High frequency of a single nucleotide substitution (c.-6-180T>G) of the canine MDR1/ABCB1 gene associated with phenobarbital-resistant idiopathic epilepsy in Border Collie dogs.

PubMed

Mizukami, Keijiro; Yabuki, Akira; Chang, Hye-Sook; Uddin, Mohammad Mejbah; Rahman, Mohammad Mahbubur; Kushida, Kazuya; Kohyama, Moeko; Yamato, Osamu

2013-01-01

A single nucleotide substitution (c.-6-180T>G) associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type, T/G heterozygote, and G/G mutant homozygote to be 60.0%, 30.3%, and 9.8%, respectively, indicating that the frequency of the mutant G allele is extremely high (24.9%) in Border Collies. The results suggest that this high mutation frequency of the mutation is likely to cause a high prevalence of phenobarbital-resistant epilepsy in Border Collies.

Description of a novel allelic “thick leafed” mutant of sorghum

USDA-ARS?s Scientific Manuscript database

An allelic sorghum [Sorghum bicolor (L.) Moench] mutant with thick and narrow erect leaves (thl) and reduced adaxial stomatal density was isolated from the Annotated Individually pedigreed Mutagenized Sorghum (AIMS) mutant library developed at the Plant Stress and Germplasm Development Unit at Lubbo...

The G allele in IL-10-1082 G/A may have a role in lowering the susceptibility to panic disorder in female patients.

PubMed

Kim, Han-Joon; Kim, Yong-Ku

2016-12-01

Immune system activation is involved in the pathophysiology of panic disorder (PD). We investigated INF-γ+874 A/T, TNF-α-308 G/A, and IL-10-1082 G/A single nucleotide polymorphisms (SNPs) to determine their association with PD. This study enroled 135 PD patients and 135 healthy controls. INF-γ+874 A/T (rs2430561), TNF-α-308 G/A (rs1800629), and IL-10-1082 G/A (rs1800896) were genotyped. There were no differences in genotypes or allele frequencies between the patient and control groups, regardless of accompanying agoraphobia. However, for female patients, the G allele frequency in IL-10 SNP was higher in the control group than in the patient group. Additionally, the female control group had a higher frequency of the A/G and G/G genotype in the IL-10 SNP than the female patient group. We suggest that the G allele in IL-10-1082 G/A might have a role in reducing the manifestations of PD in female patients. Further studies are needed to extend and confirm our findings.

BRAF Gene Copy Number and Mutant Allele Frequency Correlate with Time to Progression in Metastatic Melanoma Patients Treated with MAPK Inhibitors.

PubMed

Stagni, Camilla; Zamuner, Carolina; Elefanti, Lisa; Zanin, Tiziana; Bianco, Paola Del; Sommariva, Antonio; Fabozzi, Alessio; Pigozzo, Jacopo; Mocellin, Simone; Montesco, Maria Cristina; Chiarion-Sileni, Vanna; De Nicolo, Arcangela; Menin, Chiara

2018-06-01

Metastatic melanoma is characterized by complex genomic alterations, including a high rate of mutations in driver genes and widespread deletions and amplifications encompassing various chromosome regions. Among them, chromosome 7 is frequently gained in BRAF -mutant melanoma, inducing a mutant allele-specific imbalance. Although BRAF amplification is a known mechanism of acquired resistance to therapy with MAPK inhibitors, it is still unclear if BRAF copy-number variation and BRAF mutant allele imbalance at baseline can be associated with response to treatment. In this study, we used a multimodal approach to assess BRAF copy number and mutant allele frequency in pretreatment melanoma samples from 46 patients who received MAPK inhibitor-based therapy, and we analyzed the association with progression-free survival. We found that 65% patients displayed BRAF gains, often supported by chromosome 7 polysomy. In addition, we observed that 64% patients had a balanced BRAF -mutant/wild-type allele ratio, whereas 14% and 23% patients had low and high BRAF mutant allele frequency, respectively. Notably, a significantly higher risk of progression was observed in patients with a diploid BRAF status versus those with BRAF gains [HR, 2.86; 95% confidence interval (CI), 1.29-6.35; P = 0.01] and in patients with low percentage versus those with a balanced BRAF mutant allele percentage (HR, 4.54; 95% CI, 1.33-15.53; P = 0.016). Our data suggest that quantitative analysis of the BRAF gene could be useful to select the melanoma patients who are most likely to benefit from therapy with MAPK inhibitors. Mol Cancer Ther; 17(6); 1332-40. ©2018 AACR . ©2018 American Association for Cancer Research.

High Frequency of a Single Nucleotide Substitution (c.-6-180T>G) of the Canine MDR1/ABCB1 Gene Associated with Phenobarbital-Resistant Idiopathic Epilepsy in Border Collie Dogs

PubMed Central

Mizukami, Keijiro; Yabuki, Akira; Chang, Hye-Sook; Uddin, Mohammad Mejbah; Rahman, Mohammad Mahbubur; Kushida, Kazuya; Kohyama, Moeko

2013-01-01

A single nucleotide substitution (c.-6-180T>G) associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type, T/G heterozygote, and G/G mutant homozygote to be 60.0%, 30.3%, and 9.8%, respectively, indicating that the frequency of the mutant G allele is extremely high (24.9%) in Border Collies. The results suggest that this high mutation frequency of the mutation is likely to cause a high prevalence of phenobarbital-resistant epilepsy in Border Collies. PMID:24302812

A rapid, highly accurate method for quantifying CALR mutant allele burden in persons with myeloproliferative neoplasms.

PubMed

Yao, Qiu-Mei; Zhou, Jiao; Gale, Robert Peter; Li, Jin-Lan; Li, Ling-Di; Li, Ning; Chen, Shan-Shan; Ruan, Guo-Rui

2015-10-01

Calreticulin (CALR) mutations were recently identified in a substantial proportion of persons with essential thrombocythemia (ET) and with primary myelofibrosis (PMF) without JAK2(V617F). Consequently rapid, sensitive, and specific methods to detect and quantify these mutations are needed. We studied samples from 1088 persons with myeloproliferative neoplasms (MPNs) including 421 JAK2(V617F) negative subjects with ET, PMF, polycythemia vera (PV), chronic myeloid leukemia (CML) and hyper-eosinophilic syndrome (HES). Detection of CALR exon 9 mutations was done by PCR amplification followed by fragment length analysis and direct sequencing. Dilution assays were used to determine CALR mutant allele burden. We detected CALR mutations in blood and bone marrow samples from 152 subjects with ET and with PMF but not in samples from normal or persons with PV, CML, or HES. CALR mutant peaks were distinct from wild-type peaks and dilution experiments indicated a sensitivity level of 0.5-5% for a CALR mutant allele in a wild-type background. Diverse types of mutations were detected including deletions, insertions, and complex indels. All mutations were confirmed by direct sequencing. We also used dilution experiments to quantify mutant allele burden. We were able to reproducibly detect mutant allele levels as low 5% (0.5-5%) in a wild-type background. PCR amplification followed by fragment length analysis is a rapid, sensitive, and specific method for screening persons with MPNs for CALR mutations, especially those with ET and PMF and for estimating mutant allele burden.

Hearing loss associated with enlarged vestibular aqueduct and zero or one mutant allele of SLC26A4.

PubMed

Rose, Jane; Muskett, Julie A; King, Kelly A; Zalewski, Christopher K; Chattaraj, Parna; Butman, John A; Kenna, Margaret A; Chien, Wade W; Brewer, Carmen C; Griffith, Andrew J

2017-07-01

To characterize the severity and natural history of hearing loss, and the prevalence of having a cochlear implant in a maturing cohort of individuals with enlarged vestibular aqueduct (EVA) and zero or one mutant allele of SLC26A4. Prospective cohort study of subjects ascertained between 1998 and 2015 at the National Institutes of Health Clinical Center. Study subjects were 127 individuals (median age, 8 years; range, 0-59 years) with EVA in at least one ear. Ears with EVA and zero or one mutant allele of SLC26A4 had mean 0.5/1/2/4-kHz pure-tone averages of 62.6 and 52.9 dB HL, respectively, in contrast to EVA ears with two mutant alleles of SLC26A4 (88.1 dB HL; P < .01). This association was independent of age, sex, or side of EVA (P < .001). Natural history of hearing loss was not associated with number of mutant alleles (P = .94). The prevalence of having a cochlear implant was nine (12%) of 76, two (13%) of 15, and 12 (38%) of 32 subjects with zero, one, and two mutant alleles, respectively (P = .00833). This association was not independent (P = .534) but reflected underlying correlations with age at time of first audiogram (P = .003) or severity of hearing loss (P = .000). Ears with EVA and zero or one mutant allele of SLC26A4 have less severe hearing loss, no difference in prevalence of fluctuation, and a lower prevalence of cochlear implantation in comparison to ears with two mutant alleles of SLC26A4. NA Laryngoscope, 127:E238-E243, 2017. © 2016 The American Laryngological, Rhinological and Otological Society, Inc.

Fetal HLA-G alleles and their effect on miscarriage.

PubMed

Koc, Altug; Kirbiyik, Ozgur; Kutbay, Yasar B; Ozyilmaz, Berk; Ozdemir, Taha R; Kaya, Ozge Ozer; Kubat, Gozde; Koc, Zeynep Peker

2018-05-29

Immunosuppression at the feto-maternal interface is crucial for a successful pregnancy outcome. Human leukocyte antigen-G (HLA-G) seems to be a major contributor to fetal tolerance. The HLA-G expression is seen in cytotrophoblasts and in maternal blood. Fetal HLA-G acts on decidual antigen-presenting cells (APCs), natural killers (NKs) and T cells. Recent findings revealed that defects in placentation and their consequences are associated with maternal HLA-G variants and their expression levels. The objective of this article is to investigate the relationship between fetal HLA-G alleles and miscarriage, which has not been investigated to date. The present study includes 204 recurrent miscarriage (RM) cases who were admitted to our clinic between 2012 and 2016. Twenty-eight miscarriage products without maternal cell contamination and any known pathology were analyzed by HLA-G typing. In addition, 3' untranslated region (UTR) 14-base pair (bp) insertion/deletion polymorphism was also investigated by Sanger sequencing. For our population, the most frequent HLA-G type was G*01:01, both in the study group (30.3%) and in the control group (47%). The study revealed that the G*01:04 allele was significantly associated with miscarriage (p = 0.007). The 3' UTR 14bp deletion was more frequent in the miscarriage group, but there was no significant correlation. HLA-G alleles seem to be related with miscarriage and should be considered in RM cases.

Frequency of null allele of Human Leukocyte Antigen-G (HLA-G) locus in subjects to recurrent miscarriage.

PubMed

Alizadeh, Nazila; Mosaferi, Elnaz; Farzadi, Laya; Majidi, Jafar; Monfaredan, Amir; Yousefi, Bahman; Baradaran, Behzad

2016-07-01

Human leukocyte antigen-G (HLA-G) is a non-classical class I molecule highly expressed by extravillous cytotrophoblast cells. Due to a single base pair deletion, its function can be compensated by other isoforms. Investigating the frequency of null allele in Recurrent Miscarriage (RM) subjects could be useful in understanding the relationship between frequency of this allele and RM in a given population. This study aimed to determine the frequency of HLA-G*0105N null allele and its potential association with down-regulation of HLA-G in subjects with RM. Western blotting was used to assess the level of HLA-G protein expression. For investigating the frequency of HLA-G*0105N null allele in RM subjects, PCR-RFLP method was used. Exon 3 of HLA-G gene was amplified by polymerase chain reaction (PCR). Subsequently, PpuM-1 enzyme was employed to digest the PCR products and fragments were analyzed using gel electrophoresis. Digestion using restriction enzyme showed the presence of heterozygous HLA-G*0105N null allele in 10% of the test population. Western blotting results confirmed the decrease in expression of HLA-G in the placental tissue of subjects with RM compared to subjects who could give normal birth. The frequency of heterozygous HLA-G*0105N null allele was high to some extent in subjects with RM. The mutation rate in subjects suggested that there is a significant association between RM and frequency of mutations in this allele.

Frequency of null allele of Human Leukocyte Antigen-G (HLA-G) locus in subjects to recurrent miscarriage

PubMed Central

Alizadeh, Nazila; Mosaferi, Elnaz; Farzadi, Laya; Majidi, Jafar; Monfaredan, Amir; Yousefi, Bahman; Baradaran, Behzad

2016-01-01

Background: Human leukocyte antigen-G (HLA-G) is a non-classical class I molecule highly expressed by extravillous cytotrophoblast cells. Due to a single base pair deletion, its function can be compensated by other isoforms. Investigating the frequency of null allele in Recurrent Miscarriage (RM) subjects could be useful in understanding the relationship between frequency of this allele and RM in a given population. Objective: This study aimed to determine the frequency of HLA-G*0105N null allele and its potential association with down-regulation of HLA-G in subjects with RM. Materials and Methods: Western blotting was used to assess the level of HLA-G protein expression. For investigating the frequency of HLA-G*0105N null allele in RM subjects, PCR-RFLP method was used. Exon 3 of HLA-G gene was amplified by polymerase chain reaction (PCR). Subsequently, PpuM-1 enzyme was employed to digest the PCR products and fragments were analyzed using gel electrophoresis. Results: Digestion using restriction enzyme showed the presence of heterozygous HLA-G*0105N null allele in 10% of the test population. Western blotting results confirmed the decrease in expression of HLA-G in the placental tissue of subjects with RM compared to subjects who could give normal birth. Conclusion: The frequency of heterozygous HLA-G*0105N null allele was high to some extent in subjects with RM. The mutation rate in subjects suggested that there is a significant association between RM and frequency of mutations in this allele. PMID:27525330

Enhancing the GABI-Kat Arabidopsis thaliana T-DNA Insertion Mutant Database by Incorporating Araport11 Annotation.

PubMed

Kleinboelting, Nils; Huep, Gunnar; Weisshaar, Bernd

2017-01-01

SimpleSearch provides access to a database containing information about T-DNA insertion lines of the GABI-Kat collection of Arabidopsis thaliana mutants. These mutants are an important tool for reverse genetics, and GABI-Kat is the second largest collection of such T-DNA insertion mutants. Insertion sites were deduced from flanking sequence tags (FSTs), and the database contains information about mutant plant lines as well as insertion alleles. Here, we describe improvements within the interface (available at http://www.gabi-kat.de/db/genehits.php) and with regard to the database content that have been realized in the last five years. These improvements include the integration of the Araport11 genome sequence annotation data containing the recently updated A. thaliana structural gene descriptions, an updated visualization component that displays groups of insertions with very similar insertion positions, mapped confirmation sequences, and primers. The visualization component provides a quick way to identify insertions of interest, and access to improved data about the exact structure of confirmed insertion alleles. In addition, the database content has been extended by incorporating additional insertion alleles that were detected during the confirmation process, as well as by adding new FSTs that have been produced during continued efforts to complement gaps in FST availability. Finally, the current database content regarding predicted and confirmed insertion alleles as well as primer sequences has been made available as downloadable flat files. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists.

Real-time PCR genotyping assay for canine progressive rod-cone degeneration and mutant allele frequency in Toy Poodles, Chihuahuas and Miniature Dachshunds in Japan.

PubMed

Kohyama, Moeko; Tada, Naomi; Mitsui, Hiroko; Tomioka, Hitomi; Tsutsui, Toshihiko; Yabuki, Akira; Rahman, Mohammad Mahbubur; Kushida, Kazuya; Mizukami, Keijiro; Yamato, Osamu

2016-03-01

Canine progressive rod-cone degeneration (PRCD) is a middle- to late-onset, autosomal recessive, inherited retinal disorder caused by a substitution (c.5G>A) in the canine PRCD gene that has been identified in 29 or more purebred dogs. In the present study, a TaqMan probe-based real-time PCR assay was developed and evaluated for rapid genotyping and large-scale screening of the mutation. Furthermore, a genotyping survey was carried out in a population of the three most popular breeds in Japan (Toy Poodles, Chihuahuas and Miniature Dachshunds) to determine the current mutant allele frequency. The assay separated all the genotypes of canine PRCD rapidly, indicating its suitability for large-scale surveys. The results of the survey showed that the mutant allele frequency in Toy Poodles was high enough (approximately 0.09) to allow the establishment of measures for the prevention and control of this disorder in breeding kennels. The mutant allele was detected in Chihuahuas for the first time, but the frequency was lower (approximately 0.02) than that in Toy Poodles. The mutant allele was not detected in Miniature Dachshunds. This assay will allow the selective breeding of dogs from the two most popular breeds (Toy Poodle and Chihuahua) in Japan and effective prevention or control of the disorder.

Effects of mutant human Ki-ras{sup G12C} gene dosage on murine lung tumorigenesis and signaling to its downstream effectors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dance-Barnes, Stephanie T.; Kock, Nancy D.; Floyd, Heather S.

2008-08-15

Studies in cell culture have suggested that the level of RAS expression can influence the transformation of cells and the signaling pathways stimulated by mutant RAS expression. However, the levels of RAS expression in vivo appear to be subject to feedback regulation, limiting the total amount of RAS protein that can be expressed. We utilized a bitransgenic mouse lung tumor model that expressed the human Ki-ras{sup G12C} allele in a tetracycline-inducible, lung-specific manner. Treatment for 12 months with 500 {mu}g/ml of doxycycline (DOX) allowed for maximal expression of the human Ki-ras{sup G12C} allele in the lung, and resulted in themore » development of focal hyperplasia and adenomas. We determined if different levels of mutant RAS expression would influence the phenotype of the lung lesions. Treatment with 25, 100 and 500 {mu}g/ml of DOX resulted in dose-dependent increases in transgene expression and tumor multiplicity. Microscopic analysis of the lungs of mice treated with the 25 {mu}g/ml dose of DOX revealed infrequent foci of hyperplasia, whereas mice treated with the 100 and 500 {mu}g/ml doses exhibited numerous hyperplastic foci and also adenomas. Immunohistochemical and RNA analysis of the downstream effector pathways demonstrated that different levels of mutant RAS transgene expression resulted in differences in the expression and/or phosphorylation of specific signaling molecules. Our results suggest that the molecular alterations driving tumorigenesis may differ at different levels of mutant Ki-ras{sup G12C} expression, and this should be taken into consideration when inducible transgene systems are utilized to promote tumorigenesis in mouse models.« less

Marker-assisted selection for recognizing wheat mutant genotypes carrying HMW glutenin alleles related to baking quality.

PubMed

Zamani, Mohammad Javad; Bihamta, Mohammad Reza; Naserian Khiabani, Behnam; Tahernezhad, Zahra; Hallajian, Mohammad Taher; Shamsi, Marzieh Varasteh

2014-01-01

Allelic diversity of HMW glutenin loci in several studies revealed that allelic combinations affect dough quality. Dx5 + Dy10 subunits are related to good baking quality and Dx2 + Dy12 are related to undesirable baking quality. One of the most regular methods to evaluate the baking quality is SDS-PAGE which is used to improve baking quality labs. Marker-assisted selection is the method which can recognize the alleles related to baking quality and this method is based on polymerase chain reaction. 10 pairs of specific primers related to Dx2, Dx2.1, Dx5, Dy10, and Dy12 subunits were used for recognizing baking quality of some wheat varieties and some mutant genotypes. Only 5 pairs of them could show the specific bands. All subunits were recognized by the primers except Dx2.1. Some of the primers were extracted from previous studies and the others were designed based on D genome subunits of wheat. SDS-PAGE method accomplished having confidence in these marker's results. To realize the effect of mutation, seed storage proteins were measured. It showed that mutation had effect on the amount of seed storage protein on the mutant seeds (which showed polymorphism).

Increased prevalence of mutant null alleles that cause hereditary fructose intolerance in the American population.

PubMed

Coffee, Erin M; Yerkes, Laura; Ewen, Elizabeth P; Zee, Tiffany; Tolan, Dean R

2010-02-01

Mutations in the aldolase B gene (ALDOB) impairing enzyme activity toward fructose-1-phosphate cleavage cause hereditary fructose intolerance (HFI). Diagnosis of the disease is possible by identifying known mutant ALDOB alleles in suspected patients; however, the frequencies of mutant alleles can differ by population. Here, 153 American HFI patients with 268 independent alleles were analyzed to identify the prevalence of seven known HFI-causing alleles (A149P, A174D, N334K, Delta4E4, R59Op, A337V, and L256P) in this population. Allele-specific oligonucleotide hybridization analysis was performed on polymerase chain reaction (PCR)-amplified genomic DNA from these patients. In the American population, the missense mutations A149P and A174D are the two most common alleles, with frequencies of 44% and 9%, respectively. In addition, the nonsense mutations Delta4E4 and R59Op are the next most common alleles, with each having a frequency of 4%. Together, the frequencies of all seven alleles make up 65% of HFI-causing alleles in this population. Worldwide, these same alleles make up 82% of HFI-causing mutations. This difference indicates that screening for common HFI alleles is more difficult in the American population. Nevertheless, a genetic screen for diagnosing HFI in America can be improved by including all seven alleles studied here. Lastly, identification of HFI patients presenting with classic symptoms and who have homozygous null genotypes indicates that aldolase B is not required for proper development or metabolic maintenance.

Real-time PCR genotyping assay for canine progressive rod-cone degeneration and mutant allele frequency in Toy Poodles, Chihuahuas and Miniature Dachshunds in Japan

PubMed Central

KOHYAMA, Moeko; TADA, Naomi; MITSUI, Hiroko; TOMIOKA, Hitomi; TSUTSUI, Toshihiko; YABUKI, Akira; RAHMAN, Mohammad Mahbubur; KUSHIDA, Kazuya; MIZUKAMI, Keijiro; YAMATO, Osamu

2015-01-01

Canine progressive rod-cone degeneration (PRCD) is a middle- to late-onset, autosomal recessive, inherited retinal disorder caused by a substitution (c.5G>A) in the canine PRCD gene that has been identified in 29 or more purebred dogs. In the present study, a TaqMan probe-based real-time PCR assay was developed and evaluated for rapid genotyping and large-scale screening of the mutation. Furthermore, a genotyping survey was carried out in a population of the three most popular breeds in Japan (Toy Poodles, Chihuahuas and Miniature Dachshunds) to determine the current mutant allele frequency. The assay separated all the genotypes of canine PRCD rapidly, indicating its suitability for large-scale surveys. The results of the survey showed that the mutant allele frequency in Toy Poodles was high enough (approximately 0.09) to allow the establishment of measures for the prevention and control of this disorder in breeding kennels. The mutant allele was detected in Chihuahuas for the first time, but the frequency was lower (approximately 0.02) than that in Toy Poodles. The mutant allele was not detected in Miniature Dachshunds. This assay will allow the selective breeding of dogs from the two most popular breeds (Toy Poodle and Chihuahua) in Japan and effective prevention or control of the disorder. PMID:26549343

Characterization of grape Gibberellin Insensitive 1 mutant alleles in transgenic Arabidopsis

USDA-ARS?s Scientific Manuscript database

We generated a dozen of different mutations in the grape Gibberellin Insensitive or GAI sequence, transformed them into Arabidopsis under the control of 35S, Arabidopsis or grape GAI promoter, and evaluated the impact of these mutant alleles on plant growth and development. These GAI sequence varian...

Allelic polymorphism in the T cell receptor and its impact on immune responses.

PubMed

Gras, Stephanie; Chen, Zhenjun; Miles, John J; Liu, Yu Chih; Bell, Melissa J; Sullivan, Lucy C; Kjer-Nielsen, Lars; Brennan, Rebekah M; Burrows, Jacqueline M; Neller, Michelle A; Khanna, Rajiv; Purcell, Anthony W; Brooks, Andrew G; McCluskey, James; Rossjohn, Jamie; Burrows, Scott R

2010-07-05

In comparison to human leukocyte antigen (HLA) polymorphism, the impact of allelic sequence variation within T cell receptor (TCR) loci is much less understood. Particular TCR loci have been associated with autoimmunity, but the molecular basis for this phenomenon is undefined. We examined the T cell response to an HLA-B*3501-restricted epitope (HPVGEADYFEY) from Epstein-Barr virus (EBV), which is frequently dominated by a TRBV9*01(+) public TCR (TK3). However, the common allelic variant TRBV9*02, which differs by a single amino acid near the CDR2beta loop (Gln55-->His55), was never used in this response. The structure of the TK3 TCR, its allelic variant, and a nonnaturally occurring mutant (Gln55-->Ala55) in complex with HLA-B*3501(HPVGEADYFEY) revealed that the Gln55-->His55 polymorphism affected the charge complementarity at the TCR-peptide-MHC interface, resulting in reduced functional recognition of the cognate and naturally occurring variants of this EBV peptide. Thus, polymorphism in the TCR loci may contribute toward variability in immune responses and the outcome of infection.

Development of allele-specific multiplex PCR to determine the length of poly-T in intron 8 of CFTR

PubMed Central

Prada, Anne E.

2014-01-01

Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutation analysis has been implemented for Cystic Fibrosis (CF) carrier screening, and molecular diagnosis of CF and congenital bilateral absence of the vas deferens (CBAVD). Although poly-T allele analysis in intron 8 of CFTR is required when a patient is positive for R117H, it is not recommended for routine carrier screening. Therefore, commercial kits for CFTR mutation analysis were designed either to mask the poly-T allele results, unless a patient is R117H positive, or to have the poly-T analysis as a standalone reflex test using the same commercial platform. There are other standalone assays developed to detect poly-T alleles, such as heteroduplex analysis, High Resolution Melting (HRM) curve analysis, allele-specific PCR (AS-PCR) and Sanger sequencing. In this report, we developed a simple and easy-to-implement multiplex AS-PCR assay using unlabeled standard length primers, which can be used as a reflex or standalone test for CFTR poly-T track analysis. Out of 115 human gDNA samples tested, results from our new AS-PCR matched to the previous known poly-T results or results from Sanger sequencing. PMID:25071991

Mutant alleles of FAD2-1A and FAD2-1B combine to produce soybeans with the high oleic acid seed oil trait

PubMed Central

2010-01-01

Background The alteration of fatty acid profiles in soybean [Glycine max (L.) Merr.] to improve soybean oil quality is an important and evolving theme in soybean research to meet nutritional needs and industrial criteria in the modern market. Soybean oil with elevated oleic acid is desirable because this monounsaturated fatty acid improves the nutrition and oxidative stability of the oil. Commodity soybean oil typically contains 20% oleic acid and the target for high oleic acid soybean oil is approximately 80% of the oil; previous conventional plant breeding research to raise the oleic acid level to just 50-60% of the oil was hindered by the genetic complexity and environmental instability of the trait. The objective of this work was to create the high oleic acid trait in soybeans by identifying and combining mutations in two delta-twelve fatty acid desaturase genes, FAD2-1A and FAD2-1B. Results Three polymorphisms found in the FAD2-1B alleles of two soybean lines resulted in missense mutations. For each of the two soybean lines, there was one unique amino acid change within a highly conserved region of the protein. The mutant FAD2-1B alleles were associated with an increase in oleic acid levels, although the FAD2-1B mutant alleles alone were not capable of producing a high oleic acid phenotype. When existing FAD2-1A mutations were combined with the novel mutant FAD2-1B alleles, a high oleic acid phenotype was recovered only for those lines which were homozygous for both of the mutant alleles. Conclusions We were able to produce conventional soybean lines with 80% oleic acid in the oil in two different ways, each requiring the contribution of only two genes. The high oleic acid soybean germplasm developed contained a desirable fatty acid profile, and it was stable in two production environments. The presumed causative sequence polymorphisms in the FAD2-1B alleles were developed into highly efficient molecular markers for tracking the mutant alleles. The resources

Mutant alleles of FAD2-1A and FAD2-1B combine to produce soybeans with the high oleic acid seed oil trait.

PubMed

Pham, Anh-Tung; Lee, Jeong-Dong; Shannon, J Grover; Bilyeu, Kristin D

2010-09-09

The alteration of fatty acid profiles in soybean [Glycine max (L.) Merr.] to improve soybean oil quality is an important and evolving theme in soybean research to meet nutritional needs and industrial criteria in the modern market. Soybean oil with elevated oleic acid is desirable because this monounsaturated fatty acid improves the nutrition and oxidative stability of the oil. Commodity soybean oil typically contains 20% oleic acid and the target for high oleic acid soybean oil is approximately 80% of the oil; previous conventional plant breeding research to raise the oleic acid level to just 50-60% of the oil was hindered by the genetic complexity and environmental instability of the trait. The objective of this work was to create the high oleic acid trait in soybeans by identifying and combining mutations in two delta-twelve fatty acid desaturase genes, FAD2-1A and FAD2-1B. Three polymorphisms found in the FAD2-1B alleles of two soybean lines resulted in missense mutations. For each of the two soybean lines, there was one unique amino acid change within a highly conserved region of the protein. The mutant FAD2-1B alleles were associated with an increase in oleic acid levels, although the FAD2-1B mutant alleles alone were not capable of producing a high oleic acid phenotype. When existing FAD2-1A mutations were combined with the novel mutant FAD2-1B alleles, a high oleic acid phenotype was recovered only for those lines which were homozygous for both of the mutant alleles. We were able to produce conventional soybean lines with 80% oleic acid in the oil in two different ways, each requiring the contribution of only two genes. The high oleic acid soybean germplasm developed contained a desirable fatty acid profile, and it was stable in two production environments. The presumed causative sequence polymorphisms in the FAD2-1B alleles were developed into highly efficient molecular markers for tracking the mutant alleles. The resources described here for the creation

A Novel c.125 T>G (p.Val42Gly) Mutation in The Human INS Gene Leads to Neonatal Diabetes Mellitus via a Decrease in Insulin Synthesis.

PubMed

Sun, Fei; Du, Wenhua; Ma, Junhua; Gu, Mingjun; Wang, Jingnan; Zhu, Hongling; Song, Huaidong; Gao, Guanqi

2018-06-11

Neonatal diabetes mellitus is likely caused by monogenic mutations, several of which have been identified. INS mutations have a broad spectrum of clinical presentations, ranging from severe neonatal onset to mild adult onset, which suggests that the products of different mutant INS alleles behave differently and utilize distinct mechanisms to induce diabetes. In this study, a neonatal diabetes mellitus patient's INS gene was sequenced, and functional experiments were conducted. The neonatal diabetes mellitus patient's genomic DNA was extracted, and the patient's KCNJ11, ABCC8, and INS genes were sequenced. A novel mutation was identified in INS, and the open reading frame of this human mutant INS gene was inserted into the pMSCV-PIG plasmid. The constructed pMSCV-PIG plasmid was combined with VSV-g and Gag-pol and transfected into 293T cells to package the lentivirus. To stably overexpress the mutant gene, INS-1 cells were infected with the virus. The levels of insulin in the cell culture medium and cytoplasm were determined by ELISA and immunocytochemistry, respectively. A heterozygous mutation, c.125T>G (p. Val42Gly), was identified in a neonatal diabetes mellitus patient's INS gene. The human mutant INS open reading frame was overexpressed in INS-1 cells, and the mutant insulin was undetectable in the cell culture medium and cytoplasm. The novel heterozygous activating mutation c.125 T>G (p.Val42Gly) impairs the synthesis of insulin by pancreatic beta cells, resulting in diabetes. © Georg Thieme Verlag KG Stuttgart · New York.

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

PubMed

Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

2017-10-01

Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

Impaired Heme Binding and Aggregation of Mutant Cystathionine β-Synthase Subunits in Homocystinuria

PubMed Central

Janošík, Miroslav; Oliveriusová, Jana; Janošíková, Bohumila; Sokolová, Jitka; Kraus, Eva; Kraus, Jan P.; Kožich, Viktor

2001-01-01

During the past 20 years, cystathionine β-synthase (CBS) deficiency has been detected in the former Czechoslovakia with a calculated frequency of 1:349,000. The clinical manifestation was typical of homocystinuria, and about half of the 21 patients were not responsive to pyridoxine. Twelve distinct mutations were detected in 30 independent homocystinuric alleles. One half of the alleles carried either the c.833 T→C or the IVS11−2A→C mutation; the remaining alleles contained private mutations. The abundance of five mutant mRNAs with premature stop codons was analyzed by PCR-RFLP. Two mRNAs, c.828_931ins104 (IVS7+1G→A) and c.1226 G→A, were severely reduced in the cytoplasm as a result of nonsense-mediated decay. In contrast, the other three mRNAs—c.19_20insC, c.28_29delG, and c.210_235del26 (IVS1−1G→C)—were stable. Native western blot analysis of 14 mutant fibroblast lines showed a paucity of CBS antigen, which was detectable only in aggregates. Five mutations—A114V (c.341C→T), A155T (c.463G→A), E176K (c.526G→A), I278T (c.833T→C), and W409_G453del (IVS11−2A→C)—were expressed in Escherichia coli. All five mutant proteins formed substantially more aggregates than did the wild-type CBS, and no aggregates contained heme. These data suggest that abnormal folding, impaired heme binding, and aggregation of mutant CBS polypeptides may be common pathogenic mechanisms in CBS deficiency. PMID:11359213

Characterization of a Null Allelic Mutant of the Rice NAL1 Gene Reveals Its Role in Regulating Cell Division

PubMed Central

Jiang, Dan; Fang, Jingjing; Lou, Lamei; Zhao, Jinfeng; Yuan, Shoujiang; Yin, Liang; Sun, Wei; Peng, Lixiang; Guo, Baotai; Li, Xueyong

2015-01-01

Leaf morphology is closely associated with cell division. In rice, mutations in Narrow leaf 1 (NAL1) show narrow leaf phenotypes. Previous studies have shown that NAL1 plays a role in regulating vein patterning and increasing grain yield in indica cultivars, but its role in leaf growth and development remains unknown. In this report, we characterized two allelic mutants of NARROW LEAF1 (NAL1), nal1-2 and nal1-3, both of which showed a 50% reduction in leaf width and length, as well as a dwarf culm. Longitudinal and transverse histological analyses of leaves and internodes revealed that cell division was suppressed in the anticlinal orientation but enhanced in the periclinal orientation in the mutants, while cell size remained unaltered. In addition to defects in cell proliferation, the mutants showed abnormal midrib in leaves. Map-based cloning revealed that nal1-2 is a null allelic mutant of NAL1 since both the whole promoter and a 404-bp fragment in the first exon of NAL1 were deleted, and that a 6-bp fragment was deleted in the mutant nal1-3. We demonstrated that NAL1 functions in the regulation of cell division as early as during leaf primordia initiation. The altered transcript level of G1- and S-phase-specific genes suggested that NAL1 affects cell cycle regulation. Heterogenous expression of NAL1 in fission yeast (Schizosaccharomyces pombe) further supported that NAL1 affects cell division. These results suggest that NAL1 controls leaf width and plant height through its effects on cell division. PMID:25658704

Biochemical Analysis of Two Single Mutants that Give Rise to a Polymorphic G6PD A-Double Mutant

PubMed Central

Ramírez-Nava, Edson Jiovany; González-Valdez, Abigail; Vanoye-Carlo, America; Hernández-Ochoa, Beatriz; Sierra-Palacios, Edgar; Hernández-Pineda, Jessica; Rodríguez-Bustamante, Eduardo; Arreguin-Espinosa, Roberto; Oria-Hernández, Jesús; Reyes-Vivas, Horacio; Marcial-Quino, Jaime

2017-01-01

Glucose-6-phosphate dehydrogenase (G6PD) is a key regulatory enzyme that plays a crucial role in the regulation of cellular energy and redox balance. Mutations in the gene encoding G6PD cause the most common enzymopathy that drives hereditary nonspherocytic hemolytic anemia. To gain insights into the effects of mutations in G6PD enzyme efficiency, we have investigated the biochemical, kinetic, and structural changes of three clinical G6PD variants, the single mutations G6PD A+ (Asn126AspD) and G6PD Nefza (Leu323Pro), and the double mutant G6PD A− (Asn126Asp + Leu323Pro). The mutants showed lower residual activity (≤50% of WT G6PD) and displayed important kinetic changes. Although all Class III mutants were located in different regions of the three-dimensional structure of the enzyme and were not close to the active site, these mutants had a deleterious effect over catalytic activity and structural stability. The results indicated that the G6PD Nefza mutation was mainly responsible for the functional and structural alterations observed in the double mutant G6PD A−. Moreover, our study suggests that the G6PD Nefza and G6PD A− mutations affect enzyme functions in a similar fashion to those reported for Class I mutations. PMID:29072585

Plasminogen activator inhibitor-1 4G/5G and the MTHFR 677C/T polymorphisms and susceptibility to polycystic ovary syndrome: a meta-analysis.

PubMed

Lee, Young Ho; Song, Gwan Gyu

2014-04-01

The aim of this study was to explore whether the plasminogen activator inhibitor-1 (PAI-1) 4G/5G and the methylenetetrahydrofolate reductase (MTHFR) 677C/T polymorphisms are associated with susceptibility to polycystic ovary syndrome (PCOS). Meta-analyses were conducted to determine the association between the PAI-1 4G/5G and MTHFR 677C/T polymorphisms and PCOS using: (1) allele contrast (2) homozygote contrast, (3) recessive, and (4) dominant models. For meta-analysis, nine studies of the PAI-1 4G/5G polymorphism with 2384 subjects (PCOS, 1615; controls, 769) and eight studies of the MTHFR 677C/T polymorphism with 1270 study subjects were included. Meta-analysis of all study subjects showed no association between PCOS and the PAI-1 4G allele (OR=0.949, 95% CI=0.671-1.343, p=0.767). Stratification by ethnicity, however, indicated a significant association between the PAI-1 4G allele and PCOS in Turkish and Asian populations (OR=0.776, 95% CI=0.602-0.999, p=0.049; OR=1.749, 95% CI=1.297-2.359, p=2.5×10(-5) respectively). In addition, meta-analysis indicated an association between PCOS and the PAI-1 4G4G+4G5G genotype in Europeans (OR=1.406, 95% CI=1.025-1.928, p=0.035). However, meta-analysis of all study subjects showed no association between PCOS and the MTHFR 677T allele (OR=0.998, 95% CI=0.762-1.307, p=0.989), including Europeans (OR=0.806, 95% CI=0.610-1.063, p=0.126). Meta-analysis showed no association between PCOS and the MTHFR 677C/T polymorphism using homozygote contrast, and recessive and dominant models. In conclusion, meta-analysis suggests the PAI-1 4G/5G polymorphism is associated with susceptibility to PCOS in European, Turkish, and Asian populations, but the MTHFR 677C/T polymorphism is not associated with susceptibility to PCOS in Europeans. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Origin and Dissemination of Chloroquine-Resistant Plasmodium falciparum with Mutant pfcrt Alleles in the Philippines

PubMed Central

Chen, Nanhua; Wilson, Danny W.; Pasay, Cielo; Bell, David; Martin, Laura B.; Kyle, Dennis; Cheng, Qin

2005-01-01

The pfcrt allelic type and adjacent microsatellite marker type were determined for 82 Plasmodium falciparum isolates from the Philippines. Mutant pfcrt allelic types P1a and P2a/P2b were dominant in different locations. Microsatellite analysis revealed that P2a/P2b evolved independently in the Philippines, while P1a shared common ancestry with Papua New Guinea chloroquine-resistant parasites. PMID:15855538

EGFR mutant allelic-specific imbalance assessment in routine samples of non-small cell lung cancer.

PubMed

Malapelle, Umberto; Vatrano, Simona; Russo, Stefania; Bellevicine, Claudio; de Luca, Caterina; Sgariglia, Roberta; Rocco, Danilo; de Pietro, Livia; Riccardi, Fernando; Gobbini, Elisa; Righi, Luisella; Troncone, Giancarlo

2015-09-01

In non-small cell lung cancer (NSCLC), the epidermal growth factor receptor (EGFR) gene may undergo both mutations and copy number gains. EGFR mutant allele-specific imbalance (MASI) occurs when the ratio of mutant-to-wild-type alleles increases significantly. In this study, by using a previously validated microfluidic-chip-based technology, EGFR-MASI occurred in 25/67 mutant cases (37%), being more frequently associated with EGFR exon 19 deletions (p=0.033). In a subset of 49 treated patients, we assessed whether MASI is a modifier of anti-EGFR treatment benefit. The difference in progression-free survival and overall survival between EGFR-MASI-positive and EGFR-MASI-negative groups of patients did not show a statistical significance. In conclusion, EGFR-MASI is a significant event in NSCLC, specifically associated with EGFR exon 19 deletions. However, EGFR-MASI does not seem to play a role in predicting the response to first-generation EGFR small molecules inhibitors. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

Four of the Most Common Mutations in Primary Hyperoxaluria Type 1 Unmask the Cryptic Mitochondrial Targeting Sequence of Alanine:glyoxylate Aminotransferase Encoded by the Polymorphic Minor Allele*

PubMed Central

Fargue, Sonia; Lewin, Jackie; Rumsby, Gill; Danpure, Christopher J.

2013-01-01

The gene encoding the liver-specific peroxisomal enzyme alanine:glyoxylate aminotransferase (AGT, EC. 2.6.1.44) exists as two common polymorphic variants termed the “major” and “minor” alleles. The P11L amino acid replacement encoded by the minor allele creates a hidden N-terminal mitochondrial targeting sequence, the unmasking of which occurs in the hereditary calcium oxalate kidney stone disease primary hyperoxaluria type 1 (PH1). This unmasking is due to the additional presence of a common disease-specific G170R mutation, which is encoded by about one third of PH1 alleles. The P11L and G170R replacements interact synergistically to reroute AGT to the mitochondria where it cannot fulfill its metabolic role (i.e. glyoxylate detoxification) effectively. In the present study, we have reinvestigated the consequences of the interaction between P11L and G170R in stably transformed CHO cells and have studied for the first time whether a similar synergism exists between P11L and three other mutations that segregate with the minor allele (i.e. I244T, F152I, and G41R). Our investigations show that the latter three mutants are all able to unmask the cryptic P11L-generated mitochondrial targeting sequence and, as a result, all are mistargeted to the mitochondria. However, whereas the G170R, I244T, and F152I mutants are able to form dimers and are catalytically active, the G41R mutant aggregates and is inactive. These studies open up the possibility that all PH1 mutations, which segregate with the minor allele, might also lead to the peroxisome-to-mitochondrion mistargeting of AGT, a suggestion that has important implications for the development of treatment strategies for PH1. PMID:23229545

Mutant Kras copy number defines metabolic reprogramming and therapeutic susceptibilities

PubMed Central

Kerr, Emma; Gaude, Edoardo; Turrell, Frances; Frezza, Christian; Martins, Carla P

2016-01-01

Summary The RAS/MAPK-signalling pathway is frequently deregulated in non-small cell lung cancer (NSCLC), often through KRAS activating mutations1-3. A single endogenous mutant Kras allele is sufficient to promote lung tumour formation in mice but malignant progression requires additional genetic alterations4-7. We recently showed that advanced lung tumours from KrasG12D/+;p53-null mice frequently exhibit KrasG12D allelic enrichment (KrasG12D/Kraswild-type>1)7, implying that mutant Kras copy gains are positively selected during progression. Through a comprehensive analysis of mutant Kras homozygous and heterozygous MEFs and lung cancer cells we now show that these genotypes are phenotypically distinct. In particular, KrasG12D/G12D cells exhibit a glycolytic switch coupled to increased channelling of glucose-derived metabolites into the TCA cycle and glutathione biosynthesis, resulting in enhanced glutathione-mediated detoxification. This metabolic rewiring is recapitulated in mutant KRAS homozygous NSCLC cells and in vivo, in spontaneous advanced murine lung tumours (which display a high frequency of KrasG12D copy gain), but not in the corresponding early tumours (KrasG12D heterozygous). Finally, we demonstrate that mutant Kras copy gain creates unique metabolic dependences that can be exploited to selectively target these aggressive mutant Kras tumours. Our data demonstrate that mutant Kras lung tumours are not a single disease but rather a heterogeneous group comprised of two classes of tumours with distinct metabolic profiles, prognosis and therapeutic susceptibility, which can be discriminated based on their relative mutant allelic content. We also provide the first in vivo evidence of metabolic rewiring during lung cancer malignant progression. PMID:26909577

Cilioretinal artery: Vasculogenesis might be promoted by plasminogen activator inhibitor-1 5G allele.

PubMed

Yilmaz, Sarenur; Ardagil, Aylin; Akalin, Ibrahim; Altinel, Meltem Guzin; Dag, Yasar; Kurum, Esra; Koyun, Efe; Ari Yaylali, Sevil; Bayramlar, Huseyin

2017-01-01

Cilioretinal arteries (CAs) represent enlargements of microscopic and early established collaterals formed via vasculogenesis between choroidal and retinal circulations. We aimed to investigate whether genetic tendency to thrombosis due to well-known gene polymorphisms may induce CA vasculogenesis in embryonic life. We assessed plasminogen activator inhibitor-1 (PAI-1) 4G/5G, methylenetetrahydrofolatereductase (MTHFR), FACTOR V LEIDEN and PROTHROMBIN gene polymorphisms on 130 patients [82/48 females/males; Median age: 57 (18-84) with visible CAs and 100 (64/36: female/male; Median age: 55 (19-90)] without visible CAs. Using multiple logistic regression models, we found PAI-1 4G/5G; MTHFR (C677T and A1298C) polymorphisms to have significant effects on the probability of visible CAs, that having at least one 5G allele would increase the odds of having visible cilioretinal artery by 98.4% [Odds ratio: 1984 (95% CI: 1.320-3.000, p = 0.001)], and having at least one MTHFR C677T or A1298C allele would decrease the odds of having visible CAs by approximately 38% (OR = 0.618, 95% CI: 0.394-0.961, p = 0.035) or 44% (OR = 0.558, 95% CI: 0.354-0.871, p = 0.011), respectively. This is the first study to test the existence of significant association between presence of enlarged and visible CAs and genetic factors predisposing to thrombosis, according to the literature. Here we suggest that not only the lack of genetic predisposition to thrombosis by MTHFR gene polymorphisms, but also the PAI-1 5G allele might promote vasculogenesis of CAs.

TPH2 -703G/T SNP may have important effect on susceptibility to suicidal behavior in major depression.

PubMed

Yoon, Ho-Kyoung; Kim, Yong-Ku

2009-04-30

Serotonergic system-related genes can be good candidate genes for both major depressive disorder (MDD) and suicidal behavior. In this study, we aimed to investigate the association of serotonin 2A receptor gene -1438A/G SNP (HTR2A -1438A/G), tryptophan hydroxylase 2 gene -703G/T SNP (TPH2 -703G/T) and serotonin 1A receptor C-1019G (HTR1A C-1019G) with suicidal behavior. One hundred and eighty one suicidal depressed patients and 143 non-suicidal depressed patients who met DSM-IV criteria for major depressive disorder were recruited from patients who were admitted to Korea University Ansan Hospital. One hundred seventy six normal controls were healthy volunteers who were recruited by local advertisement. Patients and normal controls were genotyped for HTR2A -1438A/G, TPH2 -703G/T and 5-HT1A C-1019G. The suicidal depressed patients were evaluated by the lethality of individual suicide attempts using Weisman and Worden's risk-rescue rating (RRR) and the Lethality Suicide Attempt Rating Scale-updated (LSARS-II). In order to assess the severity of depressive symptoms of patients, Hamilton's Depression Rating Scale (HDRS) was administered. Genotype and allele frequencies were compared between groups by chi(2) statistics. Association of genotype of the candidate genes with the lethality of suicidal behavior was examined with ANOVA by comparing the mean scores of LSARS and RRR according to the genotype. There were statistically significant differences in the genotype distributions and allele frequencies of TPH2 -703G/T between the suicidal depressive group and the normal control group. The homozygous allele G (G/G genotype) frequency was significantly higher in suicidal depressed patients than in controls. However, no differences in either genotype distribution or in allele frequencies of HTR2A -1438A/G and HTR1A C-1019G were observed between the suicidal depressed patients, the non-suicidal depressed patients, and the normal controls. There were no differences in the

Characterization of a New Pink-Fruited Tomato Mutant Results in the Identification of a Null Allele of the SlMYB12 Transcription Factor.

PubMed

Fernandez-Moreno, Josefina-Patricia; Tzfadia, Oren; Forment, Javier; Presa, Silvia; Rogachev, Ilana; Meir, Sagit; Orzaez, Diego; Aharoni, Aspah; Granell, Antonio

2016-07-01

The identification and characterization of new tomato (Solanum lycopersicum) mutants affected in fruit pigmentation and nutritional content can provide valuable insights into the underlying biology, as well as a source of new alleles for breeding programs. To date, all characterized pink-pigmented tomato fruit mutants appear to result from low SlMYB12 transcript levels in the fruit skin. Two new mutant lines displaying a pink fruit phenotype (pf1 and pf2) were characterized in this study. In the pf mutants, SlMYB12 transcripts accumulated to wild-type levels but exhibited the same truncation, which resulted in the absence of the essential MYB activation domain coding region. Allelism and complementation tests revealed that both pf mutants were allelic to the y locus and showed the same recessive null allele in homozygosis: Δy A set of molecular and metabolic effects, reminiscent of those observed in the Arabidopsis (Arabidopsis thaliana) myb11 myb12 myb111 triple mutant, were found in the tomato Δy mutants. To our knowledge, these have not been described previously, and our data support the idea of their being null mutants, in contrast to previously described transcriptional hypomorphic pink fruit lines. We detected a reduction in the expression of several flavonol glycosides and some associated glycosyl transferases. Transcriptome analysis further revealed that the effects of the pf mutations extended beyond the flavonoid pathway into the interface between primary and secondary metabolism. Finally, screening for Myb-binding sites in the candidate gene promoter sequences revealed that 141 of the 152 co-down-regulated genes may be direct targets of SlMYB12 regulation. © 2016 American Society of Plant Biologists. All Rights Reserved.

Primary and acquired EGFR T790M-mutant NSCLC patients identified by routine mutation testing show different characteristics but may both respond to osimertinib treatment.

PubMed

Li, Weihua; Qiu, Tian; Guo, Lei; Ling, Yun; Gao, Yibo; Ying, Jianming; He, Jie

2018-06-01

Primary EGFR T790M mutation is occasionally identified by routine mutation testing in tyrosine kinase inhibitor (TKI)-naive patients with non-small cell lung cancer (NSCLC). We herein aimed to compare the characteristics of primary and acquired T790M mutations in NSCLC patients, and their response to osimertinib. Using amplification refractory mutation system (ARMS) detection, primary T790M was identified in 0.5% (46/8723) of TKI-naive patients, whereas acquired T790M was detected in 49.7% (71/143) of TKI-relapsed patients. T790M always coexisted with a sensitizing EGFR mutation. Primary T790M more commonly coexisted with L858R, whereas acquired T790M was more likely to coexist with exon 19 deletions. Moreover, next-generation sequencing (NGS) showed that concomitant sensitizing EGFR and primary T790M mutant allele frequencies (MAFs) were highly concordant, but acquired T790M MAFs were significantly lower than the sensitizing EGFR MAFs. Sixteen acquired T790M-mutant patients received osimertinib. The median progression-free survival (PFS) was 8.1 months. Four primary T790M-mutant patients received osimertinib and the median PFS was 8.0 months. Together, our study demonstrates that primary and acquired T790M-mutant patients show distinct differences in some clinical and molecular characteristics, but may both respond to osimertinib treatment. Copyright © 2018 Elsevier B.V. All rights reserved.

Carriers of the Complex Allele HFE c.[187C>G;340+4T>C] Have Increased Risk of Iron Overload in São Miguel Island Population (Azores, Portugal).

PubMed

Branco, Claudia C; Gomes, Cidália T; De Fez, Laura; Bulhões, Sara; Brilhante, Maria José; Pereirinha, Tânia; Cabral, Rita; Rego, Ana Catarina; Fraga, Cristina; Miguel, António G; Brasil, Gracinda; Macedo, Paula; Mota-Vieira, Luisa

2015-01-01

Iron overload is associated with acquired and genetic conditions, the most common being hereditary hemochromatosis (HH) type-I, caused by HFE mutations. Here, we conducted a hospital-based case-control study of 41 patients from the São Miguel Island (Azores, Portugal), six belonging to a family with HH type-I pseudodominant inheritance, and 35 unrelated individuals fulfilling the biochemical criteria of iron overload compatible with HH type-I. For this purpose, we analyzed the most common HFE mutations- c.845G>A [p.Cys282Tyr], c.187C>G [p.His63Asp], and c.193A>T [p.Ser65Cys]. Results revealed that the family's HH pseudodominant pattern is due to consanguineous marriage of HFE-c.845G>A carriers, and to marriage with a genetically unrelated spouse that is a -c.187G carrier. Regarding unrelated patients, six were homozygous for c.845A, and three were c.845A/c.187G compound heterozygous. We then performed sequencing of HFE exons 2, 4, 5 and their intron-flanking regions. No other mutations were observed, but we identified the -c.340+4C [IVS2+4C] splice variant in 26 (74.3%) patients. Functionally, the c.340+4C may generate alternative splicing by HFE exon 2 skipping and consequently, a protein missing the α1-domain essential for HFE/ transferrin receptor-1 interactions. Finally, we investigated HFE mutations configuration with iron overload by determining haplotypes and genotypic profiles. Results evidenced that carriers of HFE-c.187G allele also carry -c.340+4C, suggesting in-cis configuration. This data is corroborated by the association analysis where carriers of the complex allele HFE-c.[187C>G;340+4T>C] have an increased iron overload risk (RR = 2.08, 95% CI = 1.40-2.94, p<0.001). Therefore, homozygous for this complex allele are at risk of having iron overload because they will produce two altered proteins--the p.63Asp [c.187G], and the protein lacking 88 amino acids encoded by exon 2. In summary, we provide evidence that the complex allele HFE-c.[187C>G;340+4T

Carriers of the Complex Allele HFE c.[187C>G;340+4T>C] Have Increased Risk of Iron Overload in São Miguel Island Population (Azores, Portugal)

PubMed Central

Bulhões, Sara; Brilhante, Maria José; Pereirinha, Tânia; Cabral, Rita; Rego, Ana Catarina; Fraga, Cristina; Miguel, António G.; Brasil, Gracinda; Macedo, Paula; Mota-Vieira, Luisa

2015-01-01

Iron overload is associated with acquired and genetic conditions, the most common being hereditary hemochromatosis (HH) type-I, caused by HFE mutations. Here, we conducted a hospital-based case-control study of 41 patients from the São Miguel Island (Azores, Portugal), six belonging to a family with HH type-I pseudodominant inheritance, and 35 unrelated individuals fulfilling the biochemical criteria of iron overload compatible with HH type-I. For this purpose, we analyzed the most common HFE mutations– c.845G>A [p.Cys282Tyr], c.187C>G [p.His63Asp], and c.193A>T [p.Ser65Cys]. Results revealed that the family’s HH pseudodominant pattern is due to consanguineous marriage of HFE-c.845G>A carriers, and to marriage with a genetically unrelated spouse that is a -c.187G carrier. Regarding unrelated patients, six were homozygous for c.845A, and three were c.845A/c.187G compound heterozygous. We then performed sequencing of HFE exons 2, 4, 5 and their intron-flanking regions. No other mutations were observed, but we identified the -c.340+4C [IVS2+4C] splice variant in 26 (74.3%) patients. Functionally, the c.340+4C may generate alternative splicing by HFE exon 2 skipping and consequently, a protein missing the α1-domain essential for HFE/ transferrin receptor-1 interactions. Finally, we investigated HFE mutations configuration with iron overload by determining haplotypes and genotypic profiles. Results evidenced that carriers of HFE-c.187G allele also carry -c.340+4C, suggesting in-cis configuration. This data is corroborated by the association analysis where carriers of the complex allele HFE-c.[187C>G;340+4T>C] have an increased iron overload risk (RR = 2.08, 95% CI = 1.40−2.94, p<0.001). Therefore, homozygous for this complex allele are at risk of having iron overload because they will produce two altered proteins—the p.63Asp [c.187G], and the protein lacking 88 amino acids encoded by exon 2. In summary, we provide evidence that the complex allele HFE-c.[187C>G

Prolactin rs1341239 T allele may have protective role against the brick tea type skeletal fluorosis.

PubMed

Li, Bing-Yun; Yang, Yan-Mei; Liu, Yang; Sun, Jing; Ye, Yan; Liu, Xiao-Na; Liu, Hong-Xu; Sun, Zhen-Qi; Li, Mang; Cui, Jing; Sun, Dian-Jun; Gao, Yan-Hui

2017-01-01

Prolactin (PRL) has been reported to be associated with increased bone turnover, and increased bone turnover is also a feature of skeletal fluorosis (SF). Autocrine/paracrine production of PRL is regulated by the extrapituitary promoter and a polymorphism in the extrapituitary PRL promoter at -1149 (rs1341239) is associated with disturbances of bone metabolism in other diseases. Here, we have investigated the possibility that the rs1341239 polymorphism is associated with SF, which results from the consumption of brick tea. We conducted a cross-sectional study in Sinkiang, Qinghai, Inner Mongolia in China. Demography survey questionnaires were completed and physical examination and X-ray diagnoses were used to diagnose SF. Brick tea water fluoride intake (IF) and urinary fluoride (UF) were tested by an F-ion selective electrode method. A Sequenom MassARRAY system was used to determine PRL gene polymorphisms. Subjects who were younger than 45 years of age and carried the T allele had a significantly decreased risk of SF [OR = 0.279 (95%CI, 0.094-0.824)] compared to those carrying the homozygous G allele. This phenomenon was only observed in Kazakh subjects [OR = 0.127 (95%CI, 0.025-0.646)]. Kazakh females who carried T alleles has a decreased risk of SF [OR = 0.410 (95%CI, 0.199-0.847)]. For Kazakh subjects which IF is less than 3.5 mg/d, a decreased risk of SF was observed among the participants who carried T alleles [OR = 0.118 (95%CI, 0.029-0.472)]. Overall, subjects with 1.6-3.2 mg/L UF and carried T alleles had a significantly decreased risk of SF [OR = 0.476 (95%CI, 0.237-0.955)] compared to homozygous G allele carriers. This phenomenon was only observed in Kazakh subjects [OR = 0.324 (95%CI, 0.114-0.923)]. Our results suggested that the PRL rs1341239 T allele decreases the risk of brick tea SF.

Prolactin rs1341239 T allele may have protective role against the brick tea type skeletal fluorosis

PubMed Central

Li, Bing-Yun; Yang, Yan-Mei; Liu, Yang; Sun, Jing; Ye, Yan; Liu, Xiao-Na; Liu, Hong-Xu; Sun, Zhen-Qi; Li, Mang; Cui, Jing; Sun, Dian-Jun; Gao, Yan-Hui

2017-01-01

Objective Prolactin (PRL) has been reported to be associated with increased bone turnover, and increased bone turnover is also a feature of skeletal fluorosis (SF). Autocrine/paracrine production of PRL is regulated by the extrapituitary promoter and a polymorphism in the extrapituitary PRL promoter at -1149 (rs1341239) is associated with disturbances of bone metabolism in other diseases. Here, we have investigated the possibility that the rs1341239 polymorphism is associated with SF, which results from the consumption of brick tea. Design We conducted a cross-sectional study in Sinkiang, Qinghai, Inner Mongolia in China. Demography survey questionnaires were completed and physical examination and X-ray diagnoses were used to diagnose SF. Brick tea water fluoride intake (IF) and urinary fluoride (UF) were tested by an F-ion selective electrode method. A Sequenom MassARRAY system was used to determine PRL gene polymorphisms. Results Subjects who were younger than 45 years of age and carried the T allele had a significantly decreased risk of SF [OR = 0.279 (95%CI, 0.094–0.824)] compared to those carrying the homozygous G allele. This phenomenon was only observed in Kazakh subjects [OR = 0.127 (95%CI, 0.025–0.646)]. Kazakh females who carried T alleles has a decreased risk of SF [OR = 0.410 (95%CI, 0.199–0.847)]. For Kazakh subjects which IF is less than 3.5 mg/d, a decreased risk of SF was observed among the participants who carried T alleles [OR = 0.118 (95%CI, 0.029–0.472)]. Overall, subjects with 1.6–3.2 mg/L UF and carried T alleles had a significantly decreased risk of SF [OR = 0.476 (95%CI, 0.237–0.955)] compared to homozygous G allele carriers. This phenomenon was only observed in Kazakh subjects [OR = 0.324 (95%CI, 0.114–0.923)]. Conclusions Our results suggested that the PRL rs1341239 T allele decreases the risk of brick tea SF. PMID:28152004

An Allele of Sequoia Dominantly Enhances a Trio Mutant Phenotype to Influence Drosophila Larval Behavior

PubMed Central

Liebl, Eric C.

2013-01-01

The transition of Drosophila third instar larvae from feeding, photo-phobic foragers to non-feeding, photo-neutral wanderers is a classic behavioral switch that precedes pupariation. The neuronal network responsible for this behavior has recently begun to be defined. Previous genetic analyses have identified signaling components for food and light sensory inputs and neuropeptide hormonal outputs as being critical for the forager to wanderer transition. Trio is a Rho-Guanine Nucleotide Exchange Factor integrated into a variety of signaling networks including those governing axon pathfinding in early development. Sequoia is a pan-neuronally expressed zinc-finger transcription factor that governs dendrite and axon outgrowth. Using pre-pupal lethality as an endpoint, we have screened for dominant second-site enhancers of a weakly lethal trio mutant background. In these screens, an allele of sequoia has been identified. While these mutants have no obvious disruption of embryonic central nervous system architecture and survive to third instar larvae similar to controls, they retain forager behavior and thus fail to pupariate at high frequency. PMID:24376789

An allele of sequoia dominantly enhances a trio mutant phenotype to influence Drosophila larval behavior.

PubMed

Dean, Kathryn E; Fields, April; Geer, Marcus J; King, Eric C; Lynch, Brian T; Manohar, Rohan R; McCall, Julianne R; Palozola, Katherine C; Zhang, Yan; Liebl, Eric C

2013-01-01

The transition of Drosophila third instar larvae from feeding, photo-phobic foragers to non-feeding, photo-neutral wanderers is a classic behavioral switch that precedes pupariation. The neuronal network responsible for this behavior has recently begun to be defined. Previous genetic analyses have identified signaling components for food and light sensory inputs and neuropeptide hormonal outputs as being critical for the forager to wanderer transition. Trio is a Rho-Guanine Nucleotide Exchange Factor integrated into a variety of signaling networks including those governing axon pathfinding in early development. Sequoia is a pan-neuronally expressed zinc-finger transcription factor that governs dendrite and axon outgrowth. Using pre-pupal lethality as an endpoint, we have screened for dominant second-site enhancers of a weakly lethal trio mutant background. In these screens, an allele of sequoia has been identified. While these mutants have no obvious disruption of embryonic central nervous system architecture and survive to third instar larvae similar to controls, they retain forager behavior and thus fail to pupariate at high frequency.

'Overgrowth' mutants in barley and wheat: new alleles and phenotypes of the 'Green Revolution' DELLA gene.

PubMed

Chandler, Peter Michael; Harding, Carol Anne

2013-04-01

A suppressor screen using dwarf mutants of barley (Hordeum vulgare L.) led to the isolation of 'overgrowth' derivatives, which retained the original dwarfing gene but grew at a faster rate because of a new mutation. The new mutations were in the Slender1 (Sln1) gene (11/13 cases), which encodes the DELLA protein central to gibberellin (GA) signalling, showed 100% genetic linkage to Sln1 (1/13), or were in the Spindly1 (Spy1) gene (1/13), which encodes another protein involved in GA signalling. The overgrowth mutants were characterized by increased GA signalling, although the extent still depended on the background GA biosynthesis capacity, GA receptor function, and DELLA activity. A comparison between two GA responses, α-amylase production and leaf growth rate, revealed degrees of specificity for both the overgrowth allele and the GA response under consideration. Many overgrowth mutants were also isolated in a dwarf line of bread wheat (Triticum aestivum L.) and 19 new alleles were identified in the Rht-B1 gene, one of the 'Green Revolution' semi-dwarfing genes and the orthologue of Sln1. The sites of amino acid substitutions in the DELLA proteins of both species provide insight into DELLA function, and included examples where identical but independent substitutions were observed. In both species, the starting lines were too dwarfed to be directly useful in breeding programmes, but new overgrowth derivatives with semidwarf heights have now been characterized. The variation they exhibit in GA-influenced traits identifies novel alleles with perfect markers that are of potential use in breeding.

Marked decrease in specific activity contributes to disease phenotype in two human glucose 6-phosphate dehydrogenase mutants, G6PD(Union) and G6PD(Andalus).

PubMed

Wang, Xiao-Tao; Lam, Veronica M S; Engel, Paul C

2005-09-01

Clones overexpressing clinical glucose 6-phosphate dehydrogenase (G6PD) mutants Union (c.1360C>T/p.Arg454Cys) and Andalus (c.1361G>A/p.Arg454His), have been constructed. These abolish a salt bridge between Arg454 and Asp 286. One mutant is reportedly a Class II clinical variant and the other a Class I. Kinetic studies of the purified proteins reveal that, for both mutants, kcat is about 10-fold decreased, thus giving a 90% decrease in the WHO assay, and also presumably under physiological conditions. In contrast with unfavourable changes in Vmax for both mutants, Km values for both G6P and NADP+ are decreased approximately 5-fold. Measurements with alternative substrates confirm that G6PD Union, like the wild-type enzyme, follows a rapid-equilibrium random-order mechanism, allowing calculation of enzyme-substrate dissociation constants from initial-rate parameters. The mutations result in several-fold tighter binding of glucose 6-phosphate to the free enzyme. Binding, however, is clearly less productive than with normal enzyme. G6PD mutations are thought to cause haemolytic anaemia by compromising enzyme stability. Both these mutants indeed show somewhat decreased thermostability. However, at 37 degrees C and with NADP+, the stability differences are only moderate. Decreased catalytic efficiency clearly contributes to the disease phenotype of these two mutants, entirely accounting for reported decrease in leukocyte G6PD levels, though not for still lower levels in erythrocytes. Neither the kinetic nor the stability effects appear to justify the different clinical classification of these mutations.

Allelic variation in TLR4 is linked to resistance to Salmonella Enteritidis infection in chickens.

PubMed

Li, Peng; Wang, Huihua; Zhao, Xingwang; Gou, Zhongyong; Liu, Ranran; Song, Yongmei; Li, Qinghe; Zheng, Maiqing; Cui, Huanxian; Everaert, Nadia; Zhao, Guiping; Wen, Jie

2017-07-01

Salmonella Enteritidis (SE) is a foodborne pathogen that negatively affects both animal and human health. Polymorphisms of the TLR4 gene may affect recognition by Toll-like receptor 4 (TLR4) of bacterial lipopolysaccharide (LPS), leading to differences in host resistance to pathogenic infections. The present study has investigated polymorphic loci of chicken TLR4 (ChTLR4) in ten chicken breeds, electrostatic potentials of mutant structures of TLR4, and a linkage analysis between allelic variation and survival ratio to infection with SE in specific-pathogen-free (SPF) White Leghorns. A total of 19 Single Nucleotide Polymorphisms (SNPs), of which 10 were novel, were found in chicken breeds. Seven newly identified amino acid variants (C68G, G674A, G782A, A896T, T959G, T986A, and A1104C) and previously reported important mutations (G247A, G1028A, C1147T, and A1832G) were demonstrated in the extracellular domain of the ChTLR4 gene. Significant changes in surface electrostatic potential of the ectodomain of TLR4, built by homology modeling, were observed at the Glu83Lys (G247A), Arg298Ser (A896T), Ser368Arg (A1104C), and Gln611Arg (A1832G) substitutions. Linkage analysis showed that one polymorphic locus G247A of TLR4 gene, common in all breeds examined, was significantly associated with increased resistance to SE in SPF White Leghorns chicks (log-rank P-value = 0.04). The genotypes from A1832G SNPs did not show statistically significant survival differences. This study has provided the first direct evidence that G247A substitution in ChTLR4 is associated with increased resistance to Salmonella Enteritidis. © 2017 Poultry Science Association Inc.

Analyses of tomato fruit brightness mutants uncover both cutin-deficient and cutin-abundant mutants and a new hypomorphic allele of GDSL lipase.

PubMed

Petit, Johann; Bres, Cécile; Just, Daniel; Garcia, Virginie; Mauxion, Jean-Philippe; Marion, Didier; Bakan, Bénédicte; Joubès, Jérôme; Domergue, Frédéric; Rothan, Christophe

2014-02-01

The cuticle is a protective layer synthesized by epidermal cells of the plants and consisting of cutin covered and filled by waxes. In tomato (Solanum lycopersicum) fruit, the thick cuticle embedding epidermal cells has crucial roles in the control of pathogens, water loss, cracking, postharvest shelf-life, and brightness. To identify tomato mutants with modified cuticle composition and architecture and to further decipher the relationships between fruit brightness and cuticle in tomato, we screened an ethyl methanesulfonate mutant collection in the miniature tomato cultivar Micro-Tom for mutants with altered fruit brightness. Our screen resulted in the isolation of 16 glossy and 8 dull mutants displaying changes in the amount and/or composition of wax and cutin, cuticle thickness, and surface aspect of the fruit as characterized by optical and environmental scanning electron microscopy. The main conclusions on the relationships between fruit brightness and cuticle features were as follows: (1) screening for fruit brightness is an effective way to identify tomato cuticle mutants; (2) fruit brightness is independent from wax load variations; (3) glossy mutants show either reduced or increased cutin load; and (4) dull mutants display alterations in epidermal cell number and shape. Cuticle composition analyses further allowed the identification of groups of mutants displaying remarkable cuticle changes, such as mutants with increased dicarboxylic acids in cutin. Using genetic mapping of a strong cutin-deficient mutation, we discovered a novel hypomorphic allele of GDSL lipase carrying a splice junction mutation, thus highlighting the potential of tomato brightness mutants for advancing our understanding of cuticle formation in plants.

Persistent HPV16/18 infection in Indian women with the A-allele (rs6457617) of HLA-DQB1 and T-allele (rs16944) of IL-1β -511 is associated with development of cervical carcinoma.

PubMed

Dutta, Sankhadeep; Chakraborty, Chandraditya; Mandal, Ranajit Kumar; Basu, Partha; Biswas, Jaydip; Roychoudhury, Susanta; Panda, Chinmay Kumar

2015-07-01

The aim of this study was to understand the association of human papillomavirus (HPV) type 16/18 infection and polymorphisms in the HLA-DQB1 (rs6457617) and IL-1β -511 (rs16944) loci with the development of uterine cervical cancer (CaCx). The distribution of HLA-DQB1 G > A and IL-1β -511 C/T polymorphisms was determined in HPV-negative cervical swabs from normal women (N = 111) and compared with cervical swabs of HPV-cleared normal women (once HPV infected followed by natural clearance of the infection, N = 86), HPV16/18-positive cervical intraepithelial neoplasia (CIN, N = 41) and CaCx biopsies (N = 107). The A-allele containing genotypes (i.e. G/A and A/A) of HLA-DQB1 was significantly associated with CaCx compared with HPV-negative [OR = 2.56(1.42-4.62), p = 0.001] or HPV-cleared [OR = 2.07(1.12-3.87), p = 0.01] normal women, whereas the T-allele containing genotypes (i.e. C/T and T/T) of IL-1β showed increased risk of CIN [OR = 3.68(0.97-16.35), p = 0.03; OR = 3.59(0.92-16.38), p = 0.03] and CaCx development [OR = 2.03(1.03-5.2), p = 0.02; OR = 2.25(0.96-5.31), p = 0.04] compared with HPV-negative or HPV-cleared normal women. Considering these two loci together, it was evident that the T- and A-alleles rendered significantly increased susceptibility for development of CIN and CaCx compared with HPV-negative and HPV-cleared normal women. Moreover, the T-allele of IL-1β showed increased susceptibility for CIN [OR = 3.62(0.85-17.95), p = 0.04] and CaCx [OR = 2.39(0.91-6.37), p = 0.05] development compared with the HPV-cleared women, even in the presence of the HLA-DQB1 G-allele. Thus, our data suggest that persistent HPV16/18 infection in the cervix due to the presence of the HLA-DQB1 A-allele and chronic inflammation due to the presence of the IL-1β -511 T-allele might predispose women to CaCx development.

In vivo levels of S-adenosylmethionine modulate C:G to T:A mutations associated with repeat-induced point mutation in Neurospora crassa.

PubMed

Rosa, Alberto Luis; Folco, Hernán Diego; Mautino, Mario Ricardo

2004-04-14

In Neurospora crassa, the mutagenic process termed repeat-induced point mutation (RIP) inactivates duplicated DNA sequences during the sexual cycle by the introduction of C:G to T:A transition mutations. In this work, we have used a collection of N. crassa strains exhibiting a wide range of cellular levels of S-adenosylmethionine (AdoMet), the universal donor of methyl groups, to explore whether frequencies of RIP are dependent on the cellular levels of this metabolite. Mutant strains met-7 and eth-1 carry mutations in genes of the AdoMet pathway and have low levels of AdoMet. Wild type strains with high levels of AdoMet were constructed by introducing a chimeric transgene of the AdoMet synthetase (AdoMet-S) gene fused to the constitutive promoter trpC from Aspergillus nidulans. Crosses of these strains against tester duplications of the pan-2 and am genes showed that frequencies of RIP, as well as the total number of C:G to T:A transition mutations found in randomly selected am(RIP) alleles, are inversely correlated to the cellular level of AdoMet. These results indicate that AdoMet modulates the biochemical pathway leading to RIP.

The MAOA T941G polymorphism and short-term treatment response to mirtazapine and paroxetine in major depression.

PubMed

Tadić, André; Müller, Matthias J; Rujescu, Dan; Kohnen, Ralf; Stassen, Hans H; Dahmen, Norbert; Szegedi, Armin

2007-04-05

This study investigated the possible association of the MAOA T941G gene variant with differential antidepressant response to mirtazapine and/or paroxetine in 102 patients with major depression (DSM-IV criteria) participating in a randomized double-blind controlled clinical trial. Female mirtazapine-treated patients homozygous for the T-allele had a significantly faster and better treatment response than TG/GG-patients. In males, we failed to show an association between MAOA T941G gene variant and mirtazapine response. In the paroxetine-treated group, there were no significant differences in treatment response between MAOA T941G genotype groups. Time course of response and antidepressant efficacy of mirtazapine, but not paroxetine, seem to be influenced in a clinically relevant manner by this allelic variation within the MAOA gene, at least in female patients. An independent replication of our finding is needed. If replicated, genotyping of this locus could become a promising tool to predict response to mirtazapine treatment in females suffering from major depression. (c) 2006 Wiley-Liss, Inc.

Plasminogen Activator Inhibitor-1 (PAI-1) gene 4G/5G alleles frequency distribution in the Lebanese population.

PubMed

Shammaa, Dina M R; Sabbagh, Amira S; Taher, Ali T; Zaatari, Ghazi S; Mahfouz, Rami A R

2008-09-01

Plasminogen activator inhibitor-1 (PAI-1) is an inhibitor of fibrinolysis. Increased plasma PAI-1 levels play an essential role in the pathogenesis of cardiovascular risk and other diseases associated with thrombosis. The 4G/5G polymorphism of the PAI-1 promoter region has been extensively studied in different populations. We studied 160 healthy unrelated Lebanese individuals using a reverse hybridization PCR assay to detect the 5G/5G, 4G/5G and, 4G/4G genotypes of the PAI-1 gene and the frequencies of the 4G and 5G alleles. We found that 4G/5G genotype was the most prevalent (45.6%) followed by 5G/5G (36.9%) and 4G/4G (17.5%). The frequencies of the 4G and 5G alleles were calculated to be 0.403 and 0.597, respectively. Compared to other ethnic communities, the Lebanese population was found to harbour a relatively high prevalence of the rare 4G allele. This, in turn, may predispose this population to develop cardiovascular diseases and other thrombotic clinical conditions. This study aids to enhance our understanding of the genetic features of the Lebanese population.

Associations of the eNOS G894T gene polymorphism with target organ damage in children with newly diagnosed primary hypertension.

PubMed

Śladowska-Kozłowska, Joanna; Litwin, Mieczysław; Niemirska, Anna; Wierzbicka, Aldona; Roszczynko, Marta; Szperl, Małgorzata

2015-12-01

The endothelial nitric oxide synthase (eNOS) G894T gene polymorphism is associated with the risk of primary hypertension (PH) and vascular complications in adults with PH. We explored the associations of the G894T polymorphism with 24-h ambulatory blood pressure, left ventricular mass (LVM), carotid intima media thickness (cIMT), urinary albumin excretion, oxidative stress and inflammatory parameters in 126 children with newly diagnosed PH and in 83 healthy children. Among the 126 children with PH 92 (73%) had ambulatory hypertension and 34 (27%) had severe ambulatory hypertension. Left ventricular hypertrophy (LVH) was detected in 39 (31%) patients, cIMT of >2 standard deviation scores in 21 (16.6%) patients, albuminuria of >30 mg/24 h in 18 (14.3%) patients and metabolic syndrome (MS) in 22 (17.5%) patients. The frequency of the T allele was 52.4% in the PH group and 54.2% in the control group (not significant), and in both groups the frequency of the T allele was consistent with the Hardy-Weinberg equilibrium. Compared with G allele carriers, hypertensive T allele carriers had increased cIMT (p < 0.05) and more severe albuminuria (not significant, p = 0.1); there was no difference between the groups in hypertension severity and LVM. T and G allele distribution did not differ between patients with and without metabolic syndrome. No significant correlations between the assessed parameters and the eNOS G894T gene polymorphism were found in the controls, although T allele carriers tended to have an increased cIMT (p = 0.09). The eNOS T allele is not more prevalent among hypertensive children than among healthy ones, but it is associated with early vascular damage in children with PH, independent of metabolic abnormalities. No associations between the eNOS G894T polymorphism and metabolic abnormalities were found.

Intrinsic MYH7 expression regulation contributes to tissue level allelic imbalance in hypertrophic cardiomyopathy.

PubMed

Montag, Judith; Syring, Mandy; Rose, Julia; Weber, Anna-Lena; Ernstberger, Pia; Mayer, Anne-Kathrin; Becker, Edgar; Keyser, Britta; Dos Remedios, Cristobal; Perrot, Andreas; van der Velden, Jolanda; Francino, Antonio; Navarro-Lopez, Francesco; Ho, Carolyn Yung; Brenner, Bernhard; Kraft, Theresia

2017-08-01

HCM, the most common inherited cardiac disease, is mainly caused by mutations in sarcomeric genes. More than a third of the patients are heterozygous for mutations in the MYH7 gene encoding for the β-myosin heavy chain. In HCM-patients, expression of the mutant and the wildtype allele can be unequal, thus leading to fractions of mutant and wildtype mRNA and protein which deviate from 1:1. This so-called allelic imbalance was detected in whole tissue samples but also in individual cells. There is evidence that the severity of HCM not only depends on the functional effect of the mutation itself, but also on the fraction of mutant protein in the myocardial tissue. Allelic imbalance has been shown to occur in a broad range of genes. Therefore, we aimed to examine whether the MYH7-alleles are intrinsically expressed imbalanced or whether the allelic imbalance is solely associated with the disease. We compared the expression of MYH7-alleles in non-HCM donors and in HCM-patients with different MYH7-missense mutations. In the HCM-patients, we identified imbalanced as well as equal expression of both alleles. Also at the protein level, allelic imbalance was determined. Most interestingly, we also discovered allelic imbalance and balance in non-HCM donors. Our findings therefore strongly indicate that apart from mutation-specific mechanisms, also non-HCM associated allelic-mRNA expression regulation may account for the allelic imbalance of the MYH7 gene in HCM-patients. Since the relative amount of mutant mRNA and protein or the extent of allelic imbalance has been associated with the severity of HCM, individual analysis of the MYH7-allelic expression may provide valuable information for the prognosis of each patient.

A novel p53 mutational hotspot in skin tumors from UV-irradiated Xpc mutant mice alters transactivation functions.

PubMed

Inga, Alberto; Nahari, Dorit; Velasco-Miguel, Susana; Friedberg, Errol C; Resnick, Michael A

2002-08-22

A mutation in codon 122 of the mouse p53 gene resulting in a T to L amino acid substitution (T122-->L) is frequently associated with skin cancer in UV-irradiated mice that are both homozygous mutant for the nucleotide excision repair (NER) gene Xpc (Xpc(-/-)) and hemizygous mutant for the p53 gene. We investigated the functional consequences of the mouse T122-->L mutation when expressed either in mammalian cells or in the yeast Saccharomyces cerevisiae. Similar to a non-functional allele, high expression of the T122-->L allele in p53(-/-) mouse embryo fibroblasts and human Saos-2 cells failed to suppress growth. However, the T122-->L mutant p53 showed wild-type transactivation levels with Bax and MDM2 promoters when expressed in either cell type and retained transactivation of the p21 and the c-Fos promoters in one cell line. Using a recently developed rheostatable p53 induction system in yeast we assessed the T122-->L transactivation capacity at low levels of protein expression using 12 different p53 response elements (REs). Compared to wild-type p53 the T122-->L protein manifested an unusual transactivation pattern comprising reduced and enhanced activity with specific REs. The high incidence of the T122-->L mutant allele in the Xpc(-/-) background suggests that both genetic and epigenetic conditions may facilitate the emergence of particular functional p53 mutations. Furthermore, the approach that we have taken also provides for the dissection of functions that may be retained in many p53 tumor alleles.

Hemolysis and Mediterranean G6PD mutation (c.563 C>T) and c.1311 C>T polymorphism among Palestinians at Gaza Strip.

PubMed

Sirdah, Mahmoud; Reading, N Scott; Perkins, Sherrie L; Shubair, Mohammad; Aboud, Lina; Prchal, Josef T

2012-04-15

The G6PD c.563 C>T deficient mutation is endemic among Mediterranean populations but its clinical significance is not well delineated. We set up to estimate the proportion of G6PD deficient children presenting with hemolytic anemia at Al Nasser Pediatric Hospital at Gaza Strip, Palestine. We then established the prevalence of c.563T Mediterranean mutation and its linkage to c.1311 C>T polymorphism in this population. G6PD deficiency was identified in children presenting with hemolytic anemia at Al Nasser Pediatric Hospital by spectrophotometric measurement of G6PD activity. G6PD exon 6 and exon 11 were amplified from genomic DNA and evaluated for c.563T mutation by sequencing and the c.1311T polymorphism by restriction fragment analysis. Seventy X-chromosomes (60 males and 5 females) from G6PD deficient patients and 40 X-chromosomes from a control group known to be not G6PD deficient were tested. Over 80% of these children presenting with hemolytic anemia were G6PD deficient and 34% of these had the Mediterranean G6PD deficient variant. The allelic frequencies of Mediterranean c.563T and c.1311T polymorphisms among G6PD deficient patients were 0.33 and 0.38 respectively. The c.1311T polymorphism was linked in 95.2% of patients with the Mediterranean mutation, an allele frequency of 0.87, compared to the control non-G6PD deficient group with an allele frequency of 0.18. We conclude that G6PD deficiency accounts for majority of hemolytic anemia encountered in Gaza children treated at Al Nasser Pediatric Hospital Emergency department. The Mediterranean mutation c.563T, while not accounting for a majority of G6PD deficiency, is common among G6PD deficient Gaza Strip Palestinians and is frequently, but not always, linked to the c.1311T polymorphism. This work provides a foundation for the population screening of Palestinians for G6PD deficiency and for investigations of ancestral origin of the Mediterranean variant in world populations. Copyright © 2012 Elsevier Inc

TPH2 G/T polymorphism is associated with hyperphagia, IQ, and internalizing problems in Prader-Willi syndrome

PubMed Central

Dykens, Elisabeth M.; Roof, Elizabeth; Bittel, Douglas; Butler, Merlin G.

2010-01-01

Background Prader-Willi syndrome (PWS) is a genetic, neurodevelopmental disorder characterized by intellectual disabilities, growth hormone dysregulation, hyperphagia, increased risks of morbid obesity, compulsive behaviors, and irritability. As aberrant serotonergic functioning is strongly implicated in PWS, we examined associations between the PWS phenotype and polymorphisms in tryptophan hydroxylase 2 (TPH2), the rate-limiting enzyme in the biosynthesis of serotonin in the brain. Methods 92 individuals with PWS aged 4 to 50 years (M = 21.97) were genotyped for the TPH2 G703-T polymorphism. IQ testing was conducted in offspring, and parents completed questionnaires that tapped their child’s compulsivity, hyperphagia, and other behavior problems. Results As expected, the frequency of G/T or T/T polymorphisms in participants with PWS (39%) was similar to rates found in the general population (38%). Compared to those with a homozygous (G/G) genotype, individuals with a T allele had significantly higher hyperphagic behavior, drive, and severity scores, and they also had a younger age of onset of hyperphagia. Those with a T allele also had higher IQ scores than their counterparts. Females with a T allele had significantly higher internalizing symptoms, primarily anxiety and depression, than all others. Conclusions TPH2 G/T polymorphisms, and presumed loss of enzyme function, were associated with specific aspects of the PWS phenotype. Aberrant serotonergic functioning is strongly implicated in hyperphagia in PWS, and females with TPH2 T alleles may be at higher risk for affective or mood disorders. Findings hold promise for examining other serotonin-altering genes in PWS, and for future serotonin-altering treatment trials. PMID:21418060

TPH2 G/T polymorphism is associated with hyperphagia, IQ, and internalizing problems in Prader-Willi syndrome.

PubMed

Dykens, Elisabeth M; Roof, Elizabeth; Bittel, Douglas; Butler, Merlin G

2011-05-01

Prader-Willi syndrome (PWS) is a genetic, neurodevelopmental disorder characterized by intellectual disabilities, growth hormone dysregulation, hyperphagia, increased risks of morbid obesity, compulsive behaviors, and irritability. As aberrant serotonergic functioning is strongly implicated in PWS, we examined associations between the PWS phenotype and polymorphisms in tryptophan hydroxylase 2 (TPH2), the rate-limiting enzyme in the biosynthesis of serotonin in the brain. Ninety-two individuals with PWS aged 4 to 50 years (M = 21.97) were genotyped for the TPH2 G703-T polymorphism. IQ testing was conducted in offspring, and parents completed questionnaires that tapped their child's compulsivity, hyperphagia, and other behavior problems. As expected, the frequency of G/T or T/T polymorphisms in participants with PWS (39%) was similar to rates found in the general population (38%). Compared to those with a homozygous (G/G) genotype, individuals with a T allele had significantly higher hyperphagic behavior, drive, and severity scores, and they also had a younger age of onset of hyperphagia. Those with a T allele also had higher IQ scores than their counterparts. Females with a T allele had significantly higher internalizing symptoms, primarily anxiety and depression, than all others. TPH2 G/T polymorphisms, and presumed loss of enzyme function, were associated with specific aspects of the PWS phenotype. Aberrant serotonergic functioning is strongly implicated in hyperphagia in PWS, and females with TPH2 T alleles may be at higher risk for affective or mood disorders. Findings hold promise for examining other serotonin-altering genes in PWS, and for future serotonin-altering treatment trials. © 2011 The Authors. Journal of Child Psychology and Psychiatry © 2011 Association for Child and Adolescent Mental Health.

Clausa, a Tomato Mutant with a Wide Range of Phenotypic Perturbations, Displays a Cell Type-Dependent Expression of the Homeobox Gene LeT6/TKn21

PubMed Central

Avivi, Yigal; Lev-Yadun, Simcha; Morozova, Nadya; Libs, Laurence; Williams, Leor; Zhao, Jing; Varghese, George; Grafi, Gideon

2000-01-01

Class I knox genes play an important role in shoot meristem function and are thus involved in the ordered development of stems, leaves, and reproductive organs. To elucidate the mechanism underlying the expression pattern of these homeobox genes, we studied a spontaneous tomato (Lycopersicon esculentum) mutant that phenotypically resembles, though is more extreme than, transgenic plants misexpressing class I knox genes. This mutant was found to carry a recessive allele, denoted clausa:shootyleaf (clau:shl)—a newly identified allele of clausa. Mutant plants exhibited abnormal leaf and flower morphology, epiphyllus inflorescences, fusion of organs, calyx asymmetry, and navel-like fruits. Analysis by scanning electron microscopy revealed that such fruits carried ectopic ovules, various vegetative primordia, as well as “forests” of stalked glandular trichomes. In situ RNA hybridization showed a peculiar expression pattern of the class I knox gene LeT6/TKn2; expression was restricted to the vascular system and palisade layer of mature leaves and to the inner part of ovules integuments. We conclude that CLAUSA regulates various aspects of tomato plant development, at least partly, by rendering the LeT6/TKn2 gene silent in specific tissues during development. Considering the expression pattern of LeT6/TKn2 in the clausa mutant, we suggest that the control over a given homeobox gene is maintained by several different regulatory mechanisms, in a cell type-dependent manner. PMID:11027705

Tumor Necrosis Factor (TNF) –308G>A, Nitric Oxide Synthase 3 (NOS3) +894G>T Polymorphisms and Migraine Risk: A Meta-Analysis

PubMed Central

Chen, Min; Tang, Wenjing; Hou, Lei; Liu, Ruozhuo; Dong, Zhao; Han, Xun; Zhang, Xiaofei; Wan, Dongjun; Yu, Shengyuan

2015-01-01

Background and Objective Conflicting data have been reported on the association between tumor necrosis factor (TNF) –308G>A and nitric oxide synthase 3 (NOS3) +894G>T polymorphisms and migraine. We performed a meta-analysis of case-control studies to evaluate whether the TNF –308G>A and NOS3 +894G>T polymorphisms confer genetic susceptibility to migraine. Method We performed an updated meta-analysis for TNF –308G>A and a meta-analysis for NOS3 +894G>T based on studies published up to July 2014. We calculated study specific odds ratios (OR) and 95% confidence intervals (95% CI) assuming allele contrast, dominant model, recessive model, and co-dominant model as pooled effect estimates. Results Eleven studies in 6682 migraineurs and 22591 controls for TNF –308G>A and six studies in 1055 migraineurs and 877 controls for NOS3 +894G>T were included in the analysis. Neither indicated overall associations between gene polymorphisms and migraine risk. Subgroup analyses suggested that the “A” allele of the TNF –308G>A variant increases the risk of migraine among non-Caucasians (dominant model: pooled OR = 1.82; 95% CI 1.15 – 2.87). The risk of migraine with aura (MA) was increased among both Caucasians and non-Caucasians. Subgroup analyses suggested that the “T” allele of the NOS3 +894G>T variant increases the risk of migraine among non-Caucasians (co-dominant model: pooled OR = 2.10; 95% CI 1.14 – 3.88). Conclusions Our findings appear to support the hypothesis that the TNF –308G>A polymorphism may act as a genetic susceptibility factor for migraine among non-Caucasians and that the NOS3 +894G>T polymorphism may modulate the risk of migraine among non-Caucasians. PMID:26098763

An efficient method for generation of bi-allelic null mutant mouse embryonic stem cells and its application for investigating epigenetic modifiers

PubMed Central

Cho, Lily Ting-yin; Andrews, Robert; Carroll, Thomas; Iyer, Vivek; Tate, Peri; Rosen, Barry; Stunnenberg, Hendrik G.; Fisher, Amanda G.; Skarnes, William C.

2017-01-01

Abstract Mouse embryonic stem (ES) cells are a popular model system to study biological processes, though uncovering recessive phenotypes requires inactivating both alleles. Building upon resources from the International Knockout Mouse Consortium (IKMC), we developed a targeting vector for second allele inactivation in conditional-ready IKMC ‘knockout-first’ ES cell lines. We applied our technology to several epigenetic regulators, recovering bi-allelic targeted clones with a high efficiency of 60% and used Flp recombinase to restore expression in two null cell lines to demonstrate how our system confirms causality through mutant phenotype reversion. We designed our strategy to select against re-targeting the ‘knockout-first’ allele and identify essential genes in ES cells, including the histone methyltransferase Setdb1. For confirmation, we exploited the flexibility of our system, enabling tamoxifen inducible conditional gene ablation while controlling for genetic background and tamoxifen effects. Setdb1 ablated ES cells exhibit severe growth inhibition, which is not rescued by exogenous Nanog expression or culturing in naive pluripotency ‘2i’ media, suggesting that the self-renewal defect is mediated through pluripotency network independent pathways. Our strategy to generate null mutant mouse ES cells is applicable to thousands of genes and repurposes existing IKMC Intermediate Vectors. PMID:28981838

Analyses of Tomato Fruit Brightness Mutants Uncover Both Cutin-Deficient and Cutin-Abundant Mutants and a New Hypomorphic Allele of GDSL Lipase[C][W][OPEN

PubMed Central

Petit, Johann; Bres, Cécile; Just, Daniel; Garcia, Virginie; Mauxion, Jean-Philippe; Marion, Didier; Bakan, Bénédicte; Joubès, Jérôme; Domergue, Frédéric; Rothan, Christophe

2014-01-01

The cuticle is a protective layer synthesized by epidermal cells of the plants and consisting of cutin covered and filled by waxes. In tomato (Solanum lycopersicum) fruit, the thick cuticle embedding epidermal cells has crucial roles in the control of pathogens, water loss, cracking, postharvest shelf-life, and brightness. To identify tomato mutants with modified cuticle composition and architecture and to further decipher the relationships between fruit brightness and cuticle in tomato, we screened an ethyl methanesulfonate mutant collection in the miniature tomato cultivar Micro-Tom for mutants with altered fruit brightness. Our screen resulted in the isolation of 16 glossy and 8 dull mutants displaying changes in the amount and/or composition of wax and cutin, cuticle thickness, and surface aspect of the fruit as characterized by optical and environmental scanning electron microscopy. The main conclusions on the relationships between fruit brightness and cuticle features were as follows: (1) screening for fruit brightness is an effective way to identify tomato cuticle mutants; (2) fruit brightness is independent from wax load variations; (3) glossy mutants show either reduced or increased cutin load; and (4) dull mutants display alterations in epidermal cell number and shape. Cuticle composition analyses further allowed the identification of groups of mutants displaying remarkable cuticle changes, such as mutants with increased dicarboxylic acids in cutin. Using genetic mapping of a strong cutin-deficient mutation, we discovered a novel hypomorphic allele of GDSL lipase carrying a splice junction mutation, thus highlighting the potential of tomato brightness mutants for advancing our understanding of cuticle formation in plants. PMID:24357602

Enhancing the Production of D-Mannitol by an Artificial Mutant of Penicillium sp. T2-M10.

PubMed

Duan, Rongting; Li, Hongtao; Li, Hongyu; Tang, Linhuan; Zhou, Hao; Yang, Xueqiong; Yang, Yabin; Ding, Zhongtao

2018-05-26

D-Mannitol belongs to a linear polyol with six-carbon and has indispensable usage in medicine and industry. In order to obtain more efficient D-mannitol producer, this study has screened out a stable mutant Penicillium sp. T2-M10 that was isolated from the initial D-mannitol-produced strain Penicillium sp.T2-8 via UV irradiation as well as nitrosoguanidine (NTG) induction. The mutant had a considerable enhancement in yield of D-mannitol based on optimizing fermentation. The production condition was optimized as the PDB medium with 24 g/L glucose for 9 days. The results showed that the production of D-mannitol from the mutant strain T2-M10 increased 125% in contrast with the parental strain. Meanwhile, the fact that D-mannitol is the main product in the mutant simplified the process of purification. Our finding revealed the potential value of the mutant strain Penicillium sp. T2-M10 to be a D-mannitol-producing strain.

Association of adiponectin gene polymorphism (+T45G) with acute coronary syndrome and circulating adiponectin levels.

PubMed

Rizk, Nasser M; El-Menyar, Ayman; Marei, Isra; Sameer, Maha; Musad, Tasneem; Younis, Dima; Farag, Fathi; Basem, Nora; Al-Ali, Khalid; Al Suwaidi, Jassim

2013-05-01

We investigated the association of adiponectin gene polymorphisms (+T45G and +G276T) and adiponectin levels with acute coronary syndrome (ACS) among Arabs in Qatar. A case-control study was performed in 142 Arab patients with ACS and 122 controls. Genotypes were determined using TaqMan real-time polymerase chain reaction assay. The TT, TG, and GG genotype frequencies of the T45G variant were significantly different among cases and controls (P = .023) but not significant for G276T genotypic frequencies. It was found that only the +45G allele was significantly associated with 3-fold increased risk of ACS (odds ratio = 2.77; 1.03-6.96; P = .043) among patients, using the genetic recessive model. Carriers of GG alleles had significantly lower adiponectin levels compared to TT/TG carriers of T45G in patients with ACS. The present study suggests that only T45G single-nucleotide polymorphism in the adiponectin gene is associated with higher odds for ACS events and has an effect on serum adiponectin levels among Arab populations.

Association between VEGF polymorphisms (936c/t, -460t/c and -634g/c) with haplotypes and coronary heart disease susceptibility.

PubMed

Han, Xia; Liu, Lili; Niu, Jiamin; Yang, Jun; Zhang, Zengtang; Zhang, Zhiqiang

2015-01-01

Our aim was to investigate the association between single nucleotide polymorphisms (SNPs) of vascular endothelial growth factor (VEGF) and coronary heart disease (CHD) susceptibility in Chinese Han population. 144 CHD patients and 150 healthy individuals were enrolled in the study. Three SNPs (936C/T, -460T/C and -634G/C) of VEGF were chose and then were genotyped with Sequenom time-of-flight mass spectrometry (TOFMS). Odds ratio (OR) with 95% confidence interval (CI) were used to evaluate the association of genotypes and haplotypes and CHD susceptibility. The frequencies of -460T/C CC genotype (13.6%) was found higher in the case group than that of control group (6.7%), which indicated that CC genotype was a risk factor for CHD (OR=2.50, 95% CI=1.10-5.68). Correspondently, the C allele appeared to increase the risk of CHD (OR=1.54, 95% CI=1.07-2.22). For -634G/C polymorphism, the risk of the CC genotype carrier for CHD increased 2.24 fold compared to the wild genotype. Moreover, -634G/CC allele was significantly associated with CHD susceptibility (OR=1.65, 95% CI=1.15-2.36). In addition, +936C/T CT genotype and C allele appeared to be a genetic-susceptibility factors for CHD (OR=2.43, 95% CI=1.44-4.10; OR=1.95, 95% CI=1.26-3.02). The haplotype analysis showed that T-C-T, C-C-C and C-G-C haplotypes all could increase the risk for CHD (OR: 2.43, 2.77 and 2.33). we concluded VEGF polymorphisms were associated with CHD susceptibility. Moreover, the haplotypes of T-C-T, C-C-C and C-G-C all could increase the risk for CHD.

Atopic dermatitis patients carrying G allele in -1082 G/A IL-10 polymorphism are predisposed to higher serum concentration of IL-10.

PubMed

Lesiak, Aleksandra; Zakrzewski, Marcin; Przybyłowska, Karolina; Rogowski-Tylman, Michał; Wozniacka, Anna; Narbutt, Joanna

2014-12-22

Atopic dermatitis (AD) is a chronic skin inflammatory disease in which Th2-derived cytokines play an essential role. Aim of the study was to assess interleukin 4, 10 and 13 (IL-4, IL-10 and IL-13) serum concentrations in AD patients and to correlate the values with the occurrence of genotypes of selected polymorphisms in genes encoding these cytokines. Seventy-six AD patients (mean age 11.4 years) and 60 healthy controls were enrolled in the study. Blood samples were analyzed for IL-4, IL-10 and IL-13 concentrations with ELISA assay and genotyping for -590C/T IL-4, -1082A/G IL-10 and -1055C/T IL-13 polymorphisms with PCR-RFLP. The obtained results revealed statistically higher serum concentration of IL-10 and IL-13 in AD patients when compared to healthy controls (10.30 pg/ml vs. 8.51 pg/ml for IL-10 and 5.67 pg/ml vs. 4.98 pg/ml for IL-13). There were no significant differences between AD patients and controls in regard to IL-4 serum level (5.10 pg/ml vs. 7.1 pg/ml). Analyzing the association between level of the examined cytokines and genotype polymorphisms -590 C/T for the IL-4 gene, -1082 A/G for the IL-10 gene and -1055 C/T for the IL-13 gene, we found a statistically higher IL-10 serum level among carriers of the G allele in the -1082 G/A IL-10 polymorphism both in AD and control groups. We did not find any significant differences between serum level of IL-4 and IL-13 in regard to genotype occurrence in examined polymorphisms: -590 C/T for the IL-4 gene and -1055 C/T for the IL-13 gene. The obtained results confirm the genetic background of IL-10 synthesis in the Polish population.

Allelic Dropout During Polymerase Chain Reaction due to G-Quadruplex Structures and DNA Methylation Is Widespread at Imprinted Human Loci.

PubMed

Stevens, Aaron J; Taylor, Millie G; Pearce, Frederick Grant; Kennedy, Martin A

2017-03-10

Loss of one allele during polymerase chain reaction (PCR) amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1 , BLCAP , DNMT1 , PLAGL1 , KCNQ1 , and GRB10 These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations. Copyright © 2017 Stevens et al.

Association of polymorphism in adiponectin (+45 T/G) and leptin (–2548 G/A) genes with type 2 diabetes mellitus in male Egyptians

PubMed Central

Motawi, Tarek; Salman, Tarek; Shaker, Olfat

2015-01-01

Introduction Adiponectin is an adipose tissue-specific protein with insulin-sensitizing properties. Many investigators have explored the association between adiponectin single nucleotide polymorphisms (SNPs) and type 2 diabetes mellitus (T2DM) in different ethnic populations from different regions. Leptin is a protein hormone constituting an important signal in the regulation of adipose tissue mass and body weight. The aim of this study was to explore potential associations between SNP +45 T>G of the adiponectin gene and SNP 2548G/A of leptin with T2DM and the effect of SNPs on serum adiponectin and leptin levels. Material and methods From the Egyptian population, we enrolled 110 T2DM patients and 90 non-diabetic controls. Serum lipid profile, blood glucose, serum adiponectin, and leptin were measured. Genotyping for two common SNPs of the adiponectin and leptin genes was performed by polymerase chain reaction–restriction fragment length polymorphism. Results The G allele and TG/GG genotype of SNP 45 occurred more frequently than the T allele and TT genotype in T2DM patients compares to the controls. Subjects with the GG + TG genotype of SNP 45 were at increased risk for T2DM (OR = 6.476; 95% CI: 3.401–12.33) and associated with a low serum adiponectin level compared with the TT genotype. The serum leptin concentration of GA + AA genotype carriers was not significantly different from that of the GG genotype in the diabetic group. Conclusions The G allele carriers who have reduced plasma concentrations of adiponectin may have an association with T2DM, while leptin SNP 2548 G/A is not associated with the risk of development of T2DM in the Egyptian population. PMID:26528333

An efficient method for generation of bi-allelic null mutant mouse embryonic stem cells and its application for investigating epigenetic modifiers.

PubMed

Fisher, Cynthia L; Marks, Hendrik; Cho, Lily Ting-Yin; Andrews, Robert; Wormald, Sam; Carroll, Thomas; Iyer, Vivek; Tate, Peri; Rosen, Barry; Stunnenberg, Hendrik G; Fisher, Amanda G; Skarnes, William C

2017-12-01

Mouse embryonic stem (ES) cells are a popular model system to study biological processes, though uncovering recessive phenotypes requires inactivating both alleles. Building upon resources from the International Knockout Mouse Consortium (IKMC), we developed a targeting vector for second allele inactivation in conditional-ready IKMC 'knockout-first' ES cell lines. We applied our technology to several epigenetic regulators, recovering bi-allelic targeted clones with a high efficiency of 60% and used Flp recombinase to restore expression in two null cell lines to demonstrate how our system confirms causality through mutant phenotype reversion. We designed our strategy to select against re-targeting the 'knockout-first' allele and identify essential genes in ES cells, including the histone methyltransferase Setdb1. For confirmation, we exploited the flexibility of our system, enabling tamoxifen inducible conditional gene ablation while controlling for genetic background and tamoxifen effects. Setdb1 ablated ES cells exhibit severe growth inhibition, which is not rescued by exogenous Nanog expression or culturing in naive pluripotency '2i' media, suggesting that the self-renewal defect is mediated through pluripotency network independent pathways. Our strategy to generate null mutant mouse ES cells is applicable to thousands of genes and repurposes existing IKMC Intermediate Vectors. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Polymorphic variations in IL-1β, IL-6 and IL-10 genes, their circulating serum levels and breast cancer risk in Indian women.

PubMed

Pooja, Singh; Chaudhary, Preeti; Nayak, Lakshma V; Rajender, Singh; Saini, Karan Singh; Deol, Debashish; Kumar, Sandeep; Bid, Hemant Kumar; Konwar, Rituraj

2012-10-01

Cytokines are known as important regulators of the entire gamut of cancer from initiation, invasion and metastasis. This fact and plethora of gene polymorphism data prompted us to investigate cytokine gene polymorphisms in breast cancer (BC) patients. Selected polymorphisms in the IL-1β [-511 T>C (rs16944) and +3954 C>T (rs1143634)]; IL-6 [-174 G>C (rs1800795)]; IL-10 [-1082 A>G (rs1800896), -819 T>C (rs1800871) and -592 A>C (rs1800872)] genes were genotyped in 200 BC patients and 200 healthy volunteers in a case-control study using PCR-RFLP and direct DNA sequencing techniques. Peripheral cytokine levels were measured using ELISA. Allele and genotype data were analyzed for significance of differences between cases and controls using Chi-Square [χ(2)] test. Two sided P-values of less than 0.05 were considered to be statistically significant. Peripheral level of all three cytokines did not show any significant difference between cases and controls. Allele and genotype frequency of IL-1β [-511 T>C (rs16944)] did not show any difference between cases and controls. On the other hand mutant allele and genotype at IL-1β [+3954 C>T (rs1143634)] associated with increased risk of BC. This was also true for pre-menopausal cases and for mutant genotype in post-menopausal cases. Mutant allele and genotypes at IL-6 [-174 G>C (rs1800795)] appeared to be protective in nature such that controls had a higher frequency of both mutant alleles and genotypes. None of the three SNPs in IL-10 gene associated with risk of BC, except significant association of mutant allele and genotypes of -1082 A>G (rs1800896) polymorphism with postmenopausal BC. Mutant allele and genotype at IL-1β [+3954 C>T (rs1143634)] site associated with increased BC risk, while mutant allele and genotypes at IL-6 [-174 G>C (rs1800795)] polymorphism appeared to be protective. Also, there was significant association of mutant allele and genotypes of IL-10 [-1082 A>G (rs1800896)] with postmenopausal BC. None of

The Influence of MDR1 G2677T/a genetic polymorphisms on the pharmacokinetics of repaglinide in healthy Chinese volunteers.

PubMed

Xiang, Qian; Cui, Yi Min; Zhao, Xia; Yan, Liang; Zhou, Ying

2012-01-01

The aim of this study was to evaluate the pharmacogenetic variability in the disposition of repaglinide in healthy Chinese subjects. A single dose of 2 mg repaglinide was orally administered to 24 healthy Chinese subjects. The serum concentrations of repaglinide were measured by using liquid chromatography/tandem mass spectrometry. We determined the polymorphic alleles of MDR1 C1236T, MDR1 G2677T/A, MDR1 C3435T, CYP3A4*18, OATP1B1 G388A, and OATP1B1 T521C in each subject. The area under the plasma concentration-time curve from time 0 to infinity (AUC((0-inf))) of repaglinide was significantly higher in subjects possessing the MDR1 2677GT and 2677TT alleles than in those with the MDR1 2677GG and 2677TA alleles (p = 0.007). The mean AUCs and peak plasma concentration were higher in subjects with the 521TC allele than in those with the OATP1B1 521TT allele, and the OATP1B1 388A allele is associated with a reduced trend of pharmacokinetic exposure; however, these trends were not statistically significant. The pharmacokinetics of repaglinide was not associated with MDR1 C1236T, MDR1 C3435T, and CYP3A4*18. This study shows that the genetic polymorphisms of MDR1 G2677T/A might explain the variability in the pharmacokinetics of repaglinide in the Chinese population. Copyright © 2012 S. Karger AG, Basel.

Cas9/sgRNA selective targeting of the P23H Rhodopsin mutant allele for treating retinitis pigmentosa by intravitreal AAV9.PHP.B-based delivery.

PubMed

Giannelli, Serena G; Luoni, Mirko; Castoldi, Valerio; Massimino, Luca; Cabassi, Tommaso; Angeloni, Debora; Demontis, Gian Carlo; Leocani, Letizia; Andreazzoli, Massimiliano; Broccoli, Vania

2018-03-01

P23H is the most common mutation in the RHODOPSIN (RHO) gene leading to a dominant form of retinitis pigmentosa (RP), a rod photoreceptor degeneration that invariably causes vision loss. Specific disruption of the disease P23H RHO mutant while preserving the wild-type (WT) functional allele would be an invaluable therapy for this disease. However, various technologies tested in the past failed to achieve effective changes and consequently therapeutic benefits. We validated a CRISPR/Cas9 strategy to specifically inactivate the P23H RHO mutant, while preserving the WT allele in vitro. We, then, translated this approach in vivo by delivering the CRISPR/Cas9 components in murine Rho+/P23H mutant retinae. Targeted retinae presented a high rate of cleavage in the P23H but not WT Rho allele. This gene manipulation was sufficient to slow photoreceptor degeneration and improve retinal functions. To improve the translational potential of our approach, we tested intravitreal delivery of this system by means of adeno-associated viruses (AAVs). To this purpose, the employment of the AAV9-PHP.B resulted the most effective in disrupting the P23H Rho mutant. Finally, this approach was translated successfully in human cells engineered with the homozygous P23H RHO gene mutation. Overall, this is a significant proof-of-concept that gene allele specific targeting by CRISPR/Cas9 technology is specific and efficient and represents an unprecedented tool for treating RP and more broadly dominant genetic human disorders affecting the eye, as well as other tissues.

Heterogeneous alleles comprising G6PD deficiency trait in West Africa exert contrasting effects on two major clinical presentations of severe malaria.

PubMed

Shah, Shivang S; Rockett, Kirk A; Jallow, Muminatou; Sisay-Joof, Fatou; Bojang, Kalifa A; Pinder, Margaret; Jeffreys, Anna; Craik, Rachel; Hubbart, Christina; Wellems, Thomas E; Kwiatkowski, Dominic P

2016-01-07

Glucose-6-phosphate dehydrogenase (G6PD) deficiency exhibits considerable allelic heterogeneity which manifests with variable biochemical and clinical penetrance. It has long been thought that G6PD deficiency confers partial protection against severe malaria, however prior genetic association studies have disagreed with regard to the strength and specificity of a protective effect, which might reflect differences in the host genetic background, environmental influences, or in the specific clinical phenotypes considered. A case-control association study of severe malaria was conducted in The Gambia, a region in West Africa where there is considerable allelic heterogeneity underlying expression of G6PD deficiency trait, evaluating the three major nonsynonymous polymorphisms known to be associated with enzyme deficiency (A968G, T542A, and C202T) in a cohort of 3836 controls and 2379 severe malaria cases. Each deficiency allele exhibited a similar trend toward protection against severe malaria overall (15-26% reduced risk); however, in stratifying severe malaria to two of its constituent clinical subphenotypes, severe malarial anaemia (SMA) and cerebral malaria (CM), the three deficiency alleles exhibited trends of opposing effect, with risk conferred to SMA and protection with respect to CM. To assess the overall effect of G6PD deficiency trait, deficiency alleles found across all three loci were pooled. G6PD deficiency trait was found to be significantly associated with protection from severe malaria overall (OR 0.83 [0.75-0.92], P = 0.0006), but this was limited to CM (OR 0.73 [0.61-0.87], P = 0.0005), with a trend toward increased risk for SMA, especially in fully-deficient individuals (OR 1.43 [0.99-2.08], P = 0.056). Sex-stratified testing largely comported with these results, with evidence suggesting that protection by G6PD deficiency trait is conferred to both males and females, though susceptibility to SMA may be restricted to fully-deficient male hemizygotes

FUNCTIONAL CHARACTERIZATION OF THE A411T (L137F) and G364A (D122N) GENETIC POLYMORPHISMS IN HUMAN N-ACETYLTRANSFERASE 2

PubMed Central

Zang, Yu; Zhao, Shuang; Doll, Mark A.; States, J Christopher; Hein, David W.

2007-01-01

Human N-acetyltransferase 2 (NAT2) genetic polymorphisms may modify drug efficacy and toxicity and individual cancer susceptibility from carcinogen exposure. A411T (L137F) and G364A (D122N) are two single nucleotide polymorphisms (SNPs) that coexist with other SNPs in human NAT2 alleles NAT2*5I and NAT2*12D, respectively. Cloning and expression in COS-1 cells showed that both A411T and G364A reduced NAT2 immunoreactive protein to an undetectable level without causing changes in mRNA level. Missense mutants displayed different effects on sulfamethazine N-acetylation activity for both L137 (wild-type: 70.2±5.2; L137F: 1.34±0.03; L137W: non-detectable; L137I: 34.2±2.0; L137G: 0.52±0.04 nmol/min/mg) and D122 (wildtype: 70.2±5.2; D122R: non-detectable; D122Q: non-detectable; D122E: 1.72±0.24 nmol/min/mg). To further test our hypothesis that A411T (L137F) and G364A (D122N) accelerate protein degradation, various NAT2 alleles were cloned and expressed in E. coli, which does not possess the ubiquitin-mediated degradation pathway. In contrast to the expression in mammalian cells, recombinant NAT2 possessing either of these two SNPs showed no reduction in immunoreactive NAT2 level when expressed in E. coli. These findings suggest that both A411T (L137F) and G364A (D122N) enhance NAT2 degradation, resulting in reduced NAT2 protein and catalytic activity for NAT2 5I and NAT2 12D. PMID:17264801

Comparative study of enzymatic activities of new KatG mutants from low- and high-level isoniazid-resistant clinical isolates of Mycobacterium tuberculosis.

PubMed

Brossier, Florence; Boudinet, Marlène; Jarlier, Vincent; Petrella, Stéphanie; Sougakoff, Wladimir

2016-09-01

Resistance to isoniazid (INH-R) in Mycobacterium tuberculosis is mainly due to mutations at position 315 (S315T) of the catalase-peroxidase KatG. We identified 16 mutations (including 13 biochemically uncharacterized mutations) in KatG from INH-R clinical isolates of M. tuberculosis showing mutations other than S315T. The KatG enzymatic activities (catalase, peroxidase, free radical production and isonicotinoyl-NAD formation) of wild-type KatG and the 16 mutants were determined and correlated to their spatial location in a KatG model structure. Of all mutations studied, H270R, which conferred a high level of INH-R and results in the disruption of a coordination bond with the heme, caused complete loss of all enzymatic KatG activities. The mutants generally associated with a very high level of INH-R were all characterized by a drastic reduction in catalase activity and a marked decrease in INH activation activities. One mutant, A162E, displayed a behavior similar to S315T, i.e. a moderate decrease in catalase activity and a drastic decrease in the formation of the radical form of INH. Finally, the mutants associated with a low level of INH-R showed a moderate reduction in the four catalytic activities, likely stemming from an overall alteration of the folding and/or stability of the KatG protein. Copyright © 2016 Elsevier Ltd. All rights reserved.

Increased Steady-State Mutant Huntingtin mRNA in Huntington's Disease Brain.

PubMed

Liu, Wanzhao; Chaurette, Joanna; Pfister, Edith L; Kennington, Lori A; Chase, Kathryn O; Bullock, Jocelyn; Vonsattel, Jean Paul G; Faull, Richard L M; Macdonald, Douglas; DiFiglia, Marian; Zamore, Phillip D; Aronin, Neil

2013-01-01

Huntington's disease is caused by expansion of CAG trinucleotide repeats in the first exon of the huntingtin gene, which is essential for both development and neurogenesis. Huntington's disease is autosomal dominant. The normal allele contains 6 to 35 CAG triplets (average, 18) and the mutant, disease-causing allele contains >36 CAG triplets (average, 42). We examined 279 postmortem brain samples, including 148 HD and 131 non-HD controls. A total of 108 samples from 87 HD patients that are heterozygous at SNP rs362307, with a normal allele (18 to 27 CAG repeats) and a mutant allele (39 to 73 CAG repeats) were used to measure relative abundance of mutant and wild-type huntingtin mRNA. We used allele-specific, quantitative RT-PCR based on SNP heterozygosity to estimate the relative amount of mutant versus normal huntingtin mRNA in postmortem brain samples from patients with Huntington's disease. In the cortex and striatum, the amount of mRNA from the mutant allele exceeds that from the normal allele in 75% of patients. In the cerebellum, no significant difference between the two alleles was evident. Brain tissues from non-HD controls show no significant difference between two alleles of huntingtin mRNAs. Allelic differences were more pronounced at early neuropathological grades (grades 1 and 2) than at late grades (grades 3 and 4). More mutant HTT than normal could arise from increased transcription of mutant HTT allele, or decreased clearance of mutant HTT mRNA, or both. An implication is that equimolar silencing of both alleles would increase the mutant HTT to normal HTT ratio.

A targeted deletion/insertion in the mouse Pcsk1 locus is associated with homozygous embryo preimplantation lethality, mutant allele preferential transmission and heterozygous female susceptibility to dietary fat.

PubMed

Mbikay, Majambu; Croissandeau, Gilles; Sirois, Francine; Anini, Younes; Mayne, Janice; Seidah, Nabil G; Chrétien, Michel

2007-06-15

Proprotein convertase 1 (PC1) is a neuroendocrine proteinase involved in the proteolytic activation of precursors to hormones and neuropeptides. To determine the physiological importance of PC1, we produced a mutant mouse from embryonic stem cells in which its locus (Pcsk1) had been inactivated by homologous recombination. The inactivating mutation consisted of a 32.7-kb internal deletion and a 1.8 kb insertion of the bacterial neomycin resistance gene (neo) under the mouse phosphoglycerate kinase 1 protein (PGKneo). Intercross of Pcsk1(+/-) mice produced no Pcsk1(-/-) offspring or blastocysts; in addition, more than 80% of the offspring were Pcsk1(+/-). These observations suggested that the mutation caused preimplantation lethality of homozygous embryos and preferential transmission of the mutant allele. Interestingly, RT-PCR analysis on RNA from endocrine tissues from Pcsk1(+/-) mice revealed the presence of aberrant transcripts specifying the N-terminal half of the PC1 propeptide fused to neo gene product. Mass spectrometric profiles of proopiomelanocortin-derived peptides in the anterior pituitary were similar between Pcsk1(+/-) and Pcsk1(+/+) mice, but significantly different between male and female mice of the same genotype. Relative to their wild-type counterparts, female mutant mice exhibited stunted growth under a low fat diet, and catch-up growth under a high-fat diet. The complex phenotype exhibited by this Pcsk1 mutant mouse model may be due to PC1 deficiency aggravated by expression of aberrant gene products from the mutant allele.

Host range and cell cycle activation properties of polyomavirus large T-antigen mutants defective in pRB binding

DOE Office of Scientific and Technical Information (OSTI.GOV)

Freund, R.; Bauer, P.H.; Benjamin, T.L.

1994-11-01

The authors have examined the growth properties of polyomavirus large T-antigen mutants that ar unable to bind pRB, the product of the retinoblastoma tumor suppressor gene. These mutants grow poorly on primary mouse cells yet grow well on NIH 3T3 and other established mouse cell lines. Preinfection of primary baby mouse kidney (BMK) epithelial cells with wild-type simian virus 40 renders these cells permissive to growth of pRB-binding polyomavirus mutants. Conversely, NIH 3T3 cells transfected by and expressing wild-type human pRB become nonpermissive. Primary fibroblasts for mouse embryos that carry a homozygous knockout of the RB gene are permissive, whilemore » those from normal littermates are nonpermissive. The host range of polyomavirus pRB-binding mutants is thus determined by expression or lack of expression of functional pRB by the host. These results demonstrate the importance of pRB binding by large T antigen for productive viral infection in primary cells. Failure of pRB-binding mutants to grow well in BMK cells correlates with their failure to induce progression from G{sub 0} or G{sub 1} through the S phase of the cell cycle. Time course studies show delayed synthesis and lower levels of accumulation of large T antigen, viral DNA, and VP1 in mutant compared with wild-type virus-infected BMK cells. These results support a model in which productive infection by polyomavirus in normal mouse cells is tightly coupled to the induction and progression of the cell cycle. 48 refs., 6 figs., 5 tabs.« less

Molecular genetics of G proteins and atherosclerosis risk.

PubMed

Siffert, W

2001-11-01

Using a classical candidate gene approach, we have described a common C825T polymorphism in the gene GNB3 which encodes the ubiquitously expressed beta3 subunit of heterotrimeric G proteins. The 825T allele is associated with alternative splicing of the gene and the formation of a truncated but functionally active beta3 subunit which is referred to as Gbeta3s. Expression of the splice variant results in an enhanced G protein activation on stimulation of G protein-coupled receptors. Carriers of the 825T allele show an increased risk for hypertension and left ventricular hypertrophy. Homo- and heterozygous 825T allele carriers respond with a stronger decrease in blood pressure to therapy with a thiazide diuretic than homozygous 825C allele carriers. Moreover, 825T allele carriers appear to have an increased risk for obesity which appears sensible given the established role of G protein signaling in adipogenesis. The highest frequencies of the 825T allele are found in ethnicities with the highest lifestyle-dependent risk for obesity, e.g., black Africans and East Asians. This suggests that the 825T allele fulfills the criteria of a thrifty genotype.

Pseudo-Bartter syndrome as the sole manifestation of cystic fibrosis in a child with 711+G>T/IVS8-5T mutation: a new face of an old disease.

PubMed

Tinsa, Faten; Hadj Fredj, Sondes; Bel Hadj, Imen; Khalsi, Fatma; Abdelhak, Sonia; Boussetta, Khadija; Messaoud, Taieb

2017-08-01

Pseudo-Bartter syndrome (PBS) describes an uncommon complication of cystic fibrosis leading to hypochloraemic, hypokalaemic metabolic alkalosis. PBS as the sole manifestation of cystic fibrosis in children is extremely rare and has never been described in patients carrying 5T variant. We report a clinical, biochemical and genetic study of a four year-old boy presenting a pseudo-Bartter syndrome as the sole manifestation of cystic fibrosis. All 27 exons and the flanking intron regions of the CFTR gene were analysed by PCR and direct sequencing. Direct sequencing was also used to analyse TG m T n and M470V polymorphisms in the patient and his parents. Two sweat tests were abnormal with elevated chloride levels at 78 and 88 mmol/L. DNA sequencing revealed a heterozygous mutation 711+1 G>T and an IVS8-T5 allele. The mutation 711+1 G>T is in trans with the IVS8-T5-TG11 allele and the child carried M470/V470 genotype. To the best of our knowledge, the genotype 711+1 G>T /IVS8-5T found in our patient is described for the first time. The role of TG11-5T-V470 allele in cases of cystic fibrosis with PB syndrome remains to be determined.

Utilization of a ts-sacB selection system for the generation of a Mycobacterium avium serovar-8 specific glycopeptidolipid allelic exchange mutant

PubMed Central

Irani, Vida R; Lee, Sun-Hwa; Eckstein, Torsten M; Inamine, Julia M; Belisle, John T; Maslow, Joel N

2004-01-01

Background Mycobacterium avium are ubiquitous environmental organisms and a cause of disseminated infection in patients with end-stage AIDS. The glycopeptidolipids (GPL) of M. avium are proposed to participate in the pathogenesis of this organism, however, establishment of a clear role for GPL in disease production has been limited by the inability to genetically manipulate M. avium. Methods To be able to study the role of the GPL in M. avium pathogenesis, a ts-sacB selection system, not previously used in M. avium, was employed as a means to achieve homologous recombination for the rhamnosyltransferase (rtfA) gene of a pathogenic serovar 8 strain of M. avium to prevent addition of serovar-specific sugars to rhamnose of the fatty acyl-peptide backbone of GPL. The genotype of the resultant rtfA mutant was confirmed by polymerase chain reaction and southern hybridization. Disruption in the proximal sugar of the haptenic oligosaccharide resulted in the loss of serovar specific GPL with no change in the pattern of non-serovar specific GPL moieties as shown by thin layer chromatography and gas chromatography/mass spectrometry. Complementation of wild type (wt) rtfA in trans through an integrative plasmid restored serovar-8 specific GPL expression identical to wt serovar 8 parent strain. Results In this study, we affirm our results that rtfA encodes an enzyme responsible for the transfer of Rha to 6d-Tal and provide evidence of a second allelic exchange mutagenesis system suitable for M. avium. Conclusion We report the second allelic exchange system for M. avium utilizing ts-sacB as double-negative and xylE as positive counter-selection markers, respectively. This system of allelic exchange would be especially useful for M. avium strains that demonstrate significant isoniazid (INH) resistance despite transformation with katG. Through the construction of mutants in GPL or other mycobacterial components, their roles in M. avium pathogenesis, biosynthesis, or drug

Absence of the HLA-G*0113N allele in Amerindian populations from the Brazilian Amazon region.

PubMed

Mendes-Junior, Celso T; Castelli, Erick C; Moreau, Philippe; Simões, Aguinaldo L; Donadi, Eduardo A

2010-04-01

The HLA-G gene is predominantly expressed at the maternal-fetal interface and has been associated with maternal-fetal tolerance. The HLA-G*0113N is a null allele defined by the insertion of a premature stop codon at exon 2, observed in a single Ghanaian individual. Likewise the G*0105N allele, the occurrence of the HLA-G*0113N in a population from an area with high pathogen load suggests that the reduced HLA-G expression in G*0113N heterozygous placentas could improve the intrauterine defense against infections. The presence of the G*0113N allele here was investigated in 150 Amerindians from five isolated tribes that inhabit the Central Amazon and in 295 admixed individuals from the State of São Paulo, Southeastern Brazil, previously genotyped for HLA-G. No copy of the G*0113N null allele was found in both population samples by exon 2 sequence-based analysis, reinforcing its restricted occurrence in Africa.

High NPM1-mutant allele burden at diagnosis predicts unfavorable outcomes in de novo AML.

PubMed

Patel, Sanjay S; Kuo, Frank C; Gibson, Christopher J; Steensma, David P; Soiffer, Robert J; Alyea, Edwin P; Chen, Yi-Bin A; Fathi, Amir T; Graubert, Timothy A; Brunner, Andrew M; Wadleigh, Martha; Stone, Richard M; DeAngelo, Daniel J; Nardi, Valentina; Hasserjian, Robert P; Weinberg, Olga K

2018-06-21

Acute myeloid leukemia (AML) with mutated NPM1 is a newly recognized separate entity in the revised 2016 World Health Organization classification and is associated with a favorable prognosis. Although previous studies have evaluated NPM1 in a binary fashion, little is known about the significance of its mutant allele burden at diagnosis, nor has the effect of comutations (other than FLT3 ) been extensively evaluated. We retrospectively used targeted sequencing data from 109 patients with de novo AML with mutated NPM1 to evaluate the potential significance of NPM1 variant allele frequency (VAF), comutations, and clinical parameters with regard to patient outcomes. We observed that high NPM1 VAF (uppermost quartile) correlated with shortened overall survival (median, 12.1 months vs not reached; P < .0001) as well as event-free survival (median, 7.5 vs 65.44 months; P < .0001) compared with the other NPM1 -mutated cases. In both univariate and multivariable analyses, high NPM1 VAF had a particularly adverse prognostic effect in the subset of patients treated with stem-cell transplantation in first remission ( P = .0004) and in patients with mutated DNMT3A ( P < .0001). Our findings indicate that the prognostic effect of NPM1 mutation in de novo AML may be influenced by the relative abundance of the mutated allele. © 2018 by The American Society of Hematology.

A novel Tetra-primer ARMS-PCR based assay for genotyping SNP rs12303764(G/T) of human Unc-51 like kinase 1 gene.

PubMed

Randhawa, Rohit; Duseja, Ajay; Changotra, Harish

2017-02-01

Various case-control studies have shown association of single nucleotide polymorphism rs12303764(G/T) in ULK1 with crohn's disease. The techniques used in these studies were time consuming, complicated and require sophisticated/expensive instruments. Therefore, in order to overcome these problems, we have developed a new, rapid and cost effective Tetra-primer ARMS-PCR assay to genotype single nucleotide polymorphism rs12303764(G/T) of ULK1 gene. We manually designed allele specific primers. DNA fragment amplified using outer primers was sequenced to obtain samples with known genotypes (GG, GT and TT) for further use in the development of T-ARMS-PCR assay. Amplification conditions were optimized for parameters; annealing temperature, Taq DNA polymerase and primers. The developed T-ARMS-PCR assay was applied to genotype one hundred samples from healthy individuals. Genotyping results of 10 DNA samples from healthy individuals for rs12303764(G/T) by T-ARMS-PCR assay and sequencing were concordant. The newly developed assay was further applied to genotype samples from 100 healthy individuals of North Indian origin. Genotype frequencies were 9, 34 and 57 % for GG, GT and TT, respectively. Allele frequencies were 0.26 and 0.74 for G and T, respectively. The allele frequencies were in Hardy-Weinberg's equilibrium (p = 0.2443). T-ARMS-PCR assay developed in our laboratory for genotyping rs12303764 (G/T) of ULK1 gene is time saving and cost-effective as compared to the available methods. Furthermore, this is the first study reporting allelic and genotype frequencies of ULK1 rs12303764 (G/T) variants in North Indian population.

Allelic imbalance modulates surface expression of the tolerance-inducing HLA-G molecule on primary trophoblast cells.

PubMed

Djurisic, S; Teiblum, S; Tolstrup, C K; Christiansen, O B; Hviid, T V F

2015-03-01

The HLA-G molecule is expressed on trophoblast cells at the feto-maternal interface, where it interacts with local immune cells, and upholds tolerance against the semi-allogeneic fetus. Aberrant HLA-G expression in the placenta and reduced soluble HLA-G levels are observed in pregnancy complications, partly explained by HLA-G polymorphisms which are associated with differences in the alternative splicing pattern and of the stability of HLA-G mRNA. Of special importance is a 14 bp insertion/deletion polymorphism located in the 3'-untranslated region of the HLA-G gene. In the current study, we present novel evidence for allelic imbalance of the 14 bp insertion/deletion polymorphism, using a very accurate and sensitive Digital droplet PCR technique. Allelic imbalance in heterozygous samples was observed as differential expression levels of 14 bp insertion/deletion allele-specific mRNA transcripts, which was further associated with low levels of HLA-G surface expression on primary trophoblast cells. Full gene sequencing of HLA-G allowed us to study correlations between HLA-G extended haplotypes and single-nucleotide polymorphisms and HLA-G surface expression. We found that a 1:1 expression (allelic balance) of the 14 bp insertion/deletion mRNA alleles was associated with high surface expression of HLA-G and with a specific HLA-G extended haplotype. The 14 bp del/del genotype was associated with a significantly lower abundance of the G1 mRNA isoform, and a higher abundance of the G3 mRNA isoform. Overall, the present study provides original evidence for allelic imbalance of the 14 bp insertion/deletion polymorphism, which influences HLA-G surface expression on primary trophoblast cells, considered to be important in the pathogenesis of pre-eclampsia and other pregnancy complications. © The Author 2014. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Multiplex sequence analysis demonstrates the competitive growth advantage of the A-to-G mutants of clarithromycin-resistant Helicobacter pylori.

PubMed

Wang, G; Rahman, M S; Humayun, M Z; Taylor, D E

1999-03-01

Clarithromycin resistance in Helicobacter pylori is due to point mutation within the 23S rRNA. We examined the growth rates of different types of site-directed mutants and demonstrated quantitatively the competitive growth advantage of A-to-G mutants over other types of mutants by a multiplex sequencing assay. The results provide a rational explanation of why A-to-G mutants are predominantly observed among clarithromycin-resistant clinical isolates.

Construction of brewing-wine Aspergillus oryzae pyrG- mutant by pyrG gene deletion and its application in homology transformation.

PubMed

Du, Yu; Xie, Guizhen; Yang, Chunfa; Fang, Baishan; Chen, Hongwen

2014-06-01

pyrG(-) host cells are indispensable for pyrG(-) based transformation system. Isolations of pyrG(-) host cells by random mutations are limited by time-consuming, unclear genetic background and potential interferences of homogenous recombination. The purpose of this study was to construct brewing-wine Aspergillus oryzae pyrG(-) mutant by site-directed mutation of pyrG gene deletion which would be used as a host for further transformation. pMD-pyrGAB, a vector carrying pyrG deletion cassette, was used to construct pyrG(-) mutant of A. oryzae. Three stable pyrG deletion mutants of A. oryzae were isolated by resistant to 5-fluoroorotic acid and confirmed by polymerase chain reaction analysis, indicating that pyrG was completely excised. The ΔpyrG mutants were applied as pyrG(-) host cells to disrupt xdh gene encoding xylitol dehydrogenase, which involves in xylitol production of A. oryzae. The xdh disruption mutants were efficiently constructed by transforming a pMD-pyrG-xdh disruption plasmid carrying pyrG, and the produced xylitol concentration of the Δxdh mutant was three times as much as that of the ΔpyrG recipient. Site-directed pyrG gene deletion is thus an effective way for the isolation of pyrG(-) host cells, and the established host-vector system could be applied in further functional genomics analysis and molecular breeding of A. oryzae. © The Author 2014. Published by ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.

The SNP g.1311T>C associated with the absence of β-casein in goat milk influences CSN2 promoter activity.

PubMed

Cosenza, G; Iannaccone, M; Pico, B A; Ramunno, L; Capparelli, R

2016-10-01

Quantitative individual differences in the amount of β-casein in goat milk are determined by at least nine alleles. In particular, two alleles (CSN2(0) and CSN2(01) ) are associated with an undetectable amount of this protein in milk. The CSN2(01) allele is characterized by a single nucleotide substitution at position 373 of the seventh exon (AJ011018:g.8915C>T), responsible for the formation of a premature stop codon at the 182 position. Herein, we report the contribution of the SNP g.1311T>C, which demonstrates a linkage with the SNP AJ011018:g.8915C>T, to the promoter transcriptional activity. Particularly, we indicate that the nucleotide C at position 1311 negatively affects the promoter activity of the CSN2 gene. © 2016 Stichting International Foundation for Animal Genetics.

Multiplex Sequence Analysis Demonstrates the Competitive Growth Advantage of the A-to-G Mutants of Clarithromycin-Resistant Helicobacter pylori

PubMed Central

Wang, Ge; Rahman, M. Sayeedur; Humayun, M. Zafri; Taylor, Diane E.

1999-01-01

Clarithromycin resistance in Helicobacter pylori is due to point mutation within the 23S rRNA. We examined the growth rates of different types of site-directed mutants and demonstrated quantitatively the competitive growth advantage of A-to-G mutants over other types of mutants by a multiplex sequencing assay. The results provide a rational explanation of why A-to-G mutants are predominantly observed among clarithromycin-resistant clinical isolates. PMID:10049289

Determination of multiple-clone infection at allelic dimorphism site of Plasmodium vivax merozoite surface protein-1 in the Republic of Korea by pyrosequencing assay.

PubMed

Dinzouna-Boutamba, Sylvatrie-Danne; Lee, Sanghyun; Son, Ui-Han; Yun, Hae Soo; Joo, So-Young; Jeong, Sookwan; Rhee, Man Hee; Kwak, Dongmi; Xuan, Xuenan; Hong, Yeonchul; Chung, Dong-Il; Goo, Youn-Kyoung

2017-12-01

Allelic diversity leading to multiple gene polymorphisms of vivax malaria parasites has been shown to greatly contribute to antigenic variation and drug resistance, increasing the potential for multiple-clone infections within the host. Therefore, to identify multiple-clone infections and the predominant haplotype of Plasmodium vivax in a South Korean population, P. vivax merozoite surface protein-1 (PvMSP-1) was analyzed by pyrosequencing. Pyrosequencing of 156 vivax malaria-infected samples yielded 97 (62.18%) output pyrograms showing two main types of peak patterns of the dimorphic allele for threonine and alanine (T1476A). Most of the samples evaluated (88.66%) carried multiple-clone infections (wild- and mutant-types), whereas 11.34% of the same population carried only the mutant-type (1476A). In addition, each allele showed a high frequency of guanine (G) base substitution at both the first and third positions (86.07% and 81.13%, respectively) of the nucleotide combinations. Pyrosequencing of the PvMSP-1 42-kDa fragment revealed a heterogeneous parasite population, with the mutant-type dominant compared to the wild-type. Understanding the genetic diversity and multiple-clone infection rates may lead to improvements in vivax malaria prevention and strategic control plans. Further studies are needed to improve the efficacy of the pyrosequencing assay with large sample sizes and additional nucleotide positions. Copyright © 2017 Elsevier B.V. All rights reserved.

Reduced carriership of 4G allele of plasminogen activator inhibitor-1 4G/5G polymorphism in very young survivors of myocardial infarction.

PubMed

Rallidis, Loukianos S; Gialeraki, Argyri; Merkouri, Efrosyni; Liakos, George; Dagres, Nikolaos; Sionis, Dimitrios; Travlou, Anthi; Lekakis, John; Kremastinos, Dimitrios T

2010-05-01

There are limited and controversial data regarding the impact of 4G/5G polymorphism of the plasminogen activator inhibitor-1 (PAI-1) gene in the pathogenesis of premature myocardial infarction (MI). We explored whether 4G/5G polymorphism of the PAI-1 gene is associated with the development of MI G/5G polymorphism of PAI-1 was tested with polymerase chain reaction and reverse hybridization. 4G allele carriers (4G/4G and 4G/5G genotypes) of PAI-1 were less frequent in patients than in controls (69.6 vs. 83.6%, P = 0.007). 4G carriership of the polymorphism of PAI-1 was associated with lower risk for acute MI (odds ratio 0.45, 95% confidence interval 0.23-0.88, P = 0.02) after adjusting for major cardiovascular risk factors. Patients possessing the 4G allele had higher PAI-1 plasma levels (32.2 +/- 25 vs. 22.2 +/- 11.3 ng/ml, P = 0.006) but lower lipoprotein(a) levels (10.1 [2.1-29.9] vs. 15.3 [8.2-57.1] mg/dl, P = 0.03) compared to 5G/5G homozygotes. Our data indicate that the 4G allele of the PAI-1 4G/5G polymorphism is less frequent among survivors of MI at very young age compared with matched controls.

Isolation of a novel UVB-tolerant rice mutant obtained by exposure to carbon-ion beams.

PubMed

Takano, Nao; Takahashi, Yuko; Yamamoto, Mitsuru; Teranishi, Mika; Yamaguchi, Hiroko; Sakamoto, Ayako N; Hase, Yoshihiro; Fujisawa, Hiroko; Wu, Jianzhong; Matsumoto, Takashi; Toki, Seiichi; Hidema, Jun

2013-07-01

UVB radiation suppresses photosynthesis and protein biosynthesis in plants, which in turn decreases growth and productivity. Here, an ultraviolet-B (UVB)-tolerant rice mutant, utr319 (UV Tolerant Rice 319), was isolated from a mutagenized population derived from 2500 M1 seeds (of the UVB-resistant cultivar 'Sasanishiki') that were exposed to carbon ions. The utr319 mutant was more tolerant to UVB than the wild type. Neither the levels of UVB-induced cyclobutane pyrimidine dimers (CPDs) or (6-4) pyrimidine-pyrimidone photodimers [(6-4) photoproducts], nor the repair of CPDs or (6-4) photoproducts, was altered in the utr319 mutant. Thus, the utr319 mutant may be impaired in the production of a previously unidentified factor that confers UVB tolerance. To identify the mutated region in the utr319 mutant, microarray-based comparative genomic hybridization analysis was performed. Two adjacent genes on chromosome 7, Os07g0264900 and Os07g0265100, were predicted to represent the mutant allele. Sequence analysis of the chromosome region in utr319 revealed a deletion of 45 419 bp. RNAi analysis indicated that Os07g0265100 is most likely the mutated gene. Database analysis indicated that the Os07g0265100 gene, UTR319, encodes a putative protein with unknown characteristics or function. In addition, the homologs of UTR319 are conserved only among land plants. Therefore, utr319 is a novel UVB-tolerant rice mutant and UTR319 may be crucial for the determination of UVB sensitivity in rice, although the function of UTR319 has not yet been determined.

Allelic variation of soybean flower color gene W4 encoding dihydroflavonol 4-reductase 2.

PubMed

Yan, Fan; Di, Shaokang; Rojas Rodas, Felipe; Rodriguez Torrico, Tito; Murai, Yoshinori; Iwashina, Tsukasa; Anai, Toyoaki; Takahashi, Ryoji

2014-03-06

Flower color of soybean is primarily controlled by six genes, viz., W1, W2, W3, W4, Wm and Wp. This study was conducted to investigate the genetic and chemical basis of newly-identified flower color variants including two soybean mutant lines, 222-A-3 (near white flower) and E30-D-1 (light purple flower), a near-isogenic line (Clark-w4), flower color variants (T321 and T369) descended from the w4-mutable line and kw4 (near white flower, Glycine soja). Complementation tests revealed that the flower color of 222-A-3 and kw4 was controlled by the recessive allele (w4) of the W4 locus encoding dihydroflavonol 4-reductase 2 (DFR2). In 222-A-3, a single base was deleted in the first exon resulting in a truncated polypeptide consisting of 24 amino acids. In Clark-w4, base substitution of the first nucleotide of the fourth intron abolished the 5' splice site, resulting in the retention of the intron. The DFR2 gene of kw4 was not expressed. The above results suggest that complete loss-of-function of DFR2 gene leads to near white flowers. Light purple flower of E30-D-1 was controlled by a new allele at the W4 locus, w4-lp. The gene symbol was approved by the Soybean Genetics Committee. In E30-D-1, a single-base substitution changed an amino acid at position 39 from arginine to histidine. Pale flowers of T369 had higher expression levels of the DFR2 gene. These flower petals contained unique dihydroflavonols that have not yet been reported to occur in soybean and G. soja. Complete loss-of-function of DFR2 gene leads to near white flowers. A new allele of the W4 locus, w4-lp regulates light purple flowers. Single amino acid substitution was associated with light purple flowers. Flower petals of T369 had higher levels of DFR2 gene expression and contained unique dihydroflavonols that are absent in soybean and G. soja. Thus, mutants of the DFR2 gene have unique flavonoid compositions and display a wide variety of flower color patterns in soybean, from near white, light purple

Relationship of HLA-B*51 and HLA-B*52 alleles and TNF-α-308A/G polymorphism with susceptibility to Takayasu arteritis: a meta-analysis.

PubMed

Chen, Si; Luan, Haixia; Li, Liubing; Zeng, Xiaoli; Wang, Tian; Li, Yongzhe; Yuan, Hui

2017-01-01

We performed a meta-analysis to determine whether combined evidence shows an association between HLA-B*51 and HLA-B*52 alleles and TNF-α-308A/G polymorphism and the susceptibility to Takayasu arteritis (TA). Relevant articles dated November 2015 were acquired from the PubMed, Embase and Cochrane databases. The number of genotypes and/or alleles for HLA-B*51 and HLA-B*52 alleles and TNF-α-308 A/G polymorphism in cases and control subjects was extracted, and statistical analysis was conducted using STATA 11.2 software. We included 20 studies with 1864 TA patients and 6973 controls. The HLA-B*52 allele was found to be associated with TA (pooled OR 3.91, 95 % CI 3.22-4.74, P < 0.0001). The meta-analysis of TNF-α-308 A/G polymorphism for the A allele vs. G allele (P = 0.006) and AA + AG vs. GG (P = 0.023) revealed a significant association with TA. However, we did not find that the HLA-B*51 allele was associated with TA. This meta-analysis demonstrated that the HLA-B*52 allele and TNF-α-308 A/G polymorphism may contribute to TA susceptibility.

Molecular analysis of hyperoxaluria type 1 in Italian patients reveals eight new mutations in the alanine: glyoxylate aminotransferase gene.

PubMed

Pirulli, D; Puzzer, D; Ferri, L; Crovella, S; Amoroso, A; Ferrettini, C; Marangella, M; Mazzola, G; Florian, F

1999-06-01

Systematic screening using the SSCP technique followed by sequencing of bands with abnormal mobility derived from the AGXT exons of 15 unrelated Italian patients with primary hyperoxaluria type 1 (PH1) allowed us to characterize both the mutant alleles in each individual. Eight new mutations were identified: C155del, C156ins, G244T, C252T, GAG408ins, G468A, G588A and G1098del. This study demonstrates both the effectiveness of the screening strategy chosen to identify all the mutant alleles and the high degree of allelic heterogeneity in PH1.

Molecular characterization of the new defective P(brescia) alpha1-antitrypsin allele.

PubMed

Medicina, Daniela; Montani, Nadia; Fra, Anna M; Tiberio, Laura; Corda, Luciano; Miranda, Elena; Pezzini, Alessandro; Bonetti, Fausta; Ingrassia, Rosaria; Scabini, Roberta; Facchetti, Fabio; Schiaffonati, Luisa

2009-08-01

Alpha1-antitrypsin (alpha(1)AT) deficiency is a hereditary disorder associated with reduced alpha(1)AT serum level, predisposing adults to pulmonary emphysema. Among the known mutations of the alpha(1)AT gene (SERPINA1) causing alpha(1)AT deficiency, a few alleles, particularly the Z allele, may also predispose adults to liver disease. We have characterized a new defective alpha(1)AT allele (c.745G>C) coding for a mutant alpha(1)AT (Gly225Arg), named P(brescia). The P(brescia) alpha(1)AT allele was first identified in combination with the rare defective M(würzburg) allele in an 11-year-old boy showing significantly reduced serum alpha(1)AT level. Subsequently, the P(brescia) allele was found in the heterozygous state with the normal M or the defective Z allele in nine and three adults respectively. In cellular models of the disease, we show that the P(brescia) mutant is retained in the endoplasmic reticulum as ordered polymers and is secreted more slowly than the normal M alpha(1)AT. This behaviour recapitulates the abnormal cellular handling and fate of the Z alpha(1)AT and suggests that the mutation present in the P(brescia) alpha(1)AT causes a conformational change of the protein which, by favouring polymer formation, is etiologic to both severe alpha(1)AT deficiency in the plasma and toxic protein-overload in the liver.

Selection of tRNA(Asp) amber suppressor mutants having alanine, arginine, glutamine, and lysine identity.

PubMed Central

Martin, F; Reinbolt, J; Dirheimer, G; Gangloff, J; Eriani, G

1996-01-01

Elements that confer identity to a tRNA in the cellular environment, where all aminoacyl-tRNA synthetases are competing for substrates, may be delineated by in vivo experiments using suppressor tRNAs. Here we describe the selection of active Escherichia coli tRNAAsp amber mutants and analyze their identity. Starting from a library containing randomly mutated tRNA(CUA)Asp genes, we isolated four amber suppressors presenting either lysine, alanine, or glutamine activity. Two of them, presenting mainly alanine or lysine activity, were further submitted to a second round of mutagenesis selection in order to improve their efficiency of suppression. Eleven suppressors were isolated, each containing two or three mutations. Ten presented identities of the two parental mutants, whereas one had switched from lysine to arginine identity. Analysis of the different mutants revealed (or confirmed for some nucleotides) their role as positive and/or negative determinants in AlaRS, LysRS, and ArgRS recognition. More generally, it appears that tRNAAsp presents identity characteristics closely related to those of tRNALys, as well as a structural basis for acquiring alanine or arginine identity upon moderate mutational changes; these consist of addition or suppression of the corresponding positive or negative determinants, as well as tertiary interactions. Failure to isolate aspartic acid-inserting suppressors is probably due to elimination of the important G34 identity element and its replacement by an antideterminant when changing the anticodon of the tRNAAsp to the CUA triplet. PMID:8809018

Determination of the Inactivating Alterations in Two Mutant Alleles of the Neurospora Crassa Cross-Pathway Control Gene Cpc-1

PubMed Central

Paluh, J. L.; Plamann, M.; Kruger, D.; Barthelmess, I. B.; Yanofsky, C.; Perkins, D. D.

1990-01-01

cpc-1 is the locus specifying what is believed to be the major trans-activating transcription factor that regulates expression of amino acid biosynthetic genes subject to cross-pathway control in Neurospora crassa. Mutants altered at this locus are incapable of the global increase in gene expression normally seen in response to amino acid starvation. Using polymerase chain reaction methodology we have cloned and sequenced the inactive mutant allele, cpc-1 (CD15). The cpc-1 (CD15) mutation was found to be a single base pair deletion in codon 93 of the cpc-1 structural gene. A second, presumed lethal, allele, cpc-1 (j-5), also was investigated. Northern analyses with strains carrying the cpc-1 (j-5) allele revealed that no cpc-1 mRNA is produced. Southern and genetic analyses established that the cpc-1 (j-5) mutation involved a chromosomal rearrangement in which a break occurred within the cpc-1 locus, normally resident on linkage group VI; a small fragment from the left arm of linkage group VI, containing the cpc-1 promoter region and ylo-1, was translocated to the right arm of linkage group I. Other studies indicate that the cpc-1 locus itself is not essential for viability. Lethality previously attributed to the cpc-1 (j-5) mutation is due instead to the production of progeny that are deficient for essential genes in an adjoining segment of linkage group VI. Molecular characterization of cpc-1 (j-5) X ylo-1 pan-2 duplication progeny indicated that cpc-1 is normally transcribed towards the linkage group VI centromere. PMID:2138111

Clustering of Genetically Defined Allele Classes in the Caenorhabditis elegans DAF-2 Insulin/IGF-1 Receptor

PubMed Central

Patel, Dhaval S.; Garza-Garcia, Acely; Nanji, Manoj; McElwee, Joshua J.; Ackerman, Daniel; Driscoll, Paul C.; Gems, David

2008-01-01

The DAF-2 insulin/IGF-1 receptor regulates development, metabolism, and aging in the nematode Caenorhabditis elegans. However, complex differences among daf-2 alleles complicate analysis of this gene. We have employed epistasis analysis, transcript profile analysis, mutant sequence analysis, and homology modeling of mutant receptors to understand this complexity. We define an allelic series of nonconditional daf-2 mutants, including nonsense and deletion alleles, and a putative null allele, m65. The most severe daf-2 alleles show incomplete suppression by daf-18(0) and daf-16(0) and have a range of effects on early development. Among weaker daf-2 alleles there exist distinct mutant classes that differ in epistatic interactions with mutations in other genes. Mutant sequence analysis (including 11 newly sequenced alleles) reveals that class 1 mutant lesions lie only in certain extracellular regions of the receptor, while class 2 (pleiotropic) and nonconditional missense mutants have lesions only in the ligand-binding pocket of the receptor ectodomain or the tyrosine kinase domain. Effects of equivalent mutations on the human insulin receptor suggest an altered balance of intracellular signaling in class 2 alleles. These studies consolidate and extend our understanding of the complex genetics of daf-2 and its underlying molecular biology. PMID:18245374

Transcriptional and proteomic analysis of the Aspergillus fumigatus ΔprtT protease-deficient mutant.

PubMed

Hagag, Shelly; Kubitschek-Barreira, Paula; Neves, Gabriela W P; Amar, David; Nierman, William; Shalit, Itamar; Shamir, Ron; Lopes-Bezerra, Leila; Osherov, Nir

2012-01-01

Aspergillus fumigatus is the most common opportunistic mold pathogen of humans, infecting immunocompromised patients. The fungus invades the lungs and other organs, causing severe damage. Penetration of the pulmonary epithelium is a key step in the infectious process. A. fumigatus produces extracellular proteases to degrade the host structural barriers. The A. fumigatus transcription factor PrtT controls the expression of multiple secreted proteases. PrtT shows similarity to the fungal Gal4-type Zn(2)-Cys(6) DNA-binding domain of several transcription factors. In this work, we further investigate the function of this transcription factor by performing a transcriptional and a proteomic analysis of the ΔprtT mutant. Unexpectedly, microarray analysis revealed that in addition to the expected decrease in protease expression, expression of genes involved in iron uptake and ergosterol synthesis was dramatically decreased in the ΔprtT mutant. A second finding of interest is that deletion of prtT resulted in the upregulation of four secondary metabolite clusters, including genes for the biosynthesis of toxic pseurotin A. Proteomic analysis identified reduced levels of three secreted proteases (ALP1 protease, TppA, AFUA_2G01250) and increased levels of three secreted polysaccharide-degrading enzymes in the ΔprtT mutant possibly in response to its inability to derive sufficient nourishment from protein breakdown. This report highlights the complexity of gene regulation by PrtT, and suggests a potential novel link between the regulation of protease secretion and the control of iron uptake, ergosterol biosynthesis and secondary metabolite production in A. fumigatus.

Identification and codon reading properties of 5-cyanomethyl uridine, a new modified nucleoside found in the anticodon wobble position of mutant haloarchaeal isoleucine tRNAs

PubMed Central

Mandal, Debabrata; Köhrer, Caroline; Su, Dan; Babu, I. Ramesh; Chan, Clement T.Y.; Liu, Yuchen; Söll, Dieter; Blum, Paul; Kuwahara, Masayasu; Dedon, Peter C.; RajBhandary, Uttam L.

2014-01-01

Most archaea and bacteria use a modified C in the anticodon wobble position of isoleucine tRNA to base pair with A but not with G of the mRNA. This allows the tRNA to read the isoleucine codon AUA without also reading the methionine codon AUG. To understand why a modified C, and not U or modified U, is used to base pair with A, we mutated the C34 in the anticodon of Haloarcula marismortui isoleucine tRNA (tRNA2Ile) to U, expressed the mutant tRNA in Haloferax volcanii, and purified and analyzed the tRNA. Ribosome binding experiments show that although the wild-type tRNA2Ile binds exclusively to the isoleucine codon AUA, the mutant tRNA binds not only to AUA but also to AUU, another isoleucine codon, and to AUG, a methionine codon. The G34 to U mutant in the anticodon of another H. marismortui isoleucine tRNA species showed similar codon binding properties. Binding of the mutant tRNA to AUG could lead to misreading of the AUG codon and insertion of isoleucine in place of methionine. This result would explain why most archaea and bacteria do not normally use U or a modified U in the anticodon wobble position of isoleucine tRNA for reading the codon AUA. Biochemical and mass spectrometric analyses of the mutant tRNAs have led to the discovery of a new modified nucleoside, 5-cyanomethyl U in the anticodon wobble position of the mutant tRNAs. 5-Cyanomethyl U is present in total tRNAs from euryarchaea but not in crenarchaea, eubacteria, or eukaryotes. PMID:24344322

Association of TNF-alpha (-308 A/G) and IFN-gamma (+874 A/T) gene polymorphisms in response to spontaneous and treatment induced viral clearance in HCV infected multitransfused thalassemic patients.

PubMed

Biswas, Aritra; Gupta, Nabyendu; Gupta, Debanjali; Datta, Abira; Firdaus, Rushna; Chowdhury, Prosanto; Bhattacharyya, Maitreyee; Sadhukhan, Provash C

2018-06-01

Multitransfused thalassemic individuals are at high risk of developing transfusion transmitted Hepatitis C virus (HCV) infection. The aim of the study was to correlate the effects of host cytokine single nucleotide polymorphisms of TNF-α (-308 A/G) and IFN-γ (+874 A/T) in spontaneous or IFN induced treatment response in the HCV infected thalassemic individuals. A total of 427 HCV sero-reactive thalassemic individuals were processed for HCV viral genomic diversity and host gene polymorphisms analysis of TNF-α (-308 A/G) and IFN-γ (+874 A/T). Out of 427 HCV sero-reactive individuals, 69.09% were found to be HCV RNA positive with genotype 3 as the predominant infecting strain (94.29%). Study highlighted that, A allele was significantly associated with (p < .05) spontaneous clearance of HCV infection and G allele was correlated with viral persistence at TNF-α (-308) gene polymorphism. Whereas in case of IFN-γ (+874) SNPs, A allele was significantly responsible (p < .05) for spontaneous clearance than T allele. Our study also indicated that in relapsed cases, IFN-γ (+874) T allele is more responsible than A allele. Though no significant correlation was found at both TNF-α (-308) and IFN-γ (+874) gene polymorphism among SVR and relapsed thalassemic patients. A allele at both TNF-α (-308) and IFN-γ (+874) were strongly associated with spontaneous clearance among this population. But in case of SVR and relapsed cases no significant association was found. This cytokine gene polymorphisms pattern will help clinicians to take an informed decision about therapeutic management of HCV infected thalassemic individuals. Copyright © 2017 Elsevier Ltd. All rights reserved.

Novel mutant-selective EGFR kinase inhibitors against EGFR T790M

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou, Wenjun; Ercan, Dalia; Chen, Liang

2010-01-12

The clinical efficacy of epidermal growth factor receptor (EGFR) kinase inhibitors in EGFR-mutant non-small-cell lung cancer (NSCLC) is limited by the development of drug-resistance mutations, including the gatekeeper T790M mutation. Strategies targeting EGFR T790M with irreversible inhibitors have had limited success and are associated with toxicity due to concurrent inhibition of wild-type EGFR. All current EGFR inhibitors possess a structurally related quinazoline-based core scaffold and were identified as ATP-competitive inhibitors of wild-type EGFR. Here we identify a covalent pyrimidine EGFR inhibitor by screening an irreversible kinase inhibitor library specifically against EGFR T790M. These agents are 30- to 100-fold more potentmore » against EGFR T790M, and up to 100-fold less potent against wild-type EGFR, than quinazoline-based EGFR inhibitors in vitro. They are also effective in murine models of lung cancer driven by EGFR T790M. Co-crystallization studies reveal a structural basis for the increased potency and mutant selectivity of these agents. These mutant-selective irreversible EGFR kinase inhibitors may be clinically more effective and better tolerated than quinazoline-based inhibitors. Our findings demonstrate that functional pharmacological screens against clinically important mutant kinases represent a powerful strategy to identify new classes of mutant-selective kinase inhibitors.« less

Influence of Combined Methionine Synthase (MTR 2756A > G) and Methylenetetrahydrofolate Reductase (MTHFR 677C > T) Polymorphisms to Plasma Homocysteine Levels in Korean Patients with Ischemic Stroke

PubMed Central

Kim, Ok Joon; Hong, Sun Pyo; Ahn, Jung Yong; Hong, Seung Ho; Hwang, Tae Sun; Kim, Soo Ok; Yoo, Wangdon; Oh, Doyeun

2007-01-01

Purpose Methionine synthase (MTR) and 5,10-methylenetetrahydrofolate reductase (MTHFR) are the main regulatory enzymes for homocysteine metabolism. The present case-control study was conducted to determine whether there is an association between the MTR 2756A > G or MTHFR 677C > T polymorphism and plasma homocysteine concentration in Korean subjects with ischemic stroke. Materials and Methods DNA samples of 237 patients who had an ischemic stroke and 223 age and sex-matched controls were studied. MTR 2756A > G and MTHFR 677C > T genotypes were determined by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Results Frequencies of mutant alleles for MTR and MTHFR polymorphisms were not significantly different between the controls and cases. The patient group, however, had significantly higher homocysteine concentrations of the MTR 2756AA and MTHFR 677TT genotypes than the control group (p = 0.04 for MTR, p = 0.01 for MTHFR). The combined MTR 2756AA and MTHFR 677TT genotype (p = 0.04) and the homocysteine concentrations of the patient group were also higher than those of the controls. In addition, the genotype distribution was significant in the MTHFR 677TT genotype (p = 0.008) and combined MTR 2756AA and MTHFR 677TT genotype (p = 0.03), which divided the groups into the top 20% and bottom 20% based on their homocysteine levels. Conclusion The results of the present study demonstrate that the MTR 2756A > G and MTHFR 677C > T polymorphisms interact with elevated total homocysteine (tHcy) levels, leading to an increased risk of ischemic stroke. PMID:17461517

Craving for alcohol and food during treatment for alcohol dependence: modulation by T allele of 1519T>C GABAAalpha6.

PubMed

Han, Doug Hyun; Bolo, Nicholas; Daniels, Melissa A; Lyoo, In Kyoon; Min, Kyung Joon; Kim, Chang Hyun; Renshaw, Perry F

2008-09-01

Craving for alcohol and food has been studied in association with alcohol dependence and eating disorders, respectively. One subclass of the gamma-aminobutyric acid (GABA) receptor, 1519T>C GABA(A)alpha6 has been reported to be associated with both alcohol dependence and weight gain. In this study, we hypothesized that patients being treated for alcohol dependence would report decreased craving for alcohol, but an increased craving for food during a 4-week treatment period. We further hypothesized that the T allele of the 1519T>C GABA(A)alpha6 gene would modulate the extent of changes in craving for alcohol and food. This study included 98 male inpatients being treated for alcohol dependence. A 7-point visual analog scale was applied to evaluate relative levels of alcohol and food craving at baseline and again 4 weeks later. Body weight was also checked at the same periods. Genotyping of the 1519T>C SNP in GABA(A)alpha6 was carried out by restriction fragment length polymorphism. There were significant changes in craving for alcohol and food in all patients with alcohol dependence. During the treatment period, body weight increased in all patients with alcohol dependence. Changes in alcohol and food craving in T-allele carriers (CT + TT) of 1519T>C GABA(A)alpha6 were greater than those observed in CC homozygotes. In T-allele carriers, body weight significantly increased and the changes in weight showed a negative correlation with the change in the craving for alcohol and a positive correlation with the changes in craving for food. The current results suggest that in T-allele carriers the change in craving for alcohol during treatment for alcohol dependence is negatively associated with changes in craving for food. The T allele of the 1519T>C GABA(A)alpha6 gene may be one of the modulating factors associated with changes in craving for alcohol and food during treatment of patients with alcohol dependence.

Cold-sensitive mutants G680V and G691C of Dictyostelium myosin II confer dramatically different biochemical defects.

PubMed

Patterson, B; Ruppel, K M; Wu, Y; Spudich, J A

1997-10-31

Cold-sensitive myosin mutants represent powerful tools for dissecting discrete deficiencies in myosin function. Biochemical characterization of two such mutants, G680V and G691C, has allowed us to identify separate facets of myosin motor function perturbed by each alteration. Compared with wild type, the G680V myosin exhibits a substantially enhanced affinity for several nucleotides, decreased ATPase activity, and overoccupancy or creation of a novel strongly actin-binding state. The properties of the novel strong binding state are consistent with a partial arrest or pausing at the onset of the mechanical stroke. The G691C mutant, on the other hand, exhibits an elevated basal ATPase indicative of premature phosphate release. By releasing phosphate without a requirement for actin binding, the G691C can bypass the part of the cycle involving the mechanical stroke. The two mutants, despite having alterations in glycine residues separated by only 11 residues, have dramatically different consequences on the mechanochemical cycle.

Rapid detection of common Chinese glucose-6-phosphate dehydrogenase (G6PD) mutations by denaturing gradient gel electrophoresis (DGGE).

PubMed

Lam, V M; Huang, W; Lam, S T; Yeung, C Y; Johnson, P H

1996-03-01

We describe here the use of denaturing gradient gel electrophoresis (DGGE) to detect the most common Chinese glucose-6-phosphate dehydrogenase (G6PD) variants, which are the single point mutations: G-->T at nt 1376, G-->A at 1388 both in exon 12 and A-->G at nt 95 in exon 02. In each case, the mutant allele resolves well from the normal allele(s). The distinct heteroduplex bands are characteristic of a particular genotype suggesting that this feature is very useful for identifying all heterozygous carriers for this and other X-linked diseases. When the analysis is extended to other exons, DGGE scans the gene and coupled with direct sequencing, it leads to the identification of new G6PD variation(s). With this approach, we identified a mutation in exon 9 which had not been reported in Hong Kong. Since DGGE can rapidly screen many unknown samples in one gel, this approach could be used to diagnose these G6PD mutations and to identify the at-risk for counselling.

G Protein–Coupled Receptor-Type G Proteins Are Required for Light-Dependent Seedling Growth and Fertility in Arabidopsis[W

PubMed Central

Jaffé, Felix W.; Freschet, Gian-Enrico C.; Valdes, Billy M.; Runions, John; Terry, Matthew J.; Williams, Lorraine E.

2012-01-01

G protein–coupled receptor-type G proteins (GTGs) are highly conserved membrane proteins in plants, animals, and fungi that have eight to nine predicted transmembrane domains. They have been classified as G protein–coupled receptor-type G proteins that function as abscisic acid (ABA) receptors in Arabidopsis thaliana. We cloned Arabidopsis GTG1 and GTG2 and isolated new T-DNA insertion alleles of GTG1 and GTG2 in both Wassilewskija and Columbia backgrounds. These gtg1 gtg2 double mutants show defects in fertility, hypocotyl and root growth, and responses to light and sugars. Histological studies of shoot tissue reveal cellular distortions that are particularly evident in the epidermal layer. Stable expression of GTG1pro:GTG1-GFP (for green fluorescent protein) in Arabidopsis and transient expression in tobacco (Nicotiana tabacum) indicate that GTG1 is localized primarily to Golgi bodies and to the endoplasmic reticulum. Microarray analysis comparing gene expression profiles in the wild type and double mutant revealed differences in expression of genes important for cell wall function, hormone response, and amino acid metabolism. The double mutants isolated here respond normally to ABA in seed germination assays, root growth inhibition, and gene expression analysis. These results are inconsistent with their proposed role as ABA receptors but demonstrate that GTGs are fundamentally important for plant growth and development. PMID:23001037

GATA3 Abundance Is a Critical Determinant of T Cell Receptor β Allelic Exclusion

PubMed Central

Ku, Chia-Jui; Sekiguchi, JoAnn M.; Panwar, Bharat; Guan, Yuanfang; Takahashi, Satoru; Yoh, Keigyou; Maillard, Ivan; Hosoya, Tomonori

2017-01-01

ABSTRACT Allelic exclusion describes the essential immunological process by which feedback repression of sequential DNA rearrangements ensures that only one autosome expresses a functional T or B cell receptor. In wild-type mammals, approximately 60% of cells have recombined the DNA of one T cell receptor β (TCRβ) V-to-DJ-joined allele in a functional configuration, while the second allele has recombined only the DJ sequences; the other 40% of cells have recombined the V to the DJ segments on both alleles, with only one of the two alleles predicting a functional TCRβ protein. Here we report that the transgenic overexpression of GATA3 leads predominantly to biallelic TCRβ gene (Tcrb) recombination. We also found that wild-type immature thymocytes can be separated into distinct populations based on intracellular GATA3 expression and that GATA3LO cells had almost exclusively recombined only one Tcrb locus (that predicted a functional receptor sequence), while GATA3HI cells had uniformly recombined both Tcrb alleles (one predicting a functional and the other predicting a nonfunctional rearrangement). These data show that GATA3 abundance regulates the recombination propensity at the Tcrb locus and provide new mechanistic insight into the historic immunological conundrum for how Tcrb allelic exclusion is mediated. PMID:28320875

neu mutation in schwannomas induced transplacentally in Syrian golden hamsters by N-nitrosoethylurea: high incidence but low allelic representation.

PubMed

Buzard, G S; Enomoto, T; Hongyo, T; Perantoni, A O; Diwan, B A; Devor, D E; Reed, C D; Dove, L F; Rice, J M

1999-10-01

Peripheral nerve tumors (PNT) and melanomas induced transplacentally on day 14 of gestation in Syrian golden hamsters by N-nitrosoethylurea were analyzed for activated oncogenes by the NIH 3T3 transfection assay, and for mutations in the neu oncogene by direct sequencing, allele-specific oligonucleotide hybridization, MnlI restriction-fragment-length polymorphism, single-strand conformation polymorphism, and mismatch amplification mutation assays. All (67/67) of the PNT, but none of the melanomas, contained a somatic missense T --> A transversion within the neu oncogene transmembrane domain at a site corresponding to that which also occurs in rat schwannomas transplacentally induced by N-nitrosoethylurea. In only 2 of the 67 individual hamster PNT did the majority of tumor cells appear to carry the mutant neu allele, in contrast to comparable rat schwannomas in which it overwhelmingly predominates. The low fraction of hamster tumor cells carrying the mutation was stable through multiple transplantation passages. In the hamster, as in the rat, specific point-mutational activation of the neu oncogene thus constitutes the major pathway for induction of PNT by transplacental exposure to an alkylating agent, but the low allelic representation of mutant neu in hamster PNT suggests a significant difference in mechanism by which the mutant oncogene acts in this species.

Evaluation of Allele-Specific Somatic Changes of Genome-Wide Association Study Susceptibility Alleles in Human Colorectal Cancers

PubMed Central

Gerber, Madelyn M.; Hampel, Heather; Schulz, Nathan P.; Fernandez, Soledad; Wei, Lai; Zhou, Xiao-Ping; de la Chapelle, Albert; Toland, Amanda Ewart

2012-01-01

Background Tumors frequently exhibit loss of tumor suppressor genes or allelic gains of activated oncogenes. A significant proportion of cancer susceptibility loci in the mouse show somatic losses or gains consistent with the presence of a tumor susceptibility or resistance allele. Thus, allele-specific somatic gains or losses at loci may demarcate the presence of resistance or susceptibility alleles. The goal of this study was to determine if previously mapped susceptibility loci for colorectal cancer show evidence of allele-specific somatic events in colon tumors. Methods We performed quantitative genotyping of 16 single nucleotide polymorphisms (SNPs) showing statistically significant association with colorectal cancer in published genome-wide association studies (GWAS). We genotyped 194 paired normal and colorectal tumor DNA samples and 296 paired validation samples to investigate these SNPs for allele-specific somatic gains and losses. We combined analysis of our data with published data for seven of these SNPs. Results No statistically significant evidence for allele-specific somatic selection was observed for the tested polymorphisms in the discovery set. The rs6983267 variant, which has shown preferential loss of the non-risk T allele and relative gain of the risk G allele in previous studies, favored relative gain of the G allele in the combined discovery and validation samples (corrected p-value = 0.03). When we combined our data with published allele-specific imbalance data for this SNP, the G allele of rs6983267 showed statistically significant evidence of relative retention (p-value = 2.06×10−4). Conclusions Our results suggest that the majority of variants identified as colon cancer susceptibility alleles through GWAS do not exhibit somatic allele-specific imbalance in colon tumors. Our data confirm previously published results showing allele-specific imbalance for rs6983267. These results indicate that allele-specific imbalance of cancer

Intratumoral heterogeneity in EGFR mutant NSCLC results in divergent resistance mechanisms in response to EGFR tyrosine kinase inhibition

PubMed Central

Soucheray, Margaret; Capelletti, Marzia; Pulido, Inés; Kuang, Yanan; Paweletz, Cloud P.; Becker, Jeffrey H.; Kikuchi, Eiki; Xu, Chunxiao; Patel, Tarun B.; Al-shahrour, Fatima; Carretero, Julián; Wong, Kwok-Kin; Jänne, Pasi A.; Shapiro, Geoffrey I.; Shimamura, Takeshi

2015-01-01

Non-small cell lung cancers (NSCLC) that have developed resistance to epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs), including gefitinib and erlotinib, are clinically linked to an epithelial-to-mesenchymal transition (EMT) phenotype. Here we examined whether modulating EMT maintains the responsiveness of EGFR-mutated NSCLCs to EGFR TKI therapy. Using human NSCLC cell lines harboring mutated-EGFR and a transgenic mouse model of lung cancer driven by mutant EGFR (EGFR-Del19-T790M), we demonstrate that EGFR inhibition induces TGFβ secretion followed by SMAD pathway activation, an event that promotes EMT. Chronic exposure of EGFR-mutated NSCLC cells to TGFβ was sufficient to induce EMT and resistance to EGFR TKI treatment. Furthermore, NSCLC HCC4006 cells with acquired resistance to gefitinib were characterized by a mesenchymal phenotype and displayed a higher prevalence of the EGFR T790M mutated allele. Notably, combined inhibition of EGFR and the TGFβ receptor in HCC4006 cells prevented EMT, but was not sufficient to prevent acquired gefitinib resistance because of an increased emergence of the EGFR T790M allele compared to cells treated with gefitinib alone. Conversely, another independent NSCLC cell line, PC9, reproducibly develops EGFR T790M mutations as the primary mechanism underlying EGFR TKI resistance, even though the prevalence of the mutant allele is lower than that in HCC4006 cells. Thus, our findings underscore heterogeneity within NSCLC cells lines harboring EGFR kinase domain mutations that give rise to divergent resistance mechanisms in response to treatment and anticipate the complexity of EMT suppression as a therapeutic strategy. PMID:26282169

Isolation of a novel UVB-tolerant rice mutant obtained by exposure to carbon-ion beams

PubMed Central

Takano, Nao; Takahashi, Yuko; Yamamoto, Mitsuru; Teranishi, Mika; Yamaguchi, Hiroko; Sakamoto, Ayako N.; Hase, Yoshihiro; Fujisawa, Hiroko; Wu, Jianzhong; Matsumoto, Takashi; Toki, Seiichi; Hidema, Jun

2013-01-01

UVB radiation suppresses photosynthesis and protein biosynthesis in plants, which in turn decreases growth and productivity. Here, an ultraviolet-B (UVB)-tolerant rice mutant, utr319 (UV Tolerant Rice 319), was isolated from a mutagenized population derived from 2500 M1 seeds (of the UVB-resistant cultivar ‘Sasanishiki’) that were exposed to carbon ions. The utr319 mutant was more tolerant to UVB than the wild type. Neither the levels of UVB-induced cyclobutane pyrimidine dimers (CPDs) or (6-4) pyrimidine-pyrimidone photodimers [(6-4) photoproducts], nor the repair of CPDs or (6-4) photoproducts, was altered in the utr319 mutant. Thus, the utr319 mutant may be impaired in the production of a previously unidentified factor that confers UVB tolerance. To identify the mutated region in the utr319 mutant, microarray-based comparative genomic hybridization analysis was performed. Two adjacent genes on chromosome 7, Os07g0264900 and Os07g0265100, were predicted to represent the mutant allele. Sequence analysis of the chromosome region in utr319 revealed a deletion of 45 419 bp. RNAi analysis indicated that Os07g0265100 is most likely the mutated gene. Database analysis indicated that the Os07g0265100 gene, UTR319, encodes a putative protein with unknown characteristics or function. In addition, the homologs of UTR319 are conserved only among land plants. Therefore, utr319 is a novel UVB-tolerant rice mutant and UTR319 may be crucial for the determination of UVB sensitivity in rice, although the function of UTR319 has not yet been determined. PMID:23381954

Conformation and Stability of Intramolecular Telomeric G-Quadruplexes: Sequence Effects in the Loops

PubMed Central

Sattin, Giovanna; Artese, Anna; Nadai, Matteo; Costa, Giosuè; Parrotta, Lucia; Alcaro, Stefano; Palumbo, Manlio; Richter, Sara N.

2013-01-01

Telomeres are guanine-rich sequences that protect the ends of chromosomes. These regions can fold into G-quadruplex structures and their stabilization by G-quadruplex ligands has been employed as an anticancer strategy. Genetic analysis in human telomeres revealed extensive allelic variation restricted to loop bases, indicating that the variant telomeric sequences maintain the ability to fold into G-quadruplex. To assess the effect of mutations in loop bases on G-quadruplex folding and stability, we performed a comprehensive analysis of mutant telomeric sequences by spectroscopic techniques, molecular dynamics simulations and gel electrophoresis. We found that when the first position in the loop was mutated from T to C or A the resulting structure adopted a less stable antiparallel topology; when the second position was mutated to C or A, lower thermal stability and no evident conformational change were observed; in contrast, substitution of the third position from A to C induced a more stable and original hybrid conformation, while mutation to T did not significantly affect G-quadruplex topology and stability. Our results indicate that allelic variations generate G-quadruplex telomeric structures with variable conformation and stability. This aspect needs to be taken into account when designing new potential anticancer molecules. PMID:24367632

Association of Nitric Oxide Levels and Endothelial Nitric Oxide Synthase G894T Polymorphism with Coronary Artery Disease in the Iranian Population

PubMed Central

Mahmoodi, Khalil; Nasehi, Leila; Karami, Elham; Soltanpour, Mohammad Soleiman

2016-01-01

Purpose: The endothelial nitric oxide synthase (eNOS) G894T polymorphism has been reported to cause endothelial dysfunction and may have a role in the development of coronary artery disease (CAD). The aim of the present study was to investigate the association of eNOS G894T genetic polymorphism and plasma levels of nitric oxide (NO) with CAD risk in an Iranian population. Materials and Methods: We studied 200 patients with angiographically documented CAD and 100 matched controls. Analysis of G894T genetic polymorphism of eNOS was performed by polymerase chain reaction-restriction fragment length polymorphism method. Plasma levels of NO were determined using Griess method. Biochemical analysis was conducted by routine colorimetric methods. Results: Plasma levels of NO were significantly lower in CAD patients than control subjects (41.60±12.70 vs. 55.48±16.57, P=0.001). Also, the mean plasma levels of NO were significantly lower in T allele carriers of eNOS G894T polymorphism than G allele carriers (P<0.001). The genotype distribution and minor T allele frequency of eNOS G894T polymorphism significantly differed between CAD patients and control subjects (P<0.05). However, no significant association was found between the eNOS G894T polymorphism and the severity of CAD (number of diseased vessel) or the lipid profile of CAD patients (P>0.05). Conclusion: Reduced plasma level of NO is associated with increased risk of CAD in our population. Moreover, eNOS G894T polymorphism is a significant risk factor for CAD development via reducing the plasma levels of NO. However, eNOS G894T polymorphism is not a contributing factor for the severity of CAD. PMID:27699157

A novel RNase G mutant that is defective in degradation of adhE mRNA but proficient in the processing of 16S rRNA precursor.

PubMed

Wachi, M; Kaga, N; Umitsuki, G; Clark, D P; Nagai, K

2001-12-21

Escherichia coli RNase G, encoded by the rng gene, is involved in both the processing of 16S rRNA precursor and the degradation of adhE mRNA. Consequently, defects in RNase G result in elevation of AdhE levels. Furthermore, the adhR430 mutant strain, DC430, is reported to overproduce the AdhE protein in a manner dependent on the adhC81 mutation. We found that overproduction of AdhE by DC430 was reversed to wild-type levels by introduction of a plasmid carrying the wild-type allele of rng. Mapping by P1-phage-mediated transduction also indicated that a mutation involved in AdhE overproduction was located around the rng region in DC430. DNA sequencing of the rng region revealed that DC430 indeed had a mutation in the rng gene: a G1022 to A transition that caused substitution of Gly341 with Ser and which was named rng430. This lies in the highly conserved region of the RNase E/RNase G family, called high similarity region 2 (HSR2). However, very interestingly, rng430 mutant strains did not accumulate the 16.3S precursor of 16S rRNA unlike rng::cat mutants. We also found that the Rng1 mutant protein, which is truncated in its C-terminal domain encompassing HSR2, exhibited a residual processing activity against the 16S rRNA precursor, when overproduced. These results indicate that the HSR2 of RNase G plays an important role in substrate recognition and/or ribonucleolytic action.

Complement factor H gene (CFH) polymorphisms C-257T, G257A and haplotypes are associated with protection against severe dengue phenotype, possible related with high CFH expression

PubMed Central

Pastor, André F.; Moura, Laís Rodrigues; Neto, José W.D.; Nascimento, Eduardo J.M.; Calzavara-Silva, Carlos E.; Gomes, Ana Lisa V.; da Silva, Ana Maria; Cordeiro, Marli T.; Braga-Neto, Ulisses; Crovella, Sergio; Gil, Laura H.V.G.; Marques, Ernesto T.A.; Acioli-Santos, Bartolomeu

2013-01-01

Four genetic polymorphisms located at the promoter (C-257T) and coding regions of CFH gene (exon 2 G257A, exon 14 A2089G and exon 19 G2881T) were investigated in 121 dengue patients (DENV-3) in order to assess the relationship between allele/haplotypes variants and clinical outcomes. A statistical value was found between the CFH-257T allele (TT/TC genotypes) and reduced susceptibility to severe dengue (SD). Statistical associations indicate that individuals bearing a T allele presented significantly higher protein levels in plasma. The –257T variant is located within a NF-κB binding site, suggesting that this variant might have effect on the ability of the CFH gene to respond to signals via the NF-κB pathway. The G257A allelic variant showed significant protection against severe dengue. When CFH haplotypes effect was considered, the ancestral CG/CG promoter-exon 2 SNP genotype showed significant risk to SD either in a general comparison (ancestral × all variant genotypes), as well as in individual genotypes comparison (ancestral × each variant genotype), where the most prevalent effect was observed in the CG/CG × CA/TG comparison. These findings support the involvement of –257T, 257A allele variants and haplotypes on severe dengue phenotype protection, related with high basal CFH expression. PMID:23747994

A new spontaneous allele at the pink-eyed dilution (p) locus discovered in Mus musculus castaneus.

PubMed

Tsuji, A; Wakayama, T; Ishikawa, A

1995-10-01

Mutant mice characterized by a cream coat and pink eyes were spontaneously discovered among the descendants of Indonesian wild mice (Mus musculus castaneus). This mutant phenotype was controlled by a single autosomal recessive gene that was allelic to the pink-eyed dilution (p) gene. The mutant mouse phenotypically resembled the original p mouse which was the first mutant identified at this locus. Nevertheless, these two alleles differed in origin, a previous report suggesting that the original p allele was derived from Japanese wild mice (M. m. molossinus). Thus the symbol pcas (pink-eyed castaneus) was proposed for the present mutation allele.

Readressing the role of Toll-like receptor-4 alleles in inflammatory bowel disease: colitis, smoking, and seroreactivity.

PubMed

Manolakis, Anastassios C; Kapsoritakis, Andreas N; Kapsoritaki, Anastasia; Tiaka, Elisavet K; Oikonomou, Konstantinos A; Lotis, Vassilis; Vamvakopoulou, Dimitra; Davidi, Ioanna; Vamvakopoulos, Nikolaos; Potamianos, Spyros P

2013-02-01

Toll-like receptor (TLR) polymorphisms, and especially TLR-4 Asp299Gly and TLR-4 Thr399Ile, have been linked with Crohn's disease (CD) and to a lesser extent with ulcerative colitis (UC), CD behavior, and compromised seroreactivity to microbial antigens. Available data, however, are conflicting. To address these issues, the distribution of TLR-4 polymorphic alleles was assessed in patients with UC, CD, and healthy controls (HC), considering patient and disease characteristics as well as related serological markers. TLR-4 Asp299Gly and TLR-4 Thr399Ile polymorphisms were determined in 187 UC and 163 CD patients and 274 randomly selected HC. C reactive protein, anti-Saccharomyces cerevisiae mannan antibodies, anti-mannobioside carbohydrate antibodies, anti-laminariobioside carbohydrate antibodies IgG, and anti-chitobioside carbohydrate antibodies (ACCA) IgA levels were also assessed. UC and especially pancolitis patients carried the mutant alleles more frequently compared to CD patients and HC or UC patients with different disease extents (P = 0.002 and P < 0.0001, respectively). Involvement of the colon was more frequent in CD patients with mutant TLR-4 compared to those with wild-type alleles (P = 0.004). Levels and positivity rates of ACCA IgA were lower in inflammatory bowel disease (IBD) patients carrying the mutant compared to those with wild-type alleles (0.075 < P < 0.05). Despite the mutant TLR-4 predisposition for UC pancolitis, smoking was associated with more limited disease (P < 0.001). The presence of TLR-4 Asp299Gly and TLR-4 Thr399Ile polymorphisms is related to UC pancolitis, involvement of the colon in CD, and lower ACCA IgA levels. Smoking reduces the extent of UC, even in the presence of mutant alleles.

EOMES-positive CD4+ T cells are increased in PTPN22 (1858T) risk allele carriers.

PubMed

Chemin, Karine; Ramsköld, Daniel; Diaz-Gallo, Lina-Marcela; Herrath, Jessica; Houtman, Miranda; Tandre, Karolina; Rönnblom, Lars; Catrina, Anca; Malmström, Vivianne

2018-04-01

The presence of the PTPN22 risk allele (1858T) is associated with several autoimmune diseases including rheumatoid arthritis (RA). Despite a number of studies exploring the function of PTPN22 in T cells, the exact impact of the PTPN22 risk allele on T-cell function in humans is still unclear. In this study, using RNA sequencing, we show that, upon TCR-activation, naïve human CD4 + T cells homozygous for the PTPN22 risk allele overexpress a set of genes including CFLAR and 4-1BB, which are important for cytotoxic T-cell differentiation. Moreover, the protein expression of the T-box transcription factor Eomesodermin (EOMES) was increased in T cells from healthy donors homozygous for the PTPN22 risk allele and correlated with a decreased number of naïve CD4 + T cells. There was no difference in the frequency of other CD4 + T-cell subsets (Th1, Th17, Tfh, Treg). Finally, an accumulation of EOMES + CD4 + T cells was observed in synovial fluid of RA patients with a more pronounced production of Perforin-1 in PTPN22 risk allele carriers. Altogether, we propose a novel mechanism of action of PTPN22 risk allele through the generation of cytotoxic CD4 + T cells and identify EOMES + CD4 + T cells as a relevant T-cell subset in RA pathogenesis. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Comparison of allele-specific PCR, created restriction-site PCR, and PCR with primer-introduced restriction analysis methods used for screening complex vertebral malformation carriers in Holstein cattle

PubMed Central

Altınel, Ahmet

2017-01-01

Complex vertebral malformation (CVM) is an inherited, autosomal recessive disorder of Holstein cattle. The aim of this study was to compare sensitivity, specificity, positive and negative predictive values, accuracy, and rapidity of allele-specific polymerase chain reaction (AS-PCR), created restriction-site PCR (CRS-PCR), and PCR with primer-introduced restriction analysis (PCR-PIRA), three methods used in identification of CVM carriers in a Holstein cattle population. In order to screen for the G>T mutation in the solute carrier family 35 member A3 (SLC35A3) gene, DNA sequencing as the gold standard method was used. The prevalence of carriers and the mutant allele frequency were 3.2% and 0.016, respectively, among Holstein cattle in the Thrace region of Turkey. Among the three methods, the fastest but least accurate was AS-PCR. Although the rapidity of CRS-PCR and PCR-PIRA were nearly equal, the accuracy of PCR-PIRA was higher than that of CRS-PCR. Therefore, among the three methods, PCR-PIRA appears to be the most efficacious for screening of mutant alleles when identifying CVM carriers in a Holstein cattle population. PMID:28927256

Interactions between the APOA5 -1131T>C and the FEN1 10154G>T polymorphisms on ω6 polyunsaturated fatty acids in serum phospholipids and coronary artery disease

PubMed Central

Park, Ju Yeon; Paik, Jean Kyung; Kim, Oh Yoen; Chae, Jey Sook; Jang, Yangsoo; Lee, Jong Ho

2010-01-01

We determined the contribution of the combination of FEN1 10154G>T with the most significant association in the analysis of plasma arachidonic acid (AA, 20:4ω6) and the APOA5-1131T>C on phospholipid ω6PUFA and coronary artery disease (CAD). Patients with CAD (n = 807, 27–81 years of age) and healthy controls (n = 1123) were genotyped for FEN1 10154G>T and APOA5-1131T>C. We found a significant interaction between these two genes for CAD risk (P = 0.007) adjusted for confounding factors. APOA5-1131C allele carriers had a higher CAD risk [odds ratio (OR):1.484, 95% confidence interval (CI):1.31–1.96; P = 0.005] compared with APOA5-1131TT individuals in the FEN1 10154GG genotype group but not in the FEN1 10154T allele group (OR:1.096, 95%CI:0.84–1.43; P = 0.504). Significant interactions between these two genes were also observed for the AA proportion (P = 0.04) and the ratio of AA/linoleic acid (LA, 18:2ω6) (P = 0.004) in serum phospholipids of controls. The APOA5-1131C allele was associated with lower AA (P = 0.027) and AA/LA (P = 0.014) only in controls carrying the FEN1 10154T allele. In conclusion, the interaction between these genes suggests that the FEN1 10154T variant allele decreases AA and AA/LA in the serum phospholipids of carriers of the APOA5-1131C allele, but contributes no significant increase in CAD risk for this population subset despite their increased triglylcerides and decreased apoA5. PMID:20802161

Polymorphism of the PAI-1gene (4G/5G) may be linked with Polycystic Ovary Syndrome and associated pregnancy disorders in South Indian Women

PubMed Central

Mary, Maniraja Jesintha; Saravanan, Lakshmanan; Deecaraman, Munuswamy; Vijayalakshmi, Melantharu; Umashankar, Vetrivel; Sailaja, Jaigopal

2017-01-01

Polycystic Ovary syndrome (PCOS) is the most common endocrine disorder affecting 5 - 10% of all women of reproductive age group. The present research was carried out to study the impact of Plasminogen Activator Inhibitor (PAI-1) 4G/5G polymorphism (rs1799889) in PCOS, and the risk of developing PCOS in South Indian Population. The study was carried out in 60 subjects of South Indian population (30 PCOS and 30 Non PCOS) recruited from ARC Research and Fertility Centre, Chennai, India. Genotype and Allelic frequencies were compared by Fisher exact test, Hardy Weinberg equilibrium. p<0.05 was considered statistically significant. The Genotype frequency difference between PCOS and non-PCOS was observed as statistically non-significant (p=0.4647, OR=1.3077, 95% CI 0.63-2.68). The allelic frequency distribution in Spontaneous Abortion (SAB) cases in total subjects is not found to be statistically significant (p=0. 29), however the PCOS women carrying mutant homozygous and heterozygous genotype are more prone to recurrent pregnancy loss. Out of 17 Implantation failure cases, 23.52% were found to carry mutant homozygous (4G/4G), and 66.66% carried mutant heterozygous (4G/5G), and 5.88% carried wild type homozygous (5G/5G), the allelic difference was highly significant with 4G (62.5%), and 5G (37.5%). P value is highly significant and recorded at p=0.0164. The positive correlation between PAI-1 4G/5G polymorphism and PCOS risk was not observed in this study, however, the correlation between Recurrent Pregnancy Loss (RPL) and Implantation failures were observed in PCOS cases. PMID:28690381

Polymorphism of the PAI-1gene (4G/5G) may be linked with Polycystic Ovary Syndrome and associated pregnancy disorders in South Indian Women.

PubMed

Mary, Maniraja Jesintha; Saravanan, Lakshmanan; Deecaraman, Munuswamy; Vijayalakshmi, Melantharu; Umashankar, Vetrivel; Sailaja, Jaigopal

2017-01-01

Polycystic Ovary syndrome (PCOS) is the most common endocrine disorder affecting 5 - 10% of all women of reproductive age group. The present research was carried out to study the impact of Plasminogen Activator Inhibitor (PAI-1) 4G/5G polymorphism (rs1799889) in PCOS, and the risk of developing PCOS in South Indian Population. The study was carried out in 60 subjects of South Indian population (30 PCOS and 30 Non PCOS) recruited from ARC Research and Fertility Centre, Chennai, India. Genotype and Allelic frequencies were compared by Fisher exact test, Hardy Weinberg equilibrium. p<0.05 was considered statistically significant. The Genotype frequency difference between PCOS and non-PCOS was observed as statistically non-significant (p=0.4647, OR=1.3077, 95% CI 0.63-2.68). The allelic frequency distribution in Spontaneous Abortion (SAB) cases in total subjects is not found to be statistically significant (p=0. 29), however the PCOS women carrying mutant homozygous and heterozygous genotype are more prone to recurrent pregnancy loss. Out of 17 Implantation failure cases, 23.52% were found to carry mutant homozygous (4G/4G), and 66.66% carried mutant heterozygous (4G/5G), and 5.88% carried wild type homozygous (5G/5G), the allelic difference was highly significant with 4G (62.5%), and 5G (37.5%). P value is highly significant and recorded at p=0.0164. The positive correlation between PAI-1 4G/5G polymorphism and PCOS risk was not observed in this study, however, the correlation between Recurrent Pregnancy Loss (RPL) and Implantation failures were observed in PCOS cases.

Allele-specific Characterization of Alanine: Glyoxylate Aminotransferase Variants Associated with Primary Hyperoxaluria

PubMed Central

Lage, Melissa D.; Pittman, Adrianne M. C.; Roncador, Alessandro; Cellini, Barbara; Tucker, Chandra L.

2014-01-01

Primary Hyperoxaluria Type 1 (PH1) is a rare autosomal recessive kidney stone disease caused by deficiency of the peroxisomal enzyme alanine: glyoxylate aminotransferase (AGT), which is involved in glyoxylate detoxification. Over 75 different missense mutations in AGT have been found associated with PH1. While some of the mutations have been found to affect enzyme activity, stability, and/or localization, approximately half of these mutations are completely uncharacterized. In this study, we sought to systematically characterize AGT missense mutations associated with PH1. To facilitate analysis, we used two high-throughput yeast-based assays: one that assesses AGT specific activity, and one that assesses protein stability. Approximately 30% of PH1-associated missense mutations are found in conjunction with a minor allele polymorphic variant, which can interact to elicit complex effects on protein stability and trafficking. To better understand this allele interaction, we functionally characterized each of 34 mutants on both the major (wild-type) and minor allele backgrounds, identifying mutations that synergize with the minor allele. We classify these mutants into four distinct categories depending on activity/stability results in the different alleles. Twelve mutants were found to display reduced activity in combination with the minor allele, compared with the major allele background. When mapped on the AGT dimer structure, these mutants reveal localized regions of the protein that appear particularly sensitive to interactions with the minor allele variant. While the majority of the deleterious effects on activity in the minor allele can be attributed to synergistic interaction affecting protein stability, we identify one mutation, E274D, that appears to specifically affect activity when in combination with the minor allele. PMID:24718375

CpG methylation of a silent controlling element in the murine Avy allele is incomplete and unresponsive to methyl donor supplementation.

PubMed

Cropley, Jennifer E; Suter, Catherine M; Beckman, Kenneth B; Martin, David I K

2010-02-04

The viable yellow allele of agouti (A(vy)) is remarkable for its unstable and partially heritable epigenetic state, which produces wide variation in phenotypes of isogenic mice. In the A(vy) allele an inserted intracisternal A particle (IAP) acts as a controlling element which deregulates expression of agouti by transcription from the LTR of the IAP; the phenotypic state has been linked to CpG methylation of the LTR. Phenotypic variation between A(vy) mice indicates that the epigenetic state of the IAP is unstable in the germline. We have made a detailed examination of somatic methylation of the IAP using bisulphite allelic sequencing, and find that the promoter is incompletely methylated even when it is transcriptionally silent. In utero exposure to supplementary methyl donors, which alters the spectrum of A(vy) phenotypes, does not increase the density of CpG methylation in the silent LTR. Our findings suggest that, contrary to previous supposition, methyl donor supplementation acts through an indirect mechanism to silence A(vy). The incomplete cytosine methylation we observe at the somatically silent A(vy) allele may reflect its unstable germline state, and the influence of epigenetic modifications underlying CpG methylation.

CpG Methylation of a Silent Controlling Element in the Murine Avy Allele Is Incomplete and Unresponsive to Methyl Donor Supplementation

PubMed Central

Cropley, Jennifer E.; Suter, Catherine M.; Beckman, Kenneth B.; Martin, David I. K.

2010-01-01

Background The viable yellow allele of agouti (Avy) is remarkable for its unstable and partially heritable epigenetic state, which produces wide variation in phenotypes of isogenic mice. In the Avy allele an inserted intracisternal A particle (IAP) acts as a controlling element which deregulates expression of agouti by transcription from the LTR of the IAP; the phenotypic state has been linked to CpG methylation of the LTR. Phenotypic variation between Avy mice indicates that the epigenetic state of the IAP is unstable in the germline. Principal Findings We have made a detailed examination of somatic methylation of the IAP using bisulphite allelic sequencing, and find that the promoter is incompletely methylated even when it is transcriptionally silent. In utero exposure to supplementary methyl donors, which alters the spectrum of Avy phenotypes, does not increase the density of CpG methylation in the silent LTR. Conclusions Our findings suggest that, contrary to previous supposition, methyl donor supplementation acts through an indirect mechanism to silence Avy. The incomplete cytosine methylation we observe at the somatically silent Avy allele may reflect its unstable germline state, and the influence of epigenetic modifications underlying CpG methylation. PMID:20140227

Association of Allelic Interaction of Single Nucleotide Polymorphisms of Influx and Efflux Transporters Genes With Nonhematologic Adverse Events of Docetaxel in Breast Cancer Patients.

PubMed

Jabir, Rafid Salim; Ho, Gwo Fuang; Annuar, Muhammad Azrif Bin Ahmad; Stanslas, Johnson

2018-05-04

Nonhematologic adverse events (AEs) of docetaxel constitute an extra burden in the treatment of cancer patients and necessitate either a dose reduction or an outright switch of docetaxel for other regimens. These AEs are frequently associated with genetic polymorphisms of genes encoding for proteins involved docetaxel disposition. Therefore, we investigated that association in Malaysian breast cancer patients. A total of 110 Malaysian breast cancer patients were enrolled in the present study, and their blood samples were investigated for different single nucleotide polymorphisms using polymerase chain reaction restriction fragment length polymorphism. AEs were evaluated using the Common Terminology Criteria for Adverse Events, version 4.0. Fatigue, nausea, oral mucositis, and vomiting were the most common nonhematologic AEs. Rash was associated with heterozygous and mutant genotypes of ABCB1 3435C>T (P < .05). Moreover, patients carrying the GG genotype of ABCB1 2677G>A/T reported more fatigue than those carrying the heterozygous genotype GA (P < .05). The presence of ABCB1 3435-T, ABCC2 3972-C, ABCC2 1249-G, and ABCB1 2677-G alleles was significantly associated with nausea and oral mucositis. The coexistence of ABCB1 3435-C, ABCC2 3972-C, ABCC2 1249-G, and ABCB1 2677-A was significantly associated with vomiting (P < .05). The prevalence of nonhematologic AEs in breast cancer patients treated with docetaxel has been relatively high. The variant allele of ABCB1 3435C>T polymorphism could be a potential predictive biomarker of docetaxel-induced rash, and homozygous wild-type ABCB1 2677G>A/T might predict for a greater risk of fatigue. In addition, the concurrent presence of specific alleles could be predictive of vomiting, nausea, and oral mucositis. Copyright © 2018 Elsevier Inc. All rights reserved.

Concomitant presence of endothelial nitric oxide 894T and angiotensin II-converting enzyme D alleles are associated with diabetic nephropathy in a Kurdish population from Western Iran.

PubMed

Rahimi, Zohreh; Vaisi-Raygani, Asad; Rahimi, Ziba; Parsian, Abbas

2012-02-01

The present study investigated the influence of insertion (I)/deletion (D) polymorphism of the angiotensin II-converting enzyme (ACE) gene in combination with endothelial nitric oxide (eNOS) G894T polymorphism on the predisposition to diabetic nephropathy (DN). Using polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism (PCR-RFLP) method, the ACE and eNOS polymorphisms were genotyped in 72 microalbuminuric, 68 macroalbuminuric and 72 normoalbuinuric type 2 diabetes mellitus (T2DM) patients from Western Iran. The presence of eNOS T or ACE D allele was not associated with increased risk of macroalbuminuria (odds ratio (OR) = 1.36, P = 0.27 and OR = 1.6, P = 0.062, respectively). However, in the presence of both alleles there was a trend towards increased risk of macroalbuminuria (fivefold, P = 0.05). Our study indicates that the concomitant presence of both ACE D and eNOS T alleles tends to be associated with an elevation risk of macroalbuminuria compared with the presence of each polymorphism alone. This risk could be attributed to the increasing activity of ACE and angiotensin II level in the presence of D allele and decreasing NO production in the presence of T allele accelerating diabetic nephropathy. © 2011 The Authors. Nephrology © 2011 Asian Pacific Society of Nephrology.

Transporter TAP1-637G and Immunoproteasome PSMB9-60H Variants Influence the Risk of Developing Vitiligo in the Saudi Population

PubMed Central

Elhawary, Nasser Attia; Bogari, Neda; Jiffri, Essam Hussien; Rashad, Mona; Fatani, Abdulhamid; Tayeb, Mohammed

2014-01-01

We evaluated whether TAP1-rs1135216 (p.637D>G) and PSMB9-rs17587 (p.60R>H) were significantly associated with the risk and severity of vitiligo among Saudi patients. One hundred seventy-two subjects were genotyped for the TAP1-rs1135216 and PSMB9-rs17587 variants using endonuclease digestions of amplified genomic DNA. The TAP1-rs1135216 and PSMB9-rs17587 mutant alleles were strongly associated with vitiligo, with odds ratios showing five fold and two fold risks (P < 0.0001 and P = 0.007, resp.). In TAP1-rs1135216, the 637G mutant allele was more frequent in cases (74%) than in healthy controls. In cases, the 60H mutant allele PSMB9-rs17587 was less frequent (42%) than the wild-type 60R allele (58%). Vitiligo vulgaris was the most common type of disease, associated with the DG (55%) and GG (46%) genotypes for rs1135216 and with the RH genotype (59%) for rs17587. The heterozygous 637DG and 60RH genotypes were each linked with active phenotypes in 64% of cases. In conclusion, the TAP1-rs1135216 and PSMB9-rs17587 variants are significantly associated with vitiligo, and even one copy of these mutant alleles can influence the risk among Saudis. Vitiligo vulgaris is associated with genotypes containing the mutant G and H alleles. PMID:25548428

[Risk of type 2 diabetes mellitus in the Kyrgyz population in the presence of ADIPOQ (G276T), KCNJ11 (Glu23Lys), TCF7L2 (IVS3C>T) gene polymorphisms].

PubMed

Isakova, Zh T; Talaibekova, E T; Asambaeva, D A; Kerimkulova, A S; Lunegova, O S; Aldasheva, N M; Aldashev, A A

To analyze the association of genotype combinations of the polymorphic markers G276T in the ADIPOQ gene, Glu23Lys in the KCNJ11 gene, and IVS3C>T in the TCF7L2 gene with the development of type 2 diabetes mellitus (T2DM) in the Kyrgyz population. The investigation enrolled 23 Kyrgyz people, of whom there were 114 patients with T2DM and 109 without T2DM (a control group). T2DM was diagnosed in accordance with the WHO criteria (1999). The genotypes of ADIPOQ (G276T), KCNJ11 (Glu23Lys), and TCF7L2 (IVS3C>T) gene polymorphisms were identified using the restriction fragment length polymorphism analysis. When typing at the polymorphic loci G276T in the ADIPOQ gene, Glu23Lys in the KCNJ11 gene, and IVS3C>T in the TCF7L2 gene, the development of T2DM in the Kyrgyz population was associated with the T allele (odds ratio (OR), 1.68; p=0.025), the heterozygous G276T genotype (OR 1,8; p=0.036) in the ADIPOQ gene; the 23Lys allele (OR, 1.62; p=0.019) in the KCNJ11 gene; a two-locus genotype combination in the genes ADIPOQ/KCNJ11: G276T/Glu23Lys (OR, 4.88; p=0.0013), G276G/Lys23Lys (OR, 4.65; p=0.019), G276T/Glu23Glu (OR, 3.10; p=0.022), a two-locus genotype combination in the genes ADIPOQ/TCF7L2: G276T/СС (OR, 1.97; p=0.04); two-locus genotype combinations in the genes KCNJ11/TCF7L2: Lys23Lys/CC (ОR, 2.65; p=0.042), Glu23Lys/CT (OR, 3.88; p=0.027); and a three-locus genotype combination in the genes ADIPOQ/KCNJ11/TCF7L2: G276T/Glu23Lys/CT (OR, 14.48; p=0.02). The development of T2DM in the Kyrgyz population is genetically determined by ADIPOQ (G276T) gene, KCNJ11 (Glu23Lys), and TCF7L (IVS3C>T) gene polymorphisms with the predisposing value of the T allele of the heterozygous G276T genotype in the ADIPOQ gene; the 23Lys allele in the KCNJ1 gene; as well as by genotype combinations in the genes ADIPOQ/KCNJ11 (G276T/Glu23Lys, G276G/Lys23Lys, G276T/Glu23Glu); ADIPOQ/TCF7L2 (G276T/SS); KCNJ11/TCF7L2 (Lys23Lys/CC, Glu23Lys/CT); ADIPOQ/KCNJ11/TCF7L2 (G276T/Glu23Lys /CT). The IVS3C>T

Brassinosteroid-Insensitive Dwarf Mutants of Arabidopsis Accumulate Brassinosteroids1

PubMed Central

Noguchi, Takahiro; Fujioka, Shozo; Choe, Sunghwa; Takatsuto, Suguru; Yoshida, Shigeo; Yuan, Heng; Feldmann, Kenneth A.; Tax, Frans E.

1999-01-01

Seven dwarf mutants resembling brassinosteroid (BR)-biosynthetic dwarfs were isolated that did not respond significantly to the application of exogenous BRs. Genetic and molecular analyses revealed that these were novel alleles of BRI1 (Brassinosteroid-Insensitive 1), which encodes a receptor kinase that may act as a receptor for BRs or be involved in downstream signaling. The results of morphological and molecular analyses indicated that these represent a range of alleles from weak to null. The endogenous BRs were examined from 5-week-old plants of a null allele (bri1-4) and two weak alleles (bri1-5 and bri1-6). Previous analysis of endogenous BRs in several BR-biosynthetic dwarf mutants revealed that active BRs are deficient in these mutants. However, bri1-4 plants accumulated very high levels of brassinolide, castasterone, and typhasterol (57-, 128-, and 33-fold higher, respectively, than those of wild-type plants). Weaker alleles (bri1-5 and bri1-6) also accumulated considerable levels of brassinolide, castasterone, and typhasterol, but less than the null allele (bri1-4). The levels of 6-deoxoBRs in bri1 mutants were comparable to that of wild type. The accumulation of biologically active BRs may result from the inability to utilize these active BRs, the inability to regulate BR biosynthesis in bri1 mutants, or both. Therefore, BRI1 is required for the homeostasis of endogenous BR levels. PMID:10557222

Mutants Resistant to anti-Microtubule Herbicides Map to a Locus on the Uni Linkage Group in Chlamydomonas Reinhardtii

PubMed Central

James, S. W.; Ranum, LPW.; Silflow, C. D.; Lefebvre, P. A.

1988-01-01

We have used genetic analysis to study the mode of action of two anti-microtubule herbicides, amiprophos-methyl (APM) and oryzalin (ORY). Over 200 resistant mutants were selected by growth on APM- or ORY-containing plates. The 21 independently isolated mutants examined in this study are 3- to 8-fold resistant to APM and are strongly cross-resistant to ORY and butamiphos, a close analog of APM. Two Mendelian genes, apm1 and apm2, are defined by linkage and complementation analysis. There are 20 alleles of apm1 and one temperature-sensitive lethal (33°) allele of apm2. Mapping by two-factor crosses places apm1 6.5 cM centromere proximal to uni1 and within 4 cM of pf7 on the uni linkage group, a genetically circular linkage group comprising genes which affect flagellar assembly or function; apm2 maps near the centromere of linkage group VIII. Allele-specific synthetic lethality is observed in crosses between apm2 and alleles of apm1. Also, self crosses of apm2 are zygotic lethal, whereas crosses of nine apm1 alleles inter se result in normal germination and tetrad viability. The mutants are recessive to their wild-type alleles but doubly heterozygous diploids (apm1 +/+ apm2) made with apm2 and any of 15 apm1 alleles display partial intergenic noncomplementation, expressed as intermediate resistance. Diploids homozygous for mutant alleles of apm1 are 4-6-fold resistant to APM and ORY; diploids homozygous for apm2 are ts(-) and 2-fold resistant to the herbicides. Doubly heterozygous diploids complement the ts(-) phenotype of apm2, but they are typically 1.5-2-fold resistant to APM and ORY. From the results described we suggest that the gene products of apm1 and apm2 may interact directly or function in the same structure or process. PMID:8608924

Complement factor H gene (CFH) polymorphisms C-257T, G257A and haplotypes are associated with protection against severe dengue phenotype, possible related with high CFH expression.

PubMed

Pastor, André F; Rodrigues Moura, Laís; Neto, José W D; Nascimento, Eduardo J M; Calzavara-Silva, Carlos E; Gomes, Ana Lisa V; Silva, Ana Maria da; Cordeiro, Marli T; Braga-Neto, Ulisses; Crovella, Sergio; Gil, Laura H V G; Marques, Ernesto T A; Acioli-Santos, Bartolomeu

2013-09-01

Four genetic polymorphisms located at the promoter (C-257T) and coding regions of CFH gene (exon 2 G257A, exon 14 A2089G and exon 19 G2881T) were investigated in 121 dengue patients (DENV-3) in order to assess the relationship between allele/haplotypes variants and clinical outcomes. A statistical value was found between the CFH-257T allele (TT/TC genotypes) and reduced susceptibility to severe dengue (SD). Statistical associations indicate that individuals bearing a T allele presented significantly higher protein levels in plasma. The -257T variant is located within a NF-κB binding site, suggesting that this variant might have effect on the ability of the CFH gene to respond to signals via the NF-κB pathway. The G257A allelic variant showed significant protection against severe dengue. When CFH haplotypes effect was considered, the ancestral CG/CG promoter-exon 2 SNP genotype showed significant risk to SD either in a general comparison (ancestral × all variant genotypes), as well as in individual genotypes comparison (ancestral × each variant genotype), where the most prevalent effect was observed in the CG/CG × CA/TG comparison. These findings support the involvement of -257T, 257A allele variants and haplotypes on severe dengue phenotype protection, related with high basal CFH expression. Copyright © 2013 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

A Medicago truncatula tobacco retrotransposon insertion mutant collection with defects in nodule development and symbiotic nitrogen fixation.

PubMed

Pislariu, Catalina I; Murray, Jeremy D; Wen, JiangQi; Cosson, Viviane; Muni, RajaSekhara Reddy Duvvuru; Wang, Mingyi; Benedito, Vagner A; Andriankaja, Andry; Cheng, Xiaofei; Jerez, Ivone Torres; Mondy, Samuel; Zhang, Shulan; Taylor, Mark E; Tadege, Million; Ratet, Pascal; Mysore, Kirankumar S; Chen, Rujin; Udvardi, Michael K

2012-08-01

A Tnt1-insertion mutant population of Medicago truncatula ecotype R108 was screened for defects in nodulation and symbiotic nitrogen fixation. Primary screening of 9,300 mutant lines yielded 317 lines with putative defects in nodule development and/or nitrogen fixation. Of these, 230 lines were rescreened, and 156 lines were confirmed with defective symbiotic nitrogen fixation. Mutants were sorted into six distinct phenotypic categories: 72 nonnodulating mutants (Nod-), 51 mutants with totally ineffective nodules (Nod+ Fix-), 17 mutants with partially ineffective nodules (Nod+ Fix+/-), 27 mutants defective in nodule emergence, elongation, and nitrogen fixation (Nod+/- Fix-), one mutant with delayed and reduced nodulation but effective in nitrogen fixation (dNod+/- Fix+), and 11 supernodulating mutants (Nod++Fix+/-). A total of 2,801 flanking sequence tags were generated from the 156 symbiotic mutant lines. Analysis of flanking sequence tags revealed 14 insertion alleles of the following known symbiotic genes: NODULE INCEPTION (NIN), DOESN'T MAKE INFECTIONS3 (DMI3/CCaMK), ERF REQUIRED FOR NODULATION, and SUPERNUMERARY NODULES (SUNN). In parallel, a polymerase chain reaction-based strategy was used to identify Tnt1 insertions in known symbiotic genes, which revealed 25 additional insertion alleles in the following genes: DMI1, DMI2, DMI3, NIN, NODULATION SIGNALING PATHWAY1 (NSP1), NSP2, SUNN, and SICKLE. Thirty-nine Nod- lines were also screened for arbuscular mycorrhizal symbiosis phenotypes, and 30 mutants exhibited defects in arbuscular mycorrhizal symbiosis. Morphological and developmental features of several new symbiotic mutants are reported. The collection of mutants described here is a source of novel alleles of known symbiotic genes and a resource for cloning novel symbiotic genes via Tnt1 tagging.

Differential effects of hydroxyurea and INC424 on mutant allele burden and myeloproliferative phenotype in a JAK2-V617F polycythemia vera mouse model.

PubMed

Kubovcakova, Lucia; Lundberg, Pontus; Grisouard, Jean; Hao-Shen, Hui; Romanet, Vincent; Andraos, Rita; Murakami, Masato; Dirnhofer, Stephan; Wagner, Kay-Uwe; Radimerski, Thomas; Skoda, Radek C

2013-02-14

To establish a preclinical animal model for testing drugs with potential effects on myeloproliferative neoplasms (MPNs), we first performed a detailed phenotypic characterization of Cre-inducible transgenic JAK2-V617F mice. Deleting the conditional mouse Jak2-knockout alleles increased erythropoiesis and accentuated the polycythemia vera phenotype, but did not alter platelet or granulocyte levels. In a transplantation assay, JAK2-V617F(+) BM cells had an advantage over wild-type competitor cells. Using this competitive repopulation assay, we compared the effects of INC424 (ruxolitinib), a dual Jak1/Jak2 inhibitor, and hydroxyurea (HU). HU led to weight loss, but did not reduce spleen weight. The hematologic parameters were lowered and a slight decrease of the mutant allele burden was noted. INC424 had little effect on body weight, but strongly decreased spleen size and rapidly normalized RBC and neutrophil parameters. No significant decrease in the mutant allele burden was observed. INC424 reduced the phospho-Stat5 levels, whereas HU strongly increased phospho-Stat5, most likely because of the elevated erythropoietin levels in response to the HU-induced anemia. This compensatory increase in JAK/STAT signaling may counteract the beneficial effects of cytoreduction at higher doses of HU and represents an adverse effect that should be avoided.

Interleukin 10 (- 1082 G/A) and (- 819 C/T) gene polymorphisms in Egyptian women with polycystic ovary syndrome (PCOS).

PubMed

Talaat, Roba M; Mohamed, Yasmin A; Mohamad, Ehab H; Elsharkawy, Marwa; Guirgis, Adel A

2016-09-01

Cytokines play critical roles in the pathogenesis of Polycystic Ovarian Syndrome (PCOS). This work was designed to study the implication of IL10 gene polymorphisms (- 1082 G/A and - 819 C/T) on the susceptibility of Egyptian women to have PCOS. Rotterdam consensus criteria were used to diagnose PCOS patients. Genotyping was performed by single-stranded polymorphism-polymerase chain reaction (SSP-PCR) in 61 PCOS patients and 80 healthy controls, and IL-10 serum levels were measured using Enzyme linked immunosorbent assay (ELISA). The frequency of IL10 - 1082 G/G (46%) genotype was significantly increased (p < 0.001) while the frequency of - 1082 A/A (16%) genotype was significantly decreased (p < 0.05) in PCOS patients compared to controls (14% and 35% for G/G and A/A genotypes; respectively). G allele (65%) is significantly increased (p < 0.01( in PCOS patients while A allele (61%) is significantly increased (p < 0.001( in control subjects. The distribution of IL10 -819 T/T genotype was significantly increased (p < 0.05) in PCOS group. G/G genotype (odd ratio (OR = 5.322) with confidence interval (CI = 2.364-11.982) and the G allele (OR = 2.828 with CI = 1.73-4.61) of - 1082 G/A and T/T genotype of - 819 C/T (OR = 4.18 with CI = 1.26-13.86) could be considered as risk factors for PCOS. IL-10 levels were significantly lower among PCOS patients (313.42 ± 30.10) compared to normal controls (4914.36 ± 303.72). Depending on our preliminary work, IL10 - 1082 G/G might be considered as a host genetic factor for PCOS susceptibility in Egyptian women. Studies concerning other cytokine gene polymorphisms are required to get a better understanding of the pathogenesis of PCOS disease.

[Association study between 834+7G/A and +1332C/T polymorphisms in the growth arrest specific 6 gene and risk of severe preeclampsia in Chinese population].

PubMed

Ye, Liyan; Guan, Linbo; Fan, Ping; Liu, Xinghui; Liu, Rui; Chen, Jinxin; Zhu, Yue; Wei, Xin; Liu, Yu; Bai, Huai

2017-02-10

To investigate the relationship between polymorphisms of the growth arrest specific 6 (GAS6) gene and severe preeclampsia in a South West Han Chinese population. Blood samples from 167 patients with severe preeclampsia and 312 normal pregnant women as controls from Han Chinese in Chengdu area were analyzed by polymerase chain reaction-restriction fragment length polymorphisms. C and T allele frequencies for +1332C/T site were 85.63% and 14.37% in the patient group, respectively, and 78.04% and 21.96% in control group, respectively. The TT genotype and variant T allelic frequencies of the +1332C/T polymorphism were significantly lower in patients with severe preeclampsia than in the control group (both P<0.05), and the odds ratio for the risk of severe preeclampsia was 0.602 (95%CI: 0.401-0.904) in carriers for the variant T allele (χ 2 =6.045, P=0.014). G and A allele frequencies for 834+7G/A site were 72.75% and 27.25% in case group, respectively, and 74.36% and 25.64% in control group, respectively. The genotype and allele frequencies of the 834+7G/A polymorphism in patients with severe preeclampsia and controls showed no significant differences (both P>0.05). In addition, there was no significant association between the polymorphisms and blood pressure levels in the patient or control groups. The variant GAS6+1332 T allele is associated with a decreased risk for severe preeclampsia in a South West Han Chinese population. On the other hand, the 834+7G/A polymorphism has no effect on the severe preeclampsia.

Kinetic, mechanistic, and structural modeling studies of truncated wild-type leucine-rich repeat kinase 2 and the G2019S mutant.

PubMed

Liu, Min; Kang, Stephanie; Ray, Soumya; Jackson, Justin; Zaitsev, Alexandra D; Gerber, Scott A; Cuny, Gregory D; Glicksman, Marcie A

2011-11-01

Leucine-rich repeat kinase 2 (LRRK2), a large and complex protein that possesses two enzymatic properties, kinase and GTPase, is one of the major genetic factors in Parkinson's disease (PD). Here, we characterize the kinetic and catalytic mechanisms of truncated wild-type (t-wt) LRRK2 and its most common mutant, G2019S (t-G2019S), with a structural interpretation of the kinase domain. First, the substitution of threonine with serine in the LRRKtide peptide results in a much less efficient substrate as demonstrated by a 26-fold decrease in k(cat) and a 6-fold decrease in binding affinity. The significant decrease in k(cat) is attributed to a slow chemical transfer step as evidenced by the inverse solvent kinetic isotope effect in the proton inventory and pL (pH or pD)-dependent studies. The shape of the proton inventory and pL profile clearly signals the involvement of a general base (pK(a) = 7.5) in the catalysis with a low fractionation factor in the ground state. We report for the first time that the increased kinase activity of the G2019S mutant is substrate-dependent. Homology modeling of the kinase domain (open and closed forms) and structural analysis of the docked peptide substrates suggest that electrostatic interactions play an important role in substrate recognition, which is affected by G2019S and may directly influence the kinetic properties of the enzyme. Finally, the GTPase activity of the t-G2019S mutant was characterized, and the mutation modestly decreases GTPase activity without significantly affecting GTP binding affinity.

Isolation and Characterization of Sex-Linked Female-Sterile Mutants in DROSOPHILA MELANOGASTER with Special Attention to Eggshell Mutants

PubMed Central

Komitopoulou, Katia; Gans, Madeleine; Margaritis, Lukas H.; Kafatos, Fotis C.; Masson, Michele

1983-01-01

To study genes that function mainly or exclusively during oogenesis, we have isolated and analyzed female-sterile mutations, with special emphasis on those that affect eggshell formation. Following treatment that induced 61 to 66% lethals, 8.1% of the 1071 X chromosomes tested carried recessive female sterility mutations (87 isolates), and 8.0% carried partial female-sterile mutations (86 isolates), respectively. In addition, three dominant female steriles were recovered. Some of the mutants had very low fecundity, and others laid morphologically normal eggs that failed to develop. A third category included 29 mutants that laid eggs with morphological abnormalities: 26 were female steriles, two were partial female steriles and one was fertile. Mutants of this third category were characterized in some detail and compared with 40 previously isolated mutants that laid similarly abnormal eggs. Approximately 28–31 complementation groups with morphological abnormalities were detected, some of which were large allelic series (11, 9, 7, 6 and 5 alleles). Twenty-four groups were mapped genetically or cytogenetically, and 21 were partially characterized by ultrastructural and biochemical procedures. Of the latter, one group showed clear deficiency of yolk proteins, and nine showed prominent ultrastructural defects in the chorion (at least eight accompanied by deficiencies in characterized chorion proteins). At least six groups with clear-cut effects were found at loci not previously identified with known chorion structural genes. PMID:17246182

Polygenic variation maintained by balancing selection: pleiotropy, sex-dependent allelic effects and G x E interactions.

PubMed Central

Turelli, Michael; Barton, N H

2004-01-01

We investigate three alternative selection-based scenarios proposed to maintain polygenic variation: pleiotropic balancing selection, G x E interactions (with spatial or temporal variation in allelic effects), and sex-dependent allelic effects. Each analysis assumes an additive polygenic trait with n diallelic loci under stabilizing selection. We allow loci to have different effects and consider equilibria at which the population mean departs from the stabilizing-selection optimum. Under weak selection, each model produces essentially identical, approximate allele-frequency dynamics. Variation is maintained under pleiotropic balancing selection only at loci for which the strength of balancing selection exceeds the effective strength of stabilizing selection. In addition, for all models, polymorphism requires that the population mean be close enough to the optimum that directional selection does not overwhelm balancing selection. This balance allows many simultaneously stable equilibria, and we explore their properties numerically. Both spatial and temporal G x E can maintain variation at loci for which the coefficient of variation (across environments) of the effect of a substitution exceeds a critical value greater than one. The critical value depends on the correlation between substitution effects at different loci. For large positive correlations (e.g., rho(ij)2>3/4), even extreme fluctuations in allelic effects cannot maintain variation. Surprisingly, this constraint on correlations implies that sex-dependent allelic effects cannot maintain polygenic variation. We present numerical results that support our analytical approximations and discuss our results in connection to relevant data and alternative variance-maintaining mechanisms. PMID:15020487

Novel rapid genotyping assays for neuronal ceroid lipofuscinosis in Border Collie dogs and high frequency of the mutant allele in Japan.

PubMed

Mizukami, Keijiro; Chang, Hye-Sook; Yabuki, Akira; Kawamichi, Takuji; Kawahara, Natsuko; Hayashi, Daisuke; Hossain, Mohammad A; Rahman, Mohammad M; Uddin, Mohammad M; Yamato, Osamu

2011-11-01

Neuronal ceroid lipofuscinosis (NCL) constitutes a group of recessively inherited lysosomal storage diseases that primarily affect neuronal cells. Such diseases share certain clinical and pathologic features in human beings and animals. Neuronal ceroid lipofuscinosis in Border Collie dogs was first detected in Australia in the 1980s, and the pathogenic mutation was shown to be a nonsense mutation (c.619C>T) in exon 4 in canine CLN5 gene. In the present study, novel rapid genotyping assays including polymerase chain reaction (PCR)-restriction fragment length polymorphism, PCR primer-induced restriction analysis, mutagenically separated PCR, and real-time PCR with TaqMan minor groove binder probes, were developed. The utility of microchip electrophoresis was also evaluated. Furthermore, a genotyping survey was carried out in a population of Border Collies in Japan using these assays to determine the current allele frequency in Japan, providing information to control and prevent this disease in the next stage. All assays developed in the current study are available to discriminate these genotypes, and microchip electrophoresis showed a timesaving advantage over agarose gel electrophoresis. Of all assays, real-time PCR was the most suitable for large-scale examination because of its high throughput. The genotyping survey demonstrated that the carrier frequency was 8.1%. This finding suggested that the mutant allele frequency of NCL in Border Collies is high enough in Japan that measures to control and prevent the disease would be warranted. The genotyping assays developed in the present study could contribute to the prevention of NCL in Border Collies.

MMP-8 C-799T and MMP-8 C+17G polymorphisms in mild and severe preeclampsia: Association between MMP-8 C-799T with susceptibility to severe preeclampsia.

PubMed

Rahimi, Ziba; Zangeneh, Maryam; Rezaeyan, Arezoo; Shakiba, Ebrahim; Rahimi, Zohreh

2018-01-01

The aim of present study was to determine the role of matrix metalloproteinase-8 (MMP-8) C-799T (rs11225395) and C+17 (rs2155052) polymorphisms in susceptibility to preeclampsia. In a case-control study, 256 pregnant women including 152 women with preeclampsia (86 women with mild preeclampsia and 66 women with severe preeclampsia) and 104 women with normal pregnancy from Western Iran with Kurdish ethnic background were investigated for MMP-8 C-799T and C + 17G polymorphisms using polymerase chain reaction-restriction fragment length polymorphism method. Comparing the MMP-8 TT genotype with the combined genotype of CC+CT (recessive model) indicated a significantly higher frequency of the MMP-8 TT genotype (47%) in severe preeclamptic patients than that in healthy pregnant women (30.8%) that was associated with 1.99-fold increased risk of severe preeclampsia (95% CI = 1.05-3.77, p = 0.034). The frequency of MMP-8 G allele was 27.3% in all preeclamptic patients compared to 30.2% in controls (p = 0.56). Also, no significant difference was detected comparing the frequency of G allele in mild (26.6%, p = 0.46) and severe preeclamptic patients (28.4%, p = 0.75) with controls (30.2%). Our study demonstrated that the MMP-8 C-799T is associated with the risk of developing severe preeclampsia during pregnancy. However, the MMP-8 C + 17G polymorphism might not be a risk factor for susceptibility to preeclampsia.

Effect of the mutation (C3435T) at exon 26 of the MDR1 gene on expression level of MDR1 messenger ribonucleic acid in duodenal enterocytes of healthy Japanese subjects.

PubMed

Nakamura, Tsutomu; Sakaeda, Toshiyuki; Horinouchi, Masanori; Tamura, Takao; Aoyama, Nobuo; Shirakawa, Toshiro; Matsuo, Masafumi; Kasuga, Masato; Okumura, Katsuhiko

2002-04-01

The effect of the C3435T mutation at exon 26 of the MDR1 gene on the expression levels of MDR1 messenger ribonucleic acid (mRNA) was evaluated by means of real-time polymerase chain reaction in 51 biopsy specimens of duodenum obtained from 13 healthy Japanese subjects. The mRNA levels of MDR1 were 0.38 +/- 0.15, 0.56 +/- 0.14, and 1.13 +/- 0.42 (mean value +/- SE) in the subjects with the homozygote of wild-type allele (C/C), compound heterozygote with mutant T allele (C/T), and the homozygote of the mutant allele (T/T), respectively, reasonably explaining the lower digoxin serum concentration after administration of a single oral dose to subjects harboring a mutant T allele. Good correlation (r =.797; P <.01) was observed between the mRNA concentrations of MDR1 and CYP3A4 in the individual biopsy specimens. This finding suggested a lower plasma concentration of the substrates for CYP3A4 in subjects harboring the C3435T mutation of the MDR1 gene.

ALS mutant SOD1 interacts with G3BP1 and affects stress granule dynamics.

PubMed

Gal, Jozsef; Kuang, Lisha; Barnett, Kelly R; Zhu, Brian Z; Shissler, Susannah C; Korotkov, Konstantin V; Hayward, Lawrence J; Kasarskis, Edward J; Zhu, Haining

2016-10-01

Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disease. Mutations in Cu/Zn superoxide dismutase (SOD1) are responsible for approximately 20 % of the familial ALS cases. ALS-causing SOD1 mutants display a gain-of-toxicity phenotype, but the nature of this toxicity is still not fully understood. The Ras GTPase-activating protein-binding protein G3BP1 plays a critical role in stress granule dynamics. Alterations in the dynamics of stress granules have been reported in several other forms of ALS unrelated to SOD1. To our surprise, the mutant G93A SOD1 transgenic mice exhibited pathological cytoplasmic inclusions that co-localized with G3BP1-positive granules in spinal cord motor neurons. The co-localization was also observed in fibroblast cells derived from familial ALS patient carrying SOD1 mutation L144F. Mutant SOD1, unlike wild-type SOD1, interacted with G3BP1 in an RNA-independent manner. Moreover, the interaction is specific for G3BP1 since mutant SOD1 showed little interaction with four other RNA-binding proteins implicated in ALS. The RNA-binding RRM domain of G3BP1 and two particular phenylalanine residues (F380 and F382) are critical for this interaction. Mutant SOD1 delayed the formation of G3BP1- and TIA1-positive stress granules in response to hyperosmolar shock and arsenite treatment in N2A cells. In summary, the aberrant mutant SOD1-G3BP1 interaction affects stress granule dynamics, suggesting a potential link between pathogenic SOD1 mutations and RNA metabolism alterations in ALS.

G673 could be a novel mutational hot spot for intragenic suppressors of pheS5 lesion in Escherichia coli.

PubMed

Ponmani, Thangaraj; Munavar, M Hussain

2014-06-01

The pheS5 Ts mutant of Escherichia coli defined by a G293 → A293 transition, which is responsible for thermosensitive Phenylalanyl-tRNA synthetase has been well studied at both biochemical and molecular level but genetic analyses pertaining to suppressors of pheS5 were hard to come by. Here we have systematically analyzed a spectrum of Temperature-insensitive derivatives isolated from pheS5 Ts mutant and identified two intragenic suppressors affecting the same base pair coordinate G673 (pheS19 defines G673 → T673 ; Gly225 → Cys225 and pheS28 defines G673 → C673 ; Gly225 → Arg225). In fact in the third derivative, the intragenic suppressor originally named pheS43 (G673 → C673 transversion) is virtually same as pheS28. In the fourth case, the very pheS5 lesion itself has got changed from A293 → T293 (named pheS40). Cloning of pheS(+), pheS5, pheS5-pheS19, pheS5-pheS28 alleles into pBR322 and introduction of these clones into pheS5 mutant revealed that excess of double mutant protein is not at all good for the survival of cells at 42°C. These results clearly indicate a pivotal role for Gly225 in the structural/functional integrity of alpha subunit of E. coli PheRS enzyme and it is proposed that G673 might define a hot spot for intragenic suppressors of pheS5. © 2014 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

Normal T lymphocytes can express two different T cell receptor beta chains: implications for the mechanism of allelic exclusion

PubMed Central

1995-01-01

We have examined the extent of allelic exclusion at the T cell receptor (TCR) beta locus using monoclonal antibodies specific for V beta products. A small proportion (approximately 1%) of human peripheral blood T cells express two V beta as determined by flow cytometric analysis, isolation of representative clones, and sequencing of the corresponding V beta chains. Dual beta T cells are present in both the CD45R0+ and CD45R0- subset. These results indicate that dual beta expression is compatible with both central and peripheral selection. They also suggest that the substantial degree of TCR beta allelic exclusion is dependent only on asynchronous rearrangements at the beta locus, whereas the role of the pre-TCR is limited to signaling the presence of at least one functional beta protein. PMID:7699339

In Vivo-Selected Compensatory Mutations Restore the Fitness Cost of Mosaic penA Alleles That Confer Ceftriaxone Resistance in Neisseria gonorrhoeae.

PubMed

Vincent, Leah R; Kerr, Samuel R; Tan, Yang; Tomberg, Joshua; Raterman, Erica L; Dunning Hotopp, Julie C; Unemo, Magnus; Nicholas, Robert A; Jerse, Ann E

2018-04-03

Resistance to ceftriaxone in Neisseria gonorrhoeae is mainly conferred by mosaic penA alleles that encode penicillin-binding protein 2 (PBP2) variants with markedly lower rates of acylation by ceftriaxone. To assess the impact of these mosaic penA alleles on gonococcal fitness, we introduced the mosaic penA alleles from two ceftriaxone-resistant (Cro r ) clinical isolates (H041 and F89) into a Cro s strain (FA19) by allelic exchange and showed that the resultant Cro r mutants were significantly outcompeted by the Cro s parent strain in vitro and in a murine infection model. Four Cro r compensatory mutants of FA19 penA41 were isolated independently from mice that outcompeted the parent strain both in vitro and in vivo One of these compensatory mutants (LV41C) displayed a unique growth profile, with rapid log growth followed by a sharp plateau/gradual decline at stationary phase. Genome sequencing of LV41C revealed a mutation (G348D) in the acnB gene encoding the bifunctional aconitate hydratase 2/2 methylisocitrate dehydratase. Introduction of the acnB G348D allele into FA19 penA41 conferred both a growth profile that phenocopied that of LV41C and a fitness advantage, although not as strongly as that exhibited by the original compensatory mutant, suggesting the existence of additional compensatory mutations. The mutant aconitase appears to be a functional knockout with lower activity and expression than wild-type aconitase. Transcriptome sequencing (RNA-seq) analysis of FA19 penA41 acnB G348D revealed a large set of upregulated genes involved in carbon and energy metabolism. We conclude that compensatory mutations can be selected in Cro r gonococcal strains that increase metabolism to ameliorate their fitness deficit. IMPORTANCE The emergence of ceftriaxone-resistant (Cro r ) Neisseria gonorrhoeae has led to the looming threat of untreatable gonorrhea. Whether Cro resistance is likely to spread can be predicted from studies that compare the relative fitnesses of

[Distribution of variant alleles association with warfarin pharmacokinetics and pharmacodynamics in the Han population in China].

PubMed

Liu, Yuan; Zhong, Shi-long; Yang, Min; Tan, Hong-hong; Fei, Hong-wen; Chen, Ji-yan; Yu, Xi-yong; Lin, Shu-guang

2011-12-18

To investigate distribution of CYP2C9, CYP3A4, VKORC1 and GGCX gene polymorphisms in the Han population of Guangdong. The subjects included were 970 Chinese Han patients who received long-term warfarin anticoagulant therapy orally after valve replacement in Guangdong General Hospital between 2000 and 2008. By selecting and analyzing the 12 single nucleotide polymorphisms (SNPs) loci, rs12572351 G>A, rs9332146 G>A, rs4917639 G>T, rs1057910 A>C (CYP2C9*3), rs1934967 G>T, rs1934968 G>A, rs2242480 T>C, rs2246709 G>A, rs9923231 C>T (VKORC1-1639 G>A), rs2359612 G>A (VKORC1*2), rs10871454 C>T, and rs699664 T>C, in 4 genes including CYP2C9, CYP3A4, VKORC1 and GGCX that were possibly correlated with warfarin pharmacodynamics and pharmacokinetics through literature retrieval, the distribution of mutation frequencies of the 12 SNPs loci in Chinese Han population were obtained systematically. SNaPshot technique was used to detect gene SNPs, Hardy-Weinberg genetic equilibrium test was used to test population representativeness. The allelic mutation frequency at CYP2C9 gene rs12572351 G>A, rs9332146 G>A, rs4917639 C>A, rs1057910 A>C (*3), rs1934967 G>T and rs1934968 G>A loci was 32.53%, 2.16%, 8.25%, 3.61%, 19.18% and 37.37%, respectively; the allelic mutation frequency at CYP3A4 gene rs2242480 T>C and rs2246709 G>A loci was 29.07% and 40.41%, respectively; the allelic mutation frequency at VKORC1 gene rs9923231 C>T, rs2359612 G>A and rs10871454 C>T SNPs loci was 87.99%, 87.94% and 91.34%, respectively; the allelic mutation frequency at GGCX gene rs699664 T>C locus was 31.86%. It is of important clinical significance in individualized warfarin therapy to systematically study distribution of mutation frequencies at 12 polymorphisms loci in 4 genes including CYP2C9, CYP3A4 , VKORC1 and GGCX related to warfarin pharmacodynamics and pharmacokinetics in the Chinese Han population receiving valve replacement.

Mechanisms for dominance: Adh heterodimer formation in heterozygotes between ENU or x-ray induced null alleles and normal alleles in drosophila melanogaster

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jiang, J.C.; Lee, W.R.; Chang, S.H.

1992-01-01

To study mechanisms for dominance of phenotype, eight ENU- and four x-ray-induced mutations at the alcohol dehydrogenase (Adh) locus were analyzed for partial dominance in their interaction with normal alleles. All ENU and one of the x-ray mutations were single base substitutions; the other three x-ray mutations were 9-21 base deletions. All but one of the 12 mutant alleles were selected for this study because they produced detectable mutant polypeptides, but seven of the 11 producing a peptide could not form dimers with the normal peptide and the enzyme activity of heterozygotes was about half that of normal homozygotes. Fourmore » mutations formed dimers with a decreased catalytic efficiency and two of these were near the limit of detectability; these two also inhibited the formation of normal homodimers. The mutant alleles therefore show multiple mechanisms leading to partial enzyme expression in heterozygotes and a wide range of dominance ranging from almost complete recessive to nearly dominant. All amino acid changes in mutant peptides that form dimers are located between amino acids 182 and 194, so this region is not critical for dimerization. It may, however, be an important surface domain for catalyzation. 34 refs., 8 figs., 2 tabs.« less

A novel FY*A allele with the 265T and 298A SNPs formerly associated exclusively with the FY*B allele and weak Fy(b) antigen expression: implication for genotyping interpretative algorithms.

PubMed

Lopez, G H; Condon, J A; Wilson, B; Martin, J R; Liew, Y-W; Flower, R L; Hyland, C A

2015-01-01

An Australian Caucasian blood donor consistently presented a serology profile for the Duffy blood group as Fy(a+b+) with Fy(a) antigen expression weaker than other examples of Fy(a+b+) red cells. Molecular typing studies were performed to investigate the reason for the observed serology profile. Blood group genotyping was performed using a commercial SNP microarray platform. Sanger sequencing was performed using primer sets to amplify across exons 1 and 2 of the FY gene and using allele-specific primers. The propositus was genotyped as FY*A/B, FY*X heterozygote that predicted the Fy(a+b+(w) ) phenotype. Sequencing identified the 265T and 298A variants on the FY*A allele. This link between FY*A allele and 265T was confirmed by allele-specific PCR. The reduced Fy(a) antigen reactivity is attributed to a FY*A allele-carrying 265T and 298A variants previously defined in combination only with the FY*B allele and associated with weak Fy(b) antigen expression. This novel allele should be considered in genotyping interpretative algorithms for generating a predicted phenotype. © 2014 International Society of Blood Transfusion.

CYP3A4 allelic variants with amino acid substitutions in exons 7 and 12: evidence for an allelic variant with altered catalytic activity.

PubMed

Sata, F; Sapone, A; Elizondo, G; Stocker, P; Miller, V P; Zheng, W; Raunio, H; Crespi, C L; Gonzalez, F J

2000-01-01

To determine the existence of mutant and variant CgammaP3A4 alleles in three racial groups and to assess functions of the variant alleles by complementary deoxyribonucleic acid (cDNA) expression. A bacterial artificial chromosome that contains the complete CgammaP3A4 gene was isolated and the exons and surrounding introns were directly sequenced to develop primers to polymerase chain reaction (PCR) amplify and sequence the gene from lymphocyte DNA. DNA samples from Chinese, black, and white subjects were screened. Mutating the affected amino acid in the wild-type cDNA and expressing the variant enzyme with use of the baculovirus system was used to functionally evaluate the variant allele having a missense mutation. To investigate the existence of mutant and variant CgammaP3A4 alleles in humans, all 13 exons and the 5'-flanking region of the human CgammaP3A4 gene in three racial groups were sequenced and four alleles were identified. An A-->G point mutation in the 5'-flanking region of the human CgammaP3A4 gene, designated CgammaP3A4*1B, was found in the three different racial groups. The frequency of this allele in a white population was 4.2%, whereas it was 66.7% in black subjects. The CgammaP3A4*1B allele was not found in Chinese subjects. A second variant allele, designated CgammaP3A4*2, having a Ser222Pro change, was found at a frequency of 2.7% in the white population and was absent in the black subjects and Chinese subjects analyzed. Baculovirus-directed cDNA expression revealed that the CYP3A4*2 P450 had a lower intrinsic clearance for the CYP3A4 substrate nifedipine compared with the wild-type enzyme but was not significantly different from the wild-type enzyme for testosterone 6beta-hydroxylation. Another rare allele, designated CgammaP3A4*3, was found in a single Chinese subject who had a Met445Thr change in the conserved heme-binding region of the P450. These are the first examples of potential function polymorphisms resulting from missense mutations in

Precision-engineering the Pseudomonas aeruginosa genome with two-step allelic exchange

PubMed Central

Hmelo, Laura R.; Borlee, Bradley R.; Almblad, Henrik; Love, Michelle E.; Randall, Trevor E.; Tseng, Boo Shan; Lin, Chuyang; Irie, Yasuhiko; Storek, Kelly M.; Yang, Jaeun Jane; Siehnel, Richard J.; Howell, P. Lynne; Singh, Pradeep K.; Tolker-Nielsen, Tim; Parsek, Matthew R.; Schweizer, Herbert P.; Harrison, Joe J.

2016-01-01

Allelic exchange is an efficient method of bacterial genome engineering. This protocol describes the use of this technique to make gene knockouts and knockins, as well as single nucleotide insertions, deletions and substitutions in Pseudomonas aeruginosa. Unlike other approaches to allelic exchange, this protocol does not require heterologous recombinases to insert or excise selective markers from the target chromosome. Rather, positive and negative selection are enabled solely by suicide vector-encoded functions and host cell proteins. Here, mutant alleles, which are flanked by regions of homology to the recipient chromosome, are synthesized in vitro and then cloned into allelic exchange vectors using standard procedures. These suicide vectors are then introduced into recipient cells by conjugation. Homologous recombination then results in antibiotic resistant single-crossover mutants in which the plasmid has integrated site-specifically into the chromosome. Subsequently, unmarked double-crossover mutants are isolated directly using sucrose-mediated counter-selection. This two-step process yields seamless mutations that are precise to a single base pair of DNA. The entire procedure requires ~2 weeks. PMID:26492139

Association Between IL-10 Gene Promoter Polymorphisms (-592 A/C, -819 T/C, -1082 A/G) and Susceptibility to HBV Infection in an Iranian Population

PubMed Central

Moudi, Bita; Heidari, Zahra; Mahmoudzadeh-Sagheb, Hamidreza; Hashemi, Mohammad; Metanat, Malihe; Khosravi, Soheila; Farrokh, Parisa

2016-01-01

Background IL-10 can play a vital role in immune response against HBV. Three biallelic SNPs from the transcription start site control the transcription of the IL-10 gene. An association between susceptibility to HBV and IL-10 polymorphisms has been suggested in patients with HBV infection. Objectives The present study was designed to study the association between polymorphisms in interleukin-10 (-1082 A/G, -819 T/C and -592 A/C) promoter gene and chronic hepatitis B virus (HBV) infection. Patients and Methods 221 chronically infected patients and 200 healthy control subjects were enrolled in the study. Three biallelic (-1082 A/G, -819 T/C and -592 A/C) polymorphisms in the IL-10 promoter gene were determined by PCR-RFLP method. Results Persistent HBV infection was associated with IL-10-1082 AG (P = 0.001) and GG (P = 0.004) genotypes and G (P = 0.000) allele. IL-10-819 T/C and -592 A/C genotype and allele frequencies did not show any correlation with the risk of chronic hepatitis B infection. Conclusions These results suggest that polymorphisms in interleukin-10 gene promoter influence clinical outcome of HBV infection and susceptibility to HBV infection. PMID:27148384

Association Between IL-10 Gene Promoter Polymorphisms (-592 A/C, -819 T/C, -1082 A/G) and Susceptibility to HBV Infection in an Iranian Population.

PubMed

Moudi, Bita; Heidari, Zahra; Mahmoudzadeh-Sagheb, Hamidreza; Hashemi, Mohammad; Metanat, Malihe; Khosravi, Soheila; Farrokh, Parisa

2016-02-01

IL-10 can play a vital role in immune response against HBV. Three biallelic SNPs from the transcription start site control the transcription of the IL-10 gene. An association between susceptibility to HBV and IL-10 polymorphisms has been suggested in patients with HBV infection. The present study was designed to study the association between polymorphisms in interleukin-10 (-1082 A/G, -819 T/C and -592 A/C) promoter gene and chronic hepatitis B virus (HBV) infection. 221 chronically infected patients and 200 healthy control subjects were enrolled in the study. Three biallelic (-1082 A/G, -819 T/C and -592 A/C) polymorphisms in the IL-10 promoter gene were determined by PCR-RFLP method. Persistent HBV infection was associated with IL-10-1082 AG (P = 0.001) and GG (P = 0.004) genotypes and G (P = 0.000) allele. IL-10-819 T/C and -592 A/C genotype and allele frequencies did not show any correlation with the risk of chronic hepatitis B infection. These results suggest that polymorphisms in interleukin-10 gene promoter influence clinical outcome of HBV infection and susceptibility to HBV infection.

The Bacillus subtilis yabG Gene Is Transcribed by SigK RNA Polymerase during Sporulation, and yabG Mutant Spores Have Altered Coat Protein Composition

PubMed Central

Takamatsu, Hiromu; Kodama, Takeko; Imamura, Atsuo; Asai, Kei; Kobayashi, Kazuo; Nakayama, Tatsuo; Ogasawara, Naotake; Watabe, Kazuhito

2000-01-01

The expression of six novel genes located in the region from abrB to spoVC of the Bacillus subtilis chromosome was analyzed, and one of the genes, yabG, had a predicted promoter sequence conserved among SigK-dependent genes. Northern blot analysis revealed that yabG mRNA was first detected from 4 h after the cessation of logarithmic growth (T4) in wild-type cells and in a gerE36 (GerE−) mutant but not in spoIIAC (SigF−), spoIIGAB (SigE−), spoIIIG (SigG−), and spoIVCB (SigK−) mutants. The transcription start point was determined by primer extension analysis; the −10 and −35 regions are very similar to the consensus sequences recognized by SigK-containing RNA polymerase. Inactivation of the yabG gene by insertion of an erythromycin resistance gene did not affect vegetative growth or spore resistance to heat, chloroform, and lysozyme. The germination of yabG spores in l-alanine and in a mixture of l-asparagine, d-glucose, d-fructose, and potassium chloride was also the same as that of wild-type spores. On the other hand, the protein preparation from yabG spores included 15-, 18-, 21-, 23-, 31-, 45-, and 55-kDa polypeptides which were low in or not extracted from wild-type spores under the same conditions. We determined their N-terminal amino acid sequence and found that these polypeptides were CotT, YeeK, YxeE, CotF, YrbA (31 and 45 kDa), and SpoIVA, respectively. The fluorescence of YabG-green fluorescent protein fusion produced in sporulating cells was detectable in the forespores but not in the mother cell compartment under fluorescence microscopy. These results indicate that yabG encodes a sporulation-specific protein which is involved in coat protein composition in B. subtilis. PMID:10714992

Functional requirement of a wild-type allele for mutant IDH1 to suppress anchorage-independent growth through redox homeostasis.

PubMed

Tiburcio, Patricia D B; Xiao, Bing; Berg, Shauna; Asper, Sydney; Lyne, Sean; Zhang, Yan; Zhu, Xingen; Yan, Hai; Huang, L Eric

2018-02-01

Mutations of isocitrate dehydrogenase 1 (IDH1) gene are most common in glioma, arguably preceding all known genetic alterations during tumor development. IDH1 mutations nearly invariably target the enzymatic active site Arg132, giving rise to the predominant IDH1 R132H . Cells harboring IDH1 R132H -heterozygous mutation produce 2-hydroxyglutarate (2-HG), which results in histone and DNA hypermethylation. Although exogenous IDH1 R132H transduction has been shown to promote anchorage-independent growth, the biological role of IDH1 R132H in glioma remains debatable. In this study, we demonstrate that heterozygous IDH1 R132H suppresses but hemizygous IDH1 R132H promotes anchorage-independent growth. Whereas genetic deletion of the wild-type allele in IDH1 R132H -heterozygous cells resulted in a pronounced increase in neurosphere genesis, restoration of IDH1 expression in IDH1 R132H -hemizygous cells led to the contrary. Conversely, anchorage-independent growth was antagonistic to the mutant IDH1 function by inhibiting gene expression and 2-HG production. Furthermore, we identified that in contrast to IDH1 R132H -hemizygous neurosphere, IDH1 R132H -heterozygous cells maintained a low level of reducing power to suppress neurosphere genesis, which could be bypassed, however, by the addition of reducing agent. Taken together, these results underscore the functional importance of IDH1 mutation heterozygosity in glioma biology and indicate functional loss of mutant IDH1 as an escape mechanism underlying glioma progression and the pathway of redox homeostasis as potential therapeutic targets.

Brief communication: Molecular characterization of O alleles at the ABO locus in Chilean Aymara and Huilliche Indians.

PubMed

Llop, Elena; Henríquez, Hugo; Moraga, Mauricio; Castro, Mario; Rothhammer, Francisco

2006-12-01

A molecular characterization of alleles O1, O1variant (O1v), and the mutation G542A of the ABO blood group was performed in two Amerindian populations of Chile, the Aymara (n = 84) and the Huilliche (n = 75). In addition, a sample of 82 individuals of Santiago belonging to the mixed Chilean population was typed for comparative purposes. The polymorphisms which allow for molecular differentiation of different alleles of the O blood group were studied in genomic DNA. The mutations G188, G261-, G542A, T646A, and C771T, described for alleles O1, O1v, and G542A, were determined using the PCR-RFLP (polymerase chain reaction-restriction fragment length polymorphism) technique. All individuals studied were group O homozygotes for the deletion G261-, which defines the O1 alleles. Results obtained indicate that allele O1v exhibits frequencies of 0.65, 0.81, and 0.60 in Aymara, Huilliche, and Santiago populations, respectively. The frequencies of allele O1(G542A) were 0.119, 0.113, and 0.079 in the same populations. Frequencies for alleles O1 and O1v obtained in the Chilean populations studied concur with the results obtained by other authors, respecting the greater frequency of allele O1v as well as with its heterogeneous distribution in aboriginal South American populations. In Chilean populations, Allele G542A exhibits lower frequencies than those described for indigenous populations from Brazil and may be used as an Amerind admixture marker. 2006 Wiley-Liss, Inc.

Polymorphisms -1082 G/A and -819 C/T in the interleukin-10 gene are not associated with gout susceptibility in the Chinese Han male population.

PubMed

Liu, Shiguo; Zhang, Kun; Yin, Congcong; Han, Lin; Sun, Yuping; Ren, Wei; Chu, Nan; Li, Changgui

2012-08-01

Gout is caused by monosodium urate crystal-induced inflammation of the joints and periarticular tissues. Interleukin 10 (IL-10) is an important immunoregulatory cytokine, levels of which can be influenced by functional single-nucleotide polymorphisms in the promoter. To investigate the association of -1082 G/A and -819 C/T polymorphisms in the IL-10 promoter with gout susceptibility in the Chinese Han male population. A case-control study was performed in 302 patients and 284 controls. Genotyping of IL-10 -1082 G/A and -819 C/T polymorphisms was performed by DNA sequencing techniques. An association analysis was analyzed by the χ(2) test. No significant differences were found in -819T/C and -1082 A/G genotypic and allelic frequencies between gout cases and controls (for -819T/C, χ(2)=0.212, df=1, p=0.645 by genotype; χ(2)=0.079, df=1, p=0.779 by allele; for -1082 A/G, χ(2)=2.116, df=1, p=0.146 by genotype; χ(2)=1.854, df=1, p=0.173 by allele). IL-10 -1082 G/A and -819 C/T polymorphisms may not be associated with susceptibility to gout and thus do not play a major role in the development of gout in the Chinese Han male population.

Rapid genotyping assays for the 4-base pair deletion of canine MDR1/ABCB1 gene and low frequency of the mutant allele in Border Collie dogs.

PubMed

Mizukami, Keijiro; Chang, Hye-Sook; Yabuki, Akira; Kawamichi, Takuji; Hossain, Mohammad A; Rahman, Mohammad M; Uddin, Mohammad M; Yamato, Osamu

2012-01-01

P-glycoprotein, encoded by the MDR1 or ABCB1 gene, is an integral component of the blood-brain barrier as an efflux pump for xenobiotics crucial in limiting drug uptake into the central nervous system. Dogs homozygous for a 4-base pair deletion of the canine MDR1 gene show altered expression or function of P-glycoprotein, resulting in neurotoxicosis after administration of the substrate drugs. In the present study, the usefulness of microchip electrophoresis for genotyping assays detecting this deletion mutation was evaluated. Mutagenically separated polymerase chain reaction (MS-PCR) and real-time PCR assays were newly developed and evaluated. Furthermore, a genotyping survey was carried out in a population of Border Collies dogs in Japan to determine the allele frequency in this breed. Microchip electrophoresis showed advantages in detection sensitivity and time saving over other modes of electrophoresis. The MS-PCR assay clearly discriminated all genotypes. Real-time PCR assay was most suitable for a large-scale survey due to its high throughput and rapidity. The genotyping survey demonstrated that the carrier and mutant allele frequencies were 0.49% and 0.25%, respectively, suggesting that the mutant allele frequency in Border Collies is markedly low compared to that in the susceptible dog breeds such as rough and smooth Collies.

A double chain reversal loop and two diagonal loops define the architecture of a unimolecular DNA quadruplex containing a pair of stacked G(syn)-G(syn)-G(anti)-G(anti) tetrads flanked by a G-(T-T) Triad and a T-T-T triple.

PubMed

Kuryavyi, V; Majumdar, A; Shallop, A; Chernichenko, N; Skripkin, E; Jones, R; Patel, D J

2001-06-29

The architecture of G-G-G-G tetrad-aligned DNA quadruplexes in monovalent cation solution is dependent on the directionality of the four strands, which in turn are defined by loop connectivities and the guanine syn/anti distribution along individual strands and within individual G-G-G-G tetrads. The smallest unimolecular G-quadruplex belongs to the d(G2NnG2NnG2NnG2) family, which has the potential to form two stacked G-tetrads linked by Nn loop connectivities. Previous studies have focused on the thrombin-binding DNA aptamer d(G2T2G2TGTG2T2G2), where Nn was T2 for the first and third connecting loops and TGT for the middle connecting loop. This DNA aptamer in K(+) cation solution forms a unimolecular G-quadruplex stabilized by two stacked G(syn)-G(anti)-G(syn)-G(anti) tetrads, adjacent strands which are antiparallel to each other and edge-wise connecting T2, TGT and T2 loops. We now report on the NMR-based solution structure of the d(G2T4G2CAG2GT4G2T) sequence, which differs from the thrombin-binding DNA aptamer sequence in having longer first (T4) and third (GT4) loops and a shorter (CA) middle loop. This d(G2T4G2CAG2GT4G2T) sequence in Na(+) cation solution forms a unimolecular G-quadruplex stabilized by two stacked G(syn)-G(syn)-G(anti)-G(anti) tetrads, adjacent strands which have one parallel and one antiparallel neighbors and distinct non-edge-wise loop connectivities. Specifically, the longer first (T4) and third (GT4) loops are of the diagonal type while the shorter middle loop is of the double chain reversal type. In addition, the pair of stacked G-G-G-G tetrads are flanked on one side by a G-(T-T) triad and on the other side by a T-T-T triple. The distinct differences in strand directionalities, loop connectivities and syn/anti distribution within G-G-G-G tetrads between the thrombin-binding DNA aptamer d(G2T2G2TGTG2T2G2) quadruplex reported previously, and the d(G2T4G2CAG2GT4G2T) quadruplex reported here, reinforces the polymorphic nature of higher

Resistance to collagen-induced arthritis in SHPS-1 mutant mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Okuzawa, Chie; Kaneko, Yoriaki; Murata, Yoji

SHPS-1 is a transmembrane protein that binds the protein tyrosine phosphatases SHP-1 and SHP-2 through its cytoplasmic region and is abundantly expressed on dendritic cells and macrophages. Here we show that mice expressing a mutant form of SHPS-1 fail to develop type-II collagen (CII)-induced arthritis (CIA), a model for rheumatoid arthritis in humans. Histological examinations of the arthritic paws from immunized wild-type mice revealed that cartilage was destroyed in association with marked mononuclear cell infiltration, while only mild cell infiltration was observed in immunized SHPS-1 mutant mice. Consistently, the serum levels of both IgG and IgG2a specific to CII andmore » of IL-1{beta} in immunized SHPS-1 mutant mice were markedly reduced compared with those apparent for wild-type mice. The CII-induced proliferation of, and production of cytokines by, T cells from immunized SHPS-1 mutant mice were reduced compared to wild-type cells. These results suggest that SHPS-1 is essential for development of CIA.« less

Transformation of apple (Malus × domestica) using mutants of apple acetolactate synthase as a selectable marker and analysis of the T-DNA integration sites.

PubMed

Yao, Jia-Long; Tomes, Sumathi; Gleave, Andrew P

2013-05-01

Apple acetolactate synthase mutants were generated by site-specific mutagenesis and successfully used as selection marker in tobacco and apple transformation. T-DNA/Apple genome junctions were analysed using genome-walking PCR and sequencing. An Agrobacterium-mediated genetic transformation system was developed for apple (Malus × domestica), using mutants of apple acetolactate synthase (ALS) as a selectable marker. Four apple ALS mutants were generated by site-specific mutagenesis and subsequently cloned under the transcriptional control of the CaMV 35S promoter and ocs 3' terminator, in a pART27-derived plant transformation vector. Three of the four mutations were found to confer resistance to the herbicide Glean(®), containing the active agent chlorsulfuron, in tobacco (Nicotiana tabacum) transformation. In apple transformation, leaf explants infected with Agrobacterium tumefaciens EHA105 containing one of the three ALS mutants resulted in the production of shoots on medium containing 2-8 μg L(-1) Glean(®), whilst uninfected wild-type explants failed to regenerate shoots or survive on medium containing 1 and 3 μg L(-1) Glean(®), respectively. Glean(®)-resistant, regenerated shoots were further multiplied and rooted on medium containing 10 μg L(-1) Glean(®). The T-DNA and apple genome-DNA junctions from eight rooted transgenic apple plants were analysed using genome-walking PCR amplification and sequencing. This analysis confirmed T-DNA integration into the apple genome, identified the genome integration sites and revealed the extent of any vector backbone integration, T-DNA rearrangements and deletions of apple genome DNA at the sites of integration.

Comparison of Direct Sequencing, Real-Time PCR-High Resolution Melt (PCR-HRM) and PCR-Restriction Fragment Length Polymorphism (PCR-RFLP) Analysis for Genotyping of Common Thiopurine Intolerant Variant Alleles NUDT15 c.415C>T and TPMT c.719A>G (TPMT*3C).

PubMed

Fong, Wai-Ying; Ho, Chi-Chun; Poon, Wing-Tat

2017-05-12

Thiopurine intolerance and treatment-related toxicity, such as fatal myelosuppression, is related to non-function genetic variants encoding thiopurine S-methyltransferase (TPMT) and Nudix hydrolase 15 (NUDT15). Genetic testing of the common variants NUDT15:NM_018283.2:c.415C>T (Arg139Cys, dbSNP rs116855232 T allele) and TPMT: NM_000367.4:c.719A>G (TPMT*3C, dbSNP rs1142345 G allele) in East Asians including Chinese can potentially prevent treatment-related complications. Two complementary genotyping approaches, real-time PCR-high resolution melt (PCR-HRM) and PCR-restriction fragment length morphism (PCR-RFLP) analysis were evaluated using conventional PCR and Sanger sequencing genotyping as the gold standard. Sixty patient samples were tested, revealing seven patients (11.7%) heterozygous for NUDT15 c.415C>T, one patient homozygous for the variant and one patient heterozygous for the TPMT*3C non-function allele. No patient was found to harbor both variants. In total, nine out of 60 (15%) patients tested had genotypic evidence of thiopurine intolerance, which may require dosage adjustment or alternative medication should they be started on azathioprine, mercaptopurine or thioguanine. The two newly developed assays were more efficient and showed complete concordance (60/60, 100%) compared to the Sanger sequencing results. Accurate and cost-effective genotyping assays by real-time PCR-HRM and PCR-RFLP for NUDT15 c.415C>T and TPMT*3C were successfully developed. Further studies may establish their roles in genotype-informed clinical decision-making in the prevention of morbidity and mortality due to thiopurine intolerance.

The g.1170C>T polymorphism of the 5' untranslated region of the human alpha-galactosidase gene is associated with decreased enzyme expression--evidence from a family study.

PubMed

Oliveira, J P; Ferreira, S; Reguenga, C; Carvalho, F; Månsson, J-E

2008-12-01

Subnormal leukocyte α-galactosidase (α-Gal) activity was found during evaluation of an adolescent male with cryptogenic cerebrovascular small-vessel disease. The only molecular abnormality found was the g.1170C>T single-nucleotide polymorphism (SNP) in the 5' untranslated region of exon 1 in the α-Gal gene (GLA). Historically, this polymorphism has been considered to be biologically neutral. To test the hypothesis that the g.1170T allele might be associated with lower α-Gal expression, we genotyped GLA exon 1 and measured leukocyte and plasma α-Gal in the parents, brother and sister of the index case. The g.1170T allele co-segregated with a subnormal leukocyte α-Gal activity in the three siblings. Although plasma enzyme activities were within the normal range in all five relatives, the ranking of their values suggested a dosage effect of the g.1170T allele. Western blotting assays of leukocyte protein extracts showed that the relative expression of α-Gal in both the patient and his sister was significantly lower than in sex-matched hemizygous or homozygous controls for the g.1170C allele, either normalized to the β-actin immunoblot expression or standardized to a known amount of recombinant human α-Gal. These family data, in combination with results from a recent GLA SNP screening study among healthy Portuguese individuals, suggest that the g.1170C>T SNP may be co-dominantly associated with a relatively decreased GLA expression at the transcription and/or translation level. Larger population studies are needed to confirm these findings and to test the hypothesis that the GLA g.1170C>T may contribute to the multifactorial risk of ischaemic small-vessel cerebrovascular disease.

Understanding the loss-of-function in a triple missense mutant of DNA polymerase β found in prostate cancer.

PubMed

An, Changlong; Beard, William A; Chen, Desheng; Wilson, Samuel H; Makridakis, Nick M

2013-10-01

Human DNA polymerase (pol) β is essential for base excision repair. We previously reported a triple somatic mutant of pol β (p.P261L/T292A/I298T) found in an early onset prostate tumor. This mutation abolishes polymerase activity, and the wild-type allele was not present in the tumor, indicating a complete deficiency in pol β function. The effect on polymerase activity is unexpected because the point mutations that comprise the triple mutant are not part of the active site. Herein, we demonstrate the mechanism of this loss-of-function. In order to understand the effect of the individual point mutations we biochemically analyzed all single and double mutants that comprise the triple mutant. We found that the p.I298T mutation is responsible for a marked instability of the triple mutant protein at 37˚C. At room temperature the triple mutant's low efficiency is also due to a decrease in the apparent binding affinity for the dNTP substrate, which is due to the p.T292A mutation. Furthermore, the triple mutant displays lower fidelity for transversions in vitro, due to the p.T292A mutation. We conclude that distinct mutations of the triple pol β mutant are responsible for the loss of activity, lower fidelity, and instability observed in vitro.

Fluctuations between multiple EF-G-induced chimeric tRNA states during translocation on the ribosome

NASA Astrophysics Data System (ADS)

Adio, Sarah; Senyushkina, Tamara; Peske, Frank; Fischer, Niels; Wintermeyer, Wolfgang; Rodnina, Marina V.

2015-06-01

The coupled translocation of transfer RNA and messenger RNA through the ribosome entails large-scale structural rearrangements, including step-wise movements of the tRNAs. Recent structural work has visualized intermediates of translocation induced by elongation factor G (EF-G) with tRNAs trapped in chimeric states with respect to 30S and 50S ribosomal subunits. The functional role of the chimeric states is not known. Here we follow the formation of translocation intermediates by single-molecule fluorescence resonance energy transfer. Using EF-G mutants, a non-hydrolysable GTP analogue, and fusidic acid, we interfere with either translocation or EF-G release from the ribosome and identify several rapidly interconverting chimeric tRNA states on the reaction pathway. EF-G engagement prevents backward transitions early in translocation and increases the fraction of ribosomes that rapidly fluctuate between hybrid, chimeric and posttranslocation states. Thus, the engagement of EF-G alters the energetics of translocation towards a flat energy landscape, thereby promoting forward tRNA movement.

Glutathione S-Transferase Pi-Ile 105 Val Polymorphism and Susceptibility to T2DM in Population from Turabah Region of Saudi Arabia.

PubMed

Mergani, Adil; Mansour, Ahmed Abdelkhalik; Askar, Tamer; Zahran, Rasha Nabeel; Mustafa, Adil Musa; Mohammed, Mukhtar Ahmed; Saleh, Osama Mosailhy

2016-08-01

Type 2 diabetes mellitus is characterized by chronic hyperglycemia and associated with oxidative stress resulting from accumulation of free radicals in body's tissues, which especially affects beta cells in pancreas and is an important factor in the development of diabetes and its complications. Glutathione S-transferases (GSTs) are a family of antioxidant enzymes that play important roles in decreasing ROS species and act as a kind of antioxidant defense. In a case-control study, we investigated the role of GSTP1 Ile105Val polymorphism in predisposition to T2DM in patients from Tarabah province, Saudi Arabia. The polymorphism was screened by PCR-RFLP in 90 T2DM patients and 87 healthy controls. The genotypes and alleles frequencies in cases and controls were assessed using Cochran-Armitage trend test and odds ratios (ORs), and 95 % confidence intervals (CIs) in different genetic models of inheritance were calculated. Our data indicate that G allele (Val) is associated with an increased risk for T2DM in this population in any combination (OR 4.101, 95 % CI 1.986-8.469, P = 0.00008). This indicates that individuals who are carriers for the mutant allele, either in homozygous (GG) or heterozygous (AG) state, are at fourfold higher risk for development of T2DM than other subjects in this population.

[Double mutant alleles in the EXT1 gene not previously reported in a teenager with hereditary multiple exostoses].

PubMed

Cammarata-Scalisi, Francisco; Cozar, Mónica; Grinberg, Daniel; Balcells, Susana; Asteggiano, Carla G; Martínez-Domenech, Gustavo; Bracho, Ana; Sánchez, Yanira; Stock, Frances; Delgado-Luengo, Wilmer; Zara-Chirinos, Carmen; Chacín, José Antonio

2015-04-01

Hereditary forms of multiple exostoses, now called EXT1/EXT2-CDG within Congenital Disorders of Glycosylation, are the most common benign bone tumors in humans and clinical description consists of the formation of several cartilage-capped bone tumors, usually benign and localized in the juxta-epiphyseal region of long bones, although wide body dissemination in severe cases is not uncommon. Onset of the disease is variable ranging from 2-3 years up to 13-15 years with an estimated incidence ranging from 1/18,000 to 1/50,000 cases in European countries. We present a double mutant alleles in the EXT1 gene not previously reported in a teenager and her family with hereditary multiple exostoses.

Novel mutations in β-tubulin gene in Trichoderma harzianum mutants resistant to methyl benzimidazol-2-yl carbamate.

PubMed

Li, M; Zhang, H Y; Liang, B

2013-01-01

Twelve-low resistant (LR) mutants of Trichoderma harzianum with the capability of grow fast at 0.8 μg/mL methyl benzimidazol-2-yl carbamate (MBC) were obtained using UV mutagenesis. MR and HR mutants which could grow fast at 10 and 100 μg/mL MBC, respectively, were isolated by step-up selection protocols in which UV-treated mutants were induced and mycelial sector screening was made in plates with growth medium. Subsequently, β-tubulin genes of 14 mutants were cloned to describe-the molecular lesion likely to be responsible-for MBC resistance. Comparison of the β-tubulin sequences of the mutant and sensitive strains of T. harzianum revealed 2 new MBC-binding sites differed from those in other plant pathogens. A single mutation at-amino acid 168, having Phe (TTC) instead of Ser (TCC)', was demonstrated for the HR mutant; a double mutation in amino acid 13 resulting in the substitution of Gly (GGC) by Val (GTG) was observed in β-tubulin gene of MR mutant. On the other hand, no substitutions were identified in the β-tubulin gene and its 5'-flanking regions in 12 LR mutants of T. harzianum.

[Leigh syndrome resulting from a de novo mitochondrial DNA mutation (T8993G)].

PubMed

Playán, A; Solano-Palacios, A; González de la Rosa, J B; Merino-Arribas, J M; Andreu, A L; López-Pérez, M; Montoya, J

Several degenerative neurological diseases are caused by mutations in the mitochondrial gene coding for subunit 6 of the ATPase. Thus, NARP (neurogenic weakness, ataxia, and retinitis pigmentosa) and Leigh syndromes are associated to a T8993G mutation when the percentage of mutant mitochondrial DNA is low (60 90%) or high (>90%), respectively. Leigh syndrome is also caused by a second mutation in the same position T8993C. The patient, a boy that died at 6 months, had generalized hypotonia, psychomotor delay, hepatomegaly, choreic movements and hyporreflexia. MRI showed hypodensities in the basal ganglia and brain stem as well as hyperlactacidemia. Molecular genetic analysis of the mitochondrial DNA showed that the patient had the T8993G mutation in a percentage higher than 95%. No mutated DNA was detected in blood of the proband s mother, maternal aunt and grandmother. The point mutation T8993G may occur de novo, at high levels, causing neurodegenerative diseases.

Characterization of novel sorghum brown midrib mutants from an EMS-mutagenized population

DOE PAGES

Sattler, Scott E.; Saballos, Ana; Xin, Zhanguo; ...

2014-09-02

Reducing lignin concentration in lignocellulosic biomass can increase forage digestibility for ruminant livestock and saccharification yields of biomass for bioenergy. In sorghum ( Sorghum bicolor (L.) Moench) and several other C4 grasses, brown midrib ( bmr) mutants have been shown to reduce lignin concentration. Putative bmr mutants isolated from an EMS-mutagenized population were characterized and classified based on their leaf midrib phenotype and allelism tests with the previously described sorghum bmr mutants bmr2, bmr6, and bmr12. These tests resulted in the identification of additional alleles of bmr2, bmr6,and bmr12, and, in addition, six bmr mutants were identified that were notmore » allelic to these previously described loci. Further allelism testing among these six bmr mutants showed that they represented four novel bmr loci. Based on this study, the number of bmr loci uncovered in sorghum has doubled. The impact of these lines on agronomic traits and lignocellulosic composition was assessed in a 2-yr field study. Most of the identified bmr lines showed reduced lignin concentration of their biomass relative to wild-type (WT). Effects of the six new bmr mutants on enzymatic saccharification of lignocellulosic materials were determined, but the amount of glucose released from the stover was similar to WT in all cases. Like bmr2, bmr6, and bmr12, these mutants may affect monolignol biosynthesis and may be useful for bioenergy and forage improvement when stacked together or in combination with the three previously described bmr alleles.« less

Characterization of Novel Sorghum brown midrib Mutants from an EMS-Mutagenized Population

PubMed Central

Sattler, Scott E.; Saballos, Ana; Xin, Zhanguo; Funnell-Harris, Deanna L.; Vermerris, Wilfred; Pedersen, Jeffrey F.

2014-01-01

Reducing lignin concentration in lignocellulosic biomass can increase forage digestibility for ruminant livestock and saccharification yields of biomass for bioenergy. In sorghum (Sorghum bicolor (L.) Moench) and several other C4 grasses, brown midrib (bmr) mutants have been shown to reduce lignin concentration. Putative bmr mutants isolated from an EMS-mutagenized population were characterized and classified based on their leaf midrib phenotype and allelism tests with the previously described sorghum bmr mutants bmr2, bmr6, and bmr12. These tests resulted in the identification of additional alleles of bmr2, bmr6, and bmr12, and, in addition, six bmr mutants were identified that were not allelic to these previously described loci. Further allelism testing among these six bmr mutants showed that they represented four novel bmr loci. Based on this study, the number of bmr loci uncovered in sorghum has doubled. The impact of these lines on agronomic traits and lignocellulosic composition was assessed in a 2-yr field study. Overall, most of the identified bmr lines showed reduced lignin concentration of their biomass relative to wild-type (WT). Effects of the six new bmr mutants on enzymatic saccharification of lignocellulosic materials were determined, but the amount of glucose released from the stover was similar to WT in all cases. Like bmr2, bmr6, and bmr12, these mutants may affect monolignol biosynthesis and may be useful for bioenergy and forage improvement when stacked together or in combination with the three previously described bmr alleles. PMID:25187038

Novel compound heterozygous Thyroglobulin mutations c.745+1G>A/c.7036+2T>A associated with congenital goiter and hypothyroidism in a Vietnamese family. Identification of a new cryptic 5' splice site in the exon 6.

PubMed

Citterio, Cintia E; Morales, Cecilia M; Bouhours-Nouet, Natacha; Machiavelli, Gloria A; Bueno, Elena; Gatelais, Frédérique; Coutant, Regis; González-Sarmiento, Rogelio; Rivolta, Carina M; Targovnik, Héctor M

2015-03-15

Several patients were identified with dyshormonogenesis caused by mutations in the thyroglobulin (TG) gene. These defects are inherited in an autosomal recessive manner and affected individuals are either homozygous or compound heterozygous for the mutations. The aim of the present study was to identify new TG mutations in a patient of Vietnamese origin affected by congenital hypothyroidism, goiter and low levels of serum TG. DNA sequencing identified the presence of compound heterozygous mutations in the TG gene: the maternal mutation consists of a novel c.745+1G>A (g.IVS6 + 1G>A), whereas the hypothetical paternal mutation consists of a novel c.7036+2T>A (g.IVS40 + 2T>A). The father was not available for segregation analysis. Ex-vivo splicing assays and subsequent RT-PCR analyses were performed on mRNA isolated from the eukaryotic-cells transfected with normal and mutant expression vectors. Minigene analysis of the c.745+1G>A mutant showed that the exon 6 is skipped during pre-mRNA splicing or partially included by use of a cryptic 5' splice site located to 55 nucleotides upstream of the authentic exon 6/intron 6 junction site. The functional analysis of c.7036+2T>A mutation showed a complete skipping of exon 40. The theoretical consequences of splice site mutations, predicted with the bioinformatics tool NNSplice, Fsplice, SPL, SPLM and MaxEntScan programs were investigated and evaluated in relation with the experimental evidence. These analyses predicted that both mutant alleles would result in the abolition of the authentic splice donor sites. The c.745+1G>A mutation originates two putative truncated proteins of 200 and 1142 amino acids, whereas c.7036+2T>A mutation results in a putative truncated protein of 2277 amino acids. In conclusion, we show that the c.745+1G>A mutation promotes the activation of a new cryptic donor splice site in the exon 6 of the TG gene. The functional consequences of these mutations could be structural changes in the protein

Analysis of Yellow Striped Mutants of Zea mays Reveals Novel Loci Contributing to Iron Deficiency Chlorosis

PubMed Central

Chan-Rodriguez, David; Walker, Elsbeth L.

2018-01-01

The micronutrient iron (Fe) is essential for photosynthesis, respiration, and many other processes, but it is only sparingly soluble in aqueous solution, making adequate acquisition by plants a serious challenge. Fe is a limiting factor for plant growth on approximately 30% of the world’s arable lands. Moreover, Fe deficiency in humans is a global health issue, affecting 1.62 billion people, or about 25% of the world’s population. It is imperative that we gain a better understanding of the mechanisms that plants use to regulate iron homeostasis, since these will be important targets for future biofortification and crop improvement strategies. Grasses and non-grasses have evolved independent mechanisms for primary iron uptake from the soil. The grasses, which include most of the world’s staple grains, have evolved a distinct ‘chelation’ mechanism to acquire iron from the soil. Strong iron chelators called phytosiderophores (PSs) are synthesized by grasses and secreted into the rhizosphere where they bind and solubilize Fe(III). The Fe(III)-PS complex is then taken up into root cells via transporters specific for the Fe(III)-PS complex. In this study, 31 novel, uncharacterized striped maize mutants available through the Maize Genetics Cooperation Stock Center (MGCSC) were analyzed to determine whether their mutant phenotypes are caused by decreased iron. Many of these proved to be either pale yellow or white striped mutants. Complementation tests were performed by crossing the MGCSC mutants to ys1 and ys3 reference mutants. This allowed assignment of 10 ys1 alleles and 4 ys3 alleles among the novel mutants. In addition, four ys∗ mutant lines were identified that are not allelic to either ys1 or ys3. Three of these were characterized as being non-allelic to each other and as having low iron in leaves. These represent new genes involved in iron acquisition by maize, and future cloning of these genes may reveal novel aspects of the grass iron acquisition

G6PD deficiency alleles in a malaria-endemic region in the Western Brazilian Amazon.

PubMed

Dombrowski, Jamille G; Souza, Rodrigo M; Curry, Jonathan; Hinton, Laura; Silva, Natercia R M; Grignard, Lynn; Gonçalves, Ligia A; Gomes, Ana Rita; Epiphanio, Sabrina; Drakeley, Chris; Huggett, Jim; Clark, Taane G; Campino, Susana; Marinho, Claudio R F

2017-06-15

Plasmodium vivax parasites are the predominant cause of malaria infections in the Brazilian Amazon. Infected individuals are treated with primaquine, which can induce haemolytic anaemia in glucose-6-phosphate dehydrogenase (G6PD)-deficient individuals and may lead to severe and fatal complications. This X-linked disorder is distributed globally and is caused by allelic variants with a geographical distribution that closely reflects populations exposed historically to endemic malaria. In Brazil, few studies have reported the frequency of G6PD deficiency (G6PDd) present in malaria-endemic areas. This is particularly important, as G6PDd screening is not currently performed before primaquine treatment. The aim of this study was to determine the prevalence of G6PDd in the region of Alto do Juruá, in the Western Brazilian Amazon, an area characterized by a high prevalence of P. vivax infection. Five-hundred and sixteen male volunteers were screened for G6PDd using the fluorescence spot test (Beutler test) and CareStart™ G6PD Biosensor system. Demographic and clinical-epidemiological data were acquired through an individual interview. To assess the genetic basis of G6PDd, 24 SNPs were genotyped using the Kompetitive Allele Specific PCR assay. Twenty-three (4.5%) individuals were G6PDd. No association was found between G6PDd and the number of malaria cases. An increased risk of reported haemolysis symptoms and blood transfusions was evident among the G6PDd individuals. Twenty-two individuals had the G6PDd A(-) variant and one the G6PD A(+) variant. The Mediterranean variant was not present. Apart from one polymorphism, almost all SNPs were monomorphic or with low frequencies (0-0.04%). No differences were detected among ethnic groups. The data indicates that ~1/23 males from the Alto do Juruá could be G6PD deficient and at risk of haemolytic anaemia if treated with primaquine. G6PD A(-) is the most frequent deficiency allele in this population. These results concur

A Medicago truncatula Tobacco Retrotransposon Insertion Mutant Collection with Defects in Nodule Development and Symbiotic Nitrogen Fixation1[W][OA

PubMed Central

Pislariu, Catalina I.; D. Murray, Jeremy; Wen, JiangQi; Cosson, Viviane; Muni, RajaSekhara Reddy Duvvuru; Wang, Mingyi; A. Benedito, Vagner; Andriankaja, Andry; Cheng, Xiaofei; Jerez, Ivone Torres; Mondy, Samuel; Zhang, Shulan; Taylor, Mark E.; Tadege, Million; Ratet, Pascal; Mysore, Kirankumar S.; Chen, Rujin; Udvardi, Michael K.

2012-01-01

A Tnt1-insertion mutant population of Medicago truncatula ecotype R108 was screened for defects in nodulation and symbiotic nitrogen fixation. Primary screening of 9,300 mutant lines yielded 317 lines with putative defects in nodule development and/or nitrogen fixation. Of these, 230 lines were rescreened, and 156 lines were confirmed with defective symbiotic nitrogen fixation. Mutants were sorted into six distinct phenotypic categories: 72 nonnodulating mutants (Nod−), 51 mutants with totally ineffective nodules (Nod+ Fix−), 17 mutants with partially ineffective nodules (Nod+ Fix+/−), 27 mutants defective in nodule emergence, elongation, and nitrogen fixation (Nod+/− Fix−), one mutant with delayed and reduced nodulation but effective in nitrogen fixation (dNod+/− Fix+), and 11 supernodulating mutants (Nod++Fix+/−). A total of 2,801 flanking sequence tags were generated from the 156 symbiotic mutant lines. Analysis of flanking sequence tags revealed 14 insertion alleles of the following known symbiotic genes: NODULE INCEPTION (NIN), DOESN’T MAKE INFECTIONS3 (DMI3/CCaMK), ERF REQUIRED FOR NODULATION, and SUPERNUMERARY NODULES (SUNN). In parallel, a polymerase chain reaction-based strategy was used to identify Tnt1 insertions in known symbiotic genes, which revealed 25 additional insertion alleles in the following genes: DMI1, DMI2, DMI3, NIN, NODULATION SIGNALING PATHWAY1 (NSP1), NSP2, SUNN, and SICKLE. Thirty-nine Nod− lines were also screened for arbuscular mycorrhizal symbiosis phenotypes, and 30 mutants exhibited defects in arbuscular mycorrhizal symbiosis. Morphological and developmental features of several new symbiotic mutants are reported. The collection of mutants described here is a source of novel alleles of known symbiotic genes and a resource for cloning novel symbiotic genes via Tnt1 tagging. PMID:22679222

The inactivation of RNase G reduces the Stenotrophomonas maltophilia susceptibility to quinolones by triggering the heat shock response.

PubMed

Bernardini, Alejandra; Corona, Fernando; Dias, Ricardo; Sánchez, Maria B; Martínez, Jose L

2015-01-01

Quinolone resistance is usually due to mutations in the genes encoding bacterial topoisomerases. However, different reports have shown that neither clinical quinolone resistant isolates nor in vitro obtained Stenotrophomonas maltophilia mutants present mutations in such genes. The mechanisms so far described consist on efflux pumps' overexpression. Our objective is to get information on novel mechanisms of S. maltophilia quinolone resistance. For this purpose, a transposon-insertion mutant library was obtained in S. maltophilia D457. One mutant presenting reduced susceptibility to nalidixic acid was selected. Inverse PCR showed that the inactivated gene encodes RNase G. Complementation of the mutant with wild-type RNase G allele restored the susceptibility to quinolones. Transcriptomic and real-time RT-PCR analyses showed that several genes encoding heat-shock response proteins were expressed at higher levels in the RNase defective mutant than in the wild-type strain. In agreement with this situation, heat-shock reduces the S. maltophilia susceptibility to quinolone. We can then conclude that the inactivation of the RNase G reduces the susceptibility of S. maltophilia to quinolones, most likely by regulating the expression of heat-shock response genes. Heat-shock induces a transient phenotype of quinolone resistance in S. maltophilia.

An acquired HER2 T798I gatekeeper mutation induces resistance to neratinib in a patient with HER2 mutant-driven breast cancer

PubMed Central

Hanker, Ariella B.; Brewer, Monica Red; Sheehan, Jonathan H.; Koch, James P.; Sliwoski, Gregory R.; Nagy, Rebecca; Lanman, Richard; Berger, Michael F.; Hyman, David M.; Solit, David B.; He, Jie; Miller, Vincent; Cutler, Richard E.; Lalani, Alshad S.; Cross, Darren; Lovly, Christine M.; Meiler, Jens; Arteaga, Carlos L.

2017-01-01

We report a HER2T798I gatekeeper mutation in a patient with HER2L869R-mutant breast cancer with acquired resistance to neratinib. Laboratory studies suggested that HER2L869R is a neratinib-sensitive, gain-of-function mutation that upon dimerization with mutant HER3E928G, also present in the breast cancer, amplifies HER2 signaling. The patient was treated with neratinib and exhibited a sustained partial response. Upon clinical progression, HER2T798I was detected in plasma tumor cell-free DNA. Structural modeling of this acquired mutation suggested that the increased bulk of isoleucine in HER2T798I reduces neratinib binding. Neratinib blocked HER2-mediated signaling and growth in cells expressing HER2L869R but not HER2L869R/T798I. In contrast, afatinib and the osimertinib metabolite AZ5104 strongly suppressed HER2L869R/T798I-induced signaling and cell growth. Acquisition of HER2T798I upon development of resistance to neratinib in a breast cancer with an initial activating HER2 mutation suggests HER2L869R is a driver mutation. HER2T798I-mediated neratinib resistance may be overcome by other irreversible HER2 inhibitors like afatinib. PMID:28274957

The PTPN22 1858T allele but not variants in the proximal promoter region of IL-21 gene is associated with the susceptibility to type 1 diabetes and the presence of autoantibodies in a Brazilian cohort

PubMed Central

Mainardi-Novo, D T O; Santos, A S; Fukui, R T; Gamberini, M; Correia, M R S; Ruiz, M O; Mangueira, C L P; Matioli, S R; Vasconcelos, D M; Silva, M E R

2013-01-01

Interleukin (IL)-21 and protein tyrosine phosphatase non-receptor 22 (PTPN22) regulate lymphocyte function and have been implicated in the pathogenesis of autoimmune diabetes. We sequenced the proximal promoter of the IL-21 gene for the first time and analysed the PTPN22 1858T polymorphism in type 1A diabetes (T1AD) patients and healthy controls (HC). We correlated the frequencies of islet and extra-pancreatic autoantibodies with genotypes from both loci. The case series comprised 612 T1AD patients and 792 HC. Genotyping of PTPN22 C1858T was performed on 434 T1AD patients and 689 HC. The −448 to +83 base pairs (bp) region of the IL-21 gene was sequenced in 309 Brazilian T1AD and 189 HC subjects. We also evaluated human leucocyte antigen (HLA) DR3/DR4 alleles. The frequencies of glutamic acid decarboxylase (GAD65), tyrosine phosphatase-like protein (IA)-2, anti-nuclear antibody (ANA), thyroid peroxidase (TPO), thyroglobulin (TG), thyrotrophin receptor autoantibody (TRAb), anti-smooth muscle (ASM) and 21-hydroxylase (21-OH) autoantibodies were higher in T1AD patients than in HC. The PTPN22 1858T allele was associated with an increased risk for developing T1AD [odds ratio (OR) = 1·94; P < 0·001], particularly in patients of European ancestry, and with a higher frequency of GAD65 and TG autoantibodies. HLA-DR3/DR4 alleles predominated in T1AD patients. A heterozygous allelic IL-21 gene variant (g.-241 T > A) was found in only one patient. In conclusion, only PTPN22 C1858T polymorphism and HLA-DR3 and/or DR4 alleles, but not allelic variants in the 5′-proximal region of the IL-21 gene were associated with T1AD risk. Patients with T1AD had increased frequencies of anti-islet-cell, anti-thyroid, anti-nuclear, anti-smooth muscle and anti-21-OH autoantibodies. The C1858T PTPN22 polymorphism was also associated with a higher frequency of GAD65 and TG autoantibodies. PMID:23480181

Analysis of peptidyl-propyl-cis/trans isomerase 1 (PIN1) gene -842(G > C) and -667(T > C) polymorphic variants in relation to breast cancer risk and clinico-pathological parameters.

PubMed

Naidu, Rakesh; Har, Yip C; Taib, Nur A M

2011-10-01

The purpose of this study was to investigate the association between the peptidyl-propyl-cis/trans isomerase 1 (PIN1) -842(G > C) and -667(T > C) polymorphic variants and breast cancer risk among Malaysian ethnic groups namely the Malays, Chinese and Indians, as well as clinico-pathological characteristics of the patients. The polymerase chain reaction-restriction fragment length polymorphism was used to genotype 387 breast cancer patients and 252 normal and healthy women who had no history of any malignancy. The distribution of -842(G > C) and -667(T > C) genotypes and alleles frequencies between breast cancer cases and normal individuals showed lack of statistical significance among the Malays (p > 0.05), Chinese (p > 0.05) and Indians (p > 0.05), respectively. Multivariate logistic regression analysis showed that the Malay, Chinese and Indian women who were -842CC homozygotes (p = 0.198, 0.089, 0.620), -842GC heterozygotes (p = 0.492, 0.176, 0.377) and -842C allele carriers (P = 0.226, 0.059, 0.669), respectively, were not associated with breast cancer risk. Furthermore Malay, Chinese and Indian women who were heterozygous (p = 0.777, 0.319, 0.710) and homozygous (p = 0.864, 0.986, 0.954) for -667C allele or carriers of -667C allele (p = 0.977, 0.915, 0.880), respectively, were not associated with an increased risk of breast cancer. None of the -842C and -667C allele genotypes were significantly associated with the clinico-pathological characteristics. Our findings suggest that the polymorphic variants of -842(G > C) and -667(T > C) genes may not appear to have an influence on breast cancer risk among Malaysian Malay, Chinese and Indian women.

Concurrent MPL515 and JAK2V617F mutations in myelofibrosis: chronology of clonal emergence and changes in mutant allele burden over time.

PubMed

Lasho, Terra L; Pardanani, Animesh; McClure, Rebecca F; Mesa, Ruben A; Levine, Ross L; Gilliland, D Gary; Tefferi, Ayalew

2006-12-01

MPLW515L/K and JAK2V617F can co-exist in myelofibrosis with myeloid metaplasia (MMM). The chronology of clonal emergence was studied in three such cases using serially stored bone marrow. At diagnosis, a major MPL515 mutant clone was accompanied by a minor JAK2V617F clone in all three instances. At 25 time points over a period of 4-8 years, allele burden fluctuated but remained high for MPLW515L/K and low for JAK2V617F. We conclude that MPLW515L/K and JAK2V617F are both early events in MMM and allele burden, rather than the mere presence of these mutations, might be relevant to phenotypic variation in myeloproliferative disorders.

Development of new mouse lung tumor models expressing EGFR T790M mutants associated with clinical resistance to kinase inhibitors.

PubMed

Regales, Lucia; Balak, Marissa N; Gong, Yixuan; Politi, Katerina; Sawai, Ayana; Le, Carl; Koutcher, Jason A; Solit, David B; Rosen, Neal; Zakowski, Maureen F; Pao, William

2007-08-29

The EGFR T790M mutation confers acquired resistance to kinase inhibitors in human EGFR mutant lung adenocarcinoma, is occasionally detected before treatment, and may confer genetic susceptibility to lung cancer. To study further its role in lung tumorigenesis, we developed mice with inducible expression in type II pneumocytes of EGFR(T790M) alone or together with a drug-sensitive L858R mutation. Both transgenic lines develop lung adenocarcinomas that require mutant EGFR for tumor maintenance but are resistant to an EGFR kinase inhibitor. EGFR(L858R+T790M)-driven tumors are transiently targeted by hsp90 inhibition. Notably, EGFR(T790M)-expressing animals develop tumors with longer latency than EGFR(L858R+T790M)-bearing mice and in the absence of additional kinase domain mutations. These new mouse models of mutant EGFR-dependent lung adenocarcinomas provide insight into clinical observations. The models should also be useful for developing improved therapies for patients with lung cancers harboring EGFR(T790M) alone or in conjunction with drug-sensitive EGFR kinase domain mutations.

Independent regulation of the two Pax5 alleles during B-cell development.

PubMed

Nutt, S L; Vambrie, S; Steinlein, P; Kozmik, Z; Rolink, A; Weith, A; Busslinger, M

1999-04-01

The developmental control genes of the Pax family are frequently associated with mouse mutants and human disease syndromes. The function of these transcription factors is sensitive to gene dosage, as mutation of one allele or a modest increase in gene number results in phenotypic abnormalities. Pax5 has an important role in B-cell and midbrain development. By following the expression of individual Pax5 alleles at the single-cell level, we demonstrate here that Pax5 is subject to allele-specific regulation during B-lymphopoiesis. Pax5 is predominantly transcribed from only one allele in early progenitors and mature B cells, whereas it switches to a biallelic transcription mode in immature B cells. The allele-specific regulation of Pax5 is stochastic, reversible, independent of parental origin and correlates with synchronous replication, in contrast with imprinted and other monoallelically expressed genes. As a consequence, B-lymphoid tissues are mosaics with respect to the transcribed Pax5 allele, and thus mutation of one allele in heterozygous mice results in deletion of the cell population expressing the mutant allele due to loss of Pax5 function at the single-cell level. Similar allele-specific regulation may be a common mechanism causing the haploinsufficiency and frequent association of other Pax genes with human disease.

The PTPN22 1858T allele but not variants in the proximal promoter region of IL-21 gene is associated with the susceptibility to type 1 diabetes and the presence of autoantibodies in a Brazilian cohort.

PubMed

Mainardi-Novo, D T O; Santos, A S; Fukui, R T; Gamberini, M; Correia, M R S; Ruiz, M O; Mangueira, C L P; Matioli, S R; Vasconcelos, D M; Silva, M E R

2013-04-01

Interleukin (IL)-21 and protein tyrosine phosphatase non-receptor 22 (PTPN22) regulate lymphocyte function and have been implicated in the pathogenesis of autoimmune diabetes. We sequenced the proximal promoter of the IL-21 gene for the first time and analysed the PTPN22 1858T polymorphism in type 1A diabetes (T1AD) patients and healthy controls (HC). We correlated the frequencies of islet and extra-pancreatic autoantibodies with genotypes from both loci. The case series comprised 612 T1AD patients and 792 HC. Genotyping of PTPN22 C1858T was performed on 434 T1AD patients and 689 HC. The -448 to +83 base pairs (bp) region of the IL-21 gene was sequenced in 309 Brazilian T1AD and 189 HC subjects. We also evaluated human leucocyte antigen (HLA) DR3/DR4 alleles. The frequencies of glutamic acid decarboxylase (GAD65), tyrosine phosphatase-like protein (IA)-2, anti-nuclear antibody (ANA), thyroid peroxidase (TPO), thyroglobulin (TG), thyrotrophin receptor autoantibody (TRAb), anti-smooth muscle (ASM) and 21-hydroxylase (21-OH) autoantibodies were higher in T1AD patients than in HC. The PTPN22 1858T allele was associated with an increased risk for developing T1AD [odds ratio (OR) = 1·94; P < 0·001], particularly in patients of European ancestry, and with a higher frequency of GAD65 and TG autoantibodies. HLA-DR3/DR4 alleles predominated in T1AD patients. A heterozygous allelic IL-21 gene variant (g.-241 T > A) was found in only one patient. In conclusion, only PTPN22 C1858T polymorphism and HLA-DR3 and/or DR4 alleles, but not allelic variants in the 5'-proximal region of the IL-21 gene were associated with T1AD risk. Patients with T1AD had increased frequencies of anti-islet-cell, anti-thyroid, anti-nuclear, anti-smooth muscle and anti-21-OH autoantibodies. The C1858T PTPN22 polymorphism was also associated with a higher frequency of GAD65 and TG autoantibodies. © 2012 British Society for Immunology.

Shallow boomerang-shaped influenza hemagglutinin G13A mutant structure promotes leaky membrane fusion.

PubMed

Lai, Alex L; Tamm, Lukas K

2010-11-26

Our previous studies showed that an angled boomerang-shaped structure of the influenza hemagglutinin (HA) fusion domain is critical for virus entry into host cells by membrane fusion. Because the acute angle of ∼105° of the wild-type fusion domain promotes efficient non-leaky membrane fusion, we asked whether different angles would still support fusion and thus facilitate virus entry. Here, we show that the G13A fusion domain mutant produces a new leaky fusion phenotype. The mutant fusion domain structure was solved by NMR spectroscopy in a lipid environment at fusion pH. The mutant adopted a boomerang structure similar to that of wild type but with a shallower kink angle of ∼150°. G13A perturbed the structure of model membranes to a lesser degree than wild type but to a greater degree than non-fusogenic fusion domain mutants. The strength of G13A binding to lipid bilayers was also intermediate between that of wild type and non-fusogenic mutants. These membrane interactions provide a clear link between structure and function of influenza fusion domains: an acute angle is required to promote clean non-leaky fusion suitable for virus entry presumably by interaction of the fusion domain with the transmembrane domain deep in the lipid bilayer. A shallower angle perturbs the bilayer of the target membrane so that it becomes leaky and unable to form a clean fusion pore. Mutants with no fixed boomerang angle interacted with bilayers weakly and did not promote any fusion or membrane perturbation.

Shallow Boomerang-shaped Influenza Hemagglutinin G13A Mutant Structure Promotes Leaky Membrane Fusion*

PubMed Central

Lai, Alex L.; Tamm, Lukas K.

2010-01-01

Our previous studies showed that an angled boomerang-shaped structure of the influenza hemagglutinin (HA) fusion domain is critical for virus entry into host cells by membrane fusion. Because the acute angle of ∼105° of the wild-type fusion domain promotes efficient non-leaky membrane fusion, we asked whether different angles would still support fusion and thus facilitate virus entry. Here, we show that the G13A fusion domain mutant produces a new leaky fusion phenotype. The mutant fusion domain structure was solved by NMR spectroscopy in a lipid environment at fusion pH. The mutant adopted a boomerang structure similar to that of wild type but with a shallower kink angle of ∼150°. G13A perturbed the structure of model membranes to a lesser degree than wild type but to a greater degree than non-fusogenic fusion domain mutants. The strength of G13A binding to lipid bilayers was also intermediate between that of wild type and non-fusogenic mutants. These membrane interactions provide a clear link between structure and function of influenza fusion domains: an acute angle is required to promote clean non-leaky fusion suitable for virus entry presumably by interaction of the fusion domain with the transmembrane domain deep in the lipid bilayer. A shallower angle perturbs the bilayer of the target membrane so that it becomes leaky and unable to form a clean fusion pore. Mutants with no fixed boomerang angle interacted with bilayers weakly and did not promote any fusion or membrane perturbation. PMID:20826788

Association between endothelial nitric oxide synthase (ENOS) G894T polymorphism and high altitude (HA) adaptation: a meta-analysis.

PubMed

Lu, Hong-xiang; Wang, Yu-xiao; Chen, Yu; Luo, Yong-jun

2015-11-01

Highland natives adapt well to the hypoxic environment at high altitude (HA). Several genes have been reported to be linked to HA adaptation. Previous studies showed that the endothelial ni- tric oxide synthase (ENOS) G894T polymorphism contributed to the physiology and pathophysiology of hu- mans at HA by regulating the production of NO. In this meta-analysis, we evaluate the association between the ENOS G894T polymorphism and HA adaptation through analyzing the published data. We searched all relevant literature about the ENOS G894T polymorphism and HA adaptation in PubMed, Med- line, and Embase before Step 2015. A random-effects model was applied (Revman 5.0), and study quality was assessed in duplicate. Six studies with 634 HA native cases and 621 low-altitude controls were included in this meta-analysis. From the results, we observed that the wild-type allele G was significantly overrepresented in the HA groups (OR = 1.85; 95% Cl, 1.47-2.33; P < 0.0001). In addition, the GG genotype was significantly associated with HA adaptation (OR = 1.99; 95% Cl, 1.54-2.57; P < 0.0001). Our results showed that in 894 G allele carriers, the GG genotype might be a beneficial factor for HA adaptation through enhancing the level of NO. However, more studies were needed to confirm our findings due to the limited sample size.

The Ctf18RFC Clamp Loader Is Essential for Telomere Stability in Telomerase-Negative and mre11 Mutant Alleles

PubMed Central

Parke, Courtney; Tatum, Danielle; Lustig, Arthur J.

2014-01-01

The function of the replication clamp loaders in the semi-conservative telomere replication and their relationship to telomerase- and recombination mechanisms of telomere addition remains ambiguous. We have investigated the variant clamp loader Ctf18 RFC (Replication Factor C). To understand the role of Ctf18 at the telomere, we first investigated genetic interactions after loss of Ctf18 and TLC1 (the yeast telomerase RNA). We find that the tlc1▵ ctf18▵ double mutant confers a rapid >1000-fold decrease in viability. The rate of loss was similar to the kinetics of cell death in rad52▵ tlc1▵ cells. However, the Ctf18 pathway is distinct from Rad52, required for the repair of DSBs, as demonstrated by the synthetic lethality of rad52▵ tlc1▵ ctf18▵ triple mutants. These data suggest that each mutant elicits non-redundant defects acting on the same substrate. Second, interactions of the yeast hyper-recombinational mutant, mre11A470T, with ctf18▵ confer a synergistic cold sensitivity. The phenotype of these double mutants ultimately results in telomere loss and the generation of recombinational survivors. We observed a similar synergism between single mutants that led to hypersensitivity to the DNA alkylating agent, methane methyl sulphonate (MMS), the replication fork inhibitor hydroxyurea (HU), and to a failure to separate telomeres of sister chromatids. Hence, ctf18▵ and mre11A470T act in different pathways on telomere substrates for multiple phenotypes. The mre11A470T cells also displayed a DNA damage response (DDR) at 15°C but not at 30°C while ctf18▵ mutants conferred a constitutive DDR activity. Both the 15°C DDR pattern and growth rate were reversible at 30°C and displayed telomerase activity in vivo. We hypothesize that Ctf18 confers protection against stalling and/or breaks at the replication fork in cells that either lack, or are compromised for, telomerase activity. This Ctf18-based function is likely to contribute another level to

Determination of frequencies of alleles, associated with the pseudodeficiency of lysosomal hydrolases, in population of Ukraine.

PubMed

Olkhovych, N V; Gorovenko, N G

2016-01-01

The pseudodeficiency of lysosomal hydrolases described as a significant reduction in enzyme activi­ty in vitro in clinically healthy individuals, can lead to diagnostic errors in the process of biochemical analysis of lysosomal storage disease in case of its combination with pathology of another origin. Pseudodeficiency is mostly caused by some non-pathogenic changes in the corresponding gene. These changes lead to the in vitro lability of the enzyme molecule, whereas in vivo the enzyme retains its functional activity. To assess the prevalence of the most common lysosomal hydrolases pseudodeficiency alleles in Ukraine, we have determined the frequency of alleles c.1055A>G and c.* 96A>G in the ARSA gene, substitutions c.739C>T (R247W) and c.745C>T (R249W) in the HEXA gene, c.1726G>A (G576S) and c.2065G>A (E689K) in the GAA gene, c.937G>T (D313Y) in the GLA1 gene and c.898G>A (A300T) in the IDUA gene in a group of 117 healthy individuals from different regions of the country and 14 heterozygous carriers of pathogenic mutations in the HEXA gene (parents of children with confirmed diagnosis of Tay-Sachs disease). The total frequency of haplotypes, associated with arylsulfatase A pseudodeficiency, in healthy people in Ukraine (c.1055G/c.*96G and c.1055G/c.*96A haplotypes) was 10.3%. The frequency of c.739C>T (R247W) allele, associated with hexo­saminidase A pseudodeficiency, among Tay-Sachs carriers from Ukraine was 7.1%. The total frequency of α-glucosidase pseudodeficiency haplotypes in healthy individuals in Ukraine (c.1726A/c.2065A and c.1726G/c.2065A haplotypes) was 2.6%. No person among examined individuals with the substitution c.937G>T (D313Y) in the GLA1 gene and c.898G>A (A300T) in the IDUA gene was found. The differential diagnostics of lysosomal storage diseases requires obligatory determination of the presence of the pseudodeficiency alleles, particularly the ones with high incidence in the total population. Ignoring phenomenon of pseudodeficiency may

An Overexpressed Q Allele Leads to Increased Spike Density and Improved Processing Quality in Common Wheat (Triticum aestivum).

PubMed

Xu, Bin-Jie; Chen, Qing; Zheng, Ting; Jiang, Yun-Feng; Qiao, Yuan-Yuan; Guo, Zhen-Ru; Cao, Yong-Li; Wang, Yan; Zhang, Ya-Zhou; Zong, Lu-Juan; Zhu, Jing; Liu, Cai-Hong; Jiang, Qian-Tao; Lan, Xiu-Jin; Ma, Jian; Wang, Ji-Rui; Zheng, You-Liang; Wei, Yu-Ming; Qi, Peng-Fei

2018-03-02

Spike density and processing quality are important traits in modern wheat production and are controlled by multiple gene loci. The associated genes have been intensively studied and new discoveries have been constantly reported during the past few decades. However, no gene playing a significant role in the development of these two traits has been identified. In the current study, a common wheat mutant with extremely compact spikes and good processing quality was isolated and characterized. A new allele ( Q c1 ) of the Q gene (an important domestication gene) responsible for the mutant phenotype was cloned, and the molecular mechanism for the mutant phenotype was studied. Results revealed that Q c1 originated from a point mutation that interferes with the miRNA172-directed cleavage of Q transcripts, leading to its overexpression. It also reduces the longitudinal cell size of rachises, resulting in an increased spike density. Furthermore, Q c1 increases the number of vascular bundles, which suggests a higher efficiency in the transportation of assimilates in the spikes of the mutant than that of wild type. This accounts for the improved processing quality. The effects of Q c1 on spike density and wheat processing quality were confirmed by analyzing nine common wheat mutants possessing four different Q c alleles. These results deepen our understanding of the key roles of Q gene, and provide new insights for the potential application of Q c alleles in wheat quality breeding. Copyright © 2018 Xu et al.

GABI-Kat SimpleSearch: new features of the Arabidopsis thaliana T-DNA mutant database.

PubMed

Kleinboelting, Nils; Huep, Gunnar; Kloetgen, Andreas; Viehoever, Prisca; Weisshaar, Bernd

2012-01-01

T-DNA insertion mutants are very valuable for reverse genetics in Arabidopsis thaliana. Several projects have generated large sequence-indexed collections of T-DNA insertion lines, of which GABI-Kat is the second largest resource worldwide. User access to the collection and its Flanking Sequence Tags (FSTs) is provided by the front end SimpleSearch (http://www.GABI-Kat.de). Several significant improvements have been implemented recently. The database now relies on the TAIRv10 genome sequence and annotation dataset. All FSTs have been newly mapped using an optimized procedure that leads to improved accuracy of insertion site predictions. A fraction of the collection with weak FST yield was re-analysed by generating new FSTs. Along with newly found predictions for older sequences about 20,000 new FSTs were included in the database. Information about groups of FSTs pointing to the same insertion site that is found in several lines but is real only in a single line are included, and many problematic FST-to-line links have been corrected using new wet-lab data. SimpleSearch currently contains data from ~71,000 lines with predicted insertions covering 62.5% of the 27,206 nuclear protein coding genes, and offers insertion allele-specific data from 9545 confirmed lines that are available from the Nottingham Arabidopsis Stock Centre.

A genetic variant c.553G > T in the apolipoprotein A5 gene is associated with an increased risk of coronary artery disease and altered triglyceride levels in a Chinese population.

PubMed

Tang, Yibo; Sun, Ping; Guo, Dongping; Ferro, Albert; Ji, Yong; Chen, Qi; Fan, Leming

2006-04-01

Elevation in plasma triglycerides (TG) has been widely accepted as a coronary artery disease (CAD) risk predictor. Recently, a new apolipoprotein playing an important role in TG metabolism named apolipoprotein AV (apoAV) was discovered, which is encoded by the APOA5 gene. Several single nucleotide polymorphisms (SNPs) of APOA5 associated with increased TG concentrations have been identified. We here report that a recently identified genetic variant, c.553G>T in the APOA5 gene which causes a substitution of a cysteine for a glycine residue at amino acid residue 185(G185C) is also associated with increased TG levels. To investigate the association between this genetic variation and the risk of CAD, a case-control study comprising 232 patients with CAD and 302 controls from the same area of China was performed. The minor allele frequencies of c.553G > T for the CAD and control groups were 7.76 and 3.97%, respectively (P = 0.008). In both the CAD and control groups, the T allele carriers had higher serum TG levels than homozygous carriers of the major G allele (CAD group: 2.67 +/- 1.48 mmol/l versus 1.95 +/- 1.02 mmol/l, P = 0.021; controls: 2.31 +/- 1.20 mmol/l versus 1.68 +/- 0.95 mmol/l, P = 0.002). After adjustment for age, gender, body mass index, smoking status, glucose and presence of hypertension, the odds ratio (OR) for CAD in the T allele carriers was 2.089 (95% CI = 1.140-3.830, P = 0.017), in comparison to the individuals without the T allele. These results suggest that the APOA5 c.553G > T polymorphism is an important predictor for hypertriglyceridemia and CAD.

Identification and utilization of cleistogamy gene cl7(t) in rice (Oryza sativa L.).

PubMed

Ni, Da-Hu; Li, Juan; Duan, Yong-Bo; Yang, Ya-Chun; Wei, Peng-Cheng; Xu, Rong-Fang; Li, Chun-Rong; Liang, Dan-Dan; Li, Hao; Song, Feng-Shun; Ni, Jin-Long; Li, Li; Yang, Jian-Bo

2014-05-01

Gene transformation is an important method for improvement of plants into elite varieties. However, the possibility of gene flow between genetically modified (GM) crops and similar species is a serious public issue that may potentially endanger ecological stability. Cleistogamy is expected to be an ideal genetic tool for preventing transgene propagation from GM crops. A rice mutant, cl7(t), was created by ethyl methanesulfonate mutagenesis. The mutant exhibited cleistogamy, and had closed spikelets, reduced plant height, and altered morphology of the leaves, panicle, and seeds. Anatomical investigations revealed that the cl7(t) mutant contained more vascular bundles and thicker stems than the wild type, which increased the mechanical strength of its internodes, and anti-lodging ability. Further studies demonstrated that the force required to open the lemma and palea was higher in the cl7(t) mutant, and there was weak swelling ability in the lodicules, which leads to cleistogamy. Allelic analyses and complementation tests indicated that cl7(t) was a novel allele of dep2, a mutant that was previously reported to have similar panicle morphology. Sequence analysis showed that cl7(t) had a single nucleotide substitution (C to A) in the third exon that leads to a Ser substitution with a stop codon, giving a truncated DEP2 protein. Quantitative RT-PCR and in situ hybridization tests demonstrated that there was lower CL7(t) expression level in the spikelets and weaker CL7(t) signals in the lodicules of the cl7(t) mutant compared with wild type, which implies that CL7(t) might participate in the development of lodicules. To improve the agronomic traits of cl7(t) to fit the needs of field production, the cl7(t) mutant was crossed with an intermediate-type rice variety named Guanghui102, which bears some important agronomic traits, including increased grain numbers and high rate of seed setting. Through multi-generational pedigree selection, cleistogamy lines with improved

In Black South Africans from Rural and Urban Communities, the 4G/5G PAI-1 Polymorphism Influences PAI-1 Activity, but Not Plasma Clot Lysis Time

PubMed Central

de Lange, Zelda; Rijken, Dingeman C.; Hoekstra, Tiny; Conradie, Karin R.; Jerling, Johann C.; Pieters, Marlien

2013-01-01

Data on genetic and environmental factors influencing PAI-1 levels and their consequent effect on clot lysis in black African populations are limited. We identified polymorphisms in the promoter area of the PAI-1 gene and determined their influence on PAI-1act levels and plasma clot lysis time (CLT). We also describe gene-environment interactions and the effect of urbanisation. Data from 2010 apparently healthy urban and rural black participants from the South African arm of the PURE study were cross-sectionally analysed. The 5G allele frequency of the 4G/5G polymorphism was 0.85. PAI-1act increased across genotypes in the urban subgroup (p = 0.009) but not significantly in the rural subgroup, while CLT did not differ across genotypes. Significant interaction terms were found between the 4G/5G polymorphism and BMI, waist circumference and triglycerides in determining PAI-1act, and between the 4G/5G polymorphism and fibrinogen and fibrinogen gamma prime in determining CLT. The C428T and G429A polymorphisms did not show direct relationships with PAI-1act or CLT but they did influence the association of other environmental factors with PAI-1act and CLT. Several of these interactions differed significantly between rural and urban subgroups, particularly in individuals harbouring the mutant alleles. In conclusion, although the 4G/5G polymorphism significantly affected PAI-1act, it contributed less than 1% to the PAI-1act variance. (Central) obesity was the biggest contributor to PAI-1act variance (12.5%). Urbanisation significantly influenced the effect of the 4G/5G polymorphism on PAI-1act as well as gene-environment interactions for the C428T and G429A genotypes in determining PAI-1act and CLT. PMID:24386152

In black South Africans from rural and urban communities, the 4G/5G PAI-1 polymorphism influences PAI-1 activity, but not plasma clot lysis time.

PubMed

de Lange, Zelda; Rijken, Dingeman C; Hoekstra, Tiny; Conradie, Karin R; Jerling, Johann C; Pieters, Marlien

2013-01-01

Data on genetic and environmental factors influencing PAI-1 levels and their consequent effect on clot lysis in black African populations are limited. We identified polymorphisms in the promoter area of the PAI-1 gene and determined their influence on PAI-1act levels and plasma clot lysis time (CLT). We also describe gene-environment interactions and the effect of urbanisation. Data from 2010 apparently healthy urban and rural black participants from the South African arm of the PURE study were cross-sectionally analysed. The 5G allele frequency of the 4G/5G polymorphism was 0.85. PAI-1act increased across genotypes in the urban subgroup (p = 0.009) but not significantly in the rural subgroup, while CLT did not differ across genotypes. Significant interaction terms were found between the 4G/5G polymorphism and BMI, waist circumference and triglycerides in determining PAI-1act, and between the 4G/5G polymorphism and fibrinogen and fibrinogen gamma prime in determining CLT. The C428T and G429A polymorphisms did not show direct relationships with PAI-1act or CLT but they did influence the association of other environmental factors with PAI-1act and CLT. Several of these interactions differed significantly between rural and urban subgroups, particularly in individuals harbouring the mutant alleles. In conclusion, although the 4G/5G polymorphism significantly affected PAI-1act, it contributed less than 1% to the PAI-1act variance. (Central) obesity was the biggest contributor to PAI-1act variance (12.5%). Urbanisation significantly influenced the effect of the 4G/5G polymorphism on PAI-1act as well as gene-environment interactions for the C428T and G429A genotypes in determining PAI-1act and CLT.

Olanzapine-induced weight gain is associated with the -759C/T and -697G/C polymorphisms of the HTR2C gene.

PubMed

Godlewska, B R; Olajossy-Hilkesberger, L; Ciwoniuk, M; Olajossy, M; Marmurowska-Michałowska, H; Limon, J; Landowski, J

2009-08-01

Weight gain, a serious problem associated with some antipsychotic drugs, notably olanzapine and clozapine, was suggested to be associated with -759C/T polymorphism of the 5-HT2C receptor gene. This study aimed to examine a potential association of two functional polymorphisms of the promoter region of this gene: -759C/T (rs3813929) and -697G/C (rs518147), with weight gain after 6 weeks of olanzapine monotherapy. It included 107 patients with schizophrenia; among them 36 are first-episode drug-naive patients. Analysis was carried out by PCR-restriction fragment length polymorphism. A protective effect of -759T and -697C alleles was found: significantly less patients with -697C (3/51) and no patient with -759T (0/28) alleles experienced body mass index increase >or=10% (P=0.0006 and 0.002, respectively). The same was true for drug-naive patients possessing any of the variant alleles. There was a significant association of haplotypes with a >or=10% body mass index increase (P=0.001). On the basis of the additional statistical analysis, the more important role of -697C allele was suggested.

Processing of intervening sequences: a new yeast mutant which fails to excise intervening sequences from precursor tRNAs.

PubMed

Hopper, A K; Schultz, L D; Shapiro, R A

1980-03-01

By using conditional loss of suppression an an assay, we have been successful in screening for a yeast mutant which is defective in tRNA processing. The los1-1 mutation causes an accumulation of a subset of precursor tRNAs at the nonpermissive temperature. These pre-tRNAs are like those which accumulate in the yeast mutant ts 136 (rna1) in that they have transcribed intervening sequences. The mutations at los1-1 and rna1 complement and segregate independently of each other. The los1-1 mutation affects the expression of all 8 tyrosine-inserting suppressor loci, but does not seem to affect rRNA or mRNA synthesis.

Spectrum of MTHFR gene SNPs C677T and A1298C: a study among 23 population groups of India.

PubMed

Saraswathy, Kallur Nava; Asghar, Mohammad; Samtani, Ratika; Murry, Benrithung; Mondal, Prakash Ranjan; Ghosh, Pradeep Kumar; Sachdeva, Mohinder Pal

2012-04-01

Elevated homocysteine is a risk factor for many complex disorders. The role of methylenetetrahydrofolate reductase (MTHFR) gene in methylation of homocysteine makes it one of the most important candidate genes for these disorders. Considering the heterogeneity in its distribution in world populations, we screened MTHFR C677T and A1298C single nucleotide polymorphisms in a total of 23 Indian caste, tribal and religious population groups from five geographical regions of India and belonging to four major linguistic groups. The frequencies of MTHFR 677T and 1298C alleles were found to be 10.08 and 20.66%, respectively. MTHFR homozygous genotype 677TT was absent in eight population groups and homozygous 1298CC was absent in two population groups. 677T allele was found to be highest among north Indian populations with Indo-European tongue and 1298C was high among Dravidian-speaking tribes of east India and south India. The less common mutant haplotype 677T-1298C was observed among seven population groups and overall the frequency of this haplotype was 0.008, which is similar to that of African populations. cis configuration of 677T and 1298C was 0.94%. However, we could not find any individual with four mutant alleles which supports the earlier observation that presence of more than two mutant alleles may decrease the viability of foetus and possibly be a selective disadvantage in the population.

An Acquired HER2T798I Gatekeeper Mutation Induces Resistance to Neratinib in a Patient with HER2 Mutant-Driven Breast Cancer.

PubMed

Hanker, Ariella B; Brewer, Monica Red; Sheehan, Jonathan H; Koch, James P; Sliwoski, Gregory R; Nagy, Rebecca; Lanman, Richard; Berger, Michael F; Hyman, David M; Solit, David B; He, Jie; Miller, Vincent; Cutler, Richard E; Lalani, Alshad S; Cross, Darren; Lovly, Christine M; Meiler, Jens; Arteaga, Carlos L

2017-06-01

We report a HER2 T798I gatekeeper mutation in a patient with HER2 L869R -mutant breast cancer with acquired resistance to neratinib. Laboratory studies suggested that HER2 L869R is a neratinib-sensitive, gain-of-function mutation that upon dimerization with mutant HER3 E928G , also present in the breast cancer, amplifies HER2 signaling. The patient was treated with neratinib and exhibited a sustained partial response. Upon clinical progression, HER2 T798I was detected in plasma tumor cell-free DNA. Structural modeling of this acquired mutation suggested that the increased bulk of isoleucine in HER2 T798I reduces neratinib binding. Neratinib blocked HER2-mediated signaling and growth in cells expressing HER2 L869R but not HER2 L869R/T798I In contrast, afatinib and the osimertinib metabolite AZ5104 strongly suppressed HER2 L869R/T798I -induced signaling and cell growth. Acquisition of HER2 T798I upon development of resistance to neratinib in a breast cancer with an initial activating HER2 mutation suggests HER2 L869R is a driver mutation. HER2 T798I -mediated neratinib resistance may be overcome by other irreversible HER2 inhibitors like afatinib. Significance: We found an acquired HER2 gatekeeper mutation in a patient with HER2 -mutant breast cancer upon clinical progression on neratinib. We speculate that HER2 T798I may arise as a secondary mutation following response to effective HER2 tyrosine kinase inhibitors (TKI) in other cancers with HER2 -activating mutations. This resistance may be overcome by other irreversible HER2 TKIs, such as afatinib. Cancer Discov; 7(6); 575-85. ©2017 AACR. This article is highlighted in the In This Issue feature, p. 539 . ©2017 American Association for Cancer Research.

Natural Arabidopsis brx loss-of-function alleles confer root adaptation to acidic soil.

PubMed

Gujas, Bojan; Alonso-Blanco, Carlos; Hardtke, Christian S

2012-10-23

Soil acidification is a major agricultural problem that negatively affects crop yield. Root systems counteract detrimental passive proton influx from acidic soil through increased proton pumping into the apoplast, which is presumably also required for cell elongation and stimulated by auxin. Here, we found an unexpected impact of extracellular pH on auxin activity and cell proliferation rate in the root meristem of two Arabidopsis mutants with impaired auxin perception, axr3 and brx. Surprisingly, neutral to slightly alkaline media rescued their severely reduced root (meristem) growth by stimulating auxin signaling, independent of auxin uptake. The finding that proton pumps are hyperactive in brx roots could explain this phenomenon and is consistent with more robust growth and increased fitness of brx mutants on overly acidic media or soil. Interestingly, the original brx allele was isolated from a natural stock center accession collected from acidic soil. Our discovery of a novel brx allele in accessions recently collected from another acidic sampling site demonstrates the existence of independently maintained brx loss-of-function alleles in nature and supports the notion that they are advantageous in acidic soil pH conditions, a finding that might be exploited for crop breeding. Copyright © 2012 Elsevier Ltd. All rights reserved.

Allelic Variation in CXCL16 Determines CD3+ T Lymphocyte Susceptibility to Equine Arteritis Virus Infection and Establishment of Long-Term Carrier State in the Stallion.

PubMed

Sarkar, Sanjay; Bailey, Ernest; Go, Yun Young; Cook, R Frank; Kalbfleisch, Ted; Eberth, John; Chelvarajan, R Lakshman; Shuck, Kathleen M; Artiushin, Sergey; Timoney, Peter J; Balasuriya, Udeni B R

2016-12-01

Equine arteritis virus (EAV) is the causative agent of equine viral arteritis (EVA), a respiratory, systemic, and reproductive disease of horses and other equid species. Following natural infection, 10-70% of the infected stallions can become persistently infected and continue to shed EAV in their semen for periods ranging from several months to life. Recently, we reported that some stallions possess a subpopulation(s) of CD3+ T lymphocytes that are susceptible to in vitro EAV infection and that this phenotypic trait is associated with long-term carrier status following exposure to the virus. In contrast, stallions not possessing the CD3+ T lymphocyte susceptible phenotype are at less risk of becoming long-term virus carriers. A genome wide association study (GWAS) using the Illumina Equine SNP50 chip revealed that the ability of EAV to infect CD3+ T lymphocytes and establish long-term carrier status in stallions correlated with a region within equine chromosome 11. Here we identified the gene and mutations responsible for these phenotypes. Specifically, the work implicated three allelic variants of the equine orthologue of CXCL16 (EqCXCL16) that differ by four non-synonymous nucleotide substitutions (XM_00154756; c.715 A → T, c.801 G → C, c.804 T → A/G, c.810 G → A) within exon 1. This resulted in four amino acid changes with EqCXCL16S (XP_001504806.1) having Phe, His, Ile and Lys as compared to EqCXL16R having Tyr, Asp, Phe, and Glu at 40, 49, 50, and 52, respectively. Two alleles (EqCXCL16Sa, EqCXCL16Sb) encoded identical protein products that correlated strongly with long-term EAV persistence in stallions (P<0.000001) and are required for in vitro CD3+ T lymphocyte susceptibility to EAV infection. The third (EqCXCL16R) was associated with in vitro CD3+ T lymphocyte resistance to EAV infection and a significantly lower probability for establishment of the long-term carrier state (viral persistence) in the male reproductive tract. EqCXCL16Sa and EqCXCL16

Allelic Variation in CXCL16 Determines CD3+ T Lymphocyte Susceptibility to Equine Arteritis Virus Infection and Establishment of Long-Term Carrier State in the Stallion

PubMed Central

Cook, R. Frank; Eberth, John; Chelvarajan, R. Lakshman; Artiushin, Sergey; Timoney, Peter J.

2016-01-01

Equine arteritis virus (EAV) is the causative agent of equine viral arteritis (EVA), a respiratory, systemic, and reproductive disease of horses and other equid species. Following natural infection, 10–70% of the infected stallions can become persistently infected and continue to shed EAV in their semen for periods ranging from several months to life. Recently, we reported that some stallions possess a subpopulation(s) of CD3+ T lymphocytes that are susceptible to in vitro EAV infection and that this phenotypic trait is associated with long-term carrier status following exposure to the virus. In contrast, stallions not possessing the CD3+ T lymphocyte susceptible phenotype are at less risk of becoming long-term virus carriers. A genome wide association study (GWAS) using the Illumina Equine SNP50 chip revealed that the ability of EAV to infect CD3+ T lymphocytes and establish long-term carrier status in stallions correlated with a region within equine chromosome 11. Here we identified the gene and mutations responsible for these phenotypes. Specifically, the work implicated three allelic variants of the equine orthologue of CXCL16 (EqCXCL16) that differ by four non-synonymous nucleotide substitutions (XM_00154756; c.715 A → T, c.801 G → C, c.804 T → A/G, c.810 G → A) within exon 1. This resulted in four amino acid changes with EqCXCL16S (XP_001504806.1) having Phe, His, Ile and Lys as compared to EqCXL16R having Tyr, Asp, Phe, and Glu at 40, 49, 50, and 52, respectively. Two alleles (EqCXCL16Sa, EqCXCL16Sb) encoded identical protein products that correlated strongly with long-term EAV persistence in stallions (P<0.000001) and are required for in vitro CD3+ T lymphocyte susceptibility to EAV infection. The third (EqCXCL16R) was associated with in vitro CD3+ T lymphocyte resistance to EAV infection and a significantly lower probability for establishment of the long-term carrier state (viral persistence) in the male reproductive tract. EqCXCL16Sa and Eq

Coinheritance of a novel mutation on the HBA1 gene: c.187delG (p.W62fsX66) [codon 62 (-G) (α1)] with the α212 patchwork allele and Hb S [β6(A3)Glu→Val, GAG>GTG; HBB: c.20A>T].

PubMed

Scheps, Karen G; De Paula, Silvia M; Bitsman, Alicia R; Freigeiro, Daniel H; Basack, F Nora; Pennesi, Sandra P; Varela, Viviana

2013-01-01

We describe a novel frameshift mutation on the HBA1 gene (c.187delG), causative of α-thalassemia (α-thal) in a Black Cuban family with multiple sequence variants in the HBA genes and the Hb S [β6(A3)Glu→Val, GAG>GTG; HBB: c.20A>T] mutation. The deletion of the first base of codon 62 resulted in a frameshift at amino acid 62 with a putative premature termination codon (PTC) at amino acid 66 on the same exon (p.W62fsX66), which most likely triggers nonsense mediated decay of the resulting mRNA. This study also presents the first report of the α212 patchwork allele in Latin America and the description of two new sequence variants in the HBA2 region (c.-614G>A in the promoter region and c.95+39 C>T on the first intron).

[Meta-analysis on the association of G894T polymorphism in endothelial nitric oxide synthase gene and essential hypertension in Chinese population].

PubMed

Wang, Cong-Ju; Zhao, Jing-Bo; Xu, Jia-Liang; Xiang, Ze-Lin; Liang, Chang-Wei; Li, Jie

2009-08-01

To evaluate the relationship between G894T (Glu298Asp) polymorphism in the endothelial nitric oxide synthase (eNOS) gene and essential hypertension in Chinese population from different regions. Odds ratios (ORs) of G894T genotype and allele distributions in essential hypertension patients against healthy controls were analyzed. All the relevant studies were screened with poor-qualified studies eliminated. Meta-analysis software MIX (Meta-analysis with interactive explanations-version 1.71), was applied for investigating and analyzing heterogeneity among individual studies and summarizing the effects across studies, and the risk of publication bias was evaluated. A total of 1900 cases and 1216 controls from 10 studies were included. The heterogeneity between studies was significant (P = 0.013; P = 0.011) and there were substantial sources of publication bias (P = 0.049; P = 0.038). The pooled OR (with 95%CI) of GT + TT vs. GG genotype was 1.79 (1.33 - 2.42) (Z = 3.83, P < 0.001), and the pooled OR (with 95%CI) of T vs. G allele was 1.73 (1.32 - 2.27) (Z = 3.92, P < 0.001). In Chinese population, mainly the Hans ethnic group, 894G-->T mutation in the eNOS appeared to be related to essential hypertension.

Engineering of a glycosidase Family 7 cellobiohydrolase to more alkaline pH optimum: the pH behaviour of Trichoderma reesei Cel7A and its E223S/ A224H/L225V/T226A/D262G mutant.

PubMed Central

Becker, D; Braet, C; Brumer , H; Claeyssens, M; Divne, C; Fagerström, B R; Harris, M; Jones, T A; Kleywegt, G J; Koivula, A; Mahdi, S; Piens, K; Sinnott, M L; Ståhlberg, J; Teeri, T T; Underwood, M; Wohlfahrt, G

2001-01-01

The crystal structures of Family 7 glycohydrolases suggest that a histidine residue near the acid/base catalyst could account for the higher pH optimum of the Humicola insolens endoglucanase Cel7B, than the corresponding Trichoderma reesei enzymes. Modelling studies indicated that introduction of histidine at the homologous position in T. reesei Cel7A (Ala(224)) required additional changes to accommodate the bulkier histidine side chain. X-ray crystallography of the catalytic domain of the E223S/A224H/L225V/T226A/D262G mutant reveals that major differences from the wild-type are confined to the mutations themselves. The introduced histidine residue is in plane with its counterpart in H. insolens Cel7B, but is 1.0 A (=0.1 nm) closer to the acid/base Glu(217) residue, with a 3.1 A contact between N(epsilon2) and O(epsilon1). The pH variation of k(cat)/K(m) for 3,4-dinitrophenyl lactoside hydrolysis was accurately bell-shaped for both wild-type and mutant, with pK(1) shifting from 2.22+/-0.03 in the wild-type to 3.19+/-0.03 in the mutant, and pK(2) shifting from 5.99+/-0.02 to 6.78+/-0.02. With this poor substrate, the ionizations probably represent those of the free enzyme. The relative k(cat) for 2-chloro-4-nitrophenyl lactoside showed similar behaviour. The shift in the mutant pH optimum was associated with lower k(cat)/K(m) values for both lactosides and cellobiosides, and a marginally lower stability. However, k(cat) values for cellobiosides are higher for the mutant. This we attribute to reduced non-productive binding in the +1 and +2 subsites; inhibition by cellobiose is certainly relieved in the mutant. The weaker binding of cellobiose is due to the loss of two water-mediated hydrogen bonds. PMID:11336632

Complex mosaic CDKL5 deletion with two distinct mutant alleles in a 4-year-old girl.

PubMed

Boutry-Kryza, Nadia; Ville, Dorothée; Labalme, Audrey; Calender, Alain; Dupont, Jean-Michel; Touraine, Renaud; Edery, Patrick; des Portes, Vincent; Sanlaville, Damien; Lesca, Gaetan

2014-08-01

Mutations of the CDKL5 gene cause early epileptic encephalopathy. Patients manifest refractory epilepsy, beginning before the age of 3 months, which is associated with severe psychomotor delay and features that overlap with Rett syndrome. We report here a patient with mosaicism for CDKL5 exonic deletion, with the presence of two mutant alleles. The affected 4-year-old girl presented with infantile spasms, beginning at the age of 9 months, but subsequent progression of the disease was consistent with the classical CDKL5-related phenotype. A deletion of exons 17 and 18 was suspected on the basis of Multiplex Ligation Probe Amplification analysis, but unexpected results for cDNA analysis, which showed the presence of an abnormal transcript with the deletion of exon 18 only, led us to suspect that two distinct events might have occurred. We used custom array-CGH to determine the size and breakpoints of these deletions. Exon 18 was deleted from one of the abnormal alleles, and exon 17 was deleted from the other. A Fork Stalling and Template Switching (FoSTeS) mechanism was proposed to explain the two events, given the presence of regions of microhomology at the breakpoints. We propose here an original involvement of the FoSTeS mechanism to explain the co-occurrence of these two events in the CDKL5 gene in a single patient. This patient highlights the difficulties involved in the detection of such abnormalities, particularly when they occur in a mosaic state and involve two distinct mutational events in a single gene. © 2014 Wiley Periodicals, Inc.

Association of irisin and FNDC5 rs16835198 G>T gene polymorphism with type 2 diabetes mellitus and diabetic nephropathy. An Egyptian pilot study.

PubMed

Khidr, Emad Gamil; Ali, Shawkey Saddik; Elshafey, Mostafa Mahmoud; Fawzy, Olfat Ahmed

2017-08-30

Diabetes mellitus is a fast-growing health problem in Egypt affecting morbidity, mortality and health care resources. Irisin, a new exercise-induced myokine inducing browning of white adipose tissues, has gained a great interest as a potential new target for combating type 2 diabetes mellitus (T2DM) and its complications. In this study, we assessed serum irisin levels in T2DM and diabetic nephropathy to elucidate possible relationships between irisin and metabolic parameters and renal functions. We also investigated, for the first time in Egypt, the association of FNDC5 rs16835198 G>T polymorphism with T2DM, diabetic nephropathy and irisin levels. One hundred type 2 diabetic patients (40 normoalbuminuric and 60 with nephropathy) as well as fifty control subjects were enrolled in this study. Serum irisin and insulin were evaluated by ELISA. Genomic DNA was genotyped for FNDC5 rs16835198 polymorphism using TaqMan genotyping assay. Serum irisin levels were lower in diabetic patients compared to controls and this decrease was more pronounced in diabetic nephropathy. Irisin correlates with metabolic parameters and renal functions. Frequencies of T allele and TT genotype were significantly lower among T2DM and diabetic nephropathy patients compared to controls. Moreover, G allele was associated with elevated insulin resistance and dyslipidemia without effect on circulating irisin levels. T2DM and diabetic nephropathy are associated with decreased levels of irisin. FNDC5 rs16835198 TT genotype associates with decreased risk of T2DM in Egyptians with no effect on renal complications. Also, G allele has insulin desensitizing action with no association with circulating irisin levels. Copyright © 2017 Elsevier B.V. All rights reserved.

A66G and C524T polymorphisms of methionine synthase reductase gene are linked to the development of acyanotic congenital heart diseases in Egyptian children.

PubMed

Hassan, Fahima M; Khattab, Ahmad A; Abo El Fotoh, Wafaa Moustafa M; Zidan, Reham S

2017-09-20

Methionine synthase reductase (MTRR) is one of the main regulatory enzymes in the homocysteine/folate pathway. Genes involved in this pathway may play an important role in the development of congenital heart diseases (CHDs). C524T and A66G polymorphisms of MTRR gene may play an imperative role in the development of acyanotic CHDs. This study carried out on 200 children equally divided into 2 groups: group I: 100 children with acyanotic CHDs; and group II: 100 healthy children served as controls. PCR-RFLP method carried out to amplify the A66G and C524T polymorphisms of MTRR gene digested with Xho1and NdeI enzymes. A significant difference(P=0.015) in genotype frequencies of C524T polymorphism between cases and controls, where CC, CT, and TT were 14.0%, 40.0% and 46.0% in patients compared to 38.0,36.0% and 26.0% in controls. Again, a significant difference (P=0.010) in genotype frequencies of A66G polymorphism between the two groups as AA, AG and GG were 26.0%, 32.0% and42.0% in patients compared to 48.0, 36.0% and 16.0% in controls. Also, MTRR A66G and C524T polymorphisms were associated with a higher CHD risk in the homozygote comparison of wild and mutant genotypes and also in heterozygote and mutant comparison. So A66G and C524T polymorphisms of MTRR gene are associated with increased risk of acyanotic CHDs. Copyright © 2017 Elsevier B.V. All rights reserved.

Clinical relevance of IDH1/2 mutant allele burden during follow-up in acute myeloid leukemia. A study by the French ALFA group

PubMed Central

Ferret, Yann; Boissel, Nicolas; Helevaut, Nathalie; Madic, Jordan; Nibourel, Olivier; Marceau-Renaut, Alice; Bucci, Maxime; Geffroy, Sandrine; Celli-Lebras, Karine; Castaigne, Sylvie; Thomas, Xavier; Terré, Christine; Dombret, Hervé; Preudhomme, Claude; Renneville, Aline

2018-01-01

Assessment of minimal residual disease has emerged as a powerful prognostic factor in acute myeloid leukemia. In this study, we investigated the potential of IDH1/2 mutations as targets for minimal residual disease assessment in acute myeloid leukemia, since these mutations collectively occur in 15–20% of cases of acute myeloid leukemia and now represent druggable targets. We employed droplet digital polymerase chain reaction assays to quantify IDH1R132, IDH2R140, and IDH2R172 mutations on genomic DNA in 322 samples from 103 adult patients with primary IDH1/2 mutant acute myeloid leukemia and enrolled on Acute Leukemia French Association (ALFA) - 0701 or -0702 clinical trials. The median IDH1/2 mutant allele fraction in bone marrow samples was 42.3% (range, 8.2 – 49.9%) at diagnosis of acute myeloid leukemia, and below the detection limit of 0.2% (range, <0.2 – 39.3%) in complete remission after induction therapy. In univariate analysis, the presence of a normal karyotype, a NPM1 mutation, and an IDH1/2 mutant allele fraction <0.2% in bone marrow after induction therapy were statistically significant predictors of longer disease-free survival. In multivariate analysis, these three variables remained significantly predictive of disease-free survival. In 7/103 (7%) patients, IDH1/2 mutations persisted at high levels in complete remission, consistent with the presence of an IDH1/2 mutation in pre-leukemic hematopoietic stem cells. Five out of these seven patients subsequently relapsed or progressed toward myelodysplastic syndrome, suggesting that patients carrying the IDH1/2 mutation in a pre-leukemic clone may be at high risk of hematologic evolution. PMID:29472349

Clinical relevance of IDH1/2 mutant allele burden during follow-up in acute myeloid leukemia. A study by the French ALFA group.

PubMed

Ferret, Yann; Boissel, Nicolas; Helevaut, Nathalie; Madic, Jordan; Nibourel, Olivier; Marceau-Renaut, Alice; Bucci, Maxime; Geffroy, Sandrine; Celli-Lebras, Karine; Castaigne, Sylvie; Thomas, Xavier; Terré, Christine; Dombret, Hervé; Preudhomme, Claude; Renneville, Aline

2018-05-01

Assessment of minimal residual disease has emerged as a powerful prognostic factor in acute myeloid leukemia. In this study, we investigated the potential of IDH1/2 mutations as targets for minimal residual disease assessment in acute myeloid leukemia, since these mutations collectively occur in 15-20% of cases of acute myeloid leukemia and now represent druggable targets. We employed droplet digital polymerase chain reaction assays to quantify IDH1R132 , IDH2R140 , and IDH2R172 mutations on genomic DNA in 322 samples from 103 adult patients with primary IDH1/2 mutant acute myeloid leukemia and enrolled on Acute Leukemia French Association (ALFA) - 0701 or -0702 clinical trials. The median IDH1/2 mutant allele fraction in bone marrow samples was 42.3% (range, 8.2 - 49.9%) at diagnosis of acute myeloid leukemia, and below the detection limit of 0.2% (range, <0.2 - 39.3%) in complete remission after induction therapy. In univariate analysis, the presence of a normal karyotype, a NPM1 mutation, and an IDH1/2 mutant allele fraction <0.2% in bone marrow after induction therapy were statistically significant predictors of longer disease-free survival. In multivariate analysis, these three variables remained significantly predictive of disease-free survival. In 7/103 (7%) patients, IDH1/2 mutations persisted at high levels in complete remission, consistent with the presence of an IDH1/2 mutation in pre-leukemic hematopoietic stem cells. Five out of these seven patients subsequently relapsed or progressed toward myelodysplastic syndrome, suggesting that patients carrying the IDH1/2 mutation in a pre-leukemic clone may be at high risk of hematologic evolution. Copyright © 2018 Ferrata Storti Foundation.

A spontaneous tRNA suppressor of a mutation in the Chlamydomonas reinhardtii nuclear MCD1 gene required for stability of the chloroplast petD mRNA

PubMed Central

Murakami, Shinya; Kuehnle, Katrin; Stern, David B.

2005-01-01

Numerous nuclear gene products are required for the correct expression of organellar genes. One such gene in the green alga Chlamydomonas reinhardtii is MCD1, whose product is required for stability of the chloroplast-encoded petD mRNA. In mcd1 mutants, which are non-photosynthetic, petD mRNA is degraded by a 5′–3′ exonuclease activity, resulting in a failure to synthesize its product, subunit IV of the cytochrome b 6/f complex. Here, we report the sequence of the wild-type MCD1 gene, which encodes a large and novel putative protein. Analysis of three mutant alleles showed that two harbored large deletions, but that one allele, mcd1-2, had a single base change resulting in a nonsense codon near the N-terminus. This same mutant allele can be suppressed by a second-site mutation in the nuclear MCD2 gene, whereas mcd2-1 cannot suppress the deletion in mcd1-1 (Esposito,D. Higgs,D.C. Drager,R.G. Stern, D.B. and Girard-Bascou,J. (2001) Curr. Genet., 39, 40–48). We report the cloning of mcd2-1, and show that the mutation lies in a tRNASer(CGA), which has been modified to translate the nonsense codon in mcd1-2. We discuss how the existence of a large tRNASer gene family may permit this suppression without pleiotropic consequences. PMID:15947135

Analysis of Thiopurine S-Methyltransferase Deficient Alleles in Acute Lymphoblastic Leukemia Patients in Mexican Patients.

PubMed

Jiménez-Morales, Silvia; Ramírez-Florencio, Mireya; Mejía-Aranguré, Juan Manuel; Núñez-Enríquez, Juan Carlos; Bekker-Mendez, Carolina; Torres-Escalante, José Luis; Flores-Lujano, Janet; Jiménez-Hernández, Elva; Del Carmen Rodríguez-Zepeda, María; Leal, Yelda A; González-Montalvo, Pablo Miguel; Pantoja-Guillen, Francisco; Peñaloza-Gonzalez, José Gabriel; Gutiérrez-Juárez, Erick Israel; Núñez-Villegas, Nora Nancy; Pérez-Saldivar, Maria Luisa; Guerra-Castillo, Francisco Xavier; Flores-Villegas, Luz Victoria; Ramos-Cervantes, María Teresa; Fragoso, José Manuel; García-Escalante, María Guadalupe; Del Carmen Pinto-Escalante, Doris; Ramírez-Bello, Julián; Hidalgo-Miranda, Alfredo

2016-11-01

It has been demonstrated that heterozygote and homozygote thiopurine S-methyltransferase (TPMT) mutant allele carriers are at high risk to develop severe and potentially fatal hematopoietic toxicity after treatment with standard doses of 6-mercaptopurine (6-MP) and methotrexate (MX). Those drugs are the backbone of acute lymphoblastic leukemia (ALL) and several autoimmune disease treatments. We undertook this study to determine the frequency of the TPMT deficient alleles in children with ALL and non-ALL subjects from Mexico City and Yucatan, Mexico. We included 849 unrelated subjects, of which 368 ALL children and 342 non-ALL subjects were from Mexico City, and 60 ALL cases and 79 non-ALL individuals were from Yucatan. Genotyping of the rs1800462, rs1800460 and rs1142345 SNPs was performed by 5'exonuclease technique using TaqMan probes (Life Technologies Foster City, CA). The mutant TPMT alleles were present in 4.8% (81/1698 chromosomes) and only 0.2% were homozygote TPMT*3A/TPMT*3A. We did not find statistically significant differences in the distribution of the mutant alleles between patients from Mexico City and Yucatan in either ALL cases or non-ALL. Nonetheless, the TPMT*3C frequency in ALL patients was higher than non-ALL subjects (p = 0.03). To note, the null homozygous TPMT*3A/TPMT*3A genotype was found in 2.5% of the non-ALL subjects. TPMT mutant alleles did not exhibit differential distribution between both evaluated populations; however, TPMT*3C is overrepresented in ALL cases in comparison with non-ALL group. Assessing the TPMT mutant alleles could benefit the ALL children and those undergoing 6-MP and MX treatment. Copyright © 2016 IMSS. Published by Elsevier Inc. All rights reserved.

Allele-specific Col1a1 silencing reduces mutant collagen in fibroblasts from Brtl mouse, a model for classical osteogenesis imperfecta

PubMed Central

Rousseau, Julie; Gioia, Roberta; Layrolle, Pierre; Lieubeau, Blandine; Heymann, Dominique; Rossi, Antonio; Marini, Joan C; Trichet, Valerie; Forlino, Antonella

2014-01-01

Gene silencing approaches have the potential to become a powerful curative tool for a variety of monogenic diseases caused by gain-of-function mutations. Classical osteogenesis imperfecta (OI), a dominantly inherited bone dysplasia, is characterized in its more severe forms by synthesis of structurally abnormal type I collagen, which exerts a negative effect on extracellular matrix. Specific suppression of the mutant (Mut) allele would convert severe OI forms to the mild type caused by a quantitative defect in normal collagen. Here, we describe the in vitro and ex vivo investigation of a small interfering RNA (siRNA) approach to allele-specific gene silencing using Mut Col1a1 from the Brtl mouse, a well-characterized model for classical human OI. A human embryonic kidney cell line, which expresses the firefly luciferase gene, combined with either wild-type or Mut Brtl Col1a1 exon 23 sequences, was used for the first screening. The siRNAs selected based on their specificity and the corresponding short hairpin RNAs (shRNAs) subcloned in a lentiviral vector were evaluated ex vivo in Brtl fibroblasts for their effect on collagen transcripts and protein. A preferential reduction of the Mut allele of up to 52% was associated with about 40% decrease of the Mut protein, with no alteration of cell proliferation. Interestingly, a downregulation of HSP47, a specific collagen chaperone known to be upregulated in some OI cases, was detected. Our data support further testing of shRNAs and their delivery by lentivirus as a strategy to specifically suppress the Mut allele in mesenchymal stem cells of OI patients for autologous transplantation. PMID:24022296

Pseudorabies virus glycoprotein gIII is a major target antigen for murine and swine virus-specific cytotoxic T lymphocytes.

PubMed Central

Zuckermann, F A; Zsak, L; Mettenleiter, T C; Ben-Porat, T

1990-01-01

Pseudorabies virus (PrV) is the etiological agent of Aujeszky's disease, a disease that causes heavy economic losses in the swine industry. A rational approach to the generation of an effective vaccine against this virus requires an understanding of the immune response induced by it and of the role of the various viral antigens in inducing such a response. We have constructed mutants of PrV [strain PrV (Ka)] that differ from each other only in expression of the viral nonessential glycoproteins gI, gp63, gX, and gIII (i.e., are otherwise isogenic). These mutants were used to ascertain the importance of each of the nonessential glycoproteins in eliciting a PrV-specific cytotoxic T-lymphocyte (CTL) response in mice and pigs. Immunization of DBA/2 mice and pigs with a thymidine kinase-deficient (TK-) mutant of PrV elicits the formation of cytotoxic cells that specifically lyse syngeneic infected target cells. These PrV-specific cytolytic cells have the phenotype of major histocompatibility complex class I antigen-restricted CTLs. The relative number of CTLs specific for glycoproteins gI, gp63, gX, and gIII induced in mice vaccinated with a TK- mutant of PrV was ascertained by comparing their levels of cytotoxicity against syngeneic cells infected with either wild-type virus or gI-/gp63-, gX-, or gIII- virus deletion mutants. The PrV-specific CLTs were significantly less effective in lysing gIII(-)-infected targets than in lysing gI-/gp63-, gX-, or wild-type-infected targets. The in vitro secondary CTL response of lymphocytes obtained from either mice or pigs 6 or more weeks after immunization with a TK- mutant of PrV was also tested. Lymphocytes obtained from these animals were cultured with different glycoprotein-deficient mutants of PrV, and their cytolytic activities against wild-type-infected targets were ascertained. The importance of each of the nonessential viral glycoproteins in eliciting CTLs was assessed from the effectiveness of each of the virus mutants to

Efficient CRISPR-rAAV engineering of endogenous genes to study protein function by allele-specific RNAi.

PubMed

Kaulich, Manuel; Lee, Yeon J; Lönn, Peter; Springer, Aaron D; Meade, Bryan R; Dowdy, Steven F

2015-04-20

Gene knockout strategies, RNAi and rescue experiments are all employed to study mammalian gene function. However, the disadvantages of these approaches include: loss of function adaptation, reduced viability and gene overexpression that rarely matches endogenous levels. Here, we developed an endogenous gene knockdown/rescue strategy that combines RNAi selectivity with a highly efficient CRISPR directed recombinant Adeno-Associated Virus (rAAV) mediated gene targeting approach to introduce allele-specific mutations plus an allele-selective siRNA Sensitive (siSN) site that allows for studying gene mutations while maintaining endogenous expression and regulation of the gene of interest. CRISPR/Cas9 plus rAAV targeted gene-replacement and introduction of allele-specific RNAi sensitivity mutations in the CDK2 and CDK1 genes resulted in a >85% site-specific recombination of Neo-resistant clones versus ∼8% for rAAV alone. RNAi knockdown of wild type (WT) Cdk2 with siWT in heterozygotic knockin cells resulted in the mutant Cdk2 phenotype cell cycle arrest, whereas allele specific knockdown of mutant CDK2 with siSN resulted in a wild type phenotype. Together, these observations demonstrate the ability of CRISPR plus rAAV to efficiently recombine a genomic locus and tag it with a selective siRNA sequence that allows for allele-selective phenotypic assays of the gene of interest while it remains expressed and regulated under endogenous control mechanisms. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Antigenic Determinants of the Bilobal Cockroach Allergen Bla g 2*

PubMed Central

Woodfolk, Judith A.; Glesner, Jill; Wright, Paul W.; Kepley, Christopher L.; Li, Mi; Himly, Martin; Muehling, Lyndsey M.; Gustchina, Alla; Wlodawer, Alexander; Chapman, Martin D.; Pomés, Anna

2016-01-01

Bla g 2 is a major indoor cockroach allergen associated with the development of asthma. Antigenic determinants on Bla g 2 were analyzed by mutagenesis based on the structure of the allergen alone and in complex with monoclonal antibodies that interfere with IgE antibody binding. The structural analysis revealed mechanisms of allergen-antibody recognition through cation-π interactions. Single and multiple Bla g 2 mutants were expressed in Pichia pastoris and purified. The triple mutant K132A/K251A/F162Y showed an ∼100-fold reduced capacity to bind IgE, while preserving the native molecular fold, as proven by x-ray crystallography. This mutant was still able to induce mast cell release. T-cell responses were assessed by analyzing Th1/Th2 cytokine production and the CD4+ T-cell phenotype in peripheral blood mononuclear cell cultures. Although T-cell activating capacity was similar for the KKF mutant and Bla g 2 based on CD25 expression, the KKF mutant was a weaker inducer of the Th2 cytokine IL-13. Furthermore, this mutant induced IL-10 from a non-T-cell source at higher levels that those induced by Bla g 2. Our findings demonstrate that a rational design of site-directed mutagenesis was effective in producing a mutant with only 3 amino acid substitutions that maintained the same fold as wild type Bla g 2. These residues, which were involved in IgE antibody binding, endowed Bla g 2 with a T-cell modulatory capacity. The antigenic analysis of Bla g 2 will be useful for the subsequent development of recombinant allergen vaccines. PMID:26644466

The susceptibility of FSHB -211G > T and FSHR G-29A, 919A > G, 2039A > G polymorphisms to men infertility: an association study and meta-analysis.

PubMed

Wu, Qiuyue; Zhang, Jing; Zhu, Peiran; Jiang, Weijun; Liu, Shuaimei; Ni, Mengxia; Zhang, Mingchao; Li, Weiwei; Zhou, Qing; Cui, Yingxia; Xia, Xinyi

2017-08-01

Male infertility is a complex disorder caused by genetic, developmental, endocrine, or environmental factors as well as unknown etiology. Polymorphisms in the follicle stimulating hormone beta subunit (FSHB) (rs10835638, c.-211G > T) and follicle stimulating hormone receptor (FSHR) (rs1394205, c.-29G > A; rs6165, c.919A > G; rs6166, c.2039 A > G) genes might disturb normal spermatogenesis and affect male reproductive ability. To further ascertain the aforementioned effects, we conducted a case-control study of 255 infertile men and 340 fertile controls from South China using the Mass ARRAY method, which was analyzed by the t-tests and logistic regression analysis using SPSS for Windows 14.0. In addition, a meta-analysis was performed by combining our results with previous reports using STATA 12.0. In the FSHB or FSHR gene single nucleotide polymorphism (SNP) evaluation, no statistically-significant difference was found in the frequency of allelic variants or in genotype distribution between cases and controls. However, a significant association for the comparison of GAA (P: 0.022, OR: 0.63, 95%CI: 0.43-0.94) was seen between the oligozoospermia and controls in haplotype analysis of rs1394205/rs6165/rs6166. In the meta-analysis, rs6165G allele and rs6166 GG genotype were associated with increased risk of the male infertility. This study suggested that FSHR GAA haplotype would exert protective effects against male sterility, which indicated that the combination of three SNP genotypes of FSHR was predicted to have a much stronger impact than either one alone. Then in the meta-analysis, a significant association was seen between FSHR rs6165, rs6166 polymorphisms and male infertility. In terms of male infertility with multifactorial etiology, further studies with larger sample sizes and different ethnic backgrounds or other risk factors are warranted to clarify the potential role of FSHB and FSHR polymorphisms in the pathogenesis of male infertility.

Tomato TILLING Technology: Development of a Reverse Genetics Tool for the Efficient Isolation of Mutants from Micro-Tom Mutant Libraries

PubMed Central

Okabe, Yoshihiro; Asamizu, Erika; Saito, Takeshi; Matsukura, Chiaki; Ariizumi, Tohru; Brès, Cécile; Rothan, Christophe; Mizoguchi, Tsuyoshi; Ezura, Hiroshi

2011-01-01

To accelerate functional genomic research in tomato, we developed a Micro-Tom TILLING (Targeting Induced Local Lesions In Genomes) platform. DNA pools were constructed from 3,052 ethyl methanesulfonate (EMS) mutant lines treated with 0.5 or 1.0% EMS. The mutation frequency was calculated by screening 10 genes. The 0.5% EMS population had a mild mutation frequency of one mutation per 1,710 kb, whereas the 1.0% EMS population had a frequency of one mutation per 737 kb, a frequency suitable for producing an allelic series of mutations in the target genes. The overall mutation frequency was one mutation per 1,237 kb, which affected an average of three alleles per kilobase screened. To assess whether a Micro-Tom TILLING platform could be used for efficient mutant isolation, six ethylene receptor genes in tomato (SlETR1–SlETR6) were screened. Two allelic mutants of SlETR1 (Sletr1-1 and Sletr1-2) that resulted in reduced ethylene responses were identified, indicating that our Micro-Tom TILLING platform provides a powerful tool for the rapid detection of mutations in an EMS mutant library. This work provides a practical and publicly accessible tool for the study of fruit biology and for obtaining novel genetic material that can be used to improve important agronomic traits in tomato. PMID:21965606

Tomato TILLING technology: development of a reverse genetics tool for the efficient isolation of mutants from Micro-Tom mutant libraries.

PubMed

Okabe, Yoshihiro; Asamizu, Erika; Saito, Takeshi; Matsukura, Chiaki; Ariizumi, Tohru; Brès, Cécile; Rothan, Christophe; Mizoguchi, Tsuyoshi; Ezura, Hiroshi

2011-11-01

To accelerate functional genomic research in tomato, we developed a Micro-Tom TILLING (Targeting Induced Local Lesions In Genomes) platform. DNA pools were constructed from 3,052 ethyl methanesulfonate (EMS) mutant lines treated with 0.5 or 1.0% EMS. The mutation frequency was calculated by screening 10 genes. The 0.5% EMS population had a mild mutation frequency of one mutation per 1,710 kb, whereas the 1.0% EMS population had a frequency of one mutation per 737 kb, a frequency suitable for producing an allelic series of mutations in the target genes. The overall mutation frequency was one mutation per 1,237 kb, which affected an average of three alleles per kilobase screened. To assess whether a Micro-Tom TILLING platform could be used for efficient mutant isolation, six ethylene receptor genes in tomato (SlETR1-SlETR6) were screened. Two allelic mutants of SlETR1 (Sletr1-1 and Sletr1-2) that resulted in reduced ethylene responses were identified, indicating that our Micro-Tom TILLING platform provides a powerful tool for the rapid detection of mutations in an EMS mutant library. This work provides a practical and publicly accessible tool for the study of fruit biology and for obtaining novel genetic material that can be used to improve important agronomic traits in tomato.

[G894T (NOS3) and G1958A (MTHFD1) gene polymorphisms and risk of ischemic heart disease in Yucatan, Mexico].

PubMed

García-González, Igrid; Solís-Cárdenas, Alberto de Jesús; Flores-Ocampo, Jorge A; Alejos-Mex, Ricardo; Herrera-Sánchez, Luis Fernando; González-Herrera, Lizbeth Josefina

2015-01-01

Cardiovascular medicine is focused on the search for genetic risk markers with predictive and/or prognostic value. Among the genetic variants of interest are G894T endothelial nitric oxide synthase and G1958A methylenetetrahydrofolate dehydrogenase1 gene polymorphisms. The aim of this study was to determine the possible association between these polymorphisms and ischemic heart disease in patients from Southern of Mexico (Yucatán). Case-control study matched by age, sex and origin was designed. We studied 98 patients with coronary disease and 101 controls. Participants were evaluated for the usual risk factors. The polymorphisms were identified using the polymerase chain reaction/restriction fragment length polymorphism analysis. Informed consent was obtained from all participants. The G894T and G1958A polymorphisms were not associated with ischemic heart disease, however, the TT genotype (G894T) was associated with the angina (OR=10.2; 95%CI, 1.51-68.8; p=0.025). The genotype GT (G894T) was the most frequent in patients with family history of coronary artery disease. Multiple logistic regression analysis identified smoking (OR=5.21; 95%CI, 2.1-12.9; p=0.000), hypertension (OR=3.54; 95%CI, 1.47-8.56; p=0.005) and obesity (OR=1.16; 95%CI, 1.1-1.27; p=0.001) as risk factors predicting the ischemic heart disease. The G894T and G1958A polymorphisms showed not association with ischemic heart disease. However, homozygosis for the 894T allele (NOS3) confers at risk to develop angina on Yucatán. Copyright © 2014 Sociedad Española de Arteriosclerosis. Published by Elsevier España. All rights reserved.

Genetic transformation of Neurospora tetrasperma, demonstration of repeat-induced point mutation (RIP) in self-crosses and a screen for recessive RIP-defective mutants.

PubMed Central

Bhat, Ashwin; Tamuli, Ranjan; Kasbekar, Durgadas P

2004-01-01

The pseudohomothallic fungus Neurospora tetrasperma is naturally resistant to the antibiotic hygromycin. We discovered that mutation of its erg-3 (sterol C-14 reductase) gene confers a hygromycin-sensitive phenotype that can be used to select transformants on hygromycin medium by complementation with the N. crassa erg-3+ and bacterial hph genes. Cotransformation of hph with PCR-amplified DNA of other genes enabled us to construct strains duplicated for the amplified DNA. Using transformation we constructed self-fertile strains that were homoallelic for an ectopic erg-3+ transgene and a mutant erg-3 allele at the endogenous locus. Self-crosses of these strains yielded erg-3 mutant ascospores that produced colonies with the characteristic morphology on Vogel's sorbose agar described previously for erg-3 mutants of N. crassa. The mutants were generated by repeat-induced point mutation (RIP), a genome defense process that causes numerous G:C to A:T mutations in duplicated DNA sequences. Homozygosity for novel recessive RIP-deficient mutations was signaled by self-crosses of erg-3-duplication strains that fail to produce erg-3 mutant progeny. Using this assay we isolated a UV-induced mutant with a putative partial RIP defect. RIP-induced mutants were isolated in rid-1 and sad-1, which are essential genes, respectively, for RIP and another genome defense mechanism called meiotic silencing by unpaired DNA. PMID:15280231

Controlling aggregation propensity in A53T mutant of alpha-synuclein causing Parkinson's disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kumar, Sonu; Sarkar, Anita; Sundar, Durai, E-mail: sundar@dbeb.iitd.ac.in

2009-09-18

Understanding {alpha}-synuclein in terms of fibrillization, aggregation, solubility and stability is fundamental in Parkinson's disease (PD). The three familial mutations, namely, A30P, E46K and A53T cause PD because the hydrophobic regions in {alpha}-synuclein acquire {beta}-sheet configuration, and have a propensity to fibrillize and form amyloids that cause cytotoxicity and neurodegeneration. On simulating the native form and mutants (A30P, E46K and A53T) of {alpha}-synuclein in water solvent, clear deviations are observed in comparison to the all-helical 1XQ8 PDB structure. We have identified two crucial residues, {sup 40}Val and {sup 74}Val, which play key roles in {beta}-sheet aggregation in the hydrophobic regionsmore » 36-41 and 68-78, respectively, leading to fibrillization and amyloidosis in familial (A53T) PD. We have also identified V40D{sub V}74D, a double mutant of A53T (the most amyloidogenic mutant). The simultaneous introduction of these two mutations in A53T nearly ends its aggregation propensity, increases its solubility and positively enhances its thermodynamic stability.« less

Quantification of simian immunodeficiency virus cytotoxic T lymphocyte escape mutant viruses.

PubMed

Loh, Liyen; Kent, Stephen J

2008-08-01

Escape from cytotoxic T-lymphocyte (CTL) pressure is common in HIV-1 infection of humans and simian immunodeficiency virus (SIV) infections of macaques. CTL escape typically incurs a fitness cost as reversion back to wild-type can occur upon transmission. We utilized sequence-specific primers and DNA probes with real-time polymerase chain reaction (PCR) to sensitively and specifically track wild-type and escape mutant viremia at the Mane-A*17-restricted SIV Gag(371379) epitope AF9 in pigtail macaques. The generation of minor escape mutant populations is detected by the real-time PCR 2 weeks earlier than observed using standard sequencing techniques. We passaged the AF9 CTL escape mutant virus into two naïve Mane-A*17-negative pigtail macaques and showed that reversion to wild-type was rapid during acute infection and then slowed considerably at later stages of the infection. These data help refine our understanding of how CTL escape mutant viruses evolve.

Analysis of isoniazid-resistant transposon mutants of Mycobacterium smegmatis.

PubMed

Billman-Jacobe, H; Sloan, J; Coppel, R L

1996-10-15

The emergence of multidrug-resistant tuberculosis has renewed interest in the study of drug resistance in mycobacteria with the objective of improved chemotherapy. The genetic basis of isoniazid resistance in a model mycobacterium was studied. Eleven isoniazid-resistant mutants of Mycobacterium smegmatis were created using transposon mutagenesis. Genetic and enzymatic characterisation of the mutants showed that katG, encoding T-catalase, was inactivated. The nucleotide sequence of M. smegmatis katG was determined and the mutation sites mapped demonstrating that both the amino and carboxyl halves of T-catalase are important for enzymatic activity.

Gene polymorphisms of TNF-alpha-308 (G/A), IL-10(-1082) (G/A), IL-6(-174) (G/C) and IL-1Ra (VNTR) in Egyptian cases with type 1 diabetes mellitus.

PubMed

Settin, Ahmad; Ismail, Azza; El-Magd, Megahed Abo; El-Baz, Rizk; Kazamel, Amira

2009-01-01

Type 1 diabetes (T1D) is a genetically conditioned autoimmune disease in which cytokines play an important role. Objectives. To check for the association of polymorphisms of cytokine genes with type 1 diabetes. Subjects. This work included 50 cases with T1D and 98 healthy individuals from the Nile Delta region of Egypt. Cases included 20 males and 30 females with a median age of 25 and range of 15-50 years. DNA was amplified using PCR with sequence-specific primers for detection of polymorphisms related to tumor necrosis factor (TNF)-alpha(- 308) (G/A), interleukin (IL)-10(- 1082) (G/A), IL-6(- 174) (G/C), and IL-1Ra (VNTR). Cases with T1D showed significant higher frequency of genotypes of TNF-alpha(- 308) AA (p < 0.001, odds ratio (OR) = 7.91), IL-6-17CC (p < 0.05, OR = 3.36) and IL-1Ra A1A1 (p < 0.05, OR = 3.68) with significant lower frequencies of TNF-alpha(- 308) GA, and IL-1Ra A1A2 genotypes (p < 0.001 and < 0.05, respectively). They also showed significant higher frequency of TNF-alpha(- 308) allele A (p < 0.05, OR = 2.0), IL-1Ra allele A1 (p < 0.05, OR = 2.98) with a significant lower frequency of TNF-alpha(- 308) G allele and IL-1Ra A2 allele (p < 0.05). No significant difference was detected among cases in relation to IL-10(- 1082) (G/A) genotypes or alleles nor in relation to age, sex, consanguinity or family history of the disease. Polymorphisms related to TNF-alpha and IL-1Ra genes may be considered genetic markers for T1D among Egyptians with a potential impact on family counseling and management.

Mutants of Pseudomonas cepacia G4 defective in catabolism of aromatic compounds and trichloroethylene.

PubMed Central

Shields, M S; Montgomery, S O; Cuskey, S M; Chapman, P J; Pritchard, P H

1991-01-01

Pseudomonas cepacia G4 possesses a novel pathway of toluene catabolism that is shown to be responsible for the degradation of trichloroethylene (TCE). This pathway involves conversion of toluene via o-cresol to 3-methylcatechol. In order to determine the enzyme of toluene degradation that is responsible for TCE degradation, chemically induced mutants, blocked in the toluene ortho-monooxygenase (TOM) pathway of G4, were examined. Mutants of the phenotypic class designated TOM A- were all defective in their ability to oxidize toluene, o-cresol, m-cresol, and phenol, suggesting that a single enzyme is responsible for conversion of these compounds to their hydroxylated products (3-methylcatechol from toluene, o-cresol, and m-cresol and catechol from phenol) in the wild type. Mutants of this class did not degrade TCE. Two other mutant classes which were blocked in toluene catabolism, TOM B-, which lacked catechol-2,3-dioxygenase, and TOM C-, which lacked 2-hydroxy-6-oxoheptadienoic acid hydrolase activity, were fully capable of TCE degradation. Therefore, TCE degradation is directly associated with the monooxygenation capability responsible for toluene, cresol, and phenol hydroxylation. PMID:1892384

Antigenic Determinants of the Bilobal Cockroach Allergen Bla g 2.

PubMed

Woodfolk, Judith A; Glesner, Jill; Wright, Paul W; Kepley, Christopher L; Li, Mi; Himly, Martin; Muehling, Lyndsey M; Gustchina, Alla; Wlodawer, Alexander; Chapman, Martin D; Pomés, Anna

2016-01-29

Bla g 2 is a major indoor cockroach allergen associated with the development of asthma. Antigenic determinants on Bla g 2 were analyzed by mutagenesis based on the structure of the allergen alone and in complex with monoclonal antibodies that interfere with IgE antibody binding. The structural analysis revealed mechanisms of allergen-antibody recognition through cation-π interactions. Single and multiple Bla g 2 mutants were expressed in Pichia pastoris and purified. The triple mutant K132A/K251A/F162Y showed an ∼100-fold reduced capacity to bind IgE, while preserving the native molecular fold, as proven by x-ray crystallography. This mutant was still able to induce mast cell release. T-cell responses were assessed by analyzing Th1/Th2 cytokine production and the CD4(+) T-cell phenotype in peripheral blood mononuclear cell cultures. Although T-cell activating capacity was similar for the KKF mutant and Bla g 2 based on CD25 expression, the KKF mutant was a weaker inducer of the Th2 cytokine IL-13. Furthermore, this mutant induced IL-10 from a non-T-cell source at higher levels that those induced by Bla g 2. Our findings demonstrate that a rational design of site-directed mutagenesis was effective in producing a mutant with only 3 amino acid substitutions that maintained the same fold as wild type Bla g 2. These residues, which were involved in IgE antibody binding, endowed Bla g 2 with a T-cell modulatory capacity. The antigenic analysis of Bla g 2 will be useful for the subsequent development of recombinant allergen vaccines. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Functional Rescue of Trafficking-Impaired ABCB4 Mutants by Chemical Chaperones

PubMed Central

Gordo-Gilart, Raquel; Andueza, Sara; Hierro, Loreto; Jara, Paloma; Alvarez, Luis

2016-01-01

Multidrug resistance protein 3 (MDR3, ABCB4) is a hepatocellular membrane protein that mediates biliary secretion of phosphatidylcholine. Null mutations in ABCB4 gene give rise to severe early-onset cholestatic liver disease. We have previously shown that the disease-associated mutations p.G68R, p.G228R, p.D459H, and p.A934T resulted in retention of ABCB4 in the endoplasmic reticulum, thus failing to target the plasma membrane. In the present study, we tested the ability of two compounds with chaperone-like activity, 4-phenylbutyrate and curcumin, to rescue these ABCB4 mutants by assessing their effects on subcellular localization, protein maturation, and phospholipid efflux capability. Incubation of transfected cells at a reduced temperature (30°C) or exposure to pharmacological doses of either 4-PBA or curcumin restored cell surface expression of mutants G228R and A934T. The delivery of these mutants to the plasma membrane was accompanied by a switch in the ratio of mature to inmature protein forms, leading to a predominant expression of the mature protein. This effect was due to an improvement in the maturation rate and not to the stabilization of the mature forms. Both mutants were also functionally rescued, displaying bile salt-dependent phospholipid efflux activity after addition of 4-PBA or curcumin. Drug-induced rescue was mutant specific, given neither 4-PBA nor curcumin had an effect on the ABCB4 mutants G68R and A934T. Collectively, these data indicate that the functionality of selected trafficking-defective ABCB4 mutants can be recovered by chemical chaperones through restoration of membrane localization, suggesting a potential treatment for patients carrying such mutations. PMID:26900700

Type 2 Diabetes Risk Alleles Demonstrate Extreme Directional Differentiation among Human Populations, Compared to Other Diseases

PubMed Central

Chen, Rong; Corona, Erik; Sikora, Martin; Dudley, Joel T.; Morgan, Alex A.; Moreno-Estrada, Andres; Nilsen, Geoffrey B.; Ruau, David; Lincoln, Stephen E.; Bustamante, Carlos D.; Butte, Atul J.

2012-01-01

Many disease-susceptible SNPs exhibit significant disparity in ancestral and derived allele frequencies across worldwide populations. While previous studies have examined population differentiation of alleles at specific SNPs, global ethnic patterns of ensembles of disease risk alleles across human diseases are unexamined. To examine these patterns, we manually curated ethnic disease association data from 5,065 papers on human genetic studies representing 1,495 diseases, recording the precise risk alleles and their measured population frequencies and estimated effect sizes. We systematically compared the population frequencies of cross-ethnic risk alleles for each disease across 1,397 individuals from 11 HapMap populations, 1,064 individuals from 53 HGDP populations, and 49 individuals with whole-genome sequences from 10 populations. Type 2 diabetes (T2D) demonstrated extreme directional differentiation of risk allele frequencies across human populations, compared with null distributions of European-frequency matched control genomic alleles and risk alleles for other diseases. Most T2D risk alleles share a consistent pattern of decreasing frequencies along human migration into East Asia. Furthermore, we show that these patterns contribute to disparities in predicted genetic risk across 1,397 HapMap individuals, T2D genetic risk being consistently higher for individuals in the African populations and lower in the Asian populations, irrespective of the ethnicity considered in the initial discovery of risk alleles. We observed a similar pattern in the distribution of T2D Genetic Risk Scores, which are associated with an increased risk of developing diabetes in the Diabetes Prevention Program cohort, for the same individuals. This disparity may be attributable to the promotion of energy storage and usage appropriate to environments and inconsistent energy intake. Our results indicate that the differential frequencies of T2D risk alleles may contribute to the observed

A Hypertension-Associated tRNAAla Mutation Alters tRNA Metabolism and Mitochondrial Function

PubMed Central

Jiang, Pingping; Wang, Meng; Xue, Ling; Xiao, Yun; Yu, Jialing; Wang, Hui; Yao, Juan; Liu, Hao; Peng, Yanyan; Liu, Hanqing; Li, Haiying; Chen, Ye

2016-01-01

In this report, we investigated the pathophysiology of a novel hypertension-associated mitochondrial tRNAAla 5655A → G (m.5655A → G) mutation. The destabilization of a highly conserved base pairing (A1-U72) at the aminoacyl acceptor stem by an m.5655A → G mutation altered the tRNAAla function. An in vitro processing analysis showed that the m.5655A → G mutation reduced the efficiency of tRNAAla precursor 5′ end cleavage catalyzed by RNase P. By using cybrids constructed by transferring mitochondria from lymphoblastoid cell lines derived from a Chinese family into mitochondrial DNA (mtDNA)-less (ρo) cells, we showed a 41% reduction in the steady-state level of tRNAAla in mutant cybrids. The mutation caused an improperly aminoacylated tRNAAla, as suggested by aberrantly aminoacylated tRNAAla and slower electrophoretic mobility of mutated tRNA. A failure in tRNAAla metabolism contributed to variable reductions in six mtDNA-encoded polypeptides in mutant cells, ranging from 21% to 37.5%, with an average of a 29.1% reduction, compared to levels of the controls. The impaired translation caused reduced activities of mitochondrial respiration chains. Furthermore, marked decreases in the levels of mitochondrial ATP and membrane potential were observed in mutant cells. These caused increases in the production of reactive oxygen species in the mutant cybrids. The data provide evidence for the association of the tRNAAla 5655A → G mutation with hypertension. PMID:27161322

Mitochondrial gene therapy improves respiration, biogenesis, and transcription in G11778A Leber's hereditary optic neuropathy and T8993G Leigh's syndrome cells.

PubMed

Iyer, Shilpa; Bergquist, Kristen; Young, Kisha; Gnaiger, Erich; Rao, Raj R; Bennett, James P

2012-06-01

Many incurable mitochondrial disorders result from mutant mitochondrial DNA (mtDNA) and impaired respiration. Leigh's syndrome (LS) is a fatal neurodegenerative disorder of infants, and Leber's hereditary optic neuropathy (LHON) causes blindness in young adults. Treatment of LHON and LS cells harboring G11778A and T8993G mutant mtDNA, respectively, by >90%, with healthy donor mtDNA complexed with recombinant human mitochondrial transcription factor A (rhTFAM), improved mitochondrial respiration by ∼1.2-fold in LHON cells and restored >50% ATP synthase function in LS cells. Mitochondrial replication, transcription, and translation of key respiratory genes and proteins were increased in the short term. Increased NRF1, TFAMB1, and TFAMA expression alluded to the activation of mitochondrial biogenesis as a mechanism for improving mitochondrial respiration. These results represent the development of a therapeutic approach for LHON and LS patients in the near future.

Upregulation of IRS1 Enhances IGF1 Response in Y537S and D538G ESR1 Mutant Breast Cancer Cells.

PubMed

Li, Zheqi; Levine, Kevin M; Bahreini, Amir; Wang, Peilu; Chu, David; Park, Ben Ho; Oesterreich, Steffi; Lee, Adrian V

2018-01-01

Increased evidence suggests that somatic mutations in the ligand-binding domain of estrogen receptor [ER (ERα/ESR1)] are critical mediators of endocrine-resistant breast cancer progression. Insulinlike growth factor-1 (IGF1) is an essential regulator of breast development and tumorigenesis and also has a role in endocrine resistance. A recent study showed enhanced crosstalk between IGF1 and ERα in ESR1 mutant cells, but detailed mechanisms are incompletely understood. Using genome-edited MCF-7 and T47D cell lines harboring Y537S and D538G ESR1 mutations, we characterized altered IGF1 signaling. RNA sequencing revealed upregulation of multiple genes in the IGF1 pathway, including insulin receptor substrate-1 (IRS1), consistent in both Y537S and D538G ESR1 mutant cell line models. Higher IRS1 expression was confirmed by quantitative reverse transcription polymerase chain reaction and immunoblotting. ESR1 mutant cells also showed increased levels of IGF-regulated genes, reflected by activation of an IGF signature. IGF1 showed increased sensitivity and potency in growth stimulation of ESR1 mutant cells. Analysis of downstream signaling revealed the phosphoinositide 3-kinase (PI3K)-Akt axis as a major pathway mediating the enhanced IGF1 response in ESR1 mutant cells. Decreasing IRS1 expression by small interfering RNA diminished the increased sensitivity to IGF1. Combination treatment with inhibitors against IGF1 receptor (IGF1R; OSI-906) and ER (fulvestrant) showed synergistic growth inhibition in ESR1 mutant cells, particularly at lower effective concentrations. Our study supports a critical role of enhanced IGF1 signaling in ESR1 mutant cell lines, pointing toward a potential for cotargeting IGF1R and ERα in endocrine-resistant breast tumors with mutant ESR1. Copyright © 2018 Endocrine Society.

Enhancement of DEN-induced liver tumorigenesis in heme oxygenase-1 G143H mutant transgenic mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jin, Jianfeng; Wang, Dayong; Xiao, Haifeng

Heme oxygenase (HO) is the rate-limiting enzyme in heme metabolism. HO-1 exhibits anti-oxidative and anti-inflammatory function via the actions of its metabolite, respectively. A growing body of evidence demonstrates that HO-1 is implicated in the pathogenesis and progression of several types of cancer. However, whether HO-1 takes part in healthy-premalignant-malignant transformation is still undefined. In this study, we took advantage of transgenic mice which over-expressed HO-1 dominant negative mutant (HO-1 G143H) and observed its susceptibility to DEN-induced hepatocarcinogenesis. Our results indicate that HO-1 G143H mutant accelerates the progression of tumorigenesis and tumor growth. The mechanism is closely related to enhancementmore » of ROS production which induce more hepatocytes death and secretion of inflammatory cytokines, proliferation of surviving hepatocytes. Our result provides the direct evidence that HO-1 plays an important protective role in liver carcinogenesis. Alternatively, we suggest the possible explanation on effect of HO-1 promoter polymorphism which involved in tumorigenesis. - Highlights: • Enhancement of DEN-induced hepatocarcinogenesis in HO-1 G143H Tg mice. • HO-1G143H mutant enhanced DEN-induced ROS production and liver injury. • HO-1G143H mutant aggravated DEN-induced changes of inflammatory factors and cell proliferation.« less

Principal component analysis of binding energies for single-point mutants of hT2R16 bound to an agonist correlate with experimental mutant cell response.

PubMed

Chen, Derek E; Willick, Darryl L; Ruckel, Joseph B; Floriano, Wely B

2015-01-01

Directed evolution is a technique that enables the identification of mutants of a particular protein that carry a desired property by successive rounds of random mutagenesis, screening, and selection. This technique has many applications, including the development of G protein-coupled receptor-based biosensors and designer drugs for personalized medicine. Although effective, directed evolution is not without challenges and can greatly benefit from the development of computational techniques to predict the functional outcome of single-point amino acid substitutions. In this article, we describe a molecular dynamics-based approach to predict the effects of single amino acid substitutions on agonist binding (salicin) to a human bitter taste receptor (hT2R16). An experimentally determined functional map of single-point amino acid substitutions was used to validate the whole-protein molecular dynamics-based predictive functions. Molecular docking was used to construct a wild-type agonist-receptor complex, providing a starting structure for single-point substitution simulations. The effects of each single amino acid substitution in the functional response of the receptor to its agonist were estimated using three binding energy schemes with increasing inclusion of solvation effects. We show that molecular docking combined with molecular mechanics simulations of single-point mutants of the agonist-receptor complex accurately predicts the functional outcome of single amino acid substitutions in a human bitter taste receptor.

Analysis of fluG mutations that affect light-dependent conidiation in Aspergillus nidulans.

PubMed Central

Yager, L N; Lee, H O; Nagle, D L; Zimmerman, J E

1998-01-01

Conidiation in Aspergillus nidulans is induced by exposure to red light but can also be induced by blue light in certain mutant strains. We have isolated a mutation in the fluG gene that abolishes responsiveness to red light but does not affect the response to blue light. It has been shown that the veA1 (velvet) mutation allows conidiation to occur in the absence of light. We have identified three other fluG mutations that suppress the veA1 phenotype; these double mutants do not conidiate in the dark. The mutations described here define two new phenotypic classes of fluG alleles that display abnormal responses to light. We have characterized these mutations with respect to their molecular identity and to their effect on fluG transcription. Although it has been shown that fluG is required for the synthesis of an extracellular factor that directs conidiation, we do not detect this factor under conditions that promote conidiation in the veA1 suppressors. Furthermore, extracellular rescue is not observed in fluG deletion strains containing the wild-type veA allele. We propose that a genetic interaction between fluG and veA influences the production of the extracellular signal and regulates the initiation of conidiation. PMID:9691036

Ultrasensitive Quantification of Hepatitis B Virus A1762T/G1764A Mutant by a SimpleProbe PCR Using a Wild-Type-Selective PCR Blocker and a Primer-Blocker-Probe Partial-Overlap Approach ▿

PubMed Central

Nie, Hui; Evans, Alison A.; London, W. Thomas; Block, Timothy M.; Ren, Xiangdong David

2011-01-01

Hepatitis B virus (HBV) carrying the A1762T/G1764A double mutation in the basal core promoter (BCP) region is associated with HBe antigen seroconversion and increased risk of liver cirrhosis and hepatocellular carcinoma (HCC). Quantification of the mutant viruses may help in predicting the risk of HCC. However, the viral genome tends to have nucleotide polymorphism, which makes it difficult to design hybridization-based assays including real-time PCR. Ultrasensitive quantification of the mutant viruses at the early developmental stage is even more challenging, as the mutant is masked by excessive amounts of the wild-type (WT) viruses. In this study, we developed a selective inhibitory PCR (siPCR) using a locked nucleic acid-based PCR blocker to selectively inhibit the amplification of the WT viral DNA but not the mutant DNA. At the end of siPCR, the proportion of the mutant could be increased by about 10,000-fold, making the mutant more readily detectable by downstream applications such as real-time PCR and DNA sequencing. We also describe a primer-probe partial overlap approach which significantly simplified the melting curve patterns and minimized the influence of viral genome polymorphism on assay accuracy. Analysis of 62 patient samples showed a complete match of the melting curve patterns with the sequencing results. More than 97% of HBV BCP sequences in the GenBank database can be correctly identified by the melting curve analysis. The combination of siPCR and the SimpleProbe real-time PCR enabled mutant quantification in the presence of a 100,000-fold excess of the WT DNA. PMID:21562108

Identification of two allelic IgG1 C(H) coding regions (Cgamma1) of cat.

PubMed

Kanai, T H; Ueda, S; Nakamura, T

2000-01-31

Two types of cDNA encoding IgG1 heavy chain (gamma1) were isolated from a single domestic short-hair cat. Sequence analysis indicated a higher level of similarity of these Cgamma1 sequences to human Cgamma1 sequence (76.9 and 77.0%) than to mouse sequence (70.0 and 69.7%) at the nucleotide level. Predicted primary structures of both the feline Cgamma1 genes, designated as Cgamma1a and Cgamma1b, were similar to that of human Cgamma1 gene, for instance, as to the size of constant domains, the presence of six conserved cysteine residues involved in formation of the domain structure, and the location of a conserved N-linked glycosylation site. Sequence comparison between the two alleles showed that 7 out of 10 nucleotide differences were within the C(H)3 domain coding region, all leading to nonsynonymous changes in amino acid residues. Partial sequence analysis of genomic clones showed three nucleotide substitutions between the two Cgamma1 alleles in the intron between the CH2 and C(H)3 domain coding regions. In 12 domestic short-hair cats used in this study, the frequency of Cgamma1a allele (62.5%) was higher than that of the Cgamma1b allele (37.5%).

Whole-Genome Sequencing of Sordaria macrospora Mutants Identifies Developmental Genes.

PubMed

Nowrousian, Minou; Teichert, Ines; Masloff, Sandra; Kück, Ulrich

2012-02-01

The study of mutants to elucidate gene functions has a long and successful history; however, to discover causative mutations in mutants that were generated by random mutagenesis often takes years of laboratory work and requires previously generated genetic and/or physical markers, or resources like DNA libraries for complementation. Here, we present an alternative method to identify defective genes in developmental mutants of the filamentous fungus Sordaria macrospora through Illumina/Solexa whole-genome sequencing. We sequenced pooled DNA from progeny of crosses of three mutants and the wild type and were able to pinpoint the causative mutations in the mutant strains through bioinformatics analysis. One mutant is a spore color mutant, and the mutated gene encodes a melanin biosynthesis enzyme. The causative mutation is a G to A change in the first base of an intron, leading to a splice defect. The second mutant carries an allelic mutation in the pro41 gene encoding a protein essential for sexual development. In the mutant, we detected a complex pattern of deletion/rearrangements at the pro41 locus. In the third mutant, a point mutation in the stop codon of a transcription factor-encoding gene leads to the production of immature fruiting bodies. For all mutants, transformation with a wild type-copy of the affected gene restored the wild-type phenotype. Our data demonstrate that whole-genome sequencing of mutant strains is a rapid method to identify developmental genes in an organism that can be genetically crossed and where a reference genome sequence is available, even without prior mapping information.

Whole-Genome Sequencing of Sordaria macrospora Mutants Identifies Developmental Genes

PubMed Central

Nowrousian, Minou; Teichert, Ines; Masloff, Sandra; Kück, Ulrich

2012-01-01

The study of mutants to elucidate gene functions has a long and successful history; however, to discover causative mutations in mutants that were generated by random mutagenesis often takes years of laboratory work and requires previously generated genetic and/or physical markers, or resources like DNA libraries for complementation. Here, we present an alternative method to identify defective genes in developmental mutants of the filamentous fungus Sordaria macrospora through Illumina/Solexa whole-genome sequencing. We sequenced pooled DNA from progeny of crosses of three mutants and the wild type and were able to pinpoint the causative mutations in the mutant strains through bioinformatics analysis. One mutant is a spore color mutant, and the mutated gene encodes a melanin biosynthesis enzyme. The causative mutation is a G to A change in the first base of an intron, leading to a splice defect. The second mutant carries an allelic mutation in the pro41 gene encoding a protein essential for sexual development. In the mutant, we detected a complex pattern of deletion/rearrangements at the pro41 locus. In the third mutant, a point mutation in the stop codon of a transcription factor-encoding gene leads to the production of immature fruiting bodies. For all mutants, transformation with a wild type-copy of the affected gene restored the wild-type phenotype. Our data demonstrate that whole-genome sequencing of mutant strains is a rapid method to identify developmental genes in an organism that can be genetically crossed and where a reference genome sequence is available, even without prior mapping information. PMID:22384404

Functional analysis of potassium channels in Kv7.2 G271V mutant causing early onset familial epilepsy.

PubMed

Wang, Juanjuan; Li, Yuan; Hui, Zhiyan; Cao, Min; Shi, Ruiming; Zhang, Wei; Geng, Limeng; Zhou, Xihui

2015-08-07

Kv7 (KCNQ) channels underlying a class of voltage-gated K+ current are best known for regulating neuronal excitability. The first glycine (G) residue in the pore helix of Kv7.2 (KCNQ2) subunit is highly conserved among different classes of Kv7 channel family. A missense mutation causing the replacement of the corresponding G residues with a valine (p.G271V) in Kv7.2 was found in a large, four-generation pedigree. Here, we set out to examine the molecular pathomechanism of G271V mutants using patch clamp technology combined with biochemical and immunocytochemical techniques in transiently transfected human embryonic kidney (HEK) 293 cells. The expression of Kv7.2 protein had the same intensity for both wild type (WT) and G271V. In transfected HEK cells, G271V mutants induced large depolarizing shifts of the conductance-voltage relationships and marked slowing of current activation kinetics compared to WT. In addition, G271V mutants abolished currents in homomeric channels, and resulted in about 50% reduction of current in Kv7.2/G271V/Kv7.3 heteromultimeric condition, indicating a more severe functional defect. To test for G271V mutant channel expression in surface membrane, we performed fluorescence confocal microscopy imaging, which revealed no differences between the mutant and WT, suggesting that G271V channels fail to open in response to depolarization even though they are present in the membrane. Furthermore, pharmacologic intervention experiments revealed that upon specific incubation of transfected HEK 293 cells expressing G271V heteromultimeric channels in presence of Kv7 channel enhancer retigabine (ezogabine), the potassium currents increased significantly, suggesting the potential of retigabine as gene-specific therapy. Copyright © 2015 Elsevier B.V. All rights reserved.

Response of the pearly eye melon fly Bactrocera cucurbitae (Coquillett)(Diptera:Tephritidae) mutant to host-associated visual cues

USDA-ARS?s Scientific Manuscript database

We report on a pearly eye mutant (PEM) line generated from a single male Bactrocera cucurbitae collected in Kapoho, Hawaii. Crossing experiments with colony wild-type flies indicate that the locus controlling this trait is autosomal and the mutant allele is recessive. Experiments with females to ass...

Association of CTLA-4 gene 49A/G polymorphism with the incidence of type 1 diabetes mellitus in the Iranian Kurdish population.

PubMed

Ahmadi, Slahadin; Rostamzadeh, Jalal; Khosravi, Darya; Shariati, Parvin; Shakiba, Nadia

2013-12-15

Cytotoxic T-lymphocyte-associated antigen-4 (CTLA-4) has an inhibitory function on T cells and is critical for the induction of peripheral tolerance. CTLA-4 +49 G allele affects the CTLA-4 function and has been reported to be correlated with a higher risk of various autoimmune diseases including type 1 diabetes (T1D). The present study was conducted to investigate the association between the polymorphism of the CTLA-4 exon 1+49 A/G and susceptibility to TID and type 2 diabetes (T2D) in Kurds living in Iranian Kurdistan. The+49 A/G polymorphism was analyzed in 60 patients with T1D, 56 patients with T2D and 107 control subjects using PCR Single-strand Conformation Polymorphism (SSCP) and restriction fragment length polymorphism methods. All studied populations (T1D, T2D and Controls) were in Hardy-Weinberg equilibrium (p, 0.39, 0.94 and 0.89, respectively). Both+49 G allele (p = 0. 015, OR = 1.86) and +49 A/G genotype frequencies (p = 0. 012, OR = 2.31) were significantly higher in T1D patients than control. There was significant over-representation of the G allele in female T1D patients. No significant differences in +49 G allele and +49 A/G genotype frequencies were found between T2D and control subjects. SSCP analysis did not show new mutation in the amplified segment. The results of this study indicate that CTLA-4+49 A/G gene polymorphism confers genetic susceptibility to T1D but not T2D in the Kurdish population living in Iranian Kurdistan and women carrying the +49 G allele are at greater risk of getting T1D than men having the G allele.

Isolation and analysis of a mammalian temperature-sensitive mutant defective in G2 functions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mineo, C.; Murakami, Y.; Ishimi, Y.

1986-11-01

A temperature-sensitive (ts) mutant, designated tsFT210, was isolated from a mouse mammary carcinoma cell line, FM3A. The tsFT210 cells grew normally at 33/sup 0/C (permissive temperature), but more than 80% of the cells were arrested at the G2 phase at 39/sup 0/C (non-permissive temperature) as revealed by flow-microfluorimetric analysis. DNA replication and synthesis of other macromolecules by this mutant seemed to be normal at 39/sup 0/C for at least 10h. However, in this mutant, hyperphosphorylation of H1 histone from the G2 to M phase, which occurs in the normal cell cycle, could not be detected at the non-permissive temperature. Thismore » suggests that a gene product which is temperature-sensitive in tsFT210 cells is necessary for hyperphosphorylation of H1 histone and that this gene product may be related to chromosome condensation.« less

Allele-Specific Silencing of Mutant mRNA Rescues Ultrastructural and Arrhythmic Phenotype in Mice Carriers of the R4496C Mutation in the Ryanodine Receptor Gene (RYR2).

PubMed

Bongianino, Rossana; Denegri, Marco; Mazzanti, Andrea; Lodola, Francesco; Vollero, Alessandra; Boncompagni, Simona; Fasciano, Silvia; Rizzo, Giulia; Mangione, Damiano; Barbaro, Serena; Di Fonso, Alessia; Napolitano, Carlo; Auricchio, Alberto; Protasi, Feliciano; Priori, Silvia G

2017-08-18

Mutations in the cardiac Ryanodine Receptor gene ( RYR2 ) cause dominant catecholaminergic polymorphic ventricular tachycardia (CPVT), a leading cause of sudden death in apparently healthy individuals exposed to emotions or physical exercise. We investigated the efficacy of allele-specific silencing by RNA interference to prevent CPVT phenotypic manifestations in our dominant CPVT mice model carriers of the heterozygous mutation R4496C in RYR2 . We developed an in vitro mRNA and protein-based assays to screen multiple siRNAs for their ability to selectively silence mutant RYR2 -R4496C mRNA over the corresponding wild-type allele. For the most performant of these siRNAs (siRYR2-U10), we evaluated the efficacy of an adeno-associated serotype 9 viral vector (AAV9) expressing miRYR2-U10 in correcting RyR2 (Ryanodine Receptor type 2 protein) function after in vivo delivery by intraperitoneal injection in neonatal and adult RyR2 R4496C/+ (mice heterozygous for the R4496C mutation in the RyR2) heterozygous CPVT mice. Transcriptional analysis showed that after treatment with miRYR2-U10, the ratio between wild-type and mutant RYR2 mRNA was doubled (from 1:1 to 2:1) confirming the ability of miRYR2-U10 to selectively inhibit RYR2 -R4496C mRNA, whereas protein quantification showed that total RyR2 was reduced by 15% in the heart of treated mice. Furthermore, AAV9-miRYR2-U10 effectively (1) reduced isoproterenol-induced delayed afterdepolarizations and triggered activity in infected cells, (2) reduced adrenergically mediated ventricular tachycardia in treated mice, (3) reverted ultrastructural abnormalities of junctional sarcoplasmic reticulum and transverse tubules, and (4) attenuated mitochondrial abnormalities. The study demonstrates that allele-specific silencing with miRYR2-U10 prevents life-threatening arrhythmias in CPVT mice, suggesting that the reduction of mutant RyR2 may be a novel therapeutic approach for CPVT. © 2017 American Heart Association, Inc.

Positive selection of Caenorhabditis elegans mutants with increased stress resistance and longevity.

PubMed Central

Muñoz, Manuel J; Riddle, Donald L

2003-01-01

We developed selective conditions for long-lived mutants of the nematode Caenorhabditis elegans by subjecting the first larval stage (L1) to thermal stress at 30 degrees for 7 days. The surviving larvae developed to fertile adults after the temperature was shifted to 15 degrees. A total of one million F(2) progeny and a half million F(3) progeny of ethyl-methanesulfonate-mutagenized animals were treated in three separate experiments. Among the 81 putative mutants that recovered and matured to the reproductive adult, 63 retested as thermotolerant and 49 (80%) exhibited a >15% increase in mean life span. All the known classes of dauer formation (Daf) mutant that affect longevity were found, including six new alleles of daf-2, and a unique temperature-sensitive, dauer-constitutive allele of age-1. Alleles of dyf-2 and unc-13 were isolated, and mutants of unc-18, a gene that interacts with unc-13, were also found to be long lived. Thirteen additional mutations define at least four new genes. PMID:12586705

Development of New Mouse Lung Tumor Models Expressing EGFR T790M Mutants Associated with Clinical Resistance to Kinase Inhibitors

PubMed Central

Regales, Lucia; Balak, Marissa N.; Gong, Yixuan; Politi, Katerina; Sawai, Ayana; Le, Carl; Koutcher, Jason A.; Solit, David B.; Rosen, Neal; Zakowski, Maureen F.; Pao, William

2007-01-01

Background The EGFR T790M mutation confers acquired resistance to kinase inhibitors in human EGFR mutant lung adenocarcinoma, is occasionally detected before treatment, and may confer genetic susceptibility to lung cancer. Methodology/Principal Findings To study further its role in lung tumorigenesis, we developed mice with inducible expression in type II pneumocytes of EGFRT790M alone or together with a drug-sensitive L858R mutation. Both transgenic lines develop lung adenocarcinomas that require mutant EGFR for tumor maintenance but are resistant to an EGFR kinase inhibitor. EGFRL858R+T790M-driven tumors are transiently targeted by hsp90 inhibition. Notably, EGFRT790M-expressing animals develop tumors with longer latency than EGFRL858R+T790M-bearing mice and in the absence of additional kinase domain mutations. Conclusions/Significance These new mouse models of mutant EGFR-dependent lung adenocarcinomas provide insight into clinical observations. The models should also be useful for developing improved therapies for patients with lung cancers harboring EGFRT790M alone or in conjunction with drug-sensitive EGFR kinase domain mutations. PMID:17726540

Limits of transforming competence of SV40 nuclear and cytoplasmic large T mutants with altered Rb binding sequences.

PubMed

Tedesco, D; Fischer-Fantuzzi, L; Vesco, C

1993-03-01

Multiple amino acid substitutions were introduced into the SV40 large T region that harbors the retinoblastoma protein (Rb) binding site and the nuclear transport signal, changing either one or both of these determinants. Mutant activities were examined in a set of assays allowing different levels of transforming potential to be distinguished; phenotypic changes in established and pre-crisis rat embryo fibroblasts (REFs) were detected under isogenic cell conditions, and comparisons made with other established rodent cells. The limit of the transforming ability of mutants with important substitutions in the Rb binding site fell between two transformation levels of the same established rat cells. Such cells could be induced to form dense foci but not agar colonies (their parental pre-crises REFs, as expected, were untransformed either way). Nonetheless, agar colony induction was possible in other cell lines, such as mouse NIH3T3 and (for one of the mutants) rat F2408. All these mutants efficiently immortalized pre-crisis REFs. The transforming ability of cytoplasmic mutants appeared to depend on the integrity of the Rb-binding sequence to approximately the same extent as that of the wild-type large T, although evidence of in vivo Rb-cytoplasmic large T complexes was not found. The presence or absence of small t was critical when the transforming task of mutants was near the limit of their abilities.

Association of G894T eNOS, 4G/5G PAI and T1131C APOA5 polymorphisms with susceptibility to myocardial infarction in Morocco.

PubMed

Hassani Idrissi, Hind; Hmimech, Wiam; Diakite, Brehima; Korchi, Farah; Baghdadi, Dalila; Habbal, Rachida; Nadifi, Sellama

2016-09-01

Myocardial infarction (MI) is a common multifactorial disease. Numerous studies have found that genetic plays an essential role in MI occurrence. The main objective of our case-control study is to explore the association of G894T eNOS (rs1799983), 4G/5G PAI (rs1799889) and T1131C APOA5 (rs662799) polymorphisms with MI susceptibility in the Moroccan population. 118 MI patients were recruited vs 184 healthy controls. DNA samples were genotyped by PCR-RFLP method using MboI, BslI and MseI restriction enzymes respectively for the G894T eNOS, 4G/5G PAI and T1131C APOA5 polymorphisms. Our results show that the G894T eNOS was significantly associated with increased risk of MI under the three genetic transmission models (dominant: OR = 1.64, 95% CI = 1.05-2.58, P = 0.003; recessive: OR = 2.15, 95% CI = 0.74-6.16, P = 0.03; additive: OR = 1.54, 95% CI = 1.06-2.23, P = 0.001). The T1131C APOA5 polymorphism was associated to MI risk in recessive and additive models (OR = 1.53, 95% CI = 0.72-3.2, P = 0.04 and OR = 1.78, 95% CI = 1.26-2.51, P = 0.03 respectively). For the 4G/5G PAI variant, even the cases and controls groups were not in Hardy-Weinberg Equilibrium (HWE), the dominant and additive models show a statistically significant association with MI risk (OR = 7.96, 95%CI = 3.83-16.36, P = 0.01 and OR = 1.96, 95% CI = 1.4-2.72, P = 0.03 respectively). Our results suggest that G894T eNOS and T1131C APOA5 polymorphisms may be considered as genetic markers of MI among the Moroccan population. Further studies including larger sample sizes and exploring more genetic associations are needed to confirm our results and to better understand the susceptibility to MI.

The Arabidopsis dwarf1 Mutant Is Defective in the Conversion of 24-Methylenecholesterol to Campesterol in Brassinosteroid Biosynthesis1

PubMed Central

Choe, Sunghwa; Dilkes, Brian P.; Gregory, Brian D.; Ross, Amanda S.; Yuan, Heng; Noguchi, Takahiro; Fujioka, Shozo; Takatsuto, Suguru; Tanaka, Atsushi; Yoshida, Shigeo; Tax, Frans E.; Feldmann, Kenneth A.

1999-01-01

Since the isolation and characterization of dwarf1-1 (dwf1-1) from a T-DNA insertion mutant population, phenotypically similar mutants, including deetiolated2 (det2), constitutive photomorphogenesis and dwarfism (cpd), brassinosteroid insensitive1 (bri1), and dwf4, have been reported to be defective in either the biosynthesis or the perception of brassinosteroids. We present further characterization of dwf1-1 and additional dwf1 alleles. Feeding tests with brassinosteroid-biosynthetic intermediates revealed that dwf1 can be rescued by 22α-hydroxycampesterol and downstream intermediates in the brassinosteroid pathway. Analysis of the endogenous levels of brassinosteroid intermediates showed that 24-methylenecholesterol in dwf1 accumulates to 12 times the level of the wild type, whereas the level of campesterol is greatly diminished, indicating that the defective step is in C-24 reduction. Furthermore, the deduced amino acid sequence of DWF1 shows significant similarity to a flavin adenine dinucleotide-binding domain conserved in various oxidoreductases, suggesting an enzymatic role for DWF1. In support of this, 7 of 10 dwf1 mutations directly affected the flavin adenine dinucleotide-binding domain. Our molecular characterization of dwf1 alleles, together with our biochemical data, suggest that the biosynthetic defect in dwf1 results in reduced synthesis of bioactive brassinosteroids, causing dwarfism. PMID:10069828

Properties of the simian virus 40 (SV40) large T antigens encoded by SV40 mutants with deletions in gene A.

PubMed Central

Cole, C N; Tornow, J; Clark, R; Tjian, R

1986-01-01

The biochemical properties of the large T antigens encoded by simian virus 40 (SV40) mutants with deletions at DdeI sites in the SV40 A gene were determined. Mutant large T antigens containing only the first 138 to 140 amino acids were unable to bind to the SV40 origin of DNA replication as were large T antigens containing at their COOH termini 96 or 97 amino acids encoded by the long open reading frame located between 0.22 and 0.165 map units (m.u.). All other mutant large T antigens were able to bind to the SV40 origin of replication. Mutants with in-phase deletions at 0.288 and 0.243 m.u. lacked ATPase activity, but ATPase activity was normal in mutants lacking origin-binding activity. The 627-amino acid large T antigen encoded by dlA2465, with a deletion at 0.219 m.u., was the smallest large T antigen displaying ATPase activity. Mutant large T antigens with the alternate 96- or 97-amino acid COOH terminus also lacked ATPase activity. All mutant large T antigens were found in the nuclei of infected cells; a small amount of large T with the alternate COOH terminus was also located in the cytoplasm. Mutant dlA2465 belonged to the same class of mutants as dlA2459. It was unable to form plaques on CV-1p cells at 37 or 32 degrees C but could form plaques on BSC-1 monolayers at 37 degrees C but not at 32 degrees C. It was positive for viral DNA replication and showed intracistronic complementation with any group A mutant whose large T antigen contained a normal carboxyl terminus. These findings and those of others suggest that both DNA binding and ATPase activity are required for the viral DNA replication function of large T antigen, that these two activities must be located on the same T antigen monomer, and that these two activities are performed by distinct domains of the polypeptide. These domains are distinct and separable from the domain affected by the mutation of dlA2465 and indicate that SV40 large T antigen is made up of at least three separate functional

Association between ADIPOQ +45T>G Polymorphism and Type 2 Diabetes: A Systematic Review and Meta-Analysis

PubMed Central

Fan, Yaofu; Wang, Kun; Xu, Shuhang; Chen, Guofang; Di, Hongjie; Cao, Meng; Liu, Chao

2014-01-01

Recently, a number of studies have reported the association between the single nucleotide polymorphisms (SNPs) +45T>G polymorphism in the adiponectin (ADIPOQ) gene and type 2 diabetes mellitus (T2DM) risk, though the results are inconsistent. In order to obtain a more precise estimation of the relationship, a meta-analysis was performed. In this current study, the Medline, Embase, Pubmed, ISI Web of Knowledge, Ovid, Science Citation Index Expanded Database, Wanfang Database, and China National Knowledge Infrastructure were searched for eligible studies. Odds ratios (ORs) with 95% confidence intervals (CIs) were used to estimate the strength of association. Forty-five publications were included in the final meta-analysis with 9986 T2DM patients and 16,222 controls for ADIPOQ +45T>G polymorphism according to our inclusion and exclusion criteria. The +45T>G polymorphism was associated with an overall significantly increased risk of T2DM (G vs. T: OR = 1.18, 95% CI = 1.06–1.32; The dominant model: OR = 1.18, 95% CI = 1.03–1.33; The recessive model: OR = 1.47, 95% CI = 1.20–1.78; The homozygous model: OR = 1.62, 95% CI = 1.25–2.09; Except the heterozygous model: OR = 1.11, 95% CI = 0.98–1.24). Subgroup analysis revealed a significant association between the +45T>G polymorphism and T2D in an Asian population. Thus, this meta-analysis indicates that the G allele of the ADIPOQ +45T>G polymorphisms associated with a significantly increased risk of T2DM in the Asian population. PMID:25561226

TLR3 deficiency in herpes simplex encephalitis: high allelic heterogeneity and recurrence risk.

PubMed

Lim, Hye Kyung; Seppänen, Mikko; Hautala, Timo; Ciancanelli, Michael J; Itan, Yuval; Lafaille, Fabien G; Dell, William; Lorenzo, Lazaro; Byun, Minji; Pauwels, Elodie; Rönnelid, Ylva; Cai, Xin; Boucherit, Soraya; Jouanguy, Emmanuelle; Paetau, Anders; Lebon, Pierre; Rozenberg, Flore; Tardieu, Marc; Abel, Laurent; Yildiran, Alisan; Vergison, Anne; Roivainen, Reina; Etzioni, Amos; Tienari, Pentti J; Casanova, Jean-Laurent; Zhang, Shen-Ying

2014-11-18

To determine the proportion of children with herpes simplex encephalitis (HSE) displaying TLR3 deficiency, the extent of TLR3 allelic heterogeneity, and the specific clinical features of TLR3 deficiency. We determined the sequence of all exons of TLR3 in 110 of the 120 patients with HSE enrolled in our study who do not carry any of the previously described HSE-predisposing mutations of TLR3 pathway genes (TLR3, UNC93B1, TRIF, TRAF3, and TBK1). All the new mutant TLR3 alleles detected were characterized experimentally in-depth to establish the causal relationship between the genotype and phenotype. In addition to the 3 previously reported TLR3-deficient patients from the same cohort, 6 other children or young adults with HSE carry 1 of 5 unique or extremely rare (minor allele frequency <0.001) missense TLR3 alleles. Two alleles (M374T, D592N) heterozygous in 3 patients are not deleterious in vitro. The other 3 are deleterious via different mechanisms: G743D+R811I and L360P heterozygous in 2 patients are loss-of-function due to low levels of expression and lack of cleavage, respectively, and R867Q homozygous in 1 patient is hypomorphic. The 3 patients' fibroblasts display impaired TLR3 responses and enhanced herpes simplex virus 1 susceptibility. Overall, TLR3 deficiency is therefore found in 6 (5%) of the 120 patients studied. There is high allelic heterogeneity, with 3 forms of autosomal dominant partial defect by negative dominance or haploinsufficiency, and 2 forms of autosomal recessive defect with complete or partial deficiency. Finally, 4 (66%) of the 6 TLR3-deficient patients had at least 1 late relapse of HSE, whereas relapse occurred in only 12 (10%) of the total cohort of 120 patients. Childhood-onset HSE is due to TLR3 deficiency in a traceable fraction of patients, in particular the ones with HSE recurrence. Mutations in TLR3 and TLR3 pathway genes should be searched and experimentally studied in children with HSE, and patients with proven TLR3

Isolation and characterization of xylitol-assimilating mutants of recombinant Saccharomyces cerevisiae.

PubMed

Tani, Tatsunori; Taguchi, Hisataka; Fujimori, Kazuhiro E; Sahara, Takehiko; Ohgiya, Satoru; Kamagata, Yoichi; Akamatsu, Takashi

2016-10-01

To clarify the mechanisms of xylitol utilization, three xylitol-assimilating mutants were isolated from recombinant Saccharomyces cerevisiae strains showing highly efficient xylose-utilization. The nucleotide sequences of the mutant genomes were analyzed and compared with those of the wild-type strains and the mutation sites were identified. gal80 mutations were common to all the mutants, and recessive to the wild-type allele. Hence we constructed a gal80Δ mutant and confirmed that the gal80Δ mutant showed a xylitol-assimilation phenotype. When the constructed gal80Δ mutant was crossed with the three isolated mutants, all diploid hybrids showed xylitol assimilation, indicating that the mutations were all located in the GAL80. We analyzed the role of the galactose permease Gal2, controlled by the regulatory protein Gal80, in assimilating xylitol. A gal2Δ gal80Δ double mutant did not show xylitol assimilation, whereas expression of GAL2 under the control of the TDH3 promoter in the GAL80 strain did result in assimilation. These data indicate that Gal2 was needed for xylitol assimilation in the wild-type strain. When the gal80 mutant with an initial cell concentration of A660 = 20 was used for batch fermentation in a complex medium containing 20 g/L xylose or 20 g/L xylitol at pH 5.0 and 30°C under oxygen limitation, the gal80 mutant consumed 100% of the xylose within 12 h, but <30% of the xylitol within 100 h, indicating that xylose reductase is required for xylitol consumption in oxygen-limited conditions. Copyright © 2016 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Association of UCP1 -3826A/G and UCP3 -55C/T gene polymorphisms with obesity and its related traits among multi-ethnic Malaysians.

PubMed

Lee, Kah-Hui; Chai, Voon-Yun; Kanachamy, Sathia S; Say, Yee-How

2015-01-01

Our study investigated the association of UCP1 -3826A/G and UCP3 -55C/T single nucleotide polymorphisms (SNPs) with obesity and its related traits among multi-ethnic Malaysians. A total of 447 (225 males; 46 Malays, 339 ethnic Chinese, 62 ethnic Indians; 111 obese) participated. Demographic and anthropometric data were collected, and genotyping was performed by polymerase chain reaction-restriction fragment length polymorphism. The minor allele frequencies (MAFs) for UCP1 according to Malay/Chinese/Indian ethnicities were .61/.55/.52 and .32/.55/.38, respectively. UCP3 genotype and allele distribution was significantly associated with ethnicity and waist-to-hip ratio (WHR), but among non-obese and Chinese participants only, respectively, after stratified analysis. Chinese participants with T allele had significantly lesser risk to be centrally obese [odds ratio =.69 (CI =.48, 1.00; P=.04)], and also had significantly lower WHR compared to those with C allele. The UCP1 or UCP3 SNPs were not associated with obesity/BMI and total body fat (TBF), but combinatory genotype analysis revealed that those having the AA and CC genotype for the former and latter SNPs had significantly highest BMI and TBF compared to other genotype combinations. UCP3 -55C/T SNP was associated with central obesity among Malaysian participants of Chinese descent. Combinatory genotype analysis showed that BMI and TBF were significantly different among UCPI -3826A/G and UCP3 -55C/T genotype combinations, suggesting the existence of a gene interaction between UCP1 and UCP3 in influencing obesity and adiposity.

A comparison of QuantStudio™ 3D Digital PCR and ARMS-PCR for measuring plasma EGFR T790M mutations of NSCLC patients.

PubMed

Feng, Qin; Gai, Fei; Sang, Yaxiong; Zhang, Jie; Wang, Ping; Wang, Yue; Liu, Bing; Lin, Dongmei; Yu, Yang; Fang, Jian

2018-01-01

The AURA3 clinical trial has shown that advanced non-small cell lung cancer (NSCLC) patients with EGFR T790M mutations in circulating tumor DNA (ctDNA) could benefit from osimertinib. The aim of this study was to assess the usefulness of QuantStudio™ 3D Digital PCR System platform for the detection of plasma EGFR T790M mutations in NSCLC patients, and compare the performances of 3D Digital PCR and ARMS-PCR. A total of 119 Chinese patients were enrolled in this study. Mutant allele frequency of plasma EGFR T790M was detected by 3D Digital PCR, then 25 selected samples were verified by ARMS-PCR and four of them were verified by next generation sequencing (NGS). In total, 52.94% (69/119) had EGFR T790M mutations detected by 3D Digital PCR. In 69 positive samples, the median mutant allele frequency (AF) was 1.09% and three cases presented low concentration (AF <0.1%). Limited by the amount of plasma DNA, 17 samples (AF <2.5%) and eight samples (T790M-) were selected for verification by ARMS-PCR. Four of those samples were verified by NGS as a third verification method. Among the selected 17 positive cases, ten samples presented mutant allele frequency <0.5%, and seven samples presented intermediate mutant allele frequency (0.5% AF 2.5%). However, only three samples (3/17) were identified as positive by ARMS-PCR, namely, P6 (AF =1.09%), P7 (AF =2.09%), and P8 (AF =2.21%). It is worth mentioning that sample P9 (AF =2.05%, analyzed by 3D Digital PCR) was identified as T790M- by ARMS-PCR. Four samples were identified as T790M+ by both NGS and 3D Digital PCR, and typically three samples (3/4) presented at a low ratio (AF <0.5%). Our study demonstrated that 3D Digital PCR is a novel method with high sensitivity and specificity to detect EGFR T790M mutation in plasma.

Direct Fluorescence Detection of Allele-Specific PCR Products Using Novel Energy-Transfer Labeled Primers.

PubMed

Winn-Deen

1998-12-01

Background: Currently analysis of point mutations can be done by allele-specific polymerase chain reaction (PCR) followed by gel analysis or by gene-specific PCR followed by hybridization with an allele-specific probe. Both of these mutation detection methods require post-PCR laboratory time and run the risk of contaminating subsequent experiments with the PCR product liberated during the detection step. The author has combined the PCR amplification and detection steps into a single procedure suitable for closed-tube analysis. Methods and Results: Allele-specific PCR primers were designed as Sunrise energy-transfer primers and contained a 3' terminal mismatch to distinguish between normal and mutant DNA. Cloned normal (W64) and mutant (R64) templates of the beta3-adrenergic receptor gene were tested to verify amplification specificity and yield. A no-target negative control was also run with each reaction. After PCR, each reaction was tested for fluorescence yield by measuring fluorescence on a spectrofluorimeter or fluorescent microtitreplate reader. The cloned controls and 24 patient samples were tested for the W64R mutation by two methods. The direct fluorescence results with the Sunrise allele-specific PCR method gave comparable genotypes to those obtained with the PCR/ restriction digest/gel electrophoresis control method. No PCR artifacts were observed in the negative controls or in the PCR reactions run with the mismatched target. Conclusions: The results of this pilot study indicate good PCR product and fluorescence yield from allele-specific energy-transfer labeled primers, and the capability of distinguishing between normal and mutant alleles based on fluorescence alone, without the need for restriction digestion, gel electrophoresis, or hybridization with an allele-specific probe.

Library of synthetic transcriptional AND gates built with split T7 RNA polymerase mutants

PubMed Central

Shis, David L.; Bennett, Matthew R.

2013-01-01

The construction of synthetic gene circuits relies on our ability to engineer regulatory architectures that are orthogonal to the host’s native regulatory pathways. However, as synthetic gene circuits become larger and more complicated, we are limited by the small number of parts, especially transcription factors, that work well in the context of the circuit. The current repertoire of transcription factors consists of a limited selection of activators and repressors, making the implementation of transcriptional logic a complicated and component-intensive process. To address this, we modified bacteriophage T7 RNA polymerase (T7 RNAP) to create a library of transcriptional AND gates for use in Escherichia coli by first splitting the protein and then mutating the DNA recognition domain of the C-terminal fragment to alter its promoter specificity. We first demonstrate that split T7 RNAP is active in vivo and compare it with full-length enzyme. We then create a library of mutant split T7 RNAPs that have a range of activities when used in combination with a complimentary set of altered T7-specific promoters. Finally, we assay the two-input function of both wild-type and mutant split T7 RNAPs and find that regulated expression of the N- and C-terminal fragments of the split T7 RNAPs creates AND logic in each case. This work demonstrates that mutant split T7 RNAP can be used as a transcriptional AND gate and introduces a unique library of components for use in synthetic gene circuits. PMID:23479654

Library of synthetic transcriptional AND gates built with split T7 RNA polymerase mutants.

PubMed

Shis, David L; Bennett, Matthew R

2013-03-26

The construction of synthetic gene circuits relies on our ability to engineer regulatory architectures that are orthogonal to the host's native regulatory pathways. However, as synthetic gene circuits become larger and more complicated, we are limited by the small number of parts, especially transcription factors, that work well in the context of the circuit. The current repertoire of transcription factors consists of a limited selection of activators and repressors, making the implementation of transcriptional logic a complicated and component-intensive process. To address this, we modified bacteriophage T7 RNA polymerase (T7 RNAP) to create a library of transcriptional AND gates for use in Escherichia coli by first splitting the protein and then mutating the DNA recognition domain of the C-terminal fragment to alter its promoter specificity. We first demonstrate that split T7 RNAP is active in vivo and compare it with full-length enzyme. We then create a library of mutant split T7 RNAPs that have a range of activities when used in combination with a complimentary set of altered T7-specific promoters. Finally, we assay the two-input function of both wild-type and mutant split T7 RNAPs and find that regulated expression of the N- and C-terminal fragments of the split T7 RNAPs creates AND logic in each case. This work demonstrates that mutant split T7 RNAP can be used as a transcriptional AND gate and introduces a unique library of components for use in synthetic gene circuits.

Skewed segregation of the mtDNA nt 8993 (T-->G) mutation in human oocytes.

PubMed Central

Blok, R B; Gook, D A; Thorburn, D R; Dahl, H H

1997-01-01

Rapid changes in mtDNA variants between generations have led to the bottleneck theory, which proposes a dramatic reduction in mtDNA numbers during early oogenesis. We studied oocytes from a woman with heteroplasmic expression of the mtDNA nt 8993 (T-->G) mutation. Of seven oocytes analyzed, one showed no evidence of the mutation, and the remaining six had a mutant load > 95%. This skewed expression of the mutation in oocytes is not compatible with the conventional bottleneck theory. A possible explanation is that, during amplification of mtDNA in the developing oocyte, mtDNA from one mitochondrion is preferentially amplified. Thus, subsequent mature oocytes may contain predominantly wild-type or mutant mitochondrial genomes. Images Figure 2 Figure 3 PMID:9199572

Genetic interactions between diverged alleles of Early heading date 1 (Ehd1) and Heading date 3a (Hd3a)/ RICE FLOWERING LOCUS T1 (RFT1) control differential heading and contribute to regional adaptation in rice (Oryza sativa).

PubMed

Zhao, Jing; Chen, Hongyi; Ren, Ding; Tang, Huiwu; Qiu, Rong; Feng, Jinglei; Long, Yunming; Niu, Baixiao; Chen, Danping; Zhong, Tianyu; Liu, Yao-Guang; Guo, Jingxin

2015-11-01

Initiation of flowering, also called heading, in rice (Oryza sativa) is determined by the florigens encoded by Heading date 3a (Hd3a) and RICE FLOWERING LOCUS T1 (RFT1). Early heading date 1 (Ehd1) regulates Hd3a and RFT1. However, different rice varieties have diverged alleles of Ehd1 and Hd3a/RFT1 and their genetic interactions remain largely unclear. Here we generated three segregating populations for different combinations of diverged Ehd1 and Hd3a/RFT1 alleles, and analyzed their genetic interactions between these alleles. We demonstrated that, in an ehd1 mutant background, Hd3a was silenced, but RFT1 was expressed (although at lower levels than in plants with a functional Ehd1) under short-day (SD) and long-day (LD) conditions. We identified a nonfunctional RFT1 allele (rft1); the lines carrying homozygous ehd1 and Hd3a/rft1 failed to induce the floral transition under SD and LD conditions. Like Hd3a, RFT1 also interacted with 14-3-3 proteins, the florigen receptors, but a nonfunctional RFT1 with a crucial E105K mutation failed to interact with 14-3-3 proteins. Furthermore, analyses of sequence variation and geographic distribution suggested that functional RFT1 alleles were selected during rice adaptation to high-latitude regions. Our results demonstrate the important roles of RFT1 in rice flowering and regional adaptation. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

Association between rs2431697 T allele on 5q33.3 and systemic lupus erythematosus: case-control study and meta-analysis.

PubMed

Tang, Zhao-Ming; Wang, Ping; Chang, Pan-Pan; Hasahya, Tony; Xing, Hui; Wang, Jin-Ping; Hu, Li-Hua

2015-11-01

rs2431697 is located on 5q33.3, between pituitary tumor-transforming gene 1 and miR-146a. Several studies have estimated the association between rs2431697 and systemic lupus erythematosus risk. However, the results were inconsistent. A case-control study was carried out to explore the association between rs2431697 and systemic lupus erythematosus risk in a central Chinese population. Meta-analyses combining present with previous studies were conducted to further explore the association. Our case-control study included 322 cases and 353 controls. rs2431697 T allele was associated with increased risk of systemic lupus erythematosus (odds ratios (ORs) = 1.461, 95% confidence intervals (CI) 1.091-1.957, P = 0.011). The association was stronger between T allele and the risk of anti-double-stranded DNA (dsDNA)-positive systemic lupus erythematosus (OR = 2.510, 95% CI 1.545-4.077, P < 0.001). The meta-analyses included 8648 systemic lupus erythematosus patients and 10947 controls. rs2431697 T allele had an overall OR of 1.262 (95% CI 1.205-1.323, P < 0.001) under fixed-effects model. After stratified by ethnicity, I (2) reduced from 24.3 to 0 %. T allele had an OR of 1.213 (95% CI 1.145-1.284, P < 0.001) in European descendant and 1.365 (95% CI 1.259-1.480, P < 0.001) in Asian under fixed-effects model. Data on women were also extracted, and T allele had an OR of 1.337 (95% CI 1.162-1.539, P < 0.001) under random-effects model. The pooled ORs were not influenced by each study in sensitivity analyses. There were no publication biases observed in these analyses. The results from our case-control study and the meta-analyses indicate that rs2431697 T allele significantly associates with the increased risk of systemic lupus erythematosus.

A novel root gravitropism mutant of Arabidopsis thaliana exhibiting altered auxin physiology

NASA Technical Reports Server (NTRS)

Simmons, C.; Migliaccio, F.; Masson, P.; Caspar, T.; Soll, D.

1995-01-01

A root gravitropism mutant was isolated from the DuPont Arabidopsis thaliana T-DNA insertional mutagenesis collection. This mutant has reduced root gravitropism, hence the name rgr1. Roots of rgr1 are shorter than those of wild-type, and they have reduced lateral root formation. In addition, roots of rgr1 coil clockwise on inclined agar plates, unlike wild-type roots which grow in a wavy pattern. The rgr1 mutant has increased resistance, as measured by root elongation, to exogenously applied auxins (6-fold to indole-3-acetic acid, 3-fold to 2,4-dichlorophenoxyacetic acid, and 2-fold to napthyleneacetic acid). It is also resistant to polar auxin transport inhibitors (2-fold to triiodobenzoic acid and 3- to 5-fold to napthylphthalamic acid). The rgr1 mutant does not appear to be resistant to other plant hormone classes. When grown in the presence of 10(-7) M 2,4-dichlorophenoxyacetic acid, rgr1 roots have fewer root hairs than wild type. All these rgr1 phenotypes are Mendelian recessives. Complementation tests indicate that rgr1 is not allelic to previously characterized agravitropic or auxin-resistant mutants. The rgr1 locus was mapped using visible markers to 1.4 +/- 0.6 map units from the CH1 locus at 1-65.4. The rgr1 mutation and the T-DNA cosegregate, suggesting that rgr1 was caused by insertional gene inactivation.