Identification of Rhizopus stolonifer as a Pre-emergence Seedling Disease Pathogen of Beta vulgaris
USDA-ARS?s Scientific Manuscript database
Rhizopus stolonifer, a common soil borne fungus in Michigan, is a known root rot pathogen on mature sugar beet. In 2008, Rs was isolated from a sugar beet seed lot showing consistently low germination rates in both the field and lab, and Rs was morphologically identified on malt extract agar. Much o...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Banu, Afreen; Rathod, Vandana, E-mail: drvandanarathod@rediffmail.com; Ranganath, E.
Highlights: {yields} Silver nanoparticle production by using Rhizopus stolonifer. {yields} Antibacterial activity of silver nanoparticles against extended spectrum {beta}-lactamase producing (ESBL) strains of Enterobacteriaceae. {yields} Synergistic effect of antibiotics with silver nanoparticles towards ESBL-strains. {yields} Characterization of silver nanoparticles made by UV-vis spectra, scanning electron microscopy (SEM), transmission electron microscopy (TEM), Fourier transformed infrared (FTIR) spectroscopy, atomic force microscopy (AFM). -- Abstract: This report focuses on the synthesis of silver nanoparticles using the fungus, Rhizopus stolonifer and its antimicrobial activity. Research in nanotechnology highlights the possibility of green chemistry pathways to produce technologically important nanomaterials. Characterization of newly synthesized silvermore » nanoparticles was made by UV-visible absorption spectroscopy, scanning electron microscope (SEM), transmission electron microscope (TEM), Fourier transform infrared (FTIR) spectroscopy and atomic force microscope (AFM). TEM micrograph revealed the formation of spherical nanoparticles with size ranging between 3 and 20 nm. The biosynthesized silver nanoparticles (AgNPs) showed excellent antibacterial activity against ESBL-strains which includes E. coli, Proteus. sp. and Klebsiella sp.« less
2015-01-01
Furanoterpenoid accumulation in response to microbial attack in rotting sweetpotatoes has long been linked to deaths and lung edema of cattle in the world. However, it is not known whether furanoterpenoid ipomeamarone accumulates in the healthy-looking parts of infected sweetpotato storage roots. This is critical for effective utilization as animal feed and assessment of the potential negative impact on human health. Therefore, we first identified the fungus from infected sweetpotatoes as a Rhizopus stolonifer strain and then used it to infect healthy sweetpotato storage roots for characterization of furanoterpenoid content. Ipomeamarone and its precursor, dehydroipomeamarone, were identified through spectroscopic analyses, and detected in all samples and controls at varying concentrations. Ipomeamarone concentration was at toxic levels in healthy-looking parts of some samples. Our study provides fundamental information on furanoterpenoids in relation to high levels reported that could subsequently affect cattle on consumption and high ipomeamarone levels in healthy-looking parts. PMID:25418792
Rhizopus stolonifer mediated biosynthesis of biocompatible cadmium chalcogenide quantum dots.
Mareeswari, P; Brijitta, J; Harikrishna Etti, S; Meganathan, C; Kaliaraj, Gobi Saravanan
2016-12-01
We report an efficient method to biosynthesize biocompatible cadmium telluride and cadmium sulphide quantum dots from the fungus Rhizopus stolonifer. The suspension of the quantum dots exhibited purple and greenish-blue luminescence respectively upon UV light illumination. Photoluminescence spectroscopy, X-ray diffraction, and transmission electron microscopy confirms the formation of the quantum dots. From the photoluminescence spectrum the emission maxima is found to be 424 and 476nm respectively. The X-ray diffraction of the quantum dots matches with results reported in literature. The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay for cell viability evaluation carried out on 3-days transfer, inoculum 3×10 5 cells, embryonic fibroblast cells lines shows that more than 80% of the cells are viable even after 48h, indicating the biocompatible nature of the quantum dots. A good contrast in imaging has been obtained upon incorporating the quantum dots in human breast adenocarcinoma Michigan Cancer Foundation-7 cell lines. Copyright © 2016 Elsevier Inc. All rights reserved.
Characteristics of Deoxyribonucleic Acid Polymerase Isolated from Spores of Rhizopus stolonifer1
Gong, Cheng-Shung; Dunkle, Larry D.; Van Etten, James L.
1973-01-01
Deoxyribonucleic acid (DNA)-dependent DNA polymerase was purified several hundredfold from germinated and ungerminated spores of the fungus Rhizopus stolonifer. The partially purified enzymes from both spore stages exhibited identical characteristics; incorporation of [3H]deoxythymidine monophosphate into DNA required Mg2+, DNA, a reducing agent, and the simultaneous presence of deoxyguanosine triphosphate, deoxycytidine triphosphate, and deoxyadenosine triphosphate. Heat-denatured and activated DNAs were better templates than were native DNAs. The buoyant density of the radioactive product of the reaction was similar to that of the template DNA. The enzyme is probably composed of a single polypeptide chain with an S value of 5.12 and an estimated molecular weight of 70,000 to 75,000. During the early stages of purification, the enzyme fraction from ungerminated spores required exogenous DNA for maximum activity, whereas the corresponding enzyme fraction from germinated spores did not require added DNA. Apparently DNA polymerase from germinated spores was more tightly bound to endogenous DNA than was the enzyme from ungerminated spores. PMID:4728271
Fungal Competitors Affect Production of Antimicrobial Lipopeptides in Bacillus subtilis Strain B9-5.
DeFilippi, Stefanie; Groulx, Emma; Megalla, Merna; Mohamed, Rowida; Avis, Tyler J
2018-04-01
Bacillus subtilis has shown success in antagonizing plant pathogens where strains of the bacterium produce antimicrobial cyclic lipopeptides (CLPs) in response to microbial competitors in their ecological niche. To gain insight into the inhibitory role of these CLPs, B. subtilis strain B9-5 was co-cultured with three pathogenic fungi. Inhibition of mycelial growth and spore germination was assessed and CLPs produced by B. subtilis B9-5 were quantified over the entire period of microbial interaction. B. subtilis B9-5 significantly inhibited mycelial growth and spore germination of Fusarium sambucinum and Verticillium dahliae, but not Rhizopus stolonifer. LC-MS analysis revealed that B. subtilis differentially produced fengycin and surfactin homologs depending on the competitor. CLP quantification suggested that the presence of Verticillium dahliae, a fungus highly sensitive to the compounds, caused an increase followed by a decrease in CLP production by the bacterium. In co-cultures with Fusarium sambucinum, a moderately sensitive fungus, CLP production increased more gradually, possibly because of its slower rate of spore germination. With co-cultures of the tolerant fungus Rhizopus stolonifer, B. subtilis produced high amounts of CLPs (per bacterial cell) for the duration of the interaction. Variations in CLP production could be explained, in part, by the pathogens' overall sensitivities to the bacterial lipopeptides and/or the relative growth rates between the plant pathogen and B. subtilis. CLP production varied substantially temporally depending on the targeted fungus, which provides valuable insight concerning the effectiveness of B. subtilis B9-5 protecting its ecological niche against the ingress of these pathogens.
Pre-emergence Damping Off of Beta vulgaris by Rhizopus stolonifer
USDA-ARS?s Scientific Manuscript database
Rhizopus stolonifer (Rs), a cool temperature zygomycete that can cause a post-harvest rot on sugarbeet (Beta vulgaris), also causes pre-emergence damping off in other crops. We are interested in its potential pre-emergence damping off activity in sugarbeet. Sugarbeets are quite susceptible to seedli...
Antifungal activity of plant extracts against Aspergillus niger and Rhizopus stolonifer.
Surapuram, Venkatasaichaitanya; Setzer, William N; McFeeters, Robert L; McFeeters, Hana
2014-11-01
Despite recent advances in antifungal development, fungi remain a devastating threat to human health and compromise viability of the food supply. Plant based antimicrobials represent a vast untapped source with tremendous potential. Herein we present the antifungal properties of more than 50 plant extracts against two important human and agricultural pathogens, Aspergillus niger and Rhizopus stolonifer. Multiple extracts exhibit promising MIC values of less than 100 μg/mL and are reported for both fungal species.
Maswada, Hanafey F; Abdallah, Sabry A
2013-12-01
Plant extracts appear to be one of the most effective alternative methods of plant diseases control which are less harmful to human beings and environment. In vitro antifungal activity of methanolic extracts of three promising wild geophytic plants against three post-harvest pathogenic fungi using radial growth technique was conducted. These extracts included the shoot system (S) and underground parts (R) of Asparagus stipularis, Cyperus capitatus and Stipagrostis lanata. The tested fungi were Alternaria solani, Aspergillus niger and Rhizopus stolonifer. The results exhibited that, all plant extracts had antifungal activity against the tested fungi. The antifungal activity greatly varied depending on plant parts and/or plant species. R. stolonifer was the most susceptible fungus to the tested plant extracts followed by A. niger and then A. solani. On the other hand, the most effective plant extracts against tested fungi were S. lanata (S) and A. stipularis (R). The most effective plant extracts against R. stolonifer were S. lanata (R) and C. capitatus (S). While, the extracts of A. stipularis (R) and S. lanata (S) were the most effective against A. niger. The extracts of C. capitatus (S) and S. lanata (S) exhibited the highest antifungal activity against A. solani. The results demonstrated that, the methanolic extracts of A. stipularis, C. capitatus and S. lanata had potential antifungal activity against A. solani, A. niger and R. stolonifer.
Song, Jung-Hwa; Kim, Jae-Ho; Ahn, Byung-Hak
2010-01-01
Different strains of mold were screened for the production of high quality Korean traditional rice wine with anti-hypertension and good acceptability. We isolated 867 nuruk mold strains and selected 24 for further study based on measurement of amylase activity. Among them, mold No. 17 showed high ethanol production upon fermentation with Saccharomyces cerevisiae as well as anti-hypertensive properties. The No. 17 strain was therefore selected as the functional mold and later identified as Rhizopus stolonifer based on molecular biological characteristics. Optimal fermentation conditions for the brewing of anti-hypertensive traditional rice wine comprised the addition of R. stolonifer No. 17 koji at a concentration of 35 sp/g and a fermentation period of 10 days at 25℃ using S. cerevisiae. PMID:23956639
Song, Jung-Hwa; Kim, Jae-Ho; Ahn, Byung-Hak; Lee, Jong-Soo
2010-06-01
Different strains of mold were screened for the production of high quality Korean traditional rice wine with anti-hypertension and good acceptability. We isolated 867 nuruk mold strains and selected 24 for further study based on measurement of amylase activity. Among them, mold No. 17 showed high ethanol production upon fermentation with Saccharomyces cerevisiae as well as anti-hypertensive properties. The No. 17 strain was therefore selected as the functional mold and later identified as Rhizopus stolonifer based on molecular biological characteristics. Optimal fermentation conditions for the brewing of anti-hypertensive traditional rice wine comprised the addition of R. stolonifer No. 17 koji at a concentration of 35 sp/g and a fermentation period of 10 days at 25℃ using S. cerevisiae.
NASA Astrophysics Data System (ADS)
Chuku, E. C.; Ogbonna, D. N.; Onuegbu, B. A.; Adeleke, M. T. V.
Comparative studies on the fungi and biochemical characteristics of Tomatoes (Lycopersicon esculentus Mill) and the Snake gourd (Trichosanthes curcumerina Linn) products were investigated in Rivers State using various analytical procedures. Results of the proximate analysis of fresh snake gourd and tomatoes show that the essential minerals such as protein, ash, fibre, lipid, phosphorus and niacin contents were higher in snake gourd but low in carbohydrate, calcium, iron, vitamins A and C when compared to the mineral fractions of tomatoes which has high values of calcium, iron, vitamins A and C. The mycoflora predominantly associated with the fruit rot of tomato were Fusarium oxysporium, Fusarium moniliforme, Rhizopus stolonifer and Aspergillus niger, while other fungi isolates from Snake gourd include Rhizopus stolonifer, Aspergillus niger, Aspergillus tamari, Penicillium ita/icum and Neurospora crassa. Rhizopus stolonifer and Aspergillus niger were common spoilage fungi to both the Tomato and Snake gourd. All the fungal isolates were found to be pathogenic. The duration for storage of the fruits at room temperature (28±1°C) showed that Tomato could store for 5 days while Snake gourd stored for as much as 7 days. Sensory evaluation shows that Snake gourd is preferred to Tomatoes because of its culinary and medicinal importance.
Zhou, D; Wang, Z; Li, M; Xing, M; Xian, T; Tu, K
2018-01-01
This study aimed to investigate the antifungal mechanism of carvacrol and eugenol to inhibit Rhizopus stolonifer and the control of postharvest soft rot decay in peaches. To investigate the antifungal mechanism, the effects of carvacrol and eugenol on the mycelium growth, leakages of cytoplasmic contents, mycelium morphology, cell membrane and membrane composition of R. stolonifer were studied. Carvacrol and eugenol both exhibited dose-dependent antifungal activity against R. stolonifer, carvacrol at a concentration of 2 μl per plant and eugenol at a concentration of 4 μl per plant inhibited fungal growth completely. The two essential oils (EOs) increased cell membrane penetrability and caused the leakage of cytoplasm, nucleic acid and protein content. The observation using scanning electron microscopy and fluorescent microscopy showed modification of the hyphal morphology and breakage of the cell plasma membrane. Decreased ergosterol contents confirmed that the two EOs could destroy the membrane of R. stolonifer. For the in vivo test, the inhibition of soft rot disease and the induction of defence-related enzymes were investigated. Carvacrol and eugenol significantly reduced the incidence and severity of soft rot decay in inoculated peaches. The best treatments for controlling soft rot decay were obtained at 0·5 μl l -1 for carvacrol and 1 μl l -1 for eugenol. The activities of defence-related enzymes in peaches were also enhanced by fumigation with two EOs. This study showed that carvacrol and eugenol could effectively inhibit the growth of R. stolonifer in vitro and successfully control the incidence of soft rot decay in honey peaches. The above findings may be the main antifungal mechanism of carvacrol and eugenol on R. stolonifer. Furthermore, carvacrol and eugenol are helpful for their commercial application on the preservation of fresh fruit. © 2017 The Society for Applied Microbiology.
Raw Starch Degrading Amylase Production by Various Fungal Cultures Grown on Cassava Waste
Balaji, P.; Eyini, M.
2006-01-01
The solid waste of sago industry using cassava was fermented by Aspergillus niger, Aspergillus terreus and Rhizopus stolonifer in solid state fermentation. Cassava waste contained 52 per cent starch and 2.9 per cent protein by dry weight. The amylase activity was maintained at a high level and the highest amylase activity was observed on the 8th day in R. stolonifer mediated fermentation. R. stolonifer was more efficient than Aspergillus niger and Aspergillus terreus in bioconverting cassava waste into fungal protein (90.24 mg/g) by saccharifying 70% starch and releasing 44.5% reducing sugars in eight days of solid state fermentation. PMID:24039485
Gu, Xinzhe; Wang, Zhenjie; Huang, Yangmin; Wei, Yingying; Zhang, Miaomiao; Tu, Kang
2015-01-01
This research aimed to develop a rapid and nondestructive method to model the growth and discrimination of spoilage fungi, like Botrytis cinerea, Rhizopus stolonifer and Colletotrichum acutatum, based on hyperspectral imaging system (HIS). A hyperspectral imaging system was used to measure the spectral response of fungi inoculated on potato dextrose agar plates and stored at 28°C and 85% RH. The fungi were analyzed every 12 h over two days during growth, and optimal simulation models were built based on HIS parameters. The results showed that the coefficients of determination (R2) of simulation models for testing datasets were 0.7223 to 0.9914, and the sum square error (SSE) and root mean square error (RMSE) were in a range of 2.03–53.40×10−4 and 0.011–0.756, respectively. The correlation coefficients between the HIS parameters and colony forming units of fungi were high from 0.887 to 0.957. In addition, fungi species was discriminated by partial least squares discrimination analysis (PLSDA), with the classification accuracy of 97.5% for the test dataset at 36 h. The application of this method in real food has been addressed through the analysis of Botrytis cinerea, Rhizopus stolonifer and Colletotrichum acutatum inoculated in peaches, demonstrating that the HIS technique was effective for simulation of fungal infection in real food. This paper supplied a new technique and useful information for further study into modeling the growth of fungi and detecting fruit spoilage caused by fungi based on HIS. PMID:26642054
Navya, P N; Pushpa, S Murthy
2013-08-01
Coffee cherry husk (CH) is one of the major by-products obtained from coffee processing industry and accounts to 43 ± 5.9% of cellulose. Screening of fungal organism for cellulase production was carried out and the potential organism was identified as Rhizopus stolonifer by internal transcribed spacer's (ITS)-5.8S rDNA analysis. A systematic study with response surface methodology (RSM) based on CCRD was used to study the interactions among the variables such as pH (3-7), moisture (40-80%) and progression duration (72-168 h) of the fermentation process to maximize the enzyme production. Under the optimized cultivation condition, R. stolonifer synthesized 22,109 U/gds. Model validations at optimum operating conditions showed excellent agreement between the experimental results and the predicted responses with a confidence level of 95%. Endoglucanase thus produced was utilized for ethanol production by simultaneous saccharification and fermentation and maximum of 65.5 g/L of ethanol was obtained. This fungal cellulase has also reported to be efficient detergent additives and promising for commercial use. The present study demonstrates coffee husk as a significant bioprocess substrate. Statistical optimization with major parameters for cellulase production can be highly applicable for industrial scale. Furthermore, value addition to coffee husk with sustainable waste management leading to environment conservation can be achieved.
Martins, M Rosário; Pereira, Pablo; Lima, Nelson; Cruz-Morais, Júlio
2013-07-01
Degradation of xenobiotics by microbial populations is a potential method to enhance the effectiveness of ex situ or in situ bioremediation. The purpose of this study was to evaluate the impact of repeated metalaxyl and folpet treatments on soil microbial communities and to select soil fungal strains able to degrade these fungicides. Results showed enhanced degradation of metalaxyl and folpet in vineyards soils submitted to repeated treatments with these fungicides. Indeed, the greatest degradation ability was observed in vineyard soil samples submitted to greater numbers of treatments. Respiration activities, as determined in the presence of selective antibiotics in soil suspensions amended with metalaxyl and folpet, showed that the fungal population was the microbiota community most active in the degradation process. Batch cultures performed with a progressive increase of fungicide concentrations allowed the selection of five tolerant fungal strains: Penicillium sp. 1 and Penicillium sp. 2, mycelia sterila 1 and 3, and Rhizopus stolonifer. Among these strains, mycelium sterila 3 and R. stolonifer presented only in vineyard soils treated with repeated application of these fungicides and showed tolerance >1,000 mg l(-1) against commercial formulations of metalaxyl (10 %) plus folpet (40 %). Using specific methods for inducing sporulation, mycelium sterila 3 was identified as Gongronella sp. Because this fungus is rare, it was compared using csM13-polymerase chain reaction (PCR) with the two known species, Gongronella butleri and G. lacrispora. The high tolerance to metalaxyl and folpet shown by Gongronella sp. and R. stolonifer might be correlated with their degradation ability. Our results point out that selected strains have potential for the bioremediation of metalaxyl and folpet in polluted soil sites.
Lee, Sung-Chul; West, Charles A.
1981-01-01
Apparently homogeneous polygalacturonase-elicitor purified from the filtrates of Rhizopus stolonifer cultures stimulates germinating castor bean seedlings to produce greatly increased levels of casbene synthetase activity. The purification procedure involved gel-filtration chromatography on Sephadex G-25 and G-75 columns followed by cation-exchange chromatography on a Sephadex CM C-50 column. Homogeneity of the purified preparation was indicated by the results of cationic polyacrylamide disc gel electrophoresis and isoelectric focusing (pI = 8.0). The identity of the casbene elicitor activity and polygalacturonase were indicated by the coincidence of the two activities at all stages of purification, the coincidence of both activities with the single protein-staining band detected on a cationic polyacrylamide disc gel and an isoelectric focusing gel, and the identical behavior of both activities on an agarose gel affinity column. The purified polygalacturonase-elicitor is a glycoprotein with approximately 20% carbohydrate content and an estimated molecular weight of 32,000 by polyacrylamide disc gel electrophoresis. PMID:16661728
A method is described to discriminate between live and dead cells of the infectious fungi Aspergillus fumigatus, A. flavus, A. terreus, Mucor racemosus, Rhizopus stolonifer and Paecilomyces variotii. To test the method, conidial suspensions were heat inactivated at 85oC or held ...
Essers, A J; Jurgens, C M; Nout, M J
1995-07-01
The effect of six individual strains of the dominant microflora in solid substrate fermenting cassava on cyanogen levels was examined. Six out of eight batches of disinfected cassava root pieces were incubated for 72 h after inoculation with either of the fungi Geotrichum candidum, Mucor racemosus, Neurospora sitophila, Rhizopus oryzae and Rhizopus stolonifer, or a Bacillus sp., isolated from on-farm fermented cassava flours from Uganda. One non-inoculated batch was incubated as a reference. Levels of initial and final moisture and cyanogens were assayed. The experiment was done in quadruplicate. Incubation of disinfected root pieces reduced cyanogenic glucoside levels significantly to 62.7% (SD 2.8) of the initial value. Microbial growth resulted in significant additional reduction of the cyanogenic glucoside levels to 29.8% (SD 18.9) of the levels which were obtained after non-inoculated incubation. Among the tested strains, N. sitophila reduced cyanogenic glucoside levels most effectively, followed by R. stolonifer and R. oryzae. Of all fermented samples, both Rhizopus spp. showed highest proportion of residual cyanogens in the cyanohydrin form. Flours showed similar patterns of cyanogens as the batches they were prepared from. Cyanogenic glucoside level reduction was significantly correlated (r = 0.86) with the extent of root softening. It is concluded that both incubation and microbial activity are instrumental in reducing the potential toxicity of cassava during the solid substrate fermentation and that effectiveness varies considerably between the species of microorganisms applied.
Fungal lectins: a growing family.
Kobayashi, Yuka; Kawagishi, Hirokazu
2014-01-01
Fungi are members of a large group of eukaryotic organisms that include yeasts and molds, as well as the most familiar member, mushrooms. Fungal lectins with unique specificity and structures have been discovered. In general, fungal lectins are classified into specific families based on their amino acid sequences and three-dimensional structures. In this chapter, we provide an overview of the approximately 80 types of mushroom and fungal lectins that have been isolated and studied to date. In particular, we have focused on ten fungal lectins (Agaricus bisporus, Agrocybe cylindracea, Aleuria aurantia, Aspergillus oryzae, Clitocybe nebularis, Marasmius oreades, Psathyrella velutina, Rhizopus stolonifer, Pholiota squarrosa, Polyporus squamosus), many of which are commercially available and their properties, sugar-binding specificities, structural grouping into families, and applications for biological research being described. The sialic acid-specific lectins (Agrocybe cylindracea and Polyporus squamosus) and fucose-specific lectins (Aleuria aurantia, Aspergillus oryzae, Rhizopus stolonifer, and Pholiota squarrosa) each showed potential for use in identifying sialic acid glycoconjugates and fucose glycoconjugates. Although not much is currently known about fungal lectins compared to animal and plant lectins, the knowledge accumulated thus far shows great promise for several applications in the fields of taxonomy, biomedicine, and molecular and cellular biology.
NASA Astrophysics Data System (ADS)
Rahmawati, Della; Chandra, Mega; Santoso, Stefanus; Puteri, Maria Gunawan
2017-01-01
The essential oil of sweet orange, lemon, and key lime peel were analyzed for their antimicrobial activity. The antimicrobial activity of each citrus essential oil with different concentration was assessed using broth macro-dilution against Bacillus sp, Eschericia coli, Rhizopus stolonifer, and Botrytis sp which represented specific spoilage microorganism in tofu and fresh strawberry. Among all the citrus peel essential oils tested, lemon peel essential oil with 0.6% concentration showed significant activity as an antimicrobial agent against Escherichia coli and Bacillus sp. In other hand 1% of lemon peel essential oil is also considered to be the best concentration of inhibiting the Rhizopus Stolonifer and Botrytis sp. Lemon peel essential oil which has the highest antimicrobial activity was combined with two different kind of edible coating agents (cassava starch and sodium alginate) and was applied in both tofu and strawberry to observe whether it had possibility to decrease the degradation rate of tofu and strawberry. The addition of 0.6% and 1% lemon peel essential oil with each of edible coating agents was significantly able to reduce the degradation of tofu and fresh strawberry.
Report membrane transport of lactic acid in the filamentous fungus Rhizopus
USDA-ARS?s Scientific Manuscript database
The fungus Rhizopus is frequently used for fermentative production of lactic acid, but little is known about the mechanisms or proteins for transporting this carboxylic acid. Since transport of the lactate anion across the plasma membrane is critical to prevent acidification of the cytoplasm, we ev...
Analysis of a Functional Lactate Permease in the Fungus Rhizopus
USDA-ARS?s Scientific Manuscript database
The fungus Rhizopus is frequently used for fermentative production of lactic acid, but little is known about the mechanisms or proteins for transporting this carboxylic acid. Since transport of the lactate anion across the plasma membrane is critical to prevent acidification of the cytoplasm, we ev...
NASA Astrophysics Data System (ADS)
Kim, Kyoung-Hee; Kim, Mi-Seon; Kim, Hong-Gi; Yook, Hong-Sun
2010-04-01
The effect of gamma irradiation (0.5-2 kGy) on the physicochemical properties of peaches was investigated during a 6-day storage at 20±3 °C. Gamma irradiation is able to inactivate the four pathogens, namely Botrytis cinerea, Penicillium expansum, Rhizopus stolonifer var. stolonifer and Monilinia fructicola in peaches. Hardness significantly decreased with the increment of irradiation dose level whereas soluble solid and total polyphenol contents increased with increment of irradiation dose level. 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical-scavenging activity of the irradiated peach was higher than that of control, and its activity increased with increment of irradiation dose level. These results suggest that gamma irradiation of peaches improved antioxidant activity, but dramatically affects the hardness throughout the entire storage time.
In vitro antimalarial studies of novel artemisinin biotransformed products and its derivatives.
Gaur, Rashmi; Darokar, Mahendra P; Ajayakumar, P V; Shukla, Ram Sajiwan; Bhakuni, Rajendra Singh
2014-11-01
Biotransformation of antimalarial drug artemisinin by fungi Rhizopus stolonifer afforded three sesquiterpenoid derivatives. The transformed products were 1α-hydroxyartemisinin (3), 3.0%, a new compound, 10β-hydroxyartemisinin, 54.5% (4) and deoxyartemisinin (2) in 9% yield. The fungus expressed high-metabolism activity (66.5%). The chemical structures of the compounds were elucidated by 1D, 2D NMR spectrometry and mass spectral data. The major compound 10β-hydroxyartemisinin (4) was chemically converted to five new derivatives 5-9. All the compounds 3-9 were subjected for in vitro anti-malarial activity. 10β-Hydroxy-12β-arteether (8), IC50 at 18.29nM was found to be 10 times better active than its precursor 4 (184.56nM) and equipotent antimalarial with natural drug artemisinin whereas the α-derivative 9 is 3 times better than 4 under in vitro conditions. Therefore, the major biotransformation product 4 can be exploited for further modification into new clinically potent molecules. The results show the versatility of microbial-catalyzed biotransformations leading to the introduction of a hydroxyl group at tertiary position in artemisinin in derivative (3). Copyright © 2014 Elsevier Ltd. All rights reserved.
Biosorption of simulated dyed effluents by inactivated fungal biomasses.
Prigione, Valeria; Varese, Giovanna Cristina; Casieri, Leonardo; Marchisio, Valeria Filipello
2008-06-01
Treatment of dyed effluents presents several problems mainly due to the toxicity and recalcitrance of dyestuffs. Innovative technologies, such as biosorption, are needed as alternatives to conventional methods to find inexpensive ways of removing dyes from large volumes of effluents. Inactivated biomasses do not require a continuous supply of nutrients and are not sensitive to the toxicity of dyes or toxic wastes. They can also be regenerated and reused in many cycles and are both safe and environment-friendly. The sorption capacities (SC) of autoclaved biomasses of three Mucorales fungi (Cunninghamella elegans, Rhizomucor pusillus and Rhizopus stolonifer), cultured on two different media, were evaluated against simulated effluents containing concentrations of 1000 and 5000 ppm of a single dye and a mix of 10 industrial textile dyes in batch experiments. SC values of up to 532.8 mg of dye g(-1) dry weight of biomass were coupled with high effluent decolourisation percentages (up to 100%). These biomasses may thus prove to be extremely powerful candidates for dye biosorption from industrial wastewaters. Even better results were obtained when a column system with the immobilised and inactivated biomass of one fungus was employed.
2011-01-01
Background Rhizopus oryzae is a zygomycete filamentous fungus, well-known as a saprobe ubiquitous in soil and as a pathogenic/spoilage fungus, causing Rhizopus rot and mucomycoses. Results Carbohydrate Active enzyme (CAZy) annotation of the R. oryzae identified, in contrast to other filamentous fungi, a low number of glycoside hydrolases (GHs) and a high number of glycosyl transferases (GTs) and carbohydrate esterases (CEs). A detailed analysis of CAZy families, supported by growth data, demonstrates highly specialized plant and fungal cell wall degrading abilities distinct from ascomycetes and basidiomycetes. The specific genomic and growth features for degradation of easily digestible plant cell wall mono- and polysaccharides (starch, galactomannan, unbranched pectin, hexose sugars), chitin, chitosan, β-1,3-glucan and fungal cell wall fractions suggest specific adaptations of R. oryzae to its environment. Conclusions CAZy analyses of the genome of the zygomycete fungus R. oryzae and comparison to ascomycetes and basidiomycete species revealed how evolution has shaped its genetic content with respect to carbohydrate degradation, after divergence from the Ascomycota and Basidiomycota. PMID:21241472
NASA Astrophysics Data System (ADS)
Zeinab, E. M. EL-Bazza; Hala, A. Farrag; Mohie, E. D. Z. EL-Fouly; Seham, Y. M. EL-Tablawy
2001-02-01
Twenty samples of Nigella sativa seeds (Black cumin) were purchased from different localities in Egypt. The mold viable count ranged from 1.7×10 1 to 9.8×10 3 c.f.u. Sixty six molds were isolated belonging to six genera Aspergillus, Penicillium, Rhizopus, Mucor, Alternaria and Fusarium. Exposure of seeds samples to different radiation doses showed that a dose level of 6.0 kGy could be considered as a sufficient dose for decontamination of the tested samples. Seven radioresistant isolates were identified as Rhizopus oryzae, Rhizopus stolonifer, Penicillium chrysogenum and Penicillium corylophillum. All the herb samples were found to be free from aflatoxins B 1, B 2, G 1, G 2 and ochratoxin A. One mold isolate was identified as Aspergillus flavus could produce aflatoxin B 1 and G 1. None of the isolated radioresistant strains could produce mycotoxins. The water activities of seeds were slightly decreased by the storage time and the seeds needed to be stored at relative humidity not more than 85%. The addition of extract volatile and fixed oil from tested seeds to the medium stimulated the growth of isolated Aspergillus sp.
Novel Lactate Transporters from Carboxylic Acid-Producing Rhizopus
USDA-ARS?s Scientific Manuscript database
The fungus Rhizopus is frequently used for fermentative production of lactic acid, but little is known about the mechanisms or proteins for transporting this carboxylic acid. Since transport of the lactate anion across the plasma membrane is critical to prevent acidification of the cytoplasm, we ev...
Genomic Analysis of the Basal Lineage Fungus Rhizopus oryzae Reveals a Whote-Genome Duplication
USDA-ARS?s Scientific Manuscript database
Rhizopus oryzae is the primary etiologic agent of mucormycosis, an emerging lifethreatening infection. The rapid growth and angioinvasive nature of mucormycotic infections in humans result in an overall mortality rate that exceeds 50%, even with combined surgical and antifungal therapies. As part ...
USDA-ARS?s Scientific Manuscript database
Future fuel and specialty chemical production will benefit from the use of agricultural biomass. Efficient and effective use of agricultural biomass requires conversion to simple sugars by chemical pre-treatments and enzymes into simple sugars. Rhizopus oryzae, a filamentous fungus, makes enzymes ca...
USDA-ARS?s Scientific Manuscript database
The thin stillage leftover from ethanol production contains biodegradable organic compounds and sufficient micronutrients that are ideal for fungal cultivation of Rhizopus oligosporus (RO). This fungus removes about 60% of the organic material, including the suspended solids and even more of some sp...
Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR
2002-10-15
The present invention provides the promoter clone discovery of phosphoglycerate kinase gene 1 of a lactic acid-producing filamentous fungal strain, Rhizopus oryzae. The isolated promoter can constitutively regulate gene expression under various carbohydrate conditions. In addition, the present invention also provides a design of an integration vector for the transformation of a foreign gene in Rhizopus oryzae.
Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR
2003-03-04
The present invention provides the promoter clone discovery of phosphoglycerate kinase gene 2 of a lactic acid-producing filamentous fungal strain, Rhizopus oryzae. The isolated promoter can constitutively regulate gene expression under various carbohydrate conditions. In addition, the present invention also provides a design of an integration vector for the transformation of a foreign gene in Rhizopus oryzae.
rFTR1 is Required for Pathogenesis, and appears to be an Essential Gene, of Rhizopus oryzae
USDA-ARS?s Scientific Manuscript database
BACKGROUND: Rhizopus oryzae is a multinucleated fungus responsible for the majority of cases of mucormycosis. The high affinity iron permease gene (rFTR1) is required for R. oryzae iron transport in iron-limited environments. We sought to disrupt the gene to define its role in virulence. METHODS: ...
In Vitro Control of Post-Harvest Fruit Rot Fungi by Some Plant Essential Oil Components
Camele, Ippolito; Altieri, Luciana; De Martino, Laura; De Feo, Vincenzo; Mancini, Emilia; Rana, Gian Luigi
2012-01-01
Eight substances that are main components of the essential oils from three Mediterranean aromatic plants (Verbena officinalis, Thymus vulgaris and Origanum vulgare), previously found active against some phytopathogenic Fungi and Stramenopila, have been tested in vitro against five etiological agents of post-harvest fruit decay, Botrytis cinerea, Penicillium italicum, P. expansum, Phytophthora citrophthora and Rhizopus stolonifer. The tested compounds were β-fellandrene, β-pinene, camphene, carvacrol, citral, o-cymene, γ-terpinene and thymol. Citral exhibited a fungicidal action against P. citrophthora; carvacrol and thymol showed a fungistatic activity against P. citrophthora and R. stolonifer. Citral and carvacrol at 250 ppm, and thymol at 150 and 250 ppm stopped the growth of B. cinerea. Moreover, thymol showed fungistatic and fungicidal action against P. italicum. Finally, the mycelium growth of P. expansum was inhibited in the presence of 250 ppm of thymol and carvacrol. These results represent an important step toward the goal to use some essential oils or their components as natural preservatives for fruits and foodstuffs, due to their safety for consumer healthy and positive effect on shelf life extension of agricultural fresh products. PMID:22408454
Hong, Soon Gyu; Pryor, Barry M
2004-07-01
A new semi-selective medium, acidified weak potato-dextrose agar (AWPDA) with Mertect (active ingredient: thiabendazole), was developed for the isolation and enumeration of Alternaria species from samples of soil and plant debris. The medium was selected based on growth inhibition tests against Alternaria and several other commonly encountered saprobic fungi utilizing three antifungal agents, Botran (active ingredient: dichloran), Bayleton (active ingredient: triadimefon), and Mertect, and two basal media, acidified potato-dextrose agar (APDA) and AWPDA. Botran inhibited growth of Rhizopus stolonifer moderately, but had little effect on Cladosporium cladosporoides, Fusarium oxysporum, Penicillium chrysogenum, or Trichoderma harzianum. Bayleton inhibited growth of R. stolonifer and C. cladosporoides severely, and inhibited growth of F. oxysporum, P. chrysogenum, and T. harzianum moderately. Mertect inhibited growth of C. cladosporoides, F. oxysporum, P. chrysogenum, and T. harzianum completely, but had little or moderate effect on R. stolonifer. All three antifungal agents inhibited growth of Alternaria species slightly or moderately. The combination of Bayleton and Mertect inhibited growth of all fungi severely. A comparison of recovery rates of Alternaria from soil and plant debris samples on AWPDA with Mertect and weak potato-dextrose agar (WPDA) revealed that Alternaria spp. accounted for 63.6%-81.0% of recovered fungal isolates on AWPDA with Mertect as compared to 0.6%-2.7% of recovered isolates on WPDA. The AWPDA medium with Mertect exhibited superior selective growth of Alternaria species from samples of soil and plant debris, and will be useful in studies where the recovery and enumeration of Alternaria species is necessary.
NASA Astrophysics Data System (ADS)
Asada, Yasuo; Ishimi, Katsuhiro; Nagata, Yoko; Wakayama, Tatsuki; Miyake, Jun; Kohno, Hideki
Hydrogen production with glucose by using co-immobilized cultures of a fungus, Rhizopus oryzae NBRC5384, and a photosynthetic bacterium, Rhodobacter sphaeroides RV, in agar gels was studied. The co-immobilized cultures converted glucose to hydrogen via lactate in a high molar yield of about 8moles of hydrogen per glucose at a maximum under illuminated conditions.
Soft Rot of Rhizopus oryzae as a Postharvest Pathogen of Banana Fruit in Korea
Ryu, Jae-San; Chi, Tran Thi Phuong; Shen, Shun-Shan; Choi, Okhee
2012-01-01
Soft rot on banana fruit caused by Rhizopus oryzae was identified for the first time in Korea. Colonies were white to light brown and formed numerous sporangiospores. Optimum temperature for mycelial growth was 30℃. Sporangia were globose and 30~200 µm. Sporangiophores were usually straight, 8~20 µm, and rhizoids usually in groups of 3~5. Columella were globose to sub-globose and 90~110 µm. Sporangiospores were sub-globose or oval and 4~10 µm. Based on its mycological characteristics, molecular analysis, and pathogenicity to host plants, this fungus was identified as Rhizopus oryzae Went & Prisen Geerligs. This is the first report of soft rot on banana caused by Rhizopus oryzae in Korea. PMID:23115518
Survey and significance of filamentous fungi from tap water.
Gonçalves, Ana B; Paterson, R Russell M; Lima, Nelson
2006-05-01
Fungi in drinking water are involved in the production of tastes and odours in water. Health problems are possible, originating from mycotoxins, animal pathogens and allergies. This report concerns the surveillance of mesophilic fungi in tap water and assessment of their potential for causing problems. The methods for the determination of the filamentous fungi (ff) were filtering, swabbing and baiting. Tap water, half-strength corn meal, neopeptone-glucose rose Bengal aureomycin (NGRBA) and oomycete selective agars for the enumeration of colony forming units (cfu) were used. Samples were taken consecutively over 16 months. Filtration and NGRBA gave the highest ff counts. A total of 340 taxa were isolated. There appeared to be a negative correlation between bacterial and yeast (b/y) and ff counts. Highest counts were found in winter months for ff and in the warmer months for b/y. Penicillium (40.6%) and Acremonium (38.8%) were the most frequently isolated ff. There was a difference in the pattern of isolation of the key taxa with season: penicillia predominated in early summer and Acremonium in winter. P. expansum was isolated in high numbers in May 2004. This species is associated with the production of the mycotoxin patulin and the odour secondary metabolite geosmin. P. brevicompactum was detected throughout the sampling period and is known to produce the immunosuppressive drug mycophenolic acid. Acremonium is associated with ocentol production which is responsible for bad tastes and flavours. The remaining taxa were Phialophora sp. (4.1%), Cladosporium sp. (3.5%), Rhizopus stolonifer (2.9%), Chaetomium sp. (0.6%), Alternaria sp. (0.3%), Aspergillus sp. (0.3%), mycelia sterilia (2.6%) and unidentified (6.2%). It is emphasised that few Aspergillus and no Fusarium strains were isolated. Rhizopus stolonifer was obtained. However, none of the fungi isolated at mesophilic temperature used could be described as being involved with pathogenicity per se.
Deo, Shivashni S; Virassamy, Balaji; Halliday, Catriona; Clancy, Leighton; Chen, Sharon; Meyer, Wieland; Sorrell, Tania C; Gottlieb, David J
2016-01-01
Invasive fungal diseases caused by filamentous fungi and yeasts are significant causes of morbidity and mortality in immunosuppressed hematology patients. We previously published a method to expand Aspergillus fumigatus-specific T cells for clinical cell therapy. In the present study, we investigated expansion of T cells specific for other fungal pathogens and creation of a broadly reactive panfungal T-cell product. Fungal strains selected were those frequently observed in the clinical hematology setting and included Aspergillus, Candida, Fusarium, Rhizopus and Lomentospora/Scedosporium. Four T-cell cultures specific to each fungus were established. We selected lysates of Aspergillus terreus, Candida krusei and Rhizopus oryzae to expand panfungal T cells. Allelic restriction of anti-fungal activity was determined through the use of specific major histocompatibility complex class II-blocking antibodies. Individual T-cell cultures specific to each fungus could be expanded in vitro, generating predominantly CD4(+) T cells of which 8% to 20% were fungus-specific. We successfully expanded panfungal T cells from the peripheral blood (n = 8) and granulocyte-colony-stimulating factor-primed stem cell products (n = 3) of normal donors by using a combination of lysates from Aspergillus terreus, Candida krusei and Rhizopus oryzae. Anti-fungal activity was mediated through human leukocyte antigen (HLA)-DR alleles and was maintained when antigen-presenting cells from partially HLA-DRB1-matched donors were used to stimulate T cells. We demonstrate a method to manufacture panfungal T-cell products with specificity against a range of clinical fungal pathogens by use of the blood and stem cells of healthy donors as the starting material. The safety and efficacy of these products will need to be tested clinically. Copyright © 2015 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.
Effect on tomato plant and fruit of the application of biopolymer-oregano essential oil coatings.
Perdones, Ángela; Tur, Núria; Chiralt, Amparo; Vargas, Maria
2016-10-01
Oregano essential oil (EO) was incorporated into film-forming dispersions (FFDs) based on biopolymers (chitosan and/or methylcellulose) at two different concentrations. The effect of the application of the FFDs was evaluated on tomato plants (cultivar Micro-Tom) at three different stages of development, and on pre-harvest and postharvest applications on tomato fruit. The application of the FFDs at '3 Leaves' stage caused phytotoxic problems, which were lethal when the EO was applied without biopolymers. Even though plant growth and development were delayed, the total biomass and the crop yield were not affected by biopolymer-EO treatments. When the FFDs were applied in the 'Fruit' stage the pre-harvest application of FFDs had no negative effects. All FFDs containing EO significantly reduced the respiration rate of tomato fruit and diminished weight loss during storage. Moreover, biopolymer-EO FFDs led to a decrease in the fungal decay of tomato fruit inoculated with Rhizopus stolonifer spores, as compared with non-treated tomato fruit and those coated with FFDs without EO. The application of biopolymer-oregano essential oil coatings has been proven to be an effective treatment to control R. stolonifer in tomato fruit. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.
An attempt of postharvest orange fruit rot control using essential oils from Mediterranean plants.
Camele, Ippolito; De Feo, Vincenzo; Altieri, Luciana; Mancini, Emilia; De Martino, Laura; Luigi Rana, Gian
2010-12-01
Twelve essential oils from Mediterranean aromatic plants were tested at different doses against four fungi known as causal agents of post-harvest orange fruit rot: Botrytis cinerea, Penicillium italicum, Phytophthora citrophthora, and Rhizopus stolonifer. Essential oils were obtained from Hyssopus officinalis, Lavandula angustifolia, Majorana hortensis, Melissa officinalis, Ocimum basilicum, Origanum vulgare, Salvia officinalis, and Thymus vulgaris (Family Lamiaceae), Verbena officinalis (Family Verbenaceae), and Pimpinella anisum, Foeniculum vulgare, and Carum carvi (Family Apiaceae). Because preliminary in vitro experiments showed that only the oils from V. officinalis, T. vulgaris, and O. vulgare exhibited some fungistatic activity against the above-named fungi, these three essential oils were used in successive in vivo tests carried out to protect healthy "Washington navel" orange fruits from artificial infection by the same micromycetes. The essential oil of T. vulgaris, at a 2,000 ppm dose, controlled fruit rot by B. cinerea, P. citrophthora, and R. stolonifer but was ineffective against P. italicum. Essential oils of V. officinalis and O. vulgare inhibited infection by the first two fungi and only by P. citrophthora, respectively. This finding represents an important result, with the goal of using the essential oils as natural preservatives for food products, due to their positive effect on their safety and shelf life.
Vieira, Edson Rodrigues; Xisto, Mariana Ingrid Dutra da Silva; Pele, Milagre Américo; Alviano, Daniela Sales; Alviano, Celuta Sales; Barreto-Bergter, Eliana; de Campos-Takaki, Galba Maria
2018-06-01
Monohexosylceramides (CMHs) are highly conserved fungal glycosphingolipids playing a role in several cellular processes such as growth, differentiation and morphological transition. In this study, we report the isolation, purification and chemical characterization of CMHs from Rhizopus stolonifer and R. microspores . Using positive ion mode ESI-MS, two major ion species were observed at m / z 750 and m / z 766, respectively. Both ion species consisted of a glucose/galactose residue attached to a ceramide moiety containing 9-methyl-4,8-sphingadienine with an amidic linkage to a hydroxylated C16:0 fatty acid. The antimicrobial activity of CMH was evaluated against Gram positive and Gram negative bacteria using the agar diffusion assay. CMH from both Rhizopus species inhibited the growth of Bacillus terrae , Micrococcus luteus ( M. luteus ) and Pseudomonas stutzeri ( P. stutzeri ) with a MIC 50 of 6.25, 6.25 and 3.13 mg/mL, respectively. The bactericidal effect was detected only for M. luteus and P. stutzeri , with MBC values of 25 and 6.25 mg/mL, respectively. Furthermore, the action of CMH on the biofilm produced by methicillin-resistant Staphylococcus aureus (MRSA) was analyzed using 12.5 and 25 mg/mL of CMH from R. microsporus . Total biofilm biomass, biofilm matrix and viability of the cells that form the biofilm structure were evaluated. CMH from R. microsporus was able to inhibit the MRSA biofilm formation in all parameters tested.
Schmidt, Cristiano Gautério; Furlong, Eliana Badiale
2012-11-01
The effects of rice bran particle size (0.18-0.39mm) and ammonium sulfate concentration in the nutrient solution (2-8g/L) on biomass production, protein and phenolic content generated by solid state fermentation with the fungus Rhizopus oryzae (CCT 1217) were studied. Particle size had a positive effect on biomass production and a negative effect (p⩽0.05) on protein and phenolic contents. Ammonium sulfate concentration had a positive effect (p⩽0.05) on biomass and phenolic content gain. Cultivation of fungus in rice bran with particle size of 0.18mm and in the presence of 8g/L ammonium sulfate, resulted in protein levels of 20g/100g dry wt and phenolics content of 4mg/g dry wt. These values were 53 and 65% higher than those achieved with unfermented rice bran. The results demonstrate that the fermentation process increased the value of compounds recovered for potential use in food formulations. Copyright © 2012 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Nenadić, Marija; Ljaljević-Grbić, Milica; Stupar, Miloš; Vukojević, Jelena; Ćirić, Ana; Tešević, Vele; Vujisić, Ljubodrag; Todosijević, Marina; Vesović, Nikola; Živković, Nemanja; Ćurčić, Srećko
2017-06-01
The antifungal potential of the pygidial gland secretion of the troglophilic ground beetle Laemostenus punctatus from a cave in Southeastern Serbia against cave-dwelling micromycetes, isolated from the same habitat, has been investigated. Eleven collected samples were analyzed and 32 isolates of cave-dwelling fungi were documented. A total of 14 fungal species were identified as members of the genera Aspergillus, Penicillium, Alternaria, Cladosporium, Rhizopus, Trichoderma, Arthrinium, Aureobasidium, Epicoccum, Talaromyces, and Fusarium. Five isolates were selected for testing the antifungal activity of the pygidial gland secretion: Talaromyces duclauxi, Aspergillus brunneouniseriatus, Penicillium sp., Rhizopus stolonifer, and Trichoderma viride. The microdilution method has been applied to detect minimal inhibitory concentrations (MICs) and minimal fungicidal concentrations (MFCs). The most sensitive isolate was Penicillium sp., while the other isolates demonstrated a high level of resistance to the tested agent. L. punctatus has developed a special mechanism of producing specific compounds that act synergistically within the secretion mixture, which are responsible for the antifungal action against pathogens from the cave. The results open opportunities for further research in the field of ground beetle defense against pathogens, which could have an important application in human medicine, in addition to the environmental impact, primarily.
Comparison of nickel biosorption properties of living and dead Rhizopus arrhizus biosorbent
NASA Astrophysics Data System (ADS)
Silah, Hülya; Gül, Ülküye Dudu
2017-04-01
The passive removal of commonly used heavy metal Ni(II), from aqueous solutions by inexpensive biomaterial, fungi Rhizopus arrhizus biomass, termed biosorption, was studied in this study. The effects of biomass type (living and dead) and pH (2-6) on metal removal by fungus were investigated. The dead biomass (44.2%) exhibited higher uptake ability of Ni(II) than living biomass (40.5%) at 100 mg/L heavy metal after 6 h. Optimal pH for biosorption was 6.
Schmidt, Stanislaw; Tramsen, Lars; Perkhofer, Susanne; Lass-Flörl, Cornelia; Hanisch, Mitra; Röger, Frauke; Klingebiel, Thomas; Koehl, Ulrike; Lehrnbecher, Thomas
2013-07-01
Mucormycosis has a high mortality and is increasingly diagnosed in hematopoietic stem cell transplant (HSCT) recipients. In this setting, there is a growing interest to restore host defense to combat infections by adoptively transferring donor-derived immunocompetent cells. Natural killer (NK) cells exhibit antitumor and antiinfective activity, but the interaction with Mucormycetes is unknown. Our data demonstrate that both unstimulated and IL-2 prestimulated human NK cells damage Rhizopus oryzae hyphae, but do not affect resting conidia. The damage of the fungus is mediated, at least in part, by perforin. R. oryzae hyphae decrease the secretion of immunoregulatory molecules by NK cells, such as IFN-γ and RANTES, indicating an immunosuppressive effect of the fungus. Our data indicate that NK cells exhibit activity against Mucormycetes and future research should evaluate NK cells as a potential tool for adoptive immunotherapy in HSCT. Copyright © 2012 Elsevier GmbH. All rights reserved.
Mixed cropping regimes promote the soil fungal community under zero tillage.
Silvestro, L B; Biganzoli, F; Stenglein, S A; Forjan, H; Manso, L; Moreno, M V
2018-07-01
Fungi of yield soils represent a significant portion of the microbial biomass and reflect sensitivity to changes in the ecosystem. Our hypothesis was that crops included in cropping regimes under the zero tillage system modify the structure of the soil fungi community. Conventional and molecular techniques provide complementary information for the analysis of diversity of fungal species and successful information to accept our hypothesis. The composition of the fungal community varied according to different crops included in the cropping regimes. However, we detected other factors as sources of variation among them, season and sampling depth. The mixed cropping regimes including perennial pastures and one crop per year promote fungal diversity and species with potential benefit to soil and crop. The winter season and 0-5 cm depth gave the largest evenness and fungal diversity. Trichoderma aureoviride and Rhizopus stolonifer could be used for monitoring changes in soil under zero tillage.
Toxic micromycetes in grain raw material during its processing.
Lugauskas, Albinas; Raila, Algirdas; Railiene, Marija; Raudoniene, Vita
2006-01-01
In 2003-2005 micromycetes were isolated and identified from wheat, barley, rye, buckwheat grain brought into mills or from processing enterprises. Contamination of the produced flour with micromycete propagules (cfu g(-1)), changes in micromycete diversity and abundance in the course of flour storage, preparation and baking of bread, production of groats or other food products and fodder were determined. Most attention was given to widely distributed micromycetes, known producers of toxins: Alternaria alternata, Aspergillus candidus, A. clavatus, A. flavus, A. fumigatus, A. niger, A. oryzae, A. (=Eurotium) repens, Fusarium culmorum, F. equiseti, F. graminearum, F. moniliforme, F. oxysporum, F. poae, F. sporotrichioides, Penicillium brevicompactum, P. chrysogenum, P. cyclopium, P. daleae, P. expansum, P. funiculosum, P. roqueforti, P. urticae, P. verruculosum, P. viridicatum, Phoma exiqua, Rhizomucor pusillus, Rhizopus stolonifer, Trichothecium roseum. Abilities of these micromycetes to produce secondary toxic metabolites were determined as well as possible hazard caused to people consuming the contaminated products.
Reduction of aflatoxins by Rhizopus oryzae and Trichoderma reesei.
Hackbart, H C S; Machado, A R; Christ-Ribeiro, A; Prietto, L; Badiale-Furlong, E
2014-08-01
This study evaluated the ability of the microorganisms Rhizopus oryzae (CCT7560) and Trichoderma reesei (QM9414), producers of generally recognized as safe (GRAS) enzymes, to reduce the level of aflatoxins B1, B2, G1, G2, and M1. The variables considered to the screening were the initial number of spores in the inoculum and the culture time. The culture was conducted in contaminated 4 % potato dextrose agar (PDA) medium, and the residual mycotoxins were determined every 24 h by HPLC-FL. The fungus R. oryzae has reduced aflatoxins B1, B2, and G1 in the 96 h and aflatoxins M1 and G2 in the range of 120 h of culture by approximately 100 %. The fungus T. reesei has reduced aflatoxins B1, B2, and M1 in the 96 h and aflatoxin G1 in the range of 120 h of culture by approximately 100 %. The highest reduction occurred in the middle of R. oryzae culture.
Application of atmospheric-pressure argon plasma jet for bread mold decontamination
NASA Astrophysics Data System (ADS)
Thonglor, P.; Amnuaycheewa, P.
2017-09-01
Atmospheric-pressure argon plasma (APAP) is a promising non-thermal technology for microbial control and prevention minimally affecting quality of foods. Effect of APAP jet on the growth of bread molds, including two Aspergillus sp., Rhizopus stolonifer, and Penicillium roqueforti, isolated from white bread were investigated. The molds were isolated, verified, cultured to fully grown on potato dextrose agar (PDA), and subsequently treated with APAP jet using plasma generating power at 24 W for 5, 10, and 20 min, respectively. The inhibition of mold growth was investigated by comparing fungal dry weights and the effect on fungal cell structure was observed using compound light microscope. The results indicated that the 20-min treatment time is most effective in retarding the growth of the three bread molds. However, this level of generating power did not lead to destruction of the cellular structures for all the four fungi. Plasma generating power and treatment time are significant parameters determining the success of bread mold decontamination and further investigation on real bread matrix is needed.
Mycoflora and mycotoxin-producing fungi of air-dust particles from Egypt.
Abdel-Hafez, S I; Shoreit, A A; Abdel-Hafez, A I; el Maghraby, O M
1986-01-01
Using the dilution-plate method, 27 genera and 64 species were collected from 20 air-dust samples on glucose - (24 genera and 57 species) and cellulose - (21 genera and 45 species) Czapek's agar at 28 degrees C. There are basic similarities between the mycoflora of air-dust on the two media and the most prevalent species were Aspergillus niger, A. flavus, A. ochraceus, A. terreus, A. versicolor, Penicillium chrysogenum, P. funiculosum, Alternaria alternata, Cladosporium herbarum, Fusarium oxysporum, Rhizopus stolonifer and Trichoderma viride. Chaetomium globosum, Stachybotrys chartarum, Humicola grisea and Arthrobotrys oligospora were common only on cellulose agar plates. Extracts of mycelium from 25 isolates were tested with brine schrimp (Artemia salina); of these 23 displayed varying degrees of toxicity. Thin layer chromatographic analysis of 12 isolates of Aspergillus flavus revealed that 4 strains were producing detectable aflatoxin. Zearalenone production was noted for 3 out of 5 strains of Fusarium oxysporum and 2 out of 5 strains of F. solani.
Biodegradation of thermally treated low density polyethylene by fungus Rhizopus oryzae NS 5.
Awasthi, Shraddha; Srivastava, Neha; Singh, Tripti; Tiwary, D; Mishra, Pradeep Kumar
2017-05-01
Polythene is considered as one of the important object used in daily life. Being versatile in nature and resistant to microbial attack, they effectively cause environmental pollution. In the present study, biodegradation of low-density polyethylene (LDPE) have been performed using fungal lab isolate Rhizopus oryzae NS5. Lab isolate fungal strain capable of adhering to LDPE surface was used for the biodegradation of LDPE. This strain was identified as Rhizopus oryzae NS5 (Accession No. KT160362). Fungal growth was observed on the surface of the polyethylene when cultured in potato dextrose broth at 30 °C and 120 rpm, for 1 month. LDPE film was characterized before and after incubation by Fourier transform infrared spectroscopy, scanning electron microscopy, atomic force microscopy and universal tensile machine. About 8.4 ± 3% decrease (gravimetrically) in weight and 60% reduction in tensile strength of polyethylene was observed. Scanning electron microscope analysis showed hyphal penetration and degradation on the surface of polyethylene. Atomic force microscope analysis showed increased surface roughness after treatment with fungal isolate. A thick network of fungal hyphae forming a biofilm was also observed on the surface of the polyethylene pieces. Present study shows the potential of Rhizopus oryzae NS5 in polyethylene degradation in eco friendly and sustainable manner.
Huang, Yanfei; Wang, Jinglin; Zhang, Mingxin; Zhu, Min; Wang, Mei; Sun, Yufeng; Gu, Haitong; Cao, Jingjing; Li, Xue; Zhang, Shaoya; Lu, Xinxin
2017-03-01
Filamentous fungi are among the most important pathogens, causing fungal rhinosinusitis (FRS). Current laboratory diagnosis of FRS pathogens mainly relies on phenotypic identification by culture and microscopic examination, which is time consuming and expertise dependent. Although matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) MS has been employed to identify various fungi, its efficacy in the identification of FRS fungi is less clear. A total of 153 FRS isolates obtained from patients were analysed at the Clinical Laboratory at the Beijing Tongren Hospital affiliated to the Capital Medical University, between January 2014 and December 2015. They were identified by traditional phenotypic methods and Bruker MALDI-TOF MS (Bruker, Biotyper version 3.1), respectively. Discrepancies between the two methods were further validated by sequencing. Among the 153 isolates, 151 had correct species identification using MALDI-TOF MS (Bruker, Biot 3.1, score ≥2.0 or 2.3). MALDI-TOF MS enabled identification of some very closely related species that were indistinguishable by conventional phenotypic methods, including 1/10 Aspergillus versicolor, 3/20 Aspergillus flavus, 2/30 Aspergillus fumigatus and 1/20 Aspergillus terreus, which were misidentified by conventional phenotypic methods as Aspergillus nidulans, Aspergillus oryzae, Aspergillus japonicus and Aspergillus nidulans, respectively. In addition, 2/2 Rhizopus oryzae and 1/1 Rhizopus stolonifer that were identified only to the genus level by the phenotypic method were correctly identified by MALDI-TOF MS. MALDI-TOF MS is a rapid and accurate technique, and could replace the conventional phenotypic method for routine identification of FRS fungi in clinical microbiology laboratories.
The mechanism of uranium biosorption by Rhizopus arrhizus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tsezos, M.; Volesky, B.
1982-02-01
Biosorption of elements is a little understood phenomenon exhibited by some types of even nonliving microbial biomass. A common fungus Rhizopus arrhizus has been reportd to take up uranium from adqueous solutions to the extent of 180 mg U/sup 6 +//g. The mechanism of uranium sequestering by this type of biomass was studied by using experimental techniques such as electron microscopy, x-ray energy dispersion analysis, IR spectroscopy, and supporting evidence was obtained for a biosorption mechanism consisting of at least three processes. Uranium coordination and adsorption in the cell-wall chitin structure occur simultaneously and rapidly whereas precipitation of uranylhdroxide withinmore » the chitin microcrystalline cell-wall structure takes place at a lower rate. Interference of Fe/sup 2/ and Zn/sup 2 +/ coions with uranium biosorption is indicated.« less
Peñaloza, W; Davey, C L; Hedger, J N; Kell, D B
1991-03-01
Soya beans and several other beans and cereals have been used as substrates for tempe fermentation with the fungus Rhizopus oligosporus Saito. Except for the presence of alkaloids, the chemical composition of lupins (Lupinus mutabilis Sweet) is similar to that of soya beans. Therefore the potential of lupins for tempe production in regions with a long tradition of lupin consumption is promising. The preparation of the fermentation substrate when using bitter lupins (which contain significan quantities of alkaloids) as starting material includes a debittering stage to remove the alkaloids. However, we found that the debittering process yielded lupins that did not support the mycelial growth required in the tempe fermentation. We discovered that potassium is preferentially leached out during the debittering process. The effect of potassium on fungal biomass formation was monitored using a computerized system that determines biomass accretion by measurement of the electrical capacitance at radio frequencies. The importance of potassium for the growth of R. oligosporus was confirmed in liquid cultures. A linear relationship was found between biomass yield and K(+) concentration in the range of 1 to 10 mg/l. The present report represents one of the few demonstrations of a mineral deficiency during the growth of a fungus on a natural, solid substrate.
Edris, Amr E; Farrag, Eman S
2003-04-01
The vapors of peppermint oil and two of its major constituents (menthol and menthone), and sweet basil oil and two of its major constituents (linalool and eugenol), were tested against Sclerotinia sclerotiorum (Lib.), Rhizopus stolonifer (Ehrenb. exFr.) Vuill and Mucor sp. (Fisher) in a closed system. These fungi cause deterioration and heavy decay of peach fruit during marketing, shipping and storage. The essential oils, their major individual aroma constituents and blends of the major individual constituents at different ratios inhibited the growth of the fungi in a dose-dependent manner. Menthol was found to be the individual aroma constituent responsible for the antifungal properties of peppermint essential oil, while menthone alone did not show any effect at all doses. In the case of basil oil, linalool alone showed a moderate antifungal activity while eugenol showed no activity at all. Mixing the two components in a ratio similar to their concentrations in the original oil was found to enhance the antifungal properties of basil oil indicating a synergistic effect.
Pergomet, Jorgelina L; Di Liberto, Melina G; Derita, Marcos G; Bracca, Andrea B J; Kaufman, Teodoro S
2018-03-01
The antifungal activity of pterophyllin 2, pterophyllin 4, a 5-desmethyl analog of the latter and some of their synthetic intermediates, against three postharvest phytopathogenic fungi, was evaluated. The target fungi were Rhizopus stolonifer, Botrytis cinerea and Monilinia fructicola, which affect fruits worldwide, causing important economic losses. The tests were carried out with imazalil and carbendazim as positive controls. Minimum inhibitory concentrations and minimum fungicidal concentrations were determined, and the morphology of the colonies was examined microscopically. In liquid medium, it was found that pterophyllin 4 exhibited selective fungicidal activity toward M. fructicola, whereas its congener pterophyllin 2 proved to be less potent and not selective and the 5-desmethyl analog of pterophyllin 4 displayed a different activity profile. Morphological changes were observed in the colonies exposed to pterophyllin 4. The results highlighted the importance of small structural features for the antifungal behavior and also suggested that, in Nature, the pterophyllins may act as plant defenses against pathogens. Copyright © 2018 Elsevier B.V. All rights reserved.
Hasan, H A H
2002-01-01
Rhizosphere and rhizoplane of fababean (Vicia faba), melochia (Corchorus olitorius), sesame (Sesamum indicum) and soyabean (Glycine max) plants are inhabited with fungi, mostly Aspergillus flavus, A. niger, Fusarium oxysporum, Penicillium corylophilum, P. cyclopium, P. funiculosum and Rhizopus stolonifer. All fungal species have the ability to produce gibberellin (GA) but F. oxysporum was found to produce both GA and indole-acetic acid (IAA). The optimum period for GA and IAA production by F. oxysporum was 10 days in the mycelium and 15 days in the filtrate at 28 degrees C. The contents of GA, IAA and cytochrome P-450 were increased at 0.5 and 1% NaCl after 5 days, but GA and IAA were lowered at 4% (700 mM) NaCl. Calcium decreased NaCl stress on F. oxysporum by significant elevating GA biosynthesis at 40 mM Ca2+/700 mM Na+. GA at 10 microM and Ca2+ at 10 mM enhanced the germination of seeds under 175 mM Na+.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vesper, Stephen; McKinstry, Craig A.; Hartmann, Chris
2007-11-28
A method is described to discriminate between live and dead cells of the infectious fungi Aspergillus fumigatus, Aspergillus flavus, Aspergillus terreus, Mucor racemosus, Rhizopus stolonifer and Paecilomyces variotii. To test the method, conidial suspensions were heat inactivated at 85 °C or held at 5 °C (controls) for 1 h. Polycarbonate filters (25 mm diameter, 0.8 μm pore size) were placed on "welled" slides (14 mm diameter) and the filters treated with either PBS or PMA. Propidium monoazide (PMA), which enters dead cells but not live cells, was incubated with cell suspensions, exposed to blue wavelength light-emitting diodes (LED) to inactivatemore » remaining PMA and secure intercalation of PMAwith DNA of dead cells. Treated cells were extracted and the live and dead cells evaluated with quantitative PCR (QPCR). After heat treatment and DNA modification with PMA, all fungal species tested showed an approximate 100- to 1000-fold difference in cell viability estimated by QPCR analysis which was consistent with estimates of viability based on culturing.« less
Sakthivel, A.; Rajasekaran, K.
2007-01-01
New N2O2 donor type Schiff base has been designed and synthesized by condensing acetoacetanilido-4-aminoantipyrine with 2-aminobenzoic acid in ethanol. Solid metal complexes of the Schiff base with Cu(II), Ni(II), Co(II), Mn(II), Zn(II), VO(IV), Hg(II) and Cd(II) metal ions were synthesized and characterized by elemental analyses, magnetic susceptibility, molar conduction, fast atom bombardment (FAB) mass, IR, UV-Vis, and 1H NMR spectral studies. The data show that the complexes have the composition of ML type. The UV-Vis. and magnetic susceptibility data of the complexes suggest a square-planar geometry around the central metal ion except VO(IV) complex which has square-pyramidal geometry. The in vitro antifungal activities of the compounds were tested against fungi such as Aspergillus niger, Aspergillus flavus, Rhizopus stolonifer, Candida albicans, Rhizoctonia bataicola and Trichoderma harizanum. All the metal complexes showed stronger antifungal activities than the free ligand. The minimum inhibitory concentrations (MIC) of the metal complexes were found in the range of 10~31 µg/ml. PMID:24015086
Coinfection by Aspergillus and zygomycetes species in a case of acute rhinosinusitis.
Vaidya, Dhara; Shah, Parul
2011-01-01
Invasive mycotic infections can be effectively treated if rapid identification of fungus is obtained. We reported a case of coinfection by Aspergillus and Rhizopus sp. involving nose, paranasal sinuses, orbit, and brain in a 68-year-old known hypertensive male. He was presented to ENT OPD with history of fever and intermittent headache since fifteen days along with history of right-sided nasal obstruction and proptosis since seven days. CT scan of brain and paranasal sinuses showed findings of pansinusitis with cellulitic changes in right orbit. MRI confirmed the same along with features of intracranial extension with focal meningitis in right frontotemporal region. Laboratory parameters did not conclude much except for leucocytosis and hyponatremia. Patient was taken for endoscopic debridement from nose and paranasal sinuses, and tissue was sent for microbiological and histopathological examination. Minced tissue was processed, and after 48 hrs of incubation two types of growth were identified, one was yellowish, granular, and powdery consistent with Aspergillus sp., and another was cottony and woolly consistent with Rhizopus sp. LCB mount confirmed presence of Aspergillus flavus and Rhizopus arrhizus. Patient responded to therapy with IV amphotericin B and surgical debridement. On discharge patient's condition was good.
Coinfection by Aspergillus and Zygomycetes Species in a Case of Acute Rhinosinusitis
Vaidya, Dhara; Shah, Parul
2011-01-01
Invasive mycotic infections can be effectively treated if rapid identification of fungus is obtained. We reported a case of coinfection by Aspergillus and Rhizopus sp. involving nose, paranasal sinuses, orbit, and brain in a 68-year-old known hypertensive male. He was presented to ENT OPD with history of fever and intermittent headache since fifteen days along with history of right-sided nasal obstruction and proptosis since seven days. CT scan of brain and paranasal sinuses showed findings of pansinusitis with cellulitic changes in right orbit. MRI confirmed the same along with features of intracranial extension with focal meningitis in right frontotemporal region. Laboratory parameters did not conclude much except for leucocytosis and hyponatremia. Patient was taken for endoscopic debridement from nose and paranasal sinuses, and tissue was sent for microbiological and histopathological examination. Minced tissue was processed, and after 48 hrs of incubation two types of growth were identified, one was yellowish, granular, and powdery consistent with Aspergillus sp., and another was cottony and woolly consistent with Rhizopus sp. LCB mount confirmed presence of Aspergillus flavus and Rhizopus arrhizus. Patient responded to therapy with IV amphotericin B and surgical debridement. On discharge patient's condition was good. PMID:22937365
Lastovetsky, Olga A; Gaspar, Maria L; Mondo, Stephen J; LaButti, Kurt M; Sandor, Laura; Grigoriev, Igor V; Henry, Susan A; Pawlowska, Teresa E
2016-12-27
The recent accumulation of newly discovered fungal-bacterial mutualisms challenges the paradigm that fungi and bacteria are natural antagonists. To understand the mechanisms that govern the establishment and maintenance over evolutionary time of mutualisms between fungi and bacteria, we studied a symbiosis of the fungus Rhizopus microsporus (Mucoromycotina) and its Burkholderia endobacteria. We found that nonhost R. microsporus, as well as other mucoralean fungi, interact antagonistically with endobacteria derived from the host and are not invaded by them. Comparison of gene expression profiles of host and nonhost fungi during interaction with endobacteria revealed dramatic changes in expression of lipid metabolic genes in the host. Analysis of the host lipidome confirmed that symbiosis establishment was accompanied by specific changes in the fungal lipid profile. Diacylglycerol kinase (DGK) activity was important for these lipid metabolic changes, as its inhibition altered the fungal lipid profile and caused a shift in the host-bacterial interaction into an antagonism. We conclude that adjustments in host lipid metabolism during symbiosis establishment, mediated by DGKs, are required for the mutualistic outcome of the Rhizopus-Burkholderia symbiosis. In addition, the neutral and phospholipid profiles of R. microsporus provide important insights into lipid metabolism in an understudied group of oleaginous Mucoromycotina. Lastly, our study revealed that the DGKs involved in the symbiosis form a previously uncharacterized clade of DGK domain proteins.
Fungi Associated with Materials’ Biodeterioration in the Humid Tropics
1983-01-01
Cephalosphorium sp and Rhizopus sp. The mineral salts cultures again showed the presence of Trichoderma sp and Cephalosporium sp. The fungus Fusarium sp was... Trichoderma SD #1 A/ Ce halosvorium sp a Curvlara sp Phoma SD Unkn-own #? Tropicalized Cotton Cephalosporlum sp a/ Trichoderna SD #1 a! (2 weeks...sp Cotton None Trichoderma sp #2 a usarium SD i/ Phoma SD A/ Te-iFaosorium SD Cotton Cephaloseoriun sD a/ Fusariun SD a/ (2 weeks additional Aroasidu
Currency notes and coins as a possible source of transmitting fungal pathogens of man and plants.
Wanule, Dinesh; Jalander, Vaghmare; Gachande, B D; Sirsikar, A N
2011-10-01
Currency (notes and coins) handling by people during transaction is one of the most mobile objects within the community, which has a potential of transmitting pathogens. A survey carried out recently in Nanded city (Maharashtra) revealed heavy contamination of currency notes and coins by important fungal pathogens of plants and man, i.e. Aspergillus niger (60.37%), A. flavus (3.98%), A.nidulans (0.2%), Penicillium citrinum (17.80%), Alternaria tenuis (0.20%), Curvularia pallescens (0.20%), Cladosporium cladosporioides (10.69%), Rhizopus stolonifer (1.04%), an unidentified Aspergillus species .1 (0.20%) and another unidentified Aspergillus species.2 (3.14%), Fusarium sp. (0.20%), Trichoderma viride (0.20%),white sterile mycelium (0.62%) and brown sterile mycelium (0.62%). The study highlights the importance of preventing and controlling fungal contamination of currency notes and coins in public health and plant protection. Currency notes or coins are rarely suspected as infection sources and often not quarantined at airport or seaport terminal. Possible transmission of pathogens or "alien", invasive species through currency across borders or across countries needs to be taken into consideration especially under circumstances of serious outbreak of important disease or when there is a threat of biological warfare.
El Ouadi, Y; Manssouri, M; Bouyanzer, A; Majidi, L; Bendaif, H; Elmsellem, H; Shariati, M A; Melhaoui, A; Hammouti, B
2017-06-01
To investigate biological control methods against post-harvest phytopathogenic fungi in apples, tests on the antifungal activity of essential oil of Melissa officinalis were carried out. The essential oil, obtained by hydrodistillation, was analyzed by gas chromatography coupled with mass spectrometry (GC-MS). Analysis of the essential oil was able to detect 88.7% of the components. The main components are P-mentha-1,2,3-triol (13.1%), P-menth-3-en-8-ol (8.8%), pulegone (8.8%), piperitynone oxide (8.4%) and 2-piperitone oxide (7.3%). The determination of the antifungal activity of the essential oil of M. officinalisis carried out in vitro using the technique of poison food (PF) and the volatile activity test (VA). To carry out these two tests, three phytopathogens that cause the deterioration of apples have been selected: Botrytis cinerea, Penicillium expansum and Rhizopus stolonifer. The overall results of this study suggest that M. officinalis essential oil has potential as a bio-antifungal preservative for the control of post-harvest diseases of apple. Copyright © 2017 Elsevier Ltd. All rights reserved.
Aisyah, Siti; Vincken, Jean-Paul; Andini, Silvia; Mardiah, Zahara; Gruppen, Harry
2016-02-01
The effects of germination and elicitation on (iso)flavonoid composition of extracts from three edible lupine species (Lupinus luteus, Lupinus albus, Lupinus angustifolius) were determined by RP-UHPLC-MS(n). The total (iso)flavonoid content of lupine increased over 10-fold upon germination, with the total content and composition of isoflavonoids more affected than those of flavonoids. Glycosylated isoflavones were the most predominant compounds found in lupine seedlings. Lesser amounts of isoflavone aglycones, including prenylated ones, were also accumulated. Elicitation with Rhizopus oryzae, in addition to germination, raised the content of isoflavonoids further: the total content of 2'-hydroxygenistein derivatives was increased considerably, without increasing that of genistein derivatives. Elicitation by fungus triggered prenylation of isoflavonoids, especially of the 2'-hydroxygenistein derivatives. The preferred positions of prenylation differed among the three lupine species. The change in isoflavone composition increased the agonistic activity of the extracts towards the human estrogen receptors, whereas no antagonistic activity was observed. Copyright © 2015 Elsevier Ltd. All rights reserved.
Lee, Liang Wei; Cheong, Mun Wai; Curran, Philip; Yu, Bin; Liu, Shao Quan
2016-11-15
Modulation of coffee aroma via the biotransformation/fermentation of different coffee matrices during post-harvest remains sparingly explored despite some studies showing their positive impacts on coffee aroma. Therefore, this is an unprecedented study aimed at modulating coffee aroma via the fermentation of green coffee beans with a food-grade fungus Rhizopus oligosporus. The objective of part I of this two-part study was to characterize the volatile and non-volatile profiles of green coffee beans after fermentation. Proteolysis during fermentation resulted in 1.5-fold increase in the concentrations of proline and aspartic acid which exhibited high Maillard reactivity. Extensive degradation of ferulic and caffeic acids led to 2-fold increase in the total concentrations of volatile phenolic derivatives. 36% of the total volatiles detected in fermented green coffee beans were generated during fermentation. Hence, the work presented demonstrated that R. oligosporus fermentation of green coffee beans could induce modification of the aroma precursors of green coffees. Copyright © 2016 Elsevier Ltd. All rights reserved.
Agarwal, Kshitij; Gaur, Shailendra Nath; Chowdhary, Anuradha
2015-09-01
Atopic patients with chronic obstructive pulmonary disease (COPD) demonstrate more severe symptoms than their non-atopic counterparts. Also, Aspergillus hypersensitivity is known in COPD. However, allergic sensitisation to non-Aspergillus fungi has never been studied in COPD patients. To evaluate the prevalence of fungal sensitisation and its impact on the clinical presentation and outcome of COPD patients. Sensitisation to 17 fungi was studied in 55 COPD patients through skin prick tests, fungus-specific IgE, precipitating antibodies, total IgE and eosinophil counts. The clinical symptoms of patients were monitored thorough a patient-administered questionnaire. Overall, 5.4% (n = 3) of COPD patients were fungus sensitive. The sensitisation was noted to Alternaria alternata and Schizophyllum commune in two patients each, whereas another was sensitive to A. tamarii, Rhizopus spp. and Aspergillus fumigatus. Eosinophils were higher in fungus-sensitised patients (P = 0.001 vs. 0.003). No differences were noted in the clinical presentation of patients sensitised to fungi compared to those not sensitised to fungi or non-atopic. Although low, fungal sensitisation occurs in COPD but it is not limited to Aspergilli alone. Fungus-sensitised patients exhibit greater eosinophilia, implying more severe inflammation. Thus, such patients should be followed up regularly to recognise clinical worsening or development of ABPM. © 2015 Blackwell Verlag GmbH.
2006-01-01
Soil cyanobacteria isolated from the rice paddy fields of 10 different locations across Korea were evaluated by agar plate diffusion test for antifungal activity. Aqueous, petroleum ether, and methanol extracts from one hundred and forty two cyanobacterial strains belonging to the 14 genera were examined for antifungal properties against seven phytopathogenic fungi causing diseases in hot pepper (Capsicum annuum L). Of total cyanobacteria, nine cyanobacteria (6.34%) exhibited antifungal effects. The nine cyanobacteria selected with positive antifungal activities were two species of Oscillatoria, two of Anabaena, three of Nostoc, one of Nodularia, and one of Calothrix. Alternaria alternata and Botrytis cinerea were inhibited by nine and eight species of cyanobacteria, respectively. Rhizopus stolonifer was suppressed by only methanol extract of Nostoc commune FK-103. In particular, Nostoc commune FK-103 and Oscillatoria tenuis FK-109 showed strong antifungal activities against Phytophthora capsici. Their antifungal activity at the late exponential growth phase is related to the growth temperature and not associated with the growth parameters such as cell biomass and chlorophyll-α concentration. The high inhibition levels of antibiotics were 22.5 and 31.8 mm for N. commune FK-103 and O. tenuis FK-109, respectively. The optimal temperature for antibiotic productivity was 35℃. PMID:24039487
Sesquiterpenes from the Formosan stolonifer Tubipora musica.
Duh, C Y; Chen, K J; El-Gamal, A A; Dai, C F
2001-11-01
Eight new sesquiterpenes, tubipolides A-G (1-7) and tubiporone (8) (novel carbon skeleton), and a known sesquiterpene, spirotubipolide, have been isolated from the Formosan stolonifer Tubipora musica. The structures of compounds 1-8 were determined by 1D and 2D NMR spectral analysis.
Studying Pellet Formation of a Filamentous Fungus Rhizopus oryzae to Enhance Organic Acid Production
NASA Astrophysics Data System (ADS)
Liao, Wei; Liu, Yan; Chen, Shulin
Using pelletized fungal biomass can effectively improve the fermentation performance for most of fugal strains. This article studied the effects of inoculum and medium compositions such as potato dextrose broth (PDB) as carbon source, soybean peptone, calcium carbonate, and metal ions on pellet formation of Rhizopus oryzae. It has been found that metal ions had significantly negative effects on pellet formation whereas soybean peptone had positive effects. In addition PDB and calcium carbonate were beneficial to R. oryzae for growing small smooth pellets during the culture. The study also demonstrated that an inoculum size of less than 1.5×109 spores/L had no significant influence on pellet formation. Thus, a new approach to form pellets has been developed using only PDB, soybean peptone, and calcium carbonate. Meanwhile, palletized fungal fermentation significantly enhanced organic acid production. Lactic acid concentration reached 65.0 g/L in 30 h using pelletized R. oryzae NRRL 395, and fumeric acid concentration reached 31.0 g/L in 96 h using pelletized R. oryzae ATCC 20344.
Biosorption of americium-241 by immobilized Rhizopus arrihizus.
Liao, Jiali; Yang, Yuanyou; Luo, Shunzhong; Liu, Ning; Jin, Jiannan; Zhang, Taiming; Zhao, Pengji
2004-01-01
Rhizopus arrihizus (R. arrihizus), a fungus, which in previous experiments had shown encouraging ability to remove 241Am from solutions, was immobilized by calcium alginate and other reagents. The various factors affecting 241Am biosorption by the immobilized R. arrihizus were investigated. The results showed that not only can immobilized R. arrihizus adsorb 241Am as efficiently as free R. arrihizus, but that also can be used repeatedly or continuously. The biosorption equilibrium was achieved within 2 h, and more than 94% of 241Am was removed from 241Am solutions of 1.08 MBq/l by immobilized R. arrihizu in the pH range 1-7. Temperature did not affect the adsorption on immobilized R. arrihizus in the range 15-45 degrees C. After repeated adsorption for 8 times, the immobilized R. arrihizus still adsorbed more than 97% of 241Am. At this time, the total adsorption of 241Am was more than 88.6 KBq/g, and had not yet reached saturation. Ninety-five percent of the adsorbed 241Am was desorbed by saturated EDTA solution and 98% by 2 mol/l HNO(3).
New insight into microbial diversity and functions in traditional Vietnamese alcoholic fermentation.
Thanh, Vu Nguyen; Thuy, Nguyen Thanh; Chi, Nguyen Thuy; Hien, Dinh Duc; Ha, Bui Thi Viet; Luong, Dao Thi; Ngoc, Pham Duc; Ty, Pham Van
2016-09-02
The roles of microorganisms in traditional alcoholic fermentation are often assumed based on abundance in the starter and activity in pure culture. There is a serious lack of hard evidence on the behavior and activity of individual microbial species during the actual fermentation process. In this study, microbial succession and metabolite changes during 7days of traditional Vietnamese alcoholic fermentation were monitored. Special attention was devoted to starch degradation. In total, 22 microbial species, including 6 species of filamentous fungi (Rhizopus microsporus, Rhizopus arrhizus, Mucor indicus, Mucor circinelloides, Cunninghamella elegans, Aspergillus niger), 1 yeast-like fungus (Saccharomycopsis fibuligera), 7 yeasts (Saccharomyces cerevisiae, Clavispora lusitaniae, Wickerhamomyces anomalus, Lindnera fabianii, Pichia kudriavzevii, Candida rugosa, Candida tropicalis), and 8 bacteria (Stenotrophomonas maltophilia, Lactobacillus brevis, Lactobacillus helveticus, Acinetobacter baumannii, Staphylococcus hominis, Bacillus megaterium, Enterobacter asburiae, Pediococcus pentosaceus) were identified. Despite the presence of a complex microbiota in the starter, the fermentation process is consistent and involves a limited number of functional species. Rapid change in microbial composition of fermentation mash was observed and it was correlated with ethanol content. Microbial biomass reached maximum during first 2days of solid state fermentation. Acidification of the medium took place in day 1, starch degradation in days 2, 3, 4, and alcohol accumulation from day 3. Although Sm. fibuligera dominated by cell count amongst potential starch degraders, zymography indicated that it did not produce amylase in the fermentation mash. In mixed culture with Rhizopus, amylase production by Sm. fibuligera is regulated by the moisture content of the substrate. Rhizopus was identified as the main starch degrader and S. cerevisiae as the main ethanol producer. Bacterial load was high but unstable in species composition and dominated by acid producers. M. indicus, Sm. fibuligera, W. anomalus and bacteria were regarded as satellite microorganisms. Their possible influence on organoleptic quality of fermentation product was discussed. Copyright © 2016 Elsevier B.V. All rights reserved.
Discovery of a steroid 11α-hydroxylase from Rhizopus oryzae and its biotechnological application.
Petrič, S; Hakki, T; Bernhardt, R; Zigon, D; Crešnar, B
2010-11-01
To overcome the chemically laborious stereo- and regioselective hydroxylation steps in the pharmaceutical production of corticosteroids and progestogens, certain fungal species, e.g. Rhizopus spp. and Aspergillus spp., are employed to perform the 11α-hydroxylation of the steroid skeleton, thereby significantly simplifying steroid drug production. Here we report for the first time the identification and expression of a fungal 11α-steroid hydroxylase, CYP509C12. The newly identified cytochrome P450, which is one of the 48 putative CYP genes in Rhizopus oryzae, was induced in the fungus by progesterone. By functionally expressing CYP509C12 in recombinant fission yeast, we were able to determine that its substrate spectrum includes progesterone as well as testosterone, 11-deoxycorticosterone, and 11-deoxycortisol, with the hydroxylations taking place predominantly at 11α and 6β positions of the steroid ring system. To increase the 11α-hydroxylation activity of CYP509C12 in recombinant fission yeast, its natural redox partner, the R. oryzae NAD(P)H-dependent reductase, was coexpressed. The coexpression improved electron transfer to CYP509C12 and thus an increase in productivity from 246 to 300 μM hydroxyPg d(-1) was observed, as well as a 7-fold increase of rate of hydroxyprogesterone formation within the linear phase of transformation. This newly developed strain displayed total bioconversion of progesterone into 11α-hydroxyprogesterone and small amounts of 6β-hydroxyprogesterone within the first 6h of incubation with progesterone as substrate, hence demonstrating its potential for biotechnological application. Copyright © 2010 Elsevier B.V. All rights reserved.
Karmakar, Moumita; Ray, Rina Rani
2011-01-01
The production cost of β-glucosidase and endoglucanase could be reduced by using water hyacinth, an aquatic weed, as the sole carbon source and using cost-efficient fermentation strategies like solid-state fermentation (SSF). In the present study, the effect of different production conditions on the yield of β-glucosidase and endoglucanase by Rhizopus oryzae MTCC 9642 from water hyacinth was investigated systematically using response surface methodology. A Central composite experimental design was applied to optimize the impact of three variables, namely, substrate concentration, pH, and temperature, on enzyme production. The optimal level of each parameter for maximum enzyme production by the fungus was determined. Highest activity of endoglucanase of 495 U/mL was achieved at a substrate concentration of 1.23%, pH 7.29, and temperature 29.93°C whereas maximum β-glucosidase activity of 137.32 U/ml was achieved at a substrate concentration of 1.25%, pH 6.66, and temperature 32.09°C. There was a direct correlation between the levels of enzymatic activities and the substrate concentration of water hyacinth as carbon source. PMID:21687577
de Oliveira, Carlos Eduardo Vasconcelos; Magnani, Marciane; de Sales, Camila Veríssimo; Pontes, Alline Lima de Souza; Campos-Takaki, Galba Maria; Stamford, Thayza Christina Montenegro; de Souza, Evandro Leite
2014-12-01
The aim of this study was to extract chitosan (CHI) from Mucor circinelloides UCP 050 grown in a corn steep liquor (CSL)-based medium under optimized conditions and to assess the efficacy of the obtained CHI to inhibit the post-harvest pathogenic fungi Aspergillus niger URM 5162 and Rhizopus stolonifer URM 3482 in laboratory media and as a coating on table grapes (Vitis labrusca L.). The effect of CHI coating on some physical, physicochemical and sensory characteristics of the fruits during storage was assessed. The greatest amount of CHI was extracted from M. circinelloides UCP 050 grown in medium containing 7 g of CSL per 100 mL at pH 5.5 with rotation at 180 rpm. CHI from M. circinelloides UCP 050 caused morphological changes in the spores of the fungal strains tested and inhibited mycelial growth and spore germination. CHI coating delayed the growth of the assayed fungal strains in artificially infected grapes, as well as autochthonous mycoflora during storage. CHI coating preserved the quality of grapes during storage, as measured by their physical, physicochemical and sensory attributes. These results demonstrate that edible coatings derived from M. circinelloides CHI could be a useful alternative for controlling pathogenic fungi and maintaining the post-harvest quality of table grapes. Copyright © 2014 Elsevier Ltd. All rights reserved.
Assessing the anti-fungal efficiency of filters coated with zinc oxide nanoparticles
NASA Astrophysics Data System (ADS)
Decelis, Stephen; Sardella, Davide; Triganza, Thomas; Brincat, Jean-Pierre; Gatt, Ruben; Valdramidis, Vasilis P.
2017-05-01
Air filters support fungal growth, leading to generation of conidia and volatile organic compounds, causing allergies, infections and food spoilage. Filters that inhibit fungi are therefore necessary. Zinc oxide (ZnO) nanoparticles have anti-fungal properties and therefore are good candidates for inhibiting growth. Two concentrations (0.012 M and 0.12 M) were used to coat two types of filters (melt-blown and needle-punched) for three different periods (0.5, 5 and 50 min). Rhizopus stolonifer and Penicillium expansum isolated from spoiled pears were used as test organisms. Conidial suspensions of 105 to 103 spores ml-1 were prepared in Sabouraud dextrose agar at 50°C, and a modified slide-culture technique was used to test the anti-fungal properties of the filters. Penicillium expansum was the more sensitive organism, with inhibition at 0.012 M at only 0.5 min coating time on the needle-punched filter. The longer the coating time, the more effective inhibition was for both organisms. Furthermore, it was also determined that the coating process had only a slight effect on the Young's Moduli of the needle-punched filters, while the Young's Moduli of the melt-blown filters is more susceptible to the coating method. This work contributes to the assessment of the efficacy of filter coating with ZnO nanopaticles aimed at inhibiting fungal growth.
Assessing the anti-fungal efficiency of filters coated with zinc oxide nanoparticles
Decelis, Stephen; Sardella, Davide; Triganza, Thomas; Brincat, Jean-Pierre; Gatt, Ruben
2017-01-01
Air filters support fungal growth, leading to generation of conidia and volatile organic compounds, causing allergies, infections and food spoilage. Filters that inhibit fungi are therefore necessary. Zinc oxide (ZnO) nanoparticles have anti-fungal properties and therefore are good candidates for inhibiting growth. Two concentrations (0.012 M and 0.12 M) were used to coat two types of filters (melt-blown and needle-punched) for three different periods (0.5, 5 and 50 min). Rhizopus stolonifer and Penicillium expansum isolated from spoiled pears were used as test organisms. Conidial suspensions of 105 to 103 spores ml−1 were prepared in Sabouraud dextrose agar at 50°C, and a modified slide-culture technique was used to test the anti-fungal properties of the filters. Penicillium expansum was the more sensitive organism, with inhibition at 0.012 M at only 0.5 min coating time on the needle-punched filter. The longer the coating time, the more effective inhibition was for both organisms. Furthermore, it was also determined that the coating process had only a slight effect on the Young's Moduli of the needle-punched filters, while the Young's Moduli of the melt-blown filters is more susceptible to the coating method. This work contributes to the assessment of the efficacy of filter coating with ZnO nanopaticles aimed at inhibiting fungal growth. PMID:28572995
Assessing the anti-fungal efficiency of filters coated with zinc oxide nanoparticles.
Decelis, Stephen; Sardella, Davide; Triganza, Thomas; Brincat, Jean-Pierre; Gatt, Ruben; Valdramidis, Vasilis P
2017-05-01
Air filters support fungal growth, leading to generation of conidia and volatile organic compounds, causing allergies, infections and food spoilage. Filters that inhibit fungi are therefore necessary. Zinc oxide (ZnO) nanoparticles have anti-fungal properties and therefore are good candidates for inhibiting growth. Two concentrations (0.012 M and 0.12 M) were used to coat two types of filters (melt-blown and needle-punched) for three different periods (0.5, 5 and 50 min). Rhizopus stolonifer and Penicillium expansum isolated from spoiled pears were used as test organisms. Conidial suspensions of 10 5 to 10 3 spores ml -1 were prepared in Sabouraud dextrose agar at 50°C, and a modified slide-culture technique was used to test the anti-fungal properties of the filters. Penicillium expansum was the more sensitive organism, with inhibition at 0.012 M at only 0.5 min coating time on the needle-punched filter. The longer the coating time, the more effective inhibition was for both organisms. Furthermore, it was also determined that the coating process had only a slight effect on the Young's Moduli of the needle-punched filters, while the Young's Moduli of the melt-blown filters is more susceptible to the coating method. This work contributes to the assessment of the efficacy of filter coating with ZnO nanopaticles aimed at inhibiting fungal growth.
Chavan, Smita P; Lokhande, Vinayak H; Nitnaware, Kirti M; Nikam, Tukaram D
2011-03-01
The present study examined the effects of plant growth hormones, incubation period, biotic (Trametes versicolor, Mucor sp., Penicillium notatum, Rhizopus stolonifer, and Fusarium oxysporum) and abiotic (NaCl, MgSO(4), FeSO(4), ZnSO(4), and FeCl(3)) elicitors on cell growth and α-tocopherol and pigment (red and yellow) productions in Carthamus tinctorius cell cultures. The cell growth and α-tocopherol and pigment contents improved significantly on Murashige and Skoog (MS) liquid medium containing 50.0 μM α-naphthalene acetic acid (NAA) and 2.5 μM 6-Benzyladenine (BA) at 28 days of incubation period. Incorporation of T. versicolor (50 mg l(-1)) significantly enhanced the production of α-tocopherol (12.7-fold) and red pigment (4.24-fold). Similarly, supplementation of 30 mg l(-1) T. versicolor (7.54-fold) and 70 mg l(-1) Mucor sp. (7.40-fold) significantly increased the production of yellow pigment. Among abiotic elicitors, NaCl (50-70 mg l(-1)) and MgSO(4) (10-30 mg l(-1)) significantly improved production of α-tocopherol (1.24-fold) and red pigment (20-fold), whereas yellow pigment content increased considerably by all the abiotic elicitor treatments. Taken together, the present study reports improved productions of α-tocopherol and the pigment as a stress response of safflower cell cultures exposed to these elicitors.
Essential oil from Ocimum basilicum (Omani Basil): a desert crop.
Al-Maskri, Ahmed Yahya; Hanif, Muhammad Asif; Al-Maskari, Masoud Yahya; Abraham, Alfie Susan; Al-sabahi, Jamal Nasser; Al-Mantheri, Omar
2011-10-01
The focus of the present study was on the influence of season on yield, chemical composition, antioxidant and antifungal activities of Omani basil (Ocimum basilicum) oil. The present study involved only one of the eight Omani basil varieties. The hydro-distilled essential oil yields were computed to be 0.1%, 0.3% and 0.1% in the winter, spring and summer seasons, respectively. The major components identified were L- linalool (26.5-56.3%), geraniol (12.1-16.5%), 1,8-cineole (2.5-15.1%), p-allylanisole (0.2-13.8%) and DL-limonene (0.2-10.4%). A noteworthy extra component was beta- farnesene, which was exclusively detected in the oil extracted during winter and spring at 6.3% and 5.8%, respectively. The essential oil composition over the different seasons was quite idiosyncratic, in which the principal components of one season were either trivial or totally absent in another. The essential oil extracted in spring exhibited the highest antioxidant activity (except DPPH scavenging ability) in comparison with the oils from other seasons. The basil oil was tested against pathogenic fungi viz. Aspergillus niger, A. fumigatus, Penicillium italicum and Rhizopus stolonifer using a disc diffusion method, and by determination of minimum inhibitory concentration. Surprisingly high antifungal values were found highlighting the potential of Omani basil as a preservative in the food and medical industries.
Bioconversion of straw into improved fodder: fungal flora decomposing rice straw.
Helal, G A
2005-09-01
The fungal flora decomposing rice straw were investigated all over the soil of Sharkia Province, east of Nile Delta, Egypt, using the nylon net bag technique. Sixty-four straw-decomposing species belonging to 30 genera were isolated by the dilution plate method in ground rice straw-Czapek's agar medium at pH 6. The plates were incubated separately at 5℃, 25℃ and 45℃, respectively. Twenty nine species belonging to 14 genera were isolated at 5℃. The most frequent genus was Penicillium (seven species), and the next frequent genera were Acremonium (three species), Fusarium (three species), Alternaria, Chaetomium, Cladosporium, Mucor, Stachybotrys (two species) and Rhizopus stolonifer. At 25℃, 47 species belonging to 24 genera were isolated. The most frequent genus was Aspergillus (nine species), and the next frequent genera were ranked by Penicillium (five species), Chaetomium (three species), Fusarium (three species). Each of Alternaria, Cladosporium, Mucor, Myrothecium and Trichoderma was represented by two species. At 45℃, 15 species belonging to seven genera were isolated. These were seven species of Aspergillus, two species of Chaetomium and two species of Emericella, while Humicola, Malbranchea, Rhizomucor and Talaromyces were represented by one species respectively. The total counts of fungi the genera, and species per gram of dry straw were significantly affected by incubation temperature and soil analysis (P < 0.05).
The environmental source of emerging Apophysomyces variabilis infection in India.
Prakash, Hariprasath; Ghosh, Anup Kumar; Rudramurthy, Shivaprakash Mandya; Paul, Raees Ahmad; Gupta, Sunita; Negi, Vishwanand; Chakrabarti, Arunaloke
2016-08-01
The rare mucoraceous fungus, Apophysomyces species complex ranks second after Rhizopus arrhizus causing mucormycosis in India. The source of this agent in the environment is not clearly known. We conducted an environmental study to find its presence in Indian soil. The soil samples from different geographical locations were analyzed for isolation of Mucorales. Rhizopus arrhizus (24.6%) was most commonly isolated from soil, followed by Lichtheimia spp. (23.2%), Cunninghamella spp. (21.7%), Rhizopus microsporus (14%) and Apophysomyces spp. (4.5%). The isolation of Apophysomyces species complex was significantly associated with low nitrogen content of the soil. Based on sequencing of internal transcribed spacer (ITS) and 28S (D1/D2) regions of ribosomal DNA, the Apophysomyces isolates were identified as Apophysomyces variabilis with 98 to 100% similarity to type strain A. variabilis (CBS658.93). The analysis of amplified fragment length polymorphism (AFLP) fingerprinting data demonstrated genomic diversity of A. variabilis isolates with multiple clades (similarity 40-90%). The minimum inhibitory concentrations (MIC), MIC50 and MIC90 for A. variabilis isolates were 1 and 4 μg/ml for amphotericin B, 0.25 and 0.5 μg/ml for itraconazole, 0.125 and 0.25 μg/ml for posaconazole, 0.06 and 0.12 μg/ml for terbinafine, respectively. The present study revealed abundant presence of A. variabilis in Indian soil with low nitrogen content, its genetic heterogeneity and relatively high MICs for amphotericin B. © The Author 2016. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Chitosan production by psychrotolerant Rhizopus oryzae in non-sterile open fermentation conditions.
Tasar, Ozden Canli; Erdal, Serkan; Taskin, Mesut
2016-08-01
A new chitosan producing fungus was locally isolated from soil samples collected around Erzurum, Turkey and identified as Rhizopus oryzae PAS 17 (GenBank accession number KU318422.1). Cultivation in low cost non-sterile conditions was achieved by exploiting its ability to grow at low temperature and pH, thus, undesired microbial contamination could be eliminated when appropriate culture conditions (incubation temperature as 15°C and initial pH of the medium as 4.5) were selected. Medium composition and culture conditions were optimized using Taguchi orthogonal array (OA) design of experiment (DOE). An OA layout of L16 (4(5)) was constructed with five most influensive factors at four levels on chitosan production like, carbon source (molasses), metal ion (Mg(2+)), inoculum amount, agitation speed and incubation time. The optimal combinations of factors (molasses, 70ml/l; MgSO4·7H2O, 0.5g/l; inoculum, 6.7×10(6) spores/disc; agitation speed, 150rpm and incubation time, 8days) obtained from the proposed DOE methodology was further validated by analysis of variance (ANOVA) test and the results revealed the increment of chitosan and biomass yields of 14.45 and 8.58 folds from its unoptimized condition, respectively. Copyright © 2016 Elsevier B.V. All rights reserved.
Active invasion of bacteria into living fungal cells
Moebius, Nadine; Üzüm, Zerrin; Dijksterhuis, Jan; Lackner, Gerald; Hertweck, Christian
2014-01-01
The rice seedling blight fungus Rhizopus microsporus and its endosymbiont Burkholderia rhizoxinica form an unusual, highly specific alliance to produce the highly potent antimitotic phytotoxin rhizoxin. Yet, it has remained a riddle how bacteria invade the fungal cells. Genome mining for potential symbiosis factors and functional analyses revealed that a type 2 secretion system (T2SS) of the bacterial endosymbiont is required for the formation of the endosymbiosis. Comparative proteome analyses show that the T2SS releases chitinolytic enzymes (chitinase, chitosanase) and chitin-binding proteins. The genes responsible for chitinolytic proteins and T2SS components are highly expressed during infection. Through targeted gene knock-outs, sporulation assays and microscopic investigations we found that chitinase is essential for bacteria to enter hyphae. Unprecedented snapshots of the traceless bacterial intrusion were obtained using cryo-electron microscopy. Beyond unveiling the pivotal role of chitinolytic enzymes in the active invasion of a fungus by bacteria, these findings grant unprecedented insight into the fungal cell wall penetration and symbiosis formation. DOI: http://dx.doi.org/10.7554/eLife.03007.001 PMID:25182414
Lyu, Ang; Liu, Hao; Che, Hongjie; Yang, Long; Zhang, Jing; Wu, Mingde; Chen, Weidong; Li, Guoqing
2017-01-01
This study was conducted to determine the antifungal activity of the metabolites from Streptomyces sp. 3–10, and to purify and identify the metabolites. Meanwhile, the taxonomic status of strain 3–10 was re-evaluated. The cultural filtrates of strain 3–10 in potato dextrose broth were extracted with ethyl acetate. The resulting crude extract at 1 and 5 μg/ml inhibited growth of 22 species in 18 genera of plant pathogenic fungi and Oomycetes, accounting for 92% of the total 24 tested species, suggesting that it has a wide antifungal spectrum. Two compounds were purified from the crude extract and were identified as reveromycins A and B, which demonstrated high antifungal activity against Botrytis cinerea, Mucor hiemails, Rhizopus stolonifer, and Sclerotinia sclerotiorum under acidic pH conditions. Both the crude extract and reveromycin A from strain 3–10 at 10, 50, and 100 μg/ml showed high efficacy in suppression of strawberry fruit rot caused by the above-mentioned four pathogens. The efficacy was comparable to that of corresponding commercial fungicides (pyrimethanil, captan, dimetachlone) used in management of these pathogens. Morphological, physiological, and phylogenetic characterization showed that strain 3–10 is closely related to Streptomyces yanglinensis 1307T, representing a novel phylotype in that species. This study reported a new strain with reveromycins-producing capability. The finding is important for further exploitation of reveromycins for agricultural use. PMID:28421050
Incidence of mycoflora and mycotoxins in some edible fruits and seeds of forest origin.
Singh, P K; Khan, S; Harsh, N; Pandey, R
2001-06-01
Twelve fungi namelyAlternaria alternata, Aspergillus flavus, A niger, A ochraceus, Actinomucor repens, Capnodoium spp., Curvularia lunata, Fusarium pallidoroseum, F solani, F verticillioides, Penicillium citrinum and Rhizopus stolonifer were recorded from samples ofAegle marmelos, Aesculus indica, Buchanania lanzan andPinus gerardiana. In case ofPrunus amygdalus only Rstolonifer was recorded. A significant variation in pattern of mycoflora incidence was observed in terms of source and season. Fungal infestation in most of the substrates was found to be highest during monsoon. Aflatoxins were the most common mycotoxins elaborated by different isolates ofA flavus obtained fromA marmelos, B lanzan andP gerardiana. The amount of aflatoxins produced by the toxigenic isolates ofA flavus was in the range of traces to 0.9-26.0 μg/ml inA marmelos, 0.8-17.5 μg/ml inP gerardiana and 0.65-13.2 μg/ml inB lanzan. The percentage toxigenicity was comparatively lower in the isolates of other mycotoxigenic fungi. Aflatoxins were detected almost in all the samples analyzed for mycotoxin contamination. However, traces of zearalenone were detected inA marmelos. The concentration of aflatoxin B1 was in the range of 0.13-0.75 μg/g inA marmelos, 0.09-0.60 μg/g inP gerardiana and 0.01-0.20 ug/g inB lanzan. Mycotoxins were not detected inAesculus indica andPrunus amygdalus.
Oyedokun, A.V.; Adeniyi, D.O.
2016-01-01
The cashew stem girdler, Analeptes trifasciata, is a major insect pest of cashew in Nigeria causing economic damage in cashew plantations even at low density. In this study, newly emerged adults of A. trifasciata reared from field-infested cashew stems were collected from the rearing cages, sexed, and dissected to reveal the internal structures of the insects. The gut was excised and separated into the foregut, midgut, and hindgut. The dissected gut compartments were blotted dry by sandwiching in sterile Whatman No. 1 (150 mm) filter paper for a minute. The inoculated gut parts showed the presence of eight fungi flora, namely, Aspergillus repens, Trichoderma spp., Fusarium verticillioides, Lasiodiplodia theobromae, yeast, Aspergillus niger, Fusarium spp., and Rhizopus stolonifer. The frequencies of occurrence of bacteria in the gut compartments of A. trifasciata were Enterobacter spp.: 83.33%; Escherichia coli and Streptococcus spp.: 55.56% each; Staphylococcus spp.: 44.44%; Klebsiella pneumonia: 50% and Salmonella shigella: 11.11%, while each of Serratia marceascea, Pseudomonas spp., and Micrococcus lutea had 5.56% occurrence. The occurrence of mycoflora and microbiota species varied in the gut compartments of A. trifasciata, indicating the role of these microorganisms in metabolic and other bioprocesses of A. trifasciata during digestion and synthesis of complex food substances from the cashew stem substrate. This study would provide basic information for enzymatic studies of A. trifasciata with a view to developing an integrated pest management (IPM) protocol for managing the pest in cashew plantations. PMID:27147898
Oyedokun, A V; Adeniyi, D O
2016-01-01
The cashew stem girdler, Analeptes trifasciata, is a major insect pest of cashew in Nigeria causing economic damage in cashew plantations even at low density. In this study, newly emerged adults of A. trifasciata reared from field-infested cashew stems were collected from the rearing cages, sexed, and dissected to reveal the internal structures of the insects. The gut was excised and separated into the foregut, midgut, and hindgut. The dissected gut compartments were blotted dry by sandwiching in sterile Whatman No. 1 (150 mm) filter paper for a minute. The inoculated gut parts showed the presence of eight fungi flora, namely, Aspergillus repens, Trichoderma spp., Fusarium verticillioides, Lasiodiplodia theobromae, yeast, Aspergillus niger, Fusarium spp., and Rhizopus stolonifer. The frequencies of occurrence of bacteria in the gut compartments of A. trifasciata were Enterobacter spp.: 83.33%; Escherichia coli and Streptococcus spp.: 55.56% each; Staphylococcus spp.: 44.44%; Klebsiella pneumonia: 50% and Salmonella shigella: 11.11%, while each of Serratia marceascea, Pseudomonas spp., and Micrococcus lutea had 5.56% occurrence. The occurrence of mycoflora and microbiota species varied in the gut compartments of A. trifasciata, indicating the role of these microorganisms in metabolic and other bioprocesses of A. trifasciata during digestion and synthesis of complex food substances from the cashew stem substrate. This study would provide basic information for enzymatic studies of A. trifasciata with a view to developing an integrated pest management (IPM) protocol for managing the pest in cashew plantations.
Cutaneous mucormycosis in advanced HIV disease.
Moreira, José; Ridolfi, Felipe; Almeida-Paes, Rodrigo; Varon, Andrea; Lamas, Cristiane C
Angionvasive mucormycosis is an emerging fungal disease known to affect mainly diabetics or subjects with profound neutropenia. Infection usually occurs through the inhalation route, but cutaneous inoculation may occur after trauma or burns. However, mucormycosis remains unusual in HIV infection. We report a fatal case of cutaneous mucormycosis due to Rhizopus arrhizus involving the scalp following herpes zoster infection. The patient was a 42-year-old man with advanced AIDS failing on salvage antiretroviral therapy. The fungus was diagnosed on the basis of histopathology and culture. Our case emphasizes the need to consider mucormycosis in the differential diagnosis of necrotic cutaneous lesions in patients with late-stage HIV disease. Copyright © 2016 Sociedade Brasileira de Infectologia. Published by Elsevier Editora Ltda. All rights reserved.
Das, Ratul Kumar; Brar, Satinder Kaur; Verma, Mausam
2015-12-01
The present research account deals with the bioproduction of fumaric acid (FA) from apple pomace ultrafiltration sludge (APUS) and apple pomace (AP) through fermentation. The filamentous fungus Rhizopus oryzae 1526 was used as a biocatalyst and its morphological impact on FA production was analysed in detail. For submerged fermentation, 40 g L(-1) of total solids concentration of APUS, pH 6.0, 30 °C, 200 rpm flask shaking speed and 72 h of incubation were found to be optimum for FA production (25.2 ± 1.0 g L(-1), 0.350 g (L(-1) h(-1))). Broth viscosity (cP), residual reducing sugar (g L(-1)) and ethanol (g L(-1)) produced as by-product, were also analysed. Plastic trays were used for solid state fermentation and at optimized level of moisture and incubation period, 52 ± 2.67 g FA per kg dry weight of AP was obtained. Changes in the total phenolic content (mg g(-1) dry weight of AP) were monitored at regular intervals. Utilization of APUS and AP for the directed synthesis of the high-value platform chemical FA by the fungal strain R. oryzae 1526 was an excellent display of fungal physiological and morphological control over a fermentative product. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Endosymbiont-dependent host reproduction maintains bacterial-fungal mutualism.
Partida-Martinez, Laila P; Monajembashi, Shamci; Greulich, Karl-Otto; Hertweck, Christian
2007-05-01
Bacterial endosymbionts play essential roles for many organisms, and thus specialized mechanisms have evolved during evolution that guarantee the persistence of the symbiosis during or after host reproduction. The rice seedling blight fungus Rhizopus microsporus represents a unique example of a mutualistic life form in which a fungus harbors endobacteria (Burkholderia sp.) for the production of a phytotoxin. Here we report the unexpected observation that in the absence of endosymbionts, the host is not capable of vegetative reproduction. Formation of sporangia and spores is restored only upon reintroduction of endobacteria. To monitor this process, we succeeded in GFP labeling cultured endosymbionts. We also established a laserbeam transformation technique for the first controlled introduction of bacteria into fungi to observe their migration to the tips of the aseptate hyphae. The persistence of this fungal-bacterial mutualism through symbiont-dependent sporulation is intriguing from an evolutionary point of view and implies that the symbiont produces factors that are essential for the fungal life cycle. Reproduction of the host has become totally dependent on endofungal bacteria, which in return provide a highly potent toxin for defending the habitat and accessing nutrients from decaying plants. This scenario clearly highlights the significance for a controlled maintenance of this fungal-bacterial symbiotic relationship.
Genome sequence and transcriptome analyses of the thermophilic zygomycete fungus Rhizomucor miehei.
Zhou, Peng; Zhang, Guoqiang; Chen, Shangwu; Jiang, Zhengqiang; Tang, Yanbin; Henrissat, Bernard; Yan, Qiaojuan; Yang, Shaoqing; Chen, Chin-Fu; Zhang, Bing; Du, Zhenglin
2014-04-21
The zygomycete fungi like Rhizomucor miehei have been extensively exploited for the production of various enzymes. As a thermophilic fungus, R. miehei is capable of growing at temperatures that approach the upper limits for all eukaryotes. To date, over hundreds of fungal genomes are publicly available. However, Zygomycetes have been rarely investigated both genetically and genomically. Here, we report the genome of R. miehei CAU432 to explore the thermostable enzymatic repertoire of this fungus. The assembled genome size is 27.6-million-base (Mb) with 10,345 predicted protein-coding genes. Even being thermophilic, the G + C contents of fungal whole genome (43.8%) and coding genes (47.4%) are less than 50%. Phylogenetically, R. miehei is more closerly related to Phycomyces blakesleeanus than to Mucor circinelloides and Rhizopus oryzae. The genome of R. miehei harbors a large number of genes encoding secreted proteases, which is consistent with the characteristics of R. miehei being a rich producer of proteases. The transcriptome profile of R. miehei showed that the genes responsible for degrading starch, glucan, protein and lipid were highly expressed. The genome information of R. miehei will facilitate future studies to better understand the mechanisms of fungal thermophilic adaptation and the exploring of the potential of R. miehei in industrial-scale production of thermostable enzymes. Based on the existence of a large repertoire of amylolytic, proteolytic and lipolytic genes in the genome, R. miehei has potential in the production of a variety of such enzymes.
Dolatabadi, Somayeh; Kolecka, Anna; Versteeg, Matthijs; de Hoog, Sybren G; Boekhout, Teun
2015-07-01
This study addresses the usefulness of matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF) MS for reliable identification of the two most frequently occurring clinical species of Rhizopus, namely Rhizopus arrhizus with its two varieties, arrhizus and delemar, and Rhizopus microsporus. The test-set comprised 38 isolates of clinical and environmental origin previously identified by internal transcribed spacer (ITS) sequencing of rDNA. Multi-locus sequence data targeting three gene markers (ITS, ACT, TEF ) showed two monophylic clades for Rhizopus arrhizus and Rhizopus microsporus (bootstrap values of 99 %). Cluster analysis confirmed the presence of two distinct clades within Rhizopus arrhizus representing its varieties arrhizus and delemar. The MALDI Biotyper 3.0 Microflex LT platform (Bruker Daltonics) was used to confirm the distinction between Rhizopus arrhizus and Rhizopus microsporus and the presence of two varieties within the species Rhizopus arrhizus. An in-house database of 30 reference main spectra (MSPs) was initially tested for correctness using commercially available databases of Bruker Daltonics. By challenging the database with the same strains of which an in-house database was created, automatic identification runs confirmed that MALDI-TOF MS is able to recognize the strains at the variety level. Based on principal component analysis, two MSP dendrograms were created and showed concordance with the multi-locus tree; thus, MALDI-TOF MS is a useful tool for diagnostics of mucoralean species.
Okazaki, Fumiyoshi; Aoki, Jun-ichi; Tabuchi, Soichiro; Tanaka, Tsutomu; Ogino, Chiaki; Kondo, Akihiko
2012-10-01
We have constructed a filamentous fungus Aspergillus oryzae that secretes a llama variable heavy-chain antibody fragment (V(HH)) that binds specifically to epidermal growth factor receptor (EGFR) in a culture medium. A major improvement in yield was achieved by fusing the V(HH) with a Taka-amylase A signal sequence (sTAA) and a segment of 28 amino acids from the N-terminal region of Rhizopus oryzae lipase (N28). The yields of secreted, immunologically active anti-EGFR V(HH) reached 73.8 mg/1 in a Sakaguchi flask. The V(HH) fragments were released from the sTAA or N28 proteins by an indigenous A. oryzae protease during cultivation. The purified recombinant V(HH) fragment was specifically recognized and could bind to the EGFR with a high affinity.
Solid state fermentation (SSF): diversity of applications to valorize waste and biomass.
Lizardi-Jiménez, M A; Hernández-Martínez, R
2017-05-01
Solid state fermentation is currently used in a range of applications including classical applications, such as enzyme or antibiotic production, recently developed products, such as bioactive compounds and organic acids, new trends regarding bioethanol and biodiesel as sources of alternative energy, and biosurfactant molecules with environmental purposes of valorising unexploited biomass. This work summarizes the diversity of applications of solid state fermentation to valorize biomass regarding alternative energy and environmental purposes. The success of applying solid state fermentation to a specific process is affected by the nature of specific microorganisms and substrates. An exhaustive number of microorganisms able to grow in a solid matrix are presented, including fungus such as Aspergillus or Penicillum for antibiotics, Rhizopus for bioactive compounds, Mortierella for biodiesel to bacteria, Bacillus for biosurfactant production, or yeast for bioethanol.
Mayayo, Emilio; Stchigel, Alberto M; Cano, José F; Bernal-Escoté, Xana; Guarro, Josep
2013-01-03
Cutaneous mucormycosis (zygomycosis), with subcutaneous spreading and dissemination, in immunocompetent patients is an uncommon disease caused by species belonging to the fungal genera Apophysomyces, Rhizopus and Saksenaea, among others. A case of necrotising fasciitis by Saksenaea vasiformis in an immunocompetent woman is described. The infection was acquired through a car accident resulting in multiple injuries affecting mainly her right arm. After the surgical reduction of fractures, skin lesions worsened and led to necrosis. The patient quickly developed a severe necrotising fasciitis with negative cultures at first. Despite the extensive surgical debridement and the aggressive antifungal treatment, the patient died. The histopathological study showed a fungal infection due to a fungus belonging to the Mucorales order, which was confirmed by culturing the clinical sample on Sabouraud agar, and identifying the species by cultures on Czapek-Dox agar, and sequencing of the ITS region of the ribosomal DNA. This case confirm the presence of this fungus in Spain, the value of histopathology for the mucormycosis diagnosis, as well as the need to perform special cultures to facilitate their isolation and identification to the species level by the combined use of Czapek-Dox agar and sequencing of the ITS region. Copyright © 2012 Revista Iberoamericana de Micología. Published by Elsevier España, S.L. All rights reserved.
21 CFR 173.110 - Amyloglucosidase derived from Rhizopus niveus.
Code of Federal Regulations, 2013 CFR
2013-04-01
... FOOD FOR HUMAN CONSUMPTION Enzyme Preparations and Microorganisms § 173.110 Amyloglucosidase derived from Rhizopus niveus. Amyloglucosidase enzyme product, consisting of enzyme derived from Rhizopus... in man or other animals. (c) The enzyme is produced by a process which completely removes the...
21 CFR 173.110 - Amyloglucosidase derived from Rhizopus niveus.
Code of Federal Regulations, 2012 CFR
2012-04-01
... FOOD FOR HUMAN CONSUMPTION Enzyme Preparations and Microorganisms § 173.110 Amyloglucosidase derived from Rhizopus niveus. Amyloglucosidase enzyme product, consisting of enzyme derived from Rhizopus... in man or other animals. (c) The enzyme is produced by a process which completely removes the...
21 CFR 173.110 - Amyloglucosidase derived from Rhizopus niveus.
Code of Federal Regulations, 2011 CFR
2011-04-01
... FOOD FOR HUMAN CONSUMPTION Enzyme Preparations and Microorganisms § 173.110 Amyloglucosidase derived from Rhizopus niveus. Amyloglucosidase enzyme product, consisting of enzyme derived from Rhizopus... in man or other animals. (c) The enzyme is produced by a process which completely removes the...
21 CFR 173.110 - Amyloglucosidase derived from Rhizopus niveus.
Code of Federal Regulations, 2010 CFR
2010-04-01
... FOOD FOR HUMAN CONSUMPTION Enzyme Preparations and Microorganisms § 173.110 Amyloglucosidase derived from Rhizopus niveus. Amyloglucosidase enzyme product, consisting of enzyme derived from Rhizopus... in man or other animals. (c) The enzyme is produced by a process which completely removes the...
Fungi, aflatoxins, and cyclopiazonic acid associated with peanut retailing in Botswana.
Mphande, Fingani A; Siame, Bupe A; Taylor, Joanne E
2004-01-01
Peanuts are important food commodities, but they are susceptible to fungal infestation and mycotoxin contamination. Raw peanuts were purchased from retail outlets in Botswana and examined for fungi and mycotoxin (aflatoxins and cyclopiazonic acid) contamination. Zygomycetes were the most common fungi isolated; they accounted for 41% of all the isolates and were found on 98% of the peanut samples. Among the Zygomycetes, Absidia corymbifera and Rhizopus stolonifer were the most common. Aspergillus spp. accounted for 35% of all the isolates, with Aspergillus niger being the most prevalent (20.4%). Aspergillus flavus/parasiticus were also present and accounted for 8.5% of all the isolates, with A. flavus accounting for the majority of the A. flavus/parasiticus identified. Of the 32 isolates of A. flavus screened for mycotoxin production, 11 did not produce detectable aflatoxins, 8 produced only aflatoxins B1 and B2, and 13 produced all four aflatoxins (B1, B2, G1, and G2) in varying amounts. Only 6 of the A. flavus isolates produced cyclopiazonic acid at concentrations ranging from 1 to 55 microg/kg. The one A. parasiticus isolate screened also produced all the four aflatoxins (1,200 microg/kg) but did not produce cyclopiazonic acid. When the raw peanut samples (n = 120) were analyzed for total aflatoxins, 78% contained aflatoxins at concentrations ranging from 12 to 329 microg/kg. Many of the samples (49%) contained total aflatoxins at concentrations above the 20 microg/kg limit set by the World Health Organization. Only 21% (n = 83) of the samples contained cyclopiazonic acid with concentrations ranging from 1 to 10 microg/kg. The results show that mycotoxins and toxigenic fungi are common contaminants of peanuts sold at retail in Botswana.
Sultana, Nighat
2018-01-31
Steroids are perhaps one of the most widely used group of drugs in present day. Beside the established utilization as immunosuppressive, anti-inflammatory, anti-rheumatic, progestational, diuretic, sedative, anabolic and contraceptive agents, recent applications of steroid compounds include the treatment of some forms of cancer, osteoporosis, HIV infections and treatment of declared AIDS. Steroids isolated are often available in minute amounts. So biotransformation of natural products provides a powerful means in solving supply problems in clinical trials and marketing of the drug for obtaining natural products in bulk amounts. If the structure is complex, it is often an impossible task to isolate enough of the natural products for clinical trials. The microbial biotransformation of steroids yielded several novel metabolites, exhibiting different activities. The metabolites produced from pregnenolone acetate by Cunning hamella elegans and Rhizopus stolonifer were screened against tyrosinase and cholinesterase showed significant inhibitory activities than the parent compound. Diosgenin and its transformed sarsasapogenin were screened for their acetyl cholinesterase and butyryl cholinesterase inhibitory activities. Sarsasapogenin was screened for phytotoxicity, and was found to be more active than the parent compound. Diosgenin, prednisone and their derivatives were screened for their anti-leishmanial activity. All derivatives were found to be more active than the parent compound. The biotransformation of steroids have been reviewed to a little extent. This review focuses on the biotransformation and functions of selected steroids, the classification, advantages and agents of enzymatic biotransformation and examines the potential role of new enzymatically transformed steroids and their derivatives in the chemoprevention and treatment of other diseases. tyrosinase and cholinesterase inhibitory activities, severe asthma, rheumatic disorders, renal disorders and diseases of inflammatory bowel, skin, gastrointestinal tract. Copyright © 2018 Elsevier Inc. All rights reserved.
Nasseri, Mahboobeh; Golmohammadzadeh, Shiva; Arouiee, Hossein; Jaafari, Mahmoud Reza; Neamati, Hossein
2016-11-01
The aim of the present study was to prepare, characterize, and evaluate solid lipid nanoparticles (SLNs) containing Zataria multiflora essential oil (ZEO). In this study, Z. multiflora essential oil-loaded solid lipid nanoparticles (ZE-SLNs) were prepared to improve its efficiency in controlling some fungal pathogens. SLNs containing Z. multiflora essential oil were prepared by high shear homogenization and ultra sound technique. ZEO-SLNs contained 0.03% ZEO in 5% of lipid phase (Glyceryl monostearate-GMS and Precirol® ATO 5). Tween 80 and Poloxamer 188 (2.5% w/v) were used as surfactant in the aqueous phase. The antifungal efficacy of ZE-SLNs and ZEO was compared under in vitro conditions. The particle size of ZE-SLNs was around 255.5±3 nm with PDI of 0.369±0.05 and zeta potential was about -37.8±0.8 mV. Encapsulation efficacy of ZE-SLNs in crystalline form was 84±0.92%. The results showed that the ZEO and ZE-SLNs had 54 and 79% inhibition on the growth of fungal pathogens, respectively. The minimum inhibitory concentration (MIC) under in vitro conditions for the ZEO on the fungal pathogens of Aspergillus ochraceus, Aspergillus niger, Aspergillus flavus, Alternaria solani, Rhizoctonia solani, and Rhizopus stolonifer was 300, 200, 300, 200, 200 and 200 ppm, respectively, for ZE-SLNs, it was 200, 200, 200, 100, 50 and 50 ppm. The antifungal efficacy of ZE-SLNs was significantly more than ZEO. Our results showed that the SLNs were suitable carriers for Z. multiflora essential oil in controlling the fungal pathogens and merits further investigation.
21 CFR 173.110 - Amyloglucosidase derived from Rhizopus niveus.
Code of Federal Regulations, 2014 CFR
2014-04-01
... SERVICES (CONTINUED) SECONDARY DIRECT FOOD ADDITIVES PERMITTED IN FOOD FOR HUMAN CONSUMPTION Enzyme... enzyme product, consisting of enzyme derived from Rhizopus niveus, and diatomaceous silica as a carrier... enzyme is produced by a process which completely removes the organism Rhizopus niveus from the...
Postharvest Rhizopus rot on sugar beet
USDA-ARS?s Scientific Manuscript database
Rhizopus species have been reported as a minor post-harvest rot on sugar beet, particularly under temperatures above 5 deg C. In 2010, Rhizopus was isolated from beets collected from Michigan storage piles in February at a low frequency. However, recent evidence from Michigan has found a high incide...
21 CFR 184.1420 - Lipase enzyme preparation derived from Rhizopus niveus.
Code of Federal Regulations, 2013 CFR
2013-04-01
... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Lipase enzyme preparation derived from Rhizopus... GENERALLY RECOGNIZED AS SAFE Listing of Specific Substances Affirmed as GRAS § 184.1420 Lipase enzyme preparation derived from Rhizopus niveus. (a) Lipase enzyme preparation contains lipase enzyme (CAS Reg. No...
21 CFR 184.1420 - Lipase enzyme preparation derived from Rhizopus niveus.
Code of Federal Regulations, 2012 CFR
2012-04-01
... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Lipase enzyme preparation derived from Rhizopus... GENERALLY RECOGNIZED AS SAFE Listing of Specific Substances Affirmed as GRAS § 184.1420 Lipase enzyme preparation derived from Rhizopus niveus. (a) Lipase enzyme preparation contains lipase enzyme (CAS Reg. No...
21 CFR 184.1420 - Lipase enzyme preparation derived from Rhizopus niveus.
Code of Federal Regulations, 2014 CFR
2014-04-01
... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Lipase enzyme preparation derived from Rhizopus... Specific Substances Affirmed as GRAS § 184.1420 Lipase enzyme preparation derived from Rhizopus niveus. (a) Lipase enzyme preparation contains lipase enzyme (CAS Reg. No. 9001-62-1), which is obtained from the...
21 CFR 184.1420 - Lipase enzyme preparation derived from Rhizopus niveus.
Code of Federal Regulations, 2010 CFR
2010-04-01
... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Lipase enzyme preparation derived from Rhizopus... GENERALLY RECOGNIZED AS SAFE Listing of Specific Substances Affirmed as GRAS § 184.1420 Lipase enzyme preparation derived from Rhizopus niveus. (a) Lipase enzyme preparation contains lipase enzyme (CAS Reg. No...
21 CFR 184.1420 - Lipase enzyme preparation derived from Rhizopus niveus.
Code of Federal Regulations, 2011 CFR
2011-04-01
... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Lipase enzyme preparation derived from Rhizopus... GENERALLY RECOGNIZED AS SAFE Listing of Specific Substances Affirmed as GRAS § 184.1420 Lipase enzyme preparation derived from Rhizopus niveus. (a) Lipase enzyme preparation contains lipase enzyme (CAS Reg. No...
USDA-ARS?s Scientific Manuscript database
Sweet potato is a nutritional source worldwide. Soft rot caused by Rhizopus spp. is a major limiting factor in the storage of produce, rendering it potentially unsafe for human consumption. In this study, Rhizopus oryzae was used to develop a concept of postharvest disease control by weakening the p...
Lastovetsky, Olga A.; Gaspar, Maria L.; Mondo, Stephen J.; LaButti, Kurt M.; Sandor, Laura; Grigoriev, Igor V.; Pawlowska, Teresa E.
2016-01-01
The recent accumulation of newly discovered fungal–bacterial mutualisms challenges the paradigm that fungi and bacteria are natural antagonists. To understand the mechanisms that govern the establishment and maintenance over evolutionary time of mutualisms between fungi and bacteria, we studied a symbiosis of the fungus Rhizopus microsporus (Mucoromycotina) and its Burkholderia endobacteria. We found that nonhost R. microsporus, as well as other mucoralean fungi, interact antagonistically with endobacteria derived from the host and are not invaded by them. Comparison of gene expression profiles of host and nonhost fungi during interaction with endobacteria revealed dramatic changes in expression of lipid metabolic genes in the host. Analysis of the host lipidome confirmed that symbiosis establishment was accompanied by specific changes in the fungal lipid profile. Diacylglycerol kinase (DGK) activity was important for these lipid metabolic changes, as its inhibition altered the fungal lipid profile and caused a shift in the host–bacterial interaction into an antagonism. We conclude that adjustments in host lipid metabolism during symbiosis establishment, mediated by DGKs, are required for the mutualistic outcome of the Rhizopus–Burkholderia symbiosis. In addition, the neutral and phospholipid profiles of R. microsporus provide important insights into lipid metabolism in an understudied group of oleaginous Mucoromycotina. Lastly, our study revealed that the DGKs involved in the symbiosis form a previously uncharacterized clade of DGK domain proteins. PMID:27956601
He, Qiyang; Xia, Qianjun; Wang, Yuejiao; Li, Xun; Zhang, Yu; Hu, Bo; Wang, Fei
2016-07-28
Rhizopus chinensis cells immobilized on loofah (Luffa cylindrica) sponges were used to produce biodiesel via the transesterification of soybean oil. In whole-cell immobilization, loofah sponge is considered to be a superior alternative to conventional biomass carriers because of its biodegradable and renewable properties. During cell cultivation, Rhizopus chinensis mycelia can spontaneously and firmly adhere to the surface of loofah sponge particles. The optimal conditions for processing 9.65 g soybean oil at 40°C and 180 rpm using a 3:1 methanol-to-oil molar ratio were found to be 8% cell addition and 3-10% water content (depending on the oil's weight). Under optimal conditions, an over 90% methyl ester yield was achieved after the first reaction batch. The operational stability of immobilized Rhizopus chinensis cells was assayed utilizing a 1:1 methanol-to-oil molar ratio, thus resulting in a 16.5-fold increase in half-life when compared with immobilized cells of the widely studied Rhizopus oryzae. These results suggest that transesterification of vegetable oil using Rhizopus chinensis whole cells immobilized onto loofah sponge is an effective approach for biodiesel production.
Starzyńska-Janiszewska, Anna; Stodolak, Bożena; Wikiera, Agnieszka
2015-01-01
Tempeh is a food product obtained from legumes by means of solid-state fermentation with Rhizopus sp. Our previous research proved that mixed-culture inoculum may also be successfully applied. The objective of present research was to study the proteolytic activity of R. microsporus var. chinensis and A. oryzae during tempeh-type fermentation of grass pea seeds, and the effect of inoculum composition on the protein level and in vitro protein bioavailability in products. Fermentation substrate were soaked and cooked grass pea seeds. Material was mixed with single- or mixed-culture inoculum, and incubated in perforated plastic bags at 30°C for 32 hrs. In the products, the proteolytic activity (pH 3, 5 and 7), glucosamine, total protein and free amino acids levels, as well as protein in vitro bioavailability and degree of protein hydrolysis were obtained. The significant correlation was found between glucosamine content and proteolytic activity in grass pea seeds fermented with Rhizopus or Aspergillus. The activities of Rhizopus proteases were higher than Aspergillus ones, which corresponded with the degree of seed protein hydrolysis. Both strains showed the highest activity of protease at pH 3. Tempeh made with pure culture of Rhizopus had 37% protein of 69% in-vitro bioavailability. Mixed-culture fermentation improved nutritional parameters of products only when the dose of Aspergillus spores in the inoculum was equal and lower than that of Rhizopus. This process resulted in higher in-vitro bioavailability of protein, slightly more efficient protein hydrolysis and higher level of free amino acids, as compared to standard tempeh. The activity of A. oryzae in tempeh-type fermentation is beneficial as long as it does not dominate the activity and/or growth of Rhizopus strain.
NASA Astrophysics Data System (ADS)
Yang, Yingge; Fan, Yonghong; Li, Wen; Wang, Dongmei; Wu, Yuejin; Zheng, Zhiming; Yu, Zengliang
2007-10-01
In order to obtain an industrial strain with a higher L(+)-lactic acid yield, the strain Rhizopus oryzae PW352 was mutated by means of nitrogen ion beam implantation and the mutant strain Rhizopus oryzae RLC41-6 was obtained. An experimental finding was made in surprise that Rhizopus oryzae mutant RLC41-6 is not only an L(+)-lactic acid producer from corn starch but also an efficient producer of L(+)-lactic acid from xylose. Under optimal conditions, the production of L(+)-lactic acid from 100 g/L xylose reached 77.39 g/L after 144 h fed-batch fermentation. A high mutation rate and a wide mutation spectrum of low-energy ion implantation were observed in the experiment.
CBS domain-containing proteins are Rhizopus oryzae ferrioxamine receptors
USDA-ARS?s Scientific Manuscript database
Background: Iron-overload patients treated with deferoxamine are uniquely susceptible to mucormycosis, because Rhizopus spp. can obtain iron from ferrioxamine (deferoxamine + Fe**3+). Previously we have identified two closely related, ferrioxamine-inducible R. oryzae genes (FOB1 and FOB2) in which ...
Production of phytase by Mucor racemosus in solid-state fermentation.
Bogar, Barbara; Szakacs, George; Pandey, Ashok; Abdulhameed, Sabu; Linden, James C; Tengerdy, Robert P
2003-01-01
Phytase production was studied by three Mucor and eight Rhizopus strains by solid-state fermentation (SSF) on three commonly used natural feed ingredients (canola meal, coconut oil cake, wheat bran). Mucor racemosus NRRL 1994 (ATCC 46129) gave the highest yield (14.5 IU/g dry matter phytase activity) on coconut oil cake. Optimizing the supplementation of coconut oil cake with glucose, casein and (NH(4))(2)SO(4), phytase production in solid-state fermentation was increased to 26 IU/g dry matter (DM). Optimization was carried out by Plackett-Burman and central composite experimental designs. Using the optimized medium phytase, alpha-amylase and lipase production of Mucor racemosus NRRL 1994 was compared in solid-state fermentation and in shake flask (SF) fermentation. SSF yielded higher phytase activity than did SF based on mass of initial substrate. Because this particular isolate is a food-grade fungus that has been used for sufu fermentation in China, the whole SSF material (crude enzyme, in situ enzyme) may be used directly in animal feed rations with enhanced cost efficiency.
Dalgic, Buket; Bukulmez, Aysegul; Sari, Sinan
2011-06-01
Papillon-Lefevre syndrome (PLS) is an autosomal recessive disease that is characterized by symmetric palmoplantar keratodermatitis and severe periodontal destruction. Mutations in the cathepsin C gene (CTSC) have recently been detected in PLS. Immune dysregulation, due to a mutation in CTSC, increases the risk of pyogenic infections in PLS patients. A child with PLS is presented here with liver abscesses and peritonitis caused by Rhizopus oryzae. His liver abscess and peritonitis were cured with amphotericin B without surgical care. This is the first case in the literature liver abscess due to Rhizopus oryzae in a child with PLS.
Isolation of Mucorales from processed maize (Zea mays L.) and screening for protease activity
de Azevedo Santiago, André Luiz Cabral Monteiro; de Souza Motta, Cristina Maria
2008-01-01
Mucorales were isolated from maize flour, corn meal and cooked cornflakes using surface and depth plate methods. Rhizopus oryzae, Circinella muscae, Mucor subtilissimus, Mucor hiemalis f. hiemalis, Syncephalastrum racemosum, Rhizopus microsporus var. chinensis and Absidia cylindrospora showed protease activity. PMID:24031292
USDA-ARS?s Scientific Manuscript database
The beneficial effects of a new recombinant lipase (Rhizopus chinensis lipase, RCL) and transglutaminase (TG) were investigated on frozen dough systems and their breadmaking quality. Rheological properties and microstructure of doughs were measured using a dynamic rheometer, rheofermentometer F3, an...
USDA-ARS?s Scientific Manuscript database
An analytical and statistical method has been developed to measure the ultrasound-enhanced bioscouring performance of milligram quantities of endo- and exo-polygalacturonase enzymes obtained from Rhizopus oryzae fungi. UV-Vis spectrophotometric data and a general linear mixed models procedure indic...
USDA-ARS?s Scientific Manuscript database
Dialysis patients with chronic renal failure receiving deferoxamine for treating iron overload are uniquely predisposed for mucormycosis. Although not secreted by Mucorales, previous studies established that Rhizopus species utilize iron from ferrioxamine (iron-rich form of deferoxamine). Here we de...
The High Affinity Iron Permease is a Key Virulence Factor Required for Rhizopus oryzae Pathogenesis
USDA-ARS?s Scientific Manuscript database
Rhizopus oryzae is the most common cause of mucormycosis, an angioinvasive fungal infection that causes a >/=50% mortality rate despite first-line therapy. Clinical and animal model data clearly demonstrate that the presence of elevated available serum iron predisposes the host to mucormycosis. Th...
21 CFR 173.130 - Carbohydrase derived from Rhizopus oryzae.
Code of Federal Regulations, 2014 CFR
2014-04-01
... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Carbohydrase derived from Rhizopus oryzae. 173.130 Section 173.130 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) SECONDARY DIRECT FOOD ADDITIVES PERMITTED IN FOOD FOR HUMAN CONSUMPTION Enzyme Preparations and...
The role of aquaporins in pH-Dependent germination of Rhizopus delemar spores
USDA-ARS?s Scientific Manuscript database
Rhizopus delemar and associated species attack a wide range of fruit and vegetables after harvest. Host nutrients and acidic pH are required for optimal germination of R. delemar, and we studied how this process is triggered. Glucose induced spore swelling in an acidic environment, expressed by an u...
USDA-ARS?s Scientific Manuscript database
The effect of culture medium composition and cultivation time on biodiesel production by Rhizopus oryzae ATCC #34612 whole cell catalysts, immobilized on novel rigid polyethylene biomass supports, was investigated. Supplementation of the medium with carbon sources led to higher lipase activity and i...
NASA Astrophysics Data System (ADS)
Ge, Chunmei; Yang, Yingge; Fan, Yonghong; Li, Wen; Pan, Renrui; Zheng, Zhiming; Yu, Zengliang
2008-02-01
The wild type strain Rhizopus oryzae PW352 was mutated by means of nitrogen ion implantation (15 keV, 7.8 × 1014 ~ 2.08 × 1015 ions/cm2) to find an industrial strain with a higher L(+)-lactic acid yield, and two mutants RE3303 and RF9052 were isolated. In order to discuss the mechanism primarily, Lactate Dehydrogenase of Rhizopus oryzae was studied. While the two mutants produced L(+)-lactic acid by 75% more than the wild strain did, their specific activity of Lactate Dehydrogenase was found to be higher than that in the wild strain. The optimum temperature of Lactate Dehydrogenase in Rhizopus oryzae RF9052 was higher. Compared to the wild strain, the Michaelis constant (Km) value of Lactate Dehydrogenase in the mutants was changed. All these changes show that L(+)-lactic acid production has a correlation with the specific activity of Lactate Dehydrogenase. The low-energy ions, implanted into the strain, may improve the specific activity of Lactate Dehydrogenase by influencing its gene structure and protein structure.
Antifungal Susceptibility and Phylogeny of Opportunistic Members of the Order Mucorales
Vitale, Roxana G.; de Hoog, G. Sybren; Schwarz, Patrick; Dannaoui, Eric; Deng, Shuwen; Machouart, Marie; Voigt, Kerstin; van de Sande, Wendy W. J.; Dolatabadi, Somayeh; Meis, Jacques F.
2012-01-01
The in vitro susceptibilities of 66 molecularly identified strains of the Mucorales to eight antifungals (amphotericin B, terbinafine, itraconazole, posaconazole, voriconazole, caspofungin, micafungin, and 5-fluorocytosine) were tested. Molecular phylogeny was reconstructed based on the nuclear ribosomal large subunit to reveal taxon-specific susceptibility profiles. The impressive phylogenetic diversity of the Mucorales was reflected in susceptibilities differing at family, genus, and species levels. Amphotericin B was the most active drug, though somewhat less against Rhizopus and Cunninghamella species. Posaconazole was the second most effective antifungal agent but showed reduced activity in Mucor and Cunninghamella strains, while voriconazole lacked in vitro activity for most strains. Genera attributed to the Mucoraceae exhibited a wide range of MICs for posaconazole, itraconazole, and terbinafine and included resistant strains. Cunninghamella also comprised strains resistant to all azoles tested but was fully susceptible to terbinafine. In contrast, the Lichtheimiaceae completely lacked strains with reduced susceptibility for these antifungals. Syncephalastrum species exhibited susceptibility profiles similar to those of the Lichtheimiaceae. Mucor species were more resistant to azoles than Rhizopus species. Species-specific responses were obtained for terbinafine where only Rhizopus arrhizus and Mucor circinelloides were resistant. Complete or vast resistance was observed for 5-fluorocytosine, caspofungin, and micafungin. Intraspecific variability of in vitro susceptibility was found in all genera tested but was especially high in Mucor and Rhizopus for azoles and terbinafine. Accurate molecular identification of etiologic agents is compulsory to predict therapy outcome. For species of critical genera such as Mucor and Rhizopus, exhibiting high intraspecific variation, susceptibility testing before the onset of therapy is recommended. PMID:22075600
Antifungal susceptibility and phylogeny of opportunistic members of the order mucorales.
Vitale, Roxana G; de Hoog, G Sybren; Schwarz, Patrick; Dannaoui, Eric; Deng, Shuwen; Machouart, Marie; Voigt, Kerstin; van de Sande, Wendy W J; Dolatabadi, Somayeh; Meis, Jacques F; Walther, Grit
2012-01-01
The in vitro susceptibilities of 66 molecularly identified strains of the Mucorales to eight antifungals (amphotericin B, terbinafine, itraconazole, posaconazole, voriconazole, caspofungin, micafungin, and 5-fluorocytosine) were tested. Molecular phylogeny was reconstructed based on the nuclear ribosomal large subunit to reveal taxon-specific susceptibility profiles. The impressive phylogenetic diversity of the Mucorales was reflected in susceptibilities differing at family, genus, and species levels. Amphotericin B was the most active drug, though somewhat less against Rhizopus and Cunninghamella species. Posaconazole was the second most effective antifungal agent but showed reduced activity in Mucor and Cunninghamella strains, while voriconazole lacked in vitro activity for most strains. Genera attributed to the Mucoraceae exhibited a wide range of MICs for posaconazole, itraconazole, and terbinafine and included resistant strains. Cunninghamella also comprised strains resistant to all azoles tested but was fully susceptible to terbinafine. In contrast, the Lichtheimiaceae completely lacked strains with reduced susceptibility for these antifungals. Syncephalastrum species exhibited susceptibility profiles similar to those of the Lichtheimiaceae. Mucor species were more resistant to azoles than Rhizopus species. Species-specific responses were obtained for terbinafine where only Rhizopus arrhizus and Mucor circinelloides were resistant. Complete or vast resistance was observed for 5-fluorocytosine, caspofungin, and micafungin. Intraspecific variability of in vitro susceptibility was found in all genera tested but was especially high in Mucor and Rhizopus for azoles and terbinafine. Accurate molecular identification of etiologic agents is compulsory to predict therapy outcome. For species of critical genera such as Mucor and Rhizopus, exhibiting high intraspecific variation, susceptibility testing before the onset of therapy is recommended.
1991-01-01
Aspergillus), Blasto- T he use of effective topical chemotherapeutic agents to myces (Candida), and Zygomycetes ( Mucor , Rhizopus).6 reduce...species, 18%; Mucor species and Rhizopus species, acetate in the morning and silver sulfadiazine in the evening. Prophy- 9.1%; and Microspora species and...sensitivity reports, and the patient’s sue, including one patient who required a hip disarticulation response. to control an invasive Mucor burn wound
USDA-ARS?s Scientific Manuscript database
The kinetic characteristics of two Rhizopus oryzae exo-polygalacturonases acting on galacturonic acid oligomers (GalpA) were determined using isothermal titration calorimetry (ITC). RPG15 hydrolyzing (GalpA)2 demonstrated a Km of 55 uM and kcat of 10.3 s^-1^ while RPG16 was shown to have greater af...
Xing, Fuguo; Ding, Ning; Liu, Xiao; Selvaraj, Jonathan Nimal; Wang, Limin; Zhou, Lu; Zhao, Yueju; Wang, Yan; Liu, Yang
2016-05-16
Internal transcribed spacer 2 (ITS2) sequencing was used to characterize the peanut mycobiome during 90 days storage at five conditions. The fungal diversity in in-shell peanuts was higher with 110 operational taxonomic units (OTUs) and 41 genera than peanut kernels (91 OTUs and 37 genera). This means that the micro-environment in shell is more suitable for maintaining fungal diversity. At 20-30 d, Rhizopus, Eurotium and Wallemia were predominant in in-shell peanuts. In peanut kernels, Rhizopus (>30%) and Eurotium (>20%) were predominant at 10-20 d and 30 d, respectively. The relative abundances of Rhizopus, Eurotium and Wallemia were higher than Aspergillus, because they were xerophilic and grew well on substrates with low water activity (aw). During growth, they released metabolic water, thereby favoring the growth of Aspergillus. Therefore, from 30 to 90 d, the relative abundance of Aspergillus increased while that of Rhizopus, Eurotium and Wallemia decreased. Principal Coordinate Analysis (PCoA) revealed that peanuts stored for 60-90 days and for 10-30 days clustered differently from each other. Due to low aw values (0.34-0.72) and low levels of A. flavus, nine of 51 samples were contaminated with aflatoxins.
Primary Cutaneous Mucormycosis Caused by Rhizopus oryzae: A Case Report and Review of Literature.
Rodríguez-Lobato, Erika; Ramírez-Hobak, Lourdes; Aquino-Matus, Jorge E; Ramírez-Hinojosa, Juan P; Lozano-Fernández, Víctor H; Xicohtencatl-Cortes, Juan; Hernández-Castro, Rigoberto; Arenas, Roberto
2017-04-01
Mucormycosis is an invasive infection caused by opportunistic fungi. Rhizopus, Lichtheimia, Mucor and Rhizomucor are the most common isolated genera. Primary cutaneous mucormycosis is usually related to traumatic injuries, but immunocompromised cases are associated with underlying conditions such as diabetes mellitus and malignancies. The treatment of choice is surgical debridement and liposomal amphotericin B. We present a 40-year-old male with fever and a painful necrotic lesion on the middle back and history of poorly controlled diabetes mellitus. Rhizopus oryzae was isolated and identified using an internal transcribed spacer regions ITS1 and ITS2. An initial good response to treatment was observed; however, 7 days later a diabetic ketoacidosis due to poor adherence to treatment caused a lethal outcome.
2012-01-01
Background Biotransformation of organic compounds by using microbial whole cells provides an efficient approach to obtain novel analogues which are often difficult to synthesize chemically. In this manuscript, we report for the first time the microbial transformation of a synthetic anabolic steroidal drug, oxymetholone, by fungal cell cultures. Results Incubation of oxymetholone (1) with Macrophomina phaseolina, Aspergillus niger, Rhizopus stolonifer, and Fusarium lini produced 17β-hydroxy-2-(hydroxy-methyl)-17α-methyl-5α-androstan-1-en-3-one (2), 2α,17α-di(hydroxyl-methyl)-5α-androstan-3β,17β-diol (3), 17α-methyl-5α-androstan-2α,3β,17β-triol (4), 17β-hydroxy-2-(hydroxymethyl)-17α-methyl-androst-1,4-dien-3-one (5), 17β-hydroxy-2α-(hydroxy-methyl)-17α-methyl-5α-androstan-3-one (6), and 2α-(hydroxymethyl)-17α-methyl-5α-androstan-3β-17β-diol (7). Their structures were deduced by spectral analyses, as well as single-crystal X-ray diffraction studies. Compounds 2–5 were identified as the new metabolites of 1. The immunomodulatory, and anti-inflammatory activities and cytotoxicity of compounds 1–7 were evaluated by observing their effects on T-cell proliferation, reactive oxygen species (ROS) production, and normal cell growth in MTT assays, respectively. These compounds showed immunosuppressant effect in the T-cell proliferation assay with IC50 values between 31.2 to 2.7 μg/mL, while the IC50 values for ROS inhibition, representing anti-inflammatory effect, were in the range of 25.6 to 2.0 μg/mL. All the compounds were found to be non-toxic in a cell-based cytotoxicity assay. Conclusion Microbial transformation of oxymetholone (1) provides an efficient method for structural transformation of 1. The transformed products were obtained as a result of de novo stereoselective reduction of the enone system, isomerization of double bond, insertion of double bond and hydroxylation. The transformed products, which showed significant immunosuppressant and anti-inflammatory activities, can be further studied for their potential as novel drugs. PMID:23237028
Akbudak, Bulent; Tezcan, Himmet; Eris, Atilla
2009-08-01
The preservation methods as an alternative to chemical control to prevent postharvest quality losses of sweet cherry were examined. The efficacy of preharvest and postharvest messenger (M) treatments on sweet cherry cv. '0900 Ziraat' was tested under a controlled atmosphere in 2004 and 2005. The factors investigated included the separate or combined effect of low oxygen, high carbon dioxide and M on the quality and fungal pathogens of sweet cherries in a normal atmosphere (NA) and in a controlled atmosphere (CA). Cherries were placed at six different atmosphere combinations (0.03%:21% [NA, control], 5%:5%, 10%:5%, 15%:5%, 20%:5% and 25%:5% CO(2):O(2)) at 0°C and 90% relative humidity for up to 8 weeks. Mass values were higher in cherries stored under NA compared with CA. Initial firmness was 1.45 kg and 1.41 kg in fruits without messenger (WM) and in M fruits, respectively; and was measured as 0.30-0.59 kg in WM and 0.57-0.95 kg in M at the end of the trials. The highest acidity and ascorbic acid values were recorded at the end of storage from the fruit stored under CA + M. The CA + M treatment proved the most effective with regard to delaying the maturity and preserving the fruit quality in sweet cherries during storage. Moreover, the CA + M treatments reduced the rotten fruit from 24.06% to 3.80% in cv. '0900 Ziraat'. Better fruit quality was obtained under CA + M compared with NA and CA. The fungi most frequently isolated from sweet cherries were Botrytis cinerea, Penicillium expansum, Monilinia fructicola, Alternaria alternata and Rhizopus stolonifer. It was concluded that sweet cherry cv. '0900 Ziraat' could be stored successfully under CA (20%:5%) + M, and partially under CA (25%:5%) + M, conditions for more than 60 days. Thus, it is recommended that CO(2) levels for sweet cherry storage can be increased above 15% with M.
Thornton, C R; Dewey, F M; Gilligan, C A
1997-01-01
ABSTRACT A murine monoclonal antibody (MAb) of immunoglobulin class M (IgM) was raised against surface antigens from Gaeumannomyces graminis var. tritici and, by enzyme-linked immunosorbent assay, recognized isolates of G. graminis var. tritici, G. graminis var. avenae and G. graminis var. graminis. Characterization of the antigen by heat and protease treatments showed that the epitope recognized by the MAb was a protein. Antigen production was detected only in live mycelia. Immunofluorescence studies showed that the antigen was associated with both the broad melanized macrohyphae and hyaline mycelia of G. graminis var. tritici. Secretion of antigen into an aqueous minimal medium was promoted only by exposure of live mycelia to certain phenolic substrates, including monophenols ortho-, para-, and meta-cresol; 3,4,5-trihydroxybenzoic acid (gallic acid); and phenolic amino acid L-3-(3,4-dihydroxyphenyl) alanine (L-DOPA). Antigen secretion was not promoted by 3-(4-hydroxyphenyl) alanine (L-tyrosine). The MAb reacted strongly with purified enzyme laccase (polyphenol oxidase, EC 1.10.3.2) but did not recognize purified tyrosinase (monophenol oxidase, EC 1.14.18.1). Moreover, chemicals that bind to copper and inhibit copper-containing enzymes such as laccase completely inhibited antigen secretion in response to L-DOPA. The MAb was tested for specificity against a wide range of fungi, common yeast species, and gram positive and negative bacteria. It did not recognize antigens from a broad range of unrelated fungi, including Gliocladium roseum, Fusarium sp., Phoma exigua, Phialophora fastigiata, Penicillium crustosum, Pythium ultimum, Rhizopus stolonifer, Rhizoctonia carotae, R. oryzae, R. tuliparum, and Trichoderma viride, nor did it recognize surface antigens from yeasts or bacteria. The MAb cross-reacted with antigens from Botrytis spp., Chaetomium globosum, R. cerealis, and R. solani. However, secretion of antigen by R. solani and R. cerealis was not promoted by L-DOPA, and secretion by C. globosum in response to the phenolic amino acid was significantly less compared to G. graminis var. tritici.
Gao, Y; Chenping; Lin, X P
1997-10-01
In order to determine whether interferon-gamma (IFN-gamma) inhibits eosinphil infiltration in the trachea of asthmatic guinea pigs induced by Rhizopus nigricans. We had administered aerosolized rIFN-gamma in the tracheas of 30 sensitized guinea pigs which had been divided into six groups, then teated animal inhaled rIFN-gamma of 5 x 10(4), 20 x 10(4), and 40 x 10(4) concentration, BDP and normal saline respectively at 24 h, 12 h, 2 h before being challenged. (1) Provocation positive rates decreased in 40 x 10(4) rIFN-gamma and BDP group compared with that in normal saline group and before intervention (P < 0.05), airway resistence decreased (P < 0.01). (2) The administration of aerosolized rIFN-gamma (40 x 10(4)) and BDP also decreased fungus-induced eosnophils but not other cells infiltration in the trachea. (3) In BALF, Eos count and ECP level were obviously lower than those in other groups. However, eosinophil numbers did not show significant change in the peripheral blood. Local administration of rIFN-gamma (40 x 10(4)) may reduce airway inflammation and intervene asthmatic attack by inhibition of Eos, ECP infiltration in airways.
Silva, Janaina Costa E; Mourão, Dalmarcia de Sousa Carlos; Lima, Fabia Silva de Oliveira; Sarmento, Renato de Almeida; Dalcin, Mateus Sunti; Aguiar, Raimundo Wagner de Souza; Santos, Gil Rodrigues Dos
2017-08-14
The objective of this work was to evaluate the efficiency of noni essential oil on the control of Exserohilum turcicum , a causative agent of Exserohilum spot in maize culture. In the sanitary test 400 seeds were incubated using the blotter test method. For the transmissibility test, the fragments of damaged leaves of seedlings were removed and put into a potato, dextrose and agar (PDA) culture environment. To verify the pathogenicity, Koch´s postulates were performed. In the phytotoxicity test different concentrations of noni oil were applied in maize seedlings. E. turcicum conidia were submitted to different concentrations of noni oil. In the preventive and curative tests noni essential oils were applied before and after the conidia inoculation, respectively. The results revealed the presence of fungi of the genres Aspergillus , Penicillium , Rhizopus , Fusarium , and Exserohilum in the maize seeds. The pathogenicity of E. turcicum and also the transmission of this fungus from the seeds to the maize seedlings was confirmed. The inhibition of conidia germination was proportional to the concentration increase. The preventive application of noni essential oil was the most efficient on the control of Exserohilum spot.
NASA Astrophysics Data System (ADS)
Shakila, K.; Kalainathan, S.
2015-01-01
In this paper, we report the successful growth of complex compound of zinc iodide with thiocarbamide by slow evaporation method. The single crystal XRD study reveals that the crystal belongs to monoclinic system with centrosymmetric space group and powder XRD analysis shows that the perfect crystalline nature of the crystal. The presence of functional group and element were confirmed from FT-IR and EDAX analysis. Optical absorbance of the grown crystal was studied by UV-Vis spectrophotometer. The optical constants were calculated from the optical absorbance data such as refractive index (n), extinction coefficient (K) and reflectance (R). The optical band gap (Eg) of thiocarbamide zinc iodide crystal is 4.22 eV. The magnetic properties of grown crystal have been determined by Vibrating Sample Magnetometry (VSM). Room temperature magnetization revealed a ferromagnetic behaviour for the grown crystal. The antibacterial and antifungal activities of the title compound were performed by well diffusion method and MIC method against the standard bacteria like Staphylococcus aureus, Escherichia coli, Klebsiella pneumonia and against fungus like Aspergillus niger, Rhizopus sps and Penicillium sps. Thermal behaviour of the crystal has been investigated using thermogravimetric analysis (TGA) and differential thermal analysis (DTA).
Silva, Janaina Costa E; Mourão, Dalmarcia de Sousa Carlos; Lima, Fabia Silva de Oliveira; Sarmento, Renato de Almeida; Dalcin, Mateus Sunti; Aguiar, Raimundo Wagner de Souza
2017-01-01
The objective of this work was to evaluate the efficiency of noni essential oil on the control of Exserohilum turcicum, a causative agent of Exserohilum spot in maize culture. In the sanitary test 400 seeds were incubated using the blotter test method. For the transmissibility test, the fragments of damaged leaves of seedlings were removed and put into a potato, dextrose and agar (PDA) culture environment. To verify the pathogenicity, Koch´s postulates were performed. In the phytotoxicity test different concentrations of noni oil were applied in maize seedlings. E. turcicum conidia were submitted to different concentrations of noni oil. In the preventive and curative tests noni essential oils were applied before and after the conidia inoculation, respectively. The results revealed the presence of fungi of the genres Aspergillus, Penicillium, Rhizopus, Fusarium, and Exserohilum in the maize seeds. The pathogenicity of E. turcicum and also the transmission of this fungus from the seeds to the maize seedlings was confirmed. The inhibition of conidia germination was proportional to the concentration increase. The preventive application of noni essential oil was the most efficient on the control of Exserohilum spot. PMID:28930274
Yoder, Jay A; Jajack, Andrew J; Rosselot, Andrew E; Smith, Terrance J; Yerke, Mary Clare; Sammataro, Diana
2013-01-01
Fermentation by fungi converts stored pollen into bee bread that is fed to honey bee larvae, Apis mellifera, so the diversity of fungi in bee bread may be related to its food value. To explore the relationship between fungicide exposure and bee bread fungi, samples of bee bread collected from bee colonies pollinating orchards from 7 locations over 2 years were analyzed for fungicide residues and fungus composition. There were detectable levels of fungicides from regions that were sprayed before bloom. An organic orchard had the highest quantity and variety of fungicides, likely due to the presence of treated orchards within bees' flight range. Aspergillus, Penicillium, Rhizopus, and Cladosporium (beneficial fungi) were the primary fungal isolates found, regardless of habitat differences. There was some variation in fungal components amongst colonies, even within the same apiary. The variable components were Absidia, Alternaria, Aureobasidium, Bipolaris, Fusarium, Geotrichum, Mucor, Nigrospora, Paecilomyces, Scopulariopsis, and Trichoderma. The number of fungal isolates was reduced as an effect of fungicide contamination. Aspergillus abundance was particularly affected by increased fungicide levels, as indicated by Simpson's diversity index. Bee bread showing fungicide contamination originated from colonies, many of which showed chalkbrood symptoms.
Hur, Sang-sun; Choi, Suk-won; Lee, Dong-ryul; Park, Jong-hwan
2018-01-01
This study was conducted to determine if topical application of Moringa oleifera extracts and its bioconversion product fermented by Rhizopus oligosporus has therapeutic properties enhancement for treatment of atopic dermatitis. Rhizopus oligosporus (KCCM 11232P) was used to ferment Moringa leaves' extracts in this study. Comparison of organic acids and flavonols in Moringa simple extracts and their fermented product by HPLC analysis revealed that concentration of organic acids and flavonols of bioconversion product was lower than that of hot water extracts. The fermentation process is used as a nutrient for isolation of each component by microorganisms and growth of microorganisms. The results demonstrated that MF extracts effectively reduced clinical features based on macrography, scratching count, and severity scores, as well as model's serum IgE level, including histopathological analyses. PMID:29576799
Biosorption of Azo dyes by spent Rhizopus arrhizus biomass
NASA Astrophysics Data System (ADS)
Salvi, Neeta A.; Chattopadhyay, S.
2017-10-01
In the present study, spent Rhizopus arrhizus biomass was used for the removal of six azo dyes from aqueous solutions. The dye removal capacity of the biomass was evaluated by conducting batch tests as a function of contact time, biomass dosage, pH and initial dye concentrations. The pseudo-second-order kinetic model fitted well with the experimental data with correlation coefficients greater than 0.999, suggesting that chemisorptions might be the rate limiting step. The equilibrium sorption data showed good fit to the Langmuir isotherm model. Among the six dyes tested, the maximum monolayer adsorption capacity for fast red A and metanil yellow was found to be 108.8 and 128.5 mg/g, respectively. These encouraging results suggest that dead Rhizopus arrhizus biomass could be a potential biomaterial for the removal of azo dyes from aqueous dye solution.
Signorini, Camilla; Carpen, Aristodemo; Coletto, Luigi; Borgonovo, Gigliola; Galanti, Elisabetta; Capraro, Jessica; Magni, Chiara; Abate, Ambra; Johnson, Stuart K; Duranti, Marcello; Scarafoni, Alessio
2018-06-01
Fermentation represents a valuable and cost-effective approach for food stabilisation and nutritional improvement. Tempeh is an example of soybean solid-state fermentation. In this work, we investigated the possibility of producing a tempeh analogue containing high amounts of vitamin B12 using seeds of three different species of the legume lupin, namely Lupinus albus, L. angustifolius and L. mutabilis, with Rhizopus oligosporus and Propionibacterium freudenreichii cofermentation. Synergic effects of Rhizopus and Propionibacterium in increasing vitamin B12 up to 1230 ng/g dw was observed. These findings indicate that this cofermentation can improve lupin nutritional quality and safety to provide a tempeh analogue with added value for vegan and vegetarian communities and low-income populations. The level of potentially toxic lupin alkaloids was also monitored during the tempeh preparation.
Mertens, Jeffrey A; Bowman, Michael J
2011-04-01
Polygalacturonase (PG) enzymes hydrolyze the long polygalacturonic acid chains found in the smooth regions of pectin. Interest in this enzyme class continues due to their ability to macerate tissues of economically important crops and their use in a number of industrial processes. Rhizopus oryzae has a large PG gene family with 15 of 18 genes encoding unique active enzymes. The PG enzymes, 12 endo-PG and 3 exo-galacturonases, were expressed in Pichia pastoris and purified enabling biochemical characterization to gain insight into the maintenance of this large gene family within the Rhizopus genome. The 15 PG enzymes have a pH optima ranging from 4.0 to 5.0. Temperature optima of the 15 PG enzymes vary from 30 to 40 °C. While the pH and temperature optima do little to separate the enzymes, the specific activity of the enzymes is highly variable ranging from over 200 to less than 1 μmol/min/mg. A general pattern related to the groupings found in the phylogentic tree was visible with the group containing the exo-PG enzymes demonstrating the lowest specific activity. Finally, the progress curves of the PG enzymes, contained within the phylogenetic group that includes the exo-PG enzymes, acting on trigalacturonic acid lend additional support to the idea that the ancestral form of PG in Rhizopus is endolytic and exolytic function evolved later.
Jones, Kenneth W.; Kaufman, Leo
1978-01-01
An antigen analysis with filtrate and homogenate precipitinogens of single isolates of the zygomycetes Absidia corymbifera, Mucor pusillus, Rhizopus arrhizus, and Rhizopus oryzae demonstrated the presence of common antigens among the three genera as well as antigens which permit their differentiation. Selected homogenate antigens were valuable in developing a diagnostic immunodiffusion (ID) test for systemic zygomycosis. When sera from 43 patients with various proven mycoses other than zygomycosis were tested against each of the antigens, none formed precipitin bands identical to those formed by A. cormybifera, M. pusillus, and the Rhizopus spp. rabbit reference antisera. Sera from 23 normal persons and 25 diabetics did not react with any of the antigens. Homogenate antigens detected antibody in 8 of the 11 sera (73%) from suspected or proven cases of zygomycosis, whereas ID tests with filtrate antigens detected antibody in only 2 of the 11 sera (18%). Of the eight sera that reacted with the homogenate antigens, five only reacted with a specific Rhizopus sp. antigen, two only reacted with a specific M. pusillus antigen, and one only reacted with a specific A. corymbifera antigen. Study results show the ID test with homogenate antigens to be more specific and sensitive than the ID test with filtrate antigens and indicate that the former is a promising technique for diagnosing human zygomycosis. Images PMID:75212
Naja, Ghinwa; Mustin, Christian; Volesky, Bohumil; Berthelin, Jacques
2006-01-01
An interactive metal-based potentiometric titration method has been developed using an ion selective electrode for studying the sorption of metal cations. The accuracy of this technique was verified by analyzing the metal sorption mechanism for the biomass of Rhizopus arrhizus fungus and diatomite, two dissimilar materials (organic and mineral, strong sorbent and weak sorbent) of a different order of cation exchange capacity. The problem of the initial electrochemical potential was addressed identifying the usefulness of a Na-sulfonic resin as a strong chelating agent applied before the beginning of sorption titration experiments so that the titration curves and the sorption uptake could be quantitatively compared. The resin stabilized the initial electrochemical potential to -405+/-5 mV corresponding to 2 micro gl(-1) of lead concentration in solution. The amounts of lead sorbed by R. arrhizus biomass and diatomite were 0.9 mmol g(-1) (C(e)=5.16 x 10(-2)mM) and 0.052 mmol g(-1) (C(e)=5.97 x 10(-2) mM), respectively. Lead sorption by the fungal biomass was pinpointed to at least two types of chemical active sites. The first type was distinguished by high reactivity and a low number of sites whereas the other was characterized by their higher number and lower reactivity.
Ly, Sokny; Mith, Hasika; Tarayre, Cédric; Taminiau, Bernard; Daube, Georges; Fauconnier, Marie-Laure; Delvigne, Frank
2018-01-01
Dombae is a traditional ferment starter which has been used for starchy based wine production in Cambodia. However, the production technology of rice wine in Cambodia is not optimized. The current study aimed to investigate the microbiota associated in five ferment starters and the effect of a traditional fermentation process using a metagenomics sequencing analysis and HS-SPME-GCMS for the characterization of the aromatic profiles at the end of fermentation. Most of bacteria identified in this study were lactic acid bacteria including Weissella cibaria, Pediococcus sp. MMZ60A, Lactobacillus fermentum , and Lactobacillus plantarum . Saccharomyces cerevisiae and Saccharomycopsis fibuligera were found to be abundant yeasts while the only amylolytic filamentous fungus was Rhizopus oryzae . A total of 25 aromatic compounds were detected and identified as esters, alcohols, acids, ketones and aldehydes. The alcohol group was dominant in each rice wine. Significant changes were observed at the level of microbial communities during fermentation, suggesting microbial succession for the assimilation of starch and subsequently assimilation of fermentation by-products leading to the production of flavor compounds. At this level, the presence of Weissella, Pediococcus , and Lactobacillus genus was strongly correlated with most of the flavor compounds detected.
Ly, Sokny; Mith, Hasika; Tarayre, Cédric; Taminiau, Bernard; Daube, Georges; Fauconnier, Marie-Laure; Delvigne, Frank
2018-01-01
Dombae is a traditional ferment starter which has been used for starchy based wine production in Cambodia. However, the production technology of rice wine in Cambodia is not optimized. The current study aimed to investigate the microbiota associated in five ferment starters and the effect of a traditional fermentation process using a metagenomics sequencing analysis and HS-SPME-GCMS for the characterization of the aromatic profiles at the end of fermentation. Most of bacteria identified in this study were lactic acid bacteria including Weissella cibaria, Pediococcus sp. MMZ60A, Lactobacillus fermentum, and Lactobacillus plantarum. Saccharomyces cerevisiae and Saccharomycopsis fibuligera were found to be abundant yeasts while the only amylolytic filamentous fungus was Rhizopus oryzae. A total of 25 aromatic compounds were detected and identified as esters, alcohols, acids, ketones and aldehydes. The alcohol group was dominant in each rice wine. Significant changes were observed at the level of microbial communities during fermentation, suggesting microbial succession for the assimilation of starch and subsequently assimilation of fermentation by-products leading to the production of flavor compounds. At this level, the presence of Weissella, Pediococcus, and Lactobacillus genus was strongly correlated with most of the flavor compounds detected. PMID:29867806
Shakila, K; Kalainathan, S
2015-01-25
In this paper, we report the successful growth of complex compound of zinc iodide with thiocarbamide by slow evaporation method. The single crystal XRD study reveals that the crystal belongs to monoclinic system with centrosymmetric space group and powder XRD analysis shows that the perfect crystalline nature of the crystal. The presence of functional group and element were confirmed from FT-IR and EDAX analysis. Optical absorbance of the grown crystal was studied by UV-Vis spectrophotometer. The optical constants were calculated from the optical absorbance data such as refractive index (n), extinction coefficient (K) and reflectance (R). The optical band gap (Eg) of thiocarbamide zinc iodide crystal is 4.22 eV. The magnetic properties of grown crystal have been determined by Vibrating Sample Magnetometry (VSM). Room temperature magnetization revealed a ferromagnetic behaviour for the grown crystal. The antibacterial and antifungal activities of the title compound were performed by well diffusion method and MIC method against the standard bacteria like Staphylococcus aureus, Escherichia coli, Klebsiella pneumonia and against fungus like Aspergillus niger, Rhizopus sps and Penicillium sps. Thermal behaviour of the crystal has been investigated using thermogravimetric analysis (TGA) and differential thermal analysis (DTA). Copyright © 2014. Published by Elsevier B.V.
Alcoholic fermentation of raw cassava starch by Rhizopus koji without cooking
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fuijo, Y.; Suyanadona, P.; Attasampunna, P.
Using only wheat bran koji from the Rhizopus strain, raw cassava starch and cassava pellets converted reasonably well to alcohol (ethanol) without cooking at 35 degrees C and pH 4.5-5.0. When the initial broth contained 30 g raw cassava starch, 10 g Rhizopus species koji, and 100 mL tap water, 12.1 g of alcohol was recovered by final distillation from fermented broth. In this case, 12.1 g alcohol corresponds to an 85.5% conversion rate based on the theoretical value of the starch content. When the initial broth contained 40 g cassava starch, 14.1 g of alcohol was recovered, where 14.1more » g corresponds to a 74.5% conversion rate. The alcoholic fermentation process described in the present work is considered more effective and reasonable than the process using raw starch without cooking reported until now, since the new process makes it unnecessary to add yeast cells and glucoamylase preparation. (Refs. 15).« less
Alcoholic fermentation of raw cassava starch by Rhizopus koji without cooking
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fujio, Y.; Suyanadona, P.; Attasampunna, P.
Using only wheat bran koji from the Rhizopus strain, raw cassava starch and casava pellets converted reasonably well to alcohol (ethanol) without cooking at 35/sup 0/C and pH 4.5-5.0. When the initial broth contained 30 g raw cassava starch, 10 g Rhizopus sp. koji, and 100 mL tap water, 12.1 g of alcohol was recovered by final distillation from fermented broth. In this case, 12.1 g alcohol corresponds to an 85.5% conversion rate based on the theoretical value of the starch content. When the initial broth contained 40 g cassava starch, 14.1 g of alcohol was recovered, where 14.1 gmore » corresponds to a 74.5% conversion rate. The alcoholic fermentation process described in the present work is considered more effective and reasonable than the process using raw starch without cooking reported until now, since the new process makes it unnecessary to add yeast cells and glucoamylase preparation.« less
NASA Astrophysics Data System (ADS)
Kurniati, T.; Nurlaila, L.; Iim
2017-04-01
Jatropha curcas L already widely cultivated for its seeds pressed oil used as an alternative fuel. This plant productivity per hectare obtained 2.5-5 tonnes of oil/ha / year and jatropha seed cake from 5.5 to 9.5 tonnes/ha/year, nutrient content of Jatropha curcas seed L potential to be used as feed material, However, the constraints faced was the low crude protein and high crude protein. The purpose of the research was to determine the dosage of inoculum and fermentation time of Jatropha seed cake by a mixture of Aspergillus niger and Rhizopus oryzae on crude protein and crude fibre. The study was conducted by an experimental method using a Completely Randomised Design (CRD) factorial design (3×3). The treatment consisted of a mixture of three dosage levels of Aspergillus niger and Rhizopus oryzae (= 0.2% d1, d2 and d3 = 0.3% = 0.4%) and three levels of fermentation time (w1 = 72 hours, 96 hours and w2 = w3 = 120 hours) each repeated three times. The parameters measured were crude protein and crude fibre. The results showed that dosages of 0.3% (Aspergillus niger Rhizopus oryzae 0.15% and 0.15%) and 72 hours (d2w1) is the dosage and the optimal time to generate the highest crude protein content of 21.11% and crude fibre amounted to 21.36%.
Inhibition of lipases from Chromobacterium viscosum and Rhizopus oryzae by tetrahydrolipstatin.
Potthoff, A P; Haalck, L; Spener, F
1998-01-15
Tetrahydrolipstatin is known as an inhibitor for pancreatic lipase but not for microbial lipases. In this paper we demonstrate that in the presence of water-insoluble substrates like tributyrin or olive oil, tetrahydrolipstatin inhibits the lipases of Chromobacterium viscosum and Rhizopus oryzae, although with different potency. In contrast to porcine pancreatic lipase, which forms an irreversible and covalent enzyme-inhibitor complex with tetrahydrolipstatin, the inhibition of the microbial lipases is reversible as the inhibitor can be removed from the enzyme-inhibitor complex by solvent extraction. Moreover, after inhibition of Chromobacterium viscosum lipase tetrahydrolipstatin remains chemically unchanged.
NASA Astrophysics Data System (ADS)
Bosso, L.; Lacatena, F.; Varlese, R.; Nocerino, S.; Cristinzio, G.; Russo, D.
2017-01-01
We assessed whether the presence and abundance of plant pathogens and antagonists change in soil fungal communities along a land abandonment gradient. The study was carried out in the Cilento area (Southern Italy) at a site with three different habitats found along a land abandonment gradient: agricultural land, Mediterranean shrubland and woodland. For all microbiological substrates the colony forming units were about 3.1 × 106 g-1 soil for agricultural land and about 1.1 × 106 g-1 soil for Mediterranean shrubland and woodland. We found the following genera in all habitats: Cladosporium, Mortierella, Penicillium and Trichoderma. In agricultural land, the significantly most abundant fungus genera were Aspergillus, Fusarium, Cylindrocarpon and Nectria; in Mediterranean shrubland, Rhizopus and Trichoderma; and in woodland, Bionectria, Mortierella, Cladosporium, Diplodia, Paecilomyces, Penicillium and Trichoderma. We found a total of 8, 8 and 9 species of fungal antagonist, and 16, 6 and 6 species of fungal plant pathogens in agricultural land, Mediterranean shrubland and woodland respectively. Fungal plant pathogens decreased significantly over a land abandonment gradient, while we no found significant differences among fungal antagonists in the three habitats. We conclude that a decrease in the number of fungal pathogen species occurs when formerly cultivated areas are abandoned. On the other hand, fungal antagonists seem not to be affected by this process.
Accinelli, Cesare; Saccà, Maria Ludovica; Mencarelli, Mariangela; Vicari, Alberto
2012-09-01
Increasing environmental concerns and the introduction of technologies based on renewable resources have stimulated the replacement of persistent petroleum-derived plastics with biodegradable plastics from biopolymers. As a consequence, a variety of products are currently manufactured from bioplastic, including carrier bags. This series of studies investigated the deterioration of carrier bags made with Mater-Bi (MB), a starch-based bioplastic, in soil, compost and two aquatic ecosystems, a littoral marsh and seawater. Results from the laboratory study indicated that bioplastic carrier bags were rapidly deteriorated in soil and compost. After three months of incubation, weight loss of specimens was of 37% and 43% in soil and compost, respectively. Conversely, little deterioration was observed in specimens buried in soil under field conditions or exposed to water of a littoral marsh and of the Adriatic Sea. These findings were consistent with the greater number of bacteria and especially fungi capable of degrading MB that were recovered from soil and compost with respect to the two aquatic ecosystems. Considering that a variety of microbial isolates are capable of using MB as a source of carbon, a new alternative to recycle these MB-based carrier bags was explored. More specifically, starchy residues from bags were fermented by the fungus Rhizopus oryzae to produce up to 35 mg of lactic acid per g of bag residues. Copyright © 2012 Elsevier Ltd. All rights reserved.
Mucormycosis Caused by Unusual Mucormycetes, Non-Rhizopus, -Mucor, and -Lichtheimia Species
Gomes, Marisa Z. R.; Lewis, Russell E.; Kontoyiannis, Dimitrios P.
2011-01-01
Summary: Rhizopus, Mucor, and Lichtheimia (formerly Absidia) species are the most common members of the order Mucorales that cause mucormycosis, accounting for 70 to 80% of all cases. In contrast, Cunninghamella, Apophysomyces, Saksenaea, Rhizomucor, Cokeromyces, Actinomucor, and Syncephalastrum species individually are responsible for fewer than 1 to 5% of reported cases of mucormycosis. In this review, we provide an overview of the epidemiology, clinical manifestations, diagnosis of, treatment of, and prognosis for unusual Mucormycetes infections (non-Rhizopus, -Mucor, and -Lichtheimia species). The infections caused by these less frequent members of the order Mucorales frequently differ in their epidemiology, geographic distribution, and disease manifestations. Cunninghamella bertholletiae and Rhizomucor pusillus affect primarily immunocompromised hosts, mostly resulting from spore inhalation, causing pulmonary and disseminated infections with high mortality rates. R. pusillus infections are nosocomial or health care related in a large proportion of cases. While Apophysomyces elegans and Saksenaea vasiformis are occasionally responsible for infections in immunocompromised individuals, most cases are encountered in immunocompetent individuals as a result of trauma, leading to soft tissue infections with relatively low mortality rates. Increased knowledge of the epidemiology and clinical presentations of these unusual Mucormycetes infections may improve early diagnosis and treatment. PMID:21482731
NASA Astrophysics Data System (ADS)
Zhou, Xiuhong; Ge, Chunmei; Yao, Jianming; Pan, Renrui; Yu, Zengliang
2005-10-01
In order to obtain an industrial strain with a higher L(+)-lactic acid yield, the strain Rhizopus oryzae RF3608 was mutated by means of nitrogen ion beam implantation and the mutant strain RLC41-6 was isolated. Under optimal conditions the yield of L(+)-lactic acid produced in a shake-flask reached 133 g/L-137 g/L after 36 h cultivation, indicating that the conversion rate based on glucose was as high as 88%-91% and the productivity was 3.75 g/L.h. It was almost a 115% increase in lactic acid production compared with the original strain RF3608.
Ait Kaki El-Hadef El-Okki, Amel; Gagaoua, Mohammed; Bourekoua, Hayat; Hafid, Kahina; Bennamoun, Leila; Djekrif-Dakhmouche, Shahrazed; El-Hadef El-Okki, Mohamed; Meraihi, Zahia
2017-01-01
A new thermostable α-amylase from Rhizopus oryzae FSIS4 was purified for first time and recovered in a single step using a three-phase partitioning (TPP) system. The fungal α-amylase, at a concentration of 1.936 U per kg of flour, was used in bread-making and compared to the commercial enzyme. The results showed a significant effect of the recovered α-amylase in the prepared bread and allowed us to improve the quality of the bread. The study indicated clearly that the recovered α-amylase is a potential candidate for future applications in the bread-making industry and in other food biotechnology applications. PMID:28231081
Ethanol fermentation of raw cassava starch with Rhizopus koji in a gas circulation type fermentor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fujio, Y.; Ogato, M.; Ueda, S.
Studies have been conducted in a gas circulation type fermentor in order to characterize the ethanol fermentation of uncooked cassava starch with Rhizopus koji. Results showed that ethanol concentration reached 13-14% (v/v) in 4-day broth, and the maximum productivity of ethanol was 2.3 g ethanol/l broth h. This productivity was about 50% compared to the productivity of a glucose-yeast system. Ethanol yield reached 83.5-72.3% of the theoretical yield for the cassava starch used. The fermentor used in the present work has been proven by experiment to be suitable for ethanol fermentation of the broth with solid substrate. 10 references.
Songür, Rahime; Lurçi, Binnaz; Bayraktar, Emine; Mehmetoğlu, Ulkü; Demir, Ayhan S
2011-06-01
In this study, the production of enantiopure benzoin from rac-benzoin acetate was achieved by lipase catalyzed kinetic resolution combined with deracemization using Rhizopus oryzae (CBS111718). The growth cells were pretreated with 20 kHz and 30 kHz ultrasound irradiation and mechanical homogenization. Approximately 100% conversion and 96% enantiomeric excess of the product (S-benzoin) were obtained by applying 20 kHz ultrasound irradiation at pH 6. The deracemization process involves new and important processes that allow for the transformation of a racemate into a single stereoisomeric product in 100% theoretical yields. Moreover, the application of ultrasound increases the conversion rate by reducing mass transfer limitation.
NASA Astrophysics Data System (ADS)
Naeimi, Behrouz; Foroutan, Rauf; Ahmadi, Bahram; Sadeghzadeh, Farzaneh; Ramavandi, Bahman
2018-04-01
This study was designed to remove Pb(II) and Cd(II) from aqueous solution, shipyard wastewater, and sanitary landfill leachate using an alkaline-modified Rhizopus oryzae biomass. According to the Fourier transform infrared test, different functional groups like O–H, N–H, C=O, and P–O were detected in the bioadsorbent. The x-ray fluorescence (XRF) analysis showed that CaO, P2O3, and SO3 oxides have the highest content in the bioadsorbent. The surface area of modified Rhizopus oryzae was obtained as 20.32 m2 g‑1. The effect of initial pH, temperature, contact time, and bioadsorbent dose on the metals removal was discussed. At optimal conditions, maximum Pb(II) and Cd(II) removal was obtained 95.66% and 94.55%, respectively. Freundlich model was well- accurately described the equilibrium data. Among four studied models, the pseudo-second-order was better able to describe the kinetic behavior of the bioadsorption process. The amount of enthalpy, free energy of Gibbs, and entropy parameters indicated that the bioadsorption process of studied heavy metals is negative, exothermic, and spontaneous. The amount of heavy metals in a shipyard wastewater and sanitary landfill leachate was significantly decreased by using the developed bioadsorbent.
Identification of Mucorales isolates from soil using morphological and molecular methods
Ziaee, A; Zia, M; Bayat, M; Hashemi, J
2016-01-01
Background and Purpose: Soil is the main habitat of saprophytic and pathogenic fungi. Mucoromycotina constitutes a large group of soil fungi, with certain opportunistic members causing systemic infections in immunocompromised hosts. The majority of human and animal infections are caused by the members of the genera Rhizopus, Mucor, Rhizomucor, Lichtheimia (Absidia), Cunninghamella, and Mortierella. Accordingly, in the present study, we aimed to isolate and identify the main genera of the order Mucorales, using molecular assays and morphological features. Materials and Methods: In total, 340 soil samples were collected from seven public parks throughout the city and sidewalk gardens in 14 municipal districts in Isfahan, Iran. All the samples were cultured on the appropriate media, incubated at 27°C for 2- 4 days, and examined daily for visible fungal growth. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method was applied and macroscopic, microscopic, and physiological characteristics were assessed to identify fungal colonies. Results: 400 pure colonies, belonging to the orders Mucorales and Mortierellales, including the genera Lichtheimia, Rhizopus, Rhizomucor, Mucor, Cunninghamella, and Mortierella, were identified. The genus Rhizopus (35.5%) was the most frequent isolate, followed by Mucor (32.25%) and Rhizomucor (27.5%). Conclusion: The results emphasize the importance of opportunistic fungi in public areas and indicate the risk of exposure for immunocompromised individuals. PMID:28681007
Stress response in medically important Mucorales.
Singh, Pankaj; Paul, Saikat; Shivaprakash, M Rudramurthy; Chakrabarti, Arunaloke; Ghosh, Anup K
2016-10-01
Mucorales are saprobes, ubiquitously distributed and able to infect a heterogeneous population of human hosts. The fungi require robust stress responses to survive in human host. We tested the growth of Mucorales in the presence of different abiotic stress. Eight pathogenic species of Mucorales, including Rhizopus arrhizus, Rhizopus microsporus, Rhizomucor pusillus, Apophysomyces elegans, Licthemia corymbifera, Cunninghamella bertholletiae, Syncephalastrum racemosum and Mucor racemosus, were exposed to different stress inducers: osmotic (sodium chloride and d-sorbitol), oxidative (hydrogen peroxide and menadione), pH, cell wall and metal ions (Cu, Zn, Fe and Mg). Wide variation in stress responses was noted: R. arrhizus showed maximum resistance to both osmotic and oxidative stresses, whereas R. pusillus and M. indicus were relatively sensitive. Rhizopus arrhizus and R. microsporus showed maximum resistance to alkaline pH, whereas C. bertholletiae, L. corymbifera, M. racemosus and A. elegans were resistant to acidic pH. Maximum tolerance was noted in R. microsporus to Cu, R. microsporus and R. arrhizus to Fe and C. bertholletiae to Zn. In contrast, L. corymbifera, A. elegans and M. indicus were sensitive to Cu, Zn and Fe respectively. In conclusion, R. arrhizus showed high stress tolerance in comparison to other species of Mucorales, and this could be the possible reason for high pathogenic potential of this fungi. © 2016 Blackwell Verlag GmbH.
Identification of Mucorales isolates from soil using morphological and molecular methods.
Ziaee, A; Zia, M; Bayat, M; Hashemi, J
2016-03-01
Soil is the main habitat of saprophytic and pathogenic fungi. Mucoromycotina constitutes a large group of soil fungi, with certain opportunistic members causing systemic infections in immunocompromised hosts. The majority of human and animal infections are caused by the members of the genera Rhizopus , Mucor , Rhizomucor , Lichtheimia ( Absidia) , Cunninghamella, and Mortierella . Accordingly, in the present study, we aimed to isolate and identify the main genera of the order Mucorales, using molecular assays and morphological features . In total, 340 soil samples were collected from seven public parks throughout the city and sidewalk gardens in 14 municipal districts in Isfahan, Iran. All the samples were cultured on the appropriate media, incubated at 27°C for 2- 4 days, and examined daily for visible fungal growth. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method was applied and macroscopic, microscopic, and physiological characteristics were assessed to identify fungal colonies. 400 pure colonies, belonging to the orders Mucorales and Mortierellales, including the genera Lichtheimia , Rhizopus, Rhizomucor, Mucor, Cunninghamella, and Mortierella, were identified . The genus Rhizopus (35.5%) was the most frequent isolate, followed by Mucor (32.25%) and Rhizomucor (27.5%). The results emphasize the importance of opportunistic fungi in public areas and indicate the risk of exposure for immunocompromised individuals.
Soya bean tempe extracts show antibacterial activity against Bacillus cereus cells and spores.
Roubos-van den Hil, P J; Dalmas, E; Nout, M J R; Abee, T
2010-07-01
Tempe, a Rhizopus ssp.-fermented soya bean food product, was investigated for bacteriostatic and/or bactericidal effects against cells and spores of the food-borne pathogen Bacillus cereus. Tempe extract showed a high antibacterial activity against B. cereus ATCC 14579 based on optical density and viable count measurements. This growth inhibition was manifested by a 4 log CFU ml(-1) reduction, within the first 15 min of exposure. Tempe extracts also rapidly inactivated B. cereus spores upon germination. Viability and membrane permeability assessments using fluorescence probes showed rapid inactivation and permeabilization of the cytoplasmic membrane confirming the bactericidal mode of action. Cooked beans and Rhizopus grown on different media did not show antibacterial activity, indicating the unique association of the antibacterial activity with tempe. Subsequent characterization of the antibacterial activity revealed that heat treatment and protease addition nullified the bactericidal effect, indicating the proteinaceous nature of the bioactive compound. During fermentation of soya beans with Rhizopus, compounds are released with extensive antibacterial activity against B. cereus cells and spores. The results show the potential of producing natural antibacterial compounds that could be used as ingredients in food preservation and pathogen control. © 2009 The Authors. Journal compilation © 2009 The Society for Applied Microbiology.
[Stability of whole cell biocatalyst for biodiesel production from renewable oils].
Sun, Ting; Du, Wei; Liu, Dehua; Li, Wei; Zeng, Jing; Dai, Lingmei
2009-09-01
Lipase-mediated biodiesel production becomes increasingly important because of mild reaction conditions, pollution free during the process and easy product separation. Compared with traditional immobilized lipase, whole cell biocatalyst is promising for biodiesel production because it is easy to prepare and has higher enzyme activity recovery. Rhizopus oryzae IFO4697 can be used as the catalyst for biodiesel production. To further study the stability of the whole cell biocatalyst is extremely important for its further application on large scale. This paper focuses on the stability study of Rhizopus oryzae IFO4697 when used for the methanolysis of renewable oils for biodiesel production. The results showed that water content was important for achieving high catalytic activity and good stability of the biocatalyst. The optimum water content was found to be 5%-15%. Both particle size and desiccation methods showed no obvious effect on the stability of the biocatalyst. With GA cross-linking pretreatment, the stability of the biocatalyst could be improved significantly. When Rhizopus oryzae IFO4697 repeatedly used for next batch reaction, direct vacuum filtration was found to be a good way for the maintenance of good stability of the biocatalyst. Under the optimum reaction conditions, the methyl ester yield could keep over 80% during 20 repeated reaction batches.
Chen, Ying-Sheng; Liu, Yen-Hung; Teng, Shih-Hua; Liao, Chun-Hsing; Hung, Chien-Ching; Sheng, Wang-Huei; Teng, Lee-Jene; Hsueh, Po-Ren
2015-01-01
We evaluated the performance of matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS), the MALDI Bruker Biotyper system (microflex LT; Bruker Daltonik GmbH, Bremen, Germany), on the identification of 50 isolates of clinically encountered molds, including Penicillium marneffei (n = 28), Paecilomyces species (n = 12), Fusarium solani (n = 6), Rhizopus species (n = 3), and Pseudallescheria boydii (n = 1). The isolates were identified to species levels by sequence analysis of the internal transcribed spacer (ITS) regions using primers ITS1 and ITS4. None of the 28 genetically well characterized isolates of P. marneffei were identified as P. marneffei by MALDI-TOF MS, because P. marneffei was not present in either Bruker general library (DB 5627) or Bruker filamentous fungi library V1.0. However, the rate of accurate identification as P. marneffei (score value ≥ 2.000) was 85.7% based on newly created database from one P. marneffei strain (NTUH-3370) by MALDI Biotyper system. Sequencing analysis of these 22 non-P. marneffei isolates of molds revealed seven Paecilomyces variotii, six F. solani, four Paecilomyces lilacinus, and one each of Paecilomyces sinensis, Rhizopus arrhizus, R. oryzae, R. microspores, and P. boydii. Although all the seven P. variotii isolates, four of the six F. solani, two of the four P. lilacinus, and two of the three isolates of Rhizopus species, and the P. boydii isolate had concordant identification results between MALDI-TOF MS and sequencing analysis, the score values of these isolates were all of <1.700. This study indicated that the MALDI Bruker Biotyper is ineffective for identifying P. marneffei and other unusual molds because of the current database limitations. Therefore, it is necessary to continuously update the MALDI-TOF MS databases. PMID:26217315
Short communication: Conversion of lactose and whey into lactic acid by engineered yeast.
Turner, Timothy L; Kim, Eunbee; Hwang, ChangHoon; Zhang, Guo-Chang; Liu, Jing-Jing; Jin, Yong-Su
2017-01-01
Lactose is often considered an unwanted and wasted byproduct, particularly lactose trapped in acid whey from yogurt production. But using specialized microbial fermentation, the surplus wasted acid whey could be converted into value-added chemicals. The baker's yeast Saccharomyces cerevisiae, which is commonly used for industrial fermentation, cannot natively ferment lactose. The present study describes how an engineered S. cerevisiae yeast was constructed to produce lactic acid from purified lactose, whey, or dairy milk. Lactic acid is an excellent proof-of-concept chemical to produce from lactose, because lactic acid has many food, pharmaceutical, and industrial uses, and over 250,000 t are produced for industrial use annually. To ferment the milk sugar lactose, a cellodextrin transporter (CDT-1, which also transports lactose) and a β-glucosidase (GH1-1, which also acts as a β-galactosidase) from Neurospora crassa were expressed in a S. cerevisiae strain. A heterologous lactate dehydrogenase (encoded by ldhA) from the fungus Rhizopus oryzae was integrated into the CDT-1/GH1-1-expressing strain of S. cerevisiae. As a result, the engineered strain was able to produce lactic acid from purified lactose, whey, and store-bought milk. A lactic acid yield of 0.358g/g of lactose was achieved from whey fermentation, providing an initial proof of concept for the production of value-added chemicals from excess industrial whey using engineered yeast. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Li, Qiang; Zhao, Jian; Xiong, Chuan; Li, Xiaolin; Chen, Zuqin; Li, Ping; Huang, Wenli
2017-01-01
The aim of this study was to investigate the effect of an ectomycorrhizal fungus (Tuber indicum) on the diversity of microbial communities associated with an indigenous tree, Pinus armandii, and the microbial communities in the surrounding ectomycorhizosphere soil. High-throughput sequencing was used to analyze the richness of microbial communities in the roots or rhizosphere of treatments with or without ectomycorrhizae. The results indicated that the bacterial diversity of ectomycorhizosphere soil was significantly lower compared with the control soil. Presumably, the dominance of truffle mycelia in ectomycorhizosphere soil (80.91%) and ectomycorrhizae (97.64%) was the main factor that resulted in lower diversity and abundance of endophytic pathogenic fungi, including Fusarium, Monographella, Ustilago and Rhizopus and other competitive mycorrhizal fungi, such as Amanita, Lactarius and Boletus. Bacterial genera Reyranena, Rhizomicrobium, Nordella, Pseudomonas and fungal genera, Cuphophyllus, Leucangium, Histoplasma were significantly more abundant in ectomycorrhizosphere soil and ectomycorrhizae. Hierarchical cluster analysis of the similarities between rhizosphere and ectomycorrhizosphere soil based on the soil properties differed significantly, indicating the mycorrhizal synthesis may have a feedback effect on soil properties. Meanwhile, some soil properties were significantly correlated with bacterial and fungal diversity in the rhizosphere or root tips. Overall, this work illustrates the interactive network that exists among ectomycorrhizal fungi, soil properties and microbial communities associated with the host plant and furthers our understanding of the ecology and cultivation of T. indicum. PMID:28410376
Simons, Rudy; Vincken, Jean-Paul; Bohin, Maxime C; Kuijpers, Tomas F M; Verbruggen, Marian A; Gruppen, Harry
2011-01-15
Phytoalexins from soya are mainly characterised as prenylated pterocarpans, the glyceollins. Extracts of non-soaked and soaked soya beans, as well as that of soya seedlings, grown in the presence of Rhizopus microsporus var. oryzae, were screened for the presence of prenylated flavonoids with a liquid chromatography/mass spectrometry (LC/MS)-based screening method. The glyceollins I-III and glyceollidins I-II, belonging to the isoflavonoid subclass of the pterocarpans, were tentatively assigned. The formation of these prenylated pterocarpans was accompanied by that of other prenylated isoflavonoids of the subclasses of the isoflavones and the coumestans. It was estimated that approx. 40% of the total isoflavonoid content in Rhizopus-challenged soya bean seedlings were prenylated pterocarpans, whereas 7% comprised prenylated isoflavones and prenylated coumestans. The site of prenylation (A-ring or B-ring) of the prenylated isoflavones was tentatively annotated using positive-ion mode MS by comparing the (1,3) A(+) retro-Diels-Alder (RDA) fragments of prenylated and non-prenylated isoflavones. Furthermore, the fragmentation pathways of the five pterocarpans in negative-ion (NI) mode were proposed, which involved the cleavage of the C-ring and/or D-ring. The absence of the ring-closed prenyl (pyran or furan) gave exclusively -H(2) O(x,y) RDA fragments, whereas its presence gave predominantly the common RDA fragments. Copyright © 2010 John Wiley & Sons, Ltd.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Konstantin,J.; Gough, K.; Julian, R.
2008-01-01
Cell function is related to cell composition. The asexual state of filamentous fungi (molds and mildews) has two main life cycle stages: vegetative hyphae for substrate colonization and nutrient acquisition, and asexual spores for survival and dispersal. Hyphal composition changes over a few tens of microns during growth and maturation; spores are different from hyphae. Most biochemical analyses are restricted to studying a few components at high spatial resolution (e.g. histochemistry) or many compounds at low spatial resolution (e.g. GC-MS). Synchrotron FTIR spectromicroscopy can be used to study fungal cell biology by fingerprinting varieties of carbohydrates, proteins, and lipids atmore » about 6 microm spatial resolution. FTIR can distinguish fungal species and changes during hyphal growth, and reveals that even fungi grown under optimal vs mildly stressed conditions exhibit dramatic biochemical changes without obvious morphological effects. Here we compare hypha and spore composition of two fungi, Neurospora and Rhizopus. There are clear biochemical changes when Neurospora hyphae commit to spore development, during spore maturation and following germination, many of which are consistent with results from molecular genetics, but have not been shown before at high spatial resolution. Rhizopus spores develop within a fluid-containing sporangium that becomes dry at maturity. Rhizopus spores had similar protein content and significantly more carbohydrate than the sporangial fluid, both of which are novel findings.« less
Cloning and expression of trehalose-6-phosphate synthase 1 from Rhizopus oryzae.
Ozer Uyar, Ebru; Yücel, Meral; Hamamcı, Haluk
2016-05-01
Trehalose is a reducing disaccharide acting as a protectant against environmental stresses in many organisms. In fungi, Trehalose-6-phosphate synthase 1 (TPS1) plays a key role in the biosynthesis of trehalose. In this study, a full-length cDNA from Rhizopus oryzae encoding TPS1 (designated as RoTPS1) was isolated. The RoTPS1 cDNA is composed of 2505 nucleotides and encodes a protein of 834 amino acids with a molecular mass of 97.8 kDa. The amino acid sequence of RoTPS1 has a relatively high homology with the TPS1s in several other filamentous fungi. RoTPS1 was cloned into Saccharomyces cerevisiae and secretively expressed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Sellami, Mohamed; Kedachi, Samiha; Frikha, Fakher; Miled, Nabil; Ben Rebah, Faouzi
2013-01-01
Lipase production by Staphylococcus xylosus and Rhizopus oryzae was investigated using a culture medium based on a mixture of synthetic medium and supernatants generated from tuna by-products and Ulva rigida biomass. The proportion of the three medium components was optimized using the simplex-centroid mixture design method (SCMD). Results indicated that the experimental data were in good agreement with predicted values, indicating that SCMD was a reliable method for determining the optimum mixture proportion of the growth medium. Maximal lipase activities of 12.5 and 23.5 IU/mL were obtained with a 50:50 (v:v) mixture of synthetic medium and tuna by-product supernatant for Staphylococcus xylosus and Rhizopus oryzae, respectively. The predicted responses from these mixture proportions were also validated experimentally.
Leverrier, Aurélie; Martin, Marie-Thérèse; Servy, Claudine; Ouazzani, Jamal; Retailleau, Pascal; Awang, Khalijah; Mukhtar, Mat Ropi; Guéritte, Françoise; Litaudon, Marc
2010-06-25
In our search for inhibitors of the antiapoptotic protein Bcl-xL, investigation of Xylopia caudata afforded a new diterpenoid, ent-trachyloban-4beta-ol (2), and five known ent-trachylobane or ent-atisane compounds. Only ent-trachyloban-18-oic acid (1) exhibited weak binding activity to Bcl-xL. These compounds exhibited cytotoxicity against KB and HCT-116 cell lines with IC(50) values between 10 and 30 microM. Bioconversion of compound 1 by Rhizopus arrhizus afforded new hydroxylated metabolites (3-7) of the ent-trachylobane and ent-kaurene type and compound 8, with a rearranged pentacyclic carbon framework that was named rhizopene. Compounds 3-8 were noncytotoxic to the two cancer cell lines, and compounds 3 and 5 exhibited only weak binding affinity for Bcl-xL.
Starzynska-Janiszewska, A; Stodolak, B; Dulinski, R; Mickowska, B
2012-04-01
Tempeh is a popular Indonesian product obtained from legume seeds by solid-state fermentation with Rhizopus sp. The aim of this research was to study the effect of simultaneous mixed-culture fermentation of grass pea seeds on selected parameters of products as compared to traditional tempeh. The inoculum contained different ratios of Rhizopus oligosporus and Aspergillus oryzae spores. The simultaneous fermentation of grass pea seeds with inoculum consisting of 1.2 × 10(6) R. oligosporus and 0.6 × 10(6) A. oryzae spores (per 60 g of seeds) resulted in a product of improved quality, as compared with traditionally made tempeh (obtained after inoculation with 1.2 × 10(6) R. oligosporus spores), at the same fermentation time. This product had radical scavenging ability 70% higher than the one obtained with pure R. oligosporus culture and contained 2.23 g/kg dm of soluble phenols. The thiamin and riboflavin levels were above three (340 µg/g dm) and two (50.50 µg/g dm) folds higher than in traditionally made tempeh, respectively. The product had 65% in vitro bioavailability of proteins and 33% in vitro bioavailability of sugars. It also contained 40% less 3-N-oxalyl-L-2, 3-diaminopropionic acid (0.074 g/kg dm), as compared to traditional tempeh.
Analysis of microbial diversity in Shenqu with different fermentation times by PCR-DGGE.
Liu, Tengfei; Jia, Tianzhu; Chen, Jiangning; Liu, Xiaoyu; Zhao, Minjie; Liu, Pengpeng
Shenqu is a fermented product that is widely used in traditional Chinese medicine (TCM) to treat indigestion; however, the microbial strains in the fermentation process are still unknown. The aim of this study was to investigate microbial diversity in Shenqu using different fermentation time periods. DGGE (polymerase chain reaction-denaturing gradient gel electrophoresis) profiles indicated that a strain of Pediococcus acidilactici (band 9) is the predominant bacteria during fermentation and that the predominant fungi were uncultured Rhizopus, Aspergillus oryzae, and Rhizopus oryzae. In addition, pathogenic bacteria, such as Enterobacter cloacae, Klebsiella oxytoca, Erwinia billingiae, and Pantoea vagan were detected in Shenqu. DGGE analysis showed that bacterial and fungal diversity declined over the course of fermentation. This determination of the predominant bacterial and fungal strains responsible for fermentation may contribute to further Shenqu research, such as optimization of the fermentation process. Copyright © 2017. Published by Elsevier Editora Ltda.
NASA Astrophysics Data System (ADS)
Li, Wen; Wang, Tao; Yang, Yingge; Liu, Dan; Fan, Yonghong; Wang, Dongmei; Yang, Qian; Yao, Jianming; Zheng, Zhiming; Yu, Zengliang
2008-04-01
In order to get an industrial strain which can yield a high concentration of lactic acid for ISPR (in situ product removal), the original strain Rhizopus oryzae RE3303 was mutated by low-energy ion beam implantation. A mutant RK02 was screened, and the factors such as the substrate concentration, nitrogen source concentration, inoculum size, seed age, aeration and temperature that affect the production of lactic acid were studied in detail. Under optimal conditions, the maximum concentration of L(+)-lactic acid reached 34.85 g/L after 30 h shake-flask cultivation without adding any neutralisation (5% Glucose added), which was a 146% increase in lactic acid production after ion implantation compared with the original strain. It was also shown that RK02 can be used in ISPR to reduce the number of times of separation.
Accumulation of cadmium, lead, and nickel by fungal and wood biosorbents
DOE Office of Scientific and Technical Information (OSTI.GOV)
Holan, Z.R.; Volesky, B.
Native fungal biomass of fungi Absidia orchids, Penicillium chrysogenum, Rhizopus arrhizus, Rhizopus nugricans, and modified spruce sawdust (Picea engelmanii) sequestered metals in the following decreasing preference: Pb>Cd>Ni. The highest metal uptake was q{sub max}=351 mg Pb/g for A. orchidis biomass. P. chrysogenum biomass could accumulate cadmium best at 56 mg Cd/G. The sorption of nickel was the weakest always at >5 mg Ni/g. The spruce sawdust was modified by crosslinking, oxidation to acidic oxoforms, and by substitution. The highest metal uptake was observed in phosorylated sawdust reaching q{sub max}=224 mg Pb/g, 56 mg Cd/g, and 26 mg Ni/g. The lattermore » value is comparable to the value of nickel sorption by wet commercial resin Duolite GT-73. Some improvement in metal uptake was also observed after reinforcement of fungal biomass. 40 refs., 5 figs., 3 tabs.« less
Rabie, Nada B; Althaqafi, Abdulhakeem O
2012-03-01
Rhinocerebral or sinopulmonary mucromycosis is a well-recognized human fungal infection found among immunocompromised and diabetic patients. However, the infection is rare among immunocompetent hosts. We are reporting the case of an adult immunocompetent male patient working as an air-conditioning technician. The patient was a victim of a road traffic accident (RTA) and sustained multiple fractures in the proximal part of the left tibia, distal femur, and scapula. Two weeks postoperatively, Rhizopus microspores were isolated from an infected traumatic wound over the distal femur. Surgical debridement was performed, and the patient was started on amphotericin B. Occupational exposure history and workplace environmental sanitation are crucial for the prevention of this potentially fatal yet preventable infection. Copyright © 2011 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.
The mechanism of thorium biosorption by Rhizopus arrhizus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tsezos, M.; Volesky, B.
1982-04-01
Inactive cells of Rhizopus arrhizus have been documented to exhibit a high thorium biosorptive uptake (170 mg/g) from aqueous solutions. The mechanism of thorium sequestering by this biomass type was investigated following the same method as for the uranium biosorption emchanism. The thorium sequestering mechanism appeared somewhat different from that of uranium. Experimental evidence is presented which indicates that, at optimum biosorption pH (4), thorium coordinates with the nitroge of the chitin cell wall network and, in addition, more thorium is adsorbed by the external section of the fungal cell wall. At pH 2 the overall thorium uptake is reduced.more » The kinetic study of thorium biosorption revealed a very rapid rate of uptake. Unlike uranium at optimum solution pH, Fe/sup 2 +/ and Zn/sup 2 +/ did not interfere significantly with the thorium biosorptive uptake capacity of R. arrhizus.« less
Disseminated Zygomycosis Due to Rhizopus schipperae after Heatstroke
Anstead, Gregory M.; Sutton, Deanna A.; Thompson, Elizabeth H.; Weitzman, Irene; Otto, Randal A.; Ahuja, Sunil K.
1999-01-01
A 21-year-old woman suffered heatstroke and developed diarrhea while trekking across south Texas. The heatstroke was complicated by seizures, rhabdomyolysis, pneumonia, renal failure, and disseminated intravascular coagulation. The patient’s stool and blood cultures grew Campylobacter jejuni. The patient subsequently developed paranasal and gastrointestinal zygomycosis and required surgical debridement and a prolonged course of amphotericin B. The zygomycete cultured was Rhizopus schipperae. This is only the second isolate of R. schipperae that has been described. R. schipperae is characterized by the production of clusters of up to 10 sporangiophores arising from simple but well-developed rhizoids. These asexual reproductive propagules are produced on Czapek Dox agar but are absent on routine mycology media, where only chlamydospores are observed. Despite multiorgan failure, bacteremia, and disseminated zygomycosis, the patient survived and had a good neurological outcome. Heatstroke has not been previously described as a risk factor for the development of disseminated zygomycosis. PMID:10405417
Fungi from interior organs of free-living small mammals in Czechoslovakia and Yugoslavia.
Hubálek, Z; Rosický, B; Otcenásek, M
1980-01-01
A total of 308 fungi was isolated from interior organs (lungs, spleen, liver) of 529 small mammals belonging to 21 species, 7 families and 3 orders (Insectivora, Chiroptera, Rodentia), some of these being potentially pathogenic to vertebrates (e.g. Aspergillus flavus, A. fumigatus, Geotrichum candidum, Mucor pusillus, Rhizopus arrhizus). In one vole (Microtus arvalis) captured in South Moravia, adiaspiromycosis (Emmonsia crescens) was demonstrated. Comparison of mycoflora of hair and that of interior organs of wild small mammals revealed that out of the total number of isolates the following fungi were represented in a higher proportion from visceral organs than from the hair: Aspergillus (A. amstelodami, A. flavus, A. repens), Aureobasidium (A. pullulans), Candida, Cladosporium (C. herbarum), Cryptococcus, Fusarium, Gliocladium (G. deliquescens), Helminthosporium, Kloeckera, Mucor (M. fragilis, M. hiemalis, M. pusillus), Paecilomyces marquandii, Penicillium (P. purpurogenum), Phoma, Rhizopus arrhizus, Scopulariopsis (S. candida, S. koningii) and Torulopsis.
Cao, N.; Du, J.; Gong, C. S.; Tsao, G. T.
1996-01-01
An integrated system of simultaneous fermentation-adsorption for the production and recovery of fumaric acid from glucose by Rhizopus oryzae was investigated. The system was constructed such that growing Rhizopus mycelia were self-immobilized on the plastic discs of a rotary biofilm contactor during the nitrogen-rich growth phase. During the nongrowth, production phase, the biofilm was alternately exposed to liquid medium and air upon rotation of the discs in the horizontal fermentation vessel. The product of fermentation, fumaric acid, was removed simultaneously and continuously by a coupled adsorption column, thereby moderating inhibition, enhancing the fermentation rate, and sustaining cell viability. Another beneficial effect of the removal of fumaric acid is release of hydroxyl ions from a polyvinyl pyridine adsorbent into the circulating fermentation broth. This moderates the decrease in pH that would otherwise occur. Polyvinyl pyridine and IRA-900 gave the highest loading for this type of fermentation. This fermentation system is capable of producing fumaric acid with an average yield of 85 g/liter from 100 g of glucose per liter within 20 h under repetitive fed-batch cycles. On a weight yield basis, 91% of the theoretical maximum was obtained with a productivity of 4.25 g/liter/h. This is in contrast to stirred-tank fermentation supplemented with calcium carbonate, whose average weight yield was 65% after 72 h with a productivity of 0.9 g/liter/h. The immobilized reactor was operated repetitively for 2 weeks without loss of biological activity. PMID:16535381
Integrated genomics of Mucorales reveals novel therapeutic targets
USDA-ARS?s Scientific Manuscript database
Mucormycosis is a life-threatening infection caused by Mucorales fungi. We sequenced 30 fungal genomes and performed transcriptomics with three representative Rhizopus and Mucor strains with human airway epithelial cells during fungal invasion to reveal key host and fungal determinants contributing ...
The bioscouring performance of four polygalacturonase enzymes
USDA-ARS?s Scientific Manuscript database
Fourier Transform Infrared Attenuated Total Reflectance (FTIR-ATR) analyses of greige cotton fabrics bioscoured with a combination of ultrasound and endo- and exo-polygalacturonase enzymes obtained from Rhizopus sp. fungi were used in a fractional factorial design experiment to examine their perform...
Liu, Mingfu; Lin, Lin; Gebremariam, Teclegiorgis; Luo, Guanpingsheng; Skory, Christopher D.; French, Samuel W.; Chou, Tsui-Fen; Edwards, John E.; Ibrahim, Ashraf S.
2015-01-01
Dialysis patients with chronic renal failure receiving deferoxamine for treating iron overload are uniquely predisposed for mucormycosis, which is most often caused by Rhizopus oryzae. Although the deferoxamine siderophore is not secreted by Mucorales, previous studies established that Rhizopus species utilize iron from ferrioxamine (iron-rich form of deferoxamine). Here we determined that the CBS domain proteins of Fob1 and Fob2 act as receptors on the cell surface of R. oryzae during iron uptake from ferrioxamine. Fob1 and Fob2 cell surface expression was induced in the presence of ferrioxamine and bound radiolabeled ferrioxamine. A R. oryzae strain with targeted reduced Fob1/Fob2 expression was impaired for iron uptake, germinating, and growing on medium with ferrioxamine as the sole source of iron. This strain also exhibited reduced virulence in a deferoxamine-treated, but not the diabetic ketoacidotic (DKA), mouse model of mucormycosis. The mechanism by which R. oryzae obtains iron from ferrioxamine involves the reductase/permease uptake system since the growth on ferrioxamine supplemented medium is associated with elevated reductase activity and the use of the ferrous chelator bathophenanthroline disulfonate abrogates iron uptake and growth on medium supplemented with ferrioxamine as a sole source of iron. Finally, R. oryzae mutants with reduced copies of the high affinity iron permease (FTR1) or with decreased FTR1 expression had an impaired iron uptake from ferrioxamine in vitro and reduced virulence in the deferoxamine-treated mouse model of mucormycosis. These two receptors appear to be conserved in Mucorales, and can be the subject of future novel therapy to maintain the use of deferoxamine for treating iron-overload. PMID:25974051
Hattingh, M; Alexander, A; Meijering, I; van Reenen, C A; Dicks, L M T
2014-03-03
Good quality malt is characterised by the presence of high levels of fermentable sugars, amino acids and vitamins. To reach the starch-rich endosperm of the kernel, β-glucan- and arabinoxylan-rich cell walls have to be degraded. β-Glucanase is synthesized in vast quantities by the aleurone layer and scutellum during germination. Secretion of hydrolytic enzymes is often stimulated by addition of the plant hormone gibberellic acid (GA3) during germination. We have shown an enhanced β-glucanase and α-amylase activity in malt when germinating barley was inoculated with a combination of Lactobacillus plantarum B.S1.6 and spores of Aspergillus niger MH1, Rhizopus oligosporus MH2 or Trichoderma reesei MH3, and L. plantarum B.S1.6 combined with cell-free culture supernatants from each of these fungi. Highest malt β-glucanase activity (414 Units/kg malt) was recorded with a combination of L. plantarum B.S1.6 and spores of A. niger MH1. Highest α-amylase activities were recorded with a combination of L. plantarum B.S1.6 and spores of R. oligosporus MH2 (373 Ceralpha Units/g malt). Highest FAN levels were recorded when L. plantarum was inoculated in combination with spores of either R. oligosporus MH2 or T. reesei MH3 (259 and 260 ppm, respectively). This is the first study showing that cell-free culture supernatants of Aspergillus, Rhizopus and Trichoderma have a stimulating effect on β-glucanase and α-amylase production during malting. A combination of L. plantarum B.S1.6, and spores of A. niger MH1 and R. oligosporus MH2 may be used as starter cultures to enhance malt quality. Copyright © 2013 Elsevier B.V. All rights reserved.
Araújo, Maria Elisa Melo Branco de; Campos, Paula Renata Bueno; Alberto, Thiago Grando; Contesini, Fabiano Jares; Carvalho, Patrícia de Oliveira
The search for new biocatalysts has aroused great interest due to the variety of micro-organisms and their role as enzyme producers. Native lipases from Aspergillus niger and Rhizopus javanicus were used to enrich the n-3 long-chain polyunsaturated fatty acids content in the triacylglycerols of soybean oil by acidolysis with free fatty acids from sardine oil in solvent-free media. For the immobilization process, the best lipase/support ratios were 1:3 (w/w) for Aspergillus niger lipase and 1:5 (w/w) for Rhizopus javanicus lipase using Amberlite MB-1. Both lipases maintained constant activity for 6 months at 4°C. Reaction time, sardine-free fatty acids:soybean oil mole ratio and initial water content of the lipase were investigated to determine their effects on n-3 long-chain polyunsaturated fatty acids incorporation into soybean oil. Structured triacylglycerols with 11.7 and 7.2% of eicosapentaenoic acid+docosahexaenoic acid were obtained using Aspergillus niger lipase and Rhizopus javanicus lipase, decreasing the n-6/n-3 fatty acids ratio of soybean oil (11:1 to 3.5:1 and 4.7:1, respectively). The best reaction conditions were: initial water content of lipase of 0.86% (w/w), sardine-free faty acids:soybean oil mole ratio of 3:1 and reaction time of 36h, at 40°C. The significant factors for the acidolysis reaction were the sardine-free fatty acids:soybean oil mole ratio and reaction time. The characterization of structured triacylglycerols was obtained using easy ambient sonic-spray ionization mass spectrometry. The enzymatic reaction led to the formation of many structured triacylglycerols containing eicosapentaenoic acid, docosahexaenoic acid or both polyunsaturated fatty acids. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.
Hauke, K; Creemers, P; Brugmans, W; Van Laer, S
2004-01-01
Signum, a new fungicide developed by BASF, was applied during 6 successive years against fungal diseases in strawberries. The product is formulated as a water dispersible granule, containing 6.7 % pyraclostrobin and 26.7 % boscalid. Pyraclostrobin is similar in chemistry to other strobilurin fungicides like kresoxim-methyl and trifloxystrobin, registered for fruit disease control. Boscalid belongs to the class of carboxyanilides. Both components in the premix formulation combine two different biochemical modes of action in the fungal cell respiration. Therefore, this co-formulation gives a broad-spectrum activity and also a reduced resistance risk for different target pathogens. Botrytis cinerea is the most important disease on strawberry-fruits and thus the control of fruit rot is mainly focused on this fungus. In average over 6 years, Signum has not only given a very good control against Botrytis fruit rot, but it has also shown a high performance in the control of Colletotrichum. Besides, Signum provides good control of powdery mildew (Podosphaera aphanis) and limits the shift to other fruit rots like leather rot (Phytophthora cactorum and leak (Rhizopus, Mucor). The availability of several categories of fungicide families with a different mode of action gives opportunities in alternating different fungicides and is the best guarantee for a sustainable control of fruit rot in all kinds of strawberry production methods. Signum should be integrated in an overall disease management program. Trials, in which the applications of Signum were timed on disease forecasting, based on environmental factors favorable for Botrytis development, were very promising. This tool can also help in establishing the IPM-concept in the production of strawberries.
Verweij, P E; Smedts, F; Poot, T; Bult, P; Hoogkamp-Korstanje, J A; Meis, J F
1996-01-01
AIMS: To evaluate the performance of an immunoperoxidase stain using the monoclonal antibody EB-A1 to detect Aspergillus species in formalin fixed, paraffin wax embedded tissue. METHODS: The monoclonal antibody EB-A1 directed against galactomannan was used to detect Aspergillus species in 23 patients with suspected or confirmed invasive aspergillosis. Immunostaining was performed on formalin fixed, paraffin wax embedded tissue using the streptavidin-biotin method and compared with conventional haematoxylin and eosin, periodic acid-Schiff, and Gomori-Grocott stains. Results of immunostaining were semiquantitatively analysed with regard to both intensity of staining and number of positively staining micro-organisms. Tissue sections from 16 patients with confirmed invasive mycoses due to Candida species, Apophysomyces elegans, Rhizopus oryzae, Pseudallescheria boydii and Histoplasma capsulatum were used as controls. RESULTS: In 19 (83%) of 23 cases invasive aspergillosis was confirmed by both histological examination and culture (18 Aspergillus fumigatus and one A flavus). Immunoperoxidase stains were positive in 17 (89%) of 19 cases including one case of disseminated infection due to A flavus. Furthermore, the immunoperoxidase stain was positive in a culture negative tissue section with histological evidence of mycelial development, indicating the presence of Aspergillus species. Some cross-reactivity was observed with the highly related fungus P boydii, although the number of mycelial elements that stained was low. CONCLUSIONS: Immunoperoxidase staining using the monoclonal antibody EB-A1 performs well on routinely processed tissue sections and permits detection and generic identification of Aspergillus species, although it was no better than conventional histopathology in identifying the presence of an infection. An additional advantage is that the immunostain may help to provide an aetiological diagnosis when cultures remain negative. Images PMID:8943743
Lü, Yucai; Gong, Yanli; Li, Yajie; Pan, Zejiang; Yao, Yi; Li, Ning; Guo, Jinling; Gong, Dachun; Tian, Yihong; Peng, Caiyun
2017-08-28
Two typical microbial communities from Chinese rice wine fermentation collected in Yichang city and Suzhou city in China were investigated. Both communities could ferment glutinous rice to rice wine in 2 days. The sugar and ethanol contents were 198.67 and 14.47 mg/g, respectively, for rice wine from Yichang city, and 292.50 and 12.31 mg/g, respectively, for rice wine from Suzhou city. Acetic acid and lactic acid were the most abundant organic acids. Abundant fungi and bacteria were detected in both communities by high-throughput sequencing. Saccharomycopsis fibuligera and Rhizopus oryzae were the dominant fungi in rice wine from Suzhou city, compared with R. oryzae , Wickerhamomyces anomalus, Saccharomyces cerevisiae, Mucor indicus , and Rhizopus microsporus in rice wine from Yichang city. Bacterial diversity was greater than fungal diversity in both communities. Citrobacter was the most abundant genus. Furthermore, Exiguobacterium, Aeromonas, Acinetobacter, Pseudomonas, Enterobacter, Bacillus , and Lactococcus were highly abundant in both communities.
Enhancement of L(+)-Lactic Acid Production of Immobilized Rhizopus Oryzae Implanted by Ion Beams
NASA Astrophysics Data System (ADS)
Fan, Yonghong; Yang, Yingge; Zheng, Zhiming; Li, Wen; Wang, Peng; Yao, Liming; Yu, Zengliang
2008-02-01
Immobilized Rhizopus oryzae culturing may be a solution to the inhibited production of L(+)-lactic acid in submerged fermentation, which is caused by aggregated mycelia floc. In the present study, a R. oryzae mutant (RL6041) with a 90% conversion rate of glucose into L-lactic acid was obtained by N+ implantation under the optimized conditions of a beam energy of 15 keV and a dose of 2.6 × 1015 ions/cm2. Using polyurethane foam as the immobilization matrix, the optimal L-lactic acid production conditions were determined as 4 mm polyurethane foam, 150 r/min, 50 g/L ~ 80 g/L of initial glucose, 38°C and pH 6.0. 15-cycle repeated productions of L-lactic acid by immobilized RL6041 were performed under the optimized culturing conditions and over 80% of the glucose was converted into L-lactic acid in 30 hours on average. The results show that immobilized RL6041 is a promising candidate for continuous L-lactic acid production.
Metalaxyl Degradation by Mucorales Strains Gongronella sp. and Rhizopus oryzae.
Martins, Maria Rosário; Santos, Cledir; Pereira, Pablo; Cruz-Morais, Júlio; Lima, Nelson
2017-12-14
In this study, the degradation of metalaxyl was investigated in the presence of two Mucorales strains, previously isolated from soil subjected to repeated treatments with this fungicide and selected after enrichment technique. Fungal strains were characterised by a polyphasic approach using phylogenetic analysis of the Internal Transcribed Spacer (ITS) gene region, phenotypic characterisation by Matrix-Assisted Laser Desorption Ionization Time-Of-Flight Mass Spectrometry (MALDI-TOF MS) spectral analysis, and growth kinetics experiments. The strains were identified as Gongronella sp. and Rhizopus oryzae . The fungal growth kinetics in liquid cultures containing metalaxyl fits with Haldane model. Under laboratory conditions, the ability of Gongronella sp. and R. oryzae cultures to degrade metalaxyl was evaluated in liquid cultures and soil experiments. Both species were able to: (a) use metalaxyl as the main carbon and energy source; and (b) degrade metalaxyl in polluted soils, with rates around 1.0 mg kg - ¹ d - ¹. This suggests these strains could degrade metalaxyl in soils contaminated with this fungicide.
Siderophore production by pathogenic mucorales and uptake of deferoxamine B.
Larcher, Gérald; Dias, Marylène; Razafimandimby, Bienvenue; Bomal, Danielle; Bouchara, Jean-Philippe
2013-12-01
Clinical reports have established that mucormycosis, mainly caused by Rhizopus spp., frequently occurs in patients treated with deferoxamine B (DFO, Desferal(®)) which is misappropriated by these fungi. Siderophore production by twenty mucoralean isolates was therefore investigated using a commercial iron-depleted culture medium. Siderophore production was detected for most of the isolates. Our experiments confirmed that feroxamine B (iron chelate of DFO) promoted in vitro growth of Rhizopus arrhizus. Electrophoretic analysis of somatic extracts revealed iron-regulated proteins of 60 and 32 kDa which were lacking in iron-depleted culture conditions. Using a fluorescent derivative of deferoxamine B, we showed by fluorescence microscopy the entry of the siderophore within the fungal cells, thus suggesting a shuttle mechanism encompassing the uptake of the entire siderophore-ion complex into the cell. This useful tool renders possible a better understanding of iron metabolism in Mucorales which could lead to the development of new diagnostic method or new antifungal therapy using siderophores as imaging contrast agents or active drug vectors.
Khaskheli, Abid Ali; Talpur, Farah Naz; Cebeci Aydin, Aysun; Jawaid, Sana; Surhio, Muhammad Ali; Afridi, Hassan Imran
2017-10-01
Conjugated linoleic acid (CLA) has attracted as novel type of fatty acids having unusual health-promoting properties such as anticarcinogenic and antiobesitic effects. The present work employed castor oil as substrate for one-pot production of CLA using washed cells of Lactobacillus plantarum (L. plantarum) and lipases as catalysts. Among the screened lipases, the lipase Rhizopus oryzae (ROL) greatly assisted resting cells to produce CLA. Mass spectral analysis of the product showed that two major isomers of CLA were produced in the reaction mixture i.e. cis-9, trans-11 56.55% and trans-10, cis-12 43.45%. Optimum factors for CLA synthesis were found as substrate concentration (8 mg/mL), pH (6.5), washed cell concentration (12% w/v), and incubation time of 20 h. Hence, the combination of ROL with L. plantarum offers one pot production of CLA selectively using castor oil as a cost-effective substrate.
Wang, Yilun; Zhu, Min; Bao, Yunqi; Li, Li; Zhu, Liping; Li, Feng; Xu, Jinhua; Liang, Jun
2018-06-01
Cutaneous mucormycosis is an uncommon disease and occurs rarely in immunocompetent patients. We reported the case of a 37-year-old man presenting with a skin lesion on the left side of the chest wall with no history of trauma or primary diseases. He was firstly misdiagnosed as tuberculosis and the proper treatment was thus delayed. Histopathological examination and fungal culture of the lesion confirmed cutaneous mucormycosis. The isolate was identified as Rhizopus microspores by ITS sequencing. The patient was treated with oral posaconazole 400 mg bid for 150 days. The patient recovered satisfactorily. No recurrence was found during the follow-up and no side effect of liver function was found. This case helps doctors to consider the possibility of serious fungal infection in immunocompetent patients. It also suggested that posaconazole could be an alternative choice for the treatment of mucormycosis considering the severe side effect of Amphotericin B.
Navarro López, Elvira; Robles Medina, Alfonso; González Moreno, Pedro Antonio; Esteban Cerdán, Luis; Martín Valverde, Lorena; Molina Grima, Emilio
2016-03-01
Biodiesel (fatty acid methyl esters, FAMEs) was produced from saponifiable lipids (SLs) extracted from wet Nannochloropsis gaditana biomass using methanolysis catalyzed by Rhizopus oryzae intracellular lipase. SLs were firstly extracted with ethanol to obtain 31 wt% pure SLs. But this low SL purity also gave a low biodiesel conversion (58%). This conversion increased up to 80% using SLs purified by crystallization in acetone (95 wt% purity). Polar lipids play an important role in decreasing the reaction velocity - using SLs extracted with hexane, which have lower polar lipid content (37.4% versus 49.0% using ethanol), we obtained higher reaction velocities and less FAME conversion decrease when the same lipase batch was reused. 83% of SLs were transformed to biodiesel using a 70 wt% lipase/SL ratio, 11:1 methanol/SL molar ratio, 10 mL t-butanol/g SLs after 72 h. The FAME conversion decreased to 71% after catalyzing three reactions with the same lipase batch. Copyright © 2015 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sag, Y.; Atacoglu, I.; Kutsal, T.
1999-12-01
The simultaneous biosorption of Cr(VI) and Cu(II) on free Rhizopus arrhizus in a packed column operated in the continuous mode was investigated and compared to the single metal ion situation. The breakthrough curves were measured as a function of feed flow rate, feed pH, and different combinations of metal ion concentrations in the feed solutions. Column competitive biosorption data were evaluated in terms of the maximum (equilibrium) capacity in the column, the amount of metal loading on the R. arrhizus surface, the adsorption yield, and the total adsorption yield. In the single-ion situation the adsorption isotherms were developed for optimummore » conditions, and it was seen that the adsorption equilibrium data fit the noncompetitive Freundlich model. For the multicomponent adsorption equilibrium the competitive adsorption isotherms were also developed. The competitive Freundlich model for binary metal mixtures represented most the column adsorption equilibrium data of Cr(VI) and Cu(II) on R. arrhizus satisfactorily.« less
Rani, Richa; Ghosh, Sanjoy
2011-11-01
Present study introduces linseed oil cake as a novel substrate for phytase production by Rhizopus oryzae. Statistical approach was employed to optimize various medium components under solid state fermentation (SSF). An overall 8.41-fold increase in phytase production was achieved at the optimum concentrations (w/w, mannitol, 2.05%; ammonium sulfate, 2.84% and phosphate, 0.38%). Further enhancement by 59% was observed due to a novel strain improvement approach. Purified phytase (∼34 kDa) showed optimal temperature of 45 °C, dual pH optima at 1.5 and 5.5 and possesses high catalytic efficiency (2.38×10(6) M(-1) s(-1)). Characterization study demonstrates the phytase as highly thermostable and resistant to proteolysis, heavy metal ions, etc. Furthermore, an improved HPLC method was introduced to confirm the ability of phytase to degrade phytic acid completely and was found to be an efficient method. Copyright © 2011. Published by Elsevier Ltd.
Protein enrichment of brewery spent grain from Rhizopus oligosporus by solid-state fermentation.
Canedo, Marianny Silva; de Paula, Fernanda Gomes; da Silva, Flávio Alves; Vendruscolo, Francielo
2016-07-01
Brewery spent grain represents approximately 85 % of total by-products generated in a brewery. Consisting of carbohydrates, fiber, minerals and low amounts of protein, the use of brewery spent grain is limited to the feeding of ruminants; however, its potential use should be investigated. The reuse of this by-product using microorganisms by solid-state fermentation process as the case of protein enrichment by single-cell protein incorporation is an alternative to ensure sustainability and generate commercially interesting products. In this context, the aim of this study was to grow Rhizopus oligosporus in brewery spent grain under different initial moisture contents and nitrogen sources to increase the protein content of the fermented material. After 7 days of fermentation, increase of 2-4 times in the crude protein and soluble protein content was verified, respectively, compared to unfermented brewery spent grain. The kinetics of protein enrichment demonstrated the possibility of application of this technique, which can be a great alternative for use in diets for animals.
de Bruijn, Wouter J C; Vincken, Jean-Paul; Duran, Katharina; Gruppen, Harry
2016-08-17
Benzoxazinoids function as defense compounds and have been suggested to possess health-promoting effects. In this work, the mass spectrometric behavior of benzoxazinoids from the classes benzoxazin-3-ones (with subclasses lactams, hydroxamic acids, and methyl derivatives) and benzoxazolinones was studied. Wheat seeds were germinated with simultaneous elicitation by Rhizopus. The seedling extract was screened for the presence of benzoxazinoid (glycosides) using reversed-phase ultra-high-performance liquid chromatography with photodiode array detection coupled in line to multiple-stage mass spectrometry (RP-UHPLC-PDA-MS(n)). Benzoxazin-3-ones from the different subclasses showed distinctly different ionization and fragmentation behaviors. These features were incorporated into a newly proposed decision guideline to aid the classification of benzoxazinoids. Glycosides of the methyl derivative 2-hydroxy-4-methoxy-1,4-benzoxazin-3-one were tentatively identified for the first time in wheat. We conclude that wheat seedlings germinated with simultaneous fungal elicitation contain a diverse array of benzoxazinoids, mainly constituted by benzoxazin-3-one glycosides.
Fu, Yong-Qian; Yin, Long-Fei; Zhu, Hua-Yue; Jiang, Ru
2016-10-01
In this study, lactic acid fermentation by Rhizopus oryzae was investigated using the two different fermentation strategies of one-step fermentation (OSF) and conventional fermentation (CF). Compared to CF, OSF reduced the demurrage of the production process and increased the production of lactic acid. However, the qp was significantly lower than during CF. Based on analysis of μ, qs and qp, a novel modified OSF strategy was proposed. This strategy aimed to achieve a high final concentration of lactic acid, and a high qp by R. oryzae. In this strategy, the maximum lactic acid concentration and productivity of the lactic acid production stage reached 158g/l and 5.45g/(lh), which were 177% and 366% higher, respectively, than the best results from CF. Importantly, the qp and yield did not decrease. This strategy is a convenient and economical method for l-lactic acid fermentation by R. oryzae. Copyright © 2016 Elsevier Ltd. All rights reserved.
Yamada, Osamu; Sakamoto, Kazutoshi; Tominaga, Mihoko; Nakayama, Tasuku; Koseki, Takuya; Fujita, Akiko; Akita, Osamu
2005-03-01
We carried out protein sequencing of purified Antibiotic Peptide (ABP), and cloned two genes encoding this peptide as abp1 and abp2, from Rhizopus oligosporus NBRC 8631. Both genes contain an almost identical 231-bp segment, with only 3 nucleotide substitutions, encoding a 77 amino acid peptide. The abp gene product comprises a 28 amino acid signal sequence and a 49 amino acid mature peptide. Northern blot analysis showed that at least one of the abp genes is transcribed in R. oligosporus NBRC 8631. A truncated form of abp1 encoding only the mature peptide was fused with the alpha-factor signal peptide and engineered for expression in Pichia pastoris SMD1168H. Culture broth of the recombinant Pichia displayed ABP activity against Bacillus subtilis NBRC 3335 after induction of heterologous gene expression. This result indicates that mature ABP formed the active structure without the aid of other factors from R. oligosporus, and was secreted.
Subsite binding energies of an exo-polygalacturonase using isothermal titration calorimetry
USDA-ARS?s Scientific Manuscript database
Thermodynamic parameters for binding of a series of galacturonic acid oligomers to an exo-polygalacturonase, RPG16 from Rhizopus oryzae, were determined by isothermal titration calorimetry. Binding of oligomers varying in chain length from two to five galacturonic acid residues is an exothermic proc...
USDA-ARS?s Scientific Manuscript database
The effects of different mycorrhizal fungi species (Rhizopus intraradices, Gigapora margarita, Glomus geosporum, Paraglomus occultum, Claroideoglomus claroideum, white Glomus species) on their ability to colonize leek roots (Allium porrum) and the effect of symbiosis on changes in the levels of poly...
In Vitro Activity of Isavuconazole and Comparators against Clinical Isolates of the Mucorales Order
Jensen, Rasmus Hare; Meletiadis, Joseph
2015-01-01
The in vitro activity of isavuconazole against Mucorales isolates measured by EUCAST E.Def 9.2 and CLSI M38-A2 methodologies was investigated in comparison with those of amphotericin B, posaconazole, and voriconazole. Seventy-two isolates were included: 12 of Lichtheimia corymbifera, 5 of Lichtheimia ramosa, 5 of group I and 9 of group II of Mucor circinelloides, 9 of Rhizomucor pusillus, 26 of Rhizopus microsporus, and 6 of Rhizopus oryzae. Species identification was confirmed by internal transcribed spacer (ITS) sequencing. EUCAST MICs were read on day 1 (EUCAST-d1) and day 2 (EUCAST-d2), and CLSI MICs were read on day 2 (CLSI-d2). Isavuconazole MIC50s (range) (mg/liter) by EUCAST-d1, CLSI-d2, and EUCAST-d2 were 1 (0.125 to 16), 1 (0.125 to 2), and 4 (0.5 to >16), respectively, across all isolates. The similar values for comparator drugs were as follows: posaconazole, 0.25 (≤0.03 to >16), 0.25 (0.06 to >16), and 1 (0.06 to >16); amphotericin, 0.06 (≤0.03 to 0.5), 0.06 (≤0.03 to 0.25), and 0.125 (≤0.03 to 1); voriconazole, 16 (2 to >16), 8 (1 to >16), and >16 (8 to >16), respectively. Isavuconazole activity varied by species: Lichtheimia corymbifera, 1 (0.5 to 2), 1 (1 to 2), and 2 (1 to 4); Lichtheimia ramosa, 0.25 (0.125 to 0.5), 1 (0.5 to 2), and 2 (0.5 to 4); Rhizomucor pusillus, 0.5 (0.5 to 1), 1 (0.125 to 1), and 2 (1 to 2); Rhizopus microsporus, 1 (0.5 to 4), 0.5 (0.125 to 1), and 4 (1 to 8); and Rhizopus oryzae, 1 (0.5 to 4), 1 (0.125 to 2), and 4 (0.5 to 8), respectively, were more susceptible than Mucor circinelloides: group I, 8 (4 to 8), 4 (2 to 4), and 16 (2 to 16), respectively, and group II, 8 (1 to 16), 8 (1 to 8), and 16 (4 to >16), respectively. This was also observed for posaconazole. The essential agreement was best between EUCAST-d1 and CLSI-d2 (75% to 83%). Isavuconazole displayed in vitro activity against Mucorales isolates with the exception of Mucor circinelloides. The MICs were in general 1 to 3 steps higher than those for posaconazole. However, in the clinical setting this may be compensated for by the higher exposure at standard dosing. PMID:26438494
The Effect of Hyperbaric Oxygen on the Growth of Rhizopus nigricans.
1980-12-01
identify by block number) Impression Chamber Medical Mycology Oxygen Therapy (ompression Therapy Mucor Phycomycosis hvp)erbaric Medicine Mucormycosis...rado. 3. Cai rnev, W. J. 1980. The effect of hyperbaric oxygen on the growth of Mucor sp. and Aspergillus fumigLatus. Technical Report FJSRL-TR- 80
NASA Astrophysics Data System (ADS)
Duringer, Philippe; Schuster, Mathieu; Genise, Jorge F.; Likius, Andossa; Mackaye, Hassan Taisso; Vignaud, Patrick; Brunet, Michel
2006-12-01
Higher termites of the subfamily Macrotermitinae (fungus-growing termites) are known to build fungus gardens where a symbiotic fungus ( Termitomyces sp.) is cultivated. The fungus grows on a substrate called fungus comb, a structure built with the termites’ own faeces. Here we present the first fossil fungus combs ever found in the world. They were extracted from 7-million-year-old continental sandstone (Chad basin). Fossilized fungus combs have an ovoid morphology with a more or less flattened concave base and a characteristic general alveolar aspect. Under lens, they display a typical millimetre-scale pelletal structure. The latter, as well as the general shape and alveolar aspect, are similar to the morphology of fungus combs from extant fungus-growing termites.
Gastroenteritis outbreak associated with unpasteurized tempeh, North Carolina, USA.
Griese, Stephanie E; Fleischauer, Aaron T; MacFarquhar, Jennifer K; Moore, Zackary; Harrelson, Cris; Valiani, Anita; Morrison, Sue Ellen; Sweat, David; Maillard, Jean-Marie; Griffin, Denise; Springer, Debra; Mikoleit, Matthew; Newton, Anna E; Jackson, Brendan; Nguyen, Thai-An; Bosch, Stacey; Davies, Megan
2013-01-01
During an investigation of an outbreak of gastroenteritis caused by Salmonella enterica serovar Paratyphi B variant L(+) tartrate(+), we identified unpasteurized tempeh as a novel food vehicle and Rhizopus spp. starter culture as the source of the contamination. Safe handling of uncooked, unpasteurized tempeh should be emphasized for prevention of foodborne illnesses.
USDA-ARS?s Scientific Manuscript database
In September 2012, a female parental line in a Yolo, CA in sunflower seed-production field began displaying external stem symptoms that could not be attributed to any known disease. Symptoms appeared to be associated with tunneling caused by an un-identified insect. Stems were collected and Rhizopu...
Sterols isolated from Nuruk (Rhizopus oryzae KSD-815) inhibit the migration of cancer cells.
Lee, Dae-Young; Lee, Sang-Jin; Kwak, Ho-Young; Jung, Lakoon; Heo, Jieun; Hong, Sungyoul; Kim, Gye-Won; Baek, Nam-In
2009-11-01
An activity-guided fractionation method was used to isolate anticancer components from Nuruk (Rhizopus oryzae KSD-815:KSD-815). Dried powder of KSD-815 was extracted with 80% methanol and partitioned successively using nhexane, ethyl acetate, n-butanol, and water. The n-hexane and n-butanol fractions showed a strong antimigratory effect on human cancer cells. Both of these fractions were subjected to separation and purification procedures using silica gel, octadecyl silica gel, and Sephadex LH-20 column chromatographies to afford four purified compounds. These were identified as ergosterol peroxide (1), stigmast- 5-en-3beta,7beta-diol (2), ergosta-7,22-dien-3beta,5alpha,6beta,9alpha-tetraol (3), and daucosterol (4), respectively, by spectroscopic methods such as nuclear magnetic resonance spectrometry, mass spectrometry, and infrared spectroscopy, and comparison with those in the literature. Compounds 1-4 were isolated from KSD-815 for the first time. Compounds 1 and 4 inhibited the migration of MDA-MB-231 cells at concentrations lower than 20 micronM.
Fu, Yongqian; Sun, Xiaolong; Zhu, Huayue; Jiang, Ru; Luo, Xi; Yin, Longfei
2018-05-21
In previous work, we proposed a novel modified one-step fermentation fed-batch strategy to efficiently generate L-lactic acid (L-LA) using Rhizopus oryzae. In this study, to further enhance efficiency of L-LA production through one-step fermentation in fed-batch cultures, we systematically investigated the initial peptone- and glucose-feeding approaches, including different initial peptone and glucose concentrations and maintained residual glucose levels. Based on the results of this study, culturing R. oryzae with initial peptone and glucose concentrations of 3.0 and 50.0 g/l, respectively, using a fed-batch strategy is an effective approach of producing L-LA through one-step fermentation. Changing the residual glucose had no obvious effect on the generation of L-LA. We determined the maximum LA production and productivity to be 162 g/l and 6.23 g/(l·h), respectively, during the acid production stage. Compared to our previous work, there was almost no change in L-LA production or yield; however, the productivity of L-LA increased by 14.3%.
Pan, Xinrong; Liu, Huanhuan; Liu, Jiao; Wang, Cheng; Wen, Jianping
2016-12-01
In order to relieve the toxicity of furfural on Rhizopus oryzae fermentation, the molecular mechanism of R. oryzae responding to furfural stress for fumaric acid-production was investigated by omics-based approaches. In metabolomics analysis, 29 metabolites including amino acid, sugars, polyols and fatty acids showed significant changes for maintaining the basic cell metabolism at the cost of lowering fumaric acid production. To further uncover the survival mechanism, lipidomics was carried out, revealing that phosphatidylcholine, phosphatidylglycerol, phosphatidylinositol and polyunsaturated acyl chains might be closely correlated with R. oryzae's adapting to furfural stress. Based on the above omics analysis, lecithin, inositol and soybean oil were exogenously supplemented separately with an optimized concentration in the presence of furfural, which increased fumaric acid titer from 5.78g/L to 10.03g/L, 10.05g/L and 12.13g/L (increased by 73.5%, 73.8% and 110%, respectively). These findings provide a methodological guidance for hemicellulose-fumaric acid development. Copyright © 2016 Elsevier Ltd. All rights reserved.
Ben-Ami, Ronen; Lewis, Russell E; Tarrand, Jeffrey; Leventakos, Konstantinos; Kontoyiannis, Dimitrios P
2010-01-01
In immunosuppressed hosts, mucormycosis is a life-threatening infection with few treatment options. We studied the activity of colistin (polymyxin E) against Mucorales species in vitro and in a murine model of pulmonary Rhizopus oryzae infection. Colistin exhibited fungicidal activity in vitro against Mucorales spores and mycelia. At the colistin MIC, initial R. oryzae hyphal damage was followed by rapid regrowth; however, regrowth was prevented by combining colistin with a subinhibitory concentration of amphotericin B. Using electron microscopy and FM4-64 staining, we demonstrated that colistin disrupts R. oryzae cytoplasmic and vacuolar membranes, resulting in the leakage of intracellular contents. The prophylactic intranasal treatment of immunosuppressed mice with colistimethate significantly reduced the mortality rate and pulmonary fungal burden resulting from inhalational challenge with R. oryzae spores, whereas intraperitoneal colistimethate treatment had no effect. We conclude that colistin has modest in vitro and in vivo fungicidal activity against Mucorales spp. Further studies are warranted to assess the use of this drug in the prevention and treatment of mucormycosis.
Ben-Ami, Ronen; Lewis, Russell E.; Tarrand, Jeffrey; Leventakos, Konstantinos; Kontoyiannis, Dimitrios P.
2010-01-01
In immunosuppressed hosts, mucormycosis is a life-threatening infection with few treatment options. We studied the activity of colistin (polymyxin E) against Mucorales species in vitro and in a murine model of pulmonary Rhizopus oryzae infection. Colistin exhibited fungicidal activity in vitro against Mucorales spores and mycelia. At the colistin MIC, initial R. oryzae hyphal damage was followed by rapid regrowth; however, regrowth was prevented by combining colistin with a subinhibitory concentration of amphotericin B. Using electron microscopy and FM4-64 staining, we demonstrated that colistin disrupts R. oryzae cytoplasmic and vacuolar membranes, resulting in the leakage of intracellular contents. The prophylactic intranasal treatment of immunosuppressed mice with colistimethate significantly reduced the mortality rate and pulmonary fungal burden resulting from inhalational challenge with R. oryzae spores, whereas intraperitoneal colistimethate treatment had no effect. We conclude that colistin has modest in vitro and in vivo fungicidal activity against Mucorales spp. Further studies are warranted to assess the use of this drug in the prevention and treatment of mucormycosis. PMID:19858263
Kumar, Vinod; Jahan, Firdaus; Kameswaran, Karthikeya; Mahajan, Richi V; Saxena, Rajendra Kumar
2014-06-01
Lipase-mediated synthesis of phenolic acid esters is a green and economical alternative to current chemical methods. Octyl methoxycinnamate, an important UVB-absorbing compound, was synthesized by the esterification of p-methoxycinnamic acid with 2-ethyl hexanol using Rhizopus oryzae lipase. A molar ratio of 1:2 of p-methoxycinnamic acid and 2-ethyl hexanol was found to give an optimum yield using cyclo-octane (50 ml) as reaction solvent, at a temperature of 45 °C, and 750 U of lipase, resulting in a yield of 91.3 % in 96 h. This reaction was successfully scaled up to 400-ml reaction size where 88.6 %bioconversion was achieved. The synthesized compound was found to have superior antioxidant activity as compared to ascorbic acid. The synthesized compound also exhibited good antimicrobial activity against Escherichia coli, Klebsiella pneumonia, Salmonella typhi, Staphylococcus aures, Candida albicans (yeast), Aspergillus niger, Alternaria solani, and Fussarium oxysporum by well diffusion method in terms of zone of inhibitions (in mm).
Dulf, Francisc Vasile; Vodnar, Dan Cristian; Socaciu, Carmen
2016-10-15
Evolutions of phenolic contents and antioxidant activities during solid-state fermentation (SSF) of plum pomaces (from the juice industry) and brandy distillery wastes with Aspergillus niger and Rhizopus oligosporus were investigated. The effect of fermentation time on the oil content and major lipid classes in the plum kernels was also studied. Results showed that total phenolic (TP) amounts increased by over 30% for SSF with Rhizopus oligosporus and by >21% for SSF with A. niger. The total flavonoid contents presented similar tendencies to those of the TPs. The free radical scavenging activities of methanolic extracts were also significantly enhanced. The HPLC-MS analysis showed that quercetin-3-glucoside was the major phenolic compound in both fermented plum by-products. The results also demonstrated that SSF not only helped to achieve higher lipid recovery from plum kernels, but also resulted in oils with better quality attributes (high sterol ester and n-3 PUFA-rich polar lipid contents). Copyright © 2016 Elsevier Ltd. All rights reserved.
Rodrigues, J; Canet, A; Rivera, I; Osório, N M; Sandoval, G; Valero, F; Ferreira-Dias, S
2016-08-01
The aim of this study was to evaluate the feasibility of biodiesel production by transesterification of Jatropha oil with methanol, catalyzed by non-commercial sn-1,3-regioselective lipases. Using these lipases, fatty acid methyl esters (FAME) and monoacylglycerols are produced, avoiding the formation of glycerol as byproduct. Heterologous Rhizopus oryzae lipase (rROL) immobilized on different synthetic resins and Carica papaya lipase (rCPL) immobilized on Lewatit VP OC 1600 were tested. Reactions were performed at 30°C, with seven stepwise methanol additions. For all biocatalysts, 51-65% FAME (theoretical maximum=67%, w/w) was obtained after 4h transesterification. Stability tests were performed in 8 or 10 successive 4h-batches, either with or without rehydration of the biocatalyst between each two consecutive batches. Activity loss was much faster when biocatalysts were rehydrated. For rROL, half-life times varied from 16 to 579h. rROL on Lewatit VPOC 1600 was more stable than for rCPL on the same support. Copyright © 2016 Elsevier Ltd. All rights reserved.
Massarolo, Kelly Cristina; Denardi de Souza, Taiana; Collazzo, Carolina Carvalho; Badiale Furlong, Eliana; Souza Soares, Leonor Almeida de
2017-08-01
This study evaluated the effect of the solid state cultivation (SSC) time of rice bran by Rhizopus oryzae on γ-oryzanol recovery and its antioxidant properties. Gamma-oryzanol was extracted with organic solvents and its extracts were characterized by GC-FID and HPLC-UV. The antioxidant capacity was assessed by DPPH and ABTS + assays, β-carotene/linoleic acid system, and reduction of oxidation in lipid system. The biomass showed the γ-oryzanol recovery increased by 51.5% (20.52mg/g), and 5.7% in polyunsaturated fatty acids. The γ-oryzanol major components changing in their profile. The γ-oryzanol extract from biomass (72h) showed the greatest DPPH inhibition (59.0%), while 90.5% inhibition of oxidation of β-carotene/linoleic acid system, and 30% reduction of the indicators of oxidation in olive oil was observed in the one cultivated at 96h, these behaviors were confirmed by PCA analyses. SSC provides an increase in the γ-oryzanol recovery followed by improving of the functional properties of rice bran. Copyright © 2017 Elsevier Ltd. All rights reserved.
Botton, Vanderleia; Piovan, Leandro; Meier, Henry França; Mitchell, David Alexander; Cordova, Jesús; Krieger, Nadia
2018-04-01
A fermented solid containing lipases was produced by solid-state fermentation of Rhizopus microsporus on sugarcane bagasse enriched with urea, soybean oil, and a mineral solution. The dry fermented solid produced using R. microsporus (RMFS) was used to catalyze the synthesis of alkyl-esters by esterification in a solvent-free system containing ethanol and oleic acid (as a model system) or a mixture of fatty acids obtained from the physical hydrolysis of soybean soapstock acid oil (FA-SSAO) in subcritical water. The conversions were 93.5 and 84.1%, for oleic acid and FA-SSAO, respectively, at 48 h and 40 °C, at a molar ratio (MR) of ethanol to fatty acid of 5:1. A further increase in the MR to 10:1 improved the production of ethylic-esters, giving conversions at 48 h of 98 and 86% for oleic acid and FA-SSAO, respectively. The results obtained in this work foster further studies on scaling-up of an environmentally friendly process to produce biofuels.
Hiol; Jonzo; Rugani; Druet; Sarda; Comeau
2000-03-01
We have isolated a lipolytic strain from palm fruit that was identified as a Rhizopus oryzae. Culture conditions were optimized and highest lipase production amounting to 120 U/ml was achieved after 4 days of cultivation. The extracellular lipase was purified 1200-fold by ammonium sulfate precipitation, sulphopropyl-Sepharose chromatography, Sephadex G 75 gel filtration and a second sulphopropyl-Sepharose chromatography. The specific activity of the purified enzyme was 8800 U/mg. The lipolytic enzyme has a molecular mass of 32 kDa by SDS-polyacrylamide gel electrophoresis and gel filtration. The enzyme exhibited a single band in active polyacrylamide gel electrophoresis and its isoelectric point was 7.6. Analysis of Rhizopus oryzae lipase by RP-HPLC confirmed the homogeneity of the enzyme preparation. Determination of the N-terminal sequence over 19 amino acid residues showed a high homology with lipases of the same genus. The optimum pH for enzyme activity was 7.5. Lipase was stable in the pH range from 4.5 to 7.5. The optimum temperature for lipase activity was 35 degrees C and about 65% of its activity was retained after incubation at 45 degrees C for 30 min. The lipolytic enzyme was inhibited by Triton X100, SDS, and metal ions such as Fe(3+), Cu(2+), Hg(2+) and Fe(2+). Lipase activity against triolein was enhanced by sodium cholate or taurocholate. The purified lipase had a preference for the hydrolysis of saturated fatty acid chains (C(8)-C(18)) and a 1, 3-position specificity. It showed a good stability in organic solvents and especially in long chain-fatty alcohol. The enzyme poorly hydrolyzed triacylglycerols containing n-3 polyunsaturated fatty acids, and appeared as a suitable biocatalyst for selective esterification of sardine free fatty acids with hexanol as substrate. About 76% of sardine free fatty acids were esterified after 30 h reaction whereas 90% of docosahexaenoic acid (DHA) was recovered in the unesterified fatty acids.
Biological removal of arsenic pollution by soil fungi.
Srivastava, Pankaj Kumar; Vaish, Aradhana; Dwivedi, Sanjay; Chakrabarty, Debasis; Singh, Nandita; Tripathi, Rudra Deo
2011-05-15
Fifteen fungal strains were isolated from arsenic contaminated (range 9.45-15.63 mg kg(-1)) agricultural soils from the state of West Bengal, India. Five fungal strains were belonged to the Aspergillus and Trichoderma group each, however, remaining five were identified as the Neocosmospora, Sordaria, Rhizopus, Penicillium and sterile mycelial strain. All these fungal strains were cultivated on medium supplemented with 100, 500, 1000, 5000 and 10,000 mg l(-1) of sodium arsenate. After 30-day cultivation under laboratory conditions, radial growth of these strains was determined and compared with control. Toxicity and tolerance of these strains to arsenate were evaluated on the basis of tolerance index. Out of fifteen, only five fungal strains were found resistant and survived with tolerance index pattern as 0.956 (sterile mycelial strain)>0.311 (Rhizopus sp.)>0.306 (Neocosmospora sp.)>0.212 (Penicillium sp.)>0.189 (Aspergillus sp.) at 10,000 mg l(-1) of arsenate. The arsenic removal efficacy of ten fungal strains, tolerant to 5000 mg l(-1) arsenate, was also assayed under laboratory conditions for 21 days. All these strains were cultivated individually on mycological broth enriched with 10 mg l(-1) of arsenic. The initial and final pH of cultivating medium, fungal biomass and removal of arsenic by each fungal strain were evaluated. Fungal biomass of ten strains removed arsenic biologically from the medium which were ranged from 10.92 to 65.81% depending on fungal species. The flux of biovolatilized arsenic was determined indirectly by estimating the sum of arsenic content in fungal biomass and medium. The mean percent removal as flux of biovolatilized arsenic ranged from 3.71 to 29.86%. The most effective removal of arsenic was observed in the Trichoderma sp., sterile mycelial strain, Neocosmospora sp. and Rhizopus sp. fungal strains. These fungal strains can be effectively used for the bioremediation of arsenic-contaminated agricultural soils. Copyright © 2011 Elsevier B.V. All rights reserved.
Bhanja Dey, T; Kuhad, R C
2014-11-01
Solid-state fermentation (SSF) at 30°C for 72 h with four generally recognized as safe (GRAS) filamentous fungi (Aspergillus oryzae NCIM 1212, Aspergillus awamori MTCC No. 548, Rhizopus oligosporus NCIM 1215 and Rhizopus oryzae RCK2012) showed high efficiency for the improvement of water-soluble total phenolic content (TPC) and antioxidant properties including ABTS(●+) [2,2'-azinobis (3-ethylbenzothiazoline-6-sulphonic acid)] and DPPH(●) (2,2'-diphenyl-1-picrylhydrazyl) scavenging capacities of four whole grain cereals, namely wheat, brown rice, maize and oat. A maximum 14-fold improvement in TPC (11·61 mg gallic acid equivalent g(-1) grain) was observed in A. oryzae fermented wheat, while extract of R. oryzae fermented wheat (ROFW) showed maximum of 6·6-fold and fivefold enhancement of DPPH(●) scavenging property (8·54 μmol Trolox equivalent g(-1) grain) and ABTS(●+) scavenging activity (19·5 μmol Trolox equivalent g(-1) grain), respectively. The study demonstrates that SSF is an efficient method for the improvement of antioxidant potentials of cereals and R. oryzae RCK2012 fermented wheat can be a powerful source of natural antioxidants. Antioxidant-rich food products are getting popularity day by day. In this study, potential of solid-state fermentation (SSF) has been studied for the improvement of antioxidant potential of different cereals by GRAS micro-organisms. The comparative evaluation of the antioxidant potential of various fungal fermented products derived from whole grain cereals, such as wheat, brown rice, oat and maize, has been carried out. Among these, Rhizopus oryzae RCK2012-fermented wheat was observed as a potent source of natural antioxidants. A diet containing fermented cereals would be useful for the prevention of free radical-mediated diseases. © 2014 The Society for Applied Microbiology.
In Vitro Activity of Isavuconazole and Comparators against Clinical Isolates of the Mucorales Order.
Arendrup, Maiken Cavling; Jensen, Rasmus Hare; Meletiadis, Joseph
2015-12-01
The in vitro activity of isavuconazole against Mucorales isolates measured by EUCAST E.Def 9.2 and CLSI M38-A2 methodologies was investigated in comparison with those of amphotericin B, posaconazole, and voriconazole. Seventy-two isolates were included: 12 of Lichtheimia corymbifera, 5 of Lichtheimia ramosa, 5 of group I and 9 of group II of Mucor circinelloides, 9 of Rhizomucor pusillus, 26 of Rhizopus microsporus, and 6 of Rhizopus oryzae. Species identification was confirmed by internal transcribed spacer (ITS) sequencing. EUCAST MICs were read on day 1 (EUCAST-d1) and day 2 (EUCAST-d2), and CLSI MICs were read on day 2 (CLSI-d2). Isavuconazole MIC50s (range) (mg/liter) by EUCAST-d1, CLSI-d2, and EUCAST-d2 were 1 (0.125 to 16), 1 (0.125 to 2), and 4 (0.5 to >16), respectively, across all isolates. The similar values for comparator drugs were as follows: posaconazole, 0.25 (≤ 0.03 to >16), 0.25 (0.06 to >16), and 1 (0.06 to >16); amphotericin, 0.06 (≤ 0.03 to 0.5), 0.06 (≤ 0.03 to 0.25), and 0.125 (≤ 0.03 to 1); voriconazole, 16 (2 to >16), 8 (1 to >16), and >16 (8 to >16), respectively. Isavuconazole activity varied by species: Lichtheimia corymbifera, 1 (0.5 to 2), 1 (1 to 2), and 2 (1 to 4); Lichtheimia ramosa, 0.25 (0.125 to 0.5), 1 (0.5 to 2), and 2 (0.5 to 4); Rhizomucor pusillus, 0.5 (0.5 to 1), 1 (0.125 to 1), and 2 (1 to 2); Rhizopus microsporus, 1 (0.5 to 4), 0.5 (0.125 to 1), and 4 (1 to 8); and Rhizopus oryzae, 1 (0.5 to 4), 1 (0.125 to 2), and 4 (0.5 to 8), respectively, were more susceptible than Mucor circinelloides: group I, 8 (4 to 8), 4 (2 to 4), and 16 (2 to 16), respectively, and group II, 8 (1 to 16), 8 (1 to 8), and 16 (4 to >16), respectively. This was also observed for posaconazole. The essential agreement was best between EUCAST-d1 and CLSI-d2 (75% to 83%). Isavuconazole displayed in vitro activity against Mucorales isolates with the exception of Mucor circinelloides. The MICs were in general 1 to 3 steps higher than those for posaconazole. However, in the clinical setting this may be compensated for by the higher exposure at standard dosing. Copyright © 2015 Arendrup et al.
Isolated Polynucleotides and Methods of Promoting a Morphology in a Fungus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lasure, Linda L; Dai, Ziyu
2008-10-21
The invention includes isolated polynucleotide molecules that are differentially expressed in a native fungus exhibiting a first morphology relative to the native fungus exhibiting a second morphology. The invention includes a method of enhancing a bioprocess utilizing a fungus. A transformed fungus is produced by transforming a fungus with a recombinant polynucleotide molecule. The recombinant polynucleotide molecule contains an isolated polynucleotide sequence linked operably to a promoter. The polynucleotide sequence is expressed to promote a first morphology. The first morphology of the transformed fungus enhances a bioprocess relative to the bioprocess utilizing a second morphology.
[Effects of fungus on the growth of Dendrobium candidum and D. nobile in vitro culture].
Song, J Y; Guo, S X
2001-12-01
To examine effects of fungus AR-18 (Epulorhiza sp.) on the growth of Dendrobium candidum and D. nobile in vitro culture. Effects of fungus AR-18 on fresh weight and dry weight of D. candidum and D. nobile were studied in vitro culture, when agar was used as rest, and effects of fungus AR-18 and nutrients on fresh weight and dry weight of D. candidum and D. nobile were studied in vitro culture, when vermiculite was used as rest. In agar medium, effects of fungus AR-18 on fresh weight and dry weight of D. candidum and D. nobile were not significant (P > 0.05). However, in vermiculite medium, the effect of fungus AR-18 on fresh weight of D. nobile was significant (P < 0.05). Fresh weight of D. nobile inoculated with fungus AR-18 was increased by 16% compared with the non-inoculated ones (control). The effect of fungus AR-18 on dry weight of D. nobile was very significant (P < 0.01). Dry weight of D. nobile inoculated with fungus AR-18 was increased by 21% compared with the control. In vermiculite medium, the effect of combination treatment (Fungus AR-18 + Distilled H2O) on fresh weight of D. nobile was very significant (P < 0.01). Fresh weight of D. nobile inoculated with fungus AR-18 was increased by 47% compared with the control, while the effect of combination treatment (Fungus AR-18 + Nutrients) on fresh weight of D. nobile was not significant (P > 0.05). In addition, the effect of combinations treatment (Fungus AR-18 + Nutrients) and (Fungus AR-18 + Distilled H2O) on dry weight of D. nobile was not significant (P > 0.05). So the combination treatment (Fungus AR-18 + Distilled H2O) was the best for the growth of D. nobile. In vermiculite medium, effects of fungus AR-18 and nutrients on fresh weight and dry weight of D. candidum were not significant (P > 0.05). It is important in vitro culture to select a proper rest for the control of the growth of fungus to establish a beneficial symbiotic relationship between plants and fungi. If the fungus AR-18 is utilized as biological manure in got-up planting of D. nobile, a good result may be obtained.
Aspergillosis is an infection caused by the fungus aspergillus. Aspergillomas are formed when the fungus grows in ... of fungus that causes disease in humans is Aspergillus fumigatus . Aspergillus is a common fungus. It grows ...
Dai, Ziyu; Lasure, Linda L.; Magnuson, Jon K.
2008-11-11
The present invention encompasses isolated gene regulatory elements and gene transcription terminators that are differentially expressed in a native fungus exhibiting a first morphology relative to the native fungus exhibiting a second morphology. The invention also encompasses a method of utilizing a fungus for protein or chemical production. A transformed fungus is produced by transforming a fungus with a recombinant polynucleotide molecule. The recombinant polynucleotide molecule contains an isolated polynucleotide sequence linked operably to another molecule comprising a coding region of a gene of interest. The gene regulatory element and gene transcription terminator may temporally and spatially regulate expression of particular genes for optimum production of compounds of interest in a transgenic fungus.
Dai, Ziyu; Lasure, Linda L.; Magnuson, Jon K.
2008-11-11
The present invention encompasses isolated gene regulatory elements and gene transcription terminators that are differentially expressed in a native fungus exhibiting a first morphology relative to the native fungus exhibiting a second morphology. The invention also encompasses a method of utilizing a fungus for protein or chemical production. A transformed fungus is produced by transforming a fungus with a recombinant polynucleotide molecule. The recombinant polynucleotide molecule contains an isolated polynucleotide sequence linked operably to another molecule comprising a coding region of a gene of interest. The gene regulatory element and gene transcription terminator may temporally and spatially regulate expression of particular genes for optimum production of compounds of interest in a transgenic fungus.
Dai, Ziyu; Lasure, Linda L; Magnuson, Jon K
2014-05-27
The present invention encompasses isolated gene regulatory elements and gene transcription terminators that are differentially expressed in a native fungus exhibiting a first morphology relative to the native fungus exhibiting a second morphology. The invention also encompasses a method of utilizing a fungus for protein or chemical production. A transformed fungus is produced by transforming a fungus with a recombinant polynucleotide molecule. The recombinant polynucleotide molecule contains an isolated polynucleotide sequence linked operably to another molecule comprising a coding region of a gene of interest. The gene regulatory element and gene transcription terminator may temporally and spatially regulate expression of particular genes for optimum production of compounds of interest in a transgenic fungus.
Dentigerumycin: a bacterial mediator of an ant-fungus symbiosis
Oh, Dong-Chan; Poulsen, Michael; Currie, Cameron R.; Clardy, Jon
2009-01-01
Fungus-growing ants engage in mutualistic associations with both the fungus they cultivate for food and actinobacteria (Pseudonocardia spp.) that produce selective antibiotics to defend that fungus from specialized fungal parasites. In the first system to be analyzed at the molecular level, the bacterium associated with the ant Apterostigma dentigerum produces dentigerumycin, a cyclic depsipeptide with highly modified amino acids, to selectively inhibit the parasitic fungus (Escovopsis sp.). PMID:19330011
Howell, Charles R
2007-01-01
ABSTRACT Good quality seeds of cotton cultivars often escaped pre-emergence damping-off incited by Pythium spp. and Rhizopus oryzae, and they were resistant to postemergence damping-off incited by Rhizoctonia solani. Poor quality seeds, however, were highly susceptible to both phases of seedling disease and required seed treatment in order to survive. Pre-emergence damping-off incited by Pythium spp. and Rhizopus oryzae could be controlled by seed treatment with biocontrol preparations of a number of Trichoderma spp., but these treatments were much less effective in controlling postemergence disease incited by Rhizoctonia solani. Postemergence seedling disease can be controlled by fungicides, but they were much less effective in controlling the pre-emergence phase of the disease. Combination seed treatments of poor quality cotton seeds with fungicides and Trichoderma spp. preparations, followed by planting in pathogen-infested soil, indicated that this technique will control both phases of seedling disease. Seed treatment with either the fungicides or the biocontrol agents alone did not achieve this goal. The optimum combination treatment for disease control was that of chloroneb plus Trichoderma spp., followed by chloroneb plus metalaxyl (Deltacoat AD) plus T. virens strain G-6.
Niveditha, Vedavyas R; Sridhar, Kandikere R
2014-11-01
The raw and processed (cooked and cooked + solid-state fermented with Rhizopus oligosporus) split beans of two landraces of coastal sand dune wild legumes (Canavalia cathartica and Canavalia maritima) of the southwest coast of India were examined for bioactive compounds (total phenolics, tannins and vitamin C) and antioxidant potential (total antioxidant activity, ferrous-ion chelating capacity, DPPH free radical-scavenging activity and reducing activity). One-way ANOVA revealed significant elevation of bioactive compounds as well as antioxidant activities in fermented beans compared to raw and cooked beans in both legumes (p < 0.001). The EC50 values in fermented beans of both legumes were significantly lowest compared to raw and cooked beans (p < 0.001). In principal component analysis, total phenolics along with antioxidant activities (total antioxidant, ferrous-ion chelating and free radical-scavenging activities) of fermented beans of C. cathartica, while total antioxidant and free radical-scavenging activities of fermented beans of C. maritima were clustered. The present study demonstrated that split beans of coastal sand dune Canavalia fermented by R. oligosporus endowed with high bioactive principles as well as antioxidant potential and thus serve as future nutraceutical source.
Türkel, Sezai; Korukluoğlu, Mihriban; Yavuz, Mümine
2014-01-01
The strains of the yeast Metschnikowia pulcherrima have strong biocontrol activity against various microorganisms. Biocontrol activity of M. pulcherrima largely depends on its iron immobilizing pigment pulcherrimin. Biocontrol activity of pulcherrimin producing strain, M. pulcherrima UMY15, isolated from local vineyards, was tested on different molds that cause food spoilage. M. pulcherrima UMY15 was a very effective biocontrol agent against Penicillium roqueforti, P. italicum, P. expansum, and Aspergillus oryzae in in-vitro plate tests. However, the inhibitory activity of M. pulcherrima UMY15 was less effective on Fusarium sp. and A. niger species in biocontrol assays. In addition, M. pulcherrima UMY15 strain completely inhibited the germination and mycelia growth of A. oryzae, A. parasiticus, and Fusarium sp. spores on artificial wounds of apples when they coinoculated with M. pulcherrima UMY15. Moreover, when coinoculated, M. pulcherrima UMY15 strain also inhibited the growth of P. roqueforti, P. italicum, P. expansum, A. oryzae, Fusarium sp., and Rhizopus sp. in grape juice, indicating that M. pulcherrima UMY15 can be used as a very effective biocontrol yeast against various species of postharvest pathogens, including Penicillium, Aspergillus, Fusarium, and Rhizopus.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aksu, Z.; Calik, A.
1999-03-01
In this study a comparative biosorption of iron(III)-cyanide complex anions from aqueous solutions to Rhizopus arrhizus and Chlorella vulgaris was investigated. The iron(III)-cyanide complex ion-binding capacities of the biosorbents were shown as a function of initial pH, initial iron(III)-cyanide complex ion, and biosorbent concentrations. The results indicated that a significant reduction of iron(III)-cyanide complex ions was achieved at pH 13, a highly alkaline condition for both the biosorbents. The maximum loading capacities of the biosorbents were found to be 612.2 mg/g for R.arrhizus at 1,996.2 mg/L initial iron(III)-cyanide complex ion concentration and 387.0 mg/g for C. vulgaris at 845.4 mg/Lmore » initial iron(III)-cyanide complex ion concentration at this pH. The Freundlich, Langmuir, and Redlich-Peterson adsorption models were fitted to the equilibrium data at pH 3, 7, and 13. The equilibrium data of the biosorbents could be best fitted by all the adsorption models over the entire concentration range at pH 13.« less
Zheng, Yu-Xi; Wang, Yuan-Liang; Pan, Jun; Zhang, Jian-Rong; Dai, Ya; Chen, Kun-Yan
2017-10-01
In this study, highly reactive endo- and exo-polygalacturonases (PGs) were produced from the tobacco industry wastewater using immobilized Rhizopus oryzae. Compared with free cells, immobilized cells increased enzyme activity 2.8-fold and reduced production time to 24h by shake-flask production. Moreover, the immobilized cells enabled the semi-continuous production of enzymes through repeated-batch mode for seven consecutive cycles in a scale-up bioreactor. During the first five cycles, the average endo-PG and exo-PG activities reached 307.5 and 242.6U/ml, respectively. The addition of crude enzyme for the hydrolysis of pectin-containing lignocellulosic biomass under high-gravity conditions increased glucose release 4.2-fold (115.4 vs. 29.0g/L), compared with hydrolysis using cellulase alone. This process achieves the efficient production of pectin-degrading enzymes, provides a cost-effective method for tobacco wastewater treatment, and offers the possibility to obtain fermentable sugars with high-titer from pectin-containing lignocellulosic biomass, which has important potential for the commercial production of bio-fuels. Copyright © 2017 Elsevier Ltd. All rights reserved.
Man, Adrian; Mare, Anca; Toma, Felicia; Curticăpean, Augustin; Santacroce, Luigi
2016-01-01
The study of fungal contamination in food and mycotoxicoses is a priority today, both internationally and nationally. The purpose of this study is to have a general view over the quality of the most common spices that are sold in Romanian markets, by assessing the degree of fungal, bacterial and mycotoxin contamination in pepper and chili powders. We tested four types of spices: white pepper, black pepper, sweet and hot chili powders from 12 different distributing companies, summing a total of 35 sample types. The fungal and bacterial load was assessed by Standard Plate Count, while the mycotoxin content by High-performance liquid chromatography. Environmental conditions (humidity, pH) and the selling price for each product were also followed. Fungi were observed in 72.7% of black pepper samples, 33.3% in white pepper, 30% in sweet chili and 25% in hot chili products. The most common isolated fungus was Aspergillus spp., while Rhizopus, Mucor, Fusarium, Penicillium, Absidia species were found, in smaller percentage. Four producers (44.4%) presented fungal contamination of over 10^3 CFU/g and two producers (22.2%) presented no fungal contamination in their products. Bacterial contamination was found in 85.7% of the tested products, consisting mostly in Bacillus spp. Aflatoxin B1 was present in all the tested products, mostly in black pepper (mean value 126.3 ng/g); Ochratoxin A was present in sweet chili (mean value 328 ng/g) and Zearalenone in hot chili (mean value 604 ng/g) and sweet chili (mean value 382 ng/g). All spices presented either fungal contamination, mycotoxin contamination, or both. The high humidity and the high pH of spices represent favorable conditions for fungal growth. The selling price was partly related to the physic-chemical conditions and microbiological quality of the spices. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Contribution of cutinase serine 42 side chain to the stabilization of the oxyanion transition state.
Nicolas, A; Egmond, M; Verrips, C T; de Vlieg, J; Longhi, S; Cambillau, C; Martinez, C
1996-01-16
Cutinase from the fungus Fusarium solani pisi is a lipolytic enzyme able to hydrolyze both aggregated and soluble substrates. It therefore provides a powerful tool for probing the mechanisms underlying lipid hydrolysis. Lipolytic enzymes have a catalytic machinery similar to those present in serine proteinases. It is characterized by the triad Ser, His, and Asp (Glu) residues, by an oxyanion binding site that stabilizes the transition state via hydrogen bonds with two main chain amide groups, and possibly by other determinants. It has been suggested on the basis of a covalently bond inhibitor that the cutinase oxyanion hole may consist not only of two main chain amide groups but also of the Ser42 O gamma side chain. Among the esterases and the serine and the cysteine proteases, only Streptomyces scabies esterase, subtilisin, and papain, respectively, have a side chain residue which is involved in the oxyanion hole formation. The position of the cutinase Ser42 side chain is structurally conserved in Rhizomucor miehei lipase with Ser82 O gamma, in Rhizopus delemar lipase with Thr83 O gamma 1, and in Candida antartica B lipase with Thr40 O gamma 1. To evaluate the increase in the tetrahedral intermediate stability provided by Ser42 O gamma, we mutated Ser42 into Ala. Furthermore, since the proper orientation of Ser42 O gamma is directed by Asn84, we mutated Asn84 into Ala, Leu, Asp, and Trp, respectively, to investigate the contribution of this indirect interaction to the stabilization of the oxyanion hole. The S42A mutation resulted in a drastic decrease in the activity (450-fold) without significantly perturbing the three-dimensional structure. The N84A and N84L mutations had milder kinetic effects and did not disrupt the structure of the active site, whereas the N84W and N84D mutations abolished the enzymatic activity due to drastic steric and electrostatic effects, respectively.
Resistance to Black Dot in Potato
USDA-ARS?s Scientific Manuscript database
Black dot fungus can colonize tubers on the surface, in the stolon end, or in a combination of both.On the surface the fungus is prevalent as sclerotia, and in the stolon end the fungus colonizes the vascular tissuesas hyphae. The fungus is introduced to non-infested soils mostly by infected potato ...
Cause of Mortality in Thermally Injured Patients
1993-01-01
11 patients, Cladosporium species from nine patients, Penicillium species from seven patients, and Phycomycetes ( mucor species and rhizopus species...infecting organisms were filamentous fungi, Aspergillus species in 16 and Mucor species in two, and in four patients C(nlida species were the causative...surface. Twelve, or 75 %, of the 16 patients with Aspergillus wound infections died but, somewhat surprisingly, both of the patients with mucor species
Activity of Deferasirox in Mucorales: Influences of Species and Exogenous Iron▿
Lewis, Russell E.; Pongas, Georgios N.; Albert, Nathaniel; Ben-Ami, Ronen; Walsh, Thomas J.; Kontoyiannis, Dimitrios P.
2011-01-01
Differences in deferasirox susceptibility among members of the order Mucorales are unknown. Here we show that Cunninghamella bertholletiae (four isolates) and Mucor species (five isolates) display higher deferasirox MICs and minimal fungicidal concentrations compared to Rhizopus species (six isolates). Exogenous iron further attenuated the deferasirox susceptibility of Mucorales isolates with low MICs. Vital staining revealed damage to subapical compartments in susceptible strains. PMID:20956598
Studies on the Use of Fungal Plant Pathogens for Control of Hydrilla verticillata (L.f.) Royle
1991-06-01
species collected were mem- bers of Penicillium, Trichoderma, Rhizopus, and Aspergillus , which were iso- lated from plants growing at every sample site...8217Terra 1812’ R Rice ( Oryza sativa L.) ’Lemont’ R ’Mars’ R ’Mercury’ R ’TeBonnet’ R Polygonaceae Smartweed (Polygonum sp.) R Rub iaceae Buttonweed (Diodia
Activity of deferasirox in Mucorales: influences of species and exogenous iron.
Lewis, Russell E; Pongas, Georgios N; Albert, Nathaniel; Ben-Ami, Ronen; Walsh, Thomas J; Kontoyiannis, Dimitrios P
2011-01-01
Differences in deferasirox susceptibility among members of the order Mucorales are unknown. Here we show that Cunninghamella bertholletiae (four isolates) and Mucor species (five isolates) display higher deferasirox MICs and minimal fungicidal concentrations compared to Rhizopus species (six isolates). Exogenous iron further attenuated the deferasirox susceptibility of Mucorales isolates with low MICs. Vital staining revealed damage to subapical compartments in susceptible strains.
2013-01-01
Background Production of biodiesel from non-edible oils is receiving increasing attention. Tung oil, called “China wood oil” is one kind of promising non-edible biodiesel oil in China. To our knowledge, tung oil has not been used to produce biodiesel by enzymatic method. The enzymatic production of biodiesel has been investigated extensively by using Rhizopus oryzae lipase as catalyst. However, the high cost of R. oryzae lipase remains a barrier for its industrial applications. Through different heterologous expression strategies and fermentation techniques, the highest expression level of the lipase from R. oryzae reached 1334 U/mL in Pichia pastoris, which is still not optimistic for industry applications. Results The prosequence of lipases from Rhizopus sp. is very important for the folding and secretion of an active lipase. A chimeric lipase from R. oryzae was constructed by replacing the prosequence with that from the R. chinensis lipase and expressed in P. pastoris. The maximum activity of the chimera reached 4050 U/mL, which was 11 fold higher than that of the parent. The properties of the chimera were studied. The immobilized chimera was used successfully for biodiesel production from tung oil, which achieved higher FAME yield compared with the free chimeric lipase, non-chimeric lipase and mature lipase. By response surface methodology, three variables, water content, methanol to tung oil molar ratio and enzyme dosage were proved to be crucial parameters for biosynthesis of FAME and the FAME yield reached 91.9±2.5% at the optimized conditions by adding 5.66 wt.% of the initial water based on oil weight, 3.88 of methanol to tung oil molar ratio and 13.24 wt.% of enzyme concentration based on oil weight at 40°C. Conclusions This is the first report on improving the expression level of the lipase from R. oryzae by replacing prosequences. The immobilized chimera was used successfully for biodiesel production from tung oil. Using tung oil as non-edible raw material and a chimeric lipase from R. oryzae as an economic catalyst make this study a promising one for biodiesel applications. PMID:23432946
Yu, Xiao-Wei; Sha, Chong; Guo, Yong-Liang; Xiao, Rong; Xu, Yan
2013-02-21
Production of biodiesel from non-edible oils is receiving increasing attention. Tung oil, called "China wood oil" is one kind of promising non-edible biodiesel oil in China. To our knowledge, tung oil has not been used to produce biodiesel by enzymatic method. The enzymatic production of biodiesel has been investigated extensively by using Rhizopus oryzae lipase as catalyst. However, the high cost of R. oryzae lipase remains a barrier for its industrial applications. Through different heterologous expression strategies and fermentation techniques, the highest expression level of the lipase from R. oryzae reached 1334 U/mL in Pichia pastoris, which is still not optimistic for industry applications. The prosequence of lipases from Rhizopus sp. is very important for the folding and secretion of an active lipase. A chimeric lipase from R. oryzae was constructed by replacing the prosequence with that from the R. chinensis lipase and expressed in P. pastoris. The maximum activity of the chimera reached 4050 U/mL, which was 11 fold higher than that of the parent. The properties of the chimera were studied. The immobilized chimera was used successfully for biodiesel production from tung oil, which achieved higher FAME yield compared with the free chimeric lipase, non-chimeric lipase and mature lipase. By response surface methodology, three variables, water content, methanol to tung oil molar ratio and enzyme dosage were proved to be crucial parameters for biosynthesis of FAME and the FAME yield reached 91.9±2.5% at the optimized conditions by adding 5.66 wt.% of the initial water based on oil weight, 3.88 of methanol to tung oil molar ratio and 13.24 wt.% of enzyme concentration based on oil weight at 40°C. This is the first report on improving the expression level of the lipase from R. oryzae by replacing prosequences. The immobilized chimera was used successfully for biodiesel production from tung oil. Using tung oil as non-edible raw material and a chimeric lipase from R. oryzae as an economic catalyst make this study a promising one for biodiesel applications.
THE IMPORTANCE OF ANIMAL INFECTIONS FOR THE HUMAN
tuberculosis, leptospiroses. VIRUS-CAUSED ZOOANTHROPONOSES: Rickettsioses, ornithosis, lyssa, arboviroses. FUNGUS-CAUSED ANIMAL-HUMAN INFECTIONS: filamentous fungus, yeast fungus. PROTOZOA DISEASES: Toxoplasmoses .
Contamination of Pine Seeds by the Pitch Canker Fungus
L. David Dwinell; S.W. Fraedrich
1999-01-01
The pitch canker fungus, Fusarium subglutinans f. sp. pini, has been identified as a significant problem in man pine seed orchards and nursuries in the South. THe fungus causes strobilus mortality, seed deterioation, and cankers on the main stem, branches, and shoots of pines Dwinell and others 1985). The pitche canker fungus...
Native arbuscular mycorrhizal symbiosis alters foliar bacterial community composition.
Poosakkannu, Anbu; Nissinen, Riitta; Kytöviita, Minna-Maarit
2017-11-01
The effects of arbuscular mycorrhizal (AM) fungi on plant-associated microbes are poorly known. We tested the hypothesis that colonization by an AM fungus affects microbial species richness and microbial community composition of host plant tissues. We grew the grass, Deschampsia flexuosa in a greenhouse with or without the native AM fungus, Claroideoglomus etunicatum. We divided clonally produced tillers into two parts: one inoculated with AM fungus spores and one without AM fungus inoculation (non-mycorrhizal, NM). We characterized bacterial (16S rRNA gene) and fungal communities (internal transcribed spacer region) in surface-sterilized leaf and root plant compartments. AM fungus inoculation did not affect microbial species richness or diversity indices in leaves or roots, but the AM fungus inoculation significantly affected bacterial community composition in leaves. A total of three OTUs in leaves belonging to the phylum Firmicutes positively responded to the presence of the AM fungus in roots. Another six OTUs belonging to the Proteobacteria (Alpha, Beta, and Gamma) and Bacteroidetes were significantly more abundant in NM plants when compared to AM fungus-inoculated plants. Further, there was a significant correlation between plant dry weight and leaf microbial community compositional shift. Also, there was a significant correlation between leaf bacterial community compositional shift and foliar nitrogen content changes due to AM fungus inoculation. The results suggest that AM fungus colonization in roots has a profound effect on plant physiology that is reflected in leaf bacterial community composition.
2007-11-01
species of moss FUNGI Endangered Fuscoboletinus weaverae . . . . . . . . . . . . . . a species of fungus Psathyrella cystidiosa...a species of fungus Psathyrella rhodospora . . . . . . . . . . . . . . . a species of fungus Special concern Laccaria trullisata...SC . . . . . . . . . caddisfly Psathyrella cystidiosa . . . . . . . . . . . . . . . . a species of fungus
USDA-ARS?s Scientific Manuscript database
A nematophagous fungus, Esteya vermicola, is recorded as the first endoparasitic fungus of pine wood nematode (PWN), Burasphelenchus xylophilus, in the last century. E. vermicola exhibited high infectivity toward PWN in the laboratory conditions and conidia spraying of this fungus on Japanese red pi...
Matsumiya, Y; Murata, N; Tanabe, E; Kubota, K; Kubo, M
2010-06-01
To degrade ether-type polyurethane (ether-PUR), ether-PUR-degrading micro-organism was isolated. Moreover, ether-PUR-degrading mechanisms were analysed using model compounds of ether-PUR. A fungus designated as strain PURDK2, capable of changing the configuration of ether-PUR, has been isolated. This isolated fungus was identified as Alternaria sp. Using a scanning electron microscope, the grid structure of ether-PUR was shown to be melted and disrupted by the fungus. The degradation of ether-PUR by the fungus was analysed, and the ether-PUR was degraded by the fungus by about 27.5%. To analyse the urethane-bond degradation by the fungus, a degraded product of ethylphenylcarbamate was analysed using GC/MS. Aniline and ethanol were detected by degradation with the supernatant, indicating that the fungus secreted urethane-bond-degrading enzyme(s). PURDK2 also degraded urea bonds when diphenylmethane-4,4'-dibutylurea was used as a substrate. The enzyme(s) from PURDK2 degraded urethane and urea bonds to convert the high molecular weight structure of ether-PUR to small molecules; and then the fungus seems to use the small molecules as an energy source. Ether-PUR-degrading fungus, strain PURDK2, was isolated, and the urethane- and urea-bonds-degrading enzymes from strain PURDK2 could contribute to the material recycling of ether-PUR.
... by the fungus Histoplasma. The fungus lives in soil. You get the infection by breathing in spores ... construction, gardening, or any activity that disturbs the soil can release fungus spores into the air. If ...
... dermatitidis fungus. The fungus is found in decaying wood and soil. Causes You can get blastomycosis by ... moist soil, most commonly where there is rotting wood and leaves. The fungus enters the body through ...
Maciel, A S; Araújo, J V; Campos, A K; Benjamin, L A; Freitas, L G
2009-06-01
The interaction between the nematode-trapping fungus Duddingtonia flagrans (isolate CG768) against Ancylostoma spp. dog infective larvae (L(3)) was evaluated by means of scanning electron microscopy. Adhesive network trap formation was observed 6h after the beginning of the interaction, and the capture of Ancylostoma spp. L(3) was observed 8h after the inoculation these larvae on the cellulose membranes colonized by the fungus. Scanning electron micrographs were taken at 0, 12, 24, 36 and 48 h, where 0 is the time when Ancylostoma spp. L(3) was first captured by the fungus. Details of the capture structure formed by the fungus were described. Nematophagous Fungus Helper Bacteria (NHB) were found at interactions points between the D. flagrans and Ancylostoma spp. L(3). The cuticle penetration by the differentiated fungal hyphae with the exit of nematode internal contents was observed 36 h after the capture. Ancylostoma spp. L(3) were completely destroyed after 48 h of interaction with the fungus. The scanning electron microscopy technique was efficient on the study of this interaction, showing that the nematode-trapping fungus D. flagrans (isolate CG768) is a potential exterminator of Ancylostoma spp. L(3).
2013-01-01
Background Araucariaceae are important forest trees of the southern hemisphere. Life expectancy of their seedlings can largely be reduced by fungal infections. In this study we have isolated and characterized such a fungus and investigated the potential of Streptomyces Actinobacteria from the respective rhizosphere to act as antagonists. Results The pathogenic fungus from Araucaria angustifolia seeds was identified by morphological markers (pore-associated Woronin-bodies) as belonging to the Pezizomycotina. Molecular data identified the fungus as Neofusicoccum parvum (Botryosphaeriaceae). Co-cultures on agar of this fungus with certain streptomycete isolates from the rhizosphere, and from the surface of Araucaria roots significantly reduced the growth of the fungus. HPLC analysis of the agar yielded streptomycete-specific exudate compounds which were partly identified. There were differences in compounds between single (bacteria, fungus) and dual cultures (bacteria + fungus). Conclusion Streptomycetes from the rhizosphere of Araucariaceae produce exudates which can suppress the development of pathogenic fungi in their seeds. PMID:23866024
Caecomyces sympodialis sp. nov., a new rumen fungus isolated from Bos indicus.
Chen, Yo-Chia; Tsai, Sheng-Da; Cheng, Hsueh-Ling; Chien, Chiu-Yuan; Hu, Chun-Yi; Cheng, Tai-Yi
2007-01-01
A new anaerobic rumen fungus was isolated from the rumen fluid of a yellow cow (Bos indicus). This fungus appears to be a previously undescribed species of the genus Caecomyces, it possessing uniflagellate zoospores, a spherical holdfast, tubular sporangiophores and bulbous rhizoids. This new fungus also features distinctive multisporangiate thallus sympodially distributed on sporangiophores. The fungus resembles Caecomyces communis and C. equi in that it characterizes bulbous rhizoids and uniflagellate zoospores but differs from C. communis and C. equi in that it possesses multisporangiate and sympodial sporangia. This new fungus and Cyllamyces aberensis both reveal similar morphology during early thallus development in having a spherical holdfast, but they vary from unbranched sporangiophores and additional bulbous rhizoids. In addition, the molecular phylogenetic analyses ITS1 (internal transcribed spacer 1) also conform to the results of the morphological examinations of Caecomyces. For the mentioned reasons, this new species of fungus is described as Caecomyces sympodialis sp. nov. The genera of Neocallimasticaceae and species of Caecomyces are also keyed out.
Maneeboon, Thanapoom; Vanichsriratana, Wirat; Pomchaitaward, Chaiyaporn; Kitpreechavanich, Vichien
2010-05-01
The influence of two key environmental factors, pH and oxygen transfer coefficient (k(L)a), was evaluated on the lactic acid production as the main answer and, on the size of cell pellets of the fungal strain Rhizopus oryzae KPS106, as second dependant answer by response surface methodology using a central composite design. The results of the analysis of variance and modeling demonstrated that pH and k(L)a had a significant effect on lactic acid production by this strain. However, no interaction was observed between these two experimental factors. pH and k(L)a had no significant influence on the pellet size. Optimal pH and k(L)a of the fermentation medium for lactic acid production from response surface analysis was 5.85 and of 3.6 h(-1), respectively. The predicted and experimental lactic acid maximal values were 75.4 and 72.0 g/l, respectively, with pellets of an average of 2.54 +/- 0.41 mm. Five repeated batches in series were conducted with a mean lactic acid production of 77.54 g/l. The productivity was increased from 0.75 in the first batch to 0.99 g/l h in the last fifth batch.
Tran, S T; Smith, T K
2014-02-01
Deoxynivalenol (DON, vomitoxin) is a trichothecene mycotoxin which can be considered to be an indicator of Fusarium mycotoxin contamination in grain, feed and food. Recent studies have described the presence of glucose conjugated DON, which is a product of plant metabolism, but there is a lack of information available on DON conjugation by fungi. The aim of the current study was, therefore, to investigate the ability of fungi to metabolize DON into hydrolysable conjugated DON. Alternaria alternata (54028 NRRL) and Rhizopus microsporus var. rhizopodiformis (54029 NRRL) were found to be capable of metabolizing DON into hydrolysable conjugated DON. This ranged from 13-23 % conjugation of DON in potato dextrose agar media and from 11-36 % in corn-based media. There was, however, considerable variation between fungal strains in the ability to conjugate DON as only a slight increase in hydrolysable conjugated DON (1-6 %) was observed when incubating with A. oryzae (5509 NRRL). A. oryzae (5509 NRRL) was also shown to degrade DON (up to 92 %) over 21 days of incubation on corn-based media. The current study shows that conjugation of DON can be achieved through fungal metabolism in addition to being a product of plant metabolism.
Heterologous expression of an active chitin synthase from Rhizopus oryzae.
Salgado-Lugo, Holjes; Sánchez-Arreguín, Alejandro; Ruiz-Herrera, José
2016-12-01
Chitin synthases are highly important enzymes in nature, where they synthesize structural components in species belonging to different eukaryotic kingdoms, including kingdom Fungi. Unfortunately, their structure and the molecular mechanism of synthesis of their microfibrilar product remain largely unknown, probably because no fungal active chitin synthases have been isolated, possibly due to their extreme hydrophobicity. In this study we have turned to the heterologous expression of the transcript from a small chitin synthase of Rhizopus oryzae (RO3G_00942, Chs1) in Escherichia coli. The enzyme was active, but accumulated mostly in inclusion bodies. High concentrations of arginine or urea solubilized the enzyme, but their dilution led to its denaturation and precipitation. Nevertheless, use of urea permitted the purification of small amounts of the enzyme. The properties of Chs1 (Km, optimum temperature and pH, effect of GlcNAc) were abnormal, probably because it lacks the hydrophobic transmembrane regions characteristic of chitin synthases. The product of the enzyme showed that, contrasting with chitin made by membrane-bound Chs's and chitosomes, was only partially in the form of short microfibrils of low crystallinity. This approach may lead to future developments to obtain active chitin synthases that permit understanding their molecular mechanism of activity, and microfibril assembly. Copyright © 2016. Published by Elsevier Inc.
Functionality of selected strains of moulds and yeasts from Vietnamese rice wine starters.
Dung, N T P; Rombouts, F M; Nout, M J R
2006-06-01
The role of starch-degrading mycelial fungi, and the alcohol production and ethanol tolerance of the yeasts isolated from selected Vietnamese traditional rice wine starters were examined, and optimum conditions for these essential steps in rice wine fermentation were determined. Of pure isolates from Vietnamese rice wine starters, mould strains identified as Amylomyces rouxii, Amylomyces aff. rouxii, Rhizopus oligosporus and Rhizopus oryzae, were superior in starch degradation, glucose production and amyloglucosidase activity during the saccharification of purple glutinous rice. A. rouxii was able to produce up to 25%w/w glucose with an amyloglucosidase activity up to 0.6 Ug(-1) of fermented moulded mass. Five yeast isolates identified as Saccharomyces cerevisiae were selected for their superior alcohol productivity. They were able to deplete a relatively high initial percentage of glucose (20% w/v), forming 8.8% w/v ethanol. The ethanol tolerance of S. cerevisiae in challenge tests was 9-10% w/v, and 13.4% w/v as measured in fed-batch fermentations. Optimum conditions for the saccharification were: incubation for 2 d at 34 degrees C, of steamed rice inoculated with 5 log cfu g(-1); for the alcoholic fermentation 4 d at 28.3 degrees C, of saccharified rice liquid inoculated with 5.5 log cfu mL(-1).
Construction of the yeast whole-cell Rhizopus oryzae lipase biocatalyst with high activity.
Chen, Mei-ling; Guo, Qin; Wang, Rui-zhi; Xu, Juan; Zhou, Chen-wei; Ruan, Hui; He, Guo-qing
2011-07-01
Surface display is effectively utilized to construct a whole-cell biocatalyst. Codon optimization has been proven to be effective in maximizing production of heterologous proteins in yeast. Here, the cDNA sequence of Rhizopus oryzae lipase (ROL) was optimized and synthesized according to the codon bias of Saccharomyces cerevisiae, and based on the Saccharomyces cerevisiae cell surface display system with α-agglutinin as an anchor, recombinant yeast displaying fully codon-optimized ROL with high activity was successfully constructed. Compared with the wild-type ROL-displaying yeast, the activity of the codon-optimized ROL yeast whole-cell biocatalyst (25 U/g dried cells) was 12.8-fold higher in a hydrolysis reaction using p-nitrophenyl palmitate (pNPP) as the substrate. To our knowledge, this was the first attempt to combine the techniques of yeast surface display and codon optimization for whole-cell biocatalyst construction. Consequently, the yeast whole-cell ROL biocatalyst was constructed with high activity. The optimum pH and temperature for the yeast whole-cell ROL biocatalyst were pH 7.0 and 40 °C. Furthermore, this whole-cell biocatalyst was applied to the hydrolysis of tributyrin and the resulted conversion of butyric acid reached 96.91% after 144 h.
NASA Astrophysics Data System (ADS)
Baniyah, Laelatul; Nur Jannah, Siti; Rukmi, Isworo; Sugiharto
2018-05-01
Lactic Acid Bacteria (LAB) is a digestive tract microflora that have a positive role in poultry health. The number and diversity of LAB in the digestive tract affected by several factors, among them was the kind of feed. The purpose of this research was to know diversity of Lactic Acid Bacteria (LAB) ileum broiler’s after feeding with prebiotic bran and Rhizopus oryzae fermented bran which was added to commercial feed. As much as 15 broilers were used to determine the diversity of LAB. All broilers were fed using commercial feed. The control used commercial feed no addition of bran or fermented bran, and commercial feed with fermented bran and nonfermented bran were as a treatment. To determine the diversity of LAB, T-RFLP method was applied. The Hae III and Msp I were used as restriction enzymes. The number of phylotype, relative abundance, Shannon diversity index (H '), evenness (E), and Dominance (D) were examined. The results indicated that the addition of prebiotic bran on commercial feed showed a higher diversity of lactic acid bacteria on broiler’s ileum, compared with control and addition of Rhizopus oryzae fermented bran. LAB group that dominates in the ileum is Lactobacillus sp. and L. delbruecii subs bulgaricus.
Müller, Christoph; Neugebauer, Thomas; Zill, Patrizia; Lass-Flörl, Cornelia; Bracher, Franz; Binder, Ulrike
2018-05-19
Mucorales are fungi with increasing importance in the clinics. Infections take a rapidly progressive course resulting in high mortality rates. The ergosterol biosynthesis pathway and sterol composition are of interest, since they are targeted by currently applied antifungal drugs. Nevertheless, Mucorales often exhibit resistance to these drugs, resulting in therapeutic failure. Here, sterol patterns of six clinically relevant Mucorales ( Lichtheimia corymbifera , Lichtheimia ramosa , Mucor circinelloides , Rhizomucor pusillus , Rhizopus arrhizus , and Rhizopus microsporus ) were analysed in a targeted metabolomics fashion after derivatization by gas chromatography-mass spectrometry. Additionally, the effect of posaconazole (POS) treatment on the sterol pattern of R. arrhizus was evaluated. Overall, fifteen different sterols were detected with species dependent variations in the total and relative sterol amount. Sterol analysis from R. arrhizus hyphae confronted with sublethal concentrations of posaconazole revealed the accumulation of 14-methylergosta-8,24-diene-3,6-diol, which is a toxic sterol that was previously only detected in yeasts. Sterol content and composition were further compared to the well-characterized pathogenic mold Aspergillus fumigatus . This work contributes to a better understanding of the ergosterol biosynthesis pathway of Mucorales, which is essential to improve antifungal efficacy, the identification of targets for novel drug design, and to investigate the combinatorial effects of drugs targeting this pathway.
Römer, Daniela; Bollazzi, Martin; Roces, Flavio
2017-01-01
Defense against biotic or abiotic stresses is one of the benefits of living in symbiosis. Leaf-cutting ants, which live in an obligate mutualism with a fungus, attenuate thermal and desiccation stress of their partner through behavioral responses, by choosing suitable places for fungus-rearing across the soil profile. The underground environment also presents hypoxic (low oxygen) and hypercapnic (high carbon dioxide) conditions, which can negatively influence the symbiont. Here, we investigated whether workers of the leaf-cutting ant Acromyrmex lundii use the CO2 concentration as an orientation cue when selecting a place to locate their fungus garden, and whether they show preferences for specific CO2 concentrations. We also evaluated whether levels preferred by workers for fungus-rearing differ from those selected for themselves. In the laboratory, CO2 preferences were assessed in binary choices between chambers with different CO2 concentrations, by quantifying number of workers in each chamber and amount of relocated fungus. Leaf-cutting ants used the CO2 concentration as a spatial cue when selecting places for fungus-rearing. A. lundii preferred intermediate CO2 levels, between 1 and 3%, as they would encounter at soil depths where their nest chambers are located. In addition, workers avoided both atmospheric and high CO2 levels as they would occur outside the nest and at deeper soil layers, respectively. In order to prevent fungus desiccation, however, workers relocated fungus to high CO2 levels, which were otherwise avoided. Workers' CO2 preferences for themselves showed no clear-cut pattern. We suggest that workers avoid both atmospheric and high CO2 concentrations not because they are detrimental for themselves, but because of their consequences for the symbiotic partner. Whether the preferred CO2 concentrations are beneficial for symbiont growth remains to be investigated, as well as whether the observed preferences for fungus-rearing influences the ants' decisions where to excavate new chambers across the soil profile.
Braga, Fabio Ribeiro; Araújo, Jackson Victor; Silva, André Ricardo; Araujo, Juliana Milani; Carvalho, Rogério Oliva; Tavela, Alexandre Oliveira; Campos, Artur Kanadani; Carvalho, Giovanni Ribeiro
2009-08-26
The viability of a fungal formulation using the nematode-trapping fungus Duddingtonia flagrans was assessed for the biological control of horse cyathostomin. Two groups (fungus-treated and control without fungus treatment), consisting of eight crossbred mares (3-18 years of age) were fed on Cynodon sp. pasture naturally infected with equine cyathostome larvae. Each animal of the treated group received oral doses of sodium alginate mycelial pellets (1g/(10 kg live weight week)), during 6 months. Significant reduction (p<0.01) in the number of eggs per gram of feces and coprocultures was found for animals of the fungus-treated group compared with the control group. There was difference (p<0.01) of 78.5% reduction in herbage samples collected up to (0-20 cm) between the fungus-treated group and the control group, during the experimental period (May-October). Difference of 82.5% (p<0.01) was found between the fungus-treated group and the control group in the sampling distance (20-40 cm) from fecal pats. During the last 3 months of the experimental period (August, September and October), fungus-treated mares had significant weight gain (p<0.01) compared with the control group, an increment of 38 kg. The treatment with sodium alginate pellets containing the nematode-trapping fungus D. flagrans reduced cyathostomin in tropical southeastern Brazil and could be an effective tool for biological control of this parasitic nematode in horses.
The status of the fungi-grower ants (Hymenoptera: Formicidae) in Puerto Rico and adjacent islands
J.A. Torres
1989-01-01
Ants of the tribe Attini (fungus grower) collect different organic materials that are used to grow a fungus. It was thought that the fungus mycelium was the only source of nutrition for these ants, but Quinlan and Cherrett found that Atta cephalotes (L.) squeezes oils from fresh leaves and uses them as food. These oils supplement the fungus material eaten by this...
Rust-red stringy white rot: The Indian paint fungus, Echinodontium tinctorium
A. D. Wilson
1997-01-01
Older trees are more susceptible to damage by this fungus, although even very young trees are susceptible to infection. Infections occur most frequently in dense stands where selfpruning creates infection courts for the fungus.
Cloyd, Raymond A
2015-04-09
Fungus gnats (Bradysia spp.) are major insect pests of greenhouse-grown horticultural crops mainly due to the direct feeding damage caused by the larvae, and the ability of larvae to transmit certain soil-borne plant pathogens. Currently, insecticides and biological control agents are being used successively to deal with fungus gnat populations in greenhouse production systems. However, these strategies may only be effective as long as greenhouse producers also implement alternative management strategies such as cultural, physical, and sanitation. This includes elimination of algae, and plant and growing medium debris; placing physical barriers onto the growing medium surface; and using materials that repel fungus gnat adults. This article describes the disease-interactions associated with fungus gnats and foliar and soil-borne diseases, and the alternative management strategies that should be considered by greenhouse producers in order to alleviate problems with fungus gnats in greenhouse production systems.
Sequential batch culture studies for the decolorisation of reactive dye by Coriolus versicolor.
Sanghi, Rashmi; Dixit, Awantika; Guha, Sauymen
2006-02-01
The white rot fungus Coriolus versicolor could decolorise reactive dye Remazol Brilliant Violet to almost 90%. The fungal mycelia removed color as well as COD up to 95% and 75%, respectively, in a batch reactor. Decolorising activity was observed during the repeated reuse of the fungus. It was possible to substantially increase the dye decolorising activity of the fungus by carefully selecting the operational conditions such as media composition, age of fungus and nitrogen source. The fungal pellets could be used for eight cycles during the long term operation, where medium and dye was replenished at the end of each cycle and the fungus was recycled. Presence of a nitrogen source and nutrient content of media played an important role in sustaining the decolorisation activity of the fungus. The form of nitrogen source (e.g. peptone vs. urea) was also important to maintain the decolorising activity with peptone showing better decolorisation.
Roberts, Eric M.; Todd, Christopher N.; Aanen, Duur K.; Nobre, Tânia; Hilbert-Wolf, Hannah L.; O’Connor, Patrick M.; Tapanila, Leif; Mtelela, Cassy; Stevens, Nancy J.
2016-01-01
Based on molecular dating, the origin of insect agriculture is hypothesized to have taken place independently in three clades of fungus-farming insects: the termites, ants or ambrosia beetles during the Paleogene (66–24 Ma). Yet, definitive fossil evidence of fungus-growing behavior has been elusive, with no unequivocal records prior to the late Miocene (7–10 Ma). Here we report fossil evidence of insect agriculture in the form of fossil fungus gardens, preserved within 25 Ma termite nests from southwestern Tanzania. Using these well-dated fossil fungus gardens, we have recalibrated molecular divergence estimates for the origins of termite agriculture to around 31 Ma, lending support to hypotheses suggesting an African Paleogene origin for termite-fungus symbiosis; perhaps coinciding with rift initiation and changes in the African landscape. PMID:27333288
Cloyd, Raymond A.
2015-01-01
Fungus gnats (Bradysia spp.) are major insect pests of greenhouse-grown horticultural crops mainly due to the direct feeding damage caused by the larvae, and the ability of larvae to transmit certain soil-borne plant pathogens. Currently, insecticides and biological control agents are being used successively to deal with fungus gnat populations in greenhouse production systems. However, these strategies may only be effective as long as greenhouse producers also implement alternative management strategies such as cultural, physical, and sanitation. This includes elimination of algae, and plant and growing medium debris; placing physical barriers onto the growing medium surface; and using materials that repel fungus gnat adults. This article describes the disease-interactions associated with fungus gnats and foliar and soil-borne diseases, and the alternative management strategies that should be considered by greenhouse producers in order to alleviate problems with fungus gnats in greenhouse production systems. PMID:26463188
Tauk-Tornisielo, Sâmia M.; Arasato, Luciana S.; de Almeida, Alex F.; Govone, José S.; Malagutti, Eleni N.
2009-01-01
The fungi strains were tested in Bioscreen automated system to select the best nutritional source. Following, shaking submserse cultures were studied in media containing sole carbon or nitrogen source. The growth of these strains improved in media containing vegetable oil, with high concentration of lipids. The high concentration of γ-linolenic acid was obtained with M. circinelloides in culture containing sesame oil. PMID:24031370
Noninvasive medical management of fungus ball uropathy in a premature infant.
Alkalay, A L; Srugo, I; Blifeld, C; Komaiko, M S; Pomerance, J J
1991-09-01
Unilateral renal obstruction secondary to fungus balls is described in a premature infant. Noninvasive medical management, which included amphotericin B and 5-flucytosine therapy and forced diuresis, resulted in disappearance of fungus balls and resolution of the obstruction.
THE ROLE OF PREDISPOSING FACTORS IN EXPERIMENTAL FUNGUS INFECTIONS
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sheldon, W.H.; Bauer, H.
Among other factors, the influence of ionizing radiations on susceptibility to fungus diseases is reviewed. X irradiation singly or in combination with cortisone administration has been employed in the study of experimental fungus diseases, and it has been shown that total-body radiation enhaaced infection with Candida albicans, Blastomyces dermatididis, and Cryptococcus neoformans in mice. Enhanced susceptibility to fungus infections following radiation therapy has also been reported, the mechanism resulting in lowered host resistance being presumably the same as in other infections. (BBB)
Exploring the potential for actinobacteria as defensive symbionts in fungus-growing termites.
Visser, Anna A; Nobre, Tânia; Currie, Cameron R; Aanen, Duur K; Poulsen, Michael
2012-05-01
In fungus-growing termites, fungi of the subgenus Pseudoxylaria threaten colony health through substrate competition with the termite fungus (Termitomyces). The potential mechanisms with which termites suppress Pseudoxylaria have remained unknown. Here we explore if Actinobacteria potentially play a role as defensive symbionts against Pseudoxylaria in fungus-growing termites. We sampled for Actinobacteria from 30 fungus-growing termite colonies, spanning the three main termite genera and two geographically distant sites. Our isolations yielded 360 Actinobacteria, from which we selected subsets for morphological (288 isolates, grouped in 44 morphotypes) and for 16S rRNA (35 isolates, spanning the majority of morphotypes) characterisation. Actinobacteria were found throughout all sampled nests and colony parts and, phylogenetically, they are interspersed with Actinobacteria from origins other than fungus-growing termites, indicating lack of specificity. Antibiotic-activity screening of 288 isolates against the fungal cultivar and competitor revealed that most of the Actinobacteria-produced molecules with antifungal activity. A more detailed bioassay on 53 isolates, to test the specificity of antibiotics, showed that many Actinobacteria inhibit both Pseudoxylaria and Termitomyces, and that the cultivar fungus generally is more susceptible to inhibition than the competitor. This suggests that either defensive symbionts are not present in the system or that they, if present, represent a subset of the community isolated. If so, the antibiotics must be used in a targeted fashion, being applied to specific areas by the termites. We describe the first discovery of an assembly of antibiotic-producing Actinobacteria occurring in fungus-growing termite nests. However, due to the diversity found, and the lack of both phylogenetic and bioactivity specificity, further work is necessary for a better understanding of the putative role of antibiotic-producing bacteria in the fungus-growing termite mutualistic system.
Tempeh: a mold-modified indigenous fermented food made from soybeans and/or cereal grains.
Hachmeister, K A; Fung, D Y
1993-01-01
A variety of indigenous fermented foods exist today; however, tempeh has been one of the most widely accepted and researched mold-modified fermented products. Tempeh is a traditional fermented food made from soaked and cooked soybeans inoculated with a mold, usually of the genus Rhizopus. After fermentation has occurred, the soybeans are bound together into a compact cake by dense cottony mycelium. An important function of the mold in the fermentation process is the synthesis of enzymes, which hydrolyze soybean constituents and contribute to the development of a desirable texture, flavor, and aroma of the product. Enzymatic hydrolysis also may decrease or eliminate antinutritional constituents; consequently, the nutritional quality of the fermented product may be improved. Current technology and new scientific advancements have enabled researchers to examine specific strains of Rhizopus and new substrates such as cereal grains. Because Kansas produces numerous cereal grains, production of a fermented tempeh-like product using wheat, sorghum (milo), oats, rye, barley, corn, and triticale is a definite possibility for generating a Kansas Value-Added Product. In this study, several different tempeh-like products were produced using various cereal grains inoculated with Rhizopus oligosporus NRRL 2549 or R. oligosporus NRRL 2710. Grains used included hard red winter wheat, triticale, yellow sorghum (milo), and red sorghum (milo). The grain source as well as the strain of R. oligosporus used influenced the product's appearance, flavor, and patty integrity. Results showed that R. oligosporus NRRL 2549 produced more mycelium at a more rapid rate than did the R. oligosporus NRRL 2710 strain. The combination of red sorghum and R. oligosporus NRRL 2549 yielded a product with good patty texture, aroma, and appearance. Furthermore, the red sorghum fermented product was well suited for slicing. On the other hand, yellow sorghum inoculated with either R. oligosporus NRRL 2549 or R. oligosporus NRRL 2710 failed to produce an organoleptically suitable product. Triticale also was found to be an unacceptable substrate for the production of a tempeh-like product. Although the fermented wheat product had a desirable aroma and flavor, it lacked patty integrity and crumbled when sliced. Further research is needed to evaluate the economic significance and industrial applications of these tempeh-like products.
USDA-ARS?s Scientific Manuscript database
The endophytic fungus, Aspergillus calidoustus, was isolated from the plant species Acanthospermum australe (Asteraceae). A dichloromethane extract of the fungus displayed antifungal, antiprotozoal, and cytotoxic activities. Aspergillus calidoustus was identified using molecular, physiological and m...
Effects of Some Pesticides on the Growth of ARF18 and Its Pathogenicity to Heterodera glycines
Kim, D. G.; Riggs, R. D.
1998-01-01
The effects of 22 pesticides on the mycelial growth and pathogenicity of the biocontrol fungus ARFI8 to Heterodera glycines were tested in vitro. The chemicals were added to agar at 10, 100, and 1,000 ppm a.i.; a block of agar containing the fungus was added to each test concentration; and fungal growth was measured. Subsequently, a block of the fungus on the pesticide-containing agar was used to determine the ability of the fungus to parasitize eggs of H. glycines. Aldicarb, bentazone, and chlorothalonil had little or no effect on fungal growth, whereas benomyl and thiophanate methyl completely inhibited growth of the fungus at 10 ppm. The relative insensitivity of ARF18 to certain pesticides would permit selected use of those pesticides with ARF18 in an integrated control program if the effects on the fungus in the field are similar to results from petri dish studies. PMID:19274211
Azandémè Hounmalon, Ginette Y; Maniania, Nguya K; Niassy, Saliou; Fellous, Simon; Kreiter, Serge; Delétré, Emilie; Fiaboe, Komi K; Martin, Thibaud
2018-05-13
Tetranychus evansi (Te) is an exotic pest of solanaceous crops in Africa. The predatory mite Phytoseiulus longipes (Pl) and the fungus Metarhizium anisopliae (Ma), are potential biocontrol agents of Te. The present study investigated efficacy of fungus-treated foam placed above or below the third Te-infested tomato leaf. The persistence of fungus-treated foam and the performance of Pl with or without fungus-treated foam were evaluated. The fungus-treated foam was effective when Te infestation was below the third tomato leaf as no damage was recorded on all upper tomato leaves up to 30 days post-treatment. However, in the control treatments, the infestation increased considerably from 9±0.3% to 100±0% at 15 days post-treatment. The reuse of the fungus-treated foam at 15, 30 and 45 days post-treatment resulted in 19±1.4%, 25±1.2% and 54±2.1% respective infestation by Te. The fungus-treated foam and Pl alone are efficient, but there is no benefit to combinting both against Te. The fungus-treated foam is an effective method to optimize the use of Ma in screenhouse conditions. These two control agents could be integrated in an IPM strategy for crops protection. However, these results need to be confirmed in large field trials. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Hospital-acquired gangrenous mucormycosis.
Patterson, J. E.; Barden, G. E.; Bia, F. J.
1986-01-01
A post-operative diabetic patient who had been treated for Serratia marcescens bacterial sepsis developed recurrent thrombosis of the left femoral artery following intra-arterial instrumentation. Pathological examination of arterial thrombus ultimately demonstrated invasive mucormycosis of the femoral artery and cultures of this material grew Rhizopus oryzae. The occurrence of cutaneous and subcutaneous mucormycosis is reviewed, as well as recently recognized nosocomial risk factors for mucormycosis, such as elasticized bandages and wound dressings. Images FIG. 1 FIG. 2 FIG. 3 PMID:3765666
Khasanov, Kh T; Davranov, K; Rakhimov, M M
2015-01-01
We demonstrated that a change in the catalytic activity of fungal lipases synthesized by Rhizopus microsporus, Penicillium sp. and Oospora lactis and their ability to absorb on different sorbents depended on the nature of groups on the solid phase surface in the model systems water: lipid and water: solid phase. Thus, the stability of Penicillium sp. lipases increased 85% in the presence ofsorsilen or DEAE-cellulose, and 55% of their initial activity respectively was preserved. In the presence of silica gel and CM-cellulose, a decreased rate of lipid hydrolysis by Pseudomonas sp. enzymes was observed in water medium, and the hydrolysis rate increased by 2.4 and 1.5 times respectively in the presence of aminoaerosil and polykefamid. In an aqueous-alcohol medium, aminoaerosil and polykefamid decreased the rate of substrate hydrolysis by more than 30 times. The addition of aerosil to aqueous and aqueous-alcohol media resulted in an increase in the hydrolysis rate by 1.2-1.3 times. Sorsilen stabilized Penicillium sp. lipase activity at 40, 45, 50 and 55 degrees C. Either stabilization or inactivation of lipases was observed depending on the pH of the medium and the nature of chemical groups localized on the surface of solid phase. The synthetizing activity of lipases also changed depending on the conditions.
Identification of Mucorales From Clinical Specimens: A 4-Year Experience in a Single Institution
Yang, Mina; Lee, Jang Ho; Kim, Young-Kwon; Ki, Chang-Seok
2016-01-01
Mucormycosis, a fatal opportunistic infection in immunocompromised hosts, is caused by fungi belonging to the order Mucorales. Early diagnosis based on exact identification and multidisciplinary treatments is critical. However, identification of Mucorales fungi is difficult and often delayed, resulting in poor prognosis. This study aimed to compare the results of phenotypic and molecular identification of 12 Mucorales isolates collected from 4-yr-accumulated data. All isolates were identified on the basis of phenotypic characteristics such as growth rate, colony morphology, and reproductive structures. PCR and direct sequencing were performed to target internal transcribed spacer (ITS) and/or D1/D2 regions. Target DNA sequencing identified five Lichtheimia isolates, two Rhizopus microsporus isolates, two Rhizomucor pusillus isolates, one Cunninghamella bertholletiae isolate, one Mucor fragilis isolate, and one Syncephalastrum racemosum isolate. Five of the 12 (41.7%) isolates were incorrectly identified on the basis of phenotypic identification. DNA sequencing showed that of these five isolates, two were Lichtheimia isolates, one was Mucor isolate, one was Rhizomucor isolate, and one was Rhizopus microspores. All the isolates were identified at the species level by ITS and/or D1/D2 analyses. Phenotypic differentiation and identification of Mucorales is difficult because different Mucorales share similar morphology. Our results indicate that the molecular methods employed in this study are valuable for identifying Mucorales. PMID:26522761
Identification of mucorales from clinical specimens: a 4-year experience in a single institution.
Yang, Mina; Lee, Jang Ho; Kim, Young Kwon; Ki, Chang Seok; Huh, Hee Jae; Lee, Nam Yong
2016-01-01
Mucormycosis, a fatal opportunistic infection in immunocompromised hosts, is caused by fungi belonging to the order Mucorales. Early diagnosis based on exact identification and multidisciplinary treatments is critical. However, identification of Mucorales fungi is difficult and often delayed, resulting in poor prognosis. This study aimed to compare the results of phenotypic and molecular identification of 12 Mucorales isolates collected from 4-yr-accumulated data. All isolates were identified on the basis of phenotypic characteristics such as growth rate, colony morphology, and reproductive structures. PCR and direct sequencing were performed to target internal transcribed spacer (ITS) and/or D1/D2 regions. Target DNA sequencing identified five Lichtheimia isolates, two Rhizopus microsporus isolates, two Rhizomucor pusillus isolates, one Cunninghamella bertholletiae isolate, one Mucor fragilis isolate, and one Syncephalastrum racemosum isolate. Five of the 12 (41.7%) isolates were incorrectly identified on the basis of phenotypic identification. DNA sequencing showed that of these five isolates, two were Lichtheimia isolates, one was Mucor isolate, one was Rhizomucor isolate, and one was Rhizopus microspores. All the isolates were identified at the species level by ITS and/or D1/D2 analyses. Phenotypic differentiation and identification of Mucorales is difficult because different Mucorales share similar morphology. Our results indicate that the molecular methods employed in this study are valuable for identifying Mucorales.
Scheib, H.; Pleiss, J.; Kovac, A.; Paltauf, F.; Schmid, R. D.
1999-01-01
The lipases from Rhizopus and Rhizomucor are members of the family of Mucorales lipases. Although they display high sequence homology, their stereoselectivity toward triradylglycerols (sn-2 substituted triacylglycerols) varies. Four different triradylglycerols were investigated, which were classified into two groups: flexible substrates with rotatable O'-C1' ether or ester bonds adjacent to C2 of glycerol and rigid substrates with a rigid N'-C1' amide bond or a phenyl ring in sn-2. Although Rhizopus lipase shows opposite stereopreference for flexible and rigid substrates (hydrolysis in sn-1 and sn-3, respectively), Rhizomucor lipase hydrolyzes both groups of triradylglycerols preferably in sn-1. To explain these experimental observations, computer-aided molecular modeling was applied to study the molecular basis of stereoselectivity. A generalized model for both lipases of the Mucorales family highlights the residues mediating stereoselectivity: (1) L258, the C-terminal neighbor of the catalytic histidine, and (2) G266, which is located in a loop contacting the glycerol backbone of a bound substrate. Interactions with triradylglycerol substrates are dominated by van der Waals contacts. Stereoselectivity can be predicted by analyzing the value of a single substrate torsion angle that discriminates between sn-1 and sn-3 stereopreference for all substrates and lipases investigated here. This simple model can be easily applied in enzyme and substrate engineering to predict Mucorales lipase variants and synthetic substrates with desired stereoselectivity. PMID:10210199
Chen, Xingxuan; Wang, Xiahui; Xue, Yiyun; Zhang, Tian-Ao; Li, Yuhao; Hu, Jiajun; Tsang, Yiu Fai; Zhang, Hongsheng; Gao, Min-Tian
2018-06-01
Rice straw can be used as carbon sources for lactic acid fermentation. However, only a small amount of lactic acid is produced even though Rhizopus oryzae can consume glucose in rice straw-derived hydrolysates. This study correlated the inhibitory effect of rice straw with rice straw-derived dissolved organic matter (DOM). Lactic acid fermentations with and without DOM were conducted to investigate the effect of DOM on lactic acid fermentation by R. oryzae. Fermentation using control medium with DOM showed a similar trend to fermentation with rice straw-derived hydrolysates, showing that DOM contained the major inhibitor of rice straw. DOM assay indicated that it mainly consisted of polyphenols and polysaccharides. The addition of polyphenols and polysaccharides derived from rice straw confirmed that lactic acid fermentation was promoted by polysaccharides and significantly inhibited by polyphenols. The removal of polyphenols also improved lactic acid production. However, the loss of polysaccharides during the removal of polyphenols resulted in low glucose consumption. This study is the first to investigate the effects of rice straw-derived DOM on lactic acid fermentation by R. oryzae. The results may provide a theoretical basis for identifying inhibitors and promoters associated with lactic acid fermentation and for establishing suitable pretreatment methods. Copyright © 2018 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Denardi-Souza, Taiana; Luz, Carlos; Mañes, Jordi; Badiale-Furlong, Eliana; Meca, Giuseppe
2018-03-30
In this study the antifungal potential of a phenolic extract obtained from rice bran fermented with Rhizopus oryzae CECT 7560 and its application in the elaboration of bread was assessed. Eighteen compounds with antifungal potential were identified by LC-ESI-qTOF-MS in the extract: organic acids, gallates and gallotannins, flavonoids, ellagic acid and benzophenone derivatives. The extract was active against strains of Fusarium, Aspergillus and Penicillium, with minimum inhibitory concentration ranging from 390 to 3100 µg mL -1 and minimum fungicidal concentration variable from 780 to 6300 µg mL -1 . The strains that were most sensitive to the phenolic extract were F. graminearum, F. culmorum, F. poae, P. roqueforti, P. expansum and A. niger. The phenolic extract added at 5 and 1 g kg -1 concentrations in the preparation of bread loaves contaminated with P. expansum produced a reduction of 0.6 and 0.7 log CFU g -1 . The bread loaves treated with calcium propionate and 10 g kg -1 of the phenolic extract evidenced an improvement in their shelf lives of 3 days. The phenolic extract assessed in this study could be considered as an alternative for inhibiting toxigenic fungi and as a substitute for synthetic compounds in food preservation. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.
Clementz, Adriana L; Del Peso, Gonzalo; Canet, Albert; Yori, Juan C; Valero, Francisco
2016-09-01
In this study the possibility of using discard bovine bone as support for immobilization of Rhizopus oryzae lipase expressed in Pichia pastoris was analyzed. Discard bovine bone were milled and then subjected to a chemical treatment with acetone in order to remove lipids and blood traces. Two types of supports were evaluated: bovine bone and calcined bovine bone for 2 h at 600°C. Supports were characterized by: ICP, SEM, XRD, FTIR, XPS, and N 2 adsorption isotherms. Calcined bovine bone presented appropriate characteristics for the lipase immobilization due to the removal of collagen: high porosity, large surface area and suitable porous structure. Biocatalysts were prepared with different initial enzyme load. For the equilibrium adsorption studies, the Langmuir isotherm was used to fit the data results. The immobilization occurs in monolayer to a value of 35 UA mg -1 . The activities of biocatalysts were tested in transesterification reaction of olive oil. For the enzyme load used in the test, a final yield percentage of 49.6 was achieved after six methanol additions and 180 min of reaction, similar values were obtained using Relizyme as support. Therefore, the bovine bone discard is an economical and appropriate choice for use support immobilization of enzymes. © 2016 American Institute of Chemical Engineers Biotechnol. Prog., 32:1246-1253, 2016. © 2016 American Institute of Chemical Engineers.
NASA Astrophysics Data System (ADS)
Safitri, Anna; Mahardini, Putri; Prasetyawan, Sasangka; Roosdiana, Anna
2018-01-01
In this work, the study of biosorption of Cr(VI) from aqueous solution was conducted using Rhizopus oryzae, Bacillus firmus, and Trichoderma viride as microorganisms that can absorb Cr(VI). The research is focused on determination of optimum conditions including pH, the number of R. oryzae, B. firmus, and T. viride (inoculums), and initial concentrations of Cr(VI) used. Optimum pH was obtained at pH 5, 4.5 and 6, for biosorption of Cr(VI) with R. oryzae, B. firmus, and T. viride, respectively, in the capacity of 45.3%, 24.5%, and 90.3%. The highest amount of Cr(VI) adsorbed for biosorption with R. oryzae, B. firmus, and T. viride, were 55.4%, 18.5%, and 74.5%, respectively, using 6-mL inoculums. The equilibrium concentrations achieved for R. oryzae, B. firmus, and T. viride were 60 mg/mL, 40 mg/mL, and 40 mg/mL, with the amount of Cr(VI) adsorbed were 32.4%, 28.2%, and 89.3%, respectively. The adsorption capacity for R. oryzae, B. firmus, and T. viride were 45.3 mg/1×106 colonies, 36.2 mg/1×106 cells, and 77.8 mg/1×106 colonies, respectively. Overall, the biosorbents effectivity order in the biosorption process of Cr(VI) are T. viride > R. oryzae > B. firmus.
Pan, Xiaoqi; Zhu, Benzhong; Luo, Yunbo; Fu, Daqi
2013-01-01
Plants are endowed with a sophisticated defense mechanism that gives signals to plant cells about the immediate danger from surroundings and protects them from pathogen invasion. In the search for the particular proteins involved in fruit defense responses, we report here a comparative analysis of tomato fruit (Solanum lycopersicum cv. Ailsa Craig) infected by Rhizopus nigricans Ehrenb, which is a significant contributor to postharvest rot disease in fresh tomato fruits. In total, four hundred forty-five tomato proteins were detected in common between the non-infected group and infected tomato fruit of mature green. Forty-nine differentially expressed spots in 2-D gels were identified, and were sorted into fifteen functional groups. Most of these proteins participate directly in the stress response process, while others were found to be involved in several equally important biological processes: protein metabolic process, carbohydrate metabolic process, ethylene biosynthesis, and cell death and so on. These responses occur in different cellular components, both intra- and extracellular spaces. The differentially expressed proteins were integrated into several pathways to show the regulation style existing in tomato fruit host. The composition of the collected proteins populations and the putative functions of the identified proteins argue for their roles in pathogen-plant interactions. Collectively results provide evidence that several regulatory pathways contribute to the resistance of tomato fruit to pathogen. PMID:24023804
Liu, Huan; Yue, Xuemin; Jin, Yuhan; Wang, Meng; Deng, Li; Wang, Fang; Tan, Tianwei
2017-10-01
Fumaric acid production from lignocellulosic materials is an alternative chemicals production system. This work investigated the suitable conditions for hydrolysis of dried distiller's grains with solubles (DDGS). The hydrolytic liquid was subsequently used for the production of fumaric acid. After optimizing the hydrolysis conditions, the most suitable concentration of H 2 SO 4 (2%), hydrolysis temperature (120 °C), hydrolysis time (100min) and solid/liquid ratio (1:10) were obtained. The yield of monosaccharides reached 258 mg/g DDGS and 15.88 g/L glucose, 7.53 g/L xylose and 2.35 g/L arabinose were obtained in unprocessed hydrolytic liquid. The furfural inhibitor in the hydrolytic liquid was also detected and the yield of it was reducing progressively in the pretreatment process. The ferment ability of the hydrolytic liquid from DDGS was tested through the process of fumaric acid production by Rhizopus arrhizus RH 7-13. The unprocessed hydrolytic liquid was not appropriate for the fermentation process. The yield of fumaric acid from the concentrated processed hydrolytic liquid reached 18.93 g/L, which was close to the yield of fermenting 80 g/L glucose. This result indicated that the commonly used carbon resource glucose could to some extent be replaced by processed hydrolytic liquid. Copyright © 2017 Elsevier Ltd. All rights reserved.
Evaluation of aerial microbial pollutants in Al-Haram Al-Nabawi during pilgrimage of 2013.
Alananbeh, Kholoud M; Boquellah, Nahla; Kaff, Nadia Al; Ahmadi, Majid Al
2017-01-01
Al-Madinah Al-Munawwarah is the second holiest site in Islam. The possibility of new emerging microbes is valid due to the increased number of pilgrims. The objectives of the current study were to estimate the numbers of fungi and bacteria inside and outside Al-Haram Al-Nabawi and to find whether new bacterial and fungal species have emerged compared to previous studies. Air samples were collected twice a day from 12 spots and four directions during the pilgrim year of 2013 for four consecutive weeks by using the sedimentation method. Thirty five genera and fifty eight species were identified. The most recovered bacterial genera were Staphylococcus, Micrococcus, Bacillus, and Dermacoccus with 32.47%, 18.18%, 12.85%, and 11.23%, respectively. Fifty nine isolates of fungi were molecularly identified. Aspergillus species had the highest percentage (78%). The other fungal genera identified ( Alternaria triticina , Emericella nidulans , Emericella striata , Mucor circinelloides , Penicillium chrysogenum , Penicillium minioluteum , Rhizopus arrhizus , Rhizopus oryzae , and Syncephalastrum racemosum ) had less than 5% frequency. In places such as Al-Haram Al-Nabawi, a large and crowded public (millions) exist especially during pilgrimages and Ramadan, thus, exposure to microorganisms is high. On the other hand, microorganism infectivity depends on many factors including their virulence, landing site, and person's immunity. For those reasons, many aspects should be considered to avoid aerosol contaminants.
Adak, Sunita; Datta, Sougata; Bhattacharya, Santanu; Banerjee, Rintu
2015-11-01
An insight into the effects of new ionic liquid-type gemini imidazolium cationic surfactants on the structure and function of the lipases is of prime importance for their potential application. Changes in the activity, stability and structure of Rhizopus oryzae lipase in the presence of novel gemini surfactants, [C16-3-C16im]Br2 and [C16-12-C16im]Br2 were probed in the present study. Surfactant with shorter spacer length, [C16-3-C16im]Br2 was found to be better in improving the hydrolytic activity and thermal stability of the lipase. For both the surfactants, activation was concentration dependent. CD spectroscopy results showed a decrease in α-helix and an increase in β-sheet content in the presence of these surfactants. A higher structural change observed in presence of [C16-12-C16im]Br2 correlated with lower enzyme activity. Isothermal titration calorimetric studies showed the binding to be spontaneous in nature based on sequential two site binding model. The forces involved in binding were found to differ for the two surfactants proving that the spacer length is an important factor which governs the interaction. These surfactants could be used as promising components both in enzyme modification and media engineering for attaining the desired goals in biocatalytic reactions. Copyright © 2015 Elsevier B.V. All rights reserved.
USDA-ARS?s Scientific Manuscript database
The hyphomycete Paecilomyces fumosoroseus (Pfr) is a geographically widespread fungus capable of infecting various insect hosts. The fungus has been used for the biological control of several important insect pests of agriculture. However knowledge of the fungus’ genetic diversity and population str...
Metacridamides A and B from the biocontrol fungus metarhizium acridum
USDA-ARS?s Scientific Manuscript database
Metarhizium acridum, an entomopathogenic fungus, has been commercialized and used successfully for biocontrol of grasshopper pests in Africa and Australia. As part of an effort to catalog the secondary metabolites of this fungus we discovered that its conidia produce two novel 17-membered macrocycl...
USDA-ARS?s Scientific Manuscript database
The fungus Slafractonia leguminicola, the causal agent of blackpatch disease of legumes produces two mycotoxins slaframine and swainsonine, causing slobbers’ symptoms and locoism of grazing animals, respectively. The genetics of this important fungus is poorly understood. This work aimed to develop ...
USDA-ARS?s Scientific Manuscript database
Eighty years ago, Alexander Fleming described the antibiotic effects of a fungus that had contaminated his bacterial culture, kick starting the antimicrobial revolution. The fungus was later ascribed to a globally distributed asexual species, Penicillium chrysogenum. Recently, the species has been...
Mating and Progeny Isolation in The Corn Smut Fungus Ustilago maydis
USDA-ARS?s Scientific Manuscript database
The corn smut pathogen, Ustilago maydis (U. maydis) (DC.) Corda, is a semi-obligate plant pathogenic fungus in the phylum Basidiomycota (Alexopoulos, Mims and Blackwell, 1996). The fungus can be easily cultured in its haploid yeast phase on common laboratory media. However, to complete its sexual cy...
Chronicles of Fibroporia radiculosa (= Antrodia radiculosa) TFFH 294
Carol A. Clausen; Katie M. Jenkins
2011-01-01
The brown-rot fungus, Fibroporia radiculosa, has been included in numerous research studies because many isolates of this fungus demonstrate an unusually high tolerance to copper. This fungus has undergone several recognized changes in taxonomic nomenclature, and through DNA technology, scientists have correctly identified isolates that had been misidentified...
Naphthalene, an insect repellent, is produced by Muscodor vitigenus, a novel endophytic fungus
Bryn H. Daisy; Gary A. Strobel; Uvidelio Castillo; David Ezra; Joe Sears; David K. Weaver; Justin B. Runyon
2002-01-01
Muscodor vitigenus is a recently described endophytic fungus of Paullinia paullinioides, a liana growing in the understorey of the rainforests of the Peruvian Amazon. This fungus produces naphthalene under certain cultural conditions. Naphthalene produced by M. vitigenus was identified by gas chromatography/mass...
Jeon, Sun Jeong; Nguyen, Thi Thuong Thuong; Lee, Hyang Burm
2015-09-01
A seed-borne fungus, Curvularia sp. EML-KWD01, was isolated from an indigenous wheat seed by standard blotter method. This fungus was characterized based on the morphological characteristics and molecular phylogenetic analysis. Phylogenetic status of the fungus was determined using sequences of three loci: rDNA internal transcribed spacer, large ribosomal subunit, and glyceraldehyde 3-phosphate dehydrogenase gene. Multi loci sequencing analysis revealed that this fungus was Curvularia spicifera within Curvularia group 2 of family Pleosporaceae.
Specific, non-nutritional association between an ascomycete fungus and Allomerus plant-ants.
Ruiz-González, Mario X; Malé, Pierre-Jean G; Leroy, Céline; Dejean, Alain; Gryta, Hervé; Jargeat, Patricia; Quilichini, Angélique; Orivel, Jérôme
2011-06-23
Ant-fungus associations are well known from attine ants, whose nutrition is based on a symbiosis with basidiomycete fungi. Otherwise, only a few non-nutritional ant-fungus associations have been recorded to date. Here we focus on one of these associations involving Allomerus plant-ants that build galleried structures on their myrmecophytic hosts in order to ambush prey. We show that this association is not opportunistic because the ants select from a monophyletic group of closely related fungal haplotypes of an ascomycete species from the order Chaetothyriales that consistently grows on and has been isolated from the galleries. Both the ants' behaviour and an analysis of the genetic population structure of the ants and the fungus argue for host specificity in this interaction. The ants' behaviour reveals a major investment in manipulating, growing and cleaning the fungus. A molecular analysis of the fungus demonstrates the widespread occurrence of one haplotype and many other haplotypes with a lower occurrence, as well as significant variation in the presence of these fungal haplotypes between areas and ant species. Altogether, these results suggest that such an interaction might represent an as-yet undescribed type of specific association between ants and fungus in which the ants cultivate fungal mycelia to strengthen their hunting galleries.
Pathogenic nature of Syncephalastrum in Atta sexdens rubropilosa fungus gardens.
Barcoto, Mariana O; Pedrosa, Felipe; Bueno, Odair C; Rodrigues, Andre
2017-05-01
Leaf-cutter ants are considered to be a major herbivore and agricultural pest in the Neotropics. They are often controlled by environmentally persistent insecticides. Biological control using pathogenic fungi is regarded as an alternative for the management of these insects. Here, we assess whether the filamentous fungus Syncephalastrum sp. is a pathogenic microorganism responsible for a characteristic disease in fungus gardens. We also characterise the damage caused by this fungus by evaluating physiological and behavioural responses of Atta sexdens rubropilosa subcolonies infected with Syncephalastrum sp. Syncephalastrum sp. fulfils Koch's postulates characterising it as a pathogenic microorganism. Ant workers recognise the infection and remove contaminated fragments from the fungus garden. Syncephalastrum sp. infection causes an interruption of foraging activity, an increase in ant mortality, subcolony deterioration and an increase in the amount of waste generated, all resulting in subcolony death. Syncephalastrum sp. also inhibits the ant fungal cultivar in vitro. The pathogenic effect of Syncephalastrum sp. does not depend on host morbidity or stress (e.g. worker mortality caused by an entomopathogenic fungus). Syncephalastrum sp. treatment resulted in progressive damage in subcolonies. The interactions among Syncephalastrum sp., fungus garden and ants offer new opportunities in integrated pest management of leaf-cutter ants. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.
Tavela, Alexandre de Oliveira; Araújo, Jackson Victor; Braga, Fábio Ribeiro; Silva, André Ricardo; Carvalho, Rogério Oliva; Araujo, Juliana Milani; Ferreira, Sebastião Rodrigo; Carvalho, Giovanni Ribeiro
2011-01-10
Horses are hosts to a wide variety of helminthes; the most important are the cyathostomin, or small strongyles. The viability of a fungal formulation (pellets) using the nematode-trapping fungus Monacrosporium thaumasium was assessed in biological control of horse cyathostomin. Two groups (fungus-treated and control) consisted of six mares in each group, crossbred (ages of 2.5 and 3.5 years), were placed in pastures of Cynodon sp. naturally infected with horse cyathostomin larvae. In the treated group, each animal received 1g/10 kg body weight (0.2g/10 kg live weight of fungus) of pellets of sodium alginate matrix containing the fungus M. thaumasium orally, twice a week for 6 months. In the control group, animals received (1g/10 kg body weight) of pellets without fungus. The egg count per gram of feces showed difference (p<0.01) in the animals treated with the fungus in relation to the control animals during all months of the experiment. The EPG percentage decrease were 87.5%, 89.7%, 68.3%, 58.7%, 52.5% and 35.2% during June, July, August, September, October and November, respectively. In faecal cultures, there was difference (p<0.05) among animals treated with fungus was found in relation to the control animals during all the experiment month, with percentage reduction of 67.5%, 61.4% and 31.8% in September, October and November, respectively. Difference (p<0.01) was observed in the recovery of infective larvae from pastures that were collected up to 20 cm from the dung pats in pastures in the group treated with the fungus in relation to the control group with a reduction of 60.9% and between 0-20 and 0-40 cm from the faecal pat reduction (p<0.01) was about 56% in the group treated with the fungus M. thaumasium in relation to the control group pasture. There was no difference (p>0.05) between the average weight gains in both animal groups. The treatment of horses with pellets containing the nematophagous fungus M. thaumasium can be effective in controlling cyathostomin in the tropical region of southeastern Brazil. Copyright © 2010 Elsevier B.V. All rights reserved.
Biochemical Characterization of Fungus Isolated during In vitro Propagation of Bambusa balcooa.
Tyagi, Bhawna; Tewari, Salil; Dubey, Ashutosh
2018-01-01
Bambusa balcooa ( Poaceae: Bambusoideae ) is a multipurpose bamboo species, which is native of the Indian subcontinent. B. balcooa is regarded as one of the best species for scaffolding and building purposes because of its strong culm. Other uses include paper pulp, handicrafts, and products of the wood chip industry. Due to these various uses in industries, this species has been identified as one of the priority bamboos by the National Bamboo Mission. This study is designed to analyze the identification of fungus and develop the strategy to eliminate the contamination during in vitro establishment of B. balcooa through nodal part. Fungus contamination is a problem which is encountered during in vitro establishment of B. balcooa cultures. In the present study, fungus contamination from in vitro cultured plant has been isolated and subjected to partial sequence analysis of the 18S rRNA gene to identify the fungus strain. Experiments were designed to develop a strategy for removal of the fungus contamination with the help of antifungal compounds and commercial antimicrobial supplement supplied by HiMedia. Fusarium equiseti was identified as endophytic fungus. It was observed that antimicrobial supplement at concentration of 500 μl/l was more effective concentration to remove fungus contamination and not showed any detrimental effect on growth parameters of shoot. This experiment would help in identification and to get rid of fungal contamination and improve the in vitro establishment of B. balcooa cultures for large-scale propagation. Endogenous fungus was isolated from contaminated culture of B. balcooa , and it was identified as Fusarium equiseti and submitted to NCBI under accession no. KP274872. The endophytic fungus had shown substantial production of amylase, cellulase, and protease media. Gibberellic acid (GA 3 ) production by F. equiseti was maximum on the 7 th day on inoculation. Abbreviations used: B. balcooa : Bambusa balcooa , F. equiseti : Fusarium equiseti , PDA: Potato dextrose agar, PCR: Polymerase chain reaction, MS: Murashige and Skoog's, BAP: 6-Benzylaminopurine, ITS1/4: Internal transcribed spacer region 1/4, GA 3 : Gibberellic acid.
2014-01-01
Background Entomopathogenic fungi are potential candidates for use in integrated vector management, with recent emphasis aimed at developing adult mosquito control methods. Here we investigated the persistence of the fungus Metarhizium anisopliae when tested against female A. aegypti under field conditions. Methods Black cotton cloths impregnated with M. anisopliae conidia, formulated in vegetable oil + isoparaffin, were maintained on a covered veranda for up to 30 days. At specific times, pieces of the cloths were removed, placed in Tween 80 and the resuspended conidia were sprayed directly onto mosquitoes. The persistence of conidia impregnated on black cloths using three different carriers was evaluated in test rooms. Fifty mosquitoes were released into each room and after a 5 day period, the surviving insects were captured. Another 50 insects were then released into each room. The capacity of the fungus at reducing mosquito survival was evaluated over a total of 35 days. Results Conidia extracted from cloths maintained on the veranda for 2 to 18 days remained virulent, with 28 to 60% mosquito survival observed. Mosquito survival following exposure to fungus impregnated cloths showed that fungus + Tween caused similar reductions to that of fungus + vegetable oil. Mosquitoes exposed to the formulation fungus + vegetable oil had survival rates of 36% over the first 5 days of the experiment. Following the release of the second cohort of mosquitoes (6-11days), survival increased to 50%. The survival of the 12–17 day cohort (78%) was statistically equal to that of the controls (84%). Formulation of the fungus in vegetable oil + isoparaffin increased the persistence of the fungus, with the 18–23 day cohort (64% survival) still showing statistical differences to that of the controls (87% survival). Conclusions The potential of entomopathogenic fungi for the control of adult A. aegypti was confirmed under field conditions. Vegetable oil + isoparaffin formulations of M. anisopliae significantly increased the effectiveness of the fungus, thus reducing the need for frequent changes of black cloths in residences. Our future aim is to obtain effective control of mosquito populations, with cloths only needing to being replaced once a month. PMID:24766705
Carolino, Aline T; Paula, Adriano R; Silva, Carlos P; Butt, Tariq M; Samuels, Richard I
2014-04-25
Entomopathogenic fungi are potential candidates for use in integrated vector management, with recent emphasis aimed at developing adult mosquito control methods. Here we investigated the persistence of the fungus Metarhizium anisopliae when tested against female A. aegypti under field conditions. Black cotton cloths impregnated with M. anisopliae conidia, formulated in vegetable oil + isoparaffin, were maintained on a covered veranda for up to 30 days. At specific times, pieces of the cloths were removed, placed in Tween 80 and the resuspended conidia were sprayed directly onto mosquitoes. The persistence of conidia impregnated on black cloths using three different carriers was evaluated in test rooms. Fifty mosquitoes were released into each room and after a 5 day period, the surviving insects were captured. Another 50 insects were then released into each room. The capacity of the fungus at reducing mosquito survival was evaluated over a total of 35 days. Conidia extracted from cloths maintained on the veranda for 2 to 18 days remained virulent, with 28 to 60% mosquito survival observed. Mosquito survival following exposure to fungus impregnated cloths showed that fungus + Tween caused similar reductions to that of fungus + vegetable oil. Mosquitoes exposed to the formulation fungus + vegetable oil had survival rates of 36% over the first 5 days of the experiment. Following the release of the second cohort of mosquitoes (6-11days), survival increased to 50%. The survival of the 12-17 day cohort (78%) was statistically equal to that of the controls (84%). Formulation of the fungus in vegetable oil + isoparaffin increased the persistence of the fungus, with the 18-23 day cohort (64% survival) still showing statistical differences to that of the controls (87% survival). The potential of entomopathogenic fungi for the control of adult A. aegypti was confirmed under field conditions. Vegetable oil + isoparaffin formulations of M. anisopliae significantly increased the effectiveness of the fungus, thus reducing the need for frequent changes of black cloths in residences. Our future aim is to obtain effective control of mosquito populations, with cloths only needing to being replaced once a month.
Somera, Alexandre F.; Lima, Adriel M.; dos Santos-Neto, Álvaro J.; Lanças, Fernando M.
2015-01-01
Leaf-cutter ants use plant matter to culture the obligate mutualistic basidiomycete Leucoagaricus gongylophorus. This fungus mediates ant nutrition on plant resources. Furthermore, other microbes living in the fungus garden might also contribute to plant digestion. The fungus garden comprises a young sector with recently incorporated leaf fragments and an old sector with partially digested plant matter. Here, we show that the young and old sectors of the grass-cutter Atta bisphaerica fungus garden operate as a biphasic solid-state mixed fermenting system. An initial plant digestion phase occurred in the young sector in the fungus garden periphery, with prevailing hemicellulose and starch degradation into arabinose, mannose, xylose, and glucose. These products support fast microbial growth but were mostly converted into four polyols. Three polyols, mannitol, arabitol, and inositol, were secreted by L. gongylophorus, and a fourth polyol, sorbitol, was likely secreted by another, unidentified, microbe. A second plant digestion phase occurred in the old sector, located in the fungus garden core, comprising stocks of microbial biomass growing slowly on monosaccharides and polyols. This biphasic operation was efficient in mediating symbiotic nutrition on plant matter: the microbes, accounting for 4% of the fungus garden biomass, converted plant matter biomass into monosaccharides and polyols, which were completely consumed by the resident ants and microbes. However, when consumption was inhibited through laboratory manipulation, most of the plant polysaccharides were degraded, products rapidly accumulated, and yields could be preferentially switched between polyols and monosaccharides. This feature might be useful in biotechnology. PMID:25911490
Somera, Alexandre F; Lima, Adriel M; Dos Santos-Neto, Álvaro J; Lanças, Fernando M; Bacci, Maurício
2015-07-01
Leaf-cutter ants use plant matter to culture the obligate mutualistic basidiomycete Leucoagaricus gongylophorus. This fungus mediates ant nutrition on plant resources. Furthermore, other microbes living in the fungus garden might also contribute to plant digestion. The fungus garden comprises a young sector with recently incorporated leaf fragments and an old sector with partially digested plant matter. Here, we show that the young and old sectors of the grass-cutter Atta bisphaerica fungus garden operate as a biphasic solid-state mixed fermenting system. An initial plant digestion phase occurred in the young sector in the fungus garden periphery, with prevailing hemicellulose and starch degradation into arabinose, mannose, xylose, and glucose. These products support fast microbial growth but were mostly converted into four polyols. Three polyols, mannitol, arabitol, and inositol, were secreted by L. gongylophorus, and a fourth polyol, sorbitol, was likely secreted by another, unidentified, microbe. A second plant digestion phase occurred in the old sector, located in the fungus garden core, comprising stocks of microbial biomass growing slowly on monosaccharides and polyols. This biphasic operation was efficient in mediating symbiotic nutrition on plant matter: the microbes, accounting for 4% of the fungus garden biomass, converted plant matter biomass into monosaccharides and polyols, which were completely consumed by the resident ants and microbes. However, when consumption was inhibited through laboratory manipulation, most of the plant polysaccharides were degraded, products rapidly accumulated, and yields could be preferentially switched between polyols and monosaccharides. This feature might be useful in biotechnology. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Phomalactone from a phytopathogenic fungus infecting Zinnia elegans (Asteraceae) leaves
USDA-ARS?s Scientific Manuscript database
Zinnia elegans plants are infected by a fungus that causes necrosis with dark red spots particularly in late spring to the middle of summer in the Mid-South part of the United States. This fungal disease when untreated causes the leaves to wilt and eventually kills the plant. The fungus was isolated...
White-Nose Syndrome Fungus in a 1918 Bat Specimen from France.
Campana, Michael G; Kurata, Naoko P; Foster, Jeffrey T; Helgen, Lauren E; Reeder, DeeAnn M; Fleischer, Robert C; Helgen, Kristofer M
2017-09-01
White-nose syndrome, first diagnosed in North America in 2006, causes mass deaths among bats in North America. We found the causative fungus, Pseudogymnoascus destructans, in a 1918 sample collected in Europe, where bats have now adapted to the fungus. These results are consistent with a Eurasian origin of the pathogen.
Contents and Structure Atta texana Nest in Summer
John C. Moser
1963-01-01
A large nest of Atta texana (Buckley) in central Louisiana was partially excavated in August 1960. Twelve dormancy, 5 detritus, and 93 fungus-garden cavities were found. Fungus-garden cavities near the surface outnumbered those at lower depths and contained most of the fungus material and brood. Inquilines were most numerous in detritus cavities....
Aylward, Frank O.; Tremmel, Daniel M.; Bruce, David C.; Chain, Patrick; Chen, Amy; Walston Davenport, Karen; Detter, Chris; Han, Cliff S.; Han, James; Huntemann, Marcel; Ivanova, Natalia N.; Kyrpides, Nikos C.; Markowitz, Victor; Mavrommatis, Kostas; Nolan, Matt; Pagani, Ioanna; Pati, Amrita; Pitluck, Sam; Deshpande, Shweta; Goodwin, Lynne; Woyke, Tanja
2013-01-01
The Enterobacteriaceae bacterium strain FGI 57 was isolated from a fungus garden of the leaf-cutter ant Atta colombica. Analysis of its single 4.76-Mbp chromosome will shed light on community dynamics and plant biomass degradation in ant fungus gardens. PMID:23469353
Aylward, Frank O.; Tremmel, Daniel M.; Starrett, Gabriel J.; Bruce, David C.; Chain, Patrick; Chen, Amy; Davenport, Karen W.; Detter, Chris; Han, Cliff S.; Han, James; Huntemann, Marcel; Ivanova, Natalia N.; Kyrpides, Nikos C.; Markowitz, Victor; Mavrommatis, Kostas; Nolan, Matt; Pagani, Ioanna; Pati, Amrita; Pitluck, Sam; Teshima, Hazuki; Deshpande, Shweta; Goodwin, Lynne; Woyke, Tanja
2013-01-01
Serratia sp. strain FGI 94 was isolated from a fungus garden of the leaf-cutter ant Atta colombica. Analysis of its 4.86-Mbp chromosome will help advance our knowledge of symbiotic interactions and plant biomass degradation in this ancient ant-fungus mutualism. PMID:23516234
Miyashira, C.H.; Tanigushi, D.G.; Gugliotta, A.M.; Santos, D.Y.A.C.
2010-01-01
In vitro culture of the mutualistic fungus of leaf-cutting ants is troublesome due to its low growth rate, which leads to storage problems and contaminants accumulation. This paper aims at comparing the radial growth rate of the mutualistic fungus of Atta sexdens rubropilosa Forel in two different culture media (Pagnocca B and MEA LP). Although total MEA LP radial growth was greater all along the bioassay, no significant difference was detected between growth efficiencies of the two media. Previous evidences of low growth rate for this fungus were confirmed. Since these data cannot point greater efficiency of one culture medium over the other, MEA LP medium is indicated for in vitro studies with this mutualistic fungus due its simpler composition and translucent color, making the analysis easier. PMID:24031524
Ważny, Rafał; Rozpądek, Piotr; Jędrzejczyk, Roman J; Śliwa, Marta; Stojakowska, Anna; Anielska, Teresa; Turnau, Katarzyna
2018-04-01
Phytoremediation of polluted sites can be improved by co-inoculation with mycorrhizal and endophytic fungi. In this study, the effects of single- and co-inoculation of Lactuca serriola with an arbuscular mycorrhizal (AM) fungus, Rhizoglomus intraradices, and endophytic fungi, Mucor sp. or Trichoderma asperellum, on plant growth, vitality, toxic metal accumulation, sesquiterpene lactone production and flavonoid concentration in the presence of toxic metals were evaluated. Inoculation with the AM fungus increased biomass yield of the plants grown on non-polluted and polluted substrate. Co-inoculation with the AM fungus and Mucor sp. resulted in increased biomass yield of plants cultivated on the polluted substrate, whereas co-inoculation with T. asperellum and the AM fungus increased plant biomass on the non-polluted substrate. In the presence of Mucor sp., mycorrhizal colonization and arbuscule richness were increased in the non-polluted substrate. Co-inoculation with the AM fungus and Mucor sp. increased Zn concentration in leaves and roots. The concentration of sesquiterpene lactones in plant leaves was decreased by AM fungus inoculation in both substrates. Despite enhanced host plant costs caused by maintaining symbiosis with numerous microorganisms, interaction of wild lettuce with both mycorrhizal and endophytic fungi was more beneficial than that with a single fungus. The study shows the potential of double inoculation in unfavourable environments, including agricultural areas and toxic metal-polluted areas.
The Dynamics of Plant Cell-Wall Polysaccharide Decomposition in Leaf-Cutting Ant Fungus Gardens
Harholt, Jesper; Willats, William G. T.; Boomsma, Jacobus J.
2011-01-01
The degradation of live plant biomass in fungus gardens of leaf-cutting ants is poorly characterised but fundamental for understanding the mutual advantages and efficiency of this obligate nutritional symbiosis. Controversies about the extent to which the garden-symbiont Leucocoprinus gongylophorus degrades cellulose have hampered our understanding of the selection forces that induced large scale herbivory and of the ensuing ecological footprint of these ants. Here we use a recently established technique, based on polysaccharide microarrays probed with antibodies and carbohydrate binding modules, to map the occurrence of cell wall polymers in consecutive sections of the fungus garden of the leaf-cutting ant Acromyrmex echinatior. We show that pectin, xyloglucan and some xylan epitopes are degraded, whereas more highly substituted xylan and cellulose epitopes remain as residuals in the waste material that the ants remove from their fungus garden. These results demonstrate that biomass entering leaf-cutting ant fungus gardens is only partially utilized and explain why disproportionally large amounts of plant material are needed to sustain colony growth. They also explain why substantial communities of microbial and invertebrate symbionts have evolved associations with the dump material from leaf-cutting ant nests, to exploit decomposition niches that the ant garden-fungus does not utilize. Our approach thus provides detailed insight into the nutritional benefits and shortcomings associated with fungus-farming in ants. PMID:21423735
Kawauchi, Moriyuki; Nishiura, Mika
2013-01-01
The sirtuins are members of the NAD+-dependent histone deacetylase family that contribute to various cellular functions that affect aging, disease, and cancer development in metazoans. However, the physiological roles of the fungus-specific sirtuin family are still poorly understood. Here, we determined a novel function of the fungus-specific sirtuin HstD/Aspergillus oryzae Hst4 (AoHst4), which is a homolog of Hst4 in A. oryzae yeast. The deletion of all histone deacetylases in A. oryzae demonstrated that the fungus-specific sirtuin HstD/AoHst4 is required for the coordination of fungal development and secondary metabolite production. We also show that the expression of the laeA gene, which is the most studied fungus-specific coordinator for the regulation of secondary metabolism and fungal development, was induced in a ΔhstD strain. Genetic interaction analysis of hstD/Aohst4 and laeA clearly indicated that HstD/AoHst4 works upstream of LaeA to coordinate secondary metabolism and fungal development. The hstD/Aohst4 and laeA genes are fungus specific but conserved in the vast family of filamentous fungi. Thus, we conclude that the fungus-specific sirtuin HstD/AoHst4 coordinates fungal development and secondary metabolism via the regulation of LaeA in filamentous fungi. PMID:23729383
Biological control of Ascaris suum eggs by Pochonia chlamydosporia fungus.
Ferreira, Sebastião Rodrigo; de Araújo, Jackson Victor; Braga, Fábio Ribeiro; Araujo, Juliana Milani; Frassy, Luiza Neme; Ferreira, Aloízio Soares
2011-12-01
Ascaris suum is a gastrointestinal nematode parasite of swines. The aim of this study was to observe Pochonia chlamydosporia fungus on biological control of A. suum eggs after fungus passage through swines gastrointestinal tract. Eighteen pigs, previously dewormed, were randomly divided into three groups: group 1, treated with the fungus isolate VC4; group 2, treated with the fungus isolate VC1 and group 3 did not receive fungus (control). In the treated groups, each animal received a 9 g single dose of mycelium mass containing P. chlamydosporia (VC1 or VC4). Thereafter, animal fecal samples were collected at the following intervals: 8, 12, 24, 36, 48, 72 and 96 h after treatment beginning and these were poured in Petri dishes containing 2% water-agar culture medium. Then, 1,000 A. suum eggs were poured into each dish and kept in an incubator at 26 °C and in the dark for 30 days. After this period, approximately 100 eggs were removed from each Petri dish and morphologically analyzed under light microscopy following the ovicidal activity parameters. The higher percentage observed for isolated VC4 eggs destruction was 57.5% (36 h) after fungus administration and for isolate VC1 this percentage was 45.8% (24 h and 72 h) (p > 0.01). P. chlamydosporia remained viable after passing through the gastrointestinal tract of swines, maintaining its ability of destroying A. suum eggs.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Huang, Eric L.; Aylward, Frank O.; Kim, Young-Mo
Leaf-cutter ants are dominant herbivores in ecosystems throughout the Neotropics. Rather than directly consuming the fresh foliar biomass they harvest, these ants use it to cultivate specialized fungus gardens. Although recent investigations have shed light on how plant biomass is degraded in fungus gardens, the cycling of nutrients that takes place in these specialized microbial ecosystems is still not well understood. Here, using metametabolomics and metaproteomics techniques, we examine the dynamics of nutrient turnover and biosynthesis in these gardens. Our results reveal that numerous free amino acids and sugars are depleted throughout the process of biomass degradation, indicating that easilymore » accessible nutrients from plant material are readily consumed by microbes in these ecosystems. Accumulation of cellobiose and lignin derivatives near the end of the degradation process is consistent with previous findings of cellulases and laccases produced by Leucoagaricus gongylophorus, the fungus cultivated by leaf-cutter ants. Our results also suggest that ureides may be an important source of nitrogen in fungus gardens, especially during nitrogen-limiting conditions. No free arginine was detected in our metametabolomics experiments despite evidence that the host ants cannot produce this amino acid, suggesting that biosynthesis of this metabolite may be tightly regulated in the fungus garden. These results provide new insights into the dynamics of nutrient cycling that underlie this important ant-fungus symbiosis.« less
Min Lu; Michael J. Wingfield; Nancy Gillette; Jiang-Hua Sun
2011-01-01
Novel genotypes often arise during biological invasions, but their role in invasion success has rarely been elucidated. Here we examined the population genetics and behavior of the fungus, Leptographium procerum, vectored by a highly invasive bark beetle, Dendroctonus valens, to determine whether genetic changes in the fungus...
Association of the Pitch Canker Fungus with Cones and Seeds of Pines
L. David Dwinell
1998-01-01
The pitch canker fungus, Fusarium subglutinans f. sp.pini, causes the mortality of female flowers and mature cones, and can infect and destroy gametophyte tissues of seeds of several pine species in the southeastern U.S. The fungus can also be associated with the seed coats of apparently healthy, viable pine seeds. The pitch canker...
Fun Microbiology: Using a Plant Pathogenic Fungus To Demonstrate Koch's Postulates.
ERIC Educational Resources Information Center
Mitchell, James K.; Orsted, Kathy M.; Warnes, Carl E.
1997-01-01
Describes an experiment using a plant pathogenic fungus in which students learn to follow aseptic techniques, grow and produce spores of a fungus, use a hemacytometer for enumerating spores, prepare serial dilutions, grow and inoculate plants, isolate a pure culture using agar streak plates, and demonstrate the four steps of Koch's postulates.…
Gene expression analysis of wood decay fungus Fibroporia Radiculosa grown In ACQ-treated wood
Ayfer Akgul; Ali Akgul; Juliet D. Diehl Tang
2018-01-01
Copper-tolerant brown-rot fungi are able todegrade wood treated with copper or copper-based wood preservatives. This research used quantitative reverse transcriptase polymerase chain reaction to explore what genes of the brown-rot fungus, Fibroporia radiculosa, were expressed when the fungus was overcoming the wood preservatives and decaying the...
USDA-ARS?s Scientific Manuscript database
The culture filtrate of a plant pathogenic fungus that infects English ivy (Hegera helix) was investigated for mosquitocidal constituents by bioassay guided isolation. The fungus responsible for pathogenic effects on the plant Hegera helix has been identified as Diaporthe eres by molecular technique...
Hideshi Fukuda
2003-01-01
Most woodwasps (Siricidae) are symbiotically associated with the specific fungus, Amylostereum spp. Female adults inoculate the fungus during their oviposition in sapwood of the host trees (Morgan 1968). Woodwasp larvae can digest sapwood with low nutritional quality with the aid of symbiosis (Kukor and Martin 1983). In the earlier study, we...
Using copper sulfate to control egg fungus at Keo Fish Farm
USDA-ARS?s Scientific Manuscript database
Keo Fish Farm is the biggest producer of hybrid striped bass fry in the world. The hatchery manager asked about treatments to control fungus on eggs which occurred fairly often. Our lab has been working on gaining FDA-approval to use copper sulfate to control fungus on catfish eggs, so we were con...
Mucormycosis (Mucor fungus ball) of the maxillary sinus.
Cho, Hang Sun; Yang, Hoon Shik; Kim, Kyung Soo
2014-01-01
A fungus ball is an extramucosal fungal proliferation that completely fills one or more paranasal sinuses and usually occurs as a unilateral infection. It is mainly caused by Aspergillus spp in an immunocompetent host, but some cases of paranasal fungal balls reportedly have been caused by Mucor spp. A Mucor fungus ball is usually found in the maxillary sinus and/or the sphenoid sinus and may be black in color. Patients with mucormycosis, or a Mucor fungal ball infection, usually present with facial pain or headache. On computed tomography, there are no pathognomonic findings that are conclusive for a diagnosis of mucormycosis. In this article we report a case of mucormycosis in a 56-year-old woman and provide a comprehensive review of the literature on the "Mucor fungus ball." To the best of our knowledge, 5 case reports (8 patients) have been published in which the fungus ball was thought to be caused by Mucor spp.
Biosynthesis of size-controlled gold nanoparticles using fungus, Penicillium sp.
Zhang, Xiaorong; He, Xiaoxiao; Wang, Kemin; Wang, Yonghong; Li, Huimin; Tan, Weihong
2009-10-01
The unique optoelectronic and physicochemical properties of gold nanoparticles are significantly dependent on the particle size, shape and structure. In this paper, biosynthesis of size-controlled gold nanoparticles using fungus Penicillium sp. is reported. Fungus Penicillium sp. could successfully bioreduce and nucleate AuCl4(-) ions, and lead to the assembly and formation of intracellular Au nanoparticles with spherical morphology and good monodispersity after exposure to HAuCl4 solution. Reaction temperature, as an important physiological parameter for fungus Penicillium sp. growth, could significantly control the size of the biosynthesized Au nanoparticles. The biological compositions and FTIR spectra analysis of fungus Penicillium sp. exposed to HAuCl4 solution indicated the intracellular reducing sugar played an important role in the occurrence of intracellular reduction of AuCl4(-) ions and the growth of gold nanoparticles. Furthermore, the intracellular gold nanoparticles could be easily separated from the fungal cell lysate by ultrasonication and centrifugation.
Herrera, Raúl A; Steciow, Mónica M; Natale, Guillermo S
2005-05-20
The present contribution is the first report of parasitosis by a chytrid fungus in wild anuran amphibians in Argentina, as well as the first case of amphibian mortality documented to date in Argentina. We report the presence of the chytrid fungus in dead adult Leptodactylus ocellatus. It has been suggested that chytridiomycosis is the main cause of death in several amphibian populations worldwide. Our study demonstrates that chytridiomycosis afflicts L. ocellatus, a common widespread amphibian species, and is the first report of chytridiomycosis in the Argentinian lowlands. The occurrence at this latitude would indicate an extended distribution of this fungus in wildlife populations. It is also the first report of amphibian mortality due to chytrid fungus in our country. It is noteworthy that the site of collection is situated very close to sea level in a temperate climate zone and that this represents the southern most record for South American wild amphibians.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Luey, J.; Brouns, T.M.; Elliott, M.L.
1990-11-01
The white rot fungus Phanerochaete chrysosporium has been shown to effectively degrade pollutants such as trichlorophenol, polychlorinated biphenyls (PCBs), dioxins and other halogenated aromatic compounds. These refractory organic compounds and many others have been identified in the tank waste, groundwater and soil of various US Department of Energy (DOE) sites. The treatment of these refractory organic compounds has been identified as a high priority for DOE's Research, Development, Demonstration, Testing, and Evaluation (RDDT E) waste treatment programs. Unlike many bacteria, the white rot fungus P. chrysosporium is capable of degrading these types of refractory organics and may be valuable formore » the treatment of wastes containing multiple pollutants. The objectives of this project are to identify DOE waste problems amenable to white rot fungus treatment and to develop and demonstrate white rot fungus treatment process for these hazardous organic compounds. 32 refs., 6 figs., 7 tabs.« less
Torii, Masato; Matsuda, Yosuke; Seo, Sang Tae; Kim, Kyung Hee; Ito, Shin-Ichiro; Moon, Myung Jin; Kim, Seong Hwan; Yamada, Toshihiro
2014-06-01
In Korea, mass mortality of Quercus mongolica trees has become obvious since 2004. Raffaelea quercus-mongolicae is believed to be a causal fungus contributing the mortality. To evaluate the pathogenicity of the fungus to the trees, the fungus was multiple- and single-inoculated to the seedlings and twigs of the mature trees, respectively. In both the inoculations, the fungus was reisolated from more than 50% of inoculated twigs and seedlings. In the single inoculations, proportions of the transverse area of non-conductive sapwood at inoculation points and vertical lengths of discoloration expanded from the points were significantly different between the inoculation treatment and the control. In the multiple inoculations, no mortality was confirmed among the seedlings examined. These results showed that R. quercus-mongolicae can colonize sapwood, contribute to sapwood discoloration and disrupt sap flows around inoculation sites of Q. mongolica, although the pathogenicity of the fungus was not proven.
The Evolutionary Innovation of Nutritional Symbioses in Leaf-Cutter Ants
Aylward, Frank O.; Currie, Cameron R.; Suen, Garret
2012-01-01
Fungus-growing ants gain access to nutrients stored in plant biomass through their association with a mutualistic fungus they grow for food. This 50 million-year-old obligate mutualism likely facilitated some of these species becoming dominant Neotropical herbivores that can achieve immense colony sizes. Recent culture-independent investigations have shed light on the conversion of plant biomass into nutrients within ant fungus gardens, revealing that this process involves both the fungal cultivar and a symbiotic community of bacteria including Enterobacter, Klebsiella, and Pantoea species. Moreover, the genome sequences of the leaf-cutter ants Atta cephalotes and Acromyrmex echinatior have provided key insights into how this symbiosis has shaped the evolution of these ants at a genetic level. Here we summarize the findings of recent research on the microbial community dynamics within fungus-growing ant fungus gardens and discuss their implications for this ancient symbiosis. PMID:26467948
Shida, Yosuke; Furukawa, Takanori; Ogasawara, Wataru
2016-09-01
The filamentous fungus Trichoderma reesei is a potent cellulase producer and the best-studied cellulolytic fungus. A lot of investigations not only on glycoside hydrolases produced by T. reesei, but also on the machinery controlling gene expression of these enzyme have made this fungus a model organism for cellulolytic fungi. We have investigated the T. reesei strain including mutants developed in Japan in detail to understand the molecular mechanisms that control the cellulase gene expression, the biochemical and morphological aspects that could favor this phenotype, and have attempted to generate novel strains that may be appropriate for industrial use. Subsequently, we developed recombinant strains by combination of these insights and the heterologous-efficient saccharifing enzymes. Resulting enzyme preparations were highly effective for saccharification of various biomass. In this review, we present some of the salient findings from the recent biochemical, morphological, and molecular analyses of this remarkable cellulase hyper-producing fungus.
Fungal decay resistance of wood reacted with phosphorus pentoxide-amine system
Hong-Lin Lee; George C. Chen; Roger M. Rowell
2004-01-01
Resistance of wood reacted in situ with phosphorus pentoxide-amine to the brown-rot fungus Gloeophyllum trabeum and white-rot fungus Trametes versicolor was examined. Wood reacted with either octyl, tribromo, or nitro derivatives were more resistant to both fungi. Threshold retention values of phosphoramide-reacted wood to white-rot fungus T. versicolor ranged from 2.9...
Serpula lacrymans, the dry rot fungus and tolerance towards copper-based wood preservatives
Anne Christine Steenkjaer Hastrup; Frederick Green; Carol Clausen; Bo Jensen
2005-01-01
Serpula lacrymans (Wulfen : Fries) Schröter, the dry rot fungus, is considered the most economically important wood decay fungus in temperate regions of the world i.e. northern Europe, Japan and Australia. Previously copper based wood preservatives were the most commonly used preservatives for pressure treatment of wood for building constructions. Because of a...
Liu, Hui; Chen, Wei; Wu, Man; Wu, Rihan; Zhou, Yong; Gao, Yubao; Ren, Anzhi
2017-11-01
Grasses can be infected simultaneously by endophytic fungi and arbuscular mycorrhizal (AM) fungi. In this study, we tested the hypothesis that endophyte-associated drought resistance of a native grass was affected by an AM fungus. In a greenhouse experiment, we compared the performance of endophyte-infected (EI) and endophyte-free (EF) Leymus chinensis, a dominant species native to the Inner Mongolia steppe, under altered water and AM fungus availability. The results showed that endophyte infection significantly increased drought resistance of the host grass, but the beneficial effects were reduced by AM fungus inoculation. In the mycorrhizal-non-inoculated (MF) treatment, EI plants accumulated significantly more biomass, had greater proline and total phenolic concentration, and lower malondialdehyde concentration than EF plants. In the mycorrhizal-inoculation (MI) treatment, however, no significant difference occurred in either growth or physiological characters measured between EI and EF plants. AM fungus inoculation enhanced drought resistance of EF plants but had no significant effect on drought resistance of EI plants, thus AM fungus inoculation reduced the difference between EI and EF plants. Our findings highlight the importance of interactions among multiple microorganisms for plant performance under drought stress.
Storm, Clare; Scoates, Freya; Nunn, Adam; Potin, Olivier; Dillon, Aoife
2016-01-01
The potential of a dry powder co-formulant, kaolin, to improve the control of storage beetles by the entomopathogenic fungus Beauveria bassiana, isolate IMI389521, was investigated. The response of Oryzaephilus surinamensis adults to the fungus when applied to wheat at 1 × 1010 conidia per kg with and without kaolin at 1.74 g per kg wheat was assessed. Addition of kaolin increased control from 46% to 88% at day 7 and from 81% to 99% at day 14 post-treatment. Following this the dose response of O. surinamensis and Tribolium confusum to both kaolin and the fungus was investigated. Synergistic effects were evident against O. surinamensis at ≥0.96 g of kaolin per kg of wheat when combined with the fungus at all concentrations tested. For T. confusum, adult mortality did not exceed 55%, however, the larvae were extremely susceptible with almost complete suppression of adult emergence at the lowest fungal rate tested even without the addition of kaolin. Finally, the dose response of Sitophilus granarius to the fungus at 15 and 25 °C, with and without kaolin at 1 g per kg of wheat, was examined. Improvements in efficacy were achieved by including kaolin at every fungal rate tested and by increasing the temperature. Kaolin by itself was not effective, only when combined with the fungus was an effect observed, indicating that kaolin was having a synergistic effect on the fungus. PMID:27571107
Varanda-Haifig, Sadala Schmidt; Albarici, Tatiane Regina; Nunes, Pablo Henrique; Haifig, Ives; Vieira, Paulo Cezar; Rodrigues, Andre
2017-04-01
Leaf-cutter ants cultivate and feed on the mutualistic fungus, Leucoagaricus gongylophorus, which is threatened by parasitic fungi of the genus Escovopsis. The mechanism of Escovopsis parasitism is poorly understood. Here, we assessed the nature of the antagonism of different Escovopsis species against its host. We also evaluated the potential antagonism of Escovopsioides, a recently described fungal genus from the attine ant environment whose role in the colonies of these insects is unknown. We performed dual-culture assays to assess the interactions between L. gongylophorus and both fungi. We also evaluated the antifungal activity of compounds secreted by the latter on L. gongylophorus growth using crude extracts of Escovopsis spp. and Escovopsioides nivea obtained either in (1) absence or (2) presence of the mutualistic fungus. The physical interaction between these fungi and the mutualistic fungus was examined under scanning electron microscopy (SEM). Escovopsis spp. and E. nivea negatively affected the growth of L. gongylophorus, which was also significantly inhibited by both types of crude extract. These results indicate that Escovopsis spp. and E. nivea produce antifungal metabolites against the mutualistic fungus. SEM showed that Escovopsis spp. and E. nivea maintained physical contact with the mutualistic fungus, though no specialised structures related to mycoparasitism were observed. These results showed that Escovopsis is a destructive mycoparasite that needs physical contact for the death of the mutualistic fungus to occur. Also, our findings suggest that E. nivea is an antagonist of the ant fungal cultivar.
Waghorn, T S; Leathwick, D M; Chen, L-Y; Skipp, R A
2003-12-30
The ability of the nematode-killing fungus Duddingtonia flagrans to reduce number of infective larvae of three species of gastro-intestinal parasitic nematodes developing in dung was investigated in both goats and sheep. Groups of lambs and kids (12-20 weeks old) were given mono-specific infections of Haemonchus contortus, Ostertagia (Teladorsagia) circumcincta or Trichostrongylus colubriformis. Following patency of the infections (t1) faecal samples were collected for determination of faecal nematode egg count (FEC) and culture of parasite larvae. Groups of animals were then dosed on 2 consecutive days with one of the two dose rates of the fungus (250,000 or 500,000 spores/kg liveweight). One (t2) and 5 (t3) days after the second dose of fungus samples were again collected for FEC and culture. The number of larvae recovered from the faecal cultures at t1 and t3 were used as controls to assess the efficacy of the experimental treatment at t2. Average efficacy was 78% with group means ranging from 40 to 93%. Dose rate of fungus appeared to influence efficacy against O. circumcincta but not against H. contortus or T. colubriformis. Overall, there were no differences in the efficacy of the fungus against any of the parasite species or in either host animal. The results of this trial indicate the potential use of this fungus as a broad spectrum anti-parasite agent for use in both goats and sheep.
Hama, Shinji; Tamalampudi, Sriappareddy; Shindo, Naoki; Numata, Takao; Yamaji, Hideki; Fukuda, Hideki; Kondo, Akihiko
2008-07-01
To develop a new approach for improving heterologous protein production in Aspergillus oryzae, we focused on the functional role of the N-terminal region of Rhizopus oryzae lipase (ROL). Several N-terminal deletion variants of ROL were expressed in A. oryzae. Interestingly, a segment of 28 amino acids from the C-terminal region of the propeptide (N28) was found to be critical for secretion of ROL into the culture medium. To further investigate the role of N28, the ROL secretory process was visualized in vivo using ROL-green fluorescent protein (GFP) fusion proteins. In cells producing ROL with N28, fluorescence observations showed that the fusion proteins are transported through endoplasmic reticulum (ER), Golgi, and cell wall, which is one of the typical secretory processes in a eukaryotic cell. Because the expression of the mature ROL-GFP fusion protein induced fluorescence accumulation without its translocation into the ER, N28 is considered to play a crucial role in protein transport. When N28 was inserted between the secretion signal and GFP, fluorescence observations showed that GFP, which is originally a cytoplasmic protein, was efficiently translocated into the ER of A. oryzae, resulting in an enhanced secretion of mature GFP after proteolytic cleavage of N28. These findings suggest that N28 facilitates protein translocation into ER and can be a promising candidate for improving heterologous protein production in A. oryzae.
Trakarnpaiboon, Srisakul; Srisuk, Nantana; Piyachomkwan, Kuakoon; Sakai, Kenji; Kitpreechavanich, Vichien
2017-09-14
In the present study, solid-state fermentation for the production of raw starch degrading enzyme was investigated by thermotolerant Rhizopus microsporus TISTR 3531 using a combination of agro-industrial wastes as substrates. The obtained crude enzyme was applied for hydrolysis of raw cassava starch and chips at low temperature and subjected to nonsterile ethanol production using raw cassava chips. The agro-industrial waste ratio was optimized using a simplex axial mixture design. The results showed that the substrate mixture consisting of rice bran:corncob:cassava bagasse at 8 g:10 g:2 g yielded the highest enzyme production of 201.6 U/g dry solid. The optimized condition for solid-state fermentation was found as 65% initial moisture content, 35°C, initial pH of 6.0, and 5 × 10 6 spores/mL inoculum, which gave the highest enzyme activity of 389.5 U/g dry solid. The enzyme showed high efficiency on saccharification of raw cassava starch and chips with synergistic activities of commercial α-amylase at 50°C, which promotes low-temperature bioethanol production. A high ethanol concentration of 102.2 g/L with 78% fermentation efficiency was achieved from modified simultaneous saccharification and fermentation using cofermentation of the enzymatic hydrolysate of 300 g raw cassava chips/L with cane molasses.
Detection of fungal infectous agent of wheat grains in store-pits of Markazi province, Iran.
Saberi-Riseh, R; Javan-Nikkhah, M; Heidarian, R; Hosseini, S; Soleimani, P
2004-01-01
Wheat is an economic and important crop that provides approximately 20% of food calorie in the world. It is first crop in Iran and cultivated in the most areas of this country. Store-pit fungi make undesirable changes in quality and appearance of wheat grains. Even, some fungi produce different mycotoxins which are toxic to human and livestock's that use wheat grains as source of food. In this study, several samples were randomly collected from each of five store-pits located in different areas of Markazi Province including: Arak, Mahallat, Khomein, Saveh and Sarband. Grains were treated on PDA, and blotter, agar and washing test also used for isolating and detection of fungi. At least 100 grains per each sample were randomly used for each test and treatment. The fungi that determined in this study were Cochliobolus australiensis, Cladosporium herbarum, Epicoccum sp., Tilletia leavis, Aspergillus flavus, A. niger, A. fumigatus, Alternaria alternata, Alternaria sp., Penicillium italicum, P. digitatum, Fusarium sp., Rhizopus sp., Ustilago tritici, Scytalidium sp. Among these fungi the most isolates were belonged to Cladosporium, Alternaria, Rhizopus and Fusarium. Cladosporium herbarum was the most common in different sampling areas. Tilletia laevis and Ustilago tritici were just recovered in washing test. This study revealed that different fungi are associated with wheat grains in store-pits in Markazi Province. Some of them like Aspergillus flavus normally produce aflatoxin, a very toxic and carcinogenic mycotoxin that is harmful for human.
NASA Astrophysics Data System (ADS)
Maryati, Yati; Susilowati, Agustine; Melanie, Hakiki; Lotulung, Puspa D.
2017-11-01
Corn hydrolyzate (Zea mays L) as a functional food fortificant derived from natural folic acid has been evaluated through a hydrolysis process using protease enzyme Rhizopus oligosporus strain C1. Enzymatic hydrolysis was carried out on two types of corn; yellow and white pearl variety corn, at concentration of protease enzyme (rough) 0.025; 0.125; and 0.225% (v/w of soluble nixtamal corn protein) with a hydrolysis time of 24 h at 30 °C, and pH 5.0. The results showed that the concentration of protease enzymes can increase the folic acid to the optimum condition, from the beginning to the end of the process time. Folic acid optimization of hydrolysis results in each corn was at the concentration of protease enzyme 0.225% (v/w of soluble nixtamal corn protein) in white corn and yellow corn at 24 hours hydrolysis, with folic acid composition, 283.56 µg/mL and 412.52 µg/mL, 1.07 and 1.04 mg/mL of soluble proteins, proteolytic activity 2.09 and 2.06 U/mL, total solids of 21.74 and 17.85%, total sugars of 0.56 and 2.22 mg/mL, and reducing sugar 91.72 and 48.47 mg/mL. In this condition, the increase of optimum folic acid for white corn was 33.57% and for yellow corn was 71.60% after hydrolysis.
Berger, Lúcia Raquel Ramos; Stamford, Thayza Christina Montenegro; Stamford-Arnaud, Thatiana Montenegro; de Alcântara, Sergio Roberto Cabral; da Silva, Antonio Cardoso; da Silva, Adamares Marques; do Nascimento, Aline Elesbão; de Campos-Takaki, Galba Maria
2014-01-01
This article sets out a method for producing chitin and chitosan by Cunninghamella elegans and Rhizopus arrhizus strains using a green metabolic conversion of agroindustrial wastes (corn steep liquor and molasses). The physicochemical characteristics of the biopolymers and antimicrobial activity are described. Chitin and chitosan were extracted by alkali-acid treatment, and characterized by infrared spectroscopy, viscosity and X-ray diffraction. The effectiveness of chitosan from C. elegans and R. arrhizus in inhibiting the growth of Listeria monocytogenes, Staphylococcus aureus, Pseudomonas aeruginosa, Salmonella enterica, Escherichia coli and Yersinia enterocolitica were evaluated by determining the minimum inhibitory concentrations (MIC) and the minimum bactericidal concentrations (MBC). The highest production of biomass (24.60 g/L), chitin (83.20 mg/g) and chitosan (49.31 mg/g) was obtained by R. arrhizus. Chitin and chitosan from both fungi showed a similar degree of deacetylation, respectively of 25% and 82%, crystallinity indices of 33.80% and 32.80% for chitin, and 20.30% and 17.80% for chitosan. Both chitin and chitosan presented similar viscosimetry of 3.79–3.40 cP and low molecular weight of 5.08 × 103 and 4.68 × 103 g/mol. They both showed identical MIC and MBC for all bacteria assayed. These results suggest that: agricultural wastes can be produced in an environmentally friendly way; chitin and chitosan can be produced economically; and that chitosan has antimicrobial potential against pathogenic bacteria. PMID:24853288
Jongbum Jeon; Ki-Tae Kim; Hyeunjeong Song; Gir-Won Lee; Kyeongchae Cheong; Hyunbin Kim; Gobong Choi; Yong-Hwan Lee; Jane E. Stewart; Ned B. Klopfenstein; Mee-Sook Kim
2017-01-01
The fungus Raffaelea quercus-mongolicae is the causal agent of Korean oak wilt, a disease associated with mass mortality of oak trees (e.g., Quercus spp.). The fungus is vectored and dispersed by the ambrosia beetle, Platypus koryoensis. Here, we present the 27.0-Mb draft genome sequence of R. quercus-mongolicae strain KACC44405.
Shoda, M
2003-01-01
A newly isolated fungus, Geotrichum candidum Dec 1 (abbreviated as Dec 1), was found to have the ability to degrade many xenobiotic compounds such as synthetic dyes, food coloring agents, molasses, organic halogens, lignin and kraft pulp effluents. The broad spectrum of the degradation of these compounds are associated mainly with peroxidases produced by the fungus.
D.A. Varley; G.K. Podila; S.T. Hiremath
1992-01-01
Plant-pathogenic fungi produce cutinase, an enzyme required to degrade plant cuticles and facilitate penetration into the host. The absence of cutinase or a decrease in its production has been associated with a decrease in pathogenicity of the fungus. A set of isogenic strains of Cryphonectria parasitica, the chestnut blight fungus, was tested for...
First unusual case of keratitis in Europe due to the rare fungus Metarhizium anisopliae.
Dorin, Josephine; Debourgogne, Anne; Zaïdi, Mohamed; Bazard, Marie-Christine; Machouart, Marie
2015-05-01
Metarhizium anisopliae is a fungus utilized worldwide for insect-pest biocontrol. Few M. anisopliae infections have been reported previously. Here, M. anisopliae was isolated from a corneal ulcer in a healthy man. It is the first ocular case in France and Europe of this extremely rare fungus in humans. Copyright © 2015 Elsevier GmbH. All rights reserved.
Shiv T. Hiremath; Sujata Balasubramanian; Jun Zheng; Gopi K. Podila
2006-01-01
The ectomycorrhiza is a symbiotic organ generated from the intricate association of fungal hyphae and plant root. The establishment of the ectomycorrhiza is a coordinated process of cross-talk between plant and fungus, followed by metabolic, developmental, and structural changes in the fungus, resulting in its growth toward the root. The initial stages of the symbiotic...
M. -S. Kim; P. A. Hohenlohe; K. -H. Kim; S. -T. Seo; Ned Klopfenstein
2016-01-01
Raffaelea quercus-mongolicae is a fungus associated with oak wilt and deemed to cause extensive oak mortality in South Korea. Since the discovery of this fungus on a dead Mongolian oak (Quercus mongolica) in 2004, the mortality continued to spread southwards in South Korea. Despite continued expansion of the disease and associated significant impacts on forest...
Padin, Carmiña; Fernández-Zeppenfeldt, Guillermo; Yegres, Francisco; Richard-Yegres, Nicole
2005-09-01
The purpose of this study was to confirm the presence of Scytalidium dimidiatum on Mangifera indica (mango) trees, in a plantation managed by a diabetic patient with a white grain mycetoma of the foot caused by the same fungus. Samples from necrotic apices, roots, burned leaves and rotten stems from eight trees were processed by the Smith and Furcolow's mineral oil technique (modified). Several isolates from the apex material and clinical samples from the diabetic patient isolated in pure culture a fungus with the macroscopic and microscopic characteristics of that in S. dimidiatum. This fungus should be considered as an opportunistic microorganism for both humans and M. indica.
Xin, Zhi-Hong; Tian, Li; Zhu, Tian-Jiao; Wang, Wen-Liang; Du, Lin; Fang, Yu-Chun; Gu, Qian-Qun; Zhu, Wei-Ming
2007-07-01
Two isocoumarin derivatives, stoloniferol A (1) and B (2), a known 5alpha, 8alpha-epidioxy-23-methyl-(22E, 24R)-ergosta-6, 22-dien-3beta-ol (3), and a known dihydrocitrinone (4) were isolated from the ethyl acetate extract of the sea squirt-derived fungus, Penicillium stoloniferum QY2-10, and a halophilic fungus, Penicillium notatum B-52, respectively. Their structures were elucidated by spectroscopic methods and optical rotation. The stereochemistry of 2 was determined on the basis of different NOE experiments and chemical transformation. Compound 3 showed cytotoxicity against P388 cells, with an IC50 value of 4.07 microM.
Eusebio-Cope, Ana; Sun, Liying; Tanaka, Toru; Chiba, Sotaro; Kasahara, Shin; Suzuki, Nobuhiro
2015-03-01
The chestnut blight fungus, Cryphonectria parasitica, is an important plant pathogenic ascomycete. The fungus hosts a wide range of viruses and now has been established as a model filamentous fungus for studying virus/host and virus/virus interactions. This is based on the development of methods for artificial virus introduction and elimination, host genome manipulability, available host genome sequence with annotations, host mutant strains, and molecular tools. Molecular tools include sub-cellular distribution markers, gene expression reporters, and vectors with regulatable promoters that have been long available for unicellular organisms, cultured cells, individuals of animals and plants, and certain filamentous fungi. A comparison with other filamentous fungi such as Neurospora crassa has been made to establish clear advantages and disadvantages of C. parasitica as a virus host. In addition, a few recent studies on RNA silencing vs. viruses in this fungus are introduced. Copyright © 2014 Elsevier Inc. All rights reserved.
Gu, Yu; Wang, Yanlin; Ma, Xiaoping; Wang, Chengdong; Yue, Guizhou; Zhang, Yuetian; Zhang, Yunyan; Li, Shanshan; Ling, Shanshan; Liu, Xiaomin; Wen, Xintian; Cao, Sanjie; Huang, Xiaobo; Deng, Junliang; Zuo, Zhicai; Yu, Shumin; Shen, Liuhong; Wu, Rui
2015-01-01
While taxol yields of fungi from non-animal sources are still low, whether Pestalotiopsis hainanensis isolated from the scurf of a dermatitic giant panda, Ailuropoda melanoleuca, provides a greater taxol yield remains unknown. The objective of the study was to determine the corresponding taxol yield. The structure of the taxol produced by the fungus was evaluated by thin layer chromatography (TLC), ultraviolet (UV) spectroscopy, high-performance liquid chromatography (HPLC), (1)H and (13)C nuclear magnetic resonance spectroscopy ((1)H-NMR and (13)C-NMR), and time-of-flight mass spectrometry (TOF-MS), with standard taxol as a control. The results demonstrated that the P. hainanensis fungus produced taxol, which had the same structure as the standard taxol and yield of 1,466.87 μg/L. This fungal taxol yield from the dermatitic giant panda was significantly greater than those of fungus from non-animal sources. The taxol-producing fungus may be a potential candidate for the production of taxol on an industrial scale.
Matsuda, Yosuke; Seo, Sang Tae; Kim, Kyung Hee; Ito, Shin-ichiro; Moon, Myung Jin; Kim, Seong Hwan; Yamada, Toshihiro
2014-01-01
In Korea, mass mortality of Quercus mongolica trees has become obvious since 2004. Raffaelea quercus-mongolicae is believed to be a causal fungus contributing the mortality. To evaluate the pathogenicity of the fungus to the trees, the fungus was multiple- and single-inoculated to the seedlings and twigs of the mature trees, respectively. In both the inoculations, the fungus was reisolated from more than 50% of inoculated twigs and seedlings. In the single inoculations, proportions of the transverse area of non-conductive sapwood at inoculation points and vertical lengths of discoloration expanded from the points were significantly different between the inoculation treatment and the control. In the multiple inoculations, no mortality was confirmed among the seedlings examined. These results showed that R. quercus-mongolicae can colonize sapwood, contribute to sapwood discoloration and disrupt sap flows around inoculation sites of Q. mongolica, although the pathogenicity of the fungus was not proven. PMID:25071395
Genome Sequence of the Mucoromycotina Fungus Umbelopsis isabellina, an Effective Producer of Lipids
DOE Office of Scientific and Technical Information (OSTI.GOV)
Takeda, Itaru; Tamano, Koichi; Yamane, Noriko
2014-02-27
Umbelopsis isabellina is a fungus in the subdivision Mucoromycotina, many members of which have been shown to be oleaginous and have become important organisms for producing oil because of their high level of intracellular lipid accumulation from various feedstocks. The genome sequence of U. isabellina NBRC 7884 was determined and annotated, and this information might provide insights into the oleaginous properties of this fungus.
Bryn T.M. Dentinger; D.Jean Lodge; Andrew B. Munkacsi; Dennis E. Desjardin; David J. McLaughlin
2009-01-01
The ~50 million-year-old fungus-farming ant mutualism is a classic example of coevolution, involving ants that subsist on asexual, fungal biomass, in turn propagating the fungus clonally through nest-to-nest transmission. Most mutualistic ants cultivate two closely related groups of gilled mushrooms, whereas one small group of ants in the genus ...
Andrea Watts; Frederick Meinzer; Brandy J. Saffell
2014-01-01
Swiss needle cast is caused by a fungus native to the Pacific Northwest. Its host is Douglas-fir, an iconic evergreen tree in the region. The fungus does not kill its host, but it adversely affects the tree's growth. The fungal fruiting bodies block the stomata, small openings on the underside of the needle where carbon dioxide, water vapor, and other gases are...
Dan Cullen
2007-01-01
Few microbes compare with the filamentous fungus Aspergillus niger in its ability to produce prodigious amounts of useful chemicals and enzymes. This fungus is the principal source of citric acid for food, beverages and pharmaceuticals and of several important commercial enzymes, including glucoamylase, which is widely used for the conversion of starch to food syrups...
Histopathology of cutaneous sporotrichosis in Rio de Janeiro: a series of 119 consecutive cases.
Quintella, Leonardo Pereira; Passos, Sonia Regina Lambert; do Vale, Antônio Carlos Francesconi; Galhardo, Maria Clara Gutierrez; Barros, Monica Bastos De Lima; Cuzzi, Tullia; Reis, Rosani Dos Santos; de Carvalho, Maria Helena Galdino Figueiredo; Zappa, Mônica Barbato; Schubach, Armando De Oliveira
2011-01-01
Sporotrichosis is the most common subcutaneous mycosis in Rio de Janeiro. Histopathological examination reveals diffuse granulomatous and suppurative dermatitis, and the fungus is rarely identifiable in tissue. We describe the histopathological features of cutaneous sporotrichosis, and investigate the association between them and the lack of visualization of the fungus. A total of 119 samples of confirmed sporotrichosis cases were studied. The characteristics of the inflammatory infiltrate, the presence of epidermal changes, necrosis and fibrosis, and the parasite burden were analyzed. The association between histopathological changes and the lack of visualization of the fungus was evaluated using prevalence ratios. Granulomas were observed in all samples, suppurative granulomas in 100 (84%) and diffuse dermatitis in 114 (95.8%). Liquefaction and caseous necrosis were present in 78 (65.5%) and 52 (43.7%) samples, respectively. The fungus was not seen in 77 (64.7%) samples. Epithelioid, tuberculoid or foreign-body-type granulomas, caseous, fibrinoid or absent necrosis, predominance of lymphocytes among nonphagocytic cells and fibrosis were associated with the lack of visualization of the fungus. The histopathological characteristics of sporotrichosis were variable when the causative fungus was not seen. In a proper context, the diagnosis of sporotrichosis remains a potential consideration even in the absence of demonstrable yeast. Copyright © 2010 John Wiley & Sons A/S.
Carrasco, L; Azcón, R; Kohler, J; Roldán, A; Caravaca, F
2011-02-15
The aim of this study was to assess the effectiveness of inoculation with a native arbuscular mycorrhizal (AM) fungus, Glomus mosseae (Nicol. and Gerd.) Gerd. and Trappe, or a filamentous fungus, Penicillium aurantiogriseum Dierckx 1901, on the establishment of Coronilla juncea L. seedlings grown in a polluted, semiarid soil. For that, root and shoot biomass, nutrient uptake, mycorrhizal colonisation and nitrate reductase (NR) and phosphatase activities were analysed. Six months after planting, the shoot biomass of C. juncea was increased only by the inoculation with G. mosseae (by about 62% compared with non-mycorrhizal plants). The shoot NR and root acid phosphatase activities were increased more by inoculation with G. mosseae than with P. aurantiogriseum inoculation. The root NR activity and foliar nutrient contents were increased only by the inoculation with the AM fungus. The root Zn and Cu decreased with the AM fungus. In conclusion, the autochthonous AM fungus was an effective inoculant with regard to stimulating growth and alleviating heavy metal toxicity for plants growing on a soil contaminated by multiple heavy metals. Inoculation with an autochthonous, filamentous fungus does not seem to be a good strategy for phytoremediation of such problematic sites. Copyright © 2011 Elsevier B.V. All rights reserved.
Steenberg, Tove; Kilpinen, Ole
2014-04-01
The poultry red mite, Dermanyssus gallinae, is a major pest in egg production, feeding on laying hens. Widely used non-chemical control methods include desiccant dusts, although their persistence under field conditions is often short. Entomopathogenic fungi may also hold potential for mite control, but these fungi often take several days to kill mites. Laboratory experiments were carried out to study the efficacy of 3 types of desiccant dusts, the fungus Beauveria bassiana and combinations of the two control agents against D. gallinae. There was significant synergistic interaction between each of the desiccant dusts and the fungus, with observed levels of mite mortality significantly higher than those expected for an additive effect (up to 38 % higher). Synergistic interaction between desiccant dust and fungus was found also when different application methods were used for the fungus and at different levels of relative humidity. Although increased levels of mortality were reached due to the synergistic interaction, the speed of lethal action was not influenced by combining the two components. The persistence of the control agents applied separately or in combination did not change over a period of 4 weeks. Overall, combinations of desiccant dusts and fungus conidia seem to hold considerable promise for future non-chemical control of poultry red mites.
Phomalactone from a Phytopathogenic Fungus Infecting ZINNIA elegans (ASTERACEAE) Leaves.
Meepagala, Kumudini M; Johnson, Robert D; Techen, Natascha; Wedge, David E; Duke, Stephen O
2015-07-01
Zinnia elegans Jacq. plants are infected by a fungus that causes dark red spots with necrosis on leaves, particularly in late spring to the middle of summer in the Mid-South of the United States. This fungal disease causes the leaves to wilt and eventually kills the plant. The fungus was isolated, cultured in potato dextrose broth, and identified as Nigrospora sphaerica by molecular techniques. Two major lactone metabolites (phomalactone and catenioblin A) were isolated from liquid culture of N. sphaerica isolated from Z. elegans. When injected into leaves of Z. elegans, phomalactone caused lesions similar to those of the fungus. The lesion sizes were proportional to the concentration of the phomalactone. Phomalactone, but not catenioblin A, was phytotoxic to Z. elegans and other plant species by inhibition of seedling growth and by causing electrolyte leakage from photosynthetic tissues of both Z. elegans leaves and cucumber cotyledons. This latter effect may be related to the wilting caused by the fungus in mature Z. elegans plants. Phomalactone was moderately fungicidal to Coletotrichum fragariae and two Phomopsis species, indicating that the compound may keep certain other fungi from encroaching into plant tissue that N. sphaerica has infected. Production of large amounts of phomalactone by N. sphaerica contributes to the pathogenic behavior of this fungus, and may have other ecological functions in the interaction of N. sphaerica with other fungi. This is the first report of isolation of catenioblin A from a plant pathogenic fungus. The function of catenioblin A is unclear, as it was neither significantly phyto- nor fungitoxic.
Fungus symbionts colonizing the galleries of the ambrosia beetle Platypus quercivorus.
Endoh, Rikiya; Suzuki, Motofumi; Okada, Gen; Takeuchi, Yuko; Futai, Kazuyoshi
2011-07-01
Isolations were made to determine the fungal symbionts colonizing Platypus quercivorus beetle galleries of dead or dying Quercus laurifolia, Castanopsis cuspidata, Quercus serrata, Quercus crispula, and Quercus robur. For these studies, logs from oak wilt-killed trees were collected from Kyoto Prefecture, Japan. Fungi were isolated from the: (1) entrances of beetle galleries, (2) vertical galleries, (3) lateral galleries, and (4) the larval cradle of P. quercivorus in each host tree. Among the fungus colonies which appeared on YM agar plates, 1,219 were isolated as the representative isolates for fungus species inhabiting in the galleries based on their cultural characteristics. The validity of the visual classification of the fungus colonies was checked and if necessary properly corrected using microsatellite-primed PCR fingerprints. The nucleotide sequence of the D1/D2 region of the large subunit nuclear rRNA gene detected 38 fungus species (104 strains) of which three species, i.e., Candida sp. 3, Candida kashinagacola (both yeasts), and the filamentous fungus Raffaelea quercivora were isolated from all the tree species. The two yeasts were most prevalent in the interior of galleries, regardless of host tree species, suggesting their close association with the beetle. A culture-independent method, terminal restriction fragment length polymorphism (T-RFLP) analysis was also used to characterize the fungus flora of beetle galleries. T-RFLP patterns showed that yeast species belonging to the genus Ambrosiozyma frequently occurred on the gallery walls along with the two Candida species. Ours is the first report showing the specific fungi inhabiting the galleries of a platypodid ambrosia beetle.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aylward, Frank O.; Burnum-Johnson, Kristin E.; Tringe, Susannah G.
Plants represent a large reservoir of organic carbon comprised largely of recalcitrant polymers that most metazoans are unable to deconstruct. Many herbivores gain access to nutrients in this material indirectly by associating with microbial symbionts, and leaf-cutter ants are a paradigmatic example. These ants use fresh foliar biomass as manure to cultivate fungus gardens composed primarily of Leucoagaricus gongylophorus, a basidiomycetous symbiont that produces specialized hyphal swellings that serve as a food source for the host ant colony. Although leaf-cutter ants are conspicuous herbivores that contribute substantially to carbon turnover in Neotropical ecosystems, the process through which plant biomass ismore » degraded in their fungus gardens is not well understood. Here we present the first draft genome of L. gongylophorus, and using genomic, metaproteomic, and phylogenetic tools we investigate its role in lignocellulose degradation in the fungus gardens of both Atta cephalotes and Acromyrmex echinatior leaf-cutter ants. We show that L. gongylophorus produces a diversity of lignocellulases in fungus gardens, and is likely the primary driver of plant biomass degradation in these ecosystems. We also show that this fungus produces distinct sets of lignocellulases throughout the different stages of biomass degradation, including numerous cellulases and laccases that may be playing an important but previously uncharacterized role in lignocellulose degradation. Our study provides a comprehensive analysis of plant biomass degradation in leaf-cutter ant fungus gardens and provides insight into the molecular dynamics underlying the symbiosis between these dominant herbivores and their obligate fungal cultivar.« less
Species-specific ant brain manipulation by a specialized fungal parasite.
de Bekker, Charissa; Quevillon, Lauren E; Smith, Philip B; Fleming, Kimberly R; Ghosh, Debashis; Patterson, Andrew D; Hughes, David P
2014-08-29
A compelling demonstration of adaptation by natural selection is the ability of parasites to manipulate host behavior. One dramatic example involves fungal species from the genus Ophiocordyceps that control their ant hosts by inducing a biting behavior. Intensive sampling across the globe of ants that died after being manipulated by Ophiocordyceps suggests that this phenomenon is highly species-specific. We advance our understanding of this system by reconstructing host manipulation by Ophiocordyceps parasites under controlled laboratory conditions and combining this with field observations of infection rates and a metabolomics survey. We report on a newly discovered species of Ophiocordyceps unilateralis sensu lato from North America that we use to address the species-specificity of Ophiocordyceps-induced manipulation of ant behavior. We show that the fungus can kill all ant species tested, but only manipulates the behavior of those it infects in nature. To investigate if this could be explained at the molecular level, we used ex vivo culturing assays to measure the metabolites that are secreted by the fungus to mediate fungus-ant tissue interactions. We show the fungus reacts heterogeneously to brains of different ant species by secreting a different array of metabolites. By determining which ion peaks are significantly enriched when the fungus is grown alongside brains of its naturally occurring host, we discovered candidate compounds that could be involved in behavioral manipulation by O. unilateralis s.l.. Two of these candidates are known to be involved in neurological diseases and cancer. The integrative work presented here shows that ant brain manipulation by O. unilateralis s.l. is species-specific seemingly because the fungus produces a specific array of compounds as a reaction to the presence of the host brain it has evolved to manipulate. These studies have resulted in the discovery of candidate compounds involved in establishing behavioral manipulation by this specialized fungus and therefore represent a major advancement towards an understanding of the molecular mechanisms underlying this phenomenon.
Alastruey-Izquierdo, Ana; Castelli, Maria Victoria; Cuesta, Isabel; Monzon, Araceli; Cuenca-Estrella, Manuel; Rodriguez-Tudela, Juan Luis
2009-01-01
The antifungal susceptibility profiles of 77 clinical strains of Mucorales species, identified by internal transcribed spacer sequencing, were analyzed. MICs obtained at 24 and 48 h were compared. Amphotericin B was the most active agent against all isolates, except for Cunninghamella and Apophysomyces isolates. Posaconazole also showed good activity for all species but Cunninghamella bertholletiae. Voriconazole had no activity against any of the fungi tested. Terbinafine showed good activity, except for Rhizopus oryzae, Mucor circinelloides, and Rhizomucor variabilis isolates. PMID:19171801
Alastruey-Izquierdo, Ana; Castelli, Maria Victoria; Cuesta, Isabel; Monzon, Araceli; Cuenca-Estrella, Manuel; Rodriguez-Tudela, Juan Luis
2009-04-01
The antifungal susceptibility profiles of 77 clinical strains of Mucorales species, identified by internal transcribed spacer sequencing, were analyzed. MICs obtained at 24 and 48 h were compared. Amphotericin B was the most active agent against all isolates, except for Cunninghamella and Apophysomyces isolates. Posaconazole also showed good activity for all species but Cunninghamella bertholletiae. Voriconazole had no activity against any of the fungi tested. Terbinafine showed good activity, except for Rhizopus oryzae, Mucor circinelloides, and Rhizomucor variabilis isolates.
Pneumocystis jiroveci pneumonia
Pneumocystis pneumonia; Pneumocystosis; PCP; Pneumocystis carinii ... This type of pneumonia is caused by the fungus Pneumocystis jiroveci . This fungus is common in the environment and rarely causes illness in ...
Cooley, John R; Marshall, David C; Hill, Kathy B R
2018-01-23
Male periodical cicadas (Magicicada spp.) infected with conidiospore-producing ("Stage I") infections of the entomopathogenic fungus Massospora cicadina exhibit precisely timed wing-flick signaling behavior normally seen only in sexually receptive female cicadas. Male wing-flicks attract copulation attempts from conspecific males in the chorus; close contact apparently spreads the infective conidiospores. In contrast, males with "Stage II" infections that produce resting spores that wait for the next cicada generation do not produce female-specific signals. We propose that these complex fungus-induced behavioral changes, which resemble apparently independently derived changes in other cicada-Massospora systems, represent a fungus "extended phenotype" that hijacks cicadas, turning them into vehicles for fungus transmission at the expense of the cicadas' own interests.
Patterns of functional enzyme activity in fungus farming ambrosia beetles.
De Fine Licht, Henrik H; Biedermann, Peter H W
2012-06-06
In wood-dwelling fungus-farming weevils, the so-called ambrosia beetles (Curculionidae: Scolytinae and Platypodinae), wood in the excavated tunnels is used as a medium for cultivating fungi by the combined action of digging larvae (which create more space for the fungi to grow) and of adults sowing and pruning the fungus. The beetles are obligately dependent on the fungus that provides essential vitamins, amino acids and sterols. However, to what extent microbial enzymes support fungus farming in ambrosia beetles is unknown. Here we measure (i) 13 plant cell-wall degrading enzymes in the fungus garden microbial consortium of the ambrosia beetle Xyleborinus saxesenii, including its primary fungal symbionts, in three compartments of laboratory maintained nests, at different time points after gallery foundation and (ii) four specific enzymes that may be either insect or microbially derived in X. saxesenii adult and larval individuals. We discovered that the activity of cellulases in ambrosia fungus gardens is relatively small compared to the activities of other cellulolytic enzymes. Enzyme activity in all compartments of the garden was mainly directed towards hemicellulose carbohydrates such as xylan, glucomannan and callose. Hemicellulolytic enzyme activity within the brood chamber increased with gallery age, whereas irrespective of the age of the gallery, the highest overall enzyme activity were detected in the gallery dump material expelled by the beetles. Interestingly endo-β-1,3(4)-glucanase activity capable of callose degradation was identified in whole-body extracts of both larvae and adult X. saxesenii, whereas endo-β-1,4-xylanase activity was exclusively detected in larvae. Similar to closely related fungi associated with bark beetles in phloem, the microbial symbionts of ambrosia beetles hardly degrade cellulose. Instead, their enzyme activity is directed mainly towards comparatively more easily accessible hemicellulose components of the ray-parenchyma cells in the wood xylem. Furthermore, the detection of xylanolytic enzymes exclusively in larvae (which feed on fungus colonized wood) and not in adults (which feed only on fungi) indicates that only larvae (pre-) digest plant cell wall structures. This implies that in X. saxesenii and likely also in many other ambrosia beetles, adults and larvae do not compete for the same food within their nests - in contrast, larvae increase colony fitness by facilitating enzymatic wood degradation and fungus cultivation.
... examine you. Tests that may be ordered include: Culture of joint fluid that grows fungus Joint x-ray showing joint changes Positive antibody test (serology) for fungal disease Synovial biopsy showing fungus
Li, Hai-Yan; Yang, Guo-Dong; Shu, Huai-Rui; Yang, Yu-Tao; Ye, Bao-Xing; Nishida, Ikuo; Zheng, Cheng-Chao
2006-01-01
Inoculation of the grapevine (Vitis amurensis Rupr.) with the arbuscular mycorrhizal (AM) fungus Glomus versiforme significantly increased resistance against the root-knot nematode (RKN) Meloidogyne incognita. Studies using relative quantitative reverse transcription-PCR (RQRT-PCR) analysis of grapevine root inoculation with the AM fungus revealed an up-regulation of VCH3 transcripts. This increase was greater than that observed following infection with RKN. However, inoculation of the mycorrhizal grapevine roots with RKN was able to enhance VCH3 transcript expression further. Moreover, the increase in VCH3 transcripts appeared to result in a higher level of resistance against subsequent RKN infection. Constitutive expression of VCH3 cDNA in transgenic tobacco under the control of the cauliflower mosaic virus 35S promoter also conferred resistance against RKN, but had no significant effect on the growth of the AM fungus. We analyzed beta-glucuronidase (GUS) activity directed by a 1,216 bp VCH3 promoter in transgenic tobacco following inoculation with both the AM fungus and RKN. GUS activity was negligible in the root tissues before inoculation, and was more effectively induced after inoculation with the AM fungus than with RKN. Moreover, GUS staining in the mycorrhizal transgenic tobacco roots was enhanced by subsequent RKN infection, and was found ubiquitously throughout the whole root tissue. Together, these results suggest that AM fungus induced a defense response against RKN in the mycorrhizal grapevine roots, which appeared to involve transcriptional control of VCH3 expression throughout the whole root tissue.
Doddapaneni, Harshavardhan; Subramanian, Venkataramanan; Fu, Bolei; Cullen, Dan
2013-06-01
The oxidative enzymatic machinery for degradation of organic substrates in Agaricus bisporus (Ab) is at the core of the carbon recycling mechanisms in this fungus. To date, 156 genes have been tentatively identified as part of this oxidative enzymatic machinery, which includes 26 peroxidase encoding genes, nine copper radical oxidase [including three putative glyoxal oxidase-encoding genes (GLXs)], 12 laccases sensu stricto and 109 cytochrome P450 monooxygenases. Comparative analyses of these enzymes in Ab with those of the white-rot fungus, Phanerochaete chrysosporium, the brown-rot fungus, Postia placenta, the coprophilic litter fungus, Coprinopsis cinerea and the ectomychorizal fungus, Laccaria bicolor, revealed enzyme diversity consistent with adaptation to substrates rich in humic substances and partially degraded plant material. For instance, relative to wood decay fungi, Ab cytochrome P450 genes were less numerous (109 gene models), distributed among distinctive families, and lacked extensive duplication and clustering. Viewed together with P450 transcript accumulation patterns in three tested growth conditions, these observations were consistent with the unique Ab lifestyle. Based on tandem gene arrangements, a certain degree of gene duplication seems to have occurred in this fungus in the copper radical oxidase (CRO) and the laccase gene families. In Ab, high transcript levels and regulation of the heme-thiolate peroxidases, two manganese peroxidases and the three GLX-like genes are likely in response to complex natural substrates, including lignocellulose and its derivatives, thereby suggesting an important role in lignin degradation. On the other hand, the expression patterns of the related CROs suggest a developmental role in this fungus. Based on these observations, a brief comparative genomic overview of the Ab oxidative enzyme machinery is presented. Copyright © 2013 Elsevier Inc. All rights reserved.
Mucor indicus: biology and industrial application perspectives: a review.
Karimi, Keikhosro; Zamani, Akram
2013-01-01
Mucor indicus, one of the most important strains of zygomycetes fungi, has been the subject of several studies since a couple of hundred years ago. This fungus, regarded as a non-pathogenic dimorphic microorganism, is used for production of several beers and foods. Morphology of the fungus can be manipulated and well controlled by changing a number of parameters. Furthermore, M. indicus can grow on a variety of substrates including lignocellulosic hydrolysates which are mixtures of hexoses, pentoses, and different severe fermentation inhibitors. Indeed, high yield ethanol production is among the most important features of this strain. Presence of considerable amounts of chitosan in the cell wall is another important aspect of the fungus. Besides production of ethanol and chitosan, the biomass of this fungus has shown a great potential to be used as a rich nutritional source, e.g. fish feed. The fungus is also among the oleaginous fungi and produces high amounts of polyunsaturated fatty acids particularly γ-linolenic acid. Furthermore, the biomass autolysate has a high potential for yeast extract replacement in fermentation by the fungus. Additionally, the strain has shown promising results in heavy metal removal from wastewaters. This review discusses different aspects of biology and industrial application perspectives of M. indicus. Furthermore, open areas for the future basic and applied levels of research are also presented. Copyright © 2013 Elsevier Inc. All rights reserved.
Assis, R C L; Luns, F D; Araújo, J V; Braga, F R
2012-11-01
The efficacy of a fungal formulation based on the nematophagous fungus Duddingtonia flagrans was assessed in the control of cattle trichostrongyles. Twenty male Nellore calves, six-month-old, divided in two groups (fungus-treated and control without fungus) were fed on a pasture of Brachiaria decumbens naturally infected with larvae of bovine trichostrongyles. Animals of the treated group received doses of sodium alginate mycelial pellets orally (1 g/10 kg live weight, twice a week), for 12 months. Feces samples were collected for egg count (eggs per gram of feces-EPG) and coprocultures during 12 months. There was a significant reduction in EPG (56.7%) and infective larvae (L3) in coprocultures (60.5%) for animals of the treated group in relation to the control group at the end of the study. There was a significant reduction of L3 (64.5%) in herbage samples collected up to 0-20 cm from fecal pats and 73.2% in distant samples (20-40 cm) between the fungus-treated group and the control group. The treatment with sodium alginate pellets containing the nematode trapping fungus D. flagrans reduced trichostrongylid in tropical southeastern Brazil and could be an effective tool for biological control of this parasitic nematode in beef cattle. Copyright © 2012 Elsevier Inc. All rights reserved.
Soares, Filippe Elias de Freitas; Braga, Fabio Ribeiro; de Araújo, Jackson Victor; Lima, Walter dos Santos; de Queiroz, José Humberto
2015-01-01
The dog acts as a reservoir and environmental disseminator of potentially zoonotic parasites. The objective of this work was to study the fungus Monacrosporium thaumasium regarding its nematicidal potential in laboratory trials and its proteolytic profile. The in vitro test was carried out through two assays (A and B). In assay A, conidia of the fungus N34a were added in positive coprocultures for Angiostrongylus vasorum. In assay B, crude extract (treated group) and distilled water (control group) were added to coprocultures. Next, the proteolytic profile of crude extract of the nematophagous fungus M. thaumasium (NF34a) was revealed by performing a zymogram. There was a reduction (p<0.01) in the averages of larvae recovered from the treated groups (conidia and crude extract) in relation to control groups. The zymogram suggested that the nematophagous fungus M. thaumasium produces a protease of approximately 40 kDa. The results of this work confirm that the conidia as well as the crude extract of the fungus M. thaumasium may be used to control A. vasorum L1. The proteolytic profile suggested the presence of one protease (Mt1) of approximately 40 kDa that in the future may be used in biological control of L1 of this nematode. Copyright © 2013 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.
... brasiliensis . Spores of the fungus, which grow in soil, may be inhaled. Most people have no symptoms, ... inhaling spores of the fungus, which grow in soil. Paracoccidioidomycosis usually involves the lungs, skin, mouth, throat, ...
... by the fungus. Soil that contains bird or bat droppings may have larger amounts of this fungus. ... by reducing exposure to dust in chicken coops, bat caves, and other high-risk locations. Wear masks ...
... is a disease caused by a fungus (or mold) called Histoplasma. The fungus is common in the eastern and central United States. It grows in soil and material contaminated with bat or bird droppings. ...
Atkins, Simon D; Hidalgo-Diaz, Leopoldo; Clark, Ian M; Morton, C Oliver; de Oca, Nivian Montes; Gray, Paul A; Kerry, Brian R
2003-02-01
Pochonia chlamydosporia var. catenulata is a potential biocontrol agent against root-knot nematodes. Diagnosis of isolates has relied on morphological identification, and is both time-consuming and difficult. beta-tubulin primers have been developed for the identification of this fungus that were specific enough to distinguish between varieties of the fungus within the same species. Separate primers have been developed for the specific detection of P. chlamydosporia var. catenulata based on ITS sequences, which were able to detect the fungus in soil from various sites in Cuba where the biocontrol agent had been added. When the PCR diagnosis was combined with serial dilution of soil samples on selective medium, colonies were rapidly identified. The fungus was still present, albeit at low densities, in soils inoculated five years previously. The development of a baiting method allowed quick in situ screening of the isolates' ability to infect nematode eggs, and when combined with PCR diagnosis both varieties of the fungus could be detected in infected eggs. RFLP analysis of ITS sequences from P. chlamydosporia provided an extra level of discrimination between isolates.
Mould and yeast flora in fresh berries, grapes and citrus fruits.
Tournas, V H; Katsoudas, Eugenia
2005-11-15
Fresh fruits are prone to fungal contamination in the field, during harvest, transport, marketing, and with the consumer. It is important to identify fungal contaminants in fresh fruits because some moulds can grow and produce mycotoxins on these commodities while certain yeasts and moulds can cause infections or allergies. In this study, 251 fresh fruit samples including several varieties of grapes, strawberries, blueberries, raspberries, blackberries, and various citrus fruits were surface-disinfected, incubated at room temperature for up to 14 days without supplemental media, and subsequently examined for mould and yeast growth. The level of contamination (percent of contaminated items/sample) varied depending on the type of fruit. All raspberry and blackberry samples were contaminated at levels ranging from 33% to 100%, whereas 95% of the blueberry samples supported mould growth at levels between 10% and 100% of the tested berries, and 97% of strawberry samples showed fungal growth on 33-100% of tested berries. The most common moulds isolated from these commodities were Botrytis cinerea, Rhizopus (in strawberries), Alternaria, Penicillium, Cladosporium and Fusarium followed by yeasts, Trichoderma and Aureobasidium. Thirty-five percent of the grape samples tested were contaminated and supported fungal growth; the levels of contamination ranged from 9% to 80%. The most common fungi spoiling grapes were Alternaria, B. cinerea and Cladosporium. Eighty-three percent of the citrus fruit samples showed fungal growth at levels ranging from 25% to 100% of tested fruits. The most common fungi in citrus fruits were Alternaria, Cladosporium, Penicillium, Fusarium and yeasts. Less common were Trichoderma, Geotrichum and Rhizopus.
Ben Yaakov, Dafna; Rivkin, Anna; Mircus, Gabriel; Albert, Nathaniel; Dietl, Anna-Maria; Kovalerchick, Dimitry; Carmeli, Shmuel; Haas, Hubertus; Kontoyiannis, Dimitrios P; Osherov, Nir
2016-04-01
During recent decades, the number of invasive fungal infections among immunosuppressed patients has increased significantly, whereas the number of effective systemic antifungal drugs remains low and unsatisfactory. The aim of this study was to characterize a novel antifungal compound, CW-8/haemofungin, which we previously identified in a screen for compounds affecting fungal cell wall integrity. The in vitro characteristics of haemofungin were investigated by MIC evaluation against a panel of pathogenic and non-pathogenic fungi, bacteria and mammalian cells in culture. Haemofungin mode-of-action studies were performed by screening an Aspergillus nidulans overexpression genomic library for resistance-conferring plasmids and biochemical validation of the target. In vivo efficacy was tested in the Galleria mellonella and Drosophila melanogaster insect models of infection. We demonstrate that haemofungin causes swelling and lysis of growing fungal cells. It inhibits the growth of pathogenic Aspergillus, Candida, Fusarium and Rhizopus isolates at micromolar concentrations, while only weakly affecting the growth of mammalian cell lines. Genetic and biochemical analyses in A. nidulans and Aspergillus fumigatus indicate that haemofungin primarily inhibits ferrochelatase (HemH), the last enzyme in the haem biosynthetic pathway. Haemofungin was non-toxic and significantly reduced mortality rates of G. mellonella and D. melanogaster infected with A. fumigatus and Rhizopus oryzae, respectively. Further development and in vivo validation of haemofungin is warranted. © The Author 2016. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Occurrence and species distribution of pathogenic Mucorales in unselected soil samples from France.
Mousavi, B; Costa, J M; Arné, P; Guillot, J; Chermette, R; Botterel, F; Dannaoui, E
2018-04-01
Mucormycosis is a life-threatening invasive fungal disease that affects a variety of patient groups. Although Mucorales are mostly opportunistic pathogens originating from soil or decaying vegetation, there are currently few data on prevalence of this group of fungi in the environment. The aim of the present study was to assess the prevalence and diversity of species of Mucorales from soil samples collected in France. Two grams of soil were homogenized in sterile saline and plated on Sabouraud dextrose agar and RPMI agar supplemented with itraconazole or voriconazole. Both media contained chloramphenicol and gentamicin. The plates were incubated at 35 ± 2 °C and checked daily for fungal growth for a maximum of 7 d. Mucorales were subcultured for purity. Each isolate was identified phenotypically and molecular identification was performed by ITS sequencing. A total of 170 soil samples were analyzed. Forty-one isolates of Mucorales were retrieved from 38 culture-positive samples. Among the recovered isolates, 27 Rhizopus arrhizus, 11 Mucor circinelloides, one Lichtheimia corymbifera, one Rhizopus microsporus and one Cunninghamella bertholletiae were found. Positive soil samples came from cultivated fields but also from other types of soil such as flower beds. Mucorales were retrieved from samples obtained in different geographical regions of France. Voriconazole-containing medium improved the recovery of Mucorales compared with other media. The present study showed that pathogenic Mucorales are frequently recovered from soil samples in France. Species diversity should be further analyzed on a larger number of soil samples from different geographic areas in France and in other countries.
Millon, Laurence; Larosa, Fabrice; Lepiller, Quentin; Legrand, Faezeh; Rocchi, Steffi; Daguindau, Etienne; Scherer, Emeline; Bellanger, Anne-Pauline; Leroy, Joel; Grenouillet, Frederic
2013-05-01
The aim of our study was to assess the detection of circulating DNA from the most common species of Mucorales for early diagnosis of mucormycosis in at-risk patients. We retrospectively evaluated a combination of 3 quantitative polymerase chain reaction (qPCR) assays using hydrolysis probes targeting Mucor/Rhizopus, Lichtheimia (formerly Absidia), and Rhizomucor for circulating Mucorales detection. Serial serum samples from 10 patients diagnosed with proven mucormycosis (2-9 samples per patient) were analyzed. No cross-reactivity was detected in the 3 qPCR assays using 19 reference strains of opportunistic fungi, and the limit of detection ranged from 3.7 to 15 femtograms/10 µL, depending on the species. DNA from Mucorales was detected in the serum of 9 of 10 patients between 68 and 3 days before mucormycosis diagnosis was confirmed by histopathological examination and/or positive culture. All the qPCR results were concordant with culture and/or PCR-based identification of the causing agents in tissue (Lichtheimia species, Rhizomucor species, and Mucor/Rhizopus species in 4, 3, and 2 patients, respectively). Quantitative PCR was negative in only 1 patient with proven disseminated mucormycosis caused by Lichtheimia species. Our study suggests that using specific qPCR targeting several species of Mucorales according to local ecology to screen at-risk patients could be useful in a clinical setting. The cost and efficacy of this strategy should be evaluated. However, given the human and economic cost of mucormycosis and the need for rapid diagnosis to initiate prompt directed antifungal therapy, this strategy could be highly attractive.
Mucormycosis outbreak associated with hospital linens.
Duffy, Jonathan; Harris, Julie; Gade, Lalitha; Sehulster, Lynne; Newhouse, Emily; O'Connell, Heather; Noble-Wang, Judith; Rao, Carol; Balajee, S Arunmozhi; Chiller, Tom
2014-05-01
Mucormycosis is an invasive fungal infection with a high fatality rate. We investigated an outbreak of mucormycosis in a pediatric hospital to determine routes of pathogen transmission from the environment and prevent additional infections. A case was defined as a hospital-onset illness consistent with mucormycosis, confirmed by culture or histopathology. Case-patient medical records were reviewed for clinical course and exposure to items and locations within the hospital. Environmental samples were collected from air and surfaces. Fungal isolates collected from case-patients and the environmental samples were identified using DNA sequencing. Five case-patients had hospital-associated cutaneous mucormycosis over an 11-month period; all subsequently died. Three case-patients had conditions known to be associated with susceptibility to mucormycosis, while 2 had cardiac conditions with persistent acidosis. The cases occurred on several different wards throughout the hospital, and hospital linens were the only exposure identified as common to the case-patients. Rhizopus species were recovered from 26 (42%) of 62 environmental samples from clean linens and associated areas and from 1 (4%) of 25 samples from nonlinen-related items. Case-patients were infected with Rhizopus delemar, which was also isolated from cultures of clean linens and clean linen delivery bins from the off-site laundry facility. Hospital linens were identified as a vehicle that carried R. delemar into contact with susceptible patients. Fungal species identification using DNA-based methods is useful for corroborating epidemiologic links in hospital outbreak investigations. Hospital linens should be laundered, packaged, shipped and stored in a manner that minimizes exposure to environmental contaminants.
The normal mycoflora of commodities from Thailand. 1. Nuts and oilseeds.
Pitt, J I; Hocking, A D; Bhudhasamai, K; Miscamble, B F; Wheeler, K A; Tanboon-Ek, P
1993-12-01
A comprehensive study was carried out of the fungi occurring in commodities normally traded in Thailand. Samples of major commodities were obtained from farmers' stocks and middlemen in major producing areas throughout the country. Retail samples were obtained from outlets in and around Bankok. Samples were divided into two portions, one being examined in Bangkok, and the second in Sydney. After surface disinfection, fungi were enumerated by direct plating on dichloran rose bengal chloramphenicol agar, dichloran 18% glycerol agar, Aspergillus flavus and parasiticus agar and dichloran chloramphenicol peptone agar. Figures for percentage infection were calculated, and fungi were isolated and identified to species level. In all 602 samples were examined, and at North Ryde about 18,000 fungal isolates identified. Data obtained from 329 samples are reported here, comprising maize (154), peanuts (109), cashews (45) and copra (21). Major fungi in maize included Fusarium moniliforme (present in 97% of samples), Aspergillus flavus (85%), Penicillium citrinum (67%), Aspergillus niger (64%), Lasiodiplodia theobromae (58%) and Fusarium semitectum (45%). In peanuts, the major fungi were Aspergillus flavus (95% of samples), Aspergillus niger (86%), Rhizopus oryzae (60%), Eurotium rubrum (51%), Macromina phaseolina (49%), Penicillium citrinum (46%) and Eurotium chevalieri (46%). Invasion in cashews was lower, major fungi being Aspergillus flavus (60%), Nigrospora oryzae (58%), Aspergillus niger (53%), Chaetomium globosum (47%) and Eurotium chevalieri (40%). Aspergillus flavus (86% of samples) was again dominant in copra, with Rhizopus oryzae (52%), Aspergillus niger (43%), Eurotium chevalieri (43%) the only other species exceeding 40% infection. Aspergillus parasiticus was rarely seen, and Aspergillus nomius was reported from foods for the first time.
50 CFR Appendix A to Part 622 - Species Tables
Code of Federal Regulations, 2013 CFR
2013-10-01
... michelinii, Blushing star Family Caryophylliidae Eusmilia fastigiata, Flower coral Tubastrea aurea, Cup coral... cactus Mussa angulosa, Large flower coral Mycetophyllia aliciae, Thin fungus coral M. danae, Fat fungus...
50 CFR Appendix A to Part 622 - Species Tables
Code of Federal Regulations, 2014 CFR
2014-10-01
... michelinii, Blushing star Family Caryophylliidae Eusmilia fastigiata, Flower coral Tubastrea aurea, Cup coral... cactus Mussa angulosa, Large flower coral Mycetophyllia aliciae, Thin fungus coral M. danae, Fat fungus...
First report of Albizia lebbeck dieback caused by Scytalidium dimidiatum in Oman.
Elshafie, Abdulkadir E; Ba-Omar, Taher
2002-01-01
Over 200 Albizia lebbeck trees at Sultan Qaboos University campus wilted and died. The symptoms were dieback of large branches due to infection by Scytalidium dimidiatum. The fungus has also infected Ficus benghalensis, F. carica, F. retusa, Thespesia populnea, Delonix regia and Peltophorum petrocarpum. This is the first report of the fungus in Oman and on A. lebbeck, T. populnea, D. regia and P. petrocarpum. The strain of this fungus has not been found to cause human disease in Oman.
Antimicrobials from the marine algal endophyte Penicillium sp.
Flewelling, Andrew J; Johnson, John A; Gray, Christopher A
2013-03-01
An endophytic fungus identified as Penicillium sp. was isolated from the brown alga Fucus spiralis collected from the Shetland Islands, United Kingdom. Bioassay-guided fractionation of an extract of the fungus led to the isolation of cladosporin, epiepoformin, phyllostine, and patulin, all of which showed antimicrobial activity against either Staphylococcus aureus or Pseudomonas aeruginosa. Cladosporin has not previously been identified from a fungus of the genus Penicillium, and, despite being biosynthetically related, epiepoformin, phyllostine and patulin have not been previously reported from one source.
Yamamoto, Tatsuki; Miura, Chihiro; Fuji, Masako; Nagata, Shotaro; Otani, Yuria; Yagame, Takahiro; Yamato, Masahide; Kaminaka, Hironori
2017-02-21
In nature, orchid plants depend completely on symbiotic fungi for their nutrition at the germination and the subsequent seedling (protocorm) stages. However, only limited quantitative methods for evaluating the orchid-fungus interactions at the protocorm stage are currently available, which greatly constrains our understanding of the symbiosis. Here, we aimed to improve and integrate quantitative evaluations of the growth and fungal colonization in the protocorms of a terrestrial orchid, Blettila striata, growing on a plate medium. We achieved both symbiotic and asymbiotic germinations for the terrestrial orchid B. striata. The protocorms produced by the two germination methods grew almost synchronously for the first three weeks. At week four, however, the length was significantly lower in the symbiotic protocorms. Interestingly, the dry weight of symbiotic protocorms did not significantly change during the growth period, which implies that there was only limited transfer of carbon compounds from the fungus to the protocorms in this relationship. Next, to evaluate the orchid-fungus interactions, we developed an ink-staining method to observe the hyphal coils in protocorms without preparing thin sections. Crushing the protocorm under the coverglass enables us to observe all hyphal coils in the protocorms with high resolution. For this observation, we established a criterion to categorize the stages of hyphal coils, depending on development and degradation. By counting the symbiotic cells within each stage, it was possible to quantitatively evaluate the orchid-fungus symbiosis. We describe a method for quantitative evaluation of orchid-fungus symbiosis by integrating the measurements of plant growth and fungal colonization. The current study revealed that although fungal colonization was observed in the symbiotic protocorms, the weight of the protocorm did not significantly increase, which is probably due to the incompatibility of the fungus in this symbiosis. These results suggest that fungal colonization and nutrition transfer can be differentially regulated in the symbiosis. The evaluation methods developed in this study can be used to study various quantitative aspects of the orchid-fungus symbiosis.
FLUORESCENT-SERIOLOGICAL INVESTIGATIONS OF A PATHOGENIC FUNGUS (SPOROTRICHUM SCHENCKII),
coloration of numerous other species of fungus no cross reactions with Sporotrichum schenkii were found. The use of this fluorescent coloring method for the diagnosis of Sporotrichosis is suggested. (Author)
... this page. Please enable Javascript in your browser. Athlete's Foot Athlete's foot is a skin infection caused by fungus. A ... the body; on the foot, it is called athlete’s foot, or tinea pedis. Fungus commonly attacks the feet ...
Amóra, Sthenia Santos Albano; Bevilaqua, Claudia Maria Leal; Feijó, Francisco Marlon Carneiro; Pereira, Romeika Hermínia de Macedo Assunção; Alves, Nilza Dutra; Freire, Fúlvio Aurélio de Morais; Kamimura, Michel Toth; de Oliveira, Diana Magalhães; Luna-Alves Lima, Elza Aurea; Rocha, Marcos Fábio Gadelha
2010-03-01
The control of Visceral Leishmaniasis (VL) vector is often based on the application of chemical residual insecticide. However, this strategy has not been effective. The continuing search for an appropriate vector control may include the use of biological control. This study evaluates the effects of the fungus Metarhizium anisopliae var. acridum on Lutzomyia longipalpis. Five concentrations of the fungus were utilized, 1 x 10(4) to 1 x 10(8) conidia/ml, accompanied by controls. The unhatched eggs, larvae and dead adults previously exposed to fungi were sown to reisolate the fungi and analysis of parameters of growth. The fungus was subsequently identified by PCR and DNA sequencing. M. anisopliae var. acridum reduced egg hatching by 40%. The mortality of infected larvae was significant. The longevity of infected adults was lower than that of negative controls. The effects of fungal infection on the hatching of eggs laid by infected females were also significant. With respect to fungal growth parameters post-infection, only vegetative growth was not significantly higher than that of the fungi before infection. The revalidation of the identification of the reisolated fungus was confirmed post-passage only from adult insects. In terms of larvae mortality and the fecundity of infected females, the results were significant, proving that the main vector species of VL is susceptible to infection by this entomopathogenic fungus in the adult stage. Copyright 2009 Elsevier B.V. All rights reserved.
Quesada-Moraga, Enrique; López-Díaz, Cristina; Landa, Blanca Beatriz
2014-01-01
Beauveria bassiana strain 04/01-Tip, obtained from a larva of the opium poppy stem gall wasp Iraella luteipes (Hymenoptera; Cynipidae), endophytically colonizes opium poppy (Papaver somniferum L.) plants and protects them against this pest. The goal of this study was to monitor the dynamics of endophytic colonization of opium poppy by B. bassiana after the fungus was applied to the seed and to ascertain whether the fungus is transmitted vertically via seeds. Using a species-specific nested PCR protocol and DNA extracted from surface-sterilised leaf pieces or seeds of B. bassiana-inoculated opium poppy plants, the fungus was detected within the plant beginning at the growth stage of rosette building and them throughout the entire plant growth cycle (about 120–140 days after sowing). The fungus was also detected in seeds from 50% of the capsules sampled. Seeds that showed positive amplification for B. bassiana were planted in sterile soil and the endophyte was again detected in more than 42% of the plants sampled during all plant growth stages. Beauveria bassiana was transmitted to seeds in 25% of the plants from the second generation that formed a mature capsule. These results demonstrate for the first time the vertical transmission of an entomopathogenic fungus from endophytically colonised maternal plants. This information is crucial to better understand the ecological role of entomopathogenic fungi as plant endophytes and may allow development of a sustainable and cost effective strategy for I. luteipes management in P. somniferum. PMID:24551242
Lorch, Jeffrey M.; Muller, Laura K.; Russell, Robin E.; O'Connor, Michael; Lindner, Daniel L.; Blehert, David S.
2013-01-01
White-nose syndrome (WNS) is an emerging disease of hibernating bats caused by the recently described fungus Geomyces destructans. First isolated in 2008, the origins of this fungus in North America and its ability to persist in the environment remain undefined. To investigate the correlation between manifestation of WNS and distribution of G. destructans in the U.S., we analyzed sediment samples collected from 55 bat hibernacula (caves and mines) both within and outside the known range of WNS using a newly developed real-time PCR assay. Geomyces destructans was detected in 17 of 21 sites within the known range of WNS at the time the samples were collected; the fungus was not found in 28 sites beyond the known range of the disease at the time that environmental samples were collected. These data indicate that distribution of G. destructans is correlated with disease in hibernating bats and support the hypothesis that the fungus is likely an exotic species in North America. Additionally, we examined whether G. destructans persists in infested bat hibernacula when bats are absent. Sediment samples were collected from 14 WNS-positive hibernacula, and the samples were screened for viable fungus using a culture technique. Viable G. destructans was cultivated from 7 of the 14 sites sampled during late summer when bats were no longer in hibernation, suggesting the fungus can persist in the environment in the absence of bat hosts for long periods of time.
Quesada-Moraga, Enrique; López-Díaz, Cristina; Landa, Blanca Beatriz
2014-01-01
Beauveria bassiana strain 04/01-Tip, obtained from a larva of the opium poppy stem gall wasp Iraella luteipes (Hymenoptera; Cynipidae), endophytically colonizes opium poppy (Papaver somniferum L.) plants and protects them against this pest. The goal of this study was to monitor the dynamics of endophytic colonization of opium poppy by B. bassiana after the fungus was applied to the seed and to ascertain whether the fungus is transmitted vertically via seeds. Using a species-specific nested PCR protocol and DNA extracted from surface-sterilised leaf pieces or seeds of B. bassiana-inoculated opium poppy plants, the fungus was detected within the plant beginning at the growth stage of rosette building and them throughout the entire plant growth cycle (about 120-140 days after sowing). The fungus was also detected in seeds from 50% of the capsules sampled. Seeds that showed positive amplification for B. bassiana were planted in sterile soil and the endophyte was again detected in more than 42% of the plants sampled during all plant growth stages. Beauveria bassiana was transmitted to seeds in 25% of the plants from the second generation that formed a mature capsule. These results demonstrate for the first time the vertical transmission of an entomopathogenic fungus from endophytically colonised maternal plants. This information is crucial to better understand the ecological role of entomopathogenic fungi as plant endophytes and may allow development of a sustainable and cost effective strategy for I. luteipes management in P. somniferum.
Metagenomic and metaproteomic insights into bacterial communities in leaf-cutter ant fungus gardens
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aylward, Frank O.; Burnum, Kristin E.; Scott, Jarrod J.
2012-09-01
Herbivores gain access to nutrients stored in plant biomass largely by harnessing the metabolic activities of microbes. Leaf-cutter ants of the genus Atta are a hallmark example; these dominant Neotropical herbivores cultivate symbiotic fungus gardens on massive quantities of fresh plant forage. As the external digestive system of the ants, fungus gardens facilitate the production and sustenance of millions of workers in mature Atta colonies. Here we use metagenomic, and metaproteomic techniques to characterize the bacterial diversity and overall physiological potential of fungus gardens from two species of Atta. Our analysis of over 1.2 Gbp of community metagenomic sequence andmore » three 16S pyrotag libraries reveals that, in addition to harboring the dominant fungal crop, these ecosystems contain abundant populations of Enterobacteriaceae, including the genera Enterobacter, Pantoea, Klebsiella, Citrobacter, and Escherichia. We show that these bacterial communities possess genes commonly associated with lignocellulose degradation, and likely participate in the processing of plant biomass. Additionally, we demonstrate that bacteria in these environments encode a diverse suite of biosynthetic pathways, and that they may enrich the nitrogen-poor forage of the ants with B-vitamins, amino acids, and proteins. These results are consistent with the hypothesis that fungus gardens are highly-specialized fungus-bacteria communities that efficiently convert plant material into usable energy for their ant hosts. Together with recent investigations into the microbial symbionts of vertebrates, our work underscores the importance of microbial communities to the ecology and evolution of herbivorous metazoans.« less
Trichoderma virens as a biocontrol of Toxocara canis: In vivo evaluation.
de Souza Maia Filho, Fernando; da Silva Fonseca, Anelise Oliveira; Persici, Beatriz Maroneze; de Souza Silveira, Julia; Braga, Caroline Quintana; Pötter, Luciana; de Avila Botton, Sônia; Brayer Pereira, Daniela Isabel
Microorganisms have been widely studied as biological control agents of parasites of medical and veterinary importance. Coprophagous arthropods, bacteria and fungi are among the different organisms evaluated as potential biological control agents. Nematophagous fungi capture and digest the free forms of nematodes in the soil. Due to its zoonotic potential, Toxocara canis have been brought to the attention of researchers. The aim of the present study was to determine whether the administration of embryonated T. canis eggs exposed to the nematophagous fungus Trichoderma virens reduces parasite infection in experimental animals. Embryonated T. canis eggs were exposed to T. virens mycelium for 15 days at 25°C. Subsequently, 100 fungus-exposed eggs were orally administered to 20 Swiss mice. As a positive control, another 20 mice received 100 embryonated eggs that were not exposed to the fungus. After 48h, the animals were killed, and heart, lungs and liver were harvested for the recovery of larvae. The organs of the animals that received embryonated T. canis eggs exposed to the fungus showed a lower mean larval recovery when compared with the animals that received embryonated eggs without fungus exposure (p<0.05). The exposure of T. canis eggs to T. virens reduces the experimental infection, demonstrating the potential of this nematophagous fungus as a biocontrol agent. Copyright © 2016 Asociación Española de Micología. Publicado por Elsevier España, S.L.U. All rights reserved.
Fungus-insect gall of Phlebopus portentosus.
Zhang, Chun-Xia; He, Ming-Xia; Cao, Yang; Liu, Jing; Gao, Feng; Wang, Wen-Bing; Ji, Kai-Ping; Shao, Shi-Cheng; Wang, Yun
2015-01-01
Phlebopus portentosus is a popular edible wild mushroom found in the tropical Yunnan, China, and northern Thailand. In its natural habitats, a gall often has been found on some plant roots, around which fungal fruiting bodies are produced. The galls are different from common insect galls in that their cavity walls are not made from plant tissue but rather from the hyphae of P. portentosus. Therefore we have termed this phenomenon "fungus-insect gall". Thus far six root mealy bug species in the family Pseudococcidae that form fungus-insect galls with P. portentosus have been identified: Formicococcus polysperes, Geococcus satellitum, Planococcus minor, Pseudococcus cryptus, Paraputo banzigeri and Rastrococcus invadens. Fungus-insect galls were found on the roots of more than 21 plant species, including Delonix regia, Citrus maxima, Coffea arabica and Artocarpus heterophyllus. Greenhouse inoculation trials showed that fungus-insect galls were found on the roots of A. heterophyllus 1 mo after inoculation. The galls were subglobose to globose, fulvous when young and became dark brown at maturation. Each gall harbored one or more mealy bugs and had a chimney-like vent for ventilation and access to the gall. The cavity wall had three layers. Various shaped mealy bug wax deposits were found inside the wall. Fungal hyphae invaded the epidermis of plant roots and sometimes even the cortical cells during the late stage of gall development. The identity of the fungus inside the cavity was confirmed by molecular methods. © 2015 by The Mycological Society of America.
Viral repression of fungal pheromone precursor gene expression.
Zhang, L; Baasiri, R A; Van Alfen, N K
1998-02-01
Biological control of chestnut blight caused by the filamentous ascomycete Cryphonectria parasitica can be achieved with a virus that infects this fungus. This hypovirus causes a perturbation of fungal development that results in low virulence (hypovirulence), poor asexual sporulation, and female infertility without affecting fungal growth in culture. At the molecular level, the virus is known to affect the transcription of a number of fungal genes. Two of these genes, Vir1 and Vir2, produce abundant transcripts in noninfected strains of the fungus, but the transcripts are not detectable in virus-infected strains. We report here that these two genes encode the pheromone precursors of the Mat-2 mating type of the fungus; consequently, these genes have been renamed Mf2/1 and Mf2/2. To determine if the virus affects the mating systems of both mating types of this fungus, the pheromone precursor gene, Mf1/1, of a Mat-1 strain was cloned and likewise was found to be repressed in virus-infected strains. The suppression of transcription of the pheromone precursor genes of this fungus could be the cause of the mating defect of infected strains of the fungus. Although published reports suggest that a G alpha(i) subunit may be involved in this regulation, our results do not support this hypothesis. The prepropheromone encoded by Mf1/1 is structurally similar to that of the prepro-p-factor of Schizosaccharomyces pombe. This is the first description of the complete set of pheromone precursor genes encoded by a filamentous ascomycete.
Metagenomic and metaproteomic insights into bacterial communities in leaf-cutter ant fungus gardens.
Aylward, Frank O; Burnum, Kristin E; Scott, Jarrod J; Suen, Garret; Tringe, Susannah G; Adams, Sandra M; Barry, Kerrie W; Nicora, Carrie D; Piehowski, Paul D; Purvine, Samuel O; Starrett, Gabriel J; Goodwin, Lynne A; Smith, Richard D; Lipton, Mary S; Currie, Cameron R
2012-09-01
Herbivores gain access to nutrients stored in plant biomass largely by harnessing the metabolic activities of microbes. Leaf-cutter ants of the genus Atta are a hallmark example; these dominant neotropical herbivores cultivate symbiotic fungus gardens on large quantities of fresh plant forage. As the external digestive system of the ants, fungus gardens facilitate the production and sustenance of millions of workers. Using metagenomic and metaproteomic techniques, we characterize the bacterial diversity and physiological potential of fungus gardens from two species of Atta. Our analysis of over 1.2 Gbp of community metagenomic sequence and three 16S pyrotag libraries reveals that in addition to harboring the dominant fungal crop, these ecosystems contain abundant populations of Enterobacteriaceae, including the genera Enterobacter, Pantoea, Klebsiella, Citrobacter and Escherichia. We show that these bacterial communities possess genes associated with lignocellulose degradation and diverse biosynthetic pathways, suggesting that they play a role in nutrient cycling by converting the nitrogen-poor forage of the ants into B-vitamins, amino acids and other cellular components. Our metaproteomic analysis confirms that bacterial glycosyl hydrolases and proteins with putative biosynthetic functions are produced in both field-collected and laboratory-reared colonies. These results are consistent with the hypothesis that fungus gardens are specialized fungus-bacteria communities that convert plant material into energy for their ant hosts. Together with recent investigations into the microbial symbionts of vertebrates, our work underscores the importance of microbial communities in the ecology and evolution of herbivorous metazoans.
Rajaraman, Jeyaraman; Douchkov, Dimitar; Hensel, Götz; Stefanato, Francesca L.; Gordon, Anna; Ereful, Nelzo; Caldararu, Octav F.; Petrescu, Andrei-Jose; Kumlehn, Jochen; Boyd, Lesley A.; Schweizer, Patrick
2016-01-01
Pattern recognition receptors (PRRs) belonging to the multigene family of receptor-like kinases (RLKs) are the sensing devices of plants for microbe- or pathogen-associated molecular patterns released from microbial organisms. Here we describe Rnr8 (for Required for non-host resistance 8) encoding HvLEMK1, a LRR-malectin domain-containing transmembrane RLK that mediates non-host resistance of barley to the non-adapted wheat powdery mildew fungus Blumeria graminis f.sp. tritici. Transgenic barley lines with silenced HvLEMK1 allow entry and colony growth of the non-adapted pathogen, although sporulation was reduced and final colony size did not reach that of the adapted barley powdery mildew fungus B. graminis f.sp. hordei. Transient expression of the barley or wheat LEMK1 genes enhanced resistance in wheat to the adapted wheat powdery mildew fungus while expression of the same genes did not protect barley from attack by the barley powdery mildew fungus. The results suggest that HvLEMK1 is a factor mediating non-host resistance in barley and quantitative host resistance in wheat to the wheat powdery mildew fungus. PMID:28018377
Rajaraman, Jeyaraman; Douchkov, Dimitar; Hensel, Götz; Stefanato, Francesca L; Gordon, Anna; Ereful, Nelzo; Caldararu, Octav F; Petrescu, Andrei-Jose; Kumlehn, Jochen; Boyd, Lesley A; Schweizer, Patrick
2016-01-01
Pattern recognition receptors (PRRs) belonging to the multigene family of receptor-like kinases (RLKs) are the sensing devices of plants for microbe- or pathogen-associated molecular patterns released from microbial organisms. Here we describe Rnr8 (for Required for non-host resistance 8 ) encoding HvLEMK1, a LRR-malectin domain-containing transmembrane RLK that mediates non-host resistance of barley to the non-adapted wheat powdery mildew fungus Blumeria graminis f.sp. tritici . Transgenic barley lines with silenced HvLEMK1 allow entry and colony growth of the non-adapted pathogen, although sporulation was reduced and final colony size did not reach that of the adapted barley powdery mildew fungus B. graminis f.sp. hordei . Transient expression of the barley or wheat LEMK1 genes enhanced resistance in wheat to the adapted wheat powdery mildew fungus while expression of the same genes did not protect barley from attack by the barley powdery mildew fungus. The results suggest that HvLEMK1 is a factor mediating non-host resistance in barley and quantitative host resistance in wheat to the wheat powdery mildew fungus.
Doan, Uyen Vy; Mendez Rojas, Bomar; Kirby, Ralph
2017-09-01
Cordyceps fungus found in infected cicada nymphs ("cicada flowers") is utilized in traditional Chinese medicine. Cordyceps fungus toxicity in humans has not been previously reported. We report 60 cases of apparent Cordyceps poisoning in Southern Vietnam. We retrospectively collected demographic and clinical data from the medical records (21 cases) and by telephone interview (39 cases) of patients admitted to seven hospitals in Southern Vietnam following ingestion of cicada flowers between 2008 and 2015. We also determined the species of Cordyceps present in the cicada flowers and performed a partial chemical analysis of the fungus. Sixty cases of toxic effects following ingestion of cicada flowers were documented. Symptom onset occurred within 60 minutes following ingestion. Symptoms included dizziness, vomiting, salivation, mydriasis, jaw stiffness, urinary retention, seizures, agitated delirium, hallucinations, somnolence and coma. None of the patients suffered liver or kidney injury. There was one fatality. The Cordyceps fungus involved in these poisoning was identified as Ophiocordyceps heteropoda. The presence of ibotenic acid was confirmed, but musimol and muscarine were absent. Cicada infected with Ophiocordyceps heteropoda in Vietnam contain ibotenic acid and are associated with a clinical syndrome consistent with its effects.
NASA Astrophysics Data System (ADS)
Lee, Jeong-Won; Hwang, Woonbong
2018-06-01
Extensive research has been carried out concerning the application of superhydrophobic coating in heat exchangers, but little is known about the application of this technique to brazed aluminum heat exchangers (BAHEs). In this work, we describe a new superhydrophobic coating method, which is suitable for BAHE use on an industrial scale. We first render the BAHE superhydrophobic by fabricating micro/nanostructures using solution dipping followed by fluorination. After the complete removal of the silicon residue, we verify using surface analysis that the BAHE surface is perfectly superhydrophobic. We also studied the fungus-cleaning properties of the superhydrophobic surface by growing fungus for 4 weeks in a moist environment on BAHE fins with and without superhydrophobic coating. We observed that, whereas the fungus grown on the untreated fins is extremely difficult to remove, the fungus on the fins with the superhydrophobic coating can be removed easily with only a modest amount of water. We also found that the coated BAHE fins exhibit excellent resistance to moisture. The superhydrophobic coating method that we propose is therefore expected to have a major impact in the heating, ventilating and air conditioning industry market.
Vertical transmission as the key to the colonization of Madagascar by fungus-growing termites?
Nobre, T.; Eggleton, P.; Aanen, D. K.
2010-01-01
The mutualism between fungus-growing termites (Macrotermitinae) and their mutualistic fungi (Termitomyces) began in Africa. The fungus-growing termites have secondarily colonized Madagascar and only a subset of the genera found in Africa is found on this isolated island. Successful long-distance colonization may have been severely constrained by the obligate interaction of the termites with fungal symbionts and the need to acquire these symbionts secondarily from the environment for most species (horizontal symbiont transmission). Consistent with this hypothesis, we show that all extant species of fungus-growing termites of Madagascar are the result of a single colonization event of termites belonging to one of the only two groups with vertical symbiont transmission, and we date this event at approximately 13 Mya (Middle/Upper Miocene). Vertical symbiont transmission may therefore have facilitated long-distance dispersal since both partners disperse together. In contrast to their termite hosts, the fungal symbionts have colonized Madagascar multiple times, suggesting that the presence of fungus-growing termites may have facilitated secondary colonizations of the symbiont. Our findings indicate that the absence of the right symbionts in a new environment can prevent long-distance dispersal of symbioses relying on horizontal symbiont acquisition. PMID:19828546
Cruz, Daniela G; Costa, Luana M; Rocha, Letícia O; Retamal, Claudio A; Vieira, Ricardo A M; Seabra, Sergio H; Silva, Carlos P; DaMatta, Renato A; Santos, Clóvis P
2015-08-01
The nematode-trapping fungus Duddingtonia flagrans has been studied as a possible control method for gastrointestinal nematodes of livestock animals. These fungi capture and infect the nematode by cuticle penetration, immobilization, and digestion of the internal contents. It has been suggested that this sequence of events occurs by a combination of physical and enzymatical activities. The aim of this study was to investigate the participation of proteolytic enzymatic activity during the interaction of the nematophagous fungus D. flagrans with infective larvae of trichostrongylides and the free-living nematode Panagrellus spp. Protease inhibitors used interfered in the predatory activity of D. flagrans. However, only PMSF significantly reduced the mean number of Panagrellus spp. captured by D. flagrans in comparison with the control. The experiment with fluorogenic substrate showed that maximum urokinase activity during the interaction of the fungus with the infective larvae of trichostrongylides or Panagrellus spp. occurred within 7 or 1 h of incubation, respectively. The protease activity, especially of the serine class, may be important during the interaction between the fungus and nematodes. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Martínez-Villarreal, Rodolfo; Garza-Romero, Tamar S; Moreno-Medina, Víctor R; Hernández-Delgado, Sanjuana; Mayek-Pérez, Netzahualcoyotl
Fungus Macrophomina phaseolina (Tassi) Goid. is the causative agent of charcoal rot disease which causes significant yield losses in major crops such as maize, sorghum, soybean and common beans in Mexico. This fungus is a facultative parasite which shows broad ability to adapt itself to stressed environments where water deficits and/or high temperature stresses commonly occur. These environmental conditions are common for most cultivable lands throughout Mexico. Here we describe some basic facts related to the etiology and epidemiology of the fungus as well as to the importance of responses to stressed environments, particularly to water deficits, based on morphology and growth traits, as well as on physiology, biochemistry and pathogenicity of fungus M. phaseolina. To conclude, we show some perspectives related to future research into the genus, which emphasize the increasing need to improve the knowledge based on the application of both traditional and biotechnological tools in order to elucidate the mechanisms of resistance to environmental stress which can be extrapolated to other useful organisms to man. Copyright © 2016 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.
Im, Kyung Hoan; Nguyen, Trung Kien; Choi, Jaehyuk; Lee, Tae Soo
2016-03-01
Lenzites betulinus, known as gilled polypore belongs to Basidiomycota was isolated from fruiting body on broadleaf dead trees. It was found that the mycelia of white rot fungus Lenzites betulinus IUM 5468 produced ethanol from various sugars, including glucose, mannose, galactose, and cellobiose with a yield of 0.38, 0.26, 0.07, and 0.26 g of ethanol per gram of sugar consumed, respectively. This fungus relatively exhibited a good ethanol production from xylose at 0.26 g of ethanol per gram of sugar consumed. However, the ethanol conversion rate of arabinose was relatively low (at 0.07 g of ethanol per gram sugar). L. betulinus was capable of producing ethanol directly from rice straw and corn stalks at 0.22 g and 0.16 g of ethanol per gram of substrates, respectively, when this fungus was cultured in a basal medium containing 20 g/L rice straw or corn stalks. These results indicate that L. betulinus can produce ethanol efficiently from glucose, mannose, and cellobiose and produce ethanol very poorly from galactose and arabinose. Therefore, it is suggested that this fungus can ferment ethanol from various sugars and hydrolyze cellulosic materials to sugars and convert them to ethanol simultaneously.
46 CFR 164.018-9 - Design requirements.
Code of Federal Regulations, 2012 CFR
2012-10-01
... with the “fungus resistance” test method listed in § 164.018-11, retroreflective material must not support fungus growth, and the reflective intensity of the material must be equal to or greater than the...
46 CFR 164.018-9 - Design requirements.
Code of Federal Regulations, 2013 CFR
2013-10-01
... with the “fungus resistance” test method listed in § 164.018-11, retroreflective material must not support fungus growth, and the reflective intensity of the material must be equal to or greater than the...
46 CFR 164.018-9 - Design requirements.
Code of Federal Regulations, 2010 CFR
2010-10-01
... with the “fungus resistance” test method listed in § 164.018-11, retroreflective material must not support fungus growth, and the reflective intensity of the material must be equal to or greater than the...
46 CFR 164.018-9 - Design requirements.
Code of Federal Regulations, 2011 CFR
2011-10-01
... with the “fungus resistance” test method listed in § 164.018-11, retroreflective material must not support fungus growth, and the reflective intensity of the material must be equal to or greater than the...
ERIC Educational Resources Information Center
Whitehouse, H. L. K.
1973-01-01
Discusses the mechanisms of genetic recombination with particular emphasis on the study of the fungus Sordaria brevicollis. The study of recombination is facilitated by the use of mutants of this fungus in which the color of the ascospores is affected. (JR)
Cuspidate A, new anti-fungal triterpenoid saponin from Lepidagathis cuspidata.
Rattan, Rajeev; Inder Fozdar, Bharat; Gautam, Veena; Sharma, Ritika; Kumar, Dinesh; Sharma, Upendra
2017-04-01
One new triterpenoid saponin named cuspidate A (1) along with a known oleanane-based triterpenoid saponin clemontanoside-C were isolated from the roots of Lepidagathis cuspidata. The structure of new compound (1) was established after detailed analysis of spectroscopic data including 1D and 2D NMR spectra. This is the first report on clemontanoside-C from this genus. These saponins were found to be effective against the selected fungal strains Aspergillus flavus, Rhizopus stolinifer, Penicillum nodatum, Aspergillus fumigates. Compound 1 showed better activity, comparable to the synthetic drug, while compound 2 showed a moderate effect against all studied fungal strains.
Bioconversion of D-psicose to D-tagatose and D-talitol by Mucoraceae fungi.
Yoshihara, Kazutoshi; Shinohara, Yoshihiro; Hirotsu, Takahiro; Izumori, Ken
2006-03-01
Rhizopus oryzae MYA-2483, which cannot utilize D-psicose as a sole source of carbon, converted D-psicose to two other compounds. These compounds were identified by NMR and IR as D-tagatose and D-talitol. In this study, we describe for the first time the bioconversion of D-psicose to D-tagatose. Various strains of Mucoraceae fungi, to which R. oryzae MYA-2483 belongs, exhibited conversion activity similar to that of R. oryzae MYA-2483. There is the possibility that a considerable number of fungi belonging to Mucoraceae possess such D-psicose conversion activity.
Biosynthesis of human diazepam and clonazepam metabolites.
de Paula, Núbia C; Araujo Cordeiro, Kelly C F; de Melo Souza, Paula L; Nogueira, Diogo F; da Silva e Sousa, Diego B; Costa, Maísa B; Noël, François; de Oliveira, Valéria
2015-03-01
A screening of fungal and microbial strains allowed to select the best microorganisms to produce in high yields some of the human metabolites of two benzodiazepine drugs, diazepam and clonazepam, in order to study new pharmacological activities and for chemical standard proposes. Among the microorganisms tested, Cunninghamella echinulata ATCC 9244 and Rhizopus arrhizus ATCC 11145 strains, were the most active producers of the mains metabolites of diazepam which included demethylated, hydroxylated derivatives. Beauveria bassiana ATCC 7159 and Chaetomium indicum LCP 984200 produced the 7 amino-clonazepam metabolite and a product of acid hydrolysis of this benzodiazepine. Copyright © 2015 Elsevier Ltd. All rights reserved.
He, Haibing; Ma, Zhongjun; Wang, Qianqian; Liu, Yu; Xu, Hualin
2016-07-01
A new eremophilane sesquiterpene, capnodiumone (1), along with five known eremophilane sesquiterpenes (2-6) and eight other compounds (7-14), have been isolated from a mangrove-associated fungus Capnodium sp. SZ-F22. The chemical structures were elucidated on the basis of extensive spectroscopic analysis. The broth extract of the fungus exhibited a good inhibitory effect on the mycelium growth against Fusarium graminearum at 100 μg/mL, however, all the 14 compounds showed no expected antifungal activity. The probable reasons were discussed.
The research of using Co-60 γ ray to sterilize different mediums for edible fungus
NASA Astrophysics Data System (ADS)
Guozhu, Li; Zhenqian, Guan; Hengshou, Zhao
1993-10-01
The present experiment has been carried out by using different dosage of Co—60 γ ray for radiation sterilization of five kinds of cultural materials of edible fungus, The results indicated that sterilization dosage of sawdust is 22 kGy. that of cotton—seed shell and the rest are 26 kGy. We conclude that using Co-60 γ ray to sterilize the cultura 1 materials of edible fungus is a secure and saving labor and energy new method which could sterilize thoroughly.
Cruz-Perez, Patricia; Buttner, Mark P.
2004-05-11
A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.
Hasenclever, H F; Piggott, W R
1976-07-01
Application of bat guano to an area with reduced but detectable colonization by Histoplasma capsulatum had no quantitative effect on the fungus. After seeding the guano treated area and an untreated area with a soil culture of the fungus, a quantitative effect was noted in the treated area but the period of survival did not appear to be extended. Twenty-four months after seeding, the fungus was no longer detectable in the study areas and they have remained negative for more than a year.
Process for producing ethanol from plant biomass using the fungus paecilomyces sp.
Wu, Jung Fu
1989-01-01
A process for producing ethanol from plant biomass is disclosed. The process in cludes forming a substrate from the biomass with the substrate including hydrolysates of cellulose and hemicellulose. A species of the fungus Paecilomyces, which has the ability to ferment both cellobiose and xylose to ethanol, is then selected and isolated. The substrate is inoculated with this fungus, and the inoculated substrate is then fermented under conditions favorable for cell viability and conversion of hydrolysates to ethanol. Finally, ethanol is recovered from the fermented substrate.
Process for producing ethanol from plant biomass using the fungus Paecilomyces sp
Wu, J.F.
1985-08-08
A process for producing ethanol from plant biomass is disclosed. The process includes forming a substrate from the biomass with the substrate including hydrolysates of cellulose and hemicellulose. A species of the fungus Paecilomyces which has the ability to ferment both cellobiose and xylose to ethanol is then selected and isolated. The substrate is inoculated with this fungus, and the inoculated substrate is then fermented under conditions favorable for cell viability and conversion of hydrolysates to ethanol. Finally, ethanol is recovered from the fermented substrate. 5 figs., 3 tabs.
Gabriel, Frédéric; D'Almeida, Mahussi; Albert, Olivier; Fitton-Ouhabi, Valérie; Noël, Thierry; Accoceberry, Isabelle
2013-02-09
We report on a fatal invasive infection due to the ascomycetous fungus Neocosmospora vasinfecta, in a 20-year-old European patient suffering from an acute lymphoblastic leukemia. The infection could not be controlled by a bitherapy combining liposomal amphotericin B and voriconazole. This is the second case of disseminated infection reported with this unusual fungus, which develops under its teleomorphic state, is fully resistant to all systemic antifungals, and which is known to live in tropical countries.
Gabriel, Frédéric; D’Almeida, Mahussi; Albert, Olivier; Fitton-Ouhabi, Valérie; Noël, Thierry; Accoceberry, Isabelle
2013-01-01
We report on a fatal invasive infection due to the ascomycetous fungus Neocosmospora vasinfecta, in a 20-year-old European patient suffering from an acute lymphoblastic leukemia. The infection could not be controlled by a bitherapy combining liposomal amphotericin B and voriconazole. This is the second case of disseminated infection reported with this unusual fungus, which develops under its teleomorphic state, is fully resistant to all systemic antifungals, and which is known to live in tropical countries. PMID:24432214
Pedersen, Kristine S. K.; Aanen, Duur K.
2017-01-01
ABSTRACT Fungus-growing termites rely on mutualistic fungi of the genus Termitomyces and gut microbes for plant biomass degradation. Due to a certain degree of symbiont complementarity, this tripartite symbiosis has evolved as a complex bioreactor, enabling decomposition of nearly any plant polymer, likely contributing to the success of the termites as one of the main plant decomposers in the Old World. In this study, we evaluated which plant polymers are decomposed and which enzymes are active during the decomposition process in two major genera of fungus-growing termites. We found a diversity of active enzymes at different stages of decomposition and a consistent decrease in plant components during the decomposition process. Furthermore, our findings are consistent with the hypothesis that termites transport enzymes from the older mature parts of the fungus comb through young worker guts to freshly inoculated plant substrate. However, preliminary fungal RNA sequencing (RNA-seq) analyses suggest that this likely transport is supplemented with enzymes produced in situ. Our findings support that the maintenance of an external fungus comb, inoculated with an optimal mixture of plant material, fungal spores, and enzymes, is likely the key to the extraordinarily efficient plant decomposition in fungus-growing termites. IMPORTANCE Fungus-growing termites have a substantial ecological footprint in the Old World (sub)tropics due to their ability to decompose dead plant material. Through the establishment of an elaborate plant biomass inoculation strategy and through fungal and bacterial enzyme contributions, this farming symbiosis has become an efficient and versatile aerobic bioreactor for plant substrate conversion. Since little is known about what enzymes are expressed and where they are active at different stages of the decomposition process, we used enzyme assays, transcriptomics, and plant content measurements to shed light on how this decomposition of plant substrate is so effectively accomplished. PMID:29269491
da Costa, Rafael R; Hu, Haofu; Pilgaard, Bo; Vreeburg, Sabine M E; Schückel, Julia; Pedersen, Kristine S K; Kračun, Stjepan K; Busk, Peter K; Harholt, Jesper; Sapountzis, Panagiotis; Lange, Lene; Aanen, Duur K; Poulsen, Michael
2018-03-01
Fungus-growing termites rely on mutualistic fungi of the genus Termitomyces and gut microbes for plant biomass degradation. Due to a certain degree of symbiont complementarity, this tripartite symbiosis has evolved as a complex bioreactor, enabling decomposition of nearly any plant polymer, likely contributing to the success of the termites as one of the main plant decomposers in the Old World. In this study, we evaluated which plant polymers are decomposed and which enzymes are active during the decomposition process in two major genera of fungus-growing termites. We found a diversity of active enzymes at different stages of decomposition and a consistent decrease in plant components during the decomposition process. Furthermore, our findings are consistent with the hypothesis that termites transport enzymes from the older mature parts of the fungus comb through young worker guts to freshly inoculated plant substrate. However, preliminary fungal RNA sequencing (RNA-seq) analyses suggest that this likely transport is supplemented with enzymes produced in situ Our findings support that the maintenance of an external fungus comb, inoculated with an optimal mixture of plant material, fungal spores, and enzymes, is likely the key to the extraordinarily efficient plant decomposition in fungus-growing termites. IMPORTANCE Fungus-growing termites have a substantial ecological footprint in the Old World (sub)tropics due to their ability to decompose dead plant material. Through the establishment of an elaborate plant biomass inoculation strategy and through fungal and bacterial enzyme contributions, this farming symbiosis has become an efficient and versatile aerobic bioreactor for plant substrate conversion. Since little is known about what enzymes are expressed and where they are active at different stages of the decomposition process, we used enzyme assays, transcriptomics, and plant content measurements to shed light on how this decomposition of plant substrate is so effectively accomplished. Copyright © 2018 da Costa et al.
76 FR 7095 - Avocados Grown in South Florida; Increased Assessment Rate
Federal Register 2010, 2011, 2012, 2013, 2014
2011-02-09
... Red Bay Ambrosia beetle. The beetle carries the Laurel Wilt fungus which can infect and kill avocado trees. Research into the beetle and fungus had been funded by the University of Florida. However, the...
ERIC Educational Resources Information Center
Flannery, Maura C.
2004-01-01
A mention of "The Fungus Fighters: Two Women Scientists and Their Discovery" by Richard Baldwin and discovery of a huge fungus of the species Armillaria bulbosa and A. ostoyae are presented. Other aspects like fungal infections and shifting relationships are discussed.
Multifarious plant growth promotion by an entomopathogenic fungus Lecanicillium psalliotae.
Senthil Kumar, C M; Jacob, T K; Devasahayam, S; Thomas, Stephy; Geethu, C
2018-03-01
An entomopathogenic fungus, Lecanicillium psalliotae strain IISR-EPF-02 previously found infectious to cardamom thrips, Sciothrips cardamomi promoted plant growth in cardamom, Elettaria cardamomum. The isolate exhibited direct plant growth promoting traits by production of indole-3-acetic acid and ammonia and by solubilizing inorganic phosphate and zinc. It also showed indirect plant growth promoting traits by producing siderophores and cell wall-degrading enzymes like, α-amylases, cellulases and proteases. In pot culture experiments, application of the fungus at the root zone of cardamom seedlings significantly increased shoot and root length, shoot and root biomass, number of secondary roots and leaves and leaf chlorophyll content compared to untreated plants. This is the first report on the plant growth promoting traits of this fungus. The entomopathogenic and multifarious growth promoting traits of L. psalliotae strain IISR-EPF-02 suggest that it has great potential for exploitation in sustainable agriculture. Copyright © 2017 Elsevier GmbH. All rights reserved.
Myco-fluidics: The fluid dynamics of fungal chimerism
NASA Astrophysics Data System (ADS)
Roper, Marcus; Hickey, Patrick; Dressaire, Emilie; Roch, Sebastien
2012-11-01
Chimeras-fantastical creatures formed as amalgams of many animals-have captured the human imagination since Ancient times. But they are also surprisingly common in Nature. The syncytial cells of filamentous fungi harbor large numbers of nuclei bathed in a single cytoplasm. As a fungus grows these nuclei become genetically diverse, either from mutation or from exchange of nuclei between different fungal individuals, a process that is known to increase the virulence of the fungus and its adaptability. By directly measuring nuclear movement in the model ascomycete fungus Neurospora crassa, we show that the fungus' tolerance for internal genetic diversity is enabled by hydrodynamic mixing of nuclei acting at all length scales within the fungal mycelium. Mathematical modeling and experiments in a mutant with altered mycelial morphology reveal some of the exquisite hydraulic engineering necessary to create these mixing flows from spatially coarse pressure gradients.
NASA Astrophysics Data System (ADS)
Saghafi, S.; Penjweini, R.; Becker, K.; Kratky, K. W.; Dodt, H.-U.
2010-09-01
When moulds are illuminated by visible electromagnetic-EM radiations, several effects on nucleus materials and nucleotides can be detected. These effects have a significant influence on mould generation or destruction. This paper presents the effects and implications of a red diode laser beam (660 nm), a second-harmonics of a Nd:YAG laser emitting green beam (532 nm), or the combination of both, on the eradication of Pistachio mould fungus. Incident doses (ID) of both beams are kept identical throughout the experiment. The absorption spectrums of irradiated mouldy samples and the bright-greenish-yellow-fluorescence (BGYF) of fungus occurring in mould texture due to electronic excitation are investigated. We found that a combination of a green and a red laser beam with an ID of 0.5 J/cm2 provides the optimal effects on Pistachio mould fungus eradication.
2014-01-01
Background Lichen is a classic mutualistic organism and the lichenization is one of the fungal symbioses. The lichen-forming fungus Endocarpon pusillum is living in symbiosis with the green alga Diplosphaera chodatii Bialsuknia as a lichen in the arid regions. Results 454 and Illumina technologies were used to sequence the genome of E. pusillum. A total of 9,285 genes were annotated in the 37.5 Mb genome of E. pusillum. Analyses of the genes provided direct molecular evidence for certain natural characteristics, such as homothallic reproduction and drought-tolerance. Comparative genomics analysis indicated that the expansion and contraction of some protein families in the E. pusillum genome reflect the specific relationship with its photosynthetic partner (D. chodatii). Co-culture experiments using the lichen-forming fungus E. pusillum and its algal partner allowed the functional identification of genes involved in the nitrogen and carbon transfer between both symbionts, and three lectins without signal peptide domains were found to be essential for the symbiotic recognition in the lichen; interestingly, the ratio of the biomass of both lichen-forming fungus and its photosynthetic partner and their contact time were found to be important for the interaction between these two symbionts. Conclusions The present study lays a genomic analysis of the lichen-forming fungus E. pusillum for demonstrating its general biological features and the traits of the interaction between this fungus and its photosynthetic partner D. chodatii, and will provide research basis for investigating the nature of its drought resistance and symbiosis. PMID:24438332
Shrestha, Uttam Babu; Bawa, Kamaljit S.
2014-01-01
Climate change has already impacted ecosystems and species and substantial impacts of climate change in the future are expected. Species distribution modeling is widely used to map the current potential distribution of species as well as to model the impact of future climate change on distribution of species. Mapping current distribution is useful for conservation planning and understanding the change in distribution impacted by climate change is important for mitigation of future biodiversity losses. However, the current distribution of Chinese caterpillar fungus, a flagship species of the Himalaya with very high economic value, is unknown. Nor do we know the potential changes in suitable habitat of Chinese caterpillar fungus caused by future climate change. We used MaxEnt modeling to predict current distribution and changes in the future distributions of Chinese caterpillar fungus in three future climate change trajectories based on representative concentration pathways (RCPs: RCP 2.6, RCP 4.5, and RCP 6.0) in three different time periods (2030, 2050, and 2070) using species occurrence points, bioclimatic variables, and altitude. About 6.02% (8,989 km2) area of the Nepal Himalaya is suitable for Chinese caterpillar fungus habitat. Our model showed that across all future climate change trajectories over three different time periods, the area of predicted suitable habitat of Chinese caterpillar fungus would expand, with 0.11–4.87% expansion over current suitable habitat. Depending upon the representative concentration pathways, we observed both increase and decrease in average elevation of the suitable habitat range of the species. PMID:25180515
Shrestha, Uttam Babu; Bawa, Kamaljit S
2014-01-01
Climate change has already impacted ecosystems and species and substantial impacts of climate change in the future are expected. Species distribution modeling is widely used to map the current potential distribution of species as well as to model the impact of future climate change on distribution of species. Mapping current distribution is useful for conservation planning and understanding the change in distribution impacted by climate change is important for mitigation of future biodiversity losses. However, the current distribution of Chinese caterpillar fungus, a flagship species of the Himalaya with very high economic value, is unknown. Nor do we know the potential changes in suitable habitat of Chinese caterpillar fungus caused by future climate change. We used MaxEnt modeling to predict current distribution and changes in the future distributions of Chinese caterpillar fungus in three future climate change trajectories based on representative concentration pathways (RCPs: RCP 2.6, RCP 4.5, and RCP 6.0) in three different time periods (2030, 2050, and 2070) using species occurrence points, bioclimatic variables, and altitude. About 6.02% (8,989 km2) area of the Nepal Himalaya is suitable for Chinese caterpillar fungus habitat. Our model showed that across all future climate change trajectories over three different time periods, the area of predicted suitable habitat of Chinese caterpillar fungus would expand, with 0.11-4.87% expansion over current suitable habitat. Depending upon the representative concentration pathways, we observed both increase and decrease in average elevation of the suitable habitat range of the species.
Richards, Callum; Otani, Saria; Mikaelyan, Aram; Poulsen, Michael
2017-01-01
The gut microbiotas of cockroaches and termites play important roles in the symbiotic digestion of dietary components, such as lignocellulose. Diet has been proposed as a primary determinant of community structure within the gut, acting as a selection force to shape the diversity observed within this "bioreactor", and as a key factor for the divergence of the termite gut microbiota from the omnivorous cockroach ancestor. The gut microbiota in most termites supports primarily the breakdown of lignocellulose, but the fungus-farming sub-family of higher termites has become similar in gut microbiota to the ancestral omnivorous cockroaches. To assess the importance of a fungus diet as a driver of community structure, we compare community compositions in the guts of experimentally manipulated Pycnoscelus surinamensis cockroaches fed on fungus cultivated by fungus-farming termites. MiSeq amplicon analysis of gut microbiotas from 49 gut samples showed a step-wise gradient pattern in community similarity that correlated with an increase in the proportion of fungal material provided to the cockroaches. Comparison of the taxonomic composition of manipulated communities to that of gut communities of a fungus-feeding termite species showed that although some bacteria OTUs shared by P. surinamensis and the farming termites increased in the guts of cockroaches on a fungal diet, cockroach communities remained distinct from those of termites. These results demonstrate that a fungal diet can play a role in structuring gut community composition, but at the same time exemplifies how original community compositions constrain the magnitude of such change.
Viral Repression of Fungal Pheromone Precursor Gene Expression
Zhang, Lei; Baasiri, Rudeina A.; Van Alfen, Neal K.
1998-01-01
Biological control of chestnut blight caused by the filamentous ascomycete Cryphonectria parasitica can be achieved with a virus that infects this fungus. This hypovirus causes a perturbation of fungal development that results in low virulence (hypovirulence), poor asexual sporulation, and female infertility without affecting fungal growth in culture. At the molecular level, the virus is known to affect the transcription of a number of fungal genes. Two of these genes, Vir1 and Vir2, produce abundant transcripts in noninfected strains of the fungus, but the transcripts are not detectable in virus-infected strains. We report here that these two genes encode the pheromone precursors of the Mat-2 mating type of the fungus; consequently, these genes have been renamed Mf2/1 and Mf2/2. To determine if the virus affects the mating systems of both mating types of this fungus, the pheromone precursor gene, Mf1/1, of a Mat-1 strain was cloned and likewise was found to be repressed in virus-infected strains. The suppression of transcription of the pheromone precursor genes of this fungus could be the cause of the mating defect of infected strains of the fungus. Although published reports suggest that a Gαi subunit may be involved in this regulation, our results do not support this hypothesis. The prepropheromone encoded by Mf1/1 is structurally similar to that of the prepro-p-factor of Schizosaccharomyces pombe. This is the first description of the complete set of pheromone precursor genes encoded by a filamentous ascomycete. PMID:9447992
Scott Costa; Karen Felton; Bradley Onken; Richard Reardon; Rusty. Rhea
2011-01-01
Forest populations of hemlock woolly adelgid (HWA) were reduced using an operational formulation of the insect-killing fungus Lecanicillium muscarium when it was supported by microfactory formulation technology.
Evolutionary patterns of proteinase activity in attine ant fungus gardens
2011-01-01
Background Attine ants live in symbiosis with a basidiomycetous fungus that they rear on a substrate of plant material. This indirect herbivory implies that the symbiosis is likely to be nitrogen deprived, so that specific mechanisms may have evolved to enhance protein availability. We therefore hypothesized that fungal proteinase activity may have been under selection for efficiency and that different classes of proteinases might be involved. Results We determined proteinase activity profiles across a wide pH range for fungus gardens of 14 Panamanian species of fungus-growing ants, representing eight genera. We mapped these activity profiles on an independently obtained molecular phylogeny of the symbionts and show that total proteinase activity in lower attine symbionts peaks at ca. pH 6. The higher attine symbionts that have no known free-living relatives had much higher proteinase activities than the lower attine symbionts. Their total in vitro proteinase activity peaked at pH values around 5, which is close to the pH that the ants maintain in their fungus gardens, suggesting that the pH optimum of fungal proteinases may have changed after the irreversible domestication of evolutionary more derived fungal symbionts. This notion is also supported by buffering capacities of fungus gardens at pH 5.2 being remarkably high, and suggests that the fungal symbiont actively helps to maintain garden acidity at this specific level. Metalloproteinases dominated the activity profiles of lower attine gardens and may thus represent the ancestral type of proteinase production, whereas serine proteinase activity dominated the activity profiles of the higher attine gardens reared by Trachymyrmex and Sericomyrmex, suggesting that there may be trade-offs in the production of these enzyme classes. Remarkably, the single symbiont that is shared by species of the crown group of Atta and Acromyrmex leaf-cutting ants mostly showed metalloproteinase activity, suggesting that recurrent changes in enzyme production may have occurred throughout the domestication history of fungus-garden symbionts. Conclusions Proteinase pH optima and buffering capacities of fungal symbionts appear to have evolved remarkable adaptations to living in obligate symbiosis with farming ants. Although the functional roles of serine and metalloproteinases in fungus gardens are unknown, the differential production of these classes of proteolytic enzymes suggest that substrate specificity may be important and that trade-offs may prevent the simultaneous upregulation of both classes of enzymes. PMID:21247468
Biodegradation of pentachlorophenol by the white rot fungus Phanerochaete chrysosporium (1988)
Extensive biodegradation of pentachlorophenol (PCP) by the white rot fungus Phanerochaete chrysosporium was demonstrated by the disappearance and mineralization of [14C]PCP in nutrient nitrogen-limited culture. Mass balance analyses demonstrated the formation of water-soluble met...
CHARACTERIZATION OF THE HEMOLYSIN, FROM STACHYBOTRYS CHARTARUM
Stachybotrys chartarum is a toxigenic fungus that has been associated with human health concerns, including pulmonary hemorrhage and hemosiderosis. This fungus produces a hemolysin, stachylysin, which in its apparent monomeric form has a molecular mass of 11,920
Da as determ...
CHARACTERIZATION OF THE HEMOLYSIN, STACHYLYSIN, FROM STACHYBOTRYS CHARTARUM
Stachybotrys chartarum is a toxigenic fungus that has been associated with human health concerns, including pulmonary hemorrhage/hemosiderosis. This fungus produces a hemolysin, stachylysin, which in its monomeric form, has a molecular wieght of 11,920 daltons as determined by m...
Parasitic Aspects of a Fairy Ring Fungus, Marasmius oreades
T. H. Filer
1965-01-01
Marasmius oreades parasitizes Poa pratensis, Festuca rubra, and Agrostis tenuis. The fungus penetrates the root directly in all three species and does not require natural openings or wounds. The mycelium ramifies in the cortical cells and destroys the cell contents.
Sy-Cordero, Arlene A; Graf, Tyler N; Adcock, Audrey F; Kroll, David J; Shen, Qi; Swanson, Steven M; Wani, Mansukh C; Pearce, Cedric J; Oberlies, Nicholas H
2011-10-28
Two new cyclodepsipeptides (1 and 2), two new sesquiterpenoids (3 and 4), and the known compounds guangomide A (5), roseotoxin S, and three simple trichothecenes were isolated from the cytotoxic organic extract of a terrestrial filamentous fungus, Trichothecium sp. The structures were determined using NMR spectroscopy and mass spectrometry. Absolute configurations of the cyclodepsipeptides were established by employing chiral HPLC, while the relative configurations of 3 and 4 were determined via NOESY data. The isolation of guangomide A was of particular interest, since it was reported previously from a marine-derived fungus.
A virus in a fungus in a plant: Three-way symbiosis required for thermal tolerance
Marquez, L.M.; Redman, R.S.; Rodriguez, R.J.; Roossinck, M.J.
2007-01-01
A mutualistic association between a fungal endophyte and a tropical panic grass allows both organisms to grow at high soil temperatures. We characterized a virus from this fungus that is involved in the mutualistic interaction. Fungal isolates cured of the virus are unable to confer heat tolerance, but heat tolerance is restored after the virus is reintroduced. The virus-infected fungus confers heat tolerance not only to its native monocot host but also to a eudicot host, which suggests that the underlying mechanism involves pathways conserved between these two groups of plants.
Effects Sprayed Solution of Salicylic Acid to Prevent of Wilt Disease Caused by Fussarium oxysporium
NASA Astrophysics Data System (ADS)
Yousif, Dina. Y. M.
2018-05-01
The current search aimed to detective the effect of sprayed solution of salicylic acid on plant and leaves of sweet green pepper (Capsicum annuum) for control the pathogen Fussarium oxysporium compering with control plant and leaves. Results indicated that, the spray of salicylic acid at concentration 0.5 g/L is effecting the fungal infection through prevent transport fungus F. oxysporum to the neighboring green pepper plant. The number of dead green pepper plant after sprayed with solution of salicylic acid and only water they were (4, 6, and 3) (8, 9, and 10) respectively. While the experimental infection of green pepper leaves after inoculated the fungus as local spot by scorching small spots of these leaves with the aid of hot nail. These spots were then exposed to the 0.5 g/L aqueous solution salicylic acid before and after the inoculation of the fungus. The spray of salicylic acid before 24 and 48 hour prevent the development of disease and make a good protection of the mention leaves from infection with this fungus, the diameter of leaves lesion (1,1.5 cm) respectively. while the ability of fungus to grow after 24 and 48 hour from salicylic acid treatment was markedly reduce as compared with control, such treatment show slow growth of pathogen infect.
Freitag, M; Morrell, J J
1992-04-01
Two filamentous fungi, the white-rot fungus Trametes versicolor and the soil fungus and potential biocontrol organism Trichoderma harzianum, have been grown in pure and mixed cultures on low-N (0.4 mM) and high-N (4 mM) defined synthetic media to determine the activities of selected wood-degrading enzymes such as cellobiase, cellulase, laccase, and peroxidases. Growth characteristics and enzyme activities were examined for potential correlations. Such correlations would allow the use of simple enzyme assays for measuring biomass development and would facilitate predictions about competitiveness of species in mixed fungal cultures. Our results show that while laccase and Poly Red-478 peroxidase activities indicate survival of the decay fungus, none of the monitored extracellular enzymes can serve as a quantitative indicator for biomass accumulation. As expected, the level of available nitrogen affected the production of the enzymes monitored: in low-N media, specific cellobiase, specific cellulase, and peroxidase activities were enhanced, while laccase activities were reduced. Most importantly, laccase activities of Trametes versicolor, and to a smaller extent, cellobiase activities of both fungi, were significantly induced in mixed cultures of Trametes versicolor and Trichoderma harzianum.
Li, Fang; Guo, Yan'e; Christensen, Michael J; Gao, Ping; Li, Yanzhong; Duan, Tingyu
2018-02-01
Leaf spot of perennial ryegrass (Lolium perenne) caused by Bipolaris sorokiniana is an important disease in temperate regions of the world. We designed this experiment to test for the combined effects of the arbuscular mycorrhizal (AM) fungus Claroideoglomus etunicatum and the grass endophyte fungus Epichloë festucae var. lolii on growth and disease occurrence in perennial ryegrass. The results show that C. etunicatum increased plant P uptake and total dry weight and that this beneficial effect was slightly enhanced when in association with the grass endophyte. The presence in plants of both the endophyte and B. sorokiniana decreased AM fungal colonization. Plants inoculated with B. sorokiniana showed the typical leaf spot symptoms 2 weeks after inoculation and the lowest disease incidence was with plants that were host to both C. etunicatum and E. festucae var. lolii. Plants with these two fungi had much higher activity of peroxidases (POD), superoxide dismutase (SOD) and catalase (CAT) and lower values of malondialdehyde (MDA) and hydrogen peroxide (H 2 O 2 ). The AM fungus C. etunicatum and the grass endophyte fungus E. festucae var. lolii have the potential to promote perennial ryegrass growth and resistance to B. sorokiniana leaf spot.
Boguś, M I; Włóka, E; Wrońska, A; Kaczmarek, A; Kazek, M; Zalewska, K; Ligęza-Żuber, M; Gołębiowski, M
2017-03-01
Entomopathogenic fungi infect insects via penetration through the cuticle, which varies remarkably in chemical composition across species and life stages. Fungal infection involves the production of enzymes that hydrolyse cuticular proteins, chitin and lipids. Host specificity is associated with fungus-cuticle interactions related to substrate utilization and resistance to host-specific inhibitors. The soil fungus Conidiobolus coronatus (Constantin) (Entomophthorales: Ancylistaceae) shows virulence against susceptible species. The larvae and pupae of Calliphora vicina (Robineau-Desvoidy) (Diptera: Calliphoridae), Calliphora vomitoria (Linnaeus), Lucilia sericata (Meigen) (Diptera: Calliphoridae) and Musca domestica (Linnaeus) (Diptera: Muscidae) are resistant, but adults exposed to C. coronatus quickly perish. Fungus was cultivated for 3 weeks in a minimal medium. Cell-free filtrate, for which activity of elastase, N-acetylglucosaminidase, chitobiosidase and lipase was determined, was used for in vitro hydrolysis of the cuticle from larvae, puparia and adults. Amounts of amino acids, N-glucosamine and fatty acids released were measured after 8 h of incubation. The effectiveness of fungal enzymes was correlated with concentrations of compounds detected in the cuticles of tested insects. Positive correlations suggest compounds used by the fungus as nutrients, whereas negative correlations may indicate compounds responsible for insect resistance. Adult deaths result from the ingestion of conidia or fungal excretions. © 2016 The Royal Entomological Society.
Acromyrmex Leaf-Cutting Ants Have Simple Gut Microbiota with Nitrogen-Fixing Potential
Zhukova, Mariya; Hansen, Lars H.; Sørensen, Søren J.; Schiøtt, Morten
2015-01-01
Ants and termites have independently evolved obligate fungus-farming mutualisms, but their gardening procedures are fundamentally different, as the termites predigest their plant substrate whereas the ants deposit it directly on the fungus garden. Fungus-growing termites retained diverse gut microbiota, but bacterial gut communities in fungus-growing leaf-cutting ants have not been investigated, so it is unknown whether and how they are specialized on an exclusively fungal diet. Here we characterized the gut bacterial community of Panamanian Acromyrmex species, which are dominated by only four bacterial taxa: Wolbachia, Rhizobiales, and two Entomoplasmatales taxa. We show that the Entomoplasmatales can be both intracellular and extracellular across different gut tissues, Wolbachia is mainly but not exclusively intracellular, and the Rhizobiales species is strictly extracellular and confined to the gut lumen, where it forms biofilms along the hindgut cuticle supported by an adhesive matrix of polysaccharides. Tetracycline diets eliminated the Entomoplasmatales symbionts but hardly affected Wolbachia and only moderately reduced the Rhizobiales, suggesting that the latter are protected by the biofilm matrix. We show that the Rhizobiales symbiont produces bacterial NifH proteins that have been associated with the fixation of nitrogen, suggesting that these compartmentalized hindgut symbionts alleviate nutritional constraints emanating from an exclusive fungus garden diet reared on a substrate of leaves. PMID:26048932
Niwa, Rieko; Koyama, Takuya; Sato, Takumi; Adachi, Katsuki; Tawaraya, Keitaro; Sato, Shusei; Hirakawa, Hideki; Yoshida, Shigenobu; Ezawa, Tatsuhiro
2018-05-09
Arbuscular mycorrhizal (AM) fungi associate with most land plants and deliver phosphorus to the host. Identification of biotic/abiotic factors that determine crop responses to AM fungal inoculation is an essential step for successful application of the fungi in sustainable agriculture. We conducted three field trials on soybean with a commercial inoculum and developed a new molecular tool to dissect interactions between the inoculum and indigenous fungi on the MiSeq sequencing platform. Regression analysis indicated that sequence read abundance of the inoculum fungus was the most significant factor that determined soybean yield responses to the inoculation, suggesting that dominance of the inoculum fungus is a necessary condition for positive yield responses. Agricultural practices (fallow/cropping in the previous year) greatly affected the colonization levels (i.e. read abundances) of the inoculum fungus via altering the propagule density of indigenous AM fungi. Analysis of niche competition revealed that the inoculum fungus competed mainly with the indigenous fungi that are commonly distributed in the trial sites, probably because their life-history strategy is the same as that of the inoculum fungus. In conclusion, we provide a new framework for evaluating the significance of environmental factors towards successful application of AM fungi in agriculture.
Characteristics of uranium biosorption from aqueous solutions on fungus Pleurotus ostreatus.
Zhao, Changsong; Liu, Jun; Tu, Hong; Li, Feize; Li, Xiyang; Yang, Jijun; Liao, Jiali; Yang, Yuanyou; Liu, Ning; Sun, Qun
2016-12-01
Uranium(VI) biosorption from aqueous solutions was investigated in batch studies by using fungus Pleurotus ostreatus biomass. The optimal biosorption conditions were examined by investigating the reaction time, biomass dosage, pH, temperature, and uranium initial concentration. The interaction between fungus biomass and uranium was confirmed using Fourier transformed infrared (FT-IR), scanning electronic microscopy energy dispersive X-ray (SEM-EDX), and X-ray photoelectron spectroscopy (XPS) analysis. Results exhibited that the maximum biosorption capacity of uranium on P. ostreatus was 19.95 ± 1.17 mg/g at pH 4.0. Carboxylic, amine, as well as hydroxyl groups were involved in uranium biosorption according to FT-IR analysis. The pseudo-second-order model properly evaluated the U(VI) biosorption on fungus P. ostreatus biomass. The Langmuir equation provided better fitting in comparison with Freundlich isotherm models. The obtained thermodynamic parameters suggested that biosorption is feasible, endothermic, and spontaneous. SEM-EDX and XPS were additionally conducted to comprehend the biosorption process that could be described as a complex process involving several mechanisms of physical adsorption, chemisorptions, and ion exchange. Results obtained from this work indicated that fungus P. ostreatus biomass can be used as potential biosorbent to eliminate uranium or other radionuclides from aqueous solutions.
Baldrian, Petr; in der Wiesche, Carsten; Gabriel, Jiří; Nerud, František; Zadražil, František
2000-01-01
The white-rot fungus Pleurotus ostreatus was able to degrade the polycyclic aromatic hydrocarbons (PAHs) benzo[a]anthracene, chrysene, benzo[b]fluoranthene, benzo[k]fluoranthene, benzo[a]pyrene, dibenzo[a,h]anthracene, and benzo[ghi]perylene in nonsterile soil both in the presence and in the absence of cadmium and mercury. During 15 weeks of incubation, recovery of individual compounds was 16 to 69% in soil without additional metal. While soil microflora contributed mostly to degradation of pyrene (82%) and benzo[a]anthracene (41%), the fungus enhanced the disappearance of less-soluble polycyclic aromatic compounds containing five or six aromatic rings. Although the heavy metals in the soil affected the activity of ligninolytic enzymes produced by the fungus (laccase and Mn-dependent peroxidase), no decrease in PAH degradation was found in soil containing Cd or Hg at 10 to 100 ppm. In the presence of cadmium at 500 ppm in soil, degradation of PAHs by soil microflora was not affected whereas the contribution of fungus was negligible, probably due to the absence of Mn-dependent peroxidase activity. In the presence of Hg at 50 to 100 ppm or Cd at 100 to 500 ppm, the extent of soil colonization by the fungus was limited. PMID:10831426
Termites promote resistance of decomposition to spatiotemporal variability in rainfall.
Veldhuis, Michiel P; Laso, Francisco J; Olff, Han; Berg, Matty P
2017-02-01
The ecological impact of rapid environmental change will depend on the resistance of key ecosystems processes, which may be promoted by species that exert strong control over local environmental conditions. Recent theoretical work suggests that macrodetritivores increase the resistance of African savanna ecosystems to changing climatic conditions, but experimental evidence is lacking. We examined the effect of large fungus-growing termites and other non-fungus-growing macrodetritivores on decomposition rates empirically with strong spatiotemporal variability in rainfall and temperature. Non-fungus-growing larger macrodetritivores (earthworms, woodlice, millipedes) promoted decomposition rates relative to microbes and small soil fauna (+34%) but both groups reduced their activities with decreasing rainfall. However, fungus-growing termites increased decomposition rates strongest (+123%) under the most water-limited conditions, making overall decomposition rates mostly independent from rainfall. We conclude that fungus-growing termites are of special importance in decoupling decomposition rates from spatiotemporal variability in rainfall due to the buffered environment they create within their extended phenotype (mounds), that allows decomposition to continue when abiotic conditions outside are less favorable. This points at a wider class of possibly important ecological processes, where soil-plant-animal interactions decouple ecosystem processes from large-scale climatic gradients. This may strongly alter predictions from current climate change models. © 2016 by the Ecological Society of America.
Ethanol Production from Various Sugars and Cellulosic Biomass by White Rot Fungus Lenzites betulinus
Im, Kyung Hoan; Nguyen, Trung Kien; Choi, Jaehyuk
2016-01-01
Lenzites betulinus, known as gilled polypore belongs to Basidiomycota was isolated from fruiting body on broadleaf dead trees. It was found that the mycelia of white rot fungus Lenzites betulinus IUM 5468 produced ethanol from various sugars, including glucose, mannose, galactose, and cellobiose with a yield of 0.38, 0.26, 0.07, and 0.26 g of ethanol per gram of sugar consumed, respectively. This fungus relatively exhibited a good ethanol production from xylose at 0.26 g of ethanol per gram of sugar consumed. However, the ethanol conversion rate of arabinose was relatively low (at 0.07 g of ethanol per gram sugar). L. betulinus was capable of producing ethanol directly from rice straw and corn stalks at 0.22 g and 0.16 g of ethanol per gram of substrates, respectively, when this fungus was cultured in a basal medium containing 20 g/L rice straw or corn stalks. These results indicate that L. betulinus can produce ethanol efficiently from glucose, mannose, and cellobiose and produce ethanol very poorly from galactose and arabinose. Therefore, it is suggested that this fungus can ferment ethanol from various sugars and hydrolyze cellulosic materials to sugars and convert them to ethanol simultaneously. PMID:27103854
NASA Astrophysics Data System (ADS)
Liu, Jinghua; Qi, Zeming; Huang, Qing; Wei, Xiaoli; Ke, Zhigang; Fang, Yusheng; Tian, Yangchao; Yu, Zengliang
2013-01-01
Energetic particles exist ubiquitously and cause varied biological effects such as DNA strand breaks, lipid peroxidation, protein modification, cell apoptosis or death. An emerging biotechnology based on ion-beam technique has been developed to serve as an effective tool for mutation breeding of crops and microbes. In order to improve the effectiveness of ion-beam biotechnology for mutation breeding, it is indispensible to gain a better understanding of the mechanism of the interactions between the energetic ions and biological systems which is still elusive. A new trend is to conduct more comprehensive research which is based on micro-scaled observation of the changes of the cellular structures and compositions under the interactions. For this purpose, advanced synchrotron FTIR (s-FTIR) microscopy was employed to monitor the cellular changes of single fungal hyphae under irradiation of α-particles from 241Am. Intracellular contents of ROS, MDA, GSSG/GSH and activities of CAT and SOD were measured via biochemical assay. Ion-irradiation on Rhizopus oryzae causes localized vacuolation, autolysis of cell wall and membrane, lipid peroxidation, DNA damage and conformational changes of proteins, which have been clearly revealed by the s-FTIR microspectroscopy. The different changes of cell viability, SOD and CAT activities can be explained by the ROS-involved chemical reactions. Evidently, the elevated level of ROS in hyphal cells upon irradiation plays the key role in the caused biological effect. This study demonstrates that s-FTIR microspectroscopy is an effective tool to study the damage of fungal hyphae caused by ionizing radiation and it facilitates the exploit of the mechanism for the interactions between the energetic ions and biological systems.
Use of Deferasirox (Exjade) for Iron Overload in Peritoneal Dialysis Patients.
Yii, Erwin; Doery, James Cg; Kaplan, Zane; Kerr, Peter G
2018-04-16
A 54 year old male with β-Thalassemia major developed ESRD and was managed with continuous ambulatory peritoneal dialysis. Although not able to be transfused due to high titre red cell antibodies he did require management of iron overload. Deferasirox (Exjade) was administered orally. There was concern that excretion of iron via the peritoneal dialysate may raise the risk of iron-dependent infections (Yersinia and Rhizopus). Whilst receiving Exjade 1000mg /day, a total collection of 12.7L of peritoneal dialysate was collected over a 24 hour period by the patient and brought into the lab for testing. The dialysate total iron levels were measured by ICP-MS at 0.46μmol/L which equates to 0.33mg of Fe in total. Over a 6 month period his serum ferritin fell from 3869ug/l to 1545ug/l. There were no episodes of peritonitis. According to the deferasirox product information, 1000mg/day in this man accounts for just under the 20mg/kg/day dosage, hence giving an expected 18-20mg excretion of Fe per day (predominantly via the GIT). Since only 7-8% of the deferasirox and iron complex is excreted through the urine, the amount of Fe seen in the patient's dialysate might be expected to be up to 1.5-1.6mg. Yet, the results of the Fe levels in the patient's PD fluid was a meagre 0.33mg, about five times lower than expected. Whilst only moderately effective at a dosage of 1000mg/day, deferasirox may be a safe agent for iron removal in iron overloaded peritoneal dialysis patients, as relatively low dialysate iron levels reduces the risk of Yersinia and Rhizopus infection. This article is protected by copyright. All rights reserved.
Balasubramaniam, Bharathiraja; Sudalaiyadum Perumal, Ayyappasamy; Jayaraman, Jayamuthunagai; Mani, Jayakumar; Ramanujam, Praveenkumar
2012-08-01
The petroleum fuel is nearing the line of extinction. Recent research and technology have provided promising outcomes to rely on biodiesel as the alternative and conventional source of fuel. The use of renewable source - vegetable oil constitutes the main stream of research. In this preliminary study, Waste Cooking Oil (WCO) was used as the substrate for biodiesel production. Lipase enzyme producing fungi Rhizopus oryzae 262 and commercially available pure lipase enzyme were used for comparative study in the production of Fatty Acid Alkyl Esters (FAAE). The whole cell (RO 262) and pure lipase enzyme (PE) were immobilized using calcium alginate beads. Calcium alginate was prepared by optimizing with different molar ratios of calcium chloride and different per cent sodium alginate. Entrapment immobilization was done for whole cell biocatalyst (WCB). PE was also immobilized by entrapment for the transesterification reaction. Seven different solvents - methanol, ethanol, n-propanol, n-butanol, iso-propanol, iso-butanol and iso-amyl alcohol were used as the acyl acceptors. The reaction parameters like temperature (30°C), molar ratio (1:3 - oil:solvent), reaction time (24 h), and amount of enzyme (10% mass ratio to oil) were also optimized for methanol alone. The same parameters were adopted for the other acyl acceptors too. Among the different acyl acceptors - methanol, whose reaction parameters were optimized showed maximum conversion of triglycerides to FAAE-94% with PE and 84% with WCB. On the whole, PE showed better catalytic converting ability with all the acyl acceptor compared to WCB. Gas chromatography analysis (GC) was done to determine the fatty acid composition of WCO (sunflower oil) and FAAE production with different acyl acceptors. Copyright © 2012 Elsevier Ltd. All rights reserved.
Kachuei, R; Khodavaisy, S; Rezaie, S; Sharifynia, S
2016-03-01
Among filamentous fungal pathogens, Aspergillus spp. and zygomycetes account for highest rates of morbidity and mortality among immunocompromised patients. Recently developed antifungal drugs offer the potential to improve management and therapeutic outcomes of fungal infections. The aim of this study was to analyse the in vitro activities of voriconazole, itraconazole, amphotericin B and caspofungin against clinical isolates of Aspergillus spp. and Rhizopus oryzae. The in vitro antifungal susceptibility of 54 isolates belonging to different clinical isolates of Aspergillus spp. and R. oryzae was tested for four antifungal agents using a microdilution reference method (CLSI, M38-A2). All isolates were identified by typical colony and microscopic characteristics, and also characterized by molecular methods. Caspofungin (MEC range: 0.008-0.25 and MEC50: 0.0023μg/mL) was the most active drug in vitro against Aspergillus spp., followed by voriconazole (MIC range: 0.031-8 and MIC50: 0.5μg/mL), itraconazole (MIC range: 0.031-16 and MIC50: 0.25μg/mL), and amphotericin B (MIC range: 0.125-4 and MIC50: 0.5μg/mL), in order of decreasing activity. The caspofungin, voriconazole, and itraconazole demonstrated poor in vitro activity against R. oryzae isolates evaluated, followed by amphotericin B. This study demonstrates that caspofungin had good antifungal activity and azole agents had better activity than amphotericin B against Aspergillus species. Although, azole drugs are considered ineffective against R. oryzae. This result is just from a small scale in vitro susceptibility study and we did not take other factors into consideration. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Zhao, Zuotao; Li, Lili; Wan, Zhe; Chen, Wei; Liu, Honggang; Li, Ruoyu
2011-01-01
Rapid detection and differentiation of Aspergillus and Mucorales species in fungal rhinosinusitis diagnosis are desirable, since the clinical management and prognosis associated with the two taxa are fundamentally different. We describe an assay based on a combination of broad-range PCR amplification and reverse line blot hybridization (PCR/RLB) to detect and differentiate the pathogens causing fungal rhinosinusitis, which include five Aspergillus species (A. fumigatus, A. flavus, A. niger, A. terreus, and A. nidulans) and seven Mucorales species (Mucor heimalis, Mucor racemosus, Mucor cercinelloidea, Rhizopus arrhizus, Rhizopus microsporus, Rhizomucor pusillus, and Absidia corymbifera). The assay was validated with 98 well-characterized clinical isolates and 41 clinical tissue specimens. PCR/RLB showed high sensitivity and specificity, with 100% correct identifications of 98 clinical isolates and no cross-hybridization between the species-specific probes. Results for five control isolates, Candida albicans, Fusarium solani, Scedosporium apiospermum, Penicillium marneffei, and Exophiala verrucosa, were negative as judged by PCR/RLB. The analytical sensitivity of PCR/RLB was found to be 1.8 × 10−3 ng/μl by 10-fold serial dilution of Aspergillus genomic DNA. The assay identified 35 of 41 (85.4%) clinical specimens, exhibiting a higher sensitivity than fungal culture (22 of 41; 53.7%) and direct sequencing (18 of 41; 43.9%). PCR/RLB similarly showed high specificity, with correct identification 16 of 18 specimens detected by internal transcribed spacer (ITS) sequencing and 16 of 22 detected by fungal culture, but it also has the additional advantage of being able to detect mixed infection in a single clinical specimen. The PCR/RLB assay thus provides a rapid and reliable option for laboratory diagnosis of fungal rhinosinusitis. PMID:21325541
Zhao, Zuotao; Li, Lili; Wan, Zhe; Chen, Wei; Liu, Honggang; Li, Ruoyu
2011-04-01
Rapid detection and differentiation of Aspergillus and Mucorales species in fungal rhinosinusitis diagnosis are desirable, since the clinical management and prognosis associated with the two taxa are fundamentally different. We describe an assay based on a combination of broad-range PCR amplification and reverse line blot hybridization (PCR/RLB) to detect and differentiate the pathogens causing fungal rhinosinusitis, which include five Aspergillus species (A. fumigatus, A. flavus, A. niger, A. terreus, and A. nidulans) and seven Mucorales species (Mucor heimalis, Mucor racemosus, Mucor cercinelloidea, Rhizopus arrhizus, Rhizopus microsporus, Rhizomucor pusillus, and Absidia corymbifera). The assay was validated with 98 well-characterized clinical isolates and 41 clinical tissue specimens. PCR/RLB showed high sensitivity and specificity, with 100% correct identifications of 98 clinical isolates and no cross-hybridization between the species-specific probes. Results for five control isolates, Candida albicans, Fusarium solani, Scedosporium apiospermum, Penicillium marneffei, and Exophiala verrucosa, were negative as judged by PCR/RLB. The analytical sensitivity of PCR/RLB was found to be 1.8 × 10(-3) ng/μl by 10-fold serial dilution of Aspergillus genomic DNA. The assay identified 35 of 41 (85.4%) clinical specimens, exhibiting a higher sensitivity than fungal culture (22 of 41; 53.7%) and direct sequencing (18 of 41; 43.9%). PCR/RLB similarly showed high specificity, with correct identification 16 of 18 specimens detected by internal transcribed spacer (ITS) sequencing and 16 of 22 detected by fungal culture, but it also has the additional advantage of being able to detect mixed infection in a single clinical specimen. The PCR/RLB assay thus provides a rapid and reliable option for laboratory diagnosis of fungal rhinosinusitis.
Possible effects of glyphosate on Mucorales abundance in the rumen of dairy cows in Germany.
Schrödl, Wieland; Krüger, Susanne; Konstantinova-Müller, Theodora; Shehata, Awad A; Rulff, Ramon; Krüger, Monika
2014-12-01
Glyphosate (N-phosphonomethyl glycine) is registered as a herbicide for many food and non-food crops, as well as non-crop areas where total vegetation control is desired. Glyphosate influences the soil mycobiota; however, the possible effect of glyphosate residues in animal feed (soybean, corn, etc.) on animal mycobiota is almost unknown. Accordingly, the present study was initiated to investigate the mycological characteristics of dairy cows in relationship to glyphosate concentrations in urine. A total of 258 dairy cows on 14 dairy farms in Germany were examined. Glyphosate was detected in urine using ELISA. The fungal profile was analyzed in rumen fluid samples using conventional microbiological culture techniques and differentiated by MALDI-TOF mass spectrometry. LPS-binding protein (LBP) and antibodies (IgG1, IgG2, IgA, and IgM) against fungi were determined in blood using ELISA. Different populations of Lichtheimia corymbifera, Lichtheimia ramosa, Mucor, and Rhizopus were detected. L. corymbifera and L. ramosa were significantly more abundant in animals containing high glyphosate (>40 ng/ml) concentrations in urine. There were no significant changes in IgG1 and IgG2 antibodies toward isolated fungi that were related to glyphosate concentration in urine; however, IgA antibodies against L. corymbifera and L. ramosa were significantly lower in the higher glyphosate groups. Moreover, a negative correlation between IgM antibodies against L. corymbifera, L. ramosa, and Rhizopus relative to glyphosate concentration in urine was observed. LBP also was significantly decreased in animals with higher concentrations of glyphosate in their urine. In conclusion, glyphosate appears to modulate the fungal community. The reduction of IgM antibodies and LBP indicates an influence on the innate immune system of animals.
Sato, Vanessa Sayuri; Jorge, João Atílio; Guimarães, Luis Henrique Souza
2016-06-01
The Rhizopus microsporus var. microsporus biofilm was able to produce increased levels of an extracellular thermotolerant phytase using polyethylene and viscose as an inert support in both modified NBRIP medium and modified Khanna medium containing sugarcane bagasse as the carbon source. The enzyme production was strictly regulated by the phosphorus content with optimal production at 0.5 mM of sodium phytate and KH2PO4. The extracellular phytase, RMPhy1, was purified 4.18-fold with 4.78 % recovery using DEAE-cellulose and CM-cellulose. A single protein band with a molecular mass of 35.4 kDa was obtained when the samples were subjected to 10 % SDS-PAGE. The optimum temperature for activity was 55 °C and the optimum pH was 4.5. R. microsporus var. microsporus phytase exhibited high stability at 30 and 40 °C with a half-life of 115 min at 60 °C. The enzyme activity increased in the presence of Ca (2+) and was inhibited by Zn(2+), arsenate, and sodium phosphate. Phytase demonstrated high substrate specificity for sodium phytate with K m = 0.72 mM and V max = 94.55 U/mg of protein and for p-NPP with K m = 0.04 mM and V max = 106.38 U/mg of protein. The enzyme also hydrolyzed ATP, AMPc, glucose 6-phosphate, glucose 1-phosphate, and UDPG. This is the first report on phytase characterization delivered with biofilm technology. The properties of the enzyme account for its high potential for use in biotechnology and the possibility of application in different industrial sectors as feed in the future.
Colour and pH changes of tempe during extended fermentation
NASA Astrophysics Data System (ADS)
Muzdalifah, D.; Athaillah, Z. A.; Nugrahani, W.; Devi, A. F.
2017-01-01
Tempe is a nutritious food, prepared mostly from soybeans and was originated in Indonesia. Tempe is sometimes collected beyond its maturity age for culinary purpose. The studies of overripe tempe ranged from microbiology, chemical and nutritional changes, functionality and safety, to sensorial aspect. Study which follows pH and colour changes of tempe during fermentation, however, is scarce. The objectives of this study were to investigate and model the colour and pH changes of tempe and the mould mycelia during extended fermentation with Rhizopus spp. up to 156 hours. Our investigation revealed that both lightness soybeans and mycelia of the tempe decreased with increasing fermentation time while pH of the tempe increased. The decrease of both lightness followed simple cubic equations whilst the pH increased linearly with increasing time. The other a values of tempe decreased by one point in the first 72 h of fermentation and tended to increase later however did not reach the initial a value, The b value decreased by approximately two points during the first 24 h of fermentation and the changes during the rest of fermentation time were not significant. The colour changes were believed to be the results of increased numbers of Rhizopus spp which entered the death phase, increased amount of linoleic and linolenic unsaturated fatty acids which were prone to oxidation, and formation of red coloured vitamin B12. Meanwhile, the increase of pH was majorly because of protein break down which led to increased ammonia production. The utilisation of lactic acid for mould growth also contributed to the alkalinisation, however to a much lesser extent. The lactic acid was previously formed during the soaking which resulted in decrease in pH of initial soybeans.
Background / Question / Methods The fungal pathogen, Batrachochytrium dendrobatidis (BD), has been associated with amphibian population declines and even extinctions worldwide. Transmission of the fungus between amphibian hosts occurs via motile zoospores, which are produced on...
BIODEGRADATION OF CRYSTAL VIOLET BY THE WHITE ROT FUNGUS PHANEROCHAETE CHRYSOPORIUM
Biodegradation of crystal violet (N,N,N',N',N",N"-hexamethylpararosaniline) in ligninolytic (nitrogen-limited) cultures of the white rot fungus Phanerochaete chrysosporium was demonstrated by the disappearance of crystal violet and by the identification of three metabolites (N,N,...
7 CFR 810.302 - Definitions of other terms.
Code of Federal Regulations, 2010 CFR
2010-01-01
... computation of total dockage. (e) Ergot. Sclerotia (sclerotium, sing.) of the fungus, Claviceps species, which.... (h) Sclerotia (Sclerotium, sing.). Dark colored or black resting bodies of the fungi Sclerotinia and Claviceps. (i) Sclerotinia. Genus name which includes the fungus Sclerotinia sclerotiorum which produces...
7 CFR 810.302 - Definitions of other terms.
Code of Federal Regulations, 2011 CFR
2011-01-01
... computation of total dockage. (e) Ergot. Sclerotia (sclerotium, sing.) of the fungus, Claviceps species, which.... (h) Sclerotia (Sclerotium, sing.). Dark colored or black resting bodies of the fungi Sclerotinia and Claviceps. (i) Sclerotinia. Genus name which includes the fungus Sclerotinia sclerotiorum which produces...
Genetic structure of the fungal grapevine pathogen Eutypa lata from four continents
USDA-ARS?s Scientific Manuscript database
The generalist ascomycete fungus Eutypa lata causes Eutypa dieback of grapevine (Vitis vinifera) worldwide. To decipher the cosmopolitan distribution of this fungus, the population genetic structure of 17 geographic samples was investigated from four continental regions (Australia, California, Europ...
Zhang, Li; Wang, He; Xiao, Meng; Kudinha, Timothy; Mao, Lei-Li; Zhao, Hao-Ran; Kong, Fanrong; Xu, Ying-Chun
2014-01-01
The rapid development in the clinical microbiology diagnostic assays presents more challenges for developing countries than for the developed world, especially in the area of test validation before the introduction of new tests. Here we report on the misleading high MICs of Candida spp. to azoles using the ATB FUNGUS 3 (bioMérieux, La Balme-les Grottes, France) with automated readings in China to highlight the dangers of introducing a diagnostic assay without validation. ATB FUNGUS 3 is the most commonly used commercial antifungal susceptibility testing method in China. An in-depth analysis of data showed higher levels of resistance to azoles when ATB FUNGUS 3 strips were read automatically than when read visually. Based on this finding, the performance of ATB FUNGUS 3, read both visually and automatically, was evaluated by testing 218 isolates of five clinically important Candida species, using broth microdilution (BMD) following CLSI M27-A3 as the gold-standard. The overall essential agreement (EA) between ATB visual readings and BMD was 99.1%. In contrast, the ATB automated readings showed higher discrepancies with BMD, with overall EA of 86.2%, and specifically lower EA was observed for fluconazole (80.7%), voriconazole (77.5%), and itraconazole (73.4%), which was most likely due to the trailing effect of azoles. The major errors in azole drug susceptibilities by ATB automated readings is a concern in China that can result in misleading clinical antifungal drug selection and pseudo high rates of antifungal resistance. Therefore, the ATB visual reading is generally recommended. In the meantime, we propose a practical algorithm to be followed for ATB FUNGUS 3 antifungal susceptibility for Candida spp. before the improvement in the automated reading system.
Ishii-Minami, Naoko; Kawahara, Yoshihiro; Yoshida, Yuri; Okada, Kazunori; Ando, Sugihiro; Matsumura, Hideo; Terauchi, Ryohei; Minami, Eiichi; Nishizawa, Yoko
2016-01-01
Magnaporthe oryzae, the fungus causing rice blast disease, should contend with host innate immunity to develop invasive hyphae (IH) within living host cells. However, molecular strategies to establish the biotrophic interactions are largely unknown. Here, we report the biological function of a M. oryzae-specific gene, R equired-for-Focal- B IC- F ormation 1 (RBF1). RBF1 expression was induced in appressoria and IH only when the fungus was inoculated to living plant tissues. Long-term successive imaging of live cell fluorescence revealed that the expression of RBF1 was upregulated each time the fungus crossed a host cell wall. Like other symplastic effector proteins of the rice blast fungus, Rbf1 accumulated in the biotrophic interfacial complex (BIC) and was translocated into the rice cytoplasm. RBF1-knockout mutants (Δrbf1) were severely deficient in their virulence to rice leaves, but were capable of proliferating in abscisic acid-treated or salicylic acid-deficient rice plants. In rice leaves, Δrbf1 inoculation caused necrosis and induced defense-related gene expression, which led to a higher level of diterpenoid phytoalexin accumulation than the wild-type fungus did. Δrbf1 showed unusual differentiation of IH and dispersal of the normally BIC-focused effectors around the short primary hypha and the first bulbous cell. In the Δrbf1-invaded cells, symplastic effectors were still translocated into rice cells but with a lower efficiency. These data indicate that RBF1 is a virulence gene essential for the focal BIC formation, which is critical for the rice blast fungus to suppress host immune responses. PMID:27711180
Lee, Ching-Chen; Neoh, Kok-Boon; Lee, Chow-Yang
2014-12-01
The efficacy of chitin synthesis inhibitors (CSIs) against fungus-growing termites is known to vary. In this study, 0.1% chlorfluazuron (CFZ) cellulose bait was tested against medium and large field colonies of Macrotermes gilvus (Hagen). The termite mounds were dissected to determine the health of the colony. Individual termites (i.e., workers and larvae) and fungus combs were subjected to gas chromatography-mass spectrometry (GC-MS) analysis to detect the presence of CFZ. In this study, 540.0 ± 25.8 g (or equivalent to 540.0 ± 25.8 mg active ingredient) and 680.0 ± 49.0 g (680.0 ± 49.0 mg active ingredient) of bait matrix were removed by the medium- and large-sized colonies, respectively, after baiting. All treated medium-sized colonies were moribund. The dead termites were scattered in the mound, larvae were absent, population size had decreased by 90%, and the queens appeared unhealthy. In contrast, no or limited effects were found in large-sized colonies. Only trace amounts of CFZ were detected in workers, larvae, and fungus combs, and the population of large-sized colonies had declined by only up to 40%. This might be owing to the presence of large amount of basidiomycete fungus and a drastic decrease of CFZ content per unit fungus comb (a main food source of larvae) in the large-sized colonies, and hence reduced the toxic effect and longer time is required to accumulate the lethal dose in larvae. Nevertheless, we do not deny the possibility of CSI bait eliminating or suppressing the higher termite if the test colonies could pick up adequate lethal dose by installing more bait stations and prolonging the baiting period. © 2014 Entomological Society of America.
Utilizing fungus myceliated grain for molt induction and performance in commercial laying hens.
Willis, W L; Isikhuemhen, O S; Allen, J W; Byers, A; King, K; Thomas, C
2009-10-01
Molting in poultry is used to rejuvenate hens for a second or third laying cycle. Feed withdrawal was once the most effective method used for molt induction; however, it has being phased out due to food safety and animal welfare concerns. This study evaluated the utilization of fungus myceliated grain as a safe and effective alternative for inducing molt, enhancing immunity, reducing Salmonella growth, and returning to egg production. Laying hens were subjected to 1 of 5 treatments: 1) nonfed (NF), 2) full-fed (FF), 3) fungus myceliated meal (FM), 4) 90% fungus myceliated meal+10% standard layer ration (FM-90), and 5) 90% alfalfa meal+10% fungus myceliated meal (AF-90). Each treatment condition was replicated 9 times during a 9-d molt period. The results revealed that egg production for treatments 1 and 3 ceased completely by d 5, whereas hens in treatments 4 and 5 ceased egg production by d 6. The percentage of BW loss decreased significantly (P<0.05) in treatments 1 (57%), 2 (8%), 3 (35%), 4 (37%), and 5 (44%). Ovary weights of hens fed all molting diets decreased significantly from the full-fed control but did not differ significantly (P<0.05) from each other. Salmonella population in the crop, ovary, and ceca from hens differed significantly (P<0.05) among treatments. Return to egg production differed between treatments with higher production beginning in treatment 3 and ending in treatment 5. Antibody titers did differ (P<0.05) among treatments. From these results, fungus myceliated meal appears to be a viable alternative to conventional feed withdrawal and other methods for the successful induction of molt and retention of postmolt performance.
Identifying the core microbial community in the gut of fungus-growing termites.
Otani, Saria; Mikaelyan, Aram; Nobre, Tânia; Hansen, Lars H; Koné, N'Golo A; Sørensen, Søren J; Aanen, Duur K; Boomsma, Jacobus J; Brune, Andreas; Poulsen, Michael
2014-09-01
Gut microbes play a crucial role in decomposing lignocellulose to fuel termite societies, with protists in the lower termites and prokaryotes in the higher termites providing these services. However, a single basal subfamily of the higher termites, the Macrotermitinae, also domesticated a plant biomass-degrading fungus (Termitomyces), and how this symbiont acquisition has affected the fungus-growing termite gut microbiota has remained unclear. The objective of our study was to compare the intestinal bacterial communities of five genera (nine species) of fungus-growing termites to establish whether or not an ancestral core microbiota has been maintained and characterizes extant lineages. Using 454-pyrosequencing of the 16S rRNA gene, we show that gut communities have representatives of 26 bacterial phyla and are dominated by Firmicutes, Bacteroidetes, Spirochaetes, Proteobacteria and Synergistetes. A set of 42 genus-level taxa was present in all termite species and accounted for 56-68% of the species-specific reads. Gut communities of termites from the same genus were more similar than distantly related species, suggesting that phylogenetic ancestry matters, possibly in connection with specific termite genus-level ecological niches. Finally, we show that gut communities of fungus-growing termites are similar to cockroaches, both at the bacterial phylum level and in a comparison of the core Macrotermitinae taxa abundances with representative cockroach, lower termite and higher nonfungus-growing termites. These results suggest that the obligate association with Termitomyces has forced the bacterial gut communities of the fungus-growing termites towards a relatively uniform composition with higher similarity to their omnivorous relatives than to more closely related termites. © 2014 John Wiley & Sons Ltd.
Arenas, Andrés; Roces, Flavio
2017-01-01
Plants initially accepted by foraging leaf-cutting ants are later avoided if they prove unsuitable for their symbiotic fungus. Plant avoidance is mediated by the waste produced in the fungus garden soon after the incorporation of the unsuitable leaves, as foragers can learn plant odors and cues from the damaged fungus that are both present in the recently produced waste particles. We asked whether avoidance learning of plants unsuitable for the symbiotic fungus can take place entirely at the colony dump. In order to investigate whether cues available in the waste chamber induce plant avoidance in naïve subcolonies, we exchanged the waste produced by subcolonies fed either fungicide-treated privet leaves or untreated leaves and measured the acceptance of untreated privet leaves before and after the exchange of waste. Second, we evaluated whether foragers could perceive the avoidance cues directly at the dump by quantifying the visits of labeled foragers to the waste chamber. Finally, we asked whether foragers learn to specifically avoid untreated leaves of a plant after a confinement over 3 hours in the dump of subcolonies that were previously fed fungicide-treated leaves of that species. After the exchange of the waste chambers, workers from subcolonies that had access to waste from fungicide-treated privet leaves learned to avoid that plant. One-third of the labeled foragers visited the dump. Furthermore, naïve foragers learned to avoid a specific, previously unsuitable plant if exposed solely to cues of the dump during confinement. We suggest that cues at the dump enable foragers to predict the unsuitable effects of plants even if they had never been experienced in the fungus garden.
Roces, Flavio
2017-01-01
Plants initially accepted by foraging leaf-cutting ants are later avoided if they prove unsuitable for their symbiotic fungus. Plant avoidance is mediated by the waste produced in the fungus garden soon after the incorporation of the unsuitable leaves, as foragers can learn plant odors and cues from the damaged fungus that are both present in the recently produced waste particles. We asked whether avoidance learning of plants unsuitable for the symbiotic fungus can take place entirely at the colony dump. In order to investigate whether cues available in the waste chamber induce plant avoidance in naïve subcolonies, we exchanged the waste produced by subcolonies fed either fungicide-treated privet leaves or untreated leaves and measured the acceptance of untreated privet leaves before and after the exchange of waste. Second, we evaluated whether foragers could perceive the avoidance cues directly at the dump by quantifying the visits of labeled foragers to the waste chamber. Finally, we asked whether foragers learn to specifically avoid untreated leaves of a plant after a confinement over 3 hours in the dump of subcolonies that were previously fed fungicide-treated leaves of that species. After the exchange of the waste chambers, workers from subcolonies that had access to waste from fungicide-treated privet leaves learned to avoid that plant. One-third of the labeled foragers visited the dump. Furthermore, naïve foragers learned to avoid a specific, previously unsuitable plant if exposed solely to cues of the dump during confinement. We suggest that cues at the dump enable foragers to predict the unsuitable effects of plants even if they had never been experienced in the fungus garden. PMID:28273083
Atkins, S D; Clark, I M; Sosnowska, D; Hirsch, P R; Kerry, B R
2003-08-01
Potato cyst nematodes (PCN) are serious pests in commercial potato production, causing yield losses valued at approximately $300 million in the European Community. The nematophagous fungus Plectosphaerella cucumerina has demonstrated its potential as a biological control agent against PCN populations by reducing field populations by up to 60% in trials. The use of biological control agents in the field requires the development of specific techniques to monitor the release, population size, spread or decline, and pathogenicity against its host. A range of methods have therefore been developed to monitor P. cucumerina. A species-specific PCR primer set (PcCF1-PcCR1) was designed that was able to detect the presence of P. cucumerina in soil, root, and nematode samples. PCR was combined with a bait method to identify P. cucumerina from infected nematode eggs, confirming the parasitic ability of the fungus. A selective medium was adapted to isolate the fungus from root and soil samples and was used to quantify the fungus from field sites. A second P. cucumerina-specific primer set (PcRTF1-PcRTR1) and a Taqman probe (PcRTP1) were designed for real-time PCR quantification of the fungus and provided a very sensitive means of detecting the fungus from soil. PCR, bait, and culture methods were combined to investigate the presence and abundance of P. cucumerina from two field sites in the United Kingdom where PCN populations were naturally declining. All methods enabled differences in the activity of P. cucumerina to be detected, and the results demonstrated the importance of using a combination of methods to investigate population size and activity of fungi.
Relating coccidioidomycosis (Valley Fever) incidence via to soil moisture conditions
USDA-ARS?s Scientific Manuscript database
Coccidioidomycosis (also called Valley fever) is caused by a soil-borne fungus, Coccidioides spp., in arid regions of the southwestern United States. Though some who develop infections from this fungus remain asymptomatic, others develop respiratory disease as a consequence. Less commonly, severe ...
USDA-ARS?s Scientific Manuscript database
Eleven polymorphic microsatellite markers were developed for the Uredinales fungus Phragmidium violaceum, which causes leaf rust on European blackberry (Rubus fruticosus L. aggregate). Allele frequency ranged between two and seventeen alleles per locus with no evidence of linkage disequilibrium amon...
Brown spot needle disease--biology and control in Scotch pine plantations.
Darroll D. Skilling; Thomas H. Nicholls
1975-01-01
An application section briefly describes and illustrates the symptoms, hosts, life history of the brown spot needlecast fungus (Scirrhia acicola), and recommends chemical and cultural control methods. A documentation section details the research on the biology and control of the fungus.
USDA-ARS?s Scientific Manuscript database
The occurrence and frequency of outcrossing in homothallic fungal species in nature is an unresolved question. Here we report detection of frequent outcrossing in the homothallic fungus Sclerotinia sclerotiorum. In using multilocus linkage disequilibrium (LD) to infer recombination among microsatell...
Entomology: A Bee Farming a Fungus.
Oldroyd, Benjamin P; Aanen, Duur K
2015-11-16
Farming is done not only by humans, but also by some ant, beetle and termite species. With the discovery of a stingless bee farming a fungus that provides benefits to its larvae, bees can be added to this list. Copyright © 2015 Elsevier Ltd. All rights reserved.
David W. Johnson
1986-01-01
Commandra blister rust is a disease of hard pines that is caused by a fungus growing in the inner bark. The fungus (Cronartium commandrae Pk.) has a complex life cycle. It infects hard pines but needs an alternate host, an unrelated plant, to spread from one pine to another.
Naznin, Hushna Ara; Kimura, Minako; Miyazawa, Mitsuo; Hyakumachi, Mitsuro
2013-01-01
We extracted volatile organic compounds (VOCs) emitted by a plant growth-promoting fungus (PGPF) Phoma sp. GS8-3 by gas chromatography and identified them by mass spectrometry. All of the identified compounds belonged to C4-C8 hydrocarbons. Volatiles varied in number and quantity by the culture period of the fungus (in days). 2-Methyl-propanol and 3-methyl-butanol formed the main components of the volatile blends for all the culture periods of fungus. Growth-promoting effects of the identified synthetic compounds were analyzed individually and in blends using tobacco plants. We found that the mixture of volatiles extracted from 3-day-old culture showed significant growth promotion in tobacco in vitro. The volatile blend showed better growth promotion at lower than higher concentrations. Our results confirm the potential role of volatile organic compounds in the mechanism of growth enhancement by GS8-3. PMID:23080408
Müller, Michael; Prade, Rolf A; Segato, Fernando; Atiyeh, Hasan K; Wilkins, Mark R
2015-01-01
A trickle bed reactor (TBR) with recycle was designed and tested using Aspergillus nidulans with a pyridoxine marker and over-expressing/secreting recombinant client xylanase B (XynB). The pyridoxine marker prevented the fungus from synthesizing its own pyridoxine and fungus was unable to grow when no pyridoxine was present in the medium; however, enzyme production was unaffected. Uncontrolled mycelia growth that led to clogging of the TBR was observed when fungus without a pyridoxine marker was used for XynB production. Using the fungus with pyridoxine marker, the TBR was operated continuously for 18 days and achieved a XynB output of 41 U/ml with an influent and effluent flow rate of 0.5 ml/min and a recycle flow rate of 56 ml/min. Production yields in the TBR were 1.4 times greater than a static tray culture and between 1.1 and 67 times greater than yields for SSF enzyme production stated in the literature. Copyright © 2015 Elsevier Ltd. All rights reserved.
McLain-Romero, J; Creamer, R; Zepeda, H; Strickland, J; Bell, G
2004-07-01
Locoweeds cause significant livestock poisoning and economic loss in the western United States. The toxicity of Embellisia sp. fungi isolated from locoweed was compared with locoweed toxicity using the rat as a model. Rats were fed diets containing locoweed, fungus and alfalfa, or alfalfa. Locoweed- and fungus-fed rats consumed swainsonine-containing food at approximately 1.3 mg x kg(-1) x d(-1), gained less weight (P = 0.001) and ate less than controls. Swainsonine is the principal agent responsible for inducing locoism in animals. The concentrations of alkaline phosphatase and aspartate aminotransferase enzymes were greater (P < 0.05) in serum of locoweed- and fungus-fed rats compared with control rats. Similar intracellular vacuolation was observed in renal, pancreatic, and hepatic tissues of rats that consumed either locoweed or fungus. Rats that ate locoweed or Embellisia fungi displayed indistinguishable toxicity symptoms. The Embellisia fungi from locoweed can induce toxicity without the plants. Locoism management strategies need to involve management of the Embellisia fungi.
Xu, Xiangqun; Xu, Zhiqi; Shi, Song; Lin, Mengmeng
2017-10-01
This study examined the white rot fungus I. obliquus on the degradation of three types of straw biomass and the production of extracellular lignocellulolytic enzymes under submerged fermentation. The fungus process resulted in a highest lignin loss of 72%, 39%, and 47% in wheat straw, rice straw, and corn stover within 12days, respectively. In merely two days, the fungus selectively degraded wheat straw lignin by 37%, with only limited cellulose degradation (13%). Fourier transform infrared spectroscopy revealed that the fungus most effectively degraded the wheat straw lignin and rice straw crystalline cellulose. Scanning electronic microscopy showed the most pronounced structural changes in wheat straw. High activities of manganese peroxidase (159.0U/mL) and lignin peroxidase (123.4U/mL) were observed in wheat straw culture on Day 2 and 4, respectively. Rice straw was the best substrate to induce the production of cellulase and xylanase. Copyright © 2017 Elsevier Ltd. All rights reserved.
Lignocellulose pretreatment in a fungus-cultivating termite
Li, Hongjie; Yelle, Daniel J.; Li, Chang; ...
2017-04-19
Depolymerizing lignin, the complex phenolic polymer fortifying plant cell walls, is an essential but challenging starting point for the lignocellulosics industries. The variety of ether– and carbon–carbon interunit linkages produced via radical coupling during lignification limit chemical and biological depolymerization efficiency. In an ancient fungus-cultivating termite system, we reveal unprecedentedly rapid lignin depolymerization and degradation by combining laboratory feeding experiments, lignocellulosic compositional measurements, electron microscopy, 2D-NMR, and thermochemolysis. In a gut transit time of under 3.5 h, in young worker termites, poplar lignin sidechains are extensively cleaved and the polymer is significantly depleted, leaving a residue almost completely devoid ofmore » various condensed units that are traditionally recognized to be the most recalcitrant. Subsequently, the fungus-comb microbiome preferentially uses xylose and cleaves polysaccharides, thus facilitating final utilization of easily digestible oligosaccharides by old worker termites. This complementary symbiotic pretreatment process in the fungus-growing termite symbiosis reveals a previously unappreciated natural system for efficient lignocellulose degradation.« less
Kang, Yun; Clark, Rebecca; Makiyama, Michael; Fewell, Jennifer
2011-11-21
We propose a simple mathematical model by applying Michaelis-Menton equations of enzyme kinetics to study the mutualistic interaction between the leaf cutter ant and its fungus garden at the early stage of colony expansion. We derive sufficient conditions on the extinction and coexistence of these two species. In addition, we give a region of initial condition that leads to the extinction of two species when the model has an interior attractor. Our global analysis indicates that the division of labor by worker ants and initial conditions are two important factors that determine whether leaf cutter ants' colonies and their fungus garden can survive and grow or not. We validate the model by comparing model simulations and data on fungal and ant colony growth rates under laboratory conditions. We perform sensitive analysis of the model based on the experimental data to gain more biological insights on ecological interactions between leaf-cutter ants and their fungus garden. Finally, we give conclusions and discuss potential future work. Published by Elsevier Ltd.
Fu, Y; Yin, Z-H; Wu, L-P; Yin, C-R
2016-09-01
This research aimed to isolate β-glycosidase-producing endophytic fungus in Panax ginseng to achieve biotransformation of ginsenoside Rb1 to ginsenoside C-K. Of these 15 β-glucosidase-producing endophytic fungus isolated from ginseng roots, a β-glucosidase-producing endophytic fungi GE 17-18 could hydrolyse major ginsenosides Rb1 to minor ginsenoside C-K with metabolic pathways: ginsenoside Rb1→ginsenoside Rd→ginsenoside F2→ginsenoside C-K. Phylogenetic analysis of ITS gene sequences indicated that the strain GE 17-18 belongs to the genus Arthrinium and is most closely related to Arthrinium sp. HQ832803.1. This is the first study to provide information of cultivable β-glycosidase-producing Endophytic fungus in Panax ginseng. The strain GE 17-18 has potential to be applied on the preparation for minor ginsenoside C-K in pharmaceutical industry. © 2016 The Society for Applied Microbiology.
Lignocellulose pretreatment in a fungus-cultivating termite
Li, Hongjie; Yelle, Daniel J.; Li, Chang; Yang, Mengyi; Ke, Jing; Zhang, Ruijuan; Liu, Yu; Zhu, Na; Liang, Shiyou; Mo, Xiaochang; Currie, Cameron R.; Mo, Jianchu
2017-01-01
Depolymerizing lignin, the complex phenolic polymer fortifying plant cell walls, is an essential but challenging starting point for the lignocellulosics industries. The variety of ether– and carbon–carbon interunit linkages produced via radical coupling during lignification limit chemical and biological depolymerization efficiency. In an ancient fungus-cultivating termite system, we reveal unprecedentedly rapid lignin depolymerization and degradation by combining laboratory feeding experiments, lignocellulosic compositional measurements, electron microscopy, 2D-NMR, and thermochemolysis. In a gut transit time of under 3.5 h, in young worker termites, poplar lignin sidechains are extensively cleaved and the polymer is significantly depleted, leaving a residue almost completely devoid of various condensed units that are traditionally recognized to be the most recalcitrant. Subsequently, the fungus-comb microbiome preferentially uses xylose and cleaves polysaccharides, thus facilitating final utilization of easily digestible oligosaccharides by old worker termites. This complementary symbiotic pretreatment process in the fungus-growing termite symbiosis reveals a previously unappreciated natural system for efficient lignocellulose degradation. PMID:28424249
Lignocellulose pretreatment in a fungus-cultivating termite
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Hongjie; Yelle, Daniel J.; Li, Chang
Depolymerizing lignin, the complex phenolic polymer fortifying plant cell walls, is an essential but challenging starting point for the lignocellulosics industries. The variety of ether– and carbon–carbon interunit linkages produced via radical coupling during lignification limit chemical and biological depolymerization efficiency. In an ancient fungus-cultivating termite system, we reveal unprecedentedly rapid lignin depolymerization and degradation by combining laboratory feeding experiments, lignocellulosic compositional measurements, electron microscopy, 2D-NMR, and thermochemolysis. In a gut transit time of under 3.5 h, in young worker termites, poplar lignin sidechains are extensively cleaved and the polymer is significantly depleted, leaving a residue almost completely devoid ofmore » various condensed units that are traditionally recognized to be the most recalcitrant. Subsequently, the fungus-comb microbiome preferentially uses xylose and cleaves polysaccharides, thus facilitating final utilization of easily digestible oligosaccharides by old worker termites. This complementary symbiotic pretreatment process in the fungus-growing termite symbiosis reveals a previously unappreciated natural system for efficient lignocellulose degradation.« less