Investigation of Anaerobic Fluidized Bed Reactor/ Aerobic Moving Bed Bio Reactor (AFBR/MMBR) System for Treatment of Currant Wastewater

PubMed Central

JAFARI, Jalil; MESDAGHINIA, Alireza; NABIZADEH, Ramin; FARROKHI, Mehrdad; MAHVI, Amir Hossein

2013-01-01

Background: Anaerobic treatment methods are more suitable for the treatment of concentrated wastewater streams, offer lower operating costs, the production of usable biogas product. The aim of this study was to investigate the performance of an Anaerobic Fluidized Bed Reactor (AFBR)-Aerobic Moving Bed Bio Reactor (MBBR) in series arrangement to treat Currant wastewater. Methods: The bed materials of AFBR were cylindrical particles made of PVC with a diameter of 2–2.3 mm, particle density of 1250 kg/m3. The volume of all bed materials was 1.7 liter which expanded to 2.46 liters in fluidized situation. In MBBR, support media was composed of 1.5 liters Bee-Cell 2000 having porosity of 87% and specific surface area of 650m2/m3. Results: When system operated at 35 ºC, chemical oxygen demand (COD) removal efficiencies were achieved to 98% and 81.6% for organic loading rates (OLR) of 9.4 and 24.2 g COD/l.d, and hydraulic retention times (HRT) of 48 and 18 h, in average COD concentration feeding of 18.4 g/l, respectively. Conclusion: The contribution of AFBR in total COD removal efficiency at an organic loading rate (OLR) of 9.4 g COD/l.d was 95%, and gradually decreased to 76.5% in OLR of 24.2 g COD/l.d. Also with increasing in organic loading rate the contribution of aerobic reactor in removing COD gradually decreased. In this system, the anaerobic reactor played the most important role in the removal of COD, and the aerobic MBBR was actually needed to polish the anaerobic treated wastewater. PMID:26056640

Precipitated Silica from Pumice and Carbon Dioxide Gas (Co2) in Bubble Column Reactor

NASA Astrophysics Data System (ADS)

Dewati, R.; Suprihatin, S.; Sumada, K.; Muljani, S.; Familya, M.; Ariani, S.

2018-01-01

Precipitated silica from silica and carbon dioxide gas has been studied successfully. The source of silica was obtained from pumice stone while precipitation process was carried out with carbon dioxide gas (CO2). The sodium silicate solution was obtained by extracting the silica from pumice stone with sodium hydroxide (NaOH) solution and heated to 100 °C for 1 h. The carbon dioxide gas is injected into the aqueous solution of sodium silicate in a bubble column reactor to form precipitated silica. m2/g. The results indicate that the products obtained are precipitate silica have surface area in the range of 100 - 227 m2/g, silica concentration more than 80%, white in appearance, and silica concentration reached 90% at pH 7.

Biological hydrogen production by Clostridium acetobutylicum in an unsaturated flow reactor.

PubMed

Zhang, Husen; Bruns, Mary Ann; Logan, Bruce E

2006-02-01

A mesophilic unsaturated flow (trickle bed) reactor was designed and tested for H2 production via fermentation of glucose. The reactor consisted of a column packed with glass beads and inoculated with a pure culture (Clostridium acetobutylicum ATCC 824). A defined medium containing glucose was fed at a flow rate of 1.6 mL/min (0.096 L/h) into the capped reactor, producing a hydraulic retention time of 2.1 min. Gas-phase H2 concentrations were constant, averaging 74 +/- 3% for all conditions tested. H2 production rates increased from 89 to 220 mL/hL of reactor when influent glucose concentrations were varied from 1.0 to 10.5 g/L. Specific H2 production rate ranged from 680 to 1270 mL/g glucose per liter of reactor (total volume). The H2 yield was 15-27%, based on a theoretical limit by fermentation of 4 moles of H2 from 1 mole of glucose. The major fermentation by-products in the liquid effluent were acetate and butyrate. The reactor rapidly (within 60-72 h) became clogged with biomass, requiring manual cleaning of the system. In order to make long-term operation of the reactor feasible, biofilm accumulation in the reactor will need to be controlled through some process such as backwashing. These tests using an unsaturated flow reactor demonstrate the feasibility of the process to produce high H2 gas concentrations in a trickle-bed type of reactor. A likely application of this reactor technology could be H2 gas recovery from pre-treatment of high carbohydrate-containing wastewaters.

Development of toroid-type HTS DC reactor series for HVDC system

NASA Astrophysics Data System (ADS)

Kim, Kwangmin; Go, Byeong-Soo; Park, Hea-chul; Kim, Sung-kyu; Kim, Seokho; Lee, Sangjin; Oh, Yunsang; Park, Minwon; Yu, In-Keun

2015-11-01

This paper describes design specifications and performance of a toroid-type high-temperature superconducting (HTS) DC reactor. The first phase operation targets of the HTS DC reactor were 400 mH and 400 A. The authors have developed a real HTS DC reactor system during the last three years. The HTS DC reactor was designed using 2G GdBCO HTS wires. The HTS coils of the toroid-type DC reactor magnet were made in the form of a D-shape. The electromagnetic performance of the toroid-type HTS DC reactor magnet was analyzed using the finite element method program. A conduction cooling method was adopted for reactor magnet cooling. The total system has been successfully developed and tested in connection with LCC type HVDC system. Now, the authors are studying a 400 mH, kA class toroid-type HTS DC reactor for the next phase research. The 1500 A class DC reactor system was designed using layered 13 mm GdBCO 2G HTS wire. The expected operating temperature is under 30 K. These fundamental data obtained through both works will usefully be applied to design a real toroid-type HTS DC reactor for grid application.

Long-range magnetic order in the Heisenberg pyrochlore antiferromagnets G d2G e2O7 and G d2P t2O7 synthesized under high pressure

NASA Astrophysics Data System (ADS)

Li, X.; Cai, Y. Q.; Cui, Q.; Lin, C. J.; Dun, Z. L.; Matsubayashi, K.; Uwatoko, Y.; Sato, Y.; Kawae, T.; Lv, S. J.; Jin, C. Q.; Zhou, J.-S.; Goodenough, J. B.; Zhou, H. D.; Cheng, J.-G.

2016-12-01

G d2S n2O7 and G d2T i2O7 have been regarded as good experimental realizations of the classical Heisenberg pyrochlore antiferromagnet with dipolar interaction. The former was found to adopt the Palmer-Chalker state via a single, first-order transition at TN≈1 K , while the latter enters a distinct, partially ordered state through two successive transitions at TN 1≈1 K and TN 2= 0.75 K . To shed more light on their distinct magnetic ground states, we have synthesized two more gadolinium-based pyrochlore oxides, G d2G e2O7 and G d2P t2O7 , under high-pressure conditions and performed detailed characterizations via x-ray powder diffraction, dc and ac magnetic susceptibility, and specific heat measurements down to 100 mK. We found that both compounds enter a long-range antiferromagnetically ordered state through a single, first-order transition at TN= 1.4 K for G d2G e2O7 and TN= 1.56 K for G d2P t2O7 , with the specific heat anomaly similar to that of G d2S n2O7 rather than G d2T i2O7 . Interestingly, the low-temperature magnetic specific heat values of both G d2G e2O7 and G d2P t2O7 were found to follow nicely the T3 dependence as expected for a three-dimensional antiferromagnet with gapless spin-wave excitations. We have rationalized the enhancement of TN in terms of the reduced Gd-Gd distances for the chemically pressurized G d2G e2O7 and the addition of extra superexchange pathways through the empty Pt -eg orbitals for G d2P t2O7 . Our current study has expanded the family of gadolinium-based pyrochlores and permits us to achieve a better understanding of their distinct magnetic properties in a more comprehensive perspective.

Reactor-Scale Cultivation of the Hyperthermophilic Methanarchaeon Methanococcus jannaschii to High Cell Densities

PubMed Central

Mukhopadhyay, Biswarup; Johnson, Eric F.; Wolfe, Ralph S.

1999-01-01

For the hyperthermophilic and barophilic methanarchaeon Methanococcus jannaschii, we have developed a medium and protocols for reactor-scale cultivation that improved the final cell yield per liter from ∼0.5 to ∼7.5 g of packed wet cells (∼1.8 g dry cell mass) under autotrophic growth conditions and to ∼8.5 g of packed wet cells (∼2 g dry cell mass) with yeast extract (2 g liter−1) and tryptone (2 g liter−1) as medium supplements. For growth in a sealed bottle it was necessary to add Se to the medium, and a level of 2 μM for added Se gave the highest final cell yield. In a reactor M. jannaschii grew without added Se in the medium; it is plausible that the cells received Se as a contaminant from the reactor vessel and the H2S supply. But, for the optimal performance of a reactor culture, an addition of Se to a final concentration of 50 to 100 μM was needed. Also, cell growth in a reactor culture was inhibited at much higher Se concentrations. These observations and the data from previous work with methanogen cell extracts (B. C. McBride and R. S. Wolfe, Biochemistry 10:4312–4317, 1971) suggested that from a continuously sparged reactor culture Se was lost in the exhaust gas as volatile selenides, and this loss raised the apparent required level of and tolerance for Se. In spite of having a proteinaceous cell wall, M. jannaschii withstood an impeller tip speed of 235.5 cms−1, which was optimal for achieving high cell density and also was the higher limit for the tolerated shear rate. The organism secreted one or more acidic compounds, which lowered pH in cultures without pH control; this secretion continued even after cessation of growth. PMID:10543823

The Simulator Development for RDE Reactor

NASA Astrophysics Data System (ADS)

Subekti, Muhammad; Bakhri, Syaiful; Sunaryo, Geni Rina

2018-02-01

BATAN is proposing the construction of experimental power reactor (RDE reactor) for increasing the public acceptance on NPP development plan, proofing the safety level of the most advanced reactor by performing safety demonstration on the accidents such as Chernobyl and Fukushima, and owning the generation fourth (G4) reactor technology. For owning the reactor technology, the one of research activities is RDE’s simulator development that employing standard equation. The development utilizes standard point kinetic and thermal equation. The examination of the simulator carried out comparison in which the simulation’s calculation result has good agreement with assumed parameters and ChemCAD calculation results. The transient simulation describes the characteristic of the simulator to respond the variation of power increase of 1.5%/min, 2.5%/min, and 3.5%/min.

Anaerobic biodegradation of aircraft deicing fluid in UASB reactors.

PubMed

Tham, P T Pham thi; Kennedy, K J Kevin J

2004-05-01

A central composite design was employed to methodically investigate anaerobic treatment of aircraft deicing fluid (ADF) in bench-scale Upflow Anaerobic Sludge Blanket (UASB) reactors. A total of 23 runs at 17 different operating conditions (0.8% 1.6% ADF (6000-12,000mg/L COD), 12-56h HRT, and 18-36gVSS/L) were conducted in continuous mode. The development of four empirical models describing process responses (i.e. COD removal efficiency, biomass-specific acetoclastic activity, methane production rate, and methane production potential) as functions of ADF concentration, hydraulic retention time, and biomass concentration is presented. Model verification indicated that predicted responses (COD removal efficiencies, biomass-specific acetoclastic activity, and methane production rates and potential) were in good agreement with experimental results. Biomass-specific acetoclastic activity was improved two-fold from 0.23gCOD/gVSS/d for inoculum to a maximum of 0.55gCOD/gVSS/d during ADF treatment in UASB reactors. For the design window, COD removal efficiencies were higher than 90%. The predicted methane production potentials were close to theoretical values, and methane production rates increased as the organic loading rate is increased. ADF toxicity effects were evident for 1.6% ADF at medium organic loadings (SOLR above 0.5gCOD/gVSS/d). In contrast, good reactor stability and excellent COD removal efficiencies were achieved at 1.2% ADF for reactor loadings approaching that of highly loaded systems (0.73gCOD/gVSS/d).

Analysis of dosimetry from the H.B. Robinson unit 2 pressure vessel benchmark using RAPTOR-M3G and ALPAN

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fischer, G.A.

2011-07-01

Document available in abstract form only, full text of document follows: The dosimetry from the H. B. Robinson Unit 2 Pressure Vessel Benchmark is analyzed with a suite of Westinghouse-developed codes and data libraries. The radiation transport from the reactor core to the surveillance capsule and ex-vessel locations is performed by RAPTOR-M3G, a parallel deterministic radiation transport code that calculates high-resolution neutron flux information in three dimensions. The cross-section library used in this analysis is the ALPAN library, an Evaluated Nuclear Data File (ENDF)/B-VII.0-based library designed for reactor dosimetry and fluence analysis applications. Dosimetry is evaluated with the industry-standard SNLRMLmore » reactor dosimetry cross-section data library. (authors)« less

Reactivity control assembly for nuclear reactor. [LMFBR

DOEpatents

Bollinger, L.R.

1982-03-17

This invention, which resulted from a contact with the United States Department of Energy, relates to a control mechanism for a nuclear reactor and, more particularly, to an assembly for selectively shifting different numbers of reactivity modifying rods into and out of the core of a nuclear reactor. It has been proposed heretofore to control the reactivity of a breeder reactor by varying the depth of insertion of control rods (e.g., rods containing a fertile material such as ThO/sub 2/) in the core of the reactor, thereby varying the amount of neutron-thermalizing coolant and the amount of neutron-capturing material in the core. This invention relates to a mechanism which can advantageously be used in this type of reactor control system.

Measuring the performance of G2G services in Iran

NASA Astrophysics Data System (ADS)

Zarei, Behrouz; Safdari, Maryam

To highlight the growth of e-government and the importance of its services it is essential to evaluate the performance of the service delivery to customers. Research indicates that traditional performance indexes are not suitable for this evaluation; moreover, it is noticeable that the e-government services are intangible and invisible. Among different e-government services, measurement of quality government to government (G2G) services has been less attractive for researchers while crucial for government policy-makers. This calls for a better understanding of the specific needs of users of these services in order to provide appropriate type and level of services that meets those needs. In this paper, the performance of the G2G services is measured in the Iranian context. For this purpose, SERVQUAL, which is a well-known method for assessing service quality, is employed. This study proposes and tests a five-factor of SERVQUAL instrument to explain user satisfaction and gap analysis, between expectations and perceptions of its customers, consisting thirty ministries and main governmental organizations. Based on a Chi-square test, factor analysis, gap analysis and correlations, it is concluded the gap between expectations and perceptions of G2G customers is significant and customer satisfaction of G2G services is at low level.

Acetone-butanol-ethanol (ABE) fermentation in an immobilized cell trickle bed reactor.

PubMed

Park, C H; Okos, M R; Wankat, P C

1989-06-05

Acetone-butanol-ethanol (ABE) fermentation was successfully carried out in an immobilized cell trickle bed reactor. The reactor was composed of two serial columns packed with Clostridium acetobutylicum ATCC 824 entrapped on the surface of natural sponge segments at a cell loading in the range of 2.03-5.56 g dry cells/g sponge. The average cell loading was 3.58 g dry cells/g sponge. Batch experiments indicated that a critical pH above 4.2 is necessary for the initiation of cell growth. One of the media used during continuous experiments consisted of a salt mixture alone and the other a nutrient medium containing a salt mixture with yeast extract and peptone. Effluent pH was controlled by supplying various fractions of the two different types of media. A nutrient medium fraction above 0.6 was crucial for successful fermentation in a trickle bed reactor. The nutrient medium fraction is the ratio of the volume of the nutrient medium to the total volume of nutrient plus salt medium. Supplying nutrient medium to both columns continuously was an effective way to meet both pH and nutrient requirement. A 257-mL reactor could ferment 45 g/L glucose from an initial concentration of 60 g/L glucose at a rate of 70 mL/h. Butanol, acetone, and ethanol concentrations were 8.82, 5.22, and 1.45 g/L, respectively, with a butanol and total solvent yield of 19.4 and 34.1 wt %. Solvent productivity in an immobilized cell trickle bed reactor was 4.2 g/L h, which was 10 times higher than that obtained in a batch fermentation using free cells and 2.76 times higher than that of an immobilized CSTR. If the nutrient medium fraction was below 0.6 and the pH was below 4.2, the system degenerated. Oxygen also contributed to the system degeneration. Upon degeneration, glucose consumption and solvent yield decreased to 30.9 g/L and 23.0 wt %, respectively. The yield of total liquid product (40.0 wt %) and butanol selectivity (60.0 wt %) remained almost constant. Once the cells were degenerated

Mesophilic and thermophilic biotreatment of BTEX-polluted air in reactors.

PubMed

Mohammad, Balsam T; Veiga, María C; Kennes, Christian

2007-08-15

This study compares the removal of a mixture of benzene, toluene, ethylbenzene, and all three xylene isomers (BTEX) in mesophilic and thermophilic (50 degrees C) bioreactors. In the mesophilic reactor fungi became dominant after long-term operation, while bacteria dominated in the thermophilic unit. Microbial acclimation was achieved by exposing the biofilters to initial BTEX loads of 2-15 g m(-3) h(-1), at an empty bed residence time of 96 s. After adaptation, the elimination capacities ranged from 3 to 188 g m(-3) h(-1), depending on the inlet load, for the mesophilic biofilter with removal efficiencies reaching 96%. On the other hand, in the thermophilic reactor the average removal efficiency was 83% with a maximum elimination capacity of 218 g m(-3) h(-1). There was a clear positive relationship between temperature gradients as well as CO(2) production and elimination capacities across the biofilters. The gas phase was sampled at different depths along the reactors observing that the percentage pollutant removal in each section was strongly dependant on the load applied. The fate of individual alkylbenzene compounds was checked, showing the unusually high biodegradation rate of benzene at high loads under thermophilic conditions (100%) compared to its very low removal in the mesophilic reactor at such load (<10%). Such difference was less pronounced for the other pollutants. After 210 days of operation, the dry biomass content for the mesophilic and thermophilic reactors were 0.300 and 0.114 g g(-1) (support), respectively, reaching higher removals under thermophilic conditions with a lower biomass accumulation, that is, lower pressure drop. (c) 2007 Wiley Periodicals, Inc.

The G value in plasma and radiation chemistry

NASA Technical Reports Server (NTRS)

Baird, James K.; Miller, George P.; Li, Ning

1990-01-01

The application of the G-value concept to plasma chemistry is considered. A general formula which expresses the G value for a general reaction in terms of experimentally controllable parameters is derived by applying simple gas-dynamic theory to a plasma reactor with straight walls. The formula expresses the G value as a function of the electrical power absorbed, the fraction of molecules transformed, and the flow rate of the gas entering the reactor. The formula was applied to the ammonia plasma radio-frequency discharge data of d'Agostino et al. (1981); the results showed that the G(-NH3) value lies in the range of 6.0-20 molecules/100 eV, depending on the conditions. This similarity of the G(-NH3) value with Peterson's (1974) range 2.7-10 found for the gas-phase radiolysis of ammonia, suggests that there might be a common reaction mechanism initiated by inelastic electron-molecule collisions.

Reactor Dosimetry State of the Art 2008

NASA Astrophysics Data System (ADS)

Voorbraak, Wim; Debarberis, Luigi; D'Hondt, Pierre; Wagemans, Jan

2009-08-01

Oral session 1: Retrospective dosimetry. Retrospective dosimetry of VVER 440 reactor pressure vessel at the 3rd unit of Dukovany NPP / M. Marek ... [et al.]. Retrospective dosimetry study at the RPV of NPP Greifswald unit 1 / J. Konheiser ... [et al.]. Test of prototype detector for retrospective neutron dosimetry of reactor internals and vessel / K. Hayashi ... [et al.]. Neutron doses to the concrete vessel and tendons of a magnox reactor using retrospective dosimetry / D. A. Allen ... [et al.]. A retrospective dosimetry feasibility study for Atucha I / J. Wagemans ... [et al.]. Retrospective reactor dosimetry with zirconium alloy samples in a PWR / L. R. Greenwood and J. P. Foster -- Oral session 2: Experimental techniques. Characterizing the Time-dependent components of reactor n/y environments / P. J. Griffin, S. M. Luker and A. J. Suo-Anttila. Measurements of the recoil-ion response of silicon carbide detectors to fast neutrons / F. H. Ruddy, J. G. Seidel and F. Franceschini. Measurement of the neutron spectrum of the HB-4 cold source at the high flux isotope reactor at Oak Ridge National Laboratory / J. L. Robertson and E. B. Iverson. Feasibility of cavity ring-down laser spectroscopy for dose rate monitoring on nuclear reactor / H. Tomita ... [et al.]. Measuring transistor damage factors in a non-stable defect environment / D. B. King ... [et al.]. Neutron-detection based monitoring of void effects in boiling water reactors / J. Loberg ... [et al.] -- Poster session 1: Power reactor surveillance, retrospective dosimetry, benchmarks and inter-comparisons, adjustment methods, experimental techniques, transport calculations. Improved diagnostics for analysis of a reactor pulse radiation environment / S. M. Luker ... [et al.]. Simulation of the response of silicon carbide fast neutron detectors / F. Franceschini, F. H. Ruddy and B. Petrović. NSV A-3: a computer code for least-squares adjustment of neutron spectra and measured dosimeter responses / J. G

The effect of catalyst length and downstream reactor distance on catalytic combustor performance

NASA Technical Reports Server (NTRS)

Anderson, D.

1980-01-01

A study was made to determine the effects on catalytic combustor performance which resulted from independently varying the length of a catalytic reactor and the length available for gas-phase reactions downstream of the catalyst. Monolithic combustion catalysts from three manufacturers were tested in a combustion test rig with no. 2 diesel fuel. Catalytic reactor lengths of 2.5 and 5.4 cm, and downstream gas-phase reaction distances of 7.3, 12.4, 17.5, and 22.5 cm were evaluated. Measurements of carbon monoxide, unburned hydrocarbons, nitrogen oxides, and pressure drop were made. The catalytic-reactor pressure drop was less than 1 percent of the upstream total pressure for all test configurations and test conditions. Nitrogen oxides and unburned hydrocarbons emissions were less than 0.25 g NO2/kg fuel and 0.6 g HC/kg fuel, respectively. The minimum operating temperature (defined as the adiabatic combustion temperature required to obtain carbon monoxide emissions below a reference level of 13.6 g CO/kg fuel) ranged from 1230 K to 1500 K for the various conditions and configurations tested. The minimum operating temperature decreased with increasing total (catalytic-reactor-plus-downstream-gas-phase-reactor-zone) residence time but was independent of the relative times spent in each region when the catalytic-reactor residence time was greater than or equal to 1.4 ms.

Comparison of some characteristics of aerobic granules and sludge flocs from sequencing batch reactors.

PubMed

Li, J; Garny, K; Neu, T; He, M; Lindenblatt, C; Horn, H

2007-01-01

Physical, chemical and biological characteristics were investigated for aerobic granules and sludge flocs from three laboratory-scale sequencing batch reactors (SBRs). One reactor was operated as normal SBR (N-SBR) and two reactors were operated as granular SBRs (G-SBR1 and G-SBR2). G-SBR1 was inoculated with activated sludge and G-SBR2 with granules from the municipal wastewater plant in Garching (Germany). The following major parameters and functions were measured and compared between the three reactors: morphology, settling velocity, specific gravity (SG), sludge volume index (SVI), specific oxygen uptake rate (SOUR), distribution of the volume fraction of extracellular polymeric substances (EPS) and bacteria, organic carbon and nitrogen removal. Compared with sludge flocs, granular sludge had excellent settling properties, good solid-liquid separation, high biomass concentration, simultaneous nitrification and denitrification. Aerobic granular sludge does not have a higher microbial activity and there are some problems including higher effluent suspended solids, lower ratio of VSS/SS and no nitrification at the beginning of cultivation. Measurement with CLSM and additional image analysis showed that EPS glycoconjugates build one main fraction inside the granules. The aerobic granules from G-SBR1 prove to be heavier, smaller and have a higher microbial activity compared with G-SBR2. Furthermore, the granules were more compact, with lower SVI and less filamentous bacteria.

Benchmark tests of JENDL-3.2 for thermal and fast reactors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Takano, Hideki; Akie, Hiroshi; Kikuchi, Yasuyuki

1994-12-31

Benchmark calculations for a variety of thermal and fast reactors have been performed by using the newly evaluated JENDL-3 Version-2 (JENDL-3.2) file. In the thermal reactor calculations for the uranium and plutonium fueled cores of TRX and TCA, the k{sub eff} and lattice parameters were well predicted. The fast reactor calculations for ZPPR-9 and FCA assemblies showed that the k{sub eff} reactivity worths of Doppler, sodium void and control rod, and reaction rate distribution were in a very good agreement with the experiments.

Synthesis of G-N2-(CH2)3-N2-G Trimethylene DNA interstrand cross-links

PubMed Central

Gruppi, Francesca; Salyard, Tracy L. Johnson; Rizzo, Carmelo J.

2014-01-01

The synthesis of G-N2-(CH2)3-N2-G trimethylene DNA interstrand cross-links (ICLs) in a 5′-CG-3′ and 5′-GC-3′ sequence from oligodeoxynucleotides containing N2-(3-aminopropyl)-2′-deoxyguanosine and 2-fluoro-O6-(trimethylsilylethyl)inosine is presented. Automated solid-phase DNA synthesis was used for unmodified bases and modified nucleotides were incorporated via their corresponding phosphoramidite reagent by a manual coupling protocol. The preparation of the phosphoramidite reagents for incorporation of N2-(3-aminopropyl)-2′-deoxyguanosine is reported. The high-purity trimethylene DNA interstrand cross-link product is obtained through a nucleophilic aromatic substitution reaction between the N2-(3-aminopropyl)-2′-deoxyguanosine and 2-fluoro-O6-(trimethylsilylethyl)inosine containing oligodeoxynucleotides. PMID:25431636

OVA-bound nanoparticles induce OVA-specific IgG1, IgG2a, and IgG2b responses with low IgE synthesis.

PubMed

Yanase, Noriko; Toyota, Hiroko; Hata, Kikumi; Yagyu, Seina; Seki, Takahiro; Harada, Mitsunori; Kato, Yasuki; Mizuguchi, Junichiro

2014-10-14

There is an urgent requirement for a novel vaccine that can stimulate immune responses without unwanted toxicity, including IgE elevation. We examined whether antigen ovalbumin (OVA) conjugated to the surface of nanoparticles (NPs) (OVA-NPs) with average diameter of 110nm would serve as an immune adjuvant. When BALB/c mice were immunized with OVA-NPs, they developed sufficient levels of OVA-specific IgG1 antibody responses with low levels of IgE synthesis, representing helper T (Th)2-mediated humoral immunity. OVA-specific IgG2a and IgG2b responses (i.e., Th1-mediated immunity) were also induced by secondary immunization with OVA-NPs. As expected, immunization with OVA in alum (OVA-alum) stimulated humoral immune responses, including IgG1 and IgE antibodies, with only low levels of IgG2a/IgG2b antibodies. CD4-positive T cells from mice primed with OVA-NPs produced substantial levels of IL-21 and IL-4, comparable to those from OVA-alum group. The irradiated mice receiving OVA-NPs-primed B cells together with OVA-alum-primed T cells exhibited enhanced anti-OVA IgG2b responses relative to OVA-alum-primed B cells and T cells following stimulation with OVA-NPs. Moreover, when OVA-NPs-primed, but not OVA-alum-primed, B cells were cultured in the presence of anti-CD40 monoclonal antibody, IL-4, and IL-21, or LPS plus TGF-β in vitro, OVA-specific IgG1 or IgG2b antibody responses were elicited, suggesting that immunization with OVA-NPs modulates B cells to generate IgG1 and IgG2b responses. Thus, OVA-NPs might exert their adjuvant action on B cells, and they represent a promising potential vaccine for generating both IgG1 and IgG2a/IgG2b antibody responses with low IgE synthesis. Copyright © 2014 Elsevier Ltd. All rights reserved.

Development of a reactor with carbon catalysts for modular-scale, low-cost electrochemical generation of H 2O 2

DOE PAGES

Chen, Zhihua; Chen, Shucheng; Siahrostami, Samira; ...

2017-03-01

The development of small-scale, decentralized reactors for H 2O 2 production that can couple to renewable energy sources would be of great benefit, particularly for water purification in the developing world. Herein, we describe our efforts to develop electrochemical reactors for H 2O 2 generation with high Faradaic efficiencies of >90%, requiring cell voltages of only ~1.6 V. The reactor employs a carbon-based catalyst that demonstrates excellent performance for H 2O 2 production under alkaline conditions, as demonstrated by fundamental studies involving rotating-ring disk electrode methods. Finally, the low-cost, membrane-free reactor design represents a step towards a continuous, modular-scale, de-centralizedmore » production of H 2O 2.« less

10 CFR 2.809 - Participation by the Advisory Committee on Reactor Safeguards.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 10 Energy 1 2011-01-01 2011-01-01 false Participation by the Advisory Committee on Reactor Safeguards. 2.809 Section 2.809 Energy NUCLEAR REGULATORY COMMISSION RULES OF PRACTICE FOR DOMESTIC LICENSING PROCEEDINGS AND ISSUANCE OF ORDERS Rulemaking § 2.809 Participation by the Advisory Committee on Reactor...

Absorption and Metabolism of Phenolics from Digests of Polyphenol-Rich Potato Extracts Using the Caco-2/HepG2 Co-Culture System

PubMed Central

Sadeghi Ekbatan, Shima; Iskandar, Michele M.; Sleno, Lekha; Sabally, Kebba; Khairallah, Joelle; Prakash, Satya

2018-01-01

The bioactivity of dietary polyphenols depends upon gastrointestinal and hepatic metabolism of secondary microbial phenolic metabolites generated via colonic microbiota-mediated biotransformation. A polyphenol-rich potato extract (PRPE) containing chlorogenic, caffeic, and ferulic acids and rutin was digested in a dynamic multi-reactor gastrointestinal simulator of the human intestinal microbial ecosystem (GI model). Simulated digestion showed extensive degradation of the parent compounds and the generation of microbial phenolic metabolites. To characterize the transport and metabolism of microbial phenolic metabolites following digestion, a co-culture of intestinal Caco-2 and hepatic HepG2 cells was exposed to the PRPE-derived digests obtained from the colonic vessels. Following a 2 h incubation of the digesta with the Caco-2/HepG2 co-cultures, approximately 10–15% of ferulic, dihydrocaffeic, and dihydroferulic acids and 3–5% of 3-hydroxybenzoic, 3-hydroxyphenylpropionic, and coumaric acids were observed in the basolateral side, whereas 3-hydroxyphenylacetic acid, phenylpropanoic acid, and cinnamic acid were not detected. Subsequent HepG2 cellular metabolism led to major increases in ferulic, dihydrocaffeic, 3-hydroxyphenylpropionic, and coumaric acids ranging from 160–370%. These findings highlight the importance of hepatic metabolism towards the generation of secondary metabolites of polyphenols despite low selective Caco-2 cellular uptake of microbial phenolic metabolites. PMID:29329242

G2 Flywheel Module Design

NASA Technical Reports Server (NTRS)

Jensen, Ralph H.; Dever, Timothy P.

2006-01-01

Design of a flywheel module, designated the G2 module, is described. The G2 flywheel is a 60,000 RPM, 525 W-hr, 1 kW system designed for a laboratory environment; it will be used for component testing and system demonstrations, with the goal of applying flywheels to aerospace energy storage and integrated power and attitude control (IPACS) applications. G2 has a modular design, which allows for new motors, magnetic bearings, touchdown bearings, and rotors to be installed without a complete redesign of the system. This design process involves several engineering disciplines, and requirements are developed for the speed, energy storage, power level, and operating environment. The G2 rotor system consists of a multilayer carbon fiber rim with a titanium hub on which the other components mount, and rotordynamics analysis is conducted to ensure rigid and flexible rotor modes are controllable or outside of the operating speed range. Magnetic bearings are sized using 1-D magnetic circuit analysis and refined using 3-D finite element analysis. The G2 magnetic bearing system was designed by Texas A&M and has redundancy which allows derated operation after the loss of some components, and an existing liquid cooled two pole permanent magnet motor/generator is used. The touchdown bearing system is designed with a squeeze film damper system allowing spin down from full operating speed in case of a magnetic bearing failure. The G2 flywheel will enable module level demonstrations of component technology, and will be a key building block in system level attitude control and IPACS demonstrations.

Tower Shielding Reactor II design and operation report: Vol. 2. Safety Analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Holland, L. B.; Kolb, J. O.

1970-01-01

Information on the Tower Shielding Reactor II is contained in the TSR-II Design and Operation Report and in the Tower Shielding Facility Manual. The TSR-II Design and Operating Report consists of three volumes. Volume 1 is Descriptions of the Tower Shielding Reactor II and Facility; Volume 2 is Safety analysis of the Tower Shielding Reactor II; and Volume 3 is the Assembly and Testing of the Tower Shielding Reactor II Control Mechanism Housing.

Cardiovascular effects of anti-G suit inflation at 1 and 2 G.

PubMed

Montmerle, Stéphanie; Linnarsson, Dag

2005-06-01

We sought to determine to which pressure a full-coverage anti-G suit needs to be inflated in order to obtain the same stroke volume during a brief exposure to twice the normal gravity (2 G) as that at 1 G without anti-G suit inflation. Nine sitting subjects were studied at normal (1 G) and during 20 s of exposure to 2 G. They wore anti-G suits, which were inflated at both G-levels to the following target pressures: 0, 70, 140 and 210 mmHg. Stroke volume was computed from cardiac output, which was measured by rebreathing. Heart rate and mean arterial pressure at heart level were recorded. Inflation to 70 mmHg compensated for the decrease in stroke volume and cardiac output caused by hypergravity. Mean arterial pressure at heart level was comparable at 1 G and at 2 G and increased gradually and similarly with inflation (P<0.001) at both gravity levels. Thus, anti-G suits act by increasing both preload and afterload but the two effects counteract each other in terms of cardiac output, so that cardiac output at 2 G is maintained at its 1 G level. This effect is reached already at 70 mmHg of inflation. Greater inflation pressure further increases mean arterial pressure at heart level and compensates for the increased difference in hydrostatic pressure between heart and head in moderate hypergravity.

The H,G_1,G_2 photometric system with scarce observational data

NASA Astrophysics Data System (ADS)

Penttilä, A.; Granvik, M.; Muinonen, K.; Wilkman, O.

2014-07-01

The H,G_1,G_2 photometric system was officially adopted at the IAU General Assembly in Beijing, 2012. The system replaced the H,G system from 1985. The 'photometric system' is a parametrized model V(α; params) for the magnitude-phase relation of small Solar System bodies, and the main purpose is to predict the magnitude at backscattering, H := V(0°), i.e., the (absolute) magnitude of the object. The original H,G system was designed using the best available data in 1985, but since then new observations have been made showing certain features, especially near backscattering, to which the H,G function has troubles adjusting to. The H,G_1,G_2 system was developed especially to address these issues [1]. With a sufficient number of high-accuracy observations and with a wide phase-angle coverage, the H,G_1,G_2 system performs well. However, with scarce low-accuracy data the system has troubles producing a reliable fit, as would any other three-parameter nonlinear function. Therefore, simultaneously with the H,G_1,G_2 system, a two-parameter version of the model, the H,G_{12} system, was introduced [1]. The two-parameter version ties the parameters G_1,G_2 into a single parameter G_{12} by a linear relation, and still uses the H,G_1,G_2 system in the background. This version dramatically improves the possibility to receive a reliable phase-curve fit to scarce data. The amount of observed small bodies is increasing all the time, and so is the need to produce estimates for the absolute magnitude/diameter/albedo and other size/composition related parameters. The lack of small-phase-angle observations is especially topical for near-Earth objects (NEOs). With these, even the two- parameter version faces problems. The previous procedure with the H,G system in such circumstances has been that the G-parameter has been fixed to some constant value, thus only fitting a single-parameter function. In conclusion, there is a definitive need for a reliable procedure to produce

[Pseudolaric acid B induces G2/M arrest and inhibits invasion and migration in HepG2 hepatoma cells].

PubMed

Li, Shuai; Guo, Lianyi

2018-01-01

Objective To investigate the mechanisms of pseudolaric acid B (PAB) blocks cell cycle and inhibits invasion and migration in human hepatoma HepG2 cells. Methods The proliferation effect of PAB on HepG2 cells was evaluated by MTT assay. The effect of PAB on the cell cycle of HepG2 cells was analyzed by flow cytometry. Immunofluorescence cytochemical staining was applied to observe the effect of PAB on the α-tubulin polymerization and expression in HepG2 cells. Transwell TM chamber invasion assay and wound healing assay were performed to detect the influence of PAB on the migration and invasion ability of HepG2 cells. Western blotting was used to determine the expressions of α-tubulin, E-cadherin and MMP-9 in HepG2 cells after treated with PAB. Results PAB inhibited the proliferation of HepG2 cells in a dose-dependent manner and blocked the cell cycle in G2/M phase. PAB significantly changed the polymerization and decreased the expression of α-tubulin. The capacities of invasion and migration of HepG2 cells treated by PAB were significantly depressed. The protein levels of α-tubulin and MMP-9 decreased while the E-cadherin protein level increased. Conclusion PAB can inhibits the proliferation of HepG2 cells by down-regulating the expression of α-tubulin and influencing its polymerization, arresting HepG2 cells in G2/M phase. Meanwhile, PAB also can inhibit the invasion and migration of HepG2 cells by lowering cytoskeleton α-tubulin and MMP-9, and increasing E-cadherin.

Electrons to Reactors Multiscale Modeling: Catalytic CO Oxidation over RuO 2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sutton, Jonathan E.; Lorenzi, Juan M.; Krogel, Jaron T.

First-principles kinetic Monte Carlo (1p-kMC) simulations for CO oxidation on two RuO 2 facets, RuO 2(110) and RuO 2(111), were coupled to the computational fluid dynamics (CFD) simulations package MFIX, and reactor-scale simulations were then performed. 1p-kMC coupled with CFD has recently been shown as a feasible method for translating molecular scale mechanistic knowledge to the reactor scale, enabling comparisons to in situ and online experimental measurements. Only a few studies with such coupling have been published. This work incorporates multiple catalytic surface facets into the scale-coupled simulation, and three possibilities were investigated: the two possibilities of each facet individuallymore » being the dominant phase in the reactor, and also the possibility that both facets were present on the catalyst particles in the ratio predicted by an ab initio thermodynamics-based Wulff construction. When lateral interactions between adsorbates were included in the 1p-kMC simulations, the two surfaces, RuO 2(110) and RuO 2(111), were found to be of similar order-of-magnitude in activity for the pressure range of 1 × 10 –4 bar to 1 bar, with the RuO 2(110) surface-termination showing more simulated activity than the RuO 2(111) surface-termination. Coupling between the 1p-kMC and CFD was achieved with a lookup table generated by the error-based modified Shepard interpolation scheme. Isothermal reactor scale simulations were performed and compared to two separate experimental studies, conducted with reactant partial pressures of ≤0.1 bar. Simulations without an isothermality restriction were also conducted and showed that the simulated temperature gradient across the catalytic reactor bed is <0.5 K, which validated the use of the isothermality restriction for investigating the reactor-scale phenomenological temperature dependences. The approach with the Wulff construction based reactor simulations reproduced a trend similar to one experimental data set

Electrons to Reactors Multiscale Modeling: Catalytic CO Oxidation over RuO 2

DOE PAGES

Sutton, Jonathan E.; Lorenzi, Juan M.; Krogel, Jaron T.; ...

2018-04-20

First-principles kinetic Monte Carlo (1p-kMC) simulations for CO oxidation on two RuO 2 facets, RuO 2(110) and RuO 2(111), were coupled to the computational fluid dynamics (CFD) simulations package MFIX, and reactor-scale simulations were then performed. 1p-kMC coupled with CFD has recently been shown as a feasible method for translating molecular scale mechanistic knowledge to the reactor scale, enabling comparisons to in situ and online experimental measurements. Only a few studies with such coupling have been published. This work incorporates multiple catalytic surface facets into the scale-coupled simulation, and three possibilities were investigated: the two possibilities of each facet individuallymore » being the dominant phase in the reactor, and also the possibility that both facets were present on the catalyst particles in the ratio predicted by an ab initio thermodynamics-based Wulff construction. When lateral interactions between adsorbates were included in the 1p-kMC simulations, the two surfaces, RuO 2(110) and RuO 2(111), were found to be of similar order-of-magnitude in activity for the pressure range of 1 × 10 –4 bar to 1 bar, with the RuO 2(110) surface-termination showing more simulated activity than the RuO 2(111) surface-termination. Coupling between the 1p-kMC and CFD was achieved with a lookup table generated by the error-based modified Shepard interpolation scheme. Isothermal reactor scale simulations were performed and compared to two separate experimental studies, conducted with reactant partial pressures of ≤0.1 bar. Simulations without an isothermality restriction were also conducted and showed that the simulated temperature gradient across the catalytic reactor bed is <0.5 K, which validated the use of the isothermality restriction for investigating the reactor-scale phenomenological temperature dependences. The approach with the Wulff construction based reactor simulations reproduced a trend similar to one experimental data set

Comprehensive phenotypic analysis of knockout mice deficient in cyclin G1 and cyclin G2

PubMed Central

Ohno, Shouichi; Ikeda, Jun-ichiro; Naito, Yoko; Okuzaki, Daisuke; Sasakura, Towa; Fukushima, Kohshiro; Nishikawa, Yukihiro; Ota, Kaori; Kato, Yorika; Wang, Mian; Torigata, Kosuke; Kasama, Takashi; Uchihashi, Toshihiro; Miura, Daisaku; Yabuta, Norikazu; Morii, Eiichi; Nojima, Hiroshi

2016-01-01

Cyclin G1 (CycG1) and Cyclin G2 (CycG2) play similar roles during the DNA damage response (DDR), but their detailed roles remain elusive. To investigate their distinct roles, we generated knockout mice deficient in CycG1 (G1KO) or CycG2 (G2KO), as well as double knockout mice (DKO) deficient in both proteins. All knockouts developed normally and were fertile. Generation of mouse embryonic fibroblasts (MEFs) from these mice revealed that G2KO MEFs, but not G1KO or DKO MEFs, were resistant to DNA damage insults caused by camptothecin and ionizing radiation (IR) and underwent cell cycle arrest. CycG2, but not CycG1, co-localized with γH2AX foci in the nucleus after γ-IR, and γH2AX-mediated DNA repair and dephosphorylation of CHK2 were delayed in G2KO MEFs. H2AX associated with CycG1, CycG2, and protein phosphatase 2A (PP2A), suggesting that γH2AX affects the function of PP2A via direct interaction with its B’γ subunit. Furthermore, expression of CycG2, but not CycG1, was abnormal in various cancer cell lines. Kaplan–Meier curves based on TCGA data disclosed that head and neck cancer patients with reduced CycG2 expression have poorer clinical prognoses. Taken together, our data suggest that reduced CycG2 expression could be useful as a novel prognostic marker of cancer. PMID:27982046

Sequencing batch reactor biofilm system for treatment of milk industry wastewater.

PubMed

Sirianuntapiboon, Suntud; Jeeyachok, Narumon; Larplai, Rarintorn

2005-07-01

A sequencing batch reactor biofilm (MSBR) system was modified from the conventional sequencing batch reactor (SBR) system by installing 2.7 m2 surface area of plastic media on the bottom of the reactor to increase the system efficiency and bio-sludge quality by increasing the bio-sludge in the system. The COD, BOD5, total kjeldahl nitrogen (TKN) and oil & grease removal efficiencies of the MSBR system, under a high organic loading of 1340 g BOD5/m3 d, were 89.3+/-0.1, 83.0+/-0.2, 59.4+/-0.8, and 82.4+/-0.4%, respectively, while they were only 87.0+/-0.2, 79.9+/-0.3, 48.7+/-1.7 and 79.3+/-10%, respectively, in the conventional SBR system. The amount of excess bio-sludge in the MSBR system was about 3 times lower than that in the conventional SBR system. The sludge volume index (SVI) of the MSBR system was lower than 100 ml/g under an organic loading of up to 1340 g BOD5/m3 d. However, the MSBR under an organic loading of 680 g BOD5/m3 d gave the highest COD, BOD5, TKN and oil & grease removal efficiencies of 97.9+/-0.0, 97.9+/-0.1, 79.3+/-1.0 and 94.8+/-0.5%, respectively, without any excess bio-sludge waste. The SVI of suspended bio-sludge in the MSBR system was only 44+/-3.4 ml/g under an organic loading of 680 g BOD5/m3 d.

Proceedings of the 1992 topical meeting on advances in reactor physics. Volume 2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

1992-04-01

This document, Volume 2, presents proceedings of the 1992 Topical Meeting on Advances in Reactor Physics on March 8--11, 1992 at Charleston, SC. Session topics were as follows: Transport Theory; Fast Reactors; Plant Analyzers; Integral Experiments/Measurements & Analysis; Core Computational Systems; Reactor Physics; Monte Carlo; Safety Aspects of Heavy Water Reactors; and Space-Time Core Kinetics. The individual reports have been cataloged separately. (FI)

Improvement of poly-γ-glutamic acid biosynthesis in a moving bed biofilm reactor by Bacillus subtilis NX-2.

PubMed

Jiang, Yongxiang; Tang, Bao; Xu, Zongqi; Liu, Kun; Xu, Zheng; Feng, Xiaohai; Xu, Hong

2016-10-01

The production of poly-γ-glutamic acid (γ-PGA) by Bacillus subtilis NX-2 using a moving bed biofilm reactor (MBBR) system was tested for the first time in this study. Polypropylene TL-2 was chosen as a suitable carrier, and γ-PGA concentration of 42.7±0.86g/L and productivity of 0.59±0.06g/(Lh) were obtained in batch fermentation. After application of the strategy of dissolved oxygen (DO)-stat feeding, higher γ-PGA concentration and productivity were achieved than with glucose feedback feeding. Finally, the repeated fed-batch cultures implemented in the MBBR system showed high stability, and the maximal γ-PGA concentration and productivity of 74.2g/L and 1.24g/(Lh) were achieved, respectively. In addition, the promotion of oxygen transfer by an MBBR carrier was well explained by a computational fluid dynamics (CFD) simulation. These results suggest that an MBBR system could be applied to large-scale γ-PGA production. Copyright © 2016 Elsevier Ltd. All rights reserved.

ETR, TRA642. ON GROUND FLOOR. THE 60TON ETR REACTOR VESSEL ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

ETR, TRA-642. ON GROUND FLOOR. THE 60-TON ETR REACTOR VESSEL IS DROPPED INTO PLACE OVER PIT. KAISER USED TWO MULTI-BLOCK DRUM PULLEYS WITH A COMBINED CAPACITY OF 100 TONS AND A 100-TON DRUM HOIST. THE VESSEL WAS 35 1/2 FEET LONG. INL NEGATIVE NO. 56-4149. R.G. Larsen, Photographer, 12/18/1956 - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

UPSS and G2

NASA Technical Reports Server (NTRS)

Dito, Scott J.

2014-01-01

The Universal Propellant Servicing System (UPSS) is a dedicated mobile launcher propellant delivery method that will minimize danger and complexity in order to allow vehicles to be serviced and ultimately launched from a variety of locations previously not seen fit for space launch. The UPPS/G2 project is the development of a model, simulation, and ultimately a working application that will control and monitor the cryogenic fluid delivery to the rocket for testing purposes. To accomplish this, the project is using the programming language/environment Gensym G2. The environment is an all-inclusive application that allows development, testing, modeling, and finally operation of the unique application through graphical and programmatic methods. We have learned G2 through classes and trial-and-error, and are now in the process of building the application that will soon be able to be tested on apparatuses here at Kennedy Space Center, and eventually on the actual unit. The UPSS will bring near-autonomous control of launches to those that need it, as well it will be a great addition to NASA and KSC's operational viability and the opportunity to bring space launches to parts of the world, and in time constraints, once not thought possible.

Packed- and fluidized-bed biofilm reactor performance for anaerobic wastewater treatment.

PubMed

Denac, M; Dunn, I J

1988-07-05

Anaerobic degradation performance of a laboratory-scale packed-bed reactor (PBR) was compared with two fluidized-bed biofilm reactors (FBRs) on molasses and whey feeds. The reactors were operated under constant pH (7) and temperature (35 degrees C) conditions and were well mixed with high recirculation rates. The measured variables were chemical oxygen demand (COD), individual organic acids, gas composition, and gas rates. As carrier, sand of 0.3-0.5 mm diameter was used in the FBR, and porous clay spheres of 6 mm diameter were used in the PBR. Startup of the PBR was achieved with 1-5 day residence times. Start-up of the FBR was only successful if liquid residence times were held low at 2-3 h. COD degradations of 86% with molasses (90% was biodegradable) were reached in both the FBR and PBR at 6 h residence time and loadings of 10 g COD/L day. At higher loadings the FBR gave the best performance; even at 40-45 g COD/L day, with 6 h residence times, 70% COD was degraded. The PBR could not be operated above 20 g COD/L day without clogging. A comparison of the reaction rates show that the PBR and FBR per formed similarly at low concentrations in the reactors up to 1 g COD/L, while above 3 g COD/L the rates were 17.4 g COD/L day for the PBR and 38.4 g COD/L day for the FBR. This difference is probably due to diffusion limitations and a less active biomass content of the PBR compared with the fluidized bed.The results of dynamic step change experiments, in which residence times and feed concentrations were changed hanged at constant loading, demonstrated the rapid response of the reactors. Thus, the response times for an increase in gas rate or an increase in organic acids due to an increase in feed concentration were less than 1 day and could be explained by substrate limitation. Other slower responses were observed in which the reactor culture adapted over periods of 5-10 days; these were apparently growth related. An increase in loading of over 100% always resulted

Muon g-2

Science.gov Websites

Related Links A Key Contribution from Brookhaven Laboratory The Big Move Muon Department Facebook g-2 on is filled with an invisible sea of virtual particles that -in accordance with the laws of quantum presence and nature of these virtual particles with particle beams traveling in a magnetic field. The Muon

Pd-Ag Membrane Coupled to a Two-Zone Fluidized Bed Reactor (TZFBR) for Propane Dehydrogenation on a Pt-Sn/MgAl2O4 Catalyst

PubMed Central

Medrano, José-Antonio; Julián, Ignacio; Herguido, Javier; Menéndez, Miguel

2013-01-01

Several reactor configurations have been tested for catalytic propane dehydrogenation employing Pt-Sn/MgAl2O4 as a catalyst. Pd-Ag alloy membranes coupled to the multifunctional Two-Zone Fluidized Bed Reactor (TZFBR) provide an improvement in propane conversion by hydrogen removal from the reaction bed through the inorganic membrane in addition to in situ catalyst regeneration. Twofold process intensification is thereby achieved when compared to the use of traditional fluidized bed reactors (FBR), where coke formation and thermodynamic equilibrium represent important process limitations. Experiments were carried out at 500–575 °C and with catalyst mass to molar flow of fed propane ratios between 15.1 and 35.2 g min mmol−1, employing three different reactor configurations: FBR, TZFBR and TZFBR + Membrane (TZFBR + MB). The results in the FBR showed catalyst deactivation, which was faster at high temperatures. In contrast, by employing the TZFBR with the optimum regenerative agent flow (diluted oxygen), the process activity was sustained throughout the time on stream. The TZFBR + MB showed promising results in catalytic propane dehydrogenation, displacing the reaction towards higher propylene production and giving the best results among the different reactor configurations studied. Furthermore, the results obtained in this study were better than those reported on conventional reactors. PMID:24958620

Feasibility study of a magnetic fusion production reactor

NASA Astrophysics Data System (ADS)

Moir, R. W.

1986-12-01

A magnetic fusion reactor can produce 10.8 kg of tritium at a fusion power of only 400 MW —an order of magnitude lower power than that of a fission production reactor. Alternatively, the same fusion reactor can produce 995 kg of plutonium. Either a tokamak or a tandem mirror production plant can be used for this purpose; the cost is estimated at about 1.4 billion (1982 dollars) in either case. (The direct costs are estimated at 1.1 billion.) The production cost is calculated to be 22,000/g for tritium and 260/g for plutonium of quite high purity (1%240Pu). Because of the lack of demonstrated technology, such a plant could not be constructed today without significant risk. However, good progress is being made in fusion technology and, although success in magnetic fusion science and engineering is hard to predict with assurance, it seems possible that the physics basis and much of the needed technology could be demonstrated in facilities now under construction. Most of the remaining technology could be demonstrated in the early 1990s in a fusion test reactor of a few tens of megawatts. If the Magnetic Fusion Energy Program constructs a fusion test reactor of approximately 400 MW of fusion power as a next step in fusion power development, such a facility could be used later as a production reactor in a spinoff application. A construction decision in the late 1980s could result in an operating production reactor in the late 1990s. A magnetic fusion production reactor (MFPR) has four potential advantages over a fission production reactor: (1) no fissile material input is needed; (2) no fissioning exists in the tritium mode and very low fissioning exists in the plutonium mode thus avoiding the meltdown hazard; (3) the cost will probably be lower because of the smaller thermal power required; (4) and no reprocessing plant is needed in the tritium mode. The MFPR also has two disadvantages: (1) it will be more costly to operate because it consumes rather than sells

Osthole induces G2/M cell cycle arrest and apoptosis in human hepatocellular carcinoma HepG2 cells.

PubMed

Chao, Xu; Zhou, Xiaojun; Zheng, Gang; Dong, Changhu; Zhang, Wei; Song, Xiaomei; Jin, Tianbo

2014-05-01

Osthole [7-methoxy-8-(3-methyl-2-butenyl) coumarin] isolated from the fruit of Cnidium monnieri (L.) Cuss, one of the commonly used Chinese medicines listed in the Shennong's Classic of Materia Medica in the Han Dynasty, had remarkable antiproliferative activity against human hepatocellular carcinoma HepG2 cells in culture. This study evaluated the effects of osthole on cell growth, nuclear morphology, cell cycle distribution, and expression of apoptosis-related proteins in HepG2 cells. Cytotoxic activity of osthole was determined by the MTT assay at various concentrations ranging from 0.004 to 1.0 µmol/ml in HepG2 cells. Cell morphology was assessed by Hoechst staining and fluorescence microscopy. Apoptosis and cell-cycle distribution was determined by annexin V staining and flow cytometry. Apoptotic protein levels were assessed by Western blot. Osthole exhibited significant inhibition of the survival of HepG2 cells and the half inhibitory concentration (IC₅₀) values were 0.186, 0.158 and 0.123 µmol/ml at 24, 48 and 72 h, respectively. Cells treated with osthole at concentrations of 0, 0.004, 0.02, 0.1 and 0.5 μmol/ml showed a statistically significant increase in the G2/M fraction accompanied by a decrease in the G0/G1 fraction. The increase of apoptosis induced by osthole was correlated with down-regulation expression of anti-apoptotic Bcl-2 protein and up-regulation expression of pro-apoptotic Bax and p53 proteins. Osthole had significant growth inhibitory activity and the pro-apoptotic effect of osthole is mediated through the activation of caspases and mitochondria in HepG2 cells. Results suggest that osthole has promising therapeutic potential against hepatocellular carcinoma.

Promoting degradation of 2,4-dichlorophenoxyacetic acid with fermentative effluents from hydrogen-producing reactor.

PubMed

Yang, Zhiman; Shi, Xiaoshuang; Dai, Meng; Wang, Lin; Xu, Xiaohui; Guo, Rongbo

2018-06-01

This research aims to identifying the potential effect of using a hydrogen-producing reactor's effluent as an enrichment amendment for enhancing the degradation rates of 2,4-dichlorophenoxyacetic acid (2,4-D) during the bioremediation of contaminated paddy soils. The results showed that addition of the effluents to 2,4-D- degrading enrichment culture enhanced (up to 1.3-fold) the degradation rate constant of 2,4-D. The enhancement effect most probably resulted from the co-metabolic degradation of 2,4-D facilitated by volatile fatty acids (e.g., acetate, propionate, and butyrate) in the effluents which served as the beneficial substrates. Results from DNA sequencing analysis showed that the effluent additions shifted the bacterial community composition in the enrichment culture. Dechloromonas and Clostridium were two dominant bacterial genera involved in 2,4-D degradation. The findings will make a substantial contribution to remediation of soils contaminated with 2,4-D. Copyright © 2018 Elsevier Ltd. All rights reserved.

A neutronics feasibility study for the LEU conversion of Poland's Maria research reactor.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bretscher, M. M.

1998-10-14

The MARIA reactor is a high-flux multipurpose research reactor which is water-cooled and moderated with both beryllium and water. Standard HEU (80% {sup 235}U)fuel assemblies consist of six concentric fuel tubes of a U-Al alloy clad in aluminum. Although the inventory of HEU (80%) fuel is nearly exhausted, a supply of highly-loaded 36%-enriched fuel assemblies is available at the reactor site. Neutronic equilibrium studies have been made to determine the relative performance of fuels with enrichments of 80%, 36% and 19.7%. These studies indicate that LEU (19.7%) densities of about 2.5 gU/cm{sup 3} and 3.8 gU/cm{sup 3} are required tomore » match the performance of the MARIA reactor with 80%-enriched and with 36%-enriched fuels, respectively.« less

Thermodynamic analysis of in situ gasification-chemical looping combustion (iG-CLC) of Indian coal.

PubMed

Suresh, P V; Menon, Kavitha G; Prakash, K S; Prudhvi, S; Anudeep, A

2016-10-01

Chemical looping combustion (CLC) is an inherent CO 2 capture technology. It is gaining much interest in recent years mainly because of its potential in addressing climate change problems associated with CO 2 emissions from power plants. A typical chemical looping combustion unit consists of two reactors-fuel reactor, where oxidation of fuel occurs with the help of oxygen available in the form of metal oxides and, air reactor, where the reduced metal oxides are regenerated by the inflow of air. These oxides are then sent back to the fuel reactor and the cycle continues. The product gas from the fuel reactor contains a concentrated stream of CO 2 which can be readily stored in various forms or used for any other applications. This unique feature of inherent CO 2 capture makes the technology more promising to combat the global climate changes. Various types of CLC units have been discussed in literature depending on the type of fuel burnt. For solid fuel combustion three main varieties of CLC units exist namely: syngas CLC, in situ gasification-CLC (iG-CLC) and chemical looping with oxygen uncoupling (CLOU). In this paper, theoretical studies on the iG-CLC unit burning Indian coal are presented. Gibbs free energy minimization technique is employed to determine the composition of flue gas and oxygen carrier of an iG-CLC unit using Fe 2 O 3 , CuO, and mixed carrier-Fe 2 O 3 and CuO as oxygen carriers. The effect of temperature, suitability of oxygen carriers, and oxygen carrier circulation rate on the performance of a CLC unit for Indian coal are studied and presented. These results are analyzed in order to foresee the operating conditions at which economic and smooth operation of the unit is expected.

In vitro synthesis and processing of herpes simplex virus type 2 gG-2, using cell-free transcription and translation systems.

PubMed Central

Weldon, S K; Su, H K; Fetherston, J D; Courtney, R J

1990-01-01

Translation of in vitro-synthesized herpes simplex virus type 2 (HSV-2) gG-2 mRNA in a reticulocyte lysate system was used to study the processing of HSV-2 gG-2. In the presence of canine pancreatic microsomal membranes, a single species that is protected from trypsin digestion was detected. This product comigrates with the 104,000-Mr (104K) high mannose intermediate seen in HSV-2-infected-cell lysates. Endo-beta-N-acetylglucosaminidase H treatment of the in vitro-synthesized 104K protein yielded a single product migrating at 100 K. The 72K and 31K cleavage products of gG-2 were not observed in the in vitro system. These data show that the molecular weight of the nonglycosylated form of the gG-2 protein is 100,000 and that the cotranslational processing of this protein in the endoplasmic reticulum yields the 104K high-mannose intermediate. Images PMID:2154614

Simultaneous Bioreduction of Multiple Oxidized Contaminants Using a Membrane Biofilm Reactor.

PubMed

Li, Haixiang; Lin, Hua; Xu, Xiaoyin; Jiang, Minmin; Chang, Chein-Chi; Xia, Siqing

2017-02-01

  This study tests a hydrogen-based membrane biofilm reactor (MBfR) to investigate simultaneous bioreduction of selected oxidized contaminants, including nitrate (-N), sulfate (), bromate (), chromate (Cr(VI)) and para-chloronitrobenzene (p-CNB). The experiments demonstrate that MBfR can achieve high performance for contaminants bioreduction to harmless or immobile forms in 240 days, with a maximum reduction fluxes of 0.901 g -N/m2·d, 1.573 g /m2·d, 0.009 g /m2·d, 0.022 g Cr(VI)/m2·d, and 0.043 g p-CNB/m2·d. Increasing H2 pressure and decreasing influent surface loading enhanced removal efficiency of the reactor. Flux analysis indicates that nitrate and sulfate reductions competed more strongly than , Cr(VI) and p-CNB reduction. The average H2 utilization rate, H2 flux, and H2 utilization efficiency of the reactor were 0.026 to 0.052 mg H2/cm3·d, 0.024 to 0.046 mg H2/cm2·d, and 97.5% to 99.3% (nearly 100%). Results show the hydrogen-based MBfR may be suitable for removing multiple oxidized contaminants in drinking water or groundwater.

Observation of the spin-orbit components of the 3B 2g( 3A 2g) ground state in the system Ni 2+:MgF 2 by fluorescence line narrowing

NASA Astrophysics Data System (ADS)

Tonucci, R. J.; Jacobsen, S. M.; Yen, W. M.

1990-10-01

Using a tunable narrow-band infrared laser, we demonstrate for the first time infrared-fluorescnece line narrowing in the system Ni 2+:MgF 2. High-resolution emission spectra were obtained by pumping the lowest spin-orbit component B 3 ( 3T 2g) (orthorhombic notation with octahedral notation in parentheses) of the 3T 2g multiplet and observing the B 3( 3T 2g)→B 1, A, B 2( 3A 2g) luminescent transitions at low temperature. By tuning the narrow-band laser over the B 3( 3T 2g) band, resonant and non-resonant fluorescence were obtained which narrowed with respect to the inhomogeneously broadened profile, and additional lines were observed. The spectra can be understood in terms of a simultaneous excitation of two different subsets of Ni 2+ ions which have their B 2( 3A 2g)→B 3( 3T 2g) and A( 3A 2g)→B 3( 3T 2g) transitions in resonance with the laser. The A( 3A 2g) and B 1( 3A 2g) spin-orbit components of the ground-state multiplet lie 1.9 cm -1 and 6.5 cm -1 above the B 2( 3A 2g) ground state, respectively, at 2 K.

Development of a Novel Catalytic Membrane Reactor for Heterogeneous Catalysis in Supercritical CO2

PubMed Central

Islam, Nazrul M.; Chatterjee, Maya; Ikushima, Yutaka; Yokoyama, Toshiro; Kawanami, Hajime

2010-01-01

A novel type of high-pressure membrane reactor has been developed for hydrogenation in supercritical carbon dioxide (scCO2). The main objectives of the design of the reactor are the separate feeding of hydrogen and substrate in scCO2 for safe reactions in a continuous flow process, and to reduce the reaction time. By using this new reactor, hydrogenation of cinnamaldehyde into hydrocinnamaldehyde has been successfully carried out with 100% selectivity at 50 °C in 10 MPa (H2: 1 MPa, CO2: 9 MPa) with a flow rate of substrate ranging from 0.05 to 1.0 mL/min. PMID:20162008

D1((2)B2g) to D0((2)Au) Fluorescence from the Matrix-Isolated Perylene Cation Following Laser Excitation into the D5(2)B3g) and D2 ((2)B3g) Electronic States

NASA Technical Reports Server (NTRS)

Chillier, Xavier D. F.; Stone, Bradley M.; Joblin, Christine; Salama, Farid; Allamandola, Louis J.; DeVincenzi, Donald L. (Technical Monitor)

2001-01-01

Fluorescence spectra of the perylene cation, pumped by direct laser excitation via the D(sub 2)((2)B(sub 3g)) (left arrow) D(sub 0)((2)A(sub u)) and D(sub 5)(2)B(sub 3g)) (left arrow) D(sub 0)((2)A(sub u)) transitions, are presented. Direct excitation into the D5 or D2 states is followed by rapid non-radiative relaxation to D1 that, in turn,relaxes radiatively. Excitation spectroscopy across the D(sub 2)((2)B(sub 3g)) (left arrow) D(sub 0)((2)A(sub u)) transition near 730 nm shows that site splitting plays little or no role in determining the spectral substructure in the ion spectra. Tentative assignments for ground state vibrational frequencies are made by comparison of spectral intervals with calculated normal mode frequencies.

Visualizing Vpr-Induced G2 Arrest and Apoptosis

PubMed Central

Murakami, Tomoyuki; Aida, Yoko

2014-01-01

Vpr is an accessory protein of human immunodeficiency virus type 1 (HIV-1) with multiple functions. The induction of G2 arrest by Vpr plays a particularly important role in efficient viral replication because the transcriptional activity of the HIV-1 long terminal repeat is most active in G2 phase. The regulation of apoptosis by Vpr is also important for immune suppression and pathogenesis during HIV infection. However, it is not known whether Vpr-induced apoptosis depends on the ability of Vpr to induce G2 arrest, and the dynamics of Vpr-induced G2 arrest and apoptosis have not been visualized. We performed time-lapse imaging to examine the temporal relationship between Vpr-induced G2 arrest and apoptosis using HeLa cells containing the fluorescent ubiquitination-based cell cycle indicator2 (Fucci2). The dynamics of G2 arrest and subsequent long-term mitotic cell rounding in cells transfected with the Vpr-expression vector were visualized. These cells underwent nuclear mis-segregation after prolonged mitotic processes and then entered G1 phase. Some cells subsequently displayed evidence of apoptosis after prolonged mitotic processes and nuclear mis-segregation. Interestingly, Vpr-induced apoptosis was seldom observed in S or G2 phase. Likewise, visualization of synchronized HeLa/Fucci2 cells infected with an adenoviral vector expressing Vpr clearly showed that Vpr arrests the cell cycle at G2 phase, but does not induce apoptosis at S or G2 phase. Furthermore, time-lapse imaging of HeLa/Fucci2 cells expressing SCAT3.1, a caspase-3-sensitive fusion protein, clearly demonstrated that Vpr induces caspase-3-dependent apoptosis. Finally, to examine whether the effects of Vpr on G2 arrest and apoptosis were reversible, we performed live-cell imaging of a destabilizing domain fusion Vpr, which enabled rapid stabilization and destabilization by Shield1. The effects of Vpr on G2 arrest and subsequent apoptosis were reversible. This study is the first to characterize the

Determination of aflatoxins B1, B2, G1 and G2 in spices using a multifunctional column clean-up.

PubMed

Akiyama, H; Goda, Y; Tanaka, T; Toyoda, M

2001-10-12

A rapid and simple method using a multifunctional column, which contains lipophilic and charged active sites, was developed to analyse aflatoxins B1, B2, G1 and G2 in various spices, such as red pepper and nutmeg. After extraction by acetonitrile:water (9:1) and clean-up using MultiSep #228 column, the aflatoxins and aflatoxin-TFA derivatives are determined using LC with fluorescence detection. Recoveries of each aflatoxin B1, B2, G1 and G2 spiked to red pepper, white pepper, black pepper, nutmeg and tear grass at the level of 10 ng/g were over 80-85% in all instances. The minimum detectable concentration for aflatoxins in red pepper was 0.5 ng/g.

Nuclease digestion and mass spectrometric characterization of oligodeoxyribonucleotides containing 1,2-GpG, 1,2-ApG, and 1,3-GpXpG cisplatin intrastrand cross-links.

PubMed

Williams, Renee T; Nalbandian, Jenifer N; Tu, Audrey; Wang, Yinsheng

2013-05-01

The primary mode of action for cis-diamminedichloroplatinum (II), referred to as cisplatin, toward the treatment of solid malignancies is through formation of cross-links with DNA at purine sites, especially guanines. We prepared oligodeoxyribonucleotides (ODNs) containing a 1,2-GpG, 1,2-ApG, or 1,3-GpXpG cisplatin intrastrand cross-link and the corresponding ODNs modified with (15)N2-labeled cisplatin, and characterized these ODNs with electrospray ionization mass spectrometry (ESI-MS) and tandem MS (MS/MS). We also employed LC-MS/MS to characterize the digestion products of these ODNs after treatment with a cocktail of 4 enzymes (nuclease P1, phosphodiesterases I and II, and alkaline phosphatase). 1,2-GpG was released from the ODNs as a dinucleoside monophosphate or a dinucleotide. Analyses of the digestion products of ODNs containing a 1,2-GpG cross-link on the 5' or 3' terminus revealed that the dinucleotide carries a terminal 5' phosphate. On the other hand, digestion of the 1,3-GpXpG intrastrand cross-link yielded 3 dinucleoside products with 0, 1, or 2 phosphate groups. The availability of the ODNs carrying the stable isotope-labeled lesions, MS/MS analyses of the cisplatin-modified ODNs, and the characterization of the enzymatic digestion products of these ODNs set the stage for the future LC-MS/MS quantification of the 1,2-GpG, 1,2-ApG, and 1,3-GpXpG lesions in cellular DNA. Copyright © 2012 Elsevier B.V. All rights reserved.

Nuclease Digestion and Mass Spectrometric Characterization of Oligodeoxyribonucleotides Containing 1,2-GpG, 1,2-ApG, and 1,3-GpXpG Cisplatin Intrastrand Cross-links

PubMed Central

Williams, Renee T.; Nalbandian, Jenifer; Tu, Audrey; Wang, Yinsheng

2013-01-01

Background The primary mode of action for cis-diamminedichloroplatinum (II), referred to as cisplatin, towards the treatment of solid malignancies is through formation of cross-links with DNA at purine sites, especially guanines. Methods We prepared oligodeoxyribonucleotides (ODNs) containing a 1,2-GpG, 1,2-ApG, or 1,3-GpXpG cisplatin intrastrand cross-link and the corresponding ODNs modified with 15N2-labeled cisplatin, and characterized these ODNs with electrospray ionization mass spectrometry (ESI-MS) and tandem MS (MS/MS). We also employed LC-MS/MS to characterize the digestion products of these ODNs after treatment with a cocktail of 4 enzymes (nuclease P1, phosphodiesterases I and II, and alkaline phosphatase). Results 1,2-GpG was released from the ODNs as a dinucleoside monophosphate or a dinucleotide. Analyses of the digestion products of ODNs containing a 1,2-GpG cross-link on the 5′ or 3′ terminus revealed that the dinucleotide carries a terminal 5′ phosphate. On the other hand, digestion of the 1,3-GpXpG intrastrand cross-link yielded 3 dinucleoside products with 0, 1, or 2 phosphate groups. Results The availability of the ODNs carrying the stable isotope-labeled lesions, MS/MS analyses of the cisplatin-modified ODNs, and the characterization of the enzymatic digestion products of these ODNs set the stage for the future LC-MS/MS quantification of the 1,2-GpG, 1,2-ApG, and 1,3-GpXpG lesions in cellular DNA. PMID:23266768

Phenolic refinery wastewater biodegradation by an expanded granular sludge bed reactor.

PubMed

Almendariz, F J; Meraz, M; Olmos, A D; Monroy, O

2005-01-01

Refinery spent caustics (SC) were diluted with sour waters (SW) in a ratio 1:7, neutralized with CO2 (SC/SW(CO2)) and 83% of H2S was striped during this procedure, remaining an aromatic portion that contained 2123, 2730 and 1379 mg L(-1) of phenol, p-cresol and o-cresol, respectively. The mixture was teated anaerobically in an EGSB reactor fed with 1.5 gCOD L(-1) d(-1), without mineral supplements causing loss of COD removal efficiency that dropped to 23%, methane production ceased and no phenol or cresols were biodegraded. The EGSB experiments were resumed by feeding the reactor with nutrients and phenol at 1.0 gCOD L(-1) d(-1). The mixture SC/SWco2 added to the phenol load, was step increased from 0.10 to 0.87 gCODL(-1) d(-1) maximum. When total organic load was increased to 1.6, COD removal efficiency was 90% and at the highest load attained, 1.87, efficiency dropped to 23% attributed to the toxic effect produced by cresols.

CO2 Photoreduction by Formate Dehydrogenase and a Ru-Complex in a Nanoporous Glass Reactor.

PubMed

Noji, Tomoyasu; Jin, Tetsuro; Nango, Mamoru; Kamiya, Nobuo; Amao, Yutaka

2017-02-01

In this study, we demonstrated the conversion of CO 2 to formic acid under ambient conditions in a photoreduction nanoporous reactor using a photosensitizer, methyl viologen (MV 2+ ), and formate dehydrogenase (FDH). The overall efficiency of this reactor was 14 times higher than that of the equivalent solution. The accumulation rate of formic acid in the nanopores of 50 nm is 83 times faster than that in the equivalent solution. Thus, this CO 2 photoreduction nanoporous glass reactor will be useful as an artificial photosynthesis system that converts CO 2 to fuel.

Startup and oxygen concentration effects in a continuous granular mixed flow autotrophic nitrogen removal reactor.

PubMed

Varas, Rodrigo; Guzmán-Fierro, Víctor; Giustinianovich, Elisa; Behar, Jack; Fernández, Katherina; Roeckel, Marlene

2015-08-01

The startup and performance of the completely autotrophic nitrogen removal over nitrite (CANON) process was tested in a continuously fed granular bubble column reactor (BCR) with two different aeration strategies: controlling the oxygen volumetric flow and oxygen concentration. During the startup with the control of oxygen volumetric flow, the air volume was adjusted to 60mL/h and the CANON reactor had volumetric N loadings ranging from 7.35 to 100.90mgN/Ld with 36-71% total nitrogen removal and high instability. In the second stage, the reactor was operated at oxygen concentrations of 0.6, 0.4 and 0.2mg/L. The best condition was 0.2 mgO2/L with a total nitrogen removal of 75.36% with a CANON reactor activity of 0.1149gN/gVVSd and high stability. The feasibility and effectiveness of CANON processes with oxygen control was demonstrated, showing an alternative design tool for efficiently removing nitrogen species. Copyright © 2015 Elsevier Ltd. All rights reserved.

UO{sub 2} and PuO{sub 2} utilization in high temperature engineering test reactor with helium coolant

DOE Office of Scientific and Technical Information (OSTI.GOV)

Waris, Abdul, E-mail: awaris@fi.itb.ac.id; Novitrian,; Pramuditya, Syeilendra

High temperature engineering test reactor (HTTR) is one of high temperature gas cooled reactor (HTGR) types which has been developed by Japanese Atomic Energy Research Institute (JAERI). The HTTR is a graphite moderator, helium gas coolant, 30 MW thermal output and 950 °C outlet coolant temperature for high temperature test operation. Original HTTR uses UO{sub 2} fuel. In this study, we have evaluated the use of UO{sub 2} and PuO{sub 2} in form of mixed oxide (MOX) fuel in HTTR. The reactor cell calculation was performed by using SRAC 2002 code, with nuclear data library was derived from JENDL3.2. Themore » result shows that HTTR can obtain its criticality condition if the enrichment of {sup 235}U in loaded fuel is 18.0% or above.« less

Photo reduction of CO2 to CH4 on g-C3N4: The effect of concentrating light and pretreatment

NASA Astrophysics Data System (ADS)

Li, Dong; Fang, Xiaoxiang; Liu, Huayan; Lu, Hanfeng; Zhang, Zekai

2018-06-01

The behavior of CO2 photoreduction to CH4 on the g-C3N4 catalyst was studied in a concentrating light reactor. The g-C3N4 catalysts before and after pretreatment were characterized by FE-SEM, XRD and photoilluminance. It is found that concentrating light increases the CH4 yield on the g-C3N4 by heightening the incident light intensity, and light pretreatment has an excessive effect on the performance. Pretreated by suitable light intensity, air atmosphere and time, the CH4 yield on the g-C3N4 under concentrating light irradiation reached about 3.39 μmol.g-1.h-1, which is about 16 times of that g-C3N4 reacted at nature incident light without pretreatment. The mechanism of pretreatment is considered to be from the surface oxidation state change of the catalyst either from the oxidation of the catalyst surface or the activation of surface oxygen.

Mitigation of nitrous oxide (N2 O) emission from swine wastewater treatment in an aerobic bioreactor packed with carbon fibers.

PubMed

Yamashita, Takahiro; Yamamoto-Ikemoto, Ryoko; Yokoyama, Hiroshi; Kawahara, Hirofumi; Ogino, Akifumi; Osada, Takashi

2015-03-01

Mitigation of nitrous oxide (N2 O) emission from swine wastewater treatment was demonstrated in an aerobic bioreactor packed with carbon fibers (CF reactor). The CF reactor had a demonstrated advantage in mitigating N2 O emission and avoiding NOx (NO3  + NO2 ) accumulation. The N2 O emission factor was 0.0003 g N2 O-N/gTN-load in the CF bioreactor compared to 0.03 gN2 O-N/gTN-load in an activated sludge reactor (AS reactor). N2 O and CH4 emissions from the CF reactor were 42 g-CO2 eq/m(3) /day, while those from the AS reactor were 725 g-CO2 eq/m(3) /day. The dissolved inorganic nitrogen (DIN) in the CF reactor removed an average of 156 mg/L of the NH4 -N, and accumulated an average of 14 mg/L of the NO3 -N. In contrast, the DIN in the AS reactor removed an average 144 mg/L of the NH4 -N and accumulated an average 183 mg/L of the NO3 -N. NO2 -N was almost undetectable in both reactors. © 2014 Japanese Society of Animal Science.

Development of UO2/PuO2 dispersed in uranium matrix CERMET fuel system for fast reactors

NASA Astrophysics Data System (ADS)

Sinha, V. P.; Hegde, P. V.; Prasad, G. J.; Pal, S.; Mishra, G. P.

2012-08-01

CERMET fuel with either PuO2 or enriched UO2 dispersed in uranium metal matrix has a strong potential of becoming a fuel for the liquid metal cooled fast breeder reactors (LMR's). In fact it may act as a bridge between the advantages and disadvantages associated with the two extremes of fuel systems (i.e. ceramic fuel and metallic fuel) for fast reactors. At Bhabha Atomic Research Centre (BARC), R & D efforts are on to develop this CERMET fuel by powder metallurgy route. This paper describes the development of flow sheet for preparation of UO2 dispersed in uranium metal matrix pellets for three different compositions i.e. U-20 wt%UO2, U-25 wt%UO2 and U-30 wt%UO2. It was found that the sintered pellets were having excellent integrity and their linear mass was higher than that of carbide fuel pellets used in Fast Breeder Test Reactor programme (FBTR) in India. The pellets were characterized by X-ray diffraction (XRD) technique for phase analysis and lattice parameter determination. The optical microstructures were developed and reported for all the three different U-UO2 compositions.

Nitrogen removal from purified swine wastewater using biogas by semi-partitioned reactor.

PubMed

Waki, Miyoko; Yokoyama, Hiroshi; Ogino, Akifumi; Suzuki, Kazuyoshi; Tanaka, Yasuo

2008-09-01

Nitrate and ammonium removal from purified swine wastewater using biogas and air was investigated in continuous reactor operation. A novel type of reactor, a semi-partitioned reactor (SPR), which enables a biological reaction using methane and oxygen in the water phase and discharges these unused gases separately, was operated with a varying gas supply rate. Successful removal of NO(3)(-) and NH(4)(+) was observed when biogas and air of 1L/min was supplied to an SPR of 9L water phase with a NO(2,3)(-)-N and NH(4)(+)-N removal rate of 0.10 g/L/day and 0.060 g/L/day, respectively. The original biogas contained an average of 77.2% methane, and the discharged biogas from the SPR contained an average of 76.9% of unused methane that was useable for energy like heat or electricity production. Methane was contained in the discharged air from the SPR at an average of 2.1%. When gas supply rates were raised to 2L/min and the nitrogen load was increased, NO(3)(-) concentration was decreased, but NO(2)(-) accumulated in the reactor and the NO(2,3)(-)-N and NH(4)(+)-N removal activity declined. To recover the activity, lowering of the nitrogen load and the gas supply rate was needed. This study shows that the SPR enables nitrogen removal from purified swine wastewater using biogas under limited gas supply condition.

CHAP-2 heat-transfer analysis of the Fort St. Vrain reactor core

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kotas, J.F.; Stroh, K.R.

1983-01-01

The Los Alamos National Laboratory is developing the Composite High-Temperature Gas-Cooled Reactor Analysis Program (CHAP) to provide advanced best-estimate predictions of postulated accidents in gas-cooled reactor plants. The CHAP-2 reactor-core model uses the finite-element method to initialize a two-dimensional temperature map of the Fort St. Vrain (FSV) core and its top and bottom reflectors. The code generates a finite-element mesh, initializes noding and boundary conditions, and solves the nonlinear Laplace heat equation using temperature-dependent thermal conductivities, variable coolant-channel-convection heat-transfer coefficients, and specified internal fuel and moderator heat-generation rates. This paper discusses this method and analyzes an FSV reactor-core accident thatmore » simulates a control-rod withdrawal at full power.« less

G2 phase-specific proteins of HeLa cells.

PubMed Central

Al-Bader, A A; Orengo, A; Rao, P N

1978-01-01

The objective of this study was to determine if HeLa cells irreversibly arrested in G2 phase of the cell cycle by a brief exposure to a nitrosourea compound were deficient in certain proteins when compared with G2-synchronized cells. Total cellular proteins of G2-synchronized, G2-arrested, and S phase-synchronized cells were compared by two-dimensional polyacrylamide gel electrophoresis. The S phase cells differed from the G2-synchronized and G2-arrested cells by the absence of about 35 and 25 protein spots, respectively, of a total of nearly 150. At least nine protein spots in the molecular weight range of 4--5 X 10(4) that were present in the G2-synchronized cells were absent in both the G2-arrested and the S phase cells. Thus, these studies suggest that the missing proteins are probably necessary for the transition of cells from G2 phase to mitosis. Supplying the missing proteins to the G2-arrested cells by fusion with G2-synchronized cells facilitated the entry of the former into mitosis. Images PMID:282623

A fuel-cell reactor for the direct synthesis of hydrogen peroxide alkaline solutions from H(2) and O(2).

PubMed

Yamanaka, Ichiro; Onisawa, Takeshi; Hashimoto, Toshikazu; Murayama, Toru

2011-04-18

The effects of the type of fuel-cell reactors (undivided or divided by cation- and anion-exchange membranes), alkaline electrolytes (LiOH, NaOH, KOH), vapor-grown carbon fiber (VGCF) cathode components (additives: none, activated carbon, Valcan XC72, Black Pearls 2000, Seast-6, and Ketjen Black), and the flow rates of anolyte (0, 1.5, 12 mL h(-1)) and catholyte (0, 12 mL h(-1)) on the formation of hydrogen peroxide were studied. A divided fuel-cell system, O(2) (g)|VGCF-XC72 cathode|2 M NaOH catholyte|cation-exchange membrane (Nafion-117)|Pt/XC72-VGCF anode|2 M NaOH anolyte at 12 mL h(-1) flow|H(2) (g), was effective for the selective formation of hydrogen peroxide, with 130 mA cm(-2) , a 2 M aqueous solution of H(2)O(2)/NaOH, and a current efficiency of 95 % at atmospheric pressure and 298 K. The current and formation rate gradually decreased over a long period of time. The cause of the slow decrease in electrocatalytic performance was revealed and the decrease was stopped by a flow of catholyte. Cyclic voltammetry studies at the VGCF-XC72 electrode indicated that fast diffusion of O(2) from the gas phase to the electrode, and quick desorption of hydrogen peroxide from the electrode to the electrolyte were essential for the efficient formation of solutions of H(2)O(2)/NaOH. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Microchannel Reactor System Design & Demonstration For On-Site H2O2 Production by Controlled H2/O2 Reaction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Adeniyi Lawal

We successfully demonstrated an innovative hydrogen peroxide (H2O2) production concept which involved the development of flame- and explosion-resistant microchannel reactor system for energy efficient, cost-saving, on-site H2O2 production. We designed, fabricated, evaluated, and optimized a laboratory-scale microchannel reactor system for controlled direct combination of H2 and O2 in all proportions including explosive regime, at a low pressure and a low temperature to produce about 1.5 wt% H2O2 as proposed. In the second phase of the program, as a prelude to full-scale commercialization, we demonstrated our H2O2 production approach by ‘numbering up’ the channels in a multi-channel microreactor-based pilot plant tomore » produce 1 kg/h of H2O2 at 1.5 wt% as demanded by end-users of the developed technology. To our knowledge, we are the first group to accomplish this significant milestone. We identified the reaction pathways that comprise the process, and implemented rigorous mechanistic kinetic studies to obtain the kinetics of the three main dominant reactions. We are not aware of any such comprehensive kinetic studies for the direct combination process, either in a microreactor or any other reactor system. We showed that the mass transfer parameter in our microreactor system is several orders of magnitude higher than what obtains in the macroreactor, attesting to the superior performance of microreactor. A one-dimensional reactor model incorporating the kinetics information enabled us to clarify certain important aspects of the chemistry of the direct combination process as detailed in section 5 of this report. Also, through mathematical modeling and simulation using sophisticated and robust commercial software packages, we were able to elucidate the hydrodynamics of the complex multiphase flows that take place in the microchannel. In conjunction with the kinetics information, we were able to validate the experimental data. If fully implemented across the

Pentachlorophenol (PCP) dechlorination in horizontal-flow anaerobic immobilized biomass (HAIB) reactors.

PubMed

Damianovic, M H R Z; Moraes, E M; Zaiat, M; Foresti, E

2009-10-01

This study verifies the potential applicability of horizontal-flow anaerobic immobilized biomass (HAIB) reactors to pentachlorophenol (PCP) dechlorination. Two bench-scale HAIB reactors (R1 and R2) were filled with cubic polyurethane foam matrices containing immobilized anaerobic sludge. The reactors were then continuously fed with synthetic wastewater consisting of PCP, glucose, acetic acid, and formic acid as co-substrates for PCP anaerobic degradation. Before being immobilized in polyurethane foam matrices, the biomass was exposed to wastewater containing PCP in reactors fed at a semi-continuous rate of 2.0 microg PCP g(-1) VS. The applied PCP loading rate was increased from 0.05 to 2.59 mg PCP l(-1)day(-1) for R1, and from 0.06 to 4.15 mg PCP l(-1)day(-1) for R2. The organic loading rates (OLR) were 1.1 and 1.7 kg COD m(-3)day(-1) at hydraulic retention times (HRT) of 24h for R1 and 18 h for R2. Under such conditions, chemical oxygen demand (COD) removal efficiencies of up to 98% were achieved in the HAIB reactors. Both reactors exhibited the ability to remove 97% of the loaded PCP. Dichlorophenol (DCP) was the primary chlorophenol detected in the effluent. The adsorption of PCP and metabolites formed during PCP degradation in the packed bed was negligible for PCP removal efficiency.

Downlink power distributions for 2G and 3G mobile communication networks.

PubMed

Colombi, Davide; Thors, Björn; Persson, Tomas; Wirén, Niklas; Larsson, Lars-Eric; Jonsson, Mikael; Törnevik, Christer

2013-12-01

Knowledge of realistic power levels is key when conducting accurate EMF exposure assessments. In this study, downlink output power distributions for radio base stations in 2G and 3G mobile communication networks have been assessed. The distributions were obtained from network measurement data collected from the Operations Support System, which normally is used for network monitoring and management. Significant amounts of data were gathered simultaneously for large sets of radio base stations covering wide geographical areas and different environments. The method was validated with in situ measurements. For the 3G network, the 90th percentile of the averaged output power during high traffic hours was found to be 43 % of the maximum available power. The corresponding number for 2G, with two or more transceivers installed, was 65 % or below.

Evaluation of power density on the bioethanol production using mesoscale oscillatory baffled reactor and stirred tank reactor

NASA Astrophysics Data System (ADS)

Yussof, H. W.; Bahri, S. S.; Mazlan, N. A.

2018-03-01

A recent development in oscillatory baffled reactor technology is down-scaling the reactor, so that it can be used for production of small-scale bioproduct. In the present study, a mesoscale oscillatory baffled reactor (MOBR) with central baffle system was developed. The reactor performance of the MOBR was compared with conventional stirred tank reactor (STR) to evaluate the performance of bioethanol fermentation using Saccharomyces cerevisiae. Evaluation was made at similar power density of 24.21, 57.38, 112.35 and 193.67 Wm-3 by varying frequency (f), amplitude (xo) and agitation speed (rpm). It was found that the MOBR improved the mixing intensity resulted in lower glucose concentration (0.988 gL-1) and higher bioethanol concentration (38.98 gL-1) after 12 hours fermentation at power density of 193.67 Wm-3. Based on the results, the bioethanol yield obtained using MOBR was 39% higher than the maximum achieved in STR. Bioethanol production using MOBR proved to be feasible as it is not only able to compete with conventional STR but also offers advantages of straight-forward scale-up, whereas it is complicated and difficult in STR. Overall, MOBR offers great prospective over the conventional STR.

Performance of a composite membrane bioreactor treating toluene vapors: inocula selection, reactor performance and behavior under transient conditions.

PubMed

Kumar, Amit; Dewulf, Jo; Vercruyssen, Aline; Van Langenhove, Herman

2009-04-01

In this study, a membrane biofilm reactor performance for toluene as a model pollutant is presented. A composite membrane consisting of a porous polyacrylonitrile (PAN) support layer coated with a very thin (0.3 microm) dense polydimethylsiloxane (PDMS) top layer was used. Batch experiments were performed to select an appropriate inocula (slaughterhouse wastewater treatment sludge with a specific toluene consumption rate of 118+/-23 microg g(-1) VSS L(-1)) among the three available sources of inoculums. The maximum elimination capacity gas-side reactor volume based (EC)v and membrane based (EC)(m, max) obtained were 609 g m(-3) h(-1) and 1.2 g m(-2) h(-1) respectively, which is much higher than other membrane bioreactors. Further experiments involved the study of the membrane biofilm reactor flexibility when operational parameters as temperature, loading rate etc. were modified. In all cases, the membrane biofilm reactor showed a rapid adaptation and new steady-states were obtained within hours. Overall, the results illustrate that membrane bioreactors can potentially be a good option for treatment of air pollutants such as toluene.

Inhibition of G0/G1 Switch 2 Ameliorates Renal Inflammation in Chronic Kidney Disease.

PubMed

Matsunaga, Naoya; Ikeda, Eriko; Kakimoto, Keisuke; Watanabe, Miyako; Shindo, Naoya; Tsuruta, Akito; Ikeyama, Hisako; Hamamura, Kengo; Higashi, Kazuhiro; Yamashita, Tomohiro; Kondo, Hideaki; Yoshida, Yuya; Matsuda, Masaki; Ogino, Takashi; Tokushige, Kazutaka; Itcho, Kazufumi; Furuichi, Yoko; Nakao, Takaharu; Yasuda, Kaori; Doi, Atsushi; Amamoto, Toshiaki; Aramaki, Hironori; Tsuda, Makoto; Inoue, Kazuhide; Ojida, Akio; Koyanagi, Satoru; Ohdo, Shigehiro

2016-11-01

Chronic kidney disease (CKD) is a global health problem, and novel therapies to treat CKD are urgently needed. Here, we show that inhibition of G 0 /G 1 switch 2 (G0s2) ameliorates renal inflammation in a mouse model of CKD. Renal expression of chemokine (C-C motif) ligand 2 (Ccl2) was increased in response to p65 activation in the kidneys of wild-type 5/6 nephrectomy (5/6Nx) mice. Moreover, 5/6Nx Clk/Clk mice, which carry homozygous mutations in the gene encoding circadian locomotor output cycles kaput (CLOCK), did not exhibit aggravation of apoptosis or induction of F4/80-positive cells. The renal expression of G0s2 in wild-type 5/6Nx mice was important for the transactivation of Ccl2 by p65. These pathologies were ameliorated by G0s2 knockdown. Furthermore, a novel small-molecule inhibitor of G0s2 expression was identified by high-throughput chemical screening, and the inhibitor suppressed renal inflammation in 5/6Nx mice. These findings indicated that G0s2 inhibitors may have applications in the treatment of CKD. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

Effects of 2.0-g 1.75-g and 1.5-g Hypergravity on Pregnancy Outcome in Rats (Rattus norvegicus)

NASA Technical Reports Server (NTRS)

Mills, Nicole A.; Baer, Lisa A.; Ronca, April E.

2001-01-01

In 1995, ten pregnant female rats were launched on the Space Shuttle (STS-70) on Gestational day(G) 11 of their 22-day pregnancy as part of the NASA/NIH.Rodent (R)2 Experiment. Following landing on G20, fetuses were harvested from half of the dams, while the remaining five dams underwent birth. Spaceflight did not interrupt pregnancy, alter litter sizes, or affect body weights or gender ratios of the fetuses or neonates. In the present study we used the NASA/NIH.R2 experimental paradigm to analyze the effects of hypergravity on pregnancy outcome. On G10, time-bred Sprague-Dawley rat dams were assigned to either G20 or Birth conditions, then further assigned to Hypergravity (HG) 2.0-g, HG 1.75-g, HG 1.5-g, Rotational Control (RC, 1.03), or Stationary Control (SC, 1.0-g) treatments. Dams were exposed to continuous centrifugation from G11 through G20, with brief daily stops for animal health checks and maintenance. For both the G20 and Birth dams, comparable litter sizes and litter gender ratios were observed across gravity conditions. However, centrifugation-exposed (HG and RC) fetuses and neonates showed significantly lower body masses (p less than 0.05) relative to SC offspring. HG 2.0-g offspring weighed significantly less than those in all other gravity conditions (p less than 0.05). The observed reductions in offspring body mass at 1.5-g and 1.75-g, can be attributed to the rotational component of centrifugation, rather than to increased gravitational load, whereas 2.0-g hypergravity exposure further exacerbated the gravity centrifugation effect on offspring body mass. Pregnant dams exposed to centrifugation weighed significantly less than SC dams (p less than 0.05), suggesting that centrifugation effects on maternal body mass may contribute to reduced size of the developing offspring. These findings are consistent with previous reports of non-pregnant adult animals suggesting that, whereas spaceflight has virtually no effect on body mass, centrifugation is

Isolation and characterization of rabbit anti-m3 2,2,7G antibodies.

PubMed Central

Luhrmann, R; Appel, B; Bringmann, P; Rinke, J; Reuter, R; Rothe, S; Bald, R

1982-01-01

Antibodies specific for intact 2,2,7-trimethylguanosine (m3 2,2,7G) were induced by immunization of rabbits with a nucleoside-human serum albumen (HSA) conjugate. Competition radioimmunoassay showed that the antibody distinguishes well between intact m3 2,2,7G and its alkali-hydrolysed form (m3 2,2,7G*). Antibody specificity is largely dependent on the presence of all three methyl groups in m3 2,2,7G: none of the less extensively methylated nucleosides m7G, m2G and m2 2,2G is able to compete efficiently with the homologous hapten. Little or no competition was observed with m1G, m1A, m6A, m5U and each of the four unmodified ribonucleosides. Binding studies with nucleoplasmic RNAs from Ehrlich ascites cells suggest that the antibody reacts specifically with the m3 2,2,7G-containing cap structure of the small nuclear U-RNAs (U-snRNAs). Thus the antibody should be a valuable tool for studying the role of the 5'-terminal regions of the U-snRNAs of eucaryotic cells. Images PMID:7155893

Efficient synthesis of ammonia from N2 and H2 alone in a ferroelectric packed-bed DBD reactor

NASA Astrophysics Data System (ADS)

Gómez-Ramírez, A.; Cotrino, J.; Lambert, R. M.; González-Elipe, A. R.

2015-12-01

A detailed study of ammonia synthesis from hydrogen and nitrogen in a planar dielectric barrier discharge (DBD) reactor was carried out. Electrical parameters were systematically varied, including applied voltage and frequency, electrode gap, and type of ferroelectric material (BaTiO3 versus PZT). For selected operating conditions, power consumption and plasma electron density were estimated from Lissajous diagrams and by application of the Bolsig  +  model, respectively. Optical emission spectroscopy was used to follow the evolution of plasma species (\\text{N}{{\\text{H}}*},{{\\text{N}}*},~{N}2+~\\text{and} ~{N}2* ) as a function of applied voltage with both types of ferroelectric material. PZT gave both greater energy efficiency and higher ammonia yield than BaTiO3: 0.9 g NH3 kWh-1 and 2.7% single pass N2 conversion, respectively. This performance is substantially superior to previously published findings on DBD synthesis of NH3 from N2 and H2 alone. The influence of electrical working parameters, the beneficial effect of PZT and the importance of controlling reactant residence time are rationalized in a reaction model that takes account of the principal process variables

Efficient H2O2/CH3COOH oxidative desulfurization/denitrification of liquid fuels in sonochemical flow-reactors.

PubMed

Calcio Gaudino, Emanuela; Carnaroglio, Diego; Boffa, Luisa; Cravotto, Giancarlo; Moreira, Elizabeth M; Nunes, Matheus A G; Dressler, Valderi L; Flores, Erico M M

2014-01-01

The oxidative desulfurization/denitrification of liquid fuels has been widely investigated as an alternative or complement to common catalytic hydrorefining. In this process, all oxidation reactions occur in the heterogeneous phase (the oil and the polar phase containing the oxidant) and therefore the optimization of mass and heat transfer is of crucial importance to enhancing the oxidation rate. This goal can be achieved by performing the reaction in suitable ultrasound (US) reactors. In fact, flow and loop US reactors stand out above classic batch US reactors thanks to their greater efficiency and flexibility as well as lower energy consumption. This paper describes an efficient sonochemical oxidation with H2O2/CH3COOH at flow rates ranging from 60 to 800 ml/min of both a model compound, dibenzotiophene (DBT), and of a mild hydro-treated diesel feedstock. Four different commercially available US loop reactors (single and multi-probe) were tested, two of which were developed in the authors' laboratory. Full DBT oxidation and efficient diesel feedstock desulfurization/denitrification were observed after the separation of the polar oxidized S/N-containing compounds (S≤5 ppmw, N≤1 ppmw). Our studies confirm that high-throughput US applications benefit greatly from flow-reactors. Copyright © 2013 Elsevier B.V. All rights reserved.

48 CFR Appendix G to Chapter 2 - [Reserved

Code of Federal Regulations, 2013 CFR

2013-10-01

... 48 Federal Acquisition Regulations System 3 2013-10-01 2013-10-01 false [Reserved] G Appendix G to Chapter 2 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE Appendix G to Chapter 2 [Reserved] ...

48 CFR Appendix G to Chapter 2 - [Reserved

Code of Federal Regulations, 2011 CFR

2011-10-01

... 48 Federal Acquisition Regulations System 3 2011-10-01 2011-10-01 false [Reserved] G Appendix G to Chapter 2 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE Appendix G to Chapter 2 [Reserved] ...

48 CFR Appendix G to Chapter 2 - [Reserved

Code of Federal Regulations, 2010 CFR

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false [Reserved] G Appendix G to Chapter 2 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE Appendix G to Chapter 2 [Reserved] ...

48 CFR Appendix G to Chapter 2 - [Reserved

Code of Federal Regulations, 2012 CFR

2012-10-01

... 48 Federal Acquisition Regulations System 3 2012-10-01 2012-10-01 false [Reserved] G Appendix G to Chapter 2 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE Appendix G to Chapter 2 [Reserved] ...

48 CFR Appendix G to Chapter 2 - [Reserved

Code of Federal Regulations, 2014 CFR

2014-10-01

... 48 Federal Acquisition Regulations System 3 2014-10-01 2014-10-01 false [Reserved] G Appendix G to Chapter 2 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE Appendix G to Chapter 2 [Reserved] ...

Loss-of-Flow and Loss-of-Pressure Simulations of the BR2 Research Reactor with HEU and LEU Fuel

DOE Office of Scientific and Technical Information (OSTI.GOV)

Licht, J.; Bergeron, A.; Dionne, B.

2016-01-01

Belgian Reactor 2 (BR2) is a research and test reactor located in Mol, Belgium and is primarily used for radioisotope production and materials testing. The Materials Management and Minimization (M3) Reactor Conversion Program of the National Nuclear Security Administration (NNSA) is supporting the conversion of the BR2 reactor from Highly Enriched Uranium (HEU) fuel to Low Enriched Uranium (LEU) fuel. The reactor core of BR2 is located inside a pressure vessel that contains 79 channels in a hyperboloid configuration. The core configuration is highly variable as each channel can contain a fuel assembly, a control or regulating rod, an experimentalmore » device, or a beryllium or aluminum plug. Because of this variability, a representative core configuration, based on current reactor use, has been defined for the fuel conversion analyses. The code RELAP5/Mod 3.3 was used to perform the transient thermal-hydraulic safety analyses of the BR2 reactor to support reactor conversion. The input model has been modernized relative to that historically used at BR2 taking into account the best modeling practices developed by Argonne National Laboratory (ANL) and BR2 engineers.« less

12 CFR 563g.2 - Offering circular requirement.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 12 Banks and Banking 5 2010-01-01 2010-01-01 false Offering circular requirement. 563g.2 Section 563g.2 Banks and Banking OFFICE OF THRIFT SUPERVISION, DEPARTMENT OF THE TREASURY SECURITIES OFFERINGS § 563g.2 Offering circular requirement. (a) General. No savings association shall offer or sell, directly...

26 CFR 1.642(g)-2 - Deductions included.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 26 Internal Revenue 8 2014-04-01 2014-04-01 false Deductions included. 1.642(g)-2 Section 1.642(g... (CONTINUED) INCOME TAXES (CONTINUED) Estates, Trusts, and Beneficiaries § 1.642(g)-2 Deductions included. It...(g) is applicable be treated in the same way. One deduction or portion of a deduction may be allowed...

26 CFR 1.642(g)-2 - Deductions included.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 26 Internal Revenue 8 2013-04-01 2013-04-01 false Deductions included. 1.642(g)-2 Section 1.642(g... (CONTINUED) INCOME TAXES (CONTINUED) Estates, Trusts, and Beneficiaries § 1.642(g)-2 Deductions included. It...(g) is applicable be treated in the same way. One deduction or portion of a deduction may be allowed...

26 CFR 1.642(g)-2 - Deductions included.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 26 Internal Revenue 8 2011-04-01 2011-04-01 false Deductions included. 1.642(g)-2 Section 1.642(g... (CONTINUED) INCOME TAXES (CONTINUED) Estates, Trusts, and Beneficiaries § 1.642(g)-2 Deductions included. It...(g) is applicable be treated in the same way. One deduction or portion of a deduction may be allowed...

26 CFR 1.642(g)-2 - Deductions included.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 26 Internal Revenue 8 2012-04-01 2012-04-01 false Deductions included. 1.642(g)-2 Section 1.642(g... (CONTINUED) INCOME TAXES (CONTINUED) Estates, Trusts, and Beneficiaries § 1.642(g)-2 Deductions included. It...(g) is applicable be treated in the same way. One deduction or portion of a deduction may be allowed...

26 CFR 1.642(g)-2 - Deductions included.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 26 Internal Revenue 8 2010-04-01 2010-04-01 false Deductions included. 1.642(g)-2 Section 1.642(g... (CONTINUED) INCOME TAXES Estates, Trusts, and Beneficiaries § 1.642(g)-2 Deductions included. It is not required that the total deductions, or the total amount of any deduction, to which section 642(g) is...

Integral Inherently Safe Light Water Reactor (I 2S-LWR)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Petrovic, Bojan; Memmott, Matthew; Boy, Guy

This final report summarizes results of the multi-year effort performed during the period 2/2013- 12/2016 under the DOE NEUP IRP Project “Integral Inherently Safe Light Water Reactors (I 2S-LWR)”. The goal of the project was to develop a concept of a 1 GWe PWR with integral configuration and inherent safety features, at the same time accounting for lessons learned from the Fukushima accident, and keeping in mind the economic viability of the new concept. Essentially (see Figure 1-1) the project aimed to implement attractive safety features, typically found only in SMRs, to a larger power (1 GWe) reactor, to addressmore » the preference of some utilities in the US power market for unit power level on the order of 1 GWe.« less

Enhanced biodegradation of hexachlorocyclohexane in upflow anaerobic sludge blanket reactor using methanol as an electron donor.

PubMed

Bhatt, Praveena; Kumar, M Suresh; Mudliar, Sandeep; Chakrabarti, Tapan

2008-05-01

Anaerobic dechlorination of technical grade hexachlorocyclohexane (THCH) was studied in a continuous upflow anaerobic sludge blanket (UASB) reactor with methanol as a supplementary substrate and electron donor. A reactor without methanol served as the experimental control. The inlet feed concentration of THCH in both the experimental and the control UASB reactor was 100 mg l(-1). After 60 days of continuous operation, the removal of THCH was >99% in the methanol-supplemented reactor as compared to 20-35% in the control reactor. THCH was completely dechlorinated in the methanol fed reactor at 48 h HRT after 2 months of continuous operation. This period was also accompanied by increase in biomass in the reactor, which was not observed in the experimental control. Batch studies using other supplementary substrates as well as electron donors namely acetate, butyrate, formate and ethanol showed lower % dechlorination (<85%) and dechlorination rates (<3 mg g(-1)d(-1)) as compared to methanol (98%, 5 mg g(-1)d(-1)). The optimum concentration of methanol required, for stable dechlorination of THCH (100 mg l(-1)) in the UASB reactor, was found to be 500 mg l(-1). Results indicate that addition of methanol as electron donor enhances dechlorination of THCH at high inlet concentration, and is also required for stable UASB reactor performance.

Reactions of small negative ions with O2(a 1[Delta]g) and O2(X 3[Sigma]g-)

NASA Astrophysics Data System (ADS)

Midey, Anthony; Dotan, Itzhak; Seeley, J. V.; Viggiano, A. A.

2009-02-01

The rate constants and product ion branching ratios were measured for the reactions of various small negative ions with O2(X 3[Sigma]g-) and O2(a 1[Delta]g) in a selected ion flow tube (SIFT). Only NH2- and CH3O- were found to react with O2(X) and both reactions were slow. CH3O- reacted by hydride transfer, both with and without electron detachment. NH2- formed both OH-, as observed previously, and O2-, the latter via endothermic charge transfer. A temperature study revealed a negative temperature dependence for the former channel and Arrhenius behavior for the endothermic channel, resulting in an overall rate constant with a minimum at 500 K. SF6-, SF4-, SO3- and CO3- were found to react with O2(a 1[Delta]g) with rate constants less than 10-11 cm3 s-1. NH2- reacted rapidly with O2(a 1[Delta]g) by charge transfer. The reactions of HO2- and SO2- proceeded moderately with competition between Penning detachment and charge transfer. SO2- produced a SO4- cluster product in 2% of reactions and HO2- produced O3- in 13% of the reactions. CH3O- proceeded essentially at the collision rate by hydride transfer, again both with and without electron detachment. These results show that charge transfer to O2(a 1[Delta]g) occurs readily if the there are no restrictions on the ion beyond the reaction thermodynamics. The SO2- and HO2- reactions with O2(a) are the only known reactions involving Penning detachment besides the reaction with O2- studied previously [R.S. Berry, Phys. Chem. Chem. Phys., 7 (2005) 289-290].

Removal of natural organic matter and arsenic from water by electrocoagulation/flotation continuous flow reactor.

PubMed

Mohora, Emilijan; Rončević, Srdjan; Dalmacija, Božo; Agbaba, Jasmina; Watson, Malcolm; Karlović, Elvira; Dalmacija, Milena

2012-10-15

The performance of the laboratory scale electrocoagulation/flotation (ECF) reactor in removing high concentrations of natural organic matter (NOM) and arsenic from groundwater was analyzed in this study. An ECF reactor with bipolar plate aluminum electrodes was operated in the horizontal continuous flow mode. Electrochemical and flow variables were optimized to examine ECF reactor contaminants removal efficiency. The optimum conditions for the process were identified as groundwater initial pH 5, flow rate=4.3 l/h, inter electrode distance=2.8 cm, current density=5.78 mA/cm(2), A/V ratio=0.248 cm(-1). The NOM removal according to UV(254) absorbance and dissolved organic matter (DOC) reached highest values of 77% and 71% respectively, relative to the raw groundwater. Arsenic removal was 85% (6.2 μg As/l) relative to raw groundwater, satisfying the drinking water standards. The specific reactor electrical energy consumption was 17.5 kWh/kg Al. The specific aluminum electrode consumption was 66 g Al/m(3). According to the obtained results, ECF in horizontal continuous flow mode is an energy efficient process to remove NOM and arsenic from groundwater. Copyright © 2012 Elsevier B.V. All rights reserved.

Development of a carbon formation reactor for carbon dioxide reduction

NASA Technical Reports Server (NTRS)

Noyes, G.

1985-01-01

Applied research, engineering development, and performance evaluation were conducted on a process for formation of dense carbon by pyrolysis of methane. Experimental research showed that dense (0.7 to 1.6 g/cc bulk density and 1.6 to 2.2 g/cc solid density) carbon can be produced by methane pyrolysis in quartzwool-packed quartz tubes at temperatrues of 1100 to 1300 C. This result supports the condensation theory of pyrolytic carbon formation from gaseous hydrocarbons. A full-scale Breadboard Carbon Formation Reactor (CFR) was designed, fabricated, and tested at 1100 to 1200 C with 380 to 2280 sccm input flows of methane. Single-pass conversion of methane to carbon ranged from 60 to 100 percent, with 89 percent average conversion. Performance was projected for an Advanced Carbon Reactor Subsystem (ACRS) which indicated that the ACRS is a viable option for management of metabolic carbon on long-duration space missions.

ETR BUILDING, TRA642, INTERIOR. BASEMENT. CUBICLE SHOWN IN ID33G101, ANOTHER ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

ETR BUILDING, TRA-642, INTERIOR. BASEMENT. CUBICLE SHOWN IN ID-33-G-101, ANOTHER VIEW. PERSONNEL DOORWAY INTO CHAMBER IDENTIFIES SODIUM HAZARD AND POSSIBILITY OF INERT GAS. LIQUID SODIUM COOLANT WAS USED IN A SPECIAL ETR LOOP ADAPTED FOR IT IN 1972. INL NEGATIVE NO. HD24-3-2. Mike Crane, Photographer, 11/2000 - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

The association between PAI-1 -675 4G/5G polymorphism and type 2 diabetes mellitus.

PubMed

Chen, L; Li, S-Y; Liu, M

2017-08-15

In this study, we aimed to analyze the association between plasminogen activator inhibitor 1 (PAI-1) -675 4G/5G polymorphism and type 2 diabetes mellitus (T2DM) risk. We included in 187 T2DM patients and 186 heathy controls between 2014 and 2017 from Tianjin Gong An Hospital, China. All patients and controls were ethnically Chinese Han population. The primers and polymerase chain reaction (PCR) conditions were performed. Results from this case-control study suggested that PAI-1 -675 4G/5G polymorphism was not associated with T2DM risk in four genetic models. Additionally, PAI-1 -675 4G/5G polymorphism was not associated with clinical and laboratory characteristics, such as age, gender, body mass index, systolic blood pressure, diastolic blood pressure, total cholesterol, triglycerides, and HbA1c. In conclusion, this case-control study suggested that PAI-1 -675 4G/5G polymorphism was not associated with T2DM risk in this population.

Biodegradation of 2,4,6-trichlorophenol in a packed-bed biofilm reactor equipped with an internal net draft tube riser for aeration and liquid circulation.

PubMed

Jesús, A Gómez-De; Romano-Baez, F J; Leyva-Amezcua, L; Juárez-Ramírez, C; Ruiz-Ordaz, N; Galíndez-Mayer, J

2009-01-30

For the aerobic biodegradation of the fungicide and defoliant 2,4,6-trichlorophenol (2,4,6-TCP), a bench-scale packed-bed bioreactor equipped with a net draft tube riser for liquid circulation and oxygenation (PB-ALR) was constructed. To obtain a high packed-bed volume relative to the whole bioreactor volume, a high A(D)/A(R) ratio was used. Reactor's downcomer was packed with a porous support of volcanic stone fragments. PB-ALR hydrodynamics and oxygen mass transfer behavior was evaluated and compared to the observed behavior of the unpacked reactor operating as an internal airlift reactor (ALR). Overall gas holdup values epsilon(G), and zonal oxygen mass transfer coefficients determined at various airflow rates in the PB-ALR, were higher than those obtained with the ALR. When comparing mixing time values obtained in both cases, a slight increment in mixing time was observed when reactor was operated as a PB-ALR. By using a mixed microbial community, the biofilm reactor was used to evaluate the aerobic biodegradation of 2,4,6-TCP. Three bacterial strains identified as Burkholderia sp., Burkholderia kururiensis and Stenotrophomonas sp. constituted the microbial consortium able to cometabolically degrade the 2,4,6-TCP, using phenol as primary substrate. This consortium removed 100% of phenol and near 99% of 2,4,6-TCP. Mineralization and dehalogenation of 2,4,6-TCP was evidenced by high COD removal efficiencies ( approximately 95%), and by the stoichiometric release of chloride ions from the halogenated compound ( approximately 80%). Finally, it was observed that the microbial consortium was also capable to metabolize 2,4,6-TCP without phenol as primary substrate, with high removal efficiencies (near 100% for 2,4,6-TCP, 92% for COD and 88% for chloride ions).

TiO2-photocatalyzed As(III) oxidation in a fixed-bed, flow-through reactor.

PubMed

Ferguson, Megan A; Hering, Janet G

2006-07-01

Compliance with the U.S. drinking water standard for arsenic (As) of 10 microg L(-1) is required in January 2006. This will necessitate implementation of treatment technologies for As removal by thousands of water suppliers. Although a variety of such technologies is available, most require preoxidation of As(III) to As(V) for efficient performance. Previous batch studies with illuminated TiO2 slurries have demonstrated that TiO2-photocatalyzed AS(III) oxidation occurs rapidly. This study examined reaction efficiency in a flow-through, fixed-bed reactor that provides a better model for treatment in practice. Glass beads were coated with mixed P25/sol gel TiO2 and employed in an upflow reactor irradiated from above. The reactor residence time, influent As(III) concentration, number of TiO2 coatings on the beads, solution matrix, and light source were varied to characterize this reaction and determine its feasibility for water treatment. Repeated usage of the same beads in multiple experiments or extended use was found to affect effluent As(V) concentrations but not the steady-state effluent As(III) concentration, which suggests that As(III) oxidation at the TiO2 surface undergoes dynamic sorption equilibration. Catalyst poisoning was not observed either from As(V) or from competitively adsorbing anions, although the higher steady-state effluent As(III) concentrations in synthetic groundwater compared to 5 mM NaNO3 indicated that competitive sorbates in the matrix partially hinder the reaction. A reactive transport model with rate constants proportional to incident light at each bead layer fit the experimental data well despite simplifying assumptions. TiO2-photocatalyzed oxidation of As(III) was also effective under natural sunlight. Limitations to the efficiency of As(III) oxidation in the fixed-bed reactor were attributable to constraints of the reactor geometry, which could be overcome by improved design. The fixed-bed TiO2 reactor offers an environmentally

Irradiation performance of (Th,Pu)O2 fuel under Pressurized Water Reactor conditions

NASA Astrophysics Data System (ADS)

Boer, B.; Lemehov, S.; Wéber, M.; Parthoens, Y.; Gysemans, M.; McGinley, J.; Somers, J.; Verwerft, M.

2016-04-01

This paper examines the in-pile safety performance of (Th,Pu)O2 fuel pins under simulated Pressurized Water Reactor (PWR) conditions. Both sol-gel and SOLMAS produced (Th,Pu)O2 fuels at enrichments of 7.9% and 12.8% in Pu/HM have been irradiated at SCK·CEN. The irradiation has been performed under PWR conditions (155 bar, 300 °C) in a dedicated loop of the BR-2 reactor. The loop is instrumented with flow and temperature monitors at inlet and outlet, which allow for an accurate measurement of the deposited enthalpy.

Cultivation of shear stress sensitive microorganisms in disposable bag reactor systems.

PubMed

Jonczyk, Patrick; Takenberg, Meike; Hartwig, Steffen; Beutel, Sascha; Berger, Ralf G; Scheper, Thomas

2013-09-20

Technical scale (≥5l) cultivations of shear stress sensitive microorganisms are often difficult to perform, as common bioreactors are usually designed to maximize the oxygen input into the culture medium. This is achieved by mechanical stirrers, causing high shear stress. Examples for shear stress sensitive microorganisms, for which no specific cultivation systems exist, are many anaerobic bacteria and fungi, such as basidiomycetes. In this work a disposable bag bioreactor developed for cultivation of mammalian cells was investigated to evaluate its potential to cultivate shear stress sensitive anaerobic Eubacterium ramulus and shear stress sensitive basidiomycetes Flammulina velutipes and Pleurotus sapidus. All cultivations were compared with conventional stainless steel stirred tank reactors (STR) cultivations. Good growth of all investigated microorganisms cultivated in the bag reactor was found. E. ramulus showed growth rates of μ=0.56 h⁻¹ (bag) and μ=0.53 h⁻¹ (STR). Differences concerning morphology, enzymatic activities and growth in fungal cultivations were observed. In the bag reactor growth in form of small, independent pellets was observed while STR cultivations showed intense aggregation. F. velutipes reached higher biomass concentrations (21.2 g l⁻¹ DCW vs. 16.8 g l⁻¹ DCW) and up to 2-fold higher peptidolytic activities in comparison to cell cultivation in stirred tank reactors. Copyright © 2013 Elsevier B.V. All rights reserved.

IgG2 deficiency in sickle cell anaemia.

PubMed

Natta, C L; Outschoorn, I M

1984-08-01

8 patients with known sickle cell anaemia were studied immunologically. The concentrations of the main immunoglobulin classes, IgG and IgA, were significantly higher than the levels in 11 normal age- and sex-matched black subjects (P less than 0.01). IgM levels were not significantly different in the two groups. There was a heterogeneity in the interaction of the IgG subclasses with Protein A, with low levels of IgG2. The IgG2:IgG1 ratios varied from 1:3.8 to 1:6 (normals 1:3). In 4 patients the absolute levels of IgG2 as measured by radial immunodiffusion were lower than normal, thus confirming the chromatographic ratios. Since specific antibody is often restricted to a single subclass, the levels of IgG subclasses may be related to recurrent bacterial infections in these patients.

Treatment of G1 Baskets at the CEA Marcoule Site - 12027

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fourquet, Line; Boya, Didier

2012-07-01

In the dismantling program for the first-generation French reactors in accordance with the nonproliferation treaty, the CEA is in charge of cleanup and dismantling operations for the facilities at Marcoule, including the decladding units. The G1 decladding was built between 1955 and 1957 in order to de-clad spent fuel elements from the G1 plutonium-producing reactor and prepare them for dissolution. The facility was also used for interim storage of G1, G2 and G3 fuel dissolution baskets, which had been used during plant operation for transfer (from the decladding facility to the UP1 plant) and/or dissolution of spent fuel elements. Onemore » of the cleanup projects involves recovery of the baskets, which will be cut up, sorted, and conditioned in metal bins. The bins will be immobilized with cement grout, then transferred to the onsite solid waste conditioning facility (CDS) and to the repository operated by the French National Radioactive Waste Management Agency (ANDRA). The project is now in progress, after special safety permits were issued and measurement stations and dedicated tools were developed to handle all types of baskets (which differed according to their origin and use). The disposal of all the baskets is scheduled to last 2 years and will produce 55 metal waste bins. (authors)« less

Anaerobic treatment of winery wastewater in fixed bed reactors.

PubMed

Ganesh, Rangaraj; Rajinikanth, Rajagopal; Thanikal, Joseph V; Ramanujam, Ramamoorty Alwar; Torrijos, Michel

2010-06-01

The treatment of winery wastewater in three upflow anaerobic fixed-bed reactors (S9, S30 and S40) with low density floating supports of varying size and specific surface area was investigated. A maximum OLR of 42 g/l day with 80 +/- 0.5% removal efficiency was attained in S9, which had supports with the highest specific surface area. It was found that the efficiency of the reactors increased with decrease in size and increase in specific surface area of the support media. Total biomass accumulation in the reactors was also found to vary as a function of specific surface area and size of the support medium. The Stover-Kincannon kinetic model predicted satisfactorily the performance of the reactors. The maximum removal rate constant (U(max)) was 161.3, 99.0 and 77.5 g/l day and the saturation value constant (K(B)) was 162.0, 99.5 and 78.0 g/l day for S9, S30 and S40, respectively. Due to their higher biomass retention potential, the supports used in this study offer great promise as media in anaerobic fixed bed reactors. Anaerobic fixed-bed reactors with these supports can be applied as high-rate systems for the treatment of large volumes of wastewaters typically containing readily biodegradable organics, such as the winery wastewater.

Critical Elements of Vehicle-to-Grid (V2G) Economics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Steward, Darlene M.

This report explores the critical elements of V2G economics. Section 2 summarizes the elements and costs of a V2G system. Section 3 describes V2G revenue-generating services and the business cases for providing these services. Section 4 notes real-world V2G applications. Section 5 lists concerns related to V2G. Section 6 concludes and summarizes V2G cost and revenue elements.

Biological production of ethanol from coal. Task 4 report, Continuous reactor studies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

The production of ethanol from synthesis gas by the anaerobic bacterium C. ljungdahlii has been demonstrated in continuous stirred tank reactors (CSTRs), CSTRs with cell recycle and trickle bed reactors. Various liquid media were utilized in these studies including basal medium, basal media with 1/2 B-vitamins and no yeast extract and a medium specifically designed for the growth of C. ljungdahlii in the CSTR. Ethanol production was successful in each of the three reactor types, although trickle bed operation with C. ljungdahlii was not as good as with the stirred tank reactors. Operation in the CSTR with cell recycle wasmore » particularly promising, producing 47 g/L ethanol with only minor concentrations of the by-product acetate.« less

Dual-mode cultivation of Chlorella protothecoides applying inter-reactors gas transfer improves microalgae biodiesel production.

PubMed

Santos, C A; Nobre, B; Lopes da Silva, T; Pinheiro, H M; Reis, A

2014-08-20

Chlorella protothecoides, a lipid-producing microalga, was grown heterotrophically and autotrophically in separate reactors, the off-gases exiting the former being used to aerate the latter. Autotrophic biomass productivity with the two-reactor association, 0.0249gL(-1)h(-1), was 2.2-fold the value obtained in a control autotrophic culture, aerated with ambient air. Fatty acid productivity was 1.7-fold the control value. C. protothecoides heterotrophic biomass productivity was 0.229gL(-1)h(-1). This biomass' fatty acid content was 34.5% (w/w) with a profile suitable for biodiesel production, according to European Standards. The carbon dioxide fixed by the autotrophic biomass was 45mgCO2L(-1)h(-1) in the symbiotic arrangement, 2.1 times the control reactor value. The avoided CO2 atmospheric emission represented 30% of the CO2 produced in the heterotrophic stage, while the released O2 represented 49% of the oxygen demand in that stage. Thus, an increased efficiency in the glucose carbon source use and a higher environmental sustainability were achieved in microalgal biodiesel production using the proposed assembly. Copyright © 2014 Elsevier B.V. All rights reserved.

Utilizing a one-dimensional multispecies model to simulate the nutrient reduction and biomass structure in two types of H2-based membrane-aeration biofilm reactors (H2-MBfR): model development and parametric analysis.

PubMed

Wang, Zuowei; Xia, Siqing; Xu, Xiaoyin; Wang, Chenhui

2016-02-01

In this study, a one-dimensional multispecies model (ODMSM) was utilized to simulate NO3(-)-N and ClO4(-) reduction performances in two kinds of H2-based membrane-aeration biofilm reactors (H2-MBfR) within different operating conditions (e.g., NO3(-)-N/ClO4(-) loading rates, H2 partial pressure, etc.). Before the simulation process, we conducted the sensitivity analysis of some key parameters which would fluctuate in different environmental conditions, then we used the experimental data to calibrate the more sensitive parameters μ1 and μ2 (maximum specific growth rates of denitrification bacteria and perchlorate reduction bacteria) in two H2-MBfRs, and the diversity of the two key parameters' values in two types of reactors may be resulted from the different carbon source fed in the reactors. From the simulation results of six different operating conditions (four in H2-MBfR 1 and two in H2-MBfR 2), the applicability of the model was approved, and the variation of the removal tendency in different operating conditions could be well simulated. Besides, the rationality of operating parameters (H2 partial pressure, etc.) could be judged especially in condition of high nutrients' loading rates. To a certain degree, the model could provide theoretical guidance to determine the operating parameters on some specific conditions in practical application.

Microbial Community Analysis of Anaerobic Reactors Treating Soft Drink Wastewater

PubMed Central

Narihiro, Takashi; Kim, Na-Kyung; Mei, Ran; Nobu, Masaru K.; Liu, Wen-Tso

2015-01-01

The anaerobic packed-bed (AP) and hybrid packed-bed (HP) reactors containing methanogenic microbial consortia were applied to treat synthetic soft drink wastewater, which contains polyethylene glycol (PEG) and fructose as the primary constituents. The AP and HP reactors achieved high COD removal efficiency (>95%) after 80 and 33 days of the operation, respectively, and operated stably over 2 years. 16S rRNA gene pyrotag analyses on a total of 25 biofilm samples generated 98,057 reads, which were clustered into 2,882 operational taxonomic units (OTUs). Both AP and HP communities were predominated by Bacteroidetes, Chloroflexi, Firmicutes, and candidate phylum KSB3 that may degrade organic compound in wastewater treatment processes. Other OTUs related to uncharacterized Geobacter and Spirochaetes clades and candidate phylum GN04 were also detected at high abundance; however, their relationship to wastewater treatment has remained unclear. In particular, KSB3, GN04, Bacteroidetes, and Chloroflexi are consistently associated with the organic loading rate (OLR) increase to 1.5 g COD/L-d. Interestingly, KSB3 and GN04 dramatically decrease in both reactors after further OLR increase to 2.0 g COD/L-d. These results indicate that OLR strongly influences microbial community composition. This suggests that specific uncultivated taxa may take central roles in COD removal from soft drink wastewater depending on OLR. PMID:25748027

Strengthening IAEA Safeguards for Research Reactors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Reid, Bruce D.; Anzelon, George A.; Budlong-Sylvester, Kory

During their December 10-11, 2013, workshop in Grenoble France, which focused on the history and future of safeguarding research reactors, the United States, France and the United Kingdom (UK) agreed to conduct a joint study exploring ways to strengthen the IAEA’s safeguards approach for declared research reactors. This decision was prompted by concerns about: 1) historical cases of non-compliance involving misuse (including the use of non-nuclear materials for production of neutron generators for weapons) and diversion that were discovered, in many cases, long after the violations took place and as part of broader pattern of undeclared activities in half amore » dozen countries; 2) the fact that, under the Safeguards Criteria, the IAEA inspects some reactors (e.g., those with power levels under 25 MWt) less than once per year; 3) the long-standing precedent of States using heavy water research reactors (HWRR) to produce plutonium for weapons programs; 4) the use of HEU fuel in some research reactors; and 5) various technical characteristics common to some types of research reactors that could provide an opportunity for potential proliferators to misuse the facility or divert material with low probability of detection by the IAEA. In some research reactors it is difficult to detect diversion or undeclared irradiation. In addition, infrastructure associated with research reactors could pose a safeguards challenge. To strengthen the effectiveness of safeguards at the State level, this paper advocates that the IAEA consider ways to focus additional attention and broaden its safeguards toolbox for research reactors. This increase in focus on the research reactors could begin with the recognition that the research reactor (of any size) could be a common path element on a large number of technically plausible pathways that must be considered when performing acquisition pathway analysis (APA) for developing a State Level Approach (SLA) and Annual Implementation Plan

Behavior of nitrogen removal in an aerobic sponge based moving bed biofilm reactor.

PubMed

Zhang, Xinbo; Song, Zi; Guo, Wenshan; Lu, Yanmin; Qi, Li; Wen, Haitao; Ngo, Huu Hao

2017-12-01

This study aims to investigate the behavior of nitrogen removal in an aerobic sponge based moving bed biofilm reactor by evaluating nitrification and denitrification rates of sponge biocarriers from three aerobic moving bed biofilm reactors (MBBRs) with filling ratios of 10% (R-10), 20% (R-20) and 30% (R-30). Results showed that the highest removal efficiencies of total nitrogen in three reactors were 84.5% (R-10), 93.6% (R-20) and 95.3% (R-30). Correspondingly, simultaneous nitrification and denitrification rate (SND) was 90.9%, 97.6% and 100%, respectively. Although R-20 had the highest attached-growth biomass (AGB) per gram of sponge compared to the other two reactors, R-30 showed the maximum ammonium oxidation rate (AOR) (2.1826±0.0717mgNH 4 + -N/gAGB/h) and denitrification rate (DNR) (5.0852±0.0891mgNO 3 - -N/gAGB/h), followed by R-20 and R-10. These results indicated AOR, DNR and AGB were affected by the filling ratio under the same operation mode. Copyright © 2017 Elsevier Ltd. All rights reserved.

Organic loading rate effect on the acidogenesis of cheese whey: a comparison between UASB and SBR reactors.

PubMed

Calero, R; Iglesias-Iglesias, R; Kennes, C; Veiga, M C

2017-09-16

Volatile fatty acids (VFA) production and degree of acidification (DA) were investigated in the anaerobic treatment of cheese whey by comparison of two processes: a continuous process using a laboratory upflow anaerobic sludge blanket (UASB) reactor and a discontinuous process using a sequencing batch reactor (SBR). The main purpose of this work was to study the organic loading rate (OLR) effect on the yield of VFA in two kinds of reactors. The predominant products in the acidogenic process in both reactors were: acetate, propionate, butyrate and valerate. The maximum DA obtained was 98% in an SBR at OLR of 2.7 g COD L -1 d -1 , and 97% in the UASB at OLR at 15.1 g COD L -1 d -1 . The results revealed that the UASB reactor was more efficient at a medium OLR with a higher VFA yield, while with the SBR reactor, the maximum acidification was obtained at a lower OLR with changes in the VFA profile at different OLRs applied.

Structural and thermodynamic study of dicesium molybdate Cs2Mo2O7: Implications for fast neutron reactors

NASA Astrophysics Data System (ADS)

Smith, A. L.; Kauric, G.; van Eijck, L.; Goubitz, K.; Wallez, G.; Griveau, J.-C.; Colineau, E.; Clavier, N.; Konings, R. J. M.

2017-09-01

The structure of α-Cs2Mo2O7 (monoclinic in space group P21 / c), which can form during irradiation in fast breeder reactors in the space between nuclear fuel and cladding, has been refined in this work at room temperature from neutron diffraction data. Furthermore, the compounds' thermal expansion and polymorphism have been investigated using high temperature X-ray diffraction combined with high temperature Raman spectroscopy. A phase transition has been observed at Ttr(α → β)=(621.9±0.8) K using Differential Scanning Calorimetry, and the structure of the β-Cs2Mo2O7 phase, orthorhombic in space group Pbcm, has been solved ab initio from the high temperature X-ray diffraction data. Furthermore, the low temperature heat capacity of α-Cs2Mo2O7 has been measured in the temperature range T=(1.9-313.2) K using a Quantum Design PPMS (Physical Property Measurement System) calorimeter. The heat capacity and entropy values at T=298.15 K have been derived as Cp,mo (Cs2Mo2O7 , cr , 298.15 K) = (211.9 ± 2.1) J K-1mol-1 and Smo (Cs2Mo2O7 , cr , 298.15 K) = (317.4 ± 4.3) J K-1mol-1 . When combined with the enthalpy of formation reported in the literature, these data yield standard entropy and Gibbs energy of formation as Δf Smo (Cs2Mo2O7 , cr , 298.15 K) = - (628.2 ± 4.4) J K-1mol-1 and Δf Gmo (Cs2Mo2O7 , cr , 298.15 K) = - (2115.1 ± 2.5) kJmol-1 . Finally, the cesium partial pressure expected in the gap between fuel and cladding following the disproportionation reaction 2Cs2MoO4=Cs2Mo2O7+2Cs(g)+ 1/2 O2(g) has been calculated from the newly determined thermodynamic functions.

PARTIAL ECONOMIC STUDY OF STEAM COOLED HEAVY WATER MODERATED REACTORS

DOE Office of Scientific and Technical Information (OSTI.GOV)

None

1960-04-01

Steam-cooled reactors are compared with CAHDU for costs of Calandria tubes, pressure tubes. heavy water moderator, heavy water reflector, fuel supply, heat exchanger, and turbine generator. A direct-cycle lightsteam-cooled heavy- water-moderated pressure-tube reactor formed the basic reactor design for the study. Two methods of steam circulation through the reactor were examined. In both cases the steam was generated outside the reactor and superheated in the reactor core. One method consisted of a series of reactor and steam generator passes. The second method consisted of the Loeffler cycle and its modifications. The fuel was assumed to be natural cylindrical UO/sub 2/more » pellets sheathed in a hypothetical material with the nuclear properties of Zircaloy, but able to function at temperatures to 900 deg F. For the conditions assumed, the longer the rod, the higher the outlet temperature and therefore the higher the efficiency. The turbine cycle efficiency was calculated on the assumption that suitable steam generators are available. As the neutron losses to the pressure tubes were significant, an economic analysis of insulated pressure tubes is included. A description of the physics program for steam-cooled reactors is included. Results indicated that power from the steam-cooled reactor would cost 1.4 mills/ kwh compared with 1.25 mills/kwh for CANDU. (M.C.G.)« less

Zero valent iron simultaneously enhances methane production and sulfate reduction in anaerobic granular sludge reactors.

PubMed

Liu, Yiwen; Zhang, Yaobin; Ni, Bing-Jie

2015-05-15

Zero valent iron (ZVI) packed anaerobic granular sludge reactors have been developed for improved anaerobic wastewater treatment. In this work, a mathematical model is developed to describe the enhanced methane production and sulfate reduction in anaerobic granular sludge reactors with the addition of ZVI. The model is successfully calibrated and validated using long-term experimental data sets from two independent ZVI-enhanced anaerobic granular sludge reactors with different operational conditions. The model satisfactorily describes the chemical oxygen demand (COD) removal, sulfate reduction and methane production data from both systems. Results show ZVI directly promotes propionate degradation and methanogenesis to enhance methane production. Simultaneously, ZVI alleviates the inhibition of un-dissociated H2S on acetogens, methanogens and sulfate reducing bacteria (SRB) through buffering pH (Fe(0) + 2H(+) = Fe(2+) + H2) and iron sulfide precipitation, which improve the sulfate reduction capacity, especially under deterioration conditions. In addition, the enhancement of ZVI on methane production and sulfate reduction occurs mainly at relatively low COD/ [Formula: see text] ratio (e.g., 2-4.5) rather than high COD/ [Formula: see text] ratio (e.g., 16.7) compared to the reactor without ZVI addition. The model proposed in this work is expected to provide support for further development of a more efficient ZVI-based anaerobic granular system. Copyright © 2015 Elsevier Ltd. All rights reserved.

Largely enhanced photocatalytic activity of Au/XS2/Au (X = Re, Mo) antenna-reactor hybrids: charge and energy transfer.

PubMed

Chen, Kai; Ding, Si-Jing; Luo, Zhi-Jun; Pan, Gui-Ming; Wang, Jia-Hong; Liu, Jia; Zhou, Li; Wang, Qu-Quan

2018-02-22

An antenna-reactor hybrid coupling plasmonic antenna with catalytic nanoparticles is a new strategy to optimize photocatalytic activity. Herein, we have rationally proposed a Au/XS 2 /Au (X = Re, Mo) antenna reactor, which has a large Au core as the antenna and small satellite Au nanoparticles as the reactor separated by an ultrathin two-dimensional transition-metal dichalcogenide XS 2 shell (∼2.6 nm). Due to efficient charge transfer across the XS 2 shell as well as energy transfer via coupling of the Au antenna and Au reactor, the photocatalytic activity has been largely enhanced: Au/ReS 2 /Au exhibits a 3.59-fold enhancement, whereas Au/MoS 2 /Au exhibits a 2.66-fold enhancement as compared to that of the sum of the three individual components. The different enhancement in the Au/ReS 2 /Au and Au/MoS 2 /Au antenna-reactor hybrid is related to the competition and cooperation of charge and energy transfer. These results indicate the great potential of the Au/XS 2 /Au antenna-reactor hybrid for the development of highly efficient plasmonic photocatalysts.

MC 2 -3: Multigroup Cross Section Generation Code for Fast Reactor Analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Changho; Yang, Won Sik

This paper presents the methods and performance of the MC2 -3 code, which is a multigroup cross-section generation code for fast reactor analysis, developed to improve the resonance self-shielding and spectrum calculation methods of MC2 -2 and to simplify the current multistep schemes generating region-dependent broad-group cross sections. Using the basic neutron data from ENDF/B data files, MC2 -3 solves the consistent P1 multigroup transport equation to determine the fundamental mode spectra for use in generating multigroup neutron cross sections. A homogeneous medium or a heterogeneous slab or cylindrical unit cell problem is solved in ultrafine (2082) or hyperfine (~400more » 000) group levels. In the resolved resonance range, pointwise cross sections are reconstructed with Doppler broadening at specified temperatures. The pointwise cross sections are directly used in the hyperfine group calculation, whereas for the ultrafine group calculation, self-shielded cross sections are prepared by numerical integration of the pointwise cross sections based upon the narrow resonance approximation. For both the hyperfine and ultrafine group calculations, unresolved resonances are self-shielded using the analytic resonance integral method. The ultrafine group calculation can also be performed for a two-dimensional whole-core problem to generate region-dependent broad-group cross sections. Verification tests have been performed using the benchmark problems for various fast critical experiments including Los Alamos National Laboratory critical assemblies; Zero-Power Reactor, Zero-Power Physics Reactor, and Bundesamt für Strahlenschutz experiments; Monju start-up core; and Advanced Burner Test Reactor. Verification and validation results with ENDF/B-VII.0 data indicated that eigenvalues from MC2 -3/DIF3D agreed well with Monte Carlo N-Particle5 MCNP5 or VIM Monte Carlo solutions within 200 pcm and regionwise one-group fluxes were in good agreement with Monte Carlo

Experimental Criticality Benchmarks for SNAP 10A/2 Reactor Cores

DOE Office of Scientific and Technical Information (OSTI.GOV)

Krass, A.W.

2005-12-19

This report describes computational benchmark models for nuclear criticality derived from descriptions of the Systems for Nuclear Auxiliary Power (SNAP) Critical Assembly (SCA)-4B experimental criticality program conducted by Atomics International during the early 1960's. The selected experimental configurations consist of fueled SNAP 10A/2-type reactor cores subject to varied conditions of water immersion and reflection under experimental control to measure neutron multiplication. SNAP 10A/2-type reactor cores are compact volumes fueled and moderated with the hydride of highly enriched uranium-zirconium alloy. Specifications for the materials and geometry needed to describe a given experimental configuration for a model using MCNP5 are provided. Themore » material and geometry specifications are adequate to permit user development of input for alternative nuclear safety codes, such as KENO. A total of 73 distinct experimental configurations are described.« less

Optimization of chromatographic conditions for determination of aflatoxin B1, B2, G1 and G2 by using liquid chromatography-mass Spectrometry

NASA Astrophysics Data System (ADS)

Ramadhaningtyas, Dillani Putri; Aryana, Nurhani; Aristiawan, Yosi; Styarini, Dyah

2017-11-01

The optimization of instrument condition and chromatographic separation for analysis of aflatoxin B1, B2, G1 and G2 using liquid chromatography tandem with mass spectrometer detector was conducted in the aim to provide more accurate and reliable analysis results. The aflatoxin known to be serious threat for human health as it is classified as the carcinogenic compounds. The aflatoxin B1, B2, G1 and G2 were selected due to its extensive contamination in various agricultural commodities. The best chromatographic separation was obtained using C-18 column with gradient elution of solvent 5 mM ammonium acetate and 0.1% formic acid in methanol at 7 minutes runtime analysis. The linearity of the detector showed satisfied results as the coefficient determination found to be 0.9994, 0.9996, 0.9998 and 0.9987 for aflatoxin B1, G1, B2, and G2 respectively in the range concentration from 1 to 20 ng/g. The quantifier ion selected for the aflatoxin B1, B2, G1 and G2 was m/z 285.1, 259, 243 and 313 respectively. The instrument precision at these quantifier ions also showed satisfied result with %RSD was around 3.4 to 6.8%. The optimized method present in this study can be used for further sample analysis.

10 CFR 2.700 - Scope of subpart G.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 10 Energy 1 2011-01-01 2011-01-01 false Scope of subpart G. 2.700 Section 2.700 Energy NUCLEAR... Formal Adjudications § 2.700 Scope of subpart G. The provisions of this subpart apply to and supplement... authorization for high-level radioactive waste repository noticed under §§ 2.101(f)(8) or 2.105(a)(5...

Excitation of O 2(a 1Δ g, b 1Σ g+) and I( 2P 1/2) by energy transfer from I 2(A, A' 3Π 1,2u) in solid rare gases

NASA Astrophysics Data System (ADS)

Böhling, R.; Becker, A. C.; Minaev, B. F.; Seranski, K.; Schurath, U.

1990-04-01

O 2a 1Δ g, b 1Σ g+ → X 3Σ g- and I 2P 1/2→ 2P 3/4 fluorescence occurs in I 2/O 2-doped rare gas matrices when I 2 is excited with visible laser light. O 2(a 1Δ g) and I( 2P 1/2) are populated independently by near-resonant energy transfer from the metastable triplet states of I 2. The doublet splitting of the O 2a→X band, which peaks at 7879 and 7863 cm -1 in argon, is interpreted as sensitized emission from O 2 trapped in distinct nearest neighbour positions of the donor 3I 2. Annealing reverses the intensity of the doublet, showing that the sites can be interconverted. It is suggested that the a→X emission rate is enhanced by the sensitizer, causing a lifetime reduction of the a 1Δ g state from 79 s in pure argon to 21 and 3±1 s next to I 2. The long-lived O 2(a 1Δ g) state is the precursor of I 2-sensitized emission from O 2(b 1Σ g+). The lifetime of O 2(b 1Σ g+) is reduced from 24.5 ms in pure argon to 17±1 ms in the presence of I 2.

Comprehensive study for Anammox process via multistage anaerobic baffled reactors

NASA Astrophysics Data System (ADS)

Ismail, Sherif; Tawfik, Ahmed

2017-11-01

Continuous anaerobic ammonia oxidation (Anammox) process in multistage anaerobic baffled (MABR) reactor was investigated. The reactor was operated for approximately 150 days at constant hydraulic retention time (HRT) of 48 h and was fed with synthetic wastewater containing nitrite and ammonium as main substrates. The MABR was inoculated with mixed culture bacteria collected from activated sludge plant (41.6 g MLSS/L and 19.1 g MLVSS/L). The MABR reactor exhibited excellent performance for the start-up of Anammox process within a period of 35 days. The start-up period was divided into four successive phases; cell lysis, lag, activity elevation and steady state. Total inorganic nitrogen (TIN) removal efficiency of 96.8± 0.9% was achieved at steady state conditions, corresponding to nitrogen removal rate (NRR) of 50.2±1.7 mg N/L·d. Moreover, the effect of HRT on the Anammox process was assessed with applying five different HRTs of (48, 38.4, 28.8, 19.2 and 9.6 h). Decreasing HRT from 48 to 9.6 h reduced the removal efficiencies of NH4-N, NO2-N and TIN from 97.7±2.2 to 49.0±9.8%, from 95.7±1.9 to 71.0±8.5% and from 96.8±0.9 to 57.9±9.1%, respectively, that corresponding to reduction in NRR from 50.8±1.2 mg N/L·d at HRT of 48 h to 32.5±5.0 mg N/L·d at HRT of 9.6 h.

Treatment of winery wastewater by an anaerobic sequencing batch reactor.

PubMed

Ruíz, C; Torrijos, M; Sousbie, P; Lebrato Martínez, J; Moletta, R; Delgenès, J P

2002-01-01

Treatment of winery wastewater was investigated using an anaerobic sequencing batch reactor (ASBR). Biogas production rate was monitored and permitted the automation of the bioreactor by a simple control system. The reactor was operated at an organic loading rate (ORL) around 8.6 gCOD/L.d with soluble chemical oxygen demand (COD) removal efficiency greater than 98%, hydraulic retention time (HRT) of 2.2 d and a specific organic loading rate (SOLR) of 0.96 gCOD/gVSS.d. The kinetics of COD and VFA removal were investigated for winery wastewater and for simple compounds such as ethanol, which is a major component of winery effluent, and acetate, which is the main volatile fatty acid (VFA) produced. The comparison of the profiles obtained with the 3 substrates shows that, overall, the acidification of the organic matter and the methanisation of the VFA follow zero order reactions, in the operating conditions of our study. The effect on the gas production rate resulted in two level periods separated by a sharp break when the acidification stage was finished and only the breaking down of the VFA continued.

On the Effectiveness of Wastewater Cylindrical Reactors: an Analysis Through Steiner Symmetrization

NASA Astrophysics Data System (ADS)

Díaz, J. I.; Gómez-Castro, D.

2016-03-01

The mathematical analysis of the shape of chemical reactors is studied in this paper through the research of the optimization of its effectiveness η such as introduced by R. Aris around 1960. Although our main motivation is the consideration of reactors specially designed for the treatment of wastewaters our results are relevant also in more general frameworks. We simplify the modeling by assuming a single chemical reaction with a monotone kinetics leading to a parabolic equation with a non-necessarily differentiable function. In fact we consider here the case of a single, non-reversible catalysis reaction of chemical order q, 00). We assume the chemical reactor of cylindrical shape Ω =G× (0,H) with G and open regular set of {R}2 not necessarily symmetric. We show that among all the sections G with prescribed area the ball is the set of lowest effectiveness η (t,G). The proof uses the notions of Steiner rearrangement. Finally, we show that if the height H is small enough then the effectiveness can be made as close to 1 as desired.

Thermal characteristics analysis of microwaves reactor for pyrolysis of used cooking oil

NASA Astrophysics Data System (ADS)

Anis, Samsudin; Shahadati, Laily; Sumbodo, Wirawan; Wahyudi

2017-03-01

The research is objected to develop microwave reactor for pyrolysis of used cooking oil. The effect of microwave power as well as addition of char as absorber towards its thermal characteristic were investigated. Domestic microwave was modified and used to test the thermal characteristic of used cooking oil in the terms of temperature evolution, heating rate, and thermal efficiency. The samples were examined under various microwave power of 347W, 399W, 572W and 642W for 25 minutes of irradiation time. The char loading was tested in the level of 0, 50, and 100 g. Microwave reactor consists of microwave unit with a maximum power of 642W, a ceramic reactor, and a condenser equipped with temperature measurement system was successfully developed. It was found that microwave power and addition of absorber significantly influenced the thermal characteristic of microwave reactor. Under investigated condition, the optimum result was obtained at microwave power of 642W and 100 g of char. The condition was able to provide temperature of 480°C, heating rate of 18.2°C/min and thermal efficiency of 53% that is suitable to pyrolyze used cooking oil.

Selective cytotoxicity of PAMAM G5 core–PAMAM G2.5 shell tecto-dendrimers on melanoma cells

PubMed Central

Schilrreff, Priscila; Mundiña-Weilenmann, Cecilia; Romero, Eder Lilia; Morilla, Maria Jose

2012-01-01

Background The controlled introduction of covalent linkages between dendrimer building blocks leads to polymers of higher architectural order known as tecto-dendrimers. Because of the few simple steps involved in their synthesis, tecto-dendrimers could expand the portfolio of structures beyond commercial dendrimers, due to the absence of synthetic drawbacks (large number of reaction steps, excessive monomer loading, and lengthy chromatographic separations) and structural constraints of high-generation dendrimers (reduction of good monodispersity and ideal dendritic construction due to de Gennes dense-packing phenomenon). However, the biomedical uses of tecto-dendrimers remain unexplored. In this work, after synthesizing saturated shell core–shell tecto-dendrimers using amine-terminated polyamidoamine (PAMAM) generation 5 (G5) as core and carboxyl-terminated PAMAM G2.5 as shell (G5G2.5 tecto-dendrimers), we surveyed for the first time the main features of their interaction with epithelial cells. Methods Structural characterization of G5G2.5 was performed by polyacrylamide gel electrophoresis, matrix-assisted laser desorption time-of-flight mass spectrometry, and microscopic techniques; their hydrodynamic size and Z-potential was also determined. Cellular uptake by human epidermal keratinocytes, colon adenocarcinoma, and epidermal melanoma (SK-Mel-28) cells was determined by flow cytometry. Cytotoxicity was determined by mitochondrial activity, lactate dehydrogenase release, glutathione depletion, and apoptosis/necrosis measurement. Results The resultant 60%–67% saturated shell, 87,000-dalton G5G2.5 (mean molecular weight) interacted with cells in a significantly different fashion in comparison to their building blocks and to its closest counterpart, PAMAM G6.5. After being actively taken up by epithelial cells, G5G2.5 caused cytotoxicity only on SK-Mel-28 cells, including depletion of intracellular glutathione and fast necrosis that was manifested above 5 μM G5

Muon g-2 Experiment Shimming

ScienceCinema

Kiburg, Brendan

2018-01-16

The Muon g-2 experiment at Fermilab will use as its primary instrument a 52-foot-wide electromagnet that creates a precise magnetic field. In this video, Fermilab's Brendan Kiburg explains the lengthy process of finely "shimming" that magnetic field into shape.

High Purity and Yield of Boron Nitride Nanotubes Using Amorphous Boron and a Nozzle-Type Reactor

PubMed Central

Kim, Jaewoo; Seo, Duckbong; Yoo, Jeseung; Jeong, Wanseop; Seo, Young-Soo; Kim, Jaeyong

2014-01-01

Enhancement of the production yield of boron nitride nanotubes (BNNTs) with high purity was achieved using an amorphous boron-based precursor and a nozzle-type reactor. Use of a mixture of amorphous boron and Fe decreases the milling time for the preparation of the precursor for BNNTs synthesis, as well as the Fe impurity contained in the B/Fe interdiffused precursor nanoparticles by using a simple purification process. We also explored a nozzle-type reactor that increased the production yield of BNNTs compared to a conventional flow-through reactor. By using a nozzle-type reactor with amorphous boron-based precursor, the weight of the BNNTs sample after annealing was increased as much as 2.5-times with much less impurities compared to the case for the flow-through reactor with the crystalline boron-based precursor. Under the same experimental conditions, the yield and quantity of BNNTs were estimated as much as ~70% and ~1.15 g/batch for the former, while they are ~54% and 0.78 g/batch for the latter. PMID:28788161

High Purity and Yield of Boron Nitride Nanotubes Using Amorphous Boron and a Nozzle-Type Reactor.

PubMed

Kim, Jaewoo; Seo, Duckbong; Yoo, Jeseung; Jeong, Wanseop; Seo, Young-Soo; Kim, Jaeyong

2014-08-11

Enhancement of the production yield of boron nitride nanotubes (BNNTs) with high purity was achieved using an amorphous boron-based precursor and a nozzle-type reactor. Use of a mixture of amorphous boron and Fe decreases the milling time for the preparation of the precursor for BNNTs synthesis, as well as the Fe impurity contained in the B/Fe interdiffused precursor nanoparticles by using a simple purification process. We also explored a nozzle-type reactor that increased the production yield of BNNTs compared to a conventional flow-through reactor. By using a nozzle-type reactor with amorphous boron-based precursor, the weight of the BNNTs sample after annealing was increased as much as 2.5-times with much less impurities compared to the case for the flow-through reactor with the crystalline boron-based precursor. Under the same experimental conditions, the yield and quantity of BNNTs were estimated as much as ~70% and ~1.15 g/batch for the former, while they are ~54% and 0.78 g/batch for the latter.

G5G2.5 core-shell tecto-dendrimer specifically targets reactive glia in brain ischemia.

PubMed

Murta, Veronica; Schilrreff, Priscila; Rosciszewski, Gerardo; Morilla, Maria Jose; Ramos, Alberto Javier

2018-03-01

Secondary neuronal death is a serious stroke complication. This process is facilitated by the conversion of glial cells to the reactive pro-inflammatory phenotype that induces neurodegeneration. Therefore, regulation of glial activation is a compelling strategy to reduce brain damage after stroke. However, drugs have difficulties to access the CNS, and to specifically target glial cells. In the present work, we explored the use core-shell polyamidoamine tecto-dendrimer (G5G2.5 PAMAM) and studied its ability to target distinct populations of stroke-activated glial cells. We found that G5G2.5 tecto-dendrimer is actively engulfed by primary glial cells in a time- and dose-dependent manner showing high cellular selectivity and lysosomal localization. In addition, oxygen-glucose deprivation or lipopolysaccharides exposure in vitro and brain ischemia in vivo increase glial G5G2.5 uptake; not being incorporated by neurons or other cell types. We conclude that G5G2.5 tecto-dendrimer is a highly suitable carrier for targeted drug delivery to reactive glial cells in vitro and in vivo after brain ischemia. © 2017 International Society for Neurochemistry.

Hydrogel coated monoliths for enzymatic hydrolysis of penicillin G

PubMed Central

Smeltink, M. W.; Straathof, A. J. J.; Paasman, M. A.; van de Sandt, E. J. A. X.; Kapteijn, F.; Moulijn, J. A.

2008-01-01

The objective of this work was to develop a hydrogel-coated monolith for the entrapment of penicillin G acylase (E. coli, PGA). After screening of different hydrogels, chitosan was chosen as the carrier material for the preparation of monolithic biocatalysts. This protocol leads to active immobilized biocatalysts for the enzymatic hydrolysis of penicillin G (PenG). The monolithic biocatalyst was tested in a monolith loop reactor (MLR) and compared with conventional reactor systems using free PGA, and a commercially available immobilized PGA. The optimal immobilization protocol was found to be 5 g l−1 PGA, 1% chitosan, 1.1% glutaraldehyde and pH 7. Final PGA loading on glass plates was 29 mg ml−1 gel. For 400 cpsi monoliths, the final PGA loading on functionalized monoliths was 36 mg ml−1 gel. The observed volumetric reaction rate in the MLR was 0.79 mol s−1 m−3monolith. Apart from an initial drop in activity due to wash out of PGA at higher ionic strength, no decrease in activity was observed after five subsequent activity test runs. The storage stability of the biocatalysts is at least a month without loss of activity. Although the monolithic biocatalyst as used in the MLR is still outperformed by the current industrial catalyst (immobilized preparation of PGA, 4.5 mol s−1 m−3catalyst), the rate per gel volume is slightly higher for monolithic catalysts. Good activity and improved mechanical strength make the monolithic bioreactor an interesting alternative that deserves further investigation for this application. Although moderate internal diffusion limitations have been observed inside the gel beads and in the gel layer on the monolith channel, this is not the main reason for the large differences in reactor performance that were observed. The pH drop over the reactor as a result of the chosen method for pH control results in a decreased performance of both the MLR and the packed bed reactor compared to the batch system. A different

Photodegradation of bisphenol-A in a batch TiO2 suspension reactor.

PubMed

Tsai, Wen-Tien; Lee, Mei-Kuei; Su, Ting-Yi; Chang, Yuan-Ming

2009-08-30

In this work, the photocatalytic behaviors of bisphenol-A (BPA), which has been listed as one of endocrine disrupting chemicals, were carried out in a batch TiO(2) suspension reactor. The photodegradation efficiency has been investigated under the controlled process parameters including initial BPA concentration (i.e., 1-50 mg L(-1)), TiO(2) dosage (i.e., 5-600 mg/200 cm(3)), initial pH (i.e., 3-11), and temperature (i.e., 10-70 degrees C). It was found that the optimal conditions in the photoreaction process could be coped with at initial BPA concentration=20 mg L(-1), TiO(2) dosage=0.5 g L(-1) (100mg/200 cm(3)), initial pH=7.0, and temperature=25 degrees C. According to the Langmuir-Hinshelwood model, the results showed that the photodegradation kinetics for the destruction of BPA in water also followed the first-order model well. The apparent first-order reaction constants (k(obs)), thus obtained from the fittings of the model, were in line with the destruction-removal efficiencies of BPA in all the photocatalytic experiments. Based on the intermediate products identified in the study, the possible mechanisms for the photodegradation of BPA in water were also proposed in the present study.

Ultrasonic pilot-scale reactor for enzymatic bleaching of cotton fabrics.

PubMed

Gonçalves, Idalina; Herrero-Yniesta, Victor; Perales Arce, Iratxe; Escrigas Castañeda, Monica; Cavaco-Paulo, Artur; Silva, Carla

2014-07-01

The potential of ultrasound-assisted technology has been demonstrated by several laboratory scale studies. However, their successful industrial scaling-up is still a challenge due to the limited pilot and commercial sonochemical reactors. In this work, a pilot reactor for laccase-hydrogen peroxide cotton bleaching assisted by ultrasound was scaled-up. For this purpose, an existing dyeing machine was transformed and adapted by including piezoelectric ultrasonic devices. Laboratory experiments demonstrated that both low frequency, high power (22 kHz, 2100 W) and high frequency, low power ultrasounds (850 kHz, 400 W) were required to achieve satisfactory results. Standard half (4 g/L H2O2 at 90 °C for 60 min) and optical (8 g/L H2O2 at 103 °C for 40 min) cotton bleaching processes were used as references. Two sequential stages were established for cotton bleaching: (1) laccase pretreatment assisted by high frequency ultrasound (850 kHz, 400 W) and (2) bleaching using high power ultrasound (22 kHz, 2100 W). When compared with conventional methods, combined laccase-hydrogen peroxide cotton bleaching with ultrasound energy improved the whitening effectiveness. Subsequently, less energy (temperature) and chemicals (hydrogen peroxide) were needed for cotton bleaching thus resulting in costs reduction. This technology allowed the combination of enzyme and hydrogen peroxide treatment in a continuous process. The developed pilot-scale reactor offers an enhancement of the cotton bleaching process with lower environmental impact as well as a better performance of further finishing operations. Copyright © 2014 Elsevier B.V. All rights reserved.

Enhanced photodegradation of phenolic compounds by adding TiO2 to soil in a rotary reactor.

PubMed

Wang, Jing-xian; Chen, Shuo; Quan, Xie; Zhao, Hui-min; Zhao, Ya-zhi

2006-01-01

Photodegradation of pentachlorophenol (PCP) and p-nitrophenol (PNP) in soil was carried out in a designed rotary reactor, which can provide the soil particles with continually uniform irradiation, and on a series of thin soil layers. TiO2, as a kind of environmental friendly photocatalyst, was introduced to the soil to enhance the processes. Compared with that on the soil layers, photodegradation of PCP at initial concentration of 60 mg/kg was improved dramatically in the rotary reactor no matter whether TiO2 was added, with an increase of 3.0 times in the apparent first-order rate constants. The addition of 1 wt% TiO2 furthered the improvement by 1.4 times. Without addition of TiO2, PNP (initial concentration of 60 mg/kg) photodegradation rate in the rotary reactor was similar to that on the soil layers. When 1 wt% additional TiO2 was added, PNP photodegradation was enhanced obviously, and the enhancement in the rotary reactor was 2 times of that on the soil layers, which may be attributed to the higher frequency of the contact between PNP on soil particles and the photocatalyst. The effect of soil pH and initial concentrations of the target compounds on the photodegradation in the rotary reactor was investigated. The order of the degradation rate at different soil pH was relative to the aggregation of soil particles during mixing in the rotary reactor. Photodegradation of PCP and PNP at different initial concentrations showed that addition of TiO2 to enhance the photodegradation was more suitable for contaminated soil with higher concentration of PCP, while was effective for contaminated soil at each PNP concentration tested in our study.

Complete degradation of Orange G by electrolysis in sub-critical water.

PubMed

Yuksel, Asli; Sasaki, Mitsuru; Goto, Motonobu

2011-06-15

Complete degradation of azo dye Orange G was studied using a 500 mL continuous flow reactor made of SUS 316 stainless steel. In this system, a titanium reactor wall acted as a cathode and a titanium plate-type electrode was used as an anode in a subcritical reaction medium. This hydrothermal electrolysis process provides an environmentally friendly route that does not use any organic solvents or catalysts to remove organic pollutants from wastewater. Reactions were carried out from 30 to 90 min residence times at a pressure of 7 MPa, and at different temperatures of 180-250°C by applying various direct currents ranging from 0.5 to 1A. Removal of dye from the product solution and conversion of TOC increased with increasing current value. Moreover, the effect of salt addition on degradation of Orange G and TOC conversion was investigated, because in real textile wastewater, many salts are also included together with dye. Addition of Na(2)CO(3) resulted in a massive degradation of the dye itself and complete mineralization of TOC, while NaCl and Na(2)SO(4) obstructed the removal of Orange G. Greater than 99% of Orange G was successfully removed from the product solution with a 98% TOC conversion. Copyright © 2011 Elsevier B.V. All rights reserved.

Identification of a novel antisense long non-coding RNA PLA2G16-AS that regulates the expression of PLA2G16 in pigs.

PubMed

Liu, Pengliang; Jin, Long; Zhao, Lirui; Long, Keren; Song, Yang; Tang, Qianzi; Ma, Jideng; Wang, Xun; Tang, Guoqing; Jiang, Yanzhi; Zhu, Li; Li, Xuewei; Li, Mingzhou

2018-05-31

Natural antisense transcripts (NATs) are widely present in mammalian genomes and act as pivotal regulator molecules to control gene expression. However, studies on the NATs of pigs are relatively rare. Here, we identified a novel antisense transcript, designated PLA2G16-AS, transcribed from the phospholipase A2 group XVI locus (PLA2G16) in the porcine genome, which is a well-known regulatory molecule of fat deposition. PLA2G16-AS and PLA2G16 were dominantly expressed in porcine adipose tissue, and were differentially expressed between Tibetan pigs and Rongchang pigs. In addition, PLA2G16-AS has a weak sequence conservation among different vertebrates. PLA2G16-AS was also shown to form an RNA-RNA duplex with PLA2G16, and to regulate PLA2G16 expression at the mRNA level. Moreover, the overexpression of PLA2G16-AS increased the stability of PLA2G16 mRNA in porcine cells. We envision that our findings of a NAT for a regulatory gene associated with lipolysis might further our understanding of the molecular regulation of fat deposition. Copyright © 2017. Published by Elsevier B.V.

Supersymmetric M3-branes and G2 manifolds

NASA Astrophysics Data System (ADS)

Cvetič, M.; Gibbons, G. W.; Lü, H.; Pope, C. N.

2002-01-01

We obtain a generalisation of the original complete Ricci-flat metric of G2 holonomy on R4×S 3 to a family with a nontrivial parameter λ. For generic λ the solution is singular, but it is regular when λ={-1,0,+1}. The case λ=0 corresponds to the original G2 metric, and λ={-1,1} are related to this by an S3 automorphism of the SU(2) 3 isometry group that acts on the S3× S3 principal orbits. We then construct explicit supersymmetric M3-brane solutions in D=11 supergravity, where the transverse space is a deformation of this class of G2 metrics. These are solutions of a system of first-order differential equations coming from a superpotential. We also find M3-branes in the deformed backgrounds of new G2 holonomy metrics that include one found by A. Brandhuber, J. Gomis, S. Gubser and S. Gukov, and show that they also are supersymmetric.

Comparative performance of fixed-film biological filters: Application of reactor theory

USGS Publications Warehouse

Watten, B.J.; Sibrell, P.L.

2006-01-01

Nitrification is classified as a two-step consecutive reaction where R1 represents the rate of formation of the intermediate product NO2-N and R2 represents the rate of formation of the final product NO3-N. The relative rates of R1 and R2 are influenced by reactor type characterized hydraulically as plug-flow, plug-flow with dispersion and mixed-flow. We develop substrate conversion models for fixed-film biofilters operating in the first-order kinetic regime based on application of chemical reactor theory. Reactor type, inlet conditions and the biofilm kinetic constants Ki (h-1) are used to predict changes in NH4-N, NO2-N, NO3-N and BOD5. The inhibiting effects of the latter on R1 and R2 were established based on the ?? relation, e.g.:{A formula is presented}where BOD5,max is the concentration that causes nitrification to cease and N is a variable relating Ki to increasing BOD5. Conversion models were incorporated in spreadsheet programs that provided steady-state concentrations of nitrogen and BOD5 at several points in a recirculating aquaculture system operating with input values for fish feed rate, reactor volume, microscreen performance, make-up and recirculating flow rates. When rate constants are standardized, spreadsheet use demonstrates plug-flow reactors provide higher rates of R1 and R2 than mixed-flow reactors thereby reducing volume requirements for target concentrations of NH4-N and NO2-N. The benefit provided by the plug-flow reactor varies with hydraulic residence time t as well as the effective vessel dispersion number, D/??L. Both reactor types are capable of providing net increases in NO2-N during treatment but the rate of decrease in the mixed-flow case falls well behind that predicted for plug-flow operation. We show the potential for a positive net change in NO2-N increases with decreases in the dimensionless ratios K2, (R2 )/K1,( R1 ) and [NO2-N]/[NH4-N] and when the product K1, (R1) t provides low to moderate NH4-N conversions. Maintaining

THE GALACTIC CENTER CLOUD G2 AND ITS GAS STREAMER

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pfuhl, Oliver; Gillessen, Stefan; Eisenhauer, Frank

2015-01-10

We present new, deep near-infrared SINFONI @ VLT integral field spectroscopy of the gas cloud G2 in the Galactic Center, from late 2013 August, 2014 April, and 2014 July. G2 is visible in recombination line emission. The spatially resolved kinematic data track the ongoing tidal disruption. The cloud reached minimum distance to the MBH of 1950 Schwarzschild radii. As expected for an observation near the pericenter passage, roughly half of the gas in 2014 is found at the redshifted, pre-pericenter side of the orbit, while the other half is at the post-pericenter, blueshifted side. We also present an orbital solutionmore » for the gas cloud G1, which was discovered a decade ago in L'-band images when it was spatially almost coincident with Sgr A*. The orientation of the G1 orbit in the three angles is almost identical to that of G2, but it has a lower eccentricity and smaller semi-major axis. We show that the observed astrometric positions and radial velocities of G1 are compatible with the G2 orbit, assuming that (1) G1 was originally on the G2 orbit preceding G2 by 13 yr, and (2) a simple drag force acted on it during pericenter passage. Taken together with the previously described tail of G2, which we detect in recombination line emission and thermal broadband emission, we propose that G2 may be a bright knot in a much more extensive gas streamer. This matches purely gaseous models for G2, such as a stellar wind clump or the tidal debris from a partial disruption of a star.« less

BOILER-SUPERHEATED REACTOR

DOEpatents

Heckman, T.P.

1961-05-01

A nuclear power reactor of the type in which a liquid moderator-coolant is transformed by nuclear heating into a vapor that may be used to drive a turbo- generator is described. The core of this reactor comprises a plurality of freely suspended tubular fuel elements, called fuel element trains, within which nonboiling pressurized liquid moderator-coolant is preheated and sprayed through orifices in the walls of the trains against the outer walls thereof to be converted into vapor. Passage of the vapor ovcr other unwetted portions of the outside of the fuel elements causes the steam to be superheated. The moderatorcoolant within the fuel elements remains in the liqUid state, and that between the fuel elements remains substantiaily in the vapor state. A unique liquid neutron-absorber control system is used. Advantages expected from the reactor design include reduced fuel element failure, increased stability of operation, direct response to power demand, and circulation of a minimum amount of liquid moderatorcoolant. (A.G.W.)

Steady-State Thermal-Hydraulics Analyses for the Conversion of the BR2 Reactor to LEU

DOE Office of Scientific and Technical Information (OSTI.GOV)

Licht, J. R.; Bergeron, A.; Dionne, B.

2015-12-01

BR2 is a research reactor used for radioisotope production and materials testing. It’s a tank-in-pool type reactor cooled by light water and moderated by beryllium and light water (Figure 1). The reactor core consists of a beryllium moderator forming a matrix of 79 hexagonal prisms in a hyperboloid configuration; each having a central bore that can contain a variety of different components such as a fuel assembly, a control or regulating rod, an experimental device, or a beryllium or aluminum plug. Based on a series of tests, the BR2 operation is currently limited to a maximum allowable heat flux ofmore » 470 W/cm2 to ensure fuel plate integrity during steady-state operation and after a loss-of-flow/loss-of-pressure accident.« less

G-quadruplex induced stabilization by 2′-deoxy-2′-fluoro-d-arabinonucleic acids (2′F-ANA)

PubMed Central

Peng, Chang Geng; Damha, Masad J.

2007-01-01

The impact of 2′-deoxy-2′-fluoroarabinonucleotide residues (2′F-araN) on different G-quadruplexes derived from a thrombin-binding DNA aptamer d(G2T2G2TGTG2T2G2), an anti-HIV phosphorothioate aptamer PS-d(T2G4T2) and a DNA telomeric sequence d(G4T4G4) via UV thermal melting (Tm) and circular dichroism (CD) experiments has been investigated. Generally, replacement of deoxyguanosines that adopt the anti conformation (anti-guanines) with 2′F-araG can stabilize G-quartets and maintain the quadruplex conformation, while replacement of syn-guanines with 2′F-araG is not favored and results in a dramatic switch to an alternative quadruplex conformation. It was found that incorporation of 2′F-araG or T residues into a thrombin-binding DNA G-quadruplex stabilizes the complex (ΔTm up to ∼+3°C/2′F-araN modification); 2′F-araN units also increased the half-life in 10% fetal bovine serum (FBS) up to 48-fold. Two modified thrombin-binding aptamers (PG13 and PG14) show an approximately 4-fold increase in binding affinity to thrombin, as assessed via a nitrocellulose filter binding assay, both with increased thermal stability (∼1°C/2′F-ANA modification increase in Tm) and nuclease resistance (4–7-fold) as well. Therefore, the 2′-deoxy-2′-fluoro-d-arabinonucleic acid (2′F-ANA) modification is well suited to tune (and improve) the physicochemical and biological properties of naturally occurring DNA G-quartets. PMID:17636049

ETR BASEMENT, TRA642, INTERIOR. BASEMENT. CUBICLE INTERIOR (SEE PHOTOS ID33G101 ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

ETR BASEMENT, TRA-642, INTERIOR. BASEMENT. CUBICLE INTERIOR (SEE PHOTOS ID-33-G-101 AND ID-33-G-102) WITH TANK AND SODIUM-RELATED APPARATUS. CAMERA STANDS BEFORE ROLL-UP DOOR SHOWN IN PHOTO ID-33-G-101. INL NEGATIVE NO. HD24-3-3. Mike Crane, Photographer, 11/2000 - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

Association of COX-2 Promoter Polymorphisms -765G/C and -1195A/G with Migraine.

PubMed

Mozaffari, Elahe; Doosti, Abbas; Arshi, Asghar; Faghani, Mostafa

2016-12-01

Migraine is a common debilitating primary headache disorder with current head pain attacks, which contributes to physical activity dysfunctions in chronic pain phase. PGE2 and PGI2 are two important prostaglandins synthesised by COX-2 enzymes, involved in migraine pain signals. COX-2 modulation is essential in treatment and pathogenesis of migraine. This study aimed to investigating the association between COX-2 gene polymorphisms with the risk of migraine susceptibility in migraine patients with related and unrelated parents. This case- control study was based on 100 migraine patients and 100 non-migraine subjects in Bushehr province, Iran in 2013. Genomic DNA of blood samples was extracted and genotyping of COX-2-765G>C (rs20417) and COX-2-1195A>G (rs689466) gene variants was investigated by PCR-RFLP method. Statistical analyses were accomplished using the SPSS software package. There was a significant differences in the frequencies of the COX-2-765G>C and COX-2-1195A>G genotypes between migraine patients and controls ( P ≤0.05). COX-2-765CC , COX-2-765CG , COX-2-1195GG and COX-2-1195AG genotypes can increase the risk of migraine significantly. As the first study in Iran, we are hopeful to achieve greater results about the relevancy of COX-2 gene, migraine and pain signals pathway by repeating these experiments on more samples.

Collisional relaxation of O2(X^3Σ _g^ -, υ = 1) and O2(a1Δg, υ = 1) by atmospherically relevant species

NASA Astrophysics Data System (ADS)

Pejaković, Dušan A.; Campbell, Zachary; Kalogerakis, Konstantinos S.; Copeland, Richard A.; Slanger, Tom G.

2011-09-01

Laboratory measurements are reported of the rate coefficient for collisional removal of O2(X^3Σ _g^ -, υ = 1) by O(3P), and the rate coefficients for removal of O2(a1Δg, υ = 1) by O2, CO2, and O(3P). A two-laser method is employed, in which the pulsed output of the first laser at 285 nm photolyzes ozone to produce oxygen atoms and O2(a1Δg, υ = 1), and the output of the second laser detects O2(a1Δg, υ = 1) via resonance-enhanced multiphoton ionization. The kinetics of O2(X^3Σ _g^ -, υ = 1) + O(3P) relaxation is inferred from the temporal evolution of O2(a1Δg, υ = 1), an approach enabled by the rapid collision-induced equilibration of the O2(X^3Σ _g^ -, υ = 1) and O2(a1Δg, υ = 1) populations in the system. The measured O2(X^3Σ _g^ -, υ = 1) + O(3P) rate coefficient is (2.9 ± 0.6) × 10-12 cm3 s-1 at 295 K and (3.4 ± 0.6) × 10-12 cm3 s-1 at 240 K. These values are consistent with the previously reported result of (3.2 ± 1.0) × 10-12 cm3 s-1, which was obtained at 315 K using a different experimental approach [K. S. Kalogerakis, R. A. Copeland, and T. G. Slanger, J. Chem. Phys. 123, 194303 (2005)]. For removal of O2(a1Δg, υ = 1) by O(3P), the upper limits for the rate coefficient are 4 × 10-13 cm3 s-1 at 295 K and 6 × 10-13 cm3 s-1 at 240 K. The rate coefficient for removal of O2(a1Δg, υ = 1) by O2 is (5.6 ± 0.6) × 10-11 cm3 s-1 at 295 K and (5.9 ± 0.5) × 10-11 cm3 s-1 at 240 K. The O2(a1Δg, υ = 1) + CO2 rate coefficient is (1.5 ± 0.2) × 10-14 cm3 s-1 at 295 K and (1.2 ± 0.1) × 10-14 cm3 s-1 at 240 K. The implications of the measured rate coefficients for modeling of atmospheric emissions are discussed.

Treatment of phenolic wastewater in an anaerobic fixed bed reactor (AFBR) - recovery after shock loading.

PubMed

Bajaj, Mini; Gallert, Claudia; Winter, Josef

2009-03-15

An anaerobic fixed bed reactor (AFBR) was run for 550 days with a mixed microbial flora to stabilize synthetic wastewater that contained glucose and phenol as main carbon sources. The influent phenol concentration was gradually increased from 2 to 40 mmol/l within 221 days. The microbial flora was able to adapt to this high phenol concentration with an average of 94% phenol removal. Microbial adaptation at such a high phenol concentration is not reported elsewhere. The maximum phenol removal observed before the phenol shock load was 39.47 mmol/l or 3.7 g phenol/l at a hydraulic retention time (HRT) of 2.5 days and an organic loading rate (OLR) of 5.3 g/l.d which amounts to a phenol removal rate of ca. 15.8 mmol phenol/l.d. The chemical oxygen demand (COD) removal before exposing the reactor to a shock load corresponded with phenol removal. A shock load was induced in the reactor by increasing the phenol concentration from 40 to 50 mmol/l in the influent. The maximum phenol removal rate observed after shock load was 18 mmol/l.d at 5.7 g COD/l.d. But this was not a stable rate and a consistent drop in COD and phenol removal was observed for 1 week, followed by a sharp decline and production of fatty acids. Recovery of the reactor was possible only when no feed was provided to the reactor for 1 month and the phenol concentration was increased gradually. When glucose was omitted from the influent, unknown intermediates of anaerobic phenol metabolism were observed for some time.

Summary of the Advanced Reactor Design Criteria (ARDC) Phase 2 Activities

DOE Office of Scientific and Technical Information (OSTI.GOV)

Holbrook, Mark Raymond

This report provides an end-of-year summary reflecting the progress and status of proposed regulatory design criteria for advanced non-LWR designs in accordance with the Level 3 milestone in M3AT-15IN2001017 in work package AT-15IN200101. These criteria have been designated as ARDC, and they provide guidance to future applicants for addressing the GDC that are currently applied specifically to LWR designs. The report provides a summary of Phase 2 activities related to the various tasks associated with ARDC development and the subsequent development of example adaptations of ARDC for Sodium Fast Reactor (SFR) and modular High Temperature Gas-cooled Reactor (HTGR) designs.

Ab initio and transition state theory study of the OH + HO2 → H2O + O2(3Σg-)/O2(1Δg) reactions: yield and role of O2(1Δg) in H2O2 decomposition and in combustion of H2.

PubMed

Monge-Palacios, M; Sarathy, S Mani

2018-02-07

Reactions of hydroxyl (OH) and hydroperoxyl (HO 2 ) are important for governing the reactivity of combustion systems. We performed post-CCSD(T) ab initio calculations at the W3X-L//CCSD = FC/cc-pVTZ level to explore the triplet ground-state and singlet excited-state potential energy surfaces of the OH + HO 2 → H 2 O + O 2 ( 3 Σ g - )/O 2 ( 1 Δ g ) reactions. Using microcanonical and multistructural canonical transition state theories, we calculated the rate constant for the triplet and singlet channels over the temperature range 200-2500 K, represented by k(T) = 3.08 × 10 12 T 0.07  exp(1151/RT) + 8.00 × 10 12 T 0.32  exp(-6896/RT) and k(T) = 2.14 × 10 6 T 1.65  exp(-2180/RT) in cm 3 mol -1 s -1 , respectively. The branching ratios show that the yield of singlet excited oxygen is small (<0.5% below 1000 K). To ascertain the importance of singlet oxygen channel, our new kinetic information was implemented into the kinetic model for hydrogen combustion recently updated by Konnov (Combust. Flame, 2015, 162, 3755-3772). The updated kinetic model was used to perform H 2 O 2 thermal decomposition simulations for comparison against shock tube experiments performed by Hong et al. (Proc. Combust. Inst., 2013, 34, 565-571), and to estimate flame speeds and ignition delay times in H 2 mixtures. The simulation predicted a larger amount of O 2 ( 1 Δ g ) in H 2 O 2 decomposition than that predicted by Konnov's original model. These differences in the O 2 ( 1 Δ g ) yield are due to the use of a higher ab initio level and a more sophisticated methodology to compute the rate constant than those used in previous studies, thereby predicting a significantly larger rate constant. No effect was observed on the rate of the H 2 O 2 decomposition and on the flame speeds and ignition delay times of different H 2 -oxidizer mixtures. However, if the oxidizer is seeded with O 3 , small differences appear in the flame speed. Given that O 2 ( 1 Δ g ) is much more reactive than O

Effect of Hydraulic Retention Time on Anaerobic Digestion of Wheat Straw in the Semicontinuous Continuous Stirred-Tank Reactors

PubMed Central

Shi, Xiao-Shuang; Yu, Jun-Hong; Yin, Hua; Hu, Shu-Min; Huang, Shu-Xia

2017-01-01

Three semicontinuous continuous stirred-tank reactors (CSTR) operating at mesophilic conditions (35°C) were used to investigate the effect of hydraulic retention time (HRT) on anaerobic digestion of wheat straw. The results showed that the average biogas production with HRT of 20, 40, and 60 days was 46.8, 79.9, and 89.1 mL/g total solid as well as 55.2, 94.3, and 105.2 mL/g volatile solids, respectively. The methane content with HRT of 20 days, from 14.2% to 28.5%, was the lowest among the three reactors. The pH values with HRT of 40 and 60 days were in the acceptable range compared to that with HRT of 20 days. The propionate was dominant in the reactor with HRT of 20 days, inhibiting the activities of methanogens and causing the lower methane content in biogas. The degradation of cellulose, hemicellulose, and crystalline cellulose based on XRD was also strongly influenced by HRTs. PMID:28589134

Dependence on glucose limitation of the pCO2 influences on CHO cell growth, metabolism and IgG production.

PubMed

Takuma, Shinya; Hirashima, Chikashi; Piret, James M

2007-08-15

The culture levels of glucose and CO(2) have been reported to independently have important influences on mammalian cell processes. In this work the combined effects of glucose limitation and CO(2) partial pressure (pCO(2)) on monoclonal antibody (IgG) producing Chinese Hamster Ovary cells were investigated in a perfusion reactor operated with controlled cell specific medium feed rate, pH and osmolality. Under high glucose conditions (14.3 +/- 0.8 mM), the apparent growth rate decreased (from 0.021 to 0.009 h(-1)) as the pCO(2) increased to approximately 220 mmHg, while the cell specific IgG productivity was almost unchanged. The lactate yield from glucose was not affected by pCO(2) up to approximately 220 mmHg and glucose was mainly converted to lactate. A feed medium modification from high (33 mM) to low (6 mM) glucose resulted in <0.1 mM glucose in the culture. As a result of apparently shifting metabolism towards the conversion of pyruvate to CO(2), both the ratio of lactate to glucose and the alanine production rate were lowered (1.51-1.14 and 17.7-0.56 nmol/10(6) cells h, respectively). Interestingly, when the pCO(2) was increased to approximately 140 mmHg, limiting glucose resulted in 1.7-fold higher growth rates, compared to high glucose conditions. However, at approximately 220 mmHg pCO(2) this beneficial effect of glucose limitation on these CHO cells was lost as the growth rate dropped dramatically to 0.008 h(-1) and the IgG productivity was lowered by 15% (P < 0.01) relative to the high glucose condition. The IgG galactosylation increased under glucose- limited compared to high-glucose conditions. (c) 2007 Wiley Periodicals, Inc.

Hydrogen sulfide removal from air by Acidithiobacillus thiooxidans in a trickle bed reactor.

PubMed

Ramirez, M; Gómez, J M; Cantero, D; Páca, J; Halecký, M; Kozliak, E I; Sobotka, M

2009-09-01

A strain of Acidithiobacillus thiooxidans immobilized in polyurethane foam was utilized for H(2)S removal in a bench-scale trickle-bed reactor, testing the limits of acidity and SO(4) (2-) accumulation. The use of this acidophilic strain resulted in remarkable stability in the performance of the system. The reactor maintained a >98-99 % H(2)S removal efficiency for c of up to 66 ppmv and empty bed residence time 98 % H(2)S was achieved under steady-state conditions, over the pH range of 0.44-7.30. Despite the accumulation of acidity and SO(4) (2-) (up to 97 g/L), the system operated without inhibition.

CRITICAL TESTS FOR PRT REACTOR

DOE Office of Scientific and Technical Information (OSTI.GOV)

Triplett, J.R.; Anderson, J.K.; Dunn, R.E.

1960-07-01

Critical teste to be performed on the Plutonium Recycle Te st Heactor are described. Exponential, approach-tocritical, critical, and substitution experiments will be carried out. These experiments include: calibration of moderator level; determination of the wori of various fuel loadings; calibration of the shim system including determination of maximum control strength of the entire system; substitution experiments to determine reflector savings, void effects, effects of H/sub 2/O and degraded D/sub 2/O coolants, and effects of loop and other material intsllations; determination of fuel-plus-coolant and moderator temperature coefficients; and kinetic experiments to determine response of the reactor to reactivity changes. (M.C.G.)

Conformational Dynamics Modulate Activation of the Ubiquitin Conjugating Enzyme Ube2g2

PubMed Central

2017-01-01

The ubiquitin conjugating enzyme Ube2g2 together with its cognate E3 ligase gp78 catalyzes the synthesis of lysine-48 polyubiquitin chains constituting signals for the proteasomal degradation of misfolded proteins in the endoplasmic reticulum. Here, we employ NMR spectroscopy in combination with single-turnover diubiquitin formation assays to examine the role of the RING domain from gp78 in the catalytic activation of Ube2g2∼Ub conjugates. We find that approximately 60% of the Ube2g2∼Ub conjugates occupy a closed conformation in the absence of gp78-RING, with the population increasing to 82% upon gp78-RING binding. As expected, strong mutations in the hydrophobic patch residues of the ∼Ub moiety result in Ube2g2∼Ub populating only open states with corresponding loss of the ubiquitin conjugation activity. Less disruptive mutations introduced into the hydrophobic patch of the ∼Ub moiety also destabilize the closed conformational state, yet the corresponding effect on the ubiquitin conjugation activity ranges from complete loss to an enhancement of the catalytic activity. These results present a picture in which Ube2g2’s active site is in a state of continual dynamic flux with the organization of the active site into a catalytically viable conformation constituting the rate-limiting step for a single ubiquitin ligation event. Ube2g2’s function as a highly specific K48-polyubiquitin chain elongator leads us to speculate that this may be a strategy by which Ube2g2 reduces the probability of nonproductive catalytic outcomes in the absence of available substrate. PMID:28884161

Plasminogen activator inhibitor-1 4G/5G polymorphism is associated with type 2 diabetes risk

PubMed Central

Zhao, Luqian; Huang, Ping

2013-01-01

A number of studies were performed to assess the association between plasminogen activator inhibitor-1 (PAI-1) 4G/5G polymorphism and susceptibility to type 2 diabetes (T2DM). However, the results were inconsistent and inconclusive. In the present study, the possible association was investigated by a meta-analysis. Eligible articles were identified for the period up to June 2013. Pooled odds ratios (OR) with 95% confidence intervals (CI) were appropriately derived from random-effects models or fixed-effects models. Fourteen case-control studies with a total of 2487 cases and 3538 controls were eligible. In recessive model, PAI-1 4G/5G polymorphism was associated with T2DM risk (OR = 1.23; 95% CI 1.07-1.41; P = 0.004). In the subgroup analysis by ethnicity, a significant association was found among Asians (OR = 1.27; 95% CI 1.08-1.51; P = 0.005). This meta-analysis suggested that PAI-1 4G/5G polymorphism may be associated with T2DM development. PMID:24040470

[Characteristics and operation of enhanced continuous bio-hydrogen production reactor using support carrier].

PubMed

Ren, Nan-qi; Tang, Jing; Gong, Man-li

2006-06-01

A kind of granular activated carbon, whose granular size is no more than 2mm and specific gravity is 1.54g/cm3, was used as the support carrier to allow retention of activated sludge within a continuous stirred-tank reactor (CSTR) using molasses wastewater as substrate for bio-hydrogen production. Continuous operation characteristics and operational controlling strategy of the enhanced continuous bio-hydrogen production system were investigated. It was indicated that, support carriers could expand the activity scope of hydrogen production bacteria, make the system fairly stable in response to organic load impact and low pH value (pH <3.8), and maintain high biomass concentration in the reactor at low HRT. The reactor with ethanol-type fermentation achieved an optimal hydrogen production rate of 0.37L/(g x d), while the pH value ranged from 3.8 to 4.4, and the hydrogen content was approximately 40% approximately 57% of biogas. It is effective to inhibit the methanogens by reducing the pH value of the bio-hydrogen production system, consequently accelerate the start-up of the reactor.

Analysis of supercritical CO{sub 2} cycle control strategies and dynamic response for Generation IV Reactors.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moisseytsev, A.; Sienicki, J. J.

2011-04-12

The analysis of specific control strategies and dynamic behavior of the supercritical carbon dioxide (S-CO{sub 2}) Brayton cycle has been extended to the two reactor types selected for continued development under the Generation IV Nuclear Energy Systems Initiative; namely, the Very High Temperature Reactor (VHTR) and the Sodium-Cooled Fast Reactor (SFR). Direct application of the standard S-CO{sub 2} recompression cycle to the VHTR was found to be challenging because of the mismatch in the temperature drop of the He gaseous reactor coolant through the He-to-CO{sub 2} reactor heat exchanger (RHX) versus the temperature rise of the CO{sub 2} through themore » RHX. The reference VHTR features a large temperature drop of 450 C between the assumed core outlet and inlet temperatures of 850 and 400 C, respectively. This large temperature difference is an essential feature of the VHTR enabling a lower He flow rate reducing the required core velocities and pressure drop. In contrast, the standard recompression S-CO{sub 2} cycle wants to operate with a temperature rise through the RHX of about 150 C reflecting the temperature drop as the CO{sub 2} expands from 20 MPa to 7.4 MPa in the turbine and the fact that the cycle is highly recuperated such that the CO{sub 2} entering the RHX is effectively preheated. Because of this mismatch, direct application of the standard recompression cycle results in a relatively poor cycle efficiency of 44.9%. However, two approaches have been identified by which the S-CO{sub 2} cycle can be successfully adapted to the VHTR and the benefits of the S-CO{sub 2} cycle, especially a significant gain in cycle efficiency, can be realized. The first approach involves the use of three separate cascaded S-CO{sub 2} cycles. Each S-CO{sub 2} cycle is coupled to the VHTR through its own He-to-CO{sub 2} RHX in which the He temperature is reduced by 150 C. The three respective cycles have efficiencies of 54, 50, and 44%, respectively, resulting in a net

155. ARAIII Reactor building (ARA608) Details of reactor pit showing ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

155. ARA-III Reactor building (ARA-608) Details of reactor pit showing tray supports and fuel element storage rack. Aerojet-general 880-area/GCRE-608-MS-2. Date: November 1958. Ineel index code no. 063-0608-40-013-102625. - Idaho National Engineering Laboratory, Army Reactors Experimental Area, Scoville, Butte County, ID

SoLid: Search for Oscillations with Lithium-6 Detector at the SCK-CEN BR2 reactor

NASA Astrophysics Data System (ADS)

Ban, G.; Beaumont, W.; Buhour, J. M.; Coupé, B.; Cucoanes, A. S.; D'Hondt, J.; Durand, D.; Fallot, M.; Fresneau, S.; Giot, L.; Guillon, B.; Guilloux, G.; Janssen, X.; Kalcheva, S.; Koonen, E.; Labare, M.; Moortgat, C.; Pronost, G.; Raes, L.; Ryckbosch, D.; Ryder, N.; Shitov, Y.; Vacheret, A.; Van Mulders, P.; Van Remortel, N.; Weber, A.; Yermia, F.

2016-04-01

Sterile neutrinos have been considered as a possible explanation for the recent reactor and Gallium anomalies arising from reanalysis of reactor flux and calibration data of previous neutrino experiments. A way to test this hypothesis is to look for distortions of the anti-neutrino energy caused by oscillation from active to sterile neutrino at close stand-off (˜ 6- 8m) of a compact reactor core. Due to the low rate of anti-neutrino interactions the main challenge in such measurement is to control the high level of gamma rays and neutron background. The SoLid experiment is a proposal to search for active-to-sterile anti-neutrino oscillation at very short baseline of the SCK•CEN BR2 research reactor. This experiment uses a novel approach to detect anti-neutrino with a highly segmented detector based on Lithium-6. With the combination of high granularity, high neutron-gamma discrimination using 6LiF:ZnS(Ag) and precise localization of the Inverse Beta Decay products, a better experimental sensitivity can be achieved compared to other state-of-the-art technology. This compact system requires minimum passive shielding allowing for very close stand off to the reactor. The experimental set up of the SoLid experiment and the BR2 reactor will be presented. The new principle of neutrino detection and the detector design with expected performance will be described. The expected sensitivity to new oscillations of the SoLid detector as well as the first measurements made with the 8 kg prototype detector deployed at the BR2 reactor in 2013-2014 will be reported.

Proliferation of antibiotic resistance genes in microbial consortia of sequencing batch reactors (SBRs) upon exposure to trace erythromycin or erythromycin-H2O.

PubMed

Fan, Caian; He, Jianzhong

2011-05-01

A variety of antibiotics and their metabolites at sub-inhibitory level concentrations are suspected to expand resistance genes in the environment. However, knowledge is limited on the causal correlation of trace antibiotics or their metabolites with resistance proliferation. In this study, erythromycin (ERY) resistance genes were screened on microbial consortia of sequencing batch reactors (SBRs) after one year acclimation to ERY (100 μg/L) or dehydrated erythromycin (ERY-H(2)O, 50 μg/L). The identified esterase gene ereA explains that ERY could be degraded to six products by microbes acclimated to ERY (100 μg/L). However, ERY could not be degraded by microbes acclimated to ERY-H(2)O (50 μg/L), which may be due to the less proliferated ereA gene. Biodegradation of ERY required the presence of exogenous carbon source (e.g., glucose) and nutrients (e.g., nitrogen, phosphorus) for assimilation, but overdosed ammonium-N (>40 mg/L) inhibited degradation of ERY. Zoogloea, a kind of biofilm formation bacteria, became predominant in the ERY degradation consortia, suggesting that the input of ERY could induce biofilm resistance to antibiotics. Our study highlights that lower μg/L level of ERY or ERY-H(2)O in the environment encourages expansion of resistance genes in microbes. Copyright © 2011 Elsevier Ltd. All rights reserved.

Neutron transport analysis for nuclear reactor design

DOEpatents

Vujic, Jasmina L.

1993-01-01

Replacing regular mesh-dependent ray tracing modules in a collision/transfer probability (CTP) code with a ray tracing module based upon combinatorial geometry of a modified geometrical module (GMC) provides a general geometry transfer theory code in two dimensions (2D) for analyzing nuclear reactor design and control. The primary modification of the GMC module involves generation of a fixed inner frame and a rotating outer frame, where the inner frame contains all reactor regions of interest, e.g., part of a reactor assembly, an assembly, or several assemblies, and the outer frame, with a set of parallel equidistant rays (lines) attached to it, rotates around the inner frame. The modified GMC module allows for determining for each parallel ray (line), the intersections with zone boundaries, the path length between the intersections, the total number of zones on a track, the zone and medium numbers, and the intersections with the outer surface, which parameters may be used in the CTP code to calculate collision/transfer probability and cross-section values.

Neutron transport analysis for nuclear reactor design

DOEpatents

Vujic, J.L.

1993-11-30

Replacing regular mesh-dependent ray tracing modules in a collision/transfer probability (CTP) code with a ray tracing module based upon combinatorial geometry of a modified geometrical module (GMC) provides a general geometry transfer theory code in two dimensions (2D) for analyzing nuclear reactor design and control. The primary modification of the GMC module involves generation of a fixed inner frame and a rotating outer frame, where the inner frame contains all reactor regions of interest, e.g., part of a reactor assembly, an assembly, or several assemblies, and the outer frame, with a set of parallel equidistant rays (lines) attached to it, rotates around the inner frame. The modified GMC module allows for determining for each parallel ray (line), the intersections with zone boundaries, the path length between the intersections, the total number of zones on a track, the zone and medium numbers, and the intersections with the outer surface, which parameters may be used in the CTP code to calculate collision/transfer probability and cross-section values. 28 figures.

BPS states in N = 2 supersymmetric G2 and F4 models

NASA Astrophysics Data System (ADS)

Ahl Laamara, R.; Mellal, O.; Saidi, E. H.

2017-07-01

In BPS quiver theory of N = 2 supersymmetric pure gauge models with gauge invariance G, primitive BPS quivers Q0G are of two types: Q0ADE and Q0BCFG. In this study, we first show that Q0ADE have outer-automorphism symmetries inherited from the outer-automorphisms of the Dynkin diagrams of ADE Lie algebras. Then, we extend the usual folding operation of Dynkin diagrams ADE → BCFG to obtain the two following things: (i) relate Q0BCFG quivers and their mutations to the Q0ADE ones and their mutations; and (ii) link the BPS chambers of the N = 2ADE theories with the corresponding BCFG ones. As an illustration of this construction, we derive the BPS and anti-BPS states of the strong chambers QstgG2 and QstgF4 of the 4d N = 2 pure G2 and F4 gauge models.

REACTOR SERVICE BUILDING, TRA635. CROWDED MOCKUP AREA. CAMERA FACES EAST. ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

REACTOR SERVICE BUILDING, TRA-635. CROWDED MOCK-UP AREA. CAMERA FACES EAST. PHOTOGRAPHER'S NOTE SAYS "PICTURE REQUESTED BY IDO IN SUPPORT OF FY '58 BUILDING PROJECTS." INL NEGATIVE NO. 56-3025. R.G. Larsen, Photographer, 9/13/1956 - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

Geomechanical Analysis of Underground Coal Gasification Reactor Cool Down for Subsequent CO2 Storage

NASA Astrophysics Data System (ADS)

Sarhosis, Vasilis; Yang, Dongmin; Kempka, Thomas; Sheng, Yong

2013-04-01

Underground coal gasification (UCG) is an efficient method for the conversion of conventionally unmineable coal resources into energy and feedstock. If the UCG process is combined with the subsequent storage of process CO2 in the former UCG reactors, a near-zero carbon emission energy source can be realised. This study aims to present the development of a computational model to simulate the cooling process of UCG reactors in abandonment to decrease the initial high temperature of more than 400 °C to a level where extensive CO2 volume expansion due to temperature changes can be significantly reduced during the time of CO2 injection. Furthermore, we predict the cool down temperature conditions with and without water flushing. A state of the art coupled thermal-mechanical model was developed using the finite element software ABAQUS to predict the cavity growth and the resulting surface subsidence. In addition, the multi-physics computational software COMSOL was employed to simulate the cavity cool down process which is of uttermost relevance for CO2 storage in the former UCG reactors. For that purpose, we simulated fluid flow, thermal conduction as well as thermal convection processes between fluid (water and CO2) and solid represented by coal and surrounding rocks. Material properties for rocks and coal were obtained from extant literature sources and geomechanical testings which were carried out on samples derived from a prospective demonstration site in Bulgaria. The analysis of results showed that the numerical models developed allowed for the determination of the UCG reactor growth, roof spalling, surface subsidence and heat propagation during the UCG process and the subsequent CO2 storage. It is anticipated that the results of this study can support optimisation of the preparation procedure for CO2 storage in former UCG reactors. The proposed scheme was discussed so far, but not validated by a coupled numerical analysis and if proved to be applicable it could

Characterization of an immobilized cell, trickle bed reactor during long term butanol (ABE) fermentation.

PubMed

Park, C H; Okos, M R; Wankat, P C

1990-06-20

Acetone-butanol-ethanol (ABE) fermentation was performed continuously in an immobilized cell, trickle bed reactor for 54 days without, degeneration by maintaining the pH above 4.3. Column clogging was minimized by structured packing of immobilization matrix. The reactor contained two serial glass columns packed with Clostridium acetobutylicum adsorbed on 12- and 20-in.-long polyester sponge strips at total flow rates between 38 and 98.7 mL/h. Cells were initially grown at 20 g/L glucose resulting in low butanol (1.15 g/L) production encouraging cell growth. After the initial cell growth phase a higher glucose concentration (38.7 g/L) improved solvent yield from 13.2 to 24.1 wt%, and butanol production rate was the best. Further improvement in solvent yield and butanol production rate was not observed with 60 g/L of glucose. However, when the fresh nutrient supply was limited to only the first column, solvent yield increased to 27.3 wt% and butanol selectivity was improved to 0.592 as compared to 0.541 when fresh feed was fed to both columns. The highest butanol concentration of 5.2 g/L occurred at 55% conversion of the feed with 60 g/L glucose. Liquid product yield of immobilized cells approached the theoretical value reported in the literature. Glucose and product concentration profiles along the column showed that the columns can be divided into production and inhibition regions. The length of each zone was dependent upon the feed glucose concentration and feed pattern. Unlike batch fermentation, there was no clear distinction between acid and solvent production regions. The pH dropped, from 6.18-6.43 to 4.50-4.90 in the first inch of the reactor. The pH dropped further to 4.36-4.65 by the exit of the column. The results indicate that the strategy for long term stable operation with high solvent yield requires a structured packing of biologically stable porous matrix such as polyester sponge, a pH maintenance above 4.3, glucose concentrations up to 60 g/L and

Effect of temperature on selenium removal from wastewater by UASB reactors.

PubMed

Dessì, Paolo; Jain, Rohan; Singh, Satyendra; Seder-Colomina, Marina; van Hullebusch, Eric D; Rene, Eldon R; Ahammad, Shaikh Ziauddin; Carucci, Alessandra; Lens, Piet N L

2016-05-01

The effect of temperature on selenium (Se) removal by upflow anaerobic sludge blanket (UASB) reactors treating selenate and nitrate containing wastewater was investigated by comparing the performance of a thermophilic (55 °C) versus a mesophilic (30 °C) UASB reactor. When only selenate (50 μM) was fed to the UASB reactors (pH 7.3; hydraulic retention time 8 h) with excess electron donor (lactate at 1.38 mM corresponding to an organic loading rate of 0.5 g COD L(-1) d(-1)), the thermophilic UASB reactor achieved a higher total Se removal efficiency (94.4 ± 2.4%) than the mesophilic UASB reactor (82.0 ± 3.8%). When 5000 μM nitrate was further added to the influent, total Se removal was again better under thermophilic (70.1 ± 6.6%) when compared to mesophilic (43.6 ± 8.8%) conditions. The higher total effluent Se concentration in the mesophilic UASB reactor was due to the higher concentrations of biogenic elemental Se nanoparticles (BioSeNPs). The shape of the BioSeNPs observed in both UASB reactors was different: nanospheres and nanorods, respectively, in the mesophilic and thermophilic UASB reactors. Microbial community analysis showed the presence of selenate respirers as well as denitrifying microorganisms. Copyright © 2016 Elsevier Ltd. All rights reserved.

Biomass characteristics and simultaneous nitrification-denitrification under long sludge retention time in an integrated reactor treating rural domestic sewage.

PubMed

Gong, Lingxiao; Jun, Li; Yang, Qing; Wang, Shuying; Ma, Bin; Peng, Yongzhen

2012-09-01

In this work, a novel integrated reactor incorporating anoxic fixed bed biofilm reactor (FBBR), oxic moving bed biofilm reactor (MBBR) and settler sequentially was proposed for nitrogen removal from rural domestic sewage. For purposes of achieving high efficiency, low costs and easy maintenance, biomass characteristics and simultaneous nitrification-denitrification (SND) were investigated under long sludge retention time during a 149-day period. The results showed that enhanced SND with proportions of 37.7-42.2% tapped the reactor potentials of efficiency and economy both, despite of C/N ratio of 2.5-4.0 in influent. TN was removed averagely by 69.3% at least, even under internal recycling ratio of 200% and less proportions of biomass assimilation (<3%). Consequently, lower internal recycle and intermittent wasted sludge discharge were feasible to save costs, together with cancellations of sludge return and anoxic stir. Furthermore, biomass with low observed heterotrophic yields (0.053 ± 0.035 g VSS/g COD) and VSS/TSS ratio (<0.55) in MBBR, simplified wasted sludge disposal. Copyright © 2012 Elsevier Ltd. All rights reserved.

Control system for a small fission reactor

DOEpatents

Burelbach, J.P.; Kann, W.J.; Saiveau, J.G.

1985-02-08

A system for controlling the reactivity of a small fission reactor includes an elongated, flexible hollow tube in the general form of a helical coiled spring axially positioned around and outside of the reactor vessel in an annular space between the reactor vessel and a surrounding cylindrical-shaped neutron reflector. A neutron absorbing material is provided within the hollow tube with the rate of the reaction controlled by the extension and compression of the hollow tube, e.g., extension of the tube increases reactivity while its compression reduces reactivity, in varying the amount of neutron absorbing material disposed between the reactor vessel and the neutron reflector. Conventional mechanical displacement means may be employed to control the coil density of the hollow tube as desired.

Plasma-catalyst hybrid reactor with CeO2/γ-Al2O3 for benzene decomposition with synergetic effect and nano particle by-product reduction.

PubMed

Mao, Lingai; Chen, Zhizong; Wu, Xinyue; Tang, Xiujuan; Yao, Shuiliang; Zhang, Xuming; Jiang, Boqiong; Han, Jingyi; Wu, Zuliang; Lu, Hao; Nozaki, Tomohiro

2018-04-05

A dielectric barrier discharge (DBD) catalyst hybrid reactor with CeO 2 /γ-Al 2 O 3 catalyst balls was investigated for benzene decomposition at atmospheric pressure and 30 °C. At an energy density of 37-40 J/L, benzene decomposition was as high as 92.5% when using the hybrid reactor with 5.0wt%CeO 2 /γ-Al 2 O 3 ; while it was 10%-20% when using a normal DBD reactor without a catalyst. Benzene decomposition using the hybrid reactor was almost the same as that using an O 3 catalyst reactor with the same CeO 2 /γ-Al 2 O 3 catalyst, indicating that O 3 plays a key role in the benzene decomposition. Fourier transform infrared spectroscopy analysis showed that O 3 adsorption on CeO 2 /γ-Al 2 O 3 promotes the production of adsorbed O 2 - and O 2 2‒ , which contribute benzene decomposition over heterogeneous catalysts. Nano particles as by-products (phenol and 1,4-benzoquinone) from benzene decomposition can be significantly reduced using the CeO 2 /γ-Al 2 O 3 catalyst. H 2 O inhibits benzene decomposition; however, it improves CO 2 selectivity. The deactivated CeO 2 /γ-Al 2 O 3 catalyst can be regenerated by performing discharges at 100 °C and 192-204 J/L. The decomposition mechanism of benzene over CeO 2 /γ-Al 2 O 3 catalyst was proposed. Copyright © 2017 Elsevier B.V. All rights reserved.

5-Aminouracil treatment. A method for estimating G2.

PubMed

Socher, S H; Davidson, D

1971-02-01

Treatment of Vicia faba lateral roots with a range of concentrations of 5-aminouracil (5-AU) indicate that cells are stopped at a particular point in interphase. The timing of the fall in mitotic index suggests that cells are held at the S - G(2) transition. When cells are held at this point, treatments with 5-AU can be used to estimate the duration of G(2) + mitosis/2 of proliferating cells. Treatment with 5-AU can also be used to demonstrate the presence of subpopulations of dividing cells that differ in their G(2) duration. Using this method, 5-AU-induced inhibition, we have confirmed that in V. faba lateral roots there are two populations of dividing cells: (a) a fast-dividing population, which makes up approximately 85% of the proliferating cell population and has a G(2) + mitosis/2 duration of 3.3 hr, and (b) a slow-dividing population, which makes up approximately 15% of dividing cells and has a G(2) duration in excess of 12 hr. These estimates are similar to those obtained from percentage labeled mitosis (PLM) curves after incorporation of thymidine-(3)H.

Scale-4 Analysis of Pressurized Water Reactor Critical Configurations: Volume 2-Sequoyah Unit 2 Cycle 3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bowman, S.M.

1995-01-01

The requirements of ANSI/ANS 8.1 specify that calculational methods for away-from-reactor criticality safety analyses be validated against experimental measurements. If credit for the negative reactivity of the depleted (or spent) fuel isotopics is desired, it is necessary to benchmark computational methods against spent fuel critical configurations. This report summarizes a portion of the ongoing effort to benchmark away-from-reactor criticality analysis methods using critical configurations from commercial pressurized-water reactors. The analysis methodology selected for all the calculations reported herein is based on the codes and data provided in the SCALE-4 code system. The isotopic densities for the spent fuel assemblies inmore » the critical configurations were calculated using the SAS2H analytical sequence of the SCALE-4 system. The sources of data and the procedures for deriving SAS2H input parameters are described in detail. The SNIKR code module was used to extract the necessary isotopic densities from the SAS2H results and provide the data in the format required by the SCALE criticality analysis modules. The CSASN analytical sequence in SCALE-4 was used to perform resonance processing of the cross sections. The KENO V.a module of SCALE-4 was used to calculate the effective multiplication factor (k{sub eff}) of each case. The SCALE-4 27-group burnup library containing ENDF/B-IV (actinides) and ENDF/B-V (fission products) data was used for all the calculations. This volume of the report documents the SCALE system analysis of three reactor critical configurations for the Sequoyah Unit 2 Cycle 3. This unit and cycle were chosen because of the relevance in spent fuel benchmark applications: (1) the unit had a significantly long downtime of 2.7 years during the middle of cycle (MOC) 3, and (2) the core consisted entirely of burned fuel at the MOC restart. The first benchmark critical calculation was the MOC restart at hot, full-power (HFP) critical

Advanced Instrumentation for Transient Reactor Testing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Corradini, Michael L.; Anderson, Mark; Imel, George

Transient testing involves placing fuel or material into the core of specialized materials test reactors that are capable of simulating a range of design basis accidents, including reactivity insertion accidents, that require the reactor produce short bursts of intense highpower neutron flux and gamma radiation. Testing fuel behavior in a prototypic neutron environment under high-power, accident-simulation conditions is a key step in licensing nuclear fuels for use in existing and future nuclear power plants. Transient testing of nuclear fuels is needed to develop and prove the safety basis for advanced reactors and fuels. In addition, modern fuel development and designmore » increasingly relies on modeling and simulation efforts that must be informed and validated using specially designed material performance separate effects studies. These studies will require experimental facilities that are able to support variable scale, highly instrumented tests providing data that have appropriate spatial and temporal resolution. Finally, there are efforts now underway to develop advanced light water reactor (LWR) fuels with enhanced performance and accident tolerance. These advanced reactor designs will also require new fuel types. These new fuels need to be tested in a controlled environment in order to learn how they respond to accident conditions. For these applications, transient reactor testing is needed to help design fuels with improved performance. In order to maximize the value of transient testing, there is a need for in-situ transient realtime imaging technology (e.g., the neutron detection and imaging system like the hodoscope) to see fuel motion during rapid transient excursions with a higher degree of spatial and temporal resolution and accuracy. There also exists a need for new small, compact local sensors and instrumentation that are capable of collecting data during transients (e.g., local displacements, temperatures, thermal conductivity, neutron flux

Anaerobic reactor/high rate pond combined technology for sewage treatment in the Mediterranean area.

PubMed

El Hafiane, F; El Hamouri, B

2005-01-01

Two high-rate, anaerobic/aerobic units were used to treat the sewage of the Institut Agronomique st Vétérinaire Hassan II (Morocco) campus in a 1,100 m2-plant designed for 1,500 e.p. and receiving 63 m3 per day. The anaerobic pre-treatment consisted of a two-step up-flow anaerobic reactor (TSUAR) comprising two reactors and one external settler all in series. The aerobic line, or post-treatment, consisted of a high-rate algal pond (HRAP) and one maturation pond in series. The system totalized a hydraulic retention time (HRT) of 9 days. A gravel filter (GF) was constructed behind the TSUAR to trap low-density particles. The TSUAR removed 80% of COD and 90% of SS within 48 h. Solids retention time in the reactors averaged 32 d with a specific sludge production of 0.28 g SS g(-1) COD removed. Almost 93% of the sludge evacuated from the settler was stabilized. Specific biogas production from both reactors was 0.25m3 kg(-1) COD removed. Used in this configuration, the HRAP lost its BOD removal activity and increased its nutrients and pathogens removal capabilities (tertiary treatment). Results showed that 85% of total nitrogen and 48% of total phosphorus were removed by the HRAP. Land area requirement of this combination was less than 1 m2 per capita and filtered final effluent was of excellent quality (COD, 82 mg/l; TKN, 8.3 mg/l; total P, 2.7 mg/l, faecal coliforms, 2.4 10(3)/100 ml and zero helminths eggs).

A Benzothiazole Derivative (5g) Induces DNA Damage And Potent G2/M Arrest In Cancer Cells.

PubMed

Hegde, Mahesh; Vartak, Supriya V; Kavitha, Chandagirikoppal V; Ananda, Hanumappa; Prasanna, Doddakunche S; Gopalakrishnan, Vidya; Choudhary, Bibha; Rangappa, Kanchugarakoppal S; Raghavan, Sathees C

2017-05-31

Chemically synthesized small molecules play important role in anticancer therapy. Several chemical compounds have been reported to damage the DNA, either directly or indirectly slowing down the cancer cell progression by causing a cell cycle arrest. Direct or indirect reactive oxygen species formation causes DNA damage leading to cell cycle arrest and subsequent cell death. Therefore, identification of chemically synthesized compounds with anticancer potential is important. Here we investigate the effect of benzothiazole derivative (5g) for its ability to inhibit cell proliferation in different cancer models. Interestingly, 5g interfered with cell proliferation in both, cell lines and tumor cells leading to significant G2/M arrest. 5g treatment resulted in elevated levels of ROS and subsequently, DNA double-strand breaks (DSBs) explaining observed G2/M arrest. Consistently, we observed deregulation of many cell cycle associated proteins such as CDK1, BCL2 and their phosphorylated form, CyclinB1, CDC25c etc. Besides, 5g treatment led to decreased levels of mitochondrial membrane potential and activation of apoptosis. Interestingly, 5g administration inhibited tumor growth in mice without significant side effects. Thus, our study identifies 5g as a potent biochemical inhibitor to induce G2/M phase arrest of the cell cycle, and demonstrates its anticancer properties both ex vivo and in vivo.

Removal of gaseous trichloroethylene (TCE) in a composite membrane biofilm reactor.

PubMed

Kumar, Amit; Vercruyssen, Aline; Dewulf, Jo; Lens, Piet; Van Langenhove, Herman

2012-01-01

A membrane biofilm reactor (MBfR) was investigated for the degradation of trichloroethylene (TCE) vapors inoculated by Burkholderia vietnamiensis G4. Toluene (TOL) was used as the primary substrate. The MBfR was loaded sequentially with TOL, TCE (or both) during 110 days. In this study, a maximum steady-state TCE removal efficiency of 23% and a maximum volumetric elimination capacity (EC) of 2.1 g m(-3) h(-1) was achieved. A surface area based maximum elimination capacity (EC(m)) of 4.2 × 10(-3) g m(-2) h(-1) was observed, which is 2-10 times higher than reported in other gas phase biological treatment studies. However, further research is needed to optimize the TCE feeding cycle and to evaluate the inhibiting effects of TCE and its intermediates on TOL biodegradation.

Cytotoxic effects of 2-methoxyestradiol in the hepatocellular carcinoma cell line HepG2.

PubMed

El Naga, Reem N Abou; El-Demerdash, Ebtehal; Youssef, Samar S; Abdel-Naim, Ashraf B; El-Merzabani, Mahmoud

2009-01-01

The study was designed to examine the potential cytotoxicity of 2-methoxyestradiol (2ME2), a natural 17beta-estradiol metabolite, in hepatocellular carcinoma and the possible underlying mechanisms for this cytotoxicity. The cell line HepG2 was treated with different concentrations of 2ME2 for 48 and 72 h. Using the sulforhodamine B assay, HepG2 was sensitive to the cytotoxic effect of 2ME2. 2ME2 induced cell arrest at the G(2)/M phase and a significant high percentage of apoptotic cells compared to the control group. Also, 2ME2 induced a significant increase in caspase 9 enzymatic activity after 48 and 72 h of treatment compared with control values. The DNA laddering was observed only in cells treated for 72 h. Furthermore, 2ME2 induced a significant decrease in the expression levels of vascular endothelial growth factor (VEGF) gene compared to the control values. 2ME2 exerts cytotoxic activity in the HepG2 cell line by preferential cell blocking at the G(2)/M phase as well as induction of apoptosis as evidenced by increased caspase 9 enzymatic activity and observed DNA laddering in 2ME2-treated HepG2 cells. In addition, a reduction in hypervascularity is an important postulated mechanism as indicated by the significant reduction in the expression of VGEF, one of the most important angiogenic factors.

Aflatoxin (B1 , B2 , G1 , and G2 ) contamination in rice of Mexico and Spain, from local sources or imported.

PubMed

Suárez-Bonnet, Elena; Carvajal, Magda; Méndez-Ramírez, Ignacio; Castillo-Urueta, Pável; Cortés-Eslava, Josefina; Gómez-Arroyo, Sandra; Melero-Vara, José María

2013-11-01

Rice is an important cereal but it is often contaminated with aflatoxins (AFs). The purpose of this study was to identify and quantify AF (B1 , B2 , G1 , and G2 ) in 67 rice samples cultivated in Mexico and Spain, and from imported crops collected in 2008 and 2009. The methodology was validated, the rice samples were concentrated and purified with immunoaffinity columns and were quantified by high-pressure liquid chromatography (HPLC). The average total AF (AFt) in the Spanish rice was 37.3 μg/kg, the range was from 1.6 to 1383 μg/kg, the most contaminated samples being from San Juan de Aznalfarache, Sevilla (AFt = 138.6 μg/kg), from Tortosa, Tarragona (AFt = 104.6 μg/kg), and Calasparra, Murcia (AFt = 103.9 μg/kg). The rice imported from France to Spain had AFt of 26.6 μg/kg and from Pakistan AFt of 18.4 μg/kg, showing less AF contamination than the local one. The rice which originated from Mexico contained (AFt = 16.9 μg/kg), and those imported from the United States (AFt = 14.4 μg/kg) and Uruguay (AFt = 15.6 μg/kg). The imported rice had better quality in terms of the presence of AFs. © 2013 Institute of Food Technologists®

REACTOR PHYSICS MODELING OF SPENT RESEARCH REACTOR FUEL FOR TECHNICAL NUCLEAR FORENSICS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nichols, T.; Beals, D.; Sternat, M.

2011-07-18

Technical nuclear forensics (TNF) refers to the collection, analysis and evaluation of pre- and post-detonation radiological or nuclear materials, devices, and/or debris. TNF is an integral component, complementing traditional forensics and investigative work, to help enable the attribution of discovered radiological or nuclear material. Research is needed to improve the capabilities of TNF. One research area of interest is determining the isotopic signatures of research reactors. Research reactors are a potential source of both radiological and nuclear material. Research reactors are often the least safeguarded type of reactor; they vary greatly in size, fuel type, enrichment, power, and burn-up. Manymore » research reactors are fueled with highly-enriched uranium (HEU), up to {approx}93% {sup 235}U, which could potentially be used as weapons material. All of them have significant amounts of radiological material with which a radioactive dispersal device (RDD) could be built. Therefore, the ability to attribute if material originated from or was produced in a specific research reactor is an important tool in providing for the security of the United States. Currently there are approximately 237 operating research reactors worldwide, another 12 are in temporary shutdown and 224 research reactors are reported as shut down. Little is currently known about the isotopic signatures of spent research reactor fuel. An effort is underway at Savannah River National Laboratory (SRNL) to analyze spent research reactor fuel to determine these signatures. Computer models, using reactor physics codes, are being compared to the measured analytes in the spent fuel. This allows for improving the reactor physics codes in modeling research reactors for the purpose of nuclear forensics. Currently the Oak Ridge Research reactor (ORR) is being modeled and fuel samples are being analyzed for comparison. Samples of an ORR spent fuel assembly were taken by SRNL for analytical and

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

PubMed

Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

2017-10-01

Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

Anti-cancer Activity of Osmanthus matsumuranus Extract by Inducing G2/M Arrest and Apoptosis in Human Hepatocellular Carcinoma Hep G2 Cells

PubMed Central

Jin, Soojung; Park, Hyun-Jin; Oh, You Na; Kwon, Hyun Ju; Kim, Jeong-Hwan; Choi, Yung Hyun; Kim, Byung Woo

2015-01-01

Background: Osmanthus matsumuranus, a species of Oleaceae, is found in East Asia and Southeast Asia. The bioactivities of O. matsumuranus have not yet been fully understood. Here, we studied on the molecular mechanisms underlying anti-cancer effect of ethanol extract of O. matsumuranus (EEOM). Methods: Inhibitory effect of EEOM on cell growth and proliferation was determined by WST assay in various cancer cells. To investigate the mechanisms of EEOM-mediated cytotoxicity, HepG2 cells were treated with various concentration of EEOM and analyzed the cell cycle arrest and apoptosis induction by flow cytometry, Western blot analysis, 4,6-diamidino-2-phenylindole (DAPI) staining and DNA fragmentation. Results: EEOM showed the cytotoxic activities in a dose-dependent manner in various cancer cell lines but not in normal cells, and HepG2 cells were most susceptible to EEOM-induced cytotoxicity. EEOM induced G2/M arrest in HepG2 cells associated with decreased expression of cyclin-dependent kinase 1 (CDK1), cyclin A and cylcin B, and increased expression of phospho-checkpoint kinase 2, p53 and CDK inhibitor p21. Immunofluorescence staining showed that EEOM-treated HepG2 increased doublet nuclei and condensed actin, resulting in cell rounding. Furthermore, EEOM-mediated apoptosis was determined by Annexin V staining, chromatin condensation and DNA fragmentation. EEOM caused upregulation of FAS and Bax, activation of caspase-3, -8, -9, and fragmentation of poly ADP ribose polymerase. Conclusions: These results suggest that EEOM efficiently inhibits proliferation of HepG2 cells by inducing both G2/M arrest and apoptosis via intrinsic and extrinsic pathways, and EEOM may be used as a cancer chemopreventive agent in the food or nutraceutical industry. PMID:26734586

Thermodynamic analysis of cesium and iodine behavior in severe light water reactor accidents

NASA Astrophysics Data System (ADS)

Minato, Kazuo

1991-11-01

In order to understand the release and transport behavior of cesium (Cs) and iodine (I) in severe light water reactor accidents, chemical forms of Cs and I in steam-hydrogen mixtures were analyzed thermodynamically. In the calculations reactions of boron (B) with Cs were taken into consideration. The analysis showed that B plays an important role in determining chemical forms of Cs. The main Cs-containing species are CsBO 2(g) and CsBO 2(l), depending on temperature. The contribution of CsOH(g) is minor. The main I-containing species are HI(g) and CsI(g) over the wide ranges of the parameters considered. Calculations were also carried out under the conditions of the Three Mile Island Unit 2 accident.

Request for Naval Reactors Comment on Proposed Prometheus Space Flight Nuclear Reactor High Tier Reactor Safety Requirements and for Naval Reactors Approval to Transmit These Requirements to JPL

DOE Office of Scientific and Technical Information (OSTI.GOV)

D. Kokkinos

2005-04-28

The purpose of this letter is to request Naval Reactors comments on the nuclear reactor high tier requirements for the PROMETHEUS space flight reactor design, pre-launch operations, launch, ascent, operation, and disposal, and to request Naval Reactors approval to transmit these requirements to Jet Propulsion Laboratory to ensure consistency between the reactor safety requirements and the spacecraft safety requirements. The proposed PROMETHEUS nuclear reactor high tier safety requirements are consistent with the long standing safety culture of the Naval Reactors Program and its commitment to protecting the health and safety of the public and the environment. In addition, the philosophymore » on which these requirements are based is consistent with the Nuclear Safety Policy Working Group recommendations on space nuclear propulsion safety (Reference 1), DOE Nuclear Safety Criteria and Specifications for Space Nuclear Reactors (Reference 2), the Nuclear Space Power Safety and Facility Guidelines Study of the Applied Physics Laboratory.« less

A new approach for bioethanol production from sugarcane bagasse using hydrodynamic cavitation assisted-pretreatment and column reactors.

PubMed

Terán Hilares, Ruly; Kamoei, Douglas Viana; Ahmed, Muhammad Ajaz; da Silva, Silvio Silvério; Han, Jong-In; Santos, Júlio César Dos

2018-05-01

Hydrodynamic cavitation (HC) was adopted to assist alkaline-hydrogen peroxide pretreatment of sugarcane bagasse (SCB). In the following condition: 0.29 M of NaOH, 0.78% (v/v) of H 2 O 2 , 9.95 min of process time and 3 bar of inlet pressure, 95.4% of digestibility of cellulosic fraction was achieved. To take the best use of the pretreated biomass, the overall process was intensified by way of employing a packed bed flow-through column reactor and thus enabling to handle a high solid loading of 20%, thereby leading to cellulose and hemicellulose conversions to 74.7% and 75%, respectively. In the fermentation step, a bubble column reactor was introduced to maximize ethanol production from the pretreated SCB by Scheffersomyces stipitis NRRL-Y7124, resulting in 31.50 g/L of ethanol, 0.49 g/g of ethanol yield and 0.68 g/L.h of productivity. All this showed that our HC-assisted NaOH-H 2 O 2 pretreatment strategy along with the process intensification approach might offer an option for SCB-based biorefineries. Copyright © 2018 Elsevier B.V. All rights reserved.

A Herpes Simplex Virus 2 (HSV-2) gD Mutant Impaired for Neural Tropism Is Superior to an HSV-2 gD Subunit Vaccine To Protect Animals from Challenge with HSV-2.

PubMed

Wang, Kening; Goodman, Kyle N; Li, Daniel Y; Raffeld, Mark; Chavez, Mayra; Cohen, Jeffrey I

2016-01-01

A recent phase 3 trial with soluble herpes simplex virus 2 (HSV-2) glycoprotein D (gD2t) in adjuvant failed to show protection against genital herpes. We postulated that live attenuated HSV-2 would provide more HSV antigens for induction of virus-specific antibodies and cellular immunity than would gD2t. We previously reported an HSV-2 mutant, HSV2-gD27, in which the nectin-1 binding domain of gD2 is altered so that the virus is impaired for infecting neural cells, but not epithelial cells, in vitro and is impaired for infecting dorsal root ganglia in mice (K. Wang, J. D. Kappel, C. Canders, W. F. Davila, D. Sayre, M. Chavez, L. Pesnicak, and J. I. Cohen, J Virol 86:12891-12902, 2012, doi:10.1128/JVI.01055-12). Here we report that the mutations in HSV2-gD27 were stable when the virus was passaged in cell culture and during acute infection of mice. HSV2-gD27 was attenuated in mice when it was inoculated onto the cornea, intramuscularly (i.m.), intravaginally, and intracranially. Vaccination of mice i.m. with HSV2-gD27 provided better inhibition of challenge virus replication in the vagina than when the virus was used to vaccinate mice intranasally or subcutaneously. Comparison of i.m. vaccinations with HSV2-gD27 versus gD2t in adjuvant showed that HSV2-gD27 induced larger reductions of challenge virus replication in the vagina and reduced latent viral loads in dorsal root ganglia but induced lower serum neutralizing antibody titers than those obtained with gD2t in adjuvant. Taken together, our data indicate that a live attenuated HSV-2 vaccine impaired for infection of neurons provides better protection from vaginal challenge with HSV-2 than that obtained with a subunit vaccine, despite inducing lower titers of HSV-2 neutralizing antibodies in the serum. Genital herpes simplex is one of the most prevalent sexually transmitted diseases. Though HSV-2 disease is usually mild, it can be life threatening in neonates and immunocompromised persons. In addition, genital

G2 Autonomous Control for Cryogenic Delivery Systems

NASA Technical Reports Server (NTRS)

Dito, Scott J.

2014-01-01

The Independent System Health Management-Autonomous Control (ISHM-AC) application development for cryogenic delivery systems is intended to create an expert system that will require minimal operator involvement and ultimately allow for complete autonomy when fueling a space vehicle in the time prior to launch. The G2-Autonomous Control project is the development of a model, simulation, and ultimately a working application that will control and monitor the cryogenic fluid delivery to a rocket for testing purposes. To develop this application, the project is using the programming language/environment Gensym G2. The environment is an all-inclusive application that allows development, testing, modeling, and finally operation of the unique application through graphical and programmatic methods. We have learned G2 through training classes and subsequent application development, and are now in the process of building the application that will soon be used to test on cryogenic loading equipment here at the Kennedy Space Center Cryogenics Test Laboratory (CTL). The G2 ISHM-AC application will bring with it a safer and more efficient propellant loading system for the future launches at Kennedy Space Center and eventually mobile launches from all over the world.

Optimization of a horizontal-flow biofilm reactor for the removal of methane at low temperatures.

PubMed

Clifford, E; Kennelly, C; Walsh, R; Gerrity, S; Reilly, E O; Collins, G

2012-10-01

Three pilot-scale, horizontal-flow biofilm reactors (HFBRs 1-3) were used to treat methane (CH4)-contaminated air to assess the potential of this technology to manage emissions from agricultural activities, waste and wastewater treatment facilities, and landfills. The study was conducted over two phases (Phase 1, lasting 90 days and Phase 2, lasting 45 days). The reactors were operated at 10 degrees C (typical of ambient air and wastewater temperatures in northern Europe), and were simultaneously dosed with CH4-contaminated air and a synthetic wastewater (SWW). The influent loading rates to the reactors were 8.6 g CH4/m3/hr (4.3 g CH4/m2 TPSA/hr; where TPSA is top plan surface area). Despite the low operating temperatures, an overall average removal of 4.63 g CH4/m3/day was observed during Phase 2. The maximum removal efficiency (RE) for the trial was 88%. Potential (maximum) rates of methane oxidation were measured and indicated that biofilm samples taken from various regions in the HFBRs had mostly equal CH4 removal potential. In situ activity rates were dependent on which part of the reactor samples were obtained. The results indicate the potential of the HFBR, a simple and robust technology, to biologically treat CH4 emissions. The results of this study indicate that the HFBR technology could be effectively applied to the reduction of greenhouse gas emissions from wastewater treatment plants and agricultural facilities at lower temperatures common to northern Europe. This could reduce the carbon footprint of waste treatment and agricultural livestock facilities. Activity tests indicate that methanotrophic communities can be supported at these temperatures. Furthermore, these data can lead to improved reactor design and optimization by allowing conditions to be engineered to allow for improved removal rates, particularly at lower temperatures. The technology is simple to construct and operate, and with some optimization of the liquid phase to improve mass

Development of V2G and G2V Power Profiles and Their Implications on Grid Under Varying Equilibrium of Aggregated Electric Vehicles

NASA Astrophysics Data System (ADS)

Jain, Prateek; Jain, Trapti

2016-04-01

The objective of this paper is to examine the vehicle-to-grid (V2G) power capability of aggregated electric vehicles (EV) in the manner that they are being adopted by the consumers with their growing infiltration in the vehicles market. The proposed modeling of V2G and grid-to-vehicle (G2V) energy profiles blends the heterogeneous attributes namely, driven mileages, arrival and departure times, travel and parking durations, and speed dependent energy consumption of mobility trends. Three penetration percentages of 25 %, 50 % and 100 % resulting in varied compositions of battery electric vehicle (BEV) and plug-in hybrid electric vehicle (PHEV) in the system, as determined by the consumers' acceptance, have been considered to evaluate the grid capacity for V2G. Distinct charge-discharge powers have been selected as per charging standards to match contemporary vehicles and infrastructure requirements. Charging and discharging approaches have been devised to replicate non-linear characteristics of Li-ion battery. Effects of simultaneous conjunction of V2G and G2V power curves with daily conventional load profile are quantified drawn upon workplace-discharging home-charging scheme. Results demonstrated a marked drop in load and hence in market price during morning hours which is hurriedly overcompensated by the hike during evening hours with rising penetration level and charge-discharge power.

Determination of initial fuel state and number of reactor shutdowns in archived low-burnup uranium targets

DOE Office of Scientific and Technical Information (OSTI.GOV)

Byerly, Benjamin; Tandon, Lav; Hayes-Sterbenz, Anna

This article presents a method for destructive analysis of irradiated uranium (U) targets, with a focus on collection and measurement of long-lived (t 1/2 > ~10 years) and stable fission product isotopes of ruthenium and cesium. Long-lived and stable isotopes of these elements can provide information on reactor conditions (e.g. flux, irradiation time, cooling time) in old samples (> 5–10 years) whose short-lived fission products have decayed away. The separation and analytical procedures were tested on archived U reactor targets at Los Alamos National Laboratory as part of an effort to evaluate reactor models at low-burnup.

Determination of initial fuel state and number of reactor shutdowns in archived low-burnup uranium targets

DOE PAGES

Byerly, Benjamin; Tandon, Lav; Hayes-Sterbenz, Anna; ...

2015-10-26

This article presents a method for destructive analysis of irradiated uranium (U) targets, with a focus on collection and measurement of long-lived (t 1/2 > ~10 years) and stable fission product isotopes of ruthenium and cesium. Long-lived and stable isotopes of these elements can provide information on reactor conditions (e.g. flux, irradiation time, cooling time) in old samples (> 5–10 years) whose short-lived fission products have decayed away. The separation and analytical procedures were tested on archived U reactor targets at Los Alamos National Laboratory as part of an effort to evaluate reactor models at low-burnup.

SPERTI. Detail view of Reactor Pit Building (PER605) and Instrument ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

SPERT-I. Detail view of Reactor Pit Building (PER-605) and Instrument Cell (PER-606). Earth shielding covers side of Cell Building next to reactor. Instrumentation required protection from radiation emitted during reactor operation. Photographer: R.G. Larsen. Date: May 20, 1955. INEEL negative no. 55-1290 - Idaho National Engineering Laboratory, SPERT-I & Power Burst Facility Area, Scoville, Butte County, ID

Balancing Near-Field Enhancement, Absorption, and Scattering for Effective Antenna-Reactor Plasmonic Photocatalysis.

PubMed

Li, Kun; Hogan, Nathaniel J; Kale, Matthew J; Halas, Naomi J; Nordlander, Peter; Christopher, Phillip

2017-06-14

Efficient photocatalysis requires multifunctional materials that absorb photons and generate energetic charge carriers at catalytic active sites to facilitate a desired chemical reaction. Antenna-reactor complexes are an emerging multifunctional photocatalytic structure where the strong, localized near field of the plasmonic metal nanoparticle (e.g., Ag) is coupled to the catalytic properties of the nonplasmonic metal nanoparticle (e.g., Pt) to enable chemical transformations. With an eye toward sustainable solar driven photocatalysis, we investigate how the structure of antenna-reactor complexes governs their photocatalytic activity in the light-limited regime, where all photons need to be effectively utilized. By synthesizing core@shell/satellite (Ag@SiO 2 /Pt) antenna-reactor complexes with varying Ag nanoparticle diameters and performing photocatalytic CO oxidation, we observed plasmon-enhanced photocatalysis only for antenna-reactor complexes with antenna components of intermediate sizes (25 and 50 nm). Optimal photocatalytic performance was shown to be determined by a balance between maximized local field enhancements at the catalytically active Pt surface, minimized collective scattering of photons out of the catalyst bed by the complexes, and minimal light absorption in the Ag nanoparticle antenna. These results elucidate the critical aspects of local field enhancement, light scattering, and absorption in plasmonic photocatalyst design, especially under light-limited illumination conditions.

Simultaneous organic nitrogen and sulfate removal in an anaerobic GAC fluidised bed reactor.

PubMed

Fdz-Polanco, F; Fdz-Polanco, M; Fernandez, N; Urueña, M A; García, P A; Villaverde, S

2001-01-01

A granular activated carbon (GAC) anaerobic fluidised bed reactor treating vinasse from an ethanol distillery of sugar beet molasses was operated for 250 days under three different organic loading rates. The reactor showed good performance in terms of organic matter removal and methane production but an anomalous behaviour in terms of unusual high concentrations of molecular nitrogen and low concentration of hydrogen sulphide in the biogas. The analysis of the different nitrogenous and sulphur compounds and the mass balances of these species in the liquid and gas phases clearly indicated an uncommon evolution of nitrogen and sulphur in the reactor. Up to 55% of the TKN and up to 80% of the sulphur disappear in the liquid phase. This is the opposite to any previously reported results in the bibliography. The new postulated anaerobic process of ammonia and sulphate removal seems to follow the mechanism: SO4 = +2 NH4+-->S + N2 + 4H2O (delta G degree = -47.8 kJ/mol).

LLRF System for the Fermilab Muon g-2 and Mu2e Projects

DOE Office of Scientific and Technical Information (OSTI.GOV)

Varghese, P.; Chase, B.

The Mu2e experiment measures the conversion rate of muons into electrons and the Muon g-2 experiment measures the muon magnetic moment. Both experiments require 53 MHz batches of 8 GeV protons to be re-bunched into 150 ns, 2.5 MHz pulses for extraction to the g-2 target for Muon g-2 and to a delivery ring with a single RF cavity running at 2.36 MHz for Mu2e. The LLRF system for both experiments is implemented in a SOC FPGA board integrated into the existing 53 MHz LLRF system in a VXI crate. The tight timing requirements, the large frequency difference and themore » non-harmonic relationship between the two RF systems provide unique challenges to the LLRF system design to achieve the required phase alignment specifications for beam formation, transfers and beam extinction between pulses. The new LLRF system design for both projects is described and the results of the initial beam commissioning tests for the Muon g-2 experiment are presented.« less

Clockwork graviton contributions to muon g -2

NASA Astrophysics Data System (ADS)

Hong, Deog Ki; Kim, Du Hwan; Shin, Chang Sub

2018-02-01

The clockwork mechanism for gravity introduces a tower of massive graviton modes, clockwork gravitons, with a very compressed mass spectrum, whose interaction strengths are much stronger than those of massless gravitons. In this work, we compute the lowest order contributions of the clockwork gravitons to the anomalous magnetic moment, g -2 , of muon in the context of an extra dimensional model with a five-dimensional Planck mass, M5. We find that the total contributions are rather insensitive to the detailed model parameters and are determined mostly by the value of M5. To account for the current muon g -2 anomaly, M5 should be around 0.2 TeV, and the size of the extra dimension has to be quite large, l5≳10-7 m . For M5≳1 TeV , the clockwork graviton contributions are too small to explain the current muon g -2 anomaly. We also compare the clockwork graviton contributions with other extra dimensional models such as Randall-Sundrum models or large extra dimensional models. We find that the leading contributions in the small curvature limit are universal, but the cutoff-independent subleading contributions vary for different background geometries and the clockwork geometry gives the smallest subleading contributions.

Th1/Th2 cytokine profiles in G+/G- bacteremia in pediatric hematology/oncology patients.

PubMed

Tang, Yongmin; Liao, Chan; Xu, Xiaojun; Song, Hua; Shi, Shuwen; Yang, Shilong

2012-01-01

Early diagnosis of infection and appropriate choice of antibiotics are essential not only to improve the prognosis of the patients but also to prevent from the abuse of the antibiotics in hematology/oncology children at the time of neutropenia after intensive chemotherapy. We evaluated the quantification of Th1/Th2 cytokines with flow cytometry bead assay (CBA) in 145 hospitalized febrile hematology/oncology children with positive blood culture to seek for a rapid diagnostic method to determine the type of infection. IL-4, IL-6, IL-10, TNF-α, and IFN-γ levels from both G- and G+ bacteremia groups were significantly higher than those of controls (P < 0.001). The median levels of IL-6, IL-10, TNF-α of Group G- were 525.4, 96.0, and 6.9 pg/ml, respectively, significantly higher than those of Group G+ (150.0, 22.6, and 4.5 pg/ml, respectively, P < 0.001). According to the different degrees of increased IL-6 and IL-10 levels, we named the G- bacterial infection related cytokine profile G- BIRCP and the G+ BIRCP. The specificity and sensitivity of BIRCP prediction for G- and G+ bacteria cultures were 60.2% and 75.4%, 66.8% and 70.1%, respectively. Similar therapeutic efficacy was achieved between BIRCP-based and broad-spectrum antibiotics groups (86.1% vs. 89.3%, P > 0.05), which was significantly increased as compared with that (65.5%, P < 0.05) of empirical group. These results showed the promising use of the IL-6/IL-10/TNF-α determination with CBA technology for the early and rapid diagnosis, evaluation of G+/G- bacteremia in pediatric hematology/oncology patients. Copyright © 2011 Wiley Periodicals, Inc.

26 CFR 1.860G-2T - Other rules (temporary).

Code of Federal Regulations, 2013 CFR

2013-04-01

... 26 Internal Revenue 9 2013-04-01 2013-04-01 false Other rules (temporary). 1.860G-2T Section 1.860G-2T Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Real Estate Investment Trusts § 1.860G-2T Other rules (temporary). (a...

26 CFR 1.860G-2T - Other rules (temporary).

Code of Federal Regulations, 2012 CFR

2012-04-01

... 26 Internal Revenue 9 2012-04-01 2012-04-01 false Other rules (temporary). 1.860G-2T Section 1.860G-2T Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Real Estate Investment Trusts § 1.860G-2T Other rules (temporary). (a...

Antigenic Determinants of the Bilobal Cockroach Allergen Bla g 2*

PubMed Central

Woodfolk, Judith A.; Glesner, Jill; Wright, Paul W.; Kepley, Christopher L.; Li, Mi; Himly, Martin; Muehling, Lyndsey M.; Gustchina, Alla; Wlodawer, Alexander; Chapman, Martin D.; Pomés, Anna

2016-01-01

Bla g 2 is a major indoor cockroach allergen associated with the development of asthma. Antigenic determinants on Bla g 2 were analyzed by mutagenesis based on the structure of the allergen alone and in complex with monoclonal antibodies that interfere with IgE antibody binding. The structural analysis revealed mechanisms of allergen-antibody recognition through cation-π interactions. Single and multiple Bla g 2 mutants were expressed in Pichia pastoris and purified. The triple mutant K132A/K251A/F162Y showed an ∼100-fold reduced capacity to bind IgE, while preserving the native molecular fold, as proven by x-ray crystallography. This mutant was still able to induce mast cell release. T-cell responses were assessed by analyzing Th1/Th2 cytokine production and the CD4+ T-cell phenotype in peripheral blood mononuclear cell cultures. Although T-cell activating capacity was similar for the KKF mutant and Bla g 2 based on CD25 expression, the KKF mutant was a weaker inducer of the Th2 cytokine IL-13. Furthermore, this mutant induced IL-10 from a non-T-cell source at higher levels that those induced by Bla g 2. Our findings demonstrate that a rational design of site-directed mutagenesis was effective in producing a mutant with only 3 amino acid substitutions that maintained the same fold as wild type Bla g 2. These residues, which were involved in IgE antibody binding, endowed Bla g 2 with a T-cell modulatory capacity. The antigenic analysis of Bla g 2 will be useful for the subsequent development of recombinant allergen vaccines. PMID:26644466

Microchannel Reactors for ISRU Applications

NASA Astrophysics Data System (ADS)

Carranza, Susana; Makel, Darby B.; Blizman, Brandon; Ward, Benjamin J.

2005-02-01

Affordable planning and execution of prolonged manned space missions depend upon the utilization of local resources and the waste products which are formed in manned spacecraft and surface bases. Successful in-situ resources utilization (ISRU) will require component technologies which provide optimal size, weight, volume, and power efficiency. Microchannel reactors enable the efficient chemical processing of in situ resources. The reactors can be designed for the processes that generate the most benefit for each mission. For instance, propellants (methane) can be produced from carbon dioxide from the Mars atmosphere using the Sabatier reaction and ethylene can be produced from the partial oxidation of methane. A system that synthesizes ethylene could be the precursor for systems to synthesize ethanol and polyethylene. Ethanol can be used as a nutrient for Astrobiology experiments, as well as the production of nutrients for human crew (e.g. sugars). Polyethylene can be used in the construction of habitats, tools, and replacement parts. This paper will present recent developments in miniature chemical reactors using advanced Micro Electro Mechanical Systems (MEMS) and microchannel technology to support ISRU of Mars and lunar missions. Among other applications, the technology has been demonstrated for the Sabatier process and for the partial oxidation of methane. Microchannel reactors were developed based on ceramic substrates as well as metal substrates. In both types of reactors, multiple layers coated with catalytic material are bonded, forming a monolithic structure. Such reactors are readily scalable with the incorporation of extra layers. In addition, this reactor structure minimizes pressure drop and catalyst settling, which are common problems in conventional packed bed reactors.

16 CFR Appendix G2 to Part 305 - Furnaces- Electric

Code of Federal Regulations, 2014 CFR

2014-01-01

... 16 Commercial Practices 1 2014-01-01 2014-01-01 false Furnaces- Electric G2 Appendix G2 to Part... LABELING RULEâ) Appendix G2 to Part 305—Furnaces— Electric Furnace type Range of annual fuel utilization efficiencies (AFUEs) Low High Electric Furnaces—All Capacities 100.0 100.0 [78 FR 8377, Feb. 6, 2013] ...

Cultivation of aerobic granules in a novel configuration of sequencing batch airlift reactor.

PubMed

Rezaei, Laya Siroos; Ayati, Bita; Ganjidoust, Hossein

2012-01-01

Aerobic granules can be formed in sequencing batch airlift reactors (SBAR) and sequencing batch reactors (SBR). Comparing these two systems, the SBAR has excellent mixing condition, but due to a high height-to-diameter ratio (H/D), there is no performance capability at full scale at the present time. This research examined a novel configuration of SBAR at laboratory scale (with a box structure) for industrial wastewater treatment. To evaluate chemical oxygen demand (COD) removal efficiency and granule formation of the novel reactor (R1), in comparison a conventional SBAR (R2) was operated under similar conditions during the experimental period. R1 and R2 with working volumes of 3.6 L and 4.5 L, respectively, were used to cultivate aerobic granules. Both reactors were operated for 4 h per cycle. Experiments were done at different organic loading rates (OLRs) ranging from 0.6-4.5 kg COD/m3.d for R1 and from 0.72-5.4 kg COD/m3.d for R2. After 150 days of operation, large-sized black filamentous granules with diameters of 0.5-2 mm and 2-11 mm were formed in R1 and R2, respectively. In the second part of the experiment, the efficiency of removal of a toxic substance by aerobic granules was investigated using aniline as a carbon source with a concentration in the range 1.2-6.6 kg COD/m3.d and 1.44-7.92 kg COD/m3.d in R1 and R2, respectively. It was found that COD removal efficiency of the novel airlift reactor was over 97% and 94.5% using glucose and aniline as carbon sources, respectively. Sludge volume index (SVI) was also decreased to 30 mL/g by granulation in the novel airlift reactor.

Steady-State Thermal-Hydraulics Analyses for the Conversion of the BR2 Reactor to LEU

DOE Office of Scientific and Technical Information (OSTI.GOV)

Licht, J. R.; Bergeron, A.; Dionne, B.

BR2 is a research reactor used for radioisotope production and materials testing. It’s a tank-in-pool type reactor cooled by light water and moderated by beryllium and light water. The reactor core consists of a beryllium moderator forming a matrix of 79 hexagonal prisms in a hyperboloid configuration; each having a central bore that can contain a variety of different components such as a fuel assembly, a control or regulating rod, an experimental device, or a beryllium or aluminum plug. Based on a series of tests, the BR2 operation is currently limited to a maximum allowable heat flux of 470 W/cmmore » 2 to ensure fuel plate integrity during steady-state operation and after a loss-of-flow/loss-of-pressure accident. A feasibility study for the conversion of the BR2 reactor from highly-enriched uranium (HEU) to low-enriched uranium (LEU) fuel was previously performed to verify it can operate safely at the same maximum nominal steady-state heat flux. An assessment was also performed to quantify the heat fluxes at which the onset of flow instability and critical heat flux occur for each fuel type. This document updates and expands these results for the current representative core configuration (assuming a fresh beryllium matrix) by evaluating the onset of nucleate boiling (ONB), onset of fully developed nucleate boiling (FDNB), onset of flow instability (OFI) and critical heat flux (CHF).« less

Sugar-modified G-quadruplexes: effects of LNA-, 2′F-RNA– and 2′F-ANA-guanosine chemistries on G-quadruplex structure and stability

PubMed Central

Li, Zhe; Lech, Christopher Jacques; Phan, Anh Tuân

2014-01-01

G-quadruplex-forming oligonucleotides containing modified nucleotide chemistries have demonstrated promising pharmaceutical potential. In this work, we systematically investigate the effects of sugar-modified guanosines on the structure and stability of a (4+0) parallel and a (3+1) hybrid G-quadruplex using over 60 modified sequences containing a single-position substitution of 2′-O-4′-C-methylene-guanosine (LNAG), 2′-deoxy-2′-fluoro-riboguanosine (FG) or 2′-deoxy-2′-fluoro-arabinoguanosine (FANAG). Our results are summarized in two parts: (I) Generally, LNAG substitutions into ‘anti’ position guanines within a guanine-tetrad lead to a more stable G-quadruplex, while substitutions into ‘syn’ positions disrupt the native G-quadruplex conformation. However, some interesting exceptions to this trend are observed. We discover that a LNAG modification upstream of a short propeller loop hinders G-quadruplex formation. (II) A single substitution of either FG or FANAG into a ‘syn’ position is powerful enough to perturb the (3+1) G-quadruplex. Substitution of either FG or FANAG into any ‘anti’ position is well tolerated in the two G-quadruplex scaffolds. FANAG substitutions to ‘anti’ positions are better tolerated than their FG counterparts. In both scaffolds, FANAG substitutions to the central tetrad layer are observed to be the most stabilizing. The observations reported herein on the effects of LNAG, FG and FANAG modifications on G-quadruplex structure and stability will enable the future design of pharmaceutically relevant oligonucleotides. PMID:24371274

Loss of G2 subunit of vacuolar-type proton transporting ATPase leads to G1 subunit upregulation in the brain

PubMed Central

Kawamura, Nobuyuki; Sun-Wada, Ge-Hong; Wada, Yoh

2015-01-01

Vacuolar-type ATPase (V-ATPase) is a primary proton pump with versatile functions in various tissues. In nerve cells, V-ATPase is required for accumulation of neurotransmitters into secretory vesicles and subsequent release at the synapse. Neurons express a specific isoform (G2) of the G subunit of V-ATPase constituting the catalytic sector of the enzyme complex. Using gene targeting, we generated a mouse lacking functional G2 (G2 null), which showed no apparent disorders in architecture and behavior. In the G2-null mouse brain, a G1 subunit isoform, which is ubiquitously expressed in neuronal and non-neuronal tissues, accumulated more abundantly than in wild-type animals. This G1 upregulation was not accompanied by an increase in mRNA. These results indicate that loss of function of neuron-specific G2 isoform was compensated by an increase in levels of the G1 isoform without apparent upregulation of the G1 mRNA. PMID:26353914

Xanthorrhizol induced DNA fragmentation in HepG2 cells involving Bcl-2 family proteins

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tee, Thiam-Tsui, E-mail: thiamtsu@yahoo.com; Cheah, Yew-Hoong; Bioassay Unit, Herbal Medicine Research Center, Institute for Medical Research, Jalan Pahang, Kuala Lumpur

Highlights: Black-Right-Pointing-Pointer We isolated xanthorrhizol, a sesquiterpenoid compound from Curcuma xanthorrhiza. Black-Right-Pointing-Pointer Xanthorrhizol induced apoptosis in HepG2 cells as observed using SEM. Black-Right-Pointing-Pointer Apoptosis in xanthorrhizol-treated HepG2 cells involved Bcl-2 family proteins. Black-Right-Pointing-Pointer DNA fragmentation was observed in xanthorrhizol-treated HepG2 cells. Black-Right-Pointing-Pointer DNA fragmentation maybe due to cleavage of PARP and DFF45/ICAD proteins. -- Abstract: Xanthorrhizol is a plant-derived pharmacologically active sesquiterpenoid compound isolated from Curcuma xanthorrhiza. Previously, we have reported that xanthorrhizol inhibited the proliferation of HepG2 human hepatoma cells by inducing apoptotic cell death via caspase activation. Here, we attempt to further elucidate the mode of action ofmore » xanthorrhizol. Apoptosis in xanthorrhizol-treated HepG2 cells as observed by scanning electron microscopy was accompanied by truncation of BID; reduction of both anti-apoptotic Bcl-2 and Bcl-X{sub L} expression; cleavage of PARP and DFF45/ICAD proteins and DNA fragmentation. Taken together, these results suggest xanthorrhizol as a potent antiproliferative agent on HepG2 cells by inducing apoptosis via Bcl-2 family members. Hence we proposed that xanthorrhizol could be used as an anti-liver cancer drug for future studies.« less

Attrition reactor system

DOEpatents

Scott, C.D.; Davison, B.H.

1993-09-28

A reactor vessel for reacting a solid particulate with a liquid reactant has a centrifugal pump in circulatory flow communication with the reactor vessel for providing particulate attrition, resulting in additional fresh surface where the reaction can occur. 2 figures.

Antigenic Determinants of the Bilobal Cockroach Allergen Bla g 2.

PubMed

Woodfolk, Judith A; Glesner, Jill; Wright, Paul W; Kepley, Christopher L; Li, Mi; Himly, Martin; Muehling, Lyndsey M; Gustchina, Alla; Wlodawer, Alexander; Chapman, Martin D; Pomés, Anna

2016-01-29

Bla g 2 is a major indoor cockroach allergen associated with the development of asthma. Antigenic determinants on Bla g 2 were analyzed by mutagenesis based on the structure of the allergen alone and in complex with monoclonal antibodies that interfere with IgE antibody binding. The structural analysis revealed mechanisms of allergen-antibody recognition through cation-π interactions. Single and multiple Bla g 2 mutants were expressed in Pichia pastoris and purified. The triple mutant K132A/K251A/F162Y showed an ∼100-fold reduced capacity to bind IgE, while preserving the native molecular fold, as proven by x-ray crystallography. This mutant was still able to induce mast cell release. T-cell responses were assessed by analyzing Th1/Th2 cytokine production and the CD4(+) T-cell phenotype in peripheral blood mononuclear cell cultures. Although T-cell activating capacity was similar for the KKF mutant and Bla g 2 based on CD25 expression, the KKF mutant was a weaker inducer of the Th2 cytokine IL-13. Furthermore, this mutant induced IL-10 from a non-T-cell source at higher levels that those induced by Bla g 2. Our findings demonstrate that a rational design of site-directed mutagenesis was effective in producing a mutant with only 3 amino acid substitutions that maintained the same fold as wild type Bla g 2. These residues, which were involved in IgE antibody binding, endowed Bla g 2 with a T-cell modulatory capacity. The antigenic analysis of Bla g 2 will be useful for the subsequent development of recombinant allergen vaccines. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Recovery strategies for tackling the impact of phenolic compounds in a UASB reactor treating coal gasification wastewater.

PubMed

Wang, Wei; Han, Hongjun

2012-01-01

The impact of phenolic compounds (around 3.2 g/L) resulted in a completely failed performance in a mesophilic UASB reactor treating coal gasification wastewater. The recovery strategies, including extension of HRT, dilution, oxygen-limited aeration, and addition of powdered activated carbon were evaluated in batch tests, in order to obtain the most appropriate way for the quick recovery of the failed reactor performance. Results indicated that addition of powdered activated carbon and oxygen-limited aeration were the best recovery strategies in the batch tests. In the UASB reactor, addition of powdered activated carbon of 1 g/L shortened the recovery time from 25 to 9 days and oxygen-limited aeration of 0-0.5 mgO2/L reduced the recovery time to 17 days. Reduction of bioavailable concentration of phenolic compounds and recovery of sludge activity were the decisive factors for the recovery strategies to tackle the impact of phenolic compounds in anaerobic treatment of coal gasification wastewater. Copyright © 2011 Elsevier Ltd. All rights reserved.

Design options for a bunsen reactor.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moore, Robert Charles

2013-10-01

This work is being performed for Matt Channon Consulting as part of the Sandia National Laboratories New Mexico Small Business Assistance Program (NMSBA). Matt Channon Consulting has requested Sandia's assistance in the design of a chemical Bunsen reactor for the reaction of SO2, I2 and H2O to produce H2SO4 and HI with a SO2 feed rate to the reactor of 50 kg/hour. Based on this value, an assumed reactor efficiency of 33%, and kinetic data from the literature, a plug flow reactor approximately 1%E2%80%9D diameter and and 12 inches long would be needed to meet the specification of the project.more » Because the Bunsen reaction is exothermic, heat in the amount of approximately 128,000 kJ/hr would need to be removed using a cooling jacket placed around the tubular reactor. The available literature information on Bunsen reactor design and operation, certain support equipment needed for process operation and a design that meet the specification of Matt Channon Consulting are presented.« less

[Research on change process of nitrosation granular sludge in continuous stirred-tank reactor].

PubMed

Yin, Fang-Fang; Liu, Wen-Ru; Wang, Jian-Fang; Wu, Peng; Shen, Yao-Liang

2014-11-01

In order to investigate the effect of different types of reactors on the nitrosation granular sludge, a continuous stirred-tank reactor (CSTR) was studied, using mature nitrosation granular sludge cultivated in sequencing batch reactor (SBR) as seed sludge. Results indicated that the change of reactor type and influent mode could induce part of granules to lose stability with gradual decrease in sludge settling ability during the initial period of operation. However, the flocs in CSTR achieved fast granulation in the following reactor operation. In spite of the changes of particle size distribution, e. g. the decreasing number of granules with diameter larger than 2.5 mm and the increasing number of granules with diameter smaller than 0.3 mm, granular sludge held the absolute predominance of sludge morphology in CSTR during the entire experimental period. Moreover, results showed that the change of reactor type and influent mode didn't affect the nitrite accumulation rate which was still kept at about 85% in effluent. Additionally, the average activity of the sludge in CSTR was stronger than that of the seed sludge, because the newly generated small particles in CSTR had higher specific reactive activity than the larger granules.

Discharge Characteristics of Series Surface/Packed-Bed Discharge Reactor Diven by Bipolar Pulsed Power

NASA Astrophysics Data System (ADS)

Hu, Jian; Jiang, Nan; Li, Jie; Shang, Kefeng; Lu, Na; Wu, Yan; Mizuno, Akira

2016-03-01

The discharge characteristics of the series surface/packed-bed discharge (SSPBD) reactor driven by bipolar pulse power were systemically investigated in this study. In order to evaluate the advantages of the SSPBD reactor, it was compared with traditional surface discharge (SD) reactor and packed-bed discharge (PBD) reactor in terms of the discharge voltage, discharge current, and ozone formation. The SSPBD reactor exhibited a faster rising time and lower tail voltage than the SD and PBD reactors. The distribution of the active species generated in different discharge regions of the SSPBD reactor was analyzed by optical emission spectra and ozone analysis. It was found that the packed-bed discharge region (3.5 mg/L), rather than the surface discharge region (1.3 mg/L) in the SSPBD reactor played a more important role in ozone generation. The optical emission spectroscopy analysis indicated that more intense peaks of the active species (e.g. N2 and OI) in the optical emission spectra were observed in the packed-bed region. supported by National Natural Science Foundation of China (No. 51177007), the Joint Funds of National Natural Science Foundation of China (No. U1462105), and Dalian University of Technology Fundamental Research Fund of China (No. DUT15RC(3)030)

Development and experimental qualification of a calculation scheme for the evaluation of gamma heating in experimental reactors. Application to MARIA and Jules Horowitz (JHR) MTR Reactors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tarchalski, M.; Pytel, K.; Wroblewska, M.

2015-07-01

evaluated from measurements is of the order of 2.5 W/g at half of the possible MARIA power - 15 MW. The approach and the detailed program for experimental verification of calculations will be presented. The following points will be discussed: - Development of a gamma heating model of MARIA reactor with TRIPOLI 4 (coupled neutron-photon mode) and APOLLO2 model taking into account the key parameters like: configuration of the core, experimental loading, control rod location, reactor power, fuel depletion); - Design of specific measurement tools for MARIA experiments including for instance a new single-cell calorimeter called KAROLINA calorimeter; - MARIA experimental program description and a preliminary analysis of results; - Comparison of calculations for JHR and MARIA cores with experimental verification analysis, calculation behavior and n-γ 'environments'. (authors)« less

A plasma arc reactor for fullerene research

NASA Astrophysics Data System (ADS)

Anderson, T. T.; Dyer, P. L.; Dykes, J. W.; Klavins, P.; Anderson, P. E.; Liu, J. Z.; Shelton, R. N.

1994-12-01

A modified Krätschmer-Huffman reactor for the mass production of fullerenes is presented. Fullerene mass production is fundamental for the synthesis of higher and endohedral fullerenes. The reactor employs mechanisms for continuous graphite-rod feeding and in situ slag removal. Soot collects into a Soxhlet extraction thimble which serves as a fore-line vacuum pump filter, thereby easing fullerene separation from soot. Thermal gravimetric analysis (TGA) for yield determination is reported. This TGA method is faster and uses smaller samples than Soxhlet extraction methods which rely on aromatic solvents. Production of 10 g of soot per hour is readily achieved utilizing this reactor. Fullerene yields of 20% are attained routinely.

The dopamine D2 receptor can directly recruit and activate GRK2 without G protein activation.

PubMed

Pack, Thomas F; Orlen, Margo I; Ray, Caroline; Peterson, Sean M; Caron, Marc G

2018-04-20

The dopamine D2 receptor (D2R) is a G protein-coupled receptor (GPCR) that is critical for many central nervous system functions. The D2R carries out these functions by signaling through two transducers: G proteins and β-arrestins (βarrs). Selectively engaging either the G protein or βarr pathway may be a way to improve drugs targeting GPCRs. The current model of GPCR signal transduction posits a chain of events where G protein activation ultimately leads to βarr recruitment. GPCR kinases (GRKs), which are regulated by G proteins and whose kinase action facilitates βarr recruitment, bridge these pathways. Therefore, βarr recruitment appears to be intimately tied to G protein activation via GRKs. Here we sought to understand how GRK2 action at the D2R would be disrupted when G protein activation is eliminated and the effect of this on βarr recruitment. We used two recently developed biased D2R mutants that can preferentially interact either with G proteins or βarrs as well as a βarr-biased D2R ligand, UNC9994. With these functionally selective tools, we investigated the mechanism whereby the βarr-preferring D2R achieves βarr pathway activation in the complete absence of G protein activation. We describe how direct, G protein-independent recruitment of GRK2 drives interactions at the βarr-preferring D2R and also contributes to βarr recruitment at the WT D2R. Additionally, we found an additive interaction between the βarr-preferring D2R mutant and UNC9994. These results reveal that the D2R can directly recruit GRK2 without G protein activation and that this mechanism may have relevance to achieving βarr-biased signaling. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

The Development of Neutron Radiography and Tomography on a SLOWPOKE-2 Reactor

NASA Astrophysics Data System (ADS)

Bennett, L. G. I.; Lewis, W. J.; Hungler, P. C.

Development of neutron radiography at the Royal Military College of Canada (RMC) started by trying to interest the Royal Canadian Air Force (RCAF) in this new non-destructive testing (NDT) technique. A Californium-252 based device was ordered and then installed at RMC for development of applicable techniques for aircraft by the first author. A second and transportable device was then designed, modified and used in trials at RCAF Bases and other locations for one year. This activity was the only foreign loan of the U.S. Californium Loan Program. Around this time, SLOWPOKE-2 reactors were being installed at four Canadian universities, while a new science and engineering building was being built at RMC. A reactor pool was incorporated and efforts to procure a reactor succeeded a decade later with a SLOWPOKE-2 reactor being installed at RMC. The only modification by the vendor for RMC was a thermal column replacing an irradiation site inside the reactor container for a later installation of a neutron beam tube (NBT). Development of a working NBT took several years, starting with the second author. A demonstration of the actual worth of neutron radiography took place with a CF-18 Hornet aircraft being neutron and X-radiographed at McClellan Air Force Base, Sacramento, CA. This inspection was followed by one of the rudders that had indications of water ingress being radiographed successfully at RMC just after the NBT became functional. The next step was to develop a neutron radioscopy system (NRS), initially employing film and then digital imaging, and is in use today for all flight control surfaces (FCS). With the third author, a technique capable of removing water from affected FCS was developed at RMC. Heating equipment and a vacuum system were utilized to carefully remove the water. This technique was proven using a sequence of near real time neutron images obtained during the drying process. The results of the drying process were correlated with a relative humidity

Catalytic wet oxidation of phenol in a trickle bed reactor over a Pt/TiO2 catalyst.

PubMed

Maugans, Clayton B; Akgerman, Aydin

2003-01-01

Catalytic wet oxidation of phenol was studied in a batch and a trickle bed reactor using 4.45% Pt/TiO2 catalyst in the temperature range 150-205 degrees C. Kinetic data were obtained from batch reactor studies and used to model the reaction kinetics for phenol disappearance and for total organic carbon disappearance. Trickle bed experiments were then performed to generate data from a heterogeneous flow reactor. Catalyst deactivation was observed in the trickle bed reactor, although the exact cause was not determined. Deactivation was observed to linearly increase with the cumulative amount of phenol that had passed over the catalyst bed. Trickle bed reactor modeling was performed using a three-phase heterogeneous model. Model parameters were determined from literature correlations, batch derived kinetic data, and trickle bed derived catalyst deactivation data. The model equations were solved using orthogonal collocations on finite elements. Trickle bed performance was successfully predicted using the batch derived kinetic model and the three-phase reactor model. Thus, using the kinetics determined from limited data in the batch mode, it is possible to predict continuous flow multiphase reactor performance.

Manufacturing demonstration of microbially mediated zinc sulfide nanoparticles in pilot-plant scale reactors

DOE PAGES

Moon, Ji-Won; Phelps, Tommy J.; Fitzgerald Jr, Curtis L.; ...

2016-04-27

The thermophilic anaerobic metal-reducing bacterium Thermoanaerobacter sp. X513 efficiently produces zinc sulfide (ZnS) nanoparticles (NPs) in laboratory-scale ( ≤24-L) reactors. To determine whether this process can be up-scaled and adapted for pilot-plant production while maintaining NP yield and quality, a series of meso-scale experiments were performed using 100-l and 900-l reactors. Pasteurization and N 2-sparging replaced autoclaving and boiling for deoxygenating media in the transition from small-scale to pilot-plant reactors. Consecutive 100-L batches using new or recycled media produced ZnS NPs with highly reproducible ~2 nm average crystallite size (ACS) and yields of ~0.5g L -1, similar to small-scale batches.more » The 900-L pilot plant reactor produced ~ 320 g ZnS without process optimization or replacement of used medium; this quantity would be sufficient to form a ZnS thin film with ~120 nm thickness over 0.5 m width 13 km length. At all scales, the bacteria produced significant amounts of acetic, lactic and formic acids, which could be neutralized by the controlled addition of sodium hydroxide without the use of an organic pH buffer, eliminating 98% of the buffer chemical costs. In conclusion, the final NP products were characterized using XRD, ICP-OES, FTIR, DLS, and C/N analyses, which confirmed the growth medium without organic buffer enhanced the ZnS NP properties by reducing carbon and nitrogen surface coatings and supporting better dispersivity with similar ACS.« less

Manufacturing demonstration of microbially mediated zinc sulfide nanoparticles in pilot-plant scale reactors.

PubMed

Moon, Ji-Won; Phelps, Tommy J; Fitzgerald, Curtis L; Lind, Randall F; Elkins, James G; Jang, Gyoung Gug; Joshi, Pooran C; Kidder, Michelle; Armstrong, Beth L; Watkins, Thomas R; Ivanov, Ilia N; Graham, David E

2016-09-01

The thermophilic anaerobic metal-reducing bacterium Thermoanaerobacter sp. X513 efficiently produces zinc sulfide (ZnS) nanoparticles (NPs) in laboratory-scale (≤ 24-L) reactors. To determine whether this process can be up-scaled and adapted for pilot-plant production while maintaining NP yield and quality, a series of pilot-plant scale experiments were performed using 100-L and 900-L reactors. Pasteurization and N2-sparging replaced autoclaving and boiling for deoxygenating media in the transition from small-scale to pilot plant reactors. Consecutive 100-L batches using new or recycled media produced ZnS NPs with highly reproducible ~2-nm average crystallite size (ACS) and yields of ~0.5 g L(-1), similar to the small-scale batches. The 900-L pilot plant reactor produced ~320 g ZnS without process optimization or replacement of used medium; this quantity would be sufficient to form a ZnS thin film with ~120 nm thickness over 0.5 m width × 13 km length. At all scales, the bacteria produced significant amounts of acetic, lactic, and formic acids, which could be neutralized by the controlled addition of sodium hydroxide without the use of an organic pH buffer, eliminating 98 % of the buffer chemical costs. The final NP products were characterized using XRD, ICP-OES, TEM, FTIR, PL, DLS, HPLC, and C/N analyses, which confirmed that the growth medium without organic buffer enhanced the ZnS NP properties by reducing carbon and nitrogen surface coatings and supporting better dispersivity with similar ACS.

DESIGN AND HAZARDS SUMMARY REPORT, BOILING REACTOR EXPERIMENT V (BORAX V)

DOE Office of Scientific and Technical Information (OSTI.GOV)

None

1961-05-01

Design data for BORAX V are presented along with results of hazards evaluation studies. Considcration of the hazards associated with the operation of BORAX V was based on the following conditions: For normal steady-state power and experimental operation, the reactor and plant are adequately shielded and ventilated to allow personnel to be safely stationed in the turbine building and on the main floor of the reactor building. The control building is located one- half mile distant from the reactor building. For special, hazardous experiments, personnel are withdrawn from the reactor area. (M.C.G.)

QED contributions to electron g-2

NASA Astrophysics Data System (ADS)

Laporta, Stefano

2018-05-01

In this paper I briefly describe the results of the numerical evaluation of the mass-independent 4-loop contribution to the electron g-2 in QED with 1100 digits of precision. In particular I also show the semi-analytical fit to the numerical value, which contains harmonic polylogarithms of eiπ/3, e2iπ/3 and eiπ/2 one-dimensional integrals of products of complete elliptic integrals and six finite parts of master integrals, evaluated up to 4800 digits. I give also some information about the methods and the program used.

Continuous hydrogen production from co-digestion of municipal food waste and kitchen wastewater in mesophilic anaerobic baffled reactor.

PubMed

Tawfik, A; El-Qelish, M

2012-06-01

This study was carried out to assess the impact of organic loading rate (OLR) on the performance of mesophilic anaerobic baffled reactor (ABR) for H(2) production from a co-digestion of municipal food waste and kitchen wastewater. The reactor was operated at different organic loading rates (OLRs) of 29, 36 and 47 g COD(total)/Ld. The hydraulic retention time (HRT) was kept constant at 1.6d. The results showed that increasing the OLR from 29 to 36 g COD(total)/Ld, leads to a significant (p □ 0.01) drop in the H(2) production from 6.0±0.5 to 5.4±1.04 L H(2)/d, respectively. However, the H(2) production remained at the same level of 5.3±1.04 L H(2)/d at increasing the OLR from 36 to 47 g COD(total)/Ld. The H(2) generation was mainly due to conversion of COD (57%) and carbohydrate (81%). Protein and lipids conversion represents only 23.3% and 4.1% respectively for H(2) production. Copyright © 2012 Elsevier Ltd. All rights reserved.

Study of Electro-Cyclonic Filtration and Pneumatic Transfer of Lunar Regolith Simulants under 1/6-g and 1-g Gravity Conditions

NASA Technical Reports Server (NTRS)

Mantovani, James G.; Townsend, Ivan I.; Mueller, Robert P.

2009-01-01

NASA has built a prototype oxygen production plant to process the lunar regolith using the hydrogen reduction chemical process. This plant is known as "ROxygen - making oxygen from moon rocks". The ROxygen regolith transfer team has identified the flow and transfer characteristics of lunar regolith simulant to be a concern for lunar oxygen production efforts. It is important to ISRU lunar exploration efforts to develop hardware designs that can demonstrate the ability to flow and transfer a given mass of regolith simulant to a desired vertical height under lunar gravity conditions in order to introduce it into a reactor. We will present results obtained under both 1/6-g and 1-g gravity conditions for a system that can pneumatically convey 16.5 kg of lunar regolith simulant (NU-LHT-2M, Mauna Kea Tephra, and JSC-1A) from a flat-bottom supply hopper to a simulated ISRU reactor (dual-chambered receiving hopper) where the granular material is separated from the convey gas (air) using a series of cyclone separators, one of which is an electrically enhanced cyclone separator (electrocyclone). The results of our study include (1) the mass flow rate as a function of input air pressure for lunar regolith simulants that are conveyed pneumatically as a dusty gas in a vertical direction against gravity under lunar gravity conditions (for NU-LHT-2M and Mauna Kea Tephra), and under earth gravity conditions (for NU-LHT-2M, Mauna Kea Tephra and JSC-1A), and (2) the efficiency of the cyclone/electrocyclone filtration system in separating the convey gas (air) from the granular particulates as a function of particle size.

Association of MMP-1 -1607 1G/2G (rs1799750) polymorphism with primary knee osteoarthritis in the Greek population.

PubMed

Lepetsos, Panagiotis; Pampanos, Andreas; Kanavakis, Emmanouil; Tzetis, Maria; Korres, Dimitrios; Papavassiliou, Athanasios G; Efstathopoulos, Nicolaos

2014-09-01

Osteoarthritis is the most common form of arthritis with still unknown pathogenic etiology and considerable contribution of genetic factors. One of the mechanisms of cartilage degradation in osteoarthritis is enzymatic proteolysis of the extracellular matrix by metalloproteinases. MMP-1, produced by chondrocytes and synovial cells, is a major proteinase of the MMPs family. The present study aims at evaluating the association of MMP1 gene -1607 1G/2G (rs1799750) polymorphism with primary knee osteoarthritis in the Greek population. One hundred fifty five patients with primary symptomatic knee osteoarthritis participated in the study along with 139 controls. Genotypes were determined using PCR-RLFP technique. Allelic and genotypic frequencies were compared between both study groups. There was no significant association between MMP1 -1607 1G/2G polymorphism and knee osteoarthritis, in crude analysis; however, after multiple logistic regression analysis, 1G/2G was associated with reduced odds of knee osteoarthritis by 75% in males, compared to genotypes 1G/1G + 2G/2G, adjusting for age and BMI (adjusted OR: 0.25, 95% CI: 0.069, 0.910, p = 0.035). The present study shows that MMP1 -1607 1G/2G (rs1799750) polymorphism might be a risk factor for knee osteoarthritis susceptibility in the Greek population. Further investigations are needed to confirm this association in the pathogenesis of osteoarthritis. © 2014 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

Energetic Particle Observations from Fengyun-2G Satellite

NASA Astrophysics Data System (ADS)

Wang, C.

2017-12-01

Observations of high energy electrons and protons with High Energy Particle Instrument(HEPI) carried on the Fengyun-2G( FY-2G )satellite are presented. The instrument consists of two sets detectors- high energy electrons detector which can measure 200keV to greater than 4MeV electrons with eleven channels, and high energy protons and heavy ions detector which mainly senses incident flux of solar protons with seven channels from 4MeV to 300 MeV. The observation results showed both of the detectors can reach an accurate response to various disturbances and can provide refined particles data. Comparison of particles dynamic observations of FY2G satellite with GOES series satellites appears that energetic particle fluxes can enter into a coherent level on some quasi-quiet conditions, great difference occur on disturbances times, which can be helpful for data assimilation of multi-satellite as well as further research in more complicated magnetosphere energy particle dynamics.

Robust G2 pausing of adult stem cells in Hydra.

PubMed

Buzgariu, Wanda; Crescenzi, Marco; Galliot, Brigitte

2014-01-01

Hydra is a freshwater hydrozoan polyp that constantly renews its two tissue layers thanks to three distinct stem cell populations that cannot replace each other, epithelial ectodermal, epithelial endodermal, and multipotent interstitial. These adult stem cells, located in the central body column, exhibit different cycling paces, slow for the epithelial, fast for the interstitial. To monitor the changes in cell cycling in Hydra, we established a fast and efficient flow cytometry procedure, which we validated by confirming previous findings, as the Nocodazole-induced reversible arrest of cell cycling in G2/M, and the mitogenic signal provided by feeding. Then to dissect the cycling and differentiation behaviors of the interstitial stem cells, we used the AEP_cnnos1 and AEP_Icy1 transgenic lines that constitutively express GFP in this lineage. For the epithelial lineages we used the sf-1 strain that rapidly eliminates the fast cycling cells upon heat-shock and progressively becomes epithelial. This study evidences similar cycling patterns for the interstitial and epithelial stem cells, which all alternate between the G2 and S-phases traversing a minimal G1-phase. We also found interstitial progenitors with a shorter G2 that pause in G1/G0. At the animal extremities, most cells no longer cycle, the epithelial cells terminally differentiate in G2 and the interstitial progenitors in G1/G0. At the apical pole ~80% cells are post-mitotic differentiated cells, reflecting the higher density of neurons and nematocytes in this region. We discuss how the robust G2 pausing of stem cells, maintained over weeks of starvation, may contribute to regeneration. Copyright © 2014 International Society of Differentiation. Published by Elsevier B.V. All rights reserved.

Effect of organic loading rate on dark fermentative hydrogen production in the continuous stirred tank reactor and continuous mixed immobilized sludge reactor from waste pastry hydrolysate.

PubMed

Han, Wei; Hu, Yunyi; Li, Shiyi; Nie, Qiulin; Zhao, Hongting; Tang, Junhong

2016-12-01

Waste pastry (6%, w/v) was hydrolyzed by the produced glucoamylase and protease to obtain the glucose (19.8g/L) and free amino nitrogen (179mg/L) solution. Then, the effect of organic loading rate (OLR) (8-40kgCOD/(m 3 d)) on dark fermentative hydrogen production in the continuous stirred tank reactor (CSTR) and continuous mixed immobilized sludge reactor (CMISR) from waste pastry hydrolysate was investigated and compared. The maximum hydrogen production rate of CSTR (277.76mL/(hL)) and CMISR (320.2mL/(hL)) were achieved at OLR of 24kgCOD/(m 3 d) and 32kgCOD/(m 3 d), respectively. Carbon recovery ranged from 75.2-84.1% in the CSTR and CMISR with the balance assumed to be converted to biomass. One gram waste pastry could produce 0.33g (1.83mmol) glucose which could be further converted to 79.24mL (3.54mmol) hydrogen in the CMISR or 91.66mL (4.09mmol) hydrogen in the CSTR. This is the first study which reports dark fermentative hydrogen production from waste pastry. Copyright © 2016 Elsevier Ltd. All rights reserved.

Media arrangement impacts cell growth in anaerobic fixed-bed reactors treating sugarcane vinasse: Structured vs. randomic biomass immobilization.

PubMed

de Aquino, Samuel; Fuess, Lucas Tadeu; Pires, Eduardo Cleto

2017-07-01

This study reports on the application of an innovative structured-bed reactor (FVR) as an alternative to conventional packed-bed reactors (PBRs) to treat high-strength solid-rich wastewaters. Using the FVR prevents solids from accumulating within the fixed-bed, while maintaining the advantages of the biomass immobilization. The long-term operation (330days) of a FVR and a PBR applied to sugarcane vinasse under increasing organic loads (2.4-18.0kgCODm -3 day -1 ) was assessed, focusing on the impacts of the different media arrangements over the production and retention of biomass. Much higher organic matter degradation rates, as well as long-term operational stability and high conversion efficiencies (>80%) confirmed that the FVR performed better than the PBR. Despite the equivalent operating conditions, the biomass growth yield was different in both reactors, i.e., 0.095gVSSg -1 COD (FVR) and 0.066gVSSg -1 COD (PBR), indicating a clear control of the media arrangement over the biomass production in fixed-bed reactors. Copyright © 2017 Elsevier Ltd. All rights reserved.

26 CFR 1.402(g)-2 - Increased limit for catch-up contributions.

Code of Federal Regulations, 2012 CFR

2012-04-01

...(g)-2 Section 1.402(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY.... § 1.402(g)-2 Increased limit for catch-up contributions. (a) General rule. Under section 402(g)(1)(C...(g) for a catch-up eligible participant (within the meaning of § 1.414(v)-1(g)), the otherwise...

26 CFR 1.402(g)-2 - Increased limit for catch-up contributions.

Code of Federal Regulations, 2013 CFR

2013-04-01

....402(g)-2 Section 1.402(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY.... § 1.402(g)-2 Increased limit for catch-up contributions. (a) General rule. Under section 402(g)(1)(C...(g) for a catch-up eligible participant (within the meaning of § 1.414(v)-1(g)), the otherwise...

26 CFR 1.402(g)-2 - Increased limit for catch-up contributions.

Code of Federal Regulations, 2011 CFR

2011-04-01

....402(g)-2 Section 1.402(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY.... § 1.402(g)-2 Increased limit for catch-up contributions. (a) General rule. Under section 402(g)(1)(C...(g) for a catch-up eligible participant (within the meaning of § 1.414(v)-1(g)), the otherwise...

26 CFR 1.402(g)-2 - Increased limit for catch-up contributions.

Code of Federal Regulations, 2014 CFR

2014-04-01

....402(g)-2 Section 1.402(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY.... § 1.402(g)-2 Increased limit for catch-up contributions. (a) General rule. Under section 402(g)(1)(C...(g) for a catch-up eligible participant (within the meaning of § 1.414(v)-1(g)), the otherwise...

Background radiation measurements at high power research reactors

NASA Astrophysics Data System (ADS)

Ashenfelter, J.; Balantekin, B.; Baldenegro, C. X.; Band, H. R.; Barclay, G.; Bass, C. D.; Berish, D.; Bowden, N. S.; Bryan, C. D.; Cherwinka, J. J.; Chu, R.; Classen, T.; Davee, D.; Dean, D.; Deichert, G.; Dolinski, M. J.; Dolph, J.; Dwyer, D. A.; Fan, S.; Gaison, J. K.; Galindo-Uribarri, A.; Gilje, K.; Glenn, A.; Green, M.; Han, K.; Hans, S.; Heeger, K. M.; Heffron, B.; Jaffe, D. E.; Kettell, S.; Langford, T. J.; Littlejohn, B. R.; Martinez, D.; McKeown, R. D.; Morrell, S.; Mueller, P. E.; Mumm, H. P.; Napolitano, J.; Norcini, D.; Pushin, D.; Romero, E.; Rosero, R.; Saldana, L.; Seilhan, B. S.; Sharma, R.; Stemen, N. T.; Surukuchi, P. T.; Thompson, S. J.; Varner, R. L.; Wang, W.; Watson, S. M.; White, B.; White, C.; Wilhelmi, J.; Williams, C.; Wise, T.; Yao, H.; Yeh, M.; Yen, Y.-R.; Zhang, C.; Zhang, X.; Prospect Collaboration

2016-01-01

Research reactors host a wide range of activities that make use of the intense neutron fluxes generated at these facilities. Recent interest in performing measurements with relatively low event rates, e.g. reactor antineutrino detection, at these facilities necessitates a detailed understanding of background radiation fields. Both reactor-correlated and naturally occurring background sources are potentially important, even at levels well below those of importance for typical activities. Here we describe a comprehensive series of background assessments at three high-power research reactors, including γ-ray, neutron, and muon measurements. For each facility we describe the characteristics and identify the sources of the background fields encountered. The general understanding gained of background production mechanisms and their relationship to facility features will prove valuable for the planning of any sensitive measurement conducted therein.

CO2 Reduction Assembly Prototype Using Microlith-Based Sabatier Reactor for Ground Demonstration

NASA Technical Reports Server (NTRS)

Junaedi, Christian; Hawley, Kyle; Walsh, Dennis; Roychoudhury, Subir; Abney, Morgan B.; Perry, Jay L.

2014-01-01

The utilization of CO2 to produce life support consumables, such as O2 and H2O, via the Sabatier reaction is an important aspect of NASA's cabin Atmosphere Revitalization System (ARS) and In-Situ Resource Utilization (ISRU) architectures for both low-earth orbit and long-term manned space missions. Carbon dioxide can be reacted with H2, obtained from the electrolysis of water, via Sabatier reaction to produce methane and H2O. Methane can be stored and utilized as propellant while H2O can be either stored or electrolyzed to produce oxygen and regain the hydrogen atoms. Depending on the application, O2 can be used to replenish the atmosphere in human-crewed missions or as an oxidant for robotic and return missions. Precision Combustion, Inc. (PCI), with support from NASA, has previously developed an efficient and compact Sabatier reactor based on its Microlith® catalytic technology and demonstrated the capability to achieve high CO2 conversion and CH4 selectivity (i.e., =90% of the thermodynamic equilibrium values) at high space velocities and low operating temperatures. This was made possible through the use of high-heat-transfer and high-surface-area Microlith catalytic substrates. Using this Sabatier reactor, PCI designed, developed, and demonstrated a stand-alone CO2 Reduction Assembly (CRA) test system for ground demonstration and performance validation. The Sabatier reactor was integrated with the necessary balance-of-plant components and controls system, allowing an automated, single "push-button" start-up and shutdown. Additionally, the versatility of the test system prototype was demonstrated by operating it under H2-rich (H2/CO2 of >4), stoichiometric (ratio of 4), and CO2-rich conditions (ratio of <4) without affecting its performance and meeting the equilibrium-predicted water recovery rates. In this paper, the development of the CRA test system for ground demonstration will be discussed. Additionally, the performance results from testing the system at

Biodegradation of tech-hexachlorocyclohexane in a upflow anaerobic sludge blanket (UASB) reactor.

PubMed

Bhat, Praveena; Kumar, M Suresh; Mudliar, Sandeep N; Chakrabarti, T

2006-04-01

Biodegradability of technical grade hexachlorocyclohexane (tech-HCH) was studied in an upflow anaerobic sludge blanket reactor (UASB) under continuous mode of operation in concentration range of 100-200 mg/l and constant HRT of 48 h. At steady state operation more than 85% removal of tech-HCH (upto 175 mg/l concentration) and complete disappearance of beta-HCH was observed. Kinetic constants in terms of maximum specific tech-HCH utilization rate (k) and half saturation velocity constant (K(L)) were found to be 11.88 mg/g/day and 8.11 mg/g/day, respectively. The tech-HCH degrading seed preparation, UASB reactor startup and degradation in continuous mode of operation of the reactor is presented in this paper.

Expression of CAR in SW480 and HepG2 cells during G1 is associated with cell proliferation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Osabe, Makoto; Sugatani, Junko; Global COE Program, School of Pharmaceutical Sciences, University of Shizuoka, Shizuoka

Constitutive androstane receptor (CAR) is a transcription factor to regulate the expression of several genes related to drug-metabolism. Here, we demonstrate that CAR protein accumulates during G1 in human SW480 and HepG2 cells. After the G1/S phase transition, CAR protein levels decreased, and CAR was hardly detected in cells by the late M phase. CAR expression in both cell lines was suppressed by RNA interference-mediated suppression of CDK4. Depletion of CAR by RNA interference in both cells and by hepatocyte growth factor treatment in HepG2 cells resulted in decreased MDM2 expression that led to p21 upregulation and repression of HepG2more » cell growth. Thus, our results demonstrate that CAR expression is an early G1 event regulated by CDK4 that contributes to MDM2 expression; these findings suggest that CAR may influence the expression of genes involved in not only the metabolism of endogenous and exogenous substances but also in the cell proliferation.« less

Immunization with a Vaccine Combining Herpes Simplex Virus 2 (HSV-2) Glycoprotein C (gC) and gD Subunits Improves the Protection of Dorsal Root Ganglia in Mice and Reduces the Frequency of Recurrent Vaginal Shedding of HSV-2 DNA in Guinea Pigs Compared to Immunization with gD Alone ▿

PubMed Central

Awasthi, Sita; Lubinski, John M.; Shaw, Carolyn E.; Barrett, Shana M.; Cai, Michael; Wang, Fushan; Betts, Michael; Kingsley, Susan; DiStefano, Daniel J.; Balliet, John W.; Flynn, Jessica A.; Casimiro, Danilo R.; Bryan, Janine T.; Friedman, Harvey M.

2011-01-01

Attempts to develop a vaccine to prevent genital herpes simplex virus 2 (HSV-2) disease have been only marginally successful, suggesting that novel strategies are needed. Immunization with HSV-2 glycoprotein C (gC-2) and gD-2 was evaluated in mice and guinea pigs to determine whether adding gC-2 to a gD-2 subunit vaccine would improve protection by producing antibodies that block gC-2 immune evasion from complement. Antibodies produced by gC-2 immunization blocked the interaction between gC-2 and complement C3b, and passive transfer of gC-2 antibody protected complement-intact mice but not C3 knockout mice against HSV-2 challenge, indicating that gC-2 antibody is effective, at least in part, because it prevents HSV-2 evasion from complement. Immunization with gC-2 also produced neutralizing antibodies that were active in the absence of complement; however, the neutralizing titers were higher when complement was present, with the highest titers in animals immunized with both antigens. Animals immunized with the gC-2-plus-gD-2 combination had robust CD4+ T-cell responses to each immunogen. Multiple disease parameters were evaluated in mice and guinea pigs immunized with gC-2 alone, gD-2 alone, or both antigens. In general, gD-2 outperformed gC-2; however, the gC-2-plus-gD-2 combination outperformed gD-2 alone, particularly in protecting dorsal root ganglia in mice and reducing recurrent vaginal shedding of HSV-2 DNA in guinea pigs. Therefore, the gC-2 subunit antigen enhances a gD-2 subunit vaccine by stimulating a CD4+ T-cell response, by producing neutralizing antibodies that are effective in the absence and presence of complement, and by blocking immune evasion domains that inhibit complement activation. PMID:21813597

[Identification of rotavirus associated to serotype G2 in Yucatan, Mexico].

PubMed

Gonzales-Loza, M del R; Polanco-Marín, G G; Puerto-Solis, M

2000-01-01

In the present study, rotavirus G2 serotype was identified from fecal samples of children with gastroenteritis from the city of Merida, Yucatan, Mexico. Virological diagnosis of disease was performed using polycrylamide gel electrophoresis and immunoenzymatic assay. Out of 149 analyzed samples 25 (16.7%) gave positive reaction to rotavirus groups A, of these 23 (92%) were identified as serotype g2, subgroup i and electrophoretic short pattern, whereas 2 (8%) were identified as subgroups II and electrophoretic long pattern, however, the G serotype was not possible to determine. Rotavirus G serotype has not been detected in more than 90% of samples since 1985. This indicates that the number of people susceptible to G2 serotype within the population has increased over recent years, which perhaps indicates that an important outbreak of acute infectious diarrhea caused by the rotavirus G2 serotype may be forthcoming.

Determination of O2(a1 delta g) and O2(b1 sigma+ g) yields in the reaction O + ClO --> Cl + O2: implications for photochemistry in the atmosphere of Venus

NASA Technical Reports Server (NTRS)

Leu, M. T.; Yung, Y. L.

1987-01-01

A discharge flow apparatus with chemiluminescence detector has been used to study the reaction O + ClO --> Cl + O2, where O2 = O2(a1 delta g) or O2(b1 sigma+ g). The measured quantum yields for producing O2(a1 delta g) and O2(b1 sigma+ g) in the above reaction are less than 2.5 x 10(-2) and equal to (4.4 +/- 1.1) x 10(-4), respectively. The observed O2(a1 delta g) airglow of Venus cannot be explained in the context of standard photochemistry using our experimental results and those reported in recent literature. The possibility of an alternative source of O atoms derived from SO2 photolysis in the mesosphere of Venus is suggested.

System Administration Support/SWORDS G2

NASA Technical Reports Server (NTRS)

Dito, Scott Joseph

2014-01-01

The Soldier-Warfighter Operationally Responsive Deployer for Space (SWORDS) rocket is a dedicated small satellite launcher that will minimize danger and complexity in order to allow soldiers in the field to put payloads of up to 25kg into orbit from the field. The SWORDSG2 project is the development of a model, simulation, and ultimately a working application that will control and monitor the cryogenic fluid delivery to the SWORDS rocket for testing purposes. To accomplish this, the project is using the programming language environment Gensym G2. The environment is an all-inclusive application that allows development, testing, modeling, and finally operation of the unique application through graphical and programmatic methods. In addition, observation of the current cryogenic fluid delivery system in the Kennedy Space Center Cry Lab has allowed me to gain valuable experience of fluid systems and propelant delivery that is valuable to our team when developing amd modeling our own system.The ultimate goal of having a test-ready application to show to the heads of the project, and demonstrating G2's capabilities, by late 2014 will require hard work and intense study and understanding of not only the programming aspect but also the physical phenomena we want to model, observe, and control.

Remediation of 1,2,3-trichlorobenzene contaminated soil using a combined thermal desorption-molten salt oxidation reactor system.

PubMed

Li, Jin-hui; Sun, Xiao-fei; Yao, Zhi-tong; Zhao, Xiang-yang

2014-02-01

A combined thermal desorption (TD)-molten salt oxidation (MSO) reactor system was applied to remediate the 1,2,3-trichlorobenzene (1,2,3-TCB) contaminated soil. The TD reactor was used to enrich the contaminant from soil, and its dechlorination of the contaminant was achieved in the MSO reactor. The optimum operating conditions of TD, and the effects of MSO reactor temperatures, additive amounts of the TCB on destruction and removal efficiency (DRE) of TCB and chlorine retention efficiency (CRE) were investigated. The reaction mechanism and pathway were proposed as well. The combined system could remediate the contaminated soil at a large scale of concentration from 5 to 25gkg(-1), and the DRE and CRE reached more than 99% and 95%, respectively, at temperatures above 850°C. The reaction emissions included C6H6, CH4, CO and CO2, and chlorinated species were not detected. It was found that a little increase in the temperature can considerably reduce the emission of C6H6, CH4, and CO, while the CO2 level increased. Copyright © 2014. Published by Elsevier Ltd.

Effects of 2G and 3G mobile phones on performance and electrophysiology in adolescents, young adults and older adults.

PubMed

Leung, S; Croft, R J; McKenzie, R J; Iskra, S; Silber, B; Cooper, N R; O'Neill, B; Cropley, V; Diaz-Trujillo, A; Hamblin, D; Simpson, D

2011-11-01

This study examined sensory and cognitive processing in adolescents, young adults and older adults, when exposed to 2nd (2G) and 3rd (3G) generation mobile phone signals. Tests employed were the auditory 3-stimulus oddball and the N-back. Forty-one 13-15 year olds, forty-two 19-40 year olds and twenty 55-70 year olds were tested using a double-blind cross-over design, where each participant received Sham, 2G and 3G exposures, separated by at least 4 days. 3-Stimulus oddball task: Behavioural: accuracy and reaction time of responses to targets were not affected by exposure. Electrophysiological: augmented N1 was found in the 2G condition (independent of age group). N-back task: Behavioural: the combined groups performed less accurately during the 3G exposure (compared to Sham), with post hoc tests finding this effect separately in the adolescents only. Electrophysiological: delayed ERD/ERS responses of the alpha power were found in both 3G and 2G conditions (compared to Sham; independent of age group). Employing tasks tailored to each individual's ability level, this study provides support for an effect of acute 2G and 3G exposure on human cognitive function. The subtlety of mobile phone effect on cognition in our study suggests that it is important to account for individual differences in future mobile phone research. Copyright © 2011 International Federation of Clinical Neurophysiology. All rights reserved.

Control system for a small fission reactor

DOEpatents

Burelbach, James P.; Kann, William J.; Saiveau, James G.

1986-01-01

A system for controlling the reactivity of a small fission reactor includes an elongated, flexible hollow tube in the general form of a helical coiled spring axially positioned around and outside of the reactor vessel in an annular space between the reactor vessel and a surrounding cylindrical-shaped neutron reflector. A neutron absorbing material is provided within the hollow tube with the rate of the reaction controlled by the extension and compression of the hollow tube, e.g., extension of the tube increases reactivity while its compression reduces reactivity, in varying the amount of neutron absorbing material disposed between the reactor vessel and the neutron reflector. Conventional mechanical displacement means may be employed to control the coil density of the hollow tube as desired. In another embodiment, a plurality of flexible hollow tubes each containing a neutron absorber are positioned adjacent to one another in spaced relation around the periphery of the reactor vessel and inside the outer neutron reflector with reactivity controlled by the extension and compression of all or some of the coiled hollow tubes. Yet another embodiment of the invention envisions the neutron reflector in the form of an expandable coil spring positioned in an annular space between the reactor vessel and an outer neutron absorbing structure for controlling the neutron flux reflected back into the reactor vessel.

The extraction of the spin structure function, g2 (and g1) at low Bjorken x

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ndukum, Luwani Z.

2015-08-01

The Spin Asymmetries of the Nucleon Experiment (SANE) used the Continuous Electron Beam Accelerator Facility at Jefferson Laboratory in Newport News, VA to investigate the spin structure of the proton. The experiment measured inclusive double polarization electron asymmetries using a polarized electron beam, scattered off a solid polarized ammonia target with target polarization aligned longitudinal and near transverse to the electron beam, allowing the extraction of the spin asymmetries A1 and A2, and spin structure functions g1 and g2. Polarized electrons of energies of 4.7 and 5.9 GeV were used. The scattered electrons were detected by a novel, non-magnetic arraymore » of detectors observing a four-momentum transfer range of 2.5 to 6.5 GeV*V. This document addresses the extraction of the spin asymmetries and spin structure functions, with a focus on spin structure function, g2 (and g1) at low Bjorken x. The spin structure functions were measured as a function of x and W in four Q square bins. A full understanding of the low x region is necessary to get clean results for SANE and extend our understanding of the kinematic region at low x.« less

Visible-Light-Responsive Photocatalysis: Ag-Doped TiO2 Catalyst Development and Reactor Design Testing

NASA Technical Reports Server (NTRS)

Coutts, Janelle L.; Hintze, Paul E.; Meier, Anne; Shah, Malay G.; Devor, Robert W.; Surma, Jan M.; Maloney, Phillip R.; Bauer, Brint M.; Mazyck, David W.

2016-01-01

In recent years, the alteration of titanium dioxide to become visible-light-responsive (VLR) has been a major focus in the field of photocatalysis. Currently, bare titanium dioxide requires ultraviolet light for activation due to its band gap energy of 3.2 eV. Hg-vapor fluorescent light sources are used in photocatalytic oxidation (PCO) reactors to provide adequate levels of ultraviolet light for catalyst activation; these mercury-containing lamps, however, hinder the use of this PCO technology in a spaceflight environment due to concerns over crew Hg exposure. VLR-TiO2 would allow for use of ambient visible solar radiation or highly efficient visible wavelength LEDs, both of which would make PCO approaches more efficient, flexible, economical, and safe. Over the past three years, Kennedy Space Center has developed a VLR Ag-doped TiO2 catalyst with a band gap of 2.72 eV and promising photocatalytic activity. Catalyst immobilization techniques, including incorporation of the catalyst into a sorbent material, were examined. Extensive modeling of a reactor test bed mimicking air duct work with throughput similar to that seen on the International Space Station was completed to determine optimal reactor design. A bench-scale reactor with the novel catalyst and high-efficiency blue LEDs was challenged with several common volatile organic compounds (VOCs) found in ISS cabin air to evaluate the system's ability to perform high-throughput trace contaminant removal. The ultimate goal for this testing was to determine if the unit would be useful in pre-heat exchanger operations to lessen condensed VOCs in recovered water thus lowering the burden of VOC removal for water purification systems.

The Muon $g$-$2$ Experiment at Fermilab

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gohn, Wesley

A new measurement of the anomalous magnetic moment of the muon,more » $$a_{\\mu} \\equiv (g-2)/2$$, will be performed at the Fermi National Accelerator Laboratory with data taking beginning in 2017. The most recent measurement, performed at Brookhaven National Laboratory (BNL) and completed in 2001, shows a 3.5 standard deviation discrepancy with the standard model value of $$a_\\mu$$. The new measurement will accumulate 21 times the BNL statistics using upgraded magnet, detector, and storage ring systems, enabling a measurement of $$a_\\mu$$ to 140 ppb, a factor of 4 improvement in the uncertainty the previous measurement. This improvement in precision, combined with recent improvements in our understanding of the QCD contributions to the muon $g$-$2$, could provide a discrepancy from the standard model greater than 7$$\\sigma$$ if the central value is the same as that measured by the BNL experiment, which would be a clear indication of new physics.« less

Zeatin is indispensable for the G2-M transition in tobacco BY-2 cells.

PubMed

Laureys, F; Dewitte, W; Witters, E; Van Montagu, M; Inzé, D; Van Onckelen, H

1998-04-10

The importance of N6-isoprenoid cytokinins in the G2-M transition of Nicotiana tabacum BY-2 cells was investigated. Both cytokinin biosynthesis and entry in mitosis were partially blocked by application at early or late G2 of lovastatin (10 microM), an inhibitor of mevalonic acid synthesis. LC-MS/MS quantification of endogenous cytokinins proved that lovastatin affects cytokinin biosynthesis by inhibiting HMG-CoA reductase. Out of eight different aminopurines and a synthetic auxin tested for their ability to override lovastatin inhibition of mitosis, only zeatin was active. Our data point to a key role for a well-defined cytokinin (here, zeatin) in the G2-M transition of tobacco BY-2 cells.

26 CFR 1.904(g)-2 - Recapture of overall domestic losses.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 26 Internal Revenue 9 2010-04-01 2010-04-01 false Recapture of overall domestic losses. 1.904(g)-2 Section 1.904(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES Income from Sources Without the United States § 1.904(g)-2 Recapture...

B2 and G2 Toda systems on compact surfaces: A variational approach

NASA Astrophysics Data System (ADS)

Battaglia, Luca

2017-01-01

We consider the B2 and G2 Toda systems on a compact surface (Σ, g), namely, systems of two Liouville-type PDEs coupled with a matrix of coefficients A = ( a i j ) = 2 - 1 - 2 2 ) or (2 - 1 - 3 2) . We attack the problem using variational techniques, following the previous work [Battaglia, L. et al., Adv. Math. 285, 937-979 (2015)] concerning the A2 Toda system, namely, the case A = 2 - 1 - 1 2 ) . We get the existence and multiplicity of solutions as long as χ(Σ) ≤ 0 and a generic choice of the parameters. We also extend some of the results to the case of general systems.

Do serum angiopoietin-1, angiopoietin-2, and their receptor Tie-2 and 4G/5G variant of PAI-1 gene have a role in the pathogenesis of preeclampsia?

PubMed

Kamal, Manal; El-Khayat, Waleed

2011-10-01

To evaluate whether serum angiogenesis markers such as angiopoietins (Ang-1, Ang-2) and their receptor (Tie-2) are altered in women with preeclampsia. We also performed genotyping to determine if the 4G/5G genotypes of -675 PAI-1 gene may play a role in the pathogenesis of preeclampsia. Sixty-eight pregnant women with preeclampsia were compared to 35 normotensive pregnant women and 24 normotensive nonpregnant women in a cross-sectional study. Using enzyme-linked immunosorbent assay, levels of serum Ang-1 and Ang-2, and Tie-2 were measured. A single base pair insertion/deletion 4G/5G polymorphism of the PAI-1 gene was determined by polymerase chain reaction. Serum levels of Ang-1 and Tie-2 were significantly different among the study groups (P = 0.001 and P = 0.025, respectively) being lower in the preeclamptic group. Positive significant correlation was found between Ang-2 and Tie-2, (r = 0.26, P = 0.024). The frequency of the genotypes (4G/5G, 4G/4G, and 5G/5G) differed among the groups (P = 0.001). Also, the mean of systolic and diastolic blood pressures differed significantly according to the PAI-1 genotype being higher in those bearing the 4G allele; P = 0.04 and P = 0.023, respectively. Sera Ang-1 and Ang-2, and Tie-2 as well as variants of 4G/5G of PAI-1 polymorphism have positive implications in the pathogenesis of preeclampsia.

Locating PHEV exchange stations in V2G

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pan, Feng; Bent, Russell; Berscheid, Alan

2010-01-01

Plug-in hybrid electric vehicle (PREV) is an environment friendly modem transportation method and has been rapidly penetrate the transportation system. Renewable energy is another contributor to clean power but the associated intermittence increases the uncertainty in power generation. As a foreseen benefit of a vchicle-to-grid (V2G) system, PREV supporting infrastructures like battery exchange stations can provide battery service to PREV customers as well as being plugged into a power grid as energy sources and stabilizer. The locations of exchange stations are important for these two objectives under constraints from both ,transportation system and power grid. To model this location problemmore » and to understand and analyze the benefit of a V2G system, we develop a two-stage stochastic program to optimally locate the stations prior to the realizations of battery demands, loads, and generation capacity of renewable power sources. Based on this model, we use two data sets to construct the V2G systems and test the benefit and the performance of these systems.« less

Potential energy and dipole moment surfaces of the triplet states of the O2(X3Σg-) - O2(X3Σg-,a1Δg,b1Σg+) complex

NASA Astrophysics Data System (ADS)

Karman, Tijs; van der Avoird, Ad; Groenenboom, Gerrit C.

2017-08-01

We compute four-dimensional diabatic potential energy surfaces and transition dipole moment surfaces of O2-O2, relevant for the theoretical description of collision-induced absorption in the forbidden X3Σg- → a1Δg and X3Σg- → b1Σg+ bands at 7883 cm-1 and 13 122 cm-1, respectively. We compute potentials at the multi-reference configuration interaction (MRCI) level and dipole surfaces at the MRCI and complete active space self-consistent field (CASSCF) levels of theory. Potentials and dipole surfaces are transformed to a diabatic basis using a recent multiple-property-based diabatization algorithm. We discuss the angular expansion of these surfaces, derive the symmetry constraints on the expansion coefficients, and present working equations for determining the expansion coefficients by numerical integration over the angles. We also present an interpolation scheme with exponential extrapolation to both short and large separations, which is used for representing the O2-O2 distance dependence of the angular expansion coefficients. For the triplet ground state of the complex, the potential energy surface is in reasonable agreement with previous calculations, whereas global excited state potentials are reported here for the first time. The transition dipole moment surfaces are strongly dependent on the level of theory at which they are calculated, as is also shown here by benchmark calculations at high symmetry geometries. Therefore, ab initio calculations of the collision-induced absorption spectra cannot become quantitatively predictive unless more accurate transition dipole surfaces can be computed. This is left as an open question for method development in electronic structure theory. The calculated potential energy and transition dipole moment surfaces are employed in quantum dynamical calculations of collision-induced absorption spectra reported in Paper II [T. Karman et al., J. Chem. Phys. 147, 084307 (2017)].

Potential energy and dipole moment surfaces of the triplet states of the O2(X3Σg-) - O2(X3Σg-,a1Δg,b1Σg+) complex.

PubMed

Karman, Tijs; van der Avoird, Ad; Groenenboom, Gerrit C

2017-08-28

We compute four-dimensional diabatic potential energy surfaces and transition dipole moment surfaces of O 2 -O 2 , relevant for the theoretical description of collision-induced absorption in the forbidden X 3 Σ g -  → a 1 Δ g and X 3 Σ g -  → b 1 Σ g + bands at 7883 cm -1 and 13 122 cm -1 , respectively. We compute potentials at the multi-reference configuration interaction (MRCI) level and dipole surfaces at the MRCI and complete active space self-consistent field (CASSCF) levels of theory. Potentials and dipole surfaces are transformed to a diabatic basis using a recent multiple-property-based diabatization algorithm. We discuss the angular expansion of these surfaces, derive the symmetry constraints on the expansion coefficients, and present working equations for determining the expansion coefficients by numerical integration over the angles. We also present an interpolation scheme with exponential extrapolation to both short and large separations, which is used for representing the O 2 -O 2 distance dependence of the angular expansion coefficients. For the triplet ground state of the complex, the potential energy surface is in reasonable agreement with previous calculations, whereas global excited state potentials are reported here for the first time. The transition dipole moment surfaces are strongly dependent on the level of theory at which they are calculated, as is also shown here by benchmark calculations at high symmetry geometries. Therefore, ab initio calculations of the collision-induced absorption spectra cannot become quantitatively predictive unless more accurate transition dipole surfaces can be computed. This is left as an open question for method development in electronic structure theory. The calculated potential energy and transition dipole moment surfaces are employed in quantum dynamical calculations of collision-induced absorption spectra reported in Paper II [T. Karman et al., J. Chem. Phys. 147, 084307 (2017)].

A New Synthetic Allotetraploid (A1A1G2G2) between Gossypium herbaceum and G. australe: Bridging for Simultaneously Transferring Favorable Genes from These Two Diploid Species into Upland Cotton

PubMed Central

Chen, Yu; Wang, Yingying; Chen, Jinjin; Zhang, Tianzhen; Zhou, Baoliang

2015-01-01

Gossypium herbaceum, a cultivated diploid cotton species (2n = 2x = 26, A1A1), has favorable traits such as excellent drought tolerance and resistance to sucking insects and leaf curl virus. G. australe, a wild diploid cotton species (2n = 2x = 26, G2G2), possesses numerous economically valuable characteristics such as delayed pigment gland morphogenesis (which is conducive to the production of seeds with very low levels of gossypol as a potential food source for humans and animals) and resistance to insects, wilt diseases and abiotic stress. Creating synthetic allotetraploid cotton from these two species would lay the foundation for simultaneously transferring favorable genes into cultivated tetraploid cotton. Here, we crossed G. herbaceum (as the maternal parent) with G. australe to produce an F1 interspecific hybrid and doubled its chromosome complement with colchicine, successfully generating a synthetic tetraploid. The obtained tetraploid was confirmed by morphology, cytology and molecular markers and then self-pollinated. The S1 seedlings derived from this tetraploid gradually became flavescent after emergence of the fifth true leaf, but they were rescued by grafting and produced S2 seeds. The rescued S1 plants were partially fertile due to the existence of univalents at Metaphase I of meiosis, leading to the formation of unbalanced, nonviable gametes lacking complete sets of chromosomes. The S2 plants grew well and no flavescence was observed, implying that interspecific incompatibility, to some extent, had been alleviated in the S2 generation. The synthetic allotetraploid will be quite useful for polyploidy evolutionary studies and as a bridge for transferring favorable genes from these two diploid species into Upland cotton through hybridization. PMID:25879660

International Research Reactor Decommissioning Project

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leopando, Leonardo; Warnecke, Ernst

2008-01-15

Many research reactors have been or will be shut down and are candidates for decommissioning. Most of the respective countries neither have a decommissioning policy nor the required expertise and funds to effectively implement a decommissioning project. The IAEA established the Research Reactor Decommissioning Demonstration Project (R{sup 2}D{sup 2}P) to help answer this need. It was agreed to involve the Philippine Research Reactor (PRR-1) as model reactor to demonstrate 'hands-on' experience as it is just starting the decommissioning process. Other facilities may be included in the project as they fit into the scope of R{sup 2}D{sup 2}P and complement tomore » the PRR-1 decommissioning activities. The key outcome of the R{sup 2}D{sup 2}P will be the decommissioning of the PRR-1 reactor. On the way to this final goal the preparation of safety related documents (i.e., decommissioning plan, environmental impact assessment, safety analysis report, health and safety plan, cost estimate, etc.) and the licensing process as well as the actual dismantling activities could provide a model to other countries involved in the project. It is expected that the R{sup 2}D{sup 2}P would initiate activities related to planning and funding of decommissioning activities in the participating countries if that has not yet been done.« less

ELECTRONUCLEAR REACTOR

DOEpatents

Lawrence, E.O.; McMillan, E.M.; Alvarez, L.W.

1960-04-19

An electronuclear reactor is described in which a very high-energy particle accelerator is employed with appropriate target structure to produce an artificially produced material in commercial quantities by nuclear transformations. The principal novelty resides in the combination of an accelerator with a target for converting the accelerator beam to copious quantities of low-energy neutrons for absorption in a lattice of fertile material and moderator. The fertile material of the lattice is converted by neutron absorption reactions to an artificially produced material, e.g., plutonium, where depleted uranium is utilized as the fertile material.

Background radiation measurements at high power research reactors

DOE PAGES

Ashenfelter, J.; Yeh, M.; Balantekin, B.; ...

2015-10-23

Research reactors host a wide range of activities that make use of the intense neutron fluxes generated at these facilities. Recent interest in performing measurements with relatively low event rates, e.g. reactor antineutrino detection, at these facilities necessitates a detailed understanding of background radiation fields. Both reactor-correlated and naturally occurring background sources are potentially important, even at levels well below those of importance for typical activities. Here we describe a comprehensive series of background assessments at three high-power research reactors, including γ-ray, neutron, and muon measurements. For each facility we describe the characteristics and identify the sources of the backgroundmore » fields encountered. Furthermore, the general understanding gained of background production mechanisms and their relationship to facility features will prove valuable for the planning of any sensitive measurement conducted therein.« less

Heterogeneous Reaction of ClONO2(g) + NaCl(s) to Cl2(g) + NaNO3(s)

NASA Technical Reports Server (NTRS)

Timonen, Raimo S.; Chu, Liang T.; Leu, Ming-Taun; Keyser, Leon F.

1994-01-01

The heterogeneous reaction of ClON02 + NaCl yields Cl2 + NaNO3 (eq 1) was investigated over a temperature range 220-300 K in a flow-tube reactor interfaced with a differentially pumped quadrupole mass spectrometer. Partial pressures of ClON02 in the range 10(exp -8) - 10(exp -5) Torr were used. Granule sizes and surface roughness of the NaCl substrates were determined by using a scanning electron microscope, and in separate experiments, surface areas of the substrates were measured by using BET analysis of gas-adsorption isotherms. For dry NaCl substrates, both the decay rates of ClON02 and the growth rates Of C12 were used to obtain reaction probabilities, gamma(sub l) = (4.6 +/- 3.0) x 10(exp -3) at 296 K and (6.7 +/- 3.2) x 10(exp -1) at 225 K, after considering the internal surface area, The error bars represent 1 standard deviation. The Cl2 yield based on the ClONO2 reacted was measured to be 1.0 +/- 0.2. In order to mimic the conditions encountered in the lower stratosphere, the effect of water vapor pressures between 5 x 10(exp -5) and 3 x 10(exp -4) Torr on reaction 1 was also studied. With added H20, reaction probabilities, gamma = (4.1 +/- 2.1) x 10(exp -3) at 296 K and (4.7 +/- 2.9) x 10(exp -3) at 225 K, were obtained. A trace of HOCl, the reaction product from the ClON02 + H20 yield HOCl + HN03 reaction, was observed in addition to the C12 product from reaction 1. The implications of this result for the enhancement of hydrogen chloride in the stratosphere after the El Chichon volcanic eruption and for the marine troposphere are discussed.

Prevention of clogging in a biological trickle-bed reactor removing toluene from contaminated air.

PubMed

Weber, F J; Hartmans, S

1996-04-05

Removal of organic compounds like toluene from waste gases with a trickle-bed reactor can result in clogging of the reactor due to the formation of an excessive amount of biomass. We therefore limited the amount of nutrients available for growth, to prevent clogging of the reactor. As a consequence of this nutrient limitation a lower removal rate was observed. However, when a fungal culture was used to inoculate the reactor, the toluene removal rate under nutrient limiting conditions was higher. Over a period of 375 days, an average removal rate of 27 g C/(m(3) h) was obtained with the reactor inoculated with the fungal culture. From the carbon balance over the reactor and the nitrogen availability it was concluded that, under these nutrient-limited conditions, large amounts of carbohydrates are probably formed. We also studied the application of a NaOH wash to remove excess biomass, as a method to prevent clogging. Under these conditions an average toluene removal rate of 35 g C/(m(3) h) was obtained. After about 50 days there was no net increase in the biomass content of the reactor. The amount of biomass which was formed in the reactor equaled the amount removed by the NaOH wash.

Preliminary LOCA analysis of the westinghouse small modular reactor using the WCOBRA/TRAC-TF2 thermal-hydraulics code

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liao, J.; Kucukboyaci, V. N.; Nguyen, L.

2012-07-01

The Westinghouse Small Modular Reactor (SMR) is an 800 MWt (> 225 MWe) integral pressurized water reactor (iPWR) with all primary components, including the steam generator and the pressurizer located inside the reactor vessel. The reactor core is based on a partial-height 17x17 fuel assembly design used in the AP1000{sup R} reactor core. The Westinghouse SMR utilizes passive safety systems and proven components from the AP1000 plant design with a compact containment that houses the integral reactor vessel and the passive safety systems. A preliminary loss of coolant accident (LOCA) analysis of the Westinghouse SMR has been performed using themore » WCOBRA/TRAC-TF2 code, simulating a transient caused by a double ended guillotine (DEG) break in the direct vessel injection (DVI) line. WCOBRA/TRAC-TF2 is a new generation Westinghouse LOCA thermal-hydraulics code evolving from the US NRC licensed WCOBRA/TRAC code. It is designed to simulate PWR LOCA events from the smallest break size to the largest break size (DEG cold leg). A significant number of fluid dynamics models and heat transfer models were developed or improved in WCOBRA/TRAC-TF2. A large number of separate effects and integral effects tests were performed for a rigorous code assessment and validation. WCOBRA/TRAC-TF2 was introduced into the Westinghouse SMR design phase to assist a quick and robust passive cooling system design and to identify thermal-hydraulic phenomena for the development of the SMR Phenomena Identification Ranking Table (PIRT). The LOCA analysis of the Westinghouse SMR demonstrates that the DEG DVI break LOCA is mitigated by the injection and venting from the Westinghouse SMR passive safety systems without core heat up, achieving long term core cooling. (authors)« less

Removal of toxic uranium from synthetic nuclear power reactor effluents using uranyl ion imprinted polymer particles.

PubMed

Preetha, Chandrika Ravindran; Gladis, Joseph Mary; Rao, Talasila Prasada; Venkateswaran, Gopala

2006-05-01

Major quantities of uranium find use as nuclear fuel in nuclear power reactors. In view of the extreme toxicity of uranium and consequent stringent limits fixed by WHO and various national governments, it is essential to remove uranium from nuclear power reactor effluents before discharge into environment. Ion imprinted polymer (IIP) materials have traditionally been used for the recovery of uranium from dilute aqueous solutions prior to detection or from seawater. We now describe the use of IIP materials for selective removal of uranium from a typical synthetic nuclear power reactor effluent. The IIP materials were prepared for uranyl ion (imprint ion) by forming binary salicylaldoxime (SALO) or 4-vinylpyridine (VP) or ternary SALO-VP complexes in 2-methoxyethanol (porogen) and copolymerizing in the presence of styrene (monomer), divinylbenzene (cross-linking monomer), and 2,2'-azobisisobutyronitrile (initiator). The resulting materials were then ground and sieved to obtain unleached polymer particles. Leached IIP particles were obtained by leaching the imprint ions with 6.0 M HCl. Control polymer particles were also prepared analogously without the imprint ion. The IIP particles obtained with ternary complex alone gave quantitative removal of uranyl ion in the pH range 3.5-5.0 with as low as 0.08 g. The retention capacity of uranyl IIP particles was found to be 98.50 mg/g of polymer. The present study successfully demonstrates the feasibility of removing uranyl ions selectively in the range 5 microg - 300 mg present in 500 mL of synthetic nuclear power reactor effluent containing a host of other inorganic species.

Anaerobic degradation of aircraft deicing fluid (ADF) in upflow anaerobic sludge blanket (UASB) reactors and the fate of ADF additives

NASA Astrophysics Data System (ADS)

Pham, Thi Tham

2002-11-01

A central composite design was employed to methodically investigate anaerobic treatment of aircraft deicing fluid (ADF) in bench-scale Upflow Anaerobic Sludge Blanket (UASB) reactors. A total of 23 runs at 17 different operating conditions were conducted in continuous mode. The development of four empirical models describing process responses (i.e., chemical oxygen demand (COD) removal efficiency, biomass specific acetoclastic activity, methane production rate, and methane production potential) as functions of ADF concentration, hydraulic retention time (HRT), and biomass concentration is presented. Model verification indicated that predicted responses (COD removal efficiencies, biomass specific acetoclastic activity, and methane production rates and potential) were in good agreement with experimental results. Biomass specific acetoclastic activity was improved by almost two-fold during ADF treatment in UASB reactors. For the design window, COD removal efficiencies were higher than 90%. Predicted methane production potentials were close to theoretical values, and methane production rates increased as the organic loading rate (OLR) was increased. ADF toxicity effects were evident for 1.6% ADF at medium specific organic loadings (SOLR above 0.5 g COD/g VSS/d). In contrast, good reactor stability and excellent removal efficiencies were achieved at 1.2% ADF for reactor loadings approaching that of highly loaded systems (0.73 g COD/g VSS/d). Acclimation to ADF resulted in an initial reduction in the biomass settling velocity. The fate of ADF additives was also investigated. There was minimal sorption of benzotriazole (BT), 5-methyl-1 H-benzotriazole (MeBT), and 5,6-dimethyl-1 H-benzotriazole (DiMeBT) to anaerobic granules. A higher sorption capacity was measured for NP. Active transport may be one of the mechanisms for NP sorption. Ethylene glycol degradation experiments indicated that BT, MeBT, DiMeBT, and the nonionic surfactant Tergitol NP-4 had no significant

Plasminogen activator inhibitor-1 4G/5G polymorphism and retinopathy risk in type 2 diabetes: a meta-analysis.

PubMed

Zhang, Tengyue; Pang, Chong; Li, Ningdong; Zhou, Elaine; Zhao, Kanxing

2013-01-02

Mounting evidence has suggested that plasminogen activator inhibitor-1 (PAI-1) is a candidate for increased risk of diabetic retinopathy. Studies have reported that insertion/deletion polymorphism in the PAI-1 gene may influence the risk of this disease. To comprehensively address this issue, we performed a meta-analysis to evaluate the association of PAI-1 4G/5G polymorphism with diabetic retinopathy in type 2 diabetes. Data were retrieved in a systematic manner and analyzed using Review Manager and STATA Statistical Software. Crude odds ratios (ORs) with 95% confidence intervals (CIs) were used to assess the strength of associations. Nine studies with 1, 217 cases and 1, 459 controls were included. Allelic and genotypic comparisons between cases and controls were evaluated. Overall analysis suggests a marginal association of the 4G/5G polymorphism with diabetic retinopathy (for 4G versus 5G: OR 1.13, 95%CI 1.01 to 1.26; for 4G/4G versus 5G/5G: OR 1.30, 95%CI 1.04 to 1.64; for 4G/4G versus 5G/5G + 4G/5G: OR 1.26, 95%CI 1.05 to 1.52). In subgroup analysis by ethnicity, we found an association among the Caucasian population (for 4G versus 5G: OR 1.14, 95% CI 1.00 to 1.30; for 4G/4G versus 5G/5G: OR 1.33, 95%CI 1.02 to 1.74; for 4G/4G versus 5G/5G + 4G/5G: OR 1.41, 95%CI 1.13 to 1.77). When stratified by the average duration of diabetes, patients with diabetes histories longer than 10 years have an elevated susceptibility to diabetic retinopathy than those with shorter histories (for 4G/4G versus 5G/5G: OR 1.47, 95%CI 1.08 to 2.00). We also detected a higher risk in hospital-based studies (for 4G/4G versus 5G/5G+4G/5G: OR 1.27, 95%CI 1.02 to 1.57). The present meta-analysis suggested that 4G/5G polymorphism in the PAI-1 gene potentially increased the risk of diabetic retinopathy in type 2 diabetes and showed a discrepancy in different ethnicities. A higher susceptibility in patients with longer duration of diabetes (more than 10 years) indicated a gene

Plasminogen activator inhibitor-1 4G/5G polymorphism and retinopathy risk in type 2 diabetes: a meta-analysis

PubMed Central

2013-01-01

Background Mounting evidence has suggested that plasminogen activator inhibitor-1 (PAI-1) is a candidate for increased risk of diabetic retinopathy. Studies have reported that insertion/deletion polymorphism in the PAI-1 gene may influence the risk of this disease. To comprehensively address this issue, we performed a meta-analysis to evaluate the association of PAI-1 4G/5G polymorphism with diabetic retinopathy in type 2 diabetes. Methods Data were retrieved in a systematic manner and analyzed using Review Manager and STATA Statistical Software. Crude odds ratios (ORs) with 95% confidence intervals (CIs) were used to assess the strength of associations. Results Nine studies with 1, 217 cases and 1, 459 controls were included. Allelic and genotypic comparisons between cases and controls were evaluated. Overall analysis suggests a marginal association of the 4G/5G polymorphism with diabetic retinopathy (for 4G versus 5G: OR 1.13, 95%CI 1.01 to 1.26; for 4G/4G versus 5G/5G: OR 1.30, 95%CI 1.04 to 1.64; for 4G/4G versus 5G/5G + 4G/5G: OR 1.26, 95%CI 1.05 to 1.52). In subgroup analysis by ethnicity, we found an association among the Caucasian population (for 4G versus 5G: OR 1.14, 95% CI 1.00 to 1.30; for 4G/4G versus 5G/5G: OR 1.33, 95%CI 1.02 to 1.74; for 4G/4G versus 5G/5G + 4G/5G: OR 1.41, 95%CI 1.13 to 1.77). When stratified by the average duration of diabetes, patients with diabetes histories longer than 10 years have an elevated susceptibility to diabetic retinopathy than those with shorter histories (for 4G/4G versus 5G/5G: OR 1.47, 95%CI 1.08 to 2.00). We also detected a higher risk in hospital-based studies (for 4G/4G versus 5G/5G+4G/5G: OR 1.27, 95%CI 1.02 to 1.57). Conclusions The present meta-analysis suggested that 4G/5G polymorphism in the PAI-1 gene potentially increased the risk of diabetic retinopathy in type 2 diabetes and showed a discrepancy in different ethnicities. A higher susceptibility in patients with longer duration of diabetes (more than 10

Update on reactors and reactor instruments in Asia

NASA Astrophysics Data System (ADS)

Rao, K. R.

1991-10-01

The 1980s have seen the commissioning of several medium flux (∼10 14 neutrons/cm 2s) research reactors in Asia. The reactors are based on indigenous design and development in India and China. At Dhruva reactor (India), a variety of neutron spectrometers have been established that have provided useful data related to the structure of high- Tc materials, phonon density of states, magnetic moment distributions and micellar aggregation during the last couple of years. Polarised neutron analysis, neutron interferometry and neutron spin echo methods are some of the new techniques under development. The spectrometers and associated automaton, detectors and neutron guides have all been indigenously developed. This paper summarises the developments and on-going activities in Bangladesh, China, India, Indonesia, Korea, Malaysia, the Philippines and Thailand.

Self-Cleaning Boudouard Reactor for Full Oxygen Recovery from CO2 Project

NASA Technical Reports Server (NTRS)

Zeitlin, Nancy; Muscatello, Anthony

2015-01-01

Oxygen recovery from respiratory CO2 is an important aspect of human spaceflight. Methods exist to sequester the CO2, but production of oxygen needs further development. The current ISS Carbon Dioxide Reduction System (CRS) uses the Sabatier reaction to produce water (and ultimately breathing air). Oxygen recovery is limited to 50% because half of the hydrogen used in the Sabatier reactor is lost as methane, which is vented overboard. The Bosch reaction is the only real alternative to the Sabatier reaction, but in the last reaction in the cycle (Boudouard) the resulting carbon buildup will eventually foul the nickel or iron catalyst, reducing reactor life and increasing consumables. To minimize this fouling, find a use for this waste product, and increase efficiency, we propose testing various self-cleaning catalyst designs in an existing MSFC Boudouard reaction test bed and to determine which one is the most reliable in conversion and lack of fouling. Challenges include mechanical reliability of the cleaning method and maintaining high conversion efficiency with lower catalyst surface area. The above chemical reactions are well understood, but planned implementations are novel (TRL 2) and haven't been investigated at any level.

A full scale worm reactor for efficient sludge reduction by predation in a wastewater treatment plant.

PubMed

Tamis, J; van Schouwenburg, G; Kleerebezem, R; van Loosdrecht, M C M

2011-11-15

Sludge predation can be an effective solution to reduce sludge production at a wastewater treatment plant. Oligochaete worms are the natural consumers of biomass in benthic layers in ecosystems. In this study the results of secondary sludge degradation by the aquatic Oligochaete worm Aulophorus furcatus in a 125 m(3) reactor and further sludge conversion in an anaerobic tank are presented. The system was operated over a period of 4 years at WWTP Wolvega, the Netherlands and was fed with secondary sludge from a low loaded activated sludge process. It was possible to maintain a stable and active population of the aquatic worm species A. furcatus during the full period. Under optimal conditions a sludge conversion of 150-200 kg TSS/d or 1.2-1.6 kg TSS/m(3)/d was established in the worm reactor. The worms grew as a biofilm on carrier material in the reactor. The surface specific conversion rate reached 140-180 g TSS/m(2)d and the worm biomass specific conversion rate was 0.5-1 g TSS sludge/g dry weight worms per day. The sludge reduction under optimal conditions in the worm reactor was 30-40%. The degradation by worms was an order of magnitude larger than the endogenous conversion rate of the secondary sludge. Effluent sludge from the worm reactor was stored in an anaerobic tank where methanogenic processes became apparent. It appeared that besides reducing the sludge amount, the worms' activity increased anaerobic digestibility, allowing for future optimisation of the total system by maximising sludge reduction and methane formation. In the whole system it was possible to reduce the amount of sludge by at least 65% on TSS basis. This is a much better total conversion than reported for anaerobic biodegradability of secondary sludge of 20-30% efficiency in terms of TSS reduction. Copyright © 2011 Elsevier Ltd. All rights reserved.

A KINETIC MODEL FOR H2O2/UV PROCESS IN A COMPLETELY MIXED BATCH REACTOR. (R825370C076)

EPA Science Inventory

A dynamic kinetic model for the advanced oxidation process (AOP) using hydrogen peroxide and ultraviolet irradiation (H₂O₂/UV) in a completely mixed batch reactor (CMBR) is developed. The model includes the known elementary chemical and photochemical reac...

An approach to model reactor core nodalization for deterministic safety analysis

NASA Astrophysics Data System (ADS)

Salim, Mohd Faiz; Samsudin, Mohd Rafie; Mamat @ Ibrahim, Mohd Rizal; Roslan, Ridha; Sadri, Abd Aziz; Farid, Mohd Fairus Abd

2016-01-01

Adopting good nodalization strategy is essential to produce an accurate and high quality input model for Deterministic Safety Analysis (DSA) using System Thermal-Hydraulic (SYS-TH) computer code. The purpose of such analysis is to demonstrate the compliance against regulatory requirements and to verify the behavior of the reactor during normal and accident conditions as it was originally designed. Numerous studies in the past have been devoted to the development of the nodalization strategy for small research reactor (e.g. 250kW) up to the bigger research reactor (e.g. 30MW). As such, this paper aims to discuss the state-of-arts thermal hydraulics channel to be employed in the nodalization for RTP-TRIGA Research Reactor specifically for the reactor core. At present, the required thermal-hydraulic parameters for reactor core, such as core geometrical data (length, coolant flow area, hydraulic diameters, and axial power profile) and material properties (including the UZrH1.6, stainless steel clad, graphite reflector) have been collected, analyzed and consolidated in the Reference Database of RTP using standardized methodology, mainly derived from the available technical documentations. Based on the available information in the database, assumptions made on the nodalization approach and calculations performed will be discussed and presented. The development and identification of the thermal hydraulics channel for the reactor core will be implemented during the SYS-TH calculation using RELAP5-3D® computer code. This activity presented in this paper is part of the development of overall nodalization description for RTP-TRIGA Research Reactor under the IAEA Norwegian Extra-Budgetary Programme (NOKEBP) mentoring project on Expertise Development through the Analysis of Reactor Thermal-Hydraulics for Malaysia, denoted as EARTH-M.

An approach to model reactor core nodalization for deterministic safety analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Salim, Mohd Faiz, E-mail: mohdfaizs@tnb.com.my; Samsudin, Mohd Rafie, E-mail: rafies@tnb.com.my; Mamat Ibrahim, Mohd Rizal, E-mail: m-rizal@nuclearmalaysia.gov.my

Adopting good nodalization strategy is essential to produce an accurate and high quality input model for Deterministic Safety Analysis (DSA) using System Thermal-Hydraulic (SYS-TH) computer code. The purpose of such analysis is to demonstrate the compliance against regulatory requirements and to verify the behavior of the reactor during normal and accident conditions as it was originally designed. Numerous studies in the past have been devoted to the development of the nodalization strategy for small research reactor (e.g. 250kW) up to the bigger research reactor (e.g. 30MW). As such, this paper aims to discuss the state-of-arts thermal hydraulics channel to bemore » employed in the nodalization for RTP-TRIGA Research Reactor specifically for the reactor core. At present, the required thermal-hydraulic parameters for reactor core, such as core geometrical data (length, coolant flow area, hydraulic diameters, and axial power profile) and material properties (including the UZrH{sub 1.6}, stainless steel clad, graphite reflector) have been collected, analyzed and consolidated in the Reference Database of RTP using standardized methodology, mainly derived from the available technical documentations. Based on the available information in the database, assumptions made on the nodalization approach and calculations performed will be discussed and presented. The development and identification of the thermal hydraulics channel for the reactor core will be implemented during the SYS-TH calculation using RELAP5-3D{sup ®} computer code. This activity presented in this paper is part of the development of overall nodalization description for RTP-TRIGA Research Reactor under the IAEA Norwegian Extra-Budgetary Programme (NOKEBP) mentoring project on Expertise Development through the Analysis of Reactor Thermal-Hydraulics for Malaysia, denoted as EARTH-M.« less

Performance of a full scale prototype detector at the BR2 reactor for the SoLid experiment

NASA Astrophysics Data System (ADS)

Abreu, Y.; Amhis, Y.; Arnold, L.; Ban, G.; Beaumont, W.; Bongrand, M.; Boursette, D.; Castle, B. C.; Clark, K.; Coupé, B.; Cussans, D.; De Roeck, A.; D'Hondt, J.; Durand, D.; Fallot, M.; Ghys, L.; Giot, L.; Guillon, B.; Ihantola, S.; Janssen, X.; Kalcheva, S.; Kalousis, L. N.; Koonen, E.; Labare, M.; Lehaut, G.; Manzanillas, L.; Mermans, J.; Michiels, I.; Moortgat, C.; Newbold, D.; Park, J.; Pestel, V.; Petridis, K.; Piñera, I.; Pommery, G.; Popescu, L.; Pronost, G.; Rademacker, J.; Ryckbosch, D.; Ryder, N.; Saunders, D.; Schune, M.-H.; Simard, L.; Vacheret, A.; Van Dyck, S.; Van Mulders, P.; van Remortel, N.; Vercaemer, S.; Verstraeten, M.; Weber, A.; Yermia, F.

2018-05-01

The SoLid collaboration has developed a new detector technology to detect electron anti-neutrinos at close proximity to the Belgian BR2 reactor at surface level. A 288 kg prototype detector was deployed in 2015 and collected data during the operational period of the reactor and during reactor shut-down. Dedicated calibration campaigns were also performed with gamma and neutron sources. This paper describes the construction of the prototype detector with a high control on its proton content and the stability of its operation over a period of several months after deployment at the BR2 reactor site. All detector cells provide sufficient light yields to achieve a target energy resolution of better than 20%/√E(MeV). The capability of the detector to track muons is exploited to equalize the light response of a large number of channels to a precision of 3% and to demonstrate the stability of the energy scale over time. Particle identification based on pulse-shape discrimination is demonstrated with calibration sources. Despite a lower neutron detection efficiency due to triggering constraints, the main backgrounds at the reactor site were determined and taken into account in the shielding strategy for the main experiment. The results obtained with this prototype proved essential in the design optimization of the final detector.

26 CFR 1.402(g)-2 - Increased limit for catch-up contributions.

Code of Federal Regulations, 2010 CFR

2010-04-01

....402(g)-2 Section 1.402(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES Pension, Profit-Sharing, Stock Bonus Plans, Etc. § 1.402(g)-2 Increased limit for catch-up contributions. (a) General rule. Under section 402(g)(1)(C), in determining the...

Topoisomerase IIα maintains genomic stability through decatenation G2 checkpoint signaling

PubMed Central

Bower, Jacquelyn J.; Karaca, Gamze F.; Zhou, Yingchun; Simpson, Dennis A.; Cordeiro-Stone, Marila; Kaufmann, William K.

2010-01-01

Topoisomerase IIα (topoIIα) is an essential mammalian enzyme that topologically modifies DNA and is required for chromosome segregation during mitosis. Previous research suggests that inhibition of topoII decatenatory activity triggers a G2 checkpoint response, which delays mitotic entry due to insufficient decatenation of daughter chromatids. Here we examine the effects of both topoIIα and topoIIβ on decatenatory activity in cell extracts, DNA damage and decatenation G2 checkpoint function, and the frequencies of p16INK4A allele loss and gain. In diploid human fibroblast lines, depletion of topoIIα by siRNA was associated with severely reduced decatenatory activity, delayed progression from G2 into mitosis, and insensitivity to G2 arrest induced by the topoII catalytic inhibitor ICRF-193. Furthermore, interphase nuclei of topoIIα-depleted cells displayed increased frequencies of losses and gains of the tumor suppressor genetic locus p16INK4A. This study demonstrates that the topoIIα protein is required for decatenation G2 checkpoint function, and inactivation of decatenation and the decatenation G2 checkpoint leads to abnormal chromosome segregation and genomic instability. PMID:20562910

Reactor Physics Scoping and Characterization Study on Implementation of TRIGA Fuel in the Advanced Test Reactor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jennifer Lyons; Wade R. Marcum; Mark D. DeHart

2014-01-01

The Advanced Test Reactor (ATR), under the Reduced Enrichment for Research and Test Reactors (RERTR) Program and the Global Threat Reduction Initiative (GTRI), is conducting feasibility studies for the conversion of its fuel from a highly enriched uranium (HEU) composition to a low enriched uranium (LEU) composition. These studies have considered a wide variety of LEU plate-type fuels to replace the current HEU fuel. Continuing to investigate potential alternatives to the present HEU fuel form, this study presents a preliminary analysis of TRIGA® fuel within the current ATR fuel envelopes and compares it to the functional requirements delineated by themore » Naval Reactors Program, which includes: greater than 4.8E+14 fissions/s/g of 235U, a fast to thermal neutron flux ratio that is less than 5% deviation of its current value, a constant cycle power within the corner lobes, and an operational cycle length of 56 days at 120 MW. Other parameters outside those put forth by the Naval Reactors Program which are investigated herein include axial and radial power profiles, effective delayed neutron fraction, and mean neutron generation time.« less

Photocatalytic decomposition of N2O over TiO2/g-C3N4 photocatalysts heterojunction

NASA Astrophysics Data System (ADS)

Kočí, K.; Reli, M.; Troppová, I.; Šihor, M.; Kupková, J.; Kustrowski, P.; Praus, P.

2017-02-01

TiO2/g-C3N4 photocatalysts with the various TiO2/g-C3N4 weight ratios from 1:2 to 1:6 were fabricated by mechanical mixing in water suspension followed by calcination. Pure TiO2 was prepared by thermal hydrolysis and pure g-C3N4 was prepared from commercial melamine by thermal annealing at 620 °C. All the nanocomposites were characterized by X-ray powder diffraction, UV-vis diffuse reflectance spectroscopy, Raman spectroscopy, infrared spectroscopy, scanning electron microscopy, transmission electron microscopy, photoelectrochemical measurements and nitrogen physisorption. The prepared mixtures along with pure TiO2 and g-C3N4 were tested for the photocatalytic decomposition of nitrous oxide under UVC (λ = 254 nm), UVA (λ = 365 nm) and Vis (λ > 400 nm) irradiation. The TiO2/g-C3N4 nanocomposites showed moderate improvement compared to pure g-C3N4 but pure TiO2 proved to be a better photocatalyst under UVC irradiation. However, under UVA irradiation conditions, the photocatalytic activity of TiO2/g-C3N4 (1:2) nanocomposite exhibited an increase compared to pure TiO2. Nevertheless, further increase of g-C3N4 amount leads/led to a decrease in reactivity. These results are suggesting the nanocomposite with the optimal weight ratio of TiO2 and g-C3N4 have shifted absorption edge energy towards longer wavelengths and decreased the recombination rate of charge carriers compared to pure g-C3N4. This is probably due to the generation of heterojunction on the TiO2/g-C3N4 interface.

Preconceptual design of a fluoride high temperature salt-cooled engineering demonstration reactor: Motivation and overview

DOE PAGES

Qualls, A. Louis; Betzler, Benjamin R.; Brown, Nicholas R.; ...

2016-12-21

Engineering demonstration reactors are nuclear reactors built to establish proof of concept for technology options that have never been built. Examples of engineering demonstration reactors include Peach Bottom 1 for high temperature gas-cooled reactors (HTGRs) and Experimental Breeder Reactor-II (EBR-II) for sodium-cooled fast reactors. Historically, engineering demonstrations have played a vital role in advancing the technology readiness level of reactor technologies. Our paper details a preconceptual design for a fluoride salt-cooled engineering demonstration reactor. The fluoride salt-cooled high-temperature reactor (FHR) demonstration reactor (DR) is a concept for a salt-cooled reactor with 100 megawatts of thermal output (MWt). It would usemore » tristructural-isotropic (TRISO) particle fuel within prismatic graphite blocks. FLiBe (2 7LiF-BeF2) is the reference primary coolant. The FHR DR is designed to be small, simple, and affordable. Development of the FHR DR is a necessary intermediate step to enable near-term commercial FHRs. The design philosophy of the FHR DR was focused on safety, near-term deployment, and flexibility. Lower risk technologies are purposely included in the initial FHR DR design to ensure that the reactor can be built, licensed, and operated as an engineering demonstration with minimal risk and cost. These technologies include TRISO particle fuel, replaceable core structures, and consistent structural material selection for core structures and the primary and intermediate loops, and tube-and-shell primary-to-intermediate heat exchangers. Important capabilities to be demonstrated by building and operating the FHR DR include fabrication and operation of high temperature reactors; heat exchanger performance (including passive decay heat removal); pump performance; and reactivity control; salt chemistry control to maximize vessel life; tritium management; core design methodologies; salt procurement, handling, maintenance and ultimate

Preconceptual design of a fluoride high temperature salt-cooled engineering demonstration reactor: Motivation and overview

DOE Office of Scientific and Technical Information (OSTI.GOV)

Qualls, A. Louis; Betzler, Benjamin R.; Brown, Nicholas R.

Engineering demonstration reactors are nuclear reactors built to establish proof of concept for technology options that have never been built. Examples of engineering demonstration reactors include Peach Bottom 1 for high temperature gas-cooled reactors (HTGRs) and Experimental Breeder Reactor-II (EBR-II) for sodium-cooled fast reactors. Historically, engineering demonstrations have played a vital role in advancing the technology readiness level of reactor technologies. Our paper details a preconceptual design for a fluoride salt-cooled engineering demonstration reactor. The fluoride salt-cooled high-temperature reactor (FHR) demonstration reactor (DR) is a concept for a salt-cooled reactor with 100 megawatts of thermal output (MWt). It would usemore » tristructural-isotropic (TRISO) particle fuel within prismatic graphite blocks. FLiBe (2 7LiF-BeF2) is the reference primary coolant. The FHR DR is designed to be small, simple, and affordable. Development of the FHR DR is a necessary intermediate step to enable near-term commercial FHRs. The design philosophy of the FHR DR was focused on safety, near-term deployment, and flexibility. Lower risk technologies are purposely included in the initial FHR DR design to ensure that the reactor can be built, licensed, and operated as an engineering demonstration with minimal risk and cost. These technologies include TRISO particle fuel, replaceable core structures, and consistent structural material selection for core structures and the primary and intermediate loops, and tube-and-shell primary-to-intermediate heat exchangers. Important capabilities to be demonstrated by building and operating the FHR DR include fabrication and operation of high temperature reactors; heat exchanger performance (including passive decay heat removal); pump performance; and reactivity control; salt chemistry control to maximize vessel life; tritium management; core design methodologies; salt procurement, handling, maintenance and ultimate

Nuclear reactor construction with bottom supported reactor vessel

DOEpatents

Sharbaugh, John E.

1987-01-01

An improved liquid metal nuclear reactor construction has a reactor core and a generally cylindrical reactor vessel for holding a large pool of low pressure liquid metal coolant and housing the core within the pool. The reactor vessel has an open top end, a closed flat bottom end wall and a continuous cylindrical closed side wall interconnecting the top end and bottom end wall. The reactor also has a generally cylindrical concrete containment structure surrounding the reactor vessel and being formed by a cylindrical side wall spaced outwardly from the reactor vessel side wall and a flat base mat spaced below the reactor vessel bottom end wall. A central support pedestal is anchored to the containment structure base mat and extends upwardly therefrom to the reactor vessel and upwardly therefrom to the reactor core so as to support the bottom end wall of the reactor vessel and the lower end of the reactor core in spaced apart relationship above the containment structure base mat. Also, an annular reinforced support structure is disposed in the reactor vessel on the bottom end wall thereof and extends about the lower end of the core so as to support the periphery thereof. In addition, an annular support ring having a plurality of inward radially extending linear members is disposed between the containment structure base mat and the bottom end of the reactor vessel wall and is connected to and supports the reactor vessel at its bottom end on the containment structure base mat so as to allow the reactor vessel to expand radially but substantially prevent any lateral motions that might be imposed by the occurrence of a seismic event. The reactor construction also includes a bed of insulating material in sand-like granular form, preferably being high density magnesium oxide particles, disposed between the containment structure base mat and the bottom end wall of the reactor vessel and uniformly supporting the reactor vessel at its bottom end wall on the containment

Measurement of neutrino mixing angle θ13 and mass difference Δ mee2 from reactor antineutrino disappearance in the RENO experiment

NASA Astrophysics Data System (ADS)

Kim, Soo-Bong

2016-07-01

RENO (Reactor Experiment for Neutrino Oscillation) made a definitive measurement of the smallest neutrino mixing angle θ13 in 2012, based on the disappearance of reactor electron antineutrinos. The experiment has obtained a more precise value of the mixing angle and the first result on neutrino mass difference Δ mee2 from an energy and baseline dependent reactor neutrino disappearance using ∼500 days of data. Based on the ratio of inverse-beta-decay (IBD) prompt spectra measured in two identical far and near detectors, we obtain sin2 ⁡ (2θ13) = 0.082 ± 0.009 (stat .) ± 0.006 (syst .) and | Δ mee2 | = [2.62-0.23+0.21 (stat.)-0.13+0.12 (syst .) ] ×10-3 eV2. An excess of reactor antineutrinos near 5 MeV is observed in the measured prompt spectrum with respect to the most commonly used models. The excess is found to be consistent with coming from reactors. A successful measurement of θ13 is also made in an IBD event sample with a delayed signal of neutron capture on hydrogen. A precise value of θ13 would provide important information on determination of the leptonic CP phase if combined with a result of an accelerator neutrino beam experiment.

Metabolomic effects of CeO2, SiO2 and CuO metal oxide nanomaterials on HepG2 cells

EPA Science Inventory

To better assess potential hepatotoxicity of nanomaterials, human liver HepG2 cells were exposed for 3 days to five different CeO2 (either 30 or 100 μg/ml), 3 SiO2 based (30 μg/ml) or 1 CuO (3 μg/ml) nanomaterials with dry primary particle sizes ranging from 15 to 213 nm. Metabol...

Cytokinetically quiescent (G0/G1) human multiple myeloma cells are susceptible to simultaneous inhibition of Chk1 and MEK1/2

PubMed Central

Pei, Xin-Yan; Dai, Yun; Youssefian, Leena E.; Chen, Shuang; Bodie, Wesley W.; Takabatake, Yukie; Felthousen, Jessica; Almenara, Jorge A.; Kramer, Lora B.; Dent, Paul

2011-01-01

Effects of Chk1 and MEK1/2 inhibition were investigated in cytokinetically quiescent multiple myeloma (MM) and primary CD138+ cells. Coexposure to the Chk1 and MEK1/2 inhibitors AZD7762 and selumetinib (AZD6244) robustly induced apoptosis in various MM cells and CD138+ primary samples, but spared normal CD138− and CD34+ cells. Furthermore, Chk1/MEK1/2 inhibitor treatment of asynchronized cells induced G0/G1 arrest and increased apoptosis in all cell-cycle phases, including G0/G1. To determine whether this regimen is active against quiescent G0/G1 MM cells, cells were cultured in low-serum medium to enrich the G0/G1 population. G0/G1–enriched cells exhibited diminished sensitivity to conventional agents (eg, Taxol and VP-16) but significantly increased susceptibility to Chk1 ± MEK1/2 inhibitors or Chk1 shRNA knock-down. These events were associated with increased γH2A.X expression/foci formation and Bim up-regulation, whereas Bim shRNA knock-down markedly attenuated lethality. Immunofluorescent analysis of G0/G1–enriched or primary MM cells demonstrated colocalization of activated caspase-3 and the quiescent (G0) marker statin, a nuclear envelope protein. Finally, Chk1/MEK1/2 inhibition increased cell death in the Hoechst-positive (Hst+), low pyronin Y (PY)–staining (2N Hst+/PY−) G0 population and in sorted small side-population (SSP) MM cells. These findings provide evidence that cytokinetically quiescent MM cells are highly susceptible to simultaneous Chk1 and MEK1/2 inhibition. PMID:21911831

Cytokinetically quiescent (G0/G1) human multiple myeloma cells are susceptible to simultaneous inhibition of Chk1 and MEK1/2.

PubMed

Pei, Xin-Yan; Dai, Yun; Youssefian, Leena E; Chen, Shuang; Bodie, Wesley W; Takabatake, Yukie; Felthousen, Jessica; Almenara, Jorge A; Kramer, Lora B; Dent, Paul; Grant, Steven

2011-11-10

Effects of Chk1 and MEK1/2 inhibition were investigated in cytokinetically quiescent multiple myeloma (MM) and primary CD138(+) cells. Coexposure to the Chk1 and MEK1/2 inhibitors AZD7762 and selumetinib (AZD6244) robustly induced apoptosis in various MM cells and CD138(+) primary samples, but spared normal CD138(-) and CD34(+) cells. Furthermore, Chk1/MEK1/2 inhibitor treatment of asynchronized cells induced G(0)/G(1) arrest and increased apoptosis in all cell-cycle phases, including G(0)/G(1). To determine whether this regimen is active against quiescent G(0)/G(1) MM cells, cells were cultured in low-serum medium to enrich the G(0)/G(1) population. G(0)/G(1)-enriched cells exhibited diminished sensitivity to conventional agents (eg, Taxol and VP-16) but significantly increased susceptibility to Chk1 ± MEK1/2 inhibitors or Chk1 shRNA knock-down. These events were associated with increased γH2A.X expression/foci formation and Bim up-regulation, whereas Bim shRNA knock-down markedly attenuated lethality. Immunofluorescent analysis of G(0)/G(1)-enriched or primary MM cells demonstrated colocalization of activated caspase-3 and the quiescent (G(0)) marker statin, a nuclear envelope protein. Finally, Chk1/MEK1/2 inhibition increased cell death in the Hoechst-positive (Hst(+)), low pyronin Y (PY)-staining (2N Hst(+)/PY(-)) G(0) population and in sorted small side-population (SSP) MM cells. These findings provide evidence that cytokinetically quiescent MM cells are highly susceptible to simultaneous Chk1 and MEK1/2 inhibition.

Fermilab Muon Campus g-2 Cryogenic Distribution Remote Control System

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pei, L.; Theilacker, J.; Klebaner, A.

2015-11-05

The Muon Campus (MC) is able to measure Muon g-2 with high precision and comparing its value to the theoretical prediction. The MC has four 300 KW screw compressors and four liquid helium refrigerators. The centerpiece of the Muon g-2 experiment at Fermilab is a large, 50-foot-diameter superconducting muon storage ring. This one-of-a-kind ring, made of steel, aluminum and superconducting wire, was built for the previous g-2 experiment at Brookhaven. Due to each subsystem has to be far away from each other and be placed in the distant location, therefore, Siemens Process Control System PCS7-400, Automation Direct DL205 & DL05more » PLC, Synoptic and Fermilab ACNET HMI are the ideal choices as the MC g-2 cryogenic distribution real-time and on-Line remote control system. This paper presents a method which has been successfully used by many Fermilab distribution cryogenic real-time and On-Line remote control systems.« less

Biofilm reactors for industrial bioconversion processes: employing potential of enhanced reaction rates

PubMed Central

Qureshi, Nasib; Annous, Bassam A; Ezeji, Thaddeus C; Karcher, Patrick; Maddox, Ian S

2005-01-01

This article describes the use of biofilm reactors for the production of various chemicals by fermentation and wastewater treatment. Biofilm formation is a natural process where microbial cells attach to the support (adsorbent) or form flocs/aggregates (also called granules) without use of chemicals and form thick layers of cells known as "biofilms." As a result of biofilm formation, cell densities in the reactor increase and cell concentrations as high as 74 gL-1 can be achieved. The reactor configurations can be as simple as a batch reactor, continuous stirred tank reactor (CSTR), packed bed reactor (PBR), fluidized bed reactor (FBR), airlift reactor (ALR), upflow anaerobic sludge blanket (UASB) reactor, or any other suitable configuration. In UASB granular biofilm particles are used. This article demonstrates that reactor productivities in these reactors have been superior to any other reactor types. This article describes production of ethanol, butanol, lactic acid, acetic acid/vinegar, succinic acid, and fumaric acid in addition to wastewater treatment in the biofilm reactors. As the title suggests, biofilm reactors have high potential to be employed in biotechnology/bioconversion industry for viable economic reasons. In this article, various reactor types have been compared for the above bioconversion processes. PMID:16122390

Evolution of the Reactor Antineutrino Flux and Spectrum at Daya Bay

NASA Astrophysics Data System (ADS)

An, F. P.; Balantekin, A. B.; Band, H. R.; Bishai, M.; Blyth, S.; Cao, D.; Cao, G. F.; Cao, J.; Chan, Y. L.; Chang, J. F.; Chang, Y.; Chen, H. S.; Chen, Q. Y.; Chen, S. M.; Chen, Y. X.; Chen, Y.; Cheng, J.; Cheng, Z. K.; Cherwinka, J. J.; Chu, M. C.; Chukanov, A.; Cummings, J. P.; Ding, Y. Y.; Diwan, M. V.; Dolgareva, M.; Dove, J.; Dwyer, D. A.; Edwards, W. R.; Gill, R.; Gonchar, M.; Gong, G. H.; Gong, H.; Grassi, M.; Gu, W. Q.; Guo, L.; Guo, X. H.; Guo, Y. H.; Guo, Z.; Hackenburg, R. W.; Hans, S.; He, M.; Heeger, K. M.; Heng, Y. K.; Higuera, A.; Hsiung, Y. B.; Hu, B. Z.; Hu, T.; Huang, E. C.; Huang, H. X.; Huang, X. T.; Huang, Y. B.; Huber, P.; Huo, W.; Hussain, G.; Jaffe, D. E.; Jen, K. L.; Ji, X. P.; Ji, X. L.; Jiao, J. B.; Johnson, R. A.; Jones, D.; Kang, L.; Kettell, S. H.; Khan, A.; Kohn, S.; Kramer, M.; Kwan, K. K.; Kwok, M. W.; Langford, T. J.; Lau, K.; Lebanowski, L.; Lee, J.; Lee, J. H. C.; Lei, R. T.; Leitner, R.; Leung, J. K. C.; Li, C.; Li, D. J.; Li, F.; Li, G. S.; Li, Q. J.; Li, S.; Li, S. C.; Li, W. D.; Li, X. N.; Li, X. Q.; Li, Y. F.; Li, Z. B.; Liang, H.; Lin, C. J.; Lin, G. L.; Lin, S.; Lin, S. K.; Lin, Y.-C.; Ling, J. J.; Link, J. M.; Littenberg, L.; Littlejohn, B. R.; Liu, J. L.; Liu, J. C.; Loh, C. W.; Lu, C.; Lu, H. Q.; Lu, J. S.; Luk, K. B.; Ma, X. Y.; Ma, X. B.; Ma, Y. Q.; Malyshkin, Y.; Martinez Caicedo, D. A.; McDonald, K. T.; McKeown, R. D.; Mitchell, I.; Nakajima, Y.; Napolitano, J.; Naumov, D.; Naumova, E.; Ngai, H. Y.; Ochoa-Ricoux, J. P.; Olshevskiy, A.; Pan, H.-R.; Park, J.; Patton, S.; Pec, V.; Peng, J. C.; Pinsky, L.; Pun, C. S. J.; Qi, F. Z.; Qi, M.; Qian, X.; Qiu, R. M.; Raper, N.; Ren, J.; Rosero, R.; Roskovec, B.; Ruan, X. C.; Steiner, H.; Stoler, P.; Sun, J. L.; Tang, W.; Taychenachev, D.; Treskov, K.; Tsang, K. V.; Tull, C. E.; Viaux, N.; Viren, B.; Vorobel, V.; Wang, C. H.; Wang, M.; Wang, N. Y.; Wang, R. G.; Wang, W.; Wang, X.; Wang, Y. F.; Wang, Z.; Wang, Z.; Wang, Z. M.; Wei, H. Y.; Wen, L. J.; Whisnant, K.; White, C. G.; Whitehead, L.; Wise, T.; Wong, H. L. H.; Wong, S. C. F.; Worcester, E.; Wu, C.-H.; Wu, Q.; Wu, W. J.; Xia, D. M.; Xia, J. K.; Xing, Z. Z.; Xu, J. L.; Xu, Y.; Xue, T.; Yang, C. G.; Yang, H.; Yang, L.; Yang, M. S.; Yang, M. T.; Yang, Y. Z.; Ye, M.; Ye, Z.; Yeh, M.; Young, B. L.; Yu, Z. Y.; Zeng, S.; Zhan, L.; Zhang, C.; Zhang, C. C.; Zhang, H. H.; Zhang, J. W.; Zhang, Q. M.; Zhang, R.; Zhang, X. T.; Zhang, Y. M.; Zhang, Y. X.; Zhang, Y. M.; Zhang, Z. J.; Zhang, Z. Y.; Zhang, Z. P.; Zhao, J.; Zhou, L.; Zhuang, H. L.; Zou, J. H.; Daya Bay Collaboration

2017-06-01

The Daya Bay experiment has observed correlations between reactor core fuel evolution and changes in the reactor antineutrino flux and energy spectrum. Four antineutrino detectors in two experimental halls were used to identify 2.2 million inverse beta decays (IBDs) over 1230 days spanning multiple fuel cycles for each of six 2.9 G Wth reactor cores at the Daya Bay and Ling Ao nuclear power plants. Using detector data spanning effective 239Pu fission fractions F239 from 0.25 to 0.35, Daya Bay measures an average IBD yield σ¯f of (5.90 ±0.13 )×10-43 cm2/fission and a fuel-dependent variation in the IBD yield, d σf/d F239, of (-1.86 ±0.18 )×10-43 cm2/fission . This observation rejects the hypothesis of a constant antineutrino flux as a function of the 239Pu fission fraction at 10 standard deviations. The variation in IBD yield is found to be energy dependent, rejecting the hypothesis of a constant antineutrino energy spectrum at 5.1 standard deviations. While measurements of the evolution in the IBD spectrum show general agreement with predictions from recent reactor models, the measured evolution in total IBD yield disagrees with recent predictions at 3.1 σ . This discrepancy indicates that an overall deficit in the measured flux with respect to predictions does not result from equal fractional deficits from the primary fission isotopes 235U, 239Pu, 238U, and 241Pu. Based on measured IBD yield variations, yields of (6.17 ±0.17 ) and (4.27 ±0.26 )×10-43 cm2 /fission have been determined for the two dominant fission parent isotopes 235U and 239Pu. A 7.8% discrepancy between the observed and predicted 235U yields suggests that this isotope may be the primary contributor to the reactor antineutrino anomaly.

16 CFR Appendix G2 to Part 305 - Furnaces-Electric

Code of Federal Regulations, 2012 CFR

2012-01-01

... 16 Commercial Practices 1 2012-01-01 2012-01-01 false Furnaces-Electric G2 Appendix G2 to Part 305 Commercial Practices FEDERAL TRADE COMMISSION REGULATIONS UNDER SPECIFIC ACTS OF CONGRESS RULE CONCERNING... Part 305—Furnaces—Electric Manufacturer's rated heating capacities (Btu's/hr.) Range of annual fuel...

16 CFR Appendix G2 to Part 305 - Furnaces-Electric

Code of Federal Regulations, 2013 CFR

2013-01-01

... 16 Commercial Practices 1 2013-01-01 2013-01-01 false Furnaces-Electric G2 Appendix G2 to Part 305 Commercial Practices FEDERAL TRADE COMMISSION REGULATIONS UNDER SPECIFIC ACTS OF CONGRESS RULE CONCERNING... Part 305—Furnaces—Electric Manufacturer's rated heating capacities (Btu's/hr.) Range of annual fuel...

16 CFR Appendix G2 to Part 305 - Furnaces-Electric

Code of Federal Regulations, 2011 CFR

2011-01-01

... 16 Commercial Practices 1 2011-01-01 2011-01-01 false Furnaces-Electric G2 Appendix G2 to Part 305 Commercial Practices FEDERAL TRADE COMMISSION REGULATIONS UNDER SPECIFIC ACTS OF CONGRESS RULE CONCERNING... Part 305—Furnaces—Electric Manufacturer's rated heating capacities (Btu's/hr.) Range of annual fuel...

16 CFR Appendix G2 to Part 305 - Furnaces-Electric

Code of Federal Regulations, 2010 CFR

2010-01-01

... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Furnaces-Electric G2 Appendix G2 to Part 305 Commercial Practices FEDERAL TRADE COMMISSION REGULATIONS UNDER SPECIFIC ACTS OF CONGRESS RULE CONCERNING... Part 305—Furnaces—Electric Manufacturer's rated heating capacities (Btu's/hr.) Range of annual fuel...

Biological CO2 conversion to acetate in subsurface coal-sand formation using a high-pressure reactor system.

PubMed

Ohtomo, Yoko; Ijiri, Akira; Ikegawa, Yojiro; Tsutsumi, Masazumi; Imachi, Hiroyuki; Uramoto, Go-Ichiro; Hoshino, Tatsuhiko; Morono, Yuki; Sakai, Sanae; Saito, Yumi; Tanikawa, Wataru; Hirose, Takehiro; Inagaki, Fumio

2013-01-01

Geological CO2 sequestration in unmineable subsurface oil/gas fields and coal formations has been proposed as a means of reducing anthropogenic greenhouse gasses in the atmosphere. However, the feasibility of injecting CO2 into subsurface depends upon a variety of geological and economic conditions, and the ecological consequences are largely unpredictable. In this study, we developed a new flow-through-type reactor system to examine potential geophysical, geochemical and microbiological impacts associated with CO2 injection by simulating in-situ pressure (0-100 MPa) and temperature (0-70°C) conditions. Using the reactor system, anaerobic artificial fluid and CO2 (flow rate: 0.002 and 0.00001 ml/min, respectively) were continuously supplemented into a column comprised of bituminous coal and sand under a pore pressure of 40 MPa (confined pressure: 41 MPa) at 40°C for 56 days. 16S rRNA gene analysis of the bacterial components showed distinct spatial separation of the predominant taxa in the coal and sand over the course of the experiment. Cultivation experiments using sub-sampled fluids revealed that some microbes survived, or were metabolically active, under CO2-rich conditions. However, no methanogens were activated during the experiment, even though hydrogenotrophic and methylotrophic methanogens were obtained from conventional batch-type cultivation at 20°C. During the reactor experiment, the acetate and methanol concentration in the fluids increased while the δ(13)Cacetate, H2 and CO2 concentrations decreased, indicating the occurrence of homo-acetogenesis. 16S rRNA genes of homo-acetogenic spore-forming bacteria related to the genus Sporomusa were consistently detected from the sandstone after the reactor experiment. Our results suggest that the injection of CO2 into a natural coal-sand formation preferentially stimulates homo-acetogenesis rather than methanogenesis, and that this process is accompanied by biogenic CO2 conversion to acetate.

26 CFR 1.904(g)-2 - Recapture of overall domestic losses.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 26 Internal Revenue 9 2012-04-01 2012-04-01 false Recapture of overall domestic losses. 1.904(g)-2 Section 1.904(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Income from Sources Without the United States § 1.904(g...

26 CFR 1.904(g)-2 - Recapture of overall domestic losses.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 26 Internal Revenue 9 2011-04-01 2011-04-01 false Recapture of overall domestic losses. 1.904(g)-2 Section 1.904(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Income from Sources Without the United States § 1.904(g...

26 CFR 1.904(g)-2 - Recapture of overall domestic losses.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 26 Internal Revenue 9 2014-04-01 2014-04-01 false Recapture of overall domestic losses. 1.904(g)-2 Section 1.904(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Income from Sources Without the United States § 1.904(g...

26 CFR 1.904(g)-2 - Recapture of overall domestic losses.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 26 Internal Revenue 9 2013-04-01 2013-04-01 false Recapture of overall domestic losses. 1.904(g)-2 Section 1.904(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Income from Sources Without the United States § 1.904(g...

Design of a single chambered microbial electrolytic cell reactor for production of biohydrogen from rice straw hydrolysate.

PubMed

Gupta, Pratima; Parkhey, Piyush

2015-06-01

Rice straw was pretreated using a microwave-assisted alkali pretreatment method. Cellulose recovery was approximately 82 %. This material was hydrolysed in an optimized enzymatic saccharification reaction using cellulase from Lysinibacillus sphaericus. This resulted in saccharification of 49 % of cellulosic biomass into glucose. A single chambered microbial electrolytic cell reactor of volume 2l was built using acrylic plastic sheets with graphite sheet as anode and a stainless-steel mesh as cathode. Shewanella putrefaciens was used as exoelectrogen to oxidize rice straw hydrolysate in the reactor for electrohydrogenesis. The maximum H2 yield obtained was 801 ml H2 g(-1) COD removal. Coulombic efficiency of 88 %, cathodic H2 recovery of 58 % and total H2 recovery of 51 % with an energy efficiency of 74 % were recorded.

An evaluation of the rate of absorption of solar radiation in the O2(X3Sigma-g - b1Sigma-g) transition

NASA Technical Reports Server (NTRS)

Mlynczak, Martin G.

1993-01-01

The rate at which molecular oxygen absorbs radiation in the O2(X3Sigma-g - b1Sigma-g) transition is calculated using a line-by-line radiative transfer model. This rate is critical to the determination of the population of the O2(b1Sigma-g) state required for studies of the O2(b1Sigma-g - X3Sigma-g) dayglow, the O2(a1Delta-g - X3Sigma-g) dayglow, and possibly the rates of oxidation of H2 and N2O. Previous evaluations of this rate (which is sometimes called the g-factor) have significantly overestimated its value. The rate is tabulated as a function of altitude, pressure, and solar zenith angle.

Lithium Causes G2 Arrest of Renal Principal Cells

PubMed Central

de Groot, Theun; Alsady, Mohammad; Jaklofsky, Marcel; Otte-Höller, Irene; Baumgarten, Ruben; Giles, Rachel H.

2014-01-01

Vasopressin-regulated expression and insertion of aquaporin-2 channels in the luminal membrane of renal principal cells is essential for urine concentration. Lithium affects urine concentrating ability, and approximately 20% of patients treated with lithium develop nephrogenic diabetes insipidus (NDI), a disorder characterized by polyuria and polydipsia. Lithium-induced NDI is caused by aquaporin-2 downregulation and a reduced ratio of principal/intercalated cells, yet lithium induces principal cell proliferation. Here, we studied how lithium-induced principal cell proliferation can lead to a reduced ratio of principal/intercalated cells using two-dimensional and three-dimensional polarized cultures of mouse renal collecting duct cells and mice treated with clinically relevant lithium concentrations. DNA image cytometry and immunoblotting revealed that lithium initiated proliferation of mouse renal collecting duct cells but also increased the G2/S ratio, indicating G2/M phase arrest. In mice, treatment with lithium for 4, 7, 10, or 13 days led to features of NDI and an increase in the number of principal cells expressing PCNA in the papilla. Remarkably, 30%–40% of the PCNA-positive principal cells also expressed pHistone-H3, a late G2/M phase marker detected in approximately 20% of cells during undisturbed proliferation. Our data reveal that lithium treatment initiates proliferation of renal principal cells but that a significant percentage of these cells are arrested in the late G2 phase, which explains the reduced principal/intercalated cell ratio and may identify the molecular pathway underlying the development of lithium-induced renal fibrosis. PMID:24408872

Interim MELCOR Simulation of the Fukushima Daiichi Unit 2 Accident Reactor Core Isolation Cooling Operation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ross, Kyle W.; Gauntt, Randall O.; Cardoni, Jeffrey N.

2013-11-01

Data, a brief description of key boundary conditions, and results of Sandia National Laboratories’ ongoing MELCOR analysis of the Fukushima Unit 2 accident are given for the reactor core isolation cooling (RCIC) system. Important assumptions and related boundary conditions in the current analysis additional to or different than what was assumed/imposed in the work of SAND2012-6173 are identified. This work is for the U.S. Department of Energy’s Nuclear Energy University Programs fiscal year 2014 Reactor Safety Technologies Research and Development Program RC-7: RCIC Performance under Severe Accident Conditions.

Anti-hepatocarcinoma effects of resveratrol nanoethosomes against human HepG2 cells

NASA Astrophysics Data System (ADS)

Meng, Xiang-Ping; Zhang, Zhen; Chen, Tong-sheng; Wang, Yi-fei; Wang, Zhi-ping

2017-02-01

Hepatocarcinoma, a malignant cancer, threaten human life badly. It is a current issue to seek the effective natural remedy from plant to treat cancer due to the resistance of the advanced hepatocarcinoma to chemotherapy. Resveratrol (Res) has been widely investigated with its strong anti-tumor activity. However, its low oral bioavailability restricts its wide application. In this study, we prepared resveratrol nanoethosomes (ResN) via ethanol injection method. The in vitro anti-hepatocarcinoma effects of ResN relative to efficacy of bulk Res were evaluated on proliferation and apoptosis of human HepG2 cells. ResN were spherical vesicles and its particle diameter, zeta potential were (115.8 +/- 1.3) nm and (-12.8 +/- 1.9) mV, respectively. ResN exhibited significant inhibitory effects against human HepG2 cells by MTT assay, and the IC50 value was 49.2 μg/ml (105.4 μg/ml of Res bulk solution). By flow cytometry assay, there was an increase in G2/M phase cells treated with ResN. The results demonstrated ResN could effectively block the G2/M phase of HepG2 cells, which can also enhance the inhibitory effect of Res against HepG2 cells.

Hyperglycemia and Anthocyanin Inhibit Quercetin Metabolism in HepG2 Cells.

PubMed

Hashimoto, Naoto; Blumberg, Jeffrey B; Chen, C-Y Oliver

2016-02-01

A high glucose (Glu) milieu promotes generation of reactive oxygen species, which may not only cause cellular damage, but also modulate phase II enzymes that are responsible for the metabolism of flavonoids. Thus, we examined the effect of a high Glu milieu on quercetin (Q) metabolism in HepG2 cells. HepG2 cells were grown for 3 days in Glu ranging from 5.5 to 50 mmol/L and/or cyanidin-3-glucoside (C3G) ranging from 0 to 25 μmol/L. Subsequently, the capacity of HepG2 cells to metabolize Q was assessed for up to 16 h. Q metabolites were analyzed by high-performance liquid chromatography. Four major Q metabolites were observed in the culture medium and inside the HepG2 cells. Three of these metabolites appear to be sulfated forms of Q or methylated Q, and one was a methylated Q. These metabolites and Q itself were reduced or tended to be reduced in cells grown in a high Glu compared to a normal Glu medium. Addition of C3G or superoxide dismutase plus catalase did not prevent or enhance reduction of Q metabolites. In vitro, a hyperglycemic milieu decreases the production of the principal Q metabolites in HepG2 cells, mediated through mechanisms independent of oxidative stress.

47-mG2a: A Mouse IgG2a-Type of PcMab-47 Useful for Detecting Podocalyxin in Esophageal Cancers by Immunohistochemistry.

PubMed

Kaneko, Mika K; Itai, Shunsuke; Yamada, Shinji; Kato, Yukinari

2018-04-09

Esophageal cancer is one of the highly malignant cancers. It comprises two of the most common histological tumor types: squamous cell carcinoma (SCC) and adenocarcinoma. SCC accounts for about 90% of esophageal cancers. Despite developments in treatment strategies, the prognosis and survival rate remain poor. Podocalyxin (PODXL) is a highly glycosylated type-I transmembrane protein. It is expressed in normal tissues such as kidney, heart, breast, and pancreas. Upregulation of PODXL correlates with tumor progression, invasion, and metastasis. Therefore, this glycoprotein could be a potential biomarker for predicting the prognosis of some cancers, for instance, brain, colorectal, oral, lung, bladder, prostate, and ovarian cancers. We previously developed a specific and sensitive anti-PODXL monoclonal antibody (mAb), PcMab-47 (mouse IgG 1 , kappa) and its mouse IgG 2a -type (47-mG 2a ). We showed their utility in immunohistochemical analysis of oral cancers. Herein, we demonstrate that PcMab-47 and 47-mG 2a can also be used to detect esophageal squamous cell carcinoma (ESCC) with this technique. These two antibodies, respectively, stained 123/130 (94.6%) and 127/130 (97.7%) ESCC cases, indicating that they can detect PODXL with high sensitivity in this carcinoma. Of more than 3+ cases, 47-mG 2a was more effective than PcMab-47, respectively, staining 56/127 (44.1%) and 41/123 (33.3%). Therefore, 47-mG 2a can be used for the detection of PODXL in ESCC using immunohistochemical analysis.

Nonuniversal gaugino masses and muon g - 2

DOE PAGES

Gogoladze, Ilia; Nasir, Fariha; Shafi, Qaisar; ...

2014-08-11

We consider two classes of supersymmetric models with nonuniversal gaugino masses at the grand unification scale M GUT in an attempt to resolve the apparent muon g-2 anomaly encountered in the Standard Model. We explore two distinct scenarios, one in which all gaugino masses have the same sign at M GUT, and a second case with opposite sign gaugino masses. The sfermion masses in both cases are assumed to be universal at M GUT. We exploit the nonuniversality among gaugino masses to realize large mass splitting between the colored and noncolored sfermions. Thus, the sleptons can have masses in themore » few hundred GeV range, whereas the colored sparticles turn out to be an order of magnitude or so heavier. In both models the resolution of the muon g-2 anomaly is compatible, among other things, with a 125–126 GeV Higgs boson mass and the WMAP dark matter bounds.« less

Laboratory-scale anaerobic sequencing batch reactor for treatment of stillage from fruit distillation.

PubMed

Rada, Elena Cristina; Ragazzi, Marco; Torretta, Vincenzo

2013-01-01

This work describes batch anaerobic digestion tests carried out on stillages, the residue of the distillation process on fruit, in order to contribute to the setting of design parameters for a planned plant. The experimental apparatus was characterized by three reactors, each with a useful volume of 5 L. The different phases of the work carried out were: determining the basic components of the chemical oxygen demand (COD) of the stillages; determining the specific production of biogas; and estimating the rapidly biodegradable COD contained in the stillages. In particular, the main goal of the anaerobic digestion tests on stillages was to measure the parameters of specific gas production (SGP) and gas production rate (GPR) in reactors in which stillages were being digested using ASBR (anaerobic sequencing batch reactor) technology. Runs were developed with increasing concentrations of the feed. The optimal loads for obtaining the maximum SGP and GPR values were 8-9 gCOD L(-1) and 0.9 gCOD g(-1) volatile solids.

Comparison of actinide production in traveling wave and pressurized water reactors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Osborne, A.G.; Smith, T.A.; Deinert, M.R.

The geopolitical problems associated with civilian nuclear energy production arise in part from the accumulation of transuranics in spent nuclear fuel. A traveling wave reactor is a type of breed-burn reactor that could, if feasible, reduce the overall production of transuranics. In one possible configuration, a cylinder of natural or depleted uranium would be subjected to a fast neutron flux at one end. The neutrons would transmute the uranium, producing plutonium and higher actinides. Under the right conditions, the reactor could become critical, at which point a self-stabilizing fission wave would form and propagate down the length of the reactormore » cylinder. The neutrons from the fission wave would burn the fissile nuclides and transmute uranium ahead of the wave to produce additional fuel. Fission waves in uranium are driven largely by the production and fission of {sup 239}Pu. Simulations have shown that the fuel burnup can reach values greater than 400 MWd/kgIHM, before fission products poison the reaction. In this work we compare the production of plutonium and minor actinides produced in a fission wave to that of a UOX fueled light water reactor, both on an energy normalized basis. The nuclide concentrations in the spent traveling wave reactor fuel are computed using a one-group diffusion model and are verified using Monte Carlo simulations. In the case of the pressurized water reactor, a multi-group collision probability model is used to generate the nuclide quantities. We find that the traveling wave reactor produces about 0.187 g/MWd/kgIHM of transuranics compared to 0.413 g/MWd/kgIHM for a pressurized water reactor running fuel enriched to 4.95 % and burned to 50 MWd/kgIHM. (authors)« less

Performance Analysis for the New g-2 Experiment at Fermilab

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stratakis, Diktys; Convery, Mary; Crmkovic, J.

2016-06-01

The new g-2 experiment at Fermilab aims to measure the muon anomalous magnetic moment to a precision of ±0.14 ppm - a fourfold improvement over the 0.54 ppm precision obtained in the g-2 BNL E821experiment. Achieving this goal requires the delivery of highly polarized 3.094 GeV/c muons with a narrow ±0.5% Δp/p acceptance to the g-2 storage ring. In this study, we describe a muon capture and transport scheme that should meet this requirement. First, we present the conceptual design of our proposed scheme wherein we describe its basic features. Then, we detail its performance numerically by simulating the pionmore » production in the (g-2) production target, the muon collection by the downstream beamline optics as well as the beam polarization and spin-momentum correlation up to the storage ring. The sensitivity in performance of our proposed channel against key parameters such as magnet apertures and magnet positioning errors is analyzed« less

U-PuO2, U-PuC, U-PuN cermet fuel for fast reactor

NASA Astrophysics Data System (ADS)

Mishra, Sudhir; Kaity, Santu; Banerjee, Joydipta; Nandi, Chiranjeet; Dey, G. K.; Khan, K. B.

2018-02-01

Cermet fuel combines beneficial properties of both ceramic and metal and attracts global interest for research as a candidate fuel for nuclear reactors. In the present study, U matrix PuC/PuN/PuO2 cermet for fast reactor have been fabricated on laboratory scale by the powder metallurgy route. Characterization of the fuel has been carried out using Dilatometer, Differential Thermal analysis (DTA), X-ray diffractometer and Optical microscope. X ray diffraction study of the fuel reveals presence of different phases. The PuN dispersed cermet was observed to have high solidus temperature as compared to PuC and PuO2 dispersed cermet. Swelling was observed in U matrix PuO2 cermet which also showed higher thermal expansion. Among the three cermets studied, U matrix PuC cermet showed maximum thermal conductivity.

Nitrifying bio-cord reactor: performance optimization and effects of substratum and air scouring.

PubMed

Tian, Xin; Ahmed, Warsama; Delatolla, Robert

2017-11-20

Ammonia removal kinetics and solids' production performance of the bio-cord technology are studied in this research. Three nitrifying reactors housing different bio-cord substratum were operated at five different ammonia loading rates. All of the bio-cord substrata demonstrated stable and high ammonia-nitrogen removal efficiencies of 96.8 ± 0.9%, 97.0 ± 0.6% and 92.0 ± 0.4% at loading rates of 0.8, 1.6 and 1.8 g [Formula: see text]-N/m 2  d, respectively. At these same loading rates, the bio-cord reactors housing the three substrata also showed low solids' production rates of 0.19 ± 0.03, 0.23 ± 0.02, 0.25 ± 0.03 g total suspended solids/d. A reduction of system stability, identified via fluctuating ammonia removal rates, was however observed for all substrata at loading rates of 2.1 and 2.4 g [Formula: see text]-N/m 2  d. Further, the solids' production rates at these higher loading conditions were also observed to fluctuate for all substrata, likely indicating intermediate sloughing events. The effects of enhancing the air scouring of the bio-cord on the ammonia removal rate was shown to be dependent upon the substratum, while enhanced air scouring of the bio-cord was shown to stabilize the production of solids for all substrata. This study represents the first performance and optimization study of the bio-cord technology for low-carbon nitrification and shows that air scouring of the substratum reduces sloughing events at elevated loading and that the bio-cord technology achieves stable kinetics above conventional rates of 1 g [Formula: see text]-N/m 2  d to values of 1.8 g [Formula: see text]-N/m 2  d.

Abatement of fluorinated compounds using a 2.45GHz microwave plasma torch with a reverse vortex plasma reactor.

PubMed

Kim, J H; Cho, C H; Shin, D H; Hong, Y C; Shin, Y W

2015-08-30

Abatement of fluorinated compounds (FCs) used in semiconductor and display industries has received an attention due to the increasingly stricter regulation on their emission. We have developed a 2.45GHz microwave plasma torch with reverse vortex reactor (RVR). In order to design a reverse vortex plasma reactor, we calculated a volume fraction and temperature distribution of discharge gas and waste gas in RVR by ANSYS CFX of computational fluid dynamics (CFD) simulation code. Abatement experiments have been performed with respect to SF6, NF3 by varying plasma power and N2 flow rates, and FCs concentration. Detailed experiments were conducted on the abatement of NF3 and SF6 in terms of destruction and removal efficiency (DRE) using Fourier transform infrared (FTIR). The DRE of 99.9% for NF3 was achieved without an additive gas at the N2 flow rate of 150 liter per minute (L/min) by applying a microwave power of 6kW with RVR. Also, a DRE of SF6 was 99.99% at the N2 flow rate of 60 L/min using an applied microwave power of 6kW. The performance of reverse vortex reactor increased about 43% of NF3 and 29% of SF6 abatements results definition by decomposition energy per liter more than conventional vortex reactor. Copyright © 2015 Elsevier B.V. All rights reserved.

Characterisation of well-adhered ZrO2 layers produced on structured reactors using the sonochemical sol-gel method

NASA Astrophysics Data System (ADS)

Jodłowski, Przemysław J.; Chlebda, Damian K.; Jędrzejczyk, Roman J.; Dziedzicka, Anna; Kuterasiński, Łukasz; Sitarz, Maciej

2018-01-01

The aim of this study was to obtain thin zirconium dioxide coatings on structured reactors using the sonochemical sol-gel method. The preparation method of metal oxide layers on metallic structures was based on the synergistic combination of three approaches: the application of ultrasonic irradiation during the synthesis of Zr sol-gel based on a precursor solution containing zirconium(IV) n-propoxide, the addition of stabilszing agents, and the deposition of ZrO2 on the metallic structures using the dip-coating method. As a result, dense, uniform zirconium dioxide films were obtained on the FeCrAlloy supports. The structured reactors were characterised by various physicochemical methods, such as BET, AFM, EDX, XRF, XRD, XPS and in situ Raman spectroscopy. The results of the structural analysis by Raman and XPS spectroscopy confirmed that the metallic surface was covered by a ZrO2 layer without any impurities. SEM/EDX mapping revealed that the deposited ZrO2 covered the metallic support uniformly. The mechanical and high temperature tests showed that the developed ultrasound assisted sol-gel method is an efficient way to obtain thin, well-adhered zirconium dioxide layers on the structured reactors. The prepared metallic supports covered with thin ZrO2 layers may be a good alternative to layered structured reactors in several dynamics flow processes, for example for gas exhaust abatement.

The First CERN Muon g-2 Experiment

NASA Astrophysics Data System (ADS)

Garwin, Richard

2014-03-01

The Summary of the 16 June 1965 publication of this experiment in Il Nuovo Cimento reads, ``The anomalous part of the gyromagnetic ratio, a ≡ 1/2 (g-2) of the muon has been measured by determining the precession θ = aω0B- t for 100 MeV/c muons as a function of storage time t in a known static magnetic field of the form B = B0(1 +ay +by2 + cy3 + dy4) . The result is aexp = (1162 +/- 5) . 10-6 compared with the theoretical value ath = α/2 π + 0.76α2/π2 = 1165 . 10-6. This agreement shows that the muon obeys standard quantum electrodynamics down to distances ~ 0.1 fermi. Details are given of the methods used to store muons for ~ 103 turns in the field, and of measuring techniques and precautions necessary to achieve the final accuracy. Some of the methods of orbit analysis, magnet construction shimming and measurement, polarization analysis, and digital timing electronics may be of more general interest.'' The paper is available in full at http://www.fas.org/rlg/060065%20Nuovo%20Cimento.pdf The authors valued highly the presentation of experimental details, which will be the emphasis of this talk, recounting the motivation of choices made with the tools and technology of that era. In collaboration with G. Charpak, F. J. M. Farley, T. Mueller, J. C. Sens, and A. Zichichi.