Influence of C-5 substituted cytosine and related nucleoside analogs on the formation of benzo[a]pyrene diol epoxide-dG adducts at CG base pairs of DNA.

PubMed

Guza, Rebecca; Kotandeniya, Delshanee; Murphy, Kristopher; Dissanayake, Thakshila; Lin, Chen; Giambasu, George Madalin; Lad, Rahul R; Wojciechowski, Filip; Amin, Shantu; Sturla, Shana J; Hudson, Robert H E; York, Darrin M; Jankowiak, Ryszard; Jones, Roger; Tretyakova, Natalia Y

2011-05-01

Endogenous 5-methylcytosine ((Me)C) residues are found at all CG dinucleotides of the p53 tumor suppressor gene, including the mutational 'hotspots' for smoking induced lung cancer. (Me)C enhances the reactivity of its base paired guanine towards carcinogenic diolepoxide metabolites of polycyclic aromatic hydrocarbons (PAH) present in cigarette smoke. In the present study, the structural basis for these effects was investigated using a series of unnatural nucleoside analogs and a representative PAH diolepoxide, benzo[a]pyrene diolepoxide (BPDE). Synthetic DNA duplexes derived from a frequently mutated region of the p53 gene (5'-CCCGGCACCC GC[(15)N(3),(13)C(1)-G]TCCGCG-3', + strand) were prepared containing [(15)N(3), (13)C(1)]-guanine opposite unsubstituted cytosine, (Me)C, abasic site, or unnatural nucleobase analogs. Following BPDE treatment and hydrolysis of the modified DNA to 2'-deoxynucleosides, N(2)-BPDE-dG adducts formed at the [(15)N(3), (13)C(1)]-labeled guanine and elsewhere in the sequence were quantified by mass spectrometry. We found that C-5 alkylcytosines and related structural analogs specifically enhance the reactivity of the base paired guanine towards BPDE and modify the diastereomeric composition of N(2)-BPDE-dG adducts. Fluorescence and molecular docking studies revealed that 5-alkylcytosines and unnatural nucleobase analogs with extended aromatic systems facilitate the formation of intercalative BPDE-DNA complexes, placing BPDE in a favorable orientation for nucleophilic attack by the N(2) position of guanine. © The Author(s) 2011. Published by Oxford University Press.

High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

PubMed

Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

2015-11-02

Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Why the tautomerization of the G·C Watson-Crick base pair via the DPT does not cause point mutations during DNA replication? QM and QTAIM comprehensive analysis.

PubMed

Brovarets', Ol'ha O; Hovorun, Dmytro M

2014-01-01

The ground-state tautomerization of the G·C Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4), corresponding to a hydrophobic interface of protein-nucleic acid interactions, using DFT and MP2 levels of quantum-mechanical (QM) theory and quantum theory "Atoms in molecules" (QTAIM). Based on the sweeps of the electron-topological, geometric, polar, and energetic parameters, which describe the course of the G·C ↔ G*·C* tautomerization (mutagenic tautomers of the G and C bases are marked with an asterisk) through the DPT along the intrinsic reaction coordinate (IRC), it was proved that it is, strictly speaking, a concerted asynchronous process both at the DFT and MP2 levels of theory, in which protons move with a small time gap in vacuum, while this time delay noticeably increases in the continuum with ϵ = 4. It was demonstrated using the conductor-like polarizable continuum model (CPCM) that the continuum with ϵ = 4 does not qualitatively affect the course of the tautomerization reaction. The DPT in the G·C Watson-Crick base pair occurs without any intermediates both in vacuum and in the continuum with ϵ = 4 at the DFT/MP2 levels of theory. The nine key points along the IRC of the G·C base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These key points have been used to define the reactant, transition state, and product regions of the DPT reaction in the G·C base pair. Analysis of the energetic characteristics of the H-bonds allows us to arrive at a definite conclusion that the middle N1H⋯N3/N3H⋯N1 and the lower N2H⋯O2/N2H⋯O2 parallel H-bonds in the G·C/G*·C* base pairs, respectively, are anticooperative, that is, the strengthening of the middle H-bond is accompanied

Higher order structural effects stabilizing the reverse Watson–Crick Guanine-Cytosine base pair in functional RNAs

PubMed Central

Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi

2014-01-01

The G:C reverse Watson–Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. PMID:24121683

Influence of Hydration on Proton Transfer in the Guanine-Cytosine Radical Cation (G•+-C) Base Pair: A Density Functional Theory Study

PubMed Central

Kumar, Anil; Sevilla, Michael D.

2009-01-01

On one-electron oxidation all molecules including DNA bases become more acidic in nature. For the GC base pair experiments suggest that a facile proton transfer takes place in the G•+-C base pair from N1 of G•+ to N3 of cytosine. This intra-base pair proton transfer reaction has been extensively considered using theoretical methods for the gas phase and it is predicted that the proton transfer is slightly unfavorable in disagreement with experiment. In the present study, we consider the effect of the first hydration layer on the proton transfer reaction in G•+-C by the use of density functional theory (DFT), B3LYP/6-31+G** calculations of the G•+-C base pair in the presence of 6 and 11 water molecules. Under the influence of hydration of 11 waters, a facile proton transfer from N1 of G•+ to N3 of C is predicted. The zero point energy (ZPE) corrected forward and backward energy barriers, for the proton transfer from N1 of G•+ to N3 of C, was found to be 1.4 and 2.6 kcal/mol, respectively. The proton transferred G•-(H+)C + 11H2O was found to be 1.2 kcal/mol more stable than G•+-C + 11H2O in agreement with experiment. The present calculation demonstrates that the inclusion of the first hydration shell around G•+-C base pair has an important effect on the internal proton transfer energetics. PMID:19485319

An indole-linked C8-deoxyguanosine nucleoside acts as a fluorescent reporter of Watson-Crick versus Hoogsteen base pairing.

PubMed

Schlitt, Katherine M; Millen, Andrea L; Wetmore, Stacey D; Manderville, Richard A

2011-03-07

Pyrrole- and indole-linked C(8)-deoxyguanosine nucleosides act as fluorescent reporters of H-bonding specificity. Their fluorescence is quenched upon Watson-Crick H-bonding to dC, while Hoogsteen H-bonding to G enhances emission intensity. The indole-linked probe is ∼ 10-fold brighter and shows promise as a fluorescent reporter of Hoogsteen base pairing.

Loss of G-A base pairs is insufficient for achieving a large opening of U4 snRNA K-turn motif.

PubMed

Cojocaru, Vlad; Klement, Reinhard; Jovin, Thomas M

2005-01-01

Upon binding to the 15.5K protein, two tandem-sheared G-A base pairs are formed in the internal loop of the kink-turn motif of U4 snRNA (Kt-U4). We have reported that the folding of Kt-U4 is assisted by protein binding. Unstable interactions that contribute to a large opening of the free RNA ('k-e motion') were identified using locally enhanced sampling molecular dynamics simulations, results that agree with experiments. A detailed analysis of the simulations reveals that the k-e motion in Kt-U4 is triggered both by loss of G-A base pairs in the internal loop and backbone flexibility in the stems. Essential dynamics show that the loss of G-A base pairs is correlated along the first mode but anti-correlated along the third mode with the k-e motion. Moreover, when enhanced sampling was confined to the internal loop, the RNA adopted an alternative conformation characterized by a sharper kink, opening of G-A base pairs and modified stacking interactions. Thus, loss of G-A base pairs is insufficient for achieving a large opening of the free RNA. These findings, supported by previously published RNA structure probing experiments, suggest that G-A base pair formation occurs upon protein binding, thereby stabilizing a selective orientation of the stems.

Hydrogen bond disruption in DNA base pairs from (14)C transmutation.

PubMed

Sassi, Michel; Carter, Damien J; Uberuaga, Blas P; Stanek, Christopher R; Mancera, Ricardo L; Marks, Nigel A

2014-09-04

Recent ab initio molecular dynamics simulations have shown that radioactive carbon does not normally fragment DNA bases when it decays. Motivated by this finding, density functional theory and Bader analysis have been used to quantify the effect of C → N transmutation on hydrogen bonding in DNA base pairs. We find that (14)C decay has the potential to significantly alter hydrogen bonds in a variety of ways including direct proton shuttling (thymine and cytosine), thermally activated proton shuttling (guanine), and hydrogen bond breaking (cytosine). Transmutation substantially modifies both the absolute and relative strengths of the hydrogen bonding pattern, and in two instances (adenine and cytosine), the density at the critical point indicates development of mild covalent character. Since hydrogen bonding is an important component of Watson-Crick pairing, these (14)C-induced modifications, while infrequent, may trigger errors in DNA transcription and replication.

Thermodynamics of triple helix formation: spectrophotometric studies on the d(A)10.2d(T)10 and d(C+3T4C+3).d(G3A4G3).d(C3T4C3) triple helices.

PubMed Central

Pilch, D S; Brousseau, R; Shafer, R H

1990-01-01

We have stabilized the d(A)10.2d(T)10 and d(C+LT4C+3).d(G3A4G3).d(C3T4C3) triple helices with either NaCl or MgCl2 at pH 5.5. UV mixing curves demonstrate a 1:2 stoichiometry of purine to pyrimidine strands under the appropriate conditions of pH and ionic strength. Circular dichroic titrations suggest a possible sequence-independent spectral signature for triplex formation. Thermal denaturation profiles indicate the initial loss of the third strand followed by dissociation of the underlying duplex with increasing temperature. Depending on the base sequence and ionic conditions, the binding affinity of the third strand for the duplex at 25 degrees C is two to five orders of magnitude lower than that of the two strands forming the duplex. Thermodynamic parameters for triplex formation were determined for both sequences in the presence of 50 mM MgCl2 and/or 2.0 M NaCl. Hoogsteen base pairs are 0.22-0.64 kcal/mole less stable than Watson-Crick base pairs, depending on ionic conditions and base composition. C+.G and T.A Hoogsteen base pairs appear to have similar stability in the presence of Mg2+ ions at low pH. PMID:2216768

Recognition of T·G mismatched base pairs in DNA by stacked imidazole-containing polyamides: surface plasmon resonance and circular dichroism studies

PubMed Central

Lacy, Eilyn R.; Cox, Kari K.; Wilson, W. David; Lee, Moses

2002-01-01

An imidazole-containing polyamide trimer, f-ImImIm, where f is a formamido group, was recently found using NMR methods to recognize T·G mismatched base pairs. In order to characterize in detail the T·G recognition affinity and specificity of imidazole-containing polyamides, f-ImIm, f-ImImIm and f-PyImIm were synthesized. The kinetics and thermodynamics for the polyamides binding to Watson–Crick and mismatched (containing one or two T·G, A·G or G·G mismatched base pairs) hairpin oligonucleotides were determined by surface plasmon resonance and circular dichroism (CD) methods. f-ImImIm binds significantly more strongly to the T·G mismatch-containing oligonucleotides than to the sequences with other mismatched or with Watson–Crick base pairs. Compared with the Watson–Crick CCGG sequence, f-ImImIm associates more slowly with DNAs containing T·G mismatches in place of one or two C·G base pairs and, more importantly, the dissociation rate from the T·G oligonucleotides is very slow (small kd). These results clearly demonstrate the binding selectivity and enhanced affinity of side-by-side imidazole/imidazole pairings for T·G mismatches and show that the affinity and specificity increase arise from much lower kd values with the T·G mismatched duplexes. CD titration studies of f-ImImIm complexes with T·G mismatched sequences produce strong induced bands at ∼330 nm with clear isodichroic points, in support of a single minor groove complex. CD DNA bands suggest that the complexes remain in the B conformation. PMID:11937638

Effect of Watson-Crick and Hoogsteen base pairing on the conformational stability of C8-phenoxyl-2'-deoxyguanosine adducts.

PubMed

Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D

2010-10-14

Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which

Ni2+-binding RNA motifs with an asymmetric purine-rich internal loop and a G-A base pair.

PubMed Central

Hofmann, H P; Limmer, S; Hornung, V; Sprinzl, M

1997-01-01

RNA molecules with high affinity for immobilized Ni2+ were isolated from an RNA pool with 50 randomized positions by in vitro selection-amplification. The selected RNAs preferentially bind Ni2+ and Co2+ over other cations from first series transition metals. Conserved structure motifs, comprising about 15 nt, were identified that are likely to represent the Ni2+ binding sites. Two conserved motifs contain an asymmetric purine-rich internal loop and probably a mismatch G-A base pair. The structure of one of these motifs was studied with proton NMR spectroscopy and formation of the G-A pair at the junction of helix and internal loop was demonstrated. Using Ni2+ as a paramagnetic probe, a divalent metal ion binding site near this G-A base pair was identified. Ni2+ ions bound to this motif exert a specific stabilization effect. We propose that small asymmetric purine-rich loops that contain a G-A interaction may represent a divalent metal ion binding site in RNA. PMID:9409620

m1A and m1G Potently Disrupt A-RNA Structure Due to the Intrinsic Instability of Hoogsteen Base Pairs

PubMed Central

Zhou, Huiqing; Kimsey, Isaac J.; Nikolova, Evgenia N.; Sathyamoorthy, Bharathwaj; Grazioli, Gianmarc; McSally, James; Bai, Tianyu; Wunderlich, Christoph H.; Kreutz, Christoph; Andricioaei, Ioan; Al-Hashimi, Hashim M.

2016-01-01

The B-DNA double helix can dynamically accommodate G–C and A–T base pairs in either Watson-Crick or Hoogsteen configurations. Here, we show that G–C+ and A–U Hoogsteen base pairs are strongly disfavored in A-RNA. As a result, N1-methyl adenosine and N1-methyl guanosine, which occur in DNA as a form of alkylation damage, and in RNA as a posttranscriptional modification, have dramatically different consequences. They create G–C+ and A–U Hoogsteen base pairs in duplex DNA that maintain the structural integrity of the double helix, but block base pairing all together and induce local duplex melting in RNA, providing a mechanism for potently disrupting RNA structure through posttranscriptional modifications. The markedly different propensities to form Hoogsteen base pairs in B-DNA and A-RNA may help meet the opposing requirements of maintaining genome stability on one hand, and dynamically modulating the structure of the epitranscriptome on the other. PMID:27478929

Role of 6-Mercaptopurine in the potential therapeutic targets DNA base pairs and G-quadruplex DNA: insights from quantum chemical and molecular dynamics simulations.

PubMed

Radhika, R; Shankar, R; Vijayakumar, S; Kolandaivel, P

2018-05-01

The theoretical studies on DNA with the anticancer drug 6-Mercaptopurine (6-MP) are investigated using theoretical methods to shed light on drug designing. Among the DNA base pairs considered, 6-MP is stacked with GC with the highest interaction energy of -46.19 kcal/mol. Structural parameters revealed that structure of the DNA base pairs is deviated from the planarity of the equilibrium position due to the formation of hydrogen bonds and stacking interactions with 6-MP. These deviations are verified through the systematic comparison between X-H bond contraction and elongation and the associated blue shift and red shift values by both NBO analysis and vibrational analysis. Bent's rule is verified for the C-H bond contraction in the 6-MP interacted base pairs. The AIM results disclose that the higher values of electron density (ρ) and Laplacian of electron density (∇ 2 ρ) indicate the increased overlap between the orbitals that represent the strong interaction and positive values of the total electron density show the closed-shell interaction. The relative sensitivity of the chemical shift values for the DNA base pairs with 6-MP is investigated to confirm the hydrogen bond strength. Molecular dynamics simulation studies of G-quadruplex DNA d(TGGGGT) 4 with 6-MP revealed that the incorporation of 6-MP appears to cause local distortions and destabilize the G-quadruplex DNA.

Imidazopyridine/Pyrrole and hydroxybenzimidazole/pyrrole pairs for DNA minor groove recognition.

PubMed

Renneberg, Dorte; Dervan, Peter B

2003-05-14

The DNA binding properties of fused heterocycles imidazo[4,5-b]pyridine (Ip) and hydroxybenzimidazole (Hz) paired with pyrrole (Py) in eight-ring hairpin polyamides are reported. The recognition profile of Ip/Py and Hz/Py pairs were compared to the five-membered ring pairs Im/Py and Hp/Py on a DNA restriction fragment at four 6-base pair recognition sites which vary at a single position 5'-TGTNTA-3', where N = G, C, T, A. The Ip/Py pair distinguishes G.C from C.G, T.A, and A.T, and the Hz/Py pair distinguishes T.A from A.T, G.C, and C.G, affording a new set of heterocycle pairs to target the four Watson-Crick base pairs in the minor groove of DNA.

Graphene and g-C3N4 based photocatalysts for NOx removal: A review

NASA Astrophysics Data System (ADS)

Nikokavoura, Aspasia; Trapalis, Christos

2018-02-01

NOx liberated into atmosphere from automobile exhausts and fossil fuel combustion, comprise the major air pollutants. They are responsible for serious environmental problems such as acid rain, ozone accumulation, haze and photochemical smog. Besides they contribute to the deterioration of human health by causing decrease of the lung function and respiratory problems. The application of photocatalytic methods in order to mitigate the presence of NOx in the atmosphere is preferable as they are environmentally friendly, mild and low cost. Therefore, in this review, the photocatalytic activity of g-C3N4 and graphene based composites towards NOx removal was discussed. NOx oxidation to non volatile nitrates on the surface of graphene and g-C3N4 based photocatalysts has attracted much interest during the last years due to their structures with unique features such as large specific surface area, thermal and chemical stability and enhanced visible light utilization. The formation of 2D-2D intimate heterojunctions between graphene or g-C3N4 and other components ensures the enhanced charge transfer, lifetime of electron/hole pairs and thus photocatalytic activity. The increased visible light harvesting also contributes to their usefulness as effective photocatalytic materials. In the present work, the advantages of these novel photocatalysts and the differences/similarities between them were exhaustively highlighted. The role of graphene as catalyst promoter, electron reservoir, support and photosensitizer in its photocatalytic composites was emphasized. The effect of g-C3N4 doping and copolymerization with metals/semiconductors on its photocatalytic activity towards NOx oxidation was thoroughly discussed. Besides, the preparation methods, photocatalytic efficiencies, type of irradiation, utilization of appropriate cocatalysts, and reaction mechanisms during the photocatalytic NOx removal by graphene and g-C3N4 composies, were summarized. It was demonstrated that in the vast

Lewis pair polymerization by classical and frustrated Lewis pairs: acid, base and monomer scope and polymerization mechanism.

PubMed

Zhang, Yuetao; Miyake, Garret M; John, Mallory G; Falivene, Laura; Caporaso, Lucia; Cavallo, Luigi; Chen, Eugene Y-X

2012-08-14

Classical and frustrated Lewis pairs (LPs) of the strong Lewis acid (LA) Al(C(6)F(5))(3) with several Lewis base (LB) classes have been found to exhibit exceptional activity in the Lewis pair polymerization (LPP) of conjugated polar alkenes such as methyl methacrylate (MMA) as well as renewable α-methylene-γ-butyrolactone (MBL) and γ-methyl-α-methylene-γ-butyrolactone (γ-MMBL), leading to high molecular weight polymers, often with narrow molecular weight distributions. This study has investigated a large number of LPs, consisting of 11 LAs as well as 10 achiral and 4 chiral LBs, for LPP of 12 monomers of several different types. Although some more common LAs can also be utilized for LPP, Al(C(6)F(5))(3)-based LPs are far more active and effective than other LA-based LPs. On the other hand, several classes of LBs, when paired with Al(C(6)F(5))(3), can render highly active and effective LPP of MMA and γ-MMBL; such LBs include phosphines (e.g., P(t)Bu(3)), chiral chelating diphosphines, N-heterocyclic carbenes (NHCs), and phosphazene superbases (e.g., P(4)-(t)Bu). The P(4)-(t)Bu/Al(C(6)F(5))(3) pair exhibits the highest activity of the LP series, with a remarkably high turn-over frequency of 9.6 × 10(4) h(-1) (0.125 mol% catalyst, 100% MMA conversion in 30 s, M(n) = 2.12 × 10(5) g mol(-1), PDI = 1.34). The polymers produced by LPs at RT are typically atactic (P(γ)MMBL with ∼47% mr) or syndio-rich (PMMA with ∼70-75% rr), but highly syndiotactic PMMA with rr ∼91% can be produced by chiral or achiral LPs at -78 °C. Mechanistic studies have identified and structurally characterized zwitterionic phosphonium and imidazolium enolaluminates as the active species of the current LPP system, which are formed by the reaction of the monomer·Al(C(6)F(5))(3) adduct with P(t)Bu(3) and NHC bases, respectively. Kinetic studies have revealed that the MMA polymerization by the (t)Bu(3)P/Al(C(6)F(5))(3) pair is zero-order in monomer concentration after an initial

A Bridging Water Anchors the Tethered 5-(3-Aminopropyl)-2′-deoxyuridine Amine in the DNA Major Groove Proximate to the N+2 C·G Base Pair: Implications for Formation of Interstrand 5′-GNC-3′ Cross-Links by Nitrogen Mustards‡

PubMed Central

Wang, Feng; Li, Feng; Ganguly, Manjori; Marky, Luis A.; Gold, Barry; Egli, Martin; Stone, Michael P.

2009-01-01

Site-specific insertion of 5-(3-aminopropyl)-2′-deoxyuridine (Z3dU) and 7-deaza-dG into the Dickerson-Drew dodecamers 5′-d(C1G2C3G4A5A6T7T8C9Z10C11G12)-3′ · 5′-d(C13G14C15G16A17A18T19T20-C21Z22C23G24)-3′ (named DDDZ10) and 5′-d(C1G2C3G4A5A6T7X8C9Z10C11G12)-3′ · 5′-d(C13G14C15G16A17A18-T19X20C21Z22C23G24)-3′ (named DDD2+Z10)(X = Z3dU; Z = 7-deaza-dG) suggests a mechanism underlying the formation of interstrand N+2 DNA cross-links by nitrogen mustards, e.g., melphalan and mechlorethamine. Analysis of the DDD2+Z10 duplex reveals that the tethered cations at base pairs A5 · X20 and X8 · A17 extend within the major groove in the 3′-direction, toward conserved Mg2+ binding sites located adjacent to N+2 base pairs C3 · Z22 and Z10 · C15. Bridging waters located between the tethered amines and either Z10 or Z22 O6 stabilize the tethered cations and allow interactions with the N + 2 base pairs without DNA bending. Incorporation of 7-deaza-dG into the DDD2+Z10 duplex weakens but does not eliminate electrostatic interactions between tethered amines and Z10 O6 and Z22 O6. The results suggest a mechanism by which tethered N7-dG aziridinium ions, the active species involved in formation of interstrand 5′-GNC-3′ cross-links by nitrogen mustards, modify the electrostatics of the major groove and position the aziridinium ions proximate to the major groove edge of the N+2 C · G base pair, facilitating interstrand cross-linking. PMID:18549246

Roles of the amino group of purine bases in the thermodynamic stability of DNA base pairing.

PubMed

Nakano, Shu-ichi; Sugimoto, Naoki

2014-08-05

The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I) and 2'-deoxyribo-2,6-diaminopurine (D) as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G • C > D • T ≈ I • C > A • T > G • T > I • T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.

Incorporating a guanidine-modified cytosine base into triplex-forming PNAs for the recognition of a C-G pyrimidine–purine inversion site of an RNA duplex

PubMed Central

Toh, Desiree-Faye Kaixin; Devi, Gitali; Patil, Kiran M.; Qu, Qiuyu; Maraswami, Manikantha; Xiao, Yunyun; Loh, Teck Peng; Zhao, Yanli; Chen, Gang

2016-01-01

RNA duplex regions are often involved in tertiary interactions and protein binding and thus there is great potential in developing ligands that sequence-specifically bind to RNA duplexes. We have developed a convenient synthesis method for a modified peptide nucleic acid (PNA) monomer with a guanidine-modified 5-methyl cytosine base. We demonstrated by gel electrophoresis, fluorescence and thermal melting experiments that short PNAs incorporating the modified residue show high binding affinity and sequence specificity in the recognition of an RNA duplex containing an internal inverted Watson-Crick C-G base pair. Remarkably, the relatively short PNAs show no appreciable binding to DNA duplexes or single-stranded RNAs. The attached guanidine group stabilizes the base triple through hydrogen bonding with the G base in a C-G pair. Selective binding towards an RNA duplex over a single-stranded RNA can be rationalized by the fact that alkylation of the amine of a 5-methyl C base blocks the Watson–Crick edge. PNAs incorporating multiple guanidine-modified cytosine residues are able to enter HeLa cells without any transfection agent. PMID:27596599

Anomalous scaling of Δ C versus T c in the Fe-based superconductors: the $${S}_{\\pm }$$-wave pairing state model

DOE PAGES

Bang, Yunkyu; Stewart, G. R.

2016-02-01

The strong power law behavior of the specific heat jumpmore » $${\\rm{\\Delta }}C\\;$$ versus T c $$({\\rm{\\Delta }}C/{T}_{{\\rm{c}}}\\sim {T}_{{\\rm{c}}}^{\\alpha },\\alpha \\approx 2)$$, first observed by Bud'ko et al (2009 Phys. Rev. B 79 220516), has been confirmed with several families of the Fe-based superconducting compounds with various dopings. We tested a minimal two band BCS model to understand this anomalous behavior and showed that this non-BCS relation between $${\\rm{\\Delta }}C\\;$$ versus T c is a generic property of the multiband superconducting state paired by a dominant interband interaction ($${V}_{\\mathrm{inter}}\\gt {V}_{\\mathrm{intra}}$$) reflecting the relation $$\\frac{{{\\rm{\\Delta }}}_{{\\rm{h}}}}{{{\\rm{\\Delta }}}_{{\\rm{e}}}}\\sim \\sqrt{\\frac{{N}_{{\\rm{e}}}}{{N}_{{\\rm{h}}}}}$$ near T c, as in the $${S}_{\\pm }$$-wave pairing state. We also found that this $${\\rm{\\Delta }}C\\;$$ versus T c power law can continuously change from the ideal BNC scaling to a considerable deviation by a moderate variation of the impurity scattering rate $${{\\rm{\\Gamma }}}_{0}$$ (non-pair-breaking). Finally, as a result, our model provides a consistent explanation why the electron-doped Fe-based superconductors follow the ideal BNC scaling very well while the hole-doped systems often show varying degree of deviations.« less

A Bridging Water Anchors the Tethered 5-(3-Aminopropyl)-2′-deoxyuridine Amine in the DNA Major Groove Proximate to the N+2 C·G Base Pair: Implications for Formation of Interstrand 5′-GNC-3′ Cross-Links by Nitrogen Mustards

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Feng; Li, Feng; Ganguly, Manjori

2008-11-14

Site-specific insertion of t-(3-aminopropyl)-2'-deoxyuridine (Z3dU) and 7-deaza-dG into the Dickerson-Drew dodecamers 5'-d(C{sup 1}G{sup 2}C{sup 3}G{sup 4}A{sup 5}A{sup 6}T{sup 7}T{sup 8}C{sup 9}{und Z}{sup 10}C{sup 11}G{sup 12})-3'{center_dot}5'-d (C{sup 13}G{sup 14}C{sup 15}G{sup 16}A{sup 17}A{sup 18}T{sup 19}T{sup 20}C{sup 21}{und Z}{sup 22}C{sup 23}G{sup 24})-3' (named DDD{sup Z10}) and 5'-d(C{sup 1}G{sup 2}C{sup 3}G{sup 4}A{sup 5}A{sup 6}T{sup 7}{und X}{sup 20}C{sup 21}{und Z}{sup 22}C{sup 23}G{sup 24})-3' (named DDD{sup 2+Z10}) (X = 73dU; Z = 7-deaza-dG) suggests a mechanism underlying the formation of interstrand N+2 DNA cross-links by nitrogen mustards, e.g., melphalan and mechlorethamine. Analysis of the DDD{sup 2+Z10} duplex reveals that the tethered cations at base pairs A{supmore » 5}{center_dot}X{sup 20} and X{sup 8}{center_dot}A{sup 17} extend within the major groove in the 3'-direction, toward conserved Mg{sup 2+} binding sites located adjacent to N+2 base pairs C{sup 3}{center_dot}Z{sup 22} and Z{sup 10}{center_dot}C{sup 15}. Bridging waters located between the tethered amines and either Z{sup 10} or Z{sup 22} O{sup 6} stabilize the tethered cations and allow interactions with the N + 2 base pairs without DNA bending. Incorporation of 7-deaza-dG into the DDD{sup 2+Z10} duplex weakens but does not eliminate electrostatic interactions between tethered amines and Z{sup 10} O{sup 6} and Z{sup 22} O{sup 6}. The results suggest a mechanism by which tethered N7-dG aziridinium ions, the active species involved in formation of interstrand 5'-GNC-3' cross-links by nitrogen mustards, modify the electrostatics of the major groove and position the aziridinium ions proximate to the major groove edge of the N+2 C{center_dot}G base pair, facilitating interstrand cross-linking.« less

Ultrashort fluorescence lifetimes of hydrogen-bonded base pairs of guanosine and cytidine in solution.

PubMed

Schwalb, Nina K; Michalak, Thomas; Temps, Friedrich

2009-12-24

The optically excited electronic states of hydrogen-bonded homo- and heterodimers of guanosine (G) and deoxycytidine (C) were investigated by femtosecond fluorescence up-conversion spectroscopy. The base pairs were prepared in CHCl(3) solution by employing tert-butyldimethylsilyl (TBDMS) groups at the OH positions of the ribose (G) or deoxyribose (C) moieties to enhance the solubilities of the nucleosides in organic solvents. The H-bonded complexes that were obtained were characterized by FTIR spectroscopy. Fluorescence lifetime measurements were performed following electronic excitation at a series of UV wavelengths from lambda(pump) = 294 nm, close to the electronic origins of the bases, to lambda(pump) = 262 nm, where significant excess vibronic energy is deposited in the molecules, at nucleoside concentrations of c(0) = 0.1 and 1.0 mM. The experimental results revealed the existence of an ultrafast deactivation pathway for the optically prepared electronically excited state(s) of the G.C Watson-Crick base pair, which was found to have a lifetime of tau(GC) = 0.30(3) ps (with 2sigma error limits) irrespective of the pump wavelength. A similar short decay time, tau(GG) = 0.32(2) ps, was observed for the respective excited G.G homodimer. In contrast, the excited G monomer displayed a significantly longer-lived and wavelength-dependent deactivation, requiring three time constants, between 0.43(6) ps < or = tau(G,1) < or = 1.2(1) ps, 4.2(8) ps < or = tau(G,2) < or = 8(1) ps, and tau(G,3) = 195(32) ps. Self-complexation of C, on the other hand, led to a longer-lived excited state with a lifetime estimated between 1 ps < or = tau(CC) < or = 10 ps, compared to the dominant initial subpicosecond decay time of the C monomer of tau(C,1) = 0.80(4) ps.

A review on g-C3N4-based photocatalysts

NASA Astrophysics Data System (ADS)

Wen, Jiuqing; Xie, Jun; Chen, Xiaobo; Li, Xin

2017-01-01

As one of the most appealing and attractive technologies, heterogeneous photocatalysis has been utilized to directly harvest, convert and store renewable solar energy for producing sustainable and green solar fuels and a broad range of environmental applications. Due to their unique physicochemical, optical and electrical properties, a wide variety of g-C3N4-based photocatalysts have been designed to drive various reduction and oxidation reactions under light irradiation with suitable wavelengths. In this review, we have systematically summarized the photocatalytic fundamentals of g-C3N4-based photocatalysts, including fundamental mechanism of heterogeneous photocatalysis, advantages, challenges and the design considerations of g-C3N4-based photocatalysts. The versatile properties of g-C3N4-based photocatalysts are highlighted, including their crystal structural, surface phisicochemical, stability, optical, adsorption, electrochemical, photoelectrochemical and electronic properties. Various design strategies are also thoroughly reviewed, including band-gap engineering, defect control, dimensionality tuning, pore texture tailoring, surface sensitization, heterojunction construction, co-catalyst and nanocarbon loading. Many important applications are also addressed, such as photocatalytic water splitting (H2 evolution and overall water splitting), degradation of pollutants, carbon dioxide reduction, selective organic transformations and disinfection. Through reviewing the important state-of-the-art advances on this topic, it may provide new opportunities for designing and constructing highly effective g-C3N4-based photocatalysts for various applications in photocatalysis and other related fields, such as solar cell, photoelectrocatalysis, electrocatalysis, lithium battery, supercapacitor, fuel cell and separation and purification.

Dynamics and couplings of N-H stretching excitations of guanosine-cytidine base pairs in solution.

PubMed

Yang, Ming; Szyc, Łukasz; Röttger, Katharina; Fidder, Henk; Nibbering, Erik T J; Elsaesser, Thomas; Temps, Friedrich

2011-05-12

N-H stretching vibrations of hydrogen-bonded guanosine-cytidine (G·C) base pairs in chloroform solution are studied with linear and ultrafast nonlinear infrared (IR) spectroscopy. Assignment of the IR-active bands in the linear spectrum is made possible by combining structural information on the hydrogen bonds in G·C base pairs with literature results of density functional theory calculations, and empirical relations connecting frequency shifts and intensity of the IR-active vibrations. A local mode representation of N-H stretching vibrations is adopted, consisting of ν(G)(NH(2))(f) and ν(C)(NH(2))(f) modes for free NH groups of G and C, and of ν(G)(NH(2))(b), ν(G)(NH), and ν(C)(NH(2))(b) modes associated with N-H stretching motions of hydrogen-bonded NH groups. The couplings and relaxation dynamics of the N-H stretching excitations are studied with femtosecond mid-infrared two-dimensional (2D) and pump-probe spectroscopy. The N-H stretching vibrations of the free NH groups of G and C have an average population lifetime of 2.4 ps. Besides a vibrational population lifetime shortening to subpicosecond values observed for the hydrogen-bonded N-H stretching vibrations, the 2D spectra reveal vibrational excitation transfer from the ν(G)(NH(2))(b) mode to the ν(G)(NH) and/or ν(C)(NH(2))(b) modes. The underlying intermode vibrational couplings are on the order of 10 cm(-1).

Molecular mechanical studies of DNA flexibility: Coupled backbone torsion angles and base-pair openings

PubMed Central

Keepers, Joe W.; Kollman, Peter A.; Weiner, Paul K.; James, Thomas L.

1982-01-01

Molecular mechanics studies have been carried out on “B-DNA-like” structures of [d(C-G-C-G-A-A-T-T-C-G-C-G)]2 and [d(A)]12·[d(T)]12. Each of the backbone torsion angles (ψ, φ, ω, ω′, φ′) has been “forced” to alternative values from the normal B-DNA values (g+, t, g-, g-, t conformations). Compensating torsion angle changes preserve most of the base stacking energy in the double helix. In a second part of the study, one purine N3-pyrimidine N1 distance at a time has been forced to a value of 6 Å in an attempt to simulate the base opening motions required to rationalize proton exchange data for DNA. When the 6-Å constraint is removed, many of the structures revert to the normal Watson-Crick hydrogen-bonded structure, but a number are trapped in structures ≈5 kcal/mol higher in energy than the starting B-DNA structure. The relative energy of these structures, some of which involve a non-Watson-Crick thymine C2(carbonyl)[unk]adenine 6NH2 hydrogen bond, are qualitatively consistent with the ΔH for a “base pair-open state” suggested by Mandal et al. of 4-6 kcal/mol [Mandal, C., Kallenbach, N. R. & Englander, S. W. (1979) J. Mol. Biol. 135, 391-411]. The picture of DNA flexibility emerging from this study depicts the backbone as undergoing rapid motion between local torsional minima on a nanosecond time scale. Backbone motion is mainly localized within a dinucleoside segment and generally not conformationally coupled along the chain or across the base pairs. Base motions are much smaller in magnitude than backbone motions. Base sliding allows imino N—H exchange, but it is localized, and only a small fraction of the N—H groups is exposed at any one time. Stacking and hydrogen bonding cause a rigid core of bases in the center of the molecule accounting for the hydrodynamic properties of DNA. PMID:6957879

Nearest-neighbor thermodynamics of deoxyinosine pairs in DNA duplexes

PubMed Central

Watkins, Norman E.; SantaLucia, John

2005-01-01

Nearest-neighbor thermodynamic parameters of the ‘universal pairing base’ deoxyinosine were determined for the pairs I·C, I·A, I·T, I·G and I·I adjacent to G·C and A·T pairs. Ultraviolet absorbance melting curves were measured and non-linear regression performed on 84 oligonucleotide duplexes with 9 or 12 bp lengths. These data were combined with data for 13 inosine containing duplexes from the literature. Multiple linear regression was used to solve for the 32 nearest-neighbor unknowns. The parameters predict the Tm for all sequences within 1.2°C on average. The general trend in decreasing stability is I·C > I·A > I·T ≈ I· G > I·I. The stability trend for the base pair 5′ of the I·X pair is G·C > C·G > A·T > T·A. The stability trend for the base pair 3′ of I·X is the same. These trends indicate a complex interplay between H-bonding, nearest-neighbor stacking, and mismatch geometry. A survey of 14 tandem inosine pairs and 8 tandem self-complementary inosine pairs is also provided. These results may be used in the design of degenerate PCR primers and for degenerate microarray probes. PMID:16264087

Improved base excision repair inhibition and bacteriophage Mu Gam protein yields C:G-to-T:A base editors with higher efficiency and product purity

PubMed Central

Komor, Alexis C.; Zhao, Kevin T.; Packer, Michael S.; Gaudelli, Nicole M.; Waterbury, Amanda L.; Koblan, Luke W.; Kim, Y. Bill; Badran, Ahmed H.; Liu, David R.

2017-01-01

We recently developed base editing, the programmable conversion of target C:G base pairs to T:A without inducing double-stranded DNA breaks (DSBs) or requiring homology-directed repair using engineered fusions of Cas9 variants and cytidine deaminases. Over the past year, the third-generation base editor (BE3) and related technologies have been successfully used by many researchers in a wide range of organisms. The product distribution of base editing—the frequency with which the target C:G is converted to mixtures of undesired by-products, along with the desired T:A product—varies in a target site–dependent manner. We characterize determinants of base editing outcomes in human cells and establish that the formation of undesired products is dependent on uracil N-glycosylase (UNG) and is more likely to occur at target sites containing only a single C within the base editing activity window. We engineered CDA1-BE3 and AID-BE3, which use cytidine deaminase homologs that increase base editing efficiency for some sequences. On the basis of these observations, we engineered fourth-generation base editors (BE4 and SaBE4) that increase the efficiency of C:G to T:A base editing by approximately 50%, while halving the frequency of undesired by-products compared to BE3. Fusing BE3, BE4, SaBE3, or SaBE4 to Gam, a bacteriophage Mu protein that binds DSBs greatly reduces indel formation during base editing, in most cases to below 1.5%, and further improves product purity. BE4, SaBE4, BE4-Gam, and SaBE4-Gam represent the state of the art in C:G-to-T:A base editing, and we recommend their use in future efforts. PMID:28875174

Anomeric 2'-Deoxycytidines and Silver Ions: Hybrid Base Pairs with Greatly Enhanced Stability and Efficient DNA Mismatch Detection with α-dC.

PubMed

Guo, Xiurong; Seela, Frank

2017-09-04

α-d-Nucleosides are rare in nature but can develop fascinating properties when incorporated into DNA. This work reports on the first silver-mediated base pair constructed from two anomeric nucleosides: α-dC and β-dC. The hybrid base pair was integrated into the DNA and DNA/RNA double helix. A 12-mer duplex with α-dC and β-dC pair exhibits a higher thermal stability (T m =43 °C) than that incorporating the β-dC-Ag + -β-dC homo pair (T m =34 °C). Furthermore, α-dC shows excellent mismatch discrimination for DNA single nucleotide polymorphism (SNP). All four SNPs were identified on the basis of large T m value differences measured in the presence of silver ions. High resolution melting was not required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Determinants of Base-Pair Substitution Patterns Revealed by Whole-Genome Sequencing of DNA Mismatch Repair Defective Escherichia coli.

PubMed

Foster, Patricia L; Niccum, Brittany A; Popodi, Ellen; Townes, Jesse P; Lee, Heewook; MohammedIsmail, Wazim; Tang, Haixu

2018-06-15

Mismatch repair (MMR) is a major contributor to replication fidelity, but its impact varies with sequence context and the nature of the mismatch. Mutation accumulation experiments followed by whole-genome sequencing of MMR-defective E. coli strains yielded ≈30,000 base-pair substitutions, revealing mutational patterns across the entire chromosome. The base-pair substitution spectrum was dominated by A:T > G:C transitions, which occurred predominantly at the center base of 5'N A C3'+5'G T N3' triplets. Surprisingly, growth on minimal medium or at low temperature attenuated these mutations. Mononucleotide runs were also hotspots for base-pair substitutions, and the rate at which these occurred increased with run length. Comparison with ≈2000 base-pair substitutions accumulated in MMR-proficient strains revealed that both kinds of hotspots appeared in the wild-type spectrum and so are likely to be sites of frequent replication errors. In MMR-defective strains transitions were strand biased, occurring twice as often when A and C rather than T and G were on the lagging-strand template. Loss of nucleotide diphosphate kinase increases the cellular concentration of dCTP, which resulted in increased rates of mutations due to misinsertion of C opposite A and T. In an mmr ndk double mutant strain, these mutations were more frequent when the template A and T were on the leading strand, suggesting that lagging-strand synthesis was more error-prone or less well corrected by proofreading than was leading strand synthesis. Copyright © 2018, Genetics.

Configurations of base-pair complexes in solutions. [nucleotide chemistry

NASA Technical Reports Server (NTRS)

Egan, J. T.; Nir, S.; Rein, R.; Macelroy, R.

1978-01-01

A theoretical search for the most stable conformations (i.e., stacked or hydrogen bonded) of the base pairs A-U and G-C in water, CCl4, and CHCl3 solutions is presented. The calculations of free energies indicate a significant role of the solvent in determining the conformations of the base-pair complexes. The application of the continuum method yields preferred conformations in good agreement with experiment. Results of the calculations with this method emphasize the importance of both the electrostatic interactions between the two bases in a complex, and the dipolar interaction of the complex with the entire medium. In calculations with the solvation shell method, the last term, i.e., dipolar interaction of the complex with the entire medium, was added. With this modification the prediction of the solvation shell model agrees both with the continuum model and with experiment, i.e., in water the stacked conformation of the bases is preferred.

Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.

PubMed

Kryachko, E S; Remacle, F

2005-12-08

The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.

Twin hydroxymethyluracil-A base pair steps define the binding site for the DNA-binding protein TF1.

PubMed

Grove, A; Figueiredo, M L; Galeone, A; Mayol, L; Geiduschek, E P

1997-05-16

The DNA-bending protein TF1 is the Bacillus subtilis bacteriophage SPO1-encoded homolog of the bacterial HU proteins and the Escherichia coli integration host factor. We recently proposed that TF1, which binds with high affinity (Kd was approximately 3 nM) to preferred sites within the hydroxymethyluracil (hmU)-containing phage genome, identifies its binding sites based on sequence-dependent DNA flexibility. Here, we show that two hmU-A base pair steps coinciding with two previously proposed sites of DNA distortion are critical for complex formation. The affinity of TF1 is reduced 10-fold when both of these hmU-A base pair steps are replaced with A-hmU, G-C, or C-G steps; only modest changes in affinity result when substitutions are made at other base pairs of the TF1 binding site. Replacement of all hmU residues with thymine decreases the affinity of TF1 greatly; remarkably, the high affinity is restored when the two hmU-A base pair steps corresponding to previously suggested sites of distortion are reintroduced into otherwise T-containing DNA. T-DNA constructs with 3-base bulges spaced apart by 9 base pairs of duplex also generate nM affinity of TF1. We suggest that twin hmU-A base pair steps located at the proposed sites of distortion are key to target site selection by TF1 and that recognition is based largely, if not entirely, on sequence-dependent DNA flexibility.

Effect of BrU on the transition between wobble Gua-Thy and tautomeric Gua-Thy base-pairs: ab initio molecular orbital calculations

NASA Astrophysics Data System (ADS)

Nomura, Kazuya; Hoshino, Ryota; Hoshiba, Yasuhiro; Danilov, Victor I.; Kurita, Noriyuki

2013-04-01

We investigated transition states (TS) between wobble Guanine-Thymine (wG-T) and tautomeric G-T base-pair as well as Br-containing base-pairs by MP2 and density functional theory (DFT) calculations. The obtained TS between wG-T and G*-T (asterisk is an enol-form of base) is different from TS got by the previous DFT calculation. The activation energy (17.9 kcal/mol) evaluated by our calculation is significantly smaller than that (39.21 kcal/mol) obtained by the previous calculation, indicating that our TS is more preferable. In contrast, the obtained TS and activation energy between wG-T and G-T* are similar to those obtained by the previous DFT calculation. We furthermore found that the activation energy between wG-BrU and tautomeric G-BrU is smaller than that between wG-T and tautomeric G-T. This result elucidates that the replacement of CH3 group of T by Br increases the probability of the transition reaction producing the enol-form G* and T* bases. Because G* prefers to bind to T rather than to C, and T* to G not A, our calculated results reveal that the spontaneous mutation from C to T or from A to G base is accelerated by the introduction of wG-BrU base-pair.

Theoretical determination of one-electron redox potentials for DNA bases, base pairs, and stacks.

PubMed

Paukku, Y; Hill, G

2011-05-12

Electron affinities, ionization potentials, and redox potentials for DNA bases, base pairs, and N-methylated derivatives are computed at the DFT/M06-2X/6-31++G(d,p) level of theory. Redox properties of a guanine-guanine stack model are explored as well. Reduction and oxidation potentials are in good agreement with the experimental ones. Electron affinities of base pairs were found to be negative. Methylation of canonical bases affects the ionization potentials the most. Base pair formation and base stacking lower ionization potentials by 0.3 eV. Pairing of guanine with the 5-methylcytosine does not seem to influence the redox properties of this base pair much.

1,8-Naphthyridine-2,7-diamine: a potential universal reader of Watson-Crick base pairs for DNA sequencing by electron tunneling.

PubMed

Liang, Feng; Lindsay, Stuart; Zhang, Peiming

2012-11-21

With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A : T and G : C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs.

Seventeen {alpha}-hydroxylase deficiency with one base pair deletion of the cytochrome P450c17 (CYP17) gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oshiro, Chikara; Takasu, Nobuyuki; Wakugami, Tamio

1995-08-01

Mutation of the cytochrome P450c17 (CYP17) gene causes 17{alpha}-hydroxylase deficiency (170HD). Recently, several researchers have elucidated the molecular basis of 170HD by gene analysis. We experienced a case of 170HD and intended to reveal the abnormality of the CYP17 gene in this Japanese female with 170HD. Leukocytes were obtained from the patient, her mother and sister, and normal control subjects. We amplified the CYP17 gene using polymerase chain reaction and performed the sequence analysis using the dideoxy terminator method and restriction enzyme analysis. We found that the patient had one base-pair deletion at the position of amino acid 438. Anmore » indentical result was obtained with restriction enzyme analysis. This G deletion altered the reading frame and resulted in a premature stop codon at position 443; the ligand of heme iron (Cys: cystine 442) was absent. This small mutation may account for the patient`s clinical manifestations of 170HD. This is the first case of 170HD with only one base pair deletion of the CYP17 gene. 18 refs., 3 figs.« less

Detection of protonated non-Watson-Crick base pairs using electrospray ionization mass spectrometry.

PubMed

Ishida, Riyoko; Iwahashi, Hideo

2018-03-01

Many studies have shown that protonated nucleic acid base pairs are involved in a wide variety of nucleic acid structures. However, little information is available on relative stability of hemiprotonated self- and non-self-dimers at monomer level. We used electrospray ionization mass spectrometry (ESI-MS) to evaluate the relative stability under various concentrations of hydrogen ion. These enable conjecture of the formation of protonated non-Watson-Crick base pairs based on DNA and RNA base sequence. In the present study, we observed that ESI-MS peaks corresponded to respective self-dimers for all examined nucleosides except for adenosine. Peak heights depended on the concentration of hydrogen ion. The ESI-MS peak heights of the hemiprotonated cytidine dimers and the hemiprotonated thymidine dimer sharply increased with increased concentration of hydrogen ion, suggesting direct participation of hydrogen ion in dimer formations. In ESI-MS measurements of the solutions containing adenosine, cytidine, thymidine and guanosine, we observed protonated cytidine-guanosine dimer (CH+-G) and protonated cytidine-thymidine dimer (CH+-T) in addition to hemiprotonated cytidine-cytidine dimer (CH+-C) with following relative peak height, (CH+-C) > (CH+-G) ≈ (CH+-T) > (CH+-A). Additionally, in the ESI-MS measurements of solutions containing adenosine, thymidine and guanosine, we observed a considerable amount of protonated adenosine-guanosine (AH+-G) and protonated adenosine-thymidine (AH+-T).

Brueckner G -matrix approach for neutron-proton pairing correlations in the deformed BCS approach

NASA Astrophysics Data System (ADS)

Ha, Eunja; Cheoun, Myung-Ki; Šimkovic, F.

2015-10-01

Ground states of even-even Ge isotopes with mass number A =64 -76 have been studied in the deformed Bardeen-Cooper-Schrieffer (BCS) theory by taking neutron-proton (n p ) pairing correlations as well as neutron-neutron (n n ) and proton-proton (p p ) pairing correlations. The n p pairing has two different modes J =0 ,T =1 (isotriplet) and J =1 ,T =0 (isosinglet). In this work, the Brueckner G matrix, based on the CD-Bonn potential, has been exploited to reduce the ambiguity regarding nucleon-nucleon interactions inside nuclei compared to the results by a simple schematic phenomenological force. We found that the G matrix plays important roles to obtain reasonable descriptions of even-even nuclei compared to the schematic force. The n p pairing strength has been shown to have a clear correlation with quadrupole deformation parameter β2 for the isotopes, and affects the smearing of the Fermi surfaces of not only N =Z nuclei but also N ≠Z nuclei. In particular, the coexistence of the like particle (n n and p p ) and the n p pairing modes was found to become more salient by the G -matrix approach than by the schematic force approach.

Determination of redox potentials for the Watson-Crick base pairs, DNA nucleosides, and relevant nucleoside analogues.

PubMed

Crespo-Hernandez, Carlos E; Close, David M; Gorb, Leonid; Leszczynski, Jerzy

2007-05-17

Redox potentials for the DNA nucleobases and nucleosides, various relevant nucleoside analogues, Watson-Crick base pairs, and seven organic dyes are presented based on DFT/B3LYP/6-31++G(d,p) and B3YLP/6-311+G(2df,p)//B3LYP/6-31+G* levels of calculations. The values are determined from an experimentally calibrated set of equations that correlate the vertical ionization (electron affinity) energy of 20 organic molecules with their experimental reversible oxidation (reduction) potential. Our results are in good agreement with those estimated experimentally for the DNA nucleosides in acetonitrile solutions (Seidel et al. J. Phys. Chem. 1996, 100, 5541). We have found that nucleosides with anti conformation exhibit lower oxidation potentials than the corresponding syn conformers. The lowering in the oxidation potential is due to the formation of an intramolecular hydrogen bonding interaction between the 5'-OH group of the sugar and the N3 of the purine bases or C2=O of the pyrimidine bases in the syn conformation. Pairing of adenine or guanine with its complementary pyrimidine base decreases its oxidation potential by 0.15 or 0.28 V, respectively. The calculated energy difference between the oxidation potential for the G.C base pair and that of the guanine base is in good agreement with the experimental value estimated recently (0.34 V: Caruso, T.; et al. J. Am. Chem. Soc. 2005, 127, 15040). The complete and consistent set of reversible redox values determined in this work for the DNA constituents is expected to be of considerable value to those studying charge and electronic energy transfer in DNA.

1,8-Naphthyridine-2,7-diamine: A Potential Universal Reader of the Watson-Crick Base Pairs for DNA Sequencing by Electron Tunneling

PubMed Central

Liang, Feng; Lindsay, Stuart; Zhang, Peiming

2013-01-01

With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read the DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A:T and G:C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs. PMID:23038027

6-Oxocytidine a novel protonated C-base analogue for stable triple helix formation.

PubMed Central

Berressem, R; Engels, J W

1995-01-01

2'-O-Methyl-3'-O-phosphoramidite building blocks of 6-oxocytidine 6 and its 5-methyl derivative 7, respectively, were synthesized and incorporated via phosphoramidite chemistry in 15 mer oligodeoxynucleotides [d(T72T7), S2; d(T73T7), S3] to obtain potential Py.Pu.Py triplex forming homopyrimidine strands. UV thermal denaturation studies and CD spectroscopy of 1:1 mixtures of these oligomers and a 21 mer target duplex [d(C3A7GA7C3)-d(G3T7CT7G3), D1] with a complementary purine tract showed a nearly pH-independent (6.0-8.0) triple helix formation with melting temperatures of 21-19 degrees C and 18.5-17.5 degrees C, respectively (buffer system: 50 mM sodium cacodylate, 100 mM NaCl, 20 mM MgCl2). In contrast, with the corresponding 15mer deoxy-C-containing oligonucleotide [d(T(7)1T7), S1] triplex formation was observed only below pH 6.6. Specificity for the recognition of Watson-Crick GC-base pairs was observed by pairing the modified C-bases of the 15mers with all other possible Watson-Crick-base compositions in the target duplex [d(C3A7XA7C3)-d(G3T7YT7G3), X = A,C,T; Y = T,G,A, D2-4]. Additionally, the Watson-Crick-pairing of the modified oligomers S2 and S3 was studied. PMID:7567457

6-Oxocytidine a novel protonated C-base analogue for stable triple helix formation.

PubMed

Berressem, R; Engels, J W

1995-09-11

2'-O-Methyl-3'-O-phosphoramidite building blocks of 6-oxocytidine 6 and its 5-methyl derivative 7, respectively, were synthesized and incorporated via phosphoramidite chemistry in 15 mer oligodeoxynucleotides [d(T72T7), S2; d(T73T7), S3] to obtain potential Py.Pu.Py triplex forming homopyrimidine strands. UV thermal denaturation studies and CD spectroscopy of 1:1 mixtures of these oligomers and a 21 mer target duplex [d(C3A7GA7C3)-d(G3T7CT7G3), D1] with a complementary purine tract showed a nearly pH-independent (6.0-8.0) triple helix formation with melting temperatures of 21-19 degrees C and 18.5-17.5 degrees C, respectively (buffer system: 50 mM sodium cacodylate, 100 mM NaCl, 20 mM MgCl2). In contrast, with the corresponding 15mer deoxy-C-containing oligonucleotide [d(T(7)1T7), S1] triplex formation was observed only below pH 6.6. Specificity for the recognition of Watson-Crick GC-base pairs was observed by pairing the modified C-bases of the 15mers with all other possible Watson-Crick-base compositions in the target duplex [d(C3A7XA7C3)-d(G3T7YT7G3), X = A,C,T; Y = T,G,A, D2-4]. Additionally, the Watson-Crick-pairing of the modified oligomers S2 and S3 was studied.

Diffuse Scattering Investigations of Orientational Pair Potentials in C_60

NASA Astrophysics Data System (ADS)

Wochner, Peter

1996-03-01

Premonitory orientational fluctuations above the first order phase transition of C_60 at 260K have been studied by diffuse X-ray scattering experiments. These experiments probe the orientational pair correlations between C_60 molecules as a function of their separation and therefore the orientational pair potential. In addition to the diffuse scattering due to the orientational disorder of single molecules, we have observed zone boundary diffuse scattering at the X-points related to the Pabar 3 low temperature structure up to 300K. An additional set of diffuse peaks, which are even at room temperature comparable in intensity to the former ones, have been found at (0.5,0.5,0.5) positions (L-point). Similar results have recently been reported by P. Launois et al. (P. Launois, S. Ravy, R. Moret, PRB 52), 5414 (1995) and L. Pintschovius et al. (L. Pintschovius, S.L. Chaplot, G. Roth, G. Heger, PRL 75), 2843 (1995) The temperature dependence of the integrated intensity of both sets of diffuse peaks shows only a weak increase in approaching T_c, indicative of a strongly first order transition. Additional intensity with a very weak temperature dependence but similar correlation length has also been found at (0.5,0.5,0) and (0.5,0,0) positions. The diffuse intensity at the L, Σ and Δ points has probably its origin in competing phases which are not stabilized at low temperatures. Recent DSC measurements show close lying transitions at 260K with a separation of ~= 0.2-0.3K which might be related to these competing phases footnote J. Fischer, private communication. The data will be compared with model calculations using orientational pair potentials which have been used in literature to describe the orientational phase transition in C_60.

Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

PubMed

Takezawa, Yusuke; Shionoya, Mitsuhiko

2012-12-18

With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional

Absorption and fluorescence emission spectroscopic characters of naphtho-homologated yy-DNA bases and effect of methanol solution and base pairing.

PubMed

Zhang, Laibin; Li, Huifang; Li, Jilai; Chen, Xiaohua; Bu, Yuxiang

2010-03-01

A comprehensive theoretical study of electronic transitions of naphtho-homologated base analogs, namely, yy-T, yy-C, yy-A, and yy-G, was performed. The nature of the low-lying excited states is discussed, and the results are compared with those from experiment and also with those of y-bases. Geometrical characteristics of the lowest excited singlet pipi* and npi* states were explored using the CIS method, and the effects of methanol solution and paring with their complementary natural bases on the relevant absorption and emission spectra of these modified bases were examined. The calculated excitation and emission energies agree well with the measured data, where experimental results are available. In methanol solution, the fluorescence from yy-A and yy-G would be expected to occur around 539 and 562 nm, respectively, suggesting that yy-A is a green-colored fluorophore, whereas yy-G is a yellow-colored fluorophore. The methanol solution was found to red-shift both the absorption and emission maxima of yy-A, yy-T, and yy-C, but blue-shift those for yy-G. Generally, though base pairing has no significant effects on the absorption and fluorescence maxima of yy-A, yy-C, and yy-T, it blue-shifts those for yy-G. (c) 2009 Wiley Periodicals, Inc.

Report on Pairing-based Cryptography.

PubMed

Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

2015-01-01

This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST's position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed.

Report on Pairing-based Cryptography

PubMed Central

Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

2015-01-01

This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST’s position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed. PMID:26958435

Molecular dynamics of the frame-shifting pseudoknot from beet western yellows virus: the role of non-Watson-Crick base-pairing, ordered hydration, cation binding and base mutations on stability and unfolding.

PubMed

Csaszar, K; Spacková, N; Stefl, R; Sponer, J; Leontis, N B

2001-11-09

Molecular dynamics simulations of the frame-shifting pseudoknot from beet western yellows virus (BWYV, NDB file UR0004) were performed with explicit inclusion of solvent and counterions. In all, 33 ns of simulation were carried out, including 10 ns of the native structure with protonation of the crucial cytosine residue, C8(N3+). The native structure exhibited stable trajectories retaining all Watson-Crick and tertiary base-pairs, except for fluctuations or transient disruptions at specific sites. The most significant fluctuations involved the change or disruption of hydrogen-bonding between C8(N3+) and bases G12, A25, and C26, as well as disruption of the water bridges linking C8(N3+) with A25 and C26. To increase sampling of rare events, the native simulation was continued at 400 K. A partial, irreversible unfolding of the molecule was initiated by slippage of C8(N3+) relative to G12 and continued by sudden concerted changes in hydrogen-bonding involving A23, A24, and A25. These events were followed by a gradual loss of stacking interactions in loop 2. Of the Watson-Crick base-pairs, only the 5'-terminal pair of stem 1 dissociated at 400 K, while the trans sugar-edge/sugar-edge A20.G4 interaction remained surprisingly stable. Four additional room-temperature simulations were carried out to obtain insights into the structural and dynamic effects of selected mutations. In two of these, C8 was left unprotonated. Considerable local rearrangements occurred that were not observed in the crystal structure, thus confirming N3-protonation of C8 in the native molecule. We also investigated the effect of mutating C8(N3+) to U8, to correlate with experimental and phylogenetic studies, and of changing the G4 x C17 base-pair to A4 x U17 to weaken the trans sugar-edge interaction between positions 4 and 20 and to test models of unfolding. The simulations indicate that the C8 x G12 x C26 base-triple at the junction is the most labile region of the frame-shifting pseudoknot. They

Hydration of Watson-Crick base pairs and dehydration of Hoogsteen base pairs inducing structural polymorphism under molecular crowding conditions.

PubMed

Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki

2009-03-18

It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.

Enhanced Stability of DNA Nanostructures by Incorporation of Unnatural Base Pairs.

PubMed

Liu, Qing; Liu, Guocheng; Wang, Ting; Fu, Jing; Li, Rujiao; Song, Linlin; Wang, Zhen-Gang; Ding, Baoquan; Chen, Fei

2017-11-03

Self-assembled DNA nanostructures hold great promise in the fields of nanofabrication, biosensing and nanomedicine. However, the inherent low stability of the DNA double helices, formed by weak interactions, largely hinders the assembly and functions of DNA nanostructures. In this study, we redesigned and constructed a six-arm DNA junction by incorporation of the unnatural base pairs 5-Me-isoC/isoG and A/2-thioT into the double helices. They not only retained the structural integrity of the DNA nanostructure, but also showed enhanced thermal stability and resistance to T7 Exonuclease digestion. This research may expand the applications of DNA nanostructures in nanofabrication and biomedical fields, and furthermore, the genetic alphabet expansion with unnatural base pairs may enable us to construct more complicated and diversified self-assembled DNA nanostructures. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Energetic basis for selective recognition of T*G mismatched base pairs in DNA by imidazole-rich polyamides.

PubMed

Lacy, Eilyn R; Nguyen, Binh; Le, Minh; Cox, Kari K; OHare, Caroline; Hartley, John A; Lee, Moses; Wilson, W David

2004-01-01

To complement available structure and binding results and to develop a detailed understanding of the basis for selective molecular recognition of T.G mismatches in DNA by imidazole containing polyamides, a full thermodynamic profile for formation of the T.G-polyamide complex has been determined. The amide-linked heterocycles f-ImImIm and f-PyImIm (where f is formamido group, Im is imidazole and Py is pyrrole) were studied by using biosensor-surface plasmon resonance (SPR) and isothermal titration calorimetry (ITC) with a T.G mismatch containing DNA hairpin duplex and a similar DNA with only Watson-Crick base pairs. Large negative binding enthalpies for all of the polyamide-DNA complexes indicate that the interactions are enthalpically driven. SPR results show slower complex formation and stronger binding of f-ImImIm to the T.G than to the match site. The thermodynamic analysis indicates that the enhanced binding to the T.G site is the result of better entropic contributions. Negative heat capacity changes for the complex are correlated with calculated solvent accessible surface area changes and indicate hydrophobic contributions to complex formation. DNase I footprinting analysis in a long DNA sequence provided supporting evidence that f-ImImIm binds selectively to T.G mismatch sites.

An inversion of 25 base pairs causes feline GM2 gangliosidosis variant.

PubMed

Martin, Douglas R; Krum, Barbara K; Varadarajan, G S; Hathcock, Terri L; Smith, Bruce F; Baker, Henry J

2004-05-01

In G(M2) gangliosidosis variant 0, a defect in the beta-subunit of lysosomal beta-N-acetylhexosaminidase (EC 3.2.1.52) causes abnormal accumulation of G(M2) ganglioside and severe neurodegeneration. Distinct feline models of G(M2) gangliosidosis variant 0 have been described in both domestic shorthair and Korat cats. In this study, we determined that the causative mutation of G(M2) gangliosidosis in the domestic shorthair cat is a 25-base-pair inversion at the extreme 3' end of the beta-subunit (HEXB) coding sequence, which introduces three amino acid substitutions at the carboxyl terminus of the protein and a translational stop that is eight amino acids premature. Cats homozygous for the 25-base-pair inversion express levels of beta-subunit mRNA approximately 190% of normal and protein levels only 10-20% of normal. Because the 25-base-pair inversion is similar to mutations in the terminal exon of human HEXB, the domestic shorthair cat should serve as an appropriate model to study the molecular pathogenesis of human G(M2) gangliosidosis variant 0 (Sandhoff disease).

pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

PubMed

Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

2009-11-23

Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

Energetic basis for selective recognition of T·G mismatched base pairs in DNA by imidazole-rich polyamides

PubMed Central

Lacy, Eilyn R.; Nguyen, Binh; Le, Minh; Cox, Kari K.; O'Hare, Caroline; Hartley, John A.; Lee, Moses; Wilson, W. David

2004-01-01

To complement available structure and binding results and to develop a detailed understanding of the basis for selective molecular recognition of T·G mismatches in DNA by imidazole containing polyamides, a full thermodynamic profile for formation of the T·G–polyamide complex has been determined. The amide-linked heterocycles f-ImImIm and f-PyImIm (where f is formamido group, Im is imidazole and Py is pyrrole) were studied by using biosensor-surface plasmon resonance (SPR) and isothermal titration calorimetry (ITC) with a T·G mismatch containing DNA hairpin duplex and a similar DNA with only Watson–Crick base pairs. Large negative binding enthalpies for all of the polyamide–DNA complexes indicate that the interactions are enthalpically driven. SPR results show slower complex formation and stronger binding of f-ImImIm to the T·G than to the match site. The thermodynamic analysis indicates that the enhanced binding to the T·G site is the result of better entropic contributions. Negative heat capacity changes for the complex are correlated with calculated solvent accessible surface area changes and indicate hydrophobic contributions to complex formation. DNase I footprinting analysis in a long DNA sequence provided supporting evidence that f-ImImIm binds selectively to T·G mismatch sites. PMID:15064359

pgRNAFinder: a web-based tool to design distance independent paired-gRNA.

PubMed

Xiong, Yuanyan; Xie, Xiaowei; Wang, Yanzhi; Ma, Wenbing; Liang, Puping; Songyang, Zhou; Dai, Zhiming

2017-11-15

The CRISPR/Cas System has been shown to be an efficient and accurate genome-editing technique. There exist a number of tools to design the guide RNA sequences and predict potential off-target sites. However, most of the existing computational tools on gRNA design are restricted to small deletions. To address this issue, we present pgRNAFinder, with an easy-to-use web interface, which enables researchers to design single or distance-free paired-gRNA sequences. The web interface of pgRNAFinder contains both gRNA search and scoring system. After users input query sequences, it searches gRNA by 3' protospacer-adjacent motif (PAM), and possible off-targets, and scores the conservation of the deleted sequences rapidly. Filters can be applied to identify high-quality CRISPR sites. PgRNAFinder offers gRNA design functionality for 8 vertebrate genomes. Furthermore, to keep pgRNAFinder open, extensible to any organism, we provide the source package for local use. The pgRNAFinder is freely available at http://songyanglab.sysu.edu.cn/wangwebs/pgRNAFinder/, and the source code and user manual can be obtained from https://github.com/xiexiaowei/pgRNAFinder. songyang@bcm.edu or daizhim@mail.sysu.edu.cn. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

Damage mechanism of hydroxyl radicals toward adenine—thymine base pair

NASA Astrophysics Data System (ADS)

Tan, Rong-Ri; Wang, Dong-Qi; Zhang, Feng-Shou

2014-02-01

The adenine—thymine base pair was studied in the presence of hydroxyl radicals in order to probe the hydrogen bond effect. The results show that the hydrogen bonds have little effect on the hydroxylation and dehydrogenation happened at the sites, which are not involved in a hydrogen bond, while at the sites involved in hydrogen bond formation in the base pair, the reaction becomes more difficult, both in view of the free energy barrier and the exothermicity. With a 6-311++G(d,p) level of description, both B3LYP and MP2 methods confirm that the C8 site of isolated adenine has the highest possibility to form covalent bond with the hydroxyl radicals, though with different energetics: B3LYP predicts a barrierless pathway, while MP2 finds a transition state with an energy of 106.1 kJ/mol. For the dehydrogenation reactions, B3LYP method predicts that the free energy barrier increases in the order of HN9 < HN61 < HN62 < H2 < H8.

Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs

PubMed Central

2017-01-01

Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package. PMID:29107980

Multispectroscopic methods reveal different modes of interaction of anti cancer drug mitoxantrone with Poly(dG-dC).Poly(dG-dC) and Poly(dA-dT).Poly(dA-dT).

PubMed

Awasthi, Pamita; Dogra, Shilpa; Barthwal, Ritu

2013-10-05

The interaction of mitoxantrone with alternating Poly(dG-dC).Poly(dG-dC) and Poly(dA-dT).Poly(dA-dT) duplex has been studied by absorption, fluorescence and Circular Dichroism (CD) spectroscopy at Drug to Phosphate base pair ratios D/P=20.0-0.04. Binding to GC polymer occurs in two distinct modes: partial stacking characterized by red shifts of 18-23nm at D/P=0.2-0.8 and external binding at D/P=1.0-20.0 whereas that to AT polymer occurs externally in the entire range of D/P. The binding constant and number of binding sites is 3.7×10(5)M(-1), 0.3 and 1.3× 10(4)M(-1), 1.5 in GC and AT polymers, respectively at low D/P ratios. CD binding isotherms show breakpoints at D/P=0.1, 0.5 and 0.25, 0.5 in GC and AT polymers, respectively. The intrinsic CD bands indicate that the distortions in GC polymer are significantly higher than that in AT polymer. Docking studies show partial insertion of mitoxantrone rings between to GC base pairs in alternating GC polymer. Side chains of mitoxantrone interact specifically with base pairs and DNA backbone. The studies are relevant to the understanding of suppression or inhibition of DNA cleavage on formation of ternary complex with topoisomerase-II enzyme and hence the anti cancer action. Copyright © 2013 Elsevier B.V. All rights reserved.

Mitomycin C-induced pairing of heterochromatin reflects initiation of DNA repair and chromatid exchange formation.

PubMed

Abdel-Halim, H I; Natarajan, A T; Mullenders, L H F; Boei, J J W A

2005-04-15

Chromatid interchanges induced by the DNA cross-linking agent mitomycin C (MMC) are over-represented in human chromosomes containing large heterochromatic regions. We found that nearly all exchange breakpoints of chromosome 9 are located within the paracentromeric heterochromatin and over 70% of exchanges involving chromosome 9 are between its homologues. We provide evidence that the required pairing of chromosome 9 heterochromatic regions occurs in G(0)/G(1) and S-phase cells as a result of an active cellular process initiated upon MMC treatment. By contrast, no pairing was observed for a euchromatic paracentromeric region of the equal-sized chromosome 8. The MMC-induced pairing of chromosome 9 heterochromatin is observed in a subset of cells; its percentage closely mimics the frequency of homologous interchanges found at metaphase. Moreover, the absence of pairing in cells derived from XPF patients correlates with an altered spectrum of MMC-induced exchanges. Together, the data suggest that the heterochromatin-specific pairing following MMC treatment reflects the initiation of DNA cross-link repair and the formation of exchanges.

Introducing a model of pairing based on base pair specific interactions between identical DNA sequences

NASA Astrophysics Data System (ADS)

(O' Lee, Dominic J.

2018-02-01

At present, there have been suggested two types of physical mechanism that may facilitate preferential pairing between DNA molecules, with identical or similar base pair texts, without separation of base pairs. One mechanism solely relies on base pair specific patterns of helix distortion being the same on the two molecules, discussed extensively in the past. The other mechanism proposes that there are preferential interactions between base pairs of the same composition. We introduce a model, built on this second mechanism, where both thermal stretching and twisting fluctuations are included, as well as the base pair specific helix distortions. Firstly, we consider an approximation for weak pairing interactions, or short molecules. This yields a dependence of the energy on the square root of the molecular length, which could explain recent experimental data. However, analysis suggests that this approximation is no longer valid at large DNA lengths. In a second approximation, for long molecules, we define two adaptation lengths for twisting and stretching, over which the pairing interaction can limit the accumulation of helix disorder. When the pairing interaction is sufficiently strong, both adaptation lengths are finite; however, as we reduce pairing strength, the stretching adaptation length remains finite but the torsional one becomes infinite. This second state persists to arbitrarily weak values of the pairing strength; suggesting that, if the molecules are long enough, the pairing energy scales as length. To probe differences between the two pairing mechanisms, we also construct a model of similar form. However, now, pairing between identical sequences solely relies on the intrinsic helix distortion patterns. Between the two models, we see interesting qualitative differences. We discuss our findings, and suggest new work to distinguish between the two mechanisms.

Identification in a pseudoknot of a U.G motif essential for the regulation of the expression of ribosomal protein S15.

PubMed

Bénard, L; Mathy, N; Grunberg-Manago, M; Ehresmann, B; Ehresmann, C; Portier, C

1998-03-03

The ribosomal protein S15 from Escherichia coli binds to a pseudoknot in its own messenger. This interaction is an essential step in the mechanism of S15 translational autoregulation. In a previous study, a recognition determinant for S15 autoregulation, involving a U.G wobble pair, was located in the center of stem I of the pseudoknot. In this study, an extensive mutagenesis analysis has been conducted in and around this U.G pair by comparing the effects of these mutations on the expression level of S15. The results show that the U.G wobble pair cannot be substituted by A.G, C.A, A.C, G.U, or C.G without loss of the autocontrol. In addition, the base pair C.G, adjacent to the 5' side of U, cannot be flipped or changed to another complementary base pair without also inducing derepression of translation. A unique motif, made of only two adjacent base pairs, U.G/C.G, is essential for S15 autoregulation and is presumably involved in direct recognition by the S15 protein.

Proton tunneling in the A∙T Watson-Crick DNA base pair: myth or reality?

PubMed

Brovarets', Ol'ha O; Hovorun, Dmytro M

2015-01-01

The results and conclusions reached by Godbeer et al. in their recent work, that proton tunneling in the A∙T(WC) Watson-Crick (WC) DNA base pair occurs according to the Löwdin's (L) model, but with a small (~10(-9)) probability were critically analyzed. Here, it was shown that this finding overestimates the possibility of the proton tunneling at the A∙T(WC)↔A*∙T*(L) tautomerization, because this process cannot be implemented as a chemical reaction. Furthermore, it was outlined those biologically important nucleobase mispairs (A∙A*↔A*∙A, G∙G*↔G*∙G, T∙T*↔T*∙T, C∙C*↔C*∙C, H∙H*↔H*∙H (H - hypoxanthine)) - the players in the field of the spontaneous point mutagenesis - where the tunneling of protons is expected and for which the application of the model proposed by Godbeer et al. can be productive.

Completion of biosynthetic pathways for bacteriochlorophyll g in Heliobacterium modesticaldum: The C8-ethylidene group formation.

PubMed

Tsukatani, Yusuke; Yamamoto, Haruki; Mizoguchi, Tadashi; Fujita, Yuichi; Tamiaki, Hitoshi

2013-10-01

Heliobacteria have the simplest photosynthetic apparatus, i.e., a type-I reaction center lacking a peripheral light-harvesting complex. Bacteriochlorophyll (BChl) g molecules are bound to the reaction center complex and work both as special-pair and antenna pigments. The C8-ethylidene group formation for BChl g is the last missing link in biosynthetic pathways for bacterial special-pair pigments, which include BChls a and b as well. Here, we report that chlorophyllide a oxidoreductase (COR) of Heliobacterium modesticaldum catalyzes the C8-ethylidene formation from 8-vinyl-chlorophyllide a, producing bacteriochlorophyllide g, the direct precursor for BChl g without the farnesyl tail. The finding led to plausible biosynthetic pathways for 8(1)-hydroxy-chlorophyll a, a primary electron acceptor from the special pair in heliobacterial reaction centers. Proposed catalytic mechanisms on hydrogenation reaction of the ethylidene synthase-type CORs are also discussed. Copyright © 2013 Elsevier B.V. All rights reserved.

The binding of manganese(II) and zinc(II) to the synthetic oligonucleotide d(C-G-C-G-A-A-T-T-C-G-C-G)2. A 1H NMR study.

PubMed

Frøystein, N A; Sletten, E

1991-03-01

The interaction of the synthetic oligonucleotide d(C-G-C-G-A-A-T-T-C-G-C-G)2 with two different transition-metal ions has been investigated in aqueous solution by means of 1H NMR spectroscopy. The effects on the DNA due to the presence of manganese(II) or zinc(II) have been monitored by observing the paramagnetic broadening and diamagnetic shifts of the non-exchangeable proton resonance lines, respectively. The 1H NMR spectra acquired during the course of the manganese(II) titration show very distinct broadening effects on certain DNA resonance lines. Primarily, the H8 resonance of G4 is affected, but also the H5 and H6 resonances of C3 are clearly affected by the metal. The results imply that the binding of manganese(II) to DNA is sequence specific. The 1H spectra obtained during the zinc(II) titration reveal diamagnetic shift effects which largely conform with the paramagnetic broadening effects due to the presence of manganese(II), although this picture is somewhat more complex. The H8 resonance of G4 displays a clearly visible high-field shift, while for the other guanosine H8 protons this effect is absent. The H1' and H2' protons of C3 show an effect of similar strength, although in the opposite direction, while H5 and H6 of C3 are only slightly affected. Local differences in the structure of the DNA and the basicities of potential binding sites on different base steps in the sequence might account for the observed sequence selectivity.

Capturing the radical ion-pair intermediate in DNA guanine oxidation

PubMed Central

Jie, Jialong; Liu, Kunhui; Wu, Lidan; Zhao, Hongmei; Song, Di; Su, Hongmei

2017-01-01

Although the radical ion pair has been frequently invoked as a key intermediate in DNA oxidative damage reactions and photoinduced electron transfer processes, the unambiguous detection and characterization of this species remain formidable and unresolved due to its extremely unstable nature and low concentration. We use the strategy that, at cryogenic temperatures, the transient species could be sufficiently stabilized to be detectable spectroscopically. By coupling the two techniques (the cryogenic stabilization and the time-resolved laser flash photolysis spectroscopy) together, we are able to capture the ion-pair transient G+•⋯Cl− in the chlorine radical–initiated DNA guanine (G) oxidation reaction, and provide direct evidence to ascertain the intricate type of addition/charge separation mechanism underlying guanine oxidation. The unique spectral signature of the radical ion-pair G+•⋯Cl− is identified, revealing a markedly intense absorption feature peaking at 570 nm that is distinctive from G+• alone. Moreover, the ion-pair spectrum is found to be highly sensitive to the protonation equilibria within guanine-cytosine base pair (G:C), which splits into two resolved bands at 480 and 610 nm as the acidic proton transfers along the central hydrogen bond from G+• to C. We thus use this exquisite sensitivity to track the intrabase-pair proton transfer dynamics in the double-stranded DNA oligonucleotides, which is of critical importance for the description of the proton-coupled charge transfer mechanisms in DNA. PMID:28630924

Synthesis and characterization of g-C{sub 3}N{sub 4}/Cu{sub 2}O composite catalyst with enhanced photocatalytic activity under visible light irradiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Peng, Biyu; Zhang, Shengsen; Yang, Siyuan

2014-08-15

The prepared g-C{sub 3}N{sub 4}/Cu{sub 2}O composite exhibited the enhanced photocatalytic activity under visible-light irradiation due to the stronger ability in separation of electron–hole pairs, which was proven by the transient photocurrent measurement. - Highlights: • The coupled Cu{sub 2}O with g-C{sub 3}N{sub 4} of narrow-band-gap semiconductor has been designed. • g-C{sub 3}N{sub 4}/Cu{sub 2}O is prepared via an alcohol-aqueous based on chemical precipitation method. • g-C{sub 3}N{sub 4}/Cu{sub 2}O exhibits the enhanced photocatalytic activity under visible-light. • The enhanced photocatalytic activity is proven by the transient photocurrent test. • A mechanism for the visible-light-driven photocatalysis of g-C{sub 3}N{sub 4}/Cu{submore » 2}O is revealed. - Abstract: To overcome the drawback of low photocatalytic efficiency brought by electron–hole pairs recombination and narrow photo-response range, a novel g-C{sub 3}N{sub 4}/Cu{sub 2}O composite photocatalyst was designed and prepared successfully. Compared with bare Cu{sub 2}O and g-C{sub 3}N{sub 4}, the g-C{sub 3}N{sub 4}/Cu{sub 2}O composite exhibited significantly enhanced photocatalytic activity for acid orange-II (AO-II) degradation under visible light irradiation. Based on energy band positions, the mechanism of enhanced visible-light photocatalytic activity was proposed.« less

Pms2 and uracil-DNA glycosylases act jointly in the mismatch repair pathway to generate Ig gene mutations at A-T base pairs.

PubMed

Girelli Zubani, Giulia; Zivojnovic, Marija; De Smet, Annie; Albagli-Curiel, Olivier; Huetz, François; Weill, Jean-Claude; Reynaud, Claude-Agnès; Storck, Sébastien

2017-04-03

During somatic hypermutation (SHM) of immunoglobulin genes, uracils introduced by activation-induced cytidine deaminase are processed by uracil-DNA glycosylase (UNG) and mismatch repair (MMR) pathways to generate mutations at G-C and A-T base pairs, respectively. Paradoxically, the MMR-nicking complex Pms2/Mlh1 is apparently dispensable for A-T mutagenesis. Thus, how detection of U:G mismatches is translated into the single-strand nick required for error-prone synthesis is an open question. One model proposed that UNG could cooperate with MMR by excising a second uracil in the vicinity of the U:G mismatch, but it failed to explain the low impact of UNG inactivation on A-T mutagenesis. In this study, we show that uracils generated in the G1 phase in B cells can generate equal proportions of A-T and G-C mutations, which suggests that UNG and MMR can operate within the same time frame during SHM. Furthermore, we show that Ung -/- Pms2 -/- mice display a 50% reduction in mutations at A-T base pairs and that most remaining mutations at A-T bases depend on two additional uracil glycosylases, thymine-DNA glycosylase and SMUG1. These results demonstrate that Pms2/Mlh1 and multiple uracil glycosylases act jointly, each one with a distinct strand bias, to enlarge the immunoglobulin gene mutation spectrum from G-C to A-T bases. © 2017 Girelli Zubani et al.

Pms2 and uracil-DNA glycosylases act jointly in the mismatch repair pathway to generate Ig gene mutations at A-T base pairs

PubMed Central

De Smet, Annie; Albagli-Curiel, Olivier; Huetz, François; Weill, Jean-Claude

2017-01-01

During somatic hypermutation (SHM) of immunoglobulin genes, uracils introduced by activation-induced cytidine deaminase are processed by uracil-DNA glycosylase (UNG) and mismatch repair (MMR) pathways to generate mutations at G-C and A-T base pairs, respectively. Paradoxically, the MMR-nicking complex Pms2/Mlh1 is apparently dispensable for A-T mutagenesis. Thus, how detection of U:G mismatches is translated into the single-strand nick required for error-prone synthesis is an open question. One model proposed that UNG could cooperate with MMR by excising a second uracil in the vicinity of the U:G mismatch, but it failed to explain the low impact of UNG inactivation on A-T mutagenesis. In this study, we show that uracils generated in the G1 phase in B cells can generate equal proportions of A-T and G-C mutations, which suggests that UNG and MMR can operate within the same time frame during SHM. Furthermore, we show that Ung−/−Pms2−/− mice display a 50% reduction in mutations at A-T base pairs and that most remaining mutations at A-T bases depend on two additional uracil glycosylases, thymine-DNA glycosylase and SMUG1. These results demonstrate that Pms2/Mlh1 and multiple uracil glycosylases act jointly, each one with a distinct strand bias, to enlarge the immunoglobulin gene mutation spectrum from G-C to A-T bases. PMID:28283534

Hidden in Plain Sight: Subtle Effects of the 8-Oxoguanine Lesion on the Structure, Dynamics, and Thermodynamics of a 15-Base-Pair Oligodeoxynucleotide Duplex†

PubMed Central

Crenshaw, Charisse M.; Wade, Jacqueline E.; Arthanari, Haribabu; Frueh, Dominique; Lane, Benjamin F.; Núñez, Megan E.

2011-01-01

The base lesion 8-oxoguanine is formed readily by oxidation of DNA, potentially leading to G→T transversion mutations. Despite the apparent similarity of 8-oxoguanine-cytosine base pairs to normal guanine-cytosine base pairs, cellular base excision repair systems effectively recognize the lesion base. Here we apply several techniques to examine a single 8-oxoguanine lesion at the center of a nonpalindromic 15-mer duplex oligonucleotide in an effort to determine what, if anything, distinguishes an 8-oxoguanine-cytosine base pair from a normal base pair. The lesion duplex is globally almost indistinguishable from the unmodified parent duplex using CD spectroscopy and UV melting thermodynamics. The DNA mismatch-detecting photocleavage agent Rh(bpy)2chrysi3+ cleaves only weakly and nonspecifically, revealing that the 8oxoG-C pair is locally stable at the level of the individual base pairs. NMR spectra are also consistent with a well-conserved B-form duplex structure. In the 2D NOESY spectra, base-sugar and imino-imino crosspeaks are strikingly similar between parent and lesion duplexes. Changes in chemical shift due to the 8oxoG lesion are localized to its complementary cytosine and to the 2–3 base pairs immediately flanking the lesion on the lesion strand. Residues further removed from the lesion are shown to be unperturbed by its presence. Notably, imino exchange experiments indicate that the 8-oxoguanine-cytosine pair is strong and stable, with an apparent equilibrium constant for opening equal to that of other internal guanine-cytosine base pairs, on the order of 10−6. This collection of experiments shows that the 8-oxoguanine-cytosine base pair is incredibly stable and similar to the native pair. PMID:21902242

Ag(I)-mediated homo and hetero pairs of guanosine and cytidine: monitoring by circular dichroism spectroscopy.

PubMed

Goncharova, Iryna

2014-01-24

Ag(I)-containing compounds are attractive as antibacterial and antifungal agents. The renewed interest in the application of silver(I) compounds has led to the need for detailed knowledge of the mechanism of their action. One of the possible ways is the coordination of Ag(I) to G-C pairs of DNA, where Ag(+) ions form Ag(I)-mediated base pairs and inhibit the transcription. Herein, a systematic chiroptical study on silver(I)-mediated homo and mixed pairs of the C-G complementary-base derivatives cytidine(C) and 5'-guanosine monophosphate(G) in water is presented. Ag(I)-mediated homo and hetero pairs of G and C and their self-assembled species were studied under two pH levels (7.0 and 10.0) by vibrational (VCD) and electronic circular dichroism(ECD). VCD was used for the first time in this field and showed itself to be a powerful method for obtaining specific structural information in solution. Based on results of the VCD experiments, the different geometries of the homo pairs were proposed under pH 7.0 and 10.0. ECD was used as a diagnostic tool to characterize the studied systems and as a contact point between the previously defined structures of the metal or proton mediated pairs of nucleobases and the systems studied here. On the basis of the obtained data, the formation of the self-assembled species of cytidine with a structure similar to the i-motif structure in DNA was proposed at pH 10.0. Copyright © 2013 Elsevier B.V. All rights reserved.

Ag(I)-mediated homo and hetero pairs of guanosine and cytidine: Monitoring by circular dichroism spectroscopy

NASA Astrophysics Data System (ADS)

Goncharova, Iryna

2014-01-01

Ag(I)-containing compounds are attractive as antibacterial and antifungal agents. The renewed interest in the application of silver(I) compounds has led to the need for detailed knowledge of the mechanism of their action. One of the possible ways is the coordination of Ag(I) to G-C pairs of DNA, where Ag+ ions form Ag(I)-mediated base pairs and inhibit the transcription. Herein, a systematic chiroptical study on silver(I)-mediated homo and mixed pairs of the C-G complementary-base derivatives cytidine(C) and 5‧-guanosine monophosphate(G) in water is presented. Ag(I)-mediated homo and hetero pairs of G and C and their self-assembled species were studied under two pH levels (7.0 and 10.0) by vibrational (VCD) and electronic circular dichroism(ECD). VCD was used for the first time in this field and showed itself to be a powerful method for obtaining specific structural information in solution. Based on results of the VCD experiments, the different geometries of the homo pairs were proposed under pH 7.0 and 10.0. ECD was used as a diagnostic tool to characterize the studied systems and as a contact point between the previously defined structures of the metal or proton mediated pairs of nucleobases and the systems studied here. On the basis of the obtained data, the formation of the self-assembled species of cytidine with a structure similar to the i-motif structure in DNA was proposed at pH 10.0.

Pyrrolo-dC Metal-Mediated Base Pairs in the Reverse Watson-Crick Double Helix: Enhanced Stability of Parallel DNA and Impact of 6-Pyridinyl Residues on Fluorescence and Silver-Ion Binding.

PubMed

Yang, Haozhe; Mei, Hui; Seela, Frank

2015-07-06

Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Role of Electron-Driven Proton-Transfer Processes in the Ultrafast Deactivation of Photoexcited Anionic 8-oxoGuanine-Adenine and 8-oxoGuanine-Cytosine Base Pairs.

PubMed

Wu, Xiuxiu; Karsili, Tolga N V; Domcke, Wolfgang

2017-01-14

It has been reported that 8-oxo-7,8-dihydro-guanosine (8-oxo-G), which is the main product of oxidative damage of DNA, can repair cyclobutane pyrimidine dimer (CPD) lesions when incorporated into DNA or RNA strands in proximity to such lesions. It has therefore been suggested that the 8-oxo-G nucleoside may have been a primordial precursor of present-day flavins in DNA or RNA repair. Because the electron transfer leading to the splitting of a thymine-thymine pair in a CPD lesion occurs in the photoexcited state, a reasonably long excited-state lifetime of 8-oxo-G is required. The neutral (protonated) form of 8-oxo-G exhibits a very short (sub-picosecond) intrinsic excited-state lifetime which is unfavorable for repair. It has therefore been argued that the anionic (deprotonated) form of 8-oxo-G, which exhibits a much longer excited-state lifetime, is more likely to be a suitable cofactor for DNA repair. Herein, we have investigated the exited-state quenching mechanisms in the hydrogen-bonded complexes of deprotonated 8-oxo-G - with adenine (A) and cytosine (C) using ab initio wave-function-based electronic-structure calculations. The calculated reaction paths and potential-energy profiles reveal the existence of barrierless electron-driven inter-base proton-transfer reactions which lead to low-lying S₁/S₀ conical intersections. The latter can promote ultrafast excited-state deactivation of the anionic base pairs. While the isolated deprotonated 8-oxo-G - nucleoside may have been an efficient primordial repair cofactor, the excited states of the 8-oxo-G - -A and 8-oxo-G - -C base pairs are likely too short-lived to be efficient electron-transfer repair agents.

A structural determinant in the uracil DNA glycosylase superfamily for the removal of uracil from adenine/uracil base pairs

PubMed Central

Lee, Dong-Hoon; Liu, Yinling; Lee, Hyun-Wook; Xia, Bo; Brice, Allyn R.; Park, Sung-Hyun; Balduf, Hunter; Dominy, Brian N.; Cao, Weiguo

2015-01-01

The uracil DNA glycosylase superfamily consists of several distinct families. Family 2 mismatch-specific uracil DNA glycosylase (MUG) from Escherichia coli is known to exhibit glycosylase activity on three mismatched base pairs, T/U, G/U and C/U. Family 1 uracil N-glycosylase (UNG) from E. coli is an extremely efficient enzyme that can remove uracil from any uracil-containing base pairs including the A/U base pair. Here, we report the identification of an important structural determinant that underlies the functional difference between MUG and UNG. Substitution of a Lys residue at position 68 with Asn in MUG not only accelerates the removal of uracil from mismatched base pairs but also enables the enzyme to gain catalytic activity on A/U base pairs. Binding and kinetic analysis demonstrate that the MUG-K68N substitution results in enhanced ground state binding and transition state interactions. Molecular modeling reveals that MUG-K68N, UNG-N123 and family 5 Thermus thermophiles UDGb-A111N can form bidentate hydrogen bonds with the N3 and O4 moieties of the uracil base. Genetic analysis indicates the gain of function for A/U base pairs allows the MUG-K68N mutant to remove uracil incorporated into the genome during DNA replication. The implications of this study in the origin of life are discussed. PMID:25550433

Radical-pair based avian magnetoreception

NASA Astrophysics Data System (ADS)

Procopio, Maria; Ritz, Thorsten

2014-03-01

Behavioural experiments suggest that migratory birds possess a magnetic compass sensor able to detect the direction of the geomagnetic. One hypothesis for the basis of this remarkable sensory ability is that the coherent quantum spin dynamics of photoinduced radical pair reactions transduces directional magnetic information from the geomagnetic field into changes of reaction yields, possibly involving the photoreceptor cryptochrome in the birds retina. The suggested radical-pair based avian magnetoreception has attracted attention in the field of quantum biology as an example of a biological sensor which might exploit quantum coherences for its biological function. Investigations on such a spin-based sensor have focussed on uncovering the design features for the design of a biomimetic magnetic field sensor. We study the effects of slow fluctuations in the nuclear spin environment on the directional signal. We quantitatively evaluate the robustness of signals under fluctuations on a timescale longer than the lifetime of a radical pair, utilizing two models of radical pairs. Our results suggest design principles for building a radical-pair based compass sensor that is both robust and highly directional sensitive.

Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase iota: Hoogsteen or Watson-Crick base pairing?

PubMed

Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

2009-01-13

Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.

Easy design of colorimetric logic gates based on nonnatural base pairing and controlled assembly of gold nanoparticles.

PubMed

Zhang, Li; Wang, Zhong-Xia; Liang, Ru-Ping; Qiu, Jian-Ding

2013-07-16

Utilizing the principles of metal-ion-mediated base pairs (C-Ag-C and T-Hg-T), the pH-sensitive conformational transition of C-rich DNA strand, and the ligand-exchange process triggered by DL-dithiothreitol (DTT), a system of colorimetric logic gates (YES, AND, INHIBIT, and XOR) can be rationally constructed based on the aggregation of the DNA-modified Au NPs. The proposed logic operation system is simple, which consists of only T-/C-rich DNA-modified Au NPs, and it is unnecessary to exquisitely design and alter the DNA sequence for different multiple molecular logic operations. The nonnatural base pairing combined with unique optical properties of Au NPs promises great potential in multiplexed ion sensing, molecular-scale computers, and other computational logic devices.

Exploring the Limits of DNA Size: Naphtho-homologated DNA Bases and Pairs

PubMed Central

Lee, Alex H. F.; Kool, Eric T.

2008-01-01

A new design for DNA bases and base pairs is described in which the pyrimidine bases are widened by naphtho-homologation. Two naphtho-homologated deoxyribosides, dyyT (1) and dyyC (2) were synthesized and could be incorporated into oligonucleotides as suitably protected phosphoramidite derivatives. The deoxyribosides were found to be fluorescent, with emission maxima at 446 and 433 nm, respectively. Studies with single substitutions of 1 and 2 in the natural DNA context revealed exceptionally strong base stacking propensity for both. Sequences containing multiple substitutions of 1 and 2 paired opposite adenine and guanine were subsequently mixed and studied by several analytical methods. Data from UV mixing experiments, FRET measurements, fluorescence quenching experiments, and hybridizations on beads suggest that complementary “doublewide DNA” (yyDNA) strands may self-assemble into helical complexes with 1:1 stoichiometry. Data from thermal denaturation plots and CD spectra were less conclusive. Control experiments in one sequence context gave evidence that yyDNA helices, if formed, are preferentially antiparallel and are sequence selective. Hypothesized base pairing schemes are analogous to Watson-Crick pairing, but with glycosidic C1′-C1′ distances widened by over 45%, to ca. 15.2 Å. The possible self-assembly of the double-wide DNA helix establishes a new limit for the size of information-encoding, DNA-like molecules, and the fluorescence of yyDNA bases suggests uses as reporters in monomeric and oligomeric forms. PMID:16834396

sup 60 Co. gamma. -rays induce predominantly C/G to G/C transversions in double-stranded M13 DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hoebee, B.; Loman, H.; Brouwer, J.

Upon irradiation with gamma rays of an oxygenated aqueous solution of double-stranded M13 DNA, a very specific mutation spectrum was found with respect to both the type and the positions in the DNA sequence. Of the 23 mutations, which were sequenced, 16 represent a C/G to G/C transversion. A C/G to T/A transition was found once and a G/C to T/A transversion twice. The remaining 4 mutations are frameshifts, 2 are identical and formed by the insertion of a G/C basepair; the other 2 mutations are due to a duplication of 10 basepairs situated at different positions but with amore » remarkable homology in base sequence. Fourteen mutations, including the 2 duplications are found in the neighborhood of a TGCT/ACGA sequence.« less

A low-temperature-responsive element involved in the regulation of the Arabidopsis thaliana At1g71850/At1g71860 divergent gene pair.

PubMed

Liu, Shijuan; Chen, Huiqing; Li, Xiulan; Zhang, Wei

2016-08-01

The bidirectional promoter of the Arabidopsis thaliana gene pair At1g71850/At1g71860 harbors low-temperature-responsive elements, which participate in anti-correlated transcription regulation of the driving genes in response to environmental low temperature. A divergent gene pair is defined as two adjacent genes organized head to head in opposite orientation, sharing a common promoter region. Divergent gene pairs are mainly coexpressed, but some display opposite regulation. The mechanistic basis of such anti-correlated regulation is not well understood. Here, the regulation of the Arabidopsis thaliana gene pair At1g71850/At1g71860 was investigated. Semi-quantitative RT-PCR and Genevestigator analyses showed that while one of the pair was upregulated by exposure to low temperature, the same treatment downregulated the other. Promoter::GUS fusion transgenes were used to show that this behavior was driven by a bidirectional promoter, which harbored an as-1 motif, associated with the low-temperature response; mutation of this sequence produced a significant decrease in cold-responsive expression. With regard to the as-1 motif in the native orientation repressing the promoter's low-temperature responsiveness, the same as-1 motif introduced in the reverse direction showed a slight enhancement in the promoter's responsiveness to low-temperature exposure, indicating that the orientation of the motif was important for the promoter's activity. These findings provide new insights into the complex transcriptional regulation of bidirectional gene pairs as well as plant stress response.

Complementary Paired G4FETs as Voltage-Controlled NDR Device

NASA Technical Reports Server (NTRS)

Mojarradi, Mohammad; Chen, Suheng; Blalock, Ben; Britton, Chuck; Prothro, Ben; Vandersand, James; Schrimph, Ron; Cristoloveanu, Sorin; Akavardar, Kerem; Gentil, P.

2009-01-01

It is possible to synthesize a voltage-controlled negative-differential-resistance (NDR) device or circuit by use of a pair of complementary G4FETs (four-gate field-effect transistors). [For more information about G4FETs, please see the immediately preceding article]. As shown in Figure 1, the present voltage-controlled NDR device or circuit is an updated version of a prior NDR device or circuit, known as a lambda diode, that contains a pair of complementary junction field-effect transistors (JFETs). (The lambda diode is so named because its current-versus- voltage plot bears some resemblance to an upper-case lambda.) The present version can be derived from the prior version by substituting G4FETs for the JFETs and connecting both JFET gates of each G4FET together. The front gate terminals of the G4FETs constitute additional terminals (that is, terminals not available in the older JFET version) to which one can apply control voltages VN and VP. Circuits in which NDR devices have been used include (1) Schmitt triggers and (2) oscillators containing inductance/ capacitance (LC) resonant circuits. Figure 2 depicts such circuits containing G4FET NDR devices like that of Figure 1. In the Schmitt trigger shown here, the G4FET NDR is loaded with an ordinary inversion-mode, p-channel, metal oxide/semiconductor field-effect transistor (inversion-mode PMOSFET), the VN terminal of the G4FET NDR device is used as an input terminal, and the input terminals of the PMOSFET and the G4FET NDR device are connected. VP can be used as an extra control voltage (that is, a control voltage not available in a typical prior Schmitt trigger) for adjusting the pinch-off voltage of the p-channel G4FET and thereby adjusting the trigger-voltage window. In the oscillator, a G4FET NDR device is loaded with a conventional LC tank circuit. As in other LC NDR oscillators, oscillation occurs because the NDR counteracts the resistance in the tank circuit. The advantage of this G4FET-NDR LC oscillator

THz spectra and corresponding vibrational modes of DNA base pair cocrystals and polynucleotides

NASA Astrophysics Data System (ADS)

Wang, Fang; Zhao, Dongbo; Dong, Hao; Jiang, Ling; Huang, Lin; Liu, Yunfei; Li, Shuhua

2018-07-01

The generalized energy-based fragmentation (GEBF) approach has been applied to study the THz spectra and vibrational modes of base pair cocrystals under periodic boundary conditions (denoted as PBC-GEBF). Results of vibrational mode reveal that hydrogen bonds play a pivotal role in the pairing process of base crystals, where most Nsbnd H and Csbnd H bonds stretch to some extent. We also found that hydrogen bonds of a self-made A:T cocrystal completely break in a transition from liquid to the solid state, while self-made C:G cocrystal is different and easier to form a cocrystal, as confirmed by X-ray diffraction (XRD) and terahertz (THz) spectra. Furthermore, we have studied DNA polynucleotides (in both A and B forms) found that the vibrational modes changed a lot during the process of their forming double strand. Despite the key role played by hydrogen bonds, the key contribution originates from collective motions of the main skeleton. A comparative study of the spectra of some stranded fragments suggests that different sequences or forms have similar spectra in THz band. They distinguish from each other mainly in the low-frequency regions, especially below 1 THz. This study would make great contributions to the molecular dynamics model based DNA long-chain structure simulation in the future study.

Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase ι: Hoogsteen or Watson-Crick base pairing?†

PubMed Central

Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

2009-01-01

Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536

Solution structure of a DNA decamer duplex containing the stable 3′ T⋅G base pair of the pyrimidine(6–4)pyrimidone photoproduct [(6–4) adduct]: Implications for the highly specific 3′ T → C transition of the (6–4) adduct

PubMed Central

Lee, Joon-Hwa; Hwang, Geum-Sook; Choi, Byong-Seok

1999-01-01

The pyrimidine(6–4)pyrimidone photoproduct [(6–4) adduct] is one of the major photoproducts induced by UV irradiation of DNA and occurs at TpT sites. The (6–4) adduct is highly mutagenic and leads most often to a 3′ T → C transition with 85% replicating error frequency [LeClerc, J. E., Borden, A. & Lawrence, C. W. (1991) Proc. Natl. Acad. Sci. USA 88, 9685–9689]. To determine the origin of the specific 3′ T → C transition of the (6–4) adduct, we have used experimental NMR restraints and molecular dynamics to determine the solution structure of a (6–4)-lesion DNA decamer duplex that contains a mismatched base pair between the 3′ T residue and an opposed G residue. Normal Watson–Crick-type hydrogen bonding is retained at the 5′ T of the lesion site. The O2 carbonyl of the 3′ T residue forms hydrogen bonds with the imino and amino protons of the opposed G residue. This potential hydrogen bonding stabilizes the overall helix and restores the highly distorted conformation of the (6–4) adduct to the typical B-form-like DNA structure. This structural feature can explain the marked preference for the insertion of an A residue opposite the 5′ T and a G residue opposite the 3′ T of the (6–4) lesion during trans-lesion synthesis. Thus these insertions yield the predominant 3′ T → C transition. PMID:10359763

Magnetic Polarizability of Virtual (s\\bar{s}) and (c\\bar{c}) Pairs in the Nucleon

NASA Astrophysics Data System (ADS)

Filip, Peter

2017-12-01

We suggest 3 P 0 quantum state of virtual (s\\bar{s}) pairs in the nucleon can be polarised by the internal fields permeating the volume of the nucleon (proton or neutron). Due to the quadratic Zeeman interaction, 3 P 0 wavefunction of virtual (q\\bar{q}) pairs acquires the admixture of 1 P 10 quantum state in the magnetic field, which generates the antiparallel polarization of s and \\bar{s} quarks (in the nucleon). Considering the internal magnetic fields of neutron and proton (originating from their measured magnetic dipole moments), we suggest the induced s-quark polarization in the neutron to be of the oposite direction compared to the proton case. We mention the influence of the internal chromo-magnetic fields on the quantum state of (q\\bar{q}) pairs in the nucleon and we discuss also the expected behaviour of virtual (c\\bar{c}) pairs.

Direct NMR Evidence that Transient Tautomeric and Anionic States in dG·dT Form Watson-Crick-like Base Pairs.

PubMed

Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M

2017-03-29

The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.

Nucleic acid duplexes incorporating a dissociable covalent base pair

NASA Technical Reports Server (NTRS)

Gao, K.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

1999-01-01

We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure.

Nucleic acid duplexes incorporating a dissociable covalent base pair

PubMed Central

Gao, Kui; Orgel, Leslie E.

1999-01-01

We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure. PMID:10611299

Additional hydrogen bonds and base-pair kinetics in the symmetrical AMP-DNA aptamer complex.

PubMed Central

Nonin-Lecomte, S; Lin, C H; Patel, D J

2001-01-01

The solution structure of an adenosine monophosphate (AMP)-DNA aptamer complex has been determined previously [Lin, C. H., and Patel, D. J. (1997) Chem. Biol. 4:817-832]. On a symmetrical aptamer complex containing the same binding loop, but with better resolved spectra, we have identified two additional hydrogen bond-mediated associations in the binding loop. One of these involves a rapidly exchanging G imino proton. The phosphate group of the AMP ligand was identified as the acceptor by comparison with other aptamer complexes. Imino proton exchange measurements also yielded the dissociation constants of the stem and binding loop base pairs. This study shows that nuclear magnetic resonance-based imino proton exchange is a good probe for detection of weak hydrogen-bond associations. PMID:11721004

International Union of Basic and Clinical Pharmacology. LXXXVIII. G Protein-Coupled Receptor List: Recommendations for New Pairings with Cognate Ligands

PubMed Central

Alexander, Stephen P. H.; Sharman, Joanna L.; Pawson, Adam J.; Benson, Helen E.; Monaghan, Amy E.; Liew, Wen Chiy; Mpamhanga, Chidochangu P.; Bonner, Tom I.; Neubig, Richard R.; Pin, Jean Philippe; Spedding, Michael; Harmar, Anthony J.

2013-01-01

In 2005, the International Union of Basic and Clinical Pharmacology Committee on Receptor Nomenclature and Drug Classification (NC-IUPHAR) published a catalog of all of the human gene sequences known or predicted to encode G protein-coupled receptors (GPCRs), excluding sensory receptors. This review updates the list of orphan GPCRs and describes the criteria used by NC-IUPHAR to recommend the pairing of an orphan receptor with its cognate ligand(s). The following recommendations are made for new receptor names based on 11 pairings for class A GPCRs: hydroxycarboxylic acid receptors [HCA1 (GPR81) with lactate, HCA2 (GPR109A) with 3-hydroxybutyric acid, HCA3 (GPR109B) with 3-hydroxyoctanoic acid]; lysophosphatidic acid receptors [LPA4 (GPR23), LPA5 (GPR92), LPA6 (P2Y5)]; free fatty acid receptors [FFA4 (GPR120) with omega-3 fatty acids]; chemerin receptor (CMKLR1; ChemR23) with chemerin; CXCR7 (CMKOR1) with chemokines CXCL12 (SDF-1) and CXCL11 (ITAC); succinate receptor (SUCNR1) with succinate; and oxoglutarate receptor [OXGR1 with 2-oxoglutarate]. Pairings are highlighted for an additional 30 receptors in class A where further input is needed from the scientific community to validate these findings. Fifty-seven human class A receptors (excluding pseudogenes) are still considered orphans; information has been provided where there is a significant phenotype in genetically modified animals. In class B, six pairings have been reported by a single publication, with 28 (excluding pseudogenes) still classified as orphans. Seven orphan receptors remain in class C, with one pairing described by a single paper. The objective is to stimulate research into confirming pairings of orphan receptors where there is currently limited information and to identify cognate ligands for the remaining GPCRs. Further information can be found on the IUPHAR Database website (http://www.iuphar-db.org). PMID:23686350

[Quantum-chemical investigation of tautomerization ways of Watson-Crick DNA base pair guanine-cytosine].

PubMed

Brovarets', O O; Hovorun, D M

2010-01-01

A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*<---->Gua.Cyt<---->Gua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.

Terminal base pairs of oligodeoxynucleotides: imino proton exchange and fraying.

PubMed

Nonin, S; Leroy, J L; Guéron, M

1995-08-22

We have estimated the dissociation constant of the terminal base pairs of the B-DNA duplexes formed by 5'-d(CGCGATCGCG) and 5'-d(TAGCGCTA) by two methods, one based on the change in imino proton chemical shift with temperature and the other on the apparent pK shift of the imino proton, as monitored by the change in chemical shift of aromatic protons. These methods do not rely on imino proton exchange, whose rate was also measured. (1) The effect of ammonia on the imino proton exchange rate of the terminal pair of the 5'-d(CGCGATCGCG) duplex is 67 times less than on the isolated nucleoside. This provides an upper limit on the exchange rate from the closed pair. In fact, the effect is just as predicted from the dissociation constant, assuming that there is no exchange at all from the closed pair and that, as has been argued previously, external catalysts act on the open state as they do on the isolated nucleoside. The inhibition of catalyzed proton exchange in the closed pair, despite exposure of one face of the pair to solvent, is a new feature of the exchange process. It will allow determination of the dissociation constant of terminal pairs from the exchange rate. (2) Intrinsic catalysis of proton exchange is less efficient for the terminal pair than for an internal one. A possible explanation is that proton transfer across the water bridge responsible for intrinsic catalysis is slower, as expected if the open-state separation of the bases is larger in a terminal pair. This observation may lead to a direct method for the study of fraying. (3) At 0 degrees C, the dissociation constant of the second pair of the 5'-d(CGCGATCGCG) duplex is close to the square of the constant for the terminal pair, as predicted from a simple model of fraying. The enthalpy and entropy of opening of the terminal pairs may be compared with those of nearest neighbor interactions derived from calorimetry [Breslauer, K. J., et al. (1986) Proc. Natl. Acad. Sci. U.S.A. 83, 3746-3750].

THz spectra and corresponding vibrational modes of DNA base pair cocrystals and polynucleotides.

PubMed

Wang, Fang; Zhao, Dongbo; Dong, Hao; Jiang, Ling; Huang, Lin; Liu, Yunfei; Li, Shuhua

2018-07-05

The generalized energy-based fragmentation (GEBF) approach has been applied to study the THz spectra and vibrational modes of base pair cocrystals under periodic boundary conditions (denoted as PBC-GEBF). Results of vibrational mode reveal that hydrogen bonds play a pivotal role in the pairing process of base crystals, where most NH and CH bonds stretch to some extent. We also found that hydrogen bonds of a self-made A:T cocrystal completely break in a transition from liquid to the solid state, while self-made C:G cocrystal is different and easier to form a cocrystal, as confirmed by X-ray diffraction (XRD) and terahertz (THz) spectra. Furthermore, we have studied DNA polynucleotides (in both A and B forms) found that the vibrational modes changed a lot during the process of their forming double strand. Despite the key role played by hydrogen bonds, the key contribution originates from collective motions of the main skeleton. A comparative study of the spectra of some stranded fragments suggests that different sequences or forms have similar spectra in THz band. They distinguish from each other mainly in the low-frequency regions, especially below 1 THz. This study would make great contributions to the molecular dynamics model based DNA long-chain structure simulation in the future study. Copyright © 2018 Elsevier B.V. All rights reserved.

Base pairing and structural insights into the 5-formylcytosine in RNA duplex

PubMed Central

Wang, Rui; Luo, Zhipu; He, Kaizhang; Delaney, Michael O.; Chen, Doris; Sheng, Jia

2016-01-01

Abstract 5-Formylcytidine (f5C), a previously discovered natural nucleotide in the mitochondrial tRNA of many species including human, has been recently detected as the oxidative product of 5-methylcytidine (m5C) through 5-hydroxymethylcytidine (hm5C) in total RNA of mammalian cells. The discovery indicated that these cytosine derivatives in RNA might also play important epigenetic roles similar as in DNA, which has been intensively investigated in the past few years. In this paper, we studied the base pairing specificity of f5C in different RNA duplex contexts. We found that the 5-formyl group could increase duplex thermal stability and enhance base pairing specificity. We present three high-resolution crystal structures of an octamer RNA duplex [5′-GUA(f5C)GUAC-3′]2 that have been solved under three crystallization conditions with different buffers and pH values. Our results showed that the 5-formyl group is located in the same plane as the cytosine base and forms an intra-residue hydrogen bond with the amino group in the N4 position. In addition, this modification increases the base stacking between the f5C and the neighboring bases while not causing significant global and local structure perturbations. This work provides insights into the effects of 5-formylcytosine on RNA duplex. PMID:27079978

Molecular switching behavior in isosteric DNA base pairs.

PubMed

Jissy, A K; Konar, Sukanya; Datta, Ayan

2013-04-15

The structures and proton-coupled behavior of adenine-thymine (A-T) and a modified base pair containing a thymine isostere, adenine-difluorotoluene (A-F), are studied in different solvents by dispersion-corrected density functional theory. The stability of the canonical Watson-Crick base pair and the mismatched pair in various solvents with low and high dielectric constants is analyzed. It is demonstrated that A-F base pairing is favored in solvents with low dielectric constant. The stabilization and conformational changes induced by protonation are also analyzed for the natural as well as the mismatched base pair. DNA sequences capable of changing their sequence conformation on protonation are used in the construction of pH-based molecular switches. An acidic medium has a profound influence in stabilizing the isostere base pair. Such a large gain in stability on protonation leads to an interesting pH-controlled molecular switch, which can be incorporated in a natural DNA tract. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Layer-Based Approach for Image Pair Fusion.

PubMed

Son, Chang-Hwan; Zhang, Xiao-Ping

2016-04-20

Recently, image pairs, such as noisy and blurred images or infrared and noisy images, have been considered as a solution to provide high-quality photographs under low lighting conditions. In this paper, a new method for decomposing the image pairs into two layers, i.e., the base layer and the detail layer, is proposed for image pair fusion. In the case of infrared and noisy images, simple naive fusion leads to unsatisfactory results due to the discrepancies in brightness and image structures between the image pair. To address this problem, a local contrast-preserving conversion method is first proposed to create a new base layer of the infrared image, which can have visual appearance similar to another base layer such as the denoised noisy image. Then, a new way of designing three types of detail layers from the given noisy and infrared images is presented. To estimate the noise-free and unknown detail layer from the three designed detail layers, the optimization framework is modeled with residual-based sparsity and patch redundancy priors. To better suppress the noise, an iterative approach that updates the detail layer of the noisy image is adopted via a feedback loop. This proposed layer-based method can also be applied to fuse another noisy and blurred image pair. The experimental results show that the proposed method is effective for solving the image pair fusion problem.

The tolerance to exchanges of the Watson–Crick base pair in the hammerhead ribozyme core is determined by surrounding elements

PubMed Central

Przybilski, Rita; Hammann, Christian

2007-01-01

Tertiary interacting elements are important features of functional RNA molecules, for example, in all small nucleolytic ribozymes. The recent crystal structure of a tertiary stabilized type I hammerhead ribozyme revealed a conventional Watson–Crick base pair in the catalytic core, formed between nucleotides C3 and G8. We show that any Watson–Crick base pair between these positions retains cleavage competence in two type III ribozymes. In the Arabidopsis thaliana sequence, only moderate differences in cleavage rates are observed for the different base pairs, while the peach latent mosaic viroid (PLMVd) ribozyme exhibits a preference for a pyrimidine at position 3 and a purine at position 8. To understand these differences, we created a series of chimeric ribozymes in which we swapped sequence elements that surround the catalytic core. The kinetic characterization of the resulting ribozymes revealed that the tertiary interacting loop sequences of the PLMVd ribozyme are sufficient to induce the preference for Y3–R8 base pairs in the A. thaliana hammerhead ribozyme. In contrast to this, only when the entire stem–loops I and II of the A. thaliana sequences are grafted on the PLMVd ribozyme is any Watson–Crick base pair similarly tolerated. The data provide evidence for a complex interplay of secondary and tertiary structure elements that lead, mediated by long-range effects, to an individual modulation of the local structure in the catalytic core of different hammerhead ribozymes. PMID:17666711

An oxygen-vacancy-rich Z-scheme g-C3N4/Pd/TiO2 heterostructure for enhanced visible light photocatalytic performance

NASA Astrophysics Data System (ADS)

Guo, Yanru; Xiao, Limin; Zhang, Min; Li, Qiuye; Yang, Jianjun

2018-05-01

An oxygen-vacancy-rich Z-scheme g-C3N4/Pd/TiO2 ternary nanocomposite was fabricated using nanotubular titanic acid as precursors via a simple photo-deposition of Pd nanoparticles and calcination process. The prepared nanocomposites were investigated by X-ray diffraction, transmission electron microscopy, X-ray photoelectron spectroscopy, and UV-visible diffuse reflectance spectroscopy, respectively. For g-C3N4/TiO2 binary nanocomposites, at the optimal content of g-C3N4 (2%), the apparent photocatalytic activity of 2%g-C3N4/TiO2 was 9 times higher than that of pure TiO2 under visible-light illumination. After deposition of Pd (1 wt%) at the contact interface between g-C3N4 and TiO2, the 2%g-C3N4/Pd/TiO2 ternary nanocomposites demonstrated the highest visible-light-driven photocatalytic activity for the degradation of gaseous propylene, which was 16- and 2-fold higher activities than pure TiO2 and 2%g-C3N4/TiO2, respectively. The mechanism for the enhanced photocatalytic performance of the g-C3N4/Pd/TiO2 photo-catalyst is proposed to be based on the efficient separation of photo-generated electron-hole pairs through Z-scheme system, in which uniform dispersity of Pd nanoparticles at contact interface between g-C3N4 and TiO2 and oxygen vacancies promote charge separation.

Fragment-Based Approaches to Enhance GTP Competitive KRAS G12C Inhibitors

DTIC Science & Technology

During the current period we completed work on a series of guanine nucleotide mimetics and published results. As part of this we developed and...reported a novel method of measuring small molecule binding to KRAS G12C active site. We also published 2 additional manuscripts about KRAS G12C directed

Optimal self-cleavage activity of the hepatitis delta virus RNA is dependent on a homopurine base pair in the ribozyme core.

PubMed Central

Been, M D; Perrotta, A T

1995-01-01

A non-Watson-Crick G.G interaction within the core region of the hepatitis delta virus (HDV) antigenomic ribozyme is required for optimal rates of self-cleavage activity. Base substitutions for either one or both G's revealed that full activity was obtained only when both G's were replaced with A's. At those positions, substitutions that generate potential Watson-Crick, G.U, heteropurine, or homopyrimidine combinations resulted in dramatically lower cleavage activity. A homopurine symmetric base pair, of the same type identified in the high-affinity binding site of the HIV RRE, is most consistent with this data. Additional features shared between the antigenomic ribozyme and the Rev binding site in the vicinity of the homopurine pairs suggest some structural similarity for this region of the two RNAs and a possible motif associated with this homopurine interaction. Evidence for a homopurine pair at the equivalent position in a modified form of the HDV genomic ribozyme was also found. With the postulated symmetric pairing scheme, large distortions in the nucleotide conformation, the sugar-phosphate backbone, or both would be necessary to accommodate this interaction at the end of a helix; we hypothesize that this distortion is critical to the structure of the active site of the ribozyme and it is stabilized by the homopurine base pair. PMID:8595561

Triple helical polynucleotidic structures: an FTIR study of the C+ .G. Ctriplet.

PubMed

Akhebat, A; Dagneaux, C; Liquier, J; Taillandier, E

1992-12-01

Triple helixes containing one homopurine poly dG or poly rG strand and two homopyrimidine poly dC or poly rC strands have been prepared and studied by FTIR spectroscopy in H2O and D2O solutions. The spectra are discussed by comparison with those of the corresponding third strands (auto associated or not) and of double stranded poly dG.poly dC and poly rG.poly rC in the same concentration range and salt conditions. The triplex formation is characterized by the study of the base-base interactions reflected by changes in the spectral domain involving the in-plane double bond vibrations of the bases. Modifications of the initial duplex conformation (A family form for poly rG.poly rC, B family form for poly dG.poly dC) when the triplex is formed have been investigated. Two spectral domains (950-800 and 1450-1350 cm-1) containing absorption bands markers of the N and S type sugar geometries have been extensively studied. The spectra of the triplexes prepared starting with a double helix containing only riboses (poly rC+.poly rG.poly rC and poly dC+.poly rG.poly rC) as well as that of poly rC+.poly dG.poly dC present exclusively markers of the North type geometry of the sugars. On the contrary in the case of the poly dC+.poly dG.poly dC triplex both N and S type sugars are shown to coexist. The FTIR spectra allow us to propose that in this case the sugars of the purine (poly dG) strand adopt the S type geometry.

Hydroxylamine and methoxyamine mutagenesis: displacement of the tautomeric equilibrium of the promutagen N6-methoxyadenosine by complementary base pairing.

PubMed

Stolarski, R; Kierdaszuk, B; Hagberg, C E; Shugar, D

1984-06-19

The imino-amino tautomeric equilibrium of the promutagenic adenosine analogue N6-methoxy-2',3',5'-tri-O-methyladenosine [OMe6A(Me)3], in solvents of various polarities, has been studied with the aid of 1H and 13C NMR spectroscopy. The high energy barrier (free enthalpy delta G = 80 +/- 5 kJ X mol-1) between the two tautomeric species renders possible direct observation of the independent sets of all 1H and 13C signals from each of them. The equilibrium ranges from 10% imino in CCl4 to 90% in aqueous medium. Thermodynamic parameters, including energy barriers and lifetimes, were calculated from the temperature dependence of the equilibrium. Essentially similar results prevail for the promutagenic N6-hydroxy analogue. The conformations of the sugar moieties, and of the base about the glycosidic bond, for both tautomers are similar to those for adenosine. The conformation of the exocyclic N6-OCH3 group, which determines the ability of each species to form planar associates (hydrogen-bonded base pairs), has also been evaluated. Formation of autoassociates of OMe6A(Me)3 and of heteroassociates with the potentially complementary 2',3',5'-tri-O-methyluridine and -cytidine, in chloroform solution, was also investigated. The amino form base pairs with uridine and the imino form with cytidine. Formation of a complementary base pair by a given tautomeric species was accompanied by an increase of up to 10% in the population of this species and a concomitant decrease in population of the other species.(ABSTRACT TRUNCATED AT 250 WORDS)

Identification in a pseudoknot of a U⋅G motif essential for the regulation of the expression of ribosomal protein S15

PubMed Central

Bénard, Lionel; Mathy, Nathalie; Grunberg-Manago, Marianne; Ehresmann, Bernard; Ehresmann, Chantal; Portier, Claude

1998-01-01

The ribosomal protein S15 from Escherichia coli binds to a pseudoknot in its own messenger. This interaction is an essential step in the mechanism of S15 translational autoregulation. In a previous study, a recognition determinant for S15 autoregulation, involving a U⋅G wobble pair, was located in the center of stem I of the pseudoknot. In this study, an extensive mutagenesis analysis has been conducted in and around this U⋅G pair by comparing the effects of these mutations on the expression level of S15. The results show that the U⋅G wobble pair cannot be substituted by A⋅G, C⋅A, A⋅C, G⋅U, or C⋅G without loss of the autocontrol. In addition, the base pair C⋅G, adjacent to the 5′ side of U, cannot be flipped or changed to another complementary base pair without also inducing derepression of translation. A unique motif, made of only two adjacent base pairs, U⋅G/C⋅G, is essential for S15 autoregulation and is presumably involved in direct recognition by the S15 protein. PMID:9482926

Bipyrimidine Signatures as a Photoprotective Genome Strategy in G + C-rich Halophilic Archaea.

PubMed

Jones, Daniel L; Baxter, Bonnie K

2016-09-02

Halophilic archaea experience high levels of ultraviolet (UV) light in their environments and demonstrate resistance to UV irradiation. DNA repair systems and carotenoids provide UV protection but do not account for the high resistance observed. Herein, we consider genomic signatures as an additional photoprotective strategy. The predominant forms of UV-induced DNA damage are cyclobutane pyrimidine dimers, most notoriously thymine dimers (T^Ts), which form at adjacent Ts. We tested whether the high G + C content seen in halophilic archaea serves a photoprotective function through limiting T nucleotides, and thus T^T lesions. However, this speculation overlooks the other bipyrimidine sequences, all of which capable of forming photolesions to varying degrees. Therefore, we designed a program to determine the frequencies of the four bipyrimidine pairs (5' to 3': TT, TC, CT, and CC) within genomes of halophilic archaea and four other randomized sample groups for comparison. The outputs for each sampled genome were weighted by the intrinsic photoreactivities of each dinucleotide pair. Statistical methods were employed to investigate intergroup differences. Our findings indicate that the UV-resistance seen in halophilic archaea can be attributed in part to a genomic strategy: high G + C content and the resulting bipyrimidine signature reduces the genomic photoreactivity.

Bipyrimidine Signatures as a Photoprotective Genome Strategy in G + C-rich Halophilic Archaea

PubMed Central

Jones, Daniel L.; Baxter, Bonnie K.

2016-01-01

Halophilic archaea experience high levels of ultraviolet (UV) light in their environments and demonstrate resistance to UV irradiation. DNA repair systems and carotenoids provide UV protection but do not account for the high resistance observed. Herein, we consider genomic signatures as an additional photoprotective strategy. The predominant forms of UV-induced DNA damage are cyclobutane pyrimidine dimers, most notoriously thymine dimers (T^Ts), which form at adjacent Ts. We tested whether the high G + C content seen in halophilic archaea serves a photoprotective function through limiting T nucleotides, and thus T^T lesions. However, this speculation overlooks the other bipyrimidine sequences, all of which capable of forming photolesions to varying degrees. Therefore, we designed a program to determine the frequencies of the four bipyrimidine pairs (5’ to 3’: TT, TC, CT, and CC) within genomes of halophilic archaea and four other randomized sample groups for comparison. The outputs for each sampled genome were weighted by the intrinsic photoreactivities of each dinucleotide pair. Statistical methods were employed to investigate intergroup differences. Our findings indicate that the UV-resistance seen in halophilic archaea can be attributed in part to a genomic strategy: high G + C content and the resulting bipyrimidine signature reduces the genomic photoreactivity. PMID:27598206

Synthesis, base pairing and structure studies of geranylated RNA

PubMed Central

Wang, Rui; Vangaveti, Sweta; Ranganathan, Srivathsan V.; Basanta-Sanchez, Maria; Haruehanroengra, Phensinee; Chen, Alan; Sheng, Jia

2016-01-01

Natural RNAs utilize extensive chemical modifications to diversify their structures and functions. 2-Thiouridine geranylation is a special hydrophobic tRNA modification that has been discovered very recently in several bacteria, such as Escherichia coli, Enterobacter aerogenes, Pseudomonas aeruginosa and Salmonella Typhimurium. The geranylated residues are located in the first anticodon position of tRNAs specific for lysine, glutamine and glutamic acid. This big hydrophobic terpene functional group affects the codon recognition patterns and reduces frameshifting errors during translation. We aimed to systematically study the structure, function and biosynthesis mechanism of this geranylation pathway, as well as answer the question of why nature uses such a hydrophobic modification in hydrophilic RNA systems. Recently, we have synthesized the deoxy-analog of S-geranyluridine and showed the geranylated T-G pair is much stronger than the geranylated T-A pair and other mismatched pairs in the B-form DNA duplex context, which is consistent with the observation that the geranylated tRNAGluUUC recognizes GAG more efficiently than GAA. In this manuscript we report the synthesis and base pairing specificity studies of geranylated RNA oligos. We also report extensive molecular simulation studies to explore the structural features of the geranyl group in the context of A-form RNA and its effect on codon–anticodon interaction during ribosome binding. PMID:27307604

An ensemble of SVM classifiers based on gene pairs.

PubMed

Tong, Muchenxuan; Liu, Kun-Hong; Xu, Chungui; Ju, Wenbin

2013-07-01

In this paper, a genetic algorithm (GA) based ensemble support vector machine (SVM) classifier built on gene pairs (GA-ESP) is proposed. The SVMs (base classifiers of the ensemble system) are trained on different informative gene pairs. These gene pairs are selected by the top scoring pair (TSP) criterion. Each of these pairs projects the original microarray expression onto a 2-D space. Extensive permutation of gene pairs may reveal more useful information and potentially lead to an ensemble classifier with satisfactory accuracy and interpretability. GA is further applied to select an optimized combination of base classifiers. The effectiveness of the GA-ESP classifier is evaluated on both binary-class and multi-class datasets. Copyright © 2013 Elsevier Ltd. All rights reserved.

Unconventionally prepared TiO2/g-C3N4 photocatalysts for photocatalytic decomposition of nitrous oxide

NASA Astrophysics Data System (ADS)

Troppová, Ivana; Šihor, Marcel; Reli, Martin; Ritz, Michal; Praus, Petr; Kočí, Kamila

2018-02-01

The TiO2/g-C3N4 nanocomposites with the various TiO2:g-C3N4 weight ratios from 1:1 to 1:3 were prepared unconventionally by pressurized hot water processing in a flow regime. The parent TiO2 and g-C3N4 was prepared by thermal hydrolysis and thermal annealing, respectively. The nanocomposites as well as parent TiO2 and g-C3N4 were characterized using several complementary characterization methods and investigated in the photocatalytic decomposition of N2O under UVA (λ = 365 nm) irradiation. All the prepared TiO2/g-C3N4 nanocomposites showed higher photocatalytic activity in comparison with the pure g-C3N4 and chiefly pure TiO2. The photocatalytic activity of TiO2/g-C3N4 nanocomposites was decreasing in the following sequence: TiO2/g-C3N4 (1:3) > TiO2/g-C3N4 (1:2) > TiO2/g-C3N4 (1:1). In comparison with the parent TiO2 or g-C3N4, the TiO2/g-C3N4 nanocomposites' photocatalytic capability was significantly enhanced by coupling TiO2 with g-C3N4. The generation of TiO2/g-C3N4 Z-scheme photocatalyst mainly benefited from the effective separation of photoinduced electron-hole pairs and the extended optical absorption range. The TiO2/g-C3N4 (1:3) nanocomposite showed the best photocatalytic behavior in a consequence of the optimal weight ratio of TiO2:g-C3N4 and the lowest band gap energy from all nanocomposites. The N2O conversion in its presence was 70.6% after 20 h of UVA irradiation.

tRNA1Ser(G34) with the anticodon GGA can recognize not only UCC and UCU codons but also UCA and UCG codons.

PubMed

Yamada, Yuko; Matsugi, Jitsuhiro; Ishikura, Hisayuki

2003-04-15

The tRNA1Ser (anticodon VGA, V=uridin-5-oxyacetic acid) is essential for translation of the UCA codon in Escherichia coli. Here, we studied the translational abilities of serine tRNA derivatives, which have different bases from wild type at the first positions of their anticodons, using synthetic mRNAs containing the UCN (N=A, G, C, or U) codon. The tRNA1Ser(G34) having the anticodon GGA was able to read not only UCC and UCU codons but also UCA and UCG codons. This means that the formation of G-A or G-G pair allowed at the wobble position and these base pairs are noncanonical. The translational efficiency of the tRNA1Ser(G34) for UCA or UCG codon depends on the 2'-O-methylation of the C32 (Cm). The 2'-O-methylation of C32 may give rise to the space necessary for G-A or G-G base pair formation between the first position of anticodon and the third position of codon.

Base-Pairing Energies of Protonated Nucleoside Base Pairs of dCyd and m5dCyd: Implications for the Stability of DNA i-Motif Conformations

NASA Astrophysics Data System (ADS)

Yang, Bo; Rodgers, M. T.

2015-08-01

Hypermethylation of cytosine in expanded (CCG)n•(CGG)n trinucleotide repeats results in Fragile X syndrome, the most common cause of inherited mental retardation. The (CCG)n•(CGG)n repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of protonated base pairs of cytosine. Here we investigate the effects of 5-methylation and the sugar moiety on the base-pairing energies (BPEs) of protonated cytosine base pairs by examining protonated nucleoside base pairs of 2'-deoxycytidine (dCyd) and 5-methyl-2'-deoxycytidine (m5dCyd) using threshold collision-induced dissociation techniques. 5-Methylation of a single or both cytosine residues leads to very small change in the BPE. However, the accumulated effect may be dramatic in diseased state trinucleotide repeats where many methylated base pairs may be present. The BPEs of the protonated nucleoside base pairs examined here significantly exceed those of Watson-Crick dGuo•dCyd and neutral dCyd•dCyd base pairs, such that these base-pairing interactions provide the major forces responsible for stabilization of DNA i-motif conformations. Compared with isolated protonated nucleobase pairs of cytosine and 1-methylcytosine, the 2'-deoxyribose sugar produces an effect similar to the 1-methyl substituent, and leads to a slight decrease in the BPE. These results suggest that the base-pairing interactions may be slightly weaker in nucleic acids, but that the extended backbone is likely to exert a relatively small effect on the total BPE. The proton affinity (PA) of m5dCyd is also determined by competitive analysis of the primary dissociation pathways that occur in parallel for the protonated (m5dCyd)H+(dCyd) nucleoside base pair and the absolute PA of dCyd previously reported.

Reactivity of cytosine and thymine in single-base-pair mismatches with hydroxylamine and osmium tetroxide and its application to the study of mutations.

PubMed Central

Cotton, R G; Rodrigues, N R; Campbell, R D

1988-01-01

The chemical reactivity of thymine (T), when mismatched with the bases cytosine, guanine, and thymine, and of cytosine (C), when mismatched with thymine, adenine, and cytosine, has been examined. Heteroduplex DNAs containing such mismatched base pairs were first incubated with osmium tetroxide (for T and C mismatches) or hydroxylamine (for C mismatches) and then incubated with piperidine to cleave the DNA at the modified mismatched base. This cleavage was studied with an internally labeled strand containing the mismatched T or C, such that DNA cleavage and thus reactivity could be detected by gel electrophoresis. Cleavage at a total of 13 T and 21 C mismatches isolated (by at least three properly paired bases on both sides) single-base-pair mismatches was identified. All T or C mismatches studied were cleaved. By using end-labeled DNA probes containing T or C single-base-pair mismatches and conditions for limited cleavage, we were able to show that cleavage was at the base predicted by sequence analysis and that mismatches in a length of DNA could be readily detected by such an approach. This procedure may enable detection of all single-base-pair mismatches by use of sense and antisense probes and thus may be used to identify the mutated base and its position in a heteroduplex. Images PMID:3260032

The effect of the common c.2299delG mutation in USH2A on RNA splicing.

PubMed

Lenassi, Eva; Saihan, Zubin; Bitner-Glindzicz, Maria; Webster, Andrew R

2014-05-01

Recessive variants in the USH2A gene are an important cause of both Usher syndrome and nonsyndromic retinitis pigmentosa. A single base-pair deletion in exon 13 (c.2299delG, p.Glu767Serfs*21) is considered the most frequent mutation of USH2A. It is predicted to generate a premature termination codon and is presumed to lead to nonsense mediated decay. However the effect of this variant on RNA has not been formally investigated. It is not uncommon for exonic sequence alterations to cause aberrant splicing and the aim of the present report is to evaluate the effect of c.2299delG on USH2A transcripts. Nasal cells represent the simplest available tissue to study splicing defects in USH2A. Nasal brushing, RNA extraction from nasal epithelial cells and reverse transcription PCR were performed in five Usher syndrome patients who were homozygous for c.2299delG, two unaffected c.2299delG heterozygotes and seven control individuals. Primers to amplify between exons 12 and 15 and exons 10 and 14 were utilised. Significant variability was observed between different RT-PCR experiments. Importantly, in controls, PCR product of the expected size were amplified on all occasions (13/13 experiments); for patients this was true in only 4/14 experiments (Fisher exact test p = 0.0002). Bioinformatics tools predict the c.2299delG change to disrupt an exonic splicing enhancer and to create an exonic splicing silencer within exon 13. Here, we report an effect of the common c.2299delG mutation on splicing of exons 12 and 13 of USH2A. Future studies are expected to provide important insights into the contribution of this effect on the phenotype. Copyright © 2014 Elsevier Ltd. All rights reserved.

Unique Thermal Stability of Unnatural Hydrophobic Ds Bases in Double-Stranded DNAs.

PubMed

Kimoto, Michiko; Hirao, Ichiro

2017-10-20

Genetic alphabet expansion technology, the introduction of unnatural bases or base pairs into replicable DNA, has rapidly advanced as a new synthetic biology area. A hydrophobic unnatural base pair between 7-(2-thienyl)imidazo[4,5-b]pyridine (Ds) and 2-nitro-4-propynylpyrrole (Px) exhibited high fidelity as a third base pair in PCR. SELEX methods using the Ds-Px pair enabled high-affinity DNA aptamer generation, and introducing a few Ds bases into DNA aptamers extremely augmented their affinities and selectivities to target proteins. Here, to further scrutinize the functions of this highly hydrophobic Ds base, the thermal stabilities of double-stranded DNAs (dsDNA) containing a noncognate Ds-Ds or G-Ds pair were examined. The thermal stability of the Ds-Ds self-pair was as high as that of the natural G-C pair, and apart from the generally higher stability of the G-C pair than that of the A-T pair, most of the 5'-pyrimidine-Ds-purine-3' sequences, such as CDsA and TDsA, exhibited higher stability than the 5'-purine-Ds-pyrimidine-3' sequences, such as GDsC and ADsC, in dsDNAs. This trait enabled the GC-content-independent control of the thermal stability of the designed dsDNA fragments. The melting temperatures of dsDNA fragments containing the Ds-Ds pair can be predicted from the nearest-neighbor parameters including the Ds base. In addition, the noncognate G-Ds pair can efficiently distinguish its neighboring cognate natural base pairs from noncognate pairs. We demonstrated that real-time PCR using primers containing Ds accurately detected a single-nucleotide mismatch in target DNAs. These unique properties of the Ds base that affect the stabilities of the neighboring base pairs could impart new functions to DNA molecules and technologies.

Theory of nodal s ±-wave pairing symmetry in the Pu-based 115 superconductor family

DOE PAGES

Das, Tanmoy; Zhu, Jian -Xin; Graf, Matthias J.

2015-02-27

The spin-fluctuation mechanism of superconductivity usually results in the presence of gapless or nodal quasiparticle states in the excitation spectrum. Nodal quasiparticle states are well established in copper-oxide, and heavy-fermion superconductors, but not in iron-based superconductors. Here, we study the pairing symmetry and mechanism of a new class of plutonium-based high-T c superconductors and predict the presence of a nodal s⁺⁻ wave pairing symmetry in this family. Starting from a density-functional theory (DFT) based electronic structure calculation we predict several three-dimensional (3D) Fermi surfaces in this 115 superconductor family. We identify the dominant Fermi surface “hot-spots” in the inter-band scatteringmore » channel, which are aligned along the wavevector Q = (π, π, π), where degeneracy could induce sign-reversal of the pairing symmetry. Our calculation demonstrates that the s⁺⁻ wave pairing strength is stronger than the previously thought d-wave pairing; and more importantly, this pairing state allows for the existence of nodal quasiparticles. Finally, we predict the shape of the momentum- and energy-dependent magnetic resonance spectrum for the identification of this pairing symmetry.« less

Graphitic Carbon Nitride (g-C3N4)-Based Photocatalysts for Artificial Photosynthesis and Environmental Remediation: Are We a Step Closer To Achieving Sustainability?

PubMed

Ong, Wee-Jun; Tan, Lling-Lling; Ng, Yun Hau; Yong, Siek-Ting; Chai, Siang-Piao

2016-06-22

As a fascinating conjugated polymer, graphitic carbon nitride (g-C3N4) has become a new research hotspot and drawn broad interdisciplinary attention as a metal-free and visible-light-responsive photocatalyst in the arena of solar energy conversion and environmental remediation. This is due to its appealing electronic band structure, high physicochemical stability, and "earth-abundant" nature. This critical review summarizes a panorama of the latest progress related to the design and construction of pristine g-C3N4 and g-C3N4-based nanocomposites, including (1) nanoarchitecture design of bare g-C3N4, such as hard and soft templating approaches, supramolecular preorganization assembly, exfoliation, and template-free synthesis routes, (2) functionalization of g-C3N4 at an atomic level (elemental doping) and molecular level (copolymerization), and (3) modification of g-C3N4 with well-matched energy levels of another semiconductor or a metal as a cocatalyst to form heterojunction nanostructures. The construction and characteristics of each classification of the heterojunction system will be critically reviewed, namely metal-g-C3N4, semiconductor-g-C3N4, isotype g-C3N4/g-C3N4, graphitic carbon-g-C3N4, conducting polymer-g-C3N4, sensitizer-g-C3N4, and multicomponent heterojunctions. The band structures, electronic properties, optical absorption, and interfacial charge transfer of g-C3N4-based heterostructured nanohybrids will also be theoretically discussed based on the first-principles density functional theory (DFT) calculations to provide insightful outlooks on the charge carrier dynamics. Apart from that, the advancement of the versatile photoredox applications toward artificial photosynthesis (water splitting and photofixation of CO2), environmental decontamination, and bacteria disinfection will be presented in detail. Last but not least, this comprehensive review will conclude with a summary and some invigorating perspectives on the challenges and future directions

Synthesis of g-C{sub 3}N{sub 4}/Ag{sub 3}PO{sub 4} heterojunction with enhanced photocatalytic performance

DOE Office of Scientific and Technical Information (OSTI.GOV)

He, Peizhi; Song, Limin; Zhang, Shujuan, E-mail: songlmnk@sohu.com

2014-03-01

Graphical abstract: g-C{sub 3}N{sub 4}/Ag{sub 3}PO{sub 4} heterojunction photocatalyst with visible-light response was prepared by a facile coprecipitation method. The results show that g-C{sub 3}N{sub 4}/Ag{sub 3}PO{sub 4} possesses a much higher activity for the decomposition of RhB than that of the pure Ag{sub 3}PO{sub 4} particles. The most mechanism is that g-C{sub 3}N{sub 4}/Ag{sub 3}PO{sub 4} heterojunction photocatalyst can efficiently separate the photogenerated electron–hole pairs, enhancing the photocatalytic activity of g-C{sub 3}N{sub 4}/Ag{sub 3}PO{sub 4} composites. - Highlights: • g-C{sub 3}N{sub 4}/Ag{sub 3}PO{sub 4} heterojunction showed much higher activity than that of Ag{sub 3}PO{sub 4}. • The high activitymore » could be attributed to g-C{sub 3}N{sub 4} for modifying Ag{sub 3}PO{sub 4}. • More ·OH radicals may be significant reason to improve Ag{sub 3}PO{sub 4} activity. - Abstract: g-C{sub 3}N{sub 4}/Ag{sub 3}PO{sub 4} heterojunction photocatalyst with visible-light response was prepared by a facile coprecipitation method. The photocatalysts were characterized by X-ray powder diffraction, transmission electron microscopy, UV–vis absorption spectroscopy and Fourier transform infrared spectroscopy. The photocatalytic activities of the obtained samples were tested by using Rhodamine B (RhB) as the degradation target under visible light irradiation. g-C{sub 3}N{sub 4}/Ag{sub 3}PO{sub 4} decomposed RhB more effectively than the pure Ag{sub 3}PO{sub 4} particles did, and 2 wt.% g-C{sub 3}N{sub 4} had the highest activity. Furthermore, 2 wt.% g-C{sub 3}N{sub 4}/Ag{sub 3}PO{sub 4} degraded high-concentration RhB more potently than unmodified Ag{sub 3}PO{sub 4} did, probably because g-C{sub 3}N{sub 4}/Ag{sub 3}PO{sub 4} heterojunction photocatalyst enhanced the photocatalytic activity by efficiently separating the photogenerated electron–hole pairs.« less

Energy barriers and rates of tautomeric transitions in DNA bases: ab initio quantum chemical study.

PubMed

Basu, Soumalee; Majumdar, Rabi; Das, Gourab K; Bhattacharyya, Dhananjay

2005-12-01

Tautomeric transitions of DNA bases are proton transfer reactions, which are important in biology. These reactions are involved in spontaneous point mutations of the genetic material. In the present study, intrinsic reaction coordinates (IRC) analyses through ab initio quantum chemical calculations have been carried out for the individual DNA bases A, T, G, C and also A:T and G:C base pairs to estimate the kinetic and thermodynamic barriers using MP2/6-31G** method for tautomeric transitions. Relatively higher values of kinetic barriers (about 50-60 kcal/mol) have been observed for the single bases, indicating that tautomeric alterations of isolated single bases are quite unlikely. On the other hand, relatively lower values of the kinetic barriers (about 20-25 kcal/mol) for the DNA base pairs A:T and G:C clearly suggest that the tautomeric shifts are much more favorable in DNA base pairs than in isolated single bases. The unusual base pairing A':C, T':G, C':A or G':T in the daughter DNA molecule, resulting from a parent DNA molecule with tautomeric shifts, is found to be stable enough to result in a mutation. The transition rate constants for the single DNA bases in addition to the base pairs are also calculated by computing the free energy differences between the transition states and the reactants.

Synthesis, base pairing and structure studies of geranylated RNA.

PubMed

Wang, Rui; Vangaveti, Sweta; Ranganathan, Srivathsan V; Basanta-Sanchez, Maria; Haruehanroengra, Phensinee; Chen, Alan; Sheng, Jia

2016-07-27

Natural RNAs utilize extensive chemical modifications to diversify their structures and functions. 2-Thiouridine geranylation is a special hydrophobic tRNA modification that has been discovered very recently in several bacteria, such as Escherichia coli, Enterobacter aerogenes, Pseudomonas aeruginosa and Salmonella Typhimurium The geranylated residues are located in the first anticodon position of tRNAs specific for lysine, glutamine and glutamic acid. This big hydrophobic terpene functional group affects the codon recognition patterns and reduces frameshifting errors during translation. We aimed to systematically study the structure, function and biosynthesis mechanism of this geranylation pathway, as well as answer the question of why nature uses such a hydrophobic modification in hydrophilic RNA systems. Recently, we have synthesized the deoxy-analog of S-geranyluridine and showed the geranylated T-G pair is much stronger than the geranylated T-A pair and other mismatched pairs in the B-form DNA duplex context, which is consistent with the observation that the geranylated tRNA(Glu) UUC recognizes GAG more efficiently than GAA. In this manuscript we report the synthesis and base pairing specificity studies of geranylated RNA oligos. We also report extensive molecular simulation studies to explore the structural features of the geranyl group in the context of A-form RNA and its effect on codon-anticodon interaction during ribosome binding. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Structural Elements in the Gαs and Gαq C Termini That Mediate Selective G Protein-coupled Receptor (GPCR) Signaling.

PubMed

Semack, Ansley; Sandhu, Manbir; Malik, Rabia U; Vaidehi, Nagarajan; Sivaramakrishnan, Sivaraj

2016-08-19

Although the importance of the C terminus of the α subunit of the heterotrimeric G protein in G protein-coupled receptor (GPCR)-G protein pairing is well established, the structural basis of selective interactions remains unknown. Here, we combine live cell FRET-based measurements and molecular dynamics simulations of the interaction between the GPCR and a peptide derived from the C terminus of the Gα subunit (Gα peptide) to dissect the molecular mechanisms of G protein selectivity. We observe a direct link between Gα peptide binding and stabilization of the GPCR conformational ensemble. We find that cognate and non-cognate Gα peptides show deep and shallow binding, respectively, and in distinct orientations within the GPCR. Binding of the cognate Gα peptide stabilizes the agonist-bound GPCR conformational ensemble resulting in favorable binding energy and lower flexibility of the agonist-GPCR pair. We identify three hot spot residues (Gαs/Gαq-Gln-384/Leu-349, Gln-390/Glu-355, and Glu-392/Asn-357) that contribute to selective interactions between the β2-adrenergic receptor (β2-AR)-Gαs and V1A receptor (V1AR)-Gαq The Gαs and Gαq peptides adopt different orientations in β2-AR and V1AR, respectively. The β2-AR/Gαs peptide interface is dominated by electrostatic interactions, whereas the V1AR/Gαq peptide interactions are predominantly hydrophobic. Interestingly, our study reveals a role for both favorable and unfavorable interactions in G protein selection. Residue Glu-355 in Gαq prevents this peptide from interacting strongly with β2-AR. Mutagenesis to the Gαs counterpart (E355Q) imparts a cognate-like interaction. Overall, our study highlights the synergy in molecular dynamics and FRET-based approaches to dissect the structural basis of selective G protein interactions. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

The influence of arene-ring size on stacking interaction with canonical base pairs

NASA Astrophysics Data System (ADS)

Formánek, Martin; Burda, Jaroslav V.

2014-04-01

Stacking interactions between aromatic molecules (benzene, p-cymene, biphenyl, and di- and tetra-hydrogen anthracene) and G.C and A.T canonical Watson-Crick (WC) base pairs are explored. Two functionals with dispersion corrections: ω-B97XD and B3LYP-D3 are used. For a comparison also the MP2 and B3LYP-D3/PCM methods were used for the most stable p-cymene…WC geometries. It was found that the stacking interaction increases with the size of π-conjugation system. Its extent is in agreement with experimental finding on anticancer activity of Ru(II) piano-stool complexes where intercalation of these aromatic molecules should play an important role. The explored structures are considered as ternary system so that decomposition of the interaction energy to pairwise and non-additivity contributions is also examined.

Characterization of the Trans Watson-Crick GU Base Pair Located in the Catalytic Core of the Antigenomic HDV Ribozyme

PubMed Central

Lévesque, Dominique; Reymond, Cédric; Perreault, Jean-Pierre

2012-01-01

The HDV ribozyme’s folding pathway is, by far, the most complex folding pathway elucidated to date for a small ribozyme. It includes 6 different steps that have been shown to occur before the chemical cleavage. It is likely that other steps remain to be discovered. One of the most critical of these unknown steps is the formation of the trans Watson-Crick GU base pair within loop III. The U23 and G28 nucleotides that form this base pair are perfectly conserved in all natural variants of the HDV ribozyme, and therefore are considered as being part of the signature of HDV-like ribozymes. Both the formation and the transformation of this base pair have been studied mainly by crystal structure and by molecular dynamic simulations. In order to obtain physical support for the formation of this base pair in solution, a set of experiments, including direct mutagenesis, the site-specific substitution of chemical groups, kinetic studies, chemical probing and magnesium-induced cleavage, were performed with the specific goal of characterizing this trans Watson-Crick GU base pair in an antigenomic HDV ribozyme. Both U23 and G28 can be substituted for nucleotides that likely preserve some of the H-bond interactions present before and after the cleavage step. The formation of the more stable trans Watson-Crick base pair is shown to be a post-cleavage event, while a possibly weaker trans Watson-Crick/Hoogsteen interaction seems to form before the cleavage step. The formation of this unusually stable post-cleavage base pair may act as a driving force on the chemical cleavage by favouring the formation of a more stable ground state of the product-ribozyme complex. To our knowledge, this represents the first demonstration of a potential stabilising role of a post-cleavage conformational switch event in a ribozyme-catalyzed reaction. PMID:22768274

Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics

PubMed Central

Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.

2015-01-01

Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517

Analysis of canine herpesvirus gB, gC and gD expressed by a recombinant vaccinia virus.

PubMed

Xuan, X; Kojima, A; Murata, T; Mikami, T; Otsuka, H

1997-01-01

The genes encoding the canine herpesvirus (CHV) glycoprotein B (gB), gC and gD homologues have been reported already. However, products of these genes have not been identified yet. Previously, we have identified three CHV glycoproteins, gp 145/112, gp80 and gp47 using a panel of monoclonal antibodies (MAbs). To determine which CHV glycoprotein corresponds to gB, gC or gD, the putative genes of gB, gC, and gD of CHV were inserted into the thymidine kinase gene of vaccinia virus LC16mO strain under the control of the early-late promoter for the vaccinia virus 7.5-kilodalton polypeptide. We demonstrated here that gp145/112, gp80 and gp47 were the translation products of the CHV gB, gC and gD genes, respectively. The antigenic authenticity of recombinant gB, gC and gD were confirmed by a panel of MAbs specific for each glycoprotein produced in CHV-infected cells. Immunization of mice with these recombinants produced high titers of neutralizing antibodies against CHV. These results suggest that recombinant vaccinia viruses expressing CHV gB, gC and gD may be useful to develop a vaccine to control CHV infection.

Integrated G and C Implementation within IDOS: A Simulink Based Reusable Launch Vehicle Simulation

NASA Technical Reports Server (NTRS)

Fisher, Joseph E.; Bevacqua, Tim; Lawrence, Douglas A.; Zhu, J. Jim; Mahoney, Michael

2003-01-01

The implementation of multiple Integrated Guidance and Control (IG&C) algorithms per flight phase within a vehicle simulation poses a daunting task to coordinate algorithm interactions with the other G&C components and with vehicle subsystems. Currently being developed by Universal Space Lines LLC (USL) under contract from NASA, the Integrated Development and Operations System (IDOS) contains a high fidelity Simulink vehicle simulation, which provides a means to test cutting edge G&C technologies. Combining the modularity of this vehicle simulation and Simulink s built-in primitive blocks provide a quick way to implement algorithms. To add discrete-event functionality to the unfinished IDOS simulation, Vehicle Event Manager (VEM) and Integrated Vehicle Health Monitoring (IVHM) subsystems were created to provide discrete-event and pseudo-health monitoring processing capabilities. Matlab's Stateflow is used to create the IVHM and Event Manager subsystems and to implement a supervisory logic controller referred to as the Auto-commander as part of the IG&C to coordinate the control system adaptation and reconfiguration and to select the control and guidance algorithms for a given flight phase. Manual creation of the Stateflow charts for all of these subsystems is a tedious and time-consuming process. The Stateflow Auto-builder was developed as a Matlab based software tool for the automatic generation of a Stateflow chart from information contained in a database. This paper describes the IG&C, VEM and IVHM implementations in IDOS. In addition, this paper describes the Stateflow Auto-builder.

Database of non-canonical base pairs found in known RNA structures

NASA Technical Reports Server (NTRS)

Nagaswamy, U.; Voss, N.; Zhang, Z.; Fox, G. E.

2000-01-01

Atomic resolution RNA structures are being published at an increasing rate. It is common to find a modest number of non-canonical base pairs in these structures in addition to the usual Watson-Crick pairs. This database summarizes the occurrence of these rare base pairs in accordance with standard nomenclature. The database, http://prion.bchs.uh.edu/, contains information such as sequence context, sugar pucker conformation, anti / syn base conformations, chemical shift, p K (a)values, melting temperature and free energy. Of the 29 anticipated pairs with two or more hydrogen bonds, 20 have been encountered to date. In addition, four unexpected pairs with two hydrogen bonds have been reported bringing the total to 24. Single hydrogen bond versions of five of the expected geometries have been encountered among the single hydrogen bond interactions. In addition, 18 different types of base triplets have been encountered, each of which involves three to six hydrogen bonds. The vast majority of the rare base pairs are antiparallel with the bases in the anti configuration relative to the ribose. The most common are the GU wobble, the Sheared GA pair, the Reverse Hoogsteen pair and the GA imino pair.

Structural landscape of base pairs containing post-transcriptional modifications in RNA

PubMed Central

Seelam, Preethi P.; Sharma, Purshotam

2017-01-01

Base pairs involving post-transcriptionally modified nucleobases are believed to play important roles in a wide variety of functional RNAs. Here we present our attempts toward understanding the structural and functional role of naturally occurring modified base pairs using a combination of X-ray crystal structure database analysis, sequence analysis, and advanced quantum chemical methods. Our bioinformatics analysis reveals that despite their presence in all major secondary structural elements, modified base pairs are most prevalent in tRNA crystal structures and most commonly involve guanine or uridine modifications. Further, analysis of tRNA sequences reveals additional examples of modified base pairs at structurally conserved tRNA regions and highlights the conservation patterns of these base pairs in three domains of life. Comparison of structures and binding energies of modified base pairs with their unmodified counterparts, using quantum chemical methods, allowed us to classify the base modifications in terms of the nature of their electronic structure effects on base-pairing. Analysis of specific structural contexts of modified base pairs in RNA crystal structures revealed several interesting scenarios, including those at the tRNA:rRNA interface, antibiotic-binding sites on the ribosome, and the three-way junctions within tRNA. These scenarios, when analyzed in the context of available experimental data, allowed us to correlate the occurrence and strength of modified base pairs with their specific functional roles. Overall, our study highlights the structural importance of modified base pairs in RNA and points toward the need for greater appreciation of the role of modified bases and their interactions, in the context of many biological processes involving RNA. PMID:28341704

2-Thiouracil deprived of thiocarbonyl function preferentially base pairs with guanine rather than adenine in RNA and DNA duplexes

PubMed Central

Sochacka, Elzbieta; Szczepanowski, Roman H.; Cypryk, Marek; Sobczak, Milena; Janicka, Magdalena; Kraszewska, Karina; Bartos, Paulina; Chwialkowska, Anna; Nawrot, Barbara

2015-01-01

2-Thiouracil-containing nucleosides are essential modified units of natural and synthetic nucleic acids. In particular, the 5-substituted-2-thiouridines (S2Us) present in tRNA play an important role in tuning the translation process through codon–anticodon interactions. The enhanced thermodynamic stability of S2U-containing RNA duplexes and the preferred S2U-A versus S2U-G base pairing are appreciated characteristics of S2U-modified molecular probes. Recently, we have demonstrated that 2-thiouridine (alone or within an RNA chain) is predominantly transformed under oxidative stress conditions to 4-pyrimidinone riboside (H2U) and not to uridine. Due to the important biological functions and various biotechnological applications for sulfur-containing nucleic acids, we compared the thermodynamic stabilities of duplexes containing desulfured products with those of 2-thiouracil-modified RNA and DNA duplexes. Differential scanning calorimetry experiments and theoretical calculations demonstrate that upon 2-thiouracil desulfuration to 4-pyrimidinone, the preferred base pairing of S2U with adenosine is lost, with preferred base pairing with guanosine observed instead. Therefore, biological processes and in vitro assays in which oxidative desulfuration of 2-thiouracil-containing components occurs may be altered. Moreover, we propose that the H2U-G base pair is a suitable model for investigation of the preferred recognition of 3′-G-ending versus A-ending codons by tRNA wobble nucleosides, which may adopt a 4-pyrimidinone-type structural motif. PMID:25690900

Visible light photoelectrochemical aptasensor for adenosine detection based on CdS/PPy/g-C3N4 nanocomposites.

PubMed

Liu, Yixin; Ma, Hongmin; Zhang, Yong; Pang, Xuehui; Fan, Dawei; Wu, Dan; Wei, Qin

2016-12-15

In this work, a label-free photoelectrochemical (PEC) aptasensor was developed for adenosine detection based on CdS/PPy/g-C3N4 nanocomposites. The CdS/g-C3N4 heterojunction effectively prevented the photogenerated charges recombination of g-C3N4 and self-photocorrosion processes of CdS, improving photo-to-current conversion efficiency. The introduced polypyrrole (PPy) nanoparticles could lead to a more effective separation of photogenerated charges, thus resulting in a further increasing of photocurrent. The CdS/PPy/g-C3N4 was firstly employed as the photoactive materials for fabrication of aptasensor, and SH-aptamer was then adsorbed on the CdS/PPy/g-C3N4 modified electrodes through S-Cd bond. With increasing of adenosine concentration, the photocurrent decreased as the formation of SH-aptamer-adenosine bioaffinity complexes. Under optimal conditions, the PEC aptasensor had a sensitive response to adenosine in a linear range of 0.3nmolL(-1) to 200nmolL(-1) with a detection limit of 0.1nmolL(-1). Besides, the as-proposed aptasensor has also been applied in human serum samples analysis. The aptasensor exhibits high sensitivity and good stability, thus opening up a new promising PEC platform for some other small molecules analysis. Copyright © 2016 Elsevier B.V. All rights reserved.

Spectroscopic studies of the binding of Cu(II) complexes of oxicam NSAIDs to alternating G-C and homopolymeric G-C sequences

NASA Astrophysics Data System (ADS)

Chakraborty, Sreeja; Bose, Madhuparna; Sarkar, Munna

2014-03-01

Drugs belonging to the Non-steroidal anti-inflammatory (NSAID) group are not only used as anti-inflammatory, analgesic and anti-pyretic agents, but also show anti-cancer effects. Complexing them with a bioactive metal like copper, show an enhancement in their anti-cancer effects compared to the bare drugs, whose exact mechanism of action is not yet fully understood. For the first time, it was shown by our group that Cu(II)-NSAIDs can directly bind to the DNA backbone. The ability of the copper complexes of NSAIDs namely meloxicam and piroxicam to bind to the DNA backbone could be a possible molecular mechanism behind their enhanced anticancer effects. Elucidating base sequence specific interaction of Cu(II)-NSAIDs to the DNA will provide information on their possible binding sites in the genome sequence. In this work, we present how these complexes respond to differences in structure and hydration pattern of GC rich sequences. For this, binding studies of Cu(II) complexes of piroxicam [Cu(II)-(Px)2 (L)2] and meloxicam [Cu(II)-(Mx)2 (L)] with alternating GC (polydG-dC) and homopolymeric GC (polydG-polydC) sequences were carried out using a combination of spectroscopic techniques that include UV-Vis absorption, fluorescence and circular dichroism (CD) spectroscopy. The Cu(II)-NSAIDs show strong binding affinity to both polydG-dC and polydG-polydC. The role reversal of Cu(II)-meloxicam from a strong binder of polydG-dC (Kb = 11.5 × 103 M-1) to a weak binder of polydG-polydC (Kb = 5.02 × 103 M-1), while Cu(II)-piroxicam changes from a strong binder of polydG-polydC (Kb = 8.18 × 103 M-1) to a weak one of polydG-dC (Kb = 2.18 × 103 M-1), point to the sensitivity of these complexes to changes in the backbone structures/hydration. Changes in the profiles of UV absorption band and CD difference spectra, upon complex binding to polynucleotides and the results of competitive binding assay using ethidium bromide (EtBr) fluorescence indicate different binding modes in each

Possible association of 3' UTR +357 A>G, IVS11-nt 93 T>C, c.1311 C>T polymorphism with G6PD deficiency.

PubMed

Sirdah, Mahmoud M; Shubair, Mohammad E; Al-Kahlout, Mustafa S; Al-Tayeb, Jamal M; Prchal, Josef T; Reading, N Scott

2017-07-01

Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a common X-linked inherited enzymopathic disorder affecting more than 500 million people worldwide. It has so far been linked to 217 distinct genetic variants in the exons and exon-intron boundaries of the G6PD gene, giving rise to a wide range of biochemical heterogeneity and clinical manifestations. Reports from different settings suggested the association of intronic and other mutations outside the reading frame of the G6PD gene with reduced enzyme activity and presenting clinical symptoms. The present study aimed to investigate any association of other variations apart of the exonic or exonic intronic boundaries in the development of G6PD deficiency. Sixty-seven unrelated Palestinian children admitted to the pediatric hospital with hemolytic crises due to G6PD deficiency were studied. In our Palestinian cohort of 67 [59 males (M) and 8 females (F)] G6PD-deficient children, previously hospitalized for acute hemolytic anemia due to favism, molecular sequencing of the G6PD gene revealed four cases (3M and 1F) that did not have any of the variants known to cause G6PD deficiency, but the 3' UTR c.*+357A>G (rs1050757) polymorphism in association with IVS 11 (c.1365-13T>C; rs2071429), and c.1311C>T (rs2230037). We now provide an additional evidence form Palestinian G6PD-deficient subjects for a possible role of 3' UTR c.*+357 A>G, c.1365-13T>C, and/or c.1311C>T polymorphism for G6PD deficiency, suggesting that not only a single variation in the exonic or exonic intronic boundaries, but also a haplotype of G6PD should considered as a cause for G6PD deficiency.

Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant.

PubMed

Xia, Shuangluo; Konigsberg, William H

2014-04-01

Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.

Enhanced visible light photocatalytic water reduction from a g-C 3N 4/SrTa 2O 6 heterojunction

DOE PAGES

Adhikari, Shiba P.; Hood, Zachary D.; Wang, Hui; ...

2017-06-02

In this paper, a new g-C 3N 4/SrTa 2O 6 heterojunction photocatalyst was designed and prepared by chimie douce (soft chemistry) method where carbon nitride (g-C 3N 4) was deposited over the metastable perovskite phase of SrTa 2O 6. The morphological study of the heterojunction using SEM and STEM revealed that g-C 3N 4 nanofibers are dispersed uniformly on the surface of SrTa 2O 6 plates leading to the intimate contact between them. The heterojunction could achieve a high and stable visible light photocatalytic H 2 generation of 137 mmol/h/mole of g-C 3N 4, which is much larger than themore » amount of hydrogen generated by one mole of pristine g-C 3N 4. Finally, a plausible mechanism for the observed enhanced photocatalytic activity for the heterojunction is proposed on the basis of effective charge separation of photogenerated electron-hole pairs, supported by band position calculations and photo-physical properties of g-C 3N 4 and SrTa 2O 6.« less

Enhanced visible light photocatalytic water reduction from a g-C 3N 4/SrTa 2O 6 heterojunction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Adhikari, Shiba P.; Hood, Zachary D.; Wang, Hui

In this paper, a new g-C 3N 4/SrTa 2O 6 heterojunction photocatalyst was designed and prepared by chimie douce (soft chemistry) method where carbon nitride (g-C 3N 4) was deposited over the metastable perovskite phase of SrTa 2O 6. The morphological study of the heterojunction using SEM and STEM revealed that g-C 3N 4 nanofibers are dispersed uniformly on the surface of SrTa 2O 6 plates leading to the intimate contact between them. The heterojunction could achieve a high and stable visible light photocatalytic H 2 generation of 137 mmol/h/mole of g-C 3N 4, which is much larger than themore » amount of hydrogen generated by one mole of pristine g-C 3N 4. Finally, a plausible mechanism for the observed enhanced photocatalytic activity for the heterojunction is proposed on the basis of effective charge separation of photogenerated electron-hole pairs, supported by band position calculations and photo-physical properties of g-C 3N 4 and SrTa 2O 6.« less

The electrostatic characteristics of G·U wobble base pairs

PubMed Central

Xu, Darui; Landon, Theresa; Greenbaum, Nancy L.; Fenley, Marcia O.

2007-01-01

G·U wobble base pairs are the most common and highly conserved non-Watson–Crick base pairs in RNA. Previous surface maps imply uniformly negative electrostatic potential at the major groove of G·U wobble base pairs embedded in RNA helices, suitable for entrapment of cationic ligands. In this work, we have used a Poisson–Boltzmann approach to gain a more detailed and accurate characterization of the electrostatic profile. We found that the major groove edge of an isolated G·U wobble displays distinctly enhanced negativity compared with standard GC or AU base pairs; however, in the context of different helical motifs, the electrostatic pattern varies. G·U wobbles with distinct widening have similar major groove electrostatic potentials to their canonical counterparts, whereas those with minimal widening exhibit significantly enhanced electronegativity, ranging from 0.8 to 2.5 kT/e, depending upon structural features. We propose that the negativity at the major groove of G·U wobble base pairs is determined by the combined effect of the base atoms and the sugar-phosphate backbone, which is impacted by stacking pattern and groove width as a result of base sequence. These findings are significant in that they provide predictive power with respect to which G·U sites in RNA are most likely to bind cationic ligands. PMID:17526525

Control of box C/D snoRNP assembly by N6-methylation of adenine.

PubMed

Huang, Lin; Ashraf, Saira; Wang, Jia; Lilley, David Mj

2017-09-01

N 6 -methyladenine is the most widespread mRNA modification. A subset of human box C/D snoRNA species have target GAC sequences that lead to formation of N 6 -methyladenine at a key trans Hoogsteen-sugar A·G base pair, of which half are methylated in vivo The GAC target is conserved only in those that are methylated. Methylation prevents binding of the 15.5-kDa protein and the induced folding of the RNA Thus, the assembly of the box C/D snoRNP could in principle be regulated by RNA methylation at its critical first stage. Crystallography reveals that N 6 -methylation of adenine prevents the formation of trans Hoogsteen-sugar A·G base pairs, explaining why the box C/D RNA cannot adopt its kinked conformation. More generally, our data indicate that sheared A·G base pairs (but not Watson-Crick base pairs) are more susceptible to disruption by N 6 mA methylation and are therefore possible regulatory sites. The human signal recognition particle RNA and many related Alu retrotransposon RNA species are also methylated at N6 of an adenine that forms a sheared base pair with guanine and mediates a key tertiary interaction. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.

Envisaging quantum transport phenomenon in a muddled base pair of DNA

NASA Astrophysics Data System (ADS)

Vohra, Rajan; Sawhney, Ravinder Singh

2018-05-01

The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.

Structural and genetic relationships of closely related O-antigens of Cronobacter spp. and Escherichia coli: C. sakazakii G2594 (serotype O4)/E. coli O103 and C. malonaticus G3864 (serotype O1)/E. coli O29.

PubMed

Shashkov, Alexander S; Wang, Min; Turdymuratov, Eldar M; Hu, Shaohui; Arbatsky, Nikolay P; Guo, Xi; Wang, Lei; Knirel, Yuriy A

2015-03-02

O-Antigen (O-polysaccharide) variation is the basis for bacterial serotyping and is important in bacterial virulence and niche adaptation. In this work, we present structural and genetic evidences for close relationships between the O-antigens of the Cronobacter spp. and Escherichia coli. Cronobacter sakazakii G2594 (serotype O4) and Cronobacter malonaticus G3864 (serotype O1) are structurally related to those of E. coli O103 and O29, respectively, and some other members of the Enterobacteriaceae family differing in the patterns of lateral glucosylation (C. sakazakii G2594) or O-acetylation (C. malonaticus G3864). The O-antigen gene clusters of the corresponding Cronobacter and E. coli strains contain the same genes with high-level similarity, and the structural differences within both O-antigen pairs were suggested to be due to modification genes carried by prophages. Copyright © 2014 Elsevier Ltd. All rights reserved.

Potent and Selective Covalent Quinazoline Inhibitors of KRAS G12C

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zeng, Mei; Lu, Jia; Li, Lianbo

Targeted covalent small molecules have shown promise for cancers driven by KRAS G12C. Allosteric compounds that access an inducible pocket formed by movement of a dynamic structural element in KRAS, switch II, have been reported, but these compounds require further optimization to enable their advancement into clinical development. We demonstrate that covalent quinazoline-based switch II pocket (SIIP) compounds effectively suppress GTP loading of KRAS G12C, MAPK phosphorylation, and the growth of cancer cells harboring G12C. Notably we find that adding an amide substituent to the quinazoline scaffold allows additional interactions with KRAS G12C, and remarkably increases the labeling efficiency, potency,more » and selectivity of KRAS G12C inhibitors. Structural studies using X-ray crystallography reveal a new conformation of SIIP and key interactions made by substituents located at the quinazoline 2-, 4-, and 7-positions. Optimized lead compounds in the quinazoline series selectively inhibit KRAS G12C-dependent signaling and cancer cell growth at sub-micromolar concentrations.« less

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

PubMed

Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

2017-10-01

Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

N-H Stretching Excitations in Adenosine-Thymidine Base Pairs in Solution: Base Pair Geometries, Infrared Line Shapes and Ultrafast Vibrational Dynamics

PubMed Central

Greve, Christian; Preketes, Nicholas K.; Fidder, Henk; Costard, Rene; Koeppe, Benjamin; Heisler, Ismael A.; Mukamel, Shaul; Temps, Friedrich; Nibbering, Erik T. J.; Elsaesser, Thomas

2013-01-01

We explore the N-H stretching vibrations of adenosine-thymidine base pairs in chloroform solution with linear and nonlinear infrared spectroscopy. Based on estimates from NMR measurements and ab initio calculations, we conclude that adenosine and thymidine form hydrogen bonded base pairs in Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen configurations with similar probability. Steady-state concentration- and temperature dependent linear FT-IR studies, including H/D exchange experiments, reveal that these hydrogen-bonded base pairs have complex N-H/N-D stretching spectra with a multitude of spectral components. Nonlinear 2D-IR spectroscopic results, together with IR-pump-IR-probe measurements, as also corroborated by ab initio calculations, reveal that the number of N-H stretching transitions is larger than the total number of N-H stretching modes. This is explained by couplings to other modes, such as an underdamped low-frequency hydrogen-bond mode, and a Fermi resonance with NH2 bending overtone levels of the adenosine amino-group. Our results demonstrate that modeling based on local N-H stretching vibrations only is not sufficient and call for further refinement of the description of the N-H stretching manifolds of nucleic acid base pairs of adenosine and thymidine, incorporating a multitude of couplings with fingerprint and low-frequency modes. PMID:23234439

Cooperative Lewis pairs based on late transition metals: activation of small molecules by platinum(0) and B(C6 F5 )3.

PubMed

Forrest, Sebastian J K; Clifton, Jamie; Fey, Natalie; Pringle, Paul G; Sparkes, Hazel A; Wass, Duncan F

2015-02-09

A Lewis basic platinum(0)-CO complex supported by a diphosphine ligand and B(C6 F5 )3 act cooperatively, in a manner reminiscent of a frustrated Lewis pair, to activate small molecules such as hydrogen, CO2 , and ethene. This cooperative Lewis pair facilitates the coupling of CO and ethene in a new way. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Carnitine-acylcarnitine translocase deficiency with c.199-10 T>G and novel c.1A>G mutation

PubMed Central

Yan, Hui-ming; Hu, Hao; Ahmed, Aisha; Feng, Bing-bing; Liu, Jing; Jia, Zheng-jun; Wang, Hua

2017-01-01

Abstract Rationale: Carnitine-acylcarnitine translocate deficiency (CACTD) is a rare and life-threatening, autosomal recessive disorder of fatty acid β-oxidation characterized by hypoketotic hypoglycemia, hyperammonemia, cardiomyopathy, liver dysfunction, and muscle weakness; culminating in early death. To date, CACTD cases screened from the Chinese mainland population, especially patient with compound heterozygote with c.199-10T>G and a novel c.1A>G mutation in the SLC25A20 gene has never been described. Patient concerns: Herein, we report 2 neonatal cases of CACTD identified from the mainland China. These 2 patients were presented with severe metabolic crisis and their clinical conditions deteriorate rapidly and both died of cardiorespiratory collapse in the first week of life. We present the clinical and biochemical features of 2 probands and a brief literature review of previously reported CACTD cases with the c.199-10T>G mutation. Diagnoses: The acylcarnitine profiles by tandem-mass-spectrometry and the mutation analysis of SLC25A20 gene confirmed the diagnosis of CACTD in both patients. Mutation analysis demonstrated that patient No. 1 was homozygous for c.199-10T>G mutation, while patient No. 2 was a compound heterozygote for 2 mutations, a maternally-inherited c.199-10T>G and a paternally-inherited, novel c.1A>G mutation. Interventions: Both patients were treated with an aggressive treatment regimen include high glucose and arginine infusion, respiratory, and circulatory support. Outcomes: The first proband died 3 days after delivery due to sudden cardiac arrest. The second patient's clinical condition, at one time, was improved by high glucose infusion, intravenous arginine, and circulatory support. However, the patient failed to wean from mechanical ventilation. Unfortunately, her parents refused further treatment due to fear of financial burdens. The patient died of congestive heart failure in the 6th day of life. Lessons: We report the first 2 cases of

Bifacial Base-Pairing Behaviors of 5-Hydroxyuracil DNA Bases through Hydrogen Bonding and Metal Coordination.

PubMed

Takezawa, Yusuke; Nishiyama, Kotaro; Mashima, Tsukasa; Katahira, Masato; Shionoya, Mitsuhiko

2015-10-12

A novel bifacial ligand-bearing nucleobase, 5-hydroxyuracil (U(OH) ), which forms both a hydrogen-bonded base pair (U(OH) -A) and a metal-mediated base pair (U(OH) -M-U(OH) ) has been developed. The U(OH) -M-U(OH) base pairs were quantitatively formed in the presence of lanthanide ions such as Gd(III) when U(OH) -U(OH) pairs were consecutively incorporated into DNA duplexes. This result established metal-assisted duplex stabilization as well as DNA-templated assembly of lanthanide ions. Notably, a duplex possessing U(OH) -A base pairs was destabilized by addition of Gd(III) ions. This observation suggests that the hybridization behaviors of the U(OH) -containing DNA strands are altered by metal complexation. Thus, the U(OH) nucleobase with a bifacial base-pairing property holds great promise as a component for metal-responsive DNA materials. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs

NASA Technical Reports Server (NTRS)

Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.

2011-01-01

We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.

Neonatal Hyperbilirubinemia in infants with G6PD c.563C > TVariant

PubMed Central

2012-01-01

Background There is a strong correlation between glucose-6-phosphate dehydrogenase (G6PD) deficiency and neonatal hyperbilirubinemia with a rare but potential threat of devastating acute bilirubin encephalopathy. G6PD deficiency was observed in 4–14% of hospitalized icteric neonates in Pakistan. G6PD c.563C > T is the most frequently reported variant in this population. The present study was aimed at evaluating the time to onset of hyperbilirubinemia and the postnatal bilirubin trajectory in infants having G6PD c.563C > T. Methods This was a case–control study conducted at The Aga Khan University, Pakistan during the year 2008. We studied 216 icteric male neonates who were re-admitted for phototherapy during the study period. No selection was exercised. Medical records showed that 32 were G6PD deficient while 184 were G6PD normal. Each infant was studied for birth weight, gestational age, age at the time of presentation, presence of cephalhematoma, sepsis and neurological signs, peak bilirubin level, age at peak bilirubin level, days of hospitalization, whether phototherapy or exchange blood transfusion was initiated, and the outcome. During hospital stay, each baby was tested for complete blood count, reticulocyte count, ABO and Rh blood type, direct antiglobulin test and quantitative G6PD estimation [by kinetic determination of G6PDH]. G6PDgenotype was analyzed in 32 deficient infants through PCR-RFLP analysis and gene sequencing. Results G6PD variants c.563C > T and c.131 C > G were observed in 21 (65%) and three (9%) of the 32 G6PD deficient infants, respectively. DNA of eight (25%) newborns remained uncharacterized. In contrast to G6PD normal neonates, infants with c.563C > T variant had significantly lower enzyme activity (mean ± 1SD; 0.3 ± 0.2 U/gHb vs. 14.0 ± 4.5 U/gHb, p < 0.001) experienced higher peak levels of total serum bilirubin (mean ± 1SD; 16.8 ± 5.4 mg/dl vs. 13.8 ± 4.6 mg/dl, p = 0.008) which peaked earlier after

Mucin-like Region of Herpes Simplex Virus Type 1 Attachment Protein Glycoprotein C (gC) Modulates the Virus-Glycosaminoglycan Interaction*

PubMed Central

Altgärde, Noomi; Eriksson, Charlotta; Peerboom, Nadia; Phan-Xuan, Tuan; Moeller, Stephanie; Schnabelrauch, Matthias; Svedhem, Sofia; Trybala, Edward; Bergström, Tomas; Bally, Marta

2015-01-01

Glycoprotein C (gC) mediates the attachment of HSV-1 to susceptible host cells by interacting with glycosaminoglycans (GAGs) on the cell surface. gC contains a mucin-like region located near the GAG-binding site, which may affect the binding activity. Here, we address this issue by studying a HSV-1 mutant lacking the mucin-like domain in gC and the corresponding purified mutant protein (gCΔmuc) in cell culture and GAG-binding assays, respectively. The mutant virus exhibited two functional alterations as compared with native HSV-1 (i.e. decreased sensitivity to GAG-based inhibitors of virus attachment to cells and reduced release of viral particles from the surface of infected cells). Kinetic and equilibrium binding characteristics of purified gC were assessed using surface plasmon resonance-based sensing together with a surface platform consisting of end-on immobilized GAGs. Both native gC and gCΔmuc bound via the expected binding region to chondroitin sulfate and sulfated hyaluronan but not to the non-sulfated hyaluronan, confirming binding specificity. In contrast to native gC, gCΔmuc exhibited a decreased affinity for GAGs and a slower dissociation, indicating that once formed, the gCΔmuc-GAG complex is more stable. It was also found that a larger number of gCΔmuc bound to a single GAG chain, compared with native gC. Taken together, our data suggest that the mucin-like region of HSV-1 gC is involved in the modulation of the GAG-binding activity, a feature of importance both for unrestricted virus entry into the cells and release of newly produced viral particles from infected cells. PMID:26160171

Understanding the kinetic mechanism of RNA single base pair formation

PubMed Central

Xu, Xiaojun; Yu, Tao; Chen, Shi-Jie

2016-01-01

RNA functions are intrinsically tied to folding kinetics. The most elementary step in RNA folding is the closing and opening of a base pair. Understanding this elementary rate process is the basis for RNA folding kinetics studies. Previous studies mostly focused on the unfolding of base pairs. Here, based on a hybrid approach, we investigate the folding process at level of single base pairing/stacking. The study, which integrates molecular dynamics simulation, kinetic Monte Carlo simulation, and master equation methods, uncovers two alternative dominant pathways: Starting from the unfolded state, the nucleotide backbone first folds to the native conformation, followed by subsequent adjustment of the base conformation. During the base conformational rearrangement, the backbone either retains the native conformation or switches to nonnative conformations in order to lower the kinetic barrier for base rearrangement. The method enables quantification of kinetic partitioning among the different pathways. Moreover, the simulation reveals several intriguing ion binding/dissociation signatures for the conformational changes. Our approach may be useful for developing a base pair opening/closing rate model. PMID:26699466

Efficient water disinfection with Ag2WO4-doped mesoporous g-C3N4 under visible light.

PubMed

Li, Yi; Li, Yanan; Ma, Shuanglong; Wang, Pengfei; Hou, Qianlei; Han, Jingjing; Zhan, Sihui

2017-09-15

Ag 2 WO 4 /g-C 3 N 4 composite photocatalyst was synthesized by polymerization of thiourea and ammonia chloride combined with the deposition-precipitation method, which was applied as an efficient visible-light driven photocatalyst for inactivating Escherichia coli (E. coli). The physicochemical properties of these photocatalysts were systematically characterized by various techniques such as SEM, TEM, XRD, FT-IR, BET, UV-vis DRS and PL. The synthesized photocatalysts exhibited outstandingly enhanced photocatalytic disinfection efficiency compared with that of pure g-C 3 N 4 and Ag 2 WO 4 under visible light. Furthermore, the optimal mass ratio of the Ag 2 WO 4 to g-C 3 N 4 was 5wt%, and a number of live bacteria could be completely inactivated with Ag 2 WO 4 (5%)/g-C 3 N 4 (100μg/mL) after 90min under visible light irradiation. The high disinfection efficiency is due to the synergetic effect between g-C 3 N 4 and Ag 2 WO 4 , including a good distribution of Ag 2 WO 4 particles on the surface of g-C 3 N 4 and an improved separation rate of photogenerated electron-hole pairs. The enhanced disinfection mechanism was also investigated using photogenerated current densities and electrochemical impedance spectroscopy (EIS). Considering the bulk availability and excellent disinfection activity of Ag 2 WO 4 /g-C 3 N 4 composite, it is a promising solar-driven photocatalyst for cleaning the microbial contaminated water. Copyright © 2017 Elsevier B.V. All rights reserved.

Mitomycin C binding to poly[d(G-m5C)].

PubMed Central

Portugal, J; Sánchez-Baeza, F J

1995-01-01

Poly[d(G-m5C)] was modified by reductively activated mitomycin C, an anti-tumour drug, under buffer conditions which are known to favour either the B or the Z conformations of DNA. C.d. and 31P-n.m.r. were used to characterize the poly[d(G-m5C)]-mitomycin cross-linked complexes, as well as the effects on the equilibrium between the B and Z forms of the polynucleotide. Mitomycin C appears to inhibit the B-->Z transition, even in the presence of 3 mM MgCl2, while the Z-form of poly[d(G-m5C)] does not interact significantly with the drug under bifunctionally activating conditions; thus no reversion from the Z-form to the B-form of the polynucleotide can be observed under the salt conditions which are required for the Z-form to exist. PMID:7864808

C-1311 (Symadex), a potential anti-cancer drug, intercalates into DNA between A and G moieties. NMR-derived and MD-refined stereostructure of the d(GAGGCCTC)2:C-1311 complex

NASA Astrophysics Data System (ADS)

Laskowski, Tomasz; Borzyszkowska, Julia; Grynda, Jakub; Mazerski, Jan

2017-08-01

Imidazoacridinone C-1311 (Symadex®) is an antitumor agent which has been recommended for Phase II clinical trials a few years ago. Previously, it was shown experimentally that during the initial stage of its action C-1311 forms stable intercalation complexes with DNA duplexes. Herein, a NMR-derived stereostructure of d(GAGGCCTC)2:C-1311 complex was reported. The ligand was found locating itself between A and G moieties, forming symmetrical DNA:drug 1:2 mol/mol complex. Intercalation site was located upon the DNA-ligand proton/proton dipolar couplings observed in the NOESY spectrum and the performed MD simulations. NMR-derived stereostructure was hence refined by restrained MD using distance restraints obtained from the NOESY data and the result was compared with MD-derived structure of the proposed complex, obtained from the calculations performed with distance restraints applied only for hydrogen bonds in the terminal GC base pairs. The results of both simulations were coherent. Basing on the observed C-1311's intercalation sites and on our previous results concerning the d(CGATCG)2:C-1311 complex, we stated that AG/GA sequences are the preferred binding sites of imidazoacridinone C-1311.

76 FR 6629 - Agency Information Collection Activities: Forms G-325, G-325A, G-325B, and G-325C; Extension of...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-02-07

... Collection Activities: Forms G-325, G-325A, G- 325B, and G-325C; Extension of an Existing Information Collection; Comment Request ACTION: 60-Day Notice of Information Collection Under Review; Forms 325, G-325A, G-325B, and G-325C, Biographic Information; OMB Control No. 1615-0008. The Department of Homeland...

Determination of the pairing-strength constants in the isovector plus isoscalar pairing case

NASA Astrophysics Data System (ADS)

Mokhtari, D.; Fellah, M.; Allal, N. H.

2016-05-01

A method for the determination of the pairing-strength constants, in the neutron-proton (n-p) isovector plus isoscalar pairing case, is proposed in the framework of the BCS theory. It is based on the fitting of these constants to reproduce the experimentally known pairing gap parameters as well as the root-mean-squared (r.m.s) charge radii values. The method is applied to some proton-rich even-even nuclei. The single-particle energies used are those of a deformed Woods-Saxon mean field. It is shown that the obtained value of the ratio GnpT=0/G npT=1 is of the same order as the ones, arbitrary chosen, of some previous works. The effect of the inclusion of the isoscalar n-p pairing in the r.m.s matter radii is then numerically studied for the same nuclei.

Identification of a novel PMS2 alteration c.505C>G (R169G) in trans with a PMS2 pathogenic mutation in a patient with constitutional mismatch repair deficiency.

PubMed

Mork, Maureen E; Borras, Ester; Taggart, Melissa W; Cuddy, Amanda; Bannon, Sarah A; You, Y Nancy; Lynch, Patrick M; Ramirez, Pedro T; Rodriguez-Bigas, Miguel A; Vilar, Eduardo

2016-10-01

Constitutional mismatch repair deficiency syndrome (CMMRD) is a rare autosomal recessive predisposition to colorectal polyposis and other malignancies, often childhood-onset, that is caused by biallelic inheritance of mutations in the same mismatch repair gene. Here, we describe a patient with a clinical diagnosis of CMMRD based on colorectal polyposis and young-onset endometrial cancer who was identified to have two alterations in trans in PMS2: one known pathogenic mutation (c.1831insA; p.Ile611Asnfs*2) and one novel variant of uncertain significance (c.505C>G; p.Arg169Glu), a missense alteration. We describe the clinical and molecular features in the patient harboring this novel alteration c.505C>G, who meets clinical criteria for CMMRD and exhibits molecular evidence supporting a diagnosis of CMMRD. Although experimental validation is needed to confirm its pathogenicity, PMS2 c.505C>G likely has functional consequences that contributes to our patient's phenotype based on the patient's clinical presentation, tumor studies, and bioinformatics analysis.

N-H stretching vibrations of guanosine-cytidine base pairs in solution: ultrafast dynamics, couplings, and line shapes.

PubMed

Fidder, Henk; Yang, Ming; Nibbering, Erik T J; Elsaesser, Thomas; Röttger, Katharina; Temps, Friedrich

2013-02-07

Dynamics and couplings of N-H stretching vibrations of chemically modified guanosine-cytidine (G·C) base pairs in chloroform are investigated with linear infrared spectroscopy and ultrafast two-dimensional infrared (2D-IR) spectroscopy. Comparison of G·C absorption spectra before and after H/D exchange reveals significant N-H stretching absorption in the region from 2500 up to 3300 cm(-1). Both of the local stretching modes ν(C)(NH(2))(b) of the hydrogen-bonded N-H moiety of the cytidine NH(2) group and ν(G)(NH) of the guanosine N-H group contribute to this broad absorption band. Its complex line shape is attributed to Fermi resonances of the N-H stretching modes with combination and overtones of fingerprint vibrations and anharmonic couplings to low-frequency modes. Cross-peaks in the nonlinear 2D spectra between the 3491 cm(-1) free N-H oscillator band and the bands centered at 3145 and 3303 cm(-1) imply N-H···O═C hydrogen bond character for both of these transitions. Time evolution illustrates that the 3303 cm(-1) band is composed of a nearly homogeneous band absorbing at 3301 cm(-1), ascribed to ν(G)(NH(2))(b), and a broad inhomogeneous band peaking at 3380 cm(-1) with mainly guanosine carbonyl overtone character. Kinetics and signal strengths indicate a <0.2 ps virtually complete population transfer from the excited ν(G)(NH(2))(b) mode to the ν(G)(NH) mode at 3145 cm(-1), suggesting lifetime broadening as the dominant source for the homogeneous line shape of the 3301 cm(-1) transition. For the 3145 cm(-1) band, a 0.3 ps population lifetime was obtained.

A single base pair in the right terminal domain of tomato planta macho viroid is a virulence determinant factor on tomato.

PubMed

Li, Rugang; Padmanabhan, Chellappan; Ling, Kai-Shu

2017-01-01

Tomato planta macho viroid (TPMVd), including isolates previously designated as Mexican papita viroid (MPVd), causes serious disease on tomatoes in North America. Two predominant variants, sharing 93.8% sequence identity, incited distinct severe (MPVd-S) or mild (MPVd-M) symptoms on tomato. To identify virulence determinant factor, a series of chimeric infectious clones were generated using synthetic DNA approach to progressively replace each structural domain between the two variants. In bioassays on tomato 'Rutgers', three chimeras containing Terminal Left and Pathogenicity (MPVd-H1), Central (MPVd-H2), or Variable (MPVd-H3) of MPVd-S, incited mild to intermediate symptoms. However, a chimera containing Terminal Right (T R ) of MPVd-S (MPVd-H4) incited severe symptoms. Only one base-pair mutation in the T R domain between MPVd-M ( 176 U:A 185 ) and MPVd-S ( 174 G:C 183 ) was identified. A reciprocal mutant (MPVd-H5) rendered the chimeric viroid mild on tomato. This single base-pair in the T R domain was determined as the virulence determinant factor for TPMVd. Published by Elsevier Inc.

2-Methoxypyridine as a Thymidine Mimic in Watson-Crick Base Pairs of DNA and PNA: Synthesis, Thermal Stability, and NMR Structural Studies.

PubMed

Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks

2017-11-02

The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Orbital selective pairing and gap structures of iron-based superconductors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kreisel, Andreas; Andersen, Brian M.; Sprau, P. O.

We discuss the in uence on spin-fluctuation pairing theory of orbital selective strong correlation effects in Fe-based superconductors, particularly Fe chalcogenide systems. We propose that a key ingredient for an improved itinerant pairing theory is orbital selectivity, i.e., incorporating the reduced coherence of quasiparticles occupying specific orbital states. This modifies the usual spin-fluctuation via suppression of pair scattering processes involving those less coherent states and results in orbital selective Cooper pairing of electrons in the remaining states. We show that this paradigm yields remarkably good agreement with the experimentally observed anisotropic gap structures in both bulk and monolayer FeSe, asmore » well as LiFeAs, indicating that orbital selective Cooper pairing plays a key role in the more strongly correlated iron-based superconductors.« less

Orbital selective pairing and gap structures of iron-based superconductors

DOE PAGES

Kreisel, Andreas; Andersen, Brian M.; Sprau, P. O.; ...

2017-05-08

We discuss the in uence on spin-fluctuation pairing theory of orbital selective strong correlation effects in Fe-based superconductors, particularly Fe chalcogenide systems. We propose that a key ingredient for an improved itinerant pairing theory is orbital selectivity, i.e., incorporating the reduced coherence of quasiparticles occupying specific orbital states. This modifies the usual spin-fluctuation via suppression of pair scattering processes involving those less coherent states and results in orbital selective Cooper pairing of electrons in the remaining states. We show that this paradigm yields remarkably good agreement with the experimentally observed anisotropic gap structures in both bulk and monolayer FeSe, asmore » well as LiFeAs, indicating that orbital selective Cooper pairing plays a key role in the more strongly correlated iron-based superconductors.« less

In silico identification of novel ligands for G-quadruplex in the c- MYC promoter

NASA Astrophysics Data System (ADS)

Kang, Hyun-Jin; Park, Hyun-Ju

2015-04-01

G-quadruplex DNA formed in NHEIII1 region of oncogene promoter inhibits transcription of the genes. In this study, virtual screening combining pharmacophore-based search and structure-based docking screening was conducted to discover ligands binding to G-quadruplex in promoter region of c- MYC. Several hit ligands showed the selective PCR-arresting effects for oligonucleotide containing c- MYC G-quadruplex forming sequence. Among them, three hits selectively inhibited cell proliferation and decreased c- MYC mRNA level in Ramos cells, where NHEIII1 is included in translocated c- MYC gene for overexpression. Promoter assay using two kinds of constructs with wild-type and mutant sequences showed that interaction of these ligands with the G-quadruplex resulted in turning-off of the reporter gene. In conclusion, combined virtual screening methods were successfully used for discovery of selective c- MYC promoter G-quadruplex binders with anticancer activity.

Development of a novel device to trap heavy metal cations: application of the specific interaction between heavy metal cation and mismatch DNA base pair.

PubMed

Torigoe, Hidetaka; Miyakawa, Yukako; Fukushi, Miyako; Ono, Akira; Kozasa, Tetsuo

2009-01-01

We have already found that Hg(II) cation specifically binds to T:T mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving T:T mismatch base pair by about 4 degrees C. We have also found that Ag(I) cation specifically binds to C:C mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving C:C mismatch base pair by about 4 degrees C. Using the specific interaction, we developed a novel device to trap each of Hg(II) and Ag(I) cation. The device is composed of 5'-biotinylated T-rich or C-rich DNA oligonucleotides, BIO-T20: 5'-Bio-T(20)-3' or BIO-C20: 5'-Bio-C(20)-3' (Bio is a biotin), immobilized on streptavidin-coated polystylene beads. When the BIO-T20-immobilized beads were added to a solution containing Hg(II) cation, and the beads trapping Hg(II) cation were collected by centrifugation, almost all of Hg(II) cation were removed from the solution. Also, when the BIO-C20-immobilized beads were added to a solution containing Ag(I) cation, and the beads trapping Ag(I) cation were collected by centrifugation, almost all of Ag(I) cation were removed from the solution. We conclude that, using the novel device developed in this study, Hg(II) and Ag(I) cation can be effectively removed from the solution.

Combined effects of metal complexation and size expansion in the electronic structure of DNA base pairs

NASA Astrophysics Data System (ADS)

Brancolini, Giorgia; Di Felice, Rosa

2011-05-01

Novel DNA derivatives have been recently investigated in the pursuit of modified DNA duplexes to tune the electronic structure of DNA-based assemblies for nanotechnology applications. Size-expanded DNAs (e.g., xDNA) and metalated DNAs (M-DNA) may enhance stacking interactions and induce metallic conductivity, respectively. Here we explore possible ways of tailoring the DNA electronic structure by combining the aromatic size expansion with the metal-doping. We select the salient structures from our recent study on natural DNA pairs complexed with transition metal ions and consider the equivalent model configurations for xDNA pairs. We present the results of density functional theory electronic structure calculations of the metalated expanded base-pairs with various localized basis sets and exchange-correlation functionals. Implicit solvent and coordination water molecules are also included. Our results indicate that the effect of base expansion is largest in Ag-xGC complexes, while Cu-xGC complexes are the most promising candidates for nanowires with enhanced electron transfer and also for on-purpose modification of the DNA double-helix for signal detection.

Magnetic and superconducting phase diagrams of single-crystal Er0.8R0.2Ni2B2C (R=Tb,Lu) and ErNi1.9Co0.1B2C: Identification of pair-breaking mechanisms

NASA Astrophysics Data System (ADS)

Takeya, H.; El Massalami, M.

2004-01-01

We investigated the magnetism, superconductivity and their interplay in single crystals Er0.8R0.2Ni2B2C (R=Tb,Lu) and ErNi1.9Co0.1B2C. In contrast to Co substitution, R substitutions induce considerable modifications in the magnetism of Er sublattice: e.g., Tb (Lu) substitution enhances (reduces) TN and critical fields. Both R substitutions introduce size effects and pinning centers; the former modifies the magnon specific heat while the latter hinders the formation of a weak ferromagnetism. The superconductivity, on the other hand, is strongly (weakly) influenced by Tb and Co (Lu) substitution. Taking LuNi2B2C as a nonmagnetic superconducting limit, we analyzed their superconductivities, as well as that of ErNi2B2C, in terms of multiple pair breaking theory on dirty superconductors. Based on this analysis, many of their superconducting features can be explained: The breakdown of de Gennes scaling is due to the presence of multiple pair breakers, the anisotropy of Hc2(T) is related to the magnetic anisotropy, the absence of a structure in Hc2(T) at TN of Lu substitution (TNpair breaking process(es) is substantially reduced.

76 FR 24910 - Agency Information Collection Activities: Forms G-325, G-325A, G-325B, and G-325C; Extension of a...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-05-03

... Collection Activities: Forms G-325, G-325A, G- 325B, and G-325C; Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day notice of information collection under review: Forms G- 325, G-325A, G-325B, and G-325C, Biographic Information; OMB Control No. 1615-0008. The Department of...

Highly Stable Double-Stranded DNA Containing Sequential Silver(I)-Mediated 7-Deazaadenine/Thymine Watson-Crick Base Pairs.

PubMed

Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A

2016-05-17

The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Base-displaced intercalation of the 2-amino-3-methylimidazo[4,5-f]quinolone N2-dG adduct in the NarI DNA recognition sequence

PubMed Central

Stavros, Kallie M.; Hawkins, Edward K.; Rizzo, Carmelo J.; Stone, Michael P.

2014-01-01

2-Amino-3-methylimidazo[4,5-f]quinolone (IQ), a heterocyclic amine found in cooked meats, undergoes bioactivation to a nitrenium ion, which alkylates guanines at both the C8-dG and N2-dG positions. The conformation of a site-specific N2-dG-IQ adduct in an oligodeoxynucleotide duplex containing the iterated CG repeat restriction site of the NarI endonuclease has been determined. The IQ moiety intercalates, with the IQ H4a and CH3 protons facing the minor groove, and the IQ H7a, H8a and H9a protons facing the major groove. The adducted dG maintains the anti-conformation about the glycosyl bond. The complementary dC is extruded into the major groove. The duplex maintains its thermal stability, which is attributed to stacking between the IQ moiety and the 5′- and 3′-neighboring base pairs. This conformation is compared to that of the C8-dG-IQ adduct in the same sequence, which also formed a ‘base-displaced intercalated’ conformation. However, the C8-dG-IQ adopted the syn conformation placing the Watson−Crick edge of the modified dG into the major groove. In addition, the C8-dG-IQ adduct was oriented with the IQ CH3 group and H4a and H5a facing the major groove. These differences may lead to differential processing during DNA repair and replication. PMID:24366876

The physico-chemical "anatomy" of the tautomerization through the DPT of the biologically important pairs of hypoxanthine with DNA bases: QM and QTAIM perspectives.

PubMed

Brovarets', Ol'ha O; Zhurakivsky, Roman O; Hovorun, Dmytro M

2013-10-01

The biologically important tautomerization of the Hyp·Cyt, Hyp·Thy and Hyp·Hyp base pairs to the Hyp·Cyt, Hyp·Thy and Hyp·Hyp base pairs, respectively, by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ε = 4) corresponding to hydrophobic interfaces of protein-nucleic acid interactions by combining theoretical investigations at the B3LYP/6-311++G(d,p) level of QM theory with QTAIM topological analysis. Based on the sweeps of the energetic, electron-topological, geometric and polar parameters, which describe the course of the tautomerization along the intrinsic reaction coordinate (IRC), it was proved that the tautomerization through the DPT is concerted and asynchronous process for the Hyp·Cyt and Hyp·Thy base pairs, while concerted and synchronous for the Hyp·Hyp homodimer. The continuum with ε = 4 does not affect qualitatively the course of the tautomerization reaction for all studied complexes. The nine key points along the IRC of the Hyp·Cyt↔Hyp·Cyt and Hyp·Thy↔Hyp·Thy tautomerizations and the six key points of the Hyp·Hyp↔Hyp·Hyp tautomerization have been identified and fully characterized. These key points could be considered as electron-topological "fingerprints" of concerted asynchronous (for Hyp·Cyt and Hyp·Thy) or synchronous (for Hyp·Hyp) tautomerization process via the DPT. It was found, that in the Hyp·Cyt, Hyp·Thy, Hyp·Hyp and Hyp·Hyp base pairs all H-bonds are significantly cooperative and mutually reinforce each other, while the C2H…O2 H-bond in the Hyp·Cyt base pair and the O6H…O4 H-bond in the Hyp·Thy base pair behave anti-cooperatively, i.e., they become weakened, while two others become strengthened.

Mitochondrial tRNALeu(UUR) C3275T, tRNAGln T4363C and tRNALys A8343G mutations may be associated with PCOS and metabolic syndrome.

PubMed

Ding, Yu; Xia, Bo-Hou; Zhang, Cai-Juan; Zhuo, Guang-Chao

2018-02-05

Polycystic ovary syndrome (PCOS) is a very prevalent endocrine disease affecting reproductive women. Clinically, patients with this disorder are more vulnerable to develop type 2 diabetes mellitus (T2DM), cardiovascular events, as well as metabolic syndrome (MetS). To date, the molecular mechanism underlying PCOS remains largely unknown. Previously, we showed that mitochondrial dysfunction caused by mitochondrial DNA (mtDNA) mutation was an important cause for PCOS. In the current study, we described the clinical and biochemical features of a three-generation pedigree with maternally transmitted MetS, combined with PCOS. A total of three matrilineal relatives exhibited MetS including obesity, high triglyceride (TG) and Hemoglobin A1c (HbA1c) levels, and hypertension. Whereas one patient from the third generation manifestated PCOS. Mutational analysis of the whole mitochondrial genes from the affected individuals identified a set of genetic variations belonging to East Asia haplogroup B4b1c. Among these variants, the homoplasmic C3275T mutation disrupted a highly evolutionary conserved base-pairing (28A-46C) on the variable region of tRNA Leu(UUR) , whereas the T4363C mutation created a new base-pairing (31T-37A) in the anticodon stem of tRNA Gln , furthermore, the A8343G mutation occurred at the very conserved position of tRNA Lys and may result the failure in mitochondrial tRNAs (mt-tRNAs) metabolism. Biochemical analysis revealed the deficiency in mitochondrial functions including lower levels of mitochondrial membrane potential (MMP), ATP production and mtDNA copy number, while a significantly increased reactive oxygen species (ROS) generation was observed in polymononuclear leukocytes (PMNs) from the individuals carrying these mt-tRNA mutations, suggesting that these mutations may cause mitochondrial dysfunction that was responsible for the clinical phenotypes. Taken together, our data indicated that mt-tRNA mutations were associated with MetS and PCOS in this

Life Detection Using Glucose and Tetrasaccharide Enantiomer Pairs

NASA Astrophysics Data System (ADS)

Warmflash, David; Chu, Huanyi; Siefert, Johnathan; Fox, George E.

2009-04-01

A life-detection system based on the expectation that any viable organism will utilize stereoisomers of a given compound asymmetrically is examined. Aqueous extracts of common soil, Mars regolith simulant JSC Mars-1, and suspensions of E. coli and S. cerevisiae were incubated with stereoisomer pairs. The enantiomeric pairs were either D- and L-glucose or a pair of chiral tetrasaccharides. Following an incubation period of 10 days, stereoisomeric selectivity is detectable with the glucose pair by mass spectrometry in extracts made from soil at 0.5 g/ml, in extracts made from JSC Mars-1 at 2.5 g/ml, and in cell suspensions down to 1.0 × 107 cells/ml. For the tetrasaccharide pair, stereoisomeric selectivity was detected in extracts made from 0.5 g/ml or more of common soil but not in JSC Mars-1 simulant. The effective sensitivity in extracts was 2.5 × 107 cells/ml or better for the glucose pair and 5.0 × 108 cells/ml or better for the tetrasaccharide pair. The sensitivity of the glucose pair was such that it could detect life in samples that would be found to be devoid of organic matter by the GCMS system carried by the Viking landers. The results demonstrate the utility of the approach in the search for biological activity on Mars. However, sensitivity is a function of the enantiomer pair used, and this might also be different for hypothetical martian organisms. Therefore, it will be necessary to characterize additional stereoisomeric pairs and, ultimately, to include several in a single test environment.

Black TiO2 nanobelts/g-C3N4 nanosheets Laminated Heterojunctions with Efficient Visible-Light-Driven Photocatalytic Performance

PubMed Central

Shen, Liyan; Xing, Zipeng; Zou, Jinlong; Li, Zhenzi; Wu, Xiaoyan; Zhang, Yuchi; Zhu, Qi; Yang, Shilin; Zhou, Wei

2017-01-01

Black TiO2 nanobelts/g-C3N4 nanosheets laminated heterojunctions (b-TiO2/g-C3N4) as visible-light-driven photocatalysts are fabricated through a simple hydrothermal-calcination process and an in-situ solid-state chemical reduction approach, followed by the mild thermal treatment (350 °C) in argon atmosphere. The prepared samples are evidently investigated by X-ray diffraction, Fourier transform infrared spectroscopy, scanning electron microscopy, transmission electron microscopy, X-ray photoelectron spectroscopy, N2 adsorption, and UV-visible diffuse reflectance spectroscopy, respectively. The results show that special laminated heterojunctions are formed between black TiO2 nanobelts and g-C3N4 nanosheets, which favor the separation of photogenerated electron-hole pairs. Furthermore, the presence of Ti3+ and g-C3N4 greatly enhance the absorption of visible light. The resultant b-TiO2/g-C3N4 materials exhibit higher photocatalytic activity than that of g-C3N4, TiO2, b-TiO2 and TiO2/g-C3N4 for degradation of methyl orange (95%) and hydrogen evolution (555.8 μmol h−1 g−1) under visible light irradiation. The apparent reaction rate constant (k) of b-TiO2/g-C3N4 is ~9 times higher than that of pristine TiO2. Therefore, the high-efficient laminated heterojunction composites will have potential applications in fields of environment and energy. PMID:28165021

Identification of a Novel PMS2 Alteration c.505C>G (R169G) In Trans with a PMS2 Pathogenic Mutation in a Patient with Constitutional Mismatch Repair Deficiency

PubMed Central

Mork, Maureen E.; Borras, Ester; Taggart, Melissa W.; Cuddy, Amanda; Bannon, Sarah A.; You, Y. Nancy; Lynch, Patrick M.; Ramirez, Pedro T.; Rodriguez-Bigas, Miguel A.; Vilar, Eduardo

2016-01-01

Constitutional mismatch repair deficiency syndrome (CMMRD) is a rare autosomal recessive predisposition to colorectal polyposis and other malignancies, often childhood-onset, that is caused by biallelic inheritance of mutations in the same mismatch repair gene. Here, we describe a patient with a clinical diagnosis of CMMRD based on colorectal polyposis and young-onset endometrial cancer who was identified to have two alterations in trans in PMS2: one known pathogenic mutation (c.1831insA; p.Ile611Asnfs*2) and one novel variant of uncertain significance (c.505C>G; p.Arg169Glu), a missense alteration. We describe the clinical and molecular features in the patient harboring this novel alteration c.505C>G, who meets clinical criteria for CMMRD and exhibits molecular evidence supporting a diagnosis of CMMRD. Although experimental validation is needed to confirm its pathogenicity, PMS2 c.505C>G likely has functional consequences that contributes to our patient's phenotype based on the patient's clinical presentation, tumor studies, and bioinformatics analysis. PMID:27017610

Photodissociation Efficiency Spectroscopy Study of the Rydberg Excited Ion-Pair States of Carbon Dioxide

NASA Astrophysics Data System (ADS)

Feng, Qiang; Xu, Yun-Feng; Sun, Jin-Da; Tian, Shan-Xi; Shan, Xiao-Bin; Liu, Fu-Yi; Sheng, Liu-Si

2009-10-01

Photodissociation efficiency spectrum of anionic oxygen atom produced via ion-pair dissociations of carbon dioxide is recorded by means of the synchrotron radiation excitation (XUV photon energy 17.40-20.00 eV). The present spectrum is assigned as the Rydberg-like excited ion-pair states, i.e., Tanaka-Ogawa and Henning series, tilde C2Σg+ (CO+2) vibrational ground-state and excitation series. Three Rydberg series, npσu, npπu, and nfu, converging to tilde C2Σg+ (0, 0, 0), show the higher cross sections.

Sequence dependency of canonical base pair opening in the DNA double helix

PubMed Central

Villa, Alessandra

2017-01-01

The flipping-out of a DNA base from the double helical structure is a key step of many cellular processes, such as DNA replication, modification and repair. Base pair opening is the first step of base flipping and the exact mechanism is still not well understood. We investigate sequence effects on base pair opening using extensive classical molecular dynamics simulations targeting the opening of 11 different canonical base pairs in two DNA sequences. Two popular biomolecular force fields are applied. To enhance sampling and calculate free energies, we bias the simulation along a simple distance coordinate using a newly developed adaptive sampling algorithm. The simulation is guided back and forth along the coordinate, allowing for multiple opening pathways. We compare the calculated free energies with those from an NMR study and check assumptions of the model used for interpreting the NMR data. Our results further show that the neighboring sequence is an important factor for the opening free energy, but also indicates that other sequence effects may play a role. All base pairs are observed to have a propensity for opening toward the major groove. The preferred opening base is cytosine for GC base pairs, while for AT there is sequence dependent competition between the two bases. For AT opening, we identify two non-canonical base pair interactions contributing to a local minimum in the free energy profile. For both AT and CG we observe long-lived interactions with water and with sodium ions at specific sites on the open base pair. PMID:28369121

NMR structural studies of the ionizing radiation adduct 7-hydro-8-oxodeoxyguanosine (8-oxo-7H-dG) opposite deoxyadenosine in a DNA duplex. 8-oxo-7H-dG(syn)ter dot dA(anti) alignment at lesion site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kouchakdjian, M.; Patel, D.J.; Bodepudi, V.

1991-02-05

Proton NMR studies are reported on the complementary d(C1-C2-A3-C4-T5-A6-oxo-G7-T8-C9-A10-C11-C12){center dot}d(G13-G14-T15-G16-A17-A18-T19-A20-G21-T22-G23-G24) dodecanucleotide duplex (designated 8-oxo-7H-dG{center dot}dA 12-mer), which contains a centrally located 7-hydro-8-oxodeoxyguanosine (8-oxo-7H-dG) residue, a group commonly found in DNA that has been exposed to ionizing radiation or oxidizing free radicals. From the NMR spectra it can be deduced that this moiety exists as two tautomers, or gives rise to two DNA conformations, that are in equilibrium and that exchange slowly. The present study focuses on the major component of the equilibrium that originates in the 6,8-dioxo tautomer of 8-oxo-7H-dG. The authors have assigned the exchangeable NH1, NH7, and NH{submore » 2}-2 base protons located on the Watson-Crick and Hoogsteen edges of 8-oxo-7H-dG7 in the 8-oxo-7H-dG{center dot}dA 12-mer duplex, using an analysis of one- and two-dimensional nuclear Overhauser enhancement (NOE) data in H{sub 2}O solution. They were able to detect a set of intra- and interstrand NOEs between protons (exchangeable and nonexchangeable) on adjacent residues in the d(A6-oxo-G7-T8){center dot}d(A17-A18-T19) trinucleotide segment centered about the lesion site that establishes stacking of the oxo-dG7(syn){center dot}dA(anti) pair between stable Watson-Crick dA6{center dot}dT19 and dT8{center dot}A17 base pairs with minimal perturbation of the helix. The structural studies demonstrate that 8-oxo-7H-dG(syn){center dot}dA(anti) forms a stable pair in the interior of the helix, providing a basis for the observed incorporation of dA opposite 8-oxo-7H-dG when readthrough occurs past this oxidized nucleoside base.« less

Interfacial coupling induced direct Z scheme water splitting in metal-free photocatalyst: C3N/g-C3N4 heterojunctions.

PubMed

Wang, Jiajun; Li, Xiaoting; You, Ya; Xintong, Yang; Wang, Ying; Li, Qunxiang

2018-06-21

Mimicking the natural photosynthesis in green plants, artificial Z-scheme photocatalysis enables more efficient utilization of solar energy for photocatalytic water splitting. Most currently designed g-C3N4-based Z-scheme heterojunctions are usually based on metal-containing semiconductor photocatalysts, thus exploiting metal-free photocatalysts for Z-scheme water splitting is of huge interest. Herein, we propose two metal-free C3N/g-C3N4 heterojunctions with the C3N monolayer covering g-C3N4 sheet (monolayer or bilayer) and systematically explore their electronic structures, charge distributions and photocatalytic properties by performing extensive hybrid density functional calculations. We clearly reveal that the relative strong built-in electric fields around their respective interface regions, caused by the charge transfer from C3N monolayer to g-C3N4 monolayer or bilayer, result in the bands bending, renders the transfer of photogenerated carriers in these two heterojunctions following the Z-scheme instead of the type-II pathway. Moreover, the photogenerated electrons and holes in these two C3N/g-C3N4 heterojunctions not only can be efficiently separated, but also have strong redox abilities for water oxidation and reduction. Compared with the isolated g-C3N4 sheets, the light absorption in visible to near-infrared region are significantly enhanced in these proposed heterojunctions. These theoretical findings suggest that these proposed metal-free C3N/g-C3N4 heterojunctions are promising direct Z-scheme photocatalysts for solar water splitting. © 2018 IOP Publishing Ltd.

Carbonic acid ionization and the stability of sodium bicarbonate and carbonate ion pairs to 200 °C - A potentiometric and spectrophotometric study

NASA Astrophysics Data System (ADS)

Stefánsson, Andri; Bénézeth, Pascale; Schott, Jacques

2013-11-01

Carbonic acid ionization and sodium bicarbonate and carbonate ion pair formation constants have been experimentally determined in dilute hydrothermal solutions to 200 °C. Two experimental approaches were applied, potentiometric acid-base titrations at 10-60 °C and spectrophotometric pH measurements using the pH indicators, 2-napthol and 4-nitrophenol, at 25-200 °C. At a given temperature, the first and second ionization constants of carbonic acid (K1, K2) and the ion pair formation constants for NaHCO(aq)(K) and NaCO3-(aq)(K) were simultaneously fitted to the data. Results of this study compare well with previously determined values of K1 and K2. The NaHCO(aq) and NaCO3-(aq) ion pair formation constants vary between 25 and 200 °C having values of logK=-0.18 to 0.58 and logK=1.01 to 2.21, respectively. These ion pairs are weak at low-temperatures but become increasingly important with increasing temperature under neutral to alkaline conditions in moderately dilute to concentrated NaCl solutions, with NaCO3-(aq) predominating over CO32-(aq) in ⩾0.1 M NaCl solution at temperatures above 100 °C. The results demonstrate that NaCl cannot be considered as an inert (non-complexing) electrolyte in aqueous carbon dioxide containing solutions at elevated temperatures.

Prospective very young asteroid pairs

NASA Astrophysics Data System (ADS)

Galád, A.; Vokrouhlický, D.; Zizka, J.

2014-07-01

Several tens of asteroid pairs can be discerned from the background main-belt asteroids. The majority of them are thought to have formed within only the last few 10^6 yr. The youngest recognized pairs have formed more than ≈ 10 kyr ago. As some details of pair formation are still not understood well, the study of young pairs is of great importance. It is mainly because the conditions at the time of the pair formation could be deduced much more reliably for young pairs. For example, space weathering on the surfaces of the components, or changes in their rotational properties (in spin rates, tumbling, coordinates of rotational pole) could be negligible since the formation of young pairs. Also, possible strong perturbations by main-belt bodies on pair formation can be reliably studied only for extremely young pairs. Some pairs can quickly blend in with the background asteroids, so even the frequency of asteroid pair formation could be determined more reliably based on young pairs (though only after a statistically significant sample is at disposal). In our regular search for young pairs in the growing asteroid database, only multiopposition asteroids with very similar orbital and proper elements are investigated. Every pair component is represented by a number of clones within orbital uncertainties and drifting in semimajor axis due to the Yarkovsky effect. We found that, if the previously unrecognized pairs (87887) 2000 SS_{286} - 2002 AT_{49} and (355258) 2007 LY_{4} - 2013AF_{40} formed at the recent very close approach of their components, they could become the youngest known pairs. In both cases, the relative encounter velocities of the components were only ˜ 0.1 m s^{-1}. However, the minimum distances between some clones are too large and a few clones of the latter pair did not encounter recently (within ≈ 10 kyr). The age of some prospective young pairs cannot be determined reliably without improved orbital properties (e.g., the second component of a pair

Sequence-dependent base pair stepping dynamics in XPD helicase unwinding

PubMed Central

Qi, Zhi; Pugh, Robert A; Spies, Maria; Chemla, Yann R

2013-01-01

Helicases couple the chemical energy of ATP hydrolysis to directional translocation along nucleic acids and transient duplex separation. Understanding helicase mechanism requires that the basic physicochemical process of base pair separation be understood. This necessitates monitoring helicase activity directly, at high spatio-temporal resolution. Using optical tweezers with single base pair (bp) resolution, we analyzed DNA unwinding by XPD helicase, a Superfamily 2 (SF2) DNA helicase involved in DNA repair and transcription initiation. We show that monomeric XPD unwinds duplex DNA in 1-bp steps, yet exhibits frequent backsteps and undergoes conformational transitions manifested in 5-bp backward and forward steps. Quantifying the sequence dependence of XPD stepping dynamics with near base pair resolution, we provide the strongest and most direct evidence thus far that forward, single-base pair stepping of a helicase utilizes the spontaneous opening of the duplex. The proposed unwinding mechanism may be a universal feature of DNA helicases that move along DNA phosphodiester backbones. DOI: http://dx.doi.org/10.7554/eLife.00334.001 PMID:23741615

Probing π-π stacking modulation of g-C3N4/graphene heterojunctions and corresponding role of graphene on photocatalytic activity.

PubMed

Ma, Xinguo; Wei, Yang; Wei, Zhen; He, Hua; Huang, Chuyun; Zhu, Yongfa

2017-12-15

The photoelectrochemical properties of g-C 3 N 4 sheet are modified by the π-π stacking interaction with graphene, and the corresponding role of graphene on the surface chemical reactions is investigated by density functional theory. The calculated cohesive energies and the lattice mismatch energies indicate that g-C 3 N 4 and graphene are in parallel contact and can form a stable heterojunction. According to our calculated energy band structures and work functions of g-C 3 N 4 /graphene heterojunctions, the band edge modulations by graphene are discussed and corresponding photoinduced charge transfer processes are analyzed in detail. It is found that the incorporating of graphene into g-C 3 N 4 facilitates the separation of photoinduced e - /h + pairs and the oxidation capacity enhancement of the photoinduced holes with the downshifting of the valence band edge of g-C 3 N 4 layer. It is identified that the inhomogeneous onsite energies between interlayer and the band edge modulations are induced by the inhomogeneous charge redistribution between interlayer caused by graphene. Further, the initial dynamic reaction processes of oxygen atoms in g-C 3 N 4 /graphene heterojunctions also confirm the significant role of graphene on the surface chemical reactions. Copyright © 2017 Elsevier Inc. All rights reserved.

Synergistic binding of bHLH transcription factors to the promoter of the maize NADP-ME gene used in C4 photosynthesis is based on an ancient code found in the ancestral C3 state.

PubMed

Borba, Ana Rita; Serra, Tânia S; Górska, Alicja; Gouveia, Paulo; Cordeiro, André M; Reyna-Llorens, Ivan; Knerová, Jana; Barros, Pedro M; Abreu, Isabel A; Oliveira, M Margarida; Hibberd, Julian M; Saibo, Nelson J M

2018-04-05

C4 photosynthesis has evolved repeatedly from the ancestral C3 state to generate a carbon concentrating mechanism that increases photosynthetic efficiency. This specialised form of photosynthesis is particularly common in the PACMAD clade of grasses, and is used by many of the world's most productive crops. The C4 cycle is accomplished through cell-type specific accumulation of enzymes but cis-elements and transcription factors controlling C4 photosynthesis remain largely unknown. Using the NADP-Malic Enzyme (NADP-ME) gene as a model we tested whether mechanisms impacting on transcription in C4 plants evolved from ancestral components found in C3 species. Two basic Helix-Loop-Helix (bHLH) transcription factors, ZmbHLH128 and ZmbHLH129, were shown to bind the C4NADP-ME promoter from maize. These proteins form heterodimers and ZmbHLH129 impairs trans-activation by ZmbHLH128. Electrophoretic mobility shift assays indicate that a pair of cis-elements separated by a seven base pair spacer synergistically bind either ZmbHLH128 or ZmbHLH129. This pair of cis-elements is found in both C3 and C4 Panicoid grass species of the PACMAD clade. Our analysis is consistent with this cis-element pair originating from a single motif present in the ancestral C3 state. We conclude that C4 photosynthesis has co-opted an ancient C3 regulatory code built on G-box recognition by bHLH to regulate the NADP-ME gene. More broadly, our findings also contribute to the understanding of gene regulatory networks controlling C4 photosynthesis.

A systematic molecular dynamics study of nearest-neighbor effects on base pair and base pair step conformations and fluctuations in B-DNA

PubMed Central

Lavery, Richard; Zakrzewska, Krystyna; Beveridge, David; Bishop, Thomas C.; Case, David A.; Cheatham, Thomas; Dixit, Surjit; Jayaram, B.; Lankas, Filip; Laughton, Charles; Maddocks, John H.; Michon, Alexis; Osman, Roman; Orozco, Modesto; Perez, Alberto; Singh, Tanya; Spackova, Nada; Sponer, Jiri

2010-01-01

It is well recognized that base sequence exerts a significant influence on the properties of DNA and plays a significant role in protein–DNA interactions vital for cellular processes. Understanding and predicting base sequence effects requires an extensive structural and dynamic dataset which is currently unavailable from experiment. A consortium of laboratories was consequently formed to obtain this information using molecular simulations. This article describes results providing information not only on all 10 unique base pair steps, but also on all possible nearest-neighbor effects on these steps. These results are derived from simulations of 50–100 ns on 39 different DNA oligomers in explicit solvent and using a physiological salt concentration. We demonstrate that the simulations are converged in terms of helical and backbone parameters. The results show that nearest-neighbor effects on base pair steps are very significant, implying that dinucleotide models are insufficient for predicting sequence-dependent behavior. Flanking base sequences can notably lead to base pair step parameters in dynamic equilibrium between two conformational sub-states. Although this study only provides limited data on next-nearest-neighbor effects, we suggest that such effects should be analyzed before attempting to predict the sequence-dependent behavior of DNA. PMID:19850719

Physics of base-pairing dynamics in DNA

NASA Astrophysics Data System (ADS)

Manghi, Manoel; Destainville, Nicolas

2016-05-01

As a key molecule of life, Deoxyribo-Nucleic Acid (DNA) is the focus of numbers of investigations with the help of biological, chemical and physical techniques. From a physical point of view, both experimental and theoretical works have brought quantitative insights into DNA base-pairing dynamics that we review in this Report, putting emphasis on theoretical developments. We discuss the dynamics at the base-pair scale and its pivotal coupling with the polymer one, with a polymerization index running from a few nucleotides to tens of kilo-bases. This includes opening and closure of short hairpins and oligomers as well as zipping and unwinding of long macromolecules. We review how different physical mechanisms are either used by Nature or utilized in biotechnological processes to separate the two intertwined DNA strands, by insisting on quantitative results. They go from thermally-assisted denaturation bubble nucleation to force- or torque-driven mechanisms. We show that the helical character of the molecule, possibly supercoiled, can play a key role in many denaturation and renaturation processes. We categorize the mechanisms according to the relative timescales associated with base-pairing and chain orientational degrees of freedom such as bending and torsional elastic ones. In some specific situations, these chain orientational degrees of freedom can be integrated out, and the quasi-static approximation is valid. The complex dynamics then reduces to the diffusion in a low-dimensional free-energy landscape. In contrast, some important cases of experimental interest necessarily appeal to far-from-equilibrium statistical mechanics and hydrodynamics.

Improved genetically-encoded, FlincG-type fluorescent biosensors for neural cGMP imaging

PubMed Central

Bhargava, Yogesh; Hampden-Smith, Kathryn; Chachlaki, Konstantina; Wood, Katherine C.; Vernon, Jeffrey; Allerston, Charles K.; Batchelor, Andrew M.; Garthwaite, John

2013-01-01

Genetically-encoded biosensors are powerful tools for understanding cellular signal transduction mechanisms. In aiming to investigate cGMP signaling in neurones using the EGFP-based fluorescent biosensor, FlincG (fluorescent indicator for cGMP), we encountered weak or non-existent fluorescence after attempted transfection with plasmid DNA, even in HEK293T cells. Adenoviral infection of HEK293T cells with FlincG, however, had previously proved successful. Both constructs were found to harbor a mutation in the EGFP domain and had a tail of 17 amino acids at the C-terminus that differed from the published sequence. These discrepancies were systematically examined, together with mutations found beneficial for the related GCaMP family of Ca2+ biosensors, in a HEK293T cell line stably expressing both nitric oxide (NO)-activated guanylyl cyclase and phosphodiesterase-5. Restoring the mutated amino acid improved basal fluorescence whereas additional restoration of the correct C-terminal tail resulted in poor cGMP sensing as assessed by superfusion of either 8-bromo-cGMP or NO. Ultimately, two improved FlincGs were identified: one (FlincG2) had the divergent tail and gave moderate basal fluorescence and cGMP response amplitude and the other (FlincG3) had the correct tail, a GCaMP-like mutation in the EGFP region and an N-terminal tag, and was superior in both respects. All variants tested were strongly influenced by pH over the physiological range, in common with other EGFP-based biosensors. Purified FlincG3 protein exhibited a lower cGMP affinity (0.89 μM) than reported for the original FlincG (0.17 μM) but retained rapid kinetics and a 230-fold selectivity over cAMP. Successful expression of FlincG2 or FlincG3 in differentiated N1E-115 neuroblastoma cells and in primary cultures of hippocampal and dorsal root ganglion cells commends them for real-time imaging of cGMP dynamics in neural (and other) cells, and in their subcellular specializations. PMID:24068983

Life detection using glucose and tetrasaccharide enantiomer pairs.

PubMed

Warmflash, David; Chu, Huanyi; Siefert, Johnathan; Fox, George E

2009-04-01

A life-detection system based on the expectation that any viable organism will utilize stereoisomers of a given compound asymmetrically is examined. Aqueous extracts of common soil, Mars regolith simulant JSC Mars-1, and suspensions of E. coli and S. cerevisiae were incubated with stereoisomer pairs. The enantiomeric pairs were either D- and L-glucose or a pair of chiral tetrasaccharides. Following an incubation period of 10 days, stereoisomeric selectivity is detectable with the glucose pair by mass spectrometry in extracts made from soil at 0.5 g/ml, in extracts made from JSC Mars-1 at 2.5 g/ml, and in cell suspensions down to 1.0 x 10(7) cells/ml. For the tetrasaccharide pair, stereoisomeric selectivity was detected in extracts made from 0.5 g/ml or more of common soil but not in JSC Mars-1 simulant. The effective sensitivity in extracts was 2.5 x 10(7) cells/ml or better for the glucose pair and 5.0 x 10(8) cells/ml or better for the tetrasaccharide pair. The sensitivity of the glucose pair was such that it could detect life in samples that would be found to be devoid of organic matter by the GCMS system carried by the Viking landers. The results demonstrate the utility of the approach in the search for biological activity on Mars. However, sensitivity is a function of the enantiomer pair used, and this might also be different for hypothetical martian organisms. Therefore, it will be necessary to characterize additional stereoisomeric pairs and, ultimately, to include several in a single test environment.

Conformational analysis of a covalently cross-linked Watson-Crick base pair model.

PubMed

Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J

2008-11-15

Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.

A review on g-C3N4 for photocatalytic water splitting and CO2 reduction

NASA Astrophysics Data System (ADS)

Ye, Sheng; Wang, Rong; Wu, Ming-Zai; Yuan, Yu-Peng

2015-12-01

Solar fuel generation through water splitting and CO2 photoreduction is an ideal route to provide the renewable energy sources and mitigate global warming. The main challenge in photocatalysis is finding a low-cost photocatalyst that can work efficiently to split water into hydrogen and reduce CO2 to hydrocarbon fuels. Metal-free g-C3N4 photocatalyst shows great potentials for solar fuel production. In this mini review, we summarize the most current advances on novel design idea and new synthesis strategy for g-C3N4 preparation, insightful ideas on extending optical absorption of pristine g-C3N4, overall water splitting and CO2 photoreduction over g-C3N4 based systems. The research challenges and perspectives on g-C3N4 based photocatalysts were also suggested.

Single-Molecule Mechanical (Un)folding of RNA Hairpins: Effects of Single A-U to A∙C Pair Substitutions and Single Proton Binding and Implications for mRNA Structure-Induced -1 Ribosomal Frameshifting.

PubMed

Yang, Lixia; Zhong, Zhensheng; Tong, Cailing; Jia, Huan; Liu, Yiran; Chen, Gang

2018-06-08

A wobble A∙C pair can be protonated at near physiological pH to form a more stable wobble A+∙C pair. Here, we constructed an RNA hairpin (rHP) and three mutants with one A-U base pair substituted with an A∙C mismatch on the top (near the loop, U22C), middle (U25C) and bottom (U29C) positions of the stem, respectively. Our results on single-molecule mechanical (un)folding using optical tweezers reveal the destabilization effect of A-U to A∙C pair substitution, and protonation-dependent enhancement of mechanical stability facilitated through an increased folding rate, or decreased unfolding rate, or both. Our data show that protonation may occur rapidly upon the formation of apparent mechanical folding transition state. Furthermore, we measured the bulk -1 ribosomal frameshifting efficiencies of the hairpins by a cell-free translation assay. For the mRNA hairpins studied, -1 frameshifting efficiency correlates with mechanical unfolding force at equilibrium and folding rate at around 15 pN. U29C has a frameshifting efficiency similar to that of rHP (~2%). Accordingly, the bottom 2-4 base pairs of U29C may not form under a stretching force at pH 7.3, which is consistent with the fact that the bottom base pairs of the hairpins may be disrupted by ribosome at the slippery site. U22C and U25C have a similar frameshifting efficiency (~1%), indicating that both unfolding and folding rates of an mRNA hairpin in a crowded environment may affect frameshifting. Our data indicate that mechanical (un)folding of RNA hairpins may mimic how mRNAs unfold and fold in the presence of translating ribosomes.

New application of Z-scheme Ag3PO4/g-C3N4 composite in converting CO2 to fuel.

PubMed

He, Yiming; Zhang, Lihong; Teng, Botao; Fan, Maohong

2015-01-06

This research was designed for the first time to investigate the activities of photocatalytic composite, Ag3PO4/g-C3N4, in converting CO2 to fuels under simulated sunlight irradiation. The composite was synthesized using a simple in situ deposition method and characterized by various techniques including Brunauer-Emmett-Teller method (BET), X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FT-IR), scanning electron microscopy (SEM), transmission electron microscopy (TEM), X-ray photoelectron spectroscopy (XPS), UV-vis diffuse reflectance spectroscopy (DRS), photoluminescence spectroscopy (PL), and an electrochemical method. Thorough investigation indicated that the composite consisted of Ag3PO4, Ag, and g-C3N4. The introduction of Ag3PO4 on g-C3N4 promoted its light absorption performance. However, more significant was the formation of heterojunction structure between Ag3PO4 and g-C3N4, which efficiently promoted the separation of electron-hole pairs by a Z-scheme mechanism and ultimately enhanced the photocatalytic CO2 reduction performance of the Ag3PO4/g-C3N4. The optimal Ag3PO4/g-C3N4 photocatalyst showed a CO2 conversion rate of 57.5 μmol · h(-1) · gcat(-1), which was 6.1 and 10.4 times higher than those of g-C3N4 and P25, respectively, under simulated sunlight irradiation. The work found a new application of the photocatalyst, Ag3PO4/g-C3N4, in simultaneous environmental protection and energy production.

Race and Gender Mentor-Protégé Pairings of Resident Assistants: An Exploration on Leadership Capacity

ERIC Educational Resources Information Center

Early, Sherry L.

2017-01-01

The leadership capacity of resident assistants can be impacted by many experiences, including involvement in mentoring relationships. The purpose of this study was to examine if and how resident assistants' leadership capacities are influenced by participating in mentoring relationships. Additionally, mentor-protégé race and gender pairings were…

Error simulation of paired-comparison-based scaling methods

NASA Astrophysics Data System (ADS)

Cui, Chengwu

2000-12-01

Subjective image quality measurement usually resorts to psycho physical scaling. However, it is difficult to evaluate the inherent precision of these scaling methods. Without knowing the potential errors of the measurement, subsequent use of the data can be misleading. In this paper, the errors on scaled values derived form paired comparison based scaling methods are simulated with randomly introduced proportion of choice errors that follow the binomial distribution. Simulation results are given for various combinations of the number of stimuli and the sampling size. The errors are presented in the form of average standard deviation of the scaled values and can be fitted reasonably well with an empirical equation that can be sued for scaling error estimation and measurement design. The simulation proves paired comparison based scaling methods can have large errors on the derived scaled values when the sampling size and the number of stimuli are small. Examples are also given to show the potential errors on actually scaled values of color image prints as measured by the method of paired comparison.

A Hierarchical Z-Scheme α-Fe2 O3 /g-C3 N4 Hybrid for Enhanced Photocatalytic CO2 Reduction.

PubMed

Jiang, Zhifeng; Wan, Weiming; Li, Huaming; Yuan, Shouqi; Zhao, Huijun; Wong, Po Keung

2018-03-01

The challenge in the artificial photosynthesis of fossil resources from CO 2 by utilizing solar energy is to achieve stable photocatalysts with effective CO 2 adsorption capacity and high charge-separation efficiency. A hierarchical direct Z-scheme system consisting of urchin-like hematite and carbon nitride provides an enhanced photocatalytic activity of reduction of CO 2 to CO, yielding a CO evolution rate of 27.2 µmol g -1 h -1 without cocatalyst and sacrifice reagent, which is >2.2 times higher than that produced by g-C 3 N 4 alone (10.3 µmol g -1 h -1 ). The enhanced photocatalytic activity of the Z-scheme hybrid material can be ascribed to its unique characteristics to accelerate the reduction process, including: (i) 3D hierarchical structure of urchin-like hematite and preferable basic sites which promotes the CO 2 adsorption, and (ii) the unique Z-scheme feature efficiently promotes the separation of the electron-hole pairs and enhances the reducibility of electrons in the conduction band of the g-C 3 N 4 . The origin of such an obvious advantage of the hierarchical Z-scheme is not only explained based on the experimental data but also investigated by modeling CO 2 adsorption and CO adsorption on the three different atomic-scale surfaces via density functional theory calculation. The study creates new opportunities for hierarchical hematite and other metal-oxide-based Z-scheme system for solar fuel generation. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Two-photon production of dilepton pairs in peripheral heavy ion collisions

NASA Astrophysics Data System (ADS)

Klein, Spencer R.

2018-05-01

The STAR collaboration has observed an excess production of e+e- pairs in relativistic heavy ion collisions, over the expectations from hadronic production models. The excess pairs have transverse momenta pT<150 MeV /c and are most prominent in peripheral gold-gold and uranium-uranium collisions. The pairs exhibit a peak at the J /ψ mass, but include a wide continuum, with pair invariant masses from 400 MeV/c 2 up to 2.6 GeV/c 2 . The ALICE Collaboration observes a similar excess in peripheral lead-lead collisions, but only at the J /ψ mass, without a corresponding continuum. This paper presents a calculation of the cross section and kinematic for two-photon production of e+e- pairs, and find general agreement with the STAR data. The calculation is based on the starlight simulation code, which is based on the Weizsäcker-Williams virtual photon approach. The STAR continuum observations are compatible with two-photon production of e+e- pairs. The ALICE analysis required individual muon pT be greater than 1 GeV/c; this eliminated almost all of the pairs from two-photon interactions, while leaving most of the J /ψ decays.

The influence of anharmonic and solvent effects on the theoretical vibrational spectra of the guanine-cytosine base pairs in Watson-Crick and Hoogsteen configurations.

PubMed

Bende, Attila; Muntean, Cristina M

2014-03-01

The theoretical IR and Raman spectra of the guanine-cytosine DNA base pairs in Watson-Crick and Hoogsteen configurations were computed using DFT method with M06-2X meta-hybrid GGA exchange-correlation functional, including the anharmonic corrections and solvent effects. The results for harmonic frequencies and their anharmonic corrections were compared with our previously calculated values obtained with the B3PW91 hybrid GGA functional. Significant differences were obtained for the anharmonic corrections calculated with the two different DFT functionals, especially for the stretching modes, while the corresponding harmonic frequencies did not differ considerable. For the Hoogtseen case the H⁺ vibration between the G-C base pair can be characterized as an asymmetric Duffing oscillator and therefore unrealistic anharmonic corrections for normal modes where this proton vibration is involved have been obtained. The spectral modification due to the anharmonic corrections, solvent effects and the influence of sugar-phosphate group for the Watson-Crick and Hoogsteen base pair configurations, respectively, were also discussed. For the Watson-Crick case also the influence of the stacking interaction on the theoretical IR and Raman spectra was analyzed. Including the anharmonic correction in our normal mode analysis is essential if one wants to obtain correct assignments of the theoretical frequency values as compared with the experimental spectra.

3D-Subspace-Based Auto-Paired Azimuth Angle, Elevation Angle, and Range Estimation for 24G FMCW Radar with an L-Shaped Array

PubMed Central

Nam, HyungSoo; Choi, ByungGil; Oh, Daegun

2018-01-01

In this paper, a three-dimensional (3D)-subspace-based azimuth angle, elevation angle, and range estimation method with auto-pairing is proposed for frequency-modulated continuous waveform (FMCW) radar with an L-shaped array. The proposed method is designed to exploit the 3D shift-invariant structure of the stacked Hankel snapshot matrix for auto-paired azimuth angle, elevation angle, and range estimation. The effectiveness of the proposed method is verified through a variety of experiments conducted in a chamber. For the realization of the proposed method, K-band FMCW radar is implemented with an L-shaped antenna. PMID:29621193

The somatic FAH C.1061C>A change counteracts the frequent FAH c.1062+5G>A mutation and permits U1snRNA-based splicing correction.

PubMed

Scalet, Daniela; Sacchetto, Claudia; Bernardi, Francesco; Pinotti, Mirko; van de Graaf, Stan F J; Balestra, Dario

2018-05-01

In tyrosinaemia type 1(HT1), a mosaic pattern of fumarylacetoacetase (FAH) immunopositive or immunonegative nodules in liver tissue has been reported in many patients. This aspect is generally explained by a spontaneous reversion of the mutation into a normal genotype. In one HT1 patient carrying the frequent FAH c.1062+5G>A mutation, a second somatic change (c.1061C>A) has been reported in the same allele, and found in immunopositive nodules. Here, we demonstrated that the c.1062+5G>A prevents usage of the exon 12 5' splice site (ss), even when forced by an engineered U1snRNA specifically designed on the FAH 5'ss to strengthen its recognition. Noticeably the new somatic c.1061C>A change, in linkage with the c.1062+5G>A mutation, partially rescues the defective 5'ss and is associated to trace level (~5%) of correct transcripts. Interestingly, this combined genetic condition strongly favored the rescue by the engineered U1snRNA, with correct transcripts reaching up to 60%. Altogether, these findings elucidate the molecular basis of HT1 caused by the frequent FAH c.1062+5G>A mutation, and demonstrate the compensatory effect of the c.1061C>A change in promoting exon definition, thus unraveling a rare mechanism leading to FAH immune-reactive mosaicism.

T.C.G triplet in an antiparallel purine.purine.pyrimidine DNA triplex. Conformational studies by NMR.

PubMed

Dittrich, K; Gu, J; Tinder, R; Hogan, M; Gao, X

1994-04-12

The antiparallel purine.purine.pyrimidine DNA triplex, RRY6, which contains a T.C.G inverted triplet in the center of the sequence, was examined by proton and phosphorous two-dimensional NMR spectroscopy. The local conformation of the T.C.G triplet (T4.C11.G18) and the effect of this triplet on the global helical structure were analyzed in detail. The formation of the T.C.G triplet is confirmed by a set of cross-strand NOEs, including unusual cross-strand NOEs between the third strand and the pyrimidine strand as opposed to the purine strand of the duplex. NMR data suggest that the T.C.G triplet may be present in an equilibrium between a non-hydrogen-bonded form and a T(O4)-C(NH2) hydrogen-bonded form and that there is a distortion of the in-plane alignment of the three bases. The flanking G.G.C base triplets are well-defined on the 5'-side of T4, but somewhat interrupted on the 3'-side of T4. The effect of the third strand binding on the Watson-Crick duplex was probed by an NMR study of the free duplex RY6. NMR parameters are affected mostly around the T.C.G inversion site. The perturbations extend to at least two adjacent base triplets on either side. The binding of the third purine strand and the accommodation of a central T.C.G inversion in RRY6 does not require a readjustment in sugar pucker, which remains in the range of C2'-endo. 31P resonances of RRY6 distribute over a range of 2.2 ppm. The H-P coupling patterns of the third strand differ from those of the duplex. General spectral patterns defined by the marker protons of the RRY and YRY triplexes are compared.

Virulence of Mycobacterium tuberculosis after Acquisition of Isoniazid Resistance: Individual Nature of katG Mutants and the Possible Role of AhpC.

PubMed

Nieto R, Luisa Maria; Mehaffy, Carolina; Creissen, Elizabeth; Troudt, JoLynn; Troy, Amber; Bielefeldt-Ohmann, Helle; Burgos, Marcos; Izzo, Angelo; Dobos, Karen M

2016-01-01

In the last decade, there were 10 million new tuberculosis cases per year globally. Around 9.5% of these cases were caused by isoniazid resistant (INHr) Mycobacterium tuberculosis (Mtb) strains. Although isoniazid resistance in Mtb is multigenic, mutations in the catalase-peroxidase (katG) gene predominate among the INHr strains. The effect of these drug-resistance-conferring mutations on Mtb fitness and virulence is variable. Here, we assessed differences in bacterial growth, immune response and pathology induced by Mtb strains harboring mutations at the N-terminus of the katG gene. We studied one laboratory and one clinically isolated Mtb clonal pair from different genetic lineages. The INHr strain in each pair had one and two katG mutations with significantly reduced levels of the enzyme and peroxidase activity. Both strains share the V1A mutation, while the double mutant clinical INHr had also the novel E3V katG mutation. Four groups of C57BL/6 mice were infected with one of the Mtb strains previously described. We observed a strong reduction in virulence (reduced bacterial growth), lower induction of proinflammatory cytokines and significantly reduced pathology scores in mice infected with the clinical INHr strain compared to the infection caused by its INHs progenitor strain. On the other hand, there was a subtle reduction of bacteria growth without differences in the pathology scores in mice infected with the laboratory INHr strain. Our results also showed distinct alkyl-hydroperoxidase C (AhpC) levels in the katG mutant strains, which could explain the difference in the virulence profile observed. The difference in the AhpC levels between clonal strains was not related to a genetic defect in the gene or its promoter. Cumulatively, our results indicate that the virulence, pathology and fitness of INHr strains could be negatively affected by multiple mutations in katG, lack of the peroxidase activity and reduced AhpC levels.

Cu-modified alkalinized g-C3N4 as photocatalytically assisted heterogeneous Fenton-like catalyst

NASA Astrophysics Data System (ADS)

Dong, Qimei; Chen, Yingying; Wang, Lingli; Ai, Shasha; Ding, Hanming

2017-12-01

Alkalinized graphitic carbon nitride (CNK-OH) has been synthesized by one-step thermal poly-condensation method, and Cu-modified alkalinized g-C3N4 (Cu-CNK-OH) has been prepared by impregnation approach over CNK-OH. These copper species in Cu-CNK-OH are embedded in the frame of CNK-OH mostly via the Cu-N bonds. Cu-CNK-OH has been employed as a heterogeneous Fenton-like catalyst to degrade rhodamine B (RhB). Both the production efficiency of hydroxyl radicals and the transformation rate of Cu(II)/Cu(I) redox pair increase under visible-light irradiation. As a result, Cu-CNK-OH exhibits improved Fenton-like catalytic activity on the degradation of RhB. The synergetic interaction between Fenton-like process and photocatalytic process also contributes such improvement. The hydroxyl radicals and holes are the major reactive species in the photocatalytically assisted Fenton-like process. This study provides a valuable strategy for metal modification of alkalinized g-C3N4 with enhanced Fenton-like catalytic performance for the degradation of organic contaminants.

Dipole moments and transition probabilities of the i 3Pi sub g-b 3Sigma(+) sub u, c 3Pi sub u-a 3Sigma(+) sub g, and i 3Pi sub g-c 3Pi sub u systems of molecular hydrogen

NASA Technical Reports Server (NTRS)

Guberman, Steven L.; Dalgarno, A.

1992-01-01

Bonn-Oppenheimer-based ab initio calculations of dipole moments from the i 3Pi sub g-b 3Sigma(+) sub u, c 3Pi sub u-a 3Sigma(+) sub g, and i 3Pi sub g-c 3Pi sub u transitions of H2 have been conducted, to yield a tabulation of the dipole transition probabilities and Franck-Condon factors. These factors are given for transitions originating in the lowest vibrational level of the ground X 1Sigma(+) sub g state.

Ion-pair cloud-point extraction: a new method for the determination of water-soluble vitamins in plasma and urine.

PubMed

Heydari, Rouhollah; Elyasi, Najmeh S

2014-10-01

A novel, simple, and effective ion-pair cloud-point extraction coupled with a gradient high-performance liquid chromatography method was developed for determination of thiamine (vitamin B1 ), niacinamide (vitamin B3 ), pyridoxine (vitamin B6 ), and riboflavin (vitamin B2 ) in plasma and urine samples. The extraction and separation of vitamins were achieved based on an ion-pair formation approach between these ionizable analytes and 1-heptanesulfonic acid sodium salt as an ion-pairing agent. Influential variables on the ion-pair cloud-point extraction efficiency, such as the ion-pairing agent concentration, ionic strength, pH, volume of Triton X-100, extraction temperature, and incubation time have been fully evaluated and optimized. Water-soluble vitamins were successfully extracted by 1-heptanesulfonic acid sodium salt (0.2% w/v) as ion-pairing agent with Triton X-100 (4% w/v) as surfactant phase at 50°C for 10 min. The calibration curves showed good linearity (r(2) > 0.9916) and precision in the concentration ranges of 1-50 μg/mL for thiamine and niacinamide, 5-100 μg/mL for pyridoxine, and 0.5-20 μg/mL for riboflavin. The recoveries were in the range of 78.0-88.0% with relative standard deviations ranging from 6.2 to 8.2%. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Multi-hop teleportation based on W state and EPR pairs

NASA Astrophysics Data System (ADS)

Hai-Tao, Zhan; Xu-Tao, Yu; Pei-Ying, Xiong; Zai-Chen, Zhang

2016-05-01

Multi-hop teleportation has significant value due to long-distance delivery of quantum information. Many studies about multi-hop teleportation are based on Bell pairs, partially entangled pairs or W state. The possibility of multi-hop teleportation constituted by partially entangled pairs relates to the number of nodes. The possibility of multi-hop teleportation constituted by double W states is after n-hop teleportation. In this paper, a multi-hop teleportation scheme based on W state and EPR pairs is presented and proved. The successful possibility of quantum information transmitted hop by hop through intermediate nodes is deduced. The possibility of successful transmission is after n-hop teleportation. Project supported by the National Natural Science Foundation of China (Grant No. 61571105), the Prospective Future Network Project of Jiangsu Province, China (Grant No. BY2013095-1-18), and the Independent Project of State Key Laboratory of Millimeter Waves, China (Grant No. Z201504).

Method for sequencing DNA base pairs

DOEpatents

Sessler, Andrew M.; Dawson, John

1993-01-01

The base pairs of a DNA structure are sequenced with the use of a scanning tunneling microscope (STM). The DNA structure is scanned by the STM probe tip, and, as it is being scanned, the DNA structure is separately subjected to a sequence of infrared radiation from four different sources, each source being selected to preferentially excite one of the four different bases in the DNA structure. Each particular base being scanned is subjected to such sequence of infrared radiation from the four different sources as that particular base is being scanned. The DNA structure as a whole is separately imaged for each subjection thereof to radiation from one only of each source.

Method for sequencing DNA base pairs

DOEpatents

Sessler, A.M.; Dawson, J.

1993-12-14

The base pairs of a DNA structure are sequenced with the use of a scanning tunneling microscope (STM). The DNA structure is scanned by the STM probe tip, and, as it is being scanned, the DNA structure is separately subjected to a sequence of infrared radiation from four different sources, each source being selected to preferentially excite one of the four different bases in the DNA structure. Each particular base being scanned is subjected to such sequence of infrared radiation from the four different sources as that particular base is being scanned. The DNA structure as a whole is separately imaged for each subjection thereof to radiation from one only of each source. 6 figures.

Proteolytic processing of poliovirus polypeptides: antibodies to polypeptide P3-7c inhibit cleavage at glutamine-glycine pairs

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hanecak, R.; Semler, B.L.; Anderson, C.W.

1982-07-01

Proteolytic processing of poliovirus polypeptides was examined by the addition of antibodies directed against the viral proteins P3-7c and P2-X to a cell-free translation extract prepared from infected HeLa cells. Antisera to P3-7c specifically inhibited in vitro processing at Gln-Gly pairs. Partial amino acid sequence analysis revealed a second Tyr-Gly pair that is utilized in protein processing. Neither Tyr-Gly cleavage is affected by antibody to P3-7C. Anti-P3-7c antibodies react not only with P3-7c but also with P3-6a and P3-2, two viral polypeptides NH/sub 2/-coterminal with P3-7c. Preimmune and anti-P2-X antibodies had no effect on the processing of poliovirus proteins inmore » vitro. The authors conclude that the activity responsible for processing poliovirus polypeptides at Gln-Gly pairs resides in the primary structure of P3-7c and not in P2-X.« less

Structural, optical and photocatalytic properties of visible light driven zinc oxide hybridized two-dimensional π-conjugated polymeric g-C3N4 composite

NASA Astrophysics Data System (ADS)

Murugesan, Pramila; Girichandran, Nandalal; Narayanan, Sheeba; Manickam, Matheswaran

2018-01-01

Zinc oxide (ZnO) hybridized with graphitic carbon nitride (g-C3N4) composite was prepared via one step calcination method and well characterized using various physiochemical techniques. The prepared composite exhibits excellent photocatalytic activity and stability for decolorization of methylene blue (MB) dye solution under visible light irradiation. Effect of various rate determining parameters such as catalyst loading, initial dye concentration and pH on the decolorization of MB has been analyzed. The optimum conditions for efficient color removal were found to be 7, 10 ppm and 2 g/L for pH, dye concentration and catalyst dosage respectively. The intermediate compounds formed during the decolorization process were evaluated by GCMS spectra. It was inferred that the ZnO/g-C3N4 (98.83%) composite exhibits highest decolorization efficiency as compare with pure g-C3N4 (35.21%). Such enhancement of photocataytic activity is mainly attributed to the efficient separation of photo induced electron hole pairs via Z-scheme model composed of ZnO and g-C3N4.

Signature scheme based on bilinear pairs

NASA Astrophysics Data System (ADS)

Tong, Rui Y.; Geng, Yong J.

2013-03-01

An identity-based signature scheme is proposed by using bilinear pairs technology. The scheme uses user's identity information as public key such as email address, IP address, telephone number so that it erases the cost of forming and managing public key infrastructure and avoids the problem of user private generating center generating forgery signature by using CL-PKC framework to generate user's private key.

Structural studies of the 5'-phenazinium-tethered matched and G-A-mismatched DNA duplexes by NMR spectroscopy.

PubMed

Maltseva, T; Sandström, A; Ivanova, I M; Sergeyev, D S; Zarytova, V F; Chattopadhyaya, J

1993-05-01

The mechanism through which modified oligo-DNA analogues act as antisense repressors at the transcriptional and translational level of gene expression is based on the information content in the nucleotide sequence which is determined by the specific base pairing. The efficiency of such action is largely determined by the stability of the duplex formed between the oligonucleotide reagent and the target sequence and also by the mismatched base pairing, such as G-A, that occurs during replication or recombination. We herein report that the phenazinium (Pzn)-tethered matched duplex p(d(TGTTTGGC)):(Pzn)-p(d(CCAAACA)) (III) (Tm = 50 degrees C) has a much larger stability than the parent matched duplex p(d(TGTTTGGC)):p(d(CCAAACA)) (I) (Tm = 30 degrees C). On the other hand, the Pzn-tethered G-A-mismatched duplex p(d(TGTTTGGC)):(Pzn)-p(d(ACAAACA)) (IV) (Tm = 34 degrees C) is only slightly more stable than its parent mismatched duplex p(d(TGTTTGGC)):p(d(ACAAACA)) (Tm = 25 degrees C). A detailed 500 MHz NMR study and constrained MD refinements of NMR-derived structures have been undertaken for the DNA duplexes (I), (II), (III) and (IV) in order to understand the structural basis of stabilization of Pzn-tethered matched DNA duplex (delta Tm = 20 degrees C) compared to mismatched duplex (delta Tm = 9 degrees C). Assignment of the 1H-NMR (500 MHz) spectra of the duplexes has been carried out by 2D NOESY, HOHAHA and DQF-COSY experiments. The torsion angles have been extracted from the J-coupling constants obtained by simulation of most of the DQF-COSY cross-peaks using program SMART. The solution structure of the duplexes were assessed by an iterative hybride relaxation matrix method (MORASS) combined with NOESY distances and torsion angles restrained molecular dynamics (MD) using program Amber 4.0. The standard Amber 4.0 force-field parameters were used for the oligonucleotide in conjunction with the new parameters for Pzn residue which was obtained by full geometry

Triple helical DNA in a duplex context and base pair opening

PubMed Central

Esguerra, Mauricio; Nilsson, Lennart; Villa, Alessandra

2014-01-01

It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region. PMID:25228466

Influence of annealing temperature on physical properties and photocatalytic ability of g-C3N4 nanosheets synthesized through urea polymerization in Ar atmosphere

NASA Astrophysics Data System (ADS)

Mai Oanh, Le Thi; Hang, Lam Thi; Lai, Ngoc Diep; Phuong, Nguyen Thi; Thang, Dao Viet; Hung, Nguyen Manh; Danh Bich, Do; Minh, Nguyen Van

2018-03-01

The influences of annealing temperature on structure, morphology, vibration, optical properties and photocatalytic ability of g-C3N4 nanosheets synthesized from urea in Ar atmosphere were investigated in detail by using x-ray diffraction (XRD) analysis, scanning electron microscopy (SEM), X-ray photoelectron spectroscopy (XPS), Brunauer-Emmett-Teller (BET), Fourier transform infrared spectroscopy (FTIR), UV-vis absorption, and photoluminescence (PL). It was found that the preparation temperature had a great effect on structure and physical properties of g-C3N4. As the processing temperature increased from 450 °C to 650 °C, the interlayer stacking distance of g-C3N4 decreased from 3.281 Å to 3.217 Å and the lattice parameter a decreased from 5.010 Å to 4.934 Å. This indicated a denser packing fashion of g-C3N4 at high annealing temperature. Moreover, the FTIR spectra and SEM images revealed a large fraction of small polymer segments containing only a few heptazine units as annealing temperature increased. BET result indicated an increasing specific surface area as preparation temperature increased. UV-vis absorption spectra showed a decrease of the band gap energy with increasing calcination temperature which agrees well with the measured PL spectra. It was demonstrated that samples annealed at 550 °C exhibited the strongest photocatalytic activity. A decomposition of 80% and 100% of rhodamine B was obtained within respectively 1 h and 2 h under Xenon lamp irradiation. Photocatalytic result could be adequately explained based on evidences of specific surface area, average pore volume and pore size, and recombination rate of photoinduced electron-hole pairs.

Human telomeric DNA: G-quadruplex, i-motif and Watson–Crick double helix

PubMed Central

Phan, Anh Tuân; Mergny, Jean-Louis

2002-01-01

Human telomeric DNA composed of (TTAGGG/CCCTAA)n repeats may form a classical Watson–Crick double helix. Each individual strand is also prone to quadruplex formation: the G-rich strand may adopt a G-quadruplex conformation involving G-quartets whereas the C-rich strand may fold into an i-motif based on intercalated C·C+ base pairs. Using an equimolar mixture of the telomeric oligonucleotides d[AGGG(TTAGGG)3] and d[(CCCTAA)3CCCT], we defined which structures existed and which would be the predominant species under a variety of experimental conditions. Under near-physiological conditions of pH, temperature and salt concentration, telomeric DNA was predominantly in a double-helix form. However, at lower pH values or higher temperatures, the G-quadruplex and/or the i-motif efficiently competed with the duplex. We also present kinetic and thermodynamic data for duplex association and for G-quadruplex/i-motif unfolding. PMID:12409451

Self-organisation of an oligodeoxynucleotide containing the G- and C-rich stretches of the direct repeats of the human mitochondrial DNA.

PubMed

Nonin-Lecomte, Sylvie; Dardel, Frédéric; Lestienne, Patrick

2005-08-01

Stretches of cytosines and guanosines have been shown in vitro to adopt non-canonical structures known as i-motifs and G-quartets, respectively. When combined, such sequences are expected to either retain their structure or form duplexes or triple helices. All these structures may occur in vivo whenever the sequence criteria are met. Such stretches are present in the circular genome of human mitochondria, as two 10 nucleotide-long perfect tandem direct repeats (DR1 and DR2). The DR1 and DR2 repeats are G-rich on the heavy strand and C-rich on the light strand. Previous results suggested that during replication, transient formation of a parallel GGC triple helix between the neo-synthesised G-rich DR1 and the double-stranded homologous DR2 could be involved in a rearrangement process leading to genome instability. In order to get structural insights into the interaction between the two repeats, we have studied by nuclear magnetic resonance (NMR) the assembly properties of a 24-mer oligodeoxyribonucleotide in which the C- and G-rich segments of the DRs are covalently tethered by a TTTT linker. We show here that this 24-mer self-associates into a triplex-containing symmetrical tetramer. The core of the structure is composed of anti-parallel Watson-Crick (WC) base pairs. Two additional strands are hydrogen-bonded to the Hoogsteen side of the Gs, thus forming CGC(+) triple helices, with G-rich ends folding into G-quartets. These results suggest that such structures could occur when the two DRs are put to close proximity in a biological context.

Modified nucleotides reveal the indirect role of the central base pairs in stabilizing the lac repressor-operator complex.

PubMed Central

Zhang, X; Gottlieb, P A

1995-01-01

Guanine residues in the lac operator were replaced by 2-aminopurine or purine analogues, pairing the modified nucleotides with C. The observed equilibrium dissociation constants for lac repressor binding to substituted operators were measured in 10 mM Tris, 150 mM KCl, 0.1 mM EDTA, 0.1 mM DTE, pH 7.6 at 25 degrees C. These measurements revealed five positions that destabilized the complex when substituted with either analogue. Two positions, which are related by a 2-fold symmetry, are in the major groove of the operator thought to directly interact with the protein. Three sites were in the central region of the operator. A purine analogue at a sixth site perturbed the local DNA structure and destabilized the complex. Alkylation interference experiments of the 2-aminopurine substituted operators demonstrated that, of the five affected, two substitutions displayed altered phosphate interference patterns at the phosphate adjacent to the substituted base. For these operators, complex formation was measured in different concentrations of KCl to assess the contribution of counterion release to the bimolecular process. The results indicated that both complexes were similar to wild-type, although minor changes were observed. The Kobs of the complex was then measured when 2-aminopurine or purine analogues were paired with uracil nucleotide, a base pair that serves to stabilize the DNA. The introduction of the new base pairs revealed two effects on the bimolecular interaction. For those operator sites that are thought to perturb the interaction directly, the affinity of the complex was weakened to levels observed for the singly-substituted operators. In contrast, the nucleotides of 2-aminopurine paired with uracil positioned in the central region of the operator served to enhance the stability of the complex. The purine-uracil base pair substitution on the other hand had a significant destabilizing effect on the interaction. We propose that the central base pairs modulate

Comparison of the Specificities of IgG, IgG-Subclass, IgA and IgM Reactivities in African and European HIV-Infected Individuals with an HIV-1 Clade C Proteome-Based Array

PubMed Central

Gallerano, Daniela; Ndlovu, Portia; Makupe, Ian; Focke-Tejkl, Margarete; Fauland, Kerstin; Wollmann, Eva; Puchhammer-Stöckl, Elisabeth; Keller, Walter; Sibanda, Elopy; Valenta, Rudolf

2015-01-01

A comprehensive set of recombinant proteins and peptides of the proteome of HIV-1 clade C was prepared and purified and used to measure IgG, IgG-subclass, IgA and IgM responses in HIV-infected patients from Sub-Saharan Africa, where clade C is predominant. As a comparison group, HIV-infected patients from Europe were tested. African and European patients showed an almost identical antibody reactivity profile in terms of epitope specificity and involvement of IgG, IgG subclass, IgA and IgM responses. A V3-peptide of gp120 was identified as major epitope recognized by IgG1>IgG2 = IgG4>IgG3, IgA>IgM antibodies and a C-terminal peptide represented another major peptide epitope for the four IgG subclasses. By contrast, gp41-derived-peptides were mainly recognized by IgG1 but not by the other IgG subclasses, IgA or IgM. Among the non-surface proteins, protease, reverse transcriptase+RNAseH, integrase, as well as the capsid and matrix proteins were the most frequently and strongly recognized antigens which showed broad IgG subclass and IgA reactivity. Specificities and magnitudes of antibody responses in African patients were stable during disease and antiretroviral treatment, and persisted despite severe T cell loss. Using a comprehensive panel of gp120, gp41 peptides and recombinant non-surface proteins of HIV-1 clade C we found an almost identical antibody recognition profile in African and European patients regarding epitopes and involved IgG-sublass, IgA- and IgM-responses. Immune recognition of gp120 peptides and non-surface proteins involved all four IgG subclasses and was indicative of a mixed Th1/Th2 immune response. The HIV-1 clade C proteome-based test allowed diagnosis and monitoring of antibody responses in the course of HIV-infections and assessment of isotype and subclass responses. PMID:25658330

Variation in social systems within Chaetodon butterflyfishes, with special reference to pair bonding.

PubMed

Nowicki, Jessica P; O'Connell, Lauren A; Cowman, Peter F; Walker, Stefan P W; Coker, Darren J; Pratchett, Morgan S

2018-01-01

For many animals, affiliative relationships such as pair bonds form the foundation of society and are highly adaptive. Animal systems amenable for comparatively studying pair bonding are important for identifying underlying biological mechanisms, but mostly exist in mammals. Better establishing fish systems will enable comparison of pair bonding mechanisms across taxonomically distant lineages that may reveal general underlying mechanistic principles. We examined the utility of wild butterflyfishes (f: Chaetodontidae; g: Chaetodon) for comparatively studying pair bonding. Using stochastic character mapping, we provide the first analysis of the evolutionary history of butterflyfish sociality, revealing that pairing is ancestral, with at least seven independent transitions to gregarious grouping and solitary behavior since the late Miocene. We then formally verified social systems in six sympatric and wide-spread species representing a clade with one ancestrally reconstructed transition from paired to solitary grouping at Lizard Island, Australia. In situ observations of the size, selective affiliation and aggression, fidelity, and sex composition of social groups confirmed that Chaetodon baronessa, C. lunulatus, and C. vagabundus are predominantly pair bonding, whereas C. rainfordi, C. plebeius, and C. trifascialis are predominantly solitary. Even in the predominantly pair bonding species, C. lunulatus, a proportion of adults (15%) are solitary. Importantly, inter- and intra-specific differences in social systems do not co-vary with other previously established attributes, including parental care. Hence, the proposed butterflyfish populations are promising for inter- and intra-species comparative analyses of pair bonding and its mechanistic underpinnings. Avenues for further developing the system are proposed, including determining whether the aforementioned utility of these species applies across their geographic disruptions.

Variation in social systems within Chaetodon butterflyfishes, with special reference to pair bonding

PubMed Central

O’Connell, Lauren A.; Cowman, Peter F.; Walker, Stefan P. W.; Coker, Darren J.; Pratchett, Morgan S.

2018-01-01

For many animals, affiliative relationships such as pair bonds form the foundation of society and are highly adaptive. Animal systems amenable for comparatively studying pair bonding are important for identifying underlying biological mechanisms, but mostly exist in mammals. Better establishing fish systems will enable comparison of pair bonding mechanisms across taxonomically distant lineages that may reveal general underlying mechanistic principles. We examined the utility of wild butterflyfishes (f: Chaetodontidae; g: Chaetodon) for comparatively studying pair bonding. Using stochastic character mapping, we provide the first analysis of the evolutionary history of butterflyfish sociality, revealing that pairing is ancestral, with at least seven independent transitions to gregarious grouping and solitary behavior since the late Miocene. We then formally verified social systems in six sympatric and wide-spread species representing a clade with one ancestrally reconstructed transition from paired to solitary grouping at Lizard Island, Australia. In situ observations of the size, selective affiliation and aggression, fidelity, and sex composition of social groups confirmed that Chaetodon baronessa, C. lunulatus, and C. vagabundus are predominantly pair bonding, whereas C. rainfordi, C. plebeius, and C. trifascialis are predominantly solitary. Even in the predominantly pair bonding species, C. lunulatus, a proportion of adults (15%) are solitary. Importantly, inter- and intra-specific differences in social systems do not co-vary with other previously established attributes, including parental care. Hence, the proposed butterflyfish populations are promising for inter- and intra-species comparative analyses of pair bonding and its mechanistic underpinnings. Avenues for further developing the system are proposed, including determining whether the aforementioned utility of these species applies across their geographic disruptions. PMID:29641529

An efficient and near linear scaling pair natural orbital based local coupled cluster method.

PubMed

Riplinger, Christoph; Neese, Frank

2013-01-21

In previous publications, it was shown that an efficient local coupled cluster method with single- and double excitations can be based on the concept of pair natural orbitals (PNOs) [F. Neese, A. Hansen, and D. G. Liakos, J. Chem. Phys. 131, 064103 (2009)]. The resulting local pair natural orbital-coupled-cluster single double (LPNO-CCSD) method has since been proven to be highly reliable and efficient. For large molecules, the number of amplitudes to be determined is reduced by a factor of 10(5)-10(6) relative to a canonical CCSD calculation on the same system with the same basis set. In the original method, the PNOs were expanded in the set of canonical virtual orbitals and single excitations were not truncated. This led to a number of fifth order scaling steps that eventually rendered the method computationally expensive for large molecules (e.g., >100 atoms). In the present work, these limitations are overcome by a complete redesign of the LPNO-CCSD method. The new method is based on the combination of the concepts of PNOs and projected atomic orbitals (PAOs). Thus, each PNO is expanded in a set of PAOs that in turn belong to a given electron pair specific domain. In this way, it is possible to fully exploit locality while maintaining the extremely high compactness of the original LPNO-CCSD wavefunction. No terms are dropped from the CCSD equations and domains are chosen conservatively. The correlation energy loss due to the domains remains below <0.05%, which implies typically 15-20 but occasionally up to 30 atoms per domain on average. The new method has been given the acronym DLPNO-CCSD ("domain based LPNO-CCSD"). The method is nearly linear scaling with respect to system size. The original LPNO-CCSD method had three adjustable truncation thresholds that were chosen conservatively and do not need to be changed for actual applications. In the present treatment, no additional truncation parameters have been introduced. Any additional truncation is performed on

Nanocomposite of exfoliated bentonite/g-C3N4/Ag3PO4 for enhanced visible-light photocatalytic decomposition of Rhodamine B.

PubMed

Ma, Jianfeng; Huang, Daiqin; Zhang, Wenyi; Zou, Jing; Kong, Yong; Zhu, Jianxi; Komarneni, Sridhar

2016-11-01

Novel visible-light-driven heterojunction photocatalyst comprising exfoliated bentonite, g-C3N4 and Ag3PO4 (EB/g-C3N4/Ag3PO4) was synthesized by a facile and green method. The composites EB/g-C3N4/Ag3PO4 were characterized by X-ray diffraction, Transmission electron microscopy, Fourier transform infrared spectroscopy, UV-Vis diffuse reflectance spectroscopy and the Brunauer, Emmett, and Teller (BET) surface area method. Under visible light irradiation, EB/g-C3N4/Ag3PO4 composites displayed much higher photocatalytic activity than that of either pure g-C3N4 or pure Ag3PO4 in the degradation of Rhodamine B (RhB). Among the hybrid photocatalysts, EB/g-C3N4/Ag3PO4 composite containing 20 wt% Ag3PO4 exhibited the highest photocatalytic activity for the decolorization of RhB. Under the visible-light irradiation, the RhB dye was completely decolorized in less than 60 min. The enhanced photocatalytic performance is attributed to the stable structure, enlarged surface area, strong adsorbability, strong light absorption ability, and high-efficiency separation rate of photoinduced electron-hole pairs. Our finding paves a way to design highly efficient and stable visible-light-induced photocatalysts for practical applications in wastewater treatment. Copyright © 2016 Elsevier Ltd. All rights reserved.

Hemolysis and Mediterranean G6PD mutation (c.563 C>T) and c.1311 C>T polymorphism among Palestinians at Gaza Strip.

PubMed

Sirdah, Mahmoud; Reading, N Scott; Perkins, Sherrie L; Shubair, Mohammad; Aboud, Lina; Prchal, Josef T

2012-04-15

The G6PD c.563 C>T deficient mutation is endemic among Mediterranean populations but its clinical significance is not well delineated. We set up to estimate the proportion of G6PD deficient children presenting with hemolytic anemia at Al Nasser Pediatric Hospital at Gaza Strip, Palestine. We then established the prevalence of c.563T Mediterranean mutation and its linkage to c.1311 C>T polymorphism in this population. G6PD deficiency was identified in children presenting with hemolytic anemia at Al Nasser Pediatric Hospital by spectrophotometric measurement of G6PD activity. G6PD exon 6 and exon 11 were amplified from genomic DNA and evaluated for c.563T mutation by sequencing and the c.1311T polymorphism by restriction fragment analysis. Seventy X-chromosomes (60 males and 5 females) from G6PD deficient patients and 40 X-chromosomes from a control group known to be not G6PD deficient were tested. Over 80% of these children presenting with hemolytic anemia were G6PD deficient and 34% of these had the Mediterranean G6PD deficient variant. The allelic frequencies of Mediterranean c.563T and c.1311T polymorphisms among G6PD deficient patients were 0.33 and 0.38 respectively. The c.1311T polymorphism was linked in 95.2% of patients with the Mediterranean mutation, an allele frequency of 0.87, compared to the control non-G6PD deficient group with an allele frequency of 0.18. We conclude that G6PD deficiency accounts for majority of hemolytic anemia encountered in Gaza children treated at Al Nasser Pediatric Hospital Emergency department. The Mediterranean mutation c.563T, while not accounting for a majority of G6PD deficiency, is common among G6PD deficient Gaza Strip Palestinians and is frequently, but not always, linked to the c.1311T polymorphism. This work provides a foundation for the population screening of Palestinians for G6PD deficiency and for investigations of ancestral origin of the Mediterranean variant in world populations. Copyright © 2012 Elsevier Inc

Understanding Fomalhaut as a Cooper pair

NASA Astrophysics Data System (ADS)

Feng, F.; Jones, H. R. A.

2018-03-01

Fomalhaut is a nearby stellar system and has been found to be a triple based on astrometric observations. With new radial velocity and astrometric data, we study the association between Fomalhaut A, B, and C in a Bayesian framework, finding that the system is gravitationally bound or at least associated. Based on simulations of the system, we find that Fomalhaut C can be easily destabilized through combined perturbations from the Galactic tide and stellar encounters. Considering that observing the disruption of a triple is probably rare in the solar neighbourhood, we conclude that Fomalhaut C is a so-called `gravitational pair' of Fomalhaut A and B. Like the Cooper pair mechanism in superconductors, this phenomenon only appears once the orbital energy of a component becomes comparable with the energy fluctuations caused by the environment. Based on our simulations, we find (1) an upper limit of 8 km s-1 velocity difference is appropriate when selecting binary candidates, and (2) an empirical formula for the escape radius, which is more appropriate than tidal radius when measuring the stability of wide binaries.

NMR solution structure of an N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: Intercalation from the minor groove with ruptured Watson-Crick base pairing

PubMed Central

Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H.; Cai, Yuqin; Rodriguez, Fabian A.; Sayer, Jane M.; Jerina, Donald M.; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.

2012-01-01

The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the non-planar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely-studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14-position with the exocyclic amino group of guanine. Here, we present the first NMR solution structure of a DB[a,l]P-derived adduct, the 14R (+)-trans-anti-DB[a,l]P–N2-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N2-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3’-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3’-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE - DNA adduct conformation differs from: (1) the classical intercalation motif where Watson-Crick base-pairing is intact at the lesion site, and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix . The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed. PMID:23121427

Inhibiting Polysulfide Shuttle in Lithium-Sulfur Batteries through Low-Ion-Pairing Salts and a Triflamide Solvent.

PubMed

Shyamsunder, Abhinandan; Beichel, Witali; Klose, Petra; Pang, Quan; Scherer, Harald; Hoffmann, Anke; Murphy, Graham K; Krossing, Ingo; Nazar, Linda F

2017-05-22

The step-change in gravimetric energy density needed for electrochemical energy storage devices to power unmanned autonomous vehicles, electric vehicles, and enable low-cost clean grid storage is unlikely to be provided by conventional lithium ion batteries. Lithium-sulfur batteries comprising lightweight elements provide a promising alternative, but the associated polysulfide shuttle in typical ether-based electrolytes generates loss in capacity and low coulombic efficiency. The first new electrolyte based on a unique combination of a relatively hydrophobic sulfonamide solvent and a low ion-pairing salt, which inhibits the polysulfide shuttle, is presented. This system behaves as a sparingly solvating electrolyte at slightly elevated temperatures, where it sustains reversible capacities as high as 1200-1500 mAh g -1 over a wide range of current density (2C-C/5, respectively) when paired with a lithium metal anode, with a coulombic efficiency of >99.7 % in the absence of LiNO 3 additive. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Molecular dynamics study of some non-hydrogen-bonding base pair DNA strands

NASA Astrophysics Data System (ADS)

Tiwari, Rakesh K.; Ojha, Rajendra P.; Tiwari, Gargi; Pandey, Vishnudatt; Mall, Vijaysree

2018-05-01

In order to elucidate the structural activity of hydrophobic modified DNA, the DMMO2-D5SICS, base pair is introduced as a constituent in different set of 12-mer and 14-mer DNA sequences for the molecular dynamics (MD) simulation in explicit water solvent. AMBER 14 force field was employed for each set of duplex during the 200ns production-dynamics simulation in orthogonal-box-water solvent by the Particle-Mesh-Ewald (PME) method in infinite periodic boundary conditions (PBC) to determine conformational parameters of the complex. The force-field parameters of modified base-pair were calculated by Gaussian-code using Hartree-Fock /ab-initio methodology. RMSD Results reveal that the conformation of the duplex is sequence dependent and the binding energy of the complex depends on the position of the modified base-pair in the nucleic acid strand. We found that non-bonding energy had a significant contribution to stabilising such type of duplex in comparison to electrostatic energy. The distortion produced within strands by such type of base-pair was local and destabilised the duplex integrity near to substitution, moreover the binding energy of duplex depends on the position of substitution of hydrophobic base-pair and the DNA sequence and strongly supports the corresponding experimental study.

Development of a novel method to determine the concentration of heavy metal cations: application of the specific interaction between heavy metal cation and mismatch DNA base pair.

PubMed

Kozasa, Tetsuo; Miyakawa, Yukako; Fukushi, Miyako; Ono, Akira; Torigoe, Hidetaka

2009-01-01

We have already found that Hg(II) cation specifically binds to T:T mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving T:T mismatch base pair by about 4 degrees C. We have also found that Ag(I) cation specifically binds to C:C mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving C:C mismatch base pair by about 4 degrees C. Using the specific interaction, we developed a novel sensor to determine the concentration of each of Hg(II) and Ag(I) cation. The sensor is composed of a dye-labelled T-rich or C-rich DNA oligonucleotide, F2T6W2D: 5'-Fam-T(2)CT(2)CT(2)C(4)T(2)GT(2)GT(2)-Dabcyl-3' or F2C6W2D: 5'-Fam-C(2)TC(2)TC(2)T(4)C(2)AC(2)AC(2)-Dabcyl-3', where 6-carboxyfluorescein (Fam) is a fluorophore and Dabcyl is a quencher. The addition of Hg(II) cation decreased the intensity of Fam emission of F2T6W2D at 520 nm in a concentration-dependent manner. Also, the addition of Ag(I) cation decreased the intensity of Fam emission of F2C6W2D at 520 nm in a concentration-dependent manner. We conclude that, using the novel sensor developed in this study, the concentration of each of Hg(II) and Ag(I) cation can be determined from the intensity of Fam emission at 520 nm.

Compound Heterozygosity for Hb Alperton (HBB: c.407C>T) and IVS-I-5 (G>C) (HBB: c.92+5G>C) Mutations Presenting as a Moderate Anemia in an Indian Family.

PubMed

Godbole, Koumudi G; Ramachandran, Angelina; Karkamkar, Ashwini S; Dalal, Ashwin B

2018-04-13

While knowledge of HBB gene mutations is necessary for offering prenatal diagnosis (PND) of β-thalassemia (β-thal), a genotype-phenotype correlation may not always be available for rare variants. We present for the first time, genotype-phenotype correlation for a compound heterozygous status with IVS-I-5 (G>C) (HBB: c.92+5G>C) and HBB: c.407C>T (Hb Alperton) mutations on the HBB gene in an Indian family. Hb Alperton is a very rare hemoglobin (Hb) variant with scant published information about its clinical presentation, especially when accompanied with another HBB gene mutation. Here we provide biochemical as well as clinical details of this variant.

The use of molecular dynamics simulations to evaluate the DNA sequence-selectivity of G-A cross-linking PBD-duocarmycin dimers.

PubMed

Jackson, Paul J M; Rahman, Khondaker M; Thurston, David E

2017-01-01

The pyrrolobenzodiazepine (PBD) and duocarmycin families are DNA-interactive agents that covalently bond to guanine (G) and adenine (A) bases, respectively, and that have been joined together to create synthetic dimers capable of cross-linking G-G, A-A, and G-A bases. Three G-A alkylating dimers have been reported in publications to date, with defined DNA-binding sites proposed for two of them. In this study we have used molecular dynamics simulations to elucidate preferred DNA-binding sites for the three published molecular types. For the PBD-CPI dimer UTA-6026 (1), our simulations correctly predicted its favoured binding site (i.e., 5'-C(G)AATTA-3') as identified by DNA cleavage studies. However, for the PBD-CI molecule ('Compound 11', 3), we were unable to reconcile the results of our simulations with the reported preferred cross-linking sequence (5'-ATTTTCC(G)-3'). We found that the molecule is too short to span the five base pairs between the A and G bases as claimed, but should target instead a sequence such as 5'-ATTTC(G)-3' with two less base pairs between the reacting G and A residues. Our simulation results for this hybrid dimer are also in accord with the very low interstrand cross-linking and in vitro cytotoxicity activities reported for it. Although a preferred cross-linking sequence was not reported for the third hybrid dimer ('27eS', 2), our simulations predict that it should span two base pairs between covalently reacting G and A bases (e.g., 5'-GTAT(A)-3'). Copyright © 2016. Published by Elsevier Ltd.

An ingenious strategy of preparing TiO2/g-C3N4 heterojunction photocatalyst: In situ growth of TiO2 nanocrystals on g-C3N4 nanosheets via impregnation-calcination method

NASA Astrophysics Data System (ADS)

Zhang, Guanghui; Zhang, Tianyong; Li, Bin; Jiang, Shuang; Zhang, Xia; Hai, Li; Chen, Xingwei; Wu, Wubin

2018-03-01

An ingenious method was employed to design and fabricate the TiO2/g-C3N4 heterojunction photocatalysts in this study. The thermal oxidation etching of g-C3N4 nanosheets and the in situ growth of TiO2 nanocrystal on the surface of g-C3N4 nanosheets were completed simultaneously by the calcination process. The g-C3N4 nanosheets played a crucial role in regulating and assembling the structures and morphologies of TiO2. Furthermore, the thickness and content of g-C3N4, and the crystallinity of TiO2 in TiO2/g-C3N4 composites could be regulated and controlled by the calcination temperature. Among the resultant TiO2/g-C3N4 samples, the TiO2/g-C3N4 sample with 41.6 wt% g-C3N4 exhibited the highest photocatalytic activity. It could degrade almost all MO molecules under visible light irradiation within 3 h. Moreover, it displayed higher visible light photocatalytic performance for degrading MO solution than pure g-C3N4 and D-TiO2. The synergistic effect between TiO2 and g-C3N4 makes significant contributions to the enhancement of the visible light photocatalytic activity. In addition, the favorable photocatalytic performance of TiO2/g-C3N4 nanocomposites is also attributed to the porous structures and uniform morphologies, and large surface area. Furthermore, the resultant TiO2/g-C3N4 exhibits excellent photocatalytic stability. Radical trapping experiments indicated that rad O2- and h+ were the main reactive species during the photodegradation process under visible light irradiation. Hopefully, the results can offer new design and strategy for preparing other g-C3N4-based nanocomposites for environmental and energy applications.

A fully synthetic human Fab antibody library based on fixed VH/VL framework pairings with favorable biophysical properties

PubMed Central

Tiller, Thomas; Schuster, Ingrid; Deppe, Dorothée; Siegers, Katja; Strohner, Ralf; Herrmann, Tanja; Berenguer, Marion; Poujol, Dominique; Stehle, Jennifer; Stark, Yvonne; Heßling, Martin; Daubert, Daniela; Felderer, Karin; Kaden, Stefan; Kölln, Johanna; Enzelberger, Markus; Urlinger, Stefanie

2013-01-01

This report describes the design, generation and testing of Ylanthia, a fully synthetic human Fab antibody library with 1.3E+11 clones. Ylanthia comprises 36 fixed immunoglobulin (Ig) variable heavy (VH)/variable light (VL) chain pairs, which cover a broad range of canonical complementarity-determining region (CDR) structures. The variable Ig heavy and Ig light (VH/VL) chain pairs were selected for biophysical characteristics favorable to manufacturing and development. The selection process included multiple parameters, e.g., assessment of protein expression yield, thermal stability and aggregation propensity in fragment antigen binding (Fab) and IgG1 formats, and relative Fab display rate on phage. The framework regions are fixed and the diversified CDRs were designed based on a systematic analysis of a large set of rearranged human antibody sequences. Care was taken to minimize the occurrence of potential posttranslational modification sites within the CDRs. Phage selection was performed against various antigens and unique antibodies with excellent biophysical properties were isolated. Our results confirm that quality can be built into an antibody library by prudent selection of unmodified, fully human VH/VL pairs as scaffolds. PMID:23571156

Designed Synthesis of Mesoporous Solid-Supported Lewis Acid-Base Pairs and Their CO2 Adsorption Behaviors.

PubMed

Zakharova, Maria V; Masoumifard, Nima; Hu, Yimu; Han, Jongho; Kleitz, Freddy; Fontaine, Frédéric-Georges

2018-04-18

Conventional amines and phosphines, such as diethylenetriamine, diphenylpropylphosphine, triethylamine, and tetramethylpiperidine, were grafted or impregnated on the surface of metalated SBA-15 materials, such as Ti-, Al-, and Zr-SBA-15, to generate air-stable solid-supported Lewis acid-base pairs. The Lewis acidity of the metalated materials before and after the introduction of Lewis bases was verified by means of pyridine adsorption-Fourier transform infrared spectroscopy. Detailed characterization of the materials was achieved by solid-state 13 C and 31 P MAS NMR spectroscopy, low-temperature N 2 physisorption, X-ray photoelectron spectroscopy, and energy-dispersive X-ray mapping analyses. Study of their potential interactions with CO 2 was performed using CO 2 adsorption isotherm experiments, which provided new insights into their applicability as solid CO 2 adsorbents. A correlation between solid-supported Lewis acid-base pair strength and the resulting affinity to CO 2 is discussed based on the calculation of isosteric enthalpy of adsorption.

40 CFR Appendixes C-G to Part 80 - [Reserved

Code of Federal Regulations, 2011 CFR

2011-07-01

... 40 Protection of Environment 16 2011-07-01 2011-07-01 false [Reserved] C Appendixes C-G to Part 80 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) REGULATION OF FUELS AND FUEL ADDITIVES Appendixes C-G to Part 80 [Reserved] ...

40 CFR Appendixes C-G to Part 80 - [Reserved

Code of Federal Regulations, 2010 CFR

2010-07-01

... 40 Protection of Environment 16 2010-07-01 2010-07-01 false [Reserved] C Appendixes C-G to Part 80 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) REGULATION OF FUELS AND FUEL ADDITIVES Appendixes C-G to Part 80 [Reserved] ...

Association of COX-2 Promoter Polymorphisms -765G/C and -1195A/G with Migraine.

PubMed

Mozaffari, Elahe; Doosti, Abbas; Arshi, Asghar; Faghani, Mostafa

2016-12-01

Migraine is a common debilitating primary headache disorder with current head pain attacks, which contributes to physical activity dysfunctions in chronic pain phase. PGE2 and PGI2 are two important prostaglandins synthesised by COX-2 enzymes, involved in migraine pain signals. COX-2 modulation is essential in treatment and pathogenesis of migraine. This study aimed to investigating the association between COX-2 gene polymorphisms with the risk of migraine susceptibility in migraine patients with related and unrelated parents. This case- control study was based on 100 migraine patients and 100 non-migraine subjects in Bushehr province, Iran in 2013. Genomic DNA of blood samples was extracted and genotyping of COX-2-765G>C (rs20417) and COX-2-1195A>G (rs689466) gene variants was investigated by PCR-RFLP method. Statistical analyses were accomplished using the SPSS software package. There was a significant differences in the frequencies of the COX-2-765G>C and COX-2-1195A>G genotypes between migraine patients and controls ( P ≤0.05). COX-2-765CC , COX-2-765CG , COX-2-1195GG and COX-2-1195AG genotypes can increase the risk of migraine significantly. As the first study in Iran, we are hopeful to achieve greater results about the relevancy of COX-2 gene, migraine and pain signals pathway by repeating these experiments on more samples.

PAIRS, The GIS-Based Incident Response System for Pennsylvania, and NASA

NASA Technical Reports Server (NTRS)

Conrad, Eric; Arbegast, Daniel; Maynard, Nancy; Vicente, Gilberto

2003-01-01

Over the past several years the Pennsylvania Departments of Environmental Protection (DEP), Health (DOH), and Agriculture (PDA) built the GIs-based Pennsylvania West Nile Surveillance System. That system has become a model for collecting data that has a field component, laboratory component, reporting and mapping component, and a public information component. Given the success of the West Nile Virus System and the events of September 11, 2001, DEP then embarked on the development of the Pennsylvania Incident Response System, or PAIRS. PAIRS is an effective GIs-based approach to providing a system for response to incidents of any kind, including terrorism because it is building upon the existing experience, infrastructure and databases that were successfully developed to respond to the West Nile Virus by DEP, DOH, and PDA. The proposed system can be described as one that supports data acquisition, laboratory forensics, decision making/response, and communications. Decision makers will have tools to view and analyze data from various sources and, at the same time, to communicate with the large numbers of people responding to the same incident. Recent collaborations with NASA partners are creating mechanisms for the PAIRS system to incorporate space-based and other remote sensing geophysical parameters relevant to public health assessment and management, such as surface temperatures, precipitation, land cover/land use change, and humidity. This presentation will describe the PAIRS system and outline the Pennsylvania-NASA collaboration for integration of space-based data into the PAIRS system.

Developing Topological Insulator Fiber Based Photon Pairs Source for Ultrafast Optoelectronic Applications

DTIC Science & Technology

2016-04-01

DEVELOPING TOPOLOGICAL INSULATOR FIBER BASED PHOTON PAIRS SOURCE FOR ULTRAFAST OPTOELECTRONIC APPLICATIONS NORTHWESTERN UNIVERSITY...REPORT TYPE FINAL TECHNICAL REPORT 3. DATES COVERED (From - To) APRIL 2015 – DEC 2015 4. TITLE AND SUBTITLE DEVELOPING TOPOLOGICAL INSULATOR FIBER BASED...in developing a new source for the production of correlated/entangled photon pairs based on the unique nanolayer properties of topological insulator

21 CFR 522.1696c - Penicillin G procaine in oil.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 21 Food and Drugs 6 2012-04-01 2012-04-01 false Penicillin G procaine in oil. 522.1696c Section... § 522.1696c Penicillin G procaine in oil. (a) Specifications. Each milliliter contains penicillin G procaine equivalent to 300,000 units of penicillin G. (b) Sponsor. See No. 053501 in § 510.600(c) of this...

21 CFR 522.1696c - Penicillin G procaine in oil.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 21 Food and Drugs 6 2014-04-01 2014-04-01 false Penicillin G procaine in oil. 522.1696c Section... § 522.1696c Penicillin G procaine in oil. (a) Specifications. Each milliliter contains penicillin G procaine equivalent to 300,000 units of penicillin G. (b) Sponsor. See No. 054771 in § 510.600(c) of this...

21 CFR 522.1696c - Penicillin G procaine in oil.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Penicillin G procaine in oil. 522.1696c Section... § 522.1696c Penicillin G procaine in oil. (a) Specifications. Each milliliter contains penicillin G procaine equivalent to 300,000 units of penicillin G. (b) Sponsor. See No. 053501 in § 510.600(c) of this...

21 CFR 522.1696c - Penicillin G procaine in oil.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Penicillin G procaine in oil. 522.1696c Section... § 522.1696c Penicillin G procaine in oil. (a) Specifications. Each milliliter contains penicillin G procaine equivalent to 300,000 units of penicillin G. (b) Sponsor. See No. 053501 in § 510.600(c) of this...

21 CFR 522.1696c - Penicillin G procaine in oil.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 21 Food and Drugs 6 2011-04-01 2011-04-01 false Penicillin G procaine in oil. 522.1696c Section... § 522.1696c Penicillin G procaine in oil. (a) Specifications. Each milliliter contains penicillin G procaine equivalent to 300,000 units of penicillin G. (b) Sponsor. See No. 053501 in § 510.600(c) of this...

The carriers of the A/G-G/G allelic combination of the c.2039 A>G and c.-29 G>A FSH receptor polymorphisms retrieve the highest number of oocytes in IVF/ICSI cycles.

PubMed

Allegra, Adolfo; Marino, Angelo; Raimondo, Stefania; Maiorana, Antonio; Gullo, Salvatore; Scaglione, Piero; Volpes, Aldo; Alessandro, Riccardo

2017-02-01

The objective of this study was the elucidation of the possible role of the single-nucleotide polymorphisms (SNP) at position -29 and 2039 of the FSH receptor gene (FSHR) as independent predictive markers of ovarian response. Indeed, the tailoring of reproductive treatments is crucial for both maximizing the success of IVF patients and obtaining a reduction in hypo- or hyper-response rates. This prospective, observational study analyzed the association of -29 and 2039 FSHR polymorphisms with the number of retrieved oocytes in 140 patients attending an IVF/ICSI cycle for severe male factors (≤5,000,000 spermatozoa/mL) or tubal factors at the ANDROS Day Surgery Clinic, Palermo, Italy. The results of this study demonstrate that the genetic combination of A/G for polymorphism c.2039 A>G with G/G for polymorphism c.-29 G>A is significantly associated with the highest number of collected oocytes (p = 0.03). This association was significant even after controlling for the effect of other clinical variables. The A/G-G/G allelic variant, identified as an independent variable, if confirmed in a larger number of patients, could be considered as a new genetic biomarker, which could increase the efficacy of prediction models for ovarian stimulation.

A double chain reversal loop and two diagonal loops define the architecture of a unimolecular DNA quadruplex containing a pair of stacked G(syn)-G(syn)-G(anti)-G(anti) tetrads flanked by a G-(T-T) Triad and a T-T-T triple.

PubMed

Kuryavyi, V; Majumdar, A; Shallop, A; Chernichenko, N; Skripkin, E; Jones, R; Patel, D J

2001-06-29

The architecture of G-G-G-G tetrad-aligned DNA quadruplexes in monovalent cation solution is dependent on the directionality of the four strands, which in turn are defined by loop connectivities and the guanine syn/anti distribution along individual strands and within individual G-G-G-G tetrads. The smallest unimolecular G-quadruplex belongs to the d(G2NnG2NnG2NnG2) family, which has the potential to form two stacked G-tetrads linked by Nn loop connectivities. Previous studies have focused on the thrombin-binding DNA aptamer d(G2T2G2TGTG2T2G2), where Nn was T2 for the first and third connecting loops and TGT for the middle connecting loop. This DNA aptamer in K(+) cation solution forms a unimolecular G-quadruplex stabilized by two stacked G(syn)-G(anti)-G(syn)-G(anti) tetrads, adjacent strands which are antiparallel to each other and edge-wise connecting T2, TGT and T2 loops. We now report on the NMR-based solution structure of the d(G2T4G2CAG2GT4G2T) sequence, which differs from the thrombin-binding DNA aptamer sequence in having longer first (T4) and third (GT4) loops and a shorter (CA) middle loop. This d(G2T4G2CAG2GT4G2T) sequence in Na(+) cation solution forms a unimolecular G-quadruplex stabilized by two stacked G(syn)-G(syn)-G(anti)-G(anti) tetrads, adjacent strands which have one parallel and one antiparallel neighbors and distinct non-edge-wise loop connectivities. Specifically, the longer first (T4) and third (GT4) loops are of the diagonal type while the shorter middle loop is of the double chain reversal type. In addition, the pair of stacked G-G-G-G tetrads are flanked on one side by a G-(T-T) triad and on the other side by a T-T-T triple. The distinct differences in strand directionalities, loop connectivities and syn/anti distribution within G-G-G-G tetrads between the thrombin-binding DNA aptamer d(G2T2G2TGTG2T2G2) quadruplex reported previously, and the d(G2T4G2CAG2GT4G2T) quadruplex reported here, reinforces the polymorphic nature of higher

Isoguanine and 5-Methyl-Isocytosine Bases, In Vitro and In Vivo

PubMed Central

Bande, Omprakash; Abu El Asrar, Rania; Braddick, Darren; Dumbre, Shrinivas; Pezo, Valérie; Schepers, Guy; Pinheiro, Vitor B; Lescrinier, Eveline; Holliger, Philipp; Marlière, Philippe; Herdewijn, Piet

2015-01-01

The synthesis, base-pairing properties and in vitro and in vivo characteristics of 5-methyl-isocytosine (isoCMe) and isoguanine (isoG) nucleosides, incorporated in an HNA(h) (hexitol nucleic acid)–DNA(d) mosaic backbone, are described. The required h-isoG phosphoramidite was prepared by a selective deamination as a key step. As demonstrated by Tm measurements the hexitol sugar showed slightly better mismatch discrimination against dT. The d-isoG base mispairing follows the order T>G>C while the h-isoG base mispairing follows the order G>C>T. The h- and d-isoCMe bases mainly mispair with G. Enzymatic incorporation experiments show that the hexitol backbone has a variable effect on selectivity. In the enzymatic assays, isoG misincorporates mainly with T, and isoCMe misincorporates mainly with A. Further analysis in vivo confirmed the patterns of base-pair interpretation for the deoxyribose and hexitol isoCMe/isoG bases in a cellular context, through incorporation of the bases into plasmidic DNA. Results in vivo demonstrated that mispairing and misincorporation was dependent on the backbone scaffold of the base, which indicates rational advances towards orthogonality. PMID:25684598

Wobble pairs of the HDV ribozyme play specific roles in stabilization of active site dynamics.

PubMed

Sripathi, Kamali N; Banáš, Pavel; Réblová, Kamila; Šponer, Jiří; Otyepka, Michal; Walter, Nils G

2015-02-28

The hepatitis delta virus (HDV) is the only known human pathogen whose genome contains a catalytic RNA motif (ribozyme). The overall architecture of the HDV ribozyme is that of a double-nested pseudoknot, with two GU pairs flanking the active site. Although extensive studies have shown that mutation of either wobble results in decreased catalytic activity, little work has focused on linking these mutations to specific structural effects on catalytic fitness. Here we use molecular dynamics simulations based on an activated structure to probe the active site dynamics as a result of wobble pair mutations. In both wild-type and mutant ribozymes, the in-line fitness of the active site (as a measure of catalytic proficiency) strongly depends on the presence of a C75(N3H3+)N1(O5') hydrogen bond, which positions C75 as the general acid for the reaction. Our mutational analyses show that each GU wobble supports catalytically fit conformations in distinct ways; the reverse G25U20 wobble promotes high in-line fitness, high occupancy of the C75(N3H3+)G1(O5') general-acid hydrogen bond and stabilization of the G1U37 wobble, while the G1U37 wobble acts more locally by stabilizing high in-line fitness and the C75(N3H3+)G1(O5') hydrogen bond. We also find that stable type I A-minor and P1.1 hydrogen bonding above and below the active site, respectively, prevent local structural disorder from spreading and disrupting global conformation. Taken together, our results define specific, often redundant architectural roles for several structural motifs of the HDV ribozyme active site, expanding the known roles of these motifs within all HDV-like ribozymes and other structured RNAs.

Wobble Pairs of the HDV Ribozyme Play Specific Roles in Stabilization of Active Site Dynamics

PubMed Central

Sripathi, Kamali N.; Banáš, Pavel; Reblova, Kamila; Šponer, Jiři; Otyepka, Michal

2015-01-01

The hepatitis delta virus (HDV) is the only known human pathogen whose genome contains a catalytic RNA motif (ribozyme). The overall architecture of the HDV ribozyme is that of a double-nested pseudoknot, with two GU pairs flanking the active site. Although extensive studies have shown that mutation of either wobble results in decreased catalytic activity, little work has focused on linking these mutations to specific structural effects on catalytic fitness. Here we use molecular dynamics simulations based on an activated structure to probe the active site dynamics as a result of wobble pair mutations. In both wild-type and mutant ribozymes, the in-line fitness of the active site (as a measure of catalytic proficiency) strongly depends on the presence of a C75(N3H3+)N1(O5′) hydrogen bond, which positions C75 as the general acid for the reaction. Our mutational analyses show that each GU wobble supports catalytically fit conformations in distinct ways; the reverse G25U20 wobble promotes high in-line fitness, high occupancy of the C75(N3H3+)G1(O5′) general-acid hydrogen bond and stabilization of the G1U37 wobble, while the G1U37 wobble acts more locally by stabilizing high in-line fitness and the C75(N3H3+)G1(O5′) hydrogen bond. We also find that stable type I A-minor and P1.1 hydrogen bonding above and below the active site, respectively, prevent local structural disorder from spreading and disrupting global conformation. Taken together, our results define specific, often redundant architectural roles for several structural motifs of the HDV ribozyme active site, expanding the known roles of these motifs within all HDV-like ribozymes and other structured RNAs. PMID:25631765

Self-assembled hierarchical carbon/g-C3N4 composite with high photocatalytic activity

NASA Astrophysics Data System (ADS)

Huang, Ru-Long; Huang, Wei-Qing; Li, Dong-Feng; Ma, Li-Li; Pan, Anlian; Hu, Wangyu; Fan, Xiaoxing; Huang, Gui-Fang

2018-04-01

Hierarchical carbon/g-C3N4 composites consisting of nanosheets are synthesized by a direct thermal diffusion and exfoliation approach with glucose acting as the intercalator and carbon source. This facile protocol not only renders nanosheets with a large surface area, but also carbon intercalation into the interlayer of g-C3N4. Therefore, the synthesized carbon/g-C3N4 composites exhibit superior photocatalytic performance for degrading representative methylene blue (MB) under visible light irradiatuon. Carbon/g-C3N4 composites with an optimal glucose mass ratio of 0.25% show the apparent reaction rate constant of 0.253 h-1, which is 9 times higher than that over bluk g-C3N4. The superior photocatalytic performance of carbon/g-C3N4 hierarchical architectures can be attributed to the synergic effects of large reactive sites, effective visible light adsorption and faster charge transfer owing to the superior electron transfer ability of carbon as verified by the PL and photoelectrochemical measurements. The main reactive species responsible for the photocatalytic degradation are photoinduced holes and ·OH radicals under visible light irradiation. This work provides a facile way to fabricate effecient g-C3N4-based photocatalysts for the potential application in dealing with environmental and energy shortage issues using solar energy.

Carbazole ligands as c-myc G-quadruplex binders.

PubMed

Głuszyńska, Agata; Juskowiak, Bernard; Kuta-Siejkowska, Martyna; Hoffmann, Marcin; Haider, Shozeb

2018-07-15

The interactions of c-myc G-quadruplex with three carbazole derivatives were investigated by UV-Vis spectrophotometry, fluorescence, CD spectroscopy, and molecular modeling. The results showed that a combination of carbazole scaffold functionalized with ethyl, triazole and imidazole groups resulted in stabilization of the intramolecular G-quadruplex formed by the DNA sequence derived from the NHE III 1 region of c-myc oncogene (Pu22). Binding to the G-quadruplex Pu22 resulted in the significant increase in fluorescence intensity of complexed ligands 1-3. All ligands were capable of interacting with G4 DNA with binding stoichiometry indicating that two ligand molecules bind to G-quadruplex with comparable affinity, which agrees with binding model of end-stacking on terminal G-tetrads. Copyright © 2018 Elsevier B.V. All rights reserved.

High-precision measurement of the electron spin g factor of trapped atomic nitrogen in the endohedral fullerene N@C60

NASA Astrophysics Data System (ADS)

Wittmann, J. J.; Can, T. V.; Eckardt, M.; Harneit, W.; Griffin, R. G.; Corzilius, B.

2018-05-01

The electronic g factor carries highly useful information about the electronic structure of a paramagnetic species, such as spin-orbit coupling and dia- or paramagnetic (de-)shielding due to local fields of surrounding electron pairs. However, in many cases, a near "spin-only" case is observed, in particular for light elements, necessitating accurate and precise measurement of the g factors. Such measurement is typically impeded by a "chicken and egg situation": internal or external reference standards are used for relative comparison of electron paramagnetic resonance (EPR) Larmor frequencies. However, the g factor of the standard itself usually is subject to a significant uncertainty which directly limits the precision and/or accuracy of the sought after sample g factor. Here, we apply an EPR reference-free approach for determining the g factor of atomic nitrogen trapped within the endohedral fullerene C60:N@C60 in its polycrystalline state by measuring the 1H NMR resonance frequency of dispersing toluene at room temperature. We found a value of g = 2.00204 (4) with a finally reached relative precision of ∼20 ppm. This accurate measurement allows us to directly compare the electronic properties of N@C60 to those found in atomic nitrogen in the gas phase or trapped in other solid matrices at liquid helium temperature. We conclude that spin-orbit coupling in N@C60 at room temperature is very similar in magnitude and of same sign as found in other inert solid matrices and that interactions between the quartet spin system and the C60 molecular orbitals are thus negligible.

Intermolecular G-quadruplex structure-based fluorescent DNA detection system.

PubMed

Zhou, Hui; Wu, Zai-Sheng; Shen, Guo-Li; Yu, Ru-Qin

2013-03-15

Adopting multi-donors to pair with one acceptor could improve the performance of fluorogenic detection probes. However, common dyes (e.g., fluorescein) in close proximity to each other would self-quench the fluorescence, and the fluorescence is difficult to restore. In this contribution, we constructed a novel "multi-donors-to-one acceptor" fluorescent DNA detection system by means of the intermolecular G-quadruplex (IGQ) structure-based fluorescence signal enhancement combined with the hairpin oligonucleotide. The novel IGQ-hairpin system was characterized using the p53 gene as the model target DNA. The proposed system showed an improved assay performance due to the introduction of IGQ-structure into fluorescent signaling probes, which could inhibit the background fluorescence and increase fluorescence restoration amplitude of fluoresceins upon target DNA hybridization. The proof-of-concept scheme is expected to provide new insight into the potential of G-quadruplex structure and promote the application of fluorescent oligonucleotide probes in fundamental research, diagnosis, and treatment of genetic diseases. Copyright © 2012 Elsevier B.V. All rights reserved.

Robust prediction of consensus secondary structures using averaged base pairing probability matrices.

PubMed

Kiryu, Hisanori; Kin, Taishin; Asai, Kiyoshi

2007-02-15

Recent transcriptomic studies have revealed the existence of a considerable number of non-protein-coding RNA transcripts in higher eukaryotic cells. To investigate the functional roles of these transcripts, it is of great interest to find conserved secondary structures from multiple alignments on a genomic scale. Since multiple alignments are often created using alignment programs that neglect the special conservation patterns of RNA secondary structures for computational efficiency, alignment failures can cause potential risks of overlooking conserved stem structures. We investigated the dependence of the accuracy of secondary structure prediction on the quality of alignments. We compared three algorithms that maximize the expected accuracy of secondary structures as well as other frequently used algorithms. We found that one of our algorithms, called McCaskill-MEA, was more robust against alignment failures than others. The McCaskill-MEA method first computes the base pairing probability matrices for all the sequences in the alignment and then obtains the base pairing probability matrix of the alignment by averaging over these matrices. The consensus secondary structure is predicted from this matrix such that the expected accuracy of the prediction is maximized. We show that the McCaskill-MEA method performs better than other methods, particularly when the alignment quality is low and when the alignment consists of many sequences. Our model has a parameter that controls the sensitivity and specificity of predictions. We discussed the uses of that parameter for multi-step screening procedures to search for conserved secondary structures and for assigning confidence values to the predicted base pairs. The C++ source code that implements the McCaskill-MEA algorithm and the test dataset used in this paper are available at http://www.ncrna.org/papers/McCaskillMEA/. Supplementary data are available at Bioinformatics online.

Imino proton exchange and base-pair kinetics in the AMP-RNA aptamer complex.

PubMed

Nonin, S; Jiang, F; Patel, D J

1997-05-02

We report on the dynamics of base-pair opening in the ATP-binding asymmetric internal loop and flanking base-pairs of the AMP-RNA aptamer complex by monitoring the exchange characteristics of the extremely well resolved imino protons in the NMR spectrum of the complex. The kinetics of imino proton exchange as a function of basic pH or added ammonia catalyst are used to measure the apparent base-pair dissociation constants and lifetimes of Watson-Crick and mismatched base-pairs, as well as the solvent accessibility of the unpaired imino protons in the complex. The exchange characteristics of the imino protons identify the existence of four additional hydrogen bonds stabilizing the conformation of the asymmetric ATP-binding internal loop that were not detected by NOEs and coupling constants alone, but are readily accommodated in the previously reported solution structure of the AMP-RNA aptamer complex published from our laboratory. The hydrogen exchange kinetics of the non-Watson-Crick pairs in the asymmetric internal loop of the AMP-RNA aptamer complex have been characterized and yield apparent dissociation constants (alphaKd) that range from 10(-2) to 10(-7). Surprisingly, three of these alphaKd values are amongst the lowest measured for all base-pairs in the AMP-RNA aptamer complex. Comparative studies of hydrogen exchange of the imino protons in the free RNA aptamer and the AMP-RNA aptamer complex establish that complexation stabilizes not only the bases within the ATP-binding asymmetric internal loop, but also the flanking stem base-pairs (two pairs on either side) of the binding site. We also outline some preliminary results related to the exchange properties of a sugar 2'-hydroxyl proton of a guanosine residue involved in a novel hydrogen bond that has been shown to contribute to the immobilization of the bound AMP by the RNA aptamer, and whose resonance is narrow and downfield shifted in the spectrum.

UV-light-assisted ethanol sensing characteristics of g-C3N4/ZnO composites at room temperature

NASA Astrophysics Data System (ADS)

Zhai, Jiali; Wang, Tao; Wang, Chuang; Liu, Dechen

2018-05-01

A highly efficient UV-light-assisted room temperature sensor based on g-C3N4/ZnO composites were prepared by an in situ precipitation method. The thermostability, composition, structure, and morphology properties of the as-prepared g-C3N4/ZnO composites were characterized by TGA, XRD, FT-IR, TEM, and XPS, respectively. And then, we studied the ethanol (C2H5OH) sensing performance of the g-C3N4/ZnO composites at the room temperature. Compared with pure ZnO and g-C3N4, the gas sensing activity of g-C3N4/ZnO composites was greatly improved at room temperature, for example, the g-C3N4/ZnO-8% composites showed an obvious response of 121-40 ppm C2H5OH at room temperature, which was 60 times higher than the pure ZnO based on the sensors under the same condition. The great enhancement of the C2H5OH sensing properties of composites can be understood by the efficient separation of photogenerated charge carriers of g-C3N4/ZnO heterogeneous and the UV-light catalytic effect. Finally, a possible mechanism for the gas sensing activity was proposed.

An in situ mediator-free route to fabricate Cu2O/g-C3N4 type-II heterojunctions for enhanced visible-light photocatalytic H2 generation

NASA Astrophysics Data System (ADS)

Ji, Cong; Yin, Su-Na; Sun, Shasha; Yang, Shengyang

2018-03-01

Cu2O nanoparticles doped g-C3N4 are synthesized via an in situ method and investigated in detail by IR techniques, X-ray diffraction, X-ray photoelectron spectroscopy, transmission electron microscopy, ultraviolet visible diffuse reflection spectroscopy, and photoluminescence spectroscopy. The as-prepared Cu2O/g-C3N4 hybrids demonstrate enhanced photocatalytic activity toward hydrogen generation compared to pure bulk g-C3N4, the effect of Cu2O content on the rate of visible light photocatalytic hydrogen evolution reveals the optimal hydrogen evolution rate can reach 33.2 μmol h-1 g-1, which is about 4 times higher that of pure g-C3N4. The enhanced photocatalytic activity can be attributed to the improved separation and transfer of photogenerated electron-hole pairs at the intimate interface between g-C3N4 and Cu2O. A possible photocatalytic mechanism of the Cu2O/g-C3N4 composite is also discussed. This mediator-free in situ chemical doping strategy developed in this work will contribute to the achievement of other multicomponent photocatalysts.

Analytical pair correlations in ideal quantum gases: temperature-dependent bunching and antibunching.

PubMed

Bosse, J; Pathak, K N; Singh, G S

2011-10-01

The fluctuation-dissipation theorem together with the exact density response spectrum for ideal quantum gases has been utilized to yield a new expression for the static structure factor, which we use to derive exact analytical expressions for the temperature-dependent pair distribution function g(r) of the ideal gases. The plots of bosonic and fermionic g(r) display "Bose pile" and "Fermi hole" typically akin to bunching and antibunching as observed experimentally for ultracold atomic gases. The behavior of spin-scaled pair correlation for fermions is almost featureless, but bosons show a rich structure including long-range correlations near T(c). The coherent state at T=0 shows no correlation at all, just like single-mode lasers. The depicted decreasing trend in correlation with decrease in temperature for Tc) should be observable in accurate experiments.

Stochastic Theory for the Clustering of Rapidly Settling, Low-Inertia Particle Pairs in Isotropic Turbulence - I

NASA Astrophysics Data System (ADS)

Gupta, Vijay; Rani, Sarma; Koch, Donald

2017-11-01

A stochastic theory is developed to predict the Radial Distribution Function (RDF) of monodisperse, rapidly settling, low-inertia particle pairs in isotropic turbulence. The theory is based on approximating the turbulent flow in a reference frame following an aerosol particle as a locally linear velocity field. In the first version of the theory (referred to as T1), the fluid velocity gradient tensor ``seen'' by the primary aerosol particle is further assumed to be Gaussian. Analytical closures are then derived for the drift and diffusive fluxes controling the RDF, in the asymptotic limits of small particle Stokes number (St =τp /τη << 1), and large dimensionless settling velocity (Sv = gτp /uη >> 1). It is seen that the RDF for rapidly settling pairs has an inverse power dependency on pair separation r with an exponent, c1, that is proportional to St2 . However, the c1 predicted by T1 for Sv >> 1 particles is higher than the c1 of even non-settling (Sv = 0) particles obtained from DNS of particle-laden isotropic turbulence. Thus, the Gaussian velocity gradient in T1 leads to the unphysical effect that gravity enhances pair clustering. To address this inconsistency, a second version (T2) was developed. Funding from the CBET Division of the National Science Foundation is gratefully acknowledged.

STD-NMR-Based Protein Engineering of the Unique Arylpropionate-Racemase AMDase G74C.

PubMed

Gaßmeyer, Sarah Katharina; Yoshikawa, Hiroyuki; Enoki, Junichi; Hülsemann, Nadine; Stoll, Raphael; Miyamoto, Kenji; Kourist, Robert

2015-06-23

Structure-guided protein engineering achieved a variant of the unique racemase AMDase G74C, with 40-fold increased activity in the racemisation of several arylaliphatic carboxylic acids. Substrate binding during catalysis was investigated by saturation-transfer-difference NMR (STD-NMR) spectroscopy. All atoms of the substrate showed interactions with the enzyme. STD-NMR measurements revealed distinct nuclear Overhauser effects in experiments with and without molecular conversion. The spectroscopic analysis led to the identification of several amino acid residues whose substitutions increased the activity of G74C. Single amino acid exchanges increased the activity moderately; structure-guided saturation mutagenesis yielded a quadruple mutant with a 40 times higher reaction rate. This study presents STD-NMR as versatile tool for the analysis of enzyme-substrate interactions in catalytically competent systems and for the guidance of protein engineering. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Nuclear magnetic resonance solution structure of an N(2)-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: intercalation from the minor groove with ruptured Watson-Crick base pairing.

PubMed

Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H; Cai, Yuqin; Rodriguez, Fabian A; Sayer, Jane M; Jerina, Donald M; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E

2012-12-04

The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the nonplanar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14 position with the exocyclic amino group of guanine. Here, we present the first nuclear magnetic resonance solution structure of a DB[a,l]P-derived adduct, the 14R-(+)-trans-anti-DB[a,l]P-N(2)-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N(2)-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3'-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3'-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE-DNA adduct conformation differs from (1) the classical intercalation motif in which Watson-Crick base pairing is intact at the lesion site and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix. The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed.

Base compositions of genes encoding alpha-actin and lactate dehydrogenase-A from differently adapted vertebrates show no temperature-adaptive variation in G + C content.

PubMed

Ream, Rachael A; Johns, Glenn C; Somero, George N

2003-01-01

indicates that, whereas GC contents of isochores may show variation among different classes of vertebrates, there is no consistent relationship between adaptation temperature and the percentage of thermal stability-enhancing G + C base pairs in protein-coding genes.

The −174G/C and −572G/C Interleukin 6 Promoter Gene Polymorphisms in Mexican Patients with Rheumatoid Arthritis: A Case-Control Study

PubMed Central

Zavaleta-Muñiz, S. A.; Martín-Márquez, B. T.; Gonzalez-Lopez, L.; Gonzalez-Montoya, N. G.; Díaz-Toscano, M. L.; Ponce-Guarneros, J. M.; Ruiz-Padilla, A. J.; Mercado, M. Vázquez-Del; Maldonado-González, M.; Fafutis-Morris, M.; Flores-Martínez, S. E.; Martínez-García, E. A.; Gamez-Nava, J. I.

2013-01-01

Objective. There is a lack of information about the genotype frequencies of IL-6 −174G/C and −572G/C polymorphisms in Mexicans with rheumatoid arthritis (RA). Therefore, the aim of this study was to evaluate the association of the IL-6 −174G/C and −572G/C polymorphisms in Mexican mestizo with RA. Methods. We included 137 patients with RA and 102 healthy controls. Patients were assessed for clinical characteristics. IL-6 −174G/C and −572G/C polymorphisms were genotyped using PCR-RFLP analysis. Allele and genotype frequencies and the Hardy-Weinberg equilibrium were computed. Odds ratios (ORs) were computed to identify the risk for RA associated with the presence of GG genotype in comparison with the GC or CC genotypes. Results. The genotype −174GG occurred at a higher frequency in cases and controls (77.4% versus 78.4%, P = 0.845). We found similar results for the genotype −572GG (54% in patients versus 60.8% in controls, P = 0.295). Conclusions. This is the first study to evaluate the association of −174G/C and −572G/C polymorphisms of the IL-6 gene with RA in Mexican mestizo patients. These two polymorphisms were not associated with RA in the studied sample. Additional studies are required to evaluate if these IL-6 polymorphisms have relevance to the development of more severe disease. PMID:24223608

Fluorescent aptasensor for detection of four tetracycline veterinary drugs in milk based on catalytic hairpin assembly reaction and displacement of G-quadruplex.

PubMed

Zhou, Chen; Zou, Haimin; Sun, Chengjun; Ren, Dongxia; Xiong, Wei; Li, Yongxin

2018-05-01

Based on a novel signal amplification strategy by catalytic hairpin assembly and displacement of G-quadruplex DNA, an enzyme-free, non-label fluorescent aptasensing approach was established for sensitive detection of four tetracycline veterinary drugs in milk. The network consisted of a pair of partially complementary DNA hairpins (HP1 and HP2). The DNA aptamer of four tetracycline veterinary drugs was located at the sticky end of the HP1. The ring region of HP1 rich in G and C could form a stable G-quadruplex structure, which could emit specific fluorescence signal after binding with the fluorescent dye and N-methylmesoporphyrin IX (NMM). When presented in the system, the target analytes would be repeatedly used to trigger a recycling procedure between the hairpins, generating numerous HP1-HP2 duplex complexes and displacing G-quadruplex DNA. Thus, the sensitive detection of target analytes was achieved in a wide linear range (0-1000 μg/L) with the detection limit of 4.6 μg/L. Moreover, this proposed method showed high discrimination efficiency towards target analytes against other common mismatched veterinary drugs, and could be successfully applied to the analysis of milk samples. Graphical abstract Schematic of target analyte detection based on catalytic hairpin assembly reaction and displacement of G-quadruplex.

Interaction of Cu(+) with cytosine and formation of i-motif-like C-M(+)-C complexes: alkali versus coinage metals.

PubMed

Gao, Juehan; Berden, Giel; Rodgers, M T; Oomens, Jos

2016-03-14

The Watson-Crick structure of DNA is among the most well-known molecular structures of our time. However, alternative base-pairing motifs are also known to occur, often depending on base sequence, pH, or the presence of cations. Pairing of cytosine (C) bases induced by the sharing of a single proton (C-H(+)-C) may give rise to the so-called i-motif, which occurs primarily in expanded trinucleotide repeats and the telomeric region of DNA, particularly at low pH. At physiological pH, silver cations were recently found to stabilize C dimers in a C-Ag(+)-C structure analogous to the hemiprotonated C-dimer. Here we use infrared ion spectroscopy in combination with density functional theory calculations at the B3LYP/6-311G+(2df,2p) level to show that copper in the 1+ oxidation state induces an analogous formation of C-Cu(+)-C structures. In contrast to protons and these transition metal ions, alkali metal ions induce a different dimer structure, where each ligand coordinates the alkali metal ion in a bidentate fashion in which the N3 and O2 atoms of both cytosine ligands coordinate to the metal ion, sacrificing hydrogen-bonding interactions between the ligands for improved chelation of the metal cation.

AT base pair anions versus (9-methyl-A)(1-methyl-T) base pair anions.

PubMed

Radisic, Dunja; Bowen, Kit H; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej

2005-05-04

The anionic base pairs of adenine and thymine, (AT)(-), and 9-methyladenine and 1-methylthymine, (MAMT)(-), have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)(-) found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)(-) was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)(-) and a resulting (MAMT)(-) configuration that was either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)(-) occurred at a completely different electron binding energy than had (AT)(-). Moreover, the VDE value of (MAMT)(-) was in agreement with that predicted by theory. The configuration of (MAMT)(-) and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced DNA alterations, BFPT in the WC/HS configurations of (AT)(-) is not feasible.

77 FR 50519 - Agency Information Collection Activities: Forms G-325, G-325A, G-325B, and G-325C; Extension of a...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-08-21

... DEPARTMENT OF HOMELAND SECURITY U.S. Citizenship and Immigration Services [OMB Control Number 1615... Department of Homeland Security (DHS), U.S. Citizenship and Immigration Services (USCIS) will be submitting... collection: Forms G-325, G-325A, G-325B, and G-325C; U.S. Citizenship and Immigration Services (USCIS). (4...

Comparative study of mitotic chromosomes in two blowflies, Lucilia sericata and L. cluvia (Diptera, Calliphoridae), by C- and G-like banding patterns and rRNA loci, and implications for karyotype evolution

PubMed Central

Chirino, Mónica G.; Rossi, Luis F.; Bressa, María J.; Luaces, Juan P.; Merani, María S.

2015-01-01

Abstract The karyotypes of Lucilia cluvia (Walker, 1849) and Lucilia sericata (Meigen, 1826) from Argentina were characterized using conventional staining and the C- and G-like banding techniques. Besides, nucleolus organizer regions (NORs) were detected by fluorescent in situ hybridization (FISH) and silver staining technique. The chromosome complement of these species comprises five pairs of autosomes and a pair of sex chromosomes (XX/XY, female/male). The autosomes of both species have the same size and morphology, as well as C- and G-like banding patterns. The X and Y chromosomes of Lucilia cluvia are subtelocentric and easily identified due to their very small size. In Lucilia sericata, the X chromosome is metacentric and the largest of the complement, showing a secondary constriction in its short arm, whereas the Y is submetacentric and smaller than the X. The C-banding patterns reflect differences in chromatin structure and composition between the subtelocentric X and Y chromosomes of Lucilia cluvia and the biarmed sex chromosomes of Lucilia sericata. These differences in the sex chromosomes may be due to distinct amounts of constitutive heterochromatin. In Lucilia cluvia, the NORs are placed at one end of the long-X and of the long-Y chromosome arms, whereas one of the NORs is disposed in the secondary constriction of the short-X chromosome arm and the other on the long-Y chromosome arm in Lucilia sericata. Although the G-like banding technique does not yield G-bands like those in mammalian chromosomes, it shows a high degree chromosomal homology in both species because each pair of autosomes was correctly paired. This chromosome similarity suggests the absence of autosomal rearrangements during karyotype evolution in the two species studied. PMID:25893078

An operationally flexible fuel cell based on quaternary ammonium-biphosphate ion pairs

DOE PAGES

Lee, Kwan -Soo; Spendelow, Jacob Schatz; Choe, Yoong -Kee; ...

2016-08-22

Here, fuel cells are promising devices for clean power generation in a variety of economically and environmentally significant applications. Low-temperature proton exchange membrane (PEM) fuel cells utilizing Nafion require a high level of hydration, which limits the operating temperature to less than 100°C. In contrast, high-temperature PEM fuel cells utilizing phosphoric acid-doped polybenzimidazole can operate effectively up to 180°C; however, these devices degrade when exposed to water below 140°C. Here we present a different class of PEM fuel cells based on quaternary ammonium-biphosphate ion pairs that can operate under conditions unattainable with existing fuel cell technologies. These fuel cells exhibitmore » stable performance at 80–160°C with a conductivity decay rate more than three orders of magnitude lower than that of a commercial high-temperature PEM fuel cell. By increasing the operational flexibility, this class of fuel cell can simplify the requirements for heat and water management, and potentially reduce the costs associated with the existing fully functional fuel cell systems.« less

An operationally flexible fuel cell based on quaternary ammonium-biphosphate ion pairs

NASA Astrophysics Data System (ADS)

Lee, Kwan-Soo; Spendelow, Jacob S.; Choe, Yoong-Kee; Fujimoto, Cy; Kim, Yu Seung

2016-09-01

Fuel cells are promising devices for clean power generation in a variety of economically and environmentally significant applications. Low-temperature proton exchange membrane (PEM) fuel cells utilizing Nafion require a high level of hydration, which limits the operating temperature to less than 100 ∘C. In contrast, high-temperature PEM fuel cells utilizing phosphoric acid-doped polybenzimidazole can operate effectively up to 180 ∘C however, these devices degrade when exposed to water below 140 ∘C. Here we present a different class of PEM fuel cells based on quaternary ammonium-biphosphate ion pairs that can operate under conditions unattainable with existing fuel cell technologies. These fuel cells exhibit stable performance at 80-160 ∘C with a conductivity decay rate more than three orders of magnitude lower than that of a commercial high-temperature PEM fuel cell. By increasing the operational flexibility, this class of fuel cell can simplify the requirements for heat and water management, and potentially reduce the costs associated with the existing fully functional fuel cell systems.

Josephson Parametric Amplifer Based on a Cavity-Embedded Cooper Pair Transistor

NASA Astrophysics Data System (ADS)

Li, Juliang; Rimberg, A. J.

In this experiment a cavity-embedded Cooper-pair transistor (cCPT) is used as a Josephson parametric amplifier. The cCPT consists of a Cooper pair transistor placed at the voltage antinode of a 5.7 GHz shorted quarter-wave resonator so that the CPT provides a galvanic connection between the cavity's central conductor and ground plane, which forms a SQUID loop. Both the flux threading the loop as well as the gate charge can be modulated, and each can provide the parametric pumping. The reflected signal from the cCPT is further amplified by both SLUG and HEMT amplifiers for characterizing the parametric amplification. A first application of the parametric amplification is to improve the charge sensitivity of a single electron charge detector. This can be done either by pumping on a side band or by shifting the charge state of the cCPT near a bifurcation point. Stimulated emission has been also observed when the cCPT is pumped at twice the resonant frequency in the absence of an input signal. This could allow investigation of the dynamic Casimir effect as well as generation of non-classical photon states. Supported by Grants ARO W911NF-13-10377 and NSF DMR 1507400.

Design and Applications of Noncanonical DNA Base Pairs.

PubMed

Jissy, A K; Datta, Ayan

2014-01-02

While the Watson-Crick base pairs are known to stabilize the DNA double helix and play a vital role in storage/replication of genetic information, their replacement with non-Watson-Crick base pairs has recently been shown to have interesting practical applications. Nowadays, theoretical calculations are routinely performed on very complex systems to gain a better understanding of how molecules interact with each other. We not only bring together some of the basic concepts of how mispaired or unnatural nucleobases interact with each other but also look at how such an understanding influences the prediction of novel properties and development of new materials. We highlight the recent developments in this field of research. In this Perspective, we discuss the success of DFT methods, particularly, dispersion-corrected DFT, for applications such as pH-controlled molecular switching, electric-field-induced stacking of disk-like molecules with guanine quartets, and optical birefringence of alkali-metal-coordinated guanine quartets. The synergy between theoretical models and real applications is highlighted.

Cajanusflavanols A-C, Three Pairs of Flavonostilbene Enantiomers from Cajanus cajan.

PubMed

He, Qi-Fang; Wu, Zhen-Long; Huang, Xiao-Jun; Zhong, Yuan-Lin; Li, Man-Mei; Jiang, Ren-Wang; Li, Yao-Lan; Ye, Wen-Cai; Wang, Ying

2018-02-02

Three pairs of new flavonostilbene enantiomers, cajanusflavanols A-C (1-3), along with their putative biogenetic precursors 4-6, were isolated from Cajanus cajan. Compound 1 possesses an unprecedented carbon skeleton featuring a unique highly functionalized cyclopenta[1,2,3-de]isobenzopyran-1-one tricyclic core. Compounds 2 and 3 are the first examples of methylene-unit-linked flavonostilbenes. Their structures with absolute configurations were elucidated by spectroscopic analyses, X-ray diffraction, and computational calculations. Compounds 1 and 2 exhibited significant in vitro anti-inflammatory activities.

The Wilcoxon signed rank test for paired comparisons of clustered data.

PubMed

Rosner, Bernard; Glynn, Robert J; Lee, Mei-Ling T

2006-03-01

The Wilcoxon signed rank test is a frequently used nonparametric test for paired data (e.g., consisting of pre- and posttreatment measurements) based on independent units of analysis. This test cannot be used for paired comparisons arising from clustered data (e.g., if paired comparisons are available for each of two eyes of an individual). To incorporate clustering, a generalization of the randomization test formulation for the signed rank test is proposed, where the unit of randomization is at the cluster level (e.g., person), while the individual paired units of analysis are at the subunit within cluster level (e.g., eye within person). An adjusted variance estimate of the signed rank test statistic is then derived, which can be used for either balanced (same number of subunits per cluster) or unbalanced (different number of subunits per cluster) data, with an exchangeable correlation structure, with or without tied values. The resulting test statistic is shown to be asymptotically normal as the number of clusters becomes large, if the cluster size is bounded. Simulation studies are performed based on simulating correlated ranked data from a signed log-normal distribution. These studies indicate appropriate type I error for data sets with > or =20 clusters and a superior power profile compared with either the ordinary signed rank test based on the average cluster difference score or the multivariate signed rank test of Puri and Sen. Finally, the methods are illustrated with two data sets, (i) an ophthalmologic data set involving a comparison of electroretinogram (ERG) data in retinitis pigmentosa (RP) patients before and after undergoing an experimental surgical procedure, and (ii) a nutritional data set based on a randomized prospective study of nutritional supplements in RP patients where vitamin E intake outside of study capsules is compared before and after randomization to monitor compliance with nutritional protocols.

Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs.

PubMed

McCoy, A B; Wright, A; Krousel-Wood, M; Thomas, E J; McCoy, J A; Sittig, D F

2015-01-01

Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes.

Surprising conformers of the biologically important A·T DNA base pairs: QM/QTAIM proofs

NASA Astrophysics Data System (ADS)

Brovarets', Ol'ha O.; Tsiupa, Kostiantyn S.; Hovorun, Dmytro M.

2018-02-01

For the first time novel high-energy conformers – A·T(wWC) (5.36), A·T(wrWC) (5.97), A·T(wH) (5.78) and A·T(wrH) (ΔG=5.82 kcal•mol-1) were revealed for each of the four biologically important A·T(WC) DNA base pairs – Watson-Crick A·T(WC), reverse Watson-Crick A·T(rWC), Hoogsteen A·T(H) and reverse Hoogsteen A·T(rH) at the MP2/aug-cc-pVDZ//B3LYP/6-311++G(d,p) level of quantum-mechanical theory in the continuum with ɛ=4 under normal conditions. Each of these conformers possesses substantially non-planar wobble (w) structure and is stabilized by the participation of the two anti-parallel N6H/N6H'…O4/O2 and N3H…N6 H-bonds, involving the pyramidalized amino group of the A DNA base as an acceptor and a donor of the H-bonding. The transition states – TSA·T(WC)↔A·T(wWC), TSA·T(rWC)↔A·T(wrWC), TSA·T(H)↔A·T(wH) and TSA·T(rH)↔A·T(wrH), controlling the dipole-active transformations of the conformers from the main plane-symmetric state into the high-energy, significantly non-planar state and vice versa, were localized. They also possess wobble structures similarly to the high-energy conformers and are stabilized by the participation of the N6H/N6H'…O4/O2 and N3H…N6 H-bonds. Discovered conformers of the A·T DNA base pairs are dynamically stable short-lived structures (lifetime τ = (1.4-3.9) ps). Their possible biological significance and future perspectives have been briefly discussed.

Enhanced photocatalytic H2-production activity of C-dots modified g-C3N4/TiO2 nanosheets composites.

PubMed

Li, Yang; Feng, Xionghan; Lu, Zhexue; Yin, Hui; Liu, Fan; Xiang, Quanjun

2018-03-01

As a new carbon-based material, carbon dots (C-dots) have got widely preference because of its excellent electronic transfer capability. In this work, a novel ternary layered C-dots/g-C 3 N 4 /TiO 2 nanosheets (CGT) composite photocatalysts were prepared by impregnation precipitation methods. The optimal ternary CGT composite samples revealed high photocatalytic hydrogen evolution rate in triethanolamine aqueous solutions, which exceeded the rate of the optimal g-C 3 N 4 /TiO 2 composite sample by a factor of 5 times. The improved photocatalytic activity is owed to the positive effects of C-dots and layered heterojunction structure of TiO 2 nanosheets and g-C 3 N 4 sheets. C-dots in the CGT composites can serve as electron reservoirs to capture the photo-induced electrons. The well-defined layered heterojunction structure of CGT provides the intimate contact and the strong interaction of anatase TiO 2 nanosheets and g-C 3 N 4 sheets via face-to-face orientation, which restrains the recombination of photogenerated charge carriers, and thus enhances the photocatalytic H 2 -production activity. Electron paramagnetic resonance and transient photocurrent response proved the strong interaction and improved interfacial charge transfer of TiO 2 nanosheets and g-C 3 N 4 sheets, respectively. The mechanism of improving the photocatalytic H 2 -evolution activity was further confirmed by time-resolved fluorescence, electron paramagnetic resonance, transient photocurrent response and electrochemical impedance spectroscopy. Copyright © 2017 Elsevier Inc. All rights reserved.

52. Photocopy of Outboard Profile, Booklet of General Plans, U.S.C.G.C. ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

52. Photocopy of Outboard Profile, Booklet of General Plans, U.S.C.G.C. White Heath, WLM-545. U.S. Coast Guard Naval Engineering Department. U.S.C.G. Headquarters, Washington, D.C. Coast Guard Headquarters Drawing No. 540-WAGL-0103-019 C. sheet 2 of 7, dated May 1967; revised June 1971, December 1976, and April 1989. Original drawing property of the U.S. Coast Guard. - U.S. Coast Guard Cutter WHITE HEATH, USGS Integrated Support Command Boston, 427 Commercial Street, Boston, Suffolk County, MA

57. Photocopy of Hold, Booklet of General Plans, U.S.C.G.C. White ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

57. Photocopy of Hold, Booklet of General Plans, U.S.C.G.C. White Heath, WLM-545. U.S. Coast Guard Naval Engineering Department, U.S.C.G. Headquarters, Washington, D.C. Coast Guard Headquarters Drawing No. 540-WAGL-0103-019 C. sheet 7 of 7, dated May 1967; revised June 1971, December 1976, and April 1989. Original drawing property of the U.S. Coast Guard. - U.S. Coast Guard Cutter WHITE HEATH, USGS Integrated Support Command Boston, 427 Commercial Street, Boston, Suffolk County, MA

51. Photocopy of Title Sheet, Booklet of General Plans, U.S.C.G.C ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

51. Photocopy of Title Sheet, Booklet of General Plans, U.S.C.G.C White Heath, WLM-545, U.S. Coast Guard Naval Engineering Department, U.S.C.G. Headquarters, Washington, D.C. Coast Guard Headquarters Drawing No. 540-WAGL-0103-019 C. sheet 1 of 7, dated May 1967; revised June 1971, December 1976, and April 1989. Original drawing property of the U.S. Coast Guard. - U.S. Coast Guard Cutter WHITE HEATH, USGS Integrated Support Command Boston, 427 Commercial Street, Boston, Suffolk County, MA

53. Photocopy of Inboard Profile, Booklet of General Plans, U.S.C.G.C. ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

53. Photocopy of Inboard Profile, Booklet of General Plans, U.S.C.G.C. White Heath, WLM-545. U.S. Coast Guard Naval Engineering Department. U.S.C.G. Headquarters, Washington, D.C. Coast Guard Headquarters Drawing No. 540-WAGL-0103-019 C. sheet 3 of 7, dated May 1967; revised June 1971, December 1976, and April 1989. Original drawing property of the U.S. Coast Guard. - U.S. Coast Guard Cutter WHITE HEATH, USGS Integrated Support Command Boston, 427 Commercial Street, Boston, Suffolk County, MA

56. Photocopy of Main Deck, Booklet of General Plans, U.S.C.G.C. ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

56. Photocopy of Main Deck, Booklet of General Plans, U.S.C.G.C. White Heath WLM-545. U.S. Coast Guard Naval Engineering Department, U.S.C.G. Headquarters, Washington, D.C. Coast Guard Headquarters Drawing No. 540-WAGL-0103-019 C. sheet 6 of 7, dated May 1967; revised June 1971, December 1976, and April 1989. Original drawing property of the U.S. Coast Guard. - U.S. Coast Guard Cutter WHITE HEATH, USGS Integrated Support Command Boston, 427 Commercial Street, Boston, Suffolk County, MA

Complexes of DNA bases and Watson-Crick base pairs interaction with neutral silver Agn (n = 8, 10, 12) clusters: a DFT and TDDFT study.

PubMed

Srivastava, Ruby

2018-03-01

We study the binding of the neutral Ag n (n = 8, 10, 12) to the DNA base-adenine (A), guanine (G) and Watson-Crick -adenine-thymine, guanine-cytosine pairs. Geometries of complexes were optimized at the DFT level using the hybrid B3LYP functional. LANL2DZ effective core potential was used for silver and 6-31 + G ** was used for all other atoms. NBO charges were analyzed using the Natural population analysis. The absorption properties of Ag n -A,G/WC complexes were also studied using time-dependent density functional theory. The absorption spectra for these complexes show wavelength in the visible region. It was revealed that silver clusters interact more strongly with WC pairs than with isolated DNA complexes. Furthermore, it was found that the electronic charge transferred from silver to isolated DNA clusters are less than the electronic charge transferred from silver to the Ag n -WC complexes. The vertical ionization potential, vertical electron affinity, hardness, and electrophilicity index of Ag n -DNA/WC complexes have also been discussed.

Observation of χ c1 Decays into Vector Meson Pairs ΦΦ, ωω and, ωΦ

DOE PAGES

Ablikim, M.; Achasov, M. N.; An, L.; ...

2011-08-22

Using (106±4)×10⁶ ψ(3686) events accumulated with the BESIII detector at the BEPCII e⁺e⁻ collider, we present the first measurement of decays of χ c1 to vector meson pairs ΦΦ, ωω, and ωΦ. The branching fractions are measured to be (4.4±0.3±0.5)×10⁻⁴, (6.0±0.3±0.7)×10⁻⁴, and (2.2±0.6±0.2)×10⁻⁵, for χ c1 →ΦΦ, ωω, and ωΦ, respectively, which indicates that the hadron helicity selection rule is significantly violated in χ cJ decays. In addition, the measurement of χ cJ→ωΦ provides the first indication of the rate of doubly OZI-suppressed χ cJ decay. Finally, we present improved measurements for the branching fractions of χ c0 and χmore » c2 to vector meson pairs.« less

Lewis Acid Pairs for the Activation of Biomass-derived Oxygenates in Aqueous Media

DOE Office of Scientific and Technical Information (OSTI.GOV)

Roman, Yuriy

2015-09-14

The objective of this project is to understand the mechanistic aspects behind the cooperative activation of oxygenates by catalytic pairs in aqueous media. Specifically, we will investigate how the reactivity of a solid Lewis acid can be modulated by pairing the active site with other catalytic sites at the molecular level, with the ultimate goal of enhancing activation of targeted functional groups. Although unusual catalytic properties have been attributed to the cooperative effects promoted by such catalytic pairs, virtually no studies exist detailing the use heterogeneous water-tolerant Lewis pairs. A main goal of this work is to devise rational pathwaysmore » for the synthesis of porous heterogeneous catalysts featuring isolated Lewis pairs that are active in the transformation of biomass-derived oxygenates in the presence of bulk water. Achieving this technical goal will require closely linking advanced synthesis techniques; detailed kinetic and mechanistic investigations; strict thermodynamic arguments; and comprehensive characterization studies of both materials and reaction intermediates. For the last performance period (2014-2015), two technical aims were pursued: 1) C-C coupling using Lewis acid and base pairs in Lewis acidic zeolites. Tin-, zirconium-, and hafnium containing zeolites (e.g., Sn-, Zr-, and Hf-Beta) are versatile solid Lewis acids that selectively activate carbonyl functional groups. In this aim, we demonstrate that these zeolites catalyze the cross-aldol condensation of aromatic aldehydes with acetone under mild reaction conditions with near quantitative yields. NMR studies with isotopically labeled molecules confirm that acid-base pairs in the Si-O-M framework ensemble promote soft enolization through α-proton abstraction. The Lewis acidic zeolites maintain activity in the presence of water and, unlike traditional base catalysts, in acidic solutions. 2) One-pot synthesis of MWW zeolite nanosheets for activation of bulky substrates

Measurement of inclusive muon pair production by 225-GeV/c. pi. /sup +/,. pi. /sup -/, and proton beams with a large acceptance spectrometers. [Cross sections, 225 GeV/c, tables

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brason, J G

1977-05-01

Inclusive muon pair production by 225 GeV/c ..pi../sup +/, ..pi../sup -/ and proton beams incident upon carbon and tin targets was measured over a large range of kinematic variables (2m/sub ..mu../ < m/sub ..mu mu.. < 1 GeV/c/sup 2/, 0 < x/sub F/ < 1, P/sub perpendicular to/ < 4 GeV/c and vertical bar cos theta* vertical bar < .3). The value of the invariant cross section E d/sup 4/sigma/dmdx/sub f/dp/sup 2//sub perpendicular to/ is presented as a function of these variables. The vector mesons rho, ..omega.., phi, J and psi' appear in the data along with apparently nonresonant ..mu..-pairs.more » By looking for additional muons accompanying J ..-->.. ..mu../sup +/..mu../sup -/ events, a 1.0% upper limit on production of pairs of charmed particles in association with the J is obtained. Aspects of the continuum muon pair data are compared to Drell-Yan model calculations. The ratio of ..mu..-pairs produced by ..pi../sup +/ beam particles to ..mu..-pairs produced by ..pi../sup -/ beam particles supports electromagnetic production at high mass.« less

Retention of nucleic acids in ion-pair reversed-phase high-performance liquid chromatography depends not only on base composition but also on base sequence.

PubMed

Qiao, Jun-Qin; Liang, Chao; Wei, Lan-Chun; Cao, Zhao-Ming; Lian, Hong-Zhen

2016-12-01

The study on nucleic acid retention in ion-pair reversed-phase high-performance liquid chromatography mainly focuses on size-dependence, however, other factors influencing retention behaviors have not been comprehensively clarified up to date. In this present work, the retention behaviors of oligonucleotides and double-stranded DNAs were investigated on silica-based C 18 stationary phase by ion-pair reversed-phase high-performance liquid chromatography. It is found that the retention of oligonucleotides was influenced by base composition and base sequence as well as size, and oligonucleotides prone to self-dimerization have weaker retention than those not prone to self-dimerization but with the same base composition. However, homo-oligonucleotides are suitable for the size-dependent separation as a special case of oligonucleotides. For double-stranded DNAs, the retention is also influenced by base composition and base sequence, as well as size. This may be attributed to the interaction of exposed bases in major or minor grooves with the hydrophobic alky chains of stationary phase. In addition, no specific influence of guanine and cytosine content was confirmed on retention of double-stranded DNAs. Notably, the space effect resulted from the stereostructure of nucleic acids also influences the retention behavior in ion-pair reversed-phase high-performance liquid chromatography. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

A novel mutation of the ACADM gene (c.145C>G) associated with the common c.985A>G mutation on the other ACADM allele causes mild MCAD deficiency: a case report

PubMed Central

2010-01-01

A female patient, with normal familial history, developed at the age of 30 months an episode of diarrhoea, vomiting and lethargy which resolved spontaneously. At the age of 3 years, the patient re-iterated vomiting, was sub-febrile and hypoglycemic, fell into coma, developed seizures and sequels involving right hemi-body. Urinary excretion of hexanoylglycine and suberylglycine was low during this metabolic decompensation. A study of pre- and post-prandial blood glucose and ketones over a period of 24 hours showed a normal glycaemic cycle but a failure to form ketones after 12 hours fasting, suggesting a mitochondrial β-oxidation defect. Total blood carnitine was lowered with unesterified carnitine being half of the lowest control value. A diagnosis of mild MCAD deficiency (MCADD) was based on rates of 1-14C-octanoate and 9, 10-3H-myristate oxidation and of octanoyl-CoA dehydrogenase being reduced to 25% of control values. Other mitochondrial fatty acid oxidation proteins were functionally normal. De novo acylcarnitine synthesis in whole blood samples incubated with deuterated palmitate was also typical of MCADD. Genetic studies showed that the patient was compound heterozygous with a sequence variation in both of the two ACADM alleles; one had the common c.985A>G mutation and the other had a novel c.145C>G mutation. This is the first report for the ACADM gene c.145C>G mutation: it is located in exon 3 and causes a replacement of glutamine to glutamate at position 24 of the mature protein (Q24E). Associated with heterozygosity for c.985A>G mutation, this mutation is responsible for a mild MCADD phenotype along with a clinical story corroborating the emerging literature view that patients with genotypes representing mild MCADD (high residual enzyme activity and low urinary levels of glycine conjugates), similar to some of the mild MCADDs detected by MS/MS newborn screening, may be at risk for disease presentation. PMID:20923556

DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

PubMed

Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

2012-10-11

Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

Correlations of EGF G1380A, bFGF C754G and VEGF T460C polymorphisms with malignant melanoma susceptibility and prognosis: A case-control study.

PubMed

Wang, Xin-Hua; Long, Zi-Wen

2017-06-20

This case-control study aims to investigate the correlations of EGF G1380A, bFGF C754G and VEGF T460C polymorphisms with the susceptibility and prognosis of malignant melanoma. A total of 153 patients with multiple primary melanomas were collected as the case group and another 170 healthy individuals were selected as the control group. ELISA and PCR-RFLP were performed to test the serum level of VEGF and to analyze the genotype as well as allele frequencies of VEGF T460C, EGF G1380A, and bFGF C754G, respectively. The patients were assigned into complete remission (CR), partial remission (PR) and non-remission groups after treatment. HE and CD34 staining were conducted in tissue samples of CR and PR patients. Event-free survival (EFS) and overall survival (OS) were measured. AA genotype of EGF G1380A and GG genotype of bFGF C754G had higher frequency distribution in the case group than the control group. Patients with AA genotype of EGF G1380 and GG genotype of bFGF C754G had an elevated VEGF level in comparison to other genotypes. Patients with GA+GG genotypes of EGF G1380A and CG+CC genotypes of bFGF C754G had higher EFS and OS than those with AA genotype and those with GG genotype, respectively. According to the haplotype analysis, the case group had a notably higher frequency of TAG and CAG along with while lower frequency of TGG and CGC compared with the control group. Logistic regression analysis revealed that the polymorphisms of EGF G1380A and bFGF C754G as well as the haploid TAG increased the susceptibility of malignant melanoma. The results indicated that EGF G1380A and bFGF C754G gene polymorphisms were associated with the susceptibility and prognosis of malignant melanoma, and that the polymorphisms of EGF G1380A and bFGF C754G as well as the haploid TAG increased the susceptibility of malignant melanoma. Copyright © 2017 Elsevier B.V. All rights reserved.

31 CFR Appendix G to Subpart C of... - Financial Management Service

Code of Federal Regulations, 2014 CFR

2014-07-01

... 31 Money and Finance: Treasury 1 2014-07-01 2014-07-01 false Financial Management Service G Appendix G to Subpart C of Part 1 Money and Finance: Treasury Office of the Secretary of the Treasury DISCLOSURE OF RECORDS Privacy Act Pt. 1, Subpt. C, App. G Appendix G to Subpart C of Part 1—Financial...

31 CFR Appendix G to Subpart C of... - Financial Management Service

Code of Federal Regulations, 2013 CFR

2013-07-01

... 31 Money and Finance: Treasury 1 2013-07-01 2013-07-01 false Financial Management Service G Appendix G to Subpart C of Part 1 Money and Finance: Treasury Office of the Secretary of the Treasury DISCLOSURE OF RECORDS Privacy Act Pt. 1, Subpt. C, App. G Appendix G to Subpart C of Part 1—Financial...

31 CFR Appendix G to Subpart C of... - Financial Management Service

Code of Federal Regulations, 2011 CFR

2011-07-01

... 31 Money and Finance: Treasury 1 2011-07-01 2011-07-01 false Financial Management Service G Appendix G to Subpart C of Part 1 Money and Finance: Treasury Office of the Secretary of the Treasury DISCLOSURE OF RECORDS Privacy Act Pt. 1, Subpt. C, App. G Appendix G to Subpart C of Part 1—Financial...

31 CFR Appendix G to Subpart C of... - Financial Management Service

Code of Federal Regulations, 2012 CFR

2012-07-01

... 31 Money and Finance: Treasury 1 2012-07-01 2012-07-01 false Financial Management Service G Appendix G to Subpart C of Part 1 Money and Finance: Treasury Office of the Secretary of the Treasury DISCLOSURE OF RECORDS Privacy Act Pt. 1, Subpt. C, App. G Appendix G to Subpart C of Part 1—Financial...

Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs

PubMed Central

Wright, A.; Krousel-Wood, M.; Thomas, E. J.; McCoy, J. A.; Sittig, D. F.

2015-01-01

Summary Background Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. Objective We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. Methods We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. Results The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. Conclusions We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes. PMID:26171079

N(4)C-ethyl-N(4)C cross-linked DNA: synthesis and characterization of duplexes with interstrand cross-links of different orientations.

PubMed

Noronha, Anne M; Noll, David M; Wilds, Christopher J; Miller, Paul S

2002-01-22

The preparation and physical properties of short DNA duplexes that contain a N(4)C-ethyl-N(4)C interstrand cross-link are described. Duplexes that contain an interstrand cross-link between mismatched C-C residues and duplexes in which the C residues of a -CG- or -GC- step are linked to give "staggered" interstrand cross-links were prepared using a novel N(4)C-ethyl-N(4)C phosphoramidite reagent. Duplexes with the C-C mismatch cross-link have UV thermal transition temperatures that are 25 degrees C higher than the melting temperatures of control duplexes in which the cross-link is replaced with a G-C base pair. It appears that this cross-link stabilizes adjacent base pairs and does not perturb the structure of the helix, a conclusion that is supported by the CD spectrum of this duplex and by molecular models. An even higher level of stabilization, 49 degrees C, is seen with the duplex that contains a -CG- staggered cross-link. Molecular models suggest that this cross-link may induce propeller twisting in the cross-linked base pairs, and the CD spectrum of this duplex exhibits an unusual negative band at 298 nm, although the remainder of the spectrum is similar to that of B-form DNA. Mismatched C-C or -CG- staggered cross-linked duplexes that have complementary overhanging ends can undergo self-ligation catalyzed by T4 DNA ligase. Analysis of the ligated oligomers by nondenaturing polyacrylamide gel electrophoresis shows that the resulting oligomers migrate in a manner similar to that of a mixture of non-cross-linked control oligomers and suggests that these cross-links do not result in significant bending of the helix. However, the orientation of the staggered cross-link can have a significant effect on the structure and stability of the cross-linked duplex. Thus, the thermal stability of the duplex that contains a -GC- staggered cross-link is 10 degrees C lower than the melting temperature of the control, non-cross-linked duplex. Unlike the -CG- staggered cross

The nearest neighbor and next nearest neighbor effects on the thermodynamic and kinetic properties of RNA base pair

NASA Astrophysics Data System (ADS)

Wang, Yujie; Wang, Zhen; Wang, Yanli; Liu, Taigang; Zhang, Wenbing

2018-01-01

The thermodynamic and kinetic parameters of an RNA base pair with different nearest and next nearest neighbors were obtained through long-time molecular dynamics simulation of the opening-closing switch process of the base pair near its melting temperature. The results indicate that thermodynamic parameters of GC base pair are dependent on the nearest neighbor base pair, and the next nearest neighbor base pair has little effect, which validated the nearest-neighbor model. The closing and opening rates of the GC base pair also showed nearest neighbor dependences. At certain temperature, the closing and opening rates of the GC pair with nearest neighbor AU is larger than that with the nearest neighbor GC, and the next nearest neighbor plays little role. The free energy landscape of the GC base pair with the nearest neighbor GC is rougher than that with nearest neighbor AU.

Solar promoted azo dye degradation and energy production in the bio-photoelectrochemical system with a g-C3N4/BiOBr heterojunction photocathode

NASA Astrophysics Data System (ADS)

Hou, Yanping; Gan, Yuanyuan; Yu, Zebin; Chen, Xixi; Qian, Lun; Zhang, Boge; Huang, Lirong; Huang, Jun

2017-12-01

In this study, a single-chamber bio-photoelectrochemical system (BPES), integrating advantages of bioelectrochemical system and photocatalysis process, is developed using a g-C3N4/BiOBr heterojunction photocathode for methyl orange (MO) degradation and simultaneous energy recovery. Photocatalytic activities of g-C3N4/BiOBr, g-C3N4 and BiOBr are characterized by UV-vis diffuse reflectance spectra (UV-vis DRS) and Photoluminescence (PL) spectra; and electrochemical activities of photocathodes are examined by linear sweep voltammetry (LSV) and electrochemical impedance spectroscopy (EIS). Results show that with an applied voltage of 0.8 V and under simulated solar irradiation, MO decolorization with g-C3N4/BiOBr photocathode reaches 97.8% within 4 h, higher than those with g-C3N4 (85.3%) and BiOBr (87.3%) photocathodes. Likewise, higher hydrogen production rate (143.8 L m-3d-1) is observed using g-C3N4/BiOBr photocathode; while values for g-C3N4 and BiOBr photocathodes are 124.3 L m-3d-1 and 117.1 L m-3d-1, respectively. PL and EIS reveal that superior performance of g-C3N4/BiOBr photocathode can be attributed to more efficient separation of photogenerated electron-hole pairs, lower resistance and better charge transfer. Synergistic effect occurs among biological, electrochemical and photocatalytic processes in illuminated BPES for MO removal. Photocathode optimization and system stability evaluation are conducted. This study demonstrates that the BPES holds great potential for efficient refractory organics degradation and energy production.

Hb Midnapore [β53(D4)Ala→Val; HBB: c.161C>T]: A Novel Hemoglobin Variant with a Structural Abnormality Associated with IVS-I-5 (G>C) (HBB: c.92+5G>C) Found in a Bengali Indian Family.

PubMed

Panja, Amrita; Chowdhury, Prosanto; Basu, Anupam

2016-09-01

We describe a novel C>T substitution at codon 53 of the HBB gene (HBB: c.161C>T). The proband was a transfusion-dependent β-thalassemia major (β-TM) patient. DNA was extracted and subsequently, DNA sequencing was done to detect the mutations on the HBB gene. Capillary zone electrophoresis (CZE) revealed the presence of an unknown peak. She inherited this mutation from her grandmother through her mother. This mutation exists in cis with the common β 0 mutation IVS-I-5 (G>C) (HBB: c.92+5G>C). The proband is homozygous for HBB: c.92+5G>C and needs monthly transfusions. On the other hand, her grandmother, mother and sister all possess this novel mutation cis with the heterozygous HBB: c.92+5G>C. They are carriers not thalassemic. This mutation produces the substitution β53(D4)Ala→Val; HBB: c.161C>T, a new structural hemoglobin (Hb) variant. As this variant was identified in a Bengali family from Paschim Midnapore district of West Bengal, India, it has been designated as Hb Midnapore. This variant has now been reported to the HbVar database.

Recognition of Watson-Crick base pairs: constraints and limits due to geometric selection and tautomerism

PubMed Central

Yusupov, Marat; Yusupova, Gulnara

2014-01-01

The natural bases of nucleic acids have a strong preference for one tautomer form, guaranteeing fidelity in their hydrogen bonding potential. However, base pairs observed in recent crystal structures of polymerases and ribosomes are best explained by an alternative base tautomer, leading to the formation of base pairs with Watson-Crick-like geometries. These observations set limits to geometric selection in molecular recognition of complementary Watson-Crick pairs for fidelity in replication and translation processes. PMID:24765524

Interaction of herpes simplex virus glycoprotein gC with mammalian cell surface molecules.

PubMed Central

Tal-Singer, R; Peng, C; Ponce De Leon, M; Abrams, W R; Banfield, B W; Tufaro, F; Cohen, G H; Eisenberg, R J

1995-01-01

The entry of herpes simplex virus (HSV) into mammalian cells is a multistep process beginning with an attachment step involving glycoproteins gC and gB. A second step requires the interaction of glycoprotein gD with a cell surface molecule. We explored the interaction between gC and the cell surface by using purified proteins in the absence of detergent. Truncated forms of gC and gD, gC1(457t), gC2(426t), and gD1(306t), lacking the transmembrane and carboxyl regions were expressed in the baculovirus system. We studied the ability of these proteins to bind to mammalian cells, to bind to immobilized heparin, to block HSV type 1 (HSV-1) attachment to cells, and to inhibit plaque formation by HSV-1. Each of these gC proteins bound to conformation-dependent monoclonal antibodies and to human complement component C3b, indicating that they maintained the same conformation of gC proteins expressed in mammalian cells. Biotinylated gC1(457t) and gC2(426t) each bind to several cell lines. Binding was inhibited by an excess of unlabeled gC but not by gD, indicating specificity. The attachment of gC to cells involves primarily heparan sulfate proteoglycans, since heparitinase treatment of cells reduced gC binding by 50% but had no effect on gD binding. Moreover, binding of gC to two heparan sulfate-deficient L-cell lines, gro2C and sog9, both of which are mostly resistant to HSV infection, was markedly reduced. Purified gD1 (306t), however, bound equally well to the two mutant cell lines. In contrast, saturating amounts of gC1(457t) interfered with HSV-1 attachment to cells but failed to block plaque formation, suggesting a role for gC in attachment but not penetration. A mutant form of gC lacking residues 33 to 123, gC1(delta 33-123t), expressed in the baculovirus system, bound significantly less well to cells than did gC1(457t) and competed poorly with biotinylated gC1(457t) for binding. These results suggest that residues 33 to 123 are important for gC attachment to cells

Graphene oxide as a structure-directing agent for the two-dimensional interface engineering of sandwich-like graphene-g-C3N4 hybrid nanostructures with enhanced visible-light photoreduction of CO2 to methane.

PubMed

Ong, Wee-Jun; Tan, Lling-Lling; Chai, Siang-Piao; Yong, Siek-Ting

2015-01-18

A facile one-pot impregnation-thermal reduction strategy was employed to fabricate sandwich-like graphene-g-C3N4 (GCN) nanocomposites using urea and graphene oxide as precursors. The GCN sample exhibited a slight red shift of the absorption band edge attributed to the formation of a C-O-C bond as a covalent cross linker between graphene and g-C3N4. The GCN sample demonstrated high visible-light photoactivity towards CO2 reduction under ambient conditions, exhibiting a 2.3-fold enhancement over pure g-C3N4. This was ascribed to the inhibition of electron-hole pair recombination by graphene, which increased the charge transfer.