Sample records for g-c base pairs

  1. [Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

    PubMed

    Brovarets', O O

    2013-01-01

    At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

  2. Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

    PubMed

    Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

    2004-03-01

    A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non

  3. Sequence specificity of mutagen-nucleic acid complexes in solution: intercalation and mutagen-base pair overlap geometries for proflavine binding to dC-dC-dG-dG and dG-dG-dC-dC self-complementary duplexes.

    PubMed

    Patel, D J; Canuel, L L

    1977-07-01

    The complex formed between the mutagen proflavine and the dC-dC-dG-dG and dG-dG-dC-dC self-complementary tetranucleotide duplexes has been monitored by proton high resolution nuclear magnetic resonance spectroscopy in 0.1 M phosphate solution at high nucleotide/drug ratios. The large upfield shifts (0.5 to 0.85 ppm) observed at all the proflavine ring nonexchangeable protons on complex formation are consistent with intercalation of the mutagen between base pairs of the tetranucleotide duplex. We have proposed an approximate overlap geometry between the proflavine ring and nearest neighbor base pairs at the intercalation site from a comparison between experimental shifts and those calculated for various stacking orientations. We have compared the binding of actinomycin D, propidium diiodide, and proflavine to self-complementary tetranucleotide sequences dC-dC-dG-dG and dG-dG-dC-dC by UV absorbance changes in the drug bands between 400 and 500 nm. Actinomycin D exhibits a pronounced specificity for sequences with dG-dC sites (dG-dG-dC-dC), while propidium diiodide and proflavine exhibit a specificity for sequences with dC-dG sites (dC-dC-dG-dG). Actinomycin D binds more strongly than propidium diiodide and proflavine to dC-dG-dC-dG (contains dC-dG and dG-dC binding sites), indicative of the additional stabilization from hydrogen bonding and hydrophobic interactions between the pentapeptide lactone rings of actinomycin D and the base pair edges and sugar-phosphate backbone of the tetranucleotide duplex.

  4. Sequence specificity of mutagen-nucleic acid complexes in solution: Intercalation and mutagen-base pair overlap geometries for proflavine binding to dC-dC-dG-dG and dG-dG-dC-dC self-complementary duplexes

    PubMed Central

    Patel, Dinshaw J.; Canuel, Lita L.

    1977-01-01

    The complex formed between the mutagen proflavine and the dC-dC-dG-dG and dG-dG-dC-dC self-complementary tetranucleotide duplexes has been monitored by proton high resolution nuclear magnetic resonance spectroscopy in 0.1 M phosphate solution at high nucleotide/drug ratios. The large upfield shifts (0.5 to 0.85 ppm) observed at all the proflavine ring nonexchangeable protons on complex formation are consistent with intercalation of the mutagen between base pairs of the tetranucleotide duplex. We have proposed an approximate overlap geometry between the proflavine ring and nearest neighbor base pairs at the intercalation site from a comparison between experimental shifts and those calculated for various stacking orientations. We have compared the binding of actinomycin D, propidium diiodide, and proflavine to self-complementary tetranucleotide sequences dC-dC-dG-dG and dG-dG-dC-dC by UV absorbance changes in the drug bands between 400 and 500 nm. Actinomycin D exhibits a pronounced specificity for sequences with dG-dC sites (dG-dG-dC-dC), while propidium diiodide and proflavine exhibit a specificity for sequences with dC-dG sites (dC-dC-dG-dG). Actinomycin D binds more strongly than propidium diiodide and proflavine to dC-dG-dC-dG (contains dC-dG and dG-dC binding sites), indicative of the additional stabilization from hydrogen bonding and hydrophobic interactions between the pentapeptide lactone rings of actinomycin D and the base pair edges and sugar-phosphate backbone of the tetranucleotide duplex. PMID:268613

  5. Acid-induced exchange of the imino proton in G.C pairs.

    PubMed Central

    Nonin, S; Leroy, J L; Gueron, M

    1996-01-01

    Acid-induced catalysis of imino proton exchange in G.C pairs of DNA duplexes is surprisingly fast, being nearly as fast as for the isolated nucleoside, despite base-pair dissociation constants in the range of 10(-5) at neutral or basic pH. It is also observed in terminal G.C pairs of duplexes and in base pairs of drug-DNA complexes. We have measured imino proton exchange in deoxyguanosine and in the duplex (ATATAGATCTATAT) as a function of pH. We show that acid-induced exchange can be assigned to proton transfer from N7-protonated guanosine to cytidine in the open state of the pair. This is faster than transfer from neutral guanosine (the process of intrinsic catalysis previously characterized at neutral ph) due to the lower imino proton pK of the protonated form, 7.2 instead of 9.4. Other interpretations are excluded by a study of exchange catalysis by formiate and cytidine as exchange catalysts. The cross-over pH between the regimes of pH-independent and acid-induced exchange rates is more basic in the case of base pairs than in the mononucleoside, suggestive of an increase by one to two decades in the dissociation constant of the base pair upon N7 protonation of G. Acid-induced catalysis is much weaker in A.T base pairs, as expected in view of the low pK for protonation of thymidine. PMID:8604298

  6. Acid-induced exchange of the imino proton in G.C pairs.

    PubMed

    Nonin, S; Leroy, J L; Gueron, M

    1996-02-15

    Acid-induced catalysis of imino proton exchange in G.C pairs of DNA duplexes is surprisingly fast, being nearly as fast as for the isolated nucleoside, despite base-pair dissociation constants in the range of 10(-5) at neutral or basic pH. It is also observed in terminal G.C pairs of duplexes and in base pairs of drug-DNA complexes. We have measured imino proton exchange in deoxyguanosine and in the duplex (ATATAGATCTATAT) as a function of pH. We show that acid-induced exchange can be assigned to proton transfer from N7-protonated guanosine to cytidine in the open state of the pair. This is faster than transfer from neutral guanosine (the process of intrinsic catalysis previously characterized at neutral ph) due to the lower imino proton pK of the protonated form, 7.2 instead of 9.4. Other interpretations are excluded by a study of exchange catalysis by formiate and cytidine as exchange catalysts. The cross-over pH between the regimes of pH-independent and acid-induced exchange rates is more basic in the case of base pairs than in the mononucleoside, suggestive of an increase by one to two decades in the dissociation constant of the base pair upon N7 protonation of G. Acid-induced catalysis is much weaker in A.T base pairs, as expected in view of the low pK for protonation of thymidine.

  7. A single Watson-Crick G x C base pair in water: aqueous hydrogen bonds in hydrophobic cavities.

    PubMed

    Sawada, Tomohisa; Fujita, Makoto

    2010-05-26

    Hydrogen bond (H-bond) formation in water has been a challenging task because water molecules are constant competitors. In biological systems, however, stable H-bonds are formed by shielding the H-bonding sites from the competing water molecules within hydrophobic pockets. Inspired by the nature's elaborated way, we found that even mononucleotides (G and C) can form the minimal G x C Watson-Crick pair in water by simply providing a synthetic cavity that efficiently shields the Watson-Crick H-bonding sites. The minimal Watson-Crick structure in water was elucidated by NMR study and firmly characterized by crystallographic analysis. The crystal structure also displays that, within the cavity, coencapsulated anions and solvents efficiently mediate the minimal G x C Watson-Crick pair formation. Furthermore, the competition experiments with the other nucleobases clearly revealed the evident selectivity for the G x C base pairing in water. These results show the fact that a H-bonded nucleobase pair was effectively induced and stabilized in the local environment of an artificial hydrophobic cavity.

  8. Growth properties associated with A-U replacement of specific G-C base pairs in 16S rRNA from Escherichia coli.

    PubMed Central

    Triman, K L

    1995-01-01

    Mutations that disrupt each of seven specific G-C base pairs in 16S rRNA from Escherichia coli confer loss of expression of a plasmid-encoded 16S rRNA selectable marker (spectinomycin resistance). However, A-U replacement of G-C base pairs at nucleotides 359/52 or 1292/1245 in 16S rRNA permits normal expression of the marker. By contrast, A-U replacements at 146/176, 153/168, 350/339, or 1293/1244 are associated with loss of expression of the marker. These genetic studies are designed to determine the importance of specific base pairs by assessment of the structural and functional impairments of 16S rRNA molecules resulting from expression of base pair substitutions at these positions. PMID:7543481

  9. The integrity of the G2421-C2395 base pair in the ribosomal E-site is crucial for protein synthesis

    PubMed Central

    Koch, Miriam; Clementi, Nina; Rusca, Nicola; Vögele, Paul; Erlacher, Matthias; Polacek, Norbert

    2015-01-01

    During the elongation cycle of protein biosynthesis, tRNAs traverse through the ribosome by consecutive binding to the 3 ribosomal binding sites (A-, P-, and E- sites). While the ribosomal A- and P-sites have been functionally well characterized in the past, the contribution of the E-site to protein biosynthesis is still poorly understood in molecular terms. Previous studies suggested an important functional interaction of the terminal residue A76 of E-tRNA with the nucleobase of the universally conserved 23S rRNA residue C2394. Using an atomic mutagenesis approach to introduce non-natural nucleoside analogs into the 23S rRNA, we could show that removal of the nucleobase or the ribose 2'-OH at C2394 had no effect on protein synthesis. On the other hand, our data disclose the importance of the highly conserved E-site base pair G2421-C2395 for effective translation. Ribosomes with a disrupted G2421-C2395 base pair are defective in tRNA binding to the E-site. This results in an impaired translation of genuine mRNAs, while homo-polymeric templates are not affected. Cumulatively our data emphasize the importance of E-site tRNA occupancy and in particular the intactness of the 23S rRNA base pair G2421-C2395 for productive protein biosynthesis. PMID:25826414

  10. Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

    PubMed

    Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

    2018-03-26

    DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Base pairing and base mis-pairing in nucleic acids

    NASA Technical Reports Server (NTRS)

    Wang, A. H. J.; Rich, A.

    1986-01-01

    In recent years we have learned that DNA is conformationally active. It can exist in a number of different stable conformations including both right-handed and left-handed forms. Using single crystal X-ray diffraction analysis we are able to discover not only additional conformations of the nucleic acids but also different types of hydrogen bonded base-base interactions. Although Watson-Crick base pairings are the predominant type of interaction in double helical DNA, they are not the only types. Recently, we have been able to examine mismatching of guanine-thymine base pairs in left-handed Z-DNA at atomic resolution (1A). A minimum amount of distortion of the sugar phosphate backbone is found in the G x T pairing in which the bases are held together by two hydrogen bonds in the wobble pairing interaction. Because of the high resolution of the analysis we can visualize water molecules which fill in to accommodate the other hydrogen bonding positions in the bases which are not used in the base-base interactions. Studies on other DNA oligomers have revealed that other types of non-Watson-Crick hydrogen bonding interactions can occur. In the structure of a DNA octamer with the sequence d(GCGTACGC) complexed to an antibiotic triostin A, it was found that the two central AT base pairs are held together by Hoogsteen rather than Watson-Crick base pairs. Similarly, the G x C base pairs at the ends are also Hoogsteen rather than Watson-Crick pairing. Hoogsteen base pairs make a modified helix which is distinct from the Watson-Crick double helix.

  12. Ultraviolet Absorption Induces Hydrogen-Atom Transfer in G⋅C Watson-Crick DNA Base Pairs in Solution.

    PubMed

    Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M

    2015-12-01

    Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Differential stabilities and sequence-dependent base pair opening dynamics of Watson-Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine.

    PubMed

    Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P

    2015-02-10

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.

  14. Differential Stabilities and Sequence-Dependent Base Pair Opening Dynamics of Watson–Crick Base Pairs with 5-Hydroxymethylcytosine, 5-Formylcytosine, or 5-Carboxylcytosine

    PubMed Central

    2016-01-01

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5′-CG-3′ sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5′-T8X9G10-3′ sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A5:T8, whereas 5caC did not. At the oxidized base pair G4:X9, 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C3:G10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G4:X9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes. PMID:25632825

  15. Differential stabilities and sequence-dependent base pair opening dynamics of Watson–Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine

    DOE PAGES

    Szulik, Marta W.; Pallan, Pradeep S.; Nocek, Boguslaw; ...

    2015-01-29

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T 8X 9G 10-3' sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC didmore » not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A 5:T 8, whereas 5caC did not. At the oxidized base pair G 4:X 9, 5fC exhibited an increase in the imino proton exchange rate and the calculated k op. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C 3:G 10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G 4:X 9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N 4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. Furthermore, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.« less

  16. Molecular recognition of DNA base pairs by the formamido/pyrrole and formamido/imidazole pairings in stacked polyamides

    PubMed Central

    Buchmueller, Karen L.; Staples, Andrew M.; Uthe, Peter B.; Howard, Cameron M.; Pacheco, Kimberly A. O.; Cox, Kari K.; Henry, James A.; Bailey, Suzanna L.; Horick, Sarah M.; Nguyen, Binh; Wilson, W. David; Lee, Moses

    2005-01-01

    Polyamides containing an N-terminal formamido (f) group bind to the minor groove of DNA as staggered, antiparallel dimers in a sequence-specific manner. The formamido group increases the affinity and binding site size, and it promotes the molecules to stack in a staggered fashion thereby pairing itself with either a pyrrole (Py) or an imidazole (Im). There has not been a systematic study on the DNA recognition properties of the f/Py and f/Im terminal pairings. These pairings were analyzed here in the context of f-ImPyPy, f-ImPyIm, f-PyPyPy and f-PyPyIm, which contain the central pairing modes, –ImPy– and –PyPy–. The specificity of these triamides towards symmetrical recognition sites allowed for the f/Py and f/Im terminal pairings to be directly compared by SPR, CD and ΔTM experiments. The f/Py pairing, when placed next to the –ImPy– or –PyPy– central pairings, prefers A/T and T/A base pairs to G/C base pairs, suggesting that f/Py has similar DNA recognition specificity to Py/Py. With –ImPy– central pairings, f/Im prefers C/G base pairs (>10 times) to the other Watson–Crick base pairs; therefore, f/Im behaves like the Py/Im pair. However, the f/Im pairing is not selective for the C/G base pair when placed next to the –PyPy– central pairings. PMID:15703305

  17. Molecular recognition of DNA base pairs by the formamido/pyrrole and formamido/imidazole pairings in stacked polyamides.

    PubMed

    Buchmueller, Karen L; Staples, Andrew M; Uthe, Peter B; Howard, Cameron M; Pacheco, Kimberly A O; Cox, Kari K; Henry, James A; Bailey, Suzanna L; Horick, Sarah M; Nguyen, Binh; Wilson, W David; Lee, Moses

    2005-01-01

    Polyamides containing an N-terminal formamido (f) group bind to the minor groove of DNA as staggered, antiparallel dimers in a sequence-specific manner. The formamido group increases the affinity and binding site size, and it promotes the molecules to stack in a staggered fashion thereby pairing itself with either a pyrrole (Py) or an imidazole (Im). There has not been a systematic study on the DNA recognition properties of the f/Py and f/Im terminal pairings. These pairings were analyzed here in the context of f-ImPyPy, f-ImPyIm, f-PyPyPy and f-PyPyIm, which contain the central pairing modes, -ImPy- and -PyPy-. The specificity of these triamides towards symmetrical recognition sites allowed for the f/Py and f/Im terminal pairings to be directly compared by SPR, CD and DeltaT (M) experiments. The f/Py pairing, when placed next to the -ImPy- or -PyPy- central pairings, prefers A/T and T/A base pairs to G/C base pairs, suggesting that f/Py has similar DNA recognition specificity to Py/Py. With -ImPy- central pairings, f/Im prefers C/G base pairs (>10 times) to the other Watson-Crick base pairs; therefore, f/Im behaves like the Py/Im pair. However, the f/Im pairing is not selective for the C/G base pair when placed next to the -PyPy- central pairings.

  18. Structural features of the DNA hairpin d(ATCCTA-GTTA-TAGGAT): formation of a G-A base pair in the loop.

    PubMed Central

    van Dongen, M J; Mooren, M M; Willems, E F; van der Marel, G A; van Boom, J H; Wijmenga, S S; Hilbers, C W

    1997-01-01

    The three-dimensional structure of the hairpin formed by d(ATCCTA-GTTA-TAGGAT) has been determined by means of two-dimensional NMR studies, distance geometry and molecular dynamics calculations. The first and the last residues of the tetraloop of this hairpin form a sheared G-A base pair on top of the six Watson-Crick base pairs in the stem. The glycosidic torsion angles of the guanine and adenine residues in the G-A base pair reside in the anti and high- anti domain ( approximately -60 degrees ) respectively. Several dihedral angles in the loop adopt non-standard values to accommodate this base pair. The first and second residue in the loop are stacked in a more or less normal helical fashion; the fourth loop residue also stacks upon the stem, while the third residue is directed away from the loop region. The loop structure can be classified as a so-called type-I loop, in which the bases at the 5'-end of the loop stack in a continuous fashion. In this situation, loop stability is unlikely to depend heavily on the nature of the unpaired bases in the loop. Moreover, the present study indicates that the influence of the polarity of a closing A.T pair is much less significant than that of a closing C.G base pair. PMID:9092659

  19. Comparison of the conformation of an oligonucleotide containing a central G-T base pair with the non-mismatch sequence by proton NMR.

    PubMed Central

    Quignard, E; Fazakerley, G V; van der Marel, G; van Boom, J H; Guschlbauer, W

    1987-01-01

    We have recorded NOESY spectra of two non-selfcomplementary undecanucleotide duplexes. From the observed NOEs we do not detect any significant distortion of the helix when a G-C pair is replaced by a G-T pair and the normal interresidue connectivities can be followed through the mismatch site. We conclude that the 2D spectra of the non-exchangeable protons do not allow differentiation between a wobble or rare tautomer form for the mismatch. NOE measurements in H2O, however, clearly show that the mismatch adopts a wobble structure and give information on the hydration in the minor groove for the G-T base pair which is embedded between two A-T base pairs in the sequence. PMID:3033602

  20. Influence of C-5 substituted cytosine and related nucleoside analogs on the formation of benzo[a]pyrene diol epoxide-dG adducts at CG base pairs of DNA

    PubMed Central

    Guza, Rebecca; Kotandeniya, Delshanee; Murphy, Kristopher; Dissanayake, Thakshila; Lin, Chen; Giambasu, George Madalin; Lad, Rahul R.; Wojciechowski, Filip; Amin, Shantu; Sturla, Shana J.; Hudson, Robert H.E.; York, Darrin M.; Jankowiak, Ryszard; Jones, Roger; Tretyakova, Natalia Y.

    2011-01-01

    Endogenous 5-methylcytosine (MeC) residues are found at all CG dinucleotides of the p53 tumor suppressor gene, including the mutational ‘hotspots’ for smoking induced lung cancer. MeC enhances the reactivity of its base paired guanine towards carcinogenic diolepoxide metabolites of polycyclic aromatic hydrocarbons (PAH) present in cigarette smoke. In the present study, the structural basis for these effects was investigated using a series of unnatural nucleoside analogs and a representative PAH diolepoxide, benzo[a]pyrene diolepoxide (BPDE). Synthetic DNA duplexes derived from a frequently mutated region of the p53 gene (5′-CCCGGCACCC GC[15N3,13C1-G]TCCGCG-3′, + strand) were prepared containing [15N3, 13C1]-guanine opposite unsubstituted cytosine, MeC, abasic site, or unnatural nucleobase analogs. Following BPDE treatment and hydrolysis of the modified DNA to 2′-deoxynucleosides, N2-BPDE-dG adducts formed at the [15N3, 13C1]-labeled guanine and elsewhere in the sequence were quantified by mass spectrometry. We found that C-5 alkylcytosines and related structural analogs specifically enhance the reactivity of the base paired guanine towards BPDE and modify the diastereomeric composition of N2-BPDE-dG adducts. Fluorescence and molecular docking studies revealed that 5-alkylcytosines and unnatural nucleobase analogs with extended aromatic systems facilitate the formation of intercalative BPDE–DNA complexes, placing BPDE in a favorable orientation for nucleophilic attack by the N2 position of guanine. PMID:21245046

  1. Influence of C-5 substituted cytosine and related nucleoside analogs on the formation of benzo[a]pyrene diol epoxide-dG adducts at CG base pairs of DNA.

    PubMed

    Guza, Rebecca; Kotandeniya, Delshanee; Murphy, Kristopher; Dissanayake, Thakshila; Lin, Chen; Giambasu, George Madalin; Lad, Rahul R; Wojciechowski, Filip; Amin, Shantu; Sturla, Shana J; Hudson, Robert H E; York, Darrin M; Jankowiak, Ryszard; Jones, Roger; Tretyakova, Natalia Y

    2011-05-01

    Endogenous 5-methylcytosine ((Me)C) residues are found at all CG dinucleotides of the p53 tumor suppressor gene, including the mutational 'hotspots' for smoking induced lung cancer. (Me)C enhances the reactivity of its base paired guanine towards carcinogenic diolepoxide metabolites of polycyclic aromatic hydrocarbons (PAH) present in cigarette smoke. In the present study, the structural basis for these effects was investigated using a series of unnatural nucleoside analogs and a representative PAH diolepoxide, benzo[a]pyrene diolepoxide (BPDE). Synthetic DNA duplexes derived from a frequently mutated region of the p53 gene (5'-CCCGGCACCC GC[(15)N(3),(13)C(1)-G]TCCGCG-3', + strand) were prepared containing [(15)N(3), (13)C(1)]-guanine opposite unsubstituted cytosine, (Me)C, abasic site, or unnatural nucleobase analogs. Following BPDE treatment and hydrolysis of the modified DNA to 2'-deoxynucleosides, N(2)-BPDE-dG adducts formed at the [(15)N(3), (13)C(1)]-labeled guanine and elsewhere in the sequence were quantified by mass spectrometry. We found that C-5 alkylcytosines and related structural analogs specifically enhance the reactivity of the base paired guanine towards BPDE and modify the diastereomeric composition of N(2)-BPDE-dG adducts. Fluorescence and molecular docking studies revealed that 5-alkylcytosines and unnatural nucleobase analogs with extended aromatic systems facilitate the formation of intercalative BPDE-DNA complexes, placing BPDE in a favorable orientation for nucleophilic attack by the N(2) position of guanine. © The Author(s) 2011. Published by Oxford University Press.

  2. High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

    PubMed

    Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2015-11-02

    Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Why the tautomerization of the G·C Watson-Crick base pair via the DPT does not cause point mutations during DNA replication? QM and QTAIM comprehensive analysis.

    PubMed

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2014-01-01

    The ground-state tautomerization of the G·C Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4), corresponding to a hydrophobic interface of protein-nucleic acid interactions, using DFT and MP2 levels of quantum-mechanical (QM) theory and quantum theory "Atoms in molecules" (QTAIM). Based on the sweeps of the electron-topological, geometric, polar, and energetic parameters, which describe the course of the G·C ↔ G*·C* tautomerization (mutagenic tautomers of the G and C bases are marked with an asterisk) through the DPT along the intrinsic reaction coordinate (IRC), it was proved that it is, strictly speaking, a concerted asynchronous process both at the DFT and MP2 levels of theory, in which protons move with a small time gap in vacuum, while this time delay noticeably increases in the continuum with ϵ = 4. It was demonstrated using the conductor-like polarizable continuum model (CPCM) that the continuum with ϵ = 4 does not qualitatively affect the course of the tautomerization reaction. The DPT in the G·C Watson-Crick base pair occurs without any intermediates both in vacuum and in the continuum with ϵ = 4 at the DFT/MP2 levels of theory. The nine key points along the IRC of the G·C base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These key points have been used to define the reactant, transition state, and product regions of the DPT reaction in the G·C base pair. Analysis of the energetic characteristics of the H-bonds allows us to arrive at a definite conclusion that the middle N1H⋯N3/N3H⋯N1 and the lower N2H⋯O2/N2H⋯O2 parallel H-bonds in the G·C/G*·C* base pairs, respectively, are anticooperative, that is, the strengthening of the middle H-bond is accompanied

  4. Higher order structural effects stabilizing the reverse Watson–Crick Guanine-Cytosine base pair in functional RNAs

    PubMed Central

    Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi

    2014-01-01

    The G:C reverse Watson–Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. PMID:24121683

  5. Influence of Hydration on Proton Transfer in the Guanine-Cytosine Radical Cation (G•+-C) Base Pair: A Density Functional Theory Study

    PubMed Central

    Kumar, Anil; Sevilla, Michael D.

    2009-01-01

    On one-electron oxidation all molecules including DNA bases become more acidic in nature. For the GC base pair experiments suggest that a facile proton transfer takes place in the G•+-C base pair from N1 of G•+ to N3 of cytosine. This intra-base pair proton transfer reaction has been extensively considered using theoretical methods for the gas phase and it is predicted that the proton transfer is slightly unfavorable in disagreement with experiment. In the present study, we consider the effect of the first hydration layer on the proton transfer reaction in G•+-C by the use of density functional theory (DFT), B3LYP/6-31+G** calculations of the G•+-C base pair in the presence of 6 and 11 water molecules. Under the influence of hydration of 11 waters, a facile proton transfer from N1 of G•+ to N3 of C is predicted. The zero point energy (ZPE) corrected forward and backward energy barriers, for the proton transfer from N1 of G•+ to N3 of C, was found to be 1.4 and 2.6 kcal/mol, respectively. The proton transferred G•-(H+)C + 11H2O was found to be 1.2 kcal/mol more stable than G•+-C + 11H2O in agreement with experiment. The present calculation demonstrates that the inclusion of the first hydration shell around G•+-C base pair has an important effect on the internal proton transfer energetics. PMID:19485319

  6. An indole-linked C8-deoxyguanosine nucleoside acts as a fluorescent reporter of Watson-Crick versus Hoogsteen base pairing.

    PubMed

    Schlitt, Katherine M; Millen, Andrea L; Wetmore, Stacey D; Manderville, Richard A

    2011-03-07

    Pyrrole- and indole-linked C(8)-deoxyguanosine nucleosides act as fluorescent reporters of H-bonding specificity. Their fluorescence is quenched upon Watson-Crick H-bonding to dC, while Hoogsteen H-bonding to G enhances emission intensity. The indole-linked probe is ∼ 10-fold brighter and shows promise as a fluorescent reporter of Hoogsteen base pairing.

  7. Loss of G-A base pairs is insufficient for achieving a large opening of U4 snRNA K-turn motif.

    PubMed

    Cojocaru, Vlad; Klement, Reinhard; Jovin, Thomas M

    2005-01-01

    Upon binding to the 15.5K protein, two tandem-sheared G-A base pairs are formed in the internal loop of the kink-turn motif of U4 snRNA (Kt-U4). We have reported that the folding of Kt-U4 is assisted by protein binding. Unstable interactions that contribute to a large opening of the free RNA ('k-e motion') were identified using locally enhanced sampling molecular dynamics simulations, results that agree with experiments. A detailed analysis of the simulations reveals that the k-e motion in Kt-U4 is triggered both by loss of G-A base pairs in the internal loop and backbone flexibility in the stems. Essential dynamics show that the loss of G-A base pairs is correlated along the first mode but anti-correlated along the third mode with the k-e motion. Moreover, when enhanced sampling was confined to the internal loop, the RNA adopted an alternative conformation characterized by a sharper kink, opening of G-A base pairs and modified stacking interactions. Thus, loss of G-A base pairs is insufficient for achieving a large opening of the free RNA. These findings, supported by previously published RNA structure probing experiments, suggest that G-A base pair formation occurs upon protein binding, thereby stabilizing a selective orientation of the stems.

  8. Hydrogen bond disruption in DNA base pairs from (14)C transmutation.

    PubMed

    Sassi, Michel; Carter, Damien J; Uberuaga, Blas P; Stanek, Christopher R; Mancera, Ricardo L; Marks, Nigel A

    2014-09-04

    Recent ab initio molecular dynamics simulations have shown that radioactive carbon does not normally fragment DNA bases when it decays. Motivated by this finding, density functional theory and Bader analysis have been used to quantify the effect of C → N transmutation on hydrogen bonding in DNA base pairs. We find that (14)C decay has the potential to significantly alter hydrogen bonds in a variety of ways including direct proton shuttling (thymine and cytosine), thermally activated proton shuttling (guanine), and hydrogen bond breaking (cytosine). Transmutation substantially modifies both the absolute and relative strengths of the hydrogen bonding pattern, and in two instances (adenine and cytosine), the density at the critical point indicates development of mild covalent character. Since hydrogen bonding is an important component of Watson-Crick pairing, these (14)C-induced modifications, while infrequent, may trigger errors in DNA transcription and replication.

  9. Thermodynamics of triple helix formation: spectrophotometric studies on the d(A)10.2d(T)10 and d(C+3T4C+3).d(G3A4G3).d(C3T4C3) triple helices.

    PubMed Central

    Pilch, D S; Brousseau, R; Shafer, R H

    1990-01-01

    We have stabilized the d(A)10.2d(T)10 and d(C+LT4C+3).d(G3A4G3).d(C3T4C3) triple helices with either NaCl or MgCl2 at pH 5.5. UV mixing curves demonstrate a 1:2 stoichiometry of purine to pyrimidine strands under the appropriate conditions of pH and ionic strength. Circular dichroic titrations suggest a possible sequence-independent spectral signature for triplex formation. Thermal denaturation profiles indicate the initial loss of the third strand followed by dissociation of the underlying duplex with increasing temperature. Depending on the base sequence and ionic conditions, the binding affinity of the third strand for the duplex at 25 degrees C is two to five orders of magnitude lower than that of the two strands forming the duplex. Thermodynamic parameters for triplex formation were determined for both sequences in the presence of 50 mM MgCl2 and/or 2.0 M NaCl. Hoogsteen base pairs are 0.22-0.64 kcal/mole less stable than Watson-Crick base pairs, depending on ionic conditions and base composition. C+.G and T.A Hoogsteen base pairs appear to have similar stability in the presence of Mg2+ ions at low pH. PMID:2216768

  10. Recognition of T·G mismatched base pairs in DNA by stacked imidazole-containing polyamides: surface plasmon resonance and circular dichroism studies

    PubMed Central

    Lacy, Eilyn R.; Cox, Kari K.; Wilson, W. David; Lee, Moses

    2002-01-01

    An imidazole-containing polyamide trimer, f-ImImIm, where f is a formamido group, was recently found using NMR methods to recognize T·G mismatched base pairs. In order to characterize in detail the T·G recognition affinity and specificity of imidazole-containing polyamides, f-ImIm, f-ImImIm and f-PyImIm were synthesized. The kinetics and thermodynamics for the polyamides binding to Watson–Crick and mismatched (containing one or two T·G, A·G or G·G mismatched base pairs) hairpin oligonucleotides were determined by surface plasmon resonance and circular dichroism (CD) methods. f-ImImIm binds significantly more strongly to the T·G mismatch-containing oligonucleotides than to the sequences with other mismatched or with Watson–Crick base pairs. Compared with the Watson–Crick CCGG sequence, f-ImImIm associates more slowly with DNAs containing T·G mismatches in place of one or two C·G base pairs and, more importantly, the dissociation rate from the T·G oligonucleotides is very slow (small kd). These results clearly demonstrate the binding selectivity and enhanced affinity of side-by-side imidazole/imidazole pairings for T·G mismatches and show that the affinity and specificity increase arise from much lower kd values with the T·G mismatched duplexes. CD titration studies of f-ImImIm complexes with T·G mismatched sequences produce strong induced bands at ∼330 nm with clear isodichroic points, in support of a single minor groove complex. CD DNA bands suggest that the complexes remain in the B conformation. PMID:11937638

  11. Effect of Watson-Crick and Hoogsteen base pairing on the conformational stability of C8-phenoxyl-2'-deoxyguanosine adducts.

    PubMed

    Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D

    2010-10-14

    Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which

  12. Ni2+-binding RNA motifs with an asymmetric purine-rich internal loop and a G-A base pair.

    PubMed Central

    Hofmann, H P; Limmer, S; Hornung, V; Sprinzl, M

    1997-01-01

    RNA molecules with high affinity for immobilized Ni2+ were isolated from an RNA pool with 50 randomized positions by in vitro selection-amplification. The selected RNAs preferentially bind Ni2+ and Co2+ over other cations from first series transition metals. Conserved structure motifs, comprising about 15 nt, were identified that are likely to represent the Ni2+ binding sites. Two conserved motifs contain an asymmetric purine-rich internal loop and probably a mismatch G-A base pair. The structure of one of these motifs was studied with proton NMR spectroscopy and formation of the G-A pair at the junction of helix and internal loop was demonstrated. Using Ni2+ as a paramagnetic probe, a divalent metal ion binding site near this G-A base pair was identified. Ni2+ ions bound to this motif exert a specific stabilization effect. We propose that small asymmetric purine-rich loops that contain a G-A interaction may represent a divalent metal ion binding site in RNA. PMID:9409620

  13. m1A and m1G Potently Disrupt A-RNA Structure Due to the Intrinsic Instability of Hoogsteen Base Pairs

    PubMed Central

    Zhou, Huiqing; Kimsey, Isaac J.; Nikolova, Evgenia N.; Sathyamoorthy, Bharathwaj; Grazioli, Gianmarc; McSally, James; Bai, Tianyu; Wunderlich, Christoph H.; Kreutz, Christoph; Andricioaei, Ioan; Al-Hashimi, Hashim M.

    2016-01-01

    The B-DNA double helix can dynamically accommodate G–C and A–T base pairs in either Watson-Crick or Hoogsteen configurations. Here, we show that G–C+ and A–U Hoogsteen base pairs are strongly disfavored in A-RNA. As a result, N1-methyl adenosine and N1-methyl guanosine, which occur in DNA as a form of alkylation damage, and in RNA as a posttranscriptional modification, have dramatically different consequences. They create G–C+ and A–U Hoogsteen base pairs in duplex DNA that maintain the structural integrity of the double helix, but block base pairing all together and induce local duplex melting in RNA, providing a mechanism for potently disrupting RNA structure through posttranscriptional modifications. The markedly different propensities to form Hoogsteen base pairs in B-DNA and A-RNA may help meet the opposing requirements of maintaining genome stability on one hand, and dynamically modulating the structure of the epitranscriptome on the other. PMID:27478929

  14. Role of 6-Mercaptopurine in the potential therapeutic targets DNA base pairs and G-quadruplex DNA: insights from quantum chemical and molecular dynamics simulations.

    PubMed

    Radhika, R; Shankar, R; Vijayakumar, S; Kolandaivel, P

    2018-05-01

    The theoretical studies on DNA with the anticancer drug 6-Mercaptopurine (6-MP) are investigated using theoretical methods to shed light on drug designing. Among the DNA base pairs considered, 6-MP is stacked with GC with the highest interaction energy of -46.19 kcal/mol. Structural parameters revealed that structure of the DNA base pairs is deviated from the planarity of the equilibrium position due to the formation of hydrogen bonds and stacking interactions with 6-MP. These deviations are verified through the systematic comparison between X-H bond contraction and elongation and the associated blue shift and red shift values by both NBO analysis and vibrational analysis. Bent's rule is verified for the C-H bond contraction in the 6-MP interacted base pairs. The AIM results disclose that the higher values of electron density (ρ) and Laplacian of electron density (∇ 2 ρ) indicate the increased overlap between the orbitals that represent the strong interaction and positive values of the total electron density show the closed-shell interaction. The relative sensitivity of the chemical shift values for the DNA base pairs with 6-MP is investigated to confirm the hydrogen bond strength. Molecular dynamics simulation studies of G-quadruplex DNA d(TGGGGT) 4 with 6-MP revealed that the incorporation of 6-MP appears to cause local distortions and destabilize the G-quadruplex DNA.

  15. Imidazopyridine/Pyrrole and hydroxybenzimidazole/pyrrole pairs for DNA minor groove recognition.

    PubMed

    Renneberg, Dorte; Dervan, Peter B

    2003-05-14

    The DNA binding properties of fused heterocycles imidazo[4,5-b]pyridine (Ip) and hydroxybenzimidazole (Hz) paired with pyrrole (Py) in eight-ring hairpin polyamides are reported. The recognition profile of Ip/Py and Hz/Py pairs were compared to the five-membered ring pairs Im/Py and Hp/Py on a DNA restriction fragment at four 6-base pair recognition sites which vary at a single position 5'-TGTNTA-3', where N = G, C, T, A. The Ip/Py pair distinguishes G.C from C.G, T.A, and A.T, and the Hz/Py pair distinguishes T.A from A.T, G.C, and C.G, affording a new set of heterocycle pairs to target the four Watson-Crick base pairs in the minor groove of DNA.

  16. Graphene and g-C3N4 based photocatalysts for NOx removal: A review

    NASA Astrophysics Data System (ADS)

    Nikokavoura, Aspasia; Trapalis, Christos

    2018-02-01

    NOx liberated into atmosphere from automobile exhausts and fossil fuel combustion, comprise the major air pollutants. They are responsible for serious environmental problems such as acid rain, ozone accumulation, haze and photochemical smog. Besides they contribute to the deterioration of human health by causing decrease of the lung function and respiratory problems. The application of photocatalytic methods in order to mitigate the presence of NOx in the atmosphere is preferable as they are environmentally friendly, mild and low cost. Therefore, in this review, the photocatalytic activity of g-C3N4 and graphene based composites towards NOx removal was discussed. NOx oxidation to non volatile nitrates on the surface of graphene and g-C3N4 based photocatalysts has attracted much interest during the last years due to their structures with unique features such as large specific surface area, thermal and chemical stability and enhanced visible light utilization. The formation of 2D-2D intimate heterojunctions between graphene or g-C3N4 and other components ensures the enhanced charge transfer, lifetime of electron/hole pairs and thus photocatalytic activity. The increased visible light harvesting also contributes to their usefulness as effective photocatalytic materials. In the present work, the advantages of these novel photocatalysts and the differences/similarities between them were exhaustively highlighted. The role of graphene as catalyst promoter, electron reservoir, support and photosensitizer in its photocatalytic composites was emphasized. The effect of g-C3N4 doping and copolymerization with metals/semiconductors on its photocatalytic activity towards NOx oxidation was thoroughly discussed. Besides, the preparation methods, photocatalytic efficiencies, type of irradiation, utilization of appropriate cocatalysts, and reaction mechanisms during the photocatalytic NOx removal by graphene and g-C3N4 composies, were summarized. It was demonstrated that in the vast

  17. Lewis pair polymerization by classical and frustrated Lewis pairs: acid, base and monomer scope and polymerization mechanism.

    PubMed

    Zhang, Yuetao; Miyake, Garret M; John, Mallory G; Falivene, Laura; Caporaso, Lucia; Cavallo, Luigi; Chen, Eugene Y-X

    2012-08-14

    Classical and frustrated Lewis pairs (LPs) of the strong Lewis acid (LA) Al(C(6)F(5))(3) with several Lewis base (LB) classes have been found to exhibit exceptional activity in the Lewis pair polymerization (LPP) of conjugated polar alkenes such as methyl methacrylate (MMA) as well as renewable α-methylene-γ-butyrolactone (MBL) and γ-methyl-α-methylene-γ-butyrolactone (γ-MMBL), leading to high molecular weight polymers, often with narrow molecular weight distributions. This study has investigated a large number of LPs, consisting of 11 LAs as well as 10 achiral and 4 chiral LBs, for LPP of 12 monomers of several different types. Although some more common LAs can also be utilized for LPP, Al(C(6)F(5))(3)-based LPs are far more active and effective than other LA-based LPs. On the other hand, several classes of LBs, when paired with Al(C(6)F(5))(3), can render highly active and effective LPP of MMA and γ-MMBL; such LBs include phosphines (e.g., P(t)Bu(3)), chiral chelating diphosphines, N-heterocyclic carbenes (NHCs), and phosphazene superbases (e.g., P(4)-(t)Bu). The P(4)-(t)Bu/Al(C(6)F(5))(3) pair exhibits the highest activity of the LP series, with a remarkably high turn-over frequency of 9.6 × 10(4) h(-1) (0.125 mol% catalyst, 100% MMA conversion in 30 s, M(n) = 2.12 × 10(5) g mol(-1), PDI = 1.34). The polymers produced by LPs at RT are typically atactic (P(γ)MMBL with ∼47% mr) or syndio-rich (PMMA with ∼70-75% rr), but highly syndiotactic PMMA with rr ∼91% can be produced by chiral or achiral LPs at -78 °C. Mechanistic studies have identified and structurally characterized zwitterionic phosphonium and imidazolium enolaluminates as the active species of the current LPP system, which are formed by the reaction of the monomer·Al(C(6)F(5))(3) adduct with P(t)Bu(3) and NHC bases, respectively. Kinetic studies have revealed that the MMA polymerization by the (t)Bu(3)P/Al(C(6)F(5))(3) pair is zero-order in monomer concentration after an initial

  18. A Bridging Water Anchors the Tethered 5-(3-Aminopropyl)-2′-deoxyuridine Amine in the DNA Major Groove Proximate to the N+2 C·G Base Pair: Implications for Formation of Interstrand 5′-GNC-3′ Cross-Links by Nitrogen Mustards‡

    PubMed Central

    Wang, Feng; Li, Feng; Ganguly, Manjori; Marky, Luis A.; Gold, Barry; Egli, Martin; Stone, Michael P.

    2009-01-01

    Site-specific insertion of 5-(3-aminopropyl)-2′-deoxyuridine (Z3dU) and 7-deaza-dG into the Dickerson-Drew dodecamers 5′-d(C1G2C3G4A5A6T7T8C9Z10C11G12)-3′ · 5′-d(C13G14C15G16A17A18T19T20-C21Z22C23G24)-3′ (named DDDZ10) and 5′-d(C1G2C3G4A5A6T7X8C9Z10C11G12)-3′ · 5′-d(C13G14C15G16A17A18-T19X20C21Z22C23G24)-3′ (named DDD2+Z10)(X = Z3dU; Z = 7-deaza-dG) suggests a mechanism underlying the formation of interstrand N+2 DNA cross-links by nitrogen mustards, e.g., melphalan and mechlorethamine. Analysis of the DDD2+Z10 duplex reveals that the tethered cations at base pairs A5 · X20 and X8 · A17 extend within the major groove in the 3′-direction, toward conserved Mg2+ binding sites located adjacent to N+2 base pairs C3 · Z22 and Z10 · C15. Bridging waters located between the tethered amines and either Z10 or Z22 O6 stabilize the tethered cations and allow interactions with the N + 2 base pairs without DNA bending. Incorporation of 7-deaza-dG into the DDD2+Z10 duplex weakens but does not eliminate electrostatic interactions between tethered amines and Z10 O6 and Z22 O6. The results suggest a mechanism by which tethered N7-dG aziridinium ions, the active species involved in formation of interstrand 5′-GNC-3′ cross-links by nitrogen mustards, modify the electrostatics of the major groove and position the aziridinium ions proximate to the major groove edge of the N+2 C · G base pair, facilitating interstrand cross-linking. PMID:18549246

  19. Roles of the amino group of purine bases in the thermodynamic stability of DNA base pairing.

    PubMed

    Nakano, Shu-ichi; Sugimoto, Naoki

    2014-08-05

    The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I) and 2'-deoxyribo-2,6-diaminopurine (D) as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: GC > D • T ≈ I • C > A • T > G • T > I • T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.

  20. Incorporating a guanidine-modified cytosine base into triplex-forming PNAs for the recognition of a C-G pyrimidine–purine inversion site of an RNA duplex

    PubMed Central

    Toh, Desiree-Faye Kaixin; Devi, Gitali; Patil, Kiran M.; Qu, Qiuyu; Maraswami, Manikantha; Xiao, Yunyun; Loh, Teck Peng; Zhao, Yanli; Chen, Gang

    2016-01-01

    RNA duplex regions are often involved in tertiary interactions and protein binding and thus there is great potential in developing ligands that sequence-specifically bind to RNA duplexes. We have developed a convenient synthesis method for a modified peptide nucleic acid (PNA) monomer with a guanidine-modified 5-methyl cytosine base. We demonstrated by gel electrophoresis, fluorescence and thermal melting experiments that short PNAs incorporating the modified residue show high binding affinity and sequence specificity in the recognition of an RNA duplex containing an internal inverted Watson-Crick C-G base pair. Remarkably, the relatively short PNAs show no appreciable binding to DNA duplexes or single-stranded RNAs. The attached guanidine group stabilizes the base triple through hydrogen bonding with the G base in a C-G pair. Selective binding towards an RNA duplex over a single-stranded RNA can be rationalized by the fact that alkylation of the amine of a 5-methyl C base blocks the Watson–Crick edge. PNAs incorporating multiple guanidine-modified cytosine residues are able to enter HeLa cells without any transfection agent. PMID:27596599

  1. Anomalous scaling of Δ C versus T c in the Fe-based superconductors: the $${S}_{\\pm }$$-wave pairing state model

    DOE PAGES

    Bang, Yunkyu; Stewart, G. R.

    2016-02-01

    The strong power law behavior of the specific heat jumpmore » $${\\rm{\\Delta }}C\\;$$ versus T c $$({\\rm{\\Delta }}C/{T}_{{\\rm{c}}}\\sim {T}_{{\\rm{c}}}^{\\alpha },\\alpha \\approx 2)$$, first observed by Bud'ko et al (2009 Phys. Rev. B 79 220516), has been confirmed with several families of the Fe-based superconducting compounds with various dopings. We tested a minimal two band BCS model to understand this anomalous behavior and showed that this non-BCS relation between $${\\rm{\\Delta }}C\\;$$ versus T c is a generic property of the multiband superconducting state paired by a dominant interband interaction ($${V}_{\\mathrm{inter}}\\gt {V}_{\\mathrm{intra}}$$) reflecting the relation $$\\frac{{{\\rm{\\Delta }}}_{{\\rm{h}}}}{{{\\rm{\\Delta }}}_{{\\rm{e}}}}\\sim \\sqrt{\\frac{{N}_{{\\rm{e}}}}{{N}_{{\\rm{h}}}}}$$ near T c, as in the $${S}_{\\pm }$$-wave pairing state. We also found that this $${\\rm{\\Delta }}C\\;$$ versus T c power law can continuously change from the ideal BNC scaling to a considerable deviation by a moderate variation of the impurity scattering rate $${{\\rm{\\Gamma }}}_{0}$$ (non-pair-breaking). Finally, as a result, our model provides a consistent explanation why the electron-doped Fe-based superconductors follow the ideal BNC scaling very well while the hole-doped systems often show varying degree of deviations.« less

  2. A Bridging Water Anchors the Tethered 5-(3-Aminopropyl)-2′-deoxyuridine Amine in the DNA Major Groove Proximate to the N+2 C·G Base Pair: Implications for Formation of Interstrand 5′-GNC-3′ Cross-Links by Nitrogen Mustards

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Feng; Li, Feng; Ganguly, Manjori

    2008-11-14

    Site-specific insertion of t-(3-aminopropyl)-2'-deoxyuridine (Z3dU) and 7-deaza-dG into the Dickerson-Drew dodecamers 5'-d(C{sup 1}G{sup 2}C{sup 3}G{sup 4}A{sup 5}A{sup 6}T{sup 7}T{sup 8}C{sup 9}{und Z}{sup 10}C{sup 11}G{sup 12})-3'{center_dot}5'-d (C{sup 13}G{sup 14}C{sup 15}G{sup 16}A{sup 17}A{sup 18}T{sup 19}T{sup 20}C{sup 21}{und Z}{sup 22}C{sup 23}G{sup 24})-3' (named DDD{sup Z10}) and 5'-d(C{sup 1}G{sup 2}C{sup 3}G{sup 4}A{sup 5}A{sup 6}T{sup 7}{und X}{sup 20}C{sup 21}{und Z}{sup 22}C{sup 23}G{sup 24})-3' (named DDD{sup 2+Z10}) (X = 73dU; Z = 7-deaza-dG) suggests a mechanism underlying the formation of interstrand N+2 DNA cross-links by nitrogen mustards, e.g., melphalan and mechlorethamine. Analysis of the DDD{sup 2+Z10} duplex reveals that the tethered cations at base pairs A{supmore » 5}{center_dot}X{sup 20} and X{sup 8}{center_dot}A{sup 17} extend within the major groove in the 3'-direction, toward conserved Mg{sup 2+} binding sites located adjacent to N+2 base pairs C{sup 3}{center_dot}Z{sup 22} and Z{sup 10}{center_dot}C{sup 15}. Bridging waters located between the tethered amines and either Z{sup 10} or Z{sup 22} O{sup 6} stabilize the tethered cations and allow interactions with the N + 2 base pairs without DNA bending. Incorporation of 7-deaza-dG into the DDD{sup 2+Z10} duplex weakens but does not eliminate electrostatic interactions between tethered amines and Z{sup 10} O{sup 6} and Z{sup 22} O{sup 6}. The results suggest a mechanism by which tethered N7-dG aziridinium ions, the active species involved in formation of interstrand 5'-GNC-3' cross-links by nitrogen mustards, modify the electrostatics of the major groove and position the aziridinium ions proximate to the major groove edge of the N+2 C{center_dot}G base pair, facilitating interstrand cross-linking.« less

  3. Ultrashort fluorescence lifetimes of hydrogen-bonded base pairs of guanosine and cytidine in solution.

    PubMed

    Schwalb, Nina K; Michalak, Thomas; Temps, Friedrich

    2009-12-24

    The optically excited electronic states of hydrogen-bonded homo- and heterodimers of guanosine (G) and deoxycytidine (C) were investigated by femtosecond fluorescence up-conversion spectroscopy. The base pairs were prepared in CHCl(3) solution by employing tert-butyldimethylsilyl (TBDMS) groups at the OH positions of the ribose (G) or deoxyribose (C) moieties to enhance the solubilities of the nucleosides in organic solvents. The H-bonded complexes that were obtained were characterized by FTIR spectroscopy. Fluorescence lifetime measurements were performed following electronic excitation at a series of UV wavelengths from lambda(pump) = 294 nm, close to the electronic origins of the bases, to lambda(pump) = 262 nm, where significant excess vibronic energy is deposited in the molecules, at nucleoside concentrations of c(0) = 0.1 and 1.0 mM. The experimental results revealed the existence of an ultrafast deactivation pathway for the optically prepared electronically excited state(s) of the G.C Watson-Crick base pair, which was found to have a lifetime of tau(GC) = 0.30(3) ps (with 2sigma error limits) irrespective of the pump wavelength. A similar short decay time, tau(GG) = 0.32(2) ps, was observed for the respective excited G.G homodimer. In contrast, the excited G monomer displayed a significantly longer-lived and wavelength-dependent deactivation, requiring three time constants, between 0.43(6) ps < or = tau(G,1) < or = 1.2(1) ps, 4.2(8) ps < or = tau(G,2) < or = 8(1) ps, and tau(G,3) = 195(32) ps. Self-complexation of C, on the other hand, led to a longer-lived excited state with a lifetime estimated between 1 ps < or = tau(CC) < or = 10 ps, compared to the dominant initial subpicosecond decay time of the C monomer of tau(C,1) = 0.80(4) ps.

  4. A review on g-C3N4-based photocatalysts

    NASA Astrophysics Data System (ADS)

    Wen, Jiuqing; Xie, Jun; Chen, Xiaobo; Li, Xin

    2017-01-01

    As one of the most appealing and attractive technologies, heterogeneous photocatalysis has been utilized to directly harvest, convert and store renewable solar energy for producing sustainable and green solar fuels and a broad range of environmental applications. Due to their unique physicochemical, optical and electrical properties, a wide variety of g-C3N4-based photocatalysts have been designed to drive various reduction and oxidation reactions under light irradiation with suitable wavelengths. In this review, we have systematically summarized the photocatalytic fundamentals of g-C3N4-based photocatalysts, including fundamental mechanism of heterogeneous photocatalysis, advantages, challenges and the design considerations of g-C3N4-based photocatalysts. The versatile properties of g-C3N4-based photocatalysts are highlighted, including their crystal structural, surface phisicochemical, stability, optical, adsorption, electrochemical, photoelectrochemical and electronic properties. Various design strategies are also thoroughly reviewed, including band-gap engineering, defect control, dimensionality tuning, pore texture tailoring, surface sensitization, heterojunction construction, co-catalyst and nanocarbon loading. Many important applications are also addressed, such as photocatalytic water splitting (H2 evolution and overall water splitting), degradation of pollutants, carbon dioxide reduction, selective organic transformations and disinfection. Through reviewing the important state-of-the-art advances on this topic, it may provide new opportunities for designing and constructing highly effective g-C3N4-based photocatalysts for various applications in photocatalysis and other related fields, such as solar cell, photoelectrocatalysis, electrocatalysis, lithium battery, supercapacitor, fuel cell and separation and purification.

  5. Dynamics and couplings of N-H stretching excitations of guanosine-cytidine base pairs in solution.

    PubMed

    Yang, Ming; Szyc, Łukasz; Röttger, Katharina; Fidder, Henk; Nibbering, Erik T J; Elsaesser, Thomas; Temps, Friedrich

    2011-05-12

    N-H stretching vibrations of hydrogen-bonded guanosine-cytidine (G·C) base pairs in chloroform solution are studied with linear and ultrafast nonlinear infrared (IR) spectroscopy. Assignment of the IR-active bands in the linear spectrum is made possible by combining structural information on the hydrogen bonds in G·C base pairs with literature results of density functional theory calculations, and empirical relations connecting frequency shifts and intensity of the IR-active vibrations. A local mode representation of N-H stretching vibrations is adopted, consisting of ν(G)(NH(2))(f) and ν(C)(NH(2))(f) modes for free NH groups of G and C, and of ν(G)(NH(2))(b), ν(G)(NH), and ν(C)(NH(2))(b) modes associated with N-H stretching motions of hydrogen-bonded NH groups. The couplings and relaxation dynamics of the N-H stretching excitations are studied with femtosecond mid-infrared two-dimensional (2D) and pump-probe spectroscopy. The N-H stretching vibrations of the free NH groups of G and C have an average population lifetime of 2.4 ps. Besides a vibrational population lifetime shortening to subpicosecond values observed for the hydrogen-bonded N-H stretching vibrations, the 2D spectra reveal vibrational excitation transfer from the ν(G)(NH(2))(b) mode to the ν(G)(NH) and/or ν(C)(NH(2))(b) modes. The underlying intermode vibrational couplings are on the order of 10 cm(-1).

  6. Molecular mechanical studies of DNA flexibility: Coupled backbone torsion angles and base-pair openings

    PubMed Central

    Keepers, Joe W.; Kollman, Peter A.; Weiner, Paul K.; James, Thomas L.

    1982-01-01

    Molecular mechanics studies have been carried out on “B-DNA-like” structures of [d(C-G-C-G-A-A-T-T-C-G-C-G)]2 and [d(A)]12·[d(T)]12. Each of the backbone torsion angles (ψ, φ, ω, ω′, φ′) has been “forced” to alternative values from the normal B-DNA values (g+, t, g-, g-, t conformations). Compensating torsion angle changes preserve most of the base stacking energy in the double helix. In a second part of the study, one purine N3-pyrimidine N1 distance at a time has been forced to a value of 6 Å in an attempt to simulate the base opening motions required to rationalize proton exchange data for DNA. When the 6-Å constraint is removed, many of the structures revert to the normal Watson-Crick hydrogen-bonded structure, but a number are trapped in structures ≈5 kcal/mol higher in energy than the starting B-DNA structure. The relative energy of these structures, some of which involve a non-Watson-Crick thymine C2(carbonyl)[unk]adenine 6NH2 hydrogen bond, are qualitatively consistent with the ΔH for a “base pair-open state” suggested by Mandal et al. of 4-6 kcal/mol [Mandal, C., Kallenbach, N. R. & Englander, S. W. (1979) J. Mol. Biol. 135, 391-411]. The picture of DNA flexibility emerging from this study depicts the backbone as undergoing rapid motion between local torsional minima on a nanosecond time scale. Backbone motion is mainly localized within a dinucleoside segment and generally not conformationally coupled along the chain or across the base pairs. Base motions are much smaller in magnitude than backbone motions. Base sliding allows imino N—H exchange, but it is localized, and only a small fraction of the N—H groups is exposed at any one time. Stacking and hydrogen bonding cause a rigid core of bases in the center of the molecule accounting for the hydrodynamic properties of DNA. PMID:6957879

  7. Nearest-neighbor thermodynamics of deoxyinosine pairs in DNA duplexes

    PubMed Central

    Watkins, Norman E.; SantaLucia, John

    2005-01-01

    Nearest-neighbor thermodynamic parameters of the ‘universal pairing base’ deoxyinosine were determined for the pairsC, I·A, I·T, I·G and I·I adjacent to G·C and A·T pairs. Ultraviolet absorbance melting curves were measured and non-linear regression performed on 84 oligonucleotide duplexes with 9 or 12 bp lengths. These data were combined with data for 13 inosine containing duplexes from the literature. Multiple linear regression was used to solve for the 32 nearest-neighbor unknowns. The parameters predict the Tm for all sequences within 1.2°C on average. The general trend in decreasing stability is I·C > I·A > I·T ≈ I· G > I·I. The stability trend for the base pair 5′ of the I·X pair is G·C > C·G > A·T > T·A. The stability trend for the base pair 3′ of I·X is the same. These trends indicate a complex interplay between H-bonding, nearest-neighbor stacking, and mismatch geometry. A survey of 14 tandem inosine pairs and 8 tandem self-complementary inosine pairs is also provided. These results may be used in the design of degenerate PCR primers and for degenerate microarray probes. PMID:16264087

  8. Improved base excision repair inhibition and bacteriophage Mu Gam protein yields C:G-to-T:A base editors with higher efficiency and product purity

    PubMed Central

    Komor, Alexis C.; Zhao, Kevin T.; Packer, Michael S.; Gaudelli, Nicole M.; Waterbury, Amanda L.; Koblan, Luke W.; Kim, Y. Bill; Badran, Ahmed H.; Liu, David R.

    2017-01-01

    We recently developed base editing, the programmable conversion of target C:G base pairs to T:A without inducing double-stranded DNA breaks (DSBs) or requiring homology-directed repair using engineered fusions of Cas9 variants and cytidine deaminases. Over the past year, the third-generation base editor (BE3) and related technologies have been successfully used by many researchers in a wide range of organisms. The product distribution of base editing—the frequency with which the target C:G is converted to mixtures of undesired by-products, along with the desired T:A product—varies in a target site–dependent manner. We characterize determinants of base editing outcomes in human cells and establish that the formation of undesired products is dependent on uracil N-glycosylase (UNG) and is more likely to occur at target sites containing only a single C within the base editing activity window. We engineered CDA1-BE3 and AID-BE3, which use cytidine deaminase homologs that increase base editing efficiency for some sequences. On the basis of these observations, we engineered fourth-generation base editors (BE4 and SaBE4) that increase the efficiency of C:G to T:A base editing by approximately 50%, while halving the frequency of undesired by-products compared to BE3. Fusing BE3, BE4, SaBE3, or SaBE4 to Gam, a bacteriophage Mu protein that binds DSBs greatly reduces indel formation during base editing, in most cases to below 1.5%, and further improves product purity. BE4, SaBE4, BE4-Gam, and SaBE4-Gam represent the state of the art in C:G-to-T:A base editing, and we recommend their use in future efforts. PMID:28875174

  9. Anomeric 2'-Deoxycytidines and Silver Ions: Hybrid Base Pairs with Greatly Enhanced Stability and Efficient DNA Mismatch Detection with α-dC.

    PubMed

    Guo, Xiurong; Seela, Frank

    2017-09-04

    α-d-Nucleosides are rare in nature but can develop fascinating properties when incorporated into DNA. This work reports on the first silver-mediated base pair constructed from two anomeric nucleosides: α-dC and β-dC. The hybrid base pair was integrated into the DNA and DNA/RNA double helix. A 12-mer duplex with α-dC and β-dC pair exhibits a higher thermal stability (T m =43 °C) than that incorporating the β-dC-Ag + -β-dC homo pair (T m =34 °C). Furthermore, α-dC shows excellent mismatch discrimination for DNA single nucleotide polymorphism (SNP). All four SNPs were identified on the basis of large T m value differences measured in the presence of silver ions. High resolution melting was not required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Determinants of Base-Pair Substitution Patterns Revealed by Whole-Genome Sequencing of DNA Mismatch Repair Defective Escherichia coli.

    PubMed

    Foster, Patricia L; Niccum, Brittany A; Popodi, Ellen; Townes, Jesse P; Lee, Heewook; MohammedIsmail, Wazim; Tang, Haixu

    2018-06-15

    Mismatch repair (MMR) is a major contributor to replication fidelity, but its impact varies with sequence context and the nature of the mismatch. Mutation accumulation experiments followed by whole-genome sequencing of MMR-defective E. coli strains yielded ≈30,000 base-pair substitutions, revealing mutational patterns across the entire chromosome. The base-pair substitution spectrum was dominated by A:T > G:C transitions, which occurred predominantly at the center base of 5'N A C3'+5'G T N3' triplets. Surprisingly, growth on minimal medium or at low temperature attenuated these mutations. Mononucleotide runs were also hotspots for base-pair substitutions, and the rate at which these occurred increased with run length. Comparison with ≈2000 base-pair substitutions accumulated in MMR-proficient strains revealed that both kinds of hotspots appeared in the wild-type spectrum and so are likely to be sites of frequent replication errors. In MMR-defective strains transitions were strand biased, occurring twice as often when A and C rather than T and G were on the lagging-strand template. Loss of nucleotide diphosphate kinase increases the cellular concentration of dCTP, which resulted in increased rates of mutations due to misinsertion of C opposite A and T. In an mmr ndk double mutant strain, these mutations were more frequent when the template A and T were on the leading strand, suggesting that lagging-strand synthesis was more error-prone or less well corrected by proofreading than was leading strand synthesis. Copyright © 2018, Genetics.

  11. Configurations of base-pair complexes in solutions. [nucleotide chemistry

    NASA Technical Reports Server (NTRS)

    Egan, J. T.; Nir, S.; Rein, R.; Macelroy, R.

    1978-01-01

    A theoretical search for the most stable conformations (i.e., stacked or hydrogen bonded) of the base pairs A-U and G-C in water, CCl4, and CHCl3 solutions is presented. The calculations of free energies indicate a significant role of the solvent in determining the conformations of the base-pair complexes. The application of the continuum method yields preferred conformations in good agreement with experiment. Results of the calculations with this method emphasize the importance of both the electrostatic interactions between the two bases in a complex, and the dipolar interaction of the complex with the entire medium. In calculations with the solvation shell method, the last term, i.e., dipolar interaction of the complex with the entire medium, was added. With this modification the prediction of the solvation shell model agrees both with the continuum model and with experiment, i.e., in water the stacked conformation of the bases is preferred.

  12. Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.

    PubMed

    Kryachko, E S; Remacle, F

    2005-12-08

    The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.

  13. Twin hydroxymethyluracil-A base pair steps define the binding site for the DNA-binding protein TF1.

    PubMed

    Grove, A; Figueiredo, M L; Galeone, A; Mayol, L; Geiduschek, E P

    1997-05-16

    The DNA-bending protein TF1 is the Bacillus subtilis bacteriophage SPO1-encoded homolog of the bacterial HU proteins and the Escherichia coli integration host factor. We recently proposed that TF1, which binds with high affinity (Kd was approximately 3 nM) to preferred sites within the hydroxymethyluracil (hmU)-containing phage genome, identifies its binding sites based on sequence-dependent DNA flexibility. Here, we show that two hmU-A base pair steps coinciding with two previously proposed sites of DNA distortion are critical for complex formation. The affinity of TF1 is reduced 10-fold when both of these hmU-A base pair steps are replaced with A-hmU, G-C, or C-G steps; only modest changes in affinity result when substitutions are made at other base pairs of the TF1 binding site. Replacement of all hmU residues with thymine decreases the affinity of TF1 greatly; remarkably, the high affinity is restored when the two hmU-A base pair steps corresponding to previously suggested sites of distortion are reintroduced into otherwise T-containing DNA. T-DNA constructs with 3-base bulges spaced apart by 9 base pairs of duplex also generate nM affinity of TF1. We suggest that twin hmU-A base pair steps located at the proposed sites of distortion are key to target site selection by TF1 and that recognition is based largely, if not entirely, on sequence-dependent DNA flexibility.

  14. Effect of BrU on the transition between wobble Gua-Thy and tautomeric Gua-Thy base-pairs: ab initio molecular orbital calculations

    NASA Astrophysics Data System (ADS)

    Nomura, Kazuya; Hoshino, Ryota; Hoshiba, Yasuhiro; Danilov, Victor I.; Kurita, Noriyuki

    2013-04-01

    We investigated transition states (TS) between wobble Guanine-Thymine (wG-T) and tautomeric G-T base-pair as well as Br-containing base-pairs by MP2 and density functional theory (DFT) calculations. The obtained TS between wG-T and G*-T (asterisk is an enol-form of base) is different from TS got by the previous DFT calculation. The activation energy (17.9 kcal/mol) evaluated by our calculation is significantly smaller than that (39.21 kcal/mol) obtained by the previous calculation, indicating that our TS is more preferable. In contrast, the obtained TS and activation energy between wG-T and G-T* are similar to those obtained by the previous DFT calculation. We furthermore found that the activation energy between wG-BrU and tautomeric G-BrU is smaller than that between wG-T and tautomeric G-T. This result elucidates that the replacement of CH3 group of T by Br increases the probability of the transition reaction producing the enol-form G* and T* bases. Because G* prefers to bind to T rather than to C, and T* to G not A, our calculated results reveal that the spontaneous mutation from C to T or from A to G base is accelerated by the introduction of wG-BrU base-pair.

  15. Theoretical determination of one-electron redox potentials for DNA bases, base pairs, and stacks.

    PubMed

    Paukku, Y; Hill, G

    2011-05-12

    Electron affinities, ionization potentials, and redox potentials for DNA bases, base pairs, and N-methylated derivatives are computed at the DFT/M06-2X/6-31++G(d,p) level of theory. Redox properties of a guanine-guanine stack model are explored as well. Reduction and oxidation potentials are in good agreement with the experimental ones. Electron affinities of base pairs were found to be negative. Methylation of canonical bases affects the ionization potentials the most. Base pair formation and base stacking lower ionization potentials by 0.3 eV. Pairing of guanine with the 5-methylcytosine does not seem to influence the redox properties of this base pair much.

  16. 1,8-Naphthyridine-2,7-diamine: a potential universal reader of Watson-Crick base pairs for DNA sequencing by electron tunneling.

    PubMed

    Liang, Feng; Lindsay, Stuart; Zhang, Peiming

    2012-11-21

    With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A : T and G : C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs.

  17. Seventeen {alpha}-hydroxylase deficiency with one base pair deletion of the cytochrome P450c17 (CYP17) gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Oshiro, Chikara; Takasu, Nobuyuki; Wakugami, Tamio

    1995-08-01

    Mutation of the cytochrome P450c17 (CYP17) gene causes 17{alpha}-hydroxylase deficiency (170HD). Recently, several researchers have elucidated the molecular basis of 170HD by gene analysis. We experienced a case of 170HD and intended to reveal the abnormality of the CYP17 gene in this Japanese female with 170HD. Leukocytes were obtained from the patient, her mother and sister, and normal control subjects. We amplified the CYP17 gene using polymerase chain reaction and performed the sequence analysis using the dideoxy terminator method and restriction enzyme analysis. We found that the patient had one base-pair deletion at the position of amino acid 438. Anmore » indentical result was obtained with restriction enzyme analysis. This G deletion altered the reading frame and resulted in a premature stop codon at position 443; the ligand of heme iron (Cys: cystine 442) was absent. This small mutation may account for the patient`s clinical manifestations of 170HD. This is the first case of 170HD with only one base pair deletion of the CYP17 gene. 18 refs., 3 figs.« less

  18. Detection of protonated non-Watson-Crick base pairs using electrospray ionization mass spectrometry.

    PubMed

    Ishida, Riyoko; Iwahashi, Hideo

    2018-03-01

    Many studies have shown that protonated nucleic acid base pairs are involved in a wide variety of nucleic acid structures. However, little information is available on relative stability of hemiprotonated self- and non-self-dimers at monomer level. We used electrospray ionization mass spectrometry (ESI-MS) to evaluate the relative stability under various concentrations of hydrogen ion. These enable conjecture of the formation of protonated non-Watson-Crick base pairs based on DNA and RNA base sequence. In the present study, we observed that ESI-MS peaks corresponded to respective self-dimers for all examined nucleosides except for adenosine. Peak heights depended on the concentration of hydrogen ion. The ESI-MS peak heights of the hemiprotonated cytidine dimers and the hemiprotonated thymidine dimer sharply increased with increased concentration of hydrogen ion, suggesting direct participation of hydrogen ion in dimer formations. In ESI-MS measurements of the solutions containing adenosine, cytidine, thymidine and guanosine, we observed protonated cytidine-guanosine dimer (CH+-G) and protonated cytidine-thymidine dimer (CH+-T) in addition to hemiprotonated cytidine-cytidine dimer (CH+-C) with following relative peak height, (CH+-C) > (CH+-G) ≈ (CH+-T) > (CH+-A). Additionally, in the ESI-MS measurements of solutions containing adenosine, thymidine and guanosine, we observed a considerable amount of protonated adenosine-guanosine (AH+-G) and protonated adenosine-thymidine (AH+-T).

  19. Brueckner G -matrix approach for neutron-proton pairing correlations in the deformed BCS approach

    NASA Astrophysics Data System (ADS)

    Ha, Eunja; Cheoun, Myung-Ki; Šimkovic, F.

    2015-10-01

    Ground states of even-even Ge isotopes with mass number A =64 -76 have been studied in the deformed Bardeen-Cooper-Schrieffer (BCS) theory by taking neutron-proton (n p ) pairing correlations as well as neutron-neutron (n n ) and proton-proton (p p ) pairing correlations. The n p pairing has two different modes J =0 ,T =1 (isotriplet) and J =1 ,T =0 (isosinglet). In this work, the Brueckner G matrix, based on the CD-Bonn potential, has been exploited to reduce the ambiguity regarding nucleon-nucleon interactions inside nuclei compared to the results by a simple schematic phenomenological force. We found that the G matrix plays important roles to obtain reasonable descriptions of even-even nuclei compared to the schematic force. The n p pairing strength has been shown to have a clear correlation with quadrupole deformation parameter β2 for the isotopes, and affects the smearing of the Fermi surfaces of not only N =Z nuclei but also N ≠Z nuclei. In particular, the coexistence of the like particle (n n and p p ) and the n p pairing modes was found to become more salient by the G -matrix approach than by the schematic force approach.

  20. Determination of redox potentials for the Watson-Crick base pairs, DNA nucleosides, and relevant nucleoside analogues.

    PubMed

    Crespo-Hernandez, Carlos E; Close, David M; Gorb, Leonid; Leszczynski, Jerzy

    2007-05-17

    Redox potentials for the DNA nucleobases and nucleosides, various relevant nucleoside analogues, Watson-Crick base pairs, and seven organic dyes are presented based on DFT/B3LYP/6-31++G(d,p) and B3YLP/6-311+G(2df,p)//B3LYP/6-31+G* levels of calculations. The values are determined from an experimentally calibrated set of equations that correlate the vertical ionization (electron affinity) energy of 20 organic molecules with their experimental reversible oxidation (reduction) potential. Our results are in good agreement with those estimated experimentally for the DNA nucleosides in acetonitrile solutions (Seidel et al. J. Phys. Chem. 1996, 100, 5541). We have found that nucleosides with anti conformation exhibit lower oxidation potentials than the corresponding syn conformers. The lowering in the oxidation potential is due to the formation of an intramolecular hydrogen bonding interaction between the 5'-OH group of the sugar and the N3 of the purine bases or C2=O of the pyrimidine bases in the syn conformation. Pairing of adenine or guanine with its complementary pyrimidine base decreases its oxidation potential by 0.15 or 0.28 V, respectively. The calculated energy difference between the oxidation potential for the G.C base pair and that of the guanine base is in good agreement with the experimental value estimated recently (0.34 V: Caruso, T.; et al. J. Am. Chem. Soc. 2005, 127, 15040). The complete and consistent set of reversible redox values determined in this work for the DNA constituents is expected to be of considerable value to those studying charge and electronic energy transfer in DNA.

  1. 1,8-Naphthyridine-2,7-diamine: A Potential Universal Reader of the Watson-Crick Base Pairs for DNA Sequencing by Electron Tunneling

    PubMed Central

    Liang, Feng; Lindsay, Stuart; Zhang, Peiming

    2013-01-01

    With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read the DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A:T and G:C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs. PMID:23038027

  2. 6-Oxocytidine a novel protonated C-base analogue for stable triple helix formation.

    PubMed Central

    Berressem, R; Engels, J W

    1995-01-01

    2'-O-Methyl-3'-O-phosphoramidite building blocks of 6-oxocytidine 6 and its 5-methyl derivative 7, respectively, were synthesized and incorporated via phosphoramidite chemistry in 15 mer oligodeoxynucleotides [d(T72T7), S2; d(T73T7), S3] to obtain potential Py.Pu.Py triplex forming homopyrimidine strands. UV thermal denaturation studies and CD spectroscopy of 1:1 mixtures of these oligomers and a 21 mer target duplex [d(C3A7GA7C3)-d(G3T7CT7G3), D1] with a complementary purine tract showed a nearly pH-independent (6.0-8.0) triple helix formation with melting temperatures of 21-19 degrees C and 18.5-17.5 degrees C, respectively (buffer system: 50 mM sodium cacodylate, 100 mM NaCl, 20 mM MgCl2). In contrast, with the corresponding 15mer deoxy-C-containing oligonucleotide [d(T(7)1T7), S1] triplex formation was observed only below pH 6.6. Specificity for the recognition of Watson-Crick GC-base pairs was observed by pairing the modified C-bases of the 15mers with all other possible Watson-Crick-base compositions in the target duplex [d(C3A7XA7C3)-d(G3T7YT7G3), X = A,C,T; Y = T,G,A, D2-4]. Additionally, the Watson-Crick-pairing of the modified oligomers S2 and S3 was studied. PMID:7567457

  3. 6-Oxocytidine a novel protonated C-base analogue for stable triple helix formation.

    PubMed

    Berressem, R; Engels, J W

    1995-09-11

    2'-O-Methyl-3'-O-phosphoramidite building blocks of 6-oxocytidine 6 and its 5-methyl derivative 7, respectively, were synthesized and incorporated via phosphoramidite chemistry in 15 mer oligodeoxynucleotides [d(T72T7), S2; d(T73T7), S3] to obtain potential Py.Pu.Py triplex forming homopyrimidine strands. UV thermal denaturation studies and CD spectroscopy of 1:1 mixtures of these oligomers and a 21 mer target duplex [d(C3A7GA7C3)-d(G3T7CT7G3), D1] with a complementary purine tract showed a nearly pH-independent (6.0-8.0) triple helix formation with melting temperatures of 21-19 degrees C and 18.5-17.5 degrees C, respectively (buffer system: 50 mM sodium cacodylate, 100 mM NaCl, 20 mM MgCl2). In contrast, with the corresponding 15mer deoxy-C-containing oligonucleotide [d(T(7)1T7), S1] triplex formation was observed only below pH 6.6. Specificity for the recognition of Watson-Crick GC-base pairs was observed by pairing the modified C-bases of the 15mers with all other possible Watson-Crick-base compositions in the target duplex [d(C3A7XA7C3)-d(G3T7YT7G3), X = A,C,T; Y = T,G,A, D2-4]. Additionally, the Watson-Crick-pairing of the modified oligomers S2 and S3 was studied.

  4. Diffuse Scattering Investigations of Orientational Pair Potentials in C_60

    NASA Astrophysics Data System (ADS)

    Wochner, Peter

    1996-03-01

    Premonitory orientational fluctuations above the first order phase transition of C_60 at 260K have been studied by diffuse X-ray scattering experiments. These experiments probe the orientational pair correlations between C_60 molecules as a function of their separation and therefore the orientational pair potential. In addition to the diffuse scattering due to the orientational disorder of single molecules, we have observed zone boundary diffuse scattering at the X-points related to the Pabar 3 low temperature structure up to 300K. An additional set of diffuse peaks, which are even at room temperature comparable in intensity to the former ones, have been found at (0.5,0.5,0.5) positions (L-point). Similar results have recently been reported by P. Launois et al. (P. Launois, S. Ravy, R. Moret, PRB 52), 5414 (1995) and L. Pintschovius et al. (L. Pintschovius, S.L. Chaplot, G. Roth, G. Heger, PRL 75), 2843 (1995) The temperature dependence of the integrated intensity of both sets of diffuse peaks shows only a weak increase in approaching T_c, indicative of a strongly first order transition. Additional intensity with a very weak temperature dependence but similar correlation length has also been found at (0.5,0.5,0) and (0.5,0,0) positions. The diffuse intensity at the L, Σ and Δ points has probably its origin in competing phases which are not stabilized at low temperatures. Recent DSC measurements show close lying transitions at 260K with a separation of ~= 0.2-0.3K which might be related to these competing phases footnote J. Fischer, private communication. The data will be compared with model calculations using orientational pair potentials which have been used in literature to describe the orientational phase transition in C_60.

  5. Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

    PubMed

    Takezawa, Yusuke; Shionoya, Mitsuhiko

    2012-12-18

    With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional

  6. Absorption and fluorescence emission spectroscopic characters of naphtho-homologated yy-DNA bases and effect of methanol solution and base pairing.

    PubMed

    Zhang, Laibin; Li, Huifang; Li, Jilai; Chen, Xiaohua; Bu, Yuxiang

    2010-03-01

    A comprehensive theoretical study of electronic transitions of naphtho-homologated base analogs, namely, yy-T, yy-C, yy-A, and yy-G, was performed. The nature of the low-lying excited states is discussed, and the results are compared with those from experiment and also with those of y-bases. Geometrical characteristics of the lowest excited singlet pipi* and npi* states were explored using the CIS method, and the effects of methanol solution and paring with their complementary natural bases on the relevant absorption and emission spectra of these modified bases were examined. The calculated excitation and emission energies agree well with the measured data, where experimental results are available. In methanol solution, the fluorescence from yy-A and yy-G would be expected to occur around 539 and 562 nm, respectively, suggesting that yy-A is a green-colored fluorophore, whereas yy-G is a yellow-colored fluorophore. The methanol solution was found to red-shift both the absorption and emission maxima of yy-A, yy-T, and yy-C, but blue-shift those for yy-G. Generally, though base pairing has no significant effects on the absorption and fluorescence maxima of yy-A, yy-C, and yy-T, it blue-shifts those for yy-G. (c) 2009 Wiley Periodicals, Inc.

  7. Report on Pairing-based Cryptography.

    PubMed

    Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

    2015-01-01

    This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST's position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed.

  8. Report on Pairing-based Cryptography

    PubMed Central

    Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

    2015-01-01

    This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST’s position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed. PMID:26958435

  9. Molecular dynamics of the frame-shifting pseudoknot from beet western yellows virus: the role of non-Watson-Crick base-pairing, ordered hydration, cation binding and base mutations on stability and unfolding.

    PubMed

    Csaszar, K; Spacková, N; Stefl, R; Sponer, J; Leontis, N B

    2001-11-09

    Molecular dynamics simulations of the frame-shifting pseudoknot from beet western yellows virus (BWYV, NDB file UR0004) were performed with explicit inclusion of solvent and counterions. In all, 33 ns of simulation were carried out, including 10 ns of the native structure with protonation of the crucial cytosine residue, C8(N3+). The native structure exhibited stable trajectories retaining all Watson-Crick and tertiary base-pairs, except for fluctuations or transient disruptions at specific sites. The most significant fluctuations involved the change or disruption of hydrogen-bonding between C8(N3+) and bases G12, A25, and C26, as well as disruption of the water bridges linking C8(N3+) with A25 and C26. To increase sampling of rare events, the native simulation was continued at 400 K. A partial, irreversible unfolding of the molecule was initiated by slippage of C8(N3+) relative to G12 and continued by sudden concerted changes in hydrogen-bonding involving A23, A24, and A25. These events were followed by a gradual loss of stacking interactions in loop 2. Of the Watson-Crick base-pairs, only the 5'-terminal pair of stem 1 dissociated at 400 K, while the trans sugar-edge/sugar-edge A20.G4 interaction remained surprisingly stable. Four additional room-temperature simulations were carried out to obtain insights into the structural and dynamic effects of selected mutations. In two of these, C8 was left unprotonated. Considerable local rearrangements occurred that were not observed in the crystal structure, thus confirming N3-protonation of C8 in the native molecule. We also investigated the effect of mutating C8(N3+) to U8, to correlate with experimental and phylogenetic studies, and of changing the G4 x C17 base-pair to A4 x U17 to weaken the trans sugar-edge interaction between positions 4 and 20 and to test models of unfolding. The simulations indicate that the C8 x G12 x C26 base-triple at the junction is the most labile region of the frame-shifting pseudoknot. They

  10. Hydration of Watson-Crick base pairs and dehydration of Hoogsteen base pairs inducing structural polymorphism under molecular crowding conditions.

    PubMed

    Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki

    2009-03-18

    It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.

  11. Enhanced Stability of DNA Nanostructures by Incorporation of Unnatural Base Pairs.

    PubMed

    Liu, Qing; Liu, Guocheng; Wang, Ting; Fu, Jing; Li, Rujiao; Song, Linlin; Wang, Zhen-Gang; Ding, Baoquan; Chen, Fei

    2017-11-03

    Self-assembled DNA nanostructures hold great promise in the fields of nanofabrication, biosensing and nanomedicine. However, the inherent low stability of the DNA double helices, formed by weak interactions, largely hinders the assembly and functions of DNA nanostructures. In this study, we redesigned and constructed a six-arm DNA junction by incorporation of the unnatural base pairs 5-Me-isoC/isoG and A/2-thioT into the double helices. They not only retained the structural integrity of the DNA nanostructure, but also showed enhanced thermal stability and resistance to T7 Exonuclease digestion. This research may expand the applications of DNA nanostructures in nanofabrication and biomedical fields, and furthermore, the genetic alphabet expansion with unnatural base pairs may enable us to construct more complicated and diversified self-assembled DNA nanostructures. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Energetic basis for selective recognition of T*G mismatched base pairs in DNA by imidazole-rich polyamides.

    PubMed

    Lacy, Eilyn R; Nguyen, Binh; Le, Minh; Cox, Kari K; OHare, Caroline; Hartley, John A; Lee, Moses; Wilson, W David

    2004-01-01

    To complement available structure and binding results and to develop a detailed understanding of the basis for selective molecular recognition of T.G mismatches in DNA by imidazole containing polyamides, a full thermodynamic profile for formation of the T.G-polyamide complex has been determined. The amide-linked heterocycles f-ImImIm and f-PyImIm (where f is formamido group, Im is imidazole and Py is pyrrole) were studied by using biosensor-surface plasmon resonance (SPR) and isothermal titration calorimetry (ITC) with a T.G mismatch containing DNA hairpin duplex and a similar DNA with only Watson-Crick base pairs. Large negative binding enthalpies for all of the polyamide-DNA complexes indicate that the interactions are enthalpically driven. SPR results show slower complex formation and stronger binding of f-ImImIm to the T.G than to the match site. The thermodynamic analysis indicates that the enhanced binding to the T.G site is the result of better entropic contributions. Negative heat capacity changes for the complex are correlated with calculated solvent accessible surface area changes and indicate hydrophobic contributions to complex formation. DNase I footprinting analysis in a long DNA sequence provided supporting evidence that f-ImImIm binds selectively to T.G mismatch sites.

  13. An inversion of 25 base pairs causes feline GM2 gangliosidosis variant.

    PubMed

    Martin, Douglas R; Krum, Barbara K; Varadarajan, G S; Hathcock, Terri L; Smith, Bruce F; Baker, Henry J

    2004-05-01

    In G(M2) gangliosidosis variant 0, a defect in the beta-subunit of lysosomal beta-N-acetylhexosaminidase (EC 3.2.1.52) causes abnormal accumulation of G(M2) ganglioside and severe neurodegeneration. Distinct feline models of G(M2) gangliosidosis variant 0 have been described in both domestic shorthair and Korat cats. In this study, we determined that the causative mutation of G(M2) gangliosidosis in the domestic shorthair cat is a 25-base-pair inversion at the extreme 3' end of the beta-subunit (HEXB) coding sequence, which introduces three amino acid substitutions at the carboxyl terminus of the protein and a translational stop that is eight amino acids premature. Cats homozygous for the 25-base-pair inversion express levels of beta-subunit mRNA approximately 190% of normal and protein levels only 10-20% of normal. Because the 25-base-pair inversion is similar to mutations in the terminal exon of human HEXB, the domestic shorthair cat should serve as an appropriate model to study the molecular pathogenesis of human G(M2) gangliosidosis variant 0 (Sandhoff disease).

  14. pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

    PubMed

    Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

    2009-11-23

    Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

  15. Energetic basis for selective recognition of T·G mismatched base pairs in DNA by imidazole-rich polyamides

    PubMed Central

    Lacy, Eilyn R.; Nguyen, Binh; Le, Minh; Cox, Kari K.; O'Hare, Caroline; Hartley, John A.; Lee, Moses; Wilson, W. David

    2004-01-01

    To complement available structure and binding results and to develop a detailed understanding of the basis for selective molecular recognition of T·G mismatches in DNA by imidazole containing polyamides, a full thermodynamic profile for formation of the T·G–polyamide complex has been determined. The amide-linked heterocycles f-ImImIm and f-PyImIm (where f is formamido group, Im is imidazole and Py is pyrrole) were studied by using biosensor-surface plasmon resonance (SPR) and isothermal titration calorimetry (ITC) with a T·G mismatch containing DNA hairpin duplex and a similar DNA with only Watson–Crick base pairs. Large negative binding enthalpies for all of the polyamide–DNA complexes indicate that the interactions are enthalpically driven. SPR results show slower complex formation and stronger binding of f-ImImIm to the T·G than to the match site. The thermodynamic analysis indicates that the enhanced binding to the T·G site is the result of better entropic contributions. Negative heat capacity changes for the complex are correlated with calculated solvent accessible surface area changes and indicate hydrophobic contributions to complex formation. DNase I footprinting analysis in a long DNA sequence provided supporting evidence that f-ImImIm binds selectively to T·G mismatch sites. PMID:15064359

  16. pgRNAFinder: a web-based tool to design distance independent paired-gRNA.

    PubMed

    Xiong, Yuanyan; Xie, Xiaowei; Wang, Yanzhi; Ma, Wenbing; Liang, Puping; Songyang, Zhou; Dai, Zhiming

    2017-11-15

    The CRISPR/Cas System has been shown to be an efficient and accurate genome-editing technique. There exist a number of tools to design the guide RNA sequences and predict potential off-target sites. However, most of the existing computational tools on gRNA design are restricted to small deletions. To address this issue, we present pgRNAFinder, with an easy-to-use web interface, which enables researchers to design single or distance-free paired-gRNA sequences. The web interface of pgRNAFinder contains both gRNA search and scoring system. After users input query sequences, it searches gRNA by 3' protospacer-adjacent motif (PAM), and possible off-targets, and scores the conservation of the deleted sequences rapidly. Filters can be applied to identify high-quality CRISPR sites. PgRNAFinder offers gRNA design functionality for 8 vertebrate genomes. Furthermore, to keep pgRNAFinder open, extensible to any organism, we provide the source package for local use. The pgRNAFinder is freely available at http://songyanglab.sysu.edu.cn/wangwebs/pgRNAFinder/, and the source code and user manual can be obtained from https://github.com/xiexiaowei/pgRNAFinder. songyang@bcm.edu or daizhim@mail.sysu.edu.cn. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

  17. Damage mechanism of hydroxyl radicals toward adenine—thymine base pair

    NASA Astrophysics Data System (ADS)

    Tan, Rong-Ri; Wang, Dong-Qi; Zhang, Feng-Shou

    2014-02-01

    The adenine—thymine base pair was studied in the presence of hydroxyl radicals in order to probe the hydrogen bond effect. The results show that the hydrogen bonds have little effect on the hydroxylation and dehydrogenation happened at the sites, which are not involved in a hydrogen bond, while at the sites involved in hydrogen bond formation in the base pair, the reaction becomes more difficult, both in view of the free energy barrier and the exothermicity. With a 6-311++G(d,p) level of description, both B3LYP and MP2 methods confirm that the C8 site of isolated adenine has the highest possibility to form covalent bond with the hydroxyl radicals, though with different energetics: B3LYP predicts a barrierless pathway, while MP2 finds a transition state with an energy of 106.1 kJ/mol. For the dehydrogenation reactions, B3LYP method predicts that the free energy barrier increases in the order of HN9 < HN61 < HN62 < H2 < H8.

  18. Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs

    PubMed Central

    2017-01-01

    Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package. PMID:29107980

  19. Multispectroscopic methods reveal different modes of interaction of anti cancer drug mitoxantrone with Poly(dG-dC).Poly(dG-dC) and Poly(dA-dT).Poly(dA-dT).

    PubMed

    Awasthi, Pamita; Dogra, Shilpa; Barthwal, Ritu

    2013-10-05

    The interaction of mitoxantrone with alternating Poly(dG-dC).Poly(dG-dC) and Poly(dA-dT).Poly(dA-dT) duplex has been studied by absorption, fluorescence and Circular Dichroism (CD) spectroscopy at Drug to Phosphate base pair ratios D/P=20.0-0.04. Binding to GC polymer occurs in two distinct modes: partial stacking characterized by red shifts of 18-23nm at D/P=0.2-0.8 and external binding at D/P=1.0-20.0 whereas that to AT polymer occurs externally in the entire range of D/P. The binding constant and number of binding sites is 3.7×10(5)M(-1), 0.3 and 1.3× 10(4)M(-1), 1.5 in GC and AT polymers, respectively at low D/P ratios. CD binding isotherms show breakpoints at D/P=0.1, 0.5 and 0.25, 0.5 in GC and AT polymers, respectively. The intrinsic CD bands indicate that the distortions in GC polymer are significantly higher than that in AT polymer. Docking studies show partial insertion of mitoxantrone rings between to GC base pairs in alternating GC polymer. Side chains of mitoxantrone interact specifically with base pairs and DNA backbone. The studies are relevant to the understanding of suppression or inhibition of DNA cleavage on formation of ternary complex with topoisomerase-II enzyme and hence the anti cancer action. Copyright © 2013 Elsevier B.V. All rights reserved.

  20. Mitomycin C-induced pairing of heterochromatin reflects initiation of DNA repair and chromatid exchange formation.

    PubMed

    Abdel-Halim, H I; Natarajan, A T; Mullenders, L H F; Boei, J J W A

    2005-04-15

    Chromatid interchanges induced by the DNA cross-linking agent mitomycin C (MMC) are over-represented in human chromosomes containing large heterochromatic regions. We found that nearly all exchange breakpoints of chromosome 9 are located within the paracentromeric heterochromatin and over 70% of exchanges involving chromosome 9 are between its homologues. We provide evidence that the required pairing of chromosome 9 heterochromatic regions occurs in G(0)/G(1) and S-phase cells as a result of an active cellular process initiated upon MMC treatment. By contrast, no pairing was observed for a euchromatic paracentromeric region of the equal-sized chromosome 8. The MMC-induced pairing of chromosome 9 heterochromatin is observed in a subset of cells; its percentage closely mimics the frequency of homologous interchanges found at metaphase. Moreover, the absence of pairing in cells derived from XPF patients correlates with an altered spectrum of MMC-induced exchanges. Together, the data suggest that the heterochromatin-specific pairing following MMC treatment reflects the initiation of DNA cross-link repair and the formation of exchanges.

  1. Introducing a model of pairing based on base pair specific interactions between identical DNA sequences

    NASA Astrophysics Data System (ADS)

    (O' Lee, Dominic J.

    2018-02-01

    At present, there have been suggested two types of physical mechanism that may facilitate preferential pairing between DNA molecules, with identical or similar base pair texts, without separation of base pairs. One mechanism solely relies on base pair specific patterns of helix distortion being the same on the two molecules, discussed extensively in the past. The other mechanism proposes that there are preferential interactions between base pairs of the same composition. We introduce a model, built on this second mechanism, where both thermal stretching and twisting fluctuations are included, as well as the base pair specific helix distortions. Firstly, we consider an approximation for weak pairing interactions, or short molecules. This yields a dependence of the energy on the square root of the molecular length, which could explain recent experimental data. However, analysis suggests that this approximation is no longer valid at large DNA lengths. In a second approximation, for long molecules, we define two adaptation lengths for twisting and stretching, over which the pairing interaction can limit the accumulation of helix disorder. When the pairing interaction is sufficiently strong, both adaptation lengths are finite; however, as we reduce pairing strength, the stretching adaptation length remains finite but the torsional one becomes infinite. This second state persists to arbitrarily weak values of the pairing strength; suggesting that, if the molecules are long enough, the pairing energy scales as length. To probe differences between the two pairing mechanisms, we also construct a model of similar form. However, now, pairing between identical sequences solely relies on the intrinsic helix distortion patterns. Between the two models, we see interesting qualitative differences. We discuss our findings, and suggest new work to distinguish between the two mechanisms.

  2. Identification in a pseudoknot of a U.G motif essential for the regulation of the expression of ribosomal protein S15.

    PubMed

    Bénard, L; Mathy, N; Grunberg-Manago, M; Ehresmann, B; Ehresmann, C; Portier, C

    1998-03-03

    The ribosomal protein S15 from Escherichia coli binds to a pseudoknot in its own messenger. This interaction is an essential step in the mechanism of S15 translational autoregulation. In a previous study, a recognition determinant for S15 autoregulation, involving a U.G wobble pair, was located in the center of stem I of the pseudoknot. In this study, an extensive mutagenesis analysis has been conducted in and around this U.G pair by comparing the effects of these mutations on the expression level of S15. The results show that the U.G wobble pair cannot be substituted by A.G, C.A, A.C, G.U, or C.G without loss of the autocontrol. In addition, the base pair C.G, adjacent to the 5' side of U, cannot be flipped or changed to another complementary base pair without also inducing derepression of translation. A unique motif, made of only two adjacent base pairs, U.G/C.G, is essential for S15 autoregulation and is presumably involved in direct recognition by the S15 protein.

  3. Proton tunneling in the A∙T Watson-Crick DNA base pair: myth or reality?

    PubMed

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    The results and conclusions reached by Godbeer et al. in their recent work, that proton tunneling in the A∙T(WC) Watson-Crick (WC) DNA base pair occurs according to the Löwdin's (L) model, but with a small (~10(-9)) probability were critically analyzed. Here, it was shown that this finding overestimates the possibility of the proton tunneling at the A∙T(WC)↔A*∙T*(L) tautomerization, because this process cannot be implemented as a chemical reaction. Furthermore, it was outlined those biologically important nucleobase mispairs (A∙A*↔A*∙A, G∙G*↔G*∙G, T∙T*↔T*∙T, C∙C*↔C*∙C, H∙H*↔H*∙H (H - hypoxanthine)) - the players in the field of the spontaneous point mutagenesis - where the tunneling of protons is expected and for which the application of the model proposed by Godbeer et al. can be productive.

  4. Completion of biosynthetic pathways for bacteriochlorophyll g in Heliobacterium modesticaldum: The C8-ethylidene group formation.

    PubMed

    Tsukatani, Yusuke; Yamamoto, Haruki; Mizoguchi, Tadashi; Fujita, Yuichi; Tamiaki, Hitoshi

    2013-10-01

    Heliobacteria have the simplest photosynthetic apparatus, i.e., a type-I reaction center lacking a peripheral light-harvesting complex. Bacteriochlorophyll (BChl) g molecules are bound to the reaction center complex and work both as special-pair and antenna pigments. The C8-ethylidene group formation for BChl g is the last missing link in biosynthetic pathways for bacterial special-pair pigments, which include BChls a and b as well. Here, we report that chlorophyllide a oxidoreductase (COR) of Heliobacterium modesticaldum catalyzes the C8-ethylidene formation from 8-vinyl-chlorophyllide a, producing bacteriochlorophyllide g, the direct precursor for BChl g without the farnesyl tail. The finding led to plausible biosynthetic pathways for 8(1)-hydroxy-chlorophyll a, a primary electron acceptor from the special pair in heliobacterial reaction centers. Proposed catalytic mechanisms on hydrogenation reaction of the ethylidene synthase-type CORs are also discussed. Copyright © 2013 Elsevier B.V. All rights reserved.

  5. The binding of manganese(II) and zinc(II) to the synthetic oligonucleotide d(C-G-C-G-A-A-T-T-C-G-C-G)2. A 1H NMR study.

    PubMed

    Frøystein, N A; Sletten, E

    1991-03-01

    The interaction of the synthetic oligonucleotide d(C-G-C-G-A-A-T-T-C-G-C-G)2 with two different transition-metal ions has been investigated in aqueous solution by means of 1H NMR spectroscopy. The effects on the DNA due to the presence of manganese(II) or zinc(II) have been monitored by observing the paramagnetic broadening and diamagnetic shifts of the non-exchangeable proton resonance lines, respectively. The 1H NMR spectra acquired during the course of the manganese(II) titration show very distinct broadening effects on certain DNA resonance lines. Primarily, the H8 resonance of G4 is affected, but also the H5 and H6 resonances of C3 are clearly affected by the metal. The results imply that the binding of manganese(II) to DNA is sequence specific. The 1H spectra obtained during the zinc(II) titration reveal diamagnetic shift effects which largely conform with the paramagnetic broadening effects due to the presence of manganese(II), although this picture is somewhat more complex. The H8 resonance of G4 displays a clearly visible high-field shift, while for the other guanosine H8 protons this effect is absent. The H1' and H2' protons of C3 show an effect of similar strength, although in the opposite direction, while H5 and H6 of C3 are only slightly affected. Local differences in the structure of the DNA and the basicities of potential binding sites on different base steps in the sequence might account for the observed sequence selectivity.

  6. Capturing the radical ion-pair intermediate in DNA guanine oxidation

    PubMed Central

    Jie, Jialong; Liu, Kunhui; Wu, Lidan; Zhao, Hongmei; Song, Di; Su, Hongmei

    2017-01-01

    Although the radical ion pair has been frequently invoked as a key intermediate in DNA oxidative damage reactions and photoinduced electron transfer processes, the unambiguous detection and characterization of this species remain formidable and unresolved due to its extremely unstable nature and low concentration. We use the strategy that, at cryogenic temperatures, the transient species could be sufficiently stabilized to be detectable spectroscopically. By coupling the two techniques (the cryogenic stabilization and the time-resolved laser flash photolysis spectroscopy) together, we are able to capture the ion-pair transient G+•⋯Cl− in the chlorine radical–initiated DNA guanine (G) oxidation reaction, and provide direct evidence to ascertain the intricate type of addition/charge separation mechanism underlying guanine oxidation. The unique spectral signature of the radical ion-pair G+•⋯Cl− is identified, revealing a markedly intense absorption feature peaking at 570 nm that is distinctive from G+• alone. Moreover, the ion-pair spectrum is found to be highly sensitive to the protonation equilibria within guanine-cytosine base pair (G:C), which splits into two resolved bands at 480 and 610 nm as the acidic proton transfers along the central hydrogen bond from G+• to C. We thus use this exquisite sensitivity to track the intrabase-pair proton transfer dynamics in the double-stranded DNA oligonucleotides, which is of critical importance for the description of the proton-coupled charge transfer mechanisms in DNA. PMID:28630924

  7. Synthesis and characterization of g-C{sub 3}N{sub 4}/Cu{sub 2}O composite catalyst with enhanced photocatalytic activity under visible light irradiation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Peng, Biyu; Zhang, Shengsen; Yang, Siyuan

    2014-08-15

    The prepared g-C{sub 3}N{sub 4}/Cu{sub 2}O composite exhibited the enhanced photocatalytic activity under visible-light irradiation due to the stronger ability in separation of electron–hole pairs, which was proven by the transient photocurrent measurement. - Highlights: • The coupled Cu{sub 2}O with g-C{sub 3}N{sub 4} of narrow-band-gap semiconductor has been designed. • g-C{sub 3}N{sub 4}/Cu{sub 2}O is prepared via an alcohol-aqueous based on chemical precipitation method. • g-C{sub 3}N{sub 4}/Cu{sub 2}O exhibits the enhanced photocatalytic activity under visible-light. • The enhanced photocatalytic activity is proven by the transient photocurrent test. • A mechanism for the visible-light-driven photocatalysis of g-C{sub 3}N{sub 4}/Cu{submore » 2}O is revealed. - Abstract: To overcome the drawback of low photocatalytic efficiency brought by electron–hole pairs recombination and narrow photo-response range, a novel g-C{sub 3}N{sub 4}/Cu{sub 2}O composite photocatalyst was designed and prepared successfully. Compared with bare Cu{sub 2}O and g-C{sub 3}N{sub 4}, the g-C{sub 3}N{sub 4}/Cu{sub 2}O composite exhibited significantly enhanced photocatalytic activity for acid orange-II (AO-II) degradation under visible light irradiation. Based on energy band positions, the mechanism of enhanced visible-light photocatalytic activity was proposed.« less

  8. Pms2 and uracil-DNA glycosylases act jointly in the mismatch repair pathway to generate Ig gene mutations at A-T base pairs.

    PubMed

    Girelli Zubani, Giulia; Zivojnovic, Marija; De Smet, Annie; Albagli-Curiel, Olivier; Huetz, François; Weill, Jean-Claude; Reynaud, Claude-Agnès; Storck, Sébastien

    2017-04-03

    During somatic hypermutation (SHM) of immunoglobulin genes, uracils introduced by activation-induced cytidine deaminase are processed by uracil-DNA glycosylase (UNG) and mismatch repair (MMR) pathways to generate mutations at G-C and A-T base pairs, respectively. Paradoxically, the MMR-nicking complex Pms2/Mlh1 is apparently dispensable for A-T mutagenesis. Thus, how detection of U:G mismatches is translated into the single-strand nick required for error-prone synthesis is an open question. One model proposed that UNG could cooperate with MMR by excising a second uracil in the vicinity of the U:G mismatch, but it failed to explain the low impact of UNG inactivation on A-T mutagenesis. In this study, we show that uracils generated in the G1 phase in B cells can generate equal proportions of A-T and G-C mutations, which suggests that UNG and MMR can operate within the same time frame during SHM. Furthermore, we show that Ung -/- Pms2 -/- mice display a 50% reduction in mutations at A-T base pairs and that most remaining mutations at A-T bases depend on two additional uracil glycosylases, thymine-DNA glycosylase and SMUG1. These results demonstrate that Pms2/Mlh1 and multiple uracil glycosylases act jointly, each one with a distinct strand bias, to enlarge the immunoglobulin gene mutation spectrum from G-C to A-T bases. © 2017 Girelli Zubani et al.

  9. Pms2 and uracil-DNA glycosylases act jointly in the mismatch repair pathway to generate Ig gene mutations at A-T base pairs

    PubMed Central

    De Smet, Annie; Albagli-Curiel, Olivier; Huetz, François; Weill, Jean-Claude

    2017-01-01

    During somatic hypermutation (SHM) of immunoglobulin genes, uracils introduced by activation-induced cytidine deaminase are processed by uracil-DNA glycosylase (UNG) and mismatch repair (MMR) pathways to generate mutations at G-C and A-T base pairs, respectively. Paradoxically, the MMR-nicking complex Pms2/Mlh1 is apparently dispensable for A-T mutagenesis. Thus, how detection of U:G mismatches is translated into the single-strand nick required for error-prone synthesis is an open question. One model proposed that UNG could cooperate with MMR by excising a second uracil in the vicinity of the U:G mismatch, but it failed to explain the low impact of UNG inactivation on A-T mutagenesis. In this study, we show that uracils generated in the G1 phase in B cells can generate equal proportions of A-T and G-C mutations, which suggests that UNG and MMR can operate within the same time frame during SHM. Furthermore, we show that Ung−/−Pms2−/− mice display a 50% reduction in mutations at A-T base pairs and that most remaining mutations at A-T bases depend on two additional uracil glycosylases, thymine-DNA glycosylase and SMUG1. These results demonstrate that Pms2/Mlh1 and multiple uracil glycosylases act jointly, each one with a distinct strand bias, to enlarge the immunoglobulin gene mutation spectrum from G-C to A-T bases. PMID:28283534

  10. Hidden in Plain Sight: Subtle Effects of the 8-Oxoguanine Lesion on the Structure, Dynamics, and Thermodynamics of a 15-Base-Pair Oligodeoxynucleotide Duplex†

    PubMed Central

    Crenshaw, Charisse M.; Wade, Jacqueline E.; Arthanari, Haribabu; Frueh, Dominique; Lane, Benjamin F.; Núñez, Megan E.

    2011-01-01

    The base lesion 8-oxoguanine is formed readily by oxidation of DNA, potentially leading to G→T transversion mutations. Despite the apparent similarity of 8-oxoguanine-cytosine base pairs to normal guanine-cytosine base pairs, cellular base excision repair systems effectively recognize the lesion base. Here we apply several techniques to examine a single 8-oxoguanine lesion at the center of a nonpalindromic 15-mer duplex oligonucleotide in an effort to determine what, if anything, distinguishes an 8-oxoguanine-cytosine base pair from a normal base pair. The lesion duplex is globally almost indistinguishable from the unmodified parent duplex using CD spectroscopy and UV melting thermodynamics. The DNA mismatch-detecting photocleavage agent Rh(bpy)2chrysi3+ cleaves only weakly and nonspecifically, revealing that the 8oxoG-C pair is locally stable at the level of the individual base pairs. NMR spectra are also consistent with a well-conserved B-form duplex structure. In the 2D NOESY spectra, base-sugar and imino-imino crosspeaks are strikingly similar between parent and lesion duplexes. Changes in chemical shift due to the 8oxoG lesion are localized to its complementary cytosine and to the 2–3 base pairs immediately flanking the lesion on the lesion strand. Residues further removed from the lesion are shown to be unperturbed by its presence. Notably, imino exchange experiments indicate that the 8-oxoguanine-cytosine pair is strong and stable, with an apparent equilibrium constant for opening equal to that of other internal guanine-cytosine base pairs, on the order of 10−6. This collection of experiments shows that the 8-oxoguanine-cytosine base pair is incredibly stable and similar to the native pair. PMID:21902242

  11. Ag(I)-mediated homo and hetero pairs of guanosine and cytidine: monitoring by circular dichroism spectroscopy.

    PubMed

    Goncharova, Iryna

    2014-01-24

    Ag(I)-containing compounds are attractive as antibacterial and antifungal agents. The renewed interest in the application of silver(I) compounds has led to the need for detailed knowledge of the mechanism of their action. One of the possible ways is the coordination of Ag(I) to G-C pairs of DNA, where Ag(+) ions form Ag(I)-mediated base pairs and inhibit the transcription. Herein, a systematic chiroptical study on silver(I)-mediated homo and mixed pairs of the C-G complementary-base derivatives cytidine(C) and 5'-guanosine monophosphate(G) in water is presented. Ag(I)-mediated homo and hetero pairs of G and C and their self-assembled species were studied under two pH levels (7.0 and 10.0) by vibrational (VCD) and electronic circular dichroism(ECD). VCD was used for the first time in this field and showed itself to be a powerful method for obtaining specific structural information in solution. Based on results of the VCD experiments, the different geometries of the homo pairs were proposed under pH 7.0 and 10.0. ECD was used as a diagnostic tool to characterize the studied systems and as a contact point between the previously defined structures of the metal or proton mediated pairs of nucleobases and the systems studied here. On the basis of the obtained data, the formation of the self-assembled species of cytidine with a structure similar to the i-motif structure in DNA was proposed at pH 10.0. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. Ag(I)-mediated homo and hetero pairs of guanosine and cytidine: Monitoring by circular dichroism spectroscopy

    NASA Astrophysics Data System (ADS)

    Goncharova, Iryna

    2014-01-01

    Ag(I)-containing compounds are attractive as antibacterial and antifungal agents. The renewed interest in the application of silver(I) compounds has led to the need for detailed knowledge of the mechanism of their action. One of the possible ways is the coordination of Ag(I) to G-C pairs of DNA, where Ag+ ions form Ag(I)-mediated base pairs and inhibit the transcription. Herein, a systematic chiroptical study on silver(I)-mediated homo and mixed pairs of the C-G complementary-base derivatives cytidine(C) and 5‧-guanosine monophosphate(G) in water is presented. Ag(I)-mediated homo and hetero pairs of G and C and their self-assembled species were studied under two pH levels (7.0 and 10.0) by vibrational (VCD) and electronic circular dichroism(ECD). VCD was used for the first time in this field and showed itself to be a powerful method for obtaining specific structural information in solution. Based on results of the VCD experiments, the different geometries of the homo pairs were proposed under pH 7.0 and 10.0. ECD was used as a diagnostic tool to characterize the studied systems and as a contact point between the previously defined structures of the metal or proton mediated pairs of nucleobases and the systems studied here. On the basis of the obtained data, the formation of the self-assembled species of cytidine with a structure similar to the i-motif structure in DNA was proposed at pH 10.0.

  13. Pyrrolo-dC Metal-Mediated Base Pairs in the Reverse Watson-Crick Double Helix: Enhanced Stability of Parallel DNA and Impact of 6-Pyridinyl Residues on Fluorescence and Silver-Ion Binding.

    PubMed

    Yang, Haozhe; Mei, Hui; Seela, Frank

    2015-07-06

    Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Role of Electron-Driven Proton-Transfer Processes in the Ultrafast Deactivation of Photoexcited Anionic 8-oxoGuanine-Adenine and 8-oxoGuanine-Cytosine Base Pairs.

    PubMed

    Wu, Xiuxiu; Karsili, Tolga N V; Domcke, Wolfgang

    2017-01-14

    It has been reported that 8-oxo-7,8-dihydro-guanosine (8-oxo-G), which is the main product of oxidative damage of DNA, can repair cyclobutane pyrimidine dimer (CPD) lesions when incorporated into DNA or RNA strands in proximity to such lesions. It has therefore been suggested that the 8-oxo-G nucleoside may have been a primordial precursor of present-day flavins in DNA or RNA repair. Because the electron transfer leading to the splitting of a thymine-thymine pair in a CPD lesion occurs in the photoexcited state, a reasonably long excited-state lifetime of 8-oxo-G is required. The neutral (protonated) form of 8-oxo-G exhibits a very short (sub-picosecond) intrinsic excited-state lifetime which is unfavorable for repair. It has therefore been argued that the anionic (deprotonated) form of 8-oxo-G, which exhibits a much longer excited-state lifetime, is more likely to be a suitable cofactor for DNA repair. Herein, we have investigated the exited-state quenching mechanisms in the hydrogen-bonded complexes of deprotonated 8-oxo-G - with adenine (A) and cytosine (C) using ab initio wave-function-based electronic-structure calculations. The calculated reaction paths and potential-energy profiles reveal the existence of barrierless electron-driven inter-base proton-transfer reactions which lead to low-lying S₁/S₀ conical intersections. The latter can promote ultrafast excited-state deactivation of the anionic base pairs. While the isolated deprotonated 8-oxo-G - nucleoside may have been an efficient primordial repair cofactor, the excited states of the 8-oxo-G - -A and 8-oxo-G - -C base pairs are likely too short-lived to be efficient electron-transfer repair agents.

  15. A structural determinant in the uracil DNA glycosylase superfamily for the removal of uracil from adenine/uracil base pairs

    PubMed Central

    Lee, Dong-Hoon; Liu, Yinling; Lee, Hyun-Wook; Xia, Bo; Brice, Allyn R.; Park, Sung-Hyun; Balduf, Hunter; Dominy, Brian N.; Cao, Weiguo

    2015-01-01

    The uracil DNA glycosylase superfamily consists of several distinct families. Family 2 mismatch-specific uracil DNA glycosylase (MUG) from Escherichia coli is known to exhibit glycosylase activity on three mismatched base pairs, T/U, G/U and C/U. Family 1 uracil N-glycosylase (UNG) from E. coli is an extremely efficient enzyme that can remove uracil from any uracil-containing base pairs including the A/U base pair. Here, we report the identification of an important structural determinant that underlies the functional difference between MUG and UNG. Substitution of a Lys residue at position 68 with Asn in MUG not only accelerates the removal of uracil from mismatched base pairs but also enables the enzyme to gain catalytic activity on A/U base pairs. Binding and kinetic analysis demonstrate that the MUG-K68N substitution results in enhanced ground state binding and transition state interactions. Molecular modeling reveals that MUG-K68N, UNG-N123 and family 5 Thermus thermophiles UDGb-A111N can form bidentate hydrogen bonds with the N3 and O4 moieties of the uracil base. Genetic analysis indicates the gain of function for A/U base pairs allows the MUG-K68N mutant to remove uracil incorporated into the genome during DNA replication. The implications of this study in the origin of life are discussed. PMID:25550433

  16. Radical-pair based avian magnetoreception

    NASA Astrophysics Data System (ADS)

    Procopio, Maria; Ritz, Thorsten

    2014-03-01

    Behavioural experiments suggest that migratory birds possess a magnetic compass sensor able to detect the direction of the geomagnetic. One hypothesis for the basis of this remarkable sensory ability is that the coherent quantum spin dynamics of photoinduced radical pair reactions transduces directional magnetic information from the geomagnetic field into changes of reaction yields, possibly involving the photoreceptor cryptochrome in the birds retina. The suggested radical-pair based avian magnetoreception has attracted attention in the field of quantum biology as an example of a biological sensor which might exploit quantum coherences for its biological function. Investigations on such a spin-based sensor have focussed on uncovering the design features for the design of a biomimetic magnetic field sensor. We study the effects of slow fluctuations in the nuclear spin environment on the directional signal. We quantitatively evaluate the robustness of signals under fluctuations on a timescale longer than the lifetime of a radical pair, utilizing two models of radical pairs. Our results suggest design principles for building a radical-pair based compass sensor that is both robust and highly directional sensitive.

  17. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase iota: Hoogsteen or Watson-Crick base pairing?

    PubMed

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-13

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.

  18. Easy design of colorimetric logic gates based on nonnatural base pairing and controlled assembly of gold nanoparticles.

    PubMed

    Zhang, Li; Wang, Zhong-Xia; Liang, Ru-Ping; Qiu, Jian-Ding

    2013-07-16

    Utilizing the principles of metal-ion-mediated base pairs (C-Ag-C and T-Hg-T), the pH-sensitive conformational transition of C-rich DNA strand, and the ligand-exchange process triggered by DL-dithiothreitol (DTT), a system of colorimetric logic gates (YES, AND, INHIBIT, and XOR) can be rationally constructed based on the aggregation of the DNA-modified Au NPs. The proposed logic operation system is simple, which consists of only T-/C-rich DNA-modified Au NPs, and it is unnecessary to exquisitely design and alter the DNA sequence for different multiple molecular logic operations. The nonnatural base pairing combined with unique optical properties of Au NPs promises great potential in multiplexed ion sensing, molecular-scale computers, and other computational logic devices.

  19. Exploring the Limits of DNA Size: Naphtho-homologated DNA Bases and Pairs

    PubMed Central

    Lee, Alex H. F.; Kool, Eric T.

    2008-01-01

    A new design for DNA bases and base pairs is described in which the pyrimidine bases are widened by naphtho-homologation. Two naphtho-homologated deoxyribosides, dyyT (1) and dyyC (2) were synthesized and could be incorporated into oligonucleotides as suitably protected phosphoramidite derivatives. The deoxyribosides were found to be fluorescent, with emission maxima at 446 and 433 nm, respectively. Studies with single substitutions of 1 and 2 in the natural DNA context revealed exceptionally strong base stacking propensity for both. Sequences containing multiple substitutions of 1 and 2 paired opposite adenine and guanine were subsequently mixed and studied by several analytical methods. Data from UV mixing experiments, FRET measurements, fluorescence quenching experiments, and hybridizations on beads suggest that complementary “doublewide DNA” (yyDNA) strands may self-assemble into helical complexes with 1:1 stoichiometry. Data from thermal denaturation plots and CD spectra were less conclusive. Control experiments in one sequence context gave evidence that yyDNA helices, if formed, are preferentially antiparallel and are sequence selective. Hypothesized base pairing schemes are analogous to Watson-Crick pairing, but with glycosidic C1′-C1′ distances widened by over 45%, to ca. 15.2 Å. The possible self-assembly of the double-wide DNA helix establishes a new limit for the size of information-encoding, DNA-like molecules, and the fluorescence of yyDNA bases suggests uses as reporters in monomeric and oligomeric forms. PMID:16834396

  20. sup 60 Co. gamma. -rays induce predominantly C/G to G/C transversions in double-stranded M13 DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hoebee, B.; Loman, H.; Brouwer, J.

    Upon irradiation with gamma rays of an oxygenated aqueous solution of double-stranded M13 DNA, a very specific mutation spectrum was found with respect to both the type and the positions in the DNA sequence. Of the 23 mutations, which were sequenced, 16 represent a C/G to G/C transversion. A C/G to T/A transition was found once and a G/C to T/A transversion twice. The remaining 4 mutations are frameshifts, 2 are identical and formed by the insertion of a G/C basepair; the other 2 mutations are due to a duplication of 10 basepairs situated at different positions but with amore » remarkable homology in base sequence. Fourteen mutations, including the 2 duplications are found in the neighborhood of a TGCT/ACGA sequence.« less

  1. A low-temperature-responsive element involved in the regulation of the Arabidopsis thaliana At1g71850/At1g71860 divergent gene pair.

    PubMed

    Liu, Shijuan; Chen, Huiqing; Li, Xiulan; Zhang, Wei

    2016-08-01

    The bidirectional promoter of the Arabidopsis thaliana gene pair At1g71850/At1g71860 harbors low-temperature-responsive elements, which participate in anti-correlated transcription regulation of the driving genes in response to environmental low temperature. A divergent gene pair is defined as two adjacent genes organized head to head in opposite orientation, sharing a common promoter region. Divergent gene pairs are mainly coexpressed, but some display opposite regulation. The mechanistic basis of such anti-correlated regulation is not well understood. Here, the regulation of the Arabidopsis thaliana gene pair At1g71850/At1g71860 was investigated. Semi-quantitative RT-PCR and Genevestigator analyses showed that while one of the pair was upregulated by exposure to low temperature, the same treatment downregulated the other. Promoter::GUS fusion transgenes were used to show that this behavior was driven by a bidirectional promoter, which harbored an as-1 motif, associated with the low-temperature response; mutation of this sequence produced a significant decrease in cold-responsive expression. With regard to the as-1 motif in the native orientation repressing the promoter's low-temperature responsiveness, the same as-1 motif introduced in the reverse direction showed a slight enhancement in the promoter's responsiveness to low-temperature exposure, indicating that the orientation of the motif was important for the promoter's activity. These findings provide new insights into the complex transcriptional regulation of bidirectional gene pairs as well as plant stress response.

  2. Complementary Paired G4FETs as Voltage-Controlled NDR Device

    NASA Technical Reports Server (NTRS)

    Mojarradi, Mohammad; Chen, Suheng; Blalock, Ben; Britton, Chuck; Prothro, Ben; Vandersand, James; Schrimph, Ron; Cristoloveanu, Sorin; Akavardar, Kerem; Gentil, P.

    2009-01-01

    It is possible to synthesize a voltage-controlled negative-differential-resistance (NDR) device or circuit by use of a pair of complementary G4FETs (four-gate field-effect transistors). [For more information about G4FETs, please see the immediately preceding article]. As shown in Figure 1, the present voltage-controlled NDR device or circuit is an updated version of a prior NDR device or circuit, known as a lambda diode, that contains a pair of complementary junction field-effect transistors (JFETs). (The lambda diode is so named because its current-versus- voltage plot bears some resemblance to an upper-case lambda.) The present version can be derived from the prior version by substituting G4FETs for the JFETs and connecting both JFET gates of each G4FET together. The front gate terminals of the G4FETs constitute additional terminals (that is, terminals not available in the older JFET version) to which one can apply control voltages VN and VP. Circuits in which NDR devices have been used include (1) Schmitt triggers and (2) oscillators containing inductance/ capacitance (LC) resonant circuits. Figure 2 depicts such circuits containing G4FET NDR devices like that of Figure 1. In the Schmitt trigger shown here, the G4FET NDR is loaded with an ordinary inversion-mode, p-channel, metal oxide/semiconductor field-effect transistor (inversion-mode PMOSFET), the VN terminal of the G4FET NDR device is used as an input terminal, and the input terminals of the PMOSFET and the G4FET NDR device are connected. VP can be used as an extra control voltage (that is, a control voltage not available in a typical prior Schmitt trigger) for adjusting the pinch-off voltage of the p-channel G4FET and thereby adjusting the trigger-voltage window. In the oscillator, a G4FET NDR device is loaded with a conventional LC tank circuit. As in other LC NDR oscillators, oscillation occurs because the NDR counteracts the resistance in the tank circuit. The advantage of this G4FET-NDR LC oscillator

  3. THz spectra and corresponding vibrational modes of DNA base pair cocrystals and polynucleotides

    NASA Astrophysics Data System (ADS)

    Wang, Fang; Zhao, Dongbo; Dong, Hao; Jiang, Ling; Huang, Lin; Liu, Yunfei; Li, Shuhua

    2018-07-01

    The generalized energy-based fragmentation (GEBF) approach has been applied to study the THz spectra and vibrational modes of base pair cocrystals under periodic boundary conditions (denoted as PBC-GEBF). Results of vibrational mode reveal that hydrogen bonds play a pivotal role in the pairing process of base crystals, where most Nsbnd H and Csbnd H bonds stretch to some extent. We also found that hydrogen bonds of a self-made A:T cocrystal completely break in a transition from liquid to the solid state, while self-made C:G cocrystal is different and easier to form a cocrystal, as confirmed by X-ray diffraction (XRD) and terahertz (THz) spectra. Furthermore, we have studied DNA polynucleotides (in both A and B forms) found that the vibrational modes changed a lot during the process of their forming double strand. Despite the key role played by hydrogen bonds, the key contribution originates from collective motions of the main skeleton. A comparative study of the spectra of some stranded fragments suggests that different sequences or forms have similar spectra in THz band. They distinguish from each other mainly in the low-frequency regions, especially below 1 THz. This study would make great contributions to the molecular dynamics model based DNA long-chain structure simulation in the future study.

  4. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase ι: Hoogsteen or Watson-Crick base pairing?†

    PubMed Central

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-01

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536

  5. Solution structure of a DNA decamer duplex containing the stable 3′ T⋅G base pair of the pyrimidine(6–4)pyrimidone photoproduct [(6–4) adduct]: Implications for the highly specific 3′ T → C transition of the (6–4) adduct

    PubMed Central

    Lee, Joon-Hwa; Hwang, Geum-Sook; Choi, Byong-Seok

    1999-01-01

    The pyrimidine(6–4)pyrimidone photoproduct [(6–4) adduct] is one of the major photoproducts induced by UV irradiation of DNA and occurs at TpT sites. The (6–4) adduct is highly mutagenic and leads most often to a 3′ T → C transition with 85% replicating error frequency [LeClerc, J. E., Borden, A. & Lawrence, C. W. (1991) Proc. Natl. Acad. Sci. USA 88, 9685–9689]. To determine the origin of the specific 3′ T → C transition of the (6–4) adduct, we have used experimental NMR restraints and molecular dynamics to determine the solution structure of a (6–4)-lesion DNA decamer duplex that contains a mismatched base pair between the 3′ T residue and an opposed G residue. Normal Watson–Crick-type hydrogen bonding is retained at the 5′ T of the lesion site. The O2 carbonyl of the 3′ T residue forms hydrogen bonds with the imino and amino protons of the opposed G residue. This potential hydrogen bonding stabilizes the overall helix and restores the highly distorted conformation of the (6–4) adduct to the typical B-form-like DNA structure. This structural feature can explain the marked preference for the insertion of an A residue opposite the 5′ T and a G residue opposite the 3′ T of the (6–4) lesion during trans-lesion synthesis. Thus these insertions yield the predominant 3′ T → C transition. PMID:10359763

  6. Magnetic Polarizability of Virtual (s\\bar{s}) and (c\\bar{c}) Pairs in the Nucleon

    NASA Astrophysics Data System (ADS)

    Filip, Peter

    2017-12-01

    We suggest 3 P 0 quantum state of virtual (s\\bar{s}) pairs in the nucleon can be polarised by the internal fields permeating the volume of the nucleon (proton or neutron). Due to the quadratic Zeeman interaction, 3 P 0 wavefunction of virtual (q\\bar{q}) pairs acquires the admixture of 1 P 10 quantum state in the magnetic field, which generates the antiparallel polarization of s and \\bar{s} quarks (in the nucleon). Considering the internal magnetic fields of neutron and proton (originating from their measured magnetic dipole moments), we suggest the induced s-quark polarization in the neutron to be of the oposite direction compared to the proton case. We mention the influence of the internal chromo-magnetic fields on the quantum state of (q\\bar{q}) pairs in the nucleon and we discuss also the expected behaviour of virtual (c\\bar{c}) pairs.

  7. Direct NMR Evidence that Transient Tautomeric and Anionic States in dG·dT Form Watson-Crick-like Base Pairs.

    PubMed

    Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M

    2017-03-29

    The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.

  8. Nucleic acid duplexes incorporating a dissociable covalent base pair

    NASA Technical Reports Server (NTRS)

    Gao, K.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    1999-01-01

    We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure.

  9. Nucleic acid duplexes incorporating a dissociable covalent base pair

    PubMed Central

    Gao, Kui; Orgel, Leslie E.

    1999-01-01

    We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure. PMID:10611299

  10. Additional hydrogen bonds and base-pair kinetics in the symmetrical AMP-DNA aptamer complex.

    PubMed Central

    Nonin-Lecomte, S; Lin, C H; Patel, D J

    2001-01-01

    The solution structure of an adenosine monophosphate (AMP)-DNA aptamer complex has been determined previously [Lin, C. H., and Patel, D. J. (1997) Chem. Biol. 4:817-832]. On a symmetrical aptamer complex containing the same binding loop, but with better resolved spectra, we have identified two additional hydrogen bond-mediated associations in the binding loop. One of these involves a rapidly exchanging G imino proton. The phosphate group of the AMP ligand was identified as the acceptor by comparison with other aptamer complexes. Imino proton exchange measurements also yielded the dissociation constants of the stem and binding loop base pairs. This study shows that nuclear magnetic resonance-based imino proton exchange is a good probe for detection of weak hydrogen-bond associations. PMID:11721004

  11. International Union of Basic and Clinical Pharmacology. LXXXVIII. G Protein-Coupled Receptor List: Recommendations for New Pairings with Cognate Ligands

    PubMed Central

    Alexander, Stephen P. H.; Sharman, Joanna L.; Pawson, Adam J.; Benson, Helen E.; Monaghan, Amy E.; Liew, Wen Chiy; Mpamhanga, Chidochangu P.; Bonner, Tom I.; Neubig, Richard R.; Pin, Jean Philippe; Spedding, Michael; Harmar, Anthony J.

    2013-01-01

    In 2005, the International Union of Basic and Clinical Pharmacology Committee on Receptor Nomenclature and Drug Classification (NC-IUPHAR) published a catalog of all of the human gene sequences known or predicted to encode G protein-coupled receptors (GPCRs), excluding sensory receptors. This review updates the list of orphan GPCRs and describes the criteria used by NC-IUPHAR to recommend the pairing of an orphan receptor with its cognate ligand(s). The following recommendations are made for new receptor names based on 11 pairings for class A GPCRs: hydroxycarboxylic acid receptors [HCA1 (GPR81) with lactate, HCA2 (GPR109A) with 3-hydroxybutyric acid, HCA3 (GPR109B) with 3-hydroxyoctanoic acid]; lysophosphatidic acid receptors [LPA4 (GPR23), LPA5 (GPR92), LPA6 (P2Y5)]; free fatty acid receptors [FFA4 (GPR120) with omega-3 fatty acids]; chemerin receptor (CMKLR1; ChemR23) with chemerin; CXCR7 (CMKOR1) with chemokines CXCL12 (SDF-1) and CXCL11 (ITAC); succinate receptor (SUCNR1) with succinate; and oxoglutarate receptor [OXGR1 with 2-oxoglutarate]. Pairings are highlighted for an additional 30 receptors in class A where further input is needed from the scientific community to validate these findings. Fifty-seven human class A receptors (excluding pseudogenes) are still considered orphans; information has been provided where there is a significant phenotype in genetically modified animals. In class B, six pairings have been reported by a single publication, with 28 (excluding pseudogenes) still classified as orphans. Seven orphan receptors remain in class C, with one pairing described by a single paper. The objective is to stimulate research into confirming pairings of orphan receptors where there is currently limited information and to identify cognate ligands for the remaining GPCRs. Further information can be found on the IUPHAR Database website (http://www.iuphar-db.org). PMID:23686350

  12. [Quantum-chemical investigation of tautomerization ways of Watson-Crick DNA base pair guanine-cytosine].

    PubMed

    Brovarets', O O; Hovorun, D M

    2010-01-01

    A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*<---->Gua.Cyt<---->Gua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.

  13. Terminal base pairs of oligodeoxynucleotides: imino proton exchange and fraying.

    PubMed

    Nonin, S; Leroy, J L; Guéron, M

    1995-08-22

    We have estimated the dissociation constant of the terminal base pairs of the B-DNA duplexes formed by 5'-d(CGCGATCGCG) and 5'-d(TAGCGCTA) by two methods, one based on the change in imino proton chemical shift with temperature and the other on the apparent pK shift of the imino proton, as monitored by the change in chemical shift of aromatic protons. These methods do not rely on imino proton exchange, whose rate was also measured. (1) The effect of ammonia on the imino proton exchange rate of the terminal pair of the 5'-d(CGCGATCGCG) duplex is 67 times less than on the isolated nucleoside. This provides an upper limit on the exchange rate from the closed pair. In fact, the effect is just as predicted from the dissociation constant, assuming that there is no exchange at all from the closed pair and that, as has been argued previously, external catalysts act on the open state as they do on the isolated nucleoside. The inhibition of catalyzed proton exchange in the closed pair, despite exposure of one face of the pair to solvent, is a new feature of the exchange process. It will allow determination of the dissociation constant of terminal pairs from the exchange rate. (2) Intrinsic catalysis of proton exchange is less efficient for the terminal pair than for an internal one. A possible explanation is that proton transfer across the water bridge responsible for intrinsic catalysis is slower, as expected if the open-state separation of the bases is larger in a terminal pair. This observation may lead to a direct method for the study of fraying. (3) At 0 degrees C, the dissociation constant of the second pair of the 5'-d(CGCGATCGCG) duplex is close to the square of the constant for the terminal pair, as predicted from a simple model of fraying. The enthalpy and entropy of opening of the terminal pairs may be compared with those of nearest neighbor interactions derived from calorimetry [Breslauer, K. J., et al. (1986) Proc. Natl. Acad. Sci. U.S.A. 83, 3746-3750].

  14. THz spectra and corresponding vibrational modes of DNA base pair cocrystals and polynucleotides.

    PubMed

    Wang, Fang; Zhao, Dongbo; Dong, Hao; Jiang, Ling; Huang, Lin; Liu, Yunfei; Li, Shuhua

    2018-07-05

    The generalized energy-based fragmentation (GEBF) approach has been applied to study the THz spectra and vibrational modes of base pair cocrystals under periodic boundary conditions (denoted as PBC-GEBF). Results of vibrational mode reveal that hydrogen bonds play a pivotal role in the pairing process of base crystals, where most NH and CH bonds stretch to some extent. We also found that hydrogen bonds of a self-made A:T cocrystal completely break in a transition from liquid to the solid state, while self-made C:G cocrystal is different and easier to form a cocrystal, as confirmed by X-ray diffraction (XRD) and terahertz (THz) spectra. Furthermore, we have studied DNA polynucleotides (in both A and B forms) found that the vibrational modes changed a lot during the process of their forming double strand. Despite the key role played by hydrogen bonds, the key contribution originates from collective motions of the main skeleton. A comparative study of the spectra of some stranded fragments suggests that different sequences or forms have similar spectra in THz band. They distinguish from each other mainly in the low-frequency regions, especially below 1 THz. This study would make great contributions to the molecular dynamics model based DNA long-chain structure simulation in the future study. Copyright © 2018 Elsevier B.V. All rights reserved.

  15. Base pairing and structural insights into the 5-formylcytosine in RNA duplex

    PubMed Central

    Wang, Rui; Luo, Zhipu; He, Kaizhang; Delaney, Michael O.; Chen, Doris; Sheng, Jia

    2016-01-01

    Abstract 5-Formylcytidine (f5C), a previously discovered natural nucleotide in the mitochondrial tRNA of many species including human, has been recently detected as the oxidative product of 5-methylcytidine (m5C) through 5-hydroxymethylcytidine (hm5C) in total RNA of mammalian cells. The discovery indicated that these cytosine derivatives in RNA might also play important epigenetic roles similar as in DNA, which has been intensively investigated in the past few years. In this paper, we studied the base pairing specificity of f5C in different RNA duplex contexts. We found that the 5-formyl group could increase duplex thermal stability and enhance base pairing specificity. We present three high-resolution crystal structures of an octamer RNA duplex [5′-GUA(f5C)GUAC-3′]2 that have been solved under three crystallization conditions with different buffers and pH values. Our results showed that the 5-formyl group is located in the same plane as the cytosine base and forms an intra-residue hydrogen bond with the amino group in the N4 position. In addition, this modification increases the base stacking between the f5C and the neighboring bases while not causing significant global and local structure perturbations. This work provides insights into the effects of 5-formylcytosine on RNA duplex. PMID:27079978

  16. Molecular switching behavior in isosteric DNA base pairs.

    PubMed

    Jissy, A K; Konar, Sukanya; Datta, Ayan

    2013-04-15

    The structures and proton-coupled behavior of adenine-thymine (A-T) and a modified base pair containing a thymine isostere, adenine-difluorotoluene (A-F), are studied in different solvents by dispersion-corrected density functional theory. The stability of the canonical Watson-Crick base pair and the mismatched pair in various solvents with low and high dielectric constants is analyzed. It is demonstrated that A-F base pairing is favored in solvents with low dielectric constant. The stabilization and conformational changes induced by protonation are also analyzed for the natural as well as the mismatched base pair. DNA sequences capable of changing their sequence conformation on protonation are used in the construction of pH-based molecular switches. An acidic medium has a profound influence in stabilizing the isostere base pair. Such a large gain in stability on protonation leads to an interesting pH-controlled molecular switch, which can be incorporated in a natural DNA tract. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Layer-Based Approach for Image Pair Fusion.

    PubMed

    Son, Chang-Hwan; Zhang, Xiao-Ping

    2016-04-20

    Recently, image pairs, such as noisy and blurred images or infrared and noisy images, have been considered as a solution to provide high-quality photographs under low lighting conditions. In this paper, a new method for decomposing the image pairs into two layers, i.e., the base layer and the detail layer, is proposed for image pair fusion. In the case of infrared and noisy images, simple naive fusion leads to unsatisfactory results due to the discrepancies in brightness and image structures between the image pair. To address this problem, a local contrast-preserving conversion method is first proposed to create a new base layer of the infrared image, which can have visual appearance similar to another base layer such as the denoised noisy image. Then, a new way of designing three types of detail layers from the given noisy and infrared images is presented. To estimate the noise-free and unknown detail layer from the three designed detail layers, the optimization framework is modeled with residual-based sparsity and patch redundancy priors. To better suppress the noise, an iterative approach that updates the detail layer of the noisy image is adopted via a feedback loop. This proposed layer-based method can also be applied to fuse another noisy and blurred image pair. The experimental results show that the proposed method is effective for solving the image pair fusion problem.

  18. The tolerance to exchanges of the Watson–Crick base pair in the hammerhead ribozyme core is determined by surrounding elements

    PubMed Central

    Przybilski, Rita; Hammann, Christian

    2007-01-01

    Tertiary interacting elements are important features of functional RNA molecules, for example, in all small nucleolytic ribozymes. The recent crystal structure of a tertiary stabilized type I hammerhead ribozyme revealed a conventional Watson–Crick base pair in the catalytic core, formed between nucleotides C3 and G8. We show that any Watson–Crick base pair between these positions retains cleavage competence in two type III ribozymes. In the Arabidopsis thaliana sequence, only moderate differences in cleavage rates are observed for the different base pairs, while the peach latent mosaic viroid (PLMVd) ribozyme exhibits a preference for a pyrimidine at position 3 and a purine at position 8. To understand these differences, we created a series of chimeric ribozymes in which we swapped sequence elements that surround the catalytic core. The kinetic characterization of the resulting ribozymes revealed that the tertiary interacting loop sequences of the PLMVd ribozyme are sufficient to induce the preference for Y3–R8 base pairs in the A. thaliana hammerhead ribozyme. In contrast to this, only when the entire stem–loops I and II of the A. thaliana sequences are grafted on the PLMVd ribozyme is any Watson–Crick base pair similarly tolerated. The data provide evidence for a complex interplay of secondary and tertiary structure elements that lead, mediated by long-range effects, to an individual modulation of the local structure in the catalytic core of different hammerhead ribozymes. PMID:17666711

  19. An oxygen-vacancy-rich Z-scheme g-C3N4/Pd/TiO2 heterostructure for enhanced visible light photocatalytic performance

    NASA Astrophysics Data System (ADS)

    Guo, Yanru; Xiao, Limin; Zhang, Min; Li, Qiuye; Yang, Jianjun

    2018-05-01

    An oxygen-vacancy-rich Z-scheme g-C3N4/Pd/TiO2 ternary nanocomposite was fabricated using nanotubular titanic acid as precursors via a simple photo-deposition of Pd nanoparticles and calcination process. The prepared nanocomposites were investigated by X-ray diffraction, transmission electron microscopy, X-ray photoelectron spectroscopy, and UV-visible diffuse reflectance spectroscopy, respectively. For g-C3N4/TiO2 binary nanocomposites, at the optimal content of g-C3N4 (2%), the apparent photocatalytic activity of 2%g-C3N4/TiO2 was 9 times higher than that of pure TiO2 under visible-light illumination. After deposition of Pd (1 wt%) at the contact interface between g-C3N4 and TiO2, the 2%g-C3N4/Pd/TiO2 ternary nanocomposites demonstrated the highest visible-light-driven photocatalytic activity for the degradation of gaseous propylene, which was 16- and 2-fold higher activities than pure TiO2 and 2%g-C3N4/TiO2, respectively. The mechanism for the enhanced photocatalytic performance of the g-C3N4/Pd/TiO2 photo-catalyst is proposed to be based on the efficient separation of photo-generated electron-hole pairs through Z-scheme system, in which uniform dispersity of Pd nanoparticles at contact interface between g-C3N4 and TiO2 and oxygen vacancies promote charge separation.

  20. Fragment-Based Approaches to Enhance GTP Competitive KRAS G12C Inhibitors

    DTIC Science & Technology

    During the current period we completed work on a series of guanine nucleotide mimetics and published results. As part of this we developed and...reported a novel method of measuring small molecule binding to KRAS G12C active site. We also published 2 additional manuscripts about KRAS G12C directed

  1. Optimal self-cleavage activity of the hepatitis delta virus RNA is dependent on a homopurine base pair in the ribozyme core.

    PubMed Central

    Been, M D; Perrotta, A T

    1995-01-01

    A non-Watson-Crick G.G interaction within the core region of the hepatitis delta virus (HDV) antigenomic ribozyme is required for optimal rates of self-cleavage activity. Base substitutions for either one or both G's revealed that full activity was obtained only when both G's were replaced with A's. At those positions, substitutions that generate potential Watson-Crick, G.U, heteropurine, or homopyrimidine combinations resulted in dramatically lower cleavage activity. A homopurine symmetric base pair, of the same type identified in the high-affinity binding site of the HIV RRE, is most consistent with this data. Additional features shared between the antigenomic ribozyme and the Rev binding site in the vicinity of the homopurine pairs suggest some structural similarity for this region of the two RNAs and a possible motif associated with this homopurine interaction. Evidence for a homopurine pair at the equivalent position in a modified form of the HDV genomic ribozyme was also found. With the postulated symmetric pairing scheme, large distortions in the nucleotide conformation, the sugar-phosphate backbone, or both would be necessary to accommodate this interaction at the end of a helix; we hypothesize that this distortion is critical to the structure of the active site of the ribozyme and it is stabilized by the homopurine base pair. PMID:8595561

  2. Triple helical polynucleotidic structures: an FTIR study of the C+ .G. Ctriplet.

    PubMed

    Akhebat, A; Dagneaux, C; Liquier, J; Taillandier, E

    1992-12-01

    Triple helixes containing one homopurine poly dG or poly rG strand and two homopyrimidine poly dC or poly rC strands have been prepared and studied by FTIR spectroscopy in H2O and D2O solutions. The spectra are discussed by comparison with those of the corresponding third strands (auto associated or not) and of double stranded poly dG.poly dC and poly rG.poly rC in the same concentration range and salt conditions. The triplex formation is characterized by the study of the base-base interactions reflected by changes in the spectral domain involving the in-plane double bond vibrations of the bases. Modifications of the initial duplex conformation (A family form for poly rG.poly rC, B family form for poly dG.poly dC) when the triplex is formed have been investigated. Two spectral domains (950-800 and 1450-1350 cm-1) containing absorption bands markers of the N and S type sugar geometries have been extensively studied. The spectra of the triplexes prepared starting with a double helix containing only riboses (poly rC+.poly rG.poly rC and poly dC+.poly rG.poly rC) as well as that of poly rC+.poly dG.poly dC present exclusively markers of the North type geometry of the sugars. On the contrary in the case of the poly dC+.poly dG.poly dC triplex both N and S type sugars are shown to coexist. The FTIR spectra allow us to propose that in this case the sugars of the purine (poly dG) strand adopt the S type geometry.

  3. Hydroxylamine and methoxyamine mutagenesis: displacement of the tautomeric equilibrium of the promutagen N6-methoxyadenosine by complementary base pairing.

    PubMed

    Stolarski, R; Kierdaszuk, B; Hagberg, C E; Shugar, D

    1984-06-19

    The imino-amino tautomeric equilibrium of the promutagenic adenosine analogue N6-methoxy-2',3',5'-tri-O-methyladenosine [OMe6A(Me)3], in solvents of various polarities, has been studied with the aid of 1H and 13C NMR spectroscopy. The high energy barrier (free enthalpy delta G = 80 +/- 5 kJ X mol-1) between the two tautomeric species renders possible direct observation of the independent sets of all 1H and 13C signals from each of them. The equilibrium ranges from 10% imino in CCl4 to 90% in aqueous medium. Thermodynamic parameters, including energy barriers and lifetimes, were calculated from the temperature dependence of the equilibrium. Essentially similar results prevail for the promutagenic N6-hydroxy analogue. The conformations of the sugar moieties, and of the base about the glycosidic bond, for both tautomers are similar to those for adenosine. The conformation of the exocyclic N6-OCH3 group, which determines the ability of each species to form planar associates (hydrogen-bonded base pairs), has also been evaluated. Formation of autoassociates of OMe6A(Me)3 and of heteroassociates with the potentially complementary 2',3',5'-tri-O-methyluridine and -cytidine, in chloroform solution, was also investigated. The amino form base pairs with uridine and the imino form with cytidine. Formation of a complementary base pair by a given tautomeric species was accompanied by an increase of up to 10% in the population of this species and a concomitant decrease in population of the other species.(ABSTRACT TRUNCATED AT 250 WORDS)

  4. Identification in a pseudoknot of a U⋅G motif essential for the regulation of the expression of ribosomal protein S15

    PubMed Central

    Bénard, Lionel; Mathy, Nathalie; Grunberg-Manago, Marianne; Ehresmann, Bernard; Ehresmann, Chantal; Portier, Claude

    1998-01-01

    The ribosomal protein S15 from Escherichia coli binds to a pseudoknot in its own messenger. This interaction is an essential step in the mechanism of S15 translational autoregulation. In a previous study, a recognition determinant for S15 autoregulation, involving a U⋅G wobble pair, was located in the center of stem I of the pseudoknot. In this study, an extensive mutagenesis analysis has been conducted in and around this U⋅G pair by comparing the effects of these mutations on the expression level of S15. The results show that the U⋅G wobble pair cannot be substituted by A⋅G, C⋅A, A⋅C, G⋅U, or C⋅G without loss of the autocontrol. In addition, the base pair C⋅G, adjacent to the 5′ side of U, cannot be flipped or changed to another complementary base pair without also inducing derepression of translation. A unique motif, made of only two adjacent base pairs, U⋅G/C⋅G, is essential for S15 autoregulation and is presumably involved in direct recognition by the S15 protein. PMID:9482926

  5. Bipyrimidine Signatures as a Photoprotective Genome Strategy in G + C-rich Halophilic Archaea.

    PubMed

    Jones, Daniel L; Baxter, Bonnie K

    2016-09-02

    Halophilic archaea experience high levels of ultraviolet (UV) light in their environments and demonstrate resistance to UV irradiation. DNA repair systems and carotenoids provide UV protection but do not account for the high resistance observed. Herein, we consider genomic signatures as an additional photoprotective strategy. The predominant forms of UV-induced DNA damage are cyclobutane pyrimidine dimers, most notoriously thymine dimers (T^Ts), which form at adjacent Ts. We tested whether the high G + C content seen in halophilic archaea serves a photoprotective function through limiting T nucleotides, and thus T^T lesions. However, this speculation overlooks the other bipyrimidine sequences, all of which capable of forming photolesions to varying degrees. Therefore, we designed a program to determine the frequencies of the four bipyrimidine pairs (5' to 3': TT, TC, CT, and CC) within genomes of halophilic archaea and four other randomized sample groups for comparison. The outputs for each sampled genome were weighted by the intrinsic photoreactivities of each dinucleotide pair. Statistical methods were employed to investigate intergroup differences. Our findings indicate that the UV-resistance seen in halophilic archaea can be attributed in part to a genomic strategy: high G + C content and the resulting bipyrimidine signature reduces the genomic photoreactivity.

  6. Bipyrimidine Signatures as a Photoprotective Genome Strategy in G + C-rich Halophilic Archaea

    PubMed Central

    Jones, Daniel L.; Baxter, Bonnie K.

    2016-01-01

    Halophilic archaea experience high levels of ultraviolet (UV) light in their environments and demonstrate resistance to UV irradiation. DNA repair systems and carotenoids provide UV protection but do not account for the high resistance observed. Herein, we consider genomic signatures as an additional photoprotective strategy. The predominant forms of UV-induced DNA damage are cyclobutane pyrimidine dimers, most notoriously thymine dimers (T^Ts), which form at adjacent Ts. We tested whether the high G + C content seen in halophilic archaea serves a photoprotective function through limiting T nucleotides, and thus T^T lesions. However, this speculation overlooks the other bipyrimidine sequences, all of which capable of forming photolesions to varying degrees. Therefore, we designed a program to determine the frequencies of the four bipyrimidine pairs (5’ to 3’: TT, TC, CT, and CC) within genomes of halophilic archaea and four other randomized sample groups for comparison. The outputs for each sampled genome were weighted by the intrinsic photoreactivities of each dinucleotide pair. Statistical methods were employed to investigate intergroup differences. Our findings indicate that the UV-resistance seen in halophilic archaea can be attributed in part to a genomic strategy: high G + C content and the resulting bipyrimidine signature reduces the genomic photoreactivity. PMID:27598206

  7. Synthesis, base pairing and structure studies of geranylated RNA

    PubMed Central

    Wang, Rui; Vangaveti, Sweta; Ranganathan, Srivathsan V.; Basanta-Sanchez, Maria; Haruehanroengra, Phensinee; Chen, Alan; Sheng, Jia

    2016-01-01

    Natural RNAs utilize extensive chemical modifications to diversify their structures and functions. 2-Thiouridine geranylation is a special hydrophobic tRNA modification that has been discovered very recently in several bacteria, such as Escherichia coli, Enterobacter aerogenes, Pseudomonas aeruginosa and Salmonella Typhimurium. The geranylated residues are located in the first anticodon position of tRNAs specific for lysine, glutamine and glutamic acid. This big hydrophobic terpene functional group affects the codon recognition patterns and reduces frameshifting errors during translation. We aimed to systematically study the structure, function and biosynthesis mechanism of this geranylation pathway, as well as answer the question of why nature uses such a hydrophobic modification in hydrophilic RNA systems. Recently, we have synthesized the deoxy-analog of S-geranyluridine and showed the geranylated T-G pair is much stronger than the geranylated T-A pair and other mismatched pairs in the B-form DNA duplex context, which is consistent with the observation that the geranylated tRNAGluUUC recognizes GAG more efficiently than GAA. In this manuscript we report the synthesis and base pairing specificity studies of geranylated RNA oligos. We also report extensive molecular simulation studies to explore the structural features of the geranyl group in the context of A-form RNA and its effect on codon–anticodon interaction during ribosome binding. PMID:27307604

  8. An ensemble of SVM classifiers based on gene pairs.

    PubMed

    Tong, Muchenxuan; Liu, Kun-Hong; Xu, Chungui; Ju, Wenbin

    2013-07-01

    In this paper, a genetic algorithm (GA) based ensemble support vector machine (SVM) classifier built on gene pairs (GA-ESP) is proposed. The SVMs (base classifiers of the ensemble system) are trained on different informative gene pairs. These gene pairs are selected by the top scoring pair (TSP) criterion. Each of these pairs projects the original microarray expression onto a 2-D space. Extensive permutation of gene pairs may reveal more useful information and potentially lead to an ensemble classifier with satisfactory accuracy and interpretability. GA is further applied to select an optimized combination of base classifiers. The effectiveness of the GA-ESP classifier is evaluated on both binary-class and multi-class datasets. Copyright © 2013 Elsevier Ltd. All rights reserved.

  9. Unconventionally prepared TiO2/g-C3N4 photocatalysts for photocatalytic decomposition of nitrous oxide

    NASA Astrophysics Data System (ADS)

    Troppová, Ivana; Šihor, Marcel; Reli, Martin; Ritz, Michal; Praus, Petr; Kočí, Kamila

    2018-02-01

    The TiO2/g-C3N4 nanocomposites with the various TiO2:g-C3N4 weight ratios from 1:1 to 1:3 were prepared unconventionally by pressurized hot water processing in a flow regime. The parent TiO2 and g-C3N4 was prepared by thermal hydrolysis and thermal annealing, respectively. The nanocomposites as well as parent TiO2 and g-C3N4 were characterized using several complementary characterization methods and investigated in the photocatalytic decomposition of N2O under UVA (λ = 365 nm) irradiation. All the prepared TiO2/g-C3N4 nanocomposites showed higher photocatalytic activity in comparison with the pure g-C3N4 and chiefly pure TiO2. The photocatalytic activity of TiO2/g-C3N4 nanocomposites was decreasing in the following sequence: TiO2/g-C3N4 (1:3) > TiO2/g-C3N4 (1:2) > TiO2/g-C3N4 (1:1). In comparison with the parent TiO2 or g-C3N4, the TiO2/g-C3N4 nanocomposites' photocatalytic capability was significantly enhanced by coupling TiO2 with g-C3N4. The generation of TiO2/g-C3N4 Z-scheme photocatalyst mainly benefited from the effective separation of photoinduced electron-hole pairs and the extended optical absorption range. The TiO2/g-C3N4 (1:3) nanocomposite showed the best photocatalytic behavior in a consequence of the optimal weight ratio of TiO2:g-C3N4 and the lowest band gap energy from all nanocomposites. The N2O conversion in its presence was 70.6% after 20 h of UVA irradiation.

  10. tRNA1Ser(G34) with the anticodon GGA can recognize not only UCC and UCU codons but also UCA and UCG codons.

    PubMed

    Yamada, Yuko; Matsugi, Jitsuhiro; Ishikura, Hisayuki

    2003-04-15

    The tRNA1Ser (anticodon VGA, V=uridin-5-oxyacetic acid) is essential for translation of the UCA codon in Escherichia coli. Here, we studied the translational abilities of serine tRNA derivatives, which have different bases from wild type at the first positions of their anticodons, using synthetic mRNAs containing the UCN (N=A, G, C, or U) codon. The tRNA1Ser(G34) having the anticodon GGA was able to read not only UCC and UCU codons but also UCA and UCG codons. This means that the formation of G-A or G-G pair allowed at the wobble position and these base pairs are noncanonical. The translational efficiency of the tRNA1Ser(G34) for UCA or UCG codon depends on the 2'-O-methylation of the C32 (Cm). The 2'-O-methylation of C32 may give rise to the space necessary for G-A or G-G base pair formation between the first position of anticodon and the third position of codon.

  11. Base-Pairing Energies of Protonated Nucleoside Base Pairs of dCyd and m5dCyd: Implications for the Stability of DNA i-Motif Conformations

    NASA Astrophysics Data System (ADS)

    Yang, Bo; Rodgers, M. T.

    2015-08-01

    Hypermethylation of cytosine in expanded (CCG)n•(CGG)n trinucleotide repeats results in Fragile X syndrome, the most common cause of inherited mental retardation. The (CCG)n•(CGG)n repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of protonated base pairs of cytosine. Here we investigate the effects of 5-methylation and the sugar moiety on the base-pairing energies (BPEs) of protonated cytosine base pairs by examining protonated nucleoside base pairs of 2'-deoxycytidine (dCyd) and 5-methyl-2'-deoxycytidine (m5dCyd) using threshold collision-induced dissociation techniques. 5-Methylation of a single or both cytosine residues leads to very small change in the BPE. However, the accumulated effect may be dramatic in diseased state trinucleotide repeats where many methylated base pairs may be present. The BPEs of the protonated nucleoside base pairs examined here significantly exceed those of Watson-Crick dGuo•dCyd and neutral dCyd•dCyd base pairs, such that these base-pairing interactions provide the major forces responsible for stabilization of DNA i-motif conformations. Compared with isolated protonated nucleobase pairs of cytosine and 1-methylcytosine, the 2'-deoxyribose sugar produces an effect similar to the 1-methyl substituent, and leads to a slight decrease in the BPE. These results suggest that the base-pairing interactions may be slightly weaker in nucleic acids, but that the extended backbone is likely to exert a relatively small effect on the total BPE. The proton affinity (PA) of m5dCyd is also determined by competitive analysis of the primary dissociation pathways that occur in parallel for the protonated (m5dCyd)H+(dCyd) nucleoside base pair and the absolute PA of dCyd previously reported.

  12. Reactivity of cytosine and thymine in single-base-pair mismatches with hydroxylamine and osmium tetroxide and its application to the study of mutations.

    PubMed Central

    Cotton, R G; Rodrigues, N R; Campbell, R D

    1988-01-01

    The chemical reactivity of thymine (T), when mismatched with the bases cytosine, guanine, and thymine, and of cytosine (C), when mismatched with thymine, adenine, and cytosine, has been examined. Heteroduplex DNAs containing such mismatched base pairs were first incubated with osmium tetroxide (for T and C mismatches) or hydroxylamine (for C mismatches) and then incubated with piperidine to cleave the DNA at the modified mismatched base. This cleavage was studied with an internally labeled strand containing the mismatched T or C, such that DNA cleavage and thus reactivity could be detected by gel electrophoresis. Cleavage at a total of 13 T and 21 C mismatches isolated (by at least three properly paired bases on both sides) single-base-pair mismatches was identified. All T or C mismatches studied were cleaved. By using end-labeled DNA probes containing T or C single-base-pair mismatches and conditions for limited cleavage, we were able to show that cleavage was at the base predicted by sequence analysis and that mismatches in a length of DNA could be readily detected by such an approach. This procedure may enable detection of all single-base-pair mismatches by use of sense and antisense probes and thus may be used to identify the mutated base and its position in a heteroduplex. Images PMID:3260032

  13. The effect of the common c.2299delG mutation in USH2A on RNA splicing.

    PubMed

    Lenassi, Eva; Saihan, Zubin; Bitner-Glindzicz, Maria; Webster, Andrew R

    2014-05-01

    Recessive variants in the USH2A gene are an important cause of both Usher syndrome and nonsyndromic retinitis pigmentosa. A single base-pair deletion in exon 13 (c.2299delG, p.Glu767Serfs*21) is considered the most frequent mutation of USH2A. It is predicted to generate a premature termination codon and is presumed to lead to nonsense mediated decay. However the effect of this variant on RNA has not been formally investigated. It is not uncommon for exonic sequence alterations to cause aberrant splicing and the aim of the present report is to evaluate the effect of c.2299delG on USH2A transcripts. Nasal cells represent the simplest available tissue to study splicing defects in USH2A. Nasal brushing, RNA extraction from nasal epithelial cells and reverse transcription PCR were performed in five Usher syndrome patients who were homozygous for c.2299delG, two unaffected c.2299delG heterozygotes and seven control individuals. Primers to amplify between exons 12 and 15 and exons 10 and 14 were utilised. Significant variability was observed between different RT-PCR experiments. Importantly, in controls, PCR product of the expected size were amplified on all occasions (13/13 experiments); for patients this was true in only 4/14 experiments (Fisher exact test p = 0.0002). Bioinformatics tools predict the c.2299delG change to disrupt an exonic splicing enhancer and to create an exonic splicing silencer within exon 13. Here, we report an effect of the common c.2299delG mutation on splicing of exons 12 and 13 of USH2A. Future studies are expected to provide important insights into the contribution of this effect on the phenotype. Copyright © 2014 Elsevier Ltd. All rights reserved.

  14. Unique Thermal Stability of Unnatural Hydrophobic Ds Bases in Double-Stranded DNAs.

    PubMed

    Kimoto, Michiko; Hirao, Ichiro

    2017-10-20

    Genetic alphabet expansion technology, the introduction of unnatural bases or base pairs into replicable DNA, has rapidly advanced as a new synthetic biology area. A hydrophobic unnatural base pair between 7-(2-thienyl)imidazo[4,5-b]pyridine (Ds) and 2-nitro-4-propynylpyrrole (Px) exhibited high fidelity as a third base pair in PCR. SELEX methods using the Ds-Px pair enabled high-affinity DNA aptamer generation, and introducing a few Ds bases into DNA aptamers extremely augmented their affinities and selectivities to target proteins. Here, to further scrutinize the functions of this highly hydrophobic Ds base, the thermal stabilities of double-stranded DNAs (dsDNA) containing a noncognate Ds-Ds or G-Ds pair were examined. The thermal stability of the Ds-Ds self-pair was as high as that of the natural G-C pair, and apart from the generally higher stability of the G-C pair than that of the A-T pair, most of the 5'-pyrimidine-Ds-purine-3' sequences, such as CDsA and TDsA, exhibited higher stability than the 5'-purine-Ds-pyrimidine-3' sequences, such as GDsC and ADsC, in dsDNAs. This trait enabled the GC-content-independent control of the thermal stability of the designed dsDNA fragments. The melting temperatures of dsDNA fragments containing the Ds-Ds pair can be predicted from the nearest-neighbor parameters including the Ds base. In addition, the noncognate G-Ds pair can efficiently distinguish its neighboring cognate natural base pairs from noncognate pairs. We demonstrated that real-time PCR using primers containing Ds accurately detected a single-nucleotide mismatch in target DNAs. These unique properties of the Ds base that affect the stabilities of the neighboring base pairs could impart new functions to DNA molecules and technologies.

  15. Theory of nodal s ±-wave pairing symmetry in the Pu-based 115 superconductor family

    DOE PAGES

    Das, Tanmoy; Zhu, Jian -Xin; Graf, Matthias J.

    2015-02-27

    The spin-fluctuation mechanism of superconductivity usually results in the presence of gapless or nodal quasiparticle states in the excitation spectrum. Nodal quasiparticle states are well established in copper-oxide, and heavy-fermion superconductors, but not in iron-based superconductors. Here, we study the pairing symmetry and mechanism of a new class of plutonium-based high-T c superconductors and predict the presence of a nodal s⁺⁻ wave pairing symmetry in this family. Starting from a density-functional theory (DFT) based electronic structure calculation we predict several three-dimensional (3D) Fermi surfaces in this 115 superconductor family. We identify the dominant Fermi surface “hot-spots” in the inter-band scatteringmore » channel, which are aligned along the wavevector Q = (π, π, π), where degeneracy could induce sign-reversal of the pairing symmetry. Our calculation demonstrates that the s⁺⁻ wave pairing strength is stronger than the previously thought d-wave pairing; and more importantly, this pairing state allows for the existence of nodal quasiparticles. Finally, we predict the shape of the momentum- and energy-dependent magnetic resonance spectrum for the identification of this pairing symmetry.« less

  16. Graphitic Carbon Nitride (g-C3N4)-Based Photocatalysts for Artificial Photosynthesis and Environmental Remediation: Are We a Step Closer To Achieving Sustainability?

    PubMed

    Ong, Wee-Jun; Tan, Lling-Lling; Ng, Yun Hau; Yong, Siek-Ting; Chai, Siang-Piao

    2016-06-22

    As a fascinating conjugated polymer, graphitic carbon nitride (g-C3N4) has become a new research hotspot and drawn broad interdisciplinary attention as a metal-free and visible-light-responsive photocatalyst in the arena of solar energy conversion and environmental remediation. This is due to its appealing electronic band structure, high physicochemical stability, and "earth-abundant" nature. This critical review summarizes a panorama of the latest progress related to the design and construction of pristine g-C3N4 and g-C3N4-based nanocomposites, including (1) nanoarchitecture design of bare g-C3N4, such as hard and soft templating approaches, supramolecular preorganization assembly, exfoliation, and template-free synthesis routes, (2) functionalization of g-C3N4 at an atomic level (elemental doping) and molecular level (copolymerization), and (3) modification of g-C3N4 with well-matched energy levels of another semiconductor or a metal as a cocatalyst to form heterojunction nanostructures. The construction and characteristics of each classification of the heterojunction system will be critically reviewed, namely metal-g-C3N4, semiconductor-g-C3N4, isotype g-C3N4/g-C3N4, graphitic carbon-g-C3N4, conducting polymer-g-C3N4, sensitizer-g-C3N4, and multicomponent heterojunctions. The band structures, electronic properties, optical absorption, and interfacial charge transfer of g-C3N4-based heterostructured nanohybrids will also be theoretically discussed based on the first-principles density functional theory (DFT) calculations to provide insightful outlooks on the charge carrier dynamics. Apart from that, the advancement of the versatile photoredox applications toward artificial photosynthesis (water splitting and photofixation of CO2), environmental decontamination, and bacteria disinfection will be presented in detail. Last but not least, this comprehensive review will conclude with a summary and some invigorating perspectives on the challenges and future directions

  17. Synthesis of g-C{sub 3}N{sub 4}/Ag{sub 3}PO{sub 4} heterojunction with enhanced photocatalytic performance

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    He, Peizhi; Song, Limin; Zhang, Shujuan, E-mail: songlmnk@sohu.com

    2014-03-01

    Graphical abstract: g-C{sub 3}N{sub 4}/Ag{sub 3}PO{sub 4} heterojunction photocatalyst with visible-light response was prepared by a facile coprecipitation method. The results show that g-C{sub 3}N{sub 4}/Ag{sub 3}PO{sub 4} possesses a much higher activity for the decomposition of RhB than that of the pure Ag{sub 3}PO{sub 4} particles. The most mechanism is that g-C{sub 3}N{sub 4}/Ag{sub 3}PO{sub 4} heterojunction photocatalyst can efficiently separate the photogenerated electron–hole pairs, enhancing the photocatalytic activity of g-C{sub 3}N{sub 4}/Ag{sub 3}PO{sub 4} composites. - Highlights: • g-C{sub 3}N{sub 4}/Ag{sub 3}PO{sub 4} heterojunction showed much higher activity than that of Ag{sub 3}PO{sub 4}. • The high activitymore » could be attributed to g-C{sub 3}N{sub 4} for modifying Ag{sub 3}PO{sub 4}. • More ·OH radicals may be significant reason to improve Ag{sub 3}PO{sub 4} activity. - Abstract: g-C{sub 3}N{sub 4}/Ag{sub 3}PO{sub 4} heterojunction photocatalyst with visible-light response was prepared by a facile coprecipitation method. The photocatalysts were characterized by X-ray powder diffraction, transmission electron microscopy, UV–vis absorption spectroscopy and Fourier transform infrared spectroscopy. The photocatalytic activities of the obtained samples were tested by using Rhodamine B (RhB) as the degradation target under visible light irradiation. g-C{sub 3}N{sub 4}/Ag{sub 3}PO{sub 4} decomposed RhB more effectively than the pure Ag{sub 3}PO{sub 4} particles did, and 2 wt.% g-C{sub 3}N{sub 4} had the highest activity. Furthermore, 2 wt.% g-C{sub 3}N{sub 4}/Ag{sub 3}PO{sub 4} degraded high-concentration RhB more potently than unmodified Ag{sub 3}PO{sub 4} did, probably because g-C{sub 3}N{sub 4}/Ag{sub 3}PO{sub 4} heterojunction photocatalyst enhanced the photocatalytic activity by efficiently separating the photogenerated electron–hole pairs.« less

  18. Energy barriers and rates of tautomeric transitions in DNA bases: ab initio quantum chemical study.

    PubMed

    Basu, Soumalee; Majumdar, Rabi; Das, Gourab K; Bhattacharyya, Dhananjay

    2005-12-01

    Tautomeric transitions of DNA bases are proton transfer reactions, which are important in biology. These reactions are involved in spontaneous point mutations of the genetic material. In the present study, intrinsic reaction coordinates (IRC) analyses through ab initio quantum chemical calculations have been carried out for the individual DNA bases A, T, G, C and also A:T and G:C base pairs to estimate the kinetic and thermodynamic barriers using MP2/6-31G** method for tautomeric transitions. Relatively higher values of kinetic barriers (about 50-60 kcal/mol) have been observed for the single bases, indicating that tautomeric alterations of isolated single bases are quite unlikely. On the other hand, relatively lower values of the kinetic barriers (about 20-25 kcal/mol) for the DNA base pairs A:T and G:C clearly suggest that the tautomeric shifts are much more favorable in DNA base pairs than in isolated single bases. The unusual base pairing A':C, T':G, C':A or G':T in the daughter DNA molecule, resulting from a parent DNA molecule with tautomeric shifts, is found to be stable enough to result in a mutation. The transition rate constants for the single DNA bases in addition to the base pairs are also calculated by computing the free energy differences between the transition states and the reactants.

  19. Synthesis, base pairing and structure studies of geranylated RNA.

    PubMed

    Wang, Rui; Vangaveti, Sweta; Ranganathan, Srivathsan V; Basanta-Sanchez, Maria; Haruehanroengra, Phensinee; Chen, Alan; Sheng, Jia

    2016-07-27

    Natural RNAs utilize extensive chemical modifications to diversify their structures and functions. 2-Thiouridine geranylation is a special hydrophobic tRNA modification that has been discovered very recently in several bacteria, such as Escherichia coli, Enterobacter aerogenes, Pseudomonas aeruginosa and Salmonella Typhimurium The geranylated residues are located in the first anticodon position of tRNAs specific for lysine, glutamine and glutamic acid. This big hydrophobic terpene functional group affects the codon recognition patterns and reduces frameshifting errors during translation. We aimed to systematically study the structure, function and biosynthesis mechanism of this geranylation pathway, as well as answer the question of why nature uses such a hydrophobic modification in hydrophilic RNA systems. Recently, we have synthesized the deoxy-analog of S-geranyluridine and showed the geranylated T-G pair is much stronger than the geranylated T-A pair and other mismatched pairs in the B-form DNA duplex context, which is consistent with the observation that the geranylated tRNA(Glu) UUC recognizes GAG more efficiently than GAA. In this manuscript we report the synthesis and base pairing specificity studies of geranylated RNA oligos. We also report extensive molecular simulation studies to explore the structural features of the geranyl group in the context of A-form RNA and its effect on codon-anticodon interaction during ribosome binding. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Structural Elements in the Gαs and Gαq C Termini That Mediate Selective G Protein-coupled Receptor (GPCR) Signaling.

    PubMed

    Semack, Ansley; Sandhu, Manbir; Malik, Rabia U; Vaidehi, Nagarajan; Sivaramakrishnan, Sivaraj

    2016-08-19

    Although the importance of the C terminus of the α subunit of the heterotrimeric G protein in G protein-coupled receptor (GPCR)-G protein pairing is well established, the structural basis of selective interactions remains unknown. Here, we combine live cell FRET-based measurements and molecular dynamics simulations of the interaction between the GPCR and a peptide derived from the C terminus of the Gα subunit (Gα peptide) to dissect the molecular mechanisms of G protein selectivity. We observe a direct link between Gα peptide binding and stabilization of the GPCR conformational ensemble. We find that cognate and non-cognate Gα peptides show deep and shallow binding, respectively, and in distinct orientations within the GPCR. Binding of the cognate Gα peptide stabilizes the agonist-bound GPCR conformational ensemble resulting in favorable binding energy and lower flexibility of the agonist-GPCR pair. We identify three hot spot residues (Gαs/Gαq-Gln-384/Leu-349, Gln-390/Glu-355, and Glu-392/Asn-357) that contribute to selective interactions between the β2-adrenergic receptor (β2-AR)-Gαs and V1A receptor (V1AR)-Gαq The Gαs and Gαq peptides adopt different orientations in β2-AR and V1AR, respectively. The β2-AR/Gαs peptide interface is dominated by electrostatic interactions, whereas the V1AR/Gαq peptide interactions are predominantly hydrophobic. Interestingly, our study reveals a role for both favorable and unfavorable interactions in G protein selection. Residue Glu-355 in Gαq prevents this peptide from interacting strongly with β2-AR. Mutagenesis to the Gαs counterpart (E355Q) imparts a cognate-like interaction. Overall, our study highlights the synergy in molecular dynamics and FRET-based approaches to dissect the structural basis of selective G protein interactions. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. The influence of arene-ring size on stacking interaction with canonical base pairs

    NASA Astrophysics Data System (ADS)

    Formánek, Martin; Burda, Jaroslav V.

    2014-04-01

    Stacking interactions between aromatic molecules (benzene, p-cymene, biphenyl, and di- and tetra-hydrogen anthracene) and G.C and A.T canonical Watson-Crick (WC) base pairs are explored. Two functionals with dispersion corrections: ω-B97XD and B3LYP-D3 are used. For a comparison also the MP2 and B3LYP-D3/PCM methods were used for the most stable p-cymene…WC geometries. It was found that the stacking interaction increases with the size of π-conjugation system. Its extent is in agreement with experimental finding on anticancer activity of Ru(II) piano-stool complexes where intercalation of these aromatic molecules should play an important role. The explored structures are considered as ternary system so that decomposition of the interaction energy to pairwise and non-additivity contributions is also examined.

  2. Characterization of the Trans Watson-Crick GU Base Pair Located in the Catalytic Core of the Antigenomic HDV Ribozyme

    PubMed Central

    Lévesque, Dominique; Reymond, Cédric; Perreault, Jean-Pierre

    2012-01-01

    The HDV ribozyme’s folding pathway is, by far, the most complex folding pathway elucidated to date for a small ribozyme. It includes 6 different steps that have been shown to occur before the chemical cleavage. It is likely that other steps remain to be discovered. One of the most critical of these unknown steps is the formation of the trans Watson-Crick GU base pair within loop III. The U23 and G28 nucleotides that form this base pair are perfectly conserved in all natural variants of the HDV ribozyme, and therefore are considered as being part of the signature of HDV-like ribozymes. Both the formation and the transformation of this base pair have been studied mainly by crystal structure and by molecular dynamic simulations. In order to obtain physical support for the formation of this base pair in solution, a set of experiments, including direct mutagenesis, the site-specific substitution of chemical groups, kinetic studies, chemical probing and magnesium-induced cleavage, were performed with the specific goal of characterizing this trans Watson-Crick GU base pair in an antigenomic HDV ribozyme. Both U23 and G28 can be substituted for nucleotides that likely preserve some of the H-bond interactions present before and after the cleavage step. The formation of the more stable trans Watson-Crick base pair is shown to be a post-cleavage event, while a possibly weaker trans Watson-Crick/Hoogsteen interaction seems to form before the cleavage step. The formation of this unusually stable post-cleavage base pair may act as a driving force on the chemical cleavage by favouring the formation of a more stable ground state of the product-ribozyme complex. To our knowledge, this represents the first demonstration of a potential stabilising role of a post-cleavage conformational switch event in a ribozyme-catalyzed reaction. PMID:22768274

  3. Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics

    PubMed Central

    Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.

    2015-01-01

    Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517

  4. Analysis of canine herpesvirus gB, gC and gD expressed by a recombinant vaccinia virus.

    PubMed

    Xuan, X; Kojima, A; Murata, T; Mikami, T; Otsuka, H

    1997-01-01

    The genes encoding the canine herpesvirus (CHV) glycoprotein B (gB), gC and gD homologues have been reported already. However, products of these genes have not been identified yet. Previously, we have identified three CHV glycoproteins, gp 145/112, gp80 and gp47 using a panel of monoclonal antibodies (MAbs). To determine which CHV glycoprotein corresponds to gB, gC or gD, the putative genes of gB, gC, and gD of CHV were inserted into the thymidine kinase gene of vaccinia virus LC16mO strain under the control of the early-late promoter for the vaccinia virus 7.5-kilodalton polypeptide. We demonstrated here that gp145/112, gp80 and gp47 were the translation products of the CHV gB, gC and gD genes, respectively. The antigenic authenticity of recombinant gB, gC and gD were confirmed by a panel of MAbs specific for each glycoprotein produced in CHV-infected cells. Immunization of mice with these recombinants produced high titers of neutralizing antibodies against CHV. These results suggest that recombinant vaccinia viruses expressing CHV gB, gC and gD may be useful to develop a vaccine to control CHV infection.

  5. Integrated G and C Implementation within IDOS: A Simulink Based Reusable Launch Vehicle Simulation

    NASA Technical Reports Server (NTRS)

    Fisher, Joseph E.; Bevacqua, Tim; Lawrence, Douglas A.; Zhu, J. Jim; Mahoney, Michael

    2003-01-01

    The implementation of multiple Integrated Guidance and Control (IG&C) algorithms per flight phase within a vehicle simulation poses a daunting task to coordinate algorithm interactions with the other G&C components and with vehicle subsystems. Currently being developed by Universal Space Lines LLC (USL) under contract from NASA, the Integrated Development and Operations System (IDOS) contains a high fidelity Simulink vehicle simulation, which provides a means to test cutting edge G&C technologies. Combining the modularity of this vehicle simulation and Simulink s built-in primitive blocks provide a quick way to implement algorithms. To add discrete-event functionality to the unfinished IDOS simulation, Vehicle Event Manager (VEM) and Integrated Vehicle Health Monitoring (IVHM) subsystems were created to provide discrete-event and pseudo-health monitoring processing capabilities. Matlab's Stateflow is used to create the IVHM and Event Manager subsystems and to implement a supervisory logic controller referred to as the Auto-commander as part of the IG&C to coordinate the control system adaptation and reconfiguration and to select the control and guidance algorithms for a given flight phase. Manual creation of the Stateflow charts for all of these subsystems is a tedious and time-consuming process. The Stateflow Auto-builder was developed as a Matlab based software tool for the automatic generation of a Stateflow chart from information contained in a database. This paper describes the IG&C, VEM and IVHM implementations in IDOS. In addition, this paper describes the Stateflow Auto-builder.

  6. Database of non-canonical base pairs found in known RNA structures

    NASA Technical Reports Server (NTRS)

    Nagaswamy, U.; Voss, N.; Zhang, Z.; Fox, G. E.

    2000-01-01

    Atomic resolution RNA structures are being published at an increasing rate. It is common to find a modest number of non-canonical base pairs in these structures in addition to the usual Watson-Crick pairs. This database summarizes the occurrence of these rare base pairs in accordance with standard nomenclature. The database, http://prion.bchs.uh.edu/, contains information such as sequence context, sugar pucker conformation, anti / syn base conformations, chemical shift, p K (a)values, melting temperature and free energy. Of the 29 anticipated pairs with two or more hydrogen bonds, 20 have been encountered to date. In addition, four unexpected pairs with two hydrogen bonds have been reported bringing the total to 24. Single hydrogen bond versions of five of the expected geometries have been encountered among the single hydrogen bond interactions. In addition, 18 different types of base triplets have been encountered, each of which involves three to six hydrogen bonds. The vast majority of the rare base pairs are antiparallel with the bases in the anti configuration relative to the ribose. The most common are the GU wobble, the Sheared GA pair, the Reverse Hoogsteen pair and the GA imino pair.

  7. Structural landscape of base pairs containing post-transcriptional modifications in RNA

    PubMed Central

    Seelam, Preethi P.; Sharma, Purshotam

    2017-01-01

    Base pairs involving post-transcriptionally modified nucleobases are believed to play important roles in a wide variety of functional RNAs. Here we present our attempts toward understanding the structural and functional role of naturally occurring modified base pairs using a combination of X-ray crystal structure database analysis, sequence analysis, and advanced quantum chemical methods. Our bioinformatics analysis reveals that despite their presence in all major secondary structural elements, modified base pairs are most prevalent in tRNA crystal structures and most commonly involve guanine or uridine modifications. Further, analysis of tRNA sequences reveals additional examples of modified base pairs at structurally conserved tRNA regions and highlights the conservation patterns of these base pairs in three domains of life. Comparison of structures and binding energies of modified base pairs with their unmodified counterparts, using quantum chemical methods, allowed us to classify the base modifications in terms of the nature of their electronic structure effects on base-pairing. Analysis of specific structural contexts of modified base pairs in RNA crystal structures revealed several interesting scenarios, including those at the tRNA:rRNA interface, antibiotic-binding sites on the ribosome, and the three-way junctions within tRNA. These scenarios, when analyzed in the context of available experimental data, allowed us to correlate the occurrence and strength of modified base pairs with their specific functional roles. Overall, our study highlights the structural importance of modified base pairs in RNA and points toward the need for greater appreciation of the role of modified bases and their interactions, in the context of many biological processes involving RNA. PMID:28341704

  8. 2-Thiouracil deprived of thiocarbonyl function preferentially base pairs with guanine rather than adenine in RNA and DNA duplexes

    PubMed Central

    Sochacka, Elzbieta; Szczepanowski, Roman H.; Cypryk, Marek; Sobczak, Milena; Janicka, Magdalena; Kraszewska, Karina; Bartos, Paulina; Chwialkowska, Anna; Nawrot, Barbara

    2015-01-01

    2-Thiouracil-containing nucleosides are essential modified units of natural and synthetic nucleic acids. In particular, the 5-substituted-2-thiouridines (S2Us) present in tRNA play an important role in tuning the translation process through codon–anticodon interactions. The enhanced thermodynamic stability of S2U-containing RNA duplexes and the preferred S2U-A versus S2U-G base pairing are appreciated characteristics of S2U-modified molecular probes. Recently, we have demonstrated that 2-thiouridine (alone or within an RNA chain) is predominantly transformed under oxidative stress conditions to 4-pyrimidinone riboside (H2U) and not to uridine. Due to the important biological functions and various biotechnological applications for sulfur-containing nucleic acids, we compared the thermodynamic stabilities of duplexes containing desulfured products with those of 2-thiouracil-modified RNA and DNA duplexes. Differential scanning calorimetry experiments and theoretical calculations demonstrate that upon 2-thiouracil desulfuration to 4-pyrimidinone, the preferred base pairing of S2U with adenosine is lost, with preferred base pairing with guanosine observed instead. Therefore, biological processes and in vitro assays in which oxidative desulfuration of 2-thiouracil-containing components occurs may be altered. Moreover, we propose that the H2U-G base pair is a suitable model for investigation of the preferred recognition of 3′-G-ending versus A-ending codons by tRNA wobble nucleosides, which may adopt a 4-pyrimidinone-type structural motif. PMID:25690900

  9. Visible light photoelectrochemical aptasensor for adenosine detection based on CdS/PPy/g-C3N4 nanocomposites.

    PubMed

    Liu, Yixin; Ma, Hongmin; Zhang, Yong; Pang, Xuehui; Fan, Dawei; Wu, Dan; Wei, Qin

    2016-12-15

    In this work, a label-free photoelectrochemical (PEC) aptasensor was developed for adenosine detection based on CdS/PPy/g-C3N4 nanocomposites. The CdS/g-C3N4 heterojunction effectively prevented the photogenerated charges recombination of g-C3N4 and self-photocorrosion processes of CdS, improving photo-to-current conversion efficiency. The introduced polypyrrole (PPy) nanoparticles could lead to a more effective separation of photogenerated charges, thus resulting in a further increasing of photocurrent. The CdS/PPy/g-C3N4 was firstly employed as the photoactive materials for fabrication of aptasensor, and SH-aptamer was then adsorbed on the CdS/PPy/g-C3N4 modified electrodes through S-Cd bond. With increasing of adenosine concentration, the photocurrent decreased as the formation of SH-aptamer-adenosine bioaffinity complexes. Under optimal conditions, the PEC aptasensor had a sensitive response to adenosine in a linear range of 0.3nmolL(-1) to 200nmolL(-1) with a detection limit of 0.1nmolL(-1). Besides, the as-proposed aptasensor has also been applied in human serum samples analysis. The aptasensor exhibits high sensitivity and good stability, thus opening up a new promising PEC platform for some other small molecules analysis. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Spectroscopic studies of the binding of Cu(II) complexes of oxicam NSAIDs to alternating G-C and homopolymeric G-C sequences

    NASA Astrophysics Data System (ADS)

    Chakraborty, Sreeja; Bose, Madhuparna; Sarkar, Munna

    2014-03-01

    Drugs belonging to the Non-steroidal anti-inflammatory (NSAID) group are not only used as anti-inflammatory, analgesic and anti-pyretic agents, but also show anti-cancer effects. Complexing them with a bioactive metal like copper, show an enhancement in their anti-cancer effects compared to the bare drugs, whose exact mechanism of action is not yet fully understood. For the first time, it was shown by our group that Cu(II)-NSAIDs can directly bind to the DNA backbone. The ability of the copper complexes of NSAIDs namely meloxicam and piroxicam to bind to the DNA backbone could be a possible molecular mechanism behind their enhanced anticancer effects. Elucidating base sequence specific interaction of Cu(II)-NSAIDs to the DNA will provide information on their possible binding sites in the genome sequence. In this work, we present how these complexes respond to differences in structure and hydration pattern of GC rich sequences. For this, binding studies of Cu(II) complexes of piroxicam [Cu(II)-(Px)2 (L)2] and meloxicam [Cu(II)-(Mx)2 (L)] with alternating GC (polydG-dC) and homopolymeric GC (polydG-polydC) sequences were carried out using a combination of spectroscopic techniques that include UV-Vis absorption, fluorescence and circular dichroism (CD) spectroscopy. The Cu(II)-NSAIDs show strong binding affinity to both polydG-dC and polydG-polydC. The role reversal of Cu(II)-meloxicam from a strong binder of polydG-dC (Kb = 11.5 × 103 M-1) to a weak binder of polydG-polydC (Kb = 5.02 × 103 M-1), while Cu(II)-piroxicam changes from a strong binder of polydG-polydC (Kb = 8.18 × 103 M-1) to a weak one of polydG-dC (Kb = 2.18 × 103 M-1), point to the sensitivity of these complexes to changes in the backbone structures/hydration. Changes in the profiles of UV absorption band and CD difference spectra, upon complex binding to polynucleotides and the results of competitive binding assay using ethidium bromide (EtBr) fluorescence indicate different binding modes in each

  11. Possible association of 3' UTR +357 A>G, IVS11-nt 93 T>C, c.1311 C>T polymorphism with G6PD deficiency.

    PubMed

    Sirdah, Mahmoud M; Shubair, Mohammad E; Al-Kahlout, Mustafa S; Al-Tayeb, Jamal M; Prchal, Josef T; Reading, N Scott

    2017-07-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a common X-linked inherited enzymopathic disorder affecting more than 500 million people worldwide. It has so far been linked to 217 distinct genetic variants in the exons and exon-intron boundaries of the G6PD gene, giving rise to a wide range of biochemical heterogeneity and clinical manifestations. Reports from different settings suggested the association of intronic and other mutations outside the reading frame of the G6PD gene with reduced enzyme activity and presenting clinical symptoms. The present study aimed to investigate any association of other variations apart of the exonic or exonic intronic boundaries in the development of G6PD deficiency. Sixty-seven unrelated Palestinian children admitted to the pediatric hospital with hemolytic crises due to G6PD deficiency were studied. In our Palestinian cohort of 67 [59 males (M) and 8 females (F)] G6PD-deficient children, previously hospitalized for acute hemolytic anemia due to favism, molecular sequencing of the G6PD gene revealed four cases (3M and 1F) that did not have any of the variants known to cause G6PD deficiency, but the 3' UTR c.*+357A>G (rs1050757) polymorphism in association with IVS 11 (c.1365-13T>C; rs2071429), and c.1311C>T (rs2230037). We now provide an additional evidence form Palestinian G6PD-deficient subjects for a possible role of 3' UTR c.*+357 A>G, c.1365-13T>C, and/or c.1311C>T polymorphism for G6PD deficiency, suggesting that not only a single variation in the exonic or exonic intronic boundaries, but also a haplotype of G6PD should considered as a cause for G6PD deficiency.

  12. Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant.

    PubMed

    Xia, Shuangluo; Konigsberg, William H

    2014-04-01

    Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.

  13. Enhanced visible light photocatalytic water reduction from a g-C 3N 4/SrTa 2O 6 heterojunction

    DOE PAGES

    Adhikari, Shiba P.; Hood, Zachary D.; Wang, Hui; ...

    2017-06-02

    In this paper, a new g-C 3N 4/SrTa 2O 6 heterojunction photocatalyst was designed and prepared by chimie douce (soft chemistry) method where carbon nitride (g-C 3N 4) was deposited over the metastable perovskite phase of SrTa 2O 6. The morphological study of the heterojunction using SEM and STEM revealed that g-C 3N 4 nanofibers are dispersed uniformly on the surface of SrTa 2O 6 plates leading to the intimate contact between them. The heterojunction could achieve a high and stable visible light photocatalytic H 2 generation of 137 mmol/h/mole of g-C 3N 4, which is much larger than themore » amount of hydrogen generated by one mole of pristine g-C 3N 4. Finally, a plausible mechanism for the observed enhanced photocatalytic activity for the heterojunction is proposed on the basis of effective charge separation of photogenerated electron-hole pairs, supported by band position calculations and photo-physical properties of g-C 3N 4 and SrTa 2O 6.« less

  14. Enhanced visible light photocatalytic water reduction from a g-C 3N 4/SrTa 2O 6 heterojunction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Adhikari, Shiba P.; Hood, Zachary D.; Wang, Hui

    In this paper, a new g-C 3N 4/SrTa 2O 6 heterojunction photocatalyst was designed and prepared by chimie douce (soft chemistry) method where carbon nitride (g-C 3N 4) was deposited over the metastable perovskite phase of SrTa 2O 6. The morphological study of the heterojunction using SEM and STEM revealed that g-C 3N 4 nanofibers are dispersed uniformly on the surface of SrTa 2O 6 plates leading to the intimate contact between them. The heterojunction could achieve a high and stable visible light photocatalytic H 2 generation of 137 mmol/h/mole of g-C 3N 4, which is much larger than themore » amount of hydrogen generated by one mole of pristine g-C 3N 4. Finally, a plausible mechanism for the observed enhanced photocatalytic activity for the heterojunction is proposed on the basis of effective charge separation of photogenerated electron-hole pairs, supported by band position calculations and photo-physical properties of g-C 3N 4 and SrTa 2O 6.« less

  15. The electrostatic characteristics of G·U wobble base pairs

    PubMed Central

    Xu, Darui; Landon, Theresa; Greenbaum, Nancy L.; Fenley, Marcia O.

    2007-01-01

    G·U wobble base pairs are the most common and highly conserved non-Watson–Crick base pairs in RNA. Previous surface maps imply uniformly negative electrostatic potential at the major groove of G·U wobble base pairs embedded in RNA helices, suitable for entrapment of cationic ligands. In this work, we have used a Poisson–Boltzmann approach to gain a more detailed and accurate characterization of the electrostatic profile. We found that the major groove edge of an isolated G·U wobble displays distinctly enhanced negativity compared with standard GC or AU base pairs; however, in the context of different helical motifs, the electrostatic pattern varies. G·U wobbles with distinct widening have similar major groove electrostatic potentials to their canonical counterparts, whereas those with minimal widening exhibit significantly enhanced electronegativity, ranging from 0.8 to 2.5 kT/e, depending upon structural features. We propose that the negativity at the major groove of G·U wobble base pairs is determined by the combined effect of the base atoms and the sugar-phosphate backbone, which is impacted by stacking pattern and groove width as a result of base sequence. These findings are significant in that they provide predictive power with respect to which G·U sites in RNA are most likely to bind cationic ligands. PMID:17526525

  16. Control of box C/D snoRNP assembly by N6-methylation of adenine.

    PubMed

    Huang, Lin; Ashraf, Saira; Wang, Jia; Lilley, David Mj

    2017-09-01

    N 6 -methyladenine is the most widespread mRNA modification. A subset of human box C/D snoRNA species have target GAC sequences that lead to formation of N 6 -methyladenine at a key trans Hoogsteen-sugar A·G base pair, of which half are methylated in vivo The GAC target is conserved only in those that are methylated. Methylation prevents binding of the 15.5-kDa protein and the induced folding of the RNA Thus, the assembly of the box C/D snoRNP could in principle be regulated by RNA methylation at its critical first stage. Crystallography reveals that N 6 -methylation of adenine prevents the formation of trans Hoogsteen-sugar A·G base pairs, explaining why the box C/D RNA cannot adopt its kinked conformation. More generally, our data indicate that sheared A·G base pairs (but not Watson-Crick base pairs) are more susceptible to disruption by N 6 mA methylation and are therefore possible regulatory sites. The human signal recognition particle RNA and many related Alu retrotransposon RNA species are also methylated at N6 of an adenine that forms a sheared base pair with guanine and mediates a key tertiary interaction. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.

  17. Envisaging quantum transport phenomenon in a muddled base pair of DNA

    NASA Astrophysics Data System (ADS)

    Vohra, Rajan; Sawhney, Ravinder Singh

    2018-05-01

    The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.

  18. Structural and genetic relationships of closely related O-antigens of Cronobacter spp. and Escherichia coli: C. sakazakii G2594 (serotype O4)/E. coli O103 and C. malonaticus G3864 (serotype O1)/E. coli O29.

    PubMed

    Shashkov, Alexander S; Wang, Min; Turdymuratov, Eldar M; Hu, Shaohui; Arbatsky, Nikolay P; Guo, Xi; Wang, Lei; Knirel, Yuriy A

    2015-03-02

    O-Antigen (O-polysaccharide) variation is the basis for bacterial serotyping and is important in bacterial virulence and niche adaptation. In this work, we present structural and genetic evidences for close relationships between the O-antigens of the Cronobacter spp. and Escherichia coli. Cronobacter sakazakii G2594 (serotype O4) and Cronobacter malonaticus G3864 (serotype O1) are structurally related to those of E. coli O103 and O29, respectively, and some other members of the Enterobacteriaceae family differing in the patterns of lateral glucosylation (C. sakazakii G2594) or O-acetylation (C. malonaticus G3864). The O-antigen gene clusters of the corresponding Cronobacter and E. coli strains contain the same genes with high-level similarity, and the structural differences within both O-antigen pairs were suggested to be due to modification genes carried by prophages. Copyright © 2014 Elsevier Ltd. All rights reserved.

  19. Potent and Selective Covalent Quinazoline Inhibitors of KRAS G12C

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zeng, Mei; Lu, Jia; Li, Lianbo

    Targeted covalent small molecules have shown promise for cancers driven by KRAS G12C. Allosteric compounds that access an inducible pocket formed by movement of a dynamic structural element in KRAS, switch II, have been reported, but these compounds require further optimization to enable their advancement into clinical development. We demonstrate that covalent quinazoline-based switch II pocket (SIIP) compounds effectively suppress GTP loading of KRAS G12C, MAPK phosphorylation, and the growth of cancer cells harboring G12C. Notably we find that adding an amide substituent to the quinazoline scaffold allows additional interactions with KRAS G12C, and remarkably increases the labeling efficiency, potency,more » and selectivity of KRAS G12C inhibitors. Structural studies using X-ray crystallography reveal a new conformation of SIIP and key interactions made by substituents located at the quinazoline 2-, 4-, and 7-positions. Optimized lead compounds in the quinazoline series selectively inhibit KRAS G12C-dependent signaling and cancer cell growth at sub-micromolar concentrations.« less

  20. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

    PubMed

    Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

    2017-10-01

    Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

  1. N-H Stretching Excitations in Adenosine-Thymidine Base Pairs in Solution: Base Pair Geometries, Infrared Line Shapes and Ultrafast Vibrational Dynamics

    PubMed Central

    Greve, Christian; Preketes, Nicholas K.; Fidder, Henk; Costard, Rene; Koeppe, Benjamin; Heisler, Ismael A.; Mukamel, Shaul; Temps, Friedrich; Nibbering, Erik T. J.; Elsaesser, Thomas

    2013-01-01

    We explore the N-H stretching vibrations of adenosine-thymidine base pairs in chloroform solution with linear and nonlinear infrared spectroscopy. Based on estimates from NMR measurements and ab initio calculations, we conclude that adenosine and thymidine form hydrogen bonded base pairs in Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen configurations with similar probability. Steady-state concentration- and temperature dependent linear FT-IR studies, including H/D exchange experiments, reveal that these hydrogen-bonded base pairs have complex N-H/N-D stretching spectra with a multitude of spectral components. Nonlinear 2D-IR spectroscopic results, together with IR-pump-IR-probe measurements, as also corroborated by ab initio calculations, reveal that the number of N-H stretching transitions is larger than the total number of N-H stretching modes. This is explained by couplings to other modes, such as an underdamped low-frequency hydrogen-bond mode, and a Fermi resonance with NH2 bending overtone levels of the adenosine amino-group. Our results demonstrate that modeling based on local N-H stretching vibrations only is not sufficient and call for further refinement of the description of the N-H stretching manifolds of nucleic acid base pairs of adenosine and thymidine, incorporating a multitude of couplings with fingerprint and low-frequency modes. PMID:23234439

  2. Cooperative Lewis pairs based on late transition metals: activation of small molecules by platinum(0) and B(C6 F5 )3.

    PubMed

    Forrest, Sebastian J K; Clifton, Jamie; Fey, Natalie; Pringle, Paul G; Sparkes, Hazel A; Wass, Duncan F

    2015-02-09

    A Lewis basic platinum(0)-CO complex supported by a diphosphine ligand and B(C6 F5 )3 act cooperatively, in a manner reminiscent of a frustrated Lewis pair, to activate small molecules such as hydrogen, CO2 , and ethene. This cooperative Lewis pair facilitates the coupling of CO and ethene in a new way. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Carnitine-acylcarnitine translocase deficiency with c.199-10 T>G and novel c.1A>G mutation

    PubMed Central

    Yan, Hui-ming; Hu, Hao; Ahmed, Aisha; Feng, Bing-bing; Liu, Jing; Jia, Zheng-jun; Wang, Hua

    2017-01-01

    Abstract Rationale: Carnitine-acylcarnitine translocate deficiency (CACTD) is a rare and life-threatening, autosomal recessive disorder of fatty acid β-oxidation characterized by hypoketotic hypoglycemia, hyperammonemia, cardiomyopathy, liver dysfunction, and muscle weakness; culminating in early death. To date, CACTD cases screened from the Chinese mainland population, especially patient with compound heterozygote with c.199-10T>G and a novel c.1A>G mutation in the SLC25A20 gene has never been described. Patient concerns: Herein, we report 2 neonatal cases of CACTD identified from the mainland China. These 2 patients were presented with severe metabolic crisis and their clinical conditions deteriorate rapidly and both died of cardiorespiratory collapse in the first week of life. We present the clinical and biochemical features of 2 probands and a brief literature review of previously reported CACTD cases with the c.199-10T>G mutation. Diagnoses: The acylcarnitine profiles by tandem-mass-spectrometry and the mutation analysis of SLC25A20 gene confirmed the diagnosis of CACTD in both patients. Mutation analysis demonstrated that patient No. 1 was homozygous for c.199-10T>G mutation, while patient No. 2 was a compound heterozygote for 2 mutations, a maternally-inherited c.199-10T>G and a paternally-inherited, novel c.1A>G mutation. Interventions: Both patients were treated with an aggressive treatment regimen include high glucose and arginine infusion, respiratory, and circulatory support. Outcomes: The first proband died 3 days after delivery due to sudden cardiac arrest. The second patient's clinical condition, at one time, was improved by high glucose infusion, intravenous arginine, and circulatory support. However, the patient failed to wean from mechanical ventilation. Unfortunately, her parents refused further treatment due to fear of financial burdens. The patient died of congestive heart failure in the 6th day of life. Lessons: We report the first 2 cases of

  4. Bifacial Base-Pairing Behaviors of 5-Hydroxyuracil DNA Bases through Hydrogen Bonding and Metal Coordination.

    PubMed

    Takezawa, Yusuke; Nishiyama, Kotaro; Mashima, Tsukasa; Katahira, Masato; Shionoya, Mitsuhiko

    2015-10-12

    A novel bifacial ligand-bearing nucleobase, 5-hydroxyuracil (U(OH) ), which forms both a hydrogen-bonded base pair (U(OH) -A) and a metal-mediated base pair (U(OH) -M-U(OH) ) has been developed. The U(OH) -M-U(OH) base pairs were quantitatively formed in the presence of lanthanide ions such as Gd(III) when U(OH) -U(OH) pairs were consecutively incorporated into DNA duplexes. This result established metal-assisted duplex stabilization as well as DNA-templated assembly of lanthanide ions. Notably, a duplex possessing U(OH) -A base pairs was destabilized by addition of Gd(III) ions. This observation suggests that the hybridization behaviors of the U(OH) -containing DNA strands are altered by metal complexation. Thus, the U(OH) nucleobase with a bifacial base-pairing property holds great promise as a component for metal-responsive DNA materials. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs

    NASA Technical Reports Server (NTRS)

    Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.

    2011-01-01

    We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.

  6. Neonatal Hyperbilirubinemia in infants with G6PD c.563C > TVariant

    PubMed Central

    2012-01-01

    Background There is a strong correlation between glucose-6-phosphate dehydrogenase (G6PD) deficiency and neonatal hyperbilirubinemia with a rare but potential threat of devastating acute bilirubin encephalopathy. G6PD deficiency was observed in 4–14% of hospitalized icteric neonates in Pakistan. G6PD c.563C > T is the most frequently reported variant in this population. The present study was aimed at evaluating the time to onset of hyperbilirubinemia and the postnatal bilirubin trajectory in infants having G6PD c.563C > T. Methods This was a case–control study conducted at The Aga Khan University, Pakistan during the year 2008. We studied 216 icteric male neonates who were re-admitted for phototherapy during the study period. No selection was exercised. Medical records showed that 32 were G6PD deficient while 184 were G6PD normal. Each infant was studied for birth weight, gestational age, age at the time of presentation, presence of cephalhematoma, sepsis and neurological signs, peak bilirubin level, age at peak bilirubin level, days of hospitalization, whether phototherapy or exchange blood transfusion was initiated, and the outcome. During hospital stay, each baby was tested for complete blood count, reticulocyte count, ABO and Rh blood type, direct antiglobulin test and quantitative G6PD estimation [by kinetic determination of G6PDH]. G6PDgenotype was analyzed in 32 deficient infants through PCR-RFLP analysis and gene sequencing. Results G6PD variants c.563C > T and c.131 C > G were observed in 21 (65%) and three (9%) of the 32 G6PD deficient infants, respectively. DNA of eight (25%) newborns remained uncharacterized. In contrast to G6PD normal neonates, infants with c.563C > T variant had significantly lower enzyme activity (mean ± 1SD; 0.3 ± 0.2 U/gHb vs. 14.0 ± 4.5 U/gHb, p < 0.001) experienced higher peak levels of total serum bilirubin (mean ± 1SD; 16.8 ± 5.4 mg/dl vs. 13.8 ± 4.6 mg/dl, p = 0.008) which peaked earlier after

  7. Mucin-like Region of Herpes Simplex Virus Type 1 Attachment Protein Glycoprotein C (gC) Modulates the Virus-Glycosaminoglycan Interaction*

    PubMed Central

    Altgärde, Noomi; Eriksson, Charlotta; Peerboom, Nadia; Phan-Xuan, Tuan; Moeller, Stephanie; Schnabelrauch, Matthias; Svedhem, Sofia; Trybala, Edward; Bergström, Tomas; Bally, Marta

    2015-01-01

    Glycoprotein C (gC) mediates the attachment of HSV-1 to susceptible host cells by interacting with glycosaminoglycans (GAGs) on the cell surface. gC contains a mucin-like region located near the GAG-binding site, which may affect the binding activity. Here, we address this issue by studying a HSV-1 mutant lacking the mucin-like domain in gC and the corresponding purified mutant protein (gCΔmuc) in cell culture and GAG-binding assays, respectively. The mutant virus exhibited two functional alterations as compared with native HSV-1 (i.e. decreased sensitivity to GAG-based inhibitors of virus attachment to cells and reduced release of viral particles from the surface of infected cells). Kinetic and equilibrium binding characteristics of purified gC were assessed using surface plasmon resonance-based sensing together with a surface platform consisting of end-on immobilized GAGs. Both native gC and gCΔmuc bound via the expected binding region to chondroitin sulfate and sulfated hyaluronan but not to the non-sulfated hyaluronan, confirming binding specificity. In contrast to native gC, gCΔmuc exhibited a decreased affinity for GAGs and a slower dissociation, indicating that once formed, the gCΔmuc-GAG complex is more stable. It was also found that a larger number of gCΔmuc bound to a single GAG chain, compared with native gC. Taken together, our data suggest that the mucin-like region of HSV-1 gC is involved in the modulation of the GAG-binding activity, a feature of importance both for unrestricted virus entry into the cells and release of newly produced viral particles from infected cells. PMID:26160171

  8. Understanding the kinetic mechanism of RNA single base pair formation

    PubMed Central

    Xu, Xiaojun; Yu, Tao; Chen, Shi-Jie

    2016-01-01

    RNA functions are intrinsically tied to folding kinetics. The most elementary step in RNA folding is the closing and opening of a base pair. Understanding this elementary rate process is the basis for RNA folding kinetics studies. Previous studies mostly focused on the unfolding of base pairs. Here, based on a hybrid approach, we investigate the folding process at level of single base pairing/stacking. The study, which integrates molecular dynamics simulation, kinetic Monte Carlo simulation, and master equation methods, uncovers two alternative dominant pathways: Starting from the unfolded state, the nucleotide backbone first folds to the native conformation, followed by subsequent adjustment of the base conformation. During the base conformational rearrangement, the backbone either retains the native conformation or switches to nonnative conformations in order to lower the kinetic barrier for base rearrangement. The method enables quantification of kinetic partitioning among the different pathways. Moreover, the simulation reveals several intriguing ion binding/dissociation signatures for the conformational changes. Our approach may be useful for developing a base pair opening/closing rate model. PMID:26699466

  9. Efficient water disinfection with Ag2WO4-doped mesoporous g-C3N4 under visible light.

    PubMed

    Li, Yi; Li, Yanan; Ma, Shuanglong; Wang, Pengfei; Hou, Qianlei; Han, Jingjing; Zhan, Sihui

    2017-09-15

    Ag 2 WO 4 /g-C 3 N 4 composite photocatalyst was synthesized by polymerization of thiourea and ammonia chloride combined with the deposition-precipitation method, which was applied as an efficient visible-light driven photocatalyst for inactivating Escherichia coli (E. coli). The physicochemical properties of these photocatalysts were systematically characterized by various techniques such as SEM, TEM, XRD, FT-IR, BET, UV-vis DRS and PL. The synthesized photocatalysts exhibited outstandingly enhanced photocatalytic disinfection efficiency compared with that of pure g-C 3 N 4 and Ag 2 WO 4 under visible light. Furthermore, the optimal mass ratio of the Ag 2 WO 4 to g-C 3 N 4 was 5wt%, and a number of live bacteria could be completely inactivated with Ag 2 WO 4 (5%)/g-C 3 N 4 (100μg/mL) after 90min under visible light irradiation. The high disinfection efficiency is due to the synergetic effect between g-C 3 N 4 and Ag 2 WO 4 , including a good distribution of Ag 2 WO 4 particles on the surface of g-C 3 N 4 and an improved separation rate of photogenerated electron-hole pairs. The enhanced disinfection mechanism was also investigated using photogenerated current densities and electrochemical impedance spectroscopy (EIS). Considering the bulk availability and excellent disinfection activity of Ag 2 WO 4 /g-C 3 N 4 composite, it is a promising solar-driven photocatalyst for cleaning the microbial contaminated water. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Mitomycin C binding to poly[d(G-m5C)].

    PubMed Central

    Portugal, J; Sánchez-Baeza, F J

    1995-01-01

    Poly[d(G-m5C)] was modified by reductively activated mitomycin C, an anti-tumour drug, under buffer conditions which are known to favour either the B or the Z conformations of DNA. C.d. and 31P-n.m.r. were used to characterize the poly[d(G-m5C)]-mitomycin cross-linked complexes, as well as the effects on the equilibrium between the B and Z forms of the polynucleotide. Mitomycin C appears to inhibit the B-->Z transition, even in the presence of 3 mM MgCl2, while the Z-form of poly[d(G-m5C)] does not interact significantly with the drug under bifunctionally activating conditions; thus no reversion from the Z-form to the B-form of the polynucleotide can be observed under the salt conditions which are required for the Z-form to exist. PMID:7864808

  11. C-1311 (Symadex), a potential anti-cancer drug, intercalates into DNA between A and G moieties. NMR-derived and MD-refined stereostructure of the d(GAGGCCTC)2:C-1311 complex

    NASA Astrophysics Data System (ADS)

    Laskowski, Tomasz; Borzyszkowska, Julia; Grynda, Jakub; Mazerski, Jan

    2017-08-01

    Imidazoacridinone C-1311 (Symadex®) is an antitumor agent which has been recommended for Phase II clinical trials a few years ago. Previously, it was shown experimentally that during the initial stage of its action C-1311 forms stable intercalation complexes with DNA duplexes. Herein, a NMR-derived stereostructure of d(GAGGCCTC)2:C-1311 complex was reported. The ligand was found locating itself between A and G moieties, forming symmetrical DNA:drug 1:2 mol/mol complex. Intercalation site was located upon the DNA-ligand proton/proton dipolar couplings observed in the NOESY spectrum and the performed MD simulations. NMR-derived stereostructure was hence refined by restrained MD using distance restraints obtained from the NOESY data and the result was compared with MD-derived structure of the proposed complex, obtained from the calculations performed with distance restraints applied only for hydrogen bonds in the terminal GC base pairs. The results of both simulations were coherent. Basing on the observed C-1311's intercalation sites and on our previous results concerning the d(CGATCG)2:C-1311 complex, we stated that AG/GA sequences are the preferred binding sites of imidazoacridinone C-1311.

  12. 76 FR 6629 - Agency Information Collection Activities: Forms G-325, G-325A, G-325B, and G-325C; Extension of...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-02-07

    ... Collection Activities: Forms G-325, G-325A, G- 325B, and G-325C; Extension of an Existing Information Collection; Comment Request ACTION: 60-Day Notice of Information Collection Under Review; Forms 325, G-325A, G-325B, and G-325C, Biographic Information; OMB Control No. 1615-0008. The Department of Homeland...

  13. Determination of the pairing-strength constants in the isovector plus isoscalar pairing case

    NASA Astrophysics Data System (ADS)

    Mokhtari, D.; Fellah, M.; Allal, N. H.

    2016-05-01

    A method for the determination of the pairing-strength constants, in the neutron-proton (n-p) isovector plus isoscalar pairing case, is proposed in the framework of the BCS theory. It is based on the fitting of these constants to reproduce the experimentally known pairing gap parameters as well as the root-mean-squared (r.m.s) charge radii values. The method is applied to some proton-rich even-even nuclei. The single-particle energies used are those of a deformed Woods-Saxon mean field. It is shown that the obtained value of the ratio GnpT=0/G npT=1 is of the same order as the ones, arbitrary chosen, of some previous works. The effect of the inclusion of the isoscalar n-p pairing in the r.m.s matter radii is then numerically studied for the same nuclei.

  14. Identification of a novel PMS2 alteration c.505C>G (R169G) in trans with a PMS2 pathogenic mutation in a patient with constitutional mismatch repair deficiency.

    PubMed

    Mork, Maureen E; Borras, Ester; Taggart, Melissa W; Cuddy, Amanda; Bannon, Sarah A; You, Y Nancy; Lynch, Patrick M; Ramirez, Pedro T; Rodriguez-Bigas, Miguel A; Vilar, Eduardo

    2016-10-01

    Constitutional mismatch repair deficiency syndrome (CMMRD) is a rare autosomal recessive predisposition to colorectal polyposis and other malignancies, often childhood-onset, that is caused by biallelic inheritance of mutations in the same mismatch repair gene. Here, we describe a patient with a clinical diagnosis of CMMRD based on colorectal polyposis and young-onset endometrial cancer who was identified to have two alterations in trans in PMS2: one known pathogenic mutation (c.1831insA; p.Ile611Asnfs*2) and one novel variant of uncertain significance (c.505C>G; p.Arg169Glu), a missense alteration. We describe the clinical and molecular features in the patient harboring this novel alteration c.505C>G, who meets clinical criteria for CMMRD and exhibits molecular evidence supporting a diagnosis of CMMRD. Although experimental validation is needed to confirm its pathogenicity, PMS2 c.505C>G likely has functional consequences that contributes to our patient's phenotype based on the patient's clinical presentation, tumor studies, and bioinformatics analysis.

  15. N-H stretching vibrations of guanosine-cytidine base pairs in solution: ultrafast dynamics, couplings, and line shapes.

    PubMed

    Fidder, Henk; Yang, Ming; Nibbering, Erik T J; Elsaesser, Thomas; Röttger, Katharina; Temps, Friedrich

    2013-02-07

    Dynamics and couplings of N-H stretching vibrations of chemically modified guanosine-cytidine (G·C) base pairs in chloroform are investigated with linear infrared spectroscopy and ultrafast two-dimensional infrared (2D-IR) spectroscopy. Comparison of G·C absorption spectra before and after H/D exchange reveals significant N-H stretching absorption in the region from 2500 up to 3300 cm(-1). Both of the local stretching modes ν(C)(NH(2))(b) of the hydrogen-bonded N-H moiety of the cytidine NH(2) group and ν(G)(NH) of the guanosine N-H group contribute to this broad absorption band. Its complex line shape is attributed to Fermi resonances of the N-H stretching modes with combination and overtones of fingerprint vibrations and anharmonic couplings to low-frequency modes. Cross-peaks in the nonlinear 2D spectra between the 3491 cm(-1) free N-H oscillator band and the bands centered at 3145 and 3303 cm(-1) imply N-H···O═C hydrogen bond character for both of these transitions. Time evolution illustrates that the 3303 cm(-1) band is composed of a nearly homogeneous band absorbing at 3301 cm(-1), ascribed to ν(G)(NH(2))(b), and a broad inhomogeneous band peaking at 3380 cm(-1) with mainly guanosine carbonyl overtone character. Kinetics and signal strengths indicate a <0.2 ps virtually complete population transfer from the excited ν(G)(NH(2))(b) mode to the ν(G)(NH) mode at 3145 cm(-1), suggesting lifetime broadening as the dominant source for the homogeneous line shape of the 3301 cm(-1) transition. For the 3145 cm(-1) band, a 0.3 ps population lifetime was obtained.

  16. A single base pair in the right terminal domain of tomato planta macho viroid is a virulence determinant factor on tomato.

    PubMed

    Li, Rugang; Padmanabhan, Chellappan; Ling, Kai-Shu

    2017-01-01

    Tomato planta macho viroid (TPMVd), including isolates previously designated as Mexican papita viroid (MPVd), causes serious disease on tomatoes in North America. Two predominant variants, sharing 93.8% sequence identity, incited distinct severe (MPVd-S) or mild (MPVd-M) symptoms on tomato. To identify virulence determinant factor, a series of chimeric infectious clones were generated using synthetic DNA approach to progressively replace each structural domain between the two variants. In bioassays on tomato 'Rutgers', three chimeras containing Terminal Left and Pathogenicity (MPVd-H1), Central (MPVd-H2), or Variable (MPVd-H3) of MPVd-S, incited mild to intermediate symptoms. However, a chimera containing Terminal Right (T R ) of MPVd-S (MPVd-H4) incited severe symptoms. Only one base-pair mutation in the T R domain between MPVd-M ( 176 U:A 185 ) and MPVd-S ( 174 G:C 183 ) was identified. A reciprocal mutant (MPVd-H5) rendered the chimeric viroid mild on tomato. This single base-pair in the T R domain was determined as the virulence determinant factor for TPMVd. Published by Elsevier Inc.

  17. 2-Methoxypyridine as a Thymidine Mimic in Watson-Crick Base Pairs of DNA and PNA: Synthesis, Thermal Stability, and NMR Structural Studies.

    PubMed

    Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks

    2017-11-02

    The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Orbital selective pairing and gap structures of iron-based superconductors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kreisel, Andreas; Andersen, Brian M.; Sprau, P. O.

    We discuss the in uence on spin-fluctuation pairing theory of orbital selective strong correlation effects in Fe-based superconductors, particularly Fe chalcogenide systems. We propose that a key ingredient for an improved itinerant pairing theory is orbital selectivity, i.e., incorporating the reduced coherence of quasiparticles occupying specific orbital states. This modifies the usual spin-fluctuation via suppression of pair scattering processes involving those less coherent states and results in orbital selective Cooper pairing of electrons in the remaining states. We show that this paradigm yields remarkably good agreement with the experimentally observed anisotropic gap structures in both bulk and monolayer FeSe, asmore » well as LiFeAs, indicating that orbital selective Cooper pairing plays a key role in the more strongly correlated iron-based superconductors.« less

  19. Orbital selective pairing and gap structures of iron-based superconductors

    DOE PAGES

    Kreisel, Andreas; Andersen, Brian M.; Sprau, P. O.; ...

    2017-05-08

    We discuss the in uence on spin-fluctuation pairing theory of orbital selective strong correlation effects in Fe-based superconductors, particularly Fe chalcogenide systems. We propose that a key ingredient for an improved itinerant pairing theory is orbital selectivity, i.e., incorporating the reduced coherence of quasiparticles occupying specific orbital states. This modifies the usual spin-fluctuation via suppression of pair scattering processes involving those less coherent states and results in orbital selective Cooper pairing of electrons in the remaining states. We show that this paradigm yields remarkably good agreement with the experimentally observed anisotropic gap structures in both bulk and monolayer FeSe, asmore » well as LiFeAs, indicating that orbital selective Cooper pairing plays a key role in the more strongly correlated iron-based superconductors.« less

  20. In silico identification of novel ligands for G-quadruplex in the c- MYC promoter

    NASA Astrophysics Data System (ADS)

    Kang, Hyun-Jin; Park, Hyun-Ju

    2015-04-01

    G-quadruplex DNA formed in NHEIII1 region of oncogene promoter inhibits transcription of the genes. In this study, virtual screening combining pharmacophore-based search and structure-based docking screening was conducted to discover ligands binding to G-quadruplex in promoter region of c- MYC. Several hit ligands showed the selective PCR-arresting effects for oligonucleotide containing c- MYC G-quadruplex forming sequence. Among them, three hits selectively inhibited cell proliferation and decreased c- MYC mRNA level in Ramos cells, where NHEIII1 is included in translocated c- MYC gene for overexpression. Promoter assay using two kinds of constructs with wild-type and mutant sequences showed that interaction of these ligands with the G-quadruplex resulted in turning-off of the reporter gene. In conclusion, combined virtual screening methods were successfully used for discovery of selective c- MYC promoter G-quadruplex binders with anticancer activity.

  1. Development of a novel device to trap heavy metal cations: application of the specific interaction between heavy metal cation and mismatch DNA base pair.

    PubMed

    Torigoe, Hidetaka; Miyakawa, Yukako; Fukushi, Miyako; Ono, Akira; Kozasa, Tetsuo

    2009-01-01

    We have already found that Hg(II) cation specifically binds to T:T mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving T:T mismatch base pair by about 4 degrees C. We have also found that Ag(I) cation specifically binds to C:C mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving C:C mismatch base pair by about 4 degrees C. Using the specific interaction, we developed a novel device to trap each of Hg(II) and Ag(I) cation. The device is composed of 5'-biotinylated T-rich or C-rich DNA oligonucleotides, BIO-T20: 5'-Bio-T(20)-3' or BIO-C20: 5'-Bio-C(20)-3' (Bio is a biotin), immobilized on streptavidin-coated polystylene beads. When the BIO-T20-immobilized beads were added to a solution containing Hg(II) cation, and the beads trapping Hg(II) cation were collected by centrifugation, almost all of Hg(II) cation were removed from the solution. Also, when the BIO-C20-immobilized beads were added to a solution containing Ag(I) cation, and the beads trapping Ag(I) cation were collected by centrifugation, almost all of Ag(I) cation were removed from the solution. We conclude that, using the novel device developed in this study, Hg(II) and Ag(I) cation can be effectively removed from the solution.

  2. Combined effects of metal complexation and size expansion in the electronic structure of DNA base pairs

    NASA Astrophysics Data System (ADS)

    Brancolini, Giorgia; Di Felice, Rosa

    2011-05-01

    Novel DNA derivatives have been recently investigated in the pursuit of modified DNA duplexes to tune the electronic structure of DNA-based assemblies for nanotechnology applications. Size-expanded DNAs (e.g., xDNA) and metalated DNAs (M-DNA) may enhance stacking interactions and induce metallic conductivity, respectively. Here we explore possible ways of tailoring the DNA electronic structure by combining the aromatic size expansion with the metal-doping. We select the salient structures from our recent study on natural DNA pairs complexed with transition metal ions and consider the equivalent model configurations for xDNA pairs. We present the results of density functional theory electronic structure calculations of the metalated expanded base-pairs with various localized basis sets and exchange-correlation functionals. Implicit solvent and coordination water molecules are also included. Our results indicate that the effect of base expansion is largest in Ag-xGC complexes, while Cu-xGC complexes are the most promising candidates for nanowires with enhanced electron transfer and also for on-purpose modification of the DNA double-helix for signal detection.

  3. Magnetic and superconducting phase diagrams of single-crystal Er0.8R0.2Ni2B2C (R=Tb,Lu) and ErNi1.9Co0.1B2C: Identification of pair-breaking mechanisms

    NASA Astrophysics Data System (ADS)

    Takeya, H.; El Massalami, M.

    2004-01-01

    We investigated the magnetism, superconductivity and their interplay in single crystals Er0.8R0.2Ni2B2C (R=Tb,Lu) and ErNi1.9Co0.1B2C. In contrast to Co substitution, R substitutions induce considerable modifications in the magnetism of Er sublattice: e.g., Tb (Lu) substitution enhances (reduces) TN and critical fields. Both R substitutions introduce size effects and pinning centers; the former modifies the magnon specific heat while the latter hinders the formation of a weak ferromagnetism. The superconductivity, on the other hand, is strongly (weakly) influenced by Tb and Co (Lu) substitution. Taking LuNi2B2C as a nonmagnetic superconducting limit, we analyzed their superconductivities, as well as that of ErNi2B2C, in terms of multiple pair breaking theory on dirty superconductors. Based on this analysis, many of their superconducting features can be explained: The breakdown of de Gennes scaling is due to the presence of multiple pair breakers, the anisotropy of Hc2(T) is related to the magnetic anisotropy, the absence of a structure in Hc2(T) at TN of Lu substitution (TNpair breaking process(es) is substantially reduced.

  4. 76 FR 24910 - Agency Information Collection Activities: Forms G-325, G-325A, G-325B, and G-325C; Extension of a...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-05-03

    ... Collection Activities: Forms G-325, G-325A, G- 325B, and G-325C; Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day notice of information collection under review: Forms G- 325, G-325A, G-325B, and G-325C, Biographic Information; OMB Control No. 1615-0008. The Department of...

  5. Highly Stable Double-Stranded DNA Containing Sequential Silver(I)-Mediated 7-Deazaadenine/Thymine Watson-Crick Base Pairs.

    PubMed

    Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A

    2016-05-17

    The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Base-displaced intercalation of the 2-amino-3-methylimidazo[4,5-f]quinolone N2-dG adduct in the NarI DNA recognition sequence

    PubMed Central

    Stavros, Kallie M.; Hawkins, Edward K.; Rizzo, Carmelo J.; Stone, Michael P.

    2014-01-01

    2-Amino-3-methylimidazo[4,5-f]quinolone (IQ), a heterocyclic amine found in cooked meats, undergoes bioactivation to a nitrenium ion, which alkylates guanines at both the C8-dG and N2-dG positions. The conformation of a site-specific N2-dG-IQ adduct in an oligodeoxynucleotide duplex containing the iterated CG repeat restriction site of the NarI endonuclease has been determined. The IQ moiety intercalates, with the IQ H4a and CH3 protons facing the minor groove, and the IQ H7a, H8a and H9a protons facing the major groove. The adducted dG maintains the anti-conformation about the glycosyl bond. The complementary dC is extruded into the major groove. The duplex maintains its thermal stability, which is attributed to stacking between the IQ moiety and the 5′- and 3′-neighboring base pairs. This conformation is compared to that of the C8-dG-IQ adduct in the same sequence, which also formed a ‘base-displaced intercalated’ conformation. However, the C8-dG-IQ adopted the syn conformation placing the Watson−Crick edge of the modified dG into the major groove. In addition, the C8-dG-IQ adduct was oriented with the IQ CH3 group and H4a and H5a facing the major groove. These differences may lead to differential processing during DNA repair and replication. PMID:24366876

  7. The physico-chemical "anatomy" of the tautomerization through the DPT of the biologically important pairs of hypoxanthine with DNA bases: QM and QTAIM perspectives.

    PubMed

    Brovarets', Ol'ha O; Zhurakivsky, Roman O; Hovorun, Dmytro M

    2013-10-01

    The biologically important tautomerization of the Hyp·Cyt, Hyp·Thy and Hyp·Hyp base pairs to the Hyp·Cyt, Hyp·Thy and Hyp·Hyp base pairs, respectively, by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ε = 4) corresponding to hydrophobic interfaces of protein-nucleic acid interactions by combining theoretical investigations at the B3LYP/6-311++G(d,p) level of QM theory with QTAIM topological analysis. Based on the sweeps of the energetic, electron-topological, geometric and polar parameters, which describe the course of the tautomerization along the intrinsic reaction coordinate (IRC), it was proved that the tautomerization through the DPT is concerted and asynchronous process for the Hyp·Cyt and Hyp·Thy base pairs, while concerted and synchronous for the Hyp·Hyp homodimer. The continuum with ε = 4 does not affect qualitatively the course of the tautomerization reaction for all studied complexes. The nine key points along the IRC of the Hyp·Cyt↔Hyp·Cyt and Hyp·Thy↔Hyp·Thy tautomerizations and the six key points of the Hyp·Hyp↔Hyp·Hyp tautomerization have been identified and fully characterized. These key points could be considered as electron-topological "fingerprints" of concerted asynchronous (for Hyp·Cyt and Hyp·Thy) or synchronous (for Hyp·Hyp) tautomerization process via the DPT. It was found, that in the Hyp·Cyt, Hyp·Thy, Hyp·Hyp and Hyp·Hyp base pairs all H-bonds are significantly cooperative and mutually reinforce each other, while the C2H…O2 H-bond in the Hyp·Cyt base pair and the O6H…O4 H-bond in the Hyp·Thy base pair behave anti-cooperatively, i.e., they become weakened, while two others become strengthened.

  8. Mitochondrial tRNALeu(UUR) C3275T, tRNAGln T4363C and tRNALys A8343G mutations may be associated with PCOS and metabolic syndrome.

    PubMed

    Ding, Yu; Xia, Bo-Hou; Zhang, Cai-Juan; Zhuo, Guang-Chao

    2018-02-05

    Polycystic ovary syndrome (PCOS) is a very prevalent endocrine disease affecting reproductive women. Clinically, patients with this disorder are more vulnerable to develop type 2 diabetes mellitus (T2DM), cardiovascular events, as well as metabolic syndrome (MetS). To date, the molecular mechanism underlying PCOS remains largely unknown. Previously, we showed that mitochondrial dysfunction caused by mitochondrial DNA (mtDNA) mutation was an important cause for PCOS. In the current study, we described the clinical and biochemical features of a three-generation pedigree with maternally transmitted MetS, combined with PCOS. A total of three matrilineal relatives exhibited MetS including obesity, high triglyceride (TG) and Hemoglobin A1c (HbA1c) levels, and hypertension. Whereas one patient from the third generation manifestated PCOS. Mutational analysis of the whole mitochondrial genes from the affected individuals identified a set of genetic variations belonging to East Asia haplogroup B4b1c. Among these variants, the homoplasmic C3275T mutation disrupted a highly evolutionary conserved base-pairing (28A-46C) on the variable region of tRNA Leu(UUR) , whereas the T4363C mutation created a new base-pairing (31T-37A) in the anticodon stem of tRNA Gln , furthermore, the A8343G mutation occurred at the very conserved position of tRNA Lys and may result the failure in mitochondrial tRNAs (mt-tRNAs) metabolism. Biochemical analysis revealed the deficiency in mitochondrial functions including lower levels of mitochondrial membrane potential (MMP), ATP production and mtDNA copy number, while a significantly increased reactive oxygen species (ROS) generation was observed in polymononuclear leukocytes (PMNs) from the individuals carrying these mt-tRNA mutations, suggesting that these mutations may cause mitochondrial dysfunction that was responsible for the clinical phenotypes. Taken together, our data indicated that mt-tRNA mutations were associated with MetS and PCOS in this

  9. Life Detection Using Glucose and Tetrasaccharide Enantiomer Pairs

    NASA Astrophysics Data System (ADS)

    Warmflash, David; Chu, Huanyi; Siefert, Johnathan; Fox, George E.

    2009-04-01

    A life-detection system based on the expectation that any viable organism will utilize stereoisomers of a given compound asymmetrically is examined. Aqueous extracts of common soil, Mars regolith simulant JSC Mars-1, and suspensions of E. coli and S. cerevisiae were incubated with stereoisomer pairs. The enantiomeric pairs were either D- and L-glucose or a pair of chiral tetrasaccharides. Following an incubation period of 10 days, stereoisomeric selectivity is detectable with the glucose pair by mass spectrometry in extracts made from soil at 0.5 g/ml, in extracts made from JSC Mars-1 at 2.5 g/ml, and in cell suspensions down to 1.0 × 107 cells/ml. For the tetrasaccharide pair, stereoisomeric selectivity was detected in extracts made from 0.5 g/ml or more of common soil but not in JSC Mars-1 simulant. The effective sensitivity in extracts was 2.5 × 107 cells/ml or better for the glucose pair and 5.0 × 108 cells/ml or better for the tetrasaccharide pair. The sensitivity of the glucose pair was such that it could detect life in samples that would be found to be devoid of organic matter by the GCMS system carried by the Viking landers. The results demonstrate the utility of the approach in the search for biological activity on Mars. However, sensitivity is a function of the enantiomer pair used, and this might also be different for hypothetical martian organisms. Therefore, it will be necessary to characterize additional stereoisomeric pairs and, ultimately, to include several in a single test environment.

  10. Black TiO2 nanobelts/g-C3N4 nanosheets Laminated Heterojunctions with Efficient Visible-Light-Driven Photocatalytic Performance

    PubMed Central

    Shen, Liyan; Xing, Zipeng; Zou, Jinlong; Li, Zhenzi; Wu, Xiaoyan; Zhang, Yuchi; Zhu, Qi; Yang, Shilin; Zhou, Wei

    2017-01-01

    Black TiO2 nanobelts/g-C3N4 nanosheets laminated heterojunctions (b-TiO2/g-C3N4) as visible-light-driven photocatalysts are fabricated through a simple hydrothermal-calcination process and an in-situ solid-state chemical reduction approach, followed by the mild thermal treatment (350 °C) in argon atmosphere. The prepared samples are evidently investigated by X-ray diffraction, Fourier transform infrared spectroscopy, scanning electron microscopy, transmission electron microscopy, X-ray photoelectron spectroscopy, N2 adsorption, and UV-visible diffuse reflectance spectroscopy, respectively. The results show that special laminated heterojunctions are formed between black TiO2 nanobelts and g-C3N4 nanosheets, which favor the separation of photogenerated electron-hole pairs. Furthermore, the presence of Ti3+ and g-C3N4 greatly enhance the absorption of visible light. The resultant b-TiO2/g-C3N4 materials exhibit higher photocatalytic activity than that of g-C3N4, TiO2, b-TiO2 and TiO2/g-C3N4 for degradation of methyl orange (95%) and hydrogen evolution (555.8 μmol h−1 g−1) under visible light irradiation. The apparent reaction rate constant (k) of b-TiO2/g-C3N4 is ~9 times higher than that of pristine TiO2. Therefore, the high-efficient laminated heterojunction composites will have potential applications in fields of environment and energy. PMID:28165021

  11. Identification of a Novel PMS2 Alteration c.505C>G (R169G) In Trans with a PMS2 Pathogenic Mutation in a Patient with Constitutional Mismatch Repair Deficiency

    PubMed Central

    Mork, Maureen E.; Borras, Ester; Taggart, Melissa W.; Cuddy, Amanda; Bannon, Sarah A.; You, Y. Nancy; Lynch, Patrick M.; Ramirez, Pedro T.; Rodriguez-Bigas, Miguel A.; Vilar, Eduardo

    2016-01-01

    Constitutional mismatch repair deficiency syndrome (CMMRD) is a rare autosomal recessive predisposition to colorectal polyposis and other malignancies, often childhood-onset, that is caused by biallelic inheritance of mutations in the same mismatch repair gene. Here, we describe a patient with a clinical diagnosis of CMMRD based on colorectal polyposis and young-onset endometrial cancer who was identified to have two alterations in trans in PMS2: one known pathogenic mutation (c.1831insA; p.Ile611Asnfs*2) and one novel variant of uncertain significance (c.505C>G; p.Arg169Glu), a missense alteration. We describe the clinical and molecular features in the patient harboring this novel alteration c.505C>G, who meets clinical criteria for CMMRD and exhibits molecular evidence supporting a diagnosis of CMMRD. Although experimental validation is needed to confirm its pathogenicity, PMS2 c.505C>G likely has functional consequences that contributes to our patient's phenotype based on the patient's clinical presentation, tumor studies, and bioinformatics analysis. PMID:27017610

  12. Photodissociation Efficiency Spectroscopy Study of the Rydberg Excited Ion-Pair States of Carbon Dioxide

    NASA Astrophysics Data System (ADS)

    Feng, Qiang; Xu, Yun-Feng; Sun, Jin-Da; Tian, Shan-Xi; Shan, Xiao-Bin; Liu, Fu-Yi; Sheng, Liu-Si

    2009-10-01

    Photodissociation efficiency spectrum of anionic oxygen atom produced via ion-pair dissociations of carbon dioxide is recorded by means of the synchrotron radiation excitation (XUV photon energy 17.40-20.00 eV). The present spectrum is assigned as the Rydberg-like excited ion-pair states, i.e., Tanaka-Ogawa and Henning series, tilde Cg+ (CO+2) vibrational ground-state and excitation series. Three Rydberg series, npσu, npπu, and nfu, converging to tilde Cg+ (0, 0, 0), show the higher cross sections.

  13. Sequence dependency of canonical base pair opening in the DNA double helix

    PubMed Central

    Villa, Alessandra

    2017-01-01

    The flipping-out of a DNA base from the double helical structure is a key step of many cellular processes, such as DNA replication, modification and repair. Base pair opening is the first step of base flipping and the exact mechanism is still not well understood. We investigate sequence effects on base pair opening using extensive classical molecular dynamics simulations targeting the opening of 11 different canonical base pairs in two DNA sequences. Two popular biomolecular force fields are applied. To enhance sampling and calculate free energies, we bias the simulation along a simple distance coordinate using a newly developed adaptive sampling algorithm. The simulation is guided back and forth along the coordinate, allowing for multiple opening pathways. We compare the calculated free energies with those from an NMR study and check assumptions of the model used for interpreting the NMR data. Our results further show that the neighboring sequence is an important factor for the opening free energy, but also indicates that other sequence effects may play a role. All base pairs are observed to have a propensity for opening toward the major groove. The preferred opening base is cytosine for GC base pairs, while for AT there is sequence dependent competition between the two bases. For AT opening, we identify two non-canonical base pair interactions contributing to a local minimum in the free energy profile. For both AT and CG we observe long-lived interactions with water and with sodium ions at specific sites on the open base pair. PMID:28369121

  14. NMR structural studies of the ionizing radiation adduct 7-hydro-8-oxodeoxyguanosine (8-oxo-7H-dG) opposite deoxyadenosine in a DNA duplex. 8-oxo-7H-dG(syn)ter dot dA(anti) alignment at lesion site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kouchakdjian, M.; Patel, D.J.; Bodepudi, V.

    1991-02-05

    Proton NMR studies are reported on the complementary d(C1-C2-A3-C4-T5-A6-oxo-G7-T8-C9-A10-C11-C12){center dot}d(G13-G14-T15-G16-A17-A18-T19-A20-G21-T22-G23-G24) dodecanucleotide duplex (designated 8-oxo-7H-dG{center dot}dA 12-mer), which contains a centrally located 7-hydro-8-oxodeoxyguanosine (8-oxo-7H-dG) residue, a group commonly found in DNA that has been exposed to ionizing radiation or oxidizing free radicals. From the NMR spectra it can be deduced that this moiety exists as two tautomers, or gives rise to two DNA conformations, that are in equilibrium and that exchange slowly. The present study focuses on the major component of the equilibrium that originates in the 6,8-dioxo tautomer of 8-oxo-7H-dG. The authors have assigned the exchangeable NH1, NH7, and NH{submore » 2}-2 base protons located on the Watson-Crick and Hoogsteen edges of 8-oxo-7H-dG7 in the 8-oxo-7H-dG{center dot}dA 12-mer duplex, using an analysis of one- and two-dimensional nuclear Overhauser enhancement (NOE) data in H{sub 2}O solution. They were able to detect a set of intra- and interstrand NOEs between protons (exchangeable and nonexchangeable) on adjacent residues in the d(A6-oxo-G7-T8){center dot}d(A17-A18-T19) trinucleotide segment centered about the lesion site that establishes stacking of the oxo-dG7(syn){center dot}dA(anti) pair between stable Watson-Crick dA6{center dot}dT19 and dT8{center dot}A17 base pairs with minimal perturbation of the helix. The structural studies demonstrate that 8-oxo-7H-dG(syn){center dot}dA(anti) forms a stable pair in the interior of the helix, providing a basis for the observed incorporation of dA opposite 8-oxo-7H-dG when readthrough occurs past this oxidized nucleoside base.« less

  15. Interfacial coupling induced direct Z scheme water splitting in metal-free photocatalyst: C3N/g-C3N4 heterojunctions.

    PubMed

    Wang, Jiajun; Li, Xiaoting; You, Ya; Xintong, Yang; Wang, Ying; Li, Qunxiang

    2018-06-21

    Mimicking the natural photosynthesis in green plants, artificial Z-scheme photocatalysis enables more efficient utilization of solar energy for photocatalytic water splitting. Most currently designed g-C3N4-based Z-scheme heterojunctions are usually based on metal-containing semiconductor photocatalysts, thus exploiting metal-free photocatalysts for Z-scheme water splitting is of huge interest. Herein, we propose two metal-free C3N/g-C3N4 heterojunctions with the C3N monolayer covering g-C3N4 sheet (monolayer or bilayer) and systematically explore their electronic structures, charge distributions and photocatalytic properties by performing extensive hybrid density functional calculations. We clearly reveal that the relative strong built-in electric fields around their respective interface regions, caused by the charge transfer from C3N monolayer to g-C3N4 monolayer or bilayer, result in the bands bending, renders the transfer of photogenerated carriers in these two heterojunctions following the Z-scheme instead of the type-II pathway. Moreover, the photogenerated electrons and holes in these two C3N/g-C3N4 heterojunctions not only can be efficiently separated, but also have strong redox abilities for water oxidation and reduction. Compared with the isolated g-C3N4 sheets, the light absorption in visible to near-infrared region are significantly enhanced in these proposed heterojunctions. These theoretical findings suggest that these proposed metal-free C3N/g-C3N4 heterojunctions are promising direct Z-scheme photocatalysts for solar water splitting. © 2018 IOP Publishing Ltd.

  16. Carbonic acid ionization and the stability of sodium bicarbonate and carbonate ion pairs to 200 °C - A potentiometric and spectrophotometric study

    NASA Astrophysics Data System (ADS)

    Stefánsson, Andri; Bénézeth, Pascale; Schott, Jacques

    2013-11-01

    Carbonic acid ionization and sodium bicarbonate and carbonate ion pair formation constants have been experimentally determined in dilute hydrothermal solutions to 200 °C. Two experimental approaches were applied, potentiometric acid-base titrations at 10-60 °C and spectrophotometric pH measurements using the pH indicators, 2-napthol and 4-nitrophenol, at 25-200 °C. At a given temperature, the first and second ionization constants of carbonic acid (K1, K2) and the ion pair formation constants for NaHCO(aq)(K) and NaCO3-(aq)(K) were simultaneously fitted to the data. Results of this study compare well with previously determined values of K1 and K2. The NaHCO(aq) and NaCO3-(aq) ion pair formation constants vary between 25 and 200 °C having values of logK=-0.18 to 0.58 and logK=1.01 to 2.21, respectively. These ion pairs are weak at low-temperatures but become increasingly important with increasing temperature under neutral to alkaline conditions in moderately dilute to concentrated NaCl solutions, with NaCO3-(aq) predominating over CO32-(aq) in ⩾0.1 M NaCl solution at temperatures above 100 °C. The results demonstrate that NaCl cannot be considered as an inert (non-complexing) electrolyte in aqueous carbon dioxide containing solutions at elevated temperatures.

  17. Prospective very young asteroid pairs

    NASA Astrophysics Data System (ADS)

    Galád, A.; Vokrouhlický, D.; Zizka, J.

    2014-07-01

    Several tens of asteroid pairs can be discerned from the background main-belt asteroids. The majority of them are thought to have formed within only the last few 10^6 yr. The youngest recognized pairs have formed more than ≈ 10 kyr ago. As some details of pair formation are still not understood well, the study of young pairs is of great importance. It is mainly because the conditions at the time of the pair formation could be deduced much more reliably for young pairs. For example, space weathering on the surfaces of the components, or changes in their rotational properties (in spin rates, tumbling, coordinates of rotational pole) could be negligible since the formation of young pairs. Also, possible strong perturbations by main-belt bodies on pair formation can be reliably studied only for extremely young pairs. Some pairs can quickly blend in with the background asteroids, so even the frequency of asteroid pair formation could be determined more reliably based on young pairs (though only after a statistically significant sample is at disposal). In our regular search for young pairs in the growing asteroid database, only multiopposition asteroids with very similar orbital and proper elements are investigated. Every pair component is represented by a number of clones within orbital uncertainties and drifting in semimajor axis due to the Yarkovsky effect. We found that, if the previously unrecognized pairs (87887) 2000 SS_{286} - 2002 AT_{49} and (355258) 2007 LY_{4} - 2013AF_{40} formed at the recent very close approach of their components, they could become the youngest known pairs. In both cases, the relative encounter velocities of the components were only ˜ 0.1 m s^{-1}. However, the minimum distances between some clones are too large and a few clones of the latter pair did not encounter recently (within ≈ 10 kyr). The age of some prospective young pairs cannot be determined reliably without improved orbital properties (e.g., the second component of a pair

  18. Sequence-dependent base pair stepping dynamics in XPD helicase unwinding

    PubMed Central

    Qi, Zhi; Pugh, Robert A; Spies, Maria; Chemla, Yann R

    2013-01-01

    Helicases couple the chemical energy of ATP hydrolysis to directional translocation along nucleic acids and transient duplex separation. Understanding helicase mechanism requires that the basic physicochemical process of base pair separation be understood. This necessitates monitoring helicase activity directly, at high spatio-temporal resolution. Using optical tweezers with single base pair (bp) resolution, we analyzed DNA unwinding by XPD helicase, a Superfamily 2 (SF2) DNA helicase involved in DNA repair and transcription initiation. We show that monomeric XPD unwinds duplex DNA in 1-bp steps, yet exhibits frequent backsteps and undergoes conformational transitions manifested in 5-bp backward and forward steps. Quantifying the sequence dependence of XPD stepping dynamics with near base pair resolution, we provide the strongest and most direct evidence thus far that forward, single-base pair stepping of a helicase utilizes the spontaneous opening of the duplex. The proposed unwinding mechanism may be a universal feature of DNA helicases that move along DNA phosphodiester backbones. DOI: http://dx.doi.org/10.7554/eLife.00334.001 PMID:23741615

  19. Probing π-π stacking modulation of g-C3N4/graphene heterojunctions and corresponding role of graphene on photocatalytic activity.

    PubMed

    Ma, Xinguo; Wei, Yang; Wei, Zhen; He, Hua; Huang, Chuyun; Zhu, Yongfa

    2017-12-15

    The photoelectrochemical properties of g-C 3 N 4 sheet are modified by the π-π stacking interaction with graphene, and the corresponding role of graphene on the surface chemical reactions is investigated by density functional theory. The calculated cohesive energies and the lattice mismatch energies indicate that g-C 3 N 4 and graphene are in parallel contact and can form a stable heterojunction. According to our calculated energy band structures and work functions of g-C 3 N 4 /graphene heterojunctions, the band edge modulations by graphene are discussed and corresponding photoinduced charge transfer processes are analyzed in detail. It is found that the incorporating of graphene into g-C 3 N 4 facilitates the separation of photoinduced e - /h + pairs and the oxidation capacity enhancement of the photoinduced holes with the downshifting of the valence band edge of g-C 3 N 4 layer. It is identified that the inhomogeneous onsite energies between interlayer and the band edge modulations are induced by the inhomogeneous charge redistribution between interlayer caused by graphene. Further, the initial dynamic reaction processes of oxygen atoms in g-C 3 N 4 /graphene heterojunctions also confirm the significant role of graphene on the surface chemical reactions. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Synergistic binding of bHLH transcription factors to the promoter of the maize NADP-ME gene used in C4 photosynthesis is based on an ancient code found in the ancestral C3 state.

    PubMed

    Borba, Ana Rita; Serra, Tânia S; Górska, Alicja; Gouveia, Paulo; Cordeiro, André M; Reyna-Llorens, Ivan; Knerová, Jana; Barros, Pedro M; Abreu, Isabel A; Oliveira, M Margarida; Hibberd, Julian M; Saibo, Nelson J M

    2018-04-05

    C4 photosynthesis has evolved repeatedly from the ancestral C3 state to generate a carbon concentrating mechanism that increases photosynthetic efficiency. This specialised form of photosynthesis is particularly common in the PACMAD clade of grasses, and is used by many of the world's most productive crops. The C4 cycle is accomplished through cell-type specific accumulation of enzymes but cis-elements and transcription factors controlling C4 photosynthesis remain largely unknown. Using the NADP-Malic Enzyme (NADP-ME) gene as a model we tested whether mechanisms impacting on transcription in C4 plants evolved from ancestral components found in C3 species. Two basic Helix-Loop-Helix (bHLH) transcription factors, ZmbHLH128 and ZmbHLH129, were shown to bind the C4NADP-ME promoter from maize. These proteins form heterodimers and ZmbHLH129 impairs trans-activation by ZmbHLH128. Electrophoretic mobility shift assays indicate that a pair of cis-elements separated by a seven base pair spacer synergistically bind either ZmbHLH128 or ZmbHLH129. This pair of cis-elements is found in both C3 and C4 Panicoid grass species of the PACMAD clade. Our analysis is consistent with this cis-element pair originating from a single motif present in the ancestral C3 state. We conclude that C4 photosynthesis has co-opted an ancient C3 regulatory code built on G-box recognition by bHLH to regulate the NADP-ME gene. More broadly, our findings also contribute to the understanding of gene regulatory networks controlling C4 photosynthesis.

  1. A systematic molecular dynamics study of nearest-neighbor effects on base pair and base pair step conformations and fluctuations in B-DNA

    PubMed Central

    Lavery, Richard; Zakrzewska, Krystyna; Beveridge, David; Bishop, Thomas C.; Case, David A.; Cheatham, Thomas; Dixit, Surjit; Jayaram, B.; Lankas, Filip; Laughton, Charles; Maddocks, John H.; Michon, Alexis; Osman, Roman; Orozco, Modesto; Perez, Alberto; Singh, Tanya; Spackova, Nada; Sponer, Jiri

    2010-01-01

    It is well recognized that base sequence exerts a significant influence on the properties of DNA and plays a significant role in protein–DNA interactions vital for cellular processes. Understanding and predicting base sequence effects requires an extensive structural and dynamic dataset which is currently unavailable from experiment. A consortium of laboratories was consequently formed to obtain this information using molecular simulations. This article describes results providing information not only on all 10 unique base pair steps, but also on all possible nearest-neighbor effects on these steps. These results are derived from simulations of 50–100 ns on 39 different DNA oligomers in explicit solvent and using a physiological salt concentration. We demonstrate that the simulations are converged in terms of helical and backbone parameters. The results show that nearest-neighbor effects on base pair steps are very significant, implying that dinucleotide models are insufficient for predicting sequence-dependent behavior. Flanking base sequences can notably lead to base pair step parameters in dynamic equilibrium between two conformational sub-states. Although this study only provides limited data on next-nearest-neighbor effects, we suggest that such effects should be analyzed before attempting to predict the sequence-dependent behavior of DNA. PMID:19850719

  2. Physics of base-pairing dynamics in DNA

    NASA Astrophysics Data System (ADS)

    Manghi, Manoel; Destainville, Nicolas

    2016-05-01

    As a key molecule of life, Deoxyribo-Nucleic Acid (DNA) is the focus of numbers of investigations with the help of biological, chemical and physical techniques. From a physical point of view, both experimental and theoretical works have brought quantitative insights into DNA base-pairing dynamics that we review in this Report, putting emphasis on theoretical developments. We discuss the dynamics at the base-pair scale and its pivotal coupling with the polymer one, with a polymerization index running from a few nucleotides to tens of kilo-bases. This includes opening and closure of short hairpins and oligomers as well as zipping and unwinding of long macromolecules. We review how different physical mechanisms are either used by Nature or utilized in biotechnological processes to separate the two intertwined DNA strands, by insisting on quantitative results. They go from thermally-assisted denaturation bubble nucleation to force- or torque-driven mechanisms. We show that the helical character of the molecule, possibly supercoiled, can play a key role in many denaturation and renaturation processes. We categorize the mechanisms according to the relative timescales associated with base-pairing and chain orientational degrees of freedom such as bending and torsional elastic ones. In some specific situations, these chain orientational degrees of freedom can be integrated out, and the quasi-static approximation is valid. The complex dynamics then reduces to the diffusion in a low-dimensional free-energy landscape. In contrast, some important cases of experimental interest necessarily appeal to far-from-equilibrium statistical mechanics and hydrodynamics.

  3. Improved genetically-encoded, FlincG-type fluorescent biosensors for neural cGMP imaging

    PubMed Central

    Bhargava, Yogesh; Hampden-Smith, Kathryn; Chachlaki, Konstantina; Wood, Katherine C.; Vernon, Jeffrey; Allerston, Charles K.; Batchelor, Andrew M.; Garthwaite, John

    2013-01-01

    Genetically-encoded biosensors are powerful tools for understanding cellular signal transduction mechanisms. In aiming to investigate cGMP signaling in neurones using the EGFP-based fluorescent biosensor, FlincG (fluorescent indicator for cGMP), we encountered weak or non-existent fluorescence after attempted transfection with plasmid DNA, even in HEK293T cells. Adenoviral infection of HEK293T cells with FlincG, however, had previously proved successful. Both constructs were found to harbor a mutation in the EGFP domain and had a tail of 17 amino acids at the C-terminus that differed from the published sequence. These discrepancies were systematically examined, together with mutations found beneficial for the related GCaMP family of Ca2+ biosensors, in a HEK293T cell line stably expressing both nitric oxide (NO)-activated guanylyl cyclase and phosphodiesterase-5. Restoring the mutated amino acid improved basal fluorescence whereas additional restoration of the correct C-terminal tail resulted in poor cGMP sensing as assessed by superfusion of either 8-bromo-cGMP or NO. Ultimately, two improved FlincGs were identified: one (FlincG2) had the divergent tail and gave moderate basal fluorescence and cGMP response amplitude and the other (FlincG3) had the correct tail, a GCaMP-like mutation in the EGFP region and an N-terminal tag, and was superior in both respects. All variants tested were strongly influenced by pH over the physiological range, in common with other EGFP-based biosensors. Purified FlincG3 protein exhibited a lower cGMP affinity (0.89 μM) than reported for the original FlincG (0.17 μM) but retained rapid kinetics and a 230-fold selectivity over cAMP. Successful expression of FlincG2 or FlincG3 in differentiated N1E-115 neuroblastoma cells and in primary cultures of hippocampal and dorsal root ganglion cells commends them for real-time imaging of cGMP dynamics in neural (and other) cells, and in their subcellular specializations. PMID:24068983

  4. Life detection using glucose and tetrasaccharide enantiomer pairs.

    PubMed

    Warmflash, David; Chu, Huanyi; Siefert, Johnathan; Fox, George E

    2009-04-01

    A life-detection system based on the expectation that any viable organism will utilize stereoisomers of a given compound asymmetrically is examined. Aqueous extracts of common soil, Mars regolith simulant JSC Mars-1, and suspensions of E. coli and S. cerevisiae were incubated with stereoisomer pairs. The enantiomeric pairs were either D- and L-glucose or a pair of chiral tetrasaccharides. Following an incubation period of 10 days, stereoisomeric selectivity is detectable with the glucose pair by mass spectrometry in extracts made from soil at 0.5 g/ml, in extracts made from JSC Mars-1 at 2.5 g/ml, and in cell suspensions down to 1.0 x 10(7) cells/ml. For the tetrasaccharide pair, stereoisomeric selectivity was detected in extracts made from 0.5 g/ml or more of common soil but not in JSC Mars-1 simulant. The effective sensitivity in extracts was 2.5 x 10(7) cells/ml or better for the glucose pair and 5.0 x 10(8) cells/ml or better for the tetrasaccharide pair. The sensitivity of the glucose pair was such that it could detect life in samples that would be found to be devoid of organic matter by the GCMS system carried by the Viking landers. The results demonstrate the utility of the approach in the search for biological activity on Mars. However, sensitivity is a function of the enantiomer pair used, and this might also be different for hypothetical martian organisms. Therefore, it will be necessary to characterize additional stereoisomeric pairs and, ultimately, to include several in a single test environment.

  5. Conformational analysis of a covalently cross-linked Watson-Crick base pair model.

    PubMed

    Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J

    2008-11-15

    Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.

  6. A review on g-C3N4 for photocatalytic water splitting and CO2 reduction

    NASA Astrophysics Data System (ADS)

    Ye, Sheng; Wang, Rong; Wu, Ming-Zai; Yuan, Yu-Peng

    2015-12-01

    Solar fuel generation through water splitting and CO2 photoreduction is an ideal route to provide the renewable energy sources and mitigate global warming. The main challenge in photocatalysis is finding a low-cost photocatalyst that can work efficiently to split water into hydrogen and reduce CO2 to hydrocarbon fuels. Metal-free g-C3N4 photocatalyst shows great potentials for solar fuel production. In this mini review, we summarize the most current advances on novel design idea and new synthesis strategy for g-C3N4 preparation, insightful ideas on extending optical absorption of pristine g-C3N4, overall water splitting and CO2 photoreduction over g-C3N4 based systems. The research challenges and perspectives on g-C3N4 based photocatalysts were also suggested.

  7. Single-Molecule Mechanical (Un)folding of RNA Hairpins: Effects of Single A-U to A∙C Pair Substitutions and Single Proton Binding and Implications for mRNA Structure-Induced -1 Ribosomal Frameshifting.

    PubMed

    Yang, Lixia; Zhong, Zhensheng; Tong, Cailing; Jia, Huan; Liu, Yiran; Chen, Gang

    2018-06-08

    A wobble A∙C pair can be protonated at near physiological pH to form a more stable wobble A+∙C pair. Here, we constructed an RNA hairpin (rHP) and three mutants with one A-U base pair substituted with an A∙C mismatch on the top (near the loop, U22C), middle (U25C) and bottom (U29C) positions of the stem, respectively. Our results on single-molecule mechanical (un)folding using optical tweezers reveal the destabilization effect of A-U to A∙C pair substitution, and protonation-dependent enhancement of mechanical stability facilitated through an increased folding rate, or decreased unfolding rate, or both. Our data show that protonation may occur rapidly upon the formation of apparent mechanical folding transition state. Furthermore, we measured the bulk -1 ribosomal frameshifting efficiencies of the hairpins by a cell-free translation assay. For the mRNA hairpins studied, -1 frameshifting efficiency correlates with mechanical unfolding force at equilibrium and folding rate at around 15 pN. U29C has a frameshifting efficiency similar to that of rHP (~2%). Accordingly, the bottom 2-4 base pairs of U29C may not form under a stretching force at pH 7.3, which is consistent with the fact that the bottom base pairs of the hairpins may be disrupted by ribosome at the slippery site. U22C and U25C have a similar frameshifting efficiency (~1%), indicating that both unfolding and folding rates of an mRNA hairpin in a crowded environment may affect frameshifting. Our data indicate that mechanical (un)folding of RNA hairpins may mimic how mRNAs unfold and fold in the presence of translating ribosomes.

  8. New application of Z-scheme Ag3PO4/g-C3N4 composite in converting CO2 to fuel.

    PubMed

    He, Yiming; Zhang, Lihong; Teng, Botao; Fan, Maohong

    2015-01-06

    This research was designed for the first time to investigate the activities of photocatalytic composite, Ag3PO4/g-C3N4, in converting CO2 to fuels under simulated sunlight irradiation. The composite was synthesized using a simple in situ deposition method and characterized by various techniques including Brunauer-Emmett-Teller method (BET), X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FT-IR), scanning electron microscopy (SEM), transmission electron microscopy (TEM), X-ray photoelectron spectroscopy (XPS), UV-vis diffuse reflectance spectroscopy (DRS), photoluminescence spectroscopy (PL), and an electrochemical method. Thorough investigation indicated that the composite consisted of Ag3PO4, Ag, and g-C3N4. The introduction of Ag3PO4 on g-C3N4 promoted its light absorption performance. However, more significant was the formation of heterojunction structure between Ag3PO4 and g-C3N4, which efficiently promoted the separation of electron-hole pairs by a Z-scheme mechanism and ultimately enhanced the photocatalytic CO2 reduction performance of the Ag3PO4/g-C3N4. The optimal Ag3PO4/g-C3N4 photocatalyst showed a CO2 conversion rate of 57.5 μmol · h(-1) · gcat(-1), which was 6.1 and 10.4 times higher than those of g-C3N4 and P25, respectively, under simulated sunlight irradiation. The work found a new application of the photocatalyst, Ag3PO4/g-C3N4, in simultaneous environmental protection and energy production.

  9. Race and Gender Mentor-Protégé Pairings of Resident Assistants: An Exploration on Leadership Capacity

    ERIC Educational Resources Information Center

    Early, Sherry L.

    2017-01-01

    The leadership capacity of resident assistants can be impacted by many experiences, including involvement in mentoring relationships. The purpose of this study was to examine if and how resident assistants' leadership capacities are influenced by participating in mentoring relationships. Additionally, mentor-protégé race and gender pairings were…

  10. Error simulation of paired-comparison-based scaling methods

    NASA Astrophysics Data System (ADS)

    Cui, Chengwu

    2000-12-01

    Subjective image quality measurement usually resorts to psycho physical scaling. However, it is difficult to evaluate the inherent precision of these scaling methods. Without knowing the potential errors of the measurement, subsequent use of the data can be misleading. In this paper, the errors on scaled values derived form paired comparison based scaling methods are simulated with randomly introduced proportion of choice errors that follow the binomial distribution. Simulation results are given for various combinations of the number of stimuli and the sampling size. The errors are presented in the form of average standard deviation of the scaled values and can be fitted reasonably well with an empirical equation that can be sued for scaling error estimation and measurement design. The simulation proves paired comparison based scaling methods can have large errors on the derived scaled values when the sampling size and the number of stimuli are small. Examples are also given to show the potential errors on actually scaled values of color image prints as measured by the method of paired comparison.

  11. A Hierarchical Z-Scheme α-Fe2 O3 /g-C3 N4 Hybrid for Enhanced Photocatalytic CO2 Reduction.

    PubMed

    Jiang, Zhifeng; Wan, Weiming; Li, Huaming; Yuan, Shouqi; Zhao, Huijun; Wong, Po Keung

    2018-03-01

    The challenge in the artificial photosynthesis of fossil resources from CO 2 by utilizing solar energy is to achieve stable photocatalysts with effective CO 2 adsorption capacity and high charge-separation efficiency. A hierarchical direct Z-scheme system consisting of urchin-like hematite and carbon nitride provides an enhanced photocatalytic activity of reduction of CO 2 to CO, yielding a CO evolution rate of 27.2 µmol g -1 h -1 without cocatalyst and sacrifice reagent, which is >2.2 times higher than that produced by g-C 3 N 4 alone (10.3 µmol g -1 h -1 ). The enhanced photocatalytic activity of the Z-scheme hybrid material can be ascribed to its unique characteristics to accelerate the reduction process, including: (i) 3D hierarchical structure of urchin-like hematite and preferable basic sites which promotes the CO 2 adsorption, and (ii) the unique Z-scheme feature efficiently promotes the separation of the electron-hole pairs and enhances the reducibility of electrons in the conduction band of the g-C 3 N 4 . The origin of such an obvious advantage of the hierarchical Z-scheme is not only explained based on the experimental data but also investigated by modeling CO 2 adsorption and CO adsorption on the three different atomic-scale surfaces via density functional theory calculation. The study creates new opportunities for hierarchical hematite and other metal-oxide-based Z-scheme system for solar fuel generation. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Two-photon production of dilepton pairs in peripheral heavy ion collisions

    NASA Astrophysics Data System (ADS)

    Klein, Spencer R.

    2018-05-01

    The STAR collaboration has observed an excess production of e+e- pairs in relativistic heavy ion collisions, over the expectations from hadronic production models. The excess pairs have transverse momenta pT<150 MeV /c and are most prominent in peripheral gold-gold and uranium-uranium collisions. The pairs exhibit a peak at the J /ψ mass, but include a wide continuum, with pair invariant masses from 400 MeV/c 2 up to 2.6 GeV/c 2 . The ALICE Collaboration observes a similar excess in peripheral lead-lead collisions, but only at the J /ψ mass, without a corresponding continuum. This paper presents a calculation of the cross section and kinematic for two-photon production of e+e- pairs, and find general agreement with the STAR data. The calculation is based on the starlight simulation code, which is based on the Weizsäcker-Williams virtual photon approach. The STAR continuum observations are compatible with two-photon production of e+e- pairs. The ALICE analysis required individual muon pT be greater than 1 GeV/c; this eliminated almost all of the pairs from two-photon interactions, while leaving most of the J /ψ decays.

  13. The influence of anharmonic and solvent effects on the theoretical vibrational spectra of the guanine-cytosine base pairs in Watson-Crick and Hoogsteen configurations.

    PubMed

    Bende, Attila; Muntean, Cristina M

    2014-03-01

    The theoretical IR and Raman spectra of the guanine-cytosine DNA base pairs in Watson-Crick and Hoogsteen configurations were computed using DFT method with M06-2X meta-hybrid GGA exchange-correlation functional, including the anharmonic corrections and solvent effects. The results for harmonic frequencies and their anharmonic corrections were compared with our previously calculated values obtained with the B3PW91 hybrid GGA functional. Significant differences were obtained for the anharmonic corrections calculated with the two different DFT functionals, especially for the stretching modes, while the corresponding harmonic frequencies did not differ considerable. For the Hoogtseen case the H⁺ vibration between the G-C base pair can be characterized as an asymmetric Duffing oscillator and therefore unrealistic anharmonic corrections for normal modes where this proton vibration is involved have been obtained. The spectral modification due to the anharmonic corrections, solvent effects and the influence of sugar-phosphate group for the Watson-Crick and Hoogsteen base pair configurations, respectively, were also discussed. For the Watson-Crick case also the influence of the stacking interaction on the theoretical IR and Raman spectra was analyzed. Including the anharmonic correction in our normal mode analysis is essential if one wants to obtain correct assignments of the theoretical frequency values as compared with the experimental spectra.

  14. 3D-Subspace-Based Auto-Paired Azimuth Angle, Elevation Angle, and Range Estimation for 24G FMCW Radar with an L-Shaped Array

    PubMed Central

    Nam, HyungSoo; Choi, ByungGil; Oh, Daegun

    2018-01-01

    In this paper, a three-dimensional (3D)-subspace-based azimuth angle, elevation angle, and range estimation method with auto-pairing is proposed for frequency-modulated continuous waveform (FMCW) radar with an L-shaped array. The proposed method is designed to exploit the 3D shift-invariant structure of the stacked Hankel snapshot matrix for auto-paired azimuth angle, elevation angle, and range estimation. The effectiveness of the proposed method is verified through a variety of experiments conducted in a chamber. For the realization of the proposed method, K-band FMCW radar is implemented with an L-shaped antenna. PMID:29621193

  15. The somatic FAH C.1061C>A change counteracts the frequent FAH c.1062+5G>A mutation and permits U1snRNA-based splicing correction.

    PubMed

    Scalet, Daniela; Sacchetto, Claudia; Bernardi, Francesco; Pinotti, Mirko; van de Graaf, Stan F J; Balestra, Dario

    2018-05-01

    In tyrosinaemia type 1(HT1), a mosaic pattern of fumarylacetoacetase (FAH) immunopositive or immunonegative nodules in liver tissue has been reported in many patients. This aspect is generally explained by a spontaneous reversion of the mutation into a normal genotype. In one HT1 patient carrying the frequent FAH c.1062+5G>A mutation, a second somatic change (c.1061C>A) has been reported in the same allele, and found in immunopositive nodules. Here, we demonstrated that the c.1062+5G>A prevents usage of the exon 12 5' splice site (ss), even when forced by an engineered U1snRNA specifically designed on the FAH 5'ss to strengthen its recognition. Noticeably the new somatic c.1061C>A change, in linkage with the c.1062+5G>A mutation, partially rescues the defective 5'ss and is associated to trace level (~5%) of correct transcripts. Interestingly, this combined genetic condition strongly favored the rescue by the engineered U1snRNA, with correct transcripts reaching up to 60%. Altogether, these findings elucidate the molecular basis of HT1 caused by the frequent FAH c.1062+5G>A mutation, and demonstrate the compensatory effect of the c.1061C>A change in promoting exon definition, thus unraveling a rare mechanism leading to FAH immune-reactive mosaicism.

  16. T.C.G triplet in an antiparallel purine.purine.pyrimidine DNA triplex. Conformational studies by NMR.

    PubMed

    Dittrich, K; Gu, J; Tinder, R; Hogan, M; Gao, X

    1994-04-12

    The antiparallel purine.purine.pyrimidine DNA triplex, RRY6, which contains a T.C.G inverted triplet in the center of the sequence, was examined by proton and phosphorous two-dimensional NMR spectroscopy. The local conformation of the T.C.G triplet (T4.C11.G18) and the effect of this triplet on the global helical structure were analyzed in detail. The formation of the T.C.G triplet is confirmed by a set of cross-strand NOEs, including unusual cross-strand NOEs between the third strand and the pyrimidine strand as opposed to the purine strand of the duplex. NMR data suggest that the T.C.G triplet may be present in an equilibrium between a non-hydrogen-bonded form and a T(O4)-C(NH2) hydrogen-bonded form and that there is a distortion of the in-plane alignment of the three bases. The flanking G.G.C base triplets are well-defined on the 5'-side of T4, but somewhat interrupted on the 3'-side of T4. The effect of the third strand binding on the Watson-Crick duplex was probed by an NMR study of the free duplex RY6. NMR parameters are affected mostly around the T.C.G inversion site. The perturbations extend to at least two adjacent base triplets on either side. The binding of the third purine strand and the accommodation of a central T.C.G inversion in RRY6 does not require a readjustment in sugar pucker, which remains in the range of C2'-endo. 31P resonances of RRY6 distribute over a range of 2.2 ppm. The H-P coupling patterns of the third strand differ from those of the duplex. General spectral patterns defined by the marker protons of the RRY and YRY triplexes are compared.

  17. Virulence of Mycobacterium tuberculosis after Acquisition of Isoniazid Resistance: Individual Nature of katG Mutants and the Possible Role of AhpC.

    PubMed

    Nieto R, Luisa Maria; Mehaffy, Carolina; Creissen, Elizabeth; Troudt, JoLynn; Troy, Amber; Bielefeldt-Ohmann, Helle; Burgos, Marcos; Izzo, Angelo; Dobos, Karen M

    2016-01-01

    In the last decade, there were 10 million new tuberculosis cases per year globally. Around 9.5% of these cases were caused by isoniazid resistant (INHr) Mycobacterium tuberculosis (Mtb) strains. Although isoniazid resistance in Mtb is multigenic, mutations in the catalase-peroxidase (katG) gene predominate among the INHr strains. The effect of these drug-resistance-conferring mutations on Mtb fitness and virulence is variable. Here, we assessed differences in bacterial growth, immune response and pathology induced by Mtb strains harboring mutations at the N-terminus of the katG gene. We studied one laboratory and one clinically isolated Mtb clonal pair from different genetic lineages. The INHr strain in each pair had one and two katG mutations with significantly reduced levels of the enzyme and peroxidase activity. Both strains share the V1A mutation, while the double mutant clinical INHr had also the novel E3V katG mutation. Four groups of C57BL/6 mice were infected with one of the Mtb strains previously described. We observed a strong reduction in virulence (reduced bacterial growth), lower induction of proinflammatory cytokines and significantly reduced pathology scores in mice infected with the clinical INHr strain compared to the infection caused by its INHs progenitor strain. On the other hand, there was a subtle reduction of bacteria growth without differences in the pathology scores in mice infected with the laboratory INHr strain. Our results also showed distinct alkyl-hydroperoxidase C (AhpC) levels in the katG mutant strains, which could explain the difference in the virulence profile observed. The difference in the AhpC levels between clonal strains was not related to a genetic defect in the gene or its promoter. Cumulatively, our results indicate that the virulence, pathology and fitness of INHr strains could be negatively affected by multiple mutations in katG, lack of the peroxidase activity and reduced AhpC levels.

  18. Cu-modified alkalinized g-C3N4 as photocatalytically assisted heterogeneous Fenton-like catalyst

    NASA Astrophysics Data System (ADS)

    Dong, Qimei; Chen, Yingying; Wang, Lingli; Ai, Shasha; Ding, Hanming

    2017-12-01

    Alkalinized graphitic carbon nitride (CNK-OH) has been synthesized by one-step thermal poly-condensation method, and Cu-modified alkalinized g-C3N4 (Cu-CNK-OH) has been prepared by impregnation approach over CNK-OH. These copper species in Cu-CNK-OH are embedded in the frame of CNK-OH mostly via the Cu-N bonds. Cu-CNK-OH has been employed as a heterogeneous Fenton-like catalyst to degrade rhodamine B (RhB). Both the production efficiency of hydroxyl radicals and the transformation rate of Cu(II)/Cu(I) redox pair increase under visible-light irradiation. As a result, Cu-CNK-OH exhibits improved Fenton-like catalytic activity on the degradation of RhB. The synergetic interaction between Fenton-like process and photocatalytic process also contributes such improvement. The hydroxyl radicals and holes are the major reactive species in the photocatalytically assisted Fenton-like process. This study provides a valuable strategy for metal modification of alkalinized g-C3N4 with enhanced Fenton-like catalytic performance for the degradation of organic contaminants.

  19. Dipole moments and transition probabilities of the i 3Pi sub g-b 3Sigma(+) sub u, c 3Pi sub u-a 3Sigma(+) sub g, and i 3Pi sub g-c 3Pi sub u systems of molecular hydrogen

    NASA Technical Reports Server (NTRS)

    Guberman, Steven L.; Dalgarno, A.

    1992-01-01

    Bonn-Oppenheimer-based ab initio calculations of dipole moments from the i 3Pi sub g-b 3Sigma(+) sub u, c 3Pi sub u-a 3Sigma(+) sub g, and i 3Pi sub g-c 3Pi sub u transitions of H2 have been conducted, to yield a tabulation of the dipole transition probabilities and Franck-Condon factors. These factors are given for transitions originating in the lowest vibrational level of the ground X 1Sigma(+) sub g state.

  20. Ion-pair cloud-point extraction: a new method for the determination of water-soluble vitamins in plasma and urine.

    PubMed

    Heydari, Rouhollah; Elyasi, Najmeh S

    2014-10-01

    A novel, simple, and effective ion-pair cloud-point extraction coupled with a gradient high-performance liquid chromatography method was developed for determination of thiamine (vitamin B1 ), niacinamide (vitamin B3 ), pyridoxine (vitamin B6 ), and riboflavin (vitamin B2 ) in plasma and urine samples. The extraction and separation of vitamins were achieved based on an ion-pair formation approach between these ionizable analytes and 1-heptanesulfonic acid sodium salt as an ion-pairing agent. Influential variables on the ion-pair cloud-point extraction efficiency, such as the ion-pairing agent concentration, ionic strength, pH, volume of Triton X-100, extraction temperature, and incubation time have been fully evaluated and optimized. Water-soluble vitamins were successfully extracted by 1-heptanesulfonic acid sodium salt (0.2% w/v) as ion-pairing agent with Triton X-100 (4% w/v) as surfactant phase at 50°C for 10 min. The calibration curves showed good linearity (r(2) > 0.9916) and precision in the concentration ranges of 1-50 μg/mL for thiamine and niacinamide, 5-100 μg/mL for pyridoxine, and 0.5-20 μg/mL for riboflavin. The recoveries were in the range of 78.0-88.0% with relative standard deviations ranging from 6.2 to 8.2%. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Multi-hop teleportation based on W state and EPR pairs

    NASA Astrophysics Data System (ADS)

    Hai-Tao, Zhan; Xu-Tao, Yu; Pei-Ying, Xiong; Zai-Chen, Zhang

    2016-05-01

    Multi-hop teleportation has significant value due to long-distance delivery of quantum information. Many studies about multi-hop teleportation are based on Bell pairs, partially entangled pairs or W state. The possibility of multi-hop teleportation constituted by partially entangled pairs relates to the number of nodes. The possibility of multi-hop teleportation constituted by double W states is after n-hop teleportation. In this paper, a multi-hop teleportation scheme based on W state and EPR pairs is presented and proved. The successful possibility of quantum information transmitted hop by hop through intermediate nodes is deduced. The possibility of successful transmission is after n-hop teleportation. Project supported by the National Natural Science Foundation of China (Grant No. 61571105), the Prospective Future Network Project of Jiangsu Province, China (Grant No. BY2013095-1-18), and the Independent Project of State Key Laboratory of Millimeter Waves, China (Grant No. Z201504).

  2. Method for sequencing DNA base pairs

    DOEpatents

    Sessler, Andrew M.; Dawson, John

    1993-01-01

    The base pairs of a DNA structure are sequenced with the use of a scanning tunneling microscope (STM). The DNA structure is scanned by the STM probe tip, and, as it is being scanned, the DNA structure is separately subjected to a sequence of infrared radiation from four different sources, each source being selected to preferentially excite one of the four different bases in the DNA structure. Each particular base being scanned is subjected to such sequence of infrared radiation from the four different sources as that particular base is being scanned. The DNA structure as a whole is separately imaged for each subjection thereof to radiation from one only of each source.

  3. Method for sequencing DNA base pairs

    DOEpatents

    Sessler, A.M.; Dawson, J.

    1993-12-14

    The base pairs of a DNA structure are sequenced with the use of a scanning tunneling microscope (STM). The DNA structure is scanned by the STM probe tip, and, as it is being scanned, the DNA structure is separately subjected to a sequence of infrared radiation from four different sources, each source being selected to preferentially excite one of the four different bases in the DNA structure. Each particular base being scanned is subjected to such sequence of infrared radiation from the four different sources as that particular base is being scanned. The DNA structure as a whole is separately imaged for each subjection thereof to radiation from one only of each source. 6 figures.

  4. Proteolytic processing of poliovirus polypeptides: antibodies to polypeptide P3-7c inhibit cleavage at glutamine-glycine pairs

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hanecak, R.; Semler, B.L.; Anderson, C.W.

    1982-07-01

    Proteolytic processing of poliovirus polypeptides was examined by the addition of antibodies directed against the viral proteins P3-7c and P2-X to a cell-free translation extract prepared from infected HeLa cells. Antisera to P3-7c specifically inhibited in vitro processing at Gln-Gly pairs. Partial amino acid sequence analysis revealed a second Tyr-Gly pair that is utilized in protein processing. Neither Tyr-Gly cleavage is affected by antibody to P3-7C. Anti-P3-7c antibodies react not only with P3-7c but also with P3-6a and P3-2, two viral polypeptides NH/sub 2/-coterminal with P3-7c. Preimmune and anti-P2-X antibodies had no effect on the processing of poliovirus proteins inmore » vitro. The authors conclude that the activity responsible for processing poliovirus polypeptides at Gln-Gly pairs resides in the primary structure of P3-7c and not in P2-X.« less

  5. Structural, optical and photocatalytic properties of visible light driven zinc oxide hybridized two-dimensional π-conjugated polymeric g-C3N4 composite

    NASA Astrophysics Data System (ADS)

    Murugesan, Pramila; Girichandran, Nandalal; Narayanan, Sheeba; Manickam, Matheswaran

    2018-01-01

    Zinc oxide (ZnO) hybridized with graphitic carbon nitride (g-C3N4) composite was prepared via one step calcination method and well characterized using various physiochemical techniques. The prepared composite exhibits excellent photocatalytic activity and stability for decolorization of methylene blue (MB) dye solution under visible light irradiation. Effect of various rate determining parameters such as catalyst loading, initial dye concentration and pH on the decolorization of MB has been analyzed. The optimum conditions for efficient color removal were found to be 7, 10 ppm and 2 g/L for pH, dye concentration and catalyst dosage respectively. The intermediate compounds formed during the decolorization process were evaluated by GCMS spectra. It was inferred that the ZnO/g-C3N4 (98.83%) composite exhibits highest decolorization efficiency as compare with pure g-C3N4 (35.21%). Such enhancement of photocataytic activity is mainly attributed to the efficient separation of photo induced electron hole pairs via Z-scheme model composed of ZnO and g-C3N4.

  6. Signature scheme based on bilinear pairs

    NASA Astrophysics Data System (ADS)

    Tong, Rui Y.; Geng, Yong J.

    2013-03-01

    An identity-based signature scheme is proposed by using bilinear pairs technology. The scheme uses user's identity information as public key such as email address, IP address, telephone number so that it erases the cost of forming and managing public key infrastructure and avoids the problem of user private generating center generating forgery signature by using CL-PKC framework to generate user's private key.

  7. Structural studies of the 5'-phenazinium-tethered matched and G-A-mismatched DNA duplexes by NMR spectroscopy.

    PubMed

    Maltseva, T; Sandström, A; Ivanova, I M; Sergeyev, D S; Zarytova, V F; Chattopadhyaya, J

    1993-05-01

    The mechanism through which modified oligo-DNA analogues act as antisense repressors at the transcriptional and translational level of gene expression is based on the information content in the nucleotide sequence which is determined by the specific base pairing. The efficiency of such action is largely determined by the stability of the duplex formed between the oligonucleotide reagent and the target sequence and also by the mismatched base pairing, such as G-A, that occurs during replication or recombination. We herein report that the phenazinium (Pzn)-tethered matched duplex p(d(TGTTTGGC)):(Pzn)-p(d(CCAAACA)) (III) (Tm = 50 degrees C) has a much larger stability than the parent matched duplex p(d(TGTTTGGC)):p(d(CCAAACA)) (I) (Tm = 30 degrees C). On the other hand, the Pzn-tethered G-A-mismatched duplex p(d(TGTTTGGC)):(Pzn)-p(d(ACAAACA)) (IV) (Tm = 34 degrees C) is only slightly more stable than its parent mismatched duplex p(d(TGTTTGGC)):p(d(ACAAACA)) (Tm = 25 degrees C). A detailed 500 MHz NMR study and constrained MD refinements of NMR-derived structures have been undertaken for the DNA duplexes (I), (II), (III) and (IV) in order to understand the structural basis of stabilization of Pzn-tethered matched DNA duplex (delta Tm = 20 degrees C) compared to mismatched duplex (delta Tm = 9 degrees C). Assignment of the 1H-NMR (500 MHz) spectra of the duplexes has been carried out by 2D NOESY, HOHAHA and DQF-COSY experiments. The torsion angles have been extracted from the J-coupling constants obtained by simulation of most of the DQF-COSY cross-peaks using program SMART. The solution structure of the duplexes were assessed by an iterative hybride relaxation matrix method (MORASS) combined with NOESY distances and torsion angles restrained molecular dynamics (MD) using program Amber 4.0. The standard Amber 4.0 force-field parameters were used for the oligonucleotide in conjunction with the new parameters for Pzn residue which was obtained by full geometry

  8. Triple helical DNA in a duplex context and base pair opening

    PubMed Central

    Esguerra, Mauricio; Nilsson, Lennart; Villa, Alessandra

    2014-01-01

    It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region. PMID:25228466

  9. Influence of annealing temperature on physical properties and photocatalytic ability of g-C3N4 nanosheets synthesized through urea polymerization in Ar atmosphere

    NASA Astrophysics Data System (ADS)

    Mai Oanh, Le Thi; Hang, Lam Thi; Lai, Ngoc Diep; Phuong, Nguyen Thi; Thang, Dao Viet; Hung, Nguyen Manh; Danh Bich, Do; Minh, Nguyen Van

    2018-03-01

    The influences of annealing temperature on structure, morphology, vibration, optical properties and photocatalytic ability of g-C3N4 nanosheets synthesized from urea in Ar atmosphere were investigated in detail by using x-ray diffraction (XRD) analysis, scanning electron microscopy (SEM), X-ray photoelectron spectroscopy (XPS), Brunauer-Emmett-Teller (BET), Fourier transform infrared spectroscopy (FTIR), UV-vis absorption, and photoluminescence (PL). It was found that the preparation temperature had a great effect on structure and physical properties of g-C3N4. As the processing temperature increased from 450 °C to 650 °C, the interlayer stacking distance of g-C3N4 decreased from 3.281 Å to 3.217 Å and the lattice parameter a decreased from 5.010 Å to 4.934 Å. This indicated a denser packing fashion of g-C3N4 at high annealing temperature. Moreover, the FTIR spectra and SEM images revealed a large fraction of small polymer segments containing only a few heptazine units as annealing temperature increased. BET result indicated an increasing specific surface area as preparation temperature increased. UV-vis absorption spectra showed a decrease of the band gap energy with increasing calcination temperature which agrees well with the measured PL spectra. It was demonstrated that samples annealed at 550 °C exhibited the strongest photocatalytic activity. A decomposition of 80% and 100% of rhodamine B was obtained within respectively 1 h and 2 h under Xenon lamp irradiation. Photocatalytic result could be adequately explained based on evidences of specific surface area, average pore volume and pore size, and recombination rate of photoinduced electron-hole pairs.

  10. Human telomeric DNA: G-quadruplex, i-motif and Watson–Crick double helix

    PubMed Central

    Phan, Anh Tuân; Mergny, Jean-Louis

    2002-01-01

    Human telomeric DNA composed of (TTAGGG/CCCTAA)n repeats may form a classical Watson–Crick double helix. Each individual strand is also prone to quadruplex formation: the G-rich strand may adopt a G-quadruplex conformation involving G-quartets whereas the C-rich strand may fold into an i-motif based on intercalated C·C+ base pairs. Using an equimolar mixture of the telomeric oligonucleotides d[AGGG(TTAGGG)3] and d[(CCCTAA)3CCCT], we defined which structures existed and which would be the predominant species under a variety of experimental conditions. Under near-physiological conditions of pH, temperature and salt concentration, telomeric DNA was predominantly in a double-helix form. However, at lower pH values or higher temperatures, the G-quadruplex and/or the i-motif efficiently competed with the duplex. We also present kinetic and thermodynamic data for duplex association and for G-quadruplex/i-motif unfolding. PMID:12409451

  11. Self-organisation of an oligodeoxynucleotide containing the G- and C-rich stretches of the direct repeats of the human mitochondrial DNA.

    PubMed

    Nonin-Lecomte, Sylvie; Dardel, Frédéric; Lestienne, Patrick

    2005-08-01

    Stretches of cytosines and guanosines have been shown in vitro to adopt non-canonical structures known as i-motifs and G-quartets, respectively. When combined, such sequences are expected to either retain their structure or form duplexes or triple helices. All these structures may occur in vivo whenever the sequence criteria are met. Such stretches are present in the circular genome of human mitochondria, as two 10 nucleotide-long perfect tandem direct repeats (DR1 and DR2). The DR1 and DR2 repeats are G-rich on the heavy strand and C-rich on the light strand. Previous results suggested that during replication, transient formation of a parallel GGC triple helix between the neo-synthesised G-rich DR1 and the double-stranded homologous DR2 could be involved in a rearrangement process leading to genome instability. In order to get structural insights into the interaction between the two repeats, we have studied by nuclear magnetic resonance (NMR) the assembly properties of a 24-mer oligodeoxyribonucleotide in which the C- and G-rich segments of the DRs are covalently tethered by a TTTT linker. We show here that this 24-mer self-associates into a triplex-containing symmetrical tetramer. The core of the structure is composed of anti-parallel Watson-Crick (WC) base pairs. Two additional strands are hydrogen-bonded to the Hoogsteen side of the Gs, thus forming CGC(+) triple helices, with G-rich ends folding into G-quartets. These results suggest that such structures could occur when the two DRs are put to close proximity in a biological context.

  12. Modified nucleotides reveal the indirect role of the central base pairs in stabilizing the lac repressor-operator complex.

    PubMed Central

    Zhang, X; Gottlieb, P A

    1995-01-01

    Guanine residues in the lac operator were replaced by 2-aminopurine or purine analogues, pairing the modified nucleotides with C. The observed equilibrium dissociation constants for lac repressor binding to substituted operators were measured in 10 mM Tris, 150 mM KCl, 0.1 mM EDTA, 0.1 mM DTE, pH 7.6 at 25 degrees C. These measurements revealed five positions that destabilized the complex when substituted with either analogue. Two positions, which are related by a 2-fold symmetry, are in the major groove of the operator thought to directly interact with the protein. Three sites were in the central region of the operator. A purine analogue at a sixth site perturbed the local DNA structure and destabilized the complex. Alkylation interference experiments of the 2-aminopurine substituted operators demonstrated that, of the five affected, two substitutions displayed altered phosphate interference patterns at the phosphate adjacent to the substituted base. For these operators, complex formation was measured in different concentrations of KCl to assess the contribution of counterion release to the bimolecular process. The results indicated that both complexes were similar to wild-type, although minor changes were observed. The Kobs of the complex was then measured when 2-aminopurine or purine analogues were paired with uracil nucleotide, a base pair that serves to stabilize the DNA. The introduction of the new base pairs revealed two effects on the bimolecular interaction. For those operator sites that are thought to perturb the interaction directly, the affinity of the complex was weakened to levels observed for the singly-substituted operators. In contrast, the nucleotides of 2-aminopurine paired with uracil positioned in the central region of the operator served to enhance the stability of the complex. The purine-uracil base pair substitution on the other hand had a significant destabilizing effect on the interaction. We propose that the central base pairs modulate

  13. Comparison of the Specificities of IgG, IgG-Subclass, IgA and IgM Reactivities in African and European HIV-Infected Individuals with an HIV-1 Clade C Proteome-Based Array

    PubMed Central

    Gallerano, Daniela; Ndlovu, Portia; Makupe, Ian; Focke-Tejkl, Margarete; Fauland, Kerstin; Wollmann, Eva; Puchhammer-Stöckl, Elisabeth; Keller, Walter; Sibanda, Elopy; Valenta, Rudolf

    2015-01-01

    A comprehensive set of recombinant proteins and peptides of the proteome of HIV-1 clade C was prepared and purified and used to measure IgG, IgG-subclass, IgA and IgM responses in HIV-infected patients from Sub-Saharan Africa, where clade C is predominant. As a comparison group, HIV-infected patients from Europe were tested. African and European patients showed an almost identical antibody reactivity profile in terms of epitope specificity and involvement of IgG, IgG subclass, IgA and IgM responses. A V3-peptide of gp120 was identified as major epitope recognized by IgG1>IgG2 = IgG4>IgG3, IgA>IgM antibodies and a C-terminal peptide represented another major peptide epitope for the four IgG subclasses. By contrast, gp41-derived-peptides were mainly recognized by IgG1 but not by the other IgG subclasses, IgA or IgM. Among the non-surface proteins, protease, reverse transcriptase+RNAseH, integrase, as well as the capsid and matrix proteins were the most frequently and strongly recognized antigens which showed broad IgG subclass and IgA reactivity. Specificities and magnitudes of antibody responses in African patients were stable during disease and antiretroviral treatment, and persisted despite severe T cell loss. Using a comprehensive panel of gp120, gp41 peptides and recombinant non-surface proteins of HIV-1 clade C we found an almost identical antibody recognition profile in African and European patients regarding epitopes and involved IgG-sublass, IgA- and IgM-responses. Immune recognition of gp120 peptides and non-surface proteins involved all four IgG subclasses and was indicative of a mixed Th1/Th2 immune response. The HIV-1 clade C proteome-based test allowed diagnosis and monitoring of antibody responses in the course of HIV-infections and assessment of isotype and subclass responses. PMID:25658330

  14. Variation in social systems within Chaetodon butterflyfishes, with special reference to pair bonding.

    PubMed

    Nowicki, Jessica P; O'Connell, Lauren A; Cowman, Peter F; Walker, Stefan P W; Coker, Darren J; Pratchett, Morgan S

    2018-01-01

    For many animals, affiliative relationships such as pair bonds form the foundation of society and are highly adaptive. Animal systems amenable for comparatively studying pair bonding are important for identifying underlying biological mechanisms, but mostly exist in mammals. Better establishing fish systems will enable comparison of pair bonding mechanisms across taxonomically distant lineages that may reveal general underlying mechanistic principles. We examined the utility of wild butterflyfishes (f: Chaetodontidae; g: Chaetodon) for comparatively studying pair bonding. Using stochastic character mapping, we provide the first analysis of the evolutionary history of butterflyfish sociality, revealing that pairing is ancestral, with at least seven independent transitions to gregarious grouping and solitary behavior since the late Miocene. We then formally verified social systems in six sympatric and wide-spread species representing a clade with one ancestrally reconstructed transition from paired to solitary grouping at Lizard Island, Australia. In situ observations of the size, selective affiliation and aggression, fidelity, and sex composition of social groups confirmed that Chaetodon baronessa, C. lunulatus, and C. vagabundus are predominantly pair bonding, whereas C. rainfordi, C. plebeius, and C. trifascialis are predominantly solitary. Even in the predominantly pair bonding species, C. lunulatus, a proportion of adults (15%) are solitary. Importantly, inter- and intra-specific differences in social systems do not co-vary with other previously established attributes, including parental care. Hence, the proposed butterflyfish populations are promising for inter- and intra-species comparative analyses of pair bonding and its mechanistic underpinnings. Avenues for further developing the system are proposed, including determining whether the aforementioned utility of these species applies across their geographic disruptions.

  15. Variation in social systems within Chaetodon butterflyfishes, with special reference to pair bonding

    PubMed Central

    O’Connell, Lauren A.; Cowman, Peter F.; Walker, Stefan P. W.; Coker, Darren J.; Pratchett, Morgan S.

    2018-01-01

    For many animals, affiliative relationships such as pair bonds form the foundation of society and are highly adaptive. Animal systems amenable for comparatively studying pair bonding are important for identifying underlying biological mechanisms, but mostly exist in mammals. Better establishing fish systems will enable comparison of pair bonding mechanisms across taxonomically distant lineages that may reveal general underlying mechanistic principles. We examined the utility of wild butterflyfishes (f: Chaetodontidae; g: Chaetodon) for comparatively studying pair bonding. Using stochastic character mapping, we provide the first analysis of the evolutionary history of butterflyfish sociality, revealing that pairing is ancestral, with at least seven independent transitions to gregarious grouping and solitary behavior since the late Miocene. We then formally verified social systems in six sympatric and wide-spread species representing a clade with one ancestrally reconstructed transition from paired to solitary grouping at Lizard Island, Australia. In situ observations of the size, selective affiliation and aggression, fidelity, and sex composition of social groups confirmed that Chaetodon baronessa, C. lunulatus, and C. vagabundus are predominantly pair bonding, whereas C. rainfordi, C. plebeius, and C. trifascialis are predominantly solitary. Even in the predominantly pair bonding species, C. lunulatus, a proportion of adults (15%) are solitary. Importantly, inter- and intra-specific differences in social systems do not co-vary with other previously established attributes, including parental care. Hence, the proposed butterflyfish populations are promising for inter- and intra-species comparative analyses of pair bonding and its mechanistic underpinnings. Avenues for further developing the system are proposed, including determining whether the aforementioned utility of these species applies across their geographic disruptions. PMID:29641529

  16. An efficient and near linear scaling pair natural orbital based local coupled cluster method.

    PubMed

    Riplinger, Christoph; Neese, Frank

    2013-01-21

    In previous publications, it was shown that an efficient local coupled cluster method with single- and double excitations can be based on the concept of pair natural orbitals (PNOs) [F. Neese, A. Hansen, and D. G. Liakos, J. Chem. Phys. 131, 064103 (2009)]. The resulting local pair natural orbital-coupled-cluster single double (LPNO-CCSD) method has since been proven to be highly reliable and efficient. For large molecules, the number of amplitudes to be determined is reduced by a factor of 10(5)-10(6) relative to a canonical CCSD calculation on the same system with the same basis set. In the original method, the PNOs were expanded in the set of canonical virtual orbitals and single excitations were not truncated. This led to a number of fifth order scaling steps that eventually rendered the method computationally expensive for large molecules (e.g., >100 atoms). In the present work, these limitations are overcome by a complete redesign of the LPNO-CCSD method. The new method is based on the combination of the concepts of PNOs and projected atomic orbitals (PAOs). Thus, each PNO is expanded in a set of PAOs that in turn belong to a given electron pair specific domain. In this way, it is possible to fully exploit locality while maintaining the extremely high compactness of the original LPNO-CCSD wavefunction. No terms are dropped from the CCSD equations and domains are chosen conservatively. The correlation energy loss due to the domains remains below <0.05%, which implies typically 15-20 but occasionally up to 30 atoms per domain on average. The new method has been given the acronym DLPNO-CCSD ("domain based LPNO-CCSD"). The method is nearly linear scaling with respect to system size. The original LPNO-CCSD method had three adjustable truncation thresholds that were chosen conservatively and do not need to be changed for actual applications. In the present treatment, no additional truncation parameters have been introduced. Any additional truncation is performed on

  17. Nanocomposite of exfoliated bentonite/g-C3N4/Ag3PO4 for enhanced visible-light photocatalytic decomposition of Rhodamine B.

    PubMed

    Ma, Jianfeng; Huang, Daiqin; Zhang, Wenyi; Zou, Jing; Kong, Yong; Zhu, Jianxi; Komarneni, Sridhar

    2016-11-01

    Novel visible-light-driven heterojunction photocatalyst comprising exfoliated bentonite, g-C3N4 and Ag3PO4 (EB/g-C3N4/Ag3PO4) was synthesized by a facile and green method. The composites EB/g-C3N4/Ag3PO4 were characterized by X-ray diffraction, Transmission electron microscopy, Fourier transform infrared spectroscopy, UV-Vis diffuse reflectance spectroscopy and the Brunauer, Emmett, and Teller (BET) surface area method. Under visible light irradiation, EB/g-C3N4/Ag3PO4 composites displayed much higher photocatalytic activity than that of either pure g-C3N4 or pure Ag3PO4 in the degradation of Rhodamine B (RhB). Among the hybrid photocatalysts, EB/g-C3N4/Ag3PO4 composite containing 20 wt% Ag3PO4 exhibited the highest photocatalytic activity for the decolorization of RhB. Under the visible-light irradiation, the RhB dye was completely decolorized in less than 60 min. The enhanced photocatalytic performance is attributed to the stable structure, enlarged surface area, strong adsorbability, strong light absorption ability, and high-efficiency separation rate of photoinduced electron-hole pairs. Our finding paves a way to design highly efficient and stable visible-light-induced photocatalysts for practical applications in wastewater treatment. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Hemolysis and Mediterranean G6PD mutation (c.563 C>T) and c.1311 C>T polymorphism among Palestinians at Gaza Strip.

    PubMed

    Sirdah, Mahmoud; Reading, N Scott; Perkins, Sherrie L; Shubair, Mohammad; Aboud, Lina; Prchal, Josef T

    2012-04-15

    The G6PD c.563 C>T deficient mutation is endemic among Mediterranean populations but its clinical significance is not well delineated. We set up to estimate the proportion of G6PD deficient children presenting with hemolytic anemia at Al Nasser Pediatric Hospital at Gaza Strip, Palestine. We then established the prevalence of c.563T Mediterranean mutation and its linkage to c.1311 C>T polymorphism in this population. G6PD deficiency was identified in children presenting with hemolytic anemia at Al Nasser Pediatric Hospital by spectrophotometric measurement of G6PD activity. G6PD exon 6 and exon 11 were amplified from genomic DNA and evaluated for c.563T mutation by sequencing and the c.1311T polymorphism by restriction fragment analysis. Seventy X-chromosomes (60 males and 5 females) from G6PD deficient patients and 40 X-chromosomes from a control group known to be not G6PD deficient were tested. Over 80% of these children presenting with hemolytic anemia were G6PD deficient and 34% of these had the Mediterranean G6PD deficient variant. The allelic frequencies of Mediterranean c.563T and c.1311T polymorphisms among G6PD deficient patients were 0.33 and 0.38 respectively. The c.1311T polymorphism was linked in 95.2% of patients with the Mediterranean mutation, an allele frequency of 0.87, compared to the control non-G6PD deficient group with an allele frequency of 0.18. We conclude that G6PD deficiency accounts for majority of hemolytic anemia encountered in Gaza children treated at Al Nasser Pediatric Hospital Emergency department. The Mediterranean mutation c.563T, while not accounting for a majority of G6PD deficiency, is common among G6PD deficient Gaza Strip Palestinians and is frequently, but not always, linked to the c.1311T polymorphism. This work provides a foundation for the population screening of Palestinians for G6PD deficiency and for investigations of ancestral origin of the Mediterranean variant in world populations. Copyright © 2012 Elsevier Inc

  19. Understanding Fomalhaut as a Cooper pair

    NASA Astrophysics Data System (ADS)

    Feng, F.; Jones, H. R. A.

    2018-03-01

    Fomalhaut is a nearby stellar system and has been found to be a triple based on astrometric observations. With new radial velocity and astrometric data, we study the association between Fomalhaut A, B, and C in a Bayesian framework, finding that the system is gravitationally bound or at least associated. Based on simulations of the system, we find that Fomalhaut C can be easily destabilized through combined perturbations from the Galactic tide and stellar encounters. Considering that observing the disruption of a triple is probably rare in the solar neighbourhood, we conclude that Fomalhaut C is a so-called `gravitational pair' of Fomalhaut A and B. Like the Cooper pair mechanism in superconductors, this phenomenon only appears once the orbital energy of a component becomes comparable with the energy fluctuations caused by the environment. Based on our simulations, we find (1) an upper limit of 8 km s-1 velocity difference is appropriate when selecting binary candidates, and (2) an empirical formula for the escape radius, which is more appropriate than tidal radius when measuring the stability of wide binaries.

  20. NMR solution structure of an N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: Intercalation from the minor groove with ruptured Watson-Crick base pairing

    PubMed Central

    Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H.; Cai, Yuqin; Rodriguez, Fabian A.; Sayer, Jane M.; Jerina, Donald M.; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.

    2012-01-01

    The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the non-planar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely-studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14-position with the exocyclic amino group of guanine. Here, we present the first NMR solution structure of a DB[a,l]P-derived adduct, the 14R (+)-trans-anti-DB[a,l]P–N2-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N2-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3’-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3’-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE - DNA adduct conformation differs from: (1) the classical intercalation motif where Watson-Crick base-pairing is intact at the lesion site, and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix . The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed. PMID:23121427

  1. Inhibiting Polysulfide Shuttle in Lithium-Sulfur Batteries through Low-Ion-Pairing Salts and a Triflamide Solvent.

    PubMed

    Shyamsunder, Abhinandan; Beichel, Witali; Klose, Petra; Pang, Quan; Scherer, Harald; Hoffmann, Anke; Murphy, Graham K; Krossing, Ingo; Nazar, Linda F

    2017-05-22

    The step-change in gravimetric energy density needed for electrochemical energy storage devices to power unmanned autonomous vehicles, electric vehicles, and enable low-cost clean grid storage is unlikely to be provided by conventional lithium ion batteries. Lithium-sulfur batteries comprising lightweight elements provide a promising alternative, but the associated polysulfide shuttle in typical ether-based electrolytes generates loss in capacity and low coulombic efficiency. The first new electrolyte based on a unique combination of a relatively hydrophobic sulfonamide solvent and a low ion-pairing salt, which inhibits the polysulfide shuttle, is presented. This system behaves as a sparingly solvating electrolyte at slightly elevated temperatures, where it sustains reversible capacities as high as 1200-1500 mAh g -1 over a wide range of current density (2C-C/5, respectively) when paired with a lithium metal anode, with a coulombic efficiency of >99.7 % in the absence of LiNO 3 additive. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Molecular dynamics study of some non-hydrogen-bonding base pair DNA strands

    NASA Astrophysics Data System (ADS)

    Tiwari, Rakesh K.; Ojha, Rajendra P.; Tiwari, Gargi; Pandey, Vishnudatt; Mall, Vijaysree

    2018-05-01

    In order to elucidate the structural activity of hydrophobic modified DNA, the DMMO2-D5SICS, base pair is introduced as a constituent in different set of 12-mer and 14-mer DNA sequences for the molecular dynamics (MD) simulation in explicit water solvent. AMBER 14 force field was employed for each set of duplex during the 200ns production-dynamics simulation in orthogonal-box-water solvent by the Particle-Mesh-Ewald (PME) method in infinite periodic boundary conditions (PBC) to determine conformational parameters of the complex. The force-field parameters of modified base-pair were calculated by Gaussian-code using Hartree-Fock /ab-initio methodology. RMSD Results reveal that the conformation of the duplex is sequence dependent and the binding energy of the complex depends on the position of the modified base-pair in the nucleic acid strand. We found that non-bonding energy had a significant contribution to stabilising such type of duplex in comparison to electrostatic energy. The distortion produced within strands by such type of base-pair was local and destabilised the duplex integrity near to substitution, moreover the binding energy of duplex depends on the position of substitution of hydrophobic base-pair and the DNA sequence and strongly supports the corresponding experimental study.

  3. Development of a novel method to determine the concentration of heavy metal cations: application of the specific interaction between heavy metal cation and mismatch DNA base pair.

    PubMed

    Kozasa, Tetsuo; Miyakawa, Yukako; Fukushi, Miyako; Ono, Akira; Torigoe, Hidetaka

    2009-01-01

    We have already found that Hg(II) cation specifically binds to T:T mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving T:T mismatch base pair by about 4 degrees C. We have also found that Ag(I) cation specifically binds to C:C mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving C:C mismatch base pair by about 4 degrees C. Using the specific interaction, we developed a novel sensor to determine the concentration of each of Hg(II) and Ag(I) cation. The sensor is composed of a dye-labelled T-rich or C-rich DNA oligonucleotide, F2T6W2D: 5'-Fam-T(2)CT(2)CT(2)C(4)T(2)GT(2)GT(2)-Dabcyl-3' or F2C6W2D: 5'-Fam-C(2)TC(2)TC(2)T(4)C(2)AC(2)AC(2)-Dabcyl-3', where 6-carboxyfluorescein (Fam) is a fluorophore and Dabcyl is a quencher. The addition of Hg(II) cation decreased the intensity of Fam emission of F2T6W2D at 520 nm in a concentration-dependent manner. Also, the addition of Ag(I) cation decreased the intensity of Fam emission of F2C6W2D at 520 nm in a concentration-dependent manner. We conclude that, using the novel sensor developed in this study, the concentration of each of Hg(II) and Ag(I) cation can be determined from the intensity of Fam emission at 520 nm.

  4. Compound Heterozygosity for Hb Alperton (HBB: c.407C>T) and IVS-I-5 (G>C) (HBB: c.92+5G>C) Mutations Presenting as a Moderate Anemia in an Indian Family.

    PubMed

    Godbole, Koumudi G; Ramachandran, Angelina; Karkamkar, Ashwini S; Dalal, Ashwin B

    2018-04-13

    While knowledge of HBB gene mutations is necessary for offering prenatal diagnosis (PND) of β-thalassemia (β-thal), a genotype-phenotype correlation may not always be available for rare variants. We present for the first time, genotype-phenotype correlation for a compound heterozygous status with IVS-I-5 (G>C) (HBB: c.92+5G>C) and HBB: c.407C>T (Hb Alperton) mutations on the HBB gene in an Indian family. Hb Alperton is a very rare hemoglobin (Hb) variant with scant published information about its clinical presentation, especially when accompanied with another HBB gene mutation. Here we provide biochemical as well as clinical details of this variant.

  5. The use of molecular dynamics simulations to evaluate the DNA sequence-selectivity of G-A cross-linking PBD-duocarmycin dimers.

    PubMed

    Jackson, Paul J M; Rahman, Khondaker M; Thurston, David E

    2017-01-01

    The pyrrolobenzodiazepine (PBD) and duocarmycin families are DNA-interactive agents that covalently bond to guanine (G) and adenine (A) bases, respectively, and that have been joined together to create synthetic dimers capable of cross-linking G-G, A-A, and G-A bases. Three G-A alkylating dimers have been reported in publications to date, with defined DNA-binding sites proposed for two of them. In this study we have used molecular dynamics simulations to elucidate preferred DNA-binding sites for the three published molecular types. For the PBD-CPI dimer UTA-6026 (1), our simulations correctly predicted its favoured binding site (i.e., 5'-C(G)AATTA-3') as identified by DNA cleavage studies. However, for the PBD-CI molecule ('Compound 11', 3), we were unable to reconcile the results of our simulations with the reported preferred cross-linking sequence (5'-ATTTTCC(G)-3'). We found that the molecule is too short to span the five base pairs between the A and G bases as claimed, but should target instead a sequence such as 5'-ATTTC(G)-3' with two less base pairs between the reacting G and A residues. Our simulation results for this hybrid dimer are also in accord with the very low interstrand cross-linking and in vitro cytotoxicity activities reported for it. Although a preferred cross-linking sequence was not reported for the third hybrid dimer ('27eS', 2), our simulations predict that it should span two base pairs between covalently reacting G and A bases (e.g., 5'-GTAT(A)-3'). Copyright © 2016. Published by Elsevier Ltd.

  6. An ingenious strategy of preparing TiO2/g-C3N4 heterojunction photocatalyst: In situ growth of TiO2 nanocrystals on g-C3N4 nanosheets via impregnation-calcination method

    NASA Astrophysics Data System (ADS)

    Zhang, Guanghui; Zhang, Tianyong; Li, Bin; Jiang, Shuang; Zhang, Xia; Hai, Li; Chen, Xingwei; Wu, Wubin

    2018-03-01

    An ingenious method was employed to design and fabricate the TiO2/g-C3N4 heterojunction photocatalysts in this study. The thermal oxidation etching of g-C3N4 nanosheets and the in situ growth of TiO2 nanocrystal on the surface of g-C3N4 nanosheets were completed simultaneously by the calcination process. The g-C3N4 nanosheets played a crucial role in regulating and assembling the structures and morphologies of TiO2. Furthermore, the thickness and content of g-C3N4, and the crystallinity of TiO2 in TiO2/g-C3N4 composites could be regulated and controlled by the calcination temperature. Among the resultant TiO2/g-C3N4 samples, the TiO2/g-C3N4 sample with 41.6 wt% g-C3N4 exhibited the highest photocatalytic activity. It could degrade almost all MO molecules under visible light irradiation within 3 h. Moreover, it displayed higher visible light photocatalytic performance for degrading MO solution than pure g-C3N4 and D-TiO2. The synergistic effect between TiO2 and g-C3N4 makes significant contributions to the enhancement of the visible light photocatalytic activity. In addition, the favorable photocatalytic performance of TiO2/g-C3N4 nanocomposites is also attributed to the porous structures and uniform morphologies, and large surface area. Furthermore, the resultant TiO2/g-C3N4 exhibits excellent photocatalytic stability. Radical trapping experiments indicated that rad O2- and h+ were the main reactive species during the photodegradation process under visible light irradiation. Hopefully, the results can offer new design and strategy for preparing other g-C3N4-based nanocomposites for environmental and energy applications.

  7. A fully synthetic human Fab antibody library based on fixed VH/VL framework pairings with favorable biophysical properties

    PubMed Central

    Tiller, Thomas; Schuster, Ingrid; Deppe, Dorothée; Siegers, Katja; Strohner, Ralf; Herrmann, Tanja; Berenguer, Marion; Poujol, Dominique; Stehle, Jennifer; Stark, Yvonne; Heßling, Martin; Daubert, Daniela; Felderer, Karin; Kaden, Stefan; Kölln, Johanna; Enzelberger, Markus; Urlinger, Stefanie

    2013-01-01

    This report describes the design, generation and testing of Ylanthia, a fully synthetic human Fab antibody library with 1.3E+11 clones. Ylanthia comprises 36 fixed immunoglobulin (Ig) variable heavy (VH)/variable light (VL) chain pairs, which cover a broad range of canonical complementarity-determining region (CDR) structures. The variable Ig heavy and Ig light (VH/VL) chain pairs were selected for biophysical characteristics favorable to manufacturing and development. The selection process included multiple parameters, e.g., assessment of protein expression yield, thermal stability and aggregation propensity in fragment antigen binding (Fab) and IgG1 formats, and relative Fab display rate on phage. The framework regions are fixed and the diversified CDRs were designed based on a systematic analysis of a large set of rearranged human antibody sequences. Care was taken to minimize the occurrence of potential posttranslational modification sites within the CDRs. Phage selection was performed against various antigens and unique antibodies with excellent biophysical properties were isolated. Our results confirm that quality can be built into an antibody library by prudent selection of unmodified, fully human VH/VL pairs as scaffolds. PMID:23571156

  8. Designed Synthesis of Mesoporous Solid-Supported Lewis Acid-Base Pairs and Their CO2 Adsorption Behaviors.

    PubMed

    Zakharova, Maria V; Masoumifard, Nima; Hu, Yimu; Han, Jongho; Kleitz, Freddy; Fontaine, Frédéric-Georges

    2018-04-18

    Conventional amines and phosphines, such as diethylenetriamine, diphenylpropylphosphine, triethylamine, and tetramethylpiperidine, were grafted or impregnated on the surface of metalated SBA-15 materials, such as Ti-, Al-, and Zr-SBA-15, to generate air-stable solid-supported Lewis acid-base pairs. The Lewis acidity of the metalated materials before and after the introduction of Lewis bases was verified by means of pyridine adsorption-Fourier transform infrared spectroscopy. Detailed characterization of the materials was achieved by solid-state 13 C and 31 P MAS NMR spectroscopy, low-temperature N 2 physisorption, X-ray photoelectron spectroscopy, and energy-dispersive X-ray mapping analyses. Study of their potential interactions with CO 2 was performed using CO 2 adsorption isotherm experiments, which provided new insights into their applicability as solid CO 2 adsorbents. A correlation between solid-supported Lewis acid-base pair strength and the resulting affinity to CO 2 is discussed based on the calculation of isosteric enthalpy of adsorption.

  9. 40 CFR Appendixes C-G to Part 80 - [Reserved

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 16 2011-07-01 2011-07-01 false [Reserved] C Appendixes C-G to Part 80 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) REGULATION OF FUELS AND FUEL ADDITIVES Appendixes C-G to Part 80 [Reserved] ...

  10. 40 CFR Appendixes C-G to Part 80 - [Reserved

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 16 2010-07-01 2010-07-01 false [Reserved] C Appendixes C-G to Part 80 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) REGULATION OF FUELS AND FUEL ADDITIVES Appendixes C-G to Part 80 [Reserved] ...

  11. Association of COX-2 Promoter Polymorphisms -765G/C and -1195A/G with Migraine.

    PubMed

    Mozaffari, Elahe; Doosti, Abbas; Arshi, Asghar; Faghani, Mostafa

    2016-12-01

    Migraine is a common debilitating primary headache disorder with current head pain attacks, which contributes to physical activity dysfunctions in chronic pain phase. PGE2 and PGI2 are two important prostaglandins synthesised by COX-2 enzymes, involved in migraine pain signals. COX-2 modulation is essential in treatment and pathogenesis of migraine. This study aimed to investigating the association between COX-2 gene polymorphisms with the risk of migraine susceptibility in migraine patients with related and unrelated parents. This case- control study was based on 100 migraine patients and 100 non-migraine subjects in Bushehr province, Iran in 2013. Genomic DNA of blood samples was extracted and genotyping of COX-2-765G>C (rs20417) and COX-2-1195A>G (rs689466) gene variants was investigated by PCR-RFLP method. Statistical analyses were accomplished using the SPSS software package. There was a significant differences in the frequencies of the COX-2-765G>C and COX-2-1195A>G genotypes between migraine patients and controls ( P ≤0.05). COX-2-765CC , COX-2-765CG , COX-2-1195GG and COX-2-1195AG genotypes can increase the risk of migraine significantly. As the first study in Iran, we are hopeful to achieve greater results about the relevancy of COX-2 gene, migraine and pain signals pathway by repeating these experiments on more samples.

  12. PAIRS, The GIS-Based Incident Response System for Pennsylvania, and NASA

    NASA Technical Reports Server (NTRS)

    Conrad, Eric; Arbegast, Daniel; Maynard, Nancy; Vicente, Gilberto

    2003-01-01

    Over the past several years the Pennsylvania Departments of Environmental Protection (DEP), Health (DOH), and Agriculture (PDA) built the GIs-based Pennsylvania West Nile Surveillance System. That system has become a model for collecting data that has a field component, laboratory component, reporting and mapping component, and a public information component. Given the success of the West Nile Virus System and the events of September 11, 2001, DEP then embarked on the development of the Pennsylvania Incident Response System, or PAIRS. PAIRS is an effective GIs-based approach to providing a system for response to incidents of any kind, including terrorism because it is building upon the existing experience, infrastructure and databases that were successfully developed to respond to the West Nile Virus by DEP, DOH, and PDA. The proposed system can be described as one that supports data acquisition, laboratory forensics, decision making/response, and communications. Decision makers will have tools to view and analyze data from various sources and, at the same time, to communicate with the large numbers of people responding to the same incident. Recent collaborations with NASA partners are creating mechanisms for the PAIRS system to incorporate space-based and other remote sensing geophysical parameters relevant to public health assessment and management, such as surface temperatures, precipitation, land cover/land use change, and humidity. This presentation will describe the PAIRS system and outline the Pennsylvania-NASA collaboration for integration of space-based data into the PAIRS system.

  13. Developing Topological Insulator Fiber Based Photon Pairs Source for Ultrafast Optoelectronic Applications

    DTIC Science & Technology

    2016-04-01

    DEVELOPING TOPOLOGICAL INSULATOR FIBER BASED PHOTON PAIRS SOURCE FOR ULTRAFAST OPTOELECTRONIC APPLICATIONS NORTHWESTERN UNIVERSITY...REPORT TYPE FINAL TECHNICAL REPORT 3. DATES COVERED (From - To) APRIL 2015 – DEC 2015 4. TITLE AND SUBTITLE DEVELOPING TOPOLOGICAL INSULATOR FIBER BASED...in developing a new source for the production of correlated/entangled photon pairs based on the unique nanolayer properties of topological insulator

  14. 21 CFR 522.1696c - Penicillin G procaine in oil.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 6 2012-04-01 2012-04-01 false Penicillin G procaine in oil. 522.1696c Section... § 522.1696c Penicillin G procaine in oil. (a) Specifications. Each milliliter contains penicillin G procaine equivalent to 300,000 units of penicillin G. (b) Sponsor. See No. 053501 in § 510.600(c) of this...

  15. 21 CFR 522.1696c - Penicillin G procaine in oil.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 6 2014-04-01 2014-04-01 false Penicillin G procaine in oil. 522.1696c Section... § 522.1696c Penicillin G procaine in oil. (a) Specifications. Each milliliter contains penicillin G procaine equivalent to 300,000 units of penicillin G. (b) Sponsor. See No. 054771 in § 510.600(c) of this...

  16. 21 CFR 522.1696c - Penicillin G procaine in oil.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Penicillin G procaine in oil. 522.1696c Section... § 522.1696c Penicillin G procaine in oil. (a) Specifications. Each milliliter contains penicillin G procaine equivalent to 300,000 units of penicillin G. (b) Sponsor. See No. 053501 in § 510.600(c) of this...

  17. 21 CFR 522.1696c - Penicillin G procaine in oil.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Penicillin G procaine in oil. 522.1696c Section... § 522.1696c Penicillin G procaine in oil. (a) Specifications. Each milliliter contains penicillin G procaine equivalent to 300,000 units of penicillin G. (b) Sponsor. See No. 053501 in § 510.600(c) of this...

  18. 21 CFR 522.1696c - Penicillin G procaine in oil.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 6 2011-04-01 2011-04-01 false Penicillin G procaine in oil. 522.1696c Section... § 522.1696c Penicillin G procaine in oil. (a) Specifications. Each milliliter contains penicillin G procaine equivalent to 300,000 units of penicillin G. (b) Sponsor. See No. 053501 in § 510.600(c) of this...

  19. The carriers of the A/G-G/G allelic combination of the c.2039 A>G and c.-29 G>A FSH receptor polymorphisms retrieve the highest number of oocytes in IVF/ICSI cycles.

    PubMed

    Allegra, Adolfo; Marino, Angelo; Raimondo, Stefania; Maiorana, Antonio; Gullo, Salvatore; Scaglione, Piero; Volpes, Aldo; Alessandro, Riccardo

    2017-02-01

    The objective of this study was the elucidation of the possible role of the single-nucleotide polymorphisms (SNP) at position -29 and 2039 of the FSH receptor gene (FSHR) as independent predictive markers of ovarian response. Indeed, the tailoring of reproductive treatments is crucial for both maximizing the success of IVF patients and obtaining a reduction in hypo- or hyper-response rates. This prospective, observational study analyzed the association of -29 and 2039 FSHR polymorphisms with the number of retrieved oocytes in 140 patients attending an IVF/ICSI cycle for severe male factors (≤5,000,000 spermatozoa/mL) or tubal factors at the ANDROS Day Surgery Clinic, Palermo, Italy. The results of this study demonstrate that the genetic combination of A/G for polymorphism c.2039 A>G with G/G for polymorphism c.-29 G>A is significantly associated with the highest number of collected oocytes (p = 0.03). This association was significant even after controlling for the effect of other clinical variables. The A/G-G/G allelic variant, identified as an independent variable, if confirmed in a larger number of patients, could be considered as a new genetic biomarker, which could increase the efficacy of prediction models for ovarian stimulation.

  20. A double chain reversal loop and two diagonal loops define the architecture of a unimolecular DNA quadruplex containing a pair of stacked G(syn)-G(syn)-G(anti)-G(anti) tetrads flanked by a G-(T-T) Triad and a T-T-T triple.

    PubMed

    Kuryavyi, V; Majumdar, A; Shallop, A; Chernichenko, N; Skripkin, E; Jones, R; Patel, D J

    2001-06-29

    The architecture of G-G-G-G tetrad-aligned DNA quadruplexes in monovalent cation solution is dependent on the directionality of the four strands, which in turn are defined by loop connectivities and the guanine syn/anti distribution along individual strands and within individual G-G-G-G tetrads. The smallest unimolecular G-quadruplex belongs to the d(G2NnG2NnG2NnG2) family, which has the potential to form two stacked G-tetrads linked by Nn loop connectivities. Previous studies have focused on the thrombin-binding DNA aptamer d(G2T2G2TGTG2T2G2), where Nn was T2 for the first and third connecting loops and TGT for the middle connecting loop. This DNA aptamer in K(+) cation solution forms a unimolecular G-quadruplex stabilized by two stacked G(syn)-G(anti)-G(syn)-G(anti) tetrads, adjacent strands which are antiparallel to each other and edge-wise connecting T2, TGT and T2 loops. We now report on the NMR-based solution structure of the d(G2T4G2CAG2GT4G2T) sequence, which differs from the thrombin-binding DNA aptamer sequence in having longer first (T4) and third (GT4) loops and a shorter (CA) middle loop. This d(G2T4G2CAG2GT4G2T) sequence in Na(+) cation solution forms a unimolecular G-quadruplex stabilized by two stacked G(syn)-G(syn)-G(anti)-G(anti) tetrads, adjacent strands which have one parallel and one antiparallel neighbors and distinct non-edge-wise loop connectivities. Specifically, the longer first (T4) and third (GT4) loops are of the diagonal type while the shorter middle loop is of the double chain reversal type. In addition, the pair of stacked G-G-G-G tetrads are flanked on one side by a G-(T-T) triad and on the other side by a T-T-T triple. The distinct differences in strand directionalities, loop connectivities and syn/anti distribution within G-G-G-G tetrads between the thrombin-binding DNA aptamer d(G2T2G2TGTG2T2G2) quadruplex reported previously, and the d(G2T4G2CAG2GT4G2T) quadruplex reported here, reinforces the polymorphic nature of higher

  1. Isoguanine and 5-Methyl-Isocytosine Bases, In Vitro and In Vivo

    PubMed Central

    Bande, Omprakash; Abu El Asrar, Rania; Braddick, Darren; Dumbre, Shrinivas; Pezo, Valérie; Schepers, Guy; Pinheiro, Vitor B; Lescrinier, Eveline; Holliger, Philipp; Marlière, Philippe; Herdewijn, Piet

    2015-01-01

    The synthesis, base-pairing properties and in vitro and in vivo characteristics of 5-methyl-isocytosine (isoCMe) and isoguanine (isoG) nucleosides, incorporated in an HNA(h) (hexitol nucleic acid)–DNA(d) mosaic backbone, are described. The required h-isoG phosphoramidite was prepared by a selective deamination as a key step. As demonstrated by Tm measurements the hexitol sugar showed slightly better mismatch discrimination against dT. The d-isoG base mispairing follows the order T>G>C while the h-isoG base mispairing follows the order G>C>T. The h- and d-isoCMe bases mainly mispair with G. Enzymatic incorporation experiments show that the hexitol backbone has a variable effect on selectivity. In the enzymatic assays, isoG misincorporates mainly with T, and isoCMe misincorporates mainly with A. Further analysis in vivo confirmed the patterns of base-pair interpretation for the deoxyribose and hexitol isoCMe/isoG bases in a cellular context, through incorporation of the bases into plasmidic DNA. Results in vivo demonstrated that mispairing and misincorporation was dependent on the backbone scaffold of the base, which indicates rational advances towards orthogonality. PMID:25684598

  2. Wobble pairs of the HDV ribozyme play specific roles in stabilization of active site dynamics.

    PubMed

    Sripathi, Kamali N; Banáš, Pavel; Réblová, Kamila; Šponer, Jiří; Otyepka, Michal; Walter, Nils G

    2015-02-28

    The hepatitis delta virus (HDV) is the only known human pathogen whose genome contains a catalytic RNA motif (ribozyme). The overall architecture of the HDV ribozyme is that of a double-nested pseudoknot, with two GU pairs flanking the active site. Although extensive studies have shown that mutation of either wobble results in decreased catalytic activity, little work has focused on linking these mutations to specific structural effects on catalytic fitness. Here we use molecular dynamics simulations based on an activated structure to probe the active site dynamics as a result of wobble pair mutations. In both wild-type and mutant ribozymes, the in-line fitness of the active site (as a measure of catalytic proficiency) strongly depends on the presence of a C75(N3H3+)N1(O5') hydrogen bond, which positions C75 as the general acid for the reaction. Our mutational analyses show that each GU wobble supports catalytically fit conformations in distinct ways; the reverse G25U20 wobble promotes high in-line fitness, high occupancy of the C75(N3H3+)G1(O5') general-acid hydrogen bond and stabilization of the G1U37 wobble, while the G1U37 wobble acts more locally by stabilizing high in-line fitness and the C75(N3H3+)G1(O5') hydrogen bond. We also find that stable type I A-minor and P1.1 hydrogen bonding above and below the active site, respectively, prevent local structural disorder from spreading and disrupting global conformation. Taken together, our results define specific, often redundant architectural roles for several structural motifs of the HDV ribozyme active site, expanding the known roles of these motifs within all HDV-like ribozymes and other structured RNAs.

  3. Wobble Pairs of the HDV Ribozyme Play Specific Roles in Stabilization of Active Site Dynamics

    PubMed Central

    Sripathi, Kamali N.; Banáš, Pavel; Reblova, Kamila; Šponer, Jiři; Otyepka, Michal

    2015-01-01

    The hepatitis delta virus (HDV) is the only known human pathogen whose genome contains a catalytic RNA motif (ribozyme). The overall architecture of the HDV ribozyme is that of a double-nested pseudoknot, with two GU pairs flanking the active site. Although extensive studies have shown that mutation of either wobble results in decreased catalytic activity, little work has focused on linking these mutations to specific structural effects on catalytic fitness. Here we use molecular dynamics simulations based on an activated structure to probe the active site dynamics as a result of wobble pair mutations. In both wild-type and mutant ribozymes, the in-line fitness of the active site (as a measure of catalytic proficiency) strongly depends on the presence of a C75(N3H3+)N1(O5′) hydrogen bond, which positions C75 as the general acid for the reaction. Our mutational analyses show that each GU wobble supports catalytically fit conformations in distinct ways; the reverse G25U20 wobble promotes high in-line fitness, high occupancy of the C75(N3H3+)G1(O5′) general-acid hydrogen bond and stabilization of the G1U37 wobble, while the G1U37 wobble acts more locally by stabilizing high in-line fitness and the C75(N3H3+)G1(O5′) hydrogen bond. We also find that stable type I A-minor and P1.1 hydrogen bonding above and below the active site, respectively, prevent local structural disorder from spreading and disrupting global conformation. Taken together, our results define specific, often redundant architectural roles for several structural motifs of the HDV ribozyme active site, expanding the known roles of these motifs within all HDV-like ribozymes and other structured RNAs. PMID:25631765

  4. Self-assembled hierarchical carbon/g-C3N4 composite with high photocatalytic activity

    NASA Astrophysics Data System (ADS)

    Huang, Ru-Long; Huang, Wei-Qing; Li, Dong-Feng; Ma, Li-Li; Pan, Anlian; Hu, Wangyu; Fan, Xiaoxing; Huang, Gui-Fang

    2018-04-01

    Hierarchical carbon/g-C3N4 composites consisting of nanosheets are synthesized by a direct thermal diffusion and exfoliation approach with glucose acting as the intercalator and carbon source. This facile protocol not only renders nanosheets with a large surface area, but also carbon intercalation into the interlayer of g-C3N4. Therefore, the synthesized carbon/g-C3N4 composites exhibit superior photocatalytic performance for degrading representative methylene blue (MB) under visible light irradiatuon. Carbon/g-C3N4 composites with an optimal glucose mass ratio of 0.25% show the apparent reaction rate constant of 0.253 h-1, which is 9 times higher than that over bluk g-C3N4. The superior photocatalytic performance of carbon/g-C3N4 hierarchical architectures can be attributed to the synergic effects of large reactive sites, effective visible light adsorption and faster charge transfer owing to the superior electron transfer ability of carbon as verified by the PL and photoelectrochemical measurements. The main reactive species responsible for the photocatalytic degradation are photoinduced holes and ·OH radicals under visible light irradiation. This work provides a facile way to fabricate effecient g-C3N4-based photocatalysts for the potential application in dealing with environmental and energy shortage issues using solar energy.

  5. Carbazole ligands as c-myc G-quadruplex binders.

    PubMed

    Głuszyńska, Agata; Juskowiak, Bernard; Kuta-Siejkowska, Martyna; Hoffmann, Marcin; Haider, Shozeb

    2018-07-15

    The interactions of c-myc G-quadruplex with three carbazole derivatives were investigated by UV-Vis spectrophotometry, fluorescence, CD spectroscopy, and molecular modeling. The results showed that a combination of carbazole scaffold functionalized with ethyl, triazole and imidazole groups resulted in stabilization of the intramolecular G-quadruplex formed by the DNA sequence derived from the NHE III 1 region of c-myc oncogene (Pu22). Binding to the G-quadruplex Pu22 resulted in the significant increase in fluorescence intensity of complexed ligands 1-3. All ligands were capable of interacting with G4 DNA with binding stoichiometry indicating that two ligand molecules bind to G-quadruplex with comparable affinity, which agrees with binding model of end-stacking on terminal G-tetrads. Copyright © 2018 Elsevier B.V. All rights reserved.

  6. High-precision measurement of the electron spin g factor of trapped atomic nitrogen in the endohedral fullerene N@C60

    NASA Astrophysics Data System (ADS)

    Wittmann, J. J.; Can, T. V.; Eckardt, M.; Harneit, W.; Griffin, R. G.; Corzilius, B.

    2018-05-01

    The electronic g factor carries highly useful information about the electronic structure of a paramagnetic species, such as spin-orbit coupling and dia- or paramagnetic (de-)shielding due to local fields of surrounding electron pairs. However, in many cases, a near "spin-only" case is observed, in particular for light elements, necessitating accurate and precise measurement of the g factors. Such measurement is typically impeded by a "chicken and egg situation": internal or external reference standards are used for relative comparison of electron paramagnetic resonance (EPR) Larmor frequencies. However, the g factor of the standard itself usually is subject to a significant uncertainty which directly limits the precision and/or accuracy of the sought after sample g factor. Here, we apply an EPR reference-free approach for determining the g factor of atomic nitrogen trapped within the endohedral fullerene C60:N@C60 in its polycrystalline state by measuring the 1H NMR resonance frequency of dispersing toluene at room temperature. We found a value of g = 2.00204 (4) with a finally reached relative precision of ∼20 ppm. This accurate measurement allows us to directly compare the electronic properties of N@C60 to those found in atomic nitrogen in the gas phase or trapped in other solid matrices at liquid helium temperature. We conclude that spin-orbit coupling in N@C60 at room temperature is very similar in magnitude and of same sign as found in other inert solid matrices and that interactions between the quartet spin system and the C60 molecular orbitals are thus negligible.

  7. Intermolecular G-quadruplex structure-based fluorescent DNA detection system.

    PubMed

    Zhou, Hui; Wu, Zai-Sheng; Shen, Guo-Li; Yu, Ru-Qin

    2013-03-15

    Adopting multi-donors to pair with one acceptor could improve the performance of fluorogenic detection probes. However, common dyes (e.g., fluorescein) in close proximity to each other would self-quench the fluorescence, and the fluorescence is difficult to restore. In this contribution, we constructed a novel "multi-donors-to-one acceptor" fluorescent DNA detection system by means of the intermolecular G-quadruplex (IGQ) structure-based fluorescence signal enhancement combined with the hairpin oligonucleotide. The novel IGQ-hairpin system was characterized using the p53 gene as the model target DNA. The proposed system showed an improved assay performance due to the introduction of IGQ-structure into fluorescent signaling probes, which could inhibit the background fluorescence and increase fluorescence restoration amplitude of fluoresceins upon target DNA hybridization. The proof-of-concept scheme is expected to provide new insight into the potential of G-quadruplex structure and promote the application of fluorescent oligonucleotide probes in fundamental research, diagnosis, and treatment of genetic diseases. Copyright © 2012 Elsevier B.V. All rights reserved.

  8. Robust prediction of consensus secondary structures using averaged base pairing probability matrices.

    PubMed

    Kiryu, Hisanori; Kin, Taishin; Asai, Kiyoshi

    2007-02-15

    Recent transcriptomic studies have revealed the existence of a considerable number of non-protein-coding RNA transcripts in higher eukaryotic cells. To investigate the functional roles of these transcripts, it is of great interest to find conserved secondary structures from multiple alignments on a genomic scale. Since multiple alignments are often created using alignment programs that neglect the special conservation patterns of RNA secondary structures for computational efficiency, alignment failures can cause potential risks of overlooking conserved stem structures. We investigated the dependence of the accuracy of secondary structure prediction on the quality of alignments. We compared three algorithms that maximize the expected accuracy of secondary structures as well as other frequently used algorithms. We found that one of our algorithms, called McCaskill-MEA, was more robust against alignment failures than others. The McCaskill-MEA method first computes the base pairing probability matrices for all the sequences in the alignment and then obtains the base pairing probability matrix of the alignment by averaging over these matrices. The consensus secondary structure is predicted from this matrix such that the expected accuracy of the prediction is maximized. We show that the McCaskill-MEA method performs better than other methods, particularly when the alignment quality is low and when the alignment consists of many sequences. Our model has a parameter that controls the sensitivity and specificity of predictions. We discussed the uses of that parameter for multi-step screening procedures to search for conserved secondary structures and for assigning confidence values to the predicted base pairs. The C++ source code that implements the McCaskill-MEA algorithm and the test dataset used in this paper are available at http://www.ncrna.org/papers/McCaskillMEA/. Supplementary data are available at Bioinformatics online.

  9. Imino proton exchange and base-pair kinetics in the AMP-RNA aptamer complex.

    PubMed

    Nonin, S; Jiang, F; Patel, D J

    1997-05-02

    We report on the dynamics of base-pair opening in the ATP-binding asymmetric internal loop and flanking base-pairs of the AMP-RNA aptamer complex by monitoring the exchange characteristics of the extremely well resolved imino protons in the NMR spectrum of the complex. The kinetics of imino proton exchange as a function of basic pH or added ammonia catalyst are used to measure the apparent base-pair dissociation constants and lifetimes of Watson-Crick and mismatched base-pairs, as well as the solvent accessibility of the unpaired imino protons in the complex. The exchange characteristics of the imino protons identify the existence of four additional hydrogen bonds stabilizing the conformation of the asymmetric ATP-binding internal loop that were not detected by NOEs and coupling constants alone, but are readily accommodated in the previously reported solution structure of the AMP-RNA aptamer complex published from our laboratory. The hydrogen exchange kinetics of the non-Watson-Crick pairs in the asymmetric internal loop of the AMP-RNA aptamer complex have been characterized and yield apparent dissociation constants (alphaKd) that range from 10(-2) to 10(-7). Surprisingly, three of these alphaKd values are amongst the lowest measured for all base-pairs in the AMP-RNA aptamer complex. Comparative studies of hydrogen exchange of the imino protons in the free RNA aptamer and the AMP-RNA aptamer complex establish that complexation stabilizes not only the bases within the ATP-binding asymmetric internal loop, but also the flanking stem base-pairs (two pairs on either side) of the binding site. We also outline some preliminary results related to the exchange properties of a sugar 2'-hydroxyl proton of a guanosine residue involved in a novel hydrogen bond that has been shown to contribute to the immobilization of the bound AMP by the RNA aptamer, and whose resonance is narrow and downfield shifted in the spectrum.

  10. UV-light-assisted ethanol sensing characteristics of g-C3N4/ZnO composites at room temperature

    NASA Astrophysics Data System (ADS)

    Zhai, Jiali; Wang, Tao; Wang, Chuang; Liu, Dechen

    2018-05-01

    A highly efficient UV-light-assisted room temperature sensor based on g-C3N4/ZnO composites were prepared by an in situ precipitation method. The thermostability, composition, structure, and morphology properties of the as-prepared g-C3N4/ZnO composites were characterized by TGA, XRD, FT-IR, TEM, and XPS, respectively. And then, we studied the ethanol (C2H5OH) sensing performance of the g-C3N4/ZnO composites at the room temperature. Compared with pure ZnO and g-C3N4, the gas sensing activity of g-C3N4/ZnO composites was greatly improved at room temperature, for example, the g-C3N4/ZnO-8% composites showed an obvious response of 121-40 ppm C2H5OH at room temperature, which was 60 times higher than the pure ZnO based on the sensors under the same condition. The great enhancement of the C2H5OH sensing properties of composites can be understood by the efficient separation of photogenerated charge carriers of g-C3N4/ZnO heterogeneous and the UV-light catalytic effect. Finally, a possible mechanism for the gas sensing activity was proposed.

  11. An in situ mediator-free route to fabricate Cu2O/g-C3N4 type-II heterojunctions for enhanced visible-light photocatalytic H2 generation

    NASA Astrophysics Data System (ADS)

    Ji, Cong; Yin, Su-Na; Sun, Shasha; Yang, Shengyang

    2018-03-01

    Cu2O nanoparticles doped g-C3N4 are synthesized via an in situ method and investigated in detail by IR techniques, X-ray diffraction, X-ray photoelectron spectroscopy, transmission electron microscopy, ultraviolet visible diffuse reflection spectroscopy, and photoluminescence spectroscopy. The as-prepared Cu2O/g-C3N4 hybrids demonstrate enhanced photocatalytic activity toward hydrogen generation compared to pure bulk g-C3N4, the effect of Cu2O content on the rate of visible light photocatalytic hydrogen evolution reveals the optimal hydrogen evolution rate can reach 33.2 μmol h-1 g-1, which is about 4 times higher that of pure g-C3N4. The enhanced photocatalytic activity can be attributed to the improved separation and transfer of photogenerated electron-hole pairs at the intimate interface between g-C3N4 and Cu2O. A possible photocatalytic mechanism of the Cu2O/g-C3N4 composite is also discussed. This mediator-free in situ chemical doping strategy developed in this work will contribute to the achievement of other multicomponent photocatalysts.

  12. Analytical pair correlations in ideal quantum gases: temperature-dependent bunching and antibunching.

    PubMed

    Bosse, J; Pathak, K N; Singh, G S

    2011-10-01

    The fluctuation-dissipation theorem together with the exact density response spectrum for ideal quantum gases has been utilized to yield a new expression for the static structure factor, which we use to derive exact analytical expressions for the temperature-dependent pair distribution function g(r) of the ideal gases. The plots of bosonic and fermionic g(r) display "Bose pile" and "Fermi hole" typically akin to bunching and antibunching as observed experimentally for ultracold atomic gases. The behavior of spin-scaled pair correlation for fermions is almost featureless, but bosons show a rich structure including long-range correlations near T(c). The coherent state at T=0 shows no correlation at all, just like single-mode lasers. The depicted decreasing trend in correlation with decrease in temperature for Tc) should be observable in accurate experiments.

  13. Stochastic Theory for the Clustering of Rapidly Settling, Low-Inertia Particle Pairs in Isotropic Turbulence - I

    NASA Astrophysics Data System (ADS)

    Gupta, Vijay; Rani, Sarma; Koch, Donald

    2017-11-01

    A stochastic theory is developed to predict the Radial Distribution Function (RDF) of monodisperse, rapidly settling, low-inertia particle pairs in isotropic turbulence. The theory is based on approximating the turbulent flow in a reference frame following an aerosol particle as a locally linear velocity field. In the first version of the theory (referred to as T1), the fluid velocity gradient tensor ``seen'' by the primary aerosol particle is further assumed to be Gaussian. Analytical closures are then derived for the drift and diffusive fluxes controling the RDF, in the asymptotic limits of small particle Stokes number (St =τp /τη << 1), and large dimensionless settling velocity (Sv = gτp /uη >> 1). It is seen that the RDF for rapidly settling pairs has an inverse power dependency on pair separation r with an exponent, c1, that is proportional to St2 . However, the c1 predicted by T1 for Sv >> 1 particles is higher than the c1 of even non-settling (Sv = 0) particles obtained from DNS of particle-laden isotropic turbulence. Thus, the Gaussian velocity gradient in T1 leads to the unphysical effect that gravity enhances pair clustering. To address this inconsistency, a second version (T2) was developed. Funding from the CBET Division of the National Science Foundation is gratefully acknowledged.

  14. STD-NMR-Based Protein Engineering of the Unique Arylpropionate-Racemase AMDase G74C.

    PubMed

    Gaßmeyer, Sarah Katharina; Yoshikawa, Hiroyuki; Enoki, Junichi; Hülsemann, Nadine; Stoll, Raphael; Miyamoto, Kenji; Kourist, Robert

    2015-06-23

    Structure-guided protein engineering achieved a variant of the unique racemase AMDase G74C, with 40-fold increased activity in the racemisation of several arylaliphatic carboxylic acids. Substrate binding during catalysis was investigated by saturation-transfer-difference NMR (STD-NMR) spectroscopy. All atoms of the substrate showed interactions with the enzyme. STD-NMR measurements revealed distinct nuclear Overhauser effects in experiments with and without molecular conversion. The spectroscopic analysis led to the identification of several amino acid residues whose substitutions increased the activity of G74C. Single amino acid exchanges increased the activity moderately; structure-guided saturation mutagenesis yielded a quadruple mutant with a 40 times higher reaction rate. This study presents STD-NMR as versatile tool for the analysis of enzyme-substrate interactions in catalytically competent systems and for the guidance of protein engineering. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Nuclear magnetic resonance solution structure of an N(2)-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: intercalation from the minor groove with ruptured Watson-Crick base pairing.

    PubMed

    Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H; Cai, Yuqin; Rodriguez, Fabian A; Sayer, Jane M; Jerina, Donald M; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E

    2012-12-04

    The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the nonplanar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14 position with the exocyclic amino group of guanine. Here, we present the first nuclear magnetic resonance solution structure of a DB[a,l]P-derived adduct, the 14R-(+)-trans-anti-DB[a,l]P-N(2)-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N(2)-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3'-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3'-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE-DNA adduct conformation differs from (1) the classical intercalation motif in which Watson-Crick base pairing is intact at the lesion site and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix. The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed.

  16. Base compositions of genes encoding alpha-actin and lactate dehydrogenase-A from differently adapted vertebrates show no temperature-adaptive variation in G + C content.

    PubMed

    Ream, Rachael A; Johns, Glenn C; Somero, George N

    2003-01-01

    indicates that, whereas GC contents of isochores may show variation among different classes of vertebrates, there is no consistent relationship between adaptation temperature and the percentage of thermal stability-enhancing G + C base pairs in protein-coding genes.

  17. The −174G/C and −572G/C Interleukin 6 Promoter Gene Polymorphisms in Mexican Patients with Rheumatoid Arthritis: A Case-Control Study

    PubMed Central

    Zavaleta-Muñiz, S. A.; Martín-Márquez, B. T.; Gonzalez-Lopez, L.; Gonzalez-Montoya, N. G.; Díaz-Toscano, M. L.; Ponce-Guarneros, J. M.; Ruiz-Padilla, A. J.; Mercado, M. Vázquez-Del; Maldonado-González, M.; Fafutis-Morris, M.; Flores-Martínez, S. E.; Martínez-García, E. A.; Gamez-Nava, J. I.

    2013-01-01

    Objective. There is a lack of information about the genotype frequencies of IL-6 −174G/C and −572G/C polymorphisms in Mexicans with rheumatoid arthritis (RA). Therefore, the aim of this study was to evaluate the association of the IL-6 −174G/C and −572G/C polymorphisms in Mexican mestizo with RA. Methods. We included 137 patients with RA and 102 healthy controls. Patients were assessed for clinical characteristics. IL-6 −174G/C and −572G/C polymorphisms were genotyped using PCR-RFLP analysis. Allele and genotype frequencies and the Hardy-Weinberg equilibrium were computed. Odds ratios (ORs) were computed to identify the risk for RA associated with the presence of GG genotype in comparison with the GC or CC genotypes. Results. The genotype −174GG occurred at a higher frequency in cases and controls (77.4% versus 78.4%, P = 0.845). We found similar results for the genotype −572GG (54% in patients versus 60.8% in controls, P = 0.295). Conclusions. This is the first study to evaluate the association of −174G/C and −572G/C polymorphisms of the IL-6 gene with RA in Mexican mestizo patients. These two polymorphisms were not associated with RA in the studied sample. Additional studies are required to evaluate if these IL-6 polymorphisms have relevance to the development of more severe disease. PMID:24223608

  18. Fluorescent aptasensor for detection of four tetracycline veterinary drugs in milk based on catalytic hairpin assembly reaction and displacement of G-quadruplex.

    PubMed

    Zhou, Chen; Zou, Haimin; Sun, Chengjun; Ren, Dongxia; Xiong, Wei; Li, Yongxin

    2018-05-01

    Based on a novel signal amplification strategy by catalytic hairpin assembly and displacement of G-quadruplex DNA, an enzyme-free, non-label fluorescent aptasensing approach was established for sensitive detection of four tetracycline veterinary drugs in milk. The network consisted of a pair of partially complementary DNA hairpins (HP1 and HP2). The DNA aptamer of four tetracycline veterinary drugs was located at the sticky end of the HP1. The ring region of HP1 rich in G and C could form a stable G-quadruplex structure, which could emit specific fluorescence signal after binding with the fluorescent dye and N-methylmesoporphyrin IX (NMM). When presented in the system, the target analytes would be repeatedly used to trigger a recycling procedure between the hairpins, generating numerous HP1-HP2 duplex complexes and displacing G-quadruplex DNA. Thus, the sensitive detection of target analytes was achieved in a wide linear range (0-1000 μg/L) with the detection limit of 4.6 μg/L. Moreover, this proposed method showed high discrimination efficiency towards target analytes against other common mismatched veterinary drugs, and could be successfully applied to the analysis of milk samples. Graphical abstract Schematic of target analyte detection based on catalytic hairpin assembly reaction and displacement of G-quadruplex.

  19. Interaction of Cu(+) with cytosine and formation of i-motif-like C-M(+)-C complexes: alkali versus coinage metals.

    PubMed

    Gao, Juehan; Berden, Giel; Rodgers, M T; Oomens, Jos

    2016-03-14

    The Watson-Crick structure of DNA is among the most well-known molecular structures of our time. However, alternative base-pairing motifs are also known to occur, often depending on base sequence, pH, or the presence of cations. Pairing of cytosine (C) bases induced by the sharing of a single proton (C-H(+)-C) may give rise to the so-called i-motif, which occurs primarily in expanded trinucleotide repeats and the telomeric region of DNA, particularly at low pH. At physiological pH, silver cations were recently found to stabilize C dimers in a C-Ag(+)-C structure analogous to the hemiprotonated C-dimer. Here we use infrared ion spectroscopy in combination with density functional theory calculations at the B3LYP/6-311G+(2df,2p) level to show that copper in the 1+ oxidation state induces an analogous formation of C-Cu(+)-C structures. In contrast to protons and these transition metal ions, alkali metal ions induce a different dimer structure, where each ligand coordinates the alkali metal ion in a bidentate fashion in which the N3 and O2 atoms of both cytosine ligands coordinate to the metal ion, sacrificing hydrogen-bonding interactions between the ligands for improved chelation of the metal cation.

  20. AT base pair anions versus (9-methyl-A)(1-methyl-T) base pair anions.

    PubMed

    Radisic, Dunja; Bowen, Kit H; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej

    2005-05-04

    The anionic base pairs of adenine and thymine, (AT)(-), and 9-methyladenine and 1-methylthymine, (MAMT)(-), have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)(-) found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)(-) was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)(-) and a resulting (MAMT)(-) configuration that was either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)(-) occurred at a completely different electron binding energy than had (AT)(-). Moreover, the VDE value of (MAMT)(-) was in agreement with that predicted by theory. The configuration of (MAMT)(-) and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced DNA alterations, BFPT in the WC/HS configurations of (AT)(-) is not feasible.

  1. 77 FR 50519 - Agency Information Collection Activities: Forms G-325, G-325A, G-325B, and G-325C; Extension of a...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-08-21

    ... DEPARTMENT OF HOMELAND SECURITY U.S. Citizenship and Immigration Services [OMB Control Number 1615... Department of Homeland Security (DHS), U.S. Citizenship and Immigration Services (USCIS) will be submitting... collection: Forms G-325, G-325A, G-325B, and G-325C; U.S. Citizenship and Immigration Services (USCIS). (4...

  2. Comparative study of mitotic chromosomes in two blowflies, Lucilia sericata and L. cluvia (Diptera, Calliphoridae), by C- and G-like banding patterns and rRNA loci, and implications for karyotype evolution

    PubMed Central

    Chirino, Mónica G.; Rossi, Luis F.; Bressa, María J.; Luaces, Juan P.; Merani, María S.

    2015-01-01

    Abstract The karyotypes of Lucilia cluvia (Walker, 1849) and Lucilia sericata (Meigen, 1826) from Argentina were characterized using conventional staining and the C- and G-like banding techniques. Besides, nucleolus organizer regions (NORs) were detected by fluorescent in situ hybridization (FISH) and silver staining technique. The chromosome complement of these species comprises five pairs of autosomes and a pair of sex chromosomes (XX/XY, female/male). The autosomes of both species have the same size and morphology, as well as C- and G-like banding patterns. The X and Y chromosomes of Lucilia cluvia are subtelocentric and easily identified due to their very small size. In Lucilia sericata, the X chromosome is metacentric and the largest of the complement, showing a secondary constriction in its short arm, whereas the Y is submetacentric and smaller than the X. The C-banding patterns reflect differences in chromatin structure and composition between the subtelocentric X and Y chromosomes of Lucilia cluvia and the biarmed sex chromosomes of Lucilia sericata. These differences in the sex chromosomes may be due to distinct amounts of constitutive heterochromatin. In Lucilia cluvia, the NORs are placed at one end of the long-X and of the long-Y chromosome arms, whereas one of the NORs is disposed in the secondary constriction of the short-X chromosome arm and the other on the long-Y chromosome arm in Lucilia sericata. Although the G-like banding technique does not yield G-bands like those in mammalian chromosomes, it shows a high degree chromosomal homology in both species because each pair of autosomes was correctly paired. This chromosome similarity suggests the absence of autosomal rearrangements during karyotype evolution in the two species studied. PMID:25893078

  3. An operationally flexible fuel cell based on quaternary ammonium-biphosphate ion pairs

    DOE PAGES

    Lee, Kwan -Soo; Spendelow, Jacob Schatz; Choe, Yoong -Kee; ...

    2016-08-22

    Here, fuel cells are promising devices for clean power generation in a variety of economically and environmentally significant applications. Low-temperature proton exchange membrane (PEM) fuel cells utilizing Nafion require a high level of hydration, which limits the operating temperature to less than 100°C. In contrast, high-temperature PEM fuel cells utilizing phosphoric acid-doped polybenzimidazole can operate effectively up to 180°C; however, these devices degrade when exposed to water below 140°C. Here we present a different class of PEM fuel cells based on quaternary ammonium-biphosphate ion pairs that can operate under conditions unattainable with existing fuel cell technologies. These fuel cells exhibitmore » stable performance at 80–160°C with a conductivity decay rate more than three orders of magnitude lower than that of a commercial high-temperature PEM fuel cell. By increasing the operational flexibility, this class of fuel cell can simplify the requirements for heat and water management, and potentially reduce the costs associated with the existing fully functional fuel cell systems.« less

  4. An operationally flexible fuel cell based on quaternary ammonium-biphosphate ion pairs

    NASA Astrophysics Data System (ADS)

    Lee, Kwan-Soo; Spendelow, Jacob S.; Choe, Yoong-Kee; Fujimoto, Cy; Kim, Yu Seung

    2016-09-01

    Fuel cells are promising devices for clean power generation in a variety of economically and environmentally significant applications. Low-temperature proton exchange membrane (PEM) fuel cells utilizing Nafion require a high level of hydration, which limits the operating temperature to less than 100 ∘C. In contrast, high-temperature PEM fuel cells utilizing phosphoric acid-doped polybenzimidazole can operate effectively up to 180 ∘C however, these devices degrade when exposed to water below 140 ∘C. Here we present a different class of PEM fuel cells based on quaternary ammonium-biphosphate ion pairs that can operate under conditions unattainable with existing fuel cell technologies. These fuel cells exhibit stable performance at 80-160 ∘C with a conductivity decay rate more than three orders of magnitude lower than that of a commercial high-temperature PEM fuel cell. By increasing the operational flexibility, this class of fuel cell can simplify the requirements for heat and water management, and potentially reduce the costs associated with the existing fully functional fuel cell systems.

  5. Josephson Parametric Amplifer Based on a Cavity-Embedded Cooper Pair Transistor

    NASA Astrophysics Data System (ADS)

    Li, Juliang; Rimberg, A. J.

    In this experiment a cavity-embedded Cooper-pair transistor (cCPT) is used as a Josephson parametric amplifier. The cCPT consists of a Cooper pair transistor placed at the voltage antinode of a 5.7 GHz shorted quarter-wave resonator so that the CPT provides a galvanic connection between the cavity's central conductor and ground plane, which forms a SQUID loop. Both the flux threading the loop as well as the gate charge can be modulated, and each can provide the parametric pumping. The reflected signal from the cCPT is further amplified by both SLUG and HEMT amplifiers for characterizing the parametric amplification. A first application of the parametric amplification is to improve the charge sensitivity of a single electron charge detector. This can be done either by pumping on a side band or by shifting the charge state of the cCPT near a bifurcation point. Stimulated emission has been also observed when the cCPT is pumped at twice the resonant frequency in the absence of an input signal. This could allow investigation of the dynamic Casimir effect as well as generation of non-classical photon states. Supported by Grants ARO W911NF-13-10377 and NSF DMR 1507400.

  6. Design and Applications of Noncanonical DNA Base Pairs.

    PubMed

    Jissy, A K; Datta, Ayan

    2014-01-02

    While the Watson-Crick base pairs are known to stabilize the DNA double helix and play a vital role in storage/replication of genetic information, their replacement with non-Watson-Crick base pairs has recently been shown to have interesting practical applications. Nowadays, theoretical calculations are routinely performed on very complex systems to gain a better understanding of how molecules interact with each other. We not only bring together some of the basic concepts of how mispaired or unnatural nucleobases interact with each other but also look at how such an understanding influences the prediction of novel properties and development of new materials. We highlight the recent developments in this field of research. In this Perspective, we discuss the success of DFT methods, particularly, dispersion-corrected DFT, for applications such as pH-controlled molecular switching, electric-field-induced stacking of disk-like molecules with guanine quartets, and optical birefringence of alkali-metal-coordinated guanine quartets. The synergy between theoretical models and real applications is highlighted.

  7. Cajanusflavanols A-C, Three Pairs of Flavonostilbene Enantiomers from Cajanus cajan.

    PubMed

    He, Qi-Fang; Wu, Zhen-Long; Huang, Xiao-Jun; Zhong, Yuan-Lin; Li, Man-Mei; Jiang, Ren-Wang; Li, Yao-Lan; Ye, Wen-Cai; Wang, Ying

    2018-02-02

    Three pairs of new flavonostilbene enantiomers, cajanusflavanols A-C (1-3), along with their putative biogenetic precursors 4-6, were isolated from Cajanus cajan. Compound 1 possesses an unprecedented carbon skeleton featuring a unique highly functionalized cyclopenta[1,2,3-de]isobenzopyran-1-one tricyclic core. Compounds 2 and 3 are the first examples of methylene-unit-linked flavonostilbenes. Their structures with absolute configurations were elucidated by spectroscopic analyses, X-ray diffraction, and computational calculations. Compounds 1 and 2 exhibited significant in vitro anti-inflammatory activities.

  8. The Wilcoxon signed rank test for paired comparisons of clustered data.

    PubMed

    Rosner, Bernard; Glynn, Robert J; Lee, Mei-Ling T

    2006-03-01

    The Wilcoxon signed rank test is a frequently used nonparametric test for paired data (e.g., consisting of pre- and posttreatment measurements) based on independent units of analysis. This test cannot be used for paired comparisons arising from clustered data (e.g., if paired comparisons are available for each of two eyes of an individual). To incorporate clustering, a generalization of the randomization test formulation for the signed rank test is proposed, where the unit of randomization is at the cluster level (e.g., person), while the individual paired units of analysis are at the subunit within cluster level (e.g., eye within person). An adjusted variance estimate of the signed rank test statistic is then derived, which can be used for either balanced (same number of subunits per cluster) or unbalanced (different number of subunits per cluster) data, with an exchangeable correlation structure, with or without tied values. The resulting test statistic is shown to be asymptotically normal as the number of clusters becomes large, if the cluster size is bounded. Simulation studies are performed based on simulating correlated ranked data from a signed log-normal distribution. These studies indicate appropriate type I error for data sets with > or =20 clusters and a superior power profile compared with either the ordinary signed rank test based on the average cluster difference score or the multivariate signed rank test of Puri and Sen. Finally, the methods are illustrated with two data sets, (i) an ophthalmologic data set involving a comparison of electroretinogram (ERG) data in retinitis pigmentosa (RP) patients before and after undergoing an experimental surgical procedure, and (ii) a nutritional data set based on a randomized prospective study of nutritional supplements in RP patients where vitamin E intake outside of study capsules is compared before and after randomization to monitor compliance with nutritional protocols.

  9. Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs.

    PubMed

    McCoy, A B; Wright, A; Krousel-Wood, M; Thomas, E J; McCoy, J A; Sittig, D F

    2015-01-01

    Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes.

  10. Surprising conformers of the biologically important A·T DNA base pairs: QM/QTAIM proofs

    NASA Astrophysics Data System (ADS)

    Brovarets', Ol'ha O.; Tsiupa, Kostiantyn S.; Hovorun, Dmytro M.

    2018-02-01

    For the first time novel high-energy conformers – A·T(wWC) (5.36), A·T(wrWC) (5.97), A·T(wH) (5.78) and A·T(wrH) (ΔG=5.82 kcal•mol-1) were revealed for each of the four biologically important A·T(WC) DNA base pairs – Watson-Crick A·T(WC), reverse Watson-Crick A·T(rWC), Hoogsteen A·T(H) and reverse Hoogsteen A·T(rH) at the MP2/aug-cc-pVDZ//B3LYP/6-311++G(d,p) level of quantum-mechanical theory in the continuum with ɛ=4 under normal conditions. Each of these conformers possesses substantially non-planar wobble (w) structure and is stabilized by the participation of the two anti-parallel N6H/N6H'…O4/O2 and N3H…N6 H-bonds, involving the pyramidalized amino group of the A DNA base as an acceptor and a donor of the H-bonding. The transition states – TSA·T(WC)↔A·T(wWC), TSA·T(rWC)↔A·T(wrWC), TSA·T(H)↔A·T(wH) and TSA·T(rH)↔A·T(wrH), controlling the dipole-active transformations of the conformers from the main plane-symmetric state into the high-energy, significantly non-planar state and vice versa, were localized. They also possess wobble structures similarly to the high-energy conformers and are stabilized by the participation of the N6H/N6H'…O4/O2 and N3H…N6 H-bonds. Discovered conformers of the A·T DNA base pairs are dynamically stable short-lived structures (lifetime τ = (1.4-3.9) ps). Their possible biological significance and future perspectives have been briefly discussed.

  11. Enhanced photocatalytic H2-production activity of C-dots modified g-C3N4/TiO2 nanosheets composites.

    PubMed

    Li, Yang; Feng, Xionghan; Lu, Zhexue; Yin, Hui; Liu, Fan; Xiang, Quanjun

    2018-03-01

    As a new carbon-based material, carbon dots (C-dots) have got widely preference because of its excellent electronic transfer capability. In this work, a novel ternary layered C-dots/g-C 3 N 4 /TiO 2 nanosheets (CGT) composite photocatalysts were prepared by impregnation precipitation methods. The optimal ternary CGT composite samples revealed high photocatalytic hydrogen evolution rate in triethanolamine aqueous solutions, which exceeded the rate of the optimal g-C 3 N 4 /TiO 2 composite sample by a factor of 5 times. The improved photocatalytic activity is owed to the positive effects of C-dots and layered heterojunction structure of TiO 2 nanosheets and g-C 3 N 4 sheets. C-dots in the CGT composites can serve as electron reservoirs to capture the photo-induced electrons. The well-defined layered heterojunction structure of CGT provides the intimate contact and the strong interaction of anatase TiO 2 nanosheets and g-C 3 N 4 sheets via face-to-face orientation, which restrains the recombination of photogenerated charge carriers, and thus enhances the photocatalytic H 2 -production activity. Electron paramagnetic resonance and transient photocurrent response proved the strong interaction and improved interfacial charge transfer of TiO 2 nanosheets and g-C 3 N 4 sheets, respectively. The mechanism of improving the photocatalytic H 2 -evolution activity was further confirmed by time-resolved fluorescence, electron paramagnetic resonance, transient photocurrent response and electrochemical impedance spectroscopy. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. 52. Photocopy of Outboard Profile, Booklet of General Plans, U.S.C.G.C. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    52. Photocopy of Outboard Profile, Booklet of General Plans, U.S.C.G.C. White Heath, WLM-545. U.S. Coast Guard Naval Engineering Department. U.S.C.G. Headquarters, Washington, D.C. Coast Guard Headquarters Drawing No. 540-WAGL-0103-019 C. sheet 2 of 7, dated May 1967; revised June 1971, December 1976, and April 1989. Original drawing property of the U.S. Coast Guard. - U.S. Coast Guard Cutter WHITE HEATH, USGS Integrated Support Command Boston, 427 Commercial Street, Boston, Suffolk County, MA

  13. 57. Photocopy of Hold, Booklet of General Plans, U.S.C.G.C. White ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    57. Photocopy of Hold, Booklet of General Plans, U.S.C.G.C. White Heath, WLM-545. U.S. Coast Guard Naval Engineering Department, U.S.C.G. Headquarters, Washington, D.C. Coast Guard Headquarters Drawing No. 540-WAGL-0103-019 C. sheet 7 of 7, dated May 1967; revised June 1971, December 1976, and April 1989. Original drawing property of the U.S. Coast Guard. - U.S. Coast Guard Cutter WHITE HEATH, USGS Integrated Support Command Boston, 427 Commercial Street, Boston, Suffolk County, MA

  14. 51. Photocopy of Title Sheet, Booklet of General Plans, U.S.C.G.C ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    51. Photocopy of Title Sheet, Booklet of General Plans, U.S.C.G.C White Heath, WLM-545, U.S. Coast Guard Naval Engineering Department, U.S.C.G. Headquarters, Washington, D.C. Coast Guard Headquarters Drawing No. 540-WAGL-0103-019 C. sheet 1 of 7, dated May 1967; revised June 1971, December 1976, and April 1989. Original drawing property of the U.S. Coast Guard. - U.S. Coast Guard Cutter WHITE HEATH, USGS Integrated Support Command Boston, 427 Commercial Street, Boston, Suffolk County, MA

  15. 53. Photocopy of Inboard Profile, Booklet of General Plans, U.S.C.G.C. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    53. Photocopy of Inboard Profile, Booklet of General Plans, U.S.C.G.C. White Heath, WLM-545. U.S. Coast Guard Naval Engineering Department. U.S.C.G. Headquarters, Washington, D.C. Coast Guard Headquarters Drawing No. 540-WAGL-0103-019 C. sheet 3 of 7, dated May 1967; revised June 1971, December 1976, and April 1989. Original drawing property of the U.S. Coast Guard. - U.S. Coast Guard Cutter WHITE HEATH, USGS Integrated Support Command Boston, 427 Commercial Street, Boston, Suffolk County, MA

  16. 56. Photocopy of Main Deck, Booklet of General Plans, U.S.C.G.C. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    56. Photocopy of Main Deck, Booklet of General Plans, U.S.C.G.C. White Heath WLM-545. U.S. Coast Guard Naval Engineering Department, U.S.C.G. Headquarters, Washington, D.C. Coast Guard Headquarters Drawing No. 540-WAGL-0103-019 C. sheet 6 of 7, dated May 1967; revised June 1971, December 1976, and April 1989. Original drawing property of the U.S. Coast Guard. - U.S. Coast Guard Cutter WHITE HEATH, USGS Integrated Support Command Boston, 427 Commercial Street, Boston, Suffolk County, MA

  17. Complexes of DNA bases and Watson-Crick base pairs interaction with neutral silver Agn (n = 8, 10, 12) clusters: a DFT and TDDFT study.

    PubMed

    Srivastava, Ruby

    2018-03-01

    We study the binding of the neutral Ag n (n = 8, 10, 12) to the DNA base-adenine (A), guanine (G) and Watson-Crick -adenine-thymine, guanine-cytosine pairs. Geometries of complexes were optimized at the DFT level using the hybrid B3LYP functional. LANL2DZ effective core potential was used for silver and 6-31 + G ** was used for all other atoms. NBO charges were analyzed using the Natural population analysis. The absorption properties of Ag n -A,G/WC complexes were also studied using time-dependent density functional theory. The absorption spectra for these complexes show wavelength in the visible region. It was revealed that silver clusters interact more strongly with WC pairs than with isolated DNA complexes. Furthermore, it was found that the electronic charge transferred from silver to isolated DNA clusters are less than the electronic charge transferred from silver to the Ag n -WC complexes. The vertical ionization potential, vertical electron affinity, hardness, and electrophilicity index of Ag n -DNA/WC complexes have also been discussed.

  18. Observation of χ c1 Decays into Vector Meson Pairs ΦΦ, ωω and, ωΦ

    DOE PAGES

    Ablikim, M.; Achasov, M. N.; An, L.; ...

    2011-08-22

    Using (106±4)×10⁶ ψ(3686) events accumulated with the BESIII detector at the BEPCII e⁺e⁻ collider, we present the first measurement of decays of χ c1 to vector meson pairs ΦΦ, ωω, and ωΦ. The branching fractions are measured to be (4.4±0.3±0.5)×10⁻⁴, (6.0±0.3±0.7)×10⁻⁴, and (2.2±0.6±0.2)×10⁻⁵, for χ c1 →ΦΦ, ωω, and ωΦ, respectively, which indicates that the hadron helicity selection rule is significantly violated in χ cJ decays. In addition, the measurement of χ cJ→ωΦ provides the first indication of the rate of doubly OZI-suppressed χ cJ decay. Finally, we present improved measurements for the branching fractions of χ c0 and χmore » c2 to vector meson pairs.« less

  19. Lewis Acid Pairs for the Activation of Biomass-derived Oxygenates in Aqueous Media

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Roman, Yuriy

    2015-09-14

    The objective of this project is to understand the mechanistic aspects behind the cooperative activation of oxygenates by catalytic pairs in aqueous media. Specifically, we will investigate how the reactivity of a solid Lewis acid can be modulated by pairing the active site with other catalytic sites at the molecular level, with the ultimate goal of enhancing activation of targeted functional groups. Although unusual catalytic properties have been attributed to the cooperative effects promoted by such catalytic pairs, virtually no studies exist detailing the use heterogeneous water-tolerant Lewis pairs. A main goal of this work is to devise rational pathwaysmore » for the synthesis of porous heterogeneous catalysts featuring isolated Lewis pairs that are active in the transformation of biomass-derived oxygenates in the presence of bulk water. Achieving this technical goal will require closely linking advanced synthesis techniques; detailed kinetic and mechanistic investigations; strict thermodynamic arguments; and comprehensive characterization studies of both materials and reaction intermediates. For the last performance period (2014-2015), two technical aims were pursued: 1) C-C coupling using Lewis acid and base pairs in Lewis acidic zeolites. Tin-, zirconium-, and hafnium containing zeolites (e.g., Sn-, Zr-, and Hf-Beta) are versatile solid Lewis acids that selectively activate carbonyl functional groups. In this aim, we demonstrate that these zeolites catalyze the cross-aldol condensation of aromatic aldehydes with acetone under mild reaction conditions with near quantitative yields. NMR studies with isotopically labeled molecules confirm that acid-base pairs in the Si-O-M framework ensemble promote soft enolization through α-proton abstraction. The Lewis acidic zeolites maintain activity in the presence of water and, unlike traditional base catalysts, in acidic solutions. 2) One-pot synthesis of MWW zeolite nanosheets for activation of bulky substrates

  20. Measurement of inclusive muon pair production by 225-GeV/c. pi. /sup +/,. pi. /sup -/, and proton beams with a large acceptance spectrometers. [Cross sections, 225 GeV/c, tables

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brason, J G

    1977-05-01

    Inclusive muon pair production by 225 GeV/c ..pi../sup +/, ..pi../sup -/ and proton beams incident upon carbon and tin targets was measured over a large range of kinematic variables (2m/sub ..mu../ < m/sub ..mu mu.. < 1 GeV/c/sup 2/, 0 < x/sub F/ < 1, P/sub perpendicular to/ < 4 GeV/c and vertical bar cos theta* vertical bar < .3). The value of the invariant cross section E d/sup 4/sigma/dmdx/sub f/dp/sup 2//sub perpendicular to/ is presented as a function of these variables. The vector mesons rho, ..omega.., phi, J and psi' appear in the data along with apparently nonresonant ..mu..-pairs.more » By looking for additional muons accompanying J ..-->.. ..mu../sup +/..mu../sup -/ events, a 1.0% upper limit on production of pairs of charmed particles in association with the J is obtained. Aspects of the continuum muon pair data are compared to Drell-Yan model calculations. The ratio of ..mu..-pairs produced by ..pi../sup +/ beam particles to ..mu..-pairs produced by ..pi../sup -/ beam particles supports electromagnetic production at high mass.« less

  1. Retention of nucleic acids in ion-pair reversed-phase high-performance liquid chromatography depends not only on base composition but also on base sequence.

    PubMed

    Qiao, Jun-Qin; Liang, Chao; Wei, Lan-Chun; Cao, Zhao-Ming; Lian, Hong-Zhen

    2016-12-01

    The study on nucleic acid retention in ion-pair reversed-phase high-performance liquid chromatography mainly focuses on size-dependence, however, other factors influencing retention behaviors have not been comprehensively clarified up to date. In this present work, the retention behaviors of oligonucleotides and double-stranded DNAs were investigated on silica-based C 18 stationary phase by ion-pair reversed-phase high-performance liquid chromatography. It is found that the retention of oligonucleotides was influenced by base composition and base sequence as well as size, and oligonucleotides prone to self-dimerization have weaker retention than those not prone to self-dimerization but with the same base composition. However, homo-oligonucleotides are suitable for the size-dependent separation as a special case of oligonucleotides. For double-stranded DNAs, the retention is also influenced by base composition and base sequence, as well as size. This may be attributed to the interaction of exposed bases in major or minor grooves with the hydrophobic alky chains of stationary phase. In addition, no specific influence of guanine and cytosine content was confirmed on retention of double-stranded DNAs. Notably, the space effect resulted from the stereostructure of nucleic acids also influences the retention behavior in ion-pair reversed-phase high-performance liquid chromatography. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. A novel mutation of the ACADM gene (c.145C>G) associated with the common c.985A>G mutation on the other ACADM allele causes mild MCAD deficiency: a case report

    PubMed Central

    2010-01-01

    A female patient, with normal familial history, developed at the age of 30 months an episode of diarrhoea, vomiting and lethargy which resolved spontaneously. At the age of 3 years, the patient re-iterated vomiting, was sub-febrile and hypoglycemic, fell into coma, developed seizures and sequels involving right hemi-body. Urinary excretion of hexanoylglycine and suberylglycine was low during this metabolic decompensation. A study of pre- and post-prandial blood glucose and ketones over a period of 24 hours showed a normal glycaemic cycle but a failure to form ketones after 12 hours fasting, suggesting a mitochondrial β-oxidation defect. Total blood carnitine was lowered with unesterified carnitine being half of the lowest control value. A diagnosis of mild MCAD deficiency (MCADD) was based on rates of 1-14C-octanoate and 9, 10-3H-myristate oxidation and of octanoyl-CoA dehydrogenase being reduced to 25% of control values. Other mitochondrial fatty acid oxidation proteins were functionally normal. De novo acylcarnitine synthesis in whole blood samples incubated with deuterated palmitate was also typical of MCADD. Genetic studies showed that the patient was compound heterozygous with a sequence variation in both of the two ACADM alleles; one had the common c.985A>G mutation and the other had a novel c.145C>G mutation. This is the first report for the ACADM gene c.145C>G mutation: it is located in exon 3 and causes a replacement of glutamine to glutamate at position 24 of the mature protein (Q24E). Associated with heterozygosity for c.985A>G mutation, this mutation is responsible for a mild MCADD phenotype along with a clinical story corroborating the emerging literature view that patients with genotypes representing mild MCADD (high residual enzyme activity and low urinary levels of glycine conjugates), similar to some of the mild MCADDs detected by MS/MS newborn screening, may be at risk for disease presentation. PMID:20923556

  3. DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

    PubMed

    Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

    2012-10-11

    Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

  4. Correlations of EGF G1380A, bFGF C754G and VEGF T460C polymorphisms with malignant melanoma susceptibility and prognosis: A case-control study.

    PubMed

    Wang, Xin-Hua; Long, Zi-Wen

    2017-06-20

    This case-control study aims to investigate the correlations of EGF G1380A, bFGF C754G and VEGF T460C polymorphisms with the susceptibility and prognosis of malignant melanoma. A total of 153 patients with multiple primary melanomas were collected as the case group and another 170 healthy individuals were selected as the control group. ELISA and PCR-RFLP were performed to test the serum level of VEGF and to analyze the genotype as well as allele frequencies of VEGF T460C, EGF G1380A, and bFGF C754G, respectively. The patients were assigned into complete remission (CR), partial remission (PR) and non-remission groups after treatment. HE and CD34 staining were conducted in tissue samples of CR and PR patients. Event-free survival (EFS) and overall survival (OS) were measured. AA genotype of EGF G1380A and GG genotype of bFGF C754G had higher frequency distribution in the case group than the control group. Patients with AA genotype of EGF G1380 and GG genotype of bFGF C754G had an elevated VEGF level in comparison to other genotypes. Patients with GA+GG genotypes of EGF G1380A and CG+CC genotypes of bFGF C754G had higher EFS and OS than those with AA genotype and those with GG genotype, respectively. According to the haplotype analysis, the case group had a notably higher frequency of TAG and CAG along with while lower frequency of TGG and CGC compared with the control group. Logistic regression analysis revealed that the polymorphisms of EGF G1380A and bFGF C754G as well as the haploid TAG increased the susceptibility of malignant melanoma. The results indicated that EGF G1380A and bFGF C754G gene polymorphisms were associated with the susceptibility and prognosis of malignant melanoma, and that the polymorphisms of EGF G1380A and bFGF C754G as well as the haploid TAG increased the susceptibility of malignant melanoma. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. 31 CFR Appendix G to Subpart C of... - Financial Management Service

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 31 Money and Finance: Treasury 1 2014-07-01 2014-07-01 false Financial Management Service G Appendix G to Subpart C of Part 1 Money and Finance: Treasury Office of the Secretary of the Treasury DISCLOSURE OF RECORDS Privacy Act Pt. 1, Subpt. C, App. G Appendix G to Subpart C of Part 1—Financial...

  6. 31 CFR Appendix G to Subpart C of... - Financial Management Service

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 31 Money and Finance: Treasury 1 2013-07-01 2013-07-01 false Financial Management Service G Appendix G to Subpart C of Part 1 Money and Finance: Treasury Office of the Secretary of the Treasury DISCLOSURE OF RECORDS Privacy Act Pt. 1, Subpt. C, App. G Appendix G to Subpart C of Part 1—Financial...

  7. 31 CFR Appendix G to Subpart C of... - Financial Management Service

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 31 Money and Finance: Treasury 1 2011-07-01 2011-07-01 false Financial Management Service G Appendix G to Subpart C of Part 1 Money and Finance: Treasury Office of the Secretary of the Treasury DISCLOSURE OF RECORDS Privacy Act Pt. 1, Subpt. C, App. G Appendix G to Subpart C of Part 1—Financial...

  8. 31 CFR Appendix G to Subpart C of... - Financial Management Service

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 31 Money and Finance: Treasury 1 2012-07-01 2012-07-01 false Financial Management Service G Appendix G to Subpart C of Part 1 Money and Finance: Treasury Office of the Secretary of the Treasury DISCLOSURE OF RECORDS Privacy Act Pt. 1, Subpt. C, App. G Appendix G to Subpart C of Part 1—Financial...

  9. Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs

    PubMed Central

    Wright, A.; Krousel-Wood, M.; Thomas, E. J.; McCoy, J. A.; Sittig, D. F.

    2015-01-01

    Summary Background Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. Objective We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. Methods We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. Results The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. Conclusions We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes. PMID:26171079

  10. N(4)C-ethyl-N(4)C cross-linked DNA: synthesis and characterization of duplexes with interstrand cross-links of different orientations.

    PubMed

    Noronha, Anne M; Noll, David M; Wilds, Christopher J; Miller, Paul S

    2002-01-22

    The preparation and physical properties of short DNA duplexes that contain a N(4)C-ethyl-N(4)C interstrand cross-link are described. Duplexes that contain an interstrand cross-link between mismatched C-C residues and duplexes in which the C residues of a -CG- or -GC- step are linked to give "staggered" interstrand cross-links were prepared using a novel N(4)C-ethyl-N(4)C phosphoramidite reagent. Duplexes with the C-C mismatch cross-link have UV thermal transition temperatures that are 25 degrees C higher than the melting temperatures of control duplexes in which the cross-link is replaced with a G-C base pair. It appears that this cross-link stabilizes adjacent base pairs and does not perturb the structure of the helix, a conclusion that is supported by the CD spectrum of this duplex and by molecular models. An even higher level of stabilization, 49 degrees C, is seen with the duplex that contains a -CG- staggered cross-link. Molecular models suggest that this cross-link may induce propeller twisting in the cross-linked base pairs, and the CD spectrum of this duplex exhibits an unusual negative band at 298 nm, although the remainder of the spectrum is similar to that of B-form DNA. Mismatched C-C or -CG- staggered cross-linked duplexes that have complementary overhanging ends can undergo self-ligation catalyzed by T4 DNA ligase. Analysis of the ligated oligomers by nondenaturing polyacrylamide gel electrophoresis shows that the resulting oligomers migrate in a manner similar to that of a mixture of non-cross-linked control oligomers and suggests that these cross-links do not result in significant bending of the helix. However, the orientation of the staggered cross-link can have a significant effect on the structure and stability of the cross-linked duplex. Thus, the thermal stability of the duplex that contains a -GC- staggered cross-link is 10 degrees C lower than the melting temperature of the control, non-cross-linked duplex. Unlike the -CG- staggered cross

  11. The nearest neighbor and next nearest neighbor effects on the thermodynamic and kinetic properties of RNA base pair

    NASA Astrophysics Data System (ADS)

    Wang, Yujie; Wang, Zhen; Wang, Yanli; Liu, Taigang; Zhang, Wenbing

    2018-01-01

    The thermodynamic and kinetic parameters of an RNA base pair with different nearest and next nearest neighbors were obtained through long-time molecular dynamics simulation of the opening-closing switch process of the base pair near its melting temperature. The results indicate that thermodynamic parameters of GC base pair are dependent on the nearest neighbor base pair, and the next nearest neighbor base pair has little effect, which validated the nearest-neighbor model. The closing and opening rates of the GC base pair also showed nearest neighbor dependences. At certain temperature, the closing and opening rates of the GC pair with nearest neighbor AU is larger than that with the nearest neighbor GC, and the next nearest neighbor plays little role. The free energy landscape of the GC base pair with the nearest neighbor GC is rougher than that with nearest neighbor AU.

  12. Solar promoted azo dye degradation and energy production in the bio-photoelectrochemical system with a g-C3N4/BiOBr heterojunction photocathode

    NASA Astrophysics Data System (ADS)

    Hou, Yanping; Gan, Yuanyuan; Yu, Zebin; Chen, Xixi; Qian, Lun; Zhang, Boge; Huang, Lirong; Huang, Jun

    2017-12-01

    In this study, a single-chamber bio-photoelectrochemical system (BPES), integrating advantages of bioelectrochemical system and photocatalysis process, is developed using a g-C3N4/BiOBr heterojunction photocathode for methyl orange (MO) degradation and simultaneous energy recovery. Photocatalytic activities of g-C3N4/BiOBr, g-C3N4 and BiOBr are characterized by UV-vis diffuse reflectance spectra (UV-vis DRS) and Photoluminescence (PL) spectra; and electrochemical activities of photocathodes are examined by linear sweep voltammetry (LSV) and electrochemical impedance spectroscopy (EIS). Results show that with an applied voltage of 0.8 V and under simulated solar irradiation, MO decolorization with g-C3N4/BiOBr photocathode reaches 97.8% within 4 h, higher than those with g-C3N4 (85.3%) and BiOBr (87.3%) photocathodes. Likewise, higher hydrogen production rate (143.8 L m-3d-1) is observed using g-C3N4/BiOBr photocathode; while values for g-C3N4 and BiOBr photocathodes are 124.3 L m-3d-1 and 117.1 L m-3d-1, respectively. PL and EIS reveal that superior performance of g-C3N4/BiOBr photocathode can be attributed to more efficient separation of photogenerated electron-hole pairs, lower resistance and better charge transfer. Synergistic effect occurs among biological, electrochemical and photocatalytic processes in illuminated BPES for MO removal. Photocathode optimization and system stability evaluation are conducted. This study demonstrates that the BPES holds great potential for efficient refractory organics degradation and energy production.

  13. Hb Midnapore [β53(D4)Ala→Val; HBB: c.161C>T]: A Novel Hemoglobin Variant with a Structural Abnormality Associated with IVS-I-5 (G>C) (HBB: c.92+5G>C) Found in a Bengali Indian Family.

    PubMed

    Panja, Amrita; Chowdhury, Prosanto; Basu, Anupam

    2016-09-01

    We describe a novel C>T substitution at codon 53 of the HBB gene (HBB: c.161C>T). The proband was a transfusion-dependent β-thalassemia major (β-TM) patient. DNA was extracted and subsequently, DNA sequencing was done to detect the mutations on the HBB gene. Capillary zone electrophoresis (CZE) revealed the presence of an unknown peak. She inherited this mutation from her grandmother through her mother. This mutation exists in cis with the common β 0 mutation IVS-I-5 (G>C) (HBB: c.92+5G>C). The proband is homozygous for HBB: c.92+5G>C and needs monthly transfusions. On the other hand, her grandmother, mother and sister all possess this novel mutation cis with the heterozygous HBB: c.92+5G>C. They are carriers not thalassemic. This mutation produces the substitution β53(D4)Ala→Val; HBB: c.161C>T, a new structural hemoglobin (Hb) variant. As this variant was identified in a Bengali family from Paschim Midnapore district of West Bengal, India, it has been designated as Hb Midnapore. This variant has now been reported to the HbVar database.

  14. Recognition of Watson-Crick base pairs: constraints and limits due to geometric selection and tautomerism

    PubMed Central

    Yusupov, Marat; Yusupova, Gulnara

    2014-01-01

    The natural bases of nucleic acids have a strong preference for one tautomer form, guaranteeing fidelity in their hydrogen bonding potential. However, base pairs observed in recent crystal structures of polymerases and ribosomes are best explained by an alternative base tautomer, leading to the formation of base pairs with Watson-Crick-like geometries. These observations set limits to geometric selection in molecular recognition of complementary Watson-Crick pairs for fidelity in replication and translation processes. PMID:24765524

  15. Interaction of herpes simplex virus glycoprotein gC with mammalian cell surface molecules.

    PubMed Central

    Tal-Singer, R; Peng, C; Ponce De Leon, M; Abrams, W R; Banfield, B W; Tufaro, F; Cohen, G H; Eisenberg, R J

    1995-01-01

    The entry of herpes simplex virus (HSV) into mammalian cells is a multistep process beginning with an attachment step involving glycoproteins gC and gB. A second step requires the interaction of glycoprotein gD with a cell surface molecule. We explored the interaction between gC and the cell surface by using purified proteins in the absence of detergent. Truncated forms of gC and gD, gC1(457t), gC2(426t), and gD1(306t), lacking the transmembrane and carboxyl regions were expressed in the baculovirus system. We studied the ability of these proteins to bind to mammalian cells, to bind to immobilized heparin, to block HSV type 1 (HSV-1) attachment to cells, and to inhibit plaque formation by HSV-1. Each of these gC proteins bound to conformation-dependent monoclonal antibodies and to human complement component C3b, indicating that they maintained the same conformation of gC proteins expressed in mammalian cells. Biotinylated gC1(457t) and gC2(426t) each bind to several cell lines. Binding was inhibited by an excess of unlabeled gC but not by gD, indicating specificity. The attachment of gC to cells involves primarily heparan sulfate proteoglycans, since heparitinase treatment of cells reduced gC binding by 50% but had no effect on gD binding. Moreover, binding of gC to two heparan sulfate-deficient L-cell lines, gro2C and sog9, both of which are mostly resistant to HSV infection, was markedly reduced. Purified gD1 (306t), however, bound equally well to the two mutant cell lines. In contrast, saturating amounts of gC1(457t) interfered with HSV-1 attachment to cells but failed to block plaque formation, suggesting a role for gC in attachment but not penetration. A mutant form of gC lacking residues 33 to 123, gC1(delta 33-123t), expressed in the baculovirus system, bound significantly less well to cells than did gC1(457t) and competed poorly with biotinylated gC1(457t) for binding. These results suggest that residues 33 to 123 are important for gC attachment to cells

  16. Graphene oxide as a structure-directing agent for the two-dimensional interface engineering of sandwich-like graphene-g-C3N4 hybrid nanostructures with enhanced visible-light photoreduction of CO2 to methane.

    PubMed

    Ong, Wee-Jun; Tan, Lling-Lling; Chai, Siang-Piao; Yong, Siek-Ting

    2015-01-18

    A facile one-pot impregnation-thermal reduction strategy was employed to fabricate sandwich-like graphene-g-C3N4 (GCN) nanocomposites using urea and graphene oxide as precursors. The GCN sample exhibited a slight red shift of the absorption band edge attributed to the formation of a C-O-C bond as a covalent cross linker between graphene and g-C3N4. The GCN sample demonstrated high visible-light photoactivity towards CO2 reduction under ambient conditions, exhibiting a 2.3-fold enhancement over pure g-C3N4. This was ascribed to the inhibition of electron-hole pair recombination by graphene, which increased the charge transfer.

  17. Base Pair Opening in a Deoxynucleotide Duplex Containing a cis-syn Thymine Cyclobutane Dimer Lesion

    PubMed Central

    Wenke, Belinda B.; Huiting, Leah N.; Frankel, Elisa B.; Lane, Benjamin F.; Núñez, Megan E.

    2014-01-01

    The cis-syn thymine cyclobutane dimer is a DNA photoproduct implicated in skin cancer. We compared the stability of individual base pairs in thymine dimer-containing duplexes to undamaged parent 10-mer duplexes. UV melting thermodynamic measurements, CD spectroscopy, and 2D NOESY NMR spectroscopy confirm that the thymine dimer lesion is locally and moderately destabilizing within an overall B-form duplex conformation. We measured the rates of exchange of individual imino protons by NMR using magnetization transfer from water and determined the equilibrium constant for the opening of each base pair Kop. In the normal duplex Kop decreases from the frayed ends of the duplex toward the center, such that the central TA pair is the most stable with a Kop of 8×10−7. In contrast, base pair opening at the 5’T of the thymine dimer is facile. The 5’T of the dimer has the largest equilibrium constant (Kop =3×10−4) in its duplex, considerably larger than even the frayed penultimate base pairs. Notably, base pairing by the 3’T of the dimer is much more stable than by the 5’T, indicating that the predominant opening mechanism for the thymine dimer lesion is not likely to be flipping out into solution as a single unit. The dimer asymmetrically affects the stability of the duplex in its vicinity, destabilizing base pairing on its 5’ side more than on the 3’ side. The striking differences in base pair opening between parent and dimer duplexes occur independently of the duplex-single strand melting transitions. PMID:24328089

  18. Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

    PubMed

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-08

    The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

  19. Comparable Stability of Hoogsteen and Watson–Crick Base Pairs in Ionic Liquid Choline Dihydrogen Phosphate

    PubMed Central

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-01

    The instability of Hoogsteen base pairs relative to Watson–Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson–Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson–Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo. PMID:24399194

  20. Excited state properties of naphtho-homologated xxDNA bases and effect of methanol solution, deoxyribose, and base pairing.

    PubMed

    Zhang, Laibin; Ren, Tingqi; Tian, Jianxiang; Yang, Xiuqin; Zhou, Liuzhu; Li, Xiaoming

    2013-04-18

    Design and synthesis of fluorescent nucleobase analogues for studying structures and dynamics of nucleic acids have attracted much attention in recent years. In the present work, a comprehensive theoretical study of electronic transitions of naphtho-homologated base analogues, namely, xxC, xxT, xxA, and xxG, was performed. The nature of the low-lying excited states was discussed, and the results were compared with those of x-bases. Geometrical characteristics of the lowest excited singlet ππ* states were explored using the CIS method. The calculated excitation maxima are 423, 397, 383, and 357 nm for xxA, xxG, xxC, and xxT, respectively, and they are greatly red-shifted compared with x-bases and natural bases, allowing them to be selectively excited in the presence of the natural bases. In the gas phase, the fluorescence from them would be expected to occur around 497, 461, 457, and 417 nm, respectively. The effects of methanol solution, deoxyribose, and base paring with their complementary natural bases on the relevant absorption and emission spectra of these modified bases were also examined.

  1. Relativistic coupled cluster theory based on the no-pair Dirac-Coulomb-Breit Hamiltonian: Relativistic pair correlation energies of the Xe atom

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Eliav, E.; Kaldor, U.; Ishikawa, Y.

    1994-12-31

    Relativistic pair correlation energies of Xe were computed by employing a recently developed relativistic coupled cluster theory based on the no-pair Dirac-Coulomb-Breit Hamiltonian. The matrix Dirac-Fock-Breit SCF and relativistic coupled cluster calculations were performed by means of expansion in basis sets of well-tempered Gaussian spinors. A detailed study of the pair correlation energies in Xe is performed, in order to investigate the effects of the low-frequency Breit interaction on the correlation energies of Xe. Nonadditivity of correlation and relativistic (particularly Breit) effects is discussed.

  2. Carnitine-acylcarnitine translocase deficiency with c.199-10 T>G and novel c.1A>G mutation: Two case reports and brief literature review.

    PubMed

    Yan, Hui-Ming; Hu, Hao; Ahmed, Aisha; Feng, Bing-Bing; Liu, Jing; Jia, Zheng-Jun; Wang, Hua

    2017-11-01

    Carnitine-acylcarnitine translocate deficiency (CACTD) is a rare and life-threatening, autosomal recessive disorder of fatty acid β-oxidation characterized by hypoketotic hypoglycemia, hyperammonemia, cardiomyopathy, liver dysfunction, and muscle weakness; culminating in early death. To date, CACTD cases screened from the Chinese mainland population, especially patient with compound heterozygote with c.199-10T>G and a novel c.1A>G mutation in the SLC25A20 gene has never been described. Herein, we report 2 neonatal cases of CACTD identified from the mainland China. These 2 patients were presented with severe metabolic crisis and their clinical conditions deteriorate rapidly and both died of cardiorespiratory collapse in the first week of life. We present the clinical and biochemical features of 2 probands and a brief literature review of previously reported CACTD cases with the c.199-10T>G mutation. The acylcarnitine profiles by tandem-mass-spectrometry and the mutation analysis of SLC25A20 gene confirmed the diagnosis of CACTD in both patients. Mutation analysis demonstrated that patient No. 1 was homozygous for c.199-10T>G mutation, while patient No. 2 was a compound heterozygote for 2 mutations, a maternally-inherited c.199-10T>G and a paternally-inherited, novel c.1A>G mutation. Both patients were treated with an aggressive treatment regimen include high glucose and arginine infusion, respiratory, and circulatory support. The first proband died 3 days after delivery due to sudden cardiac arrest. The second patient's clinical condition, at one time, was improved by high glucose infusion, intravenous arginine, and circulatory support. However, the patient failed to wean from mechanical ventilation. Unfortunately, her parents refused further treatment due to fear of financial burdens. The patient died of congestive heart failure in the 6th day of life. We report the first 2 cases of CACTD identified from the mainland China. Apart from a founder mutation c.199-10T>G

  3. Tunable Schottky barrier and electronic properties in borophene/g-C2N van der Waals heterostructures

    NASA Astrophysics Data System (ADS)

    Jiang, J. W.; Wang, X. C.; Song, Y.; Mi, W. B.

    2018-05-01

    By stacking different layers of two dimensional (2D) monolayer materials, the electronic properties of the 2D van der Waals (vdW) heterostructures can be tailored. However, the Schottky barrier formed between 2D semiconductor and metallic electrode has greatly limited the application of 2D semiconductor in nanoelectronic and optoelectronic devices. Herewith, we investigate the electronic properties of borophene/g-C2N vdW heterostructures by first-principles calculations. The results indicate that electronic structures of borophene and g-C2N are preserved in borophene/g-C2N vdW heterostructures. Meanwhile, upon the external electric field, a transition from the n-type Schottky contact to Ohmic contact is induced, and the carrier concentration between the borophene and g-C2N interfaces can be tuned. These results are expected to provide useful insight in the nanoelectronic and optoelectronic devices based on the borophene/g-C2N vdW heterostructures.

  4. Ammonia-evaporation-induced construction of three-dimensional NiO/g-C3N4 composite with enhanced adsorption and visible light-driven photocatalytic performance

    NASA Astrophysics Data System (ADS)

    Tzvetkov, George; Tsvetkov, Martin; Spassov, Tony

    2018-07-01

    Novel visible light-driven heterostructured NiO/g-C3N4 photocatalyst has been designed and successfully prepared via ammonia-evaporation-induced method. The synthetic strategy consists of grafting the surface of g-C3N4 with Ni(NH3)62+ complex followed by its hydrolysis at lower pH to form nano-wrinkled thin film of α-Ni(OH)2. The final NiO/g-C3N4 hybrid was obtained after calcination of the Ni(OH)2/g-C3N4 precursor at 350 °C. Scanning electron microscopy, transmission electron microscopy, X-ray diffraction, FTIR, N2 adsorption/desorption, UV-vis diffuse reflectance and photoluminescence spectroscopy were used to characterize the resulting material. Our results revealed the formation of meso-/macroporous three-dimensional hierarchical honeycomb-like structure with high BET surface area (141 m2 g-1). The photocatalytic performance of the composite under visible light (λ > 400 nm) irradiation was evaluated through degradation of Malachite Green (MG) from aqueous medium at room temperature (25 °C). For the sake of comparison, the physico-chemical and photocatalytic properties of the pristine g-C3N4 and nanostructured NiO were also examined. Results indicated that NiO/g-C3N4 is much more active than pristine g-C3N4 and NiO in the photodegradation of MG. The enhanced photocatalytic performance of the composite was mainly attributed to the combination of high adsorption capacity which facilitates the direct redox reactions of dye and the efficient inhibition of photo-generated electron-hole pair recombination. Superoxide radicals (•O2-) and photo-generated holes (h+) were found to be the main active species in the process.

  5. Quadruplexes in 'Dicty': crystal structure of a four-quartet G-quadruplex formed by G-rich motif found in the Dictyostelium discoideum genome.

    PubMed

    Guédin, Aurore; Lin, Linda Yingqi; Armane, Samir; Lacroix, Laurent; Mergny, Jean-Louis; Thore, Stéphane; Yatsunyk, Liliya A

    2018-06-01

    Guanine-rich DNA has the potential to fold into non-canonical G-quadruplex (G4) structures. Analysis of the genome of the social amoeba Dictyostelium discoideum indicates a low number of sequences with G4-forming potential (249-1055). Therefore, D. discoideum is a perfect model organism to investigate the relationship between the presence of G4s and their biological functions. As a first step in this investigation, we crystallized the dGGGGGAGGGGTACAGGGGTACAGGGG sequence from the putative promoter region of two divergent genes in D. discoideum. According to the crystal structure, this sequence folds into a four-quartet intramolecular antiparallel G4 with two lateral and one diagonal loops. The G-quadruplex core is further stabilized by a G-C Watson-Crick base pair and a A-T-A triad and displays high thermal stability (Tm > 90°C at 100 mM KCl). Biophysical characterization of the native sequence and loop mutants suggests that the DNA adopts the same structure in solution and in crystalline form, and that loop interactions are important for the G4 stability but not for its folding. Four-tetrad G4 structures are sparse. Thus, our work advances understanding of the structural diversity of G-quadruplexes and yields coordinates for in silico drug screening programs and G4 predictive tools.

  6. Platinum(II)-Oligonucleotide Coordination Based Aptasensor for Simple and Selective Detection of Platinum Compounds.

    PubMed

    Cai, Sheng; Tian, Xueke; Sun, Lianli; Hu, Haihong; Zheng, Shirui; Jiang, Huidi; Yu, Lushan; Zeng, Su

    2015-10-20

    Wide use of platinum-based chemotherapeutic regimens for the treatment for carcinoma calls for a simple and selective detection of platinum compound in biological samples. On the basis of the platinum(II)-base pair coordination, a novel type of aptameric platform for platinum detection has been introduced. This chemiluminescence (CL) aptasensor consists of a designed streptavidin (SA) aptamer sequence in which several base pairs were replaced by G-G mismatches. Only in the presence of platinum, coordination occurs between the platinum and G-G base pairs as opposed to the hydrogen-bonded G-C base pairs, which leads to SA aptamer sequence activation, resulting in their binding to SA coated magnetic beads. These Pt-DNA coordination events were monitored by a simple and direct luminol-peroxide CL reaction through horseradish peroxidase (HRP) catalysis with a strong chemiluminescence emission. The validated ranges of quantification were 0.12-240 μM with a limit of detection of 60 nM and selectivity over other metal ions. This assay was also successfully used in urine sample determination. It will be a promising candidate for the detection of platinum in biomedical and environmental samples.

  7. Carriers of the Complex Allele HFE c.[187C>G;340+4T>C] Have Increased Risk of Iron Overload in São Miguel Island Population (Azores, Portugal).

    PubMed

    Branco, Claudia C; Gomes, Cidália T; De Fez, Laura; Bulhões, Sara; Brilhante, Maria José; Pereirinha, Tânia; Cabral, Rita; Rego, Ana Catarina; Fraga, Cristina; Miguel, António G; Brasil, Gracinda; Macedo, Paula; Mota-Vieira, Luisa

    2015-01-01

    Iron overload is associated with acquired and genetic conditions, the most common being hereditary hemochromatosis (HH) type-I, caused by HFE mutations. Here, we conducted a hospital-based case-control study of 41 patients from the São Miguel Island (Azores, Portugal), six belonging to a family with HH type-I pseudodominant inheritance, and 35 unrelated individuals fulfilling the biochemical criteria of iron overload compatible with HH type-I. For this purpose, we analyzed the most common HFE mutations- c.845G>A [p.Cys282Tyr], c.187C>G [p.His63Asp], and c.193A>T [p.Ser65Cys]. Results revealed that the family's HH pseudodominant pattern is due to consanguineous marriage of HFE-c.845G>A carriers, and to marriage with a genetically unrelated spouse that is a -c.187G carrier. Regarding unrelated patients, six were homozygous for c.845A, and three were c.845A/c.187G compound heterozygous. We then performed sequencing of HFE exons 2, 4, 5 and their intron-flanking regions. No other mutations were observed, but we identified the -c.340+4C [IVS2+4C] splice variant in 26 (74.3%) patients. Functionally, the c.340+4C may generate alternative splicing by HFE exon 2 skipping and consequently, a protein missing the α1-domain essential for HFE/ transferrin receptor-1 interactions. Finally, we investigated HFE mutations configuration with iron overload by determining haplotypes and genotypic profiles. Results evidenced that carriers of HFE-c.187G allele also carry -c.340+4C, suggesting in-cis configuration. This data is corroborated by the association analysis where carriers of the complex allele HFE-c.[187C>G;340+4T>C] have an increased iron overload risk (RR = 2.08, 95% CI = 1.40-2.94, p<0.001). Therefore, homozygous for this complex allele are at risk of having iron overload because they will produce two altered proteins--the p.63Asp [c.187G], and the protein lacking 88 amino acids encoded by exon 2. In summary, we provide evidence that the complex allele HFE-c.[187C>G;340+4T>C

  8. Carriers of the Complex Allele HFE c.[187C>G;340+4T>C] Have Increased Risk of Iron Overload in São Miguel Island Population (Azores, Portugal)

    PubMed Central

    Bulhões, Sara; Brilhante, Maria José; Pereirinha, Tânia; Cabral, Rita; Rego, Ana Catarina; Fraga, Cristina; Miguel, António G.; Brasil, Gracinda; Macedo, Paula; Mota-Vieira, Luisa

    2015-01-01

    Iron overload is associated with acquired and genetic conditions, the most common being hereditary hemochromatosis (HH) type-I, caused by HFE mutations. Here, we conducted a hospital-based case-control study of 41 patients from the São Miguel Island (Azores, Portugal), six belonging to a family with HH type-I pseudodominant inheritance, and 35 unrelated individuals fulfilling the biochemical criteria of iron overload compatible with HH type-I. For this purpose, we analyzed the most common HFE mutations– c.845G>A [p.Cys282Tyr], c.187C>G [p.His63Asp], and c.193A>T [p.Ser65Cys]. Results revealed that the family’s HH pseudodominant pattern is due to consanguineous marriage of HFE-c.845G>A carriers, and to marriage with a genetically unrelated spouse that is a -c.187G carrier. Regarding unrelated patients, six were homozygous for c.845A, and three were c.845A/c.187G compound heterozygous. We then performed sequencing of HFE exons 2, 4, 5 and their intron-flanking regions. No other mutations were observed, but we identified the -c.340+4C [IVS2+4C] splice variant in 26 (74.3%) patients. Functionally, the c.340+4C may generate alternative splicing by HFE exon 2 skipping and consequently, a protein missing the α1-domain essential for HFE/ transferrin receptor-1 interactions. Finally, we investigated HFE mutations configuration with iron overload by determining haplotypes and genotypic profiles. Results evidenced that carriers of HFE-c.187G allele also carry -c.340+4C, suggesting in-cis configuration. This data is corroborated by the association analysis where carriers of the complex allele HFE-c.[187C>G;340+4T>C] have an increased iron overload risk (RR = 2.08, 95% CI = 1.40−2.94, p<0.001). Therefore, homozygous for this complex allele are at risk of having iron overload because they will produce two altered proteins—the p.63Asp [c.187G], and the protein lacking 88 amino acids encoded by exon 2. In summary, we provide evidence that the complex allele HFE-c.[187C>G

  9. Current hormonal contraceptive use predicts female extra-pair and dyadic sexual behavior: evidence based on Czech National Survey data.

    PubMed

    Klapilová, Kateřina; Cobey, Kelly D; Wells, Timothy; Roberts, S Craig; Weiss, Petr; Havlíček, Jan

    2014-01-10

    Data from 1155 Czech women (493 using oral contraception, 662 non-users), obtained from the Czech National Survey of Sexual Behavior, were used to investigate evolutionary-based hypotheses concerning the predictive value of current oral contraceptive (OC) use on extra-pair and dyadic (in-pair) sexual behavior of coupled women. Specifically, the aim was to determine whether current OC use was associated with lower extra-pair and higher in-pair sexual interest and behavior, because OC use suppresses cyclical shifts in mating psychology that occur in normally cycling women. Zero-inflated Poisson (ZIP) regression and negative binomial models were used to test associations between OC use and these sexual measures, controlling for other relevant predictors (e.g., age, parity, in-pair sexual satisfaction, relationship length). The overall incidence of having had an extra-pair partner or one-night stand in the previous year was not related to current OC use (the majority of the sample had not). However, among the women who had engaged in extra-pair sexual behavior, OC users had fewer one-night stands than non-users, and tended to have fewer partners, than non-users. OC users also had more frequent dyadic intercourse than non-users, potentially indicating higher commitment to their current relationship. These results suggest that suppression of fertility through OC use may alter important aspects of female sexual behavior, with potential implications for relationship functioning and stability.

  10. 18. C54G AIRCRAFT IN HANGAR. Photographic copy of historic photograph. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    18. C-54G AIRCRAFT IN HANGAR. Photographic copy of historic photograph. Jan.-June 1948 OAMA, (original print located at Ogden Air Logistics Center, Hill Air Force Base, Utah). Photographer unknown. - Hill Field, Airplane Repair Hangars No. 1-No. 4, 5875 Southgate Avenue, Layton, Davis County, UT

  11. Discrimination of Single Base Pair Differences Among Individual DNA Molecules Using a Nanopore

    NASA Technical Reports Server (NTRS)

    Vercoutere, Wenonah; DeGuzman, Veronica

    2003-01-01

    The protein toxin alpha-hemolysin form nanometer scale channels across lipid membranes. Our lab uses a single channel in an artificial lipid bilayer in a patch clamp device to capture and examine individual DNA molecules. This nanopore detector used with a support vector machine (SVM) can analyze DNA hairpin molecules on the millisecond time scale. We distinguish duplex stem length, base pair mismatches, loop length, and single base pair differences. The residual current fluxes also reveal structural molecular dynamics elements. DNA end-fraying (terminal base pair dissociation) can be observed as near full blockades, or spikes, in current. This technique can be used to investigate other biological processes dependent on DNA end-fraying, such as the processing of HIV DNA by HIV integrase.

  12. A simple and highly selective 2,2-diferrocenylpropane-based multi-channel ion pair receptor for Pb(2+) and HSO4(-).

    PubMed

    Wan, Qian; Zhuo, Ji-Bin; Wang, Xiao-Xue; Lin, Cai-Xia; Yuan, Yao-Feng

    2015-03-28

    A structurally simple, 2,2-diferrocenylpropane-based ion pair receptor 1 was synthesized and characterized by (1)H NMR, (13)C NMR, HRMS, elemental analyses, and single-crystal X-ray diffraction. The ion pair receptor 1 showed excellent selectivity and sensitivity towards Pb(2+) with multi-channel responses: a fluorescence enhancement (more than 42-fold), a notable color change from yellow to red, redox anodic shift (ΔE1/2 = 151 mV), while HSO4(-) promoted fluorescence enhancement when Pb(2+) or Zn(2+) was bonded to the cation binding-site. (1)H NMR titration and density functional theory were performed to reveal the sensing mechanism based on photo-induced electron transfer (PET).

  13. Potentiometric and spectrophotometric study of the stability of magnesium carbonate and bicarbonate ion pairs to 150 °C and aqueous inorganic carbon speciation and magnesite solubility

    NASA Astrophysics Data System (ADS)

    Stefánsson, Andri; Bénézeth, Pascale; Schott, Jacques

    2014-08-01

    The formation constants of magnesium bicarbonate and carbonate ion pairs have been experimentally determined in dilute hydrothermal solutions to 150 °C. Two experimental approaches were applied, potentiometric acid-base titrations at 10-60 °C and spectrophotometric pH measurements using two pH indicators, 2-naphthol and 4-nitrophenol, at 25 and 80-150 °C. At a given temperature, the first and second ionization constants of carbonic acid (K1, K2) and the ion pair formation constants for MgHCO3+(aq) (KMgHCO3+) and MgCO3(aq) (KMgCO3) were simultaneously fitted to the data. Results of this study compare well with previously determined values of K1 and K2. The formation constants of MgHCO3+(aq) and MgCO3(aq) ion pairs increased significantly with increasing temperature, with values of logKMgHCO3+ = 1.14 and 1.75 and of logKMgCO3 = 2.86 and 3.48 at 10 °C and 100 °C, respectively. These ion pairs are important aqueous species under neutral to alkaline conditions in moderately dilute to concentrated Mg-containing solutions, with MgCO3(aq) predominating over CO32-(aq) in solutions at pH >8. The predominance of magnesium carbonate over carbonate is dependent on the concentration of dissolved magnesium and the ratio of magnesium over carbonate. With increasing temperature and at alkaline pH, brucite solubility further reduced the magnesium concentration to levels below 1 mmol kg-1, thus limiting availability of Mg2+(aq) for magnesite precipitation.

  14. Paired Learners' Verbalised Strategies for Determining Grammatical Correctness: A Turn-Based System for Coding Metatalk

    ERIC Educational Resources Information Center

    Ishii, David N.

    2011-01-01

    The purpose of this paper is to explore the use of a new coding system that incorporates the various types of metatalk that occurred during paired learners' engagement in a consciousness-raising task. On the basis of previous studies, metalanguage (e.g. with or without terminology), knowledge sources (e.g. intuition), and verbalisation strategies…

  15. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

    PubMed

    Kondo, Jiro; Westhof, Eric

    2011-10-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

  16. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide–protein complexes

    PubMed Central

    Kondo, Jiro; Westhof, Eric

    2011-01-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431

  17. Observation of {chi}{sub c1} Decays into Vector Meson Pairs {phi}{phi}, {omega}{omega}, and {omega}{phi}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ablikim, M.; An, Z. H.; Bai, J. Z.

    Using (106{+-}4)x10{sup 6} {psi}(3686) events accumulated with the BESIII detector at the BEPCII e{sup +}e{sup -} collider, we present the first measurement of decays of {chi}{sub c1} to vector meson pairs {phi}{phi}, {omega}{omega}, and {omega}{phi}. The branching fractions are measured to be (4.4{+-}0.3{+-}0.5)x10{sup -4}, (6.0{+-}0.3{+-}0.7)x10{sup -4}, and (2.2{+-}0.6{+-}0.2)x10{sup -5}, for {chi}{sub c1}{yields}{phi}{phi}, {omega}{omega}, and {omega}{phi}, respectively, which indicates that the hadron helicity selection rule is significantly violated in {chi}{sub cJ} decays. In addition, the measurement of {chi}{sub cJ}{yields}{omega}{phi} provides the first indication of the rate of doubly OZI-suppressed {chi}{sub cJ} decay. Finally, we present improved measurements for the branching fractionsmore » of {chi}{sub c0} and {chi}{sub c2} to vector meson pairs.« less

  18. Graphitic carbon nitride based nanocomposites: a review

    NASA Astrophysics Data System (ADS)

    Zhao, Zaiwang; Sun, Yanjuan; Dong, Fan

    2014-11-01

    Graphitic carbon nitride (g-C3N4), as an intriguing earth-abundant visible light photocatalyst, possesses a unique two-dimensional structure, excellent chemical stability and tunable electronic structure. Pure g-C3N4 suffers from rapid recombination of photo-generated electron-hole pairs resulting in low photocatalytic activity. Because of the unique electronic structure, the g-C3N4 could act as an eminent candidate for coupling with various functional materials to enhance the performance. According to the discrepancies in the photocatalytic mechanism and process, six primary systems of g-C3N4-based nanocomposites can be classified and summarized: namely, the g-C3N4 based metal-free heterojunction, the g-C3N4/single metal oxide (metal sulfide) heterojunction, g-C3N4/composite oxide, the g-C3N4/halide heterojunction, g-C3N4/noble metal heterostructures, and the g-C3N4 based complex system. Apart from the depiction of the fabrication methods, heterojunction structure and multifunctional application of the g-C3N4-based nanocomposites, we emphasize and elaborate on the underlying mechanisms in the photocatalytic activity enhancement of g-C3N4-based nanocomposites. The unique functions of the p-n junction (semiconductor/semiconductor heterostructures), the Schottky junction (metal/semiconductor heterostructures), the surface plasmon resonance (SPR) effect, photosensitization, superconductivity, etc. are utilized in the photocatalytic processes. Furthermore, the enhanced performance of g-C3N4-based nanocomposites has been widely employed in environmental and energetic applications such as photocatalytic degradation of pollutants, photocatalytic hydrogen generation, carbon dioxide reduction, disinfection, and supercapacitors. This critical review ends with a summary and some perspectives on the challenges and new directions in exploring g-C3N4-based advanced nanomaterials.

  19. Versatile mechanical properties of novel g-SiC x monolayers from graphene to silicene: a first-principles study.

    PubMed

    Lu, X K; Xin, T Y; Zhang, Q; Xu, Q; Wei, T H; Wang, Y X

    2018-08-03

    Recently, a series of graphene-like binary monolayers (g-SiC x ), where Si partly substitutes the C positions in graphene, have been obtained by tailoring the band gaps of graphene and silicene that have made them a promising material for application in opto-electronic devices. Subsequently, evaluating the mechanical properties of g-SiC x has assumed great importance for engineering applications. In this study, we quantified the in-plane mechanical properties of g-SiC x (x = 7, 5, 3, 2 and 1) monolayers (also including graphene and silicene) based on density function theory. It was found that the mechanical parameters of g-SiC x , such as the ideal strength, Young's modulus, shear modulus, Poisson's ratio, as well as fracture toughness, are overall related to the ratio of Si-C to C-C bonds, which varies with Si concentration. However, for g-SiC 7 and g-SiC 3 , the mechanical properties seem to depend on the structure because in g-SiC 7 , the C-C bond strength is severely weakened by abnormal stretching, and in g-SiC 3 , conjugation structure is formed. The microscopic failure of g-SiC x exhibits diverse styles depending on the more complex structural deformation modes introduced by Si substitution. We elaborated the structure-properties relationship of g-SiC x during the failure process, and in particular, found that the structural transformation of g-SiC 3 and g-SiC is due to the singular symmetry of their structure. Due to the homogeneous phase, all the g-SiC x investigated in this study preserve rigorous isotropic Young's moduli and Poisson's ratios. With versatile mechanical performances, the family of g-SiC x may facilitate the design of advanced two-dimensional materials to meet the needs for practical mechanical engineering applications. The results offer a fundamental understanding of the mechanical behaviors of g-SiC x monolayers.

  20. Hybrid density functional study on the mechanism for the enhanced photocatalytic properties of the ultrathin hybrid layered nanocomposite g-C3N4/BiOCl

    NASA Astrophysics Data System (ADS)

    Yao, Wenzhi; Zhang, Jihua; Wang, Yuanxu; Ren, Fengzhu

    2018-03-01

    To investigate the origin of the high photocatalytic performance of experimentally synthesized g-C3N4/ BiOCl, we studied its geometry structure, electronic structure, and photocatalytic properties by means of hybrid density-functional theory (DFT). The calculated band alignment of g-C3N4 and few-layer BiOCl sheets clearly shows that g-C3N4/ BiOCl is a standard type-II nanocomposite. The density of states, Bader charge, partial charge density, charge density difference, and the effective masses show that electron-hole pair can be effectively separated in the g-C3N4/BiOCl interface. The calculated absorption coefficients indicate an obvious redshift of the absorption edge. The band gap of g-C3N4/BiOCl can be modulated by external electric field, and a semiconductor-semimetal transition is observed. The type-II vdW heterostructure is still maintained during the changes of external electric field. Especially, when the electric field reaches to +0.7 V/Å, the impurity states have been eliminated with the band gap of 2.3 eV. An analysis of optical properties shows that the absorption coefficient in the visible-light region is enhanced considerably as the electric-field strength increases. Our calculation results suggest that the ultrathin hybrid layered g-C3N4/BiOCl nanocomposite may have significant advantages for visible-light photocatalysis.

  1. Activation energies for dissociation of double strand oligonucleotide anions: evidence for watson-crick base pairing in vacuo.

    PubMed

    Schnier, P D; Klassen, J S; Strittmatter, E F; Williams, E R

    1998-09-23

    The dissociation kinetics of a series of complementary and noncomplementary DNA duplexes, (TGCA)(2) (3-), (CCGG)(2) (3-), (AATTAAT)(2) (3-), (CCGGCCG)(2) (3-), A(7)*T(7) (3-), A(7)*A(7) (3-), T(7)*T(7) (3-), and A(7)*C(7) (3-) were investigated using blackbody infrared radiative dissociation in a Fourier transform mass spectrometer. From the temperature dependence of the unimolecular dissociation rate constants, Arrhenius activation parameters in the zero-pressure limit are obtained. Activation energies range from 1.2 to 1.7 eV, and preexponential factors range from 10(13) to 10(19) s(-1). Dissociation of the duplexes results in cleavage of the noncovalent bonds and/or cleavage of covalent bonds leading to loss of a neutral nucleobase followed by backbone cleavage producing sequence-specific (a - base) and w ions. Four pieces of evidence are presented which indicate that Watson-Crick (WC) base pairing is preserved in complementary DNA duplexes in the gas phase: i. the activation energy for dissociation of the complementary dimer, A(7)*T(7) (3-), to the single strands is significantly higher than that for the related noncomplementary A(7)*A(7) (3-) and T(7)*T(7) (3-) dimers, indicating a stronger interaction between strands with a specific base sequence, ii. extensive loss of neutral adenine occurs for A(7)*A(7) (3-) and A(7)*C(7) (3-) but not for A(7)*T(7) (3-) consistent with this process being shut down by WC hydrogen bonding, iii. a correlation is observed between the measured activation energy for dissociation to single strands and the dimerization enthalpy (-DeltaH(d)) in solution, and iv. molecular dynamics carried out at 300 and 400 K indicate that WC base pairing is preserved for A(7)*T(7) (3-) duplex, although the helical structure is essentially lost. In combination, these results provide strong evidence that WC base pairing can exist in the complete absence of solvent.

  2. Activation Energies for Dissociation of Double Strand Oligonucleotide Anions: Evidence for Watson–Crick Base Pairing in Vacuo

    PubMed Central

    Schnier, Paul D.; Klassen, John S.; Strittmatter, Eric F.; Williams*, Evan R.

    2005-01-01

    The dissociation kinetics of a series of complementary and noncomplementary DNA duplexes, (TGCA)23−, (CCGG)23−, (AATTAAT)23−, (CCGGCCG)23−, A7·T73−, A7·A73−, T7·T73−, and A7·C73− were investigated using blackbody infrared radiative dissociation in a Fourier transform mass spectrometer. From the temperature dependence of the unimolecular dissociation rate constants, Arrhenius activation parameters in the zero-pressure limit are obtained. Activation energies range from 1.2 to 1.7 eV, and preexponential factors range from 1013 to 1019 s−1. Dissociation of the duplexes results in cleavage of the noncovalent bonds and/or cleavage of covalent bonds leading to loss of a neutral nucleobase followed by backbone cleavage producing sequence-specific (a – base) and w ions. Four pieces of evidence are presented which indicate that Watson–Crick (WC) base pairing is preserved in complementary DNA duplexes in the gas phase: i. the activation energy for dissociation of the complementary dimer, A7·T73−, to the single strands is significantly higher than that for the related noncomplementary A7·A73− and T7·T73− dimers, indicating a stronger interaction between strands with a specific base sequence, ii. extensive loss of neutral adenine occurs for A7·A73− and A7·C73− but not for A7·T73− consistent with this process being shut down by WC hydrogen bonding, iii. a correlation is observed between the measured activation energy for dissociation to single strands and the dimerization enthalpy (−ΔHd) in solution, and iv. molecular dynamics carried out at 300 and 400 K indicate that WC base pairing is preserved for A7·T73− duplex, although the helical structure is essentially lost. In combination, these results provide strong evidence that WC base pairing can exist in the complete absence of solvent. PMID:16498487

  3. rSNPBase 3.0: an updated database of SNP-related regulatory elements, element-gene pairs and SNP-based gene regulatory networks

    PubMed Central

    2018-01-01

    Abstract Here, we present the updated rSNPBase 3.0 database (http://rsnp3.psych.ac.cn), which provides human SNP-related regulatory elements, element-gene pairs and SNP-based regulatory networks. This database is the updated version of the SNP regulatory annotation database rSNPBase and rVarBase. In comparison to the last two versions, there are both structural and data adjustments in rSNPBase 3.0: (i) The most significant new feature is the expansion of analysis scope from SNP-related regulatory elements to include regulatory element–target gene pairs (E–G pairs), therefore it can provide SNP-based gene regulatory networks. (ii) Web function was modified according to data content and a new network search module is provided in the rSNPBase 3.0 in addition to the previous regulatory SNP (rSNP) search module. The two search modules support data query for detailed information (related-elements, element-gene pairs, and other extended annotations) on specific SNPs and SNP-related graphic networks constructed by interacting transcription factors (TFs), miRNAs and genes. (3) The type of regulatory elements was modified and enriched. To our best knowledge, the updated rSNPBase 3.0 is the first data tool supports SNP functional analysis from a regulatory network prospective, it will provide both a comprehensive understanding and concrete guidance for SNP-related regulatory studies. PMID:29140525

  4. Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

    PubMed Central

    Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

    2003-01-01

    Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

  5. Computational study on the half-metallicity in transition metal—oxide-incorporated 2D g-C3N4 nanosheets

    NASA Astrophysics Data System (ADS)

    Gao, Qian; Wang, Hui-Li; Zhang, Li-Fu; Hu, Shuang-Lin; Hu, Zhen-Peng

    2018-06-01

    In this study, based on the first-principles calculations, we systematically investigated the electronic and magnetic properties of the transition metal-oxide-incorporated 2D g-C3N4 nanosheet (labeled C3N4-TM-O, TM = Sc-Mn). The results suggest that the TM-O binds to g-C3N4 nanosheets strongly for all systems. We found that the 2D C3N4-TM-O framework is ferromagnetic for TM = Sc, Ti, V, Cr, while it is antiferromagnetic for TM = Mn. All the ferromagnetic systems exhibit the half-metallic property. Furthermore, Monte Carlo simulations based on the Heisenberg model suggest that the Curie temperatures ( T c ) of the C3N4-TM-O (TM = Sc, Ti, V, Cr) framework are 169 K, 68 K, 203 K, and 190 K, respectively. Based on Bader charge analysis, we found that the origin of the half-metallicity at Fermi energy can be partially attributed to the transfer of electrons from TM atoms to the g-C3N4 nanosheet. In addition, we found that not only electrons but also holes can induce half-metallicity for 2D g-C3N4 nanosheets, which may help to understand the origin of half-metallicity for graphitic carbon nitride.

  6. Intervening sequences in a plant gene-comparison of the partial sequence of cDNA and genomic DNA of French bean phaseolin

    NASA Astrophysics Data System (ADS)

    Sun, S. M.; Slightom, J. L.; Hall, T. C.

    1981-01-01

    A plant gene coding for the major storage protein (phaseolin, G1-globulin) of the French bean was isolated from a genomic library constructed in the phage vector Charon 24A. Comparison of the nucleotide sequence of part of the gene with that of the cloned messenger RNA (cDNA) revealed the presence of three intervening sequences, all beginning with GTand ending with AG. The 5' and 3' boundaries of intervening sequences TVS-A (88 base pairs) and IVS-B (124 base pairs) are similar to those described for animal and viral genes, but the 3' boundary of IVS-C (129 base pairs) shows some differences. A sequence of 185 amino acids deduced from the cloned DMAs represents about 40% of a phaseolin polypeptide.

  7. The fidelity of replication of the three-base-pair set adenine/thymine, hypoxanthine/cytosine and 6-thiopurine/5-methyl-2-pyrimidinone with T7 DNA polymerase

    PubMed Central

    2004-01-01

    With the goal of constructing a genetic alphabet consisting of a set of three base pairs, the fidelity of replication of the three base pairs TH (5-methyl-2-pyrimidinone)/HS (6-thiopurine; thiohypoxanthine), C/H (hypoxanthine) and T/A was evaluated using T7 DNA polymerase, a polymerase with a strong 3′→5′ exonuclease activity. An evaluation of the suitability of a new base pair for replication should include both the contribution of the fidelity of a polymerase activity and the contribution of proofreading by a 3′→5′ exonuclease activity. Using a steady-state kinetics method that included the contribution of the 3′→5′ exonuclease activity, the fidelity of replication was determined. The method determined the ratio of the apparent rate constant for the addition of a deoxynucleotide to the primer across from a template base by the polymerase activity and the rate constant for removal of the added deoxynucleotide from the primer by the 3′→5′ exonuclease activity. This ratio was designated the eni (efficiency of net incorporation). The eni of the base pair C/H was equal to or greater than the eni of T/A. The eni of the base pair TH/HS was 0.1 times that of A/T for TH in the template and 0.01 times that of A/T for HS in the template. The ratio of the eni of a mismatched deoxynucleotide to the eni of a matched deoxynucleotide was a measure of the error frequency. The error frequencies were as follows: thymine or TH opposite a template hypoxanthine, 2×10−6; HS opposite a template cytosine, <3×10−4. The remaining 24 mismatched combinations of bases gave no detectable net incorporation. Two mismatches, hypoxanthine opposite a template thymine or a template TH, showed trace incorporation in the presence of a standard dNTP complementary to the next template base. T7 DNA polymerase extended the primer beyond each of the matched base pairs of the set. The level of fidelity of replication of the three base pairs with T7 DNA polymerase suggests

  8. Isoelectric point and adsorption activity of porous g-C3N4

    NASA Astrophysics Data System (ADS)

    Zhu, Bicheng; Xia, Pengfei; Ho, Wingkei; Yu, Jiaguo

    2015-07-01

    The isoelectric point (IEP) is an important physicochemical parameter of many compounds, such as oxides, hydroxides, and nitrides, and can contribute to estimation of the surface charges of compound particles at various pH conditions. In this work, three types of graphitic carbon nitrides (g-C3N4) were synthesized by directly heating melamine, thiourea, and urea. The prepared samples showed different microstructures and IEPs that influenced their adsorption activity. Differences in microstructure resulted from the various precursors used during synthesis. The IEPs of the obtained g-C3N4 were measured to be approximately 4-5, which is due to the equilibrium of chemical reactions between hydrogen ions, hydroxyl ions, and amine groups on the g-C3N4 surface. The IEP of g-C3N4 prepared from thiourea was lower than those of the corresponding samples prepared from melamine and urea. The adsorption activity of methylene blue on g-C3N4 prepared from urea and thiourea was excellent, which indicates that g-C3N4 is a promising adsorbent. This work provides a useful reference for choosing precursors with which to prepare g-C3N4 and combining g-C3N4 with other compounds in solution.

  9. Cosmochemical implications of CONSERT permittivity characterization of 67P/C-G

    NASA Astrophysics Data System (ADS)

    Levasseur-Regourd, A.; Hérique, Alain; Kofman, Wlodek; Beck, Pierre; Bonal, Lydie; Buttarazzi, Ilaria; Heggy, Essam; Lasue, Jeremie; Quirico, Eric; Zine, Sonia

    2016-10-01

    Unique information about the internal structure of the nucleus of comet 67P/C-G was provided by the CONSERT bistatic radar on-board Rosetta and Philae [1]. Analysis of the propagation of its signal throughout the small lobe indicated that the real part of the permittivity at 90 MHz is of (1.27±0.05). The first interpretation of this value using dielectric properties of mixtures of dust and ices (H2O, CO2), led to the conclusion that the comet porosity ranges between 75-85%. In addition, the dust/ice ratio was found to range between 0.4-2.6 and the permittivity of dust (including 30% of porosity) was determined to be lower than 2.9.The dust permittivity estimate is now reduced by taking into account the updated values of nucleus density and of dust/ice ratio, in order of providing further insights into the nature of the constituents of comet 67P/C-G [2]. We adopt a systematic approach: i) determination of the dust permittivity as a function of the ice (I) to dust (D) and vacuum (V) volume fraction; ii) comparison with the permittivity of meteoritic, mineral and organic materials from literature and laboratory measurements; iii) test of several composition models of the nucleus, corresponding to cosmochemical end members of 67P/C-G. For each of these models the location in the ternary I/D/V diagram is calculated based on available dielectric measurements, and confronted to the locus of 67P/C-G. The number of compliant models is small and the cosmochemical implications of each are discussed [2]. An important fraction of carbonaceous material is required in the dust in order to match CONSERT permittivity observations, establishing that comets represent a massive carbon reservoir.Support from Centre National d'Études Spatiales (CNES, France) for this work, based on observations with CONSERT on board Rosetta, is acknowledged. The CONSERT instrument was designed, built and operated by IPAG, LATMOS and MPS and was financially supported by CNES, CNRS, UJF/UGA, DLR and MPS

  10. Collision-induced dipoles and polarizabilities of pairs of hydrogen molecules: Ab initio calculations and results from spherical tensor analysis

    NASA Astrophysics Data System (ADS)

    Li, Xiaoping; Harrison, James F.; Gustafsson, Magnus; Wang, Fei; Abel, Martin; Frommhold, Lothar; Hunt, Katharine L. C.

    2012-12-01

    harmonics of the orientation angles of the intermolecular vector and of unit vectors along the molecular axes. The leading coefficients converge at long range to the predictions from perturbation theory, derived by J. E. Bohr and K. L. C. Hunt, J. Chem. Phys. 87, 3821 (1987); T. Bancewicz, W. G.az, and S. Kielich, Chem. Phys. 128, 321 (1988); and X. Li and K. L. C. Hunt, J. Chem. Phys. 100, 7875 (1994); ibid, 9276 (1994). Based on our results for Δμ, we find excellent agreement for the binary rototranslational absorption spectrum of H2 at 297.5 K as calculated by X. Li, K. L. C. Hunt, F. Wang, M. Abel, and L. Frommhold, Int. J. Spectroscopy 2010, 371201 (2010) and as determined experimentally by G. Bachet, E. R. Cohen, P. Dore, and G. Birnbaum, Can. J. Phys. 61, 591 (1983), out to ˜1500 cm-1. We have also calculated the vibrational spectra out to 20,000 cm-1, at T = 600 K, 1000 K, and 2000 K, for which there are no experimental data. We are currently working to extend the temperature range in the calculations to 7000 K, for application in modeling the spectra of cool white dwarf stars. We have used the results for Δα to calculate collision-induced rototranslational Raman spectra for H2 pairs [M. Gustafsson, L. Frommhold, X. Li, and K. L. C. Hunt, J. Chem. Phys. 130, 164314 (2009)]. Experimental results for the Raman spectra have been reported by U. Bafile, M. Zoppi, F. Barocchi, M. S. Brown, and L. Frommhold, Phys. Rev. A 40, 1654 (1989); U. Bafile, L. Ulivi, M. Zoppi, F. Barocchi, M. Moraldi, and A. Borysow, Phys. Rev. A 42, 6916 (1990); and M. S. Brown, S.-K. Wang, and L. Frommhold, Phys. Rev. A 40, 2276 (1989). Agreement between our calculations and experiment is good for both the polarized and depolarized spectra, with the remaining discrepancies probably attributable to the difference between the static (calculated) and frequency-dependent (experimental) values of Δα.

  11. Vibrational and electronic circular dichroism study of the interactions of cationic porphyrins with (dG-dC)10 and (dA-dT)10.

    PubMed

    Nový, Jakub; Urbanová, Marie

    2007-03-01

    The interactions of two different porphyrins, without axial ligands-5,10,15,20-tetrakis(1-methylpyridinium-4-yl)porphyrin-Cu(II) tetrachloride (Cu(II)TMPyP) and with bulky meso substituents-5,10,15,20-tetrakis(N,N,N-trimethylanilinium-4-yl)porphyrin tetrachloride (TMAP), with (dG-dC)10 and (dA-dT)10 were studied by combination of vibrational circular dichroism (VCD) and electronic circular dichroism (ECD) spectroscopy at different [oligonucleotide]/[porphyrin] ratios, where [oligonucleotide] and [porphyrin] are the concentrations of oligonucleotide per base-pair and porphyrin, respectively. The combination of VCD and ECD spectroscopy enables us to identify the types of interactions, and to specify the sites of interactions: The intercalative binding mode of Cu(II)TMPyP with (dG-dC)(10), which has been well described, was characterized by a new VCD "marker" and it was shown that the interaction of Cu(II)TMPyP with (dA-dT)10 via external binding to the phosphate backbone and major groove binding caused transition from the B to the non-B conformer. TMAP interacted with the major groove of (dG-dC)10, was semi-intercalated into (dA-dT)10, and caused significant variation in the structure of both oligonucleotides at the higher concentration of porphyrin. The spectroscopic techniques used in this study revealed that porphyrin binding with AT sequences caused substantial variation of the DNA structure. It was shown that VCD spectroscopy is an effective tool for the conformational studies of nucleic acid-porphyrin complexes in solution. (c) 2007 Wiley Periodicals, Inc.

  12. Ion Pairing and Diffusion in Magnesium Electrolytes Based on Magnesium Borohydride.

    PubMed

    Samuel, Devon; Steinhauser, Carl; Smith, Jeffrey G; Kaufman, Aaron; Radin, Maxwell D; Naruse, Junichi; Hiramatsu, Hidehiko; Siegel, Donald J

    2017-12-20

    One obstacle to realizing a practical, rechargeable magnesium-ion battery is the development of efficient Mg electrolytes. Electrolytes based on simple Mg(BH 4 ) 2 salts suffer from poor salt solubility and/or low conductivity, presumably due to strong ion pairing. Understanding the molecular-scale processes occurring in these electrolytes would aid in overcoming these performance limitations. Toward this goal, the present study examines the solvation, agglomeration, and transport properties of a family of Mg electrolytes based on the Mg(BH 4 ) 2 salt using classical molecular dynamics. These properties were examined across five different solvents (tetrahydrofuran and the glymes G1-G4) and at four salt concentrations ranging from the dilute limit up to 0.4 M. Significant and irreversible salt agglomeration was observed in all solvents at all nondilute Mg(BH 4 ) 2 concentrations. The degree of clustering observed in these divalent Mg systems is much larger than that reported for electrolytes containing monovalent cations, such as Li. The salt agglomeration rate and diffusivity of Mg 2+ were both observed to correlate with solvent self-diffusivity: electrolytes using longer- (shorter-) chain solvents had the lowest (highest) Mg 2+ diffusivity and agglomeration rates. Incorporation of Mg 2+ into Mg 2+ -BH 4 - clusters significantly reduces the diffusivity of Mg 2+ by restricting displacements to localized motion within largely immobile agglomerates. Consequently, diffusion is increasingly impeded with increasing Mg(BH 4 ) 2 concentration. These data are consistent with the solubility limitations observed experimentally for Mg(BH 4 ) 2 -based electrolytes and highlight the need for strategies that minimize salt agglomeration in electrolytes containing divalent cations.

  13. Base pairing among three cis-acting sequences contributes to template switching during hepadnavirus reverse transcription

    PubMed Central

    Liu, Ning; Tian, Ru; Loeb, Daniel D.

    2003-01-01

    Synthesis of the relaxed-circular (RC) DNA genome of hepadnaviruses requires two template switches during plus-strand DNA synthesis: primer translocation and circularization. Although primer translocation and circularization use different donor and acceptor sequences, and are distinct temporally, they share the common theme of switching from one end of the minus-strand template to the other end. Studies of duck hepatitis B virus have indicated that, in addition to the donor and acceptor sequences, three other cis-acting sequences, named 3E, M, and 5E, are required for the synthesis of RC DNA by contributing to primer translocation and circularization. The mechanism by which 3E, M, and 5E act was not known. We present evidence that these sequences function by base pairing with each other within the minus-strand template. 3E base-pairs with one portion of M (M3) and 5E base-pairs with an adjacent portion of M (M5). We found that disrupting base pairing between 3E and M3 and between 5E and M5 inhibited primer translocation and circularization. More importantly, restoring base pairing with mutant sequences restored the production of RC DNA. These results are consistent with the model that, within duck hepatitis B virus capsids, the ends of the minus-strand template are juxtaposed via base pairing to facilitate the two template switches during plus-strand DNA synthesis. PMID:12578983

  14. Base pairing among three cis-acting sequences contributes to template switching during hepadnavirus reverse transcription.

    PubMed

    Liu, Ning; Tian, Ru; Loeb, Daniel D

    2003-02-18

    Synthesis of the relaxed-circular (RC) DNA genome of hepadnaviruses requires two template switches during plus-strand DNA synthesis: primer translocation and circularization. Although primer translocation and circularization use different donor and acceptor sequences, and are distinct temporally, they share the common theme of switching from one end of the minus-strand template to the other end. Studies of duck hepatitis B virus have indicated that, in addition to the donor and acceptor sequences, three other cis-acting sequences, named 3E, M, and 5E, are required for the synthesis of RC DNA by contributing to primer translocation and circularization. The mechanism by which 3E, M, and 5E act was not known. We present evidence that these sequences function by base pairing with each other within the minus-strand template. 3E base-pairs with one portion of M (M3) and 5E base-pairs with an adjacent portion of M (M5). We found that disrupting base pairing between 3E and M3 and between 5E and M5 inhibited primer translocation and circularization. More importantly, restoring base pairing with mutant sequences restored the production of RC DNA. These results are consistent with the model that, within duck hepatitis B virus capsids, the ends of the minus-strand template are juxtaposed via base pairing to facilitate the two template switches during plus-strand DNA synthesis.

  15. C3G dynamically associates with nuclear speckles and regulates mRNA splicing.

    PubMed

    Shakyawar, Dhruv Kumar; Muralikrishna, Bhattiprolu; Radha, Vegesna

    2018-05-01

    C3G (Crk SH3 domain binding guanine nucleotide releasing factor) (Rap guanine nucleotide exchange factor 1), essential for mammalian embryonic development, is ubiquitously expressed and undergoes regulated nucleocytoplasmic exchange. Here we show that C3G localizes to SC35-positive nuclear speckles and regulates splicing activity. Reversible association of C3G with speckles was seen on inhibition of transcription and splicing. C3G shows partial colocalization with SC35 and is recruited to a chromatin and RNase-sensitive fraction of speckles. Its presence in speckles is dependent on intact cellular actin cytoskeleton and is lost on expression of the kinase Clk1. Rap1, a substrate of C3G, is also present in nuclear speckles, and inactivation of Rap signaling by expression of GFP-Rap1GAP alters speckle morphology and number. Enhanced association of C3G with speckles is seen on glycogen synthase kinase 3 beta inhibition or differentiation of C2C12 cells to myotubes. CRISPR/Cas9-mediated knockdown of C3G resulted in altered splicing activity of an artificial gene as well as endogenous CD44. C3G knockout clones of C2C12 as well as MDA-MB-231 cells showed reduced protein levels of several splicing factors compared with control cells. Our results identify C3G and Rap1 as novel components of nuclear speckles and a role for C3G in regulating cellular RNA splicing activity.

  16. Centromere proteins CENP-C and CAL1 functionally interact in meiosis for centromere clustering, pairing, and chromosome segregation.

    PubMed

    Unhavaithaya, Yingdee; Orr-Weaver, Terry L

    2013-12-03

    Meiotic chromosome segregation involves pairing and segregation of homologous chromosomes in the first division and segregation of sister chromatids in the second division. Although it is known that the centromere and kinetochore are responsible for chromosome movement in meiosis as in mitosis, potential specialized meiotic functions are being uncovered. Centromere pairing early in meiosis I, even between nonhomologous chromosomes, and clustering of centromeres can promote proper homolog associations in meiosis I in yeast, plants, and Drosophila. It was not known, however, whether centromere proteins are required for this clustering. We exploited Drosophila mutants for the centromere proteins centromere protein-C (CENP-C) and chromosome alignment 1 (CAL1) to demonstrate that a functional centromere is needed for centromere clustering and pairing. The cenp-C and cal1 mutations result in C-terminal truncations, removing the domains through which these two proteins interact. The mutants show striking genetic interactions, failing to complement as double heterozygotes, resulting in disrupted centromere clustering and meiotic nondisjunction. The cluster of meiotic centromeres localizes to the nucleolus, and this association requires centromere function. In Drosophila, synaptonemal complex (SC) formation can initiate from the centromere, and the SC is retained at the centromere after it disassembles from the chromosome arms. Although functional CENP-C and CAL1 are dispensable for assembly of the SC, they are required for subsequent retention of the SC at the centromere. These results show that integral centromere proteins are required for nuclear position and intercentromere associations in meiosis.

  17. KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry.

    PubMed

    Betz, Karin; Malyshev, Denis A; Lavergne, Thomas; Welte, Wolfram; Diederichs, Kay; Dwyer, Tammy J; Ordoukhanian, Phillip; Romesberg, Floyd E; Marx, Andreas

    2012-07-01

    Many candidate unnatural DNA base pairs have been developed, but some of the best-replicated pairs adopt intercalated structures in free DNA that are difficult to reconcile with known mechanisms of polymerase recognition. Here we present crystal structures of KlenTaq DNA polymerase at different stages of replication for one such pair, dNaM-d5SICS, and show that efficient replication results from the polymerase itself, inducing the required natural-like structure.

  18. Polymorphisms of endothelin 1 (G5665T and T-1370G) and endothelin receptor type A (C+70G and G-231A) in Graves' disease.

    PubMed

    Aydın, A Fatih; Develi-İş, Seval; Doğru-Abbasoğlu, Semra; Vural, Pervin; Ozderya, Ayşenur; Karadağ, Berrin; Uysal, Müjdat

    2014-01-01

    Endothelin 1 (EDN1) is a strong angiogenic and mitogenic factor, playing a key role in hypervascularization, thyroid follicle cell hyperplasia, and lymphocyte infiltration in the thyroid gland of patients with Graves' disease (GD). EDN1 induces angiogenesis and mitogenesis via endothelin receptor type A (EDNRA). This study examined the possible association of EDN1 (G5665T and T-1370G) and EDNRA (C+70G and G-231A) single nucleotide polymorphisms (SNPs) with the occurrence of GD, and evaluates the relationship between genotypes and clinical/laboratory manifestations of GD. We analyzed genotype and allele distributions of EDN1 and EDNRA polymorphisms in 165 patients with GD and 181 healthy controls by real-time PCR combined with melting curve analysis. No significant associations between GD and variant alleles of the studied polymorphisms were observed. However, the anti-thyroid peroxidase (anti-TPO) and anti-thyroglobulin (anti-TG) levels in EDN1 G5665T GG genotype were higher than those in T allele carriers (GT+TT) (p=0.001 and p=0.026, respectively). In addition, anti-TPO levels in EDN1 T-1370G wild-type homozygous patients were found to be higher than in mutant gene carrying patients (GT+GG) (p=0.006). The presence of EDNRA+70G allele was associated with 3.37-fold increased risk for development of ophthalmopathy in GD patients (p=0.009). Although there were no associations between EDN1 (G5665T and T-1370G) and EDNRA (C+70G and G-231A) SNPs and susceptibility to GD, EDN1 G5665T and T-1370G polymorphisms were related to alterations of autoantibody production and EDNRA C+70G polymorphism is related with increased risk for ophthalmopathy in GD patients. Copyright © 2013 Elsevier B.V. All rights reserved.

  19. Concealed d -wave pairs in the s ± condensate of iron-based superconductors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ong, Tzen; Coleman, Piers; Schmalian, Jörg

    A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave (s ±) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. In this paper, we propose a new class of s ± statemore » containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave (L=2) motion of the pairs with the internal angular momenta I =2 of the iron orbitals to make a singlet (J =L+I =0), an s ± superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba 1$-$xK XFe 2As 2 as a reconfiguration of the orbital and internal angular momentum into a high spin (J =L+I =4) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. Finally, the formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.« less

  20. Concealed d -wave pairs in the s ± condensate of iron-based superconductors

    DOE PAGES

    Ong, Tzen; Coleman, Piers; Schmalian, Jörg

    2016-05-02

    A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave (s ±) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. In this paper, we propose a new class of s ± statemore » containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave (L=2) motion of the pairs with the internal angular momenta I =2 of the iron orbitals to make a singlet (J =L+I =0), an s ± superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba 1$-$xK XFe 2As 2 as a reconfiguration of the orbital and internal angular momentum into a high spin (J =L+I =4) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. Finally, the formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.« less

  1. Concealed d-wave pairs in the s± condensate of iron-based superconductors.

    PubMed

    Ong, Tzen; Coleman, Piers; Schmalian, Jörg

    2016-05-17

    A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave ([Formula: see text]) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. Here, we propose a new class of [Formula: see text] state containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave ([Formula: see text]) motion of the pairs with the internal angular momenta [Formula: see text] of the iron orbitals to make a singlet ([Formula: see text]), an [Formula: see text] superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba1-x KXFe2As2 as a reconfiguration of the orbital and internal angular momentum into a high spin ([Formula: see text]) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. The formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.

  2. Use of Single-Layer g-C3N4/Ag Hybrids for Surface-Enhanced Raman Scattering (SERS)

    PubMed Central

    Jiang, Jizhou; Zou, Jing; Wee, Andrew Thye Shen; Zhang, Wenjing

    2016-01-01

    Surface-enhanced Raman scattering (SERS) substrates with high activity and stability are desirable for SERS sensing. Here, we report a new single atomic layer graphitic-C3N4 (S-g-C3N4) and Ag nanoparticles (NPs) hybrid as high-performance SERS substrates. The SERS mechanism of the highly stable S-g-C3N4/Ag substrates was systematically investigated by a combination of experiments and theoretical calculations. From the results of XPS and Raman spectroscopies, it was found that there was a strong interaction between S-g-C3N4 and Ag NPs, which facilitates the uniform distribution of Ag NPs over the edges and surfaces of S-g-C3N4 nanosheets, and induces a charge transfer from S-g-C3N4 to the oxidizing agent through the silver surface, ultimately protecting Ag NPs from oxidation. Based on the theoretical calculations, we found that the net surface charge of the Ag atoms on the S-g-C3N4/Ag substrates was positive and the Ag NPs presented high dispersibility, suggesting that the Ag atoms on the S-g-C3N4/Ag substrates were not likely to be oxidized, thereby ensuring the high stability of the S-g-C3N4/Ag substrate. An understanding of the stability mechanism in this system can be helpful for developing other effective SERS substrates with long-term stability. PMID:27687573

  3. One-pot, self-assembled hydrothermal synthesis of 3D flower-like CuS/g-C3N4 composite with enhanced photocatalytic activity under visible-light irradiation

    NASA Astrophysics Data System (ADS)

    Khan, Azam; Alam, Umair; Raza, Waseem; Bahnemann, D.; Muneer, M.

    2018-04-01

    Novel visible-light-driven 3D flower-like CuS/g-C3N4 composites have been synthesized by different wt% of CuS using hydrothermal method and characterized by standard analytical techniques such as XRD, FTIR, XPS, BET, UV-Vis DRS spectroscopy, SEM-EDS, and TEM. SEM and TEM analyses showed an intimate interfacial contact between flower-like CuS and g-C3N4 sheet. The synthesized composite materials (CuS/g-C3N4) showed excellent photocatalytic activity for the decolorization of methylene blue (MB) in aqueous suspension under visible-light irradiation, compared with pure CuS and g-C3N4. Among various composites of CuS/g-C3N4, 10 wt% of CuS showed highest photocatalytic activity for the decolorization of dye (MB). This remarkably improved photocatalytic performance of the synthesized materials could be attributed to the synergistic interaction between CuS and g-C3N4, leading to prolonged lifetime of photo-generated e- and h+ pair through the Z-scheme system. A probable Z-scheme mechanism explaining the origin of enhanced performance of the composite material has been proposed. This work not only provides a facile way to synthesize 3D flower-like heterostructure, but also renders rational design for the development of highly efficient Z-scheme photocatalytic systems.

  4. Cytoadhesion to gC1qR through Plasmodium falciparum Erythrocyte Membrane Protein 1 in Severe Malaria

    PubMed Central

    Magallón-Tejada, Ariel; Machevo, Sónia; Cisteró, Pau; Lavstsen, Thomas; Aide, Pedro; Jiménez, Alfons; Turner, Louise; Gupta, Himanshu; De Las Salas, Briegel; Mandomando, Inacio; Wang, Christian W.; Petersen, Jens E. V.; Muñoz, Jose; Gascón, Joaquim; Macete, Eusebio; Alonso, Pedro L.; Chitnis, Chetan E.

    2016-01-01

    Cytoadhesion of Plasmodium falciparum infected erythrocytes to gC1qR has been associated with severe malaria, but the parasite ligand involved is currently unknown. To assess if binding to gC1qR is mediated through the P. falciparum erythrocyte membrane protein 1 (PfEMP1) family, we analyzed by static binding assays and qPCR the cytoadhesion and var gene transcriptional profile of 86 P. falciparum isolates from Mozambican children with severe and uncomplicated malaria, as well as of a P. falciparum 3D7 line selected for binding to gC1qR (Pf3D7gC1qR). Transcript levels of DC8 correlated positively with cytoadhesion to gC1qR (rho = 0.287, P = 0.007), were higher in isolates from children with severe anemia than with uncomplicated malaria, as well as in isolates from Europeans presenting a first episode of malaria (n = 21) than Mozambican adults (n = 25), and were associated with an increased IgG recognition of infected erythrocytes by flow cytometry. Pf3D7gC1qR overexpressed the DC8 type PFD0020c (5.3-fold transcript levels relative to Seryl-tRNA-synthetase gene) compared to the unselected line (0.001-fold). DBLβ12 from PFD0020c bound to gC1qR in ELISA-based binding assays and polyclonal antibodies against this domain were able to inhibit binding to gC1qR of Pf3D7gC1qR and four Mozambican P. falciparum isolates by 50%. Our results show that DC8-type PfEMP1s mediate binding to gC1qR through conserved surface epitopes in DBLβ12 domain which can be inhibited by strain-transcending functional antibodies. This study supports a key role for gC1qR in malaria-associated endovascular pathogenesis and suggests the feasibility of designing interventions against severe malaria targeting this specific interaction. PMID:27835682

  5. Engineering activity and stability of Thermotoga maritima glutamate dehydrogenase. I. Introduction of a six-residue ion-pair network in the hinge region.

    PubMed

    Lebbink, J H; Knapp, S; van der Oost, J; Rice, D; Ladenstein, R; de Vos, W M

    1998-07-10

    Comparison of the recently determined three-dimensional structures of several glutamate dehydrogenases allowed for the identification of a five-residue ion-pair network in the hinge region of Pyrococcus furiosus glutamate dehydrogenase (melting temperature 113 degrees C), that is not present in the homologous glutamate dehydrogenase from Thermotoga maritima (melting temperature 93 degrees C). In order to study the role of this ion-pair network, we introduced it into the T. maritima enzyme using a site-directed mutagenesis approach. The resulting T. maritima glutamate dehydrogenases N97D, G376 K and N97D/G376 K as well as the wild-type enzyme were overproduced in Escherichia coli and subsequently purified. Elucidation of the three-dimensional structure of the double mutant N97D/G376 K at 3.0 A, showed that the designed ion-pair interactions were indeed formed. Moreover, because of interactions with an additional charged residue, a six-residue network is present in this double mutant. Melting temperatures of the mutant enzymes N97D, G376 K and N97D/G376 K, as determined by differential scanning calorimetry, did not differ significantly from that of the wild-type enzyme. Identical transition midpoints in guanidinium chloride-induced denaturation experiments were found for the wild-type and all mutant enzymes. Thermal inactivation at 85 degrees C occured more than twofold faster for all mutant enzymes than for the wild-type glutamate dehydrogenase. At temperatures of 65 degrees C and higher, the wild-type and the three mutant enzymes showed identical specific activities. However, at 58 degrees C the specific activity of N97D/G376 K and G376 K was found to be significantly higher than that of the wild-type and N97D enzymes. These results suggest that the engineered ion-pair interactions in the hinge region do not affect the stability towards temperature or guanidinium chloride-induced denaturation but rather affect the specific activity of the enzyme and the temperature

  6. Guide-substrate base-pairing requirement for box H/ACA RNA-guided RNA pseudouridylation.

    PubMed

    De Zoysa, Meemanage D; Wu, Guowei; Katz, Raviv; Yu, Yi-Tao

    2018-06-05

    Box H/ACA RNAs are a group of small RNAs found in abundance in eukaryotes (as well as in archaea). Although their sequences differ, eukaryotic box H/ACA RNAs all share the same unique hairpin-hinge-hairpin-tail structure. Almost all of them function as guides that primarily direct pseudouridylation of rRNAs and spliceosomal snRNAs at specific sites. Although box H/ACA RNA-guided pseudouridylation has been extensively studied, the detailed rules governing this reaction, especially those concerning the guide RNA-substrate RNA base-pairing interactions that determine the specificity and efficiency of pseudouridylation, are still not exactly clear. This is particularly relevant given that the lengths of the guide sequences involved in base-pairing vary from one box H/ACA RNA to another. Here, we carry out a detailed investigation into guide-substrate base-pairing interactions, and identify the minimum number of base-pairs (8), required for RNA-guided pseudouridylation. In addition, we find that the pseudouridylation pocket, present in each hairpin of box H/ACA RNA, exhibits flexibility in fitting slightly different substrate sequences. Our results are consistent across three independent pseudouridylation pockets tested, suggesting that our findings are generally applicable to box H/ACA RNA-guided RNA pseudouridylation. Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  7. Association between VEGF polymorphisms (936c/t, -460t/c and -634g/c) with haplotypes and coronary heart disease susceptibility.

    PubMed

    Han, Xia; Liu, Lili; Niu, Jiamin; Yang, Jun; Zhang, Zengtang; Zhang, Zhiqiang

    2015-01-01

    Our aim was to investigate the association between single nucleotide polymorphisms (SNPs) of vascular endothelial growth factor (VEGF) and coronary heart disease (CHD) susceptibility in Chinese Han population. 144 CHD patients and 150 healthy individuals were enrolled in the study. Three SNPs (936C/T, -460T/C and -634G/C) of VEGF were chose and then were genotyped with Sequenom time-of-flight mass spectrometry (TOFMS). Odds ratio (OR) with 95% confidence interval (CI) were used to evaluate the association of genotypes and haplotypes and CHD susceptibility. The frequencies of -460T/C CC genotype (13.6%) was found higher in the case group than that of control group (6.7%), which indicated that CC genotype was a risk factor for CHD (OR=2.50, 95% CI=1.10-5.68). Correspondently, the C allele appeared to increase the risk of CHD (OR=1.54, 95% CI=1.07-2.22). For -634G/C polymorphism, the risk of the CC genotype carrier for CHD increased 2.24 fold compared to the wild genotype. Moreover, -634G/CC allele was significantly associated with CHD susceptibility (OR=1.65, 95% CI=1.15-2.36). In addition, +936C/T CT genotype and C allele appeared to be a genetic-susceptibility factors for CHD (OR=2.43, 95% CI=1.44-4.10; OR=1.95, 95% CI=1.26-3.02). The haplotype analysis showed that T-C-T, C-C-C and C-G-C haplotypes all could increase the risk for CHD (OR: 2.43, 2.77 and 2.33). we concluded VEGF polymorphisms were associated with CHD susceptibility. Moreover, the haplotypes of T-C-T, C-C-C and C-G-C all could increase the risk for CHD.

  8. Synthesis of novel and stable g-C3N4-Bi2WO6 hybrid nanocomposites and their enhanced photocatalytic activity under visible light irradiation.

    PubMed

    Li, Haitao; Li, Na; Wang, Ming; Zhao, Beiping; Long, Fei

    2018-03-01

    Graphitic carbon nitride (g-C 3 N 4 ) nanosheets with a thickness of only a few nanometres were obtained by a facile deammoniation treatment of bulk g-C 3 N 4 and were further hybridized with Bi 2 WO 6 nanoparticles on the surface via a solvothermal method. The composite photocatalysts were characterized by powder X-ray diffraction, scanning electron microscopy, transmission electron microscopy, UV-vis diffuse reflection spectroscopy and X-ray photoelectron spectroscopy (XPS). The HR-TEM results show that the nano-sized Bi 2 WO 6 particles were finely distributed on g-C 3 N 4 sheet surface, which forms heterojunction structure. The UV-vis diffuse reflectance spectra (DRS) show that the absorption edge of composite photocatalysts shifts towards lower energy region in comparison with those of pure g-C 3 N 4 and Bi 2 WO 6 . The degradation of methyl orange (MO) tests reveals that the optimum activity of 8 : 2 g-C 3 N 4 -Bi 2 WO 6 photocatalyst is almost 2.7 and 8.5 times higher than those of individual g-C 3 N 4 and Bi 2 WO 6 . Moreover, the recycle experiments depict high stability of the composite photocatalysts. Through the study of the influencing factors, a possible photocatalytic mechanism is proposed. The enhancement in both photocatalytic performance and stability was caused by the synergistic effect, including the effective separation of the photogenerated electron-hole pairs at the interface of g-C 3 N 4 and Bi 2 WO 6 , the smaller the particle size and the relatively larger specific surface area of the composite photocatalyst.

  9. Thermal transport in topological-insulator-based superconducting hybrid structures with mixed singlet and triplet pairing states.

    PubMed

    Li, Hai; Zhao, Yuan Yuan

    2017-11-22

    In the framework of the Bogoliubov-de Gennes equation, we investigate the thermal transport properties in topological-insulator-based superconducting hybrid structures with mixed spin-singlet and spin-triplet pairing states, and emphasize the different manifestations of the spin-singlet and spin-triplet pairing states in the thermal transport signatures. It is revealed that the temperature-dependent differential thermal conductance strongly depends on the components of the pairing state, and the negative differential thermal conductance only occurs in the spin-singlet pairing state dominated regime. It is also found that the thermal conductance is profoundly sensitive to the components of the pairing state. In the spin-singlet pairing state controlled regime, the thermal conductance obviously oscillates with the phase difference and junction length. With increasing the proportion of the spin-triplet pairing state, the oscillating characteristic of the thermal conductance fades out distinctly. These results suggest an alternative route for distinguishing the components of pairing states in topological-insulator-based superconducting hybrid structures.

  10. Atomic-scale Visualization of Electronic Nematicity and Cooper Pairing in Iron-based Superconductors

    NASA Astrophysics Data System (ADS)

    Allan, Milan P.

    2013-03-01

    The mechanism of high-temperature superconductivity in the relatively novel iron-based high-Tc superconductors is unresolved, both in terms of how the phases evolve with doping, and in terms of the actual Cooper pairing process. To explore these issues, we used spectroscopic-imaging scanning tunneling microscopy to study the electronic structure of CaFe2As2 in the antiferromagnetic-orthorhombic `parent' state from which the superconductivity emerges. We discovered and visualized the now widely studied electronic `nematicity' of this phase, whose suppression is associated with the emergence of superconductivity (Science 327, 181, 2010). As subsequent transport experiments discovered a related anisotropic conductance which increases with dopant concentration, the interplay between the electronic structure surrounding each dopant atom, quasiparticle scattering therefrom, and the transport nematicity has become a pivotal focus of research. We find that substituting Co for Fe atoms in underdoped Ca(Fe1-xCox)2As2 generates a dense population of identical and strongly anisotropic impurity states that are distributed randomly but aligned with the antiferromagnetic a-axis. We also demonstrate, by imaging their surrounding interference patterns, that these impurity states scatter quasiparticles and thus influence transport in a highly anisotropic manner (M.P. Allan et al., 2013). Next, we studied the momentum dependence of the energy gaps of iron-based superconductivity, now focusing on LiFeAs. If strong electron-electron interactions mediate the Cooper pairing, then momentum-space anisotropic superconducting energy gaps Δi (k) were predicted by multiple techniques to appear on the different electronic bands i. We introduced intraband Bogoliubov quasiparticle scattering interference (QPI) techniques for the determination of anisotropic energy gaps to test these hypotheses and discovered the anisotropy, magnitude, and relative orientations of the energy gaps on multiple

  11. tRNAHis guanylyltransferase catalyzes a 3'-5' polymerization reaction that is distinct from G-1 addition.

    PubMed

    Jackman, Jane E; Phizicky, Eric M

    2006-06-06

    Yeast tRNA(His) guanylyltransferase, Thg1, is an essential protein that adds a single guanine to the 5' end (G(-1)) of tRNA(His). This G(-1) residue is required for aminoacylation of tRNA(His) by histidyl-tRNA synthetase, both in vitro and in vivo. The guanine nucleotide addition reaction catalyzed by Thg1 extends the polynucleotide chain in the reverse (3'-5') direction of other known polymerases, albeit by one nucleotide. Here, we show that alteration of the 3' end of the Thg1 substrate tRNA(His) unleashes an unexpected reverse polymerase activity of wild-type Thg1, resulting in the 3'-5' addition of multiple nucleotides to the tRNA, with efficiency comparable to the G(-1) addition reaction. The addition of G(-1) forms a mismatched G.A base pair at the 5' end of tRNA(His), and, with monophosphorylated tRNA substrates, it is absolutely specific for tRNA(His). By contrast, reverse polymerization forms multiple G.C or C.G base pairs, and, with preactivated tRNA species, it can initiate at positions other than -1 and is not specific for tRNA(His). Thus, wild-type Thg1 catalyzes a templated polymerization reaction acting in the reverse direction of that of canonical DNA and RNA polymerases. Surprisingly, Thg1 can also readily use dNTPs for nucleotide addition. These results suggest that 3'-5' polymerization represents either an uncharacterized role for Thg1 in RNA or DNA repair or metabolism, or it may be a remnant of an earlier catalytic strategy used in nature.

  12. Bulk Micromachined 6H-SiC High-g Piezoresistive Accelerometer Fabricated and Tested

    NASA Technical Reports Server (NTRS)

    Okojie, Robert S.

    2002-01-01

    High-g accelerometers are needed in certain applications, such as in the study and analysis of high-g impact landings and projectiles. Also, these accelerometers must survive the high electromagnetic fields associated with the all-electric vehicle technology needed for aerospace applications. The choice of SiC is largely due to its excellent thermomechanical properties over conventional silicon-based accelerometers, whose material properties inhibit applicability in high electromagnetic radiation and high temperatures (>150 C) unless more complex and sometimes costly packaging schemes are adopted. This work was the outcome of a NASA Glenn Research Center summer internship program, in collaboration with Cornell University and the Munitions Directorate of the U.S. Air Force in Eglin, Florida. It aimed to provide the enabling technology infrastructure (modeling, fabrication, and validation) for the implementation of SiC accelerometers designed specifically for harsh environments.

  13. Solution structure and base pair opening kinetics of the i-motif dimer of d(5mCCTTTACC): a noncanonical structure with possible roles in chromosome stability.

    PubMed

    Nonin, S; Phan, A T; Leroy, J L

    1997-09-15

    Repetitive cytosine-rich DNA sequences have been identified in telomeres and centromeres of eukaryotic chromosomes. These sequences play a role in maintaining chromosome stability during replication and may be involved in chromosome pairing during meiosis. The C-rich repeats can fold into an 'i-motif' structure, in which two parallel-stranded duplexes with hemiprotonated C.C+ pairs are intercalated. Previous NMR studies of naturally occurring repeats have produced poor NMR spectra. This led us to investigate oligonucleotides, based on natural sequences, to produce higher quality spectra and thus provide further information as to the structure and possible biological function of the i-motif. NMR spectroscopy has shown that d(5mCCTTTACC) forms an i-motif dimer of symmetry-related and intercalated folded strands. The high-definition structure is computed on the basis of the build-up rates of 29 intraresidue and 35 interresidue nuclear Overhauser effect (NOE) connectivities. The i-motif core includes intercalated interstrand C.C+ pairs stacked in the order 2*.8/1.7*/1*.7/2.8* (where one strand is distinguished by an asterisk and the numbers relate to the base positions within the repeat). The TTTA sequences form two loops which span the two wide grooves on opposite sides of the i-motif core; the i-motif core is extended at both ends by the stacking of A6 onto C2.C8+. The lifetimes of pairs C2.C8+ and 5mC1.C7+ are 1 ms and 1 s, respectively, at 15 degrees C. Anomalous exchange properties of the T3 imino proton indicate hydrogen bonding to A6 N7 via a water bridge. The d(5mCCTTTTCC) deoxyoligonucleotide, in which position 6 is occupied by a thymidine instead of an adenine, also forms a symmetric i-motif dimer. However, in this structure the two TTTT loops are located on the same side of the i-motif core and the C.C+ pairs are formed by equivalent cytidines stacked in the order 8*.8/1.1*/7*.7/2.2*. Oligodeoxynucleotides containing two C-rich repeats can fold and dimerize

  14. Zinc induces exposure of hydrophobic sites in the C-terminal domain of gC1q-R/p33.

    PubMed

    Kumar, Rajeev; Peerschke, Ellinor I B; Ghebrehiwet, Berhane

    2002-09-01

    Endothelial cells and platelets are known to express gC1q-R on their surface. In addition to C1q, endothelial cell gC1q-R has been shown to bind high molecular weight kininogen (HK) and factor XII (FXII). However, unlike C1q, whose interaction with gC1q-R does not require divalent ions, the binding of HK to gC1q-R is absolutely dependent on the presence of zinc. However, the mechanism by which zinc modulates this interaction is not fully understood. To investigate the role of zinc, binding studies were done using the hydrophobic dye, bis-ANS. The fluorescence intensity of bis-ANS, greatly increases and the emission maximum is blue-shifted from 525 to 485nm upon binding to hydrophobic sites on proteins. In this report, we show that a blue-shift in emission maximum is also observed when bis-ANS binds to gC1q-R in the presence but not in the absence of zinc suggesting that zinc induces exposure of hydrophobic sites in the molecule. The binding of bis-ANS to gC1q-R is specific, dose-dependent, and reversible. In the presence of zinc, this binding is abrogated by monoclonal antibody 74.5.2 directed against gC1q-R residues 204-218. This segment of gC1q-R, which corresponds to the beta6 strand in the crystal structure, has been shown previously to be the binding site for HK. A similar trend in zinc-induced gC1q-R binding was also observed using the hydrophobic matrix octyl-Sepharose. Taken together, our data suggest that zinc can induce the exposure of hydrophobic sites in the C-terminal domain of gC1q-R involved in binding to HK/FXII.

  15. [Structural and Dipole Structure Peculiarities of Hoogsteen Base Pairs Formed in Complementary Nucleobases according to ab initio Quantum Mechanics Studies].

    PubMed

    Petrenko, Y M

    2015-01-01

    Ab initio quantum mechanics studies for the detection of structure and dipole structure peculiarities of Hoogsteen base pairs relative to Watson-Crick base pairs, were performed during our work. These base pairs are formed as a result of complementary interactions. It was revealed, that adenine-thymine Hoogsteen base pair and adenine-thymine Watson-Crick base pairs can be formed depending on initial configuration. Cytosine-guanine Hoogsteen pairs are formed only when cytosine was originally protonated. Both types of Hoogsteen pairs have noticeable difference in the bond distances and angles. These differences appeared in purine as well as in pyrimidine parts of the pairs. Hoogsteen pairs have mostly shorter hydrogen bond lengths and significantly larger angles of hydrogen bonds and larger angles between the hydrogen bonds than Watson-Crick base pairs. Notable differences are also observed with respect to charge distribution and dipole moment. Quantitative data on these differences are shown in our work. It is also reported that the values of local parameters (according to Cambridge classification of the parameters which determine DNA properties) in Hoogsteen base pairs, are greatly different from Watson-Crick ones.

  16. Use of Paired Serum Samples for Serodiagnosis of Typhoid Fever

    PubMed Central

    House, Deborah; Chinh, Nguyen T.; Diep, To S.; Parry, Christopher M.; Wain, John; Dougan, Gordon; White, Nicholas J.; Hien, Tran Tinh; Farrar, Jeremy J.

    2005-01-01

    Using an enzyme-linked immunosorbent assay we demonstrate that, in adult patients with typhoid fever, the sensitivity of a serological test based on the detection of anti-lipopolysaccharide immunoglobulin G is increased when used with paired serum samples taken 1 week apart. PMID:16145168

  17. Array based Discovery of Aptamer Pairs (Open Access Publisher’s Version)

    DTIC Science & Technology

    2014-12-11

    Array-based Discovery of Aptamer Pairs Minseon Cho,†,‡ Seung Soo Oh,‡ Jeff Nie,§ Ron Stewart,§ Monte J. Radeke,⊥ Michael Eisenstein,†,‡ Peter J...bidentate” target recognition, with affinities greatly exceeding either monovalent component. DNA aptamers are especially well-suited for such...constructs, because they can be linked via standard synthesis techniques without requiring chemical conjugation. Unfortunately, aptamer pairs are difficult

  18. Quantum chemical investigations of AlN-doped C60 for use as a nano-biosensor in detection of mispairing between DNA bases.

    PubMed

    Siddiqui, Shamoon Ahmad; Bouarissa, Nadir; Rasheed, Tabish; Al-Hajry, A

    2014-12-01

    Quantum chemical calculations were carried out to study the electronic structure and stability of adenine-thymine and the rare tautomer of adenine-thymine base pairs along with their Cu 2+ complexes and their interactions with AlN-modified fullerene (C58AlN) using Density Functional Theory (B3LYP method). Since, these two forms of base pairs and their Cu 2+ complexes have almost similar electronic structures, their chemical differentiation is an extremely difficult task. In this investigation, we have observed that AlN-doped C 60 could be used as a potentially viable nanoscale sensor to detect these two base pairs as well as their Cu2+ complexes.

  19. Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

    PubMed

    Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

    2011-03-14

    We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

  20. An Ultra-Sensitive Electrometer based on the Cavity-Embedded Cooper-Pair Transistor

    NASA Astrophysics Data System (ADS)

    Li, Juliang; Miller, Marco; Rimberg, Alex

    2015-03-01

    We discuss use of a cavity-embedded Cooper-pair transistor (cCPT) as a potentially quantum-limited electrometer. The cCPT consists of a Cooper pair transistor placed at the voltage antinode of a 5.7 GHz shorted quarter-wave resonator so that the CPT provides a galvanic connection between the cavity's central conductor and ground plane. The quantum inductance of the CPT, which appears in parallel with the effective inductance of the cavity resonance, can be modulated by application of either a gate voltage to the CPT island or a flux bias to the CPT/cavity loop. Changes in the CPT inductance shift the cavity resonant frequency, and therefore the phase of a microwave signal reflected from the cavity. The reflected wave is amplified by both SLUG and HEMT amplifiers before its phase is measured. Results of recent measurements on the cCPT electrometer will be compared with theoretical predictions. This work was supported by the NSF under Grant No. DMR-1104821, by the ARO under Contract No, W911NF-13-1-0377 and by AFOSR/DARPA under Agreement No. FA8750-12-2-0339.

  1. Watson-Crick base pairing controls excited-state decay in natural DNA.

    PubMed

    Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

    2014-10-13

    Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. rSNPBase 3.0: an updated database of SNP-related regulatory elements, element-gene pairs and SNP-based gene regulatory networks.

    PubMed

    Guo, Liyuan; Wang, Jing

    2018-01-04

    Here, we present the updated rSNPBase 3.0 database (http://rsnp3.psych.ac.cn), which provides human SNP-related regulatory elements, element-gene pairs and SNP-based regulatory networks. This database is the updated version of the SNP regulatory annotation database rSNPBase and rVarBase. In comparison to the last two versions, there are both structural and data adjustments in rSNPBase 3.0: (i) The most significant new feature is the expansion of analysis scope from SNP-related regulatory elements to include regulatory element-target gene pairs (E-G pairs), therefore it can provide SNP-based gene regulatory networks. (ii) Web function was modified according to data content and a new network search module is provided in the rSNPBase 3.0 in addition to the previous regulatory SNP (rSNP) search module. The two search modules support data query for detailed information (related-elements, element-gene pairs, and other extended annotations) on specific SNPs and SNP-related graphic networks constructed by interacting transcription factors (TFs), miRNAs and genes. (3) The type of regulatory elements was modified and enriched. To our best knowledge, the updated rSNPBase 3.0 is the first data tool supports SNP functional analysis from a regulatory network prospective, it will provide both a comprehensive understanding and concrete guidance for SNP-related regulatory studies. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Single-nucleotide polymorphisms g.151435C>T and g.173057T>C in PRLR gene regulated by bta-miR-302a are associated with litter size in goats.

    PubMed

    An, Xiaopeng; Hou, Jinxing; Gao, Teyang; Lei, Yingnan; Li, Guang; Song, Yuxuan; Wang, Jiangang; Cao, Binyun

    2015-06-01

    Single-nucleotide polymorphisms (SNPs) located at microRNA-binding sites (miR-SNPs) can affect the expression of genes. This study aimed to identify the miR-SNPs associated with litter size. Guanzhong (n = 321) and Boer (n = 191) goat breeds were used to detect SNPs in the caprine prolactin receptor (PRLR) gene by DNA sequencing, primer-introduced restriction analysis-polymerase chain reaction, and polymerase chain reaction-restriction fragment length polymorphism. Three novel SNPs (g.151435C>T, g.151454A>G, and g.173057T>C) were identified in the caprine PRLR gene. Statistical results indicated that the g.151435C>T and g.173057T>C SNPs were significantly associated with litter size in Guanzhong and Boer goat breeds. Further analysis revealed that combinative genotype C6 (TTAACC) was better than the others for litter size in both goat breeds. Furthermore, the PRLR g.173057T>C polymorphism was predicted to regulate the binding activity of bta-miR-302a. Luciferase reporter gene assay confirmed that 173057C to T substitution disrupted the binding site for bta-miR-302a, resulting in the reduced levels of luciferase. Taken together, these findings suggested that bta-miR-302a can influence the expression of PRLR protein by binding with 3'untranslated region, resulting in that the g.173057T>C SNP had significant effects on litter size. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Influence of nucleotide modifications at the C2' position on the Hoogsteen base-paired parallel-stranded duplex of poly(A) RNA.

    PubMed

    Copp, William; Denisov, Alexey Y; Xie, Jingwei; Noronha, Anne M; Liczner, Christopher; Safaee, Nozhat; Wilds, Christopher J; Gehring, Kalle

    2017-09-29

    Polyadenylate (poly(A)) has the ability to form a parallel duplex with Hoogsteen adenine:adenine base pairs at low pH or in the presence of ammonium ions. In order to evaluate the potential of this structural motif for nucleic acid-based nanodevices, we characterized the effects on duplex stability of substitutions of the ribose sugar with 2'-deoxyribose, 2'-O-methyl-ribose, 2'-deoxy-2'-fluoro-ribose, arabinose and 2'-deoxy-2'-fluoro-arabinose. Deoxyribose substitutions destabilized the poly(A) duplex both at low pH and in the presence of ammonium ions: no duplex formation could be detected with poly(A) DNA oligomers. Other sugar C2' modifications gave a variety of effects. Arabinose and 2'-deoxy-2'-fluoro-arabinose nucleotides strongly destabilized poly(A) duplex formation. In contrast, 2'-O-methyl and 2'-deoxy-2'-fluoro-ribo modifications were stabilizing either at pH 4 or in the presence of ammonium ions. The differential effect suggests they could be used to design molecules selectively responsive to pH or ammonium ions. To understand the destabilization by deoxyribose, we determined the structures of poly(A) duplexes with a single DNA residue by nuclear magnetic resonance spectroscopy and X-ray crystallography. The structures revealed minor structural perturbations suggesting that the combination of sugar pucker propensity, hydrogen bonding, pKa shifts and changes in hydration determine duplex stability. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Okutsu, N.; Shimamura, K.; Shimizu, E.

    To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH{sub 2} group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH{sub 2} group of G-Cmore » base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes.« less

  6. How many tautomerization pathways connect Watson-Crick-like G*·T DNA base mispair and wobble mismatches?

    PubMed

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    In this study, we have theoretically demonstrated the intrinsic ability of the wobble G·T(w)/G*·T*(w)/G·T(w1)/G·T(w2) and Watson-Crick-like G*·T(WC) DNA base mispairs to interconvert into each other via the DPT tautomerization. We have established that among all these transitions, only one single G·T(w) ↔ G*·T(WC) pathway is eligible from a biological perspective. It involves short-lived intermediate - the G·T*(WC) base mispair - and is governed by the planar, highly stable, and zwitterionic [Formula: see text] transition state stabilized by the participation of the unique pattern of the five intermolecular O6(+)H⋯O4(-), O6(+)H⋯N3(-), N1(+)H⋯N3(-), N1(+)H⋯O2(-), and N2(+)H⋯O2(-) H-bonds. This non-dissociative G·T(w) ↔ G*·T(WC) tautomerization occurs without opening of the pair: Bases within mispair remain connected by 14 different patterns of the specific intermolecular interactions that successively change each other along the IRC. Novel kinetically controlled mechanism of the thermodynamically non-equilibrium spontaneous point GT/TG incorporation errors has been suggested. The mutagenic effect of the analogues of the nucleotide bases, in particular 5-bromouracil, can be attributed to the decreasing of the barrier of the acquisition by the wobble pair containing these compounds of the enzymatically competent Watson-Crick's geometry via the intrapair mutagenic tautomerization directly in the essentially hydrophobic recognition pocket of the replication DNA-polymerase machinery. Proposed approaches are able to explain experimental data, namely growth of the rate of the spontaneous point incorporation errors during DNA biosynthesis with increasing temperature.

  7. A highly efficient g-C3N4/SiO2 heterojunction: the role of SiO2 in the enhancement of visible light photocatalytic activity.

    PubMed

    Hao, Qiang; Niu, Xiuxiu; Nie, Changshun; Hao, Simeng; Zou, Wei; Ge, Jiangman; Chen, Daimei; Yao, Wenqing

    2016-11-23

    SiO 2 , an insulator, hardly has any photocatalytic acitivity due to its intrinsic property, and it is generally used as a hard template to increase the surface area of catalysts. However, in this work, we found that the surface state of the insulator SiO 2 can promote the migration of photogenerated charge carriers, leading to the enhancement of the photooxidation ability of graphitic carbon nitride (g-C 3 N 4 ). A one-pot calcination method was employed to prepare g-C 3 N 4 /SiO 2 composites using melamine and SiO 2 as precursors. The composites present considerably high photocatalytic degradation activities for 2,4-dichlorophenol (2,4-DCP) and rhodamine B (RhB) under visible light (λ > 420 nm) irradiation, which are about 1.53 and 4.18 times as high as those of bulk g-C 3 N 4 , respectively. The enhancement of the photocatalytic activity is due to the fact that the introduction of the insulator SiO 2 in g-C 3 N 4 /SiO 2 composites can greatly improve the specific surface area of the composites; more importantly, the impurity energy level of SiO 2 can help accelerate the separation and transfer of electron-hole pairs of g-C 3 N 4 . Electron paramagnetic resonance (EPR) spectroscopy and trapping experiments with different radical scavengers show that the main active species of g-C 3 N 4 are superoxide radicals, while holes also play a role in photodegradation. For g-C 3 N 4 /SiO 2 -5, besides superoxide radicals and holes, the effect of hydroxyl radicals was greatly improved. Finally, a possible mechanism for the photogenerated charge carrier migration of the g-C 3 N 4 /SiO 2 photocatalyst was proposed.

  8. Social Networks-Based Adaptive Pairing Strategy for Cooperative Learning

    ERIC Educational Resources Information Center

    Chuang, Po-Jen; Chiang, Ming-Chao; Yang, Chu-Sing; Tsai, Chun-Wei

    2012-01-01

    In this paper, we propose a grouping strategy to enhance the learning and testing results of students, called Pairing Strategy (PS). The proposed method stems from the need of interactivity and the desire of cooperation in cooperative learning. Based on the social networks of students, PS provides members of the groups to learn from or mimic…

  9. A Family of Zinc Finger Proteins Is Required forChromosome-specific Pairing and Synapsis during Meiosis in C.elegans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Phillips, Carolyn M.; Dernburg, Abby F.

    2006-06-07

    Homologous chromosome pairing and synapsis are prerequisitefor accurate chromosome segregation during meiosis. Here, we show that afamily of four related C2H2 zinc-finger proteins plays a central role inthese events in C. elegans. These proteins are encoded within a tandemgene cluster. In addition to the X-specific HIM-8 protein, threeadditional paralogs collectively mediate the behavior of the fiveautosomes. Each chromosome relies on a specific member of the family topair and synapse with its homolog. These "ZIM" proteins concentrate atspecial regions called meiotic pairing centers on the correspondingchromosomes. These sites are dispersed along the nuclear envelope duringearly meiotic prophase, suggesting a role analogousmore » to thetelomere-mediated meiotic bouquet in other organisms. To gain insightinto the evolution of these components, wecharacterized homologs in C.briggsae and C. remanei, which revealed changes in copy number of thisgene family within the nematode lineage.« less

  10. A process-based approach to characterizing the effect of acute alprazolam challenge on visual paired associate learning and memory in healthy older adults.

    PubMed

    Pietrzak, Robert H; Scott, James Cobb; Harel, Brian T; Lim, Yen Ying; Snyder, Peter J; Maruff, Paul

    2012-11-01

    Alprazolam is a benzodiazepine that, when administered acutely, results in impairments in several aspects of cognition, including attention, learning, and memory. However, the profile (i.e., component processes) that underlie alprazolam-related decrements in visual paired associate learning has not been fully explored. In this double-blind, placebo-controlled, randomized cross-over study of healthy older adults, we used a novel, "process-based" computerized measure of visual paired associate learning to examine the effect of a single, acute 1-mg dose of alprazolam on component processes of visual paired associate learning and memory. Acute alprazolam challenge was associated with a large magnitude reduction in visual paired associate learning and memory performance (d = 1.05). Process-based analyses revealed significant increases in distractor, exploratory, between-search, and within-search error types. Analyses of percentages of each error type suggested that, relative to placebo, alprazolam challenge resulted in a decrease in the percentage of exploratory errors and an increase in the percentage of distractor errors, both of which reflect memory processes. Results of this study suggest that acute alprazolam challenge decreases visual paired associate learning and memory performance by reducing the strength of the association between pattern and location, which may reflect a general breakdown in memory consolidation, with less evidence of reductions in executive processes (e.g., working memory) that facilitate visual paired associate learning and memory. Copyright © 2012 John Wiley & Sons, Ltd.

  11. Base-Displaced Intercalated Conformation of the 2-Amino-3-methylimidazo[4,5-f]quinoline N2-dG DNA Adduct Positioned at the Nonreiterated G1 in the NarI Restriction Site

    PubMed Central

    2016-01-01

    The conformation of an N2-dG adduct arising from the heterocyclic amine 2-amino-3-methylimidazo[4,5-f]quinoline (IQ), a potent food mutagen, was determined in 5′-d(C1T2C3X4G5C6G7C8C9A10T11C12)-3′:5′-d(G13A14T15G16G17C18G19C20C21G22A23G24)-3′; X = N2-dG-IQ, in which the modified nucleotide X4 corresponds to G1 in the 5′-d(G1G2CG3CC)-3′ NarI restriction endonuclease site. Circular dichroism (CD) revealed blue shifts relative to the unmodified duplex, consistent with adduct-induced twisting, and a hypochromic effect for the IQ absorbance in the near UV region. NMR revealed that the N2-dG-IQ adduct adopted a base-displaced intercalated conformation in which the modified guanine remained in the anti conformation about the glycosidic bond, the IQ moiety intercalated into the duplex, and the complementary base C21 was displaced into the major groove. The processing of the N2-dG-IQ lesion by hpol η is sequence-dependent; when placed at the reiterated G3 position, but not at the G1 position, this lesion exhibits a propensity for frameshift replication [Choi, J. Y., et al. (2006) J. Biol. Chem., 281, 25297–25306]. The structure of the N2-dG-IQ adduct at the nonreiterated G1 position was compared to that of the same adduct placed at the G3 position [Stavros, K. M., et al. (2014) Nucleic Acids Res., 42, 3450–3463]. CD indicted minimal spectral differences between the G1 vs G3N2-dG-IQ adducts. NMR indicated that the N2-dG-IQ adduct exhibited similar base-displaced intercalated conformations at both the G1 and G3 positions. This result differed as compared to the corresponding C8-dG-IQ adducts placed at the same positions. The C8-dG-IQ adduct adopted a minor groove conformation when placed at position G1 but a base-displaced intercalated conformation when placed at position G3 in the NarI sequence. The present studies suggest that differences in lesion bypass by hpol η may be mediated by differences in the 3′-flanking sequences, perhaps modulating the ability

  12. Kinetic selection vs. free energy of DNA base pairing in control of polymerase fidelity.

    PubMed

    Oertell, Keriann; Harcourt, Emily M; Mohsen, Michael G; Petruska, John; Kool, Eric T; Goodman, Myron F

    2016-04-19

    What is the free energy source enabling high-fidelity DNA polymerases (pols) to favor incorporation of correct over incorrect base pairs by 10(3)- to 10(4)-fold, corresponding to free energy differences of ΔΔGinc∼ 5.5-7 kcal/mol? Standard ΔΔG° values (∼0.3 kcal/mol) calculated from melting temperature measurements comparing matched vs. mismatched base pairs at duplex DNA termini are far too low to explain pol accuracy. Earlier analyses suggested that pol active-site steric constraints can amplify DNA free energy differences at the transition state (kinetic selection). A recent paper [Olson et al. (2013)J Am Chem Soc135:1205-1208] used Vent pol to catalyze incorporations in the presence of inorganic pyrophosphate intended to equilibrate forward (polymerization) and backward (pyrophosphorolysis) reactions. A steady-state leveling off of incorporation profiles at long reaction times was interpreted as reaching equilibrium between polymerization and pyrophosphorolysis, yielding apparent ΔG° = -RTlnKeq, indicating ΔΔG° of 3.5-7 kcal/mol, sufficient to account for pol accuracy without need of kinetic selection. Here we perform experiments to measure and account for pyrophosphorolysis explicitly. We show that forward and reverse reactions attain steady states far from equilibrium for wrong incorporations such as G opposite T. Therefore,[Formula: see text]values obtained from such steady-state evaluations ofKeqare not dependent on DNA properties alone, but depend largely on constraints imposed on right and wrong substrates in the polymerase active site.

  13. RNAHelix: computational modeling of nucleic acid structures with Watson-Crick and non-canonical base pairs.

    PubMed

    Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju

    2017-02-01

    Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.

  14. Balancing act: Evidence for a strong subdominant d -wave pairing channel in Ba 0.6 K 0.4 Fe 2 As 2

    DOE PAGES

    Böhm, T.; Kemper, A. F.; Moritz, B.; ...

    2014-12-18

    We present detailed measurements of the temperature-dependent Raman spectra of optimally doped Ba 0.6K 0.4Fe 2As 2 and analyze the low-temperature spectra based on local-density-approximation band-structure calculations and the subsequent estimation of effective Raman vertices. Experimentally, a narrow, emergent mode appears in the B 1g (d x2-y2) Raman spectra only below T c, well into the superconducting state and at an energy below twice the energy gap on the electron Fermi-surface sheets. The Raman spectra can be reproduced quantitatively with estimates for the magnitude and momentum-space structure of an A 1g (s-wave) pairing gap on different Fermi-surface sheets, as wellmore » as the identification of the emergent sharp feature as a Bardasis-Schrieffer exciton. Formed as a Cooper-pair bound state in a subdominant d x2-y2 channel, the binding energy of the exciton relative to the gap edge shows that the coupling strength in the subdominant channel is as strong as 60% of that in the dominant s-wave channel. This result suggests that d x2-y2 may be the dominant pairing symmetry in Fe-based superconductors that lack central hole bands.« less

  15. Reduction of Werner Syndrome Protein Enhances G:C → A:T Transition by O6-Methylguanine in Human Cells.

    PubMed

    Suzuki, Tetsuya; Kuramoto, Yoshie; Kamiya, Hiroyuki

    2018-05-21

    O 6 -Methylguanine ( O 6 -MeG) is a damaged base produced by methylating reagents. The Werner syndrome protein (WRN) is a cancer-related human DNA helicase. The effects of WRN reduction on O 6 -MeG-caused mutagenesis were assessed by an siRNA-mediated knockdown in human U2OS cells, using a shuttle plasmid with a single O 6 -MeG base in the supF gene. The plasmid DNA was replicated in the cells, isolated, and electroporated into an Escherichia coli indicator strain. The lowered amount of WRN increased the frequency of mutations induced by O 6 -MeG, mainly G:C → A:T substitution. The increased mutation rate suggested that the cancer-related WRN suppresses the G:C → A:T substitution by O 6 -MeG in human cells.

  16. 28 CFR 572.40 - Compassionate release under 18 U.S.C. 4205(g).

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    .... 4205(g)) § 572.40 Compassionate release under 18 U.S.C. 4205(g). 18 U.S.C. 4205(g) was repealed... 28 Judicial Administration 2 2011-07-01 2011-07-01 false Compassionate release under 18 U.S.C. 4205(g). 572.40 Section 572.40 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE...

  17. 28 CFR 572.40 - Compassionate release under 18 U.S.C. 4205(g).

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    .... 4205(g)) § 572.40 Compassionate release under 18 U.S.C. 4205(g). 18 U.S.C. 4205(g) was repealed... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Compassionate release under 18 U.S.C. 4205(g). 572.40 Section 572.40 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE...

  18. 28 CFR 572.40 - Compassionate release under 18 U.S.C. 4205(g).

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    .... 4205(g)) § 572.40 Compassionate release under 18 U.S.C. 4205(g). 18 U.S.C. 4205(g) was repealed... 28 Judicial Administration 2 2014-07-01 2014-07-01 false Compassionate release under 18 U.S.C. 4205(g). 572.40 Section 572.40 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE...

  19. 28 CFR 572.40 - Compassionate release under 18 U.S.C. 4205(g).

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    .... 4205(g)) § 572.40 Compassionate release under 18 U.S.C. 4205(g). 18 U.S.C. 4205(g) was repealed... 28 Judicial Administration 2 2013-07-01 2013-07-01 false Compassionate release under 18 U.S.C. 4205(g). 572.40 Section 572.40 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE...

  20. 28 CFR 572.40 - Compassionate release under 18 U.S.C. 4205(g).

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    .... 4205(g)) § 572.40 Compassionate release under 18 U.S.C. 4205(g). 18 U.S.C. 4205(g) was repealed... 28 Judicial Administration 2 2012-07-01 2012-07-01 false Compassionate release under 18 U.S.C. 4205(g). 572.40 Section 572.40 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE...

  1. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

    PubMed

    Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

    2013-06-17

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. The Impact of a Peer-Learning Agent Based on Pair Programming in a Programming Course

    ERIC Educational Resources Information Center

    Han, Keun-Woo; Lee, EunKyoung; Lee, YoungJun

    2010-01-01

    This paper analyzes the educational effects of a peer-learning agent based on pair programming in programming courses. A peer-learning agent system was developed to facilitate the learning of a programming language through the use of pair programming strategies. This system is based on the role of a peer-learning agent from pedagogical and…

  3. Reversed-phase ion-pair liquid chromatography method for purification of duplex DNA with single base pair resolution

    PubMed Central

    Wysoczynski, Christina L.; Roemer, Sarah C.; Dostal, Vishantie; Barkley, Robert M.; Churchill, Mair E. A.; Malarkey, Christopher S.

    2013-01-01

    Obtaining quantities of highly pure duplex DNA is a bottleneck in the biophysical analysis of protein–DNA complexes. In traditional DNA purification methods, the individual cognate DNA strands are purified separately before annealing to form DNA duplexes. This approach works well for palindromic sequences, in which top and bottom strands are identical and duplex formation is typically complete. However, in cases where the DNA is non-palindromic, excess of single-stranded DNA must be removed through additional purification steps to prevent it from interfering in further experiments. Here we describe and apply a novel reversed-phase ion-pair liquid chromatography purification method for double-stranded DNA ranging in lengths from 17 to 51 bp. Both palindromic and non-palindromic DNA can be readily purified. This method has the unique ability to separate blunt double-stranded DNA from pre-attenuated (n-1, n-2, etc) synthesis products, and from DNA duplexes with single base pair overhangs. Additionally, palindromic DNA sequences with only minor differences in the central spacer sequence of the DNA can be separated, and the purified DNA is suitable for co-crystallization of protein–DNA complexes. Thus, double-stranded ion-pair liquid chromatography is a useful approach for duplex DNA purification for many applications. PMID:24013567

  4. 15 CFR Appendix C to Subpart G of... - Marine Conservation Area Boundary

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 15 Commerce and Foreign Trade 3 2012-01-01 2012-01-01 false Marine Conservation Area Boundary C... COASTAL RESOURCE MANAGEMENT NATIONAL MARINE SANCTUARY PROGRAM REGULATIONS Channel Islands National Marine Sanctuary Pt. 922, Subpt. G, App. C Appendix C to Subpart G of Part 922—Marine Conservation Area Boundary C...

  5. 15 CFR Appendix C to Subpart G of... - Marine Conservation Area Boundary

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 15 Commerce and Foreign Trade 3 2014-01-01 2014-01-01 false Marine Conservation Area Boundary C... COASTAL RESOURCE MANAGEMENT NATIONAL MARINE SANCTUARY PROGRAM REGULATIONS Channel Islands National Marine Sanctuary Pt. 922, Subpt. G, App. C Appendix C to Subpart G of Part 922—Marine Conservation Area Boundary C...

  6. 15 CFR Appendix C to Subpart G of... - Marine Conservation Area Boundary

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 15 Commerce and Foreign Trade 3 2011-01-01 2011-01-01 false Marine Conservation Area Boundary C... COASTAL RESOURCE MANAGEMENT NATIONAL MARINE SANCTUARY PROGRAM REGULATIONS Channel Islands National Marine Sanctuary Pt. 922, Subpt. G, App. C Appendix C to Subpart G of Part 922—Marine Conservation Area Boundary C...

  7. 15 CFR Appendix C to Subpart G of... - Marine Conservation Area Boundary

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 15 Commerce and Foreign Trade 3 2013-01-01 2013-01-01 false Marine Conservation Area Boundary C... COASTAL RESOURCE MANAGEMENT NATIONAL MARINE SANCTUARY PROGRAM REGULATIONS Channel Islands National Marine Sanctuary Pt. 922, Subpt. G, App. C Appendix C to Subpart G of Part 922—Marine Conservation Area Boundary C...

  8. 15 CFR Appendix C to Subpart G of... - Marine Conservation Area Boundary

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 15 Commerce and Foreign Trade 3 2010-01-01 2010-01-01 false Marine Conservation Area Boundary C... COASTAL RESOURCE MANAGEMENT NATIONAL MARINE SANCTUARY PROGRAM REGULATIONS Channel Islands National Marine Sanctuary Pt. 922, Subpt. G, App. C Appendix C to Subpart G of Part 922—Marine Conservation Area Boundary C...

  9. Optimization of single-base-pair mismatch discrimination in oligonucleotide microarrays

    NASA Technical Reports Server (NTRS)

    Urakawa, Hidetoshi; El Fantroussi, Said; Smidt, Hauke; Smoot, James C.; Tribou, Erik H.; Kelly, John J.; Noble, Peter A.; Stahl, David A.

    2003-01-01

    The discrimination between perfect-match and single-base-pair-mismatched nucleic acid duplexes was investigated by using oligonucleotide DNA microarrays and nonequilibrium dissociation rates (melting profiles). DNA and RNA versions of two synthetic targets corresponding to the 16S rRNA sequences of Staphylococcus epidermidis (38 nucleotides) and Nitrosomonas eutropha (39 nucleotides) were hybridized to perfect-match probes (18-mer and 19-mer) and to a set of probes having all possible single-base-pair mismatches. The melting profiles of all probe-target duplexes were determined in parallel by using an imposed temperature step gradient. We derived an optimum wash temperature for each probe and target by using a simple formula to calculate a discrimination index for each temperature of the step gradient. This optimum corresponded to the output of an independent analysis using a customized neural network program. These results together provide an experimental and analytical framework for optimizing mismatch discrimination among all probes on a DNA microarray.

  10. Highly Efficient Performance and Conversion Pathway of Photocatalytic CH3SH Oxidation on Self-Stabilized Indirect Z-Scheme g-C3N4/I3--BiOI.

    PubMed

    Hu, Lingling; He, Huanjunwa; Xia, Dehua; Huang, Yajing; Xu, Jiarong; Li, Haoyue; He, Chun; Yang, Wenjing; Shu, Dong; Wong, Po Keung

    2018-06-06

    A self-stabilized Z-scheme porous g-C 3 N 4 /I 3- -containing BiOI ultrathin nanosheets (g-C 3 N 4 /I 3- -BiOI) heterojunction photocatalyst with I 3 - /I - redox mediator was successfully synthesized by a facile solvothermal method coupling with light illumination. The structure and optical properties of g-C 3 N 4 /I 3- -BiOI composites were systematically characterized by means of X-ray diffraction, scanning electron microscopy, transmission electron microscopy, Fourier transform infrared, X-ray photoelectron spectroscopy, N 2 adsorption/desorption, UV-vis diffuse reflectance spectrum, and photoluminescence. The g-C 3 N 4 /I 3- -BiOI composites, with a heterojunction between porous g-C 3 N 4 and BiOI ultrathin nanosheets, were first applied for the photocatalytic elimination of ppm-leveled CH 3 SH under light-emitting diode visible light illumination. The g-C 3 N 4 /I 3- -BiOI heterojunction with 10% g-C 3 N 4 showed a dramatically enhanced photocatalytic activity in the removal of CH 3 SH compared with pure BiOI and g-C 3 N 4 due to its effective interfacial charge transfer and separation. The adsorption and photocatalytic oxidation of CH 3 SH over g-C 3 N 4 /I 3- -BiOI were deeply explored by in situ diffuse reflectance infrared Fourier transform spectroscopy, and the intermediates and conversion pathways were elucidated and compared. Furthermore, on the basis of reactive species trapping, electron spin resonance and Mott-Schottky experiments, it was revealed that the responsible reactive species for catalytic CH 3 SH composition were h + , • O 2 - , and 1 O 2 ; thus, the g-C 3 N 4 /I 3- -BiOI heterojunction followed an indirect all-solid state Z-scheme charge-transfer mode with self-stabilized I 3 - /I - pairs as redox mediator, which could accelerate the separation of photogenerated charge and enhance the redox reaction power of charged carriers simultaneously.

  11. In-Situ-Reduced Synthesis of Ti 3+ Self-Doped TiO 2 /g-C 3 N 4 Heterojunctions with High Photocatalytic Performance under LED Light Irradiation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Kai; Gao, Shanmin; Wang, Qingyao

    2015-04-27

    A simple one-step calcination route was used to prepare Ti3+ self-doped TiO2/g-C3N4 heterojunctions by mixture of H2Ti3O7 and melamine. X-ray diffraction (XRD), transmission electron microscopy (TEM), high-resolution transmission electron microscopy (HRTEM), X-ray photoelectron spectroscopy (XPS), electron spin resonance (ESR) spectroscopy, and UV-Vis diffuse reflectance spectroscopy (UV-vis DRS) technologies were used to characterize the structure, crystallinity, morphology, and chemical state of the as-prepared samples. The absorption of the prepared Ti3+ self-doped TiO2/g-C3N4 heterojunctions shifted to a longer wavelength region in comparison with pristine TiO2 and g-C3N4. The photocatalytic activities of the heterojunctions were studied by degrading methylene blue under a 30more » W visible-light-emitting diode irradiation source. The visible-light photocatalytic activities enhanced by the prepared Ti3+ self-doped TiO2/g-C3N4 heterojunctions were observed and proved to be better than that of pure TiO2 and g-C3N4. The photocatalysis mechanism was investigated and discussed. The intensive separation efficiency of photogenerated electron-hole in the prepared heterojunction was confirmed by photoluminescence (PL) spectra. The removal rate constant reached 0.038 min(-1) for the 22.3 wt % Ti3+ self-doped TiO2/g-C3N4 heterojunction, which was 26.76 and 7.6 times higher than that of pure TiO2 and g-C3N4, respectively. The established heterojunction between the interfaces of TiO2 nanoparticles and g-C3N4 nanosheets as well as introduced Ti3+ led to the rapid electron transfer rate and improved photoinduced electron-hole pair's separation efficiency, resulting in the improved photocatalytic performance of the Ti3+ self-doped TiO2/g-C3N4 heterojunctions.« less

  12. Survivin -31 G/C polymorphism might contribute to colorectal cancer (CRC) risk: a meta-analysis.

    PubMed

    Yao, Linhua; Hu, Yi; Deng, Zhongmin; Li, Jingjing

    2015-01-01

    Published data has shown inconsistent findings about the association of survivin -31 G/C polymorphism with the risk of colorectal cancer (CRC). This meta-analysis quantitatively assesses the results from published studies to provide a more precise estimate of the association between survivin -31 G/C polymorphism as a possible predictor of the risk of CRC. We conducted a literature search in the PubMed, Web of Science, and Cochrane Library databases. Stata 12 software was used to calculate the pooled odds ratios (ORs) with 95% confidence intervals (CIs) based on the available data from each article. Six studies including 1840 cases with CRC and 1804 controls were included in this study. Survivin -31 G/C polymorphism was associated with a significantly increased risk of CRC (OR = 1.78; 95% CI, 1.53-2.07; I(2) = 0%). In the race subgroup analysis, both Asians (OR = 1.72; 95% CI, 1.44-2.05; I(2) = 0%) and Caucasians (OR = 1.93; 95% CI, 1.46-2.55; I(2) = 0%) with survivin -31 G/C polymorphism had increased CRC risk. In the subgroup analysis according to site of CRC, survivin -31 G/C polymorphism was not associated with colon cancer risk (OR = 2.02; 95% CI, 0.79-5.22; I(2) = 82%). However, this polymorphism was significantly associated with rectum cancer risk (OR = 1.98; 95% CI, 1.42-2.74; I(2) = 0%). In the subgroup analysis by clinical stage, both early stage (I+II) and advanced stage (III+IV) were associated with survivin -31 G/C polymorphism (OR = 1.61; 95% CI, 1.20-2.16; I(2) = 0% and OR = 2.30; 95% CI, 1.70-3.13; I(2) = 0%, respectively). In the subgroup analysis by smoke status, both smokers and non-smokers with survivin -31 G/C polymorphism showed increased CRC risk (OR = 1.47; 95% CI, 1.01-2.13; I(2) = 60% and OR = 1.71; 95% CI, 1.28-2.30; I(2) = 0%, respectively). In the subgroup analysis by drink status, both drinkers and non-drinkers with survivin -31 G/C polymorphism showed increased CRC risk (OR = 1.58; 95% CI, 1.06-2.37; I(2) = 8% and OR = 1.61; 95% CI, 1

  13. All gene-sized DNA molecules in four species of hypotrichs have the same terminal sequence and an unusual 3' terminus.

    PubMed Central

    Klobutcher, L A; Swanton, M T; Donini, P; Prescott, D M

    1981-01-01

    In hypotrichous ciliates, all of the macronuclear DNA is in the form of low molecular weight molecules with an average size of approximately 2200 base pairs. Total macronuclear DNA from four hypotrichs has been shown to have inverted terminal repeats by direct sequence analysis. In Oxytricha nova, Oxytricha sp., and Stylonychia pustulata, this terminal sequence may be written as 5'-C4A4C4A4C4 ... 3'-G4T4G4T4G4T4G4T4G4 ... In Euplotes aediculatus, the sequences is similar but differs in the lengths of the duplex region (28 base pairs) and of the putative 3' extension (14 base pairs). Also in Euplotes, a second common sequence of 5 base pairs (A-A-C-T-T-T-T-G-A-A) occurs internal to the terminal repeat and a 17-base-pair heterogeneous region: 5'-C4A4C4A4C4A4C4(X)17T-T-G-A-A ... 3'-G2T4G4T4G4T4G4T4G4T4G4(X)17A-A-C-T-T ... The length of the terminal repeat sequence for O. nova was confirmed in cloned macronuclear DNA molecules. Images PMID:6265931

  14. The Simplified Aircraft-Based Paired Approach With the ALAS Alerting Algorithm

    NASA Technical Reports Server (NTRS)

    Perry, Raleigh B.; Madden, Michael M.; Torres-Pomales, Wilfredo; Butler, Ricky W.

    2013-01-01

    This paper presents the results of an investigation of a proposed concept for closely spaced parallel runways called the Simplified Aircraft-based Paired Approach (SAPA). This procedure depends upon a new alerting algorithm called the Adjacent Landing Alerting System (ALAS). This study used both low fidelity and high fidelity simulations to validate the SAPA procedure and test the performance of the new alerting algorithm. The low fidelity simulation enabled a determination of minimum approach distance for the worst case over millions of scenarios. The high fidelity simulation enabled an accurate determination of timings and minimum approach distance in the presence of realistic trajectories, communication latencies, and total system error for 108 test cases. The SAPA procedure and the ALAS alerting algorithm were applied to the 750-ft parallel spacing (e.g., SFO 28L/28R) approach problem. With the SAPA procedure as defined in this paper, this study concludes that a 750-ft application does not appear to be feasible, but preliminary results for 1000-ft parallel runways look promising.

  15. Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

    PubMed Central

    Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

    2015-01-01

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science. PMID:25973536

  16. Silver (I) as DNA glue: Ag(+)-mediated guanine pairing revealed by removing Watson-Crick constraints.

    PubMed

    Swasey, Steven M; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G

    2015-05-14

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag(+) is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg(2+). In contrast to prior studies of Ag(+) incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag(+)-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag(+) bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag(+)-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

  17. Variation, Evolution, and Correlation Analysis of C+G Content and Genome or Chromosome Size in Different Kingdoms and Phyla

    PubMed Central

    Li, Xiu-Qing; Du, Donglei

    2014-01-01

    C+G content (GC content or G+C content) is known to be correlated with genome/chromosome size in bacteria but the relationship for other kingdoms remains unclear. This study analyzed genome size, chromosome size, and base composition in most of the available sequenced genomes in various kingdoms. Genome size tends to increase during evolution in plants and animals, and the same is likely true for bacteria. The genomic C+G contents were found to vary greatly in microorganisms but were quite similar within each animal or plant subkingdom. In animals and plants, the C+G contents are ranked as follows: monocot plants>mammals>non-mammalian animals>dicot plants. The variation in C+G content between chromosomes within species is greater in animals than in plants. The correlation between average chromosome C+G content and chromosome length was found to be positive in Proteobacteria, Actinobacteria (but not in other analyzed bacterial phyla), Ascomycota fungi, and likely also in some plants; negative in some animals, insignificant in two protist phyla, and likely very weak in Archaea. Clearly, correlations between C+G content and chromosome size can be positive, negative, or not significant depending on the kingdoms/groups or species. Different phyla or species exhibit different patterns of correlation between chromosome-size and C+G content. Most chromosomes within a species have a similar pattern of variation in C+G content but outliers are common. The data presented in this study suggest that the C+G content is under genetic control by both trans- and cis- factors and that the correlation between C+G content and chromosome length can be positive, negative, or not significant in different phyla. PMID:24551092

  18. Association of the polymorphisms 292 C>T and 1304 G>A in the SLC38A4 gene with hyperglycaemia.

    PubMed

    González-Renteria, Siblie Marbey; Loera-Castañeda, Verónica; Chairez-Hernández, Isaías; Sosa-Macias, Martha; Paniagua-Castro, Norma; Lares-Aseff, Ismael; Rodríguez-Moran, Martha; Guerrero-Romero, Fernando; Galaviz-Hernández, Carlos

    2013-01-01

    The SLC38A4 gene is related to system 'A' activity, which seems to be related to impaired gluconeogenesis. The objective of this study was to determine whether the 292 C>T and 1304 G>A polymorphisms of SLC38A4 gene are associated with hyperglycaemia in humans. A total of 227 individuals were enrolled in a case-control study, in which hyperglycaemia was defined by plasma glucose levels ≥95 mg/dL. Genotyping was carried out by using real-time polymerase chain reaction. The frequency of mutant alleles of SLC38A4 gene for single-nucleotide polymorphism (SNP) 1304 G>A was 23.6% and 30.2% for SNP 292 C>T. The frequency of allele T for the SNP 292 C>T in the case and control groups did not show significant differences, whereas the frequency of allele A for the SNP 1304 G>A was significantly higher in the case group than in the control group (p = 0.04). In the logistic regression analysis, the SNP 1304 G>A [odds ratio (OR) 1.78; 95%CI 1.04-3.05, p = 0.03] but not SNP 292 C>T (OR 1.41; 95%CI 0.80-2.47, p = 0.23) showed a significant association with hyperglycaemia. After adjusting by body mass index, waist circumference and triglycerides, the SNP 1304 G>A remained significantly associated with hyperglycaemia (OR 2.13; 95%CI 1.18-3.83, p = 0.03). Pair wise linkage disequilibrium showed correlation (D' > 0.82) between 292 C>T and 1304 G>A SNPs. Haplotype association with hyperglycaemia also showed significant association between both homozygous mutant alleles (A/T) and hyperglycaemia (OR 1.68; 95%CI 1.01-2.79, p = 0.048). Our results suggest that mutant allele A for SNP 1304 G>A of SLC38A4 gene is associated with hyperglycaemia. Copyright © 2012 John Wiley & Sons, Ltd.

  19. Universal spectral signatures in pnictides and cuprates: the role of quasiparticle-pair coupling.

    PubMed

    Sacks, William; Mauger, Alain; Noat, Yves

    2017-11-08

    Understanding the physical properties of a large variety of high-T c superconductors (SC), the cuprate family as well as the more recent iron-based superconductors, is still a major challenge. In particular, these materials exhibit the 'peak-dip-hump' structure in the quasiparticle density of states (DOS). The origin of this structure is explained within our pair-pair interaction (PPI) model: The non-superconducting state consists of incoherent pairs, a 'Cooper-pair glass' which, due to the PPI, undergoes a Bose-like condensation below T c to the coherent SC state. We derive the equations of motion for the quasiparticle operators showing that the DOS 'peak-dip-hump' is caused by the coupling between quasiparticles and excited pair states, or 'super-quasiparticles'. The renormalized SC gap function becomes energy-dependent and non retarded, reproducing accurately the experimental spectra of both pnictides and cuprates, despite the large difference in gap value.

  20. Glucose-6-Phosphate Dehydrogenase (G6PD) deficiency in Greek newborns: the Mediterranean C563T mutation screening.

    PubMed

    Molou, Elina; Schulpis, Kleopatra H; Thodi, Georgia; Georgiou, Vassiliki; Dotsikas, Yannis; Papadopoulos, Konstantinos; Biti, Sofia; Loukas, Yannis L

    2014-04-01

    Glucose-6-Phosphate Dehydrogenase (G6PD) gene is located at the X-chromosome at Xq28 and the disease is recessively inherited predominantly in males. More than 400 variants have been proposed based on clinical and enzymatic studies. The aim of the current study was to identify C563T mutation in G6PD-deficient newborns and to correlate the enzyme residual activity with the presence of the mutation. Some 1189 full-term neonates aged 3-5 days old were tested for G6PD activity in dried blood spots from Guthrie cards using a commercial kit. DNA extraction from Guthrie cards and mutation identification among the deficient samples were performed with current techniques. A total of 92 (7.7%) newborns were G6PD-deficient. In 46 (50%), the mutation C563T was identified. The residual activity in C563T hemizygote males (n = 28) was statistically significantly lower (1.23 ± 0.93 U/g Hb) than that in non-C563T G6PD-deficient males (n = 25) (4.01 ± 1.20 U/g Hb, p < 0.0001) and in controls (13.6 ± 2.9 U/g Hb, p < 0.0001). In C563T heterozygote females, the estimated enzyme activity was lower than that determined in non-C563T females. Male C563T hemizygotes suffer from G6PD deficiency and severe neonatal jaundice. G6PD activity showed statistically significant correlation with total bilirubin blood levels.

  1. A Nucleus-Imaging Probe That Selectively Stabilizes a Minor Conformation of c-MYC G-quadruplex and Down-regulates c-MYC Transcription in Human Cancer Cells

    PubMed Central

    Panda, Deepanjan; Debnath, Manish; Mandal, Samir; Bessi, Irene; Schwalbe, Harald; Dash, Jyotirmayee

    2015-01-01

    The c-MYC proto-oncogene is a regulator of fundamental cellular processes such as cell cycle progression and apoptosis. The development of novel c-MYC inhibitors that can act by targeting the c-MYC DNA G-quadruplex at the level of transcription would provide potential insight into structure-based design of small molecules and lead to a promising arena for cancer therapy. Herein we report our finding that two simple bis-triazolylcarbazole derivatives can inhibit c-MYC transcription, possibly by stabilizing the c-MYC G-quadruplex. These compounds are prepared using a facile and modular approach based on Cu(I) catalysed azide and alkyne cycloaddition. A carbazole ligand with carboxamide side chains is found to be microenvironment-sensitive and highly selective for “turn-on” detection of c-MYC quadruplex over duplex DNA. This fluorescent probe is applicable to visualize the cellular nucleus in living cells. Interestingly, the ligand binds to c-MYC in an asymmetric fashion and selects the minor-populated conformer via conformational selection. PMID:26286633

  2. Enhanced photo-Fenton-like process over Z-scheme CoFe2O4/g-C3N4 Heterostructures under natural indoor light.

    PubMed

    Yao, Yunjin; Wu, Guodong; Lu, Fang; Wang, Shaobin; Hu, Yi; Zhang, Jie; Huang, Wanzheng; Wei, Fengyu

    2016-11-01

    Low-cost catalysts with high activity and stability toward producing strongly oxidative species are extremely desirable, but their development still remains a big challenge. Here, we report a novel strategy for the synthesis of a magnetic CoFe 2 O 4 /C 3 N 4 hybrid via a simple self-assembly method. The CoFe 2 O 4 /C 3 N 4 was utilized as a photo-Fenton-like catalyst for degradation of organic dyes in the presence of H 2 O 2 under natural indoor light irradiation, a green and energy-saving approach for environmental cleaning. It was found the CoFe 2 O 4 /C 3 N 4 hybrid with a CoFe 2 O 4 : g-C 3 N 4 mass ratio of 2:1 can completely degrade Rhodamine B nearly 100 % within 210 min under room-light irradiation. The effects of the amount of H 2 O 2 (0.01-0.5 M), initial dye concentration (5-20 mg/L), solution pH (3.08-10.09), fulvic acid concentration (5-50 mg/L), different dyes and catalyst stability on the organic dye degradation were investigated. The introduction of CoFe 2 O 4 on g-C 3 N 4 produced an enhanced separation efficiency of photogenerated electron - hole pairs by a Z-scheme mechanism between the interfaces of g-C 3 N 4 and CoFe 2 O 4 , leading to an excellent activity as compared with either g-C 3 N 4 or CoFe 2 O 4 and their mixture. This study demonstrates an efficient way to construct the low-cost magnetic CoFe 2 O 4 /C 3 N 4 heterojunction as a typical Z-scheme system in environmental remediation.

  3. 11 CFR 111.4 - Complaints (2 U.S.C. 437g(a)(1)).

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 11 Federal Elections 1 2012-01-01 2012-01-01 false Complaints (2 U.S.C. 437g(a)(1)). 111.4 Section... knowledge and statements based upon information and belief. (d) The complaint should conform to the... accompanied by an identification of the source of information which gives rise to the complainants belief in...

  4. 11 CFR 111.4 - Complaints (2 U.S.C. 437g(a)(1)).

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 11 Federal Elections 1 2010-01-01 2010-01-01 false Complaints (2 U.S.C. 437g(a)(1)). 111.4 Section... knowledge and statements based upon information and belief. (d) The complaint should conform to the... accompanied by an identification of the source of information which gives rise to the complainants belief in...

  5. 11 CFR 111.4 - Complaints (2 U.S.C. 437g(a)(1)).

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 11 Federal Elections 1 2011-01-01 2011-01-01 false Complaints (2 U.S.C. 437g(a)(1)). 111.4 Section... knowledge and statements based upon information and belief. (d) The complaint should conform to the... accompanied by an identification of the source of information which gives rise to the complainants belief in...

  6. 11 CFR 111.4 - Complaints (2 U.S.C. 437g(a)(1)).

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 11 Federal Elections 1 2014-01-01 2014-01-01 false Complaints (2 U.S.C. 437g(a)(1)). 111.4 Section... knowledge and statements based upon information and belief. (d) The complaint should conform to the... accompanied by an identification of the source of information which gives rise to the complainants belief in...

  7. C (G)-Band & X (I) - Band Noncoherent Radar Transponder Performance Specification Standard

    DTIC Science & Technology

    2002-04-01

    TRAINING RANGE NEVADA TEST SITE STANDARD 262-02 ELECTRONIC TRAJECTORY MEASUREMENTS GROUP C (G) – BAND & X (I) – BAND NONCOHERENT RADAR...Date 00 Apr 2002 Report Type N/A Dates Covered (from... to) - Title and Subtitle C (G)-Band & X (I) - Band Noncoherent Radar Transponder...Number of Pages 157 i STANDARD 262-02 C (G) – BAND & X (I) – BAND NONCOHERENT RADAR TRANSPONDER PERFORMANCE SPECIFICATION STANDARD APRIL 2002 Prepared by

  8. Time series regression-based pairs trading in the Korean equities market

    NASA Astrophysics Data System (ADS)

    Kim, Saejoon; Heo, Jun

    2017-07-01

    Pairs trading is an instance of statistical arbitrage that relies on heavy quantitative data analysis to profit by capitalising low-risk trading opportunities provided by anomalies of related assets. A key element in pairs trading is the rule by which open and close trading triggers are defined. This paper investigates the use of time series regression to define the rule which has previously been identified with fixed threshold-based approaches. Empirical results indicate that our approach may yield significantly increased excess returns compared to ones obtained by previous approaches on large capitalisation stocks in the Korean equities market.

  9. Heterochromatin base pair composition and diversification in holocentric chromosomes of kissing bugs (Hemiptera, Reduviidae).

    PubMed

    Bardella, Vanessa Bellini; Pita, Sebastián; Vanzela, André Luis Laforga; Galvão, Cleber; Panzera, Francisco

    2016-10-01

    The subfamily Triatominae (Hemiptera, Reduviidae) includes 150 species of blood-sucking insects, vectors of Chagas disease or American trypanosomiasis. Karyotypic information reveals a striking stability in the number of autosomes. However, this group shows substantial variability in genome size, the amount and distribution of C-heterochromatin, and the chromosome positions of 45S rDNA clusters. Here, we analysed the karyotypes of 41 species from six different genera with C-fluorescence banding in order to evaluate the base-pair richness of heterochromatic regions. Our results show a high heterogeneity in the fluorescent staining of the heterochromatin in both autosomes and sex chromosomes, never reported before within an insect subfamily with holocentric chromosomes. This technique allows a clear discrimination of the heterochromatic regions classified as similar by C-banding, constituting a new chromosome marker with taxonomic and evolutionary significance. The diverse fluorescent patterns are likely due to the amplification of different repeated sequences, reflecting an unusual dynamic rearrangement in the genomes of this subfamily. Further, we discuss the evolution of these repeated sequences in both autosomes and sex chromosomes in species of Triatominae.

  10. A rule of seven in Watson-Crick base-pairing of mismatched sequences.

    PubMed

    Cisse, Ibrahim I; Kim, Hajin; Ha, Taekjip

    2012-05-13

    Sequence recognition through base-pairing is essential for DNA repair and gene regulation, but the basic rules governing this process remain elusive. In particular, the kinetics of annealing between two imperfectly matched strands is not well characterized, despite its potential importance in nucleic acid-based biotechnologies and gene silencing. Here we use single-molecule fluorescence to visualize the multiple annealing and melting reactions of two untethered strands inside a porous vesicle, allowing us to precisely quantify the annealing and melting rates. The data as a function of mismatch position suggest that seven contiguous base pairs are needed for rapid annealing of DNA and RNA. This phenomenological rule of seven may underlie the requirement for seven nucleotides of complementarity to seed gene silencing by small noncoding RNA and may help guide performance improvement in DNA- and RNA-based bio- and nanotechnologies, in which off-target effects can be detrimental.

  11. Women’s G Tolerance

    DTIC Science & Technology

    1986-08-01

    for the groups matched by age (70 pairs), weight sickness, uncomfortable feelings of distension in arms (26 pairs), and act~vity status (84 pairs...mass-spring-damper) s ,stem Straining G tolerance, being dpendent on skeletal having a resonant frequency above about I Hz. As muscular strength and...of the women’s G tolerance stud\\ scclic variations in muscular strength and endurance. was below 0.1 Hz (11), the production of any significant

  12. Math expression retrieval using an inverted index over symbol pairs

    NASA Astrophysics Data System (ADS)

    Stalnaker, David; Zanibbi, Richard

    2015-01-01

    We introduce a new method for indexing and retrieving mathematical expressions, and a new protocol for evaluating math formula retrieval systems. The Tangent search engine uses an inverted index over pairs of symbols in math expressions. Each key in the index is a pair of symbols along with their relative distance and vertical displacement within an expression. Matched expressions are ranked by the harmonic mean of the percentage of symbol pairs matched in the query, and the percentage of symbol pairs matched in the candidate expression. We have found that our method is fast enough for use in real time and finds partial matches well, such as when subexpressions are re-arranged (e.g. expressions moved from the left to the right of an equals sign) or when individual symbols (e.g. variables) differ from a query expression. In an experiment using expressions from English Wikipedia, student and faculty participants (N=20) found expressions returned by Tangent significantly more similar than those from a text-based retrieval system (Lucene) adapted for mathematical expressions. Participants provided similarity ratings using a 5-point Likert scale, evaluating expressions from both algorithms one-at-a-time in a randomized order to avoid bias from the position of hits in search result lists. For the Lucene-based system, precision for the top 1 and 10 hits averaged 60% and 39% across queries respectively, while for Tangent mean precision at 1 and 10 were 99% and 60%. A demonstration and source code are publicly available.

  13. Influence of nucleotide modifications at the C2’ position on the Hoogsteen base-paired parallel-stranded duplex of poly(A) RNA

    PubMed Central

    Copp, William; Denisov, Alexey Y.; Xie, Jingwei; Noronha, Anne M.; Liczner, Christopher; Safaee, Nozhat

    2017-01-01

    Abstract Polyadenylate (poly(A)) has the ability to form a parallel duplex with Hoogsteen adenine:adenine base pairs at low pH or in the presence of ammonium ions. In order to evaluate the potential of this structural motif for nucleic acid-based nanodevices, we characterized the effects on duplex stability of substitutions of the ribose sugar with 2′-deoxyribose, 2′-O-methyl-ribose, 2′-deoxy-2′-fluoro-ribose, arabinose and 2′-deoxy-2′-fluoro-arabinose. Deoxyribose substitutions destabilized the poly(A) duplex both at low pH and in the presence of ammonium ions: no duplex formation could be detected with poly(A) DNA oligomers. Other sugar C2’ modifications gave a variety of effects. Arabinose and 2′-deoxy-2′-fluoro-arabinose nucleotides strongly destabilized poly(A) duplex formation. In contrast, 2′-O-methyl and 2′-deoxy-2′-fluoro-ribo modifications were stabilizing either at pH 4 or in the presence of ammonium ions. The differential effect suggests they could be used to design molecules selectively responsive to pH or ammonium ions. To understand the destabilization by deoxyribose, we determined the structures of poly(A) duplexes with a single DNA residue by nuclear magnetic resonance spectroscopy and X-ray crystallography. The structures revealed minor structural perturbations suggesting that the combination of sugar pucker propensity, hydrogen bonding, pKa shifts and changes in hydration determine duplex stability. PMID:28973475

  14. [Study of fusion of bacteriophage f2 double-stranded RNA, poly(A).poly(U), and poly(G).poly(C) in the presence of tetraethylammonium bromide].

    PubMed

    Permogorov, V I; Tiaglov, B V; Minaev, V E

    1980-01-01

    The data on the dependence of the melting curve parameters of double-stranded RNA (replicative form of RNA of f2 bacteriophage) poly(A) times poly(U) and poly(G) times poly(C) on the concentration of (C2H5)4NBr were obtained. The RNA melting range width is shown to pass through the minimum value T =2.1+/-0.1degrees at the point of inversion of relative stability of GC and AU pairs that corresponds to 4.0+/-0.1 M concentration of (C2H5)4NBr. Using the melting temperatures of poly(A) times poly(U) and poly(G) times poly(C) the rependence of Tgc-Tau parameter on (C2H5)4NBr concentration was shown. It was concluded from these data that the effect of the double-stranded RNA stacking heterogeneity was negligible in the 0-3 M range of (C2H5)4NBr concentration. Melting curves of RNA were obtained at various values of Tgc-Tau parameter. It was shown that the profile of fine structure of melting curves depends on the value of Tgc-Tau parameter.

  15. Interaction of the E. coli DNA G:T-mismatch endonuclease (vsr protein) with oligonucleotides containing its target sequence.

    PubMed

    Turner, D P; Connolly, B A

    2000-12-15

    The Escherichia coli vsr endonuclease recognises G:T base-pair mismatches in double-stranded DNA and initiates a repair pathway by hydrolysing the phosphate group 5' to the incorrectly paired T. The enzyme shows a preference for G:T mismatches within a particular sequence context, derived from the recognition site of the E. coli dcm DNA-methyltransferase (CC[A/T]GG). Thus, the preferred substrate for the vsr protein is (CT[A/T]GG), where the underlined T is opposed by a dG base. This paper provides quantitative data for the interaction of the vsr protein with a number of oligonucleotides containing G:T mismatches. Evaluation of specificity constant (k(st)/K(D); k(st)=rate constant for single turnover, K(D)=equilibrium dissociation constant) confirms vsr's preference for a G:T mismatch within a hemi-methylated dcm sequence, i.e. the best substrate is a duplex (both strands written in the 5'-3' orientation) composed of CT[A/T]GG and C(5Me)C[T/A]GG. Conversion of the mispaired T (underlined) to dU or the d(5Me)C to dC gave poorer substrates. No interaction was observed with oligonucleotides that lacked a G:T mismatch or did not possess a dcm sequence. An analysis of the fraction of active protein, by "reverse-titration" (i.e. adding increasing amounts of DNA to a fixed amount of protein followed by gel-mobility shift analysis) showed that less than 1% of the vsr endonuclease was able to bind to the substrate. This was confirmed using "competitive titrations" (where competitor oligonucleotides are used to displace a (32)P-labelled nucleic acid from the vsr protein) and burst kinetic analysis. This result is discussed in the light of previous in vitro and in vivo data which indicate that the MutL protein may be needed for full vsr activity. Copyright 2000 Academic Press.

  16. [Construction and expression of the eukaryotic expression vector carrying HSV-1 gC glycoprotein gene].

    PubMed

    Dang, Yin-li; Yan, Yan; Zhang, Xiao-xiao; Li, Pu-yuan; Yu, Lan; Zhang, Lei; Zhang, Fang-lin; Xu, Zhi-kai; Wu, Xing-an

    2011-05-01

    To stably express herpes simplex virus type 1 (HSV-1) glycoprotein C (gC) in Chinese hamster ovary cells (CHO-K1). The eukaryotic expression vector pCI-mCMV-gC-1-IRES-DHFR-L22R was constructed and transfected into CHO-K1 cells by Lipofectamine 2000. The transfected cells were selected by G418 and methotrexate (MTX). The expression of HSV-1 gC was analyzed by Slot blot. HSV-1 gC proteins were purified with His-Ni Sepharose and then detected by Western blot. The eukaryotic expression vector pCI-mCMV-gC-1-IRES-DHFR-L22R was constructed successfully. CHO-K1 cells stably expressing HSV-1 gC proteins were established and confirmed by Western blot. The HSV-1 gC proteins have been expressed successfully and have good bioactivity. The results make it possible for further study and clinical use of HSV-1 gC.

  17. Fibrosis Progression in Paired Liver Biopsies from HIV/HCV-Coinfected Patients without Prior Treatment of Hepatitis C.

    PubMed

    Leite, Andréa G B; Duarte, Maria Irma S; Mendes-Correa, Maria Cássia

    2015-01-01

    Several studies have demonstrated that HIV/hepatitis C virus (HCV)-coinfected patients experience more rapid fibrosis progression. In this study, to estimate the annual rate of direct liver fibrosis progression, we used analyses of paired biopsy samples from HIV/HCV-coinfected patients without prior treatment of hepatitis and assessed the possible association of fibrosis progression with certain clinical variables. We evaluated 30 HIV/HCV-coinfected patients, with no history of prior treatment of hepatitis C, who underwent paired liver biopsies. All patients were under antiretroviral therapy at first and second biopsies. The average annual progression rate was 0.13 fibrosis unit/year, with 36.7% of patients defined as progressors. Liver fibrosis progression was associated with alanine aminotransferase (ALT; P < .001) and aspartate aminotransferase (AST; P < .0340) levels over 3 times the upper limit of normal present at first biopsy. Elevated ALT and AST levels appear to be associated with more accelerated liver fibrosis progression among HIV/HCV-coinfected patients. © The Author(s) 2015.

  18. Water-assisted production of honeycomb-like g-C3N4 with ultralong carrier lifetime and outstanding photocatalytic activity

    NASA Astrophysics Data System (ADS)

    Wang, Zhenyu; Guan, Wei; Sun, Yanjuan; Dong, Fan; Zhou, Ying; Ho, Wing-Kei

    2015-01-01

    Graphitic carbon nitride (g-C3N4) is a visible light photocatalyst, limited by low activity mainly caused by rapid recombination of charge carriers. In the present work, honeycomb-like g-C3N4 was synthesized via thermal condensation of urea with addition of water at 450 °C for 1 h. Prolonging the condensation time caused the morphology of g-C3N4 to change from a porous honeycomb structure to a velvet-like nanoarchitecture. Unlike in previous studies, the photocatalytic activity of g-C3N4 decreased with increasing surface area. The honeycomb-like g-C3N4 with a relatively low surface area showed highly enhanced photocatalytic activity with an NO removal ratio of 48%. The evolution of NO2 intermediate was dramatically inhibited over the honeycomb-like g-C3N4. The short and long lifetimes of the charge carriers for honeycomb-like g-C3N4 were unprecedentedly prolonged to 22.3 and 165.4 ns, respectively. As a result, the honeycomb-like g-C3N4 was highly efficient and stable in activity and could be used repeatedly. Addition of water had the following multiple positive effects on g-C3N4: (1) formation of the honeycomb structure, (2) promotion of charge separation and migration, (3) enlargement of the band gap, (4) increase in production yield, and (5) decrease in energy cost. These advantages make the present preparation method for highly efficient g-C3N4 extremely appealing for large-scale applications. The active species produced from g-C3N4 under illumination were confirmed using DMPO-ESR spin-trapping, the reaction intermediate was monitored, and the reaction mechanism of photocatalytic NO oxidation by g-C3N4 was revealed. This work could provide an attractive alternative method for mass-production of highly active g-C3N4-based photocatalysts for environmental and energetic applications.Graphitic carbon nitride (g-C3N4) is a visible light photocatalyst, limited by low activity mainly caused by rapid recombination of charge carriers. In the present work, honeycomb

  19. Exactly solvable model of transitional nuclei based on dual algebraic structure for the three level pairing model in the framework of sdg interacting boson model

    NASA Astrophysics Data System (ADS)

    Jafarizadeh, M. A.; Ranjbar, Z.; Fouladi, N.; Ghapanvari, M.

    2018-01-01

    In this paper, a successful algebraic method based on the dual algebraic structure for three level pairing model in the framework of sdg IBM is proposed for transitional nuclei which show transitional behavior from spherical to gamma-unstable quantum shape phase transition. In this method complicated sdg Hamiltonian, which is a three level pairing Hamiltonian is determined easily via the exactly solvable method. This description provides a better interpretation of some observables such as BE (4) in nuclei which exhibits the necessity of inclusion of g boson in the sd IBM, while BE (4) cannot be explained in the sd boson model. Some observables such as Energy levels, BE (2), BE (4), the two neutron separation energies signature splitting of the γ-vibrational band and expectation values of the g-boson number operator are calculated and examined for 46 104 - 110Pd isotopes.

  20. N -Sm A -Sm C phase transitions probed by a pair of elastically bound colloids

    NASA Astrophysics Data System (ADS)

    M, Muhammed Rasi; Zuhail, K. P.; Roy, Arun; Dhara, Surajit

    2018-03-01

    The competing effect of surface anchoring of dispersed microparticles and elasticity of nematic and cholesteric liquid crystals has been shown to stabilize a variety of topological defects. Here we study a pair of colloidal microparticles with homeotropic and planar surface anchoring across N -Sm A -Sm C phase transitions. We show that below the Sm A -Sm C phase transition the temperature dependence of interparticle separation (D ) of colloids with homeotropic anchoring shows a power-law behavior; D ˜(1-T /TA C) α , with an exponent α ≈0.5 . For colloids with planar surface anchoring the angle between the joining line of the centers of the two colloids and the far field director shows characteristic variation elucidating the phase transitions.

  1. Degradation of Acid Orange 7 by peroxymonosulfate activated with the recyclable nanocomposites of g-C3N4 modified magnetic carbon.

    PubMed

    Guo, Furong; Lu, Jiahua; Liu, Qing; Zhang, Ping; Zhang, Aiqing; Cai, Yingjie; Wang, Qiang

    2018-08-01

    Carbon-based catalysts have attracted high attention since they are greener and cheaper, while magnetic nanomaterials are very useful in environmental application because of the easy recovery and operation given by the magnetic separability. Therefore, graphitic carbon nitride modified magnetic carbon nanocomposites Fe 3 O 4 @C/g-C 3 N 4 was prepared herein for the first time as a new carbon-based catalyst for the activation of peroxymonosulfate (PMS). The catalytic properties of Fe 3 O 4 @C/g-C 3 N 4 in activating PMS for the degradation of Acid Orange 7 (AO 7), a model organic pollutant, were investigated. AO 7 degradation efficiency was significantly enhanced after modification of Fe 3 O 4 @C with g-C 3 N 4 , and the composite Fe 3 O 4 @C/g-C 3 N 4 from loading of 5 wt% g-C 3 N 4 and calcined at 300 °C for 30 min exhibited the best performance. AO 7 could be efficiently decolorized using the "Fe 3 O 4 @C/C 3 N 4 (5%) + PSM" system within the pH range of 2-6, and 97% of AO 7 could be removed in 20 min without pH adjustment (pH = 4). Radical quenching and EPR studies confirmed that both sulfate and hydroxyl radicals produced from PMS activation were the active species responsible for the oxidation of AO 7. The degradation mechanism was suggested based on the experimental results and XPS analyses. It was proposed that the CO groups on the carbon surface of Fe 3 O 4 @C rather than the CO in g-C 3 N 4 played a key role as the active sites for PMS activation. The catalyst was magnetically separable and displayed good stability and reusability, thus providing a potentially green catalyst for sustainable remediation of organic pollutants. Copyright © 2018 Elsevier Ltd. All rights reserved.

  2. Extension of base mispairs by Taq DNA polymerase: implications for single nucleotide discrimination in PCR.

    PubMed Central

    Huang, M M; Arnheim, N; Goodman, M F

    1992-01-01

    Thermus aquaticus (Taq) DNA polymerase was used to measure the extension efficiency for all configurations of matched and mismatched base pairs at template-primer 3'-termini. The transition mispairs, A(primer).C, C.A, G.T, and T.G were extended 10(-3) to 10(-4)-fold less efficiently than their correctly paired counterparts. Relative efficiencies for extending transversion mispairs were 10(-4) to 10(-5) for T.C and T.T, about 10(-6) for A.A, and less than 10(-6) for G.A, A.G, G.G and C.C. The transversion mispair C(primer).T was extended with high efficiency, about 10(-2) compared to a correct A.T basepair. The unexpected ease of extending the C.T mismatch was not likely to have been caused by primer-template misalignment. Taq polymerase was observed to bind with similar affinities to each of the correctly paired and mispaired primer-template 3'-ends. Thus, the failure of Taq polymerase to extend mismatches efficiently appears to be an intrinsic property of the enzyme and not due to an inability to bind to 3'-terminal mispairs. For almost all of the mispairs, C.T being the exception, Taq polymerase exhibits about 100 to 1000-fold greater discrimination against mismatch extension compared to avian myeloblastosis reverse transcriptase and HIV-1 reverse transcriptase which extend most mismatched basepairs permissively. Relative mismatch extension efficiencies for Taq polymerase were measured at 45 degrees C, 55 degrees C and 70 degrees C and found to be independent of temperature. The mispair extension data should be important in designing experiments using PCR to distinguish between sequences that vary by a single nucleotide. Images PMID:1408758

  3. Efficient and Provable Secure Pairing-Free Security-Mediated Identity-Based Identification Schemes

    PubMed Central

    Chin, Ji-Jian; Tan, Syh-Yuan; Heng, Swee-Huay; Phan, Raphael C.-W.

    2014-01-01

    Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user's secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI) was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions. PMID:25207333

  4. Efficient and provable secure pairing-free security-mediated identity-based identification schemes.

    PubMed

    Chin, Ji-Jian; Tan, Syh-Yuan; Heng, Swee-Huay; Phan, Raphael C-W

    2014-01-01

    Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user's secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI) was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions.

  5. Experimental Determination of Carbon Isotope Fractionation in C-O-H-Fluids and the Carbonate-melt - Graphite System at High Temperatures

    NASA Astrophysics Data System (ADS)

    Kueter, N.; Schmidt, M. W.; Lilley, M. D.; Bernasconi, S. M.

    2017-12-01

    The understanding of deep-earth carbon fluxes depends greatly on the investigation of carbon isotope systematics in C-O-H-fluids and carbon minerals, such as graphite and diamond (C0). The isotope fractionation factors between the different C-phases and species (in e.g. a fluid) thus govern the observed isotope fractionation patterns. C-isotope fractionation factors relevant for high temperatures are mainly derived from theoretical calculations [e.g. 1,2,3] and, with few exceptions, lack experimental determinations [e.g. 4]. Hundreds of own experiments aimed at equilibrating elemental carbon (C0, graphite/diamond) with C-O-H-fluids demonstrate that kinetics reigns as no system would be closed for H on time scales and temperatures allowing for graphite to equilibrate. To overcome this problem, we performed two studies to determine the C-isotope fractionation in 1) the CO2-CO-CH4 system and 2) the carbonate-melt - graphite system. Equilibrium C-isotope fractionation factors were obtained for CO2 - CO and CH4 - CO pairs (600 - 1200°C) and graphite - Na2CO3/CaCO3melt (900 - 1500°C). Combined with the already available fractionation data for the CaCO3-CO2 pair (400-950°C) from Chacko et al. [4], we determined experimentally based C-isotope fractionation factors for C0 - CH4 and CO2 - C0 pairs by 1) Δ13CCO2-graphite = Δ13CCO2-carbonate + Δ13CCarbonate-graphite and 2) Δ13Cgraphite-CH4 = Δ13CCO2-CH4 - Δ13CCO2-graphite . Current calculated fractionation factors relevant for mantle temperatures (1100 - 1500°C) suggest C-isotope partitioning in the CO2 - C0 pair on the order of 4.2 to 2.4‰, about 2‰ less than predicted by theoretically derived factors [3]. In contrast, our calculations suggest fractionation of about 1.4 to 1.1‰ for the C0 - CH4 pair, about 1‰ higher than expected by theory [3]. [1] Richet et al. (1977) Ann. Rev. Earth Planet. Sci.; [2] Polyakov & Kharlashina (1995) GCA; [3] Bottinga (1969) GCA; [4] Chacko et al. (2001) Rev Mineral Geochem

  6. Association between -174G/C and -572G/C interleukin 6 gene polymorphisms and severe radiographic damage to the hands of Mexican patients with rheumatoid arthritis: a preliminary report.

    PubMed

    Zavaleta-Muñiz, S A; Gonzalez-Lopez, L; Murillo-Vazquez, J D; Saldaña-Cruz, A M; Vazquez-Villegas, M L; Martín-Márquez, B T; Vasquez-Jimenez, J C; Sandoval-Garcia, F; Ruiz-Padilla, A J; Fajardo-Robledo, N S; Ponce-Guarneros, J M; Rocha-Muñoz, A D; Alcaraz-Lopez, M F; Cardona-Müller, D; Totsuka-Sutto, S E; Rubio-Arellano, E D; Gamez-Nava, J I

    2016-12-19

    Several interleukin 6 gene (IL6) polymorphisms are implicated in susceptibility to rheumatoid arthritis (RA). It has not yet been established with certainty if these polymorphisms are associated with the severe radiographic damage observed in some RA patients, particularly those with the development of joint bone ankylosis (JBA). The objective of the present study was to evaluate the association between severe radiographic damage in hands and the -174G/C and -572G/C IL6 polymorphisms in Mexican Mestizo people with RA. Mestizo adults with RA and long disease duration (>5 years) were classified into two groups according to the radiographic damage in their hands: a) severe radiographic damage (JBA and/or joint bone subluxations) and b) mild or moderate radiographic damage. We compared the differences in genotype and allele frequencies of -174G/C and -572G/C IL6 polymorphisms (genotyped using polymerase chain reaction-restriction fragment length polymorphism) between these two groups. Our findings indicated that the -174G/C polymorphism of IL6 is associated with severe joint radiographic damage [maximum likelihood odds ratios (MLE_OR): 8.03; 95%CI 1.22-187.06; P = 0.03], whereas the -572G/C polymorphism of IL6 exhibited no such association (MLE_OR: 1.5; 95%CI 0.52-4.5; P = 0.44). Higher anti-cyclic citrullinated peptide antibody levels were associated with more severe joint radiographic damage (P = 0.04). We conclude that there is a relevant association between the -174G/C IL6 polymorphism and severe radiographic damage. Future studies in other populations are required to confirm our findings.

  7. Resistin -420C>G promoter variant and colorectal cancer risk.

    PubMed

    Mahmoudi, Touraj; Karimi, Khatoon; Arkani, Maral; Farahani, Hamid; Vahedi, Mohsen; Dabiri, Reza; Nobakht, Hossein; Asadi, Asadollah; Mirakhorli, Mojgan; Arshi, Benafsheh; Derakhshan, Arash; Zali, Mohammad Reza

    2014-09-30

    Obesity is associated with an increased risk of colorectal cancer (CRC), and ghrelin (GHRL) and resistin (RETN) are thought to be related to obesity. Our aim was to investigate whether GHRL and RETN gene variants are associated with CRC risk. All 414 subjects, including 197 cases with CRC and 217 controls, were genotyped for the GHRL (rs26802) and RETN (rs1862513) or -420 C>G gene variants using the PCR-RFLP method. Our findings indicated that the RETN -420 C>G "CC" genotype, compared with the "GG" and "GC" genotypes, was a marker of decreased CRC susceptibility; the difference remained significant after adjustment for age, BMI, gender, smoking status, NSAID use, and family history of CRC (p=0.020; OR=0.52, 95% CI=0.30-0.90). Furthermore, after adjustment for confounding factors, the -420 C>G "CC" genotype, compared with the "GG" genotype, was associated with a decreased risk for CRC (p=0.044; OR=0.53, 95% CI=0.29-0.98). In addition, no significant difference was observed for the GHRL (rs26802) gene variant. To our knowledge, this is the first study suggesting that the RETN -420 C>G "CC" genotype is a marker of decreased CRC susceptibility. This observation is relevant from a scientific perspective and deserves further investigations.

  8. Cold-sensitive mutants G680V and G691C of Dictyostelium myosin II confer dramatically different biochemical defects.

    PubMed

    Patterson, B; Ruppel, K M; Wu, Y; Spudich, J A

    1997-10-31

    Cold-sensitive myosin mutants represent powerful tools for dissecting discrete deficiencies in myosin function. Biochemical characterization of two such mutants, G680V and G691C, has allowed us to identify separate facets of myosin motor function perturbed by each alteration. Compared with wild type, the G680V myosin exhibits a substantially enhanced affinity for several nucleotides, decreased ATPase activity, and overoccupancy or creation of a novel strongly actin-binding state. The properties of the novel strong binding state are consistent with a partial arrest or pausing at the onset of the mechanical stroke. The G691C mutant, on the other hand, exhibits an elevated basal ATPase indicative of premature phosphate release. By releasing phosphate without a requirement for actin binding, the G691C can bypass the part of the cycle involving the mechanical stroke. The two mutants, despite having alterations in glycine residues separated by only 11 residues, have dramatically different consequences on the mechanochemical cycle.

  9. G-quadruplexes as sensing probes.

    PubMed

    Ruttkay-Nedecky, Branislav; Kudr, Jiri; Nejdl, Lukas; Maskova, Darina; Kizek, Rene; Adam, Vojtech

    2013-11-28

    Guanine-rich sequences of DNA are able to create tetrastranded structures known as G-quadruplexes; they are formed by the stacking of planar G-quartets composed of four guanines paired by Hoogsteen hydrogen bonding. G-quadruplexes act as ligands for metal ions and aptamers for various molecules. Interestingly, the G-quadruplexes form a complex with anionic porphyrin hemin and exhibit peroxidase-like activity. This review focuses on overview of sensing techniques based on G-quadruplex complexes with anionic porphyrins for detection of various analytes, including metal ions such as K+, Ca2+, Ag+, Hg2+, Cu2+, Pb2+, Sr2+, organic molecules, nucleic acids, and proteins. Principles of G-quadruplex-based detection methods involve DNA conformational change caused by the presence of analyte which leads to a decrease or an increase in peroxidase activity, fluorescence, or electrochemical signal of the used probe. The advantages of various detection techniques are also discussed.

  10. Multiconfiguration Pair-Density Functional Theory.

    PubMed

    Li Manni, Giovanni; Carlson, Rebecca K; Luo, Sijie; Ma, Dongxia; Olsen, Jeppe; Truhlar, Donald G; Gagliardi, Laura

    2014-09-09

    We present a new theoretical framework, called Multiconfiguration Pair-Density Functional Theory (MC-PDFT), which combines multiconfigurational wave functions with a generalization of density functional theory (DFT). A multiconfigurational self-consistent-field (MCSCF) wave function with correct spin and space symmetry is used to compute the total electronic density, its gradient, the on-top pair density, and the kinetic and Coulomb contributions to the total electronic energy. We then use a functional of the total density, its gradient, and the on-top pair density to calculate the remaining part of the energy, which we call the on-top-density-functional energy in contrast to the exchange-correlation energy of Kohn-Sham DFT. Because the on-top pair density is an element of the two-particle density matrix, this goes beyond the Hohenberg-Kohn theorem that refers only to the one-particle density. To illustrate the theory, we obtain first approximations to the required new type of density functionals by translating conventional density functionals of the spin densities using a simple prescription, and we perform post-SCF density functional calculations using the total density, density gradient, and on-top pair density from the MCSCF calculations. Double counting of dynamic correlation or exchange does not occur because the MCSCF energy is not used. The theory is illustrated by applications to the bond energies and potential energy curves of H2, N2, F2, CaO, Cr2, and NiCl and the electronic excitation energies of Be, C, N, N(+), O, O(+), Sc(+), Mn, Co, Mo, Ru, N2, HCHO, C4H6, c-C5H6, and pyrazine. The method presented has a computational cost and scaling similar to MCSCF, but a quantitative accuracy, even with the present first approximations to the new types of density functionals, that is comparable to much more expensive multireference perturbation theory methods.

  11. Using Pair Programming to Teach CAD Based Engineering Graphics

    ERIC Educational Resources Information Center

    Leland, Robert P.

    2010-01-01

    Pair programming was introduced into a course in engineering graphics that emphasizes solid modeling using SolidWorks. In pair programming, two students work at a single computer, and periodically trade off roles as driver (hands on the keyboard and mouse) and navigator (discuss strategy and design issues). Pair programming was used in a design…

  12. Donor-acceptor-pair emission in fluorescent 4H-SiC grown by PVT method

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Xi, E-mail: liuxi@mail.sic.ac.cn; Zhuo, Shi-Yi; Gao, Pan

    Fluorescent SiC, which contains donor and acceptor impurities with optimum concentrations, can work as a phosphor for visible light emission by donor-acceptor-pair (DAP) recombination. In this work, 3 inch N-B-Al co-doped fluorescent 4H-SiC crystals are prepared by PVT method. The p-type fluorescent 4H-SiC with low aluminum doping concentration can show intensive yellow-green fluorescence at room temperature. N-B DAP peak wavelength shifts from 578nm to 525nm and weak N-Al DAP emission occurred 403/420 nm quenches, when the temperature increases from 4K to 298K. The aluminum doping induces higher defect concentration in the fluorescent crystal and decreases optical transmissivity of the crystalmore » in the visible light range. It triggers more non-radiative recombination and light absorption losses in the crystal.« less

  13. Comparative reactivity of mismatched and unpaired bases in relation to their type and surroundings. Chemical cleavage of DNA mismatches in mutation detection analysis.

    PubMed

    Yakubovskaya, Marianna G; Belyakova, Anna A; Gasanova, Viktoria K; Belitsky, Gennady A; Dolinnaya, Nina G

    2010-07-01

    Systematic study of chemical reactivity of non-Watson-Crick base pairs depending on their type and microenvironment was performed on a model system that represents two sets of synthetic DNA duplexes with all types of mismatched and unmatched bases flanked by T.A or G.C pairs. Using comparative cleavage pattern analysis, we identified the main and additional target bases and performed quantitative study of the time course and efficacy of DNA modification caused by potassium permanganate or hydroxylamine. Potassium permanganate in combination with tetraethylammonium chloride was shown to induce DNA cleavage at all mismatched or bulged T residues, as well as at thymines of neighboring canonical pairs. Other mispaired (bulged) bases and thymine residues located on the second position from the mismatch site were not the targets for KMnO(4) attack. In contrast, hydroxylamine cleaved only heteroduplexes containing mismatched or unmatched C residues, and did not modify adjacent cytosines. However when G.C pairs flank bulged C residue, neighboring cytosines are also attacked by hydroxylamine due to defect migration. Chemical reactivity of target bases was shown to correlate strongly with the local disturbance of DNA double helix at mismatch or bulge site. With our model system, we were able to prove the absence of false-negative and false-positive results. Portion of heteroduplex reliably revealed in a mixture with corresponding homoduplex consists of 5% for bulge bases and "open" non-canonical pairs, and 10% for wobble base pairs giving minimal violations in DNA structure. This study provides a complete understanding of the principles of mutation detection methodology based on chemical cleavage of mismatches and clarifies the advantages and limitations of this approach in various biological and conformational studies of DNA. Copyright 2010 Elsevier Masson SAS. All rights reserved.

  14. Insights into the photocatalytic mechanism of mediator-free direct Z-scheme g-C3N4/Bi2MoO6(010) and g-C3N4/Bi2WO6(010) heterostructures: A hybrid density functional theory study

    NASA Astrophysics Data System (ADS)

    Opoku, Francis; Govender, Krishna Kuben; Sittert, Cornelia Gertina Catharina Elizabeth van; Govender, Penny Poomani

    2018-01-01

    Graphite-like carbon nitride (g-C3N4)-based heterostructures have received much attention due to their prominent photocatalytic activity. The g-C3N4/Bi2WO6 and g-C3N4/Bi2MoO6 heterostructures, which follow a typical hetero-junction charge transfer mechanisms show a weak potential for hydrogen evolution and reactive radical generation under visible light irradiation. A mediator-free Z-scheme g-C3N4/Bi2MoO6(010) and g-C3N4/Bi2WO6(010) heterostructures photocatalyst are designed for the first time using first-principles studies. Moreover, theoretical understanding of the underlying mechanism, the effects of interfacial composition and the role the interface play in the overall photoactivity is still unexplained. The calculated band gap of the heterostructures is reduced compared to the bulk Bi2WO6 and Bi2MoO6. In this study, we systematically calculated energy band structure, optical properties and charge transfer of the g-C3N4/Bi2MoO6(010) and g-C3N4/Bi2WO6(010) heterostructures using the hybrid density functional theory approach. The results show that the charge transfer at the interface of the heterostructures induces a built-in potential, which benefits the separation of photogenerated charge carriers. The g-C3N4/Bi2MoO6(010) heterostructure with more negative adhesion energy (-1.10 eVA-2) is predicted to have a better adsorptive ability and can form more easily compared to the g-C3N4/Bi2WO6(010) interface (-1.16 eVA-2). Therefore, our results show that the g-C3N4 interaction with Bi2MoO6 is stronger than Bi2WO6, which is also verified by the smaller vertical separation (3.25 Å) between Bi2MoO6 and g-C3N4 compared to the g-C3N4/Bi2WO6(010) interface (3.36 Å). The optical absorption verifies that these proposed Z-scheme heterostructures are excellent visible light harvesting semiconductor photocatalyst materials. This enhancement is ascribed to the role of g-C3N4 monolayer as an electron acceptor and the direct Z-scheme charge carrier transfer at the interface of

  15. The Common Prescription Patterns Based on the Hierarchical Clustering of Herb-Pairs Efficacies

    PubMed Central

    2016-01-01

    Prescription patterns are rules or regularities used to generate, recognize, or judge a prescription. Most of existing studies focused on the specific prescription patterns for diverse diseases or syndromes, while little attention was paid to the common patterns, which reflect the global view of the regularities of prescriptions. In this paper, we designed a method CPPM to find the common prescription patterns. The CPPM is based on the hierarchical clustering of herb-pair efficacies (HPEs). Firstly, HPEs were hierarchically clustered; secondly, the individual herbs are labeled by the HPEC (the clusters of HPEs); and then the prescription patterns were extracted from the combinations of HPEC; finally the common patterns are recognized statistically. The results showed that HPEs have hierarchical clustering structure. When the clustering level is 2 and the HPEs were classified into two clusters, the common prescription patterns are obvious. Among 332 candidate prescriptions, 319 prescriptions follow the common patterns. The description of the patterns is that if a prescription contains the herbs of the cluster (C 1), it is very likely to have other herbs of another cluster (C 2); while a prescription has the herbs of C 2, it may have no herbs of C 1. Finally, we discussed that the common patterns are mathematically coincident with the Blood-Qi theory. PMID:27190534

  16. Effect of the G375C and G346E achondroplasia mutations on FGFR3 activation.

    PubMed

    He, Lijuan; Serrano, Christopher; Niphadkar, Nitish; Shobnam, Nadia; Hristova, Kalina

    2012-01-01

    Two mutations in FGFR3, G380R and G375C are known to cause achondroplasia, the most common form of human dwarfism. The G380R mutation accounts for 98% of the achondroplasia cases, and thus has been studied extensively. Here we study the effect of the G375C mutation on the phosphorylation and the cross-linking propensity of full-length FGFR3 in HEK 293 cells, and we compare the results to previously published results for the G380R mutant. We observe identical behavior of the two achondroplasia mutants in these experiments, a finding which supports a direct link between the severity of dwarfism phenotypes and the level and mechanism of FGFR3 over-activation. The mutations do not increase the cross-linking propensity of FGFR3, contrary to previous expectations that the achondroplasia mutations stabilize the FGFR3 dimers. Instead, the phosphorylation efficiency within un-liganded FGFR3 dimers is increased, and this increase is likely the underlying cause for pathogenesis in achondroplasia. We further investigate the G346E mutation, which has been reported to cause achondroplasia in one case. We find that this mutation does not increase FGFR3 phosphorylation and decreases FGFR3 cross-linking propensity, a finding which raises questions whether this mutation is indeed a genetic cause for human dwarfism.

  17. Effect of the G375C and G346E Achondroplasia Mutations on FGFR3 Activation

    PubMed Central

    He, Lijuan; Serrano, Christopher; Niphadkar, Nitish; Shobnam, Nadia; Hristova, Kalina

    2012-01-01

    Two mutations in FGFR3, G380R and G375C are known to cause achondroplasia, the most common form of human dwarfism. The G380R mutation accounts for 98% of the achondroplasia cases, and thus has been studied extensively. Here we study the effect of the G375C mutation on the phosphorylation and the cross-linking propensity of full-length FGFR3 in HEK 293 cells, and we compare the results to previously published results for the G380R mutant. We observe identical behavior of the two achondroplasia mutants in these experiments, a finding which supports a direct link between the severity of dwarfism phenotypes and the level and mechanism of FGFR3 over-activation. The mutations do not increase the cross-linking propensity of FGFR3, contrary to previous expectations that the achondroplasia mutations stabilize the FGFR3 dimers. Instead, the phosphorylation efficiency within un-liganded FGFR3 dimers is increased, and this increase is likely the underlying cause for pathogenesis in achondroplasia. We further investigate the G346E mutation, which has been reported to cause achondroplasia in one case. We find that this mutation does not increase FGFR3 phosphorylation and decreases FGFR3 cross-linking propensity, a finding which raises questions whether this mutation is indeed a genetic cause for human dwarfism. PMID:22529939

  18. Enhanced performance of dye-sensitized solar cells based on organic dopant incorporated PVDF-HFP/PEO polymer blend electrolyte with g-C{sub 3}N{sub 4}/TiO{sub 2} photoanode

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Senthil, R.A.; Theerthagiri, J.; Madhavan, J., E-mail: jagan.madhavan@gmail.com

    This work describes the effect of 2-aminopyrimidine (2-APY) on poly(vinylidinefluoride-co-hexafluoropropylene) (PVDF-HFP)/polyethylene oxide (PEO) blend polymer electrolyte along with binary iodide salts (tetrabutylammonium iodide (TBAI) and potassium iodide (KI)) and iodine (I{sub 2}) were studied for enhancing the efficiency of the dye-sensitized solar cells (DSSCs) consisting of g-C{sub 3}N{sub 4}/TiO{sub 2} composite as photoanode. The g-C{sub 3}N{sub 4} was synthesized from low cost urea by thermal condensation method. It was used as a precursor to synthesize the various weight percentage ratios (5%, 10% and 15%) of g-C{sub 3}N{sub 4}/TiO{sub 2} composites by wet-impregnation method. The pure and 2-APY incorporated PVDF-HFP/PEO polymermore » blend electrolytes were arranged by wet chemical process (casting method) using DMF as a solvent. The synthesized g-C{sub 3}N{sub 4}/TiO{sub 2} composites and polymer blend electrolytes were studied and analyzed by Fourier transform infrared (FT-IR) spectroscopy, X-ray diffractometer (XRD) and scanning electron microscopy (SEM). The ionic conductivity values of the pure and 2-APY incorporated PVDF-HFP/PEO blend electrolytes were estimated to be 4.53×10{sup −5} and 1.87×10{sup −4} Scm{sup −1} respectively. The UV–vis absorption spectroscopy was carried out for the pure and different wt% of g-C{sub 3}N{sub 4}/TiO{sub 2} composites coated FTO films after N3 dye-sensitization. The 10 wt% g-C{sub 3}N{sub 4}/TiO{sub 2} composite film showed a maximum absorption compared to the others. The DSSC assembled with 10 wt% g-C{sub 3}N{sub 4}/TiO{sub 2} as photoanode using the pure polymer blend electrolyte exhibited a power conversion efficiency (PCE) of 3.17% , which was superior than that of DSSC based pure TiO{sub 2} (2.46%). However, the PCE was increased to 4.73% for the DSSC assembled using 10 wt% g-C{sub 3}N{sub 4}/TiO{sub 2} as photoanode with 2-APY incorporated polymer blend electrolyte. Hence, the present study is

  19. Ion-pair in-tube solid-phase microextraction and capillary liquid chromatography using a titania-based column: application to the specific lauralkonium chloride determination in water.

    PubMed

    Prieto-Blanco, M C; Moliner-Martínez, Y; López-Mahía, P; Campíns-Falcó, P

    2012-07-27

    A quick, miniaturized and on-line method has been developed for the determination in water of the predominant homologue of benzalkonium chloride, dodecyl dimethyl benzyl ammonium chloride or lauralkonium chloride (C(12)-BAK). The method is based on the formation of an ion-pair in both in-tube solid-phase microextraction (IT-SPME) and capillary liquid chromatography. The IT-SPME optimization required the study of the length and nature of the stationary phase of capillary and the processed sample volume. Because to the surfactant character of the analyte both, the extracting and replacing solvents, have played a decisive role in the IT-SPME optimized procedure. Conditioning the capillary with the mobile phase which contains the counter ion (acetate), using an organic additive (tetrabutylammonium chloride) added to the sample and a mixture water/methanol as replacing solvent (processed just before the valve is switched to the inject position), allowed to obtain good precision of the retention time and a narrow peak for C(12)-BAK. A reversed-phase capillary based TiO(2) column and a mobile phase containing ammonium acetate at pH 5.0 for controlling the interactions of cationic surfactant with titania surface were proposed. The optimized procedure provided adequate linearity, accuracy and precision at the concentrations interval of 1.5-300 μg L(-1) .The limit of detection (LOD) was 0.5 μg L(-1) using diode array detection (DAD). The applicability of proposed IT-SPME-capillary LC method has been assessed in several water samples. Copyright © 2012 Elsevier B.V. All rights reserved.

  20. Tumor necrosis factor-α -308 G>A and interleukin-6 -174 G>C promoter polymorphisms and pemphigus.

    PubMed

    Mosaad, Youssef M; Fathy, Hanan; Fawzy, Zakaria; El-Saied, Moustafa Ahmed

    2012-05-01

    The objective of this study was to analyze the possible involvement of the tumor necrosis factor (TNF)-α -308 G>A and interleukin-6 (IL-6) -174 G>C polymorphisms in the susceptibility and/or disease profile of pemphigus in Egyptian patients. Detection of TNF-α -308 G>A by amplification refractory mutation system and IL-6 -174 G>C by restriction fragment length polymorphism was performed for 70 patients and 203 controls. No significant differences were observed in the distribution of TNF-α -308 in pemphigus patients and controls. However, GA+AA genotypes were more frequent in pemphigus vulgaris (PV) patients only versus controls (p(c) = 0.046). The frequency of the C allele and CC/GC genotypes of IL-6 -174 was significantly higher in pemphigus patients and those with the 2 major clinical forms (PV and pemphigus foliaceus [PF]) compared with controls (p < 0.05). Comparison of the distribution of TNF-α -308 and IL-6 -174 variants in relation to clinical type of pemphigus (PV versus PF), activity score, recurrence, and demographic data of patients revealed no significant associations. The IL-6 -174 CC genotype represents a marker of increased susceptibility to pemphigus in Egyptian patients and GG genotype can be considered a low-risk genotype; TNF-α -308 A-containing genotypes contribute to the susceptibility to PV only. Copyright © 2012 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  1. Transcobalamin II (TCN2 67A>G and TCN2 776C>G) and transcobalamin II receptor (TCblR 1104C>T) polymorphisms in Korean patients with idiopathic recurrent spontaneous abortion.

    PubMed

    Kim, Hyun Seok; Lee, Bo Eun; Jeon, Young Joo; Rah, HyungChul; Lee, Woo Sik; Shin, Ji Eun; Choi, Dong Hee; Kim, Nam Keun

    2014-09-01

    The transcobalamin II (TCN2) 776C>G polymorphism has been reported to be a genetic risk factor for idiopathic recurrent spontaneous abortion (RSA). However, the sample size in previous studies was small, and other TCN2 polymorphisms have not been studied. Moreover, the TCN2 67A>G and 776C>G polymorphisms, and the transcobalamin II receptor (TCblR/CD320) 1104C>T polymorphism, have demonstrated associations with immune responses. Three hundred and seventy-eight RSA patients who had at least two consecutive spontaneous abortions were enrolled. Two hundred and seven control subjects were collected from a convenience sample. Polymerase chain reaction and restriction fragment length polymorphism analysis were performed to identify the TCN2 67A>G and 776C>G polymorphisms, and the TCblR 1104C>T polymorphism. RSA patients showed significantly different frequencies of the TCN2 67AG+GG genotypes compared with control subjects. The TCN2 67G allele is a possible risk factor for idiopathic RSA. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  2. PAI-1 4G-4G and MTHFR 677TT in non-hepatitis C virus/hepatitis B virus-related liver cirrhosis

    PubMed Central

    Pasta, Linda; Pasta, Francesca

    2015-01-01

    AIM: To evaluate the different roles of thrombophilia in patients with and without viral etiology. The thrombophilic genetic factors (THRGFs), PAI-1 4G-4G, MTHFR 677TT, V Leiden 506Q and prothrombin 20210A, were studied as risk factors in 1079 patients with liver cirrhosis (LC), enrolled from January 2000 to January 2014. METHODS: All Caucasian LC patients consecutively observed in a fourteen-year period were included; the presence of portal vein thrombosis (PVT) and Budd Chiari syndrome (BCS) was registered. The differences between the proportions of each THRGF with regard to the presence or absence of viral etiology and the frequencies of the THRGF genotypes with those predicted in a population by the Hardy-Weinberg equilibrium were registered. RESULTS: Four hundred and seventeen/one thousand and seventy-six patients (38.6%) showed thrombophilia: 217 PAI-1 4G-4G, 176 MTHFR C677TT, 71 V Leiden factor and 41 prothrombin G20210 A, 84 with more than 1 THRGF; 350 presented with no viral liver cirrhosis (NVLC) and 729 with, called viral liver cirrhosis (VLC), of whom 56 patients were hepatitis C virus + hepatitis B virus. PAI-1 4G-4G, MTHFR C677TT, the presence of at least one TRHGF and the presence of > 1 THRGF, were statistically more frequent in patients with NVLC vs patients with VLC: All χ2 > 3.85 and P < 0.05. Patients with PVT and/or BCS with at least one TRHGF were 189/352 (53.7%). The Hardy-Weinberg of PAI-1 and MTHFR 677 genotypes deviated from that expected from a population in equilibrium in patients with NVLC (respectively χ2 = 39.3; P < 0.000 and χ2 = 27.94; P < 0.05), whereas the equilibrium was respected in VLC. CONCLUSION: MTHFR 677TT was nearly twofold and PAI-1 4G-4G more than threefold more frequently found in NVLC vs patients with VLC; the Hardy-Weinberg equilibrium of these two polymorphisms confirms this data in NVLC. We suggest that PAI-1 4G-4G and MTHFR 677TT could be considered as factors of fibrosis and thrombosis mechanisms, increasing

  3. PAI-1 4G-4G and MTHFR 677TT in non-hepatitis C virus/hepatitis B virus-related liver cirrhosis.

    PubMed

    Pasta, Linda; Pasta, Francesca

    2015-12-18

    To evaluate the different roles of thrombophilia in patients with and without viral etiology. The thrombophilic genetic factors (THRGFs), PAI-1 4G-4G, MTHFR 677TT, V Leiden 506Q and prothrombin 20210A, were studied as risk factors in 1079 patients with liver cirrhosis (LC), enrolled from January 2000 to January 2014. All Caucasian LC patients consecutively observed in a fourteen-year period were included; the presence of portal vein thrombosis (PVT) and Budd Chiari syndrome (BCS) was registered. The differences between the proportions of each THRGF with regard to the presence or absence of viral etiology and the frequencies of the THRGF genotypes with those predicted in a population by the Hardy-Weinberg equilibrium were registered. Four hundred and seventeen/one thousand and seventy-six patients (38.6%) showed thrombophilia: 217 PAI-1 4G-4G, 176 MTHFR C677TT, 71 V Leiden factor and 41 prothrombin G20210 A, 84 with more than 1 THRGF; 350 presented with no viral liver cirrhosis (NVLC) and 729 with, called viral liver cirrhosis (VLC), of whom 56 patients were hepatitis C virus + hepatitis B virus. PAI-1 4G-4G, MTHFR C677TT, the presence of at least one TRHGF and the presence of > 1 THRGF, were statistically more frequent in patients with NVLC vs patients with VLC: All χ (2) > 3.85 and P < 0.05. Patients with PVT and/or BCS with at least one TRHGF were 189/352 (53.7%). The Hardy-Weinberg of PAI-1 and MTHFR 677 genotypes deviated from that expected from a population in equilibrium in patients with NVLC (respectively χ (2) = 39.3; P < 0.000 and χ (2) = 27.94; P < 0.05), whereas the equilibrium was respected in VLC. MTHFR 677TT was nearly twofold and PAI-1 4G-4G more than threefold more frequently found in NVLC vs patients with VLC; the Hardy-Weinberg equilibrium of these two polymorphisms confirms this data in NVLC. We suggest that PAI-1 4G-4G and MTHFR 677TT could be considered as factors of fibrosis and thrombosis mechanisms, increasing the inflammation response

  4. Strong Neutron Pairing in core+4n Nuclei.

    PubMed

    Revel, A; Marqués, F M; Sorlin, O; Aumann, T; Caesar, C; Holl, M; Panin, V; Vandebrouck, M; Wamers, F; Alvarez-Pol, H; Atar, L; Avdeichikov, V; Beceiro-Novo, S; Bemmerer, D; Benlliure, J; Bertulani, C A; Boillos, J M; Boretzky, K; Borge, M J G; Caamaño, M; Casarejos, E; Catford, W N; Cederkäll, J; Chartier, M; Chulkov, L; Cortina-Gil, D; Cravo, E; Crespo, R; Datta Pramanik, U; Díaz Fernández, P; Dillmann, I; Elekes, Z; Enders, J; Ershova, O; Estradé, A; Farinon, F; Fraile, L M; Freer, M; Galaviz, D; Geissel, H; Gernhäuser, R; Golubev, P; Göbel, K; Hagdahl, J; Heftrich, T; Heil, M; Heine, M; Heinz, A; Henriques, A; Ignatov, A; Johansson, H T; Jonson, B; Kahlbow, J; Kalantar-Nayestanaki, N; Kanungo, R; Kelic-Heil, A; Knyazev, A; Kröll, T; Kurz, N; Labiche, M; Langer, C; Le Bleis, T; Lemmon, R; Lindberg, S; Machado, J; Marganiec, J; Movsesyan, A; Nacher, E; Najafi, M; Nilsson, T; Nociforo, C; Paschalis, S; Perea, A; Petri, M; Pietri, S; Plag, R; Reifarth, R; Ribeiro, G; Rigollet, C; Röder, M; Rossi, D; Savran, D; Scheit, H; Simon, H; Syndikus, I; Taylor, J T; Tengblad, O; Thies, R; Togano, Y; Velho, P; Volkov, V; Wagner, A; Weick, H; Wheldon, C; Wilson, G; Winfield, J S; Woods, P; Yakorev, D; Zhukov, M; Zilges, A; Zuber, K

    2018-04-13

    The emission of neutron pairs from the neutron-rich N=12 isotones ^{18}C and ^{20}O has been studied by high-energy nucleon knockout from ^{19}N and ^{21}O secondary beams, populating unbound states of the two isotones up to 15 MeV above their two-neutron emission thresholds. The analysis of triple fragment-n-n correlations shows that the decay ^{19}N(-1p)^{18}C^{*}→^{16}C+n+n is clearly dominated by direct pair emission. The two-neutron correlation strength, the largest ever observed, suggests the predominance of a ^{14}C core surrounded by four valence neutrons arranged in strongly correlated pairs. On the other hand, a significant competition of a sequential branch is found in the decay ^{21}O(-1n)^{20}O^{*}→^{18}O+n+n, attributed to its formation through the knockout of a deeply bound neutron that breaks the ^{16}O core and reduces the number of pairs.

  5. Strong Neutron Pairing in core+4 n Nuclei

    NASA Astrophysics Data System (ADS)

    Revel, A.; Marqués, F. M.; Sorlin, O.; Aumann, T.; Caesar, C.; Holl, M.; Panin, V.; Vandebrouck, M.; Wamers, F.; Alvarez-Pol, H.; Atar, L.; Avdeichikov, V.; Beceiro-Novo, S.; Bemmerer, D.; Benlliure, J.; Bertulani, C. A.; Boillos, J. M.; Boretzky, K.; Borge, M. J. G.; Caamaño, M.; Casarejos, E.; Catford, W. N.; Cederkäll, J.; Chartier, M.; Chulkov, L.; Cortina-Gil, D.; Cravo, E.; Crespo, R.; Datta Pramanik, U.; Díaz Fernández, P.; Dillmann, I.; Elekes, Z.; Enders, J.; Ershova, O.; Estradé, A.; Farinon, F.; Fraile, L. M.; Freer, M.; Galaviz, D.; Geissel, H.; Gernhäuser, R.; Golubev, P.; Göbel, K.; Hagdahl, J.; Heftrich, T.; Heil, M.; Heine, M.; Heinz, A.; Henriques, A.; Ignatov, A.; Johansson, H. T.; Jonson, B.; Kahlbow, J.; Kalantar-Nayestanaki, N.; Kanungo, R.; Kelic-Heil, A.; Knyazev, A.; Kröll, T.; Kurz, N.; Labiche, M.; Langer, C.; Le Bleis, T.; Lemmon, R.; Lindberg, S.; Machado, J.; Marganiec, J.; Movsesyan, A.; Nacher, E.; Najafi, M.; Nilsson, T.; Nociforo, C.; Paschalis, S.; Perea, A.; Petri, M.; Pietri, S.; Plag, R.; Reifarth, R.; Ribeiro, G.; Rigollet, C.; Röder, M.; Rossi, D.; Savran, D.; Scheit, H.; Simon, H.; Syndikus, I.; Taylor, J. T.; Tengblad, O.; Thies, R.; Togano, Y.; Velho, P.; Volkov, V.; Wagner, A.; Weick, H.; Wheldon, C.; Wilson, G.; Winfield, J. S.; Woods, P.; Yakorev, D.; Zhukov, M.; Zilges, A.; Zuber, K.; R3B Collaboration

    2018-04-01

    The emission of neutron pairs from the neutron-rich N =12 isotones 18C and 20O has been studied by high-energy nucleon knockout from 19N and 21O secondary beams, populating unbound states of the two isotones up to 15 MeV above their two-neutron emission thresholds. The analysis of triple fragment-n -n correlations shows that the decay 19N (-1 p ) 18C* → 16C +n +n is clearly dominated by direct pair emission. The two-neutron correlation strength, the largest ever observed, suggests the predominance of a 14C core surrounded by four valence neutrons arranged in strongly correlated pairs. On the other hand, a significant competition of a sequential branch is found in the decay 21O (-1 n )20O*→18O +n +n , attributed to its formation through the knockout of a deeply bound neutron that breaks the 16O core and reduces the number of pairs.

  6. Association of IL-6-174 G/C and IL10-1082 G/A polymorphisms with recurrent aphthous stomatitis risk: A meta-analysis.

    PubMed

    Yang, Shuo; Zhang, Bin; Shi, Quan; Liu, Jinglong; Xu, Juan; Huo, Na

    2017-12-01

    Recurrent aphthous stomatitis (RAS) is a common oral disease with unknown etiology. The association between IL-6-174 G/C and IL10-1082 G/A polymorphisms and the risk of RAS remains controversial. Therefore, we conducted this meta-analysis to gain more evidence-based information. Four online databases, PubMed, Embase, Web of Science, and Cochrane Library, were searched, and the relevant publications were collected. An odds ratio (OR) with a 95% confidence interval (CI) was applied to assess the association of the IL-6-174 G/C and IL10-1082 G/A polymorphisms with RAS susceptibility. Nine published case-control studies with 779 patients and 1016 controls were collected. The overall analysis proved that the IL10-1082 G/A polymorphism was significantly associated with the risk of RAS in a dominant model (GG + AG vs AA: OR = 1.49, 95% CI = 1.10-2.01, P = .01). A subgroup analysis based on ethnicity revealed significant associations in Asian populations in allelic, heterozygote, and dominant models (G vs A: OR = 1.55, 95% CI = 1.04-2.31, P = .03; AG vs AA: OR = 1.76, 95% CI = 1.16-2.67, P = .01; GG + AG vs AA: OR = 2.04, 95% CI = 1.37-3.03, P = .00). The association in Caucasians and people of mixed ethnicity requires further study. No significant association was detected between the IL-6-174 G/C polymorphism and RAS in any of the genetic models. However, subgroup analysis by ethnicity revealed that the Caucasians were more likely to develop RAS in 4 genetic models (G vs C: OR = 2.36, 95% CI = 1.26-4.41, P = .01; GG vs CC: OR = 7.05, 95% CI = 3.50-14.18, P = .00; GG + CG vs CC: OR = 4.28, 95% CI = 2.17-8.45, P = .00; GG vs CG + CC: OR = 2.59, 95% CI = 1.05-6.41, P = .04). In addition, a significantly decreased risk of RAS susceptibility was found in Asians (CG vs CC: OR = 0.27, 95% CI = 0.07-0.99, P = .049; GG + CG vs CC: OR = 0

  7. On local pairs vs. BCS: Quo vadis high-T c superconductivity

    DOE PAGES

    Pavuna, D.; Dubuis, G.; Bollinger, A. T.; ...

    2016-07-28

    Since the discovery of high-temperature superconductivity in cuprates, proposals have been made that pairing may be local, in particular in underdoped samples. Furthermore, we briefly review evidence for local pairs from our experiments on thin films of La 2–xSr xCuO 4, synthesized by atomic layer-by-layer molecular beam epitaxy (ALL-MBE).

  8. In situ synthesis of g-C3N4/TiO2 heterojunction nanocomposites as a highly active photocatalyst for the degradation of Orange II under visible light irradiation.

    PubMed

    Ren, Bin; Wang, Tiecheng; Qu, Guangzhou; Deng, Fang; Liang, Dongli; Yang, Wenli; Liu, Meishan

    2018-05-04

    As a highly active photocatalyst, g-C 3 N 4 /TiO 2 heterojunction nanocomposites were in situ synthesized by simple ultrasonic mixing and calcination by using TiO 2 and melamine as precursors. The morphology and structure of the prepared photocatalysts were characterized by field emission scanning electron microscopy, transmission electron microscopy, X-ray diffraction, Fourier-transform infrared spectroscopy, UV-Vis diffuse reflectance spectroscopy, and X-ray photoelectron spectroscopy. The photocatalytic activities of g-C 3 N 4 /TiO 2 nanocomposites to degrade Orange II (AO7) under visible light irradiation were evaluated. Results showed that the photocatalytic rate of the prepared g-C 3 N 4 /TiO 2 photocatalyst to degrade AO7 was about three times than that of pristine TiO 2 and g-C 3 N 4 . The g-C 3 N 4 /TiO 2 composite with a ratio of 1:4 had the highest degradation efficiency for AO7 solution. Its degradation efficiency under acidic conditions was significantly higher than that under alkaline conditions. The enhancement of photocatalytic activity can be attributed to the formation of heterojunctions between g-C 3 N 4 and TiO 2 , which leads to rapid charge transfer and the efficient separation of photogenerated electron-hole pairs. The recycling experiment indicated that the photocatalyst of g-C 3 N 4 /TiO 2 nanocomposites still maintained good photochemical stability and recyclability after five cycles; this finding was important for its practical applications. A series of free radical trapping experiments showed that •O 2 - played a crucial role in the degradation of AO7. Graphical Abstract ᅟ.

  9. Unconventional Electron Pairing and Topological Superconductivity in Proximitized HgTe Quantum Wells

    NASA Astrophysics Data System (ADS)

    Ren, Hechen; Hart, Sean; Kosowsky, Michael; Ben-Shach, Gilad; Leubner, Philipp; Brüne, Christoph; Buhmann, Hartmut; Molenkamp, Laurens; Halperin, Bertrand; Yacoby, Amir

    Coupling s-wave superconductors to systems with exotic Fermi surface spin textures has been recently proposed as a way to manipulate the nature of the paired state, in some cases even leading to a topological phase transition. Recently, we studied the behavior of Fraunhofer interference in HgTe quantum well-based Josephson junctions, in the presence of a magnetic field applied in the plane of the quantum well. Here we theoretically analyze our system and compare the predicted behavior to our experimental results. We find that the in-plane magnetic field tunes the momentum of Cooper pairs in the quantum well, directly reflecting the response of the spin-dependent Fermi surfaces. This momentum tuning depends crucially on the type of spin-orbit coupling in the system. In the high electron density regime, the induced superconductivity evolves with electron density in agreement with our model based on the Hamiltonian of Bernevig, Hughes and Zhang. This agreement provides a quantitative value for g/vF, where g is the effective g-factor and vF is the Fermi velocity. Our new understanding of the interplay between spin physics and superconductivity introduces a way to spatially engineer the order parameter from singlet to triplet pairing, and in general allows investigation of electronic spin texture at the Fermi surface of materials. NSF DMR-1206016; STC Center for Integrated Quantum Materials under NSF Grant No. DMR-1231319; NSF GRFP under Grant DGE1144152, Microsoft Corporation Project Q.

  10. Gα and regulator of G-protein signaling (RGS) protein pairs maintain functional compatibility and conserved interaction interfaces throughout evolution despite frequent loss of RGS proteins in plants.

    PubMed

    Hackenberg, Dieter; McKain, Michael R; Lee, Soon Goo; Roy Choudhury, Swarup; McCann, Tyler; Schreier, Spencer; Harkess, Alex; Pires, J Chris; Wong, Gane Ka-Shu; Jez, Joseph M; Kellogg, Elizabeth A; Pandey, Sona

    2017-10-01

    Signaling pathways regulated by heterotrimeric G-proteins exist in all eukaryotes. The regulator of G-protein signaling (RGS) proteins are key interactors and critical modulators of the Gα protein of the heterotrimer. However, while G-proteins are widespread in plants, RGS proteins have been reported to be missing from the entire monocot lineage, with two exceptions. A single amino acid substitution-based adaptive coevolution of the Gα:RGS proteins was proposed to enable the loss of RGS in monocots. We used a combination of evolutionary and biochemical analyses and homology modeling of the Gα and RGS proteins to address their expansion and its potential effects on the G-protein cycle in plants. Our results show that RGS proteins are widely distributed in the monocot lineage, despite their frequent loss. There is no support for the adaptive coevolution of the Gα:RGS protein pair based on single amino acid substitutions. RGS proteins interact with, and affect the activity of, Gα proteins from species with or without endogenous RGS. This cross-functional compatibility expands between the metazoan and plant kingdoms, illustrating striking conservation of their interaction interface. We propose that additional proteins or alternative mechanisms may exist which compensate for the loss of RGS in certain plant species. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

  11. Ion pair-based liquid-phase microextraction combined with cuvetteless UV-vis micro-spectrophotometry as a miniaturized assay for monitoring ammonia in waters.

    PubMed

    Senra-Ferreiro, Sonia; Pena-Pereira, Francisco; Costas-Mora, Isabel; Romero, Vanesa; Lavilla, Isela; Bendicho, Carlos

    2011-09-15

    A miniaturized method based on liquid-phase microextraction (LPME) in combination with microvolume UV-vis spectrophotometry for monitoring ammonia in waters is proposed. The methodology is based on the extraction of the ion pair formed between the blue indophenol obtained according to the Berthelot reaction and a quaternary ammonium salt into a microvolume of organic solvent. Experimental parameters affecting the LPME performance such as type and concentration of the quaternary ammonium ion salt required to form the ion pair, type and volume of extractant solvent, effect of disperser solvent, ionic strength and extraction time, were optimized. A detection limit of 5.0 μg L(-1) ammonia and an enrichment factor of 30 can be attained after a microextraction time of 4 min. The repeatability, expressed as relative standard deviation, was 7.6% (n=7). The proposed method can be successfully applied to the determination of trace amounts of ammonia in several environmental water samples. Copyright © 2011 Elsevier B.V. All rights reserved.

  12. Experimental extraction of an entangled photon pair from two identically decohered pairs.

    PubMed

    Yamamoto, Takashi; Koashi, Masato; Ozdemir, Sahin Kaya; Imoto, Nobuyuki

    2003-01-23

    Entanglement is considered to be one of the most important resources in quantum information processing schemes, including teleportation, dense coding and entanglement-based quantum key distribution. Because entanglement cannot be generated by classical communication between distant parties, distribution of entangled particles between them is necessary. During the distribution process, entanglement between the particles is degraded by the decoherence and dissipation processes that result from unavoidable coupling with the environment. Entanglement distillation and concentration schemes are therefore needed to extract pairs with a higher degree of entanglement from these less-entangled pairs; this is accomplished using local operations and classical communication. Here we report an experimental demonstration of extraction of a polarization-entangled photon pair from two decohered photon pairs. Two polarization-entangled photon pairs are generated by spontaneous parametric down-conversion and then distributed through a channel that induces identical phase fluctuations to both pairs; this ensures that no entanglement is available as long as each pair is manipulated individually. Then, through collective local operations and classical communication we extract from the two decohered pairs a photon pair that is observed to be polarization-entangled.

  13. BMP15 c.-9C>G promoter sequence variant may contribute to the cause of non-syndromic premature ovarian failure.

    PubMed

    Fonseca, Dora Janeth; Ortega-Recalde, Oscar; Esteban-Perez, Clara; Moreno-Ortiz, Harold; Patiño, Liliana Catherine; Bermúdez, Olga María; Ortiz, Angela María; Restrepo, Carlos M; Lucena, Elkin; Laissue, Paul

    2014-11-01

    BMP15 has drawn particular attention in the pathophysiology of reproduction, as its mutations in mammalian species have been related to different reproductive phenotypes. In humans, BMP15 coding regions have been sequenced in large panels of women with premature ovarian failure (POF), but only some mutations have been definitely validated as causing the phenotype. A functional association between the BMP15 c.-9C>G promoter polymorphism and cause of POF have been reported. The aim of this study was to determine the potential functional effect of this sequence variant on specific BMP15 promoter transactivation disturbances. Bioinformatics was used to identify transcription factor binding sites located on the promoter region of BMP15. Reverse transcription polymerase chain reaction was used to study specific gene expression in ovarian tissue. Luciferase reporter assays were used to establish transactivation disturbances caused by the BMP15 c.-9C>G variant. The c.-9C>G variant was found to modify the PITX1 transcription factor binding site. PITX1 and BMP15 co-expressed in human and mouse ovarian tissue, and PITX1 transactivated both BMP15 promoter versions (-9C and -9G). It was found that the BMP15 c.-9G allele was related to BMP15 increased transcription, supporting c.-9C>G as a causal agent of POF. Copyright © 2014 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.

  14. A DNA methylation map of human cancer at single base-pair resolution

    PubMed Central

    Vidal, E; Sayols, S; Moran, S; Guillaumet-Adkins, A; Schroeder, M P; Royo, R; Orozco, M; Gut, M; Gut, I; Lopez-Bigas, N; Heyn, H; Esteller, M

    2017-01-01

    Although single base-pair resolution DNA methylation landscapes for embryonic and different somatic cell types provided important insights into epigenetic dynamics and cell-type specificity, such comprehensive profiling is incomplete across human cancer types. This prompted us to perform genome-wide DNA methylation profiling of 22 samples derived from normal tissues and associated neoplasms, including primary tumors and cancer cell lines. Unlike their invariant normal counterparts, cancer samples exhibited highly variable CpG methylation levels in a large proportion of the genome, involving progressive changes during tumor evolution. The whole-genome sequencing results from selected samples were replicated in a large cohort of 1112 primary tumors of various cancer types using genome-scale DNA methylation analysis. Specifically, we determined DNA hypermethylation of promoters and enhancers regulating tumor-suppressor genes, with potential cancer-driving effects. DNA hypermethylation events showed evidence of positive selection, mutual exclusivity and tissue specificity, suggesting their active participation in neoplastic transformation. Our data highlight the extensive changes in DNA methylation that occur in cancer onset, progression and dissemination. PMID:28581523

  15. A DNA methylation map of human cancer at single base-pair resolution.

    PubMed

    Vidal, E; Sayols, S; Moran, S; Guillaumet-Adkins, A; Schroeder, M P; Royo, R; Orozco, M; Gut, M; Gut, I; Lopez-Bigas, N; Heyn, H; Esteller, M

    2017-10-05

    Although single base-pair resolution DNA methylation landscapes for embryonic and different somatic cell types provided important insights into epigenetic dynamics and cell-type specificity, such comprehensive profiling is incomplete across human cancer types. This prompted us to perform genome-wide DNA methylation profiling of 22 samples derived from normal tissues and associated neoplasms, including primary tumors and cancer cell lines. Unlike their invariant normal counterparts, cancer samples exhibited highly variable CpG methylation levels in a large proportion of the genome, involving progressive changes during tumor evolution. The whole-genome sequencing results from selected samples were replicated in a large cohort of 1112 primary tumors of various cancer types using genome-scale DNA methylation analysis. Specifically, we determined DNA hypermethylation of promoters and enhancers regulating tumor-suppressor genes, with potential cancer-driving effects. DNA hypermethylation events showed evidence of positive selection, mutual exclusivity and tissue specificity, suggesting their active participation in neoplastic transformation. Our data highlight the extensive changes in DNA methylation that occur in cancer onset, progression and dissemination.

  16. The -765G>C polymorphism in the cyclooxygenase-2 gene and digestive system cancer: a meta-analysis.

    PubMed

    Zhao, Fen; Cao, Yue; Zhu, Hong; Huang, Min; Yi, Cheng; Huang, Ying

    2014-01-01

    Published data regarding associations between the -765G>C polymorphism in cyclooxygenase-2 (COX-2) gene and digestive system cancer risk have been inconclusive. The aim of this study was to comprehensively evaluate the genetic risk of the -765G>C polymorphism in the COX-2 gene for digestive system cancer. A search was performed in Pubmed, Medline (Ovid), Embase, CNKI, Weipu, Wanfang and CBM databases, covering all studies until Feb 10, 2014. Statistical analysis was performed using Revman5.2. A total of 10,814 cases and 16,174 controls in 38 case-control studies were included in this meta-analysis. The results indicated that C allele carriers (GC+CC) had a 20% increased risk of digestive system cancer when compared with the homozygote GG (odds ratio (OR)=1.20, 95% confidence interval (CI), 1.00-1.44 for GC+CC vs GG). In the subgroup analysis by ethnicity, significant elevated risks were associated with C allele carriers (GC+CC) in Asians (OR = 1.46, 95% CI=1.07-2.01, and p=0.02) and Africans (OR=2.12, 95% CI=1.57-2.87, and p< 0.00001), but not among Caucasians, Americans and mixed groups. For subgroup analysis by cancer type (GC+CC vs GG), significant associations were found between the -765G>C polymorphism and higher risk for gastric cancer (OR=1.64, 95% CI=1.03-2.61, and p=0.04), but not for colorectal cancer, oral cancer, esophageal cancer, and others. Regarding study design (GC+CC vs GG), no significant associations were found in then population-based case-control (PCC), hospital-based case-control (HCC) and family-based case-control (FCC) studies. This meta-analysis suggested that the -765G>C polymorphism of the COX-2 gene is a potential risk factor for digestive system cancer in Asians and Africans and gastric cancer overall.

  17. Coexistence of Multiple Attractors in an Active Diode Pair Based Chua’s Circuit

    NASA Astrophysics Data System (ADS)

    Bao, Bocheng; Wu, Huagan; Xu, Li; Chen, Mo; Hu, Wen

    This paper focuses on the coexistence of multiple attractors in an active diode pair based Chua’s circuit with smooth nonlinearity. With dimensionless equations, dynamical properties, including boundness of system orbits and stability distributions of two nonzero equilibrium points, are investigated, and complex coexisting behaviors of multiple kinds of disconnected attractors of stable point attractors, limit cycles and chaotic attractors are numerically revealed. The results show that unlike the classical Chua’s circuit, the proposed circuit has two stable nonzero node-foci for the specified circuit parameters, thereby resulting in the emergence of multistability phenomenon. Based on two general impedance converters, the active diode pair based Chua’s circuit with an adjustable inductor and an adjustable capacitor is made in hardware, from which coexisting multiple attractors are conveniently captured.

  18. Electrochemical Hydroxylation of C3-C12 n-Alkanes by Recombinant Alkane Hydroxylase (AlkB) and Rubredoxin-2 (AlkG) from Pseudomonas putida GPo1.

    PubMed

    Tsai, Yi-Fang; Luo, Wen-I; Chang, Jen-Lin; Chang, Chun-Wei; Chuang, Huai-Chun; Ramu, Ravirala; Wei, Guor-Tzo; Zen, Jyh-Myng; Yu, Steve S-F

    2017-08-21

    An unprecedented method for the efficient conversion of C 3 -C 12 linear alkanes to their corresponding primary alcohols mediated by the membrane-bound alkane hydroxylase (AlkB) from Pseudomonas putida GPo1 is demonstrated. The X-ray absorption spectroscopy (XAS) studies support that electrons can be transferred from the reduced AlkG (rubredoxin-2, the redox partner of AlkB) to AlkB in a two-phase manner. Based on this observation, an approach for the electrocatalytic conversion from alkanes to alcohols mediated by AlkB using an AlkG immobilized screen-printed carbon electrode (SPCE) is developed. The framework distortion of AlkB-AlkG adduct on SPCE surface might create promiscuity toward gaseous substrates. Hence, small alkanes including propane and n-butane can be accommodated in the hydrophobic pocket of AlkB for C-H bond activation. The proof of concept herein advances the development of artificial C-H bond activation catalysts.

  19. Enhancing the response rate of strand displacement-based electrochemical aptamer sensors using bivalent binding aptamer-cDNA probes.

    PubMed

    Zhang, Ziping; Tao, Cancan; Yin, Jungang; Wang, Yunhui; Li, Yanshen

    2018-04-30

    Electrochemical aptamer (EA) sensors based on aptamer-cDNA duplex probes (cDNA: complementary DNA) and target induced strand displacement (TISD) recognition are sensitive, selective and capable of detecting a wide variety of target analytes. While substantial research efforts have focused on engineering of new signaling mechanisms for the improvement of sensor sensitivity, little attention was paid to the enhancement of sensor response rate. Typically, the previous TISD based EA sensors exhibited relatively long response times larger than 30min, which mainly resulted from the suboptimal aptamer-cDNA probe structure in which most of aptamer bases were paired to the cDNA bases. In an effort to improve the response rate of this type of sensors, we report here the rational engineering of a quickly responsive and sensitive aptamer-cDNA probe by employing the conception of bivalent interaction in supramolecular chemistry. We design a bivalent cDNA strand through linking two short monovalent cDNA sequences, and it is simultaneously hybridized to two electrode-immobilized aptamer probes to form a bivalent binding (BB) aptamer-cDNA probe. This class of BB probe possesses the advantages of less aptamer bases paired to the cDNA bases for quick response rate and good structural stability for high sensor sensitivity. By use of the rationally designed BB aptamer-cDNA probe, a TISD based EA sensor against ATP with significantly enhanced response rate (with a displacement equilibrium time of 4min) and high sensitivity was successfully constructed. We believe that our BB probe conception will help guide future designs and applications of TISD based EA sensors. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Base pairing between the 3' exon and an internal guide sequence increases 3' splice site specificity in the Tetrahymena self-splicing rRNA intron.

    PubMed Central

    Suh, E R; Waring, R B

    1990-01-01

    It has been proposed that recognition of the 3' splice site in many group I introns involves base pairing between the start of the 3' exon and a region of the intron known as the internal guide sequence (R. W. Davies, R. B. Waring, J. Ray, T. A. Brown, and C. Scazzocchio, Nature [London] 300:719-724, 1982). We have examined this hypothesis, using the self-splicing rRNA intron from Tetrahymena thermophila. Mutations in the 3' exon that weaken this proposed pairing increased use of a downstream cryptic 3' splice site. Compensatory mutations in the guide sequence that restore this pairing resulted in even stronger selection of the normal 3' splice site. These changes in 3' splice site usage were more pronounced in the background of a mutation (414A) which resulted in an adenine instead of a guanine being the last base of the intron. These results show that the proposed pairing (P10) plays an important role in ensuring that cryptic 3' splice sites are selected against. Surprisingly, the 414A mutation alone did not result in activation of the cryptic 3' splice site. Images PMID:2342465

  1. All-Fiber Dual-Parameter Sensor Based on Cascaded Long Period Fiber Grating Pair Fabricated by Femtosecond Laser and CO2 Laser

    NASA Astrophysics Data System (ADS)

    Zhang, Wen; Hao, Jiaqi; Lou, Xiaoping; Dong, Mingli; Zhu, Lianqing

    2018-03-01

    An all-fiber dual-parameter sensor based on cascaded long period grating pair fabricated by femtosecond laser and CO2 laser has been proposed and realized both theoretically and experimentally. The resonant wavelengths of LPFGs are 1557.80 nm and 1590.88 nm. In the strain range of 0-400 με, strain sensitivities are -7.2 pm/με for C-LPFG and -1.6 pm/με for F-LPFG. In the temperature range of 30-70°C, temperature sensitivities are -41.1 pm/°C for C-LPFG and -21.2 pm/°C for F-LPFG. By analyzing the resonant wavelength characterization, the proposed sensor can be efficiently used for dual-parameters measurement with promising application prospect and great research reference value.

  2. Synthesis and Enhanced Ethanol Gas Sensing Properties of the g-C3N4 Nanosheets-Decorated Tin Oxide Flower-Like Nanorods Composite

    PubMed Central

    Qin, Cong; Zhang, Bo; Sun, Guang; Zhang, Zhanying

    2017-01-01

    Flower-like SnO2/g-C3N4 nanocomposites were synthesized via a facile hydrothermal method by using SnCl4·5H2O and urea as the precursor. The structure and morphology of the as-synthesized samples were characterized by using the X-ray powder diffraction (XRD), electron microscopy (FESEM and TEM), and Fourier transform infrared spectrometer (FT-IR) techniques. SnO2 displays the unique 3D flower-like microstructure assembled with many uniform nanorods with the lengths and diameters of about 400–600 nm and 50–100 nm, respectively. For the SnO2/g-C3N4 composites, SnO2 flower-like nanorods were coupled by a lamellar structure 2D g-C3N4. Gas sensing performance test results indicated that the response of the sensor based on 7 wt. % 2D g-C3N4-decorated SnO2 composite to 500 ppm ethanol vapor was 150 at 340 °C, which was 3.5 times higher than that of the pure flower-like SnO2 nanorods-based sensor. The gas sensing mechanism of the g-C3N4nanosheets-decorated SnO2 flower-like nanorods was discussed in relation to the heterojunction structure between g-C3N4 and SnO2. PMID:28937649

  3. Experimental demonstration of wavelength domain rogue-free ONU based on wavelength-pairing for TDM/WDM optical access networks.

    PubMed

    Lee, Jie Hyun; Park, Heuk; Kang, Sae-Kyoung; Lee, Joon Ki; Chung, Hwan Seok

    2015-11-30

    In this study, we propose and experimentally demonstrate a wavelength domain rogue-free ONU based on wavelength-pairing of downstream and upstream signals for time/wavelength division-multiplexed optical access networks. The wavelength-pairing tunable filter is aligned to the upstream wavelength channel by aligning it to one of the downstream wavelength channels. Wavelength-pairing is implemented with a compact and cyclic Si-AWG integrated with a Ge-PD. The pairing filter covered four 100 GHz-spaced wavelength channels. The feasibility of the wavelength domain rogue-free operation is investigated by emulating malfunction of the misaligned laser. The wavelength-pairing tunable filter based on the Si-AWG blocks the upstream signal in the non-assigned wavelength channel before data collision with other ONUs.

  4. Base-Pairing Systems Related to TNA: alpha-Threofuranosyl Oligonucleotides Containing Phosphoramidate Linkages

    NASA Technical Reports Server (NTRS)

    Meyer, Michael (Technical Monitor); Wu, Xiaolin; Guntha, Sreenivasulu; Ferenclc, Mathias; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert

    2002-01-01

    (3'NH)- and (2'NH)-TNA, two isomeric phosphoramidate analogues of TNA (alpha-threofuranosyl-(3'-2') oligonucleotides), are shown to be efficient Watson-Crick base-pairing systems and to undergo intersystem crosspairing with TNA, RNA, and DNA.

  5. The Xylaria names proposed by C. G. Lloyd

    USDA-ARS?s Scientific Manuscript database

    Seventy-one new Xylaria names that C. G. Lloyd proposed are annotated herein. Type and/or authentic materials of these names, when available, were studied. Twenty-four of these, including X. beccarii, X. brasiliensis, X. chordaeformis, X. cuneata, X. divisa, X. fimbriata, X. humosa, X. kedahae, X. l...

  6. 0D/2D Z-Scheme Heterojunctions of Bismuth Tantalate Quantum Dots/Ultrathin g-C3N4 Nanosheets for Highly Efficient Visible Light Photocatalytic Degradation of Antibiotics.

    PubMed

    Wang, Kai; Zhang, Gaoke; Li, Jun; Li, Yuan; Wu, Xiaoyong

    2017-12-20

    Constructing 0D/2D Z-scheme photocatalysts is a great promising path to improve photocatalytic activity by  efficiently enhancing charge separation. Herein, we fabricated a visible-light-responsive Bi 3 TaO 7 quantum dots (QDs)/g-C 3 N 4 nanosheets (NSs) 0D/2D Z-scheme composite via a facile ultrasound method, and Bi 3 TaO 7 QDs could be interspersed on the surface of g-C 3 N 4 NSs uniformly. Furthermore, the strong interaction between Bi 3 TaO 7 QDs and g-C 3 N 4 NSs disturbed the CN heterocycles by forming C═O bonds between C atoms of the N-(C) 3 group and O atoms of the Ta-O bond. The optimum composite with 20 wt % g-C 3 N 4 NSs showed the superior photocatalytic activity for degradation of ciprofloxacin (CIP) over the composites prepared by mechanical mixing and solid-state methods, the photocatalytic efficiency of which were 4 and 12.2 times higher than those of bare Bi 3 TaO 7 and g-C 3 N 4 . Photoluminescence (PL), time-resolved transient PL decay spectra, and photocurrent together verify that the photogenerated hole-electron pairs in this 0D/2D Z-scheme composite have been effectively separated. The enhanced photocatalytic activity of as-synthesized photocatalysts could be attributed to the synergistic effect of efficient Z-scheme charge separation, highly dispersed 0D Bi 3 TaO 7 nanocrystals, coordinating sites of 2D g-C 3 N 4 NSs and the strong coupling between them. This study might pave the way toward designing novel visible-light-induced 0D/2D photocatalyst systems for highly efficient degradation of antibiotics.

  7. [Correlation between genetic polymorphisms of -855 G/C and -1140 G/A in GRIN1 gene and paranoid schizophrenia].

    PubMed

    Li, Zhong-Jie; Ding, Mei; Pang, Hao; Sun, Xue-Fei; Xing, Jia-Xin; Xuan, Jin-Feng; Wang, Bao-Jie

    2013-04-01

    To investigate the single nucleotide polymorphisms (SNP) of -855 G/C and -1140 G/A in promoter regions of GRIN1 gene and find their genetic correlation to paranoid schizophrenia as well as their applicable values in forensic medicine. The genetic polymorphisms of -855 G/C and -1140 G/A at the 5' end of GRIN1 gene were detected by PCR restriction fragment length polymorphism and PAGE in 183 healthy unrelated individuals of northern Chinese Han population and 172 patients of paranoid schizophrenia, respectively. The chi2 test was used to identify Hardy-Weinberg equilibrium of the genotype distribution. The differences of genotypes and allelic frequency distributions were compared between the two groups. Distributions of the genotypic frequencies satisfied Hardy-Weinberg equilibrium in both groups. The difference of genotypes was statistically significant between female patient group and female control group in -855 G/C distribution (P < 0.05). The differences of genotypes and allelic frequencies were statistically significant not only between the patient group and the control group but also between female patient group and female control group in -1140 G/A distribution (P < 0.05). The SNP of -1140 G/A in promoter regions of GRIN1 gene might positively correlate to paranoid schizophrenia. The genetic factor of schizophrenia is involved in gender tendency. And it could be useful in forensic identification of schizophrenia.

  8. Immunization with a Vaccine Combining Herpes Simplex Virus 2 (HSV-2) Glycoprotein C (gC) and gD Subunits Improves the Protection of Dorsal Root Ganglia in Mice and Reduces the Frequency of Recurrent Vaginal Shedding of HSV-2 DNA in Guinea Pigs Compared to Immunization with gD Alone ▿

    PubMed Central

    Awasthi, Sita; Lubinski, John M.; Shaw, Carolyn E.; Barrett, Shana M.; Cai, Michael; Wang, Fushan; Betts, Michael; Kingsley, Susan; DiStefano, Daniel J.; Balliet, John W.; Flynn, Jessica A.; Casimiro, Danilo R.; Bryan, Janine T.; Friedman, Harvey M.

    2011-01-01

    Attempts to develop a vaccine to prevent genital herpes simplex virus 2 (HSV-2) disease have been only marginally successful, suggesting that novel strategies are needed. Immunization with HSV-2 glycoprotein C (gC-2) and gD-2 was evaluated in mice and guinea pigs to determine whether adding gC-2 to a gD-2 subunit vaccine would improve protection by producing antibodies that block gC-2 immune evasion from complement. Antibodies produced by gC-2 immunization blocked the interaction between gC-2 and complement C3b, and passive transfer of gC-2 antibody protected complement-intact mice but not C3 knockout mice against HSV-2 challenge, indicating that gC-2 antibody is effective, at least in part, because it prevents HSV-2 evasion from complement. Immunization with gC-2 also produced neutralizing antibodies that were active in the absence of complement; however, the neutralizing titers were higher when complement was present, with the highest titers in animals immunized with both antigens. Animals immunized with the gC-2-plus-gD-2 combination had robust CD4+ T-cell responses to each immunogen. Multiple disease parameters were evaluated in mice and guinea pigs immunized with gC-2 alone, gD-2 alone, or both antigens. In general, gD-2 outperformed gC-2; however, the gC-2-plus-gD-2 combination outperformed gD-2 alone, particularly in protecting dorsal root ganglia in mice and reducing recurrent vaginal shedding of HSV-2 DNA in guinea pigs. Therefore, the gC-2 subunit antigen enhances a gD-2 subunit vaccine by stimulating a CD4+ T-cell response, by producing neutralizing antibodies that are effective in the absence and presence of complement, and by blocking immune evasion domains that inhibit complement activation. PMID:21813597

  9. A label-free photoelectrochemical biosensor for urokinase-type plasminogen activator detection based on a g-C3N4/CdS nanocomposite.

    PubMed

    Liu, Xing-Pei; Chen, Jing-Shuai; Mao, Chang-Jie; Niu, He-Lin; Song, Ji-Ming; Jin, Bao-Kang

    2018-09-26

    Herein, we established a novel ultrasensitive photoelectrochemical biosensor for detecting urokinase-type plasminogen activator (u-PA), based on a g-C 3 N 4 /CdS nanocomposite. The prepared nanocomposite was characterized by transmission electron microscopy, X-ray photoelectron spectroscopy, ultraviolet-visible absorption spectroscopy, and Fourier transform infrared spectroscopy, thus indicating that the nanocomposite was prepared successfully. In the typical process, the prepared nanocomposite was deposited on the surface of a bare FTO electrode. After being air-dried, the g-C 3 N 4 /CdS nanocomposite modified electrode was successively incubated with antibody against urokinase-type plasminogen activator and the blocking agent BSA to produce a photoelectrochemical biosensor for u-PA. In the presence of target u-PA antigen, the photocurrent response of the prepared biosensor electrode decreased significantly. The proposed novel photoelectrochemical biosensor exhibited good sensitivity, specificity, and reproducibility for u-PA detection, and a low detection limit of 33 fg mL -1 , ranging from 1 μg mL -1 -0.1 pg mL -1 . The proposed strategy should provide a promising method for detection of other biomarkers. Copyright © 2018 Elsevier B.V. All rights reserved.

  10. Exposure of Piglets to Enteroviruses Investigated by an Immunoassay Based on the EV-G1 VP4 Peptide.

    PubMed

    Benkahla, Mehdi A; Sane, Famara; Desailloud, Rachel; Hober, Didier

    2016-01-01

    The aim of this study was to investigate the exposure of piglets to enteroviruses-G (EV-G) through the presence of antibodies in their serum. Serum samples were obtained from the vena cava of 10 piglets at 9 weeks of age and again 39 days later (day 39). They were tested using an immunoassay based on the EV-G1 VP4 peptide, since VP4 is highly conserved among the four Enterovirus capsid proteins, and by using a seroneutralization assay. For each serum collected on day 39 the optical density was high compared to the value obtained in serum collected earlier (p = 0.002). However, the titers of anti-EV-G1 serum neutralizing activity were not different in paired samples (p > 0.999). The sequence alignment of the EV-G1 VP4 peptide, encompassing 50 amino acids, used in the immunoassay showed 88% homology with EV-G, suggesting that antibodies directed toward other EV-G than EV-G1 may be detected. An immunoassay based on EV-G1 VP4 can detect an increased level of EV-G antibodies in piglet serum samples. Further studies are needed to determine whether this immunoassay may be useful for diagnosis and/or epidemiological studies and to monitor EV-G infection in pigs to evaluate strategies aimed to prevent enterovirus infections. © 2016 S. Karger AG, Basel.

  11. Imidazole modified g-C3N4 photocatalyst: Structural characterization and versatile energy applications

    NASA Astrophysics Data System (ADS)

    Zhang, Lu; Liu, Qianqian; Chai, Yuanyuan; Ren, Jia; Dai, Wei-Lin

    2018-02-01

    Novel imidazole modified g-C3N4 were firstly synthesized via a facile one-pot thermo-induced co-condensation method. Characterization results showed that imidazole modification can improve the visible light harvesting, interfacial charge transfer and separation of g-C3N4, without destroying its pristine framework structure. The as-obtained imidazole modified g-C3N4 showed remarkably enhanced and rather stable photocatalytic performance in H2 evolution, photo-degradation of water contaminants and selective photo-oxidation of benzyl alcohol, demonstrating its all-round applications as a versatile photocatalyst. The weight ratio between imidazole and urea was well tuned and the optimal photocatalytic activity was obtained, which shows CNU-I50 sample (50 mg imidazole in 15 g urea) possesses the highest hydrogen evolution rate of 2150 μmol g-1 h-1, superior to most of the previous reported g-C3N4 materials. These results suggest that those imidazole modified g-C3N4 materials are potential photocatalyst when applied to solar energy conversion, water purification and selective photosynthesis reactions.

  12. How Does Mg2+ Modulate the RNA Folding Mechanism: A Case Study of the G:C W:W Trans Basepair.

    PubMed

    Halder, Antarip; Roy, Rohit; Bhattacharyya, Dhananjay; Mitra, Abhijit

    2017-07-25

    Reverse Watson-Crick G:C basepairs (G:C W:W Trans) occur frequently in different functional RNAs. This is one of the few basepairs whose gas-phase-optimized isolated geometry is inconsistent with the corresponding experimental geometry. Several earlier studies indicate that through post-transcriptional modification, direct protonation, or coordination with Mg 2+ , accumulation of positive charge near N7 of guanine can stabilize the experimental geometry. Interestingly, recent studies reveal significant variation in the position of putatively bound Mg 2+ . This, in conjunction with recently raised doubts regarding some of the Mg 2+ assignments near the imino nitrogen of guanine, is suggestive of the existence of multiple Mg 2+ binding modes for this basepair. Our detailed investigation of Mg 2+ -bound G:C W:W Trans pairs occurring in high-resolution RNA crystal structures shows that they are found in 14 different contexts, eight of which display Mg 2+ binding at the Hoogsteen edge of guanine. Further examination of occurrences in these eight contexts led to the characterization of three different Mg 2+ binding modes: 1) direct binding via N7 coordination, 2) direct binding via O6 coordination, and 3) binding via hydrogen-bonding interaction with the first-shell water molecules. In the crystal structures, the latter two modes are associated with a buckled and propeller-twisted geometry of the basepair. Interestingly, respective optimized geometries of these different Mg 2+ binding modes (optimized using six different DFT functionals) are consistent with their corresponding experimental geometries. Subsequent interaction energy calculations at the MP2 level, and decomposition of its components, suggest that for G:C W:W Trans , Mg 2+ binding can fine tune the basepair geometries without compromising with their stability. Our results, therefore, underline the importance of the mode of binding of Mg 2+ ions in shaping RNA structure, folding and function. Copyright

  13. Distribution of Base Pair Alternations in a Periodic DNA Chain: Application of Pólya Counting to a Physical System

    NASA Astrophysics Data System (ADS)

    Hillebrand, Malcolm; Paterson-Jones, Guy; Kalosakas, George; Skokos, Charalampos

    2018-03-01

    In modeling DNA chains, the number of alternations between Adenine-Thymine (AT) and Guanine-Cytosine (GC) base pairs can be considered as a measure of the heterogeneity of the chain, which in turn could affect its dynamics. A probability distribution function of the number of these alternations is derived for circular or periodic DNA. Since there are several symmetries to account for in the periodic chain, necklace counting methods are used. In particular, Polya's Enumeration Theorem is extended for the case of a group action that preserves partitioned necklaces. This, along with the treatment of generating functions as formal power series, allows for the direct calculation of the number of possible necklaces with a given number of AT base pairs, GC base pairs and alternations. The theoretically obtained probability distribution functions of the number of alternations are accurately reproduced by Monte Carlo simulations and fitted by Gaussians. The effect of the number of base pairs on the characteristics of these distributions is also discussed, as well as the effect of the ratios of the numbers of AT and GC base pairs.

  14. Closing loop base pairs in RNA loop-loop complexes: structural behavior, interaction energy and solvation analysis through molecular dynamics simulations.

    PubMed

    Golebiowski, Jérôme; Antonczak, Serge; Fernandez-Carmona, Juan; Condom, Roger; Cabrol-Bass, Daniel

    2004-12-01

    Nanosecond molecular dynamics using the Ewald summation method have been performed to elucidate the structural and energetic role of the closing base pair in loop-loop RNA duplexes neutralized by Mg2+ counterions in aqueous phases. Mismatches GA, CU and Watson-Crick GC base pairs have been considered for closing the loop of an RNA in complementary interaction with HIV-1 TAR. The simulations reveal that the mismatch GA base, mediated by a water molecule, leads to a complex that presents the best compromise between flexibility and energetic contributions. The mismatch CU base pair, in spite of the presence of an inserted water molecule, is too short to achieve a tight interaction at the closing-loop junction and seems to force TAR to reorganize upon binding. An energetic analysis has allowed us to quantify the strength of the interactions of the closing and the loop-loop pairs throughout the simulations. Although the water-mediated GA closing base pair presents an interaction energy similar to that found on fully geometry-optimized structure, the water-mediated CU closing base pair energy interaction reaches less than half the optimal value.

  15. Plasmonic resonance enhanced photoelectrochemical aptasensors based on g-C3N4/Bi2MoO6.

    PubMed

    Qiu, Zhenli; Shu, Jian; Tang, Dianping

    2018-06-13

    An in-depth exploration associated with the localized surface plasmon resonance (LSPR) effect for plasmonic photoelectrochemistry (PEC) is beneficial for the development of high-efficiency biosensors. A novel phenomenon on the LSPR between g-C3N4/Bi2MoO6 and gold nanoparticles is investigated in a PEC aptasensing system under ultraviolet and visible light irradiation.

  16. Imaging of persistent cAMP signaling by internalized G protein-coupled receptors.

    PubMed

    Calebiro, Davide; Nikolaev, Viacheslav O; Lohse, Martin J

    2010-07-01

    G protein-coupled receptors (GPCRs) are the largest family of plasma membrane receptors. They mediate the effects of several endogenous cues and serve as important pharmacological targets. Although many biochemical events involved in GPCR signaling have been characterized in great detail, little is known about their spatiotemporal dynamics in living cells. The recent advent of optical methods based on fluorescent resonance energy transfer allows, for the first time, to directly monitor GPCR signaling in living cells. Utilizing these methods, it has been recently possible to show that the receptors for two protein/peptide hormones, the TSH and the parathyroid hormone, continue signaling to cAMP after their internalization into endosomes. This type of intracellular signaling is persistent and apparently triggers specific cellular outcomes. Here, we review these recent data and explain the optical methods used for such studies. Based on these findings, we propose a revision of the current model of the GPCR-cAMP signaling pathway to accommodate receptor signaling at endosomes.

  17. Paired methods to measure biofilm killing and removal: a case study with Penicillin G treatment of Staphylococcus aureus biofilm.

    PubMed

    Ausbacher, D; Lorenz, L; Pitts, B; Stewart, P S; Goeres, D M

    2018-03-01

    Biofilms are microbial aggregates that show high tolerance to antibiotic treatments in vitro and in vivo. Killing and removal are both important in biofilm control, therefore methods that measure these two mechanisms were evaluated in a parallel experimental design. Kill was measured using the single tube method (ASTM method E2871) and removal was determined by video microscopy and image analysis using a new treatment flow cell. The advantage of the parallel test design is that both methods used biofilm covered coupons harvested from a CDC biofilm reactor, a well-established and standardized biofilm growth method. The control Staphylococcus aureus biofilms treated with growth medium increased by 0·6 logs during a 3-h contact time. Efficacy testing showed biofilms exposed to 400 μmol l -1 penicillin G decreased by only 0·3 logs. Interestingly, time-lapse confocal scanning laser microscopy revealed that penicillin G treatment dispersed the biofilm despite being an ineffective killing agent. In addition, no biofilm removal was detected when assays were performed in 96-well plates. These results illustrate that biofilm behaviour and impact of treatments can vary substantially when assayed by different methods. Measuring both killing and removal with well-characterized methods will be crucial for the discovery of new anti-biofilm strategies. Biofilms are tolerant to antimicrobial treatments and can lead to persistent infections. Finding new anti-biofilm strategies and understanding their mode-of-action is therefore of high importance. Historically, antimicrobial testing has focused on measuring the decrease in viability. While kill data are undeniably important, measuring biofilm disruption provides equally useful information. Starting with biofilm grown in the same reactor, we paired assessment of biofilm removal using a new treatment-flow-cell and real-time microscopy with kill data collected using the single tube method (ASTM E2871). Pairing these two methods

  18. Effect of the structure distortion on the high photocatalytic performance of C60/g-C3N4 composite

    NASA Astrophysics Data System (ADS)

    Ma, Xiaojuan; Li, Xinru; Li, Mengmeng; Ma, Xiangchao; Yu, Lin; Dai, Ying

    2017-08-01

    C60/g-C3N4 composite was reported experimentally to be of high photocatalytic activity in degrading organics. To investigate the underlying mechanism of high photocatalytic performance, the structural and electronic properties of g-C3N4 monolayers with adsorbing and removing fullerene C60 are studied by means of density functional theory calculations. After 25 possible configurations examination, it is found that C60 prefers to stay upon the ;junction nitrogen; with the carbon atom of fullerene being nearest to monolayers. Correspondingly, a type-I band alignment appears. Our results further demonstrate that the adsorption of C60 can lead to an irreversible structure distortion for g-C3N4 from flat to wrinkle, which plays a crucial role in improving photocatalytic performance other than the separation of carriers at interface due to the formation of type-II heterojunctions as previous report. Compared to flat one, the light absorption of wrinkled structure shows augmented, the valence band maximum shifts towards lower position along with a stronger photo-oxidation capability. Interestingly, the results indicate that the energy, light absorption and band edge all have a particular relationship with wrinkle degree. The work presented here can be helpful to understand the mechanism behind the better photocatalytic performance for C60 modified g-C3N4.

  19. Apert Syndrome: Molecularly Confirmed C.758C>G (P.Pro253Arg) in FGFR2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cha Gon, Lee, E-mail: leechagon@eulji.ac.kr

    A 5-day-old girl was referred to our clinic for evaluation of congenital malformations. She was identified with a pathogenic mutation c.758C>G (p.Pro253Arg) in FGFR2 gene using targeted exome sequencing. The de novo mutation was confirmed with Sanger sequencing in the patient and her parents. She showed occipital plagiocephaly with frontal bossing (Figure A and B). Skull frontal and lateral radiography revealed fusion of most of the sutures except coronal suture, with convolutional markings (Figure D and E). She had complete cleft palate (Figure C). Her fused bilateral hands showed type II syndactyly with complete syndactyly between the ring and themore » little fingers (Figure F1-F3). Both toes were simple syndactyly with side-to-side fusion of skin (Figure G1-)« less

  20. Quantum correlation of fiber-based telecom-band photon pairs through standard loss and random media.

    PubMed

    Sua, Yong Meng; Malowicki, John; Lee, Kim Fook

    2014-08-15

    We study quantum correlation and interference of fiber-based telecom-band photon pairs with one photon of the pair experiencing multiple scattering in a random medium. We measure joint probability of two-photon detection for signal photon in a normal channel and idler photon in a channel, which is subjected to two independent conditions: standard loss (neutral density filter) and random media. We observe that both conditions degrade the correlation of signal and idler photons, and depolarization of the idler photon in random medium can enhance two-photon interference at certain relative polarization angles. Our theoretical calculation on two-photon polarization correlation and interference as a function of mean free path is in agreement with our experiment data. We conclude that quantum correlation of a polarization-entangled photon pair is better preserved than a polarization-correlated photon pair as one photon of the pair scatters through a random medium.