Novel Chromosomal Rearrangements and breakpoints at the t(6;9) in Salivary Adenoid Cystic Carcinoma: association with MYB-NFIB chimeric fusion, MYB expression, and clinical outcome

PubMed Central

Mitani, Yoshitsugu; Rao, Pulivarthi H.; Futreal, P. Andrew; Roberts, Dianna B.; Stephens, Philip J.; Zhao, Yi-Jue; Zhang, Li; Mitani, Mutsumi; Weber, Randal S.; Lippman, Scott M.; Caulin, Carlos; El-Naggar, Adel K.

2011-01-01

Objective To investigate the molecular-genetic heterogeneity associated with the t(6:9) in adenoid cystic carcinoma (ACC) and correlate the findings with patient clinical outcome. Experimental Design Multi-molecular and genetic techniques complemented with massive pair-ended sequencing and SNP array analyses were used on tumor specimens from 30 new and 52 previously RT-PCR analyzed fusion transcript negative ACCs. MYB mRNA expression level was determined by quantitative RT-PCR. The results of 102 tumors (30 new and 72 previously reported cases) were correlated with the clinicopathologic factors and patients’ survival. Results The FISH analysis showed 34/82 (41.5%) fusion positive tumors and molecular techniques identified fusion transcripts in 21 of the 82 (25.6%) tumors. Detailed FISH analysis of 11 out the 15 tumors with gene fusion without transcript formation showed translocation of NFIB sequences to proximal or distal sites of the MYB gene. Massive pair-end sequencing of a subset of tumors confirmed the proximal translocation to an NFIB sequence and led to the identification of a new fusion gene (NFIB-AIG1) in one of the tumors. Overall, MYB-NFIB gene fusion rate by FISH was in 52.9% while fusion transcript forming incidence was 38.2%. Significant statistical association between the 5′ MYB transcript expression and patient survival was found. Conclusions We conclude that: 1) t(6;9) results in a complex genetic and molecular alterations in ACC, 2) MYB-NFIB gene fusion may not always be associated with chimeric transcript formation, 3) non-canonical MYB, NFIB gene fusions occur in a subset of tumors, 4) high MYB expression correlates with worse patient survival. PMID:21976542

Characterization of fusion genes and the significantly expressed fusion isoforms in breast cancer by hybrid sequencing.

PubMed

Weirather, Jason L; Afshar, Pegah Tootoonchi; Clark, Tyson A; Tseng, Elizabeth; Powers, Linda S; Underwood, Jason G; Zabner, Joseph; Korlach, Jonas; Wong, Wing Hung; Au, Kin Fai

2015-10-15

We developed an innovative hybrid sequencing approach, IDP-fusion, to detect fusion genes, determine fusion sites and identify and quantify fusion isoforms. IDP-fusion is the first method to study gene fusion events by integrating Third Generation Sequencing long reads and Second Generation Sequencing short reads. We applied IDP-fusion to PacBio data and Illumina data from the MCF-7 breast cancer cells. Compared with the existing tools, IDP-fusion detects fusion genes at higher precision and a very low false positive rate. The results show that IDP-fusion will be useful for unraveling the complexity of multiple fusion splices and fusion isoforms within tumorigenesis-relevant fusion genes. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

[Construction and application of prokaryotic expression system of Leptospira interrogans lipL32/1-lipL41/1 fusion gene].

PubMed

Luo, Dong-jiao; Yan, Jie; Mao, Ya-fei; Li, Shu-ping; Luo, Yi-hui; Li, Li-wei

2005-01-01

To construct lipL32/1-lipL41/1 fusion gene and its prokaryotic expression system and to determine frequencies of carrying and expression of lipL32 and lipL41 genes in L.interrogans wild strains and specific antibody levels in sera from leptospirosis patients. lipL32/1-lipL41/1 fusion gene was constructed using linking primer PCR method and the prokaryotic expression system of the fusion gene done with routine techniques. SDS-PAGE was used to examine expression of the target recombinant protein rLipL32/1-rLipL41/1. Immunogenicity of rLipL32/1-rLipL41/1 was identified by Western blot. PCR and MAT were performed to detect carrying and expression of lipL32 and lipL41 genes in 97 wild L.interrogans strains. Antibodies against products of lipL32 and lipL41 genes in serum samples from 228 leptospirosis patients were detected by ELISA method. The homogeneity of nucleotide and putative amino acid sequence of lipL32/1-lipL41/1 fusion gene were 99.9 % and 99.8 % in comparison with the reported sequences. Expression output of the target recombinant protein rLipL32/1-rLipL41/1, mainly present in inclusion body, accounted for 10 % of the total bacterial proteins. Both the rabbit antisera against rLipL32/1 and rLipL41/1 could combine to rLipL32/1-rLipL41/1. 97.9 % and 87.6 % of the L.interrogans wild strains had lipL32 and lipL41 genes, respectively. 95.9 % and 84.5 % of the wild strains were positive for MAT with titers of 1:4 - 1:128 using rabbit anti-rLipL32s or anti-rLipL41s sera, respectively. 94.7 % - 97.4 % of the patients'serum samples were positive for rLipL32s antibodies, while 78.5 % - 84.6 % of them were rLipL41s antibodies detectable. lipL32/1-jlipL41/1 fusion gene and its prokaryotic expression system were successfully constructed. The expressed fusion protein had qualified immunogenicity. Both the lipL32 and lipL41 genes are extensively carried and frequently expressed by different serogroups of L.interrogans, and their expression products exhibit cross-antigenicity.

[Prokaryotic expression and immunogenicity analysis of the chimeric HBcAg containing APP beta cleavage site peptide and Aβ(1-15);].

PubMed

Feng, Gai-feng; Wang, Jun-yang; Jin, Hui; Wang, Wei-xi; Qian, Yi-hua; Yang, Wei-na; Wang, Quan-ying; Yang, Guang-xiao

2011-11-01

To construct the recombinant prokaryotic expression plasmid pET/c-ABCSP-Aβ(15-c);, and evaluate the immunogenicity of the fusion protein expressed in E.coli. The gene fragment HBc88-144 was amplified by PCR and subcloned to pUC19. The APP beta cleavage site peptide(ABCSP) and Aβ(1-15); gene(ABCSP-Aβ(15);) was amplified by PCR and inserted downstream of HBc1-71 in pGEMEX/c1-71. After restriction enzyme digestion, c1-17-ABCSP-Aβ(15); were connected with HBc88-144, yielding the recombinant gene c-ABCSP-Aβ(15-c);. c-ABCSP-Aβ(15-c); gene was subcloned into pET-28a(+).The fusion protein expressed in transformed E.coli BL21 was induced with IPTG and analyzed by SDS-PAGE. The virus-like particles (VLP) formed by fusion protein was observed with Transmission Electron Microscope (TEM). 4 Kunming (KM) mice received intraperitoneal injection (i.p) of fusion protein VLP. The antibody was detected by indirect ELISA. The recombinant gene was confirmed by restriction enzyme digestion and DNA sequencing. After IPTG induction, fusion protein was expressed and mainly existed in the sediment of the bacterial lysate. The expression level was 40% of all the proteins in the sediment. The fusion protein could form VLP. After 5 times of immunization, the titer of anti-ABCSP and anti-Aβantibody in sera of KM mice reached up to 1:5 000 and 1:10 000 respectively, while the anti-HBc antibody was undetectable. Recombinant c-ABCSP-Aβ(15-c); gene can be expressed in E.coli. The expressed protein could form VLP and has a strong immunogenicity. This study lays the foundation for the study of AD genetic engineering vaccine.

Investigation of fusion gene expression in HCT116 cells.

PubMed

Zhang, Yanmei; Ren, Juan; Fang, Mengdie; Wang, Xiaoju

2017-12-01

Colon cancer is the most common type of gastrointestinal cancer. A number of specific and sensitive biomarkers facilitate the diagnosis and monitoring of patients with colon cancer. Fusion genes are typically identified in cancer and a majority of the newly identified fusion genes are oncogenic in nature. Therefore, fusion genes are potential biomarkers and/or therapy targets in cancer. In the present study, the regulation of specific candidate fusion genes were investigated using Brother of the Regulator of Imprinted Sites (BORIS) in the HCT116 colon cancer cell line, which is a paralog of the fusion gene regulator CCCTC-binding factor (CTCF). The copy number of BORIS increased correspondingly to the progression of colorectal carcinoma from the M0 to the M1a stage. It was identified that EIF3E(e1)-RSPO2(e2) , EIF3E(e1)-RSPO2(e3) , PTPRK(e1)-RSPO3(e2) , PTPRK(e7)-RSPO3(e2), TADA2A-MEF2B and MED13L-CD4 are fusion transcripts present in the transcriptome of the HCT116 colon cancer cell line. CDC42SE2-KIAAO146 is a genomic fusion transcript, which originates from DNA arrangement in HCT116 cells. BORIS suppresses the expression of EIF3E , RSPO2 , PTPRK , RSPO3 , TADA2A and CD4 to inhibit the expression of fusion transcripts in HCT116 cells. It was hypothesized that the fusion transcripts investigated in the present study may not be oncogenic in HCT116 cells. As BORIS is not colorectal carcinoma-specific, the fusion genes investigated may be a biomarker assemblage for monitoring the progression of colorectal carcinoma.

Investigation of fusion gene expression in HCT116 cells

PubMed Central

Zhang, Yanmei; Ren, Juan; Fang, Mengdie; Wang, Xiaoju

2017-01-01

Colon cancer is the most common type of gastrointestinal cancer. A number of specific and sensitive biomarkers facilitate the diagnosis and monitoring of patients with colon cancer. Fusion genes are typically identified in cancer and a majority of the newly identified fusion genes are oncogenic in nature. Therefore, fusion genes are potential biomarkers and/or therapy targets in cancer. In the present study, the regulation of specific candidate fusion genes were investigated using Brother of the Regulator of Imprinted Sites (BORIS) in the HCT116 colon cancer cell line, which is a paralog of the fusion gene regulator CCCTC-binding factor (CTCF). The copy number of BORIS increased correspondingly to the progression of colorectal carcinoma from the M0 to the M1a stage. It was identified that EIF3E(e1)-RSPO2(e2), EIF3E(e1)-RSPO2(e3), PTPRK(e1)-RSPO3(e2), PTPRK(e7)-RSPO3(e2), TADA2A-MEF2B and MED13L-CD4 are fusion transcripts present in the transcriptome of the HCT116 colon cancer cell line. CDC42SE2-KIAAO146 is a genomic fusion transcript, which originates from DNA arrangement in HCT116 cells. BORIS suppresses the expression of EIF3E, RSPO2, PTPRK, RSPO3, TADA2A and CD4 to inhibit the expression of fusion transcripts in HCT116 cells. It was hypothesized that the fusion transcripts investigated in the present study may not be oncogenic in HCT116 cells. As BORIS is not colorectal carcinoma-specific, the fusion genes investigated may be a biomarker assemblage for monitoring the progression of colorectal carcinoma. PMID:29181107

Kinase impact assessment in the landscape of fusion genes that retain kinase domains: a pan-cancer study

PubMed Central

Kim, Pora; Jia, Peilin; Zhao, Zhongming

2018-01-01

Abstract Assessing the impact of kinase in gene fusion is essential for both identifying driver fusion genes (FGs) and developing molecular targeted therapies. Kinase domain retention is a crucial factor in kinase fusion genes (KFGs), but such a systematic investigation has not been done yet. To this end, we analyzed kinase domain retention (KDR) status in chimeric protein sequences of 914 KFGs covering 312 kinases across 13 major cancer types. Based on 171 kinase domain-retained KFGs including 101 kinases, we studied their recurrence, kinase groups, fusion partners, exon-based expression depth, short DNA motifs around the break points and networks. Our results, such as more KDR than 5′-kinase fusion genes, combinatorial effects between 3′-KDR kinases and their 5′-partners and a signal transduction-specific DNA sequence motif in the break point intronic sequences, supported positive selection on 3′-kinase fusion genes in cancer. We introduced a degree-of-frequency (DoF) score to measure the possible number of KFGs of a kinase. Interestingly, kinases with high DoF scores tended to undergo strong gene expression alteration at the break points. Furthermore, our KDR gene fusion network analysis revealed six of the seven kinases with the highest DoF scores (ALK, BRAF, MET, NTRK1, NTRK3 and RET) were all observed in thyroid carcinoma. Finally, we summarized common features of ‘effective’ (highly recurrent) kinases in gene fusions such as expression alteration at break point, redundant usage in multiple cancer types and 3′-location tendency. Collectively, our findings are useful for prioritizing driver kinases and FGs and provided insights into KFGs’ clinical implications. PMID:28013235

Recurrent LRP1-SNRNP25 and KCNMB4-CCND3 fusion genes promote tumor cell motility in human osteosarcoma.

PubMed

Yang, Jilong; Annala, Matti; Ji, Ping; Wang, Guowen; Zheng, Hong; Codgell, David; Du, Xiaoling; Fang, Zhiwei; Sun, Baocun; Nykter, Matti; Chen, Kexin; Zhang, Wei

2014-10-10

The identification of fusion genes such as SYT-SSX1/SSX2, PAX3-FOXO1, TPM3/TPM4-ALK and EWS-FLI1 in human sarcomas has provided important insight into the diagnosis and targeted therapy of sarcomas. No recurrent fusion has been reported in human osteosarcoma. Transcriptome sequencing was used to characterize the gene fusions and mutations in 11 human osteosarcomas. Nine of 11 samples were found to harbor genetic inactivating alterations in the TP53 pathway. Two recurrent fusion genes associated with the 12q locus, LRP1-SNRNP25 and KCNMB4-CCND3, were identified and validated by RT-PCR, Sanger sequencing and fluorescence in situ hybridization, and were found to be osteosarcoma specific in a validation cohort of 240 other sarcomas. Expression of LRP1-SNRNP25 fusion gene promoted SAOS-2 osteosarcoma cell migration and invasion. Expression of KCNMB4-CCND3 fusion gene promoted SAOS-2 cell migration. Our study represents the first whole transcriptome analysis of untreated human osteosarcoma. Our discovery of two osteosarcoma specific fusion genes associated with osteosarcoma cellular motility highlights the heterogeneity of osteosarcoma and provides opportunities for new treatment modalities.

Novel kinase fusion transcripts found in endometrial cancer

PubMed Central

Tamura, Ryo; Yoshihara, Kosuke; Yamawaki, Kaoru; Suda, Kazuaki; Ishiguro, Tatsuya; Adachi, Sosuke; Okuda, Shujiro; Inoue, Ituro; Verhaak, Roel G. W.; Enomoto, Takayuki

2015-01-01

Recent advances in RNA-sequencing technology have enabled the discovery of gene fusion transcripts in the transcriptome of cancer cells. However, it remains difficult to differentiate the therapeutically targetable fusions from passenger events. We have analyzed RNA-sequencing data and DNA copy number data from 25 endometrial cancer cell lines to identify potential therapeutically targetable fusion transcripts, and have identified 124 high-confidence fusion transcripts, of which 69% are associated with gene amplifications. As targetable fusion candidates, we focused on three in-frame kinase fusion transcripts that retain a kinase domain (CPQ-PRKDC, CAPZA2-MET, and VGLL4-PRKG1). We detected only CPQ-PRKDC fusion transcript in three of 122 primary endometrial cancer tissues. Cell proliferation of the fusion-positive cell line was inhibited by knocking down the expression of wild-type PRKDC but not by blocking the CPQ-PRKDC fusion transcript expression. Quantitative real-time RT-PCR demonstrated that the expression of the CPQ-PRKDC fusion transcript was significantly lower than that of wild-type PRKDC, corresponding to a low transcript allele fraction of this fusion, based on RNA-sequencing read counts. In endometrial cancers, the CPQ-PRKDC fusion transcript may be a passenger aberration related to gene amplification. Our findings suggest that transcript allele fraction is a useful predictor to find bona-fide therapeutic-targetable fusion transcripts. PMID:26689674

Novel kinase fusion transcripts found in endometrial cancer.

PubMed

Tamura, Ryo; Yoshihara, Kosuke; Yamawaki, Kaoru; Suda, Kazuaki; Ishiguro, Tatsuya; Adachi, Sosuke; Okuda, Shujiro; Inoue, Ituro; Verhaak, Roel G W; Enomoto, Takayuki

2015-12-22

Recent advances in RNA-sequencing technology have enabled the discovery of gene fusion transcripts in the transcriptome of cancer cells. However, it remains difficult to differentiate the therapeutically targetable fusions from passenger events. We have analyzed RNA-sequencing data and DNA copy number data from 25 endometrial cancer cell lines to identify potential therapeutically targetable fusion transcripts, and have identified 124 high-confidence fusion transcripts, of which 69% are associated with gene amplifications. As targetable fusion candidates, we focused on three in-frame kinase fusion transcripts that retain a kinase domain (CPQ-PRKDC, CAPZA2-MET, and VGLL4-PRKG1). We detected only CPQ-PRKDC fusion transcript in three of 122 primary endometrial cancer tissues. Cell proliferation of the fusion-positive cell line was inhibited by knocking down the expression of wild-type PRKDC but not by blocking the CPQ-PRKDC fusion transcript expression. Quantitative real-time RT-PCR demonstrated that the expression of the CPQ-PRKDC fusion transcript was significantly lower than that of wild-type PRKDC, corresponding to a low transcript allele fraction of this fusion, based on RNA-sequencing read counts. In endometrial cancers, the CPQ-PRKDC fusion transcript may be a passenger aberration related to gene amplification. Our findings suggest that transcript allele fraction is a useful predictor to find bona-fide therapeutic-targetable fusion transcripts.

Driver Fusions and Their Implications in the Development and Treatment of Human Cancers.

PubMed

Gao, Qingsong; Liang, Wen-Wei; Foltz, Steven M; Mutharasu, Gnanavel; Jayasinghe, Reyka G; Cao, Song; Liao, Wen-Wei; Reynolds, Sheila M; Wyczalkowski, Matthew A; Yao, Lijun; Yu, Lihua; Sun, Sam Q; Chen, Ken; Lazar, Alexander J; Fields, Ryan C; Wendl, Michael C; Van Tine, Brian A; Vij, Ravi; Chen, Feng; Nykter, Matti; Shmulevich, Ilya; Ding, Li

2018-04-03

Gene fusions represent an important class of somatic alterations in cancer. We systematically investigated fusions in 9,624 tumors across 33 cancer types using multiple fusion calling tools. We identified a total of 25,664 fusions, with a 63% validation rate. Integration of gene expression, copy number, and fusion annotation data revealed that fusions involving oncogenes tend to exhibit increased expression, whereas fusions involving tumor suppressors have the opposite effect. For fusions involving kinases, we found 1,275 with an intact kinase domain, the proportion of which varied significantly across cancer types. Our study suggests that fusions drive the development of 16.5% of cancer cases and function as the sole driver in more than 1% of them. Finally, we identified druggable fusions involving genes such as TMPRSS2, RET, FGFR3, ALK, and ESR1 in 6.0% of cases, and we predicted immunogenic peptides, suggesting that fusions may provide leads for targeted drug and immune therapy. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Drosophila and mammalian models uncover a role for the myoblast fusion gene TANC1 in rhabdomyosarcoma.

PubMed

Avirneni-Vadlamudi, Usha; Galindo, Kathleen A; Endicott, Tiana R; Paulson, Vera; Cameron, Scott; Galindo, Rene L

2012-01-01

Rhabdomyosarcoma (RMS) is a malignancy of muscle myoblasts, which fail to exit the cell cycle, resist terminal differentiation, and are blocked from fusing into syncytial skeletal muscle. In some patients, RMS is caused by a translocation that generates the fusion oncoprotein PAX-FOXO1, but the underlying RMS pathogenetic mechanisms that impede differentiation and promote neoplastic transformation remain unclear. Using a Drosophila model of PAX-FOXO1-mediated transformation, we show here that mutation in the myoblast fusion gene rolling pebbles (rols) dominantly suppresses PAX-FOXO1 lethality. Further analysis indicated that PAX-FOXO1 expression caused upregulation of rols, which suggests that Rols acts downstream of PAX-FOXO1. In mammalian myoblasts, gene silencing of Tanc1, an ortholog of rols, revealed that it is essential for myoblast fusion, but is dispensable for terminal differentiation. Misexpression of PAX-FOXO1 in myoblasts upregulated Tanc1 and blocked differentiation, whereas subsequent reduction of Tanc1 expression to native levels by RNAi restored both fusion and differentiation. Furthermore, decreasing human TANC1 gene expression caused RMS cancer cells to lose their neoplastic state, undergo fusion, and form differentiated syncytial muscle. Taken together, these findings identify misregulated myoblast fusion caused by ectopic TANC1 expression as a RMS neoplasia mechanism and suggest fusion molecules as candidates for targeted RMS therapy.

Multimodality imaging of reporter gene expression using a novel fusion vector in living cells and animals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gambhir, Sanjiv; Pritha, Ray

Novel double and triple fusion reporter gene constructs harboring distinct imagable reporter genes are provided, as well as applications for the use of such double and triple fusion constructs in living cells and in living animals using distinct imaging technologies.

Multimodality imaging of reporter gene expression using a novel fusion vector in living cells and animals

DOEpatents

Gambhir, Sanjiv; Pritha, Ray

2015-07-14

Novel double and triple fusion reporter gene constructs harboring distinct imagable reporter genes are provided, as well as applications for the use of such double and triple fusion constructs in living cells and in living animals using distinct imaging technologies.

Celastrol suppresses tumor cell growth through targeting an AR-ERG-NF-κB pathway in TMPRSS2/ERG fusion gene expressing prostate cancer.

PubMed

Shao, Longjiang; Zhou, Zhansong; Cai, Yi; Castro, Patricia; Dakhov, Olga; Shi, Ping; Bai, Yaoxia; Ji, Huixiang; Shen, Wenhao; Wang, Jianghua

2013-01-01

The TMPRSS2/ERG (T/E) fusion gene is present in the majority of all prostate cancers (PCa). We have shown previously that NF-kB signaling is highly activated in these T/E fusion expressing cells via phosphorylation of NF-kB p65 Ser536 (p536). We therefore hypothesize that targeting NF-kB signaling may be an efficacious approach for the subgroup of PCas that carry T/E fusions. Celastrol is a well known NF-kB inhibitor, and thus may inhibit T/E fusion expressing PCa cell growth. We therefore evaluated Celastrol's effects in vitro and in vivo in VCaP cells, which express the T/E fusion gene. VCaP cells were treated with different concentrations of Celastrol and growth inhibition and target expression were evaluated. To test its ability to inhibit growth in vivo, 0.5 mg/kg Celastrol was used to treat mice bearing subcutaneous VCaP xenograft tumors. Our results show Celastrol can significantly inhibit the growth of T/E fusion expressing PCa cells both in vitro and in vivo through targeting three critical signaling pathways: AR, ERG and NF-kB in these cells. When mice received 0.5 mg/kg Celastrol for 4 times/week, significant growth inhibition was seen with no obvious toxicity or significant weight loss. Therefore, Celastrol is a promising candidate drug for T/E fusion expressing PCa. Our findings provide a novel strategy for the targeted therapy which may benefit the more than half of PCa patients who have T/E fusion expressing PCas.

Renilla luciferase- Aequorea GFP (Ruc-GFP) fusion protein, a novel dual reporter for real-time imaging of gene expression in cell cultures and in live animals.

PubMed

Wang, Y; Yu, Y A; Shabahang, S; Wang, G; Szalay, A A

2002-10-01

Light-emitting reporter proteins play an increasing role in the study of gene expression in vitro and in vivo. Here we present a ruc-gfp fusion gene construct generated by fusing a cDNA for Renilla luciferase (ruc) in-frame with a cDNA encoding the "humanized" GFP (gfp) from Aequorea. A plasmid containing the fusion gene construct was successfully transformed into, and expressed in, mammalian cells. The transformed cells exhibited both Renilla luciferase activity in the presence of coelenterazine and GFP fluorescence upon excitation with UV light. Spectrofluorometry of cells containing the Ruc-GFP fusion protein, in the absence of wavelengths capable of exciting GFP fluorescence but in the presence of the luciferase substrate, coelenterazine, showed an emission spectrum with two peaks at 475 nm and 508 nm. These two peaks correspond to the emission maximum of Renilla luciferase at 475 nm and that of GFP at 508 nm. The peak at 508 nm generated in the presence of coelenterazine alone (without UV excitation) is the result of intramolecular energy transfer from Renilla luciferase to Aequorea GFP. Southern analysis of genomic DNA purified from transformed Chinese hamster ovary (CHO) cells and fluorescence in situ hybridization (FISH) to metaphase chromosomes confirmed the integration of the ruc-gfp fusion gene on a single chromosome. The bifunctional Ruc-GFP fusion protein allows the detection of gene expression at the single-cell level based on green fluorescence, and in a group of cells based on luminescence emission. Furthermore, animal experiments revealed that light emission from the Ruc-GFP fusion protein can be detected externally in the organs or tissues of live animals bearing the gene construct.

Independent evolutionary origins of functional polyamine biosynthetic enzyme fusions catalyzing de novo diamine to triamine formation

PubMed Central

Green, Robert; Hanfrey, Colin C.; Elliott, Katherine A.; McCloskey, Diane E.; Wang, Xiaojing; Kanugula, Sreenivas; Pegg, Anthony E.; Michael, Anthony J.

2011-01-01

Summary We have identified gene fusions of polyamine biosynthetic enzymes S-adenosylmethionine decarboxylase (AdoMetDC, speD) and aminopropyltransferase (speE) orthologues in diverse bacterial phyla. Both domains are functionally active and we demonstrate the novel de novo synthesis of the triamine spermidine from the diamine putrescine by fusion enzymes from β-proteobacterium Delftia acidovorans and δ-proteobacterium Syntrophus aciditrophicus, in a ΔspeDE gene deletion strain of Salmonella enterica sv. Typhimurium. Fusion proteins from marine α-proteobacterium Candidatus Pelagibacter ubique, actinobacterium Nocardia farcinica, chlorobi species Chloroherpeton thalassium, and β-proteobacterium Delftia acidovorans each produce a different profile of non-native polyamines including sym-norspermidine when expressed in Escherichia coli. The different aminopropyltransferase activities together with phylogenetic analysis confirm independent evolutionary origins for some fusions. Comparative genomic analysis strongly indicates that gene fusions arose by merger of adjacent open reading frames. Independent fusion events, and horizontal and vertical gene transfer contributed to the scattered phyletic distribution of the gene fusions. Surprisingly, expression of fusion genes in E. coli and S. Typhimurium revealed novel latent spermidine catabolic activity producing non-native 1,3-diaminopropane in these species. We have also identified fusions of polyamine biosynthetic enzymes agmatine deiminase and N-carbamoylputrescine amidohydrolase in archaea, and of S-adenosylmethionine decarboxylase and ornithine decarboxylase in the single-celled green alga Micromonas. PMID:21762220

RNA-seq of 272 gliomas revealed a novel, recurrent PTPRZ1-MET fusion transcript in secondary glioblastomas.

PubMed

Bao, Zhao-Shi; Chen, Hui-Min; Yang, Ming-Yu; Zhang, Chuan-Bao; Yu, Kai; Ye, Wan-Lu; Hu, Bo-Qiang; Yan, Wei; Zhang, Wei; Akers, Johnny; Ramakrishnan, Valya; Li, Jie; Carter, Bob; Liu, Yan-Wei; Hu, Hui-Min; Wang, Zheng; Li, Ming-Yang; Yao, Kun; Qiu, Xiao-Guang; Kang, Chun-Sheng; You, Yong-Ping; Fan, Xiao-Long; Song, Wei Sonya; Li, Rui-Qiang; Su, Xiao-Dong; Chen, Clark C; Jiang, Tao

2014-11-01

Studies of gene rearrangements and the consequent oncogenic fusion proteins have laid the foundation for targeted cancer therapy. To identify oncogenic fusions associated with glioma progression, we catalogued fusion transcripts by RNA-seq of 272 gliomas. Fusion transcripts were more frequently found in high-grade gliomas, in the classical subtype of gliomas, and in gliomas treated with radiation/temozolomide. Sixty-seven in-frame fusion transcripts were identified, including three recurrent fusion transcripts: FGFR3-TACC3, RNF213-SLC26A11, and PTPRZ1-MET (ZM). Interestingly, the ZM fusion was found only in grade III astrocytomas (1/13; 7.7%) or secondary GBMs (sGBMs, 3/20; 15.0%). In an independent cohort of sGBMs, the ZM fusion was found in three of 20 (15%) specimens. Genomic analysis revealed that the fusion arose from translocation events involving introns 3 or 8 of PTPRZ and intron 1 of MET. ZM fusion transcripts were found in GBMs irrespective of isocitrate dehydrogenase 1 (IDH1) mutation status. sGBMs harboring ZM fusion showed higher expression of genes required for PIK3CA signaling and lowered expression of genes that suppressed RB1 or TP53 function. Expression of the ZM fusion was mutually exclusive with EGFR overexpression in sGBMs. Exogenous expression of the ZM fusion in the U87MG glioblastoma line enhanced cell migration and invasion. Clinically, patients afflicted with ZM fusion harboring glioblastomas survived poorly relative to those afflicted with non-ZM-harboring sGBMs (P < 0.001). Our study profiles the shifting RNA landscape of gliomas during progression and reveled ZM as a novel, recurrent fusion transcript in sGBMs. © 2014 Bao et al.; Published by Cold Spring Harbor Laboratory Press.

RNA-seq of 272 gliomas revealed a novel, recurrent PTPRZ1-MET fusion transcript in secondary glioblastomas

PubMed Central

Bao, Zhao-Shi; Yang, Ming-Yu; Zhang, Chuan-Bao; Yu, Kai; Ye, Wan-Lu; Hu, Bo-Qiang; Yan, Wei; Zhang, Wei; Akers, Johnny; Ramakrishnan, Valya; Li, Jie; Carter, Bob; Liu, Yan-Wei; Hu, Hui-Min; Wang, Zheng; Li, Ming-Yang; Yao, Kun; Qiu, Xiao-Guang; Kang, Chun-Sheng; You, Yong-Ping; Fan, Xiao-Long; Song, Wei Sonya; Li, Rui-Qiang

2014-01-01

Studies of gene rearrangements and the consequent oncogenic fusion proteins have laid the foundation for targeted cancer therapy. To identify oncogenic fusions associated with glioma progression, we catalogued fusion transcripts by RNA-seq of 272 gliomas. Fusion transcripts were more frequently found in high-grade gliomas, in the classical subtype of gliomas, and in gliomas treated with radiation/temozolomide. Sixty-seven in-frame fusion transcripts were identified, including three recurrent fusion transcripts: FGFR3-TACC3, RNF213-SLC26A11, and PTPRZ1-MET (ZM). Interestingly, the ZM fusion was found only in grade III astrocytomas (1/13; 7.7%) or secondary GBMs (sGBMs, 3/20; 15.0%). In an independent cohort of sGBMs, the ZM fusion was found in three of 20 (15%) specimens. Genomic analysis revealed that the fusion arose from translocation events involving introns 3 or 8 of PTPRZ and intron 1 of MET. ZM fusion transcripts were found in GBMs irrespective of isocitrate dehydrogenase 1 (IDH1) mutation status. sGBMs harboring ZM fusion showed higher expression of genes required for PIK3CA signaling and lowered expression of genes that suppressed RB1 or TP53 function. Expression of the ZM fusion was mutually exclusive with EGFR overexpression in sGBMs. Exogenous expression of the ZM fusion in the U87MG glioblastoma line enhanced cell migration and invasion. Clinically, patients afflicted with ZM fusion harboring glioblastomas survived poorly relative to those afflicted with non-ZM-harboring sGBMs (P < 0.001). Our study profiles the shifting RNA landscape of gliomas during progression and reveled ZM as a novel, recurrent fusion transcript in sGBMs. PMID:25135958

NUP160-SLC43A3 is a novel recurrent fusion oncogene in angiosarcoma.

PubMed

Shimozono, Naoki; Jinnin, Masatoshi; Masuzawa, Mamiko; Masuzawa, Mikio; Wang, Zhongzhi; Hirano, Ayaka; Tomizawa, Yukiko; Etoh-Kira, Tomomi; Kajihara, Ikko; Harada, Miho; Fukushima, Satoshi; Ihn, Hironobu

2015-11-01

Angiosarcoma is a malignant vascular tumor originating from endothelial cells of blood vessels or lymphatic vessels. The specific driver mutations in angiosarcoma remain unknown. In this study, we investigated this issue by transcriptome sequencing of patient-derived angiosarcoma cells (ISO-HAS), identifying a novel fusion gene NUP160-SLC43A3 found to be expressed in 9 of 25 human angiosarcoma specimens that were examined. In tumors harboring the fusion gene, the duration between the onset of symptoms and the first hospital visit was significantly shorter, suggesting more rapid tumor progression. Stable expression of the fusion gene in nontransformed human dermal microvascular endothelial cells elicited a gene-expression pattern mimicking ISO-HAS cells and increased cell proliferation, an effect traced in part to NUP160 truncation. Conversely, RNAi-mediated attenuation of NUP160 in ISO-HAS cells decreased cell number. Confirming the oncogenic effects of the fusion protein, subcutaneous implantation of NUP160-SLC43A3-expressing fibroblasts induced tumors resembling human angiosarcoma. Collectively, our findings advance knowledge concerning the genetic causes of angiosarcoma, with potential implications for new diagnostic and therapeutic approaches. ©2015 American Association for Cancer Research.

New methods for tightly regulated gene expression and highly efficient chromosomal integration of cloned genes for Methanosarcina species

DOE Office of Scientific and Technical Information (OSTI.GOV)

Guss, Adam M.; Rother, Michael; Zhang, Jun Kai

A highly efficient method for chromosomal integration of cloned DNA into Methanosarcina spp. was developed utilizing the site-specific recombination system from the Streptomyces phage φC31. Host strains expressing the φC31 integrase gene and carrying an appropriate recombination site can be transformed with non-replicating plasmids carrying the complementary recombination site at efficiencies similar to those obtained with self-replicating vectors. We have also constructed a series of hybrid promoters that combine the highly expressed M. barkeri P mcrB promoter with binding sites for the tetracycline-responsive, bacterial TetR protein. These promoters are tightly regulated by the presence or absence of tetracycline in strainsmore » that express the tetR gene. The hybrid promoters can be used in genetic experiments to test gene essentiality by placing a gene of interest under their control. Thus, growth of strains with tetR -regulated essential genes becomes tetracycline-dependent. A series of plasmid vectors that utilize the site-specific recombination system for construction of reporter gene fusions and for tetracycline regulated expression of cloned genes are reported. These vectors were used to test the efficiency of translation at a variety of start codons. Fusions using an ATG start site were the most active, whereas those using GTG and TTG were approximately one half or one fourth as active, respectively. The CTG fusion was 95% less active than the ATG fusion.« less

New methods for tightly regulated gene expression and highly efficient chromosomal integration of cloned genes for Methanosarcina species

DOE PAGES

Guss, Adam M.; Rother, Michael; Zhang, Jun Kai; ...

2008-01-01

A highly efficient method for chromosomal integration of cloned DNA into Methanosarcina spp. was developed utilizing the site-specific recombination system from the Streptomyces phage φC31. Host strains expressing the φC31 integrase gene and carrying an appropriate recombination site can be transformed with non-replicating plasmids carrying the complementary recombination site at efficiencies similar to those obtained with self-replicating vectors. We have also constructed a series of hybrid promoters that combine the highly expressed M. barkeri P mcrB promoter with binding sites for the tetracycline-responsive, bacterial TetR protein. These promoters are tightly regulated by the presence or absence of tetracycline in strainsmore » that express the tetR gene. The hybrid promoters can be used in genetic experiments to test gene essentiality by placing a gene of interest under their control. Thus, growth of strains with tetR -regulated essential genes becomes tetracycline-dependent. A series of plasmid vectors that utilize the site-specific recombination system for construction of reporter gene fusions and for tetracycline regulated expression of cloned genes are reported. These vectors were used to test the efficiency of translation at a variety of start codons. Fusions using an ATG start site were the most active, whereas those using GTG and TTG were approximately one half or one fourth as active, respectively. The CTG fusion was 95% less active than the ATG fusion.« less

[Construction and prokaryotic expression of recombinant gene EGFRvIII HBcAg and immunogenicity analysis of the fusion protein].

PubMed

Duan, Xiao-yi; Wang, Jian-sheng; Guo, You-min; Han, Jun-li; Wang, Quan-ying; Yang, Guang-xiao

2007-01-01

To construct recombinant prokaryotic expression plasmid pET28a(+)/c-PEP-3-c and evaluate the immunogenicity of the fusion protein. cDNA fragment encoding PEP-3 was obtained from pGEM-T Easy/PEP-3 and inserted into recombinant plasmid pGEMEX/HBcAg. Then it was subcloned in prokaryotic expression vector and transformed into E.coli BL21(DE3). The fusion protein was expressed by inducing IPTG and purified by Ni(2+)-NTA affinity chromatography. BALB/c mice were immunized with fusion protein and the antibody titre was determined by indirect ELISA. The recombinant gene was confirmed to be correct by restriction enzyme digestion and DNA sequencing. After prokaryotic expression, fusion protein existed in sediment and accounted for 56% of all bacterial lysate. The purified product accounted for 92% of all protein and its concentration was 8 g/L. The antibody titre in blood serum reached 1:16 000 after the fourth immunization and reached 1:2.56x10(5) after the sixth immunization. The titre of anti-PEP-3 antibody reached 1:1.28x10(5) and the titre of anti-HBcAg antibody was less than 1:4x10(3). Fusion gene PEP-3-HBcAg is highly expressed in E.coli BL21. The expressed fusion protein can induce neutralizing antibody with high titer and specificity, which lays a foundation for the study of genetically engineering vaccine for malignant tumors with the high expression of EGFRvIII.

Investigation of PAX3/7-FKHR fusion genes and IGF2 gene expression in rhabdomyosarcoma tumors.

PubMed

de Souza, Robson Ramos; Oliveira, Indhira Dias; Caran, Eliana Maria Monteiro; Alves, Maria Teresa de Seixas; Abib, Simone; Toledo, Silvia Regina Caminada

2012-12-01

The purpose of our study was to investigate the prevalence of the PAX3/7-FKHR fusion genes and quantify the IGF2 gene expression in rhabdomyosarcoma (RMS) samples. Soft tissue sarcomas account 5% of childhood cancers and 50% of them are RMS. Morphological evaluation of pediatric RMS has defined two histological subtypes, embryonal (ERMS) and alveolar (ARMS). Chromosomal analyses have demonstrated two translocations associated with ARMS, resulting in the PAX3/7-FKHR rearrangements. Reverse transcriptase-polymerase chain reaction (RT-PCR) is extremely useful in the diagnosis of ARMS positive for these rearrangements. Additionally, several studies have shown a significant involvement of IGF pathway in the pathogenesis of RMS. The presence of PAX3/7-FKHR gene fusions was studied in 25 RMS samples from patients attending the IOP-GRAACC/UNIFESP and three RMS cell lines by RT-PCR. IGF2 gene expression was quantified by qPCR and related with clinic pathological parameters. Of the 25 samples, nine (36%) were ARMS and 16 (64%) were ERMS. PAX3/7-FKHR gene fusions expression was detected in 56% of ARMS tumor samples. IGF2 overexpression was observed in 80% of samples and could indicate an important role of this pathway in RMS biology. Copyright © 2012 Elsevier Ltd. All rights reserved.

Tumor-specific expression of shVEGF and suicide gene as a novel strategy for esophageal cancer therapy.

PubMed

Liu, Ting; Wu, Hai-Jun; Liang, Yu; Liang, Xu-Jun; Huang, Hui-Chao; Zhao, Yan-Zhong; Liao, Qing-Chuan; Chen, Ya-Qi; Leng, Ai-Min; Yuan, Wei-Jian; Zhang, Gui-Ying; Peng, Jie; Chen, Yong-Heng

2016-06-21

To develop a potent and safe gene therapy for esophageal cancer. An expression vector carrying fusion suicide gene (yCDglyTK) and shRNA against vascular endothelial growth factor (VEGF) was constructed and delivered into EC9706 esophageal cancer cells by calcium phosphate nanoparticles (CPNP). To achieve tumor selectivity, expression of the fusion suicide gene was driven by a tumor-specific human telomerase reverse transcriptase (hTERT) promoter. The biologic properties and therapeutic efficiency of the vector, in the presence of prodrug 5-fluorocytosine (5-FC), were evaluated in vitro and in vivo. Both in vitro and in vivo testing showed that the expression vector was efficiently introduced by CPNP into tumor cells, leading to cellular expression of yCDglyTK and decreased VEGF level. With exposure to 5-FC, it exhibited strong anti-tumor effects against esophageal cancer. Combination of VEGF shRNA with the fusion suicide gene demonstrated strong anti-tumor activity. The shVEGF-hTERT-yCDglyTK/5-FC system provided a novel approach for esophageal cancer-targeted gene therapy.

The equine herpesvirus-1 IR3 gene that lies antisense to the sole immediate-early (IE) gene is trans-activated by the IE protein, and is poorly expressed to a protein

PubMed Central

Ahn, Byung Chul; Breitenbach, Jonathan E.; Kim, Seong K.; O’Callaghan, Dennis J.

2007-01-01

The unique IR3 gene of equine herpesvirus 1 (EHV-1) is expressed as a late 1.0-kb transcript. Previous studies confirmed the IR3 transcription initiation site and tentatively identified other cis-acting elements specific to IR3 such as a TATA box, a 443 base pair 5′untranslated region (UTR), a 285 base pair open reading frame (ORF) and a poly adenylation (A) signal (Holden et al., 1992 DNA Seq 3, 143-52). Transient transfection assays revealed that the IR3 promoter is strongly trans-activated by the IE protein (IEP) and that coexpression of the IEP with the early EICP0 and IR4 regulatory proteins results in maximal trans-activation of the IR3 promoter. Gel shift assays revealed that the IEP directly binds to the IR3 promoter region. Western blot analysis showed that the IR3 protein produced in E. coli was detected by antibodies to IR3 synthetic peptides; however, the IR3 protein was not detected in EHV-1 infected cell extracts by these same anti-IR3 antibodies, even though the IR3 transcript was detected by northern blot. These findings suggest that the IR3 may not be expressed to a protein. Expression of an IR3/GFP fusion gene was not observed, but expression of a GFP/IR3 fusion gene was detected by fluorescent microscopy. In further attempts to detect the IR3/GFP fusion protein using anti-GFP antibody, western blot analysis showed that the IR3/GFP fusion protein was not detected in vivo. Interestingly, a truncated form of the GFP/IR3 protein was synthesized from the GFP/IR3 fusion gene. However, GFP/IR3 and IR3/GFP fusion proteins of the predicted sizes were synthesized by in vitro coupled transcription and translation of the fusion genes, suggesting poor expression of the IR3 protein in vivo. The possible role of the IR3 transcript in EHV-1 infection is discussed. PMID:17306852

A sensitive HIV-1 envelope induced fusion assay identifies fusion enhancement of thrombin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cheng, De-Chun; Zhong, Guo-Cai; Su, Ju-Xiang

2010-01-22

To evaluate the interaction between HIV-1 envelope glycoprotein (Env) and target cell receptors, various cell-cell-fusion assays have been developed. In the present study, we established a novel fusion system. In this system, the expression of the sensitive reporter gene, firefly luciferase (FL) gene, in the target cells was used to evaluate cell fusion event. Simultaneously, constitutively expressed Renilla luciferase (RL) gene was used to monitor effector cell number and viability. FL gave a wider dynamic range than other known reporters and the introduction of RL made the assay accurate and reproducible. This system is especially beneficial for investigation of potentialmore » entry-influencing agents, for its power of ruling out the false inhibition or enhancement caused by the artificial cell-number variation. As a case study, we applied this fusion system to observe the effect of a serine protease, thrombin, on HIV Env-mediated cell-cell fusion and have found the fusion enhancement activity of thrombin over two R5-tropic HIV strains.« less

Reanalysis of RNA-Sequencing Data Reveals Several Additional Fusion Genes with Multiple Isoforms

PubMed Central

Kangaspeska, Sara; Hultsch, Susanne; Edgren, Henrik; Nicorici, Daniel; Murumägi, Astrid; Kallioniemi, Olli

2012-01-01

RNA-sequencing and tailored bioinformatic methodologies have paved the way for identification of expressed fusion genes from the chaotic genomes of solid tumors. We have recently successfully exploited RNA-sequencing for the discovery of 24 novel fusion genes in breast cancer. Here, we demonstrate the importance of continuous optimization of the bioinformatic methodology for this purpose, and report the discovery and experimental validation of 13 additional fusion genes from the same samples. Integration of copy number profiling with the RNA-sequencing results revealed that the majority of the gene fusions were promoter-donating events that occurred at copy number transition points or involved high-level DNA-amplifications. Sequencing of genomic fusion break points confirmed that DNA-level rearrangements underlie selected fusion transcripts. Furthermore, a significant portion (>60%) of the fusion genes were alternatively spliced. This illustrates the importance of reanalyzing sequencing data as gene definitions change and bioinformatic methods improve, and highlights the previously unforeseen isoform diversity among fusion transcripts. PMID:23119097

Reanalysis of RNA-sequencing data reveals several additional fusion genes with multiple isoforms.

PubMed

Kangaspeska, Sara; Hultsch, Susanne; Edgren, Henrik; Nicorici, Daniel; Murumägi, Astrid; Kallioniemi, Olli

2012-01-01

RNA-sequencing and tailored bioinformatic methodologies have paved the way for identification of expressed fusion genes from the chaotic genomes of solid tumors. We have recently successfully exploited RNA-sequencing for the discovery of 24 novel fusion genes in breast cancer. Here, we demonstrate the importance of continuous optimization of the bioinformatic methodology for this purpose, and report the discovery and experimental validation of 13 additional fusion genes from the same samples. Integration of copy number profiling with the RNA-sequencing results revealed that the majority of the gene fusions were promoter-donating events that occurred at copy number transition points or involved high-level DNA-amplifications. Sequencing of genomic fusion break points confirmed that DNA-level rearrangements underlie selected fusion transcripts. Furthermore, a significant portion (>60%) of the fusion genes were alternatively spliced. This illustrates the importance of reanalyzing sequencing data as gene definitions change and bioinformatic methods improve, and highlights the previously unforeseen isoform diversity among fusion transcripts.

RELATIVE EXPRESSION AND STABILITY OF A CHROMOSOMALLY INTEGRATED AND PLASMID-BORNE MARKER GENE FUSION IN ENVIRONMENTALLY COMPETENT BACTERIA

EPA Science Inventory

A xyIE-iceC transcriptional fusion was created by ligating a DNA fragment harboring the cloned xyIE structural gene from the TOL plasmid of Pseudomonas putida mt-2 into the cloned iceC gene of Pseudomonas syringae Cit7. This fusion construct was integrated into chromosome of Pseu...

Pleiotropic biological activities of alternatively spliced TMPRSS2/ERG fusion gene transcripts

PubMed Central

Wang, Jianghua; Cai, Yi; Yu, Wendong; Ren, Chengxi; Spencer, David M.; Ittmann, Michael

2008-01-01

TMPRSS2/ERG gene fusions are found in the majority of prostate cancers; however, there is significant heterogeneity in the 5′ region of the alternatively spliced fusion gene transcripts. We have found that there is also significant heterogeneity within the coding exons as well. There is variable inclusion of a 72-bp exon and other novel alternatively spliced isoforms. To assess the biological significance of these alternatively spliced transcripts, we expressed various transcripts in primary prostatic epithelial cells and in an immortalized prostatic epithelial cell line, PNT1a. The fusion gene transcripts promoted proliferation, invasion and motility with variable activities that depended on the structure of the 5′ region encoding the TMPRSS2/ERG fusion and the presence of the 72-bp exon. Cotransfection of different isoforms further enhanced biological activity, mimicking the situation in vivo, in which multiple isoforms are expressed. Finally, knockdown of the fusion gene in VCaP cells resulted in inhibition of proliferation in vitro and tumor progression in an in vivo orthotopic mice model. Our results indicate that TMPRSS2/ERG fusion isoforms have variable biological activities promoting tumor initiation and progression and are consistent with our previous clinical observations indicating that certain TMPRSS2/ERG fusion isoforms are significantly correlated with more aggressive disease. PMID:18922926

Essential Role of DAP12 Signaling in Macrophage Programming into a Fusion-Competent State

PubMed Central

Helming, Laura; Tomasello, Elena; Kyriakides, Themis R.; Martinez, Fernando O.; Takai, Toshiyuki; Gordon, Siamon; Vivier, Eric

2009-01-01

Multinucleated giant cells, formed by fusion of macrophages, are a hallmark of granulomatous inflammation. With a genetic approach, we show that signaling through the adaptor protein DAP12 (DNAX activating protein of 12 kD), its associated receptor triggering receptor expressed by myeloid cells 2 (TREM-2), and the downstream protein tyrosine kinase Syk is required for the cytokine-induced formation of giant cells and that overexpression of DAP12 potentiates macrophage fusion. We also present evidence that DAP12 is a general macrophage fusion regulator and is involved in modulating the expression of several macrophage-associated genes, including those encoding known mediators of macrophage fusion, such as DC-STAMP and Cadherin 1. Thus, DAP12 is involved in programming of macrophages through the regulation of gene and protein expression to induce a fusion-competent state. PMID:18957693

A protein disulfide isomerase gene fusion expression system that increases the extracellular productivity of Bacillus brevis.

PubMed

Kajino, T; Ohto, C; Muramatsu, M; Obata, S; Udaka, S; Yamada, Y; Takahashi, H

2000-02-01

We have developed a versatile Bacillus brevis expression and secretion system based on the use of fungal protein disulfide isomerase (PDI) as a gene fusion partner. Fusion with PDI increased the extracellular production of heterologous proteins (light chain of immunoglobulin G, 8-fold; geranylgeranyl pyrophosphate synthase, 12-fold). Linkage to PDI prevented the aggregation of the secreted proteins, resulting in high-level accumulation of fusion proteins in soluble and biologically active forms. We also show that the disulfide isomerase activity of PDI in a fusion protein is responsible for the suppression of the aggregation of the protein with intradisulfide, whereas aggregation of the protein without intradisulfide was prevented even when the protein was fused to a mutant PDI whose two active sites were disrupted, suggesting that another PDI function, such as chaperone-like activity, synergistically prevented the aggregation of heterologous proteins in the PDI fusion expression system.

A Protein Disulfide Isomerase Gene Fusion Expression System That Increases the Extracellular Productivity of Bacillus brevis

PubMed Central

Kajino, Tsutomu; Ohto, Chikara; Muramatsu, Masayoshi; Obata, Shusei; Udaka, Shigezo; Yamada, Yukio; Takahashi, Haruo

2000-01-01

We have developed a versatile Bacillus brevis expression and secretion system based on the use of fungal protein disulfide isomerase (PDI) as a gene fusion partner. Fusion with PDI increased the extracellular production of heterologous proteins (light chain of immunoglobulin G, 8-fold; geranylgeranyl pyrophosphate synthase, 12-fold). Linkage to PDI prevented the aggregation of the secreted proteins, resulting in high-level accumulation of fusion proteins in soluble and biologically active forms. We also show that the disulfide isomerase activity of PDI in a fusion protein is responsible for the suppression of the aggregation of the protein with intradisulfide, whereas aggregation of the protein without intradisulfide was prevented even when the protein was fused to a mutant PDI whose two active sites were disrupted, suggesting that another PDI function, such as chaperone-like activity, synergistically prevented the aggregation of heterologous proteins in the PDI fusion expression system. PMID:10653729

The oncogenic gene fusion TMPRSS2: ERG is not a diagnostic or prognostic marker for ovarian cancer

PubMed Central

Huang, Lillian; Schauer, Isaiah G; Zhang, Jing; Mercado-Uribe, Imelda; Deavers, Michael T; Huang, Jiaoti; Liu, Jinsong

2011-01-01

TMPRSS2:ERG is a gene fusion resulting from the chromosomal rearrangement of the androgen-regulated TMPRSS2 gene and the ETS transcription factor ERG, leading to the over-expression of the oncogenic molecule ERG. This gene rearrangement has been found in approximately half of all prostate cancers and ERG overexpression is considered as a novel diagnostic marker for prostate carcinoma. However, little is known about the role of the TMPRSS2:ERG gene fusion in ovarian cancer. The purpose of this study was to test ERG expression in ovarian cancer and its potential as a diagnostic marker for ovarian carcinoma progression. A tissue microarray containing 180 ovarian cancer tissues of various pathological types and grades were examined by immunohistochemical analysis for expression of ERG. We also used 40 prostate carcinoma tissues and 40 normal tissues for comparison in parallel experiments. ERG-positive expression was detected in 40% of the prostate tumor cancer, as well as in internal positive control endothelial cells, confirming over-expression of ERG in prostate cancer at relatively the same rate observed by others. In contrast, all of the ovarian tumor patient tissues of varying histologic types were ERG-negative, despite some positivity in endothelial cells. These results suggest that the oncogenic gene fusion TMPRSS2:ERG does not occur in ovarian cancer relative to prostate cancer. Therefore, development of ERG expression profile would not be a useful diagnostic or prognostic marker for ovarian cancer patient screening. PMID:22076164

The oncogenic gene fusion TMPRSS2: ERG is not a diagnostic or prognostic marker for ovarian cancer.

PubMed

Huang, Lillian; Schauer, Isaiah G; Zhang, Jing; Mercado-Uribe, Imelda; Deavers, Michael T; Huang, Jiaoti; Liu, Jinsong

2011-01-01

TMPRSS2:ERG is a gene fusion resulting from the chromosomal rearrangement of the androgen-regulated TMPRSS2 gene and the ETS transcription factor ERG, leading to the over-expression of the oncogenic molecule ERG. This gene rearrangement has been found in approximately half of all prostate cancers and ERG overexpression is considered as a novel diagnostic marker for prostate carcinoma. However, little is known about the role of the TMPRSS2:ERG gene fusion in ovarian cancer. The purpose of this study was to test ERG expression in ovarian cancer and its potential as a diagnostic marker for ovarian carcinoma progression. A tissue microarray containing 180 ovarian cancer tissues of various pathological types and grades were examined by immunohistochemical analysis for expression of ERG. We also used 40 prostate carcinoma tissues and 40 normal tissues for comparison in parallel experiments. ERG-positive expression was detected in 40% of the prostate tumor cancer, as well as in internal positive control endothelial cells, confirming over-expression of ERG in prostate cancer at relatively the same rate observed by others. In contrast, all of the ovarian tumor patient tissues of varying histologic types were ERG-negative, despite some positivity in endothelial cells. These results suggest that the oncogenic gene fusion TMPRSS2:ERG does not occur in ovarian cancer relative to prostate cancer. Therefore, development of ERG expression profile would not be a useful diagnostic or prognostic marker for ovarian cancer patient screening.

Expression of the Pasteurella haemolytica leukotoxin is inhibited by a locus that encodes an ATP-binding cassette homolog.

PubMed Central

Highlander, S K; Wickersham, E A; Garza, O; Weinstock, G M

1993-01-01

Multicopy and single-copy chromosomal fusions between the Pasteurella haemolytica leukotoxin regulatory region and the Escherichia coli beta-galactosidase gene have been constructed. These fusions were used as reporters to identify and isolate regulators of leukotoxin expression from a P. haemolytica cosmid library. A cosmid clone, which inhibited leukotoxin expression from multicopy and single-copy protein fusions, was isolated and found to contain the complete leukotoxin gene cluster plus additional upstream sequences. The locus responsible for inhibition of expression from leukotoxin-beta-galactosidase fusions was mapped within these upstream sequences, by transposon mutagenesis with Tn5, and its DNA sequence was determined. The inhibitory activity was found to be associated with a predicted 440-amino-acid reading frame (lapA) that lies within a four-gene arginine transport locus. LapA is predicted to be the nucleotide-binding component of this transport system and shares homology with the Clp family of proteases. Images PMID:8359916

[Prokaryotic expression of trigeminy artificial fusion gene of Leptospira interrogans and the immunogenicity of its products].

PubMed

Luo, Dong-jiao; Qiu, Xiao-feng; Wang, Jiang; Yan, Jin; Wang, Hai-bin; Zhou, Jin-cheng; Yan, Jie

2008-11-01

To construct lipL32/1-lipL21-OmpL1/2 fusion gene of Leptospira interrogans and its prokaryotic expression system, and to identify the immunogenicity of its products. PCR using linking primers was applied to construct lipL32/1-lipL21-OmpL1/2 fusion gene and a prokaryotic expression system of the fusion gene was then established using routine genetic engineering technique. SDS-PAGE was used to examine output of the target recombinant protein rLipL32/1-LipL21-OmpL1/2. Double immunodiffusion and Western Blot assay were applied to identify immunogenicity of rLipL32/1-LipL21-OmpL1/2. lipL32/1-lipL21-OmpL1/2 fusion gene with correct sequence and its prokaryotic expression system E.coli BL21DE3pET42a-lipL32/1-lipL21-ompL1/2 was obtained in this study. The output of rLipL32/1-LipL21- OmpL1/2 after optimisation was 37.78 mg/L. The immunodiffusion titer of rabbit antiserum against rLipL32/1-LipL21-OmpL1/2 was 1:4. The rLipL32/1-LipL21-OmpL1/2 antiserum was able to recognize rLipL32/1-LipL21-OmpL1/2, rLipL32/1, rLipL21 and rOmpL1/2. Positive Western hybridization signals were found among rLipL32/1-LipL21-OmpL1/2 and rabbit antiserum against whole cell of strain 56601 and serum from patients infected with L.interrogans serogroups Icterohaemorrhagiae, Grippotyphosa, Autumnalis and Pomona. The fusion gene lipL32/1-lipL21-OmpL1/2 and its prokaryotic expression system were successfully constructed in this study. The expressed fusion protein can be used as the antigen for developing universal genetic engineering vaccine and universal serological tests of leptospirosis.

Reprogramming of somatic cells induced by fusion of embryonic stem cells using hemagglutinating virus of Japan envelope (HVJ-E)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yue, Xiao-shan; Department of Biomolecular Engineering, Graduate School of Bioscience and Technology, Tokyo Institute of Technology, Nagatsuta-cho, Midori-ku, Yokohama-shi, Kanagawa 226-8501; Fujishiro, Masako

In this research, hemagglutinating virus of Japan envelope (HVJ-E) was used to reprogram somatic cells by fusion with mouse embryonic stem (ES) cells. Neomycin-resistant mouse embryonic fibroblasts (MEFs) were used as somatic cells. Nanog-overexpressing puromycin-resistant EB3 cells were used as mouse ES cells. These two cells were fused by exposing to HVJ-E and the generated fusion cells were selected by puromycin and G418 to get the stable fusion cell line. The fusion cells form colonies in feeder-free culture system. Microsatellite analysis of the fusion cells showed that they possessed genes from both ES cells and fibroblasts. The fusion cells weremore » tetraploid, had alkali phosphatase activity, and expressed stem cell marker genes such as Pou5f1, Nanog, and Sox2, but not the fibroblast cell marker genes such as Col1a1 and Col1a2. The pluripotency of fusion cells was confirmed by their expression of marker genes for all the three germ layers after differentiation induction, and by their ability to form teratoma which contained all the three primary layers. Our results show that HVJ-E can be used as a fusion reagent for reprogramming of somatic cells.« less

[Transformation of antimicrobial peptide fusion gene of cecropin B and rabbit NP-1 to Houttuynia cordata].

PubMed

Dong, Yan; Zhang, Ying; Yi, Lang; Lai, Huili; Zhang, Yaming; Zhou, Lian; Wang, Peixun

2010-07-01

To transform the antimicrobial peptide fusion gene of cecropin B and rabbit NP-1(CN) into Houttuynia cordata to improve its antimicrobic capability. The fusion gene of CN designed and synthesized artificially was recombined with expression vector pBI121. The recombined vector was transformed to Agrobacterium tumefaciens LBA4404, by which CN gene was transformed to the explants of H. cordata. The transgenic regeneration plantlets were selected by kanamycin and rapid screening PCR. The transgenic plants were identified by PCR-Southern of genomic DNA and RT-PCR. The disease resistances were detected by antibacterial zone trail of leaf extracts to E. coli K12 and infection by Rhizoctonia solani. Gene of interesting CN was inserted into genomic DNA and expressed in transformed H, cordata, whose resistance to E. coli K12 and Rh. solani was stronger than that of the non-transformed control. The fusion gene CN can improve antimicrobic capability of transformed H. cordata.

Expression of the homeotic gene mab-5 during Caenorhabditis elegans embryogenesis.

PubMed

Cowing, D W; Kenyon, C

1992-10-01

mab-5 is a member of a complex of homeobox-containing genes evolutionarily related to the Antennapedia and bithorax complexes of Drosophila melanogaster. Like the homeotic genes in Drosophila, mab-5 is required in a particular region along the anterior-posterior body axis, and acts during postembryonic development to give cells in this region their characteristic identities. We have used a mab-5-lacZ fusion integrated into the C. elegans genome to study the posterior-specific expression of mab-5 during embryogenesis. The mab-5-lacZ fusion was expressed in the posterior of the embryo by 180 minutes after the first cleavage, indicating that the mechanisms responsible for the position-specific expression of mab-5-lacZ act at a relatively early stage of embryogenesis. In embryos homozygous for mutations in the par genes, which disrupt segregation of factors during early cleavages, expression of mab-5-lacZ was no longer localized to the posterior. This suggests that posterior-specific expression of mab-5 depends on the appropriate segregation of developmental factors during early embryogenesis. After extrusion of any blastomere of the four-cell embryo, descendants of the remaining three cells could still express the mab-5-lacZ fusion. In these partial embryos, however, the fusion was often expressed in cells scattered throughout the embryo, suggesting that cell-cell interactions and/or proper positioning of early blastomeres are required for mab-5 expression to be localized to the posterior.

Identifying transposon insertions and their effects from RNA-sequencing data.

PubMed

de Ruiter, Julian R; Kas, Sjors M; Schut, Eva; Adams, David J; Koudijs, Marco J; Wessels, Lodewyk F A; Jonkers, Jos

2017-07-07

Insertional mutagenesis using engineered transposons is a potent forward genetic screening technique used to identify cancer genes in mouse model systems. In the analysis of these screens, transposon insertion sites are typically identified by targeted DNA-sequencing and subsequently assigned to predicted target genes using heuristics. As such, these approaches provide no direct evidence that insertions actually affect their predicted targets or how transcripts of these genes are affected. To address this, we developed IM-Fusion, an approach that identifies insertion sites from gene-transposon fusions in standard single- and paired-end RNA-sequencing data. We demonstrate IM-Fusion on two separate transposon screens of 123 mammary tumors and 20 B-cell acute lymphoblastic leukemias, respectively. We show that IM-Fusion accurately identifies transposon insertions and their true target genes. Furthermore, by combining the identified insertion sites with expression quantification, we show that we can determine the effect of a transposon insertion on its target gene(s) and prioritize insertions that have a significant effect on expression. We expect that IM-Fusion will significantly enhance the accuracy of cancer gene discovery in forward genetic screens and provide initial insight into the biological effects of insertions on candidate cancer genes. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Coordinate Intracellular Expression of Salmonella Genes Induced during Infection

PubMed Central

Heithoff, Douglas M.; Conner, Christopher P.; Hentschel, Ute; Govantes, Fernando; Hanna, Philip C.; Mahan, Michael J.

1999-01-01

Salmonella typhimurium in vivo-induced (ivi) genes were grouped by their coordinate behavior in response to a wide variety of environmental and genetic signals, including pH, Mg2+, Fe2+, and PhoPQ. All of the seven ivi fusions that are induced by both low pH and low Mg2+ (e.g., iviVI-A) are activated by the PhoPQ regulatory system. Iron-responsive ivi fusions include those induced under iron limitation (e.g., entF) as well as one induced by iron excess but only in the absence of PhoP (pdu). Intracellular expression studies showed that each of the pH- and Mg2+-responsive fusions is induced upon entry into and growth within three distinct mammalian cell lines: RAW 264.7 murine macrophages and two cultured human epithelial cell lines: HEp-2 and Henle-407. Each ivi fusion has a characteristic level of induction consistent within all three cell types, suggesting that this class of coordinately expressed ivi genes responds to general intracellular signals that are present both in initial and in progressive stages of infection and may reflect their responses to similar vacuolar microenvironments in these cell types. Investigation of ivi expression patterns reveals not only the inherent versatility of pathogens to express a given gene(s) at various host sites but also the ability to modify their expression within the context of different animal hosts, tissues, cell types, or subcellular compartments. PMID:9922242

Clinical Application of Prognostic Gene Expression Signature in Fusion Gene-Negative Rhabdomyosarcoma: A Report from the Children's Oncology Group.

PubMed

Hingorani, Pooja; Missiaglia, Edoardo; Shipley, Janet; Anderson, James R; Triche, Timothy J; Delorenzi, Mauro; Gastier-Foster, Julie; Wing, Michele; Hawkins, Douglas S; Skapek, Stephen X

2015-10-15

Pediatric rhabdomyosarcoma (RMS) has two common histologic subtypes: embryonal (ERMS) and alveolar (ARMS). PAX-FOXO1 fusion gene status is a more reliable prognostic marker than alveolar histology, whereas fusion gene-negative (FN) ARMS patients are clinically similar to ERMS patients. A five-gene expression signature (MG5) previously identified two diverse risk groups within the fusion gene-negative RMS (FN-RMS) patients, but this has not been independently validated. The goal of this study was to test whether expression of the MG5 metagene, measured using a technical platform that can be applied to routine pathology material, would correlate with outcome in a new cohort of patients with FN-RMS. Cases were taken from the Children's Oncology Group (COG) D9803 study of children with intermediate-risk RMS, and gene expression profiling for the MG5 genes was performed using the nCounter assay. The MG5 score was correlated with clinical and pathologic characteristics as well as overall and event-free survival. MG5 standardized score showed no significant association with any of the available clinicopathologic variables. The MG5 signature score showed a significant correlation with overall (N = 57; HR, 7.3; 95% CI, 1.9-27.0; P = 0.003) and failure-free survival (N = 57; HR, 6.1; 95% CI, 1.9-19.7; P = 0.002). This represents the first, validated molecular prognostic signature for children with FN-RMS who otherwise have intermediate-risk disease. The capacity to measure the expression of a small number of genes in routine pathology material and apply a simple mathematical formula to calculate the MG5 metagene score provides a clear path toward better risk stratification in future prospective clinical trials. ©2015 American Association for Cancer Research.

Translocations in epithelial cancers

PubMed Central

Chad Brenner, J.; Chinnaiyan, Arul M.

2009-01-01

Genomic translocations leading to the expression of chimeric transcripts characterize several hematologic, mesenchymal and epithelial malignancies. While several gene fusions have been linked to essential molecular events in hematologic malignancies, the identification and characterization of recurrent chimeric transcripts in epithelial cancers has been limited. However, the recent discovery of the recurrent gene fusions in prostate cancer has sparked a revitalization of the quest to identify novel rearrangements in epithelial malignancies. Here, the molecular mechanisms of gene fusions that drive several epithelial cancers and the recent technological advances that increase the speed and reliability of recurrent gene fusion discovery are explored. PMID:19406209

Gene trapping in differentiating cell lines: regulation of the lysosomal protease cathepsin B in skeletal myoblast growth and fusion.

PubMed

Gogos, J A; Thompson, R; Lowry, W; Sloane, B F; Weintraub, H; Horwitz, M

1996-08-01

To identify genes regulated during skeletal muscle differentiation, we have infected mouse C2C12 myoblasts with retroviral gene trap vectors, containing a promoterless marker gene with a 5' splice acceptor signal. Integration of the vector adjacent to an actively transcribed gene places the marker under the transcriptional control of the endogenous gene, while the adjacent vector sequences facilitate cloning. The vector insertionally mutates the trapped locus and may also form fusion proteins with the endogenous gene product. We have screened several hundred clones, each containing a trapping vector integrated into a different endogenous gene. In agreement with previous estimates based on hybridization kinetics, we find that a large proportion of all genes expressed in myoblasts are regulated during differentiation. Many of these genes undergo unique temporal patterns of activation or repression during cell growth and myotube formation, and some show specific patterns of subcellular localization. The first gene we have identified with this strategy is the lysosomal cysteine protease cathepsin B. Expression from the trapped allele is upregulated during early myoblast fusion and downregulated in myotubes. A direct role for cathepsin B in myoblast growth and fusion is suggested by the observation that the trapped cells deficient in cathepsin B activity have an unusual morphology and reduced survival in low-serum media and undergo differentiation with impaired cellular fusion. The phenotype is reproduced by antisense cathepsin B expression in parental C2C12 myoblasts. The cellular phenotype is similar to that observed in cultured myoblasts from patients with I cell disease, in which there is diminished accumulation of lysosomal enzymes. This suggests that a specific deficiency of cathepsin B could contribute to the myopathic component of this illness.

Detection of osteoclastic cell-cell fusion through retroviral vector packaging.

PubMed

Kondo, Takako; Ikeda, Kyoji; Matsuo, Koichi

2004-11-01

Cell-cell fusion generates multinucleated cells such as osteoclasts in bone, myotubes in muscle, and trophoblasts in placenta. Molecular details governing these fusion processes are still largely unknown. As a step toward identification of fusogenic genes, we tested the concept that retroviral vectors can be packaged as a result of cell-cell fusion. First, we introduced replication-deficient retroviral vectors expressing mCAT-1, which mediates fusogenic interaction with the retroviral envelope protein Env, into Chinese hamster ovary (CHO) cells to generate vector cells. Plasmids expressing virion proteins Gag, Pol, and Env were introduced into a separate culture of CHO cells to generate packaging cells. Co-culturing vector and packaging cells resulted in production of infectious retroviruses carrying the mCAT-1 gene as a consequence of cell-cell fusion. Second, we introduced a retroviral vector into primary osteoclast precursors and co-cultured them with established osteoclast precursor RAW264.7 cells, which turned out to harbor packaging activity. Packaged retroviral vector was detected in culture supernatants only where the osteoclast differentiation factor receptor activator for NF-kappaB ligand (RANKL) induced fusion between these two cell types. These data suggest that retrovirus production can occur as a result of cell-cell fusion. This provides a novel approach for isolating and characterizing fusogenic genes using retroviral expression vectors.

[Analysis of EML4-ALK gene fusion mutation in patients 
with non-small cell lung cancer].

PubMed

Wang, Xuzhou; Chen, Weisheng; Yu, Yinghao

2015-02-01

Non-small cell lung cancer (NSCLC) is the main type of lung cancer, and the related locus mutation detection research has become a hot direction of molecular targeted therapy, studying on gene mutation status of echinodem microtubule associated protein like 4-Anaplastic lymphoma kinase (EML4-ALK) and epidermal growth factor receptor (EGFR), detecting the sensitivity of EML4-ALK gene fusion and gene mutation of EGFR. EML4-ALK gene fusion in 85 cases of paraffin embedded tumor tissue and adjacent lung tissue was detected with the application of immunohistochemistry (IHC), Scorpions amplification refractory mutation system (Scorpions ARMS) fluorescence quantitative PCR and fluorescence in situ hybridization (FISH) technology, and EGFR gene in 18, 19, 20 and 21 exon mutation status was detected with the application of ARMS method. In 115 cases of NSCLC, IHC showed 32 cases with ALK (D5F3) expression, the expression rate was 27.8%; ARMS showed 27 cases with EML4-ALK fusion gene mutation, the mutation detection rate was 23.5%; 53 cases were detected with EGFR mutation, the mutation rate was 46%. While FISH showed 23 cases with EML4-ALK fusion gene mutation, the detection rate was 20%, slightly lower than the ARMS detection results, suggesting that ARMS more sensitive. The application of IHC, ARMS fluorescence quantitative PCR and FISH technology can make a rapid and accurate evaluation of EML4-ALK gene fusion.

Glioma stem cells targeted by oncolytic virus carrying endostatin-angiostatin fusion gene and the expression of its exogenous gene in vitro.

PubMed

Zhu, Guidong; Su, Wei; Jin, Guishan; Xu, Fujian; Hao, Shuyu; Guan, Fangxia; Jia, William; Liu, Fusheng

2011-05-16

The development of the cancer stem cell (CSCs) niche theory has provided a new target for the treatment of gliomas. Gene therapy using oncolytic viral vectors has shown great potential for the therapeutic targeting of CSCs. To explore whether a viral vector carrying an exogenous Endo-Angio fusion gene (VAE) can infect and kill glioma stem cells (GSCs), as well as inhibit their vascular niche in vitro, we have collected surgical specimens of human high-grade glioma (world health organization, WHO Classes III-VI) from which we isolated and cultured GSCs under conditions originally designed for the selective expansion of neural stem cells. Our results demonstrate the following: (1) Four lines of GSCs (isolated from 20 surgical specimens) could grow in suspension, were multipotent, had the ability to self-renew and expressed the neural stem cell markers, CD133 and nestin. (2) VAE could infect GSCs and significantly inhibit their viability. (3) The Endo-Angio fusion gene was expressed in GSCs 48 h after VAE infection and could inhibit the proliferation of human brain microvascular endothelial cells (HBMEC). (4) Residual viable cells lose the ability of self-renewal and adherent differentiation. In conclusion, VAE can significantly inhibit the activity of GSCs in vitro and the expression of exogenous Endo-Angio fusion gene can inhibit HBMEC proliferation. VAE can be used as a novel virus-gene therapy strategy for glioma. Copyright © 2011 Elsevier B.V. All rights reserved.

[Construction and expression of a fusion protein made of tissue-type plasminogen activator and hirudin in Pichia pastoris].

PubMed

Yu, Ai-Ping; Shi, Bing-Xing; Dong, Chun-Na; Jiang, Zhong-Hua; Wu, Zu-Ze

2005-07-01

To combine the fibrinolytic with anticoagulant activities for therapy of thrombotic deseases, a fusion protein made of tissue-type plasminogen activator (t-PA) and hirudin was constructed and expressed in chia pastoris. To improve thrombolytic properties of t-PA and reduce bleeding side effect of hirudin, FXa-recognition sequence was introduced between t-PA and hirudin molecules.The anticoagulant activity of hirudin can be target-released through cleavage of FXa at thrombus site. t-PA gene and hirudin gene with FXa-recognition sequence at its 5'-terminal were obtained by RT-PCR and PCR respectively. The fusion protein gene was cloned into plasmid pIC9K and electroporated into the genome of Pichia pastoris GS115. The expression of fusion protein was induced by methanol in shaking flask and secreted into the culture medium. Two forms of the fusion protein, single-chain and double-chain linked by a disulfide bond (due to the cleveage of t-PA at Arg275-Ile276), were obtained. The intact fusion protein retained the fibrinolytic activity but lacked any anticoagulant activity. After cleavage by FXa, the fusion protein liberated intact free hirudin to exert its anticoagulant activity. So, the fusion protein is a bifunctional molecule having good prospect to develop into a new targeted therapeutic agent with reduced bleeding side effect for thrombotic diseases.

Junction region of EWS-FLI1 fusion protein has a dominant negative effect in Ewing's sarcoma in vitro.

PubMed

Jully, Babu; Vijayalakshmi, Ramshankar; Gopal, Gopisetty; Sabitha, Kesavan; Rajkumar, Thangarajan

2012-11-12

Ewing's sarcoma is a malignancy characterized by a specific 11:22 chromosomal translocation which generates a novel EWS-FLI1 fusion protein functioning as an aberrant transcription factor. In the present study, we have further characterized the junction region of the EWS-FLI1 fusion protein. In-silico model of EWS-FLI1 fusion protein was analysed for ligand binding sites, and a putative region (amino acid (aa) 251-343 of the type 1 fusion protein) in the vicinity of the fusion junction was cloned and expressed using bacterial expression. The recombinant protein was characterized by Circular Dichroism (CD). We then expressed aa 251-280 ectopically in Ewing's sarcoma cell-line and its effect on cell proliferation, tumorigenicity and expression of EWS-FLI1 target genes were analysed. Our modelling analysis indicated that Junction region (aa 251-343) encompasses potential ligand biding sites in the EWS-FLI1 protein and when expressed in bacteria was present as soluble form. Ectopically expressing this region in Ewing's sarcoma cells inhibited tumorigenicity, and EWS-FLI1 target genes indicating a dominant negative biological effect. Junction region can be exploited further as target for drug development in future to specifically target EWS-FLI1 in Ewing's Sarcoma.

Fusion with stem cell makes the hepatocellular carcinoma cells similar to liver tumor-initiating cells.

PubMed

Wang, Ran; Chen, Shuxun; Li, Changxian; Ng, Kevin Tak Pan; Kong, Chi-wing; Cheng, Jinping; Cheng, Shuk Han; Li, Ronald A; Lo, Chung Mau; Man, Kwan; Sun, Dong

2016-02-04

Cell fusion is a fast and highly efficient technique for cells to acquire new properties. The fusion of somatic cells with stem cells can reprogram somatic cells to a pluripotent state. Our research on the fusion of stem cells and cancer cells demonstrates that the fused cells can exhibit stemness and cancer cell-like characteristics. Thus, tumor-initiating cell-like cells are generated. We employed laser-induced single-cell fusion technique to fuse the hepatocellular carcinoma cells and human embryonic stem cells (hESC). Real-time RT-PCR, flow cytometry and in vivo tumorigenicity assay were adopted to identify the gene expression difference. We successfully produced a fused cell line that coalesces the gene expression information of hepatocellular carcinoma cells and stem cells. Experimental results showed that the fused cells expressed cancer and stemness markers as well as exhibited increased resistance to drug treatment and enhanced tumorigenesis. Fusion with stem cells transforms liver cancer cells into tumor initiating-like cells. Results indicate that fusion between cancer cell and stem cell may generate tumor initiating-like cells.

[Prokaryotic expression of Nanog gene and preparation of anti-Nanog antibody].

PubMed

Li, Jun; Wang, Xiao-min; Dou, Zhong-ying; Li, Yong

2012-07-01

To express Nanog fusion protein in Escherichia coli ( E.coli), and to prepare rabbit anti-mouse polyclonal antibodies to the Nanog fusion protein. Mouse Nanog gene was amplified from the pNA992 recombinant plasmid and inserted into pET-32a vector to construct a recombinant expression vector pET-32a-Nanog. The recombinant vector was transfected into E.coli BL21 and induced by IPTG to express in them. The acquired Nanog fusion protein was purified with HisTrap affinity column and injected as an antigen into rabbits for preparing polyclonal antibodies. At last, the titer and specificity of the polyclonal antibodies were analyzed with indirect ELISA, Western blotting and immunocytochemical staining, respectively. The recombinant expression vector pET-32a-Nanog was successfully prepared, transfected and induced to obtain the high expression of the Nanog fusion protein in a form of inclusion bodies in E.coli. After purification, its purity was up to 97%. The titer of anti-Nanog antibodies was 1:32 000 in the immunized rabbit serum, and exhibited a high specificity to Nanog protein. The rabbit anti-mouse polyclonal antibodies have been prepared successfully with a high titer and specificity to the Nanog fusion protein.

Organization of tcp, acf, and toxT genes within a ToxT-dependent operon.

PubMed

Brown, R C; Taylor, R K

1995-05-01

The toxin coregulated pilus (TCP) is required for Vibrio cholerae to colonize the human intestine. The expression of the pilin gene, tcpA, is dependent upon ToxR and upon ToxT. The toxT gene was recently mapped within the TCP biogenesis gene cluster and shown to be capable of activating a tcpA::TnphoA fusion when cloned in Escherichia coli. In this study, we determined that ToxR/ToxT activation occurs at the level of tcpA transcription. ToxT expressed in E. coli could activate a tcp operon fusion, while ToxR, ToxR with ToxS, or a ToxR-PhoA fusion failed to activate the tcp operon fusion and we could not demonstrate binding of a ToxR extract to the tcpA promoter region in DNA mobility-shift assays. The start site for the regulated promoter was shown by primer extension to lie 75 bp upstream of the first codon of tcpA. An 800-base tcpA message was identified, by Northern analysis, that correlates by size to the distance between the transcriptional start and a hairpin-loop sequence between tcpA and tcpB. The more-sensitive assay of RNase protection analysis demonstrated that a regulated transcript probably extends through the rest of the downstream tcp genes, including toxT and the adjacent accessory colonization factor (acf) genes. An in-frame tcpA deletion, but not a polar tcpA::TnphoA fusion, could be complemented for pilus surface expression by providing tcpA in trans. This evidence suggests that the tcp genes, including toxT, are organized in an operon directly activated by ToxT in a ToxR-dependent manner. Most of the toxT expression under induced conditions requires transcription of the tcpA promoter. Further investigation of how tcp::TnphoA insertions that are polar on toxT expression retain regulation showed that a low basal level of toxT expression is present in toxR and tcp::TnphoA strains. Overall, these observations support the ToxR/ToxT cascade of regulation for tcp. Once induced, toxT expression becomes autoregulatory via the tcp promoter, linking tcp expression to that of additional colonization factors, exotoxin production, and genes of unknown function in cholera pathogenesis.

The recombinant expression and activity detection of MAF-1 fusion protein.

PubMed

Fu, Ping; Wu, Jianwei; Gao, Song; Guo, Guo; Zhang, Yong; Liu, Jian

2015-10-01

This study establishes the recombinant expression system of MAF-1 (Musca domestica antifungal peptide-1) and demonstrates the antifungal activity of the expression product and shows the relationship between biological activity and structure. The gene segments on mature peptide part of MAF-1 were cloned, based on the primers designed according to the cDNA sequence of MAF-1. We constructed the recombinant prokaryotic expression plasmid using prokaryotic expression vector (pET-28a(+)) and converted it to the competent cell of BL21(DE3) to gain recombinant MAF-1 fusion protein with His tag sequence through purifying affinity chromatographic column of Ni-NTA. To conduct the Western Blotting test, recombinant MAF-1 fusion protein was used to produce the polyclonal antibody of rat. The antifungal activity of the expression product was detected using Candida albicans (ATCC10231) as the indicator. The MAF-1 recombinant fusion protein was purified to exhibit obvious antifungal activity, which lays the foundation for the further study of MAF-1 biological activity, the relationship between structure and function, as well as control of gene expression.

Dominant positive and negative selection using a hygromycin phosphotransferase-thymidine kinase fusion gene.

PubMed

Lupton, S D; Brunton, L L; Kalberg, V A; Overell, R W

1991-06-01

The hygromycin phosphotransferase gene was fused in-frame with the herpes simplex virus type 1 thymidine kinase gene. The resulting fusion gene (termed HyTK) confers hygromycin B resistance for dominant positive selection and ganciclovir sensitivity for negative selection and provides a means by which these selectable phenotypes may be expressed and regulated as a single genetic entity.

Identification of ETV6-RUNX1-like and DUX4-rearranged subtypes in paediatric B-cell precursor acute lymphoblastic leukaemia.

PubMed

Lilljebjörn, Henrik; Henningsson, Rasmus; Hyrenius-Wittsten, Axel; Olsson, Linda; Orsmark-Pietras, Christina; von Palffy, Sofia; Askmyr, Maria; Rissler, Marianne; Schrappe, Martin; Cario, Gunnar; Castor, Anders; Pronk, Cornelis J H; Behrendtz, Mikael; Mitelman, Felix; Johansson, Bertil; Paulsson, Kajsa; Andersson, Anna K; Fontes, Magnus; Fioretos, Thoas

2016-06-06

Fusion genes are potent driver mutations in cancer. In this study, we delineate the fusion gene landscape in a consecutive series of 195 paediatric B-cell precursor acute lymphoblastic leukaemia (BCP ALL). Using RNA sequencing, we find in-frame fusion genes in 127 (65%) cases, including 27 novel fusions. We describe a subtype characterized by recurrent IGH-DUX4 or ERG-DUX4 fusions, representing 4% of cases, leading to overexpression of DUX4 and frequently co-occurring with intragenic ERG deletions. Furthermore, we identify a subtype characterized by an ETV6-RUNX1-like gene-expression profile and coexisting ETV6 and IKZF1 alterations. Thus, this study provides a detailed overview of fusion genes in paediatric BCP ALL and adds new pathogenetic insights, which may improve risk stratification and provide therapeutic options for this disease.

Bone marrow mesenchymal stem cells from infants with MLL-AF4+ acute leukemia harbor and express the MLL-AF4 fusion gene

PubMed Central

Catalina, Purificación; Rodríguez, René; Melen, Gustavo J.; Bueno, Clara; Arriero, Mar; García-Sánchez, Félix; Lassaletta, Alvaro; García-Sanz, Ramón

2009-01-01

MLL-AF4 fusion is a hallmark genetic abnormality in infant B-acute lymphoblastic leukemia (B-ALL) known to arise in utero. The cellular origin of leukemic fusion genes during human development is difficult to ascertain. The bone marrow (BM) microenvironment plays an important role in the pathogenesis of several hematological malignances. BM mesenchymal stem cells (BM-MSC) from 38 children diagnosed with cytogenetically different acute leukemias were screened for leukemic fusion genes. Fusion genes were absent in BM-MSCs of childhood leukemias carrying TEL-AML1, BCR-ABL, AML1-ETO, MLL-AF9, MLL-AF10, MLL-ENL or hyperdiploidy. However, MLL-AF4 was detected and expressed in BM-MSCs from all cases of MLL-AF4+ B-ALL. Unlike leukemic blasts, MLL-AF4+ BM-MSCs did not display monoclonal Ig gene rearrangements. Endogenous or ectopic expression of MLL-AF4 exerted no effect on MSC culture homeostasis. These findings suggest that MSCs may be in part tumor-related, highlighting an unrecognized role of the BM milieu on the pathogenesis of MLL-AF4+ B-ALL. MLL-AF4 itself is not sufficient for MSC transformation and the expression of MLL-AF4 in MSCs is compatible with a mesenchymal phenotype, suggesting a differential impact in the hematopoietic system and mesenchyme. The absence of monoclonal rearrangements in MLL-AF4+ BM-MSCs precludes the possibility of cellular plasticity or de-differentiation of B-ALL blasts and suggests that MLL-AF4 might arise in a population of prehematopoietic precursors. PMID:19995953

2A self-cleaving peptide-based multi-gene expression system in the silkworm Bombyx mori

PubMed Central

Wang, Yuancheng; Wang, Feng; Wang, Riyuan; Zhao, Ping; Xia, Qingyou

2015-01-01

Fundamental and applied studies of silkworms have entered the functional genomics era. Here, we report a multi-gene expression system (MGES) based on 2A self-cleaving peptide (2A), which regulates the simultaneous expression and cleavage of multiple gene targets in the silk gland of transgenic silkworms. First, a glycine-serine-glycine spacer (GSG) was found to significantly improve the cleavage efficiency of 2A. Then, the cleavage efficiency of six types of 2As with GSG was analyzed. The shortest porcine teschovirus-1 2A (P2A-GSG) exhibited the highest cleavage efficiency in all insect cell lines that we tested. Next, P2A-GSG successfully cleaved the artificial human serum albumin (66 kDa) linked with human acidic fibroblast growth factor (20.2 kDa) fusion genes and vitellogenin receptor fragment (196 kD) of silkworm linked with EGFP fusion genes, importantly, vitellogenin receptor protein was secreted to the outside of cells. Furthermore, P2A-GSG successfully mediated the simultaneous expression and cleavage of a DsRed and EGFP fusion gene in silk glands and caused secretion into the cocoon of transgenic silkworms using our sericin1 expression system. We predicted that the MGES would be an efficient tool for gene function research and innovative research on various functional silk materials in medicine, cosmetics, and other biomedical areas. PMID:26537835

Antibody-independent Targeted Quantification of TMPRSS2-ERG Fusion Protein Products in Prostate Cancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

He, Jintang; Sun, Xuefei; Shi, Tujin

2014-10-01

Fusions between the transmembrane protease serine 2 (TMPRSS2) and ETS related gene (ERG) represent one of the most specific biomarkers that define a distinct molecular subtype of prostate cancer. The studies on TMPRSS2-ERG gene fusions have seldom been performed at the protein level, primarily due to the lack of high-quality antibodies or an antibody-independent method that is sufficiently sensitive for detecting the truncated ERG protein products resulting from TMPRSS2-ERG gene fusions and alternative splicing. Herein, we applied a recently developed PRISM (high-pressure high-resolution separations with intelligent selection and multiplexing)-SRM (selected reaction monitoring) strategy for quantifying ERG protein in prostate cancermore » cell lines and tumors. The highly sensitive PRISM-SRM assays led to confident detection of 6 unique ERG peptides in either the TMPRSS2-ERG positive cell lines or tissues but not in the negative controls, indicating that ERG protein expression is highly correlated with TMPRSS2-ERG gene rearrangements. Significantly, our results demonstrated for the first time that at least two groups of ERG protein isoforms were simultaneously expressed at variable levels in TMPRSS2-ERG positive samples as evidenced by concomitant detection of two mutually exclusive peptides. Three peptides shared across almost all fusion protein products were determined to be the most abundant peptides, and hence can be used as “signature” peptides for detecting ERG overexpression resulting from TMPRSS2-ERG gene fusion. These PRISM-SRM assays provide valuable tools for studying TMPRSS2-ERG gene fusion protein products, thus improving our understanding of the role of TMPRSS2-ERG gene fusion in the biology of prostate cancer.« less

Positive regulation of Leptospira interrogans kdp expression by KdpE as Demonstrated with a novel β-galactosidase reporter in Leptospira biflexa.

PubMed

Matsunaga, James; Coutinho, Mariana L

2012-08-01

Leptospirosis is a potentially deadly zoonotic disease that afflicts humans and animals. Leptospira interrogans, the predominant agent of leptospirosis, encounters diverse conditions as it proceeds through its life cycle, which includes stages inside and outside the host. Unfortunately, the number of genetic tools available for examining the regulation of gene expression in L. interrogans is limited. Consequently, little is known about the genetic circuits that control gene expression in Leptospira. To better understand the regulation of leptospiral gene expression, the L. interrogans kdp locus, encoding homologs of the P-type ATPase KdpABC potassium transporter with their KdpD sensors and KdpE response regulators, was selected for analysis. We showed that a kdpE mutation in L. interrogans prevented the increase in kdpABC mRNA levels observed in the wild-type L. interrogans strain when external potassium levels were low. To confirm that KdpE was a positive regulator of kdpABC transcription, we developed a novel approach for constructing chromosomal genetic fusions to the endogenous bgaL (β-galactosidase) gene of the nonpathogen Leptospira biflexa. We demonstrated positive regulation of a kdpA'-bgaL fusion in L. biflexa by the L. interrogans KdpE response regulator. A control lipL32'-bgaL fusion was not regulated by KdpE. These results demonstrate the utility of genetic fusions to the bgaL gene of L. biflexa for examining leptospiral gene regulation.

Comprehensive analysis of the MYB-NFIB gene fusion in salivary adenoid cystic carcinoma: Incidence, variability, and clinicopathologic significance.

PubMed

Mitani, Yoshitsugu; Li, Jie; Rao, Pulivarthi H; Zhao, Yi-Jue; Bell, Diana; Lippman, Scott M; Weber, Randal S; Caulin, Carlos; El-Naggar, Adel K

2010-10-01

The objectives of this study were to determine the incidence of the MYB-NFIB fusion in salivary adenoid cystic carcinoma (ACC), to establish the clinicopathologic significance of the fusion, and to analyze the expression of MYB in ACCs in the context of the MYB-NFIB fusion. We did an extensive analysis involving 123 cancers of the salivary gland, including primary and metastatic ACCs, and non-ACC salivary carcinomas. MYB-NFIB fusions were identified by reverse transcriptase-PCR (RT-PCR) and sequencing of the RT-PCR products, and confirmed by fluorescence in situ hybridization. MYB RNA expression was determined by quantitative RT-PCR and protein expression was analyzed by immunohistochemistry. The MYB-NFIB fusion was detected in 28% primary and 35% metastatic ACCs, but not in any of the non-ACC salivary carcinomas analyzed. Different exons in both the MYB and NFIB genes were involved in the fusions, resulting in expression of multiple chimeric variants. Notably, MYB was overexpressed in the vast majority of the ACCs, although MYB expression was significantly higher in tumors carrying the MYB-NFIB fusion. The presence of the MYB-NFIB fusion was significantly associated (P = 0.03) with patients older than 50 years of age. No correlation with other clinicopathologic markers, factors, and survival was found. We conclude that the MYB-NFIB fusion characterizes a subset of ACCs and contributes to MYB overexpression. Additional mechanisms may be involved in MYB overexpression in ACCs lacking the MYB-NFIB fusion. These findings suggest that MYB may be a specific novel target for tumor intervention in patients with ACC. ©2010 AACR.

Reconstitution of the ERG Gene Expression Network Reveals New Biomarkers and Therapeutic Targets in ERG Positive Prostate Tumors

PubMed Central

Dubovenko, Alexey; Serebryiskaya, Tatiana; Nikolsky, Yuri; Nikolskaya, Tatiana; Perlina, Ally; JeBailey, Lellean; Bureeva, Svetlana; Katta, Shilpa; Srivastava, Shiv; Dobi, Albert; Khasanova, Tatiana

2015-01-01

Background: Despite a growing number of studies evaluating cancer of prostate (CaP) specific gene alterations, oncogenic activation of the ETS Related Gene (ERG) by gene fusions remains the most validated cancer gene alteration in CaP. Prevalent gene fusions have been described between the ERG gene and promoter upstream sequences of androgen-inducible genes, predominantly TMPRSS2 (transmembrane protease serine 2). Despite the extensive evaluations of ERG genomic rearrangements, fusion transcripts and the ERG oncoprotein, the prognostic value of ERG remains to be better understood. Using gene expression dataset from matched prostate tumor and normal epithelial cells from an 80 GeneChip experiment examining 40 tumors and their matching normal pairs in 40 patients with known ERG status, we conducted a cancer signaling-focused functional analysis of prostatic carcinoma representing moderate and aggressive cancers stratified by ERG expression. Results: In the present study of matched pairs of laser capture microdissected normal epithelial cells and well-to-moderately differentiated tumor epithelial cells with known ERG gene expression status from 20 patients with localized prostate cancer, we have discovered novel ERG associated biochemical networks. Conclusions: Using causal network reconstruction methods, we have identified three major signaling pathways related to MAPK/PI3K cascade that may indeed contribute synergistically to the ERG dependent tumor development. Moreover, the key components of these pathways have potential as biomarkers and therapeutic target for ERG positive prostate tumors. PMID:26000039

Analysis of the L1 gene product of human papillomavirus type 16 by expression in a vaccinia virus recombinant.

PubMed

Browne, H M; Churcher, M J; Stanley, M A; Smith, G L; Minson, A C

1988-06-01

The L1 open reading frame of human papillomavirus type 16 (HPV16) has been expressed in vaccinia virus under the control of both the 7.5K early and late promoter, and the 4b major late promoter. Antibodies to a beta-galactosidase fusion protein containing a C-terminal portion of the HPV16 L1 gene product were used to compare the levels of L1 expression in the two recombinants, and showed that greater levels of expression were obtained when the gene was placed under the control of the 4b late promoter. Immunofluorescence studies revealed a nuclear location of the L1 gene product when expressed in vaccinia virus. Antibodies to the beta-galactosidase fusion protein detected a major polypeptide species of 57K and a minor species of 64K in Western blots of recombinant-infected cell lysates. The 64K species was not detected when cells were infected in the presence of tunicamycin, indicating that the primary translation product of the HPV16 L1 open reading frame is modified by N-linked glycosylation when expressed in vaccinia virus. Whereas antibodies to HPV16 L1 fusion proteins and to a peptide containing amino acids from the C terminus of HPV16 L1 reacted well in Western blots with the HPV16 L1 target expressed in vaccinia virus, no reactivity was observed with antibodies to bovine papillomavirus type 1 particles or to a HPV6b fusion protein.

Preferential expression and immunogenicity of HIV-1 Tat fusion protein expressed in tomato plant.

PubMed

Cueno, Marni E; Hibi, Yurina; Karamatsu, Katsuo; Yasutomi, Yasuhiro; Imai, Kenichi; Laurena, Antonio C; Okamoto, Takashi

2010-10-01

HIV-1 Tat plays a major role in viral replication and is essential for AIDS development making it an ideal vaccine target providing that both humoral and cellular immune responses are induced. Plant-based antigen production, due to its cheaper cost, appears ideal for vaccine production. In this study, we created a plant-optimized tat and mutant (Cys30Ala/Lys41Ala) tat (mtat) gene and ligated each into a pBI121 expression vector with a stop codon and a gusA gene positioned immediately downstream. The vector construct was bombarded into tomato leaf calli and allowed to develop. We thus generated recombinant tomato plants preferentially expressing a Tat-GUS fusion protein over a Tat-only protein. In addition, plants bombarded with either tat or mtat genes showed no phenotypic difference and produced 2-4 microg Tat-GUS fusion protein per milligram soluble plant protein. Furthermore, tomato extracts intradermally inoculated into mice were found to induce a humoral and, most importantly, cellular immunity.

Transcriptional and functional studies of Human Endogenous Retrovirus envelope EnvP(b) and EnvV genes in human trophoblasts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vargas, Amandine, E-mail: amandine.vargas@voila.fr; Thiery, Maxime, E-mail: thiery.maxime@courrier.uqam.ca; Lafond, Julie, E-mail: lafond.julie@uqam.ca

2012-03-30

HERV (Human Endogenous Retrovirus)-encoded envelope proteins are implicated in the development of the placenta. Indeed, Syncytin-1 and -2 play a crucial role in the fusion of human trophoblasts, a key step in placentation. Other studies have identified two other HERV env proteins, namely EnvP(b) and EnvV, both expressed in the placenta. In this study, we have fully characterized both env transcripts and their expression pattern and have assessed their implication in trophoblast fusion. Through RACE analyses, standard spliced transcripts were detected, while EnvV transcripts demonstrated alternative splicing at its 3 Prime end. Promoter activity and expression of both genes weremore » induced in forskolin-stimulated BeWo cells and in primary trophoblasts. Although we have confirmed the fusogenic activity of EnvP(b), overexpression or silencing experiments revealed no impact of this protein on trophoblast fusion. Our results demonstrate that both env genes are expressed in human trophoblasts but are not required for syncytialization.« less

A new microcolumn-type microchip for examining the expression of chimeric fusion genes using a nucleic acid sandwich hybridization technique.

PubMed

Ohnishi, Michihiro; Sasaki, Naoyuki; Kishimoto, Takuya; Watanabe, Hidetoshi; Takagi, Masatoshi; Mizutani, Shuki; Kishii, Noriyuki; Yasuda, Akio

2014-11-01

We report a new type of microcolumn installed in a microchip. The architecture allows use of a nucleic acid sandwich hybridization technique to detect a messenger RNA (mRNA) chain as a target. Data are presented that demonstrate that the expression of a chimeric fusion gene can be detected. The microcolumn was filled with semi-transparent microbeads made of agarose gel that acted as carriers, allowing increased efficiency of the optical detection of fluorescence from the microcolumn. The hybrid between the target trapped on the microbeads and a probe DNA labeled with a fluorescent dye was detected by measuring the intensity of the fluorescence from the microcolumn directly. These results demonstrate an easy and simple method for determining the expression of chimeric fusion genes with no preamplification. Copyright © 2014 Elsevier B.V. All rights reserved.

Intrafocal heterogeneity of ERG protein expression and gene fusion pattern in prostate cancer.

PubMed

Suh, Ja Hee; Park, Jeong Hwan; Lee, Cheol; Moon, Kyung Chul

2017-10-01

Prostate cancer is considered to be highly heterogeneous, with various morphologic features and biologic behaviors. The TMPRSS2-ERG gene fusion is the most frequently observed genetic aberration in prostate cancer. The aim of this study was to elucidate the intrafocal heterogeneity of ERG gene fusion status. ERG immunohistochemistry (IHC) was performed in samples from 168 prostate cancer patients who had undergone radical prostatectomy, and 40 cases showing ERG-positive IHC staining were selected for tissue microarray (TMA) construction. Two to six representative cores were selected from each tumor focus. In the cases with heterogeneous ERG IHC staining intensity, the areas showing different intensities were separately selected. Using the TMA blocks, IHC and fluorescence in situ hybridization (FISH) were conducted to evaluate the heterogeneity of ERG protein expression and ERG fusion gene patterns, respectively, in a single tumor focus. Heterogeneity of ERG IHC staining was defined as the simultaneous presence of negative and positive cores in the same tumor focus. Heterogeneity of ERG FISH was defined by the presence of cores with positive and negative FISH signals or cores with break-apart and interstitial deletion FISH signals in the same tumor focus. A total of 202 TMA cores were isolated from 40 ERG-positive cases. Of the 202 total cores, 19 were negative for ERG IHC staining, and 46 showed 1+, 52 showed 2+, and 85 showed 3+ ERG staining intensity. Eleven cores were negative for ERG FISH signal, 119 cores showed ERG break-apart FISH signals, and the remaining 72 cores revealed interstitial deletion. Intrafocal heterogeneity of ERG IHC staining was found in 20% (8/40) of cases, and intrafocal heterogeneity of ERG gene fusion pattern was found in 32.5% (13/40) of cases. In summary, this study showed significantly frequent intrafocal heterogeneity of ERG protein expression, gene fusion status and fusion pattern. This heterogeneity can be caused by the development of subclones during cancer progression or the intermingling of different tumors. © 2017 Wiley Periodicals, Inc.

Tyrosine kinase fusion genes in pediatric BCR-ABL1-like acute lymphoblastic leukemia

PubMed Central

Boer, Judith M.; Steeghs, Elisabeth M.P.; Marchante, João R.M.; Boeree, Aurélie; Beaudoin, James J.; Berna Beverloo, H.; Kuiper, Roland P.; Escherich, Gabriele; van der Velden, Vincent H.J.; van der Schoot, C. Ellen; de Groot-Kruseman, Hester A.; Pieters, Rob; den Boer, Monique L.

2017-01-01

Approximately 15% of pediatric B cell precursor acute lymphoblastic leukemia (BCP-ALL) is characterized by gene expression similar to that of BCR-ABL1-positive disease and unfavorable prognosis. This BCR-ABL1-like subtype shows a high frequency of B-cell development gene aberrations and tyrosine kinase-activating lesions. To evaluate the clinical significance of tyrosine kinase gene fusions in children with BCP-ALL, we studied the frequency of recently identified tyrosine kinase fusions, associated genetic features, and prognosis in a representative Dutch/German cohort. We identified 14 tyrosine kinase fusions among 77 BCR-ABL1-like cases (18%) and none among 76 non-BCR-ABL1-like B-other cases. Novel exon fusions were identified for RCSD1-ABL2 and TERF2-JAK2. JAK2 mutation was mutually exclusive with tyrosine kinase fusions and only occurred in cases with high CRLF2 expression. The non/late response rate and levels of minimal residual disease in the fusion-positive BCR-ABL1-like group were higher than in the non-BCR-ABL1-like B-others (p<0.01), and also higher, albeit not statistically significant, compared with the fusion-negative BCR-ABL1-like group. The 8-year cumulative incidence of relapse in the fusion-positive BCR-ABL1-like group (35%) was comparable with that in the fusion-negative BCR-ABL1-like group (35%), and worse than in the non-BCR-ABL1-like B-other group (17%, p=0.07). IKZF1 deletions, predominantly other than the dominant-negative isoform and full deletion, co-occurred with tyrosine kinase fusions. This study shows that tyrosine kinase fusion-positive cases are a high-risk subtype of BCP-ALL, which warrants further studies with specific kinase inhibitors to improve outcome. PMID:27894077

Molecular cloning, recombinant expression, and antifungal functional characterization of the lipid transfer protein from Panax ginseng.

PubMed

Cai, Kexin; Wang, Jiawen; Wang, Min; Zhang, Hui; Wang, Siming; Zhao, Yu

2016-07-01

To establish an efficient expression system for a fusion protein GST-pgLTP (Lipid Transfer Protein) and to test its antifungal activity. The nucleotide sequence of LTP gene was obtained from Panax ginseng using RT-PCR. The ORF of the cDNA is 363 bp, codING for a protein OF 120 amino acids with a calculated MW of 12.09 kDa. The pgLTP gene with a His6-tag at the C-terminus was cloned into the pGEX-6p1 vector to generate a GST-fusion pgLTP protein construct that was expressed in Escherichia coli Rosetta. Following purification by Ni-NTA, the fusion protein exhibited antifungal activity against five fungi found in ginseng. The fusion protein GST-pgLTP has activity against a broad spectrum of phytopathogenic fungi, and can potentially be adapted for production to combat fungal diseases that affect P. ginseng.

Repeated evolution of chimeric fusion genes in the β-globin gene family of laurasiatherian mammals.

PubMed

Gaudry, Michael J; Storz, Jay F; Butts, Gary Tyler; Campbell, Kevin L; Hoffmann, Federico G

2014-05-09

The evolutionary fate of chimeric fusion genes may be strongly influenced by their recombinational mode of origin and the nature of functional divergence between the parental genes. In the β-globin gene family of placental mammals, the two postnatally expressed δ- and β-globin genes (HBD and HBB, respectively) have a propensity for recombinational exchange via gene conversion and unequal crossing-over. In the latter case, there are good reasons to expect differences in retention rates for the reciprocal HBB/HBD and HBD/HBB fusion genes due to thalassemia pathologies associated with the HBD/HBB "Lepore" deletion mutant in humans. Here, we report a comparative genomic analysis of the mammalian β-globin gene cluster, which revealed that chimeric HBB/HBD fusion genes originated independently in four separate lineages of laurasiatherian mammals: Eulipotyphlans (shrews, moles, and hedgehogs), carnivores, microchiropteran bats, and cetaceans. In cases where an independently derived "anti-Lepore" duplication mutant has become fixed, the parental HBD and/or HBB genes have typically been inactivated or deleted, so that the newly created HBB/HBD fusion gene is primarily responsible for synthesizing the β-type subunits of adult and fetal hemoglobin (Hb). Contrary to conventional wisdom that the HBD gene is a vestigial relict that is typically inactivated or expressed at negligible levels, we show that HBD-like genes often encode a substantial fraction (20-100%) of β-chain Hbs in laurasiatherian taxa. Our results indicate that the ascendancy or resuscitation of genes with HBD-like coding sequence requires the secondary acquisition of HBB-like promoter sequence via unequal crossing-over or interparalog gene conversion. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Regulation of the epithelial adhesion molecule CEACAM1 is important for palate formation.

PubMed

Mima, Junko; Koshino, Aya; Oka, Kyoko; Uchida, Hitoshi; Hieda, Yohki; Nohara, Kanji; Kogo, Mikihiko; Chai, Yang; Sakai, Takayoshi

2013-01-01

Cleft palate results from a mixture of genetic and environmental factors and occurs when the bilateral palatal shelves fail to fuse. The objective of this study was to search for new genes involved in mouse palate formation. Gene expression of murine embryonic palatal tissue was analyzed at various developmental stages before, during, and after palate fusion using GeneChip® microarrays. Ceacam1 was one of the highly up-regulated genes during palate formation, and this was confirmed by quantitative real-time PCR. Immunohistochemical staining showed that CEACAM1 was present in prefusion palatal epithelium and was degraded during fusion. To investigate the developmental role of CEACAM1, function-blocking antibody was added to embryonic mouse palate in organ culture. Palatal fusion was inhibited by this function-blocking antibody. To investigate the subsequent developmental role of CEACAM1, we characterized Ceacam1-deficient (Ceacam1(-/-)) mice. Epithelial cells persisted abnormally at the midline of the embryonic palate even on day E16.0, and palatal fusion was delayed in Ceacam1(-/-) mice. TGFβ3 expression, apoptosis, and cell proliferation in palatal epithelium were not affected in the palate of Ceacam1(-/-)mice. However, CEACAM1 expression was retained in the remaining MEE of TGFβ-deficient mice. These results suggest that CEACAM1 has roles in the initiation of palatal fusion via epithelial cell adhesion.

High resolution array CGH and gene expression profiling of alveolar soft part sarcoma

PubMed Central

Selvarajah, Shamini; Pyne, Saumyadipta; Chen, Eleanor; Sompallae, Ramakrishna; Ligon, Azra H.; Nielsen, Gunnlaugur P.; Dranoff, Glenn; Stack, Edward; Loda, Massimo; Flavin, Richard

2014-01-01

Purpose Alveolar soft part sarcoma (ASPS) is a soft tissue sarcoma with poor prognosis, and little molecular evidence for its origin, initiation and progression. The aim of this study was to elucidate candidate molecular pathways involved in tumor pathogenesis. Experimental Design We employed high-throughput array comparative genomic hybridization and cDNA-Mediated Annealing, Selection, Ligation, and Extension Assay to profile the genomic and expression signatures of primary and metastatic ASPS from 17 tumors derived from 11 patients. We used an integrative bioinformatics approach to elucidate the molecular pathways associated with ASPS progression. Fluorescence in situ hybridization was performed to validate the presence of the t(X;17)(p11.2;q25) ASPL-TFE3 fusion and hence confirm the aCGH observations. Results FISH analysis identified the ASPL-TFE3 fusion in all cases. ArrayCGH revealed a higher number of numerical aberrations in metastatic tumors relative to primaries, but failed to identify consistent alterations in either group. Gene expression analysis highlighted 1,063 genes which were differentially expressed between the two groups. Gene set enrichment analysis identified 16 enriched gene sets (p < 0.1) associated with differentially expressed genes. Notable among these were several stem cell gene expression signatures and pathways related to differentiation. In particular, the paired box transcription factor PAX6 was up-regulated in the primary tumors, along with several genes whose mouse orthologs have previously been implicated in Pax6-DNA binding during neural stem cell differentiation. Conclusion In addition to suggesting a tentative neural line of differentiation for ASPS, these results implicate transcriptional deregulation from fusion genes in the pathogenesis of ASPS. PMID:24493828

A dual function fusion protein of Herpes simplex virus type 1 thymidine kinase and firefly luciferase for noninvasive in vivo imaging of gene therapy in malignant glioma.

PubMed

Söling, Ariane; Theiss, Christian; Jungmichel, Stephanie; Rainov, Nikolai G

2004-08-04

BACKGROUND: Suicide gene therapy employing the prodrug activating system Herpes simplex virus type 1 thymidine kinase (HSV-TK)/ ganciclovir (GCV) has proven to be effective in killing experimental brain tumors. In contrast, glioma patients treated with HSV-TK/ GCV did not show significant treatment benefit, most likely due to insufficient transgene delivery to tumor cells. Therefore, this study aimed at developing a strategy for real-time noninvasive in vivo monitoring of the activity of a therapeutic gene in brain tumor cells. METHODS: The HSV-TK gene was fused to the firefly luciferase (Luc) gene and the fusion construct HSV-TK-Luc was expressed in U87MG human malignant glioma cells. Nude mice with subcutaneous gliomas stably expressing HSV-TK-Luc were subjected to GCV treatment and tumor response to therapy was monitored in vivo by serial bioluminescence imaging. Bioluminescent signals over time were compared with tumor volumes determined by caliper. RESULTS: Transient and stable expression of the HSV-TK-Luc fusion protein in U87MG glioma cells demonstrated close correlation of both enzyme activities. Serial optical imaging of tumor bearing mice detected in all cases GCV induced death of tumor cells expressing the fusion protein and proved that bioluminescence can be reliably used for repetitive and noninvasive quantification of HSV-TK/ GCV mediated cell kill in vivo. CONCLUSION: This approach may represent a valuable tool for the in vivo evaluation of gene therapy strategies for treatment of malignant disease.

The "grep" command but not FusionMap, FusionFinder or ChimeraScan captures the CIC-DUX4 fusion gene from whole transcriptome sequencing data on a small round cell tumor with t(4;19)(q35;q13).

PubMed

Panagopoulos, Ioannis; Gorunova, Ludmila; Bjerkehagen, Bodil; Heim, Sverre

2014-01-01

Whole transcriptome sequencing was used to study a small round cell tumor in which a t(4;19)(q35;q13) was part of the complex karyotype but where the initial reverse transcriptase PCR (RT-PCR) examination did not detect a CIC-DUX4 fusion transcript previously described as the crucial gene-level outcome of this specific translocation. The RNA sequencing data were analysed using the FusionMap, FusionFinder, and ChimeraScan programs which are specifically designed to identify fusion genes. FusionMap, FusionFinder, and ChimeraScan identified 1017, 102, and 101 fusion transcripts, respectively, but CIC-DUX4 was not among them. Since the RNA sequencing data are in the fastq text-based format, we searched the files using the "grep" command-line utility. The "grep" command searches the text for specific expressions and displays, by default, the lines where matches occur. The "specific expression" was a sequence of 20 nucleotides from the coding part of the last exon 20 of CIC (Reference Sequence: NM_015125.3) chosen since all the so far reported CIC breakpoints have occurred here. Fifteen chimeric CIC-DUX4 cDNA sequences were captured and the fusion between the CIC and DUX4 genes was mapped precisely. New primer combinations were constructed based on these findings and were used together with a polymerase suitable for amplification of GC-rich DNA templates to amplify CIC-DUX4 cDNA fragments which had the same fusion point found with "grep". In conclusion, FusionMap, FusionFinder, and ChimeraScan generated a plethora of fusion transcripts but did not detect the biologically important CIC-DUX4 chimeric transcript; they are generally useful but evidently suffer from imperfect both sensitivity and specificity. The "grep" command is an excellent tool to capture chimeric transcripts from RNA sequencing data when the pathological and/or cytogenetic information strongly indicates the presence of a specific fusion gene.

Domain retention in transcription factor fusion genes and its biological and clinical implications: a pan-cancer study

PubMed Central

Kim, Pora; Ballester, Leomar Y.; Zhao, Zhongming

2017-01-01

Genomic rearrangements involving transcription factors (TFs) can form fusion proteins resulting in either enhanced, weakened, or even loss of TF activity. Functional domain (FD) retention is a critical factor in the activity of transcription factor fusion genes (TFFGs). A systematic investigation of FD retention in TFFGs and their outcome (e.g. expression changes) in a pan-cancer study has not yet been completed. Here, we examined the FD retention status in 386 TFFGs across 13 major cancer types and identified 83 TFFGs involving 67 TFs that retained FDs. To measure the potential biological relevance of TFs in TFFGs, we introduced a Major Active Isofusion Index (MAII) and built a prioritized TFFG network using MAII scores and the observed frequency of fusion positive samples. Interestingly, the four TFFGs (PML-RARA, RUNX1-RUNX1T1, TMPRSS2-ERG, and SFPQ-TFE3) with the highest MAII scores showed 50 differentially expressed target genes (DETGs) in fusion-positive versus fusion-negative cancer samples. DETG analysis revealed that they were involved in tumorigenesis-related processes in each cancer type. PLAU, which encodes plasminogen activator urokinase and serves as a biomarker for tumor invasion, was found to be consistently activated in the samples with the highest MAII scores. Among the 50 DETGs, 21 were drug targetable genes. Fourteen of these 21 DETGs were expressed in acute myeloid leukemia (AML) samples. Accordingly, we constructed an AML-specific TFFG network, which included 38 DETGs in RUNX1-RUNX1T1 or PML-RARA positive samples. In summary, this study revealed several TFFGs and their potential target genes, and provided insights into the clinical implications of TFFGs. PMID:29299133

Evidence for participation of GCS1 in fertilization of the starlet sea anemone Nematostella vectensis: Implication of a common mechanism of sperm–egg fusion in plants and animals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ebchuqin, Eerdundagula; Yokota, Naoto; Yamada, Lixy

Highlights: • GCS1 is a sperm transmembrane protein that is essential for gamete fusion in flowering plants. • The GCS1 gene is present not only in angiosperms but also in unicellular organisms and animals. • NvGCS1 gene is expressed in the testis and GCS1 protein exists in sperm of a sea anemone. • Anti-GCS1 antibodies inhibited the fertilization, showing the participation in fertilization. - Abstract: It has been reported that GCS1 (Generative Cell Specific 1) is a transmembrane protein that is exclusively expressed in sperm cells and is essential for gamete fusion in flowering plants. The GCS1 gene is presentmore » not only in angiosperms but also in unicellular organisms and animals, implying the occurrence of a common or ancestral mechanism of GCS1-mediated gamete fusion. In order to elucidate the common mechanism, we investigated the role of GCS1 in animal fertilization using a sea anemone (Cnidaria), Nematostella vectensis. Although the existence of the GCS1 gene in N. vectensis has been reported, the expression of GCS1 in sperm and the role of GCS1 in fertilization are not known. In this study, we showed that the GCS1 gene is expressed in the testis and that GCS1 protein exists in sperm by in situ hybridization and proteomic analysis, respectively. Then we made four peptide antibodies against the N-terminal extracellular region of NvGCS1. These antibodies specifically reacted to NvGCS1 among sperm proteins on the basis of Western analysis and potently inhibited fertilization in a concentration-dependent manner. These results indicate that sperm GCS1 plays a pivotal role in fertilization, most probably in sperm–egg fusion, in a starlet sea anemone, suggesting a common gamete-fusion mechanism shared by eukaryotic organisms.« less

Engineering and Functional Characterization of Fusion Genes Identifies Novel Oncogenic Drivers of Cancer.

PubMed

Lu, Hengyu; Villafane, Nicole; Dogruluk, Turgut; Grzeskowiak, Caitlin L; Kong, Kathleen; Tsang, Yiu Huen; Zagorodna, Oksana; Pantazi, Angeliki; Yang, Lixing; Neill, Nicholas J; Kim, Young Won; Creighton, Chad J; Verhaak, Roel G; Mills, Gordon B; Park, Peter J; Kucherlapati, Raju; Scott, Kenneth L

2017-07-01

Oncogenic gene fusions drive many human cancers, but tools to more quickly unravel their functional contributions are needed. Here we describe methodology permitting fusion gene construction for functional evaluation. Using this strategy, we engineered the known fusion oncogenes, BCR-ABL1, EML4-ALK , and ETV6-NTRK3, as well as 20 previously uncharacterized fusion genes identified in The Cancer Genome Atlas datasets. In addition to confirming oncogenic activity of the known fusion oncogenes engineered by our construction strategy, we validated five novel fusion genes involving MET, NTRK2 , and BRAF kinases that exhibited potent transforming activity and conferred sensitivity to FDA-approved kinase inhibitors. Our fusion construction strategy also enabled domain-function studies of BRAF fusion genes. Our results confirmed other reports that the transforming activity of BRAF fusions results from truncation-mediated loss of inhibitory domains within the N-terminus of the BRAF protein. BRAF mutations residing within this inhibitory region may provide a means for BRAF activation in cancer, therefore we leveraged the modular design of our fusion gene construction methodology to screen N-terminal domain mutations discovered in tumors that are wild-type at the BRAF mutation hotspot, V600. We identified an oncogenic mutation, F247L, whose expression robustly activated the MAPK pathway and sensitized cells to BRAF and MEK inhibitors. When applied broadly, these tools will facilitate rapid fusion gene construction for subsequent functional characterization and translation into personalized treatment strategies. Cancer Res; 77(13); 3502-12. ©2017 AACR . ©2017 American Association for Cancer Research.

Expression, purification and characterization of a phyAm-phyCs fusion phytase*

PubMed Central

Zou, Li-kou; Wang, Hong-ning; Pan, Xin; Tian, Guo-bao; Xie, Zi-wen; Wu, Qi; Chen, Hui; Xie, Tao; Yang, Zhi-rong

2008-01-01

The phyAm gene encoding acid phytase and optimized neutral phytase phyCs gene were inserted into expression vector pPIC9K in correct orientation and transformed into Pichia pastoris in order to expand the pH profile of phytase and decrease the cost of production. The fusion phytase phyAm-phyCs gene was successfully overexpressed in P. pastoris as an active and extracellular phytase. The yield of total extracellular fusion phytase activity is (25.4±0.53) U/ml at the flask scale and (159.1±2.92) U/ml for high cell-density fermentation, respectively. Purified fusion phytase exhibits an optimal temperature at 55 °C and an optimal pH at 5.5~6.0 and its relative activity remains at a relatively high level of above 70% in the range of pH 2.0 to 7.0. About 51% to 63% of its original activity remains after incubation at 75 °C to 95 °C for 10 min. Due to heavy glycosylation, the expressed fusion phytase shows a broad and diffuse band in SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis). After deglycosylation by endoglycosidase H (EndoHf), the enzyme has an apparent molecular size of 95 kDa. The characterization of the fusion phytase was compared with those of phyCs and phyAm. PMID:18600783

Transgenic mouse model harboring the transcriptional fusion ccl20-luciferase as a novel reporter of pro-inflammatory response.

PubMed

Crispo, Martina; Van Maele, Laurye; Tabareau, Julien; Cayet, Delphine; Errea, Agustina; Ferreira, Ana María; Rumbo, Martin; Sirard, Jean Claude

2013-01-01

The chemokine CCL20, the unique ligand of CCR6 functions as an attractant of immune cells. Expression of CCL20 is induced by Toll-like Receptor (TLR) signaling or proinflammatory cytokine stimulation. However CCL20 is also constitutively produced at specific epithelial sites of mucosa. This expression profile is achieved by transcriptional regulation. In the present work we characterized regulatory features of mouse Ccl20 gene. Transcriptional fusions between the mouse Ccl20 promoter and the firefly luciferase (luc) encoding gene were constructed and assessed in in vitro and in vivo assays. We found that liver CCL20 expression and luciferase activity were upregulated by systemic administration of the TLR5 agonist flagellin. Using shRNA and dominant negative form specific for mouse TLR5, we showed that this expression was controlled by TLR5. To address in situ the regulation of gene activity, a transgenic mouse line harboring a functional Ccl20-luc fusion was generated. The luciferase expression was highly concordant with Ccl20 expression in different tissues. Our data indicate that the transgenic mouse model can be used to monitor activation of innate response in vivo.

Transgenic Mouse Model Harboring the Transcriptional Fusion Ccl20-Luciferase as a Novel Reporter of Pro-Inflammatory Response

PubMed Central

Crispo, Martina; Van Maele, Laurye; Tabareau, Julien; Cayet, Delphine; Errea, Agustina; Ferreira, Ana María; Rumbo, Martin; Sirard, Jean Claude

2013-01-01

The chemokine CCL20, the unique ligand of CCR6 functions as an attractant of immune cells. Expression of CCL20 is induced by Toll-like Receptor (TLR) signaling or proinflammatory cytokine stimulation. However CCL20 is also constitutively produced at specific epithelial sites of mucosa. This expression profile is achieved by transcriptional regulation. In the present work we characterized regulatory features of mouse Ccl20 gene. Transcriptional fusions between the mouse Ccl20 promoter and the firefly luciferase (luc) encoding gene were constructed and assessed in in vitro and in vivo assays. We found that liver CCL20 expression and luciferase activity were upregulated by systemic administration of the TLR5 agonist flagellin. Using shRNA and dominant negative form specific for mouse TLR5, we showed that this expression was controlled by TLR5. To address in situ the regulation of gene activity, a transgenic mouse line harboring a functional Ccl20-luc fusion was generated. The luciferase expression was highly concordant with Ccl20 expression in different tissues. Our data indicate that the transgenic mouse model can be used to monitor activation of innate response in vivo. PMID:24265691

Expression of Chlamydophila psittaci MOMP heat-labile toxin B subunit fusion gene in transgenic rice.

PubMed

Zhang, Xiuxiang; Yuan, Ziguo; Guo, Xuejun; Li, Jingwen; Li, Zhaonan; Wang, Qingyu

2008-09-01

A DNA fragment encoding the MOMP gene of Chlamydophila psittaci was fused to the heat-labile toxin B subunit gene (LTB-MOMP) and transferred into rice callus by Agrobacterium tumefaciens-mediated transformation. The LTB-MOMP fusion gene was detected in genomic DNA from transformed rice leaves by Southern blot and RT-PCR amplification. Synthesis and assembly of the LTB-MOMP fusion protein into pentamers was detected in transformed leaf extracts by immunoblot analysis. Binding of the pentamers to intestinal epithelial cell membrane glycolipid receptors was quantified by GM1-ganglioside enzyme-linked immunosorbent assay (GM1-ELISA). The ELISA results indicated that LTB-MOMP fusion protein made up 0.0033-0.0054% of the total soluble leaf protein. Meanwhile, this suggested that the fusion protein retained both its native antigenicity and the ability to form pentamers.

Reversible effects of oxygen partial pressure on genes associated with placental angiogenesis and differentiation in primary-term cytotrophoblast cell culture.

PubMed

Debiève, F; Depoix, C; Gruson, D; Hubinont, C

2013-09-01

Timely regulated changes in oxygen partial pressure are important for placental formation. Disturbances could be responsible for pregnancy-related diseases like preeclampsia and intrauterine growth restriction. We aimed to (i) determine the effect of oxygen partial pressure on cytotrophoblast differentiation; (ii) measure mRNA expression and protein secretion from genes associated with placental angiogenesis; and (iii) determine the reversibility of these effects at different oxygen partial pressures. Term cytotrophoblasts were incubated at 21% and 2.5% O2 for 96 hr, or were switched between the two oxygen concentrations after 48 hr. Real-time PCR and enzyme-linked immunosorbent assays (ELISAs) were used to evaluate cell fusion and differentiation, measuring transcript levels for those genes involved in cell fusion and placental angiogenesis, including VEGF, PlGF, VEGFR1, sVEGFR1, sENG, INHA, and GCM1. Cytotrophoblasts underwent fusion and differentiation in 2.5% O2 . PlGF expression was inhibited while sVEGFR1 expression increased. VEGF and sENG mRNA expressions increased in 2.5% compared to 21% O2 , but no protein was detected in the cell supernatants. Finally, GCM1 mRNA expression increased during trophoblast differentiation at 21% O2 , but was inhibited at 2.5% O2 . These mRNA expression effects were reversed by returning the cells to 21% O2 . Thus, low-oxygen partial pressure does not inhibit term-cytotrophoblast cell fusion and differentiation in vitro. Lowering the oxygen partial pressure from 21% to 2.5% caused normal-term trophoblasts to reversibly modify their expression of genes associated with placental angiogenesis. This suggests that modifications observed in pregnancy diseases such as preeclampsia or growth retardation are probably due to an extrinsic effect on trophoblasts. Copyright © 2013 Wiley Periodicals, Inc.

Comprehensive analysis of transcriptome variation uncovers known and novel driver events in T-cell acute lymphoblastic leukemia.

PubMed

Atak, Zeynep Kalender; Gianfelici, Valentina; Hulselmans, Gert; De Keersmaecker, Kim; Devasia, Arun George; Geerdens, Ellen; Mentens, Nicole; Chiaretti, Sabina; Durinck, Kaat; Uyttebroeck, Anne; Vandenberghe, Peter; Wlodarska, Iwona; Cloos, Jacqueline; Foà, Robin; Speleman, Frank; Cools, Jan; Aerts, Stein

2013-01-01

RNA-seq is a promising technology to re-sequence protein coding genes for the identification of single nucleotide variants (SNV), while simultaneously obtaining information on structural variations and gene expression perturbations. We asked whether RNA-seq is suitable for the detection of driver mutations in T-cell acute lymphoblastic leukemia (T-ALL). These leukemias are caused by a combination of gene fusions, over-expression of transcription factors and cooperative point mutations in oncogenes and tumor suppressor genes. We analyzed 31 T-ALL patient samples and 18 T-ALL cell lines by high-coverage paired-end RNA-seq. First, we optimized the detection of SNVs in RNA-seq data by comparing the results with exome re-sequencing data. We identified known driver genes with recurrent protein altering variations, as well as several new candidates including H3F3A, PTK2B, and STAT5B. Next, we determined accurate gene expression levels from the RNA-seq data through normalizations and batch effect removal, and used these to classify patients into T-ALL subtypes. Finally, we detected gene fusions, of which several can explain the over-expression of key driver genes such as TLX1, PLAG1, LMO1, or NKX2-1; and others result in novel fusion transcripts encoding activated kinases (SSBP2-FER and TPM3-JAK2) or involving MLLT10. In conclusion, we present novel analysis pipelines for variant calling, variant filtering, and expression normalization on RNA-seq data, and successfully applied these for the detection of translocations, point mutations, INDELs, exon-skipping events, and expression perturbations in T-ALL.

Characterization of distinct classes of differential gene expression in osteoblast cultures from non-syndromic craniosynostosis bone.

PubMed

Rojas-Peña, Monica L; Olivares-Navarrete, Rene; Hyzy, Sharon; Arafat, Dalia; Schwartz, Zvi; Boyan, Barbara D; Williams, Joseph; Gibson, Greg

2014-01-01

Craniosynostosis, the premature fusion of one or more skull sutures, occurs in approximately 1 in 2500 infants, with the majority of cases non-syndromic and of unknown etiology. Two common reasons proposed for premature suture fusion are abnormal compression forces on the skull and rare genetic abnormalities. Our goal was to evaluate whether different sub-classes of disease can be identified based on total gene expression profiles. RNA-Seq data were obtained from 31 human osteoblast cultures derived from bone biopsy samples collected between 2009 and 2011, representing 23 craniosynostosis fusions and 8 normal cranial bones or long bones. No differentiation between regions of the skull was detected, but variance component analysis of gene expression patterns nevertheless supports transcriptome-based classification of craniosynostosis. Cluster analysis showed 4 distinct groups of samples; 1 predominantly normal and 3 craniosynostosis subtypes. Similar constellations of sub-types were also observed upon re-analysis of a similar dataset of 199 calvarial osteoblast cultures. Annotation of gene function of differentially expressed transcripts strongly implicates physiological differences with respect to cell cycle and cell death, stromal cell differentiation, extracellular matrix (ECM) components, and ribosomal activity. Based on these results, we propose non-syndromic craniosynostosis cases can be classified by differences in their gene expression patterns and that these may provide targets for future clinical intervention.

Characterization of Distinct Classes of Differential Gene Expression in Osteoblast Cultures from Non-Syndromic Craniosynostosis Bone

PubMed Central

Rojas-Peña, Monica L.; Olivares-Navarrete, Rene; Hyzy, Sharon; Arafat, Dalia; Schwartz, Zvi; Boyan, Barbara D.; Williams, Joseph; Gibson, Greg

2014-01-01

Craniosynostosis, the premature fusion of one or more skull sutures, occurs in approximately 1 in 2500 infants, with the majority of cases non-syndromic and of unknown etiology. Two common reasons proposed for premature suture fusion are abnormal compression forces on the skull and rare genetic abnormalities. Our goal was to evaluate whether different sub-classes of disease can be identified based on total gene expression profiles. RNA-Seq data were obtained from 31 human osteoblast cultures derived from bone biopsy samples collected between 2009 and 2011, representing 23 craniosynostosis fusions and 8 normal cranial bones or long bones. No differentiation between regions of the skull was detected, but variance component analysis of gene expression patterns nevertheless supports transcriptome-based classification of craniosynostosis. Cluster analysis showed 4 distinct groups of samples; 1 predominantly normal and 3 craniosynostosis subtypes. Similar constellations of sub-types were also observed upon re-analysis of a similar dataset of 199 calvarial osteoblast cultures. Annotation of gene function of differentially expressed transcripts strongly implicates physiological differences with respect to cell cycle and cell death, stromal cell differentiation, extracellular matrix (ECM) components, and ribosomal activity. Based on these results, we propose non-syndromic craniosynostosis cases can be classified by differences in their gene expression patterns and that these may provide targets for future clinical intervention. PMID:25184005

[Construction, expression and characterization of the fusion gene of super-antigen SEA and single chain Fv of the ND-1 monoclonal antibody against human colorectal cancer].

PubMed

Chen, Hang; Li, Li; Fang, Jin

2012-04-01

To construct and express the recombinant ND-1-scFv/SEA, a fusion protein of superantigen (staphylococcal enterotoxinA, SEA) and single-chain variable fragment of monoclonal antibody ND-1 against human clolorectal carcinoma, and to enhance the targeted killing effect of SEA. The expression of the fusion protein was induced in E.coli M15 by IPTG. Ni-NTA resin affinity chromatography was used to separate and purify the expressed product. The specific binding activity of the purified ND-1-scFv/SEA protein was examined by indirect immunofluorescence assay and the targeted-cytotoxicity was determined using MTT assay. The expressing vector of fusion gene ND-1scFv/SEA was constructed successfully. ND-1-scFv/SEA protein retained a high binding affinity to antigen-positive human colorectal cancer cell CCL-187 and had a stronger capability to activate PBMC and kill the target cells compared to SEA alone, with a killing rate of 91% at 4 μg/mL. ND-1-scFv/SEA fusion protein could specifically target colorectal cancer cell, enhance the activity of kill tumor cell and has potential applications in the targeted therapy of colorectal cancer.

Fusion or Fission: The Destiny of Mitochondria In Traumatic Brain Injury of Different Severities.

PubMed

Di Pietro, Valentina; Lazzarino, Giacomo; Amorini, Angela Maria; Signoretti, Stefano; Hill, Lisa J; Porto, Edoardo; Tavazzi, Barbara; Lazzarino, Giuseppe; Belli, Antonio

2017-08-23

Mitochondrial dynamics are regulated by a complex system of proteins representing the mitochondrial quality control (MQC). MQC balances antagonistic forces of fusion and fission determining mitochondrial and cell fates. In several neurological disorders, dysfunctional mitochondria show significant changes in gene and protein expression of the MQC and contribute to the pathophysiological mechanisms of cell damage. In this study, we evaluated the main gene and protein expression involved in the MQC in rats receiving traumatic brain injury (TBI) of different severities. At 6, 24, 48 and 120 hours after mild TBI (mTBI) or severe TBI (sTBI), gene and protein expressions of fusion and fission were measured in brain tissue homogenates. Compared to intact brain controls, results showed that genes and proteins inducing fusion or fission were upregulated and downregulated, respectively, in mTBI, but downregulated and upregulated, respectively, in sTBI. In particular, OPA1, regulating inner membrane dynamics, cristae remodelling, oxidative phosphorylation, was post-translationally cleaved generating differential amounts of long and short OPA1 in mTBI and sTBI. Corroborated by data referring to citrate synthase, these results confirm the transitory (mTBI) or permanent (sTBI) mitochondrial dysfunction, enhancing MQC importance to maintain cell functions and indicating in OPA1 an attractive potential therapeutic target for TBI.

[The Influence of New Medium with RGD on Cell Growth,Cell Fusion and Expression of Exogenous Gene].

PubMed

Wang, Pei-Pei; Wei, Da-Peng; Zhu, Tong-Bo

2018-03-01

To investigate the influence of a new culture medium added with RGD on cell growth,cell fusion and expression of exogenous gene. A new medium was prepared by adding different concentrations of RGD to ordinary culture medium. The optimum concentration of RGD was determined by observation of the growth of human pancreatic epithelial cell line HPDE6-C7. After determining the optimum concentration of RGD,different concentrations of cells HPDE6-C7 (5×10 4 ,10 5 ,5×10 5 mL －1 ) were inoculated in the two mediums. The morphology,adherence,growth and density of the cells were observed by inverted microscope; The ratio of clone formation and the positive rate of cloning were compared between the two cultures after fusion; The fluorescence intensity after the transfection of plasmid with green fluorescent protein ( GFP ) and the protein expression after transfection of plasmid with KRAS were observed to campare the expression of exogenous genes between the new medium with ordinary medium. Firstly,the optimal concentration of RGD was 10 ng/mL. Compared with the normal medium,the cultured cells with RGD had better morphology,adhesion and faster proliferation. In addition,both of the number and positive rate of clones formed in the new medium were significantly higher than that in the ordinary medium ( P <0.05);The fluorescence intensity after transfection of exogenous gene GFP in the new medium was significantly higher than that in normal medium ( P <0.05); Expression level of exogenous gene KRAS of the new medium was also significantly higher than that in normal medium. The new culture medium has highlighted advantages in cell growth,cell fusion and expression of exogenous genes. RGD peptide has widely prospect and potential value in the cell culture. Copyright© by Editorial Board of Journal of Sichuan University (Medical Science Edition).

FOXO1 is a direct target of EWS-Fli1 oncogenic fusion protein in Ewing's sarcoma cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Liu, E-mail: lyang@u.washington.edu; Medical Research Service, VA Puget Sound Health Care System, Seattle, WA 98108; Hu, Hsien-Ming

2010-11-05

Research highlights: {yields} Inducible and reversible siRNA knockdown of an oncogenic fusion protein such as EWS-Fli1 is feasible and more advantageous than other siRNA methods. {yields} The tumor suppressor gene FOXO1 is a new EWS-Fli1 target. {yields} While trans-activators are known for the FOXO1 gene, there has been no report on negative regulators of FOXO1 transcription. {yields} This study provides first evidence that the EWS-Fli1 oncogenic fusion protein can function as a transcriptional repressor of the FOXO1 gene. -- Abstract: Ewing's family tumors are characterized by a specific t(11;22) chromosomal translocation that results in the formation of EWS-Fli1 oncogenic fusionmore » protein. To investigate the effects of EWS-Fli1 on gene expression, we carried out DNA microarray analysis after specific knockdown of EWS-Fli1 through transfection of synthetic siRNAs. EWS-Fli1 knockdown increased expression of genes such as DKK1 and p57 that are known to be repressed by EWS-Fli1 fusion protein. Among other potential EWS-Fli1 targets identified by our microarray analysis, we have focused on the FOXO1 gene since it encodes a potential tumor suppressor and has not been previously reported in Ewing's cells. To better understand how EWS-Fli1 affects FOXO1 expression, we have established a doxycycline-inducible siRNA system to achieve stable and reversible knockdown of EWS-Fli1 in Ewing's sarcoma cells. Here we show that FOXO1 expression in Ewing's cells has an inverse relationship with EWS-Fli1 protein level, and FOXO1 promoter activity is increased after doxycycline-induced EWS-Fli1 knockdown. In addition, we have found that direct binding of EWS-Fli1 to FOXO1 promoter is attenuated after doxycycline-induced siRNA knockdown of the fusion protein. Together, these results suggest that suppression of FOXO1 function by EWS-Fli1 fusion protein may contribute to cellular transformation in Ewing's family tumors.« less

[Construction and expression of HSV-2gD-Hsp70 fusion protein gene].

PubMed

Fan, Jian-Yong; Yang, Hui-Lan; Wang, Ying; Guan, Lei

2006-11-01

To construct and express Hsp70-HSV2gD fusion protein. Genes of Hsp70 and HSV-2gD were subcloned into vectors pGEX-4T-1 respectively. After confirmed by DNA sequence analysis, the recombinant plasmids pGEX-4T-HSP-gD was transformed into E. coli DH5alpha and induced to express with IPTG. The expressed protein was characterized by SDS-PAGE and Western blot after purified. BALB/c mice were immunized with fusion proteins respectively via intra-m uscular injection. The proliferation of spleen lymphocytes, the level of y-IFN in culture and anti-HSV-2gD IgG antibody in serum was detected was detected. The expressed protein was analyzed by SDS-PAGE after induced with IPTG, which showed a new band with an apparent molecular mass corresponding to the predicted size (118 kD). Western Blotting analysis demonstrates that the purified Hsp70-HSV2gD fusion protein had specific binding activity. The stimulation indexes of spleen lymphocytes, the level of gamma-IFN in culture and anti-HSV-2gD IgG antibody in serum of GST-Hsp70-gD group was obviously higher than that of other groups (P < 0.05 respectively). The successful expression of the Hsp70-HSV2gD fusion protein, which can induce immune responses, laid a solid foundation for its further research.

CD36 is required for myoblast fusion during myogenic differentiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Park, Seung-Yoon; Yun, Youngeun; Kim, In-San, E-mail: iskim@knu.ac.kr

2012-11-02

Highlights: Black-Right-Pointing-Pointer CD36 expression was induced during myogenic differentiation. Black-Right-Pointing-Pointer CD36 expression was localized in multinucleated myotubes. Black-Right-Pointing-Pointer The expression of myogenic markers is attenuated in CD36 knockdown C2C12 cells. Black-Right-Pointing-Pointer Knockdown of CD36 significantly inhibited myotube formation during differentiation. -- Abstract: Recently, CD36 has been found to be involved in the cytokine-induced fusion of macrophage. Myoblast fusion to form multinucleated myotubes is required for myogenesis and muscle regeneration. Because a search of gene expression database revealed the attenuation of CD36 expression in the muscles of muscular dystrophy patients, the possibility that CD36 could be required for myoblast fusion wasmore » investigated. CD36 expression was markedly up-regulated during myoblast differentiation and localized in multinucleated myotubes. Knockdown of endogenous CD36 significantly decreased the expression of myogenic markers as well as myotube formation. These results support the notion that CD36 plays an important role in cell fusion during myogenic differentiation. Our finding will aid the elucidation of the common mechanism governing cell-to-cell fusion in various fusion models.« less

Effects of sulfate concentrations on the expression of a soybean seed storage protein gene and its reversibility in transgenic Arabidopsis thaliana.

PubMed

Hirai, M Y; Fujiwara, T; Chino, M; Naito, S

1995-10-01

Transgenic expression of genes encoding the alpha' and beta subunits of beta-conglycinin, one of the major seed storage proteins of soybean (Glycine max [L.] Merr.), was analyzed in Arabidopsis thaliana (L.) Heynh. under conditions of sulfate deficiency. Temporal patterns of expression of both the intact beta subunit gene and the beta subunit gene promoter fused to the beta-glucuronidase (GUS) gene are similar in soil-less cultures using rockwool, suggesting that the response to sulfate deficiency is regulated mainly at the level of transcription. In hydroponic cultures with various concentrations of sulfate, expression of both the intact beta subunit gene and the beta subunit gene promoter-GUS fusion gene were negatively correlated to increased sulfate concentrations in the culture medium. Transfer of transgenic A. thaliana plants carrying the beta subunit gene promoter-GUS fusion from sulfate-deficient to sulfate-sufficient control medium caused GUS activity in developing siliques to be repressed within two days. A reverse shift, where the plants were transferred from the control to sulfate-deficient medium, caused GUS activity to become higher than that in seeds of the control plants within two days. These results indicate that the expression of the beta subunit gene promoter responds rapidly to changes of sulfate availability.

Expression of ACC oxidase promoter-GUS fusions in tomato and Nicotiana plumbaginifolia regulated by developmental and environmental stimuli.

PubMed

Blume, B; Grierson, D

1997-10-01

The enzyme ACC oxidase, catalysing the last step in the biosynthesis of the plant hormone ethylene, is encoded by a small multigene family in tomato, comprising three members, LEACO1, LEACO2 and LEACO3. LEACO1 is the major gene expressed during ripening, leaf senescence, and wounding (Barry et al., 1996). To investigate the transcriptional regulation of ACC oxidase gene expression, chimeric fusions between the beta-glucuronidase reporter gene and 97 bp of 5' UTR plus 124, 396 and 1825 bp, respectively, of 5' untranscribed LEACO1 sequence were constructed and introduced into Lycopersicon esculentum (Mill cv. Ailsa Craig) and Nicotiana plumbaginifolia. Analysis of transgenic tomatoes indicated that the region containing nucleotides -124 to +97 of the LEACO1 gene is sufficient to confer a marked increase in GUS activity during fruit ripening, albeit at very low levels. Fusion of 396 and 1825 bp of LEACO1 upstream sequence resulted in strong and specific induction of GUS expression in situations known to be accompanied by enhanced ethylene production. Reporter gene expression was similar to that of the endogenous LEACO1 gene, with major increases especially during fruit ripening, senescence and abscission of leaves and, to a lesser extent, of flowers. Analysis of transgenic N. plumbaginifolia plants confirmed the pattern of LEACO1 promoter activity detected in tomato leaves and flowers. Reporter gene expression was also induced following wounding, treatment with ethylene, and pathogen infection. Histochemical analysis illustrated localized GUS activity in the pericarp of ripening fruit, abscission zones of senescent petioles and unfertilized flowers, and at wound sites. These results demonstrate that ACC oxidase is regulated at the transcriptional level in a wide range of cell types at different developmental stages and in response to several external stimuli.

[Cloning, expressing of exendin-4 analogue and bioactivity analysis in vivo].

PubMed

Li, Taiming; Gu, Chunjiao; Ge, Xiaoyu; Li, Zhezhe; Wang, Dan; Ma, Yanhong; Liu, Tao; Zhang, Meiyou; Li, Li; Liu, Jingjing

2012-07-01

To construct, express and purify Exendin-4 analogue and detect its biological activity in vivo. Insert gene sequence into fusion partner ofpED plasmid which is helped to purification, entitled the new recombinant plasmid 5 Exendin-4 analogue polypeptide gene and fusion partner gene was linked by acid hydrolysisgene, transformed to E. coli BL21 and the fusion protein was induced by lactose. After acid hydrolysis, the Exendin-4 analogue polypeptide separated from fusion chaperon. Anion charge chromatography were used to further purification. 6 to 8 week-old ICR mice were injected (s.c) with Exendin-4 analogue, blood glucose and plasma insulin level was detected in different period after oral glucose tolerance test. The results show that high expression of inclusion body was induced by lactose, which accounted for 40% of germ proteins, the Exendin-4 analogue was obtained with the purity of 91.8% after being purified by anion charge chromatography. Bioactivity assay showed that the level of blood glucose of mouse which treated with exendin-4 analogue was obviously decreased to normal (P < 0.01), and the level of plasma insulin was increased obviously (P < 0.01).

A new strategy for full-length Ebola virus glycoprotein expression in E.coli.

PubMed

Zai, Junjie; Yi, Yinhua; Xia, Han; Zhang, Bo; Yuan, Zhiming

2016-12-01

Ebola virus (EBOV) causes severe hemorrhagic fever in humans and non-human primates with high rates of fatality. Glycoprotein (GP) is the only envelope protein of EBOV, which may play a critical role in virus attachment and entry as well as stimulating host protective immune responses. However, the lack of expression of full-length GP in Escherichia coli hinders the further study of its function in viral pathogenesis. In this study, the vp40 gene was fused to the full-length gp gene and cloned into a prokaryotic expression vector. We showed that the VP40-GP and GP-VP40 fusion proteins could be expressed in E.coli at 16 °C. In addition, it was shown that the position of vp40 in the fusion proteins affected the yields of the fusion proteins, with a higher level of production of the fusion protein when vp40 was upstream of gp compared to when it was downstream. The results provide a strategy for the expression of a large quantity of EBOV full-length GP, which is of importance for further analyzing the relationship between the structure and function of GP and developing an antibody for the treatment of EBOV infection.

Myogenin, AP2β, NOS-1, and HMGA2 are surrogate markers of fusion status in rhabdomyosarcoma: a report from the soft tissue sarcoma committee of the children's oncology group.

PubMed

Rudzinski, Erin R; Anderson, James R; Lyden, Elizabeth R; Bridge, Julia A; Barr, Frederic G; Gastier-Foster, Julie M; Bachmeyer, Karen; Skapek, Stephen X; Hawkins, Douglas S; Teot, Lisa A; Parham, David M

2014-05-01

Pediatric rhabdomyosarcoma (RMS) is traditionally classified on the basis of the histologic appearance into alveolar (ARMS) and embryonal (ERMS) subtypes. The majority of ARMS contain a PAX3-FOXO1 or PAX7-FOXO1 gene fusion, but about 20% do not. Intergroup Rhabdomyosarcoma Study stage-matched and group-matched ARMS typically behaves more aggressively than ERMS, but recent studies have shown that it is, in fact, the fusion status that drives the outcome for RMS. Gene expression microarray data indicate that several genes discriminate between fusion-positive and fusion-negative RMS with high specificity. Using tissue microarrays containing a series of both ARMS and ERMS, we identified a panel of 4 immunohistochemical markers-myogenin, AP2β, NOS-1, and HMGA2-which can be used as surrogate markers of fusion status in RMS. These antibodies provide an alternative to molecular methods for identification of fusion-positive RMS, particularly in cases in which there is scant or poor-quality material. In addition, these antibodies may be useful in fusion-negative ARMS as an indicator that a variant gene fusion may be present.

Construction, expression, and localization of a CycA::PhoA fusion protein in Rhodobacter sphaeroides and Escherichia coli.

PubMed Central

Varga, A R; Kaplan, S

1989-01-01

We demonstrated the utility of Escherichia coli alkaline phosphatase, encoded by phoA, as a reporter molecule for genetic fusions in Rhodobacter sphaeroides. A portion of the R. sphaeroides cycA gene was fused to phoA, yielding a fusion protein comprising the putative signal sequence and first 10 amino acids of the cytochrome c2 apoprotein joined to the sixth amino acid of alkaline phosphatase. The fusion protein was efficiently transported to the periplasm of R. sphaeroides as determined by enzyme activity, Western immunoblot analysis, and immunogold electron microscopy. We also documented the ability of an R. sphaeroides mutant, RS104, with gross defects in photosynthetic membrane morphology to efficiently recognize and translocate the fusion protein to the periplasmic compartment. The inclusion of 500 base pairs of R. sphaeroides DNA in cis to the cycA structural gene resulted in a 2.5-fold increase in alkaline phosphatase activity in photosynthetically grown cells compared with the activity in aerobically grown cells, demonstrating that the fusion protein is regulated in a manner similar to that of cytochrome c2 regulation. We also constructed two pUC19-based plasmids suitable for the construction of translational fusions to phoA. In these plasmids, translational fusions of phoA to the gene under consideration can be made in all three reading frames, thus facilitating construction and expression of fusion protein systems utilizing phoA. Images PMID:2553661

Expression of homing endonuclease gene and insertion-like element in sea anemone mitochondrial genomes: Lesson learned from Anemonia viridis.

PubMed

Chi, Sylvia Ighem; Urbarova, Ilona; Johansen, Steinar D

2018-04-30

The mitochondrial genomes of sea anemones are dynamic in structure. Invasion by genetic elements, such as self-catalytic group I introns or insertion-like sequences, contribute to sea anemone mitochondrial genome expansion and complexity. By using next generation sequencing we investigated the complete mtDNAs and corresponding transcriptomes of the temperate sea anemone Anemonia viridis and its closer tropical relative Anemonia majano. Two versions of fused homing endonuclease gene (HEG) organization were observed among the Actiniidae sea anemones; in-frame gene fusion and pseudo-gene fusion. We provided support for the pseudo-gene fusion organization in Anemonia species, resulting in a repressed HEG from the COI-884 group I intron. orfA, a putative protein-coding gene with insertion-like features, was present in both Anemonia species. Interestingly, orfA and COI expression were significantly up-regulated upon long-term environmental stress corresponding to low seawater pH conditions. This study provides new insights to the dynamics of sea anemone mitochondrial genome structure and function. Copyright © 2018 Elsevier B.V. All rights reserved.

Matrix factorization-based data fusion for gene function prediction in baker's yeast and slime mold.

PubMed

Zitnik, Marinka; Zupan, Blaž

2014-01-01

The development of effective methods for the characterization of gene functions that are able to combine diverse data sources in a sound and easily-extendible way is an important goal in computational biology. We have previously developed a general matrix factorization-based data fusion approach for gene function prediction. In this manuscript, we show that this data fusion approach can be applied to gene function prediction and that it can fuse various heterogeneous data sources, such as gene expression profiles, known protein annotations, interaction and literature data. The fusion is achieved by simultaneous matrix tri-factorization that shares matrix factors between sources. We demonstrate the effectiveness of the approach by evaluating its performance on predicting ontological annotations in slime mold D. discoideum and on recognizing proteins of baker's yeast S. cerevisiae that participate in the ribosome or are located in the cell membrane. Our approach achieves predictive performance comparable to that of the state-of-the-art kernel-based data fusion, but requires fewer data preprocessing steps.

Construction of a β-galactosidase-gene-based fusion is convenient for screening candidate genes involved in regulation of pyrrolnitrin biosynthesis in Pseudomonas chlororaphis G05.

PubMed

Luo, Wangtai; Miao, Jing; Feng, Zhibin; Lu, Ruiyang; Sun, Xiaoqiang; Zhang, Baoshen; Ding, Weiqiu; Lu, Yang; Wang, Yanhua; Chi, Xiaoyan; Ge, Yihe

2018-05-28

In our recent work, we found that pyrrolnitrin, and not phenazines, pyrrolnitrin contributed to the suppression of the mycelia growth of Fusarium graminearum that causes heavy Fusarium head blight (FHB) disease in cereal crops. However, pyrrolnitrin production of Pseudomonas chlororaphis G05 in King's B medium was very low. Although a few regulatory genes mediating the prnABCD (the prn operon, pyrrolnitrin biosynthetic locus) expression have been identified, it is not enough for us to enhance pyrrolnitrin production by systematically constructing a genetically-engineered strain. To obtain new candidate genes involved in regulation of the prn operon expression, we successfully constructed a fusion mutant G05ΔphzΔprn::lacZ, in which most of the coding regions of the prn operon and the phzABCDEFG (the phz operon, phenazine biosynthetic locus) were deleted, and the promoter region plus the first thirty condons of the prnA was in-frame fused with the truncated lacZ gene on its chromosome. The expression of the fused lacZ reporter gene driven by the promoter of the prn operon made it easy for us to detect the level of the prn expression in terms of the color variation of colonies on LB agar plates supplemented with 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal). With this fusion mutant as a recipient strain, mini-Tn5-based random insertional mutagenesis was then conducted. By picking up colonies with color change, it is possible for us to screen and identify new candidate genes involved in regulation of the prn expression. Identification of additional regulatory genes in further work could reasonably be expected to increase pyrrolnitrin production in G05 and to improve its biological control function.

Identification of Alternative Splicing and Fusion Transcripts in Non-Small Cell Lung Cancer by RNA Sequencing.

PubMed

Hong, Yoonki; Kim, Woo Jin; Bang, Chi Young; Lee, Jae Cheol; Oh, Yeon-Mok

2016-04-01

Lung cancer is the most common cause of cancer related death. Alterations in gene sequence, structure, and expression have an important role in the pathogenesis of lung cancer. Fusion genes and alternative splicing of cancer-related genes have the potential to be oncogenic. In the current study, we performed RNA-sequencing (RNA-seq) to investigate potential fusion genes and alternative splicing in non-small cell lung cancer. RNA was isolated from lung tissues obtained from 86 subjects with lung cancer. The RNA samples from lung cancer and normal tissues were processed with RNA-seq using the HiSeq 2000 system. Fusion genes were evaluated using Defuse and ChimeraScan. Candidate fusion transcripts were validated by Sanger sequencing. Alternative splicing was analyzed using multivariate analysis of transcript sequencing and validated using quantitative real time polymerase chain reaction. RNA-seq data identified oncogenic fusion genes EML4-ALK and SLC34A2-ROS1 in three of 86 normal-cancer paired samples. Nine distinct fusion transcripts were selected using DeFuse and ChimeraScan; of which, four fusion transcripts were validated by Sanger sequencing. In 33 squamous cell carcinoma, 29 tumor specific skipped exon events and six mutually exclusive exon events were identified. ITGB4 and PYCR1 were top genes that showed significant tumor specific splice variants. In conclusion, RNA-seq data identified novel potential fusion transcripts and splice variants. Further evaluation of their functional significance in the pathogenesis of lung cancer is required.

Modeling of the Human Alveolar Rhabdomyosarcoma Pax3-Foxo1 Chromosome Translocation in Mouse Myoblasts Using CRISPR-Cas9 Nuclease

PubMed Central

Lagutina, Irina V.; Valentine, Virginia; Picchione, Fabrizio; Harwood, Frank; Valentine, Marcus B.; Villarejo-Balcells, Barbara; Carvajal, Jaime J.; Grosveld, Gerard C.

2015-01-01

Many recurrent chromosome translocations in cancer result in the generation of fusion genes that are directly implicated in the tumorigenic process. Precise modeling of the effects of cancer fusion genes in mice has been inaccurate, as constructs of fusion genes often completely or partially lack the correct regulatory sequences. The reciprocal t(2;13)(q36.1;q14.1) in human alveolar rhabdomyosarcoma (A-RMS) creates a pathognomonic PAX3-FOXO1 fusion gene. In vivo mimicking of this translocation in mice is complicated by the fact that Pax3 and Foxo1 are in opposite orientation on their respective chromosomes, precluding formation of a functional Pax3-Foxo1 fusion via a simple translocation. To circumvent this problem, we irreversibly inverted the orientation of a 4.9 Mb syntenic fragment on chromosome 3, encompassing Foxo1, by using Cre-mediated recombination of two pairs of unrelated oppositely oriented LoxP sites situated at the borders of the syntenic region. We tested if spatial proximity of the Pax3 and Foxo1 loci in myoblasts of mice homozygous for the inversion facilitated Pax3-Foxo1 fusion gene formation upon induction of targeted CRISPR-Cas9 nuclease-induced DNA double strand breaks in Pax3 and Foxo1. Fluorescent in situ hybridization indicated that fore limb myoblasts show a higher frequency of Pax3/Foxo1 co-localization than hind limb myoblasts. Indeed, more fusion genes were generated in fore limb myoblasts via a reciprocal t(1;3), which expressed correctly spliced Pax3-Foxo1 mRNA encoding Pax3-Foxo1 fusion protein. We conclude that locus proximity facilitates chromosome translocation upon induction of DNA double strand breaks. Given that the Pax3-Foxo1 fusion gene will contain all the regulatory sequences necessary for precise regulation of its expression, we propose that CRISPR-Cas9 provides a novel means to faithfully model human diseases caused by chromosome translocation in mice. PMID:25659124

Duchenne Muscular Dystrophy Gene Expression in Normal and Diseased Human Muscle

NASA Astrophysics Data System (ADS)

Oronzi Scott, M.; Sylvester, J. E.; Heiman-Patterson, T.; Shi, Y.-J.; Fieles, W.; Stedman, H.; Burghes, A.; Ray, P.; Worton, R.; Fischbeck, K. H.

1988-03-01

A probe for the 5' end of the Duchenne muscular dystrophy (DMD) gene was used to study expression of the gene in normal human muscle, myogenic cell cultures, and muscle from patients with DMD. Expression was found in RNA from normal fetal muscle, adult cardiac and skeletal muscle, and cultured muscle after myoblast fusion. In DMD muscle, expression of this portion of the gene was also revealed by in situ RNA hybridization, particularly in regenerating muscle fibers.

Capmatinib, Ceritinib, Regorafenib, or Entrectinib in Treating Patients With BRAF/NRAS Wild-Type Stage III-IV Melanoma

ClinicalTrials.gov

2017-12-20

ALK Fusion Protein Expression; BRAF wt Allele; Invasive Skin Melanoma; MET Fusion Gene Positive; NRAS wt Allele; NTRK1 Fusion Positive; NTRK2 Fusion Positive; NTRK3 Fusion Positive; RET Fusion Positive; ROS1 Fusion Positive; Stage III Cutaneous Melanoma AJCC v7; Stage IIIA Cutaneous Melanoma AJCC v7; Stage IIIB Cutaneous Melanoma AJCC v7; Stage IIIC Cutaneous Melanoma AJCC v7; Stage IV Cutaneous Melanoma AJCC v6 and v7

Identification of molecular tumor markers in renal cell carcinomas with TFE3 protein expression by RNA sequencing.

PubMed

Pflueger, Dorothee; Sboner, Andrea; Storz, Martina; Roth, Jasmine; Compérat, Eva; Bruder, Elisabeth; Rubin, Mark A; Schraml, Peter; Moch, Holger

2013-11-01

TFE3 translocation renal cell carcinoma (tRCC) is defined by chromosomal translocations involving the TFE3 transcription factor at chromosome Xp11.2. Genetically proven TFE3 tRCCs have a broad histologic spectrum with overlapping features to other renal tumor subtypes. In this study, we aimed for characterizing RCC with TFE3 protein expression. Using next-generation whole transcriptome sequencing (RNA-Seq) as a discovery tool, we analyzed fusion transcripts, gene expression profile, and somatic mutations in frozen tissue of one TFE3 tRCC. By applying a computational analysis developed to call chimeric RNA molecules from paired-end RNA-Seq data, we confirmed the known TFE3 translocation. Its fusion partner SFPQ has already been described as fusion partner in tRCCs. In addition, an RNA read-through chimera between TMED6 and COG8 as well as MET and KDR (VEGFR2) point mutations were identified. An EGFR mutation, but no chromosomal rearrangements, was identified in a control group of five clear cell RCCs (ccRCCs). The TFE3 tRCC could be clearly distinguished from the ccRCCs by RNA-Seq gene expression measurements using a previously reported tRCC gene signature. In validation experiments using reverse transcription-PCR, TMED6-COG8 chimera expression was significantly higher in nine TFE3 translocated and six TFE3-expressing/non-translocated RCCs than in 24 ccRCCs (P < .001) and 22 papillary RCCs (P < .05-.07). Immunohistochemical analysis of selected genes from the tRCC gene signature showed significantly higher eukaryotic translation elongation factor 1 alpha 2 (EEF1A2) and Contactin 3 (CNTN3) expression in 16 TFE3 translocated and six TFE3-expressing/non-translocated RCCs than in over 200 ccRCCs (P < .0001, both).

Induction of apoptosis in rhabdomyosarcoma cells through down-regulation of PAX proteins

PubMed Central

Bernasconi, Michele; Remppis, Andrew; Fredericks, William J.; Rauscher, Frank J.; Schäfer, Beat W.

1996-01-01

The expression of a number of human paired box-containing (PAX) genes has been correlated with various types of tumors. Novel fusion genes encoding chimeric fusion proteins have been found in the pediatric malignant tumor alveolar rhabdomyosarcoma (RMS). They are generated by two chromosomal translocations t(2;13) and t(1;13) juxtaposing PAX3 or PAX7, respectively, with a forkhead domain gene FKHR. Here we describe that specific down-regulation of the t(2;13) translocation product in alveolar RMS cells by antisense oligonucleotides results in reduced cellular viability. Cells of embryonal RMS, the other major histiotype of this tumor, were found to express either wild type PAX3 or PAX7 at elevated levels when compared with primary human myoblasts. Treatment of corresponding embryonal RMS cells with antisense olignucleotides directed against the mRNA translational start site of either one of these two transcription factors similarly triggers cell death, which is most likely due to induction of apoptosis. Retroviral mediated ectopic expression of mouse Pax3 in a PAX7 expressing embryonal RMS cell line could partially rescue antisense induced apoptosis. These data suggest that the PAX3/FKHR fusion gene and wild-type PAX genes play a causative role in the formation of RMS and presumably other tumor types, possibly by suppressing the apoptotic program that would normally eliminate these cells. PMID:8917562

Clinicopathological Characteristics of Patients with Non-Small-Cell Lung Cancer Who Harbor EML4-ALK Fusion Gene: A Meta-Analysis

PubMed Central

Zhao, Fengzhi; Xu, Meng; Lei, Honcho; Zhou, Ziqi; Wang, Liang; Li, Ping; Zhao, Jianfu; Hu, Penghui

2015-01-01

Background A novel fusion gene of echinoderm microtubule-associated protein-like 4 (EML4) and anaplastic lymphoma kinase (ALK) has been recently identified in non-small-cell lung cancers (NSCLCs). Patients with the EML4-ALK fusion gene demonstrate unique clinicopathological and physiological characteristics. Here we present a meta-analysis of large-scale studies to evaluate the clinicopathological characteristics of NSCLC patients harboring the EML4-ALK fusion gene. Methods Both English and Chinese databases were systematically used to search the materials of the clinicopathological characteristics of patients with NSCLC harboring the EML4-ALK fusion gene. Pooled relative risk (RR) estimates and the 95% confidence intervals (95% CI) were calculated with the fixed or random effect model. Publication bias and chi-square test were also calculated. Results 27 retrospective studies were included in our meta-analysis. These studies included a total of 6950 patients. The incidence rate of EML4-ALK fusion in NSCLC patients was found to be 6.8% (472/6950). The correlation of the EML4-ALK fusion gene and clinicopathological characteristics of NSCLC patients demonstrated a significant difference in smoking status, histological types, stage, and ethnic characteristics. The positive rate of the EML4-ALK fusion gene expression in females were slightly higher than that in males, but not significantly (P = 0.52). In addition, the EML4-ALK fusion gene was mutually exclusive of the EGFR and KRAS mutation genes (P = 0.00). Conclusion Our pooled analysis revealed that the EML4-ALK fusion gene was observed predominantly in adenocarcinoma, non-smoking and NSCLC patients, especially those diagnosed in the advanced clinical stage of NSCLC. Additionally, the EML4-ALK fusion gene was exclusive of the EGFR and KRAS mutation genes. We surmise that IHC assay is a valuable tool for the prescreening of patients with ALK fusion gene in clinical practice, and FISH assay can be performed as a confirmation method. These insights might be helpful in guiding the appropriate molecular target therapy for NSCLC. PMID:25706305

Clinicopathological characteristics of patients with non-small-cell lung cancer who harbor EML4-ALK fusion gene: a meta-analysis.

PubMed

Zhao, Fengzhi; Xu, Meng; Lei, Honcho; Zhou, Ziqi; Wang, Liang; Li, Ping; Zhao, Jianfu; Hu, Penghui

2015-01-01

A novel fusion gene of echinoderm microtubule-associated protein-like 4 (EML4) and anaplastic lymphoma kinase (ALK) has been recently identified in non-small-cell lung cancers (NSCLCs). Patients with the EML4-ALK fusion gene demonstrate unique clinicopathological and physiological characteristics. Here we present a meta-analysis of large-scale studies to evaluate the clinicopathological characteristics of NSCLC patients harboring the EML4-ALK fusion gene. Both English and Chinese databases were systematically used to search the materials of the clinicopathological characteristics of patients with NSCLC harboring the EML4-ALK fusion gene. Pooled relative risk (RR) estimates and the 95% confidence intervals (95% CI) were calculated with the fixed or random effect model. Publication bias and chi-square test were also calculated. 27 retrospective studies were included in our meta-analysis. These studies included a total of 6950 patients. The incidence rate of EML4-ALK fusion in NSCLC patients was found to be 6.8% (472/6950). The correlation of the EML4-ALK fusion gene and clinicopathological characteristics of NSCLC patients demonstrated a significant difference in smoking status, histological types, stage, and ethnic characteristics. The positive rate of the EML4-ALK fusion gene expression in females were slightly higher than that in males, but not significantly (P = 0.52). In addition, the EML4-ALK fusion gene was mutually exclusive of the EGFR and KRAS mutation genes (P = 0.00). Our pooled analysis revealed that the EML4-ALK fusion gene was observed predominantly in adenocarcinoma, non-smoking and NSCLC patients, especially those diagnosed in the advanced clinical stage of NSCLC. Additionally, the EML4-ALK fusion gene was exclusive of the EGFR and KRAS mutation genes. We surmise that IHC assay is a valuable tool for the prescreening of patients with ALK fusion gene in clinical practice, and FISH assay can be performed as a confirmation method. These insights might be helpful in guiding the appropriate molecular target therapy for NSCLC.

Alternative dominance of the parental genomes in hybrid cells generated through the fusion of mouse embryonic stem cells with fibroblasts.

PubMed

Matveeva, Natalia M; Fishman, Veniamin S; Zakharova, Irina S; Shevchenko, Alexander I; Pristyazhnyuk, Inna E; Menzorov, Aleksei G; Serov, Oleg L

2017-12-22

For the first time, two types of hybrid cells with embryonic stem (ES) cell-like and fibroblast-like phenotypes were produced through the fusion of mouse ES cells with fibroblasts. Transcriptome analysis of 2,848 genes differentially expressed in the parental cells demonstrated that 34-43% of these genes are expressed in hybrid cells, consistent with their phenotypes; 25-29% of these genes display intermediate levels of expression, and 12-16% of these genes maintained expression at the parental cell level, inconsistent with the phenotype of the hybrid cell. Approximately 20% of the analyzed genes displayed unexpected expression patterns that differ from both parents. An unusual phenomenon was observed, namely, the illegitimate activation of Xist expression and the inactivation of one of two X-chromosomes in the near-tetraploid fibroblast-like hybrid cells, whereas both Xs were active before and after in vitro differentiation of the ES cell-like hybrid cells. These results and previous data obtained on heterokaryons suggest that the appearance of hybrid cells with a fibroblast-like phenotype reflects the reprogramming, rather than the induced differentiation, of the ES cell genome under the influence of a somatic partner.

TFG-MET fusion in an infantile spindle cell sarcoma with neural features.

PubMed

Flucke, Uta; van Noesel, Max M; Wijnen, Marc; Zhang, Lei; Chen, Chun-Liang; Sung, Yun-Shao; Antonescu, Cristina R

2017-09-01

An increasing number of congenital and infantile sarcomas displaying a primitive, monomorphic spindle cell phenotype have been characterized to harbor recurrent gene fusions, including infantile fibrosarcoma and congenital spindle cell rhabdomyosarcoma. Here, we report an unusual spindle cell sarcoma presenting as a large and infiltrative pelvic soft tissue mass in a 4-month-old girl, which revealed a novel TFG-MET gene fusion by whole transcriptome RNA sequencing. The tumor resembled the morphology of an infantile fibrosarcoma with both fascicular and patternless growth, however, it expressed strong S100 protein immunoreactivity, while lacking SOX10 staining and retaining H3K27me3 expression. Although this immunoprofile suggested partial neural/neuroectodermal differentiation, overall features were unusual and did not fit into any known tumor types (cellular schwannoma, MPNST), raising the possibility of a novel pathologic entity. The TFG-MET gene fusion expands the genetic spectrum implicated in the pathogenesis of congenital spindle cell sarcomas, with yet another example of kinase oncogenic activation through chromosomal translocation. The discovery of this new fusion is significant since the resulting MET activation can potentially be inhibited by targeted therapy, as MET inhibitors are presently available in clinical trials. © 2017 Wiley Periodicals, Inc.

Tissue-specific and pathogen-inducible expression of a fusion protein containing a Fusarium-specific antibody and a fungal chitinase protects wheat against Fusarium pathogens and mycotoxins.

PubMed

Cheng, Wei; Li, He-Ping; Zhang, Jing-Bo; Du, Hong-Jie; Wei, Qi-Yong; Huang, Tao; Yang, Peng; Kong, Xian-Wei; Liao, Yu-Cai

2015-06-01

Fusarium head blight (FHB) in wheat and other small grain cereals is a globally devastating disease caused by toxigenic Fusarium pathogens. Controlling FHB is a challenge because germplasm that is naturally resistant against these pathogens is inadequate. Current control measures rely on fungicides. Here, an antibody fusion comprised of the Fusarium spp.-specific recombinant antibody gene CWP2 derived from chicken, and the endochitinase gene Ech42 from the biocontrol fungus Trichoderma atroviride was introduced into the elite wheat cultivar Zhengmai9023 by particle bombardment. Expression of this fusion gene was regulated by the lemma/palea-specific promoter Lem2 derived from barley; its expression was confirmed as lemma/palea-specific in transgenic wheat. Single-floret inoculation of independent transgenic wheat lines of the T3 to T6 generations revealed significant resistance (type II) to fungal spreading, and natural infection assays in the field showed significant resistance (type I) to initial infection. Gas chromatography-mass spectrometry analysis revealed marked reduction of mycotoxins in the grains of the transgenic wheat lines. Progenies of crosses between the transgenic lines and the FHB-susceptible cultivar Huamai13 also showed significantly enhanced FHB resistance. Quantitative real-time PCR analysis revealed that the tissue-specific expression of the antibody fusion was induced by salicylic acid drenching and induced to a greater extent by F. graminearum infection. Histochemical analysis showed substantial restriction of mycelial growth in the lemma tissues of the transgenic plants. Thus, the combined tissue-specific and pathogen-inducible expression of this Fusarium-specific antibody fusion can effectively protect wheat against Fusarium pathogens and reduce mycotoxin content in grain. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

[Expression of the fusion protein CFP10-ESAT6 of Mycobacterium tuberculosis and the study of its immunogenicity].

PubMed

Wang, Xiao-ying; Bao, Lang; Zhao, Ming-cai; Zhang, Hui-dong; Long, Yang

2006-05-01

To express a recombinant fusion protein CFP10-ESAT6 of Mycobacterium tuberculosis, and obtain the polyclonal antibodies of this fusion protein by immune rabbit. The 630 bp cfpl0-esat6 fusion gene fragments were amplified from the genomic DNA of a Mycobacterium tuberculosis reference strain H37Rv and inserted into the expression plasmid pET32a (+) to generate the recombinant plasmid pET-cfp10-esat6. The recombinat expression plasmid was transformed into E. coli BL21 (DE3). The fused protein CFP10-ESAT6 with His-tag was expressed after inducing with IPTG and purified with affinity chromatography. This protein was used to immune the rabbit to obtained the polyclonal antibodies, and been analyzed with Western-blot and ELISA. The recombinant plasmid pET-cfp10-esat6 was success fully constructed, the recombinant fusion protein CFP10-ESAT6 could be expressed at relatively high levels, and the polyclonal antibodies of fusion protein were obtained. The successful construction and expression of the recombinant fusion protein CFP10-ESAT6 and the obtained polyclonal antibodies will be very helpful for the development of new anti-tuberculosis vaccine and the clinical serologic diagnosis.

Systematic identification and analysis of frequent gene fusion events in metabolic pathways

DOE Office of Scientific and Technical Information (OSTI.GOV)

Henry, Christopher S.; Lerma-Ortiz, Claudia; Gerdes, Svetlana Y.

Here, gene fusions are the most powerful type of in silico-derived functional associations. However, many fusion compilations were made when <100 genomes were available, and algorithms for identifying fusions need updating to handle the current avalanche of sequenced genomes. The availability of a large fusion dataset would help probe functional associations and enable systematic analysis of where and why fusion events occur. As a result, here we present a systematic analysis of fusions in prokaryotes. We manually generated two training sets: (i) 121 fusions in the model organism Escherichia coli; (ii) 131 fusions found in B vitamin metabolism. These setsmore » were used to develop a fusion prediction algorithm that captured the training set fusions with only 7 % false negatives and 50 % false positives, a substantial improvement over existing approaches. This algorithm was then applied to identify 3.8 million potential fusions across 11,473 genomes. The results of the analysis are available in a searchable database. A functional analysis identified 3,000 reactions associated with frequent fusion events and revealed areas of metabolism where fusions are particularly prevalent. In conclusion, customary definitions of fusions were shown to be ambiguous, and a stricter one was proposed. Exploring the genes participating in fusion events showed that they most commonly encode transporters, regulators, and metabolic enzymes. The major rationales for fusions between metabolic genes appear to be overcoming pathway bottlenecks, avoiding toxicity, controlling competing pathways, and facilitating expression and assembly of protein complexes. Finally, our fusion dataset provides powerful clues to decipher the biological activities of domains of unknown function.« less

Systematic identification and analysis of frequent gene fusion events in metabolic pathways

DOE PAGES

Henry, Christopher S.; Lerma-Ortiz, Claudia; Gerdes, Svetlana Y.; ...

2016-06-24

Here, gene fusions are the most powerful type of in silico-derived functional associations. However, many fusion compilations were made when <100 genomes were available, and algorithms for identifying fusions need updating to handle the current avalanche of sequenced genomes. The availability of a large fusion dataset would help probe functional associations and enable systematic analysis of where and why fusion events occur. As a result, here we present a systematic analysis of fusions in prokaryotes. We manually generated two training sets: (i) 121 fusions in the model organism Escherichia coli; (ii) 131 fusions found in B vitamin metabolism. These setsmore » were used to develop a fusion prediction algorithm that captured the training set fusions with only 7 % false negatives and 50 % false positives, a substantial improvement over existing approaches. This algorithm was then applied to identify 3.8 million potential fusions across 11,473 genomes. The results of the analysis are available in a searchable database. A functional analysis identified 3,000 reactions associated with frequent fusion events and revealed areas of metabolism where fusions are particularly prevalent. In conclusion, customary definitions of fusions were shown to be ambiguous, and a stricter one was proposed. Exploring the genes participating in fusion events showed that they most commonly encode transporters, regulators, and metabolic enzymes. The major rationales for fusions between metabolic genes appear to be overcoming pathway bottlenecks, avoiding toxicity, controlling competing pathways, and facilitating expression and assembly of protein complexes. Finally, our fusion dataset provides powerful clues to decipher the biological activities of domains of unknown function.« less

Molecular alterations in tumorigenic human bronchial and breast epithelial cells induced by high let radiation

NASA Astrophysics Data System (ADS)

Hei, T. K.; Zhao, Y. L.; Roy, D.; Piao, C. Q.; Calaf, G.; Hall, E. J.

Carcinogenesis is a multi-stage process with sequence of genetic events governing the phenotypic expression of a series of transformation steps leading to the development of metastatic cancer. In the present study, immortalized human bronchial (BEP2D) and breast (MCF-10F) cells were irradiated with graded doses of either 150 keV/μm alpha particles or 1 GeV/nucleon 56Fe ions. Transformed cells developed through a series of successive steps before becoming tumorigenic in nude mice. Cell fusion studies indicated that radiation-induced tumorigenic phenotype in BEP2D cells could be completely suppressed by fusion with non-tumorigenic BEP2D cells. The differential expressions of known genes between tumorigenic bronchial and breast cells induced by alpha particles and their respective control cultures were compared using cDNA expression array. Among the 11 genes identified to be differentially expressed in BEP2D cells, three ( DCC, DNA-PK and p21 CIPI) were shown to be consistently down-regulated by 2 to 4 fold in all the 5 tumor cell lines examined. In contrast, their expressions in the fusion cell lines were comparable to control BEP2D cells. Similarly, expression levels of a series of genes were found to be altered in a step-wise manner among tumorigenic MCF-10F cells. The results are highly suggestive that functional alterations of these genes may be causally related to the carcinogenic process.

Construction of fusion vectors of corynebacteria: expression of glutathione-S-transferase fusion protein in Corynebacterium acetoacidophilum ATCC 21476.

PubMed

Srivastava, Preeti; Deb, J K

2002-07-02

A series of fusion vectors containing glutathione-S-transferase (GST) were constructed by inserting GST fusion cassette of Escherichia coli vectors pGEX4T-1, -2 and -3 in corynebacterial vector pBK2. Efficient expression of GST driven by inducible tac promoter of E. coli was observed in Corynebacterium acetoacidophilum. Fusion of enhanced green fluorescent protein (EGFP) and streptokinase genes in this vector resulted in the synthesis of both the fusion proteins. The ability of this recombinant organism to produce several-fold more of the product in the extracellular medium than in the intracellular space would make this system quite attractive as far as the downstream processing of the product is concerned.

Effects of Subinhibitory Concentrations of Antibiotics on Alpha-Toxin (hla) Gene Expression of Methicillin-Sensitive and Methicillin-Resistant Staphylococcus aureus Isolates

PubMed Central

Ohlsen, Knut; Ziebuhr, Wilma; Koller, Klaus-Peter; Hell, Wolfgang; Wichelhaus, Thomas A.; Hacker, Jörg

1998-01-01

Concentrations of antibiotics below the MIC are able to modulate the expression of virulence-associated genes. In this study, the influence of subinhibitory doses of 31 antibiotics on the expression of the gene encoding the staphylococcal alpha-toxin (hla), a major virulence factor of Staphylococcus aureus, was investigated with a novel gene fusion protocol. The most striking observation was a strong induction of hla expression by subinhibitory concentrations of β-lactams and an almost complete inhibition of alpha-toxin expression by clindamycin. Whereas glycopeptide antibiotics had no effect, the macrolide erythromycin and several aminoglycosides reduced and fluoroquinolones slightly stimulated hla expression. Furthermore, Northern blot analysis of hla mRNA and Western blot (immunoblot) analysis of culture supernatants of both methicillin-sensitive and methicillin-resistant S. aureus strains revealed that methicillin-induced alpha-toxin expression is a common phenomenon of alpha-toxin-producing strains. Some methicillin-resistant S. aureus isolates produced up to 30-fold more alpha-toxin in the presence of 10 μg of methicillin per ml than in its absence. The results indicate that the novel gene fusion technique is a useful tool for studying the modulation of virulence gene expression by antibiotics. Moreover, the results suggest that the effects of certain antibiotics on virulence properties may be relevant for the management of S. aureus infections. PMID:9797209

Cloning and characterization of an adenoviral vector for highly efficient and doxycycline – suppressible expression of bioactive human single – chain interleukin 12 in colon cancer

PubMed Central

Wulff, Holger; Krieger, Thorsten; Krüger, Karen; Stahmer, Ingrid; Thaiss, Friedrich; Schäfer, Hansjörg; Block, Andreas

2007-01-01

Background Interleukin-12 (IL-12) is well characterized to induce cellular antitumoral immunity by activation of NK-cells and T-lymphocytes. However, systemic administration of recombinant human IL-12 resulted in severe toxicity without perceptible therapeutic benefit. Even though intratumoral expression of IL-12 leads to tumor regression and long-term survival in a variety of animal models, clinical trials have not yet shown a significant therapeutic benefit. One major obstacle in the treatment with IL-12 is to overcome the relatively low expression of the therapeutic gene without compromising the safety of such an approach. Our objective was to generate an adenoviral vector system enabling the regulated expression of very high levels of bioactive, human IL-12. Results High gene expression was obtained utilizing the VP16 herpes simplex transactivator. Strong regulation of gene expression was realized by fusion of the VP16 to a tetracycline repressor with binding of the fusion protein to a flanking tetracycline operator and further enhanced by auto-regulated expression of its fusion gene within a bicistronic promoter construct. Infection of human colon cancer cells (HT29) at a multiplicity of infection (m.o.i.) of 10 resulted in the production of up to 8000 ng/106 cells in 48 h, thus exceeding any published vector system so far. Doxycycline concentrations as low as 30 ng/ml resulted in up to 5000-fold suppression, enabling significant reduction of gene expression in a possible clinical setting. Bioactivity of the human single-chain IL-12 was similar to purified human heterodimeric IL-12. Frozen sections of human colon cancer showed high expression of the coxsackie adenovirus receptor with significant production of human single chain IL-12 in colon cancer biopsies after infection with 3*107 p.f.u. Ad.3r-scIL12. Doxycycline mediated suppression of gene expression was up to 9000-fold in the infected colon cancer tissue. Conclusion VP16 transactivator-mediated and doxycycline-regulated expression of the human interleukin-12 gene enables highly efficient and tightly controlled cytokine expression in human cancer. These data illustrate the potential of the described adenoviral vector system for the safe and superior expression of therapeutic genes in the treatment of colorectal cancer and other malignancies. PMID:17594499

Studies on the expression of an H-2K/human growth hormone fusion gene in giant transgenic mice.

PubMed Central

Morello, D; Moore, G; Salmon, A M; Yaniv, M; Babinet, C

1986-01-01

Transgenic mice carrying the H-2K/human growth hormone (hGH) fusion gene were produced by microinjecting into the pronucleus of fertilized eggs DNA molecules containing 2 kb of the 5' flanking sequences (including promoter) of the class I H-2Kb gene joined to the coding sequences of the hGH gene. Thirteen transgenic mice were obtained which all contained detectable levels of hGH hormone in their blood. Nine grew larger than their control litter-mates. Endogenous H-2Kb and exogenous hGH mRNA levels were analysed by S1 nuclease digestion experiments. hGH transcripts were found in all the tissues examined and the pattern of expression paralleled that of endogenous H-2K gene expression, being high in liver and lymphoid organs and low in muscle and brain. Thus 2 kb of the 5' promoter/regulatory region of the H-2K gene are sufficient to ensure regulated expression of hGH in transgenic mice. This promoter may therefore be of use to target the expression of different exogenous genes in most tissues of transgenic mice and to study the biological role of the corresponding proteins in different cellular environments. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. PMID:3019667

Neutralization of Bacterial YoeBSpn Toxicity and Enhanced Plant Growth in Arabidopsis thaliana via Co-Expression of the Toxin-Antitoxin Genes

PubMed Central

Abu Bakar, Fauziah; Yeo, Chew Chieng; Harikrishna, Jennifer Ann

2016-01-01

Bacterial toxin-antitoxin (TA) systems have various cellular functions, including as part of the general stress response. The genome of the Gram-positive human pathogen Streptococcus pneumoniae harbors several putative TA systems, including yefM-yoeBSpn, which is one of four systems that had been demonstrated to be biologically functional. Overexpression of the yoeBSpn toxin gene resulted in cell stasis and eventually cell death in its native host, as well as in Escherichia coli. Our previous work showed that induced expression of a yoeBSpn toxin-Green Fluorescent Protein (GFP) fusion gene apparently triggered apoptosis and was lethal in the model plant, Arabidopsis thaliana. In this study, we investigated the effects of co-expression of the yefMSpn antitoxin and yoeBSpn toxin-GFP fusion in transgenic A. thaliana. When co-expressed in Arabidopsis, the YefMSpn antitoxin was found to neutralize the toxicity of YoeBSpn-GFP. Interestingly, the inducible expression of both yefMSpn antitoxin and yoeBSpn toxin-GFP fusion in transgenic hybrid Arabidopsis resulted in larger rosette leaves and taller plants with a higher number of inflorescence stems and increased silique production. To our knowledge, this is the first demonstration of a prokaryotic antitoxin neutralizing its cognate toxin in plant cells. PMID:27104531

A series of vectors to construct lacZ fusions for the study of gene expression in Schizosaccharomyces pombe.

PubMed

Lafuente, M J; Petit, T; Gancedo, C

1997-12-22

We have constructed a series of plasmids to facilitate the fusion of promoters with or without coding regions of genes of Schizosaccharomyces pombe to the lacZ gene of Escherichia coli. These vectors carry a multiple cloning region in which fission yeast DNA may be inserted in three different reading frames with respect to the coding region of lacZ. The plasmids were constructed with the ura4+ or the his3+ marker of S. pombe. Functionality of the plasmids was tested measuring in parallel the expression of fructose 1,6-bisphosphatase and beta-galactosidase under the control of the fbp1+ promoter in different conditions.

High-level expression of human stem cell factor fused with erythropoietin mimetic peptide in Escherichia coli.

PubMed

Su, Lin; Chen, Song-Sen; Yang, Ke-Gong; Liu, Chang-Zheng; Zhang, Yan-Li; Liang, Zhi-Quan

2006-06-01

Stem cell factor (SCF) and erythropoietin are essential for normal erythropoiesis and induce proliferation and differentiation synergistically for erythroid progenitor cells. Here, we report our work on construction of SCF/erythropoietin mimetic peptide (EMP) fusion protein gene, in which human SCF cDNA (1-165aa) and EMP sequence (20aa) were connected using a short (GGGGS) or long (GGGGSGGGGGS) linker sequence. The SCF/EMP gene was cloned into the pBV220 vector and expressed in the Escherichia coli DH5alpha strain. The expression level of the fusion protein was about 30% of total cell protein. The resulting inclusion bodies were solubilized with 8 M urea, followed by dilution refolding. The renatured protein was subsequently purified by Q-Sepharose FF column. The final product was >95% pure by SDS-PAGE and the yield of fusion protein was about 40 mg/L of culture. UT-7 cell proliferation and human cord blood cell colony-forming assays showed that the fusion proteins exhibited more potent activity than recombinant human SCF, suggesting a new strategy to enhance biological activities of growth factors.

A heterologous hormone response element enhances expression of rat beta-casein promoter-driven chloramphenicol acetyltransferase fusion genes in the mammary gland of transgenic mice.

PubMed

Greenberg, N M; Reding, T V; Duffy, T; Rosen, J M

1991-10-01

Previous studies have demonstrated that the entire rat beta-casein (R beta C) gene and a -524/+490 R beta C fragment-chloramphenicol acetyltransferase (CAT) fusion gene are expressed preferentially in the mammary gland of transgenic mice in a developmentally regulated fashion. However, transgene expression was infrequent, less than 1% of that observed for the endogenous gene, and varied as much as 500-fold, presumably due to the site of chromosomal integration. To determine whether a heterologous hormone-responsive enhancer could be used to increase both the level and frequency of expression in the mammary gland, a fragment derived from the mouse mammary tumor virus long terminal repeat containing four hormone response elements (HREs) was inserted into the R beta C promoter at a site not known to contain transcriptional regulatory elements. Transgenic mice generated which carried HRE-enhanced R beta C-CAT fusion genes expressed CAT activity in the mammary glands of all founder lines examined at levels that were on average 13-fold greater than for lines generated with similar constructs not carrying HREs. In the highest expressing line, the level of HRE-enhanced transgene expression was found to be developmentally regulated, increasing 14-fold in the mammary gland from virgin to day 10 of lactation. In this line, expression was also observed in the thymus and spleen; however, the level of CAT activity was 4-fold lower than in the mammary gland and was not developmentally regulated. In adrenalectomized mice, the administration of dexamethasone stimulated CAT expression in the mammary gland but not in the thymus and spleen. These studies demonstrate that in the context of the R beta C promoter, the HRE functions in the mammary gland to increase both the frequency and level of transgene expression.

MATRIX FACTORIZATION-BASED DATA FUSION FOR GENE FUNCTION PREDICTION IN BAKER’S YEAST AND SLIME MOLD

PubMed Central

ŽITNIK, MARINKA; ZUPAN, BLAŽ

2014-01-01

The development of effective methods for the characterization of gene functions that are able to combine diverse data sources in a sound and easily-extendible way is an important goal in computational biology. We have previously developed a general matrix factorization-based data fusion approach for gene function prediction. In this manuscript, we show that this data fusion approach can be applied to gene function prediction and that it can fuse various heterogeneous data sources, such as gene expression profiles, known protein annotations, interaction and literature data. The fusion is achieved by simultaneous matrix tri-factorization that shares matrix factors between sources. We demonstrate the effectiveness of the approach by evaluating its performance on predicting ontological annotations in slime mold D. discoideum and on recognizing proteins of baker’s yeast S. cerevisiae that participate in the ribosome or are located in the cell membrane. Our approach achieves predictive performance comparable to that of the state-of-the-art kernel-based data fusion, but requires fewer data preprocessing steps. PMID:24297565

Application of unstable Gfp variants to the kinetic study of Legionella pneumophila icm gene expression during infection.

PubMed

Barysheva, Oksana V; Fujii, Jun; Takaesu, Giichi; Yoshida, Shin-ichi

2008-04-01

An unstable type of green fluorescent protein (Gfp) tagged with a C-terminal extension, which is a target for tail-specific protease, was used as a reporter gene in Legionella pneumophila. To analyse Gfp expression in legionellae, transcriptional fusions of unstable gfp with the Legionella-specific icm (intracellular multiplication) promoters (P(icmS), P(icmT) and P(icmQ)) were constructed. Infection studies using J774.1 macrophages as the host, and L. pneumophila strains carrying P(icmS)-gfp, P(icmT)-gfp and P(icmQ)-gfp fusions, indicated that the icmS, icmT and icmQ genes could be expressed intracellularly. Expression of icmS, icmT and icmQ genes in infected cells was examined by flow cytometry. Furthermore, fluorescent intracellular legionellae were detected directly by confocal microscopy. Real-time quantitative RT-PCR revealed the differences in the gene expression of icmS, and that of icmT and icmQ, during infection. Expression of icmS was high in the late stage of infection, while that of icmT and icmQ was high in the early phase only. We show that unstable gfp is a useful reporter gene whose expression in legionellae can be followed in real-time, and that it allows analysis of promoter activities in legionellae and monitoring of the infection process.

Environmental conditions affect transcription of the pectinase genes of Erwinia chrysanthemi 3937.

PubMed Central

Hugouvieux-Cotte-Pattat, N; Dominguez, H; Robert-Baudouy, J

1992-01-01

To depolymerize plant pectin, the phytopathogenic enterobacterium Erwinia chrysanthemi produces a series of enzymes which include a pectin-methyl-esterase encoded by the pem gene and five isoenzymes of pectate lyases encoded by the five genes pelA, pelB, pelC, pelD, and pelE. We have constructed transcriptional fusions between the pectinase gene promoters and the uidA gene, encoding beta-glucuronidase, to study the regulation of these E. chrysanthemi pectinase genes individually. The transcription of the pectinase genes is dependent on many environmental conditions. All the fusions were induced by pectic catabolic products and responded, to different degrees, to growth phase, catabolite repression, temperature, and nitrogen starvation. Transcription of pelA, pelD, and pelE was also increased in anaerobic growth conditions. High osmolarity of the culture medium increased expression of pelE but decreased that of pelD; the other pectinase genes were not affected. The level of expression of each gene was different. Transcription of pelA was very low under all growth conditions. The expression of the pelB, pelC, and pem genes was intermediate. The pelE gene had a high basal level of expression. Expression of pelD was generally the most affected by changes in culture conditions and showed a low basal level but very high induced levels. These differences in the expression of the pectinase genes of E. chrysanthemi 3937 presumably reflect their role during infection of plants, because the degradation of pectic polymers of the plant cell walls is the main determinant of tissue maceration caused by soft rot erwiniae. PMID:1447147

Analysis of Snail1 function and regulation by Twist1 in palatal fusion.

PubMed

Yu, Wenli; Zhang, Yanping; Ruest, L Bruno; Svoboda, Kathy K H

2013-01-01

Palatal fusion is a tightly controlled process which comprises multiple cellular events, including cell movement and differentiation. Midline epithelial seam (MES) degradation is essential to palatal fusion. In this study, we analyzed the function of Snail1 during the degradation of the MES. We also analyzed the mechanism regulating the expression of the Snail1 gene in palatal shelves. Palatal explants treated with Snail1 siRNA did not degrade the MES and E-cadherin was not repressed leading to failure of palatal fusion. Transforming growth factor beta 3 (Tgfβ3) regulated Snail1 mRNA, as Snail1 expression decreased in response to Tgfβ3 neutralizing antibody and a PI-3 kinase (PI3K) inhibitor. Twist1, in collaboration with E2A factors, regulated the expression of Snail1. Twist1/E47 dimers bond to the Snail1 promoter to activate expression. Without E47, Twist1 repressed Snail1 expression. These results support the hypothesis that Tgfβ3 may signal through Twist1 and then Snail1 to downregulate E-cadherin expression during palatal fusion.

ALK‐rearrangement in non‐small‐cell lung cancer (NSCLC)

PubMed Central

Du, Xue; Shao, Yun; Qin, Hai‐Feng

2018-01-01

The ALK gene encodes a transmembrane tyrosine kinase receptor. ALK is physiologically expressed in the nervous system during embryogenesis, but its expression decreases postnatally. ALK first emerged in the field of oncology in 1994 when it was identified to fuse to NPM1 in anaplastic large‐cell lymphoma. Since then, ALK has been associated with other types of cancers, including non‐small‐cell lung cancer (NSCLC). More than 19 different ALK fusion partners have been discovered in NSCLC, including EML4, KIF5B, KLC1, and TPR. Most of these ALK fusions in NSCLC patients respond well to the ALK inhibitor, crizotinib. In this paper, we reviewed fusion partner genes with ALK, detection methods for ALK‐rearrangement (ALK‐R), and the ALK‐tyrosine kinase inhibitor, crizotinib, used in NSCLC patients. PMID:29488330

Fusion expression of the PGLa-AM1 with native structure and evaluation of its anti-Helicobacter pylori activity.

PubMed

Zhang, Xiaolin; Jiang, Anmin; Wang, Guisheng; Yu, Hao; Qi, Banghua; Xiong, Youyi; Zhou, Guoliang; Qin, Meisong; Dou, Jinfeng; Wang, Jianfei

2017-07-01

Helicobacter pylori (H. pylori) shows increasingly enhanced resistance to various antibiotics, and its eradication has become a major problem in medicine. The antimicrobial peptide PGLa-AM1 is a short peptide with 22 amino acids and exhibits strong antibacterial activity. In this study, we investigated whether it has anti-H. pylori activity for the further development of anti-H. pylori drugs to replace existing antibiotics. However, the natural antimicrobial peptide PGLa-AM1 shows a low yield and is difficult to separate, limiting its application. A good strategy to solve this problem is to express the antimicrobial peptide PGLa-AM1 using gene engineering at a high level and low cost. For getting PGLa-AM1 with native structure, in this study, a specific protease cleavage site of tobacco etch virus (TEV) was designed before the PGLa-AM1 peptide. For convenience to purify and identify high-efficiency expression PGLa-AM1, the PGLa-AM1 gene was fused with the polyhedrin gene of Bombyx mori (B. mori), and a 6 × His tag was designed to insert before the amino terminus of the fusion protein. The fusion antibacterial peptide PGLa-AM1 (FAMP) gene codon was optimized, and the gene was synthesized and cloned into the Escherichia coli (E. coli) pET-30a (+) expression vector. The results showed that the FAMP was successfully expressed in E. coli. Its molecular weight was approximately 34 kDa, and its expression level was approximately 30 mg/L. After the FAMP was purified, it was further digested with TEV protease. The acquired recombinant antimicrobial peptide PGLa-AM1 exerted strong anti-H. pylori activity and therapeutic effect in vitro and in vivo.

Menin-MLL inhibitors reverse oncogenic activity of MLL fusion proteins in leukemia.

PubMed

Grembecka, Jolanta; He, Shihan; Shi, Aibin; Purohit, Trupta; Muntean, Andrew G; Sorenson, Roderick J; Showalter, Hollis D; Murai, Marcelo J; Belcher, Amalia M; Hartley, Thomas; Hess, Jay L; Cierpicki, Tomasz

2012-01-29

Translocations involving the mixed lineage leukemia (MLL) gene result in human acute leukemias with very poor prognosis. The leukemogenic activity of MLL fusion proteins is critically dependent on their direct interaction with menin, a product of the multiple endocrine neoplasia (MEN1) gene. Here we present what are to our knowledge the first small-molecule inhibitors of the menin-MLL fusion protein interaction that specifically bind menin with nanomolar affinities. These compounds effectively reverse MLL fusion protein-mediated leukemic transformation by downregulating the expression of target genes required for MLL fusion protein oncogenic activity. They also selectively block proliferation and induce both apoptosis and differentiation of leukemia cells harboring MLL translocations. Identification of these compounds provides a new tool for better understanding MLL-mediated leukemogenesis and represents a new approach for studying the role of menin as an oncogenic cofactor of MLL fusion proteins. Our findings also highlight a new therapeutic strategy for aggressive leukemias with MLL rearrangements.

Translational induction of heat shock transcription factor σ32: evidence for a built-in RNA thermosensor

PubMed Central

Morita, Miyo Terao; Tanaka, Yoshiyuki; Kodama, Takashi S.; Kyogoku, Yoshimasa; Yanagi, Hideki; Yura, Takashi

1999-01-01

Induction of heat shock proteins in Escherichia coli is primarily caused by increased cellular levels of the heat shock σ-factor σ32 encoded by the rpoH gene. Increased σ32 levels result from both enhanced synthesis and stabilization. Previous work indicated that σ32 synthesis is induced at the translational level and is mediated by the mRNA secondary structure formed within the 5′-coding sequence of rpoH, including the translation initiation region. To understand the mechanism of heat induction of σ32 synthesis further, we analyzed expression of rpoH–lacZ gene fusions with altered stability of mRNA structure before and after heat shock. A clear correlation was found between the stability and expression or the extent of heat induction. Temperature-melting profiles of mRNAs with or without mutations correlated well with the expression patterns of fusion genes carrying the corresponding mutations in vivo. Furthermore, temperature dependence of mRNA–30S ribosome–tRNAfMet complex formation with wild-type or mutant mRNAs in vitro agreed well with that of the expression of gene fusions in vivo. Our results support a novel mechanism in which partial melting of mRNA secondary structure at high temperature enhances ribosome entry and translational initiation without involvement of other cellular components, that is, intrinsic mRNA stability controls synthesis of a transcriptional regulator. PMID:10090722

Gene expression profiling and candidate gene resequencing identifies pathways and mutations important for malignant transformation caused by leukemogenic fusion genes.

PubMed

Novak, Rachel L; Harper, David P; Caudell, David; Slape, Christopher; Beachy, Sarah H; Aplan, Peter D

2012-12-01

NUP98-HOXD13 (NHD13) and CALM-AF10 (CA10) are oncogenic fusion proteins produced by recurrent chromosomal translocations in patients with acute myeloid leukemia (AML). Transgenic mice that express these fusions develop AML with a long latency and incomplete penetrance, suggesting that collaborating genetic events are required for leukemic transformation. We employed genetic techniques to identify both preleukemic abnormalities in healthy transgenic mice as well as collaborating events leading to leukemic transformation. Candidate gene resequencing revealed that 6 of 27 (22%) CA10 AMLs spontaneously acquired a Ras pathway mutation and 8 of 27 (30%) acquired an Flt3 mutation. Two CA10 AMLs acquired an Flt3 internal-tandem duplication, demonstrating that these mutations can be acquired in murine as well as human AML. Gene expression profiles revealed a marked upregulation of Hox genes, particularly Hoxa5, Hoxa9, and Hoxa10 in both NHD13 and CA10 mice. Furthermore, mir196b, which is embedded within the Hoxa locus, was overexpressed in both CA10 and NHD13 samples. In contrast, the Hox cofactors Meis1 and Pbx3 were differentially expressed; Meis1 was increased in CA10 AMLs but not NHD13 AMLs, whereas Pbx3 was consistently increased in NHD13 but not CA10 AMLs. Silencing of Pbx3 in NHD13 cells led to decreased proliferation, increased apoptosis, and decreased colony formation in vitro, suggesting a previously unexpected role for Pbx3 in leukemic transformation. Published by Elsevier Inc.

Functional imaging: monitoring heme oxygenase-1 gene expression in vivo

NASA Astrophysics Data System (ADS)

Zhang, Weisheng; Reilly-Contag, Pamela; Stevenson, David K.; Contag, Christopher H.

1999-07-01

The regulation of genetic elements can be monitored in living animals using photoproteins as reporters. Heme oxygenase (HO) is the key catabolic enzyme in the heme degradation pathway. Here, HO expression serves as a model for in vivo functional imaging of transcriptional regulation of a clinically relevant gene. HO enzymatic activity is inhibited by heme analogs, metalloporphyrins, but many members of this family of compounds also activate transcription of the HO-1 promoter. The degree of transcriptional activation by twelve metalloporphyrins, differing at the central metal and porphyrin ring substituents, was evaluated in both NIH 3T3 stable lines and transgenic animals containing HO-1 promoter-luciferase gene fusions. In the correlative cell culture assays, the metalloporphyrins increased transcription form the full length HO promoter fusion to varying degrees, but none increased transcription from a truncated HO-1 promoter. These results suggested that one or both of the two distal enhancer elements located at -4 and -10 Kb upstream from transcriptional start are required for HO-1 induction by heme and its analogs. The full-length HO-1-luc fusion was then evaluated as a transgene in mice. It was possible to monitor the effects of the metalloporphyrins, SnMP and ZnPP, in living animals over time. This spatiotemporal analyses of gene expression in vivo implied that alterations in porphyrin ring substituents and the central metal may affect the extent of gene activation. These data further indicate that using photoprotein reporters, subtle differences in gene expression can be monitored in living animals.

Expression of myogenes in longissimus dorsi muscle during prenatal development in commercial and local Piau pigs.

PubMed

Reis, Evelyze Pinheiro Dos; Paixão, Débora Martins; Brustolini, Otávio José Bernardes; Silva, Fabyano Fonseca E; Silva, Walmir; Araújo, Flávio Marcos Gomes de; Salim, Anna Christina de Matos; Oliveira, Guilherme; Guimarães, Simone Eliza Facioni

2016-01-01

This study used qRT-PCR to examine variation in the expression of 13 myogenes during muscle development in four prenatal periods (21, 40, 70 and 90 days post-insemination) in commercial (the three-way Duroc, Landrace and Large-White cross) and local Piau pig breeds that differ in muscle mass. There was no variation in the expression of the CHD8, EID2B, HIF1AN, IKBKB, RSPO3, SOX7 and SUFU genes at the various prenatal ages or between breeds. The MAP2K1 and RBM24 genes showed similar expression between commercial and Piau pigs but greater expression (p < 0.05) in at least one prenatal period. Pair-wise comparisons of prenatal periods in each breed showed that only the CSRP3, LEF1, MRAS and MYOG genes had higher expression (p < 0.05) in at least one prenatal period in commercial and Piau pigs. Overall, these results identified the LEF1 gene as a primary candidate to account for differences in muscle mass between the pig breeds since activation of this gene may lead to greater myoblast fusion in the commercial breed compared to Piau pigs. Such fusion could explain the different muscularity between breeds in the postnatal periods.

Expression of myogenes in longissimus dorsi muscle during prenatal development in commercial and local Piau pigs

PubMed Central

dos Reis, Evelyze Pinheiro; Paixão, Débora Martins; Brustolini, Otávio José Bernardes; Silva, Fabyano Fonseca e; Silva, Walmir; de Araújo, Flávio Marcos Gomes; Salim, Anna Christina de Matos; Oliveira, Guilherme; Guimarães, Simone Eliza Facioni

2016-01-01

Abstract This study used qRT-PCR to examine variation in the expression of 13 myogenes during muscle development in four prenatal periods (21, 40, 70 and 90 days post-insemination) in commercial (the three-way Duroc, Landrace and Large-White cross) and local Piau pig breeds that differ in muscle mass. There was no variation in the expression of the CHD8, EID2B, HIF1AN, IKBKB, RSPO3, SOX7 and SUFU genes at the various prenatal ages or between breeds. The MAP2K1 and RBM24 genes showed similar expression between commercial and Piau pigs but greater expression (p < 0.05) in at least one prenatal period. Pair-wise comparisons of prenatal periods in each breed showed that only the CSRP3, LEF1, MRAS and MYOG genes had higher expression (p < 0.05) in at least one prenatal period in commercial and Piau pigs. Overall, these results identified the LEF1 gene as a primary candidate to account for differences in muscle mass between the pig breeds since activation of this gene may lead to greater myoblast fusion in the commercial breed compared to Piau pigs. Such fusion could explain the different muscularity between breeds in the postnatal periods. PMID:27801482

HIP1-ALK, a novel fusion protein identified in lung adenocarcinoma.

PubMed

Hong, Mineui; Kim, Ryong Nam; Song, Ji-Young; Choi, So-Jung; Oh, Ensel; Lira, Maruja E; Mao, Mao; Takeuchi, Kengo; Han, Joungho; Kim, Jhingook; Choi, Yoon-La

2014-03-01

The most common mechanism underlying overexpression and activation of anaplastic lymphoma kinase (ALK) in non-small-cell lung carcinoma could be attributed to the formation of a fusion protein. To date, five fusion partners of ALK have been reported, namely, echinoderm microtubule associated protein like 4, tropomyosin-related kinase-fused gene, kinesin family member 5B, kinesin light chain 1, and protein tyrosine phosphatase, nonreceptor type 3. In this article, we report a novel fusion gene huntingtin interacting protein 1 (HIP1)-ALK, which is conjoined between the huntingtin-interacting protein 1 gene HIP1 and ALK. Reverse-transcriptase polymerase chain reaction and immunohistochemical analysis were used to detect this fusion gene's transcript and protein expression, respectively. We had amplified the full-length cDNA sequence of this novel fusion gene by using 5'-rapid amplification of cDNA ends. The causative genomic translocation t(2;7)(p23;q11.23) for generating this novel fusion gene was verified by using genomic sequencing. The examined adenocarcinoma showed predominant acinar pattern, and ALK immunostaining was localized to the cytoplasm, with intense staining in the submembrane region. In break-apart, fluorescence in situ hybridization analysis for ALK, split of the 5' and 3' probe signals, and isolated 3' signals were observed. Reverse-transcriptase polymerase chain reaction revealed that the tumor harbored a novel fusion transcript in which exon 21 of HIP1 was fused to exon 20 of ALK in-frame. The novel fusion gene and its protein HIP1-ALK harboring epsin N-terminal homology, coiled-coil, juxtamembrane, and kinase domains, which could play a role in carcinogenesis, could become diagnostic and therapeutic target of the lung adenocarcinoma and deserve a further study in the future.

Expression of hybrid fusion protein (Cry1Ac::ASAL) in transgenic rice plants imparts resistance against multiple insect pests.

PubMed

Boddupally, Dayakar; Tamirisa, Srinath; Gundra, Sivakrishna Rao; Vudem, Dashavantha Reddy; Khareedu, Venkateswara Rao

2018-05-31

To evolve rice varieties resistant to different groups of insect pests a fusion gene, comprising DI and DII domains of Bt Cry1Ac and carbohydrate binding domain of garlic lectin (ASAL), was constructed. Transgenic rice lines were generated and evaluated to assess the efficacy of Cry1Ac::ASAL fusion protein against three major pests, viz., yellow stem borer (YSB), leaf folder (LF) and brown planthopper (BPH). Molecular analyses of transgenic plants revealed stable integration and expression of the fusion gene. In planta insect bioassays on transgenics disclosed enhanced levels of resistance compared to the control plants. High insect mortality of YSB, LF and BPH was observed on transgenics compared to that of control plants. Furthermore, honeydew assays revealed significant decreases in the feeding ability of BPH on transgenic plants as compared to the controls. Ligand blot analysis, using BPH insects fed on cry1Ac::asal transgenic rice plants, revealed a modified receptor protein-binding pattern owing to its ability to bind to additional receptors in insects. The overall results authenticate that Cry1Ac::ASAL protein is endowed with remarkable entomotoxic effects against major lepidopteran and hemipteran insects. As such, the fusion gene appears promising and can be introduced into various other crops to control multiple insect pests.

A germline mutation of CDKN2A and a novel RPLP1-C19MC fusion detected in a rare melanotic neuroectodermal tumor of infancy: a case report.

PubMed

Barnes, David J; Hookway, Edward; Athanasou, Nick; Kashima, Takeshi; Oppermann, Udo; Hughes, Simon; Swan, Daniel; Lueerssen, Dietrich; Anson, John; Hassan, A Bassim

2016-08-12

Melanotic neuroectodermal tumor of infancy (MNTI) is exceptionally rare and occurs predominantly in the head and neck (92.8 % cases). The patient reported here is only the eighth case of MNTI presenting in an extremity, and the first reported in the fibula. A 2-month-old female presented with a mass arising in the fibula. Exhaustive genomic, transcriptomic, epigenetic and pathological characterization was performed on the excised primary tumor and a derived cell line. Whole-exome analysis of genomic DNA from both the tumor and blood indicated no somatic, non-synonymous coding mutations within the tumor, but a heterozygous, unique germline, loss of function mutation in CDKN2A (p16(INK4A), D74A). SNP-array CGH on DNA samples revealed the tumor to be euploid, with no detectable gene copy number variants. Multiple chromosomal translocations were identified by RNA-Seq, and fusion genes included RPLP1-C19MC, potentially deregulating the C19MC cluster, an imprinted locus containing microRNA genes reactivated by gene fusion in embryonal tumors with multilayered rosettes. Since the presumed cell of origin of MNTI is from the neural crest, we also compared gene expression with a dataset from human neural crest cells and identified 185 genes with significantly different expression. Consistent with the melanotic phenotype of the tumor, elevated expression of tyrosinase was observed. Other highly expressed genes encoded muscle proteins and modulators of the extracellular matrix. A derived MNTI cell line was sensitive to inhibitors of lysine demethylase, but not to compounds targeting other epigenetic regulators. In the absence of somatic copy number variations or mutations, the fully transformed phenotype of the MNTI may have arisen in infancy because of the combined effects of a germline CDKN2A mutation, tumor promoting somatic fusion genes and epigenetic deregulation. Very little is known about the etiology of MNTI and this report advances knowledge of these rare tumors by providing the first comprehensive genomic, transcriptomic and epigenetic characterization of a case.

Construction of a recombinant-BCG containing the LMP2A and BZLF1 genes and its significance in the Epstein-Barr virus positive gastric carcinoma.

PubMed

Xue, Qing-Jie; Dai, Jun; Li, Xiu-Zhen; Zhu, Wei; Si, Chuan-Ping; Chen, Ting

2014-10-01

The signal peptide Ag85B of Bacillus Chalmette-Guerin (BCG) was used to construct a recombinant plasmid of BCG. The BCG-Ag85B gene and fused EBV LMP2A and BZLF1 genes were amplified and successively inserted into the Escherichia coli-BCG shuttle-vector pMV261. The recombinant plasmids were then amplified in E. coli DH5α and transformed into competent BCG. The expression of BZLF1 and LMP2A fusion proteins in recombinant-BCG (rBCG) was shown by Western blot. After the injection of recombinant-BCG into mice, antibodies against the fusion protein BZLF1 and LMP2A were measured by ELISA, and the cellular immune effects were determined by the lactate dehydrogenate (LDH) release assays. The results confirmed that the cloned genes of BCG-Ag85B and Z2A were correctly inserted into the vector pMV261. The recombinant plasmid pMVZ2A expressed Z2A in BCG effectively after transformation. The rBCG proteins were recognized by the BZLF1 (LMP2A) antibody. An ELISA demonstrated that rBCG could stimulate the generation of antibody against the fusion protein. The fusion gene was constructed successfully, and the rBCG induced humoral and cellular immune response in mice. © 2014 Wiley Periodicals, Inc.

Sequence motifs and prokaryotic expression of the reptilian paramyxovirus fusion protein

USGS Publications Warehouse

Franke, J.; Batts, W.N.; Ahne, W.; Kurath, G.; Winton, J.R.

2006-01-01

Fourteen reptilian paramyxovirus isolates were chosen to represent the known extent of genetic diversity among this novel group of viruses. Selected regions of the fusion (F) gene were sequenced, analyzed and compared. The F gene of all isolates contained conserved motifs homologous to those described for other members of the family Paramyxoviridae including: signal peptide, transmembrane domain, furin cleavage site, fusion peptide, N-linked glycosylation sites, and two heptad repeats, the second of which (HRB-LZ) had the characteristics of a leucine zipper. Selected regions of the fusion gene of isolate Gono-GER85 were inserted into a prokaryotic expression system to generate three recombinant protein fragments of various sizes. The longest recombinant protein was cleaved by furin into two fragments of predicted length. Western blot analysis with virus-neutralizing rabbit-antiserum against this isolate demonstrated that only the longest construct reacted with the antiserum. This construct was unique in containing 30 additional C-terminal amino acids that included most of the HRB-LZ. These results indicate that the F genes of reptilian paramyxoviruses contain highly conserved motifs typical of other members of the family and suggest that the HRB-LZ domain of the reptilian paramyxovirus F protein contains a linear antigenic epitope. ?? Springer-Verlag 2005.

Enhanced expression of cro-beta-galactosidase fusion proteins under the control of the PR promoter of bacteriophage lambda.

PubMed Central

Zabeau, M; Stanley, K K

1982-01-01

Hybrid plasmids carrying cro-lacZ gene fusions have been constructed by joining DNA segments carrying the PR promoter and the start of the cro gene of bacteriophage lambda to the lacZ gene fragment carried by plasmid pLG400 . Plasmids in which the translational reading frames of the cro and lacZ genes are joined in-register (type I) direct the synthesis of elevated levels of cro-beta-galactosidase fusion protein amounting to 30% of the total cellular protein, while plasmids in which the genes are fused out-of-register (type II) produce a low level of beta-galactosidase protein. Sequence rearrangements downstream of the cro initiator AUG were found to influence the efficiency of translation, and have been correlated with alterations in the RNA secondary structure of the ribosome-binding site. Plasmids which direct the synthesis of high levels of beta-galactosidase are conditionally lethal and can only be propagated when the PR promoter is repressed. Deletion of sequences downstream of the lacZ gene restored viability, indicating that this region of the plasmid encodes a function which inhibits the growth of the cells. The different applications of these plasmids for expression of cloned genes are discussed. Images Fig. 6. PMID:6327257

BCOR Overexpression Is a Highly Sensitive Marker in Round Cell Sarcomas With BCOR Genetic Abnormalities.

PubMed

Kao, Yu-Chien; Sung, Yun-Shao; Zhang, Lei; Jungbluth, Achim A; Huang, Shih-Chiang; Argani, Pedram; Agaram, Narasimhan P; Zin, Angelica; Alaggio, Rita; Antonescu, Cristina R

2016-12-01

With the advent of next-generation sequencing, an increasing number of novel gene fusions and other abnormalities have emerged recently in the spectrum of EWSR1-negative small blue round cell tumors (SBRCTs). In this regard, a subset of SBRCTs harboring either BCOR gene fusions (BCOR-CCNB3, BCOR-MAML3), BCOR internal tandem duplications (ITD), or YWHAE-NUTM2B share a transcriptional signature including high BCOR mRNA expression, as well as similar histologic features. Furthermore, other tumors such as clear cell sarcoma of kidney (CCSK) and primitive myxoid mesenchymal tumor of infancy also demonstrate BCOR ITDs and high BCOR gene expression. The molecular diagnosis of these various BCOR genetic alterations requires an elaborate methodology including custom BAC fluorescence in situ hybridization (FISH) probes and reverse transcription polymerase chain reaction assays. As these tumors show high level of BCOR overexpression regardless of the genetic mechanism involved, either conventional gene fusion or ITD, we sought to investigate the performance of an anti-BCOR monoclonal antibody clone C-10 (sc-514576) as an immunohistochemical marker for sarcomas with BCOR gene abnormalities. Thus we assessed the BCOR expression in a pathologically and genetically well-characterized cohort of 25 SBRCTs, spanning various BCOR-related fusions and ITDs and YWHAE-NUTM2B fusion. In addition, we included related pathologic entities such as 8 CCSKs and other sarcomas with BCOR gene fusions. As a control group we included 20 SBRCTs with various (non-BCOR) genetic abnormalities, 10 fusion-negative SBRCTs, 74 synovial sarcomas, 29 rhabdomyosarcomas, and other sarcoma types. In addition, we evaluated the same study group for SATB2 immunoreactivity, as these tumors also showed SATB2 mRNA upregulation. All SBRCTs with BCOR-MAML3 and BCOR-CCNB3 fusions, as well as most with BCOR ITD (93%), and all CCSKs showed strong and diffuse nuclear BCOR immunoreactivity. Furthermore, all SBRCTs with YWHAE-NUTM2B also were positive. SATB2 stain was also positive in tumors with YWHAE-NUTM2B, BCOR-MAML3, BCOR ITD (75%), BCOR-CCNB3 (71%), and a subset of CCSKs (33%). In conclusion, BCOR immunohistochemical stain is a highly sensitive marker for SBRCTs and CCSKs with BCOR abnormalities and YWHAE-rearrangements and can be used as a useful diagnostic marker in these various molecular subsets. SATB2 immunoreactivity is also present in the majority of this group of tumors.

Isolation and characterization of an Arabidopsis biotin carboxylase gene and its promoter.

PubMed

Bao, X; Shorrosh, B S; Ohlrogge, J B

1997-11-01

In the plastids of most plants, acetyl-CoA carboxylase (ACCase; EC 6.4.1.2) is a multisubunit complex consisting of biotin carboxylase (BC), biotin-carboxyl carrier protien (BCCP), and carboxytransferase (alpha-CT, beta-CT) subunits. To better understand the regulation of this enzyme, we have isolated and sequenced a BC genomic clone from Arabidopsis and partially characterized its promoter. Fifteen introns were identified. The deduced amino acid sequence of the mature BC protein is highly conserved between Arabidopsis and tobacco (92.6% identity). BC expression was evaluated using northern blots and BC/GUS fusion constructs in transgenic Arabidopsis. GUS activity in the BC/GUS transgenics as well as transcript level of the native gene were both found to be higher in silique and flower than in root and leaf. Analysis of tobacco suspension cells transformed with truncated BC promoter/GUS gene fusions indicated the region from -140 to +147 contained necessary promoter elements which supported basal gene expression. A positive regulatory region was found to be located between -2100 and -140, whereas a negative element was possibly located in the first intron. In addition, several conserved regulatory elements were identified in the BC promoter. Surprisingly, although BC is a low-abundance protein, the expression of BC/GUS fusion constructs was similar to 35S/GUS constructs.

Deep RNA sequencing analysis of readthrough gene fusions in human prostate adenocarcinoma and reference samples

PubMed Central

2011-01-01

Background Readthrough fusions across adjacent genes in the genome, or transcription-induced chimeras (TICs), have been estimated using expressed sequence tag (EST) libraries to involve 4-6% of all genes. Deep transcriptional sequencing (RNA-Seq) now makes it possible to study the occurrence and expression levels of TICs in individual samples across the genome. Methods We performed single-end RNA-Seq on three human prostate adenocarcinoma samples and their corresponding normal tissues, as well as brain and universal reference samples. We developed two bioinformatics methods to specifically identify TIC events: a targeted alignment method using artificial exon-exon junctions within 200,000 bp from adjacent genes, and genomic alignment allowing splicing within individual reads. We performed further experimental verification and characterization of selected TIC and fusion events using quantitative RT-PCR and comparative genomic hybridization microarrays. Results Targeted alignment against artificial exon-exon junctions yielded 339 distinct TIC events, including 32 gene pairs with multiple isoforms. The false discovery rate was estimated to be 1.5%. Spliced alignment to the genome was less sensitive, finding only 18% of those found by targeted alignment in 33-nt reads and 59% of those in 50-nt reads. However, spliced alignment revealed 30 cases of TICs with intervening exons, in addition to distant inversions, scrambled genes, and translocations. Our findings increase the catalog of observed TIC gene pairs by 66%. We verified 6 of 6 predicted TICs in all prostate samples, and 2 of 5 predicted novel distant gene fusions, both private events among 54 prostate tumor samples tested. Expression of TICs correlates with that of the upstream gene, which can explain the prostate-specific pattern of some TIC events and the restriction of the SLC45A3-ELK4 e4-e2 TIC to ERG-negative prostate samples, as confirmed in 20 matched prostate tumor and normal samples and 9 lung cancer cell lines. Conclusions Deep transcriptional sequencing and analysis with targeted and spliced alignment methods can effectively identify TIC events across the genome in individual tissues. Prostate and reference samples exhibit a wide range of TIC events, involving more genes than estimated previously using ESTs. Tissue specificity of TIC events is correlated with expression patterns of the upstream gene. Some TIC events, such as MSMB-NCOA4, may play functional roles in cancer. PMID:21261984

Expression and purification of lacticin Q by small ubiquitin-related modifier fusion in Escherichia coli.

PubMed

Ma, Qingshan; Yu, Zhanqiao; Han, Bing; Wang, Qing; Zhang, Rijun

2012-04-01

Lacticin Q is a broad-spectrum class II bacteriocin with potential as an alternative to conventional antibiotics. The objective of this study was to produce recombinant lacticin Q using a small ubiquitin-related modifier (SUMO) fusion protein expression system. The 168-bp lacticin Q gene was cloned into the expression vector pET SUMO and transformed into Escherichia coli BL21(DE3). The soluble fusion protein was recovered with a Ni-NTA Sepharose column (95% purity); 130 mg protein was obtained per liter of fermentation culture. The SUMO tag was then proteolytically cleaved from the protein, which was re-applied to the column. Finally, about 32 mg lacticin Q (≥96% purity) was obtained. The recombinant protein exhibited antimicrobial properties similar to that of the native protein, demonstrating that lacticin Q had been successfully expressed by the SUMO fusion system.

Bombyx mori nucleopolyhedrovirus orf25 encodes a 30kDa late protein in the infection cycle.

PubMed

Wang, Haiyan; Chen, Keping; Guo, Zhongjian; Yao, Qin

2008-02-01

Bombyx mori nucleopolyhedrovirus (BmNPV) orf25 gene was characterized for the first time. The coding sequence of Bm25 was amplified and subcloned into the prokaryotic expression vector pGEX-4T-2 to produce glutathione S-transferase-tagged fusion protein in the BL21 (DE3) cells. The GST-Bm25 fusion protein was expressed efficiently after induction with IPTG. The purified fusion protein was used to immunize New Zealand white rabbits to prepare polyclonal antibody. Temporal expression analysis revealed a 30-kDa protein, which was detected beginning 24 hours post-infection using a polyclonal antibody against GST-Bm25 fusion protein. The transcript of Bm25 was detected by RT-PCR at 18-72 h p.i. In conclusion, the available data suggest that Bm25 encodes a 30kDa protein expressed in the late stage of infection cycle.

A Novel Paramyxovirus?

PubMed Central

García-Sastre, Adolfo; Palese, Peter

2005-01-01

In public databases, we identified sequences reported as human genes expressed in kidney mesangial cells. The similarity of these genes to paramyxovirus matrix, fusion, and phosphoprotein genes suggests that they are derived from a novel paramyxovirus. These genes are sufficiently unique to suggest the existence of a novel paramyxovirus genus. PMID:15705331

Identification of a novel fusion gene HMGA2-EGFR in glioblastoma.

PubMed

Komuro, Akiyoshi; Raja, Erna; Iwata, Caname; Soda, Manabu; Isogaya, Kazunobu; Yuki, Keiko; Ino, Yasushi; Morikawa, Masato; Todo, Tomoki; Aburatani, Hiroyuki; Suzuki, Hiromichi; Ranjit, Melissa; Natsume, Atsushi; Mukasa, Akitake; Saito, Nobuhito; Okada, Hitoshi; Mano, Hiroyuki; Miyazono, Kohei; Koinuma, Daizo

2018-04-15

Glioblastoma is one of the most malignant forms of cancer, for which no effective targeted therapy has been found. Although The Cancer Genome Atlas has provided a list of fusion genes in glioblastoma, their role in progression of glioblastoma remains largely unknown. To search for novel fusion genes, we obtained RNA-seq data from TGS-01 human glioma-initiating cells, and identified a novel fusion gene (HMGA2-EGFR), encoding a protein comprising the N-terminal region of the high-mobility group AT-hook protein 2 (HMGA2) fused to the C-terminal region of epidermal growth factor receptor (EGFR), which retained the transmembrane and kinase domains of the EGFR. This fusion gene product showed transforming potential and a high tumor-forming capacity in cell culture and in vivo. Mechanistically, HMGA2-EGFR constitutively induced a higher level of phosphorylated STAT5B than EGFRvIII, an in-frame exon deletion product of the EGFR gene that is commonly found in primary glioblastoma. Forced expression of HMGA2-EGFR enhanced orthotopic tumor formation of the U87MG human glioma cell line. Furthermore, the EGFR kinase inhibitor erlotinib blocked sphere formation of TGS-01 cells in culture and inhibited tumor formation in vivo. These findings suggest that, in addition to gene amplification and in-frame exon deletion, EGFR signaling can also be activated by gene fusion, suggesting a possible avenue for treatment of glioblastoma. © 2017 UICC.

Core labeling of adenovirus with EGFP

DOE Office of Scientific and Technical Information (OSTI.GOV)

Le, Long P.; Le, Helen N.; Nelson, Amy R.

2006-08-01

The study of adenovirus could greatly benefit from diverse methods of virus detection. Recently, it has been demonstrated that carboxy-terminal EGFP fusions of adenovirus core proteins Mu, V, and VII properly localize to the nucleus and display novel function in the cell. Based on these observations, we hypothesized that the core proteins may serve as targets for labeling the adenovirus core with fluorescent proteins. To this end, we constructed various chimeric expression vectors with fusion core genes (Mu-EGFP, V-EGFP, preVII-EGFP, and matVII-EGFP) while maintaining expression of the native proteins. Expression of the fusion core proteins was suboptimal using E1 expressionmore » vectors with both conventional CMV and modified (with adenovirus tripartite leader sequence) CMV5 promoters, resulting in non-labeled viral particles. However, robust expression equivalent to the native protein was observed when the fusion genes were placed in the deleted E3 region. The efficient Ad-wt-E3-V-EGFP and Ad-wt-E3-preVII-EGFP expression vectors were labeled allowing visualization of purified virus and tracking of the viral core during early infection. The vectors maintained their viral function, including viral DNA replication, viral DNA encapsidation, cytopathic effect, and thermostability. Core labeling offers a means to track the adenovirus core in vector targeting studies as well as basic adenovirus virology.« less

Ensartinib in Treating Patients With Relapsed or Refractory Advanced Solid Tumors, Non-Hodgkin Lymphoma, or Histiocytic Disorders With ALK or ROS1 Genomic Alterations (A Pediatric MATCH Treatment Trial)

ClinicalTrials.gov

2018-06-25

Advanced Malignant Solid Neoplasm; ALK Fusion Protein Expression; ALK Gene Mutation; ALK Gene Translocation; Ann Arbor Stage III Childhood Non-Hodgkin Lymphoma; Ann Arbor Stage IV Childhood Non-Hodgkin Lymphoma; Histiocytosis; Recurrent Childhood Central Nervous System Neoplasm; Recurrent Childhood Non-Hodgkin Lymphoma; Recurrent Malignant Solid Neoplasm; Recurrent Neuroblastoma; Refractory Central Nervous System Neoplasm; Refractory Malignant Solid Neoplasm; Refractory Neuroblastoma; Refractory Non-Hodgkin Lymphoma; ROS1 Fusion Positive; ROS1 Gene Mutation; ROS1 Gene Translocation

Cell-cycle dependent expression of a translocation-mediated fusion oncogene mediates checkpoint adaptation in rhabdomyosarcoma.

PubMed

Kikuchi, Ken; Hettmer, Simone; Aslam, M Imran; Michalek, Joel E; Laub, Wolfram; Wilky, Breelyn A; Loeb, David M; Rubin, Brian P; Wagers, Amy J; Keller, Charles

2014-01-01

Rhabdomyosarcoma is the most commonly occurring soft-tissue sarcoma in childhood. Most rhabdomyosarcoma falls into one of two biologically distinct subgroups represented by alveolar or embryonal histology. The alveolar subtype harbors a translocation-mediated PAX3:FOXO1A fusion gene and has an extremely poor prognosis. However, tumor cells have heterogeneous expression for the fusion gene. Using a conditional genetic mouse model as well as human tumor cell lines, we show that that Pax3:Foxo1a expression is enriched in G2 and triggers a transcriptional program conducive to checkpoint adaptation under stress conditions such as irradiation in vitro and in vivo. Pax3:Foxo1a also tolerizes tumor cells to clinically-established chemotherapy agents and emerging molecularly-targeted agents. Thus, the surprisingly dynamic regulation of the Pax3:Foxo1a locus is a paradigm that has important implications for the way in which oncogenes are modeled in cancer cells.

RSPO fusion transcripts in colorectal cancer in Japanese population.

PubMed

Shinmura, Kazuya; Kahyo, Tomoaki; Kato, Hisami; Igarashi, Hisaki; Matsuura, Shun; Nakamura, Satoki; Kurachi, Kiyotaka; Nakamura, Toshio; Ogawa, Hiroshi; Funai, Kazuhito; Tanahashi, Masayuki; Niwa, Hiroshi; Sugimura, Haruhiko

2014-08-01

R-spondin (RSPO) gene fusions have recently been discovered in a subset of human colorectal cancer (CRC) in the U.S. population; however, whether the fusion is recurrent in CRC arising in patients from the other demographic areas and whether it is specific for CRC remain uncertain. In this study, we examined 75 primary CRCs and 121 primary lung cancers in the Japanese population for EIF3E-RSPO2 and PTPRK-RSPO3 fusion transcripts using RT-PCR and subsequent sequencing analyses. Although the expression of EIF3E-RSPO2 and PTPRK-RSPO3 was not detected in any of the lung carcinomas, RSPO fusions were detected in three (4%) of the 75 CRCs. Two CRCs contained EIF3E-RSPO2 fusion transcripts, and another CRC contained PTPRK-RSPO3 fusion transcripts. Interestingly, in one of the two EIF3E-RSPO2 fusion-positive CRCs, a novel fusion variant form of EIF3E-RSPO2 was identified: exon 1 of EIF3E was connected to exon 2 of RSPO2 by a 351-bp insertion. A quantitative RT-PCR analysis revealed that RSPO mRNA expression was upregulated in the three CRCs containing RSPO fusion transcripts, while it was downregulated in nearly all of the other CRCs. An immunohistochemical analysis and a mutational analysis revealed that the RSPO fusion-containing CRC had a CDX2 cell lineage, was positive for mismatch repair protein expression, and had the wild-type APC allele. Finally, the forced expression of RSPO fusion proteins were shown to endow colorectal cells with an increased growth ability. These results suggest that the expression of RSPO fusion transcripts is related to a subset of CRCs arising in the Japanese population.

High-level expression and purification of heparin-binding epidermal growth factor (HB-EGF) with SUMO fusion.

PubMed

Lu, Wuguang; Cao, Peng; Lei, Huangzong; Zhang, Shuangquan

2010-03-01

Heparin-binding epidermal growth factor (HB-EGF) can stimulate the division of various cell types and has potential clinical applications that stimulate growth and differentiation. HB-EGF has an EGF-like domain typical of all members of the EGF family. The high expression of active HB-EGF in Escherichia coli has not been successful as the protein contains three intra-molecular disulfide bonds, the same as other members of the EGF super family that are difficult to form correctly in the bacterial intracellular environment. This work fused the non-glycosylated HB-EGF gene with a small ubiquitin-related modifier gene (SUMO) by over-lap PCR. The resulting fusion gene SUMO-HBEGF was highly expressed in BL21(DE3) that the soluble SUMO-HBEGF was up to 30% of the total cellular protein. The fusion protein was purified by Ni-NTA affinity chromatography and cleaved by a SUMO-specific protease Ulp1 to obtain the native HB-EGF, which was further purified by Ni-NTA affinity chromatography. MTT assays indicated the purified HB-EGF, as well as SUMO-HBEGF, had mitogenic activity in a dose-dependent manner.

Optimization of the production and purification processes of carnobacteriocins Cbn BM1 and Cbn B2 from Carnobacterium maltaromaticum CP5 by heterologous expression in Escherichia coli.

PubMed

Jasniewski, Jordane; Cailliez-Grimal, Catherine; Gelhaye, Eric; Revol-Junelles, Anne-Marie

2008-04-01

An optimization of the production and purification processes of carnobacteriocins Cbn BM1 and Cbn B2 from Carnobacterium maltaromaticum CP5, by heterologous expression in Escherichia coli is described. The genes encoding mature bacteriocin were cloned into an E. coli expression system and expressed as a fusion protein with a thermostable thioredoxin. Recombinant E. coli were cultivated following a fed-batch fermentation process with pH, temperature and oxygenation regulation. The overexpression of the fusion proteins was improved by replacing IPTG by lactose. The fusion proteins were purified by thermal coagulation followed by affinity chromatography. The thioredoxin fusion protein was removed by using CNBr instead of enterokinase and the carnobacteriocins were recovered by reverse-phase chromatography. These optimizations led us to produce up to 320 mg of pure protein per liter of culture, which is four to ten fold higher than what is described for other heterologous expression systems.

Multiple Renal Cyst Development but Not Situs Abnormalities in Transgenic RNAi Mice against Inv::GFP Rescue Gene

PubMed Central

Kamijho, Yuki; Shiozaki, Yayoi; Sakurai, Eiki; Hanaoka, Kazunori; Watanabe, Daisuke

2014-01-01

In this study we generated RNA interference (RNAi)-mediated gene knockdown transgenic mice (transgenic RNAi mice) against the functional Inv gene. Inv mutant mice show consistently reversed internal organs (situs inversus), multiple renal cysts and neonatal lethality. The Inv::GFP-rescue mice, which introduced the Inv::GFP fusion gene, can rescue inv mutant mice phenotypes. This indicates that the Inv::GFP gene is functional in vivo. To analyze the physiological functions of the Inv gene, and to demonstrate the availability of transgenic RNAi mice, we introduced a short hairpin RNA expression vector against GFP mRNA into Inv::GFP-rescue mice and analyzed the gene silencing effects and Inv functions by examining phenotypes. Transgenic RNAi mice with the Inv::GFP-rescue gene (Inv-KD mice) down-regulated Inv::GFP fusion protein and showed hypomorphic phenotypes of inv mutant mice, such as renal cyst development, but not situs abnormalities or postnatal lethality. This indicates that shRNAi-mediated gene silencing systems that target the tag sequence of the fusion gene work properly in vivo, and suggests that a relatively high level of Inv protein is required for kidney development in contrast to left/right axis determination. Inv::GFP protein was significantly down-regulated in the germ cells of Inv-KD mice testis compared with somatic cells, suggesting the existence of a testicular germ cell-specific enhanced RNAi system that regulates germ cell development. The Inv-KD mouse is useful for studying Inv gene functions in adult tissue that are unable to be analyzed in inv mutant mice showing postnatal lethality. In addition, the shRNA-based gene silencing system against the tag sequence of the fusion gene can be utilized as a new technique to regulate gene expression in either in vitro or in vivo experiments. PMID:24586938

Construction of transformed, cultured silkworm cells and transgenic silkworm using the site-specific integrase system from phage φC31.

PubMed

Yin, Yajuan; Cao, Guangli; Xue, Renyu; Gong, Chengliang

2014-10-01

The Streptomyces bacteriophage, φC31, uses a site-specific integrase enzyme to perform efficient recombination. The recombination system uses specific sequences to integrate exogenous DNA from the phage into a host. The sequences are known as the attP site in the phage and the attB site in the host. The system can be used as a genetic manipulation tool. In this study it has been applied to the transformation of cultured BmN cells and the construction of transgenic Bombyx mori individuals. A plasmid, pSK-attB/Pie1-EGFP/Zeo-PASV40, containing a cassette designed to express a egfp-zeocin fusion gene, was co-transfected into cultured BmN cells with a helper plasmid, pSK-Pie1/NLS-Int/NSL. Expression of the egfp-zeocin fusion gene was driven by an ie-1 promoter, downstream of a φC31 attB site. The helper plasmid encoded the φC31 integrase enzyme, which was flanked by two nuclear localization signals. Expression of the egfp-zeocin fusion gene could be observed in transformed cells. The two plasmids were also transferred into silkworm eggs to obtain transgenic silkworms. Successful integration of the fusion gene was indicated by the detection of green fluorescence, which was emitted by the silkworms. Nucleotide sequence analysis demonstrated that the attB site had been cut, to allow recombination between the attB and endogenous pseudo attP sites in the cultured silkworm cells and silkworm individuals.

Rho GTPase activity modulates paramyxovirus fusion protein-mediated cell-cell fusion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schowalter, Rachel M.; Wurth, Mark A.; Aguilar, Hector C.

2006-07-05

The paramyxovirus fusion protein (F) promotes fusion of the viral envelope with the plasma membrane of target cells as well as cell-cell fusion. The plasma membrane is closely associated with the actin cytoskeleton, but the role of actin dynamics in paramyxovirus F-mediated membrane fusion is unclear. We examined cell-cell fusion promoted by two different paramyxovirus F proteins in three cell types in the presence of constitutively active Rho family GTPases, major cellular coordinators of actin dynamics. Reporter gene and syncytia assays demonstrated that expression of either Rac1{sup V12} or Cdc42{sup V12} could increase cell-cell fusion promoted by the Hendra ormore » SV5 glycoproteins, though the effect was dependent on the cell type expressing the viral glycoproteins. In contrast, RhoA{sup L63} decreased cell-cell fusion promoted by Hendra glycoproteins but had little affect on SV5 F-mediated fusion. Also, data suggested that GTPase activation in the viral glycoprotein-containing cell was primarily responsible for changes in fusion. Additionally, we found that activated Cdc42 promoted nuclear rearrangement in syncytia.« less

Comprehensive characterization of RSPO fusions in colorectal traditional serrated adenomas.

PubMed

Sekine, Shigeki; Ogawa, Reiko; Hashimoto, Taiki; Motohiro, Kojima; Yoshida, Hiroshi; Taniguchi, Hirokazu; Saito, Yutaka; Yasuhiro, Ohno; Ochiai, Atsushi; Hiraoka, Nobuyoshi

2017-10-01

Traditional serrated adenoma (TSA) is a rare but distinct type of colorectal polyp. Our previous study showed that PTPRK-RSPO3 fusions are frequent and characteristic genetic alterations in TSAs. This study aimed to characterize comprehensively the prevalence and variability of RSPO fusions in colorectal TSAs. We examined RSPO expression and explored novel RSPO fusions in 129 TSAs, including 66 lesions analysed previously for WNT pathway gene mutations. Quantitative polymerase chain reaction (qPCR) analyses identified three and 43 TSAs overexpressing RSPO2 and RSPO3, respectively, whereas the expression of RSPO1 and RSPO4 was marginal or undetectable in all cases. RSPO overexpression was always mutually exclusive with other WNT pathway gene mutations. Known PTPRK-RSPO3 fusions were detected in 37 TSAs, all but one of which overexpressed RSPO3. In addition, rapid amplification of cDNA ends revealed three novel RSPO fusion transcripts, an NRIP1-RSPO2 fusion and two PTPRK-RSPO3 fusion isoforms, in six TSAs. Overall, 43 TSAs had RSPO fusions (33%), whereas four TSAs (3%) overexpressed RSPO in the absence of RSPO fusions. TSAs with RSPO fusions showed several clinicopathological features, including distal localization (P = 0.0063), larger size (P = 0.0055), prominent ectopic crypt foci (P = 8.4 × 10 -4 ), association of a high-grade component (P = 1.1 × 10 -4 ), and the presence of KRAS mutations (P = 4.5 × 10 -5 ). The present study identified RSPO fusion transcripts, including three novel transcripts, in one-third of colorectal TSAs and showed that PTPRK-RSPO3 fusions were the predominant cause of RSPO overexpression in colorectal TSA. © 2017 John Wiley & Sons Ltd.

The MARVEL domain protein, Singles Bar, is required for progression past the pre-fusion complex stage of myoblast fusion.

PubMed

Estrada, Beatriz; Maeland, Anne D; Gisselbrecht, Stephen S; Bloor, James W; Brown, Nicholas H; Michelson, Alan M

2007-07-15

Multinucleated myotubes develop by the sequential fusion of individual myoblasts. Using a convergence of genomic and classical genetic approaches, we have discovered a novel gene, singles bar (sing), that is essential for myoblast fusion. sing encodes a small multipass transmembrane protein containing a MARVEL domain, which is found in vertebrate proteins involved in processes such as tight junction formation and vesicle trafficking where--as in myoblast fusion--membrane apposition occurs. sing is expressed in both founder cells and fusion competent myoblasts preceding and during myoblast fusion. Examination of embryos injected with double-stranded sing RNA or embryos homozygous for ethane methyl sulfonate-induced sing alleles revealed an identical phenotype: replacement of multinucleated myofibers by groups of single, myosin-expressing myoblasts at a stage when formation of the mature muscle pattern is complete in wild-type embryos. Unfused sing mutant myoblasts form clusters, suggesting that early recognition and adhesion of these cells are unimpaired. To further investigate this phenotype, we undertook electron microscopic ultrastructural studies of fusing myoblasts in both sing and wild-type embryos. These experiments revealed that more sing mutant myoblasts than wild-type contain pre-fusion complexes, which are characterized by electron-dense vesicles paired on either side of the fusing plasma membranes. In contrast, embryos mutant for another muscle fusion gene, blown fuse (blow), have a normal number of such complexes. Together, these results lead to the hypothesis that sing acts at a step distinct from that of blow, and that sing is required on both founder cell and fusion-competent myoblast membranes to allow progression past the pre-fusion complex stage of myoblast fusion, possibly by mediating fusion of the electron-dense vesicles to the plasma membrane.

Purification of CD47-streptavidin fusion protein from bacterial lysate using biotin-agarose affinity chromatography.

PubMed

Salehi, Nasrin; Peng, Ching-An

2016-07-08

CD47 is a widely expressed transmembrane glycoprotein that modulates the activity of a plethora of immune cells via its extracellular domain. Therefore, CD47 plays important roles in the regulation of immune responses and may serve as targets for the development of immunotherapeutic agents. To make sure CD47 functionality is intact under the process of protein conjugation, CD47-streptavidin fusion protein was expressed and purified because it can easily bind to biotin-tagged materials via the unique biotin-streptavidin affinity. In this study, gene sequences of CD47 extracellular domain (CD47ECD) and core streptavidin (coreSA) with a total 834 bp were inserted into pET20b plasmid to construct recombinant plasmid encoding CD47-SA fusion gene. After bacteria transformation, the CD47-SA fusion protein was expressed by isopropyl-β-d-thiogalactopyranoside (IPTG) induction. The collected bacteria lysate was loaded on biotinylated agarose to proceed the purification of CD47-SA fusion protein. Due to the unexpected high affinity between biotin and coreSA, standard washing and elution approaches (e.g., varying pH, using biotin, and applying guanidine hydrochloride) reported for biotin-streptavidin affinity chromatography were not able to separate the target fusion protein. Instead, using low concentration of the non-ionic detergent Triton X-100 followed with alkaline buffer could efficiently weaken the binding between biotin and coreSA, thereby eluting out CD47-SA fusion protein from the biotin agarose column. The purified CD47-SA fusion protein was further characterized by molecular biology methods and its antiphagocytic functionality was confirmed by the phagocytosis assay. © 2016 American Institute of Chemical Engineers Biotechnol. Prog., 32:949-958, 2016. © 2016 American Institute of Chemical Engineers.

Soft tissue angiofibroma: Clinicopathologic, immunohistochemical and molecular analysis of 14 cases.

PubMed

Bekers, Elise M; Groenen, Patricia J T A; Verdijk, Marian A J; Raaijmakers-van Geloof, Winny L; Roepman, Paul; Vink, Robert; Gilhuijs, Nathalie D B; van Gorp, Joost M; Bovée, Judith V M G; Creytens, David H; Flanagan, Adrienne M; Suurmeijer, Albert J H; Mentzel, Thomas; Arbajian, Elsa; Flucke, Uta

2017-10-01

Soft tissue angiofibroma is rare and has characteristic histomorphological and genetic features. For diagnostic purposes, there are no specific antibodies available. Fourteen lesions (6 females, 8 males; age range 7-67 years) of the lower extremities (12) and trunk (2) were investigated by immunohistochemistry, including for the first time NCOA2. NCOA2 was also tested in a control group of other spindle cell lesions. The known fusion-genes (AHRR-NCOA2 and GTF2I-NCOA2) were examined using RT-PCR in order to evaluate their diagnostic value. Cases in which no fusion gene was detected were additionally analysed by RNA sequencing. All cases tested showed nuclear expression of NCOA2. However, this was not specific since other spindle cell neoplasms also expressed this marker in a high percentage of cases. Other variably positive markers were EMA, SMA, desmin and CD34. STAT6 was negative in the cases tested. By RT-PCR for the most frequently observed fusions, an AHRR-NCOA2 fusion transcript was found in 9/14 cases. GTF2I-NCOA2 was not detected in the remaining cases (n = 3). RNA sequencing revealed three additional positive cases; two harbored a AHRR-NCOA2 fusion and one case a novel GAB1-ABL1 fusion. Two cases failed molecular analysis due to poor RNA quality. In conclusion, the AHRR-NCOA2 fusion is a frequent finding in soft tissue angiofibroma, while GTF2I-NCOA2 seems to be a rare genetic event. For the first time, we report a GAB1-ABL1 fusion in a soft tissue angiofibroma of a child. Nuclear expression of NCOA2 is not discriminating when compared with other spindle cell neoplasms. © 2017 Wiley Periodicals, Inc.

Application of SGT1-Hsp90 chaperone complex for soluble expression of NOD1 LRR domain in E. coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hong, Tae-Joon; Hahn, Ji-Sook

NOD1 is an intracellular sensor of innate immunity which is related to a number of inflammatory diseases. NOD1 is known to be difficult to express and purify for structural and biochemical studies. Based on the fact that Hsp90 and its cochaperone SGT1 are necessary for the stabilization and activation of NOD1 in mammals, SGT1 was chosen as a fusion partner of the leucine-rich repeat (LRR) domain of NOD1 for its soluble expression in Escherichia coli. Fusion of human SGT1 (hSGT1) to NOD1 LRR significantly enhanced the solubility, and the fusion protein was stabilized by coexpression of mouse Hsp90α. The expressionmore » level of hSGT1-NOD1 LRR was further enhanced by supplementation of rare codon tRNAs and exchange of antibiotic marker genes. - Highlights: • The NOD1 LRR domain was solubilized by SGT1 fusion in E. coli. • The coexpression of HSP90 stabilized the SGT1-NOD1 LRR fusion protein. • Several optimizations could enhance the expression level of the fusion protein.« less

Characterization of a Cellulomonas fimi exoglucanase/xylanase-endoglucanase gene fusion which improves microbial degradation of cellulosic biomass.

PubMed

Duedu, Kwabena O; French, Christopher E

2016-11-01

Effective degradation of cellulose requires multiple classes of enzyme working together. However, naturally occurring cellulases with multiple catalytic domains seem to be rather rare in known cellulose-degrading organisms. A fusion protein made from Cellulomonas fimi exo- and endo- glucanases, Cex and CenA which improves breakdown of cellulose is described. A homologous carbohydrate binding module (CBM-2) present in both glucanases was fused to give a fusion protein CxnA. CxnA or unfused constructs (Cex+CenA, Cex, or CenA) were expressed in Escherichia coli and Citrobacter freundii. The latter recombinant strains were cultured at the expense of cellulose filter paper. The expressed CxnA had both exo- and endo- glucanase activities. It was also exported to the supernatant as were the non-fused proteins. In addition, the hybrid CBM from the fusion could bind to microcrystalline cellulose. Growth of C. freundii expressing CxnA was superior to that of cells expressing the unfused proteins. Physical degradation of filter paper was also faster with the cells expressing fusion protein than the other constructs. Our results show that fusion proteins with multiple catalytic domains can improve the efficiency of cellulose degradation. Such fusion proteins could potentially substitute cloning of multiple enzymes as well as improving product yields. Copyright © 2016 Elsevier Inc. All rights reserved.

Reciprocal products of chromosomal translocations in human cancer pathogenesis: key players or innocent bystanders?

PubMed

Rego, Eduardo M; Pandolfi, Pier Paolo

2002-08-01

Chromosomal translocations are frequently involved in the pathogenesis of leukemias, lymphomas and sarcomas. They can lead to aberrant expression of oncogenes or the generation of chimeric proteins. Classically, one of the products is thought to be oncogenic. For example, in acute promyelocytic leukaemia (APL), reciprocal chromosomal translocations involving the retinoic acid receptor alpha (RARalpha) gene lead to the formation of two fusion genes: X-RARalpha and RARalpha-X (where X is the alternative RARalpha fusion partner: PML, PLZF, NPM, NuMA and STAT 5b). The X-RARalpha fusion protein is indeed oncogenic. However, recent data indicate that the RARalpha-X product is also critical in determining the biological features of this leukemia. Here, we review the current knowledge on the role of reciprocal products in cancer pathogenesis, and highlight how their expression might impact on the biology of their respective tumour types.

In vitro mapping of Myotonic Dystrophy (DM) gene promoter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Storbeck, C.J.; Sabourin, L.; Baird, S.

1994-09-01

The Myotonic Dystrophy Kinase (DMK) gene has been cloned and shared homology to serine/threonine protein kinases. Overexpression of this gene in stably transfected mouse myoblasts has been shown to inhibit fusion into myotubes while myoblasts stably transfected with an antisense construct show increased fusion potential. These experiments, along with data showing that the DM gene is highly expressed in muscle have highlighted the possibility of DMK being involved in myogenesis. The promoter region of the DM gene lacks a consensus TATA box and CAAT box, but harbours numerous transcription binding sites. Clones containing extended 5{prime} upstream sequences (UPS) of DMKmore » only weakly drive the reporter gene chloramphenicol acetyl transferase (CAT) when transfected into C2C12 mouse myoblasts. However, four E-boxes are present in the first intron of the DM gene and transient assays show increased expression of the CAT gene when the first intron is present downstream of these 5{prime} UPS in an orientation dependent manner. Comparison between mouse and human sequence reveals that the regions in the first intron where the E-boxes are located are highly conserved. The mapping of the promoter and the importance of the first intron in the control of DMK expression will be presented.« less

Expression of Clostridium perfringens epsilon-beta fusion toxin gene in E. coli and its immunologic studies in mouse.

PubMed

Pilehchian Langroudi, Reza; Shamsara, Mehdi; Aghaiypour, Khosrow

2013-07-11

Clostridium perfringens is an anaerobic spore-forming, pathogenic bacterium that is responsible for severe diseases in humans and livestock. In the present study, an epsilon-beta fusion toxin was expressed as a soluble protein in E. coli and the recombinant cell lysate was used for immunization studies in mouse. Potency of the toxin (as an antigen) induced 6 and 10IU/ml of epsilon and beta anti-toxin in rabbit, respectively. These titers were higher than the minimum level required by the European Pharmacopoeia for epsilon and beta toxins. Experimental challenge with the recombinant fusion toxoid revealed that it could protect mice against C. perfringens epsilon and beta toxins. Toxicity of the fusion toxin was studied by histopathological findings, which were the same as the native toxins. In conclusion, E. coli is a suitable expression host for immunogenic epsilon-beta fusion toxin of C. perfringens. Copyright © 2013 Elsevier Ltd. All rights reserved.

Overcoming resistance to single-agent therapy for oncogenic BRAF gene fusions via combinatorial targeting of MAPK and PI3K/mTOR signaling pathways

PubMed Central

Jain, Payal; Silva, Amanda; Han, Harry J.; Lang, Shih-Shan; Zhu, Yuankun; Boucher, Katie; Smith, Tiffany E.; Vakil, Aesha; Diviney, Patrick; Choudhari, Namrata; Raman, Pichai; Busch, Christine M.; Delaney, Tim; Yang, Xiaodong; Olow, Aleksandra K.; Mueller, Sabine; Haas-Kogan, Daphne; Fox, Elizabeth; Storm, Phillip B.; Resnick, Adam C.; Waanders, Angela J.

2017-01-01

Pediatric low-grade gliomas (PLGGs) are frequently associated with activating BRAF gene fusions, such as KIAA1549-BRAF, that aberrantly drive the mitogen activated protein kinase (MAPK) pathway. Although RAF inhibitors (RAFi) have been proven effective in BRAF-V600E mutant tumors, we have previously shown how the KIAA1549-BRAF fusion can be paradoxically activated by RAFi. While newer classes of RAFi, such as PLX8394, have now been shown to inhibit MAPK activation by KIAA1549-BRAF, we sought to identify alternative MAPK pathway targeting strategies using clinically relevant MEK inhibitors (MEKi), along with potential escape mechanisms of acquired resistance to single-agent MAPK pathway therapies. We demonstrate effectiveness of multiple MEKi against diverse BRAF-fusions with novel N-terminal partners, with trametinib being the most potent. However, resistance to MEKi or PLX8394 develops via increased RTK expression causing activation of PI3K/mTOR pathway in BRAF-fusion expressing resistant clones. To circumvent acquired resistance, we show potency of combinatorial targeting with trametinib and everolimus, an mTOR inhibitor (mTORi) against multiple BRAF-fusions. While single-agent mTORi and MEKi PLGG clinical trials are underway, our study provides preclinical rationales for using MEKi and mTORi combinatorial therapy to stave off or prevent emergent drug-resistance in BRAF-fusion driven PLGGs. PMID:29156677

Immunogenicity and protective role of antigenic regions from five outer membrane proteins of Flavobacterium columnare in grass carp Ctenopharyngodon idella

NASA Astrophysics Data System (ADS)

Luo, Zhang; Liu, Zhixin; Fu, Jianping; Zhang, Qiusheng; Huang, Bei; Nie, Pin

2016-11-01

Flavobacterium columnare causes columnaris disease in freshwater fish. In the present study, the antigenic regions of five outer membrane proteins (OMPs), including zinc metalloprotease, prolyl oligopeptidase, thermolysin, collagenase and chondroitin AC lyase, were bioinformatically analyzed, fused together, and then expressed as a recombinant fusion protein in Escherichia coli. The expressed protein of 95.6 kDa, as estimated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis, was consistent with the molecular weight deduced from the amino acid sequence. The purified recombinant protein was used to vaccinate the grass carp, Ctenopharyngodon idella. Following vaccination of the fish their IgM antibody levels were examined, as was the expression of IgM, IgD and IgZ immunoglobulin genes and other genes such as MHC Iα and MHC IIβ, which are also involved in adaptive immunity. Interleukin genes ( IL), including IL-1β, IL-8 and IL-10, and type I and type II interferon ( IFN) genes were also examined. At 3 and 4 weeks post-vaccination (wpv), significant increases in IgM antibody levels were observed in the fish vaccinated with the recombinant fusion protein, and an increase in the expression levels of IgM, IgD and IgZ genes was also detected following the vaccinations, thus indicating that an adaptive immune response was induced by the vaccinations. Early increases in the expression levels of IL and IFN genes were also observed in the vaccinated fish. At four wpv, the fish were challenged with F. columnare, and the vaccinated fish showed a good level of protection against this pathogen, with 39% relative percent survival (RPS) compared with the control group. It can be concluded, therefore, that the five OMPs, in the form of a recombinant fusion protein vaccine, induced an immune response in fish and protection against F. columnare.

Enzyme-linked immunosorbent assay for Escherichia coli heat-stable enterotoxin type II.

PubMed Central

Handl, C; Rönnberg, B; Nilsson, B; Olsson, E; Jonsson, H; Flock, J I

1988-01-01

The gene for Escherichia coli heat-stable enterotoxin type II (STII) was fused to the genes for protein A from Staphylococcus aureus and beta-galactosidase in two different expression systems. Antibodies raised in rabbits against the protein A-STII fusion protein recognized the beta-galactosidase-STII fusion protein. The latter fusion protein was used as the immobilized antigen in an enzyme-linked immunosorbent assay (ELISA) for detection of STII. The correlation between the results of the ELISA and the intestinal loop test in piglets was 95%, suggesting that the ELISA can be used to reliably detect STII. Images PMID:3049659

A method for constructing single-copy lac fusions in Salmonella typhimurium and its application to the hemA-prfA operon.

PubMed

Elliott, T

1992-01-01

This report describes a set of Escherichia coli and Salmonella typhimurium strains that permits the reversible transfer of lac fusions between a plasmid and either bacterial chromosome. The system relies on homologous recombination in an E. coli recD host for transfer from plasmid to chromosome. This E. coli strain carries the S. typhimurium put operon inserted into trp, and the resulting fusions are of the form trp::put::[Kanr-X-lac], where X is the promoter or gene fragment under study. The put homology flanks the lac fusion segment, so that fusions can be transduced into S. typhimurium, replacing the resident put operon. Subsequent transduction into an S. typhimurium strain with a large chromosomal deletion covering put allows selection for recombinants that inherit the fusion on a plasmid. A transposable version of the put operon was constructed and used to direct lac fusions to novel locations, including the F plasmid and the ara locus. Transductional crosses between strains with fusions bearing different segments of the hemA-prfA operon were used to determine the contribution of the hemA promoter region to expression of the prfA gene and other genes downstream of hemA in S. typhimurium.

Fusion of Huntingtin interacting protein 1 to platelet-derived growth factor beta receptor (PDGFbetaR) in chronic myelomonocytic leukemia with t(5;7)(q33;q11.2).

PubMed

Ross, T S; Bernard, O A; Berger, R; Gilliland, D G

1998-06-15

We report the fusion of the Huntingtin interactin protein 1 (HIP1) gene to the platelet-derived growth factor betareceptor (PDGFbetaR) gene in a patient with chronic myelomonocytic leukemia (CMML) with a t(5;7)(q33;q11.2) translocation. Southern blot analysis of patient bone marrow cells with a PDGFbetaR gene probe demonstrated rearrangement of the PDGFbetaR gene. Anchored polymerase chain reaction using PDGFbetaR primers identified a chimeric transcript containing the HIP1 gene located at 7q11.2 fused to the PDGFbetaR gene on 5q33. HIP1 is a 116-kD protein recently cloned by yeast two-hybrid screening for proteins that interact with Huntingtin, the mutated protein in Huntington's disease. The consequence of t(5;7)(q33;q11.2) is an HIP1/PDGFbetaR fusion gene that encodes amino acids 1 to 950 of HIP1 joined in-frame to the transmembrane and tyrosine kinase domains of the PDGFbetaR. The reciprocal PDGFbetaR/HIP1 transcript is not expressed. HIP1/PDGFbetaR is a 180-kD protein when expressed in the murine hematopoietic cell line, Ba/F3, and is constitutively tyrosine phosphorylated. Furthermore, HIP1/PDGFbetaR transforms the Ba/F3 cells to interleukin-3-independent growth. These data are consistent with an alternative mechanism for activation of PDGFbetaR tyrosine kinase activity by fusion with HIP1, leading to transformation of hematopoietic cells, and may implicate Huntingtin or HIP1 in the pathogenesis of hematopoietic malignancies.

Expression and characterization of truncated human heme oxygenase (hHO-1) and a fusion protein of hHO-1 with human cytochrome P450 reductase.

PubMed

Wilks, A; Black, S M; Miller, W L; Ortiz de Montellano, P R

1995-04-04

A human heme oxygenase (hHO-1) gene without the sequence coding for the last 23 amino acids has been expressed in Escherichia coli behind the pho A promoter. The truncated enzyme is obtained in high yields as a soluble, catalytically-active protein, making it available for the first time for detailed mechanistic studies. The purified, truncated hHO-1/heme complex is spectroscopically indistinguishable from that of the rat enzyme and converts heme to biliverdin when reconstituted with rat liver cytochrome P450 reductase. A self-sufficient heme oxygenase system has been obtained by fusing the truncated hHO-1 gene to the gene for human cytochrome P450 reductase without the sequence coding for the 20 amino acid membrane binding domain. Expression of the fusion protein in pCWori+ yields a protein that only requires NADPH for catalytic turnover. The failure of exogenous cytochrome P450 reductase to stimulate turnover and the insensitivity of the catalytic rate toward changes in ionic strength establish that electrons are transferred intramolecularly between the reductase and heme oxygenase domains of the fusion protein. The Vmax for the fusion protein is 2.5 times higher than that for the reconstituted system. Therefore, either the covalent tether does not interfere with normal docking and electron transfer between the flavin and heme domains or alternative but equally efficient electron transfer pathways are available that do not require specific docking.

ERG Expression Levels in Prostate Tumors Reflect Functional Status of the Androgen Receptor (AR) as a Consequence of Fusion of ERG with AR Regulated Gene Promoters

DTIC Science & Technology

2010-01-01

mathematically defined in the following formulas. ARGI = Σ (I PMEPA1 + IPSA +INKX3.1+IODC1+IAMD1) ARFI=CI=ARGI+IERG Detection of TMPRSS2-ERG Fusion Junctions...ERG expression into the Androgen Receptor Function Index, ARFI. ARGI = Σ (I PMEPA1 + IPSA +INKX3.1+IODC1+IAMD1) ARFI=CI=ARGI+IERG In the high ERG

Gene expression platform for synthetic biology in the human pathogen Streptococcus pneumoniae.

PubMed

Sorg, Robin A; Kuipers, Oscar P; Veening, Jan-Willem

2015-03-20

The human pathogen Streptococcus pneumoniae (pneumococcus) is a bacterium that owes its success to complex gene expression regulation patterns on both the cellular and the population level. Expression of virulence factors enables a mostly hazard-free presence of the commensal, in balance with the host and niche competitors. Under specific circumstances, changes in this expression can result in a more aggressive behavior and the reversion to the invasive form as pathogen. These triggering conditions are very difficult to study due to the fact that environmental cues are often unknown or barely possible to simulate outside the host (in vitro). An alternative way of investigating expression patterns is found in synthetic biology approaches of reconstructing regulatory networks that mimic an observed behavior with orthogonal components. Here, we created a genetic platform suitable for synthetic biology approaches in S. pneumoniae and characterized a set of standardized promoters and reporters. We show that our system allows for fast and easy cloning with the BglBrick system and that reliable and robust gene expression after integration into the S. pneumoniae genome is achieved. In addition, the cloning system was extended to allow for direct linker-based assembly of ribosome binding sites, peptide tags, and fusion proteins, and we called this new generally applicable standard "BglFusion". The gene expression platform and the methods described in this study pave the way for employing synthetic biology approaches in S. pneumoniae.

Expression of the gene cluster associated with the Escherichia coli pilus adhesin K99.

PubMed

Lee, J H; Isaacson, R E

1995-10-01

The biogenesis of the pilus adhesin K99 is dependent on the expression of eight contiguous genes, fanA to fanH. Transposon mutants were prepared by using TnlacZ and TnphoA, and selected transposon mutants were used to measure expression of each K99 gene. Expression of the K99 genes is likely controlled at the transcription level, since in general, there were no differences between the results obtained with the two transposons. fanC was the most highly expressed, and fanD was expressed at very low levels. The expression of TnlacZ fusions in fanA and fanB fusions was high. Deletion of fanA, fanB, and part of fanC abolished the expression of fanD but had no effect on the distal genes fanE to fanH. To locate the DNA regions required for expression of fanE to fanH, deletion mutations were prepared and the effects on expression of fanE to fanH were determined. The deletion of a segment between fanD and fanE abolished fanE and fanF expression but did not affect fanG and fanH. The deletion of a portion of fanF (approximately 1 kb proximal to fanG) abolished the expression of fanG and fanH. These results indicate the presence of regulatory elements proximal to fanE and to fanG. Putative promoters were identified in these regions by DNA homology and by primer extension. A stem-loop structure that may act as a transcriptional attenuator of fanF was also found at the beginning of fanF. These data confirm our previous model of K99 transcriptional organization.

Expression of the gene cluster associated with the Escherichia coli pilus adhesin K99.

PubMed Central

Lee, J H; Isaacson, R E

1995-01-01

The biogenesis of the pilus adhesin K99 is dependent on the expression of eight contiguous genes, fanA to fanH. Transposon mutants were prepared by using TnlacZ and TnphoA, and selected transposon mutants were used to measure expression of each K99 gene. Expression of the K99 genes is likely controlled at the transcription level, since in general, there were no differences between the results obtained with the two transposons. fanC was the most highly expressed, and fanD was expressed at very low levels. The expression of TnlacZ fusions in fanA and fanB fusions was high. Deletion of fanA, fanB, and part of fanC abolished the expression of fanD but had no effect on the distal genes fanE to fanH. To locate the DNA regions required for expression of fanE to fanH, deletion mutations were prepared and the effects on expression of fanE to fanH were determined. The deletion of a segment between fanD and fanE abolished fanE and fanF expression but did not affect fanG and fanH. The deletion of a portion of fanF (approximately 1 kb proximal to fanG) abolished the expression of fanG and fanH. These results indicate the presence of regulatory elements proximal to fanE and to fanG. Putative promoters were identified in these regions by DNA homology and by primer extension. A stem-loop structure that may act as a transcriptional attenuator of fanF was also found at the beginning of fanF. These data confirm our previous model of K99 transcriptional organization. PMID:7558331

Gene Amplification by PCR and Subcloning into a GFP-Fusion Plasmid Expression Vector as a Molecular Biology Laboratory Course

ERIC Educational Resources Information Center

Bornhorst, Joshua A.; Deibel, Michael A.; Mulnix, Amy B.

2004-01-01

A novel experimental sequence for the advanced undergraduate laboratory course has been developed at Earlham College. Utilizing recent improvements in molecular techniques for a time-sensitive environment, undergraduates were able to create a chimera of a selected gene and green fluorescent protein (GFP) in a bacterial expression plasmid over the…

[Expression optimization and characterization of Tenebrio molitor antimicrobiol peptides TmAMP1m in Escherichia coli].

PubMed

Alimu, Reyihanguli; Mao, Xinfang; Liu, Zhongyuan

2013-06-01

To improve the expression level of tmAMP1m gene from Tenebrio molitor in Escherichia coli, we studied the effects of expression level and activity of the fusion protein HIS-TmAMP1m by conditions, such as culture temperature, inducing time and the final concentration of inductor Isopropyl beta-D-thiogalactopyranoside (IPTG). We analyzed the optimum expression conditions by Tricine-SDS-PAGE electrophoresis, meanwhile, detected its antibacterial activity by using agarose cavity diffusion method. The results suggest that when inducing the recombinant plasmid with a final IPTG concentration of 0.1 mmol/L at 37 degrees C for 4 h, there was the highest expression level of fusion protein HIS-TmAMP1m in Escherichia coli. Under these conditions, the expression of fusion protein accounted for 40% of the total cell lysate with the best antibacterial activity. We purified the fusion protein HIS-TmAMPlm with nickel-nitrilotriacetic acid (Ni-NTA) metal-affinity chromatography matrices. Western blotting analysis indicates that the His monoclonal antibody could be specifically bound to fusion protein HIS-TmAMPlm. After expression by inducing, the fusion protein could inhibit the growth of host cell transformed by pET30a-tmAMP1m. The fusion protein HIS-TmAMP1m had better stability and remained higher antibacterial activities when incubated at 100 degrees C for 10 h, repeated freeze thawing at -20 degrees C, dissolved in strong acid and alkali, or treated by organic solvents and protease. Moreover, the minimum inhibitory concentration results demonstrated that the fusion protein HIS-TmAMP1m has a good antibacterial activity against Staphylococcus aureus, Staphylococcus sp., Corynebacterium glutamicum, Bacillus thuringiensis, Corynebacterium sp. This study laid the foundation to promote the application of insect antimicrobial peptides and further research.

[Construction and eukaryotic expression of PVAX1-hPV58mE6E7fcGB composite gene vaccine].

PubMed

Wang, He; Yu, Jiyun; Li, Li

2013-10-01

To construct and express a composite gene vaccine for human papillomavirus 58(HPV58)-associated cervical cancer, we inserted HPV58mE6E7 fusion gene into pCI-Fc-GPI eukaryotic expression vector, constructing a recombinant plasmid named pCI-sig-HPV58mE6E7-Fc-GPI. Then we further inserted fragment of sig-HPV58mE6E7Fc-GPI into the novel vaccine vector PVAX1-IRES-GM/B7, constructing PVAX1-HPV58mE6E7FcGB composite gene vaccine. PVAX1-HPV58mE6E7FcGB vaccine was successfully constructed and identified by restriction endonuclease and sequencing analysis. Eukaryotic expression of fusion antigen sig-HPV58mE6E7-Fc-GPI and molecular ad-juvant GM-CSF and B7. 1 were proved to be realized at the same time by flow cytometry and immunofluorescence. So PVAX1-HPV58mE6E7FcGB can be taken as a candidate of therapeutic vaccine for HPV58-associated tumors and their precancerous transformations.

The use of quantitative real-time reverse transcriptase PCR for 5' and 3' portions of ALK transcripts to detect ALK rearrangements in lung cancers.

PubMed

Wang, Rui; Pan, Yunjian; Li, Chenguang; Hu, Haichuan; Zhang, Yang; Li, Hang; Luo, Xiaoyang; Zhang, Jie; Fang, Zhaoyuan; Li, Yuan; Shen, Lei; Ji, Hongbin; Garfield, David; Sun, Yihua; Chen, Haiquan

2012-09-01

Approximately 3% to 7% of non-small cell lung cancers (NSCLC) harbor an ALK fusion gene, thus defining a tumor group that may be responsive to targeted therapy. The breakpoint in ALK consistently occurs at exon 20 and EML4 or other fusion partners, thus driving a strong expression of ALK kinase domain and resulting in an unbalanced expression in 5' and 3' portions of ALK transcripts. We have developed a rapid and accurate method by simultaneously detecting the expression in 5' and 3' portions of ALK mRNA. Quantitative real-time reverse transcriptase PCR (qRT-PCR) was used to examine expression levels of the 5' and 3' portions of ALK transcripts in177 NSCLCs, in which EGFR, KRAS, HER2, and BRAF mutations were absent. If unbalanced ALK mRNA expression was seen, ALK rearrangement was assumed to exist. ALK FISH was used to confirm the accuracy of qRT-PCR. RT-PCR and 5' RACE coupling sequencing identified the fusion variants. Real-time RT-PCR showed excellent sensitivity and specificity (100% and 100%, respectively) for detection of ALK rearrangements in resected specimens. In addition, six novel ALK fusion variants were identified, including one KIF5B-ALK (E17;A20) and five EML4-ALK variants (E6a;A19, E6a/b ins 18;A20, E17b ins 39;A20, E10a/b, E13;A20, and E17 ins 65;A20). Real-time RT-PCR is a rapid and accurate method for diagnosing ALK-rearranged lung cancers. Coupling of 5' RACE to this method should further facilitate rapid identification of novel ALK fusion genes. ©2012 AACR.

Identification of in vivo regulators of the Vibrio cholerae xds gene using a high-throughput genetic selection

PubMed Central

McDonough, EmilyKate; Lazinski, David W.; Camilli, Andrew

2014-01-01

Summary Vibrio cholerae, the causative agent of cholera, remains a threat to public health in areas with inadequate sanitation. As a waterborne pathogen, V. cholerae moves between two dissimilar environments, aquatic reservoirs and the intestinal tract of humans. Accordingly, this pathogen undergoes adaptive shifts in gene expression throughout the different stages of its lifecycle. One particular gene, xds, encodes a secreted exonuclease that was previously identified as being induced during infection. Here we sought to identify regulators responsible for the in vivo-specific induction of xds. A transcriptional fusion of xds to two consecutive antibiotic resistance genes was used to select transposon mutants that had inserted within or adjacent to regulatory genes and thereby caused increased expression of the xds fusion under non-inducing conditions. Large pools of selected insertion sites were sequenced in a high throughput manner using Tn-seq to identify potential mechanisms of xds regulation. Our selection identified the two-component system PhoB/R as the dominant activator of xds expression. In vitro validation confirmed that PhoB, a protein which is only active during phosphate limitation, was responsible for xds activation. Using xds expression as a biosensor of the extracellular phosphate level, we observed that the mouse small intestine is a phosphate-limited environment. PMID:24673931

Reversible Heat-Induced Inactivation of Chimeric β-Glucuronidase in Transgenic Plants1

PubMed Central

Almoguera, Concepción; Rojas, Anabel; Jordano, Juan

2002-01-01

We compared the expression patterns in transgenic tobacco (Nicotiana tabacum) of two chimeric genes: a translational fusion to β-glucuronidase (GUS) and a transcriptional fusion, both with the same promoter and 5′-flanking sequences of Ha hsp17.7 G4, a small heat shock protein (sHSP) gene from sunflower (Helianthus annuus). We found that immediately after heat shock, the induced expression from the two fusions in seedlings was similar, considering chimeric mRNA or GUS protein accumulation. Surprisingly, we discovered that the chimeric GUS protein encoded by the translational fusion was mostly inactive in such conditions. We also found that this inactivation was fully reversible. Thus, after returning to control temperature, the GUS activity was fully recovered without substantial changes in GUS protein accumulation. In contrast, we did not find differences in the in vitro heat inactivation of the respective GUS proteins. Insolubilization of the chimeric GUS protein correlated with its inactivation, as indicated by immunoprecipitation analyses. The inclusion in another chimeric gene of the 21 amino-terminal amino acids from a different sHSP lead to a comparable reversible inactivation. That effect not only illustrates unexpected post-translational problems, but may also point to sequences involved in interactions specific to sHSPs and in vivo heat stress conditions. PMID:12011363

PARP-1 inhibition as a targeted strategy to treat Ewing's sarcoma

PubMed Central

Brenner, J. Chad; Feng, Felix Y.; Han, Sumin; Patel, Sonam; Goyal, Siddharth V.; Bou-Maroun, Laura M.; Liu, Meilan; Lonigro, Robert; Prensner, John R.; Tomlins, Scott A.; Chinnaiyan, Arul M.

2012-01-01

Ewing's sarcoma family tumors (ESFTs) are aggressive malignancies which frequently harbor characteristic EWS-FLI1 or EWS-ERG genomic fusions. Here we report that these fusion products interact with the DNA damage response protein and transcriptional co-regulator PARP-1. ESFT cells, primary tumor xenografts and tumor metastases were all highly sensitive to PARP1 inhibition. Addition of a PARP1 inhibitor to the second-line chemotherapeutic agent temozolamide resulted in complete responses of all treated tumors in an EWS-FLI1-driven mouse xenograft model of ESFT. Mechanistic investigations revealed that DNA damage induced by expression of EWS-FLI1 or EWS-ERG fusion genes was potentiated by PARP1 inhibition in ESFT cell lines. Notably, EWS-FLI1 fusion genes acted in a positive feedback loop to maintain the expression of PARP1, which was required for EWS-FLI-mediated transcription, thereby enforcing oncogene-dependent sensitivity to PARP-1 inhibition. Together, our findings offer a strong preclinical rationale to target the EWS-FLI1: PARP1 intersection as a therapeutic strategy to improve the treatment of Ewing's sarcoma family tumors. PMID:22287547

Enhanced synergistic anti-Lewis lung carcinoma effect of a DNA vaccine harboring a MUC1-VEGFR2 fusion gene used with GM-CSF as an adjuvant.

PubMed

Ruan, Junzhong; Duan, Yong; Li, Fugen; Wang, Zitong

2017-01-01

In order to achieve a synergistic effect on anti-tumour and anti-angiogenesis activity, we designed and constructed a DNA vaccine that expresses MUC1and VEGFR2 in the same reading frame. The aim of this study was to investigate the anti-tumour activity of this DNA vaccine. Furthermore, we also investigated the enhanced synergistic anti-Lewis lung carcinoma effect of this DNA vaccine by using GM-CSF as an adjuvant. A series of DNA plasmids encoding MUC1, VEGFR2, GM-CSF, and their conjugates were constructed and injected into mice intramuscularly (i.m.) followed by an electric pulse. The humoral and cellular immune responses after immunization were detected by enzyme-linked immunosorbent assay (ELISA) and enzyme-linked immunospot (ELISPOT), respectively. To evaluate the anti-tumour efficacy of these plasmids, murine models with MUC1-expressing tumours were generated. After injection into the tumour-bearing mouse model, the plasmid carrying the fusion gene of MUC1 and VEGFR2 showed stronger inhibition of tumour growth than the plasmid expressing MUC1 or VEGFR2 alone, which indicated that MUC1 and VEGFR2 could exert a synergistic anti-tumour effect. Furthermore, mice vaccinated with the combination of the GM-CSF expressing plasmid and the plasmid carrying the fusion gene of MUC1 and VEGFR2 showed an increased inhibition in the growth of MUC1-expressing tumours and prolonged mouse survival. These observations emphasize the potential of the synergistic anti-tumour and anti-angiogenesis strategy used in DNA vaccines, and the potential of the GM-CSF gene as an adjuvant for DNA vaccines, which could represent a promising approach for tumour immunotherapy. © 2016 John Wiley & Sons Australia, Ltd.

A zebrafish transgenic model of Ewing's sarcoma reveals conserved mediators of EWS-FLI1 tumorigenesis.

PubMed

Leacock, Stefanie W; Basse, Audrey N; Chandler, Garvin L; Kirk, Anne M; Rakheja, Dinesh; Amatruda, James F

2012-01-01

Ewing's sarcoma, a malignant bone tumor of children and young adults, is a member of the small-round-blue-cell tumor family. Ewing's sarcoma family tumors (ESFTs), which include peripheral primitive neuroectodermal tumors (PNETs), are characterized by chromosomal translocations that generate fusions between the EWS gene and ETS-family transcription factors, most commonly FLI1. The EWS-FLI1 fusion oncoprotein represents an attractive therapeutic target for treatment of Ewing's sarcoma. The cell of origin of ESFT and the molecular mechanisms by which EWS-FLI1 mediates tumorigenesis remain unknown, and few animal models of Ewing's sarcoma exist. Here, we report the use of zebrafish as a vertebrate model of EWS-FLI1 function and tumorigenesis. Mosaic expression of the human EWS-FLI1 fusion protein in zebrafish caused the development of tumors with histology strongly resembling that of human Ewing's sarcoma. The incidence of tumors increased in a p53 mutant background, suggesting that the p53 pathway suppresses EWS-FLI1-driven tumorigenesis. Gene expression profiling of the zebrafish tumors defined a set of genes that might be regulated by EWS-FLI1, including the zebrafish ortholog of a crucial EWS-FLI1 target gene in humans. Stable zebrafish transgenic lines expressing EWS-FLI1 under the control of the heat-shock promoter exhibit altered embryonic development and defective convergence and extension, suggesting that EWS-FLI1 interacts with conserved developmental pathways. These results indicate that functional targets of EWS-FLI1 that mediate tumorigenesis are conserved from zebrafish to human and provide a novel context in which to study the function of this fusion oncogene.

Cellular Transfection to Deliver Alanine-Glyoxylate Aminotransferase to Hepatocytes: A Rational Gene Therapy for Primary Hyperoxaluria-1 (PH-1)

PubMed Central

Koul, Sweaty; Johnson, Thomas; Pramanik, Saroj; Koul, Hari

2005-01-01

Background: Primary hyperoxaluria-type 1 (PH-1) is a rare autosomal recessive disorder of glyoxalate metabolism caused by deficiency in the liver-specific peroxisomal enzyme alanine-glyoxalate transaminase 1 (AGT) resulting in the increased oxidation of glyoxalate to oxalate. Accumulation of oxalate in the kidney and other soft tissues results in loss of renal function and significant morbidity. The present treatment options offer some relief in the short term, but they are not completely successful. In the present study, we tested the feasibility of corrective gene therapy for this metabolic disorder. Methods: A cDNA library was made from HepG2 cells. PCR primers were designed for the AGT sequence with modifications to preclude mistargeting during gene delivery. Amplified AGT cDNA was cloned as a fusion protein with green fluorescent protein (GFP) using the vector EGFP-C1 (Clontech) for monitoring subcellular distribution. Sequence and expression of the fusion protein was verified. Fusion protein vectors were transfected into hepatocytes by liposomal transfection. AGT expression and subcellular distribution was monitored by GFP fluorescence. Results: HepG2 cells express full-length mRNA coding for AGT as confirmed by insert size as well as sequence determination. Selective primers allowed us to generate a modified recombinant GFP-AGT fusion protein. Cellular transfections with Lipofectamine resulted in transfection efficiencies of 60–90%. The recombinant AGT did localize to peroxisomes as monitored by GFP fluorescence. Conclusions: The results demonstrate preliminary in vitro feasibility data for AGT transfection into the hepatocytes. To the best of our knowledge, this is the first study to attempt recombinant AGT gene therapy for treatment of primary hyperoxaluria-1. PMID:15849465

Molecular detection of BCR/ABL fusion gene in Saudi acute lymphoblastic leukemia patients.

PubMed

El-Sissy, Azza; El-Mashari, May; Bassuni, Wafaa; El-Swaayed, Aziza

2006-06-01

Molecular cytogenetics is becoming one of the most useful tools targeting some genes which are generally considered to lead to leukemic transformation (as well as for numerical abnormalities). A fraction of acute lymphoblastic leukemia (ALL) cases carry the translocation t(9;22) (q34;q11.2) which juxtaposes the ABL proto-oncogene to the BCR gene generating a chimeric gene, BCR/ABL. This aberration is more frequent in adult ALL (20%-40%) than in pediatric ALL (<5%), and predicts poor clinical outcome. AIM OF OUR WORK: Is to study BCR/ABL fusion gene in ALL cases using fluorescent in situ hybridization. Twenty newly diagnosed ALL patients, 16 adult and 4 paediatric cases, were included in the study, 11 cases (55%) were of precursor B phenotype, 8 cases (40%) belonged to T lineage, while one case was biphenotypic expressing mainly precursor B cell markers tether with CD13, CD33, CD117, Detection of BCR/ABL fusion gene was done using interphase FISH technique and was confirmed molecularly using the RT-PCR technique. BCR/ABL fusion gene was negative in all the examined cases, yet abnormality involving 9q34, ABL gene, either by addition or deletion was detected in three cases (15%). Two of these cases were associated with BCR gene extra copies (three and four copies, respectively). This may reflect the frequency of association of ABL gene and BCR gene abnormality in our cases, and that absence of fusion gene BCR/ABL does not exclude their role in the leukomogenic process, yet a larger study is required to confirm and detect the prevalence of these gene disturbances in ALL and their association.

Characterization of the Structural Gene Promoter of Aedes aegypti Densovirus

PubMed Central

Ward, Todd W.; Kimmick, Michael W.; Afanasiev, Boris N.; Carlson, Jonathan O.

2001-01-01

Aedes aegypti densonucleosis virus (AeDNV) has two promoters that have been shown to be active by reporter gene expression analysis (B. N. Afanasiev, Y. V. Koslov, J. O. Carlson, and B. J. Beaty, Exp. Parasitol. 79:322–339, 1994). Northern blot analysis of cells infected with AeDNV revealed two transcripts 1,200 and 3,500 nucleotides in length that are assumed to express the structural protein (VP) gene and nonstructural protein genes, respectively. Primer extension was used to map the transcriptional start site of the structural protein gene. Surprisingly, the structural protein gene transcript began at an initiator consensus sequence, CAGT, 60 nucleotides upstream from the map unit 61 TATAA sequence previously thought to define the promoter. Constructs with the β-galactosidase gene fused to the structural protein gene were used to determine elements necessary for promoter function. Deletion or mutation of the initiator sequence, CAGT, reduced protein expression by 93%, whereas mutation of the TATAA sequence at map unit 61 had little effect. An additional open reading frame was observed upstream of the structural protein gene that can express β-galactosidase at a low level (20% of that of VP fusions). Expression of the AeDNV structural protein gene was shown to be stimulated by the major nonstructural protein NS1 (Afanasiev et al., Exp. parasitol., 1994). To determine the sequences required for transactivation, expression of structural protein gene–β-galactosidase gene fusion constructs differing in AeDNV genome content was measured with and without NS1. The presence of NS1 led to an 8- to 10-fold increase in expression when either genomic end was present, compared to a 2-fold increase with a construct lacking the genomic ends. An even higher (37-fold) increase in expression occurred with both genomic ends present; however, this was in part due to template replication as shown by Southern blot analysis. These data indicate the location and importance of various elements necessary for efficient protein expression and transactivation from the structural protein gene promoter of AeDNV. PMID:11152505

Upregulation of PD-L1 by EML4-ALK fusion protein mediates the immune escape in ALK positive NSCLC: Implication for optional anti-PD-1/PD-L1 immune therapy for ALK-TKIs sensitive and resistant NSCLC patients.

PubMed

Hong, Shaodong; Chen, Nan; Fang, Wenfeng; Zhan, Jianhua; Liu, Qing; Kang, Shiyang; He, Xiaobo; Liu, Lin; Zhou, Ting; Huang, Jiaxing; Chen, Ying; Qin, Tao; Zhang, Yaxiong; Ma, Yuxiang; Yang, Yunpeng; Zhao, Yuanyuan; Huang, Yan; Zhang, Li

2016-03-01

Driver mutations were reported to upregulate programmed death-ligand 1 (PD-L1) expression. However, how PD-L1 expression and immune function was affected by ALK-TKIs and anti-PD-1/PD-L1 treatment in ALK positive non-small-cell lung cancer (NSCLC) remains poorly understood. In the present study, western-blot, real-time PCR, flow cytometry and immunofluorescence were employed to explore how PD-L1 was regulated by ALK fusion protein. ALK-TKIs and relevant inhibitors were used to identify the downstream signaling pathways involved in PD-L1 regulation. Cell apoptosis, viability and Elisa test were used to study the immune suppression by ALK activation and immune reactivation by ALK-TKIs and/or PD-1 blocking in tumor cells and DC-CIK cells co-culture system. We found that PD-L1 expression was associated with EGFR mutations and ALK fusion genes in NSCLC cell lines. Over-expression of ALK fusion protein increased PD-L1 expression. PD-L1 mediated by ALK fusion protein increased the apoptosis of T cells in tumor cells and DC-CIK cells co-culture system. Inhibiting ALK by sensitive TKIs could enhance the production of IFNγ. Anti-PD-1 antibody was effective in both crizotinib sensitive and resistant NSCLC cells. Synergistic tumor killing effects were not observed with ALK-TKIs and anti-PD-1 antibody combination in co-culture system. ALK-TKIs not only directly inhibited tumor viability but also indirectly enhanced the antitumor immunity via the downregulation of PD-L1. Anti-PD-1/PD-L1 antibodies could be an optional therapy for crizotinib sensitive, especially crizotinib resistant NSCLC patients with ALK fusion gene. Combination of ALK-TKIs and anti-PD-1/PD-L1 antibodies treatment for ALK positive NSCLC warrants more data before moving into clinical practice.

Upregulation of PD-L1 by EML4-ALK fusion protein mediates the immune escape in ALK positive NSCLC: Implication for optional anti-PD-1/PD-L1 immune therapy for ALK-TKIs sensitive and resistant NSCLC patients

PubMed Central

Hong, Shaodong; Chen, Nan; Fang, Wenfeng; Zhan, Jianhua; Liu, Qing; Kang, Shiyang; He, Xiaobo; Liu, Lin; Zhou, Ting; Huang, Jiaxing; Chen, Ying; Qin, Tao; Zhang, Yaxiong; Ma, Yuxiang; Yang, Yunpeng; Zhao, Yuanyuan; Huang, Yan; Zhang, Li

2016-01-01

ABSTRACT Driver mutations were reported to upregulate programmed death-ligand 1 (PD-L1) expression. However, how PD-L1 expression and immune function was affected by ALK-TKIs and anti-PD-1/PD-L1 treatment in ALK positive non-small-cell lung cancer (NSCLC) remains poorly understood. In the present study, western-blot, real-time PCR, flow cytometry and immunofluorescence were employed to explore how PD-L1 was regulated by ALK fusion protein. ALK-TKIs and relevant inhibitors were used to identify the downstream signaling pathways involved in PD-L1 regulation. Cell apoptosis, viability and Elisa test were used to study the immune suppression by ALK activation and immune reactivation by ALK-TKIs and/or PD-1 blocking in tumor cells and DC-CIK cells co-culture system. We found that PD-L1 expression was associated with EGFR mutations and ALK fusion genes in NSCLC cell lines. Over-expression of ALK fusion protein increased PD-L1 expression. PD-L1 mediated by ALK fusion protein increased the apoptosis of T cells in tumor cells and DC-CIK cells co-culture system. Inhibiting ALK by sensitive TKIs could enhance the production of IFNγ. Anti-PD-1 antibody was effective in both crizotinib sensitive and resistant NSCLC cells. Synergistic tumor killing effects were not observed with ALK-TKIs and anti-PD-1 antibody combination in co-culture system. ALK-TKIs not only directly inhibited tumor viability but also indirectly enhanced the antitumor immunity via the downregulation of PD-L1. Anti-PD-1/PD-L1 antibodies could be an optional therapy for crizotinib sensitive, especially crizotinib resistant NSCLC patients with ALK fusion gene. Combination of ALK-TKIs and anti-PD-1/PD-L1 antibodies treatment for ALK positive NSCLC warrants more data before moving into clinical practice. PMID:27141355

Strong FGFR3 staining is a marker for FGFR3 fusions in diffuse gliomas

PubMed Central

Annala, Matti; Lehtinen, Birgitta; Kesseli, Juha; Haapasalo, Joonas; Ruusuvuori, Pekka; Yli-Harja, Olli; Visakorpi, Tapio; Haapasalo, Hannu; Nykter, Matti; Zhang, Wei

2017-01-01

Abstract Background Inhibitors of fibroblast growth factor receptors (FGFRs) have recently arisen as a promising treatment option for patients with FGFR alterations. Gene fusions involving FGFR3 and transforming acidic coiled-coil protein 3 (TACC3) have been detected in diffuse gliomas and other malignancies, and fusion-positive cases have responded well to FGFR inhibition. As high FGFR3 expression has been detected in fusion-positive tumors, we sought to determine the clinical significance of FGFR3 protein expression level as well as its potential for indicating FGFR3 fusions. Methods We performed FGFR3 immunohistochemistry on tissue microarrays containing 676 grades II–IV astrocytomas and 116 grades II–III oligodendroglial tumor specimens. Fifty-one cases were further analyzed using targeted sequencing. Results Moderate to strong FGFR3 staining was detected in gliomas of all grades, was more common in females, and was associated with poor survival in diffuse astrocytomas. Targeted sequencing identified FGFR3-TACC3 fusions and an FGFR3-CAMK2A fusion in 10 of 15 strongly stained cases, whereas no fusions were found in 36 negatively to moderately stained cases. Fusion-positive cases were predominantly female and negative for IDH and EGFR/PDGFRA/MET alterations. These and moderately stained cases show lower MIB-1 proliferation index than negatively to weakly stained cases. Furthermore, stronger FGFR3 expression was commonly observed in malignant tissue regions of lower cellularity in fusion-negative cases. Importantly, subregional negative FGFR3 staining was also observed in a few fusion-positive cases. Conclusions Strong FGFR3 protein expression is indicative of FGFR3 fusions and may serve as a clinically applicable predictive marker for treatment regimens based on FGFR inhibitors. PMID:28379477

Cloning and high level expression of gene encoding ES antigen from Trichinella spiralis muscle larvae.

PubMed

Yan, Y; Xu, W; Chen, H; Ma, Z; Zhu, Y; Cai, S

1994-01-01

The partial structure gene encoding ES antigen derived from Trichinella spiralis (TSP) muscle larvae was cloned, characterized, and expressed in E. coli. The target DNA (0.7 kb) was directly obtained from the TSP total RNA by using RNA PCR technique. Based on the analysis with the RE digestion, the fragment was cloned into the fusion expression vector pEX31C. It was shown that a kind of 37kDa fusion protein was expressed in E. coli containing the recombinant plasmid by SDS-PAGE electrophoresis. The expressed protein was over 22% of the total cell protein, and it was aggregated in the form of inclusion bodies in E. coli. The purified protein could be recognized in ELISA both by sera from swine-infected with TSP and by the monoclonal antibody against TSP. These findings suggest that the recombinant protein is a potentially valuable antigen both for immunodiagnosis and vaccine development of trichinellosis.

Lister vaccine strain of vaccinia virus armed with the endostatin-angiostatin fusion gene: an oncolytic virus superior to dl1520 (ONYX-015) for human head and neck cancer.

PubMed

Tysome, James R; Wang, Pengju; Alusi, Ghassan; Briat, Arnaud; Gangeswaran, Rathi; Wang, Jiwei; Bhakta, Vipul; Fodor, Istvan; Lemoine, Nick R; Wang, Yaohe

2011-09-01

Oncolytic viral therapy represents a promising strategy for the treatment of head and neck squamous cell carcinoma (HNSCC), with dl1520 (ONYX-015) the most widely used oncolytic adenovirus in clinical trials. This study aimed to determine the effectiveness of the Lister vaccine strain of vaccinia virus as well as a vaccinia virus armed with the endostatin-angiostatin fusion gene (VVhEA) as a novel therapy for HNSCC and to compare them with dl1520. The potency and replication of the Lister strain and VVhEA and the expression and function of the fusion protein were determined in human HNSCC cells in vitro and in vivo. Finally, the efficacy of VVhEA was compared with dl1520 in vivo in a human HNSCC model. The Lister vaccine strain of vaccinia virus was more effective than the adenovirus against all HNSCC cell lines tested in vitro. Although the potency of VVhEA was attenuated in vitro, the expression and function of the endostatin-angiostatin fusion protein was confirmed in HNSCC models both in vitro and in vivo. This novel vaccinia virus (VVhEA) demonstrated superior antitumor potency in vivo compared with both dl1520 and the control vaccinia virus. This study suggests that the Lister strain vaccinia virus armed with an endostatin-angiostatin fusion gene may be a potential therapeutic agent for HNSCC.

Cloning and heterologous expression of plnE, -F, -J and -K genes derived from soil metagenome and purification of active plantaricin peptides.

PubMed

Pal, Gargi; Srivastava, Sheela

2014-02-01

Plantaricin gene-specific primers were used to obtain plnE, -F, -J and -K structural gene amplicons from soil metagenome. These amplicons were cloned and expressed in pET32a (+) vector in Escherichia coli BL21 (DE3). PlnE, -F, -J and -K peptides were expressed as His-tagged-fusion proteins and were separated by Ni(2+) -chelating affinity chromatography. The peptides were released from the fusion by enterokinase cleavage and separated from the carrier thioredoxin. The cleaved peptides were further analysed for antimicrobial activity and found to be active against Listeria innocua NRRL B33314, Micrococcus luteus MTCC 106 and lactic acid bacteria, such as Enterococcus casseliflavus NRRL B3502, Lactococcus lactis lactis NRRL 1821, Lactobacillus curvatus NRRL B4562 and Lactobacillus plantarum NRRL B4496. E. coli has been successfully exploited as a host for heterologous expression with a significant yield of fused and cleaved peptides in the range of 8-12 and 1-1.5 mg/l of the culture, respectively. Heterologous expression, therefore, can be used to overcome the constraints of low yield often reported from a native strain.

Wild-type myoblasts rescue the ability of myogenin-null myoblasts to fuse in vivo.

PubMed

Myer, A; Wagner, D S; Vivian, J L; Olson, E N; Klein, W H

1997-05-15

Skeletal muscle is formed via a complex series of events during embryogenesis. These events include commitment of mesodermal precursor cells, cell migration, cell-cell recognition, fusion of myoblasts, activation of structural genes, and maturation. In mice lacking the bHLH transcription factor myogenin, myoblasts are specified and positioned correctly, but few fuse to form multinucleated fibers. This indicates that myogenin is critical for the fusion process and subsequent differentiation events of myogenesis. To further define the nature of the myogenic defects in myogenin-null mice, we investigated whether myogenin-null myoblasts are capable of fusing with wild-type myoblasts in vivo using chimeric mice containing mixtures of myogenin-null and wild-type cells. Chimeric embryos demonstrated that myogenin-null myoblasts readily fused in the presence of wild-type myoblasts. However, chimeric myofibers did not express wild-type levels of muscle-specific gene products, and myofibers with a high percentage of mutant nuclei appeared abnormal, suggesting that the wild-type nuclei could not fully rescue mutant nuclei in the myofibers. These data demonstrate that myoblast fusion can be uncoupled from complete myogenic differentiation and that myogenin regulates a specific subset of genes with diverse function. Thus, myogenin appears to control not only transcription of muscle structural genes but also the extracellular environment in which myoblast fusion takes place. We propose that myogenin regulates the expression of one or more extracellular or cell surface proteins required to initiate the muscle differentiation program.

Factors affecting expression of the recF gene of Escherichia coli K-12.

PubMed

Sandler, S J; Clark, A J

1990-01-31

This report describes four factors which affect expression of the recF gene from strong upstream lambda promoters under temperature-sensitive cIAt2-encoded repressor control. The first factor was the long mRNA leader sequence consisting of the Escherichia coli dnaN gene and 95% of the dnaA gene and lambda bet, N (double amber) and 40% of the exo gene. When most of this DNA was deleted, RecF became detectable in maxicells. The second factor was the vector, pBEU28, a runaway replication plasmid. When we substituted pUC118 for pBEU28, RecF became detectable in whole cells by the Coomassie blue staining technique. The third factor was the efficiency of initiation of translation. We used site-directed mutagenesis to change the mRNA leader, ribosome-binding site and the 3 bp before and after the translational start codon. Monitoring the effect of these mutational changes by translational fusion to lacZ, we discovered that the efficiency of initiation of translation was increased 30-fold. Only an estimated two- or threefold increase in accumulated levels of RecF occurred, however. This led us to discover the fourth factor, namely sequences in the recF gene itself. These sequences reduce expression of the recF-lacZ fusion genes 100-fold. The sequences responsible for this decrease in expression occur in four regions in the N-terminal half of recF. Expression is reduced by some sequences at the transcriptional level and by others at the translational level.

Genotype-phenotype relationships in human red/green color-vision defects: Molecular and psychophysical studies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Deeb, S.S.; Motulsky, A.G.; Lindsey, D.T.

1992-10-01

The relationship between the molecular structure of the X-linked red and green visual pigment genes and color-vision phenotype as ascertained by anomaloscopy was studied in 64 color-defective males. The great majority of red-green defects were associated with either the deletion of the green-pigment gene or the formation of 5[prime] red-green hybrid genes or 5[prime] green-red hybrid genes. A rapid PCR-based method allowed detection of hybrid genes, including those undetectable by Southern blot analysis, as well as more precise localization of the fusion points in hybrid genes. Protan color-vision defects appeared always associated with 5[prime] red-green hybrid genes. Carriers of singlemore » red-green hybrid genes with fusion in introns 1-4 were protanopes. However, carriers of hybrid genes with red-green fusions in introns 2, 3, or 4 in the presence of additional normal green genes manifested as either protanopes or protanomalous trichromats, with the majority being protanomalous. Deutan defects were associated with green-pigment gene deletions, with 5[prime] green-red hybrid genes, or, rarely, with 5[prime] green-red-green hybrid genes. Complete green-pigment gene deletions or green-red fusions in intron 1 were usually associated with deuteranopia, although the authors unexpectedly found three carriers of a single red-pigment gene without any green-pigment genes to be deuteranomalous trichromats. All but one of the other deuteranomalous subjects had green-red hybrid genes with intron 1, 2, 3, or 4 fusions, as well as several normal green-pigment genes. The one exception had a grossly normal gene array, presumably with a more subtle mutation. Amino acid differences in exon 5 largely determine whether a hybrid gene will be more redlike or more greenlike in phenotype. Various discrepancies as to severity (dichromacy or trichromacy) remain unexplained but may arise because of variability of expression, postreceptoral variation, or both.« less

Gene array analysis reveals a common Runx transcriptional program controlling cell adhesion and survival

PubMed Central

Wotton, Sandy; Terry, Anne; Kilbey, Anna; Jenkins, Alma; Herzyk, Pawel; Cameron, Ewan; Neil, James C.

2008-01-01

The Runx genes play divergent roles in development and cancer, where they can act either as oncogenes or tumour suppressors. We compared the effects of ectopic Runx expression in established fibroblasts, where all three genes produce an indistinguishable phenotype entailing epithelioid morphology and increased cell survival under stress conditions. Gene array analysis revealed a strongly overlapping transcriptional signature, with no examples of opposing regulation of the same target gene. A common set of 50 highly regulated genes was identified after further filtering on regulation by inducible RUNX1-ER. This set revealed a strong bias towards genes with annotated roles in cancer and development, and a preponderance of targets encoding extracellular or surface proteins, reflecting the marked effects of Runx on cell adhesion. Furthermore, in silico prediction of resistance to glucocorticoid growth inhibition was confirmed in fibroblasts and lymphoid cells expressing ectopic Runx. The effects of fibroblast expression of common RUNX1 fusion oncoproteins (RUNX1-ETO, TEL-RUNX1, CBFB-MYH11) were also tested. While two direct Runx activation target genes were repressed (Ncam1, Rgc32), the fusion proteins appeared to disrupt regulation of down-regulated targets (Cebpd, Id2, Rgs2) rather than impose constitutive repression. These results elucidate the oncogenic potential of the Runx family and reveal novel targets for therapeutic inhibition. PMID:18560354

TMPRSS2:ERG Gene Fusions in Prostate Cancer of West African Men and a Meta-Analysis of Racial Differences

PubMed Central

Zhou, Cindy Ke; Young, Denise; Yeboah, Edward D; Coburn, Sally B; Tettey, Yao; Biritwum, Richard B; Adjei, Andrew A; Tay, Evelyn; Niwa, Shelley; Truelove, Ann; Welsh, Judith; Mensah, James E; Hoover, Robert N; Sesterhenn, Isabell A; Hsing, Ann W; Srivastava, Shiv; Cook, Michael B

2017-01-01

Abstract The prevalence of fusions of the transmembrane protease, serine 2, gene (TMPRSS2) with the erythroblast transformation-specific–related gene (ERG), or TMPRSS2:ERG, in prostate cancer varies by race. However, such somatic aberration and its association with prognostic factors have neither been studied in a West African population nor been systematically reviewed in the context of racial differences. We used immunohistochemistry to assess oncoprotein encoded by the ERG gene as the established surrogate of ERG fusion genes among 262 prostate cancer biopsies from the Ghana Prostate Study (2004–2006). Poisson regression with robust variance estimation provided prevalence ratios and 95% confidence intervals of ERG expression in relation to patient characteristics. We found that 47 of 262 (18%) prostate cancers were ERG-positive, and being negative for ERG staining was associated with higher Gleason score. We further conducted a systematic review and meta-analysis of TMPRSS2:ERG fusions in relation to race, Gleason score, and tumor stage, combining results from Ghana with 40 additional studies. Meta-analysis showed the prevalence of TMPRSS2:ERG fusions in prostate cancer to be highest in men of European descent (49%), followed by men of Asian (27%) and then African (25%) descent. The lower prevalence of TMPRSS2:ERG fusions in men of African descent implies that alternative genomic mechanisms might explain the disproportionately high prostate cancer burden in such populations. PMID:28633309

Screening for diverse PDGFRA or PDGFRB fusion genes is facilitated by generic quantitative reverse transcriptase polymerase chain reaction analysis

PubMed Central

Erben, Philipp; Gosenca, Darko; Müller, Martin C.; Reinhard, Jelena; Score, Joannah; del Valle, Francesco; Walz, Christoph; Mix, Jürgen; Metzgeroth, Georgia; Ernst, Thomas; Haferlach, Claudia; Cross, Nicholas C.P.; Hochhaus, Andreas; Reiter, Andreas

2010-01-01

Background Rapid identification of diverse fusion genes with involvement of PDGFRA or PDGFRB in eosinophilia-associated myeloproliferative neoplasms is essential for adequate clinical management but is complicated by the multitude and heterogeneity of partner genes and breakpoints. Design and Methods We established a generic quantitative reverse transcriptase polymerase chain reaction to detect overexpression of the 3′-regions of PDGFRA or PDGFRB as a possible indicator of an underlying fusion. Results At diagnosis, all patients with known fusion genes involving PDGFRA (n=5; 51 patients) or PDGFRB (n=5; 7 patients) showed significantly increased normalized expression levels compared to 191 patients with fusion gene-negative eosinophilia or healthy individuals (PDGFRA/ABL: 0.73 versus 0.0066 versus 0.0064, P<0.0001; PDGFRB/ABL: 196 versus 3.8 versus 5.85, P<0.0001). The sensitivity and specificity of the activation screening test were, respectively, 100% and 88.4% for PDGFRA and 100% and 94% for PDGFRB. Furthermore, significant overexpression of PDGFRB was found in a patient with an eosinophilia-associated myeloproliferative neoplasm with uninformative cytogenetics and an excellent response to imatinib. Subsequently, a new SART3-PDGFRB fusion gene was identified by 5′-rapid amplification of cDNA ends polymerase chain reaction (5′-RACE-PCR). Conclusions Quantitative reverse transcriptase polymerase chain reaction analysis is a simple and useful adjunct to standard diagnostic assays to detect clinically significant overexpression of PDGFRA and PDGFRB in eosinophilia-associated myeloproliferative neoplasms or related disorders. PMID:20107158

Transcriptome Profiling of Pediatric Core Binding Factor AML

PubMed Central

Hsu, Chih-Hao; Nguyen, Cu; Yan, Chunhua; Ries, Rhonda E.; Chen, Qing-Rong; Hu, Ying; Ostronoff, Fabiana; Stirewalt, Derek L.; Komatsoulis, George; Levy, Shawn

2015-01-01

The t(8;21) and Inv(16) translocations disrupt the normal function of core binding factors alpha (CBFA) and beta (CBFB), respectively. These translocations represent two of the most common genomic abnormalities in acute myeloid leukemia (AML) patients, occurring in approximately 25% pediatric and 15% of adult with this malignancy. Both translocations are associated with favorable clinical outcomes after intensive chemotherapy, and given the perceived mechanistic similarities, patients with these translocations are frequently referred to as having CBF-AML. It remains uncertain as to whether, collectively, these translocations are mechanistically the same or impact different pathways in subtle ways that have both biological and clinical significance. Therefore, we used transcriptome sequencing (RNA-seq) to investigate the similarities and differences in genes and pathways between these subtypes of pediatric AMLs. Diagnostic RNA from patients with t(8;21) (N = 17), Inv(16) (N = 14), and normal karyotype (NK, N = 33) were subjected to RNA-seq. Analyses compared the transcriptomes across these three cytogenetic subtypes, using the NK cohort as the control. A total of 1291 genes in t(8;21) and 474 genes in Inv(16) were differentially expressed relative to the NK controls, with 198 genes differentially expressed in both subtypes. The majority of these genes (175/198; binomial test p-value < 10−30) are consistent in expression changes among the two subtypes suggesting the expression profiles are more similar between the CBF cohorts than in the NK cohort. Our analysis also revealed alternative splicing events (ASEs) differentially expressed across subtypes, with 337 t(8;21)-specific and 407 Inv(16)-specific ASEs detected, the majority of which were acetylated proteins (p = 1.5x10-51 and p = 1.8x10-54 for the two subsets). In addition to known fusions, we identified and verified 16 de novo fusions in 43 patients, including three fusions involving NUP98 in six patients. Clustering of differentially expressed genes indicated that the homeobox (HOX) gene family, including two transcription factors (MEIS1 and NKX2-3) were down-regulated in CBF compared to NK samples. This finding supports existing data that the dysregulation of HOX genes play a central role in biology CBF-AML hematopoiesis. These data provide comprehensive transcriptome profiling of CBF-AML and delineate genes and pathways that are differentially expressed, providing insights into the shared biology as well as differences in the two CBF subsets. PMID:26397705

Mammalian target of rapamycin (mTOR) signaling is required for a late-stage fusion process during skeletal myotube maturation.

PubMed

Park, In-Hyun; Chen, Jie

2005-09-09

Skeletal myogenesis is a well orchestrated cascade of events regulated by multiple signaling pathways, one of which is recently characterized by its sensitivity to the bacterial macrolide rapamycin. Previously we reported that the mammalian target of rapamycin (mTOR) regulates the initiation of the differentiation program in mouse C2C12 myoblasts by controlling the expression of insulin-like growth factor-II in a kinase-independent manner. Here we provide experimental evidence suggesting that a different mode of mTOR signaling regulates skeletal myogenesis at a later stage. In the absence of endogenous mTOR function in C2C12 cells treated with rapamycin, a kinase-inactive mTOR fully supports myogenin expression, but causes a delay in contractile protein expression. Myoblasts fuse to form nascent myotubes in the absence of kinase-active mTOR, whereas the formation of mature myotubes by further fusion requires the catalytic activity of mTOR. Therefore, the two stages of myocyte fusion are molecularly separable at the level of mTOR signaling. In addition, our data suggest that a factor secreted into the culture medium is responsible for mediating the function of mTOR in regulating the late-stage fusion leading to mature myotubes. Furthermore, taking advantage of the unique features of cells stably expressing a mutant mTOR, we have performed cDNA microarray analysis to compare global gene expression profiles between mature and nascent myotubes, the results of which have implicated classes of genes and revealed candidate regulators in myotube maturation or functions of mature myotubes.

Control of muscle formation by the fusogenic micropeptide myomixer

PubMed Central

Bi, Pengpeng; Ramirez-Martinez, Andres; Li, Hui; Cannavino, Jessica; McAnally, John R.; Shelton, John M.; Sánchez-Ortiz, Efrain; Bassel-Duby, Rhonda; Olson, Eric N.

2017-01-01

Skeletal muscle formation occurs through fusion of myoblasts to form multinucleated myofibers. From a genome-wide clustered regularly interspaced short palindromic repeats (CRISPR) loss-of-function screen for genes required for myoblast fusion and myogenesis, we discovered an 84–amino acid muscle-specific peptide that we call Myomixer. Myomixer expression coincides with myoblast differentiation and is essential for fusion and skeletal muscle formation during embryogenesis. Myomixer localizes to the plasma membrane, where it promotes myoblast fusion and associates with Myomaker, a fusogenic membrane protein. Myomixer together with Myomaker can also induce fibroblast-fibroblast fusion and fibroblast-myoblast fusion. We conclude that the Myomixer-Myomaker pair controls the critical step in myofiber formation during muscle development. PMID:28386024

Computational modeling and functional analysis of Herpes simplex virus type-1 thymidine kinase and Escherichia coli cytosine deaminase fusion protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Jufeng; Wang, Zhanli; Wei, Fang

2007-08-17

Herpes simplex virus type-1 thymidine kinase (HSV-1TK) and Escherichia coli cytosine deaminase (CD) fusion protein was designed using InsightII software. The structural rationality of the fusion proteins incorporating a series of flexible linker peptide was analyzed, and a suitable linker peptide was chosen for further investigated. The recombinant plasmid containing the coding regions of HSV-1TK and CD cDNA connected by this linker peptide coding sequence was generated and subsequently transfected into the human embryonic kidney 293 cells (HEK293). The Western blotting indicated that the recombinant fusion protein existed as a dimer with a molecular weight of approximately 90 kDa. Themore » toxicity of the prodrug on the recombinant plasmid-transfected human lung cancer cell line NCIH460 was evaluated, which showed that TKglyCD-expressing cells conferred upon cells prodrug sensitivities equivalent to that observed for each enzyme independently. Most noteworthy, cytotoxicity could be enhanced by concurrently treating TKglyCD-expressing cells with prodrugs GCV and 5-FC. The results indicate that we have successfully constructed a HSV-1TKglyCD fusion gene which might have a potential application for cancer gene therapy.« less

Nuclear envelope breakdown induced by herpes simplex virus type 1 involves the activity of viral fusion proteins

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maric, Martina; Haugo, Alison C.; Dauer, William

2014-07-15

Herpesvirus infection reorganizes components of the nuclear lamina usually without loss of integrity of the nuclear membranes. We report that wild-type HSV infection can cause dissolution of the nuclear envelope in transformed mouse embryonic fibroblasts that do not express torsinA. Nuclear envelope breakdown is accompanied by an eight-fold inhibition of virus replication. Breakdown of the membrane is much more limited during infection with viruses that lack the gB and gH genes, suggesting that breakdown involves factors that promote fusion at the nuclear membrane. Nuclear envelope breakdown is also inhibited during infection with virus that does not express UL34, but ismore » enhanced when the US3 gene is deleted, suggesting that envelope breakdown may be enhanced by nuclear lamina disruption. Nuclear envelope breakdown cannot compensate for deletion of the UL34 gene suggesting that mixing of nuclear and cytoplasmic contents is insufficient to bypass loss of the normal nuclear egress pathway. - Highlights: • We show that wild-type HSV can induce breakdown of the nuclear envelope in a specific cell system. • The viral fusion proteins gB and gH are required for induction of nuclear envelope breakdown. • Nuclear envelope breakdown cannot compensate for deletion of the HSV UL34 gene.« less

Construction and Cloning of Reporter-Tagged Replicon cDNA for an In Vitro Replication Study of Murine Norovirus-1 (MNV-1).

PubMed

Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir

2017-12-01

A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3'end of the reporter gene and the VP2 start sequence to allow co-translational 'cleavage' of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication.

The TEL-AML1 fusion protein of acute lymphoblastic leukemia modulates IRF3 activity during early B-cell differentiation.

PubMed

de Laurentiis, A; Hiscott, J; Alcalay, M

2015-12-03

The t(12;21) translocation is the most common genetic rearrangement in childhood acute lymphoblastic leukemia (ALL) and gives rise to the TEL-AML1 fusion gene. Many studies on TEL-AML1 describe specific properties of the fusion protein, but a thorough understanding of its function is lacking. We exploited a pluripotent hematopoietic stem/progenitor cell line, EML1, and generated a cell line (EML-TA) stably expressing the TEL-AML1 fusion protein. EML1 cells differentiate to mature B-cells following treatment with IL7; whereas EML-TA display an impaired differentiation capacity and remain blocked at an early stage of maturation. Global gene expression profiling of EML1 cells at different stages of B-lymphoid differentiation, compared with EML-TA, identified the interferon (IFN)α/β pathway as a primary target of repression by TEL-AML1. In particular, expression and phosphorylation of interferon-regulatory factor 3 (IRF3) was decreased in EML-TA cells; strikingly, stable expression of IRF3 restored the capacity of EML-TA cells to differentiate into mature B-cells. Similarly, IRF3 silencing in EML1 cells by siRNA was sufficient to block B-lymphoid differentiation. The ability of TEL-AML1 to block B-cell differentiation and downregulate the IRF3-IFNα/β pathway was confirmed in mouse and human primary hematopoietic precursor cells (Lin- and CD34+ cells, respectively), and in a patient-derived cell line expressing TEL-AML1 (REH). Furthermore, treatment of TEL-AML1 expressing cells with IFNα/β was sufficient to overcome the maturation block. Our data provide new insight on TEL-AML1 function and may offer a new therapeutic opportunity for B-ALL.

High-level SUMO-mediated fusion expression of ABP-dHC-cecropin A from multiple joined genes in Escherichia coli.

PubMed

Zhang, Jiaxin; Movahedi, Ali; Wei, Zhiheng; Sang, Ming; Wu, Xiaolong; Wang, Mengyang; Wei, Hui; Pan, Huixin; Yin, Tongming; Zhuge, Qiang

2016-09-15

The antimicrobial peptide ABP-dHC-cecropin A is a small cationic peptide with potent activity against a wide range of bacterial species. Evidence of antifungal activity has also been suggested; however, evaluation of this peptide has been limited due to the low expression of cecropin proteins in Escherichia coli. To improve the expression level of ABP-dHC-cecropin A in E. coli, tandem repeats of the ABP-dHC-cecropin A gene were constructed and expressed as fusion proteins (SUMO-nABP-dHC-cecropin, n = 1, 2, 3, 4) via pSUMO-nABP-dHC-cecropin A vectors (n = 1, 2, 3, 4). Comparison of the expression levels of soluble SUMO-nABP-dHC-cecropin A fusion proteins (n = 1, 2, 3, 4) suggested that BL21 (DE3)/pSUMO-3ABP-dHC-cecropin A is an ideal recombinant strain for ABP-dHC-cecropin A production. Under the selected conditions of cultivation and isopropylthiogalactoside (IPTG) induction, the expression level of ABP-dHC-cecropin A was as high as 65 mg/L, with ∼21.3% of the fusion protein in soluble form. By large-scale fermentation, protein production reached nearly 300 mg/L, which is the highest yield of ABP-dHC-cecropin A reported to date. In antibacterial experiments, the efficacy was approximately the same as that of synthetic ABP-dHC-cecropin A. This method provides a novel and effective means of producing large amounts of ABP-dHC-cecropin A. Copyright © 2016 Elsevier Inc. All rights reserved.

Overexpression of a Chimeric Gene, OsDST-SRDX, Improved Salt Tolerance of Perennial Ryegrass

PubMed Central

Cen, Huifang; Ye, Wenxing; Liu, Yanrong; Li, Dayong; Wang, Kexin; Zhang, Wanjun

2016-01-01

The Drought and Salt Tolerance gene (DST) encodes a C2H2 zinc finger transcription factor, which negatively regulates salt tolerance in rice (Oryza sativa). Phylogenetic analysis of six homologues of DST genes in different plant species revealed that DST genes were conserved evolutionarily. Here, the rice DST gene was linked to an SRDX domain for gene expression repression based on the Chimeric REpressor gene-Silencing Technology (CRES-T) to make a chimeric gene (OsDST-SRDX) construct and introduced into perennial ryegrass by Agrobacterium-mediated transformation. Integration and expression of the OsDST-SRDX in transgenic plants were tested by PCR and RT-PCR, respectively. Transgenic lines overexpressing the OsDST-SRDX fusion gene showed obvious phenotypic differences and clear resistance to salt-shock and to continuous salt stresses compared to non-transgenic plants. Physiological analyses including relative leaf water content, electrolyte leakage, proline content, malondialdehyde (MDA) content, H2O2 content and sodium and potassium accumulation indicated that the OsDST-SRDX fusion gene enhanced salt tolerance in transgenic perennial ryegrass by altering a wide range of physiological responses. To our best knowledge this study is the first report of utilizing Chimeric Repressor gene-Silencing Technology (CRES-T) in turfgrass and forage species for salt-tolerance improvement. PMID:27251327

Transgenic carrot expressing fusion protein comprising M. tuberculosis antigens induces immune response in mice.

PubMed

Permyakova, Natalia V; Zagorskaya, Alla A; Belavin, Pavel A; Uvarova, Elena A; Nosareva, Olesya V; Nesterov, Andrey E; Novikovskaya, Anna A; Zav'yalov, Evgeniy L; Moshkin, Mikhail P; Deineko, Elena V

2015-01-01

Tuberculosis remains one of the major infectious diseases, which continues to pose a major global health problem. Transgenic plants may serve as bioreactors to produce heterologous proteins including antibodies, antigens, and hormones. In the present study, a genetic construct has been designed that comprises the Mycobacterium tuberculosis genes cfp10, esat6 and dIFN gene, which encode deltaferon, a recombinant analog of the human γ-interferon designed for expression in plant tissues. This construct was transferred to the carrot (Daucus carota L.) genome by Agrobacterium-mediated transformation. This study demonstrates that the fusion protein CFP10-ESAT6-dIFN is synthesized in the transgenic carrot storage roots. The protein is able to induce both humoral and cell-mediated immune responses in laboratory animals (mice) when administered either orally or by injection. It should be emphasized that M. tuberculosis antigens contained in the fusion protein have no cytotoxic effect on peripheral blood mononuclear cells.

Targeting the latent cytomegalovirus reservoir with an antiviral fusion toxin protein

PubMed Central

Krishna, B. A.; Spiess, K.; Poole, E. L.; Lau, B.; Voigt, S.; Kledal, T. N.; Rosenkilde, M. M.; Sinclair, J. H.

2017-01-01

Reactivation of human cytomegalovirus (HCMV) in transplant recipients can cause life-threatening disease. Consequently, for transplant recipients, killing latently infected cells could have far-reaching clinical benefits. In vivo, myeloid cells and their progenitors are an important site of HCMV latency, and one viral gene expressed by latently infected myeloid cells is US28. This viral gene encodes a cell surface G protein-coupled receptor (GPCR) that binds chemokines, triggering its endocytosis. We show that the expression of US28 on the surface of latently infected cells allows monocytes and their progenitor CD34+ cells to be targeted and killed by F49A-FTP, a highly specific fusion toxin protein that binds this viral GPCR. As expected, this specific targeting of latently infected cells by F49A-FTP also robustly reduces virus reactivation in vitro. Consequently, such specific fusion toxin proteins could form the basis of a therapeutic strategy for eliminating latently infected cells before haematopoietic stem cell transplantation. PMID:28148951

An efficient transgenic system by TA cloning vectors and RNAi for C. elegans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gengyo-Ando, Keiko; CREST, JST, 4-1-8 Hon-cho, Kawaguchi, Saitama 332-0012; Yoshina, Sawako

2006-11-03

In the nematode, transgenic analyses have been performed by microinjection of DNA from various sources into the syncytium gonad. To expedite these transgenic analyses, we solved two potential problems in this work. First, we constructed an efficient TA-cloning vector system which is useful for any promoter. By amplifying the genomic DNA fragments which contain regulatory sequences with or without the coding region, we could easily construct plasmids expressing fluorescent protein fusion without considering restriction sites. We could dissect motor neurons with three colors in a single animal. Second, we used feeding RNAi to isolate transgenic strains which express lag-2::venus fusionmore » gene. We found that the fusion protein is toxic when ectopically expressed in embryos but is functional to rescue a loss of function mutant in the lag-2 gene. Thus, the transgenic system described here should be useful to examine the protein function in the nematode.« less

Identification of in vivo regulators of the Vibrio cholerae xds gene using a high-throughput genetic selection.

PubMed

McDonough, Emilykate; Lazinski, David W; Camilli, Andrew

2014-04-01

Vibrio cholerae, the causative agent of cholera, remains a threat to public health in areas with inadequate sanitation. As a waterborne pathogen, V. cholerae moves between two dissimilar environments, aquatic reservoirs and the intestinal tract of humans. Accordingly, this pathogen undergoes adaptive shifts in gene expression throughout the different stages of its lifecycle. One particular gene, xds, encodes a secreted exonuclease that was previously identified as being induced during infection. Here we sought to identify regulators responsible for the in vivo-specific induction of xds. A transcriptional fusion of xds to two consecutive antibiotic resistance genes was used to select transposon mutants that had inserted within or adjacent to regulatory genes and thereby caused increased expression of the xds fusion under non-inducing conditions. Large pools of selected insertion sites were sequenced in a high throughput manner using Tn-seq to identify potential mechanisms of xds regulation. Our selection identified the two-component system PhoB/R as the dominant activator of xds expression. In vitro validation confirmed that PhoB, a protein which is only active during phosphate limitation, was responsible for xds activation. Using xds expression as a biosensor of the extracellular phosphate level, we observed that the mouse small intestine is a phosphate-limited environment. © 2014 John Wiley & Sons Ltd.

Expression of lysozymes from Erwinia amylovora phages and Erwinia genomes and inhibition by a bacterial protein.

PubMed

Müller, Ina; Gernold, Marina; Schneider, Bernd; Geider, Klaus

2012-01-01

Genes coding for lysozyme-inhibiting proteins (Ivy) were cloned from the chromosomes of the plant pathogens Erwinia amylovora and Erwinia pyrifoliae. The product interfered not only with activity of hen egg white lysozyme, but also with an enzyme from E. amylovora phage ΦEa1h. We have expressed lysozyme genes from the genomes of three Erwinia species in Escherichia coli. The lysozymes expressed from genes of the E. amylovora phages ΦEa104 and ΦEa116, Erwinia chromosomes and Arabidopsis thaliana were not affected by Ivy. The enzyme from bacteriophage ΦEa1h was fused at the N- or C-terminus to other peptides. Compared to the intact lysozyme, a His-tag reduced its lytic activity about 10-fold and larger fusion proteins abolished activity completely. Specific protease cleavage restored lysozyme activity of a GST-fusion. The bacteriophage-encoded lysozymes were more active than the enzymes from bacterial chromosomes. Viral lyz genes were inserted into a broad-host range vector, and transfer to E. amylovora inhibited cell growth. Inserted in the yeast Pichia pastoris, the ΦEa1h-lysozyme was secreted and also inhibited by Ivy. Here we describe expression of unrelated cloned 'silent' lyz genes from Erwinia chromosomes and a novel interference of bacterial Ivy proteins with a viral lysozyme. Copyright © 2012 S. Karger AG, Basel.

A novel RET rearrangement (ACBD5/RET) by pericentric inversion, inv(10)(p12.1;q11.2), in papillary thyroid cancer from an atomic bomb survivor exposed to high-dose radiation.

PubMed

Hamatani, Kiyohiro; Eguchi, Hidetaka; Koyama, Kazuaki; Mukai, Mayumi; Nakachi, Kei; Kusunoki, Yoichiro

2014-11-01

During analysis of RET/PTC rearrangements in papillary thyroid cancer (PTC) among atomic bomb survivors, a cDNA fragment of a novel type of RET rearrangement was identified in a PTC patient exposed to a high radiation dose using the improved 5' RACE method. This gene resulted from the fusion of the 3' portion of RET containing tyrosine kinase domain to the 5' portion of the acyl-coenzyme A binding domain containing 5 (ACBD5) gene, by pericentric inversion inv(10)(p12.1;q11.2); expression of the fusion gene was confirmed by RT-PCR. ACBD5 gene is ubiquitously expressed in various human normal tissues including thyroid. Full-length cDNA of the ACBD5-RET gene was constructed and then examined for tumorigenicity. Enhanced phosphorylation of ERK proteins in the MAPK pathway was observed in NIH3T3 cells transfected with expression vector encoding the full-length ACBD5/RET cDNA, while this was not observed in the cells transfected with empty expression vector. Stable NIH3T3 transfectants with ACBD5-RET cDNA induced tumor formation after their injection into nude mice. These findings suggest that the ACBD5-RET rearrangement is causatively involved in the development of PTC.

Recombinant fusion protein and DNA vaccines against foot and mouth disease virus infection in guinea pig and swine.

PubMed

Huang, H; Yang, Z; Xu, Q; Sheng, Z; Xie, Y; Yan, W; You, Y; Sun, L; Zheng, Z

1999-01-01

In this study, we provide evidence that a recombinant fusion protein containing beta-galactosidase and a tandem repeat peptide of immunogenic dominant epitope of foot-and-mouth disease virus (FMDV) VP1 protein elicits high levels of neutralizing antibody and protects both guinea pigs and swine against infection. Vaccination with this fusion protein induced a FMDV-specific proliferative T-cell response and a neutralizing antibody response. The immunized guinea pigs and swine were protected against FMD type O virus infection. Two DNA plasmids expressing genes of foot-and-mouth disease were constructed. Both plasmids pBO1 and pCO1 contain a signal sequence of the swine immunoglobulin G (IgG) gene and fusion protein gene of pXZ84. The signal sequence and fusion protein gene were under the control of a metallothionein promoter in the case of the pBO1 plasmid and under the control of a cytomegalovirus immediate early promoter in the case of pCO1 plasmid. When pBO1 and pCO1 were inoculated intramuscularly into guinea pigs, both plasmids elicited a neutralizing antibody response and spleen cell proliferation increased following stimulation with FMDV antigen, but animals were not protected from viral challenge.

Heterologous expression of enterocin A, a bacteriocin from Enterococcus faecium, fused to a cellulose-binding domain in Escherichia coli results in a functional protein with inhibitory activity against Listeria.

PubMed

Klocke, Michael; Mundt, Kerstin; Idler, Frank; Jung, Sabrina; Backhausen, Jan E

2005-06-01

The genes for the bacteriocins enterocin A and B were isolated from Enterococcus faecium ATB 197a. Using the pET37b(+) vector, the enterocin genes were fused to an Escherichia coli specific export signal sequence, a cellulose-binding domain (CBD(cenA)) and a S-tag under the control of a T7lac promotor. The constructs were subsequently cloned into E. coli host cells. The expression of the recombinant enterocins had different effects on both the host cells and other Gram-positive bacteria. The expression of entA in Esc. coli led to the synthesis and secretion of functional active enterocin A fusion proteins, which were active against some Gram-positive indicator bacteria, but did not influence the viability of the host cells. In contrast, the expression of enterocin B fusion proteins led to a reduced viability of the host cells, indicating a misfolding of the protein or interference with the cellular metabolism of Esc. coli. Indicator strains of Gram-positive bacteria were not inhibited by purified enterocin B fusion proteins. However, recombinant enterocin B displayed inhibitory activity after the proteolytic cleavage of the fused peptides.

[Retroviral-mediated transfer of a hygromycin phosphotransferase-thymidine kinase fusion gene into human bladder carcinoma cell].

PubMed

Ye, C; Chen, S; Pei, X; Li, L; Feng, K

1999-08-01

To evaluate the therapeutic efficacy of retroviral-mediated hygromycin phosphotransferase-thymidine kinase fusion gene (HyTK)/GCV on human bladder carcinoma cell. A retroviral expression vector pL (HyTK) SN was constructed. By using FuGENE 6-mediated transfection and "ping-pong effect" technique, high-titer of retroviral supernatant was obtained and HyTK gene was transferred into EJ cells. A retroviral vector encoding, enhanced green fluorescent protein, EGFP was used to rapidly detect the transduction efficiency. Antitumor effects were observed after GCV treatment. In vitro experiments demonstrated the EJ cells transferred by HyTK gene were killed in the GCV treatment. Non-transduced parental cells were not sensitive to GCV, but they were dead by the bystander killing of neighboring cells when mixed with EJ/HyTK cells at various ratios. In addition, this not only affect wild-type EJ cells but also cells from different bladder carcinoma cell lines. Retroviral-mediated HyTK/GCV systems were a promising suicide gene therapy for bladder carcinoma. EGFP may act as a convenient and rapid reporter to monitor retroviral-mediated gene transfer and expression in bladder carcinoma cells.

Improving genetic immobilization of a cellulase on yeast cell surface for bioethanol production using cellulose.

PubMed

Yang, Jinying; Dang, Hongyue; Lu, Jian Ren

2013-04-01

In this study, Saccharomyces cerevisiae was genetically engineered to harbor the capability of utilizing celluloses for bioethanol production by displaying active cellulolytic enzymes on the cell surface. An endo-1,4-β-glucanase gene egX was cloned from Bacillus pumilus C-9 and its expression products, the EGX cellulases, were displayed on the cell surface of S. cerevisiae by fusing egX with aga2 that encodes the binding subunit of the S. cerevisiae cell wall protein α-agglutinin. To achieve high gene copies and stability, multicopy integration was obtained by integrating the fusion aga2-egX gene into the rDNA region of the S. cerevisiae chromosome. To achieve high expression and surface display efficiency, the aga2-egX gene was expressed under the control of a strong promoter. The presence of the enzymatically active cellulase fusion proteins on the S. cerevisiae cell surface was verified by carboxymethyl cellulase activity assay and immunofluorescence microscopy. This work presented a promising strategy to genetically engineer yeasts to perform efficient fermentation of cellulosic materials for bioethanol production. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Subcellular localization of transiently expressed fluorescent fusion proteins.

PubMed

Collings, David A

2013-01-01

The recent and massive expansion in plant genomics data has generated a large number of gene sequences for which two seemingly simple questions need to be answered: where do the proteins encoded by these genes localize in cells, and what do they do? One widespread approach to answering the localization question has been to use particle bombardment to transiently express unknown proteins tagged with green fluorescent protein (GFP) or its numerous derivatives. Confocal fluorescence microscopy is then used to monitor the localization of the fluorescent protein as it hitches a ride through the cell. The subcellular localization of the fusion protein, if not immediately apparent, can then be determined by comparison to localizations generated by fluorescent protein fusions to known signalling sequences and proteins, or by direct comparison with fluorescent dyes. This review aims to be a tour guide for researchers wanting to travel this hitch-hiker's path, and for reviewers and readers who wish to understand their travel reports. It will describe some of the technology available for visualizing protein localizations, and some of the experimental approaches for optimizing and confirming localizations generated by particle bombardment in onion epidermal cells, the most commonly used experimental system. As the non-conservation of signal sequences in heterologous expression systems such as onion, and consequent mis-targeting of fusion proteins, is always a potential problem, the epidermal cells of the Argenteum mutant of pea are proposed as a model system.

Expression of chimeric ras protein with OmpF signal peptide in Escherichia coli: localization of OmpF fusion protein in the inner membrane.

PubMed

Yamamoto, T; Okawa, N; Endo, T; Kaji, A

1991-08-01

The ras gene was fused with the DNA sequence of OmpF signal peptide or with the DNA sequence of OmpF signal peptide plus the amino terminal portion of the OmpF gene. They were placed in plasmids together with the bacteriophage lambda PL promoter. These plasmids were introduced into Escherichia coli strain K-12 and the OmpF signal peptide fusion proteins were expressed. These fusion proteins were identified as 29.0 and 30.0 kDa proteins. However, processed products of these proteins were not found in the extract. The fusion proteins were localized mostly in the cytoplasm and the inner membrane, but none of them was secreted into the periplasmic space. On the other hand, the ras protein alone was found in the cytoplasm and not in the inner membrane. Viable counts of E. coli harbouring these plasmids decreased when these fused proteins were induced. Induction of the ras protein alone did not harm cells. These observations suggest that insertion of the heterologous proteins into the inner membrane may cause the bactericidal effect.

Effects of rearrangement and allelic exclusion of JJAZ1/SUZ12 on cell proliferation and survival

PubMed Central

Li, Hui; Ma, XianYong; Wang, Jinglan; Koontz, Jason; Nucci, Marisa; Sklar, Jeffrey

2007-01-01

Polycomb group genes (PcGs) have been implicated in cancer based on altered levels of expression observed in certain tumors and the behavior of cultured cells containing inserted PcG transgenes. Endometrial stromal tumors provide evidence for a direct causal relationship because they contain several chromosomal translocations and resultant gene fusions involving PcGs, the most common of which joins portions of theJAZF1 gene to the PcGJJAZ1/SUZ12. We show here that both benign and malignant forms of this tumor have theJAZF1–JJAZ1 fusion but only the malignant form also exhibits exclusion of the unrearrangedJJAZ1 allele. To evaluate the effects of both theJJAZ1/SUZ12 fusion and allelic exclusion on functions related to cell growth, we studied HEK293 cells that were modified with respect toJJAZ1 expression. We found that theJAZF1–JJAZ1 fusion restored levels of the polycomb protein EZH2 and histone 3 lysine 27 trimethylation, which were reduced by knockdown of endogenous JJAZ1. At the same time, the presence ofJAZF1–JJAZ1 markedly inhibited apoptosis and induced above normal proliferation rates, although the latter effect occurred only when normalJJAZ1 was suppressed. Our findings suggest a genetic pathway for progression of a benign precursor to a sarcoma involving increased cell survival associated with acquisition of a PcG rearrangement, followed by accelerated cellular proliferation upon allelic exclusion of the unrearranged copy of that gene. Furthermore, these results indicate the likely functional importance of allelic exclusion of genes disrupted by chromosomal translocations, as seen in a variety of other cancers. PMID:18077430

Post-fusion treatment with MG132 increases transcription factor expression in somatic cell nuclear transfer embryos in pigs.

PubMed

You, Jinyoung; Lee, Joohyeong; Kim, Jinyoung; Park, Junhong; Lee, Eunsong

2010-02-01

The objective of this study was to examine the effect of post-fusion treatment of somatic cell nuclear transfer (SCNT) oocytes with the proteasomal inhibitor MG132 on maturation promoting factor (MPF) activity, nuclear remodeling, embryonic development, and gene expression of cloned pig embryos. Immediately after electrofusion, SCNT oocytes were treated with MG132 and/or caffeine for 2 hr, vanadate for 0.5 hr, or vanadate for 0.5 hr followed by MG132 for 1.5 hr. Of the MG132 concentrations tested (0-5 microM), the 1 microM concentration showed a higher rate of blastocyst formation (25.9%) than 0 (14.2%), 0.5 (16.9%), and 5 microM (16.9%). Post-fusion treatment with MG132, caffeine, and both MG132 and caffeine improved blastocyst formation (22.1%, 21.4%, and 24.4%, respectively), whereas vanadate treatment inhibited blastocyst formation (6.5%) compared to the control (11.1%). When examined 2 hr after fusion and 1 hr after activation, MPF activity remained at a higher (P < 0.05) level in SCNT oocytes that were treated post-fusion with caffeine and/or MG132, but it was decreased by vanadate. The rate of oocytes showing premature chromosome condensation was not altered by MG132 but was decreased by vanadate treatment. In addition, formation of single pronuclei was increased by MG132 compared to control and vanadate treatment. MG132-treated embryos showed increased expression of POU5F1, DPPA2, DPPA3, DPPA5, and NDP52l1 genes compared to control embryos. Our results demonstrate that post-fusion treatment of SCNT oocytes with MG132 prevents MPF degradation and increases expression of transcription factors in SCNT embryos, which are necessary for normal development of SCNT embryos. (c) 2009 Wiley-Liss, Inc.

Ectopic expression of Arabidopsis broad-spectrum resistance gene RPW8.2 improves the resistance to powdery mildew in grapevine (Vitis vinifera).

PubMed

Hu, Yang; Li, Yajuan; Hou, Fengjuan; Wan, Dongyan; Cheng, Yuan; Han, Yongtao; Gao, Yurong; Liu, Jie; Guo, Ye; Xiao, Shunyuan; Wang, Yuejin; Wen, Ying-Qiang

2018-02-01

Powdery mildew is the most economically important disease of cultivated grapevines worldwide. Here, we report that the Arabidopsis broad-spectrum disease resistance gene RPW8.2 could improve resistance to powdery mildew in Vitis vinifera cv. Thompson Seedless. The RPW8.2-YFP fusion gene was stably expressed in grapevines from either the constitutive 35S promoter or the native promoter (NP) of RPW8.2. The grapevine shoots and plantlets transgenic for 35S::RPW8.2-YFP showed reduced rooting and reduced growth at later development stages in the absence of any pathogens. Infection tests with an adapted grapevine powdery mildew isolate En NAFU1 showed that hyphal growth and sporulation were significantly restricted in transgenic grapevines expressing either of the two constructs. The resistance appeared to be attributable to the ectopic expression of RPW8.2, and associated with the enhanced encasement of the haustorial complex (EHC) and onsite accumulation of H 2 O 2 . In addition, the RPW8.2-YFP fusion protein showed focal accumulation around the fungal penetration sites. Transcriptome analysis revealed that ectopic expression of RPW8.2 in grapevines not only significantly enhanced salicylic acid-dependent defense signaling, but also altered expression of other phytohormone-associated genes. Taken together, our results indicate that RPW8.2 could be utilized as a transgene for improving resistance against powdery mildew in grapevines. Copyright © 2017 Elsevier B.V. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leong, JoAnn Ching

The IHNV glycoprotein has been identified as the virion protein which elicits neutralizing antibody in rabbits and induces protective immunity in fish to homologous and heterologous strains of IHNV (Engelking and Leong, 1989). These findings suggested that genetic engineering might be used to develop an economically feasible IHNV vaccine for fish. Thus, a clone of the IHNV glycoprotein gene was made and expression of a portion of this gene in bacteria resulted in a prototype IHNV subunit vaccine. Only 350 bases of IHNV sequence was expressed in this initial vaccine construction because there were 16 cysteine residues in the glycoproteinmore » gene. Previous work with the rabies glycoprotein had shown that when the entire gene was expressed in bacteria, a denatured protein was produced, presumably because appropriate folding mechanisms for disulfide bond formation in protein were absent in E. coli. The IHNV vaccine clone contained a region of the gene which encoded only one cysteine residue. Despite the efficacy of the vaccine in laboratory trials, it seemed useful to determine whether other regions of the IHNV glycoprotein gene would be expressed in an antigenically recognizable form in bacteria and thereby, provide increased protection in fish. The recombinant plasmids pXL2, pXL3, and pXL7 were constructed so that all regions of the glycoprotein gene were expressed in bacteria as trpE-G fusion proteins. All of these recombinant plasmids produced fusion proteins that were also analyzed in Western immunoblots with anti-IHNV sera and specific monoclonal antibodies. These results were compared with the proteins produced by p52G and p618G, the plasmids identified in the original vaccine construction. The results of this comparison are shown.« less

Human Papillomavirus Genome Integration and Head and Neck Cancer.

PubMed

Pinatti, L M; Walline, H M; Carey, T E

2018-06-01

We conducted a critical review of human papillomavirus (HPV) integration into the host genome in oral/oropharyngeal cancer, reviewed the literature for HPV-induced cancers, and obtained current data for HPV-related oral and oropharyngeal cancers. In addition, we performed studies to identify HPV integration sites and the relationship of integration to viral-host fusion transcripts and whether integration is required for HPV-associated oncogenesis. Viral integration of HPV into the host genome is not required for the viral life cycle and might not be necessary for cellular transformation, yet HPV integration is frequently reported in cervical and head and neck cancer specimens. Studies of large numbers of early cervical lesions revealed frequent viral integration into gene-poor regions of the host genome with comparatively rare integration into cellular genes, suggesting that integration is a stochastic event and that site of integration may be largely a function of chance. However, more recent studies of head and neck squamous cell carcinomas (HNSCCs) suggest that integration may represent an additional oncogenic mechanism through direct effects on cancer-related gene expression and generation of hybrid viral-host fusion transcripts. In HNSCC cell lines as well as primary tumors, integration into cancer-related genes leading to gene disruption has been reported. The studies have shown that integration-induced altered gene expression may be associated with tumor recurrence. Evidence from several studies indicates that viral integration into genic regions is accompanied by local amplification, increased expression in some cases, interruption of gene expression, and likely additional oncogenic effects. Similarly, reported examples of viral integration near microRNAs suggest that altered expression of these regulatory molecules may also contribute to oncogenesis. Future work is indicated to identify the mechanisms of these events on cancer cell behavior.

The EWS–Oct-4 fusion gene encodes a transforming gene

PubMed Central

Lee, Jungwoon; Kim, Ja Young; Kang, In Young; Kim, Hye Kyoung; Han, Yong-Mahn; Kim, Jungho

2007-01-01

The t(6;22)(p21;q12) translocation associated with human bone and soft-tissue tumours results in a chimaeric molecule fusing the NTD (N-terminal domain) of the EWS (Ewing's sarcoma) gene to the CTD (C-terminal domain) of the Oct-4 (octamer-4) embryonic gene. Since the N-terminal domains of EWS and Oct-4 are structurally different, in the present study we have assessed the functional consequences of the EWS–Oct-4 fusion. We find that this chimaeric gene encodes a nuclear protein which binds DNA with the same sequence specificity as the parental Oct-4 protein. Comparison of the transactivation properties of EWS–Oct-4 and Oct-4 indicates that the former has higher transactivation activity for a known target reporter gene containing Oct-4 binding. Deletion analysis of the functional domains of EWS–Oct-4 indicates that the EWS (NTD), the POU domain and the CTD of EWS–Oct-4 are necessary for full transactivation potential. EWS–Oct-4 induced the expression of fgf-4 (fibroblast growth factor 4) and nanog, which are potent mitogens as well as Oct-4 downstream target genes whose promoters contain potential Oct-4-binding sites. Finally, ectopic expression of EWS–Oct-4 in Oct-4-null ZHBTc4 ES (embryonic stem) cells resulted in increased tumorigenic growth potential in nude mice. These results suggest that the oncogenic effect of the t(6;22) translocation is due to the EWS–Oct-4 chimaeric protein and that fusion of the EWS NTD to the Oct-4 DNA-binding domain produces a transforming chimaeric product. PMID:17564582

The cytoplasmic domain of the gamete membrane fusion protein HAP2 targets the protein to the fusion site in Chlamydomonas and regulates the fusion reaction.

PubMed

Liu, Yanjie; Pei, Jimin; Grishin, Nick; Snell, William J

2015-03-01

Cell-cell fusion between gametes is a defining step during development of eukaryotes, yet we know little about the cellular and molecular mechanisms of the gamete membrane fusion reaction. HAP2 is the sole gamete-specific protein in any system that is broadly conserved and shown by gene disruption to be essential for gamete fusion. The wide evolutionary distribution of HAP2 (also known as GCS1) indicates it was present in the last eukaryotic common ancestor and, therefore, dissecting its molecular properties should provide new insights into fundamental features of fertilization. HAP2 acts at a step after membrane adhesion, presumably directly in the merger of the lipid bilayers. Here, we use the unicellular alga Chlamydomonas to characterize contributions of key regions of HAP2 to protein location and function. We report that mutation of three strongly conserved residues in the ectodomain has no effect on targeting or fusion, although short deletions that include those residues block surface expression and fusion. Furthermore, HAP2 lacking a 237-residue segment of the cytoplasmic region is expressed at the cell surface, but fails to localize at the apical membrane patch specialized for fusion and fails to rescue fusion. Finally, we provide evidence that the ancient HAP2 contained a juxta-membrane, multi-cysteine motif in its cytoplasmic region, and that mutation of a cysteine dyad in this motif preserves protein localization, but substantially impairs HAP2 fusion activity. Thus, the ectodomain of HAP2 is essential for its surface expression, and the cytoplasmic region targets HAP2 to the site of fusion and regulates the fusion reaction. © 2015. Published by The Company of Biologists Ltd.

Immunodiagnosis of groundnut and watermelon bud necrosis viruses using polyclonal antiserum to recombinant nucleocapsid protein of Groundnut bud necrosis virus.

PubMed

Jain, R K; Pandey, Amar N; Krishnareddy, M; Mandal, Bikash

2005-12-01

In vitro gene expression strategy was used for the production of polyclonal antiserum to the nucleocapsid protein (NP) of Groundnut bud necrosis virus (GBNV). The GBNV NP gene from cowpea isolate was cloned into 6x His-tagged UA cloning vector and expressed in Escherichia coli [M15] cells. The fusion protein was detected in insoluble fraction and was purified by using Ni-NTA agarose resin. The purified 6x His-fusion protein ( approximately 32 kDa) was used for immunisation to produce a high titre polyclonal antiserum. The antiserum to the NP of GBNV at 1:4000 dilution detected successfully natural infection of GBNV and Watermelon bud necrosis virus in a wide range of cucurbitaceous, leguminous and solanaceous hosts from different locations.

[Renal cell carcinoma associated with Xp11.2 translocations/TFE3 gene fusions: a study of 11 cases and review of literature].

PubMed

Rao, Qiu; Zhou, Xiao-jun; Wu, Bo; Ma, Heng-hui; Zhou, Hang-bo; Liu, Xiao-hong; Chen, Jie-yu

2007-04-01

To study the clinicopathologic features, differential diagnosis and prognosis of renal cell carcinoma associated with Xp11.2 translocations/TFE3 gene fusions. The histopathologic findings and immunophenotype of 11 cases of renal cell carcinoma associated with Xp11.2 translocations/TFE3 gene fusions were studied. Follow-up data (ranged from 10 to 112 months) were also analyzed. There were a total of 7 females and 4 males. The age of patients ranged from 8 to 26 years (mean = 16.3 years). The diameter of the tumors varied from 2.5 to 6.0 cm. Histologically, two morphologic patterns were seen. The first pattern consisted of alveolar, papillary or nested architecture. The tumor cells contained voluminous, clear to eosinophilic cytoplasm, distinct cell borders, vesicular chromatin, and prominent nucleoli. Psammoma bodies were frequently found and could be abundant. In contrast, the second pattern was composed of nested and compact architecture. The tumor cells possessed less abundant cytoplasm and inconspicuous nucleoli. Few psammoma bodies were detected. Immunohistochemical study showed that all cases strongly expressed TFE3, CD10 and P504s. Variable positivity for pan-cytokeratin, epithelial membrane antigen and vimentin was also noted. None of them expressed CK7, Ksp-cadherin and CD117. Renal cell carcinoma associated with Xp11.2 translocations/TFE3 gene fusions is a newly described but rarely encountered subtype of renal cell carcinoma. Pathologic diagnosis can be established when taken age of the patients, histopathologic findings and immunoreactivity for TFE3 protein into consideration.

Activation of a development-specific gene, dofA, by FruA, an essential transcription factor for development of Myxococcus xanthus.

PubMed

Ueki, Toshiyuki; Inouye, Sumiko

2005-12-01

FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development.

Robust, synergistic regulation of human gene expression using TALE activators.

PubMed

Maeder, Morgan L; Linder, Samantha J; Reyon, Deepak; Angstman, James F; Fu, Yanfang; Sander, Jeffry D; Joung, J Keith

2013-03-01

Artificial activators designed using transcription activator-like effector (TALE) technology have broad utility, but previous studies suggest that these monomeric proteins often exhibit low activities. Here we demonstrate that TALE activators can robustly function individually or in synergistic combinations to increase expression of endogenous human genes over wide dynamic ranges. These findings will encourage applications of TALE activators for research and therapy, and guide design of monomeric TALE-based fusion proteins.

Expression of gamma-aminobutyric acid rho 1 and rho 1 Delta 450 as gene fusions with the green fluorescent protein.

PubMed

Martinez-Torres, A; Miledi, R

2001-02-13

The functional characteristics and cellular localization of the gamma aminobutyric acid (GABA) rho 1 receptor and its nonfunctional isoform rho 1 Delta 450 were investigated by expressing them as gene fusions with the enhanced version of the green fluorescent protein (GFP). Oocytes injected with rho 1-GFP had receptors that gated chloride channels when activated by GABA. The functional characteristics of these receptors were the same as for those of wild-type rho 1 receptors. Fluorescence, because of the chimeric receptors expressed, was over the whole oocyte but was more intense near the cell surface and more abundant in the animal hemisphere. Similar to the wild type, rho 1 Delta 450-GFP did not lead to the expression of functional GABA receptors, and injected oocytes failed to generate currents even after exposure to high concentrations of GABA. Nonetheless, the fluorescence displayed by oocytes expressing rho 1 Delta 450-GFP was distributed similarly to that of rho 1-GFP. Mammalian cells transfected with the rho 1-GFP or rho 1 Delta 450-GFP constructs showed mostly intracellularly distributed fluorescence in confocal microscope images. A sparse localization of fluorescence was observed in the plasma membrane regardless of the cell line used. We conclude that rho 1 Delta 450 is expressed and transported close to, and perhaps incorporated into, the plasma membrane. Thus, rho 1- and rho 1 Delta 450-GFP fusions provide a powerful tool to visualize the traffic of GABA type C receptors.

Cell Fusion Reprogramming Leads to a Specific Hepatic Expression Pattern during Mouse Bone Marrow Derived Hepatocyte Formation In Vivo

PubMed Central

Arza, Elvira; Alvarez-Barrientos, Alberto; Fabregat, Isabel; Garcia-Bravo, Maria; Meza, Nestor W.; Segovia, Jose C.

2012-01-01

The fusion of bone marrow (BM) hematopoietic cells with hepatocytes to generate BM derived hepatocytes (BMDH) is a natural process, which is enhanced in damaged tissues. However, the reprogramming needed to generate BMDH and the identity of the resultant cells is essentially unknown. In a mouse model of chronic liver damage, here we identify a modification in the chromatin structure of the hematopoietic nucleus during BMDH formation, accompanied by the loss of the key hematopoietic transcription factor PU.1/Sfpi1 (SFFV proviral integration 1) and gain of the key hepatic transcriptional regulator HNF-1A homeobox A (HNF-1A/Hnf1a). Through genome-wide expression analysis of laser captured BMDH, a differential gene expression pattern was detected and the chromatin changes observed were confirmed at the level of chromatin regulator genes. Similarly, Tranforming Growth Factor-β1 (TGF-β1) and neurotransmitter (e.g. Prostaglandin E Receptor 4 [Ptger4]) pathway genes were over-expressed. In summary, in vivo BMDH generation is a process in which the hematopoietic cell nucleus changes its identity and acquires hepatic features. These BMDHs have their own cell identity characterized by an expression pattern different from hematopoietic cells or hepatocytes. The role of these BMDHs in the liver requires further investigation. PMID:22457803

HIP1-ALK, a novel ALK fusion variant that responds to crizotinib.

PubMed

Fang, Douglas D; Zhang, Bin; Gu, Qingyang; Lira, Maruja; Xu, Qiang; Sun, Hongye; Qian, Maoxiang; Sheng, Weiqi; Ozeck, Mark; Wang, Zhenxiong; Zhang, Cathy; Chen, Xinsheng; Chen, Kevin X; Li, Jian; Chen, Shu-Hui; Christensen, James; Mao, Mao; Chan, Chi-Chung

2014-03-01

The aim of this study was to identify anaplastic lymphoma kinase (ALK) rearrangements in lung cancer patient-derived xenograft (PDX) models and to explore their responses to crizotinib. Screening of 99 lung cancer PDX models by the NanoString ALK fusion assay identified two ALK-rearranged non-small-cell lung cancer (NSCLC) tumors, including one harboring a previously known echinoderm microtubule-associated protein-like 4 (EML4)-ALK fusion and another containing an unknown ALK fusion variant. Expression array, RNA-Seq, reverse transcription polymerase chain reaction, and direct sequencing were then conducted to confirm the rearrangements and to identify the novel fusion partner in the xenograft and/or the primary patient tumor. Finally, pharmacological studies were performed in PDX models to evaluate their responses to ALK inhibitor crizotinib. Two ALK-rearranged NSCLC PDX models were identified: one carried a well-known EML4-ALK variant 3a/b and the other harbored a novel huntingtin interacting protein 1 (HIP1)-ALK fusion gene. Exon 28 of the HIP1 gene located on chromosome 7 was fused to exon 20 of the ALK gene located on chromosome 2. Both cases were clinically diagnosed as squamous cell carcinoma. Compared with the other lung cancer PDX models, both ALK-rearranged models displayed elevated ALK mRNA expression. Furthermore, in vivo efficacy studies demonstrated that, similar to the EML4-ALK-positive model, the HIP1-ALK-containing PDX model was sensitive to treatment with crizotinib. Discovery of HIP1 as a fusion partner of ALK in NSCLC is a novel finding. In addition, the HIP1-ALK-rearranged tumor is sensitive to treatment with crizotinib in vivo, implicating HIP1-ALKas an oncogenic driver of lung tumorigenesis. Collectively, our results indicate that HIP1-ALK-positive NSCLC may benefit from clinical applications of crizotinib.

A Lactococcus lactis BFE920 feed vaccine expressing a fusion protein composed of the OmpA and FlgD antigens from Edwardsiella tarda was significantly better at protecting olive flounder (Paralichthys olivaceus) from edwardsiellosis than single antigen vaccines.

PubMed

Beck, Bo Ram; Lee, Soon Ho; Kim, Daniel; Park, Ji Hye; Lee, Hyun Kyung; Kwon, San-Sung; Lee, Kwan Hee; Lee, Jae Il; Song, Seong Kyu

2017-09-01

Edwardsiellosis is a major fish disease that causes a significant economic damage in the aquaculture industry. Here, we assessed vaccine efficacy after feeding oral vaccines to olive flounder (Paralichthys olivaceus), either L. lactis BFE920 expressing Edwardsiella tarda outer membrane protein A (OmpA), flagellar hook protein D (FlgD), or a fusion antigen of the two. Feed vaccination was done twice with a one-week interval. Fish were fed regular feed adsorbed with the vaccines. Feed vaccination was given over the course of one week to maximize the interaction between the feed vaccines and the fish intestine. Flounder fed the vaccine containing the fusion antigen had significantly elevated levels T cell genes (CD4-1, CD4-2, and CD8α), type 1 helper T cell (Th1) subset indicator genes (T-bet and IFN-γ), and antigen-specific antibodies compared to the groups fed the single antigen-expressing vaccines. Furthermore, the superiority of the fusion vaccine was also observed in survival rates when fish were challenged with E. tarda: OmpA-FlgD-expressing vaccine (82.5% survival); FlgD-vaccine (55.0%); OmpA-vaccine (50%); WT L. lactis BFE920 (37.5%); Ctrl (10%). In addition, vaccine-fed fish exhibited increased weight gain (∼20%) and a decreased feed conversion ratio (∼20%) during the four week vaccination period. Flounder fed the FlgD-expressing vaccine, either the single or the fusion form, had significantly increased expression of TLR5M, IL-1β, and IL-12p40, suggesting that the FlgD may be a ligand of olive flounder TLR5M receptor or closely related to the TLR5M pathway. In conclusion, the present study demonstrated that olive flounder fed L. lactis BFE920 expressing a fusion antigen composed of E. tarda OmpA and FlgD showed a strong protective effect against edwardsiellosis indicating this may be developed as an E. tarda feed vaccine. Copyright © 2017 Elsevier Ltd. All rights reserved.

Establishment of a Conditional Transgenic Mouse Model Recapitulating EML4-ALK-Positive Human Non-Small Cell Lung Cancer.

PubMed

Pyo, Kyoung Ho; Lim, Sun Min; Kim, Hye Ryun; Sung, Young Hoon; Yun, Mi Ran; Kim, Sung-Moo; Kim, Hwan; Kang, Han Na; Lee, Ji Min; Kim, Sang Gyun; Park, Chae Won; Chang, Hyun; Shim, Hyo Sup; Lee, Han-Woong; Cho, Byoung Chul

2017-03-01

Anaplastic lymphoma receptor tyrosine kinase gene (ALK) fusion is a distinct molecular subclassification of NSCLC that is targeted by anaplastic lymphoma kinase (ALK) inhibitors. We established a transgenic mouse model that expresses tumors highly resembling human NSCLC harboring echinoderm microtubule associated protein like 4 gene (EML)-ALK fusion. We aimed to test an EML4-ALK transgenic mouse model as a platform for assessing the efficacy of ALK inhibitors and examining mechanisms of acquired resistance to ALK inhibitors. Transgenic mouse lines harboring LoxP-STOP-LoxP-FLAGS-tagged human EML4-ALK (variant 1) transgene was established by using C57BL/6N mice. The transgenic mouse model with highly lung-specific, inducible expression of echinoderm microtubule associated protein like 4-ALK fusion protein was established by crossing the EML4-ALK transgenic mice with mice expressing Cre-estrogen receptor fusion protein under the control of surfactant protein C gene (SPC). Expression of EML4-ALK transgene was induced by intraperitoneally injecting mice with tamoxifen. When the lung tumor of the mice treated with the ALK inhibitor crizotinib for 2 weeks was measured, tumor shrinkage was observed. EML4-ALK tumor developed after 1 week of tamoxifen treatment. Echinoderm microtubule associated protein like 4-ALK was strongly expressed in the lung but not in other organs. ALK and FLAGS expressions were observed by immunohistochemistry. Treatment of EML4-ALK tumor-bearing mice with crizotinib for 2 weeks induced dramatic shrinkage of tumors with no signs of toxicity. Furthermore, prolonged treatment with crizotinib led to acquired resistance in tumors, resulting in regrowth and disease progression. The resistant tumor nodules revealed acquired ALK G1202R mutations. An EML4-ALK transgenic mouse model for study of drug resistance was successfully established with short duration of tumorigenesis. This model should be a strong preclinical model for testing efficacy of ALK TKIs, providing a useful tool for investigating the mechanisms of acquired resistance and pursuing novel treatment strategies in ALK-positive lung cancer. Copyright © 2016 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights reserved.

A Fluorescent Bioreporter for Acetophenone and 1-Phenylethanol derived from a Specifically Induced Catabolic Operon.

PubMed

Muhr, Enrico; Leicht, Oliver; González Sierra, Silvia; Thanbichler, Martin; Heider, Johann

2015-01-01

The β-proteobacterium Aromatoleum aromaticum degrades the aromatic ketone acetophenone, a key intermediate of anaerobic ethylbenzene metabolism, either aerobically or anaerobically via a complex ATP-dependent acetophenone carboxylase and a benzoylacetate-CoA ligase. The genes coding for these enzymes (apcABCDE and bal) are organized in an apparent operon and are expressed in the presence of the substrate acetophenone. To study the conditions under which this operon is expressed in more detail, we constructed a reporter strain by inserting a gene fusion of apcA, the first gene of the apc-bal operon, with the gene for the fluorescent protein mCherry into the chromosome of A. aromaticum. The fusion protein indeed accumulated consistently with the expression pattern of the acetophenone-metabolic enzymes under various growth conditions. After evaluating and quantifying the data by fluorescence microscopy, fluorescence-based flow cytometry and immunoblot analysis, mCherry production was found to be proportional to the applied acetophenone concentrations. The reporter strain allowed quantification of acetophenone within a concentration range of 50 μM (detection limit) to 250 μM after 12 and 24 h. Moreover, production of the Apc-mCherry fusion protein in the reporter strain was highly specific and responded to acetophenone and both enantiomers of 1-phenylethanol, which are easily converted to acetophenone. Other analogous substrates showed either a significantly weaker response or none at all. Therefore, the reporter strain provides a basis for the development of a specific bioreporter system for acetophenone with an application potential reaching from environmental monitoring to petroleum prospecting.

A Fluorescent Bioreporter for Acetophenone and 1-Phenylethanol derived from a Specifically Induced Catabolic Operon

PubMed Central

Muhr, Enrico; Leicht, Oliver; González Sierra, Silvia; Thanbichler, Martin; Heider, Johann

2016-01-01

The β-proteobacterium Aromatoleum aromaticum degrades the aromatic ketone acetophenone, a key intermediate of anaerobic ethylbenzene metabolism, either aerobically or anaerobically via a complex ATP-dependent acetophenone carboxylase and a benzoylacetate-CoA ligase. The genes coding for these enzymes (apcABCDE and bal) are organized in an apparent operon and are expressed in the presence of the substrate acetophenone. To study the conditions under which this operon is expressed in more detail, we constructed a reporter strain by inserting a gene fusion of apcA, the first gene of the apc-bal operon, with the gene for the fluorescent protein mCherry into the chromosome of A. aromaticum. The fusion protein indeed accumulated consistently with the expression pattern of the acetophenone-metabolic enzymes under various growth conditions. After evaluating and quantifying the data by fluorescence microscopy, fluorescence-based flow cytometry and immunoblot analysis, mCherry production was found to be proportional to the applied acetophenone concentrations. The reporter strain allowed quantification of acetophenone within a concentration range of 50 μM (detection limit) to 250 μM after 12 and 24 h. Moreover, production of the Apc-mCherry fusion protein in the reporter strain was highly specific and responded to acetophenone and both enantiomers of 1-phenylethanol, which are easily converted to acetophenone. Other analogous substrates showed either a significantly weaker response or none at all. Therefore, the reporter strain provides a basis for the development of a specific bioreporter system for acetophenone with an application potential reaching from environmental monitoring to petroleum prospecting. PMID:26858693

Heterogeneous data fusion for brain tumor classification.

PubMed

Metsis, Vangelis; Huang, Heng; Andronesi, Ovidiu C; Makedon, Fillia; Tzika, Aria

2012-10-01

Current research in biomedical informatics involves analysis of multiple heterogeneous data sets. This includes patient demographics, clinical and pathology data, treatment history, patient outcomes as well as gene expression, DNA sequences and other information sources such as gene ontology. Analysis of these data sets could lead to better disease diagnosis, prognosis, treatment and drug discovery. In this report, we present a novel machine learning framework for brain tumor classification based on heterogeneous data fusion of metabolic and molecular datasets, including state-of-the-art high-resolution magic angle spinning (HRMAS) proton (1H) magnetic resonance spectroscopy and gene transcriptome profiling, obtained from intact brain tumor biopsies. Our experimental results show that our novel framework outperforms any analysis using individual dataset.

Up-regulation of mismatch repair genes MSH6, PMS2 and MLH1 parallels development of genetic instability and is linked to tumor aggressiveness and early PSA recurrence in prostate cancer.

PubMed

Wilczak, Waldemar; Rashed, Semin; Hube-Magg, Claudia; Kluth, Martina; Simon, Ronald; Büscheck, Franziska; Clauditz, Till Sebastian; Grupp, Katharina; Minner, Sarah; Tsourlakis, Maria Christina; Möller-Koop, Christina; Graefen, Markus; Adam, Meike; Haese, Alexander; Wittmer, Corinna; Sauter, Guido; Izbicki, Jakob Robert; Huland, Hartwig; Schlomm, Thorsten; Steurer, Stefan; Krech, Till; Lebok, Patrick

2017-01-01

DNA mismatch repair (MMR) is integral to the maintenance of genetic stability. We aimed to evaluate the clinical impact of MMR gene expression in prostate cancer. The MMR genes MSH6, MLH1 and PMS2 were analyzed by immunohistochemistry on a tissue microarray containing 11152 prostate cancer specimens. Results were compared with ETS-related gene status and deletions of PTEN, 3p13, 5q21 and 6q15. MSH6, MLH1 and PMS2 expression was detectable in 89.5%, 85.4% and 85.0% of cancers and was particularly strong in cancers with advanced pathological tumor stage (P < 0.0001 each), high Gleason grade (P < 0.0001 each), nodal metastasis (P ≤ 0.0083) and early biochemical recurrence (P < 0.0001). High levels of MMR gene expression paralleled features of genetic instability, such as the number of genomic deletions per cancer; strong expression of all three MMR genes was found in 24%, 29%, 30%, 33% and 42% of cancers with no, one, two, three or four to five deletions (P < 0.0001). The prognostic value of the analyzed MMR genes was largely driven by the subset of cancers lacking ERG fusion (P < 0.0001), while the prognostic impact of MMR gene overexpression was only marginal in ERG-positive cancers. Multivariate analyses suggested an independent prognostic relevance of MMR genes in ERG-negative prostate cancers when compared with prognostic parameters available at the time of initial biopsy. In conclusion, MMR overexpression is common in prostate cancer and is linked to poor outcome as well as features indicating genetic instability. ERG fusion should be analyzed along with MMR gene expression in potential clinical tests. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Pluripotent hybrid cells contribute to extraembryonic as well as embryonic tissues.

PubMed

Do, Jeong Tae; Choi, Hyun Woo; Choi, Youngsok; Schöler, Hans R

2011-06-01

The restricted gene expression of a differentiated cell can be reversed by forming hybrid with embryonic stem cells (ESCs). The resulting hybrid cells showed not only an ESC-specific marker expression but also a differentiation potential similar to the pluripotent fusion partner. Here, we evaluated whether the tetraploid fusion hybrid cells have a unique differentiation potential compared with diploid pluripotent cells. The first Oct4-GFP-positive cells were observed at day 2 following fusion between ESCs and neurosphere cells (OG2(+/-)/ROSA26(+/-)). Reprogramming efficiency was as high as 94.5% at passage 5 and 96.4% at passage 13. We have found that the tetraploid hybrid cells could form chimera with contribution to placenta after blastocyst injection. This result indicates that the tetraploid pluripotent fusion hybrid cells have wide range of differentiation potential. Therefore, we suggest that once the somatic cells are reprogrammed by fusion with ESCs, the tetraploid hybrid cells contributed to the extraembryonic as well as embryonic tissues.

Expression and Functional Analysis of WRKY Transcription Factors in Chinese Wild Hazel, Corylus heterophylla Fisch

PubMed Central

Liang, Li-Song; Ma, Qing-Hua; Chen, Xin; Zong, Jian-Wei; Wang, Gui-Xi

2015-01-01

Plant WRKY transcription factors are known to regulate various biotic and abiotic stress responses. In this study we identified a total of 30 putative WRKY unigenes in a transcriptome dataset of the Chinese wild Hazel, Corylus heterophylla, a species that is noted for its cold tolerance. Thirteen full-length of these ChWRKY genes were cloned and found to encode complete protein sequences, and they were divided into three groups, based on the number of WRKY domains and the pattern of zinc finger structures. Representatives of each of the groups, Unigene25835 (group I), Unigene37641 (group II) and Unigene20441 (group III), were transiently expressed as fusion proteins with yellow fluorescent fusion protein in Nicotiana benthamiana, where they were observed to accumulate in the nucleus, in accordance with their predicted roles as transcriptional activators. An analysis of the expression patterns of all 30 WRKY genes revealed differences in transcript abundance profiles following exposure to cold, drought and high salinity conditions. Among the stress-inducible genes, 23 were up-regulated by all three abiotic stresses and the WRKY genes collectively exhibited four different patterns of expression in flower buds during the overwintering period from November to April. The organ/tissue related expression analysis showed that 18 WRKY genes were highly expressed in stem but only 2 (Unigene9262 and Unigene43101) were greatest in male anthotaxies. The expression of Unigene37641, a member of the group II WRKY genes, was substantially up-regulated by cold, drought and salinity treatments, and its overexpression in Arabidopsis thaliana resulted in better seedling growth, compared with wild type plants, under cold treatment conditions. The transgenic lines also had exhibited higher soluble protein content, superoxide dismutase and peroxidase activiety and lower levels of malondialdehyde, which collectively suggets that Unigene37641 expression promotes cold tolerance. PMID:26270529

Expression and Functional Analysis of WRKY Transcription Factors in Chinese Wild Hazel, Corylus heterophylla Fisch.

PubMed

Zhao, Tian-Tian; Zhang, Jin; Liang, Li-Song; Ma, Qing-Hua; Chen, Xin; Zong, Jian-Wei; Wang, Gui-Xi

2015-01-01

Plant WRKY transcription factors are known to regulate various biotic and abiotic stress responses. In this study we identified a total of 30 putative WRKY unigenes in a transcriptome dataset of the Chinese wild Hazel, Corylus heterophylla, a species that is noted for its cold tolerance. Thirteen full-length of these ChWRKY genes were cloned and found to encode complete protein sequences, and they were divided into three groups, based on the number of WRKY domains and the pattern of zinc finger structures. Representatives of each of the groups, Unigene25835 (group I), Unigene37641 (group II) and Unigene20441 (group III), were transiently expressed as fusion proteins with yellow fluorescent fusion protein in Nicotiana benthamiana, where they were observed to accumulate in the nucleus, in accordance with their predicted roles as transcriptional activators. An analysis of the expression patterns of all 30 WRKY genes revealed differences in transcript abundance profiles following exposure to cold, drought and high salinity conditions. Among the stress-inducible genes, 23 were up-regulated by all three abiotic stresses and the WRKY genes collectively exhibited four different patterns of expression in flower buds during the overwintering period from November to April. The organ/tissue related expression analysis showed that 18 WRKY genes were highly expressed in stem but only 2 (Unigene9262 and Unigene43101) were greatest in male anthotaxies. The expression of Unigene37641, a member of the group II WRKY genes, was substantially up-regulated by cold, drought and salinity treatments, and its overexpression in Arabidopsis thaliana resulted in better seedling growth, compared with wild type plants, under cold treatment conditions. The transgenic lines also had exhibited higher soluble protein content, superoxide dismutase and peroxidase activiety and lower levels of malondialdehyde, which collectively suggets that Unigene37641 expression promotes cold tolerance.

Life-cycle and growth-phase-dependent regulation of the ubiquitin genes of Trypanosoma cruzi.

PubMed

Manning-Cela, Rebeca; Jaishankar, Sobha; Swindle, John

2006-07-01

Trypanosoma cruzi, the causative agent of Chagas disease, exhibits a complex life cycle that is accompanied by the stage-specific gene expression. At the molecular level, very little is known about gene regulation in trypanosomes. Complex gene organizations coupled with polycistronic transcription units make the analysis of regulated gene expression difficult in trypanosomes. The ubiquitin genes of T. cruzi are a good example of this complexity. They are organized as a single cluster containing five ubiquitin fusion (FUS) and five polyubiquitin (PUB) genes that are polycistronically transcribed but expressed differently in response to developmental and environmental changes. Gene replacements were used to study FUS and PUB gene expression at different stages of growth and at different points in the life cycle of T. cruzi. Based on the levels of reporter gene expression, it was determined that FUS1 expression was downregulated as the parasites approached stationary phase, whereas PUB12.5 polyubiquitin gene expression increased. Conversely, FUS1 expression increases when epimastigotes and amastigotes differentiate into trypomastigotes, whereas the expression of PUB12.5 decreases when epimastigotes differentiate into amastigotes and trypomastigotes. Although the level of CAT activity in logarithmic growing epimastigotes is six- to seven-fold higher when the gene was expressed from the FUS1 locus than when expressed from the PUB12.5 locus, the rate of transcription from the two loci was the same implying that post-transcriptional mechanisms play a dominant role in the regulation of gene expression.

Distinct Calcium Signaling Pathways Regulate Calmodulin Gene Expression in Tobacco1

PubMed Central

van der Luit, Arnold H.; Olivari, Claudio; Haley, Ann; Knight, Marc R.; Trewavas, Anthony J.

1999-01-01

Cold shock and wind stimuli initiate Ca2+ transients in transgenic tobacco (Nicotiana plumbaginifolia) seedlings (named MAQ 2.4) containing cytoplasmic aequorin. To investigate whether these stimuli initiate Ca2+ pathways that are spatially distinct, stress-induced nuclear and cytoplasmic Ca2+ transients and the expression of a stress-induced calmodulin gene were compared. Tobacco seedlings were transformed with a construct that encodes a fusion protein between nucleoplasmin (a major oocyte nuclear protein) and aequorin. Immunocytochemical evidence indicated targeting of the fusion protein to the nucleus in these plants, which were named MAQ 7.11. Comparison between MAQ 7.11 and MAQ 2.4 seedlings confirmed that wind stimuli and cold shock invoke separate Ca2+ signaling pathways. Partial cDNAs encoding two tobacco calmodulin genes, NpCaM-1 and NpCaM-2, were identified and shown to have distinct nucleotide sequences that encode identical polypeptides. Expression of NpCaM-1, but not NpCaM-2, responded to wind and cold shock stimulation. Comparison of the Ca2+ dynamics with NpCaM-1 expression after stimulation suggested that wind-induced NpCaM-1 expression is regulated by a Ca2+ signaling pathway operational predominantly in the nucleus. In contrast, expression of NpCaM-1 in response to cold shock is regulated by a pathway operational predominantly in the cytoplasm. PMID:10557218

Construction and Cloning of Reporter-Tagged Replicon cDNA for an In Vitro Replication Study of Murine Norovirus-1 (MNV-1)

PubMed Central

Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir

2017-01-01

Background A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. Methods The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3′end of the reporter gene and the VP2 start sequence to allow co-translational ‘cleavage’ of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Results Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. Conclusion NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication. PMID:29379384

SFPQ/PSF-TFE3 renal cell carcinoma: a clinicopathologic study emphasizing extended morphology and reviewing the differences between SFPQ-TFE3 RCC and the corresponding mesenchymal neoplasm despite an identical gene fusion.

PubMed

Wang, Xiao-Tong; Xia, Qiu-Yuan; Ni, Hao; Ye, Sheng-Bing; Li, Rui; Wang, Xuan; Shi, Shan-Shan; Zhou, Xiao-Jun; Rao, Qiu

2017-05-01

Xp11 translocation renal cell carcinoma (RCC) with SFPQ/PSF-TFE3 gene fusion is a rare epithelial tumor. Of note, the appearance of the gene fusion does not necessarily mean that it is renal cell carcinoma. The corresponding mesenchymal neoplasms, including Xp11 neoplasm with melanocytic differentiation, TFE3 rearrangement-associated perivascular epithelioid cell tumor (PEComa) and melanotic Xp11 translocation renal cancer, can also harbor the identical gene fusion. However, the differences between Xp11 translocation RCC and the corresponding mesenchymal neoplasm have only recently been described. Herein, we examined 5 additional cases of SFPQ-TFE3 RCCs using clinicopathologic, immunohistochemical, and molecular analyses. One tumor had the typical morphologic features of SFPQ-TFE3 RCC, whereas other 3 cases demonstrated the unusual morphologic features associated with pseudorosettes formation or clusters of smaller cells, mimicking TFEB RCC. The remaining one showed branching tubules and papillary structure composed of clear and eosinophilic tumor cells. Immunohistochemically, all 5 cases demonstrated moderate (2+) or strong (3+) positive staining for TFE3, PAX-8 and CD10, whereas no cases demonstrated TFEB, Cathepsin K, CA-IX, CK7, Melan-A, or HMB-45 expression. Genetically, the fusion transcripts were identified in 3 cases by reverse-transcription polymerase chain reaction (RT-PCR). On the basis of fluorescence in situ hybridization (FISH) analysis, all the cases were detected with SFPQ-TFE3 gene fusion. Clinical follow-up data were available for all the patients, and no one developed tumor recurrence, progression, or metastasis. We also review the differences between SFPQ-TFE3 RCC and the corresponding mesenchymal neoplasm despite the identical gene fusion. The presence of pseudorosettes also expands the known histological features of SFPQ-TFE3 RCC. Copyright © 2017 Elsevier Inc. All rights reserved.

The expression and genetic immunization of chimeric fragment of Hantaan virus M and S segments

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang Fanglin; Wu Xingan; Luo Wen

2007-03-23

Hemorrhagic fever with renal syndrome (HFRS), which is characterized by severe symptoms and high mortality, is caused by hantavirus. There are still no effective prophylactic vaccines directed to HFRS until now. In this research, we fused expressed G2 fragment of M segment and 0.7 kb fragment of S segment. We expect it could be a candidate vaccine. Chimeric gene G2S0.7 was first expressed in prokaryotic expression system pGEX-4T. After inducing expressed fusion proteins, GST-G2S0.7 was induced and its molecular weight was about 100 kDa. Meanwhile, the fusion protein kept the activity of its parental proteins. Further, BALB/c mice were vaccinatedmore » by the chimeric gene. ELISA, cell microculture neutralization test in vitro were used to detect the humoral immune response in immunized BALB/c mice. Lymphocyte proliferation assay was used to detect the cellular immune response. The results showed that the chimeric gene could simultaneously evoke specific antibody against nucleocapsid protein (NP) and glycoprotein (GP). And the immunized mice of every group elicited neutralizing antibodies with different titers. But the titers were low. Lymphocyte proliferation assay results showed that the stimulation indexes of splenocytes of chimeric gene to NP and GP were significantly higher than that of control. It suggested that the chimeric gene of Hantaan virus containing G2 fragment of M segment and 0.7 kb fragment of S segment could directly elicit specific anti-Hantaan virus humoral and cellular immune response in BALB/c mice.« less

The promoter of the cereal VERNALIZATION1 gene is sufficient for transcriptional induction by prolonged cold.

PubMed

Alonso-Peral, Maria M; Oliver, Sandra N; Casao, M Cristina; Greenup, Aaron A; Trevaskis, Ben

2011-01-01

The VERNALIZATION1 (VRN1) gene of temperate cereals is transcriptionally activated by prolonged cold during winter (vernalization) to promote flowering. To investigate the mechanisms controlling induction of VRN1 by prolonged cold, different regions of the VRN1 gene were fused to the GREEN FLUORESCENT PROTEIN (GFP) reporter and expression of the resulting gene constructs was assayed in transgenic barley (Hordeum vulgare). A 2 kb segment of the promoter of VRN1 was sufficient for GFP expression in the leaves and shoot apex of transgenic barley plants. Fluorescence increased at the shoot apex prior to inflorescence initiation and was subsequently maintained in the developing inflorescence. The promoter was also sufficient for low-temperature induction of GFP expression. A naturally occurring insertion in the proximal promoter, which is associated with elevated VRN1 expression and early flowering in some spring wheats, did not abolish induction of VRN1 transcription by prolonged cold, however. A translational fusion of the promoter and transcribed regions of VRN1 to GFP, VRN1::GFP, was localised to nuclei of cells at the shoot apex of transgenic barley plants. The distribution of VRN1::GFP at the shoot apex was similar to the expression pattern of the VRN1 promoter-GFP reporter gene. Fluorescence from the VRN1::GFP fusion protein increased in the developing leaves after prolonged cold treatment. These observations suggest that the promoter of VRN1 is targeted by mechanisms that trigger vernalization-induced flowering in economically important temperate cereal crops.

The human leukocyte antigen G promotes trophoblast fusion and β-hCG production through the Erk1/2 pathway in human choriocarcinoma cell lines

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Ji-meng; State Key Laboratory of Reproductive Biology, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101; Zhao, Hong-xi

2013-05-10

Highlights: •HLA-G expression promotes BeWo cells fusion and fusogenic gene expression. •HLA-G is capable of inducing β-hCG production in human choriocarcinoma cell lines. •Up-regulation of β-hCG production by HLA-G is mediated via the Erk1/2 pathway. -- Abstract: The human leukocyte antigen G (HLA-G) is expressed on the fetal–maternal interface and plays a role in protecting fetal-derived trophoblasts from the maternal immune response, allowing trophoblasts to invade the uterus. However, HLA-G also possesses immune suppressing-independent functions. We found that HLA-G expressing BeWo choriocarcinoma cells increased cell–cell fusion compared to control BeWo cells under forskolin treatment. Regardless of forskolin treatment, the expressionmore » of fusogenic gene mRNAs, including syncytin-1, the transcription factor glial cell missing 1 (Gcm1), and beta human chorionic gonadotropin (β-hCG) were elevated. HLA-G up-regulates β-hCG production in human choriocarcinoma cells because HLA-G knockdown in JEG-3 cells induces a dramatic decrease in β-hCG compared with control cells. The defect in β-hCG production in HLA-G knocked-down cells could not be completely overcome by stimulating hCG production through increasing intracellular cAMP levels. HLA-G expressing cells have increased phosphorylation levels for extracellular signal-regulated kinase1/2 (Erk1/2) in BeWo cells. The Erk1/2 pathway is inactivated after the inhibition of HLA-G expression in JEG-3 cells. Finally, Erk1/2 inhibition was able to suppress the increased hCG production induced by HLA-G expression. Together, these data suggest novel roles for HLA-G in regulating β-hCG production via the modulation of the Erk1/2 pathway and by inducing trophoblast cell fusion.« less

In vivo imaging of an inducible oncogenic tumor antigen visualizes tumor progression and predicts CTL tolerance.

PubMed

Buschow, Christian; Charo, Jehad; Anders, Kathleen; Loddenkemper, Christoph; Jukica, Ana; Alsamah, Wisam; Perez, Cynthia; Willimsky, Gerald; Blankenstein, Thomas

2010-03-15

Visualizing oncogene/tumor Ag expression by noninvasive imaging is of great interest for understanding processes of tumor development and therapy. We established transgenic (Tg) mice conditionally expressing a fusion protein of the SV40 large T Ag and luciferase (TagLuc) that allows monitoring of oncogene/tumor Ag expression by bioluminescent imaging upon Cre recombinase-mediated activation. Independent of Cre-mediated recombination, the TagLuc gene was expressed at low levels in different tissues, probably due to the leakiness of the stop cassette. The level of spontaneous TagLuc expression, detected by bioluminescent imaging, varied between the different Tg lines, depended on the nature of the Tg expression cassette, and correlated with Tag-specific CTL tolerance. Following liver-specific Cre-loxP site-mediated excision of the stop cassette that separated the promoter from the TagLuc fusion gene, hepatocellular carcinoma development was visualized. The ubiquitous low level TagLuc expression caused the failure of transferred effector T cells to reject Tag-expressing tumors rather than causing graft-versus-host disease. This model may be useful to study different levels of tolerance, monitor tumor development at an early stage, and rapidly visualize the efficacy of therapeutic intervention versus potential side effects of low-level Ag expression in normal tissues.

Oral or parenteral administration of replication-deficient adenoviruses expressing the measles virus haemagglutinin and fusion proteins: protective immune responses in rodents.

PubMed

Fooks, A R; Jeevarajah, D; Lee, J; Warnes, A; Niewiesk, S; ter Meulen, V; Stephenson, J R; Clegg, J C

1998-05-01

The genes encoding the measles virus (MV) haemagglutinin (H) and fusion (F) proteins were placed under the control of the human cytomegalovirus immediate early promoter in a replication-deficient adenovirus vector. Immunofluorescence and radioimmune precipitation demonstrated the synthesis of each protein and biological activity was confirmed by the detection of haemadsorption and fusion activities in infected cells. Oral as well as parenteral administration of the H-expressing recombinant adenovirus elicited a significant protective response in mice challenged with MV. While the F-expressing adenovirus failed to protect mice, cotton rats immunized with either the H- or F-expressing recombinant showed reduced MV replication in the lungs. Antibodies elicited in mice following immunization with either recombinant had no in vitro neutralizing activity, suggesting a protective mechanism involving a cell-mediated immune response. This study demonstrates the feasibility of using oral administration of adenovirus recombinants to induce protective responses to heterologous proteins.

Fusions between green fluorescent protein and beta-glucuronidase as sensitive and vital bifunctional reporters in plants.

PubMed

Quaedvlieg, N E; Schlaman, H R; Admiraal, P C; Wijting, S E; Stougaard, J; Spaink, H P

1998-07-01

By fusing the genes encoding green fluorescent protein (GFP) and beta-glucuronidase (GUS) we have created a set of bifunctional reporter constructs which are optimized for use in transient and stable expression studies in plants. This approach makes it possible to combine the advantage of GUS, its high sensitivity in histochemical staining, with the advantages of GFP as a vital marker. The fusion proteins were functional in transient expression studies in tobacco using either DNA bombardment or potato virus X as a vector, and in stably transformed Arabidopsis thaliana and Lotus japonicus plants. The results show that high level of expression does not interfere with efficient stable transformation in A. thaliana and L. japonicus. Using confocal laser scanning microscopy we show that the fusion constructs are very suitable for promoter expression studies in all organs of living plants, including root nodules. The use of these reporter constructs in the model legume L. japonicus offers exciting new possibilities for the study of the root nodulation process.

Fusions between green fluorescent protein and beta-glucuronidase as sensitive and vital bifunctional reporters in plants.

PubMed

Quaedvlieg, N E; Schlaman, H R; Admiraal, P C; Wijting, S E; Stougaard, J; Spaink, H P

1998-11-01

By fusing the genes encoding green fluorescent protein (GFP) and beta-glucuronidase (GUS) we have created a set of bifunctional reporter constructs which are optimized for use in transient and stable expression studies in plants. This approach makes it possible to combine the advantage of GUS, its high sensitivity in histochemical staining, with the advantages of GFP as a vital marker. The fusion proteins were functional in transient expression studies in tobacco using either DNA bombardment or potato virus X as a vector, and in stably transformed Arabidopsis thaliana and Lotus japonicus plants. The results show that high level of expression does not interfere with efficient stable transformation in A. thaliana and L. japonicus. Using confocal laser scanning microscopy we show that the fusion constructs are very suitable for promoter expression studies in all organs of living plants, including root nodules. The use of these reporter constructs in the model legume L. japonicus offers exciting new possibilities for the study of the root nodulation process.

In vivo interference with AtTCP20 function induces severe plant growth alterations and deregulates the expression of many genes important for development.

PubMed

Hervé, Christine; Dabos, Patrick; Bardet, Claude; Jauneau, Alain; Auriac, Marie Christine; Ramboer, Agnès; Lacout, Fabrice; Tremousaygue, Dominique

2009-03-01

AtTCP20 is a transcription factor belonging to the Arabidopsis (Arabidopsis thaliana) TCP-P subfamily, characterized by its capacity to bind to site II motifs (TGGGCY). Our aim was to understand the role of AtTCP20 in plant development. The expression pattern of a translational fusion of Prom(TCP20):CDS20GUSGFP suggested a function for AtTCP20 in several plant organs and stages of development. The role of AtTCP20 was challenged in planta by inducing expression of AtTCP20 proteins fused with either a transcriptional activator domain (VP16) or a repressor domain (EAR). Expression of both modified proteins led to severe developmental phenotypes. In-depth analysis suggested that AtTCP20 may participate in the regulation of cell expansion, cell division, and cell differentiation. Gene expression profiling in roots and hypocotyls revealed that 252 genes were down-regulated in both organs after induction of the AtTCP20EAR repressor gene. Site II motifs (TGGGCY) were underrepresented in their promoters. Conversely, GG(A/T)CCC sequences related to binding sites identified for TCP proteins in rice (Oryza sativa) were overrepresented, and a TCP20 fusion protein was shown to bind to these sequences in vitro. Gene ontology indicated that many targeted genes were involved in cell wall biogenesis and modification during expansion and also encoded numerous transcription factors controlling plant development. Our results are consistent with the previous proposal that AtTCP20 is involved in cell division and growth coordination. Moreover, they further suggest that AtTCP20 also contributes to cell expansion control and indicate a different involvement of this protein in plant morphogenesis depending on the organ and the developmental stage.

Expression Patterns Conferred by Tyrosine/Dihydroxyphenylalanine Decarboxylase Promoters from Opium Poppy Are Conserved in Transgenic Tobacco1

PubMed Central

Facchini, Peter J.; Penzes-Yost, Catherine; Samanani, Nailish; Kowalchuk, Brett

1998-01-01

Opium poppy (Papaver somniferum) contains a large family of tyrosine/dihydroxyphenylalanine decarboxylase (tydc) genes involved in the biosynthesis of benzylisoquinoline alkaloids and cell wall-bound hydroxycinnamic acid amides. Eight members from two distinct gene subfamilies have been isolated, tydc1, tydc4, tydc6, tydc8, and tydc9 in one group and tydc2, tydc3, and tydc7 in the other. The tydc8 and tydc9 genes were located 3.2 kb apart on one genomic clone, suggesting that the family is clustered. Transcripts for most tydc genes were detected only in roots. Only tydc2 and tydc7 revealed expression in both roots and shoots, and TYDC3 mRNAs were the only specific transcripts detected in seedlings. TYDC1, TYDC8, and TYDC9 mRNAs, which occurred in roots, were not detected in elicitor-treated opium poppy cultures. Expression of tydc4, which contains a premature termination codon, was not detected under any conditions. Five tydc promoters were fused to the β-glucuronidase (GUS) reporter gene in a binary vector. All constructs produced transient GUS activity in microprojectile-bombarded opium poppy and tobacco (Nicotiana tabacum) cell cultures. The organ- and tissue-specific expression pattern of tydc promoter-GUS fusions in transgenic tobacco was generally parallel to that of corresponding tydc genes in opium poppy. GUS expression was most abundant in the internal phloem of shoot organs and in the stele of roots. Select tydc promoter-GUS fusions were also wound induced in transgenic tobacco, suggesting that the basic mechanisms of developmental and inducible tydc regulation are conserved across plant species. PMID:9733527

Prostate cancer risk regions at 8q24 and 17q24 are differentially associated with somatic TMPRSS2:ERG fusion status

PubMed Central

Luedeke, Manuel; Rinckleb, Antje E.; FitzGerald, Liesel M.; Geybels, Milan S.; Schleutker, Johanna; Eeles, Rosalind A.; Teixeira, Manuel R.; Cannon-Albright, Lisa; Ostrander, Elaine A.; Weikert, Steffen; Herkommer, Kathleen; Wahlfors, Tiina; Visakorpi, Tapio; Leinonen, Katri A.; Tammela, Teuvo L.J.; Cooper, Colin S.; Kote-Jarai, Zsofia; Edwards, Sandra; Goh, Chee L.; McCarthy, Frank; Parker, Chris; Flohr, Penny; Paulo, Paula; Jerónimo, Carmen; Henrique, Rui; Krause, Hans; Wach, Sven; Lieb, Verena; Rau, Tilman T.; Vogel, Walther; Kuefer, Rainer; Hofer, Matthias D.; Perner, Sven; Rubin, Mark A.; Agarwal, Archana M.; Easton, Doug F.; Al Olama, Ali Amin; Benlloch, Sara; Hoegel, Josef; Stanford, Janet L.

2016-01-01

Abstract Molecular and epidemiological differences have been described between TMPRSS2:ERG fusion-positive and fusion-negative prostate cancer (PrCa). Assuming two molecularly distinct subtypes, we have examined 27 common PrCa risk variants, previously identified in genome-wide association studies, for subtype specific associations in a total of 1221 TMPRSS2:ERG phenotyped PrCa cases. In meta-analyses of a discovery set of 552 cases with TMPRSS2:ERG data and 7650 unaffected men from five centers we have found support for the hypothesis that several common risk variants are associated with one particular subtype rather than with PrCa in general. Risk variants were analyzed in case-case comparisons (296 TMPRSS2:ERG fusion-positive versus 256 fusion-negative cases) and an independent set of 669 cases with TMPRSS2:ERG data was established to replicate the top five candidates. Significant differences (P < 0.00185) between the two subtypes were observed for rs16901979 (8q24) and rs1859962 (17q24), which were enriched in TMPRSS2:ERG fusion-negative (OR = 0.53, P = 0.0007) and TMPRSS2:ERG fusion-positive PrCa (OR = 1.30, P = 0.0016), respectively. Expression quantitative trait locus analysis was performed to investigate mechanistic links between risk variants, fusion status and target gene mRNA levels. For rs1859962 at 17q24, genotype dependent expression was observed for the candidate target gene SOX9 in TMPRSS2:ERG fusion-positive PrCa, which was not evident in TMPRSS2:ERG negative tumors. The present study established evidence for the first two common PrCa risk variants differentially associated with TMPRSS2:ERG fusion status. TMPRSS2:ERG phenotyping of larger studies is required to determine comprehensive sets of variants with subtype-specific roles in PrCa. PMID:27798103

Activation of a Development-Specific Gene, dofA, by FruA, an Essential Transcription Factor for Development of Myxococcus xanthus

PubMed Central

Ueki, Toshiyuki; Inouye, Sumiko

2005-01-01

FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development. PMID:16321956

Tumor-targeted inhibition by a novel strategy - mimoretrovirus expressing siRNA targeting the Pokemon gene.

PubMed

Tian, Zhiqiang; Wang, Huaizhi; Jia, Zhengcai; Shi, Jinglei; Tang, Jun; Mao, Liwei; Liu, Hongli; Deng, Yijing; He, Yangdong; Ruan, Zhihua; Li, Jintao; Wu, Yuzhang; Ni, Bing

2010-12-01

Pokemon gene has crucial but versatile functions in cell differentiation, proliferation and tumorigenesis. It is a master regulator of the ARF-HDM2-p53 and Rb-E2F pathways. The facts that the expression of Pokemon is essential for tumor formation and many kinds of tumors over-express the Pokemon gene make it an attractive target for therapeutic intervention for cancer treatment. In this study, we used an RNAi strategy to silence the Pokemon gene in a cervical cancer model. To address the issues involving tumor specific delivery and durable expression of siRNA, we applied the Arg-Gly-Asp (RGD) peptide ligand and polylysine (K(18)) fusion peptide to encapsulate a recombinant retrovirus plasmid expressing a siRNA targeting the Pokemon gene and produced the 'mimoretrovirus'. At charge ratio 2.0 of fusion peptide/plasmid, the mimoretrovirus formed stable and homogenous nanoparticles, and provided complete DNase I protection and complete gel retardation. This nanoparticle inhibited SiHa cell proliferation and invasion, while it promoted SiHa cell apoptosis. The binding of the nanoparticle to SiHa cells was mediated via the RGD-integrin α(v)β(3) interaction, as evidenced by the finding that unconjugated RGD peptide inhibited this binding significantly. This tumor-targeting mimoretrovirus exhibited excellent anti-tumor capacity in vivo in a nude mouse model. Moreover, the mimoretrovirus inhibited tumor growth with a much higher efficiency than recombinant retrovirus expressing siRNA or the K(18)/P4 nanoparticle lacking the RGD peptide. Results suggest that the RNAi/RGD-based mimoretrovirus developed in this study represents a novel anti-tumor strategy that may be applicable to most research involving cancer therapy and, thus, has promising potential as a cervical cancer treatment.

Overproduction of Geranylgeraniol by Metabolically Engineered Saccharomyces cerevisiae▿

PubMed Central

Tokuhiro, Kenro; Muramatsu, Masayoshi; Ohto, Chikara; Kawaguchi, Toshiya; Obata, Shusei; Muramoto, Nobuhiko; Hirai, Masana; Takahashi, Haruo; Kondo, Akihiko; Sakuradani, Eiji; Shimizu, Sakayu

2009-01-01

(E, E, E)-Geranylgeraniol (GGOH) is a valuable starting material for perfumes and pharmaceutical products. In the yeast Saccharomyces cerevisiae, GGOH is synthesized from the end products of the mevalonate pathway through the sequential reactions of farnesyl diphosphate synthetase (encoded by the ERG20 gene), geranylgeranyl diphosphate synthase (the BTS1 gene), and some endogenous phosphatases. We demonstrated that overexpression of the diacylglycerol diphosphate phosphatase (DPP1) gene could promote GGOH production. We also found that overexpression of a BTS1-DPP1 fusion gene was more efficient for producing GGOH than coexpression of these genes separately. Overexpression of the hydroxymethylglutaryl-coenzyme A reductase (HMG1) gene, which encodes the major rate-limiting enzyme of the mevalonate pathway, resulted in overproduction of squalene (191.9 mg liter−1) rather than GGOH (0.2 mg liter−1) in test tube cultures. Coexpression of the BTS1-DPP1 fusion gene along with the HMG1 gene partially redirected the metabolic flux from squalene to GGOH. Additional expression of a BTS1-ERG20 fusion gene resulted in an almost complete shift of the flux to GGOH production (228.8 mg liter−1 GGOH and 6.5 mg liter−1 squalene). Finally, we constructed a diploid prototrophic strain coexpressing the HMG1, BTS1-DPP1, and BTS1-ERG20 genes from multicopy integration vectors. This strain attained 3.31 g liter−1 GGOH production in a 10-liter jar fermentor with gradual feeding of a mixed glucose and ethanol solution. The use of bifunctional fusion genes such as the BTS1-DPP1 and ERG20-BTS1 genes that code sequential enzymes in the metabolic pathway was an effective method for metabolic engineering. PMID:19592534

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ono, Kenji; Fuma, Kazuya; Tabata, Kaori

Magnetic resonance imaging (MRI) is a minimally invasive way to provide high spatial resolution tomograms. However, MRI has been considered to be useless for gene expression imaging compared to optical imaging. In this study, we used a ferritin reporter, binding with biogenic iron, to make it a powerful tool for gene expression imaging in MRI studies. GL261 mouse glioma cells were over-expressed with dual-reporter ferritin-DsRed under {beta}-actin promoter, then gene expression was observed by optical imaging and MRI in a brain tumor model. GL261 cells expressing ferritin-DsRed fusion protein showed enhanced visualizing effect by reducing T2-weighted signal intensity for inmore » vitro and in vivo MRI studies, as well as DsRed fluorescence for optical imaging. Furthermore, a higher contrast was achieved on T2-weighted images when permeating the plasma membrane of ferritin-DsRed-expressing GL261. Thus, a ferritin expression vector can be used as an MRI reporter to monitor in vivo gene expression.« less

Generation of a Tet-On Expression System to Study Transactivation Ability of Tax-2.

PubMed

Bignami, Fabio; Sozzi, Riccardo Alessio; Pilotti, Elisabetta

2017-01-01

HTLV Tax proteins (Tax-1 and Tax-2) are known to be able to transactivate several host cellular genes involved in complex molecular pathways. Here, we describe a stable and regulated high-level expression model based on Tet-On system, to study the capacity of Tax-2 to transactivate host genes. In particular, the Jurkat Tet-On cell line suitable for evaluating the ability of Tax-2 to stimulate transactivation of a specific host gene, CCL3L1 (C-C motif chemokine ligand 3 like 1 gene), was selected. Then, a plasmid expressing tax-2 gene under control of a tetracycline-response element was constructed. To avoid the production of a fusion protein between the report gene and the inserted gene, a bidirectional plasmid was designed. Maximum expression and fast response time were achieved by using nucleofection technology as transfection method. After developing an optimized protocol for efficiently transferring tax-2 gene in Jurkat Tet-On cellular model and exposing transfected cells to Dox (doxycycline, a tetracycline derivate), a kinetics of tax-2 expression through TaqMan Real-time PCR assay was determined.

Expression of a synthetic gene encoding human insulin-like growth factor I in cultured mouse fibroblasts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bayne, M.L.; Cascieri, M.A.; Kelder, B.

1987-05-01

A synthetic gene encoding human insulin-like growth factor I (hIGF-I) was assembled and inserted into an expression vector containing the cytomegalovirus immediate early (CMV-IE) transcriptional regulatory region and portions of the bovine growth hormone gene. The recombinant plasmid encodes a 97 amino acid fusion protein containing the first 27 amino acids of the bovine growth hormone precursor and the 70 amino acids of hIGF-I. This plasmid, when transiently introduced into cultured mouse fibroblasts, directs synthesis of the fusion protein, subsequent proteolytic removal of the bovine growth hormone signal peptide, and secretion of hIGF-I into the culture medium. Conditioned medium frommore » transfected cells inhibits binding of /sup 125/I-labeled IGF-I to type I IGF receptors on human placental membranes and to acid-stable human serum carrier proteins. The recombinant hIGF-I produced is biologically active, as monitored by the stimulation of DNA synthesis in vascular smooth muscle cells.« less

Nuclear envelope breakdown induced by herpes simplex virus type 1 involves the activity of viral fusion proteins.

PubMed

Maric, Martina; Haugo, Alison C; Dauer, William; Johnson, David; Roller, Richard J

2014-07-01

Herpesvirus infection reorganizes components of the nuclear lamina usually without loss of integrity of the nuclear membranes. We report that wild-type HSV infection can cause dissolution of the nuclear envelope in transformed mouse embryonic fibroblasts that do not express torsinA. Nuclear envelope breakdown is accompanied by an eight-fold inhibition of virus replication. Breakdown of the membrane is much more limited during infection with viruses that lack the gB and gH genes, suggesting that breakdown involves factors that promote fusion at the nuclear membrane. Nuclear envelope breakdown is also inhibited during infection with virus that does not express UL34, but is enhanced when the US3 gene is deleted, suggesting that envelope breakdown may be enhanced by nuclear lamina disruption. Nuclear envelope breakdown cannot compensate for deletion of the UL34 gene suggesting that mixing of nuclear and cytoplasmic contents is insufficient to bypass loss of the normal nuclear egress pathway. Copyright © 2014 Elsevier Inc. All rights reserved.

A strategy for targeting recombinant proteins to protein storage vacuoles by fusion to Brassica napus napin in napin-depleted seeds.

PubMed

Hegedus, Dwayne D; Baron, Marcus; Labbe, Natalie; Coutu, Cathy; Lydiate, Derek; Lui, Helen; Rozwadowski, Kevin

2014-03-01

Seeds are capable of accumulating high levels of seed storage proteins (SSP), as well as heterologous proteins under certain conditions. Arabidopsis thaliana was used to develop a strategy to deplete seeds of an endogenous SSP and then replenish them with the same protein fused to a heterologous protein. In several other studies, competition with endogenous SSP for space and metabolic resources was shown to affect the accumulation of recombinant proteins in seeds. We used RNAi to reduce the expression of the five napin genes and deplete the seeds of this SSP. Targeting a recombinant protein to a vacuole or structure within the seed where it can be protected from cytosolic proteases can also promote its accumulation. To achieve this, a synthetic Brassica napus napin gene (Bn napin) was designed that was both impervious to the A. thaliana napin (At napin) RNAi construct and permitted fusion to a heterologous protein, in this case green fluorescent protein (GFP). GFP was placed in several strategic locations within Bn napin with consideration to maintaining structure, processing sites and possible vacuolar targeting signals. In transgenic A. thaliana plants, GFP was strongly localized to the seed protein storage vacuole in all Bn napin fusion configurations tested, but not when expressed alone. This SSP depletion-replenishment strategy outlined here would be applicable to expression of recombinant proteins in industrial crops that generally have large repertoires of endogenous SSP genes. Crown Copyright © 2014. Published by Elsevier Inc. All rights reserved.

Production and purification of recombinant human glucagon overexpressed as intein fusion protein in Escherichia coli.

PubMed

Esipov, Roman S; Stepanenko, Vasily N; Gurevich, Alexandr I; Chupova, Larisa A; Miroshnikov, Anatoly I

2006-01-01

Chemico-enzymatic synthesis and cloning in Esherichia coli of an artificial gene coding human glucagon was performed. Recombinant plasmid containing hybrid glucagons gene and intein Ssp dnaB from Synechocestis sp. was designed. Expression of the obtained hybrid gene in E. coli, properties of the formed hybrid protein, and conditions of its autocatalytic cleavage leading to glucagon formation were studied.

In vivo processing and release into the circulation of GFP fusion protein in arginine vasopressin enhanced GFP transgenic rats: response to osmotic stimulation.

PubMed

Satoh, Keita; Oti, Takumi; Katoh, Akiko; Ueta, Yoichi; Morris, John F; Sakamoto, Tatsuya; Sakamoto, Hirotaka

2015-07-01

Arginine vasopressin (AVP) is a neurohypophysial hormone synthesized as a part of a prepropeptide precursor containing the signal peptide, AVP hormone, AVP-associated neurophysin II and copeptin in the hypothalamic neurosecretory neurons. A transgenic (Tg) rat line expressing the AVP-eGFP fusion gene has been generated. To establish the AVP-eGFP Tg rat as a unique model for an analysis of AVP dynamics in vivo, we first examined the in vivo molecular dynamics of the AVP-eGFP fusion gene, and then the release of GFP in response to physiological stimuli. Double immunoelectron microscopy demonstrated that GFP was specifically localized in neurosecretory vesicles of AVP neurons in this Tg rat. After stimulation of the posterior pituitary with high potassium we demonstrated the exocytosis of AVP neurosecretory vesicles containing GFP at the ultrastructural level. Biochemical analyses indicated that the AVP-eGFP fusion gene is subjected to in vivo post-translational modifications like the native AVP gene, and is packaged into neurosecretory vesicles as a fusion protein: copeptin1-14 -GFP. Moreover, GFP release into the circulating blood appeared to be augmented after osmotic stimulation, like native AVP. Thus, here we show for the first time the in vivo molecular processing of the AVP-eGFP fusion gene and stimulated secretion after osmotic stimulation in rats. Because GFP behaved like native AVP in the hypothalamo-pituitary axis, and in particular was released into the circulation in response to a physiological stimulus, the AVP-eGFP Tg rat model appears to be a powerful tool for analyzing neuroendocrine systems at the organismal level. © 2015 FEBS.

In vivo engineering of oncogenic chromosomal rearrangements with the CRISPR/Cas9 system

PubMed Central

Maddalo, Danilo; Manchado, Eusebio; Concepcion, Carla P.; Bonetti, Ciro; Vidigal, Joana A.; Han, Yoon-Chi; Ogrodowski, Paul; Crippa, Alessandra; Rekhtman, Natasha; de Stanchina, Elisa; Lowe, Scott W.; Ventura, Andrea

2014-01-01

Chromosomal rearrangements play a central role in the pathogenesis of human cancers and often result in the expression of therapeutically actionable gene fusions1. A recently discovered example is a fusion between the Echinoderm Microtubule-associated Protein-like 4 (EML4) and the Anaplastic Lymphoma Kinase (ALK) genes, generated by an inversion on the short arm of chromosome 2: inv(2)(p21p23). The EML4-ALK oncogene is detected in a subset of human non-small cell lung cancers (NSCLC)2 and is clinically relevant because it confers sensitivity to ALK inhibitors3. Despite their importance, modeling such genetic events in mice has proven challenging and requires complex manipulation of the germline. Here we describe an efficient method to induce specific chromosomal rearrangements in vivo using viral-mediated delivery of the CRISPR/Cas9 system to somatic cells of adult animals. We apply it to generate a mouse model of Eml4-Alk-driven lung cancer. The resulting tumors invariably harbor the Eml4-Alkinversion, express the Eml4-Alk fusion gene, display histo-pathologic and molecular features typical of ALK+ human NSCLCs, and respond to treatment with ALK-inhibitors. The general strategy described here substantially expands our ability to model human cancers in mice and potentially in other organisms. PMID:25337876

Evaluation of an FRDA-EGFP genomic reporter assay in transgenic mice.

PubMed

Sarsero, Joseph P; Holloway, Timothy P; Li, Lingli; McLenachan, Samuel; Fowler, Kerry J; Bertoncello, Ivan; Voullaire, Lucille; Gazeas, Sophie; Ioannou, Panos A

2005-04-01

Friedreich ataxia is an autosomal recessive neurodegenerative disorder caused by a GAA trinucleotide expansion in the first intron of the Friedreich ataxia gene (FRDA) that causes reduced synthesis of frataxin, a mitochondrial protein likely to be involved in biosynthesis of iron-sulfur clusters. This leads to increased oxidative stress, progressive loss of large sensory neurons, and hypertrophic cardiomyopathy. To elucidate the mechanisms regulating FRDA expression and to develop an in vivo assay for agents that might upregulate FRDA expression in a therapeutically relevant manner, we have generated transgenic mice with a BAC genomic reporter construct consisting of an in-frame fusion between FRDA and the gene coding for enhanced green fluorescent protein (EGFP). Production of full-length frataxin-EGFP fusion protein was demonstrated by immunoblotting. EGFP expression was observed as early as day E3.5 of development. Most tissues of adult transgenic mice were fluorescent. The level of FRDA-EGFP expression in peripheral blood, bone marrow, and cells obtained from enzymatically disaggregated tissues was quantitated by flow cytometry. There was a twofold increase in EGFP expression in mice homozygous for the transgene when compared to hemizygous mice. These transgenic mice are a valuable tool for the examination of spatial and temporal aspects of FRDA gene expression and for the preclinical evaluation of pharmacological inducers of FRDA expression in a whole-animal model. In addition, tissues from these mice should also be valuable for stem cell transplantation studies.

In vivo characterization of a reporter gene system for imaging hypoxia-induced gene expression.

PubMed

Carlin, Sean; Pugachev, Andrei; Sun, Xiaorong; Burke, Sean; Claus, Filip; O'Donoghue, Joseph; Ling, C Clifton; Humm, John L

2009-10-01

To characterize a tumor model containing a hypoxia-inducible reporter gene and to demonstrate utility by comparison of reporter gene expression to the uptake and distribution of the hypoxia tracer (18)F-fluoromisonidazole ((18)F-FMISO). Three tumors derived from the rat prostate cancer cell line R3327-AT were grown in each of two rats as follows: (1) parental R3327-AT, (2) positive control R3327-AT/PC in which the HSV1-tkeGFP fusion reporter gene was expressed constitutively, (3) R3327-AT/HRE in which the reporter gene was placed under the control of a hypoxia-inducible factor-responsive promoter sequence (HRE). Animals were coadministered a hypoxia-specific marker (pimonidazole) and the reporter gene probe (124)I-2'-fluoro-2'-deoxy-1-beta-d-arabinofuranosyl-5-iodouracil ((124)I-FIAU) 3 h prior to sacrifice. Statistical analysis of the spatial association between (124)I-FIAU uptake and pimonidazole fluorescent staining intensity was then performed on a pixel-by-pixel basis. Utility of this system was demonstrated by assessment of reporter gene expression versus the exogenous hypoxia probe (18)F-FMISO. Two rats, each bearing a single R3327-AT/HRE tumor, were injected with (124)I-FIAU (3 h before sacrifice) and (18)F-FMISO (2 h before sacrifice). Statistical analysis of the spatial association between (18)F-FMISO and (124)I-FIAU on a pixel-by-pixel basis was performed. Correlation coefficients between (124)I-FIAU uptake and pimonidazole staining intensity were: 0.11 in R3327-AT tumors, -0.66 in R3327-AT/PC and 0.76 in R3327-AT/HRE, confirming that only in the R3327-AT/HRE tumor was HSV1-tkeGFP gene expression associated with hypoxia. Correlation coefficients between (18)F-FMISO and (124)I-FIAU uptakes in R3327-AT/HRE tumors were r=0.56, demonstrating good spatial correspondence between the two tracers. We have confirmed hypoxia-specific expression of the HSV1-tkeGFP fusion gene in the R3327-AT/HRE tumor model and demonstrated the utility of this model for the evaluation of radiolabeled hypoxia tracers.

DNAJB1–PRKACA fusion kinase interacts with β-catenin and the liver regenerative response to drive fibrolamellar hepatocellular carcinoma

PubMed Central

Kastenhuber, Edward R.; Lalazar, Gadi; Houlihan, Shauna L.; Tschaharganeh, Darjus F.; Baslan, Timour; Chen, Chi-Chao; Requena, David; Tian, Sha; Bosbach, Benedikt; Wilkinson, John E.; Simon, Sanford M.; Lowe, Scott W.

2017-01-01

A segmental deletion resulting in DNAJB1–PRKACA gene fusion is now recognized as the signature genetic event of fibrolamellar hepatocellular carcinoma (FL-HCC), a rare but lethal liver cancer that primarily affects adolescents and young adults. Here we implement CRISPR-Cas9 genome editing and transposon-mediated somatic gene transfer to demonstrate that expression of either the endogenous fusion protein or a chimeric cDNA leads to the formation of indolent liver tumors in mice that closely resemble human FL-HCC. Notably, overexpression of the wild-type PRKACA was unable to fully recapitulate the oncogenic activity of DNAJB1–PRKACA, implying that FL-HCC does not simply result from enhanced PRKACA expression. Tumorigenesis was significantly enhanced by genetic activation of β-catenin, an observation supported by evidence of recurrent Wnt pathway mutations in human FL-HCC, as well as treatment with the hepatotoxin 3,5-diethoxycarbonyl-1,4-dihydrocollidine, which causes tissue injury, inflammation, and fibrosis. Our study validates the DNAJB1–PRKACA fusion kinase as an oncogenic driver and candidate drug target for FL-HCC, and establishes a practical model for preclinical studies to identify strategies to treat this disease. PMID:29162699

An Abundant Evolutionarily Conserved CSB-PiggyBac Fusion Protein Expressed in Cockayne Syndrome

PubMed Central

Newman, John C.; Bailey, Arnold D.; Fan, Hua-Ying; Pavelitz, Thomas; Weiner, Alan M.

2008-01-01

Cockayne syndrome (CS) is a devastating progeria most often caused by mutations in the CSB gene encoding a SWI/SNF family chromatin remodeling protein. Although all CSB mutations that cause CS are recessive, the complete absence of CSB protein does not cause CS. In addition, most CSB mutations are located beyond exon 5 and are thought to generate only C-terminally truncated protein fragments. We now show that a domesticated PiggyBac-like transposon PGBD3, residing within intron 5 of the CSB gene, functions as an alternative 3′ terminal exon. The alternatively spliced mRNA encodes a novel chimeric protein in which CSB exons 1–5 are joined in frame to the PiggyBac transposase. The resulting CSB-transposase fusion protein is as abundant as CSB protein itself in a variety of human cell lines, and continues to be expressed by primary CS cells in which functional CSB is lost due to mutations beyond exon 5. The CSB-transposase fusion protein has been highly conserved for at least 43 Myr since the divergence of humans and marmoset, and appears to be subject to selective pressure. The human genome contains over 600 nonautonomous PGBD3-related MER85 elements that were dispersed when the PGBD3 transposase was last active at least 37 Mya. Many of these MER85 elements are associated with genes which are involved in neuronal development, and are known to be regulated by CSB. We speculate that the CSB-transposase fusion protein has been conserved for host antitransposon defense, or to modulate gene regulation by MER85 elements, but may cause CS in the absence of functional CSB protein. PMID:18369450

Active inhibition of herpes simplex virus type 1-induced cell fusion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bzik, D.J.; Person, S.; Read, G.S.

1982-01-01

Previous studies have demonstrated that syn mutant-infected cells fuse less well with nonsyncytial virus-infected cells than with uninfected cells, a phenomenon defined as function inhibition. The present study characterizes the kinetics as well as the requirements for expression of fusion inhibition. Initially, the capacity of sparse syn mutant-infected cells to fuse with uninfected surrounding cells was determined throughout infection. Of seven syn mutants examined, including representatives with alterations in two different viral genes that affect cell fusion, all showed an increase in fusion capacity up to 12 hr after infection and a decrease at later times. Fusion inhibition was examinedmore » in experiments employing sparse syn20-infected cells which had been incubated to a maximum fusion capacity; it was shown that surrounding cells infected with KOS, the parent of syn20, began to inhibit fusion by the syn20-infected cells at about 4 hr after infection, and that the maximum ability to inhibit fusion was attained at about 6 hr after infection. The metabolic blocking agents actinomycin D (RNA), cycloheximide (protein), 2-deoxyglucose, and tunicamycin (glycoslyation of glycoproteins) all showed the ability to inhibit the expression of fusion inhibition by KOS-infected cells if added shortly after infection. It is concluded that fusion inhibition is an active process that requires the synthesis of RNA, proteins, and glycoproteins. 17 references, 3 figures, 2 tables.« less

Moult-inhibiting fusion protein augments while polyclonal antisera attenuate moult stages and duration in Penaeus monodon.

PubMed

Vrinda, S; Jasmin, C; Sivakumar, K C; Jose, Blessy; Philip, Rosamma; Bright Singh, I S

2016-07-01

Moulting in crustaceans is regulated by moult-inhibiting hormone (MIH) of the CHH family neuropeptides. The inhibitory functions of MIH have pivotal roles in growth and reproduction of Penaeus monodon. In this study, we report the expression of a thioredoxin-fused mature MIH I protein (mf-PmMIH I) of P. monodon in a bacterial system and its use as antigen to raise polyclonal antiserum (anti-mf-PmMIH I). The mature MIH I gene of 231bp, that codes for 77 amino acids, was cloned into the Escherichia coli thioredoxin gene fusion expression system. The translation expression vector construct (mf-PmMIH I+pET32a+) upon induction produced 29.85kDa mature MIH I fusion protein (mf-PmMIH I). The purified fusion protein was used as exogenous MIH I and as antigen to raise polyclonal antisera. When fusion protein (mf-PmMIH I) was injected into D2 and D3 stages of juvenile shrimp, the moult cycle duration was extended significantly to 16.67±1.03 and 14.67±1.03days respectively compared to that of 11.67±1.03days in controls. Moult duration was further reduced to 8.33±0.82days when polyclonal antiserum (anti-mf-PmMIH I - 1:500 dilutions) was injected. Anti-mf-PmMIH I immunolocalized MIH I producing neurosecretory cells in the eyestalk of P. monodon. In short, the present manuscript reports an innovative means of moult regulation in P. monodon with thioredoxin fused MIH I and antisera developed. Copyright © 2016 Elsevier Inc. All rights reserved.

A multipurpose fusion tag derived from an unstructured and hyperacidic region of the amyloid precursor protein

PubMed Central

Sangawa, Takeshi; Tabata, Sanae; Suzuki, Kei; Saheki, Yasushi; Tanaka, Keiji; Takagi, Junichi

2013-01-01

Expression and purification of aggregation-prone and disulfide-containing proteins in Escherichia coli remains as a major hurdle for structural and functional analyses of high-value target proteins. Here, we present a novel gene-fusion strategy that greatly simplifies purification and refolding procedure at very low cost using a unique hyperacidic module derived from the human amyloid precursor protein. Fusion with this polypeptide (dubbed FATT for Flag-Acidic-Target Tag) results in near-complete soluble expression of variety of extracellular proteins, which can be directly refolded in the crude bacterial lysate and purified in one-step by anion exchange chromatography. Application of this system enabled preparation of functionally active extracellular enzymes and antibody fragments without the need for condition optimization. PMID:23526492

CRISPR/Cas9 Engineering of Adult Mouse Liver Demonstrates That the Dnajb1-Prkaca Gene Fusion Is Sufficient to Induce Tumors Resembling Fibrolamellar Hepatocellular Carcinoma.

PubMed

Engelholm, Lars H; Riaz, Anjum; Serra, Denise; Dagnæs-Hansen, Frederik; Johansen, Jens V; Santoni-Rugiu, Eric; Hansen, Steen H; Niola, Francesco; Frödin, Morten

2017-12-01

Fibrolamellar hepatocellular carcinoma (FL-HCC) is a primary liver cancer that predominantly affects children and young adults with no underlying liver disease. A somatic, 400 Kb deletion on chromosome 19 that fuses part of the DnaJ heat shock protein family (Hsp40) member B1 gene (DNAJB1) to the protein kinase cAMP-activated catalytic subunit alpha gene (PRKACA) has been repeatedly identified in patients with FL-HCC. However, the DNAJB1-PRKACA gene fusion has not been shown to induce liver tumorigenesis. We used the CRISPR/Cas9 technique to delete in mice the syntenic region on chromosome 8 to create a Dnajb1-Prkaca fusion and monitored the mice for liver tumor development. We delivered CRISPR/Cas9 vectors designed to juxtapose exon 1 of Dnajb1 with exon 2 of Prkaca to create the Dnajb1-Prkaca gene fusion associated with FL-HCC, or control Cas9 vector, via hydrodynamic tail vein injection to livers of 8-week-old female FVB/N mice. These mice did not have any other engineered genetic alterations and were not exposed to liver toxins or carcinogens. Liver tissues were collected 14 months after delivery; genomic DNA was analyzed by PCR to detect the Dnajb1-Prkaca fusion, and tissues were characterized by histology, immunohistochemistry, RNA sequencing, and whole-exome sequencing. Livers from 12 of the 15 mice given the vectors to induce the Dnajb1-Prkaca gene fusion, but none of the 11 mice given the control vector, developed neoplasms. The tumors contained the Dnajb1-Prkaca gene fusion and had histologic and cytologic features of human FL-HCCs: large polygonal cells with granular, eosinophilic, and mitochondria-rich cytoplasm, prominent nucleoli, and markers of hepatocytes and cholangiocytes. In comparing expression levels of genes between the mouse tumor and non-tumor liver cells, we identified changes similar to those detected in human FL-HCC, which included genes that affect cell cycle and mitosis regulation. Genomic analysis of mouse neoplasms induced by the Dnajb1-Prkaca fusion revealed a lack of mutations in genes commonly associated with liver cancers, as observed in human FL-HCC. Using CRISPR/Cas9 technology, we found generation of the Dnajb1-Prkaca fusion gene in wild-type mice to be sufficient to initiate formation of tumors that have many features of human FL-HCC. Strategies to block DNAJB1-PRKACA might be developed as therapeutics for this form of liver cancer. Copyright © 2017 AGA Institute. Published by Elsevier Inc. All rights reserved.

Generation of HIV-1 based bi-cistronic lentiviral vectors for stable gene expression and live cell imaging.

PubMed

Sehgal, Lalit; Budnar, Srikanth; Bhatt, Khyati; Sansare, Sneha; Mukhopadhaya, Amitabha; Kalraiya, Rajiv D; Dalal, Sorab N

2012-10-01

The study of protein-protein interactions, protein localization, protein organization into higher order structures and organelle dynamics in live cells, has greatly enhanced the understanding of various cellular processes. Live cell imaging experiments employ plasmid or viral vectors to express the protein/proteins of interest fused to a fluorescent protein. Unlike plasmid vectors, lentiviral vectors can be introduced into both dividing and non dividing cells, can be pseudotyped to infect a broad or narrow range of cells, and can be used to generate transgenic animals. However, the currently available lentiviral vectors are limited by the choice of fluorescent protein tag, choice of restriction enzyme sites in the Multiple Cloning Sites (MCS) and promoter choice for gene expression. In this report, HIV-1 based bi-cistronic lentiviral vectors have been generated that drive the expression of multiple fluorescent tags (EGFP, mCherry, ECFP, EYFP and dsRed), using two different promoters. The presence of a unique MCS with multiple restriction sites allows the generation of fusion proteins with the fluorescent tag of choice, allowing analysis of multiple fusion proteins in live cell imaging experiments. These novel lentiviral vectors are improved delivery vehicles for gene transfer applications and are important tools for live cell imaging in vivo.

Fine regulation of RhoA and Rock is required for skeletal muscle differentiation.

PubMed

Castellani, Loriana; Salvati, Erica; Alemà, Stefano; Falcone, Germana

2006-06-02

The RhoA GTPase controls a variety of cell functions such as cell motility, cell growth, and gene expression. Previous studies suggested that RhoA mediates signaling inputs that promote skeletal myogenic differentiation. We show here that levels and activity of RhoA protein are down-regulated in both primary avian myoblasts and mouse satellite cells undergoing differentiation, suggesting that a fine regulation of this GTPase is required. In addition, ectopic expression of activated RhoA in primary quail myocytes, but not in mouse myocytes, inhibits accumulation of muscle-specific proteins and cell fusion. By disrupting RhoA signaling with specific inhibitors, we have shown that this GTPase, although required for cell identity in proliferating myoblasts, is not essential for commitment to terminal differentiation and muscle gene expression. Ectopic expression of an activated form of its downstream effector, Rock, impairs differentiation of both avian and mouse myoblasts. Conversely, Rock inhibition with specific inhibitors and small interfering RNA-mediated gene silencing leads to accelerated progression in the lineage and enhanced cell fusion, underscoring a negative regulatory function of Rock in myogenesis. Finally, we have reported that Rock acts independently from RhoA in preventing myoblast exit from the cell cycle and commitment to differentiation and may receive signaling inputs from Raf-1 kinase.

Xcat, a novel mouse model for Nance-Horan syndrome inhibits expression of the cytoplasmic-targeted Nhs1 isoform.

PubMed

Huang, Kristen M; Wu, Junhua; Duncan, Melinda K; Moy, Chris; Dutra, Amalia; Favor, Jack; Da, Tong; Stambolian, Dwight

2006-01-15

Nance-Horan syndrome (NHS) is an X-linked disorder characterized by congenital cataracts, dental anomalies, dysmorphic features and mental retardation. A recent report suggests that the novel gene NHS1 is involved in this disorder due to the presence of point mutations in NHS patients. A possible mouse model for NHS, Xcat, was mapped to a 2.11 Mb interval on the X-chromosome. Sequence and FISH analysis of the X-chromosome region containing the Xcat mutation reveal a large insertion between exons 1 and 2 of the mouse Nhs1 gene. The insertion inhibits the expression of the Nhs1 isoform containing exon 1 and results in exclusive expression of the alternative isoform containing exon 1A. Quantitative RT-PCR of Xcat cDNA shows reduced levels of Nhs1 transcripts. The Nhs1 protein is strongly expressed within the cytoplasm of elongating lens fiber cells from wild-type neonate lens, but is significantly reduced within the Xcat lens. Transient transfection studies of CHO cells with Nhs1-GFP fusion proteins were done to determine whether the amino acids encoded by exon 1 were critical for protein localization. We found the presence of Nhs1 exon 1 critical for localization of the fusion protein to the cytoplasm, whereas fusion proteins lacking Nhs1 exon 1 are predominantly nuclear. These results indicate that the first exon of Nhs1 contains crucial information required for the proper expression and localization of Nhs1 protein. Inhibition of expression of the exon 1 containing isoform results in the abnormal phenotype of Xcat.

Expression of γ-aminobutyric acid ρ1 and ρ1Δ450 as gene fusions with the green fluorescent protein

PubMed Central

Martínez-Torres, Ataúlfo; Miledi, Ricardo

2001-01-01

The functional characteristics and cellular localization of the γaminobutyric acid (GABA) ρ1 receptor and its nonfunctional isoform ρ1Δ450 were investigated by expressing them as gene fusions with the enhanced version of the green fluorescent protein (GFP). Oocytes injected with ρ1-GFP had receptors that gated chloride channels when activated by GABA. The functional characteristics of these receptors were the same as for those of wild-type ρ1 receptors. Fluorescence, because of the chimeric receptors expressed, was over the whole oocyte but was more intense near the cell surface and more abundant in the animal hemisphere. Similar to the wild type, ρ1Δ450-GFP did not lead to the expression of functional GABA receptors, and injected oocytes failed to generate currents even after exposure to high concentrations of GABA. Nonetheless, the fluorescence displayed by oocytes expressing ρ1Δ450-GFP was distributed similarly to that of ρ1-GFP. Mammalian cells transfected with the ρ1-GFP or ρ1Δ450-GFP constructs showed mostly intracellularly distributed fluorescence in confocal microscope images. A sparse localization of fluorescence was observed in the plasma membrane regardless of the cell line used. We conclude that ρ1Δ450 is expressed and transported close to, and perhaps incorporated into, the plasma membrane. Thus, ρ1- and ρ1Δ450-GFP fusions provide a powerful tool to visualize the traffic of GABA type C receptors. PMID:11172056

CDKN2D-WDFY2 is a cancer-specific fusion gene recurrent in high-grade serous ovarian carcinoma.

PubMed

Kannan, Kalpana; Coarfa, Cristian; Rajapakshe, Kimal; Hawkins, Shannon M; Matzuk, Martin M; Milosavljevic, Aleksandar; Yen, Laising

2014-03-01

Ovarian cancer is the fifth leading cause of cancer death in women. Almost 70% of ovarian cancer deaths are due to the high-grade serous subtype, which is typically detected only after it has metastasized. Characterization of high-grade serous cancer is further complicated by the significant heterogeneity and genome instability displayed by this cancer. Other than mutations in TP53, which is common to many cancers, highly recurrent recombinant events specific to this cancer have yet to be identified. Using high-throughput transcriptome sequencing of seven patient samples combined with experimental validation at DNA, RNA and protein levels, we identified a cancer-specific and inter-chromosomal fusion gene CDKN2D-WDFY2 that occurs at a frequency of 20% among sixty high-grade serous cancer samples but is absent in non-cancerous ovary and fallopian tube samples. This is the most frequent recombinant event identified so far in high-grade serous cancer implying a major cellular lineage in this highly heterogeneous cancer. In addition, the same fusion transcript was also detected in OV-90, an established high-grade serous type cell line. The genomic breakpoint was identified in intron 1 of CDKN2D and intron 2 of WDFY2 in patient tumor, providing direct evidence that this is a fusion gene. The parental gene, CDKN2D, is a cell-cycle modulator that is also involved in DNA repair, while WDFY2 is known to modulate AKT interactions with its substrates. Transfection of cloned fusion construct led to loss of wildtype CDKN2D and wildtype WDFY2 protein expression, and a gain of a short WDFY2 protein isoform that is presumably under the control of the CDKN2D promoter. The expression of short WDFY2 protein in transfected cells appears to alter the PI3K/AKT pathway that is known to play a role in oncogenesis. CDKN2D-WDFY2 fusion could be an important molecular signature for understanding and classifying sub-lineages among heterogeneous high-grade serous ovarian carcinomas.

The conserved upstream region of lscB/C determines expression of different levansucrase genes in plant pathogen Pseudomonas syringae

PubMed Central

2014-01-01

Background Pseudomonas syringae pv. glycinea PG4180 is an opportunistic plant pathogen which causes bacterial blight of soybean plants. It produces the exopolysaccharide levan by the enzyme levansucrase. Levansucrase has three gene copies in PG4180, two of which, lscB and lscC, are expressed while the third, lscA, is cryptic. Previously, nucleotide sequence alignments of lscB/C variants in various P. syringae showed that a ~450-bp phage-associated promoter element (PAPE) including the first 48 nucleotides of the ORF is absent in lscA. Results Herein, we tested whether this upstream region is responsible for the expression of lscB/C and lscA. Initially, the transcriptional start site for lscB/C was determined. A fusion of the PAPE with the ORF of lscA (lscB UpN A) was generated and introduced to a levan-negative mutant of PG4180. Additionally, fusions comprising of the non-coding part of the upstream region of lscB with lscA (lscB Up A) or the upstream region of lscA with lscB (lscA Up B) were generated. Transformants harboring the lscB UpN A or the lscB Up A fusion, respectively, showed levan formation while the transformant carrying lscA Up B did not. qRT-PCR and Western blot analyses showed that lscB UpN A had an expression similar to lscB while lscB Up A had a lower expression. Accuracy of protein fusions was confirmed by MALDI-TOF peptide fingerprinting. Conclusions Our data suggested that the upstream sequence of lscB is essential for expression of levansucrase while the N-terminus of LscB mediates an enhanced expression. In contrast, the upstream region of lscA does not lead to expression of lscB. We propose that lscA might be an ancestral levansucrase variant upstream of which the PAPE got inserted by potentially phage-mediated transposition events leading to expression of levansucrase in P. syringae. PMID:24670199

Incorporation of aptamers in the terminal loop of shRNAs yields an effective and novel combinatorial targeting strategy.

PubMed

Pang, Ka Ming; Castanotto, Daniela; Li, Haitang; Scherer, Lisa; Rossi, John J

2018-01-09

Gene therapy by engineering patient's own blood cells to confer HIV resistance can potentially lead to a functional cure for AIDS. Toward this goal, we have previously developed an anti-HIV lentivirus vector that deploys a combination of shRNA, ribozyme and RNA decoy. To further improve this therapeutic vector against viral escape, we sought an additional reagent to target HIV integrase. Here, we report the development of a new strategy for selection and expression of aptamer for gene therapy. We developed a SELEX protocol (multi-tag SELEX) for selecting RNA aptamers against proteins with low solubility or stability, such as integrase. More importantly, we expressed these aptamers in vivo by incorporating them in the terminal loop of shRNAs. This novel strategy allowed efficient expression of the shRNA-aptamer fusions that targeted RNAs and proteins simultaneously. Expressed shRNA-aptamer fusions targeting HIV integrase or reverse transcriptase inhibited HIV replication in cell cultures. Viral inhibition was further enhanced by combining an anti-integrase aptamer with an anti-HIV Tat-Rev shRNA. This construct exhibited efficacy comparable to that of integrase inhibitor Raltegravir. Our strategy for the selection and expression of RNA aptamers can potentially extend to other gene therapy applications. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Recombinant mumps viruses expressing the batMuV fusion glycoprotein are highly fusion active and neurovirulent.

PubMed

Krüger, Nadine; Sauder, Christian; Hoffmann, Markus; Örvell, Claes; Drexler, Jan Felix; Rubin, Steven; Herrler, Georg

2016-11-01

A recent study reported the detection of a bat-derived virus (BatPV/Epo_spe/AR1/DCR/2009, batMuV) with phylogenetic relatedness to human mumps virus (hMuV). Since all efforts to isolate infectious batMuV have reportedly failed, we generated recombinant mumps viruses (rMuVs) in which the open reading frames (ORFs) of the fusion (F) and haemagglutinin-neuraminidase (HN) glycoproteins of an hMuV strain were replaced by the corresponding ORFs of batMuV. The batMuV F and HN proteins were successfully incorporated into viral particles and the resultant chimeric virus was able to mediate infection of Vero cells. Distinct differences were observed between the fusogenicity of rMuVs expressing one or both batMuV glycoproteins: viruses expressing batMuV F were highly fusogenic, regardless of the origin of HN. In contrast, rMuVs expressing human F and bat-derived HN proteins were less fusogenic compared to hMuV. The growth kinetics of chimeric MuVs expressing batMuV HN in combination with either hMuV or batMuV F were similar to that of the backbone virus, whereas a delay in virus replication was obtained for rMuVs harbouring batMuV F and hMuV HN. Replacement of the hMuV F and HN genes or the HN gene alone by the corresponding batMuV genes led to a slight reduction in neurovirulence of the highly neurovirulent backbone strain. Neutralizing antibodies inhibited infection mediated by all recombinant viruses generated. Furthermore, group IV anti-MuV antibodies inhibited the neuraminidase activity of bat-derived HN. Our study reports the successful generation of chimeric MuVs expressing the F and HN proteins of batMuV, providing a means for further examination of this novel batMuV.

Evolutionary history of the HAP2/GCS1 gene and sexual reproduction in metazoans.

PubMed

Steele, Robert E; Dana, Catherine E

2009-11-03

The HAP2/GCS1 gene first appeared in the common ancestor of plants, animals, and protists, and is required in the male gamete for fusion to the female gamete in the unicellular organisms Chlamydomonas and Plasmodium. We have identified a HAP2/GCS1 gene in the genome sequence of the sponge Amphimedon queenslandica. This finding provides a continuous evolutionary history of HAP2/GCS1 from unicellular organisms into the metazoan lineage. Divergent versions of the HAP2/GCS1 gene are also present in the genomes of some but not all arthropods. By examining the expression of the HAP2/GCS1 gene in the cnidarian Hydra, we have found the first evidence supporting the hypothesis that HAP2/GCS1 was used for male gamete fusion in the ancestor of extant metazoans and that it retains that function in modern cnidarians.

Introduction of Peptidase Genes from Lactobacillus delbrueckii subsp. lactis into Lactococcus lactis and Controlled Expression

PubMed Central

Wegmann, U.; Klein, J. R.; Drumm, I.; Kuipers, O. P.; Henrich, B.

1999-01-01

Peptidases PepI, PepL, PepW, and PepG from Lactobacillus delbrueckii subsp. lactis, which have no counterparts in Lactococcus lactis, and peptidase PepQ were examined to determine their potential to confer new peptidolytic properties to lactococci. Controllable expression of the corresponding genes (pep genes) was achieved by constructing translational fusions with the promoter of the nisA gene (PnisA). A suitable host strain, UKLc10, was constructed by chromosomal integration of the genes encoding the NisRK two-component system into the fivefold peptidase-deficient mutant IM16 of L. lactis. Recombinants of this strain were used to analyze growth, peptidase activities, peptide utilization, and intracellular protein cleavage products. After nisin induction of PnisA::pep fusions, all of the peptidases were visible as distinct bands in protein gels. Despite the fact that identical transcription and translation signals were used to express the pep genes, the relative amounts of individual peptidases varied considerably. All of the peptidases exhibited activities in extracts of recombinant UKLc10 clones, but only PepL and PepG allowed the clones to utilize specific peptide substrates as sources of essential amino acids. In milk medium, induction of pepG and induction of pepW resulted in growth acceleration. The activities of all five peptidases during growth in milk medium were revealed by high-performance liquid chromatography analyses of intracellular amino acid and peptide pools. PMID:10543778

Transcription Factors Expressed in Lateral Organ Boundaries: Identification of Downstream Targets

DOE Office of Scientific and Technical Information (OSTI.GOV)

Springer, Patricia S

2010-07-12

The processes of lateral organ initiation and patterning are central to the generation of mature plant form. Characterization of the molecular mechanisms underlying these processes is essential to our understanding of plant development. Communication between the shoot apical meristem and initiating organ primordia is important both for functioning of the meristem and for proper organ patterning, and very little is known about this process. In particular, the boundary between meristem and leaf is emerging as a critical region that is important for SAM maintenance and regulation of organogenesis. The goal of this project was to characterize three boundary-expressed genes thatmore » encode predicted transcription factors. Specifically, we have studied LATERAL ORGAN BOUNDARIES (LOB), LATERAL ORGAN FUSION1 (LOF1), and LATERAL ORGAN FUSION2 (LOF2). LOB encodes the founding member of the LOB-DOMAIN (LBD) plant-specific DNA binding transcription factor family and LOF1 and LOF2 encode paralogous MYB-domain transcription factors. We characterized the genetic relationship between these three genes and other boundary and meristem genes. We also used an ectopic inducible expression system to identify direct targets of LOB.« less

WHOLE-GENOME SEQUENCING OF SALIVARY GLAND ADENOID CYSTIC CARCINOMA

PubMed Central

Rettig, Eleni M; Talbot, C Conover; Sausen, Mark; Jones, Sian; Bishop, Justin A; Wood, Laura D; Tokheim, Collin; Niknafs, Noushin; Karchin, Rachel; Fertig, Elana J; Wheelan, Sarah J; Marchionni, Luigi; Considine, Michael; Ling, Shizhang; Fakhry, Carole; Papadopoulos, Nickolas; Kinzler, Kenneth W; Vogelstein, Bert; Ha, Patrick K; Agrawal, Nishant

2016-01-01

Adenoid cystic carcinomas (ACCs) of the salivary glands are challenging to understand, treat, and cure. To better understand the genetic alterations underlying the pathogenesis of these tumors, we performed comprehensive genome analyses of 25 fresh-frozen tumors, including whole genome sequencing, expression and pathway analyses. In addition to the well-described MYB-NFIB fusion which was found in 11 tumors (44%), we observed five different rearrangements involving the NFIB transcription factor gene in seven tumors (28%). Taken together, NFIB translocations occurred in 15 of 25 samples (60%, 95%CI=41–77%). In addition, mRNA expression analysis of 17 tumors revealed overexpression of NFIB in ACC tumors compared with normal tissues (p=0.002). There was no difference in NFIB mRNA expression in tumors with NFIB fusions compared to those without. We also report somatic mutations of genes involved in the axonal guidance and Rho family signaling pathways. Finally, we confirm previously described alterations in genes related to chromatin regulation and Notch signaling. Our findings suggest a separate role for NFIB in ACC oncogenesis and highlight important signaling pathways for future functional characterization and potential therapeutic targeting. PMID:26862087

Production of human interferon alfa 2b in plants of Nicotiana excelsior by Agrobacterium-mediated transient expression.

PubMed

Sindarovska, Y R; Gerasymenko, I M; Sheludko, Y V; Olevinskaya, Z M; Spivak, N Y; Kuchuk, N V

2010-01-01

Human interferon alpha2b gene was transiently expressed in Nicotiana excelsior plants. Fusion with N. plumbaginifolia calreticulin signal peptide for improved apoplast targeting and carrying out the expression under optimized conditions resulted in maximal interferon activity of 3.2 x 10(3) IU/g fresh weight (FW) with an average of 2.1 +/- 0.8 x 10(3) IU/g FW. It proves that N. excelsior is a suitable host for Agrobacterium-mediated transient expression of genes encoding physiologically active human proteins. The transient expression conditions optimized for GFP marker protein were confirmed to be preferable for hIFN alpha2b.

Sequences 5' to translation start regulate expression of petunia rbcS genes.

PubMed Central

Dean, C; Favreau, M; Bedbrook, J; Dunsmuir, P

1989-01-01

The promoter sequences that contribute to quantitative differences in expression of the petunia genes (rbcS) encoding the small subunit of ribulose bisphosphate carboxylase have been characterized. The promoter regions of the two most abundantly expressed petunia rbcS genes, SSU301 and SSU611, show sequence similarity not present in other rbcS genes. We investigated the significance of these and other sequences by adding specific regions from the SSU301 promoter (the most strongly expressed gene) to equivalent regions in the SSU911 promoter (the least strongly expressed gene) and assaying the expression of the fusions in transgenic tobacco plants. In this way, we characterized an SSU301 promoter region (either from -285 to -178 or -291 to -204) which, when added to SSU911, in either orientation, increased SSU911 expression 25-fold. This increase was equivalent to that caused by addition of the entire SSU301 5'-flanking region. Replacement of SSU911 promoter sequences between -198 and the start codon with sequences from the equivalent region of SSU301 did not increase SSU911 expression significantly. The -291 to -204 SSU301 promoter fragment contributes significantly to quantitative differences in expression between the petunia rbcS genes. PMID:2535543

Transgene expression of lilies grown in the greenhouse and outdoors

USDA-ARS?s Scientific Manuscript database

Lilium longiflorum cv. Nellie White plants were transformed with either the bar-uidA fusion gene or the npt II and uidA genes and grown for two seasons in the greenhouse and outdoors in containers. All transgenes were under control of the CaMV 35S promoter. During the first year there was no differ...

Dissecting the Molecular Mechanism of RhoC GTPase Expression in the Normal and Malignant Breast

DTIC Science & Technology

2010-09-01

Headquarters Services , Directorate for Information Operations and Reports (0704-0188), 1215 Jefferson Davis Highway, Suite 1204, Arlington, VA 22202- 4302...transcriptome and categorized as (i) mapping to same gene, (ii) mapping to different genes (chimera candidates), (iii) nonmapping, (iv) mitochondrial, (v) quality ...mitochondrial, (iv) quality control, (v) chimera can- didates, and (vi) nonmapping. Chimera candidates and nonmapping categories were used for gene fusion

Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

PubMed

Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

1992-01-01

A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

Studies on the Expression of Sesquiterpene Synthases Using Promoter-β-Glucuronidase Fusions in Transgenic Artemisia annua L

PubMed Central

Wang, Hongzhen; Han, Junli; Kanagarajan, Selvaraju; Lundgren, Anneli; Brodelius, Peter E.

2013-01-01

In order to better understand the influence of sesquiterpene synthases on artemisinin yield in Artemisia annua, the expression of some sesquiterpene synthases has been studied using transgenic plants expressing promoter-GUS fusions. The cloned promoter sequences were 923, 1182 and 1510 bp for β-caryophyllene (CPS), epi-cedrol (ECS) and β-farnesene (FS) synthase, respectively. Prediction of cis-acting regulatory elements showed that the promoters are involved in complex regulation of expression. Transgenic A. annua plants carrying promoter-GUS fusions were studied to elucidate the expression pattern of the three sesquiterpene synthases and compared to the previously studied promoter of amorpha-4,11-diene synthase (ADS), a key enzyme of artemisinin biosynthesis. The CPS and ECS promoters were active in T-shaped trichomes of leaves and stems, basal bracts of flower buds and also in some florets cells but not in glandular secretory trichome while FS promoter activity was only observed in leaf cells and trichomes of transgenic shoots. ADS, CPS, ECS and FS transcripts were induced by wounding in a time depended manner. The four sesquiterpene synthases may be involved in responsiveness of A. annua to herbivory. Methyl jasmonate treatment triggered activation of the promoters of all four sesquiterpene synthases in a time depended manner. Southern blot result showed that the GUS gene was inserted into genomic DNA of transgenic lines as a single copy or two copies. The relative amounts of CPS and ECS as well as germacrene A synthase (GAS) transcripts are much lower than that of ADS transcript. Consequently, down-regulation of the expression of the CPS, ECS or GAS gene may not improve artemsinin yield. However, blocking the expression of FS may have effects on artemisinin production. PMID:24278301

FusionHub: A unified web platform for annotation and visualization of gene fusion events in human cancer.

PubMed

Panigrahi, Priyabrata; Jere, Abhay; Anamika, Krishanpal

2018-01-01

Gene fusion is a chromosomal rearrangement event which plays a significant role in cancer due to the oncogenic potential of the chimeric protein generated through fusions. At present many databases are available in public domain which provides detailed information about known gene fusion events and their functional role. Existing gene fusion detection tools, based on analysis of transcriptomics data usually report a large number of fusion genes as potential candidates, which could be either known or novel or false positives. Manual annotation of these putative genes is indeed time-consuming. We have developed a web platform FusionHub, which acts as integrated search engine interfacing various fusion gene databases and simplifies large scale annotation of fusion genes in a seamless way. In addition, FusionHub provides three ways of visualizing fusion events: circular view, domain architecture view and network view. Design of potential siRNA molecules through ensemble method is another utility integrated in FusionHub that could aid in siRNA-based targeted therapy. FusionHub is freely available at https://fusionhub.persistent.co.in.

Visualisation of the mechanosensitive channel of large conductance in bacteria using confocal microscopy.

PubMed

Norman, Christel; Liu, Zhen-Wei; Rigby, Paul; Raso, Albert; Petrov, Yevgeniy; Martinac, Boris

2005-07-01

The mechanosensitive channel of large conductance (MscL) plays an important role in the survival of bacterial cells to hypo-osmotic shock. This channel has been extensively studied and its sequence, structure and electrophysiological characteristics are well known. Here we present a method to visualise MscL in living bacteria using confocal microscopy. By creating a gene fusion between mscl and the gene encoding the green fluorescent protein (GFP) we were able to express the fusion protein MscL-GFP in bacteria. We show that MscL-GFP is present in the cytoplasmic membrane and forms functional channels. These channels have the same characteristics as wild-type MscL, except that they require more pressure to open. This method could prove an interesting, non-invasive, tool to study the localisation and the regulation of expression of MscL in bacteria.

Tyrosine kinase gene rearrangements in epithelial malignancies

PubMed Central

Shaw, Alice T.; Hsu, Peggy P.; Awad, Mark M.; Engelman, Jeffrey A.

2014-01-01

Chromosomal rearrangements that lead to oncogenic kinase activation are observed in many epithelial cancers. These cancers express activated fusion kinases that drive the initiation and progression of malignancy, and often have a considerable response to small-molecule kinase inhibitors, which validates these fusion kinases as ‘druggable’ targets. In this Review, we examine the aetiologic, pathogenic and clinical features that are associated with cancers harbouring oncogenic fusion kinases, including anaplastic lymphoma kinase (ALK), ROS1 and RET. We discuss the clinical outcomes with targeted therapies and explore strategies to discover additional kinases that are activated by chromosomal rearrangements in solid tumours. PMID:24132104

A novel feature extraction approach for microarray data based on multi-algorithm fusion

PubMed Central

Jiang, Zhu; Xu, Rong

2015-01-01

Feature extraction is one of the most important and effective method to reduce dimension in data mining, with emerging of high dimensional data such as microarray gene expression data. Feature extraction for gene selection, mainly serves two purposes. One is to identify certain disease-related genes. The other is to find a compact set of discriminative genes to build a pattern classifier with reduced complexity and improved generalization capabilities. Depending on the purpose of gene selection, two types of feature extraction algorithms including ranking-based feature extraction and set-based feature extraction are employed in microarray gene expression data analysis. In ranking-based feature extraction, features are evaluated on an individual basis, without considering inter-relationship between features in general, while set-based feature extraction evaluates features based on their role in a feature set by taking into account dependency between features. Just as learning methods, feature extraction has a problem in its generalization ability, which is robustness. However, the issue of robustness is often overlooked in feature extraction. In order to improve the accuracy and robustness of feature extraction for microarray data, a novel approach based on multi-algorithm fusion is proposed. By fusing different types of feature extraction algorithms to select the feature from the samples set, the proposed approach is able to improve feature extraction performance. The new approach is tested against gene expression dataset including Colon cancer data, CNS data, DLBCL data, and Leukemia data. The testing results show that the performance of this algorithm is better than existing solutions. PMID:25780277

A novel feature extraction approach for microarray data based on multi-algorithm fusion.

PubMed

Jiang, Zhu; Xu, Rong

2015-01-01

Feature extraction is one of the most important and effective method to reduce dimension in data mining, with emerging of high dimensional data such as microarray gene expression data. Feature extraction for gene selection, mainly serves two purposes. One is to identify certain disease-related genes. The other is to find a compact set of discriminative genes to build a pattern classifier with reduced complexity and improved generalization capabilities. Depending on the purpose of gene selection, two types of feature extraction algorithms including ranking-based feature extraction and set-based feature extraction are employed in microarray gene expression data analysis. In ranking-based feature extraction, features are evaluated on an individual basis, without considering inter-relationship between features in general, while set-based feature extraction evaluates features based on their role in a feature set by taking into account dependency between features. Just as learning methods, feature extraction has a problem in its generalization ability, which is robustness. However, the issue of robustness is often overlooked in feature extraction. In order to improve the accuracy and robustness of feature extraction for microarray data, a novel approach based on multi-algorithm fusion is proposed. By fusing different types of feature extraction algorithms to select the feature from the samples set, the proposed approach is able to improve feature extraction performance. The new approach is tested against gene expression dataset including Colon cancer data, CNS data, DLBCL data, and Leukemia data. The testing results show that the performance of this algorithm is better than existing solutions.

Mitochondrial functions mediate cellulase gene expression in Trichoderma reesei.

PubMed

Abrahão-Neto, J; Rossini, C H; el-Gogary, S; Henrique-Silva, F; Crivellaro, O; el-Dorry, H

1995-08-22

We examined the effects of inhibition of mitochondrial functions on the expression of two nuclear genes encoding the extracellular cellobiohydrolase I (cbh1) and endoglucanase I (egl1) of the cellulase system of the filamentous fungus Trichoderma reesei. The cbh1 and egl1 transcripts are repressed at a low oxygen tension, and by glucose at a concentration known to repress mitochondrial respiration. The transcripts are also down-regulated by chemical agents known to dissipate the proton electrochemical gradient of the inner mitochondrial membrane and blocking of the electron-transport chain, such as DNP and KCN, respectively. These results suggest that expression of those transcripts is influenced by the physiological state of the mitochondria. In addition, heterologous gene fusion shows that the sensitivity of the expression of those transcripts to the functional state of the mitochondria is transcriptionally controlled through the 5'-flanking DNA sequence of those genes.

Molecular analysis of the ependymin gene and functional test of its promoter region by transient expression in Brachydanio rerio.

PubMed

Rinder, H; Bayer, T A; Gertzen, E M; Hoffmann, W

1992-01-01

Ependymins are secretory products of meningeal cells and represent the predominant glycoproteins in the cerebrospinal fluid from various orders of teleost fish. In the zebrafish, their expression starts between 48 and 72 h post-fertilization. Generally, they share characteristics with proteins involved in cell-contact phenomena. Here, we characterize the ependymin gene from Brachydanio rerio and its flanking regions. The sequence was obtained from clones generated using the polymerase chain reaction (PCR), including a variation of an "anchored" PCR. Also, clones from a conventional phage library were analyzed. We found that the transcribed portion is arranged in six exons. Transient expression of an ependymin-promoter-lacZ gene fusion in zebrafish embryos revealed that the 2.0-kb upstream regulatory region used is sufficient to direct the ependymin-specific correct temporal and spatial expression pattern of the lacZ reporter gene.

Characterization of the telomere complex, TERF1 and TERF2 genes in muntjac species with fusion karyotypes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hartmann, Nils; Scherthan, Harry

The telomere binding proteins TRF1 and TRF2 maintain and protect chromosome ends and confer karyotypic stability. Chromosome evolution in the genus Muntiacus is characterized by numerous tandem (end-to-end) fusions. To study TRF1 and TRF2 telomere binding proteins in Muntiacus species, we isolated and characterized the TERF1 and -2 genes from Indian muntjac (Muntiacus muntjak vaginalis; 2n = 6 female) and from Chinese muntjac (Muntiacus reveesi; 2n = 46). Expression analysis revealed that both genes are ubiquitously expressed and sequence analysis identified several transcript variants of both TERF genes. Control experiments disclosed a novel testis-specific splice variant of TERF1 in humanmore » testes. Amino acid sequence comparisons demonstrate that Muntiacus TRF1 and in particular TRF2 are highly conserved between muntjac and human. In vivo TRF2-GFP and immuno-staining studies in muntjac cell lines revealed telomeric TRF2 localization, while deletion of the DNA binding domain abrogated this localization, suggesting muntjac TRF2 represents a functional telomere protein. Finally, expression analysis of a set of telomere-related genes revealed their presence in muntjac fibroblasts and testis tissue, which suggests the presence of a conserved telomere complex in muntjacs. However, a deviation from the common theme was noted for the TERT gene, encoding the catalytic subunit of telomerase; TERT expression could not be detected in Indian or Chinese muntjac cDNA or genomic DNA using a series of conserved primers, while TRAP assay revealed functional telomerase in Chinese muntjac testis tissues. This suggests muntjacs may harbor a diverged telomerase sequence.« less

Host responses of Japanese flounder Paralichthys olivaceus with lymphocystis cell formation.

PubMed

Iwakiri, Shogo; Song, Jun-Young; Nakayama, Kei; Oh, Myung-Joo; Ishida, Minoru; Kitamura, Shin-Ichi

2014-06-01

Lymphocystis disease virus (LCDV) is the causative agent of lymphocystis disease (LCD). In this study, we investigated the mechanisms of lymphocystis cell (LCC) formation from the viewpoint of gene expression changes in the infected fish. LCC occurrence and virus titers in the experimentally infected Japanese flounder, Paralichthys olivaceus were monitored by visual confirmation and real-time PCR, respectively. The gene expression changes in the fish fin were investigated by microarray experiments. LCCs firstly appeared in the fish at 21 days post infection (dpi). LCD incidence increased with time and reached 92.9% at 62 dpi. LCDV genome was firstly detected from dorsal fins at 14 dpi, and the relative amount of the genome gradually-increased until 56 dpi. Since the occurrence of LCC was approximately synchronized with increasing of the virus genome, virus replication might play important roles for LCC formation. The microarray detected a few gene expression changes until 28 dpi. However, the number of expression changed genes dramatically increased between 28 and 42 dpi in which LCCs formation was active. From the microarray data analyses, apoptosis and cell division related genes were down-regulated, whereas cell fusion and collagen related genes were up-regulated at 42 dpi. Together with the observation of morphological changes of LCCs in previous reports, it is suggested that the following steps are involved in LCC formation: the virus infected cells were (1) inhibited apoptotic death and (2) cell division before enlargement, (3) hypertrophied by cell fusion, and (4) surrounded by a hyaline capsule associated with the alteration of collagen fibers. Copyright © 2014 Elsevier Ltd. All rights reserved.

Effect of Mild Acid on Gene Expression in Staphylococcus aureus

PubMed Central

Weinrick, Brian; Dunman, Paul M.; McAleese, Fionnuala; Murphy, Ellen; Projan, Steven J.; Fang, Yuan; Novick, Richard P.

2004-01-01

During staphylococcal growth in glucose-supplemented medium, the pH of a culture starting near neutrality typically decreases by about 2 units due to the fermentation of glucose. Many species can comfortably tolerate the resulting mildly acidic conditions (pH, ∼5.5) by mounting a cellular response, which serves to defend the intracellular pH and, in principle, to modify gene expression for optimal performance in a mildly acidic infection site. In this report, we show that changes in staphylococcal gene expression formerly thought to represent a glucose effect are largely the result of declining pH. We examine the cellular response to mild acid by microarray analysis and define the affected gene set as the mild acid stimulon. Many of the genes encoding extracellular virulence factors are affected, as are genes involved in regulation of virulence factor gene expression, transport of sugars and peptides, intermediary metabolism, and pH homeostasis. Key results are verified by gene fusion and Northern blot hybridization analyses. The results point to, but do not define, possible regulatory pathways by which the organism senses and responds to a pH stimulus. PMID:15576791

Influence of insertion site of the avian influenza virus haemagglutinin (HA) gene within the Newcastle disease virus genome on HA expression.

PubMed

Ramp, Kristina; Skiba, Martin; Karger, Axel; Mettenleiter, Thomas C; Römer-Oberdörfer, Angela

2011-02-01

Members of the order Mononegavirales express their genes in a transcription gradient from 3' to 5'. To assess how this impacts on expression of a foreign transgene, the haemagglutinin (HA) of highly pathogenic avian influenza virus (HPAIV) A/chicken/Vietnam/P41/05 (subtype H5N1) was inserted between the phosphoprotein (P) and matrix protein (M), M and fusion protein (F), or F and haemagglutinin-neuraminidase protein (HN) genes of attenuated Newcastle disease virus (NDV) Clone 30. In addition, the gene encoding the neuraminidase of HPAIV A/duck/Vietnam/TG24-01/05 (subtype H5N1) was inserted into the NDV genome either alone or in combination with the HA gene. All recombinants replicated well in embryonated chicken eggs. The expression levels of HA-specific mRNA and protein were quantified by Northern blot analysis and mass spectrometry, with good correlation. HA expression levels differed only moderately and were highest in the recombinant carrying the HA insertion between the F and HN genes of NDV.

Adenoviral-Mediated Imaging of Gene Transfer Using a Somatostatin Receptor-Cytosine Deaminase Fusion Protein

PubMed Central

Lears, Kimberly A.; Parry, Jesse J.; Andrews, Rebecca; Nguyen, Kim; Wadas, Thaddeus J.; Rogers, Buck E.

2015-01-01

Suicide gene therapy is a process by which cells are administered a gene that encodes a protein capable of converting a nontoxic prodrug into an active toxin. Cytosine deaminase (CD) has been widely investigated as a means of suicide gene therapy due to the enzyme’s ability to convert the prodrug 5-fluorocytosine (5-FC) into the toxic compound 5-fluorouracil (5-FU). However, the extent of gene transfer is a limiting factor in predicting therapeutic outcome. The ability to monitor gene transfer, non-invasively, would strengthen the efficiency of therapy. In this regard, we have constructed and evaluated a replication-deficient adenovirus (Ad) containing the human somatostatin receptor subtype 2 (SSTR2) fused with a C-terminal yeast CD gene for the non-invasive monitoring of gene transfer and therapy. The resulting Ad (AdSSTR2-yCD) was evaluated in vitro in breast cancer cells to determine the function of the fusion protein. These studies demonstrated that the both the SSTR2 and yCD were functional in binding assays, conversion assays, and cytotoxicity assays. In vivo studies similarly demonstrated the functionality using conversion assays, biodistribution studies, and small animal positron-emission tomography (PET) imaging studies. In conclusion, the fusion protein has been validated as useful for the non-invasive imaging of yCD expression and will be evaluated in the future for monitoring yCD-based therapy. PMID:25837665

Universal light-switchable gene promoter system

DOEpatents

Quail, Peter H.; Huq, Enamul; Tepperman, James; Sato, Sae

2005-02-22

An artificial promoter system that can be fused upstream of any desired gene enabling reversible induction or repression of the expression of the gene at will in any suitable host cell or organisms by light is described. The design of the system is such that a molecule of the plant photoreceptor phytochrome is targeted to the specific DNA binding site in the promoter by a protein domain that is fused to the phytochrome and that specifically recognizes this binding site. This bound phytochrome, upon activation by light, recruits a second fusion protein consisting of a protein that binds to phytochrome only upon light activation and a transcriptional activation domain that activates expression of the gene downstream of the promoter.

The class I protein AtTCP15 modulates plant development through a pathway that overlaps with the one affected by CIN-like TCP proteins.

PubMed

Uberti-Manassero, Nora G; Lucero, Leandro E; Viola, Ivana L; Vegetti, Abelardo C; Gonzalez, Daniel H

2012-01-01

The function of the class I TCP transcription factor TCP15 from Arabidopsis thaliana has been studied through the analysis of plants that express a fusion of this protein to the EAR repressor domain. Constitutive expression of TCP15-EAR produces growth arrest at the seedling stage, before leaf emergence. Expression of the repressor fusion from the AtTCP15 promoter produces small plants with leaves whose margins progressively curve upwards, starting from the basal part of the lamina. Leaves contain smaller and less differentiated cells, both on the adaxial and abaxial sides. The abaxial domain is relatively enlarged, with disorganized cells separated by empty spaces. TCP15-EAR also affects the growth of leaf petioles, flower pedicels, and anther filaments. Flowers show reduced elongation of the three outer whorls and altered gynoecia with irregular carpel surfaces and enlarged repla. Ectopic stigma-like structures develop from medial and basal parts of the replum. TCP15-EAR produces an increase in expression of the boundary-specific genes LOB, CUC1, and CUC2. Changes in CUC1 and CUC2 expression can be explained by the existence of lower levels of miR164 in leaves and the repression of IAA3/SHY2 and the SAUR-like gene At1g29460 in leaves and flowers. TCP15 binds to the promoter regions of IAA3/SHY2 and At1g29460, suggesting that these genes may be direct targets of the transcription factor. The results indicate that TCP15 regulates the expression of boundary-specific genes through a pathway that affects auxin homeostasis and partially overlaps with the one modulated by class II CIN-like TCP proteins.

Expression and use of the green fluorescent protein as a reporter system in Legionella pneumophila.

PubMed

Köhler, R; Bubert, A; Goebel, W; Steinert, M; Hacker, J; Bubert, B

2000-01-01

The gene encoding the green fluorescent protein (GFP) was used as a reporter gene in Legionella pneumophila. To analyze GFP expression in Legionella, transcriptional fusions of gfp with the Legionella-specific mip (Macrophage Infectivity Potentiator) promoter (P(mip)) and the sod (SuperOxide Dismutase) promoter (P(sod)) derived from Listeria monocytogenes were constructed. Following transformation into the virulent L. pneumophila strain JR 32, strong GFP-mediated fluorescence was detected with both plasmids, although the sod promoter was associated with a 1ten-fold higher intensity. No fluorescence was observed in L. pneumophila transformed with the promoterless gfp gene. Comparison of fluorescence yields between various L. pneumophila strains that differ in their virulence characteristics and were transformed with the P(mip)-gfp carrying plasmid revealed no differences in GFP expression. Infection studies using Acanthamoeba castellanii as host and recombinant L. pneumophila strains carrying the P(mip)-gfp and P(sod)-gfp fusions indicated that the mip promoter was expressed when the bacteria replicated intracellularly. GFP expression was also used to monitor, in infected A. castellanii cells, the intracellular survival of, and incidence of host-cell killing by. L. pneumophila strains that vary in their virulence properties. As quantified by flow cytometry the highly virulent L. pneumophila strain Corby was twice as infectious to A. castellanii as the Philadelphia strain JR 32. Using the avirulent Philadelphia derivative 25D invasion but no intracellular multiplication was observed. In addition, we examined by flow cytometry the influence of cytochalasin D, cycloheximide, and methylamine on the uptake of Legionella by A. castellanii. In conclusion, gfp appears to be a convenient reporter gene whose expression in Legionella can be followed in real time and allows analysis of promoter activities in Legionella and monitoring of the infection process.

Fusagene vectors: a novel strategy for the expression of multiple genes from a single cistron.

PubMed

Gäken, J; Jiang, J; Daniel, K; van Berkel, E; Hughes, C; Kuiper, M; Darling, D; Tavassoli, M; Galea-Lauri, J; Ford, K; Kemeny, M; Russell, S; Farzaneh, F

2000-12-01

Transduction of cells with multiple genes, allowing their stable and co-ordinated expression, is difficult with the available methodologies. A method has been developed for expression of multiple gene products, as fusion proteins, from a single cistron. The encoded proteins are post-synthetically cleaved and processed into each of their constituent proteins as individual, biologically active factors. Specifically, linkers encoding cleavage sites for the Golgi expressed endoprotease, furin, have been incorporated between in-frame cDNA sequences encoding different secreted or membrane bound proteins. With this strategy we have developed expression vectors encoding multiple proteins (IL-2 and B7.1, IL-4 and B7.1, IL-4 and IL-2, IL-12 p40 and p35, and IL-12 p40, p35 and IL-2 ). Transduction and analysis of over 100 individual clones, derived from murine and human tumour cell lines, demonstrate the efficient expression and biological activity of each of the encoded proteins. Fusagene vectors enable the co-ordinated expression of multiple gene products from a single, monocistronic, expression cassette.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Claus, Claudia; Tzeng, W.-P.; Liebert, Uwe Gerd

During serial passaging of rubella virus (RUB) in cell culture, the dominant species of defective-interfering RNA (DI) generated contains an in-frame deletion between the capsid protein (C) gene and E1 glycoprotein gene resulting in production of a C-E1 fusion protein that is necessary for the maintenance of the DI [Tzeng, W.P., Frey, T.K. (2006). C-E1 fusion protein synthesized by rubella virus DI RNAs maintained during serial passage. Virology 356 198-207.]. A BHK cell line stably expressing the RUB structural proteins was established which was used to package DIs into virus particles following transfection with in vitro transcripts from DI infectiousmore » cDNA constructs. Packaging of a DI encoding an in-frame C-GFP-E1 reporter fusion protein corresponding to the C-E1 fusion protein expressed in a native DI was only marginally more efficient than packaging of a DI encoding GFP, indicating that the C-E1 fusion protein did not function by enhancing packaging. However, infection with the DI encoding the C-GFP-E1 fusion protein (in the absence of wt RUB helper virus) resulted in formation of clusters of GFP-positive cells and the percentage of GFP-positive cells in the culture following infection remained relatively constant. In contrast, a DI encoding GFP did not form GFP-positive clusters and the percentage of GFP-positive cells declined by roughly half from 2 to 4 days post-infection. Cluster formation and sustaining the percentage of infected (GFP-positive) cells required the C part of the fusion protein, including the downstream but not the upstream of two arginine clusters (both of which are associated with RNA binding and association with mitochondrial p32 protein) and the E1 part through the transmembrane sequence, but not the C-terminal cytoplasmic tail. Among a collection of mutant DI constructs, cluster formation and sustaining infected cell percentage correlated with maintenance during serial passage with wt RUB. We hypothesize that cluster formation and sustaining infected cell percentage increase the likelihood of co-infection by a DI and wt RUB during serial passage thus enhancing maintenance of the DI. Cluster formation and sustaining infected cell percentage were found to be due to a combination of attenuated cytopathogenicity of DIs that express the C-E1 fusion protein and cell-to-cell movement of the DI. In infected cells, the C-GFP-E1 fusion protein was localized to potentially novel vesicular structures that appear to originate from ER-Golgi transport vacuoles. This species of DI expressing a C-E1 fusion protein that exhibits attenuated cytopathogenicity and the ability to increase the number of infected cells through cell-to-cell movement could be the basis for development of an attractive vaccine vector.« less

Characterization of the fusion core in zebrafish endogenous retroviral envelope protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shi, Jian; State Key Laboratory of Virology, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, Hubei 430071; Zhang, Huaidong

2015-05-08

Zebrafish endogenous retrovirus (ZFERV) is the unique endogenous retrovirus in zebrafish, as yet, containing intact open reading frames of its envelope protein gene in zebrafish genome. Similarly, several envelope proteins of endogenous retroviruses in human and other mammalian animal genomes (such as syncytin-1 and 2 in human, syncytin-A and B in mouse) were identified and shown to be functional in induction of cell–cell fusion involved in placental development. ZFERV envelope protein (Env) gene appears to be also functional in vivo because it is expressible. After sequence alignment, we found ZFERV Env shares similar structural profiles with syncytin and other type Imore » viral envelopes, especially in the regions of N- and C-terminal heptad repeats (NHR and CHR) which were crucial for membrane fusion. We expressed the regions of N + C protein in the ZFERV Env (residues 459–567, including predicted NHR and CHR) to characterize the fusion core structure. We found N + C protein could form a stable coiled-coil trimer that consists of three helical NHR regions forming a central trimeric core, and three helical CHR regions packing into the grooves on the surface of the central core. The structural characterization of the fusion core revealed the possible mechanism of fusion mediated by ZFERV Env. These results gave comprehensive explanation of how the ancient virus infects the zebrafish and integrates into the genome million years ago, and showed a rational clue for discovery of physiological significance (e.g., medicate cell–cell fusion). - Highlights: • ZFERV Env shares similar structural profiles with syncytin and other type I viral envelopes. • The fusion core of ZFERV Env forms stable coiled-coil trimer including three NHRs and three CHRs. • The structural mechanism of viral entry mediated by ZFERV Env is disclosed. • The results are helpful for further discovery of physiological function of ZFERV Env in zebrafish.« less

Regulated bioluminescence as a tool for bioremediation process monitoring and control of bacterial cultures

NASA Technical Reports Server (NTRS)

Burlage, Robert S.; Heitzer, Armin; Digrazia, Philip M.

1991-01-01

An effective on-line monitoring technique for toxic waste bioremediation using bioluminescent microorganisms has shown great potential for the description and optimization of biological processes. The lux genes of the bacterium Vibrio fischeri are used by this species to produce visible light. The lux genes can be genetically fused to the control region of a catabolic gene, with the result that bioluminescence is produced whenever the catabolic gene is induced. Thus the detection of light from a sample indicates that genetic expression from a specific gene is occurring. This technique was used to monitor biodegradation of specific contaminants from waste sites. For these studies, fusions between the lux genes and the operons for naphthalene and toluene/xylene degradation were constructed. Strains carrying one of these fusions respond sensitively and specifically to target substrates. Bioluminescence from these cultures can be rapidly measured in a nondestructive and noninvasive manner. The potential for this technique in this and other biological systems is discussed.

SHP2 regulates osteoclastogenesis by promoting preosteoclast fusion

USDA-ARS?s Scientific Manuscript database

Genes that regulate osteoclast development and function under physiological and disease conditions remain incompletely understood. Shp2, a ubiquitously expressed cytoplasmic protein tyrosine phosphatase, was implicated in regulating M-CSF and RANKL-evoked signaling, its role in osteoclastogenesis an...

Identification of Small Molecules Targeting the Posttranscriptional Control of ERG Expression

DTIC Science & Technology

2012-10-01

ied. To establish a cell line expressing lucife rase-ERG fusion protein, the vector along pRL-CMV-Rluc expressing Renilla luciferase gene was...expanded, and examined for the e xpression of t wo different luciferases. A clone expressing both Firefly luciferase and Renilla luciferase was selected...treated with the individual chemical at 10 μM for 24 h. The dual luciferase activities were measured. The ratio of Firefly to Renilla lu ciferase

Differential expression pattern of UBX family genes in Caenorhabditis elegans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yamauchi, Seiji; Sasagawa, Yohei; Ogura, Teru

2007-06-29

UBX (ubiquitin regulatory X)-containing proteins belong to an evolutionary conserved protein family and determine the specificity of p97/VCP/Cdc48p function by binding as its adaptors. Caenorhabditis elegans was found to possess six UBX-containing proteins, named UBXN-1 to -6. However, no general or specific function of them has been revealed. During the course of understanding not only their function but also specified function of p97, we investigated spatial and temporal expression patterns of six ubxn genes in this study. Transcript analyses showed that the expression pattern of each ubxn gene was different throughout worm's development and may show potential developmental dynamics inmore » their function, especially ubxn-5 was expressed specifically in the spermatogenic germline, suggesting a crucial role in spermatogenesis. In addition, as ubxn-4 expression was induced by ER stress, it would function as an ERAD factor in C. elegans. In vivo expression analysis by using GFP translational fusion constructs revealed that six ubxn genes show distinct expression patterns. These results altogether demonstrate that the expression of all six ubxn genes of C. elegans is differently regulated.« less

Isolation of Erwinia chrysanthemi kduD mutants altered in pectin degradation.

PubMed Central

Condemine, G; Hugouvieux-Cotte-Pattat, N; Robert-Baudouy, J

1986-01-01

Mutants of Erwinia chrysanthemi impaired in pectin degradation were isolated by chemical and Mu d(Ap lac) insertion mutagenesis. A mutation in the kduD gene coding for 2-keto-3-deoxygluconate oxidoreductase prevented the growth of the bacteria on polygalacturonate as the sole carbon source. Analysis of the kduD::Mu d(Ap lac) insertions indicated that kduD is either an isolated gene or the last gene of a polycistronic operon. Some of the Mu d(Ap lac) insertions were kduD-lac fusions in which beta-galactosidase synthesis reflected kduD gene expression. In all these fusions, beta-galactosidase activity was shown to be sensitive to catabolite repression by glucose and to be inducible by polygalacturonate, galacturonate, and other intermediates of polygalacturonate catabolism. Galacturonate-mediated induction was prevented by a mutation which blocked its metabolism to 2-keto-3-deoxygluconate. 2-Keto-3-deoxygluconate appeared to be the true inducer of kduD expression resulting from galacturonate degradation. 5-Keto-4-deoxyuronate or 2,5-diketo-3-deoxygluconate were the true inducers, originating from polygalacturonate cleavage. These three intermediates also appeared to induce pectate lyases, oligogalacturonate lyase, and 5-keto-4-deoxyuronate isomerase synthesis. PMID:3949717

Multiplex PCR assay for detection of recombinant genes encoding fatty acid desaturases fused with lichenase reporter protein in GM plants.

PubMed

Berdichevets, Iryna N; Shimshilashvili, Hristina R; Gerasymenko, Iryna M; Sindarovska, Yana R; Sheludko, Yuriy V; Goldenkova-Pavlova, Irina V

2010-07-01

Thermostable lichenase encoded by licB gene of Clostridium thermocellum can be used as a reporter protein in plant, bacterial, yeast, and mammalian cells. It has important advantages of high sensitivity and specificity in qualitative and quantitative assays. Deletion variants of LicB (e.g., LicBM3) retain its enzymatic activity and thermostability and can be expressed in translational fusion with target proteins without compromising with their properties. Fusion with the lichenase reporter is especially convenient for the heterologous expression of proteins whose analysis is difficult or compromised by host enzyme activities, as it is in case of fatty acid desaturases occurring in all groups of organisms. Recombinant desaturase-lichenase genes can be used for creating genetically modified (GM) plants with improved chill tolerance. Development of an analytical method for detection of fused desaturase-lichenase transgenes is necessary both for production of GM plants and for their certification. Here, we report a multiplex polymerase chain reaction method for detection of desA and desC desaturase genes of cyanobacteria Synechocystis sp. PCC6803 and Synechococcus vulcanus, respectively, fused to licBM3 reporter in GM plants.

Induction of polyploidy by nuclear fusion mechanism upon decreased expression of the nuclear envelope protein LAP2β in the human osteosarcoma cell line U2OS.

PubMed

Ben-Shoshan, Shirley Oren; Simon, Amos J; Jacob-Hirsch, Jasmine; Shaklai, Sigal; Paz-Yaacov, Nurit; Amariglio, Ninette; Rechavi, Gideon; Trakhtenbrot, Luba

2014-01-28

Polyploidy has been recognized for many years as an important hallmark of cancer cells. Polyploid cells can arise through cell fusion, endoreplication and abortive cell cycle. The inner nuclear membrane protein LAP2β plays key roles in nuclear envelope breakdown and reassembly during mitosis, initiation of replication and transcriptional repression. Here we studied the function of LAP2β in the maintenance of cell ploidy state, a role which has not yet been assigned to this protein. By knocking down the expression of LAP2β, using both viral and non-viral RNAi approaches in osteosarcoma derived U2OS cells, we detected enlarged nuclear size, nearly doubling of DNA content and chromosomal duplications, as analyzed by fluorescent in situ hybridization and spectral karyotyping methodologies. Spectral karyotyping analyses revealed that near-hexaploid karyotypes of LAP2β knocked down cells consisted of not only seven duplicated chromosomal markers, as could be anticipated by genome duplication mechanism, but also of four single chromosomal markers. Furthermore, spectral karyotyping analysis revealed that both of two near-triploid U2OS sub-clones contained the seven markers that were duplicated in LAP2β knocked down cells, whereas the four single chromosomal markers were detected only in one of them. Gene expression profiling of LAP2β knocked down cells revealed that up to a third of the genes exhibiting significant changes in their expression are involved in cancer progression. Our results suggest that nuclear fusion mechanism underlies the polyploidization induction upon LAP2β reduced expression. Our study implies on a novel role of LAP2β in the maintenance of cell ploidy status. LAP2β depleted U2OS cells can serve as a model to investigate polyploidy and aneuploidy formation by nuclear fusion mechanism and its involvement in cancerogenesis.

Discovering and understanding oncogenic gene fusions through data intensive computational approaches

PubMed Central

Latysheva, Natasha S.; Babu, M. Madan

2016-01-01

Abstract Although gene fusions have been recognized as important drivers of cancer for decades, our understanding of the prevalence and function of gene fusions has been revolutionized by the rise of next-generation sequencing, advances in bioinformatics theory and an increasing capacity for large-scale computational biology. The computational work on gene fusions has been vastly diverse, and the present state of the literature is fragmented. It will be fruitful to merge three camps of gene fusion bioinformatics that appear to rarely cross over: (i) data-intensive computational work characterizing the molecular biology of gene fusions; (ii) development research on fusion detection tools, candidate fusion prioritization algorithms and dedicated fusion databases and (iii) clinical research that seeks to either therapeutically target fusion transcripts and proteins or leverages advances in detection tools to perform large-scale surveys of gene fusion landscapes in specific cancer types. In this review, we unify these different—yet highly complementary and symbiotic—approaches with the view that increased synergy will catalyze advancements in gene fusion identification, characterization and significance evaluation. PMID:27105842

A 20 bp cis-acting element is both necessary and sufficient to mediate elicitor response of a maize PRms gene.

PubMed

Raventós, D; Jensen, A B; Rask, M B; Casacuberta, J M; Mundy, J; San Segundo, B

1995-01-01

Transient gene expression assays in barley aleurone protoplasts were used to identify a cis-regulatory element involved in the elicitor-responsive expression of the maize PRms gene. Analysis of transcriptional fusions between PRms 5' upstream sequences and a chloramphenicol acetyltransferase reporter gene, as well as chimeric promoters containing PRms promoter fragments or repeated oligonucleotides fused to a minimal promoter, delineated a 20 bp sequence which functioned as an elicitor-response element (ERE). This sequence contains a motif (-246 AATTGACC) similar to sequences found in promoters of other pathogen-responsive genes. The analysis also indicated that an enhancing sequence(s) between -397 and -296 is required for full PRms activation by elicitors. The protein kinase inhibitor staurosporine was found to completely block the transcriptional activation induced by elicitors. These data indicate that protein phosphorylation is involved in the signal transduction pathway leading to PRms expression.

[Value of Immunohistochemical Methods in Detecting EML4-ALK Fusion Mutations: A Meta-analysis].

PubMed

Liu, Chang; Cai, Lu; Zhong, Diansheng; Wang, Jing

2016-01-01

The fusion between echinoderm microtubule-associated protein 4 (EML4) and anaplastic lymphatic tumor kinase (ALK) rearrangement is present in approximately 5% of non-small cell lung cancer (NSCLC) patients. It has been regarded as another new target gene after epidermal growth factor receptor (EGFR) and K-ras. Figures showed that the disease control rate could reach up to 80% in NSCLC patients with EML4-ALK fusion gene after treated with ALK inhibitors. Thus, exploring an accurate and rapid detecting method is the key in screening NSCLC patients with EML4-ALK expressions. The aim of this study is to analyze the specificity and sensitivity of IHC in detecting EML4-ALK fusion mutations. To evaluate the accuracy and clinical value of this method, and then provide basis for individual molecular therapy of NSCLC patients. Using Pubmed database to search all documents required. The deadline of retrieval was February 25, 2015. Then further screening the articles according to the inclusion and exclusion criteria. Using diagnostic test meta-analysis methods to analyze the sensitivity and specificity of the immunohistochemistry (IHC) method compared with fluorescence in situ hybridization (FISH) method. Eleven literatures were added into the meta analysis, there were 3,234 of total cases. The diagnostic odds ratio (DOR) was 1,135.00 (95%CI: 337.10-3,821.46); the area under curve (AUC) of summary receiver operating characteristic curve (SROC) curve was 0.992,3 (SEAUC=0.003,2), the Q* was 0.964,4 (SEQ*=0.008,7). Immunohistochemical detection of EML4-ALK fusion gene mutation with specific antibody is feasible. It has high sensitivity and specificity. IHC can be a simple and rapid way in screening EML4-ALK fusion gene mutation and exhibits important clinical values.

CNVs leading to fusion transcripts in individuals with autism spectrum disorder

PubMed Central

Holt, Richard; Sykes, Nuala H; Conceição, Inês C; Cazier, Jean-Baptiste; Anney, Richard JL; Oliveira, Guiomar; Gallagher, Louise; Vicente, Astrid; Monaco, Anthony P; Pagnamenta, Alistair T

2012-01-01

There is strong evidence that rare copy number variants (CNVs) have a role in susceptibility to autism spectrum disorders (ASDs). Much research has focused on how CNVs mediate a phenotypic effect by altering gene expression levels. We investigated an alternative mechanism whereby CNVs combine the 5′ and 3′ ends of two genes, creating a ‘fusion gene'. Any resulting mRNA with an open reading frame could potentially alter the phenotype via a gain-of-function mechanism. We examined 2382 and 3096 rare CNVs from 996 individuals with ASD and 1287 controls, respectively, for potential to generate fusion transcripts. There was no increased burden in individuals with ASD; 122/996 cases harbored at least one rare CNV of this type, compared with 179/1287 controls (P=0.89). There was also no difference in the overall frequency distribution between cases and controls. We examined specific examples of such CNVs nominated by case–control analysis and a candidate approach. Accordingly, a duplication involving REEP1-POLR1A (found in 3/996 cases and 0/1287 controls) and a single occurrence CNV involving KIAA0319-TDP2 were tested. However, no fusion transcripts were detected by RT-PCR. Analysis of additional samples based on cell line availability resulted in validation of a MAPKAPK5-ACAD10 fusion transcript in two probands. However, this variant was present in controls at a similar rate and is unlikely to influence ASD susceptibility. In summary, although we find no evidence that fusion-gene generating CNVs lead to ASD susceptibility, discovery of a MAPKAPK5-ACAD10 transcript with an estimated frequency of ∼1/200 suggests that gain-of-function mechanisms should be considered in future CNVs studies. PMID:22549408

Targeting both viral and host determinants of human immunodeficiency virus entry, using a new lentiviral vector coexpressing the T20 fusion inhibitor and a selective CCL5 intrakine.

PubMed

Petit, Nicolas; Dorgham, Karim; Levacher, Béatrice; Burlion, Aude; Gorochov, Guy; Marodon, Gilles

2014-08-01

Numerous strategies targeting early and late steps of the HIV life cycle have been proposed for gene therapy. However, targeting viral and host determinants of HIV entry is the only strategy that would prevent viral DNA-mediated CD4(+) cell death while diminishing the possibility for the virus to escape. To this end, we devised a bicistronic lentiviral vector expressing the membrane-bound form of the T20 fusion inhibitor, referred to as the C46 peptide, and a CCR5 superagonist, modified to sequester CCR5 away from the cell surface, referred to as the P2-CCL5 intrakine. We tested the effects of the vector on HIV infection and replication, using the human CEMR5 cell line expressing CD4 and CCR5, and primary human T cells. Transduced cells expressed the C46 peptide, detected with the 2F5 monoclonal antibody by flow cytometry. Expression of the P2-CCL5 intrakine correlates with lower levels of cell surface CCR5. Complete protection against HIV infection could be observed in cells expressing the protective transgenes. Importantly, we show that the combination of the transgenes was more potent than either transgene alone, showing the interest of expressing two entry inhibitors to inhibit HIV infection. Last, genetically modified cells possessed a selective advantage over nonmodified cells on HIV challenge in vitro, showing that modified cells were protected from HIV-induced cell death. Our results demonstrate that lentiviral vectors coexpressing the T20 fusion inhibitor and the P2-CCL5 intrakine represent promising tools for HIV gene therapy.

Cytosolic expression of functional Fab fragments in Escherichia coli using a novel combination of dual SUMO expression cassette and EnBase® cultivation mode.

PubMed

Rezaie, F; Davami, F; Mansouri, K; Agha Amiri, S; Fazel, R; Mahdian, R; Davoudi, N; Enayati, S; Azizi, M; Khalaj, V

2017-05-08

The Escherichia coli expression system is highly effective in producing recombinant proteins. However, there are some limitations in this system, especially in obtaining correctly folded forms of some complex proteins such as Fab fragments. To improve the solubility and folding quality of Fab fragments, we have examined the effect of simultaneous application of a SUMO fusion tag, EnBase ® cultivation mode and a redox mutant strain in the E. coli expression system. A bicistronic gene construct was designed to express an antivascular endothelial growth factor (VEGF) Fab fragment as a model system. The construct contained a dual SUMO fusion gene fragment to encode SUMO-tagged heavy and light chains. While the expression of the construct in batch cultures of BL21 or SHuffle ® transformants produced insoluble and unfolded products, the induction of the transformants in EnBase ® medium resulted in soluble and correctly folded Fab fragment, reaching as high as 19% of the total protein in shuffle strain. The functional assays indicated that the biological activity of the target Fab is similar to the commercial anti-VEGF, Lucentis ® . This study demonstrated that the combination of SUMO fusion technology, EnBase ® cultivation system and recruiting a redox mutant of E. coli can efficiently enhance the solubility and productivity of recombinant Fab fragments. The presented strategy provides not only a novel method to produce soluble and active form of an anti-VEGF Fab but also may use in the efficient production of other antibody fragments. © 2017 The Society for Applied Microbiology.

DNA inversion within the apolipoproteins AI/CIII/AIV-encoding gene cluster of certain patients with premature atherosclerosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Karathanasis, S.K.; Ferris, E.; Haddad, I.A.

1987-10-01

The genes coding for apolipoproteins (apo) AI, CIII, and AIV, designated APOA1, APOC3, and APOA4, respectively, are closely linked and tandemly organized in the long arm of the human chromosome 11. A DNA rearrangement involving the genes encoding apoAI and apoCIII in certain patients with premature atherosclerosis has been associated with deficiency of both apoAI and apoCIII in the plasma of these patients. Structural characterization of the genes for apoAI and apoCIII in one of these patients indicates that this rearrangement consists of a DNA inversion containing portions of the 3' ends of the apoAI and apoCIII genes, including themore » DNA region between these genes. The breakpoints of this DNA inversion are located within the fourth exon of the apoAI gene and the first intron of the apoCIII gene. Thus, this DNA inversion results in reciprocal fusion of the apoAI and apoCIII gene transcriptional units. Expression of these gene fusions in cultured mammalian cells results in stable mRNA transcripts with sequences representing fusions of the apoAI and apoCIII mRNAs. These results indicate that absence of transcripts with correct apoAI and apoCIII mRNA sequences causes apoAI and apoCIII deficiency in the plasma of these patients and suggest that these apolipoproteins are involved in cholesterol homeostasis and protection against premature atherosclerosis.« less

Improving the Immunogenicity of the Mycobacterium bovis BCG Vaccine by Non-Genetic Bacterial Surface Decoration Using the Avidin-Biotin System.

PubMed

Liao, Ting-Yu Angela; Lau, Alice; Joseph, Sunil; Hytönen, Vesa; Hmama, Zakaria

2015-01-01

Current strategies to improve the current BCG vaccine attempt to over-express genes encoding specific M. tuberculosis (Mtb) antigens and/or regulators of antigen presentation function, which indeed have the potential to reshape BCG in many ways. However, these approaches often face serious difficulties, in particular the efficiency and stability of gene expression via nucleic acid complementation and safety concerns associated with the introduction of exogenous DNA. As an alternative, we developed a novel non-genetic approach for rapid and efficient display of exogenous proteins on bacterial cell surface. The technology involves expression of proteins of interest in fusion with a mutant version of monomeric avidin that has the feature of reversible binding to biotin. Fusion proteins are then used to decorate the surface of biotinylated BCG. Surface coating of BCG with recombinant proteins was highly reproducible and stable. It also resisted to the freeze-drying shock routinely used in manufacturing conventional BCG. Modifications of BCG surface did not affect its growth in culture media neither its survival within the host cell. Macrophages phagocytized coated BCG bacteria, which efficiently delivered their surface cargo of avidin fusion proteins to MHC class I and class II antigen presentation compartments. Thereafter, chimeric proteins corresponding to a surrogate antigen derived from ovalbumin and the Mtb specific ESAT6 antigen were generated and tested for immunogenicity in vaccinated mice. We found that BCG displaying ovalbumin antigen induces an immune response with a magnitude similar to that induced by BCG genetically expressing the same surrogate antigen. We also found that BCG decorated with Mtb specific antigen ESAT6 successfully induces the expansion of specific T cell responses. This novel technology, therefore, represents a practical and effective alternative to DNA-based gene expression for upgrading the current BCG vaccine.

Accumulation and processing of a recombinant protein designed as a cleavable fusion to the endogenous Rubisco LSU protein in Chlamydomonas chloroplast

PubMed Central

Muto, Machiko; Henry, Ryan E; Mayfield, Stephen P

2009-01-01

Background Expression of recombinant proteins in green algal chloroplast holds substantial promise as a platform for the production of human therapeutic proteins. A number of proteins have been expressed in the chloroplast of Chlamydomonas reinhardtii, including complex mammalian proteins, but many of these proteins accumulate to significantly lower levels than do endogenous chloroplast proteins. We examined if recombinant protein accumulation could be enhanced by genetically fusing the recombinant reporter protein, luciferase, to the carboxy-terminal end of an abundant endogenous protein, the large subunit of ribulose bisphosphate carboxylase (Rubisco LSU). Additionally, as recombinant proteins fused to endogenous proteins are of little clinical or commercial value, we explored the possibility of engineering our recombinant protein to be cleavable from the endogenous protein in vivo. This strategy would obviate the need for further in vitro processing steps in order to produce the desired recombinant protein. To achieve this, a native protein-processing site from preferredoxin (preFd) was placed between the Rubisco LSU and luciferase coding regions in the fusion protein construct. Results The luciferase from the fusion protein accumulated to significantly higher levels than luciferase expressed alone. By eliminating the endogenous Rubisco large subunit gene (rbcL), we achieved a further increase in luciferase accumulation with respect to luciferase expression in the WT background. Importantly, near-wild type levels of functional Rubisco holoenzyme were generated following the proteolytic removal of the fused luciferase, while luciferase activity for the fusion protein was almost ~33 times greater than luciferase expressed alone. These data demonstrate the utility of using fusion proteins to enhance recombinant protein accumulation in algal chloroplasts, and also show that engineered proteolytic processing sites can be used to liberate the exogenous protein from the endogenous fusion partner, allowing for the purification of the intended mature protein. Conclusion These results demonstrate the utility of fusion proteins in algal chloroplast as a method to increase accumulation of recombinant proteins that are difficult to express. Since Rubisco is ubiquitous to land plants and green algae, this strategy may also be applied to higher plant transgenic expression systems. PMID:19323825

Overexpression of an endo-1,4-β-glucanase V gene (EGV) from Trichoderma reesei leads to the accumulation of cellulase activity in transgenic rice.

PubMed

Li, X Y; Liu, F; Hu, Y F; Xia, M; Cheng, B J; Zhu, S W; Ma, Q

2015-12-21

The ectopic expression of cellulase in biomass can reduce the cost of biofuel conversion. This trait modification technique is highly beneficial for biofuel production. In this study, we isolated an endo-1,4-beta-glucanase gene (EGV) from Trichoderma reesei and inserted this gene downstream of a fragment encoding the signal peptide Apo-SP in a modified pCAMBIA1301 vector to obtain an Apo-SP and AsRed fusion protein. Transient expression of this fusion protein in onion epidermal cells showed that the Apo-SP signal was localized to the plastids. EGV transgenic rice plants that did not carry screening marker genes were obtained through overexpression of the pDTB double T-DNA vector. Western blotting showed that EGV was expressed in the dry straw of T0 generation transgenic rice plants and in fresh leaves of the T1 generation. More importantly, our results also showed that the peptide product of EGV in the transgenic plants folded correctly and was capable of digesting the cellulase substrate CMC. Additionally, cellulase activity remained stable in the straw that had been dried at room temperature for three months. This study presents an important technical approach for the development of transgenic rice straw that has stable cellulase activity and can be used for biofuel conversion.

Development of a Newcastle disease virus vector expressing a foreign gene through an internal ribosomal entry site provides direct proof for a sequential transcription mechanism.

PubMed

Zhang, Zhenyu; Zhao, Wei; Li, Deshan; Yang, Jinlong; Zsak, Laszlo; Yu, Qingzhong

2015-08-01

In the present study, we developed a novel approach for foreign gene expression by Newcastle disease virus (NDV) from a second ORF through an internal ribosomal entry site (IRES). Six NDV LaSota strain-based recombinant viruses vectoring the IRES and a red fluorescence protein (RFP) gene behind the nucleocapsid (NP), phosphoprotein (P), matrix (M), fusion (F), haemagglutinin-neuraminidase (HN) or large polymerase (L) gene ORF were generated using reverse genetics technology. The insertion of the second ORF slightly attenuated virus pathogenicity, but did not affect ability of the virus to grow. Quantitative measurements of RFP expression in virus-infected DF-1 cells revealed that the abundance of viral mRNAs and red fluorescence intensity were positively correlated with the gene order of NDV, 3'-NP-P-M-F-HN-L-5', proving the sequential transcription mechanism for NDV. The results herein suggest that the level of foreign gene expression could be regulated by selecting the second ORF insertion site to maximize the efficacy of vaccine and gene therapy.

Expression and purification of antimicrobial peptide adenoregulin with C-amidated terminus in Escherichia coli.

PubMed

Cao, Wei; Zhou, Yuxun; Ma, Yushu; Luo, Qingping; Wei, Dongzhi

2005-04-01

Adenoregulin is a 33 amino acid antimicrobial peptide isolated from the skin of the arboreal frog Phyllomedusa bicolor. Natural adenoregulin is synthesized with an amidated valine residue at C-terminus and shows lethal effects against filamentous fungi, as well as a broad spectrum of pathogenic microorganisms. A synthetic gene for adenoregulin (ADR) with an additional amino acid glutamine at C-terminus was cloned into pET32a vector to allow expression of ADR as a Trx fusion protein in Escherichia coli BL21(DE3). The resulting expression level of the fusion protein could reach up to 20% of the total cell proteins. The fusion protein could be purified effectively by Ni2+-chelating chromatography. Released from the fusion protein by enterokinase cleavage and purified to homogeneity, the recombinant ADR displayed antimicrobial activity similar to that of the synthetic ADR reported earlier. Comparing the antimicrobial activities of the recombinant adenoregulin with C-amidated terminus to that without an amidated C-terminus, we found that the amide of glutamine at C-terminus of ADR improved its potency on certain microorganisms such as Tritirachium album and Saccharomyces cerevisiae.

Cloning of the Pseudomonas aeruginosa outer membrane porin protein P gene: evidence for a linked region of DNA homology.

PubMed Central

Siehnel, R J; Worobec, E A; Hancock, R E

1988-01-01

The gene encoding the outer membrane phosphate-selective porin protein P from Pseudomonas aeruginosa was cloned into Escherichia coli. The protein product was expressed and transported to the outer membrane of an E. coli phoE mutant and assembled into functional trimers. Expression of a product of the correct molecular weight was confirmed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western blot (immunoblot) analysis, using polyclonal antibodies to protein P monomer and trimer forms. Protein P trimers were partially purified from the E. coli clone and shown to form channels with the same conductance as those formed by protein P from P. aeruginosa. The location and orientation of the protein P-encoding (oprP) gene on the cloned DNA was identified by three methods: (i) mapping the insertion point of transposon Tn501 in a previously isolated P. aeruginosa protein P-deficient mutant; (ii) hybridization of restriction fragments from the cloned DNA to an oligonucleotide pool synthesized on the basis of the amino-terminal protein sequence of protein P; and (iii) fusion of a PstI fragment of the cloned DNA to the amino terminus of the beta-galactosidase gene of pUC8, producing a fusion protein that contained protein P-antigenic epitopes. Structural analysis of the cloned DNA and P. aeruginosa chromosomal DNA revealed the presence of two adjacent PstI fragments which cross-hybridized, suggesting a possible gene duplication. The P-related (PR) region hybridized to the oligonucleotide pool described above. When the PstI fragment which contained the PR region was fused to the beta-galactosidase gene of pUC8, a fusion protein was produced which reacted with a protein P-specific antiserum. However, the restriction endonuclease patterns of the PR region and the oprP gene differed significantly beyond the amino-terminal one-third of the two genes. Images PMID:2834340

IQCJ-SCHIP1, a novel fusion transcript encoding a calmodulin-binding IQ motif protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kwasnicka-Crawford, Dorota A.; Carson, Andrew R.; Scherer, Stephen W.

The existence of transcripts that span two adjacent, independent genes is considered rare in the human genome. This study characterizes a novel human fusion gene named IQCJ-SCHIP1. IQCJ-SCHIP1 is the longest isoform of a complex transcriptional unit that bridges two separate genes that encode distinct proteins, IQCJ, a novel IQ motif containing protein and SCHIP1, a schwannomin interacting protein that has been previously shown to interact with the Neurofibromatosis type 2 (NF2) protein. IQCJ-SCHIP1 is located on the chromosome 3q25 and comprises a 1692-bp transcript encompassing 11 exons spanning 828 kb of the genomic DNA. We show that IQCJ-SCHIP1 mRNAmore » is highly expressed in the brain. Protein encoded by the IQCJ-SCHIP1 gene was localized to cytoplasm and actin-rich regions and in differentiated PC12 cells was also seen in neurite extensions.« less

Temporal regulation and forespore-specific expression of the spore photoproduct lyase gene by sigma-G RNA polymerase during Bacillus subtilis sporulation.

PubMed Central

Pedraza-Reyes, M; Gutiérrez-Corona, F; Nicholson, W L

1994-01-01

Bacterial spores are highly resistant to killing by UV radiation and exhibit unique DNA photochemistry. UV irradiation of spore DNA results in formation of spore photoproduct (SP), the thymine dimer 5-thyminyl-5,6-dihydrothymine. Repair of SP occurs during germination of Bacillus subtilis spores by two distinct routes, either by the general nucleotide excision repair (uvr) pathway or by a novel SP-specific monomerization reaction mediated by the enzyme SP lyase, which is encoded by the spl gene. Repair of SP occurs early in spore germination and is independent of de novo protein synthesis, suggesting that the SP repair enzymes are synthesized during sporulation and are packaged in the dormant spore. To test this hypothesis, the expression of a translational spl-lacZ fusion integrated at the spl locus was monitored during B. subtilis growth and sporulation. beta-Galactosidase expression from the spl-lacZ fusion was silent during vegetative growth and was not DNA damage inducible, but it was activated at morphological stage III of sporulation specifically in the forespore compartment, coincident with activation of expression of the stage III marker enzyme glucose dehydrogenase. Expression of the spl-lacZ fusion was shown to be dependent upon the sporulation-specific RNA polymerase containing the sigma-G factor (E sigma G), as spl-lacZ expression was abolished in a mutant harboring a deletion in the sigG gene and restored by expression of the sigG gene in trans. Primer extension analysis of spl mRNA revealed a major extension product initiating upstream from a small open reading frame of unknown function which precedes spl, and it revealed two other shorter minor extension products. All three extension products were present in higher quantities during sporulation and after sigG induction. The three putative transcripts are all preceded by sequences which share homology with the consensus sigma-G factor-type promoter sequence, but in vitro transcription by purified sigma-G RNA polymerase was detected only from the promoter corresponding to the major extension product. The open reading frame-spl operon therefore appears to be an additional member of the sigma-G regulon, which also includes as members the small, acid-soluble spore proteins which are in large part responsible for spore DNA photochemistry. Therefore, sporulating bacteria appear to coordinately regulate genes whose products not only alter spore DNA photochemistry but also repair the major spore-specific photoproduct during germination Images PMID:8021181

Epithelioid fibrous histiocytoma: molecular characterization of ALK fusion partners in 23 cases.

PubMed

Dickson, Brendan C; Swanson, David; Charames, George S; Fletcher, Christopher Dm; Hornick, Jason L

2018-05-01

Epithelioid fibrous histiocytoma is a rare and distinctive cutaneous neoplasm. Most cases harbor ALK rearrangement and show ALK overexpression, which distinguish this neoplasm from conventional cutaneous fibrous histiocytoma and variants. SQSTM1 and VCL have previously been shown to partner with ALK in one case each of epithelioid fibrous histiocytoma. The purpose of this study was to examine a large cohort of epithelioid fibrous histiocytomas by next-generation sequencing to characterize the nature and prevalence of ALK fusion partners. A retrospective archival review was performed to identify cases of epithelioid fibrous histiocytoma (2012-2016). Immunohistochemistry was performed to confirm ALK expression. Targeted next-generation sequencing was applied on RNA extracted from formalin-fixed paraffin-embedded tissue to identify the fusion partners. Twenty-three cases fulfilled inclusion criteria. The mean patient age was 39 years (range, 8-74), there was no sex predilection, and >75% of cases involved the lower extremities. The most common gene fusions were SQSTM1-ALK (N=12; 52%) and VCL-ALK (N=7; 30%); the other four cases harbored novel fusion partners (DCTN1, ETV6, PPFIBP1, and SPECC1L). The pattern of ALK immunoreactivity was usually granular cytoplasmic (N=12; 52%) or granular cytoplasmic and nuclear (N=10; 43%); the case containing an ETV6 fusion partner showed nuclear staining alone. There was no apparent relationship between tumor morphology and the ALK fusion partner. In summary, SQSTM1 and VCL are the most common ALK fusion partners in epithelioid fibrous histiocytoma; DCTN1, ETV6, PPFIBP1, and SPECC1L represent rare fusion partners. The proteins encoded by these genes play diverse roles in scaffolding, cell adhesion, signaling, and transcription (among others) without clear commonalities. These findings expand the oncogenic promiscuity of many of these ALK fusion genes, which drive neoplasia in tumors of diverse lineages with widely varied clinical behavior. This is the first documented account of ETV6-ALK and SPECC1L-ALK translocations in neoplasms.

A combination HIV reporter virus system for measuring post-entry event efficiency and viral outcome in primary CD4+ T cell subsets.

PubMed

Tilton, Carisa A; Tabler, Caroline O; Lucera, Mark B; Marek, Samantha L; Haqqani, Aiman A; Tilton, John C

2014-01-01

Fusion between the viral membrane of human immunodeficiency virus (HIV) and the host cell marks the end of the HIV entry process and the beginning of a series of post-entry events including uncoating, reverse transcription, integration, and viral gene expression. The efficiency of post-entry events can be modulated by cellular factors including viral restriction factors and can lead to several distinct outcomes: productive, latent, or abortive infection. Understanding host and viral proteins impacting post-entry event efficiency and viral outcome is critical for strategies to reduce HIV infectivity and to optimize transduction of HIV-based gene therapy vectors. Here, we report a combination reporter virus system measuring both membrane fusion and viral promoter-driven gene expression. This system enables precise determination of unstimulated primary CD4+ T cell subsets targeted by HIV, the efficiency of post-entry viral events, and viral outcome and is compatible with high-throughput screening and cell-sorting methods. Copyright © 2013 Elsevier B.V. All rights reserved.

PchR, a regulator of ferripyochelin receptor gene (fptA) expression in Pseudomonas aeruginosa, functions both as an activator and as a repressor.

PubMed Central

Heinrichs, D E; Poole, K

1996-01-01

The product of the pchR gene, an AraC-like regulatory protein, is required for production of the FptA ferric pyochelin receptor in response to iron limitation and pyochelin (D. E. Heinrichs and K. Poole, J. Bacteriol. 175:5882-5889, 1993). The influence of iron, pyochelin, PchR, and FptA on fptA and pchR gene expression was assessed with fptA-lacZ and pchR-lacZ transcriptional fusions. As was expected, the expression of fptA decreased dramatically following the inactivation of pchR by the insertion of an OmegaHg cartridge, although the effect (> 10-fold) was not as dramatic as that of pyochelin deficiency, which obviated fptA gene expression. Insertional inactivation of pchR in a pyochelin-deficient (Pch-) background restored fptA expression to levels observed in the pyochelin-producing (Pch+) PchR- strain, suggesting that PchR represses fptA expression in the absence of pyochelin. Consistent with this, the cloned gene caused a five-fold decrease in the expression of the fptA-lacZ fusion in Escherichia coli. pchR gene expression was inducible by iron limitation, a result in agreement with the previous identification of a Fur box upstream of the gene, although the magnitude of the induction was less than that observed for fptA in response to iron limitation. Expression of pchR was effectively absent in a pyochelin-deficient strain, and insertional inactivation of pchR in a Pch+ or Pch- background caused an increase in pchR gene expression. PchR, thus, negatively regulates its own expression. Two related heptameric sequences, CGAGGAA and CGTGGAT, were identified upstream of the putative -35 region of both fptA and pchR and may function as a binding site for PchR. Insertional inactivation of fptA caused a marked decrease in fptA expression in a Pch+ background and obviated the apparent repression of fptA expression in a Pch- background, reminiscent of the effect of a pchR mutation. The fptA mutant did not, however, exhibit a defect in pchR expression. Interestingly, fptA mutants were unable to grow in the presence of pyochelin, suggesting that FptA is the sole outer membrane receptor for ferric pyochelin. These data indicate that PchR functions as both an activator and a repressor in controlling the expression of fptA and pchR. The involvement of FptA in this control is unclear, although it may be important in mediating the pyochelin effect on fptA expression, possibly by modulating PchR activity. PMID:8626326

Expression of the A56 and K2 proteins is sufficient to inhibit vaccinia virus entry and cell fusion.

PubMed

Wagenaar, Timothy R; Moss, Bernard

2009-02-01

Many animal viruses induce cells to fuse and form syncytia. For vaccinia virus, this phenomenon is associated with mutations affecting the A56 and K2 proteins, which form a multimer (A56/K2) on the surface of infected cells. Recent evidence that A56/K2 interacts with the entry/fusion complex (EFC) and that the EFC is necessary for syncytium formation furnishes a strong connection between virus entry and cell fusion. Among the important remaining questions are whether A56/K2 can prevent virus entry as well as cell-cell fusion and whether these two viral proteins are sufficient as well as necessary for this. To answer these questions, we transiently and stably expressed A56 and K2 in uninfected cells. Uninfected cells expressing A56 and K2 exhibited resistance to fusing with A56 mutant virus-infected cells, whereas expression of A56 or K2 alone induced little or no resistance, which fits with the need for both proteins to bind the EFC. Furthermore, transient or stable expression of A56/K2 interfered with virus entry and replication as determined by inhibition of early expression of a luciferase reporter gene, virus production, and plaque formation. The specificity of this effect was demonstrated by restoring entry after enzymatically removing a chimeric glycophosphatidylinositol-anchored A56/K2 or by binding a monoclonal antibody to A56. Importantly, the antibody disrupted the interaction between A56/K2 and the EFC without disrupting the A56-K2 interaction itself. Thus, we have shown that A56/K2 is sufficient to prevent virus entry and fusion as well as formation of syncytia through interaction with the EFC.

A phycocyanin·phellandrene synthase fusion enhances recombinant protein expression and β-phellandrene (monoterpene) hydrocarbons production in Synechocystis (cyanobacteria).

PubMed

Formighieri, Cinzia; Melis, Anastasios

2015-11-01

Cyanobacteria can be exploited as photosynthetic platforms for heterologous generation of terpene hydrocarbons with industrial applications. Transformation of Synechocystis and heterologous expression of the β-phellandrene synthase (PHLS) gene alone is necessary and sufficient to confer to Synechocystis the ability to divert intermediate terpenoid metabolites and to generate the monoterpene β-phellandrene during photosynthesis. However, terpene synthases, including the PHLS, have a slow Kcat (low Vmax) necessitating high levels of enzyme concentration to enable meaningful rates and yield of product formation. Here, a novel approach was applied to increase the PHLS protein expression alleviating limitations in the rate and yield of β-phellandrene product generation. Different PHLS fusion constructs were generated with the Synechocystis endogenous cpcB sequence, encoding for the abundant in cyanobacteria phycocyanin β-subunit, expressed under the native cpc operon promoter. In one of these constructs, the CpcB·PHLS fusion protein accumulated to levels approaching 20% of the total cellular protein, i.e., substantially higher than expressing the PHLS protein alone under the same endogenous cpc promoter. The CpcB·PHLS fusion protein retained the activity of the PHLS enzyme and catalyzed β-phellandrene synthesis, yielding an average of 3.2 mg product g(-1) dry cell weight (dcw) versus the 0.03 mg g(-1)dcw measured with low-expressing constructs, i.e., a 100-fold yield improvement. In conclusion, the terpene synthase fusion-protein approach is promising, as, in this case, it substantially increased the amount of the PHLS in cyanobacteria, and commensurately improved rates and yield of β-phellandrene hydrocarbons production in these photosynthetic microorganisms. Copyright © 2015 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhong, Yiming; Program in Molecular, Cellular, and Developmental Biology, The Ohio State University, Columbus, OH; Sullenbarger, Brent

Research highlights: {yields} HoxB4 overexpression in human TF1 cells increased the expression of CD61 and CD41a. {yields} HoxB4 fusion protein enhanced megakaryocytic development of CD34{sup +} cord blood cells. {yields} Ectopic HoxB4 increased Tpo receptor expression and decreased c-Myb expression. {yields} HoxB4 RNA silencing increased c-Myb expression and decreased Fli-1 expression. -- Abstract: In order to produce clinically useful quantities of platelets ex vivo we may need to firstly enhance early self-renewal of hematopoietic stem cells (HSCs) and/or megakaryocyte (Mk) progenitors. The homeodomain transcription factor HoxB4 has been shown to be an important regulator of stem cell renewal and hematopoiesis;more » however, its effect on megakaryopoiesis is unclear. In this study, we investigated the effect of HoxB4 overexpression or RNA silencing on megakaryocytic development in the human TF1 progenitor cell line; we then used recombinant tPTD-HoxB4 fusion protein to study the effect of exogenous HoxB4 on megakaryocytic development of human CD34 positively-selected cord blood cells. We found that ectopic HoxB4 in TF1 cells increased the antigen expression of CD61and CD41a, increased the gene expression of thrombopoietin receptor (TpoR), Scl-1, Cyclin D1, Fog-1 and Fli-1 while it decreased c-Myb expression. HoxB4 RNA silencing in TF1 cells decreased the expression of CD61 and CD41a and decreased Fli-1 expression while it increased the expression of c-Myb. Recombinant tPTD-HoxB4 fusion protein increased the percentages and absolute numbers of CD41a and CD61 positive cells during megakaryocytic differentiation of CD34 positively-selected cord blood cells and increased the numbers of colony-forming unit-megakaryocyte (CFU-Mk). Adding tPTD-HoxB4 fusion protein increased the gene expression of TpoR, Cyclin D1, Fog-1 and Fli-1 while it inhibited c-Myb expression. Our data suggest that increased HoxB4 enhanced early megakaryocytic development in human TF1 cells and CD34 positively-selected cord blood cells primarily by upregulating TpoR and Fli-1 expression and downregulating c-Myb expression. Increasing HoxB4 expression or adding recombinant HoxB4 protein might be a way to expand Mks for the production of platelets for use in transfusion medicine.« less

Multiple environmental factors regulate the expression of the carbohydrate-selective OprB porin of Pseudomonas aeruginosa.

PubMed

Adewoye, L O; Worobec, E A

1999-12-01

In response to low extracellular glucose concentration, Pseudomonas aeruginosa induces the expression of the outer membrane carbohydrate-selective OprB porin. The promoter region of the oprB gene was cloned into a lacZ transcriptional fusion vector, and the construct was mobilized into P. aeruginosa OprB-deficient strain, WW100, to evaluate additional environmental factors that influence OprB porin gene expression. Growth temperature, pH of the growth medium, salicylate concentration, and carbohydrate source were found to differentially influence porin expression. This expression pattern was compared to those of whole-cell [14C]glucose uptake under conditions of high osmolarity, ionicity, variable pH, growth temperatures, and carbohydrate source. These studies revealed that the high-affinity glucose transport genes are down-regulated by salicylic acid, differentially regulated by pH and temperature, and are specifically responsive to exogenous glucose induction.

Up-Regulated Expression of AOS-LOXa and Increased Eicosanoid Synthesis in Response to Coral Wounding

PubMed Central

Lõhelaid, Helike; Teder, Tarvi; Tõldsepp, Kadri; Ekins, Merrick; Samel, Nigulas

2014-01-01

In octocorals, a catalase–like allene oxide synthase (AOS) and an 8R-lipoxygenase (LOX) gene are fused together encoding for a single AOS-LOX fusion protein. Although the AOS-LOX pathway is central to the arachidonate metabolism in corals, its biological function in coral homeostasis is unclear. Using an acute incision wound model in the soft coral Capnella imbricata, we here test whether LOX pathway, similar to its role in plants, can contribute to the coral damage response and regeneration. Analysis of metabolites formed from exogenous arachidonate before and after fixed time intervals following wounding indicated a significant increase in AOS-LOX activity in response to mechanical injury. Two AOS-LOX isoforms, AOS-LOXa and AOS-LOXb, were cloned and expressed in bacterial expression system as active fusion proteins. Transcription levels of corresponding genes were measured in normal and stressed coral by qPCR. After wounding, AOS-LOXa was markedly up-regulated in both, the tissue adjacent to the incision and distal parts of a coral colony (with the maximum reached at 1 h and 6 h post wounding, respectively), while AOS-LOXb was stable. According to mRNA expression analysis, combined with detection of eicosanoid product formation for the first time, the AOS-LOX was identified as an early stress response gene which is induced by mechanical injury in coral. PMID:24551239

Ephrin reverse signaling mediates palatal fusion and epithelial-to-mesenchymal transition independently of Tgfß3.

PubMed

Serrano, Maria J; Liu, Jingpeng; Svoboda, Kathy K H; Nawshad, Ali; Benson, M Douglas

2015-12-01

The mammalian secondary palate forms from shelves of epithelia-covered mesenchyme that meet at midline and fuse. The midline epithelial seam (MES) is thought to degrade by apoptosis, epithelial-to-mesenchymal transition (EMT), or both. Failure to degrade the MES blocks fusion and causes cleft palate. It was previously thought that transforming growth factor ß3 (Tgfß3) is required to initiate fusion. Members of the Eph tyrosine kinase receptor family and their membrane-bound ephrin ligands are expressed on the MES. We demonstrated that treatment of mouse palates with recombinant EphB2/Fc to activate ephrin reverse signaling (where the ephrin acts as a receptor and transduces signals from its cytodomain) was sufficient to cause mouse palatal fusion when Tgfß3 signaling was blocked by an antibody against Tgfß3 or by an inhibitor of the TgfßrI serine/threonine receptor kinase. Cultured palatal epithelial cells traded their expression of epithelial cell markers for that of mesenchymal cells and became motile after treatment with EphB2/Fc. They concurrently increased their expression of the EMT-associated transcription factors Snail, Sip1, and Twist1. EphB2/Fc did not cause apoptosis in these cells. These data reveal that ephrin reverse signaling directs palatal fusion in mammals through a mechanism that involves EMT but not apoptosis and activates a gene expression program not previously associated with ephrin reverse signaling. © 2015 Wiley Periodicals, Inc.

cDNA microarray analyses reveal candidate marker genes for the detection of ascidian disease in Korea.

PubMed

Azumi, Kaoru; Usami, Takeshi; Kamimura, Akiko; Sabau, Sorin V; Miki, Yasufumi; Fujie, Manabu; Jung, Sung-Ju; Kitamura, Shin-Ichi; Suzuki, Satoru; Yokosawa, Hideyoshi

2007-12-01

A serious disease of the ascidian Halocynthia roretzi has been spread extensively among Korean aquaculture sites. To reveal the cause of the disease and establish a monitoring system for it, we constructed a cDNA microarray spotted with 2,688 cDNAs derived from H. roretzi hemocyte cDNA libraries to detect genes differentially expressed in hemocytes between diseased and non-diseased ascidians. We detected 21 genes showing increased expression and 16 genes showing decreased expression in hemocytes from diseased ascidians compared with those from non-diseased ascidians. RT-PCR analyses confirmed that the expression levels of genes encoding astacin, lysozyme, ribosomal protein PO, and ubiquitin-ribosomal protein L40e fusion protein were increased in hemocytes from diseased ascidians, while those of genes encoding HSP40, HSP70, fibronectin, carboxypeptidase and lactate dehydrogenase were decreased. These genes were expressed not only in hemocytes but also in various other tissues in ascidians. Furthermore, the expression of glutathione-S transferase omega, which is known to be up-regulated in H. roretzi hemocytes during inflammatory responses, was strongly increased in hemocytes from diseased ascidians. These gene expression profiles suggest that immune and inflammatory reactions occur in the hemocytes of diseased ascidians. These genes will be good markers for detecting and monitoring this disease of ascidians in Korean aquaculture sites.

Rate of Amino Acid Substitution Is Influenced by the Degree and Conservation of Male-Biased Transcription Over 50 Myr of Drosophila Evolution

PubMed Central

Grath, Sonja; Parsch, John

2012-01-01

Sex-biased gene expression (i.e., the differential expression of genes between males and females) is common among sexually reproducing species. However, genes often differ in their sex-bias classification or degree of sex bias between species. There is also an unequal distribution of sex-biased genes (especially male-biased genes) between the X chromosome and the autosomes. We used whole-genome expression data and evolutionary rate estimates for two different Drosophilid lineages, melanogaster and obscura, spanning an evolutionary time scale of around 50 Myr to investigate the influence of sex-biased gene expression and chromosomal location on the rate of molecular evolution. In both lineages, the rate of protein evolution correlated positively with the male/female expression ratio. Genes with highly male-biased expression, genes expressed specifically in male reproductive tissues, and genes with conserved male-biased expression over long evolutionary time scales showed the fastest rates of evolution. An analysis of sex-biased gene evolution in both lineages revealed evidence for a “fast-X” effect in which the rate of evolution was greater for X-linked than for autosomal genes. This pattern was particularly pronounced for male-biased genes. Genes located on the obscura “neo-X” chromosome, which originated from a recent X-autosome fusion, showed rates of evolution that were intermediate between genes located on the ancestral X-chromosome and the autosomes. This suggests that the shift to X-linkage led to an increase in the rate of molecular evolution. PMID:22321769

Molecular diagnostics in the management of rhabdomyosarcoma.

PubMed

Arnold, Michael A; Barr, Fredric G

2017-02-01

A classification of rhabdomyosarcoma (RMS) with prognostic relevance has primarily relied on clinical features and histologic classification as either embryonal or alveolar RMS. The PAX3-FOXO1 and PAX7-FOXO1 gene fusions occur in 80% of cases with the alveolar subtype and are more predictive of outcome than histologic classification. Identifying additional molecular hallmarks that further subclassify RMS is an active area of research. Areas Covered: The authors review the current state of the PAX3-FOXO1 and PAX7-FOXO1 fusions as prognostic biomarkers. Emerging biomarkers, including mRNA expression profiling, MYOD1 mutations, RAS pathway mutations and gene fusions involving NCOA2 or VGLL2 are also reviewed. Expert commentary: Strategies for modifying RMS risk stratification based on molecular biomarkers are emerging with the potential to transform the clinical management of RMS, ultimately improving patient outcomes by tailoring therapy to predicted patient risk and identifying targets for novel therapies.

Nitrogenase activity of Herbaspirillum seropedicae grown under low iron levels requires the products of nifXorf1 genes.

PubMed

Klassen, Giseli; de Oliveira Pedrosa, Fábio; de Souza, Emanuel M; Yates, M Geoffrey; Rigo, Liu Un

2003-07-29

Herbaspirillum seropedicae strains mutated in the nifX or orf1 genes showed 90% or 50% reduction in nitrogenase activity under low levels of iron or molybdenum respectively. Mutations in nifX or orf1 genes did not affect nif gene expression since a nifH::lacZ fusion was fully active in both mutants. nifX and the contiguous gene orf1 are essential for maximum nitrogen fixation under iron limitation and are probably involved in synthesis of nitrogenase iron or iron-molybdenum clusters.

Evaluation of EML4-ALK Fusion Proteins in Non-Small Cell Lung Cancer Using Small Molecule Inhibitors12

PubMed Central

Li, Yongjun; Ye, Xiaofen; Liu, Jinfeng; Zha, Jiping; Pei, Lin

2011-01-01

The echinoderm microtubule-associated protein-like 4-anaplastic lymphoma kinase (EML4-ALK) fusion gene resulting from an inversion within chromosome 2p occurs in approximately 5% of non-small cell lung cancer and is mutually exclusive with Ras and EGFR mutations. In this study, we have used a potent and selective ALK small molecule inhibitor, NPV-TAE684, to assess the oncogenic role of EML4-ALK in non-small cell lung cancer (NSCLC). We show here that TAE684 inhibits proliferation and induces cell cycle arrest, apoptosis, and tumor regression in two NSCLC models that harbor EML4-ALK fusions. TAE684 inhibits EML4-ALK activation and its downstream signaling including ERK, AKT, and STAT3. We used microarray analysis to carry out targeted pathway studies of gene expression changes in H2228 NSCLC xenograft model after TAE684 treatment and identified a gene signature of EML4-ALK inhibition. The gene signature represents 1210 known human genes, and the top biologic processes represented by these genes are cell cycle, DNA synthesis, cell proliferation, and cell death. We also compared the effect of TAE684 with PF2341066, a c-Met and ALK small molecule inhibitor currently in clinical trial in cancers harboring ALK fusions, and demonstrated that TAE684 is a much more potent inhibitor of EML4-ALK. Our data demonstrate that EML4-ALK plays an important role in the pathogenesis of a subset of NSCLC and provides insight into the mechanism of EML4-ALK inhibition by a small molecule inhibitor. PMID:21245935

The C. elegans che-1 gene encodes a zinc finger transcription factor required for specification of the ASE chemosensory neurons.

PubMed

Uchida, Okiko; Nakano, Hiroyuki; Koga, Makoto; Ohshima, Yasumi

2003-04-01

Chemotaxis to water-soluble chemicals such as NaCl is an important behavior of C. elegans when seeking food. ASE chemosensory neurons have a major role in this behavior. We show that che-1, defined by chemotaxis defects, encodes a zinc-finger protein similar to the GLASS transcription factor required for photoreceptor cell differentiation in Drosophila, and that che-1 is essential for specification and function of ASE neurons. Expression of a che-1::gfp fusion construct was predominant in ASE. In che-1 mutants, expression of genes characterizing ASE such as seven-transmembrane receptors, guanylate cyclases and a cyclic-nucleotide gated channel is lost. Ectopic expression of che-1 cDNA induced expression of ASE-specific marker genes, a dye-filling defect in neurons other than ASE and dauer formation.

Regulation of glutamine synthetase II activity in Rhizobium meliloti 104A14.

PubMed Central

Shatters, R G; Somerville, J E; Kahn, M L

1989-01-01

Most rhizobia contain two glutamine synthetase (GS) enzymes: GSI, encoded by glnA, and GSII, encoded by glnII. We have found that WSU414, a Rhizobium meliloti 104A14 glutamine auxotroph derived from a glnA parental strain, is an ntrA mutant. The R. meliloti glnII promoter region contains DNA sequences similar to those found in front of other genes that require ntrA for their transcription. No GSII was found in the glnA ntrA mutant, and when a translational fusion of glnII to the Escherichia coli lacZ gene was introduced into WSU414, no beta-galactosidase was expressed. These results indicate that ntrA is required for glnII expression. The ntrA mutation did not prevent the expression of GSI. In free-living culture, the level of GSII and of the glnII-lacZ fusion protein was regulated by altering transcription in response to available nitrogen. No GSII protein was detected in alfalfa, pea, or soybean nodules when anti-GSII-specific antiserum was used. Images PMID:2570059

Genotype-phenotype relationships in human red/green color-vision defects: molecular and psychophysical studies.

PubMed Central

Deeb, S S; Lindsey, D T; Hibiya, Y; Sanocki, E; Winderickx, J; Teller, D Y; Motulsky, A G

1992-01-01

The relationship between the molecular structure of the X-linked red and green visual pigment genes and color-vision phenotype as ascertained by anomaloscopy was studied in 64 color-defective males. The great majority of red-green defects were associated with either the deletion of the green-pigment gene or the formation of 5' red-green hybrid genes or 5' green-red hybrid genes. A rapid PCR-based method allowed detection of hybrid genes, including those undetectable by Southern blot analysis, as well as more precise localization of the fusion points in hybrid genes. Protan color-vision defects appeared always associated with 5' red-green hybrid genes. Carriers of single red-green hybrid genes with fusion in introns 1-4 were protanopes. However, carriers of hybrid genes with red-green fusions in introns 2, 3, or 4 in the presence of additional normal green genes manifested as either protanopes or protanomalous trichromats, with the majority being protanomalous. Deutan defects were associated with green-pigment gene deletions, with 5' green-red hybrid genes, or, rarely, with 5' green-red-green hybrid genes. Complete green-pigment gene deletions or green-red fusions in intron 1 were usually associated with deuteranopia, although we unexpectedly found three carriers of a single red-pigment gene without any green-pigment genes to be deuteranomalous trichromats. All but one of the other deuteranomalous subjects had green-red hybrid genes with intron 1, 2, 3, or 4 fusions, as well as several normal green-pigment genes. The one exception had a grossly normal gene array, presumably with a more subtle mutation. Amino acid differences in exon 5 largely determine whether a hybrid gene will be more redlike or more greenlike in phenotype. Various discrepancies as to severity (dichromacy or trichromacy) remain unexplained but may arise because of variability of expression, postreceptoral variation, or both. When phenotypic color-vision defects exist, the kind of defect (protan or deutan) can be predicted by molecular analysis. Red-green hybrid genes are probably always associated with protan color-vision defects, while the presence of green-red hybrid genes may not always manifest phenotypically with color-vision defects. Four subjects who were found to have 5' green-red hybrid genes in addition to normal red- and green-pigment genes had normal color vision as determined by anomaloscopy. These were discovered among a group of 129 Caucasian males who had been recruited as volunteers for a vision study.(ABSTRACT TRUNCATED AT 400 WORDS) Images Figure 3 PMID:1415215

confFuse: High-Confidence Fusion Gene Detection across Tumor Entities.

PubMed

Huang, Zhiqin; Jones, David T W; Wu, Yonghe; Lichter, Peter; Zapatka, Marc

2017-01-01

Background: Fusion genes play an important role in the tumorigenesis of many cancers. Next-generation sequencing (NGS) technologies have been successfully applied in fusion gene detection for the last several years, and a number of NGS-based tools have been developed for identifying fusion genes during this period. Most fusion gene detection tools based on RNA-seq data report a large number of candidates (mostly false positives), making it hard to prioritize candidates for experimental validation and further analysis. Selection of reliable fusion genes for downstream analysis becomes very important in cancer research. We therefore developed confFuse, a scoring algorithm to reliably select high-confidence fusion genes which are likely to be biologically relevant. Results: confFuse takes multiple parameters into account in order to assign each fusion candidate a confidence score, of which score ≥8 indicates high-confidence fusion gene predictions. These parameters were manually curated based on our experience and on certain structural motifs of fusion genes. Compared with alternative tools, based on 96 published RNA-seq samples from different tumor entities, our method can significantly reduce the number of fusion candidates (301 high-confidence from 8,083 total predicted fusion genes) and keep high detection accuracy (recovery rate 85.7%). Validation of 18 novel, high-confidence fusions detected in three breast tumor samples resulted in a 100% validation rate. Conclusions: confFuse is a novel downstream filtering method that allows selection of highly reliable fusion gene candidates for further downstream analysis and experimental validations. confFuse is available at https://github.com/Zhiqin-HUANG/confFuse.

Characterization of two trpE genes encoding anthranilate synthase {alpha}-subunit in Azospirillum brasilense

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ge Shimei; Xie Baoen; Chen Sanfeng

2006-03-10

The previous report from our laboratory has recently identified a new trpE gene (termed trpE {sub 2}) which exists independently in Azospirillum brasilense Yu62. In this study, amplification of trpE(G) (termed trpE {sub 1}(G) here) confirmed that there are two copies of trpE gene, one trpE being fused into trpG while the other trpE existed independently. This is First report to suggest that two copies of the trpE gene exist in this bacterium. Comparison of the nucleotide sequence demonstrated that putative leader peptide, terminator, and anti-terminator were found upstream of trpE {sub 1}(G) while these sequence features did not existmore » in front of trpE {sub 2}. The {beta}-galactosidase activity of an A. brasilense strain carrying a trpE {sub 2}-lacZ fusion remained constant at different tryptophan concentrations, but the {beta}-galactosidase activity of the same strain carrying a trpE {sub 1}(G)-lacZ fusion decreased as the tryptophan concentration increased. These data suggest that the expression of trpE {sub 1}(G) is regulated at the transcriptional level by attenuation while trpE {sub 2} is constantly expressed. The anthranilate synthase assays with trpE {sub 1}(G){sup -} and trpE {sub 2} {sup -} mutants demonstrated that TrpE{sub 1}(G) fusion protein is feedback inhibited by tryptophan while TrpE{sub 2} protein is not. We also found that both trpE {sub 1}(G) and trpE {sub 2} gene products were involved in IAA synthesis.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Paquette, Stéphane G.; Institute of Medical Science, Faculty of Medicine, University of Toronto, Toronto, Ontario; Banner, David

Pandemic H1N1 influenza A (H1N1pdm) elicits stronger pulmonary inflammation than previously circulating seasonal H1N1 influenza A (sH1N1), yet mechanisms of inflammatory activation in respiratory epithelial cells during H1N1pdm infection are unclear. We investigated host responses to H1N1pdm/sH1N1 infection and virus entry mechanisms in primary human bronchial epithelial cells in vitro. H1N1pdm infection rapidly initiated a robust inflammatory gene signature (3 h post-infection) not elicited by sH1N1 infection. Protein secretion inhibition had no effect on gene induction. Infection with membrane fusion deficient H1N1pdm failed to induce robust inflammatory gene expression which was rescued with restoration of fusion ability, suggesting H1N1pdm directlymore » triggered the inflammatory signature downstream of membrane fusion. Investigation of intra-virion components revealed H1N1pdm viral RNA (vRNA) triggered a stronger inflammatory phenotype than sH1N1 vRNA. Thus, our study is first to report H1N1pdm induces greater inflammatory gene expression than sH1N1 in vitro due to direct virus–epithelial cell interaction. - Highlights: • We investigated H1N1pdm/sH1N1 infection in primary epithelial cells. • H1N1pdm directly initiated a robust inflammatory gene signature, sH1N1 did not. • H1N1pdm viral RNA triggered a stronger response than sH1N1. • H1N1pdm induces greater response due to direct virus–cell interaction. • These results have potential to impact vaccine and therapeutic development.« less

Histological and immunohistochemical characteristics of undifferentiated small round cell sarcomas associated with CIC-DUX4 and BCOR-CCNB3 fusion genes.

PubMed

Yamada, Yuichi; Kuda, Masaaki; Kohashi, Kenichi; Yamamoto, Hidetaka; Takemoto, Junkichi; Ishii, Takeaki; Iura, Kunio; Maekawa, Akira; Bekki, Hirofumi; Ito, Takamichi; Otsuka, Hiroshi; Kuroda, Makoto; Honda, Yumi; Sumiyoshi, Shinji; Inoue, Takeshi; Kinoshita, Naoe; Nishida, Atsushi; Yamashita, Kyoko; Ito, Ichiro; Komune, Shizuo; Taguchi, Tomoaki; Iwamoto, Yukihide; Oda, Yoshinao

2017-04-01

CIC-DUX4 and BCOR-CCNB3 fusion-gene-associated small round cell sarcomas account for a proportion of pediatric small round cell sarcomas, but their pathological features have not been sufficiently clarified. We reviewed a large number of soft tissue tumors registered at our institution, retrieved the cases of unclassified tumors with a small round cell component, and subjected them to histopathological, immunohistochemical, and gene profile analysis. We reviewed 164 cases of unclassified tumors with a small round cell component and analyzed them by RT-PCR and FISH. Tumors positive for a specific fusion-gene were also subjected to histopathological and immunohistochemical examinations. We identified 16 cases of BCOR-CCNB3/CIC-associated (CIC-DUX4 or CIC gene rearrangement-positive) sarcomas. These included seven BCOR-CCNB3 sarcomas and nine CIC-associated sarcomas. Heterogeneous elements included a myxoid spindle cell component in three BCOR-CCNB3 sarcomas and an epithelioid cell component in two CIC-associated sarcomas (one CIC-DUX4-positive and one CIC-DUX4-negative sarcomas). Mitotic activity was low in both heterogeneous components. By immunohistochemistry, in seven BCOR-CCNB3 sarcomas expression of EMA was positive in two cases, of p63 in three, of CD56 in six, of TLE1 in seven, of NKX2.2 in two, of CCNB3 in seven, and of BCOR in six cases (one case could not be tested for BCOR). In nine cases of CIC-associated sarcoma, CD56 was expressed in five, alpha-smooth muscle actin in one, ERG in three, and CD99, WT1 and TLE1 each in eight cases. Both sarcoma types showed not only a small round cell component, but also a myxoid/epithelioid component with low mitotic activity.

Sex Chromosome Turnover Contributes to Genomic Divergence between Incipient Stickleback Species

PubMed Central

Yoshida, Kohta; Makino, Takashi; Yamaguchi, Katsushi; Shigenobu, Shuji; Hasebe, Mitsuyasu; Kawata, Masakado; Kume, Manabu; Mori, Seiichi; Peichel, Catherine L.; Toyoda, Atsushi; Fujiyama, Asao; Kitano, Jun

2014-01-01

Sex chromosomes turn over rapidly in some taxonomic groups, where closely related species have different sex chromosomes. Although there are many examples of sex chromosome turnover, we know little about the functional roles of sex chromosome turnover in phenotypic diversification and genomic evolution. The sympatric pair of Japanese threespine stickleback (Gasterosteus aculeatus) provides an excellent system to address these questions: the Japan Sea species has a neo-sex chromosome system resulting from a fusion between an ancestral Y chromosome and an autosome, while the sympatric Pacific Ocean species has a simple XY sex chromosome system. Furthermore, previous quantitative trait locus (QTL) mapping demonstrated that the Japan Sea neo-X chromosome contributes to phenotypic divergence and reproductive isolation between these sympatric species. To investigate the genomic basis for the accumulation of genes important for speciation on the neo-X chromosome, we conducted whole genome sequencing of males and females of both the Japan Sea and the Pacific Ocean species. No substantial degeneration has yet occurred on the neo-Y chromosome, but the nucleotide sequence of the neo-X and the neo-Y has started to diverge, particularly at regions near the fusion. The neo-sex chromosomes also harbor an excess of genes with sex-biased expression. Furthermore, genes on the neo-X chromosome showed higher non-synonymous substitution rates than autosomal genes in the Japan Sea lineage. Genomic regions of higher sequence divergence between species, genes with divergent expression between species, and QTL for inter-species phenotypic differences were found not only at the regions near the fusion site, but also at other regions along the neo-X chromosome. Neo-sex chromosomes can therefore accumulate substitutions causing species differences even in the absence of substantial neo-Y degeneration. PMID:24625862

Detection of normal and chimeric nucleophosmin in human cells.

PubMed

Cordell, J L; Pulford, K A; Bigerna, B; Roncador, G; Banham, A; Colombo, E; Pelicci, P G; Mason, D Y; Falini, B

1999-01-15

In anaplastic large-cell lymphoma (ALCL), the (2;5) chromosomal translocation creates a fusion gene encoding the 80-kD NPM-ALK hybrid protein. This report describes three new monoclonal antibodies, two of which recognize, by Western blotting, the N-terminal portion of NPM present in the NPM-ALK fusion protein and also in two other NPM fusion proteins (NPM-RARalpha and NPM-MLF1). The third antibody recognizes the C-terminal portion (deleted in NPM-ALK) and reacts only with wild-type NPM. The three antibodies immunostain wild-type NPM (in paraffin-embedded normal tissue samples) in cell nuclei and in the cytoplasm of mitotic cells. Cerebral neurones, exceptionally, show diffuse cytoplasmic labeling. In contrast to normal tissues, the two antibodies against the N-terminal portion of NPM labeled the cytoplasm of neoplastic cells, in four ALK-positive ALCL, reflecting their reactivity with NPM-ALK fusion protein, whereas the antibody to the C-terminal NPM epitope labeled only cell nuclei. Immunocytochemical labeling with these antibodies can therefore confirm that an ALK-positive lymphoma expresses NPM-ALK (rather than a variant ALK-fusion protein) and may also provide evidence for chromosomal anomalies involving the NPM gene other than the classical (2;5) translocation.

Location of Promoter and Operator Sites in the Biotin Gene Cluster of Escherichia coli

PubMed Central

Cleary, Paul P.; Campbell, Allan; Chang, Robin

1972-01-01

Biotin independence in E. coli requires five closely linked genes, bioA, bioB, bioF, bioC, and bioD. The residual gene activity of deletion mutants has been studied by complementation and enzyme assays. Deletion of the left end of the bioA gene does not impair expression of the remaining genes, but deletions from the left extending into bioB abolish all gene expression. Nonsense mutations in bioB reduce expression of bioC, bioF, and bioD. Therefore, the four genes, bioB, bioF, bioC, and bioD, are transcribed as a unit from left to right, from a promotor located between bioA and bioB. Expression of the bio genes is repressible by added biotin. Deletions removing the left end of bioA do not affect repressibility of bioD. Therefore the operator, as well as the promoter, lie to the right of bioA. One deletion that removes bioA, bioB, and bioF renders the bioD gene constitutive, presumably by fusion to an unknown operon. Therefore, the operator lies to the left of bioC. PMID:4559599

ChimeRScope: a novel alignment-free algorithm for fusion transcript prediction using paired-end RNA-Seq data

PubMed Central

Li, You; Heavican, Tayla B.; Vellichirammal, Neetha N.; Iqbal, Javeed

2017-01-01

Abstract The RNA-Seq technology has revolutionized transcriptome characterization not only by accurately quantifying gene expression, but also by the identification of novel transcripts like chimeric fusion transcripts. The ‘fusion’ or ‘chimeric’ transcripts have improved the diagnosis and prognosis of several tumors, and have led to the development of novel therapeutic regimen. The fusion transcript detection is currently accomplished by several software packages, primarily relying on sequence alignment algorithms. The alignment of sequencing reads from fusion transcript loci in cancer genomes can be highly challenging due to the incorrect mapping induced by genomic alterations, thereby limiting the performance of alignment-based fusion transcript detection methods. Here, we developed a novel alignment-free method, ChimeRScope that accurately predicts fusion transcripts based on the gene fingerprint (as k-mers) profiles of the RNA-Seq paired-end reads. Results on published datasets and in-house cancer cell line datasets followed by experimental validations demonstrate that ChimeRScope consistently outperforms other popular methods irrespective of the read lengths and sequencing depth. More importantly, results on our in-house datasets show that ChimeRScope is a better tool that is capable of identifying novel fusion transcripts with potential oncogenic functions. ChimeRScope is accessible as a standalone software at (https://github.com/ChimeRScope/ChimeRScope/wiki) or via the Galaxy web-interface at (https://galaxy.unmc.edu/). PMID:28472320

Novel BCOR-MAML3 and ZC3H7B-BCOR Gene Fusions in Undifferentiated Small Blue Round Cell Sarcomas.

PubMed

Specht, Katja; Zhang, Lei; Sung, Yun-Shao; Nucci, Marisa; Dry, Sarah; Vaiyapuri, Sumathi; Richter, Gunther H S; Fletcher, Christopher D M; Antonescu, Cristina R

2016-04-01

Small blue round cell tumors (SBRCTs) are a heterogenous group of tumors that are difficult to diagnose because of overlapping morphologic, immunohistochemical, and clinical features. About two-thirds of EWSR1-negative SBRCTs are associated with CIC-DUX4-related fusions, whereas another small subset shows BCOR-CCNB3 X-chromosomal paracentric inversion. Applying paired-end RNA sequencing to an SBRCT index case of a 44-year-old man, we identified a novel BCOR-MAML3 chimeric fusion, which was validated by reverse transcription polymerase chain reaction and fluorescence in situ hybridization techniques. We then screened a total of 75 SBRCTs lacking EWSR1, FUS, SYT, CIC, and BCOR-CCNB3 abnormalities for BCOR break-apart probes by fluorescence in situ hybridization to detect potential recurrent BCOR gene rearrangements outside the typical X-chromosomal inversion. Indeed, 8/75 (11%) SBRCTs showed distinct BCOR gene rearrangements, with 2 cases each showing either a BCOR-MAML3 or the alternative ZC3H7B-BCOR fusion, whereas no fusion partner was detected in the remaining 4 cases. Gene expression of the BCOR-MAML3-positive index case showed a distinct transcriptional profile with upregulation of HOX-gene signature, compared with classic Ewing's sarcoma or CIC-DUX4-positive SBRCTs. The clinicopathologic features of the SBRCTs with alternative BCOR rearrangements were also compared with a group of BCOR-CCNB3 inversion-positive cases, combining 11 from our files with a meta-analysis of 42 published cases. The BCOR-CCNB3-positive tumors occurred preferentially in children and in bone, in contrast to alternative BCOR-rearranged SBRCTs, which presented in young adults, with a variable anatomic distribution. Furthermore, BCOR-rearranged tumors often displayed spindle cell areas, either well defined in intersecting fascicles or blending with the round cell component, which appears distinct from most other fusion-positive SBRCTs and shares histologic overlap with poorly differentiated synovial sarcoma.

Novel BCOR-MAML3 and ZC3H7B-BCOR Gene Fusions in Undifferentiated Small Blue Round Cell Sarcomas

PubMed Central

Specht, Katja; Zhang, Lei; Sung, Yun-Shao; Nucci, Marisa; Dry, Sarah; Vaiyapuri, Sumathi; Richter, Gunther HS; Fletcher, Christopher DM; Antonescu, Cristina R

2015-01-01

Small blue round cell tumors (SBRCTs) are a heterogenous group of tumors that are difficult to diagnose due to overlapping morphologic, immunohistochemical and clinical features. About two-thirds of EWSR1-negative SBRCTs are associated with CIC-DUX4 related fusions, while another small subset shows BCOR-CCNB3 X-chromosomal paracentric inversion. Applying paired-end RNA sequencing to an SBRCT index case of a 44 year-old male, we identified a novel BCOR-MAML3 chimeric fusion, which was validated by RT-PCR and FISH techniques. We then screened a total of 75 SBRCTs lacking EWSR1, FUS, SYT, CIC and BCOR-CCNB3 abnormalities, for BCOR break-apart probes by FISH to detect potential recurrent BCOR gene rearrangements, outside the typical X-chromosomal inversion. Indeed, 8/75 (11%) SBRCTs showed distinct BCOR gene rearrangements, with 2 cases each showing either a BCOR-MAML3 or the alternative ZC3H7B-BCOR fusion, while no fusion partner was detected in the remaining 4 cases. Gene expression of the BCOR-MAML3 positive index case showed a distinct transcriptional profile with upregulation of HOX-gene signature, compared to classic Ewing sarcoma or CIC-DUX4-positive SBRCTs. The clinicopathologic features of the SRBCTs with alternative BCOR rearrangements were also compared with a group of BCOR-CCNB3 inversion positive cases, combining 11 from our files with a meta-analysis of 42 published cases. The BCOR-CCNB3-positive tumors occurred preferentially in children and in bone, in contrast to alternative BCOR-rearranged SBRCTs which presented in young adults, with a variable anatomic distribution. Furthermore BCOR-rearranged tumors often displayed spindle cell areas, either well-defined in intersecting fascicles or blending with the round cell component, which appears distinct from most other fusion-positive SBRCTs and shares histologic overlap with poorly differentiated synovial sarcoma. PMID:26752546

Paediatric and adult soft tissue sarcomas with NTRK1 gene fusions: a subset of spindle cell sarcomas unified by a prominent myopericytic/haemangiopericytic pattern.

PubMed

Haller, Florian; Knopf, Jasmin; Ackermann, Anne; Bieg, Matthias; Kleinheinz, Kortine; Schlesner, Matthias; Moskalev, Evgeny A; Will, Rainer; Satir, Ali Abdel; Abdelmagid, Ibtihalat E; Giedl, Johannes; Carbon, Roman; Rompel, Oliver; Hartmann, Arndt; Wiemann, Stefan; Metzler, Markus; Agaimy, Abbas

2016-04-01

Neoplasms with a myopericytomatous pattern represent a morphological spectrum of lesions encompassing myopericytoma of the skin and soft tissue, angioleiomyoma, myofibromatosis/infantile haemangiopericytoma and putative neoplasms reported as malignant myopericytoma. Lack of reproducible phenotypic and genetic features of malignant myopericytic neoplasms have prevented the establishment of myopericytic sarcoma as an acceptable diagnostic category. Following detection of a LMNA-NTRK1 gene fusion in an index case of paediatric haemangiopericytoma-like sarcoma by combined whole-genome and RNA sequencing, we identified three additional sarcomas harbouring NTRK1 gene fusions, termed 'spindle cell sarcoma, NOS with myo/haemangiopericytic growth pattern'. The patients were two children aged 11 months and 2 years and two adults aged 51 and 80 years. While the tumours of the adults were strikingly myopericytoma-like, but with clear-cut atypical features, the paediatric cases were more akin to infantile myofibromatosis/haemangiopericytoma. All cases contained numerous thick-walled dysplastic-like vessels with segmental or diffuse nodular myxohyaline myo-intimal proliferations of smooth muscle actin-positive cells, occasionally associated with thrombosis. Immunohistochemistry showed variable expression of smooth muscle actin and CD34, but other mesenchymal markers, including STAT6, were negative. This study showed a novel variant of myo/haemangiopericytic sarcoma with recurrent NTRK1 gene fusions. Given the recent introduction of a novel therapeutic approach targeting NTRK fusion-positive neoplasms, recognition of this rare but likely under-reported sarcoma variant is strongly encouraged. Copyright © 2016 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

Developmentally regulated GTP-binding protein 2 depletion leads to mitochondrial dysfunction through downregulation of dynamin-related protein 1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vo, Mai-Tram; Ko, Myoung Seok; Lee, Unn Hwa

Mitochondrial dynamics, including constant fusion and fission, play critical roles in maintaining mitochondrial morphology and function. Here, we report that developmentally regulated GTP-binding protein 2 (DRG2) regulates mitochondrial morphology by modulating the expression of the mitochondrial fission gene dynamin-related protein 1 (Drp1). shRNA-mediated silencing of DRG2 induced mitochondrial swelling, whereas expression of an shRNA-resistant version of DRG2 decreased mitochondrial swelling in DRG2-depleted cells. Analysis of the expression levels of genes involved in mitochondrial fusion and fission revealed that DRG2 depletion significantly decreased the level of Drp1. Overexpression of Drp1 rescued the defect in mitochondrial morphology induced by DRG2 depletion. DRG2more » depletion reduced the mitochondrial membrane potential, oxygen consumption rate (OCR), and amount of mitochondrial DNA (mtDNA), whereas it increased reactive oxygen species (ROS) production and apoptosis. Taken together, our data demonstrate that DRG2 acts as a regulator of mitochondrial fission by controlling the expression of Drp1. - Highlights: • DRG2 depletion increased mitochondrial swelling. • DRG2 depletion inhibited the expression of Drp1. • Overexpression of DRG2 or Drp1 rescued mitochondrial shape in DRG2 depleted cells. • DRG2 depletion induced mitochondrial dysfunction.« less

The expression of nifB gene from Herbaspirillum seropedicae is dependent upon the NifA and RpoN proteins.

PubMed

Rego, Fabiane G M; Pedrosa, Fábio O; Chubatsu, Leda S; Yates, M Geoffrey; Wassem, Roseli; Steffens, Maria B R; Rigo, Liu U; Souza, Emanuel M

2006-12-01

The putative nifB promoter region of Herbaspirillum seropedicae contained two sequences homologous to NifA-binding site and a -24/-12 type promoter. A nifB::lacZ fusion was assayed in the backgrounds of both Escherichia coli and H. seropedicae. In E. coli, the expression of nifB::lacZ occurred only in the presence of functional rpoN and Klebsiella pneumoniae nifA genes. In addition, the integration host factor (IHF) stimulated the expression of the nifB::lacZ fusion in this background. In H. seropedicae, nifB expression occurred only in the absence of ammonium and under low levels of oxygen, and it was shown to be strictly dependent on NifA. DNA band shift experiments showed that purified K. pneumoniae RpoN and E. coli IHF proteins were capable of binding to the nifB promoter region, and in vivo dimethylsulfate footprinting showed that NifA binds to both NifA-binding sites. These results strongly suggest that the expression of the nifB promoter of H. seropedicae is dependent on the NifA and RpoN proteins and that the IHF protein stimulates NifA activation of nifB promoter.

Sesquiterpene Synthase-3-Hydroxy-3-Methylglutaryl Coenzyme A Synthase Fusion Protein Responsible for Hirsutene Biosynthesis in Stereum hirsutum.

PubMed

Flynn, Christopher M; Schmidt-Dannert, Claudia

2018-06-01

The wood-rotting mushroom Stereum hirsutum is a known producer of a large number of namesake hirsutenoids, many with important bioactivities. Hirsutenoids form a structurally diverse and distinct class of sesquiterpenoids. No genes involved in hirsutenoid biosynthesis have yet been identified or their enzymes characterized. Here, we describe the cloning and functional characterization of a hirsutene synthase as an unexpected fusion protein of a sesquiterpene synthase (STS) with a C-terminal 3-hydroxy-3-methylglutaryl-coenzyme A (3-hydroxy-3-methylglutaryl-CoA) synthase (HMGS) domain. Both the full-length fusion protein and truncated STS domain are highly product-specific 1,11-cyclizing STS enzymes with kinetic properties typical of STSs. Complementation studies in Saccharomyces cerevisiae confirmed that the HMGS domain is also functional in vivo Phylogenetic analysis shows that the hirsutene synthase domain does not form a clade with other previously characterized sesquiterpene synthases from Basidiomycota. Comparative gene structure analysis of this hirsutene synthase with characterized fungal enzymes reveals a significantly higher intron density, suggesting that this enzyme may be acquired by horizontal gene transfer. In contrast, the HMGS domain is clearly related to other fungal homologs. This STS-HMGS fusion protein is part of a biosynthetic gene cluster that includes P450s and oxidases that are expressed and could be cloned from cDNA. Finally, this unusual fusion of a terpene synthase to an HMGS domain, which is not generally recognized as a key regulatory enzyme of the mevalonate isoprenoid precursor pathway, led to the identification of additional HMGS duplications in many fungal genomes, including the localization of HMGSs in other predicted sesquiterpenoid biosynthetic gene clusters. IMPORTANCE Hirsutenoids represent a structurally diverse class of bioactive sesquiterpenoids isolated from fungi. Identification of their biosynthetic pathways will provide access to this chemodiversity for the discovery and synthesis of molecules with new bioactivities. The identification and successful cloning of the previously elusive hirsutene synthase from the S. hirsutum provide important insights and strategies for biosynthetic gene discovery in Basidiomycota. The finding of a terpene synthase-HMGS fusion, the discovery of other sesquiterpenoid biosynthetic gene clusters with dedicated HMGS genes, and HMGS gene duplications in fungal genomes give new importance to the role of HMGS as a key regulatory enzyme in isoprenoid and sterol biosynthesis that should be exploited for metabolic engineering. Copyright © 2018 American Society for Microbiology.

An RNAi based screen in Drosophila larvae identifies fascin as a regulator of myoblast fusion and myotendinous junction structure.

PubMed

Camuglia, Jaclyn M; Mandigo, Torrey R; Moschella, Richard; Mark, Jenna; Hudson, Christine H; Sheen, Derek; Folker, Eric S

2018-04-06

A strength of Drosophila as a model system is its utility as a tool to screen for novel regulators of various functional and developmental processes. However, the utility of Drosophila as a screening tool is dependent on the speed and simplicity of the assay used. Here, we use larval locomotion as an assay to identify novel regulators of skeletal muscle function. We combined this assay with muscle-specific depletion of 82 genes to identify genes that impact muscle function by their expression in muscle cells. The data from the screen were supported with characterization of the muscle pattern in embryos and larvae that had disrupted expression of the strongest hit from the screen. With this assay, we showed that 12/82 tested genes regulate muscle function. Intriguingly, the disruption of five genes caused an increase in muscle function, illustrating that mechanisms that reduce muscle function exist and that the larval locomotion assay is sufficiently quantitative to identify conditions that both increase and decrease muscle function. We extended the data from this screen and tested the mechanism by which the strongest hit, fascin, impacted muscle function. Compared to controls, animals in which fascin expression was disrupted with either a mutant allele or muscle-specific expression of RNAi had fewer muscles, smaller muscles, muscles with fewer nuclei, and muscles with disrupted myotendinous junctions. However, expression of RNAi against fascin only after the muscle had finished embryonic development did not recapitulate any of these phenotypes. These data suggest that muscle function is reduced due to impaired myoblast fusion, muscle growth, and muscle attachment. Together, these data demonstrate the utility of Drosophila larval locomotion as an assay for the identification of novel regulators of muscle development and implicate fascin as necessary for embryonic muscle development.

Whole-genome landscape of pancreatic neuroendocrine tumours.

PubMed

Scarpa, Aldo; Chang, David K; Nones, Katia; Corbo, Vincenzo; Patch, Ann-Marie; Bailey, Peter; Lawlor, Rita T; Johns, Amber L; Miller, David K; Mafficini, Andrea; Rusev, Borislav; Scardoni, Maria; Antonello, Davide; Barbi, Stefano; Sikora, Katarzyna O; Cingarlini, Sara; Vicentini, Caterina; McKay, Skye; Quinn, Michael C J; Bruxner, Timothy J C; Christ, Angelika N; Harliwong, Ivon; Idrisoglu, Senel; McLean, Suzanne; Nourse, Craig; Nourbakhsh, Ehsan; Wilson, Peter J; Anderson, Matthew J; Fink, J Lynn; Newell, Felicity; Waddell, Nick; Holmes, Oliver; Kazakoff, Stephen H; Leonard, Conrad; Wood, Scott; Xu, Qinying; Nagaraj, Shivashankar Hiriyur; Amato, Eliana; Dalai, Irene; Bersani, Samantha; Cataldo, Ivana; Dei Tos, Angelo P; Capelli, Paola; Davì, Maria Vittoria; Landoni, Luca; Malpaga, Anna; Miotto, Marco; Whitehall, Vicki L J; Leggett, Barbara A; Harris, Janelle L; Harris, Jonathan; Jones, Marc D; Humphris, Jeremy; Chantrill, Lorraine A; Chin, Venessa; Nagrial, Adnan M; Pajic, Marina; Scarlett, Christopher J; Pinho, Andreia; Rooman, Ilse; Toon, Christopher; Wu, Jianmin; Pinese, Mark; Cowley, Mark; Barbour, Andrew; Mawson, Amanda; Humphrey, Emily S; Colvin, Emily K; Chou, Angela; Lovell, Jessica A; Jamieson, Nigel B; Duthie, Fraser; Gingras, Marie-Claude; Fisher, William E; Dagg, Rebecca A; Lau, Loretta M S; Lee, Michael; Pickett, Hilda A; Reddel, Roger R; Samra, Jaswinder S; Kench, James G; Merrett, Neil D; Epari, Krishna; Nguyen, Nam Q; Zeps, Nikolajs; Falconi, Massimo; Simbolo, Michele; Butturini, Giovanni; Van Buren, George; Partelli, Stefano; Fassan, Matteo; Khanna, Kum Kum; Gill, Anthony J; Wheeler, David A; Gibbs, Richard A; Musgrove, Elizabeth A; Bassi, Claudio; Tortora, Giampaolo; Pederzoli, Paolo; Pearson, John V; Waddell, Nicola; Biankin, Andrew V; Grimmond, Sean M

2017-03-02

The diagnosis of pancreatic neuroendocrine tumours (PanNETs) is increasing owing to more sensitive detection methods, and this increase is creating challenges for clinical management. We performed whole-genome sequencing of 102 primary PanNETs and defined the genomic events that characterize their pathogenesis. Here we describe the mutational signatures they harbour, including a deficiency in G:C > T:A base excision repair due to inactivation of MUTYH, which encodes a DNA glycosylase. Clinically sporadic PanNETs contain a larger-than-expected proportion of germline mutations, including previously unreported mutations in the DNA repair genes MUTYH, CHEK2 and BRCA2. Together with mutations in MEN1 and VHL, these mutations occur in 17% of patients. Somatic mutations, including point mutations and gene fusions, were commonly found in genes involved in four main pathways: chromatin remodelling, DNA damage repair, activation of mTOR signalling (including previously undescribed EWSR1 gene fusions), and telomere maintenance. In addition, our gene expression analyses identified a subgroup of tumours associated with hypoxia and HIF signalling.

Intelligent Data Fusion for Wide-Area Assessment of UXO Contamination

DTIC Science & Technology

2008-02-29

Development Program (SERDP). The authors thank the SERDP staff and team members for their assistance, particularly Dr. Herb Nelson and Dr. Dan Steinhurst...Fusion and Integration for Intelligent Systems, Taipei, Taiwan , R.O.C., Aug., 1999. 4. B.J. Johnson, T.G. Moore, B.J. Blejer, C.F. Lee, T.P. Opar, S...gene-expression data using Dempster-Shafer Theory of evidence to predict breast cancer tumors,” Bioinformation 1(5), 170-5, (2006) 21. Dr. Herb H. Nelson, personal communication (2007)

Recurrent PAX3-MAML3 Fusion in Biphenotypic Sinonasal Sarcoma

PubMed Central

Wang, Xiaoke; Bledsoe, Krista L.; Graham, Rondell P.; Asmann, Yan W.; Viswanatha, David S.; Lewis, Jean E.; Lewis, Jason T.; Chou, Margaret M.; Yaszemski, Michael J.; Jen, Jin; Westendorf, Jennifer J.; Oliveira, André M.

2014-01-01

Biphenotypic sinonasal sarcoma (SNS) is a newly described tumor of the nasal and paranasal areas. Herein, we report the novel recurring chromosomal translocation t(2;4)(q35;q31.1) in SNS. The translocation results in the formation of the fusion protein PAX3-MAML3, which is a potent transcriptional activator of PAX3 response elements. The SNS phenotype is characterized by aberrant expression of genes involved in neuroectodermal and myogenic differentiation, which closely simulates the developmental roles of PAX3. PMID:24859338

Gene Overexpression and RNA Silencing Tools for the Genetic Manipulation of the S-(+)-Abscisic Acid Producing Ascomycete Botrytis cinerea

PubMed Central

Ding, Zhong-Tao; Zhang, Zhi; Luo, Di; Zhou, Jin-Yan; Zhong, Juan; Yang, Jie; Xiao, Liang; Shu, Dan; Tan, Hong

2015-01-01

The phytopathogenic ascomycete Botrytis cinerea produces several secondary metabolites that have biotechnical significance and has been particularly used for S-(+)-abscisic acid production at the industrial scale. To manipulate the expression levels of specific secondary metabolite biosynthetic genes of B. cinerea with Agrobacterium tumefaciens-mediated transformation system, two expression vectors (pCBh1 and pCBg1 with different selection markers) and one RNA silencing vector, pCBSilent1, were developed with the In-Fusion assembly method. Both expression vectors were highly effective in constitutively expressing eGFP, and pCBSilent1 effectively silenced the eGFP gene in B. cinerea. Bcaba4, a gene suggested to participate in ABA biosynthesis in B. cinerea, was then targeted for gene overexpression and RNA silencing with these reverse genetic tools. The overexpression of bcaba4 dramatically induced ABA formation in the B. cinerea wild type strain Bc-6, and the gene silencing of bcaba4 significantly reduced ABA-production in an ABA-producing B. cinerea strain. PMID:25955649

Enhancing hydrogen production of Enterobacter aerogenes by heterologous expression of hydrogenase genes originated from Synechocystis sp.

PubMed

Song, Wenlu; Cheng, Jun; Zhao, Jinfang; Zhang, Chuanxi; Zhou, Junhu; Cen, Kefa

2016-09-01

The hydrogenase genes (hoxEFUYH) of Synechocystis sp. PCC 6803 were cloned and heterologously expressed in Enterobacter aerogenes ATCC13408 for the first time in this study, and the hydrogen yield was significantly enhanced using the recombinant strain. A recombinant plasmid containing the gene in-frame with Glutathione-S-Transferase (GST) gene was transformed into E. aerogenes ATCC13408 to produce a GST-fusion protein. SDS-PAGE and western blot analysis confirm the successful expression of the hox genes. The hydrogenase activity of the recombinant strain is 237.6±9.3ml/(g-DW·h), which is 152% higher than the wild strain. The hydrogen yield of the recombinant strain is 298.3ml/g-glucose, which is 88% higher than the wild strain. During hydrogen fermentation, the recombinant strain produces more acetate and butyrate, but less ethanol. This is corresponding to the NADH metabolism in the cell due to the higher hydrogenase activity with the heterologous expression of hox genes. Copyright © 2016 Elsevier Ltd. All rights reserved.

[Clinical utility of real-time fluorescent PCR for combined detection of anaplastic lymphoma kinase and c-ros oncogene 1 receptor tyrosine kinase in non-small cell lung cancer].

PubMed

Bai, D Y; Zhang, H P; Zhong, S; Suo, W H; Gao, D H; Ding, Y; Tu, J H

2016-12-23

Objective: To investigate the clinical application value of combined detection of ALK fusion gene and c-ros oncogene 1 receptor tyrosine kinase (ROS1) fusion gene in non-small cell lung cancer (NSCLC) using real-time fluorescent PCR. Methods: A kit for combined detection of ALK fusion gene and ROS1 fusion gene based on fluorescent PCR was used to simultaneously detect the two fusion genes in 302 cases of NSCLC specimens. The results were validated through Sanger sequencing. The consistency of the two detection methods was analyzed. Results: All 302 cases of NSCLC specimens were successfully analyzed through fluorescent PCR (302/302). 12 cases (4.0%) were found to contain ALK fusion gene, including 3 cases with ALK-M1, 3 with ALK-M2, 3 with ALK-M3, 1 with ALK-M4, and 2 with ALK-M6 fusion gene.12 cases (4.0%) were found to contain ROS1 fusion gene, including 1 case with ROS1-M7, 8 cases with ROS1-M8, 1 case with ROS1-M12, 1 case with ROS1-M14, and 1 case with double-positive ROS1-M3 and ROS1-M8 fusion genes. The total detection rate of ALK fusion gene and ROS1 fusion gene was 7.9% (24/302) and 278 cases showed to be negative for ALK fusion gene and ROS1 fusion gene. The successful detection rates for Sanger DNA sequencing were also 100%. The positive, negative and total coincidence rates obtained by real-time fluorescent PCR and by Sanger DNA sequencing were all 100%. Conclusions: The results of Sanger DNA sequencing demonstrate that the real-time fluorescent PCR assay is equally effective in detecting ALK and ROS1 fusion genes in NSCLC tissues. Furthermore, real-time fluorescent PCR assay can be used to detect trace ALK and ROS1 fusion gene simultaneously in tiny samples, and can save time and avoid repeated sampling. It is worthy of recommendation as a rapid and reliable detection technique.

Use of lambdagt11 to isolate genes for two pseudorabies virus glycoproteins with homology to herpes simplex virus and varicella-zoster virus glycoproteins

DOE Office of Scientific and Technical Information (OSTI.GOV)

Petrovskis, E.A.; Timmins, J.G.; Post, L.E.

1986-10-01

A library of pseudorabies virus (PRV) DNA fragments was constructed in the expression cloning vector lambdagt11. The library was screened with antisera which reacted with mixtures of PRV proteins to isolate recombinant bacteriophages expressing PRV proteins. By the nature of the lambdagt11 vector, the cloned proteins were expressed in Escherichia coli as ..beta..-galactosidase fusion proteins. The fusion proteins from 35 of these phages were purified and injected into mice to raise antisera. The antisera were screened by several different assays, including immunoprecipitation of (/sup 14/C)glucosamine-labeled PRV proteins. This method identified phages expressing three different PRV glycoproteins: the secreted glycoprotein, gX;more » gI; and a glycoprotein that had not been previously identified, which we designate gp63. The gp63 and gI genes map adjacent to each other in the small unique region of the PRV genome. The DNA sequence was determined for the region of the genome encoding gp63 and gI. It was found that gp63 has a region of homology with a herpes simplex virus type 1 (HSV-1) protein, encoded by US7, and also with varicella-zoster virus (VZV) gpIV. The gI protein sequence has a region of homology with HSV-1 gE and VZV gpI. It is concluded that PRV, HSV, and VZV all have a cluster of homologous glycoprotein genes in the small unique components of their genomes and that the organization of these genes is conserved.« less

Co-regulation of the atrial natriuretic factor and cardiac myosin light chain-2 genes during alpha-adrenergic stimulation of neonatal rat ventricular cells. Identification of cis sequences within an embryonic and a constitutive contractile protein gene which mediate inducible expression.

PubMed

Knowlton, K U; Baracchini, E; Ross, R S; Harris, A N; Henderson, S A; Evans, S M; Glembotski, C C; Chien, K R

1991-04-25

To study the mechanisms which mediate the transcriptional activation of cardiac genes during alpha adrenergic stimulation, the present study examined the regulated expression of three cardiac genes, a ventricular embryonic gene (atrial natriuretic factor, ANF), a constitutively expressed contractile protein gene (cardiac MLC-2), and a cardiac sodium channel gene. alpha 1-Adrenergic stimulation activates the expression and release of ANF from neonatal ventricular cells. As assessed by RNase protection analyses, treatment with alpha-adrenergic agonists increases the steady-state levels of ANF mRNA by greater than 15-fold. However, a rat cardiac sodium channel gene mRNA is not induced, indicating that alpha-adrenergic stimulation does not lead to an increase in the expression of all cardiac genes. Studies employing a series of rat ANF luciferase and rat MLC-2 luciferase fusion genes identify 315- and 92-base pair cis regulatory sequences within an embryonic gene (ANF) and a constitutively expressed contractile protein gene (MLC-2), respectively, which mediate alpha-adrenergic-inducible gene expression. Transfection of various ANF luciferase reporters into neonatal rat ventricular cells demonstrated that upstream sequences which mediate tissue-specific expression (-3003 to -638) can be segregated from those responsible for inducibility. The lack of inducibility of a cardiac Na+ channel gene, and the segregation of ANF gene sequences which mediate cardiac specific from those which mediate inducible expression, provides further insight into the relationship between muscle-specific and inducible expression during cardiac myocyte hypertrophy. Based on these results, a testable model is proposed for the induction of embryonic cardiac genes and constitutively expressed contractile protein genes and the noninducibility of a subset of cardiac genes during alpha-adrenergic stimulation of neonatal rat ventricular cells.

AUU-to-AUG mutation in the initiator codon of the translation initiation factor IF3 abolishes translational autocontrol of its own gene (infC) in vivo.

PubMed Central

Butler, J S; Springer, M; Grunberg-Manago, M

1987-01-01

We previously showed that Escherichia coli translation initiation factor IF3 regulates the expression of its own gene infC at the translational level in vivo. Here we create two alterations in the infC gene and test their effects on translational autocontrol of infC expression in vivo by measuring beta-galactosidase activity expressed from infC-lacZ gene fusions under conditions of up to 4-fold derepression or 3-fold repression of infC expression. Replacement of the infC promoter with the trp promoter deletes 120 nucleotides of the infC mRNA 5' to the translation initiation site without affecting autogenous translational control. Mutation of the unusual AUU initiator codon of infC to the more common AUG initiator codon abolishes translation initiation factor IF3-dependent repression and derepression of infC expression in vivo. These results establish the AUU initiator codon of infC as an essential cis-acting element in autogenous translational control of translation initiation factor IF3 expression in vivo. PMID:2954162

AUU-to-AUG mutation in the initiator codon of the translation initiation factor IF3 abolishes translational autocontrol of its own gene (infC) in vivo.

PubMed

Butler, J S; Springer, M; Grunberg-Manago, M

1987-06-01

We previously showed that Escherichia coli translation initiation factor IF3 regulates the expression of its own gene infC at the translational level in vivo. Here we create two alterations in the infC gene and test their effects on translational autocontrol of infC expression in vivo by measuring beta-galactosidase activity expressed from infC-lacZ gene fusions under conditions of up to 4-fold derepression or 3-fold repression of infC expression. Replacement of the infC promoter with the trp promoter deletes 120 nucleotides of the infC mRNA 5' to the translation initiation site without affecting autogenous translational control. Mutation of the unusual AUU initiator codon of infC to the more common AUG initiator codon abolishes translation initiation factor IF3-dependent repression and derepression of infC expression in vivo. These results establish the AUU initiator codon of infC as an essential cis-acting element in autogenous translational control of translation initiation factor IF3 expression in vivo.

Some properties of human neuronal alpha 7 nicotinic acetylcholine receptors fused to the green fluorescent protein.

PubMed

Palma, Eleonora; Mileo, Anna M; Martinez-Torres, Ataulfo; Eusebi, Fabrizio; Miledi, Ricardo

2002-03-19

The functional properties and cellular localization of the human neuronal alpha7 nicotinic acetylcholine (AcCho) receptor (alpha7 AcChoR) and its L248T mutated (mut) form were investigated by expressing them alone or as gene fusions with the enhanced version of the green fluorescent protein (GFP). Xenopus oocytes injected with wild-type (wt), mutalpha7, or the chimeric subunit cDNAs expressed receptors that gated membrane currents when exposed to AcCho. As already known, AcCho currents generated by wtalpha7 receptors decay much faster than those elicited by the mutalpha7 receptors. Unexpectedly, the fusion of GFP to the wt and mutated alpha7 receptors led to opposite results: the AcCho-current decay of the wt receptors became slower, whereas that of the mutated receptors was accelerated. Furthermore, repetitive applications of AcCho led to a considerable "run-down" of the AcCho currents generated by mutalpha7-GFP receptors, whereas those of the wtalpha7-GFP receptors remained stable or increased in amplitude. The AcCho-current run-down of mutalpha7-GFP oocytes was accompanied by a marked decrease of alpha-bungarotoxin binding activity. Fluorescence, caused by the chimeric receptors expressed, was seen over the whole oocyte surface but was more intense and abundant in the animal hemisphere, whereas it was much weaker in the vegetal hemisphere. We conclude that fusion of GFP to wtalpha7 and mutalpha7 receptors provides powerful tools to study the distribution and function of alpha7 receptors. We also conclude that fused genes do not necessarily recapitulate all of the properties of the original receptors. This fact must be borne close in mind whenever reporter genes are attached to proteins.

MNDA binds NPM/B23 and the NPM-MLF1 chimera generated by the t(3;5) associated with myelodysplastic syndrome and acute myeloid leukemia.

PubMed

Xie, J; Briggs, J A; Morris, S W; Olson, M O; Kinney, M C; Briggs, R C

1997-10-01

The myeloid cell nuclear differentiation antigen (MNDA) is a nuclear protein expressed specifically in developing cells of the human myelomonocytic lineage, including the end-stage monocytes/macrophages and granulocytes. Nuclear localization, lineage- and stage-specific expression, association with chromatin, and regulation by interferon alpha indicate that this protein is involved in regulating gene expression uniquely associated with the differentiation process and/or function of the monocyte/macrophage. MNDA does not bind specific DNA sequences, but rather a set of nuclear proteins that includes nucleolin (C23). Both in vitro binding assays and co-immunoprecipitation were used to demonstrate that MNDA also binds protein B23 (nucleophosmin/NPM). Three reciprocal chromosome translocations found in certain cases of leukemia/lymphoma involve fusions with the NPM/B23 gene, t(5;17) NPM-RARalpha, t(2;5) NPM-ALK, and the t(3;5) NPM-MLF1. In the current study, MNDA was not able to bind the NPM-ALK chimera originating from the t(2;5) and containing residues 1-117 of NPM. However, MNDA did bind the NPM-MLF1 product of the t(3;5) that contains the N-terminal 175 residues of NPM. The additional 58 amino acids (amino acids 117-175) of the NPM sequence that are contained in the product of the NPM-MLF1 fusion gene relative to the product of the NPM-ALK fusion appear responsible for MNDA binding. This additional NPM sequence contains a nuclear localization signal and clusters of acidic residues believed to bind nuclear localization signals of other proteins. Whereas NPM and nucleolin are primarily localized within the nucleolus, MNDA is distributed throughout the nucleus including the nucleolus, suggesting that additional interactions define overall MNDA localization.

Expression of an endotoxin-free S-layer/allergen fusion protein in gram-positive Bacillus subtilis 1012 for the potential application as vaccines for immunotherapy of atopic allergy

PubMed Central

2011-01-01

Background Genetic fusion of the major birch pollen allergen (Bet v1) to bacterial surface-(S)-layer proteins resulted in recombinant proteins exhibiting reduced allergenicity as well as immunomodulatory capacity. Thus, S-layer/allergen fusion proteins were considered as suitable carriers for new immunotherapeutical vaccines for treatment of Type I hypersensitivity. Up to now, endotoxin contamination of the fusion protein which occurred after isolation from the gram-negative expression host E. coli had to be removed by an expensive and time consuming procedure. In the present study, in order to achieve expression of pyrogen-free, recombinant S-layer/allergen fusion protein and to study the secretion of a protein capable to self-assemble, the S-layer/allergen fusion protein rSbpA/Bet v1 was produced in the gram-positive organism Bacillus subtilis 1012. Results The chimaeric gene encoding the S-layer protein SbpA of Lysinibacillus sphaericus CCM 2177 as well as Bet v1 was cloned and expressed in B. subtilis 1012. For that purpose, the E. coli-B. subtilis shuttle vectors pHT01 for expression in the B. subtilis cytoplasm and pHT43 for secretion of the recombinant fusion protein into the culture medium were used. As shown by western blot analysis, immediately after induction of expression, B. subtilis 1012 was able to secret rSbpA/Bet v1 mediated by the signal peptide amyQ of Bacillus amyloliquefaciens. Electron microscopical investigation of the culture medium revealed that the secreted fusion protein was able to form self-assembly products in suspension but did not recrystallize on the surface of the B. subtilis cells. The specific binding mechanism between the N-terminus of the S-layer protein and a secondary cell wall polymer (SCWP), located in the peptidoglycan-containing sacculi of Ly. sphaericus CCM 2177, could be used for isolation and purification of the secreted fusion protein from the culture medium. Immune reactivity of rSbpA/Bet v1 could be demonstrated in immunoblotting experiments with Bet v1 specific IgE containing serum samples from patients suffering birch pollen allergy. Conclusions The impact of this study can be seen in the usage of a gram-positive organism for the production of pyrogen-free self-assembling recombinant S-layer/allergen fusion protein with great relevance for the development of vaccines for immunotherapy of atopic allergy. PMID:21310062

[Detection of ALK, ROS1 and RET fusion genes in non-small cell lung cancer patients and its clinicopathologic correlation].

PubMed

Zhong, Shan; Zhang, Haiping; Bai, Dongyu; Gao, Dehong; Zheng, Jie; Ding, Yi

2015-09-01

To study the prevalence of ALK, ROS1 and RET fusion genes in non-small cell lung cancer (NSCLC), and its correlation with clinicopathologic features. Formalin-fixed and paraffin-embedded tissue sections from samples of 302 patients with NSCLC were screened for ALK, ROS1, RET fusions by real-time polymerase chain reaction (PCR). All of the cases were validated by Sanger DNA sequencing. The relationship between ALK, ROS1, RET fusion genes and clinicopathologic features were analyzed. In the cohort of 302 NSCLC samples, 3.97% (12/302) were found to contain ALK fusion genes, including 3 cases with E13; A20 gene fusion, 3 cases with E6; A20 gene fusion and 3 cases with E20; A20 gene fusion. There was no statistically significant difference in patient's gender, age, smoking history and histologic type. Moreover, in the 302 NSCLC samples studied, 3.97% (12/302) were found to contain ROS1 fusion genes, with CD74-ROS1 fusion identified in 9 cases. There was no statistically significant difference in patients' gender, age, smoking history and histologic type. One non-smoking elderly female patient with pulmonary adenocarcinoma had RET gene fusion. None of the cases studied had concurrent ALK, ROS1 and RET mutations. The ALK, ROS1 and RET fusion gene mutation rates in NSCLC are low, they represent some specific molecular subtypes of NSCLC. Genetic testing has significant meaning to guide clinical targeted therapy.

MIXTA-Like Transcription Factors and WAX INDUCER1/SHINE1 Coordinately Regulate Cuticle Development in Arabidopsis and Torenia fournieri[C][W

PubMed Central

Oshima, Yoshimi; Shikata, Masahito; Koyama, Tomotsugu; Ohtsubo, Norihiro; Mitsuda, Nobutaka; Ohme-Takagi, Masaru

2013-01-01

The waxy plant cuticle protects cells from dehydration, repels pathogen attack, and prevents organ fusion during development. The transcription factor WAX INDUCER1/SHINE1 (WIN1/SHN1) regulates the biosynthesis of waxy substances in Arabidopsis thaliana. Here, we show that the MIXTA-like MYB transcription factors MYB106 and MYB16, which regulate epidermal cell morphology, also regulate cuticle development coordinately with WIN1/SHN1 in Arabidopsis and Torenia fournieri. Expression of a MYB106 chimeric repressor fusion (35S:MYB106-SRDX) and knockout/down of MYB106 and MYB16 induced cuticle deficiencies characterized by organ adhesion and reduction of epicuticular wax crystals and cutin nanoridges. A similar organ fusion phenotype was produced by expression of a WIN1/SHN1 chimeric repressor. Conversely, the dominant active form of MYB106 (35S:MYB106-VP16) induced ectopic production of cutin nanoridges and increased expression of WIN1/SHN1 and wax biosynthetic genes. Microarray experiments revealed that MYB106 and WIN1/SHN1 regulate similar sets of genes, predominantly those involved in wax and cutin biosynthesis. Furthermore, WIN1/SHN1 expression was induced by MYB106-VP16 and repressed by MYB106-SRDX. These results indicate that the regulatory cascade of MIXTA-like proteins and WIN1/SHN1 coordinately regulate cutin biosynthesis and wax accumulation. This study reveals an additional key aspect of MIXTA-like protein function and suggests a unique relationship between cuticle development and epidermal cell differentiation. PMID:23709630

Phenotypical and molecular distinctness of sinonasal haemangiopericytoma compared to solitary fibrous tumour of the sinonasal tract.

PubMed

Agaimy, Abbas; Barthelmeß, Sarah; Geddert, Helene; Boltze, Carsten; Moskalev, Evgeny A; Koch, Michael; Wiemann, Stefan; Hartmann, Arndt; Haller, Florian

2014-11-01

Sinonasal haemangiopericytoma (SN-HPC) is a rare sinonasal mesenchymal neoplasm of perivascular myoid cell origin. Solitary fibrous tumour (SFT) occurs only very rarely in the sinonasal tract. SFT and soft tissue HPC have been considered a single entity. Recently, recurrent gene fusions involving NAB2-STAT6 resulting in differential expression of STAT6 were characterized as central molecular events in SFT. However, no data exist for NAB2-STAT6 status or STAT6 expression in SN-HPC. We examined six SN-HPCs and two sinonasal SFTs by immunohistochemistry and RT-PCR for NAB2-STAT6 fusions. SN-HPC affected three females and three males (mean age: 72 years). They expressed smooth muscle actin, lacked strong CD34 reactivity and were negative for nuclear STAT6 expression. RT-PCR analysis confirmed the absence of NAB2-STAT6 fusions in all cases. Conversely, both sinonasal SFTs (in males aged 39 and 52 years) displayed classical features of pleuropulmonary and soft-tissue SFTs (uniformly CD34-positive with strong nuclear expression of STAT6). RT-PCR revealed NAB2-STAT6 fusions in both cases. These findings confirm the molecular and phenotypical distinctness of these two entities. While SN-HPC is a site-specific sinonasal neoplasm of as yet unknown molecular pathogenesis, sinonasal SFTs show phenotypical and molecular identity to their pleural/extrapleural counterparts. © 2014 John Wiley & Sons Ltd.

Regulation of ecmF gene expression and genetic hierarchy among STATa, CudA, and MybC on several prestalk A-specific gene expressions in Dictyostelium.

PubMed

Saga, Yukika; Inamura, Tomoka; Shimada, Nao; Kawata, Takefumi

2016-05-01

STATa, a Dictyostelium homologue of metazoan signal transducer and activator of transcription, is important for the organizer function in the tip region of the migrating Dictyostelium slug. We previously showed that ecmF gene expression depends on STATa in prestalk A (pstA) cells, where STATa is activated. Deletion and site-directed mutagenesis analysis of the ecmF/lacZ fusion gene in wild-type and STATa null strains identified an imperfect inverted repeat sequence, ACAAATANTATTTGT, as a STATa-responsive element. An upstream sequence element was required for efficient expression in the rear region of pstA zone; an element downstream of the inverted repeat was necessary for sufficient prestalk expression during culmination. Band shift analyses using purified STATa protein detected no sequence-specific binding to those ecmF elements. The only verified upregulated target gene of STATa is cudA gene; CudA directly activates expL7 gene expression in prestalk cells. However, ecmF gene expression was almost unaffected in a cudA null mutant. Several previously reported putative STATa target genes were also expressed in cudA null mutant but were downregulated in STATa null mutant. Moreover, mybC, which encodes another transcription factor, belonged to this category, and ecmF expression was downregulated in a mybC null mutant. These findings demonstrate the existence of a genetic hierarchy for pstA-specific genes, which can be classified into two distinct STATa downstream pathways, CudA dependent and independent. The ecmF expression is indirectly upregulated by STATa in a CudA-independent activation manner but dependent on MybC, whose expression is positively regulated by STATa. © 2016 Japanese Society of Developmental Biologists.

A plasmid collection for PCR-based gene targeting in the filamentous ascomycete Ashbya gossypii.

PubMed

Kaufmann, Andreas

2009-08-01

PCR-based gene targeting with heterologous markers is an efficient method to delete genes, generate gene fusions, and modulate gene expression. For the yeasts Saccharomyces cerevisiae and Schizosaccharomyces pombe, several plasmid collections are available covering a wide range of tags and markers. For several reasons, many of these cassettes cannot be used in the filamentous ascomycete Ashbya gossypii. This article describes the construction of 93 heterologous modules for C- and N-terminal tagging and promoter replacements in A. gossypii. The performance of 12 different fluorescent tags was evaluated by monitoring their brightness, detectability, and photostability when fused to the myosin light-chain protein Mlc2. Furthermore, the thiamine-repressible S. cerevisiae THI13 promoter was established to regulate gene expression in A. gossypii. This collection will help accelerate analysis of gene function in A. gossypii and in other ascomycetes where S. cerevisiae promoter elements are functional.

[Indirect ELISA for simultaneous detection of antibodies against duck hepatitis A type 1 and 3 viruses].

PubMed

Zhang, Yuyao; Ma, Xiuli; Huang, Bing; Li, Yufeng; Yu, Kexiang; Li, Jianliang; Liu, Cunxia; Han, Hongyu; Cui, Yanshun

2015-04-04

To simultaneously detect antibodies against Duck hepatitis A type 1 (DHAV-1) and type 3 (DHAV-3) viruses, we developed an indirect enzyme-linked immunosobent assay (ELISA) with bacterially expressed recombinant viral protein as antigen in Escherichia coli. We amplified the full-length VP3 gene of DHAV-1 and the full-length VP1 gene of DHAV-3 through reverse transcription-polymerase chain reaction (RT-PCR) and then cloned them into pET-32a expression vector, designated as pET-1VP3-3VP1. The fusion protein DHAV-1VP3-3VP1 expressed correctly and was subsequently used to develop an indirect ELISA assay. DHAV-1VP3-3VP1 fusion protein expressed in BL21 (DE3) cells following induction by Isopropyl-beta-D-1-thiogalactopyranoside (IPTG). The expressed protein was very antigenic and reactive to virus-specific antibodies in western blot assay. The optimal working concentration for coating antigen was 1.0 microg per well and the working concentration of serum samples was 1:200 dilution and the cut-off value that distinguished the positive from negative serum samples was OD650 > OR = 0.38. The ELISA method based on the prokaryotic expression of VP3 (DHAV-1) and VP1 proteins (DHAV-3) can be used effectively for the clinical detection antibodies against DHAV-1 and DHAV-3.

Patterning C. elegans: homeotic cluster genes, cell fates and cell migrations.

PubMed

Salser, S J; Kenyon, C

1994-05-01

Despite its simple body form, the nematode C. elegans expresses homeotic cluster genes similar to those of insects and vertebrates in the patterning of many cell types and tissues along the anteroposterior axis. In the ventral nerve cord, these genes program spatial patterns of cell death, fusion, division and neurotransmitter production; in migrating cells they regulate the direction and extent of movement. Nematode development permits an analysis at the cellular level of how homeotic cluster genes interact to specify cell fates, and how cell behavior can be regulated to assemble an organism.

Intrinsic and Extrinsic Regulation of PD-L2 Expression in Oncogene-Driven Non-Small Cell Lung Cancer.

PubMed

Shibahara, Daisuke; Tanaka, Kentaro; Iwama, Eiji; Kubo, Naoki; Ota, Keiichi; Azuma, Koichi; Harada, Taishi; Fujita, Jiro; Nakanishi, Yoichi; Okamoto, Isamu

2018-03-27

The interaction of programmed cell death ligand 2 (PD-L2) with programmed cell death 1 is implicated in tumor immune escape. The regulation of PD-L2 expression in tumor cells has remained unclear, however. We here examined intrinsic and extrinsic regulation of PD-L2 expression in NSCLC. PD-L2 expression was evaluated by reverse transcription and real-time polymerase chain reaction analysis and by flow cytometry. BEAS-2B cells stably expressing an activated mutant form of EGFR or the echinoderm microtubule associated protein like 4 (EML4)-ALK receptor tyrosine kinase fusion oncoprotein manifested increased expression of PD-L2 at both the mRNA and protein levels. Furthermore, treatment of NSCLC cell lines that harbor such driver oncogenes with corresponding EGFR or ALK tyrosine kinase inhibitors or depletion of EGFR or ALK by small interfering RNA transfection suppressed expression of PD-L2, demonstrating that activating EGFR mutations or echinoderm microtubule associated protein like 4 gene (EML4)-ALK receptor tyrosine kinase gene (ALK) fusion intrinsically induce PD-L2 expression. We also found that interferon gamma (IFN-γ) extrinsically induced expression of PD-L2 through signal transducer and activator of transcription 1 signaling in NSCLC cells. Oncogene-driven expression of PD-L2 in NSCLC cells was inhibited by knockdown of the transcription factors signal transducer and activator of transcription 3 (STAT3) or c-FOS. IFN-γ also activated STAT3 and c-FOS, suggesting that these proteins may also contribute to the extrinsic induction of PD-L2 expression. Expression of PD-L2 is induced intrinsically by activating EGFR mutations or EML4-ALK fusion and extrinsically by IFN-γ, with STAT3 and c-FOS possibly contributing to both intrinsic and extrinsic pathways. Our results thus provide insight into the complexity of tumor immune escape in NSCLC. Copyright © 2018 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights reserved.

Identifying Growth Conditions for Nicotiana benthimiana Resulting in Predictable Gene Expression of Promoter-Gus Fusion

NASA Astrophysics Data System (ADS)

Sandoval, V.; Barton, K.; Longhurst, A.

2012-12-01

Revoluta (Rev) is a transcription factor that establishes leaf polarity inArabidopsis thaliana. Through previous work in Dr. Barton's Lab, it is known that Revoluta binds to the ZPR3 promoter, thus activating the ZPR3 gene product inArabidopsis thaliana. Using this knowledge, two separate DNA constructs were made, one carrying revgene and in the other, the ZPR3 promoter fussed with the GUS gene. When inoculated in Nicotiana benthimiana (tobacco), the pMDC32 plasmid produces the Rev protein. Rev binds to the ZPR3 promoter thereby activating the transcription of the GUS gene, which can only be expressed in the presence of Rev. When GUS protein comes in contact with X-Gluc it produce the blue stain seen (See Figure 1). In the past, variability has been seen of GUS expression on tobacco therefore we hypothesized that changing the growing conditions and leaf age might improve how well it's expressed.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Inoh, Yoshikazu; Furuno, Tadahide; Hirashima, Naohide

Highlights: Black-Right-Pointing-Pointer We use MEL-A-containing cationic liposomes for siRNA delivery. Black-Right-Pointing-Pointer MEL-A-containing cationic liposomes can efficiently and rapidly deliver siRNA into the cytoplasm. Black-Right-Pointing-Pointer Rapid delivery of siRNA is due to the membrane fusion between liposomes and plasma membrane. -- Abstract: The downregulation of gene expression by RNA interference holds great potential for genetic analysis and gene therapy. However, a more efficient delivery system for small interfering RNA (siRNA) into the target cells is required for wide fields such as cell biology, physiology, and clinical application. Non-viral vectors are stronger candidates than viral vectors because they are safer and easiermore » to prepare. We have previously used a new method for gene transfection by combining cationic liposomes with the biosurfactant mannosylerythritol lipid-A (MEL-A). The novel MEL-A-containing cationic liposomes rapidly delivered DNA (plasmids and oligonucleotides) into the cytosol and nucleus through membrane fusion between liposomes and the plasma membrane, and consequently, enhanced the gene transfection efficiency. In this study, we determined the efficiency of MEL-A-containing cationic liposomes for siRNA delivery. We observed that exogenous and endogenous protein expression was suppressed by approximately 60% at 24 h after brief (30 min) incubation of target cells with MEL-A-containing cationic liposome/siRNA complexes. Confocal microscopic analysis showed that suppression of protein expression was caused by rapid siRNA delivery into the cytosol. We found that the MEL-A-containing cationic liposomes directly delivered siRNA into the cytoplasm by the membrane fusion in addition to endocytotic pathway whereas Lipofectamine Trade-Mark-Sign RNAiMax delivered siRNA only by the endocytotic pathway. It seems that the ability to rapidly and directly deliver siRNA into the cytosol using MEL-A-containing cationic liposomes is able to reduce immune responses, cytotoxicity, and other side effects caused by viral vectors in clinical applications.« less

Transient co-expression of post-transcriptional gene silencing suppressors for increased in planta expression of a recombinant anthrax receptor fusion protein.

PubMed

Arzola, Lucas; Chen, Junxing; Rattanaporn, Kittipong; Maclean, James M; McDonald, Karen A

2011-01-01

Potential epidemics of infectious diseases and the constant threat of bioterrorism demand rapid, scalable, and cost-efficient manufacturing of therapeutic proteins. Molecular farming of tobacco plants provides an alternative for the recombinant production of therapeutics. We have developed a transient production platform that uses Agrobacterium infiltration of Nicotiana benthamiana plants to express a novel anthrax receptor decoy protein (immunoadhesin), CMG2-Fc. This chimeric fusion protein, designed to protect against the deadly anthrax toxins, is composed of the von Willebrand factor A (VWA) domain of human capillary morphogenesis 2 (CMG2), an effective anthrax toxin receptor, and the Fc region of human immunoglobulin G (IgG). We evaluated, in N. benthamiana intact plants and detached leaves, the expression of CMG2-Fc under the control of the constitutive CaMV 35S promoter, and the co-expression of CMG2-Fc with nine different viral suppressors of post-transcriptional gene silencing (PTGS): p1, p10, p19, p21, p24, p25, p38, 2b, and HCPro. Overall, transient CMG2-Fc expression was higher on intact plants than detached leaves. Maximum expression was observed with p1 co-expression at 3.5 days post-infiltration (DPI), with a level of 0.56 g CMG2-Fc per kg of leaf fresh weight and 1.5% of the total soluble protein, a ten-fold increase in expression when compared to absence of suppression. Co-expression with the p25 PTGS suppressor also significantly increased the CMG2-Fc expression level after just 3.5 DPI.

Production of an active feline interferon in the cocoon of transgenic silkworms using the fibroin H-chain expression system

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kurihara, H.; Sezutsu, H.; Tamura, T.

2007-04-20

We constructed the fibroin H-chain expression system to produce recombinant proteins in the cocoon of transgenic silkworms. Feline interferon (FeIFN) was used for production and to assess the quality of the product. Two types of FeIFN fusion protein, each with N- and C-terminal sequences of the fibroin H-chain, were designed to be secreted into the lumen of the posterior silk glands. The expression of the FeIFN/H-chain fusion gene was regulated by the fibroin H-chain promoter domain. The transgenic silkworms introduced these constructs with the piggyBac transposon-derived vector, which produced the normal sized cocoons containing each FeIFN/H-chain fusion protein. Although themore » native-protein produced by transgenic silkworms have almost no antiviral activity, the proteins after the treatment with PreScission protease to eliminate fibroin H-chain derived N- and C-terminal sequences from the products, had very high antiviral activity. This H-chain expression system, using transgenic silkworms, could be an alternative method to produce an active recombinant protein and silk-based biomaterials.« less

UGT-29 protein expression and localization during bacterial infection in Caenorhabditis elegans

NASA Astrophysics Data System (ADS)

Wong, Rui-Rui; Lee, Song-Hua; Nathan, Sheila

2014-09-01

The nematode Caenorhabditis elegans is routinely used as an animal model to delineate complex molecular mechanisms involved in the host response to pathogen infection. Following up on an earlier study on host-pathogen interaction, we constructed a ugt-29::GFP transcriptional fusion transgenic worm strain to examine UGT-29 protein expression and localization upon bacterial infection. UGT-29 orthologs can be found in higher organisms including humans and is proposed as a member of the UDP-Glucoronosyl Transferase family of proteins which are involved in phase II detoxification of compounds detrimental to the host organism. Under uninfected conditions, UGT-29::GFP fusion protein was highly expressed in the C. elegans anterior pharynx and intestine, two major organs involved in detoxification. We further evaluated the localization of the enzyme in worms infected with the bacterial pathogen, Burkholderia pseudomallei. The infected ugt-29::GFP transgenic strain exhibited increased fluorescence in the pharynx and intestine with pronounced fluorescence also extending to body wall muscle. This transcriptional fusion GFP transgenic worm is a convenient and direct tool to provide information on UGT detoxification enzyme gene expression and could be a useful tool for a number of diverse applications.

The alternative sigma factor, sigmaS, affects polyhydroxyalkanoate metabolism in Pseudomonas putida.

PubMed

Raiger-Iustman, Laura J; Ruiz, Jimena A

2008-07-01

To determine whether the stationary sigma factor, sigma(S), influences polyhydroxyalkanoate metabolism in Pseudomonas putida KT2440, an rpoS-negative mutant was constructed to evaluate polyhydroxyalkanoate accumulation and expression of a translational fusion to the promoter region of the genes that code for polyhydroxyalkanoate synthase 1 (phaC1) and polyhydroxyalkanoate depolymerase (phaZ). By comparison with the wild-type, the rpoS mutant showed a higher polyhydroxyalkanoate degradation rate and increased expression of the translational fusion during the stationary growth phase. These results suggest that sigma(S) might control the genes involved in polyhydroxyalkanoate metabolism, possibly in an indirect manner. In addition, survival and oxidative stress assays performed under polyhydroxyalkanoate- and nonpolyhydroxyalkanoate- accumulating conditions demonstrated that the accumulated polyhydroxyalkanoate increased the survival and stress tolerance of the rpoS mutant. According to this, polyhydroxyalkanoate accumulation would help cells to overcome the adverse conditions encountered during the stationary phase in the strain that lacks RpoS.

Evolution of AF6-RAS association and its implications in mixed-lineage leukemia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Smith, Matthew J.; Ottoni, Elizabeth; Ishiyama, Noboru

Elucidation of activation mechanisms governing protein fusions is essential for therapeutic development. MLL undergoes rearrangement with numerous partners, including a recurrent translocation fusing the epigenetic regulator to a cytoplasmic RAS effector, AF6/afadin. We show here that AF6 employs a non-canonical, evolutionarily conserved α-helix to bind RAS, unique to AF6 and the classical RASSF effectors. Further, all patients with MLL-AF6 translocations express fusion proteins missing only this helix from AF6, resulting in exposure of hydrophobic residues that induce dimerization. We provide evidence that oligomerization is the dominant mechanism driving oncogenesis from rare MLL translocation partners and employ our mechanistic understanding ofmore » MLL-AF6 to examine how dimers induce leukemia. Proteomic data resolve association of dimerized MLL with gene expression modulators, and inhibiting dimerization disrupts formation of these complexes while completely abrogating leukemogenesis in mice. Oncogenic gene translocations are thus selected under pressure from protein structure/function, underscoring the complex nature of chromosomal rearrangements.« less

Statistical algorithms improve accuracy of gene fusion detection

PubMed Central

Hsieh, Gillian; Bierman, Rob; Szabo, Linda; Lee, Alex Gia; Freeman, Donald E.; Watson, Nathaniel; Sweet-Cordero, E. Alejandro

2017-01-01

Abstract Gene fusions are known to play critical roles in tumor pathogenesis. Yet, sensitive and specific algorithms to detect gene fusions in cancer do not currently exist. In this paper, we present a new statistical algorithm, MACHETE (Mismatched Alignment CHimEra Tracking Engine), which achieves highly sensitive and specific detection of gene fusions from RNA-Seq data, including the highest Positive Predictive Value (PPV) compared to the current state-of-the-art, as assessed in simulated data. We show that the best performing published algorithms either find large numbers of fusions in negative control data or suffer from low sensitivity detecting known driving fusions in gold standard settings, such as EWSR1-FLI1. As proof of principle that MACHETE discovers novel gene fusions with high accuracy in vivo, we mined public data to discover and subsequently PCR validate novel gene fusions missed by other algorithms in the ovarian cancer cell line OVCAR3. These results highlight the gains in accuracy achieved by introducing statistical models into fusion detection, and pave the way for unbiased discovery of potentially driving and druggable gene fusions in primary tumors. PMID:28541529

Expression of BCR-ABL1 oncogene relative to ABL1 gene changes overtime in chronic myeloid leukemia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gupta, Manu; Milani, Lili; Hermansson, Monica

Using a quantitative single nucleotide polymorphism (SNP) assay we have investigated the changes in the expression of the BCR-ABL1 oncogene relative to the wild-type ABL1 and BCR alleles in cells from chronic myeloid leukemia (CML) patients not responding to therapy. The results show a progressive increase in the BCR-ABL1 oncogene expression at the expense of decreased expression of the ABL1 allele, not involved in the fusion. No relative changes in the expression of the two BCR alleles were found. These results demonstrate that allele-specific changes in gene expression, with selective, progressive silencing of the wild-type ABL1 allele in favor ofmore » the oncogenic BCR-ABL1 allele occur in CML patients with therapy-resistant disease.« less

From pollen tubes to infection threads: recruitment of Medicago floral pectic genes for symbiosis.

PubMed

Rodríguez-Llorente, Ignacio D; Pérez-Hormaeche, Javier; El Mounadi, Kaoutar; Dary, Mohammed; Caviedes, Miguel A; Cosson, Viviane; Kondorosi, Adam; Ratet, Pascal; Palomares, Antonio J

2004-08-01

While the biology of nitrogen-fixing root nodules has been extensively studied, little is known about the evolutionary events that predisposed legume plants to form symbiosis with rhizobia. We have studied the presence and the expression of two pectic gene families in Medicago, polygalacturonases (PGs) and pectin methyl esterases (PMEs) during the early steps of the Sinorhizobium meliloti-Medicago interaction and compared them with related pollen-specific genes. First, we have compared the expression of MsPG3, a PG gene specifically expressed during the symbiotic interaction, with the expression of MsPG11, a highly homologous pollen-specific gene, using promoter-gus fusions in transgenic M. truncatula and tobacco plants. These results demonstrated that the symbiotic promoter functions as a pollen-specific promoter in the non-legume host. Second, we have identified the presence of a gene family of at least eight differentially expressed PMEs in Medicago. One subfamily is represented by one symbiotic gene (MtPER) and two pollen-expressed genes (MtPEF1 and MtPEF2) that are clustered in the M. truncatula genome. The promoter-gus studies presented in this work and the homology between plant PGs, together with the analysis of the PME locus structure and MtPER expression studies, suggest that the symbiotic MsPG3 and MtPER could have as ancestors pollen-expressed genes involved in polar tip growth processes during pollen tube elongation. Moreover, they could have been recruited after gene duplication in the symbiotic interaction to facilitate polar tip growth during infection thread formation.

Generation and validation of homozygous fluorescent knock-in cells using CRISPR-Cas9 genome editing.

PubMed

Koch, Birgit; Nijmeijer, Bianca; Kueblbeck, Moritz; Cai, Yin; Walther, Nike; Ellenberg, Jan

2018-06-01

Gene tagging with fluorescent proteins is essential for investigations of the dynamic properties of cellular proteins. CRISPR-Cas9 technology is a powerful tool for inserting fluorescent markers into all alleles of the gene of interest (GOI) and allows functionality and physiological expression of the fusion protein. It is essential to evaluate such genome-edited cell lines carefully in order to preclude off-target effects caused by (i) incorrect insertion of the fluorescent protein, (ii) perturbation of the fusion protein by the fluorescent proteins or (iii) nonspecific genomic DNA damage by CRISPR-Cas9. In this protocol, we provide a step-by-step description of our systematic pipeline to generate and validate homozygous fluorescent knock-in cell lines.We have used the paired Cas9D10A nickase approach to efficiently insert tags into specific genomic loci via homology-directed repair (HDR) with minimal off-target effects. It is time-consuming and costly to perform whole-genome sequencing of each cell clone to check for spontaneous genetic variations occurring in mammalian cell lines. Therefore, we have developed an efficient validation pipeline of the generated cell lines consisting of junction PCR, Southern blotting analysis, Sanger sequencing, microscopy, western blotting analysis and live-cell imaging for cell-cycle dynamics. This protocol takes between 6 and 9 weeks. With this protocol, up to 70% of the targeted genes can be tagged homozygously with fluorescent proteins, thus resulting in physiological levels and phenotypically functional expression of the fusion proteins.

Construction and characterization of a fusion β-1,3-1,4-glucanase to improve hydrolytic activity and thermostability.

PubMed

Sun, Juntao; Wang, Hongxin; Lv, Wenping; Ma, Chaoyang; Lou, Zaixiang; Dai, Yixing

2011-11-01

A new fusion gene (Bgl-licMB), encoding β-1,3-1,4-glucanase both from Bacillus amyloliquefaciens (Bgl) and Clostridium thermocellum (licMB), was constructed via end-to-end fusion and expressed in Escherichia coli to improve hydrolytic activity and thermostability of β-1,3-1,4-glucanase. The results of enzymatic properties showed that the catalytic efficiency (K(cat)/K(m)) of the fusion enzyme for oat β-glucan was 2.7 and 20-fold higher than that of the parental Bgl and licMB, respectively, and that the fusion enzyme can retain more than 50% of activity following incubation at 80°C for 30 min, whereas the residual activities of Bgl and licMB were both less than 30%. These properties make this particular β-1,3-1,4-glucanase a good candidate for application in brewing and animal-feed industries.

Application of β-glucuronidase (GusA) as an effective reporter for extremely acidophilic Acidithiobacillus ferrooxidans.

PubMed

Wang, Huiyan; Fang, Liangyan; Wen, Qing; Lin, Jianqun; Liu, Xiangmei

2017-04-01

Acidithiobacillus ferrooxidans is a model organism for investigating metal sulfide bioleaching. The regulatory mechanism of gene expression by metabolizing various substrates is critical for understanding its role in bioleaching processes. However, no reporter has been successfully employed to study gene expression in A. ferrooxidans to date. In this study, a sensitive and robust reporter system based on β-glucuronidase (GusA) was described for feasible application in A. ferrooxidans. A set of vectors, which contained the transcriptional and translational fusions of gusA, were constructed and employed to analyze promoter activity and efficiency of translation initiation in A. ferrooxidans. Ptac and P2811 were screened out from ten tested promoters and could be used as strong promoters for gene overexpression in A. ferrooxidans. Among the four translational fusions of gusA with different start codons, ATG was most active, followed by TTG and GTG, while CTG showed the least activity. The transcriptional inhibition effect of an IclR-like transcription factor was also observed on its own encoding gene AFE_1668 as well as its neighboring AFE_1667. In addition, the specific chromogenic reaction of GusA could be detected and visualized by colonies of A. ferrooxidans containing gusA expression plasmids. Generally, the established GusA reporter system would be applied not only for quantitative analysis of promoter strength and its transcriptional regulation but also for qualitative colony screening in A. ferrooxidans in the future.

Alcohol induces synaptotagmin 1 expression in neurons via activation of heat shock factor 1.

PubMed

Varodayan, F P; Pignataro, L; Harrison, N L

2011-10-13

Many synapses within the central nervous system are sensitive to ethanol. Although alcohol is known to affect the probability of neurotransmitter release in specific brain regions, the effects of alcohol on the underlying synaptic vesicle fusion machinery have been little studied. To identify a potential pathway by which ethanol can regulate neurotransmitter release, we investigated the effects of acute alcohol exposure (1-24 h) on the expression of the gene encoding synaptotagmin 1 (Syt1), a synaptic protein that binds calcium to directly trigger vesicle fusion. Syt1 was identified in a microarray screen as a gene that may be sensitive to alcohol and heat shock. We found that Syt1 mRNA and protein expression are rapidly and robustly up-regulated by ethanol in mouse cortical neurons, and that the distribution of Syt1 protein along neuronal processes is also altered. Syt1 mRNA up-regulation is dependent on the activation of the transcription factor heat shock factor 1 (HSF1). The transfection of a constitutively active Hsf1 construct into neurons stimulates Syt1 transcription, while transfection of Hsf1 small interfering RNA (siRNA) or a constitutively inactive Hsf1 construct into neurons attenuates the induction of Syt1 by ethanol. This suggests that the activation of HSF1 can induce Syt1 expression and that this may be a mechanism by which alcohol regulates neurotransmitter release during brief exposures. Further analysis revealed that a subset of the genes encoding the core synaptic vesicle fusion (soluble NSF (N-ethylmaleimide-sensitive factor) attachment protein receptor; SNARE) proteins share this property of induction by ethanol, suggesting that alcohol may trigger a specific coordinated adaptation in synaptic function. This molecular mechanism could explain some of the changes in synaptic function that occur following alcohol administration and may be an important step in the process of neuronal adaptation to alcohol. Copyright © 2011 IBRO. Published by Elsevier Ltd. All rights reserved.

Purification and characterization of human pancreatic polypeptide expressed in E. coli.

PubMed

Griko, Y V; Kapanadze, M D

1995-08-04

The region of cDNA encoding human pancreatic polypeptide (hPP) was obtained by polymerase chain reaction (PCR) and subcloned into an expression vector. The pancreatic polypeptide gene was expressed in Escherichia coli in two versions: as a cleavable fusion protein with IgG-binding synthetic ZZ domains of protein A from Staphylococcus aureus or with the 1-48 fragment of lambda Cro repressor. Site-specific hydrolysis by hydroxylamine was used to cleave the fusion protein, releasing the human polypeptide. The structure of the obtained hPP has been studied by scanning microcalorimetry and circular dichroism spectrometry. It has been shown that hPP in solutions close to neutral has a compact and unique spatial structure with an extended hydrophobic core. This structure is stable at 20 degrees C and co-operatively breaks down upon heating from this temperature.

MacoNPV baculovirus midgut-specific gene expression during infection of the bertha armyworm, Mamestra configurata

DOE Office of Scientific and Technical Information (OSTI.GOV)

Donly, B. Cameron, E-mail: Cam.Donly@agr.gc.ca

Baculoviruses have two forms, occlusion derived virus (ODV) which is responsible for primary infection in host midgut tissue and budded virus (BV), which infects all other host tissues during secondary infection. This study examined the primary infection by ODV of midgut cells of bertha armyworm Mamestra configurata fourth instar larvae and measured the expression of viral genes over a time course of infection. Both digital PCR and RNA sequencing methods showed the profile of transcription to be different from those produced by AcMNPV BV infection of in vitro cell cultures. This included having unique collections of genes expressed early, asmore » well as much greater late gene expression of p6.9 and much reduced expression of polh and p10. These differences likely reflect characteristics unique to the critical step of in vivo midgut cell infection, and provide insights into the processes that regulate viral gene expression in different host tissues. -- Highlights: •The transcriptome of MacoNPV ODV in larval midgut was measured by RNA-seq and digital PCR. •The earliest genes expressed included fusion protein, hoar, and me53. •p6.9 was highly expressed late but polH and p10 were less so. •These patterns are unique from BV of other baculoviruses in tissue culture cells.« less

Development of a keratinocyte-based screening model for antipsoriatic drugs using green fluorescent protein under the control of an endogenous promoter.

PubMed

Pol, Arno; van Ruissen, Fred; Schalkwijk, Joost

2002-08-01

Inflamed epidermis (psoriasis, wound healing, ultraviolet-irradiated skin) harbors keratinocytes that are hyperproliferative and display an abnormal differentiation program. A distinct feature of this so-called regenerative maturation pathway is the expression of proteins such as the cytokeratins CK6, CK16, and CK17 and the antiinflammatory protein SKALP/elafin. These proteins are absent in normal skin but highly induced in lesional psoriatic skin. Expression of these genes can be used as a surrogate marker for psoriasis in drug-screening procedures of large compound libraries. The aim of this study was to develop a keratinocyte cell line that contained a reporter gene under the control of a psoriasis-associated endogenous promoter and demonstrate its use in an assay suitable for screening. We generated a stably transfected keratinocyte cell line that expresses enhanced green fluorescent protein (EGFP), under the control of a 0.8-kb fragment derived from the promoter of the SKALP/elafin gene, which confers high levels of tissue-specific expression at the mRNA level. Induction of the SKALP promoter by tumor necrosis factor-alpha resulted in increased expression levels of the secreted SKALP-EGFP fusion protein as assessed by direct readout of fluorescence and fluorescence polarization in 96-well cell culture plates. The fold stimulation of the reporter gene was comparable to that of the endogenous SKALP gene as assessed by enzyme-linked immunosorbent assay. Although the dynamic range of the screening system is limited, the small standard deviation yields a Z factor of 0.49. This indicates that the assay is suitable as a high-throughput screen, and provides proof of the concept that a secreted EGFP fusion protein under the control of a physiologically relevant endogenous promoter can be used as a fluorescence-based high-throughput screen for differentiation-modifying or antiinflammatory compounds that act via the keratinocyte.

Effect of increased HoxB4 on human megakaryocytic development

PubMed Central

Zhong, Yiming; Sullenbarger, Brent; Lasky, Larry C.

2010-01-01

In order to ex vivo produce clinically useful quantity of platelets, we may need to firstly enhance early self-renewal of hematopoietic stem cells (HSCs) and/or megakaryocyte (Mk) progenitors. The homeodomain transcription factor HoxB4 has been shown to be an important regulator of stem cell renewal and hematopoiesis; however, its effect on megakaryopoiesis is unclear. In this study, we investigated the effect of HoxB4 overexpression or RNA silencing on megakaryocytic development in the human TF1 progenitor cell line; we then used recombinant tPTD-HoxB4 fusion protein to study the effect of exogenous HoxB4 on megakaryocytic development of human CD34 positively-selected cord blood cells. We found that ectopic HoxB4 in TF1 cells increased the antigen expression of CD61and CD41a, increased the gene expression of thrombopoietin receptor (TpoR), Scl-1, Cyclin D1, Fog-1 and Fli-1 while it decreased c-Myb expression. HoxB4 RNA silencing in TF1 cells decreased the expression of CD61 and CD41a and decreased Fli-1 expression while it increased the expression of c-Myb. Recombinant tPTD-HoxB4 fusion protein increased the percentages and absolute numbers of CD41a and CD61 positive cells during megakaryocytic differentiation of CD34 positively-selected cord blood cells and increased the numbers of colony forming unit-megakaryocyte (CFU-Mk). Adding tPTD-HoxB4 fusion protein increased the gene expression of TpoR, Cyclin D1, Fog-1 and Fli-1 while it inhibited c-Myb expression. Our data indicate that increased HoxB4 enhanced early megakaryocytic development in human TF1 cells and CD34 positively-selected cord blood cells primarily by upregulating Tpo R and Fli-1 expression and downregulating c-Myb expression. Increasing HoxB4 expression or adding recombinant HoxB4 protein might be a way to expand Mks for the production of platelets for use in transfusion medicine. PMID:20599537

Expression in Escherichia coli and purification of bioactive antibacterial peptide ABP-CM4 from the Chinese silk worm, Bombyx mori.

PubMed

Li, Bao-Cun; Zhang, Shuang-Quan; Dan, Wen-Bing; Chen, Yu-Qing; Cao, Peng

2007-07-01

The antibacterial peptide CM4 (ABP-CM4), isolated from Chinese Bombys mori, is a 35-residue cationic, amphipathic alpha-helical peptide that exhibits a broad range of antimicrobial activity. To explore a new approach for the expression of ABP-CM4 in E. coli, the gene ABP-CM4, obtained by recursive PCR (rPCR), was cloned into the vector pET32a to construct a fusion expression plasmid. The fusion protein Trx-CM4 was expressed in soluble form, purified by Ni(2+)-chelating chromatography, and cleaved by formic acid to release recombinant CM4. Purification of rCM4 was achieved by affinity chromatography and reverse-phase HPLC. The purified of recombinant peptide showed antimicrobial activities against E. coli K(12)D(31), Penicillium chrysogenum, Aspergillus niger and Gibberella saubinetii. According to the antimicrobial peptide database (http://aps.unmc.edu/AP/main.html), 116 peptides contain a Met residue, but only 5 peptides contain the AspPro site, indicating a broader application of formic acid than CNBr in cleaving fusion protein. The successful application to the expression of the ABP-CM4 indicates that the system is a low-cost, efficient way of producting milligram quantities of ABP-CM4 that is biologically active.

Meningeal hemangiopericytoma and solitary fibrous tumors carry the NAB2-STAT6 fusion and can be diagnosed by nuclear expression of STAT6 protein.

PubMed

Schweizer, Leonille; Koelsche, Christian; Sahm, Felix; Piro, Rosario M; Capper, David; Reuss, David E; Pusch, Stefan; Habel, Antje; Meyer, Jochen; Göck, Tanja; Jones, David T W; Mawrin, Christian; Schittenhelm, Jens; Becker, Albert; Heim, Stephanie; Simon, Matthias; Herold-Mende, Christel; Mechtersheimer, Gunhild; Paulus, Werner; König, Rainer; Wiestler, Otmar D; Pfister, Stefan M; von Deimling, Andreas

2013-05-01

Non-central nervous system hemangiopericytoma (HPC) and solitary fibrous tumor (SFT) are considered by pathologists as two variants of a single tumor entity now subsumed under the entity SFT. Recent detection of frequent NAB2-STAT6 fusions in both, HPC and SFT, provided additional support for this view. On the other hand, current neuropathological practice still distinguishes between HPC and SFT. The present study set out to identify genes involved in the formation of meningeal HPC. We performed exome sequencing and detected the NAB2-STAT6 fusion in DNA of 8/10 meningeal HPC thereby providing evidence of close relationship of these tumors with peripheral SFT. Due to the considerable effort required for exome sequencing, we sought to explore surrogate markers for the NAB2-STAT6 fusion protein. We adopted the Duolink proximity ligation assay and demonstrated the presence of NAB2-STAT6 fusion protein in 17/17 HPC and the absence in 15/15 meningiomas. More practical, presence of the NAB2-STAT6 fusion protein resulted in a strong nuclear signal in STAT6 immunohistochemistry. The nuclear reallocation of STAT6 was detected in 35/37 meningeal HPC and 25/25 meningeal SFT but not in 87 meningiomas representing the most important differential diagnosis. Tissues not harboring the NAB2-STAT6 fusion protein presented with nuclear expression of NAB2 and cytoplasmic expression of STAT6 proteins. In conclusion, we provide strong evidence for meningeal HPC and SFT to constitute variants of a single entity which is defined by NAB2-STAT6 fusion. In addition, we demonstrate that this fusion can be rapidly detected by STAT6 immunohistochemistry which shows a consistent nuclear reallocation. This immunohistochemical assay may prove valuable for the differentiation of HPC and SFT from other mesenchymal neoplasms.

Functional characterization of the late embryogenesis abundant (LEA) protein gene family from Pinus tabuliformis (Pinaceae) in Escherichia coli.

PubMed

Gao, Jie; Lan, Ting

2016-01-19

Late embryogenesis abundant (LEA) proteins are a large and highly diverse gene family present in a wide range of plant species. LEAs are proposed to play a role in various stress tolerance responses. Our study represents the first-ever survey of LEA proteins and their encoding genes in a widely distributed pine (Pinus tabuliformis) in China. Twenty-three LEA genes were identified from the P. tabuliformis belonging to seven groups. Proteins with repeated motifs are an important feature specific to LEA groups. Ten of 23 pine LEA genes were selectively expressed in specific tissues, and showed expression divergence within each group. In addition, we selected 13 genes representing each group and introduced theses genes into Escherichia coli to assess the protective function of PtaLEA under heat and salt stresses. Compared with control cells, the E. coli cells expressing PtaLEA fusion protein exhibited enhanced salt and heat resistance and viability, indicating the protein may play a protective role in cells under stress conditions. Furthermore, among these enhanced tolerance genes, a certain extent of function divergence appeared within a gene group as well as between gene groups, suggesting potential functional diversity of this gene family in conifers.

Immunohistochemical expression of ERG in the molecular epidemiology of fatal prostate cancer study.

PubMed

Weinmann, Sheila; Van Den Eeden, Stephen K; Haque, Reina; Chen, Chuhe; Richert-Boe, Kathryn; Schwartzman, Jacob; Gao, Lina; Berry, Deborah L; Kallakury, Bhaskar V S; Alumkal, Joshi J

2013-09-01

Gene fusions between the ERG transcription factor and the androgen-regulated gene TMPRSS2 occur in a subset of prostate cancers and contribute to transformation of prostatic epithelial cells. Prior reports have used fluorescence in situ hybridization (FISH) or quantitative PCR (QPCR) to determine the presence of TMPRSS2-ERG fusions or ERG expression, respectively. Recently, several groups have reported on immunohistochemistry (IHC) to measure ERG expression, which is much more readily performed in clinical practice. However, the prior studies examining ERG expression by IHC had small sample sizes or they failed to clarify the association of ERG protein expression with important clinico-pathological features or prostate cancer-specific mortality. To address these deficits, we evaluated ERG expression by IHC in 208 radical prostatectomy samples from the Kaiser Permanente Molecular Epidemiology of Fatal Prostate Cancer (MEFPC) study, a case-control study of prostate cancer-specific mortality. Nuclear ERG expression was seen in neoplastic prostate epithelia in 49 of the samples (23.7%). ERG expression in tumor cells was associated with higher tumor stage (OR = 2.0, 95% confidence interval 1.0-4.0, P value = 0.04). ERG immunoreactivity was positively associated with prostate cancer-specific mortality, although the confidence interval was wide (OR = 1.9, 95% confidence interval 0.88-4.0, P value = 0.10). Our results demonstrate that ERG protein expression is readily quantifiable with an existing commercial antibody. Evaluating ERG protein expression may improve our ability to identify the subset of more aggressive, invasive prostate cancers. © 2013 Wiley Periodicals, Inc.

Cancer translocations in human cells induced by zinc finger and TALE nucleases

PubMed Central

Piganeau, Marion; Ghezraoui, Hind; De Cian, Anne; Guittat, Lionel; Tomishima, Mark; Perrouault, Loic; René, Oliver; Katibah, George E.; Zhang, Lei; Holmes, Michael C.; Doyon, Yannick; Concordet, Jean-Paul; Giovannangeli, Carine; Jasin, Maria; Brunet, Erika

2013-01-01

Chromosomal translocations are signatures of numerous cancers and lead to expression of fusion genes that act as oncogenes. The wealth of genomic aberrations found in cancer, however, makes it challenging to assign a specific phenotypic change to a specific aberration. In this study, we set out to use genome editing with zinc finger (ZFN) and transcription activator-like effector (TALEN) nucleases to engineer, de novo, translocation-associated oncogenes at cognate endogenous loci in human cells. Using ZFNs and TALENs designed to cut precisely at relevant translocation breakpoints, we induced cancer-relevant t(11;22)(q24;q12) and t(2;5)(p23;q35) translocations found in Ewing sarcoma and anaplastic large cell lymphoma (ALCL), respectively. We recovered both translocations with high efficiency, resulting in the expression of the EWSR1–FLI1 and NPM1–ALK fusions. Breakpoint junctions recovered after ZFN cleavage in human embryonic stem (ES) cell–derived mesenchymal precursor cells fully recapitulated the genomic characteristics found in tumor cells from Ewing sarcoma patients. This approach with tailored nucleases demonstrates that expression of fusion genes found in cancer cells can be induced from the native promoter, allowing interrogation of both the underlying mechanisms and oncogenic consequences of tumor-related translocations in human cells. With an analogous strategy, the ALCL translocation was reverted in a patient cell line to restore the integrity of the two participating chromosomes, further expanding the repertoire of genomic rearrangements that can be engineered by tailored nucleases. PMID:23568838

A novel lumazine synthase molecule from Brucella significantly promotes the immune-stimulation effects of antigenic protein.

PubMed

Du, Z Q; Wang, J Y

2015-10-27

Brucella, an intracellular parasite that infects some livestock and humans, can damage or destroy the reproductive system of livestock. The syndrome is referred to as brucellosis and often occurs in pastoral areas; it is contagious from livestock to humans. In this study, the intact Brucella suis outer membrane protein 31 (omp31) gene was cloned, recombinantly expressed, and examined as a subunit vaccine candidate. The intact Brucella lumazine synthase (bls) gene was cloned and recombinantly expressed to study polymerization function in vitro. Non-reducing gel electrophoresis showed that rBs-BLS existed in different forms in vitro, including as a dimer and a pentamer. An enzyme-linked immunosorbent assay result showed that rOmp31 protein could induce production of an antibody in rabbits. However, the rOmp31-BLS fusion protein could elicit a much higher antibody titer in rabbits; this construct involved fusion of the Omp31 molecule with the BLS molecule. Our results indicate that Omp31 is involved in immune stimulation, while BLS has a polymerizing function based on rOmp31-BLS fusion protein immunogenicity. These data suggest that Omp31 is an ideal subunit vaccine candidate and that the BLS molecule is a favorable transport vector for antigenic proteins.

Development and Verification of an RNA Sequencing (RNA-Seq) Assay for the Detection of Gene Fusions in Tumors.

PubMed

Winters, Jennifer L; Davila, Jaime I; McDonald, Amber M; Nair, Asha A; Fadra, Numrah; Wehrs, Rebecca N; Thomas, Brittany C; Balcom, Jessica R; Jin, Long; Wu, Xianglin; Voss, Jesse S; Klee, Eric W; Oliver, Gavin R; Graham, Rondell P; Neff, Jadee L; Rumilla, Kandelaria M; Aypar, Umut; Kipp, Benjamin R; Jenkins, Robert B; Jen, Jin; Halling, Kevin C

2018-06-13

We assessed the performance characteristics of an RNA sequencing (RNA-Seq) assay designed to detect gene fusions in 571 genes to help manage patients with cancer. Polyadenylated RNA was converted to cDNA, which was then used to prepare next-generation sequencing libraries that were sequenced on an Illumina HiSeq 2500 instrument and analyzed with an in-house developed bioinformatic pipeline. The assay identified 38 of 41 gene fusions detected by another method, such as fluorescence in situ hybridization or RT-PCR, for a sensitivity of 93%. No false-positive gene fusions were identified in 15 normal tissue specimens and 10 tumor specimens that were negative for fusions by RNA sequencing or Mate Pair NGS (100% specificity). The assay also identified 22 fusions in 17 tumor specimens that had not been detected by other methods. Eighteen of the 22 fusions had not previously been described. Good intra-assay and interassay reproducibility was observed with complete concordance for the presence or absence of gene fusions in replicates. The analytical sensitivity of the assay was tested by diluting RNA isolated from gene fusion-positive cases with fusion-negative RNA. Gene fusions were generally detectable down to 12.5% dilutions for most fusions and as little as 3% for some fusions. This assay can help identify fusions in patients with cancer; these patients may in turn benefit from both US Food and Drug Administration-approved and investigational targeted therapies. Copyright © 2018 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

Characterization of hybrid cells derived from spontaneous fusion events between breast epithelial cells exhibiting stem-like characteristics and breast cancer cells.

PubMed

Dittmar, Thomas; Schwitalla, Sarah; Seidel, Jeanette; Haverkampf, Sonja; Reith, Georg; Meyer-Staeckling, Sönke; Brandt, Burkhard H; Niggemann, Bernd; Zänker, Kurt S

2011-01-01

Several data of the past years clearly indicated that the fusion of tumor cells and tumor cells or tumor cells and normal cells can give rise to hybrids cells exhibited novel properties such as an increased malignancy, drug resistance, or resistance to apoptosis. In the present study we characterized hybrid cells derived from spontaneous fusion events between the breast epithelial cell line M13SV1-EGFP-Neo and two breast cancer cell lines: HS578T-Hyg and MDA-MB-435-Hyg. Short-tandem-repeat analysis revealed an overlap of parental alleles in all hybrid cells indicating that hybrid cells originated from real cell fusion events. RealTime-PCR-array gene expression data provided evidence that each hybrid cell clone exhibited a unique gene expression pattern, resulting in a specific resistance of hybrid clones towards chemotherapeutic drugs, such as doxorubicin and paclitaxel, as well as a specific migratory behavior of hybrid clones towards EGF. For instance, M13MDA435-4 hybrids showed a marked resistance towards etoposide, doxorubicin and paclitaxel, whereas hybrid clones M13MDA-435-1 and -2 were only resistant towards etoposide. Likewise, all investigated M13MDA435 hybrids responded to EGF with an increased migratory activity, whereas the migration of parental MDA-MB-435-Hyg cells was blocked by EGF, suggesting that M13MDA435 hybrids may have acquired a new motility pathway. Similar findings have been obtained for M13HS hybrids. We conclude from our data that they further support the hypothesis that cell fusion could give rise to drug resistant and migratory active tumor (hybrid) cells in cancer.

A Nitrile Hydratase in the Eukaryote Monosiga brevicollis

PubMed Central

Foerstner, Konrad U.; Doerks, Tobias; Muller, Jean; Raes, Jeroen; Bork, Peer

2008-01-01

Bacterial nitrile hydratase (NHases) are important industrial catalysts and waste water remediation tools. In a global computational screening of conventional and metagenomic sequence data for NHases, we detected the two usually separated NHase subunits fused in one protein of the choanoflagellate Monosiga brevicollis, a recently sequenced unicellular model organism from the closest sister group of Metazoa. This is the first time that an NHase is found in eukaryotes and the first time it is observed as a fusion protein. The presence of an intron, subunit fusion and expressed sequence tags covering parts of the gene exclude contamination and suggest a functional gene. Phylogenetic analyses and genomic context imply a probable ancient horizontal gene transfer (HGT) from proteobacteria. The newly discovered NHase might open biotechnological routes due to its unconventional structure, its new type of host and its apparent integration into eukaryotic protein networks. PMID:19096720

Identification and characterization of the Myxococcus xanthus bsgA gene product.

PubMed Central

Gill, R E; Bornemann, M C

1988-01-01

The bsgA mutants of Myxococcus xanthus are blocked at a very early stage of the developmental program. They fail to produce fruiting bodies or to sporulate under normal conditions but can be rescued by extracellular complementation in mixtures with wild-type cells. A bsgA-lacZ gene fusion was constructed and expressed in Escherichia coli. The resulting fusion protein, which has beta-galactosidase enzyme activity, was partially purified by affinity chromatography and preparative polyacrylamide gel electrophoresis. The protein was used to immunize mice, which produced a hybridoma secreting monoclonal antibody that was specific for the bsgA gene product. The monoclonal antibody was used in Western blot (immunoblot) experiments to determine the apparent cellular location of the bsgA protein in M. xanthus and to compare the level of this protein at various times in the Myxococcus life cycle. Images PMID:2846515

The ubiquitin ligase TRIM25 targets ERG for degradation in prostate cancer.

PubMed

Wang, Shan; Kollipara, Rahul K; Humphries, Caroline G; Ma, Shi-Hong; Hutchinson, Ryan; Li, Rui; Siddiqui, Javed; Tomlins, Scott A; Raj, Ganesh V; Kittler, Ralf

2016-10-04

Ets related gene (ERG) is a transcription factor that is overexpressed in 40% of prostate tumors due to a gene fusion between ERG and TMPRSS2. Because ERG functions as a driver of prostate carcinogenesis, understanding the mechanisms that influence its turnover may provide new molecular handles to target the protein. Previously, we found that ERG undergoes ubiquitination and then is deubiquitinated by USP9X in prostate cancer cells to prevent its proteasomal degradation. Here, we identify Tripartite motif-containing protein 25 (TRIM25) as the E3 ubiquitin ligase that ubiquitinates the protein prior to its degradation. TRIM25 binds full-length ERG, and it also binds the N-terminally truncated variants of ERG that are expressed in tumors with TMPRSS2-ERG fusions. We demonstrate that TRIM25 polyubiquitinates ERG in vitro and that inactivation of TRIM25 resulted in reduced polyubiquitination and stabilization of ERG. TRIM25 mRNA and protein expression was increased in ERG rearrangement-positive prostate cancer specimens, and we provide evidence that ERG upregulates TRIM25 expression. Thus, overexpression of ERG in prostate cancer may cause an increase in TRIM25 activity, which is mitigated by the expression of the deubiquitinase USP9X, which is required to stabilize ERG.

The ubiquitin ligase TRIM25 targets ERG for degradation in prostate cancer

PubMed Central

Wang, Shan; Kollipara, Rahul K.; Humphries, Caroline G.; Ma, Shi-Hong; Hutchinson, Ryan; Li, Rui; Siddiqui, Javed; Tomlins, Scott A.; Raj, Ganesh V.; Kittler, Ralf

2016-01-01

Ets related gene (ERG) is a transcription factor that is overexpressed in 40% of prostate tumors due to a gene fusion between ERG and TMPRSS2. Because ERG functions as a driver of prostate carcinogenesis, understanding the mechanisms that influence its turnover may provide new molecular handles to target the protein. Previously, we found that ERG undergoes ubiquitination and then is deubiquitinated by USP9X in prostate cancer cells to prevent its proteasomal degradation. Here, we identify Tripartite motif-containing protein 25 (TRIM25) as the E3 ubiquitin ligase that ubiquitinates the protein prior to its degradation. TRIM25 binds full-length ERG, and it also binds the N-terminally truncated variants of ERG that are expressed in tumors with TMPRSS2-ERG fusions. We demonstrate that TRIM25 polyubiquitinates ERG in vitro and that inactivation of TRIM25 resulted in reduced polyubiquitination and stabilization of ERG. TRIM25 mRNA and protein expression was increased in ERG rearrangement-positive prostate cancer specimens, and we provide evidence that ERG upregulates TRIM25 expression. Thus, overexpression of ERG in prostate cancer may cause an increase in TRIM25 activity, which is mitigated by the expression of the deubiquitinase USP9X, which is required to stabilize ERG. PMID:27626314

Characterization of the Autophagy related gene-8a (Atg8a) promoter in Drosophila melanogaster.

PubMed

Bali, Arundhati; Shravage, Bhupendra V

2017-01-01

Autophagy is an evolutionarily conserved process which is upregulated under various stress conditions, including nutrient stress and oxidative stress. Amongst autophagy related genes (Atgs), Atg8a (LC3 in mammals) is induced several-fold during nutrient limitation in Drosophila. The minimal Atg8a cis-regulatory module (CRM) which mediates transcriptional upregulation under various stress conditions is not known. Here, we describe the generation and analyses of a series of Atg8a promoter deletions which drive the expression of an mCherry-Atg8a fusion cassette. Expression studies revealed that a 200 bp region of Atg8a is sufficient to drive expression of Atg8a in nutrient rich conditions in fat body and ovaries, as well as under nutrient deficient conditions in the fat body. Furthermore, this 200 bp region can mediate Atg8a upregulation during developmental histolysis of the larval fat body and under oxidative stress conditions induced by H 2 O 2 . Finally, the expression levels of Atg8a from this promoter are sufficient to rescue the lethality of the Atg8a mutant. The 200 bp promoter-fusion reporter provides a valuable tool which can be used in genetic screens to identify transcriptional and post-transcriptional regulators of Atg8a.

Microfluidics-Based PCR for Fusion Transcript Detection.

PubMed

Chen, Hui

2016-01-01

The microfluidic technology allows the production of network of submillimeter-size fluidic channels and reservoirs in a variety of material systems. The microfluidic-based polymerase chain reaction (PCR) allows automated multiplexing of multiple samples and multiple assays simultaneously within a network of microfluidic channels and chambers that are co-ordinated in controlled fashion by the valves. The individual PCR reaction is performed in nanoliter volume, which allows testing on samples with limited DNA and RNA. The microfluidics devices are used in various types of PCR such as digital PCR and single molecular emulsion PCR for genotyping, gene expression, and miRNA expression. In this chapter, the use of a microfluidics-based PCR for simultaneous screening of 14 known fusion transcripts in patients with leukemia is described.

NSD3-NUT fusion oncoprotein in NUT midline carcinoma: implications for a novel oncogenic mechanism.

PubMed

French, Christopher A; Rahman, Shaila; Walsh, Erica M; Kühnle, Simone; Grayson, Adlai R; Lemieux, Madeleine E; Grunfeld, Noam; Rubin, Brian P; Antonescu, Cristina R; Zhang, Songlin; Venkatramani, Rajkumar; Dal Cin, Paola; Howley, Peter M

2014-08-01

NUT midline carcinoma (NMC) is an aggressive subtype of squamous cell carcinoma that typically harbors BRD4/3-NUT fusion oncoproteins that block differentiation and maintain tumor growth. In 20% of cases, NUT is fused to uncharacterized non-BRD gene(s). We established a new patient-derived NMC cell line (1221) and demonstrated that it harbors a novel NSD3-NUT fusion oncogene. We find that NSD3-NUT is both necessary and sufficient for the blockade of differentiation and maintenance of proliferation in NMC cells. NSD3-NUT binds to BRD4, and BRD bromodomain inhibitors induce differentiation and arrest proliferation of 1221 cells. We find further that NSD3 is required for the blockade of differentiation in BRD4-NUT-expressing NMCs. These findings identify NSD3 as a novel critical oncogenic component and potential therapeutic target in NMC. The existence of a family of fusion oncogenes in squamous cell carcinoma is unprecedented, and should lead to key insights into aberrant differentiation in NMC and possibly other squamous cell carcinomas. The involvement of the NSD3 methyltransferase as a component of the NUT fusion protein oncogenic complex identifies a new potential therapeutic target. ©2014 American Association for Cancer Research.

Long Term Non-Invasive Imaging of Embryonic Stem Cells Using Reporter Genes

PubMed Central

Sun, Ning; Lee, Andrew; Wu, Joseph C.

2013-01-01

Development of non-invasive and accurate methods to track cell fate following delivery will greatly expedite transition of embryonic stem (ES) cell therapy to the clinic. Here we describe a protocol for the in vivo monitoring of stem cell survival, proliferation, and migration using reporter genes. We established stable ES cell lines constitutively expressing double fusion (DF; enhanced green fluorescent protein and firefly luciferase) or triple fusion (TF; monomeric red fluorescent protein, firefly luciferase, and herpes simplex virus thymidine kinase) reporter genes using lentiviral transduction. We used fluorescence activated cell sorting to purify these populations in vitro, bioluminescence imaging and positron emission tomography imaging to track them in vivo, and fluorescence immunostaining to confirm the results ex vivo. Unlike other methods of cell tracking such as iron particle and radionuclide labeling, reporter genes are inherited genetically and can be used to monitor cell proliferation and survival for the lifetime of transplanted cells and their progeny. PMID:19617890

Functional identification of the non-specific nuclease from white spot syndrome virus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li Li; Lin Shumei; Yanga Feng

2005-07-05

The product encoded by the wsv191 gene from shrimp white spot syndrome virus (WSSV) is homologous with non-specific nucleases (NSN) of other organisms. To functionally identify the protein, the wsv191 gene was expressed in Escherichia coli as a glutathione S-transferase (GST) fusion protein with 6His-tag at C-terminal. The fusion protein (termed as rWSSV-NSN) was purified using Ni-NTA affinity chromatography under denatured conditions, renatured and characterized by three methods. The results showed that rWSSV-NSN could hydrolyze both DNA and RNA. 5'-RACE result revealed that the transcription initiation site of the wsv191 gene was located at nucleotide residue G of the predictedmore » ATG triplet. Therefore, we concluded that the next ATG should be the genuine translation initiation codon of the wsv191 gene. Western blot analysis revealed that the molecular mass of natural WSSV-NSN was 37 kDa.« less

Identification and Characterization of LFD-2, a Predicted Fringe Protein Required for Membrane Integrity during Cell Fusion in Neurospora crassa

PubMed Central

Palma-Guerrero, Javier; Zhao, Jiuhai; Gonçalves, A. Pedro; Starr, Trevor L.

2015-01-01

The molecular mechanisms of membrane merger during somatic cell fusion in eukaryotic species are poorly understood. In the filamentous fungus Neurospora crassa, somatic cell fusion occurs between genetically identical germinated asexual spores (germlings) and between hyphae to form the interconnected network characteristic of a filamentous fungal colony. In N. crassa, two proteins have been identified to function at the step of membrane fusion during somatic cell fusion: PRM1 and LFD-1. The absence of either one of these two proteins results in an increase of germling pairs arrested during cell fusion with tightly appressed plasma membranes and an increase in the frequency of cell lysis of adhered germlings. The level of cell lysis in ΔPrm1 or Δlfd-1 germlings is dependent on the extracellular calcium concentration. An available transcriptional profile data set was used to identify genes encoding predicted transmembrane proteins that showed reduced expression levels in germlings cultured in the absence of extracellular calcium. From these analyses, we identified a mutant (lfd-2, for late fusion defect-2) that showed a calcium-dependent cell lysis phenotype. lfd-2 encodes a protein with a Fringe domain and showed endoplasmic reticulum and Golgi membrane localization. The deletion of an additional gene predicted to encode a low-affinity calcium transporter, fig1, also resulted in a strain that showed a calcium-dependent cell lysis phenotype. Genetic analyses showed that LFD-2 and FIG1 likely function in separate pathways to regulate aspects of membrane merger and repair during cell fusion. PMID:25595444

Evaluation of a novel Dot-ELISA assay utilizing a recombinant protein for the effective diagnosis of Taenia pisiformis larval infections.

PubMed

Chen, Lin; Yang, Deying; Gu, Xiaobin; Peng, Xuerong; Yang, Guangyou

2014-08-29

Cysticercosis, caused by the larvae of Taenia pisiformis, is a common disease in domestic breeds of the rabbit Oryctolagus cuniculus that results in economic losses. At present, there is no convenient and effective method for the rapid detection of T. pisiformis larvae. Here, we developed and tested the efficacy of a Dot-ELISA assay for the diagnosis of T. pisiformis larval infections in rabbits, based on the expression of the recombinant fusion protein (rTp1) from the Tp1 gene. Rapid amplification of cDNA ends (RACE) was used to amplify the 3' ends of the Tp1 gene, based on the unigene similar to Ts1 gene (EU009656.1) which comes from transcriptome sequencing of T. pisiformis. The Tp1 gene was successfully amplified, cloned and expressed in BL21 (DE3). Western blot analysis revealed that the recombinant Tp1 protein is specifically recognized by rabbit T. pisiformis cysticercosis antisera. This purified recombinant fusion protein, rTp1, was probed by Dot-ELISA with sera from rabbits infected with T. pisiformis larvae and with other parasitic infections. Results showed that this Dot-ELISA assay had both high sensitivity (92.9-97.6%) and specificity (95.2-98.4%) to detect T. pisiformis larval infections. We also found very low levels of cross-reaction with other parasitic infections. This study has revealed that our novel Dot-ELISA assay utilizing the recombinant fusion protein, rTp1, has a strong potential for the effective diagnosis of T. pisiformis infections in rabbits. Copyright © 2014 Elsevier B.V. All rights reserved.

MultiSite Gateway-Compatible Cell Type-Specific Gene-Inducible System for Plants1[OPEN

PubMed Central

Siligato, Riccardo; Wang, Xin; Yadav, Shri Ram; Lehesranta, Satu; Ma, Guojie; Ursache, Robertas; Sevilem, Iris; Zhang, Jing; Gorte, Maartje; Prasad, Kalika; Heidstra, Renze

2016-01-01

A powerful method to study gene function is expression or overexpression in an inducible, cell type-specific system followed by observation of consequent phenotypic changes and visualization of linked reporters in the target tissue. Multiple inducible gene overexpression systems have been developed for plants, but very few of these combine plant selection markers, control of expression domains, access to multiple promoters and protein fusion reporters, chemical induction, and high-throughput cloning capabilities. Here, we introduce a MultiSite Gateway-compatible inducible system for Arabidopsis (Arabidopsis thaliana) plants that provides the capability to generate such constructs in a single cloning step. The system is based on the tightly controlled, estrogen-inducible XVE system. We demonstrate that the transformants generated with this system exhibit the expected cell type-specific expression, similar to what is observed with constitutively expressed native promoters. With this new system, cloning of inducible constructs is no longer limited to a few special cases but can be used as a standard approach when gene function is studied. In addition, we present a set of entry clones consisting of histochemical and fluorescent reporter variants designed for gene and promoter expression studies. PMID:26644504

ERG/AKR1C3/AR Constitutes a Feed-Forward Loop for AR Signaling in Prostate Cancer Cells.

PubMed

Powell, Katelyn; Semaan, Louie; Conley-LaComb, M Katie; Asangani, Irfan; Wu, Yi-Mi; Ginsburg, Kevin B; Williams, Julia; Squire, Jeremy A; Maddipati, Krishna R; Cher, Michael L; Chinni, Sreenivasa R

2015-06-01

Intratumoral androgen synthesis in prostate cancer contributes to the development of castration-resistant prostate cancer (CRPC). Several enzymes responsible for androgen biosynthesis have been shown to be overexpressed in CRPC, thus contributing to CRPC in a castrated environment. The TMPRSS2-ERG transcription factor has been shown to be present in primary prostate cancer tumors as well as CRPC tumors. We hypothesize that TMPRSS2-ERG fusions regulate androgen biosynthetic enzyme (ABE) gene expression and the production of androgens, which contributes to the development of CRPC. We used a panel of assays, including lentivirus transduction, gene expression, chromatin immunoprecipitation and sequencing, liquid chromatography-mass spectrometric quantitation, immunocytochemistry, immunohistochemistry, and bioinformatics analysis of gene microarray databases, to determine ERG regulation of androgen synthesis. We found that ERG regulated the expression of the ABE AKR1C3 in prostate cancer cells via direct binding to the AKR1C3 gene. Knockdown of ERG resulted in reduced AKR1C3 expression, which caused a reduction in both DHT synthesis and PSA expression in VCaP prostate cancer cells treated with 5α-androstanedione (5α-Adione), a DHT precursor metabolite. Immunohistochemical staining revealed that ERG was coexpressed with AKR1C3 in prostate cancer tissue samples. These data suggest that AKR1C3 catalyzes the biochemical reduction of 5α-Adione to DHT in prostate cancer cells, and that ERG regulates this step through upregulation of AKR1C3 expression. Elucidation of ERG regulation of ABEs in CRPC may help to stratify TMPRSS2-ERG fusion-positive prostate cancer patients in the clinic for anti-androgen receptor-driven therapies; and AKR1C3 may serve as a valuable therapeutic target in the treatment of CRPC. ©2015 American Association for Cancer Research.

Combining Random Gene Fission and Rational Gene Fusion To Discover Near-Infrared Fluorescent Protein Fragments That Report on Protein–Protein Interactions

PubMed Central

2015-01-01

Gene fission can convert monomeric proteins into two-piece catalysts, reporters, and transcription factors for systems and synthetic biology. However, some proteins can be challenging to fragment without disrupting function, such as near-infrared fluorescent protein (IFP). We describe a directed evolution strategy that can overcome this challenge by randomly fragmenting proteins and concomitantly fusing the protein fragments to pairs of proteins or peptides that associate. We used this method to create libraries that express fragmented IFP as fusions to a pair of associating peptides (IAAL-E3 and IAAL-K3) and proteins (CheA and CheY) and screened for fragmented IFP with detectable near-infrared fluorescence. Thirteen novel fragmented IFPs were identified, all of which arose from backbone fission proximal to the interdomain linker. Either the IAAL-E3 and IAAL-K3 peptides or CheA and CheY proteins could assist with IFP fragment complementation, although the IAAL-E3 and IAAL-K3 peptides consistently yielded higher fluorescence. These results demonstrate how random gene fission can be coupled to rational gene fusion to create libraries enriched in fragmented proteins with AND gate logic that is dependent upon a protein–protein interaction, and they suggest that these near-infrared fluorescent protein fragments will be suitable as reporters for pairs of promoters and protein–protein interactions within whole animals. PMID:25265085

Combining random gene fission and rational gene fusion to discover near-infrared fluorescent protein fragments that report on protein-protein interactions.

PubMed

Pandey, Naresh; Nobles, Christopher L; Zechiedrich, Lynn; Maresso, Anthony W; Silberg, Jonathan J

2015-05-15

Gene fission can convert monomeric proteins into two-piece catalysts, reporters, and transcription factors for systems and synthetic biology. However, some proteins can be challenging to fragment without disrupting function, such as near-infrared fluorescent protein (IFP). We describe a directed evolution strategy that can overcome this challenge by randomly fragmenting proteins and concomitantly fusing the protein fragments to pairs of proteins or peptides that associate. We used this method to create libraries that express fragmented IFP as fusions to a pair of associating peptides (IAAL-E3 and IAAL-K3) and proteins (CheA and CheY) and screened for fragmented IFP with detectable near-infrared fluorescence. Thirteen novel fragmented IFPs were identified, all of which arose from backbone fission proximal to the interdomain linker. Either the IAAL-E3 and IAAL-K3 peptides or CheA and CheY proteins could assist with IFP fragment complementation, although the IAAL-E3 and IAAL-K3 peptides consistently yielded higher fluorescence. These results demonstrate how random gene fission can be coupled to rational gene fusion to create libraries enriched in fragmented proteins with AND gate logic that is dependent upon a protein-protein interaction, and they suggest that these near-infrared fluorescent protein fragments will be suitable as reporters for pairs of promoters and protein-protein interactions within whole animals.

Identification of target genes of synovial sarcoma-associated fusion oncoprotein using human pluripotent stem cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hayakawa, Kazuo; Department of Cell Growth and Differentiation, Center for iPS Cell Research and Application, Kyoto University, Kyoto; Department of Orthopaedic Surgery, Graduate School of Medical Sciences, Nagoya City University, Nagoya

2013-03-22

Highlights: ► We tried to identify targets of synovial sarcoma (SS)-associated SYT–SSX fusion gene. ► We established pluripotent stem cell (PSC) lines with inducible SYT–SSX gene. ► SYT–SSX responsive genes were identified by the induction of SYT–SSX in PSC. ► SS-related genes were selected from database by in silico analyses. ► 51 genes were finally identified among SS-related genes as targets of SYT–SSX in PSC. -- Abstract: Synovial sarcoma (SS) is a malignant soft tissue tumor harboring chromosomal translocation t(X; 18)(p11.2; q11.2), which produces SS-specific fusion gene, SYT–SSX. Although precise function of SYT–SSX remains to be investigated, accumulating evidences suggestmore » its role in gene regulation via epigenetic mechanisms, and the product of SYT–SSX target genes may serve as biomarkers of SS. Lack of knowledge about the cell-of-origin of SS, however, has placed obstacle in the way of target identification. Here we report a novel approach to identify SYT–SSX2 target genes using human pluripotent stem cells (hPSCs) containing a doxycycline-inducible SYT–SSX2 gene. SYT–SSX2 was efficiently induced both at mRNA and protein levels within three hours after doxycycline administration, while no morphological change of hPSCs was observed until 24 h. Serial microarray analyses identified genes of which the expression level changed more than twofold within 24 h. Surprisingly, the majority (297/312, 95.2%) were up-regulated genes and a result inconsistent with the current concept of SYT–SSX as a transcriptional repressor. Comparing these genes with SS-related genes which were selected by a series of in silico analyses, 49 and 2 genes were finally identified as candidates of up- and down-regulated target of SYT–SSX, respectively. Association of these genes with SYT–SSX in SS cells was confirmed by knockdown experiments. Expression profiles of SS-related genes in hPSCs and human mesenchymal stem cells (hMSCs) were strikingly different in response to the induction of SYT–SSX, and more than half of SYT–SSX target genes in hPSCs were not induced in hMSCs. These results suggest the importance of cellular context for correct understanding of SYT–SSX function, and demonstrated how our new system will help to overcome this issue.« less

[Eukaryotic Expression and Immunogenic Research of Recombination Ebola Virus Membrane Protein Gp-Fc].

PubMed

Zhang, Xiaoguang; Yang, Ren; Wang, Jiao; Wang, Xuan; Hou, Mieling; An, Lina; Zhu, Ying; Cao, Yuxi; Zeng, Yi

2016-01-01

We used 293 cells to express the recombinant membrane protein of the Ebola virus. Then, the immunogenicity of the recombinant protein was studied by immunized BALB/c mice. According to the codon use frequency of humans, the gene encoding the extracellular domain of the Ebola virus membrane protein was optimized, synthesized, and inserted into the eukaryotic expression plasmid pXG-Fc to construct the human IgG Fc and Ebola GP fusion protein expression plasmid pXG-modGP-Fc. To achieve expression, the fusion protein expression vector was transfected into high-density 293 cells using transient transfection technology. The recombinant protein was purified by protein A affinity chromatography. BALB/c mice were immunized with the purified fusion protein, and serum antibody titers evaluated by an indirect enzyme-linked immunosorbent assay (ELISA). Purification and analyses of the protein revealed that the eukaryotic expression vector could express the recombinant protein GP-Fc effectively, and that the recombinant protein in the supernatant of the cell culture was present as a dimer. After immunization with the purified recombinant protein, a high titer of antigen-specific IgG could be detected in the serum of immunized mice by indirect ELISA, showing that the recombinant protein had good immunogenicity. These data suggest that we obtained a recombinant protein with good immunogenicity. Our study is the basis for development of a vaccine against the Ebola virus and for screening of monoclonal antibodies.

Hierarchical Bayesian modelling of gene expression time series across irregularly sampled replicates and clusters.

PubMed

Hensman, James; Lawrence, Neil D; Rattray, Magnus

2013-08-20

Time course data from microarrays and high-throughput sequencing experiments require simple, computationally efficient and powerful statistical models to extract meaningful biological signal, and for tasks such as data fusion and clustering. Existing methodologies fail to capture either the temporal or replicated nature of the experiments, and often impose constraints on the data collection process, such as regularly spaced samples, or similar sampling schema across replications. We propose hierarchical Gaussian processes as a general model of gene expression time-series, with application to a variety of problems. In particular, we illustrate the method's capacity for missing data imputation, data fusion and clustering.The method can impute data which is missing both systematically and at random: in a hold-out test on real data, performance is significantly better than commonly used imputation methods. The method's ability to model inter- and intra-cluster variance leads to more biologically meaningful clusters. The approach removes the necessity for evenly spaced samples, an advantage illustrated on a developmental Drosophila dataset with irregular replications. The hierarchical Gaussian process model provides an excellent statistical basis for several gene-expression time-series tasks. It has only a few additional parameters over a regular GP, has negligible additional complexity, is easily implemented and can be integrated into several existing algorithms. Our experiments were implemented in python, and are available from the authors' website: http://staffwww.dcs.shef.ac.uk/people/J.Hensman/.

Depression of streptomycin production by Streptomyces griseus at elevated growth temperature: studies using gene fusions.

PubMed

Deeble, V J; Lindley, H K; Fazeli, M R; Cove, J H; Baumberg, S

1995-10-01

Streptomyces griseus ATCC 12475 fails to produce streptomycin when grown at 34 degrees C or above, although growth is appreciable up to at least 37 degrees C. This depression of streptomycin production at elevated growth temperature is manifest equally in liquid and on solid, and with complex and minimal, media. We report studies with gene fusions of the reporter genes aph or xyIE to restriction fragments containing the streptomycin biosynthesis promoter PstrB1. aph constructs were in high, and xyIE constructs in low, copy number vectors. Two strB1 promoter fragments were used, one requiring activation by the pathway-specific activator StrR of S. griseus, the other reportedly activator independent. PstrB1 expression in the aph constructs in S. griseus and in S. lividans was significantly reduced at 37 degrees C compared to 30 degrees C. Some of this reduction could be explained by lower plasmid copy number at the higher temperature, but strR-dependent expression was clearly temperature controlled. Using the xyIE reporter system, the temperature dependence of PstrB1 expression was confirmed but, surprisingly, the strR dependence of the two promoter fragments differed from that observed in the multicopy aph constructs. These data identify a temperature-dependent promoter which may contribute to the depressive effect of elevated growth temperature on streptomycin production.

DNA sequence and characterization of GcvA, a LysR family regulatory protein for the Escherichia coli glycine cleavage enzyme system.

PubMed Central

Wilson, R L; Stauffer, G V

1994-01-01

The gene encoding GcvA, the trans-acting regulatory protein for the Escherichia coli glycine cleavage enzyme system, has been sequenced. The gcvA locus contains an open reading frame of 930 nucleotides that could encode a protein with a molecular mass of 34.4 kDa, consistent with the results of minicell analysis indicating that GcvA is a polypeptide of approximately 33 kDa. The deduced amino acid sequence of GcvA revealed that this protein shares similarity with the LysR family of activator proteins. The transcription start site was found to be 72 bp upstream of the presumed translation start site. A chromosomal deletion of gcvA resulted in the inability of cells to activate the expression of a gcvT-lacZ gene fusion when grown in the presence of glycine and an inability to repress gcvT-lacZ expression when grown in the presence of inosine. The regulation of gcvA was examined by constructing a gcvA-lacZ gene fusion in which beta-galactosidase synthesis is under the control of the gcvA regulatory region. Although gcvA expression appears to be autogenously regulated over a two- to threefold range, it is neither induced by glycine nor repressed by inosine. Images PMID:8188587

Arabidopsis thaliana gonidialess A/Zuotin related factors (GlsA/ZRF) are essential for maintenance of meristem integrity.

PubMed

Guzmán-López, José Alfredo; Abraham-Juárez, María Jazmín; Lozano-Sotomayor, Paulina; de Folter, Stefan; Simpson, June

2016-05-01

Observation of a differential expression pattern, including strong expression in meristematic tissue of an Agave tequilana GlsA/ZRF ortholog suggested an important role for this gene during bulbil formation and developmental changes in this species. In order to better understand this role, the two GlsA/ZFR orthologs present in the genome of Arabidopsis thaliana were functionally characterized by analyzing expression patterns, double mutant phenotypes, promoter-GUS fusions and expression of hormone related or meristem marker genes. Patterns of expression for A. thaliana show that GlsA/ZFR genes are strongly expressed in SAMs and RAMs in mature plants and developing embryos and double mutants showed multiple changes in morphology related to both SAM and RAM tissues. Typical double mutants showed stunted growth of aerial and root tissue, formation of multiple ectopic meristems and effects on cotyledons, leaves and flowers. The KNOX genes STM and BP were overexpressed in double mutants whereas CLV3, WUSCHEL and AS1 were repressed and lack of AtGlsA expression was also associated with changes in localization of auxin and cytokinin. These results suggest that GlsA/ZFR is an essential component of the machinery that maintains the integrity of SAM and RAM tissue and underline the potential to identify new genes or gene functions based on observations in non-model plants.

NUP98-PHF23 is a chromatin modifying oncoprotein that causes a wide array of leukemias sensitive to inhibition of PHD domain histone reader function

PubMed Central

Gough, Sheryl M; Lee, Fan; Yang, Fan; Walker, Robert L; Zhu, Yeulin J; Pineda, Marbin; Onozawa, Masahiro; Chung, Yang Jo; Bilke, Sven; Wagner, Elise K; Denu, John M; Ning, Yi; Xu, Bowen; Wang, Gang Greg; Meltzer, Paul S; Aplan, Peter D

2014-01-01

In this report, we show that expression of a NUP98-PHF23 (NP23) fusion, associated with acute myeloid leukemia (AML) in humans, leads to myeloid, erythroid, T-cell, and B-cell leukemia in mice. The leukemic and pre-leukemic tissues display a stem cell-like expression signature including Hoxa, Hoxb, and Meis1 genes. The PHF23 PHD domain is known to bind H3K4me3 residues, and chromatin immunoprecipitation experiments demonstrated that the NP23 protein bound chromatin at a specific subset of H3K4me3 sites, including Hoxa, Hoxb, and Meis1. Treatment of NP23 cells with disulfiram, which inhibits the binding of PHD domains to H3K4me3 residues, rapidly and selectively killed NP23 myeloblasts; cell death was preceded by decreased expression of Hoxa, Hoxb, and Meis1. Furthermore, AML driven by a related fusion gene, NUP98-JARID1A (NJL), was also sensitive to disulfiram. Thus, the NP23 mouse provides a platform to evaluate compounds that disrupt binding of oncogenic PHD proteins to H3K4me3. PMID:24535671

Repressing a Repressor

PubMed Central

Silverstone, Aron L.; Jung, Hou-Sung; Dill, Alyssa; Kawaide, Hiroshi; Kamiya, Yuji; Sun, Tai-ping

2001-01-01

RGA (for repressor of ga1-3) and SPINDLY (SPY) are likely repressors of gibberellin (GA) signaling in Arabidopsis because the recessive rga and spy mutations partially suppressed the phenotype of the GA-deficient mutant ga1-3. We found that neither rga nor spy altered the GA levels in the wild-type or the ga1-3 background. However, expression of the GA biosynthetic gene GA4 was reduced 26% by the rga mutation, suggesting that partial derepression of the GA response pathway by rga resulted in the feedback inhibition of GA4 expression. The green fluorescent protein (GFP)–RGA fusion protein was localized to nuclei in transgenic Arabidopsis. This result supports the predicted function of RGA as a transcriptional regulator based on sequence analysis. Confocal microscopy and immunoblot analyses demonstrated that the levels of both the GFP-RGA fusion protein and endogenous RGA were reduced rapidly by GA treatment. Therefore, the GA signal appears to derepress the GA signaling pathway by degrading the repressor protein RGA. The effect of rga on GA4 gene expression and the effect of GA on RGA protein level allow us to identify part of the mechanism by which GA homeostasis is achieved. PMID:11449051

Production of chimeric recombinant single domain antibody-green fluorescent fusion protein in Chinese hamster ovary cells.

PubMed

Bazl, M Rajabi; Rasaee, M J; Foruzandeh, M; Rahimpour, A; Kiani, J; Rahbarizadeh, F; Alirezapour, B; Mohammadi, M

2007-02-01

There is an increasing interest in the application of nanobodies such as VHH in the field of therapy and imaging. In the present study a stable genetically engineered cell line of Chinese hamster ovary (CHO) origin transfected using two sets of expression vectors was constructed in order to permit the cytoplasmic and extracellular expression of single domain antibody along with green fluorescent protein (GFP) as reporter gene. The quality of the constructs were examined both by the restriction map as well as sequence analysis. The gene transfection and protein expression was further examined by reverse transcription-polymerase chain reaction (RT-PCR). The transfected cells were grown in 200 microg/mL hygromycin containing media and the stable cell line obtained showed fluorescent activity for more than a period of 180 days. The production of fusion protein was also detected by fluorescent microscopy, fluorescent spectroscopy as well as by enzyme-linked immunosorbent assay (ELISA) analysis. This strategy allows a rapid production of recombinant fluobodies involving VHH, which can be used in various experiments such as imaging and detection in which a primary labeled antibody is required.

Exploration of the gene fusion landscape of glioblastoma using transcriptome sequencing and copy number data.

PubMed

Shah, Nameeta; Lankerovich, Michael; Lee, Hwahyung; Yoon, Jae-Geun; Schroeder, Brett; Foltz, Greg

2013-11-22

RNA-seq has spurred important gene fusion discoveries in a number of different cancers, including lung, prostate, breast, brain, thyroid and bladder carcinomas. Gene fusion discovery can potentially lead to the development of novel treatments that target the underlying genetic abnormalities. In this study, we provide comprehensive view of gene fusion landscape in 185 glioblastoma multiforme patients from two independent cohorts. Fusions occur in approximately 30-50% of GBM patient samples. In the Ivy Center cohort of 24 patients, 33% of samples harbored fusions that were validated by qPCR and Sanger sequencing. We were able to identify high-confidence gene fusions from RNA-seq data in 53% of the samples in a TCGA cohort of 161 patients. We identified 13 cases (8%) with fusions retaining a tyrosine kinase domain in the TCGA cohort and one case in the Ivy Center cohort. Ours is the first study to describe recurrent fusions involving non-coding genes. Genomic locations 7p11 and 12q14-15 harbor majority of the fusions. Fusions on 7p11 are formed in focally amplified EGFR locus whereas 12q14-15 fusions are formed by complex genomic rearrangements. All the fusions detected in this study can be further visualized and analyzed using our website: http://ivygap.swedish.org/fusions. Our study highlights the prevalence of gene fusions as one of the major genomic abnormalities in GBM. The majority of the fusions are private fusions, and a minority of these recur with low frequency. A small subset of patients with fusions of receptor tyrosine kinases can benefit from existing FDA approved drugs and drugs available in various clinical trials. Due to the low frequency and rarity of clinically relevant fusions, RNA-seq of GBM patient samples will be a vital tool for the identification of patient-specific fusions that can drive personalized therapy.

Co-fuse: a new class discovery analysis tool to identify and prioritize recurrent fusion genes from RNA-sequencing data.

PubMed

Paisitkriangkrai, Sakrapee; Quek, Kelly; Nievergall, Eva; Jabbour, Anissa; Zannettino, Andrew; Kok, Chung Hoow

2018-06-07

Recurrent oncogenic fusion genes play a critical role in the development of various cancers and diseases and provide, in some cases, excellent therapeutic targets. To date, analysis tools that can identify and compare recurrent fusion genes across multiple samples have not been available to researchers. To address this deficiency, we developed Co-occurrence Fusion (Co-fuse), a new and easy to use software tool that enables biologists to merge RNA-seq information, allowing them to identify recurrent fusion genes, without the need for exhaustive data processing. Notably, Co-fuse is based on pattern mining and statistical analysis which enables the identification of hidden patterns of recurrent fusion genes. In this report, we show that Co-fuse can be used to identify 2 distinct groups within a set of 49 leukemic cell lines based on their recurrent fusion genes: a multiple myeloma (MM) samples-enriched cluster and an acute myeloid leukemia (AML) samples-enriched cluster. Our experimental results further demonstrate that Co-fuse can identify known driver fusion genes (e.g., IGH-MYC, IGH-WHSC1) in MM, when compared to AML samples, indicating the potential of Co-fuse to aid the discovery of yet unknown driver fusion genes through cohort comparisons. Additionally, using a 272 primary glioma sample RNA-seq dataset, Co-fuse was able to validate recurrent fusion genes, further demonstrating the power of this analysis tool to identify recurrent fusion genes. Taken together, Co-fuse is a powerful new analysis tool that can be readily applied to large RNA-seq datasets, and may lead to the discovery of new disease subgroups and potentially new driver genes, for which, targeted therapies could be developed. The Co-fuse R source code is publicly available at https://github.com/sakrapee/co-fuse .

Gene transfer and gene mapping in mammalian cells in culture.

PubMed

Shows, T B; Sakaguchi, A Y

1980-01-01

The ability to transfer mammalian genes parasexually has opened new possibilities for gene mapping and fine structure mapping and offers great potential for contributing to several aspects of mammalian biology, including gene expression and genetic engineering. The DNA transferred has ranged from whole genomes to single genes and smaller segments of DNA. The transfer of whole genomes by cell fusion forms cell hybrids, which has promoted the extensive mapping of human and mouse genes. Transfer, by cell fusion, of rearranged chromosomes has contributed significantly to determining close linkage and the assignment of genes to specific chromosomal regions. Transfer of single chromosomes has been achieved utilizing microcells fused to recipient cells. Metaphase chromosomes have been isolated and used to transfer single-to-multigenic DNA segments. DNA-mediated gene transfer, simulating bacterial transformation, has achieved transfer of single-copy genes. By utilizing DNA cleaved with restriction endonucleases, gene transfer is being empolyed as a bioassay for the purification of genes. Gene mapping and the fate of transferred genes can be examined now at the molecular level using sequence-specific probles. Recently, single genes have been cloned into eucaryotic and procaryotic vectors for transfer into mammalian cells. Moreover, recombinant libraries in which entire mammalian genomes are represented collectively are a rich new source of transferable genes. Methodology for transferring mammalian genetic information and applications for mapping mammalian genes is presented and prospects for the future discussed.

Engineering and Functional Characterization of Fusion Genes Identifies Novel Oncogenic Drivers of Cancer. | Office of Cancer Genomics

Cancer.gov

Oncogenic gene fusions drive many human cancers, but tools to more quickly unravel their functional contributions are needed. Here we describe methodology permitting fusion gene construction for functional evaluation. Using this strategy, we engineered the known fusion oncogenes, BCR-ABL1, EML4-ALK, and ETV6-NTRK3, as well as 20 previously uncharacterized fusion genes identified in TCGA datasets.

Expression of the Acyl-Coenzyme A: Cholesterol Acyltransferase GFP Fusion Protein in Sf21 Insect Cells

NASA Technical Reports Server (NTRS)

Mahtani, H. K.; Richmond, R. C.; Chang, T. Y.; Chang, C. C. Y.; Rose, M. Franklin (Technical Monitor)

2001-01-01

The enzyme acyl-coenzyme A:cholesterol acyltransferase (ACAT) is an important contributor to the pathological expression of plaque leading to artherosclerosis n a major health problem. Adequate knowledge of the structure of this protein will enable pharmaceutical companies to design drugs specific to the enzyme. ACAT is a membrane protein located in the endoplasmic reticulum.t The protein has never been purified to homogeneity.T.Y. Chang's laboratory at Dartmouth College provided a 4-kb cDNA clone (K1) coding for a structural gene of the protein. We have modified the gene sequence and inserted the cDNA into the BioGreen His Baculovirus transfer vector. This was successfully expressed in Sf2l insect cells as a GFP-labeled ACAT protein. The advantage to this ACAT-GFP fusion protein (abbreviated GCAT) is that one can easily monitor its expression as a function of GFP excitation at 395 nm and emission at 509 nm. Moreover, the fusion protein GCAT can be detected on Western blots with the use of commercially available GFP antibodies. Antibodies against ACAT are not readily available. The presence of the 6xHis tag in the transfer vector facilitates purification of the recombinant protein since 6xHis fusion proteins bind with high affinity to Ni-NTA agarose. Obtaining highly pure protein in large quantities is essential for subsequent crystallization. The purified GCAT fusion protein can readily be cleaved into distinct GFP and ACAT proteins in the presence of thrombin. Thrombin digests the 6xHis tag linking the two protein sequences. Preliminary experiments have indicated that both GCAT and ACAT are expressed as functional proteins. The ultimate aim is to obtain large quantities of the ACAT protein in pure and functional form appropriate for protein crystal growth. Determining protein structure is the key to the design and development of effective drugs. X-ray analysis requires large homogeneous crystals that are difficult to obtain in the gravity environment of earth. Protein crystals grown in microgravity are often larger and have fewer defects than those grown on earth. The analysis of higher quality space-grown crystals will assist in structure-based drug design. We have successfully grown GCAT-infected Sf21 cells in both adhesion and suspension cultures. Expression levels of GCAT in cell lines such as Sf9 and High Five appear to be reduced. We intend to replicate GCAT expression in all three cell lines using the NASA rotating wall bioreactor which effectively duplicates a microgravity environment. The bioreactor itself could be launched to study the expression of the GFP and GCAT proteins in the actual microgravity environment achieved in orbit.

Differential Expression of Virulence Genes and Motility in Ralstonia (Pseudomonas) solanacearum during Exponential Growth.

PubMed

Clough, S J; Flavier, A B; Schell, M A; Denny, T P

1997-03-01

A complex network regulates virulence in Ralstonia solanacearum (formerly Pseudomonas solanacearum); central to this system is PhcA, a LysR-type transcriptional regulator. We report here that two PhcA-regulated virulence factors, endoglucanase (Egl) and acidic exopolysaccharide I (EPS I), and motility are expressed differentially during exponential growth in batch cultures. Tests with strains carrying lacZ fusions in a wild-type genetic background revealed that expression (on a per-cell basis) of phcA was constant but expression of egl and epsB increased 20- to 50-fold during multiplication from 1 x 10(sup7) to 5 x 10(sup8) CFU/ml. Expression of xpsR, an intermediate regulator downstream of PhcA in the regulatory cascade for eps expression, was similar to that of epsB and egl. Motility track photography revealed that all strains were essentially nonmotile at 10(sup6) CFU/ml. As cell density increased, 30 to 50% of wild-type cells were motile between 10(sup7) and 10(sup8) CFU/ml, but this population was again nonmotile at 10(sup9) CFU/ml. In contrast, about 60% of the cells of phcB and phcA mutants remained motile at 10(sup9) CFU/ml. Expression of phcB, which is not positively regulated by PhcA, was the inverse of epsB, egl, and xpsR (i.e., it decreased 20-fold at high cell density). PhcB is essential for production of an extracellular factor, tentatively identified as 3-hydroxypalmitic acid methyl ester (3-OH PAME), that might act as an exponential-phase signal to activate motility or expression of virulence genes. However, growth of the lacZ fusion strains in medium containing excess 3-OH PAME did not result in motility or expression of virulence genes at dramatically lower cell densities, suggesting that 3-OH PAME is not the only factor controlling these traits.

Diffuse myogenin expression by immunohistochemistry is an independent marker of poor survival in pediatric rhabdomyosarcoma: a tissue microarray study of 71 primary tumors including correlation with molecular phenotype.

PubMed

Heerema-McKenney, Amy; Wijnaendts, Liliane C D; Pulliam, Joseph F; Lopez-Terrada, Dolores; McKenney, Jesse K; Zhu, Shirley; Montgomery, Kelli; Mitchell, Janet; Marinelli, Robert J; Hart, Augustinus A M; van de Rijn, Matt; Linn, Sabine C

2008-10-01

The pathologic classification of rhabdomyosarcoma (RMS) into embryonal or alveolar subtype is an important prognostic factor guiding the therapeutic protocol chosen for an individual patient. Unfortunately, this classification is not always straightforward, and the diagnostic criteria are controversial in a subset of cases. Ancillary studies are used to aid in the classification, but their potential use as independent prognostic factors is rarely studied. The aim of this study is to identify immunohistochemical markers of potential prognostic significance in pediatric RMS and to correlate their expression with PAX-3/FKHR and PAX-7/FKHR fusion status. A single tissue microarray containing 71 paraffin-embedded pediatric RMSs was immunostained with antibodies against p53, bcl-2, Ki-67, CD44, myogenin, and MyoD1. The tissue microarray and whole paraffin blocks were studied for PAX-3/FKHR and PAX-7/FKHR gene fusions by fluorescence in situ hybridization and reverse transcription-polymerase chain reaction. Clinical follow-up data were available for each patient. Immunohistochemical staining results and translocation status were correlated with recurrence-free interval (RFI) and overall survival (OS) using the Kaplan-Meier method, the log-rank test, and Cox proportional hazard regression. The minimum clinical follow-up interval was 24 months (median follow-up=57 mo). On univariable analysis, immunohistochemical expression of myogenin, bcl-2, and identification of a gene fusion were associated with decreased 5-year RFI and 10-year OS (myogenin RFI P=0.0028, OS P=0.0021; bcl-2 RFI P=0.037, OS P=0.032; gene fusion RFI P=0.0001, OS P=0.0058). After adjustment for Intergroup Rhabdomyosarcoma Study-TNM stage, tumor site, age, tumor histology, and translocation status by multivariable analysis, only myogenin retained an independent association with RFI (P=0.034) and OS (P=0.0069). In this retrospective analysis, diffuse immunohistochemical reactivity for myogenin in RMS correlates with decreased RFI and OS, independent of histologic subtype, translocation status, tumor site, or stage.

The biosynthetic gene cluster for the cyanogenic glucoside dhurrin in Sorghum bicolor contains its co-expressed vacuolar MATE transporter

PubMed Central

Darbani, Behrooz; Motawia, Mohammed Saddik; Olsen, Carl Erik; Nour-Eldin, Hussam H.; Møller, Birger Lindberg; Rook, Fred

2016-01-01

Genomic gene clusters for the biosynthesis of chemical defence compounds are increasingly identified in plant genomes. We previously reported the independent evolution of biosynthetic gene clusters for cyanogenic glucoside biosynthesis in three plant lineages. Here we report that the gene cluster for the cyanogenic glucoside dhurrin in Sorghum bicolor additionally contains a gene, SbMATE2, encoding a transporter of the multidrug and toxic compound extrusion (MATE) family, which is co-expressed with the biosynthetic genes. The predicted localisation of SbMATE2 to the vacuolar membrane was demonstrated experimentally by transient expression of a SbMATE2-YFP fusion protein and confocal microscopy. Transport studies in Xenopus laevis oocytes demonstrate that SbMATE2 is able to transport dhurrin. In addition, SbMATE2 was able to transport non-endogenous cyanogenic glucosides, but not the anthocyanin cyanidin 3-O-glucoside or the glucosinolate indol-3-yl-methyl glucosinolate. The genomic co-localisation of a transporter gene with the biosynthetic genes producing the transported compound is discussed in relation to the role self-toxicity of chemical defence compounds may play in the formation of gene clusters. PMID:27841372

TMPRSS2-ERG gene fusion in small cell carcinoma of the prostate.

PubMed

Guo, Charles C; Dancer, Jane Y; Wang, Yan; Aparicio, Ana; Navone, Nora M; Troncoso, Patricia; Czerniak, Bogdan A

2011-01-01

Recent studies have shown that most prostate cancers carry the TMPRSS2-ERG gene fusion. Here we evaluated the TMPRSS2-ERG gene fusion in small cell carcinoma of the prostate (n = 12) in comparison with small cell carcinoma of the urinary bladder (n = 12) and lung (n = 11). Fluorescence in situ hybridization demonstrated rearrangement of the ERG gene in 8 cases of prostatic small cell carcinoma (67%), and the rearrangement was associated with deletion of the 5' ERG gene in 7 cases, but rearrangement of the ERG gene was not present in any small cell carcinoma of the urinary bladder or lung. Next we evaluated the TMPRSS2-ERG gene fusion in nude mouse xenografts that were derived from 2 prostatic small cell carcinomas carrying the TMPRSS2-ERG gene fusion. Two transcripts encoded by the TMPRSS2-ERG gene fusion were detected by reverse transcriptase polymerase chain reaction, and DNA sequencing demonstrated that the 2 transcripts were composed of fusions of exon 1 of the TMPRSS2 gene to exon 4 or 5 of the ERG gene. Our study demonstrates the specific presence of TMPRSS2-ERG gene fusion in prostatic small cell carcinoma, which may be helpful in distinguishing small cell carcinoma of prostatic origin from nonprostatic origins. The high prevalence of the TMPRSS2-ERG gene fusion in prostatic small cell carcinoma as well as adenocarcinoma implies that small cell carcinoma may share a common pathogenic pathway with adenocarcinoma in the prostate. Copyright © 2011 Elsevier Inc. All rights reserved.

The Transcriptional Response to Nonself in the Fungus Podospora anserina

PubMed Central

Bidard, Frédérique; Clavé, Corinne; Saupe, Sven J.

2013-01-01

In fungi, heterokaryon incompatibility is a nonself recognition process occurring when filaments of different isolates of the same species fuse. Compatibility is controlled by so-called het loci and fusion of strains of unlike het genotype triggers a complex incompatibility reaction that leads to the death of the fusion cell. Herein, we analyze the transcriptional changes during the incompatibility reaction in Podospora anserina. The incompatibility response was found to be associated with a massive transcriptional reprogramming: 2231 genes were up-regulated by a factor 2 or more during incompatibility. In turn, 2441 genes were down-regulated. HET, NACHT, and HeLo domains previously found to be involved in the control of heterokaryon incompatibility were enriched in the up-regulated gene set. In addition, incompatibility was characterized by an up-regulation of proteolytic and other hydrolytic activities, of secondary metabolism clusters and toxins and effector-like proteins. The up-regulated set was found to be enriched for proteins lacking orthologs in other species and chromosomal distribution of the up-regulated genes was uneven with up-regulated genes residing preferentially in genomic islands and on chromosomes IV and V. There was a significant overlap between regulated genes during incompatibility in P. anserina and Neurospora crassa, indicating similarities in the incompatibility responses in these two species. Globally, this study illustrates that the expression changes occurring during cell fusion incompatibility in P. anserina are in several aspects reminiscent of those described in host-pathogen or symbiotic interactions in other fungal species. PMID:23589521

RSPO3 expands intestinal stem cell and niche compartments and drives tumorigenesis

PubMed Central

Hilkens, John; Timmer, Nikki C; Boer, Mandy; Ikink, Gerjon J; Schewe, Matthias; Sacchetti, Andrea; Koppens, Martijn A J; Song, Ji-Ying; Bakker, Elvira R M

2017-01-01

Objective The gross majority of colorectal cancer cases results from aberrant Wnt/β-catenin signalling through adenomatous polyposis coli (APC) or CTNNB1 mutations. However, a subset of human colon tumours harbour, mutually exclusive with APC and CTNNB1 mutations, gene fusions in RSPO2 or RSPO3, leading to enhanced expression of these R-spondin genes. This suggested that RSPO activation can substitute for the most common mutations as an alternative driver for intestinal cancer. Involvement of RSPO3 in tumour growth was recently shown in RSPO3-fusion-positive xenograft models. The current study determines the extent into which solely a gain in RSPO3 actually functions as a driver of intestinal cancer in a direct, causal fashion, and addresses the in vivo activities of RSPO3 in parallel. Design We generated a conditional Rspo3 transgenic mouse model in which the Rspo3 transgene is expressed upon Cre activity. Cre is provided by cross-breeding with Lgr5-GFP-CreERT2 mice. Results Upon in vivo Rspo3 expression, mice rapidly developed extensive hyperplastic, adenomatous and adenocarcinomatous lesions throughout the intestine. RSPO3 induced the expansion of Lgr5+ stem cells, Paneth cells, non-Paneth cell label-retaining cells and Lgr4+ cells, thus promoting both intestinal stem cell and niche compartments. Wnt/β-catenin signalling was modestly increased upon Rspo3 expression and mutant Kras synergised with Rspo3 in hyperplastic growth. Conclusions We provide in vivo evidence that RSPO3 stimulates the crypt stem cell and niche compartments and drives rapid intestinal tumorigenesis. This establishes RSPO3 as a potent driver of intestinal cancer and proposes RSPO3 as a candidate target for therapy in patients with colorectal cancer harbouring RSPO3 fusions. PMID:27511199

Characterization of a RacGTPase up-regulated in the large yellow croaker Pseudosciaena crocea immunity.

PubMed

Han, Fang; Wang, Xiaoqing; Yang, Qilian; Cai, Mingyi; Wang, Zhi Yong

2011-02-01

The Rac proteins are members of the Rho family of small G proteins and are implicated in the regulation of several pathways, including those leading to cytoskeleton reorganization, gene expression, cell proliferation, cell adhesion and cell migration and survival. In this investigation, a Rac gene (named as LycRac gene) was obtained from the large yellow croaker and it was expressed in Escherichia coli and purified. Subsequently the specific antibody was raised using the purified fusion protein (GST-LycRac). Moreover, the GTP-binding assay showed that the LycRac protein had GTP-binding activity. The LycRac gene was ubiquitously transcribed and expressed in 9 tissues. Quantitative real-time RT-PCR and Western blot analysis revealed the highest expression in gill and the weakest expression in spleen. Time-course analysis revealed that LycRac expression was obviously up-regulated in blood, spleen and liver after immunization with polyinosinic polycytidynic acid (poly I:C), formalin-inactive Gram-negative bacterium Vibrio parahemolyticus and bacterial lipopolysaccharides (LPS). These results suggested that LycRac protein might play an important role in the immune response against microorganisms in large yellow croaker. Crown Copyright © 2010. Published by Elsevier Ltd. All rights reserved.

The Use of a Dexamethasone-inducible System to Synchronize Xa21 Expression to Study Rice Immunity.

PubMed

Caddell, Daniel F; Wei, Tong; Park, Chang-Jin; Ronald, Pamela C

2015-05-05

Inducible gene expression systems offer researchers the opportunity to synchronize target gene expression at particular developmental stages and in particular tissues. The glucocorticoid receptor (GR), a vertebrate steroid receptor, has been well adopted for this purpose in plants. To generate steroid-inducible plants, a construct of GAL4-binding domain-VP16 activation domain-GR fusion (GVG) with the target gene under the control of upstream activation sequence (UAS) has been developed and extensively used in plant research. Immune receptors perceive conserved molecular patterns secreted by pathogens and initiate robust immune responses. The rice immune receptor, XA21 , recognizes a molecular pattern highly conserved in all sequenced genomes of Xanthomonas , and confers robust resistance to X. oryzae pv. oryzae ( Xoo ). However, identifying genes downstream of XA21 has been hindered because of the restrained lesion and thus limited defense response region in the plants expressing Xa21 . Inducible expression allows for a synchronized immune response across a large amount of rice tissue, well suited for studying XA21-mediated immunity by genome-wide approaches such as transcriptomics and proteomics. In this protocol, we describe the use of this GVG system to synchronize Xa21 expression.

The Use of a Dexamethasone-inducible System to Synchronize Xa21 Expression to Study Rice Immunity

PubMed Central

Caddell, Daniel F.; Wei, Tong; Park, Chang-Jin; Ronald, Pamela C.

2016-01-01

Inducible gene expression systems offer researchers the opportunity to synchronize target gene expression at particular developmental stages and in particular tissues. The glucocorticoid receptor (GR), a vertebrate steroid receptor, has been well adopted for this purpose in plants. To generate steroid-inducible plants, a construct of GAL4-binding domain-VP16 activation domain-GR fusion (GVG) with the target gene under the control of upstream activation sequence (UAS) has been developed and extensively used in plant research. Immune receptors perceive conserved molecular patterns secreted by pathogens and initiate robust immune responses. The rice immune receptor, XA21, recognizes a molecular pattern highly conserved in all sequenced genomes of Xanthomonas, and confers robust resistance to X. oryzae pv. oryzae (Xoo). However, identifying genes downstream of XA21 has been hindered because of the restrained lesion and thus limited defense response region in the plants expressing Xa21. Inducible expression allows for a synchronized immune response across a large amount of rice tissue, well suited for studying XA21-mediated immunity by genome-wide approaches such as transcriptomics and proteomics. In this protocol, we describe the use of this GVG system to synchronize Xa21 expression. PMID:27525297

A novel hNIS/tdTomato fusion reporter for visualizing the relationship between the cellular localization of sodium iodide symporter and its iodine uptake function under heat shock treatment.

PubMed

Yeom, Chan Joo; Chung, Taemoon; Youn, Hyewon; Kang, Keon Wook; Lee, Dong Soo; Chung, June-Key

2015-01-01

The function of membrane-localized sodium iodide symporter (NIS) determines the efficacy of radioiodine therapy in thyroid cancer. Here, we describe a dual mode reporter fused with human NIS (hNIS) and a red fluorescent protein named tandem dimeric Tomato (tdTomato) for the in vitro and in vivo imaging of hNIS protein expression, localization, and iodide uptake function. Human cervical epithelial adenocarcinoma cell line (HeLa)-hNIS/tdTomato cells were established by transducing a fusion gene expressing hNIS/tdTomato under the control of a cytomegalovirus promoter. Fluorescence imaging, confocal microscopy, and an 125I uptake assay were performed to validate the integrity of the fusion protein. Actinomycin D and cycloheximide were used to block newly synthesized hNIS proteins. In vivo images were acquired using a gamma camera and a Maestro fluorescence imaging device. The fluorescence intensity of membrane-localized hNIS and 125I uptake both were increased after heat shock. Scintigraphy and fluorescence imaging indicated specific accumulation of the hNIS/tdTomato fusion protein in xenografted tumors, supporting the utility of this system for in vivo monitoring of hNIS expression and activity. We developed a novel hNIS/tdTomato dual mode reporter that enables visualization of the expression, localization, and iodine uptake function of hNIS in vitro and in vivo.

[Construction of cTnC-linker-TnI (P) Genes, Expression of Fusion Protein and Preparation of Lyophilized Protein].

PubMed

Song, Xiaoli; Liu, Xiaoyun; Cai, Lei; Wu, Jianwei; Wang, Jihua

2015-12-01

In order to construct and express human cardiac troponin C-linker-troponin I(P) [ cTnC-linker-TnI(P)] fusion protein, detect its activity and prepare lyophilized protein, we searched the CDs of human cTnC and cTnI from GenBank, synthesized cTnC and cTnI(30-110aa) into cloning vector by a short DNA sequence coding for 15 neutral amino acid residues. pCold I-cTnC-linker-TnI(P) was constructed and transformed into E. coli BL21(DE3). Then, cTnC-linker-TnI(P) fusion protein was induced by isopropyl-β-D-thiogalactopyranoside (IPTG). Soluable expression of cTnC-linker-TnI(P) in prokaryotic system was successfully obtained. The fusion protein was purified by Ni²⁺ Sepharose 6 Fast Flow affinity chromatography with over 95% purity and prepared into lyophilized protein. The activity of purified cTnC-linker-TnI(P) and its lyophilized protein were detected by Wondfo Finecare™ cTnI Test. Lyophilized protein of cTnC-linker-TnI(P) was stable for 10 or more days at 37 °C and 4 or more months at 25 °C and 4 °C. The expression system established in this research is feasible and efficient. Lyophilized protein is stable enough to be provided as biological raw materials for further research.

[Gene Expression and Clinical Characteristics of Molecular Targeted Therapy 
in Non-small Cell Lung Cancer Patients in Shandong].

PubMed

Qiao, Xiuli; Ai, Dan; Liang, Honglu; Mu, Dianbin; Guo, Qisen

2017-01-20

Molecular targeted therapy has gradually become an important treatment for lung cancer, the aim of this research is to analyze the clinicopathologic features associated with the gene mutation status of epidermal growth factor receptor (EGFR), echinoderm microtubule-associated protein-like 4-anaplastic lymphoma kinase (EML4-ALK), ROS proto-oncogene 1, receptor tyrosine kinase (ROS1) and Kirsten rat sarcoma viral oncogene (KRAS) in non-small cell lung cancer (NSCLC) patients and determine the most likely populations to benefit from molecular target therapy treatment. The mutation status of EGFR, EML4-ALK fusion gene, ROS1 and KARS gene were determined by Real-time PCR, the relationship between clinical pathologic features and concomitant gene were analyzed with χ2 test by SPSS software 19.0. A total of 514 specimens from Shandong tumor hospital were collected from NSCLC patients between January 2014 and May 2016. The total mutation rate of EGFR gene was 36.70%, major occurred in exon 19 (36.61%) and exon 21 (51.36%), respectively, and EGFR mutations usually occurred in female, non-smoking and adenocarcinoma patients (P<0.05). The total rearrangements rate of EML4-ALK fusion gene was 9.37%, EML4-ALK fusion gene usually occurred in younger age (≤60 yr) and non-smoking patients (P<0.05). Mutations were not related to gender and pathological type (P>0.05). ROS1 fusion gene was detected in 136 cases, the positive rate was 3.67%, all patients were 60 years old, and the difference was statistically significant (P<0.05). Only 23 samples were tested KARS gene mutations, two of them were positive and the positive rate was 8.70%. They all occurred in non-smoker and adenocarcinoma patients. No mutation was detected to coexist in EGFR, EML4-ALK and KARS gene mutation. EGFR, EML4-ALK, ROS1 and KRAS defines different molecular subset of NSCLC with distinct characteristic, which provides a new option for the clinical treatment of patients with NSCLC.

[Construction and transfection of eucaryotic expression recombinant vector containing truncated region of UL83 gene of human cytomegalovirus and it's sheltered effect as DNA vaccine].

PubMed

Gao, Rong-Bao; Li, Yan-Qiu; Wang, Ming-Li

2006-06-01

To construct eucaryotic expression recombinant vector containing vivo truncated region of UL83 gene of human cytomegalovirus, realize its steady expression in Hep-2 cell, and study sheltered effect of the eucaryotic expression recombinant vector as DNA vaccine. A vivo truncated UL83 gene fragment encoding for truncated HCMV pp65 was obtained by PCR from human cytomegalovirus AD169 stock genome. By gene recombinant ways, the truncated UL83 gene fragment was cloned into eucaryotic expression vector pEGFP-C1 with reported gene coding GFP to construct recombinant vector pEGFP-C1-UL83. The recombinant vector pEGFP-C1-UL83 was tested by different methods including PCR, restriction digestion and gene sequencing. Test results showed the recombinant vector was constructed successfully. After pEGFP-C1-UL83 was transfected into Hep-2 cell by lipofectin mediation, expression of GFP and truncated pp65 fusion protein in Hep-2 cell was observed at different time points by fluorescence microscope. Results showed that quantity of fusion protein expression was the highest at 36h point. Then, Hep-2 cell was cultured selectively by RPMI-1640 containing G418 (200 microg/mL) to obtain a new cell stock of expressing truncated UL83 Gene fragment steadily. RT-PCR and Western blot results showed the truncated fragment of UL83 gene could be expressed steadily in Hep-2 cell. The result showed a new cell stock of expressing Tpp65 was established. This cell stock could be useful in some HCMV research fields, for example, it could be a tool in study of pp65 and HCMV infection, and it could provide a platform for the research into the therapy of HCMV infection. Immune sheltered effect of pEGFP-C1-UL83 as DNA vaccine was studied in vivo of HCMV congenital infection mouse model. The mouse model was immunized solely by pEGFP-C1-UL83, and was immunized jointly by pEGFP-C1-UL83 and its expression product. When the mouse was pregnant and brought to bed, differential antibody of anti-HCMV pp65 was tested by indirect ELISA in mother mouse, the infectious virus was separated with the method of virus separation, and pp65 antigen was checked up by indirect immunofluorescence staining in fetal mouse. Results showed differential antibody of anti-HCMV pp65 was produced in mouse model. Tilter of the antibody was from 1:2.51 to 1:50.79. Results of virus separation and pp65 checkup of fetal mouse brain tissue were negative. So the conclusion can be reached that pEGFP-C1-UL83 as DNA vaccine in vivo has sheltered effect which can prevent HCMV vertical transmission from mother mouse to her fetus.

Identification of the crucial genes in the elimination and survival process of Salmonella enterica ser. Pullorum in the chicken spleen.

PubMed

Ma, T; Xu, L; Wang, H; Guo, X; Li, Z; Wan, F; Chen, J; Liu, L; Liu, X; Chang, G; Chen, G

2017-06-01

Salmonella enterica ser. Pullorum is one of the most easily re-infecting pathogens in poultry production because of its mechanism of escaping from immune elimination. We used the transcriptome method to investigate the variation in gene expression in chicken spleen resulting from the interaction between hosts and S. Pullorum in the survival process. The expression of various genes related to the maturation and activation of B cells was activated before S. Pullorum was eliminated, which might help S. Pullorum escape from the elimination process. The suppression of some genes involved in the fusion of autophagosomes and lysosomes, such as MYO6, was identified and may be regulated by the secretion systems of S. Pullorum. In addition, a large proportion of these differentially expressed genes could be localized in the identified quantitative trait loci regions associated with the antibody response to bacteria. Collectively, these identified genes provided an outline for further understanding the interaction between chicken immune cells and S. Pullorum in chicken spleen. © 2017 Stichting International Foundation for Animal Genetics.

Protein preparation and preliminary X-ray crystallographic analysis of a putative glucosamine 6-phosphate deaminase from Streptococcus mutants

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hu, Guan-Jing; Li, Lan-Fen; Li, Dan

2007-09-01

A glucosamine 6-phosphate deaminase homologue from S. mutans was expressed, purified and crystallized. Diffraction data have been collected to 2.4 Å resolution. The SMU.636 protein from Streptococcus mutans is a putative glucosamine 6-phosphate deaminase with 233 residues. The smu.636 gene was PCR-amplified from S. mutans genomic DNA and cloned into the expression vector pET-28a(+). The resultant His-tagged fusion protein was expressed in Escherichia coli and purified to homogeneity in two steps. Crystals of the fusion protein were obtained by the hanging-drop vapour-diffusion method. The crystals diffracted to 2.4 Å resolution and belong to space group P2{sub 1}2{sub 1}2{sub 1}, withmore » unit-cell parameters a = 53.83, b = 82.13, c = 134.70 Å.« less

Analysis of clinicopathological features of the echinoderm microtubule-associated protein-like-4-anaplastic lymphoma kinase fusion gene in Chinese patients with advanced non-small-cell lung cancer

PubMed Central

Liu, Yu-Tao; Shi, Yuan-Kai; Hao, Xue-Zhi; Wang, Lin; Li, Jun-Ling; Han, Xiao-Hong; Li, Dan; Zhou, Yu-Jie; Tang, Le

2014-01-01

Background The echinoderm microtubule-associated protein-like-4-anaplastic lymphoma kinase (EML4-ALK) fusion gene defines a novel molecular subset of non-small-cell lung cancer (NSCLC). However, the clinicopathological features of patients with the EML4-ALK fusion gene have not been defined completely. Methods Clinicopathological data of 200 Chinese patients with advanced NSCLC were analyzed retrospectively to explore their possible correlations with EML4-ALK fusions. Results The EML4-ALK fusion gene was detected in 56 (28.0%) of the 200 NSCLC patients, and undetected in 22 (11.0%) patients because of an insufficient amount of pathological tissue. The median age of the patients with positive and negative EML4-ALK was 48 and 55 years, respectively. Patients with the EML4-ALK fusion gene were significantly younger (P< 0.001). The detection rate of the EML4-ALK fusion gene in patients who received primary tumor or metastatic lymph node resection was significantly higher than in patients who received fine-needle biopsy (P= 0.003). The detection rate of the EML4-ALK fusion gene in patients with a time lag from obtainment of the pathological tissue to EML4-ALK fusion gene detection ≤48 months was significantly higher than in patients >48 months (P= 0.020). The occurrence of the EML4-ALK fusion gene in patients with wild-type epidermal growth factor receptor (EGFR) was significantly higher than in patients with mutant-type EGFR (42.5% [37/87] vs. 6.3% [1/16], P= 0.005). Conclusions Younger age and wild-type EGFR were identified as clinicopathological characteristics of patients with advanced NSCLC who harbored the EML4-ALK fusion gene. The optimal time lag from the obtainment of the pathological tissue to the time of EML4-ALK fusion gene detection is ≤48 months. PMID:26767009

[Expression of Dengue virus type 2 nonstructural protein 3 and isolation of host proteins interacting with it].

PubMed

Weng, Daihui; Lei, Yingfeng; Dong, Yangchao; Han, Peijun; Ye, Chuantao; Yang, Jing; Wang, Yuan; Yin, Wen

2015-12-01

To construct the plasmid expressing the fusion protein of Dengue virus type 2 (DENV2) nonstructural protein 3 (NS3) with affinity tag, and isolate the cellular proteins interacting with NS3 protein using tandem affinity purification (TAP) assay. Primers for amplifying NS3 gene were designed according to the sequence of DENV2 genome and chemically synthesized. The NS3 fragments, after amplified by PCR with DENV2 cDNA as template, were digested and cloned into the mammalian eukaryotic expression vector pCI-SF with the tandem affinity tag (FLAG-StrepII). The recombinant pCI-NS3-SF was transiently transformed by Lipofectamine(TM) 2000 into HEK293T cells, and the expression of the fusion protein was confirmed by Western blotting. Cellular proteins that interacted with NS3 were isolated and purified by TAP assay. The eukaryotic expression vector expressing NS3 protein was successfully constructed. The host proteins interacting with NS3 protein were isolated by TAP system. TAP is an efficient method to isolate the cellular proteins interacting with DENV2 NS3.

Characterization of protein-protein interaction domains within the baculovirus Autographa californica multiple nucleopolyhedrovirus late expression factor LEF-3.

PubMed

Downie, Kelsey; Adetola, Gbolagade; Carstens, Eric B

2013-11-01

Autographa californica nucleopolyhedrovirus late expression factor 3 (LEF-3) is required for late viral gene expression probably through its numerous functions related to DNA replication, including nuclear localization of the virus helicase P143 and binding to ssDNA. LEF-3 appears to interact with itself as a homo-oligomer, although the details of this oligomeric structure are not yet known. To examine LEF-3-LEF-3 interactions, a bimolecular fluorescent protein complementation assay was used. Pairs of recombinant plasmids expressing full-length LEF-3 fused to one of two complementary fragments (V1 or V2) of a variant of yellow fluorescent protein named 'Venus' were constructed. Plasmids expressing fusions with complementary fragments of Venus were co-transfected into Sf21 cells and analysed by fluorescence microscopy. Co-transfected plasmids expressing full-length V1-LEF-3 and V2-LEF-3 showed positive fluorescence, confirming the formation of homo-oligomers. A series of truncated V1/V2-LEF-3 fusions was constructed and used to investigate interactions with one another as well as with full-length LEF-3.

Transient Co-Expression of Post-Transcriptional Gene Silencing Suppressors for Increased in Planta Expression of a Recombinant Anthrax Receptor Fusion Protein

PubMed Central

Arzola, Lucas; Chen, Junxing; Rattanaporn, Kittipong; Maclean, James M.; McDonald, Karen A.

2011-01-01

Potential epidemics of infectious diseases and the constant threat of bioterrorism demand rapid, scalable, and cost-efficient manufacturing of therapeutic proteins. Molecular farming of tobacco plants provides an alternative for the recombinant production of therapeutics. We have developed a transient production platform that uses Agrobacterium infiltration of Nicotiana benthamiana plants to express a novel anthrax receptor decoy protein (immunoadhesin), CMG2-Fc. This chimeric fusion protein, designed to protect against the deadly anthrax toxins, is composed of the von Willebrand factor A (VWA) domain of human capillary morphogenesis 2 (CMG2), an effective anthrax toxin receptor, and the Fc region of human immunoglobulin G (IgG). We evaluated, in N. benthamiana intact plants and detached leaves, the expression of CMG2-Fc under the control of the constitutive CaMV 35S promoter, and the co-expression of CMG2-Fc with nine different viral suppressors of post-transcriptional gene silencing (PTGS): p1, p10, p19, p21, p24, p25, p38, 2b, and HCPro. Overall, transient CMG2-Fc expression was higher on intact plants than detached leaves. Maximum expression was observed with p1 co-expression at 3.5 days post-infiltration (DPI), with a level of 0.56 g CMG2-Fc per kg of leaf fresh weight and 1.5% of the total soluble protein, a ten-fold increase in expression when compared to absence of suppression. Co-expression with the p25 PTGS suppressor also significantly increased the CMG2-Fc expression level after just 3.5 DPI. PMID:21954339

Induction of PD-L1 Expression by the EML4-ALK Oncoprotein and Downstream Signaling Pathways in Non-Small Cell Lung Cancer.

PubMed

Ota, Keiichi; Azuma, Koichi; Kawahara, Akihiko; Hattori, Satoshi; Iwama, Eiji; Tanizaki, Junko; Harada, Taishi; Matsumoto, Koichiro; Takayama, Koichi; Takamori, Shinzo; Kage, Masayoshi; Hoshino, Tomoaki; Nakanishi, Yoichi; Okamoto, Isamu

2015-09-01

Therapies targeted to the immune checkpoint mediated by PD-1 and PD-L1 show antitumor activity in a subset of patients with non-small cell lung cancer (NSCLC). We have now examined PD-L1 expression and its regulation in NSCLC positive for the EML4-ALK fusion gene. The expression of PD-L1 at the protein and mRNA levels in NSCLC cell lines was examined by flow cytometry and by reverse transcription and real-time PCR analysis, respectively. The expression of PD-L1 in 134 surgically resected NSCLC specimens was evaluated by immunohistochemical analysis. The PD-L1 expression level was higher in NSCLC cell lines positive for EML4-ALK than in those negative for the fusion gene. Forced expression of EML4-ALK in Ba/F3 cells markedly increased PD-L1 expression, whereas endogenous PD-L1 expression in EML4-ALK-positive NSCLC cells was attenuated by treatment with the specific ALK inhibitor alectinib or by RNAi with ALK siRNAs. Furthermore, expression of PD-L1 was downregulated by inhibitors of the MEK-ERK and PI3K-AKT signaling pathways in NSCLC cells positive for either EML4-ALK or activating mutations of the EGFR. Finally, the expression level of PD-L1 was positively associated with the presence of EML4-ALK in NSCLC specimens. Our findings that both EML4-ALK and mutant EGFR upregulate PD-L1 by activating PI3K-AKT and MEK-ERK signaling pathways in NSCLC reveal a direct link between oncogenic drivers and PD-L1 expression. ©2015 American Association for Cancer Research.

Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

PubMed

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-12-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

ChimerDB 3.0: an enhanced database for fusion genes from cancer transcriptome and literature data mining.

PubMed

Lee, Myunggyo; Lee, Kyubum; Yu, Namhee; Jang, Insu; Choi, Ikjung; Kim, Pora; Jang, Ye Eun; Kim, Byounggun; Kim, Sunkyu; Lee, Byungwook; Kang, Jaewoo; Lee, Sanghyuk

2017-01-04

Fusion gene is an important class of therapeutic targets and prognostic markers in cancer. ChimerDB is a comprehensive database of fusion genes encompassing analysis of deep sequencing data and manual curations. In this update, the database coverage was enhanced considerably by adding two new modules of The Cancer Genome Atlas (TCGA) RNA-Seq analysis and PubMed abstract mining. ChimerDB 3.0 is composed of three modules of ChimerKB, ChimerPub and ChimerSeq. ChimerKB represents a knowledgebase including 1066 fusion genes with manual curation that were compiled from public resources of fusion genes with experimental evidences. ChimerPub includes 2767 fusion genes obtained from text mining of PubMed abstracts. ChimerSeq module is designed to archive the fusion candidates from deep sequencing data. Importantly, we have analyzed RNA-Seq data of the TCGA project covering 4569 patients in 23 cancer types using two reliable programs of FusionScan and TopHat-Fusion. The new user interface supports diverse search options and graphic representation of fusion gene structure. ChimerDB 3.0 is available at http://ercsb.ewha.ac.kr/fusiongene/. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Combination of a fusogenic glycoprotein, prodrug activation, and oncolytic herpes simplex virus for enhanced local tumor control.

PubMed

Simpson, Guy R; Han, Ziqun; Liu, Binlei; Wang, Yibing; Campbell, Gregor; Coffin, Robert S

2006-05-01

We have previously developed an oncolytic herpes simplex virus-1 based on a clinical virus isolate, which was deleted for ICP34.5 to provide tumor selected replication and ICP47 to increase antigen presentation as well as tumor selective virus replication. A phase I/II clinical trial using a version of this virus expressing granulocyte macrophage colony-stimulating factor has shown promising results. The work reported here aimed to develop a version of this virus in which local tumor control was further increased through the combined expression of a highly potent prodrug activating gene [yeast cytosine deaminase/uracil phospho-ribosyltransferase fusion (Fcy::Fur)] and the fusogenic glycoprotein from gibbon ape leukemia virus (GALV), which it was hoped would aid the spread of the activated prodrug through the tumor. Viruses expressing the two genes individually or in combination were constructed and tested, showing (a) GALV and/or Fcy::Fur expression did not affect virus growth; (b) GALV expression causes cell fusion and increases the tumor cell killing at least 30-fold in vitro and tumor shrinkage 5- to 10-fold in vivo; (c) additional expression of Fcy::Fur combined with 5-fluorocytosine administration improves tumor shrinkage further. These results indicate, therefore, that the combined expression of the GALV protein and Fcy::Fur provides a highly potent oncolytic virus with improved capabilities for local tumor control. It is intended to enter the GALV/Fcy::Fur expressing virus into clinical development for the treatment of tumor types, such as pancreatic or lung cancer, where local control would be anticipated to be clinically advantageous.

Epigenetics changes caused by the fusion of human embryonic stem cell and ovarian cancer cells.

PubMed

He, Ke; Qu, Hu; Xu, Li-Nan; Gao, Jun; Cheng, Fu-Yi; Xiang, Peng; Zhou, Can-Quan

2016-10-01

To observe the effect of gene expression and tumorigenicity in hybrid cells of human embryonic stem cells (hESCs) and ovarian cancer cells in vitro and in vivo using a mouse model, and to determine its feasibility in reprogramming tumour cells growth and apoptosis, for a potential exploration of the role of hESCs and tumour cells fusion in the management of ovarian cancer. Stable transgenic hESCs (H1) and ovarian cancer cell line OVCAR-3 were established before fusion, and cell fusion system was established to analyse the related indicators. PTEN expression in HO-H1 cells was higher than those in the parental stem cells and lower than those in parental tumour cells; the growth of OV-H1 (RFP+GFP) hybrid cells with double fluorescence expressions were obviously slower than that of human embryonic stem cells and OVCAR-3 ovarian cancer cells. The apoptosis signal of the OV-H1 hybrid cells was significantly higher than that of the hESCs and OVCAR-3 ovarian cancer cells. In vivo results showed that compared with 7 days, 28 days and 35 days after inoculation of OV-H1 hybrid cells; also, apoptotic cell detection indicated that much stronger apoptotic signal was found in OV-H1 hybrid cells inoculated mouse. The hESCs can inhibit the growth of OVCAR-3 cells in vitro by suppressing p53 and PTEN expression to suppress the growth of tumour that may be achieved by inducing apoptosis of OVCAR-3 cells. The change of epigenetics after fusion of ovarian cancer cells and hESCs may become a novel direction for treatment of ovarian cancer. © 2016 The Author(s).

The clinical relevance and prognostic significance of adenosine triphosphate ATP-binding cassette (ABCB5) and multidrug resistance (MDR1) genes expression in acute leukemia: an Egyptian study.

PubMed

Farawela, Hala M; Khorshied, Mervat M; Kassem, Neemat M; Kassem, Heba A; Zawam, Hamdy M

2014-08-01

Multidrug resistance (MDR1) represents a major obstacle in the chemotherapeutic treatment of acute leukemia (AL). Adenosine triphosphate ATP-binding cassette (ABCB5) and MDR1 genes are integral membrane proteins belonging to ATP-binding cassette transporters superfamily. The present work aimed to investigate the impact of ABCB5 and MDR1 genes expression on the response to chemotherapy in a cohort of Egyptian AL patients. The study included 90 patients: 53 AML cases and 37 ALL cases in addition to 20 healthy volunteers as controls. Quantitative assessment of MDR1 and ABCB5 genes expression was performed by quantitative real-time polymerase chain reaction. Additional prognostic molecular markers were determined as internal tandem duplications of the FLT3 gene (FLT3-ITD) and nucleophosmin gene mutation (NPM1) for AML cases, and mbcr-abl fusion transcript for B-ALL cases. In AML patients, ABCB5 and MDR1 expression levels did not differ significantly between de novo and relapsed cases and did not correlate with the overall survival or disease-free survival. AML patients were stratified according to the studied genetic markers, and complete remission rate was found to be more prominent in patients having low expression of MDR1 and ABCB5 genes together with mutated NPM1 gene. In ALL patients, ABCB5 gene expression level was significantly higher in relapsed cases and MDR1 gene expression was significantly higher in patients with resistant disease. In conclusion, the results obtained by the current study provide additional evidence of the role played by these genes as predictive factors for resistance of leukemic cells to chemotherapy and hence treatment outcome.

Genomic analysis of fibrolamellar hepatocellular carcinoma.

PubMed

Xu, Lei; Hazard, Florette K; Zmoos, Anne-Flore; Jahchan, Nadine; Chaib, Hassan; Garfin, Phillip M; Rangaswami, Arun; Snyder, Michael P; Sage, Julien

2015-01-01

Pediatric tumors are relatively infrequent, but are often associated with significant lethality and lifelong morbidity. A major goal of pediatric cancer research has been to identify key drivers of tumorigenesis to eventually develop targeted therapies to enhance cure rate and minimize acute and long-term toxic effects. Here, we used genomic approaches to identify biomarkers and candidate drivers for fibrolamellar hepatocellular carcinoma (FL-HCC), a very rare subtype of pediatric liver cancer for which limited therapeutic options exist. In-depth genomic analyses of one tumor followed by immunohistochemistry validation on seven other tumors showed expression of neuroendocrine markers in FL-HCC. DNA and RNA sequencing data further showed that common cancer pathways are not visibly altered in FL-HCC but identified two novel structural variants, both resulting in fusion transcripts. The first, a 400 kb deletion, results in a DNAJB1-PRKCA fusion transcript, which leads to increased cAMP-dependent protein kinase (PKA) activity in the index tumor case and other FL-HCC cases compared with normal liver. This PKA fusion protein is oncogenic in HCC cells. The second gene fusion event, a translocation between the CLPTM1L and GLIS3 genes, generates a transcript whose product also promotes cancer phenotypes in HCC cell lines. These experiments further highlight the tumorigenic role of gene fusions in the etiology of pediatric solid tumors and identify both candidate biomarkers and possible therapeutic targets for this lethal pediatric disease. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Cloning of a methanol-inducible moxF promoter and its analysis in moxB mutants of Methylobacterium extorquens AM1rif.

PubMed Central

Morris, C J; Lidstrom, M E

1992-01-01

In Methylobacterium extorquens AM1, gene encoding methanol dehydrogenase polypeptides are transcriptionally regulated in response to C1 compounds, including methanol (M. E. Lidstrom and D. I. Stirling, Annu. Rev. Microbiol. 44:27-57, 1990). In order to study this regulation, a transcriptional fusion has been constructed between a beta-galactosidase reporter gene and a 1.55-kb XhoI-SalI fragment of M. extorquens AM1rif DNA encoding the N terminus of the methanol dehydrogenase large subunit (moxF) and 1,289 bp of upstream DNA. The fusion exhibited orientation-specific promoter activity in M. extorquens AM1rif but was expressed constitutively when the transcriptional fusion was located on the plasmid. However, correct regulation was restored when the construction was inserted in the M. extorquens AM1rif chromosome. This DNA fragment was shown to contain both the moxFJGI promoter and the sequences necessary in cis for its transcriptional regulation by methanol. Transcription from this promoter was studied in the M. extorquens AM1rif moxB mutant strains UV4rif and UV25rif, which have a pleiotropic phenotype with regard to the components of methanol oxidation. In these mutants, beta-galactosidase activity from the fusion was reduced to a level equal to that of the vector background when the fusion was present in both plasmid and chromosomal locations. Since both constitutive and methanol-inducible promoter activities were lost in the mutants, moxB appears to be required for transcription of the genes encoding the methanol dehydrogenase polypeptides. Images PMID:1624436

Evidence that the lung Adenocarcinoma EML4-ALK fusion gene is not caused by exposure to secondhand tobacco smoke during childhood.

PubMed

Ryan, Bríd M; Wang, Yi; Jen, Jin; Yi, Eunhee S; Olivo-Marston, Susan; Yang, Ping; Harris, Curtis C

2014-07-01

The EML4-ALK fusion gene is more frequently found in younger, never smoking patients with lung cancer. Meanwhile, never smokers exposed to secondhand tobacco smoke (SHS) during childhood are diagnosed at a younger age compared with never smoking patients with lung cancer who are not exposed. We, therefore, hypothesized that SHS, which can induce DNA damage, is associated with the EML4-ALK fusion gene. We compared the frequency of the EML4-ALK fusion gene among 197 never smoker patients with lung cancer with and without a history of exposure to SHS during childhood at Mayo Clinic. The EML4-ALK fusion gene was detected in 33% of cases from never smokers with a history of SHS exposure during childhood, whereas 47% of never smoking lung cancer cases without a history of childhood SHS exposure tested positive for the fusion gene. The EML4-ALK fusion gene is not enriched in tumors from individuals exposed to SHS during childhood. These data suggest that childhood exposure to SHS is not a significant etiologic cause of the EML4-ALK fusion gene in lung cancer. ©2014 American Association for Cancer Research.

A gene expression system offering multiple levels of regulation: the Dual Drug Control (DDC) system.

PubMed

Sudomoina, Marina; Latypova, Ekaterina; Favorova, Olga O; Golemis, Erica A; Serebriiskii, Ilya G

2004-04-29

Whether for cell culture studies of protein function, construction of mouse models to enable in vivo analysis of disease epidemiology, or ultimately gene therapy of human diseases, a critical enabling step is the ability to achieve finely controlled regulation of gene expression. Previous efforts to achieve this goal have explored inducible drug regulation of gene expression, and construction of synthetic promoters based on two-hybrid paradigms, among others. In this report, we describe the combination of dimerizer-regulated two-hybrid and tetracycline regulatory elements in an ordered cascade, placing expression of endpoint reporters under the control of two distinct drugs. In this Dual Drug Control (DDC) system, a first plasmid expresses fusion proteins to DBD and AD, which interact only in the presence of a small molecule dimerizer; a second plasmid encodes a cassette transcriptionally responsive to the first DBD, directing expression of the Tet-OFF protein; and a third plasmid encodes a reporter gene transcriptionally responsive to binding by Tet-OFF. We evaluate the dynamic range and specificity of this system in comparison to other available systems. This study demonstrates the feasibility of combining two discrete drug-regulated expression systems in a temporally sequential cascade, without loss of dynamic range of signal induction. The efficient layering of control levels allowed by this combination of elements provides the potential for the generation of complex control circuitry that may advance ability to regulate gene expression in vivo.

Effective enrichment strategy for EML4-ALK fusion gene screening in patients with non-small cell lung cancer.

PubMed

Kobayashi, Makoto; Sakakibara, Tomohiro; Inoue, Akira; Fukuhara, Tatsuro; Sasano, Hironobu; Ichinose, Masakazu; Nukiwa, Toshihiro

2014-01-01

A novel fusion gene that comprises the echinoderm microtubule-associated protein-like 4 (EML4) and anaplastic lymphoma kinase (ALK) genes was recently identified in non-small cell lung cancer (NSCLC), particularly in adenocarcinoma. A specific ALK inhibitor has been shown to exert anti-tumor effects in NSCLC with the EML4-ALK fusion gene. Previous reports suggested an EML4-ALK incidence of approximately 5% in a pan-NSCLC population, with an increased frequency in younger patients, but an appropriate strategy for further selecting patients with the EML4-ALK fusion gene remains unknown. Patients, 55 years of age or younger, who were diagnosed with NSCLC without typical squamous cell carcinoma features at our institute were retrospectively evaluated. The tumor specimens were examined by immunohistochemistry for the EML4-ALK fusion gene and by polymerase chain reaction for epidermal growth factor receptor (EGFR) mutations. Between January 2004 and September 2011, the EML4-ALK fusion gene was detected in 19.6% (9/46) of patients. The fusion gene incidence increased to 31% (9/29) when patients with EGFR mutations were excluded. The EML4-ALK fusion gene was further detected in 2 cases of undifferentiated cell carcinoma. EML4-ALK fusion gene examinations could be more effectively performed by selecting young NSCLC patients without EGFR mutations, whereas selection on the basis of a non-smoking or adenocarcinoma history, as reported in previous studies, may not correctly identify the patient groups with potential EML4-ALK fusion gene. Copyright © 2013 The Japanese Respiratory Society. Published by Elsevier B.V. All rights reserved.

[Mutations of EGFR gene and EML4-ALK fusion gene in superficial lymph node of non-small cell lung cancer].

PubMed

Wei, Lili; Li, Xingzhou; Yu, Zhonghe

2015-07-14

To explore the mutation status of epidermal growth factor receptor (EGFR) fusion gene and microtubule associated protein like 4-anaplastic lymphoma kinase (EML4-ALK) fusion gene in superficial lymph nodes of non-small cell lung cancer (NSCLC). The technique of fluorescent quantitative polymerase chain reaction (FQ-PCR) was employed for detecting the mutation rate of EGFR gene and EML4-ALK fusion gene for 40 cases of superficial lymph node tissue of NSCLC inpatients at General Military Hospital of Beijing PLA Command from February 2013 to November 2014. And then the correlations were analyzed between EMIA-ALK fusion gene and EGFR gene with clinical features and the clinical efficacies of targeted therapy. The mutation rate of EGFR gene was 35% (14/40) and 50% (10/20) in non-smokers and 46.7% (14/30) in adenocarcinoma patients. The mutation distribution was as follows: exon 18 (n = 1), exon 19 (n =8) and exon 21 (n =5). The mutation rate of EML4-ALK fusion gene was 2. 5% (1/40). EGFR gene mutation was predominantly present in non-smokers (P < 0. 05) and adenocarcinoma (P <0. 01) while no significant difference existed between gender, age or stage (P >0. 05). Those on a targeted therapy had a disease control rate of 93. 3%. Both EGFR gene and EMI4-ALK fusion gene may be detected in superficial lymph nodes of NSCLC patients. The mutation rate of EGFR gene is high in adenocarcinoma and non-smokers while EML4-ALK fusion gene has a low mutation rate.

Expression and characterization of hydrophobin HGFI fused with the cell-specific peptide TPS in Pichia pastoris.

PubMed

Niu, Baolong; Huang, Yujian; Zhang, Suai; Wang, Dandan; Xu, Haijin; Kong, Deling; Qiao, Mingqiang

2012-05-01

The cell-specific peptide TPS (TPSLEQRTVYAK) has been proposed as a potential candidate for fabricating tissue engineering scaffolds based on its ability of binding to human endothelial progenitor cells (EPC) with high affinity and specificity. In this study, the class I hydrophobin hgfI gene from Grifola frondosa and the tps were fused and cloned into pPIC9. The fusion gene was expressed in Pichia pastoris under the control of alcohol oxidase 1 promoter. Tricine-SDS-PAGE and Western blotting confirmed that the fusion protein TPS-linker-HGFI (TLH) was successfully secreted into the culture medium. The fusion protein TLH was purified by ultrafiltration and reverse-phase high performance liquid chromatography (RP-HPLC). Water contact angle (WCA) demonstrated that similar to recombinant HGFI (rHGFI), the purified TLH could convert the surface wettability of polystyrene and mica. X-ray photoelectron spectroscopy (XPS) measurements indicated that the purified TLH could form stable films on the hydrophobic siliconized glass surface. The cell adhesion examination showed that the TLH modified poly(ε-caprolactone) (PCL) could specially facilitate the EPC (particularly EPC derived from human) binding, while rHGFI modified PCL could nonselectively enhance cells adhesion. To the best of our knowledge, this is the first report that demonstrates that the TPS peptide was immobilized on biomaterial-PCL surface by fusion with hydrophobin. The potential application of this finding in combination with biomedical devices for EPC culture, will facilitate the current techniques used for cell-based therapies. Copyright © 2012 Elsevier Inc. All rights reserved.

The t(3;5)(q25.1;q34) of myelodysplastic syndrome and acute myeloid leukemia produces a novel fusion gene, NPM-MLF1.

PubMed

Yoneda-Kato, N; Look, A T; Kirstein, M N; Valentine, M B; Raimondi, S C; Cohen, K J; Carroll, A J; Morris, S W

1996-01-18

A t(3;5)(q25.1;q34) chromosomal translocation associated with myelodysplastic syndrome and acute myeloid leukemia (AML) was found to rearrange part of the nucleophosmin (NPM) gene on chromosome 5 with sequences from a novel gene on chromosome 3. Chimeric transcripts expressed by these cells contain 5' NPM coding sequences fused in-frame to those of the new gene, which we named myelodysplasia/myeloid leukemia factor 1 (MLF1). RNA-based polymerase chain reaction analysis revealed identical NPM-MLF1 mRNA fusions in each of the three t(3;5)-positive cases of AML examined. The predicted MLF1 amino acid sequence lacked homology to previously characterized proteins and did not contain known functional motifs. Normal MLF1 transcripts were expressed in a variety of tissues, most abundantly in testis, ovary, skeletal muscle, heart, kidney and colon. Anti-MLF1 antibodies detected the wild-type 31 kDa protein in K562 and HEL erythroleukemia cell lines, but not in HL-60, U937 or KG-1 myeloid leukemia lines. By contrast, t(3;5)-positive leukemia cells expressed a 54 kDa NPM-MLF1 protein, but not normal MLF1. Immunostaining experiments indicated that MLF1 is normally located in the cytoplasm, whereas NPM-MLF1 is targeted to the nucleus, with highest levels in the nucleolus. The nuclear/nucleolar localization of NPM-MLF1 mirrors that of NPM, indicating that NPM trafficking signals direct MLF1 to an inappropriate cellular compartment in myeloid leukemia cells.

TAD disruption as oncogenic driver

PubMed Central

Valton, Anne-Laure; Dekker, Job

2016-01-01

Topologically Associating Domains (TADs) are conserved during evolution and play roles in guiding and constraining long-range regulation of gene expression. Disruption of TAD boundaries results in aberrant gene expression by exposing genes to inappropriate regulatory elements. Recent studies have shown that TAD disruption is often found in cancer cells and contributes to oncogenesis through two mechanisms. One mechanism locally disrupts domains by deleting or mutating a TAD boundary leading to fusion of the two adjacent TADs. The other mechanism involves genomic rearrangements that break up TADs and creates new ones without directly affecting TAD boundaries. Understanding the mechanisms by which TADs form and control long-range chromatin interactions will therefore not only provide insights into the mechanism of gene regulation in general, but will also reveal how genomic rearrangements and mutations in cancer genomes can lead to misregulation of oncogenes and tumor suppressors. PMID:27111891

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pasek, Marta; Boeggeman, Elizabeth; Ramakrishnan, Boopathy

The expression of recombinant proteins in Escherichia coli often leads to inactive aggregated proteins known as the inclusion bodies. To date, the best available tool has been the use of fusion tags, including the carbohydrate-binding protein; e.g., the maltose-binding protein (MBP) that enhances the solubility of recombinant proteins. However, none of these fusion tags work universally with every partner protein. We hypothesized that galectins, which are also carbohydrate-binding proteins, may help as fusion partners in folding the mammalian proteins in E. coli. Here we show for the first time that a small soluble lectin, human galectin-1, one member of amore » large galectin family, can function as a fusion partner to produce soluble folded recombinant human glycosyltransferase, {beta}-1,4-galactosyltransferase-7 ({beta}4Gal-T7), in E. coli. The enzyme {beta}4Gal-T7 transfers galactose to xylose during the synthesis of the tetrasaccharide linker sequence attached to a Ser residue of proteoglycans. Without a fusion partner, {beta}4Gal-T7 is expressed in E. coli as inclusion bodies. We have designed a new vector construct, pLgals1, from pET-23a that includes the sequence for human galectin-1, followed by the Tev protease cleavage site, a 6x His-coding sequence, and a multi-cloning site where a cloned gene is inserted. After lactose affinity column purification of galectin-1-{beta}4Gal-T7 fusion protein, the unique protease cleavage site allows the protein {beta}4Gal-T7 to be cleaved from galectin-1 that binds and elutes from UDP-agarose column. The eluted protein is enzymatically active, and shows CD spectra comparable to the folded {beta}4Gal-T1. The engineered galectin-1 vector could prove to be a valuable tool for expressing other proteins in E. coli.« less

Lateral organ boundaries 1 is a disease susceptibility gene for citrus bacterial canker disease

PubMed Central

Hu, Yang; Zhang, Junli; Jia, Hongge; Sosso, Davide; Li, Ting; Frommer, Wolf B.; Yang, Bing; White, Frank F.; Wang, Nian; Jones, Jeffrey B.

2014-01-01

Citrus bacterial canker (CBC) disease occurs worldwide and incurs considerable costs both from control measures and yield losses. Bacteria that cause CBC require one of six known type III transcription activator-like (TAL) effector genes for the characteristic pustule formation at the site of infection. Here, we show that Xanthomonas citri subspecies citri strain Xcc306, with the type III TAL effector gene pthA4 or with the distinct yet biologically equivalent gene pthAw from strain XccAw, induces two host genes, CsLOB1 and CsSWEET1, in a TAL effector-dependent manner. CsLOB1 is a member of the Lateral Organ Boundaries (LOB) gene family of transcription factors, and CsSWEET1 is a homolog of the SWEET sugar transporter and rice disease susceptibility gene. Both TAL effectors drive expression of CsLOB1 and CsSWEET1 promoter reporter gene fusions when coexpressed in citrus or Nicotiana benthamiana. Artificially designed TAL effectors directed to sequences in the CsLOB1 promoter region, but not the CsSWEET1 promoter, promoted pustule formation and higher bacterial leaf populations. Three additional distinct TAL effector genes, pthA*, pthB, and pthC, also direct pustule formation and expression of CsLOB1. Unlike pthA4 and pthAw, pthB and pthC do not promote the expression of CsSWEET1. CsLOB1 expression was associated with the expression of genes associated with cell expansion. The results indicate that CBC-inciting species of Xanthomonas exploit a single host disease susceptibility gene by altering the expression of an otherwise developmentally regulated gene using any one of a diverse set of TAL effector genes in the pathogen populations. PMID:24474801