Science.gov

Sample records for fyn regulatory mechanisms

  1. STriatal-Enriched protein tyrosine Phosphatase (STEP) Regulates the PTPα/Fyn Signaling Pathway

    PubMed Central

    Xu, Jian; Kurup, Pradeep; Foscue, Ethan; Lombroso, Paul J.

    2015-01-01

    The tyrosine kinase Fyn has two regulatory tyrosine residues that when phosphorylated either activate (Tyr420) or inhibit (Tyr531) Fyn activity. Within the central nervous system, two protein tyrosine phosphatases (PTPs) target these regulatory tyrosines in Fyn. PTPα dephosphorylates Tyr531 and activates Fyn, while STEP (STriatal-Enriched protein tyrosine Phosphatase) dephosphorylates Tyr420 and inactivates Fyn. Thus, PTPα and STEP have opposing functions in the regulation of Fyn; however, whether there is cross talk between these two PTPs remains unclear. Here, we used molecular techniques in primary neuronal cultures and in vivo to demonstrate that STEP negatively regulates PTPα by directly dephosphorylating PTPα at its regulatory Tyr789. Dephosphorylation of Tyr789 prevents the translocation of PTPα to synaptic membranes, blocking its ability to interact with and activate Fyn. Genetic or pharmacologic reduction of STEP61 activity increased the phosphorylation of PTPα at Tyr789, as well as increased translocation of PTPα to synaptic membranes. Activation of PTPα and Fyn and trafficking of GluN2B to synaptic membranes are necessary for ethanol intake behaviors in rodents. We tested the functional significance of STEP61 in this signaling pathway by ethanol administration to primary cultures as well as in vivo, and demonstrated that the inactivation of STEP61 by ethanol leads to the activation of PTPα, its translocation to synaptic membranes, and the activation of Fyn. These findings indicate a novel mechanism by which STEP61 regulates PTPα and suggest that STEP and PTPα coordinate the regulation of Fyn. PMID:25951993

  2. Rescue of a trafficking defective human pacemaker channel via a novel mechanism: roles of Src, Fyn, and Yes tyrosine kinases.

    PubMed

    Lin, Yen-Chang; Huang, Jianying; Kan, Hong; Frisbee, Jefferson C; Yu, Han-Gang

    2009-10-30

    Therapeutic strategies such as using channel blockers and reducing culture temperature have been used to rescue some long QT-associated voltage-gated potassium Kv trafficking defective mutant channels. A hyperpolarization-activated cyclic nucleotide-gated HCN4 pacemaker channel mutant (D553N) has been recently found in a patient associated with cardiac arrhythmias including long QT. D553N showed the defective trafficking to the cell surface, leading to little ionic current expression (loss-of-function). We show in this report that enhanced tyrosine phosphorylation mediated by Src, Fyn, and Yes kinases was able to restore the surface expression of D553N for normal current expression. Src or Yes, but not Fyn, significantly increased the current density and surface expression of D553N. Fyn accelerated the activation kinetics of the rescued D553N. Co-expression of D553N with Yes exhibited the slowest activation kinetics of D553N. Src, Fyn, and Yes significantly enhanced the tyrosine phosphorylation of D553N. A combination of Src, Fyn, and Yes rescued the current expression and the gating of D553N comparable with those of wild-type HCN4. In conclusion, we demonstrate a novel mechanism using three endogenous Src kinases to rescue a trafficking defective HCN4 mutant channel (D553N) by enhancing the tyrosine phosphorylation of the mutant channel protein.

  3. The Cbl Proto-Oncogene Product Negatively Regulates the Src-Family Tyrosine Kinase Fyn by Enhancing Its Degradation

    PubMed Central

    Andoniou, Christopher E.; Lill, Nancy L.; Thien, Christine B.; Lupher, Mark L.; Ota, Satoshi; Bowtell, David D. L.; Scaife, Robin M.; Langdon, Wallace Y.; Band, Hamid

    2000-01-01

    Fyn is a prototype Src-family tyrosine kinase that plays specific roles in neural development, keratinocyte differentiation, and lymphocyte activation, as well as roles redundant with other Src-family kinases. Similar to other Src-family kinases, efficient regulation of Fyn is achieved through intramolecular binding of its SH3 and SH2 domains to conserved regulatory regions. We have investigated the possibility that the tyrosine kinase regulatory protein Cbl provides a complementary mechanism of Fyn regulation. We show that Cbl overexpression in 293T embryonic kidney and Jurkat T-lymphocyte cells led to a dramatic reduction in the active pool of Fyn; this was seen as a reduction in Fyn autophosphorylation, reduced phosphorylation of in vivo substrates, and inhibition of transcription from a Src-family kinase response element linked to a luciferase reporter. Importantly, a Fyn mutant (FynY528F) relieved of intramolecular repression was still negatively regulated by Cbl. The Cbl-dependent negative regulation of Fyn did not appear to be mediated by inhibition of Fyn kinase activity but was correlated with enhanced protein turnover. Consistent with such a mechanism, elevated levels of Fyn protein were observed in cell lines derived from Cbl−/− mice compared to those in wild-type controls. The effects of Cbl on Fyn were not observed when the 70ZCbl mutant protein was analyzed. Taken together, these observations implicate Cbl as a component in the negative regulation of Fyn and potentially other Src-family kinases, especially following kinase activation. These results also suggest that protein degradation may be a general mechanism for Cbl-mediated negative regulation of activated tyrosine kinases. PMID:10629042

  4. Roles of Fyn in pancreatic cancer metastasis.

    PubMed

    Chen, Zhi-Yu; Cai, Lei; Bie, Ping; Wang, Shu-Guang; Jiang, Yan; Dong, Jia-Hong; Li, Xiao-Wu

    2010-02-01

    Src family kinases have been suggested to be associated with the metastasis of tumors, but their related mechanisms remain unclear. The aims of the present study were to assess the possible mechanisms by which the inhibition of Fyn activation regulates pancreatic cancer metastasis. We examined the expressions of Fyn in human pancreatic cancer tissues by immunohistochemistry and systematically investigated the relationship between Fyn expression and pancreatic cancer metastasis. A nude mouse xenograft model induced by BxPC3 cells with or without the inhibition of Fyn activation was used to explore the effect of the inhibition of Fyn on metastasis in vivo. Methyl thiazolyl tetrazolium and terminal deoxynucleotidyl transferase-labeling assays were used to examine the effect of the inhibition of Fyn on the cell proliferation of BxPC3 pancreatic cancer cells in vitro. Reverse transcription polymerase chain reaction and Western blot analysis were performed to explore the possible mechanism of Fyn-induced metastasis. We found that the upregulation of Fyn expression was correlated with human pancreatic cancer metastasis. In BxPC3 pancreatic cancer cells, the inhibition of Fyn activation by kinase-dead Fyn transfection decreased liver metastasis in nude mice. Further analyses showed that Fyn activity modulated pancreatic cell metastasis through the regulation of proliferation and apoptosis. Our results suggest a possible mechanism by which Fyn activity regulates cell proliferation and apoptosis that exerts an effect on pancreatic cancer metastasis.

  5. Fyn is required for oxidative- and hyperosmotic-stress-induced tyrosine phosphorylation of caveolin-1.

    PubMed Central

    Sanguinetti, Amy R; Cao, Haiming; Corley Mastick, Cynthia

    2003-01-01

    Caveolin-1 is phosphorylated on Tyr(14) in response to both oxidative and hyperosmotic stress. In the present paper, we show that this phosphorylation requires activation of the Src family kinase Fyn. Stress-induced caveolin phosphorylation was abolished by three Src kinase inhibitors, SU6656, PP2 and PD180970, and was not observed in fibroblasts derived from a Src, Yes and Fyn triple-knockout mouse (SYF-/-). Using cell lines derived from single-kinase-knockout mice (Src-/-, Yes-/- and Fyn-/-), we show that expression of Fyn, but not Src or Yes, is required for stress-induced caveolin phosphorylation. Heterologous expression of Fyn in the SYF-/- and Fyn-/- cells was sufficient to reconstitute stress-induced caveolin phosphorylation, and overexpression of Fyn in wild-type cells induced hyperphosphorylation of caveolin. Fyn was autophosphorylated following oxidative stress, verifying activation of this kinase. Interestingly, there was a concomitant increase in the phosphorylation of Fyn on its Csk (C-terminal Src kinase) site, indicating feedback inhibition. Csk binds to phosphocaveolin [Cao, Courchesne and Mastick (2002) J. Biol. Chem. 277, 8771-8774] and should phosphorylate any co-localized Src-family kinases. Oxidative-stress-induced phosphorylation of caveolin-1 also requires expression of Abl [Sanguinetti and Mastick (2003) Cell Signal. 15, 289-298]. Using inhibitors and cells derived from knockout mice, we verified a requirement for both Abl and Fyn in stress-induced caveolin phosphorylation in a single cell type. Our data suggest a novel mechanism for attenuation of Src-kinase activity by Abl: stable tyrosine phosphorylation of a scaffolding protein, caveolin, and recruitment of Csk. Paxillin, a substrate of both Abl and Src, organizes a similar regulatory complex. PMID:12921535

  6. Mice lacking the IFN-gamma receptor or fyn develop severe experimental autoimmune uveoretinitis characterized by different immune responses.

    PubMed

    Fukushima, Atsuki; Yamaguchi, Tomoko; Ishida, Waka; Fukata, Kazuyo; Udaka, Keiko; Ueno, Hisayuki

    2005-06-01

    significantly higher in GRKO and fyn KO mice than in WT mice, suggesting that endogenous IFN-gammaR and fyn negatively regulate the development of EAU. The different cytokine production patterns by the GRKO and fyn KO mice indicate that the negative regulatory mechanism mediated by IFN-gammaR and fyn may differ.

  7. Tyrosine kinase FYN negatively regulates NOX4 in cardiac remodeling

    PubMed Central

    Matsushima, Shouji; Kuroda, Junya; Zhai, Peiyong; Liu, Tong; Ikeda, Shohei; Nagarajan, Narayani; Yokota, Takashi; Kinugawa, Shintaro; Hsu, Chiao-Po; Li, Hong; Tsutsui, Hiroyuki

    2016-01-01

    NADPH oxidases (Noxes) produce ROS that regulate cell growth and death. NOX4 expression in cardiomyocytes (CMs) plays an important role in cardiac remodeling and injury, but the posttranslational mechanisms that modulate this enzyme are poorly understood. Here, we determined that FYN, a Src family tyrosine kinase, interacts with the C-terminal domain of NOX4. FYN and NOX4 colocalized in perinuclear mitochondria, ER, and nuclear fractions in CMs, and FYN expression negatively regulated NOX4-induced O2– production and apoptosis in CMs. Mechanistically, we found that direct phosphorylation of tyrosine 566 on NOX4 was critical for this FYN-mediated negative regulation. Transverse aortic constriction activated FYN in the left ventricle (LV), and FYN-deficient mice displayed exacerbated cardiac hypertrophy and dysfunction and increased ROS production and apoptosis. Deletion of Nox4 rescued the exaggerated LV remodeling in FYN-deficient mice. Furthermore, FYN expression was markedly decreased in failing human hearts, corroborating its role as a regulator of cardiac cell death and ROS production. In conclusion, FYN is activated by oxidative stress and serves as a negative feedback regulator of NOX4 in CMs during cardiac remodeling. PMID:27525436

  8. Fyn kinase mediates cortical actin ring depolymerization required for mast cell migration in response to TGF-β in mice.

    PubMed

    Ramírez-Valadez, Karla A; Vázquez-Victorio, Genaro; Macías-Silva, Marina; González-Espinosa, Claudia

    2017-08-01

    Transforming growth factor-β (TGF-β) is a potent mast cell (MC) chemoattractant able to modulate local inflammatory reactions. The molecular mechanism leading to TGF-β-directed MC migration is not fully described. Here we analyzed the role of the Src family protein kinase Fyn on the main TGF-β-induced cytoskeletal changes leading to MC migration. Utilizing bone marrow-derived mast cells (BMMCs) from WT and Fyn-deficient mice we found that BMMC migration to TGF-β was impaired in the absence of the kinase. TGF-β caused depolymerization of the cortical actin ring and changes on the phosphorylation of cofilin, LIMK and CAMKII only in WT cells. Defective cofilin activation and phosphorylation of regulatory proteins was detected in Fyn-deficient BMMCs and this finding correlated with a lower activity of the catalytic subunit of the phosphatase PP2A. Diminished TGF-β-induced chemotaxis of Fyn-deficient cells was also observed in an in vivo model of MC migration (bleomycin-induced scleroderma). Our results show that Fyn kinase is an important positive effector of TGF-β-induced chemotaxis through the control of PP2A activity and this is relevant to pathological processes that are related to TGF-β-dependent mast cell migration. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. The adaptor molecule signaling lymphocytic activation molecule (SLAM)-associated protein (SAP) is essential in mechanisms involving the Fyn tyrosine kinase for induction and progression of collagen-induced arthritis.

    PubMed

    Zhong, Ming-Chao; Veillette, André

    2013-11-01

    Signaling lymphocytic activation molecule-associated protein (SAP) is an Src homology 2 domain-only adaptor involved in multiple immune cell functions. It has also been linked to immunodeficiencies and autoimmune diseases, such as systemic lupus erythematosus. Here, we examined the role and mechanism of action of SAP in autoimmunity using a mouse model of autoimmune arthritis, collagen-induced arthritis (CIA). We found that SAP was essential for development of CIA in response to collagen immunization. It was also required for production of collagen-specific antibodies, which play a key role in disease pathogenesis. These effects required SAP expression in T cells, not in B cells. In mice immunized with a high dose of collagen, the activity of SAP was nearly independent of its ability to bind the protein tyrosine kinase Fyn and correlated with the capacity of SAP to promote full differentiation of follicular T helper (TFH) cells. However, with a lower dose of collagen, the role of SAP was more dependent on Fyn binding, suggesting that additional mechanisms other than TFH cell differentiation were involved. Further studies suggested that this might be due to a role of the SAP-Fyn interaction in natural killer T cell development through the ability of SAP-Fyn to promote Vav-1 activation. We also found that removal of SAP expression during progression of CIA attenuated disease severity. However, it had no effect on disease when CIA was clinically established. Together, these results indicate that SAP plays an essential role in CIA because of Fyn-independent and Fyn-dependent effects on TFH cells and, possibly, other T cell types.

  10. The Adaptor Molecule Signaling Lymphocytic Activation Molecule (SLAM)-associated Protein (SAP) Is Essential in Mechanisms Involving the Fyn Tyrosine Kinase for Induction and Progression of Collagen-induced Arthritis

    PubMed Central

    Zhong, Ming-Chao; Veillette, André

    2013-01-01

    Signaling lymphocytic activation molecule-associated protein (SAP) is an Src homology 2 domain-only adaptor involved in multiple immune cell functions. It has also been linked to immunodeficiencies and autoimmune diseases, such as systemic lupus erythematosus. Here, we examined the role and mechanism of action of SAP in autoimmunity using a mouse model of autoimmune arthritis, collagen-induced arthritis (CIA). We found that SAP was essential for development of CIA in response to collagen immunization. It was also required for production of collagen-specific antibodies, which play a key role in disease pathogenesis. These effects required SAP expression in T cells, not in B cells. In mice immunized with a high dose of collagen, the activity of SAP was nearly independent of its ability to bind the protein tyrosine kinase Fyn and correlated with the capacity of SAP to promote full differentiation of follicular T helper (TFH) cells. However, with a lower dose of collagen, the role of SAP was more dependent on Fyn binding, suggesting that additional mechanisms other than TFH cell differentiation were involved. Further studies suggested that this might be due to a role of the SAP-Fyn interaction in natural killer T cell development through the ability of SAP-Fyn to promote Vav-1 activation. We also found that removal of SAP expression during progression of CIA attenuated disease severity. However, it had no effect on disease when CIA was clinically established. Together, these results indicate that SAP plays an essential role in CIA because of Fyn-independent and Fyn-dependent effects on TFH cells and, possibly, other T cell types. PMID:24045941

  11. Fyn Kinase Regulates Microglial Neuroinflammatory Responses in Cell Culture and Animal Models of Parkinson's Disease.

    PubMed

    Panicker, Nikhil; Saminathan, Hariharan; Jin, Huajun; Neal, Matthew; Harischandra, Dilshan S; Gordon, Richard; Kanthasamy, Kavin; Lawana, Vivek; Sarkar, Souvarish; Luo, Jie; Anantharam, Vellareddy; Kanthasamy, Anumantha G; Kanthasamy, Arthi

    2015-07-08

    Sustained neuroinflammation mediated by resident microglia is recognized as a key pathophysiological contributor to many neurodegenerative diseases, including Parkinson's disease (PD), but the key molecular signaling events regulating persistent microglial activation have yet to be clearly defined. In the present study, we examined the role of Fyn, a non-receptor tyrosine kinase, in microglial activation and neuroinflammatory mechanisms in cell culture and animal models of PD. The well-characterized inflammogens LPS and TNFα rapidly activated Fyn kinase in microglia. Immunocytochemical studies revealed that activated Fyn preferentially localized to the microglial plasma membrane periphery and the nucleus. Furthermore, activated Fyn phosphorylated PKCδ at tyrosine residue 311, contributing to an inflammogen-induced increase in its kinase activity. Notably, the Fyn-PKCδ signaling axis further activated the LPS- and TNFα-induced MAP kinase phosphorylation and activation of the NFκB pathway, implying that Fyn is a major upstream regulator of proinflammatory signaling. Functional studies in microglia isolated from wild-type (Fyn(+/+)) and Fyn knock-out (Fyn(-/-)) mice revealed that Fyn is required for proinflammatory responses, including cytokine release as well as iNOS activation. Interestingly, a prolonged inflammatory insult induced Fyn transcript and protein expression, indicating that Fyn is upregulated during chronic inflammatory conditions. Importantly, in vivo studies using MPTP, LPS, or 6-OHDA models revealed a greater attenuation of neuroinflammatory responses in Fyn(-/-) and PKCδ (-/-) mice compared with wild-type mice. Collectively, our data demonstrate that Fyn is a major upstream signaling mediator of microglial neuroinflammatory processes in PD. Parkinson's disease (PD) is a complex multifactorial disease characterized by the progressive loss of midbrain dopamine neurons. Sustained microglia-mediated neuroinflammation has been recognized as a major

  12. Reduced Surface Expression of Epithelial E-Cadherin Evoked by Interferon-Gamma Is Fyn Kinase-Dependent

    PubMed Central

    Smyth, David; Leung, Gabriella; Fernando, Maria; McKay, Derek M.

    2012-01-01

    Interferon gamma (IFNγ) is an important regulatory cytokine that can exert a pro-inflammatory effect in the gut, where it has been shown to increase epithelial permeability via disruption of the tight junctions. Here we investigated the potential for IFNγ to regulate the adherens junction protein E-cadherin, an important mediator of normal epithelial tissue function, using the model T84 human colonic epithelial cell line. IFNγ (10 ng/ml) stimulated increased internalization of E-cadherin as assessed by immunofluorescence microscopy; internalization was reversed when cells were treated with PP1 (125 nM), a Src kinase-selective inhibitor. Immunoprecipitation studies demonstrated loss of E-cadherin from membrane fractions following IFNγ treatment and a corresponding increase in cytosolic E-cadherin and its binding partners, p120-catenin and beta-catenin: effects that were Src-kinase dependent. E-cadherin and p120-catenin phosphorylation was increased by IFNγ treatment and siRNA studies showed this was dependent upon the Src-kinase isoform Fyn. E-cadherin ubiquitinylation and subsequent proteasomal degradation stimulated by IFNγ was found to be dependent upon Fyn and the E-cadherin-selective ubiquitin ligase, Hakai. Use of Fyn and Hakai siRNA inhibited the internalization of E-cadherin as shown by immunoblotting and confocal fluorescence microscopy. Finally, IFNγ treatment resulted in a more fragile T84 cell monolayer with increased cell detachment in response to physical stress, which was prevented by PP1 and siRNA targeting Fyn or Hakai. Collectively, these results demonstrate a Fyn kinase-dependent mechanism through which IFNγ regulates E-cadherin stability and suggest a novel mechanism of disruption of epithelial cell contact, which could contribute to perturbed epithelial barrier function. PMID:22715382

  13. Chemically Diverse Toxicants Converge on Fyn and c-Cbl to Disrupt Precursor Cell Function

    PubMed Central

    Li, Zaibo; Dong, Tiefei; Pröschel, Chris; Noble, Mark

    2007-01-01

    Identification of common mechanistic principles that shed light on the action of the many chemically diverse toxicants to which we are exposed is of central importance in understanding how toxicants disrupt normal cellular function and in developing more effective means of protecting against such effects. Of particular importance is identifying mechanisms operative at environmentally relevant toxicant exposure levels. Chemically diverse toxicants exhibit striking convergence, at environmentally relevant exposure levels, on pathway-specific disruption of receptor tyrosine kinase (RTK) signaling required for cell division in central nervous system (CNS) progenitor cells. Relatively small toxicant-induced increases in oxidative status are associated with Fyn kinase activation, leading to secondary activation of the c-Cbl ubiquitin ligase. Fyn/c-Cbl pathway activation by these pro-oxidative changes causes specific reductions, in vitro and in vivo, in levels of the c-Cbl target platelet-derived growth factor receptor-α and other c-Cbl targets, but not of the TrkC RTK (which is not a c-Cbl target). Sequential Fyn and c-Cbl activation, with consequent pathway-specific suppression of RTK signaling, is induced by levels of methylmercury and lead that affect large segments of the population, as well as by paraquat, an organic herbicide. Our results identify a novel regulatory pathway of oxidant-mediated Fyn/c-Cbl activation as a shared mechanism of action of chemically diverse toxicants at environmentally relevant levels, and as a means by which increased oxidative status may disrupt mitogenic signaling. These results provide one of a small number of general mechanistic principles in toxicology, and the only such principle integrating toxicology, precursor cell biology, redox biology, and signaling pathway analysis in a predictive framework of broad potential relevance to the understanding of pro-oxidant–mediated disruption of normal development. PMID:17298174

  14. Fyn is a redox sensor involved in solar ultraviolet light-induced signal transduction in skin carcinogenesis.

    PubMed

    Kim, J-E; Roh, E; Lee, M H; Yu, D H; Kim, D J; Lim, T-G; Jung, S K; Peng, C; Cho, Y-Y; Dickinson, S; Alberts, D; Bowden, G T; Einspahr, J; Stratton, S P; Curiel-Lewandrowski, C; Bode, A M; Lee, K W; Dong, Z

    2016-08-04

    Solar ultraviolet (UV) light is a major etiological factor in skin carcinogenesis, with solar UV-stimulated signal transduction inducing pathological changes and skin damage. The primary sensor of solar UV-induced cellular signaling has not been identified. We use an experimental system of solar simulated light (SSL) to mimic solar UV and we demonstrate that Fyn is a primary redox sensor involved in SSL-induced signal transduction. Reactive oxygen species (ROS) generated by SSL exposure directly oxidize Cys488 of Fyn, resulting in increased Fyn kinase activity. Fyn oxidation was increased in mouse skin after SSL exposure and Fyn-knockout mice formed larger and more tumors compared with Fyn wild-type mice when exposed to SSL for an extended period of time. Murine embryonic fibroblasts (MEFs) lacking Fyn and cells in which Fyn expression was knocked down were resistant to SSL-induced apoptosis. Furthermore, cells expressing mutant Fyn (C448A) were resistant to SSL-induced apoptosis. These findings suggest that Fyn acts as a regulatory nexus between solar UV, ROS and signal transduction during skin carcinogenesis.

  15. Fyn in Neurodevelopment and Ischemic Brain Injury

    PubMed Central

    Knox, Renatta; Jiang, Xiangning

    2016-01-01

    The Src Family kinases (SFKs) are nonreceptor protein tyrosine kinases that are implicated in many normal and pathological processes in the nervous system. The SFKs Fyn, Src, Yes, Lyn and Lck are expressed in the brain. This review will focus on Fyn, as Fyn mutant mice have striking phenotypes in the brain and Fyn has been shown to be involved in ischemic brain injury in adult rodents, and with our work, in neonatal animals. An understanding of Fyn’s role in neurodevelopment and disease will allow researchers to target pathological pathways while preserving protective ones. PMID:25720756

  16. Regulatory Mechanisms of Hsp90

    PubMed Central

    Prodromou, Chrisostomos

    2017-01-01

    The ability of Hsp90 to activate a disparate clientele implicates this chaperone in diverse biological processes. To accommodate such varied roles, Hsp90 requires a variety of regulatory mechanisms that are coordinated in order to modulate its activity appropriately. Amongst these, the master-regulator heat shock factor 1 (HSF1) is critically important in upregulating Hsp90 during stress, but is also responsible, through interaction with specific transcription factors (such as STAT1 and Strap/p300) for the integration of a variety of biological signals that ultimately modulate Hsp90 expression. Additionally, transcription factors, such as STAT1, STAT3 (including STAT1-STAT3 oligomers), NF-IL6, and NF-kB, are known to influence Hsp90 expression directly. Co-chaperones offer another mechanism for Hsp90 regulation, and these can modulate the chaperone cycle appropriately for specific clientele. Co-chaperones include those that deliver specific clients to Hsp90, and others that regulate the chaperone cycle for specific Hsp90-client complexes by modulating Hsp90s ATPase activity. Finally, post-translational modification (PTM) of Hsp90 and its co-chaperones helps too further regulate the variety of different Hsp90 complexes found in cells. PMID:28289734

  17. IA channels: diverse regulatory mechanisms.

    PubMed

    Carrasquillo, Yarimar; Nerbonne, Jeanne M

    2014-04-01

    In many peripheral and central neurons, A-type K(+) currents, IA, have been identified and shown to be key determinants in shaping action potential waveforms and repetitive firing properties, as well as in the regulation of synaptic transmission and synaptic plasticity. The functional properties and physiological roles of native neuronal IA, however, have been shown to be quite diverse in different types of neurons. Accumulating evidence suggests that this functional diversity is generated by multiple mechanisms, including the expression and subcellular distributions of IA channels encoded by different voltage-gated K(+) (Kv) channel pore-forming (α) subunits, interactions of Kv α subunits with cytosolic and/or transmembrane accessory subunits and regulatory proteins and post-translational modifications of channel subunits. Several recent reports further suggest that local protein translation in the dendrites of neurons and interactions between IA channels with other types of voltage-gated ion channels further expands the functional diversity of native neuronal IA channels. Here, we review the diverse molecular mechanisms that have been shown or proposed to underlie the functional diversity of native neuronal IA channels.

  18. Activation of Src, Fyn and Yes non-receptor tyrosine kinases in keratinocytes expressing human papillomavirus (HPV) type 16 E7 oncoprotein.

    PubMed

    Szalmás, Anita; Gyöngyösi, Eszter; Ferenczi, Annamária; László, Brigitta; Karosi, Tamás; Csomor, Péter; Gergely, Lajos; Veress, György; Kónya, József

    2013-03-07

    The Src family tyrosine kinases (SFK) are cellular regulatory proteins that influence cell adhesion, proliferation, invasion and survival during tumor development. Elevated activity of Src was associated with increased cell proliferation and invasivity in human papillomavirus (HPV)-associated malignancies; therefore, transduced human foreskin keratinocytes (HFK) were used to investigate whether SFK activation is a downstream effect of papillomaviral oncoproteins. Activation of ubiquitously expressed SFKs, namely Src, Yes and Fyn, was investigated in both proliferating and differentiating keratinocytes. In proliferating keratinocytes, Src, Yes and Fyn mRNA levels were not affected by HPV 16 E6 or E7 oncoproteins, while at the protein level as detected by western blot, the presence of both E6 and E7 resulted in substantial increase in Src and Yes expression, but did not alter the high constitutive level of Fyn. Phospo-kinase array revealed that all ubiquitously expressed SFKs are activated by phosphorylation in the presence of HPV 16 E7 oncoprotein. Keratinocyte differentiation led to increased Yes mRNA and protein levels in all transduced cell lines, while it did not influence the Src transcription but resulted in elevated Src protein level in HPV16 E7 expressing lines. This study revealed that HPV 16 oncoproteins upregulate Src family kinases Src and Yes via posttranscriptional mechanisms. A further effect of HPV 16 E7 oncoprotein is to enhance the activating phosphorylation of SFKs expressed in keratinocytes.

  19. The Src family kinases: distinct functions of c-Src, Yes, and Fyn in the liver.

    PubMed

    Reinehr, Roland; Sommerfeld, Annika; Häussinger, Dieter

    2013-04-01

    The Src family kinases Yes, Fyn, and c-Src play a pivotal role in regulating diverse liver functions such as bile flow, proteolysis, apoptosis, and proliferation and are regulated by anisoosmotic cell volume changes, death receptor ligands, and bile acids. For example, cell swelling leads to an integrin-sensed and focal adhesion kinase-mediated activation of c-Src-triggering choleresis, proteolysis inhibition, regulatory volume decrease via p38MAPK and proliferation via the activation of the epidermal growth factor receptor and extracellular regulated kinases 1 and 2. In contrast, hepatocyte shrinkage generates an almost instantaneous oxidative stress response that triggers the activation of c-Jun N-terminal kinase and the Src family kinases Fyn and Yes. Whereas Fyn activation mediates cholestasis, Yes triggers CD95 activation and apoptosis. This review will discuss the role of Src family kinases in the regulation of liver function with emphasis on their role in osmo-signaling and bile acid signaling.

  20. Modulation of FcεRI-dependent mast cell response by OX40L via Fyn, PI3K, and RhoA.

    PubMed

    Sibilano, Riccardo; Frossi, Barbara; Suzuki, Ryo; D'Incà, Federica; Gri, Giorgia; Piconese, Silvia; Colombo, Mario P; Rivera, Juan; Pucillo, Carlo E

    2012-09-01

    The interaction of mast cells (MCs) with regulatory T cells through the OX40 ligand (OX40L):OX40 axis downregulates FcεRI-dependent immediate hypersensitivity responses both in vitro and in vivo. Little is known on OX40L-mediated intracellular signaling or on the mechanism by which OX40L engagement suppresses MC degranulation. We explored the role of OX40L engagement on IgE/antigen-triggered MCs both in vitro and in vivo. The soluble form of OX40 molecule was used to selectively trigger OX40L on MCs in vitro and was used to dissect OX40L contribution in an in vivo model of systemic anaphylaxis. OX40L:OX40 interaction led to the recruitment of C-terminal src kinase into lipid rafts, causing a preferential suppression of Fyn kinase activity and subsequent reduction in the phosphorylation of Gab2, the phosphatidylinositol 3-OH kinase regulatory subunit p85, and Akt, without affecting the Lyn pathway. Dampening of Fyn kinase activity also inhibited RhoA activation and microtubule nucleation, key regulators of MC degranulation. The in vivo administration of a blocking antibody to OX40L in wild-type mice caused enhanced immediate hypersensitivity, whereas the administration of soluble OX40 to regulatory T-cell-depleted or OX40-deficient mice reduced MC degranulation. The engagement of OX40L selectively suppresses Fyn-initiated signals required for MC degranulation and serves to limit immediate hypersensitivity. Our data suggest that soluble OX40 can restore the aberrant or absent regulatory T-cell activity, revealing a previously unappreciated homeostatic role for OX40L in setting the basal threshold of MC response. Copyright © 2012 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights reserved.

  1. Neuroprotective Effects of Inhibiting Fyn S-Nitrosylation on Cerebral Ischemia/Reperfusion-Induced Damage to CA1 Hippocampal Neurons

    PubMed Central

    Hao, Lingyun; Wei, Xuewen; Guo, Peng; Zhang, Guangyi; Qi, Suhua

    2016-01-01

    Nitric oxide (NO) can regulate signaling pathways via S-nitrosylation. Fyn can be post-translationally modified in many biological processes. In the present study, using a rat four-vessel-occlusion ischemic model, we aimed to assess whether Fyn could be S-nitrosylated and to evaluate the effects of Fyn S-nitrosylation on brain damage. In vitro, Fyn could be S-nitrosylated by S-nitrosoglutathione (GSNO, an exogenous NO donor), and in vivo, endogenous NO synthesized by NO synthases (NOS) could enhance Fyn S-nitrosylation. Application of GSNO, 7-nitroindazole (7-NI, an inhibitor of neuronal NOS) and hydrogen maleate (MK-801, the N-methyl-d-aspartate receptor (NMDAR) antagonist) could decrease the S-nitrosylation and phosphorylation of Fyn induced by cerebral ischemia/reperfusion (I/R). Cresyl violet staining validated that these compounds exerted neuroprotective effects against the cerebral I/R-induced damage to hippocampal CA1 neurons. Taken together, in this study, we demonstrated that Fyn can be S-nitrosylated both in vitro and in vivo and that inhibiting S-nitrosylation can exert neuroprotective effects against cerebral I/R injury, potentially via NMDAR-mediated mechanisms. These findings may lead to a new field of inquiry to investigate the underlying pathogenesis of stroke and the development of novel treatment strategies. PMID:27420046

  2. Neuroprotective Effects of Inhibiting Fyn S-Nitrosylation on Cerebral Ischemia/Reperfusion-Induced Damage to CA1 Hippocampal Neurons.

    PubMed

    Hao, Lingyun; Wei, Xuewen; Guo, Peng; Zhang, Guangyi; Qi, Suhua

    2016-07-12

    Nitric oxide (NO) can regulate signaling pathways via S-nitrosylation. Fyn can be post-translationally modified in many biological processes. In the present study, using a rat four-vessel-occlusion ischemic model, we aimed to assess whether Fyn could be S-nitrosylated and to evaluate the effects of Fyn S-nitrosylation on brain damage. In vitro, Fyn could be S-nitrosylated by S-nitrosoglutathione (GSNO, an exogenous NO donor), and in vivo, endogenous NO synthesized by NO synthases (NOS) could enhance Fyn S-nitrosylation. Application of GSNO, 7-nitroindazole (7-NI, an inhibitor of neuronal NOS) and hydrogen maleate (MK-801, the N-methyl-d-aspartate receptor (NMDAR) antagonist) could decrease the S-nitrosylation and phosphorylation of Fyn induced by cerebral ischemia/reperfusion (I/R). Cresyl violet staining validated that these compounds exerted neuroprotective effects against the cerebral I/R-induced damage to hippocampal CA1 neurons. Taken together, in this study, we demonstrated that Fyn can be S-nitrosylated both in vitro and in vivo and that inhibiting S-nitrosylation can exert neuroprotective effects against cerebral I/R injury, potentially via NMDAR-mediated mechanisms. These findings may lead to a new field of inquiry to investigate the underlying pathogenesis of stroke and the development of novel treatment strategies.

  3. Fyn kinase controls Fc{epsilon}RI receptor-operated calcium entry necessary for full degranulation in mast cells

    SciTech Connect

    Sanchez-Miranda, Elizabeth; Ibarra-Sanchez, Alfredo; Gonzalez-Espinosa, Claudia

    2010-01-22

    IgE-antigen-dependent crosslinking of the high affinity IgE receptor (Fc{epsilon}RI) on mast cells leads to degranulation, leukotriene synthesis and cytokine production. Calcium (Ca{sup 2+}) mobilization is a sine qua non requisite for degranulation, allowing the rapid secretion of stored pro-inflammatory mediators responsible for allergy symptoms. Fyn is a Src-family kinase that positively controls Fc{epsilon}RI-induced mast cell degranulation. However, our understanding of the mechanism connecting Fyn activation to secretion of pre-synthesized mediators is very limited. We analyzed Fc{epsilon}RI-dependent Ca{sup 2+} mobilization in bone marrow-derived mast cells (BMMCs) differentiated from WT and Fyn -/- knock out mice. Fyn -/- BMMCs showed a marked defect in extracellular Ca{sup 2+} influx after Fc{epsilon}RI crosslinking but not after thapsigargin addition. High concentrations of Gadolinium (Gd{sup 3+}) partially blocked Fc{epsilon}RI-induced Ca{sup 2+} influx in WT cells but, in contrast, completely inhibited Ca{sup 2+} mobilization in Fyn -/- cells. Low concentrations of an inhibitor of the canonical transient receptor potential (TRPC) Ca{sup 2+} channels (2-aminoethoxyphenyl-borane, 2-APB) blocked Fc{epsilon}RI-induced maximal Ca{sup 2+} rise in WT but not in Fyn -/- cells. Ca{sup 2+} entry through Fyn-controlled, 2-APB sensitive channels was found to be important for full degranulation and IL-2 mRNA accumulation in WT cells. Immunoprecipitation assays showed that Fyn kinase interacts with TRPC 3/6/7 channels after IgE-antigen stimulation, but its association is not related to protein tyrosine phosphorylation. Results indicate Fyn kinase mediates the receptor-dependent activation of TRPC channels that contribute to degranulation in Fc{epsilon}RI-stimulated mast cells.

  4. Src-homology 3 domain of protein kinase p59fyn mediates binding to phosphatidylinositol 3-kinase in T cells.

    PubMed Central

    Prasad, K V; Janssen, O; Kapeller, R; Raab, M; Cantley, L C; Rudd, C E

    1993-01-01

    The Src-related tyrosine kinase p59fyn(T) plays an important role in the generation of intracellular signals from the T-cell antigen receptor TCR zeta/CD3 complex. A key question concerns the nature and the binding sites of downstream components that interact with this Src-related kinase. p59fyn(T) contains Src-homology 2 and 3 domains (SH2 and SH3) with a capacity to bind to intracellular proteins. One potential downstream target is phosphatidylinositol 3-kinase (PI 3-kinase). In this study, we demonstrate that anti-CD3 and anti-Fyn immunoprecipitates possess PI 3-kinase activity as assessed by TLC and HPLC. Both free and receptor-bound p59fyn(T) were found to bind to the lipid kinase. Further, our results indicate that Src-related kinases have developed a novel mechanism to interact with PI 3-kinase. Precipitation using GST fusion proteins containing Fyn SH2, SH3, and SH2/SH3 domains revealed that PI 3-kinase bound principally to the SH3 domain of Fyn. Fyn SH3 bound directly to the p85 subunit of PI 3-kinase as expressed in a baculoviral system. Anti-CD3 crosslinking induced an increase in the detection of Fyn SH3-associated PI 3-kinase activity. Thus PI 3-kinase is a target of SH3 domains and is likely to play a major role in the signals derived from the TCR zeta/CD3-p59fyn complex. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:8394019

  5. Vascular Smooth Muscle Cell Motility Is Mediated by a Physical and Functional Interaction of Ca2+/Calmodulin-dependent Protein Kinase IIδ2 and Fyn*

    PubMed Central

    Ginnan, Roman; Zou, Xiaojing; Pfleiderer, Paul J.; Mercure, Melissa Z.; Barroso, Margarida; Singer, Harold A.

    2013-01-01

    In vascular smooth muscle (VSM) cells, Ca2+/calmodulin-dependent protein kinase IIδ2 (CaMKIIδ2) activates non-receptor tyrosine kinases and EGF receptor, with a Src family kinase as a required intermediate. siRNA-mediated suppression of Fyn, a Src family kinase, inhibited VSM cell motility. Simultaneous suppression of both Fyn and CaMKIIδ2 was non-additive, suggesting coordinated regulation of cell motility. Confocal immunofluorescence microscopy indicated that CaMKIIδ2 and Fyn selectively (compared with Src) co-localized with the Golgi in quiescent cultured VSM cells. Stimulation with PDGF resulted in a rapid (<5 min) partial redistribution and co-localization of both kinases in peripheral membrane regions. Furthermore, CaMKIIδ2 and Fyn selectively (compared with Src) co-immunoprecipitated, suggesting a physical interaction in a signaling complex. Stimulation of VSM cells with ionomycin, a calcium ionophore, resulted in activation of CaMKIIδ2 and Fyn and disruption of the complex. Pretreatment with KN-93, a pharmacological inhibitor of CaMKII, prevented activation-dependent disruption of CaMKIIδ2 and Fyn, implicating CaMKIIδ2 as an upstream mediator of Fyn. Overexpression of constitutively active CaMKII resulted in the dephosphorylation of Fyn at Tyr-527, which is required for Fyn activation. Taken together, these data demonstrate a dynamic interaction between CaMKIIδ2 and Fyn in VSM cells and indicate a mechanism by which CaMKIIδ2 and Fyn may coordinately regulate VSM cell motility. PMID:24003228

  6. Vascular smooth muscle cell motility is mediated by a physical and functional interaction of Ca2+/calmodulin-dependent protein kinase IIδ2 and Fyn.

    PubMed

    Ginnan, Roman; Zou, Xiaojing; Pfleiderer, Paul J; Mercure, Melissa Z; Barroso, Margarida; Singer, Harold A

    2013-10-11

    In vascular smooth muscle (VSM) cells, Ca(2+)/calmodulin-dependent protein kinase IIδ2 (CaMKIIδ2) activates non-receptor tyrosine kinases and EGF receptor, with a Src family kinase as a required intermediate. siRNA-mediated suppression of Fyn, a Src family kinase, inhibited VSM cell motility. Simultaneous suppression of both Fyn and CaMKIIδ2 was non-additive, suggesting coordinated regulation of cell motility. Confocal immunofluorescence microscopy indicated that CaMKIIδ2 and Fyn selectively (compared with Src) co-localized with the Golgi in quiescent cultured VSM cells. Stimulation with PDGF resulted in a rapid (<5 min) partial redistribution and co-localization of both kinases in peripheral membrane regions. Furthermore, CaMKIIδ2 and Fyn selectively (compared with Src) co-immunoprecipitated, suggesting a physical interaction in a signaling complex. Stimulation of VSM cells with ionomycin, a calcium ionophore, resulted in activation of CaMKIIδ2 and Fyn and disruption of the complex. Pretreatment with KN-93, a pharmacological inhibitor of CaMKII, prevented activation-dependent disruption of CaMKIIδ2 and Fyn, implicating CaMKIIδ2 as an upstream mediator of Fyn. Overexpression of constitutively active CaMKII resulted in the dephosphorylation of Fyn at Tyr-527, which is required for Fyn activation. Taken together, these data demonstrate a dynamic interaction between CaMKIIδ2 and Fyn in VSM cells and indicate a mechanism by which CaMKIIδ2 and Fyn may coordinately regulate VSM cell motility.

  7. Fyn polymorphisms are associated with distinct personality traits in healthy Chinese-Han subjects.

    PubMed

    Li, Jingying; Ma, Huan; Deng, Shumin; Wu, Lijuan; Huang, Yinglin; Zhu, Gang

    2011-05-01

    The Src family tyrosine kinase Fyn regulates a myriad of neurophysiological processes, including learning and memory. To date, the role of Fyn in the neurological mechanisms that determine personality traits has not been addressed. To this end, we determined the association between the rs706895C/T polymorphism of the Fyn gene (FYN) and personality traits measured by the Tridimensional Personality Questionnaire in 502 healthy Chinese-Han subjects. There were no significant differences in the total scores for novelty seeking (χ² = 5.12, P = 0.077), harm avoidance (HA; χ² = 2.63, P = 0.269), or reward dependence (RD; χ² = 3.94, P = 0.139) among the rs706895C/T genotypes. In sub-item analyses, however, both fear of uncertainty (HA2; χ² = 7.84, P = 0.020) and sentimentality (RD1; χ² = 8.27; P = 0.016) scores were significantly different among rs706895C/T genotypes. Our results suggest that FYN alleles can contribute to the variance in human personality traits.

  8. Advances in Autophagy Regulatory Mechanisms

    PubMed Central

    Gallagher, Laura E.; Williamson, Leon E.; Chan, Edmond Y. W.

    2016-01-01

    Autophagy plays a critical role in cell metabolism by degrading and recycling internal components when challenged with limited nutrients. This fundamental and conserved mechanism is based on a membrane trafficking pathway in which nascent autophagosomes engulf cytoplasmic cargo to form vesicles that transport their content to the lysosome for degradation. Based on this simple scheme, autophagy modulates cellular metabolism and cytoplasmic quality control to influence an unexpectedly wide range of normal mammalian physiology and pathophysiology. In this review, we summarise recent advancements in three broad areas of autophagy regulation. We discuss current models on how autophagosomes are initiated from endogenous membranes. We detail how the uncoordinated 51-like kinase (ULK) complex becomes activated downstream of mechanistic target of rapamycin complex 1 (MTORC1). Finally, we summarise the upstream signalling mechanisms that can sense amino acid availability leading to activation of MTORC1. PMID:27187479

  9. Regulatory mechanisms for floral homeotic gene expression.

    PubMed

    Liu, Zhongchi; Mara, Chloe

    2010-02-01

    Proper regulation of floral homeotic gene (or ABCE gene) expression ensures the development of floral organs in the correct number, type, and precise spatial arrangement. This review summarizes recent advances on the regulation of floral homeotic genes, highlighting the variety and the complexity of the regulatory mechanisms involved. As flower development is one of the most well characterized developmental processes in higher plants, it facilitates the discovery of novel regulatory mechanisms. To date, mechanisms for the regulation of floral homeotic genes range from transcription to post-transcription, from activators to repressors, and from microRNA- to ubiquitin-mediated post-transcriptional regulation. Region-specific activation of floral homeotic genes is dependent on the integration of a flower-specific activity provided by LEAFY (LFY) and a region- and stage-specific activating function provided by one of the LFY cofactors. Two types of regulatory loops, the feed-forward and the feedback loop, provide properly timed gene activation and subsequent maintenance and refinement in proper spatial and temporal domains of ABCE genes. Two different microRNA/target modules may have been independently recruited in different plant species to regulate C gene expression. Additionally, competition among different MADS box proteins for common interacting partners may represent a mechanism in whorl boundary demarcation. Future work using systems approaches and the development of non-model plants will provide integrated views on floral homeotic gene regulation and insights into the evolution of morphological diversity in flowering plants. Copyright 2009 Elsevier Ltd. All rights reserved.

  10. Fyn: A Key Regulator of Metastasis in Prostate Cancer

    DTIC Science & Technology

    2013-06-01

    cortactin. These proteins are involved in cytoskeletal organization and cellular motility- consistent with our observed phenotype. As we had noted in...a substrate of Fyn). Figure 1. A) Fyn protein expression B) Growth and C&D) matrigel invasion assays of PC3/NT and PC3/FYN- and PC3/EV and...use of the human nature of the tumor cells and expression of human proteins on the cell surface. The blood from our mice was subjected to CTC

  11. Major regulatory mechanisms involved in sperm motility.

    PubMed

    Pereira, Rute; Sá, Rosália; Barros, Alberto; Sousa, Mário

    2017-01-01

    The genetic bases and molecular mechanisms involved in the assembly and function of the flagellum components as well as in the regulation of the flagellar movement are not fully understood, especially in humans. There are several causes for sperm immotility, of which some can be avoided and corrected, whereas other are related to genetic defects and deserve full investigation to give a diagnosis to patients. This review was performed after an extensive literature search on the online databases PubMed, ScienceDirect, and Web of Science. Here, we review the involvement of regulatory pathways responsible for sperm motility, indicating possible causes for sperm immotility. These included the calcium pathway, the cAMP-dependent protein kinase pathway, the importance of kinases and phosphatases, the function of reactive oxygen species, and how the regulation of cell volume and osmolarity are also fundamental components. We then discuss main gene defects associated with specific morphological abnormalities. Finally, we slightly discuss some preventive and treatments approaches to avoid development of conditions that are associated with unspecified sperm immotility. We believe that in the near future, with the development of more powerful techniques, the genetic causes of sperm immotility and the regulatory mechanisms of sperm motility will be better understand, thus enabling to perform a full diagnosis and uncover new therapies.

  12. Major regulatory mechanisms involved in sperm motility

    PubMed Central

    Pereira, Rute; Sá, Rosália; Barros, Alberto; Sousa, Mário

    2017-01-01

    The genetic bases and molecular mechanisms involved in the assembly and function of the flagellum components as well as in the regulation of the flagellar movement are not fully understood, especially in humans. There are several causes for sperm immotility, of which some can be avoided and corrected, whereas other are related to genetic defects and deserve full investigation to give a diagnosis to patients. This review was performed after an extensive literature search on the online databases PubMed, ScienceDirect, and Web of Science. Here, we review the involvement of regulatory pathways responsible for sperm motility, indicating possible causes for sperm immotility. These included the calcium pathway, the cAMP-dependent protein kinase pathway, the importance of kinases and phosphatases, the function of reactive oxygen species, and how the regulation of cell volume and osmolarity are also fundamental components. We then discuss main gene defects associated with specific morphological abnormalities. Finally, we slightly discuss some preventive and treatments approaches to avoid development of conditions that are associated with unspecified sperm immotility. We believe that in the near future, with the development of more powerful techniques, the genetic causes of sperm immotility and the regulatory mechanisms of sperm motility will be better understand, thus enabling to perform a full diagnosis and uncover new therapies. PMID:26680031

  13. Mechanisms of T regulatory cell function.

    PubMed

    Askenasy, Nadir; Kaminitz, Ayelet; Yarkoni, Shai

    2008-05-01

    Regulatory T cells (Treg) play a pivotal role in tolerance to self-antigens and tissue grafts, and suppression of autoimmune reactions. These cells modulate the intensity and quality of immune reactions through attenuation of the cytolytic activities of reactive immune cells. Treg cells operate primarily at the site of inflammation where they modulate the immune reaction through three major mechanisms: a) direct killing of cytotoxic cells through cell-to-cell contact, b) inhibition of cytokine production by cytotoxic cells, in particular interleukin-2, c) direct secretion of immunomodulatory cytokines, in particular TGF-beta and interleukin-10. In addition to differential contributions of these mechanisms under variable inflammatory conditions, mechanistic complexity and diversity evolves from the diverse tasks performed by various Treg cell subsets in different stages of the immune reaction. Here we attempt to integrate the current experimental evidence to delineate the major suppressive pathways of Treg cells.

  14. Fyn requires HnRNPA2B1 and Sam68 to synergistically regulate apoptosis in pancreatic cancer.

    PubMed

    Chen, Zhi-Yu; Cai, Lei; Zhu, Jin; Chen, Min; Chen, Jian; Li, Zhi-Hua; Liu, Xiang-De; Wang, Shu-Guang; Bie, Ping; Jiang, Peng; Dong, Jia-Hong; Li, Xiao-Wu

    2011-10-01

    The Src family kinase Fyn, heterogenous nuclear ribonucleoprotein (HnRNP) A2B1 and Sam68 are thought to be associated with the metastasis of tumors, but their roles in the regulation of apoptosis remain unclear. This study investigated the role of Fyn and its potential relationship with HnRNPA2B1 and Sam68 in the regulation of apoptosis in pancreatic cancer. Experimental design. We examined both the activity of Fyn and the expression of HnRNPA2B1 in human pancreatic cancer tissues and systematically investigated the apoptotic mechanisms induced by Fyn activity using multiple experimental approaches. We found that Fyn activity was increased in metastatic pancreatic cancer tissues. In the pancreatic cancer BxPc3 cell line, the inhibition of Fyn activity by kinase-dead Fyn downregulated HnRNPA2B1 expression. Further analysis showed that HnRNPA2B1 expression was associated with pancreatic cancer progression. In BxPc3 cells, HnRNPA2B1 bound to Bcl-x messenger RNA (mRNA), which affected splicing and therefore, the formation of Bcl-x(s). Downregulation of HnRNPA2B1 by RNA interference (RNAi) resulted in the increased formation of the pro-apoptotic Bcl-x(s) and promoted apoptosis of BxPc3 cells. In addition, deactivation of Fyn in BxPc3 cells reduced Sam68 phosphorylation. This resulted in increased binding between Sam68 and Bcl-x mRNA, promoting the formation of the anti-apoptotic Bcl-x(L). The knockdown of Sam68 by RNAi also increased the formation of Bcl-x(L). Finally, HnRNPA2B1 overexpression or Sam68 knockdown could rescue pancreatic cancer cells from apoptosis. Our results suggest a mechanism by which Fyn requires HnRNPA2B1 and Sam68 to coordinate and regulate apoptosis, thus promoting the proliferation and metastasis of pancreatic cancer.

  15. Fyn mediates transforming growth factor-beta1-induced down-regulation of E-cadherin in human A549 lung cancer cells.

    PubMed

    Kim, An Na; Jeon, Woo-Kwang; Lim, Kyu-Hyoung; Lee, Hui-Young; Kim, Woo Jin; Kim, Byung-Chul

    2011-04-01

    Transforming growth factor-beta (TGF-β) signaling positively contributes to the regulation of tumor metastasis. However, the underlying molecular mechanisms are less well defined. We here show that Fyn, a member of Src family tyrosine kinases, plays a critical role in mediating TGF-β1-induced down-regulation of E-cadherin in human A549 lung cancer cells. Blockade of Fyn with siRNA knockdown or ligand-binding defective mutant significantly lowered the ability of TGF-β1 to repress E-cadherin expression. Furthermore, our results demonstrated that Fyn facilitates TGF-β1-mediated suppression of E-cadherin through p38 kinase-dependent induction of Snail. Collectively, our findings identify a Fyn-p38-Snail cascade as a new signaling pathway mediating oncogenic TGF-β function.

  16. Multiphoton imaging of renal regulatory mechanisms.

    PubMed

    Peti-Peterdi, János; Toma, Ildikó; Sipos, Arnold; Vargas, Sarah L

    2009-04-01

    Most physiological functions of the kidneys, including the clearance of metabolic waste products, maintenance of body fluid, electrolyte homeostasis, and blood pressure, are achieved by complex interactions between multiple renal cell types and previously inaccessible structures in many organ parts that have been difficult to study. Multiphoton fluorescence microscopy offers a state-of-the-art imaging technique for deep optical sectioning of living tissues and organs with minimal deleterious effects. Dynamic regulatory processes and multiple functions in the intact kidney can be quantitatively visualized in real time, noninvasively, and with submicron resolution. This article reviews innovative multiphoton imaging technologies and their applications that provided the most complex, immediate, and dynamic portrayal of renal function-clearly depicting as well as analyzing the components and mechanisms involved in renal (patho)physiology.

  17. Regulatory mechanisms underlying C4 photosynthesis.

    PubMed

    Wang, Lin; Peterson, Richard B; Brutnell, Thomas P

    2011-04-01

    C4 photosynthesis is an adaptation that evolved to alleviate the detrimental effects of photorespiration as a result of the gradual decline in atmospheric carbon dioxide levels. In most C4 plants, two cell types, bundle sheath and mesophyll, cooperate in carbon fixation, and, in so doing, are able to alleviate photorespiratory losses. Although much of the biochemistry is well characterized, little is known about the genetic mechanisms underlying the cell-type specificity driving C4 . However, several studies have shown that regulation acts at multiple levels, including transcriptional, post-transcriptional, post-translational and epigenetic. One example of such a regulatory mechanism is the cell-specific accumulation of major photorespiratory transcripts/proteins in bundle sheath cells, where ribulose-1,5-bisphosphate carboxylase/oxygenase is localized. Although many of the genes are expressed in the bundle sheath, some are expressed in both cell types, implicating post-transcriptional control mechanisms. Recently, ultra-high-throughput sequencing techniques and sophisticated mass spectrometry instrumentation have provided new opportunities to further our understanding of C4 regulation. Computational pipelines are being developed to accommodate the mass of data associated with these techniques. Finally, we discuss a readily transformable C4 grass--Setaria viridis--that has great potential to serve as a model for the genetic dissection of C4 photosynthesis in the grasses. © 2011 The Authors. New Phytologist © 2011 New Phytologist Trust.

  18. Targeting Fyn in Ras-transformed cells induces F-actin to promote adherens junction-mediated cell-cell adhesion.

    PubMed

    Fenton, Sarah E; Hutchens, Kelli A; Denning, Mitchell F

    2015-10-01

    Fyn, a member of the Src family kinases (SFK), is an oncogene in murine epidermis and is associated with cell-cell adhesion turnover and induction of cell migration. Additionally, Fyn upregulation has been reported in multiple tumor types, including cutaneous squamous cell carcinoma (cSCC). Introduction of active H-Ras(G12V) into the HaCaT human keratinocyte cell line resulted in upregulation of Fyn mRNA (200-fold) and protein, while expression of other SFKs remained unaltered. Transduction of active Ras or Fyn was sufficient to induce an epithelial-to-mesenchymal transition in HaCaT cells. Inhibition of Fyn activity, using siRNA or the clinical SFK inhibitor Dasatinib, increased cell-cell adhesion and rapidly (5-60 min) increased levels of cortical F-actin. Fyn inhibition with siRNA or Dasatinib also induced F-actin in MDA-MB-231 breast cancer cells, which have elevated Fyn. F-actin co-localized with adherens junction proteins, and Dasatinib-induced cell-cell adhesion could be blocked by Cytochalasin D, indicating that F-actin polymerization was a key initiator of cell-cell adhesion through the adherens junction. Conversely, inhibiting cell-cell adhesion with low Ca(2+) media did not block Dasatinib-induced F-actin polymerization. Inhibition of the Rho effector kinase ROCK blocked Dasatinib-induced F-actin and cell-cell adhesion, implicating relief of Rho GTPase inhibition as a mechanism of Dasatinib-induced cell-cell adhesion. Finally, topical Dasatinib treatment significantly reduced total tumor burden in the SKH1 mouse model of UV-induced skin carcinogenesis. Together these results identify the promotion of actin-based cell-cell adhesion as a newly described mechanism of action for Dasatinib and suggest that Fyn inhibition may be an effective therapeutic approach in treating cSCC.

  19. Dopamine D2 receptors are involved in the regulation of Fyn and metabotropic glutamate receptor 5 phosphorylation in the rat striatum in vivo.

    PubMed

    Mao, Li-Min; Wang, John Q

    2016-04-01

    Fyn, a major Src family kinase (SFK) member that is densely expressed in striatal neurons, is actively involved in the regulation of cellular and synaptic activities in local neurons. This SFK member is likely regulated by dopamine signaling through a receptor mechanism involving dopamine D2 receptors (D2Rs). This study characterizes the D2R-dependent regulation of Fyn in the rat striatum in vivo. Moreover, we explore whether D2Rs regulate metabotropic glutamate receptor 5 (mGluR5) in its tyrosine phosphorylation and whether the D2R-SFK pathway modulates trafficking of mGluR5. We found that blockade of D2Rs by systemic administration of a D2R antagonist, eticlopride, substantially increased SFK phosphorylation in the striatum. This increase was a transient and reversible event. The eticlopride-induced SFK phosphorylation occurred predominantly in immunopurified Fyn but not in another SFK member, Src. Eticlopride also elevated tyrosine phosphorylation of mGluR5. In parallel, eticlopride enhanced synaptic delivery of active Fyn and mGluR5. Pretreatment with an SFK inhibitor blocked the eticlopride-induced tyrosine phosphorylation and synaptic trafficking of mGluR5. These results indicate that D2Rs inhibit SFK (mainly Fyn) phosphorylation in the striatum. D2Rs also inhibit tyrosine phosphorylation and synaptic recruitment of mGluR5 through a signaling mechanism likely involving Fyn. © 2016 Wiley Periodicals, Inc.

  20. VEGF secretion during hypoxia depends on free radicals-induced Fyn kinase activity in mast cells

    SciTech Connect

    Garcia-Roman, Jonathan; Ibarra-Sanchez, Alfredo; Lamas, Monica; Gonzalez Espinosa, Claudia

    2010-10-15

    Research highlights: {yields} Bone marrow-derived mast cells (BMMCs) secrete functional VEGF but do not degranulate after Cobalt chloride-induced hypoxia. {yields} CoCl{sub 2}-induced VEGF secretion in mast cells occurs by a Ca{sup 2+}-insensitive but brefeldin A and Tetanus toxin-sensitive mechanism. {yields} Trolox and N-acetylcysteine inhibit hypoxia-induced VEGF secretion but only Trolox inhibits Fc{epsilon}RI-dependent anaphylactic degranulation in mast cells. {yields} Src family kinase Fyn activation after free radical production is necessary for hypoxia-induced VEGF secretion in mast cells. -- Abstract: Mast cells (MC) have an important role in pathologic conditions such as asthma and chronic obstructive pulmonary disease (COPD), where hypoxia conduce to deleterious inflammatory response. MC contribute to hypoxia-induced angiogenesis producing factors such as vascular endothelial growth factor (VEGF), but the mechanisms behind the control of hypoxia-induced VEGF secretion in this cell type is poorly understood. We used the hypoxia-mimicking agent cobalt chloride (CoCl{sub 2}) to analyze VEGF secretion in murine bone marrow-derived mast cells (BMMCs). We found that CoCl{sub 2} promotes a sustained production of functional VEGF, able to induce proliferation of endothelial cells in vitro. CoCl{sub 2}-induced VEGF secretion was independent of calcium rise but dependent on tetanus toxin-sensitive vesicle-associated membrane proteins (VAMPs). VEGF exocytosis required free radicals formation and the activation of Src family kinases. Interestingly, an important deficiency on CoCl{sub 2}-induced VEGF secretion was observed in Fyn kinase-deficient BMMCs. Moreover, Fyn kinase was activated by CoCl{sub 2} in WT cells and this activation was prevented by treatment with antioxidants such as Trolox and N-acetylcysteine. Our results show that BMMCs are able to release VEGF under hypoxic conditions through a tetanus toxin-sensitive mechanism, promoted by free radicals

  1. CD36 and Fyn kinase mediate malaria-induced lung endothelial barrier dysfunction in mice infected with Plasmodium berghei.

    PubMed

    Anidi, Ifeanyi U; Servinsky, Laura E; Rentsendorj, Otgonchimeg; Stephens, R Scott; Scott, Alan L; Pearse, David B

    2013-01-01

    Severe malaria can trigger acute lung injury characterized by pulmonary edema resulting from increased endothelial permeability. However, the mechanism through which lung fluid conductance is altered during malaria remains unclear. To define the role that the scavenger receptor CD36 may play in mediating this response, C57BL/6J (WT) and CD36-/- mice were infected with P. berghei ANKA and monitored for changes in pulmonary endothelial barrier function employing an isolated perfused lung system. WT lungs demonstrated a >10-fold increase in two measures of paracellular fluid conductance and a decrease in the albumin reflection coefficient (σalb) compared to control lungs indicating a loss of barrier function. In contrast, malaria-infected CD36-/- mice had near normal fluid conductance but a similar reduction in σalb. In WT mice, lung sequestered iRBCs demonstrated production of reactive oxygen species (ROS). To determine whether knockout of CD36 could protect against ROS-induced endothelial barrier dysfunction, mouse lung microvascular endothelial monolayers (MLMVEC) from WT and CD36-/- mice were exposed to H2O2. Unlike WT monolayers, which showed dose-dependent decreases in transendothelial electrical resistance (TER) from H2O2 indicating loss of barrier function, CD36-/- MLMVEC demonstrated dose-dependent increases in TER. The differences between responses in WT and CD36-/- endothelial cells correlated with important differences in the intracellular compartmentalization of the CD36-associated Fyn kinase. Malaria infection increased total lung Fyn levels in CD36-/- lungs compared to WT, but this increase was due to elevated production of the inactive form of Fyn further suggesting a dysregulation of Fyn-mediated signaling. The importance of Fyn in CD36-dependent endothelial signaling was confirmed using in vitro Fyn knockdown as well as Fyn-/- mice, which were also protected from H2O2- and malaria-induced lung endothelial leak, respectively. Our results demonstrate

  2. VEGF secretion during hypoxia depends on free radicals-induced Fyn kinase activity in mast cells.

    PubMed

    García-Román, Jonathan; Ibarra-Sánchez, Alfredo; Lamas, Mónica; González Espinosa, Claudia

    2010-10-15

    Mast cells (MC) have an important role in pathologic conditions such as asthma and chronic obstructive pulmonary disease (COPD), where hypoxia conduce to deleterious inflammatory response. MC contribute to hypoxia-induced angiogenesis producing factors such as vascular endothelial growth factor (VEGF), but the mechanisms behind the control of hypoxia-induced VEGF secretion in this cell type is poorly understood. We used the hypoxia-mimicking agent cobalt chloride (CoCl2) to analyze VEGF secretion in murine bone marrow-derived mast cells (BMMCs). We found that CoCl2 promotes a sustained production of functional VEGF, able to induce proliferation of endothelial cells in vitro. CoCl2-induced VEGF secretion was independent of calcium rise but dependent on tetanus toxin-sensitive vesicle-associated membrane proteins (VAMPs). VEGF exocytosis required free radicals formation and the activation of Src family kinases. Interestingly, an important deficiency on CoCl2-induced VEGF secretion was observed in Fyn kinase-deficient BMMCs. Moreover, Fyn kinase was activated by CoCl2 in WT cells and this activation was prevented by treatment with antioxidants such as Trolox and N-acetylcysteine. Our results show that BMMCs are able to release VEGF under hypoxic conditions through a tetanus toxin-sensitive mechanism, promoted by free radicals-dependent Fyn kinase activation.

  3. Decreased expression of Fyn protein and disbalanced alternative splicing patterns in platelets from patients with schizophrenia.

    PubMed

    Hattori, Kotaro; Fukuzako, Hiroshi; Hashiguchi, Tomo; Hamada, Shun; Murata, Yoji; Isosaka, Tomoko; Yuasa, Shigeki; Yagi, Takeshi

    2009-07-30

    Fyn, a Src-family kinase, is highly expressed in brain tissue and blood cells. In the mouse brain, Fyn participates in brain development, synaptic transmission through the phosphorylation of N-methyl-d-aspartate (NMDA) receptor subunits, and the regulation of emotional behavior. Recently, we found that Fyn is required for the signal transduction in striatal neurons that is initiated by haloperidol, an antipsychotic drug. To determine whether Fyn abnormalities are present in patients with schizophrenia, we analyzed Fyn expression in platelet samples from 110 patients with schizophrenia, 75 of the patients' first-degree relatives, and 130 control subjects. A Western blot analysis revealed significantly lower levels of Fyn protein among the patients with schizophrenia and their relatives, compared with the level in the control group. At the mRNA level, the splicing patterns of fyn were altered in the patients and their relatives; specifically, the ratio of fynDelta7, in which exon 7 is absent, was elevated. An expression study in HEK293T cells revealed that FynDelta7 had a dominant-negative effect on the phosphorylation of Fyn's substrate. These results suggest novel deficits in Fyn function, manifested as the downregulation of Fyn protein or the altered transcription of the fyn gene, in patients with schizophrenia.

  4. GSK-3beta acts upstream of Fyn kinase in regulation of nuclear export and degradation of NF-E2 related factor 2.

    PubMed

    Jain, Abhinav K; Jaiswal, Anil K

    2007-06-01

    NF-E2-related factor 2 (Nrf2) regulates expression and coordinated induction of a battery of chemoprotective genes in response to oxidative and electrophilic stress. This leads to protection against oxidative stress and neoplastic diseases. Nuclear import and export of Nrf2 play a significant role in control of nuclear levels of Nrf2 and thus the expression of Nrf2 down-stream genes. Tyrosine kinase Fyn phosphorylates tyrosine 568 of Nrf2 that leads to the nuclear export of Nrf2. In this study, we investigated the upstream factor(s) in regulation of Fyn and Fyn-mediated nuclear export of Nrf2. The investigations shed light on a novel mechanism of Nrf2 regulation in response to oxidative stress. We demonstrate that GSK-3beta acts upstream of Fyn kinase in control of nuclear export of Nrf2. Chemical and short interfering RNA-mediated inhibition of GSK-3beta led to nuclear accumulation of Nrf2 and transcriptional activation of the Nrf2 downstream gene nqo1. Chemical and short interfering RNA inhibition of GSK-3beta and Fyn individually and in combination revealed that both kinases follow the same pathway to regulate nuclear export of Nrf2. We further demonstrate that hydrogen peroxide phosphorylates tyrosine 216 of GSK-3beta. This leads to activation of GSK-3beta. The activated GSK-3beta phosphorylates Fyn at threonine residue(s). Phosphorylated Fyn accumulates in the nucleus and phosphorylates Nrf2 at tyrosine 568. This leads to nuclear export, ubiquitination, and degradation of Nrf2.

  5. Effects of Four Different Regulatory Mechanisms on the Dynamics of Gene Regulatory Cascades

    PubMed Central

    Hansen, Sabine; Krishna, Sandeep; Semsey, Szabolcs; Lo Svenningsen, Sine

    2015-01-01

    Gene regulatory cascades (GRCs) are common motifs in cellular molecular networks. A given logical function in these cascades, such as the repression of the activity of a transcription factor, can be implemented by a number of different regulatory mechanisms. The potential consequences for the dynamic performance of the GRC of choosing one mechanism over another have not been analysed systematically. Here, we report the construction of a synthetic GRC in Escherichia coli, which allows us for the first time to directly compare and contrast the dynamics of four different regulatory mechanisms, affecting the transcription, translation, stability, or activity of a transcriptional repressor. We developed a biologically motivated mathematical model which is sufficient to reproduce the response dynamics determined by experimental measurements. Using the model, we explored the potential response dynamics that the constructed GRC can perform. We conclude that dynamic differences between regulatory mechanisms at an individual step in a GRC are often concealed in the overall performance of the GRC, and suggest that the presence of a given regulatory mechanism in a certain network environment does not necessarily mean that it represents a single optimal evolutionary solution. PMID:26184971

  6. Carotenoid biosynthesis regulatory mechanisms in plants.

    PubMed

    Othman, Rashidi; Mohd Zaifuddin, Fatimah Azzahra; Hassan, Norazian Mohd

    2014-01-01

    Carotenoids are bioactive compounds with remarkably special properties produced by plants in response to internal and external stresses. In this review paper, we focus on the subject of carotenoid biosynthesis and several factors that have been reported to significantly enhance or reduce carotenoid accumulation in studied plant species. These factors include varietal aspects, location, growing season, and type of stress experienced by a plant. In addition, we propose that there are three stress resistance mechanisms in plants: avoidance, tolerance, and acclimation. Better understanding of the environmental factors affecting carotenoid biosynthesis will help researchers to develop methods for enhancing the production of carotenoids and other pigments to desired concentrations in plant crops.

  7. Identifying regulatory mechanisms underlying tumorigenesis using locus expression signature analysis.

    PubMed

    Lee, Eunjee; de Ridder, Jeroen; Kool, Jaap; Wessels, Lodewyk F A; Bussemaker, Harmen J

    2014-04-15

    Retroviral insertional mutagenesis is a powerful tool for identifying putative cancer genes in mice. To uncover the regulatory mechanisms by which common insertion loci affect downstream processes, we supplemented genotyping data with genome-wide mRNA expression profiling data for 97 tumors induced by retroviral insertional mutagenesis. We developed locus expression signature analysis, an algorithm to construct and interpret the differential gene expression signature associated with each common insertion locus. Comparing locus expression signatures to promoter affinity profiles allowed us to build a detailed map of transcription factors whose protein-level regulatory activity is modulated by a particular locus. We also predicted a large set of drugs that might mitigate the effect of the insertion on tumorigenesis. Taken together, our results demonstrate the potential of a locus-specific signature approach for identifying mammalian regulatory mechanisms in a cancer context.

  8. Comparative phosphoproteomics of zebrafish Fyn/Yes morpholino knockdown embryos.

    PubMed

    Lemeer, Simone; Jopling, Chris; Gouw, Joost; Mohammed, Shabaz; Heck, Albert J R; Slijper, Monique; den Hertog, Jeroen

    2008-11-01

    The coordinated movement of cells is indispensable for normal vertebrate gastrulation. Several important players and signaling pathways have been identified in convergence and extension (CE) cell movements during gastrulation, including non-canonical Wnt signaling. Fyn and Yes, members of the Src family of kinases, are key regulators of CE movements as well. Here we investigated signaling pathways in early development by comparison of the phosphoproteome of wild type zebrafish embryos with Fyn/Yes knockdown embryos that display specific CE cell movement defects. For quantitation we used differential stable isotope labeling by reductive amination of peptides. Equal amounts of labeled peptides from wild type and Fyn/Yes knockdown embryos were mixed and analyzed by on-line reversed phase TiO(2)-reversed phase LC-MS/MS. Phosphorylated and non-phosphorylated peptides were quantified, and significant changes in protein expression and/or phosphorylation were detected. We identified 348 phosphoproteins of which 69 showed a decrease in phosphorylation in Fyn/Yes knockdown embryos and 72 showed an increase in phosphorylation. Among these phosphoproteins were known regulators of cell movements, including Adducin and PDLIM5. Our results indicate that quantitative phosphoproteomics combined with morpholino-mediated knockdowns can be used to identify novel signaling pathways that act in zebrafish development in vivo.

  9. Detecting Regulatory Mechanisms in Endocrine Time Series Measurements

    PubMed Central

    Vis, Daniel J.; Westerhuis, Johan A.; Hoefsloot, Huub C. J.; Roelfsema, Ferdinand

    2012-01-01

    The regulatory mechanisms underlying pulsatile secretion are complex, especially as it is partly controlled by other hormones and the combined action of multiple agents. Regulatory relations between hormones are not directly observable but may be deduced from time series measurements of plasma hormone concentrations. Variation in plasma hormone levels are the resultant of secretion and clearance from the circulation. A strategy is proposed to extract inhibition, activation, thresholds and circadian synchronicity from concentration data, using particular association methods. Time delayed associations between hormone concentrations and/or extracted secretion pulse profiles reveal the information on regulatory mechanisms. The above mentioned regulatory mechanisms are illustrated with simulated data. Additionally, data from a lean cohort of healthy control subjects is used to illustrate activation (ACTH and cortisol) and circadian synchronicity (ACTH and TSH) in real data. The simulation and the real data both consist of 145 equidistant samples per individual, matching a 24-hr time span with 10 minute intervals. The results of the simulation and the real data are in concordance. PMID:22461889

  10. Selective induction of alternatively spliced FynT isoform by TNF facilitates persistent inflammatory responses in astrocytes

    PubMed Central

    Lee, Chingli; Low, Clara Y. B.; Wong, Siew Ying; Lai, Mitchell K. P.; Tan, Michelle G. K.

    2017-01-01

    Fyn tyrosine kinase has been implicated in the pathogenesis of Alzheimer’s disease (AD). We have previously reported that upregulation of the FynT isoform in AD brains was partly associated with astrocyte activation. In this study, we demonstrated selective FynT induction in murine cortex and primary astrocyte culture after prolonged exposure to inflammatory stimulants, suggesting that FynT may mediate persistent neuroinflammation. To delineate the functional role of astrocytic FynT in association with TNF-mediated inflammatory responses, immortalized normal human astrocytes (iNHA) stably expressing FynT kinase constitutively active (FynT-CA) or kinase dead (FynT-KD) mutants were treated with TNF and compared for inflammatory responses using high-throughput real-time RT-PCR and Luminex multi-analyte immunoassays. FynT-CA but not FynT-KD mutant exhibited drastic induction of proinflammatory cytokines and chemokines after prolonged exposure to TNF, which could be attenuated by treating with Fyn kinase inhibitor PP2 or silencing via FynT-specific DsiRNA. FynT kinase activity-dependent induction of PKCδ expression, PKCδ phosphorylation, as well as NFκB activation was detected at the late phase but not the early phase of TNF signaling. In conclusion, selective FynT induction by TNF may facilitate persistent inflammatory responses in astrocytes, which is highly relevant to chronic neuroinflammation in neurodegenerative diseases including but not limited to AD. PMID:28266558

  11. The hypothalamic GnRH pulse generator: multiple regulatory mechanisms.

    PubMed

    Krsmanovic, Lazar Z; Hu, Lian; Leung, Po-Ki; Feng, Hao; Catt, Kevin J

    2009-10-01

    Pulsatile secretion of gonadotropin-releasing hormone (GnRH) release is an intrinsic property of hypothalamic GnRH neurons. Pulse generation has been attributed to multiple specific mechanisms, including spontaneous electrical activity of GnRH neurons, calcium and cAMP signaling, a GnRH receptor autocrine regulatory component, a GnRH concentration-dependent switch in GnRH receptor (GnRH-R) coupling to specific G proteins, the expression of G protein-coupled receptors (GPCRs) and steroid receptors, and homologous and heterologous interactions between cell membrane receptors expressed in GnRH neurons. The coexistence of multiple regulatory mechanisms for pulsatile GnRH secretion provides a high degree of redundancy in maintaining this crucial component of the mammalian reproductive process. These studies provide insights into the basic cellular and molecular mechanisms involved in GnRH neuronal function.

  12. Iron and ageing: an introduction to iron regulatory mechanisms.

    PubMed

    Levenson, Cathy W; Tassabehji, Nadine M

    2004-07-01

    While there have been significant advances made in our understanding of the cellular and molecular mechanisms that regulate iron absorption, transport, storage, and utilization, the effect of ageing on these mechanisms and the role of iron in the ageing process is not fully understood. Thus, this review will provide an overview of the iron regulatory mechanisms that may be a factor in the ageing process. Additional reviews in this volume represent an attempt to explore the very latest information on the regulation of iron with a particular emphasis on age-related pathology including mitochondrial function, Parkinson's disease, Alzheimer's disease, stroke, and cardiovascular disease.

  13. Regulatory mechanisms underlying the differential growth of dendrites and axons.

    PubMed

    Wang, Xin; Sterne, Gabriella R; Ye, Bing

    2014-08-01

    A typical neuron is comprised of an information input compartment, or the dendrites, and an output compartment, known as the axon. These two compartments are the structural basis for functional neural circuits. However, little is known about how dendritic and axonal growth are differentially regulated. Recent studies have uncovered two distinct types of regulatory mechanisms that differentiate dendritic and axonal growth: dedicated mechanisms and bimodal mechanisms. Dedicated mechanisms regulate either dendritespecific or axon-specific growth; in contrast, bimodal mechanisms direct dendritic and axonal development in opposite manners. Here, we review the dedicated and bimodal regulators identified by recent Drosophila and mammalian studies. The knowledge of these underlying molecular mechanisms not only expands our understanding about how neural circuits are wired, but also provides insights that will aid in the rational design of therapies for neurological diseases.

  14. Regulatory mechanisms related to biofuel tolerance in producing microbes.

    PubMed

    Fu, Y; Chen, L; Zhang, W

    2016-08-01

    Production of renewable biofuels through either native or engineered microbes has drawn significant attention in recent years, mostly due to the increasing concerns on the energy crisis and the environmental consequences of the overutilization of petroleum-based fuels. Although significant progress has been achieved thus far, further advances are still necessary in order to decrease the manufacturing cost so that the producing processes can be more competitive to petroleum fuels. Among various possible approaches, the increase in biofuel tolerance in microbes has been suggested as one aspect which is important for the success of biofuel production at industry-scale. In this article, we critically summarize recent advances in deciphering regulatory mechanisms for enhancing biofuel tolerance in various micro-organisms, focusing on functions and utilization of several well-studied regulatory mechanisms in microbes, such as two-component signal transduction systems, sigma factors, transcription factors, noncoding RNA and other regulators. © 2016 The Society for Applied Microbiology.

  15. Secretory pattern and regulatory mechanism of growth hormone in cattle.

    PubMed

    Kasuya, Etsuko

    2016-02-01

    The ultradian rhythm of growth hormone (GH) secretion has been known in several animal species for years and has recently been observed in cattle. Although the physiological significance of the rhythm is not yet fully understood, it appears essential for normal growth. In this review, previous studies concerning the GH secretory pattern in cattle, including its ultradian rhythm, are introduced and the regulatory mechanism is discussed on the basis of recent findings.

  16. Conserved transcriptional regulatory mechanisms in aortic valve development and disease

    PubMed Central

    Wirrig, Elaine E.; Yutzey, Katherine E.

    2014-01-01

    There is increasing evidence for activation of developmental transcriptional regulatory pathways in heart valve disease. Here we review molecular regulatory mechanisms involved in heart valve progenitor development, leaflet morphogenesis, and extracellular matrix organization that also are active in diseased aortic valves. These include regulators of endothelial-to-mesenchymal transitions, such as the Notch pathway effector RBPJ, and the valve progenitor markers Twist1, Msx1/2, and Sox9. Little is known of the potential reparative or pathological functions of these developmental mechanisms in adult aortic valves, but it is tempting to speculate that valve progenitor cells could contribute to repair in the context of disease. Likewise, loss of either RBPJ or Sox9 leads to aortic valve calcification in mice, supporting a potential therapeutic role in prevention of disease. During aortic valve calcification, transcriptional regulators of osteogenic development are activated in addition to valve progenitor regulatory programs. Specifically, the transcription factor Runx2 and its downstream target genes are induced in calcified valves. Runx2 and osteogenic genes also are induced with vascular calcification, but activation of valve progenitor markers and the cellular context of expression are likely to be different for valve and vascular calcification. Additional research is necessary to determine if developmental mechanisms contribute to valve repair or if these pathways can be harnessed for new treatments of heart valve disease. PMID:24665126

  17. Mouse skeletal muscle fiber-type specific macroautophagy and muscle wasting is regulated by a Fyn/STAT3/Vps34 signaling pathway

    PubMed Central

    Yamada, Eijiro; Bastie, Claire C.; Koga, Hiroshi; Wang, Yichen; Cuervo, Ana Maria; Pessin, Jeffrey E.

    2012-01-01

    SUMMARY Skeletal muscle atrophy induced by aging (sarcopenia), inactivity and prolonged fasting states (starvation) is predominantly restricted to glycolytic type II muscle fibers and typical spares oxidative type I fibers. However, the mechanisms accounting for muscle fiber type specificity of atrophy have remained enigmatic. In the current study, we that although the Fyn tyrosine kinase activated the mTORC1 signaling complex, it also induced marked atrophy of glycolytic fibers with relatively less effect on oxidative muscle fibers. This was due to inhibition of macroautophagy via an mTORC1-independent but STAT3-dependent reduction in Vps34 protein levels and decreased Vps34/p150/Beclin1/Atg14 complexes. Physiologically, in the fed sate endogenous Fyn kinase activity was increased in glycolytic but not oxidative skeletal muscle. In parallel, Y705-STAT3 phosphorylation increased with decreased Vps34 protein levels. Moreover, fed/starved regulation of Y705-STAT3 phosphorylation and Vps34 protein levels was prevented in skeletal muscle of Fyn null mice. These data demonstrate a novel Fyn/STAT3/Vps34 pathway that is responsible for fiber type specific regulation of macroautophagy and skeletal muscle atrophy. PMID:22745922

  18. Gene regulatory network inference using out of equilibrium statistical mechanics

    PubMed Central

    Benecke, Arndt

    2008-01-01

    Spatiotemporal control of gene expression is fundamental to multicellular life. Despite prodigious efforts, the encoding of gene expression regulation in eukaryotes is not understood. Gene expression analyses nourish the hope to reverse engineer effector-target gene networks using inference techniques. Inference from noisy and circumstantial data relies on using robust models with few parameters for the underlying mechanisms. However, a systematic path to gene regulatory network reverse engineering from functional genomics data is still impeded by fundamental problems. Recently, Johannes Berg from the Theoretical Physics Institute of Cologne University has made two remarkable contributions that significantly advance the gene regulatory network inference problem. Berg, who uses gene expression data from yeast, has demonstrated a nonequilibrium regime for mRNA concentration dynamics and was able to map the gene regulatory process upon simple stochastic systems driven out of equilibrium. The impact of his demonstration is twofold, affecting both the understanding of the operational constraints under which transcription occurs and the capacity to extract relevant information from highly time-resolved expression data. Berg has used his observation to predict target genes of selected transcription factors, and thereby, in principle, demonstrated applicability of his out of equilibrium statistical mechanics approach to the gene network inference problem. PMID:19404429

  19. Gene regulatory network inference using out of equilibrium statistical mechanics.

    PubMed

    Benecke, Arndt

    2008-08-01

    Spatiotemporal control of gene expression is fundamental to multicellular life. Despite prodigious efforts, the encoding of gene expression regulation in eukaryotes is not understood. Gene expression analyses nourish the hope to reverse engineer effector-target gene networks using inference techniques. Inference from noisy and circumstantial data relies on using robust models with few parameters for the underlying mechanisms. However, a systematic path to gene regulatory network reverse engineering from functional genomics data is still impeded by fundamental problems. Recently, Johannes Berg from the Theoretical Physics Institute of Cologne University has made two remarkable contributions that significantly advance the gene regulatory network inference problem. Berg, who uses gene expression data from yeast, has demonstrated a nonequilibrium regime for mRNA concentration dynamics and was able to map the gene regulatory process upon simple stochastic systems driven out of equilibrium. The impact of his demonstration is twofold, affecting both the understanding of the operational constraints under which transcription occurs and the capacity to extract relevant information from highly time-resolved expression data. Berg has used his observation to predict target genes of selected transcription factors, and thereby, in principle, demonstrated applicability of his out of equilibrium statistical mechanics approach to the gene network inference problem.

  20. Sociocognitive self-regulatory mechanisms governing transgressive behavior.

    PubMed

    Bandura, A; Caprara, G V; Barbaranelli, C; Pastorelli, C; Regalia, C

    2001-01-01

    This longitudinal research examined a structural model of the self-regulatory mechanisms governing transgressive conduct. Perceived academic and self-regulatory efficacy concurrently and longitudinally deterred transgressiveness both directly and by fostering prosocialness and adherence to moral self-sanctions for harmful conduct. The impact of perceived social self-efficacy was mediated through prosocialness. Moral disengagement and prosocialness affected transgressiveness through the mediating influence of irascible affectivity and hostile rumination. Ruminative affectivity, in turn, both concurrently and longitudinally affected transgressiveness. Moral disengagement also contributed independently to variance in transgressiveness over time. This pattern of relations was obtained after controlling for prior transgressiveness. The structural model was replicated across gender and provided a better fit to the data than did several alternative models.

  1. NR2B antagonist CP-101,606 inhibits NR2B phosphorylation at tyrosine-1472 and its interactions with Fyn in levodopa-induced dyskinesia rat model.

    PubMed

    Kong, Min; Ba, Maowen; Liu, Chuanyu; Zhang, Yanxiang; Zhang, Hongli; Qiu, Haiyan

    2015-04-01

    The augmented tyrosine phosphorylation of NR2B subunit of N-methyl-d-aspartate receptors (NMDAR) dependent on Fyn kinase has been associated with levodopa (l-dopa)-induced dyskinesia (LID). CP-101,606, one selective NR2B subunit antagonist, can improve dyskinesia. Yet, the accurate action mechanism is less well understood. In the present study, the evidences were investigated. Valid 6-hydroxydopamine-lesioned parkinsonian rats were treated with l-dopa intraperitoneally for 22 days to induce LID rat model. On day 23, rats received either CP-101,606 (0.5mg/kg) or vehicle with each l-dopa dose. On the day of 1, 8, 15, 22, and 23 during l-dopa treatment, we determined abnormal involuntary movements (AIMs) in rats. The levels of NR2B phosphorylation at tyrosine-1472 (pNR2B-Tyr1472) and interactions of NR2B with Fyn in LID rat model were detected by immunoblotting and immunoprecipitation. Results showed that CP-101,606 attenuated l-dopa-induced AIMs. In agreement with behavioral analysis, CP-101,606 reduced the augmented pNR2B-Tyr1472 and its interactions with Fyn triggered during the l-dopa administration in the lesioned striatum of parkinsonian rats. Moreover, CP-101,606 also decreased the level of Ca(2+)/calmodulin-dependent protein kinase II at threonine-286 hyperphosphorylation (pCaMKII-Thr286), which was the downstream signaling amplification molecule of NMDAR overactivation and closely associated with LID. However, the protein level of NR2B and Fyn had no difference under the above conditions. These data indicate that the inhibition of the interactions of NR2B with Fyn and NR2B tyrosine phosphorylation may contribute to the CP-101,606-induced downregulation of NMDAR function and provide benefit for the therapy of LID. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Regulatory mechanisms of EGFR signalling during Drosophila eye development.

    PubMed

    Malartre, Marianne

    2016-05-01

    EGFR signalling is a well-conserved signalling pathway playing major roles during development and cancers. This review explores what studying the EGFR pathway during Drosophila eye development has taught us in terms of the diversity of its regulatory mechanisms. This model system has allowed the identification of numerous positive and negative regulators acting at specific time and place, thus participating to the tight control of signalling. EGFR signalling regulation is achieved by a variety of mechanisms, including the control of ligand processing, the availability of the receptor itself and the transduction of the cascade in the cytoplasm. Ultimately, the transcriptional responses contribute to the establishment of positive and negative feedback loops. The combination of these multiple mechanisms employed to regulate the EGFR pathway leads to specific cellular outcomes involved in functions as diverse as the acquisition of cell fate, proliferation, survival, adherens junction remodelling and morphogenesis.

  3. SRC family kinase FYN promotes the neuroendocrine phenotype and visceral metastasis in advanced prostate cancer.

    PubMed

    Gururajan, Murali; Cavassani, Karen A; Sievert, Margarit; Duan, Peng; Lichterman, Jake; Huang, Jen-Ming; Smith, Bethany; You, Sungyong; Nandana, Srinivas; Chu, Gina Chia-Yi; Mink, Sheldon; Josson, Sajni; Liu, Chunyan; Morello, Matteo; Jones, Lawrence W M; Kim, Jayoung; Freeman, Michael R; Bhowmick, Neil; Zhau, Haiyen E; Chung, Leland W K; Posadas, Edwin M

    2015-12-29

    FYN is a SRC family kinase (SFK) that has been shown to be up-regulated in human prostate cancer (PCa) tissues and cell lines. In this study, we observed that FYN is strongly up-regulated in human neuroendocrine PCa (NEPC) tissues and xenografts, as well as cells derived from a NEPC transgenic mouse model. In silico analysis of FYN expression in prostate cancer cell line databases revealed an association with the expression of neuroendocrine (NE) markers such as CHGA, CD44, CD56, and SYP. The loss of FYN abrogated the invasion of PC3 and ARCaPM cells in response to MET receptor ligand HGF. FYN also contributed to the metastatic potential of NEPC cells in two mouse models of visceral metastasis with two different cell lines (PC3 and TRAMPC2-RANKL). The activation of MET appeared to regulate neuroendocrine (NE) features as evidenced by increased expression of NE markers in PC3 cells with HGF. Importantly, the overexpression of FYN protein in DU145 cells was directly correlated with the increase of CHGA. Thus, our data demonstrated that the neuroendocrine differentiation that occurs in PCa cells is, at least in part, regulated by FYN kinase. Understanding the role of FYN in the regulation of NE markers will provide further support for ongoing clinical trials of SFK and MET inhibitors in castration-resistant PCa patients.

  4. SRC family kinase FYN promotes the neuroendocrine phenotype and visceral metastasis in advanced prostate cancer

    PubMed Central

    Sievert, Margarit; Duan, Peng; Lichterman, Jake; Huang, Jen-Ming; Smith, Bethany; You, Sungyong; Nandana, Srinivas; Chu, Gina Chia-Yi; Mink, Sheldon; Josson, Sajni; Liu, Chunyan; Morello, Matteo; Jones, Lawrence W. M.; Kim, Jayoung; Freeman, Michael R.; Bhowmick, Neil; Zhau, Haiyen E.; Chung, Leland W.K.; Posadas, Edwin M.

    2015-01-01

    FYN is a SRC family kinase (SFK) that has been shown to be up-regulated in human prostate cancer (PCa) tissues and cell lines. In this study, we observed that FYN is strongly up-regulated in human neuroendocrine PCa (NEPC) tissues and xenografts, as well as cells derived from a NEPC transgenic mouse model. In silico analysis of FYN expression in prostate cancer cell line databases revealed an association with the expression of neuroendocrine (NE) markers such as CHGA, CD44, CD56, and SYP. The loss of FYN abrogated the invasion of PC3 and ARCaPM cells in response to MET receptor ligand HGF. FYN also contributed to the metastatic potential of NEPC cells in two mouse models of visceral metastasis with two different cell lines (PC3 and TRAMPC2-RANKL). The activation of MET appeared to regulate neuroendocrine (NE) features as evidenced by increased expression of NE markers in PC3 cells with HGF. Importantly, the overexpression of FYN protein in DU145 cells was directly correlated with the increase of CHGA. Thus, our data demonstrated that the neuroendocrine differentiation that occurs in PCa cells is, at least in part, regulated by FYN kinase. Understanding the role of FYN in the regulation of NE markers will provide further support for ongoing clinical trials of SFK and MET inhibitors in castration-resistant PCa patients. PMID:26624980

  5. Molecular and Cellular Regulatory Mechanisms of Tongue Myogenesis

    PubMed Central

    Parada, C.; Han, D.; Chai, Y.

    2012-01-01

    The tongue exerts crucial functions in our daily life. However, we know very little about the regulatory mechanisms of mammalian tongue development. In this review, we summarize recent findings of the molecular and cellular mechanisms that control tissue-tissue interactions during tongue morphogenesis. Specifically, cranial neural crest cells (CNCC) lead the initiation of tongue bud formation and contribute to the interstitial connective tissue, which ultimately compartmentalizes tongue muscles and serves as their attachments. Occipital somite-derived cells migrate into the tongue primordium and give rise to muscle cells in the tongue. The intimate relationship between CNCC- and mesoderm-derived cells, as well as growth and transcription factors that have been shown to be crucial for tongue myogenesis, clearly indicate that tissue-tissue interactions play an important role in regulating tongue morphogenesis. PMID:22219210

  6. Ochratoxin A Producing Fungi, Biosynthetic Pathway and Regulatory Mechanisms.

    PubMed

    Wang, Yan; Wang, Liuqing; Liu, Fei; Wang, Qi; Selvaraj, Jonathan Nimal; Xing, Fuguo; Zhao, Yueju; Liu, Yang

    2016-03-21

    Ochratoxin A (OTA), mainly produced by Aspergillus and Penicillum species, is one of the most important mycotoxin contaminants in agricultural products. It is detrimental to human health because of its nephrotoxicity, hepatotoxicity, carcinogenicity, teratogenicity, and immunosuppression. OTA structurally consists of adihydrocoumarin moiety linked with l-phenylalanine via an amide bond. OTA biosynthesis has been putatively hypothesized, although several contradictions exist on some processes of the biosynthetic pathway. We discuss recent information on molecular studies of OTA biosynthesis despite insufficient genetic background in detail. Accordingly, genetic regulation has also been explored with regard to the interaction between the regulators and the environmental factors. In this review, we focus on three aspects of OTA: OTA-producing strains, OTA biosynthetic pathway and the regulation mechanisms of OTA production. This can pave the way to assist in protecting food and feed from OTA contamination by understanding OTA biosynthetic pathway and regulatory mechanisms.

  7. Ochratoxin A Producing Fungi, Biosynthetic Pathway and Regulatory Mechanisms

    PubMed Central

    Wang, Yan; Wang, Liuqing; Liu, Fei; Wang, Qi; Selvaraj, Jonathan Nimal; Xing, Fuguo; Zhao, Yueju; Liu, Yang

    2016-01-01

    Ochratoxin A (OTA), mainly produced by Aspergillus and Penicillum species, is one of the most important mycotoxin contaminants in agricultural products. It is detrimental to human health because of its nephrotoxicity, hepatotoxicity, carcinogenicity, teratogenicity, and immunosuppression. OTA structurally consists of adihydrocoumarin moiety linked with l-phenylalanine via an amide bond. OTA biosynthesis has been putatively hypothesized, although several contradictions exist on some processes of the biosynthetic pathway. We discuss recent information on molecular studies of OTA biosynthesis despite insufficient genetic background in detail. Accordingly, genetic regulation has also been explored with regard to the interaction between the regulators and the environmental factors. In this review, we focus on three aspects of OTA: OTA-producing strains, OTA biosynthetic pathway and the regulation mechanisms of OTA production. This can pave the way to assist in protecting food and feed from OTA contamination by understanding OTA biosynthetic pathway and regulatory mechanisms. PMID:27007394

  8. Gene regulatory mechanisms governing energy metabolism during cardiac hypertrophic growth.

    PubMed

    Lehman, John J; Kelly, Daniel P

    2002-04-01

    Studies in a variety of mammalian species, including humans, have demonstrated a reduction in fatty acid oxidation (FAO) and increased glucose utilization in pathologic cardiac hypertrophy, consistent with reinduction of the fetal energy metabolic program. This review describes results of recent molecular studies aimed at delineating the gene regulatory events which facilitate myocardial energy substrate switches during hypertrophic growth of the heart. Studies aimed at the characterization of transcriptional control mechanisms governing FAO enzyme gene expression in the cardiac myocyte have defined a central role for the fatty acid-activated nuclear receptor peroxisome proliferator-activated receptor alpha (PPAR(alpha)). Cardiac FAO enzyme gene expression was shown to be coordinately downregulated in murine models of ventricular pressure overload, consistent with the energy substrate switch away from fatty acid utilization in the hypertrophied heart. Nuclear protein levels of PPAR(alpha) decline in the ventricle in response to pressure overload, while several Sp and nuclear receptor transcription factors are induced to fetal levels, consistent with their binding to DNA as transcriptional repressors of rate-limiting FAO enzyme genes with hypertrophy. Knowledge of key components of this transcriptional regulatory pathway will allow for the development of genetic engineering strategies in mice that will modulate fatty acid oxidative flux and assist in defining whether energy metabolic derangements play a primary role in the development of pathologic cardiac hypertrophy and eventual progression to heart failure.

  9. Toxin-mediated gene regulatory mechanism in Staphylococcus aureus

    PubMed Central

    Joo, Hwang-Soo; Otto, Michael

    2016-01-01

    The dangerous human pathogen Staphylococcus aureus relies heavily on toxins to cause disease, but toxin production can put a strong burden on the bacteria’s energy balance. Thus, controlling the synthesis of proteins solely needed in times of toxin production represents a way for the bacteria to avoid wasting energy. One hypothetical manner to accomplish this sort of regulation is by gene regulatory functions of the toxins themselves. There have been several reports about gene regulation by toxins in S. aureus, but these were never verified on the molecular level. In our study published in MBio [Joo et al., 7(5). pii: e01579-16], we show that phenol-soluble modulins (PSMs), important peptide toxins of S. aureus, release a repressor from the promoter of the operon encoding the toxin export system, thereby enabling toxin secretion. This study describes the first molecular regulatory mechanism exerted by an S. aureus toxin, setting a paradigmatic example of how S. aureus toxins may influence cell functions to adjust them to times of toxin production.

  10. The Molecular Mechanisms of Regulatory T Cell Immunosuppression

    PubMed Central

    Pandiyan, Pushpa; Zheng, Lixin; Lenardo, Michael J.

    2011-01-01

    CD4+CD25+Foxp3+ T lymphocytes, known as regulatory T cells or Tregs, have been proposed to be a lineage of professional immune suppressive cells that exclusively counteract the effects of the immunoprotective “helper” and “cytotoxic” lineages of T lymphocytes. Here we discuss new concepts on the mechanisms and functions of Tregs. There are several key points we emphasize: 1. Tregs exert suppressive effects both directly on effector T cells and indirectly through antigen-presenting cells; 2. Regulation can occur through a novel mechanism of cytokine consumption to regulate as opposed to the usual mechanism of cytokine/chemokine production; 3. In cases where CD4+ effector T cells are directly inhibited by Tregs, it is chiefly through a mechanism of lymphokine withdrawal apoptosis leading to polyclonal deletion; and 4. Contrary to the current view, we discuss new evidence that Tregs, similar to other T-cells lineages, can promote protective immune responses in certain infectious contexts (Chen et al., 2011; Pandiyan et al., 2011). Although these points are at variance to varying degrees with the standard model of Treg behavior, we will recount developing findings that support these new concepts. PMID:22566849

  11. Glucose- and nitrogen sensing and regulatory mechanisms in Saccharomyces cerevisiae.

    PubMed

    Rødkaer, Steven V; Faergeman, Nils J

    2014-08-01

    Pro- and eukaryotic cells are constantly challenged by varying concentrations of nutrients in their environment. Perceiving and adapting to such changes are therefore crucial for cellular viability. Thus, numerous specialized cellular receptors continuously sense and react to the availability of nutrients such as glucose and nitrogen. When stimulated, these receptors initiate various cellular signaling pathways, which in concert constitute a complex regulatory network. To ensure a highly specific response, these pathways and networks cross-communicate with each other and are regulated at several steps and by numerous different regulators. As numerous of these regulating proteins, biochemical mechanisms, and cellular pathways are evolutionary conserved, complex biochemical information relevant to humans can be obtained by studying simple organisms. Thus, the yeast Saccharomyces cerevisiae has been recognized as a powerful model system to study fundamental biochemical processes. In the present review, we highlight central signaling pathways and molecular circuits conferring nitrogen- and glucose sensing in S. cerevisiae.

  12. Restricted autoantigen recognition associated with deletional and adaptive regulatory mechanisms.

    PubMed

    Gebe, John A; Yue, Betty B; Unrath, Kelly A; Falk, Ben A; Nepom, Gerald T

    2009-07-01

    Autoimmune diabetes (T1D) is characterized by CD4(+) T cell reactivity to a variety of islet-associated Ags. At-risk individuals, genetically predisposed to T1D, often have similar T cell reactivity, but nevertheless fail to progress to clinically overt disease. To study the immune tolerance and regulatory environment permissive for such autoreactive T cells, we expressed TCR transgenes derived from two autoreactive human T cells, 4.13 and 164, in HLA-DR4 transgenic mice on a C57BL/6-derived "diabetes-resistant" background. Both TCR are responsive to an immunodominant epitope of glutamic acid decarboxylase 65(555-567), which is identical in sequence between humans and mice, is restricted by HLA-DR4, and is a naturally processed self Ag associated with T1D. Although both TCR use the identical Valpha and Vbeta genes, differing only in CDR3, we found stark differences in the mechanisms utilized in vivo in the maintenance of immune tolerance. A combination of thymic deletion (negative selection), TCR down-regulation, and peripheral activation-induced cell death dominated the phenotype of 164 T cells, which nevertheless still maintain their Ag responsiveness in the periphery. In contrast, 4.13 T cells are much less influenced by central and deletional tolerance mechanisms, and instead display a peripheral immune deviation including differentiation into IL-10-secreting Tr1 cells. These findings indicate a distinct set of regulatory alternatives for autoreactive T cells, even within a single highly restricted HLA-peptide-TCR recognition profile.

  13. Overcoming barriers and thresholds – signaling of oligomeric Aβ through the prion protein to Fyn

    PubMed Central

    2013-01-01

    Evidence has been mounting for an involvement of the prion protein (PrP) in a molecular pathway assumed to play a critical role in the etiology of Alzheimer disease. A currently popular model sees oligomeric amyloid β (oAβ) peptides bind directly to PrP to emanate a signal that causes activation of the cytoplasmic tyrosine kinase Fyn, an essential player in a cascade of events that ultimately leads to NMDA receptor-mediated excitotoxicity and hyper-phosphorylation of tau. The model does not reveal, however, how extracellular binding of oAβ to PrP is communicated across the plasma membrane barrier to affect activation of Fyn. A scenario whereby PrP may adapt a transmembrane topology to affect Fyn activation in the absence of additional partners is currently not supported by evidence. A survey of known candidate PrP interactors leads to a small number of molecules that are known to acquire a transmembrane topology and understood to contribute to Fyn activation. Because multiple signaling pathways converge onto Fyn, a realistic model needs to take into account a reality of Fyn acting as a hub that integrates signals from multiple inhibitory and activating effectors. To clarify the role of PrP in oAβ-dependent excitotoxicity, future studies may need to incorporate experimental designs that can probe the contributions of Fyn modulator pathways and rely on analogous readouts, rather than threshold effects, known to underlie excitotoxic signaling. PMID:23856335

  14. Regulatory Mechanisms and Physiological Significance of Reelin Function.

    PubMed

    Kohno, Takao

    2017-01-01

     Reelin is a large secreted glycoprotein that regulates embryonic neuronal lamination and adult synaptic function. Secreted Reelin binds to lipoprotein receptors expressed on neurons. The Reelin-receptor interaction induces phosphorylation of an intracellular adaptor protein Dab1, which is required for normal embryonic brain development and adult brain functions. It has been suggested that Reelin hypofunction plays a role in the pathogenesis of several neuropsychiatric diseases, such as schizophrenia, autism, and Alzheimer's disease. Thus upregulation of Reelin activity may ameliorate the symptoms of neuropsychiatric diseases. However, the regulatory mechanism underlying the functions of Reelin is largely unknown and there are no good animal models of Reelin malfunction; thus, causal relations between Reelin and neuropsychiatric diseases remain unclear. Recently, our studies have shown that proteolytic cleavage of the Reelin protein regulates its activity. Herein, we will review recent findings about relations between Reelin and Alzheimer's disease, and the mechanism underlying the regulation of Reelin function by proteolytic cleavage. Also, we will discuss the prospect of treating neuropsychiatric diseases by upregulation of Reelin activity.

  15. Regulatory mechanisms of growth hormone secretion are sexually dimorphic.

    PubMed Central

    Jaffe, C A; Ocampo-Lim, B; Guo, W; Krueger, K; Sugahara, I; DeMott-Friberg, R; Bermann, M; Barkan, A L

    1998-01-01

    Sexually dimorphic growth hormone (GH) secretory pattern is important in the determination of gender-specific patterns of growth and metabolism in rats. Whether GH secretion in humans is also sexually dimorphic and the neuroendocrine mechanisms governing this potential difference are not fully established. We have compared pulsatile GH secretion profiles in young men and women in the baseline state and during a continuous intravenous infusion of recombinant human insulin-like growth factor I (rhIGF-I). During the baseline study, men had large nocturnal GH pulses and relatively small pulses during the rest of the day. In contrast, women had more continuous GH secretion and more frequent GH pulses that were of more uniform size. The infusion of rhIGF-I (10 microg/kg/h) potently suppressed both spontaneous and growth hormone-releasing hormone (GHRH)-induced GH secretion in men. In women, however, rhIGF-I had less effect on pulsatile GH secretion and did not suppress the GH response to GHRH. These data demonstrate the existence of sexual dimorphism in the regulatory mechanisms involved in GH secretion in humans. The persistence of GH responses to GHRH in women suggests that negative feedback by IGF-I might be expressed, in part, through suppression of hypothalamic GHRH. PMID:9649569

  16. A conserved regulatory mechanism in bifunctional biotin protein ligases.

    PubMed

    Wang, Jingheng; Beckett, Dorothy

    2017-08-01

    Class II bifunctional biotin protein ligases (BirA), which catalyze post-translational biotinylation and repress transcription initiation, are broadly distributed in eubacteria and archaea. However, it is unclear if these proteins all share the same molecular mechanism of transcription regulation. In Escherichia coli the corepressor biotinoyl-5'-AMP (bio-5'-AMP), which is also the intermediate in biotin transfer, promotes operator binding and resulting transcription repression by enhancing BirA dimerization. Like E. coli BirA (EcBirA), Staphylococcus aureus, and Bacillus subtilis BirA (Sa and BsBirA) repress transcription in vivo in a biotin-dependent manner. In this work, sedimentation equilibrium measurements were performed to investigate the molecular basis of this biotin-responsive transcription regulation. The results reveal that, as observed for EcBirA, Sa, and BsBirA dimerization reactions are significantly enhanced by bio-5'-AMP binding. Thus, the molecular mechanism of the Biotin Regulatory System is conserved in the biotin repressors from these three organisms. © 2017 The Protein Society.

  17. Redox-switch regulatory mechanism of thiolase from Clostridium acetobutylicum

    PubMed Central

    Kim, Sangwoo; Jang, Yu-Sin; Ha, Sung-Chul; Ahn, Jae-Woo; Kim, Eun-Jung; Hong Lim, Jae; Cho, Changhee; Shin Ryu, Yong; Kuk Lee, Sung; Lee, Sang Yup; Kim, Kyung-Jin

    2015-01-01

    Thiolase is the first enzyme catalysing the condensation of two acetyl-coenzyme A (CoA) molecules to form acetoacetyl-CoA in a dedicated pathway towards the biosynthesis of n-butanol, an important solvent and biofuel. Here we elucidate the crystal structure of Clostridium acetobutylicum thiolase (CaTHL) in its reduced/oxidized states. CaTHL, unlike those from other aerobic bacteria such as Escherichia coli and Zoogloea ramegera, is regulated by the redox-switch modulation through reversible disulfide bond formation between two catalytic cysteine residues, Cys88 and Cys378. When CaTHL is overexpressed in wild-type C. acetobutylicum, butanol production is reduced due to the disturbance of acidogenic to solventogenic shift. The CaTHLV77Q/N153Y/A286K mutant, which is not able to form disulfide bonds, exhibits higher activity than wild-type CaTHL, and enhances butanol production upon overexpression. On the basis of these results, we suggest that CaTHL functions as a key enzyme in the regulation of the main metabolism of C. acetobutylicum through a redox-switch regulatory mechanism. PMID:26391388

  18. Redox-switch regulatory mechanism of thiolase from Clostridium acetobutylicum.

    PubMed

    Kim, Sangwoo; Jang, Yu-Sin; Ha, Sung-Chul; Ahn, Jae-Woo; Kim, Eun-Jung; Lim, Jae Hong; Cho, Changhee; Ryu, Yong Shin; Lee, Sung Kuk; Lee, Sang Yup; Kim, Kyung-Jin

    2015-09-22

    Thiolase is the first enzyme catalysing the condensation of two acetyl-coenzyme A (CoA) molecules to form acetoacetyl-CoA in a dedicated pathway towards the biosynthesis of n-butanol, an important solvent and biofuel. Here we elucidate the crystal structure of Clostridium acetobutylicum thiolase (CaTHL) in its reduced/oxidized states. CaTHL, unlike those from other aerobic bacteria such as Escherichia coli and Zoogloea ramegera, is regulated by the redox-switch modulation through reversible disulfide bond formation between two catalytic cysteine residues, Cys88 and Cys378. When CaTHL is overexpressed in wild-type C. acetobutylicum, butanol production is reduced due to the disturbance of acidogenic to solventogenic shift. The CaTHL(V77Q/N153Y/A286K) mutant, which is not able to form disulfide bonds, exhibits higher activity than wild-type CaTHL, and enhances butanol production upon overexpression. On the basis of these results, we suggest that CaTHL functions as a key enzyme in the regulation of the main metabolism of C. acetobutylicum through a redox-switch regulatory mechanism.

  19. Naturally occurring regulatory T cells: markers, mechanisms, and manipulation.

    PubMed

    Schmetterer, Klaus G; Neunkirchner, Alina; Pickl, Winfried F

    2012-06-01

    Naturally occurring CD4(+)CD25(high) forkhead box protein 3 (FOXP3)(+) regulatory T cells (nTregs) are key mediators of immunity, which orchestrate and maintain tolerance to self and foreign antigens. In the recent 1.5 decades, a multitude of studies have aimed to define the phenotype and function of nTregs and to assess their therapeutic potential for modulating immune mediated disorders such as autoimmunity, allergy, and episodes of transplant rejection. In this review, we summarize the current knowledge on the biology of nTregs. We address the exact definition of nTregs by specific markers and combinations thereof, which is a prerequisite for the state-of-the-art isolation of defined nTreg populations. Furthermore, we discuss the mechanism by which nTregs mediate immunosuppression and how this knowledge might translate into novel therapeutic modalities. With first clinical studies of nTreg-based therapies being finished, questions concerning the reliable sources of nTregs are becoming more and more eminent. Consequently, approaches allowing conversion of CD4(+) T cells into nTregs by coculture with antigen-presenting cells, cytokines, and/or pharmacological agents are discussed. In addition, genetic engineering approaches for the generation of antigen-specific nTregs are described.

  20. The role of Fyn kinase in the release from metaphase in mammalian oocytes.

    PubMed

    Levi, M; Shalgi, R

    2010-01-27

    Meiosis in mammalian oocytes starts during embryonic life and arrests for the first time before birth, at prophase of the first meiotic division. The second meiotic arrest occurs after spindle formation at metaphase of the second meiotic division (MII) in selected oocytes designated for ovulation. The fertilizing spermatozoon induces the release from MII arrest only after the oocyte's spindle assembly checkpoint (SAC) was deactivated. Src family kinases (SFKs) are nine non-receptor protein tyrosine kinases that regulate many key cellular functions. Fyn is an SFK expressed in many cell types, including oocytes. Recent studies, including ours, imply a role for Fyn in exit from meiotic and mitotic metaphases. Other studies demonstrate that SFKs, particularly Fyn, are required for regulation of microtubules polymerization and spindle stabilization. Altogether, Fyn is suggested to play an essential role in signaling events that implicate SAC pathway and hence in regulating the exit from metaphase in oocytes and zygote. 2009 Elsevier Ireland Ltd. All rights reserved.

  1. The Kinase Fyn As a Novel Intermediate in L-DOPA-Induced Dyskinesia in Parkinson's Disease.

    PubMed

    Sanz-Blasco, Sara; Bordone, Melina P; Damianich, Ana; Gomez, Gimena; Bernardi, M Alejandra; Isaja, Luciana; Taravini, Irene R; Hanger, Diane P; Avale, M Elena; Gershanik, Oscar S; Ferrario, Juan E

    2017-08-24

    Dopamine replacement therapy with L-DOPA is the treatment of choice for Parkinson's disease; however, its long-term use is frequently associated with L-DOPA-induced dyskinesia (LID). Many molecules have been implicated in the development of LID, and several of these have been proposed as potential therapeutic targets. However, to date, none of these molecules have demonstrated full clinical efficacy, either because they lie downstream of dopaminergic signaling, or due to adverse side effects. Therefore, discovering new strategies to reduce LID in Parkinson's disease remains a major challenge. Here, we have explored the tyrosine kinase Fyn, as a novel intermediate molecule in the development of LID. Fyn, a member of the Src kinase family, is located in the postsynaptic density, where it regulates phosphorylation of the NR2B subunit of the N-methyl-D-aspartate (NMDA) receptor in response to dopamine D1 receptor stimulation. We have used Fyn knockout and wild-type mice, lesioned with 6-hydroxydopamine and chronically treated with L-DOPA, to investigate the role of Fyn in the induction of LID. We found that mice lacking Fyn displayed reduced LID, ΔFosB accumulation and NR2B phosphorylation compared to wild-type control mice. Pre-administration of saracatinib (AZD0530), an inhibitor of Fyn activity, also significantly reduced LID in dyskinetic wild-type mice. These results support that Fyn has a critical role in the molecular pathways affected during the development of LID and identify Fyn as a novel potential therapeutic target for the management of dyskinesia in Parkinson's disease.

  2. Dietary omega-3 deficiency reduces BDNF content and activation NMDA receptor and Fyn in dorsal hippocampus: implications on persistence of long-term memory in rats.

    PubMed

    Bach, Simone Azevedo; de Siqueira, Letícia V; Müller, Alexandre P; Oses, Jean P; Quatrim, Andreia; Emanuelli, Tatiana; Vinadé, Lúcia; Souza, Diogo O; Moreira, Júlia D

    2014-07-01

    Omega-3 (n-3) fatty acids are important for adequate brain function and cognition. The aim of the present study was to evaluate how n-3 fatty acids influence the persistence of long-term memory (LTM) in an aversive memory task and to explore the putative mechanism involved. Female rats received isocaloric diets that included n-3 (n-3 group) or not (D group). The adult litters were subjected to an inhibitory avoidance task (0.7 mA, 1.0 seconds foot shock) to elicit persistent LTM. Twelve hours after the training session, the fatty acid profile and the brain derived neurotrophic factor (BDNF) content of the dorsal hippocampus were assessed. In addition, we measured the activation of the NR2B subunit of the N-methyl-d-aspartate (NMDA) receptor and the SRC family protein Fyn. Despite pronounced learning in both groups, the persistence of LTM was abolished in the D group 7 days after the training session. We also observed that the D group presented reductions in hippocampal DHA (22:6 n-3) and BDNF content. Twelve hours after the training session, the D group showed decreased NR2B and Fyn phosphorylation in the dorsal hippocampus, with no change in the total content of these proteins. Further, there was a decrease in the interaction of Fyn with NR2B in the D group, as observed by co-immunoprecipitation. Taken together, these data suggest that n-3 fatty acids influence the persistence of LTM by maintaining adequate levels of DHA and BDNF as well as by influencing the activation of NR2B and Fyn during the period of memory formation.

  3. Fyn phosphorylates AMPK to inhibit AMPK activity and AMP-dependent activation of autophagy

    PubMed Central

    Yamada, Eijiro; Okada, Shuichi; Bastie, Claire C.; Vatish, Manu; Nakajima, Yasuyo; Shibusawa, Ryo; Ozawa, Atsushi; Pessin, Jeffrey E.; Yamada, Masanobu

    2016-01-01

    We previously demonstrated that proto-oncogene Fyn decreased energy expenditure and increased metabolic phenotypes. Also Fyn decreased autophagy-mediated muscle mass by directly inhibiting LKB1 and stimulating STAT3 activities, respectively. AMPK, a downstream target of LKB1, was recently identified as a key molecule controlling autophagy. Here we identified that Fyn phosphorylates the α subunit of AMPK on Y436 and inhibits AMPK enzymatic activity without altering the assembly state of the AMPK heterotrimeric complex. As pro-inflammatory mediators are reported modulators of the autophagy processes, treatment with the pro-inflammatory cytokine TNFα resulted in 1) increased Fyn activity 2) stimulated Fyn-dependent AMPKα tyrosine phosphorylation and 3) decreased AICAR-dependent AMPK activation. Importantly, TNFα induced inhibition of autophagy was not observed when AMPKα was mutated on Y436. 4) These data demonstrate that Fyn plays an important role in relaying the effects of TNFα on autophagy and apoptosis via phosphorylation and inhibition of AMPK. PMID:27626315

  4. Fyn Kinase Activity Is Required for Normal Organization and Functional Polarity of the Mouse Oocyte Cortex

    PubMed Central

    Luo, Jinping; Mcginnis, Lynda K.; Kinsey, William H.

    2014-01-01

    Summary The objective of the present study was to determine whether Fyn kinase participated in signaling events during sperm–egg interactions, sperm incorporation, and meiosis II. The functional requirement of Fyn kinase activity in these events was tested through the use of the protein kinase inhibitor SKI-606 (Bosutinib) and by analysis of Fyn-null oocytes. Suppression of Fyn kinase signaling prior to fertilization caused disruption of the functional polarity of the oocyte with the result that sperm were able to fuse with the oocyte in the immediate vicinity of the meiotic spindle, a region that normally does not allow sperm fusion. The loss of functional polarity was accompanied by disruption of the microvilli and cortical granule-free zone that normally overlie the meiotic spindle. Changes in the distribution of cortical granules and filamentous actin provided further evidence of disorganization of the oocyte cortex. Rho B, a molecular marker for oocyte polarity, was unaffected by suppression of Fyn activity; however, the polarized association of Par-3 with the cortex overlying the meiotic spindle was completely disrupted. The defects in oocyte polarity in Fyn-null oocytes correlated with a failure of the MII chromosomes to maintain a position close to the oocyte cortex which seemed to underlie the above defects in oocyte polarity. This was associated with a delay in completion of meiosis II, however, pronuclei eventually formed and subsequent mitotic cleavages and blastocyst formation occurred normally. PMID:19363790

  5. PSD-93 deletion inhibits Fyn-mediated phosphorylation of NR2B and protects against focal cerebral ischemia.

    PubMed

    Zhang, Meijuan; Li, Qingjie; Chen, Ling; Li, Jie; Zhang, Xin; Chen, Xiang; Zhang, Qingxiu; Shao, Yuan; Xu, Yun

    2014-08-01

    Modification of N-methyl-d-aspartate receptor (NMDAR)-mediated excitotoxicity appears to be a potential target in the treatment of ischemic stroke. Postsynaptic density protein-93 (PSD-93) specifically binds the C-terminal tails of the NMDAR, which is critical to couple NMDAR activity to specific intracellular signaling. This study is to investigate whether PSD-93 disruption displays neuroprotection in a focal ischemic stroke model of adult mice and, if it does, to explore possible mechanisms. It was found that, following middle cerebral artery occlusion (MCAO), PSD-93 knockout (KO) mice manifested significant reductions in infarcted volume, neurological deficits and number of degenerated neurons. PSD-93 deletion also reduced cultured cortical neuronal death caused by glucose and oxygen deprivation (OGD). Ischemic long term potentiation (i-LTP) could not be induced in the PSD-93 KO group and wild type (WT) groups pretreated with either AP-5 (NMDAR inhibitor) or PP2 (Src family inhibitor). PSD-93 KO decreased the phosphorylation of the NR2B at Tyr1472 and the interaction between NR2B and Fyn after MCAO. Together, our study demonstrated that PSD-93 KO confers profound neuroprotection against ischemic brain injury, which probably links to the inhibitory effect on Fyn-mediated phosphorylation of NR2B caused by PSD-93 deletion. These findings may provide a novel avenue for the treatment of ischemic stroke. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. Regulatory and pathogenic mechanisms in human autoimmune myasthenia gravis.

    PubMed

    Le Panse, Rozen; Cizeron-Clairac, Géraldine; Cuvelier, Mélinée; Truffault, Frédérique; Bismuth, Jacky; Nancy, Patrice; De Rosbo, Nicole Kerlero; Berrih-Aknin, Sonia

    2008-01-01

    The thymus is frequently hyperplastic in young female myasthenia gravis (MG) patients presenting with anti-acetylcholine receptor (AChR) antibodies. This thymic pathology is characterized by the presence of ectopic germinal centers (GCs) containing B cells involved at least partially in the production of pathogenic anti-AChR antibodies. Our recent studies have furthered our understanding of the mechanisms leading to GC formation in the hyperplastic thymus. First, we showed that CXCL13 and CCL21, chemokines involved in GC formation, are overexpressed in MG thymus. Second, we demonstrated an increase in pro-inflammatory activity in the thymus from MG patients and its partial normalization by glucocorticoids, as evidenced by gene expression profile. Third, we found that pro-inflammatory cytokines are able to upregulate the expression of AChR subunits in thymic epithelial and myoid cells. Fourth, we showed that the function of T regulatory (Treg) cells, whose role is to downregulate the immune response, is severely impaired in the thymus of MG patients; such a defect could explain the chronic immune activation observed consistently in MG thymic hyperplasia. Altogether, these new data suggest that CXCL13 and CCL21, which are produced in excess in MG thymus, attract peripheral B cells and activated T cells, which are maintained chronically activated in the inflammatory thymic environment because of the defect in suppressive activity of Treg cells. Presence of AChR in the thymus and upregulation of its expression by the pro-inflammatory environment contribute to the triggering and maintenance of the anti-AChR autoimmune response.

  7. The human disease network in terms of dysfunctional regulatory mechanisms.

    PubMed

    Yang, Jing; Wu, Su-Juan; Dai, Wen-Tao; Li, Yi-Xue; Li, Yuan-Yuan

    2015-10-08

    Elucidation of human disease similarities has emerged as an active research area, which is highly relevant to etiology, disease classification, and drug repositioning. In pioneer studies, disease similarity was commonly estimated according to clinical manifestation. Subsequently, scientists started to investigate disease similarity based on gene-phenotype knowledge, which were inevitably biased to well-studied diseases. In recent years, estimating disease similarity according to transcriptomic behavior significantly enhances the probability of finding novel disease relationships, while the currently available studies usually mine expression data through differential expression analysis that has been considered to have little chance of unraveling dysfunctional regulatory relationships, the causal pathogenesis of diseases. We developed a computational approach to measure human disease similarity based on expression data. Differential coexpression analysis, instead of differential expression analysis, was employed to calculate differential coexpression level of every gene for each disease, which was then summarized to the pathway level. Disease similarity was eventually calculated as the partial correlation coefficients of pathways' differential coexpression values between any two diseases. The significance of disease relationships were evaluated by permutation test. Based on mRNA expression data and a differential coexpression analysis based method, we built a human disease network involving 1326 significant Disease-Disease links among 108 diseases. Compared with disease relationships captured by differential expression analysis based method, our disease links shared known disease genes and drugs more significantly. Some novel disease relationships were discovered, for example, Obesity and cancer, Obesity and Psoriasis, lung adenocarcinoma and S. pneumonia, which had been commonly regarded as unrelated to each other, but recently found to share similar molecular

  8. Enhanced NMDA receptor tyrosine phosphorylation and increased brain injury following neonatal hypoxia–ischemia in mice with neuronal Fyn overexpression

    PubMed Central

    Knox, Renatta; Zhao, Chong; Miguel-Perez, Dario; Wang, Steven; Yuan, Jinwei; Ferriero, Donna; Jiang, Xiangning

    2013-01-01

    The Src family kinases (SFKs) Src and Fyn are implicated in hypoxic–ischemic (HI) injury in the developing brain. However, it is unclear how these particular SFKs contribute to brain injury. Using neuron-specific Fyn overexpressing (OE) mice, we investigated the role of neuronal Fyn in neonatal brain HI. Wild type (WT) and Fyn OE mice were subjected to HI using the Vannucci model at postnatal day 7. Brains were scored five days later for evaluation of damage using cresyl violet and iron staining. Western blotting with postsynaptic density (PSD)-associated synaptic membrane proteins and co-immunoprecipitation with cortical lysates were performed at various time points after HI to determine NMDA receptor tyrosine phosphorylation and Fyn kinase activity. Fyn OE mice had significantly higher mortality and brain injury compared to their WT littermates. Neuronal Fyn overexpression led to sustained NR2A and NR2B tyrosine phosphorylation and enhanced NR2B phosphorylation at tyrosine (Y) 1472 and Y1252 in synaptic membranes. These early changes correlated with higher calpain activity 24 h after HI in Fyn OE mice relative to WT animals. Our findings suggest a role for Fyn kinase in neuronal death after neonatal HI, possibly via up-regulation of NMDA receptor tyrosine phosphorylation. PMID:23127881

  9. Symbiotic Nitrogen Fixation in Legume Nodules: Metabolism and Regulatory Mechanisms

    PubMed Central

    Sulieman, Saad; Tran, Lam-Son Phan

    2014-01-01

    The special issue “Symbiotic Nitrogen Fixation in Legume Nodules: Metabolism and Regulatory Mechanisms” aims to investigate the physiological and biochemical advances in the symbiotic process with an emphasis on nodule establishment, development and functioning. The original research articles included in this issue provide important information regarding novel aspects of nodule metabolism and various regulatory pathways, which could have important future implications. This issue also included one review article that highlights the importance of using legume trees in the production of renewable biofuels. PMID:25347276

  10. Fyn Inhibition Rescues Established Memory and Synapse Loss in Alzheimer Mice

    PubMed Central

    Kaufman, Adam C.; Salazar, Santiago V.; Haas, Laura T.; Yang, Jinhee; Kostylev, Mikhail A.; Jeng, Amanda T.; Robinson, Sophie A.; Gunther, Erik C.; van Dyck, Christopher H.; Nygaard, Haakon B.; Strittmatter, Stephen M.

    2015-01-01

    Objective Currently no effective disease modifying agents exist for the treatment of AD. The Fyn tyrosine kinase is implicated in Alzheimer’s disease (AD) pathology triggered by amyloid-β oligomers (Aβo) and propagated by Tau. Thus, Fyn inhibition may prevent or delay disease progression. Here, we sought to repurpose the Src family kinase inhibitor oncology compound, AZD0530, for AD. Methods The pharmacokinetics and distribution of AZD0530 were evaluated in mice. Inhibition of Aβo signaling to Fyn, Pyk2 and Glu receptors by AZD0530 was tested by brain slice assays. After AZD0530 or vehicle treatment of wild type and AD transgenic mice, memory was assessed by Morris water maze and novel object recognition. For these cohorts, APP metabolism, synaptic markers (SV2 and PSD-95), and targets of Fyn (Pyk2 and Tau) were studied by immunohistochemistry and by immunoblotting. Results AZD0530 potently inhibits Fyn and prevents both Aβo-induced Fyn signaling and downstream phosphorylation of the AD risk gene product, Pyk2, and of NR2B Glu receptors in brain slices. After 4 weeks of treatment, AZD0530 dosing of APP/PS1 transgenic mice fully rescues spatial memory deficits and synaptic depletion, without altering APP or Aβ metabolism. AZD0530 treatment also reduces microglial activation in APP/PS1 mice, and rescues Tau phosphorylation and deposition abnormalities in APP/PS1/Tau transgenic mice. There is no evidence of AZD0530 chronic toxicity. Interpretation Targeting Fyn can reverse memory deficits found in AD mouse models, and rescue synapse density loss characteristic of the disease. Thus, AZD0530 is a promising candidate to test as a potential therapy for AD. PMID:25707991

  11. The Cellular and Molecular Mechanisms of Immuno-Suppression by Human Type 1 Regulatory T Cells

    PubMed Central

    Gregori, Silvia; Goudy, Kevin S.; Roncarolo, Maria Grazia

    2011-01-01

    The immuno-regulatory mechanisms of IL-10-producing type 1 regulatory T (Tr1) cells have been widely studied over the years. However, several recent discoveries have shed new light on the cellular and molecular mechanisms that human Tr1 cells use to control immune responses and induce tolerance. In this review we outline the well known and newly discovered regulatory properties of human Tr1 cells and provide an in-depth comparison of the known suppressor mechanisms of Tr1 cells with FOXP3+ Treg. We also highlight the role that Tr1 cells play in promoting and maintaining tolerance in autoimmunity, allergy, and transplantation. PMID:22566914

  12. Role of Fyn-mediated NMDA receptor function in prediabetic neuropathy in mice.

    PubMed

    Suo, Meng; Wang, Ping; Zhang, Mengyuan

    2016-08-01

    Diabetic neuropathy is a common complication of diabetes. This study evaluated the role of Fyn kinase and N-methyl-d-aspartate receptors (NMDARs) in the spinal cord in diabetic neuropathy using an animal model of high-fat diet-induced prediabetes. We found that prediabetic wild-type mice exhibited tactile allodynia and thermal hypoalgesia after a 16-wk high-fat diet, relative to normal diet-fed wild-type mice. Furthermore, prediabetic wild-type mice exhibited increased tactile allodynia and thermal hypoalgesia at 24 wk relative to 16 wk. Such phenomena were correlated with increased expression and activation of NR2B subunit of NMDARs, as well as Fyn-NR2B interaction in the spinal cord. Fyn(-/-) mice developed prediabetes after 16-wk high-fat diet treatment and exhibited thermal hypoalgesia, without showing tactile allodynia or altered expression and activation of NR2B subunit, relative to normal diet-fed Fyn(-/-) mice. Finally, intrathecal administrations of Ro 25-6981 (selective NR2B subunit-containing NMDAR antagonist) dose-dependently alleviated tactile allodynia, but not thermal hypoalgesia, at 16 and 24 wk in prediabetic wild-type mice. Our results suggested that Fyn-mediated NR2B signaling plays a critical role in regulation of prediabetic neuropathy and that the increased expression/function of NR2B subunit-containing NMDARs may contribute to the progression of neuropathy in type 2 diabetes. Copyright © 2016 the American Physiological Society.

  13. Regulatory Mechanisms Controlling Maturation of Serotonin Neuron Identity and Function.

    PubMed

    Spencer, William C; Deneris, Evan S

    2017-01-01

    The brain serotonin (5-hydroxytryptamine; 5-HT) system has been extensively studied for its role in normal physiology and behavior, as well as, neuropsychiatric disorders. The broad influence of 5-HT on brain function, is in part due to the vast connectivity pattern of 5-HT-producing neurons throughout the CNS. 5-HT neurons are born and terminally specified midway through embryogenesis, then enter a protracted period of maturation, where they functionally integrate into CNS circuitry and then are maintained throughout life. The transcriptional regulatory networks controlling progenitor cell generation and terminal specification of 5-HT neurons are relatively well-understood, yet the factors controlling 5-HT neuron maturation are only recently coming to light. In this review, we first provide an update on the regulatory network controlling 5-HT neuron development, then delve deeper into the properties and regulatory strategies governing 5-HT neuron maturation. In particular, we discuss the role of the 5-HT neuron terminal selector transcription factor (TF) Pet-1 as a key regulator of 5-HT neuron maturation. Pet-1 was originally shown to positively regulate genes needed for 5-HT synthesis, reuptake and vesicular transport, hence 5-HT neuron-type transmitter identity. It has now been shown to regulate, both positively and negatively, many other categories of genes in 5-HT neurons including ion channels, GPCRs, transporters, neuropeptides, and other transcription factors. Its function as a terminal selector results in the maturation of 5-HT neuron excitability, firing characteristics, and synaptic modulation by several neurotransmitters. Furthermore, there is a temporal requirement for Pet-1 in the control of postmitotic gene expression trajectories thus indicating a direct role in 5-HT neuron maturation. Proper regulation of the maturation of cellular identity is critical for normal neuronal functioning and perturbations in the gene regulatory networks controlling

  14. Fyn kinase genetic ablation causes structural abnormalities in mature retina and defective Müller cell function.

    PubMed

    Chavez-Solano, Marbella; Ibarra-Sanchez, Alfredo; Treviño, Mario; Gonzalez-Espinosa, Claudia; Lamas, Monica

    2016-04-01

    Fyn kinase is widely expressed in neuronal and glial cells of the brain, where it exerts multiple functional roles that affect fundamental physiological processes. The aim of our study was to investigate the, so far unknown, functional role of Fyn in the retina. We report that Fyn is expressed, in vivo, in a subpopulation of Müller glia. We used a mouse model of Fyn genetic ablation and Müller-enriched primary cultures to demonstrate that Fyn deficiency induces morphological alterations in the mature retina, a reduction in the thickness of the outer and inner nuclear layers and alterations in postnatal Müller cell physiology. These include shortening of Müller cell processes, a decrease in cell proliferation, inactivation of the Akt signal transduction pathway, a reduced number of focal adhesions points and decreased adhesion of these cells to the ECM. As abnormalities in Müller cell physiology have been previously associated to a compromised retinal function we evaluated behavioral responses to visual stimulation. Our results associate Fyn deficiency with impaired visual optokinetic responses under scotopic and photopic light conditions. Our study reveals novel roles for Fyn kinase in retinal morphology and Müller cell physiology and suggests that Fyn is required for optimal visual processing. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. Characterization and merger of oscillatory mechanisms in an artificial genetic regulatory network

    NASA Astrophysics Data System (ADS)

    Yang, D.; Li, Y.; Kuznetsov, A.

    2009-09-01

    Regulatory molecular networks have numerous pharmacological and medical applications. The oscillatory mechanisms and the role of oscillations in these regulatory networks are not fully understood. In this paper, we explore two oscillatory mechanisms: the hysteresis-based relaxation oscillator and the repressilator. We combine these mechanisms into one regulatory network so that only two parameters, the strength of an additional regulatory connection and the timescale separation for one of the variables, control the transition from one mechanism to the other. Our data support a qualitative difference between the oscillatory mechanisms, but in the parameter space, we found a single oscillatory region, suggesting that the two mechanisms support each other. We examine interactions in a basic population: that is, a pair of the composite oscillators. We found that the relaxation oscillation mechanism is much more resistant to oscillatory death as the cells are diffusively coupled in a population. Additionally, stationary pattern formation has been found to accompany the relaxation oscillation but not the repressilator mechanism. These properties may guide the identification of oscillatory mechanisms in complex natural regulatory networks.

  16. Mechanisms of Regulatory B cell Function in Autoimmune and Inflammatory Diseases beyond IL-10

    PubMed Central

    Ray, Avijit; Dittel, Bonnie N.

    2017-01-01

    In the past two decades it has become clear that in addition to antigen presentation and antibody production B cells play prominent roles in immune regulation. While B cell-derived IL-10 has garnered much attention, B cells also effectively regulate inflammation by a variety of IL-10-independent mechanisms. B cell regulation has been studied in both autoimmune and inflammatory diseases. While collectively called regulatory B cells (Breg), no definitive phenotype has emerged for B cells with regulatory potential. This has made their study challenging and thus unique B cell regulatory mechanisms have emerged in a disease-dependent manner. Thus to harness the therapeutic potential of Breg, further studies are needed to understand how they emerge and are induced to evoke their regulatory activities. PMID:28124981

  17. Modeling Transport and Flow Regulatory Mechanisms of the Kidney

    PubMed Central

    Layton, Anita T.

    2013-01-01

    The kidney plays an indispensable role in the regulation of whole-organism water balance, electrolyte balance, and acid-base balance, and in the excretion of metabolic wastes and toxins. In this paper, we review representative mathematical models that have been developed to better understand kidney physiology and pathophysiology, including the regulation of glomerular filtration, the regulation of renal blood flow by means of the tubuloglomerular feedback mechanisms and of the myogenic mechanism, the urine concentrating mechanism, and regulation of renal oxygen transport. We discuss how such modeling efforts have significantly expanded our understanding of renal function in both health and disease. PMID:23914303

  18. Structural imprints in vivo decode RNA regulatory mechanisms

    NASA Astrophysics Data System (ADS)

    Spitale, Robert C.; Flynn, Ryan A.; Zhang, Qiangfeng Cliff; Crisalli, Pete; Lee, Byron; Jung, Jong-Wha; Kuchelmeister, Hannes Y.; Batista, Pedro J.; Torre, Eduardo A.; Kool, Eric T.; Chang, Howard Y.

    2015-03-01

    Visualizing the physical basis for molecular behaviour inside living cells is a great challenge for biology. RNAs are central to biological regulation, and the ability of RNA to adopt specific structures intimately controls every step of the gene expression program. However, our understanding of physiological RNA structures is limited; current in vivo RNA structure profiles include only two of the four nucleotides that make up RNA. Here we present a novel biochemical approach, in vivo click selective 2'-hydroxyl acylation and profiling experiment (icSHAPE), which enables the first global view, to our knowledge, of RNA secondary structures in living cells for all four bases. icSHAPE of the mouse embryonic stem cell transcriptome versus purified RNA folded in vitro shows that the structural dynamics of RNA in the cellular environment distinguish different classes of RNAs and regulatory elements. Structural signatures at translational start sites and ribosome pause sites are conserved from in vitro conditions, suggesting that these RNA elements are programmed by sequence. In contrast, focal structural rearrangements in vivo reveal precise interfaces of RNA with RNA-binding proteins or RNA-modification sites that are consistent with atomic-resolution structural data. Such dynamic structural footprints enable accurate prediction of RNA-protein interactions and N6-methyladenosine (m6A) modification genome wide. These results open the door for structural genomics of RNA in living cells and reveal key physiological structures controlling gene expression.

  19. A Pyrazolo[3,4-d]pyrimidine compound inhibits Fyn phosphorylation and induces apoptosis in natural killer cell leukemia

    PubMed Central

    Laurenzana, Ilaria; Caivano, Antonella; Trino, Stefania; De Luca, Luciana; Rocca, Francesco La; Simeon, Vittorio; Tintori, Cristina; D'Alessio, Francesca; Teramo, Antonella; Zambello, Renato; Traficante, Antonio; Maietti, Maddalena; Semenzato, Gianpietro; Schenone, Silvia; Botta, Maurizio

    2016-01-01

    Natural killer (NK) cell neoplasms are characterized by clonal proliferation of cytotoxic NK cells. Since there is no standard treatment to date, new therapeutic options are needed, especially for NK aggressive tumors. Fyn tyrosine kinase has a key role in different biological processes, such as cell growth and differentiation, being also involved in the pathogenesis of hematologic malignancies. Our previous studies led us to identify 4c pyrazolo[3,4-d]pyrimidine compound capable of inhibiting Fyn activation and inducing apoptosis in different cancer cell lines. Here we investigated the presence of Fyn and the effect of its inhibitor in NK malignant cells. Firstly, we showed Fyn over-expression in NK leukemic cells compared to peripheral blood mononuclear cells from healthy donors. Subsequently, we demonstrated that 4c treatment reduced cell viability, induced caspase 3-mediate apoptosis and cell cycle arrest in NK cells. Moreover, by inhibiting Fyn phosphorylation, 4c compound reduced Akt and P70 S6 kinase activation and changed the expression of genes involved in cell death and survival in NK cells. Our study demonstrated that Fyn is involved in the pathogenesis of NK leukemia and that it could represent a potential target for this neoplasm. Moreover, we proved that Fyn inhibitor pyrazolo[3,4-d]pyrimidine compound, could be a started point to develop new therapeutic agents. PMID:27566560

  20. Potential self-regulatory mechanisms of yoga for psychological health

    PubMed Central

    Gard, Tim; Noggle, Jessica J.; Park, Crystal L.; Vago, David R.; Wilson, Angela

    2014-01-01

    Research suggesting the beneficial effects of yoga on myriad aspects of psychological health has proliferated in recent years, yet there is currently no overarching framework by which to understand yoga’s potential beneficial effects. Here we provide a theoretical framework and systems-based network model of yoga that focuses on integration of top-down and bottom-up forms of self-regulation. We begin by contextualizing yoga in historical and contemporary settings, and then detail how specific components of yoga practice may affect cognitive, emotional, behavioral, and autonomic output under stress through an emphasis on interoception and bottom-up input, resulting in physical and psychological health. The model describes yoga practice as a comprehensive skillset of synergistic process tools that facilitate bidirectional feedback and integration between high- and low-level brain networks, and afferent and re-afferent input from interoceptive processes (somatosensory, viscerosensory, chemosensory). From a predictive coding perspective we propose a shift to perceptual inference for stress modulation and optimal self-regulation. We describe how the processes that sub-serve self-regulation become more automatized and efficient over time and practice, requiring less effort to initiate when necessary and terminate more rapidly when no longer needed. To support our proposed model, we present the available evidence for yoga affecting self-regulatory pathways, integrating existing constructs from behavior theory and cognitive neuroscience with emerging yoga and meditation research. This paper is intended to guide future basic and clinical research, specifically targeting areas of development in the treatment of stress-mediated psychological disorders. PMID:25368562

  1. Biochemical Features and Functional Implications of the RNA-Based T-Box Regulatory Mechanism

    PubMed Central

    Gutiérrez-Preciado, Ana; Henkin, Tina M.; Grundy, Frank J.; Yanofsky, Charles; Merino, Enrique

    2009-01-01

    Summary: The T-box mechanism is a common regulatory strategy used for modulating the expression of genes of amino acid metabolism-related operons in gram-positive bacteria, especially members of the Firmicutes. T-box regulation is usually based on a transcription attenuation mechanism in which an interaction between a specific uncharged tRNA and the 5′ region of the transcript stabilizes an antiterminator structure in preference to a terminator structure, thereby preventing transcription termination. Although single T-box regulatory elements are common, double or triple T-box arrangements are also observed, expanding the regulatory range of these elements. In the present study, we predict the functional implications of T-box regulation in genes encoding aminoacyl-tRNA synthetases, proteins of amino acid biosynthetic pathways, transporters, and regulatory proteins. We also consider the global impact of the use of this regulatory mechanism on cell physiology. Novel biochemical relationships between regulated genes and their corresponding metabolic pathways were revealed. Some of the genes identified, such as the quorum-sensing gene luxS, in members of the Lactobacillaceae were not previously predicted to be regulated by the T-box mechanism. Our analyses also predict an imbalance in tRNA sensing during the regulation of operons containing multiple aminoacyl-tRNA synthetase genes or biosynthetic genes involved in pathways common to more than one amino acid. Based on the distribution of T-box regulatory elements, we propose that this regulatory mechanism originated in a common ancestor of members of the Firmicutes, Chloroflexi, Deinococcus-Thermus group, and Actinobacteria and was transferred into the Deltaproteobacteria by horizontal gene transfer. PMID:19258532

  2. Arrestin-3 is essential for the activation of Fyn by the luteinizing hormone receptor (LHR) in MA-10 cells*

    PubMed Central

    Galet, Colette; Ascoli, Mario

    2008-01-01

    Recent studies showed that Fyn is a mediator of the LHR-induced activation of the ERK1/2 cascade in MA-10 cells. Since the LHR is a G protein-coupled receptor and the Src family of kinases can be activated by some Gα subunits and by the non-visual arrestins we investigated the role of these signaling molecules in the LHR-provoked activation of Fyn. Small interfering RNAs (siRNAs) that target two Gα subunits that participate in LHR signaling (Gαs and Gα11) and one that targets arrestin-3 were co-transfected with the hLHR in MA-10 cells. We then determined the effects of these siRNAs on the LHR-provoked activation of Fyn, the phosphorylation of FAK (a prominent Fyn substrate) and the release of EGF-like growth factors (a Fyn-mediated process). Expression of the siRNA against Gαs decreased the level of Gαs and LHR-stimulated cAMP production by ~50% but did not affect LHR-stimulated Fyn activation or FAK phosphorylation. Likewise, expression of the siRNA against Gα11 decreased the level of Gα11 and LHR-stimulated inositol phosphate production by ~50% but did not affect LHR-stimulated Fyn activation or FAK phosphorylation. Expression of the siRNA against arrestin-3 decreased the level of arrestin-3 and the rate of internalization of hCG by ~50% and it also inhibited the LHR-provoked stimulation of Fyn, the phosphorylation of FAK and the release of EGF-like growth factors. These results show that, in MA-10 cells, the hLHR activates Fyn through and arrestin-3-dependent pathway and that this pathway is a mediator of the hLHR-provoked release of EGF-like growth factors. PMID:18647647

  3. Translational regulatory mechanisms in persistent forms of synaptic plasticity.

    PubMed

    Kelleher, Raymond J; Govindarajan, Arvind; Tonegawa, Susumu

    2004-09-30

    Memory and synaptic plasticity exhibit distinct temporal phases, with long-lasting forms distinguished by their dependence on macromolecular synthesis. Prevailing models for the molecular mechanisms underlying long-lasting synaptic plasticity have largely focused on transcriptional regulation. However, a growing body of evidence now supports a crucial role for neuronal activity-dependent mRNA translation, which may occur in dendrites for a subset of neuronal mRNAs. Recent work has begun to define the signaling mechanisms coupling synaptic activation to the protein synthesis machinery. The ERK and mTOR signaling pathways have been shown to regulate the activity of the general translational machinery, while the translation of particular classes of mRNAs is additionally controlled by gene-specific mechanisms. Rapid enhancement of the synthesis of a diverse array of neuronal proteins through such mechanisms provides the components necessary for persistent forms of LTP and LTD. These findings have important implications for the synapse specificity and associativity of protein synthesis-dependent changes in synaptic strength.

  4. Fyn-phosphorylated PIKE-A binds and inhibits AMPK signaling, blocking its tumor suppressive activity.

    PubMed

    Zhang, S; Qi, Q; Chan, C B; Zhou, W; Chen, J; Luo, H R; Appin, C; Brat, D J; Ye, K

    2016-01-01

    The AMP-activated protein kinase, a key regulator of energy homeostasis, has a critical role in metabolic disorders and cancers. AMPK is mainly regulated by cellular AMP and phosphorylation by upstream kinases. Here, we show that PIKE-A binds to AMPK and blocks its tumor suppressive actions, which are mediated by tyrosine kinase Fyn. PIKE-A directly interacts with AMPK catalytic alpha subunit and impairs T172 phosphorylation, leading to repression of its kinase activity on the downstream targets. Mutation of Fyn phosphorylation sites on PIKE-A, depletion of Fyn, or pharmacological inhibition of Fyn blunts the association between PIKE-A and AMPK, resulting in loss of its inhibitory effect on AMPK. Cell proliferation and oncogenic assays demonstrate that PIKE-A antagonizes tumor suppressive actions of AMPK. In human glioblastoma samples, PIKE-A expression inversely correlates with the p-AMPK levels, supporting that PIKE-A negatively regulates AMPK activity in cancers. Thus, our findings provide additional layer of molecular regulation of the AMPK signaling pathway in cancer progression.

  5. Epigallocatechin gallate, a green tea polyphenol, mediates NO-dependent vasodilation using signaling pathways in vascular endothelium requiring reactive oxygen species and Fyn.

    PubMed

    Kim, Jeong-A; Formoso, Gloria; Li, Yunhua; Potenza, Maria A; Marasciulo, Flora L; Montagnani, Monica; Quon, Michael J

    2007-05-04

    Green tea consumption is associated with reduced cardiovascular mortality in some epidemiological studies. Epigallocatechin gallate (EGCG), a bioactive polyphenol in green tea, mimics metabolic actions of insulin to inhibit gluconeogenesis in hepatocytes. Because signaling pathways regulating metabolic and vasodilator actions of insulin are shared in common, we hypothesized that EGCG may also have vasodilator actions to stimulate production of nitric oxide (NO) from endothelial cells. Acute intra-arterial administration of EGCG to mesenteric vascular beds isolated ex vivo from WKY rats caused dose-dependent vasorelaxation. This was inhibitable by L-NAME (NO synthase inhibitor), wortmannin (phosphatidylinositol 3-kinase inhibitor), or PP2 (Src family kinase inhibitor). Treatment of bovine aortic endothelial cells (BAEC) with EGCG (50 microm) acutely stimulated production of NO (assessed with NO-specific fluorescent dye DAF-2) that was inhibitable by l-NAME, wortmannin, or PP2. Stimulation of BAEC with EGCG also resulted in dose- and time-dependent phosphorylation of eNOS that was inhibitable by wortmannin or PP2 (but not by MEK inhibitor PD98059). Specific knockdown of Fyn (but not Src) with small interfering RNA inhibited both EGCG-stimulated phosphorylation of Akt and eNOS as well as production of NO in BAEC. Treatment of BAEC with EGCG generated intracellular H(2)O(2) (assessed with H(2)O(2)-specific fluorescent dye CM-H(2)DCF-DA), whereas treatment with N-acetylcysteine inhibited EGCG-stimulated phosphorylation of Fyn, Akt, and eNOS. We conclude that EGCG has endothelial-dependent vasodilator actions mediated by intracellular signaling pathways requiring reactive oxygen species and Fyn that lead to activation of phosphatidylinositol 3-kinase, Akt, and eNOS. This mechanism may explain, in part, beneficial vascular and metabolic health effects of green tea consumption.

  6. Arsenic interferes with the signaling transduction pathway of T cell receptor activation by increasing basal and induced phosphorylation of Lck and Fyn in spleen cells

    SciTech Connect

    Soto-Pena, Gerson A.; Vega, Libia

    2008-07-15

    Arsenic is known to produce inhibition as well as induction of immune cells proliferative responses depending on the doses as one of its mechanisms of immunotoxicity. Here we evaluate the effect of arsenic exposure on the activation of splenic mononuclear cells (SMC) in male CD57BL6N mice. Intra-gastric exposure to arsenic (as sodium arsenite) for 30 days (1, 0.1, or 0.01 mg/kg/day), reduced the proportion of CD4+ cells and the CD4+/CD8+ ratio in the spleen, increasing the proportion of CD11b+ cells. Arsenic exposure did not modify the proportion of B cells. SMC showed an increased level of phosphorylation of lck and fyn kinases (first kinases associated to TCR complex when activated). Although normal levels of apoptosis were observed on freshly isolated SMC, an increase in apoptotic cells related with the increase in phosphorylation of lck and fyn was observed when SMC were activated with Concanavalin-A (Con-A). Arsenic exposure reduced the proliferative response of SMC to Con-A, and also reduced secretion of IL-2, IL-6, IL-12 and IFN{gamma}. No effect was observed on IL-4, and IL-10 secretion. The same effects were observed when SMC of exposed animals were activated with anti-CD3/CD28 antibodies for 24 h, but these effects were transitory since a recovery, up to control levels or even higher, were observed after 72 h of stimulation. This study demonstrates that repeated and prolonged exposure to arsenic alters cell populations and produces functional changes depending on the specific activation pathway, and could be related with the phosphorylation status of lck and fyn kinases.

  7. Regulatory mechanisms for specification and patterning of plant vascular tissues.

    PubMed

    Caño-Delgado, Ana; Lee, Ji-Young; Demura, Taku

    2010-01-01

    Plant vascular tissues, the conduits of water, nutrients, and small molecules, play important roles in plant growth and development. Vascular tissues have allowed plants to successfully adapt to various environmental conditions since they evolved 450 Mya. The majority of plant biomass, an important source of renewable energy, comes from the xylem of the vascular tissues. Efforts have been made to identify the underlying mechanisms of cell specification and patterning of plant vascular tissues and their proliferation. The formation of the plant vascular system is a complex process that integrates signaling and gene regulation at transcriptional and posttranscriptional levels. Recently, a wealth of molecular genetic studies and the advent of cell biology and genomic tools have enabled important progress toward understanding its underlying mechanisms. Here, we provide a comprehensive review of the cell and developmental processes of plant vascular tissue and resources recently available for studying them that will enable the discovery of new ways to develop sustainable energy using plant biomass.

  8. Sociocognitive self-regulatory mechanisms governing judgments of the acceptability and likelihood of sport cheating.

    PubMed

    d'Arripe-Longueville, Fabienne; Corrion, Karine; Scoffier, Stéphanie; Roussel, Peggy; Chalabaev, Aïna

    2010-10-01

    This study extends previous psychosocial literature (Bandura et al., 2001, 2003) by examining a structural model of the self-regulatory mechanisms governing the acceptability and likelihood of cheating in a sport context. Male and female adolescents (N = 804), aged 15-20 years, took part in this study. Negative affective self-regulatory efficacy influenced the acceptability and likelihood of cheating through the mediating role of moral disengagement, in females and males. Affective efficacy positively influenced prosocial behavior through moral disengagement or through resistive self-regulatory efficacy and social efficacy, in both groups. The direct effects of affective efficacy on beliefs about cheating were only evident in females. These results extend the findings of Bandura et al. (2001, 2003) to the sport context and suggest that affective and resistive self-regulatory efficacy operate in concert in governing adolescents' moral disengagement and transgressive behaviors in sport.

  9. The prion protein constitutively controls neuronal store-operated Ca(2+) entry through Fyn kinase.

    PubMed

    De Mario, Agnese; Castellani, Angela; Peggion, Caterina; Massimino, Maria Lina; Lim, Dmitry; Hill, Andrew F; Sorgato, M Catia; Bertoli, Alessandro

    2015-01-01

    The prion protein (PrP(C)) is a cell surface glycoprotein mainly expressed in neurons, whose misfolded isoforms generate the prion responsible for incurable neurodegenerative disorders. Whereas PrP(C) involvement in prion propagation is well established, PrP(C) physiological function is still enigmatic despite suggestions that it could act in cell signal transduction by modulating phosphorylation cascades and Ca(2+) homeostasis. Because PrP(C) binds neurotoxic protein aggregates with high-affinity, it has also been proposed that PrP(C) acts as receptor for amyloid-β (Aβ) oligomers associated with Alzheimer's disease (AD), and that PrP(C)-Aβ binding mediates AD-related synaptic dysfunctions following activation of the tyrosine kinase Fyn. Here, use of gene-encoded Ca(2+) probes targeting different cell domains in primary cerebellar granule neurons (CGN) expressing, or not, PrP(C), allowed us to investigate whether PrP(C) regulates store-operated Ca(2+) entry (SOCE) and the implication of Fyn in this control. Our findings show that PrP(C) attenuates SOCE, and Ca(2+) accumulation in the cytosol and mitochondria, by constitutively restraining Fyn activation and tyrosine phosphorylation of STIM1, a key molecular component of SOCE. This data establishes the existence of a PrP(C)-Fyn-SOCE triad in neurons. We also demonstrate that treating cerebellar granule and cortical neurons with soluble Aβ(1-42) oligomers abrogates the control of PrP(C) over Fyn and SOCE, suggesting a PrP(C)-dependent mechanizm for Aβ-induced neuronal Ca(2+) dyshomeostasis.

  10. Calcium-regulatory mechanisms. Functional classification using skinned fibers

    PubMed Central

    1981-01-01

    The primary purpose of this study was to determine whether various agents (adenosine 3-thiotriphosphate [ATP gamma S], trifluoperazine [TFP], troponin I, the catalytic subunit of the cyclic adenosine 3',5'- monophosphate dependent protein kinase [C-subunit], and calmodulin [CaM]) could be used to classify skinned fiber types, and then to determine whether the proposed mechanisms for Ca2+ regulation were consistent with the results. Agents (ATP gamma S, TFP, C-subunit, CaM) expected to alter a light chain kinase-phosphatase system strongly affect the Ca2+-activated tension in skinned gizzard smooth muscle fibers, whereas these agents have no effect on skinned mammalian striated and scallop adductor fibers. Troponin I, which is known to bind strongly to troponin C and CaM, inhibits Ca2+ activation of skinned mammalian striated and gizzard fibers but not scallop adductor muscle. The results in different types of skinned fibers are consistent with proposed mechanisms for Ca2+ regulation. PMID:6267161

  11. Regulatory mechanisms of hemoglobin oxygen affinity in acidosis and alkalosis

    PubMed Central

    Bellingham, A. J.; Detter, J. C.; Lenfant, C.

    1971-01-01

    The recent reports of the effect of 2,3-diphosphoglycerate (2,3-DPG) on hemoglobin affinity for oxygen suggested that this substance may play a role in man's adaptation to acidosis and alkalosis. A study of the effect of induced acidosis and alkalosis on the oxyhemoglobin dissociation curve of normal man was therefore carried out, and the mechanisms involved in the physiological regulation of hemoglobin oxygen affinity examined. In acute changes of plasma pH there was no alteration in red cell 2,3-DPG content. However, there were changes in hemoglobin oxygen affinity and these correlated with changes in mean corpuscular hemoglobin concentration (MCHC). With maintained acidosis and alkalosis, red cell 2,3-DPG content was altered and correlated with the changes in hemoglobin oxygen affinity. Both of these mechanisms shift the hemoglobin oxygen dissociation curve opposite to the direct pH (Bohr) effect, and providing the rate of pH change is neither too rapid nor too large, they counteract the direct pH effect and the in vivo hemoglobin oxygen affinity remains unchanged. It is also shown that approximately 35% of the change in hemoglobin oxygen affinity resulting from an alteration in red cell 2,3-DPG, is explained by effect of 2,3-DPG on the red cell pH. PMID:5545127

  12. Silver Nanoparticles Disrupt GDNF/Fyn kinase Signaling in Spermatogonial Stem Cells

    PubMed Central

    Braydich-Stolle, Laura K.; Lucas, Benjamin; Schrand, Amanda; Murdock, Richard C.; Lee, Timothy; Schlager, John J.; Hussain, Saber M.; Hofmann, Marie-Claude

    2010-01-01

    Silver nanoparticles (Ag-NPs) are being utilized in an increasing number of fields and are components of antibacterial coatings, antistatic materials, superconductors, and biosensors. A number of reports have now described the toxic effects of silver nanoparticles on somatic cells; however, no study has examined their effects on the germ line at the molecular level. Spermatogenesis is a complex biological process that is particularly sensitive to environmental insults. Many chemicals, including ultrafine particles, have a negative effect on the germ line, either by directly affecting the germ cells or by indirectly acting on the somatic cells of the testis. In the present study, we have assessed the impact of different doses of Ag-NPs, as well as their size and biocompatible coating, on the proliferation of mouse spermatogonial stem cells (SSCs), which are at the origin of the germ line in the adult testis. At concentrations ≥ 10 μg/ml, Ag-NPs induced a significant decline in SSCs proliferation, which was also dependent on their size and coating. At the concentration of 10 μg/ml, reactive oxygen species production and/or apoptosis did not seem to play a major role; therefore, we explored other mechanisms to explain the decrease in cell proliferation. Because glial cell line–derived neurotrophic factor (GDNF) is vital for SSC self-renewal in vitro and in vivo, we evaluated the effects of Ag-NPs on GDNF-mediated signaling in these cells. Although the nanoparticles did not reduce GDNF binding or Ret receptor activity, our data revealed that already at a concentration of 10 μg/ml, silver nanoparticles specifically interact with Fyn kinase downstream of Ret and impair SSC proliferation in vitro. In addition, we demonstrated that the particle coating was degraded upon interaction with the intracellular microenvironment, reducing biocompatibility. PMID:20488942

  13. Ser/Thr phosphorylation as a regulatory mechanism in bacteria.

    PubMed

    Dworkin, Jonathan

    2015-04-01

    This review will discuss some recent work describing the role of Ser/Thr phosphorylation as a post-translational mechanism of regulation in bacteria. I will discuss the interaction between bacterial eukaryotic-like Ser/Thr kinases (eSTKs) and two-component systems as well as hints as to physiological function of eSTKs and their cognate eukaryotic-like phosphatases (eSTPs). In particular, I will highlight the role of eSTKs and eSTPs in the regulation of peptidoglycan metabolism and protein synthesis. In addition, I will discuss how data from phosphoproteomic surveys suggest that Ser/Thr phosphorylation plays a much more significant physiological role than would be predicted simply based on in vivo and in vitro analyses of individual kinases.

  14. Gap junction-mediated electrical transmission: regulatory mechanisms and plasticity

    PubMed Central

    Pereda, Alberto E.; Curti, Sebastian; Hoge, Gregory; Cachope, Roger; Flores, Carmen E.; Rash, John E.

    2012-01-01

    The term synapse applies to cellular specializations that articulate the processing of information within neural circuits by providing a mechanism for the transfer of information between two different neurons. There are two main modalities of synaptic transmission: chemical and electrical. While most efforts have been dedicated to the understanding of the properties and modifiability of chemical transmission, less is still known regarding the plastic properties of electrical synapses, whose structural correlate is the gap junction. A wealth of data indicates that, rather than passive intercellular channels, electrical synapses are more dynamic and modifiable than was generally perceived. This article will discuss the factors determining the strength of electrical transmission and review current evidence demonstrating its dynamic properties. Like their chemical counterparts, electrical synapses can also be plastic and modifiable. PMID:22659675

  15. Photosynthesis Control: An underrated short-term regulatory mechanism essential for plant viability.

    PubMed

    Colombo, Monica; Suorsa, Marjaana; Rossi, Fabio; Ferrari, Roberto; Tadini, Luca; Barbato, Roberto; Pesaresi, Paolo

    2016-01-01

    Regulation of photosynthetic electron transport provides efficient performance of oxygenic photosynthesis in plants. During the last 15 years, the molecular bases of various photosynthesis short-term regulatory processes have been elucidated, however the wild type-like phenotypes of mutants lacking of State Transitions, Non Photochemical Quenching, or Cyclic Electron Transport, when grown under constant light conditions, have also raised doubts about the acclimatory significance of these short-regulatory mechanisms on plant performance. Interestingly, recent studies performed by growing wild type and mutant plants under field conditions revealed a prominent role of State Transitions and Non Photochemical Quenching on plant fitness, with almost no effect on vegetative plant growth. Conversely, the analysis of plants lacking the regulation of electron transport by the cytochrome b6f complex, also known as Photosynthesis Control, revealed the fundamental role of this regulatory mechanism in the survival of young, developing seedlings under fluctuating light conditions.

  16. Thick filament mechano-sensing is a calcium-independent regulatory mechanism in skeletal muscle

    PubMed Central

    Fusi, L.; Brunello, E.; Yan, Z.; Irving, M.

    2016-01-01

    Recent X-ray diffraction studies on actively contracting fibres from skeletal muscle showed that the number of myosin motors available to interact with actin-containing thin filaments is controlled by the stress in the myosin-containing thick filaments. Those results suggested that thick filament mechano-sensing might constitute a novel regulatory mechanism in striated muscles that acts independently of the well-known thin filament-mediated calcium signalling pathway. Here we test that hypothesis using probes attached to the myosin regulatory light chain in demembranated muscle fibres. We show that both the extent and kinetics of thick filament activation depend on thick filament stress but are independent of intracellular calcium concentration in the physiological range. These results establish direct control of myosin motors by thick filament mechano-sensing as a general regulatory mechanism in skeletal muscle that is independent of the canonical calcium signalling pathway. PMID:27796302

  17. Photosynthesis Control: An underrated short-term regulatory mechanism essential for plant viability

    PubMed Central

    Colombo, Monica; Suorsa, Marjaana; Rossi, Fabio; Ferrari, Roberto; Tadini, Luca; Barbato, Roberto; Pesaresi, Paolo

    2016-01-01

    ABSTRACT Regulation of photosynthetic electron transport provides efficient performance of oxygenic photosynthesis in plants. During the last 15 years, the molecular bases of various photosynthesis short-term regulatory processes have been elucidated, however the wild type-like phenotypes of mutants lacking of State Transitions, Non Photochemical Quenching, or Cyclic Electron Transport, when grown under constant light conditions, have also raised doubts about the acclimatory significance of these short-regulatory mechanisms on plant performance. Interestingly, recent studies performed by growing wild type and mutant plants under field conditions revealed a prominent role of State Transitions and Non Photochemical Quenching on plant fitness, with almost no effect on vegetative plant growth. Conversely, the analysis of plants lacking the regulation of electron transport by the cytochrome b6f complex, also known as Photosynthesis Control, revealed the fundamental role of this regulatory mechanism in the survival of young, developing seedlings under fluctuating light conditions. PMID:27018523

  18. Transcriptional and Epigenetic Regulatory Mechanisms Affecting HTLV-1 Provirus.

    PubMed

    Miyazato, Paola; Matsuo, Misaki; Katsuya, Hiroo; Satou, Yorifumi

    2016-06-16

    Human T-cell leukemia virus type 1 (HTLV-1) is a retrovirus associated with human diseases, such as adult T-cell leukemia (ATL) and HTLV-1-associated myelopathy/Tropic spastic paraparesis (HAM/TSP). As a retrovirus, its life cycle includes a step where HTLV-1 is integrated into the host genomic DNA and forms proviral DNA. In the chronic phase of the infection, HTLV‑1 is known to proliferate as a provirus via the mitotic division of the infected host cells. There are generally tens of thousands of infected clones within an infected individual. They exist not only in peripheral blood, but also in various lymphoid organs. Viral proteins encoded in HTLV-1 genome play a role in the proliferation and survival of the infected cells. As is the case with other chronic viral infections, HTLV-1 gene expression induces the activation of the host immunity against the virus. Thus, the transcription from HTLV-1 provirus needs to be controlled in order to evade the host immune surveillance. There should be a dynamic and complex regulation in vivo, where an equilibrium between viral antigen expression and host immune surveillance is achieved. The mechanisms regulating viral gene expression from the provirus are a key to understanding the persistent/latent infection with HTLV-1 and its pathogenesis. In this article, we would like to review our current understanding on this topic.

  19. Cis-regulatory mechanisms governing stem and progenitor cell transitions

    PubMed Central

    Johnson, Kirby D.; Kong, Guangyao; Gao, Xin; Chang, Yuan-I; Hewitt, Kyle J.; Sanalkumar, Rajendran; Prathibha, Rajalekshmi; Ranheim, Erik A.; Dewey, Colin N.; Zhang, Jing; Bresnick, Emery H.

    2015-01-01

    Cis-element encyclopedias provide information on phenotypic diversity and disease mechanisms. Although cis-element polymorphisms and mutations are instructive, deciphering function remains challenging. Mutation of an intronic GATA motif (+9.5) in GATA2, encoding a master regulator of hematopoiesis, underlies an immunodeficiency associated with myelodysplastic syndrome (MDS) and acute myeloid leukemia (AML). Whereas an inversion relocalizes another GATA2 cis-element (−77) to the proto-oncogene EVI1, inducing EVI1 expression and AML, whether this reflects ectopic or physiological activity is unknown. We describe a mouse strain that decouples −77 function from proto-oncogene deregulation. The −77−/− mice exhibited a novel phenotypic constellation including late embryonic lethality and anemia. The −77 established a vital sector of the myeloid progenitor transcriptome, conferring multipotentiality. Unlike the +9.5−/− embryos, hematopoietic stem cell genesis was unaffected in −77−/− embryos. These results illustrate a paradigm in which cis-elements in a locus differentially control stem and progenitor cell transitions, and therefore the individual cis-element alterations cause unique and overlapping disease phenotypes. PMID:26601269

  20. Transcriptional and Epigenetic Regulatory Mechanisms Affecting HTLV-1 Provirus

    PubMed Central

    Miyazato, Paola; Matsuo, Misaki; Katsuya, Hiroo; Satou, Yorifumi

    2016-01-01

    Human T-cell leukemia virus type 1 (HTLV-1) is a retrovirus associated with human diseases, such as adult T-cell leukemia (ATL) and HTLV-1-associated myelopathy/Tropic spastic paraparesis (HAM/TSP). As a retrovirus, its life cycle includes a step where HTLV-1 is integrated into the host genomic DNA and forms proviral DNA. In the chronic phase of the infection, HTLV‑1 is known to proliferate as a provirus via the mitotic division of the infected host cells. There are generally tens of thousands of infected clones within an infected individual. They exist not only in peripheral blood, but also in various lymphoid organs. Viral proteins encoded in HTLV-1 genome play a role in the proliferation and survival of the infected cells. As is the case with other chronic viral infections, HTLV-1 gene expression induces the activation of the host immunity against the virus. Thus, the transcription from HTLV-1 provirus needs to be controlled in order to evade the host immune surveillance. There should be a dynamic and complex regulation in vivo, where an equilibrium between viral antigen expression and host immune surveillance is achieved. The mechanisms regulating viral gene expression from the provirus are a key to understanding the persistent/latent infection with HTLV-1 and its pathogenesis. In this article, we would like to review our current understanding on this topic. PMID:27322309

  1. BIOCHEMICAL ANALYSES OF TRANSCRIPTIONAL REGULATORY MECHANISMS IN A CHROMATIN CONTEXT

    PubMed Central

    KONESKY, KASEY L.; LAYBOURN, PAUL J.

    2007-01-01

    We have optimized a recombinant chromatin assembly system that properly incorporates core histones and histone H1 into a chromatin template containing a natural promoter sequence. This article provides a step-by-step procedure for expression and purification of the proteins required for assembling well-defined chromatin templates. We describe how the degree of chromatin assembly in the absence and presence of histone H1 is measured using topological analysis and the use of micrococcal nuclease digestion performed to confirm H1 incorporation and determine the quality of in vitro chromatin templates. Further we describe the use sucrose gradient ultracentrifugation to verify that no unincorporated H1 remains as a second means for deciding on the proper H1 to core histone ratio during assembly. Additionally, we discuss the use of both yeast and Drosophila NAP-1 (yNAP-1 and dNAP-1, respectively) in the assembly of H1-containing chromatin. Finally, we provide detailed description of functional assays for investigating the mechanism of transcriptional regulation in a chromatin context (transcription, histone acetyltransferase activity, and protein association with promoter-bound complexes using immobilized chromatin templates). PMID:17309835

  2. Requirement and Redundancy of the Src Family Kinases Fyn and Lyn in Perforin-Dependent Killing of Cryptococcus neoformans by NK Cells

    PubMed Central

    Oykhman, Paul; Timm-McCann, Martina; Xiang, Richard F.; Islam, Anowara; Li, Shu Shun; Stack, Danuta; Huston, Shaunna M.; Ma, Ling Ling

    2013-01-01

    Natural killer (NK) cells directly recognize and kill fungi, such as the pathogenic fungus Cryptococcus neoformans, via cytolytic mechanisms. However, the precise signaling pathways governing this NK cell microbicidal activity and the implications for fungal recognition are still unknown. Previously, it was reported that NK cell anticryptococcal activity is mediated through a conserved phosphatidylinositol 3-kinase–extracellular signal-regulated kinase 1/2 (PI3K-ERK1/2) pathway. Using YT (a human NK-like cell line) and primary human NK cells, we sought to identify the upstream, receptor-proximal signaling elements that led to fungal cytolysis. We demonstrate that Src family kinases were activated in response to C. neoformans. Furthermore, pharmacologic inhibition with an Src kinase inhibitor blocked C. neoformans-induced downstream activation of PI3K and ERK1/2 and abrogated cryptococcal killing. At the same time, the inhibitor disrupted the polarization of perforin-containing granules toward the NK cell-cryptococcal synapse but had no effect on conjugate formation between the organism and the NK cell. Finally, small interfering RNA (siRNA) double (but not single) knockdown of two Src family kinases, Fyn and Lyn, blocked cryptococcal killing. Together these data demonstrate a mechanism whereby the Src family kinases, Fyn and Lyn, redundantly mediate anticryptococcal activity through the activation of PI3K and ERK1/2, which in turn facilitates killing by inducing the polarization of perforin-containing granules to the NK cell-cryptococcal synapse. PMID:23918783

  3. Light-potentiation of acoustic startle response (ASR) and monoamine efflux related to fearfulness in Fyn-deficient mice.

    PubMed

    Hironaka, Naoyuki; Yagi, Takeshi; Niki, Hiroaki

    2002-01-31

    Fyn tyrosine kinase deficient mice are known to show increased fearfulness. We investigated the fear response of these mice using the light-potentiation of the acoustic startle response (ASR) and examined its neurochemical correlates using in vivo microdialysis. Female homozygous Fyn-deficient mice showed an enhancement of the startle amplitude under a bright light while heterozygotes and wild-types did not show such a change. Along with these behavioral findings, the homozygous Fyn-deficient mice showed an increase in extracellular serotonin (5-HT) and dopamine (DA) in the prefrontal cortex and 5-HT in the hippocampus when they were exposed to bright light, while heterozygous and wild-type mice did not show such changes. These results suggest that the increased fearfulness of Fyn-deficient mice is related to enhanced serotonergic and dopaminergic activity in the prefrontal cortex and limbic system.

  4. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  5. A new regulatory mechanism for bacterial lipoic acid synthesis.

    PubMed

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-22

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis.

  6. An essential role of ubiquitination in Cbl-mediated negative regulation of the Src-family kinase Fyn

    PubMed Central

    Rao, Navin; Ghosh, Amiya K.; Douillard, Patrice; Andoniou, Christopher E.; Zhou, Pengcheng; Band, Hamid

    2009-01-01

    SUMMARY The Cbl family of ubiquitin ligases function as negative regulators of activated receptor tyrosine kinases by facilitating their ubiquitination and subsequent lysosomal targeting. Here, we have investigated the role of Cbl ubiquitin ligase activity in the negative regulation of a non-receptor tyrosine kinase, the Src-family kinase Fyn. Using primary embryonic fibroblasts from Cbl+/+ and Cbl−/− mice, we demonstrate that endogenous Cbl mediates the ubiquitination of Fyn and dictates the rate of Fyn turnover. By analyzing CHO-TS20 cells with a temperature-sensitive ubiquitin activating enzyme, we demonstrate that intact cellular ubiquitin machinery is required for Cbl-induced degradation of Fyn. Analyses of Cbl mutants, with mutations in or near the RING finger domain, in 293T cells revealed that the ubiquitin ligase activity of Cbl is essential for Cbl-induced degradation of Fyn by the proteasome pathway. Finally, use of a SRE-luciferase reporter demonstrated that Cbl-dependent negative regulation of Fyn function requires the region of Cbl that mediates the ubiquitin ligase activity. Given the conservation of structure between various Src-family kinases and the ability of Cbl to interact with multiple members of this family, Cbl-dependent ubiquitination could serve a general role to negatively regulate activated Src-family kinases. PMID:19966925

  7. Hospital closures and survivals: an analysis of operating characteristics and regulatory mechanisms in three states.

    PubMed Central

    Kennedy, L; Dumas, M B

    1983-01-01

    This article examines factors related to hospital closures, using a longitudinal sample of surviving and closed hospitals. The hospitals are drawn from three states with different regulatory programs. Size of hospital and occupancy rate are shown to be related to likelihood of closure, while ownership, length of stay, and expenditures are not. These findings are observed both in the aggregate and within the individual states between 1960 and 1980. The three states--Arizona, Pennsylvania, and Maryland--represent different population trends and regulatory mechanisms and goals. The findings indicate that some programs appear to guarantee survival, whereas others are more neutral. PMID:6668180

  8. Control and regulatory mechanisms associated with thermogenesis in flying insects and birds.

    PubMed

    Loli, Denise; Bicudo, José Eduardo P W

    2005-01-01

    Most insects and birds are able to fly. The chitin made exoskeleton of insects poses them several constraints, and this is one the reasons they are in general small sized animals. On the other hand, because birds possess an endoskeleton made of bones they may grow much larger when compared to insects. The two taxa are quite different with regards to their general "design" platform, in particular with respect to their respiratory and circulatory systems. However, because they fly, they may share in common several traits, namely those associated with the control and regulatory mechanisms governing thermogenesis. High core temperatures are essential for animal flight irrespective of the taxa they belong to. Birds and insects have thus evolved mechanisms which allowed them to control and regulate high rates of heat fluxes. This article discusses possible convergent thermogenic control and regulatory mechanisms associated with flight in insects and birds.

  9. Catecholamine Stress Hormones Regulate Cellular Iron Homeostasis by a Posttranscriptional Mechanism Mediated by Iron Regulatory Protein

    PubMed Central

    Tapryal, Nisha; Vivek G, Vishnu; Mukhopadhyay, Chinmay K.

    2015-01-01

    Adequate availability of iron is important for cellular energy metabolism. Catecholamines such as epinephrine and norepinephrine promote energy expenditure to adapt to conditions that arose due to stress. To restore the energy balance, epinephrine/norepinephrine-exposed cells may face higher iron demand. So far, no direct role of epinephrine/norepinephrine in cellular iron homeostasis has been reported. Here we show that epinephrine/norepinephrine regulates iron homeostasis components such as transferrin receptor-1 and ferritin-H in hepatic and skeletal muscle cells by promoting the binding of iron regulatory proteins to iron-responsive elements present in the UTRs of transferrin receptor-1 and ferritin-H transcripts. Increased transferrin receptor-1, decreased ferritin-H, and increased iron-responsive element-iron regulatory protein interaction are also observed in liver and muscle tissues of epinephrine/norepinephrine-injected mice. We demonstrate the role of epinephrine/norepinephrine-induced generation of reactive oxygen species in converting cytosolic aconitase (ACO1) into iron regulatory protein-1 to bind iron-responsive elements present in UTRs of transferrin receptor-1 and ferritin-H. Our study further reveals that mitochondrial iron content and mitochondrial aconitase (ACO2) activity are elevated by epinephrine/norepinephrine that are blocked by the antioxidant N-acetyl cysteine and iron regulatory protein-1 siRNA, suggesting involvement of reactive oxygen species and iron regulatory protein-1 in this mechanism. This study reveals epinephrine and norepinephrine as novel regulators of cellular iron homeostasis. PMID:25572399

  10. Identification of genes involved in regulatory mechanism of pigments in broiler chickens.

    PubMed

    Tarique, T M; Yang, S; Mohsina, Z; Qiu, J; Yan, Z; Chen, G; Chen, A

    2014-09-05

    Chicken is an important model organism that unites the evolutionary gap between mammals and other vertebrates and provide major source of protein from meat and eggs for all over the world population. However, specific genes underlying the regulatory mechanism of broiler pigmentation have not yet been determined. In order to better understand the genes involved in the mechanism of pigmentation in the muscle tissues of broilers, the Affymetrix microarray hybridization experiment platform was used to identify gene expression profiles at 7 weeks of age. Broilers fed canthaxanthin, natural lutein, and orangeII pigments (100 mg/kg) were used to explore gene expression profiles). Our data showed that the 7th week of age was a very important phase with regard to gene expression profiles. We identified a number of differentially expressed genes; in canthaxanthin, natural lutein, and orangeII, there were 54 (32 upregulated and 22 downregulated), 23 (15 upregulated and 8 downregulated), and 7 (5 upregulated and 2 downregulated) known genes, respectively. Our data indicate that the numbers of differentially expressed genes were more upregulated than downregulated, and several genes showed conserved signaling to previously known functions. Thus, functional characterization of differentially expressed genes revealed several categories that are involved in important biological processes, including pigmentation, growth, molecular mechanisms, fat metabolism, cell proliferation, immune response, lipid metabolism, and protein synthesis and degradation. The results of the present study demonstrate that the genes associated with canthaxanthin, natural lutein, and orangeII are key regulatory genes that control the regulatory mechanisms of pigmentation.

  11. Neural cell adhesion molecule-mediated Fyn activation promotes GABAergic synapse maturation in postnatal mouse cortex.

    PubMed

    Chattopadhyaya, Bidisha; Baho, Elie; Huang, Z Josh; Schachner, Melitta; Di Cristo, Graziella

    2013-04-03

    GABAergic basket interneurons form perisomatic synapses, which are essential for regulating neural networks, and their alterations are linked to various cognitive dysfunction. Maturation of basket synapses in postnatal cortex is activity dependent. In particular, activity-dependent downregulation of polysialiac acid carried by the neural cell adhesion molecule (NCAM) regulates the timing of their maturation. Whether and how NCAM per se affects GABAergic synapse development is unknown. Using single-cell genetics to knock out NCAM in individual basket interneurons in mouse cortical slice cultures, at specific developmental time periods, we found that NCAM loss during perisomatic synapse formation impairs the process of basket cell axonal branching and bouton formation. However, loss of NCAM once the synapses are already formed did not show any effect. We further show that NCAM120 and NCAM140, but not the NCAM180 isoform, rescue the phenotype. Finally, we demonstrate that a dominant-negative form of Fyn kinase mimics, whereas a constitutively active form of Fyn kinase rescues, the effects of NCAM knockdown. Altogether, our data suggest that NCAM120/NCAM140-mediated Fyn activation promotes GABAergic synapse maturation in postnatal cortex.

  12. Thy1 (CD90) controls adipogenesis by regulating activity of the Src family kinase, Fyn

    PubMed Central

    Woeller, Collynn F.; O’Loughlin, Charles W.; Pollock, Stephen J.; Thatcher, Thomas H.; Feldon, Steven E.; Phipps, Richard P.

    2015-01-01

    Worldwide obesity rates are at epidemic levels, and new insight into the regulation of obesity and adipogenesis are required. Thy1 (CD90), a cell surface protein with an enigmatic function, is expressed on subsets of fibroblasts and stem cells. We used a diet-induced obesity model to show that Thy1-null mice gain weight at a faster rate and gain 30% more weight than control C57BL/6 mice. During adipogenesis, Thy1 expression is lost in mouse 3T3-L1 cells. Overexpression of Thy1 blocked adipocyte formation and reduced mRNA and protein expression of an adipocyte marker, fatty acid-binding protein 4, by 5-fold. Although preadipocyte fibroblasts expressed Thy1 mRNA and protein, adipocytes from mouse and human fat tissue had almost undetectable Thy1 levels. Thy1 decreases the activity of the adipogenic transcription factor PPARγ by more than 60% as shown by PPARγ-dependent reporter assays. Using both genetic and pharmacologic approaches, we show Thy1 expression dampens PPARγ by inhibiting the activity of the Src-family kinase, Fyn. Thus, these studies reveal Thy1 blocks adipogenesis and PPARγ by inhibiting Fyn and support the idea that Thy1 is a novel therapeutic target in obesity.—Woeller, C. F., O’Loughlin, C. W., Pollock, S. J., Thatcher, T. H., Feldon, S. E., Phipps, R. P. Thy1 (CD90) controls adipogenesis by regulating activity of the Src family kinase, Fyn. PMID:25416548

  13. Structural Instability Tuning as a Regulatory Mechanism in Protein-Protein Interactions

    PubMed Central

    Chen, Li; Balabanidou, Vassilia; Remeta, David P.; Minetti, Conceição A.S.A.; Portaliou, Athina G.; Economou, Anastassios; Kalodimos, Charalampos G.

    2011-01-01

    SUMMARY Protein-protein interactions mediate a vast number of cellular processes. Here we present a regulatory mechanism in protein-protein interactions mediated by finely-tuned structural instability coupled with molecular mimicry. We show that a set of type III secretion (TTS) autoinhibited homodimeric chaperones adopt a molten-globule-like state that transiently exposes the substrate binding site as a means to become rapidly poised for binding to their cognate protein substrates. Packing defects at the homodimeric interface stimulate binding whereas correction of these defects results in less labile chaperones that give rise to non-functional biological systems. The protein substrates use structural mimicry to offset the “weak spots” in the chaperones and to counteract their autoinhibitory conformation. This regulatory mechanism of protein activity is evolutionary conserved among several TSS systems and presents a lucid example of functional advantage conferred upon a biological system by finely-tuned structural instability. PMID:22152477

  14. Diversity of regulatory mechanisms of photosynthetic carbon metabolism in plants and algae.

    PubMed

    Tamoi, Masahiro; Shigeoka, Shigeru

    2015-01-01

    To clarify the regulatory mechanisms of the Calvin cycle in algae, we analyzed the molecular properties of the enzymes involved in this cycle. We demonstrated that these enzymes were not regulated by redox modulation through the ferredoxin/thioredoxin system under light/dark conditions and were not sensitive to treatments with hydrogen peroxide in vitro, unlike the chloroplastic thiol-modulated enzymes of plants. On the other hand, we found that cyanobacteria possessed a unique enzyme involved in the Calvin cycle. The CP12 protein played an important role in regulating carbon metabolism in the Calvin cycle in cyanobacteria and eukaryotic algae. This review described the regulatory mechanisms of the Calvin cycle in algae and also the effects of alterations to photosynthetic carbon metabolism on plant productivity, carbon partitioning, and the carbon/nitrogen balance using transgenic plants expressing algal genes.

  15. Gene regulatory mechanisms orchestrated by p63 in epithelial development and related disorders.

    PubMed

    Kouwenhoven, Evelyn N; van Bokhoven, Hans; Zhou, Huiqing

    2015-06-01

    The transcription factor p63 belongs to the p53 family and is a key regulator in epithelial commitment and development. Mutations in p63 give rise to several epithelial related disorders with defects in skin, limb and orofacial structures. Since the discovery of p63, efforts have been made to identify its target genes using individual gene approaches and to understand p63 function in normal epithelial development and related diseases. Recent genome-wide approaches have identified tens of thousands of potential p63-regulated target genes and regulatory elements, and reshaped the concept of gene regulation orchestrated by p63. These data also provide insights into p63-related disease mechanisms. In this review, we discuss the regulatory role of p63 in normal and diseased epithelial development in light of these novel findings. We also propose future perspectives for dissecting the molecular mechanism of p63-mediated epithelial development and related disorders as well as for potential therapeutic strategies.

  16. Exploring associations between self-regulatory mechanisms and neuropsychological functioning and driver behaviour after brain injury.

    PubMed

    Rike, Per-Ola; Johansen, Hans J; Ulleberg, Pål; Lundqvist, Anna; Schanke, Anne-Kristine

    2016-04-11

    The objective of this prospective one-year follow-up study was to explore the associations between self-regulatory mechanisms and neuropsychological tests as well as baseline and follow-up ratings of driver behaviour. The participants were a cohort of subjects with stroke and traumatic brain injury (TBI) who were found fit to drive after a multi-disciplinary driver assessment (baseline). Baseline measures included neuropsychological tests and ratings of self-regulatory mechanisms, i.e., executive functions (Behavior Rating Inventory of Executive Function-Adult Version; BRIEF-A) and impulsive personality traits (UPPS Impulsive Behavior Scale). The participants rated pre-injury driving behaviour on the Driver Behaviour Qestionnaire (DBQ) retrospectively at baseline and after one year of post-injury driving (follow-up). Better performance on neuropsychological tests was significantly associated with more post-injury DBQ Violations. The BRIEF-A main indexes were significantly associated with baseline and follow-up ratings of DBQ Mistakes and follow-up DBQ Inattention. UPPS (lack of) Perseverance was significantly associated with baseline DBQ Inattention, whereas UPPS Urgency was significantly associated with baseline DBQ Inexperience and post-injury DBQ Mistakes. There were no significant changes in DBQ ratings from baseline (pre-injury) to follow-up (post-injury). It was concluded that neuropsychological functioning and self-regulatory mechanisms are related to driver behaviour. Some aspects of driver behaviour do not necessarily change after brain injury, reflecting the influence of premorbid driving behaviour or impaired awareness of deficits on post-injury driving behaviour. Further evidence is required to predict the role of self-regulatory mechanisms on driver behaviour and crashes or near misses.

  17. Modeling the Regulatory Mechanisms by Which NLRX1 Modulates Innate Immune Responses to Helicobacter pylori Infection.

    PubMed

    Philipson, Casandra W; Bassaganya-Riera, Josep; Viladomiu, Monica; Kronsteiner, Barbara; Abedi, Vida; Hoops, Stefan; Michalak, Pawel; Kang, Lin; Girardin, Stephen E; Hontecillas, Raquel

    2015-01-01

    Helicobacter pylori colonizes half of the world's population as the dominant member of the gastric microbiota resulting in a lifelong chronic infection. Host responses toward the bacterium can result in asymptomatic, pathogenic or even favorable health outcomes; however, mechanisms underlying the dual role of H. pylori as a commensal versus pathogenic organism are not well characterized. Recent evidence suggests mononuclear phagocytes are largely involved in shaping dominant immunity during infection mediating the balance between host tolerance and succumbing to overt disease. We combined computational modeling, bioinformatics and experimental validation in order to investigate interactions between macrophages and intracellular H. pylori. Global transcriptomic analysis on bone marrow-derived macrophages (BMDM) in a gentamycin protection assay at six time points unveiled the presence of three sequential host response waves: an early transient regulatory gene module followed by sustained and late effector responses. Kinetic behaviors of pattern recognition receptors (PRRs) are linked to differential expression of spatiotemporal response waves and function to induce effector immunity through extracellular and intracellular detection of H. pylori. We report that bacterial interaction with the host intracellular environment caused significant suppression of regulatory NLRC3 and NLRX1 in a pattern inverse to early regulatory responses. To further delineate complex immune responses and pathway crosstalk between effector and regulatory PRRs, we built a computational model calibrated using time-series RNAseq data. Our validated computational hypotheses are that: 1) NLRX1 expression regulates bacterial burden in macrophages; and 2) early host response cytokines down-regulate NLRX1 expression through a negative feedback circuit. This paper applies modeling approaches to characterize the regulatory role of NLRX1 in mechanisms of host tolerance employed by macrophages to

  18. Modeling the Regulatory Mechanisms by Which NLRX1 Modulates Innate Immune Responses to Helicobacter pylori Infection

    PubMed Central

    Philipson, Casandra W.; Bassaganya-Riera, Josep; Viladomiu, Monica; Kronsteiner, Barbara; Abedi, Vida; Hoops, Stefan; Michalak, Pawel; Kang, Lin; Girardin, Stephen E.; Hontecillas, Raquel

    2015-01-01

    Helicobacter pylori colonizes half of the world’s population as the dominant member of the gastric microbiota resulting in a lifelong chronic infection. Host responses toward the bacterium can result in asymptomatic, pathogenic or even favorable health outcomes; however, mechanisms underlying the dual role of H. pylori as a commensal versus pathogenic organism are not well characterized. Recent evidence suggests mononuclear phagocytes are largely involved in shaping dominant immunity during infection mediating the balance between host tolerance and succumbing to overt disease. We combined computational modeling, bioinformatics and experimental validation in order to investigate interactions between macrophages and intracellular H. pylori. Global transcriptomic analysis on bone marrow-derived macrophages (BMDM) in a gentamycin protection assay at six time points unveiled the presence of three sequential host response waves: an early transient regulatory gene module followed by sustained and late effector responses. Kinetic behaviors of pattern recognition receptors (PRRs) are linked to differential expression of spatiotemporal response waves and function to induce effector immunity through extracellular and intracellular detection of H. pylori. We report that bacterial interaction with the host intracellular environment caused significant suppression of regulatory NLRC3 and NLRX1 in a pattern inverse to early regulatory responses. To further delineate complex immune responses and pathway crosstalk between effector and regulatory PRRs, we built a computational model calibrated using time-series RNAseq data. Our validated computational hypotheses are that: 1) NLRX1 expression regulates bacterial burden in macrophages; and 2) early host response cytokines down-regulate NLRX1 expression through a negative feedback circuit. This paper applies modeling approaches to characterize the regulatory role of NLRX1 in mechanisms of host tolerance employed by macrophages to

  19. Type 1 regulatory T cells: a new mechanism of peripheral immune tolerance.

    PubMed

    Zeng, Hanyu; Zhang, Rong; Jin, Boquan; Chen, Lihua

    2015-09-01

    The lack of immune response to an antigen, a process known as immune tolerance, is essential for the preservation of immune homeostasis. To date, two mechanisms that drive immune tolerance have been described extensively: central tolerance and peripheral tolerance. Under the new nomenclature, thymus-derived regulatory T (tT(reg)) cells are the major mediators of central immune tolerance, whereas peripherally derived regulatory T (pT(reg)) cells function to regulate peripheral immune tolerance. A third type of T(reg) cells, termed iT(reg), represents only the in vitro-induced T(reg) cells(1). Depending on whether the cells stably express Foxp3, pT(reg), and iT(reg) cells may be divided into two subsets: the classical CD4(+)Foxp3(+) T(reg) cells and the CD4(+)Foxp3(-) type 1 regulatory T (Tr1) cells(2). This review focuses on the discovery, associated biomarkers, regulatory functions, methods of induction, association with disease, and clinical trials of Tr1 cells.

  20. Alzheimer Amyloid-β Oligomer Bound to Post-Synaptic Prion Protein Activates Fyn to Impair Neurons

    PubMed Central

    Um, Ji Won; Nygaard, Haakon B.; Heiss, Jacqueline K.; Kostylev, Mikhail A.; Stagi, Massimiliano; Vortmeyer, Alexander; Wisniewski, Thomas; Gunther, Erik C.; Strittmatter, Stephen M.

    2012-01-01

    SUMMARY Amyloid-beta (Aβ) oligomers are thought to trigger Alzheimer’s disease (AD) pathophysiology. Cellular Prion Protein (PrPC) selectively binds oligomeric Aβ and can mediate AD-related phenotypes. Here, we examined the specificity, distribution and signaling from Aβ/PrP complexes, seeking to explain how they might alter the function of NMDA receptors in neurons. PrPC is enriched in post-synaptic densities, and Aβ/PrPC interaction leads to Fyn kinase activation. Soluble Aβ assemblies derived from human AD brain interact with PrPC to activate Fyn. Aβ engagement of PrPC/Fyn signaling yields phosphorylation of the NR2B subunit of NMDA-receptors, which is coupled to an initial increase and then loss of surface NMDA-receptors. Aβ-induced LDH release and dendritic spine loss require both PrPC and Fyn, and human familial AD transgene-induced convulsive seizures do not occur in mice lacking PrPC. These results delineate an Aβ oligomer signal transduction pathway requiring PrPC and Fyn to alter synaptic function with relevance to AD. PMID:22820466

  1. A SerpinB1 regulatory mechanism is essential for restricting NETosis

    PubMed Central

    Farley, Kalamo; Stolley, J Michael; Zhao, Picheng; Cooley, Jessica; Remold-O’Donnell, Eileen

    2014-01-01

    NETosis (NET generation), a programmed death pathway initiated in mature neutrophils by pathogens and inflammatory mediators, can be a protective process that sequesters microbes and prevents spread of infection, but can also be a pathological process that causes inflammation and serious tissue injury. Little is known about the regulatory mechanism. Previously we demonstrated that serpinb1-deficient mice are highly susceptible to pulmonary bacterial and viral infections due to inflammation and tissue injury associated with increased neutrophilic death. Here we used in vitro and in vivo approaches to investigate whether SerpinB1 regulates NETosis. We found that serpinb1-deficient bone marrow and lung neutrophils are hyper-susceptible to NETosis induced by multiple mediators in both NADPH-dependent and independent manner, indicating a deeply rooted regulatory role in NETosis. This role is further supported by increased nuclear expansion (representing chromatin decondensation) of PMA-treated serpinb-1-deficient neutrophils compared to wild-type, by migration of SerpinB1 from the cytoplasm to the nucleus of human neutrophils coincident with, or before, early conversion of lobulated (segmented) nuclei to delobulated (spherical) morphology, and by finding that exogenous rSerpinB1 abrogates NET production. NETosis of serpinb1-deficient neutrophils is also increased in vivo during Pseudomonas aeruginosa lung infection. The findings identify a previously unrecognized regulatory mechanism involving SerpinB1 that restricts the production of NETs. PMID:23002442

  2. A serpinB1 regulatory mechanism is essential for restricting neutrophil extracellular trap generation.

    PubMed

    Farley, Kalamo; Stolley, J Michael; Zhao, Picheng; Cooley, Jessica; Remold-O'Donnell, Eileen

    2012-11-01

    NETosis (neutrophil extracellular trap [NET] generation), a programmed death pathway initiated in mature neutrophils by pathogens and inflammatory mediators, can be a protective process that sequesters microbes and prevents spread of infection, but it can also be a pathological process that causes inflammation and serious tissue injury. Little is known about the regulatory mechanism. Previously, we demonstrated that serpinb1-deficient mice are highly susceptible to pulmonary bacterial and viral infections due to inflammation and tissue injury associated with increased neutrophilic death. In this study, we used in vitro and in vivo approaches to investigate whether SerpinB1 regulates NETosis. We found that serpinb1-deficient bone marrow and lung neutrophils are hypersusceptible to NETosis induced by multiple mediators in both an NADPH-dependent and -independent manner, indicating a deeply rooted regulatory role in NETosis. This role is further supported by increased nuclear expansion (representing chromatin decondensation) of PMA-treated serpinb1-deficient neutrophils compared with wild-type, by migration of SerpinB1 from the cytoplasm to the nucleus of human neutrophils that is coincident with or preceding early conversion of lobulated (segmented) nuclei to delobulated (spherical) morphology, as well as by the finding that exogenous human recombinant SerpinB1 abrogates NET production. NETosis of serpinb1-deficient neutrophils is also increased in vivo during Pseudomonas aeruginosa lung infection. The findings identify a previously unrecognized regulatory mechanism involving SerpinB1 that restricts the production of NETs.

  3. Architecture and Molecular Mechanism of PAN, the Archaeal Proteasome Regulatory ATPase*

    PubMed Central

    Medalia, Noa; Beer, Avital; Zwickl, Peter; Mihalache, Oana; Beck, Martin; Medalia, Ohad; Navon, Ami

    2009-01-01

    In Archaea, an hexameric ATPase complex termed PAN promotes proteins unfolding and translocation into the 20 S proteasome. PAN is highly homologous to the six ATPases of the eukaryotic 19 S proteasome regulatory complex. Thus, insight into the mechanism of PAN function may reveal a general mode of action mutual to the eukaryotic 19 S proteasome regulatory complex. In this study we generated a three-dimensional model of PAN from tomographic reconstruction of negatively stained particles. Surprisingly, this reconstruction indicated that the hexameric complex assumes a two-ring structure enclosing a large cavity. Assessment of distinct three-dimensional functional states of PAN in the presence of adenosine 5′-O-(thiotriphosphate) and ADP and in the absence of nucleotides outlined a possible mechanism linking nucleotide binding and hydrolysis to substrate recognition, unfolding, and translocation. A novel feature of the ATPase complex revealed in this study is a gate controlling the “exit port” of the regulatory complex and, presumably, translocation into the 20 S proteasome. Based on our structural and biochemical findings, we propose a possible model in which substrate binding and unfolding are linked to structural transitions driven by nucleotide binding and hydrolysis, whereas translocation into the proteasome only depends upon the presence of an unfolded substrate and binding but not hydrolysis of nucleotide. PMID:19363223

  4. AlphaScreen HTS and live-cell bioluminescence resonance energy transfer (BRET) assays for identification of Tau-Fyn SH3 interaction inhibitors for Alzheimer disease.

    PubMed

    Cochran, J Nicholas; Diggs, Pauleatha V; Nebane, N Miranda; Rasmussen, Lynn; White, E Lucile; Bostwick, Robert; Maddry, Joseph A; Suto, Mark J; Roberson, Erik D

    2014-12-01

    Alzheimer disease (AD) is the most common neurodegenerative disease, and with Americans' increasing longevity, it is becoming an epidemic. There are currently no effective treatments for this disorder. Abnormalities of Tau track more closely with cognitive decline than the most studied therapeutic target in AD, amyloid-β, but the optimal strategy for targeting Tau has not yet been identified. On the basis of considerable preclinical data from AD models, we hypothesize that interactions between Tau and the Src-family tyrosine kinase, Fyn, are pathogenic in AD. Genetically reducing either Tau or Fyn is protective in AD mouse models, and a dominant negative fragment of Tau that alters Fyn localization is also protective. Here, we describe a new AlphaScreen assay and a live-cell bioluminescence resonance energy transfer (BRET) assay using a novel BRET pair for quantifying the Tau-Fyn interaction. We used these assays to map the binding site on Tau for Fyn to the fifth and sixth PXXP motifs to show that AD-associated phosphorylation at microtubule affinity regulating kinase sites increases the affinity of the Tau-Fyn interaction and to identify Tau-Fyn interaction inhibitors by high-throughput screening. This screen has identified a variety of chemically tractable hits, suggesting that the Tau-Fyn interaction may represent a good drug target for AD.

  5. Regulatory mechanism of human vascular smooth muscle cell phenotypic transformation induced by NELIN

    PubMed Central

    PEI, CHANGAN; QIN, SHIYONG; WANG, MINGHAI; ZHANG, SHUGUANG

    2015-01-01

    Vascular disorders, including hypertension, atherosclerosis and restenosis, arise from dysregulation of vascular smooth muscle cell (VSMC) differentiation, which can be controlled by regulatory factors. The present study investigated the regulatory mechanism of the phenotypic transformation of human VSMCs by NELIN in order to evaluate its potential as a preventive and therapeutic of vascular disorders. An in vitro model of NELIN-overexpressing VSMCs was prepared by transfection with a lentiviral (LV) vector (NELIN-VSMCs) and NELIN was slienced using an a lentiviral vector with small interfering (si)RNA in another group (LV-NELIN-siRNA-VSMCs). The effects of NELIN overexpression or knockdown on the phenotypic transformation of human VSMCs were observed, and its regulatory mechanism was studied. Compared with the control group, cells in the NELIN-VSMCs group presented a contractile phenotype with a significant increase of NELIN mRNA, NELIN protein, smooth muscle (SM)α-actin and total Ras homolog gene family member A (RhoA) protein expression. The intra-nuclear translocation of SMα-actin-serum response factor (SMα-actin-SRF) occurred in these cells simultaneously. Following exposure to Rho kinsase inhibitor Y-27632, SRF and SMα-actin expression decreased. However, cells in the LV-NELIN-siRNA-VSMCs group presented a synthetic phenotype, and the expression of NELIN mRNA, NELIN protein, SMα-actin protein and total RhoA protein was decreased. The occurrence of SRF extra-nuclear translocation was observed. In conclusion, the present study suggested that NELIN was able to activate regulatory factors of SMα-actin, RhoA and SRF successively in human VSMCs cultured in vitro. Furthermore, NELIN-induced phenotypic transformation of human VSMCs was regulated via the RhoA/SRF signaling pathway. The results of the present study provide a foundation for the use of NELIN in preventive and therapeutic treatment of vascular remodeling diseases, including varicosity and

  6. Latent Tuberculosis: Models, Computational Efforts and the Pathogen’s Regulatory Mechanisms during Dormancy

    PubMed Central

    Magombedze, Gesham; Dowdy, David; Mulder, Nicola

    2013-01-01

    Latent tuberculosis is a clinical syndrome that occurs after an individual has been exposed to the Mycobacterium tuberculosis (Mtb) Bacillus, the infection has been established and an immune response has been generated to control the pathogen and force it into a quiescent state. Mtb can exit this quiescent state where it is unresponsive to treatment and elusive to the immune response, and enter a rapid replicating state, hence causing infection reactivation. It remains a gray area to understand how the pathogen causes a persistent infection and it is unclear whether the organism will be in a slow replicating state or a dormant non-replicating state. The ability of the pathogen to adapt to changing host immune response mechanisms, in which it is exposed to hypoxia, low pH, nitric oxide (NO), nutrient starvation, and several other anti-microbial effectors, is associated with a high metabolic plasticity that enables it to metabolize under these different conditions. Adaptive gene regulatory mechanisms are thought to coordinate how the pathogen changes their metabolic pathways through mechanisms that sense changes in oxygen tension and other stress factors, hence stimulating the pathogen to make necessary adjustments to ensure survival. Here, we review studies that give insights into latency/dormancy regulatory mechanisms that enable infection persistence and pathogen adaptation to different stress conditions. We highlight what mathematical and computational models can do and what they should do to enhance our current understanding of TB latency. PMID:25023946

  7. Effects of a Regulatory Protocol for Mechanical Restraint and Coercion in a Spanish Psychiatric Ward.

    PubMed

    Guzman-Parra, Jose; Garcia-Sanchez, Juan A; Pino-Benitez, Isabel; Alba-Vallejo, Mercedes; Mayoral-Cleries, Fermin

    2015-10-01

    There is still limited information on what type of measures are most efficient to reduce coercion. The aim of this study was to determine if the introduction of a new regulatory protocol in a specific psychiatric ward in Andalusia (Spain) contributed to reducing the use of mechanical restraint. The study included a comparison of two time periods: 2005 (one year before the implementation of the new regulatory protocol) and 2012, in all hospitalized patients (N=1,094). The study also analyzes with logistic regression the variables related to a shorter duration of mechanical restraint. Mechanical restraint rate per year was reduced, not significantly, from 18.2% to 15.1%. The average duration of each mechanical restraint episode was significantly reduced from 27.91 to 15.33 hr. The following variables have been associated with a shorter period of coercion: being female and the year of restraint (2012). Specific plans are required, including different interventions, in order to achieve marked reduction in the use of coercive measures. © 2014 Wiley Periodicals, Inc.

  8. Defining Transcriptional Regulatory Mechanisms for Primary let-7 miRNAs.

    PubMed

    Gaeta, Xavier; Le, Luat; Lin, Ying; Xie, Yuan; Lowry, William E

    2017-01-01

    The let-7 family of miRNAs have been shown to control developmental timing in organisms from C. elegans to humans; their function in several essential cell processes throughout development is also well conserved. Numerous studies have defined several steps of post-transcriptional regulation of let-7 production; from pri-miRNA through pre-miRNA, to the mature miRNA that targets endogenous mRNAs for degradation or translational inhibition. Less-well defined are modes of transcriptional regulation of the pri-miRNAs for let-7. let-7 pri-miRNAs are expressed in polycistronic fashion, in long transcripts newly annotated based on chromatin-associated RNA-sequencing. Upon differentiation, we found that some let-7 pri-miRNAs are regulated at the transcriptional level, while others appear to be constitutively transcribed. Using the Epigenetic Roadmap database, we further annotated regulatory elements of each polycistron identified putative promoters and enhancers. Probing these regulatory elements for transcription factor binding sites identified factors that regulate transcription of let-7 in both promoter and enhancer regions, and identified novel regulatory mechanisms for this important class of miRNAs.

  9. Integrative functional genomics identifies regulatory mechanisms at coronary artery disease loci

    PubMed Central

    Miller, Clint L.; Pjanic, Milos; Wang, Ting; Nguyen, Trieu; Cohain, Ariella; Lee, Jonathan D.; Perisic, Ljubica; Hedin, Ulf; Kundu, Ramendra K.; Majmudar, Deshna; Kim, Juyong B.; Wang, Oliver; Betsholtz, Christer; Ruusalepp, Arno; Franzén, Oscar; Assimes, Themistocles L.; Montgomery, Stephen B.; Schadt, Eric E.; Björkegren, Johan L.M.; Quertermous, Thomas

    2016-01-01

    Coronary artery disease (CAD) is the leading cause of mortality and morbidity, driven by both genetic and environmental risk factors. Meta-analyses of genome-wide association studies have identified >150 loci associated with CAD and myocardial infarction susceptibility in humans. A majority of these variants reside in non-coding regions and are co-inherited with hundreds of candidate regulatory variants, presenting a challenge to elucidate their functions. Herein, we use integrative genomic, epigenomic and transcriptomic profiling of perturbed human coronary artery smooth muscle cells and tissues to begin to identify causal regulatory variation and mechanisms responsible for CAD associations. Using these genome-wide maps, we prioritize 64 candidate variants and perform allele-specific binding and expression analyses at seven top candidate loci: 9p21.3, SMAD3, PDGFD, IL6R, BMP1, CCDC97/TGFB1 and LMOD1. We validate our findings in expression quantitative trait loci cohorts, which together reveal new links between CAD associations and regulatory function in the appropriate disease context. PMID:27386823

  10. Defining Transcriptional Regulatory Mechanisms for Primary let-7 miRNAs

    PubMed Central

    Gaeta, Xavier; Le, Luat; Lin, Ying; Xie, Yuan; Lowry, William E.

    2017-01-01

    The let-7 family of miRNAs have been shown to control developmental timing in organisms from C. elegans to humans; their function in several essential cell processes throughout development is also well conserved. Numerous studies have defined several steps of post-transcriptional regulation of let-7 production; from pri-miRNA through pre-miRNA, to the mature miRNA that targets endogenous mRNAs for degradation or translational inhibition. Less-well defined are modes of transcriptional regulation of the pri-miRNAs for let-7. let-7 pri-miRNAs are expressed in polycistronic fashion, in long transcripts newly annotated based on chromatin-associated RNA-sequencing. Upon differentiation, we found that some let-7 pri-miRNAs are regulated at the transcriptional level, while others appear to be constitutively transcribed. Using the Epigenetic Roadmap database, we further annotated regulatory elements of each polycistron identified putative promoters and enhancers. Probing these regulatory elements for transcription factor binding sites identified factors that regulate transcription of let-7 in both promoter and enhancer regions, and identified novel regulatory mechanisms for this important class of miRNAs. PMID:28052101

  11. Autocrine/paracrine regulatory mechanisms in adrenocortical neoplasms responsible for primary adrenal hypercorticism.

    PubMed

    Lefebvre, H; Prévost, G; Louiset, E

    2013-11-01

    A wide variety of autocrine/paracrine bioactive signals are able to modulate corticosteroid secretion in the human adrenal gland. These regulatory factors, released in the vicinity of adrenocortical cells by diverse cell types comprising chromaffin cells, nerve terminals, cells of the immune system, endothelial cells, and adipocytes, include neuropeptides, biogenic amines, and cytokines. A growing body of evidence now suggests that paracrine mechanisms may also play an important role in the physiopathology of adrenocortical hyperplasias and tumors responsible for primary adrenal steroid excess. These intra-adrenal regulatory systems, although globally involving the same actors as those observed in the normal gland, display alterations at different levels, which reinforce the capacity of paracrine factors to stimulate the activity of adrenocortical cells. The main modifications in the adrenal local control systems reported by now include hyperplasia of cells producing the paracrine factors and abnormal expression of the latter and their receptors. Because steroid-secreting adrenal neoplasms are independent of the classical endocrine regulatory factors angiotensin II and ACTH, which are respectively suppressed by hyperaldosteronism and hypercortisolism, these lesions have long been considered as autonomous tissues. However, the presence of stimulatory substances within the neoplastic tissues suggests that steroid hypersecretion is driven by autocrine/paracrine loops that should be regarded as promising targets for pharmacological treatments of primary adrenal disorders. This new potential therapeutic approach may constitute an alternative to surgical removal of the lesions that is classically recommended in order to cure steroid excess.

  12. Timing Embryo Segmentation: Dynamics and Regulatory Mechanisms of the Vertebrate Segmentation Clock

    PubMed Central

    Resende, Tatiana P.; Andrade, Raquel P.; Palmeirim, Isabel

    2014-01-01

    All vertebrate species present a segmented body, easily observed in the vertebrate column and its associated components, which provides a high degree of motility to the adult body and efficient protection of the internal organs. The sequential formation of the segmented precursors of the vertebral column during embryonic development, the somites, is governed by an oscillating genetic network, the somitogenesis molecular clock. Herein, we provide an overview of the molecular clock operating during somite formation and its underlying molecular regulatory mechanisms. Human congenital vertebral malformations have been associated with perturbations in these oscillatory mechanisms. Thus, a better comprehension of the molecular mechanisms regulating somite formation is required in order to fully understand the origin of human skeletal malformations. PMID:24895605

  13. USP1 deubiquitinase: cellular functions, regulatory mechanisms and emerging potential as target in cancer therapy

    PubMed Central

    2013-01-01

    Reversible protein ubiquitination is emerging as a key process for maintaining cell homeostasis, and the enzymes that participate in this process, in particular E3 ubiquitin ligases and deubiquitinases (DUBs), are increasingly being regarded as candidates for drug discovery. Human DUBs are a group of approximately 100 proteins, whose cellular functions and regulatory mechanisms remain, with some exceptions, poorly characterized. One of the best-characterized human DUBs is ubiquitin-specific protease 1 (USP1), which plays an important role in the cellular response to DNA damage. USP1 levels, localization and activity are modulated through several mechanisms, including protein-protein interactions, autocleavage/degradation and phosphorylation, ensuring that USP1 function is carried out in a properly regulated spatio-temporal manner. Importantly, USP1 expression is deregulated in certain types of human cancer, suggesting that USP1 could represent a valid target in cancer therapy. This view has gained recent support with the finding that USP1 inhibition may contribute to revert cisplatin resistance in an in vitro model of non-small cell lung cancer (NSCLC). Here, we describe the current knowledge on the cellular functions and regulatory mechanisms of USP1. We also summarize USP1 alterations found in cancer, combining data from the literature and public databases with our own data. Finally, we discuss the emerging potential of USP1 as a target, integrating published data with our novel findings on the effects of the USP1 inhibitor pimozide in combination with cisplatin in NSCLC cells. PMID:23937906

  14. Regulatory T cells: Mechanisms of suppression and impairment in autoimmune liver disease.

    PubMed

    Liberal, Rodrigo; Grant, Charlotte R; Longhi, Maria Serena; Mieli-Vergani, Giorgina; Vergani, Diego

    2015-02-01

    There are three classic liver diseases with probable autoimmune etiology: primary biliary cirrhosis, primary sclerosing cholangitis, and autoimmune hepatitis. The occurrence of these autoimmune conditions is determined by the breakdown of immune-regulatory mechanisms that in health are responsible for maintaining immunological tolerance against self-antigens. Among the multiple T cell subsets with suppressive function, the regulatory T cells (Tregs), defined by the expression of CD4, the IL-2 receptor α chain (CD25), and the transcription factor FOXP3, have emerged as having a central role in maintaining immune-tolerance to autoantigens. Tregs are equipped with an array of mechanisms of suppression, including the modulation of antigen presenting cell maturation and function, the killing of target cells, the disruption of metabolic pathways, and the production of anti-inflammatory cytokines. In all the three autoimmune liver diseases mentioned above, there is evidence pointing for either a reduced frequency and/or function of Tregs. Here, we review the definition, phenotypic characteristics, and mechanisms of suppression employed by Tregs and then we discuss the evidence available pointing to their impairment in patients with autoimmune liver disease.

  15. Biosafety, biosecurity and internationally mandated regulatory regimes: compliance mechanisms for education and global health security

    PubMed Central

    Sture, Judi; Whitby, Simon; Perkins, Dana

    2015-01-01

    This paper highlights the biosafety and biosecurity training obligations that three international regulatory regimes place upon states parties. The duty to report upon the existence of such provisions as evidence of compliance is discussed in relation to each regime. We argue that such mechanisms can be regarded as building blocks for the development and delivery of complementary biosafety and biosecurity teaching and training materials. We show that such building blocks represent foundations upon which life and associated scientists – through greater awareness of biosecurity concerns – can better fulfil their responsibilities to guard their work from misuse in the future. PMID:24494580

  16. Distinct Regulatory Mechanisms Act to Establish and Maintain Pax3 Expression in the Developing Neural Tube

    PubMed Central

    Moore, Steven; Ribes, Vanessa; Terriente, Javier; Wilkinson, David; Relaix, Frédéric; Briscoe, James

    2013-01-01

    Pattern formation in developing tissues is driven by the interaction of extrinsic signals with intrinsic transcriptional networks that together establish spatially and temporally restricted profiles of gene expression. How this process is orchestrated at the molecular level by genomic cis-regulatory modules is one of the central questions in developmental biology. Here we have addressed this by analysing the regulation of Pax3 expression in the context of the developing spinal cord. Pax3 is induced early during neural development in progenitors of the dorsal spinal cord and is maintained as pattern is subsequently elaborated, resulting in the segregation of the tissue into dorsal and ventral subdivisions. We used a combination of comparative genomics and transgenic assays to define and dissect several functional cis-regulatory modules associated with the Pax3 locus. We provide evidence that the coordinated activity of two modules establishes and refines Pax3 expression during neural tube development. Mutational analyses of the initiating element revealed that in addition to Wnt signaling, Nkx family homeodomain repressors restrict Pax3 transcription to the presumptive dorsal neural tube. Subsequently, a second module mediates direct positive autoregulation and feedback to maintain Pax3 expression. Together, these data indicate a mechanism by which transient external signals are converted into a sustained expression domain by the activities of distinct regulatory elements. This transcriptional logic differs from the cross-repression that is responsible for the spatiotemporal patterns of gene expression in the ventral neural tube, suggesting that a variety of circuits are deployed within the neural tube regulatory network to establish and elaborate pattern formation. PMID:24098141

  17. Amyloid-β induced signaling by cellular prion protein and Fyn kinase in Alzheimer disease.

    PubMed

    Um, Ji Won; Strittmatter, Stephen M

    2013-01-01

    Alzheimer disease (AD) is the most prevalent cause of dementia. Amyloid-β (Aβ) oligomers are potent synaptotoxins thought to mediate AD-related phenotypes. Cellular prion protein (PrP(C)) has been identified as a high-affinity receptor for Aβ oligomers. Herein, we review the functional consequences of Aβ oligomer binding to PrP(C) on the neuronal surface. We highlight recent evidence that Fyn kinase mediates signal transduction downstream of the PrP(C)-Aβ oligomer complex. These studies suggest that PrP(C) has a central role in AD pathogenesis and may provide a target for therapeutic intervention in AD.

  18. Identifying miRNA regulatory mechanisms in preeclampsia by systems biology approaches.

    PubMed

    Biró, Orsolya; Nagy, Bálint; Rigó, János

    2017-02-01

    Preeclampsia (PE) is the major cause of maternal and fetal morbidity and mortality, affecting 3-8% of all pregnancies around the globe. miRNAs are small, noncoding RNA molecules, which negatively regulate gene expression. Abnormally expressed miRNAs contribute to pregnancy complications such as PE. The aim of our study was to find possible regulatory mechanisms by system biology approaches, which are connected to the pathogenesis of PE. We integrated publicly available miRNA and gene expression profiles and created a network from the significant miRNA-mRNA pairs with the help of MAGIA and Cytoscape softwares. Two subnetworks were expanded by adding protein-protein interactions. Differentially expressed miRNAs were identified for the evaluation of their regulatory effect. We analyzed the miRNAs and their targets using different bioinformatics tools and through literature research. Altogether, 52,603 miRNA-mRNA interactions were generated by the MAGIA web tool. The top 250 interactions were visualized and pairs with q < 0.0001 were analyzed, which included 85 nodes and 80 edges signalizing the connections between 52 regulated genes and 33 miRNAs. A total of 11 of the regulated genes are PE related and 9 of them were targeted by multiple miRNAs. A total of 8 miRNAs were associated with PE before, and 13 miRNAs regulated more than 1 mRNA. Hsa-mir-210 was the highest degree node in the network and its role in PE is well established. We identified several miRNA-mRNA regulatory mechanisms which may contribute to the pathogenesis of PE. Further investigations are needed to validate these miRNA-mRNA interactions and to enlighten the possibilities of developing potential therapeutic targets.

  19. [Influence of geomagnetic storms on the balance of autonomic regulatory mechanisms].

    PubMed

    Chichinadze, G; Tvildiani, L; Kvachadze, I; Tarkhan-Mouravi, I

    2005-09-01

    The investigation aimed to evaluate autonomic regulatory mechanisms in practically healthy persons during the geomagnetically quiet periods and during geomagnetic storms. The examinations were conducted among the volunteer young men (n=64) 18-22 years of age. The autonomic function was studied on the basis of the heart rate variability. The geomagnetically quiet periods were considered when the value of the K-index was no more then 2 and a geomagnetic storm was considered when the value of the index was 5 and more. It is ascertained that in the both cases the basic statistical indices of the heart rate were identical. The analysis of R-R intervals spectral power gave the possibility to sort the persons examined into the three different groups. The data obtained allowed to suggest that geomagnetic storms influence human organisms through the vagus centers by means of their excitation. This phenomenon may be considered as a self-regulatory physiologic mechanism of the adaptive character. The analysis of the spectral power of R-R intervals may be considered as a sensitive method for the detection of the magnitolabile persons.

  20. Comparative genetic screens in human cells reveal new regulatory mechanisms in WNT signaling

    PubMed Central

    Lebensohn, Andres M; Dubey, Ramin; Neitzel, Leif R; Tacchelly-Benites, Ofelia; Yang, Eungi; Marceau, Caleb D; Davis, Eric M; Patel, Bhaven B; Bahrami-Nejad, Zahra; Travaglini, Kyle J; Ahmed, Yashi; Lee, Ethan; Carette, Jan E; Rohatgi, Rajat

    2016-01-01

    The comprehensive understanding of cellular signaling pathways remains a challenge due to multiple layers of regulation that may become evident only when the pathway is probed at different levels or critical nodes are eliminated. To discover regulatory mechanisms in canonical WNT signaling, we conducted a systematic forward genetic analysis through reporter-based screens in haploid human cells. Comparison of screens for negative, attenuating and positive regulators of WNT signaling, mediators of R-spondin-dependent signaling and suppressors of constitutive signaling induced by loss of the tumor suppressor adenomatous polyposis coli or casein kinase 1α uncovered new regulatory features at most levels of the pathway. These include a requirement for the transcription factor AP-4, a role for the DAX domain of AXIN2 in controlling β-catenin transcriptional activity, a contribution of glycophosphatidylinositol anchor biosynthesis and glypicans to R-spondin-potentiated WNT signaling, and two different mechanisms that regulate signaling when distinct components of the β-catenin destruction complex are lost. The conceptual and methodological framework we describe should enable the comprehensive understanding of other signaling systems. DOI: http://dx.doi.org/10.7554/eLife.21459.001 PMID:27996937

  1. Studies on the regulatory mechanism of isocitrate dehydrogenase 2 using acetylation mimics.

    PubMed

    Xu, Yuqun; Liu, Lingwen; Nakamura, Akira; Someya, Shinichi; Miyakawa, Takuya; Tanokura, Masaru

    2017-08-29

    Mitochondrial isocitrate dehydrogenase 2 (IDH2) converts NADP(+) to NADPH and promotes regeneration of reduced glutathione (GSH) by supplying NADPH to glutathione reductase or thioredoxin reductase. We have previously shown that under calorie restriction, mitochondrial deacetylase Sirt3 deacetylates and activates IDH2, thereby regulating the mitochondrial glutathione antioxidant defense system in mice. To investigate the regulatory mechanism of mIDH2 (mouse mitochondrial IDH2), we used lysine-to-glutamine (KQ) mutants to mimic acetylated lysines and screened 15 KQ mutants. Among these mutants, the activities of the K256Q and K413Q proteins were less than 50% of the wild-type value. We then solved the crystal structures of the wild-type mIDH2 and the K256Q mutant proteins, revealing conformational changes in the substrate-binding pocket. Structural data suggested that positively charged Lys256 was important in stabilizing the pocket because it repelled a lysine cluster on the other side. Glutamine (or acetylated lysine) was neutral and thus caused the pocket size to decrease, which might be the main reason for the lower activity of the K256Q mutant. Together, our data provide the first structure of an acetylation mimic of mIDH2 and new insights into the regulatory mechanism of acetylation of mIDH2.

  2. Anti-Sigma Factors in E. coli: Common Regulatory Mechanisms Controlling Sigma Factors Availability

    PubMed Central

    Treviño-Quintanilla, Luis Gerardo; Freyre-González, Julio Augusto; Martínez-Flores, Irma

    2013-01-01

    In bacteria, transcriptional regulation is a key step in cellular gene expression. All bacteria contain a core RNA polymerase that is catalytically competent but requires an additional σ factor for specific promoter recognition and correct transcriptional initiation. The RNAP core is not able to selectively bind to a given σ factor. In contrast, different σ factors have different affinities for the RNAP core. As a consequence, the concentration of alternate σ factors requires strict regulation in order to properly control the delicate interplay among them, which favors the competence for the RNAP core. This control is archived by different σ/anti-σ controlling mechanisms that shape complex regulatory networks and cascades, and enable the response to sudden environmental cues, whose global understanding is a current challenge for systems biology. Although there have been a number of excellent studies on each of these σ/anti-σ post-transcriptional regulatory systems, no comprehensive comparison of these mechanisms in a single model organism has been conducted. Here, we survey all these systems in E. coli dissecting and analyzing their inner workings and highlightin their differences. Then, following an integral approach, we identify their commonalities and outline some of the principles exploited by the cell to effectively and globally reprogram the transcriptional machinery. These principles provide guidelines for developing biological synthetic circuits enabling an efficient and robust response to sudden stimuli. PMID:24396271

  3. Transancestral fine-mapping of four type 2 diabetes susceptibility loci highlights potential causal regulatory mechanisms.

    PubMed

    Horikoshi, Momoko; Pasquali, Lorenzo; Wiltshire, Steven; Huyghe, Jeroen R; Mahajan, Anubha; Asimit, Jennifer L; Ferreira, Teresa; Locke, Adam E; Robertson, Neil R; Wang, Xu; Sim, Xueling; Fujita, Hayato; Hara, Kazuo; Young, Robin; Zhang, Weihua; Choi, Sungkyoung; Chen, Han; Kaur, Ismeet; Takeuchi, Fumihiko; Fontanillas, Pierre; Thuillier, Dorothée; Yengo, Loic; Below, Jennifer E; Tam, Claudia H T; Wu, Ying; Abecasis, Gonçalo; Altshuler, David; Bell, Graeme I; Blangero, John; Burtt, Noél P; Duggirala, Ravindranath; Florez, Jose C; Hanis, Craig L; Seielstad, Mark; Atzmon, Gil; Chan, Juliana C N; Ma, Ronald C W; Froguel, Philippe; Wilson, James G; Bharadwaj, Dwaipayan; Dupuis, Josee; Meigs, James B; Cho, Yoon Shin; Park, Taesung; Kooner, Jaspal S; Chambers, John C; Saleheen, Danish; Kadowaki, Takashi; Tai, E Shyong; Mohlke, Karen L; Cox, Nancy J; Ferrer, Jorge; Zeggini, Eleftheria; Kato, Norihiro; Teo, Yik Ying; Boehnke, Michael; McCarthy, Mark I; Morris, Andrew P

    2016-05-15

    To gain insight into potential regulatory mechanisms through which the effects of variants at four established type 2 diabetes (T2D) susceptibility loci (CDKAL1, CDKN2A-B, IGF2BP2 and KCNQ1) are mediated, we undertook transancestral fine-mapping in 22 086 cases and 42 539 controls of East Asian, European, South Asian, African American and Mexican American descent. Through high-density imputation and conditional analyses, we identified seven distinct association signals at these four loci, each with allelic effects on T2D susceptibility that were homogenous across ancestry groups. By leveraging differences in the structure of linkage disequilibrium between diverse populations, and increased sample size, we localised the variants most likely to drive each distinct association signal. We demonstrated that integration of these genetic fine-mapping data with genomic annotation can highlight potential causal regulatory elements in T2D-relevant tissues. These analyses provide insight into the mechanisms through which T2D association signals are mediated, and suggest future routes to understanding the biology of specific disease susceptibility loci. © The Author 2016. Published by Oxford University Press.

  4. Transancestral fine-mapping of four type 2 diabetes susceptibility loci highlights potential causal regulatory mechanisms

    PubMed Central

    Horikoshi, Momoko; Pasquali, Lorenzo; Wiltshire, Steven; Huyghe, Jeroen R.; Mahajan, Anubha; Asimit, Jennifer L.; Ferreira, Teresa; Locke, Adam E.; Robertson, Neil R.; Wang, Xu; Sim, Xueling; Fujita, Hayato; Hara, Kazuo; Young, Robin; Zhang, Weihua; Choi, Sungkyoung; Chen, Han; Kaur, Ismeet; Takeuchi, Fumihiko; Fontanillas, Pierre; Thuillier, Dorothée; Yengo, Loic; Below, Jennifer E.; Tam, Claudia H.T.; Wu, Ying; Abecasis, Gonçalo; Altshuler, David; Bell, Graeme I.; Blangero, John; Burtt, Noél P.; Duggirala, Ravindranath; Florez, Jose C.; Hanis, Craig L.; Seielstad, Mark; Atzmon, Gil; Chan, Juliana C.N.; Ma, Ronald C.W.; Froguel, Philippe; Wilson, James G.; Bharadwaj, Dwaipayan; Dupuis, Josee; Meigs, James B.; Cho, Yoon Shin; Park, Taesung; Kooner, Jaspal S.; Chambers, John C.; Saleheen, Danish; Kadowaki, Takashi; Tai, E. Shyong; Mohlke, Karen L.; Cox, Nancy J.; Ferrer, Jorge; Zeggini, Eleftheria; Kato, Norihiro; Teo, Yik Ying; Boehnke, Michael; McCarthy, Mark I.; Morris, Andrew P.

    2016-01-01

    To gain insight into potential regulatory mechanisms through which the effects of variants at four established type 2 diabetes (T2D) susceptibility loci (CDKAL1, CDKN2A-B, IGF2BP2 and KCNQ1) are mediated, we undertook transancestral fine-mapping in 22 086 cases and 42 539 controls of East Asian, European, South Asian, African American and Mexican American descent. Through high-density imputation and conditional analyses, we identified seven distinct association signals at these four loci, each with allelic effects on T2D susceptibility that were homogenous across ancestry groups. By leveraging differences in the structure of linkage disequilibrium between diverse populations, and increased sample size, we localised the variants most likely to drive each distinct association signal. We demonstrated that integration of these genetic fine-mapping data with genomic annotation can highlight potential causal regulatory elements in T2D-relevant tissues. These analyses provide insight into the mechanisms through which T2D association signals are mediated, and suggest future routes to understanding the biology of specific disease susceptibility loci. PMID:26911676

  5. Anti-Sigma Factors in E. coli: Common Regulatory Mechanisms Controlling Sigma Factors Availability.

    PubMed

    Treviño-Quintanilla, Luis Gerardo; Freyre-González, Julio Augusto; Martínez-Flores, Irma

    2013-09-01

    In bacteria, transcriptional regulation is a key step in cellular gene expression. All bacteria contain a core RNA polymerase that is catalytically competent but requires an additional σ factor for specific promoter recognition and correct transcriptional initiation. The RNAP core is not able to selectively bind to a given σ factor. In contrast, different σ factors have different affinities for the RNAP core. As a consequence, the concentration of alternate σ factors requires strict regulation in order to properly control the delicate interplay among them, which favors the competence for the RNAP core. This control is archived by different σ/anti-σ controlling mechanisms that shape complex regulatory networks and cascades, and enable the response to sudden environmental cues, whose global understanding is a current challenge for systems biology. Although there have been a number of excellent studies on each of these σ/anti-σ post-transcriptional regulatory systems, no comprehensive comparison of these mechanisms in a single model organism has been conducted. Here, we survey all these systems in E. coli dissecting and analyzing their inner workings and highlightin their differences. Then, following an integral approach, we identify their commonalities and outline some of the principles exploited by the cell to effectively and globally reprogram the transcriptional machinery. These principles provide guidelines for developing biological synthetic circuits enabling an efficient and robust response to sudden stimuli.

  6. An indoxyl compound 5-bromo-4-chloro-3-indolyl 1,3-diacetate, CAC-0982, suppresses activation of Fyn kinase in mast cells and IgE-mediated allergic responses in mice

    SciTech Connect

    Lee, Jun Ho; Kim, Tae Hyung; Kim, Hyuk Soon; Kim, A-Ram; Kim, Do-Kyun; Nam, Seung Taek; Kim, Hyun Woo; Park, Young Hwan; Her, Erk; Park, Yeong Min; Kim, Hyung Sik; Kim, Young Mi; Choi, Wahn Soo

    2015-06-15

    Mast cells, constituents of virtually all organs and tissues, are critical cells in IgE-mediated allergic responses. The aim of this study was to investigate the effect and mechanism of an indoxyl chromogenic compound, 5-bromo-4-chloro-3-indolyl 1,3-diacetate, CAC-0982, on IgE-mediated mast cell activation and allergic responses in mice. CAC-0982 reversibly suppressed antigen-stimulated degranulation in murine mast cells (IC{sub 50}, ~ 3.8 μM) and human mast cells (IC{sub 50}, ~ 3.0 μM). CAC-0982 also inhibited the expression and secretion of IL-4 and TNF-α in mast cells. Furthermore, CAC-0982 suppressed the mast cell-mediated allergic responses in mice in a dose-dependent manner (ED{sub 50} 27.9 mg/kg). As for the mechanism, CAC-0982 largely suppressed the phosphorylation of Syk and its downstream signaling molecules, including LAT, Akt, Erk1/2, p38, and JNK. Notably, the tyrosine kinase assay of antigen-stimulated mast cells showed that CAC-0982 inhibited Fyn kinase, one of the upstream tyrosine kinases for Syk activation in mast cells. Taken together, these results suggest that CAC-0982 may be used as a new treatment for regulating IgE-mediated allergic diseases through the inhibition of the Fyn/Syk pathway in mast cells. - Highlights: • The anti-allergic effect of 5-bromo-4-chloro-3-indolyl 1,3-diacetate, CAC-0982, was measured. • CAC-0982 reversibly suppressed the activation of mast cells by IgE and antigen. • CAC-0982 inhibited passive cutaneous anaphylaxis in mice. • CAC-0982 suppresses mast cells through inhibition of Fyn activation in mast cells.

  7. Regulatory RNAs and control of epigenetic mechanisms: expectations for cognition and cognitive dysfunction

    PubMed Central

    Butler, Anderson A; Webb, William M; Lubin, Farah D

    2016-01-01

    The diverse functions of noncoding RNAs (ncRNAs) can influence virtually every aspect of the transcriptional process including epigenetic regulation of genes. In the CNS, regulatory RNA networks and epigenetic mechanisms have broad relevance to gene transcription changes involved in long-term memory formation and cognition. Thus, it is becoming increasingly clear that multiple classes of ncRNAs impact neuronal development, neuroplasticity, and cognition. Currently, a large gap exists in our knowledge of how ncRNAs facilitate epigenetic processes, and how this phenomenon affects cognitive function. In this review, we discuss recent findings highlighting a provocative role for ncRNAs including lncRNAs and piRNAs in the control of epigenetic mechanisms involved in cognitive function. Furthermore, we discuss the putative roles for these ncRNAs in cognitive disorders such as schizophrenia and Alzheimer's disease. PMID:26366811

  8. Transcription factor abundance controlled by an auto-regulatory mechanism involving a transcription start site switch.

    PubMed

    Ngondo, Richard Patryk; Carbon, Philippe

    2014-02-01

    A transcriptional feedback loop is the simplest and most direct means for a transcription factor to provide an increased stability of gene expression. In this work performed in human cells, we reveal a new negative auto-regulatory mechanism involving an alternative transcription start site (TSS) usage. Using the activating transcription factor ZNF143 as a model, we show that the ZNF143 low-affinity binding sites, located downstream of its canonical TSS, play the role of protein sensors to induce the up- or down-regulation of ZNF143 gene expression. We uncovered that the TSS switch that mediates this regulation implies the differential expression of two transcripts with an opposite protein production ability due to their different 5' untranslated regions. Moreover, our analysis of the ENCODE data suggests that this mechanism could be used by other transcription factors to rapidly respond to their own aberrant expression level.

  9. An atlas of gene regulatory networks reveals multiple three-gene mechanisms for interpreting morphogen gradients

    PubMed Central

    Cotterell, James; Sharpe, James

    2010-01-01

    The interpretation of morphogen gradients is a pivotal concept in developmental biology, and several mechanisms have been proposed to explain how gene regulatory networks (GRNs) achieve concentration-dependent responses. However, the number of different mechanisms that may exist for cells to interpret morphogens, and the importance of design features such as feedback or local cell–cell communication, is unclear. A complete understanding of such systems will require going beyond a case-by-case analysis of real morphogen interpretation mechanisms and mapping out a complete GRN ‘design space.' Here, we generate a first atlas of design space for GRNs capable of patterning a homogeneous field of cells into discrete gene expression domains by interpreting a fixed morphogen gradient. We uncover multiple very distinct mechanisms distributed discretely across the atlas, thereby expanding the repertoire of morphogen interpretation network motifs. Analyzing this diverse collection of mechanisms also allows us to predict that local cell–cell communication will rarely be responsible for the basic dose-dependent response of morphogen interpretation networks. PMID:21045819

  10. The residue at position 5 of the N-terminal region of Src and Fyn modulates their myristoylation, palmitoylation, and membrane interactions

    PubMed Central

    Gottlieb-Abraham, Efrat; Gutman, Orit; Pai, Govind M.; Rubio, Ignacio; Henis, Yoav I.

    2016-01-01

    The interactions of Src family kinases (SFKs) with the plasma membrane are crucial for their activity. They depend on their fatty-acylated N-termini, containing N-myristate and either a polybasic cluster (in Src) or palmitoylation sites (e.g., Fyn). To investigate the roles of these moieties in SFK membrane association, we used fluorescence recovery after photobleaching beam-size analysis to study the membrane interactions of c-Src-GFP (green fluorescent protein) or Fyn-GFP fatty-acylation mutants. Our studies showed for the first time that the membrane association of Fyn is more stable than that of Src, an effect lost in a Fyn mutant lacking the palmitoylation sites. Unexpectedly, Src-S3C/S6C (containing cysteines at positions 3/6, which are palmitoylated in Fyn) exhibited fast cytoplasmic diffusion insensitive to palmitoylation inhibitors, suggesting defective fatty acylation. Further replacement of the charged Lys-5 by neutral Gln to resemble Fyn (Src-S3C/S6C/K5Q) restored Fyn-like membrane interactions, indicating that Lys-5 in the context of Src-S3C/S6C interferes with its myristoylation/palmitoylation. This was validated by direct myristoylation and palmitoylation studies, which indicated that the residue at position 5 regulates the membrane interactions of Src versus Fyn. Moreover, the palmitoylation levels correlated with targeting to detergent-resistant membranes (rafts) and to caveolin-1. Palmitoylation-dependent preferential containment of Fyn in rafts may contribute to its lower transformation potential. PMID:27733622

  11. Comparative genomic analysis of NAC transcriptional factors to dissect the regulatory mechanisms for cell wall biosynthesis.

    PubMed

    Yao, Dongxia; Wei, Qiang; Xu, Wenying; Syrenne, Ryan D; Yuan, Joshua S; Su, Zhen

    2012-01-01

    evolution and the gene regulatory network of a subgroup of the NAC gene family controlling cell wall composition through bioinformatics data mining and bench validation. Our work might benefit to elucidate the possible molecular mechanism underlying the regulation network of secondary cell wall biosynthesis.

  12. The nature and mechanisms of DN regulatory T-cell mediated suppression.

    PubMed

    Young, Kevin J; Zhang, Li

    2002-10-01

    Regulatory T cells have been reported to enhance survival of transplanted allografts. We have recently identified and cloned a novel CD3(+)CD4(-)CD8(-) (double negative, DN) regulatory T cell from mice that were given a single class I mismatched donor lymphocyte infusion and permanently accepted donor-specific skin allografts. When infused into naïve syngeneic mice, these DN T cells prolonged the survival of class I mismatched donor skin allografts. Here we further characterize the nature and mechanism of DN T-cell mediated suppression. This present study reveals that DN T cells are able to specifically eliminate activated syngeneic CD8(+) T cells that share the same T cell receptor (TCR) specificity as DN T cells in vitro. Similarly, we found that, along with an increase of recipient DN T cells in the peripheral blood, anti-donor CD8(+) T cells were also eliminated in vivo following a donor lymphocyte infusion. We further demonstrate that DN T regulatory cells do not mediate suppression by competition for growth factors or antigen presenting cells (APC) nor by modulation of APC, but require cell contact with the activated target CD8(+) T cells. This contact can be mediated either by the TCR on CD8(+) T cells that recognize constitutively expressed or acquired MHC molecules on DN T cells, or by the TCR on DN T cells that recognize constitutively expressed MHC molecules on CD8(+) T cells. Together, these data extend our previous findings, and expand the conditions in which DN T cells can potentially be used to specifically suppress allogeneic immune responses.

  13. Molecular mechanism underlying the regulatory specificity of a Drosophila homeodomain protein that specifies myoblast identity

    PubMed Central

    Busser, Brian W.; Shokri, Leila; Jaeger, Savina A.; Gisselbrecht, Stephen S.; Singhania, Aditi; Berger, Michael F.; Zhou, Bo; Bulyk, Martha L.; Michelson, Alan M.

    2012-01-01

    A subfamily of Drosophila homeodomain (HD) transcription factors (TFs) controls the identities of individual muscle founder cells (FCs). However, the molecular mechanisms by which these TFs generate unique FC genetic programs remain unknown. To investigate this problem, we first applied genome-wide mRNA expression profiling to identify genes that are activated or repressed by the muscle HD TFs Slouch (Slou) and Muscle segment homeobox (Msh). Next, we used protein-binding microarrays to define the sequences that are bound by Slou, Msh and other HD TFs that have mesodermal expression. These studies revealed that a large class of HDs, including Slou and Msh, predominantly recognize TAAT core sequences but that each HD also binds to unique sites that deviate from this canonical motif. To understand better the regulatory specificity of an individual FC identity HD, we evaluated the functions of atypical binding sites that are preferentially bound by Slou relative to other HDs within muscle enhancers that are either activated or repressed by this TF. These studies showed that Slou regulates the activities of particular myoblast enhancers through Slou-preferred sequences, whereas swapping these sequences for sites that are capable of binding to multiple HD family members does not support the normal regulatory functions of Slou. Moreover, atypical Slou-binding sites are overrepresented in putative enhancers associated with additional Slou-responsive FC genes. Collectively, these studies provide new insights into the roles of individual HD TFs in determining cellular identity, and suggest that the diversity of HD binding preferences can confer regulatory specificity. PMID:22296846

  14. Innovation of a Regulatory Mechanism Modulating Semi-determinate Stem Growth through Artificial Selection in Soybean

    PubMed Central

    Ping, Jieqing; Li, Shuai; Chen, Zhixiang; Ma, Jianxin

    2016-01-01

    It has been demonstrated that Terminal Flowering 1 (TFL1) in Arabidopsis and its functional orthologs in other plants specify indeterminate stem growth through their specific expression that represses floral identity genes in shoot apical meristems (SAMs), and that the loss-of-function mutations at these functional counterparts result in the transition of SAMs from the vegetative to reproductive state that is essential for initiation of terminal flowering and thus formation of determinate stems. However, little is known regarding how semi-determinate stems, which produce terminal racemes similar to those observed in determinate plants, are specified in any flowering plants. Here we show that semi-determinacy in soybean is modulated by transcriptional repression of Dt1, the functional ortholog of TFL1, in SAMs. Such repression is fulfilled by recently enabled spatiotemporal expression of Dt2, an ancestral form of the APETALA1/FRUITFULL orthologs, which encodes a MADS-box factor directly binding to the regulatory sequence of Dt1. In addition, Dt2 triggers co-expression of the putative SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (GmSOC1) in SAMs, where GmSOC1 interacts with Dt2, and also directly binds to the Dt1 regulatory sequence. Heterologous expression of Dt2 and Dt1 in determinate (tfl1) Arabidopsis mutants enables creation of semi-determinacy, but the same forms of the two genes in the tfl1 and soc1 background produce indeterminate stems, suggesting that Dt2 and SOC1 both are essential for transcriptional repression of Dt1. Nevertheless, the expression of Dt2 is unable to repress TFL1 in Arabidopsis, further demonstrating the evolutionary novelty of the regulatory mechanism underlying stem growth in soybean. PMID:26807727

  15. Regulatory Mechanisms Underlying the Expression of Prolactin Receptor in Chicken Granulosa Cells

    PubMed Central

    Hu, Shenqiang; Duggavathi, Raj; Zadworny, David

    2017-01-01

    Prolactin (PRL) has both pro- and anti-gonadal roles in the regulation of avian ovarian functions through its interaction with the receptor (PRLR). However, neither the pattern of expression of PRLR nor its regulatory mechanisms during follicle development have been clearly defined. The objective of the present study was to investigate mechanisms of PRLR expression in chicken granulosa cells. Levels of PRLR transcript were highest in the stroma and walls of follicles < 2 mm in diameter and progressively declined with the maturation of follicles. In preovulatory follicles, PRLR was expressed at higher levels in granulosa than theca layers. FSH exerted the greatest stimulatory effect on PRLR and StAR expression in cultured granulosa cells of the 6–8 mm follicles but this effect declined as follicles matured to F1. In contrast, LH did not alter the expression of PRLR in granulosa cells of all follicular classes but increased levels of StAR in F2 and F1 granulosa cells. Both non-glycosylated- (NG-) and glycosylated- (G-) PRL upregulated basal PRLR expression in granulosa cells of the 6–8 mm, F3 or F1 follicles but had little effect in F2 follicles. Furthermore, FSH-stimulated PRLR expression was reduced by the addition of either isoform of PRL especially in F2 granulosa cells. These results indicate that PRLR is differentially distributed and regulated by FSH or PRL variants independently or in combination in the follicular hierarchy. By using activators and inhibitors, we further demonstrated that multiple signaling pathways, including PKA, PKC, PI3K, mTOR and AMPK, are not only directly involved in, but they can also converge to modulate ERK2 activity to regulate FSH-mediated PRLR and StAR expression in undifferentiated granulosa cells. These data provide new insights into the regulatory mechanisms controlling the expression of PRLR in granulosa cells. PMID:28107515

  16. Putting theory to the test: which regulatory mechanisms can drive realistic growth of a root?

    PubMed

    De Vos, Dirk; Vissenberg, Kris; Broeckhove, Jan; Beemster, Gerrit T S

    2014-10-01

    In recent years there has been a strong development of computational approaches to mechanistically understand organ growth regulation in plants. In this study, simulation methods were used to explore which regulatory mechanisms can lead to realistic output at the cell and whole organ scale and which other possibilities must be discarded as they result in cellular patterns and kinematic characteristics that are not consistent with experimental observations for the Arabidopsis thaliana primary root. To aid in this analysis, a 'Uniform Longitudinal Strain Rule' (ULSR) was formulated as a necessary condition for stable, unidirectional, symplastic growth. Our simulations indicate that symplastic structures are robust to differences in longitudinal strain rates along the growth axis only if these differences are small and short-lived. Whereas simple cell-autonomous regulatory rules based on counters and timers can produce stable growth, it was found that steady developmental zones and smooth transitions in cell lengths are not feasible. By introducing spatial cues into growth regulation, those inadequacies could be avoided and experimental data could be faithfully reproduced. Nevertheless, a root growth model based on previous polar auxin-transport mechanisms violates the proposed ULSR due to the presence of lateral gradients. Models with layer-specific regulation or layer-driven growth offer potential solutions. Alternatively, a model representing the known cross-talk between auxin, as the cell proliferation promoting factor, and cytokinin, as the cell differentiation promoting factor, predicts the effect of hormone-perturbations on meristem size. By down-regulating PIN-mediated transport through the transcription factor SHY2, cytokinin effectively flattens the lateral auxin gradient, at the basal boundary of the division zone, (thereby imposing the ULSR) to signal the exit of proliferation and start of elongation. This model exploration underlines the value of

  17. Putting Theory to the Test: Which Regulatory Mechanisms Can Drive Realistic Growth of a Root?

    PubMed Central

    De Vos, Dirk; Vissenberg, Kris; Broeckhove, Jan; Beemster, Gerrit T. S.

    2014-01-01

    In recent years there has been a strong development of computational approaches to mechanistically understand organ growth regulation in plants. In this study, simulation methods were used to explore which regulatory mechanisms can lead to realistic output at the cell and whole organ scale and which other possibilities must be discarded as they result in cellular patterns and kinematic characteristics that are not consistent with experimental observations for the Arabidopsis thaliana primary root. To aid in this analysis, a ‘Uniform Longitudinal Strain Rule’ (ULSR) was formulated as a necessary condition for stable, unidirectional, symplastic growth. Our simulations indicate that symplastic structures are robust to differences in longitudinal strain rates along the growth axis only if these differences are small and short-lived. Whereas simple cell-autonomous regulatory rules based on counters and timers can produce stable growth, it was found that steady developmental zones and smooth transitions in cell lengths are not feasible. By introducing spatial cues into growth regulation, those inadequacies could be avoided and experimental data could be faithfully reproduced. Nevertheless, a root growth model based on previous polar auxin-transport mechanisms violates the proposed ULSR due to the presence of lateral gradients. Models with layer-specific regulation or layer-driven growth offer potential solutions. Alternatively, a model representing the known cross-talk between auxin, as the cell proliferation promoting factor, and cytokinin, as the cell differentiation promoting factor, predicts the effect of hormone-perturbations on meristem size. By down-regulating PIN-mediated transport through the transcription factor SHY2, cytokinin effectively flattens the lateral auxin gradient, at the basal boundary of the division zone, (thereby imposing the ULSR) to signal the exit of proliferation and start of elongation. This model exploration underlines the value of

  18. Regulatory mechanisms of metabolic flexibility in the dark-eyed junco (Junco hyemalis).

    PubMed

    Stager, Maria; Swanson, David L; Cheviron, Zachary A

    2015-03-01

    Small temperate birds reversibly modify their aerobic performance to maintain thermoregulatory homeostasis under seasonally changing environmental conditions and these physiological adjustments may be attributable to changes in the expression of genes in the underlying regulatory networks. Here, we report the results of an experimental procedure designed to gain insight into the fundamental mechanisms of metabolic flexibility in the dark-eyed junco (Junco hyemalis). We combined genomic transcriptional profiles with measures of metabolic enzyme activities and whole-animal thermogenic performance from juncos exposed to four 6-week acclimation treatments that varied in temperature (cold, 3°C; warm, 24°C) and photoperiod (short day, 8 h light:16 h dark; long day, 16 h light:8 h dark). Cold-acclimated birds increased thermogenic capacity compared with warm-acclimated birds, and this enhanced performance was associated with upregulation of genes involved in muscle hypertrophy, angiogenesis, and lipid transport and oxidation, as well as with catabolic enzyme activities. These physiological changes occurred over ecologically relevant timescales, suggesting that birds make regulatory adjustments to interacting, hierarchical pathways in order to seasonally enhance thermogenic capacity.

  19. Visual- and Vestibular-Autonomic Influence on Short-Term Cardiovascular Regulatory Mechanisms

    NASA Technical Reports Server (NTRS)

    Mullen, Thomas J.; Ramsdell, Craig D.

    1999-01-01

    This synergy project was a one-year effort conducted cooperatively by members of the NSBRI Cardiovascular Alterations and Neurovestibular Adaptation Teams in collaboration with NASA Johnson Space Center (JSC) colleagues. The objective of this study was to evaluate visual autonomic interactions on short-term cardiovascular regulatory mechanisms. Based on established visual-vestibular and vestibular-autonomic shared neural pathways, we hypothesized that visually induced changes in orientation will trigger autonomic cardiovascular reflexes. A second objective was to compare baroreflex changes during postural changes as measured with the new Cardiovascular System Identification (CSI) technique with those measured using a neck barocuff. While the neck barocuff stimulates only the carotid baroreceptors, CSI provides a measure of overall baroreflex responsiveness. This study involved a repeated measures design with 16 healthy human subjects (8 M, 8 F) to examine cardiovascular regulatory responses during actual and virtual head-upright tilts. Baroreflex sensitivity was first evaluated with subjects in supine and upright positions during actual tilt-table testing using both neck barocuff and CSI methods. The responses to actual tilts during this first session were then compared to responses during visually induced tilt and/or rotation obtained during a second session.

  20. Global analysis of p53-regulated transcription identifies its direct targets and unexpected regulatory mechanisms

    PubMed Central

    Allen, Mary Ann; Andrysik, Zdenek; Dengler, Veronica L; Mellert, Hestia S; Guarnieri, Anna; Freeman, Justin A; Sullivan, Kelly D; Galbraith, Matthew D; Luo, Xin; Kraus, W Lee; Dowell, Robin D; Espinosa, Joaquin M

    2014-01-01

    The p53 transcription factor is a potent suppressor of tumor growth. We report here an analysis of its direct transcriptional program using Global Run-On sequencing (GRO-seq). Shortly after MDM2 inhibition by Nutlin-3, low levels of p53 rapidly activate ∼200 genes, most of them not previously established as direct targets. This immediate response involves all canonical p53 effector pathways, including apoptosis. Comparative global analysis of RNA synthesis vs steady state levels revealed that microarray profiling fails to identify low abundance transcripts directly activated by p53. Interestingly, p53 represses a subset of its activation targets before MDM2 inhibition. GRO-seq uncovered a plethora of gene-specific regulatory features affecting key survival and apoptotic genes within the p53 network. p53 regulates hundreds of enhancer-derived RNAs. Strikingly, direct p53 targets harbor pre-activated enhancers highly transcribed in p53 null cells. Altogether, these results enable the study of many uncharacterized p53 target genes and unexpected regulatory mechanisms. DOI: http://dx.doi.org/10.7554/eLife.02200.001 PMID:24867637

  1. Use of lactobacilli and their pheromone-based regulatory mechanism in gene expression and drug delivery.

    PubMed

    Diep, D B; Mathiesen, G; Eijsink, V G H; Nes, I F

    2009-01-01

    Lactobacilli are common microorganisms in diverse vegetables and meat products and several of these are also indigenous inhabitants in the gastro-intestinal (GI) tract of humans and animals where they are believed to have health promoting effects on the host. One of the highly appreciated probiotic effects is their ability to inhibit the growth of pathogens by producing antimicrobial peptides, so-called bacteriocins. Production of some bacteriocins has been shown to be strictly regulated through a quorum-sensing based mechanism mediated by a secreted peptide-pheromone (also called induction peptide; IP), a membrane-located sensor (histidine protein kinase; HPK) and a cytoplasmic response regulator (RR). The interaction between an IP and its sensor, which is highly specific, leads to activation of the cognate RR which in turn binds to regulated promoters and activates gene expression. The HPKs and RRs are built up by conserved modules, and the signalling between them within a network is efficient and directional, and can easily be activated by exogenously added synthetic IPs. Consequently, components from such regulatory networks have successfully been exploited in construction of a number of inducible gene expression systems. In this review, we discuss some well-characterised quorum sensing networks involved in bacteriocin production in lactobacilli, with special focus on the use of the regulatory components in gene expression and on lactobacilli as potential delivery vehicle for therapeutic and vaccine purposes.

  2. Visual- and Vestibular-Autonomic Influence on Short-Term Cardiovascular Regulatory Mechanisms

    NASA Technical Reports Server (NTRS)

    Mullen, Thomas J.; Ramsdell, Craig D.

    1999-01-01

    This synergy project was a one-year effort conducted cooperatively by members of the NSBRI Cardiovascular Alterations and Neurovestibular Adaptation Teams in collaboration with NASA Johnson Space Center (JSC) colleagues. The objective of this study was to evaluate visual autonomic interactions on short-term cardiovascular regulatory mechanisms. Based on established visual-vestibular and vestibular-autonomic shared neural pathways, we hypothesized that visually induced changes in orientation will trigger autonomic cardiovascular reflexes. A second objective was to compare baroreflex changes during postural changes as measured with the new Cardiovascular System Identification (CSI) technique with those measured using a neck barocuff. While the neck barocuff stimulates only the carotid baroreceptors, CSI provides a measure of overall baroreflex responsiveness. This study involved a repeated measures design with 16 healthy human subjects (8 M, 8 F) to examine cardiovascular regulatory responses during actual and virtual head-upright tilts. Baroreflex sensitivity was first evaluated with subjects in supine and upright positions during actual tilt-table testing using both neck barocuff and CSI methods. The responses to actual tilts during this first session were then compared to responses during visually induced tilt and/or rotation obtained during a second session.

  3. A systems biology approach to defining regulatory mechanisms for cartilage and tendon cell phenotypes

    PubMed Central

    Mueller, A. J.; Tew, S. R.; Vasieva, O.; Clegg, P. D.; Canty-Laird, E. G.

    2016-01-01

    Phenotypic plasticity of adult somatic cells has provided emerging avenues for the development of regenerative therapeutics. In musculoskeletal biology the mechanistic regulatory networks of genes governing the phenotypic plasticity of cartilage and tendon cells has not been considered systematically. Additionally, a lack of strategies to effectively reproduce in vitro functional models of cartilage and tendon is retarding progress in this field. De- and redifferentiation represent phenotypic transitions that may contribute to loss of function in ageing musculoskeletal tissues. Applying a systems biology network analysis approach to global gene expression profiles derived from common in vitro culture systems (monolayer and three-dimensional cultures) this study demonstrates common regulatory mechanisms governing de- and redifferentiation transitions in cartilage and tendon cells. Furthermore, evidence of convergence of gene expression profiles during monolayer expansion of cartilage and tendon cells, and the expression of key developmental markers, challenges the physiological relevance of this culture system. The study also suggests that oxidative stress and PI3K signalling pathways are key modulators of in vitro phenotypes for cells of musculoskeletal origin. PMID:27670352

  4. Peripheral circadian rhythms and their regulatory mechanism in insects and some other arthropods: a review.

    PubMed

    Tomioka, Kenji; Uryu, Outa; Kamae, Yuichi; Umezaki, Yujiro; Yoshii, Taishi

    2012-08-01

    Many physiological functions of insects show a rhythmic change to adapt to daily environmental cycles. These rhythms are controlled by a multi-clock system. A principal clock located in the brain usually organizes the overall behavioral rhythms, so that it is called the "central clock". However, the rhythms observed in a variety of peripheral tissues are often driven by clocks that reside in those tissues. Such autonomous rhythms can be found in sensory organs, digestive and reproductive systems. Using Drosophila melanogaster as a model organism, researchers have revealed that the peripheral clocks are self-sustained oscillators with a molecular machinery slightly different from that of the central clock. However, individual clocks normally run in harmony with each other to keep a coordinated temporal structure within an animal. How can this be achieved? What is the molecular mechanism underlying the oscillation? Also how are the peripheral clocks entrained by light-dark cycles? There are still many questions remaining in this research field. In the last several years, molecular techniques have become available in non-model insects so that the molecular oscillatory mechanisms are comparatively investigated among different insects, which give us more hints to understand the essential regulatory mechanism of the multi-oscillatory system across insects and other arthropods. Here we review current knowledge on arthropod's peripheral clocks and discuss their physiological roles and molecular mechanisms.

  5. Regulatory mechanisms of nitric oxide and reactive oxygen species generation and their role in plant immunity.

    PubMed

    Yoshioka, Hirofumi; Mase, Keisuke; Yoshioka, Miki; Kobayashi, Michie; Asai, Shuta

    2011-08-01

    Rapid production of nitric oxide (NO) and reactive oxygen species (ROS) has been implicated in diverse physiological processes, such as programmed cell death, development, cell elongation and hormonal signaling, in plants. Much attention has been paid to the regulation of plant innate immunity by these signal molecules. Recent studies provide evidence that an NADPH oxidase, respiratory burst oxidase homolog, is responsible for pathogen-responsive ROS burst. However, we still do not know about NO-producing enzymes, except for nitrate reductase, although many studies suggest the existence of NO synthase-like activity responsible for NO burst in plants. Here, we introduce regulatory mechanisms of NO and ROS bursts by mitogen-activated protein kinase cascades, calcium-dependent protein kinase or riboflavin and its derivatives, flavin mononucleotide and flavin adenine dinucleotide, and we discuss the roles of the bursts in defense responses against plant pathogens.

  6. The Regulatory Mechanisms of Tumor Suppressor P16INK4A and Relevance to Cancer†

    PubMed Central

    Li, Junan; Poi, Ming Jye; Tsai, Ming-Daw

    2011-01-01

    P16INK4A (also known as P16 and MTS1), a protein consisting exclusively of four ankyrin repeats, is recognized as a tumor suppressor mainly due to the prevalence of genetic inactivation of the p16INK4A (or CDKN2A) gene in virtually all types of human cancers. However, it has also been shown that elevated expression (up-regulation) of P16 is involved in cellular senescence, aging, and cancer progression, indicating that the regulation of P16 is critical for its function. Here, we discuss the regulatory mechanisms of P16 function at the DNA level, the transcription level, and the posttranscriptional level, as well as their implications in the structure-function relationship of P16 and in human cancers. PMID:21619050

  7. Mechanistic Basis for Plant Responses to Drought Stress : Regulatory Mechanism of Abscisic Acid Signaling

    NASA Astrophysics Data System (ADS)

    Miyakawa, Takuya; Tanokura, Masaru

    The phytohormone abscisic acid (ABA) plays a key role in the rapid adaptation of plants to environmental stresses such as drought and high salinity. Accumulated ABA in plant cells promotes stomatal closure in guard cells and transcription of stress-tolerant genes. Our understanding of ABA responses dramatically improved by the discovery of both PYR/PYL/RCAR as a soluble ABA receptor and inhibitory complex of a protein phospatase PP2C and a protein kinase SnRK2. Moreover, several structural analyses of PYR/PYL/RCAR revealed the mechanistic basis for the regulatory mechanism of ABA signaling, which provides a rational framework for the design of alternative agonists in future.

  8. Regulatory mechanisms of tumor suppressor P16(INK4A) and their relevance to cancer.

    PubMed

    Li, Junan; Poi, Ming Jye; Tsai, Ming-Daw

    2011-06-28

    P16(INK4A) (also known as P16 and MTS1), a protein consisting exclusively of four ankyrin repeats, is recognized as a tumor suppressor mainly because of the prevalence of genetic inactivation of the p16(INK4A) (or CDKN2A) gene in virtually all types of human cancers. However, it has also been shown that an elevated level of expression (upregulation) of P16 is involved in cellular senescence, aging, and cancer progression, indicating that the regulation of P16 is critical for its function. Here, we discuss the regulatory mechanisms of P16 function at the DNA level, the transcription level, and the posttranscriptional level, as well as their implications for the structure-function relationship of P16 and for human cancers.

  9. Regulatory motifs on ISWI chromatin remodelers: molecular mechanisms and kinetic proofreading

    NASA Astrophysics Data System (ADS)

    Brysbaert, Guillaume; Lensink, Marc F.; Blossey, Ralf

    2015-02-01

    Recently, kinetic proofreading scenarios have been proposed for the regulation of chromatin remodeling, first on purely theoretical grounds (Blossey and Schiessel 2008 HFSP J. 2 167-70) and deduced from experiments on the ISWI/ACF system (Narlikar 2010 Curr. Opin. Chem. Biol. 14 660). In the kinetic proofreading scenario of chromatin remodeling, the combination of the recognition of a histone tail state and ATP-hydrolysis in the remodeler motor act together to select (i.e. proofread) a nucleosomal substrate. ISWI remodelers have recently been shown to have an additional level of regulation as they contain auto-inhibitory motifs which need to be inactivated through an interaction with the nucleosome. In this paper we show that the auto-regulatory effect enhances substrate recognition in kinetic proofreading. We further report some suggestive additional insights into the molecular mechanism underlying ISWI-autoregulation.

  10. Transcriptional control of photosynthesis genes: the evolutionarily conserved regulatory mechanism in plastid genome function.

    PubMed

    Puthiyaveetil, Sujith; Ibrahim, Iskander M; Jelicić, Branka; Tomasić, Ana; Fulgosi, Hrvoje; Allen, John F

    2010-01-01

    Chloroplast sensor kinase (CSK) is a bacterial-type sensor histidine kinase found in chloroplasts--photosynthetic plastids--in eukaryotic plants and algae. Using a yeast two-hybrid screen, we demonstrate recognition and interactions between: CSK, plastid transcription kinase (PTK), and a bacterial-type RNA polymerase sigma factor-1 (SIG-1). CSK interacts with itself, with SIG-1, and with PTK. PTK also interacts directly with SIG-1. PTK has previously been shown to catalyze phosphorylation of plastid-encoded RNA polymerase (PEP), suppressing plastid transcription nonspecifically. Phospho-PTK is inactive as a PEP kinase. Here, we propose that phospho-CSK acts as a PTK kinase, releasing PTK repression of chloroplast transcription, while CSK also acts as a SIG-1 kinase, blocking transcription specifically at the gene promoter of chloroplast photosystem I. Oxidation of the photosynthetic electron carrier plastoquinone triggers phosphorylation of CSK, inducing chloroplast photosystem II while suppressing photosystem I. CSK places photosystem gene transcription under the control of photosynthetic electron transport. This redox signaling pathway has its origin in cyanobacteria, photosynthetic prokaryotes from which chloroplasts evolved. The persistence of this mechanism in cytoplasmic organelles of photosynthetic eukaryotes is in precise agreement with the CoRR hypothesis for the function of organellar genomes: the plastid genome and its primary gene products are Co-located for Redox Regulation. Genes are retained in plastids primarily in order for their expression to be subject to this rapid and robust redox regulatory transcriptional control mechanism, whereas plastid genes also encode genetic system components, such as some ribosomal proteins and RNAs, that exist in order to support this primary, redox regulatory control of photosynthesis genes. Plastid genome function permits adaptation of the photosynthetic apparatus to changing environmental conditions of light

  11. Interplay of cis- and trans-regulatory mechanisms in the spliceosomal RNA helicase Brr2.

    PubMed

    Absmeier, Eva; Becke, Christian; Wollenhaupt, Jan; Santos, Karine F; Wahl, Markus C

    2017-01-02

    RNA helicase Brr2 is implicated in multiple phases of pre-mRNA splicing and thus requires tight regulation. Brr2 can be auto-inhibited via a large N-terminal region folding back onto its helicase core and auto-activated by a catalytically inactive C-terminal helicase cassette. Furthermore, it can be regulated in trans by the Jab1 domain of the Prp8 protein, which can inhibit Brr2 by intermittently inserting a C-terminal tail in the enzyme's RNA-binding tunnel or activate the helicase after removal of this tail. Presently it is unclear, whether these regulatory mechanisms functionally interact and to which extent they are evolutionarily conserved. Here, we report crystal structures of Saccharomyces cerevisiae and Chaetomium thermophilum Brr2-Jab1 complexes, demonstrating that Jab1-based inhibition of Brr2 presumably takes effect in all eukaryotes but is implemented via organism-specific molecular contacts. Moreover, the structures show that Brr2 auto-inhibition can act in concert with Jab1-mediated inhibition, and suggest that the N-terminal region influences how the Jab1 C-terminal tail interacts at the RNA-binding tunnel. Systematic RNA binding and unwinding studies revealed that the N-terminal region and the Jab1 C-terminal tail specifically interfere with accommodation of double-stranded and single-stranded regions of an RNA substrate, respectively, mutually reinforcing each other. Additionally, such analyses show that regulation based on the N-terminal region requires the presence of the inactive C-terminal helicase cassette. Together, our results outline an intricate system of regulatory mechanisms, which control Brr2 activities during snRNP assembly and splicing.

  12. Acute-Phase Serum Amyloid A in Osteoarthritis: Regulatory Mechanism and Proinflammatory Properties

    PubMed Central

    de Seny, Dominique; Cobraiville, Gaël; Charlier, Edith; Neuville, Sophie; Esser, Nathalie; Malaise, Denis; Malaise, Olivier; Calvo, Florence Quesada; Relic, Biserka; Malaise, Michel G.

    2013-01-01

    Objective To determine if serum amyloid A (A-SAA) could be detected in human osteoarthritic (OA) joints and further clarify if high A-SAA level in joints result from a local production or from a diffusion process from abnormally elevated plasma concentration. Regulatory mechanism of A-SAA expression and its pro-inflammatory properties were also investigated. Methods A-SAA levels in serum and synovial fluid of OA (n = 29) and rheumatoid arthritis (RA) (n = 27) patients were measured and compared to matched-healthy volunteers (HV) (n = 35). In vitro cell cultures were performed on primary joint cells provided from osteoarthritis patients. Regulatory mechanisms were studied using Western-blotting, ELISA and lentiviral transfections. Results A-SAA was statistically increased in OA plasma patients compared to HV. Moreover, A-SAA level in OA plasma and synovial fluid increased with the Kellgren & Lauwrence grade. For all OA and RA patients, A-SAA plasma level was higher and highly correlated with its corresponding level in the synovial fluid, therefore supporting that A-SAA was mainly due to the passive diffusion process from blood into the joint cavity. However, A-SAA expression was also observed in vitro under corticosteroid treatment and/or under IL-1beta stimuli. A-SAA expression was down-regulated by PPAR-γ agonists (genistein and rosiglitazone) and up-regulated by TGF-β1 through Alk1 (Smad1/5) pathway. RhSAA induced proinflammatory cytokines (IL-6, IL-8, GRO-α and MCP-1) and metalloproteinases (MMP-1, MMP-3 and MMP-13) expression in FLS and chondrocytes, which expression was downregulated by TAK242, a specific TLR4 inhibitor. Conclusion Systemic or local A-SAA expression inside OA joint cavity may play a key role in inflammatory process seen in osteoarthritis, which could be counteracted by TLR4 inhibition. PMID:23776697

  13. Restricted Autoantigen Recognition Associated With Deletional and Adaptive Regulatory Mechanisms1

    PubMed Central

    Gebe, John A.; Yue, Betty B.; Unrath, Kelly A; Falk, Ben A.; Nepom, Gerald T.

    2009-01-01

    Autoimmune diabetes (T1D) is characterized by CD4+ T cell reactivity to a variety of islet-associated antigens. At-risk individuals, genetically predisposed to T1D, often have similar T cell reactivity, but nevertheless fail to progress to clinically overt disease. In order to study the immune tolerance and regulatory environment permissive for such autoreactive T cells, we expressed TcR transgenes derived from two autoreactive human T cells, 4.13 and 164, in HLA-DR4 transgenic mice on a C57Bl/6-derived “diabetes-resistant” background. Both TcR are responsive to an immunodominant epitope of glutamic acid decarboxylase 65 (555–567), which is identical in sequence between humans and mice, is restricted by HLA-DR4, and is a naturally processed self antigen associated with T1D. Although both TcR use the identical Vα and Vβ genes, differing only in CDR3, we found stark differences in the mechanisms utilized in vivo in the maintenance of immune tolerance. A combination of thymic deletion (negative selection), TcR down-regulation, and peripheral activation-induced cell death dominated the phenotype of 164 T cells, which nevertheless still maintain their antigen responsiveness in the periphery. In contrast, 4.13 T cells are much less influenced by central and deletional tolerance mechanisms, and instead display a peripheral immune deviation including differentiation into IL-10 secreting Tr1 cells. These findings indicate a distinct set of regulatory alternatives for autoreactive T cells, even within a single highly restricted HLA-peptide-TcR recognition profile. PMID:19535636

  14. Systemic blood loss affects NF-kappa B regulatory mechanisms in the lungs.

    PubMed

    Moine, P; Shenkar, R; Kaneko, D; Le Tulzo, Y; Abraham, E

    1997-07-01

    The nuclear regulatory factor (NF)-kappa B is activated in the lungs of patients with acute respiratory distress syndrome (ARDS). In experimental models of acute lung injury, activation of NF-kappa B contributes to the increased expression of immunoregulatory cytokines and other proinflammatory mediators in the lungs. Because of the important role that NF-kappa B activation appears to play in the development of acute lung injury, we examined cytoplasmic and nuclear NF-kappa B counterregulatory mechanisms in lung mononuclear cells, using a murine model in which inflammatory lung injury develops after blood loss. Sustained activation of NF-kappa B was present in lung mononuclear cells over the 4-h period after blood loss. The activation of NF-kappa B after hemorrhage was accompanied by alterations in levels of the NF-kappa B regulatory proteins I kappa B alpha and Bcl-3. Cytoplasmic and nuclear I kappa B alpha were increased and nuclear Bcl-3 was decreased during the first hour after blood loss, but, by 4 h posthemorrhage, cytoplasmic and nuclear I kappa B alpha levels were decreased and nuclear levels of Bcl-3 were increased. Inhibition of xanthine oxidase activity in otherwise unmanipulated unhemorrhaged mice resulted in increased levels of I kappa B alpha and decreased amounts of Bcl-3 in nuclear extracts from lung mononuclear cells. No changes in the levels of nuclear I kappa B alpha or Bcl-3 occurred after hemorrhage when xanthine oxidase activity was inhibited. These results demonstrate that blood loss, at least partly through xanthine oxidase-dependent mechanisms, produces alterations in the levels of both I kappa B alpha and Bcl-3 in lung mononuclear cell populations. The effects of hemorrhage on proteins that regulate activation of NF-kappa B may contribute to the frequent development of inflammatory lung injury in this setting.

  15. Integrative analysis of miRNA and gene expression reveals regulatory networks in tamoxifen-resistant breast cancer

    PubMed Central

    Stenvang, Jan; Alves, Carla L.; Teng, Fei; Lyng, Maria B.; Lykkesfeldt, Anne E.; Brünner, Nils; Wang, Jun; Gupta, Ramneek; Workman, Christopher T.; Ditzel, Henrik J.

    2016-01-01

    Tamoxifen is an effective anti-estrogen treatment for patients with estrogen receptor-positive (ER+) breast cancer, however, tamoxifen resistance is frequently observed. To elucidate the underlying molecular mechanisms of tamoxifen resistance, we performed a systematic analysis of miRNA-mediated gene regulation in three clinically-relevant tamoxifen-resistant breast cancer cell lines (TamRs) compared to their parental tamoxifen-sensitive cell line. Alterations in the expression of 131 miRNAs in tamoxifen-resistant vs. parental cell lines were identified, 22 of which were common to all TamRs using both sequencing and LNA-based quantitative PCR technologies. Although the target genes affected by the altered miRNA in the three TamRs differed, good agreement in terms of affected molecular pathways was observed. Moreover, we found evidence of miRNA-mediated regulation of ESR1, PGR1, FOXM1 and 14-3-3 family genes. Integrating the inferred miRNA-target relationships, we investigated the functional importance of 2 central genes, SNAI2 and FYN, which showed increased expression in TamR cells, while their corresponding regulatory miRNA were downregulated. Using specific chemical inhibitors and siRNA-mediated gene knockdown, we showed that both SNAI2 and FYN significantly affect the growth of TamR cell lines. Finally, we show that a combination of 2 miRNAs (miR-190b and miR-516a-5p) exhibiting altered expression in TamR cell lines were predictive of treatment outcome in a cohort of ER+ breast cancer patients receiving adjuvant tamoxifen mono-therapy. Our results provide new insight into the molecular mechanisms of tamoxifen resistance and may form the basis for future medical intervention for the large number of women with tamoxifen-resistant ER+ breast cancer. PMID:27528030

  16. Distinct regulatory mechanisms of eukaryotic transcriptional activation by SAGA and TFIID

    PubMed Central

    Bhaumik, Sukesh R.

    2010-01-01

    A growing number of human diseases are linked to abnormal gene expression which is largely controlled at the level of transcriptional initiation. The gene-specific activator promotes the initiation of transcription through its interaction with one or more components of the transcriptional initiation machinery, hence leading to stimulated transcriptional initiation or activation. However, all activator proteins do not target the same component(s) of the transcriptional initiation machinery. Rather, they can have different target specificities, and thus, can lead to distinct mechanisms of transcriptional activation. Two such distinct mechanisms of transcriptional activation in yeast are mediated by the SAGA (Spt-Ada-Gcn5-Acetyltransferase) and TFIID (Transcription factor IID) complexes, and are termed as “SAGA-dependent” and “TFIID-dependent” transcriptional activation, respectively. SAGA is the target of the activator in case of SAGA-dependent transcriptional activation, while the targeting of TFIID by the activator leads to TFIID-dependent transcriptional activation. Both the SAGA and TFIID complexes are highly conserved from yeast to human, and play crucial roles in gene activation among eukaryotes. The regulatory mechanisms of eukaryotic transcriptional activation by SAGA and TFIID are discussed here. PMID:20800707

  17. The regulatory mechanisms of myogenin expression in doxorubicin-treated rat cardiomyocytes.

    PubMed

    Liu, Shu-Ting; Huang, Shih-Ming; Ho, Ching-Liang; Yen, Li-Chen; Huang, Chi-Jung; Lin, Wei-Shiang; Chan, James Yi-Hsin

    2015-11-10

    Doxorubicin, an anthracycline antibiotic, has been used as an anti-neoplastic drug for almost 60 years. However, the mechanism(s) by which anthracyclines cause irreversible myocardial injury remains unclear. In order to delineate possible molecular signals involved in the myocardial toxicity, we assessed candidate genes using mRNA expression profiling in the doxorubicin-treated rat cardiomyocyte H9c2 cell line. In the study, it was confirmed that myogenin, an important transcriptional factor for muscle terminal differentiation, was significantly reduced by doxorubicin in a dose-dependent manner using both RT-PCR and western blot analyses. Also, it was identified that the doxorubicin-reduced myogenin gene level could not be rescued by most cardio-protectants. Furthermore, it was demonstrated how the signaling of the decreased myogenin expression by doxorubicin was altered at the transcriptional, post-transcriptional and translational levels. Based on these findings, a working model was proposed for relieving doxorubicin-associated myocardial toxicity by down-regulating miR-328 expression and increasing voltage-gated calcium channel β1 expression, which is a repressor of myogenin gene regulation. In summary, this study provides several lines of evidence indicating that myogenin is the target for doxorubicin-induced cardio-toxicity and a novel therapeutic strategy for doxorubicin clinical applications based on the regulatory mechanisms of myogenin expression.

  18. Adjunct Strategies for Tuberculosis Vaccines: Modulating Key Immune Cell Regulatory Mechanisms to Potentiate Vaccination

    PubMed Central

    Jayashankar, Lakshmi; Hafner, Richard

    2016-01-01

    Tuberculosis (TB) remains a global health threat of alarming proportions, resulting in 1.5 million deaths worldwide. The only available licensed vaccine, Bacillus Calmette–Guérin, does not confer lifelong protection against active TB. To date, development of an effective vaccine against TB has proven to be elusive, and devising newer approaches for improved vaccination outcomes is an essential goal. Insights gained over the last several years have revealed multiple mechanisms of immune manipulation by Mycobacterium tuberculosis (Mtb) in infected macrophages and dendritic cells that support disease progression and block development of protective immunity. This review provides an assessment of the known immunoregulatory mechanisms altered by Mtb, and how new interventions may reverse these effects. Examples include blocking of inhibitory immune cell coreceptor checkpoints (e.g., programed death-1). Conversely, immune mechanisms that strengthen immune cell effector functions may be enhanced by interventions, including stimulatory immune cell coreceptors (e.g., OX40). Modification of the activity of key cell “immunometabolism” signaling pathway molecules, including mechanistic target of rapamycin, glycogen synthase kinase-3β, wnt/β-catenin, adenosine monophosophate-activated protein kinase, and sirtuins, related epigenetic changes, and preventing induction of immune regulatory cells (e.g., regulatory T cells, myeloid-derived suppressor cells) are powerful new approaches to improve vaccine responses. Interventions to favorably modulate these components have been studied primarily in oncology to induce efficient antitumor immune responses, often by potentiation of cancer vaccines. These agents include antibodies and a rapidly increasing number of small molecule drug classes that have contributed to the dramatic immune-based advances in treatment of cancer and other diseases. Because immune responses to malignancies and to Mtb share many similar mechanisms

  19. An indoxyl compound 5-bromo-4-chloro-3-indolyl 1,3-diacetate, CAC-0982, suppresses activation of Fyn kinase in mast cells and IgE-mediated allergic responses in mice.

    PubMed

    Lee, Jun Ho; Kim, Tae Hyung; Kim, Hyuk Soon; Kim, A-Ram; Kim, Do-Kyun; Nam, Seung Taek; Kim, Hyun Woo; Park, Young Hwan; Her, Erk; Park, Yeong Min; Kim, Hyung Sik; Kim, Young Mi; Choi, Wahn Soo

    2015-06-15

    Mast cells, constituents of virtually all organs and tissues, are critical cells in IgE-mediated allergic responses. The aim of this study was to investigate the effect and mechanism of an indoxyl chromogenic compound, 5-bromo-4-chloro-3-indolyl 1,3-diacetate, CAC-0982, on IgE-mediated mast cell activation and allergic responses in mice. CAC-0982 reversibly suppressed antigen-stimulated degranulation in murine mast cells (IC50, ~3.8μM) and human mast cells (IC50, ~3.0μM). CAC-0982 also inhibited the expression and secretion of IL-4 and TNF-α in mast cells. Furthermore, CAC-0982 suppressed the mast cell-mediated allergic responses in mice in a dose-dependent manner (ED50 27.9mg/kg). As for the mechanism, CAC-0982 largely suppressed the phosphorylation of Syk and its downstream signaling molecules, including LAT, Akt, Erk1/2, p38, and JNK. Notably, the tyrosine kinase assay of antigen-stimulated mast cells showed that CAC-0982 inhibited Fyn kinase, one of the upstream tyrosine kinases for Syk activation in mast cells. Taken together, these results suggest that CAC-0982 may be used as a new treatment for regulating IgE-mediated allergic diseases through the inhibition of the Fyn/Syk pathway in mast cells.

  20. Development of neurodevelopmental disorders: a regulatory mechanism involving bromodomain-containing proteins.

    PubMed

    Li, Junlin; Zhao, Guifang; Gao, Xiaocai

    2013-02-20

    Neurodevelopmental disorders are classified as diseases that cause abnormal functions of the brain or central nervous system. Children with neurodevelopmental disorders show impaired language and speech abilities, learning and memory damage, and poor motor skills. However, we still know very little about the molecular etiology of these disorders. Recent evidence implicates the bromodomain-containing proteins (BCPs) in the initiation and development of neurodevelopmental disorders. BCPs have a particular domain, the bromodomain (Brd), which was originally identified as specifically binding acetyl-lysine residues at the N-terminus of histone proteins in vitro and in vivo. Other domains of BCPs are responsible for binding partner proteins to form regulatory complexes. Once these complexes are assembled, BCPs alter chromosomal states and regulate gene expression. Some BCP complexes bind nucleosomes, are involved in basal transcription regulation, and influence the transcription of many genes. However, most BCPs are involved in targeting. For example, some BCPs function as a recruitment platform or scaffold through their Brds-binding targeting sites. Others are recruited to form a complex to bind the targeting sites of their partners. The regulation mediated by these proteins is especially critical during normal and abnormal development. Mutant BCPs or dysfunctional BCP-containing complexes are implicated in the initiation and development of neurodevelopmental disorders. However, the pathogenic molecular mechanisms are not fully understood. In this review, we focus on the roles of regulatory BCPs associated with neurodevelopmental disorders, including mental retardation, Fragile X syndrome (FRX), Williams syndrome (WS), Rett syndrome and Rubinstein-Taybi syndrome (RTS). A better understanding of the molecular pathogenesis, based upon the roles of BCPs, will lead to screening of targets for the treatment of neurodevelopmental disorders.

  1. Development of neurodevelopmental disorders: a regulatory mechanism involving bromodomain-containing proteins

    PubMed Central

    2013-01-01

    Neurodevelopmental disorders are classified as diseases that cause abnormal functions of the brain or central nervous system. Children with neurodevelopmental disorders show impaired language and speech abilities, learning and memory damage, and poor motor skills. However, we still know very little about the molecular etiology of these disorders. Recent evidence implicates the bromodomain-containing proteins (BCPs) in the initiation and development of neurodevelopmental disorders. BCPs have a particular domain, the bromodomain (Brd), which was originally identified as specifically binding acetyl-lysine residues at the N-terminus of histone proteins in vitro and in vivo. Other domains of BCPs are responsible for binding partner proteins to form regulatory complexes. Once these complexes are assembled, BCPs alter chromosomal states and regulate gene expression. Some BCP complexes bind nucleosomes, are involved in basal transcription regulation, and influence the transcription of many genes. However, most BCPs are involved in targeting. For example, some BCPs function as a recruitment platform or scaffold through their Brds-binding targeting sites. Others are recruited to form a complex to bind the targeting sites of their partners. The regulation mediated by these proteins is especially critical during normal and abnormal development. Mutant BCPs or dysfunctional BCP-containing complexes are implicated in the initiation and development of neurodevelopmental disorders. However, the pathogenic molecular mechanisms are not fully understood. In this review, we focus on the roles of regulatory BCPs associated with neurodevelopmental disorders, including mental retardation, Fragile X syndrome (FRX), Williams syndrome (WS), Rett syndrome and Rubinstein-Taybi syndrome (RTS). A better understanding of the molecular pathogenesis, based upon the roles of BCPs, will lead to screening of targets for the treatment of neurodevelopmental disorders. PMID:23425632

  2. NF-kappaB regulatory mechanisms in alveolar macrophages from patients with acute respiratory distress syndrome.

    PubMed

    Moine, P; McIntyre, R; Schwartz, M D; Kaneko, D; Shenkar, R; Le Tulzo, Y; Moore, E E; Abraham, E

    2000-02-01

    Activation of the nuclear regulatory factor NF-kappaB occurs in the lungs of patients with the acute respiratory distress syndrome (ARDS) and may contribute to the increased expression of immunoregulatory cytokines and other proinflammatory mediators in this setting. Because of the important role that NF-kappaB activation appears to play in the development of acute lung injury, we examined cytoplasmic and nuclear NF-kapppaB counterregulatory mechanisms, involving IkappaB proteins, in alveolar macrophages obtained from 7 control patients without lung injury and 11 patients with established ARDS. Cytoplasmic levels of the NF-kappaB subunits p50, p65, and c-Rel were significantly decreased in alveolar macrophages from patients with ARDS, consistent with enhanced migration of liberated NF-kappaB dimers from the cytoplasm to the nucleus. Cytoplasmic and nuclear levels of IkappaBalpha were not significantly altered in alveolar macrophages from patients with established ARDS, compared with controls. In contrast, nuclear levels of Bcl-3 were significantly decreased in patients with ARDS compared with controls (P = 0.02). No IkappaBgamma, IkappaBbeta, or p105 proteins were detected in the cytoplasm of alveolar macrophages from control patients or patients with ARDS. The presence of activated NF-kappaB in alveolar macrophages from patients with established ARDS implies the presence of an ongoing stimulus for NF-kappaB activation. In this setting, appropriate counterregulatory mechanisms to normalize nuclear levels of NF-kappaB and to suppress NF-kappaB-mediated transcription, such as increased cytoplasmic and nuclear IkappaBalpha levels or decreased Bcl-3 levels, appeared to be induced. Nevertheless, even though counterregulatory mechanisms to NF-kappaB activation are activated in lung macrophages of patients with ARDS, NF-kappaB remains activated. These results suggest that fundamental abnormalities in transcriptional mechanisms involving NF-kappaB and important in the

  3. Comprehensive population-based genome sequencing provides insight into hematopoietic regulatory mechanisms

    PubMed Central

    Guo, Michael H.; Nandakumar, Satish K.; Ulirsch, Jacob C.; Zekavat, Seyedeh M.; Buenrostro, Jason D.; Natarajan, Pradeep; Salem, Rany M.; Chiarle, Roberto; Mitt, Mario; Kals, Mart; Pärn, Kalle; Fischer, Krista; Milani, Lili; Mägi, Reedik; Palta, Priit; Gabriel, Stacey B.; Metspalu, Andres; Lander, Eric S.; Kathiresan, Sekar; Hirschhorn, Joel N.; Esko, Tõnu; Sankaran, Vijay G.

    2017-01-01

    Genetic variants affecting hematopoiesis can influence commonly measured blood cell traits. To identify factors that affect hematopoiesis, we performed association studies for blood cell traits in the population-based Estonian Biobank using high-coverage whole-genome sequencing (WGS) in 2,284 samples and SNP genotyping in an additional 14,904 samples. Using up to 7,134 samples with available phenotype data, our analyses identified 17 associations across 14 blood cell traits. Integration of WGS-based fine-mapping and complementary epigenomic datasets provided evidence for causal mechanisms at several loci, including at a previously undiscovered basophil count-associated locus near the master hematopoietic transcription factor CEBPA. The fine-mapped variant at this basophil count association near CEBPA overlapped an enhancer active in common myeloid progenitors and influenced its activity. In situ perturbation of this enhancer by CRISPR/Cas9 mutagenesis in hematopoietic stem and progenitor cells demonstrated that it is necessary for and specifically regulates CEBPA expression during basophil differentiation. We additionally identified basophil count-associated variation at another more pleiotropic myeloid enhancer near GATA2, highlighting regulatory mechanisms for ordered expression of master hematopoietic regulators during lineage specification. Our study illustrates how population-based genetic studies can provide key insights into poorly understood cell differentiation processes of considerable physiologic relevance. PMID:28031487

  4. Comprehensive population-based genome sequencing provides insight into hematopoietic regulatory mechanisms.

    PubMed

    Guo, Michael H; Nandakumar, Satish K; Ulirsch, Jacob C; Zekavat, Seyedeh M; Buenrostro, Jason D; Natarajan, Pradeep; Salem, Rany M; Chiarle, Roberto; Mitt, Mario; Kals, Mart; Pärn, Kalle; Fischer, Krista; Milani, Lili; Mägi, Reedik; Palta, Priit; Gabriel, Stacey B; Metspalu, Andres; Lander, Eric S; Kathiresan, Sekar; Hirschhorn, Joel N; Esko, Tõnu; Sankaran, Vijay G

    2017-01-17

    Genetic variants affecting hematopoiesis can influence commonly measured blood cell traits. To identify factors that affect hematopoiesis, we performed association studies for blood cell traits in the population-based Estonian Biobank using high-coverage whole-genome sequencing (WGS) in 2,284 samples and SNP genotyping in an additional 14,904 samples. Using up to 7,134 samples with available phenotype data, our analyses identified 17 associations across 14 blood cell traits. Integration of WGS-based fine-mapping and complementary epigenomic datasets provided evidence for causal mechanisms at several loci, including at a previously undiscovered basophil count-associated locus near the master hematopoietic transcription factor CEBPA The fine-mapped variant at this basophil count association near CEBPA overlapped an enhancer active in common myeloid progenitors and influenced its activity. In situ perturbation of this enhancer by CRISPR/Cas9 mutagenesis in hematopoietic stem and progenitor cells demonstrated that it is necessary for and specifically regulates CEBPA expression during basophil differentiation. We additionally identified basophil count-associated variation at another more pleiotropic myeloid enhancer near GATA2, highlighting regulatory mechanisms for ordered expression of master hematopoietic regulators during lineage specification. Our study illustrates how population-based genetic studies can provide key insights into poorly understood cell differentiation processes of considerable physiologic relevance.

  5. A model for the volume regulatory mechanism of the Airway Surface Layer

    NASA Astrophysics Data System (ADS)

    Lang, Michael; Rubinstein, Michael; Davis, C. William; Tarran, Robert; Boucher, Richard

    2006-03-01

    The airway surface layer (ASL) of a lung consists of two parts: a mucus layer with thickness of about 30 μm in contact with air and a periciliary layer (PCL) of about 7 μm below. Mucus collects dust and bacteria and is swept to throat by beating cilia, while riding on top of PCL. It is important that the thickness of PCL is matched with the length of cilia in order to optimize clearance of mucus. Decrease of PCL thickness would finally lead to an occlusion of the respiratory system. Experiments show that the height of PCL stays constant after removing mucus. When modifying height or composition of this open PCL by removing fluid or adding isotonic solution leads to the same final height of PCL. Thus, there must be a regulatory mechanism, that controls height, i.e. ASL volume. Additional experiments show that mechanical stimulus of the cells like shear leads to an increase of ASL volume, thus, the cell is able to actively adjust this volume. Based on these observations a class of models is introduced that describes the experiments and a specific minimum model for the given problem is proposed.

  6. A Cell-Regulatory Mechanism Involving Feedback between Contraction and Tissue Formation Guides Wound Healing Progression

    PubMed Central

    Valero, Clara; Javierre, Etelvina; García-Aznar, José Manuel; Gómez-Benito, María José

    2014-01-01

    Wound healing is a process driven by cells. The ability of cells to sense mechanical stimuli from the extracellular matrix that surrounds them is used to regulate the forces that cells exert on the tissue. Stresses exerted by cells play a central role in wound contraction and have been broadly modelled. Traditionally, these stresses are assumed to be dependent on variables such as the extracellular matrix and cell or collagen densities. However, we postulate that cells are able to regulate the healing process through a mechanosensing mechanism regulated by the contraction that they exert. We propose that cells adjust the contraction level to determine the tissue functions regulating all main activities, such as proliferation, differentiation and matrix production. Hence, a closed-regulatory feedback loop is proposed between contraction and tissue formation. The model consists of a system of partial differential equations that simulates the evolution of fibroblasts, myofibroblasts, collagen and a generic growth factor, as well as the deformation of the extracellular matrix. This model is able to predict the wound healing outcome without requiring the addition of phenomenological laws to describe the time-dependent contraction evolution. We have reproduced two in vivo experiments to evaluate the predictive capacity of the model, and we conclude that there is feedback between the level of cell contraction and the tissue regenerated in the wound. PMID:24681636

  7. Apoptosis as a mechanism of T-regulatory cell homeostasis and suppression.

    PubMed

    Yolcu, Esma S; Ash, Shifra; Kaminitz, Ayelet; Sagiv, Yuval; Askenasy, Nadir; Yarkoni, Shai

    2008-01-01

    Activation-induced cell death is a general mechanism of immune homeostasis through negative regulation of clonal expansion of activated immune cells. This mechanism is involved in the maintenance of self- and transplant tolerance through polarization of the immune responses. The Fas/Fas-ligand interaction is a major common executioner of apoptosis in lymphocytes, with a dual role in regulatory T cell (Treg) function: Treg cell homeostasis and Treg cell-mediated suppression. Sensitivity to apoptosis and the patterns of Treg-cell death are of outmost importance in immune homeostasis that affects the equilibrium between cytolytic and suppressor forces in activation and termination of immune activity. Naive innate (naturally occurring) Treg cells present variable sensitivities to apoptosis, related to their turnover rates in tissue under steady state conditions. Following activation, Treg cells are less sensitive to apoptosis than cytotoxic effector subsets. Their susceptibility to apoptosis is influenced by cytokines within the inflammatory environment (primarily interleukin-2), the mode of antigenic stimulation and the proliferation rates. Here, we attempt to resolve some controversies surrounding the sensitivity of Treg cells to apoptosis under various experimental conditions, to delineate the function of cell death in regulation of immunity.

  8. Quantifying information transfer by protein domains: Analysis of the Fyn SH2 domain structure

    PubMed Central

    Lenaerts, Tom; Ferkinghoff-Borg, Jesper; Stricher, Francois; Serrano, Luis; Schymkowitz, Joost WH; Rousseau, Frederic

    2008-01-01

    Background Efficient communication between distant sites within a protein is essential for cooperative biological response. Although often associated with large allosteric movements, more subtle changes in protein dynamics can also induce long-range correlations. However, an appropriate formalism that directly relates protein structural dynamics to information exchange between functional sites is still lacking. Results Here we introduce a method to analyze protein dynamics within the framework of information theory and show that signal transduction within proteins can be considered as a particular instance of communication over a noisy channel. In particular, we analyze the conformational correlations between protein residues and apply the concept of mutual information to quantify information exchange. Mapping out changes of mutual information on the protein structure then allows visualizing how distal communication is achieved. We illustrate the approach by analyzing information transfer by the SH2 domain of Fyn tyrosine kinase, obtained from Monte Carlo dynamics simulations. Our analysis reveals that the Fyn SH2 domain forms a noisy communication channel that couples residues located in the phosphopeptide and specificity binding sites and a number of residues at the other side of the domain near the linkers that connect the SH2 domain to the SH3 and kinase domains. We find that for this particular domain, communication is affected by a series of contiguous residues that connect distal sites by crossing the core of the SH2 domain. Conclusion As a result, our method provides a means to directly map the exchange of biological information on the structure of protein domains, making it clear how binding triggers conformational changes in the protein structure. As such it provides a structural road, next to the existing attempts at sequence level, to predict long-range interactions within protein structures. PMID:18842137

  9. Loss of TRPC1-mediated Ca2+ influx contributes to impaired degranulation in Fyn-deficient mouse bone marrow-derived mast cells

    PubMed Central

    Suzuki, Ryo; Liu, Xibao; Olivera, Ana; Aguiniga, Lizath; Yamashita, Yumi; Blank, Ulrich; Ambudkar, Indu; Rivera, Juan

    2010-01-01

    MC degranulation requires the influx of calcium from the extracellular environment. Orai1/STIM1 is essential to MC SOCE, as shown in rat peritoneal MCs, the rat MC lines (RBL-2H3), or in Orai1 null embryo liver-derived, cultured MCs. However, minimal information exists about the role of other calcium channels expressed on these cells. Here, we demonstrate that the nonselective TRPC1 participates in FcεRI-mediated calcium entry in mouse BMMCs. We found that Fyn null MCs, which have an impaired degranulation response, expressed reduced levels of TRPC1, had normal depletion of intracellular calcium stores but an impaired calcium influx, and failed to depolymerize cortical F-actin (a key step for granule-plasma membrane fusion). Partial RNAi silencing of TRPC1 expression in WT MCs (to the level of Fyn null MCs) mimicked the Fyn null defect in calcium influx, cortical F-actin depolymerization, and MC degranulation. Ectopic expression of Fyn or TRPC1 in Fyn null MCs restored calcium responses and cortical F-actin depolymerization and increased MC degranulation. Together with our findings that expression of Orai1 is not altered in Fyn null MCs, our findings suggest that TRPC1 participates in calcium influx and other key events required for MC degranulation. This demonstrates that in addition to a role described previously for Orai1 in promoting MC degranulation, nonselective cation channels participate in promoting the exocytotic response. PMID:20571036

  10. Unravelling the regulatory mechanisms that modulate the MEP pathway in higher plants.

    PubMed

    Cordoba, Elizabeth; Salmi, Mari; León, Patricia

    2009-01-01

    The methyl-D-erythritol 4-phosphate pathway is responsible for the biosynthesis of a substantial number of natural compounds of biological and biotechnological importance. In recent years, this pathway has become an obvious target to develop new herbicides and antimicrobial drugs. In addition, the production of a variety of compounds of medical and agricultural interest may be possible through the genetic manipulation of this pathway. To this end, a complete understanding of the molecular mechanisms that regulate this pathway is of tremendous importance. Recent data have accumulated that show some of the multiple mechanisms that regulate the methyl-D-erythritol 4-phosphate pathway in plants. In this review we will describe some of these and discuss their implications. It has been demonstrated that 1-deoxy-D-xylulose-5-phosphate synthase (DXS), the first enzyme of this route, plays a major role in the overall regulation of the pathway. A small gene family codes for this enzyme in most of the plants which have been analysed so far, and the members of these gene families belong to different phylogenetic groups. Each of these genes exhibits a distinct expression pattern, suggesting unique functions. One of the most interesting regulatory mechanisms recently described for this pathway is the post-transcriptional regulation of the level of DXS and DXR proteins. In the case of DXS, this regulation appears conserved among plants, supporting its importance. The evidence accumulated suggests that this regulation might link the activity of this pathway with the plant's physiological conditions and the metabolic demand for the final products of this route.

  11. Manassantin B isolated from Saururus chinensis inhibits cyclooxygenase-2-dependent prostaglandin D2 generation by blocking Fyn-mediated nuclear factor-kappaB and mitogen activated protein kinase pathways in bone marrow derived-mast cells.

    PubMed

    Lu, Yue; Hwang, Seung-Lark; Son, Jong Keun; Chang, Hyeun Wook

    2013-01-01

    The authors investigated the effect of manassantin B (Man B) isolated from Saururus chinensis (S. chinensis) on cyclooxygenase-2 (COX-2)-dependent prostaglandin D2 (PGD2) generation in mouse bone marrow derived-mast cells (BMMCs). Man B inhibited the generation of PGD2 dose-dependently by inhibiting COX-2 expression in immunoglobulin E (IgE)/Ag-stimulated BMMCs. To elucidate the mechanism responsible for the inhibition of COX-2 expression by Man B, the effects of Man B on the activation of nuclear factor-kappaB (NF-κB), a transcription factor essential and mitogen-activated protein kinases (MAPKs) for COX-2 induction, were examined. Man B attenuated the nuclear translocation of NF-κB p65 and its DNA-binding activity by inhibiting inhibitors of kappa Bα (IκBα) degradation and concomitantly suppressing IκB kinase (IKK) phosphorylation. In addition, Man B suppressed phosphorylation of MAPKs including extracellular signal-regulated kinase 1/2 (ERK1/2), c-Jun NH2-terminal kinase (JNK) and p38. It was also found that Man B suppressed Fyn kinase activation and consequent downstream signaling processes, including those involving Syk, Gab2, and Akt. Taken together, the present results suggest that Man B suppresses COX-2 dependent PGD2 generation by primarily inhibiting Fyn kinase in FcεRI-mediated mast cells.

  12. Morphogenetic and Regulatory Mechanisms During Developmental Chondrogenesis: New Paradigms for Cartilage Tissue Engineering

    PubMed Central

    Quintana, Lluís; zur Nieden, Nicole I.

    2009-01-01

    Cartilage is the first skeletal tissue to be formed during embryogenesis leading to the creation of all mature cartilages and bones, with the exception of the flat bones in the skull. Therefore, errors occurring during the process of chondrogenesis, the formation of cartilage, often lead to severe skeletal malformations such as dysplasias. There are hundreds of skeletal dysplasias, and the molecular genetic etiology of some remains more elusive than of others. Many efforts have aimed at understanding the morphogenetic event of chondrogenesis in normal individuals, of which the main morphogenetic and regulatory mechanisms will be reviewed here. For instance, many signaling molecules that guide chondrogenesis—for example, transforming growth factor-β, bone morphogenetic proteins, fibroblast growth factors, and Wnts, as well as transcriptional regulators such as the Sox family—have already been identified. Moreover, extracellular matrix components also play an important role in this developmental event, as evidenced by the promotion of the chondrogenic potential of chondroprogenitor cells caused by collagen II and proteoglycans like versican. The growing evidence of the elements that control chondrogenesis and the increasing number of different sources of progenitor cells will, hopefully, help to create tissue engineering platforms that could overcome many developmental or degenerative diseases associated with cartilage defects. PMID:19063663

  13. Regulatory mechanism of protein metabolic pathway during the differentiation process of chicken male germ cell.

    PubMed

    Li, Dong; Zuo, Qisheng; Lian, Chao; Zhang, Lei; Shi, Qingqing; Zhang, Zhentao; Wang, Yingjie; Ahmed, Mahmoud F; Tang, Beibei; Xiao, Tianrong; Zhang, Yani; Li, Bichun

    2015-08-01

    We explored the regulatory mechanism of protein metabolism during the differentiation process of chicken male germ cells and provide a basis for improving the induction system of embryonic stem cell differentiation to male germ cells in vitro. We sequenced the transcriptome of embryonic stem cells, primordial germ cells, and spermatogonial stem cells with RNA sequencing (RNA-Seq), bioinformatics analysis methods, and detection of the key genes by quantitative reverse transcription PCR (qRT-PCR). Finally, we found 16 amino acid metabolic pathways enriched in the biological metabolism during the differentiation process of embryonic stem cells to primordial germ cells and 15 amino acid metabolic pathways enriched in the differentiation stage of primordial germ cells to spermatogonial stem cells. We found three pathways, arginine-proline metabolic pathway, tyrosine metabolic pathway, and tryptophan metabolic pathway, significantly enriched in the whole differentiation process of embryonic stem cells to spermatogonial stem cells. Moreover, for these three pathways, we screened key genes such as NOS2, ADC, FAH, and IDO. qRT-PCR results showed that the expression trend of these genes were the same to RNA-Seq. Our findings showed that the three pathways and these key genes play an important role in the differentiation process of embryonic stem cells to male germ cells. These results provide basic information for improving the induction system of embryonic stem cell differentiation to male germ cells in vitro.

  14. Cardiovascular Risk in Systemic Autoimmune Diseases: Epigenetic Mechanisms of Immune Regulatory Functions

    PubMed Central

    López-Pedrera, Chary; Pérez-Sánchez, Carlos; Ramos-Casals, Manuel; Santos-Gonzalez, Monica; Rodriguez-Ariza, Antonio; José Cuadrado, Ma

    2012-01-01

    Autoimmune diseases (AIDs) have been associated with accelerated atherosclerosis (AT) leading to increased cardio- and cerebrovascular disease risk. Traditional risk factors, as well as systemic inflammation mediators, including cytokines, chemokines, proteases, autoantibodies, adhesion receptors, and others, have been implicated in the development of these vascular pathologies. Yet, the characteristics of vasculopathies may significantly differ depending on the underlying disease. In recent years, many new genes and signalling pathways involved in autoimmunity with often overlapping patterns between different disease entities have been further detected. Epigenetics, the control of gene packaging and expression independent of alterations in the DNA sequence, is providing new directions linking genetics and environmental factors. Epigenetic regulatory mechanisms comprise DNA methylation, histone modifications, and microRNA activity, all of which act upon gene and protein expression levels. Recent findings have contributed to our understanding of how epigenetic modifications could influence AID development, not only showing differences between AID patients and healthy controls, but also showing how one disease differs from another and even how the expression of key proteins involved in the development of each disease is regulated. PMID:21941583

  15. Context-dependent regulatory mechanism of the splicing factor hnRNP L

    PubMed Central

    Motta-Mena, Laura B.; Heyd, Florian; Lynch, Kristen W.

    2010-01-01

    Splicing regulatory proteins often have distinct activities when bound to exons versus introns. However, less clear is whether variables besides location can influence activity. HnRNP L binds to a motif present in both CD45 variable exons 4 and 5 to affect their coordinate repression. Here we show that, in contrast to its direct repression of exon 4, hnRNP L represses exon 5 by countering the activity of a neighboring splicing enhancer. In the absence of the enhancer hnRNP L unexpectedly activates exon inclusion. As the splice sites flanking exon 4 and 5 are distinct, we directly examined the effect of varying splice site strength on the mechanism of hnRNP L function. Remarkably, binding of hnRNP L to an exon represses strong splice sites but enhances weak splice sites. A model in which hnRNP L stabilizes snRNP binding can explain both effects in a manner determined by the inherent snRNP-substrate affinity. PMID:20122404

  16. Expression of the large clostridial toxins is controlled by conserved regulatory mechanisms.

    PubMed

    Carter, Glen P; Larcombe, Sarah; Li, Lucy; Jayawardena, Darshani; Awad, Milena M; Songer, J Glenn; Lyras, Dena

    2014-11-01

    The clostridia cause many human and animal diseases, resulting in significant morbidity and mortality. Host damage results from the action of potent exotoxins, an important group of which is the large clostridial toxins (LCTs) produced by Clostridium difficile, Clostridium sordellii, Clostridium perfringens and Clostridium novyi. Knowledge of the structure and function of these toxins has been attained, however, apart from C. difficile, the regulatory pathways that control LCT production remain largely unknown. Here we show that LCT production in C. sordellii and C. perfringens is temporally regulated and repressed by glucose in a similar manner to C. difficile. Furthermore, we show that the TpeL-encoding gene of C. perfringens is located in an uncharacterized Pathogenicity Locus (PaLoc), along with accessory genes predicted to encode a bacteriophage holin-type protein and a TcdR-family alternative sigma factor, TpeR. Inactivation of tpeR demonstrated that TpeR is critical for C. perfringens TpeL production, in a similar manner to C. difficile TcdR and C. sordellii TcsR, but cross-complementation showed that TpeR is not functionally interchangeable with TcdR or TcsR. Although conserved mechanisms are employed by the clostridia to control LCT production there are important functional differences that distinguish members of the TcdR-family of clostridial alternative sigma factors. Copyright © 2014 Elsevier GmbH. All rights reserved.

  17. A novel regulatory mechanism couples deoxyribonucleotide synthesis and DNA replication in Escherichia coli.

    PubMed

    Gon, Stéphanie; Camara, Johanna E; Klungsøyr, Hege K; Crooke, Elliott; Skarstad, Kirsten; Beckwith, Jon

    2006-03-08

    We present evidence for a complex regulatory interplay between the initiation of DNA replication and deoxyribonucleotide synthesis. In Escherichia coli, the ATP-bound DnaA protein initiates chromosomal replication. Upon loading of the beta-clamp subunit (DnaN) of the replicase, DnaA is inactivated as its intrinsic ATPase activity is stimulated by the protein Hda. The beta-subunit acts as a matchmaker between Hda and DnaA. Chain elongation of DNA requires a sufficient supply of deoxyribonucleotides (dNTPs), which are produced by ribonucleotide reductase (RNR). We present evidence suggesting that the molecular switch from ATP-DnaA to ADP-DnaA is a critical step coordinating DNA replication with increased deoxyribonucleotide synthesis. Characterization of dnaA and dnaN mutations that result in a constitutively high expression of RNR reveal this mechanism. We propose that the nucleotide bound state of DnaA regulates the transcription of the genes encoding ribonucleotide reductase (nrdAB). Accordingly, the conversion of ATP-DnaA to ADP-DnaA after initiation and loading of the beta-subunit DnaN would allow increased nrdAB expression, and consequently, coordinated RNR synthesis and DNA replication during the cell cycle.

  18. A novel regulatory mechanism couples deoxyribonucleotide synthesis and DNA replication in Escherichia coli

    PubMed Central

    Gon, Stéphanie; Camara, Johanna E; Klungsøyr, Hege K; Crooke, Elliott; Skarstad, Kirsten; Beckwith, Jon

    2006-01-01

    We present evidence for a complex regulatory interplay between the initiation of DNA replication and deoxyribonucleotide synthesis. In Escherichia coli, the ATP-bound DnaA protein initiates chromosomal replication. Upon loading of the β-clamp subunit (DnaN) of the replicase, DnaA is inactivated as its intrinsic ATPase activity is stimulated by the protein Hda. The β-subunit acts as a matchmaker between Hda and DnaA. Chain elongation of DNA requires a sufficient supply of deoxyribonucleotides (dNTPs), which are produced by ribonucleotide reductase (RNR). We present evidence suggesting that the molecular switch from ATP-DnaA to ADP-DnaA is a critical step coordinating DNA replication with increased deoxyribonucleotide synthesis. Characterization of dnaA and dnaN mutations that result in a constitutively high expression of RNR reveal this mechanism. We propose that the nucleotide bound state of DnaA regulates the transcription of the genes encoding ribonucleotide reductase (nrdAB). Accordingly, the conversion of ATP-DnaA to ADP-DnaA after initiation and loading of the β-subunit DnaN would allow increased nrdAB expression, and consequently, coordinated RNR synthesis and DNA replication during the cell cycle. PMID:16482221

  19. Regulatory mechanisms and clinical perspectives of miRNA in tumor radiosensitivity

    PubMed Central

    Cao, Ya; Dong, Zigang

    2012-01-01

    MicroRNA (miRNA) influences carcinogenesis at multiple stages and it can effectively control tumor radiosensitivity by affecting DNA damage repair, cell cycle checkpoint, apoptosis, radio-related signal transduction pathways and tumor microenvironment. MiRNA also efficiently modulates tumor radiosensitivity at multiple levels by blocking the two essential non-homologous end-joining repair and homologous recombination repair pathways in the DNA damage response. It interferes with four radio-related pathways in ionizing radiation, including the PI3-K/Akt, NF-κB, MAPK and TGFβ signaling pathways. Moreover, the regulatory effect of miRNA in radiosensitivity can be enhanced when interacting with various key molecules, including H2AX, BRCA1, ATM, DNA-PK, RAD51, Chk1, Cdc25A, p53, PLK1, HIF-1 and VEGF, which are involved in these processes. Therefore, thoroughly understanding the mechanism of miRNA in tumor radiosensitivity could assist in finding novel targets to improve the radiotherapeutic effects and provide new clinical perspectives and insights for developing effective cancer treatments. PMID:22798379

  20. The regulatory mechanism of Tremella mesenterica on steroidogenesis in MA-10 mouse Leydig tumor cells.

    PubMed

    Chen, Yen-Wen; Lo, Hui-Chen; Yang, Jyuer-Ger; Chien, Chi-Hsien; Lee, Shi-Hsiung; Tseng, Chi-Yu; Huang, Bu-Miin

    2006-07-04

    Tremella mesenterica (TM), a yellow jelly mushroom, has been traditionally used as tonic food to improve body condition in Chinese society for a long time. We have previously demonstrated that TM reduced in vitro hCG-treated steroidogenesis in MA-10 mouse Leydig tumor cells without any toxicity effect. In the present study, the mechanism how TM suppressed hCG-treated steroidogenesis in MA-10 cells was investigated. MA-10 cells were treated with vehicle, human chorionic gonadotropin (hCG, 50 ng/ml), or different reagents with or without TM to clarify the effects. TM significantly suppressed progesterone production with the presences of forskolin (10 and 100 microM) or dbcAMP (0.5 and 1mM), respectively, in MA-10 cells (p<0.05), which indicated that TM suppressed steroidogenesis after PKA activation along the signal pathway. Beyond our expectation, TM induced the expression of steroidogenic acute regulatory (StAR) protein with or without hCG treatments. However, TM profoundly decreased P450 side chain cleavage (P450scc) and 3beta-hydroxysteroid dehydrogenase (3beta-HSD) enzyme activities without any influences on the expression of both enzymes. These inhibitions on steroidogenic enzyme activities might counteract the stimulation of StAR protein expression. In conclusion, results suggest that TM suppressed hCG-treated steroidogenesis in MA-10 cells by inhibiting PKA signal pathway and steroidogenic enzyme activities.

  1. Dynamic responsiveness of the vascular bed as a regulatory mechanism in vasomotor control.

    PubMed

    Zamir, Mair; Norton, Katelyn; Fleischhauer, Arlene; Frances, Maria F; Goswami, Ruma; Usselman, Charlotte W; Nolan, Robert P; Shoemaker, J Kevin

    2009-07-01

    The dynamics of blood supply to a vascular bed depend on lumped mechanical properties of that bed, namely the compliance (C), resistance (R), viscoelasticity (K), and inertance (L). While the study of regulatory mechanisms has so far placed the emphasis largely on R, it is not known how the remaining properties contribute collectively to the play of dynamics in vasomotor control. To examine this question and to establish some benchmark values of these properties, simultaneous measurements of pressure and flow waveforms in the vascular bed of the forearm were obtained from three groups: young healthy individuals, older hypertensives with controlled blood pressure, and older hypertensives with uncontrolled blood pressure. The values of R and C were found to vary within a wide range in each of the three groups to the extent that neither R nor C could be used independently as an indicator of health or age of the subjects tested. However, higher level dynamic properties of the bed, such as the time constants and damping index, which depend on combinations of C,K, and L, and which may reflect measures of the dynamic responsiveness or "sluggishness" of the system, were found to be maintained over a wide range of pulse pressures. These findings support a hypothesis that the pulsatile dynamics of blood supply to a vascular bed are adapted to the individual baseline values of R and C in different subjects with the effect of optimizing the level of dynamic responsiveness to changes in pressure or flow, and that this dynamic property of the vascular bed may be a protected and/or regulated property.

  2. Dynamic responsiveness of the vascular bed as a regulatory mechanism in vasomotor control

    PubMed Central

    Norton, Katelyn; Fleischhauer, Arlene; Frances, Maria F.; Goswami, Ruma; Usselman, Charlotte W.; Nolan, Robert P.; Shoemaker, J. Kevin

    2009-01-01

    The dynamics of blood supply to a vascular bed depend on lumped mechanical properties of that bed, namely the compliance (C), resistance (R), viscoelasticity (K), and inertance (L). While the study of regulatory mechanisms has so far placed the emphasis largely on R, it is not known how the remaining properties contribute collectively to the play of dynamics in vasomotor control. To examine this question and to establish some benchmark values of these properties, simultaneous measurements of pressure and flow waveforms in the vascular bed of the forearm were obtained from three groups: young healthy individuals, older hypertensives with controlled blood pressure, and older hypertensives with uncontrolled blood pressure. The values of R and C were found to vary within a wide range in each of the three groups to the extent that neither R nor C could be used independently as an indicator of health or age of the subjects tested. However, higher level dynamic properties of the bed, such as the time constants and damping index, which depend on combinations of C,K, and L, and which may reflect measures of the dynamic responsiveness or “sluggishness” of the system, were found to be maintained over a wide range of pulse pressures. These findings support a hypothesis that the pulsatile dynamics of blood supply to a vascular bed are adapted to the individual baseline values of R and C in different subjects with the effect of optimizing the level of dynamic responsiveness to changes in pressure or flow, and that this dynamic property of the vascular bed may be a protected and/or regulated property. PMID:19528260

  3. Genome-wide annotation of microRNA primary transcript structures reveals novel regulatory mechanisms

    PubMed Central

    Chang, Tsung-Cheng; Pertea, Mihaela; Lee, Sungyul; Salzberg, Steven L.; Mendell, Joshua T.

    2015-01-01

    Precise regulation of microRNA (miRNA) expression is critical for diverse physiologic and pathophysiologic processes. Nevertheless, elucidation of the mechanisms through which miRNA expression is regulated has been greatly hindered by the incomplete annotation of primary miRNA (pri-miRNA) transcripts. While a subset of miRNAs are hosted in protein-coding genes, the majority of pri-miRNAs are transcribed as poorly characterized noncoding RNAs that are 10's to 100's of kilobases in length and low in abundance due to efficient processing by the endoribonuclease DROSHA, which initiates miRNA biogenesis. Accordingly, these transcripts are poorly represented in existing RNA-seq data sets and exhibit limited and inaccurate annotation in current transcriptome assemblies. To overcome these challenges, we developed an experimental and computational approach that allows genome-wide detection and mapping of pri-miRNA structures. Deep RNA-seq in cells expressing dominant-negative DROSHA resulted in much greater coverage of pri-miRNA transcripts compared with standard RNA-seq. A computational pipeline was developed that produces highly accurate pri-miRNA assemblies, as confirmed by extensive validation. This approach was applied to a panel of human and mouse cell lines, providing pri-miRNA transcript structures for 1291/1871 human and 888/1181 mouse miRNAs, including 594 human and 425 mouse miRNAs that fall outside protein-coding genes. These new assemblies uncovered unanticipated features and new potential regulatory mechanisms, including links between pri-miRNAs and distant protein-coding genes, alternative pri-miRNA splicing, and transcripts carrying subsets of miRNAs encoded by polycistronic clusters. These results dramatically expand our understanding of the organization of miRNA-encoding genes and provide a valuable resource for the study of mammalian miRNA regulation. PMID:26290535

  4. Differential regulation analysis reveals dysfunctional regulatory mechanism involving transcription factors and microRNAs in gastric carcinogenesis.

    PubMed

    Li, Quanxue; Li, Junyi; Dai, Wentao; Li, Yi-Xue; Li, Yuan-Yuan

    2017-03-01

    Gastric cancer (GC) is one of the most incident malignancies in the world. Although lots of featured genes and microRNAs (miRNAs) have been identified to be associated with gastric carcinogenesis, underlying regulatory mechanisms still remain unclear. In order to explore the dysfunctional mechanisms of GC, we developed a novel approach to identify carcinogenesis relevant regulatory relationships, which is characterized by quantifying the difference of regulatory relationships between stages. Firstly, we applied the strategy of differential coexpression analysis (DCEA) to transcriptomic datasets including paired mRNA and miRNA of gastric samples to identify a set of genes/miRNAs related to gastric cancer progression. Based on these genes/miRNAs, we constructed conditional combinatorial gene regulatory networks (cGRNs) involving both transcription factors (TFs) and miRNAs. Enrichment of known cancer genes/miRNAs and predicted prognostic genes/miRNAs was observed in each cGRN. Then we designed a quantitative method to measure differential regulation level of every regulatory relationship between normal and cancer, and the known cancer genes/miRNAs proved to be ranked significantly higher. Meanwhile, we defined differentially regulated link (DRL) by combining differential regulation, differential expression and the regulation contribution of the regulator to the target. By integrating survival analysis and DRL identification, three master regulators TCF7L1, TCF4, and MEIS1 were identified and testable hypotheses of dysfunctional mechanisms underlying gastric carcinogenesis related to them were generated. The fine-tuning effects of miRNAs were also observed. We propose that this differential regulation network analysis framework is feasible to gain insights into dysregulated mechanisms underlying tumorigenesis and other phenotypic changes. Copyright © 2017. Published by Elsevier B.V.

  5. Controlling the fire--tissue-specific mechanisms of effector regulatory T-cell homing.

    PubMed

    Chow, Zachary; Banerjee, Ashish; Hickey, Michael J

    2015-04-01

    Regulatory T cells have essential roles in regulating immune responses and limiting inappropriate inflammation. Evidence now indicates that to achieve this function, regulatory T cells must be able to migrate to the most appropriate locations within both lymphoid and non-lymphoid organs. This function is achieved via the spatiotemporally controlled expression of adhesion molecules and chemokine receptors, varying according to the developmental stage of the regulatory T cell and the location and environment where they undergo activation. In this Review, we summarise information on the roles of adhesion molecules and chemokine receptors in mediating regulatory T-cell migration and function throughout the body under homeostatic and inflammatory conditions. In addition, we review recent studies that have used in vivo imaging to examine the actions of regulatory T cells in vivo, in lymph nodes, in the microvasculature and in the interstitium of peripheral organs. These studies reveal that the capacity of regulatory T cells to undergo selective migration serves a critical role in their ability to suppress immune responses. As such, the cellular and molecular requirements of regulatory T-cell migration need to be completely understood to enable the most effective use of these cells in clinical settings.

  6. Differential trafficking of Src, Lyn, Yes and Fyn is specified by the state of palmitoylation in the SH4 domain.

    PubMed

    Sato, Izumi; Obata, Yuuki; Kasahara, Kousuke; Nakayama, Yuji; Fukumoto, Yasunori; Yamasaki, Takahito; Yokoyama, Kazunari K; Saito, Takashi; Yamaguchi, Naoto

    2009-04-01

    Src-family tyrosine kinases (SFKs), which participate in a variety of signal transduction events, are known to localize to the cytoplasmic face of the plasma membrane through lipid modification. Recently, we showed that Lyn, an SFK member, is exocytosed to the plasma membrane via the Golgi region along the secretory pathway. We show here that SFK trafficking is specified by the palmitoylation state. Yes is also a monopalmitoylated SFK and is biosynthetically transported from the Golgi pool of caveolin to the plasma membrane. This pathway can be inhibited in the trans-Golgi network (TGN)-to-cell surface delivery by temperature block at 19 degrees C or dominant-negative Rab11 GTPase. A large fraction of Fyn, a dually palmitoylated SFK, is directly targeted to the plasma membrane irrespective of temperature block of TGN exit. Fyn(C6S), which lacks the second palmitoylation site, is able to traffic in the same way as Lyn and Yes. Moreover, construction of Yes(S6C) and chimeric Lyn or Yes with the Fyn N-terminus further substantiates the importance of the dual palmitoylation site for plasma membrane targeting. Taken together with our recent finding that Src, a nonpalmitoylated SFK, is rapidly exchanged between the plasma membrane and late endosomes/lysosomes, these results suggest that SFK trafficking is specified by the palmitoylation state in the SH4 domain.

  7. Heart Rate Variability: New Perspectives on Physiological Mechanisms, Assessment of Self-regulatory Capacity, and Health risk

    PubMed Central

    Shaffer, Fred

    2015-01-01

    Heart rate variability, the change in the time intervals between adjacent heartbeats, is an emergent property of interdependent regulatory systems that operates on different time scales to adapt to environmental and psychological challenges. This article briefly reviews neural regulation of the heart and offers some new perspectives on mechanisms underlying the very low frequency rhythm of heart rate variability. Interpretation of heart rate variability rhythms in the context of health risk and physiological and psychological self-regulatory capacity assessment is discussed. The cardiovascular regulatory centers in the spinal cord and medulla integrate inputs from higher brain centers with afferent cardiovascular system inputs to adjust heart rate and blood pressure via sympathetic and parasympathetic efferent pathways. We also discuss the intrinsic cardiac nervous system and the heart-brain connection pathways, through which afferent information can influence activity in the subcortical, frontocortical, and motor cortex areas. In addition, the use of real-time HRV feedback to increase self-regulatory capacity is reviewed. We conclude that the heart's rhythms are characterized by both complexity and stability over longer time scales that reflect both physiological and psychological functional status of these internal self-regulatory systems. PMID:25694852

  8. Heart Rate Variability: New Perspectives on Physiological Mechanisms, Assessment of Self-regulatory Capacity, and Health risk.

    PubMed

    McCraty, Rollin; Shaffer, Fred

    2015-01-01

    Heart rate variability, the change in the time intervals between adjacent heartbeats, is an emergent property of interdependent regulatory systems that operates on different time scales to adapt to environmental and psychological challenges. This article briefly reviews neural regulation of the heart and offers some new perspectives on mechanisms underlying the very low frequency rhythm of heart rate variability. Interpretation of heart rate variability rhythms in the context of health risk and physiological and psychological self-regulatory capacity assessment is discussed. The cardiovascular regulatory centers in the spinal cord and medulla integrate inputs from higher brain centers with afferent cardiovascular system inputs to adjust heart rate and blood pressure via sympathetic and parasympathetic efferent pathways. We also discuss the intrinsic cardiac nervous system and the heart-brain connection pathways, through which afferent information can influence activity in the subcortical, frontocortical, and motor cortex areas. In addition, the use of real-time HRV feedback to increase self-regulatory capacity is reviewed. We conclude that the heart's rhythms are characterized by both complexity and stability over longer time scales that reflect both physiological and psychological functional status of these internal self-regulatory systems.

  9. Acute inflammation in peritoneal dialysis: experimental studies in rats. Characterization of regulatory mechanisms.

    PubMed

    Bazargani, Farhan

    2005-01-01

    The predominant problems associated with peritoneal dialysis (PD) are ultrafiltration failure and peritonitis. PD maintains a state of intraperitoneal inflammation that affects the structure and function of the peritoneal membrane, potentially impairing ultrafiltration efficiency. Paradoxically, some PD fluids also have anti-inflammatory properties that may compromise the immune defense against peritonitis. This anti-inflammatory feature is mostly due to the glucose degradation products (GDPs), formed during heat-sterilization and storage of PD fluids. The main purpose of the present thesis was to study regulatory mechanisms behind the acute intraperitoneal inflammatory response in PD in the presence and absence of experimental peritonitis. Rats were exposed to a single dose of heat- or filter sterilized PD fluids either as an i.p. injection or as an infusion through an indwelling catheter, with or without supplementations, or pretreatment of the animals. The dwell fluid was analyzed zero, two and four hours later concerning activation of the complement and coagulation cascades, neutrophil recruitment and respiratory burst, ultrafiltration volumes, cytokine-induced neutrophil chemoattractant (CINC-1), rat mast cell protease 2 (RMCP-2), glucose, urea and histamine concentrations and ex vivo/in vitro intraperitoneal chemotactic activity. Exposure to filter sterilized PD fluid alone induced intraperitoneal complement activation and coagulation, neutrophil recruitment and increased the levels of CINC-1 during the dwell. Intraperitoneal concentrations of the mast cell markers histamine and RMCP-2 changed little during the dwells and did not indicate mast cell activation. Low molecular weight heparin (LMWH) and C5 blockade improved ultrafiltration. Pretreatment with cobra venom factor, known decomplementing agent, blocked the CINC-1 release and the neutrophil recruitment and improved ultrafiltration. In combination with experimental peritonitis, heat sterilized PD fluid

  10. microRNA regulatory mechanism by which PLLA aligned nanofibers influence PC12 cell differentiation

    NASA Astrophysics Data System (ADS)

    Yu, Yadong; Lü, Xiaoying; Ding, Fei

    2015-08-01

    Objective. Aligned nanofibers (AFs) are regarded as promising biomaterials in nerve tissue engineering. However, a full understanding of the biocompatibility of AFs at the molecular level is still challenging. Therefore, the present study focused on identifying the microRNA (miRNA)-mediated regulatory mechanism by which poly-L-lactic acid (PLLA) AFs influence PC12 cell differentiation. Approach. Firstly, the effects of PLLA random nanofibers (RFs)/AFs and PLLA films (control) on the biological responses of PC12 cells that are associated with neuronal differentiation were examined. Then, SOLiD sequencing and cDNA microarray were employed to profile the expressions of miRNAs and mRNAs. The target genes of the misregulated miRNAs were predicted and compared with the mRNA profile data. Functions of the matched target genes (the intersection between the predicted target genes and the experimentally-determined, misregulated genes) were analyzed. Main results. The results revealed that neurites spread in various directions in control and RF groups. In the AF group, most neurites extended in parallel with each other. The glucose consumption and lactic acid production in the RF and AF groups were higher than those in the control group. Compared with the control group, 42 and 94 miRNAs were significantly dysregulated in the RF and AF groups, respectively. By comparing the predicted target genes with the mRNA profile data, five and 87 matched target genes were found in the RF and AF groups, respectively. Three of the matched target genes in the AF group were found to be associated with neuronal differentiation, whereas none had this association in the RF group. The PLLA AFs induced the dysregulation of miRNAs that regulate many biological functions, including axonal guidance, lipid metabolism and long-term potentiation. In particular, two miRNA-matched target gene-biological function modules associated with neuronal differentiation were identified as follows: (1) miR-23b, mi

  11. RNA-Binding Proteins in Trichomonas vaginalis: Atypical Multifunctional Proteins Involved in a Posttranscriptional Iron Regulatory Mechanism

    PubMed Central

    Figueroa-Angulo, Elisa E.; Calla-Choque, Jaeson S.; Mancilla-Olea, Maria Inocente; Arroyo, Rossana

    2015-01-01

    Iron homeostasis is highly regulated in vertebrates through a regulatory system mediated by RNA-protein interactions between the iron regulatory proteins (IRPs) that interact with an iron responsive element (IRE) located in certain mRNAs, dubbed the IRE-IRP regulatory system. Trichomonas vaginalis, the causal agent of trichomoniasis, presents high iron dependency to regulate its growth, metabolism, and virulence properties. Although T. vaginalis lacks IRPs or proteins with aconitase activity, possesses gene expression mechanisms of iron regulation at the transcriptional and posttranscriptional levels. However, only one gene with iron regulation at the transcriptional level has been described. Recently, our research group described an iron posttranscriptional regulatory mechanism in the T. vaginalis tvcp4 and tvcp12 cysteine proteinase mRNAs. The tvcp4 and tvcp12 mRNAs have a stem-loop structure in the 5'-coding region or in the 3'-UTR, respectively that interacts with T. vaginalis multifunctional proteins HSP70, α-Actinin, and Actin under iron starvation condition, causing translation inhibition or mRNA stabilization similar to the previously characterized IRE-IRP system in eukaryotes. Herein, we summarize recent progress and shed some light on atypical RNA-binding proteins that may participate in the iron posttranscriptional regulation in T. vaginalis. PMID:26703754

  12. Genome-Wide Analysis of the Salmonella Fis Regulon and Its Regulatory Mechanism on Pathogenicity Islands

    PubMed Central

    Wang, Quan; Wang, Lei

    2013-01-01

    Fis, one of the most important nucleoid-associated proteins, functions as a global regulator of transcription in bacteria that has been comprehensively studied in Escherichia coli K12. Fis also influences the virulence of Salmonella enterica and pathogenic E. coli by regulating their virulence genes, however, the relevant mechanism is unclear. In this report, using combined RNA-seq and chromatin immunoprecipitation (ChIP)-seq technologies, we first identified 1646 Fis-regulated genes and 885 Fis-binding targets in the S. enterica serovar Typhimurium, and found a Fis regulon different from that in E. coli. Fis has been reported to contribute to the invasion ability of S. enterica. By using cell infection assays, we found it also enhances the intracellular replication ability of S. enterica within macrophage cell, which is of central importance for the pathogenesis of infections. Salmonella pathogenicity islands (SPI)-1 and SPI-2 are crucial for the invasion and survival of S. enterica in host cells. Using mutation and overexpression experiments, real-time PCR analysis, and electrophoretic mobility shift assays, we demonstrated that Fis regulates 63 of the 94 Salmonella pathogenicity island (SPI)-1 and SPI-2 genes, by three regulatory modes: i) binds to SPI regulators in the gene body or in upstream regions; ii) binds to SPI genes directly to mediate transcriptional activation of themselves and downstream genes; iii) binds to gene encoding OmpR which affects SPI gene expression by controlling SPI regulators SsrA and HilD. Our results provide new insights into the impact of Fis on SPI genes and the pathogenicity of S. enterica. PMID:23717649

  13. Deciphering Transcriptional Regulatory Mechanisms Associated with Hemicellulose Degradation in Neurospora crassa

    PubMed Central

    Sun, Jianping; Tian, Chaoguang; Diamond, Spencer

    2012-01-01

    Hemicellulose, the second most abundant plant biomass fraction after cellulose, is widely viewed as a potential substrate for the production of liquid fuels and other value-added materials. Degradation of hemicellulose by filamentous fungi requires production of many different enzymes, which are induced by biopolymers or its derivatives and regulated mainly at the transcriptional level through transcription factors (TFs). Neurospora crassa, a model filamentous fungus, expresses and secretes enzymes required for plant cell wall deconstruction. To better understand genes specifically associated with degradation of hemicellulose, we applied secretome and transcriptome analysis to N. crassa grown on beechwood xylan. We identified 34 secreted proteins and 353 genes with elevated transcription on xylan. The xylanolytic phenotype of strains with deletions in genes identified from the secretome and transcriptome analysis of the wild type was assessed, revealing functions for known and unknown proteins associated with hemicellulose degradation. By evaluating phenotypes of strains containing deletions of predicted TF genes in N. crassa, we identified a TF (XLR-1; xylan degradation regulator 1) essential for hemicellulose degradation that is an ortholog to XlnR/XYR1 in Aspergillus and Trichoderma species, respectively, a major transcriptional regulator of genes encoding both cellulases and hemicellulases. Deletion of xlr-1 in N. crassa abolished growth on xylan and xylose, but growth on cellulose and cellulolytic activity were only slightly affected. To determine the regulatory mechanisms for hemicellulose degradation, we explored the transcriptional regulon of XLR-1 under xylose, xylanolytic, and cellulolytic conditions. XLR-1 regulated only some predicted hemicellulase genes in N. crassa and was required for a full induction of several cellulase genes. Hemicellulase gene expression was induced by a combination of release from carbon catabolite repression (CCR) and induction

  14. Analysis of regulatory mechanism after ErbB4 gene mutation based on local modeling methodology.

    PubMed

    Chen, C L; Zhao, J W

    2016-05-13

    ErbB4 is an oncogene belonging to the epidermal growth factor receptor family and contributes to the occurrence and development of multiple cancers, such as gastric, breast, and colorectal cancers. Therefore, studies of the regulation of ErbB4 in cancerigenic pathway will advance molecular targeted therapy. Advanced bioinformatic analysis softwares, such as ExPASy, Predictprotei, QUARK, and I-TASSER, were used to analyze the regulatory mechanism after ErbB4 gene mutation in terms of amino acid sequence, primary, secondary, and tertiary structure of the protein and upstream-downstream receptor/ligands. Mutation of the 19th and 113th amino acids at the carboxyl terminus of ErbB4 protein did not affect its biological nature, but its secondary structure changed and protein binding sites were near 2 mutational sites; moreover, after mutation introduction, additional binding sites were observed. Tertiary structure modeling indicated that local structure of ErbB4 was changed from an α helical conformation into a β chain folding structure; the α helical conformation is the functional site of protein, while active sites are typically near junctions between helical regions, thus the helical structures are easily destroyed and change into folding structures or other structures after stretching. Mutable sites of ErbB4 is exact binding sites where dimer formed with other epidermal growth factor family proteins; mutation enabled the ErbB4 receptor to bind to neuregulin 1 ligand without dimer formation, disrupting the signal transduction pathway and affecting ErbB4 function.

  15. Nitrous Oxide Metabolism in Nitrate-Reducing Bacteria: Physiology and Regulatory Mechanisms.

    PubMed

    Torres, M J; Simon, J; Rowley, G; Bedmar, E J; Richardson, D J; Gates, A J; Delgado, M J

    2016-01-01

    Nitrous oxide (N2O) is an important greenhouse gas (GHG) with substantial global warming potential and also contributes to ozone depletion through photochemical nitric oxide (NO) production in the stratosphere. The negative effects of N2O on climate and stratospheric ozone make N2O mitigation an international challenge. More than 60% of global N2O emissions are emitted from agricultural soils mainly due to the application of synthetic nitrogen-containing fertilizers. Thus, mitigation strategies must be developed which increase (or at least do not negatively impact) on agricultural efficiency whilst decrease the levels of N2O released. This aim is particularly important in the context of the ever expanding population and subsequent increased burden on the food chain. More than two-thirds of N2O emissions from soils can be attributed to bacterial and fungal denitrification and nitrification processes. In ammonia-oxidizing bacteria, N2O is formed through the oxidation of hydroxylamine to nitrite. In denitrifiers, nitrate is reduced to N2 via nitrite, NO and N2O production. In addition to denitrification, respiratory nitrate ammonification (also termed dissimilatory nitrate reduction to ammonium) is another important nitrate-reducing mechanism in soil, responsible for the loss of nitrate and production of N2O from reduction of NO that is formed as a by-product of the reduction process. This review will synthesize our current understanding of the environmental, regulatory and biochemical control of N2O emissions by nitrate-reducing bacteria and point to new solutions for agricultural GHG mitigation. © 2016 Elsevier Ltd. All rights reserved.

  16. An examination of the regulatory mechanism of Pxdn mutation-induced eye disorders using microarray analysis

    PubMed Central

    YANG, YANG; XING, YIQIAO; LIANG, CHAOQUN; HU, LIYA; XU, FEI; MEI, QI

    2016-01-01

    The present study aimed to identify biomarkers for peroxidasin (Pxdn) mutation-induced eye disorders and study the underlying mechanisms involved in this process. The microarray dataset GSE49704 was used, which encompasses 4 mouse samples from embryos with Pxdn mutation and 4 samples from normal tissues. After data preprocessing, the differentially expressed genes (DEGs) between Pxdn mutation and normal tissues were identified using the t-test in the limma package, followed by functional enrichment analysis. The protein-protein interaction (PPI) network was constructed based on the STRING database, and the transcriptional regulatory (TR) network was established using the GeneCodis database. Subsequently, the overlapping DEGs with high degrees in two networks were identified, as well as the sub-network extracted from the TR network. In total, 121 (75 upregulated and 46 downregulated) DEGs were identified, and these DEGs play important roles in biological processes (BPs), including neuron development and differentiation. A PPI network containing 25 nodes such as actin, alpha 1, skeletal muscle (Acta1) and troponin C type 2 (fast) (Tnnc2), and a TR network including 120 nodes were built. By comparing the two networks, seven crucial genes which overlapped were identified, including cyclin-dependent kinase inhibitor 1B (Cdkn1b), Acta1 and troponin T type 3 (Tnnt3). In the sub-network, Cdkn1b was predicted as the target of miRNAs such as mmu-miR-24 and transcription factors (TFs) including forkhead box O4 (FOXO4) and activating enhancer binding protein 4 (AP4). Thus, we suggest that seven crucial genes, including Cdkn1b, Acta1 and Tnnt3, play important roles in the progression of eye disorders such as glaucoma. We suggest that Cdkn1b exert its effects via the inhibition of proliferation and is mediated by mmu-miR-24 and targeted by the TFs FOXO4 and AP4. PMID:27121343

  17. Regulatory mechanisms underlying sepsis progression in patients with tumor necrosis factor-α genetic variations

    PubMed Central

    LIU, YANGZHOU; HAN, NING; LI, QINCHUAN; LI, ZENGCHUN

    2016-01-01

    The present study aimed to investigate the regulatory mechanisms underlying sepsis progression in patients with tumor necrosis factor (TNF)-α genetic variations. The GSE5760 expression profile data, which was downloaded from the Gene Expression Omnibus database, contained 30 wild-type (WT) and 28 mutation (MUT) samples. Differentially expressed genes (DEGs) between the two types of samples were identified using the Student's t-test, and the corresponding microRNAs (miRNAs) were screened using WebGestalt software. An integrated miRNA-DEG network was constructed using the Cytoscape software, based on the interactions between the DEGs, as identified using the Search Tool for the Retrieval of Interacting Genes/Proteins database, and the correlation between miRNAs and their target genes. Furthermore, Gene Ontology and pathway enrichment analyses were conducted for the DEGs using the Database for Annotation, Visualization and Integrated Discovery and the KEGG Orthology Based Annotation System, respectively. A total of 390 DEGS between the WT and MUT samples, along with 11 -associated miRNAs, were identified. The integrated miRNA-DEG network consisted of 38 DEGs and 11 miRNAs. Within this network, COPS2 was found to be associated with transcriptional functions, while FUS was found to be involved in mRNA metabolic processes. Other DEGs, including FBXW7 and CUL3, were enriched in the ubiquitin-mediated proteolysis pathway. In addition, miR-15 was predicted to target COPS2 and CUL3. The results of the present study suggested that COPS2, FUS, FBXW7 and CUL3 may be associated with sepsis in patients with TNF-α genetic variations. In the progression of sepsis, FBXW7 and CUL3 may participate in the ubiquitin-mediated proteolysis pathway, whereas COPS2 may regulate the phosphorylation and ubiquitination of the FUS protein. Furthermore, COPS2 and CUL3 may be novel targets of miR-15. PMID:27347057

  18. High-risk medical devices, children and the FDA: regulatory challenges facing pediatric mechanical circulatory support devices.

    PubMed

    Almond, Christopher S D; Chen, Eric A; Berman, Michael R; Less, Joanne R; Baldwin, J Timothy; Linde-Feucht, Sarah R; Hoke, Tracey R; Pearson, Gail D; Jenkins, Kathy; Duncan, Brian W; Zuckerman, Bram D

    2007-01-01

    Pediatric mechanical circulatory support is a critical unmet need in the United States. Infant- and child-sized ventricular assist devices are currently being developed largely through federal contracts and grants through the National Heart, Lung, and Blood Institute (NHLBI). Human testing and marketing of high-risk devices for children raises epidemiologic and regulatory issues that will need to be addressed. Leaders from the US Food and Drug Administration (FDA), NHLBI, academic pediatric community, and industry convened in January 2006 for the first FDA Workshop on the Regulatory Process for Pediatric Mechanical Circulatory Support Devices. The purpose was to provide the pediatric community with an overview of the federal regulatory process for high-risk medical devices and to review the challenges specific to the development and regulation of pediatric mechanical circulatory support devices. Pediatric mechanical circulatory support present significant epidemiologic, logistic, and financial challenges to industry, federal regulators, and the pediatric community. Early interactions with the FDA, shared appreciation of challenges, and careful planning will be critical to avoid unnecessary delays in making potentially life-saving devices available for children. Collaborative efforts to address these challenges are warranted.

  19. Regulatory Mechanisms Involved in the Expression of Brain-Derived Neurotrophic Factor and Glial Cell Line-Derived Neurotrophic Factor

    DTIC Science & Technology

    1996-03-01

    of Philosophy, 1996 Dissertation Advisor: Gregory P. Mueller, PhD. Associate Professor Department of Physiology Brain-derived neurotrophic factor ( BDNF ...postsynaptic effects of BDNF and GDNF, very few have addressed the regulatory mechanisms involved in the expression of these factors. In phase 1 of the project...five alternate first exons contained in the rat BDNF gene, including a novel one termed exon la, were isolated and found to be individually spliced to

  20. Influence of visual impairment level on the regulatory mechanism used during the approach phase of a long jump.

    PubMed

    Theodorou, Apostolos; Skordilis, Emmanouil; Plainis, Sotiris; Panoutsakopoulos, Vassilios; Panteli, Flora

    2013-08-01

    The purpose of the study was to investigate the occurrence of stride regulation at the approach phase of the long jump in athletes with normal vision and visually deprived Class F12 and F13 athletes. All the athletes exhibited the presence of a regulatory mechanism. In the normal vision group this occurred on the fifth-to-last stride. In Class F12 athletes regulation commenced on the fourth-to-last stride for males and third-to-last stride for females. Class F13 males commenced regulation, like the control group, on the fifth-to-last stride; but females commenced on the fourth-to-last stride. The study demonstrated that reduced vision does not prevent Class F12 and F13 athletes from applying a regulatory mechanism similar to that observed in sighted athletes. However, the control mechanism of regulation emerged earlier in non-visually deprived long jumpers and the least visually impaired Class F13 athletes, signifying the importance of visual function in the regulatory stimuli.

  1. In silico identification of oncogenic potential of fyn-related kinase in hepatocellular carcinoma.

    PubMed

    Chen, Jia-Shing; Hung, Wei-Shiang; Chan, Hsiang-Han; Tsai, Shaw-Jenq; Sun, H Sunny

    2013-02-15

    Cancer development is a complex and heterogeneous process. It is estimated that 5-10% of human genes probably contribute to oncogenesis, whereas current experimentally validated cancer genes only cover 1% of the human genome. Thus hundreds of cancer genes may still remain to be identified. To search for new genes that play roles in carcinogenesis and facilitate cancer research, we developed a systematic workflow to use information saved in a previously established tumor-associated gene (TAG) database. By exploiting the information of conserved protein domains from the TAG, we identified 183 potential new TAGs. As a proof-of-concept, one predicted oncogene, fyn-related kinase (FRK), which shows an aberrant digital expression pattern in liver cancer cells, was selected for further investigation. Using 68 paired hepatocellular carcinoma samples, we found that FRK was up-regulated in 52% of cases (P < 0.001). Tumorigenic assays performed in Hep3B and HepG2 cell lines revealed a significant correlation between the level of FRK expression and invasiveness, suggesting that FRK is a positive regulator of invasiveness in liver cancer cells. These findings implied that FRK is a multitalented signal transduction molecule that produces diverse biological responses in different cell types in various microenvironments. In addition, our data demonstrated the accuracy of computational prediction and suggested that other predicted TAGs can be potential targets for future cancer research. The TAG database is available online at the Bioinformatics Center website: http://www.binfo.ncku.edu.tw/TAG/.

  2. Regulatory mechanisms in arterial hypertension: role of microRNA in pathophysiology and therapy.

    PubMed

    Klimczak, Dominika; Jazdzewski, Krystian; Kuch, Marek

    2017-02-01

    Multiple factors underlie the pathophysiology of hypertension, involving endothelial dysregulation, vascular smooth muscle dysfunction, increased oxidative stress, sympathetic nervous system activation and altered renin -angiotensin -aldosterone regulatory activity. A class of non-coding RNA called microRNA, consisting of 17-25 nucleotides, exert regulatory function over these processes. This paper summarizes the currently available data from preclinical and clinical studies on miRNA in the development of hypertension as well as the impact of anti-hypertensive treatment on their plasma expression. We present microRNAs' characteristics, their biogenesis and role in the regulation of blood pressure together with their potential diagnostic and therapeutic application in clinical practice.

  3. Brucella BioR regulator defines a complex regulatory mechanism for bacterial biotin metabolism.

    PubMed

    Feng, Youjun; Xu, Jie; Zhang, Huimin; Chen, Zeliang; Srinivas, Swaminath

    2013-08-01

    The enzyme cofactor biotin (vitamin H or B7) is an energetically expensive molecule whose de novo biosynthesis requires 20 ATP equivalents. It seems quite likely that diverse mechanisms have evolved to tightly regulate its biosynthesis. Unlike the model regulator BirA, a bifunctional biotin protein ligase with the capability of repressing the biotin biosynthetic pathway, BioR has been recently reported by us as an alternative machinery and a new type of GntR family transcriptional factor that can repress the expression of the bioBFDAZ operon in the plant pathogen Agrobacterium tumefaciens. However, quite unusually, a closely related human pathogen, Brucella melitensis, has four putative BioR-binding sites (both bioR and bioY possess one site in the promoter region, whereas the bioBFDAZ [bio] operon contains two tandem BioR boxes). This raised the question of whether BioR mediates the complex regulatory network of biotin metabolism. Here, we report that this is the case. The B. melitensis BioR ortholog was overexpressed and purified to homogeneity, and its solution structure was found to be dimeric. Functional complementation in a bioR isogenic mutant of A. tumefaciens elucidated that Brucella BioR is a functional repressor. Electrophoretic mobility shift assays demonstrated that the four predicted BioR sites of Brucella plus the BioR site of A. tumefaciens can all interact with the Brucella BioR protein. In a reporter strain that we developed on the basis of a double mutant of A. tumefaciens (the ΔbioR ΔbioBFDA mutant), the β-galactosidase (β-Gal) activity of three plasmid-borne transcriptional fusions (bioBbme-lacZ, bioYbme-lacZ, and bioRbme-lacZ) was dramatically decreased upon overexpression of Brucella bioR. Real-time quantitative PCR analyses showed that the expression of bioBFDA and bioY is significantly elevated upon removal of bioR from B. melitensis. Together, we conclude that Brucella BioR is not only a negative autoregulator but also a repressor of

  4. Regulatory mechanisms of testosterone-stimulated song in the sensorimotor nucleus HVC of female songbirds.

    PubMed

    Dittrich, Falk; Ramenda, Claudia; Grillitsch, Doris; Frankl-Vilches, Carolina; Ko, Meng-Ching; Hertel, Moritz; Goymann, Wolfgang; ter Maat, Andries; Gahr, Manfred

    2014-12-02

    differentiation processes in the HVC that were partially similar to those seen in the HVC of testosterone-treated female canaries. Other modes of testosterone action, notably related to synaptic transmission, appeared to be regulated in a more species-specific manner in the female HVC. Divergent effects of testosterone on the HVC of different species might be related to differences between species in regulatory mechanisms of the singing behavior.

  5. Brucella BioR Regulator Defines a Complex Regulatory Mechanism for Bacterial Biotin Metabolism

    PubMed Central

    Xu, Jie; Zhang, Huimin; Srinivas, Swaminath

    2013-01-01

    The enzyme cofactor biotin (vitamin H or B7) is an energetically expensive molecule whose de novo biosynthesis requires 20 ATP equivalents. It seems quite likely that diverse mechanisms have evolved to tightly regulate its biosynthesis. Unlike the model regulator BirA, a bifunctional biotin protein ligase with the capability of repressing the biotin biosynthetic pathway, BioR has been recently reported by us as an alternative machinery and a new type of GntR family transcriptional factor that can repress the expression of the bioBFDAZ operon in the plant pathogen Agrobacterium tumefaciens. However, quite unusually, a closely related human pathogen, Brucella melitensis, has four putative BioR-binding sites (both bioR and bioY possess one site in the promoter region, whereas the bioBFDAZ [bio] operon contains two tandem BioR boxes). This raised the question of whether BioR mediates the complex regulatory network of biotin metabolism. Here, we report that this is the case. The B. melitensis BioR ortholog was overexpressed and purified to homogeneity, and its solution structure was found to be dimeric. Functional complementation in a bioR isogenic mutant of A. tumefaciens elucidated that Brucella BioR is a functional repressor. Electrophoretic mobility shift assays demonstrated that the four predicted BioR sites of Brucella plus the BioR site of A. tumefaciens can all interact with the Brucella BioR protein. In a reporter strain that we developed on the basis of a double mutant of A. tumefaciens (the ΔbioR ΔbioBFDA mutant), the β-galactosidase (β-Gal) activity of three plasmid-borne transcriptional fusions (bioBbme-lacZ, bioYbme-lacZ, and bioRbme-lacZ) was dramatically decreased upon overexpression of Brucella bioR. Real-time quantitative PCR analyses showed that the expression of bioBFDA and bioY is significantly elevated upon removal of bioR from B. melitensis. Together, we conclude that Brucella BioR is not only a negative autoregulator but also a repressor of

  6. Regulatory Mechanisms of the Molecular Pathways in Fibrosis Induced by MicroRNAs

    PubMed Central

    Yang, Cui; Zheng, Si-Dao; Wu, Hong-Jin; Chen, Shao-Jun

    2016-01-01

    Objective: MicroRNAs (miRNAs or miRs) play critical roles in the fibrotic process in different organs. We summarized the latest research progress on the roles and mechanisms of miRNAs in the regulation of the molecular signaling pathways involved in fibrosis. Data Sources: Papers published in English from January 2010 to August 2015 were selected from the PubMed and Web of Science databases using the search terms “microRNA”, “miR”, “transforming growth factor β”, “tgf β”, “mitogen-activated protein kinase”, “mapk”, “integrin”, “p38”, “c-Jun NH2-terminal kinase”, “jnk”, “extracellular signal-regulated kinase”, “erk”, and “fibrosis”. Study Selection: Articles were obtained and reviewed to analyze the regulatory effects of miRNAs on molecular signaling pathways involved in the fibrosis. Results: Recent evidence has shown that miRNAs are involved in regulating fibrosis by targeting different substrates in the molecular processes that drive fibrosis, such as immune cell sensitization, effector cell activation, and extracellular matrix remodeling. Moreover, several important molecular signaling pathways involve in fibrosis, such as the transforming growth factor-beta (TGF-β) pathway, mitogen-activated protein kinase (MAPK) pathways, and the integrin pathway are regulated by miRNAs. Third, regulation of the fibrotic pathways induced by miRNAs is found in many other tissues in addition to the heart, lung, liver, and kidney. Interestingly, the actions of many drugs on the human body are also induced by miRNAs. It is encouraging that the fibrotic process can be blocked or reversed by targeting specific miRNAs and their signaling pathways, thereby protecting the structures and functions of different organs. Conclusions: miRNAs not only regulate molecular signaling pathways in fibrosis but also serve as potential targets of novel therapeutic interventions for fibrosing diseases. PMID:27647197

  7. Potentiation of Synaptic GluN2B NMDAR Currents by Fyn Kinase Is Gated through BDNF-Mediated Disinhibition in Spinal Pain Processing.

    PubMed

    Hildebrand, Michael E; Xu, Jian; Dedek, Annemarie; Li, Yi; Sengar, Ameet S; Beggs, Simon; Lombroso, Paul J; Salter, Michael W

    2016-12-06

    In chronic pain states, the neurotrophin brain-derived neurotrophic factor (BDNF) transforms the output of lamina I spinal neurons by decreasing synaptic inhibition. Pain hypersensitivity also depends on N-methyl-D-aspartate receptors (NMDARs) and Src-family kinases, but the locus of NMDAR dysregulation remains unknown. Here, we show that NMDAR-mediated currents at lamina I synapses are potentiated in a peripheral nerve injury model of neuropathic pain. We find that BDNF mediates NMDAR potentiation through activation of TrkB and phosphorylation of the GluN2B subunit by the Src-family kinase Fyn. Surprisingly, we find that Cl(-)-dependent disinhibition is necessary and sufficient to prime potentiation of synaptic NMDARs by BDNF. Thus, we propose that spinal pain amplification is mediated by a feedforward mechanism whereby loss of inhibition gates the increase in synaptic excitation within individual lamina I neurons. Given that neither disinhibition alone nor BDNF-TrkB signaling is sufficient to potentiate NMDARs, we have discovered a form of molecular coincidence detection in lamina I neurons. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  8. Analysis of weighted co-regulatory networks in maize provides insights into new genes and regulatory mechanisms related to inositol phosphate metabolism.

    PubMed

    Zhang, Shaojun; Yang, Wenzhu; Zhao, Qianqian; Zhou, Xiaojin; Jiang, Ling; Ma, Shuai; Liu, Xiaoqing; Li, Ye; Zhang, Chunyi; Fan, Yunliu; Chen, Rumei

    2016-02-24

    D-myo-inositol phosphates (IPs) are a series of phosphate esters. Myo-inositol hexakisphosphate (phytic acid, IP6) is the most abundant IP and has negative effects on animal and human nutrition. IPs play important roles in plant development, stress responses, and signal transduction. However, the metabolic pathways and possible regulatory mechanisms of IPs in maize are unclear. In this study, the B73 (high in phytic acid) and Qi319 (low in phytic acid) lines were selected for RNA-Seq analysis from 427 inbred lines based on a screening of IP levels. By integrating the metabolite data with the RNA-Seq data at three different kernel developmental stages (12, 21 and 30 days after pollination), co-regulatory networks were constructed to explore IP metabolism and its interactions with other pathways. Differentially expressed gene analyses showed that the expression of MIPS and ITPK was related to differences in IP metabolism in Qi319 and B73. Moreover, WRKY and ethylene-responsive transcription factors (TFs) were common among the differentially expressed TFs, and are likely to be involved in the regulation of IP metabolism. Six co-regulatory networks were constructed, and three were chosen for further analysis. Based on network analyses, we proposed that the GA pathway interacts with the IP pathway through the ubiquitination pathway, and that Ca(2+) signaling functions as a bridge between IPs and other pathways. IP pools were found to be transported by specific ATP-binding cassette (ABC) transporters. Finally, three candidate genes (Mf3, DH2 and CB5) were identified and validated using Arabidopsis lines with mutations in orthologous genes or RNA interference (RNAi)-transgenic maize lines. Some mutant or RNAi lines exhibited seeds with a low-phytic-acid phenotype, indicating perturbation of IP metabolism. Mf3 likely encodes an enzyme involved in IP synthesis, DH2 encodes a transporter responsible for IP transport across organs and CB5 encodes a transporter involved in IP

  9. [Peripheral blood circulation in the skin and the regulatory mechanisms in the course of primary transmural myocardial infarction].

    PubMed

    Khalepo, O V; Molotkov, O V; Eshkina, S L

    2009-01-01

    Laser Doppler flowmetry was used to study the indicators characterizing the peripheral blood circulation in the skin, regulatory mechanisms, and the compensatory capacities of the microcirculatory bed in 32 patients aged 45-60 years in the course of primary transmural myocardial infarction during exercise tests. Significant disturbances of the mechanism responsible for regulating the peripheral blood circulation system and chiefly its active components were detected in the presence of adequate blood filling of microvessels. There was a drastic decrease in the reserves of skin microvascular endothelial activity during ionophoresis of sodium nitroprusside and acetylcholine, the maximum degree of disturbances being observed on day 10 of myocardial infarction development.

  10. Analysis of the Transcription Regulatory Mechanism of Otx During the Development of the Sensory Vesicle in Ciona intestinalis.

    PubMed

    Oonuma, Kouhei; Hirose, Dan; Takatori, Naohito; Saiga, Hidetoshi

    2014-09-01

    Establishment of the anterior-posterior axis is an important event in the development of bilateral animals. A homeodomain transcription factor, Otx, is important for the formation of the anterior part of the embryo, and its mRNA is expressed in a continuous manner in a wide range of animals. This pattern of expression is thought to be important for the formation of anterior neural structures, but the mechanism that regulates Otx expression remains largely unknown. Towards understanding how the transcription of Otx is maintained in the cells of anterior neural structure, the sensory vesicle, during embryogenesis, we examined transcription regulatory mechanisms of Otx, using embryos of the ascidian, Ciona intestinalis, from the gastrula to tailbud stages, which have not been studied previously. We identified two genomic regions capable of mimicking the Otx expression pattern from the gastrula to tailbud stages. Putative transcription factor binding sites required for this activity were identified. Notably, distinct sets of transcription factor binding sites were required at different developmental stages for the expression of Otx, suggesting that the continuity of Otx is supported by distinct transcriptional mechanisms in the gastrula and neurula stages. Along with previous studies using Halocynthia roretzi, the present results provide insight into the evolution of transcriptional regulatory mechanism of Otx.

  11. Biofilm formation by Bacillus subtilis: new insights into regulatory strategies and assembly mechanisms.

    PubMed

    Cairns, Lynne S; Hobley, Laura; Stanley-Wall, Nicola R

    2014-08-01

    Biofilm formation is a social behaviour that generates favourable conditions for sustained survival in the natural environment. For the Gram-positive bacterium Bacillus subtilis the process involves the differentiation of cell fate within an isogenic population and the production of communal goods that form the biofilm matrix. Here we review recent progress in understanding the regulatory pathways that control biofilm formation and highlight developments in understanding the composition, function and structure of the biofilm matrix.

  12. Biofilm formation by Bacillus subtilis: new insights into regulatory strategies and assembly mechanisms

    PubMed Central

    Cairns, Lynne S; Hobley, Laura; Stanley-Wall, Nicola R

    2014-01-01

    Biofilm formation is a social behaviour that generates favourable conditions for sustained survival in the natural environment. For the Gram-positive bacterium Bacillus subtilis the process involves the differentiation of cell fate within an isogenic population and the production of communal goods that form the biofilm matrix. Here we review recent progress in understanding the regulatory pathways that control biofilm formation and highlight developments in understanding the composition, function and structure of the biofilm matrix. PMID:24988880

  13. A 'danse macabre': tau and Fyn in STEP with amyloid beta to facilitate induction of synaptic depression and excitotoxicity.

    PubMed

    Boehm, Jannic

    2013-06-01

    Alzheimer's disease, with its two most prominent pathological factors amyloid beta and tau protein, can be described as a disease of the synapse. It therefore comes as little surprise that NMDA receptor-related synaptic dysfunction had been thought for several years to underlie the synaptic pathophysiology seen in Alzheimer's disease. In this review I will summarise recent evidence showing that the NMDA receptor links the effects of extracellular amyloid beta with intracellular tau protein. Furthermore, the antagonistic roles of Fyn and STEP in NMDA receptor regulation, synaptic plasticity and induction of synaptic depression will be discussed. © 2013 Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

  14. CHOOSING A CHEMICAL MECHANISM FOR REGULATORY AND RESEARCH AIR QUALITY MODELING APPLICATIONS

    EPA Science Inventory

    There are numerous, different chemical mechanisms currently available for use in air quality models, and new mechanisms and versions of mechanisms are continually being developed. The development of Morphecule-type mechanisms will add a near-infinite number of additional mecha...

  15. CHOOSING A CHEMICAL MECHANISM FOR REGULATORY AND RESEARCH AIR QUALITY MODELING APPLICATIONS

    EPA Science Inventory

    There are numerous, different chemical mechanisms currently available for use in air quality models, and new mechanisms and versions of mechanisms are continually being developed. The development of Morphecule-type mechanisms will add a near-infinite number of additional mecha...

  16. Identification of a regulatory loop for the synthesis of neurosteroids: a steroidogenic acute regulatory protein-dependent mechanism involving hypothalamic-pituitary-gonadal axis receptors

    PubMed Central

    Meethal, Sivan Vadakkadath; Liu, Tianbing; Chan, Hsien W.; Ginsburg, Erika; Wilson, Andrea C.; Gray, Danielle N.; Bowen, Richard L.; Vonderhaar, Barbara K.; Atwood, Craig S.

    2009-01-01

    Brain sex steroids are derived from both peripheral (primarily gonadal) and local (neurosteroids) sources and are crucial for neurogenesis, neural differentiation and neural function. The mechanism(s) regulating the production of neurosteroids is not understood. To determine whether hypothalamic-pituitary-gonadal axis components previously detected in the extra-hypothalamic brain comprise a feedback loop to regulate neuro-sex steroid (NSS) production, we assessed dynamic changes in expression patterns of steroidogenic acute regulatory (StAR) protein, a key regulator of steroidogenesis, and key hypothalamic-pituitary-gonadal endocrine receptors, by modulating peripheral sex hormone levels in female mice. Ovariectomy (OVX; high serum gonadotropins, low serum sex steroids) had a differential effect on StAR protein levels in the extrahypothalamic brain; increasing the 30- and 32-kDa variants but decreasing the 37-kDa variant and is indicative of cholesterol transport into mitochondria for steroidogenesis. Treatment of OVX animals with E2,P4,or E2 + P4 for 3 days, which decreases OVX-induced increases in GnRH/gonadotropin production, reversed this pattern. Suppression of gonadotropin levels in OVX mice using the GnRH agonist leuprolide acetate inhibited the processing of the 37-kDa StAR protein into the 30-kDa StAR protein, confirming that the differential processing of brain StAR protein is regulated by gonadotropins. OVX dramatically suppressed extra-hypothalamic brain gonadotropin-releasing hormone 1 receptor expression, and was further suppressed in E2- or P4-treated OVX mice. Together, these data indicate the existence of endocrine and autocrine/paracrine feedback loops that regulate NSS synthesis. Further delineation of these feedback loops that regulate NSS production will aid in developing therapies to maintain brain sex steroid levels and cognition. PMID:19493163

  17. Activation of Vago by interferon regulatory factor (IRF) suggests an interferon system-like antiviral mechanism in shrimp

    PubMed Central

    Li, Chaozheng; Li, Haoyang; Chen, Yixiao; Chen, Yonggui; Wang, Sheng; Weng, Shao-Ping; Xu, Xiaopeng; He, Jianguo

    2015-01-01

    There is a debate on whether invertebrates possess an antiviral immunity similar to the interferon (IFN) system of vertebrates. The Vago gene from arthropods encodes a viral-activated secreted peptide that restricts virus infection through activating the JAK-STAT pathway and is considered to be a cytokine functionally similar to IFN. In this study, the first crustacean IFN regulatory factor (IRF)-like gene was identified in Pacific white shrimp, Litopenaeus vannamei. The L. vannamei IRF showed similar protein nature to mammalian IRFs and could be activated during virus infection. As a transcriptional regulatory factor, L. vannamei IRF could activate the IFN-stimulated response element (ISRE)-containing promoter to regulate the expression of mammalian type I IFNs and initiate an antiviral state in mammalian cells. More importantly, IRF could bind the 5′-untranslated region of L. vannamei Vago4 gene and activate its transcription, suggesting that shrimp Vago may be induced in a similar manner to that of IFNs and supporting the opinion that Vago might function as an IFN-like molecule in invertebrates. These suggested that shrimp might possess an IRF-Vago-JAK/STAT regulatory axis, which is similar to the IRF-IFN-JAK/STAT axis of vertebrates, indicating that invertebrates might possess an IFN system-like antiviral mechanism. PMID:26459861

  18. Activation of Vago by interferon regulatory factor (IRF) suggests an interferon system-like antiviral mechanism in shrimp.

    PubMed

    Li, Chaozheng; Li, Haoyang; Chen, Yixiao; Chen, Yonggui; Wang, Sheng; Weng, Shao-Ping; Xu, Xiaopeng; He, Jianguo

    2015-10-13

    There is a debate on whether invertebrates possess an antiviral immunity similar to the interferon (IFN) system of vertebrates. The Vago gene from arthropods encodes a viral-activated secreted peptide that restricts virus infection through activating the JAK-STAT pathway and is considered to be a cytokine functionally similar to IFN. In this study, the first crustacean IFN regulatory factor (IRF)-like gene was identified in Pacific white shrimp, Litopenaeus vannamei. The L. vannamei IRF showed similar protein nature to mammalian IRFs and could be activated during virus infection. As a transcriptional regulatory factor, L. vannamei IRF could activate the IFN-stimulated response element (ISRE)-containing promoter to regulate the expression of mammalian type I IFNs and initiate an antiviral state in mammalian cells. More importantly, IRF could bind the 5'-untranslated region of L. vannamei Vago4 gene and activate its transcription, suggesting that shrimp Vago may be induced in a similar manner to that of IFNs and supporting the opinion that Vago might function as an IFN-like molecule in invertebrates. These suggested that shrimp might possess an IRF-Vago-JAK/STAT regulatory axis, which is similar to the IRF-IFN-JAK/STAT axis of vertebrates, indicating that invertebrates might possess an IFN system-like antiviral mechanism.

  19. Role of Sodium Bicarbonate Cotransporters in Intracellular pH Regulation and Their Regulatory Mechanisms in Human Submandibular Glands.

    PubMed

    Namkoong, Eun; Shin, Yong-Hwan; Bae, Jun-Seok; Choi, Seulki; Kim, Minkyoung; Kim, Nahyun; Hwang, Sung-Min; Park, Kyungpyo

    2015-01-01

    Sodium bicarbonate cotransporters (NBCs) are involved in the pH regulation of salivary glands. However, the roles and regulatory mechanisms among different NBC isotypes have not been rigorously evaluated. We investigated the roles of two different types of NBCs, electroneutral (NBCn1) and electrogenic NBC (NBCe1), with respect to pH regulation and regulatory mechanisms using human submandibular glands (hSMGs) and HSG cells. Intracellular pH (pHi) was measured and the pHi recovery rate from cell acidification induced by an NH4Cl pulse was recorded. Subcellular localization and protein phosphorylation were determined using immunohistochemistry and co-immunoprecipitation techniques. We determined that NBCn1 is expressed on the basolateral side of acinar cells and the apical side of duct cells, while NBCe1 is exclusively expressed on the apical membrane of duct cells. The pHi recovery rate in hSMG acinar cells, which only express NBCn1, was not affected by pre-incubation with 5 μM PP2, an Src tyrosine kinase inhibitor. However, in HSG cells, which express both NBCe1 and NBCn1, the pHi recovery rate was inhibited by PP2. The apparent difference in regulatory mechanisms for NBCn1 and NBCe1 was evaluated by artificial overexpression of NBCn1 or NBCe1 in HSG cells, which revealed that the pHi recovery rate was only inhibited by PP2 in cells overexpressing NBCe1. Furthermore, only NBCe1 was significantly phosphorylated and translocated by NH4Cl, which was inhibited by PP2. Our results suggest that both NBCn1 and NBCe1 play a role in pHi regulation in hSMG acinar cells, and also that Src kinase does not regulate the activity of NBCn1.

  20. Mechanisms of diabetic autoimmunity: II--Is diabetes a central or peripheral disorder of effector and regulatory cells?

    PubMed

    Askenasy, Nadir

    2016-02-01

    Two competing hypotheses aiming to explain the onset of autoimmune reactions are discussed in the context of genetic and environmental predisposition to type 1 diabetes (T1D). The first hypothesis has evolved along characterization of the mechanisms of self-discrimination and attributes diabetic autoimmunity to escape of reactive T cells from central regulation in the thymus. The second considers frequent occurrence of autoimmune reactions within the immune homunculus, which are adequately suppressed by regulatory T cells originating from the thymus, and occasionally, insufficient suppression results in autoimmunity. Besides thymic dysfunction, deregulation of both effector and suppressor cells can in fact result from homeostatic aberrations at the peripheral level during initial stages of evolution of adaptive immunity. Pathogenic cells sensitized in the islets are efficiently expanded in the target tissue and pancreatic lymph nodes of lymphopenic neonates. In parallel, the same mechanisms of peripheral sensitization contribute to tolerization through education of naïve/effector T cells and expansion of regulatory T cells. Experimental evidence presented for each individual mechanism implies that T1D may result from a primary effector or suppressor immune abnormality. Disturbed self-tolerance leading to T1D may well result from peripheral deregulation of innate and adaptive immunity, with variable contribution of central thymic dysfunction.

  1. Thermo-mechanical study of bare 48Y UF6 containers exposed to the regulatory fire environment.

    SciTech Connect

    Ammerman, Douglas James; Lopez, Carlos; Morrow, Charles; Korbmacher, Tim; Charette, Marc-Andre

    2010-11-01

    Most of the regulatory agencies world-wide require that containers used for the transportation of natural UF6 and depleted UF6 must survive a fully-engulfing fire environment for 30 minutes as described in 10CFR71 and in TS-R-1. The primary objective of this project is to examine the thermo-mechanical performance of 48Y transportation cylinders when exposed to the regulatory hypothetical fire environment without the thermal protection that is currently used for shipments in those countries where required. Several studies have been performed in which UF6 cylinders have been analyzed to determine if the thermal protection currently used on UF6 cylinders of type 48Y is necessary for transport. However, none of them could clearly confirm neither the survival nor the failure of the 48Y cylinder when exposed to the regulatory fire environment without the additional thermal protection. A consortium of five companies that move UF6 is interested in determining if 48Y cylinders can be shipped without the thermal protection that is currently used. Sandia National Laboratories has outlined a comprehensive testing and analysis project to determine if these shipping cylinders are capable of withstanding the regulatory thermal environment without additional thermal protection. Sandia-developed coupled physics codes will be used for the analyses that are planned. A series of destructive and non-destructive tests will be performed to acquire the necessary material and behavior information to benchmark the models and to answer the question about the ability of these containers to survive the fire environment. Both the testing and the analysis phases of this project will consider the state of UF6 under thermal and pressure loads as well as the weakening of the steel container due to the thermal load. Experiments with UF6 are also planned to collect temperature- and pressure-dependent thermophysical properties of this material.

  2. Mosaic gene network modelling identified new regulatory mechanisms in HCV infection.

    PubMed

    Popik, Olga V; Petrovskiy, Evgeny D; Mishchenko, Elena L; Lavrik, Inna N; Ivanisenko, Vladimir A

    2016-06-15

    Modelling of gene networks is widely used in systems biology to study the functioning of complex biological systems. Most of the existing mathematical modelling techniques are useful for analysis of well-studied biological processes, for which information on rates of reactions is available. However, complex biological processes such as those determining the phenotypic traits of organisms or pathological disease processes, including pathogen-host interactions, involve complicated cross-talk between interacting networks. Furthermore, the intrinsic details of the interactions between these networks are often missing. In this study, we developed an approach, which we call mosaic network modelling, that allows the combination of independent mathematical models of gene regulatory networks and, thereby, description of complex biological systems. The advantage of this approach is that it allows us to generate the integrated model despite the fact that information on molecular interactions between parts of the model (so-called mosaic fragments) might be missing. To generate a mosaic mathematical model, we used control theory and mathematical models, written in the form of a system of ordinary differential equations (ODEs). In the present study, we investigated the efficiency of this method in modelling the dynamics of more than 10,000 simulated mosaic regulatory networks consisting of two pieces. Analysis revealed that this approach was highly efficient, as the mean deviation of the dynamics of mosaic network elements from the behaviour of the initial parts of the model was less than 10%. It turned out that for construction of the control functional, data on perturbation of one or two vertices of the mosaic piece are sufficient. Further, we used the developed method to construct a mosaic gene regulatory network including hepatitis C virus (HCV) as the first piece and the tumour necrosis factor (TNF)-induced apoptosis and NF-κB induction pathways as the second piece. Thus

  3. Platelet-derived growth factor (PDGF)-induced activation of signal transducer and activator of transcription (Stat) 5 is mediated by PDGF beta-receptor and is not dependent on c-src, fyn, jak1 or jak2 kinases.

    PubMed Central

    Paukku, K; Valgeirsdóttir, S; Saharinen, P; Bergman, M; Heldin, C H; Silvennoinen, O

    2000-01-01

    Several growth factors activate signal transducers and activators of transcription (Stats) but the mechanism of Stat activation in receptor tyrosine kinase signalling has remained elusive. In the present study we have analysed the roles of different platelet-derived growth factor (PDGF)-induced tyrosine kinases in the activation of Stat5. Co-expression experiments in insect and mammalian cells demonstrated that both PDGF beta-receptor (PDGF beta-R) and Jak1, but not c-Src, induced the activation of Stat5. Furthermore, immune-complex-purified PDGF beta-R was able to phosphorylate Stat5 directly. The role of the cytoplasmic tyrosine kinases in the PDGF-induced activation of Stat5 was further investigated by overexpressing kinase-negative (KN) and wild-type Jak and c-Src kinases. Jak1-KN or Jak2-KN had no effect but both Src-KN and wild-type c-Src similarly decreased the PDGF-beta-R-induced activation of Stat5. The activation of both Src and Stat5 is dependent on the same tyrosine residues Tyr(579) and Tyr(581) in PDGF beta-R; thus the observed inhibition by Src might result from competition for binding of Stat5 to the receptor. Finally, fibroblasts derived from Src(-/-) and Fyn(-/-) mice showed normal pattern of PDGF-induced tyrosine phosphorylation of Stat5. Taken together, these results indicate that Stat5 is a direct substrate for PDGF beta-R and that the activation does not require Jak1, Jak2, c-Src or Fyn tyrosine kinases. PMID:10642538

  4. Fyn and p38 signaling are both required for maximal hypertonic activation of the osmotic response element-binding protein/tonicity-responsive enhancer-binding protein (OREBP/TonEBP).

    PubMed

    Ko, Ben C B; Lam, Amy K M; Kapus, Andras; Fan, Lingzhi; Chung, Sookja K; Chung, Stephen S M

    2002-11-29

    When cells are challenged by hyperosmotic stress, one of the crucial adaptive responses is the expression of osmoprotective genes that are responsible for raising the intracellular level of compatible osmolytes such as sorbitol, betaine, and myo-inositol. This is achieved by the activation of the transcription factor called OREBP (also known as TonEBP or NFAT5) that specifically binds to the osmotic response element (ORE) or tonicity-responsive enhancer that enhances the transcription of these genes. Here we show that p38, a subgroup of the mitogen-activated kinases activated by hypertonic stress, and Fyn, a shrinkage-activated tyrosine kinase, are both involved in the hypertonic activation of OREBP/TonEBP. Inhibition of p38 by SB203580 or by the dominant negative p38 mutant partially blocked the hypertonic induction of ORE reporter (reporter gene regulated by ORE). Similarly, hypertonic activation of ORE reporter was partially blocked by pharmacological inhibition of Fyn or by a dominant negative Fyn and was attenuated in Fyn-deficient cells. Importantly, inhibiting p38 in Fyn-deficient cells almost completely abolished the hypertonic induction of ORE reporter activity, indicating that p38 and Fyn are the major signaling pathways for the hypertonic activation of OREBP/TonEBP. Further we show that the transactivation domain of OREBP/TonEBP is the target of p38- and Fyn-mediated hypertonic activation. These results indicate a dual control in regulating the expression of the osmoprotective genes in mammalian cells.

  5. Transmembrane Form Agrin-induced Process Formation Requires Lipid Rafts and the Activation of Fyn and MAPK*S⃞

    PubMed Central

    Ramseger, Rene; White, Robin; Kröger, Stephan

    2009-01-01

    Overexpression or clustering of the transmembrane form of the extracellular matrix heparan sulfate proteoglycan agrin (TM-agrin) induces the formation of highly dynamic filopodia-like processes on axons and dendrites from central and peripheral nervous system-derived neurons. Here we show that the formation of these processes is paralleled by a partitioning of TM-agrin into lipid rafts, that lipid rafts and transmembrane-agrin colocalize on the processes, that extraction of lipid rafts with methyl-β-cyclodextrin leads to a dose-dependent reduction of process formation, that inhibition of lipid raft synthesis prevents process formation, and that the continuous presence of lipid rafts is required for the maintenance of the processes. Association of TM-agrin with lipid rafts results in the phosphorylation and activation of the Src family kinase Fyn and subsequently in the phosphorylation and activation of MAPK. Inhibition of Fyn or MAPK activation inhibits process formation. These results demonstrate that the formation of filopodia-like processes by TM-agrin is the result of the activation of a complex intracellular signaling cascade, supporting the hypothesis that TM-agrin is a receptor or coreceptor on neurons. PMID:19139104

  6. Comparative analysis of mutant plants impaired in the main regulatory mechanisms of photosynthetic light reactions - From biophysical measurements to molecular mechanisms.

    PubMed

    Tikkanen, Mikko; Rantala, Sanna; Grieco, Michele; Aro, Eva-Mari

    2017-03-01

    Chlorophyll (chl) fluorescence emission by photosystem II (PSII) and light absorption by P700 reaction center chl a of photosystem I (PSI) provide easy means to probe the function of the photosynthetic machinery. The exact relationship between the measured optical variables and the molecular processes have, however, remained elusive. Today, the availability of mutants with distinct molecular characterization of photosynthesis regulatory processes should make it possible to gain further insights into this relationship, yet a systematic comparative analysis of such regulatory mutants has been missing. Here we have systematically compared the behavior of Dual-PAM fluorescence and P700 variables from well-characterized photosynthesis regulation mutants. The analysis revealed a very convincing relationship between the given molecular deficiency in the photosynthetic apparatus and the original fluorescence and P700 signals obtained by using varying intensities of actinic light and by applying a saturating pulse. Importantly, the specific information on the underlying molecular mechanism, present in these authentic signals of a given photosynthesis mutant, was largely nullified when using the commonly accepted parameters that are based on further treatment of the original signals. Understanding the unique relationship between the investigated molecular process of photosynthesis and the measured variable is an absolute prerequisite for comprehensive interpretation of fluorescence and P700 measurements. The data presented here elucidates the relationships between the main regulatory mechanisms controlling the photosynthetic light reactions and the variables obtained by fluorescence and P700 measurements. It is discussed how the full potential of optical photosynthesis measurements can be utilized in investigation of a given molecular mechanism.

  7. Transcriptional regulatory network triggered by oxidative signals configures the early response mechanisms of japonica rice to chilling stress

    PubMed Central

    2010-01-01

    Background The transcriptional regulatory network involved in low temperature response leading to acclimation has been established in Arabidopsis. In japonica rice, which can only withstand transient exposure to milder cold stress (10°C), an oxidative-mediated network has been proposed to play a key role in configuring early responses and short-term defenses. The components, hierarchical organization and physiological consequences of this network were further dissected by a systems-level approach. Results Regulatory clusters responding directly to oxidative signals were prominent during the initial 6 to 12 hours at 10°C. Early events mirrored a typical oxidative response based on striking similarities of the transcriptome to disease, elicitor and wounding induced processes. Targets of oxidative-mediated mechanisms are likely regulated by several classes of bZIP factors acting on as1/ocs/TGA-like element enriched clusters, ERF factors acting on GCC-box/JAre-like element enriched clusters and R2R3-MYB factors acting on MYB2-like element enriched clusters. Temporal induction of several H2O2-induced bZIP, ERF and MYB genes coincided with the transient H2O2 spikes within the initial 6 to 12 hours. Oxidative-independent responses involve DREB/CBF, RAP2 and RAV1 factors acting on DRE/CRT/rav1-like enriched clusters and bZIP factors acting on ABRE-like enriched clusters. Oxidative-mediated clusters were activated earlier than ABA-mediated clusters. Conclusion Genome-wide, physiological and whole-plant level analyses established a holistic view of chilling stress response mechanism of japonica rice. Early response regulatory network triggered by oxidative signals is critical for prolonged survival under sub-optimal temperature. Integration of stress and developmental responses leads to modulated growth and vigor maintenance contributing to a delay of plastic injuries. PMID:20100339

  8. Regulatory mechanism of the three-component system HptRSA in glucose-6-phosphate uptake in Staphylococcus aureus.

    PubMed

    Yang, Yifan; Sun, Haipeng; Liu, Xiaoyu; Wang, Mingxing; Xue, Ting; Sun, Baolin

    2016-06-01

    Glucose-6-phosphate (G6P) is a common alternative carbon source for various bacteria, and its uptake usually relies on the hexose phosphate antiporter UhpT. In the human pathogenic bacterium Staphylococcus aureus, the ability to utilize different nutrients, particularly alternative carbon source uptake in glucose-limiting conditions, is essential for its fitness in the host environment during the infectious process. It has been reported that G6P uptake in S. aureus is regulated by the three-component system HptRSA. When G6P is provided as the only carbon source, HptRSA could sense extracellular G6P and activate uhpT expression to facilitate G6P utilization. However, the regulatory mechanism of HptRSA is still unclear. In this study, we further investigated the HptRSA system in S. aureus. First, we confirmed that HptRSA is necessary for the normal growth of this pathogen in chemically defined medium with G6P supplementation, and we discovered that HptRSA could exclusively sense extracellular G6P compared to the other organophosphates we tested. Next, using isothermal titration calorimetry, we found that HptA could bind to G6P, suggesting that it may be the G6P sensor. After that experiment, using an electrophoresis mobility shift assay, we verified that the response regulator HptR could directly bind to the uhpT promoter and identified a putative binding site from -67 to -96-bp. Subsequently, we created different point mutations in the putative binding site and revealed that the entire 30-bp sequence is essential for HptR regulation. In summary, we unveiled the regulatory mechanism of the HptRSA system in S. aureus, HptA most likely functions as the G6P sensor, and HptR could implement its regulatory function by directly binding to a conserved, approximately 30-bp sequence in the uhpT promoter.

  9. Potential Novel Mechanism for Axenfeld-Rieger Syndrome: Deletion of a Distant Region Containing Regulatory Elements of PITX2

    PubMed Central

    Volkmann, Bethany A.; Zinkevich, Natalya S.; Mustonen, Aki; Schilter, Kala F.; Bosenko, Dmitry V.; Reis, Linda M.; Broeckel, Ulrich; Link, Brian A.

    2011-01-01

    Purpose. Mutations in PITX2 are associated with Axenfeld-Rieger syndrome (ARS), which involves ocular, dental, and umbilical abnormalities. Identification of cis-regulatory elements of PITX2 is important to better understand the mechanisms of disease. Methods. Conserved noncoding elements surrounding PITX2/pitx2 were identified and examined through transgenic analysis in zebrafish; expression pattern was studied by in situ hybridization. Patient samples were screened for deletion/duplication of the PITX2 upstream region using arrays and probes. Results. Zebrafish pitx2 demonstrates conserved expression during ocular and craniofacial development. Thirteen conserved noncoding sequences positioned within a gene desert as far as 1.1 Mb upstream of the human PITX2 gene were identified; 11 have enhancer activities consistent with pitx2 expression. Ten elements mediated expression in the developing brain, four regions were active during eye formation, and two sequences were associated with craniofacial expression. One region, CE4, located approximately 111 kb upstream of PITX2, directed a complex pattern including expression in the developing eye and craniofacial region, the classic sites affected in ARS. Screening of ARS patients identified an approximately 7600-kb deletion that began 106 to 108 kb upstream of the PITX2 gene, leaving PITX2 intact while removing regulatory elements CE4 to CE13. Conclusions. These data suggest the presence of a complex distant regulatory matrix within the gene desert located upstream of PITX2 with an essential role in its activity and provides a possible mechanism for the previous reports of ARS in patients with balanced translocations involving the 4q25 region upstream of PITX2 and the current patient with an upstream deletion. PMID:20881290

  10. Redox biology in normal cells and cancer: restoring function of the redox/Fyn/c-Cbl pathway in cancer cells offers new approaches to cancer treatment.

    PubMed

    Noble, Mark; Mayer-Pröschel, Margot; Li, Zaibo; Dong, Tiefei; Cui, Wanchang; Pröschel, Christoph; Ambeskovic, Ibro; Dietrich, Joerg; Han, Ruolan; Yang, Yin Miranda; Folts, Christopher; Stripay, Jennifer; Chen, Hsing-Yu; Stevens, Brett M

    2015-02-01

    This review discusses a unique discovery path starting with novel findings on redox regulation of precursor cell and signaling pathway function and identification of a new mechanism by which relatively small changes in redox status can control entire signaling networks that regulate self-renewal, differentiation, and survival. The pathway central to this work, the redox/Fyn/c-Cbl (RFC) pathway, converts small increases in oxidative status to pan-activation of the c-Cbl ubiquitin ligase, which controls multiple receptors and other proteins of central importance in precursor cell and cancer cell function. Integration of work on the RFC pathway with attempts to understand how treatment with systemic chemotherapy causes neurological problems led to the discovery that glioblastomas (GBMs) and basal-like breast cancers (BLBCs) inhibit c-Cbl function through altered utilization of the cytoskeletal regulators Cool-1/βpix and Cdc42, respectively. Inhibition of these proteins to restore normal c-Cbl function suppresses cancer cell division, increases sensitivity to chemotherapy, disrupts tumor-initiating cell (TIC) activity in GBMs and BLBCs, controls multiple critical TIC regulators, and also allows targeting of non-TICs. Moreover, these manipulations do not increase chemosensitivity or suppress division of nontransformed cells. Restoration of normal c-Cbl function also allows more effective harnessing of estrogen receptor-α (ERα)-independent activities of tamoxifen to activate the RFC pathway and target ERα-negative cancer cells. Our work thus provides a discovery strategy that reveals mechanisms and therapeutic targets that cannot be deduced by standard genetics analyses, which fail to reveal the metabolic information, isoform shifts, protein activation, protein complexes, and protein degradation critical to our discoveries.

  11. The tyrosine kinases Fyn and Hck favor the recruitment of tyrosine-phosphorylated APOBEC3G into vif-defective HIV-1 particles.

    PubMed

    Douaisi, Marc; Dussart, Sylvie; Courcoul, Marianne; Bessou, Gilles; Lerner, Edwina C; Decroly, Etienne; Vigne, Robert

    2005-04-15

    The main function of Vif is to limit the antiviral activity of APOBEC3G by counteracting its packaging into HIV-1 virions. In this work, we examine the possible functional interactions between Vif, APOBEC3G, and two Src family tyrosine kinases, Fyn and Hck, present in T lymphocytes and in monocyte-macrophages, respectively. By GST pull-down, we show that the SH3 domains of Fyn and Hck, and the corresponding full-length proteins bind Vif of HIV-1. One consequence of this interaction is a reduction in their catalytic activity. Interestingly, we also observed that APOBEC3G can be phosphorylated on tyrosine in the presence of Fyn or Hck, suggesting that both kinases may regulate APOBEC3G function. Accordingly, we demonstrate that in the presence of Fyn or Hck and in the absence of Vif, the overall level of APOBEC3G incorporated into HIV-1 particles is decreased, whereas the level of encapsidation of its phosphorylated form is significantly enhanced.

  12. Function and mechanism by which interferon regulatory factor-1 inhibits oncogenesis

    PubMed Central

    CHEN, FEI-FEI; JIANG, GUAN; XU, KERUI; ZHENG, JUN-NIAN

    2013-01-01

    The present review focuses on recent advances in the understanding of the molecular mechnisms by which interferon regulatory factor (IRF)-1 inhibits oncogenesis. IRF-1 is associated with regulation of interferon α and β transcription. In addition, numerous clinical studies have indicated that IRF-1 gene deletion or rearrangement correlates with development of specific forms of human cancer. IRF-1 has been revealed to exhibit marked functional diversity in the regulation of oncogenesis. IRF-1 activates a set of target genes associated with regulation of the cell cycle, apoptosis and the immune response. The role of IRF-1 in the regulation of various types of human tumor has important implications for understanding the susceptibility and progression of cancer. In addition, an improved understanding of the role of IRF-1 in the pathological processes that lead to human malignant diseases may aid development of novel therapeutic strategies. PMID:23420765

  13. The Human Imprintome: Regulatory Mechanisms, Methods of Ascertainment, and Roles in Disease Susceptibility

    PubMed Central

    Skaar, David A.; Li, Yue; Bernal, Autumn J.; Hoyo, Cathrine; Murphy, Susan K.; Jirtle, Randy L.

    2012-01-01

    Imprinted genes form a special subset of the genome, exhibiting monoallelic expression in a parent-of-origin–dependent fashion. This monoallelic expression is controlled by parental-specific epigenetic marks, which are established in gametogenesis and early embryonic development and are persistent in all somatic cells throughout life. We define this specific set of cis-acting epigenetic regulatory elements as the imprintome, a distinct and specially tasked subset of the epigenome. Imprintome elements contain DNA methylation and histone modifications that regulate monoallelic expression by affecting promoter accessibility, chromatin structure, and chromatin configuration. Understanding their regulation is critical because a significant proportion of human imprinted genes are implicated in complex diseases. Significant species variation in the repertoire of imprinted genes and their epigenetic regulation, however, will not allow model organisms solely to be used for this crucial purpose. Ultimately, only the human will suffice to accurately define the human imprintome. PMID:23744971

  14. The Emerging Role of Protein Phosphorylation as a Critical Regulatory Mechanism Controlling Cellulose Biosynthesis

    PubMed Central

    Jones, Danielle M.; Murray, Christian M.; Ketelaar, KassaDee J.; Thomas, Joseph J.; Villalobos, Jose A.; Wallace, Ian S.

    2016-01-01

    Plant cell walls are extracellular matrices that surround plant cells and critically influence basic cellular processes, such as cell division and expansion. Cellulose is a major constituent of plant cell walls, and this paracrystalline polysaccharide is synthesized at the plasma membrane by a large protein complex known as the cellulose synthase complex (CSC). Recent efforts have identified numerous protein components of the CSC, but relatively little is known about regulation of cellulose biosynthesis. Numerous phosphoproteomic surveys have identified phosphorylation events in CSC associated proteins, suggesting that protein phosphorylation may represent an important regulatory control of CSC activity. In this review, we discuss the composition and dynamics of the CSC in vivo, the catalog of CSC phosphorylation sites that have been identified, the function of experimentally examined phosphorylation events, and potential kinases responsible for these phosphorylation events. Additionally, we discuss future directions in cellulose synthase kinase identification and functional analyses of CSC phosphorylation sites. PMID:27252710

  15. The Role of 5-HTR6 in Mossy Fiber Sprouting: Activating Fyn and p-ERK1/2 in Pilocarpine-Induced Chronic Epileptic Rats.

    PubMed

    Lin, Wanhui; Huang, Wenli; Chen, Shenggen; Lin, Mingxing; Huang, Qingyu; Huang, Huapin

    2017-01-01

    Our primary objective is to verify whether 5-HTR6 is involved in the development of mossy fiber sprouting (MFS), and to determine how the progression of MFS is affected by 5-HTR6. A total of 90 male adult Sprague-Dawley rats were allocated into either the control group (n=36) or the epileptic group (n=54). Status epilepticus (SE) of rats was induced by the intraperitoneal (i.p.) injection of LiCl-pilocarpine. We conducted our experiments in two stages. The first stage involves equally dividing 36 epileptic rats into three groups with treatments of none, 5-HTR6 antagonist SB-27104 (SB) and vehicle DMSO. Then behavior and electroencephalogram (EEG) of rats were monitored by video-EEG. The second stage involves dividing 126 epileptic rats into seven groups with treatments of none, 10% DMSO, SB (100 µg/kg), Fyn antagonist PP2 (50 µg/kg), p-ERK1/2 antagonist PD-98059 (30 µg/kg), SB (100 µg/ kg) + PP2 (50 µg/kg); SB (100 µg/kg) + PD-98059 (30 µg/kg). We also treated 18 rats in the control group of the first stage with 100 µg/kg 5-HTR6 agonist WAY-181187 (WAY). MFS of rats was detected through the approach of Timm's staining. Finally, expressions of 5-HTR6, Fyn, p-ERK1/2 and GAP-3 were qualified and semi-quantified via western blotting or RT-PCR. Induction of SE could stimulate formation of MFS and increased GAP-43 expressions. Expressions of 5-HTR6, Fyn and p-ERK1/2 were also up-regulated with increasing time after establishment of SE models. The development of MFS was remarkably inhibited by SB, PP2 and PD. Compared to the single antagonist, such an inhibitory effect was enhanced by SB+PD or SB+PP. Moreover, treatment of healthy rats with WAY would contribute to up-regulated Fyn and p-ERK1/2 expressions, as well as development of MFS (P < 0.05). Suppression of Fyn triggered a down-regulating trend of p-ERK1/2 (P < 0.05), however, suppressed p-ERK1/2 did not have such a significant effect on Fyn expression. HTR6 may affect the progression of MFS by activating

  16. Biochemistry on a leash: Confinement as a regulatory mechanism for bimolecular reaction rates

    NASA Astrophysics Data System (ADS)

    Reeves, Daniel; Cheveralls, Keith; Kondev, Jane

    2009-03-01

    We describe two mechanisms by which confinement regulates diffusion-limited bimolecular reaction rates. The first mechanism, illustrated by the actin capping protein formin, uses a flexible polymer to tether ligand binding sites, which serve as intermediaries, to the reactive site. The second mechanism uses a potential (e.g. hard wall potential), to constrain the motion of a ligand receptor within a confining volume. We analyze both mechanisms theoretically, using a combination of analytic and numerical techniques, to obtain the steady state binding kinetics. We explore how the reaction rates are regulated by parameters of the model such as the length of the polymer tether, and use our findings to explain the key features of the formin system. Finally, we suggest other systems, both synthetic and biological, in which these mechanisms for regulating bimolecular reactions might be at play.

  17. Structure Reveals Regulatory Mechanisms of a MaoC-Like Hydratase from Phytophthora capsici Involved in Biosynthesis of Polyhydroxyalkanoates (PHAs)

    PubMed Central

    Wang, Huizheng; Zhang, Kai; Zhu, Jie; Song, Weiwei; Zhao, Li; Zhang, Xiuguo

    2013-01-01

    Background Polyhydroxyalkanoates (PHAs) have attracted increasing attention as “green plastic” due to their biodegradable, biocompatible, thermoplastic, and mechanical properties, and considerable research has been undertaken to develop low cost/high efficiency processes for the production of PHAs. MaoC-like hydratase (MaoC), which belongs to (R)-hydratase involved in linking the β-oxidation and the PHA biosynthetic pathways, has been identified recently. Understanding the regulatory mechanisms of (R)-hydratase catalysis is critical for efficient production of PHAs that promise synthesis an environment-friendly plastic. Methodology/Principal Findings We have determined the crystal structure of a new MaoC recognized from Phytophthora capsici. The crystal structure of the enzyme was solved at 2.00 Å resolution. The structure shows that MaoC has a canonical (R)-hydratase fold with an N-domain and a C-domain. Supporting its dimerization observed in structure, MaoC forms a stable homodimer in solution. Mutations that disrupt the dimeric MaoC result in a complete loss of activity toward crotonyl-CoA, indicating that dimerization is required for the enzymatic activity of MaoC. Importantly, structure comparison reveals that a loop unique to MaoC interacts with an α-helix that harbors the catalytic residues of MaoC. Deletion of the loop enhances the enzymatic activity of MaoC, suggesting its inhibitory role in regulating the activity of MaoC. Conclusions/Significance The data in our study reveal the regulatory mechanism of an (R)-hydratase, providing information on enzyme engineering to produce low cost PHAs. PMID:24244597

  18. Discovery of Novel Splice Variants and Regulatory Mechanisms for Microsomal Triglyceride Transfer Protein in Human Tissues

    PubMed Central

    Suzuki, Takashi; Swift, Larry L.

    2016-01-01

    Microsomal triglyceride transfer protein (MTP) is a unique lipid transfer protein essential for the assembly of triglyceride-rich lipoproteins by the liver and intestine. Previous studies in mice identified a splice variant of MTP with an alternate first exon. Splice variants of human MTP have not been reported. Using PCR approaches we have identified two splice variants in human tissues, which we have named MTP-B and MTP-C. MTP-B has a unique first exon (Ex1B) located 10.5 kb upstream of the first exon (Ex1A) for canonical MTP (MTP-A); MTP-C contains both first exons for MTP-A and MTP-B. MTP-B was found in a number of tissues, whereas MTP-C was prominent in brain and testis. MTP-B does not encode a protein; MTP-C encodes the same protein encoded by MTP-A, although MTP-C translation is strongly inhibited by regulatory elements within its 5′-UTR. Using luciferase assays, we demonstrate that the promoter region upstream of exon 1B is quite adequate to drive expression of MTP. We conclude that alternate splicing plays a key role in regulating cellular MTP levels by introducing distinct promoter regions and unique 5′-UTRs, which contain elements that alter translation efficiency, enabling the cell to optimize MTP activity. PMID:27256115

  19. Discovery of Novel Splice Variants and Regulatory Mechanisms for Microsomal Triglyceride Transfer Protein in Human Tissues.

    PubMed

    Suzuki, Takashi; Swift, Larry L

    2016-06-03

    Microsomal triglyceride transfer protein (MTP) is a unique lipid transfer protein essential for the assembly of triglyceride-rich lipoproteins by the liver and intestine. Previous studies in mice identified a splice variant of MTP with an alternate first exon. Splice variants of human MTP have not been reported. Using PCR approaches we have identified two splice variants in human tissues, which we have named MTP-B and MTP-C. MTP-B has a unique first exon (Ex1B) located 10.5 kb upstream of the first exon (Ex1A) for canonical MTP (MTP-A); MTP-C contains both first exons for MTP-A and MTP-B. MTP-B was found in a number of tissues, whereas MTP-C was prominent in brain and testis. MTP-B does not encode a protein; MTP-C encodes the same protein encoded by MTP-A, although MTP-C translation is strongly inhibited by regulatory elements within its 5'-UTR. Using luciferase assays, we demonstrate that the promoter region upstream of exon 1B is quite adequate to drive expression of MTP. We conclude that alternate splicing plays a key role in regulating cellular MTP levels by introducing distinct promoter regions and unique 5'-UTRs, which contain elements that alter translation efficiency, enabling the cell to optimize MTP activity.

  20. Immunomodulation of mesenchymal stromal cells on regulatory T cells and its possible mechanism.

    PubMed

    Yan, Zhidong; Zhuansun, Yongxun; Chen, Rui; Li, Jianguo; Ran, Pixin

    2014-05-15

    Mesenchymal stromal cells (MSCs) and regulatory T cells (Tregs) have both garnered abundant interests from immunologists worldwide, as both MSCs and Tregs can be considered immunosuppressive in their own right. But a little attention has been paid to the impacts of MSCs on Tregs. To clarify the effects of MSCs on Tregs, we performed the coculture systems within MSCs and Tregs. We confirmed that MSC-exposed Tregs are capable of more immunosuppressive than Tregs without coculturing with MSCs. And this augmenting suppressive capacity was accompanied with an upregulation of programmed cell death 1 receptor (PD-1) on Tregs. Importantly, we found that cell viability of Tregs was excluded from the influences of MSCs. Finally, we showed that PD-1/B7-H1 interactions and IL-10 might be responsible for the enhanced suppressive capability of MSC-exposed Tregs. Further analysis revealed that PD-1/B7-H1 interactions were not responsible for the productions of IL-10 and TGF-β1 in the MSC-Treg coculture systems; in contrast, IL-10 rather than TGF-β1 played a role in the upregualtion of PD-1. Furthermore, this is the first explorative study to evaluate the immunomodulation of MSCs on the suppressive capacity of Tregs in MSC-Treg in vitro coculture setting.

  1. Analysis of microRNA and Gene Expression Profiles in Multiple Sclerosis: Integrating Interaction Data to Uncover Regulatory Mechanisms

    PubMed Central

    Freiesleben, Sherry; Hecker, Michael; Zettl, Uwe Klaus; Fuellen, Georg; Taher, Leila

    2016-01-01

    MicroRNAs (miRNAs) have been reported to contribute to the pathophysiology of multiple sclerosis (MS), an inflammatory disorder of the central nervous system. Here, we propose a new consensus-based strategy to analyse and integrate miRNA and gene expression data in MS as well as other publically available data to gain a deeper understanding of the role of miRNAs in MS and to overcome the challenges posed by studies with limited patient sample sizes. We processed and analysed microarray datasets, and compared the expression of genes and miRNAs in the blood of MS patients and controls. We then used our consensus and integration approach to construct two molecular networks dysregulated in MS: a miRNA- and a gene-based network. We identified 18 differentially expressed (DE) miRNAs and 128 DE genes that may contribute to the regulatory alterations behind MS. The miRNAs were linked to immunological and neurological pathways, and we exposed let-7b-5p and miR-345-5p as promising blood-derived disease biomarkers in MS. The results suggest that DE miRNAs are more informative than DE genes in uncovering pathways potentially involved in MS. Our findings provide novel insights into the regulatory mechanisms and networks underlying MS. PMID:27694855

  2. Oligodendrocyte differentiation and signaling after transferrin internalization: a mechanism of action.

    PubMed

    Pérez, María Julia; Fernandez, Natalia; Pasquini, Juana María

    2013-10-01

    Oligodendrocytes are the cells producing the myelin membrane around the axons in the central nervous system and, although apotransferrin (aTf) is required for oligodendrocyte differentiation, the underlying mechanisms are not fully understood. Fyn tyrosine kinase, a member of the Src family of proteins, has been shown to play an important role in myelination by up-regulating the expression of myelin basic protein; however, a molecular link between aTf and Fyn kinase signaling pathway during oligodendrocytes differentiation has not been established yet. Our aim was to investigate whether Fyn kinase, MEK/ERK and PI3K/Akt signaling pathways are required for aTf-stimulation of oligodendrocyte differentiation and also to determine if the transferrin receptor is involved in these mechanisms. Treatment of primary cultures of oligodendroglial precursor cells with aTf leads to Fyn kinase activation by a mechanism that involves transferrin receptor. In turn, Fyn kinase activation promotes MEK-mediated transient phosphorylation of ERK1/2. On the other hand, transferrin receptor internalization also produces rapid and sustained activation of Akt, which involves phosphatidylinositol 3-kinase (PI3K) activation. Finally, aTf incorporated through clathrin-mediated endocytosis increases myelin basic protein, F3-contactin and β-tubulin through Fyn/MEK/ERK pathways, as well as an activation of the PI3K/Akt pathway. Our results also demonstrate that the activation of the pathways necessary for oligodendroglial precursor cell maturation is dependent on AP2 recruitment onto the plasma membrane for clathrin-mediated endocytosis of transferrin receptor.

  3. Regulatory mechanisms of Hertwig׳s epithelial root sheath formation and anomaly correlated with root length.

    PubMed

    Kumakami-Sakano, Mika; Otsu, Keishi; Fujiwara, Naoki; Harada, Hidemitsu

    2014-07-15

    Teeth are composed of two domains, the enamel-covered crown and cementum-covered root. The mechanism for determining the transition from crown to root is important for understanding root anomaly diseases. Hertwig׳s epithelial root sheath (HERS) is derived from the dental epithelium and is known to drive the growth of root dentin and periodontal tissue. Some clinical cases of hypoplastic tooth root are caused by the cessation of HERS development. Understanding the mechanisms of HERS development will contribute to the study of the disease and dental regenerative medicine. However, the developmental biology of tooth root formation has not been fully studied, particularly regarding HERS formation. Here, we describe the mechanisms of HERS formation on the basis of analysis of cell dynamics using imaging and summarize how the growth factor and its receptor regulate cell behavior of the dental epithelium.

  4. Effect of radiologic contrast media on cell volume regulatory mechanisms in human red blood cells.

    PubMed

    Galtung, Hilde Kanli; Sørlundsengen, Vibeke; Sakariassen, Kjell S; Benestad, Haakon B

    2002-08-01

    The authors performed this study to evaluate cell volume regulation in human red blood cells (RBCs) after incubation in solutions of three contrast media: iohexol (830 mOsm), ioxaglate (520 mOsm), and iodixanol (300 mOsm). Whole blood sampled from six healthy subjects was exposed to Ringer solutions containing 25% or 5% vol/vol iohexol (final osmolality, 440 or 340 mOsm, respectively), ioxaglate (final osmolality, 395 or 335 mOsm, respectively), iodixanol (final osmolality, 330 or 315 mOsm, respectively), or NaCl (control solutions with the same osmolality as that of the contrast media). In some experiments, control RBCs were subjected to a hyposmotic solution (100 mOsm). RBC volumes were obtained with a Coulter counter. The RBCs showed normal regulatory cell shrinkage after hyposmotically induced swelling. All 25% vol/vol contrast material solutions and their control solutions induced RBC shrinkage (range, 6% +/- 1 [standard error] to 22% +/- 3). The same was true for cells exposed to 5% vol/vol contrast material (range, 4% +/- 1 to 7% +/- 1). The shrinkage phase was followed by cell swelling (10% +/- 2 to 20% +/- 2 for 25% contrast material and their control solutions and 8% +/- 1 to 15% +/- 2 for 5% contrast material and their control solutions). No contrast material-exposed RBCs increased their volumes to the level reached with their control solutions. RBCs exposed to hyperosmotic iohexol, ioxaglate, or iodixanol solutions shrank and then swelled. The degree of shrinkage and subsequent swelling could not be explained simply with the osmolality of the test solutions. Physicochemical properties of the contrast media must be involved, putatively affecting electrolyte fluxes over the RBC membrane. Possible targets of these effects are the K+/Cl- symporter, K+ channels, and the Na+/K+/Cl- symporter.

  5. Regulatory mechanisms differ in UMP kinases from gram-negative and gram-positive bacteria.

    PubMed

    Evrin, Cécile; Straut, Monica; Slavova-Azmanova, Neli; Bucurenci, Nadia; Onu, Adrian; Assairi, Liliane; Ionescu, Mihaela; Palibroda, Nicolae; Bârzu, Octavian; Gilles, Anne-Marie

    2007-03-09

    In this work, we examined the regulation by GTP and UTP of the UMP kinases from eight bacterial species. The enzyme from Gram-positive organisms exhibited cooperative kinetics with ATP as substrate. GTP decreased this cooperativity and increased the affinity for ATP. UTP had the opposite effect, as it decreased the enzyme affinity for ATP. The nucleotide analogs 5-bromo-UTP and 5-iodo-UTP were 5-10 times stronger inhibitors than the parent compound. On the other hand, UMP kinases from the Gram-negative organisms did not show cooperativity in substrate binding and catalysis. Activation by GTP resulted mainly from the reversal of inhibition caused by excess UMP, and inhibition by UTP was accompanied by a strong increase in the apparent K(m) for UMP. Altogether, these results indicate that, depending on the bacteria considered, GTP and UTP interact with different enzyme recognition sites. In Gram-positive bacteria, GTP and UTP bind to a single site or largely overlapping sites, shifting the T R equilibrium to either the R or T form, a scenario corresponding to almost all regulatory proteins, commonly called K systems. In Gram-negative organisms, the GTP-binding site corresponds to the unique allosteric site of the Gram-positive bacteria. In contrast, UTP interacts cooperatively with a site that overlaps the catalytic center, i.e. the UMP-binding site and part of the ATP-binding site. These characteristics make UTP an original regulator of UMP kinases from Gram-negative organisms, beyond the common scheme of allosteric control.

  6. [VEGETATIVE REGULATORY MECHANISMS IN DIFFERENT GEOMAGNETIC CONDITIONS DEPENDING ON A DEGREE OF PHYSICAL CONDITIONING].

    PubMed

    Kvachadze, I; Tsibadze, A; Sanadiradze, G; Mzhavanadze, D; Chichinadze, G

    2016-04-01

    The aim of the study was to evaluate the vegetative regulatory action in healthy, untrained and trained individuals in different geomagnetic conditions. The study involved 94 healthy untrained young men aged 18-22 years - I group (control), and 60 trained volunteers aged 18-25 years - II group, who during the period of the study and for at least three years prior have been following active regular physical exercise regimen(weight lifting), but were not professional athletes. In order to evaluate the heart rate variability the following statistical indicators were studied: arithmetic mean, the arithmetic mean of the error variance, dispersion, the arithmetic mean deviation, coefficient of skewness, kurtosis, standard deviation of the mean. Geometric analysis was performed using a variation pulsometry. All the individuals were studied in natural/tranquil conditions, during naturally occuring or a simulated geomagnetic storm, which provided the use of the characteristics of vegetative balance as a marker for differential assessment of the impact of electromagnetic field (EMF). The forecast of natural geomagnetic conditions had been made at least three days before the study. Under the conditions of simulated geomagnetic storm the test subjects were placed in a solenoid with non-magnetic equipment. EMF inductance in the solenoid corresponded to the geomagnetic storm frequencies. The study had a nature of social experiment and was carried out by a single blind method: tested subjects were unaware of geomagnetic conditions during the study. This was an open, three-step, cohort, prospective study with parallel character. The results showed that under the uniform qualitative conditions (balanced, in particular) of initial state of vegetative equilibrium, the level of fitness of the human body determines the differentiated response to EMF exposure. Thus, with the possible inclusion of the EMF in the complex of therapeutic or preventive measures, it is necessary to predict

  7. Catalytic control in the EGF Receptor and its connection to general kinase regulatory mechanisms

    PubMed Central

    Jura, Natalia; Zhang, Xuewu; Endres, Nicholas F.; Seeliger, Markus A.; Schindler, Thomas; Kuriyan, John

    2011-01-01

    Summary In contrast to the active conformations of protein kinases, which are essentially the same for all kinases, inactive kinase conformations are structurally diverse. Some inactive conformations are, however, observed repeatedly in different kinases, perhaps reflecting an important role in catalysis. In this review, we analyze one of these recurring conformations, first identified in CDK and Src kinases, which turned out to be central to understanding of how kinase domain of the EGF receptor is activated. This mechanism, which involves the stabilization of the active conformation of an α helix, has features in common with mechanisms operative in several other kinases. PMID:21474065

  8. Single-Nucleotide Mutations in FMR1 Reveal Novel Functions and Regulatory Mechanisms of the Fragile X Syndrome Protein FMRP

    PubMed Central

    Suhl, Joshua A.; Warren, Stephen T.

    2015-01-01

    Fragile X syndrome is a monogenic disorder and a common cause of intellectual disability. Despite nearly 25 years of research on FMR1, the gene underlying the syndrome, very few pathological mutations other than the typical CGG-repeat expansion have been reported. This is in contrast to other X-linked, monogenic, intellectual disability disorders, such as Rett syndrome, where many point mutations have been validated as causative of the disorder. As technology has improved and significantly driven down the cost of sequencing, allowing for whole genes to be sequenced with relative ease, in-depth sequencing studies on FMR1 have recently been performed. These studies have led to the identification of novel variants in FMR1, where some of which have been functionally evaluated and are likely pathogenic. In this review, we discuss recently identified FMR1 variants, the ways these novel variants cause dysfunction, and how they reveal new regulatory mechanisms and functionalities of the gene. PMID:26819560

  9. Reactive oxygen species regulatory mechanisms associated with rapid response of MC3T3-E1 cells for vibration stress.

    PubMed

    Zhang, Ling; Gan, Xueqi; Zhu, Zhuoli; Yang, Yang; He, Yuting; Yu, Haiyang

    2016-02-12

    Although many previous studies have shown that refractory period-dependent memory effect of vibration stress is anabolic for skeletal homeostasis, little is known about the rapid response of osteoblasts simply derived from vibration itself. In view of the potential role of reactive oxygen species (ROS) in mediating differentiated activity of osteoblasts, whether and how ROS regulates the rapid effect of vibration deserve to be demonstrated. Our findings indicated that MC3T3-E1 cells underwent decreased gene expression of Runx2, Col-I and ALP and impaired ALP activity accompanied by increased mitochondrial fission immediately after vibration loading. Moreover, we also revealed the involvement of ERK-Drp1 signal transduction in ROS regulatory mechanisms responsible for the rapid effect of vibration stress.

  10. Regulatory effect of caffeine on the acute and the chronic pain and its possible mechanisms.

    PubMed

    Zhang, Yu-Guan; Shen, Le; Xu, Li; Huang, Yu-Guang

    2014-12-01

    Caffeine,as an important component of refreshment beverage,has been used for a long history. In recent years,its effect on pain relief has been widely explored. As one of nonselective adenosine receptor blockers,caffeine plays different roles in the central and peripheral pain. This review explores the roles of caffeine in acute and chronic pain and the potential mechanisms.

  11. Large-scale profiling and identification of potential regulatory mechanisms for allelic gene expression in colorectal cancer cells.

    PubMed

    Lee, Robin Dong-Woo; Song, Min-Young; Lee, Jong-Keuk

    2013-01-01

    Allelic variation in gene expression is common in humans and this variation is associated with phenotypic variation. In this study, we employed high-density single nucleotide polymorphism (SNP) chips containing 13,900 exonic SNPs to identify genes with allelic gene expression in cells from colorectal cancer cell lines. We found 2 monoallelically expressed genes (ERAP2 and MYLK4), 32 genes with an allelic imbalance in their expression, and 13 genes showing allele substitution by RNA editing. Among a total of 34 allelically expressed genes in colorectal cancer cells, 15 genes (44.1%) were associated with cis-acting eQTL, indicating that large portions of allelically expressed genes are regulated by cis-acting mechanisms of gene expression. In addition, potential regulatory variants present in the proximal promoter regions of genes showing either monoallelic expression or allelic imbalance were not tightly linked with coding SNPs, which were detected with allelic gene expression. These results suggest that multiple rare variants could be involved in the cis-acting regulatory mechanism of allelic gene expression. In the comparison with allelic gene expression data from Centre d'Etude du Polymorphisme Humain (CEPH) family B cells, 12 genes showed B-cell specific allelic imbalance and 1 noncoding SNP showed colorectal cancer cell-specific allelic imbalance. In addition, different patterns of allele substitution were observed between B cells and colorectal cancer cells. Overall, our study not only indicates that allelic gene expression is common in colorectal cancer cells, but our study also provides a better understanding of allele-specific gene expression in colorectal cancer cells.

  12. Contraction-initiated NO-dependent lymphatic relaxation: a self-regulatory mechanism in rat thoracic duct.

    PubMed

    Gasheva, Olga Yu; Zawieja, David C; Gashev, Anatoliy A

    2006-09-15

    The objectives of this study were to evaluate the physiological importance of the flow and shear generated by phasic contractions of lymphatic vessels and the mechanisms responsible for the influences of such shear on lymphatic pumping. Lymphatic segments of the rat thoracic duct were isolated, cannulated and pressurized. The diastolic diameters were measured in phasically non-active segments. The diastolic and systolic diameters, half-relaxation time (HRT), contraction frequency, ejection fraction and fractional pump flow were determined in phasically active segments. Since imposed flow was excluded, flow and shear occurred only as a result of the intrinsic contractions in phasically active segments whereas in phasically non-active segments contraction-generated flow and shear were absent. The influences of incrementally increased transmural pressure (from 1 to 5 cmH(2)O) were examined in control conditions and after NO synthase blockade (l-NAME 10(-4) m) or cyclooxygenase blockade (indomethacin 10(-5) m). The spontaneous phasic contractions produced a flow-dependent diastolic relaxation. This reduction of the lymphatic tone is a regulatory mechanism that maintains pumping in thoracic duct in an energy-saving/efficient mode: it improves diastolic filling (enhanced lusitropy - lowering HRT), makes lymphatic contractions stronger (enhanced inotropy - higher contraction amplitude) and propels more fluid forward during each contraction (elevated ejection fraction) while decreasing contraction frequency (reduced chronotropy). The findings also demonstrated that the NO pathway, not the cyclooxygenase pathway is responsible for this reduction of lymphatic tone and is the prevailing pathway responsible for the self-regulatory adjustment of thoracic duct pumping to changes in lymph flow pattern.

  13. Transition into inflammatory cancer-associated adipocytes in breast cancer microenvironment requires microRNA regulatory mechanism

    PubMed Central

    Ryu, Han Suk; Lee, Han-Byoel; Lee, Minju; Park, In Ae; Kim, Jisun; Han, Wonshik; Noh, Dong-Young

    2017-01-01

    The role of adipocytes in cancer microenvironment has gained focus during the recent years. However, the characteristics of the cancer-associated adipocytes (CAA) in human breast cancer tissues and the underlying regulatory mechanism are not clearly understood. We reviewed pathology specimens of breast cancer patients to understand the morphologic characteristics of CAA, and profiled the mRNA and miRNA expression of CAA by using indirect co-culture system in vitro. The CAAs in human breast cancers showed heterogeneous topographic relationship with breast cancer cells within the breast microenvironment. The CAAs exhibited the characteristics of de-differentiation determined by their microscopic appearance and the expression levels of adipogenic markers. Additionally, the 3T3-L1 adipocytes indirectly co-cultured with breast cancer cells showed up-regulation of inflammation-related genes including Il6 and Ptx3. The up-regulation of IL6 in CAA was further observed in human breast cancer tissues. miRNA array of indirectly co-cultured 3T3-L1 cells showed increased expression of mmu-miR-5112 which may target Cpeb1. Cpeb1 is a negative regulator of Il6. The suppressive role of mmu-miR-5112 was confirmed by dual luciferase reporter assay, and mmu-miR-5112-treated adipocytes showed up-regulation of Il6. The transition of adipocytes into more inflammatory CAA resulted in proliferation-promoting effect in ER positive breast cancer cells such as MCF7 and ZR-75-1 but not in ER negative cells. In this study, we have determined the de-differentiated and inflammatory natures of CAA in breast cancer microenvironment. Additionally, we propose a miRNA-based regulatory mechanism underlying the process of acquiring inflammatory phenotypes in CAA. PMID:28333977

  14. Investigation of molecular mechanisms and regulatory pathways of pro-angiogenic nanorods

    NASA Astrophysics Data System (ADS)

    Nethi, Susheel Kumar; Veeriah, Vimal; Barui, Ayan Kumar; Rajendran, Saranya; Mattapally, Saidulu; Misra, Sanjay; Chatterjee, Suvro; Patra, Chitta Ranjan

    2015-05-01

    Angiogenesis, a process involving the growth of new blood vessels from the pre-existing vasculature, plays a crucial role in various pathophysiological conditions. We have previously demonstrated that europium hydroxide [EuIII(OH)3] nanorods (EHNs) exhibit pro-angiogenic properties through the generation of reactive oxygen species (ROS) and mitogen activated protein kinase (MAPK) activation. Considering the enormous implication of angiogenesis in cardiovascular diseases (CVDs) and cancer, it is essential to understand in-depth molecular mechanisms and signaling pathways in order to develop the most efficient and effective alternative treatment strategy for CVDs. However, the exact underlying mechanism and cascade signaling pathways behind the pro-angiogenic properties exhibited by EHNs still remain unclear. Herein, we report for the first time that the hydrogen peroxide (H2O2), a redox signaling molecule, generated by these EHNs activates the endothelial nitric oxide synthase (eNOS) that promotes the nitric oxide (NO) production in a PI3K (phosphoinositide 3-kinase)/Akt dependent manner, eventually triggering angiogenesis. We intensely believe that the investigation and understanding of the in-depth molecular mechanism and signaling pathways of EHNs induced angiogenesis will help us in developing an effective alternative treatment strategy for cardiovascular related and ischemic diseases where angiogenesis plays an important role.Angiogenesis, a process involving the growth of new blood vessels from the pre-existing vasculature, plays a crucial role in various pathophysiological conditions. We have previously demonstrated that europium hydroxide [EuIII(OH)3] nanorods (EHNs) exhibit pro-angiogenic properties through the generation of reactive oxygen species (ROS) and mitogen activated protein kinase (MAPK) activation. Considering the enormous implication of angiogenesis in cardiovascular diseases (CVDs) and cancer, it is essential to understand in-depth molecular

  15. Transport mechanism and regulatory properties of the human amino acid transporter ASCT2 (SLC1A5).

    PubMed

    Scalise, Mariafrancesca; Pochini, Lorena; Panni, Simona; Pingitore, Piero; Hedfalk, Kristina; Indiveri, Cesare

    2014-11-01

    The kinetic mechanism of the transport catalyzed by the human glutamine/neutral amino acid transporter hASCT2 over-expressed in P. pastoris was determined in proteoliposomes by pseudo-bi-substrate kinetic analysis of the Na(+)-glutamineex/glutaminein transport reaction. A random simultaneous mechanism resulted from the experimental analysis. Purified functional hASCT2 was chemically cross-linked to a stable dimeric form. The oligomeric structure correlated well with the kinetic mechanism of transport. Half-saturation constants (Km) of the transporter for the other substrates Ala, Ser, Asn and Thr were measured both on the external and internal side. External Km were much lower than the internal ones confirming the asymmetry of the transporter. The electric nature of the transport reaction was determined imposing a negative inside membrane potential generated by K(+) gradients in the presence of valinomycin. The transport reaction resulted to be electrogenic and the electrogenicity originated from external Na(+). Internal Na(+) exerted a stimulatory effect on the transport activity which could be explained by a regulatory, not a counter-transport, effect. Native and deglycosylated hASCT2 extracted from HeLa showed the same transport features demonstrating that the glycosyl moiety has no role in transport function. Both in vitro and in vivo interactions of hASCT2 with the scaffold protein PDZK1 were revealed.

  16. Mechanisms of autoimmunity in the non-obese diabetic mouse: effector/regulatory cell equilibrium during peak inflammation.

    PubMed

    Askenasy, Nadir

    2016-04-01

    Immune imbalance in autoimmune disorders such as type 1 diabetes may originate from aberrant activities of effector cells or dysfunction of suppressor cells. All possible defective mechanisms have been proposed for diabetes-prone species: (i) quantitative dominance of diabetogenic cells and decreased numbers of regulatory T cells, (ii) excessive aggression of effectors and defective function of suppressors, (iii) perturbed interaction between effector and suppressor cells, and (iv) variations in sensitivity to negative regulation. The experimental evidence available to date presents conflicting information on these mechanisms, with identification of perturbed equilibrium on the one hand and negation of critical role of each mechanism in propagation of diabetic autoimmunity on the other hand. In our analysis, there is no evidence that inherent abnormalities in numbers and function of effector and suppressor T cells are responsible for the immune imbalance responsible for propagation of type 1 diabetes as a chronic inflammatory process. Possibly, the experimental tools for investigation of these features of immune activity are still underdeveloped and lack sufficient resolution, in the presence of the extensive biological viability and functional versatility of effector and suppressor elements.

  17. [Research Progress of NOS3 Participation in Regulatory Mechanisms of Cardiovascular Diseases].

    PubMed

    Sun, Ting; Chi, Qingjia; Wang, Guixue

    2016-02-01

    Cardiovascular disease has been a major threat to human's health and lives for many years. It is of great importance to explore the mechanisms and develop strategies to prevent the pathogenesis. Generally, cardiovascular disease is associated with endothelial dysfunction, which is closely related to the nitric oxide (NO)-mediated vasodilatation. The release of NO is regulated by NOS3 gene in mammals' vascular system. A great deal of evidences have shown that the polymorphism and epigenetic of NOS3 gene play vital roles in the pathological process of cardiovascular disease. To gain insights into the role of NOS3 in the cardiovascular diseases, we reviewed the molecular mechanisms underlying the development of cardiovascular diseases in this paper, including the uncoupling of NOS3 protein, epigenetic and polymorphism of NOS3 gene. The review can also offer possible strategies to prevent and treat cardiovascular diseases.

  18. Transcriptome profiling of a curdlan-producing Agrobacterium reveals conserved regulatory mechanisms of exopolysaccharide biosynthesis

    PubMed Central

    2012-01-01

    Background The ability to synthesize exopolysaccharides (EPS) is widespread among microorganisms, and microbial EPS play important roles in biofilm formation, pathogen persistence, and applications in the food and medical industries. Although it is well established that EPS synthesis is invariably in response to environmental cues, it remains largely unknown how various environmental signals trigger activation of the biochemical synthesis machinery. Results We report here the transcriptome profiling of Agrobacterium sp. ATCC 31749, a microorganism that produces large amounts of a glucose polymer known as curdlan under nitrogen starvation. Transcriptome analysis revealed a nearly 100-fold upregulation of the curdlan synthesis operon upon transition to nitrogen starvation, thus establishing the prominent role that transcriptional regulation plays in the EPS synthesis. In addition to known mechanisms of EPS regulation such as activation by c-di-GMP, we identify novel mechanisms of regulation in ATCC 31749, including RpoN-independent NtrC regulation and intracellular pH regulation by acidocalcisomes. Furthermore, we show evidence that curdlan synthesis is also regulated by conserved cell stress responses, including polyphosphate accumulation and the stringent response. In fact, the stringent response signal, pppGpp, appears to be indispensible for transcriptional activation of curdlan biosynthesis. Conclusions This study identifies several mechanisms regulating the synthesis of curdlan, an EPS with numerous applications. These mechanisms are potential metabolic engineering targets for improving the industrial production of curdlan from Agrobacterium sp. ATCC 31749. Furthermore, many of the genes identified in this study are highly conserved across microbial genomes, and we propose that the molecular elements identified in this study may serve as universal regulators of microbial EPS synthesis. PMID:22305302

  19. Regulatory mechanisms of anthrax toxin receptor 1-dependent vascular and connective tissue homeostasis

    PubMed Central

    Besschetnova, Tatiana Y.; Ichimura, Takaharu; Katebi, Negin; St. Croix, Brad; Bonventre, Joseph V.; Olsen, Bjorn R.

    2015-01-01

    It is well known that angiogenesis is linked to fibrotic processes in fibroproliferative diseases, but insights into pathophysiological processes are limited, due to lack of understanding of molecular mechanisms controlling endothelial and fibroblastic homeostasis. We demonstrate here that the matrix receptor anthrax toxin receptor 1 (ANTXR1), also known as tumor endothelial marker 8 (TEM8), is an essential component of these mechanisms. Loss of TEM8 function in mice causes reduced synthesis of endothelial basement membrane components and hyperproliferative and leaky blood vessels in skin. In addition, endothelial cell alterations in mutants are almost identical to those of endothelial cells in infantile hemangioma lesions, including activated VEGF receptor signaling in endothelial cells, increased expression of the downstream targets VEGF and CXCL12, and increased numbers of macrophages and mast cells. In contrast, loss of TEM8 in fibroblasts leads to increased rates of synthesis of fiber-forming collagens, resulting in progressive fibrosis in skin and other organs. Compromised interactions between TEM8-deficient endothelial and fibroblastic cells cause dramatic reduction in the activity of the matrix-degrading enzyme MMP2. In addition to insights into mechanisms of connective tissue homeostasis, our data provide molecular explanations for vascular and connective tissue abnormalities in GAPO syndrome, caused by loss-of-function mutations in ANTXR1. Furthermore, the loss of MMP2 activity suggests that fibrotic skin abnormalities in GAPO syndrome are, in part, the consequence of pathophysiological mechanisms underlying syndromes (NAO, Torg and Winchester) with multicentric skin nodulosis and osteolysis caused by homozygous loss-of-function mutations in MMP2. PMID:25572963

  20. Investigation of molecular mechanisms and regulatory pathways of pro-angiogenic nanorods†

    PubMed Central

    Nethi, Susheel Kumar; Veeriah, Vimal; Barui, Ayan Kumar; Rajendran, Saranya; Mattapally, Saidulu; Misra, Sanjay

    2016-01-01

    Angiogenesis, a process involving the growth of new blood vessels from the pre-existing vasculature, plays a crucial role in various pathophysiological conditions. We have previously demonstrated that europium hydroxide [EuIII(OH)3] nanorods (EHNs) exhibit pro-angiogenic properties through the generation of reactive oxygen species (ROS) and mitogen activated protein kinase (MAPK) activation. Considering the enormous implication of angiogenesis in cardiovascular diseases (CVDs) and cancer, it is essential to understand in-depth molecular mechanisms and signaling pathways in order to develop the most efficient and effective alternative treatment strategy for CVDs. However, the exact underlying mechanism and cascade signaling pathways behind the pro-angiogenic properties exhibited by EHNs still remain unclear. Herein, we report for the first time that the hydrogen peroxide (H2O2), a redox signaling molecule, generated by these EHNs activates the endothelial nitric oxide synthase (eNOS) that promotes the nitric oxide (NO) production in a PI3K (phosphoinositide 3-kinase)/Akt dependent manner, eventually triggering angiogenesis. We intensely believe that the investigation and understanding of the in-depth molecular mechanism and signaling pathways of EHNs induced angiogenesis will help us in developing an effective alternative treatment strategy for cardiovascular related and ischemic diseases where angiogenesis plays an important role. PMID:25963768

  1. c-myc in whitefish (Coregonus lavaretus): structure, expression, and insights into possible posttranscriptional regulatory mechanism.

    PubMed

    Brzuzan, P; Kramer, C; Łakomiak, A; Jakimiuk, E; Florczyk, M; Woźny, M

    2015-10-01

    c-myc has a crucial function in growth control, differentiation, and apoptosis of vertebrate cells. Despite the important role of c-myc in mediating the biological effects, studies of c-myc gene expression and factors that control it in organisms other than mammals, such as fish, have been rare. In the current study, we asked whether c-myc mRNA of whitefish, a feasible organism for pollution monitoring in aquatic systems and a model in toxicological research, contains activity sites for regulatory motifs in its 5'- and 3'-UTRs, similar to those found in mammals. We were particularly interested in whether miRNA-34, a known negative regulator of c-myc's in mammals, is able to regulate c-myc in fish. To answer these questions, we determined the mRNA sequence of whitefish c-myc and inferred the structure of the protein that it codes for. We found that the active sites of mRNA and structures of the inferred c-myc protein are similar to those found in mammals and other fish. Remarkably, levels of c-myc mRNA expression were very high in ovaries compared to other tissues of whitefish, thus corroborating previous data in fish. Using bioinformatic searches on c-myc 3'-UTR, we confirmed the presence of two miRNA-34a (miR-34a) response elements. Luciferase reporter assay showed that activity of reporters containing either the miR response elements or entire c-myc 3'-UTR was significantly reduced (p < 0.001) by ectopic expression of miR-34a. Therefore, we further investigated possible involvement of miR-34a in c-myc gene silencing by profiling the expression of both genes in livers of whitefish treated for 8, 24, 48 h with MC-LR, a potent c-myc inducer in mammals. Although the difference was only significant at p = 0.08, the expression of c-myc mRNA in challenged whitefish after 24 h of the treatment was notably higher than that in livers of control fish. Concurrently, we noticed slight but significant up-regulation of miR-34a after 24 and 48 h of the challenge (p

  2. Novel Regulatory Mechanisms for Generation of the Soluble Leptin Receptor: Implications for Leptin Action

    PubMed Central

    Schaab, Michael; Kausch, Henriette; Klammt, Juergen; Nowicki, Marcin; Anderegg, Ulf; Gebhardt, Rolf; Rose-John, Stefan; Scheller, Juergen; Thiery, Joachim; Kratzsch, Juergen

    2012-01-01

    Background The adipokine leptin realizes signal transduction via four different membrane-anchored leptin receptor (Ob-R) isoforms in humans. However, the amount of functionally active Ob-R is affected by constitutive shedding of the extracellular domain via a so far unknown mechanism. The product of the cleavage process the so-called soluble leptin receptor (sOb-R) is the main binding protein for leptin in human blood and modulates its bioavailability. sOb-R levels are differentially regulated in metabolic disorders like type 1 diabetes mellitus or obesity and can, therefore, enhance or reduce leptin sensitivity. Methodology/Principal Findings To describe mechanisms of Ob-R cleavage and to investigate the functional significance of differential sOb-R levels we established a model of HEK293 cells transiently transfected with different human Ob-R isoforms. Using siRNA knockdown experiments we identified ADAM10 (A Disintegrin And Metalloproteinase 10) as a major protease for constitutive and activated Ob-R cleavage. Additionally, the induction of lipotoxicity and apoptosis led to enhanced shedding shown by increased levels of the soluble leptin receptor (sOb-R) in cell supernatants. Conversely, high leptin concentrations and ER stress reduced sOb-R levels. Decreased amounts of sOb-R due to ER stress were accompanied by impaired leptin signaling and reduced leptin binding. Conclusions Lipotoxicity and apoptosis increased Ob-R cleavage via ADAM10-dependent mechanisms. In contrast high leptin levels and ER stress led to reduced sOb-R levels. While increased sOb-R concentrations seem to directly block leptin action, reduced amounts of sOb-R may reflect decreased membrane expression of Ob-R. These findings could explain changes of leptin sensitivity which are associated with variations of serum sOb-R levels in metabolic diseases. PMID:22545089

  3. Regulatory players of DNA damage repair mechanisms: Role in Cancer Chemoresistance.

    PubMed

    Sakthivel, Kunnathur Murugesan; Hariharan, Sreedharan

    2017-09-01

    DNA damaging agents are most common in chemotherapeutic molecules that act against cancer. However, cancer cells possess inherent biological features to overcome DNA damages by activating various distinct repair mechanisms and pathways. Importantly, various oncogenes, cancer stem cells (CSCs), hypoxic environment, transcription factors and bystander signaling that are activated in the cancer cells influence DNA repair, thereby effectively repairing the DNA damage. Repaired cancer cells often become more resistance to further therapy and results in disease recurrence. In this review, we summarize how the various signaling pathways in cancer cells regulates DNA repair and induce chemoresistance. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  4. [Research progress in biofilm formation and regulatory mechanism of Campylobacter jejuni].

    PubMed

    Wu, Qingping; Zhong, Xian; Zhang, Jumei

    2016-02-04

    Biofilm of Campylobacter jejuni was formed by cross-linking its extracellular secretion, polysaccharides, various extracellular proteins, nucleic acids etc to enhance its survival in hostile environments, especially for detergents, antibiotics and disinfectants. This paper elaborated C. jejuni biofilm formation and regulation mechanisms in the surface properties of the media, temperatures, gas environment, the regulation of gene etc, also analysed and discussed a variety of biofilm removal practical applications. We hope it can provide a reference for studies on biofilm control of C. jejuni.

  5. Novel Sinorhizobium meliloti quorum sensing positive and negative regulatory feedback mechanisms respond to phosphate availability.

    PubMed

    McIntosh, Matthew; Meyer, Stefan; Becker, Anke

    2009-12-01

    The Sin quorum sensing system of Sinorhizobium meliloti depends upon at least three genes, sinR, sinI and expR, and N-acyl homoserine lactones (AHLs) as signals to regulate multiple processes in its free-living state in the rhizosphere and in the development towards symbiosis with its plant host. In this study, we have characterized novel mechanisms of transcription control through which the system regulates itself. At low AHL levels a positive feedback loop activates expression of sinI (AHL synthase), resulting in amplification of AHL levels. At high AHL levels, expression of sinI is reduced by a negative feedback loop. These feedback mechanisms are mediated by the LuxR-type regulators ExpR and SinR. Expression of sinR and expR is regulated by ExpR in the presence of AHLs. A novel ExpR binding site in the promoter of sinR is responsible for the reduction of expression of this gene. In addition, expression of sinR, upon which sinI expression is dependent, is induced by phoB during growth under phosphate-limiting conditions. This indicates that this response ensures quorum sensing in phosphate-restricted growth.

  6. Subchromoplast sequestration of carotenoids affects regulatory mechanisms in tomato lines expressing different carotenoid gene combinations.

    PubMed

    Nogueira, Marilise; Mora, Leticia; Enfissi, Eugenia M A; Bramley, Peter M; Fraser, Paul D

    2013-11-01

    Metabolic engineering of the carotenoid pathway in recent years has successfully enhanced the carotenoid contents of crop plants. It is now clear that only increasing biosynthesis is restrictive, as mechanisms to sequestrate these increased levels in the cell or organelle should be exploited. In this study, biosynthetic pathway genes were overexpressed in tomato (Solanum lycopersicum) lines and the effects on carotenoid formation and sequestration revealed. The bacterial Crt carotenogenic genes, independently or in combination, and their zygosity affect the production of carotenoids. Transcription of the pathway genes was perturbed, whereby the tissue specificity of transcripts was altered. Changes in the steady state levels of metabolites in unrelated sectors of metabolism were found. Of particular interest was a concurrent increase of the plastid-localized lipid monogalactodiacylglycerol with carotenoids along with membranous subcellular structures. The carotenoids, proteins, and lipids in the subchromoplast fractions of the transgenic tomato fruit with increased carotenoid content suggest that cellular structures can adapt to facilitate the sequestration of the newly formed products. Moreover, phytoene, the precursor of the pathway, was identified in the plastoglobule, whereas the biosynthetic enzymes were in the membranes. The implications of these findings with respect to novel pathway regulation mechanisms are discussed.

  7. Global regulatory mechanism underlying the activation of an exon network required for neurogenesis

    PubMed Central

    Raj, Bushra; Irimia, Manuel; Braunschweig, Ulrich; Sterne-Weiler, Timothy; O’Hanlon, Dave; Yuan-Lin, Zhen; Chen, Ginny I.; Easton, Laura; Ule, Jernej; Gingras, Anne-Claude; Eyras, Eduardo; Blencowe, Benjamin J.

    2015-01-01

    SUMMARY The vertebrate and neural-specific SR-related protein nSR100/SRRM4 regulates an extensive program of alternative splicing with critical roles in nervous system development. However, the mechanism by which nSR100 controls its target exons is poorly understood. We demonstrate that nSR100-dependent neural exons are associated with a unique configuration of intronic cis-elements that promote rapid switch-like regulation during neurogenesis. A key feature of this configuration is the insertion of specialized intronic enhancers between polypyrimidine tracts and acceptor sites that bind nSR100 to potently activate exon inclusion in neural cells, while weakening 3′ splice site recognition and contributing to exon skipping in non-neural cells. nSR100 further operates by forming multiple interactions with early spliceosome components bound proximal to 3′ splice sites. These multifaceted interactions achieve dominance over neural exon silencing mediated by the splicing regulator PTBP1. The results thus illuminate a widespread mechanism by which a critical neural exon network is activated during neurogenesis. PMID:25219497

  8. The Influence of Early Life Nutrition on Epigenetic Regulatory Mechanisms of the Immune System

    PubMed Central

    Paparo, Lorella; di Costanzo, Margherita; di Scala, Carmen; Cosenza, Linda; Leone, Ludovica; Nocerino, Rita; Berni Canani, Roberto

    2014-01-01

    The immune system is exquisitely sensitive to environmental changes. Diet constitutes one of the major environmental factors that exerts a profound effect on immune system development and function. Epigenetics is the study of mitotically heritable, yet potentially reversible, molecular modifications to DNA and chromatin without alteration to the underlying DNA sequence. Nutriepigenomics is an emerging discipline examining the role of dietary influences on gene expression. There is increasing evidence that the epigenetic mechanisms that regulate gene expression during immune differentiation are directly affected by dietary factors or indirectly through modifications in gut microbiota induced by different dietary habits. Short-chain fatty acids, in particular butyrate, produced by selected bacteria stains within gut microbiota, are crucial players in this network. PMID:25353665

  9. The T box mechanism: tRNA as a regulatory molecule

    PubMed Central

    Green, Nicholas J.; Grundy, Frank J.; Henkin, Tina M.

    2009-01-01

    The T box mechanism is widely used in Gram-positive bacteria to regulate expression of aminoacyl-tRNA synthetase genes and genes involved in amino acid biosynthesis and uptake. Binding of a specific uncharged tRNA to a riboswitch element in the nascent transcript causes a structural change in the transcript that promotes expression of the downstream coding sequence. In most cases, this occurs by stabilization of an antiterminator element that competes with formation of a terminator helix. Specific tRNA recognition by the nascent transcript results in increased expression of genes important for tRNA aminoacylation in response to decreased pools of charged tRNA. PMID:19932103

  10. Ocean warming and acidification modulate energy budget and gill ion regulatory mechanisms in Atlantic cod (Gadus morhua).

    PubMed

    Kreiss, C M; Michael, K; Lucassen, M; Jutfelt, F; Motyka, R; Dupont, S; Pörtner, H-O

    2015-10-01

    Ocean warming and acidification are threatening marine ecosystems. In marine animals, acidification is thought to enhance ion regulatory costs and thereby baseline energy demand, while elevated temperature also increases baseline metabolic rate. Here we investigated standard metabolic rates (SMR) and plasma parameters of Atlantic cod (Gadus morhua) after 3-4 weeks of exposure to ambient and future PCO2 levels (550, 1200 and 2200 µatm) and at two temperatures (10, 18 °C). In vivo branchial ion regulatory costs were studied in isolated, perfused gill preparations. Animals reared at 18 °C responded to increasing CO2 by elevating SMR, in contrast to specimens at 10 °C. Isolated gills at 10 °C and elevated PCO2 (≥1200 µatm) displayed increased soft tissue mass, in parallel to increased gill oxygen demand, indicating an increased fraction of gill in whole animal energy budget. Altered gill size was not found at 18 °C, where a shift in the use of ion regulation mechanisms occurred towards enhanced Na(+)/H(+)-exchange and HCO3 (-) transport at high PCO2 (2200 µatm), paralleled by higher Na(+)/K(+)-ATPase activities. This shift did not affect total gill energy consumption leaving whole animal energy budget unaffected. Higher Na(+)/K(+)-ATPase activities in the warmth might have compensated for enhanced branchial permeability and led to reduced plasma Na(+) and/or Cl(-) concentrations and slightly lowered osmolalities seen at 18 °C and 550 or 2200 µatm PCO2 in vivo. Overall, the gill as a key ion regulation organ seems to be highly effective in supporting the resilience of cod to effects of ocean warming and acidification.

  11. Ca2+ regulatory mechanisms of exercise protection against coronary artery disease in metabolic syndrome and diabetes

    PubMed Central

    2011-01-01

    Chronic exercise attenuates coronary artery disease (CAD) in humans largely independent of reductions in risk factors; thus major protective mechanisms of exercise are directly within the coronary vasculature. Further, tight control of diabetes, e.g., blood glucose, can be detrimental. Accordingly, knowledge of mechanisms by which exercise attenuates diabetic CAD could catalyze development of molecular therapies. Exercise attenuates CAD (atherosclerosis) and restenosis in miniature swine models, which enable precise control of exercise parameters (intensity, duration, and frequency) and characterization of the metabolic syndrome (MetS) and diabetic milieu. Intracellular Ca2+ is a pivotal second messenger for coronary smooth muscle (CSM) excitation-contraction and excitation-transcription coupling that modulates CSM proliferation, migration, and calcification. CSM of diabetic dyslipidemic Yucatan swine have impaired Ca2+ extrusion via the plasmalemma Ca2+ ATPase (PMCA), downregulation of L-type voltage-gated Ca2+ channels (VGCC), increased Ca2+ sequestration by the sarcoplasmic reticulum (SR) Ca2+ ATPase (SERCA), increased nuclear Ca2+ localization, and greater activation of K channels by Ca2+ release from the SR. Endurance exercise training prevents Ca2+ transport changes with virtually no effect on the diabetic milieu (glucose, lipids). In MetS Ossabaw swine transient receptor potential canonical (TRPC) channels are upregulated and exercise training reverses expression and TRPC-mediated Ca2+ influx with almost no change in the MetS milieu. Overall, exercise effects on Ca2+ signaling modulate CSM phenotype. Future studies should 1) selectively target key Ca2+ transporters to determine definitively their causal role in atherosclerosis and 2) combine mechanistic studies with clinical outcomes, e.g., reduction of myocardial infarction. PMID:21596923

  12. Gene Regulatory Mechanisms Underlying the Spatial and Temporal Regulation of Target-Dependent Gene Expression in Drosophila Neurons.

    PubMed

    Berndt, Anthony J E; Tang, Jonathan C Y; Ridyard, Marc S; Lian, Tianshun; Keatings, Kathleen; Allan, Douglas W

    2015-12-01

    Neuronal differentiation often requires target-derived signals from the cells they innervate. These signals typically activate neural subtype-specific genes, but the gene regulatory mechanisms remain largely unknown. Highly restricted expression of the FMRFa neuropeptide in Drosophila Tv4 neurons requires target-derived BMP signaling and a transcription factor code that includes Apterous. Using integrase transgenesis of enhancer reporters, we functionally dissected the Tv4-enhancer of FMRFa within its native cellular context. We identified two essential but discrete cis-elements, a BMP-response element (BMP-RE) that binds BMP-activated pMad, and a homeodomain-response element (HD-RE) that binds Apterous. These cis-elements have low activity and must be combined for Tv4-enhancer activity. Such combinatorial activity is often a mechanism for restricting expression to the intersection of cis-element spatiotemporal activities. However, concatemers of the HD-RE and BMP-RE cis-elements were found to independently generate the same spatiotemporal expression as the Tv4-enhancer. Thus, the Tv4-enhancer atypically combines two low-activity cis-elements that confer the same output from distinct inputs. The activation of target-dependent genes is assumed to 'wait' for target contact. We tested this directly, and unexpectedly found that premature BMP activity could not induce early FMRFa expression; also, we show that the BMP-insensitive HD-RE cis-element is activated at the time of target contact. This led us to uncover a role for the nuclear receptor, seven up (svp), as a repressor of FMRFa induction prior to target contact. Svp is normally downregulated immediately prior to target contact, and we found that maintaining Svp expression prevents cis-element activation, whereas reducing svp gene dosage prematurely activates cis-element activity. We conclude that the target-dependent FMRFa gene is repressed prior to target contact, and that target-derived BMP signaling directly

  13. Gene Regulatory Mechanisms Underlying the Spatial and Temporal Regulation of Target-Dependent Gene Expression in Drosophila Neurons

    PubMed Central

    Ridyard, Marc S.; Lian, Tianshun; Keatings, Kathleen; Allan, Douglas W.

    2015-01-01

    Neuronal differentiation often requires target-derived signals from the cells they innervate. These signals typically activate neural subtype-specific genes, but the gene regulatory mechanisms remain largely unknown. Highly restricted expression of the FMRFa neuropeptide in Drosophila Tv4 neurons requires target-derived BMP signaling and a transcription factor code that includes Apterous. Using integrase transgenesis of enhancer reporters, we functionally dissected the Tv4-enhancer of FMRFa within its native cellular context. We identified two essential but discrete cis-elements, a BMP-response element (BMP-RE) that binds BMP-activated pMad, and a homeodomain-response element (HD-RE) that binds Apterous. These cis-elements have low activity and must be combined for Tv4-enhancer activity. Such combinatorial activity is often a mechanism for restricting expression to the intersection of cis-element spatiotemporal activities. However, concatemers of the HD-RE and BMP-RE cis-elements were found to independently generate the same spatiotemporal expression as the Tv4-enhancer. Thus, the Tv4-enhancer atypically combines two low-activity cis-elements that confer the same output from distinct inputs. The activation of target-dependent genes is assumed to 'wait' for target contact. We tested this directly, and unexpectedly found that premature BMP activity could not induce early FMRFa expression; also, we show that the BMP-insensitive HD-RE cis-element is activated at the time of target contact. This led us to uncover a role for the nuclear receptor, seven up (svp), as a repressor of FMRFa induction prior to target contact. Svp is normally downregulated immediately prior to target contact, and we found that maintaining Svp expression prevents cis-element activation, whereas reducing svp gene dosage prematurely activates cis-element activity. We conclude that the target-dependent FMRFa gene is repressed prior to target contact, and that target-derived BMP signaling directly

  14. Intrinsic and extrinsic regulatory mechanisms are required to form and maintain a lens of the correct size and shape.

    PubMed

    McAvoy, J W; Dawes, L J; Sugiyama, Y; Lovicu, F J

    2017-03-01

    Understanding how tissues and organs acquire and maintain an appropriate size and shape remains one of the most challenging areas in developmental biology. The eye lens represents an excellent system to provide insights into regulatory mechanisms because in addition to its relative simplicity in cellular composition (being made up of only two forms of cells, epithelial and fiber cells), these cells must become organized to generate the precise spheroidal arrangement that delivers normal lens function. Epithelial and fiber cells also represent spatially distinct proliferation and differentiation compartments, respectively, and an ongoing balance between these domains must be tightly regulated so that the lens achieves and maintains appropriate dimensions during growth and ageing. Recent research indicates that reciprocal inductive interactions mediated by Wnt-Frizzled and Notch-Jagged signaling pathways are important for maintaining and organizing these compartments. The Hippo-Yap pathway has also been implicated in maintaining the epithelial progenitor compartment and regulating growth processes. Thus, whilst some molecules and mechanisms have been identified, further work in this important area is needed to provide a clearer understanding of how lens size and shape is regulated. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. PI(4,5)P2-Mediated Cell Signaling: Emerging Principles and PTEN as a Paradigm for Regulatory Mechanism

    PubMed Central

    Gericke, Arne; Leslie, Nicholas R.; Lösche, Mathias; Ross, Alonzo H.

    2013-01-01

    PI(4,5)P2 (phosphatidylinositol 4,5-bisphosphate) is a relatively common anionic lipid that regulates cellular functions by multiple mechanisms. Hydrolysis of PI(4,5)P2 by phospholipase C yields inositol trisphosphate and diacylglycerol. Phosphorylation by phosphoinositide 3-kinase yields PI(3,4,5)P3, which is a potent signal for survival and proliferation. Also, PI(4,5)P2 can bind directly to integral and peripheral membrane proteins. As an example of regulation by PI(4,5)P2, we discuss phosphatase and tensin homologue deleted on chromosome 10 (PTEN) in detail. PTEN is an important tumor suppressor and hydrolyzes PI(3,4,5)P3. PI(4,5)P2 enhances PTEN association with the plasma membrane and activates its phosphatase activity. This is a critical regulatory mechanism, but a detailed description of this process from a structural point of view is lacking. The disordered lipid bilayer environment hinders structural determinations of membrane-bound PTEN. A new method to analyze membrane-bound protein measures neutron reflectivity for proteins bound to tethered phospholipid membranes. These methods allow determination of the orientation and shape of membrane-bound proteins. In combination with molecular dynamics simulations, these studies will provide crucial structural information that can serve as a foundation for our understanding of PTEN regulation in normal and pathological processes. PMID:23775692

  16. Targeted mutagenesis of intergenic regions in the Neisseria gonorrhoeae gonococcal genetic island reveals multiple regulatory mechanisms controlling type IV secretion.

    PubMed

    Ramsey, Meghan E; Bender, Tobias; Klimowicz, Amy K; Hackett, Kathleen T; Yamamoto, Ami; Jolicoeur, Adrienne; Callaghan, Melanie M; Wassarman, Karen M; van der Does, Chris; Dillard, Joseph P

    2015-09-01

    Gonococci secrete chromosomal DNA into the extracellular environment using a type IV secretion system (T4SS). The secreted DNA acts in natural transformation and initiates biofilm development. Although the DNA and its effects are detectable, structural components of the T4SS are present at very low levels, suggestive of uncharacterized regulatory control. We sought to better characterize the expression and regulation of T4SS genes and found that the four operons containing T4SS genes are transcribed at very different levels. Increasing transcription of two of the operons through targeted promoter mutagenesis did not increase DNA secretion. The stability and steady-state levels of two T4SS structural proteins were affected by a homolog of tail-specific protease. An RNA switch was also identified that regulates translation of a third T4SS operon. The switch mechanism relies on two putative stem-loop structures contained within the 5' untranslated region of the transcript, one of which occludes the ribosome binding site and start codon. Mutational analysis of these stem loops supports a model in which induction of an alternative structure relieves repression. Taken together, these results identify multiple layers of regulation, including transcriptional, translational and post-translational mechanisms controlling T4SS gene expression and DNA secretion. © 2015 John Wiley & Sons Ltd.

  17. Evidence of unbalanced regulatory mechanism of heart rate and systolic pressure after acute myocardial infarction.

    PubMed

    Nollo, Giandomenico; Faes, Luca; Porta, Alberto; Pellegrini, Barbara; Ravelli, Flavia; Del Greco, Maurizio; Disertori, Marcello; Antolini, Renzo

    2002-09-01

    The interactions between systolic arterial pressure (SAP) and R-R interval (RR) fluctuations after acute myocardial infarction (AMI) were investigated by measures of synchronization separating the feedback from the feedforward control and capturing both linear and nonlinear contributions. The causal synchronization, evaluating the ability of RR to predict SAP (chi(s/t)) or vice versa (chi(t/s)), and the global synchronization (chi) were estimated at rest and after head-up tilt in 35 post-AMI patients, 20 young and 12 old. Significance and nonlinearity of the coupling were assessed by surrogate data analysis. Tilting increased the number of young subjects in which RR-SAP link was significant (from 17 to 19) and linear (from 11 to 18). In AMI, both significance and linearity of the coupling were low at rest (26 significant and 24 nonlinear) and further reduced after tilt (17 significant and 16 nonlinear). Old subjects showed a partial recovery of linearity after tilt (rest: 1 linear of 7 significant; tilt: 5 linear of 8 significant). In young subjects, the causal synchronization indexes were balanced and increased from rest (chi(t/s) = 0.072 +/- 0.037 and chi(s/t) = 0.054 +/- 0.028) to tilt (chi(t/s) = 0.125 +/- 0.071 and chi(s/t) = 0.108 +/- 0.053). On the contrary, in old subjects and AMI patients, the feedforward was prevalent to the feedback coupling at rest (old: chi(t/s) = 0.041 +/- 0.023 and chi(s/t) = 0.069 +/- 0.042; AMI: chi(t/s) = 0.050 +/- 0.030 and chi(s/t) = 0.089 +/- 0.053). Tilting blunted the unbalance in old subjects (chi(t/s) = 0.065 +/- 0.052 and chi(s/t) = 0.069 +/- 0.044) but not in AMI patients (chi(t/s) = 0.040 +/- 0.019 and chi(s/t) = 0.060 +/- 0.040). Thus, after AMI, nonlinear mechanisms are elicited in RR-SAP interactions. Furthermore, the neural regulation of the cardiovascular system resulted in imbalance as a consequence of impaired feedback and enhanced feedforward control mechanisms.

  18. A competitive regulatory mechanism discriminates between juxtaposed splice sites and pri-miRNA structures

    PubMed Central

    Mattioli, Chiara; Pianigiani, Giulia; Pagani, Franco

    2013-01-01

    We have explored the functional relationships between spliceosome and Microprocessor complex activities in a novel class of microRNAs (miRNAs), named Splice site Overlapping (SO) miRNAs, whose pri-miRNA hairpins overlap splice sites. We focused on the evolutionarily conserved SO miR-34b, and we identified two indispensable elements for recognition of its 3′ splice site: a branch point located in the hairpin and a downstream purine-rich exonic splicing enhancer. In minigene systems, splicing inhibition owing to exonic splicing enhancer deletion or AG 3′ss mutation increases miR-34b levels. Moreover, small interfering-mediated silencing of Drosha and/or DGCR8 improves splicing efficiency and abolishes miR-34b production. Thus, the processing of this 3′ SO miRNA is regulated in an antagonistic manner by the Microprocessor and the spliceosome owing to competition between these two machineries for the nascent transcript. We propose that this novel mechanism is commonly used to regulate the relative amount of SO miRNA and messenger RNA produced from primary transcripts. PMID:23863840

  19. Novel regulatory mechanisms for the Dbl family guanine nucleotide exchange factor Cool-2/alpha-Pix.

    PubMed

    Feng, Qiyu; Baird, Daniel; Cerione, Richard A

    2004-09-01

    The Cool-2 (cloned-out of library-2) protein (identical to alpha-Pix for Pak-interactive exchange factor) has been implicated in various biological responses including chemoattractant signaling and in certain forms of mental retardation. We show that when Cool-2 exists as a dimer, it functions as a Rac-specific guanine nucleotide exchange factor (GEF). Dimerization of Cool-2 enables its Dbl (diffuse B-cell lymphoma) and pleckstrin homology domains to work together (in trans) to bind specifically to Rac-GDP. Dissociation of dimeric Cool-2 into its monomeric form allows it to act as a GEF for Cdc42 as well as for Rac. The binding of either PAK (p21-activated kinase) or Cbl (Casitas B-lymphoma) to the SH3 domain of monomeric Cool-2 is necessary for the functional interactions between GDP-bound Cdc42 or Rac and the Cool-2 monomer. The betagamma subunit complex of large GTP-binding proteins, by interacting with PAK, stimulates the dissociation of the Cool-2 dimer and activates its GEF activity for Cdc42. Overall, these findings highlight novel mechanisms by which extracellular signals can direct the specific activation of Rac versus Cdc42 by Cool-2/alpha-Pix.

  20. Sweat, the driving force behind normal skin: an emerging perspective on functional biology and regulatory mechanisms.

    PubMed

    Murota, Hiroyuki; Matsui, Saki; Ono, Emi; Kijima, Akiko; Kikuta, Junichi; Ishii, Masaru; Katayama, Ichiro

    2015-01-01

    The various symptoms associated with excessive or insufficient perspiration can significantly reduce a patient's quality of life. If a versatile and minimally invasive method could be established for returning sweat activity to normalcy, there is no question that it could be used in the treatment of many diseases that are believed to involve perspiration. For this reason, based on an understanding of the sweat-gland control function and sweat activity, it was necessary to conduct a comprehensive search for the factors that control sweating, such as the central and peripheral nerves that control sweat-gland function, the microenvironment surrounding the sweat glands, and lifestyle. We focused on the mechanism by which atopic dermatitis leads to hypohidrosis and confirmed that histamine inhibits acetylcholinergic sweating. Acetylcholine promotes the phosphorylation of glycogen synthesis kinase 3β (GSK3β) in the sweat-gland secretory cells and leads to sensible perspiration. By suppressing the phosphorylation of GSK3β, histamine inhibits the movement of sweat from the sweat-gland secretory cells through the sweat ducts, which could presumably be demonstrated by dynamic observations of the sweat glands using two-photon microscopy. It is expected that the discovery of new factors that control sweat-gland function can contribute to the treatment of diseases associated with dyshidrosis.

  1. The Mechanisms of Water Exchange: The Regulatory Roles of Multiple Interactions in Social Wasps

    PubMed Central

    Agrawal, Devanshu; Karsai, Istvan

    2016-01-01

    Evolutionary benefits of task fidelity and improving information acquisition via multiple transfers of materials between individuals in a task partitioned system have been shown before, but in this paper we provide a mechanistic explanation of these phenomena. Using a simple mathematical model describing the individual interactions of the wasps, we explain the functioning of the common stomach, an information center, which governs construction behavior and task change. Our central hypothesis is a symmetry between foragers who deposit water and foragers who withdraw water into and out of the common stomach. We combine this with a trade-off between acceptance and resistance to water transfer. We ultimately derive a mathematical function that relates the number of interactions that foragers complete with common stomach wasps during a foraging cycle. We use field data and additional model assumptions to calculate values of our model parameters, and we use these to explain why the fullness of the common stomach stabilizes just below 50 percent, why the average number of successful interactions between foragers and the wasps forming the common stomach is between 5 and 7, and why there is a variation in this number of interactions over time. Our explanation is that our proposed water exchange mechanism places natural bounds on the number of successful interactions possible, water exchange is set to optimize mediation of water through the common stomach, and the chance that foragers abort their task prematurely is very low. PMID:26751076

  2. The Mechanisms of Water Exchange: The Regulatory Roles of Multiple Interactions in Social Wasps.

    PubMed

    Agrawal, Devanshu; Karsai, Istvan

    2016-01-01

    Evolutionary benefits of task fidelity and improving information acquisition via multiple transfers of materials between individuals in a task partitioned system have been shown before, but in this paper we provide a mechanistic explanation of these phenomena. Using a simple mathematical model describing the individual interactions of the wasps, we explain the functioning of the common stomach, an information center, which governs construction behavior and task change. Our central hypothesis is a symmetry between foragers who deposit water and foragers who withdraw water into and out of the common stomach. We combine this with a trade-off between acceptance and resistance to water transfer. We ultimately derive a mathematical function that relates the number of interactions that foragers complete with common stomach wasps during a foraging cycle. We use field data and additional model assumptions to calculate values of our model parameters, and we use these to explain why the fullness of the common stomach stabilizes just below 50 percent, why the average number of successful interactions between foragers and the wasps forming the common stomach is between 5 and 7, and why there is a variation in this number of interactions over time. Our explanation is that our proposed water exchange mechanism places natural bounds on the number of successful interactions possible, water exchange is set to optimize mediation of water through the common stomach, and the chance that foragers abort their task prematurely is very low.

  3. Inducible nitric oxide synthase (NOS-2) in subarachnoid hemorrhage: Regulatory mechanisms and therapeutic implications

    PubMed Central

    Iqbal, Sana; Hayman, Erik G; Hong, Caron; Stokum, Jesse A; Kurland, David B; Gerzanich, Volodymyr; Simard, J Marc

    2016-01-01

    Aneurysmal subarachnoid hemorrhage (SAH) typically carries a poor prognosis. Growing evidence indicates that overabundant production of nitric oxide (NO) may be responsible for a large part of the secondary injury that follows SAH. Although SAH modulates the activity of all three isoforms of nitric oxide synthase (NOS), the inducible isoform, NOS-2, accounts for a majority of NO-mediated secondary injuries after SAH. Here, we review the indispensable physiological roles of NO that must be preserved, even while attempting to downmodulate the pathophysiologic effects of NO that are induced by SAH. We examine the effects of SAH on the function of the various NOS isoforms, with a particular focus on the pathological effects of NOS-2 and on the mechanisms responsible for its transcriptional upregulation. Finally, we review interventions to block NOS-2 upregulation or to counteract its effects, with an emphasis on the potential therapeutic strategies to improve outcomes in patients afflicted with SAH. There is still much to be learned regarding the apparently maladaptive response of NOS-2 and its harmful product NO in SAH. However, the available evidence points to crucial effects that, on balance, are adverse, making the NOS-2/NO/peroxynitrite axis an attractive therapeutic target in SAH. PMID:27774520

  4. The route of passive chloride movement across amphibian skin: localization and regulatory mechanisms.

    PubMed

    Nagel, Wolfram; Somieski, Petra; Katz, Uri

    2002-11-13

    Transepithelial Cl(-) conductance (G(Cl)) in amphibian skin can be activated in several species by serosa positive potentials. Mitochondria-rich cells (MRC) or tight junctions (TJ) between the epithelial cells are possible sites for this pathway. The properties and the techniques used to investigate this pathway are reviewed in the present paper. In situ techniques are preferable, since specific properties of the MRC are apparently not maintained in isolated cells. Volume measurements and electronprobe microanalysis of intracellular ions suggest the localization of voltage-activated G(Cl) to MRC. G(Cl) correlates poorly with the density of MRC. The vibrating voltage probe allows quantitative correlation of the local Cl(-) current through morphologically identified structures and the transepithelial Cl(-) current. Our analysis shows that 80% of the voltage-activated Cl(-) current is accounted for by current through MRC or their immediate vicinity. The activation patterns of this current and the inhibition by the alpha(1)-adrenergic agonist, epinephrine, conform to those of the transepithelial current. However, less than 20% of the MRC are active at a certain moment and the activity is spontaneously variable with time. The molecular nature of this pathway, physiological control mechanisms and their relation to the temporal activity of MRC remain to be studied.

  5. The regulatory mechanism underlying light-inducible production of carotenoids in nonphototrophic bacteria.

    PubMed

    Takano, Hideaki

    2016-07-01

    Light is a ubiquitous environmental factor serving as an energy source and external stimulus. Here, I review the conserved molecular mechanism of light-inducible production of carotenoids in three nonphototrophic bacteria: Streptomyces coelicolor A3(2), Thermus thermophilus HB27, and Bacillus megaterium QM B1551. A MerR family transcriptional regulator, LitR, commonly plays a central role in their light-inducible carotenoid production. Genetic and biochemical studies on LitR proteins revealed a conserved function: LitR in complex with adenosyl B12 (AdoB12) has a light-sensitive DNA-binding activity and thus suppresses the expression of the Crt biosynthesis gene cluster. The in vitro DNA-binding and transcription assays showed that the LitR-AdoB12 complex serves as a repressor allowing transcription initiation by RNA polymerase in response to illumination. The existence of novel light-inducible genes and the unique role of the megaplasmid were revealed by the transcriptomic analysis of T. thermophilus. The findings suggest that LitR is a general regulator responsible for the light-inducible carotenoid production in the phylogenetically divergent nonphototrophic bacteria, and that LitR performs diverse physiological functions in bacteria.

  6. PP2A activation by beta2-adrenergic receptor agonists: novel regulatory mechanism of keratinocyte migration.

    PubMed

    Pullar, Christine E; Chen, Jin; Isseroff, R Rivkah

    2003-06-20

    Understanding the mechanisms that regulate cell migration is important for devising novel therapies to control metastasis or enhance wound healing. Previously, we demonstrated that beta2-adrenergic receptor (beta2-AR) activation in keratinocytes inhibited their migration by decreasing the phosphorylation of a critical promigratory signaling component, the extracellular signal-related kinase (ERK). Here we demonstrate that beta2-AR-induced inhibition of migration is mediated by the activation of the serine/threonine phosphatase PP2A. Pretreating human keratinocytes with the PP2A inhibitor, okadaic acid, prevented the beta2-AR-induced inhibition of migration, either as isolated cells or as a confluent sheet of cells repairing an in vitro "wound" and also prevented the beta2-AR-induced reduction in ERK phosphorylation. Similar results were obtained with human corneal epithelial cells. In keratinocytes, immunoprecipitation studies revealed that beta2-AR activation resulted in the rapid association of beta2-AR with PP2A as well as a 37% increase in association of PP2A with ERK2. Finally, beta2-AR activation resulted in a rapid and transient 2-fold increase in PP2A activity. Thus, we provide the first evidence that beta2-AR activation in keratinocytes modulates migration via a novel pathway utilizing PP2A to alter the promigratory signaling cascade. Exploiting this pathway may result in novel therapeutic approaches for control of epithelial cell migration.

  7. Inducible nitric oxide synthase (NOS-2) in subarachnoid hemorrhage: Regulatory mechanisms and therapeutic implications.

    PubMed

    Iqbal, Sana; Hayman, Erik G; Hong, Caron; Stokum, Jesse A; Kurland, David B; Gerzanich, Volodymyr; Simard, J Marc

    2016-01-01

    Aneurysmal subarachnoid hemorrhage (SAH) typically carries a poor prognosis. Growing evidence indicates that overabundant production of nitric oxide (NO) may be responsible for a large part of the secondary injury that follows SAH. Although SAH modulates the activity of all three isoforms of nitric oxide synthase (NOS), the inducible isoform, NOS-2, accounts for a majority of NO-mediated secondary injuries after SAH. Here, we review the indispensable physiological roles of NO that must be preserved, even while attempting to downmodulate the pathophysiologic effects of NO that are induced by SAH. We examine the effects of SAH on the function of the various NOS isoforms, with a particular focus on the pathological effects of NOS-2 and on the mechanisms responsible for its transcriptional upregulation. Finally, we review interventions to block NOS-2 upregulation or to counteract its effects, with an emphasis on the potential therapeutic strategies to improve outcomes in patients afflicted with SAH. There is still much to be learned regarding the apparently maladaptive response of NOS-2 and its harmful product NO in SAH. However, the available evidence points to crucial effects that, on balance, are adverse, making the NOS-2/NO/peroxynitrite axis an attractive therapeutic target in SAH.

  8. The regulatory mechanism of fungal elicitor-induced secondary metabolite biosynthesis in medical plants.

    PubMed

    Zhai, Xin; Jia, Min; Chen, Ling; Zheng, Cheng-Jian; Rahman, Khalid; Han, Ting; Qin, Lu-Ping

    2017-03-01

    A wide range of external stress stimuli trigger plant cells to undergo complex network of reactions that ultimately lead to the synthesis and accumulation of secondary metabolites. Accumulation of such metabolites often occurs in plants subjected to stresses including various elicitors or signal molecules. Throughout evolution, endophytic fungi, an important constituent in the environment of medicinal plants, have known to form long-term stable and mutually beneficial symbiosis with medicinal plants. The endophytic fungal elicitor can rapidly and specifically induce the expression of specific genes in medicinal plants which can result in the activation of a series of specific secondary metabolic pathways resulting in the significant accumulation of active ingredients. Here we summarize the progress made on the mechanisms of fungal elicitor including elicitor signal recognition, signal transduction, gene expression and activation of the key enzymes and its application. This review provides guidance on studies which may be conducted to promote the efficient synthesis and accumulation of active ingredients by the endogenous fungal elicitor in medicinal plant cells, and provides new ideas and methods of studying the regulation of secondary metabolism in medicinal plants.

  9. Seasonality of reproduction in mammals: intimate regulatory mechanisms and practical implications.

    PubMed

    Chemineau, P; Guillaume, D; Migaud, M; Thiéry, J C; Pellicer-Rubio, M T; Malpaux, B

    2008-07-01

    Farm mammals generally express seasonal variations in their production traits, thus inducing changing availability of fresh derived animal products (meat, milk and cheese) or performances (horses). This is due to a more or less marked seasonal birth distribution in sheep and goats, in horses but not cattle. Birth peak occurs at the end of winter-early spring, the most favourable period for the progeny to survive. Most species show seasonal variations in their ovulation frequency (presence or absence of ovulation), spermatogenic activity (from moderate decrease to complete absence of sperm production), gamete quality (variations in fertilization rates and embryo survival), and also sexual behaviour. The intimate mechanism involved is a complex combination of endogenous circannual rhythm driven and synchronized by light and melatonin. Profound and long-term neuroendocrine changes involving different neuromediator systems were described to play a role in these processes. In most species artificial photoperiodic treatments consisting of extra-light during natural short days (in sheep and goats and mares) or melatonin during long days (in sheep and goats) are extensively used to either adjust the breeding season to animal producer needs and/or to completely overcome seasonal variations of sperm production in artificial insemination centres. Pure light treatments (without melatonin), especially when applied in open barns, could be considered as non-invasive ones which fully respect animal welfare. Genetic selection could be one of the future ways to decrease seasonality in sheep and goats.

  10. Gastrointestinal regulatory peptides and central nervous system mechanisms of weight control.

    PubMed

    Ladenheim, Ellen E

    2012-02-01

    This review focuses on recent advances in understanding the multiple roles of gastrointestinal peptides in the control of food intake and body weight with specific emphasis on ghrelin, amylin and glucagon-like peptide 1. Recent studies support a role for ghrelin, amylin and glucagon-like peptide 1 in short-term and long-term effects on food intake and body weight. Apart from contributing to energy homeostasis, ghrelin's participation in reward and sensory processing has been the focus of much recent work. New findings on amylin's effects on food intake and energy balance provide further support for its role in meal-related food intake and suggest that it may also function as an adiposity signal. New investigations on the role of central and peripheral glucagon-like peptide 1 receptors in mediating the anorexic effects of glucagon-like peptide 1 have suggested that they differentially contribute to short-term and long term effects on food intake. Gastrointestinal peptides can influence food intake through mechanisms that involve short-term meal-related effects or through activation of central pathways involved in energy balance. An appreciation of the multiple actions of gastrointestinal peptides on food intake will aid in developing new strategies for weight management.

  11. Tuning of Redox Regulatory Mechanisms, Reactive Oxygen Species and Redox Homeostasis under Salinity Stress

    PubMed Central

    Hossain, M. Sazzad; Dietz, Karl-Josef

    2016-01-01

    Soil salinity is a crucial environmental constraint which limits biomass production at many sites on a global scale. Saline growth conditions cause osmotic and ionic imbalances, oxidative stress and perturb metabolism, e.g., the photosynthetic electron flow. The plant ability to tolerate salinity is determined by multiple biochemical and physiological mechanisms protecting cell functions, in particular by regulating proper water relations and maintaining ion homeostasis. Redox homeostasis is a fundamental cell property. Its regulation includes control of reactive oxygen species (ROS) generation, sensing deviation from and readjustment of the cellular redox state. All these redox related functions have been recognized as decisive factors in salinity acclimation and adaptation. This review focuses on the core response of plants to overcome the challenges of salinity stress through regulation of ROS generation and detoxification systems and to maintain redox homeostasis. Emphasis is given to the role of NADH oxidase (RBOH), alternative oxidase (AOX), the plastid terminal oxidase (PTOX) and the malate valve with the malate dehydrogenase isoforms under salt stress. Overwhelming evidence assigns an essential auxiliary function of ROS and redox homeostasis to salinity acclimation of plants. PMID:27242807

  12. Retinal proteomic changes under different ischemic conditions - implication of an epigenetic regulatory mechanism

    PubMed Central

    Stowell, Cheri; Wang, Lin; Arbogast, Brian; Lan, Jing-quan; Cioffi, George A; Burgoyne, Claude F; Zhou, An

    2010-01-01

    In retina, an ischemic injury-resistant condition (ischemic tolerance) can be induced by a sub-lethal ischemic treatment (preconditioning) prior to an otherwise injurious ischemic insult. In this work, we compared retinal proteomic changes under three different ischemic conditions, as a means to identify the effector mechanisms that underlie retinal ischemic tolerance. Transient retinal ischemia was induced by elevating the intraocular pressure (IOP) in three groups of adult rats as follows: Group 1, ischemic-preconditioned, 110 mmHg for 8 minutes followed by 48 hours reperfusion; Group 2, ischemic-injured, 110 mmHg for 60 minutes followed by 24 hours reperfusion; Group 3, ischemic-tolerant, preconditioning treatment followed by another 60 minutes of 110 mmHg and 24 hours reperfusion. Protein quantities in retinas from each of the afore-mentioned retinal ischemic conditions, as determined by quantitative mass spectrometry, were compared with that of the contralateral control eyes (sham-treated). As a result, a total of 328 proteins were identified and quantified; among them, 30–60% of proteins showed a change in abundance under one or more retinal ischemic conditions. In particular, in ischemic-tolerant retinas, histone proteins H2B, H3 and H4 demonstrated an increase in abundance, whereas histone H2A showed a decrease in abundance. Further immunohistochemical analyses confirmed the results of proteomic analyses, and detected an up regulation of tri-methylated histone H3, mono-ubiquitinated histone H2A and Polycomb group protein RING2. Together, these results suggest a role of epigenetic regulation in the induction of retinal ischemic tolerance that involves histone and polycomb proteins. PMID:20740046

  13. Anaerobic transcription activation in Bacillus subtilis: identification of distinct FNR-dependent and -independent regulatory mechanisms.

    PubMed Central

    Cruz Ramos, H; Boursier, L; Moszer, I; Kunst, F; Danchin, A; Glaser, P

    1995-01-01

    Bacillus subtilis is able to grow anaerobically using alternative electron acceptors, including nitrate or fumarate. We characterized an operon encoding the dissimilatory nitrate reductase subunits homologous to the Escherichia coli narGHJI operon and the narK gene encoding a protein with nitrite extrusion activity. Downstream from narK and co-transcribed with it a gene (fnr) encoding a protein homologous to E.coli FNR was found. Disruption of fnr abolished both nitrate and fumarate utilization as electron acceptors and anaerobic induction of narK. Four putative FNR binding sites were found in B.subtilis sequences. The consensus sequence, centred at position -41.5, is identical to the consensus for the DNA site for E.coli CAP. Bs-FNR contained a four cysteine residue cluster at its C-terminal end. This is in contrast to Ec-FNR, where a similar cluster is present at the N-terminal end. It is possible that oxygen modulates the activity of both activators by a similar mechanism involving iron. Unlike in E.coli, where fnr expression is weakly repressed by anaerobiosis, fnr gene expression in B.subtilis is strongly activated by anaerobiosis. We have identified in the narK-fnr intergenic region a promotor activated by anaerobiosis independently of FNR. Thus induction of genes involved in anaerobic respiration requires in B.subtilis at least two levels of regulation: activation of fnr transcription and activation of FNR to induce transcription of FNR-dependent promoters. Images PMID:8846791

  14. Phosphoproteomic analysis of interacting tumor and endothelial cells identifies regulatory mechanisms of transendothelial migration.

    PubMed

    Locard-Paulet, Marie; Lim, Lindsay; Veluscek, Giulia; McMahon, Kelly; Sinclair, John; van Weverwijk, Antoinette; Worboys, Jonathan D; Yuan, Yinyin; Isacke, Clare M; Jørgensen, Claus

    2016-02-09

    The exit of metastasizing tumor cells from the vasculature, extravasation, is regulated by their dynamic interactions with the endothelial cells that line the internal surface of vessels. To elucidate signals controlling tumor cell adhesion to the endothelium and subsequent transendothelial migration, we performed phosphoproteomic analysis to map cell-specific changes in protein phosphorylation that were triggered by contact between metastatic MDA-MB-231 breast cancer cells and endothelial cells. From the 2669 unique phosphorylation sites identified, 77 and 43 were differentially phosphorylated in the tumor cells and endothelial cells, respectively. The receptor tyrosine kinase ephrin type A receptor 2 (EPHA2) exhibited decreased Tyr(772) phosphorylation in the cancer cells upon endothelial contact. Knockdown of EPHA2 increased adhesion of the breast cancer cells to human umbilical vein endothelial cells (HUVECs) and their transendothelial migration in coculture cell assays, as well as early-stage lung colonization in vivo. EPHA2-mediated inhibition of transendothelial migration of breast cancer cells depended on interaction with the ligand ephrinA1 on HUVECs and phosphorylation of EPHA2-Tyr(772). When EPHA2 phosphorylation dynamics were compared between cell lines of different metastatic ability, EPHA2-Tyr(772) was rapidly dephosphorylated after ephrinA1 stimulation specifically in cells targeting the lung. Knockdown of the phosphatase LMW-PTP reduced adhesion and transendothelial migration of the breast cancer cells. Overall, cell-specific phosphoproteomic analysis provides a bidirectional map of contact-initiated signaling between tumor and endothelial cells that can be further investigated to identify mechanisms controlling the transendothelial cell migration of cancer cells.

  15. Molecular mechanism for differential recognition of membrane phosphatidylserine by the immune regulatory receptor Tim4.

    PubMed

    Tietjen, Gregory T; Gong, Zhiliang; Chen, Chiu-Hao; Vargas, Ernesto; Crooks, James E; Cao, Kathleen D; Heffern, Charles T R; Henderson, J Michael; Meron, Mati; Lin, Binhua; Roux, Benot; Schlossman, Mark L; Steck, Theodore L; Lee, Ka Yee C; Adams, Erin J

    2014-04-15

    Recognition of phosphatidylserine (PS) lipids exposed on the extracellular leaflet of plasma membranes is implicated in both apoptotic cell removal and immune regulation. The PS receptor T cell immunoglobulin and mucin-domain-containing molecule 4 (Tim4) regulates T-cell immunity via phagocytosis of both apoptotic (high PS exposure) and nonapoptotic (intermediate PS exposure) activated T cells. The latter population must be removed at lower efficiency to sensitively control immune tolerance and memory cell population size, but the molecular basis for how Tim4 achieves this sensitivity is unknown. Using a combination of interfacial X-ray scattering, molecular dynamics simulations, and membrane binding assays, we demonstrate how Tim4 recognizes PS in the context of a lipid bilayer. Our data reveal that in addition to the known Ca(2+)-coordinated, single-PS binding pocket, Tim4 has four weaker sites of potential ionic interactions with PS lipids. This organization makes Tim4 sensitive to PS surface concentration in a manner capable of supporting differential recognition on the basis of PS exposure level. The structurally homologous, but functionally distinct, Tim1 and Tim3 are significantly less sensitive to PS surface density, likely reflecting the differences in immunological function between the Tim proteins. These results establish the potential for lipid membrane parameters, such as PS surface density, to play a critical role in facilitating selective recognition of PS-exposing cells. Furthermore, our multidisciplinary approach overcomes the difficulties associated with characterizing dynamic protein/membrane systems to reveal the molecular mechanisms underlying Tim4's recognition properties, and thereby provides an approach capable of providing atomic-level detail to uncover the nuances of protein/membrane interactions.

  16. Regulatory mechanisms in the interaction between carbohydrate and lipid oxidation during exercise.

    PubMed

    Spriet, L L; Watt, M J

    2003-08-01

    At the onset of exercise, signals from inside and outside the muscle cell increase the availability of carbohydrate (CHO) and fat to provide the fuel required for ATP production. CHO and fat oxidation are the dominant sources of aerobic ATP production and both pathways must be heavily upregulated during exercise to meet the increased energy demand. Within this paradigm, there is room for shifts between the proportion of energy that is provided from CHO and fat. It has long been known that increasing the availability of endogenous or exogenous CHO can increase the oxidation of CHO and decrease the oxidation of fat. The opposite is also true. While descriptive studies documenting these changes are numerous, the mechanisms regulating these shifts in fuel use in the face of constant energy demand have not been thoroughly elucidated. It would be expected, for example, that any fat-induced shift in CHO metabolism would target the enzymes that play key roles in regulating CHO metabolism and oxidation. Inside the muscle these could include glucose uptake (GLUT4) and phosphorylation (hexokinase), glycogenolysis (glycogen phosphorylase), glycolysis (phosphofructokinase) and conversion to acetyl CoA (pyruvate dehydrogenase). The same would be expected for a CHO-induced down regulation of fat metabolism and oxidation and might target transport of long chain fatty acids into the cell (fatty acid translocase CD36), release of fatty acids from intramuscular triacylglycerol (hormone sensitive lipase) and transport into the mitochondria (carnitine palmitoyl transferase complex). This review summarizes the work describing the interaction between CHO and fat metabolism in human skeletal muscle during exercise and presents the theories that may account for CHO/fat interaction during exercise.

  17. Just-in-Time Control of Spo0A Synthesis in Bacillus subtilis by Multiple Regulatory Mechanisms ▿ §

    PubMed Central

    Chastanet, Arnaud; Losick, Richard

    2011-01-01

    The response regulator Spo0A governs multiple developmental processes in Bacillus subtilis, including most conspicuously sporulation. Spo0A is activated by phosphorylation via a multicomponent phosphorelay. Previous work has shown that the Spo0A protein is not rate limiting for sporulation. Rather, Spo0A is present at high levels in growing cells, rapidly rising to yet higher levels under sporulation-inducing conditions, suggesting that synthesis of the response regulator is subject to a just-in-time control mechanism. Transcription of spo0A is governed by a promoter switching mechanism, involving a vegetative, σA-recognized promoter, Pv, and a sporulation σH-recognized promoter, Ps, that is under phosphorylated Spo0A (Spo0A∼P) control. The spo0A regulatory region also contains four (including one identified in the present work) conserved elements that conform to the consensus binding site for Spo0A∼P binding sites. These are herein designated O1, O2, O3, and O4 in reverse order of their proximity to the coding sequence. Here we report that O1 is responsible for repressing Pv during the transition to stationary phase, that O2 is responsible for repressing Ps during growth, that O3 is responsible for activating Ps at the start of sporulation, and that O4 is dispensable for promoter switching. We also report that Spo0A synthesis is subject to a posttranscriptional control mechanism such that translation of mRNAs originating from Pv is impeded due to RNA secondary structure whereas mRNAs originating from Ps are fully competent for protein synthesis. We propose that the opposing actions of O2 and O3 and the enhanced translatability of mRNAs originating from Ps create a highly sensitive, self-reinforcing switch that is responsible for producing a burst of Spo0A synthesis at the start of sporulation. PMID:21949067

  18. Mechanisms underlying zoonotic success of Campylobacter jejuni: the CprRS two-component regulatory system influences essential processes, biofilm formation, and pathogenesis

    USDA-ARS?s Scientific Manuscript database

    Mechanisms underlying zoonotic success of Campylobacter jejuni: the CprRS two-component regulatory system influences essential processes, biofilm formation, and pathogenesis Campylobacter jejuni is a leading cause of food- and waterbourne bacterial gastroenteritis in the developed world. Although il...

  19. Evidence for the involvement of p59fyn and p53/56lyn in collagen receptor signalling in human platelets.

    PubMed

    Briddon, S J; Watson, S P

    1999-02-15

    The binding of collagen to platelet glycoprotein VI (GPVI) leads to the subsequent activation of phospholipase Cgamma2 through a pathway that is dependent on the Fc receptor gamma (FcR gamma) chain and the tyrosine kinase p72syk. We have investigated the role of platelet Src-family kinases in this signalling pathway. The selective Src-family kinase inhibitor PP1 prevented collagen-stimulated increases in whole-cell tyrosine phosphorylation and tyrosine phosphorylation of the FcR gamma chain and p72syk. A similar set of observations was made for a collagen-related peptide (CRP), which binds to GPVI but not to the integrin alpha2beta1 (GPIa/IIa). These effects were seen at a concentration of PP1 that inhibited platelet aggregation, dense granule release and Ca2+ mobilization induced by CRP, but not aggregation and Ca2+ mobilization mediated by the G-protein-coupled receptor agonist thrombin. After stimulation by CRP or collagen, the Src-family kinases p59fyn and p53/56lyn became associated with several tyrosine-phosphorylated proteins including the FcR gamma chain. This was not true of the other platelet Src-family kinases. The association between the FcR gamma chain and p59fyn was also seen under basal conditions, and was stable only in the weak detergent Brij96 but not in Nonidet P40, suggesting a non-SH2-dependent interaction. These results provide strong evidence for the involvement of p59fyn and p53/56lyn in signalling via GPVI, with p59fyn possibly acting upstream of FcR gamma chain phosphorylation.

  20. Constitutive activation of Lck and Fyn tyrosine kinases in large granular lymphocytes infected with the γ-herpesvirus agents of malignant catarrhal fever

    PubMed Central

    Swa, S; Wright, H; Thomson, J; Reid, H; Haig, D

    2001-01-01

    Large granular lymphocytes (LGL) with a T or natural killer (NK) lymphoblast morphology and indiscriminate (non-major histocompatibility complex-linked) cytotoxicity for a variety of target cells can be derived in culture from the tissues of animals infected with either alcelaphine herpesvirus-1 (AlHV-1) or ovine herpesvirus-2 (OvHV-2). In this study, LGL survival in the absence of exogenous interleukin-2 was inhibited by the protein kinase inhibitor genestein, but not the p70 s6 kinase inhibitor rapamycin. Constitutive activation of the src kinases Lck and Fyn was demonstrated in a bovine LGL line infected with OvHV-2 and in two rabbit LGL lines infected with AlHV-1. The p44 erk1 and p42 erk2 mitogen-activated protein kinases (MAPK) were also constitutively activated in the LGLs but not control T cells. Lck and Fyn kinase activity in the LGLs did not increase after mitogen (concanavalin A or concanavalin A plus phorbol ester) stimulation of the cells, in contrast to control T cells. Control T cells, but not the LGLs, proliferated after mitogen stimulation. An analysis of tyrosine phosphorylated proteins in the cells indicated that the LGLs exhibited some similarities and differences to activated control T cells. The results demonstrate that the activated phenotype of the LGLs, associated with malignant catarrhal fever virus infection and in the absence of exogenous interleukin-2, involves constitutively activated Lck and Fyn kinases. These are normally crucial for the initial activation of T cells via several cell-surface receptors (e.g. the T-cell receptor and CD2). The inability of the LGLs to proliferate in response to mitogen may be due to an inability of Lck and Fyn to become further activated after mitogen stimulation. PMID:11168636

  1. [Inductive effect of zinc oxide nanoparticles on interleukin 8 gene expression in human bronchial epithelial cells and its regulatory mechanism].

    PubMed

    Lu, Yang; Xu, Lei; Yan, Zhen; Wu, Yi-ming; Wu, Wei-dong

    2013-02-01

    To clarify the effect of zinc oxide nanoparticles (ZnO-NPs) (30 nm in diameter) on the interleukin 8 (IL-8) gene expression in human bronchial epithelial cells (BEAS-2B) and its regulatory mechanism. BEAS-2B cells were used in the study. The MTT assay was employed to evaluate the damage to BEAS-2B cells by ZnO-NPs. RT-PCR and ELISA were used to measure the mRNA and protein expression levels of IL-8 in the BEAS-2B cells exposed to ZnO-NPs. The IL-8 mRNA decay assay was used to determine the effect of ZnO-NPs on IL-8 mRNA stability. Exposure to ZnO-NPs significantly increased the level of IL-8 mRNA in BEAS-2B cells and the level of IL-8 protein in supernatant medium. The transcription inhibitor significantly reduced the mRNA expression of IL-8 induced by ZnO-NPs. ZnO-NPs significantly delayed IL-8 mRNA degradation in the BEAS-2B cells that were pretreated with actinomycin D for terminating IL-8 mRNA synthesis. ZnO-NPs can increase the mRNA and protein expression levels of IL-8 and IL-8 mRNA stability in BEAS-2B cells.

  2. Regulatory Mechanisms of the Ihh/PTHrP Signaling Pathway in Fibrochondrocytes in Entheses of Pig Achilles Tendon

    PubMed Central

    Han, Xuesong; Zhuang, Yanfeng; Zhang, Zhihong

    2016-01-01

    This study is aimed at exploring the effect of stress stimulation on the proliferation and differentiation of fibrochondrocytes in entheses mediated via the Indian hedgehog (Ihh)/parathyroid hormone-related protein (PTHrP) signaling pathway. Differential stress stimulation on fibrochondrocytes in entheses was imposed. Gene expression and protein levels of signaling molecules including collagen type I (Col I), Col II, Col X, Ihh, and PTHrP in the cytoplasm of fibrochondrocytes were detected. Ihh signal blocking group was set up using Ihh signaling pathway-specific blocking agent cyclopamine. PTHrP enhancement group was set up using PTHrP reagent. Ihh/PTHrP double intervention group, as well as control group, was included to study the regulatory mechanisms of the Ihh/PTHrP signaling pathway in fibrochondrocytes. Under low cyclic stress tensile (CTS), PTHrP, Col I, and Col II gene expression and protein synthesis increased. Under high CTS, Ihh and Col X gene expression and protein synthesis increased. Blocking Ihh signaling with cyclopamine resulted in reduced PTHrP gene expression and protein synthesis and increased Col X gene expression and protein synthesis. Ihh and PTHrP coregulate fibrochondrocyte proliferation and differentiation in entheses through negative feedback regulation. Fibrochondrocyte is affected by the CTS. This phenomenon is regulated by stress stimulation through the Ihh/PTHrP signaling pathway. PMID:27994624

  3. Auxin Response Factor SlARF2 Is an Essential Component of the Regulatory Mechanism Controlling Fruit Ripening in Tomato

    PubMed Central

    Hao, Yanwei; Hu, Guojian; Breitel, Dario; Liu, Mingchun; Mila, Isabelle; Frasse, Pierre; Fu, Yongyao; Aharoni, Asaph; Bouzayen, Mondher; Zouine, Mohamed

    2015-01-01

    Ethylene is the main regulator of climacteric fruit ripening, by contrast the putative role of other phytohormones in this process remains poorly understood. The present study brings auxin signaling components into the mechanism regulating tomato fruit ripening through the functional characterization of Auxin Response Factor2 (SlARF2) which encodes a downstream component of auxin signaling. Two paralogs, SlARF2A and SlARF2B, are found in the tomato genome, both displaying a marked ripening-associated expression but distinct responsiveness to ethylene and auxin. Down-regulation of either SlARF2A or SlARF2B resulted in ripening defects while simultaneous silencing of both genes led to severe ripening inhibition suggesting a functional redundancy among the two ARFs. Tomato fruits under-expressing SlARF2 produced less climacteric ethylene and exhibited a dramatic down-regulation of the key ripening regulators RIN, CNR, NOR and TAGL1. Ethylene treatment failed to reverse the non-ripening phenotype and the expression of ethylene signaling and biosynthesis genes was strongly altered in SlARF2 down-regulated fruits. Although both SlARF proteins are transcriptional repressors the data indicate they work as positive regulators of tomato fruit ripening. Altogether, the study defines SlARF2 as a new component of the regulatory network controlling the ripening process in tomato. PMID:26716451

  4. Auxin Response Factor SlARF2 Is an Essential Component of the Regulatory Mechanism Controlling Fruit Ripening in Tomato.

    PubMed

    Hao, Yanwei; Hu, Guojian; Breitel, Dario; Liu, Mingchun; Mila, Isabelle; Frasse, Pierre; Fu, Yongyao; Aharoni, Asaph; Bouzayen, Mondher; Zouine, Mohamed

    2015-12-01

    Ethylene is the main regulator of climacteric fruit ripening, by contrast the putative role of other phytohormones in this process remains poorly understood. The present study brings auxin signaling components into the mechanism regulating tomato fruit ripening through the functional characterization of Auxin Response Factor2 (SlARF2) which encodes a downstream component of auxin signaling. Two paralogs, SlARF2A and SlARF2B, are found in the tomato genome, both displaying a marked ripening-associated expression but distinct responsiveness to ethylene and auxin. Down-regulation of either SlARF2A or SlARF2B resulted in ripening defects while simultaneous silencing of both genes led to severe ripening inhibition suggesting a functional redundancy among the two ARFs. Tomato fruits under-expressing SlARF2 produced less climacteric ethylene and exhibited a dramatic down-regulation of the key ripening regulators RIN, CNR, NOR and TAGL1. Ethylene treatment failed to reverse the non-ripening phenotype and the expression of ethylene signaling and biosynthesis genes was strongly altered in SlARF2 down-regulated fruits. Although both SlARF proteins are transcriptional repressors the data indicate they work as positive regulators of tomato fruit ripening. Altogether, the study defines SlARF2 as a new component of the regulatory network controlling the ripening process in tomato.

  5. Reactive oxygen species regulatory mechanisms associated with rapid response of MC3T3-E1 cells for vibration stress

    SciTech Connect

    Zhang, Ling; Gan, Xueqi; Zhu, Zhuoli; Yang, Yang; He, Yuting; Yu, Haiyang

    2016-02-12

    Although many previous studies have shown that refractory period-dependent memory effect of vibration stress is anabolic for skeletal homeostasis, little is known about the rapid response of osteoblasts simply derived from vibration itself. In view of the potential role of reactive oxygen species (ROS) in mediating differentiated activity of osteoblasts, whether and how ROS regulates the rapid effect of vibration deserve to be demonstrated. Our findings indicated that MC3T3-E1 cells underwent decreased gene expression of Runx2, Col-I and ALP and impaired ALP activity accompanied by increased mitochondrial fission immediately after vibration loading. Moreover, we also revealed the involvement of ERK-Drp1 signal transduction in ROS regulatory mechanisms responsible for the rapid effect of vibration stress. - Highlights: • ROS contributed to the rapid response of MC3T3-E1 cells for vibration stress. • Imbalance of mitochondrial dynamics were linked to the LMHFV-derived rapid response. • The role of ERK-Drp1 signal pathway in the LMHFV-derived osteoblast rapid response.

  6. Transcriptome profiling reveals the regulatory mechanism underlying pollination dependent and parthenocarpic fruit set mainly mediated by auxin and gibberellin.

    PubMed

    Tang, Ning; Deng, Wei; Hu, Guojian; Hu, Nan; Li, Zhengguo

    2015-01-01

    Fruit set is a key process for crop production in tomato which occurs after successful pollination and fertilization naturally. However, parthenocarpic fruit development can be uncoupled from fertilization triggered by exogenous auxin or gibberellins (GAs). Global transcriptome knowledge during fruit initiation would help to characterize the molecular mechanisms by which these two hormones regulate pollination-dependent and -independent fruit set. In this work, digital gene expression tag profiling (DGE) technology was applied to compare the transcriptomes from pollinated and 2, 4-D/GA3-treated ovaries. Activation of carbohydrate metabolism, cell division and expansion as well as the down-regulation of MADS-box is a comprehensive regulatory pathway during pollination-dependent and parthenocarpic fruit set. The signaling cascades of auxin and GA are significantly modulated. The feedback regulations of Aux/IAAs and DELLA genes which functioned to fine-tune auxin and GA response respectively play fundamental roles in triggering fruit initiation. In addition, auxin regulates GA synthesis via up-regulation of GA20ox1 and down-regulation of KNOX. Accordingly, the effect of auxin on fruit set is mediated by GA via ARF2 and IAA9 down-regulation, suggesting that both pollination-dependent and parthenocarpic fruit set depend on the crosstalk between auxin and GA. This study characterizes the transcriptomic features of ovary development and more importantly unravels the integral roles of auxin and GA on pollination-dependent and parthenocarpic fruit set.

  7. Transcriptome Profiling Reveals the Regulatory Mechanism Underlying Pollination Dependent and Parthenocarpic Fruit Set Mainly Mediated by Auxin and Gibberellin

    PubMed Central

    Tang, Ning; Deng, Wei; Hu, Guojian; Hu, Nan; Li, Zhengguo

    2015-01-01

    Background Fruit set is a key process for crop production in tomato which occurs after successful pollination and fertilization naturally. However, parthenocarpic fruit development can be uncoupled from fertilization triggered by exogenous auxin or gibberellins (GAs). Global transcriptome knowledge during fruit initiation would help to characterize the molecular mechanisms by which these two hormones regulate pollination-dependent and -independent fruit set. Principal Findings In this work, digital gene expression tag profiling (DGE) technology was applied to compare the transcriptomes from pollinated and 2, 4-D/GA3-treated ovaries. Activation of carbohydrate metabolism, cell division and expansion as well as the down-regulation of MADS-box is a comprehensive regulatory pathway during pollination-dependent and parthenocarpic fruit set. The signaling cascades of auxin and GA are significantly modulated. The feedback regulations of Aux/IAAs and DELLA genes which functioned to fine-tune auxin and GA response respectively play fundamental roles in triggering fruit initiation. In addition, auxin regulates GA synthesis via up-regulation of GA20ox1 and down-regulation of KNOX. Accordingly, the effect of auxin on fruit set is mediated by GA via ARF2 and IAA9 down-regulation, suggesting that both pollination-dependent and parthenocarpic fruit set depend on the crosstalk between auxin and GA. Significance This study characterizes the transcriptomic features of ovary development and more importantly unravels the integral roles of auxin and GA on pollination-dependent and parthenocarpic fruit set. PMID:25909657

  8. Multistructure index in revealing complexity of regulatory mechanisms of human cardiovascular system at rest and orthostatic stress in healthy humans

    NASA Astrophysics Data System (ADS)

    Makowiec, Danuta; Graff, Beata; Struzik, Zbigniew R.

    2017-02-01

    Biological regulation is sufficiently complex to pose an enduring challenge for characterization of both its equilibrium and transient non-equilibrium dynamics. Two univariate but coupled observables, heart rate and systolic blood pressure, are commonly characterized in the benchmark example of the human cardiovascular regulatory system. Asymmetric distributions of accelerations and decelerations of heart rate, as well as rises and falls in systolic blood pressure, recorded in humans during a head-up tilt test provide insights into the dynamics of cardiovascular response to a rapid, controlled deregulation of the system's homeostasis. The baroreflex feedback loop is assumed to be the fundamental physiological mechanism for ensuring homeostatic blood supply to distant organs at rest and during orthostatic stress, captured in a classical beat-to-beat autoregressive model of baroreflex by de Boer et al. (1987). For model corroboration, a multistructure index statistic is proposed, seamlessly evaluating the size spectrum of magnitudes of neural reflexes such as baroreflex, responsible for maintaining the homeostatic dynamics. The multistructure index exposes a distinctly different dynamics of multiscale asymmetry between results obtained from real-life signals recorded from healthy subjects and those simulated using both the classical and perturbed versions of the model. Nonlinear effects observed suggest the pronounced presence of complex mechanisms resulting from baroreflex regulation when a human is at rest, which is aggravated in the system's response to orthostatic stress. Using our methodology of multistructure index, we therefore show a marked difference between model and real-life scenarios, which we attribute to multiscale asymmetry of non-linear origin in real-life signals, which we are not reproducible by the classical model.

  9. Simulations of cellulose translocation in the bacterial cellulose synthase suggest a regulatory mechanism for the dimeric structure of cellulose

    SciTech Connect

    Knott, Brandon C.; Crowley, Michael F.; Himmel, Michael E.; Zimmer, Jochen; Beckham, Gregg T.

    2016-01-29

    The processive cycle of the bacterial cellulose synthase (Bcs) includes the addition of a single glucose moiety to the end of a growing cellulose chain followed by the translocation of the nascent chain across the plasma membrane. The mechanism of this translocation and its precise location within the processive cycle are not well understood. In particular, the molecular details of how a polymer (cellulose) whose basic structural unit is a dimer (cellobiose) can be constructed by adding one monomer (glucose) at a time are yet to be elucidated. Here, we have utilized molecular dynamics simulations and free energy calculations to the shed light on these questions. We find that translocation forward by one glucose unit is quite favorable energetically, giving a free energy stabilization of greater than 10 kcal mol-1. In addition, there is only a small barrier to translocation, implying that translocation is not rate limiting within the Bcs processive cycle (given experimental rates for cellulose synthesis in vitro). Perhaps most significantly, our results also indicate that steric constraints at the transmembrane tunnel entrance regulate the dimeric structure of cellulose. Namely, when a glucose molecule is added to the cellulose chain in the same orientation as the acceptor glucose, the terminal glucose freely rotates upon forward motion, thus suggesting a regulatory mechanism for the dimeric structure of cellulose. We characterize both the conserved and non-conserved enzyme-polysaccharide interactions that drive translocation, and find that 20 of the 25 residues that strongly interact with the translocating cellulose chain in the simulations are well conserved, mostly with polar or aromatic side chains. Our results also allow for a dynamical analysis of the role of the so-called 'finger helix' in cellulose translocation that has been observed structurally. Taken together, these findings aid in the elucidation of the translocation steps of the Bcs processive cycle

  10. Selective intestinal decontamination with norfloxacin enhances a regulatory T cell-mediated inflammatory control mechanism in cirrhosis.

    PubMed

    Juanola, Oriol; Gómez-Hurtado, Isabel; Zapater, Pedro; Moratalla, Alba; Caparrós, Esther; Piñero, Paula; González-Navajas, José M; Giménez, Paula; Such, José; Francés, Rubén

    2016-12-01

    Norfloxacin exerts immunomodulatory effects in cirrhosis beyond its bactericidal activity. We aimed at identifying the role of regulatory T (Treg) cells in the norfloxacin mechanism that compensates the inflammatory environment in cirrhosis. Consecutively admitted patients with cirrhosis and ascitic fluid (AF) with: spontaneous bacterial peritonitis (SBP), non-infected AF, and norfloxacin as secondary SBP prophylaxis (SID group). Tregs were defined by flow-cytometry as CD4(+) CD25(+) FoxP3(+) cells. Dendritic cells (DCs) were purified for co-stimulatory signalling evaluation and norfloxacin and IL-10 levels were measured in serum. Wildtype and recombination activating gene 1 (Rag1)-deficient mice with CCl4 -induced cirrhosis were used for adoptive-transfer experiments using naïve CD4(+) T cells and Tregs. Eighty-four patients were included. Treg percentage was significantly increased in SID patients compared with SBP or non-infected AF patients. A positive correlation was observed between Tregs and serum norfloxacin and IL-10 levels. DCs from SID patients showed a significantly decreased expression of CD80 and CD86 compared with SBP and non-infected AF patients and correlated with norfloxacin levels. Modulation of co-stimulatory signalling by norfloxacin was not detected in Rag1-deficient mice and Rag1-deficient mice reconstituted with naïve T-cells. However, reconstitution with naïve T-cells and Tregs was associated with significantly downregulated CD80 and CD86 expression in the presence of norfloxacin. Norfloxacin immunomodulatory effect on IL-2 and IFN-gamma reduction and on the increase of IL-10 was significantly achieved only when the Tregs were restored in Rag1-deficient mice. These results provide a plausible mechanism for the immunomodulatory effects of norfloxacin in cirrhosis beyond its bactericidal effect. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  11. The function of the RNA-binding protein TEL1 in moss reveals ancient regulatory mechanisms of shoot development.

    PubMed

    Vivancos, Julien; Spinner, Lara; Mazubert, Christelle; Charlot, Florence; Paquet, Nicolas; Thareau, Vincent; Dron, Michel; Nogué, Fabien; Charon, Céline

    2012-03-01

    The shoot represents the basic body plan in land plants. It consists of a repeated structure composed of stems and leaves. Whereas vascular plants generate a shoot in their diploid phase, non-vascular plants such as mosses form a shoot (called the gametophore) in their haploid generation. The evolution of regulatory mechanisms or genetic networks used in the development of these two kinds of shoots is unclear. TERMINAL EAR1-like genes have been involved in diploid shoot development in vascular plants. Here, we show that disruption of PpTEL1 from the moss Physcomitrella patens, causes reduced protonema growth and gametophore initiation, as well as defects in gametophore development. Leafy shoots formed on ΔTEL1 mutants exhibit shorter stems with more leaves per shoot, suggesting an accelerated leaf initiation (shortened plastochron), a phenotype shared with the Poaceae vascular plants TE1 and PLA2/LHD2 mutants. Moreover, the positive correlation between plastochron length and leaf size observed in ΔTEL1 mutants suggests a conserved compensatory mechanism correlating leaf growth and leaf initiation rate that would minimize overall changes in plant biomass. The RNA-binding protein encoded by PpTEL1 contains two N-terminus RNA-recognition motifs, and a third C-terminus non-canonical RRM, specific to TEL proteins. Removal of the PpTEL1 C-terminus (including this third RRM) or only 16-18 amino acids within it seriously impairs PpTEL1 function, suggesting a critical role for this third RRM. These results show a conserved function of the RNA-binding PpTEL1 protein in the regulation of shoot development, from early ancestors to vascular plants, that depends on the third TEL-specific RRM.

  12. Gene regulatory network reveals oxidative stress as the underlying molecular mechanism of type 2 diabetes and hypertension

    PubMed Central

    2010-01-01

    Background The prevalence of diabetes is increasing worldwide. It has been long known that increased rates of inflammatory diseases, such as obesity (OBS), hypertension (HT) and cardiovascular diseases (CVD) are highly associated with type 2 diabetes (T2D). T2D and/or OBS can develop independently, due to genetic, behavioral or lifestyle-related variables but both lead to oxidative stress generation. The underlying mechanisms by which theses complications arise and manifest together remain poorly understood. Protein-protein interactions regulate nearly every living process. Availability of high-throughput genomic data has enabled unprecedented views of gene and protein co-expression, co-regulations and interactions in cellular systems. Methods The present work, applied a systems biology approach to develop gene interaction network models, comprised of high throughput genomic and PPI data for T2D. The genes differentially regulated through T2D were 'mined' and their 'wirings' were studied to get a more complete understanding of the overall gene network topology and their role in disease progression. Results By analyzing the genes related to T2D, HT and OBS, a highly regulated gene-disease integrated network model has been developed that provides useful functional linkages among groups of genes and thus addressing how different inflammatory diseases are connected and propagated at genetic level. Based on the investigations around the 'hubs' that provided more meaningful insights about the cross-talk within gene-disease networks in terms of disease phenotype association with oxidative stress and inflammation, a hypothetical co-regulation disease mechanism model been proposed. The results from this study revealed that the oxidative stress mediated regulation cascade is the common mechanistic link among the pathogenesis of T2D, HT and other inflammatory diseases such as OBS. Conclusion The findings provide a novel comprehensive approach for understanding the

  13. Simulations of cellulose translocation in the bacterial cellulose synthase suggest a regulatory mechanism for the dimeric structure of cellulose

    PubMed Central

    Knott, Brandon C.; Crowley, Michael F.; Himmel, Michael E.; Zimmer, Jochen; Beckham, Gregg T.

    2016-01-01

    The processive cycle of the bacterial cellulose synthase (Bcs) includes the addition of a single glucose moiety to the end of a growing cellulose chain followed by the translocation of the nascent chain across the plasma membrane. The mechanism of this translocation and its precise location within the processive cycle are not well understood. In particular, the molecular details of how a polymer (cellulose) whose basic structural unit is a dimer (cellobiose) can be constructed by adding one monomer (glucose) at a time are yet to be elucidated. Here, we have utilized molecular dynamics simulations and free energy calculations to the shed light on these questions. We find that translocation forward by one glucose unit is quite favorable energetically, giving a free energy stabilization of greater than 10 kcal/mol. In addition, there is only a small barrier to translocation, implying that translocation is not rate limiting within the Bcs processive cycle (given experimental rates for cellulose synthesis in vitro). Perhaps most significantly, our results also indicate that steric constraints at the transmembrane tunnel entrance regulate the dimeric structure of cellulose. Namely, when a glucose molecule is added to the cellulose chain in the same orientation as the acceptor glucose, the terminal glucose freely rotates upon forward motion, thus suggesting a regulatory mechanism for the dimeric structure of cellulose. We characterize both the conserved and non-conserved enzyme-polysaccharide interactions that drive translocation, and find that 20 of the 25 residues that strongly interact with the translocating cellulose chain in the simulations are well conserved, mostly with polar or aromatic side chains. Our results also allow for a dynamical analysis of the role of the so-called `finger helix' in cellulose translocation that has been observed structurally. Taken together, these findings aid in the elucidation of the translocation steps of the Bcs processive cycle and

  14. Simulations of cellulose translocation in the bacterial cellulose synthase suggest a regulatory mechanism for the dimeric structure of cellulose.

    PubMed

    Knott, Brandon C; Crowley, Michael F; Himmel, Michael E; Zimmer, Jochen; Beckham, Gregg T

    2016-05-01

    The processive cycle of the bacterial cellulose synthase (Bcs) includes the addition of a single glucose moiety to the end of a growing cellulose chain followed by the translocation of the nascent chain across the plasma membrane. The mechanism of this translocation and its precise location within the processive cycle are not well understood. In particular, the molecular details of how a polymer (cellulose) whose basic structural unit is a dimer (cellobiose) can be constructed by adding one monomer (glucose) at a time are yet to be elucidated. Here, we have utilized molecular dynamics simulations and free energy calculations to the shed light on these questions. We find that translocation forward by one glucose unit is quite favorable energetically, giving a free energy stabilization of greater than 10 kcal/mol. In addition, there is only a small barrier to translocation, implying that translocation is not rate limiting within the Bcs processive cycle (given experimental rates for cellulose synthesis in vitro). Perhaps most significantly, our results also indicate that steric constraints at the transmembrane tunnel entrance regulate the dimeric structure of cellulose. Namely, when a glucose molecule is added to the cellulose chain in the same orientation as the acceptor glucose, the terminal glucose freely rotates upon forward motion, thus suggesting a regulatory mechanism for the dimeric structure of cellulose. We characterize both the conserved and non-conserved enzyme-polysaccharide interactions that drive translocation, and find that 20 of the 25 residues that strongly interact with the translocating cellulose chain in the simulations are well conserved, mostly with polar or aromatic side chains. Our results also allow for a dynamical analysis of the role of the so-called `finger helix' in cellulose translocation that has been observed structurally. Taken together, these findings aid in the elucidation of the translocation steps of the Bcs processive cycle and

  15. Prefrontal and Striatal Glutamate Differently Relate to Striatal Dopamine: Potential Regulatory Mechanisms of Striatal Presynaptic Dopamine Function?

    PubMed

    Gleich, Tobias; Deserno, Lorenz; Lorenz, Robert Christian; Boehme, Rebecca; Pankow, Anne; Buchert, Ralph; Kühn, Simone; Heinz, Andreas; Schlagenhauf, Florian; Gallinat, Jürgen

    2015-07-01

    Theoretical and animal work has proposed that prefrontal cortex (PFC) glutamate inhibits dopaminergic inputs to the ventral striatum (VS) indirectly, whereas direct VS glutamatergic afferents have been suggested to enhance dopaminergic inputs to the VS. In the present study, we aimed to investigate relationships of glutamate and dopamine measures in prefrontostriatal circuitries of healthy humans. We hypothesized that PFC and VS glutamate, as well as their balance, are differently associated with VS dopamine. Glutamate concentrations in the left lateral PFC and left striatum were assessed using 3-Tesla proton magnetic resonance spectroscopy. Striatal presynaptic dopamine synthesis capacity was measured by fluorine-18-l-dihydroxyphenylalanine (F-18-FDOPA) positron emission tomography. First, a negative relationship was observed between glutamate concentrations in lateral PFC and VS dopamine synthesis capacity (n = 28). Second, a positive relationship was revealed between striatal glutamate and VS dopamine synthesis capacity (n = 26). Additionally, the intraindividual difference between PFC and striatal glutamate concentrations correlated negatively with VS dopamine synthesis capacity (n = 24). The present results indicate an involvement of a balance in PFC and striatal glutamate in the regulation of VS dopamine synthesis capacity. This notion points toward a potential mechanism how VS presynaptic dopamine levels are kept in a fine-tuned range. A disruption of this mechanism may account for alterations in striatal dopamine turnover as observed in mental diseases (e.g., in schizophrenia). The present work demonstrates complementary relationships between prefrontal and striatal glutamate and ventral striatal presynaptic dopamine using human imaging measures: a negative correlation between prefrontal glutamate and presynaptic dopamine and a positive relationship between striatal glutamate and presynaptic dopamine are revealed. The results may reflect a regulatory role

  16. Simulating molecular mechanisms of the MDM2-mediated regulatory interactions: a conformational selection model of the MDM2 lid dynamics.

    PubMed

    Verkhivker, Gennady M

    2012-01-01

    Diversity and complexity of MDM2 mechanisms govern its principal function as the cellular antagonist of the p53 tumor suppressor. Structural and biophysical studies have demonstrated that MDM2 binding could be regulated by the dynamics of a pseudo-substrate lid motif. However, these experiments and subsequent computational studies have produced conflicting mechanistic models of MDM2 function and dynamics. We propose a unifying conformational selection model that can reconcile experimental findings and reveal a fundamental role of the lid as a dynamic regulator of MDM2-mediated binding. In this work, structure, dynamics and energetics of apo-MDM2 are studied as a function of posttranslational modifications and length of the lid. We found that the dynamic equilibrium between "closed" and "semi-closed" lid forms may be a fundamental characteristic of MDM2 regulatory interactions, which can be modulated by phosphorylation, phosphomimetic mutation as well as by the lid size. Our results revealed that these factors may regulate p53-MDM2 binding by fine-tuning the thermodynamic equilibrium between preexisting conformational states of apo-MDM2. In agreement with NMR studies, the effect of phosphorylation on MDM2 interactions was more pronounced with the truncated lid variant that favored the thermodynamically dominant closed form. The phosphomimetic mutation S17D may alter the lid dynamics by shifting the thermodynamic equilibrium towards the ensemble of "semi-closed" conformations. The dominant "semi-closed" lid form and weakened dependence on the phosphorylation seen in simulations with the complete lid can provide a rationale for binding of small p53-based mimetics and inhibitors without a direct competition with the lid dynamics. The results suggested that a conformational selection model of preexisting MDM2 states may provide a robust theoretical framework for understanding MDM2 dynamics. Probing biological functions and mechanisms of MDM2 regulation would require

  17. Simulations of cellulose translocation in the bacterial cellulose synthase suggest a regulatory mechanism for the dimeric structure of cellulose

    DOE PAGES

    Knott, Brandon C.; Crowley, Michael F.; Himmel, Michael E.; ...

    2016-01-29

    The processive cycle of the bacterial cellulose synthase (Bcs) includes the addition of a single glucose moiety to the end of a growing cellulose chain followed by the translocation of the nascent chain across the plasma membrane. The mechanism of this translocation and its precise location within the processive cycle are not well understood. In particular, the molecular details of how a polymer (cellulose) whose basic structural unit is a dimer (cellobiose) can be constructed by adding one monomer (glucose) at a time are yet to be elucidated. Here, we have utilized molecular dynamics simulations and free energy calculations tomore » the shed light on these questions. We find that translocation forward by one glucose unit is quite favorable energetically, giving a free energy stabilization of greater than 10 kcal mol-1. In addition, there is only a small barrier to translocation, implying that translocation is not rate limiting within the Bcs processive cycle (given experimental rates for cellulose synthesis in vitro). Perhaps most significantly, our results also indicate that steric constraints at the transmembrane tunnel entrance regulate the dimeric structure of cellulose. Namely, when a glucose molecule is added to the cellulose chain in the same orientation as the acceptor glucose, the terminal glucose freely rotates upon forward motion, thus suggesting a regulatory mechanism for the dimeric structure of cellulose. We characterize both the conserved and non-conserved enzyme-polysaccharide interactions that drive translocation, and find that 20 of the 25 residues that strongly interact with the translocating cellulose chain in the simulations are well conserved, mostly with polar or aromatic side chains. Our results also allow for a dynamical analysis of the role of the so-called 'finger helix' in cellulose translocation that has been observed structurally. Taken together, these findings aid in the elucidation of the translocation steps of the Bcs processive

  18. Regulatory Mechanisms That Prevent Re-initiation of DNA Replication Can Be Locally Modulated at Origins by Nearby Sequence Elements

    PubMed Central

    Richardson, Christopher D.; Li, Joachim J.

    2014-01-01

    Eukaryotic cells must inhibit re-initiation of DNA replication at each of the thousands of origins in their genome because re-initiation can generate genomic alterations with extraordinary frequency. To minimize the probability of re-initiation from so many origins, cells use a battery of regulatory mechanisms that reduce the activity of replication initiation proteins. Given the global nature of these mechanisms, it has been presumed that all origins are inhibited identically. However, origins re-initiate with diverse efficiencies when these mechanisms are disabled, and this diversity cannot be explained by differences in the efficiency or timing of origin initiation during normal S phase replication. This observation raises the possibility of an additional layer of replication control that can differentially regulate re-initiation at distinct origins. We have identified novel genetic elements that are necessary for preferential re-initiation of two origins and sufficient to confer preferential re-initiation on heterologous origins when the control of re-initiation is partially deregulated. The elements do not enhance the S phase timing or efficiency of adjacent origins and thus are specifically acting as re-initiation promoters (RIPs). We have mapped the two RIPs to ∼60 bp AT rich sequences that act in a distance- and sequence-dependent manner. During the induction of re-replication, Mcm2-7 reassociates both with origins that preferentially re-initiate and origins that do not, suggesting that the RIP elements can overcome a block to re-initiation imposed after Mcm2-7 associates with origins. Our findings identify a local level of control in the block to re-initiation. This local control creates a complex genomic landscape of re-replication potential that is revealed when global mechanisms preventing re-replication are compromised. Hence, if re-replication does contribute to genomic alterations, as has been speculated for cancer cells, some regions of the genome

  19. Protein Tyrosine Phosphatase δ Mediates the Sema3A-Induced Cortical Basal Dendritic Arborization through the Activation of Fyn Tyrosine Kinase.

    PubMed

    Nakamura, Fumio; Okada, Takako; Shishikura, Maria; Uetani, Noriko; Taniguchi, Masahiko; Yagi, Takeshi; Iwakura, Yoichiro; Ohshima, Toshio; Goshima, Yoshio; Strittmatter, Stephen M

    2017-07-26

    Leukocyte common antigen-related (LAR) class protein tyrosine phosphatases (PTPs) are critical for axonal guidance; however, their relation to specific guidance cues is poorly defined. We here show that PTP-3, a LAR homolog in Caenorhabditis elegans, is involved in axon guidance regulated by Semaphorin-2A-signaling. PTPδ, one of the vertebrate LAR class PTPs, participates in the Semaphorin-3A (Sema3A)-induced growth cone collapse response of primary cultured dorsal root ganglion neurons from Mus musculus embryos. In vivo, however, the contribution of PTPδ in Sema3A-regualted axon guidance was minimal. Instead, PTPδ played a major role in Sema3A-dependent cortical dendritic growth. Ptpδ(-/-) and Sema3a(-/-) mutant mice exhibited poor arborization of basal dendrites of cortical layer V neurons. This phenotype was observed in both male and female mutants. The double-heterozygous mutants, Ptpδ(+/-); Sema3a(+/-), also showed a similar phenotype, indicating the genetic interaction. In Ptpδ(-/-) brains, Fyn and Src kinases were hyperphosphorylated at their C-terminal Tyr527 residues. Sema3A-stimulation induced dephosphorylation of Tyr527 in the dendrites of wild-type cortical neurons but not of Ptpδ(-/-) Arborization of cortical basal dendrites was reduced in Fyn(-/-) as well as in Ptpδ(+/-); Fyn(+/-) double-heterozygous mutants. Collectively, PTPδ mediates Sema3A-signaling through the activation of Fyn by C-terminal dephosphorylation.SIGNIFICANCE STATEMENT The relation of leukocyte common antigen-related (LAR) class protein tyrosine phosphatases (PTPs) and specific axon guidance cues is poorly defined. We show that PTP-3, a LAR homolog in Caenorhabditis elegans, participates in Sema2A-regulated axon guidance. PTPδ, a member of vertebrate LAR class PTPs, is involved in Sema3A-regulated cortical dendritic growth. In Sema3A signaling, PTPδ activates Fyn and Src kinases by dephosphorylating their C-terminal Tyr residues. This is the first evidence showing that LAR

  20. ZNF148 modulates TOP2A expression and cell proliferation via ceRNA regulatory mechanism in colorectal cancer

    PubMed Central

    Gao, Xian Hua; Li, Juan; Liu, Yan; Liu, Qi Zhi; Hao, Li Qiang; Liu, Lian Jie; Zhang, Wei

    2017-01-01

    Abstract Background: Competing endogenous RNA (ceRNA) regulation is a novel hypothesized mechanism that states RNA molecules share common target microRNAs (miRNAs) and may competitively combine into the same miRNA pool. Methods: Zinc finger protein 148 (ZNF148) and TOP2A expression were analyzed in 742 colorectal cancer (CRC) tissues using immunohistochemistry (IHC). ZNF148 mRNA, TOP2A mRNA, miR101, miR144, miR335, and miR365 expression were estimated in 53 fresh frozen CRC tissues by reverse transcription polymerase chain reaction. Mechanisms underpinning ceRNA were examined using bioinformatics, correlation analysis, RNA interference, gene over-expression, and luciferase assays. Results: Protein levels of ZNF148 and TOP2A detected by IHC positively correlated (Spearman correlation coefficient [rs] = 0.431, P < 0.001); mRNA levels of ZNF148 and TOP2A also positively correlated (r = 0.591, P < 0.001). Bioinformatics analysis demonstrated that ZNF148 and TOP2A mRNA had 13 common target miRNAs, including miR101, miR144, miR335, and miR365. Correlation analysis demonstrated that levels of ZNF148 mRNA were negatively associated with levels of miR144, miR335, and miR365. Knockdown and overexpression tests showed that ZNF148 mRNA and TOP2A mRNA regulated each other in HCT116 cells, respectively, but not in Dicer-deficient HCT116 cells. Luciferase assays demonstrated that ZNF148 and TOP2A regulated each other through 3′UTR. Overexpression of ZNF148 mRNA and TOP2A mRNA caused significant downregulation of miR101, miR144, miR335, and miR365 in the HCT116 cells. We also found that knockdown of ZNF148 and TOP2A significantly promoted cell growth, and overexpression of ZNF148 and TOP2A inhibited cell proliferation, which was abrogated in Dicer-deficient HCT116 cells. Conclusion: ZNF148 and TOP2A regulate each other through ceRNA regulatory mechanism in CRC, which has biological effects on cell proliferation. PMID:28072746

  1. Just-in-time control of Spo0A synthesis in Bacillus subtilis by multiple regulatory mechanisms.

    PubMed

    Chastanet, Arnaud; Losick, Richard

    2011-11-01

    The response regulator Spo0A governs multiple developmental processes in Bacillus subtilis, including most conspicuously sporulation. Spo0A is activated by phosphorylation via a multicomponent phosphorelay. Previous work has shown that the Spo0A protein is not rate limiting for sporulation. Rather, Spo0A is present at high levels in growing cells, rapidly rising to yet higher levels under sporulation-inducing conditions, suggesting that synthesis of the response regulator is subject to a just-in-time control mechanism. Transcription of spo0A is governed by a promoter switching mechanism, involving a vegetative, σ(A)-recognized promoter, P(v), and a sporulation σ(H)-recognized promoter, P(s), that is under phosphorylated Spo0A (Spo0A∼P) control. The spo0A regulatory region also contains four (including one identified in the present work) conserved elements that conform to the consensus binding site for Spo0A∼P binding sites. These are herein designated O(1), O(2), O(3), and O(4) in reverse order of their proximity to the coding sequence. Here we report that O(1) is responsible for repressing P(v) during the transition to stationary phase, that O(2) is responsible for repressing P(s) during growth, that O(3) is responsible for activating P(s) at the start of sporulation, and that O(4) is dispensable for promoter switching. We also report that Spo0A synthesis is subject to a posttranscriptional control mechanism such that translation of mRNAs originating from P(v) is impeded due to RNA secondary structure whereas mRNAs originating from P(s) are fully competent for protein synthesis. We propose that the opposing actions of O(2) and O(3) and the enhanced translatability of mRNAs originating from P(s) create a highly sensitive, self-reinforcing switch that is responsible for producing a burst of Spo0A synthesis at the start of sporulation.

  2. Endocytosis and trafficking of BMP receptors: Regulatory mechanisms for fine-tuning the signaling response in different cellular contexts.

    PubMed

    Ehrlich, Marcelo

    2016-02-01

    Signaling by bone morphogenetic protein (BMP) receptors is regulated at multiple levels in order to ensure proper interpretation of BMP stimuli in different cellular settings. As with other signaling receptors, regulation of the amount of exposed and signaling-competent BMP receptors at the plasma-membrane is predicted to be a key mechanism in governing their signaling output. Currently, the endocytosis of BMP receptors is thought to resemble that of the structurally related transforming growth factor-β (TGF-β) receptors, as BMP receptors are constitutively internalized (independently of ligand binding), with moderate kinetics, and mostly via clathrin-mediated endocytosis. Also similar to TGF-β receptors, BMP receptors are able to signal from the plasma membrane, while internalization to endosomes may have a signal modulating effect. When at the plasma membrane, BMP receptors localize to different membrane domains including cholesterol rich domains and caveolae, suggesting a complex interplay between membrane distribution and internalization. An additional layer of complexity stems from the putative regulatory influence on the signaling and trafficking of BMP receptors exerted by ligand traps and/or co-receptors. Furthermore, the trafficking and signaling of BMP receptors are subject to alterations in cellular context. For example, genetic diseases involving changes in the expression of auxiliary factors of endocytic pathways hamper retrograde BMP signals in neurons, and perturb the regulation of synapse formation. This review summarizes current understanding of the trafficking of BMP receptors and discusses the role of trafficking in regulation of BMP signals. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. Ionic mechanisms of regulatory volume increase (RVI) in the human hepatoma cell-line HepG2.

    PubMed

    Wehner, Frank; Lawonn, Peter; Tinel, Hanna

    2002-03-01

    We studied the effects of hypertonic stress on ion transport and cell volume regulation (regulatory volume increase; RVI) in the human tumor cell-line HepG2. Ion conductances were monitored in intracellular current-clamp measurements with rapid ion-substitutions and in whole-cell patch-clamp recordings; intracellular pH buffering capacity and activation of Na(+)/H(+) antiport were determined fluorometrically; the rates of Na(+)-K(+)-2Cl(-) symport and Na(+)/K(+)-ATPase were quantified on the basis of time-dependent and furosemide- or ouabain-sensitive (86)Rb(+) uptake, respectively; changes in cell volume were recorded by means of confocal laser-scanning microscopy. It was found that hypertonic conditions led to the activation of a cation conductance that was inhibited by Gd(3+), flufenamate as well as amiloride, but not by benzamil or ethyl-isopropyl-amiloride (EIPA). Most likely, this cation conductance was non-selective for Na(+) over K(+). Hypertonic stress did not change K(+) conductance, whereas possible changes in Cl(-) conductance remain ambiguous. The contribution of Na(+)/H(+)antiport to the RVI process appeared to be minor. Under hypertonic conditions an approximately 3.5-fold stimulation of Na(+)-K(+)-2Cl(-)symport was observed but this transporter did not significantly contribute to the overall RVI process. Hypertonic stress did not increase the activity of Na(+)/K(+)-ATPase, which even under isotonic conditions appeared to be working at its limit. It is concluded that the main mechanism in the RVI of HepG2 cells is the activation of a novel non-selective cation conductance. In contrast, there is little if any contribution of K(+) conductance, Na(+)/H(+) antiport, Na(+)-K(+)-2Cl(-) symport, and Na(+)/K(+)-ATPase to this process.

  4. Bacillus subtilis as a platform for molecular characterisation of regulatory mechanisms of Enterococcus faecalis resistance against cell wall antibiotics.

    PubMed

    Fang, Chong; Stiegeler, Emanuel; Cook, Gregory M; Mascher, Thorsten; Gebhard, Susanne

    2014-01-01

    To combat antibiotic resistance of Enterococcus faecalis, a better understanding of the molecular mechanisms, particularly of antibiotic detection, signal transduction and gene regulation is needed. Because molecular studies in this bacterium can be challenging, we aimed at exploiting the genetically highly tractable Gram-positive model organism Bacillus subtilis as a heterologous host. Two fundamentally different regulators of E. faecalis resistance against cell wall antibiotics, the bacitracin sensor BcrR and the vancomycin-sensing two-component system VanSB-VanRB, were produced in B. subtilis and their functions were monitored using target promoters fused to reporter genes (lacZ and luxABCDE). The bacitracin resistance system BcrR-BcrAB of E. faecalis was fully functional in B. subtilis, both regarding regulation of bcrAB expression and resistance mediated by the transporter BcrAB. Removal of intrinsic bacitracin resistance of B. subtilis increased the sensitivity of the system. The lacZ and luxABCDE reporters were found to both offer sensitive detection of promoter induction on solid media, which is useful for screening of large mutant libraries. The VanSB-VanRB system displayed a gradual dose-response behaviour to vancomycin, but only when produced at low levels in the cell. Taken together, our data show that B. subtilis is a well-suited host for the molecular characterization of regulatory systems controlling resistance against cell wall active compounds in E. faecalis. Importantly, B. subtilis facilitates the careful adjustment of expression levels and genetic background required for full functionality of the introduced regulators.

  5. Total Expression and Dual Gene-regulatory Mechanisms Maintained in Deletions and Duplications of the Pcdha Cluster*

    PubMed Central

    Noguchi, Yukiko; Hirabayashi, Takahiro; Katori, Shota; Kawamura, Yoshimi; Sanbo, Makoto; Hirabayashi, Masumi; Kiyonari, Hiroshi; Nakao, Kazuki; Uchimura, Arikuni; Yagi, Takeshi

    2009-01-01

    The clustered protocadherin-α (Pcdha) genes, which are expressed in the vertebrate brain, encode diverse membrane proteins whose functions are involved in axonal projection and in learning and memory. The Pcdha cluster consists of 14 tandemly arranged genes (Pcdha1–Pcdha12, Pcdhac1, and Pcdhac2, from 5′ to 3′). Each first exon (the variable exons) is transcribed from its own promoter, and spliced to the constant exons, which are common to all the Pcdha genes. Cerebellar Purkinje cells show dual expression patterns for Pcdha. In individual Purkinje cells, different sets of the 5′ genes in the cluster, Pcdha1–12, are randomly expressed, whereas both 3′ genes, Pcdhac1 and Pcdhac2, are expressed constitutively. To elucidate the relationship between the genomic structure of the Pcdha cluster and their expression in Purkinje cells, we deleted or duplicated multiple variable exons and analyzed the expression of Pcdha genes in the mouse brain. In all mutant mice, transcript levels of the constant exons and the dual expression patterns were maintained. In the deletion mutants, the missing genes were flexibly compensated by the remaining variable exons. On the other hand, in duplication mutants, the levels of the duplicated genes were trimmed. These results indicate that the Pcdha genes are comprehensively regulated as a cluster unit, and that the regulators that randomly and constitutively drive Pcdha gene expression are intact in the deleted or duplicated mutant alleles. These dual regulatory mechanisms may play important roles in the diversity and fundamental functions of neurons. PMID:19797050

  6. Regulatory T Cells from Colon Cancer Patients Inhibit Effector T-cell Migration through an Adenosine-Dependent Mechanism.

    PubMed

    Sundström, Patrik; Stenstad, Hanna; Langenes, Veronica; Ahlmanner, Filip; Theander, Lisa; Ndah, Tapuka Gordon; Fredin, Kamilla; Börjesson, Lars; Gustavsson, Bengt; Bastid, Jérémy; Quiding-Järbrink, Marianne

    2016-03-01

    T cell-mediated immunity is a major component of antitumor immunity. In order to be efficient, effector T cells must leave the circulation and enter into the tumor tissue. Regulatory T cells (Treg) from gastric cancer patients, but not from healthy volunteers, potently inhibit migration of conventional T cells through activated endothelium. In this study, we compared T cells from colon cancer patients and healthy donors to determine the mechanisms used by Tregs from cancer patients to inhibit conventional T-cell migration. Our results showed that circulating Tregs from cancer patients expressed high levels of CD39, an ectoenzyme mediating hydrolysis of ATP to AMP, as a rate-determining first step in the generation of immunosuppressive adenosine. Tumor-associated Tregs expressed even more CD39, and we therefore examined the importance of adenosine in Treg-mediated inhibition of T-cell transendothelial migration in vitro. Exogenous adenosine significantly reduced migration of conventional T cells from healthy volunteers, and blocking either adenosine receptors or CD39 enzymatic activity during transmigration restored the ability of conventional T cells from cancer patients to migrate. Adenosine did not directly affect T cells or endothelial cells, but reduced the ability of monocytes to activate the endothelium. Taken together, our results indicate that Treg-derived adenosine acts on monocytes and contributes to reduced transendothelial migration of effector T cells into tumors. This effect of Tregs is specific for cancer patients, and our results indicate that Tregs may affect not only T-cell effector functions but also their migration into tumors.

  7. Morphological and molecular characterization of a spontaneously tuberizing potato mutant: an insight into the regulatory mechanisms of tuber induction

    PubMed Central

    Fischer, Lukas; Lipavska, Helena; Hausman, Jean-Francois; Opatrny, Zdenek

    2008-01-01

    Background Tuberization in potato (Solanum tuberosum L.) represents a morphogenetic transition of stolon growth to tuber formation, which is under complex environmental and endogenous regulation. In the present work, we studied the regulatory mechanisms and the role of different morphogenetic factors in a newly isolated potato mutant, which exhibited spontaneous tuberization (ST). The ST mutant was characterized in detail at morphological, physiological and biochemical levels. Results Tuberization of the ST mutant grown in the soil was photoperiod-insensitive; predominantly sessile tubers formed directly from axillary buds even under continuous light. Single-node cuttings of the ST mutant cultured in vitro frequently formed tubers or basal tuber-like swellings instead of normal shoots under conditions routinely used for shoot propagation. The tuberization response of ST cuttings under light was dependent on sucrose, the concentration of which had to exceed certain threshold that inversely correlated with irradiance. Gibberellic acid prevented tuberization of ST cuttings, but failed to restore normal shoot phenotype and caused severe malformations. Carbohydrate analysis showed increased levels of both soluble sugars and starch in ST plants, with altered carbohydrate partitioning and metabolism. Comparative proteomic analysis revealed only a few differences between ST- and wild-type plants, primary amongst which seemed to be the absence of an isoform of manganese-stabilizing protein, a key subunit of photosystem II. Conclusion ST mutant exhibits complex developmental and phenotypic modifications, with features that are typical for plants strongly induced to tuberize. These changes are likely to be related to altered regulation of photosynthesis and carbohydrate metabolism rather than impaired transduction of inhibitory gibberellin or photoperiod-based signals. The effect of gibberellins on tuberization of ST mutant suggests that gibberellins inhibit tuberization

  8. Docking and molecular dynamics simulations of the Fyn-SH3 domain with free and phospholipid bilayer-associated 18.5-kDa myelin basic protein (MBP) - Insights into a non-canonical and fuzzy interaction.

    PubMed

    Bessonov, Kyrylo; Vassall, Kenrick A; Harauz, George

    2017-04-05

    The molecular details of the association between the human Fyn-SH3 domain, and the fragment of 18.5-kDa myelin basic protein (MBP) spanning residues S38-S107 (denoted as xα2-peptide, murine sequence numbering), were studied in silico via docking and molecular dynamics over 50-ns trajectories. The results show that interaction between the two proteins is energetically favorable and heavily-dependent on the MBP proline-rich region (P93-P98) in both aqueous and membrane environments. In aqueous conditions, the xα2-peptide/Fyn-SH3 complex adopts a "sandwich"-like structure. In the membrane context, the xα2-peptide interacts with the Fyn-SH3 domain via the proline-rich region and the β-sheets of Fyn-SH3, with the latter wrapping around the proline-rich region in a form of a clip. Moreover, the simulations corroborate prior experimental evidence of the importance of upstream segments beyond the canonical SH3-ligand. This study thus provides a more-detailed glimpse into the context-dependent interaction dynamics and importance of the β-sheets in Fyn-SH3 and proline-rich region of MBP. This article is protected by copyright. All rights reserved.

  9. Simulating Molecular Mechanisms of the MDM2-Mediated Regulatory Interactions: A Conformational Selection Model of the MDM2 Lid Dynamics

    PubMed Central

    Verkhivker, Gennady M.

    2012-01-01

    Diversity and complexity of MDM2 mechanisms govern its principal function as the cellular antagonist of the p53 tumor suppressor. Structural and biophysical studies have demonstrated that MDM2 binding could be regulated by the dynamics of a pseudo-substrate lid motif. However, these experiments and subsequent computational studies have produced conflicting mechanistic models of MDM2 function and dynamics. We propose a unifying conformational selection model that can reconcile experimental findings and reveal a fundamental role of the lid as a dynamic regulator of MDM2-mediated binding. In this work, structure, dynamics and energetics of apo-MDM2 are studied as a function of posttranslational modifications and length of the lid. We found that the dynamic equilibrium between “closed” and “semi-closed” lid forms may be a fundamental characteristic of MDM2 regulatory interactions, which can be modulated by phosphorylation, phosphomimetic mutation as well as by the lid size. Our results revealed that these factors may regulate p53-MDM2 binding by fine-tuning the thermodynamic equilibrium between preexisting conformational states of apo-MDM2. In agreement with NMR studies, the effect of phosphorylation on MDM2 interactions was more pronounced with the truncated lid variant that favored the thermodynamically dominant closed form. The phosphomimetic mutation S17D may alter the lid dynamics by shifting the thermodynamic equilibrium towards the ensemble of “semi-closed” conformations. The dominant “semi-closed” lid form and weakened dependence on the phosphorylation seen in simulations with the complete lid can provide a rationale for binding of small p53-based mimetics and inhibitors without a direct competition with the lid dynamics. The results suggested that a conformational selection model of preexisting MDM2 states may provide a robust theoretical framework for understanding MDM2 dynamics. Probing biological functions and mechanisms of MDM2 regulation

  10. Awareness of Federal Regulatory Mechanisms Relevant to Community-Engaged Research: Survey of Health Disparities-Oriented NIH-Funded Investigators.

    PubMed

    Fullerton, Stephanie M; Anderson, Emily E; Cowan, Ketch; Malen, Rachel C; Brugge, Doug

    2015-02-01

    Few studies or investigators involved in community-engaged research or community-based participatory research have examined awareness and adoption of federal regulatory mechanisms. We conducted a survey of investigators affiliated with the 10 National Institutes of Health (NIH) Centers for Population Health and Health Disparities. A questionnaire designed to capture experience with the conduct and oversight of community-engaged research, and awareness of pertinent regulatory mechanisms, including Federalwide Assurances (FWAs), Individual Investigator Agreements (IIAs), and Institutional Review Board Authorization Agreements (IAAs), was completed by 101 respondents (68% response rate). Although most were aware of FWAs, only a minority of those surveyed reported knowledge of IAAs and IIAs and even fewer had used them in their research with community partners. Implications for future training and oversight are discussed. © The Author(s) 2014.

  11. Awareness of federal regulatory mechanisms relevant to community-engaged research: survey of health disparities-oriented NIH-funded investigators

    PubMed Central

    Fullerton, Stephanie M.; Anderson, Emily E.; Cowan, Ketch; Malen, Rachel C.; Brugge, Doug

    2015-01-01

    Few studies or investigators involved in community engaged research or community-based participatory research have examined awareness and adoption of federal regulatory mechanisms. We conducted a survey of investigators affiliated with the ten National Institutes of Health (NIH) Centers for Population Health and Health Disparities. A questionnaire designed to capture experience with the conduct and oversight of community engaged research, and awareness of pertinent regulatory mechanisms, including Federalwide Assurances (FWAs), Individual Investigator Agreements (IIAs), and Institutional Review Board Authorization Agreements (IAAs), was completed by 101 respondents (68% response rate). Although most were aware of FWAs, only a minority of those surveyed reported knowledge of IAAs and IIAs and even fewer had used them in their research with community partners. Implications for future training and oversight are discussed. PMID:25742662

  12. A conserved RNA structural element within the hepatitis B virus post-transcriptional regulatory element enhance nuclear export of intronless transcripts and repress the splicing mechanism.

    PubMed

    Visootsat, Akasit; Payungporn, Sunchai; T-Thienprasert, Nattanan P

    2015-12-01

    Hepatitis B virus (HBV) infection is a primary cause of hepatocellular carcinoma and liver cirrhosis worldwide. To develop novel antiviral drugs, a better understanding of HBV gene expression regulation is vital. One important aspect is to understand how HBV hijacks the cellular machinery to export unspliced RNA from the nucleus. The HBV post-transcriptional regulatory element (HBV PRE) has been proposed to be the HBV RNA nuclear export element. However, the function remains controversial, and the core element is unclear. This study, therefore, aimed to identify functional regulatory elements within the HBV PRE and investigate their functions. Using bioinformatics programs based on sequence conservation and conserved RNA secondary structures, three regulatory elements were predicted, namely PRE 1151-1410, PRE 1520-1620 and PRE 1650-1684. PRE 1151-1410 significantly increased intronless and unspliced luciferase activity in both HepG2 and COS-7 cells. Likewise, PRE 1151-1410 significantly elevated intronless and unspliced HBV surface transcripts in liver cancer cells. Moreover, motif analysis predicted that PRE 1151-1410 contains several regulatory motifs. This study reported the roles of PRE 1151-1410 in intronless transcript nuclear export and the splicing mechanism. Additionally, these results provide knowledge in the field of HBV RNA regulation. Moreover, PRE 1151-1410 may be used to enhance the expression of other mRNAs in intronless reporter plasmids.

  13. Combined chromatin and expression analysis reveals specific regulatory mechanisms within cytokine genes in the macrophage early immune response.

    PubMed

    Iglesias, Maria Jesus; Jesus Iglesias, Maria; Reilly, Sarah-Jayne; Emanuelsson, Olof; Sennblad, Bengt; Pirmoradian Najafabadi, Mohammad; Folkersen, Lasse; Mälarstig, Anders; Lagergren, Jens; Eriksson, Per; Hamsten, Anders; Odeberg, Jacob

    2012-01-01

    Macrophages play a critical role in innate immunity, and the expression of early response genes orchestrate much of the initial response of the immune system. Macrophages undergo extensive transcriptional reprogramming in response to inflammatory stimuli such as Lipopolysaccharide (LPS).To identify gene transcription regulation patterns involved in early innate immune responses, we used two genome-wide approaches--gene expression profiling and chromatin immunoprecipitation-sequencing (ChIP-seq) analysis. We examined the effect of 2 hrs LPS stimulation on early gene expression and its relation to chromatin remodeling (H3 acetylation; H3Ac) and promoter binding of Sp1 and RNA polymerase II phosphorylated at serine 5 (S5P RNAPII), which is a marker for transcriptional initiation. Our results indicate novel and alternative gene regulatory mechanisms for certain proinflammatory genes. We identified two groups of up-regulated inflammatory genes with respect to chromatin modification and promoter features. One group, including highly up-regulated genes such as tumor necrosis factor (TNF), was characterized by H3Ac, high CpG content and lack of TATA boxes. The second group, containing inflammatory mediators (interleukins and CCL chemokines), was up-regulated upon LPS stimulation despite lacking H3Ac in their annotated promoters, which were low in CpG content but did contain TATA boxes. Genome-wide analysis showed that few H3Ac peaks were unique to either +/-LPS condition. However, within these, an unpacking/expansion of already existing H3Ac peaks was observed upon LPS stimulation. In contrast, a significant proportion of S5P RNAPII peaks (approx 40%) was unique to either condition. Furthermore, data indicated a large portion of previously unannotated TSSs, particularly in LPS-stimulated macrophages, where only 28% of unique S5P RNAPII peaks overlap annotated promoters. The regulation of the inflammatory response appears to occur in a very specific manner at the chromatin

  14. Combined Chromatin and Expression Analysis Reveals Specific Regulatory Mechanisms within Cytokine Genes in the Macrophage Early Immune Response

    PubMed Central

    Emanuelsson, Olof; Sennblad, Bengt; Pirmoradian Najafabadi, Mohammad; Folkersen, Lasse; Mälarstig, Anders; Lagergren, Jens; Eriksson, Per; Hamsten, Anders; Odeberg, Jacob

    2012-01-01

    Macrophages play a critical role in innate immunity, and the expression of early response genes orchestrate much of the initial response of the immune system. Macrophages undergo extensive transcriptional reprogramming in response to inflammatory stimuli such as Lipopolysaccharide (LPS). To identify gene transcription regulation patterns involved in early innate immune responses, we used two genome-wide approaches - gene expression profiling and chromatin immunoprecipitation-sequencing (ChIP-seq) analysis. We examined the effect of 2 hrs LPS stimulation on early gene expression and its relation to chromatin remodeling (H3 acetylation; H3Ac) and promoter binding of Sp1 and RNA polymerase II phosphorylated at serine 5 (S5P RNAPII), which is a marker for transcriptional initiation. Our results indicate novel and alternative gene regulatory mechanisms for certain proinflammatory genes. We identified two groups of up-regulated inflammatory genes with respect to chromatin modification and promoter features. One group, including highly up-regulated genes such as tumor necrosis factor (TNF), was characterized by H3Ac, high CpG content and lack of TATA boxes. The second group, containing inflammatory mediators (interleukins and CCL chemokines), was up-regulated upon LPS stimulation despite lacking H3Ac in their annotated promoters, which were low in CpG content but did contain TATA boxes. Genome-wide analysis showed that few H3Ac peaks were unique to either +/−LPS condition. However, within these, an unpacking/expansion of already existing H3Ac peaks was observed upon LPS stimulation. In contrast, a significant proportion of S5P RNAPII peaks (approx 40%) was unique to either condition. Furthermore, data indicated a large portion of previously unannotated TSSs, particularly in LPS-stimulated macrophages, where only 28% of unique S5P RNAPII peaks overlap annotated promoters. The regulation of the inflammatory response appears to occur in a very specific manner at the

  15. Phosphorylation of Tyr1214 within VEGFR-2 triggers the recruitment of Nck and activation of Fyn leading to SAPK2/p38 activation and endothelial cell migration in response to VEGF.

    PubMed

    Lamalice, Laurent; Houle, François; Huot, Jacques

    2006-11-10

    VEGFR-2 is the major receptor that regulates the different functions of VEGF in adults. We have previously reported that following VEGF treatment of endothelial cells, VEGFR-2 is phosphorylated on Tyr1214 upstream of the Cdc42-SAPK2/p38-MAPKAP K2 pathway. However, little is known of the earliest molecular events that compose the SAPK2/p38 pathway following VEGFR-2 activation. In this study, we address this question using HA-tagged constructs of either wild-type VEGFR-2 or Y1214F VEGFR-2 mutant in immunoprecipitation assays. We show that the Src family kinase member Fyn, but not c-Src itself, is recruited to VEGFR-2 and is activated in a p-Tyr1214-dependent manner. We also report that the SH2 domain-containing adapter molecule Nck, but not Grb2, is recruited to VEGFR-2 in a p-Tyr1214-dependent manner and that it associates with Fyn. Moreover, PAK-2 is phosphorylated in a Fyn-dependent manner. Using chemical and genetic inhibitors, we show that Fyn activity is required for SAPK2/p38 but not for FAK activation in response to VEGF. In contrast, c-Src permits activation of FAK, but not that of SAPK2/p38. In addition, Fyn is required for stress fiber formation and endothelial cell migration. We propose a model in which Fyn forms a molecular complex with Nck and PAK-2 and suggest that this complex assembles in a p-Tyr1214-dependent manner within VEGFR-2 following VEGF treatment. In turn, this triggers the activation of the SAPK2/p38 MAP kinase module, and promotes stress fiber formation and endothelial cell migration.

  16. Contrasting evolutionary dynamics of the developmental regulator PAX9, among bats, with evidence for a novel post-transcriptional regulatory mechanism.

    PubMed

    Phillips, Caleb D; Butler, Boyd; Fondon, John W; Mantilla-Meluk, Hugo; Baker, Robert J

    2013-01-01

    Morphological evolution can be the result of natural selection favoring modification of developmental signaling pathways. However, little is known about the genetic basis of such phenotypic diversity. Understanding these mechanisms is difficult for numerous reasons, yet studies in model organisms often provide clues about the major developmental pathways involved. The paired-domain gene, PAX9, is known to be a key regulator of development, particularly of the face and teeth. In this study, using a comparative genetics approach, we investigate PAX9 molecular evolution among mammals, focusing on craniofacially diversified (Phyllostomidae) and conserved (Vespertilionidae) bat families, and extend our comparison to other orders of mammal. Open-reading frame analysis disclosed signatures of selection, in which a small percentage of residues vary, and lineages acquire different combinations of variation through recurrent substitution and lineage specific changes. A few instances of convergence for specific residues were observed between morphologically convergent bat lineages. Bioinformatic analysis for unknown PAX9 regulatory motifs indicated a novel post-transcriptional regulatory mechanism involving a Musashi protein. This regulation was assessed through fluorescent reporter assays and gene knockdowns. Results are compatible with the hypothesis that the number of Musashi binding-elements in PAX9 mRNA proportionally regulates protein translation rate. Although a connection between morphology and binding element frequency was not apparent, results indicate this regulation would vary among craniofacially divergent bat species, but be static among conserved species. Under this model, Musashi's regulatory control of alternative human PAX9 isoforms would also vary. The presence of Musashi-binding elements within PAX9 of all mammals examined, chicken, zebrafish, and the fly homolog of PAX9, indicates this regulatory mechanism is ancient, originating basal to much of the

  17. Regulatory mechanisms underlying oil palm fruit mesocarp maturation, ripening, and functional specialization in lipid and carotenoid metabolism.

    PubMed

    Tranbarger, Timothy J; Dussert, Stéphane; Joët, Thierry; Argout, Xavier; Summo, Marilyne; Champion, Antony; Cros, David; Omore, Alphonse; Nouy, Bruno; Morcillo, Fabienne

    2011-06-01

    Fruit provide essential nutrients and vitamins for the human diet. Not only is the lipid-rich fleshy mesocarp tissue of the oil palm (Elaeis guineensis) fruit the main source of edible oil for the world, but it is also the richest dietary source of provitamin A. This study examines the transcriptional basis of these two outstanding metabolic characters in the oil palm mesocarp. Morphological, cellular, biochemical, and hormonal features defined key phases of mesocarp development. A 454 pyrosequencing-derived transcriptome was then assembled for the developmental phases preceding and during maturation and ripening, when high rates of lipid and carotenoid biosynthesis occur. A total of 2,629 contigs with differential representation revealed coordination of metabolic and regulatory components. Further analysis focused on the fatty acid and triacylglycerol assembly pathways and during carotenogenesis. Notably, a contig similar to the Arabidopsis (Arabidopsis thaliana) seed oil transcription factor WRINKLED1 was identified with a transcript profile coordinated with those of several fatty acid biosynthetic genes and the high rates of lipid accumulation, suggesting some common regulatory features between seeds and fruits. We also focused on transcriptional regulatory networks of the fruit, in particular those related to ethylene transcriptional and GLOBOSA/PISTILLATA-like proteins in the mesocarp and a central role for ethylene-coordinated transcriptional regulation of type VII ethylene response factors during ripening. Our results suggest that divergence has occurred in the regulatory components in this monocot fruit compared with those identified in the dicot tomato (Solanum lycopersicum) fleshy fruit model.

  18. Distinct regulatory mechanisms of the human ferritin gene by hypoxia and hypoxia mimetic cobalt chloride at the transcriptional and post-transcriptional levels.

    PubMed

    Huang, Bo-Wen; Miyazawa, Masaki; Tsuji, Yoshiaki

    2014-12-01

    Cobalt chloride has been used as a hypoxia mimetic because it stabilizes hypoxia inducible factor-1α (HIF1-α) and activates gene transcription through a hypoxia responsive element (HRE). However, differences between hypoxia and hypoxia mimetic cobalt chloride in gene regulation remain elusive. Expression of ferritin, the major iron storage protein, is regulated at the transcriptional and posttranscriptional levels through DNA and RNA regulatory elements. Here we demonstrate that hypoxia and cobalt chloride regulate ferritin heavy chain (ferritin H) expression by two distinct mechanisms. Both hypoxia and cobalt chloride increased HIF1-α but a putative HRE in the human ferritin H gene was not activated. Instead, cobalt chloride but not hypoxia activated ferritin H transcription through an antioxidant responsive element (ARE), to which Nrf2 was recruited. Intriguingly, cobalt chloride downregulated ferritin H protein expression while it upregulated other ARE-regulated antioxidant genes in K562 cells. Further characterization demonstrated that cobalt chloride increased interaction between iron regulatory proteins (IRP1 and IRP2) and iron responsive element (IRE) in the 5'UTR of ferritin H mRNA, resulting in translational block of the accumulated ferritin H mRNA. In contrast, hypoxia had marginal effect on ferritin H transcription but increased its translation through decreased IRP1-IRE interaction. These results suggest that hypoxia and hypoxia mimetic cobalt chloride employ distinct regulatory mechanisms through the interplay between DNA and mRNA elements at the transcriptional and post-transcriptional levels. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Distinct Regulatory Mechanisms of the Human Ferritin Gene by Hypoxia and Hypoxia Mimetic Cobalt Chloride at the Transcriptional and Post-transcriptional Levels

    PubMed Central

    Huang, Bo-Wen; Miyazawa, Masaki; Tsuji, Yoshiaki

    2014-01-01

    Cobalt chloride has been used as a hypoxia mimetic because it stabilizes hypoxia inducible factor-1α (HIF1-α) and activates gene transcription through a hypoxia responsive element (HRE). However, differences between hypoxia and hypoxia mimetic cobalt chloride in gene regulation remain elusive. Expression of ferritin, the major iron storage protein, is regulated at the transcriptional and posttranscriptional levels through DNA and RNA regulatory elements. Here we demonstrate that hypoxia and cobalt chloride regulate ferritin heavy chain (ferritin H) expression by two distinct mechanisms. Both hypoxia and cobalt chloride increased HIF1-α but a putative HRE in the human ferritin H gene was not activated. Instead, cobalt chloride but not hypoxia activated ferritin H transcription through an antioxidant responsive element (ARE), to which Nrf2 was recruited. Intriguingly, cobalt chloride downregulated ferritin H protein expression while upregulated other ARE-regulated antioxidant genes in K562 cells. Further characterization demonstrated that cobalt chloride increased interaction between iron regulatory proteins (IRP1 and IRP2) and iron responsive element (IRE) in the 5′UTR of ferritin H mRNA, resulting in translational block of the accumulated ferritin H mRNA. In contrast, hypoxia had marginal effect on ferritin H transcription but increased its translation through decreased IRP1-IRE interaction. These results suggest that hypoxia and hypoxia mimetic cobalt chloride employ distinct regulatory mechanisms through the interplay between DNA and mRNA elements at the transcriptional and post-transcriptional levels. PMID:25172425

  20. Signal transduction in neurons: effects of cellular prion protein on fyn kinase and ERK1/2 kinase.

    PubMed

    Tomasi, Vittorio

    2010-12-16

    It has been reported that cellular prion protein (PrPc) co-localizes with caveolin-1 and participates to signal transduction events by recruiting Fyn kinase. As PrPc is a secreted protein anchored to the outer surface membrane through a glycosylphosphatidylinositol (GPI) anchor (secPrP) and caveolin-1 is located in the inner leaflet of plasma membrane, there is a problem of how the two proteins can physically interact each other and transduce signals. By using the GST-fusion proteins system we observed that PrPc strongly interacts with caveolin-1 scaffolding domain and with a caveolin-1 hydrophilic C-terminal region, but not with the caveolin-1 N-terminal region. In vitro binding experiments were also performed to define the site(s) of PrPc interacting with cav-1. The results are consistent with a participation of PrPc octapeptide repeats motif in the binding to caveolin-1 scaffolding domain. The caveolar localization of PrPc was ascertained by co-immunoprecipitation, by co-localization after flotation in density gradients and by confocal microscopy analysis of PrPc and caveolin-1 distributions in a neuronal cell line (GN11) expressing caveolin-1 at high levels. We observed that, after antibody-mediated cross-linking or copper treatment, PrPc was internalized probably into caveolae. We propose that following translocation from rafts to caveolae or caveolae-like domains, secPrP could interact with caveolin-1 and induce signal transduction events.

  1. α -Actinin TvACTN3 of Trichomonas vaginalis is an RNA-binding protein that could participate in its posttranscriptional iron regulatory mechanism.

    PubMed

    Calla-Choque, Jaeson Santos; Figueroa-Angulo, Elisa Elvira; Ávila-González, Leticia; Arroyo, Rossana

    2014-01-01

    Trichomonas vaginalis is a sexually transmitted flagellated protist parasite responsible for trichomoniasis. This parasite is dependent on high levels of iron, favoring its growth and multiplication. Iron also differentially regulates some trichomonad virulence properties by unknown mechanisms. However, there is evidence to support the existence of gene regulatory mechanisms at the transcriptional and posttranscriptional levels that are mediated by iron concentration in T. vaginalis. Thus, the goal of this study was to identify an RNA-binding protein in T. vaginalis that interacts with the tvcp4 RNA stem-loop structure, which may participate in a posttranscriptional iron regulatory mechanism mediated by RNA-protein interactions. We performed RNA electrophoretic mobility shift assay (REMSA) and supershift, UV cross-linking, Northwestern blot, and western blot (WB) assays using cytoplasmic protein extracts from T. vaginalis with the tvcp4 RNA hairpin structure as a probe. We identified a 135-kDa protein isolated by the UV cross-linking assays as α-actinin 3 (TvACTN3) by MALDI-TOF-MS that was confirmed by LS-MS/MS and de novo sequencing. TvACTN3 is a cytoplasmic protein that specifically binds to hairpin RNA structures from trichomonads and humans when the parasites are grown under iron-depleted conditions. Thus, TvACTN3 could participate in the regulation of gene expression by iron in T. vaginalis through a parallel posttranscriptional mechanism similar to that of the IRE/IRP system.

  2. The Legionella pneumophila genome evolved to accommodate multiple regulatory mechanisms controlled by the CsrA-system

    PubMed Central

    Sahr, Tobias; Rusniok, Christophe; Impens, Francis; Oliva, Giulia; Sismeiro, Odile; Coppée, Jean-Yves

    2017-01-01

    The carbon storage regulator protein CsrA regulates cellular processes post-transcriptionally by binding to target-RNAs altering translation efficiency and/or their stability. Here we identified and analyzed the direct targets of CsrA in the human pathogen Legionella pneumophila. Genome wide transcriptome, proteome and RNA co-immunoprecipitation followed by deep sequencing of a wild type and a csrA mutant strain identified 479 RNAs with potential CsrA interaction sites located in the untranslated and/or coding regions of mRNAs or of known non-coding sRNAs. Further analyses revealed that CsrA exhibits a dual regulatory role in virulence as it affects the expression of the regulators FleQ, LqsR, LetE and RpoS but it also directly regulates the timely expression of over 40 Dot/Icm substrates. CsrA controls its own expression and the stringent response through a regulatory feedback loop as evidenced by its binding to RelA-mRNA and links it to quorum sensing and motility. CsrA is a central player in the carbon, amino acid, fatty acid metabolism and energy transfer and directly affects the biosynthesis of cofactors, vitamins and secondary metabolites. We describe the first L. pneumophila riboswitch, a thiamine pyrophosphate riboswitch whose regulatory impact is fine-tuned by CsrA, and identified a unique regulatory mode of CsrA, the active stabilization of RNA anti-terminator conformations inside a coding sequence preventing Rho-dependent termination of the gap operon through transcriptional polarity effects. This allows L. pneumophila to regulate the pentose phosphate pathway and the glycolysis combined or individually although they share genes in a single operon. Thus the L. pneumophila genome has evolved to acclimate at least five different modes of regulation by CsrA giving it a truly unique position in its life cycle. PMID:28212376

  3. The Legionella pneumophila genome evolved to accommodate multiple regulatory mechanisms controlled by the CsrA-system.

    PubMed

    Sahr, Tobias; Rusniok, Christophe; Impens, Francis; Oliva, Giulia; Sismeiro, Odile; Coppée, Jean-Yves; Buchrieser, Carmen

    2017-02-01

    The carbon storage regulator protein CsrA regulates cellular processes post-transcriptionally by binding to target-RNAs altering translation efficiency and/or their stability. Here we identified and analyzed the direct targets of CsrA in the human pathogen Legionella pneumophila. Genome wide transcriptome, proteome and RNA co-immunoprecipitation followed by deep sequencing of a wild type and a csrA mutant strain identified 479 RNAs with potential CsrA interaction sites located in the untranslated and/or coding regions of mRNAs or of known non-coding sRNAs. Further analyses revealed that CsrA exhibits a dual regulatory role in virulence as it affects the expression of the regulators FleQ, LqsR, LetE and RpoS but it also directly regulates the timely expression of over 40 Dot/Icm substrates. CsrA controls its own expression and the stringent response through a regulatory feedback loop as evidenced by its binding to RelA-mRNA and links it to quorum sensing and motility. CsrA is a central player in the carbon, amino acid, fatty acid metabolism and energy transfer and directly affects the biosynthesis of cofactors, vitamins and secondary metabolites. We describe the first L. pneumophila riboswitch, a thiamine pyrophosphate riboswitch whose regulatory impact is fine-tuned by CsrA, and identified a unique regulatory mode of CsrA, the active stabilization of RNA anti-terminator conformations inside a coding sequence preventing Rho-dependent termination of the gap operon through transcriptional polarity effects. This allows L. pneumophila to regulate the pentose phosphate pathway and the glycolysis combined or individually although they share genes in a single operon. Thus the L. pneumophila genome has evolved to acclimate at least five different modes of regulation by CsrA giving it a truly unique position in its life cycle.

  4. Human regulatory macrophages are potent in suppression of the xenoimmune response via indoleamine-2,3-dioxygenase-involved mechanism(s).

    PubMed

    Guo, Fei; Hu, Min; Huang, Dandan; Zhao, Yuanfei; Heng, Benjamin; Guillemin, Gilles; Lim, Chai K; Hawthorne, Wayne J; Yi, Shounan

    2017-08-02

    For xenotransplantation to truly succeed, we must develop immunomodulatory strategies to suppress the xenoimmune response but by minimizing immunosuppression over the long term. Regulatory macrophages (Mreg) have been shown to suppress polyclonal T-cell proliferation in vitro and prolong allograft survival in vivo. However, the question of whether they are capable of suppressing xenoimmune responses remains unknown. This study assessed the potential of human Mreg to be used as an effective immunomodulatory method in xenotransplantation. CD14+ monocytes selected from human peripheral blood mononuclear cells (PBMC) were cultured with macrophage colony-stimulating factor (M-CSF) for 7 days with IFN-γ added at day 6 for Mreg induction. Mreg phenotyping was performed by flow cytometric analysis, and the in vitro suppressive function was assessed by mixed lymphocyte reaction (MLR) using irradiated pig PBMC as the xenogeneic stimulator cells, human PBMC as responder cells, and autologous Mreg as suppressor cells. To assess mRNA expression of Mreg functional molecules indoleamine-2,3-dioxygenase (IDO), IL-10, inducible nitric oxide synthase (iNOS) and TGF-β were measured by real-time PCR. Supernatants were collected from the MLR cultures for IDO activity assay by high-performance liquid chromatography (HPLC). The effects of the IDO inhibitor 1-D/L-methyl-tryptophan (1-MT), iNOS inhibitor N(G) -monomethyl-l-arginine (L-NMMA), and anti-IFN-γ or anti-TGF-β monoclonal antibody (mAb) treatment on Mreg suppressive capacity were tested from the supernatants of the MLR assays. We demonstrated that induced Mreg with a phenotype of CD14(low) CD16(-/low) CD80(low) CD83(-/low) CD86(+/hi) HLA-DR(+/hi) were capable of suppressing proliferating human PBMC, CD4+, and CD8+ T cells, even at a higher responder:Mreg ratio of 32:1 in a pig-human xenogeneic MLR. The strong suppressive potency of Mreg was further correlated with their upregulated IDO expression and activity. The IDO

  5. Cis- and Trans-Regulatory Mechanisms of Gene Expression in the ASJ Sensory Neuron of Caenorhabditis elegans

    PubMed Central

    González-Barrios, María; Fierro-González, Juan Carlos; Krpelanova, Eva; Mora-Lorca, José Antonio; Pedrajas, José Rafael; Peñate, Xenia; Chavez, Sebastián; Swoboda, Peter; Jansen, Gert; Miranda-Vizuete, Antonio

    2015-01-01

    The identity of a given cell type is determined by the expression of a set of genes sharing common cis-regulatory motifs and being regulated by shared transcription factors. Here, we identify cis and trans regulatory elements that drive gene expression in the bilateral sensory neuron ASJ, located in the head of the nematode Caenorhabditis elegans. For this purpose, we have dissected the promoters of the only two genes so far reported to be exclusively expressed in ASJ, trx-1 and ssu-1. We hereby identify the ASJ motif, a functional cis-regulatory bipartite promoter region composed of two individual 6 bp elements separated by a 3 bp linker. The first element is a 6 bp CG-rich sequence that presumably binds the Sp family member zinc-finger transcription factor SPTF-1. Interestingly, within the C. elegans nervous system SPTF-1 is also found to be expressed only in ASJ neurons where it regulates expression of other genes in these neurons and ASJ cell fate. The second element of the bipartite motif is a 6 bp AT-rich sequence that is predicted to potentially bind a transcription factor of the homeobox family. Together, our findings identify a specific promoter signature and SPTF-1 as a transcription factor that functions as a terminal selector gene to regulate gene expression in C. elegans ASJ sensory neurons. PMID:25769980

  6. Fyn Kinase regulates GluN2B subunit-dominant NMDA receptors in human induced pluripotent stem cell-derived neurons.

    PubMed

    Zhang, Wen-Bo; Ross, P Joel; Tu, YuShan; Wang, Yongqian; Beggs, Simon; Sengar, Ameet S; Ellis, James; Salter, Michael W

    2016-04-04

    NMDA receptor (NMDAR)-mediated fast excitatory neurotransmission is implicated in a broad range of physiological and pathological processes in the mammalian central nervous system. The function and regulation of NMDARs have been extensively studied in neurons from rodents and other non-human species, and in recombinant expression systems. Here, we investigated human NMDARs in situ by using neurons produced by directed differentiation of human induced pluripotent stem cells (iPSCs). The resultant cells showed electrophysiological characteristics demonstrating that they are bona fide neurons. In particular, human iPSC-derived neurons expressed functional ligand-gated ion channels, including NMDARs, AMPA receptors, GABAA receptors, as well as glycine receptors. Pharmacological and electrophysiological properties of NMDAR-mediated currents indicated that these were dominated by receptors containing GluN2B subunits. The NMDAR currents were suppressed by genistein, a broad-spectrum tyrosine kinase inhibitor. The NMDAR currents were also inhibited by a Fyn-interfering peptide, Fyn(39-57), but not a Src-interfering peptide, Src(40-58). Together, these findings are the first evidence that tyrosine phosphorylation regulates the function of NMDARs in human iPSC-derived neurons. Our findings provide a basis for utilizing human iPSC-derived neurons in screening for drugs targeting NMDARs in neurological disorders.

  7. Fyn Kinase regulates GluN2B subunit-dominant NMDA receptors in human induced pluripotent stem cell-derived neurons

    PubMed Central

    Zhang, Wen-Bo; Ross, P. Joel; Tu, YuShan; Wang, Yongqian; Beggs, Simon; Sengar, Ameet S.; Ellis, James; Salter, Michael W.

    2016-01-01

    NMDA receptor (NMDAR)-mediated fast excitatory neurotransmission is implicated in a broad range of physiological and pathological processes in the mammalian central nervous system. The function and regulation of NMDARs have been extensively studied in neurons from rodents and other non-human species, and in recombinant expression systems. Here, we investigated human NMDARs in situ by using neurons produced by directed differentiation of human induced pluripotent stem cells (iPSCs). The resultant cells showed electrophysiological characteristics demonstrating that they are bona fide neurons. In particular, human iPSC-derived neurons expressed functional ligand-gated ion channels, including NMDARs, AMPA receptors, GABAA receptors, as well as glycine receptors. Pharmacological and electrophysiological properties of NMDAR-mediated currents indicated that these were dominated by receptors containing GluN2B subunits. The NMDAR currents were suppressed by genistein, a broad-spectrum tyrosine kinase inhibitor. The NMDAR currents were also inhibited by a Fyn-interfering peptide, Fyn(39–57), but not a Src-interfering peptide, Src(40–58). Together, these findings are the first evidence that tyrosine phosphorylation regulates the function of NMDARs in human iPSC-derived neurons. Our findings provide a basis for utilizing human iPSC-derived neurons in screening for drugs targeting NMDARs in neurological disorders. PMID:27040756

  8. Cellular Prion Protein and Caveolin-1 Interaction in a Neuronal Cell Line Precedes Fyn/Erk 1/2 Signal Transduction

    PubMed Central

    Toni, Mattia; Spisni, Enzo; Griffoni, Cristiana; Santi, Spartaco; Riccio, Massimo; Lenaz, Patrizia; Tomasi, Vittorio

    2006-01-01

    It has been reported that cellular prion protein (PrPc) is enriched in caveolae or caveolae-like domains with caveolin-1 (Cav-1) participating to signal transduction events by Fyn kinase recruitment. By using the Glutathione-S-transferase (GST)-fusion proteins assay, we observed that PrPc strongly interacts in vitro with Cav-1. Thus, we ascertained the PrPc caveolar localization in a hypothalamic neuronal cell line (GN11), by confocal microscopy analysis, flotation on density gradient, and coimmunoprecipitation experiments. Following the anti-PrPc antibody-mediated stimulation of live GN11 cells, we observed that PrPc clustered on plasma membrane domains rich in Cav-1 in which Fyn kinase converged to be activated. After these events, a signaling cascade through p42/44 MAP kinase (Erk 1/2) was triggered, suggesting that following translocations from rafts to caveolae or caveolaelike domains PrPc could interact with Cav-1 and induce signal transduction events. PMID:17489019

  9. PARP-2 and PARP-3 are selectively activated by 5′ phosphorylated DNA breaks through an allosteric regulatory mechanism shared with PARP-1

    PubMed Central

    Langelier, Marie-France; Riccio, Amanda A.; Pascal, John M.

    2014-01-01

    PARP-1, PARP-2 and PARP-3 are DNA-dependent PARPs that localize to DNA damage, synthesize poly(ADP-ribose) (PAR) covalently attached to target proteins including themselves, and thereby recruit repair factors to DNA breaks to increase repair efficiency. PARP-1, PARP-2 and PARP-3 have in common two C-terminal domains—Trp-Gly-Arg (WGR) and catalytic (CAT). In contrast, the N-terminal region (NTR) of PARP-1 is over 500 residues and includes four regulatory domains, whereas PARP-2 and PARP-3 have smaller NTRs (70 and 40 residues, respectively) of unknown structural composition and function. Here, we show that PARP-2 and PARP-3 are preferentially activated by DNA breaks harboring a 5′ phosphate (5′P), suggesting selective activation in response to specific DNA repair intermediates, in particular structures that are competent for DNA ligation. In contrast to PARP-1, the NTRs of PARP-2 and PARP-3 are not strictly required for DNA binding or for DNA-dependent activation. Rather, the WGR domain is the central regulatory domain of PARP-2 and PARP-3. Finally, PARP-1, PARP-2 and PARP-3 share an allosteric regulatory mechanism of DNA-dependent catalytic activation through a local destabilization of the CAT. Collectively, our study provides new insights into the specialization of the DNA-dependent PARPs and their specific roles in DNA repair pathways. PMID:24928857

  10. PARP-2 and PARP-3 are selectively activated by 5' phosphorylated DNA breaks through an allosteric regulatory mechanism shared with PARP-1.

    PubMed

    Langelier, Marie-France; Riccio, Amanda A; Pascal, John M

    2014-07-01

    PARP-1, PARP-2 and PARP-3 are DNA-dependent PARPs that localize to DNA damage, synthesize poly(ADP-ribose) (PAR) covalently attached to target proteins including themselves, and thereby recruit repair factors to DNA breaks to increase repair efficiency. PARP-1, PARP-2 and PARP-3 have in common two C-terminal domains-Trp-Gly-Arg (WGR) and catalytic (CAT). In contrast, the N-terminal region (NTR) of PARP-1 is over 500 residues and includes four regulatory domains, whereas PARP-2 and PARP-3 have smaller NTRs (70 and 40 residues, respectively) of unknown structural composition and function. Here, we show that PARP-2 and PARP-3 are preferentially activated by DNA breaks harboring a 5' phosphate (5'P), suggesting selective activation in response to specific DNA repair intermediates, in particular structures that are competent for DNA ligation. In contrast to PARP-1, the NTRs of PARP-2 and PARP-3 are not strictly required for DNA binding or for DNA-dependent activation. Rather, the WGR domain is the central regulatory domain of PARP-2 and PARP-3. Finally, PARP-1, PARP-2 and PARP-3 share an allosteric regulatory mechanism of DNA-dependent catalytic activation through a local destabilization of the CAT. Collectively, our study provides new insights into the specialization of the DNA-dependent PARPs and their specific roles in DNA repair pathways. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. FarR regulates the farAB-encoded efflux pump of Neisseria gonorrhoeae via an MtrR regulatory mechanism.

    PubMed

    Lee, E-H; Rouquette-Loughlin, C; Folster, J P; Shafer, W M

    2003-12-01

    The farAB operon of Neisseria gonorrhoeae encodes an efflux pump which mediates gonococcal resistance to antibacterial fatty acids. It was previously observed that expression of the farAB operon was positively regulated by MtrR, which is a repressor of the mtrCDE-encoded efflux pump system (E.-H. Lee and W. M. Shafer, Mol. Microbiol. 33:839-845, 1999). This regulation was believed to be indirect since MtrR did not bind to the farAB promoter. In this study, computer analysis of the gonococcal genome sequence database, lacZ reporter fusions, and gel mobility shift assays were used to elucidate the regulatory mechanism by which expression of the farAB operon is modulated by MtrR in gonococci. We identified a regulatory protein belonging to the MarR family of transcriptional repressors and found that it negatively controls expression of farAB by directly binding to the farAB promoter. We designated this regulator FarR to signify its role in regulating the farAB operon. We found that MtrR binds to the farR promoter, thereby repressing farR expression. Hence, MtrR regulates farAB in a positive fashion by modulating farR expression. This MtrR regulatory cascade seems to play an important role in adjusting levels of the FarAB and MtrCDE efflux pumps to prevent their excess expression in gonococci.

  12. Signal Transduction and Regulatory Mechanisms Involved in Control of the σS (RpoS) Subunit of RNA Polymerase

    PubMed Central

    Hengge-Aronis, Regine

    2002-01-01

    The σS (RpoS) subunit of RNA polymerase is the master regulator of the general stress response in Escherichia coli and related bacteria. While rapidly growing cells contain very little σS, exposure to many different stress conditions results in rapid and strong σS induction. Consequently, transcription of numerous σS-dependent genes is activated, many of which encode gene products with stress-protective functions. Multiple signal integration in the control of the cellular σS level is achieved by rpoS transcriptional and translational control as well as by regulated σS proteolysis, with various stress conditions differentially affecting these levels of σS control. Thus, a reduced growth rate results in increased rpoS transcription whereas high osmolarity, low temperature, acidic pH, and some late-log-phase signals stimulate the translation of already present rpoS mRNA. In addition, carbon starvation, high osmolarity, acidic pH, and high temperature result in stabilization of σS, which, under nonstress conditions, is degraded with a half-life of one to several minutes. Important cis-regulatory determinants as well as trans-acting regulatory factors involved at all levels of σS regulation have been identified. rpoS translation is controlled by several proteins (Hfq and HU) and small regulatory RNAs that probably affect the secondary structure of rpoS mRNA. For σS proteolysis, the response regulator RssB is essential. RssB is a specific direct σS recognition factor, whose affinity for σS is modulated by phosphorylation of its receiver domain. RssB delivers σS to the ClpXP protease, where σS is unfolded and completely degraded. This review summarizes our current knowledge about the molecular functions and interactions of these components and tries to establish a framework for further research on the mode of multiple signal input into this complex regulatory system. PMID:12208995

  13. PHLPP2 down regulation influences nuclear Nrf2 stability via Akt-1/Gsk3β/Fyn kinase axis in acetaminophen induced oxidative renal toxicity: Protection accorded by morin.

    PubMed

    Mathur, Alpana; Rizvi, Fatima; Kakkar, Poonam

    2016-03-01

    NF-E2 p45-related factor 2 (Nrf2) is a cap 'n' collar (CNC) basic region-leucine zipper (bZIP) transcription factor that imparts cellular defence against xenobiotic and oxidative stress evoked responses by inducing an array of cytoprotective genes. Essential factors that regulate Nrf2 activity and stability during analgesic nephropathy are incompletely understood. In this study, we demonstrate that acetaminophen (a classic analgesic) posit nephrotoxicity both in vitro and in vivo via PHLPP2 activation. Enhanced PHLPP2 levels down regulate p-Akt by dephosphorylating it at Ser 473 residue leading to Gsk3β activation. APAP subsided Nrf2 nuclear accumulation by activating Gsk3β which phosphorylates Fyn kinase. p-Fyn kinase translocates into the nucleus and phosphorylates Nrf2 (Tyr 568) leading to its nuclear export, ubiquitination and degradation. Therefore, poor prognosis prevails during analgesic nephrotoxicity because of the defects in Akt-1/Gsk3β/Fyn-Nrf2 signaling pathway. Morin, a bioflavonoid given as co- and pre-treatment with acetaminophen significantly prevented the toxicity induced damage by constitutively stabilizing Nrf2 nuclear retention. Diminished Nrf2 levels by APAP overdose imposed severe proximal tubular damage leading to apoptotic cell death. Morin, as a potent Nrf2 inducer accorded protection against acetaminophen induced renal damages by its molecular intervention with Akt-1/Gsk3β/Fyn kinase pathway via PHLPP2 de-activation.

  14. Mass Spectrometric Analysis of TRPM6 and TRPM7 Phosphorylation Reveals Regulatory Mechanisms of the Channel-Kinases

    PubMed Central

    Cai, Na; Bai, Zhiyong; Nanda, Vikas; Runnels, Loren W.

    2017-01-01

    TRPM7 and TRPM6 were the first identified bifunctional channels to contain their own kinase domains, but how these channel-kinases are regulated is poorly understood. Previous studies identified numerous phosphorylation sites on TRPM7, but very little is known about TRPM6 phosphorylation or sites on TRPM7 transphosphorylated by TRPM6. Our mass spectrometric analysis of homomeric and heteromeric TRPM7 and TRPM6 channels identified phosphorylation sites on both proteins, as well as several prominent sites on TRPM7 that are commonly modified through autophosphorylation and transphosphorylation by TRPM6. We conducted a series of amino acid substitution analyses and identified S1777, in TRPM7’s catalytic domain, and S1565, in TRPM7’s exchange domain that mediates kinase dimerization, as potential regulatory sites. The phosphomimetic S1777D substitution disrupted catalytic activity, most likely by causing an electrostatic perturbation at the active site. The S1565D phosphomimetic substitution also inactivated the kinase but did so without interfering with kinase dimerization. Molecular modeling indicates that phosphorylation of S1565 is predicted to structurally affect TRPM7’s functionally conserved N/D loop, which is thought to influence the access of substrate to the active site pocket. We propose that phosphorylation of S1565 within the exchange domain functions as a regulatory switch to control TRPM7 catalytic activity. PMID:28220887

  15. Mass Spectrometric Analysis of TRPM6 and TRPM7 Phosphorylation Reveals Regulatory Mechanisms of the Channel-Kinases.

    PubMed

    Cai, Na; Bai, Zhiyong; Nanda, Vikas; Runnels, Loren W

    2017-02-21

    TRPM7 and TRPM6 were the first identified bifunctional channels to contain their own kinase domains, but how these channel-kinases are regulated is poorly understood. Previous studies identified numerous phosphorylation sites on TRPM7, but very little is known about TRPM6 phosphorylation or sites on TRPM7 transphosphorylated by TRPM6. Our mass spectrometric analysis of homomeric and heteromeric TRPM7 and TRPM6 channels identified phosphorylation sites on both proteins, as well as several prominent sites on TRPM7 that are commonly modified through autophosphorylation and transphosphorylation by TRPM6. We conducted a series of amino acid substitution analyses and identified S1777, in TRPM7's catalytic domain, and S1565, in TRPM7's exchange domain that mediates kinase dimerization, as potential regulatory sites. The phosphomimetic S1777D substitution disrupted catalytic activity, most likely by causing an electrostatic perturbation at the active site. The S1565D phosphomimetic substitution also inactivated the kinase but did so without interfering with kinase dimerization. Molecular modeling indicates that phosphorylation of S1565 is predicted to structurally affect TRPM7's functionally conserved N/D loop, which is thought to influence the access of substrate to the active site pocket. We propose that phosphorylation of S1565 within the exchange domain functions as a regulatory switch to control TRPM7 catalytic activity.

  16. Positive and Negative Regulatory Mechanisms for Fine-Tuning Cellularity and Functions of Medullary Thymic Epithelial Cells

    PubMed Central

    Akiyama, Taishin; Tateishi, Ryosuke; Akiyama, Nobuko; Yoshinaga, Riko; Kobayashi, Tetsuya J.

    2015-01-01

    Self-tolerant T cells and regulatory T cells develop in the thymus. A wide variety of cell–cell interactions in the thymus is required for the differentiation, proliferation, and repertoire selection of T cells. Various secreted and cell surface molecules expressed in thymic epithelial cells (TECs) mediate these processes. Moreover, cytokines expressed by cells of hematopoietic origin regulate the cellularity of TECs. Tumor necrosis factor (TNF) family RANK ligand, lymphotoxin, and CD40 ligand, expressed in T cells and innate lymphoid cells (ILCs), promote the differentiation and proliferation of medullary TECs (mTECs) that play critical roles in the induction of immune tolerance. A recent study suggests that interleukin-22 (IL-22) produced by ILCs promotes regeneration of TECs after irradiation. Intriguingly, tumor growth factor-β and osteoprotegerin limit cellularity of mTECs, thereby attenuating regulatory T cell generation. We will review recent insights into the molecular basis for cell–cell interactions regulating differentiation and proliferation of mTECs and also discuss about a perspective on use of mathematical models for understanding this complicated system. PMID:26441966

  17. Identification of Src, Fyn, and Lyn SH3-binding proteins: implications for a function of SH3 domains.

    PubMed Central

    Weng, Z; Thomas, S M; Rickles, R J; Taylor, J A; Brauer, A W; Seidel-Dugan, C; Michael, W M; Dreyfuss, G; Brugge, J S

    1994-01-01

    Src homology 3 (SH3) domains mediate protein-protein interactions necessary for the coupling of cellular proteins involved in intracellular signal transduction. We previously established solution-binding conditions that allow affinity isolation of Src SH3-binding proteins from cellular extracts (Z. Weng, J. A. Taylor, C. E. Turner, J. S. Brugge, and C. Seidel-Dugan, J. Biol. Chem. 268:14956-14963, 1993). In this report, we identified three of these proteins: Shc, a signaling protein that couples membrane tyrosine kinases with Ras; p62, a protein which can bind to p21rasGAP; and heterogeneous nuclear ribonucleoprotein K, a pre-mRNA-binding protein. All of these proteins contain proline-rich peptide motifs that could serve as SH3 domain ligands, and the binding of these proteins to the Src SH3 domain was inhibited with a proline-rich Src SH3 peptide ligand. These three proteins, as well as most of the other Src SH3 ligands, also bound to the SH3 domains of the closely related protein tyrosine kinases Fyn and Lyn. However, Src- and Lyn-specific SH3-binding proteins were also detected, suggesting subtle differences in the binding specificity of the SH3 domains from these related proteins. Several Src SH3-binding proteins were phosphorylated in Src-transformed cells. The phosphorylation of these proteins was not detected in cells transformed by a mutant variant of Src lacking the SH3 domain, while there was little change in tyrosine phosphorylation of other Src-induced phosphoproteins. In addition, the coprecipitation of v-Src with two tyrosyl-phosphorylated proteins with M(r)s of 62,000 and 130,000 was inhibited by incubation with a Src SH3 peptide ligand, suggesting that the binding of these substrate proteins is dependent on interactions with the SH3 domain. These results strongly suggest a role for the Src SH3 domain in the recruitment of substrates to this protein tyrosine kinase, either through direct interaction with the SH3 domain or indirectly through

  18. NMR binding and crystal structure reveal that intrinsically-unstructured regulatory domain auto-inhibits PAK4 by a mechanism different from that of PAK1.

    PubMed

    Wang, Wei; Lim, Liangzhong; Baskaran, Yohendran; Manser, Ed; Song, Jianxing

    2013-08-16

    Six human PAK members are classified into groups I (PAKs 1-3) and II (PAK4-6). Previously, only group I PAKs were thought to be auto-inhibited but very recently PAK4, the prototype of group II PAKs, has also been shown to be auto-inhibited by its N-terminal regulatory domain. However, the complete auto-inhibitory domain (AID) sequence remains undefined and the mechanism underlying its auto-inhibition is largely elusive. Here, the N-terminal regulatory domain of PAK4 sufficient for auto-inhibiting and binding Cdc42/Rac was characterized to be intrinsically unstructured, but nevertheless we identified the entire AID sequence by NMR. Strikingly, an AID peptide was derived by deleting the binding-unnecessary residues, which has a Kd of 320 nM to the PAK4 catalytic domain. Consequently, the PAK4 crystal structure complexed with the entire AID has been determined, which reveals that the complete kinase cleft is occupied by 20 AID residuescomposed of an N-terminal α-helix and a previously-identified pseudosubstrate motif, thus achieving auto-inhibition. Our study reveals that PAK4 is auto-inhibited by a novel mechanism which is completely different from that for PAK1, thus bearing critical implications for design of inhibitors specific for group II PAKs. Copyright © 2013 Elsevier Inc. All rights reserved.

  19. More than one way to control hair growth: regulatory mechanisms in enterobacteria that affect fimbriae assembled by the chaperone/usher pathway.

    PubMed

    Clegg, Steven; Wilson, Janet; Johnson, Jeremiah

    2011-05-01

    Many gram-negative enterobacteria produce surface-associated fimbriae that facilitate attachment and adherence to eucaryotic cells and tissues. These organelles are believed to play an important role during infection by enabling bacteria to colonize specific niches within their hosts. One class of these fimbriae is assembled using a periplasmic chaperone and membrane-associated scaffolding protein that has been referred to as an usher because of its function in fimbrial biogenesis. The presence of multiple types of fimbriae assembled by the chaperone/usher pathway can be found both within a single bacterial species and also among different genera. One way of controlling fimbrial assembly in these bacteria is at the genetic level by positively or negatively regulating fimbrial gene expression. This minireview considers the mechanisms that have been described to control fimbrial gene expression and uses specific examples to demonstrate both unique and shared properties of such regulatory mechanisms.

  20. More than One Way To Control Hair Growth: Regulatory Mechanisms in Enterobacteria That Affect Fimbriae Assembled by the Chaperone/Usher Pathway▿

    PubMed Central

    Clegg, Steven; Wilson, Janet; Johnson, Jeremiah

    2011-01-01

    Many Gram-negative enterobacteria produce surface-associated fimbriae that facilitate attachment and adherence to eucaryotic cells and tissues. These organelles are believed to play an important role during infection by enabling bacteria to colonize specific niches within their hosts. One class of these fimbriae is assembled using a periplasmic chaperone and membrane-associated scaffolding protein that has been referred to as an usher because of its function in fimbrial biogenesis. The presence of multiple types of fimbriae assembled by the chaperone/usher pathway can be found both within a single bacterial species and also among different genera. One way of controlling fimbrial assembly in these bacteria is at the genetic level by positively or negatively regulating fimbrial gene expression. This minireview considers the mechanisms that have been described to control fimbrial gene expression and uses specific examples to demonstrate both unique and shared properties of such regulatory mechanisms. PMID:21398554

  1. Impact of guided exploration and enactive exploration on self-regulatory mechanisms and information acquisition through electronic search.

    PubMed

    Debowski, S; Wood, R E; Bandura, A

    2001-12-01

    Following instruction in basic skills for electronic search, participants who practiced in a guided exploration mode developed stronger self-efficacy and greater satisfaction than those who practiced in a self-guided exploratory mode. Intrinsic motivation was not affected by exploration mode. On 2 post-training tasks, guided exploration participants produced more effective search strategies. expended less effort, made fewer errors, rejected fewer lines of search, and achieved higher performance. Relative lack of support for self-regulatory factors as mediators of exploration mode impacts was attributed to the uninformative feedback from electronic search, which causes most people to remain at a novice level and to require external guidance for development of self-efficacy and skills. Self-guided learning will be more effective on structured tasks with more informative feedback and for individuals with greater expertise on dynamic tasks.

  2. Whole brain-pituitary in vitro preparation of the transgenic medaka (Oryzias latipes) as a tool for analyzing the differential regulatory mechanisms of LH and FSH release.

    PubMed

    Karigo, Tomomi; Aikawa, Masato; Kondo, Chika; Abe, Hideki; Kanda, Shinji; Oka, Yoshitaka

    2014-02-01

    Two types of gonadotropins, luteinizing hormone (LH) and follicle stimulating hormone (FSH), are important pituitary hormones for sexual maturation and reproduction, and both of them are centrally regulated by gonadotropin-releasing hormone (GnRH) from the hypothalamus. In mammals, these two gonadotropins are secreted from a single type of gonadotrope. The mechanisms of differential regulation by GnRH of the release of two types of gonadotropins with different secretory profiles are still unknown. In teleosts, however, LH and FSH are secreted from separate cellular populations, unlike in mammals. This feature makes them useful for studying the regulatory mechanisms of LH and FSH secretions independently. Here, we generated transgenic medaka lines that express Ca(2+) indicator protein, inverse-pericam, specifically in the LH or FSH cells. We performed cell-type-specific Ca(2+) imaging of LH and FSH cells, respectively, using the whole brain-pituitary preparations of these transgenic fish in which all neural circuits and GnRH neuronal projection to the pituitary are kept intact. LH and FSH cells showed different Ca(2+) responses to GnRH. The results suggest differential regulation mechanisms for LH and FSH release by GnRH. Moreover, we also succeeded in detecting the effect on LH cells of endogenous GnRH peptide, which was released by electrical stimulation of the axons of GnRH1 neurons. Thus, our newly developed experimental model system using the whole brain-pituitary in vitro preparation of the transgenic medaka is a powerful tool for analyzing the differential regulatory mechanisms of the release of LH and FSH by multisynaptic neural inputs to the pituitary.

  3. Induction of Regulatory T Cells as a Novel Mechanism Underlying the Therapeutic Action of Kakkonto, a Traditional Japanese Herbal Medicine, in a Murine Food Allergy Model.

    PubMed

    Yamamoto, Takeshi; Fujiwara, Kanae; Tsubota, Yuma; Kageyama-Yahara, Natsuko; Hayashi, Shusaku; Kadowaki, Makoto

    2016-01-01

    The number of patients with food allergy (FA) has dramatically increased. Although satisfactory drug therapies for FA are not available, we have found that kakkonto, a traditional Japanese herbal medicine, suppressed the occurrence of allergic symptoms in an FA mouse model. Thus, we investigated whether kakkonto could regulate the activation and differentiation of T cells in the colon. BALB/c mice were systemically sensitized and then orally challenged with ovalbumin. FA mice were orally treated with kakkonto. Lamina propria (LP) cells from their colons were isolated and analyzed. Kakkonto significantly reduced the proportion of CD69+ cells and the elevated helper T cell type 2-specific transcription factor GATA-3 mRNA expression in the LP CD4+ T cells, showing that kakkonto has a suppressive effect on the activation and Th2 differentiation of LP effector CD4+ T cells of the FA mouse colon. Furthermore, kakkonto significantly increased the proportion of Foxp3+CD4+ regulatory T cells in the LP CD4+ T cells of the FA mouse colon. Similarly, the number of Foxp3-positive cells was dramatically increased in the colonic mucosa of kakkonto-administered FA mice. However, the pharmacological effect and Foxp3+CD4+ regulatory T cell-inducing ability of kakkonto were not attenuated by the administration of an anti-CD25 monoclonal antibody in the FA model. The induction of Foxp3+CD4+CD25- regulatory T cells in the colon as a novel mechanism underlying the therapeutic action of kakkonto could be utilized for the development of a novel anti-FA drug. © 2016 S. Karger AG, Basel.

  4. Post-translational hydroxylation by 2OG/Fe(II)-dependent oxygenases as a novel regulatory mechanism in bacteria.

    PubMed

    van Staalduinen, Laura M; Jia, Zongchao

    2014-01-01

    Protein hydroxylation has been well-studied in eukaryotic systems. The structural importance of hydroxylation of specific proline and lysine residues during collagen biosynthesis is well established. Recently, key roles for post-translational hydroxylation in signaling and degradation pathways have been discovered. The function of hydroxylation in signaling is highlighted by its role in the hypoxic response of eukaryotic cells, where oxygen dependent hydroxylation of the hypoxia inducible transcription factor both targets it for degradation and blocks its activation. In contrast, the role of protein hydroxylation has been largely understudied in prokaryotes. Recently, an evolutionarily conserved class of ribosomal oxygenases (ROX) that catalyze the hydroxylation of specific residues in the ribosome has been identified in bacteria. ROX activity has been linked to cell growth, and has been found to have a direct impact on bulk protein translation. This discovery of ribosomal protein hydroxylation in bacteria could lead to new therapeutic targets for regulating bacterial growth, as well as, shed light on new prokaryotic hydroxylation signaling pathways. In this review, recent structural and functional studies will be highlighted and discussed, underscoring the regulatory potential of post-translational hydroxylation in bacteria.

  5. Mechanisms by Which B Cells and Regulatory T Cells Influence Development of Murine Organ-Specific Autoimmune Diseases

    PubMed Central

    Ellis, Jason S.; Braley-Mullen, Helen

    2017-01-01

    Experiments with B cell-deficient (B−/−) mice indicate that a number of autoimmune diseases require B cells in addition to T cells for their development. Using B−/− Non-obese diabetic (NOD) and NOD.H-2h4 mice, we demonstrated that development of spontaneous autoimmune thyroiditis (SAT), Sjogren’s syndrome and diabetes do not develop in B−/− mice, whereas all three diseases develop in B cell-positive wild-type (WT) mice. B cells are required early in life, since reconstitution of adult mice with B cells or autoantibodies did not restore their ability to develop disease. B cells function as important antigen presenting cells (APC) to initiate activation of autoreactive CD4+ effector T cells. If B cells are absent or greatly reduced in number, other APC will present the antigen, such that Treg are preferentially activated and effector T cells are not activated. In these situations, B−/− or B cell-depleted mice develop the autoimmune disease when T regulatory cells (Treg) are transiently depleted. This review focuses on how B cells influence Treg activation and function, and briefly considers factors that influence the effectiveness of B cell depletion for treatment of autoimmune diseases. PMID:28134752

  6. Allergic contact dermatitis: epidemiology, molecular mechanisms, in vitro methods and regulatory aspects. Current knowledge assembled at an international workshop at BfR, Germany.

    PubMed

    Peiser, M; Tralau, T; Heidler, J; Api, A M; Arts, J H E; Basketter, D A; English, J; Diepgen, T L; Fuhlbrigge, R C; Gaspari, A A; Johansen, J D; Karlberg, A T; Kimber, I; Lepoittevin, J P; Liebsch, M; Maibach, H I; Martin, S F; Merk, H F; Platzek, T; Rustemeyer, T; Schnuch, A; Vandebriel, R J; White, I R; Luch, A

    2012-03-01

    Contact allergies are complex diseases, and one of the important challenges for public health and immunology. The German 'Federal Institute for Risk Assessment' hosted an 'International Workshop on Contact Dermatitis'. The scope of the workshop was to discuss new discoveries and developments in the field of contact dermatitis. This included the epidemiology and molecular biology of contact allergy, as well as the development of new in vitro methods. Furthermore, it considered regulatory aspects aiming to reduce exposure to contact sensitisers. An estimated 15-20% of the general population suffers from contact allergy. Workplace exposure, age, sex, use of consumer products and genetic predispositions were identified as the most important risk factors. Research highlights included: advances in understanding of immune responses to contact sensitisers, the importance of autoxidation or enzyme-mediated oxidation for the activation of chemicals, the mechanisms through which hapten-protein conjugates are formed and the development of novel in vitro strategies for the identification of skin-sensitising chemicals. Dendritic cell cultures and structure-activity relationships are being developed to identify potential contact allergens. However, the local lymph node assay (LLNA) presently remains the validated method of choice for hazard identification and characterisation. At the workshop the use of the LLNA for regulatory purposes and for quantitative risk assessment was also discussed.

  7. Structure of a Construct of a Human Poly(C)-binding Protein Containing the First and Second KH Domains Reveals Insights into Its Regulatory Mechanisms*

    PubMed Central

    Du, Zhihua; Fenn, Sebastian; Tjhen, Richard; James, Thomas L.

    2008-01-01

    Poly(C)-binding proteins (PCBPs) are important regulatory proteins that contain three KH (hnRNP K homology) domains. Binding poly(C) D/RNA sequences via KH domains is essential for multiple PCBP functions. To reveal the basis for PCBP-D/RNA interactions and function, we determined the structure of a construct containing the first two domains (KH1-KH2) of human PCBP2 by NMR. KH1 and KH2 form an intramolecular pseudodimer. The large hydrophobic dimerization surface of each KH domain is on the side opposite the D/RNA binding interface. Chemical shift mapping indicates both domains bind poly(C) DNA motifs without disrupting the KH1-KH2 interaction. Spectral comparison of KH1-KH2, KH3, and full-length PCBP2 constructs suggests that the KH1-KH2 pseudodimer forms, but KH3 does not interact with other parts of the protein. From NMR studies and modeling, we propose possible modes of cooperative binding tandem poly(C) motifs by the KH domains. D/RNA binding may induce pseudodimer dissociation or stabilize dissociated KH1 and KH2, making protein interaction surfaces available to PCBP-binding partners. This conformational change may represent a regulatory mechanism linking D/RNA binding to PCBP functions. PMID:18701464

  8. Inference of the Arabidopsis Lateral Root Gene Regulatory Network Suggests a Bifurcation Mechanism That Defines Primordia Flanking and Central Zones[OPEN

    PubMed Central

    Lavenus, Julien; Goh, Tatsuaki; Guyomarc’h, Soazig; Hill, Kristine; Lucas, Mikael; Voß, Ute; Kenobi, Kim; Wilson, Michael H.; Farcot, Etienne; Hagen, Gretchen; Guilfoyle, Thomas J.; Fukaki, Hidehiro; Laplaze, Laurent; Bennett, Malcolm J.

    2015-01-01

    A large number of genes involved in lateral root (LR) organogenesis have been identified over the last decade using forward and reverse genetic approaches in Arabidopsis thaliana. Nevertheless, how these genes interact to form a LR regulatory network largely remains to be elucidated. In this study, we developed a time-delay correlation algorithm (TDCor) to infer the gene regulatory network (GRN) controlling LR primordium initiation and patterning in Arabidopsis from a time-series transcriptomic data set. The predicted network topology links the very early-activated genes involved in LR initiation to later expressed cell identity markers through a multistep genetic cascade exhibiting both positive and negative feedback loops. The predictions were tested for the key transcriptional regulator AUXIN RESPONSE FACTOR7 node, and over 70% of its targets were validated experimentally. Intriguingly, the predicted GRN revealed a mutual inhibition between the ARF7 and ARF5 modules that would control an early bifurcation between two cell fates. Analyses of the expression pattern of ARF7 and ARF5 targets suggest that this patterning mechanism controls flanking and central zone specification in Arabidopsis LR primordia. PMID:25944102

  9. miRTrail--a comprehensive webserver for analyzing gene and miRNA patterns to enhance the understanding of regulatory mechanisms in diseases.

    PubMed

    Laczny, Cedric; Leidinger, Petra; Haas, Jan; Ludwig, Nicole; Backes, Christina; Gerasch, Andreas; Kaufmann, Michael; Vogel, Britta; Katus, Hugo A; Meder, Benjamin; Stähler, Cord; Meese, Eckart; Lenhof, Hans-Peter; Keller, Andreas

    2012-02-22

    Expression profiling provides new insights into regulatory and metabolic processes and in particular into pathogenic mechanisms associated with diseases. Besides genes, non-coding transcripts as microRNAs (miRNAs) gained increasing relevance in the last decade. To understand the regulatory processes of miRNAs on genes, integrative computer-aided approaches are essential, especially in the light of complex human diseases as cancer. Here, we present miRTrail, an integrative tool that allows for performing comprehensive analyses of interactions of genes and miRNAs based on expression profiles. The integrated analysis of mRNA and miRNA data should generate more robust and reliable results on deregulated pathogenic processes and may also offer novel insights into the regulatory interactions between miRNAs and genes. Our web-server excels in carrying out gene sets analysis, analysis of miRNA sets as well as the combination of both in a systems biology approach. To this end, miRTrail integrates information on 20.000 genes, almost 1.000 miRNAs, and roughly 280.000 putative interactions, for Homo sapiens and accordingly for Mus musculus and Danio rerio. The well-established, classical Chi-squared test is one of the central techniques of our tool for the joint consideration of miRNAs and their targets. For interactively visualizing obtained results, it relies on the network analyzers and viewers BiNA or Cytoscape-web, also enabling direct access to relevant literature. We demonstrated the potential of miRTrail by applying our tool to mRNA and miRNA data of malignant melanoma. MiRTrail identified several deregulated miRNAs that target deregulated mRNAs including miRNAs hsa-miR-23b and hsa-miR-223, which target the highest numbers of deregulated mRNAs and regulate the pathway "basal cell carcinoma". In addition, both miRNAs target genes like PTCH1 and RASA1 that are involved in many oncogenic processes. The application on melanoma samples demonstrates that the mi

  10. Functional anatomy and ion regulatory mechanisms of the antennal gland in a semi-terrestrial crab, Ocypode stimpsoni

    PubMed Central

    Tsai, Jyuan-Ru; Lin, Hui-Chen

    2014-01-01

    ABSTRACT Brachyuran crabs from diverse habitats show great differences in their osmoregulatory processes, especially in terms of the structural and physiological characteristics of the osmoregulatory organs. In crustaceans, the antennal glands are known to be important in osmoregulation, and they play a functional role analogous to that of the vertebrate kidney. Nevertheless, the detailed structure and function of the antennal glands in different species have rarely been described. The aim of this study is to investigate the role of the antennal gland in ion regulation by examining the ultrastructure of the cells and the distribution of the ion regulatory proteins in each cell type in the antennal gland of a semi-terrestrial crab. The results showed that Na+, K+-ATPase activity significantly increased in the antennal gland after a 4-day acclimation in dilute seawater and returned to its original (day 0) level after 7 days. Three major types of cells were identified in the antennal gland, including coelomic cells (COEs), labyrinthine cells (LBRs) and end-labyrinthine cells (ELBRs). The proximal tubular region (PT) and distal tubular region (DT) of the antennal gland consist of LBRs and COEs, whereas the end tubular region (ET) consists of all three types of cells, with fewer COEs and more ELBRs. We found a non-uniform distribution of NKA immunoreactivity, with increasing intensity from the proximal to the distal regions of the antennal gland. We summarise our study with a proposed model for the urine reprocessing pathway and the role of each cell type or segment of the antennal gland. PMID:24795144

  11. Autophagy Regulatory Network — A systems-level bioinformatics resource for studying the mechanism and regulation of autophagy

    PubMed Central

    Türei, Dénes; Földvári-Nagy, László; Fazekas, Dávid; Módos, Dezső; Kubisch, János; Kadlecsik, Tamás; Demeter, Amanda; Lenti, Katalin; Csermely, Péter; Vellai, Tibor; Korcsmáros, Tamás

    2015-01-01

    Autophagy is a complex cellular process having multiple roles, depending on tissue, physiological, or pathological conditions. Major post-translational regulators of autophagy are well known, however, they have not yet been collected comprehensively. The precise and context-dependent regulation of autophagy necessitates additional regulators, including transcriptional and post-transcriptional components that are listed in various datasets. Prompted by the lack of systems-level autophagy-related information, we manually collected the literature and integrated external resources to gain a high coverage autophagy database. We developed an online resource, Autophagy Regulatory Network (ARN; http://autophagy-regulation.org), to provide an integrated and systems-level database for autophagy research. ARN contains manually curated, imported, and predicted interactions of autophagy components (1,485 proteins with 4,013 interactions) in humans. We listed 413 transcription factors and 386 miRNAs that could regulate autophagy components or their protein regulators. We also connected the above-mentioned autophagy components and regulators with signaling pathways from the SignaLink 2 resource. The user-friendly website of ARN allows researchers without computational background to search, browse, and download the database. The database can be downloaded in SQL, CSV, BioPAX, SBML, PSI-MI, and in a Cytoscape CYS file formats. ARN has the potential to facilitate the experimental validation of novel autophagy components and regulators. In addition, ARN helps the investigation of transcription factors, miRNAs and signaling pathways implicated in the control of the autophagic pathway. The list of such known and predicted regulators could be important in pharmacological attempts against cancer and neurodegenerative diseases. PMID:25635527

  12. “Curcumin, the King of Spices”: Epigenetic Regulatory Mechanisms in the Prevention of Cancer, Neurological, and Inflammatory Diseases

    PubMed Central

    Boyanapalli, Sarandeep S. S.

    2015-01-01

    Curcumin (diferuloylmethane), a polyphenolic compound, is a component of Curcuma longa, commonly known as turmeric. It is a well-known anti-inflammatory, anti-oxidative, and anti-lipidemic agent and has recently been shown to modulate several diseases via epigenetic regulation. Many recent studies have demonstrated the role of epigenetic inactivation of pivotal genes that regulate human pathologies, such as neurocognitive disorders, inflammation, obesity, and cancers. Epigenetic changes involve changes in DNA methylation, histone modifications, or altered microRNA expression patterns which are known to be interconnected and play a key role in tumor progression and failure of conventional chemotherapy. The majority of epigenetic changes are influenced by lifestyle and diets. In this regard, dietary phytochemicals as dietary supplements have emerged as a promising source that are able to reverse these epigenetic alterations, to actively regulate gene expression and molecular targets that are known to promote tumorigenesis, and also to prevent age-related diseases through epigenetic modifications. There have been several studies which reported the role of curcumin as an epigenetic regulator in neurological disorders, inflammation, and in diabetes apart from cancers. The epigenetic regulatory roles of curcumin include (1) inhibition of DNA methyltransferases (DNMTs), which has been well defined from the recent studies on its function as a DNA hypomethylating agent; (2) regulation of histone modifications via regulation of histone acetyltransferases (HATs) and histone deacetylases (HDACs); and (3) regulation of micro RNAs (miRNA). This review summarizes the current knowledge on the effect of curcumin in the treatment and/or prevention of inflammation, neurodegenerative diseases, and cancers by regulating histone deacetylases, histone acetyltransferases, and DNA methyltransferases. PMID:26457241

  13. Control of liver size by RNAi-mediated multiplex knockdown and its application for discovery of regulatory mechanisms

    PubMed Central

    Yin, Hao; Bogorad, Roman L.; Barnes, Carmen; Walsha, Stephen; Zhuang, Iris; Nonaka, Hidenori; Ruda, Vera; Kuchimanchi, Satya; Nechev, Lubomir; Akinc, Akin; Xue, Wen; Zerial, Marino; Langer, Robert; Anderson, Daniel G.; Koteliansky, Victor

    2017-01-01

    Background and aims The Hippo pathway controls organ size through a negative regulation of the transcription co-activator Yap1. The overexpression of hyperactive mutant Yap1 or deletion of key components in the Hippo pathway leads to increased organ size in different species. Analysis of interactions of this pathway with other cellular signals corroborating organ size control is limited in part due to the difficulties associated with development of rodent models. Methods Here, we develop a new model of reversible induction of the liver size in mice using siRNA-nanoparticles targeting two kinases of Hippo pathway, namely, mammalian Ste20 family kinases 1 and 2 (Mst1 and Mst2), and an upstream regulator, neurofibromatosis type II (NF2). Results The triple siRNAs nanoparticle-induced hepatomegaly in mice phenocopies one observed with Mst1-/- Mst2-/- liver-specific depletion, as shown by extensive proliferation of hepatocytes and activation of Yap1. The simultaneous co-treatment with a fourth siRNA nanoparticle against Yap1 fully blocked the liver growth. Hippo pathway-induced liver enlargement is associated with p53 activation, evidenced by its accumulation in the nuclei and upregulation of its target genes. Moreover, injections of the triple siRNAs nanoparticle in p53LSL/LSL mice shows that livers lacking p53 expression grow faster and exceed the size of livers in p53 wild type animals, indicating a role of p53 in controlling Yap1-induced liver growth. Conclusion Our data show that siRNA-nanoparticulate manipulation of gene expression can provide the reversible control of organ size in adult animals, which presents a new avenue for the investigation of complex regulatory networks in liver. PMID:26658687

  14. Potential of acute phase proteins as predictor of postpartum uterine infections during transition period and its regulatory mechanism in dairy cattle

    PubMed Central

    Manimaran, A.; Kumaresan, A.; Jeyakumar, S.; Mohanty, T. K.; Sejian, V.; Kumar, Narender; Sreela, L.; Prakash, M. Arul; Mooventhan, P.; Anantharaj, A.; Das, D. N.

    2016-01-01

    Among the various systemic reactions against infection or injury, the acute phase response is the cascade of reaction and mostly coordinated by cytokines-mediated acute phase proteins (APPs) production. Since APPs are sensitive innate immune molecules, they are useful for early detection of inflammation in bovines and believed to be better discriminators than routine hematological parameters. Therefore, the possibility of using APPs as a diagnostic and prognostic marker of inflammation in major bovine health disorders including postpartum uterine infection has been explored by many workers. In this review, we discussed specifically importance of postpartum uterine infection, the role of energy balance in uterine infections and potential of APPs as a predictor of postpartum uterine infections during the transition period and its regulatory mechanism in dairy cattle. PMID:27051191

  15. Potential of acute phase proteins as predictor of postpartum uterine infections during transition period and its regulatory mechanism in dairy cattle.

    PubMed

    Manimaran, A; Kumaresan, A; Jeyakumar, S; Mohanty, T K; Sejian, V; Kumar, Narender; Sreela, L; Prakash, M Arul; Mooventhan, P; Anantharaj, A; Das, D N

    2016-01-01

    Among the various systemic reactions against infection or injury, the acute phase response is the cascade of reaction and mostly coordinated by cytokines-mediated acute phase proteins (APPs) production. Since APPs are sensitive innate immune molecules, they are useful for early detection of inflammation in bovines and believed to be better discriminators than routine hematological parameters. Therefore, the possibility of using APPs as a diagnostic and prognostic marker of inflammation in major bovine health disorders including postpartum uterine infection has been explored by many workers. In this review, we discussed specifically importance of postpartum uterine infection, the role of energy balance in uterine infections and potential of APPs as a predictor of postpartum uterine infections during the transition period and its regulatory mechanism in dairy cattle.

  16. Crosstalk between bone marrow-derived mesenchymal stem cells and regulatory T cells through a glucocorticoid-induced leucine zipper/developmental endothelial locus-1-dependent mechanism

    PubMed Central

    Yang, Nianlan; Baban, Babak; Isales, Carlos M.; Shi, Xing-Ming

    2015-01-01

    Bone marrow is a reservoir for regulatory T (Treg) cells, but how Treg cells are regulated in that environment remains poorly understood. We show that expression of glucocorticoid (GC)-induced leucine zipper (GILZ) in bone marrow mesenchymal lineage cells or bone marrow-derived mesenchymal stem cells (BMSCs) increases the production of Treg cells via a mechanism involving the up-regulation of developmental endothelial locus-1 (Del-1), an endogenous leukocyte-endothelial adhesion inhibitor. We found that the expression of Del-1 is increased ∼4-fold in the bone tissues of GILZ transgenic (Tg) mice, and this increase is coupled with a significant increase in the production of IL-10 (2.80 vs. 0.83) and decrease in the production of IL-6 (0.80 vs. 2.33) and IL-12 (0.25 vs. 1.67). We also show that GILZ-expressing BMSCs present antigen in a way that favors Treg cells. These results indicate that GILZ plays a critical role mediating the crosstalk between BMSCs and Treg in the bone marrow microenvironment. These data, together with our previous findings that overexpression of GILZ in BMSCs antagonizes TNF-α-elicited inflammatory responses, suggest that GILZ plays important roles in bone-immune cell communication and BMSC immune suppressive functions.—Yang, N., Baban, B., Isales, C. M., Shi, X.-M. Crosstalk between bone marrow-derived mesenchymal stem cells and regulatory T cells through a glucocorticoid-induced leucine zipper/developmental endothelial locus-1-dependent mechanism. PMID:26038125

  17. Equine CD4+ CD25high T cells exhibit regulatory activity by close contact and cytokine-dependent mechanisms in vitro

    PubMed Central

    Hamza, Eman; Gerber, Vinzenz; Steinbach, Falko; Marti, Eliane

    2011-01-01

    Horses are particularly prone to allergic and autoimmune diseases, but little information about equine regulatory T cells (Treg) is currently available. The aim of this study therefore was to investigate the existence of CD4+ Treg cells in horses, determine their suppressive function as well as their mechanism of action. Freshly isolated peripheral blood mononuclear cells (PBMC) from healthy horses were examined for CD4, CD25 and forkhead box P3 (FoxP3) expression. We show that equine FoxP3 is expressed constitutively by a population of CD4+ CD25+ T cells, mainly in the CD4+ CD25high subpopulation. Proliferation of CD4+ CD25− sorted cells stimulated with irradiated allogenic PBMC was significantly suppressed in co-culture with CD4+ CD25high sorted cells in a dose-dependent manner. The mechanism of suppression by the CD4+ CD25high cell population is mediated by close contact as well as interleukin (IL)-10 and transforming growth factor-β1 (TGF-β1) and probably other factors. In addition, we studied the in vitro induction of CD4+ Treg and their characteristics compared to those of freshly isolated CD4+ Treg cells. Upon stimulation with a combination of concanavalin A, TGF-β1 and IL-2, CD4+ CD25+ T cells which express FoxP3 and have suppressive capability were induced from CD4+ CD25− cells. The induced CD4+ CD25high express higher levels of IL-10 and TGF-β1 mRNA compared to the freshly isolated ones. Thus, in horses as in man, the circulating CD4+ CD25high subpopulation contains natural Treg cells and functional Treg can be induced in vitro upon appropriate stimulation. Our study provides the first evidence of the regulatory function of CD4+ CD25+ cells in horses and offers insights into ex vivo manipulation of Treg cells. PMID:21977999

  18. Studies of the lethargic (lh/lh) mouse model of absence seizures: regulatory mechanisms and identification of the lh gene.

    PubMed

    Hosford, D A; Lin, F H; Wang, Y; Caddick, S J; Rees, M; Parkinson, N J; Barclay, J; Cox, R D; Gardiner, R M; Hosford, D A; Denton, P; Wang, Y; Seldin, M F; Chen, B

    1999-01-01

    To understand the cellular and molecular mechanisms that underlie generalized absence seizures sufficiently well to design rational, efficacious new therapies for patients, it is necessary to turn to animal models to gain insights into these mechanisms. The lethargic (lh/lh) mutant mouse expresses spontaneous absence seizures that share behavioral, electrographic, and anticonvulsant profiles with absence seizures in patients. This validates its use to study the mechanisms that underlie absence seizures. This chapter discusses two scientific approaches that involve the use of lh/lh mice. The first part of the chapter discusses neurobiologic approaches used to investigate critical mechanisms that regulate the synchronized burst firing within the thalamocortical network that generates absence seizures. Two of these critical mechanisms have been studied in detail with lh/lh mice. The first critical mechanism involves the required activation of gamma-aminobutyric acid B (GABAB) receptors to generate absence seizures. Because the numbers of GABAB receptors are increased in thalamocortical populations among lh/lh mice compared with littermates without epilepsy, these receptors appear to play a pathophysiologic role in the expression of absence seizures among lh/lh mice. Moreover, there may be a role for GABAB receptors in the generation of absence seizures among humans, because administration of compounds that activate GABAB receptors can produce absence seizures among humans. These findings suggest that GABAB receptor antagonists may represent a new class of antiabsence compounds that will be efficacious against absence seizures among patients. A second critical mechanism that regulates generation of absence seizures involves GABAA receptors in the nucleus reticularis thalami (NRT), a nucleus that sends GABA-ergic afferents to thalamic relay nuclei. Activation of GABAA receptors in the NRT appears to suppress the generation of absence seizures among lh/lh mice and in

  19. Robustness and evolvability in natural chemical resistance: identification of novel systems properties, biochemical mechanisms and regulatory interactions.

    PubMed

    Venancio, Thiago M; Balaji, S; Geetha, S; Aravind, L

    2010-08-01

    A vast amount of data on the natural resistance of Saccharomyces cerevisiae to a diverse array of chemicals has been generated over the past decade (chemical genetics). We endeavored to use this data to better characterize the "systems" level properties of this phenomenon. By collating data from over 30 different genome-scale studies on growth of gene deletion mutants in presence of diverse chemicals, we assembled the largest currently available gene-chemical network. We also derived a second gene-gene network that links genes with significantly overlapping chemical-genetic profiles. We analyzed properties of these networks and investigated their significance by overlaying various sources of information, such as presence of TATA boxes in their promoters (which typically correlate with transcriptional noise), association with TFIID or SAGA, and propensity to function as phenotypic capacitors. We further combined these networks with ubiquitin and protein kinase-substrate networks to understand chemical tolerance in the context of major post-translational regulatory processes. Hubs in the gene-chemical network (multidrug resistance genes) are notably enriched for phenotypic capacitors (buffers against phenotypic variation), suggesting the generality of these players in buffering mechanistically unrelated deleterious forces impinging on the cell. More strikingly, analysis of the gene-gene network derived from the gene-chemical network uncovered another set of genes that appear to function in providing chemical tolerance in a cooperative manner. These appear to be enriched in lineage-specific and rapidly diverging members that also show a corresponding tendency for SAGA-dependent regulation, evolutionary divergence and noisy expression patterns. This set represents a previously underappreciated component of the chemical response that enables cells to explore alternative survival strategies. Thus, systems robustness and evolvability are simultaneously active as general

  20. Probing the chemical mechanism and critical regulatory amino acid residues of Drosophila melanogaster arylalkylamine N-acyltransferase like 2.

    PubMed

    Dempsey, Daniel R; Carpenter, Anne-Marie; Ospina, Santiago Rodriguez; Merkler, David J

    2015-11-01

    Arylalkylamine N-acyltransferase like 2 (AANATL2) catalyzes the formation of N-acylarylalkylamides from the corresponding acyl-CoA and arylalkylamine. The N-acylation of biogenic amines in Drosophila melanogaster is a critical step for the inactivation of neurotransmitters, cuticle sclerotization, and melatonin biosynthesis. In addition, D. melanogaster has been used as a model system to evaluate the biosynthesis of fatty acid amides: a family of potent cell signaling lipids. We have previously showed that AANATL2 catalyzes the formation of N-acylarylakylamides, including long-chain N-acylserotonins and N-acyldopamines. Herein, we define the kinetic mechanism for AANATL2 as an ordered sequential mechanism with acetyl-CoA binding first followed by tyramine to generate the ternary complex prior to catalysis. Bell shaped kcat,app - acetyl-CoA and (kcat/Km)app - acetyl-CoA pH-rate profiles identified two apparent pKa,app values of ∼7.4 and ∼8.9 that are critical to catalysis, suggesting the AANATL2-catalyzed formation of N-acetyltyramine occurs through an acid/base chemical mechanism. Site-directed mutagenesis of a conserved glutamate that corresponds to the catalytic base for other D. melanogaster AANATL enzymes did not produce a substantial depression in the kcat,app value nor did it abolish the pKa,app value attributed to the general base in catalysis (pKa ∼7.4). These data suggest that AANATL2 catalyzes the formation of N-acylarylalkylamides using either different catalytic residues or a different chemical mechanism relative to other D. melanogaster AANATL enzymes. In addition, we constructed other site-directed mutants of AANATL2 to help define the role of targeted amino acids in substrate binding and/or enzyme catalysis.

  1. Immune-Regulatory Mechanisms of Classical and Experimental Multiple Sclerosis Drugs: A Special Focus on Helminth-Derived Treatments.

    PubMed

    Peón, Alberto N; Terrazas, Luis I

    2016-01-01

    Multiple sclerosis (MS) is the most prevalent autoimmune disease affecting the central nervous system (CNS). Its pathophysiology is centered on neuron myelin sheath destruction in a manner largely dependent upon CD4+/CD8+ T-cell autoreactivity against myelin antigens, inducing Th1/Th17 pathogenic responses with the resulting production of free radicals and soluble mediators that exhibit the effector mechanisms of neurodegeneration. The immune response responsible for this disease is complex and challenges modern medicine. Consequently, many experimental therapies have been proposed in addition to the classical array of immunoregulatory/ immunosuppressive drugs that are normally used to treat MS. In this review, we will describe the effects and mechanisms of action of widely used disease-modifying MS drugs as well as those of select treatments that are currently in the experimental phase. Special emphasis is placed on helminth-derived immunoregulators, as some of them have shown promising results. Additionally, we will compare the mechanisms of action of both the MS drugs and the helminth-derived treatments to discuss the potential importance of some signaling pathways in the control of MS.

  2. The allosteric regulatory mechanism of the Escherichia coli MetNI methionine ATP binding cassette (ABC) transporter.

    PubMed

    Yang, Janet G; Rees, Douglas C

    2015-04-03

    The MetNI methionine importer of Escherichia coli, an ATP binding cassette (ABC) transporter, uses the energy of ATP binding and hydrolysis to catalyze the high affinity uptake of D- and L-methionine. Early in vivo studies showed that the uptake of external methionine is repressed by the level of the internal methionine pool, a phenomenon termed transinhibition. Our understanding of the MetNI mechanism has thus far been limited to a series of crystal structures in an inward-facing conformation. To understand the molecular mechanism of transinhibition, we studied the kinetics of ATP hydrolysis using detergent-solubilized MetNI. We find that transinhibition is due to noncompetitive inhibition by L-methionine, much like a negative feedback loop. Thermodynamic analyses revealed two allosteric methionine binding sites per transporter. This quantitative analysis of transinhibition, the first to our knowledge for a structurally defined transporter, builds upon the previously proposed structurally based model for regulation. This mechanism of regulation at the transporter activity level could be applicable to not only ABC transporters but other types of membrane transporters as well. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Co-Expression Analysis of Blood Cell Genome Expression to Preliminary Investigation of Regulatory Mechanisms in Uremia

    PubMed Central

    Cheng, Liu; Yonggui, Wu

    2017-01-01

    Background Uremia involves a series of clinical manifestations and is a common syndrome that occurs in nearly all end-stage kidney diseases. However, the exact genetic and/or molecular mechanisms that underlie uremia remain poorly understood. Material/Methods In this case-control study, we analyzed whole-genome microarray of 75 uremia patients and 20 healthy controls to investigate changes in gene expression and cellular mechanisms relevant to uremia. Gene co-expression network analysis was performed to construct co-expression networks using differentially expressed genes (DEGs) in uremia. We then determined hub models of co-expressed gene networks by MCODE, and we used miRNA enrichment analysis to detect key miRNAs in each hub module. Results We found nine co-expressed hub modules implicated in uremia. These modules were enriched in specific biological functions, including “proteolysis”, “membrane-enclosed lumen”, and “apoptosis”. Finally, miRNA enrichment analysis to detect key miRNAs in each hub module found 15 miRNAs that were specifically targeted to uremia-related hub modules. Of these, miRNA-21-3p and miRNA-210-3p have been identified in other studies as being important for uremia. Conclusions In summary, our study connected biological functions, genes, and miRNAs that underpin the network modules that can be used to elucidate the molecular mechanisms involved in uremia. PMID:28050009

  4. Transcriptomes reveal the genetic mechanisms underlying ionic regulatory adaptations to salt in the crab-eating frog

    PubMed Central

    Shao, Yong; Wang, Li-Jun; Zhong, Li; Hong, Mei-Ling; Chen, Hong-Man; Murphy, Robert W.; Wu, Dong-Dong; Zhang, Ya-Ping; Che, Jing

    2015-01-01

    The crab-eating frog, Fejervarya cancrivora, is the only frog that lives near seas. It tolerates increased environmental concentrations of sodium, chloride and potassium partly by raising ion and urea levels in its blood plasma. The molecular mechanism of the adaptation remains rarely documented. Herein, we analyze transcriptomes of the crab-eating frog and its closely related saline-intolerant species, F. limnocharis, to explore the molecular basis of adaptations to such extreme environmental conditions. Analyses reveal the potential genetic mechanism underlying the adaptation to salinity for the crab-eating frog. Genes in categories associated with ion transport appear to have evolved rapidly in F. cancrivora. Both positively selected and differentially expressed genes exhibit enrichment in the GO category regulation of renal sodium excretion. In this category, the positively selected sites of ANPEP and AVPR2 encode CD13 and V2 receptors, respectively; they fall precisely on conserved domains. More differentially expressed rapidly evolved genes occur in the kidney of F. cancrivora than in F. limnocharis. Four genes involved in the regulation of body fluid levels show signs of positive selection and increased expression. Significant up-regulation occurs in several genes of F. cancrivora associated with renin-angiotensin system and aldosterone-regulated sodium reabsorption pathways, which relate to osmotic regulation. PMID:26619819

  5. Disparate Regulatory Mechanisms Control Fat3 and P75NTR Protein Transport through a Conserved Kif5-Interaction Domain

    PubMed Central

    Birkness, Jacqueline E.; Trinidad, Jonathan C.

    2016-01-01

    Directed transport delivers proteins to specific cellular locations and is one mechanism by which cells establish and maintain polarized cellular architectures. The atypical cadherin Fat3 directs the polarized extension of dendrites in retinal amacrine cells by influencing the distribution of cytoskeletal regulators during retinal development, however the mechanisms regulating the distribution of Fat3 remain unclear. We report a novel Kinesin/Kif5 Interaction domain (Kif5-ID) in Fat3 that facilitates Kif5B binding, and determines the distribution of Fat3 cytosolic domain constructs in neurons and MDCK cells. The Kif5-ID sequence is conserved in the neurotrophin receptor P75NTR, which also binds Kif5B, and Kif5-ID mutations similarly result in P75NTR mislocalization. Despite these similarities, Kif5B-mediated protein transport is differentially regulated by these two cargos. For Fat3, the Kif5-ID is regulated by alternative splicing, and the timecourse of splicing suggests that the distribution of Fat3 may switch between early and later stages of retinal development. In contrast, P75NTR binding to Kif5B is enhanced by tyrosine phosphorylation and thus has the potential to be dynamically regulated on a more rapid time scale. PMID:27788242

  6. Complementary vascular and matrix regulatory pathways underlie the beneficial mechanism of action of sorafenib in liver fibrosis

    PubMed Central

    Thabut, Dominique; Routray, Chittaranjan; Lomberk, Gwen; Shergill, Uday; Glaser, Kevin; Huebert, Robert; Patel, Leena; Masyuk, Tetyana; Blechacz, Boris; Vercnocke, Andrew; Ritman, Erik; Ehman, Richard; Urrutia, Raul; Shah, Vijay

    2011-01-01

    Background Paracrine signaling between hepatic stellate cells (HSC) and liver endothelial cells (LEC) modulates fibrogenesis, angiogenesis, and portal hypertension. However, mechanisms regulating these processes are not fully defined. Sorafenib is a receptor tyrosine kinase inhibitor that blocks growth factor signaling in tumor cells but also displays important and not yet fully characterized effects on liver nonparenchymal cells including HSC and LEC. The aim of this study was to test the hypothesis that sorafenib influences paracrine signaling between HSC and LEC and thereby regulates matrix and vascular changes associated with chronic liver injury. Results Complementary magnetic resonance elastography, micro-CT, and histochemical analyses indicate that sorafenib attenuates the changes in both matrix and vascular compartments that occur in response to bile-duct ligation induced liver injury in rats. Cell biology studies demonstrate that sorafenib markedly reduces cell to cell apposition and junctional complexes, thus reducing the proximity typically observed between these sinusoidal barrier cells. At the molecular level, sorafenib down-regulates angiopoietin-1 and fibronectin, both released by HSC in a manner dependent on the transcription factor KLF6, suggesting that this pathway underlies both matrix and vascular changes associated with chronic liver disease. Conclusion Collectively, our results demonstrate that sorafenib inhibits both matrix restructuring and vascular remodeling that accompany chronic liver diseases and characterize cell and molecular mechanisms underlying this effect. These data may help to refine future therapies for advanced gastrointestinal and liver diseases characterized by abundant fibrosis and neovascularization. PMID:21567441

  7. Subchromoplast Sequestration of Carotenoids Affects Regulatory Mechanisms in Tomato Lines Expressing Different Carotenoid Gene Combinations[C][W

    PubMed Central

    Nogueira, Marilise; Mora, Leticia; Enfissi, Eugenia M.A.; Bramley, Peter M.; Fraser, Paul D.

    2013-01-01

    Metabolic engineering of the carotenoid pathway in recent years has successfully enhanced the carotenoid contents of crop plants. It is now clear that only increasing biosynthesis is restrictive, as mechanisms to sequestrate these increased levels in the cell or organelle should be exploited. In this study, biosynthetic pathway genes were overexpressed in tomato (Solanum lycopersicum) lines and the effects on carotenoid formation and sequestration revealed. The bacterial Crt carotenogenic genes, independently or in combination, and their zygosity affect the production of carotenoids. Transcription of the pathway genes was perturbed, whereby the tissue specificity of transcripts was altered. Changes in the steady state levels of metabolites in unrelated sectors of metabolism were found. Of particular interest was a concurrent increase of the plastid-localized lipid monogalactodiacylglycerol with carotenoids along with membranous subcellular structures. The carotenoids, proteins, and lipids in the subchromoplast fractions of the transgenic tomato fruit with increased carotenoid content suggest that cellular structures can adapt to facilitate the sequestration of the newly formed products. Moreover, phytoene, the precursor of the pathway, was identified in the plastoglobule, whereas the biosynthetic enzymes were in the membranes. The implications of these findings with respect to novel pathway regulation mechanisms are discussed. PMID:24249831

  8. Complementary transcriptomic and proteomic analyses reveal regulatory mechanisms of milk protein production in dairy cows consuming different forages

    PubMed Central

    Dai, Wenting; Chen, Qiong; Wang, Quanjuan; White, Robin R.; Liu, Jianxin; Liu, Hongyun

    2017-01-01

    Forage plays a critical role in the milk production of dairy cows; however, the mechanisms regulating bovine milk synthesis in dairy cows fed high forage rations with different basal forage types are not well-understood. In the study, rice straw (RS, low-quality) and alfalfa hay (AH, high-quality) diets were fed to lactating cows to explore how forage quality affected the molecular mechanisms regulating milk production using RNA-seq transcriptomic method with iTRAQ proteomic technique. A total of 554 transcripts (423 increased and 131 decreased) and 517 proteins (231 up-regulated and 286 down-regulated) were differentially expressed in the mammary glands of the two groups. The correlation analysis demonstrated seven proteins (six up-regulated and one down-regulated) had consistent mRNA expression. Functional analysis of the differentially expressed transcripts/proteins suggested that enhanced capacity for energy and fatty acid metabolism, increased protein degradation, reduced protein synthesis, decreased amino acid metabolism and depressed cell growth were related to RS consumption. The results indicated cows consuming RS diets may have had depressed milk protein synthesis because these animals had decreased capacity for protein synthesis, enhanced proteolysis, inefficient energy generation and reduced cell growth. Additional work evaluating RS- and AH-based rations may help better isolate molecular adaptations to low nutrient availability during lactation. PMID:28290485

  9. First Insights into the Subterranean Crustacean Bathynellacea Transcriptome: Transcriptionally Reduced Opsin Repertoire and Evidence of Conserved Homeostasis Regulatory Mechanisms.

    PubMed

    Kim, Bo-Mi; Kang, Seunghyun; Ahn, Do-Hwan; Kim, Jin-Hyoung; Ahn, Inhye; Lee, Chi-Woo; Cho, Joo-Lae; Min, Gi-Sik; Park, Hyun

    2017-01-01

    Bathynellacea (Crustacea, Syncarida, Parabathynellidae) are subterranean aquatic crustaceans that typically inhabit freshwater interstitial spaces (e.g., groundwater) and are occasionally found in caves and even hot springs. In this study, we sequenced the whole transcriptome of Allobathynella bangokensis using RNA-seq. De novo sequence assembly produced 74,866 contigs including 28,934 BLAST hits. Overall, the gene sequences were most similar to those of the waterflea Daphnia pulex. In the A. bangokensis transcriptome, no opsin or related sequences were identified, and no contig aligned to the crustacean visual opsins and non-visual opsins (i.e. arthropsins, peropsins, and melaopsins), suggesting potential regressive adaptation to the dark environment. However, A. bangokensis expressed conserved gene family sets, such as heat shock proteins and those related to key innate immunity pathways and antioxidant defense systems, at the transcriptional level, suggesting that this species has evolved adaptations involving molecular mechanisms of homeostasis. The transcriptomic information of A. bangokensis will be useful for investigating molecular adaptations and response mechanisms to subterranean environmental conditions.

  10. First Insights into the Subterranean Crustacean Bathynellacea Transcriptome: Transcriptionally Reduced Opsin Repertoire and Evidence of Conserved Homeostasis Regulatory Mechanisms

    PubMed Central

    Kim, Bo-Mi; Kang, Seunghyun; Ahn, Do-Hwan; Kim, Jin-Hyoung; Ahn, Inhye; Lee, Chi-Woo; Cho, Joo-Lae; Min, Gi-Sik; Park, Hyun

    2017-01-01

    Bathynellacea (Crustacea, Syncarida, Parabathynellidae) are subterranean aquatic crustaceans that typically inhabit freshwater interstitial spaces (e.g., groundwater) and are occasionally found in caves and even hot springs. In this study, we sequenced the whole transcriptome of Allobathynella bangokensis using RNA-seq. De novo sequence assembly produced 74,866 contigs including 28,934 BLAST hits. Overall, the gene sequences were most similar to those of the waterflea Daphnia pulex. In the A. bangokensis transcriptome, no opsin or related sequences were identified, and no contig aligned to the crustacean visual opsins and non-visual opsins (i.e. arthropsins, peropsins, and melaopsins), suggesting potential regressive adaptation to the dark environment. However, A. bangokensis expressed conserved gene family sets, such as heat shock proteins and those related to key innate immunity pathways and antioxidant defense systems, at the transcriptional level, suggesting that this species has evolved adaptations involving molecular mechanisms of homeostasis. The transcriptomic information of A. bangokensis will be useful for investigating molecular adaptations and response mechanisms to subterranean environmental conditions. PMID:28107438

  11. Regulatory mechanisms of cAMP levels as a multiple target for antiplatelet activity and less bleeding risk.

    PubMed

    Fuentes, Eduardo; Palomo, Iván

    2014-08-01

    Platelet activation is a critical component of atherothrombosis. The multiple pathways of platelet activation limit the effect of specific receptor/pathway inhibitors, resulting in limited clinical efficacy. Recent research has confirmed that combination therapy results in enhanced antithrombotic efficacy without increasing bleeding risk. In this way, the best-known inhibitor and turn off signaling in platelet activation is cAMP. In this article we discuss the mechanisms of regulation of intraplatelet cAMP levels, a) platelet-dependent pathway: Gi/Gs protein-coupled receptors, phosphodiesterase inhibition and activation of PPARs and b) platelet-independent pathway: inhibition of adenosine uptake by erythrocytes. With respect to the association between intraplatelet cAMP levels and bleeding risk it is possible to establish that compounds/drugs with pleitropic effect for increased intraplatelet cAMP level could have an antithrombotic activity with less risk of bleeding.

  12. Regulatory Mechanisms of a Highly Pectinolytic Mutant of Penicillium occitanis and Functional Analysis of a Candidate Gene in the Plant Pathogen Fusarium oxysporum

    PubMed Central

    Bravo-Ruiz, Gustavo; Sassi, Azza Hadj; Marcet-Houben, Marina; Di Pietro, Antonio; Gargouri, Ali; Gabaldon, Toni; Roncero, M. Isabel G.

    2017-01-01

    Penicillium occitanis is a model system for enzymatic regulation. A mutant strain exhibiting constitutive overproduction of different pectinolytic enzymes both under inducing (pectin) or repressing conditions (glucose) was previously isolated after chemical mutagenesis. In order to identify the molecular basis of this regulatory mechanism, the genomes of the wild type and the derived mutant strain were sequenced and compared, providing the first reference genome for this species. We used a phylogenomic approach to compare P. occitanis with other pectinolytic fungi and to trace expansions of gene families involved in carbohydrate degradation. Genome comparison between wild type and mutant identified seven mutations associated with predicted proteins. The most likely candidate was a mutation in a highly conserved serine residue of a conserved fungal protein containing a GAL4-like Zn2Cys6 binuclear cluster DNA-binding domain and a fungus-specific transcription factor regulatory middle homology region. To functionally characterize the role of this candidate gene, the mutation was recapitulated in the predicted orthologue Fusarium oxysporum, a vascular wilt pathogen which secretes a wide array of plant cell wall degrading enzymes, including polygalacturonases, pectate lyases, xylanases and proteases, all of which contribute to infection. However, neither the null mutant nor a mutant carrying the analogous point mutation exhibited a deregulation of pectinolytic enzymes. The availability, annotation and phylogenomic analysis of the P. occitanis genome sequence represents an important resource for understanding the evolution and biology of this species, and sets the basis for the discovery of new genes of biotechnological interest for the degradation of complex polysaccharides. PMID:28951729

  13. Depletion of Foxp3+ regulatory T cells increases severity of mechanical allodynia and significantly alters systemic cytokine levels following peripheral nerve injury.

    PubMed

    Lees, Justin G; Duffy, Samuel S; Perera, Chamini J; Moalem-Taylor, Gila

    2015-02-01

    Neuropathic pain is a debilitating condition caused by damage to the somatosensory nervous system, such as peripheral nerve injury. The immune system, and in particular the adaptive T cell response, plays a key role in mediating such pain. Regulatory T (Treg) cells are a small subpopulation of inhibitory T cells that prevent autoimmunity, limit immunopathology and maintain immune homeostasis. Here, we investigated the effects of conditional depletion of Treg cells on mechanical allodynia and serum cytokines in mice with chronic constriction injury (CCI) of the sciatic nerve, an animal model of neuropathic pain. We demonstrate that CCI induced the infiltration of small numbers of Treg cells within effected neuronal tissue. Utilising the transgenic DEREG (DEpletion of REGulatory T cells) mice, we confirmed effective depletion of Foxp3+ Treg cells by diphtheria toxin injections. Following CCI we observed a transient, though significant, increase in pain hypersensitivity for Treg-depleted DEREG mice compared to non-Treg-depleted mice. Analysis of systemic cytokine levels demonstrated significant changes in serum cytokine expression profiles. In particular, we observed significant increases in systemic concentration of RANTES, IL-2 and IL-5, and significant decreases in IL-12 and IFN-γ in nerve-injured Treg-depleted DEREG mice. Further analysis indicated a substantial increase in the serum concentration of IL-12p40 as a direct result of Treg cell depletion. These results suggest that depletion of Foxp3+ Treg cells promote nerve injury-induced pain hypersensitivity, partially by inducing altered systemic concentrations of cytokines, which may act to regulate neuropathic pain.

  14. A mathematical model of cancer stem cell driven tumor initiation: implications of niche size and loss of homeostatic regulatory mechanisms.

    PubMed

    Gentry, Sara N; Jackson, Trachette L

    2013-01-01

    Hierarchical organized tissue structures, with stem cell driven cell differentiation, are critical to the homeostatic maintenance of most tissues, and this underlying cellular architecture is potentially a critical player in the development of a many cancers. Here, we develop a mathematical model of mutation acquisition to investigate how deregulation of the mechanisms preserving stem cell homeostasis contributes to tumor initiation. A novel feature of the model is the inclusion of both extrinsic and intrinsic chemical signaling and interaction with the niche to control stem cell self-renewal. We use the model to simulate the effects of a variety of types and sequences of mutations and then compare and contrast all mutation pathways in order to determine which ones generate cancer cells fastest. The model predicts that the sequence in which mutations occur significantly affects the pace of tumorigenesis. In addition, tumor composition varies for different mutation pathways, so that some sequences generate tumors that are dominated by cancerous cells with all possible mutations, while others are primarily comprised of cells that more closely resemble normal cells with only one or two mutations. We are also able to show that, under certain circumstances, healthy stem cells diminish due to the displacement by mutated cells that have a competitive advantage in the niche. Finally, in the event that all homeostatic regulation is lost, exponential growth of the cancer population occurs in addition to the depletion of normal cells. This model helps to advance our understanding of how mutation acquisition affects mechanisms that influence cell-fate decisions and leads to the initiation of cancers.

  15. Histone Deacetylases 6 and 9 and Sirtuin-1 Control Foxp3+ Regulatory T Cell Function Through Shared and Isotype-Specific Mechanisms

    PubMed Central

    Beier, Ulf H.; Wang, Liqing; Han, Rongxiang; Akimova, Tatiana; Liu, Yujie; Hancock, Wayne W.

    2013-01-01

    Therapeutic targeting of histone/protein deacetylase 6 (HDAC6), HDAC9, or the sirtuin-1 (Sirt1) augments the suppressive functions of regulatory T cells (Tregs) that contain the transcription factor Foxp3. However, it is unclear whether distinct mechanisms are involved or whether combined inhibition of these targets would be more beneficial. We compared the suppressive functions of Tregs from wild-type C57BL/6 mice with those from mice with either global (HDAC6−/−, HDAC9−/−, and HDAC6−/−HDAC9−/−), or conditional (fl-Sirt1/CD4-Cre or fl-Sirt1/Foxp3-Cre) HDAC deletion, as well as treatment with isoform-selective HDAC inhibitors. We found that the heat shock response was important for the improvement of Treg suppressive function mediated by HDAC6 inhibition, but not Sirt1 inhibition. Furthermore, although HDAC6, HDAC9, and Sirt1 all deacetylated Foxp3, each protein had diverse effects on transcription factors controlling Foxp3 gene expression. For example, loss of HDAC9 was associated with stabilization of the acetylation of signal transducer and activator of transcription 5 (STAT5) and of its transcriptional activity. Hence, targeting different HDACs increased Treg function by multiple and additive mechanisms, which indicates the therapeutic potential for combinations of HDAC inhibitors in the management of autoimmunity and organ transplantation. PMID:22715468

  16. A novel regulatory mechanism of the mitochondrial Ca2+ uniporter revealed by the p38 mitogen-activated protein kinase inhibitor SB202190.

    PubMed

    Montero, Mayte; Lobaton, Carmen D; Moreno, Alfredo; Alvarez, Javier

    2002-12-01

    It is widely acknowledged that mitochondrial Ca2+ uptake modulates the cytosolic [Ca2+] ([Ca2+]c) acting as a transient Ca2+ buffer. In addition, mitochondrial [Ca2+] ([Ca2+]M) regulates the rate of respiration and may trigger opening of the permeability transition pore and start apoptosis. However, no mechanism for the physiological regulation of mitochondrial Ca2+ uptake has been described. We show here that SB202190, an inhibitor of p38 mitogen-activated protein (MAP) kinase, strongly stimulates ruthenium red-sensitive mitochondrial Ca2+ uptake, both in intact and in permeabilized HeLa cells. The [Ca2+]M peak induced by agonists was increased about fourfold in the presence of the inhibitor, with a concomitant reduction in the [Ca2+]c peak. The stimulation occurred fast and was rapidly reversible. In addition, experiments in permeabilized cells perfused with controlled [Ca2+] showed that SB202190 stimulated mitochondrial Ca2+ uptake by more than 10-fold, but only in the physiological [Ca2+]c range (1-4 mM). Other structurally related p38 MAP kinase inhibitors (SB203580, PD169316, or SB220025) produced little or no effect. Our data suggest that in HeLa cells, a protein kinase sensitive to SB202190 tonically inhibits the mitochondrial Ca2+ uniporter. This novel regulatory mechanism may be of paramount importance to modulate mitochondrial Ca2+ uptake under different physiopathological conditions.

  17. GTP cyclohydrolase I inhibition by the prototypic inhibitor 2, 4-diamino-6-hydroxypyrimidine. Mechanisms and unanticipated role of GTP cyclohydrolase I feedback regulatory protein.

    PubMed

    Xie, L; Smith, J A; Gross, S S

    1998-08-14

    2,4-Diamino-6-hydroxypyrimidine (DAHP) is considered to be a selective and direct-acting inhibitor of GTP cyclohydrolase I (GTPCH), the first and rate-limiting enzyme in the pathway for synthesis of tetrahydrobiopterin (BH4). Accordingly, DAHP has been widely employed to distinguish whether de novo BH4 synthesis is required in a given biological system. Although it has been assumed that DAHP inhibits GTPCH by direct competition with substrate GTP, this has never been formally demonstrated. In view of apparent structural homology between DAHP and BH4, we questioned whether DAHP may mimic BH4 in its inhibition of GTPCH by an indirect mechanism, involving interaction with a recently cloned 9.5-kDa protein termed GTPCH Feedback Regulatory Protein (GFRP). We show by reverse transcription-polymerase chain reaction that GFRP mRNA is constitutively expressed in rat aortic smooth muscle cells and further induced by treatment with immunostimulants. Moreover, functional GFRP is expressed and immunostimulant-induced BH4 accumulates in sufficient quantity to trigger feedback inhibition of GTPCH. Studies with DAHP reveal that GFRP is also essential to achieve potent inhibition of GTPCH. Indeed, DAHP inhibits GTPCH by dual mechanisms. At a relatively low concentration, DAHP emulates BH4 and engages the GFRP-dependent feedback inhibitory system; at higher concentrations, DAHP competes directly for binding with GTP substrate. This knowledge predicts that DAHP would preferably target GTPCH in tissues with abundant GFRP.

  18. Insights into the mechanism of FTY720 and compatibility with regulatory T cells for the inhibition of graft-versus-host disease (GVHD).

    PubMed

    Taylor, Patricia A; Ehrhardt, Michael J; Lees, Christopher J; Tolar, Jakub; Weigel, Brenda J; Panoskaltsis-Mortari, Angela; Serody, Jonathan S; Brinkmann, Volker; Blazar, Bruce R

    2007-11-01

    The immunomodulator FTY720 (FTY) has been shown to be beneficial in experimental models of organ transplantation and autoimmunity. We show that FTY significantly inhibited but did not prevent graft-versus-host disease (GVHD) in lethally irradiated or nonirradiated allogeneic recipients. Although most studies implicate prevention of lymphocyte egress from lymphoid organs as the primary mechanism of action, our data indicate that FTY effects on the host are more likely to be responsible for GVHD inhibition. FTY reduced splenic CD11c+ cells by 50%, and similarly reduced CD4+ and CD8+ T-cell responder frequencies in the spleen early after transplantation. Imaging of GFP+ effectors indicated that FTY modified donor effector T-cell migration to secondary lymphoid organs, but did not uniformly trap T cells in lymph nodes or prevent early effector migration to GVHD parenchymal target organs. Administration of FTY only prior to transplantation inhibited GVHD, indicating that the primary function of FTY may be targeted to host cells. FTY was additive with regulatory T cells for GVHD inhibition. FTY slightly impaired but did not abrogate a graft-versus-leukemia (GVL) effect against C1498, a myeloid leukemia. Our data further define the mechanisms of action and provide insight as to the potential clinical uses of FTY in allogeneic bone marrow transplant recipients.

  19. See the forest for the trees: Whole-plant allocation patterns and regulatory mechanisms in Norway spruce

    NASA Astrophysics Data System (ADS)

    Huang, Jianbei; Behrendt, Thomas; Hammerbacher, Almuth; Weinhold, Alexander; Hellén, Heidi; Reichelt, Michael; Wisthaler, Armin; Dam, Nicole; Trumbore, Susan; Hartmann, Henrik

    2017-04-01

    acetone) decreased whereas monoterpene and sesquiterpene emissions slightly increased with decreasing [CO2]. Our experimental design provides an excellent platform for studying control mechanisms of C allocation. The range of C availabilities applied in our study will allow partitioning compensatory mechanisms (e.g., up-regulation of C storage due to sugar signalling at high C availability) from evolutionary programming (e.g., storage formation to increase long-term survival at expense of other functions with decreasing C availability). Such partitioning is corroborated via phytohormone and transcriptome analysis, and results will hopefully be available at the time of presentation.