The equine herpesvirus-1 IR3 gene that lies antisense to the sole immediate-early (IE) gene is trans-activated by the IE protein, and is poorly expressed to a protein

PubMed Central

Ahn, Byung Chul; Breitenbach, Jonathan E.; Kim, Seong K.; O’Callaghan, Dennis J.

2007-01-01

The unique IR3 gene of equine herpesvirus 1 (EHV-1) is expressed as a late 1.0-kb transcript. Previous studies confirmed the IR3 transcription initiation site and tentatively identified other cis-acting elements specific to IR3 such as a TATA box, a 443 base pair 5′untranslated region (UTR), a 285 base pair open reading frame (ORF) and a poly adenylation (A) signal (Holden et al., 1992 DNA Seq 3, 143-52). Transient transfection assays revealed that the IR3 promoter is strongly trans-activated by the IE protein (IEP) and that coexpression of the IEP with the early EICP0 and IR4 regulatory proteins results in maximal trans-activation of the IR3 promoter. Gel shift assays revealed that the IEP directly binds to the IR3 promoter region. Western blot analysis showed that the IR3 protein produced in E. coli was detected by antibodies to IR3 synthetic peptides; however, the IR3 protein was not detected in EHV-1 infected cell extracts by these same anti-IR3 antibodies, even though the IR3 transcript was detected by northern blot. These findings suggest that the IR3 may not be expressed to a protein. Expression of an IR3/GFP fusion gene was not observed, but expression of a GFP/IR3 fusion gene was detected by fluorescent microscopy. In further attempts to detect the IR3/GFP fusion protein using anti-GFP antibody, western blot analysis showed that the IR3/GFP fusion protein was not detected in vivo. Interestingly, a truncated form of the GFP/IR3 protein was synthesized from the GFP/IR3 fusion gene. However, GFP/IR3 and IR3/GFP fusion proteins of the predicted sizes were synthesized by in vitro coupled transcription and translation of the fusion genes, suggesting poor expression of the IR3 protein in vivo. The possible role of the IR3 transcript in EHV-1 infection is discussed. PMID:17306852

CNVs leading to fusion transcripts in individuals with autism spectrum disorder

PubMed Central

Holt, Richard; Sykes, Nuala H; Conceição, Inês C; Cazier, Jean-Baptiste; Anney, Richard JL; Oliveira, Guiomar; Gallagher, Louise; Vicente, Astrid; Monaco, Anthony P; Pagnamenta, Alistair T

2012-01-01

There is strong evidence that rare copy number variants (CNVs) have a role in susceptibility to autism spectrum disorders (ASDs). Much research has focused on how CNVs mediate a phenotypic effect by altering gene expression levels. We investigated an alternative mechanism whereby CNVs combine the 5′ and 3′ ends of two genes, creating a ‘fusion gene'. Any resulting mRNA with an open reading frame could potentially alter the phenotype via a gain-of-function mechanism. We examined 2382 and 3096 rare CNVs from 996 individuals with ASD and 1287 controls, respectively, for potential to generate fusion transcripts. There was no increased burden in individuals with ASD; 122/996 cases harbored at least one rare CNV of this type, compared with 179/1287 controls (P=0.89). There was also no difference in the overall frequency distribution between cases and controls. We examined specific examples of such CNVs nominated by case–control analysis and a candidate approach. Accordingly, a duplication involving REEP1-POLR1A (found in 3/996 cases and 0/1287 controls) and a single occurrence CNV involving KIAA0319-TDP2 were tested. However, no fusion transcripts were detected by RT-PCR. Analysis of additional samples based on cell line availability resulted in validation of a MAPKAPK5-ACAD10 fusion transcript in two probands. However, this variant was present in controls at a similar rate and is unlikely to influence ASD susceptibility. In summary, although we find no evidence that fusion-gene generating CNVs lead to ASD susceptibility, discovery of a MAPKAPK5-ACAD10 transcript with an estimated frequency of ∼1/200 suggests that gain-of-function mechanisms should be considered in future CNVs studies. PMID:22549408

RELATIVE EXPRESSION AND STABILITY OF A CHROMOSOMALLY INTEGRATED AND PLASMID-BORNE MARKER GENE FUSION IN ENVIRONMENTALLY COMPETENT BACTERIA

EPA Science Inventory

A xyIE-iceC transcriptional fusion was created by ligating a DNA fragment harboring the cloned xyIE structural gene from the TOL plasmid of Pseudomonas putida mt-2 into the cloned iceC gene of Pseudomonas syringae Cit7. This fusion construct was integrated into chromosome of Pseu...

Transcriptional and functional studies of Human Endogenous Retrovirus envelope EnvP(b) and EnvV genes in human trophoblasts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vargas, Amandine, E-mail: amandine.vargas@voila.fr; Thiery, Maxime, E-mail: thiery.maxime@courrier.uqam.ca; Lafond, Julie, E-mail: lafond.julie@uqam.ca

2012-03-30

HERV (Human Endogenous Retrovirus)-encoded envelope proteins are implicated in the development of the placenta. Indeed, Syncytin-1 and -2 play a crucial role in the fusion of human trophoblasts, a key step in placentation. Other studies have identified two other HERV env proteins, namely EnvP(b) and EnvV, both expressed in the placenta. In this study, we have fully characterized both env transcripts and their expression pattern and have assessed their implication in trophoblast fusion. Through RACE analyses, standard spliced transcripts were detected, while EnvV transcripts demonstrated alternative splicing at its 3 Prime end. Promoter activity and expression of both genes weremore » induced in forskolin-stimulated BeWo cells and in primary trophoblasts. Although we have confirmed the fusogenic activity of EnvP(b), overexpression or silencing experiments revealed no impact of this protein on trophoblast fusion. Our results demonstrate that both env genes are expressed in human trophoblasts but are not required for syncytialization.« less

Cloning of a methanol-inducible moxF promoter and its analysis in moxB mutants of Methylobacterium extorquens AM1rif.

PubMed Central

Morris, C J; Lidstrom, M E

1992-01-01

In Methylobacterium extorquens AM1, gene encoding methanol dehydrogenase polypeptides are transcriptionally regulated in response to C1 compounds, including methanol (M. E. Lidstrom and D. I. Stirling, Annu. Rev. Microbiol. 44:27-57, 1990). In order to study this regulation, a transcriptional fusion has been constructed between a beta-galactosidase reporter gene and a 1.55-kb XhoI-SalI fragment of M. extorquens AM1rif DNA encoding the N terminus of the methanol dehydrogenase large subunit (moxF) and 1,289 bp of upstream DNA. The fusion exhibited orientation-specific promoter activity in M. extorquens AM1rif but was expressed constitutively when the transcriptional fusion was located on the plasmid. However, correct regulation was restored when the construction was inserted in the M. extorquens AM1rif chromosome. This DNA fragment was shown to contain both the moxFJGI promoter and the sequences necessary in cis for its transcriptional regulation by methanol. Transcription from this promoter was studied in the M. extorquens AM1rif moxB mutant strains UV4rif and UV25rif, which have a pleiotropic phenotype with regard to the components of methanol oxidation. In these mutants, beta-galactosidase activity from the fusion was reduced to a level equal to that of the vector background when the fusion was present in both plasmid and chromosomal locations. Since both constitutive and methanol-inducible promoter activities were lost in the mutants, moxB appears to be required for transcription of the genes encoding the methanol dehydrogenase polypeptides. Images PMID:1624436

CRTC1/MAML2 fusion transcript in central mucoepidermoid carcinoma of mandible--diagnostic and histogenetic implications.

PubMed

Bell, Diana; Holsinger, Christopher F; El-Naggar, Adel K

2010-12-01

Intraosseous salivary gland carcinomas are extremely rare, comprising only 2% to 3% of all mucoepidermoid carcinomas (MECs) reported. The t(11;19) translocation and its CRTC1/MAML1 fusion transcript have been identified in MEC at different sites and are believed to be associated with the development of a subset of these tumors. However, the status of the fusion transcript has not been reported in intraosseous MEC. Here, we report 3 examples of central MEC of the mandible, including a case with a history of primary retromolar MEC. Reverse transcriptase-polymerase chain reaction and DNA sequencing analyses of the microdissected components of these tumors were used for the detection and verification of the fusion transcript. We identified, for the first time, the t(11;19) fusion gene transcript in central MEC, including in the previous primary retromolar MEC. No fusion transcript was detected in the second primary noncentral MEC or in another central MEC. The results indicate that central MEC can manifest the fusion transcript. This finding may have diagnostic and histogenetic roles in the future analysis of this entity. Published by Elsevier Inc.

Discovering and understanding oncogenic gene fusions through data intensive computational approaches

PubMed Central

Latysheva, Natasha S.; Babu, M. Madan

2016-01-01

Abstract Although gene fusions have been recognized as important drivers of cancer for decades, our understanding of the prevalence and function of gene fusions has been revolutionized by the rise of next-generation sequencing, advances in bioinformatics theory and an increasing capacity for large-scale computational biology. The computational work on gene fusions has been vastly diverse, and the present state of the literature is fragmented. It will be fruitful to merge three camps of gene fusion bioinformatics that appear to rarely cross over: (i) data-intensive computational work characterizing the molecular biology of gene fusions; (ii) development research on fusion detection tools, candidate fusion prioritization algorithms and dedicated fusion databases and (iii) clinical research that seeks to either therapeutically target fusion transcripts and proteins or leverages advances in detection tools to perform large-scale surveys of gene fusion landscapes in specific cancer types. In this review, we unify these different—yet highly complementary and symbiotic—approaches with the view that increased synergy will catalyze advancements in gene fusion identification, characterization and significance evaluation. PMID:27105842

IQCJ-SCHIP1, a novel fusion transcript encoding a calmodulin-binding IQ motif protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kwasnicka-Crawford, Dorota A.; Carson, Andrew R.; Scherer, Stephen W.

The existence of transcripts that span two adjacent, independent genes is considered rare in the human genome. This study characterizes a novel human fusion gene named IQCJ-SCHIP1. IQCJ-SCHIP1 is the longest isoform of a complex transcriptional unit that bridges two separate genes that encode distinct proteins, IQCJ, a novel IQ motif containing protein and SCHIP1, a schwannomin interacting protein that has been previously shown to interact with the Neurofibromatosis type 2 (NF2) protein. IQCJ-SCHIP1 is located on the chromosome 3q25 and comprises a 1692-bp transcript encompassing 11 exons spanning 828 kb of the genomic DNA. We show that IQCJ-SCHIP1 mRNAmore » is highly expressed in the brain. Protein encoded by the IQCJ-SCHIP1 gene was localized to cytoplasm and actin-rich regions and in differentiated PC12 cells was also seen in neurite extensions.« less

Functional imaging: monitoring heme oxygenase-1 gene expression in vivo

NASA Astrophysics Data System (ADS)

Zhang, Weisheng; Reilly-Contag, Pamela; Stevenson, David K.; Contag, Christopher H.

1999-07-01

The regulation of genetic elements can be monitored in living animals using photoproteins as reporters. Heme oxygenase (HO) is the key catabolic enzyme in the heme degradation pathway. Here, HO expression serves as a model for in vivo functional imaging of transcriptional regulation of a clinically relevant gene. HO enzymatic activity is inhibited by heme analogs, metalloporphyrins, but many members of this family of compounds also activate transcription of the HO-1 promoter. The degree of transcriptional activation by twelve metalloporphyrins, differing at the central metal and porphyrin ring substituents, was evaluated in both NIH 3T3 stable lines and transgenic animals containing HO-1 promoter-luciferase gene fusions. In the correlative cell culture assays, the metalloporphyrins increased transcription form the full length HO promoter fusion to varying degrees, but none increased transcription from a truncated HO-1 promoter. These results suggested that one or both of the two distal enhancer elements located at -4 and -10 Kb upstream from transcriptional start are required for HO-1 induction by heme and its analogs. The full-length HO-1-luc fusion was then evaluated as a transgene in mice. It was possible to monitor the effects of the metalloporphyrins, SnMP and ZnPP, in living animals over time. This spatiotemporal analyses of gene expression in vivo implied that alterations in porphyrin ring substituents and the central metal may affect the extent of gene activation. These data further indicate that using photoprotein reporters, subtle differences in gene expression can be monitored in living animals.

Cryptic chromosome 9q34 deletion generates TAF-Ialpha/CAN and TAF-Ibeta/CAN fusion transcripts in acute myeloid leukemia.

PubMed

Rosati, Roberto; La Starza, Roberta; Barba, Gianluca; Gorello, Paolo; Pierini, Valentina; Matteucci, Caterina; Roti, Giovanni; Crescenzi, Barbara; Aloisi, Teresa; Aversa, Franco; Martelli, Massimo Fabrizio; Mecucci, Cristina

2007-02-01

In hematologic malignancies chromosome aberrations generating fusion genes include cryptic deletions. In a patient with acute myeloid leukemia and normal karyo-type we discovered a new cryptic 9q34 deletion and here report the cytogenetic and molecular findings. The 9q34 deletion extends 2.5 megabases and juxtaposes the 5' TAF-I to the 3' CAN producing a TAF-I/CAN fusion gene. TAF-I/CAN transcribes into two fusion proteins bearing either TAF-Ialpha or TAF-Ibeta moieties. We set up molecular assays to monitor the chimeric TAF-Ialpha/CAN and TAF-Ibeta/CAN transcripts which, after hematopoietic stem cell transplantation from an HLA-identical sibling, were no longer detected.

The divergently transcribed genes encoding yeast ribosomal proteins L46 and S24 are activated by shared RPG-boxes.

PubMed Central

Kraakman, L S; Mager, W H; Maurer, K T; Nieuwint, R T; Planta, R J

1989-01-01

Transcription of the majority of the ribosomal protein (rp) genes in yeast is activated through common cis-acting elements, designated RPG-boxes. These elements have been shown to act as specific binding sites for the protein factor TUF/RAP1/GRF1 in vitro. Two such elements occur in the intergenic region separating the divergently transcribed genes encoding L46 and S24. To investigate whether the two RPG-boxes mediate transcription activation of both the L46 and S24 gene, two experimental strategies were followed: cloning of the respective genes on multicopy vectors and construction of fusion genes. Cloning of the L46 + S24 gene including the intergenic region in a multicopy yeast vector indicated that both genes are transcriptionally active. Using constructs in which only the S24 or the L46 gene is present, with or without the intergenic region, we obtained evidence that the intergenic region is indispensable for transcription activation of either gene. To demarcate the element(s) responsible for this activation, fusions of the intergenic region in either orientation to the galK reporter gene were made. Northern analysis of the levels of hybrid mRNA demonstrated that the intergenic region can serve as an heterologous promoter when it is in the 'S24-orientation'. Surprisingly, however, when fused in the reverse orientation the intergenic region did hardly confer transcription activity on the fusion gene. Furthermore, a 274 bp FnuDII-FnuDII fragment from the intergenic region that contains the RPG-boxes, could replace the naturally occurring upstream activation site (UASrpg) of the L25 rp-gene only when inserted in the 'S24-orientation'. Removal of 15 bp from the FnuDII fragment appeared to be sufficient to obtain transcription activation in the 'L46 orientation' as well. Analysis of a construct in which the RPG-boxes were selectively deleted from the promoter region of the L46 gene indicated that the RPG-boxes are needed for efficient transcriptional activation of the L46 gene. We conclude that all promoter elements for the S24 gene are located within the intergenic region, where the RPG-boxes are the most likely UAS-elements. However, the intergenic region (including the RPG-boxes) is required but not sufficient to confer transcription activity on the L46 gene. Images PMID:2602141

The divergently transcribed genes encoding yeast ribosomal proteins L46 and S24 are activated by shared RPG-boxes.

PubMed

Kraakman, L S; Mager, W H; Maurer, K T; Nieuwint, R T; Planta, R J

1989-12-11

Transcription of the majority of the ribosomal protein (rp) genes in yeast is activated through common cis-acting elements, designated RPG-boxes. These elements have been shown to act as specific binding sites for the protein factor TUF/RAP1/GRF1 in vitro. Two such elements occur in the intergenic region separating the divergently transcribed genes encoding L46 and S24. To investigate whether the two RPG-boxes mediate transcription activation of both the L46 and S24 gene, two experimental strategies were followed: cloning of the respective genes on multicopy vectors and construction of fusion genes. Cloning of the L46 + S24 gene including the intergenic region in a multicopy yeast vector indicated that both genes are transcriptionally active. Using constructs in which only the S24 or the L46 gene is present, with or without the intergenic region, we obtained evidence that the intergenic region is indispensable for transcription activation of either gene. To demarcate the element(s) responsible for this activation, fusions of the intergenic region in either orientation to the galK reporter gene were made. Northern analysis of the levels of hybrid mRNA demonstrated that the intergenic region can serve as an heterologous promoter when it is in the 'S24-orientation'. Surprisingly, however, when fused in the reverse orientation the intergenic region did hardly confer transcription activity on the fusion gene. Furthermore, a 274 bp FnuDII-FnuDII fragment from the intergenic region that contains the RPG-boxes, could replace the naturally occurring upstream activation site (UASrpg) of the L25 rp-gene only when inserted in the 'S24-orientation'. Removal of 15 bp from the FnuDII fragment appeared to be sufficient to obtain transcription activation in the 'L46 orientation' as well. Analysis of a construct in which the RPG-boxes were selectively deleted from the promoter region of the L46 gene indicated that the RPG-boxes are needed for efficient transcriptional activation of the L46 gene. We conclude that all promoter elements for the S24 gene are located within the intergenic region, where the RPG-boxes are the most likely UAS-elements. However, the intergenic region (including the RPG-boxes) is required but not sufficient to confer transcription activity on the L46 gene.

HIP1-ALK, a novel fusion protein identified in lung adenocarcinoma.

PubMed

Hong, Mineui; Kim, Ryong Nam; Song, Ji-Young; Choi, So-Jung; Oh, Ensel; Lira, Maruja E; Mao, Mao; Takeuchi, Kengo; Han, Joungho; Kim, Jhingook; Choi, Yoon-La

2014-03-01

The most common mechanism underlying overexpression and activation of anaplastic lymphoma kinase (ALK) in non-small-cell lung carcinoma could be attributed to the formation of a fusion protein. To date, five fusion partners of ALK have been reported, namely, echinoderm microtubule associated protein like 4, tropomyosin-related kinase-fused gene, kinesin family member 5B, kinesin light chain 1, and protein tyrosine phosphatase, nonreceptor type 3. In this article, we report a novel fusion gene huntingtin interacting protein 1 (HIP1)-ALK, which is conjoined between the huntingtin-interacting protein 1 gene HIP1 and ALK. Reverse-transcriptase polymerase chain reaction and immunohistochemical analysis were used to detect this fusion gene's transcript and protein expression, respectively. We had amplified the full-length cDNA sequence of this novel fusion gene by using 5'-rapid amplification of cDNA ends. The causative genomic translocation t(2;7)(p23;q11.23) for generating this novel fusion gene was verified by using genomic sequencing. The examined adenocarcinoma showed predominant acinar pattern, and ALK immunostaining was localized to the cytoplasm, with intense staining in the submembrane region. In break-apart, fluorescence in situ hybridization analysis for ALK, split of the 5' and 3' probe signals, and isolated 3' signals were observed. Reverse-transcriptase polymerase chain reaction revealed that the tumor harbored a novel fusion transcript in which exon 21 of HIP1 was fused to exon 20 of ALK in-frame. The novel fusion gene and its protein HIP1-ALK harboring epsin N-terminal homology, coiled-coil, juxtamembrane, and kinase domains, which could play a role in carcinogenesis, could become diagnostic and therapeutic target of the lung adenocarcinoma and deserve a further study in the future.

Adult-onset renal cell carcinoma associated with Xp11.2 translocations/TFE3 gene fusion with smooth muscle stroma and abnormal vessels.

PubMed

Kuroda, Naoto; Tamura, Masato; Tanaka, Yukichi; Hes, Ondrej; Michal, Michal; Inoue, Kaori; Ohara, Masahiko; Mizuno, Keiko; Lee, Gang-Hong

2009-07-01

Renal cell carcinoma (RCC) associated with Xp11.2 translocation/TFE3 gene fusion has been recently identified. Herein is presented a case of RCC with Xp11.2 translocations/TFE3 gene fusions with unusual histological findings. A 68-year-old Japanese woman was incidentally found to have a renal mass on CT. Histological examination showed clear cell neoplasm with alveolar and papillary growth patterns. The nuclear atypia corresponded to Fuhrman grade 3. Additionally, smooth muscle stroma was observed and abnormal vessels showing a heterogeniety in thickness were also identified. On immunohistochemistry, neoplastic cells were diffusely positive for transcription factor E3 (TFE3) and Melan A, and focally positive for CD10 and RCC marker. The smooth muscle stroma was positive for alpha-smooth muscle actin and h-caldesmon, but reverse transcription-polymerase chain reaction of the tumor using frozen material could not detect any previously reported chimeric transcripts including ASPL-TFE3, PRCC-TFE3, CLTC-TFE3, PSF-TFE3 or NoNo-TFE3. G-band karyotype was unsuccessful. Pathologists should pay attention to the afore-described unusual stromal reaction of adult-onset RCC associated with Xp11.2 translocations/TFE3 gene fusions.

Domain retention in transcription factor fusion genes and its biological and clinical implications: a pan-cancer study

PubMed Central

Kim, Pora; Ballester, Leomar Y.; Zhao, Zhongming

2017-01-01

Genomic rearrangements involving transcription factors (TFs) can form fusion proteins resulting in either enhanced, weakened, or even loss of TF activity. Functional domain (FD) retention is a critical factor in the activity of transcription factor fusion genes (TFFGs). A systematic investigation of FD retention in TFFGs and their outcome (e.g. expression changes) in a pan-cancer study has not yet been completed. Here, we examined the FD retention status in 386 TFFGs across 13 major cancer types and identified 83 TFFGs involving 67 TFs that retained FDs. To measure the potential biological relevance of TFs in TFFGs, we introduced a Major Active Isofusion Index (MAII) and built a prioritized TFFG network using MAII scores and the observed frequency of fusion positive samples. Interestingly, the four TFFGs (PML-RARA, RUNX1-RUNX1T1, TMPRSS2-ERG, and SFPQ-TFE3) with the highest MAII scores showed 50 differentially expressed target genes (DETGs) in fusion-positive versus fusion-negative cancer samples. DETG analysis revealed that they were involved in tumorigenesis-related processes in each cancer type. PLAU, which encodes plasminogen activator urokinase and serves as a biomarker for tumor invasion, was found to be consistently activated in the samples with the highest MAII scores. Among the 50 DETGs, 21 were drug targetable genes. Fourteen of these 21 DETGs were expressed in acute myeloid leukemia (AML) samples. Accordingly, we constructed an AML-specific TFFG network, which included 38 DETGs in RUNX1-RUNX1T1 or PML-RARA positive samples. In summary, this study revealed several TFFGs and their potential target genes, and provided insights into the clinical implications of TFFGs. PMID:29299133

Two modes of control of pilA, the gene encoding type 1 pilin in Escherichia coli.

PubMed Central

Orndorff, P E; Spears, P A; Schauer, D; Falkow, S

1985-01-01

Type 1 piliation in Escherichia coli is subject to metastable regulation at the transcriptional level (B. I. Eisenstein, Science 214:337-339, 1981). However, the genes controlling in this fashion are not known. We present evidence that the pilA gene, encoding the structural subunit of type 1 pili, is subject to metastable transcriptional regulation. A pilA'-lacZ fusion, constructed in vitro on a recombinant plasmid, was used in conjunction with a recBC sbcB mutant of E. coli K-12 to introduce the fusion into the chromosomal region encoding Pil. This fusion was found to be subject to metastable transcriptional control. The rate of switching from the Lac+ to the Lac- phenotype was 4 X 10(-4) per cell per generation and 6.2 X 10(-4) in the opposite direction. A ca. 10-fold difference in beta-galactosidase activity was observed between phenotypically "ON" (Lac+) and "OFF" (Lac-) populations. P1 transduction experiments showed that the element determining the ON or OFF phenotype was tightly linked to pilA. In addition to the metastable regulation of pilA, a second type of transcriptional regulation was effected by the product of a gene, hyp, adjacent to pilA. By using a recombinant plasmid containing just a pilA'-lacZ fusion and the putative pilA promoter, we found that a lesion in hyp conferred a beta-galactosidase activity about fivefold higher than that of a strain possessing the parental hyp gene. Mutants constructed to have a pilA'-lacZ fusion and a hyp::Tn5-132 mutation in the chromosome exhibited a frequency of switching from Lac+ to Lac- and vice versa indistinguishable from that of the parental strain. However, in the ON mode, hyp::Tn5-132 mutants showed a twofold-higher beta-galactosidase activity. Thus, hyp does not appear to affect metastable variation but does affect the level of transcription of the pilA gene in the ON (transcribed) mode. Images PMID:3930469

Development of Peptidomimetic Inhibitors of the ERG Gene Fusion Product in Prostate Cancer.

PubMed

Wang, Xiaoju; Qiao, Yuanyuan; Asangani, Irfan A; Ateeq, Bushra; Poliakov, Anton; Cieślik, Marcin; Pitchiaya, Sethuramasundaram; Chakravarthi, Balabhadrapatruni V S K; Cao, Xuhong; Jing, Xiaojun; Wang, Cynthia X; Apel, Ingrid J; Wang, Rui; Tien, Jean Ching-Yi; Juckette, Kristin M; Yan, Wei; Jiang, Hui; Wang, Shaomeng; Varambally, Sooryanarayana; Chinnaiyan, Arul M

2017-04-10

Transcription factors play a key role in the development of diverse cancers, and therapeutically targeting them has remained a challenge. In prostate cancer, the gene encoding the transcription factor ERG is recurrently rearranged and plays a critical role in prostate oncogenesis. Here, we identified a series of peptides that interact specifically with the DNA binding domain of ERG. ERG inhibitory peptides (EIPs) and derived peptidomimetics bound ERG with high affinity and specificity, leading to proteolytic degradation of the ERG protein. The EIPs attenuated ERG-mediated transcription, chromatin recruitment, protein-protein interactions, cell invasion and proliferation, and tumor growth. Thus, peptidomimetic targeting of transcription factor fusion products may provide a promising therapeutic strategy for prostate cancer as well as other malignancies. Copyright © 2017 Elsevier Inc. All rights reserved.

RSPO fusion transcripts in colorectal cancer in Japanese population.

PubMed

Shinmura, Kazuya; Kahyo, Tomoaki; Kato, Hisami; Igarashi, Hisaki; Matsuura, Shun; Nakamura, Satoki; Kurachi, Kiyotaka; Nakamura, Toshio; Ogawa, Hiroshi; Funai, Kazuhito; Tanahashi, Masayuki; Niwa, Hiroshi; Sugimura, Haruhiko

2014-08-01

R-spondin (RSPO) gene fusions have recently been discovered in a subset of human colorectal cancer (CRC) in the U.S. population; however, whether the fusion is recurrent in CRC arising in patients from the other demographic areas and whether it is specific for CRC remain uncertain. In this study, we examined 75 primary CRCs and 121 primary lung cancers in the Japanese population for EIF3E-RSPO2 and PTPRK-RSPO3 fusion transcripts using RT-PCR and subsequent sequencing analyses. Although the expression of EIF3E-RSPO2 and PTPRK-RSPO3 was not detected in any of the lung carcinomas, RSPO fusions were detected in three (4%) of the 75 CRCs. Two CRCs contained EIF3E-RSPO2 fusion transcripts, and another CRC contained PTPRK-RSPO3 fusion transcripts. Interestingly, in one of the two EIF3E-RSPO2 fusion-positive CRCs, a novel fusion variant form of EIF3E-RSPO2 was identified: exon 1 of EIF3E was connected to exon 2 of RSPO2 by a 351-bp insertion. A quantitative RT-PCR analysis revealed that RSPO mRNA expression was upregulated in the three CRCs containing RSPO fusion transcripts, while it was downregulated in nearly all of the other CRCs. An immunohistochemical analysis and a mutational analysis revealed that the RSPO fusion-containing CRC had a CDX2 cell lineage, was positive for mismatch repair protein expression, and had the wild-type APC allele. Finally, the forced expression of RSPO fusion proteins were shown to endow colorectal cells with an increased growth ability. These results suggest that the expression of RSPO fusion transcripts is related to a subset of CRCs arising in the Japanese population.

Identification of novel recurrent ETV6-IGH fusions in primary central nervous system lymphoma.

PubMed

Bruno, Aurélie; Labreche, Karim; Daniau, Maïlys; Boisselier, Blandine; Gauchotte, Guillaume; Royer-Perron, Louis; Rahimian, Amithys; Lemoine, Frédéric; de la Grange, Pierre; Guégan, Justine; Bielle, Franck; Polivka, Marc; Adam, Clovis; Meyronet, David; Figarella-Branger, Dominique; Villa, Chiara; Chrétien, Fabrice; Eimer, Sandrine; Davi, Frédéric; Rousseau, Audrey; Houillier, Caroline; Soussain, Carole; Mokhtari, Karima; Hoang-Xuan, Khê; Alentorn, Agusti

2018-02-08

Primary central nervous system lymphoma (PCNSL) represents a particular entity within non-Hodgkin lymphomas and is associated with poor outcome. The present study addresses the potential clinical relevance of chimeric transcripts in PCSNL discovered by using RNA-sequencing (RNA-Seq). Seventy-two immunocompetent and newly diagnosed PCNSL cases were included in the present study. Among them, six were analyzed by RNA-seq to detect new potential fusion transcripts. We confirmed the results in the remaining 66 PCNSL. The gene fusion was validated by fluorescence in situ hybridization (FISH) using formalin-fixed paraffin-embedded (FFPE) samples. We assessed the biological and clinical impact of one new gene fusion. We identified a novel recurrent gene fusion ETV6-IgH. Overall, ETV6-IgH was found in 13 out of 72 PCNSL (18%). No fusion conserved an intact functional domain of ETV6 and ETV6 was significantly underexpressed at gene level, suggesting an ETV6 haploinsufficiency mechanism. The presence of the gene fusion was also validated by FISH in FFPE samples. Finally, PCNSL samples harboring ETV6-IgH showed a better prognosis in multivariate analysis, p-value=0.03, HR=0.33, 95% interval confidence (IC95) [0.12-0.88]. The overall survival at 5 years was of 69% for PCNSL harboring ETV6-IgH vs 29% for samples without this gene fusion. ETV6-IgH is a new potential surrogate marker of PCNSL with favorable prognosis with ETV6 haploinsuffiency as a possible mechanism. The potential clinical impact of ETV6-IgH should be validated in larger prospective studies. © The Author(s) 2018. Published by Oxford University Press on behalf of the Society for Neuro-Oncology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

Detection of 22 common leukemic fusion genes using a single-step multiplex qRT-PCR-based assay.

PubMed

Lyu, Xiaodong; Wang, Xianwei; Zhang, Lina; Chen, Zhenzhu; Zhao, Yu; Hu, Jieying; Fan, Ruihua; Song, Yongping

2017-07-25

Fusion genes generated from chromosomal translocation play an important role in hematological malignancies. Detection of fusion genes currently employ use of either conventional RT-PCR methods or fluorescent in situ hybridization (FISH), where both methods involve tedious methodologies and require prior characterization of chromosomal translocation events as determined by cytogenetic analysis. In this study, we describe a real-time quantitative reverse transcription PCR (qRT-PCR)-based multi-fusion gene screening method with the capacity to detect 22 fusion genes commonly found in leukemia. This method does not require pre-characterization of gene translocation events, thereby facilitating immediate diagnosis and therapeutic management. We performed fluorescent qRT-PCR (F-qRT-PCR) using a commercially-available multi-fusion gene detection kit on a patient cohort of 345 individuals comprising 108 cases diagnosed with acute myeloid leukemia (AML) for initial evaluation; remaining patients within the cohort were assayed for confirmatory diagnosis. Results obtained by F-qRT-PCR were compared alongside patient analysis by cytogenetic characterization. Gene translocations detected by F-qRT-PCR in AML cases were diagnosed in 69.4% of the patient cohort, which was comparatively similar to 68.5% as diagnosed by cytogenetic analysis, thereby demonstrating 99.1% concordance. Overall gene fusion was detected in 53.7% of the overall patient population by F-qRT-PCR, 52.9% by cytogenetic prediction in leukemia, and 9.1% in non-leukemia patients by both methods. The overall concordance rate was calculated to be 99.0%. Fusion genes were detected by F-qRT-PCR in 97.3% of patients with CML, followed by 69.4% with AML, 33.3% with acute lymphoblastic leukemia (ALL), 9.1% with myelodysplastic syndromes (MDS), and 0% with chronic lymphocytic leukemia (CLL). We describe the use of a F-qRT-PCR-based multi-fusion gene screening method as an efficient one-step diagnostic procedure as an effective alternative to lengthy conventional diagnostic procedures requiring both cytogenetic analysis followed by targeted quantitative reverse transcription (qRT-PCR) methods, thus allowing timely patient management.

DNA inversion within the apolipoproteins AI/CIII/AIV-encoding gene cluster of certain patients with premature atherosclerosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Karathanasis, S.K.; Ferris, E.; Haddad, I.A.

1987-10-01

The genes coding for apolipoproteins (apo) AI, CIII, and AIV, designated APOA1, APOC3, and APOA4, respectively, are closely linked and tandemly organized in the long arm of the human chromosome 11. A DNA rearrangement involving the genes encoding apoAI and apoCIII in certain patients with premature atherosclerosis has been associated with deficiency of both apoAI and apoCIII in the plasma of these patients. Structural characterization of the genes for apoAI and apoCIII in one of these patients indicates that this rearrangement consists of a DNA inversion containing portions of the 3' ends of the apoAI and apoCIII genes, including themore » DNA region between these genes. The breakpoints of this DNA inversion are located within the fourth exon of the apoAI gene and the first intron of the apoCIII gene. Thus, this DNA inversion results in reciprocal fusion of the apoAI and apoCIII gene transcriptional units. Expression of these gene fusions in cultured mammalian cells results in stable mRNA transcripts with sequences representing fusions of the apoAI and apoCIII mRNAs. These results indicate that absence of transcripts with correct apoAI and apoCIII mRNA sequences causes apoAI and apoCIII deficiency in the plasma of these patients and suggest that these apolipoproteins are involved in cholesterol homeostasis and protection against premature atherosclerosis.« less

Automated Discovery of Long Intergenic RNAs Associated with Breast Cancer Progression

DTIC Science & Technology

2012-02-01

manuscript in preparation), (2) development and publication of an algorithm for detecting gene fusions in RNA-Seq data [1], and (3) discovery of outlier long...subjected to de novo assembly algorithms to discover novel transcripts representing either unannotated genes or novel somatic mutations such as gene...fusions. To this end the P.I. developed and published a novel algorithm called ChimeraScan to facilitate the discovery and validation of gene

Comprehensive characterization of RSPO fusions in colorectal traditional serrated adenomas.

PubMed

Sekine, Shigeki; Ogawa, Reiko; Hashimoto, Taiki; Motohiro, Kojima; Yoshida, Hiroshi; Taniguchi, Hirokazu; Saito, Yutaka; Yasuhiro, Ohno; Ochiai, Atsushi; Hiraoka, Nobuyoshi

2017-10-01

Traditional serrated adenoma (TSA) is a rare but distinct type of colorectal polyp. Our previous study showed that PTPRK-RSPO3 fusions are frequent and characteristic genetic alterations in TSAs. This study aimed to characterize comprehensively the prevalence and variability of RSPO fusions in colorectal TSAs. We examined RSPO expression and explored novel RSPO fusions in 129 TSAs, including 66 lesions analysed previously for WNT pathway gene mutations. Quantitative polymerase chain reaction (qPCR) analyses identified three and 43 TSAs overexpressing RSPO2 and RSPO3, respectively, whereas the expression of RSPO1 and RSPO4 was marginal or undetectable in all cases. RSPO overexpression was always mutually exclusive with other WNT pathway gene mutations. Known PTPRK-RSPO3 fusions were detected in 37 TSAs, all but one of which overexpressed RSPO3. In addition, rapid amplification of cDNA ends revealed three novel RSPO fusion transcripts, an NRIP1-RSPO2 fusion and two PTPRK-RSPO3 fusion isoforms, in six TSAs. Overall, 43 TSAs had RSPO fusions (33%), whereas four TSAs (3%) overexpressed RSPO in the absence of RSPO fusions. TSAs with RSPO fusions showed several clinicopathological features, including distal localization (P = 0.0063), larger size (P = 0.0055), prominent ectopic crypt foci (P = 8.4 × 10 -4 ), association of a high-grade component (P = 1.1 × 10 -4 ), and the presence of KRAS mutations (P = 4.5 × 10 -5 ). The present study identified RSPO fusion transcripts, including three novel transcripts, in one-third of colorectal TSAs and showed that PTPRK-RSPO3 fusions were the predominant cause of RSPO overexpression in colorectal TSA. © 2017 John Wiley & Sons Ltd.

Inversion-mediated gene fusions involving NAB2-STAT6 in an unusual malignant meningioma.

PubMed

Gao, F; Ling, C; Shi, L; Commins, D; Zada, G; Mack, W J; Wang, K

2013-08-20

Meningiomas are the most common primary intracranial tumours, with ∼3% meeting current histopathologic criteria for malignancy. In this study, we explored the transcriptome of meningiomas using RNA-Seq. Inversion-mediated fusions between two adjacent genes, NAB2 and STAT6, were detected in one malignant tumour, creating two novel in-frame transcripts that were validated by RT-PCR and Sanger sequencing. Gene fusions of NAB2-STAT6 were recently implicated in the pathogenesis of solitary fibrous tumours; our study suggested that similar fusions may also have a role in a malignant meningioma with unusual histopathologic features.

Decoding of exon splicing patterns in the human RUNX1-RUNX1T1 fusion gene.

PubMed

Grinev, Vasily V; Migas, Alexandr A; Kirsanava, Aksana D; Mishkova, Olga A; Siomava, Natalia; Ramanouskaya, Tatiana V; Vaitsiankova, Alina V; Ilyushonak, Ilia M; Nazarov, Petr V; Vallar, Laurent; Aleinikova, Olga V

2015-11-01

The t(8;21) translocation is the most widespread genetic defect found in human acute myeloid leukemia. This translocation results in the RUNX1-RUNX1T1 fusion gene that produces a wide variety of alternative transcripts and influences the course of the disease. The rules of combinatorics and splicing of exons in the RUNX1-RUNX1T1 transcripts are not known. To address this issue, we developed an exon graph model of the fusion gene organization and evaluated its local exon combinatorics by the exon combinatorial index (ECI). Here we show that the local exon combinatorics of the RUNX1-RUNX1T1 gene follows a power-law behavior and (i) the vast majority of exons has a low ECI, (ii) only a small part is represented by "exons-hubs" of splicing with very high ECI values, and (iii) it is scale-free and very sensitive to targeted skipping of "exons-hubs". Stochasticity of the splicing machinery and preferred usage of exons in alternative splicing can explain such behavior of the system. Stochasticity may explain up to 12% of the ECI variance and results in a number of non-coding and unproductive transcripts that can be considered as a noise. Half-life of these transcripts is increased due to the deregulation of some key genes of the nonsense-mediated decay system in leukemia cells. On the other hand, preferred usage of exons may explain up to 75% of the ECI variability. Our analysis revealed a set of splicing-related cis-regulatory motifs that can explain "attractiveness" of exons in alternative splicing but only when they are considered together. Cis-regulatory motifs are guides for splicing trans-factors and we observed a leukemia-specific profile of expression of the splicing genes in t(8;21)-positive blasts. Altogether, our results show that alternative splicing of the RUNX1-RUNX1T1 transcripts follows strict rules and that the power-law component of the fusion gene organization confers a high flexibility to this process. Copyright © 2015 Elsevier Ltd. All rights reserved.

A rapid and efficient newly established method to detect COL1A1-PDGFB gene fusion in dermatofibrosarcoma protuberans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yokoyama, Yoko; Shimizu, Akira; Okada, Etsuko

Highlights: Black-Right-Pointing-Pointer We developed new method to rapidly identify COL1A1-PDGFB fusion in DFSP. Black-Right-Pointing-Pointer New PCR method using a single primer pair detected COL1A1-PDGFB fusion in DFSP. Black-Right-Pointing-Pointer This is the first report of DFSP with a novel COL1A1 breakpoint in exon 5. -- Abstract: The detection of fusion transcripts of the collagen type 1{alpha}1 (COL1A1) and platelet-derived growth factor-BB (PDGFB) genes by genetic analysis has recognized as a reliable and valuable molecular tool for the diagnosis of dermatofibrosarcoma protuberans (DFSP). To detect the COL1A1-PDGFB fusion, almost previous reports performed reverse transcription polymerase chain reaction (RT-PCR) using multiplex forward primersmore » from COL1A1. However, it has possible technical difficulties with respect to the handling of multiple primers and reagents in the procedure. The objective of this study is to establish a rapid, easy, and efficient one-step method of PCR using only a single primer pair to detect the fusion transcripts of the COL1A1 and PDGFB in DFSP. To validate new method, we compared the results of RT-PCR in five patients of DFSP between the previous method using multiplex primers and our established one-step RT-PCR using a single primer pair. In all cases of DFSP, the COL1A1-PDGFB fusion was detected by both previous method and newly established one-step PCR. Importantly, we detected a novel COL1A1 breakpoint in exon 5. The newly developed method is valuable to rapidly identify COL1A1-PDGFB fusion transcripts in DFSP.« less

Genetics in methylotrophic bacteria: Appendix. Final report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lidstrom, M.E.

This research has focused primarily on promoters in Methylobacterium extorquens AM1 and in methanotrophic bacteria. In Methylobacterium extorquens work continued on the moxF promoter. The author constructed chromosomal lacZ fusions of this promoter to avoid the regulation problems of plasmid-borne fragments and has shown that this is regulated normally in the chromosome. She has constructed lacZ fusions to some of the mox genes involved in the synthesis of the cofactor, PQQ, in order to carry out similar analysis of transcription of PQQ genes. The author has continued to isolate mox genes in methanotrophs for the purpose of studying their promotersmore » and transcriptional regulation.« less

Signaling networks in TMPRSS2-ERG positive prostate cancers: Do we need a Pied Piper or sharpshooter to deal with "at large" fused oncoprotein.

PubMed

Lin, X; Qureshi, M Z; Romero, M A; Yaylim, I; Arif, S; Ucak, I; Fayyaz, S; Farooqi, A A; Mansoor, Q; Ismail, M

2017-02-28

Overwhelmingly increasing scientific evidence has provided near complete resolution of prostate cancer landscape and it is now more understandable that wide ranging factors underlies its development and progression. Increasingly it is being realized that genetic/epigenetic factors, Intra-tumoral and inter-tumoral heterogeneity, loss of apoptosis, dysregulations of spatio-temporally controlled signaling cascades, Darwinian evolution in response to therapeutic pressures play instrumental role in prostate carcinogenesis. Moreover, multi-directional patterns of spread between primary tumors and metastatic sites have also been studied extensively in prostate cancer. Research over the years has gradually and systematically revealed closer association between tumor phenotype and type of gene fusion. Latest developments in deep sequencing technologies have shown that gene fusions originate in a non-random, cell type dependent manner and are much more frequent than previously surmised. These findings enabled sub-classification and categorization of seemingly identical diseases. Furthermore, research methodologies have shown that many gene fusions inform us about risk stratification and many chimeric proteins encoded by the fused genes are being studied as drug target/s. We partition this multi-component review into the molecular basis of formation of fusion transcripts, how protein network is regulated in fusion positive prostate cancer cells and therapeutic strategies which are currently being investigated to efficiently target fusion transcript and its protein product.

Establishment of an ASPL-TFE3 renal cell carcinoma cell line (S-TFE).

PubMed

Hirobe, Megumi; Masumori, Naoya; Tanaka, Toshiaki; Kitamura, Hiroshi; Tsukamoto, Taiji

2013-06-01

Xp11 translocation renal cell carcinoma is a rare disease diagnosed in children and adolescents in the advanced stage with an aggressive clinical course. Various gene fusions including the transcription factor E3 (TFE3) gene located on chromosome X cause the tumor. We established an Xp11 translocation renal cell carcinoma cell line from a renal tumor in a 18-y-old Japanese female and named it "S-TFE." The cell line and its xenograft demonstrated definite gene fusion including TFE3. They showed strong nuclear staining for TFE3 in immunohistochemistry, TFE3 gene rearrangement in dual-color, break-apart FISH analysis and ASPL-TFE3 type 1 fusion transcripts detected by RT-PCR and direct DNA sequencing. Although many renal cell carcinoma cell lines have been established and investigated, only a few cell lines are recognized as Xp11.2 translocation carcinoma. S-TFE will be useful to examine the characteristics and drug susceptibility of Xp11 translocation renal cell carcinoma.

Establishment of an ASPL-TFE3 renal cell carcinoma cell line (S-TFE)

PubMed Central

Hirobe, Megumi; Masumori, Naoya; Tanaka, Toshiaki; Kitamura, Hiroshi; Tsukamoto, Taiji

2013-01-01

Xp11 translocation renal cell carcinoma is a rare disease diagnosed in children and adolescents in the advanced stage with an aggressive clinical course. Various gene fusions including the transcription factor E3 (TFE3) gene located on chromosome X cause the tumor. We established an Xp11 translocation renal cell carcinoma cell line from a renal tumor in a 18-y-old Japanese female and named it “S-TFE.” The cell line and its xenograft demonstrated definite gene fusion including TFE3. They showed strong nuclear staining for TFE3 in immunohistochemistry, TFE3 gene rearrangement in dual-color, break-apart FISH analysis and ASPL-TFE3 type 1 fusion transcripts detected by RT-PCR and direct DNA sequencing. Although many renal cell carcinoma cell lines have been established and investigated, only a few cell lines are recognized as Xp11.2 translocation carcinoma. S-TFE will be useful to examine the characteristics and drug susceptibility of Xp11 translocation renal cell carcinoma. PMID:23760492

Environmental conditions affect transcription of the pectinase genes of Erwinia chrysanthemi 3937.

PubMed Central

Hugouvieux-Cotte-Pattat, N; Dominguez, H; Robert-Baudouy, J

1992-01-01

To depolymerize plant pectin, the phytopathogenic enterobacterium Erwinia chrysanthemi produces a series of enzymes which include a pectin-methyl-esterase encoded by the pem gene and five isoenzymes of pectate lyases encoded by the five genes pelA, pelB, pelC, pelD, and pelE. We have constructed transcriptional fusions between the pectinase gene promoters and the uidA gene, encoding beta-glucuronidase, to study the regulation of these E. chrysanthemi pectinase genes individually. The transcription of the pectinase genes is dependent on many environmental conditions. All the fusions were induced by pectic catabolic products and responded, to different degrees, to growth phase, catabolite repression, temperature, and nitrogen starvation. Transcription of pelA, pelD, and pelE was also increased in anaerobic growth conditions. High osmolarity of the culture medium increased expression of pelE but decreased that of pelD; the other pectinase genes were not affected. The level of expression of each gene was different. Transcription of pelA was very low under all growth conditions. The expression of the pelB, pelC, and pem genes was intermediate. The pelE gene had a high basal level of expression. Expression of pelD was generally the most affected by changes in culture conditions and showed a low basal level but very high induced levels. These differences in the expression of the pectinase genes of E. chrysanthemi 3937 presumably reflect their role during infection of plants, because the degradation of pectic polymers of the plant cell walls is the main determinant of tissue maceration caused by soft rot erwiniae. PMID:1447147

Differential transactivation by orphan nuclear receptor NOR1 and its fusion gene product EWS/NOR1: possible involvement of poly(ADP-ribose) polymerase I, PARP-1.

PubMed

Ohkura, Naganari; Nagamura, Yuko; Tsukada, Toshihiko

2008-10-15

In extraskeletal myxoid chondrosarcoma, a chromosomal translocation creates a gene fusion between EWS and an orphan nuclear receptor, NOR1. The resulting fusion protein EWS/NOR1 has been believed to lead to malignant transformation by functioning as a transactivator for NOR1-target genes. By comparing the gene expression profiles of NOR1- and EWS/NOR1-overexpressing cells, we found that they largely shared up-regulated genes, but no significant correlation was observed with respect to the transactivation levels of each gene. In addition, the proteins associated with NOR1 and EWS/NOR1 were mostly the same in these cells. The results suggest that these proteins differentially transactivate overlapping target genes through a similar transcriptional machinery. To clarify the mechanisms underlying the transcriptional divergence between NOR1 and EWS/NOR1, we searched for alternatively associated proteins, and identified poly(ADP-ribose) polymerase I (PARP-1) as an NOR1-specific binding protein. Consistent with its binding properties, PARP-1 acted as a transcriptional repressor of NOR1, but not EWS/NOR1, in a luciferase reporter assay employing PARP-1(-/-) fibroblasts. Interestingly, suppressive activity of PARP-1 was observed in a DNA response element-specific manner, and in a subtype-specific manner toward the NR4A family (Nur77, Nurr1, and NOR1), suggesting that PARP-1 plays a role in the diversity of transcriptional regulation mediated by the NR4A family in normal cells. Altogether, our findings suggest that NOR1 and EWS/NOR1 regulate overlapping target genes differently by utilizing associated proteins, including PARP-1; and that EWS/NOR1 may acquire oncogenic activities by avoiding (or gaining) transcription factor-specific modulation by the associated proteins. (c) 2008 Wiley-Liss, Inc.

RNA sequencing of esophageal adenocarcinomas identifies novel fusion transcripts, including NPC1-MELK, arising from a complex chromosomal rearrangement.

PubMed

Wang, Zhixiong; Cheng, Yulan; Abraham, John M; Yan, Rong; Liu, Xi; Chen, Wei; Ibrahim, Sariat; Schroth, Gary P; Ke, Xiquan; He, Yulong; Meltzer, Stephen J

2017-10-15

Studies of chromosomal rearrangements and fusion transcripts have elucidated mechanisms of tumorigenesis and led to targeted cancer therapies. This study was aimed at identifying novel fusion transcripts in esophageal adenocarcinoma (EAC). To identify new fusion transcripts associated with EAC, targeted RNA sequencing and polymerase chain reaction (PCR) verification were performed in 40 EACs and matched nonmalignant specimens from the same patients. Genomic PCR and Sanger sequencing were performed to find the breakpoint of fusion genes. Five novel in-frame fusion transcripts were identified and verified in 40 EACs and in a validation cohort of 15 additional EACs (55 patients in all): fibroblast growth factor receptor 2 (FGFR2)-GRB2-associated binding protein 2 (GAB2) in 2 of 55 or 3.6%, Niemann-Pick C1 (NPC1)-maternal embryonic leucine zipper kinase (MELK) in 2 of 55 or 3.6%, ubiquitin-specific peptidase 54 (USP54)-calcium/calmodulin dependent protein kinase II γ (CAMK2G) in 2 of 55 or 3.6%, megakaryoblastic leukemia (translocation) 1 (MKL1)-fibulin 1 (FBLN1) in 1 of 55 or 1.8%, and CCR4-NOT transcription complex subunit 2 (CNOT2)-chromosome 12 open reading frame 49 (C12orf49) in 1 of 55 or 1.8%. A genomic analysis indicated that NPC1-MELK arose from a complex interchromosomal translocation event involving chromosomes 18, 3, and 9 with 3 rearrangement points, and this was consistent with chromoplexy. These data indicate that fusion transcripts occur at a stable frequency in EAC. Furthermore, our results indicate that chromoplexy is an underlying mechanism that generates fusion transcripts in EAC. These and other fusion transcripts merit further study as diagnostic markers and potential therapeutic targets in EAC. Cancer 2017;123:3916-24. © 2017 American Cancer Society. © 2017 American Cancer Society.

Organization of tcp, acf, and toxT genes within a ToxT-dependent operon.

PubMed

Brown, R C; Taylor, R K

1995-05-01

The toxin coregulated pilus (TCP) is required for Vibrio cholerae to colonize the human intestine. The expression of the pilin gene, tcpA, is dependent upon ToxR and upon ToxT. The toxT gene was recently mapped within the TCP biogenesis gene cluster and shown to be capable of activating a tcpA::TnphoA fusion when cloned in Escherichia coli. In this study, we determined that ToxR/ToxT activation occurs at the level of tcpA transcription. ToxT expressed in E. coli could activate a tcp operon fusion, while ToxR, ToxR with ToxS, or a ToxR-PhoA fusion failed to activate the tcp operon fusion and we could not demonstrate binding of a ToxR extract to the tcpA promoter region in DNA mobility-shift assays. The start site for the regulated promoter was shown by primer extension to lie 75 bp upstream of the first codon of tcpA. An 800-base tcpA message was identified, by Northern analysis, that correlates by size to the distance between the transcriptional start and a hairpin-loop sequence between tcpA and tcpB. The more-sensitive assay of RNase protection analysis demonstrated that a regulated transcript probably extends through the rest of the downstream tcp genes, including toxT and the adjacent accessory colonization factor (acf) genes. An in-frame tcpA deletion, but not a polar tcpA::TnphoA fusion, could be complemented for pilus surface expression by providing tcpA in trans. This evidence suggests that the tcp genes, including toxT, are organized in an operon directly activated by ToxT in a ToxR-dependent manner. Most of the toxT expression under induced conditions requires transcription of the tcpA promoter. Further investigation of how tcp::TnphoA insertions that are polar on toxT expression retain regulation showed that a low basal level of toxT expression is present in toxR and tcp::TnphoA strains. Overall, these observations support the ToxR/ToxT cascade of regulation for tcp. Once induced, toxT expression becomes autoregulatory via the tcp promoter, linking tcp expression to that of additional colonization factors, exotoxin production, and genes of unknown function in cholera pathogenesis.

A Multiplexed Amplicon Approach for Detecting Gene Fusions by Next-Generation Sequencing.

PubMed

Beadling, Carol; Wald, Abigail I; Warrick, Andrea; Neff, Tanaya L; Zhong, Shan; Nikiforov, Yuri E; Corless, Christopher L; Nikiforova, Marina N

2016-03-01

Chromosomal rearrangements that result in oncogenic gene fusions are clinically important drivers of many cancer types. Rapid and sensitive methods are therefore needed to detect a broad range of gene fusions in clinical specimens that are often of limited quantity and quality. We describe a next-generation sequencing approach that uses a multiplex PCR-based amplicon panel to interrogate fusion transcripts that involve 19 driver genes and 94 partners implicated in solid tumors. The panel also includes control assays that evaluate the 3'/5' expression ratios of 12 oncogenic kinases, which might be used to infer gene fusion events when the partner is unknown or not included on the panel. There was good concordance between the solid tumor fusion gene panel and other methods, including fluorescence in situ hybridization, real-time PCR, Sanger sequencing, and other next-generation sequencing panels, because 40 specimens known to harbor gene fusions were correctly identified. No specific fusion reads were observed in 59 fusion-negative specimens. The 3'/5' expression ratio was informative for fusions that involved ALK, RET, and NTRK1 but not for BRAF or ROS1 fusions. However, among 37 ALK or RET fusion-negative specimens, four exhibited elevated 3'/5' expression ratios, indicating that fusions predicted solely by 3'/5' read ratios require confirmatory testing. Copyright © 2016 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

Detection of Echinoderm Microtubule Associated Protein Like 4-Anaplastic Lymphoma Kinase Fusion Genes in Non-small Cell Lung Cancer Clinical Samples by a Real-time Quantitative Reverse Transcription Polymerase Chain Reaction Method.

PubMed

Zhao, Jing; Zhao, Jin-Yin; Chen, Zhi-Xia; Zhong, Wei; Li, Long-Yun; Liu, Li-Cheng; Hu, Xiao-Xu; Chen, Wei-Jun; Wang, Meng-Zhao

2016-12-20

Objective To establish a real-time quantitative reverse transcription polymerase chain reaction assay (qRT-PCR) for the rapid, sensitive, and specific detection of echinoderm microtubule associated protein like 4-anaplastic lymphoma kinase (EML4-ALK) fusion genes in non-small cell lung cancer. Methods The specific primers for the four variants of EML4-ALK fusion genes (V1, V2, V3a, and V3b) and Taqman fluorescence probes for the detection of the target sequences were carefully designed by the Primer Premier 5.0 software. Then, using pseudovirus containing EML4-ALK fusion genes variants (V1, V2, V3a, and V3b) as the study objects, we further analyzed the lower limit, sensitivity, and specificity of this method. Finally, 50 clinical samples, including 3 ALK-fluorescence in situ hybridization (FISH) positive specimens, were collected and used to detect EML4-ALK fusion genes using this method. Results The lower limit of this method for the detection of EML4-ALK fusion genes was 10 copies/μl if no interference of background RNA existed. Regarding the method's sensitivity, the detection resolution was as high as 1% and 0.5% in the background of 500 and 5000 copies/μl wild-type ALK gene, respectively. Regarding the method's specificity, no non-specific amplification was found when it was used to detect EML4-ALK fusion genes in leukocyte and plasma RNA samples from healthy volunteers. Among the 50 clinical samples, 47 ALK-FISH negative samples were also negative. Among 3 ALK-FISH positive samples, 2 cases were detected positive using this method, but another was not detected because of the failure of RNA extraction. Conclusion The proposed qRT-PCR assay for the detection of EML4-ALK fusion genes is rapid, simple, sensitive, and specific, which is deserved to be validated and widely used in clinical settings.

Transgenic mouse model harboring the transcriptional fusion ccl20-luciferase as a novel reporter of pro-inflammatory response.

PubMed

Crispo, Martina; Van Maele, Laurye; Tabareau, Julien; Cayet, Delphine; Errea, Agustina; Ferreira, Ana María; Rumbo, Martin; Sirard, Jean Claude

2013-01-01

The chemokine CCL20, the unique ligand of CCR6 functions as an attractant of immune cells. Expression of CCL20 is induced by Toll-like Receptor (TLR) signaling or proinflammatory cytokine stimulation. However CCL20 is also constitutively produced at specific epithelial sites of mucosa. This expression profile is achieved by transcriptional regulation. In the present work we characterized regulatory features of mouse Ccl20 gene. Transcriptional fusions between the mouse Ccl20 promoter and the firefly luciferase (luc) encoding gene were constructed and assessed in in vitro and in vivo assays. We found that liver CCL20 expression and luciferase activity were upregulated by systemic administration of the TLR5 agonist flagellin. Using shRNA and dominant negative form specific for mouse TLR5, we showed that this expression was controlled by TLR5. To address in situ the regulation of gene activity, a transgenic mouse line harboring a functional Ccl20-luc fusion was generated. The luciferase expression was highly concordant with Ccl20 expression in different tissues. Our data indicate that the transgenic mouse model can be used to monitor activation of innate response in vivo.

Transgenic Mouse Model Harboring the Transcriptional Fusion Ccl20-Luciferase as a Novel Reporter of Pro-Inflammatory Response

PubMed Central

Crispo, Martina; Van Maele, Laurye; Tabareau, Julien; Cayet, Delphine; Errea, Agustina; Ferreira, Ana María; Rumbo, Martin; Sirard, Jean Claude

2013-01-01

The chemokine CCL20, the unique ligand of CCR6 functions as an attractant of immune cells. Expression of CCL20 is induced by Toll-like Receptor (TLR) signaling or proinflammatory cytokine stimulation. However CCL20 is also constitutively produced at specific epithelial sites of mucosa. This expression profile is achieved by transcriptional regulation. In the present work we characterized regulatory features of mouse Ccl20 gene. Transcriptional fusions between the mouse Ccl20 promoter and the firefly luciferase (luc) encoding gene were constructed and assessed in in vitro and in vivo assays. We found that liver CCL20 expression and luciferase activity were upregulated by systemic administration of the TLR5 agonist flagellin. Using shRNA and dominant negative form specific for mouse TLR5, we showed that this expression was controlled by TLR5. To address in situ the regulation of gene activity, a transgenic mouse line harboring a functional Ccl20-luc fusion was generated. The luciferase expression was highly concordant with Ccl20 expression in different tissues. Our data indicate that the transgenic mouse model can be used to monitor activation of innate response in vivo. PMID:24265691

Colorimetric TMPRSS2-ERG Gene Fusion Detection in Prostate Cancer Urinary Samples via Recombinase Polymerase Amplification.

PubMed

Koo, Kevin M; Wee, Eugene J H; Trau, Matt

2016-01-01

TMPRSS2 (Exon 1)-ERG (Exon 4) is the most frequent gene fusion event in prostate cancer (PC), and is highly PC-specific unlike the current serum prostate specific antigen (PSA) biomarker. However, TMPRSS2-ERG levels are currently measured with quantitative reverse-transcription PCR (RT-qPCR) which is time-consuming and requires costly equipment, thus limiting its use in clinical diagnostics. Herein, we report a novel rapid, cost-efficient and minimal-equipment assay named "FusBLU" for detecting TMPRSS2-ERG gene fusions from urine. TMPRSS2-ERG mRNA was amplified by isothermal reverse transcription-recombinase polymerase amplification (RT-RPA), magnetically-isolated, and detected through horseradish peroxidase (HRP)-catalyzed colorimetric reaction. FusBLU was specific for TMPRSS2-ERG mRNA with a low visual detection limit of 10(5) copies. We also demonstrated assay readout versatility on 3 potentially useful platforms. The colorimetric readout was detectable by naked eye for a quick yes/no evaluation of gene fusion presence. On the other hand, a more quantitative TMPRSS2-ERG detection was achievable by absorbance/electrochemical measurements. FusBLU was successfully applied to 12 urinary samples and results were validated by gold-standard RT-qPCR. We also showed that sediment RNA was likely the main source of TMPRSS2-ERG mRNA in urinary samples. We believe that our assay is a potential clinical screening tool for PC and could also have wide applications for other disease-related fusion genes.

The Transcriptional Response to Nonself in the Fungus Podospora anserina

PubMed Central

Bidard, Frédérique; Clavé, Corinne; Saupe, Sven J.

2013-01-01

In fungi, heterokaryon incompatibility is a nonself recognition process occurring when filaments of different isolates of the same species fuse. Compatibility is controlled by so-called het loci and fusion of strains of unlike het genotype triggers a complex incompatibility reaction that leads to the death of the fusion cell. Herein, we analyze the transcriptional changes during the incompatibility reaction in Podospora anserina. The incompatibility response was found to be associated with a massive transcriptional reprogramming: 2231 genes were up-regulated by a factor 2 or more during incompatibility. In turn, 2441 genes were down-regulated. HET, NACHT, and HeLo domains previously found to be involved in the control of heterokaryon incompatibility were enriched in the up-regulated gene set. In addition, incompatibility was characterized by an up-regulation of proteolytic and other hydrolytic activities, of secondary metabolism clusters and toxins and effector-like proteins. The up-regulated set was found to be enriched for proteins lacking orthologs in other species and chromosomal distribution of the up-regulated genes was uneven with up-regulated genes residing preferentially in genomic islands and on chromosomes IV and V. There was a significant overlap between regulated genes during incompatibility in P. anserina and Neurospora crassa, indicating similarities in the incompatibility responses in these two species. Globally, this study illustrates that the expression changes occurring during cell fusion incompatibility in P. anserina are in several aspects reminiscent of those described in host-pathogen or symbiotic interactions in other fungal species. PMID:23589521

Fusion gene addiction: can tumours be forced to give up the habit?

PubMed

Selfe, Joanna L; Shipley, Janet

2017-07-01

Fusion of genes in tumours can have oncogenic roles in reprogramming cells through overexpression of oncogenes or the production of novel fusion proteins. A fundamental question in cancer biology is what genetic events are critical for initiation and whether these are also required for cancer progression. In recent work published in The Journal of Pathology, dependency on a fusion protein was addressed using a model of alveolar rhabdomyosarcomas - a sarcoma subtype with frequent fusion of PAX3 and FOXO1 genes that is associated with poor outcome. PAX3-FOXO1 encodes a potent transcription factor that together with MYCN alters the transcriptional landscape of cells. Building on previous work, an inducible model in human myoblast cells was used to show that PAX3-FOXO1 and MYCN can initiate rhabdomyosarcoma development but, contrary to current thinking, tumour recurrences occasionally arose independent of the fusion protein. Further work needs to identify the molecular nature of this independence and assess any relevance in human tumours. Such functional approaches are required together with computational modeling of molecular data to unravel spatial and temporal dependencies on specific genetic events. This may support molecular prognostic markers and therapeutic targets. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

Genomic analysis of fibrolamellar hepatocellular carcinoma.

PubMed

Xu, Lei; Hazard, Florette K; Zmoos, Anne-Flore; Jahchan, Nadine; Chaib, Hassan; Garfin, Phillip M; Rangaswami, Arun; Snyder, Michael P; Sage, Julien

2015-01-01

Pediatric tumors are relatively infrequent, but are often associated with significant lethality and lifelong morbidity. A major goal of pediatric cancer research has been to identify key drivers of tumorigenesis to eventually develop targeted therapies to enhance cure rate and minimize acute and long-term toxic effects. Here, we used genomic approaches to identify biomarkers and candidate drivers for fibrolamellar hepatocellular carcinoma (FL-HCC), a very rare subtype of pediatric liver cancer for which limited therapeutic options exist. In-depth genomic analyses of one tumor followed by immunohistochemistry validation on seven other tumors showed expression of neuroendocrine markers in FL-HCC. DNA and RNA sequencing data further showed that common cancer pathways are not visibly altered in FL-HCC but identified two novel structural variants, both resulting in fusion transcripts. The first, a 400 kb deletion, results in a DNAJB1-PRKCA fusion transcript, which leads to increased cAMP-dependent protein kinase (PKA) activity in the index tumor case and other FL-HCC cases compared with normal liver. This PKA fusion protein is oncogenic in HCC cells. The second gene fusion event, a translocation between the CLPTM1L and GLIS3 genes, generates a transcript whose product also promotes cancer phenotypes in HCC cell lines. These experiments further highlight the tumorigenic role of gene fusions in the etiology of pediatric solid tumors and identify both candidate biomarkers and possible therapeutic targets for this lethal pediatric disease. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

FARE-CAFE: a database of functional and regulatory elements of cancer-associated fusion events.

PubMed

Korla, Praveen Kumar; Cheng, Jack; Huang, Chien-Hung; Tsai, Jeffrey J P; Liu, Yu-Hsuan; Kurubanjerdjit, Nilubon; Hsieh, Wen-Tsong; Chen, Huey-Yi; Ng, Ka-Lok

2015-01-01

Chromosomal translocation (CT) is of enormous clinical interest because this disorder is associated with various major solid tumors and leukemia. A tumor-specific fusion gene event may occur when a translocation joins two separate genes. Currently, various CT databases provide information about fusion genes and their genomic elements. However, no database of the roles of fusion genes, in terms of essential functional and regulatory elements in oncogenesis, is available. FARE-CAFE is a unique combination of CTs, fusion proteins, protein domains, domain-domain interactions, protein-protein interactions, transcription factors and microRNAs, with subsequent experimental information, which cannot be found in any other CT database. Genomic DNA information including, for example, manually collected exact locations of the first and second break points, sequences and karyotypes of fusion genes are included. FARE-CAFE will substantially facilitate the cancer biologist's mission of elucidating the pathogenesis of various types of cancer. This database will ultimately help to develop 'novel' therapeutic approaches. Database URL: http://ppi.bioinfo.asia.edu.tw/FARE-CAFE. © The Author(s) 2015. Published by Oxford University Press.

FARE-CAFE: a database of functional and regulatory elements of cancer-associated fusion events

PubMed Central

Korla, Praveen Kumar; Cheng, Jack; Huang, Chien-Hung; Tsai, Jeffrey J. P.; Liu, Yu-Hsuan; Kurubanjerdjit, Nilubon; Hsieh, Wen-Tsong; Chen, Huey-Yi; Ng, Ka-Lok

2015-01-01

Chromosomal translocation (CT) is of enormous clinical interest because this disorder is associated with various major solid tumors and leukemia. A tumor-specific fusion gene event may occur when a translocation joins two separate genes. Currently, various CT databases provide information about fusion genes and their genomic elements. However, no database of the roles of fusion genes, in terms of essential functional and regulatory elements in oncogenesis, is available. FARE-CAFE is a unique combination of CTs, fusion proteins, protein domains, domain–domain interactions, protein–protein interactions, transcription factors and microRNAs, with subsequent experimental information, which cannot be found in any other CT database. Genomic DNA information including, for example, manually collected exact locations of the first and second break points, sequences and karyotypes of fusion genes are included. FARE-CAFE will substantially facilitate the cancer biologist’s mission of elucidating the pathogenesis of various types of cancer. This database will ultimately help to develop ‘novel’ therapeutic approaches. Database URL: http://ppi.bioinfo.asia.edu.tw/FARE-CAFE PMID:26384373

The significance of alternative transcripts for Caenorhabditis elegans transcription factor genes, based on expression pattern analysis

PubMed Central

2013-01-01

Background Sequence-specific DNA-binding proteins, with their paramount importance in the regulation of expression of the genetic material, are encoded by approximately 5% of the genes in an animal’s genome. But it is unclear to what extent alternative transcripts from these genes may further increase the complexity of the transcription factor complement. Results Of the 938 potential C. elegans transcription factor genes, 197 were annotated in WormBase as encoding at least two distinct isoforms. Evaluation of prior evidence identified, with different levels of confidence, 50 genes with alternative transcript starts, 23 with alternative transcript ends, 35 with alternative splicing and 34 with alternative transcripts generated by a combination of mechanisms, leaving 55 that were discounted. Expression patterns were determined for transcripts for a sample of 29 transcription factor genes, concentrating on those with alternative transcript starts for which the evidence was strongest. Seamless fosmid recombineering was used to generate reporter gene fusions with minimal modification to assay expression of specific transcripts while maintaining the broad genomic DNA context and alternative transcript production. Alternative transcription factor gene transcripts were typically expressed with identical or substantially overlapping distributions rather than in distinct domains. Conclusions Increasingly sensitive sequencing technologies will reveal rare transcripts but many of these are clearly non-productive. The majority of the transcription factor gene alternative transcripts that are productive may represent tolerable noise rather than encoding functionally distinct isoforms. PMID:23586691

SFPQ/PSF-TFE3 renal cell carcinoma: a clinicopathologic study emphasizing extended morphology and reviewing the differences between SFPQ-TFE3 RCC and the corresponding mesenchymal neoplasm despite an identical gene fusion.

PubMed

Wang, Xiao-Tong; Xia, Qiu-Yuan; Ni, Hao; Ye, Sheng-Bing; Li, Rui; Wang, Xuan; Shi, Shan-Shan; Zhou, Xiao-Jun; Rao, Qiu

2017-05-01

Xp11 translocation renal cell carcinoma (RCC) with SFPQ/PSF-TFE3 gene fusion is a rare epithelial tumor. Of note, the appearance of the gene fusion does not necessarily mean that it is renal cell carcinoma. The corresponding mesenchymal neoplasms, including Xp11 neoplasm with melanocytic differentiation, TFE3 rearrangement-associated perivascular epithelioid cell tumor (PEComa) and melanotic Xp11 translocation renal cancer, can also harbor the identical gene fusion. However, the differences between Xp11 translocation RCC and the corresponding mesenchymal neoplasm have only recently been described. Herein, we examined 5 additional cases of SFPQ-TFE3 RCCs using clinicopathologic, immunohistochemical, and molecular analyses. One tumor had the typical morphologic features of SFPQ-TFE3 RCC, whereas other 3 cases demonstrated the unusual morphologic features associated with pseudorosettes formation or clusters of smaller cells, mimicking TFEB RCC. The remaining one showed branching tubules and papillary structure composed of clear and eosinophilic tumor cells. Immunohistochemically, all 5 cases demonstrated moderate (2+) or strong (3+) positive staining for TFE3, PAX-8 and CD10, whereas no cases demonstrated TFEB, Cathepsin K, CA-IX, CK7, Melan-A, or HMB-45 expression. Genetically, the fusion transcripts were identified in 3 cases by reverse-transcription polymerase chain reaction (RT-PCR). On the basis of fluorescence in situ hybridization (FISH) analysis, all the cases were detected with SFPQ-TFE3 gene fusion. Clinical follow-up data were available for all the patients, and no one developed tumor recurrence, progression, or metastasis. We also review the differences between SFPQ-TFE3 RCC and the corresponding mesenchymal neoplasm despite the identical gene fusion. The presence of pseudorosettes also expands the known histological features of SFPQ-TFE3 RCC. Copyright © 2017 Elsevier Inc. All rights reserved.

The ygaVP Genes of Escherichia coli Form a Tributyltin-Inducible Operon▿ †

PubMed Central

Gueuné, Hervé; Durand, Marie-José; Thouand, Gérald; DuBow, Michael S.

2008-01-01

A tributyltin (TBT) luxAB transcriptional fusion in Escherichia coli revealed that a TBT-activated promoter is located upstream of two cotranscribed orphan genes, ygaV and ygaP. We demonstrate that transcription from the promoter upstream of ygaVP is constitutive in a ygaVP mutant, suggesting that YgaV is an autoregulated, TBT-inducible repressor. PMID:18245262

An MSC2 Promoter-lacZ Fusion Gene Reveals Zinc-Responsive Changes in Sites of Transcription Initiation That Occur across the Yeast Genome

PubMed Central

Wu, Yi-Hsuan; Taggart, Janet; Song, Pamela Xiyao; MacDiarmid, Colin; Eide, David J.

2016-01-01

The Msc2 and Zrg17 proteins of Saccharomyces cerevisiae form a complex to transport zinc into the endoplasmic reticulum. ZRG17 is transcriptionally induced in zinc-limited cells by the Zap1 transcription factor. In this report, we show that MSC2 mRNA also increases (~1.5 fold) in zinc-limited cells. The MSC2 gene has two in-frame ATG codons at its 5’ end, ATG1 and ATG2; ATG2 is the predicted initiation codon. When the MSC2 promoter was fused at ATG2 to the lacZ gene, we found that unlike the chromosomal gene this reporter showed a 4-fold decrease in lacZ mRNA in zinc-limited cells. Surprisingly, β-galactosidase activity generated by this fusion gene increased ~7 fold during zinc deficiency suggesting the influence of post-transcriptional factors. Transcription of MSC2ATG2-lacZ was found to start upstream of ATG1 in zinc-replete cells. In zinc-limited cells, transcription initiation shifted to sites just upstream of ATG2. From the results of mutational and polysome profile analyses, we propose the following explanation for these effects. In zinc-replete cells, MSC2ATG2-lacZ mRNA with long 5’ UTRs fold into secondary structures that inhibit translation. In zinc-limited cells, transcripts with shorter unstructured 5’ UTRs are generated that are more efficiently translated. Surprisingly, chromosomal MSC2 did not show start site shifts in response to zinc status and only shorter 5’ UTRs were observed. However, the shifts that occur in the MSC2ATG2-lacZ construct led us to identify significant transcription start site changes affecting the expression of ~3% of all genes. Therefore, zinc status can profoundly alter transcription initiation across the yeast genome. PMID:27657924

Temperature sensing in Yersinia pestis: regulation of yopE transcription by lcrF.

PubMed Central

Hoe, N P; Minion, F C; Goguen, J D

1992-01-01

In Escherichia coli, a yopE::lacZ fusion was found to be regulated by temperature in the presence of the cloned BamHI G fragment of Yersinia pestis plasmid pCD1, which contains the lcrF locus. Increasing the copy number of lcrF relative to that of the yopE reporter had a negligible effect on the induction ratio (26 versus 37 degrees C) but caused large reductions in the absolute levels of yopE transcription. We localized the lcrF gene by monitoring the induction phenotype of BamHI G deletion derivatives. Sequencing revealed an open reading frame capable of encoding a protein of 30.8 kDa. A protein product of this size was detected in a T7 expression system, and LcrF-dependent yopE-specific DNA binding activity was observed. As expected, LcrF exhibited 98% homology to VirF of Yersinia enterocolitica and significant homology to the carboxy termini of other members of the AraC family of transcriptional regulatory proteins. These proteins could be divided into two classes according to function: those regulating operons involved in catabolism of carbon and energy sources and those involved in regulating virulence genes. lcrF::lacZ transcriptional fusions were constructed and analyzed in Y. pestis and E. coli. The activity of the fusions was not affected by the native pCD1 virulence plasmid, an intact lcrF gene, or temperature. Thus, induction of lcrF transcription is not essential for temperature-dependent activation of yopE transcription. A portion of LcrF was found associated with the membrane fraction in E. coli; however, pulse-chase experiments indicated that this result is an artifact of fractionation. Images PMID:1624422

Fusion genes with ALK as recurrent partner in ependymoma-like gliomas: a new brain tumor entity?

PubMed Central

Olsen, Thale Kristin; Panagopoulos, Ioannis; Meling, Torstein R.; Micci, Francesca; Gorunova, Ludmila; Thorsen, Jim; Due-Tønnessen, Bernt; Scheie, David; Lund-Iversen, Marius; Krossnes, Bård; Saxhaug, Cathrine; Heim, Sverre; Brandal, Petter

2015-01-01

Background We have previously characterized 19 ependymal tumors using Giemsa banding and high-resolution comparative genomic hybridization. The aim of this study was to analyze these tumors searching for fusion genes. Methods RNA sequencing was performed in 12 samples. Potential fusion transcripts were assessed by seed count and structural chromosomal aberrations. Transcripts of interest were validated using fluorescence in situ hybridization and PCR followed by direct sequencing. Results RNA sequencing identified rearrangements of the anaplastic lymphoma kinase gene (ALK) in 2 samples. Both tumors harbored structural aberrations involving the ALK locus 2p23. Tumor 1 had an unbalanced t(2;14)(p23;q22) translocation which led to the fusion gene KTN1-ALK. Tumor 2 had an interstitial del(2)(p16p23) deletion causing the fusion of CCDC88A and ALK. In both samples, the breakpoint of ALK was located between exons 19 and 20. Both patients were infants and both tumors were supratentorial. The tumors were well demarcated from surrounding tissue and had both ependymal and astrocytic features but were diagnosed and treated as ependymomas. Conclusions By combining karyotyping and RNA sequencing, we identified the 2 first ever reported ALK rearrangements in CNS tumors. Such rearrangements may represent the hallmark of a new entity of pediatric glioma characterized by both ependymal and astrocytic features. Our findings are of particular importance because crizotinib, a selective ALK inhibitor, has demonstrated effect in patients with lung cancer harboring ALK rearrangements. Thus, ALK emerges as an interesting therapeutic target in patients with ependymal tumors carrying ALK fusions. PMID:25795305

Inhibition of CRM1-mediated nuclear export of transcription factors by leukemogenic NUP98 fusion proteins.

PubMed

Takeda, Akiko; Sarma, Nayan J; Abdul-Nabi, Anmaar M; Yaseen, Nabeel R

2010-05-21

NUP98 is a nucleoporin that plays complex roles in the nucleocytoplasmic trafficking of macromolecules. Rearrangements of the NUP98 gene in human leukemia result in the expression of numerous fusion oncoproteins whose effect on nucleocytoplasmic trafficking is poorly understood. The present study was undertaken to determine the effects of leukemogenic NUP98 fusion proteins on CRM1-mediated nuclear export. NUP98-HOXA9, a prototypic NUP98 fusion, inhibited the nuclear export of two known CRM1 substrates: mutated cytoplasmic nucleophosmin and HIV-1 Rev. In vitro binding assays revealed that NUP98-HOXA9 binds CRM1 through the FG repeat motif in a Ran-GTP-dependent manner similar to but stronger than the interaction between CRM1 and its export substrates. Two NUP98 fusions, NUP98-HOXA9 and NUP98-DDX10, whose fusion partners are structurally and functionally unrelated, interacted with endogenous CRM1 in myeloid cells as shown by co-immunoprecipitation. These leukemogenic NUP98 fusion proteins interacted with CRM1, Ran, and the nucleoporin NUP214 in a manner fundamentally different from that of wild-type NUP98. NUP98-HOXA9 and NUP98-DDX10 formed characteristic aggregates within the nuclei of a myeloid cell line and primary human CD34+ cells and caused aberrant localization of CRM1 to these aggregates. These NUP98 fusions caused nuclear accumulation of two transcription factors, NFAT and NFkappaB, that are regulated by CRM1-mediated export. The nuclear entrapment of NFAT and NFkappaB correlated with enhanced transcription from promoters responsive to these transcription factors. Taken together, the results suggest a new mechanism by which NUP98 fusions dysregulate transcription and cause leukemia, namely, inhibition of CRM1-mediated nuclear export with aberrant nuclear retention of transcriptional regulators.

Transcription Factors Expressed in Lateral Organ Boundaries: Identification of Downstream Targets

DOE Office of Scientific and Technical Information (OSTI.GOV)

Springer, Patricia S

2010-07-12

The processes of lateral organ initiation and patterning are central to the generation of mature plant form. Characterization of the molecular mechanisms underlying these processes is essential to our understanding of plant development. Communication between the shoot apical meristem and initiating organ primordia is important both for functioning of the meristem and for proper organ patterning, and very little is known about this process. In particular, the boundary between meristem and leaf is emerging as a critical region that is important for SAM maintenance and regulation of organogenesis. The goal of this project was to characterize three boundary-expressed genes thatmore » encode predicted transcription factors. Specifically, we have studied LATERAL ORGAN BOUNDARIES (LOB), LATERAL ORGAN FUSION1 (LOF1), and LATERAL ORGAN FUSION2 (LOF2). LOB encodes the founding member of the LOB-DOMAIN (LBD) plant-specific DNA binding transcription factor family and LOF1 and LOF2 encode paralogous MYB-domain transcription factors. We characterized the genetic relationship between these three genes and other boundary and meristem genes. We also used an ectopic inducible expression system to identify direct targets of LOB.« less

PARP-1 inhibition as a targeted strategy to treat Ewing's sarcoma

PubMed Central

Brenner, J. Chad; Feng, Felix Y.; Han, Sumin; Patel, Sonam; Goyal, Siddharth V.; Bou-Maroun, Laura M.; Liu, Meilan; Lonigro, Robert; Prensner, John R.; Tomlins, Scott A.; Chinnaiyan, Arul M.

2012-01-01

Ewing's sarcoma family tumors (ESFTs) are aggressive malignancies which frequently harbor characteristic EWS-FLI1 or EWS-ERG genomic fusions. Here we report that these fusion products interact with the DNA damage response protein and transcriptional co-regulator PARP-1. ESFT cells, primary tumor xenografts and tumor metastases were all highly sensitive to PARP1 inhibition. Addition of a PARP1 inhibitor to the second-line chemotherapeutic agent temozolamide resulted in complete responses of all treated tumors in an EWS-FLI1-driven mouse xenograft model of ESFT. Mechanistic investigations revealed that DNA damage induced by expression of EWS-FLI1 or EWS-ERG fusion genes was potentiated by PARP1 inhibition in ESFT cell lines. Notably, EWS-FLI1 fusion genes acted in a positive feedback loop to maintain the expression of PARP1, which was required for EWS-FLI-mediated transcription, thereby enforcing oncogene-dependent sensitivity to PARP-1 inhibition. Together, our findings offer a strong preclinical rationale to target the EWS-FLI1: PARP1 intersection as a therapeutic strategy to improve the treatment of Ewing's sarcoma family tumors. PMID:22287547

Mitochondrial functions mediate cellulase gene expression in Trichoderma reesei.

PubMed

Abrahão-Neto, J; Rossini, C H; el-Gogary, S; Henrique-Silva, F; Crivellaro, O; el-Dorry, H

1995-08-22

We examined the effects of inhibition of mitochondrial functions on the expression of two nuclear genes encoding the extracellular cellobiohydrolase I (cbh1) and endoglucanase I (egl1) of the cellulase system of the filamentous fungus Trichoderma reesei. The cbh1 and egl1 transcripts are repressed at a low oxygen tension, and by glucose at a concentration known to repress mitochondrial respiration. The transcripts are also down-regulated by chemical agents known to dissipate the proton electrochemical gradient of the inner mitochondrial membrane and blocking of the electron-transport chain, such as DNP and KCN, respectively. These results suggest that expression of those transcripts is influenced by the physiological state of the mitochondria. In addition, heterologous gene fusion shows that the sensitivity of the expression of those transcripts to the functional state of the mitochondria is transcriptionally controlled through the 5'-flanking DNA sequence of those genes.

Identifying transposon insertions and their effects from RNA-sequencing data.

PubMed

de Ruiter, Julian R; Kas, Sjors M; Schut, Eva; Adams, David J; Koudijs, Marco J; Wessels, Lodewyk F A; Jonkers, Jos

2017-07-07

Insertional mutagenesis using engineered transposons is a potent forward genetic screening technique used to identify cancer genes in mouse model systems. In the analysis of these screens, transposon insertion sites are typically identified by targeted DNA-sequencing and subsequently assigned to predicted target genes using heuristics. As such, these approaches provide no direct evidence that insertions actually affect their predicted targets or how transcripts of these genes are affected. To address this, we developed IM-Fusion, an approach that identifies insertion sites from gene-transposon fusions in standard single- and paired-end RNA-sequencing data. We demonstrate IM-Fusion on two separate transposon screens of 123 mammary tumors and 20 B-cell acute lymphoblastic leukemias, respectively. We show that IM-Fusion accurately identifies transposon insertions and their true target genes. Furthermore, by combining the identified insertion sites with expression quantification, we show that we can determine the effect of a transposon insertion on its target gene(s) and prioritize insertions that have a significant effect on expression. We expect that IM-Fusion will significantly enhance the accuracy of cancer gene discovery in forward genetic screens and provide initial insight into the biological effects of insertions on candidate cancer genes. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Activation of a development-specific gene, dofA, by FruA, an essential transcription factor for development of Myxococcus xanthus.

PubMed

Ueki, Toshiyuki; Inouye, Sumiko

2005-12-01

FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development.

The Transcription Factor Ste12 Mediates the Regulatory Role of the Tmk1 MAP Kinase in Mycoparasitism and Vegetative Hyphal Fusion in the Filamentous Fungus Trichoderma atroviride

PubMed Central

Gruber, Sabine; Zeilinger, Susanne

2014-01-01

Mycoparasitic species of the fungal genus Trichoderma are potent antagonists able to combat plant pathogenic fungi by direct parasitism. An essential step in this mycoparasitic fungus-fungus interaction is the detection of the fungal host followed by activation of molecular weapons in the mycoparasite by host-derived signals. The Trichoderma atroviride MAP kinase Tmk1, a homolog of yeast Fus3/Kss1, plays an essential role in regulating the mycoparasitic host attack, aerial hyphae formation and conidiation. However, the transcription factors acting downstream of Tmk1 are hitherto unknown. Here we analyzed the functions of the T. atroviride Ste12 transcription factor whose orthologue in yeast is targeted by the Fus3 and Kss1 MAP kinases. Deletion of the ste12 gene in T. atroviride not only resulted in reduced mycoparasitic overgrowth and lysis of host fungi but also led to loss of hyphal avoidance in the colony periphery and a severe reduction in conidial anastomosis tube formation and vegetative hyphal fusion events. The transcription of several orthologues of Neurospora crassa hyphal fusion genes was reduced upon ste12 deletion; however, the Δste12 mutant showed enhanced expression of mycoparasitism-relevant chitinolytic and proteolytic enzymes and of the cell wall integrity MAP kinase Tmk2. Based on the comparative analyses of Δste12 and Δtmk1 mutants, an essential role of the Ste12 transcriptional regulator in mediating outcomes of the Tmk1 MAPK pathway such as regulation of the mycoparasitic activity, hyphal fusion and carbon source-dependent vegetative growth is suggested. Aerial hyphae formation and conidiation, in contrast, were found to be independent of Ste12. PMID:25356841

The transcription factor Ste12 mediates the regulatory role of the Tmk1 MAP kinase in mycoparasitism and vegetative hyphal fusion in the filamentous fungus Trichoderma atroviride.

PubMed

Gruber, Sabine; Zeilinger, Susanne

2014-01-01

Mycoparasitic species of the fungal genus Trichoderma are potent antagonists able to combat plant pathogenic fungi by direct parasitism. An essential step in this mycoparasitic fungus-fungus interaction is the detection of the fungal host followed by activation of molecular weapons in the mycoparasite by host-derived signals. The Trichoderma atroviride MAP kinase Tmk1, a homolog of yeast Fus3/Kss1, plays an essential role in regulating the mycoparasitic host attack, aerial hyphae formation and conidiation. However, the transcription factors acting downstream of Tmk1 are hitherto unknown. Here we analyzed the functions of the T. atroviride Ste12 transcription factor whose orthologue in yeast is targeted by the Fus3 and Kss1 MAP kinases. Deletion of the ste12 gene in T. atroviride not only resulted in reduced mycoparasitic overgrowth and lysis of host fungi but also led to loss of hyphal avoidance in the colony periphery and a severe reduction in conidial anastomosis tube formation and vegetative hyphal fusion events. The transcription of several orthologues of Neurospora crassa hyphal fusion genes was reduced upon ste12 deletion; however, the Δste12 mutant showed enhanced expression of mycoparasitism-relevant chitinolytic and proteolytic enzymes and of the cell wall integrity MAP kinase Tmk2. Based on the comparative analyses of Δste12 and Δtmk1 mutants, an essential role of the Ste12 transcriptional regulator in mediating outcomes of the Tmk1 MAPK pathway such as regulation of the mycoparasitic activity, hyphal fusion and carbon source-dependent vegetative growth is suggested. Aerial hyphae formation and conidiation, in contrast, were found to be independent of Ste12.

Recurrent R-spondin fusions in colon cancer.

PubMed

Seshagiri, Somasekar; Stawiski, Eric W; Durinck, Steffen; Modrusan, Zora; Storm, Elaine E; Conboy, Caitlin B; Chaudhuri, Subhra; Guan, Yinghui; Janakiraman, Vasantharajan; Jaiswal, Bijay S; Guillory, Joseph; Ha, Connie; Dijkgraaf, Gerrit J P; Stinson, Jeremy; Gnad, Florian; Huntley, Melanie A; Degenhardt, Jeremiah D; Haverty, Peter M; Bourgon, Richard; Wang, Weiru; Koeppen, Hartmut; Gentleman, Robert; Starr, Timothy K; Zhang, Zemin; Largaespada, David A; Wu, Thomas D; de Sauvage, Frederic J

2012-08-30

Identifying and understanding changes in cancer genomes is essential for the development of targeted therapeutics. Here we analyse systematically more than 70 pairs of primary human colon tumours by applying next-generation sequencing to characterize their exomes, transcriptomes and copy-number alterations. We have identified 36,303 protein-altering somatic changes that include several new recurrent mutations in the Wnt pathway gene TCF7L2, chromatin-remodelling genes such as TET2 and TET3 and receptor tyrosine kinases including ERBB3. Our analysis for significantly mutated cancer genes identified 23 candidates, including the cell cycle checkpoint kinase ATM. Copy-number and RNA-seq data analysis identified amplifications and corresponding overexpression of IGF2 in a subset of colon tumours. Furthermore, using RNA-seq data we identified multiple fusion transcripts including recurrent gene fusions involving R-spondin family members RSPO2 and RSPO3 that together occur in 10% of colon tumours. The RSPO fusions were mutually exclusive with APC mutations, indicating that they probably have a role in the activation of Wnt signalling and tumorigenesis. Consistent with this we show that the RSPO fusion proteins were capable of potentiating Wnt signalling. The R-spondin gene fusions and several other gene mutations identified in this study provide new potential opportunities for therapeutic intervention in colon cancer.

Recurrent R-spondin fusions in colon cancer

PubMed Central

Seshagiri, Somasekar; Stawiski, Eric W.; Durinck, Steffen; Modrusan, Zora; Storm, Elaine E.; Conboy, Caitlin B.; Chaudhuri, Subhra; Guan, Yinghui; Janakiraman, Vasantharajan; Jaiswal, Bijay S.; Guillory, Joseph; Ha, Connie; Dijkgraaf, Gerrit J. P.; Stinson, Jeremy; Gnad, Florian; Huntley, Melanie A.; Degenhardt, Jeremiah D.; Haverty, Peter M.; Bourgon, Richard; Wang, Weiru; Koeppen, Hartmut; Gentleman, Robert; Starr, Timothy K.; Zhang, Zemin; Largaespada, David A.; Wu, Thomas D.; de Sauvage, Frederic J

2013-01-01

Identifying and understanding changes in cancer genomes is essential for the development of targeted therapeutics1. Here we analyse systematically more than 70 pairs of primary human colon tumours by applying next-generation sequencing to characterize their exomes, transcriptomes and copy-number alterations. We have identified 36,303 protein-altering somatic changes that include several new recurrent mutations in the Wnt pathway gene TCF7L2, chromatin-remodelling genes such as TET2 and TET3 and receptor tyrosine kinases including ERBB3. Our analysis for significantly mutated cancer genes identified 23 candidates, including the cell cycle checkpoint kinase ATM. Copy-number and RNA-seq data analysis identified amplifications and corresponding overexpression of IGF2 in a subset of colon tumours. Furthermore, using RNA-seq data we identified multiple fusion transcripts including recurrent gene fusions involving R-spondin family members RSPO2 and RSPO3 that together occur in 10% of colon tumours. The RSPO fusions were mutually exclusive with APC mutations, indicating that they probably have a role in the activation of Wnt signalling and tumorigenesis. Consistent with this we show that the RSPO fusion proteins were capable of potentiating Wnt signalling. The R-spondin gene fusions and several other gene mutations identified in this study provide new potential opportunities for therapeutic intervention in colon cancer. PMID:22895193

Control of transcription of the Bacillus subtilis spoIIIG gene, which codes for the forespore-specific transcription factor sigma G.

PubMed

Sun, D X; Cabrera-Martinez, R M; Setlow, P

1991-05-01

The Bacillus subtilis spoIIIG gene codes for a sigma factor termed sigma G which directs transcription of genes expressed only in the forespore compartment of the sporulating cell. Use of spoIIIG-lacZ transcriptional fusions showed that spoIIIG is cotranscribed with the spoIIG operon beginning at t0.5-1 of sporulation. However, this large mRNA produced little if any sigma G, and transferring the spoIIIG gene without the spoIIG promoter into the amyE locus resulted in a Spo+ phenotype. Significant translation of spoIIIG began at t2.5-3 with use of an mRNA whose 5' end is just upstream of the spoIIIG coding sequence. Synthesis of this spoIIIG-specific mRNA was not abolished by a deletion in spoIIIG itself. Similar results were obtained when a spoIIIG-lacZ translational fusion lacking the spoIIG promoter was integrated at the amyE locus. These data suggest that synthesis of sigma G is dependent neither on transcription from the spoIIG promoter nor on sigma G itself but can be due to another transcription factor. This transcription factor may be sigma F, the product of the spoIIAC locus, since a spoIIAC mutation blocked spoIIIG expression, and sequences upstream of the 5' end of the spoIIIG-specific mRNA agree well with the recognition sequence for sigma F. RNA polymerase containing sigma F (E sigma F) initiated transcription in vitro on a spoIIIG template at the 5' end found in vivo, as did E sigma G. However, E sigma F showed a greater than 20-fold preference for spoIIIG over a known sigma G-dependent gene compared with the activity of E sigma G.

Clinicopathological features of younger (aged ≤ 50 years) lung adenocarcinoma patients harboring the EML4-ALK fusion gene.

PubMed

Kometani, Takuro; Sugio, Kenji; Osoegawa, Atsushi; Seto, Takashi; Ichinose, Yukito

2018-05-01

The EML4-ALK fusion gene has recently been identified as a driver mutation in a subset of non-small cell lung cancers. In subsequent studies, EML4-ALK has been detected in a low percentage of patients, and was associated with a lack of EGFR or KRAS mutations, younger age, and adenocarcinoma with acinar histology. Cases with the EML4-ALK fusion gene were examined to clarify the clinicopathological characteristics of young adenocarcinoma patients. Between December 1998 and May 2009, 85 patients aged ≤ 50 with lung adenocarcinoma were treated at our hospital. We examined 49 samples from adenocarcinoma patients who underwent surgical resection, chemotherapy, and/or radiotherapy for the EML4-ALK gene. None of the patients received ALK inhibitors because these drugs had not been approved in Japan before 2012. EML4-ALK fusion genes were screened using multiplex reverse-transcription PCR assay, and were confirmed by direct sequencing. The EML4-ALK fusion gene was detected in five tumors (10.2%). One patient had stage IB disease, one had stage IIIA, and three had stage IV. Histologically, there was one solid adenocarcinoma, two acinar adenocarcinomas, and two papillary adenocarcinomas. EML4-ALK fusion genes were mutually exclusive to EGFR and KRAS mutations. The five-year survival rate was 59.4% in patients without EML4-ALK fusion and was not reached in patients with EML4-ALK fusion. The EML4-ALK fusion gene may be a strong oncogene in younger patients with lung adenocarcinoma. © 2018 The Authors. Thoracic Cancer published by China Lung Oncology Group and John Wiley & Sons Australia, Ltd.

Clinicopathological features of younger (aged ≤ 50 years) lung adenocarcinoma patients harboring the EML4‐ALK fusion gene

PubMed Central

Sugio, Kenji; Osoegawa, Atsushi; Seto, Takashi; Ichinose, Yukito

2018-01-01

Background The EML4‐ALK fusion gene has recently been identified as a driver mutation in a subset of non‐small cell lung cancers. In subsequent studies, EML4‐ALK has been detected in a low percentage of patients, and was associated with a lack of EGFR or KRAS mutations, younger age, and adenocarcinoma with acinar histology. Cases with the EML4‐ALK fusion gene were examined to clarify the clinicopathological characteristics of young adenocarcinoma patients. Methods Between December 1998 and May 2009, 85 patients aged ≤ 50 with lung adenocarcinoma were treated at our hospital. We examined 49 samples from adenocarcinoma patients who underwent surgical resection, chemotherapy, and/or radiotherapy for the EML4‐ALK gene. None of the patients received ALK inhibitors because these drugs had not been approved in Japan before 2012. EML4‐ALK fusion genes were screened using multiplex reverse‐transcription PCR assay, and were confirmed by direct sequencing. Results The EML4‐ALK fusion gene was detected in five tumors (10.2%). One patient had stage IB disease, one had stage IIIA, and three had stage IV. Histologically, there was one solid adenocarcinoma, two acinar adenocarcinomas, and two papillary adenocarcinomas. EML4‐ALK fusion genes were mutually exclusive to EGFR and KRAS mutations. The five‐year survival rate was 59.4% in patients without EML4‐ALK fusion and was not reached in patients with EML4‐ALK fusion. Conclusion The EML4‐ALK fusion gene may be a strong oncogene in younger patients with lung adenocarcinoma. PMID:29517858

Fusion of Huntingtin interacting protein 1 to platelet-derived growth factor beta receptor (PDGFbetaR) in chronic myelomonocytic leukemia with t(5;7)(q33;q11.2).

PubMed

Ross, T S; Bernard, O A; Berger, R; Gilliland, D G

1998-06-15

We report the fusion of the Huntingtin interactin protein 1 (HIP1) gene to the platelet-derived growth factor betareceptor (PDGFbetaR) gene in a patient with chronic myelomonocytic leukemia (CMML) with a t(5;7)(q33;q11.2) translocation. Southern blot analysis of patient bone marrow cells with a PDGFbetaR gene probe demonstrated rearrangement of the PDGFbetaR gene. Anchored polymerase chain reaction using PDGFbetaR primers identified a chimeric transcript containing the HIP1 gene located at 7q11.2 fused to the PDGFbetaR gene on 5q33. HIP1 is a 116-kD protein recently cloned by yeast two-hybrid screening for proteins that interact with Huntingtin, the mutated protein in Huntington's disease. The consequence of t(5;7)(q33;q11.2) is an HIP1/PDGFbetaR fusion gene that encodes amino acids 1 to 950 of HIP1 joined in-frame to the transmembrane and tyrosine kinase domains of the PDGFbetaR. The reciprocal PDGFbetaR/HIP1 transcript is not expressed. HIP1/PDGFbetaR is a 180-kD protein when expressed in the murine hematopoietic cell line, Ba/F3, and is constitutively tyrosine phosphorylated. Furthermore, HIP1/PDGFbetaR transforms the Ba/F3 cells to interleukin-3-independent growth. These data are consistent with an alternative mechanism for activation of PDGFbetaR tyrosine kinase activity by fusion with HIP1, leading to transformation of hematopoietic cells, and may implicate Huntingtin or HIP1 in the pathogenesis of hematopoietic malignancies.

Deep RNA sequencing analysis of readthrough gene fusions in human prostate adenocarcinoma and reference samples

PubMed Central

2011-01-01

Background Readthrough fusions across adjacent genes in the genome, or transcription-induced chimeras (TICs), have been estimated using expressed sequence tag (EST) libraries to involve 4-6% of all genes. Deep transcriptional sequencing (RNA-Seq) now makes it possible to study the occurrence and expression levels of TICs in individual samples across the genome. Methods We performed single-end RNA-Seq on three human prostate adenocarcinoma samples and their corresponding normal tissues, as well as brain and universal reference samples. We developed two bioinformatics methods to specifically identify TIC events: a targeted alignment method using artificial exon-exon junctions within 200,000 bp from adjacent genes, and genomic alignment allowing splicing within individual reads. We performed further experimental verification and characterization of selected TIC and fusion events using quantitative RT-PCR and comparative genomic hybridization microarrays. Results Targeted alignment against artificial exon-exon junctions yielded 339 distinct TIC events, including 32 gene pairs with multiple isoforms. The false discovery rate was estimated to be 1.5%. Spliced alignment to the genome was less sensitive, finding only 18% of those found by targeted alignment in 33-nt reads and 59% of those in 50-nt reads. However, spliced alignment revealed 30 cases of TICs with intervening exons, in addition to distant inversions, scrambled genes, and translocations. Our findings increase the catalog of observed TIC gene pairs by 66%. We verified 6 of 6 predicted TICs in all prostate samples, and 2 of 5 predicted novel distant gene fusions, both private events among 54 prostate tumor samples tested. Expression of TICs correlates with that of the upstream gene, which can explain the prostate-specific pattern of some TIC events and the restriction of the SLC45A3-ELK4 e4-e2 TIC to ERG-negative prostate samples, as confirmed in 20 matched prostate tumor and normal samples and 9 lung cancer cell lines. Conclusions Deep transcriptional sequencing and analysis with targeted and spliced alignment methods can effectively identify TIC events across the genome in individual tissues. Prostate and reference samples exhibit a wide range of TIC events, involving more genes than estimated previously using ESTs. Tissue specificity of TIC events is correlated with expression patterns of the upstream gene. Some TIC events, such as MSMB-NCOA4, may play functional roles in cancer. PMID:21261984

Pax2 regulates a fadd-dependent molecular switch that drives tissue fusion during eye development.

PubMed

Viringipurampeer, Ishaq A; Ferreira, Todd; DeMaria, Shannon; Yoon, Jookyung J; Shan, Xianghong; Moosajee, Mariya; Gregory-Evans, Kevin; Ngai, John; Gregory-Evans, Cheryl Y

2012-05-15

Tissue fusion is an essential morphogenetic mechanism in development, playing a fundamental role in developing neural tube, palate and the optic fissure. Disruption of genes associated with the tissue fusion can lead to congenital malformations, such as spina bifida, cleft lip/palate and ocular coloboma. For instance, the Pax2 transcription factor is required for optic fissure closure, although the mechanism of Pax2 action leading to tissue fusion remains elusive. This lack of information defining how transcription factors drive tissue morphogenesis at the cellular level is hampering new treatments options. Through loss- and gain-of-function analysis, we now establish that pax2 in combination with vax2 directly regulate the fas-associated death domain (fadd) gene. In the presence of fadd, cell proliferation is restricted in the developing eye through a caspase-dependent pathway. However, the loss of fadd results in a proliferation defect and concomitant activation of the necroptosis pathway through RIP1/RIP3 activity, leading to an abnormal open fissure. Inhibition of RIP1 with the small molecule drug necrostatin-1 rescues the pax2 eye fusion defect, thereby overcoming the underlying genetic defect. Thus, fadd has an essential physiological function in protecting the developing optic fissure neuroepithelium from RIP3-dependent necroptosis. This study demonstrates the molecular hierarchies that regulate a cellular switch between proliferation and the apoptotic and necroptotic cell death pathways, which in combination drive tissue morphogenesis. Furthermore, our data suggest that future therapeutic strategies may be based on small molecule drugs that can bypass the gene defects causing common congenital tissue fusion defects.

Activation of a Development-Specific Gene, dofA, by FruA, an Essential Transcription Factor for Development of Myxococcus xanthus

PubMed Central

Ueki, Toshiyuki; Inouye, Sumiko

2005-01-01

FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development. PMID:16321956

Novel BCOR-MAML3 and ZC3H7B-BCOR Gene Fusions in Undifferentiated Small Blue Round Cell Sarcomas.

PubMed

Specht, Katja; Zhang, Lei; Sung, Yun-Shao; Nucci, Marisa; Dry, Sarah; Vaiyapuri, Sumathi; Richter, Gunther H S; Fletcher, Christopher D M; Antonescu, Cristina R

2016-04-01

Small blue round cell tumors (SBRCTs) are a heterogenous group of tumors that are difficult to diagnose because of overlapping morphologic, immunohistochemical, and clinical features. About two-thirds of EWSR1-negative SBRCTs are associated with CIC-DUX4-related fusions, whereas another small subset shows BCOR-CCNB3 X-chromosomal paracentric inversion. Applying paired-end RNA sequencing to an SBRCT index case of a 44-year-old man, we identified a novel BCOR-MAML3 chimeric fusion, which was validated by reverse transcription polymerase chain reaction and fluorescence in situ hybridization techniques. We then screened a total of 75 SBRCTs lacking EWSR1, FUS, SYT, CIC, and BCOR-CCNB3 abnormalities for BCOR break-apart probes by fluorescence in situ hybridization to detect potential recurrent BCOR gene rearrangements outside the typical X-chromosomal inversion. Indeed, 8/75 (11%) SBRCTs showed distinct BCOR gene rearrangements, with 2 cases each showing either a BCOR-MAML3 or the alternative ZC3H7B-BCOR fusion, whereas no fusion partner was detected in the remaining 4 cases. Gene expression of the BCOR-MAML3-positive index case showed a distinct transcriptional profile with upregulation of HOX-gene signature, compared with classic Ewing's sarcoma or CIC-DUX4-positive SBRCTs. The clinicopathologic features of the SBRCTs with alternative BCOR rearrangements were also compared with a group of BCOR-CCNB3 inversion-positive cases, combining 11 from our files with a meta-analysis of 42 published cases. The BCOR-CCNB3-positive tumors occurred preferentially in children and in bone, in contrast to alternative BCOR-rearranged SBRCTs, which presented in young adults, with a variable anatomic distribution. Furthermore, BCOR-rearranged tumors often displayed spindle cell areas, either well defined in intersecting fascicles or blending with the round cell component, which appears distinct from most other fusion-positive SBRCTs and shares histologic overlap with poorly differentiated synovial sarcoma.

Wild-type myoblasts rescue the ability of myogenin-null myoblasts to fuse in vivo.

PubMed

Myer, A; Wagner, D S; Vivian, J L; Olson, E N; Klein, W H

1997-05-15

Skeletal muscle is formed via a complex series of events during embryogenesis. These events include commitment of mesodermal precursor cells, cell migration, cell-cell recognition, fusion of myoblasts, activation of structural genes, and maturation. In mice lacking the bHLH transcription factor myogenin, myoblasts are specified and positioned correctly, but few fuse to form multinucleated fibers. This indicates that myogenin is critical for the fusion process and subsequent differentiation events of myogenesis. To further define the nature of the myogenic defects in myogenin-null mice, we investigated whether myogenin-null myoblasts are capable of fusing with wild-type myoblasts in vivo using chimeric mice containing mixtures of myogenin-null and wild-type cells. Chimeric embryos demonstrated that myogenin-null myoblasts readily fused in the presence of wild-type myoblasts. However, chimeric myofibers did not express wild-type levels of muscle-specific gene products, and myofibers with a high percentage of mutant nuclei appeared abnormal, suggesting that the wild-type nuclei could not fully rescue mutant nuclei in the myofibers. These data demonstrate that myoblast fusion can be uncoupled from complete myogenic differentiation and that myogenin regulates a specific subset of genes with diverse function. Thus, myogenin appears to control not only transcription of muscle structural genes but also the extracellular environment in which myoblast fusion takes place. We propose that myogenin regulates the expression of one or more extracellular or cell surface proteins required to initiate the muscle differentiation program.

Fungal mediator tail subunits contain classical transcriptional activation domains.

PubMed

Liu, Zhongle; Myers, Lawrence C

2015-04-01

Classical activation domains within DNA-bound eukaryotic transcription factors make weak interactions with coactivator complexes, such as Mediator, to stimulate transcription. How these interactions stimulate transcription, however, is unknown. The activation of reporter genes by artificial fusion of Mediator subunits to DNA binding domains that bind to their promoters has been cited as evidence that the primary role of activators is simply to recruit Mediator. We have identified potent classical transcriptional activation domains in the C termini of several tail module subunits of Saccharomyces cerevisiae, Candida albicans, and Candida dubliniensis Mediator, while their N-terminal domains are necessary and sufficient for their incorporation into Mediator but do not possess the ability to activate transcription when fused to a DNA binding domain. This suggests that Mediator fusion proteins actually are functioning in a manner similar to that of a classical DNA-bound activator rather than just recruiting Mediator. Our finding that deletion of the activation domains of S. cerevisiae Med2 and Med3, as well as C. dubliniensis Tlo1 (a Med2 ortholog), impairs the induction of certain genes shows these domains function at native promoters. Activation domains within coactivators are likely an important feature of these complexes and one that may have been uniquely leveraged by a common fungal pathogen. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Genes on a Wire: The Nucleoid-Associated Protein HU Insulates Transcription Units in Escherichia coli

PubMed Central

Berger, Michael; Gerganova, Veneta; Berger, Petya; Rapiteanu, Radu; Lisicovas, Viktoras; Dobrindt, Ulrich

2016-01-01

The extent to which chromosomal gene position in prokaryotes affects local gene expression remains an open question. Several studies have shown that chromosomal re-positioning of bacterial transcription units does not alter their expression pattern, except for a general decrease in gene expression levels from chromosomal origin to terminus proximal positions, which is believed to result from gene dosage effects. Surprisingly, the question as to whether this chromosomal context independence is a cis encoded property of a bacterial transcription unit, or if position independence is a property conferred by factors acting in trans, has not been addressed so far. For this purpose, we established a genetic test system assessing the chromosomal positioning effects by means of identical promoter-fluorescent reporter gene fusions inserted equidistantly from OriC into both chromosomal replichores of Escherichia coli K-12. Our investigations of the reporter activities in mutant cells lacking the conserved nucleoid associated protein HU uncovered various drastic chromosomal positional effects on gene transcription. In addition we present evidence that these positional effects are caused by transcriptional activity nearby the insertion site of our reporter modules. We therefore suggest that the nucleoid-associated protein HU is functionally insulating transcription units, most likely by constraining transcription induced DNA supercoiling. PMID:27545593

Identification of molecular tumor markers in renal cell carcinomas with TFE3 protein expression by RNA sequencing.

PubMed

Pflueger, Dorothee; Sboner, Andrea; Storz, Martina; Roth, Jasmine; Compérat, Eva; Bruder, Elisabeth; Rubin, Mark A; Schraml, Peter; Moch, Holger

2013-11-01

TFE3 translocation renal cell carcinoma (tRCC) is defined by chromosomal translocations involving the TFE3 transcription factor at chromosome Xp11.2. Genetically proven TFE3 tRCCs have a broad histologic spectrum with overlapping features to other renal tumor subtypes. In this study, we aimed for characterizing RCC with TFE3 protein expression. Using next-generation whole transcriptome sequencing (RNA-Seq) as a discovery tool, we analyzed fusion transcripts, gene expression profile, and somatic mutations in frozen tissue of one TFE3 tRCC. By applying a computational analysis developed to call chimeric RNA molecules from paired-end RNA-Seq data, we confirmed the known TFE3 translocation. Its fusion partner SFPQ has already been described as fusion partner in tRCCs. In addition, an RNA read-through chimera between TMED6 and COG8 as well as MET and KDR (VEGFR2) point mutations were identified. An EGFR mutation, but no chromosomal rearrangements, was identified in a control group of five clear cell RCCs (ccRCCs). The TFE3 tRCC could be clearly distinguished from the ccRCCs by RNA-Seq gene expression measurements using a previously reported tRCC gene signature. In validation experiments using reverse transcription-PCR, TMED6-COG8 chimera expression was significantly higher in nine TFE3 translocated and six TFE3-expressing/non-translocated RCCs than in 24 ccRCCs (P < .001) and 22 papillary RCCs (P < .05-.07). Immunohistochemical analysis of selected genes from the tRCC gene signature showed significantly higher eukaryotic translation elongation factor 1 alpha 2 (EEF1A2) and Contactin 3 (CNTN3) expression in 16 TFE3 translocated and six TFE3-expressing/non-translocated RCCs than in over 200 ccRCCs (P < .0001, both).

FOXO1 is a direct target of EWS-Fli1 oncogenic fusion protein in Ewing's sarcoma cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Liu, E-mail: lyang@u.washington.edu; Medical Research Service, VA Puget Sound Health Care System, Seattle, WA 98108; Hu, Hsien-Ming

2010-11-05

Research highlights: {yields} Inducible and reversible siRNA knockdown of an oncogenic fusion protein such as EWS-Fli1 is feasible and more advantageous than other siRNA methods. {yields} The tumor suppressor gene FOXO1 is a new EWS-Fli1 target. {yields} While trans-activators are known for the FOXO1 gene, there has been no report on negative regulators of FOXO1 transcription. {yields} This study provides first evidence that the EWS-Fli1 oncogenic fusion protein can function as a transcriptional repressor of the FOXO1 gene. -- Abstract: Ewing's family tumors are characterized by a specific t(11;22) chromosomal translocation that results in the formation of EWS-Fli1 oncogenic fusionmore » protein. To investigate the effects of EWS-Fli1 on gene expression, we carried out DNA microarray analysis after specific knockdown of EWS-Fli1 through transfection of synthetic siRNAs. EWS-Fli1 knockdown increased expression of genes such as DKK1 and p57 that are known to be repressed by EWS-Fli1 fusion protein. Among other potential EWS-Fli1 targets identified by our microarray analysis, we have focused on the FOXO1 gene since it encodes a potential tumor suppressor and has not been previously reported in Ewing's cells. To better understand how EWS-Fli1 affects FOXO1 expression, we have established a doxycycline-inducible siRNA system to achieve stable and reversible knockdown of EWS-Fli1 in Ewing's sarcoma cells. Here we show that FOXO1 expression in Ewing's cells has an inverse relationship with EWS-Fli1 protein level, and FOXO1 promoter activity is increased after doxycycline-induced EWS-Fli1 knockdown. In addition, we have found that direct binding of EWS-Fli1 to FOXO1 promoter is attenuated after doxycycline-induced siRNA knockdown of the fusion protein. Together, these results suggest that suppression of FOXO1 function by EWS-Fli1 fusion protein may contribute to cellular transformation in Ewing's family tumors.« less

KIAA1549-BRAF fusions and IDH mutations can coexist in diffuse gliomas of adults.

PubMed

Badiali, Manuela; Gleize, Vincent; Paris, Sophie; Moi, Loredana; Elhouadani, Selma; Arcella, Antonietta; Morace, Roberta; Antonelli, Manila; Buttarelli, Francesca Romana; Figarella-Branger, Dominique; Kim, Young-Ho; Ohgaki, Hiroko; Mokhtari, Karima; Sanson, Marc; Giangaspero, Felice

2012-11-01

KIAA1549-BRAF fusion gene and isocitrate dehydrogenase (IDH) mutations are considered two mutually exclusive genetic events in pilocytic astrocytomas and diffuse gliomas, respectively. We investigated the presence of the KIAA1549-BRAF fusion gene in conjunction with IDH mutations and 1p/19q loss in 185 adult diffuse gliomas. Moreover BRAF(v600E) mutation was also screened. The KIAA1549-BRAF fusion gene was evaluated by reverse-transcription polymerase chain reaction (RT-PCR) and sequencing. We found IDH mutations in 125 out 175 cases (71.4%). There were KIAA1549-BRAF fusion gene in 17 out of 180 (9.4%) cases and BRAF(v600E) in 2 out of 133 (1.5%) cases. In 11 of these 17 cases, both IDH mutations and the KIAA1549-BRAF fusion were present, as independent molecular events. Moreover, 6 of 17 cases showed co-presence of 1p/19q loss, IDH mutations and KIAA1549-BRAF fusion. Among the 17 cases with KIAA1549-BRAF fusion gene 15 (88.2%) were oligodendroglial neoplasms. Similarly, the two cases with BRAF(v600E) mutation were both oligodendroglioma and one had IDH mutations and 1p/19q co-deletion. Our results suggest that in a small fraction of diffuse gliomas, KIAA1549-BRAF fusion gene and BRAF(v600E) mutation may be responsible for deregulation of the Ras-RAF-ERK signaling pathway. Such alterations are more frequent in oligodendroglial neoplasm and may be co-present with IDH mutations and 1p/19q loss. © 2012 The Authors; Brain Pathology © 2012 International Society of Neuropathology.

Histone deacetylases: a common molecular target for differentiation treatment of acute myeloid leukemias?

PubMed

Minucci, S; Nervi, C; Lo Coco, F; Pelicci, P G

2001-05-28

Recent discoveries have identified key molecular events in the pathogenesis of acute promyelocytic leukemia (APL), caused by chromosomal rearrangements of the transcription factor RAR (resulting in a fusion protein with the product of other cellular genes, such as PML). Oligomerization of RAR, through a self-association domain present in PML, imposes an altered interaction with transcriptional co-regulators (NCoR/SMRT). NCoR/SMRT are responsible for recruitment of histone deacetylases (HDACs), which is required for transcriptional repression of PML-RAR target genes, and for the transforming potential of the fusion protein. Oligomerization and altered recruitment of HDACs are also responsible for transformation by the fusion protein AML1-ETO, extending these mechanisms to other forms of acute myeloid leukemias (AMLs) and suggesting that HDAC is a common target for myeloid leukemias. Strikingly, AML1-ETO expression blocks retinoic acid (RA) signaling in hematopoietic cells, suggesting that interference with the RA pathway (genetically altered in APL) by HDAC recruitment may be a common theme in AMLs. Treatment of APLs with RA, and of other AMLs with RA plus HDAC inhibitors (HDACi), results in myeloid differentiation. Thus, activation of the RA signaling pathway and inhibition of HDAC activity might represent a general strategy for the differentiation treatment of myeloid leukemias.

Transcriptional analysis of the multicopy hao gene coding for hydroxylamine oxidoreductase in Nitrosomonas sp. strain ENI-11.

PubMed

Hirota, Ryuichi; Kuroda, Akio; Ikeda, Tsukasa; Takiguchi, Noboru; Ohtake, Hisao; Kato, Junichi

2006-08-01

The nitrifying bacterium Nitrosomonas sp. strain ENI-11 has three copies of the gene encoding hydroxylamine oxidoreductase (hao(1), hao(2), and hao(3)) on its genome. Broad-host-range reporter plasmids containing transcriptional fusion genes between hao copies and lacZ were constructed to analyze the expression of each hydroxylamine oxidoreductase gene (hao) copy individually and quantitatively. beta-Galactosidase assays of ENI-11 harboring reporter plasmids revealed that all hao copies were transcribed in the wild-type strain. Promoter analysis of hao copies revealed that transcription of hao(3) was highest among the hao copies. Expression levels of hao(1) and hao(2) were 40% and 62% of that of hao(3) respectively. Transcription of hao(1) was negatively regulated, whereas a portion of hao(3) transcription was read through transcription from the rpsT promoter. When energy-depleted cells were incubated in the growth medium, only hao(3) expression increased. This result suggests that it is hao(3) that is responsible for recovery from energy-depleted conditions in Nitrosomonas sp. strain ENI-11.

Application of β-glucuronidase (GusA) as an effective reporter for extremely acidophilic Acidithiobacillus ferrooxidans.

PubMed

Wang, Huiyan; Fang, Liangyan; Wen, Qing; Lin, Jianqun; Liu, Xiangmei

2017-04-01

Acidithiobacillus ferrooxidans is a model organism for investigating metal sulfide bioleaching. The regulatory mechanism of gene expression by metabolizing various substrates is critical for understanding its role in bioleaching processes. However, no reporter has been successfully employed to study gene expression in A. ferrooxidans to date. In this study, a sensitive and robust reporter system based on β-glucuronidase (GusA) was described for feasible application in A. ferrooxidans. A set of vectors, which contained the transcriptional and translational fusions of gusA, were constructed and employed to analyze promoter activity and efficiency of translation initiation in A. ferrooxidans. Ptac and P2811 were screened out from ten tested promoters and could be used as strong promoters for gene overexpression in A. ferrooxidans. Among the four translational fusions of gusA with different start codons, ATG was most active, followed by TTG and GTG, while CTG showed the least activity. The transcriptional inhibition effect of an IclR-like transcription factor was also observed on its own encoding gene AFE_1668 as well as its neighboring AFE_1667. In addition, the specific chromogenic reaction of GusA could be detected and visualized by colonies of A. ferrooxidans containing gusA expression plasmids. Generally, the established GusA reporter system would be applied not only for quantitative analysis of promoter strength and its transcriptional regulation but also for qualitative colony screening in A. ferrooxidans in the future.

The Csr system regulates genome-wide mRNA stability and transcription and thus gene expression in Escherichia coli.

PubMed

Esquerré, Thomas; Bouvier, Marie; Turlan, Catherine; Carpousis, Agamemnon J; Girbal, Laurence; Cocaign-Bousquet, Muriel

2016-04-26

Bacterial adaptation requires large-scale regulation of gene expression. We have performed a genome-wide analysis of the Csr system, which regulates many important cellular functions. The Csr system is involved in post-transcriptional regulation, but a role in transcriptional regulation has also been suggested. Two proteins, an RNA-binding protein CsrA and an atypical signaling protein CsrD, participate in the Csr system. Genome-wide transcript stabilities and levels were compared in wildtype E. coli (MG1655) and isogenic mutant strains deficient in CsrA or CsrD activity demonstrating for the first time that CsrA and CsrD are global negative and positive regulators of transcription, respectively. The role of CsrA in transcription regulation may be indirect due to the 4.6-fold increase in csrD mRNA concentration in the CsrA deficient strain. Transcriptional action of CsrA and CsrD on a few genes was validated by transcriptional fusions. In addition to an effect on transcription, CsrA stabilizes thousands of mRNAs. This is the first demonstration that CsrA is a global positive regulator of mRNA stability. For one hundred genes, we predict that direct control of mRNA stability by CsrA might contribute to metabolic adaptation by regulating expression of genes involved in carbon metabolism and transport independently of transcriptional regulation.

Secondary RNA structure and its role in RNA interference to silence the respiratory syncytial virus fusion protein gene.

PubMed

Vig, Komal; Lewis, Nuruddeen; Moore, Eddie G; Pillai, Shreekumar; Dennis, Vida A; Singh, Shree R

2009-11-01

RNA interference (RNAi) is a post-transcriptional, gene silencing mechanism which uses small interfering RNA molecules (siRNA) for gene silencing. Respiratory Syncytial Virus (RSV) is an important respiratory pathogen of medical significance that causes high mortality in infants. The fusion (F) protein of RSV is a good target for therapeutic purposes as it is primarily responsible for penetration of the virus into host cells and subsequent syncytium formation during infection. In the present study, four siRNAs were designed and used individually as well as a mixture, to silence the RSV F gene. The relationship between siRNA design, target RNA structure, and their thermodynamics was also investigated. Silencing of F gene was observed using indirect immunofluorescence, western blot, reverse transcription PCR, and progeny viral titers. Our results show F gene silencing by all the four siRNAs individually and collectively. RT-PCR analysis revealed a decrease in mRNA level which corresponded to decreased F protein expression. siRNAs also inhibited RSV progeny as shown by viral titer estimation on infected HEp-2 cells. The present study demonstrates the silencing of the F gene using siRNA. Thermodynamic characteristics of the target RSV mRNA and siRNA seem to play an important role in siRNA gene silencing efficiency.

The use of quantitative real-time reverse transcriptase PCR for 5' and 3' portions of ALK transcripts to detect ALK rearrangements in lung cancers.

PubMed

Wang, Rui; Pan, Yunjian; Li, Chenguang; Hu, Haichuan; Zhang, Yang; Li, Hang; Luo, Xiaoyang; Zhang, Jie; Fang, Zhaoyuan; Li, Yuan; Shen, Lei; Ji, Hongbin; Garfield, David; Sun, Yihua; Chen, Haiquan

2012-09-01

Approximately 3% to 7% of non-small cell lung cancers (NSCLC) harbor an ALK fusion gene, thus defining a tumor group that may be responsive to targeted therapy. The breakpoint in ALK consistently occurs at exon 20 and EML4 or other fusion partners, thus driving a strong expression of ALK kinase domain and resulting in an unbalanced expression in 5' and 3' portions of ALK transcripts. We have developed a rapid and accurate method by simultaneously detecting the expression in 5' and 3' portions of ALK mRNA. Quantitative real-time reverse transcriptase PCR (qRT-PCR) was used to examine expression levels of the 5' and 3' portions of ALK transcripts in177 NSCLCs, in which EGFR, KRAS, HER2, and BRAF mutations were absent. If unbalanced ALK mRNA expression was seen, ALK rearrangement was assumed to exist. ALK FISH was used to confirm the accuracy of qRT-PCR. RT-PCR and 5' RACE coupling sequencing identified the fusion variants. Real-time RT-PCR showed excellent sensitivity and specificity (100% and 100%, respectively) for detection of ALK rearrangements in resected specimens. In addition, six novel ALK fusion variants were identified, including one KIF5B-ALK (E17;A20) and five EML4-ALK variants (E6a;A19, E6a/b ins 18;A20, E17b ins 39;A20, E10a/b, E13;A20, and E17 ins 65;A20). Real-time RT-PCR is a rapid and accurate method for diagnosing ALK-rearranged lung cancers. Coupling of 5' RACE to this method should further facilitate rapid identification of novel ALK fusion genes. ©2012 AACR.

High resolution array CGH and gene expression profiling of alveolar soft part sarcoma

PubMed Central

Selvarajah, Shamini; Pyne, Saumyadipta; Chen, Eleanor; Sompallae, Ramakrishna; Ligon, Azra H.; Nielsen, Gunnlaugur P.; Dranoff, Glenn; Stack, Edward; Loda, Massimo; Flavin, Richard

2014-01-01

Purpose Alveolar soft part sarcoma (ASPS) is a soft tissue sarcoma with poor prognosis, and little molecular evidence for its origin, initiation and progression. The aim of this study was to elucidate candidate molecular pathways involved in tumor pathogenesis. Experimental Design We employed high-throughput array comparative genomic hybridization and cDNA-Mediated Annealing, Selection, Ligation, and Extension Assay to profile the genomic and expression signatures of primary and metastatic ASPS from 17 tumors derived from 11 patients. We used an integrative bioinformatics approach to elucidate the molecular pathways associated with ASPS progression. Fluorescence in situ hybridization was performed to validate the presence of the t(X;17)(p11.2;q25) ASPL-TFE3 fusion and hence confirm the aCGH observations. Results FISH analysis identified the ASPL-TFE3 fusion in all cases. ArrayCGH revealed a higher number of numerical aberrations in metastatic tumors relative to primaries, but failed to identify consistent alterations in either group. Gene expression analysis highlighted 1,063 genes which were differentially expressed between the two groups. Gene set enrichment analysis identified 16 enriched gene sets (p < 0.1) associated with differentially expressed genes. Notable among these were several stem cell gene expression signatures and pathways related to differentiation. In particular, the paired box transcription factor PAX6 was up-regulated in the primary tumors, along with several genes whose mouse orthologs have previously been implicated in Pax6-DNA binding during neural stem cell differentiation. Conclusion In addition to suggesting a tentative neural line of differentiation for ASPS, these results implicate transcriptional deregulation from fusion genes in the pathogenesis of ASPS. PMID:24493828

Identification of Three Novel Fusion Oncogenes, SQSTM1/NTRK3, AFAP1L2/RET, and PPFIBP2/RET, in Thyroid Cancers of Young Patients in Fukushima.

PubMed

Iyama, Keita; Matsuse, Michiko; Mitsutake, Norisato; Rogounovitch, Tatiana; Saenko, Vladimir; Suzuki, Keiji; Ashizawa, Mai; Ookouchi, Chiyo; Suzuki, Satoshi; Mizunuma, Hiroshi; Fukushima, Toshihiko; Suzuki, Shinichi; Yamashita, Shunichi

2017-06-01

The BRAF V600E mutation is the most frequent genetic abnormality in adult papillary thyroid carcinomas (PTCs). On the other hand, various chromosomal rearrangements are more prevalent in childhood and adolescent PTCs. The aim of the present study was to identify novel rearrangements in PTCs from young patients. Among 63 postoperative specimens of childhood and adolescent PTCs, which had been discovered by the thyroid ultrasound screening program in Fukushima, nine samples without prevalent known oncogenes, BRAF V600E , RAS, RET/PTC1, RET/PTC3, and ETV6/NTRK3, were analyzed in the current study by quantitative real-time reverse transcription polymerase chain reaction to screen for novel fusion genes by comparing transcript expression between extracellular and kinase domains of ALK, NTRK1, NTRK3, and RET. Of the above nine samples, five samples were suspected to harbor a fusion, and using subsequent 5' rapid amplification of cDNA end (RACE), two already reported fusion oncogenes, STRN/ALK and TPR/NTRK1, and three novel fusions, SQSTM1/NTRK3, AFAP1L2/RET, and PPFIBP2/RET, were identified. Functional analyses of these three chimeric genes were performed, and their transforming abilities were confirmed through the activation of mitogen-activated protein kinase (MAPK). Three novel fusion oncogenes have been identified in young PTC patients in Fukushima, suggesting that rare fusions may be present among the cases negative for known oncogenes in this age group and that such rearrangements can play a significant role in thyroid carcinogenesis.

Translational induction of heat shock transcription factor σ32: evidence for a built-in RNA thermosensor

PubMed Central

Morita, Miyo Terao; Tanaka, Yoshiyuki; Kodama, Takashi S.; Kyogoku, Yoshimasa; Yanagi, Hideki; Yura, Takashi

1999-01-01

Induction of heat shock proteins in Escherichia coli is primarily caused by increased cellular levels of the heat shock σ-factor σ32 encoded by the rpoH gene. Increased σ32 levels result from both enhanced synthesis and stabilization. Previous work indicated that σ32 synthesis is induced at the translational level and is mediated by the mRNA secondary structure formed within the 5′-coding sequence of rpoH, including the translation initiation region. To understand the mechanism of heat induction of σ32 synthesis further, we analyzed expression of rpoH–lacZ gene fusions with altered stability of mRNA structure before and after heat shock. A clear correlation was found between the stability and expression or the extent of heat induction. Temperature-melting profiles of mRNAs with or without mutations correlated well with the expression patterns of fusion genes carrying the corresponding mutations in vivo. Furthermore, temperature dependence of mRNA–30S ribosome–tRNAfMet complex formation with wild-type or mutant mRNAs in vitro agreed well with that of the expression of gene fusions in vivo. Our results support a novel mechanism in which partial melting of mRNA secondary structure at high temperature enhances ribosome entry and translational initiation without involvement of other cellular components, that is, intrinsic mRNA stability controls synthesis of a transcriptional regulator. PMID:10090722

The genomic complexity of primary human prostate cancer

PubMed Central

Berger, Michael F.; Lawrence, Michael S.; Demichelis, Francesca; Drier, Yotam; Cibulskis, Kristian; Sivachenko, Andrey Y.; Sboner, Andrea; Esgueva, Raquel; Pflueger, Dorothee; Sougnez, Carrie; Onofrio, Robert; Carter, Scott L.; Park, Kyung; Habegger, Lukas; Ambrogio, Lauren; Fennell, Timothy; Parkin, Melissa; Saksena, Gordon; Voet, Douglas; Ramos, Alex H.; Pugh, Trevor J.; Wilkinson, Jane; Fisher, Sheila; Winckler, Wendy; Mahan, Scott; Ardlie, Kristin; Baldwin, Jennifer; Simons, Jonathan W.; Kitabayashi, Naoki; MacDonald, Theresa Y.; Kantoff, Philip W.; Chin, Lynda; Gabriel, Stacey B.; Gerstein, Mark B.; Golub, Todd R.; Meyerson, Matthew; Tewari, Ashutosh; Lander, Eric S.; Getz, Gad; Rubin, Mark A.; Garraway, Levi A.

2010-01-01

Prostate cancer is the second most common cause of male cancer deaths in the United States. Here we present the complete sequence of seven primary prostate cancers and their paired normal counterparts. Several tumors contained complex chains of balanced rearrangements that occurred within or adjacent to known cancer genes. Rearrangement breakpoints were enriched near open chromatin, androgen receptor and ERG DNA binding sites in the setting of the ETS gene fusion TMPRSS2-ERG, but inversely correlated with these regions in tumors lacking ETS fusions. This observation suggests a link between chromatin or transcriptional regulation and the genesis of genomic aberrations. Three tumors contained rearrangements that disrupted CADM2, and four harbored events disrupting either PTEN (unbalanced events), a prostate tumor suppressor, or MAGI2 (balanced events), a PTEN interacting protein not previously implicated in prostate tumorigenesis. Thus, genomic rearrangements may arise from transcriptional or chromatin aberrancies to engage prostate tumorigenic mechanisms. PMID:21307934

C11orf95-MKL2 is the Resulting Fusion Oncogene of t(11;16)(q13;p13) in Chondroid Lipoma

PubMed Central

Huang, Dali; Sumegi, Janos; Cin, Paola Dal; Reith, John D.; Yasuda, Taketoshi; Nelson, Marilu; Muirhead, David; Bridge, Julia A.

2010-01-01

Chondroid lipoma, a rare benign adipose tissue tumor, may histologically resemble myxoid liposarcoma or extraskeletal myxoid chondrosarcoma, but is genetically distinct. In the current study, an identical reciprocal translocation, t(11;16)(q13;p13) was identified in three chondroid lipomas, a finding consistent with previous isolated reports. A fluorescence in situ hybridization (FISH)-based positional cloning strategy using a series of bacterial artificial chromosome (BAC) probe combinations designed to narrow the 16p13 breakpoint revealed MKL2 as the candidate gene. Subsequent 5′ RACE studies demonstrated C11orf95 as the MKL2 fusion gene partner. MKL/myocardin-like 2 (MKL2) encodes myocardin-related transcription factor B (MRTF-B) in a megakaryoblastic leukemia gene family, and C11orf95 (chromosome 11 open reading frame 95) is a hypothetical protein. Sequencing analysis of RT-PCR generated transcripts from all three chondroid lipomas defined the fusion as occurring between exons 5 and 9 of C11orf95 and MKL2, respectively. Dual-color breakpoint spanning probe sets custom-designed for recognition of the translocation event in interphase cells confirmed the anticipated rearrangements of the C11orf95 and MKL2 loci in all cases. The FISH and RT-PCR assays developed in this study can serve as diagnostic adjuncts for identification of this novel C11orf95-MKL2 fusion oncogene in chondroid lipoma. PMID:20607705

Comprehensive analysis of transcriptome variation uncovers known and novel driver events in T-cell acute lymphoblastic leukemia.

PubMed

Atak, Zeynep Kalender; Gianfelici, Valentina; Hulselmans, Gert; De Keersmaecker, Kim; Devasia, Arun George; Geerdens, Ellen; Mentens, Nicole; Chiaretti, Sabina; Durinck, Kaat; Uyttebroeck, Anne; Vandenberghe, Peter; Wlodarska, Iwona; Cloos, Jacqueline; Foà, Robin; Speleman, Frank; Cools, Jan; Aerts, Stein

2013-01-01

RNA-seq is a promising technology to re-sequence protein coding genes for the identification of single nucleotide variants (SNV), while simultaneously obtaining information on structural variations and gene expression perturbations. We asked whether RNA-seq is suitable for the detection of driver mutations in T-cell acute lymphoblastic leukemia (T-ALL). These leukemias are caused by a combination of gene fusions, over-expression of transcription factors and cooperative point mutations in oncogenes and tumor suppressor genes. We analyzed 31 T-ALL patient samples and 18 T-ALL cell lines by high-coverage paired-end RNA-seq. First, we optimized the detection of SNVs in RNA-seq data by comparing the results with exome re-sequencing data. We identified known driver genes with recurrent protein altering variations, as well as several new candidates including H3F3A, PTK2B, and STAT5B. Next, we determined accurate gene expression levels from the RNA-seq data through normalizations and batch effect removal, and used these to classify patients into T-ALL subtypes. Finally, we detected gene fusions, of which several can explain the over-expression of key driver genes such as TLX1, PLAG1, LMO1, or NKX2-1; and others result in novel fusion transcripts encoding activated kinases (SSBP2-FER and TPM3-JAK2) or involving MLLT10. In conclusion, we present novel analysis pipelines for variant calling, variant filtering, and expression normalization on RNA-seq data, and successfully applied these for the detection of translocations, point mutations, INDELs, exon-skipping events, and expression perturbations in T-ALL.

BCOR Overexpression Is a Highly Sensitive Marker in Round Cell Sarcomas With BCOR Genetic Abnormalities.

PubMed

Kao, Yu-Chien; Sung, Yun-Shao; Zhang, Lei; Jungbluth, Achim A; Huang, Shih-Chiang; Argani, Pedram; Agaram, Narasimhan P; Zin, Angelica; Alaggio, Rita; Antonescu, Cristina R

2016-12-01

With the advent of next-generation sequencing, an increasing number of novel gene fusions and other abnormalities have emerged recently in the spectrum of EWSR1-negative small blue round cell tumors (SBRCTs). In this regard, a subset of SBRCTs harboring either BCOR gene fusions (BCOR-CCNB3, BCOR-MAML3), BCOR internal tandem duplications (ITD), or YWHAE-NUTM2B share a transcriptional signature including high BCOR mRNA expression, as well as similar histologic features. Furthermore, other tumors such as clear cell sarcoma of kidney (CCSK) and primitive myxoid mesenchymal tumor of infancy also demonstrate BCOR ITDs and high BCOR gene expression. The molecular diagnosis of these various BCOR genetic alterations requires an elaborate methodology including custom BAC fluorescence in situ hybridization (FISH) probes and reverse transcription polymerase chain reaction assays. As these tumors show high level of BCOR overexpression regardless of the genetic mechanism involved, either conventional gene fusion or ITD, we sought to investigate the performance of an anti-BCOR monoclonal antibody clone C-10 (sc-514576) as an immunohistochemical marker for sarcomas with BCOR gene abnormalities. Thus we assessed the BCOR expression in a pathologically and genetically well-characterized cohort of 25 SBRCTs, spanning various BCOR-related fusions and ITDs and YWHAE-NUTM2B fusion. In addition, we included related pathologic entities such as 8 CCSKs and other sarcomas with BCOR gene fusions. As a control group we included 20 SBRCTs with various (non-BCOR) genetic abnormalities, 10 fusion-negative SBRCTs, 74 synovial sarcomas, 29 rhabdomyosarcomas, and other sarcoma types. In addition, we evaluated the same study group for SATB2 immunoreactivity, as these tumors also showed SATB2 mRNA upregulation. All SBRCTs with BCOR-MAML3 and BCOR-CCNB3 fusions, as well as most with BCOR ITD (93%), and all CCSKs showed strong and diffuse nuclear BCOR immunoreactivity. Furthermore, all SBRCTs with YWHAE-NUTM2B also were positive. SATB2 stain was also positive in tumors with YWHAE-NUTM2B, BCOR-MAML3, BCOR ITD (75%), BCOR-CCNB3 (71%), and a subset of CCSKs (33%). In conclusion, BCOR immunohistochemical stain is a highly sensitive marker for SBRCTs and CCSKs with BCOR abnormalities and YWHAE-rearrangements and can be used as a useful diagnostic marker in these various molecular subsets. SATB2 immunoreactivity is also present in the majority of this group of tumors.

Multi-layered nanoparticles for penetrating the endosome and nuclear membrane via a step-wise membrane fusion process.

PubMed

Akita, Hidetaka; Kudo, Asako; Minoura, Arisa; Yamaguti, Masaya; Khalil, Ikramy A; Moriguchi, Rumiko; Masuda, Tomoya; Danev, Radostin; Nagayama, Kuniaki; Kogure, Kentaro; Harashima, Hideyoshi

2009-05-01

Efficient targeting of DNA to the nucleus is a prerequisite for effective gene therapy. The gene-delivery vehicle must penetrate through the plasma membrane, and the DNA-impermeable double-membraned nuclear envelope, and deposit its DNA cargo in a form ready for transcription. Here we introduce a concept for overcoming intracellular membrane barriers that involves step-wise membrane fusion. To achieve this, a nanotechnology was developed that creates a multi-layered nanoparticle, which we refer to as a Tetra-lamellar Multi-functional Envelope-type Nano Device (T-MEND). The critical structural elements of the T-MEND are a DNA-polycation condensed core coated with two nuclear membrane-fusogenic inner envelopes and two endosome-fusogenic outer envelopes, which are shed in stepwise fashion. A double-lamellar membrane structure is required for nuclear delivery via the stepwise fusion of double layered nuclear membrane structure. Intracellular membrane fusions to endosomes and nuclear membranes were verified by spectral imaging of fluorescence resonance energy transfer (FRET) between donor and acceptor fluorophores that had been dually labeled on the liposome surface. Coating the core with the minimum number of nucleus-fusogenic lipid envelopes (i.e., 2) is essential to facilitate transcription. As a result, the T-MEND achieves dramatic levels of transgene expression in non-dividing cells.

Xp11.2 translocation renal cell carcinoma with TFE3 gene fusion: A case report.

PubMed

Pan, Xiang; Quan, Jing; Zhao, Liwen; Li, Wenhua; Wei, Benlin; Yang, Shangqi; Lai, Yongqing

2018-01-01

Xp11.2 translocation renal cell carcinoma (RCC) with transcription factor E3 (TFE3) gene fusion is a rare tumor, and the prognosis of this tumor is poorer compared with that of other subtypes of RCC. The patient presented herein was a 70-year-old man who presented with a solid mass sized ~8.2×6.1 cm in the right kidney and underwent radical right nephrectomy. Following pathological and immunohistochemical (IHC) examination and fluorescent in situ hybridization (FISH), the patient was diagnosed with Xp11.2 translocation RCC with TFE3 gene fusion. These tumors are more commonly encountered in children rather than in adults, and adult Xp11.2 translocation RCC is associated with a poorer prognosis compared with its pediatric counterpart. IHC assay and FISH are important diagnostic methods. However, there is currently no established effective treatment for Xp11.2 RCC.

Xp11.2 translocation renal cell carcinoma with TFE3 gene fusion: A case report

PubMed Central

Pan, Xiang; Quan, Jing; Zhao, Liwen; Li, Wenhua; Wei, Benlin; Yang, Shangqi; Lai, Yongqing

2018-01-01

Xp11.2 translocation renal cell carcinoma (RCC) with transcription factor E3 (TFE3) gene fusion is a rare tumor, and the prognosis of this tumor is poorer compared with that of other subtypes of RCC. The patient presented herein was a 70-year-old man who presented with a solid mass sized ~8.2×6.1 cm in the right kidney and underwent radical right nephrectomy. Following pathological and immunohistochemical (IHC) examination and fluorescent in situ hybridization (FISH), the patient was diagnosed with Xp11.2 translocation RCC with TFE3 gene fusion. These tumors are more commonly encountered in children rather than in adults, and adult Xp11.2 translocation RCC is associated with a poorer prognosis compared with its pediatric counterpart. IHC assay and FISH are important diagnostic methods. However, there is currently no established effective treatment for Xp11.2 RCC. PMID:29399348

A Critical Role for CRM1 in Regulating HOXA Gene Transcription in CALM-AF10 Leukemias

PubMed Central

Conway, Amanda E.; Haldeman, Jonathan M.; Wechsler, Daniel S.; Lavau, Catherine P.

2014-01-01

The leukemogenic CALM-AF10 fusion protein is found in patients with immature acute myeloid and T-lymphoid malignancies. CALM-AF10 leukemias display abnormal H3K79 methylation and increased HOXA cluster gene transcription. Elevated expression of HOXA genes is critical for leukemia maintenance and progression; however, the precise mechanism by which CALM-AF10 alters HOXA gene expression is unclear. We previously determined that CALM contains a CRM1-dependent nuclear export signal (NES), which is both necessary and sufficient for CALM-AF10-mediated leukemogenesis. Here, we find that interaction of CALM-AF10 with the nuclear export receptor CRM1 is necessary for activating HOXA gene expression. We show that CRM1 localizes to HOXA loci where it recruits CALM-AF10, leading to transcriptional and epigenetic activation of HOXA genes. Genetic and pharmacological inhibition of the CALM-CRM1 interaction prevents CALM-AF10 enrichment at HOXA chromatin, resulting in immediate loss of transcription. These results provide a comprehensive mechanism by which the CALM-AF10 translocation activates the critical HOXA cluster genes. Furthermore, this report identifies a novel function of CRM1: the ability to bind chromatin and recruit the NES-containing CALM-AF10 transcription factor. PMID:25027513

Designed Transcriptional Regulation in Mammalian Cells Based on TALE- and CRISPR/dCas9.

PubMed

Lebar, Tina; Jerala, Roman

2018-01-01

Transcriptional regulation lies at the center of many cellular processes and is the result of cellular response to different external and internal signals. Control of transcription of selected genes enables an unprecedented access to shape the cellular response. While orthogonal transcription factors from bacteria, yeast, plants, or other cells have been used to introduce new cellular logic into mammalian cells, the discovery of designable modular DNA binding domains, such as Transcription Activator-Like Effectors (TALEs) and the CRISPR system, enable targeting of almost any selected DNA sequence. Fusion or conditional association of DNA targeting domain with transcriptional effector domains enables controlled regulation of almost any endogenous or ectopic gene. Moreover, the designed regulators can be linked into genetic circuits to implement complex responses, such as different types of Boolean functions and switches. In this chapter, we describe the protocols for achieving efficient transcriptional regulation with TALE- and CRISPR-based designed transcription factors in mammalian cells.

Massive NGS Data Analysis Reveals Hundreds Of Potential Novel Gene Fusions in Human Cell Lines.

PubMed

Gioiosa, Silvia; Bolis, Marco; Flati, Tiziano; Massini, Annalisa; Garattini, Enrico; Chillemi, Giovanni; Fratelli, Maddalena; Castrignanò, Tiziana

2018-06-01

Gene fusions derive from chromosomal rearrangements and the resulting chimeric transcripts are often endowed with oncogenic potential. Furthermore, they serve as diagnostic tools for the clinical classification of cancer subgroups with different prognosis and, in some cases, they can provide specific drug targets. So far, many efforts have been carried out to study gene fusion events occurring in tumor samples. In recent years, the availability of a comprehensive Next Generation Sequencing dataset for all the existing human tumor cell lines has provided the opportunity to further investigate these data in order to identify novel and still uncharacterized gene fusion events. In our work, we have extensively reanalyzed 935 paired-end RNA-seq experiments downloaded from "The Cancer Cell Line Encyclopedia" repository, aiming at addressing novel putative cell-line specific gene fusion events in human malignancies. The bioinformatics analysis has been performed by the execution of four different gene fusion detection algorithms. The results have been further prioritized by running a bayesian classifier which makes an in silico validation. The collection of fusion events supported by all of the predictive softwares results in a robust set of ∼ 1,700 in-silico predicted novel candidates suitable for downstream analyses. Given the huge amount of data and information produced, computational results have been systematized in a database named LiGeA. The database can be browsed through a dynamical and interactive web portal, further integrated with validated data from other well known repositories. Taking advantage of the intuitive query forms, the users can easily access, navigate, filter and select the putative gene fusions for further validations and studies. They can also find suitable experimental models for a given fusion of interest. We believe that the LiGeA resource can represent not only the first compendium of both known and putative novel gene fusion events in the catalog of all of the human malignant cell lines, but it can also become a handy starting point for wet-lab biologists who wish to investigate novel cancer biomarkers and specific drug targets.

Ewing's sarcoma precursors are highly enriched in embryonic osteochondrogenic progenitors.

PubMed

Tanaka, Miwa; Yamazaki, Yukari; Kanno, Yohei; Igarashi, Katsuhide; Aisaki, Ken-ichi; Kanno, Jun; Nakamura, Takuro

2014-07-01

Ewing's sarcoma is a highly malignant bone tumor found in children and adolescents, and the origin of this malignancy is not well understood. Here, we introduced a Ewing's sarcoma-associated genetic fusion of the genes encoding the RNA-binding protein EWS and the transcription factor ETS (EWS-ETS) into a fraction of cells enriched for osteochondrogenic progenitors derived from the embryonic superficial zone (eSZ) of long bones collected from late gestational murine embryos. EWS-ETS fusions efficiently induced Ewing's sarcoma-like small round cell sarcoma formation by these cells. Analysis of the eSZ revealed a fraction of a precursor cells that express growth/differentiation factor 5 (Gdf5), the transcription factor Erg, and parathyroid hormone-like hormone (Pthlh), and selection of the Pthlh-positive fraction alone further enhanced EWS-ETS-dependent tumor induction. Genes downstream of the EWS-ETS fusion protein were quite transcriptionally active in eSZ cells, especially in regions in which the chromatin structure of the ETS-responsive locus was open. Inhibition of β-catenin, poly (ADP-ribose) polymerase 1 (PARP1), or enhancer of zeste homolog 2 (EZH2) suppressed cell growth in a murine model of Ewing's sarcoma, suggesting the utility of the current system as a preclinical model. These results indicate that eSZ cells are highly enriched in precursors to Ewing's sarcoma and provide clues to the histogenesis of Ewing's sarcoma in bone.

Directing an artificial zinc finger protein to new targets by fusion to a non-DNA-binding domain.

PubMed

Lim, Wooi F; Burdach, Jon; Funnell, Alister P W; Pearson, Richard C M; Quinlan, Kate G R; Crossley, Merlin

2016-04-20

Transcription factors are often regarded as having two separable components: a DNA-binding domain (DBD) and a functional domain (FD), with the DBD thought to determine target gene recognition. While this holds true for DNA bindingin vitro, it appears thatin vivoFDs can also influence genomic targeting. We fused the FD from the well-characterized transcription factor Krüppel-like Factor 3 (KLF3) to an artificial zinc finger (AZF) protein originally designed to target the Vascular Endothelial Growth Factor-A (VEGF-A) gene promoter. We compared genome-wide occupancy of the KLF3FD-AZF fusion to that observed with AZF. AZF bound to theVEGF-Apromoter as predicted, but was also found to occupy approximately 25,000 other sites, a large number of which contained the expected AZF recognition sequence, GCTGGGGGC. Interestingly, addition of the KLF3 FD re-distributes the fusion protein to new sites, with total DNA occupancy detected at around 50,000 sites. A portion of these sites correspond to known KLF3-bound regions, while others contained sequences similar but not identical to the expected AZF recognition sequence. These results show that FDs can influence and may be useful in directing AZF DNA-binding proteins to specific targets and provide insights into how natural transcription factors operate. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

The novel ER membrane protein PRO41 is essential for sexual development in the filamentous fungus Sordaria macrospora.

PubMed

Nowrousian, Minou; Frank, Sandra; Koers, Sandra; Strauch, Peter; Weitner, Thomas; Ringelberg, Carol; Dunlap, Jay C; Loros, Jennifer J; Kück, Ulrich

2007-05-01

The filamentous fungus Sordaria macrospora develops complex fruiting bodies (perithecia) to propagate its sexual spores. Here, we present an analysis of the sterile mutant pro41 that is unable to produce mature fruiting bodies. The mutant carries a deletion of 4 kb and is complemented by the pro41 open reading frame that is contained within the region deleted in the mutant. In silico analyses predict PRO41 to be an endoplasmic reticulum (ER) membrane protein, and a PRO41-EGFP fusion protein colocalizes with ER-targeted DsRED. Furthermore, Western blot analysis shows that the PRO41-EGFP fusion protein is present in the membrane fraction. A fusion of the predicted N-terminal signal sequence of PRO41 with EGFP is secreted out of the cell, indicating that the signal sequence is functional. pro41 transcript levels are upregulated during sexual development. This increase in transcript levels was not observed in the sterile mutant pro1 that lacks a transcription factor gene. Moreover, microarray analysis of gene expression in the mutants pro1, pro41 and the pro1/41 double mutant showed that pro41 is partly epistatic to pro1. Taken together, these data show that PRO41 is a novel ER membrane protein essential for fruiting body formation in filamentous fungi.

The novel ER membrane protein PRO41 is essential for sexual development in the filamentous fungus Sordaria macrospora

PubMed Central

Nowrousian, Minou; Frank, Sandra; Koers, Sandra; Strauch, Peter; Weitner, Thomas; Ringelberg, Carol; Dunlap, Jay C.; Loros, Jennifer J.; Kück, Ulrich

2013-01-01

Summary The filamentous fungus Sordaria macrospora develops complex fruiting bodies (perithecia) to propagate its sexual spores. Here, we present an analysis of the sterile mutant pro41 that is unable to produce mature fruiting bodies. The mutant carries a deletion of 4 kb and is complemented by the pro41 open reading frame that is contained within the region deleted in the mutant. In silico analyses predict PRO41 to be an endoplasmic reticulum (ER) membrane protein, and a PRO41–EGFP fusion protein colocalizes with ER-targeted DsRED. Furthermore, Western blot analysis shows that the PRO41–EGFP fusion protein is present in the membrane fraction. A fusion of the predicted N-terminal signal sequence of PRO41 with EGFP is secreted out of the cell, indicating that the signal sequence is functional. pro41 transcript levels are upregulated during sexual development. This increase in transcript levels was not observed in the sterile mutant pro1 that lacks a transcription factor gene. Moreover, microarray analysis of gene expression in the mutants pro1, pro41 and the pro1/41 double mutant showed that pro41 is partly epistatic to pro1. Taken together, these data show that PRO41 is a novel ER membrane protein essential for fruiting body formation in filamentous fungi. PMID:17501918

Identification and Transcript Analysis of the TCP Transcription Factors in the Diploid Woodland Strawberry Fragaria vesca

PubMed Central

Wei, Wei; Hu, Yang; Cui, Meng-Yuan; Han, Yong-Tao; Gao, Kuan; Feng, Jia-Yue

2016-01-01

Plant-specific TEOSINTE BRANCHED 1, CYCLOIDEA, and PROLIFERATING CELL FACTORS (TCP) transcription factors play versatile functions in multiple processes of plant growth and development. However, no systematic study has been performed in strawberry. In this study, 19 FvTCP genes were identified in the diploid woodland strawberry (Fragaria vesca) accession Heilongjiang-3. Phylogenetic analysis suggested that the FvTCP genes were classified into two main classes, with the second class further divided into two subclasses, which was supported by the exon-intron organizations and the conserved motif structures. Promoter analysis revealed various cis-acting elements related to growth and development, hormone and/or stress responses. We analyzed FvTCP gene transcript accumulation patterns in different tissues and fruit developmental stages. Among them, 12 FvTCP genes exhibited distinct tissue-specific transcript accumulation patterns. Eleven FvTCP genes were down-regulated in different fruit developmental stages, while five FvTCP genes were up-regulated. Transcripts of FvTCP genes also varied with different subcultural propagation periods and were induced by hormone treatments and biotic and abiotic stresses. Subcellular localization analysis showed that six FvTCP-GFP fusion proteins showed distinct localizations in Arabidopsis mesophyll protoplasts. Notably, transient over-expression of FvTCP9 in strawberry fruits dramatically affected the expression of a series of genes implicated in fruit development and ripening. Taken together, the present study may provide the basis for functional studies to reveal the role of this gene family in strawberry growth and development. PMID:28066489

Structural characterization of the FKHR gene and its rearrangement in alveolar rhabdomyosarcoma.

PubMed

Davis, R J; Bennicelli, J L; Macina, R A; Nycum, L M; Biegel, J A; Barr, F G

1995-12-01

The FKHR gene, which contains a forkhead DNA-binding motif, is fused to either PAX3 or PAX7 by the t(2;13) or t(1;13) translocation in alveolar rhabdomyosarcoma,respectively. These tumors express chimeric transcripts encoding the N-terminal portion of either PAX protein fused to the C-terminal portion of FKHR. To understand the structural basis and functional consequences of these translocations, we characterized the wild-type FKHR gene and its rearrangement in alveolar rhabdomyosarcomas. By isolating and analyzing phage, cosmid and YAC clones, we determined that FKHR consists of three exons spanning 140 kb and that several highly similar loci are present in other genomic regions. Exon 1 encodes the N-terminus of the forkhead domain and is embedded within demethylated CpG island. RNA analyses reveal FKHR transcripts initiate from a TATA-less promoter within this island. Exon 2 encodes the C-terminus of the forkhead domain and a transcription activation domain, whereas exon 3 encodes a large 3' untranslated region. The intron 1-exon 2 boundary precisely matches the FHKR fusion point in the chimeric transcripts found in alveolar rhabdomyosarcomas. Using pulsed-field and fluorescence in situ hybridization analyses, we demonstrate that the 130kb FKHR intron 1 is rearranged in t(2;13)-containing alveolar rhabdomyosarcomas. Our findings indicate that FKHR intron 1 provides a large target for DNA rearrangemnt. Rearrangement of this intron with PAX3 produces two important functional consequences: in-frame fusion of N-terminal PAX3 sequences to the FKHR transcriptional activation domain and disruption of the FKHR DNA binding domain.

Expression of ACC oxidase promoter-GUS fusions in tomato and Nicotiana plumbaginifolia regulated by developmental and environmental stimuli.

PubMed

Blume, B; Grierson, D

1997-10-01

The enzyme ACC oxidase, catalysing the last step in the biosynthesis of the plant hormone ethylene, is encoded by a small multigene family in tomato, comprising three members, LEACO1, LEACO2 and LEACO3. LEACO1 is the major gene expressed during ripening, leaf senescence, and wounding (Barry et al., 1996). To investigate the transcriptional regulation of ACC oxidase gene expression, chimeric fusions between the beta-glucuronidase reporter gene and 97 bp of 5' UTR plus 124, 396 and 1825 bp, respectively, of 5' untranscribed LEACO1 sequence were constructed and introduced into Lycopersicon esculentum (Mill cv. Ailsa Craig) and Nicotiana plumbaginifolia. Analysis of transgenic tomatoes indicated that the region containing nucleotides -124 to +97 of the LEACO1 gene is sufficient to confer a marked increase in GUS activity during fruit ripening, albeit at very low levels. Fusion of 396 and 1825 bp of LEACO1 upstream sequence resulted in strong and specific induction of GUS expression in situations known to be accompanied by enhanced ethylene production. Reporter gene expression was similar to that of the endogenous LEACO1 gene, with major increases especially during fruit ripening, senescence and abscission of leaves and, to a lesser extent, of flowers. Analysis of transgenic N. plumbaginifolia plants confirmed the pattern of LEACO1 promoter activity detected in tomato leaves and flowers. Reporter gene expression was also induced following wounding, treatment with ethylene, and pathogen infection. Histochemical analysis illustrated localized GUS activity in the pericarp of ripening fruit, abscission zones of senescent petioles and unfertilized flowers, and at wound sites. These results demonstrate that ACC oxidase is regulated at the transcriptional level in a wide range of cell types at different developmental stages and in response to several external stimuli.

A novel type of EWS-CHOP fusion gene in myxoid liposarcoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Matsui, Yoshito; Ueda, Takafumi; Kubo, Takahiro

2006-09-22

The cytogenetic hallmark of myxoid type and round cell type liposarcoma consists of reciprocal translocation of t(12;16)(q13;p11) and t(12;22)(q13;q12), which results in fusion of TLS/FUS and CHOP, and EWS and CHOP, respectively. Nine structural variations of the TLS/FUS-CHOP chimeric transcript have been reported, however, only two types of EWS-CHOP have been described. We describe here a case of myxoid liposarcoma containing a novel EWS-CHOP chimeric transcript and identified the breakpoint occurring in intron 13 of EWS. Reverse transcription-polymerase chain reaction and direct sequence showed that exon 13 of EWS was in-frame fused to exon 2 of CHOP. Genomic analysis revealedmore » that the breaks were located in intron 13 of EWS and intron 1 of CHOP.« less

Xp11.2 translocation renal cell carcinoma with PSF-TFE3 rearrangement.

PubMed

Zhong, Minghao; Weisman, Paul; Zhu, Bing; Brassesco, Maria; Yang, Youfeng; Linehan, W Marston; Merino, Maria J; Zhang, David; Rohan, Stephen; Cai, Dongming; Yang, Ximing

2013-06-01

Xp11.2 translocation renal cell carcinoma (Xp11.2 RCC) is a subtype of RCC characterized by translocations involving a breakpoint at the TFE3 gene (Xp11.2). Moderate to strong nuclear TFE3 immunoreactivity has been recognized as a specific diagnostic marker for this type of tumor. However, exclusive cytoplasmic localization of a TFE3 fusion protein was reported in UOK 145 cells, a cell line derived from an Xp11.2 RCC harboring the PSF-TFE3 translocation. If reproducible using immunohistochemistry (IHC), this finding would have important implications for pathologists in the diagnosis of Xp11.2 RCC, calling into question the specificity of nuclear immunoreactivity for TFE3 in these tumors. The purpose of this study was to determine whether the above-noted cytoplasmic localization of the TFE3 fusion protein could be reproduced using IHC. UOK 145 cells and fresh frozen tissue from 2 clinical cases of Xp11.2 RCC found to harbor the PSF-TFE3 gene rearrangement (by cytogenetic testing) were collected. All samples were subjected to histopathologic evaluation by board-certified pathologists, TFE3 IHC, reverse transcription polymerase chain reaction, and Sanger sequencing analysis. A strong nuclear TFE3 immunoreactivity was demonstrated in all samples including the UOK 145 cell line. No cytoplasmic immunoreactivity was seen. Reverse transcription polymerase chain reaction and Sanger sequencing confirmed the previously reported PSF-TFE3 gene fusion between exon 9 of PSF and exon 6 of TFE3 in the UOK 145 cell line and in one of 2 clinical cases of Xp11.2 RCC. A novel PSF-TFE3 gene fusion between exon 9 of PSF and exon 5 of TFE3 was detected in the second clinical case of Xp11.2 RCC.

Gene array analysis reveals a common Runx transcriptional program controlling cell adhesion and survival

PubMed Central

Wotton, Sandy; Terry, Anne; Kilbey, Anna; Jenkins, Alma; Herzyk, Pawel; Cameron, Ewan; Neil, James C.

2008-01-01

The Runx genes play divergent roles in development and cancer, where they can act either as oncogenes or tumour suppressors. We compared the effects of ectopic Runx expression in established fibroblasts, where all three genes produce an indistinguishable phenotype entailing epithelioid morphology and increased cell survival under stress conditions. Gene array analysis revealed a strongly overlapping transcriptional signature, with no examples of opposing regulation of the same target gene. A common set of 50 highly regulated genes was identified after further filtering on regulation by inducible RUNX1-ER. This set revealed a strong bias towards genes with annotated roles in cancer and development, and a preponderance of targets encoding extracellular or surface proteins, reflecting the marked effects of Runx on cell adhesion. Furthermore, in silico prediction of resistance to glucocorticoid growth inhibition was confirmed in fibroblasts and lymphoid cells expressing ectopic Runx. The effects of fibroblast expression of common RUNX1 fusion oncoproteins (RUNX1-ETO, TEL-RUNX1, CBFB-MYH11) were also tested. While two direct Runx activation target genes were repressed (Ncam1, Rgc32), the fusion proteins appeared to disrupt regulation of down-regulated targets (Cebpd, Id2, Rgs2) rather than impose constitutive repression. These results elucidate the oncogenic potential of the Runx family and reveal novel targets for therapeutic inhibition. PMID:18560354

Gene trapping in differentiating cell lines: regulation of the lysosomal protease cathepsin B in skeletal myoblast growth and fusion.

PubMed

Gogos, J A; Thompson, R; Lowry, W; Sloane, B F; Weintraub, H; Horwitz, M

1996-08-01

To identify genes regulated during skeletal muscle differentiation, we have infected mouse C2C12 myoblasts with retroviral gene trap vectors, containing a promoterless marker gene with a 5' splice acceptor signal. Integration of the vector adjacent to an actively transcribed gene places the marker under the transcriptional control of the endogenous gene, while the adjacent vector sequences facilitate cloning. The vector insertionally mutates the trapped locus and may also form fusion proteins with the endogenous gene product. We have screened several hundred clones, each containing a trapping vector integrated into a different endogenous gene. In agreement with previous estimates based on hybridization kinetics, we find that a large proportion of all genes expressed in myoblasts are regulated during differentiation. Many of these genes undergo unique temporal patterns of activation or repression during cell growth and myotube formation, and some show specific patterns of subcellular localization. The first gene we have identified with this strategy is the lysosomal cysteine protease cathepsin B. Expression from the trapped allele is upregulated during early myoblast fusion and downregulated in myotubes. A direct role for cathepsin B in myoblast growth and fusion is suggested by the observation that the trapped cells deficient in cathepsin B activity have an unusual morphology and reduced survival in low-serum media and undergo differentiation with impaired cellular fusion. The phenotype is reproduced by antisense cathepsin B expression in parental C2C12 myoblasts. The cellular phenotype is similar to that observed in cultured myoblasts from patients with I cell disease, in which there is diminished accumulation of lysosomal enzymes. This suggests that a specific deficiency of cathepsin B could contribute to the myopathic component of this illness.

Identification of PPAP2B as a novel recurrent translocation partner gene of HMGA2 in lipomas.

PubMed

Bianchini, Laurence; Birtwisle, Loïc; Saâda, Esma; Bazin, Audrey; Long, Elodie; Roussel, Jean-François; Michiels, Jean-François; Forest, Fabien; Dani, Christian; Myklebost, Ola; Birtwisle-Peyrottes, Isabelle; Pedeutour, Florence

2013-06-01

Most lipomas are characterized by translocations involving the HMGA2 gene in 12q14.3. These rearrangements lead to the fusion of HMGA2 with an ectopic sequence from the translocation chromosome partner. Only five fusion partners of HMGA2 have been identified in lipomas so far. The identification of novel fusion partners of HMGA2 is important not only for diagnosis in soft tissue tumors but also because these genes might have an oncogenic role in other tumors. We observed that t(1;12)(p32;q14) was the second most frequent translocation in our series of lipomas after t(3;12)(q28;q14.3). We detected overexpression of HMGA2 mRNA and protein in all t(1;12)(p32;q14) lipomas. We used a fluorescence in situ hybridization-based positional cloning strategy to characterize the 1p32 breakpoint. In 11 cases, we identified PPAP2B, a member of the lipid phosphate phosphatases family as the 1p32 target gene. Reverse transcription-polymerase chain reaction analysis followed by nucleotide sequencing of the fusion transcript indicated that HMGA2 3' untranslated region (3'UTR) fused with exon 6 of PPAP2B in one case. In other t(1;12) cases, the breakpoint was extragenic, located in the 3'region flanking PPAP2B 3'UTR. Moreover, in one case showing a t(1;6)(p32;p21) we observed a rearrangement of PPAP2B and HMGA1, which suggests that HMGA1 might also be a fusion partner for PPAP2B. Our results also revealed that adipocytic differentiation of human mesenchymal stem cells derived from adipose tissue was associated with a significant decrease in PPAP2B mRNA expression suggesting that PPAP2B might play a role in adipogenesis. Copyright © 2013 Wiley Periodicals, Inc.

Identification of a transcriptional activation domain in yeast repressor activator protein 1 (Rap1) using an altered DNA-binding specificity variant

PubMed Central

Johnson, Amanda N.; Weil, P. Anthony

2017-01-01

Repressor activator protein 1 (Rap1) performs multiple vital cellular functions in the budding yeast Saccharomyces cerevisiae. These include regulation of telomere length, transcriptional repression of both telomere-proximal genes and the silent mating type loci, and transcriptional activation of hundreds of mRNA-encoding genes, including the highly transcribed ribosomal protein- and glycolytic enzyme-encoding genes. Studies of the contributions of Rap1 to telomere length regulation and transcriptional repression have yielded significant mechanistic insights. However, the mechanism of Rap1 transcriptional activation remains poorly understood because Rap1 is encoded by a single copy essential gene and is involved in many disparate and essential cellular functions, preventing easy interpretation of attempts to directly dissect Rap1 structure-function relationships. Moreover, conflicting reports on the ability of Rap1-heterologous DNA-binding domain fusion proteins to serve as chimeric transcriptional activators challenge use of this approach to study Rap1. Described here is the development of an altered DNA-binding specificity variant of Rap1 (Rap1AS). We used Rap1AS to map and characterize a 41-amino acid activation domain (AD) within the Rap1 C terminus. We found that this AD is required for transcription of both chimeric reporter genes and authentic chromosomal Rap1 enhancer-containing target genes. Finally, as predicted for a bona fide AD, mutation of this newly identified AD reduced the efficiency of Rap1 binding to a known transcriptional coactivator TFIID-binding target, Taf5. In summary, we show here that Rap1 contains an AD required for Rap1-dependent gene transcription. The Rap1AS variant will likely also be useful for studies of the functions of Rap1 in other biological pathways. PMID:28196871

A Genetic Selection For Neurospora crassa Mutants Altered in Their Light Regulation of Transcription

PubMed Central

Navarro-Sampedro, Laura; Yanofsky, Charles; Corrochano, Luis M.

2008-01-01

Transcription of the Neurospora crassa gene con-10 is induced during conidiation and following exposure of vegetative mycelia to light, but light activation is transient due to photoadaptation. We describe mutational analyses of photoadaptation using a N. crassa strain bearing a translational fusion of con-10, including its regulatory region, to a selectable bacterial gene conferring hygromycin resistance (hph). Growth of this strain was sensitive to hygromycin, upon continuous culture in the light. Five mutants were isolated that were resistant to hygromycin when cultured under constant light. Three mutant strains displayed elevated, sustained accumulation of con-10∷hph mRNA during continued light exposure, suggesting that they bear mutations that reduce or eliminate the presumed light-dependent repression mechanism that blocks con-10 transcription upon prolonged illumination. These mutations altered photoadaptation for only a specific group of genes (con-10 and con-6), suggesting that regulation of photoadaptation is relatively gene specific. The mutations increased light-dependent mRNA accumulation for genes al-1, al-2, and al-3, each required for carotenoid biosynthesis, resulting in a threefold increase in carotenoid accumulation following continuous light exposure. Identification of the altered gene or genes in these mutants may reveal novel proteins that participate in light regulation of gene transcription in fungi. PMID:18202366

Performance characteristics of a reverse transcriptase-polymerase chain reaction assay for the detection of tumor-specific fusion transcripts from archival tissue.

PubMed

Fritsch, Michael K; Bridge, Julia A; Schuster, Amy E; Perlman, Elizabeth J; Argani, Pedram

2003-01-01

Pediatric small round cell tumors still pose tremendous diagnostic problems. In difficult cases, the ability to detect tumor-specific gene fusion transcripts for several of these neoplasms, including Ewing sarcoma/peripheral primitive neuroectodermal tumor (ES/PNET), synovial sarcoma (SS), alveolar rhabdomyosarcoma (ARMS), and desmoplastic small round cell tumor (DSRCT) using reverse transcriptase-polymerase chain reaction (RT-PCR), can be extremely helpful. Few studies to date, however, have systematically examined several different tumor types for the presence of multiple different fusion transcripts in order to determine the specificity and sensitivity of the RT-PCR method, and no study has addressed this issue for formalin-fixed material. The objectives of this study were to address the specificity, sensitivity, and practicality of such an assay applied strictly to formalin-fixed tissue blocks. Our results demonstrate that, for these tumors, the overall sensitivity for detecting each fusion transcript is similar to that reported in the literature for RT-PCR on fresh or formalin-fixed tissues. The specificity of the assay is very high, being essentially 100% for each primer pair when interpreting the results from visual inspection of agarose gels. However, when these same agarose gels were examined using Southern blotting, a small number of tumors also yielded reproducibly detectable weak signals for unexpected fusion products, in addition to a strong signal for the expected fusion product. Fluorescence in situ hybridization (FISH) studies in one such case indicated that a rearrangement that would account for the unexpected fusion was not present, while another case was equivocal. The overall specificity for each primer pair used in this assay ranged from 94 to 100%. Therefore, RT-PCR using formalin-fixed paraffin-embedded tissue sections can be used to detect chimeric transcripts as a reliable, highly sensitive, and highly specific diagnostic assay. However, we strongly suggest that the final interpretation of the results from this assay be viewed in light of the other features of the case, including clinical history, histology, and immunohistochemistry, by the diagnostic pathologist. Additional studies such as FISH may be useful in clarifying the nature of equivocal or unexpected results.

MYB and MYBL1 in adenoid cystic carcinoma: diversity in the mode of genomic rearrangement and transcripts.

PubMed

Togashi, Yuki; Dobashi, Akito; Sakata, Seiji; Sato, Yukiko; Baba, Satoko; Seto, Akira; Mitani, Hiroki; Kawabata, Kazuyoshi; Takeuchi, Kengo

2018-02-06

MYB-NFIB and MYBL1-NFIB have been reported in ~60% of adenoid cystic carcinoma cases, but driver alterations in the remaining ~40% of adenoid cystic carcinoma remain unclear. We examined 100 adenoid cystic carcinoma cases for MYB and MYBL1 locus rearrangements by fluorescence in situ hybridization (FISH) with originally designed probe sets using formalin-fixed paraffin-embedded materials. Approximately one-third of samples were also analyzed by fusion transcript-specific RT-PCR and capture RNA sequencing. In the 27 cases with frozen materials, MYB-NFIB and MYBL1-NFIB fusion transcripts were detected in 9 (33%) and 6 cases (22%) by RT-PCR, respectively. Meanwhile, high expression of MYB (18 cases, 67%) or MYBL1 (9 cases, 33%) was detected in all 27 cases in a mutually exclusive manner, regardless of its form (full-length, truncation, or fusion transcript). Interestingly, genomic rearrangements around the corresponding highly-expressed gene were observed in all 27 cases by FISH, suggesting a causative relationship between genomic rearrangements and gene expression. Among the 100 cases, including additional 73 cases, 97 harbored genomic rearrangements in the MYB (73 cases) or MYBL1 locus (24 cases) including 10 cases with atypical FISH patterns undetectable through ordinary split FISH approaches: breakpoints far distant from MYB (5 cases) and a small NFIB locus insertion into the MYB (3 cases) or MYBL1 locus (2 cases). In clinicopathological analyses, histological grade, primary tumor size, and lymph node metastasis were identified as prognostic factors, whereas MYB/MYBL1 rearrangements were not, but were associated with histological grade. In the present study, MYB or MYBL1 locus rearrangement was detected in nearly all adenoid cystic carcinoma cases, and therefore it would be a good diagnostic marker for adenoid cystic carcinoma. However, fusion transcript-specific RT-PCR for MYB-NFIB and MYBL1-NFIB and ordinary split FISH assays for MYB and MYBL1 were less sensitive, and thus detection methods should be judiciously designed because of the diversity of rearrangement modes in adenoid cystic carcinoma.

MiT family translocation renal cell carcinoma.

PubMed

Argani, Pedram

2015-03-01

The MiT subfamily of transcription factors includes TFE3, TFEB, TFC, and MiTF. Gene fusions involving two of these transcription factors have been identified in renal cell carcinoma (RCC). The Xp11 translocation RCCs were first officially recognized in the 2004 WHO renal tumor classification, and harbor gene fusions involving TFE3. The t(6;11) RCCs harbor a specific Alpha-TFEB gene fusion and were first officially recognized in the 2013 International Society of Urologic Pathology (ISUP) Vancouver classification of renal neoplasia. These two subtypes of translocation RCC have many similarities. Both were initially described in and disproportionately involve young patients, though adult translocation RCC may overall outnumber pediatric cases. Both often have unusual and distinctive morphologies; the Xp11 translocation RCCs frequently have clear cells with papillary architecture and abundant psammomatous bodies, while the t(6;11) RCCs frequently have a biphasic appearance with both large and small epithelioid cells and nodules of basement membrane material. However, the morphology of these two neoplasms can overlap, with one mimicking the other. Both of these RCCs underexpress epithelial immunohistochemical markers like cytokeratin and epithelial membrane antigen (EMA) relative to most other RCCs. Unlike other RCCs, both frequently express the cysteine protease cathepsin k and often express melanocytic markers like HMB45 and Melan A. Finally, TFE3 and TFEB have overlapping functional activity as these two transcription factors frequently heterodimerize and bind to the same targets. Therefore, on the basis of clinical, morphologic, immunohistochemical, and genetic similarities, the 2013 ISUP Vancouver classification of renal neoplasia grouped these two neoplasms together under the heading of "MiT family translocation RCC." This review summarizes our current knowledge of these recently described RCCs. Copyright © 2015 Elsevier Inc. All rights reserved.

A sensitive and high throughput TaqMan-based reverse transcription quantitative polymerase chain reaction assay efficiently discriminates ALK rearrangement from overexpression for lung cancer FFPE specimens.

PubMed

Lung, Jrhau; Lin, Yu-Ching; Hung, Ming-Szu; Jiang, Yuan Yuan; Lee, Kuan-Der; Lin, Paul Yann; Tsai, Ying Huang

2016-04-01

ALK fusion gene is an oncogenic driver in lung cancer with low prevalence, which can be ameliorated by crizotinib. Currently, ALK fusion gene can be diagnosed by fluorescence in situ hybridization (FISH) and immunohistochemistry (IHC), but inconstistnt results between the two methods are encountered regularly. To make the ALK fusion gene screening more efficient and to provide a simple solution to clarify the discrepancy between FISH and IHC results, a sensitive TaqMan-based reverse transcription quantitative polymerase chain reaction (RT-qPCR) assay was established. The 3-plex TaqMan-based RT-qPCR assay was established and performed on 102 archived formalin-fixed, paraffin-embedded (FFPE) NSCLC samples to detect ALK rearrangement and overexpression. Break-apart FISH and automatic immunohistochemistry based ALK assays were performed side by side using tissue microarray. The RT-qPCR was performed successfully for 80 samples and 10 of them showed positive signals. Three out of the 10 qPCR positive cases were further confirmed by FISH and IHC test. Two others were IHC positive and FISH negative, and expressed full-length ALK transcript. The rest were neither FISH nor IHC positive and their ALK expression level was significantly lower than those FISH or IHC positive cases. Our RT-qPCR assay demonstrates that the capability and reliability of ALK detection is comparable to FISH and IHC, but it is more effective at discriminating ALK rearrangement from overexpression. The RT-qPCR assay easily clarifies the discrepancy between FISH and IHC, and can be incorporated into routine ALK screening for lung cancer. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Retinoic acid induces proteasome-dependent degradation of retinoic acid receptor α (RARα) and oncogenic RARα fusion proteins

PubMed Central

Zhu, Jun; Gianni, Maurizio; Kopf, Eliezer; Honoré, Nicole; Chelbi-Alix, Mounira; Koken, Marcel; Quignon, Frédérique; Rochette-Egly, Cécile; de Thé, Hugues

1999-01-01

Analyzing the pathways by which retinoic acid (RA) induces promyelocytic leukemia/retinoic acid receptor α (PML/RARα) catabolism in acute promyelocytic leukemia (APL), we found that, in addition to caspase-mediated PML/RARα cleavage, RA triggers degradation of both PML/RARα and RARα. Similarly, in non-APL cells, RA directly targeted RARα and RARα fusions to the proteasome degradation pathway. Activation of either RARα or RXRα by specific agonists induced degradation of both proteins. Conversely, a mutation in RARα that abolishes heterodimer formation and DNA binding, blocked both RARα and RXRα degradation. Mutations in the RARα DNA-binding domain or AF-2 transcriptional activation region also impaired RARα catabolism. Hence, our results link transcriptional activation to receptor catabolism and suggest that transcriptional up-regulation of nuclear receptors by their ligands may be a feedback mechanism allowing sustained target-gene activation. PMID:10611294

Positive and negative regulatory regions control the spatial distribution of polygalacturonase transcription in tomato fruit pericarp.

PubMed Central

Montgomery, J; Pollard, V; Deikman, J; Fischer, R L

1993-01-01

The tomato fruit consists of a thick, fleshy pericarp composed predominantly of highly vacuolated parenchymatous cells, which surrounds the seeds. During ripening, the activation of gene expression results in dramatic biochemical and physiological changes in the pericarp. The polygalacturonase (PG) gene, unlike many fruit ripening-induced genes, is not activated by the increase in ethylene hormone concentration associated with the onset of ripening. To investigate ethylene concentration-independent gene transcription in ripe tomato fruit, we analyzed the expression of chimeric PG promoter-beta-glucuronidase (GUS) reporter gene fusions in transgenic tomato plants. We determined that a 1.4-kb PG promoter directs ripening-regulated transcription in outer pericarp but not in inner pericarp cells, with a sharp boundary of PG promoter activity located midway through the pericarp. Promoter deletion analysis indicated that a minimum of three promoter regions influence the spatial regulation of PG transcription. A positive regulatory region from -231 to -134 promotes gene transcription in the outer pericarp of ripe fruit. A second positive regulatory region from -806 to -443 extends gene activity to the inner pericarp. However, a negative regulatory region from -1411 to -1150 inhibits gene transcription in the inner pericarp. DNase I footprint analysis showed that nuclear proteins in unripe and ripe fruit interact with DNA sequences within each of these three regulatory regions. Thus, temporal and spatial control of PG transcription is mediated by the interaction of negative and positive regulatory promoter elements, resulting in gene activity in the outer pericarp but not the inner pericarp of ripe tomato fruit. The expression pattern of PG suggests that, although they are morphologically similar, there is a fundamental difference between the parenchymatous cells within the inner and outer pericarp. PMID:8400876

The Mediator Complex MED15 Subunit Mediates Activation of Downstream Lipid-Related Genes by the WRINKLED1 Transcription Factor.

PubMed

Kim, Mi Jung; Jang, In-Cheol; Chua, Nam-Hai

2016-07-01

The Mediator complex is known to be a master coordinator of transcription by RNA polymerase II, and this complex is recruited by transcription factors (TFs) to target promoters for gene activation or repression. The plant-specific TF WRINKLED1 (WRI1) activates glycolysis-related and fatty acid biosynthetic genes during embryogenesis. However, no Mediator subunit has yet been identified that mediates WRI1 transcriptional activity. Promoter-β-glucuronidase fusion experiments showed that MEDIATOR15 (MED15) is expressed in the same cells in the embryo as WRI1. We found that the Arabidopsis (Arabidopsis thaliana) MED15 subunit of the Mediator complex interacts directly with WRI1 in the nucleus. Overexpression of MED15 or WRI1 increased transcript levels of WRI1 target genes involved in glycolysis and fatty acid biosynthesis; these genes were down-regulated in wild-type or WRI1-overexpressing plants by silencing of MED15 However, overexpression of MED15 in the wri1 mutant also increased transcript levels of WRI1 target genes, suggesting that MED15 also may act with other TFs to activate downstream lipid-related genes. Chromatin immunoprecipitation assays confirmed the association of MED15 with six WRI1 target gene promoters. Additionally, silencing of MED15 resulted in reduced fatty acid content in seedlings and mature seeds, whereas MED15 overexpression increased fatty acid content in both developmental stages. Similar results were found in wri1 mutant and WRI1 overexpression lines. Together, our results indicate that the WRI1/MED15 complex transcriptionally regulates glycolysis-related and fatty acid biosynthetic genes during embryogenesis. © 2016 American Society of Plant Biologists. All Rights Reserved.

The past and presence of gene targeting: from chemicals and DNA via proteins to RNA.

PubMed

Geel, T M; Ruiters, M H J; Cool, R H; Halby, L; Voshart, D C; Andrade Ruiz, L; Niezen-Koning, K E; Arimondo, P B; Rots, M G

2018-06-05

The ability to target DNA specifically at any given position within the genome allows many intriguing possibilities and has inspired scientists for decades. Early gene-targeting efforts exploited chemicals or DNA oligonucleotides to interfere with the DNA at a given location in order to inactivate a gene or to correct mutations. We here describe an example towards correcting a genetic mutation underlying Pompe's disease using a nucleotide-fused nuclease (TFO-MunI). In addition to the promise of gene correction, scientists soon realized that genes could be inactivated or even re-activated without inducing potentially harmful DNA damage by targeting transcriptional modulators to a particular gene. However, it proved difficult to fuse protein effector domains to the first generation of programmable DNA-binding agents. The engineering of gene-targeting proteins (zinc finger proteins (ZFPs), transcription activator-like effectors (TALEs)) circumvented this problem. The disadvantage of protein-based gene targeting is that a fusion protein needs to be engineered for every locus. The recent introduction of CRISPR/Cas offers a flexible approach to target a (fusion) protein to the locus of interest using cheap designer RNA molecules. Many research groups now exploit this platform and the first human clinical trials have been initiated: CRISPR/Cas has kicked off a new era of gene targeting and is revolutionizing biomedical sciences.This article is part of a discussion meeting issue 'Frontiers in epigenetic chemical biology'. © 2018 The Author(s).

The promoter of the cereal VERNALIZATION1 gene is sufficient for transcriptional induction by prolonged cold.

PubMed

Alonso-Peral, Maria M; Oliver, Sandra N; Casao, M Cristina; Greenup, Aaron A; Trevaskis, Ben

2011-01-01

The VERNALIZATION1 (VRN1) gene of temperate cereals is transcriptionally activated by prolonged cold during winter (vernalization) to promote flowering. To investigate the mechanisms controlling induction of VRN1 by prolonged cold, different regions of the VRN1 gene were fused to the GREEN FLUORESCENT PROTEIN (GFP) reporter and expression of the resulting gene constructs was assayed in transgenic barley (Hordeum vulgare). A 2 kb segment of the promoter of VRN1 was sufficient for GFP expression in the leaves and shoot apex of transgenic barley plants. Fluorescence increased at the shoot apex prior to inflorescence initiation and was subsequently maintained in the developing inflorescence. The promoter was also sufficient for low-temperature induction of GFP expression. A naturally occurring insertion in the proximal promoter, which is associated with elevated VRN1 expression and early flowering in some spring wheats, did not abolish induction of VRN1 transcription by prolonged cold, however. A translational fusion of the promoter and transcribed regions of VRN1 to GFP, VRN1::GFP, was localised to nuclei of cells at the shoot apex of transgenic barley plants. The distribution of VRN1::GFP at the shoot apex was similar to the expression pattern of the VRN1 promoter-GFP reporter gene. Fluorescence from the VRN1::GFP fusion protein increased in the developing leaves after prolonged cold treatment. These observations suggest that the promoter of VRN1 is targeted by mechanisms that trigger vernalization-induced flowering in economically important temperate cereal crops.

Expression and Functional Analysis of WRKY Transcription Factors in Chinese Wild Hazel, Corylus heterophylla Fisch

PubMed Central

Liang, Li-Song; Ma, Qing-Hua; Chen, Xin; Zong, Jian-Wei; Wang, Gui-Xi

2015-01-01

Plant WRKY transcription factors are known to regulate various biotic and abiotic stress responses. In this study we identified a total of 30 putative WRKY unigenes in a transcriptome dataset of the Chinese wild Hazel, Corylus heterophylla, a species that is noted for its cold tolerance. Thirteen full-length of these ChWRKY genes were cloned and found to encode complete protein sequences, and they were divided into three groups, based on the number of WRKY domains and the pattern of zinc finger structures. Representatives of each of the groups, Unigene25835 (group I), Unigene37641 (group II) and Unigene20441 (group III), were transiently expressed as fusion proteins with yellow fluorescent fusion protein in Nicotiana benthamiana, where they were observed to accumulate in the nucleus, in accordance with their predicted roles as transcriptional activators. An analysis of the expression patterns of all 30 WRKY genes revealed differences in transcript abundance profiles following exposure to cold, drought and high salinity conditions. Among the stress-inducible genes, 23 were up-regulated by all three abiotic stresses and the WRKY genes collectively exhibited four different patterns of expression in flower buds during the overwintering period from November to April. The organ/tissue related expression analysis showed that 18 WRKY genes were highly expressed in stem but only 2 (Unigene9262 and Unigene43101) were greatest in male anthotaxies. The expression of Unigene37641, a member of the group II WRKY genes, was substantially up-regulated by cold, drought and salinity treatments, and its overexpression in Arabidopsis thaliana resulted in better seedling growth, compared with wild type plants, under cold treatment conditions. The transgenic lines also had exhibited higher soluble protein content, superoxide dismutase and peroxidase activiety and lower levels of malondialdehyde, which collectively suggets that Unigene37641 expression promotes cold tolerance. PMID:26270529

Expression and Functional Analysis of WRKY Transcription Factors in Chinese Wild Hazel, Corylus heterophylla Fisch.

PubMed

Zhao, Tian-Tian; Zhang, Jin; Liang, Li-Song; Ma, Qing-Hua; Chen, Xin; Zong, Jian-Wei; Wang, Gui-Xi

2015-01-01

Plant WRKY transcription factors are known to regulate various biotic and abiotic stress responses. In this study we identified a total of 30 putative WRKY unigenes in a transcriptome dataset of the Chinese wild Hazel, Corylus heterophylla, a species that is noted for its cold tolerance. Thirteen full-length of these ChWRKY genes were cloned and found to encode complete protein sequences, and they were divided into three groups, based on the number of WRKY domains and the pattern of zinc finger structures. Representatives of each of the groups, Unigene25835 (group I), Unigene37641 (group II) and Unigene20441 (group III), were transiently expressed as fusion proteins with yellow fluorescent fusion protein in Nicotiana benthamiana, where they were observed to accumulate in the nucleus, in accordance with their predicted roles as transcriptional activators. An analysis of the expression patterns of all 30 WRKY genes revealed differences in transcript abundance profiles following exposure to cold, drought and high salinity conditions. Among the stress-inducible genes, 23 were up-regulated by all three abiotic stresses and the WRKY genes collectively exhibited four different patterns of expression in flower buds during the overwintering period from November to April. The organ/tissue related expression analysis showed that 18 WRKY genes were highly expressed in stem but only 2 (Unigene9262 and Unigene43101) were greatest in male anthotaxies. The expression of Unigene37641, a member of the group II WRKY genes, was substantially up-regulated by cold, drought and salinity treatments, and its overexpression in Arabidopsis thaliana resulted in better seedling growth, compared with wild type plants, under cold treatment conditions. The transgenic lines also had exhibited higher soluble protein content, superoxide dismutase and peroxidase activiety and lower levels of malondialdehyde, which collectively suggets that Unigene37641 expression promotes cold tolerance.

SymB and SymC, two membrane associated proteins, are required for Epichloë festucae hyphal cell-cell fusion and maintenance of a mutualistic interaction with Lolium perenne.

PubMed

Green, Kimberly A; Becker, Yvonne; Tanaka, Aiko; Takemoto, Daigo; Fitzsimons, Helen L; Seiler, Stephan; Lalucque, Hervé; Silar, Philippe; Scott, Barry

2017-02-01

Cell-cell fusion in fungi is required for colony formation, nutrient transfer and signal transduction. Disruption of genes required for hyphal fusion in Epichloë festucae, a mutualistic symbiont of Lolium grasses, severely disrupts the host interaction phenotype. They examined whether symB and symC, the E. festucae homologs of Podospora anserina self-signaling genes IDC2 and IDC3, are required for E. festucae hyphal fusion and host symbiosis. Deletion mutants of these genes were defective in hyphal cell fusion, formed intra-hyphal hyphae, and had enhanced conidiation. SymB-GFP and SymC-mRFP1 localize to plasma membrane, septa and points of hyphal cell fusion. Plants infected with ΔsymB and ΔsymC strains were severely stunted. Hyphae of the mutants colonized vascular bundles, were more abundant than wild type in the intercellular spaces and formed intra-hyphal hyphae. Although these phenotypes are identical to those previously observed for cell wall integrity MAP kinase mutants no difference was observed in the basal level of MpkA phosphorylation or its cellular localization in the mutant backgrounds. Both genes contain binding sites for the transcription factor ProA. Collectively these results show that SymB and SymC are key components of a conserved signaling network for E. festucae to maintain a mutualistic symbiotic interaction within L. perenne. © 2016 The Authors. Molecular Microbiology Published by John Wiley & Sons Ltd.

Interactions between the promoter and first intron are involved in transcriptional control of alpha 1(I) collagen gene expression.

PubMed Central

Bornstein, P; McKay, J; Liska, D J; Apone, S; Devarayalu, S

1988-01-01

The first intron of the human collagen alpha 1(I) gene contains several positively and negatively acting elements. We have studied the transcription of collagen-human growth hormone fusion genes, containing deletions and rearrangements of collagen intronic sequences, by transient transfection of chick tendon fibroblasts and NIH 3T3 cells. In chick tendon fibroblasts, but not in 3T3 cells, inversion of intronic sequences containing a previously studied 274-base-pair segment, A274, resulted in markedly reduced human growth hormone mRNA levels as determined by an RNase protection assay. This inhibitory effect was largely alleviated when deletions were introduced in the collagen promoter of plasmids containing negatively oriented intronic sequences. Evidence for interaction of the promoter with the intronic segment, A274, was obtained by gel mobility shift assays. We suggest that promoter-intron interactions, mediated by DNA-binding proteins, regulate collagen gene transcription. Inversion of intronic segments containing critical interactive elements might then lead to an altered geometry and reduced activity of a transcriptional complex in those cells with sufficiently high levels of appropriate transcription factors. We further suggest that the deleted promoter segment plays a key role in directing DNA interactions involved in transcriptional control. Images PMID:3211130

Silencing of the PiAvr3a effector-encoding gene from Phytophthora infestans by transcriptional fusion to a short interspersed element.

PubMed

Vetukuri, Ramesh R; Tian, Zhendong; Avrova, Anna O; Savenkov, Eugene I; Dixelius, Christina; Whisson, Stephen C

2011-12-01

Phytophthora infestans is the notorious oomycete causing late blight of potato and tomato. A large proportion of the P. infestans genome is composed of transposable elements, the activity of which may be controlled by RNA silencing. Accumulation of small RNAs is one of the hallmarks of RNA silencing. Here we demonstrate the presence of small RNAs corresponding to the sequence of a short interspersed retrotransposable element (SINE) suggesting that small RNAs might be involved in silencing of SINEs in P. infestans. This notion was exploited to develop novel tools for gene silencing in P. infestans by engineering transcriptional fusions of the PiAvr3a gene, encoding an RXLR avirulence effector, to the infSINEm retroelement. Transgenic P. infestans lines expressing either 5'-infSINEm::PiAvr3a-3' or 5'-PiAvr3a::SINEm-3' chimeric transcripts initially exhibited partial silencing of PiAvr3a. Over time, PiAvr3a either recovered wild type transcript levels in some lines, or became fully silenced in others. Introduction of an inverted repeat construct was also successful in yielding P. infestans transgenic lines silenced for PiAvr3a. In contrast, constructs expressing antisense or aberrant RNA transcripts failed to initiate silencing of PiAvr3a. Lines exhibiting the most effective silencing of PiAvr3a were either weakly or non-pathogenic on susceptible potato cv. Bintje. This study expands the repertoire of reverse genetics tools available for P. infestans research, and provides insights into a possible mode of variation in effector expression through spread of silencing from adjacent retroelements. Crown Copyright © 2011. Published by Elsevier Ltd. All rights reserved.

Ewing’s sarcoma precursors are highly enriched in embryonic osteochondrogenic progenitors

PubMed Central

Tanaka, Miwa; Yamazaki, Yukari; Kanno, Yohei; Igarashi, Katsuhide; Aisaki, Ken-ichi; Kanno, Jun; Nakamura, Takuro

2014-01-01

Ewing’s sarcoma is a highly malignant bone tumor found in children and adolescents, and the origin of this malignancy is not well understood. Here, we introduced a Ewing’s sarcoma–associated genetic fusion of the genes encoding the RNA-binding protein EWS and the transcription factor ETS (EWS-ETS) into a fraction of cells enriched for osteochondrogenic progenitors derived from the embryonic superficial zone (eSZ) of long bones collected from late gestational murine embryos. EWS-ETS fusions efficiently induced Ewing’s sarcoma–like small round cell sarcoma formation by these cells. Analysis of the eSZ revealed a fraction of a precursor cells that express growth/differentiation factor 5 (Gdf5), the transcription factor Erg, and parathyroid hormone-like hormone (Pthlh), and selection of the Pthlh-positive fraction alone further enhanced EWS-ETS–dependent tumor induction. Genes downstream of the EWS-ETS fusion protein were quite transcriptionally active in eSZ cells, especially in regions in which the chromatin structure of the ETS-responsive locus was open. Inhibition of β-catenin, poly (ADP-ribose) polymerase 1 (PARP1), or enhancer of zeste homolog 2 (EZH2) suppressed cell growth in a murine model of Ewing’s sarcoma, suggesting the utility of the current system as a preclinical model. These results indicate that eSZ cells are highly enriched in precursors to Ewing’s sarcoma and provide clues to the histogenesis of Ewing’s sarcoma in bone. PMID:24911143

Microfluidics-Based PCR for Fusion Transcript Detection.

PubMed

Chen, Hui

2016-01-01

The microfluidic technology allows the production of network of submillimeter-size fluidic channels and reservoirs in a variety of material systems. The microfluidic-based polymerase chain reaction (PCR) allows automated multiplexing of multiple samples and multiple assays simultaneously within a network of microfluidic channels and chambers that are co-ordinated in controlled fashion by the valves. The individual PCR reaction is performed in nanoliter volume, which allows testing on samples with limited DNA and RNA. The microfluidics devices are used in various types of PCR such as digital PCR and single molecular emulsion PCR for genotyping, gene expression, and miRNA expression. In this chapter, the use of a microfluidics-based PCR for simultaneous screening of 14 known fusion transcripts in patients with leukemia is described.

High-resolution characterization of a hepatocellular carcinoma genome.

PubMed

Totoki, Yasushi; Tatsuno, Kenji; Yamamoto, Shogo; Arai, Yasuhito; Hosoda, Fumie; Ishikawa, Shumpei; Tsutsumi, Shuichi; Sonoda, Kohtaro; Totsuka, Hirohiko; Shirakihara, Takuya; Sakamoto, Hiromi; Wang, Linghua; Ojima, Hidenori; Shimada, Kazuaki; Kosuge, Tomoo; Okusaka, Takuji; Kato, Kazuto; Kusuda, Jun; Yoshida, Teruhiko; Aburatani, Hiroyuki; Shibata, Tatsuhiro

2011-05-01

Hepatocellular carcinoma, one of the most common virus-associated cancers, is the third most frequent cause of cancer-related death worldwide. By massively parallel sequencing of a primary hepatitis C virus-positive hepatocellular carcinoma (36× coverage) and matched lymphocytes (>28× coverage) from the same individual, we identified more than 11,000 somatic substitutions of the tumor genome that showed predominance of T>C/A>G transition and a decrease of the T>C substitution on the transcribed strand, suggesting preferential DNA repair. Gene annotation enrichment analysis of 63 validated non-synonymous substitutions revealed enrichment of phosphoproteins. We further validated 22 chromosomal rearrangements, generating four fusion transcripts that had altered transcriptional regulation (BCORL1-ELF4) or promoter activity. Whole-exome sequencing at a higher sequence depth (>76× coverage) revealed a TSC1 nonsense substitution in a subpopulation of the tumor cells. This first high-resolution characterization of a virus-associated cancer genome identified previously uncharacterized mutation patterns, intra-chromosomal rearrangements and fusion genes, as well as genetic heterogeneity within the tumor.

A functional promoter shift of a chloroplast gene: a transcriptional fusion between a novel psbA gene copy and the trnK (UUU) gene in Pinus contorta.

PubMed

Lidholm, J; Gustafsson, P

1992-11-01

A comparative transcription analysis of the chloroplast trnK-psbA-trnH region of the two pine species Pinus contorta and Pinus sylvestris is reported. The chloroplast genome of P. contorta has previously been shown to contain a duplicated psbA gene copy integrated closely upstream of the split trnK gene. This rearrangement has resulted in the gene order psbAI-trnK-psbAII-trnH, where psbAII is the ancestral psbA gene copy. In P. sylvestris, a species which lacks the psbA duplication, transcription of the trnK gene originates from a position 291 bp upstream of the trnK 5' exon, adjacent to a canonical promoter structure. In P. contorta, the corresponding promoter structure has been separated from the trnK gene by the insertion of psbAI, and has, in addition, been partially deleted. Analysis of the transcriptional organization of the trnK-psbA-trnH region of the two pine species revealed that the trnK gene in P. contorta is transcriptionally fused to the inserted psbAI gene copy. As a result, trnK is under the control of the psbA promoter in this species and has therefore acquired psbA-like expression characteristics. In P. sylvestris, accumulation of trnK transcripts is not significantly higher in light-grown than in dark-grown seedlings. In contrast, the level of trnK transcripts in P. contorta is approximately 12-fold higher in the light than in the dark. When light-grown seedlings of the two pine species were compared, an approximately 20-fold higher level of trnK RNAs was found in P. contorta. In both pine species, evidence was obtained for trnK-psbA and psbA-trnH co-transcription.

Nucleo-cytoplasmic shuttling dynamics of the transcriptional regulators XYR1 and CRE1 under conditions of cellulase and xylanase gene expression in Trichoderma reesei

PubMed Central

Lichius, Alexander; Seidl-Seiboth, Verena; Seiboth, Bernhard; Kubicek, Christian P

2014-01-01

Trichoderma reesei is a model for investigating the regulation of (hemi-)cellulase gene expression. Cellulases are formed adaptively, and the transcriptional activator XYR1 and the carbon catabolite repressor CRE1 are main regulators of their expression. We quantified the nucleo-cytoplasmic shuttling dynamics of GFP-fusion proteins of both transcription factors under cellulase and xylanase inducing conditions, and correlated their nuclear presence/absence with transcriptional changes. We also compared their subcellular localization in conidial germlings and mature hyphae. We show that cellulase gene expression requires de novo biosynthesis of XYR1 and its simultaneous nuclear import, whereas carbon catabolite repression is regulated through preformed CRE1 imported from the cytoplasmic pool. Termination of induction immediately stopped cellulase gene transcription and was accompanied by rapid nuclear degradation of XYR1. In contrast, nuclear CRE1 rapidly decreased upon glucose depletion, and became recycled into the cytoplasm. In mature hyphae, nuclei containing activated XYR1 were concentrated in the colony center, indicating that this is the main region of XYR1 synthesis and cellulase transcription. CRE1 was found to be evenly distributed throughout the entire mycelium. Taken together, our data revealed novel aspects of the dynamic shuttling and spatial bias of the major regulator of (hemi-)cellulase gene expression, XYR1, in T. reesei. PMID:25302561

Expression of a repressor form of the Arabidopsis thaliana transcription factor TCP16 induces the formation of ectopic meristems.

PubMed

Uberti-Manassero, Nora G; Coscueta, Ezequiel R; Gonzalez, Daniel H

2016-11-01

Plants that express a fusion of the Arabidopsis thaliana class I TCP transcription factor TCP16 to the EAR repressor domain develop several phenotypic alterations, including rounder leaves, short petioles and pedicels, and delayed elongation of sepals, petals and anthers. In addition, these plants develop lobed cotyledons and ectopic meristems. Ectopic meristems are formed on the adaxial side of cotyledon petioles and arise from a cleft that is formed at this site. Analysis of the expression of reporter genes indicated that meristem genes are reactivated at the site of emergence of ectopic meristems, located near the bifurcation of cotyledon veins. The plants also show increased transcript levels of the boundary-specific CUP-SHAPED COTYLEDON (CUC) genes. The results suggest that TCP16 is able to modulate the induction of meristematic programs and the differentiation state of plant cells. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

In vivo interference with AtTCP20 function induces severe plant growth alterations and deregulates the expression of many genes important for development.

PubMed

Hervé, Christine; Dabos, Patrick; Bardet, Claude; Jauneau, Alain; Auriac, Marie Christine; Ramboer, Agnès; Lacout, Fabrice; Tremousaygue, Dominique

2009-03-01

AtTCP20 is a transcription factor belonging to the Arabidopsis (Arabidopsis thaliana) TCP-P subfamily, characterized by its capacity to bind to site II motifs (TGGGCY). Our aim was to understand the role of AtTCP20 in plant development. The expression pattern of a translational fusion of Prom(TCP20):CDS20GUSGFP suggested a function for AtTCP20 in several plant organs and stages of development. The role of AtTCP20 was challenged in planta by inducing expression of AtTCP20 proteins fused with either a transcriptional activator domain (VP16) or a repressor domain (EAR). Expression of both modified proteins led to severe developmental phenotypes. In-depth analysis suggested that AtTCP20 may participate in the regulation of cell expansion, cell division, and cell differentiation. Gene expression profiling in roots and hypocotyls revealed that 252 genes were down-regulated in both organs after induction of the AtTCP20EAR repressor gene. Site II motifs (TGGGCY) were underrepresented in their promoters. Conversely, GG(A/T)CCC sequences related to binding sites identified for TCP proteins in rice (Oryza sativa) were overrepresented, and a TCP20 fusion protein was shown to bind to these sequences in vitro. Gene ontology indicated that many targeted genes were involved in cell wall biogenesis and modification during expansion and also encoded numerous transcription factors controlling plant development. Our results are consistent with the previous proposal that AtTCP20 is involved in cell division and growth coordination. Moreover, they further suggest that AtTCP20 also contributes to cell expansion control and indicate a different involvement of this protein in plant morphogenesis depending on the organ and the developmental stage.

TFE3-Fusion Variant Analysis Defines Specific Clinicopathologic Associations Among Xp11 Translocation Cancers

PubMed Central

Argani, Pedram; Zhong, Minghao; Reuter, Victor E.; Fallon, John T.; Epstein, Jonathan I.; Netto, George J.; Antonescu, Cristina R.

2016-01-01

Xp11 translocation cancers include Xp11 translocation renal cell carcinoma (RCC), Xp11 translocation perivascular epithelioid cell tumor (PEComa), and melanotic Xp11 translocation renal cancer. In Xp11 translocation cancers, oncogenic activation of TFE3 is driven by the fusion of TFE3 with a number of different gene partners, however, the impact of individual fusion variant on specific clinicopathologic features of Xp11 translocation cancers has not been well defined. In this study, we analyze 60 Xp11 translocation cancers by fluorescence in situ hybridization (FISH) using custom BAC probes to establish their TFE3 fusion gene partner. In 5 cases RNA sequencing (RNA-seq) was also used to further characterize the fusion transcripts. The 60 Xp11 translocation cancers included 47 Xp11 translocation RCC, 8 Xp11 translocation PEComas, and 5 melanotic Xp11 translocation renal cancers. A fusion partner was identified in 53/60 (88%) cases, including 18 SFPQ (PSF), 16 PRCC, 12 ASPSCR1 (ASPL), 6 NONO, and 1 DVL2. We provide the first morphologic description of the NONO-TFE3 RCC, which frequently demonstrates sub-nuclear vacuoles leading to distinctive suprabasal nuclear palisading. Similar sub-nuclear vacuolization was also characteristic of SFPQ-TFE3 RCC, creating overlapping features with clear cell papillary RCC. We also describe the first RCC with a DVL2-TFE3 gene fusion, in addition to an extrarenal pigmented PEComa with a NONO-TFE3 gene fusion. Furthermore, among neoplasms with the SFPQ-TFE3, NONO-TFE3, DVL2-TFE3 and ASPL-TFE3 gene fusions, the RCC are almost always PAX8-positive, cathepsin K-negative by immunohistochemistry, whereas the mesenchymal counterparts (Xp11 translocation PEComas, melanotic Xp11 translocation renal cancers, and alveolar soft part sarcoma) are PAX8-negative, cathepsin K-positive. These findings support the concept that despite an identical gene fusion, the RCCs are distinct from the corresponding mesenchymal neoplasms, perhaps due to the cellular context in which the translocation occurs. We corroborate prior data showing that the PRCC-TFE3 RCC are the only known Xp11 translocation RCC molecular subtype which is consistently cathepsin K positive. In summary, our data expand further the clinicopathologic features of cancers with specific TFE3 gene fusions, and should allow for more meaningful clinicopathologic associations to be drawn. PMID:26975036

The recurrent chromosomal translocation t(12;18) (q14~15;q12~21) causes the fusion gene HMGA2-SETBP1 and HMGA2 expression in lipoma and osteochondrolipoma

PubMed Central

PANAGOPOULOS, IOANNIS; GORUNOVA, LUDMILA; BJERKEHAGEN, BODIL; LOBMAIER, INGVILD; HEIM, SVERRE

2015-01-01

Lipomas are the most common soft tissue tumors in adults. They often carry chromosome aberrations involving 12q13~15 leading to rearrangements of the HMGA2 gene in 12q14.3, with breakpoints occurring within or outside of the gene. Here, we present eleven lipomas and one osteochondrolipoma with a novel recurrent chromosome aberration, t(12;18) (q14~15;q12~21). Molecular studies on eight of the tumors showed that full-length HMGA2 transcript was expressed in three and a chimeric HMGA2 transcript in five of them. In three lipomas and in the osteochondrolipoma, exons 1–3 of HMGA2 were fused to a sequence of SETBP1 on 18q12.3 or an intragenic sequence from 18q12.3 circa 10 kbp distal to SETBP1. In another lipoma, exons 1–4 of HMGA2 were fused to an intronic sequence of GRIP1 which maps to chromosome band 12q14.3, distal to HMGA2. The ensuing HMGA2 fusion transcripts code for putative proteins which contain amino acid residues of HMGA2 corresponding to exons 1–3 (or exons 1–4 in one case) followed by amino acid residues corresponding to the fused sequences. Thus, the pattern is similar to the rearrangements of HMGA2 found in other lipomas, i.e., disruption of the HMGA2 locus leaves intact exons 1–3 which encode the AT-hooks domains and separates them from the 3′-terminal part of the gene. The fact that the examined osteochondrolipoma had a t(12;18) and a HMGA2-SETBP1 fusion identical to the findings in the much more common ordinary lipomas, underscores the close developmental relationship between the two tumor types. PMID:26202160

Temsirolimus in the treatment of renal cell carcinoma associated with Xp11.2 translocation/TFE gene fusion proteins: a case report and review of literature.

PubMed

Parikh, Jigarkumar; Coleman, Teresa; Messias, Nidia; Brown, James

2009-12-28

Xp11.2 translocation renal cell carcinomas (TRCCs) are a rare family of tumors newly recognized by the World Health Organization (WHO) in 2004. These tumors result in the fusion of partner genes to the TFE3 gene located on Xp11.2. They are most common in the pediatric population, but have been recently implicated in adult renal cell carcinoma (RCC) presenting at an early age. TFE3-mediated direct transcriptional upregulation of the Met tyrosine kinase receptor triggers dramatic activation of downstream signaling pathways including the protein kinase B (Akt)/phosphatidylinositol-3 kinase (PI3K) and mammalian target of rapamycin (mTOR) pathways. Temsirolimus is an inhibitor of mammalian target of rapamycin (mTOR) kinase, a component of intracellular signaling pathways involved in the growth and proliferation of malignant cells. Here we present a case of a 22-year old female who has been treated with temsirolimus for her Xp11.2/TFE3 gene fusion RCC.

Temsirolimus in the treatment of renal cell carcinoma associated with Xp11.2 translocation/TFE gene fusion proteins: a case report and review of literature

PubMed Central

Parikh, Jigarkumar; Coleman, Teresa; Messias, Nidia; Brown, James

2009-01-01

Xp11.2 translocation renal cell carcinomas (TRCCs) are a rare family of tumors newly recognized by the World Health Organization (WHO) in 2004. These tumors result in the fusion of partner genes to the TFE3 gene located on Xp11.2. They are most common in the pediatric population, but have been recently implicated in adult renal cell carcinoma (RCC) presenting at an early age. TFE3-mediated direct transcriptional upregulation of the Met tyrosine kinase receptor triggers dramatic activation of downstream signaling pathways including the protein kinase B (Akt)/phosphatidylinositol-3 kinase (PI3K) and mammalian target of rapamycin (mTOR) pathways. Temsirolimus is an inhibitor of mammalian target of rapamycin (mTOR) kinase, a component of intracellular signaling pathways involved in the growth and proliferation of malignant cells. Here we present a case of a 22-year old female who has been treated with temsirolimus for her Xp11.2/TFE3 gene fusion RCC. PMID:21139932

Recurrent PAX3-MAML3 Fusion in Biphenotypic Sinonasal Sarcoma

PubMed Central

Wang, Xiaoke; Bledsoe, Krista L.; Graham, Rondell P.; Asmann, Yan W.; Viswanatha, David S.; Lewis, Jean E.; Lewis, Jason T.; Chou, Margaret M.; Yaszemski, Michael J.; Jen, Jin; Westendorf, Jennifer J.; Oliveira, André M.

2014-01-01

Biphenotypic sinonasal sarcoma (SNS) is a newly described tumor of the nasal and paranasal areas. Herein, we report the novel recurring chromosomal translocation t(2;4)(q35;q31.1) in SNS. The translocation results in the formation of the fusion protein PAX3-MAML3, which is a potent transcriptional activator of PAX3 response elements. The SNS phenotype is characterized by aberrant expression of genes involved in neuroectodermal and myogenic differentiation, which closely simulates the developmental roles of PAX3. PMID:24859338

ESWR1-CREM Fusion in an Intracranial Myxoid Angiomatoid Fibrous Histiocytoma-Like Tumor: A Case Report and Literature Review.

PubMed

Gareton, Albane; Pierron, Gaëlle; Mokhtari, Karima; Tran, Suzanne; Tauziède-Espariat, Arnault; Pallud, Johan; Louvel, Guillaume; Meary, Eric; Capelle, Laurent; Chrétien, Fabrice; Varlet, Pascale

2018-05-19

Gene fusions of EWSR1 with members of the CREB family of transcription factors (CREB1, ATF1, and CREM) have recently been described in exceptional intracranial myxoid mesenchymal tumors. Although this is a known gene fusion found in various mesenchymal tumors, EWSR1 fusion with CREM has only been observed in 3 intracranial myxoid tumors. In this paper, we present 1 such tumor with in-depth histopathological description and long-term follow-up. There is controversy regarding whether these tumors represent a novel entity or simply an intracranial localization of the myxoid variant of angiomatoid fibrous histiocytoma, a rare soft tissue tumor of the extremities. Out of 11 cases mentioned in the literature, the 3 isolated case reports by Dunham et al, Ochalski et al, and Alshareef et al are designated as angiomatoid fibrous histiocytoma, whereas the others are defined as a novel tumoral entity called intracranial myxoid mesenchymal tumor with EWSR1-CREB fusion. We believe the vast morphological and immunohistochemical spectrum of angiomatoid fibrous histiocytoma makes it difficult to dismiss this diagnosis.

Transcriptional analysis of the bglP gene from Streptococcus mutans.

PubMed

Cote, Christopher K; Honeyman, Allen L

2006-04-21

An open reading frame encoding a putative antiterminator protein, LicT, was identified in the genomic sequence of Streptococcus mutans. A potential ribonucleic antitermination (RAT) site to which the LicT protein would potentially bind has been identified immediately adjacent to this open reading frame. The licT gene and RAT site are both located 5' to a beta-glucoside PTS regulon previously described in S. mutans that is responsible for esculin utilization in the presence of glucose. It was hypothesized that antitermination is the regulatory mechanism that is responsible for the control of the bglP gene expression, which encodes an esculin-specific PTS enzyme II. To localize the promoter activity associated with the bglP locus, a series of transcriptional lacZ gene fusions was formed on a reporter shuttle vector using various DNA fragments from the bglP promoter region. Subsequent beta-galactosidase assays in S. mutans localized the bglP promoter region and identified putative -35 and -10 promoter elements. Primer extension analysis identified the bglP transcriptional start site. In addition, a terminated bglP transcript formed by transcriptional termination was identified via transcript mapping experiments. The physical location of these genetic elements, the RAT site and the promoter regions, and the identification of a short terminated mRNA support the hypothesis that antitermination regulates the bglP transcript.

Transcriptional analysis of the bglP gene from Streptococcus mutans

PubMed Central

Cote, Christopher K; Honeyman, Allen L

2006-01-01

Background An open reading frame encoding a putative antiterminator protein, LicT, was identified in the genomic sequence of Streptococcus mutans. A potential ribonucleic antitermination (RAT) site to which the LicT protein would potentially bind has been identified immediately adjacent to this open reading frame. The licT gene and RAT site are both located 5' to a beta-glucoside PTS regulon previously described in S. mutans that is responsible for esculin utilization in the presence of glucose. It was hypothesized that antitermination is the regulatory mechanism that is responsible for the control of the bglP gene expression, which encodes an esculin-specific PTS enzyme II. Results To localize the promoter activity associated with the bglP locus, a series of transcriptional lacZ gene fusions was formed on a reporter shuttle vector using various DNA fragments from the bglP promoter region. Subsequent beta-galactosidase assays in S. mutans localized the bglP promoter region and identified putative -35 and -10 promoter elements. Primer extension analysis identified the bglP transcriptional start site. In addition, a terminated bglP transcript formed by transcriptional termination was identified via transcript mapping experiments. Conclusion The physical location of these genetic elements, the RAT site and the promoter regions, and the identification of a short terminated mRNA support the hypothesis that antitermination regulates the bglP transcript. PMID:16630357

Shikimate Induced Transcriptional Activation of Protocatechuate Biosynthesis Genes by QuiR, a LysR-Type Transcriptional Regulator, in Listeria monocytogenes.

PubMed

Prezioso, Stephanie M; Xue, Kevin; Leung, Nelly; Gray-Owen, Scott D; Christendat, Dinesh

2018-04-27

Listeria monocytogenes is a common foodborne bacterial pathogen that contaminates plant and animal consumable products. The persistent nature of L. monocytogenes is associated with millions of dollars in food recalls annually. Here, we describe the role of shikimate in directly modulating the expression of genes encoding enzymes for the conversion of quinate and shikimate metabolites to protocatechuate. In L. monocytogenes, these genes are found within two operons, named qui1 and qui2. In addition, a gene named quiR, encoding a LysR-Type Transcriptional Regulator (QuiR), is located immediately upstream of the qui1 operon. Transcriptional lacZ-promoter fusion experiments show that QuiR induces gene expression of both qui1 and qui2 operons in the presence of shikimate. Furthermore, co-crystallization of the QuiR effector binding domain in complex with shikimate provides insights into the mechanism of activation of this regulator. Together these data show that upon shikimate accumulation, QuiR activates the transcription of genes encoding enzymes involved in shikimate and quinate utilization for the production of protocatechuate. Furthermore, the accumulation of protocatechuate leads to the inhibition of Listeria growth. Since protocatechuate is not known to be utilized by Listeria, its role is distinct from those established in other bacteria. Copyright © 2018 Elsevier Ltd. All rights reserved.

Identification, cloning and characterization of R2R3-MYB gene family in canola (Brassica napus L.) identify a novel member modulating ROS accumulation and hypersensitive-like cell death

PubMed Central

Chen, Bisi; Niu, Fangfang; Liu, Wu-Zhen; Yang, Bo; Zhang, Jingxiao; Ma, Jieyu; Cheng, Hao; Han, Feng; Jiang, Yuan-Qing

2016-01-01

The R2R3-MYB proteins comprise one of the largest families of transcription factors in plants. Although genome-wide analysis of this family has been carried out in some plant species, little is known about R2R3-MYB genes in canola (Brassica napus L.). In this study, we have identified 76 R2R3-MYB genes in the canola genome through mining of expressed sequence tags (ESTs). The cDNA sequences of 44 MYB genes were successfully cloned. The transcriptional activities of BnaMYB proteins encoded by these genes were assayed in yeast. The subcellular localizations of representative R2R3-MYB proteins were investigated through GFP fusion. Besides, the transcript abundance level analysis during abiotic conditions and ABA treatment identified a group of R2R3-MYB genes that responded to one or more treatments. Furthermore, we identified a previously functionally unknown MYB gene-BnaMYB78, which modulates reactive oxygen species (ROS)-dependent cell death in Nicotiana benthamiana, through regulating the transcription of a few ROS- and defence-related genes. Taken together, this study has provided a solid foundation for understanding the roles and regulatory mechanism of canola R2R3-MYB genes. PMID:26800702

Heritability and genetic basis of protein level variation in an outbred population

PubMed Central

Liu, Yi-Chun; Tekkedil, Manu M.; Steinmetz, Lars M.; Caudy, Amy A.; Fraser, Andrew G.

2014-01-01

The genetic basis of heritable traits has been studied for decades. Although recent mapping efforts have elucidated genetic determinants of transcript levels, mapping of protein abundance has lagged. Here, we analyze levels of 4084 GFP-tagged yeast proteins in the progeny of a cross between a laboratory and a wild strain using flow cytometry and high-content microscopy. The genotype of trans variants contributed little to protein level variation between individual cells but explained >50% of the variance in the population’s average protein abundance for half of the GFP fusions tested. To map trans-acting factors responsible, we performed flow sorting and bulk segregant analysis of 25 proteins, finding a median of five protein quantitative trait loci (pQTLs) per GFP fusion. Further, we find that cis-acting variants predominate; the genotype of a gene and its surrounding region had a large effect on protein level six times more frequently than the rest of the genome combined. We present evidence for both shared and independent genetic control of transcript and protein abundance: More than half of the expression QTLs (eQTLs) contribute to changes in protein levels of regulated genes, but several pQTLs do not affect their cognate transcript levels. Allele replacements of genes known to underlie trans eQTL hotspots confirmed the correlation of effects on mRNA and protein levels. This study represents the first genome-scale measurement of genetic contribution to protein levels in single cells and populations, identifies more than a hundred trans pQTLs, and validates the propagation of effects associated with transcript variation to protein abundance. PMID:24823668

Comprehensive Analysis of CBFβ-MYH11 Fusion Transcripts in Acute Myeloid Leukemia by RT-PCR Analysis

PubMed Central

Kadkol, ShriHari S.; Bruno, Annette; Dodge, Carol; Lindgren, Valerie; Ravandi, Farhad

2004-01-01

CBFβ-MYH11 fusion transcripts are expressed in acute myeloid leukemias of the M4Eo subtype. Patients who express CBFβ-MYH11 fusion transcripts respond favorably to high-dose chemotherapy and are generally spared allogeneic bone marrow transplantation. Hence it is important to identify this fusion in all patients with acute myeloid leukemia M4Eo leukemia. The fusion can be detected by cytogenetics, fluorescence in-situ hybridization (FISH), or by molecular analysis with RT-PCR. Multiple fusion transcripts arising as a result of various breakpoints in the CBFβ and MYH11 have been identified. In this report we describe a comprehensive RT-PCR assay to identify all known fusion transcripts and provide an algorithm for molecular analysis of CBFβ-MYH11 fusions from patient specimens. Further, identification of the fusion transcript by such an assay would help in the diagnosis and follow up of patients with cryptic inversion 16 translocations (such as patient 2 in this report) not detected by standard cytogenetics or FISH and for rational design of probes for quantitative analysis by real-time PCR. PMID:14736823

ChiTaRS-3.1-the enhanced chimeric transcripts and RNA-seq database matched with protein-protein interactions.

PubMed

Gorohovski, Alessandro; Tagore, Somnath; Palande, Vikrant; Malka, Assaf; Raviv-Shay, Dorith; Frenkel-Morgenstern, Milana

2017-01-04

Discovery of chimeric RNAs, which are produced by chromosomal translocations as well as the joining of exons from different genes by trans-splicing, has added a new level of complexity to our study and understanding of the transcriptome. The enhanced ChiTaRS-3.1 database (http://chitars.md.biu.ac.il) is designed to make widely accessible a wealth of mined data on chimeric RNAs, with easy-to-use analytical tools built-in. The database comprises 34 922: chimeric transcripts along with 11 714: cancer breakpoints. In this latest version, we have included multiple cross-references to GeneCards, iHop, PubMed, NCBI, Ensembl, OMIM, RefSeq and the Mitelman collection for every entry in the 'Full Collection'. In addition, for every chimera, we have added a predicted Chimeric Protein-Protein Interaction (ChiPPI) network, which allows for easy visualization of protein partners of both parental and fusion proteins for all human chimeras. The database contains a comprehensive annotation for 34 922: chimeric transcripts from eight organisms, and includes the manual annotation of 200 sense-antiSense (SaS) chimeras. The current improvements in the content and functionality to the ChiTaRS database make it a central resource for the study of chimeric transcripts and fusion proteins. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Diagnostic pitfall on the histological spectrum of adult-onset renal carcinoma associated with Xp11.2 translocations/TFE3 gene fusions.

PubMed

Kuroda, Naoto; Katto, Kazunobu; Tanaka, Yukichi; Yamaguchi, Tadanori; Inoue, Kaori; Ohara, Masahiko; Mizuno, Keiko; Hes, Ondrej; Michal, Michal; Lee, Gang-Hong

2010-06-01

Renal cell carcinoma (RCC) associated with Xp11.2 translocation/TFE3 gene fusion recently has been found. In this article, we demonstrate an unusual features of such a case. A 73-year-old Japanese woman presented with macroscopic hematuria. The imaging examinations disclosed the renal tumor. Histological examination showed the finding of ASPL-TFE3 RCC, which was characterized by papillary, alveolar, or solid growth of voluminous cell with clear and eosinophilic cells, and stromal psammoma body and hyaline nodules. Additionally, shrunken nuclei, thick cell border, and perinuclear clearing characteristic of chromophobe renal cell carcinoma were observed in the alveolar growth area and the transitional zone between stromal hyalinization, and osseous metaplasia was identified. Immunohistochemically, nuclei of tumorous cell were diffusely positive for TFE3. A RT-PCR study revealed the ASPL-TFE3 chimeric transcript. Finally, pathologists should recognize that the histology of RCC associated with Xp11.2 translocation/TFE3 gene fusion may focally resemble that of chromophobe RCC, but TFE3 immunohistochemistry and molecular genetic study may be helpful in the differential diagnosis. Moreover, osseous metaplasia as well as psammoma bodies should be added to the histological spectrum of the stromal change in RCC associated with Xp11.2 translocations/TFE3 gene fusions.

Superoxide-responsive gene expression in Arabidopsis thaliana and Zea mays.

PubMed

Xu, Junhuan; Tran, Thu; Padilla Marcia, Carmen S; Braun, David M; Goggin, Fiona L

2017-08-01

Superoxide (O 2 - ) and other reactive oxygen species (ROS) are generated in response to numerous biotic and abiotic stresses. Different ROS have been reported to elicit different transcriptional responses in plants, and so ROS-responsive marker genes and promoter::reporter gene fusions have been proposed as indirect means of detecting ROS and discriminating among different species. However, further information about the specificity of transcriptional responses to O 2 - is needed in order to assess potential markers for this critical stress-responsive signaling molecule. Using qRT-PCR, the expression of 12 genes previously reported to be upregulated by O 2 - was measured in Arabidopsis thaliana plants exposed to elicitors of common stress-responsive ROS: methyl viologen (an inducer of O 2 - ), rose bengal (an inducer of singlet oxygen, 1 ΔO 2 ), and exogenous hydrogen peroxide (H 2 O 2 ). Surprisingly, Zinc-Finger Protein 12 (AtZAT12), which had previously been used as a reporter for H 2 O 2 , responded more strongly to O 2 - than to H 2 O 2 ; moreover, the expression of an AtZAT12 promoter-reporter fusion (AtZAT12::Luc) was enhanced by diethyldithiocarbamate, which inhibits dismutation of O 2 - to H 2 O 2 . These results suggest that AtZAT12 is transcriptionally upregulated in response to O 2 - , and that AtZAT12::Luc may be a useful biosensor for detecting O 2 - generation in vivo. In addition, transcripts encoding uncoupling proteins (AtUCPs) showed selectivity for O 2 - in Arabidopsis, and an AtUCP homolog upregulated by methyl viologen was also identified in maize (Zea mays L.), indicating that there are O 2 - -responsive members of this family in monocots. These results expand our limited knowledge of ROS-responsive gene expression in monocots, as well as O 2 - -selective responses in dicots. Copyright © 2017 The Authors. Published by Elsevier Masson SAS.. All rights reserved.

Oncogenic fusion proteins adopt the insulin-like growth factor signaling pathway.

PubMed

Werner, Haim; Meisel-Sharon, Shilhav; Bruchim, Ilan

2018-02-19

The insulin-like growth factor-1 receptor (IGF1R) has been identified as a potent anti-apoptotic, pro-survival tyrosine kinase-containing receptor. Overexpression of the IGF1R gene constitutes a typical feature of most human cancers. Consistent with these biological roles, cells expressing high levels of IGF1R are expected not to die, a quintessential feature of cancer cells. Tumor specific chromosomal translocations that disrupt the architecture of transcription factors are a common theme in carcinogenesis. Increasing evidence gathered over the past fifteen years demonstrate that this type of genomic rearrangements is common not only among pediatric and hematological malignancies, as classically thought, but may also provide a molecular and cytogenetic foundation for an ever-increasing portion of adult epithelial tumors. In this review article we provide evidence that the mechanism of action of oncogenic fusion proteins associated with both pediatric and adult malignancies involves transactivation of the IGF1R gene, with ensuing increases in IGF1R levels and ligand-mediated receptor phosphorylation. Disrupted transcription factors adopt the IGF1R signaling pathway and elicit their oncogenic activities via activation of this critical regulatory network. Combined targeting of oncogenic fusion proteins along with the IGF1R may constitute a promising therapeutic approach.

Oncogenes and tumor suppressors in the molecular pathogenesis of acute promyelocytic leukemia.

PubMed

Pandolfi, P P

2001-04-01

Acute promyelocytic leukemia (APL) is associated with reciprocal chromosomal translocations always involving the retinoic acid receptor alpha (RARalpha) gene on chromosome 17 and variable partner genes (X genes) on distinct chromosomes. RARalpha fuses to the PML gene in the vast majority of APL cases, and in a few cases to the PLZF, NPM, NuMA and Stat5b genes, respectively, leading to the generation of RARalpha-X: and X:-RARalpha fusion genes. Both fusion proteins can exert oncogenic functions through their ability to interfere with the activities of X and RARalpha proteins. Here, it will be discussed in detail how an extensive biochemical analysis as well as a systematic in vivo genetic approach in the mouse has allowed the definition of the multiple oncogenic activities of PML-RARalpha, and how it has become apparent that this oncoprotein is able to impair RARalpha at the transcription level and the tumor suppressive function of the PML protein.

A 20 bp cis-acting element is both necessary and sufficient to mediate elicitor response of a maize PRms gene.

PubMed

Raventós, D; Jensen, A B; Rask, M B; Casacuberta, J M; Mundy, J; San Segundo, B

1995-01-01

Transient gene expression assays in barley aleurone protoplasts were used to identify a cis-regulatory element involved in the elicitor-responsive expression of the maize PRms gene. Analysis of transcriptional fusions between PRms 5' upstream sequences and a chloramphenicol acetyltransferase reporter gene, as well as chimeric promoters containing PRms promoter fragments or repeated oligonucleotides fused to a minimal promoter, delineated a 20 bp sequence which functioned as an elicitor-response element (ERE). This sequence contains a motif (-246 AATTGACC) similar to sequences found in promoters of other pathogen-responsive genes. The analysis also indicated that an enhancing sequence(s) between -397 and -296 is required for full PRms activation by elicitors. The protein kinase inhibitor staurosporine was found to completely block the transcriptional activation induced by elicitors. These data indicate that protein phosphorylation is involved in the signal transduction pathway leading to PRms expression.

Expression of the gene cluster associated with the Escherichia coli pilus adhesin K99.

PubMed

Lee, J H; Isaacson, R E

1995-10-01

The biogenesis of the pilus adhesin K99 is dependent on the expression of eight contiguous genes, fanA to fanH. Transposon mutants were prepared by using TnlacZ and TnphoA, and selected transposon mutants were used to measure expression of each K99 gene. Expression of the K99 genes is likely controlled at the transcription level, since in general, there were no differences between the results obtained with the two transposons. fanC was the most highly expressed, and fanD was expressed at very low levels. The expression of TnlacZ fusions in fanA and fanB fusions was high. Deletion of fanA, fanB, and part of fanC abolished the expression of fanD but had no effect on the distal genes fanE to fanH. To locate the DNA regions required for expression of fanE to fanH, deletion mutations were prepared and the effects on expression of fanE to fanH were determined. The deletion of a segment between fanD and fanE abolished fanE and fanF expression but did not affect fanG and fanH. The deletion of a portion of fanF (approximately 1 kb proximal to fanG) abolished the expression of fanG and fanH. These results indicate the presence of regulatory elements proximal to fanE and to fanG. Putative promoters were identified in these regions by DNA homology and by primer extension. A stem-loop structure that may act as a transcriptional attenuator of fanF was also found at the beginning of fanF. These data confirm our previous model of K99 transcriptional organization.

Expression of the gene cluster associated with the Escherichia coli pilus adhesin K99.

PubMed Central

Lee, J H; Isaacson, R E

1995-01-01

The biogenesis of the pilus adhesin K99 is dependent on the expression of eight contiguous genes, fanA to fanH. Transposon mutants were prepared by using TnlacZ and TnphoA, and selected transposon mutants were used to measure expression of each K99 gene. Expression of the K99 genes is likely controlled at the transcription level, since in general, there were no differences between the results obtained with the two transposons. fanC was the most highly expressed, and fanD was expressed at very low levels. The expression of TnlacZ fusions in fanA and fanB fusions was high. Deletion of fanA, fanB, and part of fanC abolished the expression of fanD but had no effect on the distal genes fanE to fanH. To locate the DNA regions required for expression of fanE to fanH, deletion mutations were prepared and the effects on expression of fanE to fanH were determined. The deletion of a segment between fanD and fanE abolished fanE and fanF expression but did not affect fanG and fanH. The deletion of a portion of fanF (approximately 1 kb proximal to fanG) abolished the expression of fanG and fanH. These results indicate the presence of regulatory elements proximal to fanE and to fanG. Putative promoters were identified in these regions by DNA homology and by primer extension. A stem-loop structure that may act as a transcriptional attenuator of fanF was also found at the beginning of fanF. These data confirm our previous model of K99 transcriptional organization. PMID:7558331

Gene fusions AHRR-NCOA2, NCOA2-ETV4, ETV4-AHRR, P4HA2-TBCK, and TBCK-P4HA2 resulting from the translocations t(5;8;17)(p15;q13;q21) and t(4;5)(q24;q31) in a soft tissue angiofibroma

PubMed Central

Panagopoulos, Ioannis; Gorunova, Ludmila; Viset, Trond; Heim, Sverre

2016-01-01

We present an angiofibroma of soft tissue with the karyotype 46,XY,t(4;5)(q24;q31),t(5;8;17)(p15;q13;q21) [8]/46,XY,t(1;14)(p31;q32)[2]/46,XY[3]. RNA-sequencing showed that the t(4;5)(q24;q31) resulted in recombination of the genes TBCK on 4q24 and P4HA2 on 5q31.1 with generation of an in-frame TBCK-P4HA2 and the reciprocal but out-of-frame P4HA2-TBCK fusion transcripts. The putative TBCK-P4HA2 protein would contain the kinase, the rhodanese-like domain, and the Tre-2/Bub2/Cdc16 (TBC) domains of TBCK together with the P4HA2 protein which is a component of the prolyl 4-hydroxylase. The t(5;8;17)(p15;q13;q21) three-way chromosomal translocation targeted AHRR (on 5p15), NCOA2 (on 8q13), and ETV4 (on 17q21) generating the in-frame fusions AHRR-NCOA2 and NCOA2-ETV4 as well as an out-of-frame ETV4-AHRR transcript. In the AHRR-NCOA2 protein, the C-terminal part of AHRR is replaced by the C-terminal part of NCOA2 which contains two activation domains. The NCOA2-ETV4 protein would contain the helix-loop-helix, PAS_9 and PAS_11, CITED domains, the SRC-1 domain of NCOA2 and the ETS DNA-binding domain of ETV4. No fusion gene corresponding to t(1;14)(p31;q32) was found. Our findings indicate that, in spite of the recurrence of AHRR-NCOA2 in angiofibroma of soft tissue, additional genetic events (or fusion genes) might be required for the development of this tumor. PMID:27633981

Gene fusions AHRR-NCOA2, NCOA2-ETV4, ETV4-AHRR, P4HA2-TBCK, and TBCK-P4HA2 resulting from the translocations t(5;8;17)(p15;q13;q21) and t(4;5)(q24;q31) in a soft tissue angiofibroma.

PubMed

Panagopoulos, Ioannis; Gorunova, Ludmila; Viset, Trond; Heim, Sverre

2016-11-01

We present an angiofibroma of soft tissue with the karyotype 46,XY,t(4;5)(q24;q31),t(5;8;17)(p15;q13;q21)[8]/46,XY,t(1;14)(p31;q32)[2]/46,XY[3]. RNA‑sequencing showed that the t(4;5)(q24;q31) resulted in recombination of the genes TBCK on 4q24 and P4HA2 on 5q31.1 with generation of an in‑frame TBCK‑P4HA2 and the reciprocal but out‑of‑frame P4HA2‑TBCK fusion transcripts. The putative TBCK‑P4HA2 protein would contain the kinase, the rhodanese‑like domain, and the Tre‑2/Bub2/Cdc16 (TBC) domains of TBCK together with the P4HA2 protein which is a component of the prolyl 4‑hydroxylase. The t(5;8;17)(p15;q13;q21) three‑way chromosomal translocation targeted AHRR (on 5p15), NCOA2 (on 8q13), and ETV4 (on 17q21) generating the in‑frame fusions AHRR‑NCOA2 and NCOA2‑ETV4 as well as an out‑of‑frame ETV4‑AHRR transcript. In the AHRR‑NCOA2 protein, the C‑terminal part of AHRR is replaced by the C‑terminal part of NCOA2 which contains two activation domains. The NCOA2‑ETV4 protein would contain the helix‑loop‑helix, PAS_9 and PAS_11, CITED domains, the SRC‑1 domain of NCOA2 and the ETS DNA‑binding domain of ETV4. No fusion gene corresponding to t(1;14)(p31;q32) was found. Our findings indicate that, in spite of the recurrence of AHRR‑NCOA2 in angiofibroma of soft tissue, additional genetic events (or fusion genes) might be required for the development of this tumor.

Positive regulation of Leptospira interrogans kdp expression by KdpE as Demonstrated with a novel β-galactosidase reporter in Leptospira biflexa.

PubMed

Matsunaga, James; Coutinho, Mariana L

2012-08-01

Leptospirosis is a potentially deadly zoonotic disease that afflicts humans and animals. Leptospira interrogans, the predominant agent of leptospirosis, encounters diverse conditions as it proceeds through its life cycle, which includes stages inside and outside the host. Unfortunately, the number of genetic tools available for examining the regulation of gene expression in L. interrogans is limited. Consequently, little is known about the genetic circuits that control gene expression in Leptospira. To better understand the regulation of leptospiral gene expression, the L. interrogans kdp locus, encoding homologs of the P-type ATPase KdpABC potassium transporter with their KdpD sensors and KdpE response regulators, was selected for analysis. We showed that a kdpE mutation in L. interrogans prevented the increase in kdpABC mRNA levels observed in the wild-type L. interrogans strain when external potassium levels were low. To confirm that KdpE was a positive regulator of kdpABC transcription, we developed a novel approach for constructing chromosomal genetic fusions to the endogenous bgaL (β-galactosidase) gene of the nonpathogen Leptospira biflexa. We demonstrated positive regulation of a kdpA'-bgaL fusion in L. biflexa by the L. interrogans KdpE response regulator. A control lipL32'-bgaL fusion was not regulated by KdpE. These results demonstrate the utility of genetic fusions to the bgaL gene of L. biflexa for examining leptospiral gene regulation.

The oncogenic gene fusion TMPRSS2: ERG is not a diagnostic or prognostic marker for ovarian cancer

PubMed Central

Huang, Lillian; Schauer, Isaiah G; Zhang, Jing; Mercado-Uribe, Imelda; Deavers, Michael T; Huang, Jiaoti; Liu, Jinsong

2011-01-01

TMPRSS2:ERG is a gene fusion resulting from the chromosomal rearrangement of the androgen-regulated TMPRSS2 gene and the ETS transcription factor ERG, leading to the over-expression of the oncogenic molecule ERG. This gene rearrangement has been found in approximately half of all prostate cancers and ERG overexpression is considered as a novel diagnostic marker for prostate carcinoma. However, little is known about the role of the TMPRSS2:ERG gene fusion in ovarian cancer. The purpose of this study was to test ERG expression in ovarian cancer and its potential as a diagnostic marker for ovarian carcinoma progression. A tissue microarray containing 180 ovarian cancer tissues of various pathological types and grades were examined by immunohistochemical analysis for expression of ERG. We also used 40 prostate carcinoma tissues and 40 normal tissues for comparison in parallel experiments. ERG-positive expression was detected in 40% of the prostate tumor cancer, as well as in internal positive control endothelial cells, confirming over-expression of ERG in prostate cancer at relatively the same rate observed by others. In contrast, all of the ovarian tumor patient tissues of varying histologic types were ERG-negative, despite some positivity in endothelial cells. These results suggest that the oncogenic gene fusion TMPRSS2:ERG does not occur in ovarian cancer relative to prostate cancer. Therefore, development of ERG expression profile would not be a useful diagnostic or prognostic marker for ovarian cancer patient screening. PMID:22076164

The oncogenic gene fusion TMPRSS2: ERG is not a diagnostic or prognostic marker for ovarian cancer.

PubMed

Huang, Lillian; Schauer, Isaiah G; Zhang, Jing; Mercado-Uribe, Imelda; Deavers, Michael T; Huang, Jiaoti; Liu, Jinsong

2011-01-01

TMPRSS2:ERG is a gene fusion resulting from the chromosomal rearrangement of the androgen-regulated TMPRSS2 gene and the ETS transcription factor ERG, leading to the over-expression of the oncogenic molecule ERG. This gene rearrangement has been found in approximately half of all prostate cancers and ERG overexpression is considered as a novel diagnostic marker for prostate carcinoma. However, little is known about the role of the TMPRSS2:ERG gene fusion in ovarian cancer. The purpose of this study was to test ERG expression in ovarian cancer and its potential as a diagnostic marker for ovarian carcinoma progression. A tissue microarray containing 180 ovarian cancer tissues of various pathological types and grades were examined by immunohistochemical analysis for expression of ERG. We also used 40 prostate carcinoma tissues and 40 normal tissues for comparison in parallel experiments. ERG-positive expression was detected in 40% of the prostate tumor cancer, as well as in internal positive control endothelial cells, confirming over-expression of ERG in prostate cancer at relatively the same rate observed by others. In contrast, all of the ovarian tumor patient tissues of varying histologic types were ERG-negative, despite some positivity in endothelial cells. These results suggest that the oncogenic gene fusion TMPRSS2:ERG does not occur in ovarian cancer relative to prostate cancer. Therefore, development of ERG expression profile would not be a useful diagnostic or prognostic marker for ovarian cancer patient screening.

Genomic response to Wnt signalling is highly context-dependent - Evidence from DNA microarray and chromatin immunoprecipitation screens of Wnt/TCF targets

DOE Office of Scientific and Technical Information (OSTI.GOV)

Railo, Antti; Pajunen, Antti; Itaeranta, Petri

2009-10-01

Wnt proteins are important regulators of embryonic development, and dysregulated Wnt signalling is involved in the oncogenesis of several human cancers. Our knowledge of the downstream target genes is limited, however. We used a chromatin immunoprecipitation-based assay to isolate and characterize the actual gene segments through which Wnt-activatable transcription factors, TCFs, regulate transcription and an Affymetrix microarray analysis to study the global transcriptional response to the Wnt3a ligand. The anti-{beta}-catenin immunoprecipitation of DNA-protein complexes from mouse NIH3T3 fibroblasts expressing a fusion protein of {beta}-catenin and TCF7 resulted in the identification of 92 genes as putative TCF targets. GeneChip assays ofmore » gene expression performed on NIH3T3 cells and the rat pheochromocytoma cell line PC12 revealed 355 genes in NIH3T3 and 129 genes in the PC12 cells with marked changes in expression after Wnt3a stimulus. Only 2 Wnt-regulated genes were shared by both cell lines. Surprisingly, Disabled-2 was the only gene identified by the chromatin immunoprecipitation approach that displayed a marked change in expression in the GeneChip assay. Taken together, our approaches give an insight into the complex context-dependent nature of Wnt pathway transcriptional responses and identify Disabled-2 as a potential new direct target for Wnt signalling.« less

Cluster of Genes That Encode Positive and Negative Elements Influencing Filament Length in a Heterocyst-Forming Cyanobacterium

PubMed Central

Merino-Puerto, Victoria; Herrero, Antonia

2013-01-01

The filamentous, heterocyst-forming cyanobacteria perform oxygenic photosynthesis in vegetative cells and nitrogen fixation in heterocysts, and their filaments can be hundreds of cells long. In the model heterocyst-forming cyanobacterium Anabaena sp. strain PCC 7120, the genes in the fraC-fraD-fraE operon are required for filament integrity mainly under conditions of nitrogen deprivation. The fraC operon transcript partially overlaps gene all2395, which lies in the opposite DNA strand and ends 1 bp beyond fraE. Gene all2395 produces transcripts of 1.35 kb (major transcript) and 2.2 kb (minor transcript) that overlap fraE and whose expression is dependent on the N-control transcription factor NtcA. Insertion of a gene cassette containing transcriptional terminators between fraE and all2395 prevented production of the antisense RNAs and resulted in an increased length of the cyanobacterial filaments. Deletion of all2395 resulted in a larger increase of filament length and in impaired growth, mainly under N2-fixing conditions and specifically on solid medium. We denote all2395 the fraF gene, which encodes a protein restricting filament length. A FraF-green fluorescent protein (GFP) fusion protein accumulated significantly in heterocysts. Similar to some heterocyst differentiation-related proteins such as HglK, HetL, and PatL, FraF is a pentapeptide repeat protein. We conclude that the fraC-fraD-fraE←fraF gene cluster (where the arrow indicates a change in orientation), in which cis antisense RNAs are produced, regulates morphology by encoding proteins that influence positively (FraC, FraD, FraE) or negatively (FraF) the length of the filament mainly under conditions of nitrogen deprivation. This gene cluster is often conserved in heterocyst-forming cyanobacteria. PMID:23813733

MIXTA-Like Transcription Factors and WAX INDUCER1/SHINE1 Coordinately Regulate Cuticle Development in Arabidopsis and Torenia fournieri[C][W

PubMed Central

Oshima, Yoshimi; Shikata, Masahito; Koyama, Tomotsugu; Ohtsubo, Norihiro; Mitsuda, Nobutaka; Ohme-Takagi, Masaru

2013-01-01

The waxy plant cuticle protects cells from dehydration, repels pathogen attack, and prevents organ fusion during development. The transcription factor WAX INDUCER1/SHINE1 (WIN1/SHN1) regulates the biosynthesis of waxy substances in Arabidopsis thaliana. Here, we show that the MIXTA-like MYB transcription factors MYB106 and MYB16, which regulate epidermal cell morphology, also regulate cuticle development coordinately with WIN1/SHN1 in Arabidopsis and Torenia fournieri. Expression of a MYB106 chimeric repressor fusion (35S:MYB106-SRDX) and knockout/down of MYB106 and MYB16 induced cuticle deficiencies characterized by organ adhesion and reduction of epicuticular wax crystals and cutin nanoridges. A similar organ fusion phenotype was produced by expression of a WIN1/SHN1 chimeric repressor. Conversely, the dominant active form of MYB106 (35S:MYB106-VP16) induced ectopic production of cutin nanoridges and increased expression of WIN1/SHN1 and wax biosynthetic genes. Microarray experiments revealed that MYB106 and WIN1/SHN1 regulate similar sets of genes, predominantly those involved in wax and cutin biosynthesis. Furthermore, WIN1/SHN1 expression was induced by MYB106-VP16 and repressed by MYB106-SRDX. These results indicate that the regulatory cascade of MIXTA-like proteins and WIN1/SHN1 coordinately regulate cutin biosynthesis and wax accumulation. This study reveals an additional key aspect of MIXTA-like protein function and suggests a unique relationship between cuticle development and epidermal cell differentiation. PMID:23709630

MYB89 Transcription Factor Represses Seed Oil Accumulation1[OPEN

PubMed Central

Li, Dong; Jin, Changyu; Duan, Shaowei; Zhu, Yana; Qi, Shuanghui; Liu, Kaige; Gao, Chenhao; Ma, Haoli; Liao, Yuncheng

2017-01-01

In many higher plants, seed oil accumulation is precisely controlled by intricate multilevel regulatory networks, among which transcriptional regulation mainly influences oil biosynthesis. In Arabidopsis (Arabidopsis thaliana), the master positive transcription factors, WRINKLED1 (WRI1) and LEAFY COTYLEDON1-LIKE (L1L), are important for seed oil accumulation. We found that an R2R3-MYB transcription factor, MYB89, was expressed predominantly in developing seeds during maturation. Oil and major fatty acid biosynthesis in seeds was significantly promoted by myb89-1 mutation and MYB89 knockdown; thus, MYB89 was an important repressor during seed oil accumulation. RNA sequencing revealed remarkable up-regulation of numerous genes involved in seed oil accumulation in myb89 seeds at 12 d after pollination. Posttranslational activation of a MYB89-glucocorticoid receptor fusion protein and chromatin immunoprecipitation assays demonstrated that MYB89 inhibited seed oil accumulation by directly repressing WRI1 and five key genes and by indirectly suppressing L1L and 11 key genes involved in oil biosynthesis during seed maturation. These results help us to understand the novel function of MYB89 and provide new insights into the regulatory network of transcriptional factors controlling seed oil accumulation in Arabidopsis. PMID:27932421

Robust, synergistic regulation of human gene expression using TALE activators.

PubMed

Maeder, Morgan L; Linder, Samantha J; Reyon, Deepak; Angstman, James F; Fu, Yanfang; Sander, Jeffry D; Joung, J Keith

2013-03-01

Artificial activators designed using transcription activator-like effector (TALE) technology have broad utility, but previous studies suggest that these monomeric proteins often exhibit low activities. Here we demonstrate that TALE activators can robustly function individually or in synergistic combinations to increase expression of endogenous human genes over wide dynamic ranges. These findings will encourage applications of TALE activators for research and therapy, and guide design of monomeric TALE-based fusion proteins.

Development of Transcriptional Fusions to Assess Leptospira interrogans Promoter Activity

PubMed Central

Cerqueira, Gustavo M.; Souza, Natalie M.; Araújo, Eduardo R.; Barros, Aline T.; Morais, Zenaide M.; Vasconcellos, Sílvio A.; Nascimento, Ana L. T. O.

2011-01-01

Background Leptospirosis is a zoonotic infectious disease that affects both humans and animals. The existing genetic tools for Leptospira spp. have improved our understanding of the biology of this spirochete as well as the interaction of pathogenic leptospires with the mammalian host. However, new tools are necessary to provide novel and useful information to the field. Methodology and Principal Findings A series of promoter-probe vectors carrying a reporter gene encoding green fluorescent protein (GFP) were constructed for use in L. biflexa. They were tested by constructing transcriptional fusions between the lipL41, Leptospiral Immunoglobulin-like A (ligA) and Sphingomielynase 2 (sph2) promoters from L. interrogans and the reporter gene. ligA and sph2 promoters were the most active, in comparison to the lipL41 promoter and the non-induced controls. The results obtained are in agreement with LigA expression from the L. interrogans Fiocruz L1-130 strain. Conclusions The novel vectors facilitated the in vitro evaluation of L. interrogans promoter activity under defined growth conditions which simulate the mammalian host environment. The fluorescence and rt-PCR data obtained closely reflected transcriptional regulation of the promoters, thus demonstrating the suitability of these vectors for assessing promoter activity in L. biflexa. PMID:21445252

Characterization of the Autophagy related gene-8a (Atg8a) promoter in Drosophila melanogaster.

PubMed

Bali, Arundhati; Shravage, Bhupendra V

2017-01-01

Autophagy is an evolutionarily conserved process which is upregulated under various stress conditions, including nutrient stress and oxidative stress. Amongst autophagy related genes (Atgs), Atg8a (LC3 in mammals) is induced several-fold during nutrient limitation in Drosophila. The minimal Atg8a cis-regulatory module (CRM) which mediates transcriptional upregulation under various stress conditions is not known. Here, we describe the generation and analyses of a series of Atg8a promoter deletions which drive the expression of an mCherry-Atg8a fusion cassette. Expression studies revealed that a 200 bp region of Atg8a is sufficient to drive expression of Atg8a in nutrient rich conditions in fat body and ovaries, as well as under nutrient deficient conditions in the fat body. Furthermore, this 200 bp region can mediate Atg8a upregulation during developmental histolysis of the larval fat body and under oxidative stress conditions induced by H 2 O 2 . Finally, the expression levels of Atg8a from this promoter are sufficient to rescue the lethality of the Atg8a mutant. The 200 bp promoter-fusion reporter provides a valuable tool which can be used in genetic screens to identify transcriptional and post-transcriptional regulators of Atg8a.

Cloning and characterization of GETS-1, a goldfish Ets family member that functions as a transcriptional repressor in muscle.

PubMed

Goldman, D; Sapru, M K; Stewart, S; Plotkin, J; Libermann, T A; Wasylyk, B; Guan, K

1998-10-15

An Ets transcription factor family member, GETS-1, was cloned from a goldfish retina cDNA library. GETS-1 contains a conserved Ets DNA-binding domain at its N-terminus and is most similar to ternary complex factor (TCF) serum-response-factor protein-1a (SAP-1a). GETS-1 is expressed in many tissues, but is enriched in retina and brain. As with the TCFs SAP-1a and ets-related protein (ERP), overexpression of the GETS-1 promoter suppresses nicotinic acetylcholine receptor epsilon-subunit gene expression in cultured muscle cells. A consensus Ets binding site sequence in the promoter of the epsilon-subunit gene is required for GETS-1-mediated repression. GETS-1 repressor activity is abrogated by overexpression of an activated Ras/mitogen-activated protein kinase (MAP kinase) or by mutation of Ser-405, a MAP kinase phosphorylation site in GETS-1. Fusion proteins created between GETS-1 and the Gal4 DNA-binding domain show that, like other TCFs, GETS-1 contains a C-terminal activation domain that is activated by a Ras/MAP kinase signalling cascade. Interestingly, mutation of Ser-405 located within this activation domain abrogated transcriptional activation of the fusion protein.

Characterization of the Structural Gene Promoter of Aedes aegypti Densovirus

PubMed Central

Ward, Todd W.; Kimmick, Michael W.; Afanasiev, Boris N.; Carlson, Jonathan O.

2001-01-01

Aedes aegypti densonucleosis virus (AeDNV) has two promoters that have been shown to be active by reporter gene expression analysis (B. N. Afanasiev, Y. V. Koslov, J. O. Carlson, and B. J. Beaty, Exp. Parasitol. 79:322–339, 1994). Northern blot analysis of cells infected with AeDNV revealed two transcripts 1,200 and 3,500 nucleotides in length that are assumed to express the structural protein (VP) gene and nonstructural protein genes, respectively. Primer extension was used to map the transcriptional start site of the structural protein gene. Surprisingly, the structural protein gene transcript began at an initiator consensus sequence, CAGT, 60 nucleotides upstream from the map unit 61 TATAA sequence previously thought to define the promoter. Constructs with the β-galactosidase gene fused to the structural protein gene were used to determine elements necessary for promoter function. Deletion or mutation of the initiator sequence, CAGT, reduced protein expression by 93%, whereas mutation of the TATAA sequence at map unit 61 had little effect. An additional open reading frame was observed upstream of the structural protein gene that can express β-galactosidase at a low level (20% of that of VP fusions). Expression of the AeDNV structural protein gene was shown to be stimulated by the major nonstructural protein NS1 (Afanasiev et al., Exp. parasitol., 1994). To determine the sequences required for transactivation, expression of structural protein gene–β-galactosidase gene fusion constructs differing in AeDNV genome content was measured with and without NS1. The presence of NS1 led to an 8- to 10-fold increase in expression when either genomic end was present, compared to a 2-fold increase with a construct lacking the genomic ends. An even higher (37-fold) increase in expression occurred with both genomic ends present; however, this was in part due to template replication as shown by Southern blot analysis. These data indicate the location and importance of various elements necessary for efficient protein expression and transactivation from the structural protein gene promoter of AeDNV. PMID:11152505

Host control of plasmid replication: requirement for the sigma factor sigma 32 in transcription of mini-F replication initiator gene.

PubMed Central

Wada, C; Imai, M; Yura, T

1987-01-01

Replication of F factor or mini-F plasmid is strongly inhibited in the rpoH (htpR) mutants of Escherichia coli deficient in the sigma factor (sigma 32) known to be required for heat shock gene expression. Transcription of the mini-F repE gene encoding a replication initiator protein (E protein) was examined by operon fusion and by direct determination of repE mRNA. The synthesis rate and the level of repE mRNA were found to increase transiently upon temperature upshift (30 degrees C to 42 degrees C) in wild-type cells but to decrease rapidly in the rpoH mutants. Thus sigma 32 appeared to be directly involved in transcription of repE whose product, E protein, in turn activates DNA replication from the mini-F ori2 region. This scheme of host-controlled plasmid replication is further supported by the analysis of transcription in vitro: RNA synthesis can be initiated from the repE promoter by a minor form of RNA polymerase containing sigma 32 but not by the major polymerase containing the normal sigma factor sigma 70. The sigma 32-mediated transcription from the repE promoter is strongly inhibited by the E protein. We conclude that transcription of the mini-F repE gene is mediated by the host transcription factor sigma 32 and is negatively controlled by its own product. Images PMID:2447584

EWS-FLI1 inhibits TNF{alpha}-induced NF{kappa}B-dependent transcription in Ewing sarcoma cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lagirand-Cantaloube, Julie, E-mail: julie.cantaloube@crbm.cnrs.fr; Laud, Karine, E-mail: karine.laud@curie.fr; Institut Curie, Genetique et biologie des cancers, Paris

2010-09-03

Research highlights: {yields} EWS-FLI1 interferes with TNF-induced activation of NF{kappa}B in Ewing sarcoma cells. {yields} EWS-FLI1 knockdown in Ewing sarcoma cells increases TNF-induced NF{kappa}B binding to DNA. {yields} EWS-FLI1 reduces TNF-stimulated NF{kappa}B-dependent transcriptional activation. {yields} Constitutive NF{kappa}B activity is not affected by EWS-FLI1. {yields} EWS-FLI1 physically interacts with NF{kappa}B p65 in vivo. -- Abstract: Ewing sarcoma is primarily caused by a t(11;22) chromosomal translocation encoding the EWS-FLI1 fusion protein. To exert its oncogenic function, EWS-FLI1 acts as an aberrant transcription factor, broadly altering the gene expression profile of tumor cells. Nuclear factor-kappaB (NF{kappa}B) is a tightly regulated transcription factor controllingmore » cell survival, proliferation and differentiation, as well as tumorigenesis. NF{kappa}B activity is very low in unstimulated Ewing sarcoma cells, but can be induced in response to tumor necrosis factor (TNF). We wondered whether NF{kappa}B activity could be modulated by EWS-FLI1 in Ewing sarcoma. Using a knockdown approach in Ewing sarcoma cells, we demonstrated that EWS-FLI1 has no influence on NF{kappa}B basal activity, but impairs TNF-induced NF{kappa}B-driven transcription, at least in part through inhibition of NF{kappa}B binding to DNA. We detected an in vivo physical interaction between the fusion protein and NF{kappa}B p65, which could mediate these effects. Our findings suggest that, besides directly controlling the activity of its primary target promoters, EWS-FLI1 can also indirectly influence gene expression in tumor cells by modulating the activity of key transcription factors such as NF{kappa}B.« less

Reconstitution of the ERG Gene Expression Network Reveals New Biomarkers and Therapeutic Targets in ERG Positive Prostate Tumors

PubMed Central

Dubovenko, Alexey; Serebryiskaya, Tatiana; Nikolsky, Yuri; Nikolskaya, Tatiana; Perlina, Ally; JeBailey, Lellean; Bureeva, Svetlana; Katta, Shilpa; Srivastava, Shiv; Dobi, Albert; Khasanova, Tatiana

2015-01-01

Background: Despite a growing number of studies evaluating cancer of prostate (CaP) specific gene alterations, oncogenic activation of the ETS Related Gene (ERG) by gene fusions remains the most validated cancer gene alteration in CaP. Prevalent gene fusions have been described between the ERG gene and promoter upstream sequences of androgen-inducible genes, predominantly TMPRSS2 (transmembrane protease serine 2). Despite the extensive evaluations of ERG genomic rearrangements, fusion transcripts and the ERG oncoprotein, the prognostic value of ERG remains to be better understood. Using gene expression dataset from matched prostate tumor and normal epithelial cells from an 80 GeneChip experiment examining 40 tumors and their matching normal pairs in 40 patients with known ERG status, we conducted a cancer signaling-focused functional analysis of prostatic carcinoma representing moderate and aggressive cancers stratified by ERG expression. Results: In the present study of matched pairs of laser capture microdissected normal epithelial cells and well-to-moderately differentiated tumor epithelial cells with known ERG gene expression status from 20 patients with localized prostate cancer, we have discovered novel ERG associated biochemical networks. Conclusions: Using causal network reconstruction methods, we have identified three major signaling pathways related to MAPK/PI3K cascade that may indeed contribute synergistically to the ERG dependent tumor development. Moreover, the key components of these pathways have potential as biomarkers and therapeutic target for ERG positive prostate tumors. PMID:26000039

Expression of Shigella flexneri gluQ-rs gene is linked to dksA and controlled by a transcriptional terminator

PubMed Central

2012-01-01

Background Glutamyl queuosine-tRNAAsp synthetase (GluQ-RS) is a paralog of the catalytic domain of glutamyl-tRNA synthetase and catalyzes the formation of glutamyl-queuosine on the wobble position of tRNAAsp. Here we analyze the transcription of its gene in Shigella flexneri, where it is found downstream of dksA, which encodes a transcriptional regulator involved in stress responses. Results The genomic organization, dksA-gluQ-rs, is conserved in more than 40 bacterial species. RT-PCR assays show co-transcription of both genes without a significant change in transcript levels during growth of S. flexneri. However, mRNA levels of the intergenic region changed during growth, increasing at stationary phase, indicating an additional level of control over the expression of gluQ-rs gene. Transcriptional fusions with lacZ as a reporter gene only produced β-galactosidase activity when the constructs included the dksA promoter, indicating that gluQ-rs do not have a separate promoter. Using bioinformatics, we identified a putative transcriptional terminator between dksA and gluQ-rs. Deletion or alteration of the predicted terminator resulted in increased expression of the lacZ reporter compared with cells containing the wild type terminator sequence. Analysis of the phenotype of a gluQ-rs mutant suggested that it may play a role in some stress responses, since growth of the mutant was impaired in the presence of osmolytes. Conclusions The results presented here, show that the expression of gluQ-rs depends on the dksA promoter, and strongly suggest the presence and the functionality of a transcriptional terminator regulating its expression. Also, the results indicate a link between glutamyl-queuosine synthesis and stress response in Shigella flexneri. PMID:23035718

Expression of Shigella flexneri gluQ-rs gene is linked to dksA and controlled by a transcriptional terminator.

PubMed

Caballero, Valeria C; Toledo, Viviana P; Maturana, Cristian; Fisher, Carolyn R; Payne, Shelley M; Salazar, Juan Carlos

2012-10-05

Glutamyl queuosine-tRNA(Asp) synthetase (GluQ-RS) is a paralog of the catalytic domain of glutamyl-tRNA synthetase and catalyzes the formation of glutamyl-queuosine on the wobble position of tRNA(Asp). Here we analyze the transcription of its gene in Shigella flexneri, where it is found downstream of dksA, which encodes a transcriptional regulator involved in stress responses. The genomic organization, dksA-gluQ-rs, is conserved in more than 40 bacterial species. RT-PCR assays show co-transcription of both genes without a significant change in transcript levels during growth of S. flexneri. However, mRNA levels of the intergenic region changed during growth, increasing at stationary phase, indicating an additional level of control over the expression of gluQ-rs gene. Transcriptional fusions with lacZ as a reporter gene only produced β-galactosidase activity when the constructs included the dksA promoter, indicating that gluQ-rs do not have a separate promoter. Using bioinformatics, we identified a putative transcriptional terminator between dksA and gluQ-rs. Deletion or alteration of the predicted terminator resulted in increased expression of the lacZ reporter compared with cells containing the wild type terminator sequence. Analysis of the phenotype of a gluQ-rs mutant suggested that it may play a role in some stress responses, since growth of the mutant was impaired in the presence of osmolytes. The results presented here, show that the expression of gluQ-rs depends on the dksA promoter, and strongly suggest the presence and the functionality of a transcriptional terminator regulating its expression. Also, the results indicate a link between glutamyl-queuosine synthesis and stress response in Shigella flexneri.

Identification of a novel FN1-FGFR1 genetic fusion as a frequent event in phosphaturic mesenchymal tumour.

PubMed

Lee, Jen-Chieh; Jeng, Yung-Ming; Su, Sheng-Yao; Wu, Chen-Tu; Tsai, Keh-Sung; Lee, Cheng-Han; Lin, Chung-Yen; Carter, Jodi M; Huang, Jenq-Wen; Chen, Shu-Hwa; Shih, Shyang-Rong; Mariño-Enríquez, Adrián; Chen, Chih-Chi; Folpe, Andrew L; Chang, Yih-Leong; Liang, Cher-Wei

2015-03-01

Phosphaturic mesenchymal tumours (PMTs) are uncommon soft tissue and bone tumours that typically cause hypophosphataemia and tumour-induced osteomalacia (TIO) through secretion of phosphatonins including fibroblast growth factor 23 (FGF23). PMT has recently been accepted by the World Health Organization as a formal tumour entity. The genetic basis and oncogenic pathways underlying its tumourigenesis remain obscure. In this study, we identified a novel FN1-FGFR1 fusion gene in three out of four PMTs by next-generation RNA sequencing. The fusion transcripts and proteins were subsequently confirmed with RT-PCR and western blotting. Fluorescence in situ hybridization analysis showed six cases with FN1-FGFR1 fusion out of an additional 11 PMTs. Overall, nine out of 15 PMTs (60%) harboured this fusion. The FN1 gene possibly provides its constitutively active promoter and the encoded protein's oligomerization domains to overexpress and facilitate the activation of the FGFR1 kinase domain. Interestingly, unlike the prototypical leukaemia-inducing FGFR1 fusion genes, which are ligand-independent, the FN1-FGFR1 chimeric protein was predicted to preserve its ligand-binding domains, suggesting an advantage of the presence of its ligands (such as FGF23 secreted at high levels by the tumour) in the activation of the chimeric receptor tyrosine kinase, thus effecting an autocrine or a paracrine mechanism of tumourigenesis. Copyright © 2014 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

New insights into the roles of NADPH oxidases in sexual development and ascospore germination in Sordaria macrospora.

PubMed

Dirschnabel, Daniela Elisabeth; Nowrousian, Minou; Cano-Domínguez, Nallely; Aguirre, Jesus; Teichert, Ines; Kück, Ulrich

2014-03-01

NADPH oxidase (NOX)-derived reactive oxygen species (ROS) act as signaling determinants that induce different cellular processes. To characterize NOX function during fungal development, we utilized the genetically tractable ascomycete Sordaria macrospora. Genome sequencing of a sterile mutant led us to identify the NADPH oxidase encoding nox1 as a gene required for fruiting body formation, regular hyphal growth, and hyphal fusion. These phenotypes are shared by nor1, lacking the NOX regulator NOR1. Further phenotypic analyses revealed a high correlation between increased ROS production and hyphal fusion deficiencies in nox1 and other sterile mutants. A genome-wide transcriptional profiling analysis of mycelia and isolated protoperithecia from wild type and nox1 revealed that nox1 inactivation affects the expression of genes related to cytoskeleton remodeling, hyphal fusion, metabolism, and mitochondrial respiration. Genetic analysis of nox2, lacking the NADPH oxidase 2 gene, nor1, and transcription factor deletion mutant ste12, revealed a strict melanin-dependent ascospore germination defect, indicating a common genetic pathway for these three genes. We report that gsa3, encoding a G-protein α-subunit, and sac1, encoding cAMP-generating adenylate cyclase, act in a separate pathway during the germination process. The finding that cAMP inhibits ascospore germination in a melanin-dependent manner supports a model in which cAMP inhibits NOX2 activity, thus suggesting a link between both pathways. Our results expand the current knowledge on the role of NOX enzymes in fungal development and provide a frame to define upstream and downstream components of the NOX signaling pathways in fungi.

New Insights Into the Roles of NADPH Oxidases in Sexual Development and Ascospore Germination in Sordaria macrospora

PubMed Central

Dirschnabel, Daniela Elisabeth; Nowrousian, Minou; Cano-Domínguez, Nallely; Aguirre, Jesus; Teichert, Ines; Kück, Ulrich

2014-01-01

NADPH oxidase (NOX)-derived reactive oxygen species (ROS) act as signaling determinants that induce different cellular processes. To characterize NOX function during fungal development, we utilized the genetically tractable ascomycete Sordaria macrospora. Genome sequencing of a sterile mutant led us to identify the NADPH oxidase encoding nox1 as a gene required for fruiting body formation, regular hyphal growth, and hyphal fusion. These phenotypes are shared by ∆nor1, lacking the NOX regulator NOR1. Further phenotypic analyses revealed a high correlation between increased ROS production and hyphal fusion deficiencies in ∆nox1 and other sterile mutants. A genome-wide transcriptional profiling analysis of mycelia and isolated protoperithecia from wild type and ∆nox1 revealed that nox1 inactivation affects the expression of genes related to cytoskeleton remodeling, hyphal fusion, metabolism, and mitochondrial respiration. Genetic analysis of ∆nox2, lacking the NADPH oxidase 2 gene, ∆nor1, and transcription factor deletion mutant ∆ste12, revealed a strict melanin-dependent ascospore germination defect, indicating a common genetic pathway for these three genes. We report that gsa3, encoding a G-protein α-subunit, and sac1, encoding cAMP-generating adenylate cyclase, act in a separate pathway during the germination process. The finding that cAMP inhibits ascospore germination in a melanin-dependent manner supports a model in which cAMP inhibits NOX2 activity, thus suggesting a link between both pathways. Our results expand the current knowledge on the role of NOX enzymes in fungal development and provide a frame to define upstream and downstream components of the NOX signaling pathways in fungi. PMID:24407906

A metabolic function of FGFR3-TACC3 gene fusions in cancer.

PubMed

Frattini, Véronique; Pagnotta, Stefano M; Tala; Fan, Jerry J; Russo, Marco V; Lee, Sang Bae; Garofano, Luciano; Zhang, Jing; Shi, Peiguo; Lewis, Genevieve; Sanson, Heloise; Frederick, Vanessa; Castano, Angelica M; Cerulo, Luigi; Rolland, Delphine C M; Mall, Raghvendra; Mokhtari, Karima; Elenitoba-Johnson, Kojo S J; Sanson, Marc; Huang, Xi; Ceccarelli, Michele; Lasorella, Anna; Iavarone, Antonio

2018-01-11

Chromosomal translocations that generate in-frame oncogenic gene fusions are notable examples of the success of targeted cancer therapies. We have previously described gene fusions of FGFR3-TACC3 (F3-T3) in 3% of human glioblastoma cases. Subsequent studies have reported similar frequencies of F3-T3 in many other cancers, indicating that F3-T3 is a commonly occuring fusion across all tumour types. F3-T3 fusions are potent oncogenes that confer sensitivity to FGFR inhibitors, but the downstream oncogenic signalling pathways remain unknown. Here we show that human tumours with F3-T3 fusions cluster within transcriptional subgroups that are characterized by the activation of mitochondrial functions. F3-T3 activates oxidative phosphorylation and mitochondrial biogenesis and induces sensitivity to inhibitors of oxidative metabolism. Phosphorylation of the phosphopeptide PIN4 is an intermediate step in the signalling pathway of the activation of mitochondrial metabolism. The F3-T3-PIN4 axis triggers the biogenesis of peroxisomes and the synthesis of new proteins. The anabolic response converges on the PGC1α coactivator through the production of intracellular reactive oxygen species, which enables mitochondrial respiration and tumour growth. These data illustrate the oncogenic circuit engaged by F3-T3 and show that F3-T3-positive tumours rely on mitochondrial respiration, highlighting this pathway as a therapeutic opportunity for the treatment of tumours with F3-T3 fusions. We also provide insights into the genetic alterations that initiate the chain of metabolic responses that drive mitochondrial metabolism in cancer.

Reverse transcriptase polymerase chain reaction on fine needle aspirates for rapid detection of translocations in synovial sarcoma.

PubMed

Nilsson, G; Wang, M; Wejde, J; Kanter, L; Karlén, J; Tani, E; Kreicbergs, A; Larsson, O

1998-01-01

To evaluate the utilization of fine needle aspiration (FNA) biopsy to obtain material for reverse-transcriptase polymerase chain reaction (RT-PCR) in the detection of the t(X;18)(p11.2;q11.2) translocation in synovial sarcomas. We applied RT-PCR to detection of synovial sarcoma fusion gene transcripts on fine needle aspirates. Five clinical samples were first analyzed: one was a tumor previously diagnosed as malignant hemangiopericytoma, one was a poorly defined tumor, and three were suspected synovial sarcomas. FNA material was transferred directly to the RT-PCR reaction tube without RNA extraction. The t(X;18) translocation could be detected on the limited amount of material that FNA provides. In each of the cases studied the representivity of the tumor samples was confirmed microscopically. Our protocol permits analysis directly on representative samples without extraction of RNA. The results imply that RT-PCR offers reliable detection of sarcoma fusion gene transcripts on fine needle aspirates. The procedure, apart from being applicable to outpatients, is rapid and sensitive.

Regulation of glutamine synthetase II activity in Rhizobium meliloti 104A14.

PubMed Central

Shatters, R G; Somerville, J E; Kahn, M L

1989-01-01

Most rhizobia contain two glutamine synthetase (GS) enzymes: GSI, encoded by glnA, and GSII, encoded by glnII. We have found that WSU414, a Rhizobium meliloti 104A14 glutamine auxotroph derived from a glnA parental strain, is an ntrA mutant. The R. meliloti glnII promoter region contains DNA sequences similar to those found in front of other genes that require ntrA for their transcription. No GSII was found in the glnA ntrA mutant, and when a translational fusion of glnII to the Escherichia coli lacZ gene was introduced into WSU414, no beta-galactosidase was expressed. These results indicate that ntrA is required for glnII expression. The ntrA mutation did not prevent the expression of GSI. In free-living culture, the level of GSII and of the glnII-lacZ fusion protein was regulated by altering transcription in response to available nitrogen. No GSII protein was detected in alfalfa, pea, or soybean nodules when anti-GSII-specific antiserum was used. Images PMID:2570059

Dimerization-induced corepressor binding and relaxed DNA-binding specificity are critical for PML/RARA-induced immortalization

PubMed Central

Zhou, Jun; Pérès, Laurent; Honoré, Nicole; Nasr, Rihab; Zhu, Jun; de Thé, Hugues

2006-01-01

The pathogenesis of acute promyelocytic leukemia involves the transcriptional repression of master genes of myeloid differentiation by the promyelocytic leukemia–retinoic acid receptor α (PML/RARA) oncogene. PML-enforced RARA homodimerization allows the tighter binding of corepressors, silencing RARA target genes. In addition, homodimerization dramatically extends the spectrum of DNA-binding sites of the fusion protein compared with those of normal RARA. Yet, any contribution of these two properties of PML/RARA to differentiation arrest and immortalization of primary mouse hematopoietic progenitors was unknown. We demonstrate that dimerization-induced silencing mediator of retinoid and thyroid receptors (SMRT)-enhanced binding and relaxed DNA-binding site specificity are both required for efficient immortalization. Thus, enforced RARA dimerization is critical not only for triggering transcriptional repression but also for extending the repertoire of target genes. Our studies exemplify how dimerization-induced gain of functions converts an unessential transcription factor into a dominant oncogenic protein. PMID:16757557

Roles of mono-ubiquitinated Smad4 in the formation of Smad transcriptional complexes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang Bei; Suzuki, Hiroyuki; Kato, Mitsuyasu

2008-11-14

TGF-{beta} activates receptor-regulated Smad (R-Smad) through phosphorylation by type I receptors. Activated R-Smad binds to Smad4 and the complex translocates into the nucleus and stimulates the transcription of target genes through association with co-activators including p300. It is not clear, however, how activated Smad complexes are removed from target genes. In this study, we show that TGF-{beta} enhances the mono-ubiquitination of Smad4. Smad4 mono-ubiquitination was promoted by p300 and suppressed by the c-Ski co-repressor. Smad4 mono-ubiquitination disrupted the interaction with Smad2 in the presence of constitutively active TGF-{beta} type I receptor. Furthermore, mono-ubiquitinated Smad4 was not found in DNA-binding Smadmore » complexes. A Smad4-Ubiquitin fusion protein, which mimics mono-ubiquitinated Smad4, enhanced localization to the cytoplasm. These results suggest that mono-ubiquitination of Smad4 occurs in the transcriptional activator complex and facilitates the turnover of Smad complexes at target genes.« less

Roles of mono-ubiquitinated Smad4 in the formation of Smad transcriptional complexes.

PubMed

Wang, Bei; Suzuki, Hiroyuki; Kato, Mitsuyasu

2008-11-14

TGF-beta activates receptor-regulated Smad (R-Smad) through phosphorylation by type I receptors. Activated R-Smad binds to Smad4 and the complex translocates into the nucleus and stimulates the transcription of target genes through association with co-activators including p300. It is not clear, however, how activated Smad complexes are removed from target genes. In this study, we show that TGF-beta enhances the mono-ubiquitination of Smad4. Smad4 mono-ubiquitination was promoted by p300 and suppressed by the c-Ski co-repressor. Smad4 mono-ubiquitination disrupted the interaction with Smad2 in the presence of constitutively active TGF-beta type I receptor. Furthermore, mono-ubiquitinated Smad4 was not found in DNA-binding Smad complexes. A Smad4-Ubiquitin fusion protein, which mimics mono-ubiquitinated Smad4, enhanced localization to the cytoplasm. These results suggest that mono-ubiquitination of Smad4 occurs in the transcriptional activator complex and facilitates the turnover of Smad complexes at target genes.

Targeted resequencing reveals ALK fusions in non-small cell lung carcinomas detected by FISH, immunohistochemistry, and real-time RT-PCR: a comparison of four methods.

PubMed

Tuononen, Katja; Sarhadi, Virinder Kaur; Wirtanen, Aino; Rönty, Mikko; Salmenkivi, Kaisa; Knuuttila, Aija; Remes, Satu; Telaranta-Keerie, Aino I; Bloor, Stuart; Ellonen, Pekka; Knuutila, Sakari

2013-01-01

Anaplastic lymphoma receptor tyrosine kinase (ALK) gene rearrangements occur in a subgroup of non-small cell lung carcinomas (NSCLCs). The identification of these rearrangements is important for guiding treatment decisions. The aim of our study was to screen ALK gene fusions in NSCLCs and to compare the results detected by targeted resequencing with results detected by commonly used methods, including fluorescence in situ hybridization (FISH), immunohistochemistry (IHC), and real-time reverse transcription-PCR (RT-PCR). Furthermore, we aimed to ascertain the potential of targeted resequencing in detection of ALK-rearranged lung carcinomas. We assessed ALK fusion status for 95 formalin-fixed paraffin-embedded tumor tissue specimens from 87 patients with NSCLC by FISH and real-time RT-PCR, for 57 specimens from 56 patients by targeted resequencing, and for 14 specimens from 14 patients by IHC. All methods were performed successfully on formalin-fixed paraffin-embedded tumor tissue material. We detected ALK fusion in 5.7% (5 out of 87) of patients examined. The results obtained from resequencing correlated significantly with those from FISH, real-time RT-PCR, and IHC. Targeted resequencing proved to be a promising method for ALK gene fusion detection in NSCLC. Means to reduce the material and turnaround time required for analysis are, however, needed.

Identification of a Cryptic Insertion ins(11;X)(q23;q28q12) Resulting in a KMT2A-FLNA Fusion in a 13-Month-Old Child with Acute Myelomonocytic Leukemia.

PubMed

Lentes, Jana; Thomay, Kathrin; Schneider, Dominik T; Bernbeck, Benedikt; Reinhardt, Dirk; Marschalek, Rolf; Meyer, Claus; Schlegelberger, Brigitte; Göhring, Gudrun

2016-01-01

In pediatric acute myeloid leukemia (AML), chromosomal abnormalities leading to a disruption of the lysine methyltransferase 2A (KMT2A) gene in 11q23 are the most frequent rearrangements. Here, we report on the identification of a novel cryptic insertion, ins(11;X)(q23;q28q12), resulting in a translocation of the KMT2A gene in 11q23, leading to a KMT2A-FLNA fusion in a 13-month-old boy with de novo acute myelomonocytic leukemia, who died 38 days after diagnosis. The patient presented a complex karyotype 48∼49,Y,del(X)(q12),+del(X)(q12),+8,ins(11;X)(q23; q28q12),+19. The identified fusion gene was predicted to be out-of-frame (fusion of portions of KMT2A exon 11 with FLNA exon 11). However, RT-PCR experiments demonstrated that a potentially functional transcript was generated by alternative splicing where KMT2A exon 10 was spliced in-frame to the truncated FLNA exon 11. This case report helps to better understand the rare but potentially severe impact of KMT2A- FLNA fusions in infants with AML to improve prognostic stratification of therapy and clinical management. © 2017 S. Karger AG, Basel.

Junction region of EWS-FLI1 fusion protein has a dominant negative effect in Ewing's sarcoma in vitro.

PubMed

Jully, Babu; Vijayalakshmi, Ramshankar; Gopal, Gopisetty; Sabitha, Kesavan; Rajkumar, Thangarajan

2012-11-12

Ewing's sarcoma is a malignancy characterized by a specific 11:22 chromosomal translocation which generates a novel EWS-FLI1 fusion protein functioning as an aberrant transcription factor. In the present study, we have further characterized the junction region of the EWS-FLI1 fusion protein. In-silico model of EWS-FLI1 fusion protein was analysed for ligand binding sites, and a putative region (amino acid (aa) 251-343 of the type 1 fusion protein) in the vicinity of the fusion junction was cloned and expressed using bacterial expression. The recombinant protein was characterized by Circular Dichroism (CD). We then expressed aa 251-280 ectopically in Ewing's sarcoma cell-line and its effect on cell proliferation, tumorigenicity and expression of EWS-FLI1 target genes were analysed. Our modelling analysis indicated that Junction region (aa 251-343) encompasses potential ligand biding sites in the EWS-FLI1 protein and when expressed in bacteria was present as soluble form. Ectopically expressing this region in Ewing's sarcoma cells inhibited tumorigenicity, and EWS-FLI1 target genes indicating a dominant negative biological effect. Junction region can be exploited further as target for drug development in future to specifically target EWS-FLI1 in Ewing's Sarcoma.

kdgREcc Negatively Regulates Genes for Pectinases, Cellulase, Protease, HarpinEcc, and a Global RNA Regulator in Erwinia carotovora subsp. carotovora†

PubMed Central

Liu, Yang; Jiang, Guoqiao; Cui, Yaya; Mukherjee, Asita; Ma, Wei Lei; Chatterjee, Arun K.

1999-01-01

Erwinia carotovora subsp. carotovora produces extracellular pectate lyase (Pel), polygalacturonase (Peh), cellulase (Cel), and protease (Prt). The concerted actions of these enzymes largely determine the virulence of this plant-pathogenic bacterium. E. carotovora subsp. carotovora also produces HarpinEcc, the elicitor of the hypersensitive reaction. We document here that KdgREcc (Kdg, 2-keto-3-deoxygluconate; KdgR, general repressor of genes involved in pectin and galacturonate catabolism), a homolog of the E. chrysanthemi repressor, KdgREch and the Escherichia coli repressor, KdgREco, negatively controls not only the pectinases, Pel and Peh, but also Cel, Prt, and HarpinEcc production in E. carotovora subsp. carotovora. The levels of pel-1, peh-1, celV, and hrpNEcc transcripts are markedly affected by KdgREcc. The KdgREcc− mutant is more virulent than the KdgREcc+ parent. Thus, our data for the first time establish a global regulatory role for KdgREcc in E. carotovora subsp. carotovora. Another novel observation is the negative effect of KdgREcc on the transcription of rsmB (previously aepH), which specifies an RNA regulator controlling exoenzyme and HarpinEcc production. The levels of rsmB RNA are higher in the KdgREcc− mutant than in the KdgREcc+ parent. Moreover, by DNase I protection assays we determined that purified KdgREcc protected three 25-bp regions within the transcriptional unit of rsmB. Alignment of the protected sequences revealed the 21-mer consensus sequence of the KdgREcc-binding site as 5′-G/AA/TA/TGAAA[N6]TTTCAG/TG/TA-3′. Two such KdgREcc-binding sites occur in rsmB DNA in a close proximity to each other within nucleotides +79 and +139 and the third KdgREcc-binding site within nucleotides +207 and +231. Analysis of lacZ transcriptional fusions shows that the KdgR-binding sites negatively affect the expression of rsmB. KdgREcc also binds the operator DNAs of pel-1 and peh-1 genes and represses expression of a pel1-lacZ and a peh1-lacZ transcriptional fusions. We conclude that KdgREcc affects extracellular enzyme production by two ways: (i) directly, by inhibiting the transcription of exoenzyme genes; and (ii) indirectly, by preventing the production of a global RNA regulator. Our findings support the idea that KdgREcc affects transcription by promoter occlusion, i.e., preventing the initiation of transcription, and by a roadblock mechanism, i.e., by affecting the elongation of transcription. PMID:10198003

The role of syncytins in human reproduction and reproductive organ cancers.

PubMed

Soygur, Bikem; Sati, Leyla

2016-11-01

Human life begins with sperm and oocyte fusion. After fertilization, various fusion events occur during human embryogenesis and morphogenesis. For example, the fusion of trophoblastic cells constitutes a key process for normal placental development. Fusion in the placenta is facilitated by syncytin 1 and syncytin 2. These syncytins arose from retroviral sequences that entered the primate genome 25 million and more than 40 million years ago respectively. About 8% of the human genome consists of similar human endogenous retroviral (HERVs) sequences. Many are inactive because of mutations or deletions. However, the role of the few that remain transcriptionally active has not been fully elucidated. Syncytin proteins maintain cell-cell fusogenic activity based on ENV: gene-mediated viral cell entry. In this review, we summarize how syncytins and their receptors are involved in fusion events during human reproduction. The significance of syncytins in tumorigenesis is also discussed. © 2016 Society for Reproduction and Fertility.

Post-fusion treatment with MG132 increases transcription factor expression in somatic cell nuclear transfer embryos in pigs.

PubMed

You, Jinyoung; Lee, Joohyeong; Kim, Jinyoung; Park, Junhong; Lee, Eunsong

2010-02-01

The objective of this study was to examine the effect of post-fusion treatment of somatic cell nuclear transfer (SCNT) oocytes with the proteasomal inhibitor MG132 on maturation promoting factor (MPF) activity, nuclear remodeling, embryonic development, and gene expression of cloned pig embryos. Immediately after electrofusion, SCNT oocytes were treated with MG132 and/or caffeine for 2 hr, vanadate for 0.5 hr, or vanadate for 0.5 hr followed by MG132 for 1.5 hr. Of the MG132 concentrations tested (0-5 microM), the 1 microM concentration showed a higher rate of blastocyst formation (25.9%) than 0 (14.2%), 0.5 (16.9%), and 5 microM (16.9%). Post-fusion treatment with MG132, caffeine, and both MG132 and caffeine improved blastocyst formation (22.1%, 21.4%, and 24.4%, respectively), whereas vanadate treatment inhibited blastocyst formation (6.5%) compared to the control (11.1%). When examined 2 hr after fusion and 1 hr after activation, MPF activity remained at a higher (P < 0.05) level in SCNT oocytes that were treated post-fusion with caffeine and/or MG132, but it was decreased by vanadate. The rate of oocytes showing premature chromosome condensation was not altered by MG132 but was decreased by vanadate treatment. In addition, formation of single pronuclei was increased by MG132 compared to control and vanadate treatment. MG132-treated embryos showed increased expression of POU5F1, DPPA2, DPPA3, DPPA5, and NDP52l1 genes compared to control embryos. Our results demonstrate that post-fusion treatment of SCNT oocytes with MG132 prevents MPF degradation and increases expression of transcription factors in SCNT embryos, which are necessary for normal development of SCNT embryos. (c) 2009 Wiley-Liss, Inc.

Reversible Heat-Induced Inactivation of Chimeric β-Glucuronidase in Transgenic Plants1

PubMed Central

Almoguera, Concepción; Rojas, Anabel; Jordano, Juan

2002-01-01

We compared the expression patterns in transgenic tobacco (Nicotiana tabacum) of two chimeric genes: a translational fusion to β-glucuronidase (GUS) and a transcriptional fusion, both with the same promoter and 5′-flanking sequences of Ha hsp17.7 G4, a small heat shock protein (sHSP) gene from sunflower (Helianthus annuus). We found that immediately after heat shock, the induced expression from the two fusions in seedlings was similar, considering chimeric mRNA or GUS protein accumulation. Surprisingly, we discovered that the chimeric GUS protein encoded by the translational fusion was mostly inactive in such conditions. We also found that this inactivation was fully reversible. Thus, after returning to control temperature, the GUS activity was fully recovered without substantial changes in GUS protein accumulation. In contrast, we did not find differences in the in vitro heat inactivation of the respective GUS proteins. Insolubilization of the chimeric GUS protein correlated with its inactivation, as indicated by immunoprecipitation analyses. The inclusion in another chimeric gene of the 21 amino-terminal amino acids from a different sHSP lead to a comparable reversible inactivation. That effect not only illustrates unexpected post-translational problems, but may also point to sequences involved in interactions specific to sHSPs and in vivo heat stress conditions. PMID:12011363

Requirement for CDK6 in MLL-rearranged acute myeloid leukemia

PubMed Central

Placke, Theresa; Faber, Katrin; Nonami, Atsushi; Putwain, Sarah L.; Salih, Helmut R.; Heidel, Florian H.; Krämer, Alwin; Root, David E.; Barbie, David A.; Krivtsov, Andrei V.; Armstrong, Scott A.; Hahn, William C.; Huntly, Brian J.; Sykes, Stephen M.; Milsom, Michael D.; Scholl, Claudia

2014-01-01

Chromosomal rearrangements involving the H3K4 methyltransferase mixed-lineage leukemia (MLL) trigger aberrant gene expression in hematopoietic progenitors and give rise to an aggressive subtype of acute myeloid leukemia (AML). Insights into MLL fusion-mediated leukemogenesis have not yet translated into better therapies because MLL is difficult to target directly, and the identity of the genes downstream of MLL whose altered transcription mediates leukemic transformation are poorly annotated. We used a functional genetic approach to uncover that AML cells driven by MLL-AF9 are exceptionally reliant on the cell-cycle regulator CDK6, but not its functional homolog CDK4, and that the preferential growth inhibition induced by CDK6 depletion is mediated through enhanced myeloid differentiation. CDK6 essentiality is also evident in AML cells harboring alternate MLL fusions and a mouse model of MLL-AF9–driven leukemia and can be ascribed to transcriptional activation of CDK6 by mutant MLL. Importantly, the context-dependent effects of lowering CDK6 expression are closely phenocopied by a small-molecule CDK6 inhibitor currently in clinical development. These data identify CDK6 as critical effector of MLL fusions in leukemogenesis that might be targeted to overcome the differentiation block associated with MLL-rearranged AML, and underscore that cell-cycle regulators may have distinct, noncanonical, and nonredundant functions in different contexts. PMID:24764564

DOE Office of Scientific and Technical Information (OSTI.GOV)

Orfali, Nina; Department of Pharmacology, Weill Cornell Medical College, New York, NY 10065, USA.; McKenna, Sharon L.

Retinoids are a family of signaling molecules derived from vitamin A with well established roles in cellular differentiation. Physiologically active retinoids mediate transcriptional effects on cells through interactions with retinoic acid (RARs) and retinoid-X (RXR) receptors. Chromosomal translocations involving the RARα gene, which lead to impaired retinoid signaling, are implicated in acute promyelocytic leukemia (APL). All-trans-retinoic acid (ATRA), alone and in combination with arsenic trioxide (ATO), restores differentiation in APL cells and promotes degradation of the abnormal oncogenic fusion protein through several proteolytic mechanisms. RARα fusion-protein elimination is emerging as critical to obtaining sustained remission and long-term cure in APL.more » Autophagy is a degradative cellular pathway involved in protein turnover. Both ATRA and ATO also induce autophagy in APL cells. Enhancing autophagy may therefore be of therapeutic benefit in resistant APL and could broaden the application of differentiation therapy to other cancers. Here we discuss retinoid signaling in hematopoiesis, leukemogenesis, and APL treatment. We highlight autophagy as a potential important regulator in anti-leukemic strategies. - Highlights: • Normal and aberrant retinoid signaling in hematopoiesis and leukemia is reviewed. • We suggest a novel role for RARα in the development of X-RARα gene fusions in APL. • ATRA therapy in APL activates transcription and promotes onco-protein degradation. • Autophagy may be involved in both onco-protein degradation and differentiation. • Pharmacologic autophagy induction may potentiate ATRA's therapeutic effects.« less

A role for peroxisome proliferator-activated receptor γ coactivator-1 in the control of mitochondrial dynamics during postnatal cardiac growth.

PubMed

Martin, Ola J; Lai, Ling; Soundarapandian, Mangala M; Leone, Teresa C; Zorzano, Antonio; Keller, Mark P; Attie, Alan D; Muoio, Deborah M; Kelly, Daniel P

2014-02-14

Increasing evidence has shown that proper control of mitochondrial dynamics (fusion and fission) is required for high-capacity ATP production in the heart. Transcriptional coactivators, peroxisome proliferator-activated receptor γ coactivator-1 (PGC-1) α and PGC-1β, have been shown to regulate mitochondrial biogenesis in the heart at the time of birth. The function of PGC-1 coactivators in the heart after birth has been incompletely understood. Our aim was to assess the role of PGC-1 coactivators during postnatal cardiac development and in adult hearts in mice. Conditional gene targeting was used in mice to explore the role of PGC-1 coactivators during postnatal cardiac development and in adult hearts. Marked mitochondrial structural derangements were observed in hearts of PGC-1α/β-deficient mice during postnatal growth, including fragmentation and elongation, associated with the development of a lethal cardiomyopathy. The expression of genes involved in mitochondrial fusion (Mfn1, Opa1) and fission (Drp1, Fis1) was altered in the hearts of PGC-1α/β-deficient mice. PGC-lα was shown to directly regulate Mfn1 gene transcription by coactivating the estrogen-related receptor α on a conserved DNA element. Surprisingly, PGC-1α/β deficiency in the adult heart did not result in evidence of abnormal mitochondrial dynamics or heart failure. However, transcriptional profiling demonstrated that PGC-1 coactivators are required for high-level expression of nuclear- and mitochondrial-encoded genes involved in mitochondrial dynamics and energy transduction in the adult heart. These results reveal distinct developmental stage-specific programs involved in cardiac mitochondrial dynamics.

Functional Impact and Evolution of a Novel Human Polymorphic Inversion That Disrupts a Gene and Creates a Fusion Transcript

PubMed Central

Puig, Marta; Castellano, David; Pantano, Lorena; Giner-Delgado, Carla; Izquierdo, David; Gayà-Vidal, Magdalena; Lucas-Lledó, José Ignacio; Esko, Tõnu; Terao, Chikashi; Matsuda, Fumihiko; Cáceres, Mario

2015-01-01

Despite many years of study into inversions, very little is known about their functional consequences, especially in humans. A common hypothesis is that the selective value of inversions stems in part from their effects on nearby genes, although evidence of this in natural populations is almost nonexistent. Here we present a global analysis of a new 415-kb polymorphic inversion that is among the longest ones found in humans and is the first with clear position effects. This inversion is located in chromosome 19 and has been generated by non-homologous end joining between blocks of transposable elements with low identity. PCR genotyping in 541 individuals from eight different human populations allowed the detection of tag SNPs and inversion genotyping in multiple populations worldwide, showing that the inverted allele is mainly found in East Asia with an average frequency of 4.7%. Interestingly, one of the breakpoints disrupts the transcription factor gene ZNF257, causing a significant reduction in the total expression level of this gene in lymphoblastoid cell lines. RNA-Seq analysis of the effects of this expression change in standard homozygotes and inversion heterozygotes revealed distinct expression patterns that were validated by quantitative RT-PCR. Moreover, we have found a new fusion transcript that is generated exclusively from inverted chromosomes around one of the breakpoints. Finally, by the analysis of the associated nucleotide variation, we have estimated that the inversion was generated ~40,000–50,000 years ago and, while a neutral evolution cannot be ruled out, its current frequencies are more consistent with those expected for a deleterious variant, although no significant association with phenotypic traits has been found so far. PMID:26427027

Functional Impact and Evolution of a Novel Human Polymorphic Inversion That Disrupts a Gene and Creates a Fusion Transcript.

PubMed

Puig, Marta; Castellano, David; Pantano, Lorena; Giner-Delgado, Carla; Izquierdo, David; Gayà-Vidal, Magdalena; Lucas-Lledó, José Ignacio; Esko, Tõnu; Terao, Chikashi; Matsuda, Fumihiko; Cáceres, Mario

2015-10-01

Despite many years of study into inversions, very little is known about their functional consequences, especially in humans. A common hypothesis is that the selective value of inversions stems in part from their effects on nearby genes, although evidence of this in natural populations is almost nonexistent. Here we present a global analysis of a new 415-kb polymorphic inversion that is among the longest ones found in humans and is the first with clear position effects. This inversion is located in chromosome 19 and has been generated by non-homologous end joining between blocks of transposable elements with low identity. PCR genotyping in 541 individuals from eight different human populations allowed the detection of tag SNPs and inversion genotyping in multiple populations worldwide, showing that the inverted allele is mainly found in East Asia with an average frequency of 4.7%. Interestingly, one of the breakpoints disrupts the transcription factor gene ZNF257, causing a significant reduction in the total expression level of this gene in lymphoblastoid cell lines. RNA-Seq analysis of the effects of this expression change in standard homozygotes and inversion heterozygotes revealed distinct expression patterns that were validated by quantitative RT-PCR. Moreover, we have found a new fusion transcript that is generated exclusively from inverted chromosomes around one of the breakpoints. Finally, by the analysis of the associated nucleotide variation, we have estimated that the inversion was generated ~40,000-50,000 years ago and, while a neutral evolution cannot be ruled out, its current frequencies are more consistent with those expected for a deleterious variant, although no significant association with phenotypic traits has been found so far.

Inducible in vivo DNA footprints define sequences necessary for UV light activation of the parsley chalcone synthase gene.

PubMed Central

Schulze-Lefert, P; Dangl, J L; Becker-André, M; Hahlbrock, K; Schulz, W

1989-01-01

We began characterization of the protein--DNA interactions necessary for UV light induced transcriptional activation of the gene encoding chalcone synthase (CHS), a key plant defense enzyme. Three light dependent in vivo footprints appear on a 90 bp stretch of the CHS promoter with a time course correlated with the onset of CHS transcription. We define a minimal light responsive promoter by functional analysis of truncated CHS promoter fusions with a reporter gene in transient expression experiments in parsley protoplasts. Two of the three footprinted sequence 'boxes' reside within the minimal promoter. Replacement of 10 bp within either of these 'boxes' leads to complete loss of light responsiveness. We conclude that these sequences define the necessary cis elements of the minimal CHS promoter's light responsive element. One of the functionally defined 'boxes' is homologous to an element implicated in regulation of genes involved in photosynthesis. These data represent the first example in a plant defense gene of an induced change in protein--DNA contacts necessary for transcriptional activation. Also, our data argue strongly that divergent light induced biosynthetic pathways share common regulatory units. Images PMID:2566481

Cell Fusion Reprogramming Leads to a Specific Hepatic Expression Pattern during Mouse Bone Marrow Derived Hepatocyte Formation In Vivo

PubMed Central

Arza, Elvira; Alvarez-Barrientos, Alberto; Fabregat, Isabel; Garcia-Bravo, Maria; Meza, Nestor W.; Segovia, Jose C.

2012-01-01

The fusion of bone marrow (BM) hematopoietic cells with hepatocytes to generate BM derived hepatocytes (BMDH) is a natural process, which is enhanced in damaged tissues. However, the reprogramming needed to generate BMDH and the identity of the resultant cells is essentially unknown. In a mouse model of chronic liver damage, here we identify a modification in the chromatin structure of the hematopoietic nucleus during BMDH formation, accompanied by the loss of the key hematopoietic transcription factor PU.1/Sfpi1 (SFFV proviral integration 1) and gain of the key hepatic transcriptional regulator HNF-1A homeobox A (HNF-1A/Hnf1a). Through genome-wide expression analysis of laser captured BMDH, a differential gene expression pattern was detected and the chromatin changes observed were confirmed at the level of chromatin regulator genes. Similarly, Tranforming Growth Factor-β1 (TGF-β1) and neurotransmitter (e.g. Prostaglandin E Receptor 4 [Ptger4]) pathway genes were over-expressed. In summary, in vivo BMDH generation is a process in which the hematopoietic cell nucleus changes its identity and acquires hepatic features. These BMDHs have their own cell identity characterized by an expression pattern different from hematopoietic cells or hepatocytes. The role of these BMDHs in the liver requires further investigation. PMID:22457803

A Set of Activators and Repressors Control Peripheral Glucose Pathways in Pseudomonas putida To Yield a Common Central Intermediate▿

PubMed Central

del Castillo, Teresa; Duque, Estrella; Ramos, Juan L.

2008-01-01

Pseudomonas putida KT2440 channels glucose to the central Entner-Doudoroff intermediate 6-phosphogluconate through three convergent pathways. The genes for these convergent pathways are clustered in three independent regions on the host chromosome. A number of monocistronic units and operons coexist within each of these clusters, favoring coexpression of catabolic enzymes and transport systems. Expression of the three pathways is mediated by three transcriptional repressors, HexR, GnuR, and PtxS, and by a positive transcriptional regulator, GltR-2. In this study, we generated mutants in each of the regulators and carried out transcriptional assays using microarrays and transcriptional fusions. These studies revealed that HexR controls the genes that encode glucokinase/glucose 6-phosphate dehydrogenase that yield 6-phosphogluconate; the genes for the Entner-Doudoroff enzymes that yield glyceraldehyde-3-phosphate and pyruvate; and gap-1, which encodes glyceraldehyde-3-phosphate dehydrogenase. GltR-2 is the transcriptional regulator that controls specific porins for the entry of glucose into the periplasmic space, as well as the gtsABCD operon for glucose transport through the inner membrane. GnuR is the repressor of gluconate transport and gluconokinase responsible for the conversion of gluconate into 6-phosphogluconate. PtxS, however, controls the enzymes for oxidation of gluconate to 2-ketogluconate, its transport and metabolism, and a set of genes unrelated to glucose metabolism. PMID:18245293

The C. elegans che-1 gene encodes a zinc finger transcription factor required for specification of the ASE chemosensory neurons.

PubMed

Uchida, Okiko; Nakano, Hiroyuki; Koga, Makoto; Ohshima, Yasumi

2003-04-01

Chemotaxis to water-soluble chemicals such as NaCl is an important behavior of C. elegans when seeking food. ASE chemosensory neurons have a major role in this behavior. We show that che-1, defined by chemotaxis defects, encodes a zinc-finger protein similar to the GLASS transcription factor required for photoreceptor cell differentiation in Drosophila, and that che-1 is essential for specification and function of ASE neurons. Expression of a che-1::gfp fusion construct was predominant in ASE. In che-1 mutants, expression of genes characterizing ASE such as seven-transmembrane receptors, guanylate cyclases and a cyclic-nucleotide gated channel is lost. Ectopic expression of che-1 cDNA induced expression of ASE-specific marker genes, a dye-filling defect in neurons other than ASE and dauer formation.

Transcription factor mutations in myelodysplastic/myeloproliferative neoplasms

PubMed Central

Ernst, Thomas; Chase, Andrew; Zoi, Katerina; Waghorn, Katherine; Hidalgo-Curtis, Claire; Score, Joannah; Jones, Amy; Grand, Francis; Reiter, Andreas; Hochhaus, Andreas; Cross, Nicholas C.P.

2010-01-01

Background Aberrant activation of tyrosine kinases, caused by either mutation or gene fusion, is of major importance for the development of many hematologic malignancies, particularly myeloproliferative neoplasms. We hypothesized that hitherto unrecognized, cytogenetically cryptic tyrosine kinase fusions may be common in non-classical or atypical myeloproliferative neoplasms and related myelodysplastic/myeloproliferative neoplasms. Design and Methods To detect genomic copy number changes associated with such fusions, we performed a systematic search in 68 patients using custom designed, targeted, high-resolution array comparative genomic hybridization. Arrays contained 44,000 oligonucleotide probes that targeted 500 genes including all 90 tyrosine kinases plus downstream tyrosine kinase signaling components, other translocation targets, transcription factors, and other factors known to be important for myelopoiesis. Results No abnormalities involving tyrosine kinases were detected; however, nine cytogenetically cryptic copy number imbalances were detected in seven patients, including hemizygous deletions of RUNX1 or CEBPA in two cases with atypical chronic myeloid leukemia. Mutation analysis of the remaining alleles revealed non-mutated RUNX1 and a frameshift insertion within CEBPA. A further mutation screen of 187 patients with myelodysplastic/myeloproliferative neoplasms identified RUNX1 mutations in 27 (14%) and CEBPA mutations in seven (4%) patients. Analysis of other transcription factors known to be frequently mutated in acute myeloid leukemia revealed NPM1 mutations in six (3%) and WT1 mutations in two (1%) patients with myelodysplastic/myeloproliferative neoplasms. Univariate analysis indicated that patients with mutations had a shorter overall survival (28 versus 44 months, P=0.019) compared with patients without mutations, with the prognosis for cases with CEBPA, NPM1 or WT1 mutations being particularly poor. Conclusions We conclude that mutations of transcription and other nuclear factors are frequent in myelodysplastic/myeloproliferative neoplasms and are generally mutually exclusive. CEBPA, NPM1 or WT1 mutations may be associated with a poor prognosis, an observation that will need to be confirmed by detailed prospective studies. PMID:20421268

Environmental signals modulate ToxT-dependent virulence factor expression in Vibrio cholerae.

PubMed

Schuhmacher, D A; Klose, K E

1999-03-01

The regulatory protein ToxT directly activates the transcription of virulence factors in Vibrio cholerae, including cholera toxin (CT) and the toxin-coregulated pilus (TCP). Specific environmental signals stimulate virulence factor expression by inducing the transcription of toxT. We demonstrate that transcriptional activation by the ToxT protein is also modulated by environmental signals. ToxT expressed from an inducible promoter activated high-level expression of CT and TCP in V. cholerae at 30 degrees C, but expression of CT and TCP was significantly decreased or abolished by the addition of 0.4% bile to the medium and/or an increase of the temperature to 37 degrees C. Also, expression of six ToxT-dependent TnphoA fusions was modulated by temperature and bile. Measurement of ToxT-dependent transcription of genes encoding CT and TCP by ctxAp- and tcpAp-luciferase fusions confirmed that negative regulation by 37 degrees C or bile occurs at the transcriptional level in V. cholerae. Interestingly, ToxT-dependent transcription of these same promoters in Salmonella typhimurium was relatively insensitive to regulation by temperature or bile. These data are consistent with ToxT transcriptional activity being modulated by environmental signals in V. cholerae and demonstrate an additional level of complexity governing the expression of virulence factors in this pathogen. We propose that negative regulation of ToxT-dependent transcription by environmental signals prevents the incorrect temporal and spatial expression of virulence factors during cholera pathogenesis.

Identification of the Regulator Gene Responsible for the Acetone-Responsive Expression of the Binuclear Iron Monooxygenase Gene Cluster in Mycobacteria ▿

PubMed Central

Furuya, Toshiki; Hirose, Satomi; Semba, Hisashi; Kino, Kuniki

2011-01-01

The mimABCD gene cluster encodes the binuclear iron monooxygenase that oxidizes propane and phenol in Mycobacterium smegmatis strain MC2 155 and Mycobacterium goodii strain 12523. Interestingly, expression of the mimABCD gene cluster is induced by acetone. In this study, we investigated the regulator gene responsible for this acetone-responsive expression. In the genome sequence of M. smegmatis strain MC2 155, the mimABCD gene cluster is preceded by a gene designated mimR, which is divergently transcribed. Sequence analysis revealed that MimR exhibits amino acid similarity with the NtrC family of transcriptional activators, including AcxR and AcoR, which are involved in acetone and acetoin metabolism, respectively. Unexpectedly, many homologs of the mimR gene were also found in the sequenced genomes of actinomycetes. A plasmid carrying a transcriptional fusion of the intergenic region between the mimR and mimA genes with a promoterless green fluorescent protein (GFP) gene was constructed and introduced into M. smegmatis strain MC2 155. Using a GFP reporter system, we confirmed by deletion and complementation analyses that the mimR gene product is the positive regulator of the mimABCD gene cluster expression that is responsive to acetone. M. goodii strain 12523 also utilized the same regulatory system as M. smegmatis strain MC2 155. Although transcriptional activators of the NtrC family generally control transcription using the σ54 factor, a gene encoding the σ54 factor was absent from the genome sequence of M. smegmatis strain MC2 155. These results suggest the presence of a novel regulatory system in actinomycetes, including mycobacteria. PMID:21856847

Studies on the Expression of Sesquiterpene Synthases Using Promoter-β-Glucuronidase Fusions in Transgenic Artemisia annua L

PubMed Central

Wang, Hongzhen; Han, Junli; Kanagarajan, Selvaraju; Lundgren, Anneli; Brodelius, Peter E.

2013-01-01

In order to better understand the influence of sesquiterpene synthases on artemisinin yield in Artemisia annua, the expression of some sesquiterpene synthases has been studied using transgenic plants expressing promoter-GUS fusions. The cloned promoter sequences were 923, 1182 and 1510 bp for β-caryophyllene (CPS), epi-cedrol (ECS) and β-farnesene (FS) synthase, respectively. Prediction of cis-acting regulatory elements showed that the promoters are involved in complex regulation of expression. Transgenic A. annua plants carrying promoter-GUS fusions were studied to elucidate the expression pattern of the three sesquiterpene synthases and compared to the previously studied promoter of amorpha-4,11-diene synthase (ADS), a key enzyme of artemisinin biosynthesis. The CPS and ECS promoters were active in T-shaped trichomes of leaves and stems, basal bracts of flower buds and also in some florets cells but not in glandular secretory trichome while FS promoter activity was only observed in leaf cells and trichomes of transgenic shoots. ADS, CPS, ECS and FS transcripts were induced by wounding in a time depended manner. The four sesquiterpene synthases may be involved in responsiveness of A. annua to herbivory. Methyl jasmonate treatment triggered activation of the promoters of all four sesquiterpene synthases in a time depended manner. Southern blot result showed that the GUS gene was inserted into genomic DNA of transgenic lines as a single copy or two copies. The relative amounts of CPS and ECS as well as germacrene A synthase (GAS) transcripts are much lower than that of ADS transcript. Consequently, down-regulation of the expression of the CPS, ECS or GAS gene may not improve artemsinin yield. However, blocking the expression of FS may have effects on artemisinin production. PMID:24278301

Epithelioid fibrous histiocytoma: molecular characterization of ALK fusion partners in 23 cases.

PubMed

Dickson, Brendan C; Swanson, David; Charames, George S; Fletcher, Christopher Dm; Hornick, Jason L

2018-05-01

Epithelioid fibrous histiocytoma is a rare and distinctive cutaneous neoplasm. Most cases harbor ALK rearrangement and show ALK overexpression, which distinguish this neoplasm from conventional cutaneous fibrous histiocytoma and variants. SQSTM1 and VCL have previously been shown to partner with ALK in one case each of epithelioid fibrous histiocytoma. The purpose of this study was to examine a large cohort of epithelioid fibrous histiocytomas by next-generation sequencing to characterize the nature and prevalence of ALK fusion partners. A retrospective archival review was performed to identify cases of epithelioid fibrous histiocytoma (2012-2016). Immunohistochemistry was performed to confirm ALK expression. Targeted next-generation sequencing was applied on RNA extracted from formalin-fixed paraffin-embedded tissue to identify the fusion partners. Twenty-three cases fulfilled inclusion criteria. The mean patient age was 39 years (range, 8-74), there was no sex predilection, and >75% of cases involved the lower extremities. The most common gene fusions were SQSTM1-ALK (N=12; 52%) and VCL-ALK (N=7; 30%); the other four cases harbored novel fusion partners (DCTN1, ETV6, PPFIBP1, and SPECC1L). The pattern of ALK immunoreactivity was usually granular cytoplasmic (N=12; 52%) or granular cytoplasmic and nuclear (N=10; 43%); the case containing an ETV6 fusion partner showed nuclear staining alone. There was no apparent relationship between tumor morphology and the ALK fusion partner. In summary, SQSTM1 and VCL are the most common ALK fusion partners in epithelioid fibrous histiocytoma; DCTN1, ETV6, PPFIBP1, and SPECC1L represent rare fusion partners. The proteins encoded by these genes play diverse roles in scaffolding, cell adhesion, signaling, and transcription (among others) without clear commonalities. These findings expand the oncogenic promiscuity of many of these ALK fusion genes, which drive neoplasia in tumors of diverse lineages with widely varied clinical behavior. This is the first documented account of ETV6-ALK and SPECC1L-ALK translocations in neoplasms.

The t(10;11)(p13;q14) in the U937 cell line results in the fusion of the AF10 gene and CALM, encoding a new member of the AP-3 clathrin assembly protein family.

PubMed Central

Dreyling, M H; Martinez-Climent, J A; Zheng, M; Mao, J; Rowley, J D; Bohlander, S K

1996-01-01

The translocation t(10;11)(p13;q14) is a recurring chromosomal abnormality that has been observed in patients with acute lymphoblastic leukemia as well as acute myeloid leukemia. We have recently reported that the monocytic cell line U937 has a t(10;11)(p13;q14) translocation. Using a combination of positional cloning and candidate gene approach, we cloned the breakpoint and were able to show that AF10 is fused to a novel gene that we named CALM (Clathrin Assembly Lymphoid Myeloid leukemia gene) located at 11q14. AF10, a putative transcription factor, had recently been cloned as one of the fusion partners of MLL. CALM has a very high homology in its N-terminal third to the murine ap-3 gene which is one of the clathrin assembly proteins. The N-terminal region of ap-3 has been shown to bind to clathrin and to have a high-affinity binding site for phosphoinositols. The identification of the CALM/AF10 fusion gene in the widely used U937 cell line will contribute to our understanding of the malignant phenotype of this line. Images Fig. 1 Fig. 3 PMID:8643484

Functional identification of the non-specific nuclease from white spot syndrome virus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li Li; Lin Shumei; Yanga Feng

2005-07-05

The product encoded by the wsv191 gene from shrimp white spot syndrome virus (WSSV) is homologous with non-specific nucleases (NSN) of other organisms. To functionally identify the protein, the wsv191 gene was expressed in Escherichia coli as a glutathione S-transferase (GST) fusion protein with 6His-tag at C-terminal. The fusion protein (termed as rWSSV-NSN) was purified using Ni-NTA affinity chromatography under denatured conditions, renatured and characterized by three methods. The results showed that rWSSV-NSN could hydrolyze both DNA and RNA. 5'-RACE result revealed that the transcription initiation site of the wsv191 gene was located at nucleotide residue G of the predictedmore » ATG triplet. Therefore, we concluded that the next ATG should be the genuine translation initiation codon of the wsv191 gene. Western blot analysis revealed that the molecular mass of natural WSSV-NSN was 37 kDa.« less

Plant-Derived Transcription Factors for Orthologous Regulation of Gene Expression in the Yeast Saccharomyces cerevisiae.

PubMed

Naseri, Gita; Balazadeh, Salma; Machens, Fabian; Kamranfar, Iman; Messerschmidt, Katrin; Mueller-Roeber, Bernd

2017-09-15

Control of gene expression by transcription factors (TFs) is central in many synthetic biology projects for which a tailored expression of one or multiple genes is often needed. As TFs from evolutionary distant organisms are unlikely to affect gene expression in a host of choice, they represent excellent candidates for establishing orthogonal control systems. To establish orthogonal regulators for use in yeast (Saccharomyces cerevisiae), we chose TFs from the plant Arabidopsis thaliana. We established a library of 106 different combinations of chromosomally integrated TFs, activation domains (yeast GAL4 AD, herpes simplex virus VP64, and plant EDLL) and synthetic promoters harboring cognate cis-regulatory motifs driving a yEGFP reporter. Transcriptional output of the different driver/reporter combinations varied over a wide spectrum, with EDLL being a considerably stronger transcription activation domain in yeast than the GAL4 activation domain, in particular when fused to Arabidopsis NAC TFs. Notably, the strength of several NAC-EDLL fusions exceeded that of the strong yeast TDH3 promoter by 6- to 10-fold. We furthermore show that plant TFs can be used to build regulatory systems encoded by centromeric or episomal plasmids. Our library of TF-DNA binding site combinations offers an excellent tool for diverse synthetic biology applications in yeast.

Curcumin differentially regulates endoplasmic reticulum stress through transcriptional corepressor SMILE (small heterodimer partner-interacting leucine zipper protein)-mediated inhibition of CREBH (cAMP responsive element-binding protein H).

PubMed

Misra, Jagannath; Chanda, Dipanjan; Kim, Don-kyu; Li, Tiangang; Koo, Seung-Hoi; Back, Sung-Hoon; Chiang, John Y L; Choi, Hueng-Sik

2011-12-09

Curcumin (diferuloylmethane), a major active component of turmeric (Curcuma longa), is a natural polyphenolic compound. Herein the effect of curcumin on endoplasmic reticulum (ER) stress responsive gene expression was investigated. We report that curcumin induces transcriptional corepressor small heterodimer partner-interacting leucine zipper protein (SMILE) gene expression through liver kinase B1 (LKB1)/adenosine monophosphate-activated kinase (AMPK) signaling pathway and represses ER stress-responsive gene transcription in an ER-bound transcription factor specific manner. cAMP responsive element-binding protein H (CREBH) and activating transcription factor 6 (ATF6) are both ER-bound bZIP family transcription factors that are activated upon ER stress. Of interest, we observed that both curcumin treatment and SMILE overexpression only represses CREBH-mediated transactivation of the target gene but not ATF6-mediated transactivation. Knockdown of endogenous SMILE significantly releases the inhibitory effect of curcumin on CREBH transactivation. Intrinsic repressive activity of SMILE is observed in the Gal4 fusion system, and the intrinsic repressive domain is mapped to the C terminus of SMILE spanning amino acid residues 203-269, corresponding to the basic region leucine zipper (bZIP) domain. In vivo interaction assay revealed that through its bZIP domain, SMILE interacts with CREBH and inhibits its transcriptional activity. Interestingly, we observed that SMILE does not interact with ATF6. Furthermore, competition between SMILE and the coactivator peroxisome proliferator-activated receptor α (PGC-1α) on CREBH transactivation has been demonstrated in vitro and in vivo. Finally, chromatin immunoprecipitation assays revealed that curcumin decreases the binding of PGC-1α and CREBH on target gene promoter in a SMILE-dependent manner. Overall, for the first time we suggest a novel phenomenon that the curcumin/LKB1/AMPK/SMILE/PGC1α pathway differentially regulates ER stress-mediated gene transcription.

Transcriptional network control of normal and leukaemic haematopoiesis

PubMed Central

Sive, Jonathan I.; Göttgens, Berthold

2014-01-01

Transcription factors (TFs) play a key role in determining the gene expression profiles of stem/progenitor cells, and defining their potential to differentiate into mature cell lineages. TF interactions within gene-regulatory networks are vital to these processes, and dysregulation of these networks by TF overexpression, deletion or abnormal gene fusions have been shown to cause malignancy. While investigation of these processes remains a challenge, advances in genome-wide technologies and growing interactions between laboratory and computational science are starting to produce increasingly accurate network models. The haematopoietic system provides an attractive experimental system to elucidate gene regulatory mechanisms, and allows experimental investigation of both normal and dysregulated networks. In this review we examine the principles of TF-controlled gene regulatory networks and the key experimental techniques used to investigate them. We look in detail at examples of how these approaches can be used to dissect out the regulatory mechanisms controlling normal haematopoiesis, as well as the dysregulated networks associated with haematological malignancies. PMID:25014893

Transcriptional network control of normal and leukaemic haematopoiesis.

PubMed

Sive, Jonathan I; Göttgens, Berthold

2014-12-10

Transcription factors (TFs) play a key role in determining the gene expression profiles of stem/progenitor cells, and defining their potential to differentiate into mature cell lineages. TF interactions within gene-regulatory networks are vital to these processes, and dysregulation of these networks by TF overexpression, deletion or abnormal gene fusions have been shown to cause malignancy. While investigation of these processes remains a challenge, advances in genome-wide technologies and growing interactions between laboratory and computational science are starting to produce increasingly accurate network models. The haematopoietic system provides an attractive experimental system to elucidate gene regulatory mechanisms, and allows experimental investigation of both normal and dysregulated networks. In this review we examine the principles of TF-controlled gene regulatory networks and the key experimental techniques used to investigate them. We look in detail at examples of how these approaches can be used to dissect out the regulatory mechanisms controlling normal haematopoiesis, as well as the dysregulated networks associated with haematological malignancies. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

Identification of BSAP (Pax-5) target genes in early B-cell development by loss- and gain-of-function experiments.

PubMed Central

Nutt, S L; Morrison, A M; Dörfler, P; Rolink, A; Busslinger, M

1998-01-01

The Pax-5 gene codes for the transcription factor BSAP which is essential for the progression of adult B lymphopoiesis beyond an early progenitor (pre-BI) cell stage. Although several genes have been proposed to be regulated by BSAP, CD19 is to date the only target gene which has been genetically confirmed to depend on this transcription factor for its expression. We have now taken advantage of cultured pre-BI cells of wild-type and Pax-5 mutant bone marrow to screen a large panel of B lymphoid genes for additional BSAP target genes. Four differentially expressed genes were shown to be under the direct control of BSAP, as their expression was rapidly regulated in Pax-5-deficient pre-BI cells by a hormone-inducible BSAP-estrogen receptor fusion protein. The genes coding for the B-cell receptor component Ig-alpha (mb-1) and the transcription factors N-myc and LEF-1 are positively regulated by BSAP, while the gene coding for the cell surface protein PD-1 is efficiently repressed. Distinct regulatory mechanisms of BSAP were revealed by reconstituting Pax-5-deficient pre-BI cells with full-length BSAP or a truncated form containing only the paired domain. IL-7 signalling was able to efficiently induce the N-myc gene only in the presence of full-length BSAP, while complete restoration of CD19 synthesis was critically dependent on the BSAP protein concentration. In contrast, the expression of the mb-1 and LEF-1 genes was already reconstituted by the paired domain polypeptide lacking any transactivation function, suggesting that the DNA-binding domain of BSAP is sufficient to recruit other transcription factors to the regulatory regions of these two genes. In conclusion, these loss- and gain-of-function experiments demonstrate that BSAP regulates four newly identified target genes as a transcriptional activator, repressor or docking protein depending on the specific regulatory sequence context. PMID:9545244

Optimized approach for Ion Proton RNA sequencing reveals details of RNA splicing and editing features of the transcriptome.

PubMed

Brown, Roger B; Madrid, Nathaniel J; Suzuki, Hideaki; Ness, Scott A

2017-01-01

RNA-sequencing (RNA-seq) has become the standard method for unbiased analysis of gene expression but also provides access to more complex transcriptome features, including alternative RNA splicing, RNA editing, and even detection of fusion transcripts formed through chromosomal translocations. However, differences in library methods can adversely affect the ability to recover these different types of transcriptome data. For example, some methods have bias for one end of transcripts or rely on low-efficiency steps that limit the complexity of the resulting library, making detection of rare transcripts less likely. We tested several commonly used methods of RNA-seq library preparation and found vast differences in the detection of advanced transcriptome features, such as alternatively spliced isoforms and RNA editing sites. By comparing several different protocols available for the Ion Proton sequencer and by utilizing detailed bioinformatics analysis tools, we were able to develop an optimized random primer based RNA-seq technique that is reliable at uncovering rare transcript isoforms and RNA editing features, as well as fusion reads from oncogenic chromosome rearrangements. The combination of optimized libraries and rapid Ion Proton sequencing provides a powerful platform for the transcriptome analysis of research and clinical samples.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miranda, Tina Branscombe; Webb, Kristofor J.; Edberg, Dale D.

The HMGA family proteins HMGA1a and HMGA1b are nuclear nonhistone species implicated in a wide range of cellular processes including inducible gene transcription, modulation of chromosome structure through nucleosome and chromosome remodeling, and neoplastic transformation. HMGA proteins are highly modified, and changes in their phosphorylation states have been correlated with the phase of the cell cycle and changes in their transcriptional activity. HMGA1a is also methylated in the first DNA-binding AT-hook at Arg25 and other sites, although the enzyme or enzymes responsible have not been identified. We demonstrate here that a GST fusion of protein arginine methyltransferase 6 (PRMT6) specificallymore » methylates full-length recombinant HMGA1a protein in vitro. Although GST fusions of PRMT1 and PRMT3 were also capable of methylating the full-length HMGA1a polypeptide, they recognize its proteolytic degradation products much better. GST fusions of PRMT4 or PRMT7 were unable to methylate the full-length protein or its degradation products. We conclude that PRMT6 is a good candidate for the endogenous enzyme responsible for HGMA1a methylation.« less

Cell-cycle dependent expression of a translocation-mediated fusion oncogene mediates checkpoint adaptation in rhabdomyosarcoma.

PubMed

Kikuchi, Ken; Hettmer, Simone; Aslam, M Imran; Michalek, Joel E; Laub, Wolfram; Wilky, Breelyn A; Loeb, David M; Rubin, Brian P; Wagers, Amy J; Keller, Charles

2014-01-01

Rhabdomyosarcoma is the most commonly occurring soft-tissue sarcoma in childhood. Most rhabdomyosarcoma falls into one of two biologically distinct subgroups represented by alveolar or embryonal histology. The alveolar subtype harbors a translocation-mediated PAX3:FOXO1A fusion gene and has an extremely poor prognosis. However, tumor cells have heterogeneous expression for the fusion gene. Using a conditional genetic mouse model as well as human tumor cell lines, we show that that Pax3:Foxo1a expression is enriched in G2 and triggers a transcriptional program conducive to checkpoint adaptation under stress conditions such as irradiation in vitro and in vivo. Pax3:Foxo1a also tolerizes tumor cells to clinically-established chemotherapy agents and emerging molecularly-targeted agents. Thus, the surprisingly dynamic regulation of the Pax3:Foxo1a locus is a paradigm that has important implications for the way in which oncogenes are modeled in cancer cells.

Life-cycle and growth-phase-dependent regulation of the ubiquitin genes of Trypanosoma cruzi.

PubMed

Manning-Cela, Rebeca; Jaishankar, Sobha; Swindle, John

2006-07-01

Trypanosoma cruzi, the causative agent of Chagas disease, exhibits a complex life cycle that is accompanied by the stage-specific gene expression. At the molecular level, very little is known about gene regulation in trypanosomes. Complex gene organizations coupled with polycistronic transcription units make the analysis of regulated gene expression difficult in trypanosomes. The ubiquitin genes of T. cruzi are a good example of this complexity. They are organized as a single cluster containing five ubiquitin fusion (FUS) and five polyubiquitin (PUB) genes that are polycistronically transcribed but expressed differently in response to developmental and environmental changes. Gene replacements were used to study FUS and PUB gene expression at different stages of growth and at different points in the life cycle of T. cruzi. Based on the levels of reporter gene expression, it was determined that FUS1 expression was downregulated as the parasites approached stationary phase, whereas PUB12.5 polyubiquitin gene expression increased. Conversely, FUS1 expression increases when epimastigotes and amastigotes differentiate into trypomastigotes, whereas the expression of PUB12.5 decreases when epimastigotes differentiate into amastigotes and trypomastigotes. Although the level of CAT activity in logarithmic growing epimastigotes is six- to seven-fold higher when the gene was expressed from the FUS1 locus than when expressed from the PUB12.5 locus, the rate of transcription from the two loci was the same implying that post-transcriptional mechanisms play a dominant role in the regulation of gene expression.

Comparison of susceptibility and transcription profile of the new antifungal hassallidin A with caspofungin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Neuhof, Torsten; Seibold, Michael; Thewes, Sascha

This is First report on the antifungal effects of the new glycolipopeptide hassallidin A. Due to related molecular structure moieties between hassallidin A and the established antifungal drug caspofungin we assumed parallels in the effects on cell viability. Therefore we compared hassallidin A with caspofungin by antifungal susceptibility testing and by analysing the genome-wide transcriptional profile of Candida albicans. Furthermore, we examined modifications in ultracellular structure due to hassallidin A treatment by electron microscopy. Hassallidin A was found to be fungicidal against all tested Candida species and Cryptococcus neoformans isolates. MICs ranged from 4 to 8 {mu}g/ml, independently from themore » species. Electron microscopy revealed noticeable ultrastructural changes in C. albicans cells exposed to hassallidin A. Comparing the transcriptional profile of C. albicans cells treated with hassallidin A to that of cells exposed to caspofungin, only 20 genes were found to be similarly up- or down-regulated in both assays, while 227 genes were up- or down-regulated induced by hassallidin A specifically. Genes up-regulated in cells exposed to hassallidin A included metabolic and mitotic genes, while genes involved in DNA repair, vesicle docking, and membrane fusion were down-regulated. In summary, our data suggest that, although hassallidin A and caspofungin have similar structures, however, the effects on susceptibility and transcriptional response to yeasts seem to be different.« less

CEP72-ROS1: A novel ROS1 oncogenic fusion variant in lung adenocarcinoma identified by next-generation sequencing.

PubMed

Zhu, You-Cai; Zhou, Yue-Fen; Wang, Wen-Xian; Xu, Chun-Wei; Zhuang, Wu; Du, Kai-Qi; Chen, Gang

2018-05-01

ROS1 rearrangement is a validated therapeutic driver gene in non-small cell lung cancer (NSCLC) and represents a small subset (1-2%) of NSCLC. A total of 17 different fusion partner genes of ROS1 in NSCLC have been reported. The multi-targeted MET/ALK/ROS1 tyrosine kinase inhibitor (TKI) crizotinib has demonstrated remarkable efficacy in ROS1-rearranged NSCLC. Consequently, ROS1 detection assays include fluorescence in situ hybridization, immunohistochemistry, and real-time PCR. Next-generation sequencing (NGS) assay covers a range of fusion genes and approaches to discover novel receptor-kinase rearrangements in lung cancer. A 63-year-old male smoker with stage IV NSCLC (TxNxM1) was detected with a novel ROS1 fusion. Histological examination of the tumor showed lung adenocarcinoma. NGS analysis of the hydrothorax cellblocks revealed a novel CEP72-ROS1 rearrangement. This novel CEP72-ROS1 fusion variant is generated by the fusion of exons 1-11 of CEP72 on chromosome 5p15 to exons 23-43 of ROS1 on chromosome 6q22. The predicted CEP72-ROS1 protein product contains 1202 amino acids comprising the N-terminal amino acids 594-647 of CEP72 and C-terminal amino acid 1-1148 of ROS1. CEP72-ROS1 is a novel ROS1 fusion variant in NSCLC discovered by NGS and could be included in ROS1 detection assay, such as reverse transcription PCR. Pleural effusion samples show good diagnostic performance in clinical practice. © 2018 The Authors. Thoracic Cancer published by China Lung Oncology Group and John Wiley & Sons Australia, Ltd.

CEP72‐ROS1: A novel ROS1 oncogenic fusion variant in lung adenocarcinoma identified by next‐generation sequencing

PubMed Central

Zhu, You‐cai; Zhou, Yue‐fen; Zhuang, Wu; Du, Kai‐qi; Chen, Gang

2018-01-01

ROS1 rearrangement is a validated therapeutic driver gene in non‐small cell lung cancer (NSCLC) and represents a small subset (1–2%) of NSCLC. A total of 17 different fusion partner genes of ROS1 in NSCLC have been reported. The multi‐targeted MET/ALK/ROS1 tyrosine kinase inhibitor (TKI) crizotinib has demonstrated remarkable efficacy in ROS1‐rearranged NSCLC. Consequently, ROS1 detection assays include fluorescence in situ hybridization, immunohistochemistry, and real‐time PCR. Next‐generation sequencing (NGS) assay covers a range of fusion genes and approaches to discover novel receptor‐kinase rearrangements in lung cancer. A 63‐year‐old male smoker with stage IV NSCLC (TxNxM1) was detected with a novel ROS1 fusion. Histological examination of the tumor showed lung adenocarcinoma. NGS analysis of the hydrothorax cellblocks revealed a novel CEP72‐ROS1 rearrangement. This novel CEP72‐ROS1 fusion variant is generated by the fusion of exons 1–11 of CEP72 on chromosome 5p15 to exons 23–43 of ROS1 on chromosome 6q22. The predicted CEP72‐ROS1 protein product contains 1202 amino acids comprising the N‐terminal amino acids 594–647 of CEP72 and C‐terminal amino acid 1‐1148 of ROS1. CEP72‐ROS1 is a novel ROS1 fusion variant in NSCLC discovered by NGS and could be included in ROS1 detection assay, such as reverse transcription PCR. Pleural effusion samples show good diagnostic performance in clinical practice. PMID:29517860

Fusion gene profile of biphenotypic sinonasal sarcoma: an analysis of 44 cases.

PubMed

Fritchie, Karen J; Jin, Long; Wang, Xiaoke; Graham, Rondell P; Torbenson, Michael S; Lewis, Jean E; Rivera, Michael; Garcia, Joaquin J; Schembri-Wismayer, David J; Westendorf, Jennifer J; Chou, Margaret M; Dong, Jie; Oliveira, Andre M

2016-12-01

Biphenotypic sinonasal sarcoma (SNS) is a locally aggressive tumour that occurs in the sinonasal region. PAX3-MAML3 has recently been identified as a recurrent fusion gene event in this entity; however, a subset of tumours harbour alternative PAX3 rearrangement without the involvement of MAML3. In this study we sought to characterize the molecular profile of a large series of cases, with a special emphasis on tumours with alternative fusions. Forty-four examples of SNS were screened by fluorescence in-situ hybridization and reverse transcription polymerase chain reaction to better characterize its molecular profile and identify potential novel fusion genes. Twenty-four were positive for PAX3-MAML3 (55%), 15 showed rearrangements of PAX3 without MAML3 involvement (34%), one showed rearrangement of MAML3 without PAX3 involvement, and four were negative for the involvement of either gene (9%). Among 15 cases with PAX3 involvement only, three were found to harbour PAX3-FOXO1. Two of these cases arose in the nasal cavities of female patients (aged 31 and 47 years), and one showed bilateral involvement of the nasal cavities of a 35-year-old male. A fourth case involved the skull base of a 47-year-old male, and was positive for PAX3-NCOA1. Patients with fusion-negative tumours were slightly older. More than half of the SNSs in this series were positive for PAX3-MAML3. However, a subset of tumours may harbour alternative PAX3 fusion genes or show no involvement of PAX3. Except for a possible weak association between age and molecular profile, the overall morphological and immunophenotypic features of all cases seem to be similar. Because of the rarity of these tumours, the impact of the molecular profile on the clinical course of these tumours remains to be determined. © 2016 John Wiley & Sons Ltd.

Novel BCOR-MAML3 and ZC3H7B-BCOR Gene Fusions in Undifferentiated Small Blue Round Cell Sarcomas

PubMed Central

Specht, Katja; Zhang, Lei; Sung, Yun-Shao; Nucci, Marisa; Dry, Sarah; Vaiyapuri, Sumathi; Richter, Gunther HS; Fletcher, Christopher DM; Antonescu, Cristina R

2015-01-01

Small blue round cell tumors (SBRCTs) are a heterogenous group of tumors that are difficult to diagnose due to overlapping morphologic, immunohistochemical and clinical features. About two-thirds of EWSR1-negative SBRCTs are associated with CIC-DUX4 related fusions, while another small subset shows BCOR-CCNB3 X-chromosomal paracentric inversion. Applying paired-end RNA sequencing to an SBRCT index case of a 44 year-old male, we identified a novel BCOR-MAML3 chimeric fusion, which was validated by RT-PCR and FISH techniques. We then screened a total of 75 SBRCTs lacking EWSR1, FUS, SYT, CIC and BCOR-CCNB3 abnormalities, for BCOR break-apart probes by FISH to detect potential recurrent BCOR gene rearrangements, outside the typical X-chromosomal inversion. Indeed, 8/75 (11%) SBRCTs showed distinct BCOR gene rearrangements, with 2 cases each showing either a BCOR-MAML3 or the alternative ZC3H7B-BCOR fusion, while no fusion partner was detected in the remaining 4 cases. Gene expression of the BCOR-MAML3 positive index case showed a distinct transcriptional profile with upregulation of HOX-gene signature, compared to classic Ewing sarcoma or CIC-DUX4-positive SBRCTs. The clinicopathologic features of the SRBCTs with alternative BCOR rearrangements were also compared with a group of BCOR-CCNB3 inversion positive cases, combining 11 from our files with a meta-analysis of 42 published cases. The BCOR-CCNB3-positive tumors occurred preferentially in children and in bone, in contrast to alternative BCOR-rearranged SBRCTs which presented in young adults, with a variable anatomic distribution. Furthermore BCOR-rearranged tumors often displayed spindle cell areas, either well-defined in intersecting fascicles or blending with the round cell component, which appears distinct from most other fusion-positive SBRCTs and shares histologic overlap with poorly differentiated synovial sarcoma. PMID:26752546

Low Temperature Induction of Arabidopsis CBF1, 2, and 3 Is Gated by the Circadian Clock1

PubMed Central

Fowler, Sarah G.; Cook, Daniel; Thomashow, Michael F.

2005-01-01

Exposing Arabidopsis (Arabidopsis thaliana) plants to low temperature results in rapid induction of CBF1, 2, and 3 (CBF1-3; also known as DREB1B, C, and A, respectively), which encode transcriptional activators that induce expression of a battery of genes that increase plant freezing and chilling tolerance. Recently, it has been shown that basal levels of CBF3 transcripts and those of certain CBF-regulated genes exhibit circadian cycling. Here, we further explored the regulation of CBF1-3 by the circadian clock. The results indicated that the extent to which CBF1-3 transcripts accumulated in response to low temperature was dependent on the time of day that the plants were exposed to low temperature and that this was regulated by the circadian clock. The highest and lowest levels of cold-induced CBF1-3 transcript accumulation occurred at 4 and 16 h after subjective dawn, respectively. An analysis of CBF2 promoter-reporter gene fusions indicated that this control included transcriptional regulation. In addition, the cold responsiveness of RAV1 and ZAT12, genes that are cold induced in parallel with CBF1-3, was also subject to circadian regulation. However, whereas the maximum level of cold-induced RAV1 transcript accumulation occurred at the same time of day as did CBF1-3 transcripts, that of ZAT12 was in reverse phase, i.e. the highest level of cold-induced ZAT12 transcript accumulation occurred 16 h after subjective dawn. These results indicate that cold-induced expression of CBF1-3, RAV1, and ZAT12 is gated by the circadian clock and suggest that this regulation likely occurs through at least two nonidentical (though potentially overlapping) signaling pathways. PMID:15728337

Development of a Newcastle disease virus vector expressing a foreign gene through an internal ribosomal entry site provides direct proof for a sequential transcription mechanism.

PubMed

Zhang, Zhenyu; Zhao, Wei; Li, Deshan; Yang, Jinlong; Zsak, Laszlo; Yu, Qingzhong

2015-08-01

In the present study, we developed a novel approach for foreign gene expression by Newcastle disease virus (NDV) from a second ORF through an internal ribosomal entry site (IRES). Six NDV LaSota strain-based recombinant viruses vectoring the IRES and a red fluorescence protein (RFP) gene behind the nucleocapsid (NP), phosphoprotein (P), matrix (M), fusion (F), haemagglutinin-neuraminidase (HN) or large polymerase (L) gene ORF were generated using reverse genetics technology. The insertion of the second ORF slightly attenuated virus pathogenicity, but did not affect ability of the virus to grow. Quantitative measurements of RFP expression in virus-infected DF-1 cells revealed that the abundance of viral mRNAs and red fluorescence intensity were positively correlated with the gene order of NDV, 3'-NP-P-M-F-HN-L-5', proving the sequential transcription mechanism for NDV. The results herein suggest that the level of foreign gene expression could be regulated by selecting the second ORF insertion site to maximize the efficacy of vaccine and gene therapy.

Neurospora crassa Female Development Requires the PACC and Other Signal Transduction Pathways, Transcription Factors, Chromatin Remodeling, Cell-To-Cell Fusion, and Autophagy

PubMed Central

Chinnici, Jennifer L.; Fu, Ci; Caccamise, Lauren M.; Arnold, Jason W.; Free, Stephen J.

2014-01-01

Using a screening protocol we have identified 68 genes that are required for female development in the filamentous fungus Neurospora crassa. We find that we can divide these genes into five general groups: 1) Genes encoding components of the PACC signal transduction pathway, 2) Other signal transduction pathway genes, including genes from the three N. crassa MAP kinase pathways, 3) Transcriptional factor genes, 4) Autophagy genes, and 5) Other miscellaneous genes. Complementation and RIP studies verified that these genes are needed for the formation of the female mating structure, the protoperithecium, and for the maturation of a fertilized protoperithecium into a perithecium. Perithecia grafting experiments demonstrate that the autophagy genes and the cell-to-cell fusion genes (the MAK-1 and MAK-2 pathway genes) are needed for the mobilization and movement of nutrients from an established vegetative hyphal network into the developing protoperithecium. Deletion mutants for the PACC pathway genes palA, palB, palC, palF, palH, and pacC were found to be defective in two aspects of female development. First, they were unable to initiate female development on synthetic crossing medium. However, they could form protoperithecia when grown on cellophane, on corn meal agar, or in response to the presence of nearby perithecia. Second, fertilized perithecia from PACC pathway mutants were unable to produce asci and complete female development. Protein localization experiments with a GFP-tagged PALA construct showed that PALA was localized in a peripheral punctate pattern, consistent with a signaling center associated with the ESCRT complex. The N. crassa PACC signal transduction pathway appears to be similar to the PacC/Rim101 pathway previously characterized in Aspergillus nidulans and Saccharomyces cerevisiae. In N. crassa the pathway plays a key role in regulating female development. PMID:25333968

Neurospora crassa female development requires the PACC and other signal transduction pathways, transcription factors, chromatin remodeling, cell-to-cell fusion, and autophagy.

PubMed

Chinnici, Jennifer L; Fu, Ci; Caccamise, Lauren M; Arnold, Jason W; Free, Stephen J

2014-01-01

Using a screening protocol we have identified 68 genes that are required for female development in the filamentous fungus Neurospora crassa. We find that we can divide these genes into five general groups: 1) Genes encoding components of the PACC signal transduction pathway, 2) Other signal transduction pathway genes, including genes from the three N. crassa MAP kinase pathways, 3) Transcriptional factor genes, 4) Autophagy genes, and 5) Other miscellaneous genes. Complementation and RIP studies verified that these genes are needed for the formation of the female mating structure, the protoperithecium, and for the maturation of a fertilized protoperithecium into a perithecium. Perithecia grafting experiments demonstrate that the autophagy genes and the cell-to-cell fusion genes (the MAK-1 and MAK-2 pathway genes) are needed for the mobilization and movement of nutrients from an established vegetative hyphal network into the developing protoperithecium. Deletion mutants for the PACC pathway genes palA, palB, palC, palF, palH, and pacC were found to be defective in two aspects of female development. First, they were unable to initiate female development on synthetic crossing medium. However, they could form protoperithecia when grown on cellophane, on corn meal agar, or in response to the presence of nearby perithecia. Second, fertilized perithecia from PACC pathway mutants were unable to produce asci and complete female development. Protein localization experiments with a GFP-tagged PALA construct showed that PALA was localized in a peripheral punctate pattern, consistent with a signaling center associated with the ESCRT complex. The N. crassa PACC signal transduction pathway appears to be similar to the PacC/Rim101 pathway previously characterized in Aspergillus nidulans and Saccharomyces cerevisiae. In N. crassa the pathway plays a key role in regulating female development.

Overlapping Podospora anserina Transcriptional Responses to Bacterial and Fungal Non Self Indicate a Multilayered Innate Immune Response

PubMed Central

Lamacchia, Marina; Dyrka, Witold; Breton, Annick; Saupe, Sven J.; Paoletti, Mathieu

2016-01-01

Recognition and response to non self is essential to development and survival of all organisms. It can occur between individuals of the same species or between different organisms. Fungi are established models for conspecific non self recognition in the form of vegetative incompatibility (VI), a genetically controlled process initiating a programmed cell death (PCD) leading to the rejection of a fusion cell between genetically different isolates of the same species. In Podospora anserina VI is controlled by members of the hnwd gene family encoding for proteins analogous to NOD Like Receptors (NLR) immune receptors in eukaryotes. It was hypothesized that the hnwd controlled VI reaction was derived from the fungal innate immune response. Here we analyze the P. anserina transcriptional responses to two bacterial species, Serratia fonticola to which P. anserina survives and S. marcescens to which P. anserina succumbs, and compare these to the transcriptional response induced under VI conditions. Transcriptional responses to both bacteria largely overlap, however the number of genes regulated and magnitude of regulation is more important when P. anserina survives. Transcriptional responses to bacteria also overlap with the VI reaction for both up or down regulated gene sets. Genes up regulated tend to be clustered in the genome, and display limited phylogenetic distribution. In all three responses we observed genes related to autophagy to be up-regulated. Autophagy contributes to the fungal survival in all three conditions. Genes encoding for secondary metabolites and histidine kinase signaling are also up regulated in all three conditions. Transcriptional responses also display differences. Genes involved in response to oxidative stress, or encoding small secreted proteins are essentially expressed in response to bacteria, while genes encoding NLR proteins are expressed during VI. Most functions encoded in response to bacteria favor survival of the fungus while most functions up regulated during VI would lead to cell death. These differences are discussed in the frame of a multilayered response to non self in fungi. PMID:27148175

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tzeng, W.-P.; Frey, Teryl K.

Rubella virus (RUB) replicons are derivatives of the RUB infectious cDNA clone that retain the nonstructural open reading frame (NS-ORF) that encodes the replicase proteins but not the structural protein ORF (SP-ORF) that encodes the virion proteins. RUB defective interfering (DI) RNAs contain deletions within the SP-ORF and thus resemble replicons. DI RNAs often retain the 5' end of the capsid protein (C) gene that has been shown to modulate virus-specific RNA synthesis. However, when replicons either with or without the C gene were passaged serially in the presence of wt RUB as a source of the virion proteins, itmore » was found that neither replicon was maintained and DI RNAs were generated. The majority DI RNA species contained in-frame deletions in the SP-ORF leading to a fusion between the 5' end of the C gene and the 3' end of the E1 glycoprotein gene. DI infectious cDNA clones were constructed and transcripts from these DI infectious cDNA clones were maintained during serial passage with wt RUB. The C-E1 fusion protein encoded by the DI RNAs was synthesized and was required for maintenance of the DI RNA during serial passage. This is the first report of a functional novel gene product resulting from deletion during DI RNA generation. Thus far, the role of the C-E1 fusion protein in maintenance of DI RNAs during serial passage remained elusive as it was found that the fusion protein diminished rather than enhanced DI RNA synthesis and was not incorporated into virus particles.« less

Human Papillomavirus Genome Integration and Head and Neck Cancer.

PubMed

Pinatti, L M; Walline, H M; Carey, T E

2018-06-01

We conducted a critical review of human papillomavirus (HPV) integration into the host genome in oral/oropharyngeal cancer, reviewed the literature for HPV-induced cancers, and obtained current data for HPV-related oral and oropharyngeal cancers. In addition, we performed studies to identify HPV integration sites and the relationship of integration to viral-host fusion transcripts and whether integration is required for HPV-associated oncogenesis. Viral integration of HPV into the host genome is not required for the viral life cycle and might not be necessary for cellular transformation, yet HPV integration is frequently reported in cervical and head and neck cancer specimens. Studies of large numbers of early cervical lesions revealed frequent viral integration into gene-poor regions of the host genome with comparatively rare integration into cellular genes, suggesting that integration is a stochastic event and that site of integration may be largely a function of chance. However, more recent studies of head and neck squamous cell carcinomas (HNSCCs) suggest that integration may represent an additional oncogenic mechanism through direct effects on cancer-related gene expression and generation of hybrid viral-host fusion transcripts. In HNSCC cell lines as well as primary tumors, integration into cancer-related genes leading to gene disruption has been reported. The studies have shown that integration-induced altered gene expression may be associated with tumor recurrence. Evidence from several studies indicates that viral integration into genic regions is accompanied by local amplification, increased expression in some cases, interruption of gene expression, and likely additional oncogenic effects. Similarly, reported examples of viral integration near microRNAs suggest that altered expression of these regulatory molecules may also contribute to oncogenesis. Future work is indicated to identify the mechanisms of these events on cancer cell behavior.

Solid-Pattern Desmoplastic Small Round Cell Tumor.

PubMed

Ali, Ahmed; Mohamed, Mustafa; Chisholm, Julia; Thway, Khin

2017-04-01

Desmoplastic small round cell tumor (DSRCT) is an aggressive small round cell sarcoma that typically occurs intra-abdominally in adolescents and young adults, and is characterized by a recurrent t(11;22)(p13;q12) translocation leading to generation of the EWSR1-WT1 fusion gene, which codes for a chimeric protein with transcriptional regulatory activity. DSRCT has a characteristic histologic appearance of nests of uniform small cells within prominent fibroblastic stroma and immunohistochemically it shows multidirectional differentiation, with expression of epithelial, neural, and muscle markers. We illustrate a case of DSRCT that presented as a large intra-abdominal mass, which harbored EWSR1 rearrangement by fluorescence in situ hybridization and EWSR1-WT1 fusion transcripts by reverse transcription-polymerase chain reaction (RT-PCR), and which histologically had an entirely solid morphology, lacking evidence of desmoplastic stroma. This purely solid variant emphasizes that even when occurring at a typical location, DSRCT may be difficult to recognize when lacking nonclassical morphology. This is of clinical relevance, as DSRCT with this pattern could be misdiagnosed as Ewing sarcoma if RT-PCR is not performed, with resulting prognostic and therapeutic implications.

Isolation and characterization of an Arabidopsis biotin carboxylase gene and its promoter.

PubMed

Bao, X; Shorrosh, B S; Ohlrogge, J B

1997-11-01

In the plastids of most plants, acetyl-CoA carboxylase (ACCase; EC 6.4.1.2) is a multisubunit complex consisting of biotin carboxylase (BC), biotin-carboxyl carrier protien (BCCP), and carboxytransferase (alpha-CT, beta-CT) subunits. To better understand the regulation of this enzyme, we have isolated and sequenced a BC genomic clone from Arabidopsis and partially characterized its promoter. Fifteen introns were identified. The deduced amino acid sequence of the mature BC protein is highly conserved between Arabidopsis and tobacco (92.6% identity). BC expression was evaluated using northern blots and BC/GUS fusion constructs in transgenic Arabidopsis. GUS activity in the BC/GUS transgenics as well as transcript level of the native gene were both found to be higher in silique and flower than in root and leaf. Analysis of tobacco suspension cells transformed with truncated BC promoter/GUS gene fusions indicated the region from -140 to +147 contained necessary promoter elements which supported basal gene expression. A positive regulatory region was found to be located between -2100 and -140, whereas a negative element was possibly located in the first intron. In addition, several conserved regulatory elements were identified in the BC promoter. Surprisingly, although BC is a low-abundance protein, the expression of BC/GUS fusion constructs was similar to 35S/GUS constructs.

Construction and Cloning of Reporter-Tagged Replicon cDNA for an In Vitro Replication Study of Murine Norovirus-1 (MNV-1).

PubMed

Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir

2017-12-01

A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3'end of the reporter gene and the VP2 start sequence to allow co-translational 'cleavage' of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication.

Overexpression of a Chimeric Gene, OsDST-SRDX, Improved Salt Tolerance of Perennial Ryegrass

PubMed Central

Cen, Huifang; Ye, Wenxing; Liu, Yanrong; Li, Dayong; Wang, Kexin; Zhang, Wanjun

2016-01-01

The Drought and Salt Tolerance gene (DST) encodes a C2H2 zinc finger transcription factor, which negatively regulates salt tolerance in rice (Oryza sativa). Phylogenetic analysis of six homologues of DST genes in different plant species revealed that DST genes were conserved evolutionarily. Here, the rice DST gene was linked to an SRDX domain for gene expression repression based on the Chimeric REpressor gene-Silencing Technology (CRES-T) to make a chimeric gene (OsDST-SRDX) construct and introduced into perennial ryegrass by Agrobacterium-mediated transformation. Integration and expression of the OsDST-SRDX in transgenic plants were tested by PCR and RT-PCR, respectively. Transgenic lines overexpressing the OsDST-SRDX fusion gene showed obvious phenotypic differences and clear resistance to salt-shock and to continuous salt stresses compared to non-transgenic plants. Physiological analyses including relative leaf water content, electrolyte leakage, proline content, malondialdehyde (MDA) content, H2O2 content and sodium and potassium accumulation indicated that the OsDST-SRDX fusion gene enhanced salt tolerance in transgenic perennial ryegrass by altering a wide range of physiological responses. To our best knowledge this study is the first report of utilizing Chimeric Repressor gene-Silencing Technology (CRES-T) in turfgrass and forage species for salt-tolerance improvement. PMID:27251327

β-Glucuronidase as a Sensitive and Versatile Reporter in Actinomycetes ▿

PubMed Central

Myronovskyi, Maksym; Welle, Elisabeth; Fedorenko, Viktor; Luzhetskyy, Andriy

2011-01-01

Here we describe a versatile and sensitive reporter system for actinomycetes that is based on gusA, which encodes the β-glucuronidase enzyme. A series of gusA-containing transcriptional and translational fusion vectors were constructed and utilized to study the regulatory cascade of the phenalinolactone biosynthetic gene cluster. Furthermore, these vectors were used to study the efficiency of translation initiation at the ATG, GTG, TTG, and CTG start codons. Surprisingly, constructs using a TTG start codon showed the best activity, whereas those using ATG or GTG were approximately one-half or one-third as active, respectively. The CTG fusion showed only 5% of the activity of the TTG fusion. A suicide vector, pKGLP2, carrying gusA in its backbone was used to visually detect merodiploid formation and resolution, making gene targeting in actinomycetes much faster and easier. Three regulatory genes, plaR1, plaR2, and plaR3, involved in phenalinolactone biosynthesis were efficiently replaced with an apramycin resistance marker using this system. Finally, we expanded the genetic code of actinomycetes by introducing the nonproteinogenic amino acid N-epsilon-cyclopentyloxycarbonyl-l-lysine with the GusA protein as a reporter. PMID:21685164

Renal Cell Carcinoma Associated with Xp11.2 Translocation/TFE3 Gene Fusion: A Rare Case Report with Review of the Literature.

PubMed

Ahluwalia, Puneet; Nair, Balagopal; Kumar, Ginil

2013-01-01

Introduction. The recently recognized renal cell carcinomas associated with Xp11.2 translocations are rare tumors predominantly reported in children. Chromosome Xp11.2 translocation results in gene fusion related to transcription factor E3 (TFE3) that plays an important role in proliferation and survival. Case Report. Herein, we present two cases of a TFE3 translocation-associated RCC in young female adults, one detected incidentally and the other one presenting with gross hematuria. Tumor is characterized by immunohistochemistry and a literature review with optimal treatment regimen is presented. Discussion. Xp11.2 translocation RCCs in adult patients are associated with advanced stages, large tumors, and extracapsular disease and usually have an aggressive clinical course. Conclusion. In TFE3 RCC, the genetic background may not only contribute to tumorigenesis, but also determine the response to chemotherapy and targeted therapy. Therefore it is necessary to diagnose this tumor entity accurately. Because of the small number of TFE3 gene fusion-related renal tumors described in the literature, the exact biologic behavior and impact of current treatment modalities remain to be uncertain.

Renal Cell Carcinoma Associated with Xp11.2 Translocation/TFE3 Gene Fusion: A Rare Case Report with Review of the Literature

PubMed Central

Ahluwalia, Puneet; Nair, Balagopal; Kumar, Ginil

2013-01-01

Introduction. The recently recognized renal cell carcinomas associated with Xp11.2 translocations are rare tumors predominantly reported in children. Chromosome Xp11.2 translocation results in gene fusion related to transcription factor E3 (TFE3) that plays an important role in proliferation and survival. Case Report. Herein, we present two cases of a TFE3 translocation-associated RCC in young female adults, one detected incidentally and the other one presenting with gross hematuria. Tumor is characterized by immunohistochemistry and a literature review with optimal treatment regimen is presented. Discussion. Xp11.2 translocation RCCs in adult patients are associated with advanced stages, large tumors, and extracapsular disease and usually have an aggressive clinical course. Conclusion. In TFE3 RCC, the genetic background may not only contribute to tumorigenesis, but also determine the response to chemotherapy and targeted therapy. Therefore it is necessary to diagnose this tumor entity accurately. Because of the small number of TFE3 gene fusion-related renal tumors described in the literature, the exact biologic behavior and impact of current treatment modalities remain to be uncertain. PMID:24455396

Identification of a novel fusion gene, IRF2BP2-RARA, in acute promyelocytic leukemia.

PubMed

Yin, C Cameron; Jain, Nitin; Mehrotra, Meenakshi; Zhagn, Jianhua; Protopopov, Alexei; Zuo, Zhuang; Pemmaraju, Naveen; DiNardo, Courtney; Hirsch-Ginsberg, Cheryl; Wang, Sa A; Medeiros, L Jeffrey; Chin, Lynda; Patel, Keyur P; Ravandi, Farhad; Futreal, Andrew; Bueso-Ramos, Carlos E

2015-01-01

Acute promyelocytic leukemia (APL) is characterized by the fusion of retinoic acid receptor alpha (RARA) with promyelocytic leukemia (PML) or, rarely, other gene partners. This report presents a patient with APL with a novel fusion between RARA and the interferon regulatory factor 2 binding protein 2 (IRF2BP2) genes. A bone marrow examination in a 19-year-old woman who presented with ecchymoses and epistaxis showed morphologic and immunophenotypic features consistent with APL. PML oncogenic domain antibody was positive. Results of fluorescence in situ hybridization, conventional cytogenetics, reverse transcription-polymerase chain reaction (RT-PCR), and oligonucleotide microarray for PML-RARA and common APL variant translocations were negative. Next-generation RNA-sequencing analysis followed by RT-PCR and direct sequencing revealed distinct breakpoints within IRF2BP2 exon 2 and RARA intron 2. The patient received all-trans retinoic acid, arsenic, and gemtuzumab ozogamicin, and achieved complete remission. However, the disease relapsed 10 months later, 2 months after consolidation therapy. This is the first report showing involvement of IRF2BP2 in APL, and it expands the list of novel RARA partners identified in APL. Copyright © 2015 by the National Comprehensive Cancer Network.

Molecular cloning and functional characterization of the promoter region of the human uncoupling protein-2 gene.

PubMed

Tu, N; Chen, H; Winnikes, U; Reinert, I; Marmann, G; Pirke, K M; Lentes, K U

1999-11-19

As a member of the uncoupling protein family, UCP2 is ubiquitously expressed in rodents and humans, implicating a major role in thermogenesis. To analyze promoter function and regulatory motifs involved in the transcriptional regulation of UCP2 gene expression, 3.3 kb of 5'-flanking region of the human UCP2 (hUCP2) gene have been cloned. Sequence analysis showed that the promoter region of hUCP2 lacks a classical TATA or CAAT box, however, appeared GC-rich resulting in the presence of several Sp-1 motifs and Ap-1/-2 binding sites near the transcription initiation site. Functional characterization of human UCP2 promoter-CAT fusion constructs in transient expression assays showed that minimal promoter activity was observed within 65 bp upstream of the transcriptional start site (+1). 75 bp further upstream (from nt -141 to -66) a strong cis-acting regulatory element (or enhancer) was identified, which significantly enhanced basal promoter activity. The regulation of human UCP2 gene expression involves complex interactions among positive and negative regulatory elements distributed over a minimum of 3.3 kb of the promoter region. Copyright 1999 Academic Press.

Synergistic induction of the heat shock response in Escherichia coli by simultaneous treatment with chemical inducers.

PubMed Central

Van Dyk, T K; Reed, T R; Vollmer, A C; LaRossa, R A

1995-01-01

Escherichia coli strains carrying transcriptional fusions of four sigma 32-controlled E. coli heat shock promoters to luxCDABE or lacZ reporter genes were stressed by chemicals added singly or in pairs. Much more than additive induction resulted from combinations of cadmium chloride, copper sulfate, ethanol, formamide, 4-nitrophenol, and pentachlorophenol. PMID:7592357

Induction of apoptosis in rhabdomyosarcoma cells through down-regulation of PAX proteins

PubMed Central

Bernasconi, Michele; Remppis, Andrew; Fredericks, William J.; Rauscher, Frank J.; Schäfer, Beat W.

1996-01-01

The expression of a number of human paired box-containing (PAX) genes has been correlated with various types of tumors. Novel fusion genes encoding chimeric fusion proteins have been found in the pediatric malignant tumor alveolar rhabdomyosarcoma (RMS). They are generated by two chromosomal translocations t(2;13) and t(1;13) juxtaposing PAX3 or PAX7, respectively, with a forkhead domain gene FKHR. Here we describe that specific down-regulation of the t(2;13) translocation product in alveolar RMS cells by antisense oligonucleotides results in reduced cellular viability. Cells of embryonal RMS, the other major histiotype of this tumor, were found to express either wild type PAX3 or PAX7 at elevated levels when compared with primary human myoblasts. Treatment of corresponding embryonal RMS cells with antisense olignucleotides directed against the mRNA translational start site of either one of these two transcription factors similarly triggers cell death, which is most likely due to induction of apoptosis. Retroviral mediated ectopic expression of mouse Pax3 in a PAX7 expressing embryonal RMS cell line could partially rescue antisense induced apoptosis. These data suggest that the PAX3/FKHR fusion gene and wild-type PAX genes play a causative role in the formation of RMS and presumably other tumor types, possibly by suppressing the apoptotic program that would normally eliminate these cells. PMID:8917562

Combining Random Gene Fission and Rational Gene Fusion To Discover Near-Infrared Fluorescent Protein Fragments That Report on Protein–Protein Interactions

PubMed Central

2015-01-01

Gene fission can convert monomeric proteins into two-piece catalysts, reporters, and transcription factors for systems and synthetic biology. However, some proteins can be challenging to fragment without disrupting function, such as near-infrared fluorescent protein (IFP). We describe a directed evolution strategy that can overcome this challenge by randomly fragmenting proteins and concomitantly fusing the protein fragments to pairs of proteins or peptides that associate. We used this method to create libraries that express fragmented IFP as fusions to a pair of associating peptides (IAAL-E3 and IAAL-K3) and proteins (CheA and CheY) and screened for fragmented IFP with detectable near-infrared fluorescence. Thirteen novel fragmented IFPs were identified, all of which arose from backbone fission proximal to the interdomain linker. Either the IAAL-E3 and IAAL-K3 peptides or CheA and CheY proteins could assist with IFP fragment complementation, although the IAAL-E3 and IAAL-K3 peptides consistently yielded higher fluorescence. These results demonstrate how random gene fission can be coupled to rational gene fusion to create libraries enriched in fragmented proteins with AND gate logic that is dependent upon a protein–protein interaction, and they suggest that these near-infrared fluorescent protein fragments will be suitable as reporters for pairs of promoters and protein–protein interactions within whole animals. PMID:25265085

Combining random gene fission and rational gene fusion to discover near-infrared fluorescent protein fragments that report on protein-protein interactions.

PubMed

Pandey, Naresh; Nobles, Christopher L; Zechiedrich, Lynn; Maresso, Anthony W; Silberg, Jonathan J

2015-05-15

Gene fission can convert monomeric proteins into two-piece catalysts, reporters, and transcription factors for systems and synthetic biology. However, some proteins can be challenging to fragment without disrupting function, such as near-infrared fluorescent protein (IFP). We describe a directed evolution strategy that can overcome this challenge by randomly fragmenting proteins and concomitantly fusing the protein fragments to pairs of proteins or peptides that associate. We used this method to create libraries that express fragmented IFP as fusions to a pair of associating peptides (IAAL-E3 and IAAL-K3) and proteins (CheA and CheY) and screened for fragmented IFP with detectable near-infrared fluorescence. Thirteen novel fragmented IFPs were identified, all of which arose from backbone fission proximal to the interdomain linker. Either the IAAL-E3 and IAAL-K3 peptides or CheA and CheY proteins could assist with IFP fragment complementation, although the IAAL-E3 and IAAL-K3 peptides consistently yielded higher fluorescence. These results demonstrate how random gene fission can be coupled to rational gene fusion to create libraries enriched in fragmented proteins with AND gate logic that is dependent upon a protein-protein interaction, and they suggest that these near-infrared fluorescent protein fragments will be suitable as reporters for pairs of promoters and protein-protein interactions within whole animals.

Characterization of distinct classes of differential gene expression in osteoblast cultures from non-syndromic craniosynostosis bone.

PubMed

Rojas-Peña, Monica L; Olivares-Navarrete, Rene; Hyzy, Sharon; Arafat, Dalia; Schwartz, Zvi; Boyan, Barbara D; Williams, Joseph; Gibson, Greg

2014-01-01

Craniosynostosis, the premature fusion of one or more skull sutures, occurs in approximately 1 in 2500 infants, with the majority of cases non-syndromic and of unknown etiology. Two common reasons proposed for premature suture fusion are abnormal compression forces on the skull and rare genetic abnormalities. Our goal was to evaluate whether different sub-classes of disease can be identified based on total gene expression profiles. RNA-Seq data were obtained from 31 human osteoblast cultures derived from bone biopsy samples collected between 2009 and 2011, representing 23 craniosynostosis fusions and 8 normal cranial bones or long bones. No differentiation between regions of the skull was detected, but variance component analysis of gene expression patterns nevertheless supports transcriptome-based classification of craniosynostosis. Cluster analysis showed 4 distinct groups of samples; 1 predominantly normal and 3 craniosynostosis subtypes. Similar constellations of sub-types were also observed upon re-analysis of a similar dataset of 199 calvarial osteoblast cultures. Annotation of gene function of differentially expressed transcripts strongly implicates physiological differences with respect to cell cycle and cell death, stromal cell differentiation, extracellular matrix (ECM) components, and ribosomal activity. Based on these results, we propose non-syndromic craniosynostosis cases can be classified by differences in their gene expression patterns and that these may provide targets for future clinical intervention.

Characterization of Distinct Classes of Differential Gene Expression in Osteoblast Cultures from Non-Syndromic Craniosynostosis Bone

PubMed Central

Rojas-Peña, Monica L.; Olivares-Navarrete, Rene; Hyzy, Sharon; Arafat, Dalia; Schwartz, Zvi; Boyan, Barbara D.; Williams, Joseph; Gibson, Greg

2014-01-01

Craniosynostosis, the premature fusion of one or more skull sutures, occurs in approximately 1 in 2500 infants, with the majority of cases non-syndromic and of unknown etiology. Two common reasons proposed for premature suture fusion are abnormal compression forces on the skull and rare genetic abnormalities. Our goal was to evaluate whether different sub-classes of disease can be identified based on total gene expression profiles. RNA-Seq data were obtained from 31 human osteoblast cultures derived from bone biopsy samples collected between 2009 and 2011, representing 23 craniosynostosis fusions and 8 normal cranial bones or long bones. No differentiation between regions of the skull was detected, but variance component analysis of gene expression patterns nevertheless supports transcriptome-based classification of craniosynostosis. Cluster analysis showed 4 distinct groups of samples; 1 predominantly normal and 3 craniosynostosis subtypes. Similar constellations of sub-types were also observed upon re-analysis of a similar dataset of 199 calvarial osteoblast cultures. Annotation of gene function of differentially expressed transcripts strongly implicates physiological differences with respect to cell cycle and cell death, stromal cell differentiation, extracellular matrix (ECM) components, and ribosomal activity. Based on these results, we propose non-syndromic craniosynostosis cases can be classified by differences in their gene expression patterns and that these may provide targets for future clinical intervention. PMID:25184005

Multiple independent regulatory pathways control UBI4 expression after heat shock in Saccharomyces cerevisiae.

PubMed

Simon, J R; Treger, J M; McEntee, K

1999-02-01

Transcription of the polyubiquitin gene UBI4 of Saccharomyces cerevisiae is strongly induced by a variety of environmental stresses, such as heat shock, nutrient depletion and exposure to DNA-damaging agents. This transcriptional response of UBI4 is likely to be the primary mechanism for increasing the pool of ubiquitin for degradation of stress-damaged proteins. Deletion and promoter fusion studies of the 5' regulatory sequences indicated that two different elements, heat shock elements (HSEs) and stress response element (STREs), contributed independently to heat shock regulation of the UBI4 gene. In the absence of HSEs, STRE sequences localized to the intervals -264 to -238 and -215 to -183 were needed for stress control of transcription after heat shock. Site-directed mutagenesis of the STRE (AG4) at -252 to -248 abolished heat shock induction of UBI4 transcription. Northern analysis demonstrated that cells containing either a temperature-sensitive HSF or non-functional Msn2p/Msn4p transcription factors induced high levels of UBI4 transcripts after heat shock. In cells deficient in both heat stress pathways, heat-induced UBI4 transcript levels were considerably lower but not abolished, suggesting a role for another factor(s) in stress control of its expression.

Nuclear Import of the Parsley bZIP Transcription Factor CPRF2 Is Regulated by Phytochrome Photoreceptors

PubMed Central

Kircher, Stefan; Wellmer, Frank; Nick, Peter; Rügner, Alexander; Schäfer, Eberhard; Harter, Klaus

1999-01-01

In plants, light perception by photoreceptors leads to differential expression of an enormous number of genes. An important step for differential gene expression is the regulation of transcription factor activities. To understand these processes in light signal transduction we analyzed the three well-known members of the common plant regulatory factor (CPRF) family from parsley (Petroselinum crispum). Here, we demonstrate that these CPRFs, which belong to the basic- region leucine-zipper (bZIP) domain-containing transcription factors, are differentially distributed within parsley cells, indicating different regulatory functions within the regulatory networks of the plant cell. In particular, we show by cell fractionation and immunolocalization approaches that CPRF2 is transported from the cytosol into the nucleus upon irradiation due to action of phytochrome photoreceptors. Two NH2-terminal domains responsible for cytoplasmic localization of CPRF2 in the dark were characterized by deletion analysis using a set of CPRF2-green fluorescent protein (GFP) gene fusion constructs transiently expressed in parsley protoplasts. We suggest that light-induced nuclear import of CPRF2 is an essential step in phytochrome signal transduction. PMID:9922448

Bombyx mori nucleopolyhedrovirus orf25 encodes a 30kDa late protein in the infection cycle.

PubMed

Wang, Haiyan; Chen, Keping; Guo, Zhongjian; Yao, Qin

2008-02-01

Bombyx mori nucleopolyhedrovirus (BmNPV) orf25 gene was characterized for the first time. The coding sequence of Bm25 was amplified and subcloned into the prokaryotic expression vector pGEX-4T-2 to produce glutathione S-transferase-tagged fusion protein in the BL21 (DE3) cells. The GST-Bm25 fusion protein was expressed efficiently after induction with IPTG. The purified fusion protein was used to immunize New Zealand white rabbits to prepare polyclonal antibody. Temporal expression analysis revealed a 30-kDa protein, which was detected beginning 24 hours post-infection using a polyclonal antibody against GST-Bm25 fusion protein. The transcript of Bm25 was detected by RT-PCR at 18-72 h p.i. In conclusion, the available data suggest that Bm25 encodes a 30kDa protein expressed in the late stage of infection cycle.

Sulfate-Dependent Repression of Genes That Function in Organosulfur Metabolism in Bacillus subtilis Requires Spx

PubMed Central

Erwin, Kyle N.; Nakano, Shunji; Zuber, Peter

2005-01-01

Oxidative stress in Bacillus subtilis results in the accumulation of Spx protein, which exerts both positive and negative transcriptional control over a genome-wide scale through its interaction with the RNA polymerase α subunit. Previous microarray transcriptome studies uncovered a unique class of genes that are controlled by Spx-RNA polymerase interaction under normal growth conditions that do not promote Spx overproduction. These genes were repressed by Spx when sulfate was present as a sole sulfur source. The genes include those of the ytmI, yxeI, and ssu operons, which encode products resembling proteins that function in the uptake and desulfurization of organic sulfur compounds. Primer extension and analysis of operon-lacZ fusion expression revealed that the operons are repressed by sulfate and cysteine; however, Spx functioned only in sulfate-dependent repression. Both the ytmI operon and the divergently transcribed ytlI, encoding a LysR-type regulator that positively controls ytmI operon transcription, are repressed by Spx in sulfate-containing media. The CXXC motif of Spx, which is necessary for redox sensitive control of Spx activity in response to oxidative stress, is not required for sulfate-dependent repression. The yxeL-lacZ and ssu-lacZ fusions were also repressed in an Spx-dependent manner in media containing sulfate as the sole sulfur source. This work uncovers a new role for Spx in the control of sulfur metabolism in a gram-positive bacterium under nonstressful growth conditions. PMID:15937167

Selective DNA demethylation by fusion of TDG with a sequence-specific DNA-binding domain

PubMed Central

Gregory, David J.; Mikhaylova, Lyudmila; Fedulov, Alexey V.

2012-01-01

Our ability to selectively manipulate gene expression by epigenetic means is limited, as there is no approach for targeted reactivation of epigenetically silenced genes, in contrast to what is available for selective gene silencing. We aimed to develop a tool for selective transcriptional activation by DNA demethylation. Here we present evidence that direct targeting of thymine-DNA-glycosylase (TDG) to specific sequences in the DNA can result in local DNA demethylation at potential regulatory sequences and lead to enhanced gene induction. When TDG was fused to a well-characterized DNA-binding domain [the Rel-homology domain (RHD) of NFκB], we observed decreased DNA methylation and increased transcriptional response to unrelated stimulus of inducible nitric oxide synthase (NOS2). The effect was not seen for control genes lacking either RHD-binding sites or high levels of methylation, nor in control mock-transduced cells. Specific reactivation of epigenetically silenced genes may thus be achievable by this approach, which provides a broadly useful strategy to further our exploration of biological mechanisms and to improve control over the epigenome. PMID:22419066

Effects of sulfate concentrations on the expression of a soybean seed storage protein gene and its reversibility in transgenic Arabidopsis thaliana.

PubMed

Hirai, M Y; Fujiwara, T; Chino, M; Naito, S

1995-10-01

Transgenic expression of genes encoding the alpha' and beta subunits of beta-conglycinin, one of the major seed storage proteins of soybean (Glycine max [L.] Merr.), was analyzed in Arabidopsis thaliana (L.) Heynh. under conditions of sulfate deficiency. Temporal patterns of expression of both the intact beta subunit gene and the beta subunit gene promoter fused to the beta-glucuronidase (GUS) gene are similar in soil-less cultures using rockwool, suggesting that the response to sulfate deficiency is regulated mainly at the level of transcription. In hydroponic cultures with various concentrations of sulfate, expression of both the intact beta subunit gene and the beta subunit gene promoter-GUS fusion gene were negatively correlated to increased sulfate concentrations in the culture medium. Transfer of transgenic A. thaliana plants carrying the beta subunit gene promoter-GUS fusion from sulfate-deficient to sulfate-sufficient control medium caused GUS activity in developing siliques to be repressed within two days. A reverse shift, where the plants were transferred from the control to sulfate-deficient medium, caused GUS activity to become higher than that in seeds of the control plants within two days. These results indicate that the expression of the beta subunit gene promoter responds rapidly to changes of sulfate availability.

A novel EML4-ALK variant: exon 6 of EML4 fused to exon 19 of ALK.

PubMed

Penzel, Roland; Schirmacher, Peter; Warth, Arne

2012-07-01

Cytotoxic chemotherapy remains the mainstay of treatment for most patients with advanced disease. Recently, anaplastic lymphoma kinase (ALK) expression as a major target for successful treatment with ALK inhibitors was detected in a subset of non-small-cell lung carcinomas, usually as a result of echinoderm microtubule-associated protein-like 4 (EML4)-ALK rearrangements. Although the chromosomal breakpoint within the EML4 gene varied, the breakpoint within ALK was most frequently reported within intron 19 or rarely in exon 20. Therefore, the different EML4-ALK variants so far contain the same 3' portion of ALK starting with exon 20. Here, we report a novel EML4-ALK variant detected by reverse transcription polymerase chain reaction analysis. Subsequent sequencing revealed an EML4-ALK fusion variant in which exon 6 of EML4 was fused to exon 19 of ALK. It occurred in a predominant solid pulmonary adenocarcinoma of a 65-year-old woman with a clear split signal of ALK in fluorescence in situ hybridization analysis and a weakly homogeneous ALK expression in immunohistochemical staining. Because of the growing number of fusion variants a primary reverse transcription polymerase chain reaction-based screening for ALK-positive non-small-cell lung carcinoma patients may not be sufficient for predictive diagnostics but transcript-based approaches and sequencing of ALK fusion variants might finally contribute to an optimized selection of patients.

Identifying Growth Conditions for Nicotiana benthimiana Resulting in Predictable Gene Expression of Promoter-Gus Fusion

NASA Astrophysics Data System (ADS)

Sandoval, V.; Barton, K.; Longhurst, A.

2012-12-01

Revoluta (Rev) is a transcription factor that establishes leaf polarity inArabidopsis thaliana. Through previous work in Dr. Barton's Lab, it is known that Revoluta binds to the ZPR3 promoter, thus activating the ZPR3 gene product inArabidopsis thaliana. Using this knowledge, two separate DNA constructs were made, one carrying revgene and in the other, the ZPR3 promoter fussed with the GUS gene. When inoculated in Nicotiana benthimiana (tobacco), the pMDC32 plasmid produces the Rev protein. Rev binds to the ZPR3 promoter thereby activating the transcription of the GUS gene, which can only be expressed in the presence of Rev. When GUS protein comes in contact with X-Gluc it produce the blue stain seen (See Figure 1). In the past, variability has been seen of GUS expression on tobacco therefore we hypothesized that changing the growing conditions and leaf age might improve how well it's expressed.

ERG signaling in prostate cancer is driven through PRMT5-dependent methylation of the Androgen Receptor.

PubMed

Mounir, Zineb; Korn, Joshua M; Westerling, Thomas; Lin, Fallon; Kirby, Christina A; Schirle, Markus; McAllister, Gregg; Hoffman, Greg; Ramadan, Nadire; Hartung, Anke; Feng, Yan; Kipp, David Randal; Quinn, Christopher; Fodor, Michelle; Baird, Jason; Schoumacher, Marie; Meyer, Ronald; Deeds, James; Buchwalter, Gilles; Stams, Travis; Keen, Nicholas; Sellers, William R; Brown, Myles; Pagliarini, Raymond A

2016-05-16

The TMPRSS2:ERG gene fusion is common in androgen receptor (AR) positive prostate cancers, yet its function remains poorly understood. From a screen for functionally relevant ERG interactors, we identify the arginine methyltransferase PRMT5. ERG recruits PRMT5 to AR-target genes, where PRMT5 methylates AR on arginine 761. This attenuates AR recruitment and transcription of genes expressed in differentiated prostate epithelium. The AR-inhibitory function of PRMT5 is restricted to TMPRSS2:ERG-positive prostate cancer cells. Mutation of this methylation site on AR results in a transcriptionally hyperactive AR, suggesting that the proliferative effects of ERG and PRMT5 are mediated through attenuating AR's ability to induce genes normally involved in lineage differentiation. This provides a rationale for targeting PRMT5 in TMPRSS2:ERG positive prostate cancers. Moreover, methylation of AR at arginine 761 highlights a mechanism for how the ERG oncogene may coax AR towards inducing proliferation versus differentiation.

Identification and Characterization of LFD-2, a Predicted Fringe Protein Required for Membrane Integrity during Cell Fusion in Neurospora crassa

PubMed Central

Palma-Guerrero, Javier; Zhao, Jiuhai; Gonçalves, A. Pedro; Starr, Trevor L.

2015-01-01

The molecular mechanisms of membrane merger during somatic cell fusion in eukaryotic species are poorly understood. In the filamentous fungus Neurospora crassa, somatic cell fusion occurs between genetically identical germinated asexual spores (germlings) and between hyphae to form the interconnected network characteristic of a filamentous fungal colony. In N. crassa, two proteins have been identified to function at the step of membrane fusion during somatic cell fusion: PRM1 and LFD-1. The absence of either one of these two proteins results in an increase of germling pairs arrested during cell fusion with tightly appressed plasma membranes and an increase in the frequency of cell lysis of adhered germlings. The level of cell lysis in ΔPrm1 or Δlfd-1 germlings is dependent on the extracellular calcium concentration. An available transcriptional profile data set was used to identify genes encoding predicted transmembrane proteins that showed reduced expression levels in germlings cultured in the absence of extracellular calcium. From these analyses, we identified a mutant (lfd-2, for late fusion defect-2) that showed a calcium-dependent cell lysis phenotype. lfd-2 encodes a protein with a Fringe domain and showed endoplasmic reticulum and Golgi membrane localization. The deletion of an additional gene predicted to encode a low-affinity calcium transporter, fig1, also resulted in a strain that showed a calcium-dependent cell lysis phenotype. Genetic analyses showed that LFD-2 and FIG1 likely function in separate pathways to regulate aspects of membrane merger and repair during cell fusion. PMID:25595444

Gene encoding γ-carbonic anhydrase is cotranscribed with argC and induced in response to stationary phase and high CO2 in Azospirillum brasilense Sp7

PubMed Central

2010-01-01

Background Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (γ-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only γ-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one β-CA and two γ-CAs. Results One of the putative γ-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-γ-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. Conclusions This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a γ-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized γ-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration. PMID:20598158

Gene encoding gamma-carbonic anhydrase is cotranscribed with argC and induced in response to stationary phase and high CO2 in Azospirillum brasilense Sp7.

PubMed

Kaur, Simarjot; Mishra, Mukti N; Tripathi, Anil K

2010-07-04

Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (gamma-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only gamma-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one beta-CA and two gamma-CAs. One of the putative gamma-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-gamma-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a gamma-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized gamma-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.

RegA, an AraC-like protein, is a global transcriptional regulator that controls virulence gene expression in Citrobacter rodentium.

PubMed

Hart, Emily; Yang, Ji; Tauschek, Marija; Kelly, Michelle; Wakefield, Matthew J; Frankel, Gad; Hartland, Elizabeth L; Robins-Browne, Roy M

2008-11-01

Citrobacter rodentium is an attaching and effacing pathogen which causes transmissible colonic hyperplasia in mice. Infection with C. rodentium serves as a model for infection of humans with enteropathogenic and enterohemorrhagic Escherichia coli. To identify novel colonization factors of C. rodentium, we screened a signature-tagged mutant library of C. rodentium in mice. One noncolonizing mutant had a single transposon insertion in an open reading frame (ORF) which we designated regA because of its homology to genes encoding members of the AraC family of transcriptional regulators. Deletion of regA in C. rodentium resulted in markedly reduced colonization of the mouse intestine. Examination of lacZ transcriptional fusions using promoter regions of known and putative virulence-associated genes of C. rodentium revealed that RegA strongly stimulated transcription of two newly identified genes located close to regA, which we designated adcA and kfcC. The cloned adcA gene conferred autoaggregation and adherence to mammalian cells to E. coli strain DH5alpha, and a kfc mutation led to a reduction in the duration of intestinal colonization, but the kfc mutant was far less attenuated than the regA mutant. These results indicated that other genes of C. rodentium whose expression required activation by RegA were required for colonization. Microarray analysis revealed a number of RegA-regulated ORFs encoding proteins homologous to known colonization factors. Transcription of these putative virulence determinants was activated by RegA only in the presence of sodium bicarbonate. Taken together, these results show that RegA is a global regulator of virulence in C. rodentium which activates factors that are required for intestinal colonization.

RegA, an AraC-Like Protein, Is a Global Transcriptional Regulator That Controls Virulence Gene Expression in Citrobacter rodentium▿

PubMed Central

Hart, Emily; Yang, Ji; Tauschek, Marija; Kelly, Michelle; Wakefield, Matthew J.; Frankel, Gad; Hartland, Elizabeth L.; Robins-Browne, Roy M.

2008-01-01

Citrobacter rodentium is an attaching and effacing pathogen which causes transmissible colonic hyperplasia in mice. Infection with C. rodentium serves as a model for infection of humans with enteropathogenic and enterohemorrhagic Escherichia coli. To identify novel colonization factors of C. rodentium, we screened a signature-tagged mutant library of C. rodentium in mice. One noncolonizing mutant had a single transposon insertion in an open reading frame (ORF) which we designated regA because of its homology to genes encoding members of the AraC family of transcriptional regulators. Deletion of regA in C. rodentium resulted in markedly reduced colonization of the mouse intestine. Examination of lacZ transcriptional fusions using promoter regions of known and putative virulence-associated genes of C. rodentium revealed that RegA strongly stimulated transcription of two newly identified genes located close to regA, which we designated adcA and kfcC. The cloned adcA gene conferred autoaggregation and adherence to mammalian cells to E. coli strain DH5α, and a kfc mutation led to a reduction in the duration of intestinal colonization, but the kfc mutant was far less attenuated than the regA mutant. These results indicated that other genes of C. rodentium whose expression required activation by RegA were required for colonization. Microarray analysis revealed a number of RegA-regulated ORFs encoding proteins homologous to known colonization factors. Transcription of these putative virulence determinants was activated by RegA only in the presence of sodium bicarbonate. Taken together, these results show that RegA is a global regulator of virulence in C. rodentium which activates factors that are required for intestinal colonization. PMID:18765720

Fungal-specific transcription factor AbPf2 activates pathogenicity in Alternaria brassicicola

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cho, Yangrae; Ohm, Robin A.; Grigoriev, Igor V.

Alternaria brassicicola is a successful saprophyte and necrotrophic plant pathogen. To identify molecular determinants of pathogenicity, we created non-pathogenic mutants of a transcription factor-encoding gene, AbPf2. The frequency and timing of germination and appressorium formation on host plants were similar between the non-pathogenic abpf2 mutants and wild-type A. brassicicola. The mutants were also similar in vitro to wild-type A. brassicicola in terms of vegetative growth, conidium production, and responses to a phytoalexin, reactive oxygen species and osmolites. The hyphae of the mutants grew slowly but did not cause disease symptoms on the surface of host plants. Transcripts of the AbPf2more » gene increased exponentially soon after wild-type conidia contacted their host plants . A small amount of AbPf2 protein, as monitored using GFP fusions, was present in young, mature conidia. The protein level decreased during saprophytic growth, but increased and was located primarily in fungal nuclei during pathogenesis. Levels of the proteins and transcripts sharply decreased following colonization of host tissues beyond the initial infection site. When expression of the transcription factor was induced in the wild-type during early pathogenesis, 106 fungal genes were also induced in the wild-type but not in the abpf2 mutants. Notably, 33 of the 106 genes encoded secreted proteins, including eight putative effector proteins. Plants inoculated with abpf2 mutants expressed higher levels of genes associated with photosynthesis, the pentose phosphate pathway and primary metabolism, but lower levels of defense-related genes. Our results suggest that AbPf2 is an important regulator of pathogenesis, but does not affect other cellular processes in A. brassicicola.« less

Intact or broken-apart RNA: an alternative concept for ALK fusion screening in non-small cell lung cancer (NSCLC).

PubMed

Kotoula, Vassiliki; Bobos, Mattheos; Vassilakopoulou, Maria; Tsolaki, Eleftheria; Chrisafi, Sofia; Psyrri, Amanda; Lazaridis, George; Papadopoulou, Kyriaki; Efstratiou, Ioannis; Michail-Strantzia, Catherine; Debelenko, Larisa V; Kosmidis, Paris; Fountzilas, George

2015-01-01

Anaplastic lymphoma kinase (ALK) break-apart fluorescent in situ hybridization (FISH) is currently used in diagnostics for the selection of non-small cell lung cancer (NSCLC) patients to receive crizotinib. We evaluated ALK status in NSCLC with a novel ALK mRNA test based on the break-apart FISH concept, which we called break-apart transcript (BAT) test. ALK5' and ALK3' transcript patterns were established with qPCR for ALK-expressing controls including fusion-negative neuroblastomas, as well as fusion-positive anaplastic large cell lymphomas and NSCLC. The BAT test was evaluated on 271 RNA samples from routinely processed paraffin NSCLC tissues. Test results were compared with ALK FISH (n=121), immunohistochemical (IHC) analysis (n=86), and automated quantitative analysis (AQUA, n=83). On the basis of the nonoverlapping ALK BAT patterns in ALK-expressing controls (P<0.0001), 8/174 adenocarcinomas (4.6%) among 259 informative NSCLC were predicted as fusion positive. Overall concordance for paired method results was high (94.1% to 98.8%) but mainly concerned negative prediction because of the limited availability of positive-matched cases. Tumors with 100% cytoplasmic IHC staining of any intensity (n=3) were positive for AQUA, FISH, and BAT test; tumors with lower IHC positivity and different staining patterns were AQUA-negative. Upon multiple reevaluations, ALK gene status was considered as originally misinterpreted by FISH in 3/121 cases (2.5%). Tumors with >4 ALK gene copies were associated with longer overall survival upon first-line chemotherapy. In conclusion, application of the ALK BAT test on routinely processed NSCLC tissues yields the same fusion partner independent information as ALK break-apart FISH but is more robust and cost-effective. The BAT concept may be considered for the development of further drug-predictive translocation tests.

Detection of Her2-overexpressing cancer cells using keyhole shaped chamber array employing a magnetic droplet-handling system.

PubMed

Okochi, Mina; Koike, Shinji; Tanaka, Masayoshi; Honda, Hiroyuki

2017-07-15

An on-chip gene expression analysis compartmentalized in droplets was developed for detection of cancer cells at a single-cell level. The chip consists of a keyhole-shaped reaction chamber with hydrophobic modification employing a magnetic bead-droplet-handling system with a gate for bead separation. Using three kinds of water-based droplets in oil, a droplet with sample cells, a lysis buffer with magnetic beads, and RT-PCR buffer, parallel magnetic manipulation and fusion of droplets were performed using a magnet-handling device containing small external magnet patterns in an array. The actuation with the magnet offers a simple system for droplet manipulation that allows separation and fusion of droplets containing magnetic beads. After reverse transcription and amplification by thermal cycling, fluorescence was obtained for detection of overexpressing genes. For clinical detection of gastric cancer cells in peritoneal washing, the Her2-overexpressing gastric cancer cells spiked within normal cells was detected by gene expression analysis of droplets containing an average of 2.5 cells. Our developed droplet-based cancer detection system manipulated by external magnetic force without pumps or valves offers a simple and flexible set-up for transcriptional detection of cancer cells, and will be greatly advantageous for less-invasive clinical diagnosis and prognostic prediction. Copyright © 2016 Elsevier B.V. All rights reserved.

A Novel Selenite- and Tellurite-Inducible Gene in Escherichia coli

PubMed Central

Guzzo, Julie; Dubow, Michael S.

2000-01-01

Selenium is both an essential and a toxic trace element, and the range of concentrations between the two is extremely narrow. Although tellurium is not essential and is only rarely found in the environment, it is considered to be extremely toxic. Several hypotheses have been proposed to account for the toxic effects of selenite and tellurite. However, these potential mechanisms have yet to be fully substantiated. Through screening of an Escherichia coli luxAB transcriptional gene fusion library, we identified a clone whose luminescence increased in the presence of increasing concentrations of sodium selenite or sodium tellurite. Cloning and sequencing of the luxAB junction revealed that the fusion had occurred in a previously uncharacterized open reading frame, termed o393 or yhfC, which we have now designated gutS, for gene up-regulated by tellurite and selenite. Transcription from gutS in the presence of selenite or tellurite was confirmed by RNA dot blot analysis. In vivo expression of the GutS polypeptide, using the pET expression system, revealed a polypeptide of approximately 43 kDa, in good agreement with its predicted molecular mass. Although the function of GutS remains to be elucidated, homology searches as well as protein motif and secondary-structure analyses have provided clues which may implicate GutS in transport in response to selenite and tellurite. PMID:11055951

Detection of phenols using engineered bacteria

DOEpatents

Wise, Arlene A.; Kuske, Cheryl R.; Terwilliger, Thomas C.

2007-12-04

Detection of phenols using engineered bacteria. A biosensor can be created by placing a reporter gene under control of an inducible promoter. The reporter gene produces a signal when a cognate transcriptional activator senses the inducing chemical. Creation of bacterial biosensors is currently restricted by limited knowledge of the genetic systems of bacteria that catabolize xenobiotics. By using mutagenic PCR to change the chemical specificity of the Pseudomonas species CF600 DmpR protein, the potential for engineering novel biosensors for detection of phenols has been demonstrated. DmpR, a well-characterized transcriptional activator of the P. CF600's dmp operon mediates growth on simple phenols. Transcription from Po, the promoter heading the dmp operon, is activated when the sensor domain of DmpR interacts with phenol and mono-substituted phenols. By altering the sensor domain of the DmpR, a group of DmpR derivatives that activate transcription of a Po-lacZ fusion in response to eight of the EPA's eleven priority pollutant phenols has been created. The assays and the sensor domain mutations that alter the chemical specificity of DmpR is described.

Detection of phenols using engineered bacteria

DOEpatents

Wise, Arlene A.; Kuske, Cheryl R.; Terwilliger, Thomas C.

2004-08-10

Detection of phenols using engineered bacteria. A biosensor can be created by placing a reporter gene under control of an inducible promoter. The reporter gene produces a signal when a cognate transcriptional activator senses the inducing chemical. Creation of bacterial biosensors is currently restricted by limited knowledge of the genetic systems of bacteria that catabolize xenobiotics. By using mutagenic PCR to change the chemical specificity of the Pseudomonas species CF600 DmpR protein, the potential for engineering novel biosensors for detection of phenols has been demonstrated. DmpR, a well-characterized transcriptional activator of the P. CF600's dmp operon mediates growth on simple phenols. Transcription from Po, the promoter heading the dmp operon, is activated when the sensor domain of DmpR interacts with phenol and mono-substituted phenols. By altering the sensor domain of the DmpR, a group of DmpR derivatives that activate transcription of a Po-lacZ fusion in response to eight of the EPA's eleven priority pollutant phenols has been created. The assays and the sensor domain mutations that alter the chemical specificity of DmpR is described.

BCOR-CCNB3 Fusions Are Frequent in Undifferentiated Sarcomas of Male Children

PubMed Central

Peters, Tricia L.; Kumar, Vijetha; Polikepahad, Sumanth; Lin, Frank Y.; Sarabia, Stephen F.; Liang, Yu; Wang, Wei-Lien; Lazar, Alexander J.; Doddapaneni, Harsha Vardhan; Chao, Hsu; Muzny, Donna M.; Wheeler, David A.; Okcu, M. Fatih; Plon, Sharon E.; Hicks, M. John; López-Terrada, Dolores; Parsons, D. Williams; Roy, Angshumoy

2014-01-01

The BCOR-CCNB3 fusion gene, resulting from a chromosome X paracentric inversion, was recently described in translocation-negative ‘Ewing-like’ sarcomas arising in bone and soft tissue. Genetic subclassification of undifferentiated unclassified sarcomas may potentially offer markers for reproducible diagnosis and substrates for therapy. Using whole transcriptome paired end RNA sequencing (RNA-seq) we unexpectedly identified BCOR-CCNB3 fusion transcripts in an undifferentiated spindle cell sarcoma. RNA-seq results were confirmed through direct RT-PCR of tumor RNA and cloning of the genomic breakpoints from tumor DNA. Five additional undifferentiated sarcomas with BCOR-CCNB3 fusions were identified in a series of 42 pediatric and adult unclassified sarcomas. Genomic breakpoint analysis demonstrated unique breakpoint locations in each case at the DNA level even though the resulting fusion mRNA was identical in all cases. All patients with BCOR-CCNB3 sarcoma were males diagnosed in mid-childhood (7-13 years of age). Tumors were equally distributed between axial and extra-axial locations. Five of the six tumors were soft tissue lesions with either predominant spindle cell morphology or spindle cell areas interspersed with ovoid to round cells. CCNB3 immunohistochemistry showed strong nuclear positivity in 5 tumors prior to oncologic therapy, but was patchy to negative in post-treatment tumor samples. An RT-PCR assay developed to detect the fusion transcript in archival formalin-fixed tissue was positive in all 6 cases, with high sensitivity and specificity in both pre- and post-treated samples. This study adds to recent reports on the clinicopathologic spectrum of BCOR-CCNB3 fusion-positive sarcomas, a newly-emerging entity within the undifferentiated unclassified sarcoma category, and describes a simple RT-PCR assay that in conjunction with CCNB3 immunohistochemistry can be useful in diagnosing these tumors. PMID:25360585

Expression Patterns Conferred by Tyrosine/Dihydroxyphenylalanine Decarboxylase Promoters from Opium Poppy Are Conserved in Transgenic Tobacco1

PubMed Central

Facchini, Peter J.; Penzes-Yost, Catherine; Samanani, Nailish; Kowalchuk, Brett

1998-01-01

Opium poppy (Papaver somniferum) contains a large family of tyrosine/dihydroxyphenylalanine decarboxylase (tydc) genes involved in the biosynthesis of benzylisoquinoline alkaloids and cell wall-bound hydroxycinnamic acid amides. Eight members from two distinct gene subfamilies have been isolated, tydc1, tydc4, tydc6, tydc8, and tydc9 in one group and tydc2, tydc3, and tydc7 in the other. The tydc8 and tydc9 genes were located 3.2 kb apart on one genomic clone, suggesting that the family is clustered. Transcripts for most tydc genes were detected only in roots. Only tydc2 and tydc7 revealed expression in both roots and shoots, and TYDC3 mRNAs were the only specific transcripts detected in seedlings. TYDC1, TYDC8, and TYDC9 mRNAs, which occurred in roots, were not detected in elicitor-treated opium poppy cultures. Expression of tydc4, which contains a premature termination codon, was not detected under any conditions. Five tydc promoters were fused to the β-glucuronidase (GUS) reporter gene in a binary vector. All constructs produced transient GUS activity in microprojectile-bombarded opium poppy and tobacco (Nicotiana tabacum) cell cultures. The organ- and tissue-specific expression pattern of tydc promoter-GUS fusions in transgenic tobacco was generally parallel to that of corresponding tydc genes in opium poppy. GUS expression was most abundant in the internal phloem of shoot organs and in the stele of roots. Select tydc promoter-GUS fusions were also wound induced in transgenic tobacco, suggesting that the basic mechanisms of developmental and inducible tydc regulation are conserved across plant species. PMID:9733527

Arabidopsis MALE STERILITY1 Encodes a PHD-Type Transcription Factor and Regulates Pollen and Tapetum Development[W

PubMed Central

Ito, Takuya; Nagata, Noriko; Yoshiba, Yoshu; Ohme-Takagi, Masaru; Ma, Hong; Shinozaki, Kazuo

2007-01-01

The Arabidopsis thaliana MALE STERILITY1 (MS1) gene encodes a nuclear protein with Leu zipper–like and PHD-finger motifs and is important for postmeiotic pollen development. Here, we examined MS1 function using both cell biological and molecular biological approaches. We introduced a fusion construct of MS1 and a transcriptional repression domain (MS1-SRDX) into wild-type Arabidopsis, and the transgenic plants showed a semisterile phenotype similar to that of ms1. Since the repression domain can convert various kinds of transcriptional activators to dominant repressors, this suggested that MS1 functioned as a transcriptional activator. The Leu zipper–like region and the PHD motif were required for the MS1 function. Phenotypic analysis of the ms1 mutant and the MS1-SRDX transgenic Arabidopsis indicated that MS1 was involved in formation of pollen exine and pollen cytosolic components as well as tapetum development. Next, we searched for MS1 downstream genes by analyzing publicly available microarray data and identified 95 genes affected by MS1. Using a transgenic ms1 plant showing dexamethasone-inducible recovery of fertility, we further examined whether these genes were immediately downstream of MS1. From these results, we discuss a role of MS1 in pollen and tapetum development and the conservation of MS1 function in flowering plants. PMID:18032630

bZIP transcription factor SmJLB1 regulates autophagy-related genes Smatg8 and Smatg4 and is required for fruiting-body development and vegetative growth in Sordaria macrospora.

PubMed

Voigt, Oliver; Herzog, Britta; Jakobshagen, Antonia; Pöggeler, Stefanie

2013-12-01

Autophagy is a precisely controlled degradation process in eukaryotic cells, during which the bulk of the cytoplasm is engulfed by a double membrane vesicle, the autophagosome. Fusion of the autophagosome with the vacuole leads to breakdown of its contents, such as proteins and organelles, and the recycling of nutrients. Earlier studies of autophagic genes of the core autophagic machinery in the filamentous ascomycete Sordaria macrospora elucidated the impact of autophagy on fungal viability, vegetative growth and fruiting-body development. To gain further knowledge about the regulation of autophagy in S. macrospora, we analyzed the function of the bZIP transcription factor SmJLB1, a homolog of the Podospora anserina basic zipper-type transcription factor induced during incompatibility 4 (IDI-4) and the Aspergillus nidulans transcription factor jun-like bZIP A (JlbA). Generation of the homokaryotic deletion mutant demonstrated S. macrospora Smjlb1 is associated with autophagy-dependent processes. Deletion of Smjlb1 abolished fruiting-body formation and impaired vegetative growth. SmJLB1 is localized to the cytoplasm and to nuclei. Quantitative real-time PCR experiments revealed an upregulated expression of autophagy-related genes Smatg8 and Smatg4 in the Smjlb1 deletion mutant, suggesting a transcriptional repression function of SmJLB1. Copyright © 2013 Elsevier Inc. All rights reserved.

Establishment of a novel clear cell sarcoma cell line (Hewga-CCS), and investigation of the antitumor effects of pazopanib on Hewga-CCS

PubMed Central

2014-01-01

Background Clear cell sarcoma (CCS) is a therapeutically unresolved, aggressive, soft tissue sarcoma (STS) that predominantly affects young adults. This sarcoma is defined by t(12;22)(q13;q12) translocation, which leads to the fusion of Ewing sarcoma gene (EWS) to activating transcription factor 1 (ATF1) gene, producing a chimeric EWS-ATF1 fusion gene. We established a novel CCS cell line called Hewga-CCS and developed an orthotopic tumor xenograft model to enable comprehensive bench-side investigation for intensive basic and preclinical research in CCS with a paucity of experimental cell lines. Methods Hewga-CCS was derived from skin metastatic lesions of a CCS developed in a 34-year-old female. The karyotype and chimeric transcript were analyzed. Xenografts were established and characterized by morphology and immunohistochemical reactivity. Subsequently, the antitumor effects of pazopanib, a recently approved, novel, multitargeted, tyrosine kinase inhibitor (TKI) used for the treatment of advanced soft tissue sarcoma, on Hewga-CCS were assessed in vitro and in vivo. Results Hewga-CCS harbored the type 2 EWS-ATF1 transcript. Xenografts morphologically mimicked the primary tumor and expressed S-100 protein and antigens associated with melanin synthesis (Melan-A, HMB45). Pazopanib suppressed the growth of Hewga-CCS both in vivo and in vitro. A phospho-receptor tyrosine kinase array revealed phosphorylation of c-MET, but not of VEGFR, in Hewga-CCS. Subsequent experiments showed that pazopanib exerted antitumor effects through the inhibition of HGF/c-MET signaling. Conclusions CCS is a rare, devastating disease, and our established CCS cell line and xenograft model may be a useful tool for further in-depth investigation and understanding of the drug-sensitivity mechanism. PMID:24946937

Establishment of a novel clear cell sarcoma cell line (Hewga-CCS), and investigation of the antitumor effects of pazopanib on Hewga-CCS.

PubMed

Outani, Hidetatsu; Tanaka, Takaaki; Wakamatsu, Toru; Imura, Yoshinori; Hamada, Kenichiro; Araki, Nobuhito; Itoh, Kazuyuki; Yoshikawa, Hideki; Naka, Norifumi

2014-06-19

Clear cell sarcoma (CCS) is a therapeutically unresolved, aggressive, soft tissue sarcoma (STS) that predominantly affects young adults. This sarcoma is defined by t(12;22)(q13;q12) translocation, which leads to the fusion of Ewing sarcoma gene (EWS) to activating transcription factor 1 (ATF1) gene, producing a chimeric EWS-ATF1 fusion gene. We established a novel CCS cell line called Hewga-CCS and developed an orthotopic tumor xenograft model to enable comprehensive bench-side investigation for intensive basic and preclinical research in CCS with a paucity of experimental cell lines. Hewga-CCS was derived from skin metastatic lesions of a CCS developed in a 34-year-old female. The karyotype and chimeric transcript were analyzed. Xenografts were established and characterized by morphology and immunohistochemical reactivity. Subsequently, the antitumor effects of pazopanib, a recently approved, novel, multitargeted, tyrosine kinase inhibitor (TKI) used for the treatment of advanced soft tissue sarcoma, on Hewga-CCS were assessed in vitro and in vivo. Hewga-CCS harbored the type 2 EWS-ATF1 transcript. Xenografts morphologically mimicked the primary tumor and expressed S-100 protein and antigens associated with melanin synthesis (Melan-A, HMB45). Pazopanib suppressed the growth of Hewga-CCS both in vivo and in vitro. A phospho-receptor tyrosine kinase array revealed phosphorylation of c-MET, but not of VEGFR, in Hewga-CCS. Subsequent experiments showed that pazopanib exerted antitumor effects through the inhibition of HGF/c-MET signaling. CCS is a rare, devastating disease, and our established CCS cell line and xenograft model may be a useful tool for further in-depth investigation and understanding of the drug-sensitivity mechanism.

ZFX controls propagation and prevents differentiation of acute T-lymphoblastic and myeloid leukemia

PubMed Central

Weisberg, Stuart P.; Smith-Raska, Matthew R.; Esquilin, Jose M.; Zhang, Ji; Arenzana, Teresita L.; Lau, Colleen M.; Churchill, Michael; Pan, Haiyan; Klinakis, Apostolos; Dixon, Jack E.; Mirny, Leonid A.; Mukherjee, Siddhartha; Reizis, Boris

2014-01-01

Summary Tumor-propagating cells in acute leukemia maintain a stem/progenitor-like immature phenotype and proliferative capacity. Acute myeloid leukemia (AML) and acute T-lymphoblastic leukemia (T-ALL) originate from different lineages through distinct oncogenic events such as MLL fusions and Notch signaling, respectively. We found that Zfx, a transcription factor that controls hematopoietic stem cell self-renewal, controls the initiation and maintenance of AML caused by MLL-AF9 fusion and of T-ALL caused by Notch1 activation. In both leukemia types, Zfx prevents differentiation and activates gene sets characteristic of immature cells of the respective lineages. In addition, endogenous Zfx contributes to gene induction and transformation by Myc overexpression in myeloid progenitors. Key Zfx target genes include the mitochondrial enzymes Ptpmt1 and Idh2, whose overexpression partially rescues the propagation of Zfx-deficient AML. These results show that distinct leukemia types maintain their undifferentiated phenotype and self-renewal by exploiting a common stem cell-related genetic regulator. PMID:24485662

Expression of a synthetic gene encoding human insulin-like growth factor I in cultured mouse fibroblasts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bayne, M.L.; Cascieri, M.A.; Kelder, B.

1987-05-01

A synthetic gene encoding human insulin-like growth factor I (hIGF-I) was assembled and inserted into an expression vector containing the cytomegalovirus immediate early (CMV-IE) transcriptional regulatory region and portions of the bovine growth hormone gene. The recombinant plasmid encodes a 97 amino acid fusion protein containing the first 27 amino acids of the bovine growth hormone precursor and the 70 amino acids of hIGF-I. This plasmid, when transiently introduced into cultured mouse fibroblasts, directs synthesis of the fusion protein, subsequent proteolytic removal of the bovine growth hormone signal peptide, and secretion of hIGF-I into the culture medium. Conditioned medium frommore » transfected cells inhibits binding of /sup 125/I-labeled IGF-I to type I IGF receptors on human placental membranes and to acid-stable human serum carrier proteins. The recombinant hIGF-I produced is biologically active, as monitored by the stimulation of DNA synthesis in vascular smooth muscle cells.« less

Imaging Erg and Jun transcription factor interaction in living cells using fluorescence resonance energy transfer analyses

DOE Office of Scientific and Technical Information (OSTI.GOV)

Camuzeaux, Barbara; Spriet, Corentin; Heliot, Laurent

2005-07-15

Physical interactions between transcription factors play important roles in modulating gene expression. Previous in vitro studies have shown a transcriptional synergy between Erg protein, an Ets family member, and Jun/Fos heterodimer, members of the bZip family, which requires direct Erg-Jun protein interactions. Visualization of protein interactions in living cells is a new challenge in biology. For this purpose, we generated fusion proteins of Erg, Fos, and Jun with yellow and cyan fluorescent proteins, YFP and CFP, respectively. After transient expression in HeLa cells, interactions of the resulting fusion proteins were explored by fluorescence resonance energy transfer microscopy (FRET) in fixedmore » and living cells. FRET between YFP-Erg and CFP-Jun was monitored by using photobleaching FRET and fluorescence lifetime imaging microscopy. Both techniques revealed the occurrence of intermolecular FRET between YFP-Erg and CFP-Jun. This is stressed by loss of FRET with an YFP-Erg version carrying a point mutation in its ETS domain. These results provide evidence for the interaction of Erg and Jun proteins in living cells as a critical prerequisite of their transcriptional synergy, but also for the essential role of the Y371 residue, conserved in most Ets proteins, in this interaction.« less

Extracellular matrix and hormones transcriptionally regulate bovine. beta. -casein 5 prime sequences in stably transfected mouse mammary cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schmidhauser, C. Bissell, M.J.; Myers, C.A.; Casperson, G.F.

1990-12-01

Milk protein regulation involves synergistic action of lactogenic hormones and extracellular matrix (ECM). It is well established that substratum has a dramatic effect on morphology and function of mammary cells. The molecular mechanisms that regulate the ECM- and hormone-dependent gene expression, however, have not been resolved. To address this question, a subpopulation (designated CID 9) of the mouse mammary epithelial cell strain COMMA-2D has been developed in which more than 35% of the cells express {beta}-casein, form alveoli-like structures when plated onto a reconstituted basement membrane, and secrete {beta}-casein undirectionally into a lumen. These cells were stably transfected with amore » series of chloramphenicol acetyltransferase (CAT) fusion genes to study transcriptional regulation of the bovine {beta}-casein gene. The expression of CAT in these lines demonstrated a striking matrix and hormone dependency. This regulation occurered primarily at the transcriptional level and was dependent on the length of the 5{prime} flanking region of the {beta}-casein promotor. Both matrix and hormonal control of transcription occurred within at least the first 1790 base pairs upstream and/or 42 base pairs downstream of the transcriptional initiation site. The ECM effect was independent of glucocorticoid stimulation. However, prolactin was essential and hydrocortisone further increased CAT expression. Endogenous {beta}-casein expression in these lines was similar to that of the parent CID 9 cells. Our data indicate the existence of matrix-dependent elements that regulate transcription.« less

Regulation of Sulfur Assimilation Pathways in Burkholderia cenocepacia through Control of Genes by the SsuR Transcription Factor▿

PubMed Central

Łochowska, Anna; Iwanicka-Nowicka, Roksana; Zielak, Agata; Modelewska, Anna; Thomas, Mark S.; Hryniewicz, Monika M.

2011-01-01

The genome of Burkholderia cenocepacia contains two genes encoding closely related LysR-type transcriptional regulators, CysB and SsuR, involved in control of sulfur assimilation processes. In this study we show that the function of SsuR is essential for the utilization of a number of organic sulfur sources of either environmental or human origin. Among the genes upregulated by SsuR identified here are the tauABC operon encoding a predicted taurine transporter, three tauD-type genes encoding putative taurine dioxygenases, and atsA encoding a putative arylsulfatase. The role of SsuR in expression of these genes/operons was characterized through (i) construction of transcriptional reporter fusions to candidate promoter regions and analysis of their expression in the presence/absence of SsuR and (ii) testing the ability of SsuR to bind SsuR-responsive promoter regions. We also demonstrate that expression of SsuR-activated genes is not repressed in the presence of inorganic sulfate. A more detailed analysis of four SsuR-responsive promoter regions indicated that ∼44 bp of the DNA sequence preceding and/or overlapping the predicted −35 element of such promoters is sufficient for SsuR binding. The DNA sequence homology among SsuR “recognition motifs” at different responsive promoters appears to be limited. PMID:21317335

Targeting the Oncogenic Transcriptional Regulator MYB in Adenoid Cystic Carcinoma by Inhibition of IGF1R/AKT Signaling.

PubMed

Andersson, Mattias K; Afshari, Maryam K; Andrén, Ywonne; Wick, Michael J; Stenman, Göran

2017-09-01

Adenoid cystic carcinoma (ACC) is an aggressive cancer with no curative treatment for patients with recurrent/metastatic disease. The MYB-NFIB gene fusion is the main genomic hallmark and a potential therapeutic target. Oncogenic signaling pathways were studied in cultured cells and/or tumors from 15 ACC patients. Phospho-receptor tyrosine kinase (RTK) arrays were used to study the activity of RTKs. Effects of RTK inhibition on cell proliferation were analyzed with AlamarBlue, sphere assays, and two ACC xenograft models (n = 4-9 mice per group). The molecular effects of MYB-NFIB knockdown and IGF1R inhibition were studied with quantitative polymerase chain reaction, immunoblot, and gene expression microarrays. All statistical tests were two-sided. The MYB-NFIB fusion drives proliferation of ACC cells and is crucial for spherogenesis. Intriguingly, the fusion is regulated through AKT-dependent signaling induced by IGF1R overexpression and is downregulated upon IGF1R-inhibition (% expression of control ± SD = 27.2 ± 1.3, P < .001). MYB-NFIB regulates genes involved in cell cycle control, DNA replication/repair, and RNA processing. The transcriptional program induced by MYB-NFIB affects critical oncogenic mediators normally controlled by MYC and is reversed by pharmacological inhibition of IGF1R. Co-activation of epidermal growth factor receptor (EGFR) and MET promoted proliferation of ACC cells, and combined targeting of IGFR1/EGFR/MET induced differentiation and synergistically inhibited the growth of patient-derived xenografted ACCs (ACCX5M1, % growth of control ± SD = 34.9 ± 20.3, P = .006; ACCX6, % growth of control ± SD = 24.1 ± 17.5, P = .04). MYB-NFIB is an oncogenic driver and a key therapeutic target in ACC that is regulated by AKT-dependent IGF1R signaling. Our studies uncover a new strategy to target an oncogenic transcriptional master regulator and provide new important insights into the biology and treatment of ACC. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Detection of rearrangements and transcriptional up-regulation of ALK in FFPE lung cancer specimens using a novel, sensitive, quantitative reverse transcription polymerase chain reaction assay.

PubMed

Gruber, Kim; Horn, Heike; Kalla, Jörg; Fritz, Peter; Rosenwald, Andreas; Kohlhäufl, Martin; Friedel, Godehard; Schwab, Matthias; Ott, German; Kalla, Claudia

2014-03-01

The approved dual-color fluorescence in situ hybridization (FISH) test for the detection of anaplastic lymphoma receptor tyrosine kinase (ALK) gene rearrangements in non-small-cell lung cancer (NSCLC) is complex and represents a low-throughput assay difficult to use in daily diagnostic practice. We devised a sensitive and robust routine diagnostic test for the detection of rearrangements and transcriptional up-regulation of ALK. We developed a quantitative reverse transcription polymerase chain reaction (qRT-PCR) assay adapted to RNA isolated from routine formalin-fixed, paraffin-embedded material and applied it to 652 NSCLC specimens. The reliability of this technique to detect ALK dysregulation was shown by comparison with FISH and immunohistochemistry. qRT-PCR analysis detected unbalanced ALK expression indicative of a gene rearrangement in 24 (4.6%) and full-length ALK transcript expression in six (1.1%) of 523 interpretable tumors. Among 182 tumors simultaneously analyzed by FISH and qRT-PCR, the latter accurately typed 97% of 19 rearranged and 158 nonrearranged tumors and identified ALK deregulation in two cases with insufficient FISH. Six tumors expressing full-length ALK transcripts did not show rearrangements of the gene. Immunohistochemistry detected ALK protein overexpression in tumors with gene fusions and transcriptional up-regulation, but did not distinguish between the two. One case with full-length ALK expression carried a heterozygous point mutation (S1220Y) within the kinase domain potentially interfering with kinase activity and/or inhibitor binding. Our qRT-PCR assay reliably identifies and distinguishes ALK rearrangements and full-length transcript expression in formalin-fixed, paraffin-embedded material. It is an easy-to-perform, cost-effective, and high-throughput tool for the diagnosis of ALK activation. The expression of full-length ALK transcripts may be relevant for ALK inhibitor therapy in NSCLC.

NCLscan: accurate identification of non-co-linear transcripts (fusion, trans-splicing and circular RNA) with a good balance between sensitivity and precision.

PubMed

Chuang, Trees-Juen; Wu, Chan-Shuo; Chen, Chia-Ying; Hung, Li-Yuan; Chiang, Tai-Wei; Yang, Min-Yu

2016-02-18

Analysis of RNA-seq data often detects numerous 'non-co-linear' (NCL) transcripts, which comprised sequence segments that are topologically inconsistent with their corresponding DNA sequences in the reference genome. However, detection of NCL transcripts involves two major challenges: removal of false positives arising from alignment artifacts and discrimination between different types of NCL transcripts (trans-spliced, circular or fusion transcripts). Here, we developed a new NCL-transcript-detecting method ('NCLscan'), which utilized a stepwise alignment strategy to almost completely eliminate false calls (>98% precision) without sacrificing true positives, enabling NCLscan outperform 18 other publicly-available tools (including fusion- and circular-RNA-detecting tools) in terms of sensitivity and precision, regardless of the generation strategy of simulated dataset, type of intragenic or intergenic NCL event, read depth of coverage, read length or expression level of NCL transcript. With the high accuracy, NCLscan was applied to distinguishing between trans-spliced, circular and fusion transcripts on the basis of poly(A)- and nonpoly(A)-selected RNA-seq data. We showed that circular RNAs were expressed more ubiquitously, more abundantly and less cell type-specifically than trans-spliced and fusion transcripts. Our study thus describes a robust pipeline for the discovery of NCL transcripts, and sheds light on the fundamental biology of these non-canonical RNA events in human transcriptome. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

The super elongation complex (SEC) and MLL in development and disease

PubMed Central

Smith, Edwin; Lin, Chengqi; Shilatifard, Ali

2011-01-01

Transcriptional regulation at the level of elongation is vital for the control of gene expression and metazoan development. The mixed lineage leukemia (MLL) protein and its Drosophila homolog, Trithorax, which exist within COMPASS (complex of proteins associated with Set1)-like complexes, are master regulators of development. They are required for proper homeotic gene expression, in part through methylation of histone H3 on Lys 4. In humans, the MLL gene is involved in a large number of chromosomal translocations that create chimeric proteins, fusing the N terminus of MLL to several proteins that share little sequence similarity. Several frequent translocation partners of MLL were found recently to coexist in a super elongation complex (SEC) that includes known transcription elongation factors such as eleven-nineteen lysine-rich leukemia (ELL) and P-TEFb. Importantly, the SEC is required for HOX gene expression in leukemic cells, suggesting that chromosomal translocations involving MLL could lead to the overexpression of HOX and other genes through the involvement of the SEC. Here, we review the normal developmental roles of MLL and the SEC, and how MLL fusion proteins can mediate leukemogenesis. PMID:21460034

UGT-29 protein expression and localization during bacterial infection in Caenorhabditis elegans

NASA Astrophysics Data System (ADS)

Wong, Rui-Rui; Lee, Song-Hua; Nathan, Sheila

2014-09-01

The nematode Caenorhabditis elegans is routinely used as an animal model to delineate complex molecular mechanisms involved in the host response to pathogen infection. Following up on an earlier study on host-pathogen interaction, we constructed a ugt-29::GFP transcriptional fusion transgenic worm strain to examine UGT-29 protein expression and localization upon bacterial infection. UGT-29 orthologs can be found in higher organisms including humans and is proposed as a member of the UDP-Glucoronosyl Transferase family of proteins which are involved in phase II detoxification of compounds detrimental to the host organism. Under uninfected conditions, UGT-29::GFP fusion protein was highly expressed in the C. elegans anterior pharynx and intestine, two major organs involved in detoxification. We further evaluated the localization of the enzyme in worms infected with the bacterial pathogen, Burkholderia pseudomallei. The infected ugt-29::GFP transgenic strain exhibited increased fluorescence in the pharynx and intestine with pronounced fluorescence also extending to body wall muscle. This transcriptional fusion GFP transgenic worm is a convenient and direct tool to provide information on UGT detoxification enzyme gene expression and could be a useful tool for a number of diverse applications.

Nucleophosmin regulates the stability and transcriptional activity of p53.

PubMed

Colombo, Emanuela; Marine, Jean-Christophe; Danovi, Davide; Falini, Brunangelo; Pelicci, Pier Giuseppe

2002-07-01

Nucleophosmin (NPM) is a ubiquitously expressed nucleolar phosphoprotein that continuously shuttles between the nucleus and cytoplasm. It has been proposed to function in ribosomal protein assembly and transport, and also as a molecular chaperone that prevents proteins from aggregating in the crowded environment of the nucleolus. The NPM gene is involved in several tumour-associated chromosome translocations, which have resulted in the formation of fusion proteins that retain the amino terminus of NPM, including NPM ALK, NPM RAR and NPM MLF1 (ref. 6). It is generally thought that the NPM component is not involved in the transforming potential of these fusion proteins, but instead provides a dimerization interface for the oligomerization and the oncogenic conversion of the various NPM partners (ALK, RAR, MLF1). Here we show that NPM interacts directly with the tumour suppressor p53, regulates the increase in stability and transcriptional activation of p53 after different types of stress, and induces p53-dependent premature senescence on overexpression in diploid fibroblasts. These findings indicate that NPM is a crucial regulator of p53 and suggest that alterations of the NPM function by NPM fusion proteins might lead to deregulation of p53 in tumours.

Protein arginine methyltransferase 6 specifically methylates the nonhistone chromatin protein HMGA1a.

PubMed

Miranda, Tina Branscombe; Webb, Kristofor J; Edberg, Dale D; Reeves, Raymond; Clarke, Steven

2005-10-28

The HMGA family proteins HMGA1a and HMGA1b are nuclear nonhistone species implicated in a wide range of cellular processes including inducible gene transcription, modulation of chromosome structure through nucleosome and chromosome remodeling, and neoplastic transformation. HMGA proteins are highly modified, and changes in their phosphorylation states have been correlated with the phase of the cell cycle and changes in their transcriptional activity. HMGA1a is also methylated in the first DNA-binding AT-hook at Arg25 and other sites, although the enzyme or enzymes responsible have not been identified. We demonstrate here that a GST fusion of protein arginine methyltransferase 6 (PRMT6) specifically methylates full-length recombinant HMGA1a protein in vitro. Although GST fusions of PRMT1 and PRMT3 were also capable of methylating the full-length HMGA1a polypeptide, they recognize its proteolytic degradation products much better. GST fusions of PRMT4 or PRMT7 were unable to methylate the full-length protein or its degradation products. We conclude that PRMT6 is a good candidate for the endogenous enzyme responsible for HGMA1a methylation.

Transcriptional regulation of fksA, a β-1,3-glucan synthase gene, by the APSES protein StuA during Aspergillus nidulans development.

PubMed

Park, Bum-Chan; Park, Yun-Hee; Yi, Soohyun; Choi, Yu Kyung; Kang, Eun-Hye; Park, Hee-Moon

2014-11-01

The temporal and spatial regulation of β-1,3-glucan synthesis plays an important role in morphogenesis during fungal growth and development. Northern blot analysis showed that the transcription of fksA, the gene encoding β-1,3-glucan synthase in Aspergillus nidulans, was cell-cycle-dependent and increased steadily over the duration of the vegetative period, but its overall expression during the asexual and sexual stages was fairly constant up until the time of transcription cessation. In an A. nidulans strain mutated in the eukaryotic bHLH-like APSES transcription factor stuA1, the transcriptional level of fksA, and consequently the content of alkali-insoluble cell wall β-glucan, significantly increased at the conidial chain formation and maturation stage. Electrophoretic mobility shift assays revealed that StuA was bound to StREs (StuA Response Elements) on the fksA promoter region. Promoter analysis with sGFP-fusion constructs also indicated the negative regulation of fksA expression by StuA, especially during asexual development. Taken together, these data suggest that StuA plays an important role in cell wall biogenesis during the development of A. nidulans, by controlling the transcription level of fksA.

Identification, isolation, and expression analysis of heat shock transcription factors in the diploid woodland strawberry Fragaria vesca

PubMed Central

Hu, Yang; Han, Yong-Tao; Wei, Wei; Li, Ya-Juan; Zhang, Kai; Gao, Yu-Rong; Zhao, Feng-Li; Feng, Jia-Yue

2015-01-01

Heat shock transcription factors (Hsfs) are known to play dominant roles in plant responses to heat, as well as other abiotic or biotic stress stimuli. While the strawberry is an economically important fruit plant, little is known about the Hsf family in the strawberry. To explore the functions of strawberry Hsfs in abiotic and biotic stress responses, this study identified 17 Hsf genes (FvHsfs) in a wild diploid woodland strawberry (Fragaria vesca, 2n = 2x = 14) and isolated 14 of these genes. Phylogenetic analysis divided the strawberry FvHsfs genes into three main groups. The evolutionary and structural analyses revealed that the FvHsf family is conserved. The promoter sequences of the FvHsf genes contain upstream regulatory elements corresponding to different stress stimuli. In addition, 14 FvHsf-GFP fusion proteins showed differential subcellular localization in Arabidopsis mesophyll protoplasts. Furthermore, we examined the expression of the 17 FvHsf genes in wild diploid woodland strawberries under various conditions, including abiotic stresses (heat, cold, drought, and salt), biotic stress (powdery mildew infection), and hormone treatments (abscisic acid, ethephon, methyl jasmonate, and salicylic acid). Fifteen of the seventeen FvHsf genes exhibited distinct changes on the transcriptional level during heat treatment. Of these 15 FvHsfs, 8 FvHsfs also exhibited distinct responses to other stimuli on the transcriptional level, indicating versatile roles in the response to abiotic and biotic stresses. Taken together, the present work may provide the basis for further studies to dissect FvHsf function in response to stress stimuli. PMID:26442049

Cold Induction of Arabidopsis CBF Genes Involves Multiple ICE (Inducer of CBF Expression) Promoter Elements and a Cold-Regulatory Circuit That Is Desensitized by Low Temperature1

PubMed Central

Zarka, Daniel G.; Vogel, Jonathan T.; Cook, Daniel; Thomashow, Michael F.

2003-01-01

The Arabidopsis CBF1, 2, and 3 genes (also known as DREB1b, c, and a, respectively) encode transcriptional activators that have a central role in cold tolerance. CBF1-3 are rapidly induced upon exposing plants to low temperature, followed by expression of CBF-targeted genes, the CBF regulon, resulting in an increase in plant freezing tolerance. At present, little is known about the cold-sensing mechanism that controls CBF expression. Results presented here indicate that this mechanism does not require a cold shock to bring about the accumulation of CBF transcripts, but instead, absolute temperature is monitored with a greater degree of input, i.e. lower temperature, resulting in a greater output, i.e. higher levels of CBF transcripts. Temperature-shift experiments also indicate that the cold-sensing mechanism becomes desensitized to a given low temperature, such as 4°C, and that resensitization to that temperature requires between 8 and 24 h at warm temperature. Gene fusion experiments identified a 125-bp section of the CBF2 promoter that is sufficient to impart cold-responsive gene expression. Mutational analysis of this cold-responsive region identified two promoter segments that work in concert to impart robust cold-regulated gene expression. These sequences, designated ICEr1 and ICEr2 (induction of CBF expression region 1 or 2), were also shown to stimulate transcription in response to mechanical agitation and the protein synthesis inhibitor, cycloheximide. PMID:14500791

Universal light-switchable gene promoter system

DOEpatents

Quail, Peter H.; Huq, Enamul; Tepperman, James; Sato, Sae

2005-02-22

An artificial promoter system that can be fused upstream of any desired gene enabling reversible induction or repression of the expression of the gene at will in any suitable host cell or organisms by light is described. The design of the system is such that a molecule of the plant photoreceptor phytochrome is targeted to the specific DNA binding site in the promoter by a protein domain that is fused to the phytochrome and that specifically recognizes this binding site. This bound phytochrome, upon activation by light, recruits a second fusion protein consisting of a protein that binds to phytochrome only upon light activation and a transcriptional activation domain that activates expression of the gene downstream of the promoter.

In vitro mapping of Myotonic Dystrophy (DM) gene promoter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Storbeck, C.J.; Sabourin, L.; Baird, S.

1994-09-01

The Myotonic Dystrophy Kinase (DMK) gene has been cloned and shared homology to serine/threonine protein kinases. Overexpression of this gene in stably transfected mouse myoblasts has been shown to inhibit fusion into myotubes while myoblasts stably transfected with an antisense construct show increased fusion potential. These experiments, along with data showing that the DM gene is highly expressed in muscle have highlighted the possibility of DMK being involved in myogenesis. The promoter region of the DM gene lacks a consensus TATA box and CAAT box, but harbours numerous transcription binding sites. Clones containing extended 5{prime} upstream sequences (UPS) of DMKmore » only weakly drive the reporter gene chloramphenicol acetyl transferase (CAT) when transfected into C2C12 mouse myoblasts. However, four E-boxes are present in the first intron of the DM gene and transient assays show increased expression of the CAT gene when the first intron is present downstream of these 5{prime} UPS in an orientation dependent manner. Comparison between mouse and human sequence reveals that the regions in the first intron where the E-boxes are located are highly conserved. The mapping of the promoter and the importance of the first intron in the control of DMK expression will be presented.« less

Development of a new fluorescent reporter:operator system: location of AraC regulated genes in Escherichia coli K-12.

PubMed

Sellars, Laura E; Bryant, Jack A; Sánchez-Romero, María-Antonia; Sánchez-Morán, Eugenio; Busby, Stephen J W; Lee, David J

2017-08-03

In bacteria, many transcription activator and repressor proteins regulate multiple transcription units that are often distally distributed on the bacterial genome. To investigate the subcellular location of DNA bound proteins in the folded bacterial nucleoid, fluorescent reporters have been developed which can be targeted to specific DNA operator sites. Such Fluorescent Reporter-Operator System (FROS) probes consist of a fluorescent protein fused to a DNA binding protein, which binds to an array of DNA operator sites located within the genome. Here we have developed a new FROS probe using the Escherichia coli MalI transcription factor, fused to mCherry fluorescent protein. We have used this in combination with a LacI repressor::GFP protein based FROS probe to assess the cellular location of commonly regulated transcription units that are distal on the Escherichia coli genome. We developed a new DNA binding fluorescent reporter, consisting of the Escherichia coli MalI protein fused to the mCherry fluorescent protein. This was used in combination with a Lac repressor:green fluorescent protein fusion to examine the spatial positioning and possible co-localisation of target genes, regulated by the Escherichia coli AraC protein. We report that induction of gene expression with arabinose does not result in co-localisation of AraC-regulated transcription units. However, measurable repositioning was observed when gene expression was induced at the AraC-regulated promoter controlling expression of the araFGH genes, located close to the DNA replication terminus on the chromosome. Moreover, in dividing cells, arabinose-induced expression at the araFGH locus enhanced chromosome segregation after replication. Regions of the chromosome regulated by AraC do not colocalise, but transcription events can induce movement of chromosome loci in bacteria and our observations suggest a role for gene expression in chromosome segregation.

A de novo t(10;19)(q22.3;q13.33) leads to ZMIZ1/PRR12 reciprocal fusion transcripts in a girl with intellectual disability and neuropsychiatric alterations.

PubMed

Córdova-Fletes, Carlos; Domínguez, Ma Guadalupe; Delint-Ramirez, Ilse; Martínez-Rodríguez, Herminia G; Rivas-Estilla, Ana María; Barros-Núñez, Patricio; Ortiz-López, Rocío; Neira, Vivian Alejandra

2015-10-01

We report a girl with intellectual disability (ID), neuropsychiatric alterations, and a de novo balanced t(10;19)(q22.3;q13.33) translocation. After chromosome sorting, fine mapping of breakpoints by array painting disclosed disruptions of the zinc finger, MIZ-type containing 1 (ZMIZ1) (on chr10) and proline-rich 12 (PRR12) (on chr19) genes. cDNA analyses revealed that the translocation resulted in gene fusions. The resulting hybrid transcripts predict mRNA decay or, if translated, formation of truncated proteins, both due to frameshifts that introduced premature stop codons. Though other molecular mechanisms may be operating, these results suggest that haploinsufficiency of one or both genes accounts for the patient's phenotype. ZMIZ1 is highly expressed in the brain, and its protein product appears to interact with neuron-specific chromatin remodeling complex (nBAF) and activator protein 1 (AP-1) complexes which play a role regulating the activity of genes essential for normal synapse and dendrite growth/behavior. Strikingly, the patient's phenotype overlaps with phenotypes caused by mutations in SMARCA4 (BRG1), an nBAF subunit presumably interacting with ZMIZ1 in brain cells as suggested by our results of coimmunoprecipitation in the mouse brain. PRR12 is also expressed in the brain, and its protein product possesses domains and residues thought to be related in formation of large protein complexes and chromatin remodeling. Our observation from E15 mouse brain cells that a Prr12 isoform was confined to nucleus suggests a role as a transcription nuclear cofactor likely involved in neuronal development. Moreover, a pilot transcriptome analysis from t(10;19) lymphoblastoid cell line suggests dysregulation of genes linked to neurodevelopment processes/neuronal communication (e.g., NRCAM) most likely induced by altered PRR12. This case represents the first constitutional balanced translocation disrupting and fusing both genes and provides clues for the potential function and effects of these in the central nervous system.

Spatiotemporal regulation of cell fusion by JNK and JAK/STAT signaling during Drosophila wound healing.

PubMed

Lee, Ji-Hyun; Lee, Chan-Wool; Park, Si-Hyoung; Choe, Kwang-Min

2017-06-01

Cell-cell fusion is widely observed during development and disease, and imposes a dramatic change on participating cells. Cell fusion should be tightly controlled, but the underlying mechanism is poorly understood. Here, we found that the JAK/STAT pathway suppressed cell fusion during wound healing in the Drosophila larval epidermis, restricting cell fusion to the vicinity of the wound. In the absence of JAK/STAT signaling, a large syncytium containing a 3-fold higher number of nuclei than observed in wild-type tissue formed in wounded epidermis. The JAK/STAT ligand-encoding genes upd2 and upd3 were transcriptionally induced by wounding, and were required for suppressing excess cell fusion. JNK (also known as Basket in flies) was activated in the wound vicinity and activity peaked at ∼8 h after injury, whereas JAK/STAT signaling was activated in an adjoining concentric ring and activity peaked at a later stage. Cell fusion occurred primarily in the wound vicinity, where JAK/STAT activation was suppressed by fusion-inducing JNK signaling. JAK/STAT signaling was both necessary and sufficient for the induction of βPS integrin (also known as Myospheroid) expression, suggesting that the suppression of cell fusion was mediated at least in part by integrin protein. © 2017. Published by The Company of Biologists Ltd.

Intrinsic and Extrinsic Regulation of PD-L2 Expression in Oncogene-Driven Non-Small Cell Lung Cancer.

PubMed

Shibahara, Daisuke; Tanaka, Kentaro; Iwama, Eiji; Kubo, Naoki; Ota, Keiichi; Azuma, Koichi; Harada, Taishi; Fujita, Jiro; Nakanishi, Yoichi; Okamoto, Isamu

2018-03-27

The interaction of programmed cell death ligand 2 (PD-L2) with programmed cell death 1 is implicated in tumor immune escape. The regulation of PD-L2 expression in tumor cells has remained unclear, however. We here examined intrinsic and extrinsic regulation of PD-L2 expression in NSCLC. PD-L2 expression was evaluated by reverse transcription and real-time polymerase chain reaction analysis and by flow cytometry. BEAS-2B cells stably expressing an activated mutant form of EGFR or the echinoderm microtubule associated protein like 4 (EML4)-ALK receptor tyrosine kinase fusion oncoprotein manifested increased expression of PD-L2 at both the mRNA and protein levels. Furthermore, treatment of NSCLC cell lines that harbor such driver oncogenes with corresponding EGFR or ALK tyrosine kinase inhibitors or depletion of EGFR or ALK by small interfering RNA transfection suppressed expression of PD-L2, demonstrating that activating EGFR mutations or echinoderm microtubule associated protein like 4 gene (EML4)-ALK receptor tyrosine kinase gene (ALK) fusion intrinsically induce PD-L2 expression. We also found that interferon gamma (IFN-γ) extrinsically induced expression of PD-L2 through signal transducer and activator of transcription 1 signaling in NSCLC cells. Oncogene-driven expression of PD-L2 in NSCLC cells was inhibited by knockdown of the transcription factors signal transducer and activator of transcription 3 (STAT3) or c-FOS. IFN-γ also activated STAT3 and c-FOS, suggesting that these proteins may also contribute to the extrinsic induction of PD-L2 expression. Expression of PD-L2 is induced intrinsically by activating EGFR mutations or EML4-ALK fusion and extrinsically by IFN-γ, with STAT3 and c-FOS possibly contributing to both intrinsic and extrinsic pathways. Our results thus provide insight into the complexity of tumor immune escape in NSCLC. Copyright © 2018 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights reserved.

Desmoplastic small round cell tumor: evaluation of reverse transcription-polymerase chain reaction and fluorescence in situ hybridization as ancillary molecular diagnostic techniques.

PubMed

Mohamed, Mustafa; Gonzalez, David; Fritchie, Karen J; Swansbury, John; Wren, Dorte; Benson, Charlotte; Jones, Robin L; Fisher, Cyril; Thway, Khin

2017-11-01

Desmoplastic small round cell tumor (DSRCT) is a rare, biologically aggressive soft tissue neoplasm of uncertain differentiation, most often arising in the abdominal and pelvic cavities of adolescents and young adults with a striking male predominance. Histologically, it is characterized by islands of uniform small round cells in prominent desmoplastic stroma, and it has a polyimmunophenotypic profile, typically expressing WT1 and cytokeratin, desmin, and neural/neuroendocrine differentiation markers to varying degrees. Tumors at other sites and with variant morphology are more rarely described. DSRCT is associated with a recurrent t(11;22)(p13;q12) translocation, leading to the characteristic EWSR1-WT1 gene fusion. Fluorescence in situ hybridization (FISH), to detect EWSR1 rearrangement, and reverse transcription-polymerase chain reaction (RT-PCR) to assess for EWSR1-WT1 fusion transcripts are routine diagnostic ancillary tools. We present a large institutional comparative series of FISH and RT-PCR for DSRCT diagnosis. Twenty-six specimens (from 25 patients) histologically diagnosed as DSRCT were assessed for EWSR1 rearrangement and EWSR1-WT1 fusion transcripts. Of these 26 specimens, 24 yielded positive results with either FISH or RT-PCR or both. FISH was performed in 23 samples, with EWSR1 rearrangement seen in 21 (91.3%). RT-PCR was performed in 18 samples, of which 13 (72.2%) harbored EWSR1-WT1 fusion transcripts. The sensitivity of FISH in detecting DSRCT was 91.3%, and that of RT-PCR was 92.8% following omission of four technical failures. Therefore, both methods are comparable in terms of sensitivity. FISH is more sensitive if technical failures for RT-PCR are taken into account, and RT-PCR is more specific in confirming DSRCT. Both methods complement each other by confirming cases that the other method may not. In isolation, FISH is a relatively non-specific diagnostic adjunct due to the number of different neoplasms that can harbor EWSR1 rearrangement, such as Ewing sarcoma. However, in cases with appropriate morphology and a typical pattern of immunostaining, FISH is confirmatory of the diagnosis.

Construction and Cloning of Reporter-Tagged Replicon cDNA for an In Vitro Replication Study of Murine Norovirus-1 (MNV-1)

PubMed Central

Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir

2017-01-01

Background A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. Methods The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3′end of the reporter gene and the VP2 start sequence to allow co-translational ‘cleavage’ of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Results Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. Conclusion NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication. PMID:29379384

RNAseq analysis of fast skeletal muscle in restriction-fed transgenic coho salmon (Oncorhynchus kisutch): an experimental model uncoupling the growth hormone and nutritional signals regulating growth.

PubMed

Garcia de la Serrana, Daniel; Devlin, Robert H; Johnston, Ian A

2015-07-31

Coho salmon (Oncorhynchus kisutch) transgenic for growth hormone (Gh) express Gh in multiple tissues which results in increased appetite and continuous high growth with satiation feeding. Restricting Gh-transgenics to the same lower ration (TR) as wild-type fish (WT) results in similar growth, but with the recruitment of fewer, larger diameter, muscle skeletal fibres to reach a given body size. In order to better understand the genetic mechanisms behind these different patterns of muscle growth and to investigate how the decoupling of Gh and nutritional signals affects gene regulation we used RNA-seq to compare the fast skeletal muscle transcriptome in TR and WT coho salmon. Illumina sequencing of individually barcoded libraries from 6 WT and 6 TR coho salmon yielded 704,550,985 paired end reads which were used to construct 323,115 contigs containing 19,093 unique genes of which >10,000 contained >90 % of the coding sequence. Transcripts coding for 31 genes required for myoblast fusion were identified with 22 significantly downregulated in TR relative to WT fish, including 10 (vaspa, cdh15, graf1, crk, crkl, dock1, trio, plekho1a, cdc42a and dock5) associated with signaling through the cell surface protein cadherin. Nineteen out of 44 (43 %) translation initiation factors and 14 of 47 (30 %) protein chaperones were upregulated in TR relative to WT fish. TR coho salmon showed increased growth hormone transcripts and gene expression associated with protein synthesis and folding than WT fish even though net rates of protein accretion were similar. The uncoupling of Gh and amino acid signals likely results in additional costs of transcription associated with protein turnover in TR fish. The predicted reduction in the ionic costs of homeostasis in TR fish associated with increased fibre size were shown to involve multiple pathways regulating myotube fusion, particularly cadherin signaling.

Renal cell carcinoma associated with Xp11.2 translocation/TFE3 gene fusion: radiological findings mimicking papillary subtype.

PubMed

Kato, Hiroki; Kanematsu, Masayuki; Yokoi, Shigeaki; Miwa, Kousei; Horie, Kengo; Deguchi, Takashi; Hirose, Yoshinobu

2011-01-01

The authors describe the computed tomography (CT) and magnetic resonance imaging (MRI) findings of an 18-year-old man with renal cell carcinoma (RCC) associated with the Xp11.2 translocation/transcription factor E3 (TFE3) gene fusion (Xp11 translocation carcinoma). The lesion was hyperdense on unenhanced CT, hypovascular on contrast-enhanced studies, hypointense on T2-weighted MR images, and hemosiderin deposition was suspected on phase-shift gradient-echo MR images. Histopathological specimens revealed pathological findings resembling papillary RCC predominantly and exhibited immunoreactivity for TFE3. Because there is often considerable morphological overlap between this carcinoma and papillary RCC, the imaging findings of Xp11 translocation carcinoma may be similar to those of the papillary subtype. Therefore, Xp11 translocation carcinoma should be considered, particularly in young patients when radiologic images demonstrate a renal tumor mimicking the papillary subtype. Copyright © 2010 Wiley-Liss, Inc.

Measles inclusion-body encephalitis caused by the vaccine strain of measles virus.

PubMed

Bitnun, A; Shannon, P; Durward, A; Rota, P A; Bellini, W J; Graham, C; Wang, E; Ford-Jones, E L; Cox, P; Becker, L; Fearon, M; Petric, M; Tellier, R

1999-10-01

We report a case of measles inclusion-body encephalitis (MIBE) occurring in an apparently healthy 21-month-old boy 8.5 months after measles-mumps-rubella vaccination. He had no prior evidence of immune deficiency and no history of measles exposure or clinical disease. During hospitalization, a primary immunodeficiency characterized by a profoundly depressed CD8 cell count and dysgammaglobulinemia was demonstrated. A brain biopsy revealed histopathologic features consistent with MIBE, and measles antigens were detected by immunohistochemical staining. Electron microscopy revealed inclusions characteristic of paramyxovirus nucleocapsids within neurons, oligodendroglia, and astrocytes. The presence of measles virus in the brain tissue was confirmed by reverse transcription polymerase chain reaction. The nucleotide sequence in the nucleoprotein and fusion gene regions was identical to that of the Moraten and Schwarz vaccine strains; the fusion gene differed from known genotype A wild-type viruses.

Soft tissue angiofibroma: Clinicopathologic, immunohistochemical and molecular analysis of 14 cases.

PubMed

Bekers, Elise M; Groenen, Patricia J T A; Verdijk, Marian A J; Raaijmakers-van Geloof, Winny L; Roepman, Paul; Vink, Robert; Gilhuijs, Nathalie D B; van Gorp, Joost M; Bovée, Judith V M G; Creytens, David H; Flanagan, Adrienne M; Suurmeijer, Albert J H; Mentzel, Thomas; Arbajian, Elsa; Flucke, Uta

2017-10-01

Soft tissue angiofibroma is rare and has characteristic histomorphological and genetic features. For diagnostic purposes, there are no specific antibodies available. Fourteen lesions (6 females, 8 males; age range 7-67 years) of the lower extremities (12) and trunk (2) were investigated by immunohistochemistry, including for the first time NCOA2. NCOA2 was also tested in a control group of other spindle cell lesions. The known fusion-genes (AHRR-NCOA2 and GTF2I-NCOA2) were examined using RT-PCR in order to evaluate their diagnostic value. Cases in which no fusion gene was detected were additionally analysed by RNA sequencing. All cases tested showed nuclear expression of NCOA2. However, this was not specific since other spindle cell neoplasms also expressed this marker in a high percentage of cases. Other variably positive markers were EMA, SMA, desmin and CD34. STAT6 was negative in the cases tested. By RT-PCR for the most frequently observed fusions, an AHRR-NCOA2 fusion transcript was found in 9/14 cases. GTF2I-NCOA2 was not detected in the remaining cases (n = 3). RNA sequencing revealed three additional positive cases; two harbored a AHRR-NCOA2 fusion and one case a novel GAB1-ABL1 fusion. Two cases failed molecular analysis due to poor RNA quality. In conclusion, the AHRR-NCOA2 fusion is a frequent finding in soft tissue angiofibroma, while GTF2I-NCOA2 seems to be a rare genetic event. For the first time, we report a GAB1-ABL1 fusion in a soft tissue angiofibroma of a child. Nuclear expression of NCOA2 is not discriminating when compared with other spindle cell neoplasms. © 2017 Wiley Periodicals, Inc.

POM-ZP3, a bipartite transcript derived from human ZP3 and a POM121 homologue

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kipersztok, S.; Osawa, G.A.; Liang, L.F.

1995-01-20

Human POM-ZP3 is a novel bipartite RNA transcript that is derived from a gene homologous to rat POM121 (a nuclear pore membrane protein) and ZP3 (a sperm receptor ligand in the zona pellucida). The 5{prime} region is 77% identical to the 5{prime} end of the coding region of rat POM121 and appears to represent a partial duplication of a gene encoding a human homologue of this rodent gene. The 3{prime} end of the POM-ZP3 transcript is 99% identical to ZP3 and appears to have arisen from a duplication of the last four exons (exons 5-8) of ZP3. Using Northern blotsmore » and RT-PCR, POM-ZP3 transcripts were detected in human ovaries, testes, spleen, thymus, lymphocytes, prostate, and intestines. The longest open reading frame encodes a conceptual protein of 210 amino acids, the first 76 of which are 83% identical to residues 241-315 of rat POM121. The next 125 amino acids are 98% identical to residues 239-363 of the 424-amino-acid human ZP3 protein. By fluorescence in situ hybridization, genomic fragments of ZP3 and a human homologue of POM121 were localized to chromosome 7q11.23. Taken together, these data suggest that partial duplications of human ZP3 and a POM121-like gene have resulted in a fusion transcript, POM-ZP3, that is expressed in multiple human tissues. 24 refs., 5 figs.« less

Studies on the expression of an H-2K/human growth hormone fusion gene in giant transgenic mice.

PubMed Central

Morello, D; Moore, G; Salmon, A M; Yaniv, M; Babinet, C

1986-01-01

Transgenic mice carrying the H-2K/human growth hormone (hGH) fusion gene were produced by microinjecting into the pronucleus of fertilized eggs DNA molecules containing 2 kb of the 5' flanking sequences (including promoter) of the class I H-2Kb gene joined to the coding sequences of the hGH gene. Thirteen transgenic mice were obtained which all contained detectable levels of hGH hormone in their blood. Nine grew larger than their control litter-mates. Endogenous H-2Kb and exogenous hGH mRNA levels were analysed by S1 nuclease digestion experiments. hGH transcripts were found in all the tissues examined and the pattern of expression paralleled that of endogenous H-2K gene expression, being high in liver and lymphoid organs and low in muscle and brain. Thus 2 kb of the 5' promoter/regulatory region of the H-2K gene are sufficient to ensure regulated expression of hGH in transgenic mice. This promoter may therefore be of use to target the expression of different exogenous genes in most tissues of transgenic mice and to study the biological role of the corresponding proteins in different cellular environments. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. PMID:3019667

The t(3;5)(q25.1;q34) of myelodysplastic syndrome and acute myeloid leukemia produces a novel fusion gene, NPM-MLF1.

PubMed

Yoneda-Kato, N; Look, A T; Kirstein, M N; Valentine, M B; Raimondi, S C; Cohen, K J; Carroll, A J; Morris, S W

1996-01-18

A t(3;5)(q25.1;q34) chromosomal translocation associated with myelodysplastic syndrome and acute myeloid leukemia (AML) was found to rearrange part of the nucleophosmin (NPM) gene on chromosome 5 with sequences from a novel gene on chromosome 3. Chimeric transcripts expressed by these cells contain 5' NPM coding sequences fused in-frame to those of the new gene, which we named myelodysplasia/myeloid leukemia factor 1 (MLF1). RNA-based polymerase chain reaction analysis revealed identical NPM-MLF1 mRNA fusions in each of the three t(3;5)-positive cases of AML examined. The predicted MLF1 amino acid sequence lacked homology to previously characterized proteins and did not contain known functional motifs. Normal MLF1 transcripts were expressed in a variety of tissues, most abundantly in testis, ovary, skeletal muscle, heart, kidney and colon. Anti-MLF1 antibodies detected the wild-type 31 kDa protein in K562 and HEL erythroleukemia cell lines, but not in HL-60, U937 or KG-1 myeloid leukemia lines. By contrast, t(3;5)-positive leukemia cells expressed a 54 kDa NPM-MLF1 protein, but not normal MLF1. Immunostaining experiments indicated that MLF1 is normally located in the cytoplasm, whereas NPM-MLF1 is targeted to the nucleus, with highest levels in the nucleolus. The nuclear/nucleolar localization of NPM-MLF1 mirrors that of NPM, indicating that NPM trafficking signals direct MLF1 to an inappropriate cellular compartment in myeloid leukemia cells.

HIP1-ALK, a novel ALK fusion variant that responds to crizotinib.

PubMed

Fang, Douglas D; Zhang, Bin; Gu, Qingyang; Lira, Maruja; Xu, Qiang; Sun, Hongye; Qian, Maoxiang; Sheng, Weiqi; Ozeck, Mark; Wang, Zhenxiong; Zhang, Cathy; Chen, Xinsheng; Chen, Kevin X; Li, Jian; Chen, Shu-Hui; Christensen, James; Mao, Mao; Chan, Chi-Chung

2014-03-01

The aim of this study was to identify anaplastic lymphoma kinase (ALK) rearrangements in lung cancer patient-derived xenograft (PDX) models and to explore their responses to crizotinib. Screening of 99 lung cancer PDX models by the NanoString ALK fusion assay identified two ALK-rearranged non-small-cell lung cancer (NSCLC) tumors, including one harboring a previously known echinoderm microtubule-associated protein-like 4 (EML4)-ALK fusion and another containing an unknown ALK fusion variant. Expression array, RNA-Seq, reverse transcription polymerase chain reaction, and direct sequencing were then conducted to confirm the rearrangements and to identify the novel fusion partner in the xenograft and/or the primary patient tumor. Finally, pharmacological studies were performed in PDX models to evaluate their responses to ALK inhibitor crizotinib. Two ALK-rearranged NSCLC PDX models were identified: one carried a well-known EML4-ALK variant 3a/b and the other harbored a novel huntingtin interacting protein 1 (HIP1)-ALK fusion gene. Exon 28 of the HIP1 gene located on chromosome 7 was fused to exon 20 of the ALK gene located on chromosome 2. Both cases were clinically diagnosed as squamous cell carcinoma. Compared with the other lung cancer PDX models, both ALK-rearranged models displayed elevated ALK mRNA expression. Furthermore, in vivo efficacy studies demonstrated that, similar to the EML4-ALK-positive model, the HIP1-ALK-containing PDX model was sensitive to treatment with crizotinib. Discovery of HIP1 as a fusion partner of ALK in NSCLC is a novel finding. In addition, the HIP1-ALK-rearranged tumor is sensitive to treatment with crizotinib in vivo, implicating HIP1-ALKas an oncogenic driver of lung tumorigenesis. Collectively, our results indicate that HIP1-ALK-positive NSCLC may benefit from clinical applications of crizotinib.

Self-regulation of 70-kilodalton heat shock proteins in Saccharomyces cerevisiae.

PubMed Central

Stone, D E; Craig, E A

1990-01-01

To determine whether the 70-kilodalton heat shock proteins of Saccharomyces cerevisiae play a role in regulating their own synthesis, we studied the effect of overexpressing the SSA1 protein on the activity of the SSA1 5'-regulatory region. The constitutive level of Ssa1p was increased by fusing the SSA1 structural gene to the GAL1 promoter. A reporter vector consisting of an SSA1-lacZ translational fusion was used to assess SSA1 promoter activity. In a strain producing approximately 10-fold the normal heat shock level of Ssa1p, induction of beta-galactosidase activity by heat shock was almost entirely blocked. Expression of a transcriptional fusion vector in which the CYC1 upstream activating sequence of a CYC1-lacZ chimera was replaced by a sequence containing a heat shock upstream activating sequence (heat shock element 2) from the 5'-regulatory region of SSA1 was inhibited by excess Ssa1p. The repression of an SSA1 upstream activating sequence by the SSA1 protein indicates that SSA1 self-regulation is at least partially mediated at the transcriptional level. The expression of another transcriptional fusion vector, containing heat shock element 2 and a lesser amount of flanking sequence, is not inhibited when Ssa1p is overexpressed. This suggests the existence of an element, proximal to or overlapping heat shock element 2, that confers sensitivity to the SSA1 protein. Images PMID:2181281

Genome-wide analysis and expression profile of the bZIP transcription factor gene family in grapevine (Vitis vinifera)

PubMed Central

2014-01-01

Background Basic leucine zipper (bZIP) transcription factor gene family is one of the largest and most diverse families in plants. Current studies have shown that the bZIP proteins regulate numerous growth and developmental processes and biotic and abiotic stress responses. Nonetheless, knowledge concerning the specific expression patterns and evolutionary history of plant bZIP family members remains very limited. Results We identified 55 bZIP transcription factor-encoding genes in the grapevine (Vitis vinifera) genome, and divided them into 10 groups according to the phylogenetic relationship with those in Arabidopsis. The chromosome distribution and the collinearity analyses suggest that expansion of the grapevine bZIP (VvbZIP) transcription factor family was greatly contributed by the segment/chromosomal duplications, which may be associated with the grapevine genome fusion events. Nine intron/exon structural patterns within the bZIP domain and the additional conserved motifs were identified among all VvbZIP proteins, and showed a high group-specificity. The predicted specificities on DNA-binding domains indicated that some highly conserved amino acid residues exist across each major group in the tree of land plant life. The expression patterns of VvbZIP genes across the grapevine gene expression atlas, based on microarray technology, suggest that VvbZIP genes are involved in grapevine organ development, especially seed development. Expression analysis based on qRT-PCR indicated that VvbZIP genes are extensively involved in drought- and heat-responses, with possibly different mechanisms. Conclusions The genome-wide identification, chromosome organization, gene structures, evolutionary and expression analyses of grapevine bZIP genes provide an overall insight of this gene family and their potential involvement in growth, development and stress responses. This will facilitate further research on the bZIP gene family regarding their evolutionary history and biological functions. PMID:24725365

Inhibition of poly(ADP-ribose) polymerase-1 alters expression of mitochondria-related genes in PC12 cells: relevance to mitochondrial homeostasis in neurodegenerative disorders.

PubMed

Czapski, Grzegorz A; Cieślik, Magdalena; Wencel, Przemysław L; Wójtowicz, Sylwia; Strosznajder, Robert P; Strosznajder, Joanna B

2018-02-01

Alzheimer's disease (AD) is characterized by the release of amyloid beta peptides (Aβ) in the form of monomers/oligomers which may lead to oxidative stress, mitochondria dysfunction, synaptic loss, neuroinflammation and, in consequence, to overactivation of poly(ADP-ribose) polymerase-1 (PARP-1). However, Aβ peptides are also released in the brain ischemia, traumatic injury and in inflammatory response. PARP-1 is suggested to be a promising target in therapy of neurodegenerative disorders. We investigated the impact of PARP-1 inhibition on transcription of mitochondria-related genes in PC12 cells. Moreover, the effect of PARP-1 inhibitor (PJ34) on cells subjected to Aβ oligomers (AβO) - evoked stress was analyzed. Our data demonstrated that inhibition of PARP-1 in PC12 cells enhanced the transcription of genes for antioxidative enzymes (Sod1, Gpx1, Gpx4), activated genes regulating mitochondrial fission/fusion (Mfn1, Mfn2, Dnm1l, Opa1, Fis1), subunits of ETC complexes (mt-Nd1, Sdha, mt-Cytb) and modulated expression of several TFs, enhanced Foxo1 and decreased Nrf1, Stat6, Nfkb1. AβO elevated free radicals concentration, decreased mitochondria membrane potential (MMP) and cell viability after 24h. Gene transcription was not affected by AβO after 24h, but was significantly downregulated after 96h. In AβO stress, PJ34 exerted stimulatory effect on expression of several genes (Gpx1, Gpx4, Opa1, Mfn2, Fis1 and Sdha), decreased transcription of numerous TFs (Nrf1, Tfam, Stat3, Stat6, Trp53, Nfkb1) and prevented oxidative stress. Our results indicated that PARP-1 inhibition significantly enhanced transcription of genes involved in antioxidative defense and in regulation of mitochondria function, but was not able to ameliorate cells viability affected by Aβ. Copyright © 2017 Elsevier B.V. All rights reserved.

Heterologous gene expression driven by carbonic anhydrase gene promoter in Dunaliella salina

NASA Astrophysics Data System (ADS)

Chai, Yurong; Lu, Yumin; Wang, Tianyun; Hou, Weihong; Xue, Lexun

2006-12-01

Dunaliella salina, a halotolerant unicellular green alga without a rigid cell wall, can live in salinities ranging from 0.05 to 5 mol/L NaCl. These features of D. salina make it an ideal host for the production of antibodies, oral vaccine, and commercially valuable polypeptides. To produce high level of heterologous proteins from D. salina, highly efficient promoters are required to drive expression of target genes under controlled condition. In the present study, we cloned a 5' franking region of 1.4 kb from the carbonic anhydrase ( CAH) gene of D. salina by genomic walking and PCR. The fragment was ligated to the pMD18-T vector and characterized. Sequence analysis indicated that this region contained conserved motifs, including a TATA- like box and CAAT-box. Tandem (GT)n repeats that had a potential role of transcriptional control, were also found in this region. The transcription start site (TSS) of the CAH gene was determined by 5' RACE and nested PCR method. Transformation assays showed that the 1.4 kb fragment was able to drive expression of the selectable bar (bialaphos resistance) gene when the fusion was transformed into D. salina by biolistics. Northern blotting hybridizations showed that the bar transcript was most abundant in cells grown in 2 mol/L NaCl, and less abundant in 0.5 mol/L NaCl, indicating that expression of the bar gene was induced at high salinity. These results suggest the potential use of the CAH gene promoter to induce the expression of heterologous genes in D. salina under varied salt condition.

Transcription control by the ENL YEATS domain in acute leukaemia.

PubMed

Erb, Michael A; Scott, Thomas G; Li, Bin E; Xie, Huafeng; Paulk, Joshiawa; Seo, Hyuk-Soo; Souza, Amanda; Roberts, Justin M; Dastjerdi, Shiva; Buckley, Dennis L; Sanjana, Neville E; Shalem, Ophir; Nabet, Behnam; Zeid, Rhamy; Offei-Addo, Nana K; Dhe-Paganon, Sirano; Zhang, Feng; Orkin, Stuart H; Winter, Georg E; Bradner, James E

2017-03-09

Recurrent chromosomal translocations producing a chimaeric MLL oncogene give rise to a highly aggressive acute leukaemia associated with poor clinical outcome. The preferential involvement of chromatin-associated factors as MLL fusion partners belies a dependency on transcription control. Despite recent progress made in targeting chromatin regulators in cancer, available therapies for this well-characterized disease remain inadequate, prompting the need to identify new targets for therapeutic intervention. Here, using unbiased CRISPR-Cas9 technology to perform a genome-scale loss-of-function screen in an MLL-AF4-positive acute leukaemia cell line, we identify ENL as an unrecognized gene that is specifically required for proliferation in vitro and in vivo. To explain the mechanistic role of ENL in leukaemia pathogenesis and dynamic transcription control, a chemical genetic strategy was developed to achieve targeted protein degradation. Acute loss of ENL suppressed the initiation and elongation of RNA polymerase II at active genes genome-wide, with pronounced effects at genes featuring a disproportionate ENL load. Notably, an intact YEATS chromatin-reader domain was essential for ENL-dependent leukaemic growth. Overall, these findings identify a dependency factor in acute leukaemia and suggest a mechanistic rationale for disrupting the YEATS domain in disease.

Rapid Construction of Stable Infectious Full-Length cDNA Clone of Papaya Leaf Distortion Mosaic Virus Using In-Fusion Cloning

PubMed Central

Tuo, Decai; Shen, Wentao; Yan, Pu; Li, Xiaoying; Zhou, Peng

2015-01-01

Papaya leaf distortion mosaic virus (PLDMV) is becoming a threat to papaya and transgenic papaya resistant to the related pathogen, papaya ringspot virus (PRSV). The generation of infectious viral clones is an essential step for reverse-genetics studies of viral gene function and cross-protection. In this study, a sequence- and ligation-independent cloning system, the In-Fusion® Cloning Kit (Clontech, Mountain View, CA, USA), was used to construct intron-less or intron-containing full-length cDNA clones of the isolate PLDMV-DF, with the simultaneous scarless assembly of multiple viral and intron fragments into a plasmid vector in a single reaction. The intron-containing full-length cDNA clone of PLDMV-DF was stably propagated in Escherichia coli. In vitro intron-containing transcripts were processed and spliced into biologically active intron-less transcripts following mechanical inoculation and then initiated systemic infections in Carica papaya L. seedlings, which developed similar symptoms to those caused by the wild-type virus. However, no infectivity was detected when the plants were inoculated with RNA transcripts from the intron-less construct because the instability of the viral cDNA clone in bacterial cells caused a non-sense or deletion mutation of the genomic sequence of PLDMV-DF. To our knowledge, this is the first report of the construction of an infectious full-length cDNA clone of PLDMV and the splicing of intron-containing transcripts following mechanical inoculation. In-Fusion cloning shortens the construction time from months to days. Therefore, it is a faster, more flexible, and more efficient method than the traditional multistep restriction enzyme-mediated subcloning procedure. PMID:26633465

Rapid Construction of Stable Infectious Full-Length cDNA Clone of Papaya Leaf Distortion Mosaic Virus Using In-Fusion Cloning.

PubMed

Tuo, Decai; Shen, Wentao; Yan, Pu; Li, Xiaoying; Zhou, Peng

2015-12-01

Papaya leaf distortion mosaic virus (PLDMV) is becoming a threat to papaya and transgenic papaya resistant to the related pathogen, papaya ringspot virus (PRSV). The generation of infectious viral clones is an essential step for reverse-genetics studies of viral gene function and cross-protection. In this study, a sequence- and ligation-independent cloning system, the In-Fusion(®) Cloning Kit (Clontech, Mountain View, CA, USA), was used to construct intron-less or intron-containing full-length cDNA clones of the isolate PLDMV-DF, with the simultaneous scarless assembly of multiple viral and intron fragments into a plasmid vector in a single reaction. The intron-containing full-length cDNA clone of PLDMV-DF was stably propagated in Escherichia coli. In vitro intron-containing transcripts were processed and spliced into biologically active intron-less transcripts following mechanical inoculation and then initiated systemic infections in Carica papaya L. seedlings, which developed similar symptoms to those caused by the wild-type virus. However, no infectivity was detected when the plants were inoculated with RNA transcripts from the intron-less construct because the instability of the viral cDNA clone in bacterial cells caused a non-sense or deletion mutation of the genomic sequence of PLDMV-DF. To our knowledge, this is the first report of the construction of an infectious full-length cDNA clone of PLDMV and the splicing of intron-containing transcripts following mechanical inoculation. In-Fusion cloning shortens the construction time from months to days. Therefore, it is a faster, more flexible, and more efficient method than the traditional multistep restriction enzyme-mediated subcloning procedure.

The venom gland transcriptome of the Desert Massasauga Rattlesnake (Sistrurus catenatus edwardsii): towards an understanding of venom composition among advanced snakes (Superfamily Colubroidea)

PubMed Central

Pahari, Susanta; Mackessy, Stephen P; Kini, R Manjunatha

2007-01-01

Background Snake venoms are complex mixtures of pharmacologically active proteins and peptides which belong to a small number of superfamilies. Global cataloguing of the venom transcriptome facilitates the identification of new families of toxins as well as helps in understanding the evolution of venom proteomes. Results We have constructed a cDNA library of the venom gland of a threatened rattlesnake (a pitviper), Sistrurus catenatus edwardsii (Desert Massasauga), and sequenced 576 ESTs. Our results demonstrate a high abundance of serine proteinase and metalloproteinase transcripts, indicating that the disruption of hemostasis is a principle mechanism of action of the venom. In addition to the transcripts encoding common venom proteins, we detected two varieties of low abundance unique transcripts in the library; these encode for three-finger toxins and a novel toxin possibly generated from the fusion of two genes. We also observed polyadenylated ribosomal RNAs in the venom gland library, an interesting preliminary obsevation of this unusual phenomenon in a reptilian system. Conclusion The three-finger toxins are characteristic of most elapid venoms but are rare in viperid venoms. We detected several ESTs encoding this group of toxins in this study. We also observed the presence of a transcript encoding a fused protein of two well-characterized toxins (Kunitz/BPTI and Waprins), and this is the first report of this kind of fusion in a snake toxin transcriptome. We propose that these new venom proteins may have ancillary functions for envenomation. The presence of a fused toxin indicates that in addition to gene duplication and accelerated evolution, exon shuffling or transcriptional splicing may also contribute to generating the diversity of toxins and toxin isoforms observed among snake venoms. The detection of low abundance toxins, as observed in this and other studies, indicates a greater compositional similarity of venoms (though potency will differ) among advanced snakes than has been previously recognized. PMID:18096037

Stressing Escherichia coli to educate students about research: A CURE to investigate multiple levels of gene regulation.

PubMed

McDonough, Janet; Goudsouzian, Lara K; Papaj, Agllai; Maceli, Ashley R; Klepac-Ceraj, Vanja; Peterson, Celeste N

2017-09-01

Course-based undergraduate research experiences (CUREs) have been shown to increase student retention and learning in the biological sciences. Most CURES cover only one aspect of gene regulation, such as transcriptional control. Here we present a new inquiry-based lab that engages understanding of gene expression from multiple perspectives. Students carry out a forward genetic screen to identify regulators of the stationary phase master regulator RpoS in the model organism Escherichia coli and then use a series of reporter fusions to determine if the regulation is at the level of transcription or the post-transcription level. This easy-to-implement course has been run both as a 9-week long project and a condensed 5-6 week version in three different schools and types of courses. A majority of the genes found in the screen are novel, thus giving students the opportunity to contribute to original findings to the field. Assessments of this CURE show student gains in learning in many knowledge areas. In addition, attitudinal surveys suggest the students are enthusiastic about the screen and their learning about gene regulation. In summary, this lab would be an appropriate addition to an intermediate or advanced level Molecular Biology, Genetics, or Microbiology curriculum. © 2017 by The International Union of Biochemistry and Molecular Biology, 45(5):449-458, 2017. © 2017 The International Union of Biochemistry and Molecular Biology.

A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes.

PubMed

Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos

2015-07-01

The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA-  mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA-  mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA-  mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.

The recX gene product is involved in the SOS response in Herbaspirillum seropedicae.

PubMed

Galvão, Carolina W; Pedrosa, Fábio O; Souza, Emanuel M; Yates, M Geoffrey; Chubatsu, Leda S; Steffens, Maria Berenice R

2003-02-01

The recA and the recX genes of Herbaspirillum seropedicae were sequenced. The recX is located 359 bp downstream from recA. Sequence analysis indicated the presence of a putative operator site overlapping a probable sigma70-dependent promoter upstream of recA and a transcription terminator downstream from recX, with no apparent promoter sequence in the intergenic region. Transcriptional analysis using lacZ promoter fusions indicated that recA expression increased three- to fourfold in the presence of methyl methanesulfonate (MMS). The roles of recA and recX genes in the SOS response were determined from studies of chromosomal mutants. The recA mutant showed the highest sensitivity to MMS and UV, and the recX mutant had an intermediate sensitivity, compared with the wild type (SMR1), confirming the essential role of the RecA protein in cell viability in the presence of mutagenic agents and also indicating a role for RecX in the SOS response.

Isoform Sequencing and State-of-Art Applications for Unravelling Complexity of Plant Transcriptomes

PubMed Central

An, Dong; Li, Changsheng; Humbeck, Klaus

2018-01-01

Single-molecule real-time (SMRT) sequencing developed by PacBio, also called third-generation sequencing (TGS), offers longer reads than the second-generation sequencing (SGS). Given its ability to obtain full-length transcripts without assembly, isoform sequencing (Iso-Seq) of transcriptomes by PacBio is advantageous for genome annotation, identification of novel genes and isoforms, as well as the discovery of long non-coding RNA (lncRNA). In addition, Iso-Seq gives access to the direct detection of alternative splicing, alternative polyadenylation (APA), gene fusion, and DNA modifications. Such applications of Iso-Seq facilitate the understanding of gene structure, post-transcriptional regulatory networks, and subsequently proteomic diversity. In this review, we summarize its applications in plant transcriptome study, specifically pointing out challenges associated with each step in the experimental design and highlight the development of bioinformatic pipelines. We aim to provide the community with an integrative overview and a comprehensive guidance to Iso-Seq, and thus to promote its applications in plant research. PMID:29346292

Xp11.2 translocation renal cell carcinoma with NONO-TFE3 gene fusion: morphology, prognosis, and potential pitfall in detecting TFE3 gene rearrangement.

PubMed

Xia, Qiu-Yuan; Wang, Zhe; Chen, Ni; Gan, Hua-Lei; Teng, Xiao-Dong; Shi, Shan-Shan; Wang, Xuan; Wei, Xue; Ye, Sheng-Bing; Li, Rui; Ma, Heng-Hui; Lu, Zhen-Feng; Zhou, Xiao-Jun; Rao, Qiu

2017-03-01

Xp11 translocation renal cell carcinomas are characterized by several different translocations involving the TFE3 gene. Tumors with different specific gene fusions may have different clinicopathological manifestations. Fewer than 10 renal cell carcinoma cases with NONO-TFE3 have been described. Here we examined eight additional cases of this rare tumor using clinicopathological, immunohistochemical, and molecular analyses. The male-to-female ratio of our study cohort was 1:1, and the median age was 30 years. The most distinctive feature of the tumors was that they exhibited glandular/tubular or papillary architecture that was lined with small-to-medium cuboidal to high columnar cells with indistinct cell borders and an abundantly clear or flocculent eosinophilic cytoplasm. The nuclei were oriented toward the luminal surface and were round and uniform in shape, which resulted in the appearance of secretory endometrioid subnuclear vacuolization. The distinct glandular/tubular or papillary architecture was often accompanied by sheets of epithelial cells that presented a biphasic pattern. Immunohistochemically, all eight cases demonstrated moderate (2+) or strong (3+) positive staining for TFE3, CD10, RCC marker, and PAX-8. None of the tumors were immunoreactive for CK7, Cathepsin K, Melan-A, HMB45, Ksp-cadherin, Vimentin, CA9, 34βE12 or CD117. NONO-TFE3 fusion transcripts were identified in six cases by RT-PCR. All eight cases showed equivocal split signals with a distance of nearly 2 signal diameters and sometimes had false-negative results. Furthermore, we developed a fluorescence in situ hybridization (FISH) assay to serve as an adjunct diagnostic tool for the detection of the NONO-TFE3 fusion gene and used this method to detect the fusion gene in all eight cases. Long-term follow-up (range, 10-102 months) was available for 7 patients. All 7 patients were alive with no evidence of recurrent disease or disease progression after their initial resection. This report adds to the known data regarding NONO-TFE3 renal cell carcinoma.

Expression of multidrug resistance efflux pump gene norA is iron responsive in Staphylococcus aureus.

PubMed

Deng, Xin; Sun, Fei; Ji, Quanjiang; Liang, Haihua; Missiakas, Dominique; Lan, Lefu; He, Chuan

2012-04-01

Staphylococcus aureus utilizes efflux transporter NorA to pump out a wide range of structurally dissimilar drugs, conferring low-level multidrug resistance. The regulation of norA expression has yet to be fully understood although past studies have revealed that this gene is under the control of the global transcriptional regulator MgrA and the two-component system ArlRS. To identify additional regulators of norA, we screened a transposon library in strain Newman expressing the transcriptional fusion norA-lacZ for altered β-galactosidase activity. We identify a transposon insertion in fhuB, a gene that encodes a ferric hydroxamate uptake system permease, and propose that the norA transcription is iron responsive. In agreement with this observation, addition of FeCl(3) repressed the induction of norA-lacZ, suggesting that bacterial iron uptake plays an important role in regulating norA transcription. In addition, a fur (ferric uptake regulator) deletion exhibited compromised norA transcription and reduced resistance to quinolone compared to the wild-type strain, indicating that fur functions as a positive regulator of norA. A putative Fur box identified in the promoter region of norA was confirmed by electrophoretic mobility shift and DNase I footprint assays. Finally, by employing a siderophore secretion assay, we reveal that NorA may contribute to the export of siderophores. Collectively, our experiments uncover some novel interactions between cellular iron level and norA regulation in S. aureus.

Expression of Multidrug Resistance Efflux Pump Gene norA Is Iron Responsive in Staphylococcus aureus

PubMed Central

Deng, Xin; Sun, Fei; Ji, Quanjiang; Liang, Haihua; Missiakas, Dominique; Lan, Lefu

2012-01-01

Staphylococcus aureus utilizes efflux transporter NorA to pump out a wide range of structurally dissimilar drugs, conferring low-level multidrug resistance. The regulation of norA expression has yet to be fully understood although past studies have revealed that this gene is under the control of the global transcriptional regulator MgrA and the two-component system ArlRS. To identify additional regulators of norA, we screened a transposon library in strain Newman expressing the transcriptional fusion norA-lacZ for altered β-galactosidase activity. We identify a transposon insertion in fhuB, a gene that encodes a ferric hydroxamate uptake system permease, and propose that the norA transcription is iron responsive. In agreement with this observation, addition of FeCl3 repressed the induction of norA-lacZ, suggesting that bacterial iron uptake plays an important role in regulating norA transcription. In addition, a fur (ferric uptake regulator) deletion exhibited compromised norA transcription and reduced resistance to quinolone compared to the wild-type strain, indicating that fur functions as a positive regulator of norA. A putative Fur box identified in the promoter region of norA was confirmed by electrophoretic mobility shift and DNase I footprint assays. Finally, by employing a siderophore secretion assay, we reveal that NorA may contribute to the export of siderophores. Collectively, our experiments uncover some novel interactions between cellular iron level and norA regulation in S. aureus. PMID:22267518

Compositions and methods for detecting gene rearrangements and translocations

DOEpatents

Rowley, Janet D.; Diaz, Manuel O.

2000-01-01

Disclosed is a series of nucleic acid probes for use in diagnosing and monitoring certain types of leukemia using, e.g., Southern and Northern blot analyses and fluorescence in situ hybridization (FISH). These probes detect rearrangements, such as translocations involving chromosome band 11q23 with other chromosomes bands, including 4q21, 6q27, 9p22, 19p13.3, in both dividing leukemic cells and interphase nuclei. The breakpoints in all such translocations are clustered within an 8.3 kb BamHI genomic region of the MLL gene. A novel 0.7 kb BamH1 cDNA fragment derived from this gene detects rearrangements on Southern blot analysis with a single BamHI restriction digest in all patients with the common 11q23 translocations and in patients with other 11q23 anomalies. Northern blot analyses are presented demonstrating that the MLL gene has multiple transcripts and that transcript size differentiates leukemic cells from normal cells. Also disclosed are MLL fusion proteins, MLL protein domains and anti-MLL antibodies.

ETO2-GLIS2 Hijacks Transcriptional Complexes to Drive Cellular Identity and Self-Renewal in Pediatric Acute Megakaryoblastic Leukemia.

PubMed

Thirant, Cécile; Ignacimouttou, Cathy; Lopez, Cécile K; Diop, M'Boyba; Le Mouël, Lou; Thiollier, Clarisse; Siret, Aurélie; Dessen, Phillipe; Aid, Zakia; Rivière, Julie; Rameau, Philippe; Lefebvre, Céline; Khaled, Mehdi; Leverger, Guy; Ballerini, Paola; Petit, Arnaud; Raslova, Hana; Carmichael, Catherine L; Kile, Benjamin T; Soler, Eric; Crispino, John D; Wichmann, Christian; Pflumio, Françoise; Schwaller, Jürg; Vainchenker, William; Lobry, Camille; Droin, Nathalie; Bernard, Olivier A; Malinge, Sébastien; Mercher, Thomas

2017-03-13

Chimeric transcription factors are a hallmark of human leukemia, but the molecular mechanisms by which they block differentiation and promote aberrant self-renewal remain unclear. Here, we demonstrate that the ETO2-GLIS2 fusion oncoprotein, which is found in aggressive acute megakaryoblastic leukemia, confers megakaryocytic identity via the GLIS2 moiety while both ETO2 and GLIS2 domains are required to drive increased self-renewal properties. ETO2-GLIS2 directly binds DNA to control transcription of associated genes by upregulation of expression and interaction with the ETS-related ERG protein at enhancer elements. Importantly, specific interference with ETO2-GLIS2 oligomerization reverses the transcriptional activation at enhancers and promotes megakaryocytic differentiation, providing a relevant interface to target in this poor-prognosis pediatric leukemia. Copyright © 2017 Elsevier Inc. All rights reserved.

Aberrantly activated AREG-EGFR signaling is required for the growth and survival of CRTC1-MAML2 fusion-positive mucoepidermoid carcinoma cells.

PubMed

Chen, Z; Chen, J; Gu, Y; Hu, C; Li, J-L; Lin, S; Shen, H; Cao, C; Gao, R; Li, J; Ha, P K; Kaye, F J; Griffin, J D; Wu, L

2014-07-17

Salivary gland tumors (SGT) are a group of highly heterogeneous head and neck malignancies with widely varied clinical outcomes and no standard effective treatments. The CRTC1-MAML2 fusion oncogene, encoded by a recurring chromosomal translocation t(11;19)(q14-21;p12-13), is a frequent genetic alteration found in >50% of mucoepidermoid carcinomas (MEC), the most common malignant SGT. In this study, we aimed to define the role of the CRTC1-MAML2 oncogene in the maintenance of MEC tumor growth and to investigate critical downstream target genes and pathways for therapeutic targeting of MEC. By performing gene expression analyses and functional studies via RNA interference and pharmacological modulation, we determined the importance of the CRTC1-MAML2 fusion gene and its downstream AREG-EGFR signaling in human MEC cancer cell growth and survival in vitro and in vivo using human MEC xenograft models. We found that CRTC1-MAML2 fusion oncogene was required for the growth and survival of fusion-positive human MEC cancer cells in vitro and in vivo. The CRTC1-MAML2 oncoprotein induced the upregulation of the epidermal growth factor receptor (EGFR) ligand Amphiregulin (AREG) by co-activating the transcription factor CREB, and AREG subsequently activated EGFR signaling in an autocrine manner that promoted MEC cell growth and survival. Importantly, CRTC1-MAML2-positive MEC cells were highly sensitive to EGFR signaling inhibition. Therefore, our study revealed that aberrantly activated AREG-EGFR signaling is required for CRTC1-MAML2-positive MEC cell growth and survival, suggesting that EGFR-targeted therapies will benefit patients with advanced, unresectable CRTC1-MAML2-positive MEC.

Bacillus subtilis IolQ (DegA) is a transcriptional repressor of iolX encoding NAD+-dependent scyllo-inositol dehydrogenase.

PubMed

Kang, Dong-Min; Michon, Christophe; Morinaga, Tetsuro; Tanaka, Kosei; Takenaka, Shinji; Ishikawa, Shu; Yoshida, Ken-Ichi

2017-07-11

Bacillus subtilis is able to utilize at least three inositol stereoisomers as carbon sources, myo-, scyllo-, and D-chiro-inositol (MI, SI, and DCI, respectively). NAD + -dependent SI dehydrogenase responsible for SI catabolism is encoded by iolX. Even in the absence of functional iolX, the presence of SI or MI in the growth medium was found to induce the transcription of iolX through an unknown mechanism. Immediately upstream of iolX, there is an operon that encodes two genes, yisR and iolQ (formerly known as degA), each of which could encode a transcriptional regulator. Here we performed an inactivation analysis of yisR and iolQ and found that iolQ encodes a repressor of the iolX transcription. The coding sequence of iolQ was expressed in Escherichia coli and the gene product was purified as a His-tagged fusion protein, which bound to two sites within the iolX promoter region in vitro. IolQ is a transcriptional repressor of iolX. Genetic evidences allowed us to speculate that SI and MI might possibly be the intracellular inducers, however they failed to antagonize DNA binding of IolQ in in vitro experiments.

Transcriptional regulation of fatty acid biosynthesis in mycobacteria

PubMed Central

Mondino, S.; Gago, G.; Gramajo, H.

2013-01-01

SUMMARY The main purpose of our study is to understand how mycobacteria exert control over the biosynthesis of their membrane lipids and find out the key components of the regulatory network that control fatty acid biosynthesis at the transcriptional level. In this paper we describe the identification and purification of FasR, a transcriptional regulator from Mycobacterium sp. that controls the expression of the fatty acid synthase (fas) and the 4-phosphopantetheinyl transferase (acpS) encoding genes, whose products are involved in the fatty acid and mycolic acid biosynthesis pathways. In vitro studies demonstrated that fas and acpS genes are part of the same transcriptional unit and that FasR specifically binds to three conserved operator sequences present in the fas-acpS promoter region (Pfas). The construction and further characterization of a fasR conditional mutant confirmed that FasR is a transcriptional activator of the fas-acpS operon and that this protein is essential for mycobacteria viability. Furthermore, the combined used of Pfas-lacZ fusions in different fasR backgrounds and electrophoretic mobility shift assays experiments, strongly suggested that long-chain acyl-CoAs are the effector molecules that modulate the affinity of FasR for its DNA binding sequences and therefore the expression of the essential fas-acpS operon. PMID:23721164

Members of the LATERAL ORGAN BOUNDARIES DOMAIN Transcription Factor Family Are Involved in the Regulation of Secondary Growth in Populus[W

PubMed Central

Yordanov, Yordan S.; Regan, Sharon; Busov, Victor

2010-01-01

Regulation of secondary (woody) growth is of substantial economic and environmental interest but is poorly understood. We identified and subsequently characterized an activation-tagged poplar (Populus tremula × Populus alba) mutant with enhanced woody growth and changes in bark texture caused primarily by increased secondary phloem production. Molecular characterization of the mutation through positioning of the tag and retransformation experiments shows that the phenotype is conditioned by activation of an uncharacterized gene that encodes a novel member of the LATERAL ORGAN BOUNDARIES DOMAIN (LBD) family of transcription factors. Homology analysis showed highest similarity to an uncharacterized LBD1 gene from Arabidopsis thaliana, and we consequently named it Populus tremula × Populus alba (Pta) LBD1. Dominant-negative suppression of Pta LBD1 via translational fusion with the repressor SRDX domain caused decreased diameter growth and suppressed and highly irregular phloem development. In wild-type plants, LBD1 was most highly expressed in the phloem and cambial zone. Two key Class I KNOTTED1-like homeobox genes that promote meristem identity in the cambium were downregulated, while an Altered Phloem Development gene that is known to promote phloem differentiation was upregulated in the mutant. A set of four LBD genes, including the LBD1 gene, was predominantly expressed in wood-forming tissues, suggesting a broader regulatory role of these transcription factors during secondary woody growth in poplar. PMID:21097711

Osteoclast fusion is initiated by a small subset of RANKL-stimulated monocyte progenitors, which can fuse to RANKL-unstimulated progenitors.

PubMed

Levaot, Noam; Ottolenghi, Aner; Mann, Mati; Guterman-Ram, Gali; Kam, Zvi; Geiger, Benjamin

2015-10-01

Osteoclasts are multinucleated, bone-resorbing cells formed via fusion of monocyte progenitors, a process triggered by prolonged stimulation with RANKL, the osteoclast master regulator cytokine. Monocyte fusion into osteoclasts has been shown to play a key role in bone remodeling and homeostasis; therefore, aberrant fusion may be involved in a variety of bone diseases. Indeed, research in the last decade has led to the discovery of genes regulating osteoclast fusion; yet the basic cellular regulatory mechanism underlying the fusion process is poorly understood. Here, we applied a novel approach for tracking the fusion processes, using live-cell imaging of RANKL-stimulated and non-stimulated progenitor monocytes differentially expressing dsRED or GFP, respectively. We show that osteoclast fusion is initiated by a small (~2.4%) subset of precursors, termed "fusion founders", capable of fusing either with other founders or with non-stimulated progenitors (fusion followers), which alone, are unable to initiate fusion. Careful examination indicates that the fusion between a founder and a follower cell consists of two distinct phases: an initial pairing of the two cells, typically lasting 5-35 min, during which the cells nevertheless maintain their initial morphology; and the fusion event itself. Interestingly, during the initial pre-fusion phase, a transfer of the fluorescent reporter proteins from nucleus to nucleus was noticed, suggesting crosstalk between the founder and follower progenitors via the cytoplasm that might directly affect the fusion process, as well as overall transcriptional regulation in the developing heterokaryon. Copyright © 2015 Elsevier Inc. All rights reserved.

A zebrafish transgenic model of Ewing's sarcoma reveals conserved mediators of EWS-FLI1 tumorigenesis.

PubMed

Leacock, Stefanie W; Basse, Audrey N; Chandler, Garvin L; Kirk, Anne M; Rakheja, Dinesh; Amatruda, James F

2012-01-01

Ewing's sarcoma, a malignant bone tumor of children and young adults, is a member of the small-round-blue-cell tumor family. Ewing's sarcoma family tumors (ESFTs), which include peripheral primitive neuroectodermal tumors (PNETs), are characterized by chromosomal translocations that generate fusions between the EWS gene and ETS-family transcription factors, most commonly FLI1. The EWS-FLI1 fusion oncoprotein represents an attractive therapeutic target for treatment of Ewing's sarcoma. The cell of origin of ESFT and the molecular mechanisms by which EWS-FLI1 mediates tumorigenesis remain unknown, and few animal models of Ewing's sarcoma exist. Here, we report the use of zebrafish as a vertebrate model of EWS-FLI1 function and tumorigenesis. Mosaic expression of the human EWS-FLI1 fusion protein in zebrafish caused the development of tumors with histology strongly resembling that of human Ewing's sarcoma. The incidence of tumors increased in a p53 mutant background, suggesting that the p53 pathway suppresses EWS-FLI1-driven tumorigenesis. Gene expression profiling of the zebrafish tumors defined a set of genes that might be regulated by EWS-FLI1, including the zebrafish ortholog of a crucial EWS-FLI1 target gene in humans. Stable zebrafish transgenic lines expressing EWS-FLI1 under the control of the heat-shock promoter exhibit altered embryonic development and defective convergence and extension, suggesting that EWS-FLI1 interacts with conserved developmental pathways. These results indicate that functional targets of EWS-FLI1 that mediate tumorigenesis are conserved from zebrafish to human and provide a novel context in which to study the function of this fusion oncogene.

Recurrence of lung adenocarcinoma after an interval of 15 years revealed by demonstration of the same type of EML4-ALK fusion gene.

PubMed

Tsukamoto, Yoshitane; Kanamori, Kiyonobu; Watanabe, Takahiro; Mikami, Koji; Ieki, Ryuji; Nakano, Takashi; Kajimoto, Kazuyoshi; Hirota, Seiichi

2014-12-01

We carried out an experiment on a 58-year-old man with multiple left lung tumors and swelling of multiple lymph nodes. For clinical staging and therapeutic purposes, bronchoalveolar lavage (BAL) cytology and lung biopsy were performed. The biopsy specimen revealed the left lower lung mass to be immunohistochemically ALK (anaplastic lymphoma kinase)-positive adenocarcinoma. Using the BAL specimen from the left lower lung, EML4 (echinoderm microtubule-associated protein-like 4)-ALK variant 1 fusion gene was detected by reverse transcription-polymerase chain reaction (RT-PCR). His past history showed that he had undergone an operation for lung adenocarcinoma of the right lower lobe 15 years before, and the pathological specimen at that time revealed that the lung adenocarcinoma with pleural invasion and single metastasis of mediastinal lymph node showed a mucinous cribriform pattern and/or signet-ring cell pattern. The typical histology led us to examine the ALK rearrangement in the primary lung cancer and mediastinal metastatic tumor. Immunohistochemistry (IHC) for ALK was positive, and ALK break apart fluorescence in situ hybridization (FISH) showed a positive result. Moreover, RT-PCR using formalin-fixed, paraffin-embedded tissue from the right lung cancer also demonstrated EML4-ALK variant 1 fusion gene. Although there is a possibility that the left lung cancer is de novo one with multiple metastases, detection of the same fusion gene of the very rare EML4-ALK variant 1 in both tumors suggests that the left cancer is a recurrence of the right lung cancer after an interval of 15 years. Copyright © 2014 Elsevier GmbH. All rights reserved.

Reversible effects of oxygen partial pressure on genes associated with placental angiogenesis and differentiation in primary-term cytotrophoblast cell culture.

PubMed

Debiève, F; Depoix, C; Gruson, D; Hubinont, C

2013-09-01

Timely regulated changes in oxygen partial pressure are important for placental formation. Disturbances could be responsible for pregnancy-related diseases like preeclampsia and intrauterine growth restriction. We aimed to (i) determine the effect of oxygen partial pressure on cytotrophoblast differentiation; (ii) measure mRNA expression and protein secretion from genes associated with placental angiogenesis; and (iii) determine the reversibility of these effects at different oxygen partial pressures. Term cytotrophoblasts were incubated at 21% and 2.5% O2 for 96 hr, or were switched between the two oxygen concentrations after 48 hr. Real-time PCR and enzyme-linked immunosorbent assays (ELISAs) were used to evaluate cell fusion and differentiation, measuring transcript levels for those genes involved in cell fusion and placental angiogenesis, including VEGF, PlGF, VEGFR1, sVEGFR1, sENG, INHA, and GCM1. Cytotrophoblasts underwent fusion and differentiation in 2.5% O2 . PlGF expression was inhibited while sVEGFR1 expression increased. VEGF and sENG mRNA expressions increased in 2.5% compared to 21% O2 , but no protein was detected in the cell supernatants. Finally, GCM1 mRNA expression increased during trophoblast differentiation at 21% O2 , but was inhibited at 2.5% O2 . These mRNA expression effects were reversed by returning the cells to 21% O2 . Thus, low-oxygen partial pressure does not inhibit term-cytotrophoblast cell fusion and differentiation in vitro. Lowering the oxygen partial pressure from 21% to 2.5% caused normal-term trophoblasts to reversibly modify their expression of genes associated with placental angiogenesis. This suggests that modifications observed in pregnancy diseases such as preeclampsia or growth retardation are probably due to an extrinsic effect on trophoblasts. Copyright © 2013 Wiley Periodicals, Inc.

The multidrug ABC transporter BmrC/BmrD of Bacillus subtilis is regulated via a ribosome-mediated transcriptional attenuation mechanism

PubMed Central

Reilman, Ewoud; Mars, Ruben A. T.; van Dijl, Jan Maarten; Denham, Emma L.

2014-01-01

Expression of particular drug transporters in response to antibiotic pressure is a critical element in the development of bacterial multidrug resistance, and represents a serious concern for human health. To obtain a better understanding of underlying regulatory mechanisms, we have dissected the transcriptional activation of the ATP-binding cassette (ABC) transporter BmrC/BmrD of the Gram-positive model bacterium Bacillus subtilis. By using promoter-GFP fusions and live cell array technology, we demonstrate a temporally controlled transcriptional activation of the bmrCD genes in response to antibiotics that target protein synthesis. Intriguingly, bmrCD expression only occurs during the late-exponential and stationary growth stages, irrespective of the timing of the antibiotic challenge. We show that this is due to tight transcriptional control by the transition state regulator AbrB. Moreover, our results show that the bmrCD genes are co-transcribed with bmrB (yheJ), a small open reading frame immediately upstream of bmrC that harbors three alternative stem-loop structures. These stem-loops are apparently crucial for antibiotic-induced bmrCD transcription. Importantly, the antibiotic-induced bmrCD expression requires translation of bmrB, which implies that BmrB serves as a regulatory leader peptide. Altogether, we demonstrate for the first time that a ribosome-mediated transcriptional attenuation mechanism can control the expression of a multidrug ABC transporter. PMID:25217586

RET fusion as a novel driver of medullary thyroid carcinoma.

PubMed

Grubbs, Elizabeth G; Ng, Patrick Kwok-Shing; Bui, Jacquelin; Busaidy, Naifa L; Chen, Ken; Lee, Jeffrey E; Lu, Xinyan; Lu, Hengyu; Meric-Bernstam, Funda; Mills, Gordon B; Palmer, Gary; Perrier, Nancy D; Scott, Kenneth L; Shaw, Kenna R; Waguespack, Steven G; Williams, Michelle D; Yelensky, Roman; Cote, Gilbert J

2015-03-01

Oncogenic RET tyrosine kinase gene fusions and activating mutations have recently been identified in lung cancers, prompting initiation of targeted therapy trials in this disease. Although RET point mutation has been identified as a driver of tumorigenesis in medullary thyroid carcinoma (MTC), no fusions have been described to date. We evaluated the role of RET fusion as an oncogenic driver in MTC. We describe a patient who died from aggressive sporadic MTC < 10 months after diagnosis. Her tumor was evaluated by means of next-generation sequencing, including an intronic capture strategy. A reciprocal translocation involving RET intron 12 was identified. The fusion was validated using a targeted break apart fluorescence in situ hybridization probe, and RNA sequencing confirmed the existence of an in-frame fusion transcript joining MYH13 exon 35 with RET exon 12. Ectopic expression of fusion product in a murine Ba/F3 cell reporter model established strong oncogenicity. Three tyrosine kinase inhibitors currently used to treat MTC in clinical practice blocked tumorigenic cell growth. This finding represents the report of a novel RET fusion, the first of its kind described in MTC. The finding of this potential novel oncogenic mechanism has clear implications for sporadic MTC, which in the majority of cases has no driver mutation identified. The presence of a RET fusion also provides a plausible target for RET tyrosine kinase inhibitor therapies.

Regulation of Benzoate Degradation in Acinetobacter sp. Strain ADP1 by BenM, a LysR-Type Transcriptional Activator

PubMed Central

Collier, Lauren S.; Gaines, George L.; Neidle, Ellen L.

1998-01-01

In Acinetobacter sp. strain ADP1, benzoate degradation requires the ben genes for converting benzoate to catechol and the cat genes for degrading catechol. Here we describe a novel transcriptional activator, BenM, that regulates the chromosomal ben and cat genes. BenM is homologous to CatM, a LysR-type transcriptional activator of the cat genes. Unusual regulatory features of this system include the abilities of both BenM and CatM to recognize the same inducer, cis,cis-muconate, and to regulate some of the same genes, such as catA and catB. Unlike CatM, BenM responded to benzoate. Benzoate together with cis,cis-muconate increased the BenM-dependent expression of the benABCDE operon synergistically. CatM was not required for this synergism, nor did CatM regulate the expression of a chromosomal benA::lacZ transcriptional fusion. BenM-mediated regulation differs significantly from that of the TOL plasmid-encoded conversion of benzoate to catechol in pseudomonads. The benM gene is immediately upstream of, and divergently transcribed from, benA, and a possible DNA binding site for BenM was identified between the two coding regions. Two mutations in the predicted operator/promoter region rendered ben gene expression either constitutive or inducible by cis,cis-muconate but not benzoate. Mutants lacking BenM, CatM, or both of these regulators degraded aromatic compounds at different rates, and the levels of intermediary metabolites that accumulated depended on the genetic background. These studies indicated that BenM is necessary for ben gene expression but not for expression of the cat genes, which can be regulated by CatM. In a catM-disrupted strain, BenM was able to induce higher levels of catA expression than catB expression. PMID:9573203

Regulation of the CgPdr1 Transcription Factor from the Pathogen Candida glabrata ▿

PubMed Central

Paul, Sanjoy; Schmidt, Jennifer A.; Moye-Rowley, W. Scott

2011-01-01

Candida glabrata is an opportunistic human pathogen that is increasingly associated with candidemia, owing in part to the intrinsic and acquired high tolerance the organism exhibits for the important clinical antifungal drug fluconazole. This elevated fluconazole resistance often develops through gain-of-function mutations in the zinc cluster-containing transcriptional regulator C. glabrata Pdr1 (CgPdr1). CgPdr1 induces the expression of an ATP-binding cassette (ABC) transporter-encoding gene, CgCDR1. Saccharomyces cerevisiae has two CgPdr1 homologues called ScPdr1 and ScPdr3. These factors control the expression of an ABC transporter-encoding gene called ScPDR5, which encodes a homologue of CgCDR1. Loss of the mitochondrial genome (ρ0 cell) or overexpression of the mitochondrial enzyme ScPsd1 induces ScPDR5 expression in a strictly ScPdr3-dependent fashion. ScPdr3 requires the presence of a transcriptional Mediator subunit called Gal11 (Med15) to fully induce ScPDR5 transcription in response to ρ0 signaling. ScPdr1 does not respond to either ρ0 signals or ScPsd1 overproduction. In this study, we employed transcriptional fusions between CgPdr1 target promoters, like CgCDR1, to demonstrate that CgPdr1 stimulates gene expression via binding to elements called pleiotropic drug response elements (PDREs). Deletion mapping and electrophoretic mobility shift assays demonstrated that a single PDRE in the CgCDR1 promoter was capable of supporting ρ0-induced gene expression. Removal of one of the two ScGal11 homologues from C. glabrata caused a major defect in drug-induced expression of CgCDR1 but had a quantitatively minor effect on ρ0-stimulated transcription. These data demonstrate that CgPdr1 appears to combine features of ScPdr1 and ScPdr3 to produce a transcription factor with chimeric regulatory properties. PMID:21131438

Development of a tightly regulated and highly responsive copper-inducible gene expression system and its application to control of flowering time.

PubMed

Saijo, Takanori; Nagasawa, Akitsu

2014-01-01

A newly developed copper-inducible gene expression system overcame the mixed results reported earlier, worked well both in cultured cells and a whole plant, and enabled to control flowering timing. Copper is one of the essential microelements and is readily taken up by plants. However, to date, it has rarely been used to control the expression of genes of interest, probably due to the inefficiency of the gene expression systems. In this study, we successfully developed a copper-inducible gene expression system that is based on the regulation of the yeast metallothionein gene. This system can be applied in the field and regulated at approximately one-hundredth of the rate used for registered copper-based fungicides. In the presence of copper, a translational fusion of the ACE1 transcription factor with the VP16 activation domain (VP16AD) of herpes simplex virus strongly activated transcription of the GFP gene in transgenic Arabidopsis. Interestingly, insertion of the To71 sequence, a 5'-untranslated region of the 130k/180k gene of tomato mosaic virus, upstream of the GFP gene reduced the basal expression of GFP in the absence of copper to almost negligible levels, even in soil-grown plants that were supplemented with ordinary liquid nutrients. Exposure of plants to 100 μM copper resulted in an over 1,000-fold induction ratio at the transcriptional level of GFP. This induction was copper-specific and dose-dependent with rapid and reversible responses. Using this expression system, we also succeeded in regulating floral transition by copper treatment. These results indicate that our newly developed copper-inducible system can accelerate gene functional analysis in model plants and can be used to generate novel agronomic traits in crop species.

Insertion of part of an intron into the 5[prime] untranslated region of a Caenorhabditis elegans gene converts it into a trans-spliced gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Conrad, R.; Thomas, J.; Spieth, J.

In nematodes, the RNA products of some genes are trans-spliced to a 22-nucleotide spliced leader (SL), while the RNA products of other genes are not. In Caenorhabditis elegans, there are two SLs, Sl1 and SL2, donated by two distinct small nuclear ribonucleoprotein particles in a process functionally quite similar to nuclear intron removal. The authors demonstrate here that it is possible to convert a non-trans-spliced gene into a trans-spliced gene by placement of an intron missing only the 5[prime] splice site into the 5[prime] untranslated region. Stable transgenic strains were isolated expressing a gene in which 69 nucleotides of amore » vit-5 intron, including the 3[prime] splice site, were inserted into the 5[prime] untranslated region of a vit-2/vit-6 fusion gene. The RNA product of this gene was examined by primer extension and PCR amplification. Although the vit-2/vit-6 transgene product is not normally trans-spliced, the majority of transcripts from this altered gene were trans-spliced to SL1. They termed the region of a trans-spliced mRNA precursor between the 5[prime] end and the first 3[prime] splice site an 'outrun'. The results suggest that if a transcript begins with intronlike sequence followed by a 3[prime] splice site, this alone may constitute an outrun and be sufficient to demarcate a transcript as a trans-splice acceptor. These findings leave open the possibility that specific sequences are required to increase the efficiency of trans-splicing.« less

Phosphorylation-regulated Binding of RNA Polymerase II to Fibrous Polymers of Low Complexity Domains

PubMed Central

Xiang, Siheng; Wu, Leeju; Theodoropoulos, Pano; Mirzaei, Hamid; Han, Tina; Xie, Shanhai; Corden, Jeffry L.; McKnight, Steven L.

2014-01-01

SUMMARY The low complexity (LC) domains of the products of the fused in sarcoma (FUS), Ewings sarcoma (EWS) and TAF15 genes are translocated onto a variety of different DNA-binding domains and thereby assist in driving the formation of cancerous cells. In the context of the translocated fusion proteins, these LC sequences function as transcriptional activation domains. Here we show that polymeric fibers formed from these LC domains directly bind the C-terminal domain (CTD) of RNA polymerase II in a manner reversible by phosphorylation of the iterated, heptad repeats of the CTD. Mutational analysis indicates that the degree of binding between the CTD and the LC domain polymers correlates with the strength of transcriptional activation. These studies offer a simple means of conceptualizing how RNA polymerase II is recruited to active genes in its unphosphorylated state, and released for elongation following phosphorylation of the CTD. PMID:24267890

Organization and PprB-dependent control of the Pseudomonas aeruginosa tad Locus, involved in Flp pilus biology.

PubMed

Bernard, Christophe S; Bordi, Christophe; Termine, Elise; Filloux, Alain; de Bentzmann, Sophie

2009-03-01

Bacterial attachment to the substratum involves several cell surface organelles, including various types of pili. The Pseudomonas aeruginosa Tad machine assembles type IVb pili, which are required for adhesion to abiotic surfaces and to eukaryotic cells. Type IVb pili consist of a major subunit, the Flp pilin, processed by the FppA prepilin peptidase. In this study, we investigated the regulatory mechanism of the tad locus. We showed that the flp gene is expressed late in the stationary growth phase in aerobic conditions. We also showed that the tad locus was composed of five independent transcriptional units. We used transcriptional fusions to show that tad gene expression was positively controlled by the PprB response regulator. We subsequently showed that PprB bound to the promoter regions, directly controlling the expression of these genes. We then evaluated the contribution of two genes, tadF and rcpC, to type IVb pilus assembly. The deletion of these two genes had no effect on Flp production, pilus assembly, or Flp-mediated adhesion to abiotic surfaces in our conditions. However, our results suggest that the putative RcpC protein modifies the Flp pilin, thereby promoting Flp-dependent adhesion to eukaryotic cells.

Identification of atypical ATRNL1 insertion to EML4-ALK fusion gene in NSCLC.

PubMed

Robesova, Blanka; Bajerova, Monika; Hausnerova, Jitka; Skrickova, Jana; Tomiskova, Marcela; Dvorakova, Dana

2015-03-01

We herein present a rare case of an EML4-ALK positive patient. A 61-year-old man was diagnosed with locoregional non-small cell lung cancer (NSCLC). No EGFR mutations were detected, and therefore the ALK rearrangement was evaluated using immunohistochemistry (IHC), fluorescence in situ hybridization (FISH) and the reverse transcription PCR (RT-PCR) method for EML4-ALK. All methods showed a positive result and, therefore, the patient was treated with crizotinib with a good therapeutic response. However, a detailed RT-PCR analysis and sequencing revealed an unexpected 138 bp insertion of attractin-like 1 (ATRNL1) gene into the EML4-ALK fusion gene. In our case, the positive therapeutic response suggests that ATRNL1 insertion does not affect EML4-ALK's sensitivity to crizotinib. This case shows great EML4-ALK heterogeneity and also that basic detection methods (IHC, FISH) cannot fully specify ALK rearrangement but in many cases a full specification seems to be important for an effective TKI indication, and sequencing ALK variants might contribute to optimized patient selection. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

A combination HIV reporter virus system for measuring post-entry event efficiency and viral outcome in primary CD4+ T cell subsets.

PubMed

Tilton, Carisa A; Tabler, Caroline O; Lucera, Mark B; Marek, Samantha L; Haqqani, Aiman A; Tilton, John C

2014-01-01

Fusion between the viral membrane of human immunodeficiency virus (HIV) and the host cell marks the end of the HIV entry process and the beginning of a series of post-entry events including uncoating, reverse transcription, integration, and viral gene expression. The efficiency of post-entry events can be modulated by cellular factors including viral restriction factors and can lead to several distinct outcomes: productive, latent, or abortive infection. Understanding host and viral proteins impacting post-entry event efficiency and viral outcome is critical for strategies to reduce HIV infectivity and to optimize transduction of HIV-based gene therapy vectors. Here, we report a combination reporter virus system measuring both membrane fusion and viral promoter-driven gene expression. This system enables precise determination of unstimulated primary CD4+ T cell subsets targeted by HIV, the efficiency of post-entry viral events, and viral outcome and is compatible with high-throughput screening and cell-sorting methods. Copyright © 2013 Elsevier B.V. All rights reserved.

Characterization of fusion genes and the significantly expressed fusion isoforms in breast cancer by hybrid sequencing

PubMed Central

Weirather, Jason L.; Afshar, Pegah Tootoonchi; Clark, Tyson A.; Tseng, Elizabeth; Powers, Linda S.; Underwood, Jason G.; Zabner, Joseph; Korlach, Jonas; Wong, Wing Hung; Au, Kin Fai

2015-01-01

We developed an innovative hybrid sequencing approach, IDP-fusion, to detect fusion genes, determine fusion sites and identify and quantify fusion isoforms. IDP-fusion is the first method to study gene fusion events by integrating Third Generation Sequencing long reads and Second Generation Sequencing short reads. We applied IDP-fusion to PacBio data and Illumina data from the MCF-7 breast cancer cells. Compared with the existing tools, IDP-fusion detects fusion genes at higher precision and a very low false positive rate. The results show that IDP-fusion will be useful for unraveling the complexity of multiple fusion splices and fusion isoforms within tumorigenesis-relevant fusion genes. PMID:26040699

Haematopoietic malignancies caused by dysregulation of a chromatin-binding PHD finger.

PubMed

Wang, Gang G; Song, Jikui; Wang, Zhanxin; Dormann, Holger L; Casadio, Fabio; Li, Haitao; Luo, Jun-Li; Patel, Dinshaw J; Allis, C David

2009-06-11

Histone H3 lysine 4 methylation (H3K4me) has been proposed as a critical component in regulating gene expression, epigenetic states, and cellular identities1. The biological meaning of H3K4me is interpreted by conserved modules including plant homeodomain (PHD) fingers that recognize varied H3K4me states. The dysregulation of PHD fingers has been implicated in several human diseases, including cancers and immune or neurological disorders. Here we report that fusing an H3K4-trimethylation (H3K4me3)-binding PHD finger, such as the carboxy-terminal PHD finger of PHF23 or JARID1A (also known as KDM5A or RBBP2), to a common fusion partner nucleoporin-98 (NUP98) as identified in human leukaemias, generated potent oncoproteins that arrested haematopoietic differentiation and induced acute myeloid leukaemia in murine models. In these processes, a PHD finger that specifically recognizes H3K4me3/2 marks was essential for leukaemogenesis. Mutations in PHD fingers that abrogated H3K4me3 binding also abolished leukaemic transformation. NUP98-PHD fusion prevented the differentiation-associated removal of H3K4me3 at many loci encoding lineage-specific transcription factors (Hox(s), Gata3, Meis1, Eya1 and Pbx1), and enforced their active gene transcription in murine haematopoietic stem/progenitor cells. Mechanistically, NUP98-PHD fusions act as 'chromatin boundary factors', dominating over polycomb-mediated gene silencing to 'lock' developmentally critical loci into an active chromatin state (H3K4me3 with induced histone acetylation), a state that defined leukaemia stem cells. Collectively, our studies represent, to our knowledge, the first report that deregulation of the PHD finger, an 'effector' of specific histone modification, perturbs the epigenetic dynamics on developmentally critical loci, catastrophizes cellular fate decision-making, and even causes oncogenesis during mammalian development.

Alcohol induces synaptotagmin 1 expression in neurons via activation of heat shock factor 1.

PubMed

Varodayan, F P; Pignataro, L; Harrison, N L

2011-10-13

Many synapses within the central nervous system are sensitive to ethanol. Although alcohol is known to affect the probability of neurotransmitter release in specific brain regions, the effects of alcohol on the underlying synaptic vesicle fusion machinery have been little studied. To identify a potential pathway by which ethanol can regulate neurotransmitter release, we investigated the effects of acute alcohol exposure (1-24 h) on the expression of the gene encoding synaptotagmin 1 (Syt1), a synaptic protein that binds calcium to directly trigger vesicle fusion. Syt1 was identified in a microarray screen as a gene that may be sensitive to alcohol and heat shock. We found that Syt1 mRNA and protein expression are rapidly and robustly up-regulated by ethanol in mouse cortical neurons, and that the distribution of Syt1 protein along neuronal processes is also altered. Syt1 mRNA up-regulation is dependent on the activation of the transcription factor heat shock factor 1 (HSF1). The transfection of a constitutively active Hsf1 construct into neurons stimulates Syt1 transcription, while transfection of Hsf1 small interfering RNA (siRNA) or a constitutively inactive Hsf1 construct into neurons attenuates the induction of Syt1 by ethanol. This suggests that the activation of HSF1 can induce Syt1 expression and that this may be a mechanism by which alcohol regulates neurotransmitter release during brief exposures. Further analysis revealed that a subset of the genes encoding the core synaptic vesicle fusion (soluble NSF (N-ethylmaleimide-sensitive factor) attachment protein receptor; SNARE) proteins share this property of induction by ethanol, suggesting that alcohol may trigger a specific coordinated adaptation in synaptic function. This molecular mechanism could explain some of the changes in synaptic function that occur following alcohol administration and may be an important step in the process of neuronal adaptation to alcohol. Copyright © 2011 IBRO. Published by Elsevier Ltd. All rights reserved.

RAP: RNA-Seq Analysis Pipeline, a new cloud-based NGS web application.

PubMed

D'Antonio, Mattia; D'Onorio De Meo, Paolo; Pallocca, Matteo; Picardi, Ernesto; D'Erchia, Anna Maria; Calogero, Raffaele A; Castrignanò, Tiziana; Pesole, Graziano

2015-01-01

The study of RNA has been dramatically improved by the introduction of Next Generation Sequencing platforms allowing massive and cheap sequencing of selected RNA fractions, also providing information on strand orientation (RNA-Seq). The complexity of transcriptomes and of their regulative pathways make RNA-Seq one of most complex field of NGS applications, addressing several aspects of the expression process (e.g. identification and quantification of expressed genes and transcripts, alternative splicing and polyadenylation, fusion genes and trans-splicing, post-transcriptional events, etc.). In order to provide researchers with an effective and friendly resource for analyzing RNA-Seq data, we present here RAP (RNA-Seq Analysis Pipeline), a cloud computing web application implementing a complete but modular analysis workflow. This pipeline integrates both state-of-the-art bioinformatics tools for RNA-Seq analysis and in-house developed scripts to offer to the user a comprehensive strategy for data analysis. RAP is able to perform quality checks (adopting FastQC and NGS QC Toolkit), identify and quantify expressed genes and transcripts (with Tophat, Cufflinks and HTSeq), detect alternative splicing events (using SpliceTrap) and chimeric transcripts (with ChimeraScan). This pipeline is also able to identify splicing junctions and constitutive or alternative polyadenylation sites (implementing custom analysis modules) and call for statistically significant differences in genes and transcripts expression, splicing pattern and polyadenylation site usage (using Cuffdiff2 and DESeq). Through a user friendly web interface, the RAP workflow can be suitably customized by the user and it is automatically executed on our cloud computing environment. This strategy allows to access to bioinformatics tools and computational resources without specific bioinformatics and IT skills. RAP provides a set of tabular and graphical results that can be helpful to browse, filter and export analyzed data, according to the user needs.

Complex regulation of AprA metalloprotease in Pseudomonas fluorescens M114: evidence for the involvement of iron, the ECF sigma factor, PbrA and pseudobactin M114 siderophore.

PubMed

Maunsell, Bláithín; Adams, Claire; O'Gara, Fergal

2006-01-01

In the soil bacterium Pseudomonas fluorescens M114, extracellular proteolytic activity and fluorescent siderophore (pseudobactin M114) production were previously shown to be co-ordinately negatively regulated in response to environmental iron levels. An iron-starvation extracytoplasmic function sigma factor, PbrA, required for the transcription of siderophore biosynthetic genes, was also implicated in M114 protease regulation. The current study centred on the characterization and genetic regulation of the gene(s) responsible for protease production in M114. A serralysin-type metalloprotease gene, aprA, was identified and found to encode the major, if not only, extracellular protease produced by this strain. The expression of aprA and its protein product were found to be subject to complex regulation. Transcription analysis confirmed that PbrA was required for full aprA transcription under low iron conditions, while the ferric uptake regulator, Fur, was implicated in aprA repression under high iron conditions. Interestingly, the iron regulation of AprA was dependent on culture conditions, with PbrA-independent AprA-mediated proteolytic activity observed on skim milk agar supplemented with yeast extract, when supplied with iron or purified pseudobactin M114. These effects were not observed on skim milk agar without yeast extract. PbrA-independent aprA expression was also observed from a truncated transcriptional fusion when grown in sucrose asparagine tryptone broth supplied with iron or purified pseudobactin M114. Thus, experimental evidence suggested that iron mediated its effects via transcriptional activation by PbrA under low iron conditions, while an as-yet-unidentified sigma factor(s) may be required for the PbrA-independent aprA expression and AprA proteolytic activity induced by siderophore and iron.

Detection of EML4-ALK in lung adenocarcinoma using pleural effusion with FISH, IHC, and RT-PCR methods.

PubMed

Liu, Leilei; Zhan, Ping; Zhou, Xiaodie; Song, Yong; Zhou, Xiaojun; Yu, Like; Wang, Jiandong

2015-01-01

Anaplastic lymphoma kinase (ALK) and echinoderm microtubule-associated protein-like 4 (EML4) gene rearrangements occur in approximately 5% of non-small-cell lung cancers (NSCLC), leading to the overexpression of anaplastic lymphoma kinase and predicting a response to the targeted inhibitor, crizotinib. Malignant pleural effusion occurs in most patients with advanced lung cancer, especially adenocarcinoma, and tissue samples are not always available from these patients. We attempted to clarify the feasibility of detecting the EML4-ALK fusion gene in pleural effusion cells using different methods. We obtained 66 samples of pleural effusion from NSCLC patients. The pleural effusion fluid was centrifuged, and the cellular components obtained were formalin fixed and paraffin embedded. The EML4-ALK fusion gene status was determined with fluorescent in situ hybridization (FISH), reverse transcription-polymerase chain reaction (RT-PCR), and immunohistochemistry (IHC). EML4-ALK was detected in three of 66 patient samples (4.5%) with RT-PCR. When the RT-PCR data were used as the standard, one false positive and one false negative samples were identified with IHC; and one false negative sample was identified with FISH. These results suggest that a block of pleural effusion cells can be used to detect the EML4-ALK fusion gene. IHC had good sensitivity, but low specificity. FISH had low sensitivity, but high specificity. RT-PCR is a good candidate method for detecting EML4-ALK in blocks of pleural effusion cells from lung cancer patients.

Evidence for Moonlighting Functions of the θ Subunit of Escherichia coli DNA Polymerase III

PubMed Central

Dietrich, M.; Pedró, L.; García, J.; Pons, M.; Hüttener, M.; Paytubi, S.; Madrid, C.

2014-01-01

The holE gene is an enterobacterial ORFan gene (open reading frame [ORF] with no detectable homology to other ORFs in a database). It encodes the θ subunit of the DNA polymerase III core complex. The precise function of the θ subunit within this complex is not well established, and loss of holE does not result in a noticeable phenotype. Paralogs of holE are also present on many conjugative plasmids and on phage P1 (hot gene). In this study, we provide evidence indicating that θ (HolE) exhibits structural and functional similarities to a family of nucleoid-associated regulatory proteins, the Hha/YdgT-like proteins that are also encoded by enterobacterial ORFan genes. Microarray studies comparing the transcriptional profiles of Escherichia coli holE, hha, and ydgT mutants revealed highly similar expression patterns for strains harboring holE and ydgT alleles. Among the genes differentially regulated in both mutants were genes of the tryptophanase (tna) operon. The tna operon consists of a transcribed leader region, tnaL, and two structural genes, tnaA and tnaB. Further experiments with transcriptional lacZ fusions (tnaL::lacZ and tnaA::lacZ) indicate that HolE and YdgT downregulate expression of the tna operon by possibly increasing the level of Rho-dependent transcription termination at the tna operon's leader region. Thus, for the first time, a regulatory function can be attributed to HolE, in addition to its role as structural component of the DNA polymerase III complex. PMID:24375106

Separate necdin domains bind ARNT2 and HIF1{alpha} and repress transcription

DOE Office of Scientific and Technical Information (OSTI.GOV)

Friedman, Eitan R.; Fan Chenming

2007-11-09

PWS is caused by the loss of expression of a set of maternally imprinted genes including NECDIN (NDN). NDN is expressed in post-mitotic neurons and plays an essential role in PWS as mouse models lacking only the Ndn gene mimic aspects of this disease. Patients haploid for SIM1 develop a PW-like syndrome. Here, we report that NDN directly interacts with ARNT2, a bHLH-PAS protein and dimer partner for SIM1. We also found that NDN can interact with HIF1{alpha}. We showed that NDN can repress transcriptional activation mediated by ARNT2:SIM1 as well as ARNT2:HIF1{alpha}. The N-terminal 115 residues of NDN aremore » sufficient for interaction with the bHLH domains of ARNT2 or HIF1{alpha} but not for transcriptional repression. Using GAL4-NDN fusion proteins, we determined that NDN possesses multiple repression domains. We thus propose that NDN regulates neuronal function and hypoxic response by regulating the activities of the ARNT2:SIM1 and ARNT2:HIF1{alpha} dimers, respectively.« less

A case of PSF-TFE3 gene fusion in Xp11.2 renal cell carcinoma with melanotic features.

PubMed

Zhan, He-Qin; Chen, Hong; Wang, Chao-Fu; Zhu, Xiong-Zeng

2015-03-01

Xp11.2 translocation renal cell carcinoma (Xp11.2 RCC) with PSF-TFE3 gene fusion is a rare neoplasm. Only 22 cases of Xp11.2 RCCs with PSF-TFE3 have been reported to date. We describe an additional case of Xp11.2 RCC with PSF-TFE3 showing melanotic features. Microscopically, the histologic features mimic clear cell renal cell carcinoma. However, the dark-brown pigments were identified and could be demonstrated as melanins. Immunohistochemically, the tumor cells were widely positive for CD10, human melanoma black 45, and TFE3 but negative for cytokeratins, vimentin, Melan-A, microphthalmia-associated transcription factor, smooth muscle actin, and S-100 protein. Genetically, we demonstrated PSF-TFE3 fusion between exon 9 of PSF and exon 5 of TFE3. The patient was free of disease with 50 months of follow-up. The prognosis of this type of tumor requires more cases because of limited number of cases and follow-up period. Xp11.2 RCC with PSF-TFE3 inevitably requires differentiation from other kidney neoplasms. Immunohistochemical and molecular genetic analyses are essential for accurate diagnosis. Copyright © 2015 Elsevier Inc. All rights reserved.

PAX3-FOXO1: Zooming in on an "undruggable" target.

PubMed

Wachtel, Marco; Schäfer, Beat W

2018-06-01

Driver oncogenes are prime targets for therapy in tumors many of which, including leukemias and sarcomas, express recurrent fusion transcription factors. One specific example for such a cancer type is alveolar rhabdomyosarcoma, which is associated in the majority of cases with the fusion protein PAX3-FOXO1. Since fusion transcription factors are challenging targets for development of small molecule inhibitors, indirect inhibitory strategies for this type of oncogenes represent a more promising approach. One can envision strategies at different molecular levels including upstream modifiers and activators, epigenetic and transcriptional co-regulators, and downstream effector targets. In this review, we will discuss the current knowledge regarding potential therapeutic targets that might contribute to indirect interference with PAX3-FOXO1 activity in alveolar rhabdomyosarcoma at the different molecular levels and extrapolate these findings to fusion transcription factors in general. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

CDKN2D-WDFY2 is a cancer-specific fusion gene recurrent in high-grade serous ovarian carcinoma.

PubMed

Kannan, Kalpana; Coarfa, Cristian; Rajapakshe, Kimal; Hawkins, Shannon M; Matzuk, Martin M; Milosavljevic, Aleksandar; Yen, Laising

2014-03-01

Ovarian cancer is the fifth leading cause of cancer death in women. Almost 70% of ovarian cancer deaths are due to the high-grade serous subtype, which is typically detected only after it has metastasized. Characterization of high-grade serous cancer is further complicated by the significant heterogeneity and genome instability displayed by this cancer. Other than mutations in TP53, which is common to many cancers, highly recurrent recombinant events specific to this cancer have yet to be identified. Using high-throughput transcriptome sequencing of seven patient samples combined with experimental validation at DNA, RNA and protein levels, we identified a cancer-specific and inter-chromosomal fusion gene CDKN2D-WDFY2 that occurs at a frequency of 20% among sixty high-grade serous cancer samples but is absent in non-cancerous ovary and fallopian tube samples. This is the most frequent recombinant event identified so far in high-grade serous cancer implying a major cellular lineage in this highly heterogeneous cancer. In addition, the same fusion transcript was also detected in OV-90, an established high-grade serous type cell line. The genomic breakpoint was identified in intron 1 of CDKN2D and intron 2 of WDFY2 in patient tumor, providing direct evidence that this is a fusion gene. The parental gene, CDKN2D, is a cell-cycle modulator that is also involved in DNA repair, while WDFY2 is known to modulate AKT interactions with its substrates. Transfection of cloned fusion construct led to loss of wildtype CDKN2D and wildtype WDFY2 protein expression, and a gain of a short WDFY2 protein isoform that is presumably under the control of the CDKN2D promoter. The expression of short WDFY2 protein in transfected cells appears to alter the PI3K/AKT pathway that is known to play a role in oncogenesis. CDKN2D-WDFY2 fusion could be an important molecular signature for understanding and classifying sub-lineages among heterogeneous high-grade serous ovarian carcinomas.

The class I protein AtTCP15 modulates plant development through a pathway that overlaps with the one affected by CIN-like TCP proteins.

PubMed

Uberti-Manassero, Nora G; Lucero, Leandro E; Viola, Ivana L; Vegetti, Abelardo C; Gonzalez, Daniel H

2012-01-01

The function of the class I TCP transcription factor TCP15 from Arabidopsis thaliana has been studied through the analysis of plants that express a fusion of this protein to the EAR repressor domain. Constitutive expression of TCP15-EAR produces growth arrest at the seedling stage, before leaf emergence. Expression of the repressor fusion from the AtTCP15 promoter produces small plants with leaves whose margins progressively curve upwards, starting from the basal part of the lamina. Leaves contain smaller and less differentiated cells, both on the adaxial and abaxial sides. The abaxial domain is relatively enlarged, with disorganized cells separated by empty spaces. TCP15-EAR also affects the growth of leaf petioles, flower pedicels, and anther filaments. Flowers show reduced elongation of the three outer whorls and altered gynoecia with irregular carpel surfaces and enlarged repla. Ectopic stigma-like structures develop from medial and basal parts of the replum. TCP15-EAR produces an increase in expression of the boundary-specific genes LOB, CUC1, and CUC2. Changes in CUC1 and CUC2 expression can be explained by the existence of lower levels of miR164 in leaves and the repression of IAA3/SHY2 and the SAUR-like gene At1g29460 in leaves and flowers. TCP15 binds to the promoter regions of IAA3/SHY2 and At1g29460, suggesting that these genes may be direct targets of the transcription factor. The results indicate that TCP15 regulates the expression of boundary-specific genes through a pathway that affects auxin homeostasis and partially overlaps with the one modulated by class II CIN-like TCP proteins.

Complete genome sequence of Fer-de-Lance Virus reveals a novel gene in reptilian Paramyxoviruses

USGS Publications Warehouse

Kurath, G.; Batts, W.N.; Ahne, W.; Winton, J.R.

2004-01-01

The complete RNA genome sequence of the archetype reptilian paramyxovirus, Fer-de-Lance virus (FDLV), has been determined. The genome is 15,378 nucleotides in length and consists of seven nonoverlapping genes in the order 3??? N-U-P-M-F-HN-L 5???, coding for the nucleocapsid, unknown, phospho-, matrix, fusion, hemagglutinin-neuraminidase, and large polymerase proteins, respectively. The gene junctions contain highly conserved transcription start and stop signal sequences and tri-nucleotide intergenic regions similar to those of other Paramyxoviridae. The FDLV P gene expression strategy is like that of rubulaviruses, which express the accessory V protein from the primary transcript and edit a portion of the mRNA to encode P and I proteins. There is also an overlapping open reading frame potentially encoding a small basic protein in the P gene. The gene designated U (unknown), encodes a deduced protein of 19.4 kDa that has no counterpart in other paramyxoviruses and has no similarity with sequences in the National Center for Biotechnology Information database. Active transcription of the U gene in infected cells was demonstrated by Northern blot analysis, and bicistronic N-U mRNA was also evident. The genomes of two other snake paramyxovirus genotypes were also found to have U genes, with 11 to 16% nucleotide divergence from the FDLV U gene. Pairwise comparisons of amino acid identities and phylogenetic analyses of all deduced FDLV protein sequences with homologous sequences from other Paramyxoviridae indicate that FDLV represents a new genus within the subfamily Paramyxovirinae. We suggest the name Ferlavirus for the new genus, with FDLV as the type species.

The WRKY transcription factors in the diploid woodland strawberry Fragaria vesca: Identification and expression analysis under biotic and abiotic stresses.

PubMed

Wei, Wei; Hu, Yang; Han, Yong-Tao; Zhang, Kai; Zhao, Feng-Li; Feng, Jia-Yue

2016-08-01

WRKY proteins comprise a large family of transcription factors that play important roles in response to biotic and abiotic stresses and in plant growth and development. To date, little is known about the WRKY gene family in strawberry. In this study, we identified 62 WRKY genes (FvWRKYs) in the wild diploid woodland strawberry (Fragaria vesca, 2n = 2x = 14) accession Heilongjiang-3. According to the phylogenetic analysis and structural features, these identified strawberry FvWRKY genes were classified into three main groups. In addition, eight FvWRKY-GFP fusion proteins showed distinct subcellular localizations in Arabidopsis mesophyll protoplasts. Furthermore, we examined the expression of the 62 FvWRKY genes in 'Heilongjiang-3' under various conditions, including biotic stress (Podosphaera aphanis), abiotic stresses (drought, salt, cold, and heat), and hormone treatments (abscisic acid, ethephon, methyl jasmonate, and salicylic acid). The expression levels of 33 FvWRKY genes were upregulated, while 12 FvWRKY genes were downregulated during powdery mildew infection. FvWRKY genes responded to drought and salt treatment to a greater extent than to temperature stress. Expression profiles derived from quantitative real-time PCR suggested that 11 FvWRKY genes responded dramatically to various stimuli at the transcriptional level, indicating versatile roles in responses to biotic and abiotic stresses. Interaction networks revealed that the crucial pathways controlled by WRKY proteins may be involved in the differential response to biotic stress. Taken together, the present work may provide the basis for future studies of the genetic modification of WRKY genes for pathogen resistance and stress tolerance in strawberry. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Vibrio parahaemolyticus CalR down regulates the thermostable direct hemolysin (TDH) gene transcription and thereby inhibits hemolytic activity.

PubMed

Zhang, Yiquan; Zhang, Ying; Gao, He; Zhang, Lingyu; Yin, Zhe; Huang, Xinxiang; Zhou, Dongsheng; Yang, Huiying; Yang, Wenhui; Wang, Li

2017-05-20

TDH, encoded by tdh gene, is a major virulent determinant of V. parahaemolyticus that controls various biological activities, such as hemolytic activity, cytotoxicity, and enterotoxicity. The hemolytic activity on Wagatsuma agar ascribed to TDH is called Kanagawa phenomenon (KP). All KP positive strains contain tdh1 and tdh2 genes, but tdh2 is predominantly responsible for KP. CalR is a regulatory protein that was originally identified as a repressor of swarming motility and T3SS1 gene expression in V. parahaemolyticus. In the present study, the regulation of tdh2 by CalR was investigated using a set of experiments including qRT-PCR, primer extension, LacZ fusion, hemolytic phenotype, EMSA, and DNase I footprinting assays. The results showed that His-CalR protected a single region from 224bp to 318bp upstream of tdh2 against DNase I digestion, and a transcriptional start site located at 42bp upstream of tdh2 was detected and its transcribed activity was inhibited by CalR. Moreover, the KP test results showed that the hemolytic activity of V. parahaemolyticus is also under negative control of CalR. The data demonstrated that CalR is a repressor of the tdh2 transcription and thereby inhibits the hemolytic activity of V. parahaemolyticus. Copyright © 2017. Published by Elsevier B.V.

Effects of various types of stress on the metabolism of reserve carbohydrates in Saccharomyces cerevisiae: genetic evidence for a stress-induced recycling of glycogen and trehalose.

PubMed

Parrou, J L; Teste, M A; François, J

1997-06-01

It is well known that glycogen and trehalose accumulate in yeast under nutrient starvation or entering into the stationary phase of growth, and that high levels of trehalose are found in heat-shocked cells. However, effects of various types of stress on trehalose, and especially on glycogen, are poorly documented. Taking into account that almost all genes encoding the enzymes involved in the metabolism of these two reserve carbohydrates contain between one and several copies of the stress-responsive element (STRE), an investigation was made of the possibility of a link between the potential transcriptional induction of these genes and the accumulation of glycogen and trehalose under different stress conditions. Using transcriptional fusions, it was found that all these genes were induced in a similar fashion, although to various extents, by temperature, osmotic and oxidative stresses. Experiments performed with an msn2/msn4 double mutant proved that the transcriptional induction of the genes encoding glycogen synthase (GSY2) and trehalose-6-phosphate synthase (TPS1) was needed for the small increase in glycogen and trehalose upon exposure to a mild heat stress and salt shock. However, the extent of transcriptional activation of these genes upon stresses in wild-type strains was not correlated with a proportional rise in either glycogen or trehalose. The major explanation for this lack of correlation comes from the fact that genes encoding the enzymes of the biosynthetic and of the biodegradative pathways were almost equally induced. Hence, trehalose and glycogen accumulated to much higher levels in cells lacking neutral trehalose or glycogen phosphorylase exposed to stress conditions, which suggested that one of the major effects of stress in yeast is to induce a wasteful expenditure of energy by increasing the recycling of these molecules. We also found that transcriptional induction of STRE-controlled genes was abolished at temperatures above 40 degree C, while induction was still observed for a heat-shock-element regulated gene. Remarkably, trehalose accumulated to very high levels under this condition. This can be explained by a stimulation of trehalose synthase and inhibition of trehalose by high temperature.

Identification of in vivo regulators of the Vibrio cholerae xds gene using a high-throughput genetic selection

PubMed Central

McDonough, EmilyKate; Lazinski, David W.; Camilli, Andrew

2014-01-01

Summary Vibrio cholerae, the causative agent of cholera, remains a threat to public health in areas with inadequate sanitation. As a waterborne pathogen, V. cholerae moves between two dissimilar environments, aquatic reservoirs and the intestinal tract of humans. Accordingly, this pathogen undergoes adaptive shifts in gene expression throughout the different stages of its lifecycle. One particular gene, xds, encodes a secreted exonuclease that was previously identified as being induced during infection. Here we sought to identify regulators responsible for the in vivo-specific induction of xds. A transcriptional fusion of xds to two consecutive antibiotic resistance genes was used to select transposon mutants that had inserted within or adjacent to regulatory genes and thereby caused increased expression of the xds fusion under non-inducing conditions. Large pools of selected insertion sites were sequenced in a high throughput manner using Tn-seq to identify potential mechanisms of xds regulation. Our selection identified the two-component system PhoB/R as the dominant activator of xds expression. In vitro validation confirmed that PhoB, a protein which is only active during phosphate limitation, was responsible for xds activation. Using xds expression as a biosensor of the extracellular phosphate level, we observed that the mouse small intestine is a phosphate-limited environment. PMID:24673931

A diagnostic biochip for the comprehensive analysis of MLL translocations in acute leukemia.

PubMed

Maroc, N; Morel, A; Beillard, E; De La Chapelle, A L; Fund, X; Mozziconacci, M-J; Dupont, M; Cayuela, J-M; Gabert, J; Koki, A; Fert, V; Hermitte, F

2004-09-01

Reciprocal rearrangements of the MLL gene are among the most common chromosomal abnormalities in both Acute Lymphoblastic and Myeloid Leukemia. The MLL gene, located on the 11q23 chromosomal band, is involved in more than 40 recurrent translocations. In the present study, we describe the development and validation of a biochip-based assay designed to provide a comprehensive molecular analysis of MLL rearrangements when used in a standard clinical pathology laboratory. A retrospective blind study was run with cell lines (n=5), and MLL positive and negative patient samples (n=31), to evaluate assay performance. The limits of detection determined on cell line data were 10(-1), and the precision studies yielded 100% repeatability and 98% reproducibility. The study shows that the device can detect frequent (AF4, AF6, AF10, ELL or ENL) as well as rare partner genes (AF17, MSF). The identified fusion transcripts can then be used as molecular phenotypic markers of disease for the precise evaluation of minimal residual disease by RQ-PCR. This biochip-based molecular diagnostic tool allows, in a single experiment, rapid and accurate identification of MLL gene rearrangements among 32 different fusion gene (FG) partners, precise breakpoint positioning and comprehensive screening of all currently characterized MLL FGs.

Renal Cell Carcinoma With Chromosome 6p Amplification Including the TFEB Gene: A Novel Mechanism of Tumor Pathogenesis?

PubMed

Williamson, Sean R; Grignon, David J; Cheng, Liang; Favazza, Laura; Gondim, Dibson D; Carskadon, Shannon; Gupta, Nilesh S; Chitale, Dhananjay A; Kalyana-Sundaram, Shanker; Palanisamy, Nallasivam

2017-03-01

Amplification of chromosome 6p has been implicated in aggressive behavior in several cancers, but has not been characterized in renal cell carcinoma (RCC). We identified 9 renal tumors with amplification of chromosome 6p including the TFEB gene, 3 by fluorescence in situ hybridization, and 6 from the Cancer Genome Atlas (TCGA) databases. Patients' ages were 28 to 78 years (median, 61 y). Most tumors were high stage (7/9 pT3a, 2/9 pN1). Using immunohistochemistry, 2/4 were positive for melanocytic markers and cathepsin K. Novel TFEB fusions were reported by TCGA in 2; however, due to a small composition of fusion transcripts compared with full-length transcripts (0.5/174 and 3.3/132 FPKM), we hypothesize that these represent secondary fusions due to amplification. Five specimens (4 TCGA, 1 fluorescence in situ hybridization) had concurrent chromosome 3p copy number loss or VHL deletion. However, these did not resemble clear cell RCC, had negative carbonic anhydrase IX labeling, lacked VHL mutation, and had papillary or unclassified histology (2/4 had gain of chromosome 7 or 17). One tumor each had somatic FH mutation and SMARCB1 mutation. Chromosome 6p amplification including TFEB is a previously unrecognized cytogenetic alteration in RCC, associated with heterogenous tubulopapillary eosinophilic and clear cell histology. The combined constellation of features does not fit cleanly into an existing tumor category (unclassified), most closely resembling papillary or translocation RCC. The tendency for high tumor stage, varied tubulopapillary morphology, and a subset with melanocytic marker positivity suggests the possibility of a unique tumor type, despite some variation in appearance and genetics.

FusionHub: A unified web platform for annotation and visualization of gene fusion events in human cancer.

PubMed

Panigrahi, Priyabrata; Jere, Abhay; Anamika, Krishanpal

2018-01-01

Gene fusion is a chromosomal rearrangement event which plays a significant role in cancer due to the oncogenic potential of the chimeric protein generated through fusions. At present many databases are available in public domain which provides detailed information about known gene fusion events and their functional role. Existing gene fusion detection tools, based on analysis of transcriptomics data usually report a large number of fusion genes as potential candidates, which could be either known or novel or false positives. Manual annotation of these putative genes is indeed time-consuming. We have developed a web platform FusionHub, which acts as integrated search engine interfacing various fusion gene databases and simplifies large scale annotation of fusion genes in a seamless way. In addition, FusionHub provides three ways of visualizing fusion events: circular view, domain architecture view and network view. Design of potential siRNA molecules through ensemble method is another utility integrated in FusionHub that could aid in siRNA-based targeted therapy. FusionHub is freely available at https://fusionhub.persistent.co.in.

Analysis of clock-regulated genes in Neurospora reveals widespread posttranscriptional control of metabolic potential

PubMed Central

Hurley, Jennifer M.; Dasgupta, Arko; Emerson, Jillian M.; Zhou, Xiaoying; Ringelberg, Carol S.; Knabe, Nicole; Lipzen, Anna M.; Lindquist, Erika A.; Daum, Christopher G.; Barry, Kerrie W.; Grigoriev, Igor V.; Smith, Kristina M.; Galagan, James E.; Bell-Pedersen, Deborah; Freitag, Michael; Cheng, Chao; Loros, Jennifer J.; Dunlap, Jay C.

2014-01-01

Neurospora crassa has been for decades a principal model for filamentous fungal genetics and physiology as well as for understanding the mechanism of circadian clocks. Eukaryotic fungal and animal clocks comprise transcription-translation–based feedback loops that control rhythmic transcription of a substantial fraction of these transcriptomes, yielding the changes in protein abundance that mediate circadian regulation of physiology and metabolism: Understanding circadian control of gene expression is key to understanding eukaryotic, including fungal, physiology. Indeed, the isolation of clock-controlled genes (ccgs) was pioneered in Neurospora where circadian output begins with binding of the core circadian transcription factor WCC to a subset of ccg promoters, including those of many transcription factors. High temporal resolution (2-h) sampling over 48 h using RNA sequencing (RNA-Seq) identified circadianly expressed genes in Neurospora, revealing that from ∼10% to as much 40% of the transcriptome can be expressed under circadian control. Functional classifications of these genes revealed strong enrichment in pathways involving metabolism, protein synthesis, and stress responses; in broad terms, daytime metabolic potential favors catabolism, energy production, and precursor assembly, whereas night activities favor biosynthesis of cellular components and growth. Discriminative regular expression motif elicitation (DREME) identified key promoter motifs highly correlated with the temporal regulation of ccgs. Correlations between ccg abundance from RNA-Seq, the degree of ccg-promoter activation as reported by ccg-promoter–luciferase fusions, and binding of WCC as measured by ChIP-Seq, are not strong. Therefore, although circadian activation is critical to ccg rhythmicity, posttranscriptional regulation plays a major role in determining rhythmicity at the mRNA level. PMID:25362047

Functional dissection of the Hox protein Abdominal-B in Drosophila cell culture

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhai, Zongzhao; CellNetworks - Cluster of Excellence, Centre for Organismal Studies; Graduate School of Chinese Academy of Sciences, Beijing 100039

2011-11-04

Highlights: Black-Right-Pointing-Pointer ct340 CRM was identified to be the posterior spiracle enhancer of gene cut. Black-Right-Pointing-Pointer ct340 is under the direct transcriptional control of Hox protein Abd-B. Black-Right-Pointing-Pointer An efficient cloning system was developed to assay protein-DNA interaction. Black-Right-Pointing-Pointer New features of Abd-B dependent target gene regulation were detected. -- Abstract: Hox transcription factors regulate the morphogenesis along the anterior-posterior (A/P) body axis through the interaction with small cis-regulatory modules (CRMs) of their target gene, however so far very few Hox CRMs are known and have been analyzed in detail. In this study we have identified a new Hox CRM,more » ct340, which guides the expression of the cell type specification gene cut (ct) in the posterior spiracle under the direct control of the Hox protein Abdominal-B (Abd-B). Using the ct340 enhancer activity as readout, an efficient cloning system to generate VP16 activation domain fusion protein was developed to unambiguously test protein-DNA interaction in Drosophila cell culture. By functionally dissecting the Abd-B protein, new features of Abd-B dependent target gene regulation were detected. Due to its easy adaptability, this system can be generally used to map functional domains within sequence-specific transcriptional factors in Drosophila cell culture, and thus provide preliminary knowledge of the protein functional domain structure for further in vivo analysis.« less

Molecular characterization of epithelioid haemangioendotheliomas identifies novel WWTR1-CAMTA1 fusion variants.

PubMed

Patel, Nimesh R; Salim, Alaa A; Sayeed, Hadi; Sarabia, Stephen F; Hollingsworth, Faith; Warren, Mikako; Jakacky, Jared; Tanas, Munir; Oliveira, Andre M; Rubin, Brian P; Lazar, Alexander J; López-Terrada, Dolores; Wang, Wei-Lien

2015-11-01

Epithelioid haemangioendothelioma (EHE) is a malignant vascular neoplasm. Subsets have been characterized previously by translocations resulting in either WWTR1-CAMTA1 or YAP1-TFE3 fusion. We sought to develop molecular and immunohistochemical (IHC) assays to aid in the diagnosis and characterization of EHE. Fifty-two formalin-fixed, paraffin-embedded (FFPE) cases diagnosed between 2002 and 2014 were retrieved from the pathology files of our institutions. Reverse transcription-polymerase chain reaction (RT-PCR) assays were optimized to detect WWTR1-CAMTA1 and YAP1-TFE3 fusion transcripts in FFPE tissue and transcription factor E3 (TFE3) protein accumulation was examined by immunohistochemistry (IHC). RNA was extracted from 33 adequate samples, with more recent cases providing a greater yield of high quality RNA. Fourteen of 18 informative cases were positive for WWTR1-CAMTA1 fusion transcripts, four of which showed higher-grade cytological features termed by some as 'malignant EHE'. Novel in-frame fusion transcripts were identified in four cases by direct sequencing. IHC revealed variable nuclear TFE3 staining in six of 17 cases; three with patchy staining showed WWTR1-CAMTA1 fusion. One of 18 informative cases was positive for YAP1-TFE3 fusion and showed strong nuclear TFE3 staining by IHC. This study confirms the high incidence of WWTR1-CAMTA1 and YAP1-TFE3 rearrangements in EHE and indicates that the staining pattern for TFE3 IHC is critical for specificity. © 2015 John Wiley & Sons Ltd.

Characterization of fusion genes and the significantly expressed fusion isoforms in breast cancer by hybrid sequencing.

PubMed

Weirather, Jason L; Afshar, Pegah Tootoonchi; Clark, Tyson A; Tseng, Elizabeth; Powers, Linda S; Underwood, Jason G; Zabner, Joseph; Korlach, Jonas; Wong, Wing Hung; Au, Kin Fai

2015-10-15

We developed an innovative hybrid sequencing approach, IDP-fusion, to detect fusion genes, determine fusion sites and identify and quantify fusion isoforms. IDP-fusion is the first method to study gene fusion events by integrating Third Generation Sequencing long reads and Second Generation Sequencing short reads. We applied IDP-fusion to PacBio data and Illumina data from the MCF-7 breast cancer cells. Compared with the existing tools, IDP-fusion detects fusion genes at higher precision and a very low false positive rate. The results show that IDP-fusion will be useful for unraveling the complexity of multiple fusion splices and fusion isoforms within tumorigenesis-relevant fusion genes. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

ORMAN: optimal resolution of ambiguous RNA-Seq multimappings in the presence of novel isoforms.

PubMed

Dao, Phuong; Numanagić, Ibrahim; Lin, Yen-Yi; Hach, Faraz; Karakoc, Emre; Donmez, Nilgun; Collins, Colin; Eichler, Evan E; Sahinalp, S Cenk

2014-03-01

RNA-Seq technology is promising to uncover many novel alternative splicing events, gene fusions and other variations in RNA transcripts. For an accurate detection and quantification of transcripts, it is important to resolve the mapping ambiguity for those RNA-Seq reads that can be mapped to multiple loci: >17% of the reads from mouse RNA-Seq data and 50% of the reads from some plant RNA-Seq data have multiple mapping loci. In this study, we show how to resolve the mapping ambiguity in the presence of novel transcriptomic events such as exon skipping and novel indels towards accurate downstream analysis. We introduce ORMAN ( O ptimal R esolution of M ultimapping A mbiguity of R N A-Seq Reads), which aims to compute the minimum number of potential transcript products for each gene and to assign each multimapping read to one of these transcripts based on the estimated distribution of the region covering the read. ORMAN achieves this objective through a combinatorial optimization formulation, which is solved through well-known approximation algorithms, integer linear programs and heuristics. On a simulated RNA-Seq dataset including a random subset of transcripts from the UCSC database, the performance of several state-of-the-art methods for identifying and quantifying novel transcripts, such as Cufflinks, IsoLasso and CLIIQ, is significantly improved through the use of ORMAN. Furthermore, in an experiment using real RNA-Seq reads, we show that ORMAN is able to resolve multimapping to produce coverage values that are similar to the original distribution, even in genes with highly non-uniform coverage. ORMAN is available at http://orman.sf.net

A stable transcription factor complex nucleated by oligomeric AML1–ETO controls leukaemogenesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sun, Xiao-Jian; Wang, Zhanxin; Wang, Lan

2013-06-30

Transcription factors are frequently altered in leukaemia through chromosomal translocation, mutation or aberrant expression. AML1–ETO, a fusion protein generated by the t(8;21) translocation in acute myeloid leukaemia, is a transcription factor implicated in both gene repression and activation. AML1–ETO oligomerization, mediated by the NHR2 domain, is critical for leukaemogenesis, making it important to identify co-regulatory factors that ‘read’ the NHR2 oligomerization and contribute to leukaemogenesis. Here we show that, in human leukaemic cells, AML1–ETO resides in and functions through a stable AML1–ETO-containing transcription factor complex (AETFC) that contains several haematopoietic transcription (co)factors. These AETFC components stabilize the complex through multivalentmore » interactions, provide multiple DNA-binding domains for diverse target genes, co-localize genome wide, cooperatively regulate gene expression, and contribute to leukaemogenesis. Within the AETFC complex, AML1–ETO oligomerization is required for a specific interaction between the oligomerized NHR2 domain and a novel NHR2-binding (N2B) motif in E proteins. Crystallographic analysis of the NHR2–N2B complex reveals a unique interaction pattern in which an N2B peptide makes direct contact with side chains of two NHR2 domains as a dimer, providing a novel model of how dimeric/oligomeric transcription factors create a new protein-binding interface through dimerization/oligomerization. Intriguingly, disruption of this interaction by point mutations abrogates AML1–ETO-induced haematopoietic stem/progenitor cell self-renewal and leukaemogenesis. These results reveal new mechanisms of action of AML1–ETO, and provide a potential therapeutic target in t(8;21)-positive acute myeloid leukaemia.« less

CFLAP1 and CFLAP2 Are Two bHLH Transcription Factors Participating in Synergistic Regulation of AtCFL1-Mediated Cuticle Development in Arabidopsis

PubMed Central

Li, Shibai; Wang, Xiaochen; He, Shan; Li, Jieru; Huang, Qingpei; Imaizumi, Takato; Qu, Leqing; Qin, Genji; Qu, Li-Jia; Gu, Hongya

2016-01-01

The cuticle is a hydrophobic lipid layer covering the epidermal cells of terrestrial plants. Although many genes involved in Arabidopsis cuticle development have been identified, the transcriptional regulation of these genes is largely unknown. Previously, we demonstrated that AtCFL1 negatively regulates cuticle development by interacting with the HD-ZIP IV transcription factor HDG1. Here, we report that two bHLH transcription factors, AtCFL1 associated protein 1 (CFLAP1) and CFLAP2, are also involved in AtCFL1-mediated regulation of cuticle development. CFLAP1 and CFLAP2 interact with AtCFL1 both in vitro and in vivo. Overexpression of either CFLAP1 or CFLAP2 led to expressional changes of genes involved in fatty acids, cutin and wax biosynthesis pathways and caused multiple cuticle defective phenotypes such as organ fusion, breakage of the cuticle layer and decreased epicuticular wax crystal loading. Functional inactivation of CFLAP1 and CFLAP2 by chimeric repression technology caused opposite phenotypes to the CFLAP1 overexpressor plants. Interestingly, we find that, similar to the transcription factor HDG1, the function of CFLAP1 in cuticle development is dependent on the presence of AtCFL1. Furthermore, both HDG1 and CFLAP1/2 interact with the same C-terminal C4 zinc finger domain of AtCFL1, a domain that is essential for AtCFL1 function. These results suggest that AtCFL1 may serve as a master regulator in the transcriptional regulation of cuticle development, and that CFLAP1 and CFLAP2 are involved in the AtCFL1-mediated regulation pathway, probably through competing with HDG1 to bind to AtCFL1. PMID:26745719

Translational Repression of NhaR, a Novel Pathway for Multi-Tier Regulation of Biofilm Circuitry by CsrA

PubMed Central

Pannuri, Archana; Yakhnin, Helen; Vakulskas, Christopher A.; Edwards, Adrianne N.; Babitzke, Paul

2012-01-01

The RNA binding protein CsrA (RsmA) represses biofilm formation in several proteobacterial species. In Escherichia coli, it represses the production of the polysaccharide adhesin poly-β-1,6-N-acetyl-d-glucosamine (PGA) by binding to the pgaABCD mRNA leader, inhibiting pgaA translation, and destabilizing this transcript. In addition, CsrA represses genes responsible for the synthesis of cyclic di-GMP, an activator of PGA production. Here we determined that CsrA also represses NhaR, a LysR-type transcriptional regulator which responds to elevated [Na+] and alkaline pH and activates the transcription of the pgaABCD operon. Gel shift studies revealed that CsrA binds at two sites in the 5′ untranslated segment of nhaR, one of which overlaps the Shine-Dalgarno sequence. An epitope-tagged NhaR protein, expressed from the nhaR chromosomal locus, and an nhaR posttranscriptional reporter fusion (PlacUV5-nhaR′-′lacZ) both showed robust repression by CsrA. Northern blotting revealed a complex transcription pattern for the nhaAR locus. Nevertheless, CsrA did not repress nhaR mRNA levels. Toeprinting assays showed that CsrA competes effectively with the ribosome for binding to the translation initiation region of nhaR. Together, these findings indicate that CsrA blocks nhaR translation. Epistasis studies with a pgaA-lacZ transcriptional fusion confirmed a model in which CsrA indirectly represses pgaABCD transcription via NhaR. We conclude that CsrA regulates the horizontally acquired pgaABCD operon and PGA biosynthesis at multiple levels. Furthermore, nhaR repression exemplifies an expanding role for CsrA as a global regulator of stress response systems. PMID:22037401

Ewing-like sarcomas with BCOR-CCNB3 fusion transcript: a clinical, radiological and pathological retrospective study from the Société Française des Cancers de L'Enfant.

PubMed

Cohen-Gogo, Sarah; Cellier, Cécile; Coindre, Jean-Michel; Mosseri, Véronique; Pierron, Gaëlle; Guillemet, Cécile; Italiano, Antoine; Brugières, Laurence; Orbach, Daniel; Laurence, Valérie; Delattre, Olivier; Michon, Jean

2014-12-01

This retrospective multicenter study assessed the clinical, radiological and pathological presentation, treatment and outcome of 26 patients with Ewing-like sarcoma harboring BCOR-CCNB3 gene fusion transcript. Tumor samples had been collected between 1994 and April 2012. Eligibility criteria included assessment of a BCOR-CCNB3 transcript-positive tumor after molecular analysis and availability of minimal clinical and pathological data. Radiological data were also retrieved when possible. Data were analyzed by descriptive statistics and methods for survival analysis. Median age at diagnosis was 13.1 years (5.9 to 25.6 years). Most patients (24/26) had localized tumors. All tumors but five were localized to bone. CCNB3 immunochemistry showed strong nuclear staining on all samples. No specific radiological features were found. Most patients received chemotherapy (15 according to protocols designed for Ewing tumors), before and/or after local treatment (surgery and/or radiotherapy, with 46.2% receiving both). Local and metastatic relapses were of poor prognosis. Induction chemotherapy and treatment according to an Ewing protocol might influence survival for patients with localized tumors. Sixteen patients are alive in complete remission with a median follow-up of 86 months. Five year overall survival and disease-free survival were respectively 76.5% (95% CI, 58%-95%) and 67.9% (95% CI, 48%-88%). BCOR-CCNB3 transcript-positive Ewing-like sarcoma diagnosis should be discussed for a transcript-negative small round cell sarcoma in a child, adolescent or young adult patient. Diagnosis needs to be stated through CCNB3 immunochemistry or transcript identification. The exquisite chemosensitivity of these tumors should encourage the use of polychemotherapy for appropriate care, associated with best local tumor control. © 2014 Wiley Periodicals, Inc.

Identification of a STOP1-like protein in Eucalyptus that regulates transcription of Al tolerance genes.

PubMed

Sawaki, Yoshiharu; Kobayashi, Yuriko; Kihara-Doi, Tomonori; Nishikubo, Nobuyuki; Kawazu, Tetsu; Kobayashi, Masatomo; Kobayashi, Yasufumi; Iuchi, Satoshi; Koyama, Hiroyuki; Sato, Shigeru

2014-06-01

Tolerance to soil acidity is an important trait for eucalyptus clones that are introduced to commercial forestry plantations in pacific Asian countries, where acidic soil is dominant in many locations. A conserved transcription factor regulating aluminum (Al) and proton (H⁺) tolerance in land-plant species, STOP1 (SENSITIVE TOPROTON RHIZOTOXICITY 1)-like protein, was isolated by polymerase chain reaction-based cloning, and then suppressed by RNA interference in hairy roots produced by Agrobacterium rhizogenes-mediated transformation. Eucalyptus STOP1-like protein complemented proton tolerance in an Arabidopsis thaliana stop1-mutant, and localized to the nucleus in a transient assay of a green fluorescent protein fusion protein expressed in tobacco leaves by Agrobacterium tumefaciens-mediated transformation. Genes encoding a citrate transporting MULTIDRUGS AND TOXIC COMPOUND EXTRUSION protein and an orthologue of ALUMINUM SENSITIVE 3 were suppressed in transgenic hairy roots in which the STOP1 orthologue was knocked down. In summary, we identified a series of genes for Al-tolerance in eucalyptus, including a gene for STOP1-like protein and the Al-tolerance genes it regulates. These genes may be useful for molecular breeding and genomic selection of elite clones to introduce into acid soil regions. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

A new regulatory mechanism for bacterial lipoic acid synthesis

PubMed Central

Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

2015-01-01

Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID:25611823

A new regulatory mechanism for bacterial lipoic acid synthesis.

PubMed

Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

2015-01-22

Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

A Meloidogyne incognita effector is imported into the nucleus and exhibits transcriptional activation activity in planta.

PubMed

Zhang, Lei; Davies, Laura J; Elling, Axel A

2015-01-01

Root-knot nematodes are sedentary biotrophic endoparasites that maintain a complex interaction with their host plants. Nematode effector proteins are synthesized in the oesophageal glands of nematodes and secreted into plant tissue through a needle-like stylet. Effectors characterized to date have been shown to mediate processes essential for nematode pathogenesis. To gain an insight into their site of action and putative function, the subcellular localization of 13 previously isolated Meloidogyne incognita effectors was determined. Translational fusions were created between effectors and EGFP-GUS (enhanced green fluorescent protein-β-glucuronidase) reporter genes, which were transiently expressed in tobacco leaf cells. The majority of effectors localized to the cytoplasm, with one effector, 7H08, imported into the nuclei of plant cells. Deletion analysis revealed that the nuclear localization of 7H08 was mediated by two novel independent nuclear localization domains. As a result of the nuclear localization of the effector, 7H08 was tested for the ability to activate gene transcription. 7H08 was found to activate the expression of reporter genes in both yeast and plant systems. This is the first report of a plant-parasitic nematode effector with transcriptional activation activity. © 2014 BSPP AND JOHN WILEY & SONS LTD.

Regulation of the Osem gene by abscisic acid and the transcriptional activator VP1: analysis of cis-acting promoter elements required for regulation by abscisic acid and VP1.

PubMed

Hattori, T; Terada, T; Hamasuna, S

1995-06-01

Osem, a rice gene homologous to the wheat Em gene, which encodes one of the late-embryogenesis abundant proteins was isolated. The gene was characterized with respect to control of transcription by abscisic acid (ABA) and the transcriptional activator VP1, which is involved in the ABA-regulated gene expression during late embryo-genesis. A fusion gene (Osem-GUS) consisting of the Osem promoter and the bacterial beta-glucuronidase (GUS) gene was constructed and tested in a transient expression system, using protoplasts derived from a suspension-cultured line of rice cells, for activation by ABA and by co-transfection with an expression vector (35S-Osvp1) for the rice VP1 (OSVP1) cDNA. The expression of Osem-GUS was strongly (40- to 150-fold) activated by externally applied ABA and by over-expression of (OS)VP1. The Osem promoter has three ACGTG-containing sequences, motif A, motif B and motif A', which resemble the abscisic acid-responsive element (ABRE) that was previously identified in the wheat Em and the rice Rab16. There is also a CATGCATG sequence, which is known as the Sph box and is shown to be essential for the regulation by VP1 of the maize anthocyanin regulatory gene C1. Focusing on these sequence elements, various mutant derivatives of the Osem promoter in the transient expression system were assayed. The analysis revealed that motif A functions not only as an ABRE but also as a sequence element required for the regulation by (OS)VP1.

Recurrent NTRK1 Gene Fusions Define a Novel Subset of Locally Aggressive Lipofibromatosis-like Neural Tumors.

PubMed

Agaram, Narasimhan P; Zhang, Lei; Sung, Yun-Shao; Chen, Chun-Liang; Chung, Catherine T; Antonescu, Cristina R; Fletcher, Christopher Dm

2016-10-01

The family of pediatric fibroblastic and myofibroblastic proliferations encompasses a wide spectrum of pathologic entities with overlapping morphologies and ill-defined genetic abnormalities. Among the superficial lesions, lipofibromatosis (LPF), composed of an admixture of adipose tissue and fibroblastic elements, in the past has been variously classified as infantile fibromatosis or fibrous hamartoma of infancy. In this regard, we have encountered a group of superficial soft tissue tumors occurring in children and young adults, with a notably infiltrative growth pattern reminiscent of LPF, variable cytologic atypia, and a distinct immunoprofile of S100 protein and CD34 reactivity, suggestive of neural differentiation. SOX10 and melanocytic markers were negative in all cases tested. In contrast, a control group of classic LPF displayed bland, monomorphic histology and lacked S100 protein immunoreactivity. To define the pathogenetic abnormalities in these seemingly distinctive groups, we performed RNA sequencing for fusion gene discovery in 2 cases each, followed by screening for any novel alterations identified in a larger cohort representing both entities. The 2 index LPF-like neural tumors (LPF-NT) showed TPR-NTRK1 and TPM3-NTRK1 gene fusions, which were further validated by fluorescence in situ hybridization (FISH) and reverse transcription polymerase chain reaction. Subsequent FISH screening of 14 LPF-NT identified recurrent NTRK1 gene rearrangements in 10 (71%) cases. Of the NTRK1-negative LPF-NT cases, 1 case each showed ROS1 and ALK gene rearrangements. In contrast, none of the 25 classic LPFs showed NTRK1 gene rearrangements, although regional abnormalities were noted in the 1q21-22 region by FISH in a majority of cases. Furthermore, NTRK1 immunostaining was positive only in NTRK1-rearranged S100-positive LPF-NT but negative in classic LPF. These results suggest that NTRK1 oncogenic activation through gene fusion defines a novel and distinct subset of soft tissue tumors resembling LPF, but displaying cytologic atypia and a neural immunophenotype, provisionally named LPF-like neural tumors.

Maximization of transcription of the serC (pdxF)-aroA multifunctional operon by antagonistic effects of the cyclic AMP (cAMP) receptor protein-cAMP complex and Lrp global regulators of Escherichia coli K-12.

PubMed

Man, T K; Pease, A J; Winkler, M E

1997-06-01

The arrangement of the Escherichia coli serC (pdxF) and aroA genes into a cotranscribed multifunctional operon allows coregulation of two enzymes required for the biosynthesis of L-serine, pyridoxal 5'-phosphate, chorismate, and the aromatic amino acids and vitamins. RNase T2 protection assays revealed two major transcripts that were initiated from a promoter upstream from serC (pdxF). Between 80 to 90% of serC (pdxF) transcripts were present in single-gene mRNA molecules that likely arose by Rho-independent termination between serC (pdxF) and aroA. serC (pdxF)-aroA cotranscripts terminated at another Rho-independent terminator near the end of aroA. We studied operon regulation by determining differential rates of beta-galactosidase synthesis in a merodiploid strain carrying a single-copy lambda[phi(serC [pdxF]'-lacZYA)] operon fusion. serC (pdxF) transcription was greatest in bacteria growing in minimal salts-glucose medium (MMGlu) and was reduced in minimal salts-glycerol medium, enriched MMGlu, and LB medium. serC (pdxF) transcription was increased in cya or crp mutants compared to their cya+ crp+ parent in MMGlu or LB medium. In contrast, serC (pdxF) transcription decreased in an lrp mutant compared to its lrp+ parent in MMGlu. Conclusions obtained by using the operon fusion were corroborated by quantitative Western immunoblotting of SerC (PdxF), which was present at around 1,800 dimers per cell in bacteria growing in MMGlu. RNase T2 protection assays of serC (pdxF)-terminated and serC (pdxF)-aroA cotranscript amounts supported the conclusion that the operon was regulated at the transcription level under the conditions tested. Results with a series of deletions upstream of the P(serC (pdxF)) promoter revealed that activation by Lrp was likely direct, whereas repression by the cyclic AMP (cAMP) receptor protein-cAMP complex (CRP-cAMP) was likely indirect, possibly via a repressor whose amount or activity was stimulated by CRP-cAMP.

Dual-mode enhancement of metallothionein protein with cell transduction and retention peptide fusion.

PubMed

Lim, Kwang Suk; Lim, Myoung-Hwa; Won, Young-Wook; Kim, Jang Kyoung; Kang, Young Cheol; Park, Eun Jeong; Chae, Ji-Won; Kim, So-Mi; Ryu, Seong-Eon; Pak, Youngmi Kim; Kim, Yong-Hee

2013-10-28

Protein transduction domains (PTDs), also known as cell-penetrating peptides (CPPs), have been developed as effective systems for delivering bio-active cargos such as proteins, genes and particles. Further improvements on cell-specific targeting, intracellular organelle targeting and intracellular retention are still necessary to enhance the therapeutic effect of PTD fusion proteins. In order to enhance the cell transduction and retention of anti-oxidative metallothionein protein (MT), MT was recombinantly fused with transcriptional activator (Tat) with or without a short peptide (sMTS) derived from mitochondria malate dehydrogenase (mMDH). Cellular uptake and retention time of fusion protein were significantly increased in the H9c2 cell by sMTS. The Tat-sMTS-MT (TMM) fusion protein protected H9c2 cells more effectively against hypoxia, hyperglycemia and combination compared with Tat-MT (TM) by reducing intracellular ROS level. It maintained the normal blood glucose level over an extended period of time in a streptozotocin-induced diabetic mouse model. PTD-sMTS-MT fusion protein has a potential to be used as a therapeutic protein for the treatment or prevention of diabetes and diabetic complications. © 2013.

The developmental dynamics of the Populus stem transcriptome.

PubMed

Chao, Qing; Gao, Zhi-Fang; Zhang, Dong; Zhao, Biligen-Gaowa; Dong, Feng-Qin; Fu, Chun-Xiang; Liu, Li-Jun; Wang, Bai-Chen

2018-05-31

The Populus shoot undergoes primary growth (longitudinal growth) followed by secondary growth (radial growth), which produces biomass that is an important source of energy worldwide. We adopted joint PacBio Iso-Seq and RNA-seq analysis to identify differentially expressed transcripts along a developmental gradient from the shoot apex to the fifth internode of Populus Nanlin895. We obtained 87,150 full-length transcripts, including 2,081 new isoforms and 62,058 new alternatively spliced isoforms, most of which were produced by intron retention, that were used to update the Populus annotation. Among these novel isoforms, there are 1,187 long noncoding RNAs and 356 fusion genes. Using this annotation, we found 15,838 differentially expressed transcripts along the shoot developmental gradient, of which 1,216 were transcription factors (TFs). Only a few of these genes were reported previously. The differential expression of these TFs suggests that they may play important roles in primary and secondary growth. AP2, ARF, YABBY and GRF TFs are highly expressed in the apex, whereas NAC, bZIP, PLATZ and HSF TFs are likely to be important for secondary growth. Overall, our findings provide evidence that long-read sequencing can complement short-read sequencing for cataloging and quantifying eukaryotic transcripts and increase our understanding of the vital and dynamic process of shoot development. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

The leukemia associated ETO nuclear repressor gene is regulated by the GATA-1 transcription factor in erythroid/megakaryocytic cells

PubMed Central

2010-01-01

Background The Eight-Twenty-One (ETO) nuclear co-repressor gene belongs to the ETO homologue family also containing Myeloid Translocation Gene on chromosome 16 (MTG16) and myeloid translocation Gene-Related protein 1 (MTGR1). By chromosomal translocations ETO and MTG16 become parts of fusion proteins characteristic of morphological variants of acute myeloid leukemia. Normal functions of ETO homologues have as yet not been examined. The goal of this work was to identify structural and functional promoter elements upstream of the coding sequence of the ETO gene in order to explore lineage-specific hematopoietic expression and get hints to function. Results A putative proximal ETO promoter was identified within 411 bp upstream of the transcription start site. Strong ETO promoter activity was specifically observed upon transfection of a promoter reporter construct into erythroid/megakaryocytic cells, which have endogeneous ETO gene activity. An evolutionary conserved region of 228 bp revealed potential cis-elements involved in transcription of ETO. Disruption of the evolutionary conserved GATA -636 consensus binding site repressed transactivation and disruption of the ETS1 -705 consensus binding site enhanced activity of the ETO promoter. The promoter was stimulated by overexpression of GATA-1 into erythroid/megakaryocytic cells. Electrophoretic mobility shift assay with erythroid/megakaryocytic cells showed specific binding of GATA-1 to the GATA -636 site. Furthermore, results from chromatin immunoprecipitation showed GATA-1 binding in vivo to the conserved region of the ETO promoter containing the -636 site. The results suggest that the GATA -636 site may have a role in activation of the ETO gene activity in cells with erythroid/megakaryocytic potential. Leukemia associated AML1-ETO strongly suppressed an ETO promoter reporter in erythroid/megakaryocytic cells. Conclusions We demonstrate that the GATA-1 transcription factor binds and transactivates the ETO proximal promoter in an erythroid/megakaryocytic-specific manner. Thus, trans-acting factors that are essential in erythroid/megakaryocytic differentiation govern ETO expression. PMID:20487545

Application of unstable Gfp variants to the kinetic study of Legionella pneumophila icm gene expression during infection.

PubMed

Barysheva, Oksana V; Fujii, Jun; Takaesu, Giichi; Yoshida, Shin-ichi

2008-04-01

An unstable type of green fluorescent protein (Gfp) tagged with a C-terminal extension, which is a target for tail-specific protease, was used as a reporter gene in Legionella pneumophila. To analyse Gfp expression in legionellae, transcriptional fusions of unstable gfp with the Legionella-specific icm (intracellular multiplication) promoters (P(icmS), P(icmT) and P(icmQ)) were constructed. Infection studies using J774.1 macrophages as the host, and L. pneumophila strains carrying P(icmS)-gfp, P(icmT)-gfp and P(icmQ)-gfp fusions, indicated that the icmS, icmT and icmQ genes could be expressed intracellularly. Expression of icmS, icmT and icmQ genes in infected cells was examined by flow cytometry. Furthermore, fluorescent intracellular legionellae were detected directly by confocal microscopy. Real-time quantitative RT-PCR revealed the differences in the gene expression of icmS, and that of icmT and icmQ, during infection. Expression of icmS was high in the late stage of infection, while that of icmT and icmQ was high in the early phase only. We show that unstable gfp is a useful reporter gene whose expression in legionellae can be followed in real-time, and that it allows analysis of promoter activities in legionellae and monitoring of the infection process.

Genomic architecture of histone 3 lysine 27 trimethylation during late ovine skeletal muscle development.

PubMed

Byrne, K; McWilliam, S; Vuocolo, T; Gondro, C; Cockett, N E; Tellam, R L

2014-06-01

The ruminant developmental transition from late foetus to lamb is associated with marked changes in skeletal muscle structure and function that reflect programming for new physiological demands following birth. To determine whether epigenetic changes are involved in this transition, we investigated the genomic architecture of the chromatin modification, histone 3 lysine 27 trimethylation (H3K27me3), which typically regulates early life developmental processes; however, its role in later life processes is unclear. Chromatin immunoprecipitation coupled with next-generation sequencing was used to map H3K27me3 nucleosomes in ovine longissimus lumborum skeletal muscle at 100 days of gestation and 12 weeks post-partum. In both states, H3K27me3 modification was associated with genes, transcription start sites and CpG islands and with transcriptional silencing. The H3K27me3 peaks consisted of two major categories, promoter specific and regional, with the latter the dominant feature. Genes encoding homeobox transcription factors regulating early life development and genes involved in neural functions, particularly gated ion channels, were strongly modified by H3K27me3. Gene promoters differentially modified by H3K27me3 in the foetus and lamb were enriched for gated ion channels, which may reflect changes in neuromuscular function. However, most modified genes showed no changes, indicating that H3K27me3 does not have a large role in late muscle maturation. Notably, promyogenic transcription factors were strongly modified with H3K27me3 but showed no differences between the late gestation foetus and lamb, likely reflecting their lack of involvement in the myofibre fusion process occurring in this transition. H3K27me3 is a major architectural feature of the epigenetic landscape of ruminant skeletal muscle, and it comments on gene transcription and gene function in the context of late skeletal muscle development. © 2014 The Authors. Animal Genetics published by John Wiley & Sons Ltd on behalf of Stichting International Foundation for Animal Genetics.

The multidrug ABC transporter BmrC/BmrD of Bacillus subtilis is regulated via a ribosome-mediated transcriptional attenuation mechanism.

PubMed

Reilman, Ewoud; Mars, Ruben A T; van Dijl, Jan Maarten; Denham, Emma L

2014-10-01

Expression of particular drug transporters in response to antibiotic pressure is a critical element in the development of bacterial multidrug resistance, and represents a serious concern for human health. To obtain a better understanding of underlying regulatory mechanisms, we have dissected the transcriptional activation of the ATP-binding cassette (ABC) transporter BmrC/BmrD of the Gram-positive model bacterium Bacillus subtilis. By using promoter-GFP fusions and live cell array technology, we demonstrate a temporally controlled transcriptional activation of the bmrCD genes in response to antibiotics that target protein synthesis. Intriguingly, bmrCD expression only occurs during the late-exponential and stationary growth stages, irrespective of the timing of the antibiotic challenge. We show that this is due to tight transcriptional control by the transition state regulator AbrB. Moreover, our results show that the bmrCD genes are co-transcribed with bmrB (yheJ), a small open reading frame immediately upstream of bmrC that harbors three alternative stem-loop structures. These stem-loops are apparently crucial for antibiotic-induced bmrCD transcription. Importantly, the antibiotic-induced bmrCD expression requires translation of bmrB, which implies that BmrB serves as a regulatory leader peptide. Altogether, we demonstrate for the first time that a ribosome-mediated transcriptional attenuation mechanism can control the expression of a multidrug ABC transporter. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Statins Increase Plasminogen Activator Inhibitor Type 1 Gene Transcription through a Pregnane X Receptor Regulated Element

PubMed Central

Stanley, Frederick M.; Linder, Kathryn M.; Cardozo, Timothy J.

2015-01-01

Plasminogen activator inhibitor type 1 (PAI-1) is a multifunctional protein that has important roles in inflammation and wound healing. Its aberrant regulation may contribute to many disease processes such as heart disease. The PAI-1 promoter is responsive to multiple inputs including cytokines, growth factors, steroids and oxidative stress. The statin drugs, atorvastatin, mevastatin and rosuvastatin, increased basal and stimulated expression of the PAI-1 promoter 3-fold. A statin-responsive, nuclear hormone response element was previously identified in the PAI-1 promoter, but it was incompletely characterized. We characterized this direct repeat (DR) of AGGTCA with a 3-nucleotide spacer at -269/-255 using deletion and directed mutagenesis. Deletion or mutation of this element increased basal transcription from the promoter suggesting that it repressed PAI-1 transcription in the unliganded state. The half-site spacing and the ligand specificity suggested that this might be a pregnane X receptor (PXR) responsive element. Computational molecular docking showed that atorvastatin, mevastatin and rosuvastatin were structurally compatible with the PXR ligand-binding pocket in its agonist conformation. Experiments with Gal4 DNA binding domain fusion proteins showed that Gal4-PXR was activated by statins while other DR + 3 binding nuclear receptor fusions were not. Overexpression of PXR further enhanced PAI-1 transcription in response to statins. Finally, ChIP experiments using Halo-tagged PXR and RXR demonstrated that both components of the PXR-RXR heterodimer bound to this region of the PAI-1 promoter. PMID:26379245

Antagonism between granulocytic maturation and deacetylase inhibitor-induced apoptosis in acute promyelocytic leukaemia cells.

PubMed

Hennig, D; Müller, S; Wichmann, C; Drube, S; Pietschmann, K; Pelzl, L; Grez, M; Bug, G; Heinzel, T; Krämer, O H

2015-01-20

Transcriptional repression is a key mechanism driving leukaemogenesis. In acute promyelocytic leukaemia (APL), the fusion protein promyelocytic leukaemia-retinoic acid receptor-α fusion (PML-RARα) recruits transcriptional repressors to myeloid differentiation genes. All-trans-retinoic acid (ATRA) induces the proteasomal degradation of PML-RARα and granulocytic differentiation. Histone deacetylases (HDACs) fall into four classes (I-IV) and contribute to the transcription block caused by PML-RARα. Immunoblot, flow cytometry, and May-Grünwald-Giemsa staining were used to analyze differentiation and induction of apoptosis. A PML-RARα- and ATRA-dependent differentiation programme induces granulocytic maturation associated with an accumulation of the myeloid transcription factor CCAAT/enhancer binding protein (C/EBP)ɛ and of the surface protein CD11b. While this process protects APL cells from inhibitors of class I HDAC activity, inhibition of all Zinc-dependent HDACs (classes I, II, and IV) with the pan-HDACi (histone deacetylase inhibitor(s)) LBH589 induces apoptosis of immature and differentiated APL cells. LBH589 can eliminate C/EBPɛ and the mitochondrial apoptosis regulator B-cell lymphoma (BCL)-xL in immature and differentiated NB4 cells. Thus, BCL-xL and C/EBPɛ are newly identified molecular markers for the efficacy of HDACi against APL cells. Our results could explain the therapeutic limitations occurring with ATRA and class I HDACi combinations. Pro-apoptotic effects caused by pan-HDAC inhibition are not blunted by ATRA-induced differentiation and may provide a clinically interesting alternative.

A quasi-lentiviral green fluorescent protein reporter exhibits nuclear export features of late human immunodeficiency virus type 1 transcripts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Graf, Marcus; Ludwig, Christine; Kehlenbeck, Sylvia

2006-09-01

We have previously shown that Rev-dependent expression of HIV-1 Gag from CMV immediate early promoter critically depends on the AU-rich codon bias of the gag gene. Here, we demonstrate that adaptation of the green fluorescent protein (GFP) reporter gene to HIV codon bias is sufficient to turn this hivGFP RNA into a quasi-lentiviral message following the rules of late lentiviral gene expression. Accordingly, GFP expression was significantly decreased in transfected cells strictly correlating with reduced RNA levels. In the presence of the HIV 5' major splice donor, the hivGFP RNAs were stabilized in the nucleus and efficiently exported to themore » cytoplasm following fusion of the 3' Rev-responsive element (RRE) and coexpression of HIV-1 Rev. This Rev-dependent translocation was specifically inhibited by leptomycin B suggesting export via the CRM1-dependent pathway used by late lentiviral transcripts. In conclusion, this quasi-lentiviral reporter system may provide a new platform for developing sensitive Rev screening assays.« less

Molecular cloning and sequence analysis of the Anticarsia gemmatalis multicapsid nuclear polyhedrosis virus GP64 glycoprotein.

PubMed

Pilloff, Marcela Gabriela; Bilen, Marcos Fabián; Belaich, Mariano Nicolás; Lozano, Mario Enrique; Ghiringhelli, Pablo Daniel

2003-01-01

The gp64 locus of Anticarsia gemmatalis multicapsid nucleopolyhedrovirus isolate Santa Fe (AgMNPV-SF) was characterised molecularly in our laboratory. To this end, we have located and cloned a AgMNPV-SF genomic DNA fragment containing the gp64 gene and sequenced the complete gp64 locus. Nucleotide sequence analysis indicated that the AgMNPV gp64 gene consists of a 1500 nucleotide open reading frame (ORF), encoding a protein of 499 amino acids. Of the seven gp64 homologues identified to date, the AgMNPV gp64 ORF shared most sequence similarity with the gp64 gene of Orgyia pseudotsugata MNPV. The GP64 from AgMNPV is the smallest baculoviral envelope glycoprotein found to date, differing in 10 or more residues from the other group I nucleopolyhedroviruses. The biological activity of AgMNPV GP64 protein was assessed by cell fusion assays in UFL-AG-286 cells using the obtained recombinant plasmids. In the upstream and downstream regions, relative to the gp64 ORF, we found different conserved transcriptional and post-transcriptional regulatory elements, respectively.

The complete genome sequence of the Atlantic salmon paramyxovirus (ASPV)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nylund, Stian; Karlsen, Marius; Nylund, Are

2008-03-30

The complete RNA genome of the Atlantic salmon paramyxovirus (ASPV), isolated from Atlantic salmon suffering from proliferative gill inflammation (PGI), has been determined. The genome is 16,965 nucleotides in length and consists of six nonoverlapping genes in the order 3'- N - P/C/V - M - F - HN - L -5', coding for the nucleocapsid, phospho-, matrix, fusion, hemagglutinin-neuraminidase and large polymerase proteins, respectively. The gene junctions contain highly conserved transcription start and stop signal sequences and trinucleotide intergenic regions similar to those of other Paramyxoviridae. The ASPV P-gene expression strategy is like that of the respiro- and morbilliviruses,more » which express the phosphoprotein from the primary transcript, and edit a portion of the mRNA to encode the accessory proteins V and W. It also encodes the C-protein by ribosomal choice of translation initiation. Pairwise comparisons of amino acid identities, and phylogenetic analysis of deduced ASPV protein sequences with homologous sequences from other Paramyxoviridae, show that ASPV has an affinity for the genus Respirovirus, but may represent a new genus within the subfamily Paramyxovirinae.« less

Cyclin-dependent protein kinase and cyclin homologs SSN3 and SSN8 contribute to transcriptional control in yeast.

PubMed Central

Kuchin, S; Yeghiayan, P; Carlson, M

1995-01-01

The SSN3 and SSN8 genes of Saccharomyces cerevisiae were identified by mutations that suppress a defect in SNF1, a protein kinase required for release from glucose repression. Mutations in SSN3 and SSN8 also act synergistically with a mutation of the MIG1 repressor protein to relieve glucose repression. We have cloned the SSN3 and SSN8 genes. SSN3 encodes a cyclin-dependent protein kinase (cdk) homolog and is identical to UME5. SSN8 encodes a cyclin homolog 35% identical to human cyclin C. SSN3 and SSN8 fusion proteins interact in the two-hybrid system and coimmunoprecipitate from yeast cell extracts. Using an immune complex assay, we detected protein kinase activity that depends on both SSN3 and SSN8. Thus, the two SSN proteins are likely to function as a cdk-cyclin pair. Genetic analysis indicates that the SSN3-SSN8 complex contributes to transcriptional repression of diversely regulated genes and also affects induction of the GAL1 promoter. Images Fig. 3 Fig. 4 Fig. 5 PMID:7732022

The same pocket in menin binds both MLL and JUND but has opposite effects on transcription

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huang, Jing; Gurung, Buddha; Wan, Bingbing

2013-04-08

Menin is a tumour suppressor protein whose loss or inactivation causes multiple endocrine neoplasia 1 (MEN1), a hereditary autosomal dominant tumour syndrome that is characterized by tumorigenesis in multiple endocrine organs. Menin interacts with many proteins and is involved in a variety of cellular processes. Menin binds the JUN family transcription factor JUND and inhibits its transcriptional activity. Several MEN1 missense mutations disrupt the menin-JUND interaction, suggesting a correlation between the tumour-suppressor function of menin and its suppression of JUND-activated transcription. Menin also interacts with mixed lineage leukaemia protein 1 (MLL1), a histone H3 lysine 4 methyltransferase, and functions asmore » an oncogenic cofactor to upregulate gene transcription and promote MLL1-fusion-protein-induced leukaemogenesis. A recent report on the tethering of MLL1 to chromatin binding factor lens epithelium-derived growth factor (LEDGF) by menin indicates that menin is a molecular adaptor coordinating the functions of multiple proteins. Despite its importance, how menin interacts with many distinct partners and regulates their functions remains poorly understood. Here we present the crystal structures of human menin in its free form and in complexes with MLL1 or with JUND, or with an MLL1-LEDGF heterodimer. These structures show that menin contains a deep pocket that binds short peptides of MLL1 or JUND in the same manner, but that it can have opposite effects on transcription. The menin-JUND interaction blocks JUN N-terminal kinase (JNK)-mediated JUND phosphorylation and suppresses JUND-induced transcription. In contrast, menin promotes gene transcription by binding the transcription activator MLL1 through the peptide pocket while still interacting with the chromatin-anchoring protein LEDGF at a distinct surface formed by both menin and MLL1.« less

DEAF-1 regulates immunity gene expression in Drosophila.

PubMed

Reed, Darien E; Huang, Xinhua M; Wohlschlegel, James A; Levine, Michael S; Senger, Kate

2008-06-17

Immunity genes are activated in the Drosophila fat body by Rel and GATA transcription factors. Here, we present evidence that an additional regulatory factor, deformed epidermal autoregulatory factor-1 (DEAF-1), also contributes to the immune response and is specifically important for the induction of two genes encoding antimicrobial peptides, Metchnikowin (Mtk) and Drosomycin (Drs). The systematic mutagenesis of a minimal Mtk 5' enhancer identified a sequence motif essential for both a response to LPS preparations in S2 cells and activation in the larval fat body in response to bacterial infection. Using affinity chromatography coupled to multidimensional protein identification technology (MudPIT), we identified DEAF-1 as a candidate regulator. DEAF-1 activates the expression of Mtk and Drs promoter-luciferase fusion genes in S2 cells. SELEX assays and footprinting data indicate that DEAF-1 binds to and activates Mtk and Drs regulatory DNAs via a TTCGGBT motif. The insertion of this motif into the Diptericin (Dpt) regulatory region confers DEAF-1 responsiveness to this normally DEAF-1-independent enhancer. The coexpression of DEAF-1 with Dorsal, Dif, and Relish results in the synergistic activation of transcription. We propose that DEAF-1 is a regulator of Drosophila immunity.

A Novel WRKY transcription factor is required for induction of PR-1a gene expression by salicylic acid and bacterial elicitors.

PubMed

van Verk, Marcel C; Pappaioannou, Dimitri; Neeleman, Lyda; Bol, John F; Linthorst, Huub J M

2008-04-01

PR-1a is a salicylic acid-inducible defense gene of tobacco (Nicotiana tabacum). One-hybrid screens identified a novel tobacco WRKY transcription factor (NtWRKY12) with specific binding sites in the PR-1a promoter at positions -564 (box WK(1)) and -859 (box WK(2)). NtWRKY12 belongs to the class of transcription factors in which the WRKY sequence is followed by a GKK rather than a GQK sequence. The binding sequence of NtWRKY12 (WK box TTTTCCAC) deviated significantly from the consensus sequence (W box TTGAC[C/T]) shown to be recognized by WRKY factors with the GQK sequence. Mutation of the GKK sequence in NtWRKY12 into GQK or GEK abolished binding to the WK box. The WK(1) box is in close proximity to binding sites in the PR-1a promoter for transcription factors TGA1a (as-1 box) and Myb1 (MBSII box). Expression studies with PR-1a promoterbeta-glucuronidase (GUS) genes in stably and transiently transformed tobacco indicated that NtWRKY12 and TGA1a act synergistically in PR-1a expression induced by salicylic acid and bacterial elicitors. Cotransfection of Arabidopsis thaliana protoplasts with 35SNtWRKY12 and PR-1aGUS promoter fusions showed that overexpression of NtWRKY12 resulted in a strong increase in GUS expression, which required functional WK boxes in the PR-1a promoter.

[Construction and expression of the targeting super-antigen EGF-SEA fusion gene].

PubMed

Xie, Yang; Peng, Shaoping; Liao, Zhiying; Liu, Jiafeng; Liu, Xuemei; Chen, Weifeng

2014-05-01

To construct expression vector for the SEA-EGF fusion gene. Clone the SEA gene and the EGF gene segment with PCR and RT-PCR independently, and connect this two genes by the bridge PCR. Insert the fusion gene EGF-SEA into the expression vector PET-44. Induced the secretion of the fusion protein SEA-EGF by the antileptic. The gene fragment encoding EGF and SEA mature peptide was successfully cloned. The fusion gene EGF-SEA was successfully constructed and was inserted into expression vector. The new recombinant expression vector for fusion gene EGF-SEA is specific for head and neck cancer, laid the foundation for the further study of fusion protein SEA-EGF targeting immune therapy in head and neck tumors.

Functional Genomic Screening Reveals Splicing of the EWS-FLI1 Fusion Transcript as a Vulnerability in Ewing Sarcoma.

PubMed

Grohar, Patrick J; Kim, Suntae; Rangel Rivera, Guillermo O; Sen, Nirmalya; Haddock, Sara; Harlow, Matt L; Maloney, Nichole K; Zhu, Jack; O'Neill, Maura; Jones, Tamara L; Huppi, Konrad; Grandin, Magdalena; Gehlhaus, Kristen; Klumpp-Thomas, Carleen A; Buehler, Eugen; Helman, Lee J; Martin, Scott E; Caplen, Natasha J

2016-01-26

Ewing sarcoma cells depend on the EWS-FLI1 fusion transcription factor for cell survival. Using an assay of EWS-FLI1 activity and genome-wide RNAi screening, we have identified proteins required for the processing of the EWS-FLI1 pre-mRNA. We show that Ewing sarcoma cells harboring a genomic breakpoint that retains exon 8 of EWSR1 require the RNA-binding protein HNRNPH1 to express in-frame EWS-FLI1. We also demonstrate the sensitivity of EWS-FLI1 fusion transcripts to the loss of function of the U2 snRNP component, SF3B1. Disrupted splicing of the EWS-FLI1 transcript alters EWS-FLI1 protein expression and EWS-FLI1-driven expression. Our results show that the processing of the EWS-FLI1 fusion RNA is a potentially targetable vulnerability in Ewing sarcoma cells. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Characterization of two trpE genes encoding anthranilate synthase {alpha}-subunit in Azospirillum brasilense

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ge Shimei; Xie Baoen; Chen Sanfeng

2006-03-10

The previous report from our laboratory has recently identified a new trpE gene (termed trpE {sub 2}) which exists independently in Azospirillum brasilense Yu62. In this study, amplification of trpE(G) (termed trpE {sub 1}(G) here) confirmed that there are two copies of trpE gene, one trpE being fused into trpG while the other trpE existed independently. This is First report to suggest that two copies of the trpE gene exist in this bacterium. Comparison of the nucleotide sequence demonstrated that putative leader peptide, terminator, and anti-terminator were found upstream of trpE {sub 1}(G) while these sequence features did not existmore » in front of trpE {sub 2}. The {beta}-galactosidase activity of an A. brasilense strain carrying a trpE {sub 2}-lacZ fusion remained constant at different tryptophan concentrations, but the {beta}-galactosidase activity of the same strain carrying a trpE {sub 1}(G)-lacZ fusion decreased as the tryptophan concentration increased. These data suggest that the expression of trpE {sub 1}(G) is regulated at the transcriptional level by attenuation while trpE {sub 2} is constantly expressed. The anthranilate synthase assays with trpE {sub 1}(G){sup -} and trpE {sub 2} {sup -} mutants demonstrated that TrpE{sub 1}(G) fusion protein is feedback inhibited by tryptophan while TrpE{sub 2} protein is not. We also found that both trpE {sub 1}(G) and trpE {sub 2} gene products were involved in IAA synthesis.« less

Distinct patterns of alteration of myc genes associated with integration of human papillomavirus type 16 or type 45 DNA in two genital tumours.

PubMed

Sastre-Garau, X; Favre, M; Couturier, J; Orth, G

2000-08-01

We previously described two genital carcinomas (IC2, IC4) containing human papillomavirus type 16 (HPV-16)- or HPV-18-related sequences integrated in chromosomal bands containing the c-myc (8q24) or N-myc (2p24) gene, respectively. The c-myc gene was rearranged and amplified in IC2 cells without evidence of overexpression. The N-myc gene was amplified and highly transcribed in IC4 cells. Here, the sequence of an 8039 bp IC4 DNA fragment containing the integrated viral sequences and the cellular junctions is reported. A 3948 bp segment of the genome of HPV-45 encompassing the upstream regulatory region and the E6 and E7 ORFs was integrated into the untranslated part of N-myc exon 3, upstream of the N-myc polyadenylation signal. Both N-myc and HPV-45 sequences were amplified 10- to 20-fold. The 3' ends of the major N-myc transcript were mapped upstream of the 5' junction. A minor N-myc/HPV-45 fusion transcript was also identified, as well as two abundant transcripts from the HPV-45 E6-E7 region. Large amounts of N-myc protein were detected in IC4 cells. A major alteration of c-myc sequences in IC2 cells involved the insertion of a non-coding sequence into the second intron and their co-amplification with the third exon, without any evidence for the integration of HPV-16 sequences within or close to the gene. Different patterns of myc gene alterations may thus be associated with integration of HPV DNA in genital tumours, including the activation of the protooncogene via a mechanism of insertional mutagenesis and/or gene amplification.

Quantitative expression analysis of selected transcription factors in pavement, basal and trichome cells of mature leaves from Arabidopsis thaliana

PubMed Central

Schliep, Martin; Ebert, Berit; Simon-Rosin, Ulrike; Zoeller, Daniela

2010-01-01

Gene expression levels of several transcription factors from Arabidopsis thaliana that were described previously to be involved in leaf development and trichome formation were analysed in trichome, basal and pavement cells of mature leaves. Single cell samples of these three cells types were collected by glass micro-capillaries. Real-time reverse transcription (RT)-PCR was used to analyse expression patterns of the following transcription factors: MYB23, MYB55, AtHB1, FILAMENTOUS FLOWER (FIL)/YABBY1 (YAB1), TRIPTYCHON (TRY) and CAPRICE (CPC). A difference in the expression patterns of TRY and CPC was revealed. Contrary to the CPC expression pattern, no transcripts of TRY could be detected in pavement cells. FIL/YAB1 was exclusively expressed in trichome cells. AtHB1 was highly expressed throughout all three cell types. MYB55 was higher expressed in basal cells than in trichome and pavement cells. MYB23 showed a pattern of low expression in pavement cells, medium in basal cells and high expression in trichomes. Expression patterns obtained by single cell sampling and real-time RT-PCR were compared to promoter GUS fusions of the selected transcription factors. Therefore, we regenerated two transgenic Arabidopsis lines that expressed the GUS reporter gene under control of the promoters of MYB55 and YAB1. In conclusion, despite their function in leaf morphogenesis, all six transcription factors were detected in mature leaves. Furthermore, single cell sampling and promoter GUS staining patterns demonstrated the predominant presence of MYB55 in basal cells as compared to pavement cells and trichomes. PMID:20101514

Quantitative expression analysis of selected transcription factors in pavement, basal and trichome cells of mature leaves from Arabidopsis thaliana.

PubMed

Schliep, Martin; Ebert, Berit; Simon-Rosin, Ulrike; Zoeller, Daniela; Fisahn, Joachim

2010-05-01

Gene expression levels of several transcription factors from Arabidopsis thaliana that were described previously to be involved in leaf development and trichome formation were analysed in trichome, basal and pavement cells of mature leaves. Single cell samples of these three cells types were collected by glass micro-capillaries. Real-time reverse transcription (RT)-PCR was used to analyse expression patterns of the following transcription factors: MYB23, MYB55, AtHB1, FILAMENTOUS FLOWER (FIL)/YABBY1 (YAB1), TRIPTYCHON (TRY) and CAPRICE (CPC). A difference in the expression patterns of TRY and CPC was revealed. Contrary to the CPC expression pattern, no transcripts of TRY could be detected in pavement cells. FIL/YAB1 was exclusively expressed in trichome cells. AtHB1 was highly expressed throughout all three cell types. MYB55 was higher expressed in basal cells than in trichome and pavement cells. MYB23 showed a pattern of low expression in pavement cells, medium in basal cells and high expression in trichomes. Expression patterns obtained by single cell sampling and real-time RT-PCR were compared to promoter GUS fusions of the selected transcription factors. Therefore, we regenerated two transgenic Arabidopsis lines that expressed the GUS reporter gene under control of the promoters of MYB55 and YAB1. In conclusion, despite their function in leaf morphogenesis, all six transcription factors were detected in mature leaves. Furthermore, single cell sampling and promoter GUS staining patterns demonstrated the predominant presence of MYB55 in basal cells as compared to pavement cells and trichomes.

PehN, a Polygalacturonase Homologue with a Low Hydrolase Activity, Is Coregulated with the Other Erwinia chrysanthemi Polygalacturonases

PubMed Central

Hugouvieux-Cotte-Pattat, Nicole; Shevchik, Vladimir E.; Nasser, William

2002-01-01

Erwinia chrysanthemi 3937 secretes an arsenal of pectinolytic enzymes, including at least eight endo-pectate lyases encoded by pel genes, which play a major role in the soft-rot disease caused by this bacterium on various plants. E. chrysanthemi also produces some hydrolases that cleave pectin. Three adjacent hydrolase genes, pehV, pehW, and pehX, encoding exo-poly-α-d-galacturonosidases, have been characterized. These enzymes liberate digalacturonides from the nonreducing end of pectin. We report the identification of a novel gene, named pehN, encoding a protein homologous to the glycosyl hydrolases of family 28, which includes mainly polygalacturonases. PehN has a low hydrolase activity on polygalacturonate and on various pectins. PehN action favors the activity of the secreted endo-pectate lyases, mainly PelB and PelC, and that of the periplasmic exo-pectate lyase PelX. However, removal of the pehN gene does not significantly alter the virulence of E. chrysanthemi. Regulation of pehN transcription was analyzed by using gene fusions. Like other pectinase genes, pehN transcription is dependent on several environmental conditions. It is induced by pectic catabolic products and is affected by growth phase, catabolite repression, osmolarity, anaerobiosis, nitrogen starvation, and the presence of calcium ions. The transcription of pehN is modulated by the repressor KdgR, which controls almost all the steps of pectin catabolism, and by cyclic AMP receptor protein (CRP), the global activator of sugar catabolism. The regulator PecS, which represses the transcription of the pel genes but activates that of pehV, pehW, and pehX, also activates transcription of pehN. The three regulators KdgR, PecS, and CRP act by direct interaction with the pehN promoter region. The sequences involved in the binding of these three regulators and of RNA polymerase have been precisely defined. Analysis of the simultaneous binding of these proteins indicates that CRP and RNA polymerase bind cooperatively and that the binding of KdgR could prevent pehN transcription. In contrast, the activator effect of PecS is not linked to competition with KdgR or to cooperation with CRP or RNA polymerase. This effect probably results from competition between PecS and an unidentified repressor involved in peh regulation. PMID:11976295

confFuse: High-Confidence Fusion Gene Detection across Tumor Entities.

PubMed

Huang, Zhiqin; Jones, David T W; Wu, Yonghe; Lichter, Peter; Zapatka, Marc

2017-01-01

Background: Fusion genes play an important role in the tumorigenesis of many cancers. Next-generation sequencing (NGS) technologies have been successfully applied in fusion gene detection for the last several years, and a number of NGS-based tools have been developed for identifying fusion genes during this period. Most fusion gene detection tools based on RNA-seq data report a large number of candidates (mostly false positives), making it hard to prioritize candidates for experimental validation and further analysis. Selection of reliable fusion genes for downstream analysis becomes very important in cancer research. We therefore developed confFuse, a scoring algorithm to reliably select high-confidence fusion genes which are likely to be biologically relevant. Results: confFuse takes multiple parameters into account in order to assign each fusion candidate a confidence score, of which score ≥8 indicates high-confidence fusion gene predictions. These parameters were manually curated based on our experience and on certain structural motifs of fusion genes. Compared with alternative tools, based on 96 published RNA-seq samples from different tumor entities, our method can significantly reduce the number of fusion candidates (301 high-confidence from 8,083 total predicted fusion genes) and keep high detection accuracy (recovery rate 85.7%). Validation of 18 novel, high-confidence fusions detected in three breast tumor samples resulted in a 100% validation rate. Conclusions: confFuse is a novel downstream filtering method that allows selection of highly reliable fusion gene candidates for further downstream analysis and experimental validations. confFuse is available at https://github.com/Zhiqin-HUANG/confFuse.

Antimetastatic Effects of a Novel Telomerase Inhibitor, GRN163L, on Human Prostate Cancer

DTIC Science & Technology

2010-05-01

techniques such as identifi- cation of TMPRSS2:ERG fusion transcripts [4,5], Glutathione-S- transferase P1 ( GSTP1 ) gene promoter hypermethylation [6,7...telomerase activity and GSTP1 promoter methylation in ejaculate as potential screening tests for prostate cancer, Mol. Cell. Probes 14 (2000) 211–217. [7...C. Jeronimo, H. Usadel, R. Henrique, J. Oliveira, C. Lopes, W.G. Nelson, D. Sidransky, Quantitation of GSTP1 methylation in non-neoplastic prostatic

Assembly of Customized TAL Effectors Through Advanced ULtiMATE System.

PubMed

Yang, Junjiao; Guo, Shengjie; Yuan, Pengfei; Wei, Wensheng

2016-01-01

Transcription activator-like effectors (TALEs) have been widely applied in gene targeting. Here we describe an advanced ULtiMATE (USER-based Ligation-Mediated Assembly of TAL Effector) system that utilizes USER fusion technique and archive of 512 tetramer templates to achieve highly efficient construction of TALEs, which takes only half a day to accomplish the assembly of any given TALE construct. This system is also suitable for large-scale assembly of TALENs and any other TALE-based constructions.

The i6A37 tRNA modification is essential for proper decoding of UUX-Leucine codons during rpoS and iraP translation

PubMed Central

Aubee, Joseph I.; Olu, Morenike

2016-01-01

The translation of rpoS (σS), the general stress/stationary phase sigma factor, is tightly regulated at the post-transcriptional level by several factors via mechanisms that are not clearly defined. One of these factors is MiaA, the enzyme necessary for the first step in the N6-isopentyl-2-thiomethyladenosinemethyladenosine 37 (ms2i6A37) tRNA modification. We tested the hypothesis that an elevated UUX-Leucine/total leucine codon ratio can be used to identify transcripts whose translation would be sensitive to loss of the MiaA-dependent modification. We identified iraP as another candidate MiaA-sensitive gene, based on the UUX-Leucine/total leucine codon ratio. An iraP-lacZ fusion was significantly decreased in the absence of MiaA, consistent with our predictive model. To determine the role of MiaA in UUX-Leucine decoding in rpoS and iraP, we measured β-galactosidase-specific activity of miaA− rpoS and iraP translational fusions upon overexpression of leucine tRNAs. We observed suppression of the MiaA effect on rpoS, and not iraP, via overexpression of tRNALeuX but not tRNALeuZ. We also tested the hypothesis that the MiaA requirement for rpoS and iraP translation is due to decoding of UUX-Leucine codons within the rpoS and iraP transcripts, respectively. We observed a partial suppression of the MiaA requirement for rpoS and iraP translational fusions containing one or both UUX-Leucine codons removed. Taken together, this suggests that MiaA is necessary for rpoS and iraP translation through proper decoding of UUX-Leucine codons and that rpoS and iraP mRNAs are both modification tunable transcripts (MoTTs) via the presence of the modification. PMID:26979278

[Disappearance of residual disease confirmed by RT-PCR following induction chemotherapy in two hypoplastic leukemia patients with t(8;21)].

PubMed

Sawada, M; Tsurumi, H; Yamada, T; Hara, T; Oyama, M; Moriwaki, H

1999-04-01

Reverse transcriptase-polymerase chain reaction (RT-PCR) methods often detect the AML1/MTG8 fusion transcript even in acute myelogenous leukemia (AML) patients with t(8;21) who have been in long-term remission. We encountered 2 hypoplastic leukemia patients with t(8;21) who achieved cytogenetic remission with short-term conventional chemotherapy. Patient 1 was a 42-year-old woman. Chromosomal analysis detected t(8;21) (q22;q22) and PCR analysis (35 cycles PCR amplification; detection limit 1 x 10(-5) cells) detected the AML1/MTG8 fusion transcript. Complete remission was obtained with 1 course of chemotherapy consisting of low-dose cytarabine (20 mg x 14 days) and etoposide (50 mg x 14 days). After 2 courses of consolidation chemotherapy consisting of conventional-dose cytarabine and mitoxantrone, the RT-PCR findings were negative for the AML1/MTG8 fusion transcript. Patient 2 was a 67-year-old man. Cytogenetic analysis detected t(8;21) (q22;q22), and was positive for the AML1/MTG8 fusion transcript. After 2 courses of induction chemotherapy comprising low-dose cytarabine (20 mg x 14 days) and etoposide (50 mg x 14 days), and 3 courses of conventional consolidation chemotherapy, RT-PCR analysis confirmed the disappearance of the AML1/MTG8 fusion transcript.

Fibroblast growth factor receptor 1 is fused to FIM in stem-cell myeloproliferative disorder with t(8;13)(p12;q12)

PubMed Central

Popovici, Cornel; Adélaïde, José; Ollendorff, Vincent; Chaffanet, Max; Guasch, Géraldine; Jacrot, Michèle; Leroux, Dominique; Birnbaum, Daniel; Pébusque, Marie-Josèphe

1998-01-01

Chromosome 8p11–12 is the site of a recurrent breakpoint in a myeloproliferative disorder that involves lymphoid (T- or B-cell), myeloid hyperplasia and eosinophilia, and evolves toward acute leukemia. This multilineage involvement suggests the malignant transformation of a primitive hematopoietic stem cell. In this disorder, the 8p11–12 region is associated with three different partners 6q27, 9q33, and 13q12. We describe here the molecular characterization of the t(8;13) translocation that involves the FGFR1 gene from 8p12, encoding a tyrosine kinase receptor for members of the fibroblast growth factor family, and a gene from 13q12, tentatively named FIM (Fused In Myeloproliferative disorders). FIM is related to DXS6673E, a candidate gene for X-linked mental retardation in Xq13.1; this defines a gene family involved in different human pathologies. The two reciprocal fusion transcripts, FIM/FGFR1 and FGFR1/FIM are expressed in the malignant cells. The FIM/FGFR1 fusion protein contains the FIM putative zinc finger motifs and the catalytic domain of FGFR1. We show that it has a constitutive tyrosine kinase activity. PMID:9576949

WHOLE-GENOME SEQUENCING OF SALIVARY GLAND ADENOID CYSTIC CARCINOMA

PubMed Central

Rettig, Eleni M; Talbot, C Conover; Sausen, Mark; Jones, Sian; Bishop, Justin A; Wood, Laura D; Tokheim, Collin; Niknafs, Noushin; Karchin, Rachel; Fertig, Elana J; Wheelan, Sarah J; Marchionni, Luigi; Considine, Michael; Ling, Shizhang; Fakhry, Carole; Papadopoulos, Nickolas; Kinzler, Kenneth W; Vogelstein, Bert; Ha, Patrick K; Agrawal, Nishant

2016-01-01

Adenoid cystic carcinomas (ACCs) of the salivary glands are challenging to understand, treat, and cure. To better understand the genetic alterations underlying the pathogenesis of these tumors, we performed comprehensive genome analyses of 25 fresh-frozen tumors, including whole genome sequencing, expression and pathway analyses. In addition to the well-described MYB-NFIB fusion which was found in 11 tumors (44%), we observed five different rearrangements involving the NFIB transcription factor gene in seven tumors (28%). Taken together, NFIB translocations occurred in 15 of 25 samples (60%, 95%CI=41–77%). In addition, mRNA expression analysis of 17 tumors revealed overexpression of NFIB in ACC tumors compared with normal tissues (p=0.002). There was no difference in NFIB mRNA expression in tumors with NFIB fusions compared to those without. We also report somatic mutations of genes involved in the axonal guidance and Rho family signaling pathways. Finally, we confirm previously described alterations in genes related to chromatin regulation and Notch signaling. Our findings suggest a separate role for NFIB in ACC oncogenesis and highlight important signaling pathways for future functional characterization and potential therapeutic targeting. PMID:26862087

Two-stage control of an oxidative stress regulon: the Escherichia coli SoxR protein triggers redox-inducible expression of the soxS regulatory gene.

PubMed Central

Nunoshiba, T; Hidalgo, E; Amábile Cuevas, C F; Demple, B

1992-01-01

Escherichia coli responds to the redox stress imposed by superoxide-generating agents such as paraquat by activating the synthesis of as many as 80 polypeptides. Expression of a key group of these inducible proteins is controlled at the transcriptional level by the soxRS locus (the soxRS regulon). A two-stage control system was hypothesized for soxRS, in which an intracellular redox signal would trigger the SoxR protein as a transcriptional activator of the soxS gene and the resulting increased levels of SoxS protein would activate transcription of the various soxRS regulon genes (B. Demple and C.F. Amábile Cuevas, Cell 67:837-839, 1990). We have constructed operon fusions of the E. coli lac genes to the soxS promoter to monitor soxS transcription. Expression from the soxS promoter is strongly inducible by paraquat in a manner strictly dependent on a functional soxR gene. Several other superoxide-generating agents also trigger soxR(+)-dependent soxS expression, and the inductions by paraquat and phenazine methosulfate were dependent on the presence of oxygen. Numerous other oxidative stress agents (H2O2, gamma rays, heat shock, etc.) failed to induce soxS, while aerobic growth of superoxide dismutase-deficient bacteria triggered soxR-dependent soxS expression. These results indicate a specific redox signal for soxS induction. A direct role for SoxR protein in the activation of the soxS gene is indicated by band-shift and DNase I footprinting experiments that demonstrate specific binding of the SoxR protein in cell extracts to the soxS promoter. The mode of SoxR binding to DNA appears to be similar to that of its homolog MerR in that the SoxR footprint spans the -10 to -35 region of the soxS promoter. Images PMID:1400156

Adenoid cystic carcinoma: emerging role of translocations and gene fusions

PubMed Central

Wysocki, Piotr T.; Izumchenko, Evgeny; Meir, Juliet; Ha, Patrick K.; Sidransky, David; Brait, Mariana

2016-01-01

Adenoid cystic carcinoma (ACC), the second most common salivary gland malignancy, is notorious for poor prognosis, which reflects the propensity of ACC to progress to clinically advanced metastatic disease. Due to high long-term mortality and lack of effective systemic treatment, the slow-growing but aggressive ACC poses a particular challenge in head and neck oncology. Despite the advancements in cancer genomics, up until recently relatively few genetic alterations critical to the ACC development have been recognized. Although the specific chromosomal translocations resulting in MYB-NFIB fusions provide insight into the ACC pathogenesis and represent attractive diagnostic and therapeutic targets, their clinical significance is unclear, and a substantial subset of ACCs do not harbor the MYB-NFIB translocation. Strategies based on detection of newly described genetic events (such as MYB activating super-enhancer translocations and alterations affecting another member of MYB transcription factor family-MYBL1) offer new hope for improved risk assessment, therapeutic intervention and tumor surveillance. However, the impact of these approaches is still limited by an incomplete understanding of the ACC biology, and the manner by which these alterations initiate and drive ACC remains to be delineated. This manuscript summarizes the current status of gene fusions and other driver genetic alterations in ACC pathogenesis and discusses new therapeutic strategies stemming from the current research. PMID:27533466

Long noncoding RNA EWSAT1-mediated gene repression facilitates Ewing sarcoma oncogenesis

PubMed Central

Marques Howarth, Michelle; Simpson, David; Ngok, Siu P.; Nieves, Bethsaida; Chen, Ron; Siprashvili, Zurab; Vaka, Dedeepya; Breese, Marcus R.; Crompton, Brian D.; Alexe, Gabriela; Hawkins, Doug S.; Jacobson, Damon; Brunner, Alayne L.; West, Robert; Mora, Jaume; Stegmaier, Kimberly; Khavari, Paul; Sweet-Cordero, E. Alejandro

2014-01-01

Chromosomal translocation that results in fusion of the genes encoding RNA-binding protein EWS and transcription factor FLI1 (EWS-FLI1) is pathognomonic for Ewing sarcoma. EWS-FLI1 alters gene expression through mechanisms that are not completely understood. We performed RNA sequencing (RNAseq) analysis on primary pediatric human mesenchymal progenitor cells (pMPCs) expressing EWS-FLI1 in order to identify gene targets of this oncoprotein. We determined that long noncoding RNA-277 (Ewing sarcoma–associated transcript 1 [EWSAT1]) is upregulated by EWS-FLI1 in pMPCs. Inhibition of EWSAT1 expression diminished the ability of Ewing sarcoma cell lines to proliferate and form colonies in soft agar, whereas EWSAT1 inhibition had no effect on other cell types tested. Expression of EWS-FLI1 and EWSAT1 repressed gene expression, and a substantial fraction of targets that were repressed by EWS-FLI1 were also repressed by EWSAT1. Analysis of RNAseq data from primary human Ewing sarcoma further supported a role for EWSAT1 in mediating gene repression. We identified heterogeneous nuclear ribonucleoprotein (HNRNPK) as an RNA-binding protein that interacts with EWSAT1 and found a marked overlap in HNRNPK-repressed genes and those repressed by EWS-FLI1 and EWSAT1, suggesting that HNRNPK participates in EWSAT1-mediated gene repression. Together, our data reveal that EWSAT1 is a downstream target of EWS-FLI1 that facilitates the development of Ewing sarcoma via the repression of target genes. PMID:25401475

[Clinical utility of real-time fluorescent PCR for combined detection of anaplastic lymphoma kinase and c-ros oncogene 1 receptor tyrosine kinase in non-small cell lung cancer].

PubMed

Bai, D Y; Zhang, H P; Zhong, S; Suo, W H; Gao, D H; Ding, Y; Tu, J H

2016-12-23

Objective: To investigate the clinical application value of combined detection of ALK fusion gene and c-ros oncogene 1 receptor tyrosine kinase (ROS1) fusion gene in non-small cell lung cancer (NSCLC) using real-time fluorescent PCR. Methods: A kit for combined detection of ALK fusion gene and ROS1 fusion gene based on fluorescent PCR was used to simultaneously detect the two fusion genes in 302 cases of NSCLC specimens. The results were validated through Sanger sequencing. The consistency of the two detection methods was analyzed. Results: All 302 cases of NSCLC specimens were successfully analyzed through fluorescent PCR (302/302). 12 cases (4.0%) were found to contain ALK fusion gene, including 3 cases with ALK-M1, 3 with ALK-M2, 3 with ALK-M3, 1 with ALK-M4, and 2 with ALK-M6 fusion gene.12 cases (4.0%) were found to contain ROS1 fusion gene, including 1 case with ROS1-M7, 8 cases with ROS1-M8, 1 case with ROS1-M12, 1 case with ROS1-M14, and 1 case with double-positive ROS1-M3 and ROS1-M8 fusion genes. The total detection rate of ALK fusion gene and ROS1 fusion gene was 7.9% (24/302) and 278 cases showed to be negative for ALK fusion gene and ROS1 fusion gene. The successful detection rates for Sanger DNA sequencing were also 100%. The positive, negative and total coincidence rates obtained by real-time fluorescent PCR and by Sanger DNA sequencing were all 100%. Conclusions: The results of Sanger DNA sequencing demonstrate that the real-time fluorescent PCR assay is equally effective in detecting ALK and ROS1 fusion genes in NSCLC tissues. Furthermore, real-time fluorescent PCR assay can be used to detect trace ALK and ROS1 fusion gene simultaneously in tiny samples, and can save time and avoid repeated sampling. It is worthy of recommendation as a rapid and reliable detection technique.

Genomic and Epigenomic Landscapes of Adult De Novo Acute Myeloid Leukemia

PubMed Central

2013-01-01

BACKGROUND Many mutations that contribute to the pathogenesis of acute myeloid leukemia (AML) are undefined. The relationships between patterns of mutations and epigenetic phenotypes are not yet clear. METHODS We analyzed the genomes of 200 clinically annotated adult cases of de novo AML, using either whole-genome sequencing (50 cases) or whole-exome sequencing (150 cases), along with RNA and microRNA sequencing and DNA-methylation analysis. RESULTS AML genomes have fewer mutations than most other adult cancers, with an average of only 13 mutations found in genes. Of these, an average of 5 are in genes that are recurrently mutated in AML. A total of 23 genes were significantly mutated, and another 237 were mutated in two or more samples. Nearly all samples had at least 1 nonsynonymous mutation in one of nine categories of genes that are almost certainly relevant for pathogenesis, including transcription-factor fusions (18% of cases), the gene encoding nucleophosmin (NPM1) (27%), tumor-suppressor genes (16%), DNA-methylation–related genes (44%), signaling genes (59%), chromatin-modifying genes (30%), myeloid transcription-factor genes (22%), cohesin-complex genes (13%), and spliceosome-complex genes (14%). Patterns of cooperation and mutual exclusivity suggested strong biologic relationships among several of the genes and categories. CONCLUSIONS We identified at least one potential driver mutation in nearly all AML samples and found that a complex interplay of genetic events contributes to AML pathogenesis in individual patients. The databases from this study are widely available to serve as a foundation for further investigations of AML pathogenesis, classification, and risk stratification. (Funded by the National Institutes of Health.) PMID:23634996

Fusion of NUP98 and the SET binding protein 1 (SETBP1) gene in a paediatric acute T cell lymphoblastic leukaemia with t(11;18)(p15;q12).

PubMed

Panagopoulos, Ioannis; Kerndrup, Gitte; Carlsen, Niels; Strömbeck, Bodil; Isaksson, Margareth; Johansson, Bertil

2007-01-01

Three NUP98 chimaeras have previously been reported in T cell acute lymphoblastic leukaemia (T-ALL): NUP98/ADD3, NUP98/CCDC28A, and NUP98/RAP1GDS1. We report a T-ALL with t(11;18)(p15;q12) resulting in a novel NUP98 fusion. Fluorescent in situ hybridisation showed NUP98 and SET binding protein 1(SETBP1) fusion signals; other analyses showed that exon 12 of NUP98 was fused in-frame with exon 5 of SETBP1. Nested polymerase chain reaction did not amplify the reciprocal SETBP1/NUP98, suggesting that NUP98/SETBP1 transcript is pathogenetically important. SETBP1 has previously not been implicated in leukaemias; however, it encodes a protein that specifically interacts with SET, fused to NUP214 in a case of acute undifferentiated leukaemia.

PRADA: pipeline for RNA sequencing data analysis.

PubMed

Torres-García, Wandaliz; Zheng, Siyuan; Sivachenko, Andrey; Vegesna, Rahulsimham; Wang, Qianghu; Yao, Rong; Berger, Michael F; Weinstein, John N; Getz, Gad; Verhaak, Roel G W

2014-08-01

Technological advances in high-throughput sequencing necessitate improved computational tools for processing and analyzing large-scale datasets in a systematic automated manner. For that purpose, we have developed PRADA (Pipeline for RNA-Sequencing Data Analysis), a flexible, modular and highly scalable software platform that provides many different types of information available by multifaceted analysis starting from raw paired-end RNA-seq data: gene expression levels, quality metrics, detection of unsupervised and supervised fusion transcripts, detection of intragenic fusion variants, homology scores and fusion frame classification. PRADA uses a dual-mapping strategy that increases sensitivity and refines the analytical endpoints. PRADA has been used extensively and successfully in the glioblastoma and renal clear cell projects of The Cancer Genome Atlas program.  http://sourceforge.net/projects/prada/  gadgetz@broadinstitute.org or rverhaak@mdanderson.org  Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

C11orf95-RELA fusion present in a primary supratentorial ependymoma and recurrent sarcoma.

PubMed

Cachia, David; Wani, Khalida; Penas-Prado, Marta; Olar, Adriana; McCutcheon, Ian E; Benjamin, Robert S; Armstrong, Terri S; Gilbert, Mark R; Aldape, Kenneth D

2015-04-01

Ependymomas are rare glial tumors of the central nervous system that arise from the cells lining the ventricles and central canal within the spinal cord. The distribution of these tumors along the neuroaxis varies by age, most commonly involving the spinal cord in adults and the posterior fossa in children. It is becoming evident that ependymomas of infratentorial, supratentorial, and spinal cord location are genetically distinct which may explain the differences in clinical outcomes. A novel oncogenic fusion involving the C11orf95 and RELA genes was recently described in supratentorial ependymomas that results in constitutive aberrant activation of the nuclear factor-kB signaling pathway. Ependymosarcomas are rare neoplasms in which a malignant mesenchymal component arises within an ependymoma. We here describe a case of a sarcoma developing in a patient previously treated with chemotherapy and radiation whose original ependymoma and recurrent sarcoma were both shown to carry the type 1 C11orf95-RELA fusion transcript indicating a monoclonal origin for both tumors.

Targeted repression of AXIN2 and MYC gene expression using designer TALEs

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rennoll, Sherri A.; Scott, Samantha A.; Yochum, Gregory S., E-mail: gsy3@psu.edu

Highlights: • We designed TALE–SID fusion proteins to target AXIN2 and MYC. • TALE–SIDs bound the chromosomal AXIN2 and MYC genes and repressed their expression. • TALE–SIDs repress β-catenin{sup S45F}-dependent AXIN2 and MYC transcription. - Abstract: Designer TALEs (dTALEs) are chimeric transcription factors that can be engineered to regulate gene expression in mammalian cells. Whether dTALEs can block gene transcription downstream of signal transduction cascades, however, has yet to be fully explored. Here we tested whether dTALEs can be used to target genes whose expression is controlled by Wnt/β-catenin signaling. TALE DNA binding domains were engineered to recognize sequences adjacentmore » to Wnt responsive enhancer elements (WREs) that control expression of axis inhibition protein 2 (AXIN2) and c-MYC (MYC). These custom DNA binding domains were linked to the mSin3A interaction domain (SID) to generate TALE–SID chimeric repressors. The TALE–SIDs repressed luciferase reporter activity, bound their genomic target sites, and repressed AXIN2 and MYC expression in HEK293 cells. We generated a novel HEK293 cell line to determine whether the TALE–SIDs could function downstream of oncogenic Wnt/β-catenin signaling. Treating these cells with doxycycline and tamoxifen stimulates nuclear accumulation of a stabilized form of β-catenin found in a subset of colorectal cancers. The TALE–SIDs repressed AXIN2 and MYC expression in these cells, which suggests that dTALEs could offer an effective therapeutic strategy for the treatment of colorectal cancer.« less

Isoprenoid Pyrophosphate-Dependent Transcriptional Regulation of Carotenogenesis in Corynebacterium glutamicum

PubMed Central

Henke, Nadja A.; Heider, Sabine A. E.; Hannibal, Silvin; Wendisch, Volker F.; Peters-Wendisch, Petra

2017-01-01

Corynebacterium glutamicum is a natural producer of the C50 carotenoid decaprenoxanthin. The crtEcg0722crtBIYEb operon comprises most of its genes for terpenoid biosynthesis. The MarR-type regulator encoded upstream and in divergent orientation of the carotenoid biosynthesis operon has not yet been characterized. This regulator, named CrtR in this study, is encoded in many actinobacterial genomes co-occurring with terpenoid biosynthesis genes. CrtR was shown to repress the crt operon of C. glutamicum since DNA microarray experiments revealed that transcript levels of crt operon genes were increased 10 to 70-fold in its absence. Transcriptional fusions of a promoter-less gfp gene with the crt operon and crtR promoters confirmed that CrtR represses its own gene and the crt operon. Gel mobility shift assays with purified His-tagged CrtR showed that CrtR binds to a region overlapping with the −10 and −35 promoter sequences of the crt operon. Isoprenoid pyrophosphates interfered with binding of CrtR to its target DNA, a so far unknown mechanism for regulation of carotenogenesis. The molecular details of protein-ligand interactions remain to be studied. Decaprenoxanthin synthesis by C. glutamicum wild type was enhanced 10 to 30-fold upon deletion of crtR and was decreased 5 to 6-fold as result of crtR overexpression. Moreover, deletion of crtR was shown as metabolic engineering strategy to improve production of native and non-native carotenoids including lycopene, β-carotene, C.p. 450 and sarcinaxanthin. PMID:28484430

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sun, Zhen; Department of Biochemistry and Molecular Biology, Program in Molecular Cell Biology, Zhejiang University School of Medicine, Hangzhou, Zhejiang 310058; Xiang, Wenqing

Highlights: {yields} LNA-modified oligonucleotides can pass through the plasma membrane of cultured cells even without using transfection machinery. {yields} LNA-modified oligonucleotides passed efficiently across the cell membrane, and lipid-coating facilitated translocation from the cytoplasm to the nucleus. {yields} LNA-oligonucleotide designed to target nuclear HBV DNA efficiently suppresses HBV replication and transcription in cultured hepatic cells. -- Abstract: Silencing target genes with small regulatory RNAs is widely used to investigate gene function and therapeutic drug development. Recently, triplex-based approaches have provided another attractive means to achieve targeted gene regulation and gene manipulation at the molecular and cellular levels. Nuclear entry ofmore » oligonucleotides and enhancement of their affinity to the DNA targets are key points of such approaches. In this study, we developed lipid-based transport of a locked-nucleic-acid (LNA)-modified oligonucleotide for hepatitis B virus (HBV) DNA interference in human hepatocytes expressing HBV genomic DNA. In these cells, the LNA-modified oligonucleotides passed efficiently across the cell membrane, and lipid-coating facilitated translocation from the cytoplasm to the nucleus. The oligonucleotide specifically targeting HBV DNA clearly interfered with HBV DNA transcription as shown by a block in pregenomic RNA (pgRNA) production. The HBV DNA-targeted oligonucleotide suppressed HBV DNA replication and HBV protein production more efficiently than small interfering RNAs directed to the pgRNA. These results demonstrate that fusion with lipid can carry LNA-modified oligonucleotides to the nucleus where they regulate gene expression. Interfering with HBV DNA transcription by LNA-modified oligonucleotides has strong potential as a new strategy for HBV inhibition.« less

Zscan4 is regulated by PI3-kinase and DNA-damaging agents and directly interacts with the transcriptional repressors LSD1 and CtBP2 in mouse embryonic stem cells.

PubMed

Storm, Michael P; Kumpfmueller, Benjamin; Bone, Heather K; Buchholz, Michael; Sanchez Ripoll, Yolanda; Chaudhuri, Julian B; Niwa, Hitoshi; Tosh, David; Welham, Melanie J

2014-01-01

The Zscan4 family of genes, encoding SCAN-domain and zinc finger-containing proteins, has been implicated in the control of early mammalian embryogenesis as well as the regulation of pluripotency and maintenance of genome integrity in mouse embryonic stem cells. However, many features of this enigmatic family of genes are poorly understood. Here we show that undifferentiated mouse embryonic stem cell (ESC) lines simultaneously express multiple members of the Zscan4 gene family, with Zscan4c, Zscan4f and Zscan4-ps2 consistently being the most abundant. Despite this, between only 0.1 and 0.7% of undifferentiated mouse pluripotent stem cells express Zscan4 protein at a given time, consistent with a very restricted pattern of Zscan4 transcripts reported previously. Herein we demonstrate that Zscan4 expression is regulated by the p110α catalytic isoform of phosphoinositide 3-kinases and is induced following exposure to a sub-class of DNA-damage-inducing agents, including Zeocin and Cisplatin. Furthermore, we observe that Zscan4 protein expression peaks during the G2 phase of the cell cycle, suggesting that it may play a critical role at this checkpoint. Studies with GAL4-fusion proteins suggest a role for Zscan4 in transcriptional regulation, further supported by the fact that protein interaction analyses demonstrate that Zscan4 interacts with both LSD1 and CtBP2 in ESC nuclei. This study advances and extends our understanding of Zscan4 expression, regulation and mechanism of action. Based on our data we propose that Zscan4 may regulate gene transcription in mouse ES cells through interaction with LSD1 and CtBP2.

Zscan4 Is Regulated by PI3-Kinase and DNA-Damaging Agents and Directly Interacts with the Transcriptional Repressors LSD1 and CtBP2 in Mouse Embryonic Stem Cells

PubMed Central

Bone, Heather K.; Buchholz, Michael; Sanchez Ripoll, Yolanda; Chaudhuri, Julian B.; Niwa, Hitoshi; Tosh, David; Welham, Melanie J.

2014-01-01

The Zscan4 family of genes, encoding SCAN-domain and zinc finger-containing proteins, has been implicated in the control of early mammalian embryogenesis as well as the regulation of pluripotency and maintenance of genome integrity in mouse embryonic stem cells. However, many features of this enigmatic family of genes are poorly understood. Here we show that undifferentiated mouse embryonic stem cell (ESC) lines simultaneously express multiple members of the Zscan4 gene family, with Zscan4c, Zscan4f and Zscan4-ps2 consistently being the most abundant. Despite this, between only 0.1 and 0.7% of undifferentiated mouse pluripotent stem cells express Zscan4 protein at a given time, consistent with a very restricted pattern of Zscan4 transcripts reported previously. Herein we demonstrate that Zscan4 expression is regulated by the p110α catalytic isoform of phosphoinositide 3-kinases and is induced following exposure to a sub-class of DNA-damage-inducing agents, including Zeocin and Cisplatin. Furthermore, we observe that Zscan4 protein expression peaks during the G2 phase of the cell cycle, suggesting that it may play a critical role at this checkpoint. Studies with GAL4-fusion proteins suggest a role for Zscan4 in transcriptional regulation, further supported by the fact that protein interaction analyses demonstrate that Zscan4 interacts with both LSD1 and CtBP2 in ESC nuclei. This study advances and extends our understanding of Zscan4 expression, regulation and mechanism of action. Based on our data we propose that Zscan4 may regulate gene transcription in mouse ES cells through interaction with LSD1 and CtBP2. PMID:24594919

Adenylyl cyclase A expression is tip-specific in Dictyostelium slugs and directs StatA nuclear translocation and CudA gene expression.

PubMed

Verkerke-van Wijk, I; Fukuzawa, M; Devreotes, P N; Schaap, P

2001-06-01

cAMP oscillations, generated by adenylyl cyclase A (ACA), coordinate cell aggregation in Dictyostelium and have also been implicated in organizer function during multicellular development. We used a gene fusion of the ACA promoter with a labile lacZ derivative to study the expression pattern of ACA. During aggregation, most cells expressed ACA, but thereafter expression was lost in all cells except those of the anterior tip. Before aggregation, ACA transcription was strongly upregulated by nanomolar cAMP pulses. Postaggregative transcription was sustained by nanomolar cAMP pulses, but downregulated by a continuous micromolar cAMP stimulus and by the stalk-cell-inducing factor DIF. Earlier work showed that the transcription factor StatA displays tip-specific nuclear translocation and directs tip-specific expression of the nuclear protein CudA, which is essential for culmination. Both StatA and CudA were present in nuclei throughout the entire slug in an aca null mutant that expresses ACA from the constitutive actin15 promoter. This suggests that the tip-specific expression of ACA directs tip-specific nuclear translocation of StatA and tip-specific expression of CudA. Copyright 2001 Academic Press.

OsSLI1, a homeodomain containing transcription activator, involves abscisic acid related stress response in rice (Oryza sativa L.).

PubMed

Huang, Xi; Duan, Min; Liao, Jiakai; Yuan, Xi; Chen, Hui; Feng, Jiejie; Huang, Ji; Zhang, Hong-Sheng

2014-01-01

Homeodomain-leucine zipper type I (HD-Zip I) proteins are involved in the regulation of plant development and response to environmental stresses. In this study, OsSLI1 (Oryza sativa stress largely induced 1), encoding a member of the HD-Zip I subfamily, was isolated from rice. The expression of OsSLI1 was dramatically induced by multiple abiotic stresses and exogenous abscisic acid (ABA). In silico sequence analysis discovered several cis-acting elements including multiple ABREs (ABA-responsive element binding factors) in the upstream promoter region of OsSLI1. The OsSLI1-GFP fusion protein was localized in the nucleus of rice protoplast cells and the transcriptional activity of OsSLI1 was confirmed by the yeast hybrid system. Further, it was found that OsSLI1 expression was enhanced in an ABI5-Like1 (ABL1) deficiency rice mutant abl1 under stress conditions, suggesting that ABL1 probably negatively regulates OsSLI1 gene expression. Moreover, it was found that OsSLI1 was regulated in panicle development. Taken together, OsSLI1 may be a transcriptional activator regulating stress-responsive gene expression and panicle development in rice.

Ligand specificity of MobR, a transcriptional regulator for the 3-hydroxybenzoate hydroxylase gene of Comamonas testosteroni KH122-3s

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yoshida, Mariko; Hiromoto, Takeshi; Hosokawa, Keiichi

2007-10-19

MobR from Comamonas testosteroni KH122-3s is a member of the MarR family of transcriptional regulators and functions as a repressor for the mobA gene that encodes a 3-hydroxybenzoate 4-hydroxylase. 3-Hydroxybenzoate binds to MobR as a ligand, resulting in an efficient induction of mobA. Various 3-hydroxybenzoate analogues were examined for their inducibilities using the mobA::lacZ transcriptional fusion system. {beta}-Galactosidase was induced by the addition of 2,3-dihydroxybenzoate or 3,5-dihydroxybenzoate besides 3-hydroxybenzoate, suggesting that the hydroxyl group at position 3 is critical in addition to the carboxyl group on the aromatic ring. A gel mobility-shift assay also showed that MobR was released frommore » the target DNA in the presence of these compounds. Circular dichroism studies demonstrated that MobR adopted two conformational states corresponding to the 3-hydroxybenzoate-bound and unbound forms. Other ligands also induced the structural change as well; however, the tertiary structures of converted forms were different from those by 3-hydroxybenzoate.« less

Chimeric peptide-mediated siRNA transduction to inhibit HIV-1 infection.

PubMed

Bivalkar-Mehla, Shalmali; Mehla, Rajeev; Chauhan, Ashok

2017-04-01

Persistent human immunodeficiency virus 1 (HIV-1) infection provokes immune activation and depletes CD4 +  lymphocytes, leading to acquired immunodeficiency syndrome. Uninterrupted administration of combination antiretroviral therapy (cART) in HIV-infected patients suppresses viral replication to below the detectable level and partially restores the immune system. However, cART-unresponsive residual HIV-1 infection and elusive transcriptionally silent but reactivatable viral reservoirs maintain a permanent viral DNA blue print. The virus rebounds within a few weeks after interruption of suppressive therapy. Adjunct gene therapy to control viral replication by ribonucleic acid interference (RNAi) is a post-transcriptional gene silencing strategy that could suppress residual HIV-1 burden and overcome viral resistance. Small interfering ribonucleic acids (siRNAs) are efficient transcriptional inhibitors, but need delivery systems to reach inside target cells. We investigated the potential of chimeric peptide (FP-PTD) to deliver specific siRNAs to HIV-1-susceptible and permissive cells. Chimeric FP-PTD peptide was designed with an RNA binding domain (PTD) to bind siRNA and a cell fusion peptide domain (FP) to enter cells. FP-PTD-siRNA complex entered and inhibited HIV-1 replication in susceptible cells, and could be a candidate for in vivo testing.

Heterogeneity of BCR-ABL rearrangement in patients with chronic myeloid leukemia in Pakistan.

PubMed

Tabassum, Najia; Saboor, Mohammad; Ghani, Rubina; Moinuddin, Moinuddin

2014-07-01

Breakpoint cluster region-Abelson (BCR-ABL) rearrangement or Philadelphia (Ph) chromosome in Chronic Myeloid Leukemia (CML) is derived from a reciprocal chromosomal translocation between ABL gene on chromosome 9 and BCR gene on chromosome 22. This chimeric protein has various sizes and therefore different clinical behaviour. The purpose of this study was to determine the heterogeneity of BCR-ABL rearrangement in patients with Ph(+)CML in Pakistan. The study was conducted at Civil Hospital and Baqai Institute of Hematology (BIH) Karachi. Blood samples from 25 patients with CML were collected. Multiplex reverse transcription polymerase chain reaction (RT-PCR) was performed to identify various BCR-ABL transcripts. All 25 samples showed BCR-ABL rearrangements. Out of these, 24 (96%) patients expressed p210 BCR-ABL rearrangements i.e. 60% (n=15) had b3a2 and 32% (n=8) had b2a2 rearrangements. Co-expression of b3a2 /b2a2 rearrangement and p190 (e1a3) rearrangement was also identified in two patients. It is apparent that majority of the patients had p210 BCR-ABL rearrangements. Frequency of co-expression and rare fusion transcripts was very low.

The Herbaspirillum seropedicae SmR1 Fnr orthologs controls the cytochrome composition of the electron transport chain.

PubMed

Batista, Marcelo B; Sfeir, Michelle Z T; Faoro, Helisson; Wassem, Roseli; Steffens, Maria B R; Pedrosa, Fábio O; Souza, Emanuel M; Dixon, Ray; Monteiro, Rose A

2013-01-01

The transcriptional regulatory protein Fnr, acts as an intracellular redox sensor regulating a wide range of genes in response to changes in oxygen levels. Genome sequencing of Herbaspirillum seropedicae SmR1 revealed the presence of three fnr-like genes. In this study we have constructed single, double and triple fnr deletion mutant strains of H. seropedicae. Transcriptional profiling in combination with expression data from reporter fusions, together with spectroscopic analysis, demonstrates that the Fnr1 and Fnr3 proteins not only regulate expression of the cbb3-type respiratory oxidase, but also control the cytochrome content and other component complexes required for the cytochrome c-based electron transport pathway. Accordingly, in the absence of the three Fnr paralogs, growth is restricted at low oxygen tensions and nitrogenase activity is impaired. Our results suggest that the H. seropedicae Fnr proteins are major players in regulating the composition of the electron transport chain in response to prevailing oxygen concentrations.

The Herbaspirillum seropedicae SmR1 Fnr orthologs controls the cytochrome composition of the electron transport chain

PubMed Central

Batista, Marcelo B.; Sfeir, Michelle Z. T.; Faoro, Helisson; Wassem, Roseli; Steffens, Maria B. R.; Pedrosa, Fábio O.; Souza, Emanuel M.; Dixon, Ray; Monteiro, Rose A.

2013-01-01

The transcriptional regulatory protein Fnr, acts as an intracellular redox sensor regulating a wide range of genes in response to changes in oxygen levels. Genome sequencing of Herbaspirillum seropedicae SmR1 revealed the presence of three fnr-like genes. In this study we have constructed single, double and triple fnr deletion mutant strains of H. seropedicae. Transcriptional profiling in combination with expression data from reporter fusions, together with spectroscopic analysis, demonstrates that the Fnr1 and Fnr3 proteins not only regulate expression of the cbb3-type respiratory oxidase, but also control the cytochrome content and other component complexes required for the cytochrome c-based electron transport pathway. Accordingly, in the absence of the three Fnr paralogs, growth is restricted at low oxygen tensions and nitrogenase activity is impaired. Our results suggest that the H. seropedicae Fnr proteins are major players in regulating the composition of the electron transport chain in response to prevailing oxygen concentrations. PMID:23996052

Identification of in vivo regulators of the Vibrio cholerae xds gene using a high-throughput genetic selection.

PubMed

McDonough, Emilykate; Lazinski, David W; Camilli, Andrew

2014-04-01

Vibrio cholerae, the causative agent of cholera, remains a threat to public health in areas with inadequate sanitation. As a waterborne pathogen, V. cholerae moves between two dissimilar environments, aquatic reservoirs and the intestinal tract of humans. Accordingly, this pathogen undergoes adaptive shifts in gene expression throughout the different stages of its lifecycle. One particular gene, xds, encodes a secreted exonuclease that was previously identified as being induced during infection. Here we sought to identify regulators responsible for the in vivo-specific induction of xds. A transcriptional fusion of xds to two consecutive antibiotic resistance genes was used to select transposon mutants that had inserted within or adjacent to regulatory genes and thereby caused increased expression of the xds fusion under non-inducing conditions. Large pools of selected insertion sites were sequenced in a high throughput manner using Tn-seq to identify potential mechanisms of xds regulation. Our selection identified the two-component system PhoB/R as the dominant activator of xds expression. In vitro validation confirmed that PhoB, a protein which is only active during phosphate limitation, was responsible for xds activation. Using xds expression as a biosensor of the extracellular phosphate level, we observed that the mouse small intestine is a phosphate-limited environment. © 2014 John Wiley & Sons Ltd.

The tumorigenic FGFR3-TACC3 gene fusion escapes miR-99a regulation in glioblastoma.

PubMed

Parker, Brittany C; Annala, Matti J; Cogdell, David E; Granberg, Kirsi J; Sun, Yan; Ji, Ping; Li, Xia; Gumin, Joy; Zheng, Hong; Hu, Limei; Yli-Harja, Olli; Haapasalo, Hannu; Visakorpi, Tapio; Liu, Xiuping; Liu, Chang-Gong; Sawaya, Raymond; Fuller, Gregory N; Chen, Kexin; Lang, Frederick F; Nykter, Matti; Zhang, Wei

2013-02-01

Fusion genes are chromosomal aberrations that are found in many cancers and can be used as prognostic markers and drug targets in clinical practice. Fusions can lead to production of oncogenic fusion proteins or to enhanced expression of oncogenes. Several recent studies have reported that some fusion genes can escape microRNA regulation via 3'-untranslated region (3'-UTR) deletion. We performed whole transcriptome sequencing to identify fusion genes in glioma and discovered FGFR3-TACC3 fusions in 4 of 48 glioblastoma samples from patients both of mixed European and of Asian descent, but not in any of 43 low-grade glioma samples tested. The fusion, caused by tandem duplication on 4p16.3, led to the loss of the 3'-UTR of FGFR3, blocking gene regulation of miR-99a and enhancing expression of the fusion gene. The fusion gene was mutually exclusive with EGFR, PDGFR, or MET amplification. Using cultured glioblastoma cells and a mouse xenograft model, we found that fusion protein expression promoted cell proliferation and tumor progression, while WT FGFR3 protein was not tumorigenic, even under forced overexpression. These results demonstrated that the FGFR3-TACC3 gene fusion is expressed in human cancer and generates an oncogenic protein that promotes tumorigenesis in glioblastoma.

MYBL1 rearrangements and MYB amplification in breast adenoid cystic carcinomas lacking the MYB-NFIB fusion gene.

PubMed

Kim, Jisun; Geyer, Felipe C; Martelotto, Luciano G; Ng, Charlotte Ky; Lim, Raymond S; Selenica, Pier; Li, Anqi; Pareja, Fresia; Fusco, Nicola; Edelweiss, Marcia; Kumar, Rahul; Gularte-Merida, Rodrigo; Forbes, Andre N; Khurana, Ekta; Mariani, Odette; Badve, Sunil; Vincent-Salomon, Anne; Norton, Larry; Reis-Filho, Jorge S; Weigelt, Britta

2018-02-01

Breast adenoid cystic carcinoma (AdCC), a rare type of triple-negative breast cancer, has been shown to be driven by MYB pathway activation, most often underpinned by the MYB-NFIB fusion gene. Alternative genetic mechanisms, such as MYBL1 rearrangements, have been reported in MYB-NFIB-negative salivary gland AdCCs. Here we report on the molecular characterization by massively parallel sequencing of four breast AdCCs lacking the MYB-NFIB fusion gene. In two cases, we identified MYBL1 rearrangements (MYBL1-ACTN1 and MYBL1-NFIB), which were associated with MYBL1 overexpression. A third AdCC harboured a high-level MYB amplification, which resulted in MYB overexpression at the mRNA and protein levels. RNA-sequencing and whole-genome sequencing revealed no definite alternative driver in the fourth AdCC studied, despite high levels of MYB expression and the activation of pathways similar to those activated in MYB-NFIB-positive AdCCs. In this case, a deletion encompassing the last intron and part of exon 15 of MYB, including the binding site of ERG-1, a transcription factor that may downregulate MYB, and the exon 15 splice site, was detected. In conclusion, we demonstrate that MYBL1 rearrangements and MYB amplification probably constitute alternative genetic drivers of breast AdCCs, functioning through MYBL1 or MYB overexpression. These observations emphasize that breast AdCCs probably constitute a convergent phenotype, whereby activation of MYB and MYBL1 and their downstream targets can be driven by the MYB-NFIB fusion gene, MYBL1 rearrangements, MYB amplification, or other yet to be identified mechanisms. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

Fusion primer and nested integrated PCR (FPNI-PCR): a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning

PubMed Central

2011-01-01

Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR) for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs). These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures. PMID:22093809

[Detection of ALK, ROS1 and RET fusion genes in non-small cell lung cancer patients and its clinicopathologic correlation].

PubMed

Zhong, Shan; Zhang, Haiping; Bai, Dongyu; Gao, Dehong; Zheng, Jie; Ding, Yi

2015-09-01

To study the prevalence of ALK, ROS1 and RET fusion genes in non-small cell lung cancer (NSCLC), and its correlation with clinicopathologic features. Formalin-fixed and paraffin-embedded tissue sections from samples of 302 patients with NSCLC were screened for ALK, ROS1, RET fusions by real-time polymerase chain reaction (PCR). All of the cases were validated by Sanger DNA sequencing. The relationship between ALK, ROS1, RET fusion genes and clinicopathologic features were analyzed. In the cohort of 302 NSCLC samples, 3.97% (12/302) were found to contain ALK fusion genes, including 3 cases with E13; A20 gene fusion, 3 cases with E6; A20 gene fusion and 3 cases with E20; A20 gene fusion. There was no statistically significant difference in patient's gender, age, smoking history and histologic type. Moreover, in the 302 NSCLC samples studied, 3.97% (12/302) were found to contain ROS1 fusion genes, with CD74-ROS1 fusion identified in 9 cases. There was no statistically significant difference in patients' gender, age, smoking history and histologic type. One non-smoking elderly female patient with pulmonary adenocarcinoma had RET gene fusion. None of the cases studied had concurrent ALK, ROS1 and RET mutations. The ALK, ROS1 and RET fusion gene mutation rates in NSCLC are low, they represent some specific molecular subtypes of NSCLC. Genetic testing has significant meaning to guide clinical targeted therapy.

Regulation of Serratia marcescens ompF and ompC porin genes in response to osmotic stress, salicylate, temperature and pH.

PubMed

Begic, Sanela; Worobec, Elizabeth A

2006-02-01

Serratia marcescens is a Gram-negative enterobacterium that has become an important opportunistic pathogen, largely due to its high degree of natural antibiotic resistance. One factor contributing to this natural antibiotic resistance is reduced outer membrane permeability, which is controlled in part by OmpC and OmpF porin proteins. OmpF expression is regulated by micF, an RNA transcript encoded upstream of the ompC gene, which hybridizes with the ompF transcript to inhibit its translation. Regulation of S. marcescens porin gene expression, as well as that of micF, was investigated using beta-galactosidase reporter gene fusions in response to 5, 8 and 10 % sucrose, 1, 5 and 8 mM salicylate, and different pH and temperature values. beta-Galactosidase activity assays revealed that a lower growth temperature (28 degrees C), a more basic pH (pH 8), and an absence of sucrose and salicylate induce the transcription of the ompF gene, whereas the induction of ompC is stimulated at a higher growth temperature (42 degrees C), acidic pH (pH 6), and maximum concentrations of sucrose (10 %) and salicylate (8 mM). In addition, when multiple conditions were tested, temperature had the predominant effect, followed by pH. In this study, it was found that the MicF regulatory mechanism does not play a role in the osmoregulation of the ompF and ompC genes, whereas MicF does repress OmpF expression in the presence of salicylate and high growth temperature, and under low pH conditions.

Genomic profiling of rice sperm cell transcripts reveals conserved and distinct elements in the flowering plant male germ lineage.

PubMed

Russell, Scott D; Gou, Xiaoping; Wong, Chui E; Wang, Xinkun; Yuan, Tong; Wei, Xiaoping; Bhalla, Prem L; Singh, Mohan B

2012-08-01

Genomic assay of sperm cell RNA provides insight into functional control, modes of regulation, and contributions of male gametes to double fertilization. Sperm cells of rice (Oryza sativa) were isolated from field-grown, disease-free plants and RNA was processed for use with the full-genome Affymetrix microarray. Comparison with Gene Expression Omnibus (GEO) reference arrays confirmed expressionally distinct gene profiles. A total of 10,732 distinct gene sequences were detected in sperm cells, of which 1668 were not expressed in pollen or seedlings. Pathways enriched in male germ cells included ubiquitin-mediated pathways, pathways involved in chromatin modeling including histones, histone modification and nonhistone epigenetic modification, and pathways related to RNAi and gene silencing. Genome-wide expression patterns in angiosperm sperm cells indicate common and divergent themes in the male germline that appear to be largely self-regulating through highly up-regulated chromatin modification pathways. A core of highly conserved genes appear common to all sperm cells, but evidence is still emerging that another class of genes have diverged in expression between monocots and dicots since their divergence. Sperm cell transcripts present at fusion may be transmitted through plasmogamy during double fertilization to effect immediate post-fertilization expression of early embryo and (or) endosperm development. © 2012 The Authors. New Phytologist © 2012 New Phytologist Trust.

Analysis of the hypoxia-sensing pathway in Drosophila melanogaster

PubMed Central

Arquier, Nathalie; Vigne, Paul; Duplan, Eric; Hsu, Tien; Therond, Pascal P.; Frelin, Christian; D'Angelo, Gisela

2005-01-01

The mechanism by which hypoxia induces gene transcription involves the inhibition of HIF-1α (hypoxia-inducible factor-1 α subunit) PHD (prolyl hydroxylase) activity, which prevents the VHL (von Hippel-Lindau)-dependent targeting of HIF-1α to the ubiquitin/proteasome pathway. HIF-1α thus accumulates and promotes gene transcription. In the present study, first we provide direct biochemical evidence for the presence of a conserved hypoxic signalling pathway in Drosophila melanogaster. An assay for 2-oxoglutarate-dependent dioxygenases was developed using Drosophila embryonic and larval homogenates as a source of enzyme. Drosophila PHD has a low substrate specificity and hydroxylates key proline residues in the ODD (oxygen-dependent degradation) domains of human HIF-1α and Similar, the Drosophila homologue of HIF-1α. The enzyme promotes human and Drosophila [35S]VHL binding to GST (glutathione S-transferase)–ODD-domain fusion protein. Hydroxylation is enhanced by proteasomal inhibitors and was ascertained using an anti-hydroxyproline antibody. Secondly, by using transgenic flies expressing a fusion protein that combined an ODD domain and the green fluorescent protein (ODD–GFP), we analysed the hypoxic cascade in different embryonic and larval tissues. Hypoxic accumulation of the reporter protein was observed in the whole tracheal tree, but not in the ectoderm. Hypoxic stabilization of ODD–GFP in the ectoderm was restored by inducing VHL expression in these cells. These results show that Drosophila tissues exhibit different sensitivities to hypoxia. PMID:16176182

Statistical algorithms improve accuracy of gene fusion detection

PubMed Central

Hsieh, Gillian; Bierman, Rob; Szabo, Linda; Lee, Alex Gia; Freeman, Donald E.; Watson, Nathaniel; Sweet-Cordero, E. Alejandro

2017-01-01

Abstract Gene fusions are known to play critical roles in tumor pathogenesis. Yet, sensitive and specific algorithms to detect gene fusions in cancer do not currently exist. In this paper, we present a new statistical algorithm, MACHETE (Mismatched Alignment CHimEra Tracking Engine), which achieves highly sensitive and specific detection of gene fusions from RNA-Seq data, including the highest Positive Predictive Value (PPV) compared to the current state-of-the-art, as assessed in simulated data. We show that the best performing published algorithms either find large numbers of fusions in negative control data or suffer from low sensitivity detecting known driving fusions in gold standard settings, such as EWSR1-FLI1. As proof of principle that MACHETE discovers novel gene fusions with high accuracy in vivo, we mined public data to discover and subsequently PCR validate novel gene fusions missed by other algorithms in the ovarian cancer cell line OVCAR3. These results highlight the gains in accuracy achieved by introducing statistical models into fusion detection, and pave the way for unbiased discovery of potentially driving and druggable gene fusions in primary tumors. PMID:28541529

Use of a novel FISH assay on paraffin-embedded tissues as an adjunct to diagnosis of alveolar rhabdomyosarcoma.

PubMed

Nishio, Jun; Althof, Pamela A; Bailey, Jacqueline M; Zhou, Ming; Neff, James R; Barr, Frederic G; Parham, David M; Teot, Lisa; Qualman, Stephen J; Bridge, Julia A

2006-06-01

A valuable diagnostic adjunct and important prognostic parameter in alveolar rhabdomyosarcoma (ARMS) is the identification of translocations t(2;13)(q35;q14) and t(1;13)(p36;q14), and the associated PAX3-FKHR and PAX7-FKHR fusion transcripts, respectively. Most RMS fusion gene type studies have been based on reverse transcriptase-polymerase chain reaction (RT-PCR) detection of the fusion transcript, a technique limited by RNA quality and failure of devised primer sets to detect unusual variants. As an alternative approach, we developed a fluorescence in situ hybridization (FISH) assay that can: (1) distinguish between the two most common ARMS-associated fusion genes; (2) identify potential unusual variant translocations; (3) assess histologic components in mixed alveolar/embryonal RMS; and (4) be performed on paraffinized tissue. FISH analyses of 75 specimens (40 ARMS, 16 ERMS, 8 mixed ARMS/ERMS, and 11 non-RMS tumors) using selected cosmid clone, bacterial, P1-derived, and yeast artificial chromosome probe sets were successful in all but two cases. Among specimens with informative results for both FISH and RT-PCR or standard karyotyping, PAX/FKHR classification results were concordant in 94.6% (53/56). The three discordant cases included one exhibiting a t(2;13) by FISH that was subsequently confirmed by repeat RT-PCR, a second showing a rearrangement of the PAX3 locus only (consistent with the presence of a PAX3 variant translocation), and a third revealing a t(2;13) by FISH that lacked this translocation cytogenetically. Both alveolar and embryonal components of the mixed ARMS/ERMS subtype were negative for PAX3, PAX7, and FKHR rearrangements, a surprising finding confirmed by RT-PCR and/or conventional karyotyping. These data demonstrate that FISH with newly designed probe sets is a reliable and highly specific method of detecting t(1;13) and t(2;13) in routinely processed tissue and may be useful in differentiating ARMS from other small round cell tumors. The findings also suggest that FISH may be a more sensitive assay than RT-PCR in some settings, capable of revealing variant translocations.

A harpin elicitor induces the expression of a coiled-coil nucleotide binding leucine rich repeat (CC-NB-LRR) defense signaling gene and others functioning during defense to parasitic nematodes.

PubMed

Aljaafri, Weasam A R; McNeece, Brant T; Lawaju, Bisho R; Sharma, Keshav; Niruala, Prakash M; Pant, Shankar R; Long, David H; Lawrence, Kathy S; Lawrence, Gary W; Klink, Vincent P

2017-12-01

The bacterial effector harpin induces the transcription of the Arabidopsis thaliana NON-RACE SPECIFIC DISEASE RESISTANCE 1/HARPIN INDUCED1 (NDR1/HIN1) coiled-coil nucleotide binding leucine rich repeat (CC-NB-LRR) defense signaling gene. In Glycine max, Gm-NDR1-1 transcripts have been detected within root cells undergoing a natural resistant reaction to parasitism by the syncytium-forming nematode Heterodera glycines, functioning in the defense response. Expressing Gm-NDR1-1 in Gossypium hirsutum leads to resistance to Meloidogyne incognita parasitism. In experiments presented here, the heterologous expression of Gm-NDR1-1 in G. hirsutum impairs Rotylenchulus reniformis parasitism. These results are consistent with the hypothesis that Gm-NDR1-1 expression functions broadly in generating a defense response. To examine a possible relationship with harpin, G. max plants topically treated with harpin result in induction of the transcription of Gm-NDR1-1. The result indicates the topical treatment of plants with harpin, itself, may lead to impaired nematode parasitism. Topical harpin treatments are shown to impair G. max parasitism by H. glycines, M. incognita and R. reniformis and G. hirsutum parasitism by M. incognita and R. reniformis. How harpin could function in defense has been examined in experiments showing it also induces transcription of G. max homologs of the proven defense genes ENHANCED DISEASE SUSCEPTIBILITY1 (EDS1), TGA2, galactinol synthase, reticuline oxidase, xyloglucan endotransglycosylase/hydrolase, alpha soluble N-ethylmaleimide-sensitive fusion protein (α-SNAP) and serine hydroxymethyltransferase (SHMT). In contrast, other defense genes are not directly transcriptionally activated by harpin. The results indicate harpin induces pathogen associated molecular pattern (PAMP) triggered immunity (PTI) and effector-triggered immunity (ETI) defense processes in the root, activating defense to parasitic nematodes. Copyright © 2017. Published by Elsevier Masson SAS.

RAP: RNA-Seq Analysis Pipeline, a new cloud-based NGS web application

PubMed Central

2015-01-01

Background The study of RNA has been dramatically improved by the introduction of Next Generation Sequencing platforms allowing massive and cheap sequencing of selected RNA fractions, also providing information on strand orientation (RNA-Seq). The complexity of transcriptomes and of their regulative pathways make RNA-Seq one of most complex field of NGS applications, addressing several aspects of the expression process (e.g. identification and quantification of expressed genes and transcripts, alternative splicing and polyadenylation, fusion genes and trans-splicing, post-transcriptional events, etc.). Moreover, the huge volume of data generated by NGS platforms introduces unprecedented computational and technological challenges to efficiently analyze and store sequence data and results. Methods In order to provide researchers with an effective and friendly resource for analyzing RNA-Seq data, we present here RAP (RNA-Seq Analysis Pipeline), a cloud computing web application implementing a complete but modular analysis workflow. This pipeline integrates both state-of-the-art bioinformatics tools for RNA-Seq analysis and in-house developed scripts to offer to the user a comprehensive strategy for data analysis. RAP is able to perform quality checks (adopting FastQC and NGS QC Toolkit), identify and quantify expressed genes and transcripts (with Tophat, Cufflinks and HTSeq), detect alternative splicing events (using SpliceTrap) and chimeric transcripts (with ChimeraScan). This pipeline is also able to identify splicing junctions and constitutive or alternative polyadenylation sites (implementing custom analysis modules) and call for statistically significant differences in genes and transcripts expression, splicing pattern and polyadenylation site usage (using Cuffdiff2 and DESeq). Results Through a user friendly web interface, the RAP workflow can be suitably customized by the user and it is automatically executed on our cloud computing environment. This strategy allows to access to bioinformatics tools and computational resources without specific bioinformatics and IT skills. RAP provides a set of tabular and graphical results that can be helpful to browse, filter and export analyzed data, according to the user needs. PMID:26046471

Transcriptional repression mediated by the KRAB domain of the human C2H2 zinc finger protein Kox1/ZNF10 does not require histone deacetylation.

PubMed

Lorenz, P; Koczan, D; Thiesen, H J

2001-04-01

The KRAB domain of human Kox1, a member of the KRAB C2H2 zinc finger family, confers strong transcriptional repressor activities even to remote promoter positions. Here, HDAC inhibitors were used to demonstrate that histone deacetylation is not required for mediating transcriptional repression of KRAB zinc finger proteins. Two reporter systems with either stably integrated or transiently transfected templates, both under control of strong viral promoters, were analyzed. Under all circumstances, HDAC inhibition did not alter the repression potential of the KRAB domain. In case of the stably integrated luciferase reporter gene system, neither expression levels of the KRAB fusion protein nor complex formation with its putative co-repressor TIF1beta were significantly changed. Furthermore, the TIF1beta/KRAB complex was devoid of mSin3A and HDAC1. In the transient transfection system, the transcriptional repression induced by TIF1beta and HP1alpha was not diminished by HDAC inhibitors, whereas the repressory activity of TIF1alpha was significantly affected. Thus, KRAB, TIF1beta and HP1alpha are likely to be functionally linked. In conclusion, HDAC activity is not essential for the strong transcriptional repressor activity mediated by the KRAB domain of Kox1 in particular and, presumably, by KRAB domains in general. This feature might be helpful in identifying and characterizing target genes under the control of

Genome-wide Identification and Expression Analysis of the CDPK Gene Family in Grape, Vitis spp.

PubMed

Zhang, Kai; Han, Yong-Tao; Zhao, Feng-Li; Hu, Yang; Gao, Yu-Rong; Ma, Yan-Fei; Zheng, Yi; Wang, Yue-Jin; Wen, Ying-Qiang

2015-06-30

Calcium-dependent protein kinases (CDPKs) play vital roles in plant growth and development, biotic and abiotic stress responses, and hormone signaling. Little is known about the CDPK gene family in grapevine. In this study, we performed a genome-wide analysis of the 12X grape genome (Vitis vinifera) and identified nineteen CDPK genes. Comparison of the structures of grape CDPK genes allowed us to examine their functional conservation and differentiation. Segmentally duplicated grape CDPK genes showed high structural conservation and contributed to gene family expansion. Additional comparisons between grape and Arabidopsis thaliana demonstrated that several grape CDPK genes occured in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes arose before the divergence of grapevine and Arabidopsis. Phylogenetic analysis divided the grape CDPK genes into four groups. Furthermore, we examined the expression of the corresponding nineteen homologous CDPK genes in the Chinese wild grape (Vitis pseudoreticulata) under various conditions, including biotic stress, abiotic stress, and hormone treatments. The expression profiles derived from reverse transcription and quantitative PCR suggested that a large number of VpCDPKs responded to various stimuli on the transcriptional level, indicating their versatile roles in the responses to biotic and abiotic stresses. Moreover, we examined the subcellular localization of VpCDPKs by transiently expressing six VpCDPK-GFP fusion proteins in Arabidopsis mesophyll protoplasts; this revealed high variability consistent with potential functional differences. Taken as a whole, our data provide significant insights into the evolution and function of grape CDPKs and a framework for future investigation of grape CDPK genes.

Introduction of Peptidase Genes from Lactobacillus delbrueckii subsp. lactis into Lactococcus lactis and Controlled Expression

PubMed Central

Wegmann, U.; Klein, J. R.; Drumm, I.; Kuipers, O. P.; Henrich, B.

1999-01-01

Peptidases PepI, PepL, PepW, and PepG from Lactobacillus delbrueckii subsp. lactis, which have no counterparts in Lactococcus lactis, and peptidase PepQ were examined to determine their potential to confer new peptidolytic properties to lactococci. Controllable expression of the corresponding genes (pep genes) was achieved by constructing translational fusions with the promoter of the nisA gene (PnisA). A suitable host strain, UKLc10, was constructed by chromosomal integration of the genes encoding the NisRK two-component system into the fivefold peptidase-deficient mutant IM16 of L. lactis. Recombinants of this strain were used to analyze growth, peptidase activities, peptide utilization, and intracellular protein cleavage products. After nisin induction of PnisA::pep fusions, all of the peptidases were visible as distinct bands in protein gels. Despite the fact that identical transcription and translation signals were used to express the pep genes, the relative amounts of individual peptidases varied considerably. All of the peptidases exhibited activities in extracts of recombinant UKLc10 clones, but only PepL and PepG allowed the clones to utilize specific peptide substrates as sources of essential amino acids. In milk medium, induction of pepG and induction of pepW resulted in growth acceleration. The activities of all five peptidases during growth in milk medium were revealed by high-performance liquid chromatography analyses of intracellular amino acid and peptide pools. PMID:10543778

Recurrent cis-SAGe chimeric RNA, D2HGDH-GAL3ST2, in prostate cancer.

PubMed

Qin, Fujun; Song, Zhenguo; Chang, Maxwell; Song, Yansu; Frierson, Henry; Li, Hui

2016-09-28

Neighboring genes transcribing in the same direction can form chimeric RNAs via cis-splicing (cis-SAGe). Previously, we reported 16 novel cis-SAGe chimeras in prostate cancer cell lines, and performed in silico validation on 14 pairs of normal and tumor samples from Chinese patients. However, whether these fusions exist in different populations, as well as their clinical implications, remains unclear. To investigate, we developed a bioinformatics pipeline using modified Spliced Transcripts Alignment to a Reference (STAR) to quantify these fusion RNAs simultaneously in silico. From RNA-Seq data of 100 paired normal and prostate cancer samples from TCGA, we find that most fusions are not specific to cancer. However, D2HGDH-GAL3ST2 is more frequently seen in cancer samples, and seems to be enriched in the African American group. Further validation with our own collection as well as from commercial sources did not detect this fusion RNA in 29 normal prostate samples, but in 19 of 93 prostate cancer samples. It is more frequently detected in late stage cancer, suggesting a role in cancer progression. Consistently, silencing this fusion resulted in dramatic reduction of cell proliferation rate and cell motility. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

The tumorigenic FGFR3-TACC3 gene fusion escapes miR-99a regulation in glioblastoma

PubMed Central

Parker, Brittany C.; Annala, Matti J.; Cogdell, David E.; Granberg, Kirsi J.; Sun, Yan; Ji, Ping; Li, Xia; Gumin, Joy; Zheng, Hong; Hu, Limei; Yli-Harja, Olli; Haapasalo, Hannu; Visakorpi, Tapio; Liu, Xiuping; Liu, Chang-gong; Sawaya, Raymond; Fuller, Gregory N.; Chen, Kexin; Lang, Frederick F.; Nykter, Matti; Zhang, Wei

2013-01-01

Fusion genes are chromosomal aberrations that are found in many cancers and can be used as prognostic markers and drug targets in clinical practice. Fusions can lead to production of oncogenic fusion proteins or to enhanced expression of oncogenes. Several recent studies have reported that some fusion genes can escape microRNA regulation via 3′–untranslated region (3′-UTR) deletion. We performed whole transcriptome sequencing to identify fusion genes in glioma and discovered FGFR3-TACC3 fusions in 4 of 48 glioblastoma samples from patients both of mixed European and of Asian descent, but not in any of 43 low-grade glioma samples tested. The fusion, caused by tandem duplication on 4p16.3, led to the loss of the 3′-UTR of FGFR3, blocking gene regulation of miR-99a and enhancing expression of the fusion gene. The fusion gene was mutually exclusive with EGFR, PDGFR, or MET amplification. Using cultured glioblastoma cells and a mouse xenograft model, we found that fusion protein expression promoted cell proliferation and tumor progression, while WT FGFR3 protein was not tumorigenic, even under forced overexpression. These results demonstrated that the FGFR3-TACC3 gene fusion is expressed in human cancer and generates an oncogenic protein that promotes tumorigenesis in glioblastoma. PMID:23298836

Dynamics simulations for engineering macromolecular interactions

NASA Astrophysics Data System (ADS)

Robinson-Mosher, Avi; Shinar, Tamar; Silver, Pamela A.; Way, Jeffrey

2013-06-01

The predictable engineering of well-behaved transcriptional circuits is a central goal of synthetic biology. The artificial attachment of promoters to transcription factor genes usually results in noisy or chaotic behaviors, and such systems are unlikely to be useful in practical applications. Natural transcriptional regulation relies extensively on protein-protein interactions to insure tightly controlled behavior, but such tight control has been elusive in engineered systems. To help engineer protein-protein interactions, we have developed a molecular dynamics simulation framework that simplifies features of proteins moving by constrained Brownian motion, with the goal of performing long simulations. The behavior of a simulated protein system is determined by summation of forces that include a Brownian force, a drag force, excluded volume constraints, relative position constraints, and binding constraints that relate to experimentally determined on-rates and off-rates for chosen protein elements in a system. Proteins are abstracted as spheres. Binding surfaces are defined radially within a protein. Peptide linkers are abstracted as small protein-like spheres with rigid connections. To address whether our framework could generate useful predictions, we simulated the behavior of an engineered fusion protein consisting of two 20 000 Da proteins attached by flexible glycine/serine-type linkers. The two protein elements remained closely associated, as if constrained by a random walk in three dimensions of the peptide linker, as opposed to showing a distribution of distances expected if movement were dominated by Brownian motion of the protein domains only. We also simulated the behavior of fluorescent proteins tethered by a linker of varying length, compared the predicted Förster resonance energy transfer with previous experimental observations, and obtained a good correspondence. Finally, we simulated the binding behavior of a fusion of two ligands that could simultaneously bind to distinct cell-surface receptors, and explored the landscape of linker lengths and stiffnesses that could enhance receptor binding of one ligand when the other ligand has already bound to its receptor, thus, addressing potential mechanisms for improving targeted signal transduction proteins. These specific results have implications for the design of targeted fusion proteins and artificial transcription factors involving fusion of natural domains. More broadly, the simulation framework described here could be extended to include more detailed system features such as non-spherical protein shapes and electrostatics, without requiring detailed, computationally expensive specifications. This framework should be useful in predicting behavior of engineered protein systems including binding and dissociation reactions.

Dynamics simulations for engineering macromolecular interactions.

PubMed

Robinson-Mosher, Avi; Shinar, Tamar; Silver, Pamela A; Way, Jeffrey

2013-06-01

The predictable engineering of well-behaved transcriptional circuits is a central goal of synthetic biology. The artificial attachment of promoters to transcription factor genes usually results in noisy or chaotic behaviors, and such systems are unlikely to be useful in practical applications. Natural transcriptional regulation relies extensively on protein-protein interactions to insure tightly controlled behavior, but such tight control has been elusive in engineered systems. To help engineer protein-protein interactions, we have developed a molecular dynamics simulation framework that simplifies features of proteins moving by constrained Brownian motion, with the goal of performing long simulations. The behavior of a simulated protein system is determined by summation of forces that include a Brownian force, a drag force, excluded volume constraints, relative position constraints, and binding constraints that relate to experimentally determined on-rates and off-rates for chosen protein elements in a system. Proteins are abstracted as spheres. Binding surfaces are defined radially within a protein. Peptide linkers are abstracted as small protein-like spheres with rigid connections. To address whether our framework could generate useful predictions, we simulated the behavior of an engineered fusion protein consisting of two 20,000 Da proteins attached by flexible glycine/serine-type linkers. The two protein elements remained closely associated, as if constrained by a random walk in three dimensions of the peptide linker, as opposed to showing a distribution of distances expected if movement were dominated by Brownian motion of the protein domains only. We also simulated the behavior of fluorescent proteins tethered by a linker of varying length, compared the predicted Förster resonance energy transfer with previous experimental observations, and obtained a good correspondence. Finally, we simulated the binding behavior of a fusion of two ligands that could simultaneously bind to distinct cell-surface receptors, and explored the landscape of linker lengths and stiffnesses that could enhance receptor binding of one ligand when the other ligand has already bound to its receptor, thus, addressing potential mechanisms for improving targeted signal transduction proteins. These specific results have implications for the design of targeted fusion proteins and artificial transcription factors involving fusion of natural domains. More broadly, the simulation framework described here could be extended to include more detailed system features such as non-spherical protein shapes and electrostatics, without requiring detailed, computationally expensive specifications. This framework should be useful in predicting behavior of engineered protein systems including binding and dissociation reactions.

Development and Verification of an RNA Sequencing (RNA-Seq) Assay for the Detection of Gene Fusions in Tumors.

PubMed

Winters, Jennifer L; Davila, Jaime I; McDonald, Amber M; Nair, Asha A; Fadra, Numrah; Wehrs, Rebecca N; Thomas, Brittany C; Balcom, Jessica R; Jin, Long; Wu, Xianglin; Voss, Jesse S; Klee, Eric W; Oliver, Gavin R; Graham, Rondell P; Neff, Jadee L; Rumilla, Kandelaria M; Aypar, Umut; Kipp, Benjamin R; Jenkins, Robert B; Jen, Jin; Halling, Kevin C

2018-06-13

We assessed the performance characteristics of an RNA sequencing (RNA-Seq) assay designed to detect gene fusions in 571 genes to help manage patients with cancer. Polyadenylated RNA was converted to cDNA, which was then used to prepare next-generation sequencing libraries that were sequenced on an Illumina HiSeq 2500 instrument and analyzed with an in-house developed bioinformatic pipeline. The assay identified 38 of 41 gene fusions detected by another method, such as fluorescence in situ hybridization or RT-PCR, for a sensitivity of 93%. No false-positive gene fusions were identified in 15 normal tissue specimens and 10 tumor specimens that were negative for fusions by RNA sequencing or Mate Pair NGS (100% specificity). The assay also identified 22 fusions in 17 tumor specimens that had not been detected by other methods. Eighteen of the 22 fusions had not previously been described. Good intra-assay and interassay reproducibility was observed with complete concordance for the presence or absence of gene fusions in replicates. The analytical sensitivity of the assay was tested by diluting RNA isolated from gene fusion-positive cases with fusion-negative RNA. Gene fusions were generally detectable down to 12.5% dilutions for most fusions and as little as 3% for some fusions. This assay can help identify fusions in patients with cancer; these patients may in turn benefit from both US Food and Drug Administration-approved and investigational targeted therapies. Copyright © 2018 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

The BABY BOOM Transcription Factor Activates the LEC1-ABI3-FUS3-LEC2 Network to Induce Somatic Embryogenesis1[OPEN

PubMed Central

Weemen, Mieke

2017-01-01

Somatic embryogenesis is an example of induced cellular totipotency, where embryos develop from vegetative cells rather than from gamete fusion. Somatic embryogenesis can be induced in vitro by exposing explants to growth regulators and/or stress treatments. The BABY BOOM (BBM) and LEAFY COTYLEDON1 (LEC1) and LEC2 transcription factors are key regulators of plant cell totipotency, as ectopic overexpression of either transcription factor induces somatic embryo formation from Arabidopsis (Arabidopsis thaliana) seedlings without exogenous growth regulators or stress treatments. Although LEC and BBM proteins regulate the same developmental process, it is not known whether they function in the same molecular pathway. We show that BBM transcriptionally regulates LEC1 and LEC2, as well as the two other LAFL genes, FUSCA3 (FUS3) and ABSCISIC ACID INSENSITIVE3 (ABI3). LEC2 and ABI3 quantitatively regulate BBM-mediated somatic embryogenesis, while FUS3 and LEC1 are essential for this process. BBM-mediated somatic embryogenesis is dose and context dependent, and the context-dependent phenotypes are associated with differential LAFL expression. We also uncover functional redundancy for somatic embryogenesis among other Arabidopsis BBM-like proteins and show that one of these proteins, PLETHORA2, also regulates LAFL gene expression. Our data place BBM upstream of other major regulators of plant embryo identity and totipotency. PMID:28830937

Overexpression of the Arabidopsis thaliana signalling peptide TAXIMIN1 affects lateral organ development.

PubMed

Colling, Janine; Tohge, Takayuki; De Clercq, Rebecca; Brunoud, Geraldine; Vernoux, Teva; Fernie, Alisdair R; Makunga, Nokwanda P; Goossens, Alain; Pauwels, Laurens

2015-08-01

Lateral organ boundary formation is highly regulated by transcription factors and hormones such as auxins and brassinosteroids. However, in contrast to many other developmental processes in plants, no role for signalling peptides in the regulation of this process has been reported yet. The first characterization of the secreted cysteine-rich TAXIMIN (TAX) signalling peptides in Arabidopsis is presented here. TAX1 overexpression resulted in minor alterations in the primary shoot and root metabolome, abnormal fruit morphology, and fusion of the base of cauline leaves to stems forming a decurrent leaf attachment. The phenotypes at the paraclade junction match TAX1 promoter activity in this region and are similar to loss of LATERAL ORGAN FUSION (LOF) transcription factor function. Nevertheless, TAX1 expression was unchanged in lof1lof2 paraclade junctions and, conversely, LOF gene expression was unchanged in TAX1 overexpressing plants, suggesting TAX1 may act independently. This study identifies TAX1 as the first plant signalling peptide influencing lateral organ separation and implicates the existence of a peptide signal cascade regulating this process in Arabidopsis. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Acute myeloid leukaemia (FAB AML-M4Eo) with cryptic insertion of cbfb resulting in cbfb-Myh11 fusion.

PubMed

Douet-Guilbert, Nathalie; Chauveau, Aurelie; Gueganic, Nadia; Guillerm, Gaëlle; Tous, Corine; Le Bris, Marie-Josee; Basinko, Audrey; Morel, Frederic; Ugo, Valerie; De Braekeleer, Marc

2017-09-01

Inv(16)(p13q22) and t(16;16)(p13;q22) are cytogenetic hallmarks of acute myelomonoblastic leukaemia, most of them associated with abnormal bone marrow eosinophils [acute myeloid leukaemia French-American-British classification M4 with eosinophilia (FAB AML-M4Eo)] and a relatively favourable clinical course. They generate a 5'CBFB-3'MYH11 fusion gene. However, in a few cases, although RT-PCR identified a CBFB-MYH11 transcript, normal karyotype and/or fluorescent in situ hybridization (FISH) analyses using commercially available probes are found. We identified a 32-year-old woman with AML-M4Eo and normal karyotype and FISH results. Using two libraries of Bacterial Artificial Chromosome clones on 16p13 and 16q22, FISH analyses identified an insertion of 16q22 material in band 16p13, generating a CBFB-MYH11 type A transcript. Although very rare, insertions should be searched for in patients with discordant cytological and cytogenetic features because of the therapeutic consequences. Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

Development of a bioluminescence resonance energy transfer (BRET) for monitoring estrogen receptor alpha activation

NASA Astrophysics Data System (ADS)

Michelini, Elisa; Mirasoli, Mara; Karp, Matti; Virta, Marko; Roda, Aldo

2004-06-01

Estrogen receptor (ER) is a ligand-activated transcriptional factor, able to dimerize after activation and to bind specific DNA sequences (estrogen response elements), thus activating gene target transcription. Since ER homo- and hetero-dimerization (giving a-a and a-b isoforms) is a fundamental step for receptor activation, we developed an assay for detecting compounds that induce human ERa homo-dimerization based on bioluminescence resonance energy transfer (BRET). BRET is a non-radiative energy transfer, occurring between a luminescent donor and a fluorescent acceptor, that strictly depends on the closeness between the two proteins and can therefore be used for studying protein-protein interactions. We cloned ERa coding sequence in frame with either a variant of the green fluorescent protein (enhanced yellow fluorescent protein, EYFP) or Renilla luciferase (RLuc). Upon ERa homo-dimerization, BRET process takes place in the presence of the RLuc substrate coelenterazine resulting in EYFP emission at its characteristic wavelength. The ER alpha-Rluc and ER alpha-EYFP fusion proteins were cloned, then the occurrence of BRET in the presence of ER alpha activators was assayed both in vivo, within cells, and in vitro, with purified fusion proteins.

Genomic analyses identify recurrent MEF2D fusions in acute lymphoblastic leukaemia

PubMed Central

Gu, Zhaohui; Churchman, Michelle; Roberts, Kathryn; Li, Yongjin; Liu, Yu; Harvey, Richard C.; McCastlain, Kelly; Reshmi, Shalini C.; Payne-Turner, Debbie; Iacobucci, Ilaria; Shao, Ying; Chen, I-Ming; Valentine, Marcus; Pei, Deqing; Mungall, Karen L.; Mungall, Andrew J.; Ma, Yussanne; Moore, Richard; Marra, Marco; Stonerock, Eileen; Gastier-Foster, Julie M.; Devidas, Meenakshi; Dai, Yunfeng; Wood, Brent; Borowitz, Michael; Larsen, Eric E.; Maloney, Kelly; Mattano Jr, Leonard A.; Angiolillo, Anne; Salzer, Wanda L.; Burke, Michael J.; Gianni, Francesca; Spinelli, Orietta; Radich, Jerald P.; Minden, Mark D.; Moorman, Anthony V.; Patel, Bella; Fielding, Adele K.; Rowe, Jacob M.; Luger, Selina M.; Bhatia, Ravi; Aldoss, Ibrahim; Forman, Stephen J.; Kohlschmidt, Jessica; Mrózek, Krzysztof; Marcucci, Guido; Bloomfield, Clara D.; Stock, Wendy; Kornblau, Steven; Kantarjian, Hagop M.; Konopleva, Marina; Paietta, Elisabeth; Willman, Cheryl L.; L. Loh, Mignon; P. Hunger, Stephen; Mullighan, Charles G.

2016-01-01

Chromosomal rearrangements are initiating events in acute lymphoblastic leukaemia (ALL). Here using RNA sequencing of 560 ALL cases, we identify rearrangements between MEF2D (myocyte enhancer factor 2D) and five genes (BCL9, CSF1R, DAZAP1, HNRNPUL1 and SS18) in 22 B progenitor ALL (B-ALL) cases with a distinct gene expression profile, the most common of which is MEF2D-BCL9. Examination of an extended cohort of 1,164 B-ALL cases identified 30 cases with MEF2D rearrangements, which include an additional fusion partner, FOXJ2; thus, MEF2D-rearranged cases comprise 5.3% of cases lacking recurring alterations. MEF2D-rearranged ALL is characterized by a distinct immunophenotype, DNA copy number alterations at the rearrangement sites, older diagnosis age and poor outcome. The rearrangements result in enhanced MEF2D transcriptional activity, lymphoid transformation, activation of HDAC9 expression and sensitive to histone deacetylase inhibitor treatment. Thus, MEF2D-rearranged ALL represents a distinct form of high-risk leukaemia, for which new therapeutic approaches should be considered. PMID:27824051

A maize spermine synthase 1 PEST sequence fused to the GUS reporter protein facilitates proteolytic degradation.

PubMed

Maruri-López, Israel; Rodríguez-Kessler, Margarita; Rodríguez-Hernández, Aída Araceli; Becerra-Flora, Alicia; Olivares-Grajales, Juan Elías; Jiménez-Bremont, Juan Francisco

2014-05-01

Polyamines are low molecular weight aliphatic compounds involved in various biochemical, cellular and physiological processes in all organisms. In plants, genes involved in polyamine biosynthesis and catabolism are regulated at transcriptional, translational, and posttranslational level. In this research, we focused on the characterization of a PEST sequence (rich in proline, glutamic acid, serine, and threonine) of the maize spermine synthase 1 (ZmSPMS1). To this aim, 123 bp encoding 40 amino acids of the C-terminal region of the ZmSPMS1 enzyme containing the PEST sequence were fused to the GUS reporter gene. This fusion was evaluated in Arabidopsis thaliana transgenic lines and onion monolayers transient expression system. The ZmSPMS1 PEST sequence leads to specific degradation of the GUS reporter protein. It is suggested that the 26S proteasome may be involved in GUS::PEST fusion degradation in both onion and Arabidopsis. The PEST sequences appear to be present in plant spermine synthases, mainly in monocots. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

Early and delayed long-term transcriptional changes and short-term transient responses during cold acclimation in olive leaves

PubMed Central

Leyva-Pérez, María de la O; Valverde-Corredor, Antonio; Valderrama, Raquel; Jiménez-Ruiz, Jaime; Muñoz-Merida, Antonio; Trelles, Oswaldo; Barroso, Juan Bautista; Mercado-Blanco, Jesús; Luque, Francisco

2015-01-01

Low temperature severely affects plant growth and development. To overcome this constraint, several plant species from regions having a cool season have evolved an adaptive response, called cold acclimation. We have studied this response in olive tree (Olea europaea L.) cv. Picual. Biochemical stress markers and cold-stress symptoms were detected after the first 24 h as sagging leaves. After 5 days, the plants were found to have completely recovered. Control and cold-stressed plants were sequenced by Illumina HiSeq 1000 paired-end technique. We also assembled a new olive transcriptome comprising 157,799 unigenes and found 6,309 unigenes differentially expressed in response to cold. Three types of response that led to cold acclimation were found: short-term transient response, early long-term response, and late long-term response. These subsets of unigenes were related to different biological processes. Early responses involved many cold-stress-responsive genes coding for, among many other things, C-repeat binding factor transcription factors, fatty acid desaturases, wax synthesis, and oligosaccharide metabolism. After long-term exposure to cold, a large proportion of gene down-regulation was found, including photosynthesis and plant growth genes. Up-regulated genes after long-term cold exposure were related to organelle fusion, nucleus organization, and DNA integration, including retrotransposons. PMID:25324298

An experimentally validated network of nine haematopoietic transcription factors reveals mechanisms of cell state stability

PubMed Central

Schütte, Judith; Wang, Huange; Antoniou, Stella; Jarratt, Andrew; Wilson, Nicola K; Riepsaame, Joey; Calero-Nieto, Fernando J; Moignard, Victoria; Basilico, Silvia; Kinston, Sarah J; Hannah, Rebecca L; Chan, Mun Chiang; Nürnberg, Sylvia T; Ouwehand, Willem H; Bonzanni, Nicola; de Bruijn, Marella FTR; Göttgens, Berthold

2016-01-01

Transcription factor (TF) networks determine cell-type identity by establishing and maintaining lineage-specific expression profiles, yet reconstruction of mammalian regulatory network models has been hampered by a lack of comprehensive functional validation of regulatory interactions. Here, we report comprehensive ChIP-Seq, transgenic and reporter gene experimental data that have allowed us to construct an experimentally validated regulatory network model for haematopoietic stem/progenitor cells (HSPCs). Model simulation coupled with subsequent experimental validation using single cell expression profiling revealed potential mechanisms for cell state stabilisation, and also how a leukaemogenic TF fusion protein perturbs key HSPC regulators. The approach presented here should help to improve our understanding of both normal physiological and disease processes. DOI: http://dx.doi.org/10.7554/eLife.11469.001 PMID:26901438

Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

PubMed

Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

1992-01-01

A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

Regulation of Bacteriocin Production in Streptococcus mutans by the Quorum-Sensing System Required for Development of Genetic Competence

PubMed Central

van der Ploeg, Jan R.

2005-01-01

In Streptococcus mutans, competence for genetic transformation and biofilm formation are dependent on the two-component signal transduction system ComDE together with the inducer peptide pheromone competence-stimulating peptide (CSP) (encoded by comC). Here, it is shown that the same system is also required for expression of the nlmAB genes, which encode a two-peptide nonlantibiotic bacteriocin. Expression from a transcriptional nlmAB′-lacZ fusion was highest at high cell density and was increased up to 60-fold following addition of CSP, but it was abolished when the comDE genes were interrupted. Two more genes, encoding another putative bacteriocin and a putative bacteriocin immunity protein, were also regulated by this system. The regions upstream of these genes and of two further putative bacteriocin-encoding genes and a gene encoding a putative bacteriocin immunity protein contained a conserved 9-bp repeat element just upstream of the transcription start, which suggests that expression of these genes is also dependent on the ComCDE regulatory system. Mutations in the repeat element of the nlmAB promoter region led to a decrease in CSP-dependent expression of nlmAB′-lacZ. In agreement with these results, a comDE mutant and mutants unable to synthesize or export CSP did not produce bacteriocins. It is speculated that, at high cell density, bacteriocin production is induced to liberate DNA from competing streptococci. PMID:15937160

Characterization of the Methylation Status of Pax7 and Myogenic Regulator Factors in Cell Myogenic Differentiation.

PubMed

Chao, Zhe; Zheng, Xin-Li; Sun, Rui-Ping; Liu, Hai-Long; Huang, Li-Li; Cao, Zong-Xi; Deng, Chang-Yan; Wang, Feng

2016-07-01

Epigenetic processes in the development of skeletal muscle have been appreciated for over a decade. DNA methylation is a major epigenetic modification important for regulating gene expression and suppressing spurious transcription. Up to now, the importance of epigenetic marks in the regulation of Pax7 and myogenic regulatory factors (MRFs) expression is far less explored. In the present study, semi-quantitative the real-time polymerase chain reaction (RT-PCR) analyses showed MyoD and Myf5 were expressed in activated and quiescent C2C12 cells. MyoG was expressed in a later stage of myogenesis. Pax7 was weakly expressed in differentiated C2C12 cells. To further understand the regulation of expression of these genes, the DNA methylation status of Pax7, MyoD, and Myf5 was determined by bisulfite sequencing PCR. During the C2C12 myoblasts fusion process, the changes of promoter and exon 1 methylation of Pax7, MyoD, and Myf5 genes were observed. In addition, an inverse relationship of low methylation and high expression was found. These results suggest that DNA methylation may be an important mechanism regulating Pax7 and MRFs transcription in cell myogenic differentiation.

Cloning and function analysis of an alfalfa (Medicago sativa L.) zinc finger protein promoter MsZPP.

PubMed

Li, Yan; Sun, Yan; Yang, Qingchuan; Kang, Junmei; Zhang, Tiejun; Gruber, Margaret Yvonne; Fang, Feng

2012-08-01

A 1272 bp upstream sequence of MsZFN gene was cloned from alfalfa, which was designed as MsZPP (Genbank accession number: FJ 161979.2) using an adaptor-mediated genome walking method. A sole transcription start site was located 69 bp upstream of the translation start site. Its pattern of expression included roots, stem vascular tissues, floral reproductive organs, and leaves, but the promoter did not express in seeds, petals or sepals. Transcription levels can be stimulated by dark, MeJA, and IAA. However, GUS fusion activities had no change by treatments of GA, ABA, drought and high salt for 3 days. Deletion analysis revealed that all sections of the promoter can drive gus gene expression in the root, stem, leaves and floral reproductive organs; however, only fragments longer than the -460 bp promoter can stimulate strong gus gene expression in these organs. In addition, the -460 bp promoter fragment can drive gus expression not only in the vascular tissue, but also in leaf guard cells. The results suggest that the promoter MsZPP plays roles in the regulation of transgene expression, particularly due to its darkness, MeJA, and IAA responsiveness.

Flow Cytometric Immunobead Assay for Detection of BCR-ABL1 Fusion Proteins in Chronic Myleoid Leukemia: Comparison with FISH and PCR Techniques

PubMed Central

Recchia, Anna Grazia; Caruso, Nadia; Bossio, Sabrina; Pellicanò, Mariavaleria; De Stefano, Laura; Franzese, Stefania; Palummo, Angela; Abbadessa, Vincenzo; Lucia, Eugenio; Gentile, Massimo; Vigna, Ernesto; Caracciolo, Clementina; Agostino, Antolino; Galimberti, Sara; Levato, Luciano; Stagno, Fabio; Molica, Stefano; Martino, Bruno; Vigneri, Paolo; Di Raimondo, Francesco; Morabito, Fortunato

2015-01-01

Chronic Myeloid Leukemia (CML) is characterized by a balanced translocation juxtaposing the Abelson (ABL) and breakpoint cluster region (BCR) genes. The resulting BCR-ABL1 oncogene leads to increased proliferation and survival of leukemic cells. Successful treatment of CML has been accompanied by steady improvements in our capacity to accurately and sensitively monitor therapy response. Currently, measurement of BCR-ABL1 mRNA transcript levels by real-time quantitative PCR (RQ-PCR) defines critical response endpoints. An antibody-based technique for BCR-ABL1 protein recognition could be an attractive alternative to RQ-PCR. To date, there have been no studies evaluating whether flow-cytometry based assays could be of clinical utility in evaluating residual disease in CML patients. Here we describe a flow-cytometry assay that detects the presence of BCR-ABL1 fusion proteins in CML lysates to determine the applicability, reliability, and specificity of this method for both diagnosis and monitoring of CML patients for initial response to therapy. We show that: i) CML can be properly diagnosed at onset, (ii) follow-up assessments show detectable fusion protein (i.e. relative mean fluorescent intensity, rMFI%>1) when BCR-ABL1IS transcripts are between 1–10%, and (iii) rMFI% levels predict CCyR as defined by FISH analysis. Overall, the FCBA assay is a rapid technique, fully translatable to the routine management of CML patients. PMID:26111048

Development of a biochip-based assay integrated in a global strategy for identification of fusion transcripts in acute myeloid leukemia: a work flow for acute myeloid leukemia diagnosis.

PubMed

Giusiano, S; Formisano-Tréziny, C; Benziane, A; Maroc, N; Picard, C; Hermitte, F; Taranger-Charpin, C; Gabert, J

2010-08-01

Three major types of rearrangements are involved in acute myeloid leukemias (AML): t(8;21)(q22;q22), inv(16)(p13q22), and 11q23/MLL abnormalities. Their precise identification becomes essential for diagnosis, prognosis, and therapeutic choices. Resulting fusion transcripts (FT) are also powerful markers for monitoring the efficacy of treatment, the minimal residual disease (MRD) and could become therapeutic targets. Today, the challenge is to propose an individual follow-up for each patient even for those with a rare fusion event. In this study, we propose a biochip-based assay integrated in a global strategy for identification of rare FT in AML, after fluorescence in situ hybridization detection, as described by the World Health Organization classification. Using cell lines, we developed and validated a biochip-based assay called the AMLFusionChip that identifies every FT of AML1-ETO, CBFbeta-MYH11 as well as MLL-AF9, MLL-ENL, MLL-AF6, and MLL-AF10. The original design of our AMLFusionChip.v01 enables the identification of these FT wherever the breakpoint on the partner gene may be. In case of biochip negative result, our 3'RACE amplification strategy enables to clone and then sequence the new translocation partner. This AMLFusionChip strategy fits into the concept of personalized medicine for the largest number of patients.

Exploration of the gene fusion landscape of glioblastoma using transcriptome sequencing and copy number data.

PubMed

Shah, Nameeta; Lankerovich, Michael; Lee, Hwahyung; Yoon, Jae-Geun; Schroeder, Brett; Foltz, Greg

2013-11-22

RNA-seq has spurred important gene fusion discoveries in a number of different cancers, including lung, prostate, breast, brain, thyroid and bladder carcinomas. Gene fusion discovery can potentially lead to the development of novel treatments that target the underlying genetic abnormalities. In this study, we provide comprehensive view of gene fusion landscape in 185 glioblastoma multiforme patients from two independent cohorts. Fusions occur in approximately 30-50% of GBM patient samples. In the Ivy Center cohort of 24 patients, 33% of samples harbored fusions that were validated by qPCR and Sanger sequencing. We were able to identify high-confidence gene fusions from RNA-seq data in 53% of the samples in a TCGA cohort of 161 patients. We identified 13 cases (8%) with fusions retaining a tyrosine kinase domain in the TCGA cohort and one case in the Ivy Center cohort. Ours is the first study to describe recurrent fusions involving non-coding genes. Genomic locations 7p11 and 12q14-15 harbor majority of the fusions. Fusions on 7p11 are formed in focally amplified EGFR locus whereas 12q14-15 fusions are formed by complex genomic rearrangements. All the fusions detected in this study can be further visualized and analyzed using our website: http://ivygap.swedish.org/fusions. Our study highlights the prevalence of gene fusions as one of the major genomic abnormalities in GBM. The majority of the fusions are private fusions, and a minority of these recur with low frequency. A small subset of patients with fusions of receptor tyrosine kinases can benefit from existing FDA approved drugs and drugs available in various clinical trials. Due to the low frequency and rarity of clinically relevant fusions, RNA-seq of GBM patient samples will be a vital tool for the identification of patient-specific fusions that can drive personalized therapy.

Co-fuse: a new class discovery analysis tool to identify and prioritize recurrent fusion genes from RNA-sequencing data.

PubMed

Paisitkriangkrai, Sakrapee; Quek, Kelly; Nievergall, Eva; Jabbour, Anissa; Zannettino, Andrew; Kok, Chung Hoow

2018-06-07

Recurrent oncogenic fusion genes play a critical role in the development of various cancers and diseases and provide, in some cases, excellent therapeutic targets. To date, analysis tools that can identify and compare recurrent fusion genes across multiple samples have not been available to researchers. To address this deficiency, we developed Co-occurrence Fusion (Co-fuse), a new and easy to use software tool that enables biologists to merge RNA-seq information, allowing them to identify recurrent fusion genes, without the need for exhaustive data processing. Notably, Co-fuse is based on pattern mining and statistical analysis which enables the identification of hidden patterns of recurrent fusion genes. In this report, we show that Co-fuse can be used to identify 2 distinct groups within a set of 49 leukemic cell lines based on their recurrent fusion genes: a multiple myeloma (MM) samples-enriched cluster and an acute myeloid leukemia (AML) samples-enriched cluster. Our experimental results further demonstrate that Co-fuse can identify known driver fusion genes (e.g., IGH-MYC, IGH-WHSC1) in MM, when compared to AML samples, indicating the potential of Co-fuse to aid the discovery of yet unknown driver fusion genes through cohort comparisons. Additionally, using a 272 primary glioma sample RNA-seq dataset, Co-fuse was able to validate recurrent fusion genes, further demonstrating the power of this analysis tool to identify recurrent fusion genes. Taken together, Co-fuse is a powerful new analysis tool that can be readily applied to large RNA-seq datasets, and may lead to the discovery of new disease subgroups and potentially new driver genes, for which, targeted therapies could be developed. The Co-fuse R source code is publicly available at https://github.com/sakrapee/co-fuse .

Factors affecting expression of the recF gene of Escherichia coli K-12.

PubMed

Sandler, S J; Clark, A J

1990-01-31

This report describes four factors which affect expression of the recF gene from strong upstream lambda promoters under temperature-sensitive cIAt2-encoded repressor control. The first factor was the long mRNA leader sequence consisting of the Escherichia coli dnaN gene and 95% of the dnaA gene and lambda bet, N (double amber) and 40% of the exo gene. When most of this DNA was deleted, RecF became detectable in maxicells. The second factor was the vector, pBEU28, a runaway replication plasmid. When we substituted pUC118 for pBEU28, RecF became detectable in whole cells by the Coomassie blue staining technique. The third factor was the efficiency of initiation of translation. We used site-directed mutagenesis to change the mRNA leader, ribosome-binding site and the 3 bp before and after the translational start codon. Monitoring the effect of these mutational changes by translational fusion to lacZ, we discovered that the efficiency of initiation of translation was increased 30-fold. Only an estimated two- or threefold increase in accumulated levels of RecF occurred, however. This led us to discover the fourth factor, namely sequences in the recF gene itself. These sequences reduce expression of the recF-lacZ fusion genes 100-fold. The sequences responsible for this decrease in expression occur in four regions in the N-terminal half of recF. Expression is reduced by some sequences at the transcriptional level and by others at the translational level.

Phylogeny of Plant CAMTAs and Role of AtCAMTAs in Nonhost Resistance to Xanthomonas oryzae pv. oryzae

PubMed Central

Rahman, Hafizur; Yang, Juan; Xu, You-Ping; Munyampundu, Jean-Pierre; Cai, Xin-Zhong

2016-01-01

Calmodulin-binding transcription activator (CAMTA) constitutes one of the most important Ca2+/CaM-regulated transcription factor families in plants. Nevertheless, the phylogeny, protein interaction network, and role in nonhost resistance of plant CAMTAs are not well understood. In this study, 200 CAMTA genes were identified from 35 species representing four major plant lineages. The CAMTA genes were conserved in multicellular land plants but absent in unicellular eukaryotes, and were likely to emerge from the fusion of two separate genes encoding a CAMTA-like protein and an IQ/CaM binding motif containing protein, respectively, in the embryophyta lineage ancestor. Approximately one fourth of plant CAMTAs did not contain a TIG domain. This non-TIG class of CAMTAs seems to have newly evolved through mutation of some key amino acids in the TIG domain of flowering land plants after divergence from the non-flowering plants. Phylogenetic analysis classified CAMTA proteins into three major groups and nine distinct subgroups, a result supported by protein domain and motif conservation analyses. Most (59.0 and 21.5%) of the identified CAMTA genes contained 12 or 11 introns, respectively. Gene duplication, intron invasion, enlargement and turnover, as well as exon rearrangements and skipping have apparently occurred during evolution of the CAMTA family. Moreover, 38 potential interactors of six Arabidopsis CAMTAs were predicted and 10 predicted target genes of AtCAMTA3 exhibited changes in expression between Atcamta3 mutants and wild-type plants. The majority of predicted interactors are transcription factors and/or Ca2+/CaM-regulated proteins, suggesting that transcriptional regulation of the target genes might be the dominant functional mechanism of AtCAMTAs, and AtCAMTAs might act together with other Ca2+ signaling components to regulate Ca2+-related biological processes. Furthermore, functional analyses employing Atcamta mutants revealed that AtCAMTA3 negatively regulated the immunity triggered by flg22 and nonhost resistance to Xanthomonas oryzae pv. oryzae via repressing accumulation of reactive oxygen species probably by targeting CBP60G, EDS1, and NDR1 and involving SA pathway. PMID:26973658

Phylogeny of Plant CAMTAs and Role of AtCAMTAs in Nonhost Resistance to Xanthomonas oryzae pv. oryzae.

PubMed

Rahman, Hafizur; Yang, Juan; Xu, You-Ping; Munyampundu, Jean-Pierre; Cai, Xin-Zhong

2016-01-01

Calmodulin-binding transcription activator (CAMTA) constitutes one of the most important Ca(2+)/CaM-regulated transcription factor families in plants. Nevertheless, the phylogeny, protein interaction network, and role in nonhost resistance of plant CAMTAs are not well understood. In this study, 200 CAMTA genes were identified from 35 species representing four major plant lineages. The CAMTA genes were conserved in multicellular land plants but absent in unicellular eukaryotes, and were likely to emerge from the fusion of two separate genes encoding a CAMTA-like protein and an IQ/CaM binding motif containing protein, respectively, in the embryophyta lineage ancestor. Approximately one fourth of plant CAMTAs did not contain a TIG domain. This non-TIG class of CAMTAs seems to have newly evolved through mutation of some key amino acids in the TIG domain of flowering land plants after divergence from the non-flowering plants. Phylogenetic analysis classified CAMTA proteins into three major groups and nine distinct subgroups, a result supported by protein domain and motif conservation analyses. Most (59.0 and 21.5%) of the identified CAMTA genes contained 12 or 11 introns, respectively. Gene duplication, intron invasion, enlargement and turnover, as well as exon rearrangements and skipping have apparently occurred during evolution of the CAMTA family. Moreover, 38 potential interactors of six Arabidopsis CAMTAs were predicted and 10 predicted target genes of AtCAMTA3 exhibited changes in expression between Atcamta3 mutants and wild-type plants. The majority of predicted interactors are transcription factors and/or Ca(2+)/CaM-regulated proteins, suggesting that transcriptional regulation of the target genes might be the dominant functional mechanism of AtCAMTAs, and AtCAMTAs might act together with other Ca(2+) signaling components to regulate Ca(2+)-related biological processes. Furthermore, functional analyses employing Atcamta mutants revealed that AtCAMTA3 negatively regulated the immunity triggered by flg22 and nonhost resistance to Xanthomonas oryzae pv. oryzae via repressing accumulation of reactive oxygen species probably by targeting CBP60G, EDS1, and NDR1 and involving SA pathway.

Lateral organ boundaries 1 is a disease susceptibility gene for citrus bacterial canker disease

PubMed Central

Hu, Yang; Zhang, Junli; Jia, Hongge; Sosso, Davide; Li, Ting; Frommer, Wolf B.; Yang, Bing; White, Frank F.; Wang, Nian; Jones, Jeffrey B.

2014-01-01

Citrus bacterial canker (CBC) disease occurs worldwide and incurs considerable costs both from control measures and yield losses. Bacteria that cause CBC require one of six known type III transcription activator-like (TAL) effector genes for the characteristic pustule formation at the site of infection. Here, we show that Xanthomonas citri subspecies citri strain Xcc306, with the type III TAL effector gene pthA4 or with the distinct yet biologically equivalent gene pthAw from strain XccAw, induces two host genes, CsLOB1 and CsSWEET1, in a TAL effector-dependent manner. CsLOB1 is a member of the Lateral Organ Boundaries (LOB) gene family of transcription factors, and CsSWEET1 is a homolog of the SWEET sugar transporter and rice disease susceptibility gene. Both TAL effectors drive expression of CsLOB1 and CsSWEET1 promoter reporter gene fusions when coexpressed in citrus or Nicotiana benthamiana. Artificially designed TAL effectors directed to sequences in the CsLOB1 promoter region, but not the CsSWEET1 promoter, promoted pustule formation and higher bacterial leaf populations. Three additional distinct TAL effector genes, pthA*, pthB, and pthC, also direct pustule formation and expression of CsLOB1. Unlike pthA4 and pthAw, pthB and pthC do not promote the expression of CsSWEET1. CsLOB1 expression was associated with the expression of genes associated with cell expansion. The results indicate that CBC-inciting species of Xanthomonas exploit a single host disease susceptibility gene by altering the expression of an otherwise developmentally regulated gene using any one of a diverse set of TAL effector genes in the pathogen populations. PMID:24474801

Lateral organ boundaries 1 is a disease susceptibility gene for citrus bacterial canker disease.

PubMed

Hu, Yang; Zhang, Junli; Jia, Hongge; Sosso, Davide; Li, Ting; Frommer, Wolf B; Yang, Bing; White, Frank F; Wang, Nian; Jones, Jeffrey B

2014-01-28

Citrus bacterial canker (CBC) disease occurs worldwide and incurs considerable costs both from control measures and yield losses. Bacteria that cause CBC require one of six known type III transcription activator-like (TAL) effector genes for the characteristic pustule formation at the site of infection. Here, we show that Xanthomonas citri subspecies citri strain Xcc306, with the type III TAL effector gene pthA4 or with the distinct yet biologically equivalent gene pthAw from strain XccA(w), induces two host genes, CsLOB1 and CsSWEET1, in a TAL effector-dependent manner. CsLOB1 is a member of the Lateral Organ Boundaries (LOB) gene family of transcription factors, and CsSWEET1 is a homolog of the SWEET sugar transporter and rice disease susceptibility gene. Both TAL effectors drive expression of CsLOB1 and CsSWEET1 promoter reporter gene fusions when coexpressed in citrus or Nicotiana benthamiana. Artificially designed TAL effectors directed to sequences in the CsLOB1 promoter region, but not the CsSWEET1 promoter, promoted pustule formation and higher bacterial leaf populations. Three additional distinct TAL effector genes, pthA*, pthB, and pthC, also direct pustule formation and expression of CsLOB1. Unlike pthA4 and pthAw, pthB and pthC do not promote the expression of CsSWEET1. CsLOB1 expression was associated with the expression of genes associated with cell expansion. The results indicate that CBC-inciting species of Xanthomonas exploit a single host disease susceptibility gene by altering the expression of an otherwise developmentally regulated gene using any one of a diverse set of TAL effector genes in the pathogen populations.

Engineering and Functional Characterization of Fusion Genes Identifies Novel Oncogenic Drivers of Cancer. | Office of Cancer Genomics

Cancer.gov

Oncogenic gene fusions drive many human cancers, but tools to more quickly unravel their functional contributions are needed. Here we describe methodology permitting fusion gene construction for functional evaluation. Using this strategy, we engineered the known fusion oncogenes, BCR-ABL1, EML4-ALK, and ETV6-NTRK3, as well as 20 previously uncharacterized fusion genes identified in TCGA datasets.

Temporal regulation and forespore-specific expression of the spore photoproduct lyase gene by sigma-G RNA polymerase during Bacillus subtilis sporulation.

PubMed Central

Pedraza-Reyes, M; Gutiérrez-Corona, F; Nicholson, W L

1994-01-01

Bacterial spores are highly resistant to killing by UV radiation and exhibit unique DNA photochemistry. UV irradiation of spore DNA results in formation of spore photoproduct (SP), the thymine dimer 5-thyminyl-5,6-dihydrothymine. Repair of SP occurs during germination of Bacillus subtilis spores by two distinct routes, either by the general nucleotide excision repair (uvr) pathway or by a novel SP-specific monomerization reaction mediated by the enzyme SP lyase, which is encoded by the spl gene. Repair of SP occurs early in spore germination and is independent of de novo protein synthesis, suggesting that the SP repair enzymes are synthesized during sporulation and are packaged in the dormant spore. To test this hypothesis, the expression of a translational spl-lacZ fusion integrated at the spl locus was monitored during B. subtilis growth and sporulation. beta-Galactosidase expression from the spl-lacZ fusion was silent during vegetative growth and was not DNA damage inducible, but it was activated at morphological stage III of sporulation specifically in the forespore compartment, coincident with activation of expression of the stage III marker enzyme glucose dehydrogenase. Expression of the spl-lacZ fusion was shown to be dependent upon the sporulation-specific RNA polymerase containing the sigma-G factor (E sigma G), as spl-lacZ expression was abolished in a mutant harboring a deletion in the sigG gene and restored by expression of the sigG gene in trans. Primer extension analysis of spl mRNA revealed a major extension product initiating upstream from a small open reading frame of unknown function which precedes spl, and it revealed two other shorter minor extension products. All three extension products were present in higher quantities during sporulation and after sigG induction. The three putative transcripts are all preceded by sequences which share homology with the consensus sigma-G factor-type promoter sequence, but in vitro transcription by purified sigma-G RNA polymerase was detected only from the promoter corresponding to the major extension product. The open reading frame-spl operon therefore appears to be an additional member of the sigma-G regulon, which also includes as members the small, acid-soluble spore proteins which are in large part responsible for spore DNA photochemistry. Therefore, sporulating bacteria appear to coordinately regulate genes whose products not only alter spore DNA photochemistry but also repair the major spore-specific photoproduct during germination Images PMID:8021181

Molecular Cloning and Functional Characterization of the Lycopene ε-Cyclase Gene via Virus-Induced Gene Silencing and Its Expression Pattern in Nicotiana tabacum

PubMed Central

Shi, Yanmei; Wang, Ran; Luo, Zhaopeng; Jin, Lifeng; Liu, Pingping; Chen, Qiansi; Li, Zefeng; Li, Feng; Wei, Chunyang; Wu, Mingzhu; Wei, Pan; Xie, He; Qu, Lingbo; Lin, Fucheng; Yang, Jun

2014-01-01

Lycopene ε-cyclase (ε-LCY) is a key enzyme that catalyzes the synthesis of α-branch carotenoids through the cyclization of lycopene. Two cDNA molecules encoding ε-LCY (designated Ntε-LCY1 and Ntε-LCY2) were cloned from Nicotiana tabacum. Ntε-LCY1 and Ntε-LCY2 are encoded by two distinct genes with different evolutionary origins, one originating from the tobacco progenitor, Nicotiana sylvestris, and the other originating from Nicotiana tomentosiformis. The two coding regions are 97% identical at the nucleotide level and 95% identical at the amino acid level. Transcripts of Ntε-LCY were detectable in both vegetative and reproductive organs, with a relatively higher level of expression in leaves than in other tissues. Subcellular localization experiments using an Ntε-LCY1-GFP fusion protein demonstrated that mature Ntε-LCY1 protein is localized within the chloroplast in Bright Yellow 2 suspension cells. Under low-temperature and low-irradiation stress, Ntε-LCY transcript levels substantially increased relative to control plants. Tobacco rattle virus (TRV)-mediated silencing of ε-LCY in Nicotiana benthamiana resulted in an increase of β-branch carotenoids and a reduction in the levels of α-branch carotenoids. Meanwhile, transcripts of related genes in the carotenoid biosynthetic pathway observably increased, with the exception of β-OHase in the TRV-ε-lcy line. Suppression of ε-LCY expression was also found to alleviate photoinhibition of Potosystem II in virus-induced gene silencing (VIGS) plants under low-temperature and low-irradiation stress. Our results provide insight into the regulatory role of ε-LCY in plant carotenoid biosynthesis and suggest a role for ε-LCY in positively modulating low temperature stress responses. PMID:25153631

Molecular cloning and functional characterization of the lycopene ε-cyclase gene via virus-induced gene silencing and its expression pattern in Nicotiana tabacum.

PubMed

Shi, Yanmei; Wang, Ran; Luo, Zhaopeng; Jin, Lifeng; Liu, Pingping; Chen, Qiansi; Li, Zefeng; Li, Feng; Wei, Chunyang; Wu, Mingzhu; Wei, Pan; Xie, He; Qu, Lingbo; Lin, Fucheng; Yang, Jun

2014-08-22

Lycopene ε-cyclase (ε-LCY) is a key enzyme that catalyzes the synthesis of α-branch carotenoids through the cyclization of lycopene. Two cDNA molecules encoding ε-LCY (designated Ntε-LCY1 and Ntε-LCY2) were cloned from Nicotiana tabacum. Ntε-LCY1 and Ntε-LCY2 are encoded by two distinct genes with different evolutionary origins, one originating from the tobacco progenitor, Nicotiana sylvestris, and the other originating from Nicotiana tomentosiformis. The two coding regions are 97% identical at the nucleotide level and 95% identical at the amino acid level. Transcripts of Ntε-LCY were detectable in both vegetative and reproductive organs, with a relatively higher level of expression in leaves than in other tissues. Subcellular localization experiments using an Ntε-LCY1-GFP fusion protein demonstrated that mature Ntε-LCY1 protein is localized within the chloroplast in Bright Yellow 2 suspension cells. Under low-temperature and low-irradiation stress, Ntε-LCY transcript levels substantially increased relative to control plants. Tobacco rattle virus (TRV)-mediated silencing of ε-LCY in Nicotiana benthamiana resulted in an increase of β-branch carotenoids and a reduction in the levels of α-branch carotenoids. Meanwhile, transcripts of related genes in the carotenoid biosynthetic pathway observably increased, with the exception of β-OHase in the TRV-ε-lcy line. Suppression of ε-LCY expression was also found to alleviate photoinhibition of Potosystem II in virus-induced gene silencing (VIGS) plants under low-temperature and low-irradiation stress. Our results provide insight into the regulatory role of ε-LCY in plant carotenoid biosynthesis and suggest a role for ε-LCY in positively modulating low temperature stress responses.

Flexible tools for gene expression and silencing in tomato.

PubMed

Fernandez, Ana I; Viron, Nicolas; Alhagdow, Moftah; Karimi, Mansour; Jones, Matthew; Amsellem, Ziva; Sicard, Adrien; Czerednik, Anna; Angenent, Gerco; Grierson, Donald; May, Sean; Seymour, Graham; Eshed, Yuval; Lemaire-Chamley, Martine; Rothan, Christophe; Hilson, Pierre

2009-12-01

As a genetic platform, tomato (Solanum lycopersicum) benefits from rich germplasm collections and ease of cultivation and transformation that enable the analysis of biological processes impossible to investigate in other model species. To facilitate the assembly of an open genetic toolbox designed to study Solanaceae, we initiated a joint collection of publicly available gene manipulation tools. We focused on the characterization of promoters expressed at defined time windows during fruit development, for the regulated expression or silencing of genes of interest. Five promoter sequences were captured as entry clones compatible with the versatile MultiSite Gateway format: PPC2, PG, TPRP, and IMA from tomato and CRC from Arabidopsis (Arabidopsis thaliana). Corresponding transcriptional fusions were made with the GUS gene, a nuclear-localized GUS-GFP reporter, and the chimeric LhG4 transcription factor. The activity of the promoters during fruit development and in fruit tissues was confirmed in transgenic tomato lines. Novel Gateway destination vectors were generated for the transcription of artificial microRNA (amiRNA) precursors and hairpin RNAs under the control of these promoters, with schemes only involving Gateway BP and LR Clonase reactions. Efficient silencing of the endogenous phytoene desaturase gene was demonstrated in transgenic tomato lines producing a matching amiRNA under the cauliflower mosaic virus 35S or PPC2 promoter. Lastly, taking advantage of the pOP/LhG4 two-component system, we found that well-characterized flower-specific Arabidopsis promoters drive the expression of reporters in patterns generally compatible with heterologous expression. Tomato lines and plasmids will be distributed through a new Nottingham Arabidopsis Stock Centre service unit dedicated to Solanaceae resources.

Regulation of ciaXRH Operon Expression and Identification of the CiaR Regulon in Streptococcus mutans▿

PubMed Central

Wu, Chenggang; Ayala, Eduardo A.; Downey, Jennifer S.; Merritt, Justin; Goodman, Steven D.; Qi, Fengxia

2010-01-01

The ciaRH operon in Streptococcus mutans contains 3 contiguous genes, ciaXRH. Unlike the CiaRH system in other streptococci, only the ciaH-null mutant displays defective phenotypes, while the ciaR-null mutant behaves like the wild type. The objective of this study was to determine the mechanism of this unusual property. We demonstrate that the ciaH mutation caused a >20-fold increase in ciaR transcript synthesis. A ciaRH double deletion reversed the ciaH phenotype, suggesting that overexpressed ciaR might be responsible for the observed ciaH phenotypes. When ciaR was forced to be overexpressed by a transcriptional fusion to the ldh promoter in the wild-type background, the same ciaH phenotypes were restored, confirming the involvement of overexpressed ciaR in the ciaH phenotypes. The ciaH mutation and ciaR overexpression also caused transcriptional alterations in 100 genes, with 15 genes upregulated >5-fold. Bioinformatics analysis identified a putative CiaR regulon consisting of 8 genes/operons, including the ciaXRH operon itself, all of which were upregulated. In vitro footprinting on 4 of the 8 promoters revealed a protected region of 26 to 28 bp encompassing two direct repeats, NTTAAG-n5-WTTAAG, 10 bp upstream of the −10 region, indicating direct binding of the CiaR protein to these promoters. Taken together, we conclude that overexpressed CiaR, as a result of either ciaH deletion or forced expression from a constitutive promoter, is a mediator in the CiaH-regulated phenotypes. PMID:20639331

Identification of Heat Shock Transcription Factor Genes Involved in Thermotolerance of Octoploid Cultivated Strawberry

PubMed Central

Liao, Wan-Yu; Lin, Lee-Fong; Jheng, Jing-Lian; Wang, Chun-Chung; Yang, Jui-Hung; Chou, Ming-Lun

2016-01-01

Heat shock transcription factors (HSFs) are mainly involved in the activation of genes in response to heat stress as well as other abiotic and biotic stresses. The growth, development, reproduction, and yield of strawberry are strongly limited by extreme temperatures and droughts. In this study, we used Illumina sequencing and obtained transcriptome data set from Fragaria × ananassa Duchessne cv. Toyonoka. Six contigs and three unigenes were confirmed to encode HSF proteins (FaTHSFs). Subsequently, we characterized the biological functions of two particularly selected unigenes, FaTHSFA2a and FaTHSFB1a, which were classified into class A2 and B HSFs, respectively. Expression assays revealed that FaTHSFA2a and FaTHSFB1a expression was induced by heat shock and correlated well with elevated ambient temperatures. Overexpression of FaTHSFA2a and FaTHSFB1a resulted in the activation of their downstream stress-associated genes, and notably enhanced the thermotolerance of transgenic Arabidopsis plants. Besides, both FaTHSFA2a and FaTHSFB1a fusion proteins localized in the nucleus, indicating their similar subcellular distributions as transcription factors. Our yeast one-hybrid assay suggested that FaTHSFA2a has trans-activation activity, whereas FaTHSFB1a expresses trans-repression function. Altogether, our annotated transcriptome sequences provide a beneficial resource for identifying most genes expressed in octoploid strawberry. Furthermore, HSF studies revealed the possible insights into the molecular mechanisms of thermotolerance, thus rendering valuable molecular breeding to improve the tolerance of strawberry in response to high-temperature stress. PMID:27999304

Identification of Heat Shock Transcription Factor Genes Involved in Thermotolerance of Octoploid Cultivated Strawberry.

PubMed

Liao, Wan-Yu; Lin, Lee-Fong; Jheng, Jing-Lian; Wang, Chun-Chung; Yang, Jui-Hung; Chou, Ming-Lun

2016-12-17

Heat shock transcription factors (HSFs) are mainly involved in the activation of genes in response to heat stress as well as other abiotic and biotic stresses. The growth, development, reproduction, and yield of strawberry are strongly limited by extreme temperatures and droughts. In this study, we used Illumina sequencing and obtained transcriptome data set from Fragaria × ananassa Duchessne cv. Toyonoka. Six contigs and three unigenes were confirmed to encode HSF proteins (FaTHSFs). Subsequently, we characterized the biological functions of two particularly selected unigenes, FaTHSFA2a and FaTHSFB1a , which were classified into class A2 and B HSFs, respectively. Expression assays revealed that FaTHSFA2a and FaTHSFB1a expression was induced by heat shock and correlated well with elevated ambient temperatures. Overexpression of FaTHSFA2a and FaTHSFB1a resulted in the activation of their downstream stress-associated genes, and notably enhanced the thermotolerance of transgenic Arabidopsis plants. Besides, both FaTHSFA2a and FaTHSFB1a fusion proteins localized in the nucleus, indicating their similar subcellular distributions as transcription factors. Our yeast one-hybrid assay suggested that FaTHSFA2a has trans-activation activity, whereas FaTHSFB1a expresses trans-repression function. Altogether, our annotated transcriptome sequences provide a beneficial resource for identifying most genes expressed in octoploid strawberry. Furthermore, HSF studies revealed the possible insights into the molecular mechanisms of thermotolerance, thus rendering valuable molecular breeding to improve the tolerance of strawberry in response to high-temperature stress.

The recurrent SET-NUP214 fusion as a new HOXA activation mechanism in pediatric T-cell acute lymphoblastic leukemia

PubMed Central

Van Vlierberghe, Pieter; van Grotel, Martine; Tchinda, Joëlle; Lee, Charles; Beverloo, H. Berna; van der Spek, Peter J.; Stubbs, Andrew; Cools, Jan; Nagata, Kyosuke; Fornerod, Maarten; Buijs-Gladdines, Jessica; Horstmann, Martin; van Wering, Elisabeth R.; Soulier, Jean; Pieters, Rob

2008-01-01

T-cell acute lymphoblastic leukemia (T-ALL) is mostly characterized by specific chromosomal abnormalities, some occurring in a mutually exclusive manner that possibly delineate specific T-ALL subgroups. One subgroup, including MLL-rearranged, CALM-AF10 or inv (7)(p15q34) patients, is characterized by elevated expression of HOXA genes. Using a gene expression–based clustering analysis of 67 T-ALL cases with recurrent molecular genetic abnormalities and 25 samples lacking apparent aberrations, we identified 5 new patients with elevated HOXA levels. Using microarray-based comparative genomic hybridization (array-CGH), a cryptic and recurrent deletion, del (9)(q34.11q34.13), was exclusively identified in 3 of these 5 patients. This deletion results in a conserved SET-NUP214 fusion product, which was also identified in the T-ALL cell line LOUCY. SET-NUP214 binds in the promoter regions of specific HOXA genes, where it interacts with CRM1 and DOT1L, which may transcriptionally activate specific members of the HOXA cluster. Targeted inhibition of SET-NUP214 by siRNA abolished expression of HOXA genes, inhibited proliferation, and induced differentiation in LOUCY but not in other T-ALL lines. We conclude that SET-NUP214 may contribute to the pathogenesis of T-ALL by enforcing T-cell differentiation arrest. PMID:18299449

Aberrant DNA Methylation in Chronic Myeloid Leukemia: Cell Fate Control, Prognosis, and Therapeutic Response.

PubMed

Behzad, Masumeh Maleki; Shahrabi, Saeid; Jaseb, Kaveh; Bertacchini, Jessika; Ketabchi, Neda; Saki, Najmaldin

2018-01-31

Chronic myeloid leukemia (CML) is a hematopoietic stem cell malignancy characterized by the expression of the BCR-ABL1 fusion gene with different chimeric transcripts. Despite the crucial impact of constitutively active tyrosine kinase in CML pathogenesis, aberrant DNA methylation of certain genes plays an important role in disease progression and the development of drug resistance. This article reviews recent findings relevant to the effect of DNA methylation pattern of regulatory genes on various cellular activities such as cell proliferation and survival, as well as cell-signaling molecules in CML. These data might contribute to defining the role of aberrant DNA methylation in disease initiation and progression. However, further studies are needed on the validation of specific aberrant methylation markers regarding the prognosis and prediction of response among the CML patients.

Purification of cold-shock-like proteins from Stigmatella aurantiaca - molecular cloning and characterization of the cspA gene.

PubMed

Stamm, I; Leclerque, A; Plaga, W

1999-09-01

Prominent low-molecular-weight proteins were isolated from vegetative cells of the myxobacterium Stigmatella aurantiaca and were found to be members of the cold-shock protein family. A first gene of this family (cspA) was cloned and sequenced. It encodes a protein of 68 amino acid residues that displays up to 71% sequence identity with other bacterial cold-shock(-like) proteins. A cysteine residue within the RNP-2 motif is a peculiarity of Stigmatella CspA. A cspA::(Deltatrp-lacZ) fusion gene construct was introduced into Stigmatella by electroporation, a method that has not been used previously for this strain. Analysis of the resultant transformants revealed that cspA transcription occurs at high levels during vegetative growth at 20 and 32 degrees C, and during fruiting body formation.

Promiscuous partnerships in Ewing's sarcoma.

PubMed

Sankar, Savita; Lessnick, Stephen L

2011-07-01

Ewing's sarcoma is a highly aggressive bone and soft tissue tumor of children and young adults. At the molecular genetic level Ewing's sarcoma is characterized by a balanced reciprocal translocation, t(11;22)(q24;q12), which encodes an oncogenic fusion protein and transcription factor EWS/FLI. This tumor-specific chimeric fusion retains the amino terminus of EWS, a member of the TET (TLS/EWS/TAF15) family of RNA-binding proteins, and the carboxy terminus of FLI, a member of the ETS family of transcription factors. In addition to EWS/FLI, variant translocation fusions belonging to the TET/ETS family have been identified in Ewing's sarcoma. These studies solidified the importance of TET/ETS fusions in the pathogenesis of Ewing's sarcoma and have since been used as diagnostic markers for the disease. EWS fusions with non-ETS transcription factor family members have been described in sarcomas that are clearly distinct from Ewing's sarcoma. However, in recent years there have been reports of rare fusions in "Ewing's-like tumors" that harbor the amino-terminus of EWS fused to the carboxy-terminal DNA or chromatin-interacting domains contributed by non-ETS proteins. This review aims to summarize the growing list of fusion oncogenes that characterize Ewing's sarcoma and Ewing's-like tumors and highlights important questions that need to be answered to further support the existing concept that Ewing's sarcoma is strictly a "TET/ETS" fusion-driven malignancy. Understanding the molecular mechanisms of action of the various different fusion oncogenes will provide better insights into the biology underlying this rare but important solid tumor. Copyright © 2011 Elsevier Inc. All rights reserved.

Highly specific targeting of the TMPRSS2/ERG fusion gene using liposomal nanovectors

PubMed Central

Shao, Longjiang; Tekedereli, Ibrahim; Wang, Jianghua; Yuca, Erkan; Tsang, Susan; Sood, Anil; Lopez-Berestein, Gabriel; Ozpolat, Bulent; Ittmann, Michael

2012-01-01

Purpose The TMPRSS2/ERG (T/E) fusion gene is present in half of all prostate cancer (PCa) tumors. Fusion of the oncogenic ERG gene with the androgen-regulated TMPRSS2 gene promoter results in expression of fusion mRNAs in PCa cells. The junction of theTMPRSS2 and ERG derived portions of the fusion mRNA constitutes a cancer specific target in cells containing the T/E fusion gene. Targeting the most common alternatively spliced fusion gene mRNA junctional isoforms in vivo using siRNAs in liposomal nanovectors may potentially be a novel, low toxicity treatment for PCa. Experimental Design We designed and optimized siRNAs targeting the two most common T/E fusion gene mRNA junctional isoforms (Type III or Type VI). Specificity of siRNAs was assessed by transient co-transfection in vitro. To test their ability to inhibit growth of PCa cells expressing these fusion gene isoforms in vivo, specific siRNAs in liposomal nanovectors were used to treat mice bearing orthotopic or subcutaneous xenograft tumors expressing the targeted fusion isoforms. Results The targeting siRNAs were both potent and highly specific in vitro. In vivo they significantly inhibited tumor growth. The degree of growth inhibition was variable and was correlated with the extent of fusion gene knockdown. The growth inhibition was associated with marked inhibition of angiogenesis and, to a lesser degree, proliferation and a marked increase in apoptosis of tumor cells. No toxicity was observed. Conclusions Targeting the T/E fusion junction in vivo with specific siRNAs delivered via liposomal nanovectors is a promising therapy for men with PCa. PMID:23052253

Highly specific targeting of the TMPRSS2/ERG fusion gene using liposomal nanovectors.

PubMed

Shao, Longjiang; Tekedereli, Ibrahim; Wang, Jianghua; Yuca, Erkan; Tsang, Susan; Sood, Anil; Lopez-Berestein, Gabriel; Ozpolat, Bulent; Ittmann, Michael

2012-12-15

The TMPRSS2/ERG (T/E) fusion gene is present in half of all prostate cancer tumors. Fusion of the oncogenic ERG gene with the androgen-regulated TMPRSS2 gene promoter results in expression of fusion mRNAs in prostate cancer cells. The junction of theTMPRSS2- and ERG-derived portions of the fusion mRNA constitutes a cancer-specific target in cells containing the T/E fusion gene. Targeting the most common alternatively spliced fusion gene mRNA junctional isoforms in vivo using siRNAs in liposomal nanovectors may potentially be a novel, low-toxicity treatment for prostate cancer. We designed and optimized siRNAs targeting the two most common T/E fusion gene mRNA junctional isoforms (type III or type VI). Specificity of siRNAs was assessed by transient co-transfection in vitro. To test their ability to inhibit growth of prostate cancer cells expressing these fusion gene isoforms in vivo, specific siRNAs in liposomal nanovectors were used to treat mice bearing orthotopic or subcutaneous xenograft tumors expressing the targeted fusion isoforms. The targeting siRNAs were both potent and highly specific in vitro. In vivo they significantly inhibited tumor growth. The degree of growth inhibition was variable and was correlated with the extent of fusion gene knockdown. The growth inhibition was associated with marked inhibition of angiogenesis and, to a lesser degree, proliferation and a marked increase in apoptosis of tumor cells. No toxicity was observed. Targeting the T/E fusion junction in vivo with specific siRNAs delivered via liposomal nanovectors is a promising therapy for men with prostate cancer. ©2012 AACR.

The evolutionary duplication and probable demise of an endodermal GATA factor in Caenorhabditis elegans.

PubMed

Fukushige, Tetsunari; Goszczynski, Barbara; Tian, Helen; McGhee, James D

2003-10-01

We describe the elt-4 gene from the nematode Caenorhabditis elegans. elt-4 is predicted to encode a very small (72 residues, 8.1 kD) GATA-type zinc finger transcription factor. The elt-4 gene is located approximately 5 kb upstream of the C. elegans elt-2 gene, which also encodes a GATA-type transcription factor; the zinc finger DNA-binding domains are highly conserved (24/25 residues) between the two proteins. The elt-2 gene is expressed only in the intestine and is essential for normal intestinal development. This article explores whether elt-4 also has a role in intestinal development. Reporter fusions to the elt-4 promoter or reporter insertions into the elt-4 coding regions show that elt-4 is indeed expressed in the intestine, beginning at the 1.5-fold stage of embryogenesis and continuing into adulthood. elt-4 reporter fusions are also expressed in nine cells of the posterior pharynx. Ectopic expression of elt-4 cDNA within the embryo does not cause detectable ectopic expression of biochemical markers of gut differentiation; furthermore, ectopic elt-4 expression neither inhibits nor enhances the ectopic marker expression caused by ectopic elt-2 expression. A deletion allele of elt-4 was isolated but no obvious phenotype could be detected, either in the gut or elsewhere; brood sizes, hatching efficiencies, and growth rates were indistinguishable from wild type. We found no evidence that elt-4 provided backup functions for elt-2. We used microarray analysis to search for genes that might be differentially expressed between L1 larvae of the elt-4 deletion strain and wild-type worms. Paired hybridizations were repeated seven times, allowing us to conclude, with some confidence, that no candidate target transcript could be identified as significantly up- or downregulated by loss of elt-4 function. In vitro binding experiments could not detect specific binding of ELT-4 protein to candidate binding sites (double-stranded oligonucleotides containing single or multiple WGATAR sequences); ELT-4 protein neither enhanced nor inhibited the strong sequence-specific binding of the ELT-2 protein. Whereas ELT-2 protein is a strong transcriptional activator in yeast, ELT-4 protein has no such activity under similar conditions, nor does it influence the transcriptional activity of coexpressed ELT-2 protein. Although an elt-2 homolog was easily identified in the genomic sequence of the related nematode C. briggsae, no elt-4 homolog could be identified. Analysis of the changes in silent third codon positions within the DNA-binding domains indicates that elt-4 arose as a duplication of elt-2, some 25-55 MYA. Thus, elt-4 has survived far longer than the average duplicated gene in C. elegans, even though no obvious biological function could be detected. elt-4 provides an interesting example of a tandemly duplicated gene that may originally have been the same size as elt-2 but has gradually been whittled down to its present size of little more than a zinc finger. Although elt-4 must confer (or must have conferred) some selective advantage to C. elegans, we suggest that its ultimate evolutionary fate will be disappearance from the C. elegans genome.

Analysis of clinicopathological features of the echinoderm microtubule-associated protein-like-4-anaplastic lymphoma kinase fusion gene in Chinese patients with advanced non-small-cell lung cancer

PubMed Central

Liu, Yu-Tao; Shi, Yuan-Kai; Hao, Xue-Zhi; Wang, Lin; Li, Jun-Ling; Han, Xiao-Hong; Li, Dan; Zhou, Yu-Jie; Tang, Le

2014-01-01

Background The echinoderm microtubule-associated protein-like-4-anaplastic lymphoma kinase (EML4-ALK) fusion gene defines a novel molecular subset of non-small-cell lung cancer (NSCLC). However, the clinicopathological features of patients with the EML4-ALK fusion gene have not been defined completely. Methods Clinicopathological data of 200 Chinese patients with advanced NSCLC were analyzed retrospectively to explore their possible correlations with EML4-ALK fusions. Results The EML4-ALK fusion gene was detected in 56 (28.0%) of the 200 NSCLC patients, and undetected in 22 (11.0%) patients because of an insufficient amount of pathological tissue. The median age of the patients with positive and negative EML4-ALK was 48 and 55 years, respectively. Patients with the EML4-ALK fusion gene were significantly younger (P< 0.001). The detection rate of the EML4-ALK fusion gene in patients who received primary tumor or metastatic lymph node resection was significantly higher than in patients who received fine-needle biopsy (P= 0.003). The detection rate of the EML4-ALK fusion gene in patients with a time lag from obtainment of the pathological tissue to EML4-ALK fusion gene detection ≤48 months was significantly higher than in patients >48 months (P= 0.020). The occurrence of the EML4-ALK fusion gene in patients with wild-type epidermal growth factor receptor (EGFR) was significantly higher than in patients with mutant-type EGFR (42.5% [37/87] vs. 6.3% [1/16], P= 0.005). Conclusions Younger age and wild-type EGFR were identified as clinicopathological characteristics of patients with advanced NSCLC who harbored the EML4-ALK fusion gene. The optimal time lag from the obtainment of the pathological tissue to the time of EML4-ALK fusion gene detection is ≤48 months. PMID:26767009

Engineering and Functional Characterization of Fusion Genes Identifies Novel Oncogenic Drivers of Cancer.

PubMed

Lu, Hengyu; Villafane, Nicole; Dogruluk, Turgut; Grzeskowiak, Caitlin L; Kong, Kathleen; Tsang, Yiu Huen; Zagorodna, Oksana; Pantazi, Angeliki; Yang, Lixing; Neill, Nicholas J; Kim, Young Won; Creighton, Chad J; Verhaak, Roel G; Mills, Gordon B; Park, Peter J; Kucherlapati, Raju; Scott, Kenneth L

2017-07-01

Oncogenic gene fusions drive many human cancers, but tools to more quickly unravel their functional contributions are needed. Here we describe methodology permitting fusion gene construction for functional evaluation. Using this strategy, we engineered the known fusion oncogenes, BCR-ABL1, EML4-ALK , and ETV6-NTRK3, as well as 20 previously uncharacterized fusion genes identified in The Cancer Genome Atlas datasets. In addition to confirming oncogenic activity of the known fusion oncogenes engineered by our construction strategy, we validated five novel fusion genes involving MET, NTRK2 , and BRAF kinases that exhibited potent transforming activity and conferred sensitivity to FDA-approved kinase inhibitors. Our fusion construction strategy also enabled domain-function studies of BRAF fusion genes. Our results confirmed other reports that the transforming activity of BRAF fusions results from truncation-mediated loss of inhibitory domains within the N-terminus of the BRAF protein. BRAF mutations residing within this inhibitory region may provide a means for BRAF activation in cancer, therefore we leveraged the modular design of our fusion gene construction methodology to screen N-terminal domain mutations discovered in tumors that are wild-type at the BRAF mutation hotspot, V600. We identified an oncogenic mutation, F247L, whose expression robustly activated the MAPK pathway and sensitized cells to BRAF and MEK inhibitors. When applied broadly, these tools will facilitate rapid fusion gene construction for subsequent functional characterization and translation into personalized treatment strategies. Cancer Res; 77(13); 3502-12. ©2017 AACR . ©2017 American Association for Cancer Research.

ChimerDB 3.0: an enhanced database for fusion genes from cancer transcriptome and literature data mining.

PubMed

Lee, Myunggyo; Lee, Kyubum; Yu, Namhee; Jang, Insu; Choi, Ikjung; Kim, Pora; Jang, Ye Eun; Kim, Byounggun; Kim, Sunkyu; Lee, Byungwook; Kang, Jaewoo; Lee, Sanghyuk

2017-01-04

Fusion gene is an important class of therapeutic targets and prognostic markers in cancer. ChimerDB is a comprehensive database of fusion genes encompassing analysis of deep sequencing data and manual curations. In this update, the database coverage was enhanced considerably by adding two new modules of The Cancer Genome Atlas (TCGA) RNA-Seq analysis and PubMed abstract mining. ChimerDB 3.0 is composed of three modules of ChimerKB, ChimerPub and ChimerSeq. ChimerKB represents a knowledgebase including 1066 fusion genes with manual curation that were compiled from public resources of fusion genes with experimental evidences. ChimerPub includes 2767 fusion genes obtained from text mining of PubMed abstracts. ChimerSeq module is designed to archive the fusion candidates from deep sequencing data. Importantly, we have analyzed RNA-Seq data of the TCGA project covering 4569 patients in 23 cancer types using two reliable programs of FusionScan and TopHat-Fusion. The new user interface supports diverse search options and graphic representation of fusion gene structure. ChimerDB 3.0 is available at http://ercsb.ewha.ac.kr/fusiongene/. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Paracentric inversion-associated t(8;21) variant in de novo acute myelogenous leukemia: characteristic patterns of conventional cytogenetics, FISH, and multicolor banding analysis.

PubMed

Park, Tae Sung; Song, Jaewoo; Lee, Kyung-A; Min, Yoo Hong; Lee, Sang-Guk; Park, Yongjung; Kim, Juwon; Lee, Eun Yup; Choi, Jong Rak

2008-05-01

Acute myelogenous leukemia (AML) with t(8;21)(q22;q22) demonstrates unique clinico-pathologic disease entity in patients with hematologic malignancies. The t(8;21), which results in fusion of the AML1 gene on 21q22 and the ETO gene on 8q22 on a molecular level, is one of the most common nonrandom chromosomal changes, and it is found in about 5-12% of patients with AML. Among these cases, complex variants involving chromosomes 8 and 21, as well as a third or fourth chromosome, account for approximately 6-10% of patients with an AML1/ETO chimeric gene, and about 100 variant cases with AML1/ETO fusion transcript have been reported in the literature. Here, we describe a rare case report of reciprocal paracentric inversion-associated t(8;21) variant in a 28-year old male patient with de novo AML. The abnormal results of conventional cytogenetics and interphase fluorescent in situ hybridization in this patient drove us to perform further studies and a literature review. This report emphasizes the value of "conventional" cytogenetics, as well as "newly developed" molecular cytogenetic methods in the diagnosis of rare complex t(8;21) variant in patients with AML. Copyright 2008 Elsevier Inc.

Xp11.2 translocation renal cell carcinoma.

PubMed

Armah, Henry B; Parwani, Anil V

2010-01-01

Xp11.2 translocation renal cell carcinomas (RCCs), a recently recognized distinct subtype, are rare tumors predominantly reported in young patients. They comprise at least one-third of pediatric RCCs, and only few adult cases have been reported. They are characterized by various translocations involving chromosome Xp11.2, all resulting in gene fusions involving the transcription factor E3 (TFE3) gene. In recent years, at least 6 different Xp11.2 translocation RCCs have been identified and characterized at the molecular level. These include a distinctive RCC that bears a translocation with the identical chromosomal breakpoints (Xp11.2, 17q25) and identical resulting ASPL-TFE3 gene fusion as alveolar soft part sarcoma. They typically have papillary or nested architecture and are composed of cells with voluminous, clear, or eosinophilic cytoplasm. Their most distinctive immunohistochemical feature is nuclear labeling for TFE3 protein. Although only limited data are available so far, they are believed to be rather indolent, but there have been increasing, recent reports of an aggressive clinical course in adult cases. The consistent immunohistochemical staining for TFE3 in all RCC with unusual histology, regardless of patient age, is likely to expand the spectrum of Xp11.2 translocation RCC with respect to age, clinical behavior, and molecular abnormalities.

Diagnosis of Cetacean morbillivirus: A sensitive one step real time RT fast-PCR method based on SYBR(®) Green.

PubMed

Sacristán, Carlos; Carballo, Matilde; Muñoz, María Jesús; Bellière, Edwige Nina; Neves, Elena; Nogal, Verónica; Esperón, Fernando

2015-12-15

Cetacean morbillivirus (CeMV) (family Paramyxoviridae, genus Morbillivirus) is considered the most pathogenic virus of cetaceans. It was first implicated in the bottlenose dolphin (Tursiops truncatus) mass stranding episode along the Northwestern Atlantic coast in the late 1980s, and in several more recent worldwide epizootics in different Odontoceti species. This study describes a new one step real-time reverse transcription fast polymerase chain reaction (real-time RT-fast PCR) method based on SYBR(®) Green to detect a fragment of the CeMV fusion protein gene. This primer set also works for conventional RT-PCR diagnosis. This method detected and identified all three well-characterized strains of CeMV: porpoise morbillivirus (PMV), dolphin morbillivirus (DMV) and pilot whale morbillivirus (PWMV). Relative sensitivity was measured by comparing the results obtained from 10-fold dilution series of PMV and DMV positive controls and a PWMV field sample, to those obtained by the previously described conventional phosphoprotein gene based RT-PCR method. Both the conventional and real-time RT-PCR methods involving the fusion protein gene were 100- to 1000-fold more sensitive than the previously described conventional RT-PCR method. Copyright © 2015 Elsevier B.V. All rights reserved.

Resolving quandaries: basaloid adenoid cystic carcinoma or breast cylindroma? The role of massively parallel sequencing.

PubMed

Fusco, Nicola; Colombo, Pierre-Emmanuel; Martelotto, Luciano G; De Filippo, Maria R; Piscuoglio, Salvatore; Ng, Charlotte K Y; Lim, Raymond S; Jacot, William; Vincent-Salomon, Anne; Reis-Filho, Jorge S; Weigelt, Britta

2016-01-01

The aims of this study were to perform a whole-exome sequencing analysis of a breast cylindroma and to investigate the role of molecular analyses in the differentiation between breast cylindroma, a benign tumour that displays MYB expression, and CYLD gene mutations, and its main differential diagnosis, the breast solid-basaloid adenoid cystic carcinoma, a malignant tumour that is characterized by the presence of the MYB-NFIB fusion gene and MYB overexpression. A 66-year-old female underwent quadrantectomy after an irregular dense shadow was discovered in the right breast at the screening mammogram. Histologically, the tumour displayed features suggestive of a solid-basaloid variant of adenoid cystic carcinoma with a differential diagnosis of cylindroma. Fluorescence in situ hybridization, reverse transcription-polymerase chain reaction, immunohistochemistry and whole-exome sequencing revealed absence of the MYB-NFIB fusion gene, low levels of MYB protein expression and a clonal somatic CYLD splice site mutation associated with loss of heterozygosity of the wild-type allele. The results of the histological, immunohistochemical and molecular analyses were consistent with a diagnosis of breast cylindroma, providing a proof-of-principle that the integration of histopathological and molecular approaches can help to differentiate between a low-malignant potential and a benign breast tumour of triple-negative phenotype. © 2015 John Wiley & Sons Ltd.

Clinicopathological Characteristics of Patients with Non-Small-Cell Lung Cancer Who Harbor EML4-ALK Fusion Gene: A Meta-Analysis

PubMed Central

Zhao, Fengzhi; Xu, Meng; Lei, Honcho; Zhou, Ziqi; Wang, Liang; Li, Ping; Zhao, Jianfu; Hu, Penghui

2015-01-01

Background A novel fusion gene of echinoderm microtubule-associated protein-like 4 (EML4) and anaplastic lymphoma kinase (ALK) has been recently identified in non-small-cell lung cancers (NSCLCs). Patients with the EML4-ALK fusion gene demonstrate unique clinicopathological and physiological characteristics. Here we present a meta-analysis of large-scale studies to evaluate the clinicopathological characteristics of NSCLC patients harboring the EML4-ALK fusion gene. Methods Both English and Chinese databases were systematically used to search the materials of the clinicopathological characteristics of patients with NSCLC harboring the EML4-ALK fusion gene. Pooled relative risk (RR) estimates and the 95% confidence intervals (95% CI) were calculated with the fixed or random effect model. Publication bias and chi-square test were also calculated. Results 27 retrospective studies were included in our meta-analysis. These studies included a total of 6950 patients. The incidence rate of EML4-ALK fusion in NSCLC patients was found to be 6.8% (472/6950). The correlation of the EML4-ALK fusion gene and clinicopathological characteristics of NSCLC patients demonstrated a significant difference in smoking status, histological types, stage, and ethnic characteristics. The positive rate of the EML4-ALK fusion gene expression in females were slightly higher than that in males, but not significantly (P = 0.52). In addition, the EML4-ALK fusion gene was mutually exclusive of the EGFR and KRAS mutation genes (P = 0.00). Conclusion Our pooled analysis revealed that the EML4-ALK fusion gene was observed predominantly in adenocarcinoma, non-smoking and NSCLC patients, especially those diagnosed in the advanced clinical stage of NSCLC. Additionally, the EML4-ALK fusion gene was exclusive of the EGFR and KRAS mutation genes. We surmise that IHC assay is a valuable tool for the prescreening of patients with ALK fusion gene in clinical practice, and FISH assay can be performed as a confirmation method. These insights might be helpful in guiding the appropriate molecular target therapy for NSCLC. PMID:25706305

Clinicopathological characteristics of patients with non-small-cell lung cancer who harbor EML4-ALK fusion gene: a meta-analysis.

PubMed

Zhao, Fengzhi; Xu, Meng; Lei, Honcho; Zhou, Ziqi; Wang, Liang; Li, Ping; Zhao, Jianfu; Hu, Penghui

2015-01-01

A novel fusion gene of echinoderm microtubule-associated protein-like 4 (EML4) and anaplastic lymphoma kinase (ALK) has been recently identified in non-small-cell lung cancers (NSCLCs). Patients with the EML4-ALK fusion gene demonstrate unique clinicopathological and physiological characteristics. Here we present a meta-analysis of large-scale studies to evaluate the clinicopathological characteristics of NSCLC patients harboring the EML4-ALK fusion gene. Both English and Chinese databases were systematically used to search the materials of the clinicopathological characteristics of patients with NSCLC harboring the EML4-ALK fusion gene. Pooled relative risk (RR) estimates and the 95% confidence intervals (95% CI) were calculated with the fixed or random effect model. Publication bias and chi-square test were also calculated. 27 retrospective studies were included in our meta-analysis. These studies included a total of 6950 patients. The incidence rate of EML4-ALK fusion in NSCLC patients was found to be 6.8% (472/6950). The correlation of the EML4-ALK fusion gene and clinicopathological characteristics of NSCLC patients demonstrated a significant difference in smoking status, histological types, stage, and ethnic characteristics. The positive rate of the EML4-ALK fusion gene expression in females were slightly higher than that in males, but not significantly (P = 0.52). In addition, the EML4-ALK fusion gene was mutually exclusive of the EGFR and KRAS mutation genes (P = 0.00). Our pooled analysis revealed that the EML4-ALK fusion gene was observed predominantly in adenocarcinoma, non-smoking and NSCLC patients, especially those diagnosed in the advanced clinical stage of NSCLC. Additionally, the EML4-ALK fusion gene was exclusive of the EGFR and KRAS mutation genes. We surmise that IHC assay is a valuable tool for the prescreening of patients with ALK fusion gene in clinical practice, and FISH assay can be performed as a confirmation method. These insights might be helpful in guiding the appropriate molecular target therapy for NSCLC.

Evidence that the lung Adenocarcinoma EML4-ALK fusion gene is not caused by exposure to secondhand tobacco smoke during childhood.

PubMed

Ryan, Bríd M; Wang, Yi; Jen, Jin; Yi, Eunhee S; Olivo-Marston, Susan; Yang, Ping; Harris, Curtis C

2014-07-01

The EML4-ALK fusion gene is more frequently found in younger, never smoking patients with lung cancer. Meanwhile, never smokers exposed to secondhand tobacco smoke (SHS) during childhood are diagnosed at a younger age compared with never smoking patients with lung cancer who are not exposed. We, therefore, hypothesized that SHS, which can induce DNA damage, is associated with the EML4-ALK fusion gene. We compared the frequency of the EML4-ALK fusion gene among 197 never smoker patients with lung cancer with and without a history of exposure to SHS during childhood at Mayo Clinic. The EML4-ALK fusion gene was detected in 33% of cases from never smokers with a history of SHS exposure during childhood, whereas 47% of never smoking lung cancer cases without a history of childhood SHS exposure tested positive for the fusion gene. The EML4-ALK fusion gene is not enriched in tumors from individuals exposed to SHS during childhood. These data suggest that childhood exposure to SHS is not a significant etiologic cause of the EML4-ALK fusion gene in lung cancer. ©2014 American Association for Cancer Research.

Developmentally distinct MYB genes encode functionally equivalent proteins in Arabidopsis.

PubMed

Lee, M M; Schiefelbein, J

2001-05-01

The duplication and divergence of developmental control genes is thought to have driven morphological diversification during the evolution of multicellular organisms. To examine the molecular basis of this process, we analyzed the functional relationship between two paralogous MYB transcription factor genes, WEREWOLF (WER) and GLABROUS1 (GL1), in Arabidopsis. The WER and GL1 genes specify distinct cell types and exhibit non-overlapping expression patterns during Arabidopsis development. Nevertheless, reciprocal complementation experiments with a series of gene fusions showed that WER and GL1 encode functionally equivalent proteins, and their unique roles in plant development are entirely due to differences in their cis-regulatory sequences. Similar experiments with a distantly related MYB gene (MYB2) showed that its product cannot functionally substitute for WER or GL1. Furthermore, an analysis of the WER and GL1 proteins shows that conserved sequences correspond to specific functional domains. These results provide new insights into the evolution of the MYB gene family in Arabidopsis, and, more generally, they demonstrate that novel developmental gene function may arise solely by the modification of cis-regulatory sequences.

Identification of target genes of synovial sarcoma-associated fusion oncoprotein using human pluripotent stem cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hayakawa, Kazuo; Department of Cell Growth and Differentiation, Center for iPS Cell Research and Application, Kyoto University, Kyoto; Department of Orthopaedic Surgery, Graduate School of Medical Sciences, Nagoya City University, Nagoya

2013-03-22

Highlights: ► We tried to identify targets of synovial sarcoma (SS)-associated SYT–SSX fusion gene. ► We established pluripotent stem cell (PSC) lines with inducible SYT–SSX gene. ► SYT–SSX responsive genes were identified by the induction of SYT–SSX in PSC. ► SS-related genes were selected from database by in silico analyses. ► 51 genes were finally identified among SS-related genes as targets of SYT–SSX in PSC. -- Abstract: Synovial sarcoma (SS) is a malignant soft tissue tumor harboring chromosomal translocation t(X; 18)(p11.2; q11.2), which produces SS-specific fusion gene, SYT–SSX. Although precise function of SYT–SSX remains to be investigated, accumulating evidences suggestmore » its role in gene regulation via epigenetic mechanisms, and the product of SYT–SSX target genes may serve as biomarkers of SS. Lack of knowledge about the cell-of-origin of SS, however, has placed obstacle in the way of target identification. Here we report a novel approach to identify SYT–SSX2 target genes using human pluripotent stem cells (hPSCs) containing a doxycycline-inducible SYT–SSX2 gene. SYT–SSX2 was efficiently induced both at mRNA and protein levels within three hours after doxycycline administration, while no morphological change of hPSCs was observed until 24 h. Serial microarray analyses identified genes of which the expression level changed more than twofold within 24 h. Surprisingly, the majority (297/312, 95.2%) were up-regulated genes and a result inconsistent with the current concept of SYT–SSX as a transcriptional repressor. Comparing these genes with SS-related genes which were selected by a series of in silico analyses, 49 and 2 genes were finally identified as candidates of up- and down-regulated target of SYT–SSX, respectively. Association of these genes with SYT–SSX in SS cells was confirmed by knockdown experiments. Expression profiles of SS-related genes in hPSCs and human mesenchymal stem cells (hMSCs) were strikingly different in response to the induction of SYT–SSX, and more than half of SYT–SSX target genes in hPSCs were not induced in hMSCs. These results suggest the importance of cellular context for correct understanding of SYT–SSX function, and demonstrated how our new system will help to overcome this issue.« less