High resolution spectral analysis of oxygen. I. Isotopically invariant Dunham fit for the X(3)Σ(g)(-), a(1)Δ(g), b(1)Σ(g)(+) states.

PubMed

Yu, Shanshan; Miller, Charles E; Drouin, Brian J; Müller, Holger S P

2012-07-14

We have developed a simultaneous global fit to the MW, THz, infrared, visible, and UV transitions of all six oxygen isotopologues, (16)O(16)O, (16)O(17)O, (16)O(18)O, (17)O(17)O, (17)O(18)O, (18)O(18)O, with the objective of predicting all transitions below the O((3)P) + O((3)P) dissociation threshold as well as the B(3)Σ(u) (-) state from O((3)P)+O((1)D) within state-of-the-art experimental uncertainty. Here, we report an isotopically invariant Dunham fit for the lowest three electronic states, X(3)Σ(g)(-), a(1)Δ(g), and b(1)Σ(g)(+). Experimental transition frequencies involving these three states of all six O(2) isotopologues were critically reviewed and incorporated into the analysis. For the (16)O(16)O isotopologue, experimental data sample vibrational states v = 0-31 for X(3)Σ(g)(-), v = 0-10 for a(1)Δ(g), and v = 0-12 for b(1)Σ(g)(+). To the best of our knowledge, this is the first analysis that simultaneously fits spectra from all six O(2) isotopologues.

Supersymmetric M3-branes and G2 manifolds

NASA Astrophysics Data System (ADS)

Cvetič, M.; Gibbons, G. W.; Lü, H.; Pope, C. N.

2002-01-01

We obtain a generalisation of the original complete Ricci-flat metric of G2 holonomy on R4×S 3 to a family with a nontrivial parameter λ. For generic λ the solution is singular, but it is regular when λ={-1,0,+1}. The case λ=0 corresponds to the original G2 metric, and λ={-1,1} are related to this by an S3 automorphism of the SU(2) 3 isometry group that acts on the S3× S3 principal orbits. We then construct explicit supersymmetric M3-brane solutions in D=11 supergravity, where the transverse space is a deformation of this class of G2 metrics. These are solutions of a system of first-order differential equations coming from a superpotential. We also find M3-branes in the deformed backgrounds of new G2 holonomy metrics that include one found by A. Brandhuber, J. Gomis, S. Gubser and S. Gukov, and show that they also are supersymmetric.

Downlink power distributions for 2G and 3G mobile communication networks.

PubMed

Colombi, Davide; Thors, Björn; Persson, Tomas; Wirén, Niklas; Larsson, Lars-Eric; Jonsson, Mikael; Törnevik, Christer

2013-12-01

Knowledge of realistic power levels is key when conducting accurate EMF exposure assessments. In this study, downlink output power distributions for radio base stations in 2G and 3G mobile communication networks have been assessed. The distributions were obtained from network measurement data collected from the Operations Support System, which normally is used for network monitoring and management. Significant amounts of data were gathered simultaneously for large sets of radio base stations covering wide geographical areas and different environments. The method was validated with in situ measurements. For the 3G network, the 90th percentile of the averaged output power during high traffic hours was found to be 43 % of the maximum available power. The corresponding number for 2G, with two or more transceivers installed, was 65 % or below.

TeV γ-ray observations of the young synchrotron-dominated SNRs G1.9+0.3 and G330.2+1.0 with H.E.S.S.

NASA Astrophysics Data System (ADS)

H.E.S.S. Collaboration; Abramowski, A.; Aharonian, F.; Benkhali, F. Ait; Akhperjanian, A. G.; Angüner, E.; Anton, G.; Balenderan, S.; Balzer, A.; Barnacka, A.; Becherini, Y.; Becker Tjus, J.; Bernlöhr, K.; Birsin, E.; Bissaldi, E.; Biteau, J.; Böttcher, M.; Boisson, C.; Bolmont, J.; Bordas, P.; Brucker, J.; Brun, F.; Brun, P.; Bulik, T.; Carrigan, S.; Casanova, S.; Cerruti, M.; Chadwick, P. M.; Chalme-Calvet, R.; Chaves, R. C. G.; Cheesebrough, A.; Chrétien, M.; Colafrancesco, S.; Cologna, G.; Conrad, J.; Couturier, C.; Cui, Y.; Dalton, M.; Daniel, M. K.; Davids, I. D.; Degrange, B.; Deil, C.; deWilt, P.; Dickinson, H. J.; Djannati-Ataï, A.; Domainko, W.; O'C. Drury, L.; Dubus, G.; Dutson, K.; Dyks, J.; Dyrda, M.; Edwards, T.; Egberts, K.; Eger, P.; Espigat, P.; Farnier, C.; Fegan, S.; Feinstein, F.; Fernandes, M. V.; Fernandez, D.; Fiasson, A.; Fontaine, G.; Förster, A.; Füßling, M.; Gajdus, M.; Gallant, Y. A.; Garrigoux, T.; Giavitto, G.; Giebels, B.; Glicenstein, J. F.; Grondin, M.-H.; Grudzińska, M.; Häffner, S.; Hahn, J.; Harris, J.; Heinzelmann, G.; Henri, G.; Hermann, G.; Hervet, O.; Hillert, A.; Hinton, J. A.; Hofmann, W.; Hofverberg, P.; Holler, M.; Horns, D.; Jacholkowska, A.; Jahn, C.; Jamrozy, M.; Janiak, M.; Jankowsky, F.; Jung, I.; Kastendieck, M. A.; Katarzyński, K.; Katz, U.; Kaufmann, S.; Khélifi, B.; Kieffer, M.; Klepser, S.; Klochkov, D.; Kluźniak, W.; Kneiske, T.; Kolitzus, D.; Komin, Nu.; Kosack, K.; Krakau, S.; Krayzel, F.; Krüger, P. P.; Laffon, H.; Lamanna, G.; Lefaucheur, J.; Lemière, A.; Lemoine-Goumard, M.; Lenain, J.-P.; Lennarz, D.; Lohse, T.; Lopatin, A.; Lu, C.-C.; Marandon, V.; Marcowith, A.; Marx, R.; Maurin, G.; Maxted, N.; Mayer, M.; McComb, T. J. L.; Méhault, J.; Meintjes, P. J.; Menzler, U.; Meyer, M.; Moderski, R.; Mohamed, M.; Moulin, E.; Murach, T.; Naumann, C. L.; de Naurois, M.; Niemiec, J.; Nolan, S. J.; Oakes, L.; Ohm, S.; Wilhelmi, E. de Oña; Opitz, B.; Ostrowski, M.; Oya, I.; Panter, M.; Parsons, R. D.; Arribas, M. Paz; Pekeur, N. W.; Pelletier, G.; Perez, J.; Petrucci, P.-O.; Peyaud, B.; Pita, S.; Poon, H.; Pühlhofer, G.; Punch, M.; Quirrenbach, A.; Raab, S.; Raue, M.; Reimer, A.; Reimer, O.; Renaud, M.; Reyes, R. de los; Rieger, F.; Rob, L.; Romoli, C.; Rosier-Lees, S.; Rowell, G.; Rudak, B.; Rulten, C. B.; Sahakian, V.; Sanchez, D. A.; Santangelo, A.; Schlickeiser, R.; Schüssler, F.; Schulz, A.; Schwanke, U.; Schwarzburg, S.; Schwemmer, S.; Sol, H.; Spengler, G.; Spies, F.; Stawarz, Ł.; Steenkamp, R.; Stegmann, C.; Stinzing, F.; Stycz, K.; Sushch, I.; Szostek, A.; Tavernet, J.-P.; Tavernier, T.; Taylor, A. M.; Terrier, R.; Tluczykont, M.; Trichard, C.; Valerius, K.; van Eldik, C.; van Soelen, B.; Vasileiadis, G.; Venter, C.; Viana, A.; Vincent, P.; Völk, H. J.; Volpe, F.; Vorster, M.; Vuillaume, T.; Wagner, S. J.; Wagner, P.; Ward, M.; Weidinger, M.; Weitzel, Q.; White, R.; Wierzcholska, A.; Willmann, P.; Wörnlein, A.; Wouters, D.; Zabalza, V.; Zacharias, M.; Zajczyk, A.; Zdziarski, A. A.; Zech, A.; Zechlin, H.-S.

2014-06-01

The non-thermal nature of the X-ray emission from the shell-type supernova remnants (SNRs) G1.9+0.3 and G330.2+1.0 is an indication of intense particle acceleration in the shock fronts of both objects. This suggests that the SNRs are prime candidates for very-high-energy (VHE; E > 0.1 TeV) γ-ray observations. G1.9+0.3, recently established as the youngest known SNR in the Galaxy, also offers a unique opportunity to study the earliest stages of SNR evolution in the VHE domain. The purpose of this work is to probe the level of VHE γ-ray emission from both SNRs and use this to constrain their physical properties. Observations were conducted with the H.E.S.S. (High Energy Stereoscopic System) Cherenkov Telescope Array over a more than six-year period spanning 2004-2010. The obtained data have effective livetimes of 67 h for G1.9+0.3 and 16 h for G330.2+1.0. The data are analysed in the context of the multiwavelength observations currently available and in the framework of both leptonic and hadronic particle acceleration scenarios. No significant γ-ray signal from G1.9+0.3 or G330.2+1.0 was detected. Upper limits (99 per cent confidence level) to the TeV flux from G1.9+0.3 and G330.2+1.0 for the assumed spectral index Γ = 2.5 were set at 5.6 × 10-13 cm-2 s-1 above 0.26 TeV and 3.2 × 10-12 cm-2 s-1 above 0.38 TeV, respectively. In a one-zone leptonic scenario, these upper limits imply lower limits on the interior magnetic field to BG1.9 ≳ 12 μG for G1.9+0.3 and to BG330 ≳ 8 μG for G330.2+1.0. In a hadronic scenario, the low ambient densities and the large distances to the SNRs result in very low predicted fluxes, for which the H.E.S.S. upper limits are not constraining.

Observation of the spin-orbit components of the 3B 2g( 3A 2g) ground state in the system Ni 2+:MgF 2 by fluorescence line narrowing

NASA Astrophysics Data System (ADS)

Tonucci, R. J.; Jacobsen, S. M.; Yen, W. M.

1990-10-01

Using a tunable narrow-band infrared laser, we demonstrate for the first time infrared-fluorescnece line narrowing in the system Ni 2+:MgF 2. High-resolution emission spectra were obtained by pumping the lowest spin-orbit component B 3 ( 3T 2g) (orthorhombic notation with octahedral notation in parentheses) of the 3T 2g multiplet and observing the B 3( 3T 2g)→B 1, A, B 2( 3A 2g) luminescent transitions at low temperature. By tuning the narrow-band laser over the B 3( 3T 2g) band, resonant and non-resonant fluorescence were obtained which narrowed with respect to the inhomogeneously broadened profile, and additional lines were observed. The spectra can be understood in terms of a simultaneous excitation of two different subsets of Ni 2+ ions which have their B 2( 3A 2g)→B 3( 3T 2g) and A( 3A 2g)→B 3( 3T 2g) transitions in resonance with the laser. The A( 3A 2g) and B 1( 3A 2g) spin-orbit components of the ground-state multiplet lie 1.9 cm -1 and 6.5 cm -1 above the B 2( 3A 2g) ground state, respectively, at 2 K.

D1((2)B2g) to D0((2)Au) Fluorescence from the Matrix-Isolated Perylene Cation Following Laser Excitation into the D5(2)B3g) and D2 ((2)B3g) Electronic States

NASA Technical Reports Server (NTRS)

Chillier, Xavier D. F.; Stone, Bradley M.; Joblin, Christine; Salama, Farid; Allamandola, Louis J.; DeVincenzi, Donald L. (Technical Monitor)

2001-01-01

Fluorescence spectra of the perylene cation, pumped by direct laser excitation via the D(sub 2)((2)B(sub 3g)) (left arrow) D(sub 0)((2)A(sub u)) and D(sub 5)(2)B(sub 3g)) (left arrow) D(sub 0)((2)A(sub u)) transitions, are presented. Direct excitation into the D5 or D2 states is followed by rapid non-radiative relaxation to D1 that, in turn,relaxes radiatively. Excitation spectroscopy across the D(sub 2)((2)B(sub 3g)) (left arrow) D(sub 0)((2)A(sub u)) transition near 730 nm shows that site splitting plays little or no role in determining the spectral substructure in the ion spectra. Tentative assignments for ground state vibrational frequencies are made by comparison of spectral intervals with calculated normal mode frequencies.

Restraint hypothermia in cold-exposed rats at 3 G and 1 G

NASA Technical Reports Server (NTRS)

Monson, C. B.; Horowitz, J. M.; Horwitz, B. A.

1982-01-01

The relationship between heat loss, heat production, and hypothermia was investigated in experiments with rats which determined if hypergravity affects heat production by altering oxygen consumption and if restraint modifies the ability of the rats to activate thermogenic mechanisms after cold exposure in a hypergravic field. Restrained and unrestrained rats were exposed for 1 hr periods to 1 G and 3 G at ambient temperatures of 24 C or 10 C, and the rate of oxygen consumption, the core temperatures, and the tail temperatures were measured. Results show that thermoregulatory mechanisms are impaired when rats are exposed to 3 G fields, and at 24 C as well as at 10 C this impairment leads to an inappropriate increase in heat loss.

Immunocytochemical localization of the ovine immunoglobulins IgA, IgG1, IgG1A and IgG2: effect of gastro-intestinal parasitism in the sheep

PubMed Central

Curtain, C. C.; Anderson, N.

1971-01-01

A study has been made of the immunocytochemical localization of IgG1, IgG2, IgG1A and IgA in the alimentary tract and associated lymph nodes of parasitized and parasite-free sheep. No immunoglobulin-containing cells were found in the abomasal mucosa of the parasite-free sheep. On the other hand, large numbers of IgG1 and IgG1A-containing cells were found in the lamina propria and at the base of the villi of the abomasum of the parasitized sheep. IgG1, IgG1A, and IgA-containing cells were found in mucosal sections from the jejunum and ileum of both parasitized and parasite-free sheep, the number of IgG1A-containing cells being sifnificantly greater in the former than in the latter. This increase was considered to be of some importance since the IgG1A subclass appears to be involved in the allergic response of the sheep to intestinal parasites. ImagesFIG. 1FIG. 2FIG. 3FIG. 4FIG. 5FIG. 6FIG. 7 PMID:4924939

OVA-bound nanoparticles induce OVA-specific IgG1, IgG2a, and IgG2b responses with low IgE synthesis.

PubMed

Yanase, Noriko; Toyota, Hiroko; Hata, Kikumi; Yagyu, Seina; Seki, Takahiro; Harada, Mitsunori; Kato, Yasuki; Mizuguchi, Junichiro

2014-10-14

There is an urgent requirement for a novel vaccine that can stimulate immune responses without unwanted toxicity, including IgE elevation. We examined whether antigen ovalbumin (OVA) conjugated to the surface of nanoparticles (NPs) (OVA-NPs) with average diameter of 110nm would serve as an immune adjuvant. When BALB/c mice were immunized with OVA-NPs, they developed sufficient levels of OVA-specific IgG1 antibody responses with low levels of IgE synthesis, representing helper T (Th)2-mediated humoral immunity. OVA-specific IgG2a and IgG2b responses (i.e., Th1-mediated immunity) were also induced by secondary immunization with OVA-NPs. As expected, immunization with OVA in alum (OVA-alum) stimulated humoral immune responses, including IgG1 and IgE antibodies, with only low levels of IgG2a/IgG2b antibodies. CD4-positive T cells from mice primed with OVA-NPs produced substantial levels of IL-21 and IL-4, comparable to those from OVA-alum group. The irradiated mice receiving OVA-NPs-primed B cells together with OVA-alum-primed T cells exhibited enhanced anti-OVA IgG2b responses relative to OVA-alum-primed B cells and T cells following stimulation with OVA-NPs. Moreover, when OVA-NPs-primed, but not OVA-alum-primed, B cells were cultured in the presence of anti-CD40 monoclonal antibody, IL-4, and IL-21, or LPS plus TGF-β in vitro, OVA-specific IgG1 or IgG2b antibody responses were elicited, suggesting that immunization with OVA-NPs modulates B cells to generate IgG1 and IgG2b responses. Thus, OVA-NPs might exert their adjuvant action on B cells, and they represent a promising potential vaccine for generating both IgG1 and IgG2a/IgG2b antibody responses with low IgE synthesis. Copyright © 2014 Elsevier Ltd. All rights reserved.

Cytokinetically quiescent (G0/G1) human multiple myeloma cells are susceptible to simultaneous inhibition of Chk1 and MEK1/2

PubMed Central

Pei, Xin-Yan; Dai, Yun; Youssefian, Leena E.; Chen, Shuang; Bodie, Wesley W.; Takabatake, Yukie; Felthousen, Jessica; Almenara, Jorge A.; Kramer, Lora B.; Dent, Paul

2011-01-01

Effects of Chk1 and MEK1/2 inhibition were investigated in cytokinetically quiescent multiple myeloma (MM) and primary CD138+ cells. Coexposure to the Chk1 and MEK1/2 inhibitors AZD7762 and selumetinib (AZD6244) robustly induced apoptosis in various MM cells and CD138+ primary samples, but spared normal CD138− and CD34+ cells. Furthermore, Chk1/MEK1/2 inhibitor treatment of asynchronized cells induced G0/G1 arrest and increased apoptosis in all cell-cycle phases, including G0/G1. To determine whether this regimen is active against quiescent G0/G1 MM cells, cells were cultured in low-serum medium to enrich the G0/G1 population. G0/G1–enriched cells exhibited diminished sensitivity to conventional agents (eg, Taxol and VP-16) but significantly increased susceptibility to Chk1 ± MEK1/2 inhibitors or Chk1 shRNA knock-down. These events were associated with increased γH2A.X expression/foci formation and Bim up-regulation, whereas Bim shRNA knock-down markedly attenuated lethality. Immunofluorescent analysis of G0/G1–enriched or primary MM cells demonstrated colocalization of activated caspase-3 and the quiescent (G0) marker statin, a nuclear envelope protein. Finally, Chk1/MEK1/2 inhibition increased cell death in the Hoechst-positive (Hst+), low pyronin Y (PY)–staining (2N Hst+/PY−) G0 population and in sorted small side-population (SSP) MM cells. These findings provide evidence that cytokinetically quiescent MM cells are highly susceptible to simultaneous Chk1 and MEK1/2 inhibition. PMID:21911831

Cytokinetically quiescent (G0/G1) human multiple myeloma cells are susceptible to simultaneous inhibition of Chk1 and MEK1/2.

PubMed

Pei, Xin-Yan; Dai, Yun; Youssefian, Leena E; Chen, Shuang; Bodie, Wesley W; Takabatake, Yukie; Felthousen, Jessica; Almenara, Jorge A; Kramer, Lora B; Dent, Paul; Grant, Steven

2011-11-10

Effects of Chk1 and MEK1/2 inhibition were investigated in cytokinetically quiescent multiple myeloma (MM) and primary CD138(+) cells. Coexposure to the Chk1 and MEK1/2 inhibitors AZD7762 and selumetinib (AZD6244) robustly induced apoptosis in various MM cells and CD138(+) primary samples, but spared normal CD138(-) and CD34(+) cells. Furthermore, Chk1/MEK1/2 inhibitor treatment of asynchronized cells induced G(0)/G(1) arrest and increased apoptosis in all cell-cycle phases, including G(0)/G(1). To determine whether this regimen is active against quiescent G(0)/G(1) MM cells, cells were cultured in low-serum medium to enrich the G(0)/G(1) population. G(0)/G(1)-enriched cells exhibited diminished sensitivity to conventional agents (eg, Taxol and VP-16) but significantly increased susceptibility to Chk1 ± MEK1/2 inhibitors or Chk1 shRNA knock-down. These events were associated with increased γH2A.X expression/foci formation and Bim up-regulation, whereas Bim shRNA knock-down markedly attenuated lethality. Immunofluorescent analysis of G(0)/G(1)-enriched or primary MM cells demonstrated colocalization of activated caspase-3 and the quiescent (G(0)) marker statin, a nuclear envelope protein. Finally, Chk1/MEK1/2 inhibition increased cell death in the Hoechst-positive (Hst(+)), low pyronin Y (PY)-staining (2N Hst(+)/PY(-)) G(0) population and in sorted small side-population (SSP) MM cells. These findings provide evidence that cytokinetically quiescent MM cells are highly susceptible to simultaneous Chk1 and MEK1/2 inhibition.

KINETIC ENERGY DISTRIBUTION OF H(1s) FROM H{sub 2} X {sup 1}{Sigma}{sup +} {sub g}-a {sup 3}{Sigma}{sup +} {sub g} EXCITATION AND LIFETIMES AND TRANSITION PROBABILITIES OF a {sup 3}{Sigma}{sup +} {sub g}(v, J)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu Xianming; Johnson, Paul V.; Malone, Charles P.

Dissociative excitation of molecular hydrogen plays an important role in the heating of outer planet upper thermospheres. This paper addresses the role of one of the triplet states involved in the process. H{sub 2} excited to the a {sup 3}{Sigma}{sup +} {sub g} state, or higher triplet-ungerade states, is dissociated via the a {sup 3}{Sigma}{sup +} {sub g}-b {sup 3}{Sigma}{sup +} {sub u} continuum. The kinetic energy distribution of H(1s) produced from direct X {sup 1}{Sigma}{sup +} {sub g}-a {sup 3}{Sigma}{sup +} {sub g}(v, J) excitation by electrons is investigated by an accurate theoretical evaluation of spontaneous transition probabilities ofmore » the a {sup 3}{Sigma}{sup +} {sub g}(v, J)-b {sup 3}{Sigma}{sup +} {sub u} continuum transition. It is shown that the X {sup 1}{Sigma}{sup +} {sub g}(0)-a {sup 3}{Sigma}{sup +} {sub g}(v, J) excitation primarily produces H(1s) atoms with kinetic energies lower than 2 eV. In addition to the continuum a {sup 3}{Sigma}{sup +} {sub g}(v, J)-b {sup 3}{Sigma}{sup +} {sub u} transition probabilities, spontaneous emission lifetimes of the a {sup 3}{Sigma}{sup +} {sub g}(v, J) (v = 0-20, J {<=} 14) levels have been calculated by considering both the a {sup 3}{Sigma}{sup +} {sub g}-b {sup 3}{Sigma}{sup +} {sub u} and a {sup 3}{Sigma}{sup +} {sub g}-c {sup 3}{Pi} {sub u} transitions. The calculated lifetimes show a moderately strong rotational dependence, and the lifetimes for the J = 0 rotational level of the low v levels agree well with previous calculations and experimental measurements. Calculations of the a {sup 3}{Sigma}{sup +} {sub g}-b {sup 3}{Sigma}{sup +} {sub u} continuum emission spectra from electron impact X {sup 1}{Sigma}{sup +} {sub g}-a {sup 3}{Sigma}{sup +} {sub g} excitation are included.« less

PAI-1 4G/5G polymorphism contributes to cancer susceptibility: evidence from meta-analysis.

PubMed

Wang, Shangqian; Cao, Qiang; Wang, Xiaoxiang; Li, Bingjie; Tang, Min; Yuan, Wanqing; Fang, Jianzheng; Qian, Jian; Qin, Chao; Zhang, Wei

2013-01-01

The plasminogen activator inhibitor-1 (PAI-1) is expressed in many cancer cell types and allows the modulation of cancer growth, invasion and angiogenesis. To date, studies investigated the association between a functional polymorphism in PAI-1 (4G/5G) and risk of cancer have shown inclusive results. A meta-analysis based on 25 case-control studies was performed to address this issue. Odds ratios (OR) with corresponding 95% confidence intervals (CIs) were used to assess the association. The statistical heterogeneity across studies was examined with I(2) test. Overall, a significant increased risk of cancer was associated with the PAI-1 4G/4G polymorphism for the allele contrast (4G vs. 5G: OR = 1.10, CI = 1.03-1.18, I(2) = 49.5%), the additive genetic model (4G/4G vs. 5G/5G: OR = 1.21, CI = 1.06-1.39, I(2) = 51.9%), the recessive genetic model (4G/4G vs. 4G/5G+5G/5G: OR = 1.11, CI = 1.04-1.18, I(2) = 20.8%). In the subgroup analysis by ethnicity, the results indicated that individuals with 4G/4G genotype had a significantly higher cancer risk among Caucasians (4G/4G vs. 5G/5G: OR = 1.31, 95%CI = 1.09-1.59, I(2) = 59.6%; 4G/4G vs. 4G/5G: OR = 1.12, 95%CI = 1.04-1.21, I(2) = 3.6%; recessive model: OR = 1.12, 95%CI = 1.05-1.21, I(2) = 25.3%). The results of the present meta-analysis support an association between the PAI-1 4G/5G polymorphism and increasing cancer risk, especially among Caucasians, and those with 4G allele have a high risk to develop colorectal cancer and endometrial cancer.

Th1/Th2 cytokine profiles in G+/G- bacteremia in pediatric hematology/oncology patients.

PubMed

Tang, Yongmin; Liao, Chan; Xu, Xiaojun; Song, Hua; Shi, Shuwen; Yang, Shilong

2012-01-01

Early diagnosis of infection and appropriate choice of antibiotics are essential not only to improve the prognosis of the patients but also to prevent from the abuse of the antibiotics in hematology/oncology children at the time of neutropenia after intensive chemotherapy. We evaluated the quantification of Th1/Th2 cytokines with flow cytometry bead assay (CBA) in 145 hospitalized febrile hematology/oncology children with positive blood culture to seek for a rapid diagnostic method to determine the type of infection. IL-4, IL-6, IL-10, TNF-α, and IFN-γ levels from both G- and G+ bacteremia groups were significantly higher than those of controls (P < 0.001). The median levels of IL-6, IL-10, TNF-α of Group G- were 525.4, 96.0, and 6.9 pg/ml, respectively, significantly higher than those of Group G+ (150.0, 22.6, and 4.5 pg/ml, respectively, P < 0.001). According to the different degrees of increased IL-6 and IL-10 levels, we named the G- bacterial infection related cytokine profile G- BIRCP and the G+ BIRCP. The specificity and sensitivity of BIRCP prediction for G- and G+ bacteria cultures were 60.2% and 75.4%, 66.8% and 70.1%, respectively. Similar therapeutic efficacy was achieved between BIRCP-based and broad-spectrum antibiotics groups (86.1% vs. 89.3%, P > 0.05), which was significantly increased as compared with that (65.5%, P < 0.05) of empirical group. These results showed the promising use of the IL-6/IL-10/TNF-α determination with CBA technology for the early and rapid diagnosis, evaluation of G+/G- bacteremia in pediatric hematology/oncology patients. Copyright © 2011 Wiley Periodicals, Inc.

Optimization of chromatographic conditions for determination of aflatoxin B1, B2, G1 and G2 by using liquid chromatography-mass Spectrometry

NASA Astrophysics Data System (ADS)

Ramadhaningtyas, Dillani Putri; Aryana, Nurhani; Aristiawan, Yosi; Styarini, Dyah

2017-11-01

The optimization of instrument condition and chromatographic separation for analysis of aflatoxin B1, B2, G1 and G2 using liquid chromatography tandem with mass spectrometer detector was conducted in the aim to provide more accurate and reliable analysis results. The aflatoxin known to be serious threat for human health as it is classified as the carcinogenic compounds. The aflatoxin B1, B2, G1 and G2 were selected due to its extensive contamination in various agricultural commodities. The best chromatographic separation was obtained using C-18 column with gradient elution of solvent 5 mM ammonium acetate and 0.1% formic acid in methanol at 7 minutes runtime analysis. The linearity of the detector showed satisfied results as the coefficient determination found to be 0.9994, 0.9996, 0.9998 and 0.9987 for aflatoxin B1, G1, B2, and G2 respectively in the range concentration from 1 to 20 ng/g. The quantifier ion selected for the aflatoxin B1, B2, G1 and G2 was m/z 285.1, 259, 243 and 313 respectively. The instrument precision at these quantifier ions also showed satisfied result with %RSD was around 3.4 to 6.8%. The optimized method present in this study can be used for further sample analysis.

PAI-1 4G/5G Polymorphism Contributes to Cancer Susceptibility: Evidence from Meta-Analysis

PubMed Central

Li, Bingjie; Tang, Min; Yuan, Wanqing; Fang, Jianzheng; Qian, Jian; Qin, Chao; Zhang, Wei

2013-01-01

Background The plasminogen activator inhibitor-1 (PAI-1) is expressed in many cancer cell types and allows the modulation of cancer growth, invasion and angiogenesis. To date, studies investigated the association between a functional polymorphism in PAI-1 (4G/5G) and risk of cancer have shown inclusive results. Methods A meta-analysis based on 25 case-control studies was performed to address this issue. Odds ratios (OR) with corresponding 95% confidence intervals (CIs) were used to assess the association. The statistical heterogeneity across studies was examined with I2 test. Results Overall, a significant increased risk of cancer was associated with the PAI-1 4G/4G polymorphism for the allele contrast (4G vs. 5G: OR = 1.10, CI = 1.03–1.18, I2 = 49.5%), the additive genetic model (4G/4G vs. 5G/5G: OR = 1.21, CI = 1.06–1.39, I2 = 51.9%), the recessive genetic model (4G/4G vs. 4G/5G+5G/5G: OR = 1.11, CI = 1.04–1.18, I2 = 20.8%). In the subgroup analysis by ethnicity, the results indicated that individuals with 4G/4G genotype had a significantly higher cancer risk among Caucasians (4G/4G vs. 5G/5G: OR = 1.31, 95%CI = 1.09–1.59, I2 = 59.6%; 4G/4G vs. 4G/5G: OR = 1.12, 95%CI = 1.04–1.21, I2 = 3.6%; recessive model: OR = 1.12, 95%CI = 1.05–1.21, I2 = 25.3%). Conclusions The results of the present meta-analysis support an association between the PAI-1 4G/5G polymorphism and increasing cancer risk, especially among Caucasians, and those with 4G allele have a high risk to develop colorectal cancer and endometrial cancer. PMID:23437240

The Roles of APOBEC3G Complexes in the Incorporation of APOBEC3G into HIV-1

PubMed Central

Zhang, Quan; Liu, Zhenlong; Jia, Pingping; Zhou, Jinming; Guo, Fei; You, Xuefu; Yu, Liyan; Zhao, Lixun; Jiang, Jiandong; Cen, Shan

2013-01-01

Background The incorporation of human APOBEC3G (hA3G) into HIV is required for exerting its antiviral activity, therefore the mechanism underlying hA3G virion encapsidation has been investigated extensively. hA3G was shown to form low-molecular-mass (LMM) and high-molecular-mass (HMM) complexes. The function of different forms of hA3G in its viral incorporation remains unclear. Methodology/Principal Findings In this study, we investigated the subcellular distribution and lipid raft association of hA3G using subcellular fractionation, membrane floatation assay and pulse-chase radiolabeling experiments respectively, and studied the correlation between the ability of hA3G to form the different complex and its viral incorporation. Our work herein provides evidence that the majority of newly-synthesized hA3G interacts with membrane lipid raft domains to form Lipid raft-associated hA3G (RA hA3G), which serve as the precursor of mature HMM hA3G complex, while a minority of newly-synthesized hA3G remains in the cytoplasm as a soluble LMM form. The distribution of hA3G among the soluble LMM form, the RA LMM form and the mature forms of HMM is regulated by a mechanism involving the N-terminal part of the linker region and the C-terminus of hA3G. Mutagenesis studies reveal a direct correlation between the ability of hA3G to form the RA LMM complex and its viral incorporation. Conclusions/Significance Together these data suggest that the Lipid raft-associated LMM A3G complex functions as the cellular source of viral hA3G. PMID:24098356

Determination of aflatoxins B1, B2, G1 and G2 in spices using a multifunctional column clean-up.

PubMed

Akiyama, H; Goda, Y; Tanaka, T; Toyoda, M

2001-10-12

A rapid and simple method using a multifunctional column, which contains lipophilic and charged active sites, was developed to analyse aflatoxins B1, B2, G1 and G2 in various spices, such as red pepper and nutmeg. After extraction by acetonitrile:water (9:1) and clean-up using MultiSep #228 column, the aflatoxins and aflatoxin-TFA derivatives are determined using LC with fluorescence detection. Recoveries of each aflatoxin B1, B2, G1 and G2 spiked to red pepper, white pepper, black pepper, nutmeg and tear grass at the level of 10 ng/g were over 80-85% in all instances. The minimum detectable concentration for aflatoxins in red pepper was 0.5 ng/g.

The association between PAI-1 -675 4G/5G polymorphism and type 2 diabetes mellitus.

PubMed

Chen, L; Li, S-Y; Liu, M

2017-08-15

In this study, we aimed to analyze the association between plasminogen activator inhibitor 1 (PAI-1) -675 4G/5G polymorphism and type 2 diabetes mellitus (T2DM) risk. We included in 187 T2DM patients and 186 heathy controls between 2014 and 2017 from Tianjin Gong An Hospital, China. All patients and controls were ethnically Chinese Han population. The primers and polymerase chain reaction (PCR) conditions were performed. Results from this case-control study suggested that PAI-1 -675 4G/5G polymorphism was not associated with T2DM risk in four genetic models. Additionally, PAI-1 -675 4G/5G polymorphism was not associated with clinical and laboratory characteristics, such as age, gender, body mass index, systolic blood pressure, diastolic blood pressure, total cholesterol, triglycerides, and HbA1c. In conclusion, this case-control study suggested that PAI-1 -675 4G/5G polymorphism was not associated with T2DM risk in this population.

Reduced carriership of 4G allele of plasminogen activator inhibitor-1 4G/5G polymorphism in very young survivors of myocardial infarction.

PubMed

Rallidis, Loukianos S; Gialeraki, Argyri; Merkouri, Efrosyni; Liakos, George; Dagres, Nikolaos; Sionis, Dimitrios; Travlou, Anthi; Lekakis, John; Kremastinos, Dimitrios T

2010-05-01

There are limited and controversial data regarding the impact of 4G/5G polymorphism of the plasminogen activator inhibitor-1 (PAI-1) gene in the pathogenesis of premature myocardial infarction (MI). We explored whether 4G/5G polymorphism of the PAI-1 gene is associated with the development of MI 2 +/- 3.4 years). The control group consisted of 140 healthy individuals matched with cases for age and sex, without a family history of premature coronary heart disease. 4G/5G polymorphism of PAI-1 was tested with polymerase chain reaction and reverse hybridization. 4G allele carriers (4G/4G and 4G/5G genotypes) of PAI-1 were less frequent in patients than in controls (69.6 vs. 83.6%, P = 0.007). 4G carriership of the polymorphism of PAI-1 was associated with lower risk for acute MI (odds ratio 0.45, 95% confidence interval 0.23-0.88, P = 0.02) after adjusting for major cardiovascular risk factors. Patients possessing the 4G allele had higher PAI-1 plasma levels (32.2 +/- 25 vs. 22.2 +/- 11.3 ng/ml, P = 0.006) but lower lipoprotein(a) levels (10.1 [2.1-29.9] vs. 15.3 [8.2-57.1] mg/dl, P = 0.03) compared to 5G/5G homozygotes. Our data indicate that the 4G allele of the PAI-1 4G/5G polymorphism is less frequent among survivors of MI at very young age compared with matched controls.

Secure Military Communications on 3G, 4G and WiMAX

DTIC Science & Technology

2013-09-01

per bit, low latency, good quality of service, good coverage and support for mobility at high speeds. Thus, 4G wireless technologies are based on 3G ...security for military communications. 87 LIST OF REFERENCES [1] C. Blanchard, “Security for the third generation ( 3G ) mobile system,” Elsevier Science...COMMUNICATIONS ON 3G , 4G AND WIMAX by Panagiotis Schoinas September 2013 Thesis Advisor: Gurminder Singh Co-Advisor: John H. Gibson

Aflatoxin (B1 , B2 , G1 , and G2 ) contamination in rice of Mexico and Spain, from local sources or imported.

PubMed

Suárez-Bonnet, Elena; Carvajal, Magda; Méndez-Ramírez, Ignacio; Castillo-Urueta, Pável; Cortés-Eslava, Josefina; Gómez-Arroyo, Sandra; Melero-Vara, José María

2013-11-01

Rice is an important cereal but it is often contaminated with aflatoxins (AFs). The purpose of this study was to identify and quantify AF (B1 , B2 , G1 , and G2 ) in 67 rice samples cultivated in Mexico and Spain, and from imported crops collected in 2008 and 2009. The methodology was validated, the rice samples were concentrated and purified with immunoaffinity columns and were quantified by high-pressure liquid chromatography (HPLC). The average total AF (AFt) in the Spanish rice was 37.3 μg/kg, the range was from 1.6 to 1383 μg/kg, the most contaminated samples being from San Juan de Aznalfarache, Sevilla (AFt = 138.6 μg/kg), from Tortosa, Tarragona (AFt = 104.6 μg/kg), and Calasparra, Murcia (AFt = 103.9 μg/kg). The rice imported from France to Spain had AFt of 26.6 μg/kg and from Pakistan AFt of 18.4 μg/kg, showing less AF contamination than the local one. The rice which originated from Mexico contained (AFt = 16.9 μg/kg), and those imported from the United States (AFt = 14.4 μg/kg) and Uruguay (AFt = 15.6 μg/kg). The imported rice had better quality in terms of the presence of AFs. © 2013 Institute of Food Technologists®

Base-Displaced Intercalated Conformation of the 2-Amino-3-methylimidazo[4,5-f]quinoline N2-dG DNA Adduct Positioned at the Nonreiterated G1 in the NarI Restriction Site

PubMed Central

2016-01-01

The conformation of an N2-dG adduct arising from the heterocyclic amine 2-amino-3-methylimidazo[4,5-f]quinoline (IQ), a potent food mutagen, was determined in 5′-d(C1T2C3X4G5C6G7C8C9A10T11C12)-3′:5′-d(G13A14T15G16G17C18G19C20C21G22A23G24)-3′; X = N2-dG-IQ, in which the modified nucleotide X4 corresponds to G1 in the 5′-d(G1G2CG3CC)-3′ NarI restriction endonuclease site. Circular dichroism (CD) revealed blue shifts relative to the unmodified duplex, consistent with adduct-induced twisting, and a hypochromic effect for the IQ absorbance in the near UV region. NMR revealed that the N2-dG-IQ adduct adopted a base-displaced intercalated conformation in which the modified guanine remained in the anti conformation about the glycosidic bond, the IQ moiety intercalated into the duplex, and the complementary base C21 was displaced into the major groove. The processing of the N2-dG-IQ lesion by hpol η is sequence-dependent; when placed at the reiterated G3 position, but not at the G1 position, this lesion exhibits a propensity for frameshift replication [Choi, J. Y., et al. (2006) J. Biol. Chem., 281, 25297–25306]. The structure of the N2-dG-IQ adduct at the nonreiterated G1 position was compared to that of the same adduct placed at the G3 position [Stavros, K. M., et al. (2014) Nucleic Acids Res., 42, 3450–3463]. CD indicted minimal spectral differences between the G1 vs G3N2-dG-IQ adducts. NMR indicated that the N2-dG-IQ adduct exhibited similar base-displaced intercalated conformations at both the G1 and G3 positions. This result differed as compared to the corresponding C8-dG-IQ adducts placed at the same positions. The C8-dG-IQ adduct adopted a minor groove conformation when placed at position G1 but a base-displaced intercalated conformation when placed at position G3 in the NarI sequence. The present studies suggest that differences in lesion bypass by hpol η may be mediated by differences in the 3′-flanking sequences, perhaps modulating the ability

Birth of Archaeal Cells: Molecular Phylogenetic Analyses of G1P Dehydrogenase, G3P Dehydrogenases, and Glycerol Kinase Suggest Derived Features of Archaeal Membranes Having G1P Polar Lipids

PubMed Central

2016-01-01

Bacteria and Eukarya have cell membranes with sn-glycerol-3-phosphate (G3P), whereas archaeal membranes contain sn-glycerol-1-phosphate (G1P). Determining the time at which cells with either G3P-lipid membranes or G1P-lipid membranes appeared is important for understanding the early evolution of terrestrial life. To clarify this issue, we reconstructed molecular phylogenetic trees of G1PDH (G1P dehydrogenase; EgsA/AraM) which is responsible for G1P synthesis and G3PDHs (G3P dehydrogenase; GpsA and GlpA/GlpD) and glycerol kinase (GlpK) which is responsible for G3P synthesis. Together with the distribution of these protein-encoding genes among archaeal and bacterial groups, our phylogenetic analyses suggested that GlpA/GlpD in the Commonote (the last universal common ancestor of all extant life with a cellular form, Commonote commonote) acquired EgsA (G1PDH) from the archaeal common ancestor (Commonote archaea) and acquired GpsA and GlpK from a bacterial common ancestor (Commonote bacteria). In our scenario based on this study, the Commonote probably possessed a G3P-lipid membrane synthesized enzymatically, after which the archaeal lineage acquired G1PDH followed by the replacement of a G3P-lipid membrane with a G1P-lipid membrane. PMID:27774041

26 CFR 1.642(g)-2 - Deductions included.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 26 Internal Revenue 8 2014-04-01 2014-04-01 false Deductions included. 1.642(g)-2 Section 1.642(g... (CONTINUED) INCOME TAXES (CONTINUED) Estates, Trusts, and Beneficiaries § 1.642(g)-2 Deductions included. It...(g) is applicable be treated in the same way. One deduction or portion of a deduction may be allowed...

26 CFR 1.642(g)-2 - Deductions included.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 26 Internal Revenue 8 2013-04-01 2013-04-01 false Deductions included. 1.642(g)-2 Section 1.642(g... (CONTINUED) INCOME TAXES (CONTINUED) Estates, Trusts, and Beneficiaries § 1.642(g)-2 Deductions included. It...(g) is applicable be treated in the same way. One deduction or portion of a deduction may be allowed...

26 CFR 1.642(g)-2 - Deductions included.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 26 Internal Revenue 8 2011-04-01 2011-04-01 false Deductions included. 1.642(g)-2 Section 1.642(g... (CONTINUED) INCOME TAXES (CONTINUED) Estates, Trusts, and Beneficiaries § 1.642(g)-2 Deductions included. It...(g) is applicable be treated in the same way. One deduction or portion of a deduction may be allowed...

26 CFR 1.642(g)-2 - Deductions included.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 26 Internal Revenue 8 2012-04-01 2012-04-01 false Deductions included. 1.642(g)-2 Section 1.642(g... (CONTINUED) INCOME TAXES (CONTINUED) Estates, Trusts, and Beneficiaries § 1.642(g)-2 Deductions included. It...(g) is applicable be treated in the same way. One deduction or portion of a deduction may be allowed...

26 CFR 1.642(g)-2 - Deductions included.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 26 Internal Revenue 8 2010-04-01 2010-04-01 false Deductions included. 1.642(g)-2 Section 1.642(g... (CONTINUED) INCOME TAXES Estates, Trusts, and Beneficiaries § 1.642(g)-2 Deductions included. It is not required that the total deductions, or the total amount of any deduction, to which section 642(g) is...

4G/5G Plasminogen Activator Inhibitor-1 Polymorphisms and Haplotypes Are Associated with Pneumonia

PubMed Central

Yende, Sachin; Angus, Derek C.; Ding, Jingzhong; Newman, Anne B.; Kellum, John A.; Li, Rongling; Ferrell, Robert E.; Zmuda, Joseph; Kritchevsky, Stephen B.; Harris, Tamara B.; Garcia, Melissa; Yaffe, Kristine; Wunderink, Richard G.

2007-01-01

Rationale: Plasminogen activator inhibitor (PAI)-1 inhibits urokinase and tissue plasminogen activator, required for host response to infection. Whether variation within the PAI-1 gene is associated with increased susceptibility to infection is unknown. Objectives: To ascertain the role of the 4G/5G polymorphism and other genetic variants within the PAI-1 gene. We hypothesized that variants associated with increased PAI-1 expression would be associated with an increased occurrence of community-acquired pneumonia (CAP). Methods: Longitudinal analysis (>12 yr) of the Health, Aging, and Body Composition cohort, aged 65–74 years at start of analysis. Measurements and Main Results: We genotyped the 4G/5G PAI-1 polymorphism and six additional single nucleotide polymorphisms. Of the 3,075 subjects, 272 (8.8%) had at least one hospitalization for CAP. Among whites, variants at the PAI4G,5G, PAI2846, and PAI7343 sites had higher risk of CAP (P = 0.018, 0.021, and 0.021, respectively). At these sites, variants associated with higher PAI-1 expression were associated with increased CAP susceptibility. Compared with the 5G/5G genotypes at PAI4G,5G site, the 4G/4G and 4G/5G genotypes were associated with a 1.98-fold increased risk of CAP (95% confidence interval, 1.2–3.2; P = 0.006). In whole blood stimulation assay, subjects with a 4G allele had 3.3- and 1.9-fold increased PAI-1 expression (P = 0.043 and 0.034, respectively). In haplotype analysis, the 4G/G/C/A haplotype at the PAI4G,5G, PAI2846, PAI4588, and PAI7343 single nucleotide polymorphisms was associated with higher CAP susceptibility, whereas the 5G/G/C/A haplotype was associated with lower CAP susceptibility. No associations were seen among blacks. Conclusions: Genotypes associated with increased expression of PAI-1 were associated with increased susceptibility to CAP in elderly whites. PMID:17761618

Isolation and characterization of rabbit anti-m3 2,2,7G antibodies.

PubMed Central

Luhrmann, R; Appel, B; Bringmann, P; Rinke, J; Reuter, R; Rothe, S; Bald, R

1982-01-01

Antibodies specific for intact 2,2,7-trimethylguanosine (m3 2,2,7G) were induced by immunization of rabbits with a nucleoside-human serum albumen (HSA) conjugate. Competition radioimmunoassay showed that the antibody distinguishes well between intact m3 2,2,7G and its alkali-hydrolysed form (m3 2,2,7G*). Antibody specificity is largely dependent on the presence of all three methyl groups in m3 2,2,7G: none of the less extensively methylated nucleosides m7G, m2G and m2 2,2G is able to compete efficiently with the homologous hapten. Little or no competition was observed with m1G, m1A, m6A, m5U and each of the four unmodified ribonucleosides. Binding studies with nucleoplasmic RNAs from Ehrlich ascites cells suggest that the antibody reacts specifically with the m3 2,2,7G-containing cap structure of the small nuclear U-RNAs (U-snRNAs). Thus the antibody should be a valuable tool for studying the role of the 5'-terminal regions of the U-snRNAs of eucaryotic cells. Images PMID:7155893

Effects of 2G and 3G mobile phones on performance and electrophysiology in adolescents, young adults and older adults.

PubMed

Leung, S; Croft, R J; McKenzie, R J; Iskra, S; Silber, B; Cooper, N R; O'Neill, B; Cropley, V; Diaz-Trujillo, A; Hamblin, D; Simpson, D

2011-11-01

This study examined sensory and cognitive processing in adolescents, young adults and older adults, when exposed to 2nd (2G) and 3rd (3G) generation mobile phone signals. Tests employed were the auditory 3-stimulus oddball and the N-back. Forty-one 13-15 year olds, forty-two 19-40 year olds and twenty 55-70 year olds were tested using a double-blind cross-over design, where each participant received Sham, 2G and 3G exposures, separated by at least 4 days. 3-Stimulus oddball task: Behavioural: accuracy and reaction time of responses to targets were not affected by exposure. Electrophysiological: augmented N1 was found in the 2G condition (independent of age group). N-back task: Behavioural: the combined groups performed less accurately during the 3G exposure (compared to Sham), with post hoc tests finding this effect separately in the adolescents only. Electrophysiological: delayed ERD/ERS responses of the alpha power were found in both 3G and 2G conditions (compared to Sham; independent of age group). Employing tasks tailored to each individual's ability level, this study provides support for an effect of acute 2G and 3G exposure on human cognitive function. The subtlety of mobile phone effect on cognition in our study suggests that it is important to account for individual differences in future mobile phone research. Copyright © 2011 International Federation of Clinical Neurophysiology. All rights reserved.

Synthesis of G-N2-(CH2)3-N2-G Trimethylene DNA interstrand cross-links

PubMed Central

Gruppi, Francesca; Salyard, Tracy L. Johnson; Rizzo, Carmelo J.

2014-01-01

The synthesis of G-N2-(CH2)3-N2-G trimethylene DNA interstrand cross-links (ICLs) in a 5′-CG-3′ and 5′-GC-3′ sequence from oligodeoxynucleotides containing N2-(3-aminopropyl)-2′-deoxyguanosine and 2-fluoro-O6-(trimethylsilylethyl)inosine is presented. Automated solid-phase DNA synthesis was used for unmodified bases and modified nucleotides were incorporated via their corresponding phosphoramidite reagent by a manual coupling protocol. The preparation of the phosphoramidite reagents for incorporation of N2-(3-aminopropyl)-2′-deoxyguanosine is reported. The high-purity trimethylene DNA interstrand cross-link product is obtained through a nucleophilic aromatic substitution reaction between the N2-(3-aminopropyl)-2′-deoxyguanosine and 2-fluoro-O6-(trimethylsilylethyl)inosine containing oligodeoxynucleotides. PMID:25431636

Plasminogen activator inhibitor-1 4G/5G polymorphism is associated with type 2 diabetes risk

PubMed Central

Zhao, Luqian; Huang, Ping

2013-01-01

A number of studies were performed to assess the association between plasminogen activator inhibitor-1 (PAI-1) 4G/5G polymorphism and susceptibility to type 2 diabetes (T2DM). However, the results were inconsistent and inconclusive. In the present study, the possible association was investigated by a meta-analysis. Eligible articles were identified for the period up to June 2013. Pooled odds ratios (OR) with 95% confidence intervals (CI) were appropriately derived from random-effects models or fixed-effects models. Fourteen case-control studies with a total of 2487 cases and 3538 controls were eligible. In recessive model, PAI-1 4G/5G polymorphism was associated with T2DM risk (OR = 1.23; 95% CI 1.07-1.41; P = 0.004). In the subgroup analysis by ethnicity, a significant association was found among Asians (OR = 1.27; 95% CI 1.08-1.51; P = 0.005). This meta-analysis suggested that PAI-1 4G/5G polymorphism may be associated with T2DM development. PMID:24040470

Association of MMP-1 -1607 1G/2G (rs1799750) polymorphism with primary knee osteoarthritis in the Greek population.

PubMed

Lepetsos, Panagiotis; Pampanos, Andreas; Kanavakis, Emmanouil; Tzetis, Maria; Korres, Dimitrios; Papavassiliou, Athanasios G; Efstathopoulos, Nicolaos

2014-09-01

Osteoarthritis is the most common form of arthritis with still unknown pathogenic etiology and considerable contribution of genetic factors. One of the mechanisms of cartilage degradation in osteoarthritis is enzymatic proteolysis of the extracellular matrix by metalloproteinases. MMP-1, produced by chondrocytes and synovial cells, is a major proteinase of the MMPs family. The present study aims at evaluating the association of MMP1 gene -1607 1G/2G (rs1799750) polymorphism with primary knee osteoarthritis in the Greek population. One hundred fifty five patients with primary symptomatic knee osteoarthritis participated in the study along with 139 controls. Genotypes were determined using PCR-RLFP technique. Allelic and genotypic frequencies were compared between both study groups. There was no significant association between MMP1 -1607 1G/2G polymorphism and knee osteoarthritis, in crude analysis; however, after multiple logistic regression analysis, 1G/2G was associated with reduced odds of knee osteoarthritis by 75% in males, compared to genotypes 1G/1G + 2G/2G, adjusting for age and BMI (adjusted OR: 0.25, 95% CI: 0.069, 0.910, p = 0.035). The present study shows that MMP1 -1607 1G/2G (rs1799750) polymorphism might be a risk factor for knee osteoarthritis susceptibility in the Greek population. Further investigations are needed to confirm this association in the pathogenesis of osteoarthritis. © 2014 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

Geological studies of the COST nos. G-1 and G-2 wells, United States North Atlantic outer continental shelf

USGS Publications Warehouse

Scholle, Peter A.; Wenkam, Chiye R.

1982-01-01

The COST Nos. G-1 and G-2 wells (fig. 1) are the second and third deep stratigraphic test wells drilled in the North Atlantic Outer Continental Shelf of the United States. COST No. G-1 was drilled in the Georges Bank basin to a total depth of 16,071 ft (4,898 m). G-1 bottomed in phyllite, slate, and metaquartzite overlain by weakly metamorphosed dolomite, all of Cambrian age. From approximately 15,600 to 12,400 ft (4,755 to 3,780 m) the strata are Upper Triassic(?), Lower Jurassic(?), and Middle Jurassic, predominantly red shales, sandstones, and conglomerates. Thin, gray Middle Jurassic beds of shale, sandstone, limestone, and dolomite occur from 12,400 to 9,900 ft (3,780 to 3,018 m). From 9,900 to 1,030 ft (3,018 to 314 m) are coarse-grained unconsolidated sands and loosely cemented sandstones, with beds of gray shale, lignite, and coal. The microfossils indicate the rocks are Upper Jurassic from 10,100 ft (3,078 m) up to 5,400 ft (1,646 m) and Cretaceous from that depth to 1,030 ft (314 m). No younger or shallower rocks were recovered in the drilling at the COST No. G-1 site, but an Eocene limestone is inferred to be disconformable over Santonian strata. The Jurassic strata of the COST No. G-1 well were deposited in shallow marine, marginal marine, and nonmarine environments, which changed to a dominantly shallow marine but still nearshore environment in the Cretaceous. The COST No. G-2 well was drilled 42 statute miles {68 km) east of the G-1 site, still within the Georges Bank basin, to a depth of 21,874 ft (6,667 m). The bottom 40 ft (12 m) of salt and anhydrite is overlain by approximately 7,000 ft {2,134 m) of Upper Triassic{?), Lower Jurassic{?) and Middle Jurassic dolomite, limestone, and interbedded anhydrite from 21,830 to 13,615 ft (6,654 to 4,153 m). From 13,500 to 9,700 ft (4,115 to 2,957 m) are Middle Jurassic limestones with interbedded sandstone. From 9,700 to 4,000 ft (2,957 to 1,219 m) are Upper Jurassic and Cretaceous interbedded sandstones and

Conformational organizations of G-quadruplexes composed of d(G(4)T(n))(3)G(4).

PubMed

Wong, Wan Chi; Zhuang, Jinyi; Ng, Selina Ling Ling; New, Lilian Li Lin; Hiew, Shuhui; Guo, Juanjuan; Yang, Zhaoqi; Li, Tianhu

2010-08-01

Structural polymorphism is one of the important issues with regard to G-quadruplexes because the structural diversity may significantly affect their biological functions in vivo and their physical property in nano-material. A series of oligonucleotides with four repeat guanines sequence [d(G(4)T(n))(3)G(4) (n=1-6)] were designed. In this study, the effects of loop length on the formation of structures of G-quadruplex were investigated through the result of CD (circular dichroism) and 20% non-denatured polyacrylamide gel electrophoresis. Our studies demonstrate that the length of loop in 100mM KCl solution could predict the conformation of G-quadruplex. Copyright 2010 Elsevier Ltd. All rights reserved.

In brown adipocytes, adrenergically induced β{sub 1}-/β{sub 3}-(G{sub s})-, α{sub 2}-(G{sub i})- and α{sub 1}-(G{sub q})-signalling to Erk1/2 activation is not mediated via EGF receptor transactivation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Yanling; Fälting, Johanna M.; Mattsson, Charlotte L.

2013-10-15

Brown adipose tissue is unusual in that the neurotransmitter norepinephrine influences cell destiny in ways generally associated with effects of classical growth factors: regulation of cell proliferation, of apoptosis, and progression of differentiation. The norepinephrine effects are mediated through G-protein-coupled receptors; further mediation of such stimulation to e.g. Erk1/2 activation is in cell biology in general accepted to occur through transactivation of the EGF receptor (by external or internal pathways). We have examined here the significance of such transactivation in brown adipocytes. Stimulation of mature brown adipocytes with cirazoline (α{sub 1}-adrenoceptor coupled via G{sub q}), clonidine (α{sub 2} via G{submore » i}) or CL316243 (β{sub 3} via G{sub s}) or via β{sub 1}-receptors significantly activated Erk1/2. Pretreatment with the EGF receptor kinase inhibitor AG1478 had, remarkably, no significant effect on Erk1/2 activation induced by any of these adrenergic agonists (although it fully abolished EGF-induced Erk1/2 activation), demonstrating absence of EGF receptor-mediated transactivation. Results with brown preadipocytes (cells in more proliferative states) were not qualitatively different. Joint stimulation of all adrenoceptors with norepinephrine did not result in synergism on Erk1/2 activation. AG1478 action on EGF-stimulated Erk1/2 phosphorylation showed a sharp concentration–response relationship (IC{sub 50} 0.3 µM); a minor apparent effect of AG1478 on norepinephrine-stimulated Erk1/2 phosphorylation showed nonspecific kinetics, implying caution in interpretation of partial effects of AG1478 as reported in other systems. Transactivation of the EGF receptor is clearly not a universal prerequisite for coupling of G-protein coupled receptors to Erk1/2 signalling cascades. - Highlights: • In brown adipocytes, norepinephrine regulates proliferation, apoptosis, differentiation. • EGF receptor transactivation is supposed to

Towards G2G: Systems of Technology Database Systems

NASA Technical Reports Server (NTRS)

Maluf, David A.; Bell, David

2005-01-01

We present an approach and methodology for developing Government-to-Government (G2G) Systems of Technology Database Systems. G2G will deliver technologies for distributed and remote integration of technology data for internal use in analysis and planning as well as for external communications. G2G enables NASA managers, engineers, operational teams and information systems to "compose" technology roadmaps and plans by selecting, combining, extending, specializing and modifying components of technology database systems. G2G will interoperate information and knowledge that is distributed across organizational entities involved that is ideal for NASA future Exploration Enterprise. Key contributions of the G2G system will include the creation of an integrated approach to sustain effective management of technology investments that supports the ability of various technology database systems to be independently managed. The integration technology will comply with emerging open standards. Applications can thus be customized for local needs while enabling an integrated management of technology approach that serves the global needs of NASA. The G2G capabilities will use NASA s breakthrough in database "composition" and integration technology, will use and advance emerging open standards, and will use commercial information technologies to enable effective System of Technology Database systems.

Inhibition of G0/G1 Switch 2 Ameliorates Renal Inflammation in Chronic Kidney Disease.

PubMed

Matsunaga, Naoya; Ikeda, Eriko; Kakimoto, Keisuke; Watanabe, Miyako; Shindo, Naoya; Tsuruta, Akito; Ikeyama, Hisako; Hamamura, Kengo; Higashi, Kazuhiro; Yamashita, Tomohiro; Kondo, Hideaki; Yoshida, Yuya; Matsuda, Masaki; Ogino, Takashi; Tokushige, Kazutaka; Itcho, Kazufumi; Furuichi, Yoko; Nakao, Takaharu; Yasuda, Kaori; Doi, Atsushi; Amamoto, Toshiaki; Aramaki, Hironori; Tsuda, Makoto; Inoue, Kazuhide; Ojida, Akio; Koyanagi, Satoru; Ohdo, Shigehiro

2016-11-01

Chronic kidney disease (CKD) is a global health problem, and novel therapies to treat CKD are urgently needed. Here, we show that inhibition of G 0 /G 1 switch 2 (G0s2) ameliorates renal inflammation in a mouse model of CKD. Renal expression of chemokine (C-C motif) ligand 2 (Ccl2) was increased in response to p65 activation in the kidneys of wild-type 5/6 nephrectomy (5/6Nx) mice. Moreover, 5/6Nx Clk/Clk mice, which carry homozygous mutations in the gene encoding circadian locomotor output cycles kaput (CLOCK), did not exhibit aggravation of apoptosis or induction of F4/80-positive cells. The renal expression of G0s2 in wild-type 5/6Nx mice was important for the transactivation of Ccl2 by p65. These pathologies were ameliorated by G0s2 knockdown. Furthermore, a novel small-molecule inhibitor of G0s2 expression was identified by high-throughput chemical screening, and the inhibitor suppressed renal inflammation in 5/6Nx mice. These findings indicated that G0s2 inhibitors may have applications in the treatment of CKD. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

Plasminogen activator inhibitor-1 4G/5G polymorphism and retinopathy risk in type 2 diabetes: a meta-analysis.

PubMed

Zhang, Tengyue; Pang, Chong; Li, Ningdong; Zhou, Elaine; Zhao, Kanxing

2013-01-02

Mounting evidence has suggested that plasminogen activator inhibitor-1 (PAI-1) is a candidate for increased risk of diabetic retinopathy. Studies have reported that insertion/deletion polymorphism in the PAI-1 gene may influence the risk of this disease. To comprehensively address this issue, we performed a meta-analysis to evaluate the association of PAI-1 4G/5G polymorphism with diabetic retinopathy in type 2 diabetes. Data were retrieved in a systematic manner and analyzed using Review Manager and STATA Statistical Software. Crude odds ratios (ORs) with 95% confidence intervals (CIs) were used to assess the strength of associations. Nine studies with 1, 217 cases and 1, 459 controls were included. Allelic and genotypic comparisons between cases and controls were evaluated. Overall analysis suggests a marginal association of the 4G/5G polymorphism with diabetic retinopathy (for 4G versus 5G: OR 1.13, 95%CI 1.01 to 1.26; for 4G/4G versus 5G/5G: OR 1.30, 95%CI 1.04 to 1.64; for 4G/4G versus 5G/5G + 4G/5G: OR 1.26, 95%CI 1.05 to 1.52). In subgroup analysis by ethnicity, we found an association among the Caucasian population (for 4G versus 5G: OR 1.14, 95% CI 1.00 to 1.30; for 4G/4G versus 5G/5G: OR 1.33, 95%CI 1.02 to 1.74; for 4G/4G versus 5G/5G + 4G/5G: OR 1.41, 95%CI 1.13 to 1.77). When stratified by the average duration of diabetes, patients with diabetes histories longer than 10 years have an elevated susceptibility to diabetic retinopathy than those with shorter histories (for 4G/4G versus 5G/5G: OR 1.47, 95%CI 1.08 to 2.00). We also detected a higher risk in hospital-based studies (for 4G/4G versus 5G/5G+4G/5G: OR 1.27, 95%CI 1.02 to 1.57). The present meta-analysis suggested that 4G/5G polymorphism in the PAI-1 gene potentially increased the risk of diabetic retinopathy in type 2 diabetes and showed a discrepancy in different ethnicities. A higher susceptibility in patients with longer duration of diabetes (more than 10 years) indicated a gene

Plasminogen activator inhibitor-1 4G/5G polymorphism and retinopathy risk in type 2 diabetes: a meta-analysis

PubMed Central

2013-01-01

Background Mounting evidence has suggested that plasminogen activator inhibitor-1 (PAI-1) is a candidate for increased risk of diabetic retinopathy. Studies have reported that insertion/deletion polymorphism in the PAI-1 gene may influence the risk of this disease. To comprehensively address this issue, we performed a meta-analysis to evaluate the association of PAI-1 4G/5G polymorphism with diabetic retinopathy in type 2 diabetes. Methods Data were retrieved in a systematic manner and analyzed using Review Manager and STATA Statistical Software. Crude odds ratios (ORs) with 95% confidence intervals (CIs) were used to assess the strength of associations. Results Nine studies with 1, 217 cases and 1, 459 controls were included. Allelic and genotypic comparisons between cases and controls were evaluated. Overall analysis suggests a marginal association of the 4G/5G polymorphism with diabetic retinopathy (for 4G versus 5G: OR 1.13, 95%CI 1.01 to 1.26; for 4G/4G versus 5G/5G: OR 1.30, 95%CI 1.04 to 1.64; for 4G/4G versus 5G/5G + 4G/5G: OR 1.26, 95%CI 1.05 to 1.52). In subgroup analysis by ethnicity, we found an association among the Caucasian population (for 4G versus 5G: OR 1.14, 95% CI 1.00 to 1.30; for 4G/4G versus 5G/5G: OR 1.33, 95%CI 1.02 to 1.74; for 4G/4G versus 5G/5G + 4G/5G: OR 1.41, 95%CI 1.13 to 1.77). When stratified by the average duration of diabetes, patients with diabetes histories longer than 10 years have an elevated susceptibility to diabetic retinopathy than those with shorter histories (for 4G/4G versus 5G/5G: OR 1.47, 95%CI 1.08 to 2.00). We also detected a higher risk in hospital-based studies (for 4G/4G versus 5G/5G+4G/5G: OR 1.27, 95%CI 1.02 to 1.57). Conclusions The present meta-analysis suggested that 4G/5G polymorphism in the PAI-1 gene potentially increased the risk of diabetic retinopathy in type 2 diabetes and showed a discrepancy in different ethnicities. A higher susceptibility in patients with longer duration of diabetes (more than 10

Calibration of mass and conventional mass of weights 2 kg, 1 kg, 200 g, 50 g, 1 g and 200 mg

NASA Astrophysics Data System (ADS)

Becerra, Luis Omar; Peña, Luis Manuel; Escalante Vargas, Boris; Cori Almonte, Luz; Martín Quiroga Rojas, Aldo; Bermúdez Coronel, Álvaro; Escobar Soto, Jhon J.; Naula, Wilson; Florencio, Arnaldo; Lourdes Valenzuela, María; Ramos Alfaro, Olman; Prenda Peña, Marcela

2018-01-01

This report describes the results of a supplementary comparison between SIM NMIs, which was carried out to evaluate the consistency of the measurements of calibration in high accuracy mass standards using the normalized error criteria (2 kg, 1 kg, 200 g, 50 g, 1 g and 200 mg). The supplementary comparison was carried out from April 2012 to July 2013. Main text To reach the main text of this paper, click on Final Report. Note that this text is that which appears in Appendix B of the BIPM key comparison database kcdb.bipm.org/. The final report has been peer-reviewed and approved for publication by the CCM, according to the provisions of the CIPM Mutual Recognition Arrangement (CIPM MRA).

Requirement of ClC-3 in G0/G1 to S Phase Transition Induced by IGF-1 via ERK1/2-Cyclins Cascade in Multiple Myeloma Cells.

PubMed

Du, Yu; Tu, Yong-Sheng; Tang, Yong-Bo; Huang, Yun-Ying; Zhou, Fang-Min; Tian, Tian; Li, Xiao-Yan

2018-06-01

ClC-3 is involved in the proliferation and migration of several cancer cells. However, ClC-3 expression and its role of cell-cycle control in multiple myeloma (MM) has not yet been investigated. MM cells were treated with different concentrations of IGF (30, 100, 300 ng/mL), and their proliferation was examined by CCK-8. The effects of ClC-3 on cell cycle progression was detected by flow cytometry. Western blot was used to analyze the relative levels of ClC3, CD138, P21, P27, CDK, p-Erk1/2, and t-Erk1/2 protein expression. Transfection of RPMI8226 with gpClC-3 cDNA and siRNA alters the expression of ClC-3. We compared the expression of ClC-3 in primary myeloma cells and in MM cell lines (U266 and RPMI8266) with that in normal plasma cells (PCs) from normal subjects and found that myeloma cells from patients and MM cell lines had significantly higher expression of ClC-3. Additionally, silencing of ClC-3 with the small interfering RNA (siRNA) that targets human ClC-3 decreased proliferation of RPMI8226 after IGF-1 treatment and slowed cell cycle progression from G0/G1 to S phase, which was associated with diminished phosphorylation of ERK1/2, down-expression of cyclin E, cyclin D1 and up-regulation of p27 and p21. By contrast, overexpression of ClC-3 potentiated cell proliferation induced by IGF-1, raised the percentage of S phase cells, enhanced phosphorylation of ERK1/2, downregulated p27 and p21 and upregulated cyclin E and cyclin D1. ClC-3 accelerated G0/G1 to S phase transition in the cell cycle by modulating ERK1/2 kinase activity and expression of G1/S transition related proteins, making ClC-3 an attractive therapeutic target in MM.

The binding of manganese(II) and zinc(II) to the synthetic oligonucleotide d(C-G-C-G-A-A-T-T-C-G-C-G)2. A 1H NMR study.

PubMed

Frøystein, N A; Sletten, E

1991-03-01

The interaction of the synthetic oligonucleotide d(C-G-C-G-A-A-T-T-C-G-C-G)2 with two different transition-metal ions has been investigated in aqueous solution by means of 1H NMR spectroscopy. The effects on the DNA due to the presence of manganese(II) or zinc(II) have been monitored by observing the paramagnetic broadening and diamagnetic shifts of the non-exchangeable proton resonance lines, respectively. The 1H NMR spectra acquired during the course of the manganese(II) titration show very distinct broadening effects on certain DNA resonance lines. Primarily, the H8 resonance of G4 is affected, but also the H5 and H6 resonances of C3 are clearly affected by the metal. The results imply that the binding of manganese(II) to DNA is sequence specific. The 1H spectra obtained during the zinc(II) titration reveal diamagnetic shift effects which largely conform with the paramagnetic broadening effects due to the presence of manganese(II), although this picture is somewhat more complex. The H8 resonance of G4 displays a clearly visible high-field shift, while for the other guanosine H8 protons this effect is absent. The H1' and H2' protons of C3 show an effect of similar strength, although in the opposite direction, while H5 and H6 of C3 are only slightly affected. Local differences in the structure of the DNA and the basicities of potential binding sites on different base steps in the sequence might account for the observed sequence selectivity.

Prothrombin polymorphism A19911G, factor V HR2 haplotype A4070G, and plasminogen activator-inhibitor-1 polymorphism 4G/5G and the risk of retinal vein occlusion.

PubMed

Kuhli-Hattenbach, Claudia; Hellstern, Peter; Nägler, Dorit Karin; Kohnen, Thomas; Hattenbach, Lars-Olof

2017-01-01

Thus far, no data has become available to evaluate systematically the prevalences of prothrombin polymorphism A19911G (PT A19911G), factor V HR2 haplotype A4070G (FV A4070G), or plasminogen activator-inhibitor-1 polymorphism 4G/5G (PAI-1 4G/5G) in patients who develop retinal vein occlusion (RVO) without cardiovascular risk factors. We retrospectively evaluated comprehensive thrombophilia data from 42 preselected RVO patients without cardiovascular risk factors. The prevalences of different gene mutations and polymorphisms including factor V Leiden mutation G1691A (FVL), FV A4070G, prothrombin mutation G20210A, PT A19911G, and PAI-1 4G/5G were compared with 241 healthy controls matched for age and sex. A total of 20 patients (47.7%) were found to carry thrombophilic gene polymorphisms including FVL, FV A4070G, and homozygous PT A19911G compared with 72 of 241 controls (29.9%; p = 0.03). Subgroup analysis of patients with a significant personal or family history of thromboembolism revealed a high prevalence of FVL, FV A4070G, and homozygous PT A19911G (p = 0.005). FV A4070G was found to be significantly associated with at least two other heterozygous or one homozygous gene polymorphisms (p = 0.02). Multivariate analysis revealed the presence of FVL (p = 0.0017) and homozygous PT A19911G (p = 0.03) polymorphism as independent risk factors for the development of RVO. Our results indicate that in selected RVO patients screening for thrombophilic gene polymorphisms including FVL, FV A4070G and homozygous PT G19911A may be helpful in a high percentage of cases. Our findings suggest that hereditary thrombophilia associated with RVO is more likely to be multigenic than caused by any single risk factor.

ELECTRON IMPACT DISSOCIATION X {sup 1}{Sigma}{sup +} {sub g} {yields} b {sup 3}{Sigma} {sub u} {sup +} AND EXCITATIONS X {sup 1}{Sigma}{sup +} {sub g} {yields} a {sup 3}{Sigma} {sub g} {sup +} AND X {sup 1}{Sigma}{sup +} {sub g} {yields} B {sup 1}{Sigma} {sub u} {sup +} OF MOLECULAR HYDROGEN IN NONTHERMAL ASTROPHYSICAL PLASMAS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ki, Dae-Han; Jung, Young-Dae, E-mail: ydjung@hanyang.ac.kr

We investigate the electronic transitions X {sup 1}{Sigma}{sup +} {sub g} {yields} b {sup 3}{Sigma} {sub u} {sup +}, X {sup 1}{Sigma}{sup +} {sub g} {yields} a {sup 3}{Sigma} {sub g} {sup +}, and X {sup 1}{Sigma}{sup +} {sub g} {yields} B {sup 1}{Sigma} {sub u} {sup +} of molecular hydrogen by studying electron impacts in astrophysical Lorentzian plasmas. Useful fitting formulae for the X {sup 1}{Sigma}{sup +} {sub g} {yields} b {sup 3}{Sigma} {sub u} {sup +}, X {sup 1}{Sigma}{sup +} {sub g} {yields} a {sup 3}{Sigma} {sub g} {sup +}, and X {sup 1}{Sigma}{sup +} {sub g} {yields}more » B {sup 1}{Sigma} {sub u} {sup +} excitation cross sections are employed in order to obtain the electronic excitation rate coefficients of H{sub 2} as functions of the spectral index and temperature. In low-temperature regions, it is found that the excitation rate coefficients R{sub b{sup 3}{Sigma}{sub u{sup {sub +}}}}, R{sub a{sup 3}{Sigma}{sub g{sup {sub +}}}}, and R{sub B{sub {sup 1}{Sigma}{sub u{sup {sub +}}}}} of H{sub 2} in non-Maxwellian plasmas are smaller than those in Maxwellian plasmas. However, in high-temperature regions, the excitation rate coefficients of H{sub 2} in non-Maxwellian plasmas are greater than those in Maxwellian plasmas. It is also shown that the X {sup 1}{Sigma}{sup +} {sub g} {yields} b {sup 3}{Sigma} {sub u} {sup +} excitation rate coefficient is the main contributor in low-temperature regions. In contrast, it is found that the X {sup 1}{Sigma}{sup +} {sub g} {yields} B {sup 1}{Sigma} {sub u} {sup +} electronic excitation is dominant in high-temperature regions.« less

Long-range magnetic order in the Heisenberg pyrochlore antiferromagnets G d2G e2O7 and G d2P t2O7 synthesized under high pressure

NASA Astrophysics Data System (ADS)

Li, X.; Cai, Y. Q.; Cui, Q.; Lin, C. J.; Dun, Z. L.; Matsubayashi, K.; Uwatoko, Y.; Sato, Y.; Kawae, T.; Lv, S. J.; Jin, C. Q.; Zhou, J.-S.; Goodenough, J. B.; Zhou, H. D.; Cheng, J.-G.

2016-12-01

G d2S n2O7 and G d2T i2O7 have been regarded as good experimental realizations of the classical Heisenberg pyrochlore antiferromagnet with dipolar interaction. The former was found to adopt the Palmer-Chalker state via a single, first-order transition at TN≈1 K , while the latter enters a distinct, partially ordered state through two successive transitions at TN 1≈1 K and TN 2= 0.75 K . To shed more light on their distinct magnetic ground states, we have synthesized two more gadolinium-based pyrochlore oxides, G d2G e2O7 and G d2P t2O7 , under high-pressure conditions and performed detailed characterizations via x-ray powder diffraction, dc and ac magnetic susceptibility, and specific heat measurements down to 100 mK. We found that both compounds enter a long-range antiferromagnetically ordered state through a single, first-order transition at TN= 1.4 K for G d2G e2O7 and TN= 1.56 K for G d2P t2O7 , with the specific heat anomaly similar to that of G d2S n2O7 rather than G d2T i2O7 . Interestingly, the low-temperature magnetic specific heat values of both G d2G e2O7 and G d2P t2O7 were found to follow nicely the T3 dependence as expected for a three-dimensional antiferromagnet with gapless spin-wave excitations. We have rationalized the enhancement of TN in terms of the reduced Gd-Gd distances for the chemically pressurized G d2G e2O7 and the addition of extra superexchange pathways through the empty Pt -eg orbitals for G d2P t2O7 . Our current study has expanded the family of gadolinium-based pyrochlores and permits us to achieve a better understanding of their distinct magnetic properties in a more comprehensive perspective.

Role of polyamines at the G1/S boundary and G2/M phase of the cell cycle.

PubMed

Yamashita, Tomoko; Nishimura, Kazuhiro; Saiki, Ryotaro; Okudaira, Hiroyuki; Tome, Mayuko; Higashi, Kyohei; Nakamura, Mizuho; Terui, Yusuke; Fujiwara, Kunio; Kashiwagi, Keiko; Igarashi, Kazuei

2013-06-01

The role of polyamines at the G1/S boundary and in the G2/M phase of the cell cycle was studied using synchronized HeLa cells treated with thymidine or with thymidine and aphidicolin. Synchronized cells were cultured in the absence or presence of α-difluoromethylornithine (DFMO), an inhibitor of ornithine decarboxylase, plus ethylglyoxal bis(guanylhydrazone) (EGBG), an inhibitor of S-adenosylmethionine decarboxylase. When polyamine content was reduced by treatment with DFMO and EGBG, the transition from G1 to S phase was delayed. In parallel, the level of p27(Kip1) was greatly increased, so its mechanism was studied in detail. Synthesis of p27(Kip1) was stimulated at the level of translation by a decrease in polyamine levels, because of the existence of long 5'-untranslated region (5'-UTR) in p27(Kip1) mRNA. Similarly, the transition from the G2/M to the G1 phase was delayed by a reduction in polyamine levels. In parallel, the number of multinucleate cells increased by 3-fold. This was parallel with the inhibition of cytokinesis due to an unusual distribution of actin and α-tubulin at the M phase. Since an association of polyamines with chromosomes was not observed by immunofluorescence microscopy at the M phase, polyamines may have only a minor role in structural changes of chromosomes at the M phase. In general, the involvement of polyamines at the G2/M phase was smaller than that at the G1/S boundary. Copyright © 2013 Elsevier Ltd. All rights reserved.

Human rotavirus strains circulating in Venezuela after vaccine introduction: predominance of G2P[4] and reemergence of G1P[8].

PubMed

Vizzi, Esmeralda; Piñeros, Oscar A; Oropeza, M Daniela; Naranjo, Laura; Suárez, José A; Fernández, Rixio; Zambrano, José L; Celis, Argelia; Liprandi, Ferdinando

2017-03-21

Rotavirus (RV) is the most common cause of severe childhood diarrhea worldwide. Despite Venezuela was among the first developing countries to introduce RV vaccines into their national immunization schedules, RV is still contributing to the burden of diarrhea. Concerns exist about the selective pressure that RV vaccines could exert on the predominant types and/or emergence of new strains. To assess the impact of RV vaccines on the genotype distribution 1 year after the vaccination was implemented, a total of 912 fecal specimens, collected from children with acute gastroenteritis in Caracas from February 2007 to April 2008, were screened, of which 169 (18.5%) were confirmed to be RV positive by PAGE. Rotavirus-associated diarrhea occurred all year-round, although prevailed during the coolest and driest months among unvaccinated children under 24 months old. Of 165 RV strains genotyped for G (VP7) and P (VP4) by seminested multiplex RT-PCR, 77 (46.7%) were G2P[4] and 63 (38.2%) G1P[8]. G9P[8], G3P[8] and G2P[6] were found in a lower proportion (7.3%). Remarkable was also the detection of <5% of uncommon combinations (G8P[14], G8P[4], G1P[4] and G4P[4]) and 3.6% of mixed infections. A changing pattern of G/P-type distribution was observed during the season studied, with complete predominance of G2P[4] from February to June 2007 followed by its gradual decline and the reemergence of G1P[8], predominant since January 2008. Phylogenetic analysis of VP7 and VP4 genes revealed a high similarity among G2P[4] and global strains belonging to G2-II and P[4]-V lineages. The amino acid substitution 96D → N, related with reemergence of the G2 genotype elsewhere, was observed. The G1P[8] strains from Caracas were grouped into the lineages G1-I and P[8]-III, along with geographically remote G1P[8] rotaviruses, but they were rather distant from Rotarix ® vaccine and pre-vaccine strains. Unique amino acid substitutions observed on neutralization domains of the VP7 sequence from

The plasminogen activator inhibitor-1 (PAI-1) gene -844 A/G and -675 4G/5G promoter polymorphism significantly influences plasma PAI-1 levels in women with polycystic ovary syndrome.

PubMed

Lin, Sun; Huiya, Zhang; Bo, Liu; Wei, Wei; Yongmei, Guan

2009-12-01

Mutations in the plasminogen activator inhibitor-1 (PAI-1) gene, along with increased PAI-1 levels, have been implicated in the pathogenesis of polycystic ovarian syndrome (PCOS). We investigated a possible influence of the promoter polymorphism (-844 A/G and -675 4G/5G) in the PAI-1 gene on plasma PAI-1 levels in 126 PCOS patients and 97 healthy controls. Levels of total testosterone, luteinizing hormone (LH), follicle stimulating hormone (FSH), fasting plasma glucose (FPG), fasting insulin, and PAI-1 were measured, and body mass index (BMI), waist-to-hip ratio (WHR), LH/FSH ratio, and homeostasis model assessment for insulin resistance (HOMA-IR) were calculated. PAI-1 -675 4G/5G and -844 A/G gene polymorphisms were also performed. Total testosterone, fasting insulin, and PAI-1 levels; BMI, LH/FSH, and HOMA-IR were significantly higher in PCOS patients than controls (P < 0.05). The odds ratio of 4G/4G genotype, 4G allele, and the combination genotype of 4G/4G and -844 A/A were 2.49 (95% confidence interval (CI), 1.4-4.44), 2.1 (95% CI, 1.43-3.08), and 2.9 (95% CI, 1.41-5.98), respectively, (P < 0.001). In the PCOS group, the PAI-1 level of the A/A was significantly higher than that of the A/G or G/G genotype, similarly was 4G/4G genotype compared with 4G/5G or 5G/5G genotype. The plasma PAI-1 levels of the combination of the PAI-1 -844 A/A and -675 4G/4G or 4G/5G genotypes, or the coadunation of 4G/4G and -844 non-G/G (A/A + A/G) genotypes were significantly high in PCOS women compared with controls. A trend to a positive interaction between PAI-1 -675 4G/5G and -844 A/G gene polymorphism may elevate plasma PAI-1 levels and hypofibrinolysis, which is probably an important hereditary risk factor in PCOS.

Induction of G1 and G2/M cell cycle arrests by the dietary compound 3,3'-diindolylmethane in HT-29 human colon cancer cells.

PubMed

Choi, Hyun Ju; Lim, Do Young; Park, Jung Han Yoon

2009-05-29

3,3'-Diindolylmethane (DIM), an indole derivative produced in the stomach after the consumption of broccoli and other cruciferous vegetables, has been demonstrated to exert anti-cancer effects in both in vivo and in vitro models. We have previously determined that DIM (0 - 30 micromol/L) inhibited the growth of HT-29 human colon cancer cells in a concentration-dependent fashion. In this study, we evaluated the effects of DIM on cell cycle progression in HT-29 cells. HT-29 cells were cultured with various concentrations of DIM (0 - 30 micromol/L) and the DNA was stained with propidium iodide, followed by flow cytometric analysis. [3H]Thymidine incorporation assays, Western blot analyses, immunoprecipitation and in vitro kinase assays for cyclin-dependent kinase (CDK) and cell division cycle (CDC)2 were conducted. The percentages of cells in the G1 and G2/M phases were dose-dependently increased and the percentages of cells in S phase were reduced within 12 h in DIM-treated cells. DIM also reduced DNA synthesis in a dose-dependent fashion. DIM markedly reduced CDK2 activity and the levels of phosphorylated retinoblastoma proteins (Rb) and E2F-1, and also increased the levels of hypophosphorylated Rb. DIM reduced the protein levels of cyclin A, D1, and CDK4. DIM also increased the protein levels of CDK inhibitors, p21CIP1/WAF1 and p27KIPI. In addition, DIM reduced the activity of CDC2 and the levels of CDC25C phosphatase and cyclin B1. Here, we have demonstrated that DIM induces G1 and G2/M phase cell cycle arrest in HT-29 cells, and this effect may be mediated by reduced CDK activity.

Ab initio and transition state theory study of the OH + HO2 → H2O + O2(3Σg-)/O2(1Δg) reactions: yield and role of O2(1Δg) in H2O2 decomposition and in combustion of H2.

PubMed

Monge-Palacios, M; Sarathy, S Mani

2018-02-07

Reactions of hydroxyl (OH) and hydroperoxyl (HO 2 ) are important for governing the reactivity of combustion systems. We performed post-CCSD(T) ab initio calculations at the W3X-L//CCSD = FC/cc-pVTZ level to explore the triplet ground-state and singlet excited-state potential energy surfaces of the OH + HO 2 → H 2 O + O 2 ( 3 Σ g - )/O 2 ( 1 Δ g ) reactions. Using microcanonical and multistructural canonical transition state theories, we calculated the rate constant for the triplet and singlet channels over the temperature range 200-2500 K, represented by k(T) = 3.08 × 10 12 T 0.07  exp(1151/RT) + 8.00 × 10 12 T 0.32  exp(-6896/RT) and k(T) = 2.14 × 10 6 T 1.65  exp(-2180/RT) in cm 3 mol -1 s -1 , respectively. The branching ratios show that the yield of singlet excited oxygen is small (<0.5% below 1000 K). To ascertain the importance of singlet oxygen channel, our new kinetic information was implemented into the kinetic model for hydrogen combustion recently updated by Konnov (Combust. Flame, 2015, 162, 3755-3772). The updated kinetic model was used to perform H 2 O 2 thermal decomposition simulations for comparison against shock tube experiments performed by Hong et al. (Proc. Combust. Inst., 2013, 34, 565-571), and to estimate flame speeds and ignition delay times in H 2 mixtures. The simulation predicted a larger amount of O 2 ( 1 Δ g ) in H 2 O 2 decomposition than that predicted by Konnov's original model. These differences in the O 2 ( 1 Δ g ) yield are due to the use of a higher ab initio level and a more sophisticated methodology to compute the rate constant than those used in previous studies, thereby predicting a significantly larger rate constant. No effect was observed on the rate of the H 2 O 2 decomposition and on the flame speeds and ignition delay times of different H 2 -oxidizer mixtures. However, if the oxidizer is seeded with O 3 , small differences appear in the flame speed. Given that O 2 ( 1 Δ g ) is much more reactive than O

BRN 3.1 Knockouts Affect the Vestibular, Autonomic, and Circadian Rhythm Responses to 2G Exposure

NASA Technical Reports Server (NTRS)

Murakami, D. M.; Erkman, L.; Rosenfeld, M. G.; Fuller, C. A.

1999-01-01

Our previous studies have demonstrated that 2G exposure via centrifugation significantly attenuated the daily mean and circadian rhythm amplitude of rat body temperature (Tb), heart rate, and activity (Act). In addition, 2G exposure activates neural responses in several vestibular, autonomic, and circadian nuclei. Although we have characterized the effect of 2G on an animal's physiological, neuronal, and behavioral responses, it will be important to understand the underlying neural and physiological mechanisms that mediate those responses. For example, the vestibular responses, proprioceptive feedback, or fluid shifts may be the critical factors that mediate the responses to 2G. As a first step to understand the relative importance of these different response pathways to altered gravitational fields, this study examined the contribution of the vestibular system by utilizing an animal model from molecular biology. Brain 3.1 (Bm 3.1) is a POU domain homeobox gene involved in the normal development of the vestibular and auditory system. Brn 3.1 deletion results in a loss of hair cells in the otoliths, semicircular canals, and cochlea. As a result mice with a Brn 3.1 deletion do not have a functioning vestibular or auditory system. The BRN 3.1 knockout mouse could be a very useful animal model for isolating the role of the vestibular system in mediating the physiological responses to 2G exposure. Therefore, this study compared the effect of 2G exposure via centrifugation between Brn 3.1 knockout (KO) versus Wildtype (W) mice.

Study of Infrared Emission Spectroscopy for the B1Δg-A1Πu and B'1Σg+-A1Πu Systems of C2

NASA Astrophysics Data System (ADS)

Tang, Jian; Chen, Wang; Kawaguchi, Kentarou; Bernath, Peter F.

2016-06-01

Recently, we carried out the perturbation analysis of C_2 spectra and identified forbidden singlet-triplet intersystem transitions, which aroused further interest in other C_2 spectra for the many low-lying electronic states of this fundamental molecule. In 1988, the B1Δg-A1Πu and B'1Σg+-A1Πu band systems were discovered by Douay et al., who observed eight bands of the B1Δg-A1Πu system with v up to 5 for the B1Δg state and six bands of the B'1Σg+-A1Πu system with v up to 3 for the B'1Σg+ state in the Fourier transform infrared emission spectra of hydrocarbon discharges. In the work presented here, we identified twenty-four bands of the two systems, among which the B'1Σg+ v = 4 and the B1Δg v = 6, 7 and 8 vibrational levels involved in nine bands were studied for the first time. A direct global analysis with Dunham parameters was carried out satisfactorily for the B1Δg-A1Πu system except for a small perturbation in the B1Δg v = 6 level. The calculated rovibrational term energies up to B1Δg v = 12 showed that the level crossing between the B1Δg and d3Πg states is responsible for many of the prominent perturbations in the Swan system observed previously. Nineteen lines of the B1Δg-a3Πu forbidden transitions were identified and the off-diagonal spin-orbit interaction constant AdB between d3Πg and B1Δg was derived as 8.3(1) wn. For the B'1Σg+-A1Πu system, only individual band analyses for each vibrational level in the B'1Σg+ state could be done satisfactorily and Dunham parameters obtained from these effective parameters showed that the anharmonic vibrational constant ω_e x_e is anomalously small (nearly zero). Inspection of the RKR potential curves for the B'1Σg+ and X1Σg+ states revealed that an avoided crossing may occur around 30000 wn, which is responsible for the anomalous molecular constants in these two states. W. Chen, K. Kawaguchi, P. F. Bernath, and J. Tang, J. Chem. Phys., 141, 064317 (2015) M. Douay, R. Nietmann and P. F. Bernath

Plasminogen activator inhibitor 1 4G/5G and -844G/A variants in idiopathic recurrent pregnancy loss.

PubMed

Magdoud, Kalthoum; Herbepin, Viviana G; Touraine, Renaud; Almawi, Wassim Y; Mahjoub, Touhami

2013-09-01

Plasminogen activator inhibitor type 1 (PAI-1) regulates fibrinolysis, and the common promoter region variants -675G/A (4G/5G) and -844G/A are associated with increased thrombotic risk. Despite evidence linking altered fibrinolysis with adverse pregnancy events, including idiopathic recurrent pregnancy loss (RPL), the contribution of PAI-1 variants to RPL risk remains controversial. We investigated the association between the PAI-1 -844G/A and 4G/5G (-675G/A) variants with altered risk of RPL. This was a case-control study involving 304 women with confirmed RPL and 371 age- and ethnically matched control women. PAI-1 genotyping was performed by PCR single-specific primer -675 (G/A) and real-time PCR (-844G/A) analysis. Minor allele frequency (MAF) of 4G/5G (P < 0.001), but not -844G/A (P = 0.507), was higher in RPL cases. PAI-1 4G/5G single-nucleotide polymorphism (SNP) was significantly associated with RPL under additive, dominant, and recessive genetic models; no association of -844G/A with RPL was seen irrespective of the genetic model tested. Taking common -844G/5G haplotype as reference (OR = 1.00), multivariate analysis confirmed the association of 4G-containing -844A/4G (P < 0.001) and -844G/4G (P = 0.011) haplotypes with increased RPL risk. 4G/5G, but not -844G/A, PAI-1 variant is associated with an increased risk of RPL. © 2013 John Wiley & Sons Ltd.

APOBEC3G ubiquitination by Nedd4-1 favors its packaging into HIV-1 particles.

PubMed

Dussart, Sylvie; Douaisi, Marc; Courcoul, Marianne; Bessou, Gilles; Vigne, Robert; Decroly, Etienne

2005-01-21

APOBEC3G is a cytidine deaminase that limits the replication of many retroviruses. This antiviral host factor is packaged into retrovirus particles, where it targets single-stranded DNA generated during reverse transcription and induces up to 2% of G-to-A mutations, which are lethal for the HIV-1 provirus. Vif protein counteracts this antiviral factor by decreasing its packaging into lentivirus particles. Here, we demonstrate that Nedd4-1, an HECT E3 ubiquitin ligase, interacts with APOBEC3G, through its WW2 and WW3 domains. As a result of this interaction, APOBEC3G undergoes post-translational modification by addition of ubiquitin moieties. Accordingly, we demonstrate that the dominant negative Nedd4-1 C/S form prevents APOBEC3G ubiquitination. Moreover, the packaging of APOBEC3G into Pr55 Gag virus-like particles and into HIV-1 virions is reduced when Nedd4-1 C/S is expressed. During HIV-1 viral production in the presence of APOBEC3G, Nedd4-1 C/S restores partially the infectivity of Deltavif HIV-1. We conclude that the ubiquitination of APOBEC3G by Nedd4-1 favors its targeting to the virus assembly site where APOBEC3G interacts with Gag and is packaged into HIV-1 particles in the absence of Vif.

The mCpG-binding domain of human MBD3 does not bind to mCpG but interacts with NuRD/Mi2 components HDAC1 and MTA2.

PubMed

Saito, Motoki; Ishikawa, Fuyuki

2002-09-20

Although mammalian MBD3 contains the mCpG-binding domain (MBD) and is highly homologous with the authentic mCpG-binding protein MBD2, it was reported that the protein does not bind to mCpG specifically. Using recombinant human wild type and mutant MBD3 proteins, we demonstrated that atypical amino acids found in MBD3 MBD, namely, His-30 and Phe-34, are responsible for the inability of MBD3 to bind to mCpG. Interestingly, although H30K/F34Y MBD3 mutant protein binds to mCpG efficiently in vitro, it was not localized at the mCpG-rich pericentromeric regions in mouse cells. We also showed that Y34F MBD2b MBD, which possesses not the mCpG-specific DNA-binding activity but the nonspecific DNA-binding activity, was localized at the pericentromeric regions. These results suggested that the mCpG-specific DNA-binding activity is largely dispensable, and another factor(s) is required for the localization of MBD proteins in vivo. MBD3 was identified as a component of the NuRD/Mi2 complex that shows chromatin remodeling and histone deacetylase activities. We demonstrated that MBD3 MBD is necessary and sufficient for binding to HDAC1 and MTA2, two components of the NuRD/Mi2 complex. It was therefore suggested that mCpG-binding-defective MBD3 has evolutionarily conserved its MBD because of the secondary role played by the MBD in protein-protein interactions.

Multifaceted counter-APOBEC3G mechanisms employed by HIV-1 Vif.

PubMed

Britan-Rosich, Elena; Nowarski, Roni; Kotler, Moshe

2011-07-29

In the absence of human immunodeficiency virus type 1 (HIV-1) Vif protein, the host antiviral deaminase apolipoprotein B mRNA-editing enzyme-catalytic polypeptide-like 3G (A3G) restricts the production of infectious HIV-1 by deamination of dC residues in the negative single-stranded DNA produced by reverse transcription. The Vif protein averts the lethal threat of deamination by precluding the packaging of A3G into assembling virions by mediating proteasomal degradation of A3G. In spite of this robust Vif activity, residual A3G molecules that escape degradation and incorporate into newly assembled virions are potentially deleterious to the virus. We hypothesized that virion-associated Vif inhibits A3G enzymatic activity and therefore prevents lethal mutagenesis of the newly synthesized viral DNA. Here, we show that (i) Vif-proficient HIV-1 particles released from H9 cells contain A3G with lower specific activity compared with Δvif-virus-associated A3G, (ii) encapsidated HIV-1 Vif inhibits the deamination activity of recombinant A3G, and (iii) purified HIV-1 Vif protein and the Vif-derived peptide Vif25-39 inhibit A3G activity in vitro at nanomolar concentrations in an uncompetitive manner. Our results manifest the potentiality of Vif to control the deamination threat in virions or in the pre-integration complexes following entry to target cells. Hence, virion-associated Vif could serve as a last line of defense, protecting the virus against A3G antiviral activity. Copyright © 2011 Elsevier Ltd. All rights reserved.

Loss of G2 subunit of vacuolar-type proton transporting ATPase leads to G1 subunit upregulation in the brain

PubMed Central

Kawamura, Nobuyuki; Sun-Wada, Ge-Hong; Wada, Yoh

2015-01-01

Vacuolar-type ATPase (V-ATPase) is a primary proton pump with versatile functions in various tissues. In nerve cells, V-ATPase is required for accumulation of neurotransmitters into secretory vesicles and subsequent release at the synapse. Neurons express a specific isoform (G2) of the G subunit of V-ATPase constituting the catalytic sector of the enzyme complex. Using gene targeting, we generated a mouse lacking functional G2 (G2 null), which showed no apparent disorders in architecture and behavior. In the G2-null mouse brain, a G1 subunit isoform, which is ubiquitously expressed in neuronal and non-neuronal tissues, accumulated more abundantly than in wild-type animals. This G1 upregulation was not accompanied by an increase in mRNA. These results indicate that loss of function of neuron-specific G2 isoform was compensated by an increase in levels of the G1 isoform without apparent upregulation of the G1 mRNA. PMID:26353914

Rate Coefficient for Collisional Removal of O2(X3Σ ^-g, v = 1) with O Atoms at 240 K

NASA Astrophysics Data System (ADS)

Pejaković, D. A.; Campbell, Z.; Kalogerakis, K. S.; Copeland, R. A.; Slanger, T. G.

2004-12-01

Knowledge of the water concentration profile is key to understanding of the chemistry and energy flow in the stratosphere and mesosphere. One of the tasks of the SABER instrument in NASA's TIMED mission is to measure water vapor concentration by detecting H2O(ν 2) emission in the 6.8 μ m region. An important source of the H2O(ν 2) emission is the collisional deactivation of vibrationally excited O2: O2(X3Σ ^-g, v = 1) + H2O <-> O2(X3Σ ^-g, v = 0) + H2O(ν 2). For reliable interpretation of the SABER data it is crucial to determine rate coefficient for the competing process: O2(X3Σ ^-g, v = 1) + O(3P) -> O2(X3Σ ^-g, v = 0) + O(3P) [1]. Laboratory measurements are reported of the rate coefficient for collisional removal of O2(X3Σ ^-g, v = 1) by O(3P) at a temperature of 240 K, relevant to the upper mesosphere. Instead of directly detecting the O2(X3Σ ^-g, v = 1) population, a novel, technically simpler, approach is used in which the v = 1 level of the O2(a1Δ g) state is monitored. With ground-state O2 present, owing to the rapid equilibration of the O2(X3Σ ^-g, v = 1) and O2(a1Δ g, v = 1) populations via the processes O2(a1Δ g, v = 1) + O2(X3Σ ^-g, v = 0) <-> O2(a1Δ g, v = 0) + O2(X3Σ ^-g, v = 1), the information on the O2(X3Σ ^-g, v = 1) kinetics is extracted from the O2(a1Δ g, v = 1) temporal evolution. A two-laser method is employed, in which the pulsed output of the first laser near 285 nm photodissociates ozone to produce atomic oxygen and O2(a1Δ g, v = 1), and the pulsed output of the second laser detects O2(a1Δ g, v = 1) via the resonance-enhanced multiphoton ionization. In the same experiment, rate coefficients for removal of O2(a1Δ g, v = 1) with the atmospherically relevant colliders O2, CO2, and O also were measured at room temperature and 240 K. The measured rate coefficient for O2(X3Σ ^-g, v = 1) removal by O(3P) is in the range 2--3 × 10-12 cm3s-1 at 240 K, compared to the recently measured room temperature value of about 3 × 10

Polymorphisms of endothelin 1 (G5665T and T-1370G) and endothelin receptor type A (C+70G and G-231A) in Graves' disease.

PubMed

Aydın, A Fatih; Develi-İş, Seval; Doğru-Abbasoğlu, Semra; Vural, Pervin; Ozderya, Ayşenur; Karadağ, Berrin; Uysal, Müjdat

2014-01-01

Endothelin 1 (EDN1) is a strong angiogenic and mitogenic factor, playing a key role in hypervascularization, thyroid follicle cell hyperplasia, and lymphocyte infiltration in the thyroid gland of patients with Graves' disease (GD). EDN1 induces angiogenesis and mitogenesis via endothelin receptor type A (EDNRA). This study examined the possible association of EDN1 (G5665T and T-1370G) and EDNRA (C+70G and G-231A) single nucleotide polymorphisms (SNPs) with the occurrence of GD, and evaluates the relationship between genotypes and clinical/laboratory manifestations of GD. We analyzed genotype and allele distributions of EDN1 and EDNRA polymorphisms in 165 patients with GD and 181 healthy controls by real-time PCR combined with melting curve analysis. No significant associations between GD and variant alleles of the studied polymorphisms were observed. However, the anti-thyroid peroxidase (anti-TPO) and anti-thyroglobulin (anti-TG) levels in EDN1 G5665T GG genotype were higher than those in T allele carriers (GT+TT) (p=0.001 and p=0.026, respectively). In addition, anti-TPO levels in EDN1 T-1370G wild-type homozygous patients were found to be higher than in mutant gene carrying patients (GT+GG) (p=0.006). The presence of EDNRA+70G allele was associated with 3.37-fold increased risk for development of ophthalmopathy in GD patients (p=0.009). Although there were no associations between EDN1 (G5665T and T-1370G) and EDNRA (C+70G and G-231A) SNPs and susceptibility to GD, EDN1 G5665T and T-1370G polymorphisms were related to alterations of autoantibody production and EDNRA C+70G polymorphism is related with increased risk for ophthalmopathy in GD patients. Copyright © 2013 Elsevier B.V. All rights reserved.

[Knockdown of STAT3 inhibits proliferation and migration of HepG2 hepatoma cells induced by IFN1].

PubMed

Li, Xiaofang; Wang, Yuqi; Yan, Ben; Fang, Peipei; Ma, Chao; Xu, Ning; Fu, Xiaoyan; Liang, Shujuan

2018-02-01

Objective To prepare lentiviruses expressing shRNA sequences targeting human signal transducer and activator of transcription 3 (STAT3) and detect the effect of STAT3 knockdown on type I interferon (IFN1)-induced proliferation and migration in HepG2 cells. Methods Four STAT3-targeting shRNA sequences (shRNA1-shRNA4) and one control sequence (Ctrl shRNA) were selected and cloned respectively into pLKO.1-sp6-pgk-GFP to construct shRNA-expressing vectors. Along with backbone psPAX2 and pMD2.G vectors, they were separately transfected into HEK293T cells to prepare lentiviruses. HepG2 cells were infected with the lentiviruses. Cytoplastic STAT3 level was detected by Western blotting to screen effective shRNA sequence(s) targeting STAT3. Proliferation and migration of HepG2 cells were analyzed by CCK-8 assay and Transwell TM migration and scratching assay, respectively. To detect the effect of IFN1 on cell proliferation and migration of HepG2 cells, the cells were treated with 2000 U/mL IFNα2b for indicated time and the activation of IFN-triggered STAT1 signal transduction was assayed by Western blotting. Results Two most effective STAT3-targeting shRNA sequences shRNA1 and shRNA2 were selected, and the expression of both STAT3 shRNA significantly decreased proliferation and migration of HepG2 cells. When treated with IFNα2b, 2000 U/mL of IFN1 showed more competent in attenuating growth and migration of HepG2 cells. Our data further proved that knockdown of STAT3 increased the phosphorylation of STAT1, and IFNα2b further enhanced the activation of STAT1 signaling in HepG2 cells. Conclusion Knockdown of STAT3 inhibits cell migration and growth, and rescues IFN response through up-regulating STAT1 signal transduction in HepG2 hepatoma cells.

The cellular source for APOBEC3G's incorporation into HIV-1

PubMed Central

2011-01-01

Background Human APOBEC3G (hA3G) has been identified as a cellular inhibitor of HIV-1 infectivity. Viral incorporation of hA3G is an essential step for its antiviral activity. Although the mechanism underlying hA3G virion encapsidation has been investigated extensively, the cellular source of viral hA3G remains unclear. Results Previous studies have shown that hA3G forms low-molecular-mass (LMM) and high-molecular-mass (HMM) complexes. Our work herein provides evidence that the majority of newly-synthesized hA3G interacts with membrane lipid raft domains to form Lipid raft-associated hA3G (RA hA3G), which serve as the precursor of the mature HMM hA3G complex, while a minority of newly-synthesized hA3G remains in the cytoplasm as a soluble LMM form. The distribution of hA3G among the soluble LMM form, the RA LMM form and the mature forms of HMM is regulated by a mechanism involving the N-terminal part of the linker region and the C-terminus of hA3G. Mutagenesis studies reveal a direct correlation between the ability of hA3G to form the RA LMM complex and its viral incorporation. Conclusions Together these data suggest that the Lipid raft-associated LMM A3G complex functions as the cellular source of viral hA3G. PMID:21211018

Association Between Plasminogen Activator Inhibitor-1-675 4G/5G Insertion/Deletion Polymorphism and Chronic Obstructive Pulmonary Disease.

PubMed

Essa, Enas S; El Wahsh, Rabab A

2016-12-01

Molecular pathology of chronic obstructive pulmonary disease (COPD) is still being investigated to discover relationships with disease pathogenesis. Evidence of plasminogen activator inhibitor-1 (PAI-1) overexpression in the sputum and the blood of COPD patients is growing. We aimed to investigate the potential relation between PAI-1 promoter 4G/5G insertion/deletion polymorphism and COPD development. In a case-control study, we genotyped 117 COPD patients and 160 control subjects for PAI-1 promoter 4G/5G polymorphism by an allele-specific polymerase chain reaction analysis. All subjects were male smokers. In the co-dominant model, there was a significant difference in the distribution of 5G/5G, 4G/5G and 4G/4G genotypes between COPD patients and controls (p = 0.002). In the recessive model, carriers of 4G/4G genotype were significantly higher in COPD patients than controls (p = 0.01). Carriers of 4G/4G genotype were at higher risk to develop COPD than those carrying 5G/5G or 4G/5G genotypes (crude odds ratio (OR) = 2.10, 95% confidence interval (CI) = 1.19-3.73, adjusted OR = 2.5, 95% CI = 1.22-3.99). In conclusion, PAI-1 4G/5G genetic variations are associated with COPD development in males.

Advances to G3

NASA Astrophysics Data System (ADS)

Salters, Vincent; Tarduno, John; van Keken, Peter

2008-12-01

Geochemistry, Geophysics, Geosystems (G3 ), a joint publication of AGU and the Geochemical Society, publishes research papers that speak to a broad community interested in Earth processes that are best studied with interdisciplinary approaches. G3 publishes conventional papers but is especially interested in novel publication forms that take advantage of electronic formats, such as animations and readily reusable digitized data sets. G3 's large number of submissions and subscriptions attests to how an interdisciplinary approach and electronic format benefit authors and readers. In the past few months, G3 has undergone substantial improvements. These include several changes in the timeliness of publication, revised protocols for the publication of data sets, the appointment of new associate editors, an updated Web site, and improved access to articles. As the editors of G3 , we are confident that these improvements will better serve AGU members.

Application and expression of HSV gG1 protein from a recombinant strain.

PubMed

Yan, Hua; Yan, Huishen; Huang, Tao; Li, Guocai; Gong, Weijuan; Jiao, Hongmei; Chen, Hongju; Ji, Mingchun

2010-11-01

According to the homologous sequence of glycoprotein G1 (gG1) genes from different strains of herpes simplex virus type 1 (HSV-1), a pair of primers was designed to amplify the gG1 gene fragment by PCR. Both the PCR product and the pGEX-4T-1 vector were digested with EcoR I and Sal I. The gG1 gene fragment was subcloned into the digested pGEX-4T-1 vector to construct a recombinant plasmid (pGEX-4T-1-gG1). The resultant plasmid was identified by dual-enzyme digestion and sequence analysis, and then transformed into Escherichia coli BL21 for expression under the induction of isopropyl β-D-1-thiogalactoside (IPTG). The expressed GST-gG1 fragment was detected by SDS-PAGE and purified by affinity chromatography. The properties of GST-gG1 fragment were evaluated by immunoblot analysis. Enzyme-linked immunosorbent assays (ELISAs) based on the GST-gG1 fragment were used for determining IgG or IgM to HSV-1. The GST-gG1 fragment-specific ELISA was also compared with ELISA with whole-HSV-1 antigen and commercial ELISA kits. The gG1-specific IgG and IFN-γ producing CD8+ T cells were induced in mice immunized with the GST-gG1 fragment. These results indicated that the GST-gG1 fragment could be used for replacing whole-virus antigen to detect IgM and IgG to HSV-1 in human sera, which provided a strategy for developing vaccines to protect HSV-1 infection using gG1 fragment. Copyright © 2010 Elsevier B.V. All rights reserved.

G2 Flywheel Module Design

NASA Technical Reports Server (NTRS)

Jensen, Ralph H.; Dever, Timothy P.

2006-01-01

Design of a flywheel module, designated the G2 module, is described. The G2 flywheel is a 60,000 RPM, 525 W-hr, 1 kW system designed for a laboratory environment; it will be used for component testing and system demonstrations, with the goal of applying flywheels to aerospace energy storage and integrated power and attitude control (IPACS) applications. G2 has a modular design, which allows for new motors, magnetic bearings, touchdown bearings, and rotors to be installed without a complete redesign of the system. This design process involves several engineering disciplines, and requirements are developed for the speed, energy storage, power level, and operating environment. The G2 rotor system consists of a multilayer carbon fiber rim with a titanium hub on which the other components mount, and rotordynamics analysis is conducted to ensure rigid and flexible rotor modes are controllable or outside of the operating speed range. Magnetic bearings are sized using 1-D magnetic circuit analysis and refined using 3-D finite element analysis. The G2 magnetic bearing system was designed by Texas A&M and has redundancy which allows derated operation after the loss of some components, and an existing liquid cooled two pole permanent magnet motor/generator is used. The touchdown bearing system is designed with a squeeze film damper system allowing spin down from full operating speed in case of a magnetic bearing failure. The G2 flywheel will enable module level demonstrations of component technology, and will be a key building block in system level attitude control and IPACS demonstrations.

Impacts, Effectiveness and Regional Inequalities of the GeoMIP G1 to G4 Solar Radiation Management Scenarios

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yu, Xiaoyong; Moore, John; Cui, Xuefeng

We evaluate the regional effectiveness of solar radiation management (SRM) to compensate for simultaneous changes in temperature and precipitation induced by increased greenhouse gas concentrations. We analyze results from multiple earth system models under four Geoengineering Model Intercomparison Project(GeoMIP) experiments with a modified form of the Residual Climate Response approach. Under the solar dimming geoengineering experiments G1(4xCO2) and G2(increasing CO2 by 1% per year), global average temperature is successfully restored to pre-industrial level over 50 years simulations. However, these two SRM experiments also produce a robust global precipitation decrease. The stratospheric aerosol GeoMIP geoengineering experiment, G4 has significantly greater regionalmore » inequality and lower effectiveness for compensating temperature change than G1 and G2. G4 also has significantly larger regional inequality for compensating precipitation change than G1and G2. However, there is no significant difference between precipitation change compensation effectiveness of G4 and G2, though there is much larger across model variability in G4 results. G3 has significant greater regional inequality for compensating temperature change than G1 and G2, and has significant lower effectiveness than G1. The effectiveness of four SRMs to compensate for temperature change is much higher than for precipitation. The large cross-model variation in adjustment percentage of compensated SAT and precipitation change by SRM to achieve optimal compensation effectiveness shed a light on the uncertainty accumulation effect in optimizing compensation effectiveness of SRM.« less

IgG2 deficiency in sickle cell anaemia.

PubMed

Natta, C L; Outschoorn, I M

1984-08-01

8 patients with known sickle cell anaemia were studied immunologically. The concentrations of the main immunoglobulin classes, IgG and IgA, were significantly higher than the levels in 11 normal age- and sex-matched black subjects (P less than 0.01). IgM levels were not significantly different in the two groups. There was a heterogeneity in the interaction of the IgG subclasses with Protein A, with low levels of IgG2. The IgG2:IgG1 ratios varied from 1:3.8 to 1:6 (normals 1:3). In 4 patients the absolute levels of IgG2 as measured by radial immunodiffusion were lower than normal, thus confirming the chromatographic ratios. Since specific antibody is often restricted to a single subclass, the levels of IgG subclasses may be related to recurrent bacterial infections in these patients.

17 CFR 240.12g-1 - Exemption from section 12(g).

Code of Federal Regulations, 2014 CFR

2014-04-01

... pursuant to section 12(g)(1) if on the last day of its most recent fiscal year the issuer had total assets...). 240.12g-1 Section 240.12g-1 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION... Securities Exchange Act of 1934 Extensions and Temporary Exemptions; Definitions § 240.12g-1 Exemption from...

17 CFR 240.12g-1 - Exemption from section 12(g).

Code of Federal Regulations, 2012 CFR

2012-04-01

... pursuant to section 12(g)(1) if on the last day of its most recent fiscal year the issuer had total assets...). 240.12g-1 Section 240.12g-1 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION... Securities Exchange Act of 1934 Extensions and Temporary Exemptions; Definitions § 240.12g-1 Exemption from...

17 CFR 240.12g-1 - Exemption from section 12(g).

Code of Federal Regulations, 2013 CFR

2013-04-01

... pursuant to section 12(g)(1) if on the last day of its most recent fiscal year the issuer had total assets...). 240.12g-1 Section 240.12g-1 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION... Securities Exchange Act of 1934 Extensions and Temporary Exemptions; Definitions § 240.12g-1 Exemption from...

17 CFR 240.12g-1 - Exemption from section 12(g).

Code of Federal Regulations, 2010 CFR

2010-04-01

... pursuant to section 12(g)(1) if on the last day of its most recent fiscal year the issuer had total assets...). 240.12g-1 Section 240.12g-1 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION... Securities Exchange Act of 1934 Extensions and Temporary Exemptions; Definitions § 240.12g-1 Exemption from...

17 CFR 240.12g-1 - Exemption from section 12(g).

Code of Federal Regulations, 2011 CFR

2011-04-01

... pursuant to section 12(g)(1) if on the last day of its most recent fiscal year the issuer had total assets...). 240.12g-1 Section 240.12g-1 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION... Securities Exchange Act of 1934 Extensions and Temporary Exemptions; Definitions § 240.12g-1 Exemption from...

Primary cilium suppression by SREBP1c involves distortion of vesicular trafficking by PLA2G3

PubMed Central

Gijs, Hannah Laura; Willemarck, Nicolas; Vanderhoydonc, Frank; Khan, Niamat Ali; Dehairs, Jonas; Derua, Rita; Waelkens, Etienne; Taketomi, Yoshitaka; Murakami, Makoto; Agostinis, Patrizia; Annaert, Wim; Swinnen, Johannes V.

2015-01-01

Distortion of primary cilium formation is increasingly recognized as a key event in many human pathologies. One of the underlying mechanisms involves aberrant activation of the lipogenic transcription factor sterol regulatory element–binding protein 1c (SREBP1c), as observed in cancer cells. To gain more insight into the molecular pathways by which SREBP1c suppresses primary ciliogenesis, we searched for overlap between known ciliogenesis regulators and targets of SREBP1. One of the candidate genes that was consistently up-regulated in cellular models of SREBP1c-induced cilium repression was phospholipase A2 group III (PLA2G3), a phospholipase that hydrolyzes the sn-2 position of glycerophospholipids. Use of RNA interference and a chemical inhibitor of PLA2G3 rescued SREBP1c-induced cilium repression. Cilium repression by SREBP1c and PLA2G3 involved alterations in endosomal recycling and vesicular transport toward the cilium, as revealed by aberrant transferrin and Rab11 localization, and was largely mediated by an increase in lysophosphatidylcholine and lysophosphatidylethanolamine levels. Together these findings indicate that aberrant activation of SREBP1c suppresses primary ciliogenesis by PLA2G3-mediated distortion of vesicular trafficking and suggest that PLA2G3 is a novel potential target to normalize ciliogenesis in SREBP1c-overexpressing cells, including cancer cells. PMID:25904332

Enhanced HIV-1 neutralization by a CD4-VH3-IgG1 fusion protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Meyuhas, Ronit; Noy, Hava; Fishman, Sigal

2009-08-21

HIV-1 gp120 is an alleged B cell superantigen, binding certain VH3+ human antibodies. We reasoned that a CD4-VH3 fusion protein could possess higher affinity for gp120 and improved HIV-1 inhibitory capacity. To test this we produced several human IgG1 immunoligands harboring VH3. Unlike VH3-IgG1 or VH3-CD4-IgG1, CD4-VH3-IgG1 bound gp120 considerably stronger than CD4-IgG1. CD4-VH3-IgG1 exhibited {approx}1.5-2.5-fold increase in neutralization of two T-cell laboratory-adapted strains when compared to CD4-IgG1. CD4-VH3-IgG1 improved neutralization of 7/10 clade B primary isolates or pseudoviruses, exceeding 20-fold for JR-FL and 13-fold for Ba-L. It enhanced neutralization of 4/8 clade C viruses, and had negligible effect onmore » 1/4 clade A pseudoviruses. We attribute this improvement to possible pairing of VH3 with CD4 D1 and stabilization of an Ig Fv-like structure, rather than to superantigen interactions. These novel findings support the current notion that CD4 fusion proteins can act as better HIV-1 entry inhibitors with potential clinical implications.« less

Visualizing Vpr-Induced G2 Arrest and Apoptosis

PubMed Central

Murakami, Tomoyuki; Aida, Yoko

2014-01-01

Vpr is an accessory protein of human immunodeficiency virus type 1 (HIV-1) with multiple functions. The induction of G2 arrest by Vpr plays a particularly important role in efficient viral replication because the transcriptional activity of the HIV-1 long terminal repeat is most active in G2 phase. The regulation of apoptosis by Vpr is also important for immune suppression and pathogenesis during HIV infection. However, it is not known whether Vpr-induced apoptosis depends on the ability of Vpr to induce G2 arrest, and the dynamics of Vpr-induced G2 arrest and apoptosis have not been visualized. We performed time-lapse imaging to examine the temporal relationship between Vpr-induced G2 arrest and apoptosis using HeLa cells containing the fluorescent ubiquitination-based cell cycle indicator2 (Fucci2). The dynamics of G2 arrest and subsequent long-term mitotic cell rounding in cells transfected with the Vpr-expression vector were visualized. These cells underwent nuclear mis-segregation after prolonged mitotic processes and then entered G1 phase. Some cells subsequently displayed evidence of apoptosis after prolonged mitotic processes and nuclear mis-segregation. Interestingly, Vpr-induced apoptosis was seldom observed in S or G2 phase. Likewise, visualization of synchronized HeLa/Fucci2 cells infected with an adenoviral vector expressing Vpr clearly showed that Vpr arrests the cell cycle at G2 phase, but does not induce apoptosis at S or G2 phase. Furthermore, time-lapse imaging of HeLa/Fucci2 cells expressing SCAT3.1, a caspase-3-sensitive fusion protein, clearly demonstrated that Vpr induces caspase-3-dependent apoptosis. Finally, to examine whether the effects of Vpr on G2 arrest and apoptosis were reversible, we performed live-cell imaging of a destabilizing domain fusion Vpr, which enabled rapid stabilization and destabilization by Shield1. The effects of Vpr on G2 arrest and subsequent apoptosis were reversible. This study is the first to characterize the

EIF3G is associated with narcolepsy across ethnicities.

PubMed

Holm, Anja; Lin, Ling; Faraco, Juliette; Mostafavi, Sara; Battle, Alexis; Zhu, Xiaowei; Levinson, Douglas F; Han, Fang; Gammeltoft, Steen; Jennum, Poul; Mignot, Emmanuel; Kornum, Birgitte R

2015-11-01

Type 1 narcolepsy, an autoimmune disease affecting hypocretin (orexin) neurons, is strongly associated with HLA-DQB1*06:02. Among polymorphisms associated with the disease is single-nucleotide polymorphism rs2305795 (c.*638G>A) located within the P2RY11 gene. P2RY11 is in a region of synteny conserved in mammals and zebrafish containing PPAN, EIF3G and DNMT1 (DNA methyltransferase 1). As mutations in DNMT1 cause a rare dominant form of narcolepsy in association with deafness, cerebellar ataxia and dementia, we questioned whether the association with P2RY11 in sporadic narcolepsy could be secondary to linkage disequilibrium with DNMT1. Based on genome-wide association data from two cohorts of European and Chinese ancestry, we found that the narcolepsy association signal drops sharply between P2RY11/EIF3G and DNMT1, suggesting that the association with narcolepsy does not extend into the DNMT1 gene region. Interestingly, using transethnic mapping, we identified a novel single-nucleotide polymorphism rs3826784 (c.596-260A>G) in the EIF3G gene also associated with narcolepsy. The disease-associated allele increases EIF3G mRNA expression. EIF3G is located in the narcolepsy risk locus and EIF3G expression correlates with PPAN and P2RY11 expression. This suggests shared regulatory mechanisms that might be affected by the polymorphism and are of relevance to narcolepsy.

26 CFR 1.860G-2T - Other rules (temporary).

Code of Federal Regulations, 2013 CFR

2013-04-01

... 26 Internal Revenue 9 2013-04-01 2013-04-01 false Other rules (temporary). 1.860G-2T Section 1.860G-2T Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Real Estate Investment Trusts § 1.860G-2T Other rules (temporary). (a...

26 CFR 1.860G-2T - Other rules (temporary).

Code of Federal Regulations, 2012 CFR

2012-04-01

... 26 Internal Revenue 9 2012-04-01 2012-04-01 false Other rules (temporary). 1.860G-2T Section 1.860G-2T Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Real Estate Investment Trusts § 1.860G-2T Other rules (temporary). (a...

Measuring the performance of G2G services in Iran

NASA Astrophysics Data System (ADS)

Zarei, Behrouz; Safdari, Maryam

To highlight the growth of e-government and the importance of its services it is essential to evaluate the performance of the service delivery to customers. Research indicates that traditional performance indexes are not suitable for this evaluation; moreover, it is noticeable that the e-government services are intangible and invisible. Among different e-government services, measurement of quality government to government (G2G) services has been less attractive for researchers while crucial for government policy-makers. This calls for a better understanding of the specific needs of users of these services in order to provide appropriate type and level of services that meets those needs. In this paper, the performance of the G2G services is measured in the Iranian context. For this purpose, SERVQUAL, which is a well-known method for assessing service quality, is employed. This study proposes and tests a five-factor of SERVQUAL instrument to explain user satisfaction and gap analysis, between expectations and perceptions of its customers, consisting thirty ministries and main governmental organizations. Based on a Chi-square test, factor analysis, gap analysis and correlations, it is concluded the gap between expectations and perceptions of G2G customers is significant and customer satisfaction of G2G services is at low level.

Gunner's Mate G 3 and 2; Rate Training Manual. Revised.

ERIC Educational Resources Information Center

Naval Education and Training Command, Pensacola, FL.

The rate training manual has been prepared for men of the regular Navy and of the Naval Reserve for the purpose of advancement to increase knowledge in the various aspects of the Gunner's Mate rating (G 3 and 2). Chapters 1 through 14 deal with the following topics: the requirements of the Gunner's Mate G Rating, explosives and pyrotechnics,…

4G/5G polymorphism modulates PAI-1 circulating levels in obese women.

PubMed

Fernandes, Karla S; Sandrim, Valéria C

2012-05-01

The increase in plasminogen activator inhibitor type 1 (PAI-1) has been described as a risk factor to thrombosis-related diseases. In addition, it has been demonstrated that the variant 4G of polymorphism 4G/5G located in promoter region of PAI-1 gene is associated with higher PAI-1 levels. We investigate the role of this polymorphism on circulating PAI-1 concentration in a population of 57 obese women (23%, 4G/4G; 49%, 4G/5G and 28%, 5G/5G genotypes). Our results demonstrate a genotype-specific modulation on PAI-1 levels in obese women, thus 5G/5G genotype presented significantly lower levels of plasma PAI-1 when compared to 4G/4G group (46 ± 19 ng/mL vs. 63 ± 13 ng/mL, respectively). Our findings indicate that obese carriers of 4G/4G genotype may have increased risk to develop thrombotic diseases.

High resolution spectral analysis of oxygen. IV. Energy levels, partition sums, band constants, RKR potentials, Franck-Condon factors involving the X{sup 3}Σ{sub g}{sup −}, a{sup 1}Δ{sub g} and b{sup 1}Σ{sub g}{sup +} states

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yu, Shanshan, E-mail: shanshan.yu@jpl.nasa.gov; Drouin, Brian J.; Miller, Charles E.

We have updated the isotopically invariant Dunham fit of O{sub 2} with newly reported literature transitions to derive (1) the energy levels, partition sums, band-by-band molecular constants, and RKR potentials for the X{sup 3}Σ{sub g}{sup −}, a{sup 1}Δ{sub g}, and b{sup 1}Σ{sub g}{sup +} states of the six O{sub 2} isotopologues: {sup 16}O{sup 16}O, {sup 16}O{sup 17}O, {sup 16}O{sup 18}O, {sup 17}O{sup 17}O, {sup 17}O{sup 18}O, and {sup 18}O{sup 18}O; (2) Franck-Condon factors for their a{sup 1}Δ{sub g}−X{sup 3}Σ{sub g}{sup −}, b{sup 1}Σ{sub g}{sup +}−X{sup 3}Σ{sub g}{sup −}, and a{sup 1}Δ{sub g}−b{sup 1}Σ{sub g}{sup +} band systems. This new spectroscopicmore » parameterization characterizes all known transitions within and between the X{sup 3}Σ{sub g}{sup −}, a{sup 1}Δ{sub g}, and b{sup 1}Σ{sub g}{sup +} states within experimental uncertainty and can be used for accurate predictions of as yet unmeasured transitions. All of these results are necessary to provide a consistent linelist of all transitions which will be reported in a followup paper.« less

Plasminogen activator inhibitor-1 4G/5G polymorphism in infertile women with and without endometriosis.

PubMed

Gonçalves-Filho, Rubens P; Brandes, Ariel; Christofolini, Denise M; Lerner, Tatiana G; Bianco, Bianca; Barbosa, Caio P

2011-05-01

To evaluate PAI-1 genotypes in a group of infertile women with or without endometriosis and control subjects. Case-control study. Human Reproduction Center of Medicina do ABC Faculty. One hundred and forty infertile women with endometriosis, 64 women with idiopathic infertility and 148 fertile women as control subjects. The PAI-1 4G/5G polymorphism was identified by restriction fragment length polymorphism-polymerase chain reaction. Genotype distribution and allele frequency of the 4G/5G polymorphism of the PAI-1 gene. The frequencies of genotypes 4G/4G, 4G/5G and 5G/5G of the PAI-1 gene in the infertile women with endometriosis were 38.6, 37.1 and 24.3%, respectively, and in the control group 24.3, 33.8 and 41.9%, respectively (p=0.003). When the infertile women with endometriosis were divided according to their endometriosis stage, genotypes 4G/4G, 4G/5G and 5G/5G were identified, respectively, in 36.7, 32.9 and 30.4% of the patients with minimal/mild endometriosis (p=0.102) and in 41.0, 42.6 and 16.4% of the patients with moderate/severe endometriosis (p=0.001); in the women with idiopathic infertility, these genotypes were found at a frequency of 29.7, 34.3 and 36%, respectively (p=0.637). The data suggest that, in Brazilian women, the PAI-1 4G/5G polymorphism may be associated with a risk of endometriosis-associated infertility. © 2011 The Authors Acta Obstetricia et Gynecologica Scandinavica© 2011 Nordic Federation of Societies of Obstetrics and Gynecology.

Expression of CAR in SW480 and HepG2 cells during G1 is associated with cell proliferation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Osabe, Makoto; Sugatani, Junko; Global COE Program, School of Pharmaceutical Sciences, University of Shizuoka, Shizuoka

Constitutive androstane receptor (CAR) is a transcription factor to regulate the expression of several genes related to drug-metabolism. Here, we demonstrate that CAR protein accumulates during G1 in human SW480 and HepG2 cells. After the G1/S phase transition, CAR protein levels decreased, and CAR was hardly detected in cells by the late M phase. CAR expression in both cell lines was suppressed by RNA interference-mediated suppression of CDK4. Depletion of CAR by RNA interference in both cells and by hepatocyte growth factor treatment in HepG2 cells resulted in decreased MDM2 expression that led to p21 upregulation and repression of HepG2more » cell growth. Thus, our results demonstrate that CAR expression is an early G1 event regulated by CDK4 that contributes to MDM2 expression; these findings suggest that CAR may influence the expression of genes involved in not only the metabolism of endogenous and exogenous substances but also in the cell proliferation.« less

Distances to supernova remnants G20.4 + 0.1, G24.7 - 0.6, and G28.6 - 0.1 and new molecular cloud associations

NASA Astrophysics Data System (ADS)

Ranasinghe, S.; Leahy, D. A.

2018-06-01

Accurate distances to supernova remnants (SNRs) are crucial in determining their size, age, luminosity, and evolutionary state. To determine distances, we chose three SNRs from the VLA (Very Large Array) Galactic Plane Survey for extraction of H I absorption spectra. Analysing H I absorption spectra, 13CO emission spectra, and H I and 13CO channel maps, kinematic velocities (or their limits) to the three SNRs were calculated. The three SNRs are probably associated with molecular clouds and the new distance to G20.4 + 0.1, G24.7 - 0.6, and G28.6 - 0.1 are 7.8 ± 0.5 kpc, 3.8 ± 0.2 kpc, and 9.6 ± 0.3 kpc, respectively.

Microwave Observations and Modeling of O2 (1-delta(sub g)) and O3 Diurnal Variation in the Mesosphere

NASA Technical Reports Server (NTRS)

Sandor, Brad J.; Clancy, R. Todd; Rusch, David W.; Randall, Cora E.; Eckman, Richard S.; Siskind, David S.; Muhleman, Duane O.

1997-01-01

The first microwave measurements of an electronically excited molecular species in the Earth's atmosphere are presented. Local thermodynamic equilibrium (LTE) rotational line emission from mesospheric O2(1-del(sub g)) was observed at a frequency of 255.01794 GHz (lambda is approx. 1.2 mm), employing the National Radio Astronomy Observatory (NRAO) millimeter facility at Kitt Peak, Arizona (32 N, 111 W). The pressure broadened line shapes of the O2(1-del(sub g)) spectra, which were obtained in January and April 1992 and in January and November 1993, are inverted to retrieve O2(1-del(sub g)) mixing profiles over the 50-70 km altitude region. The observed daytime abundances exceed ozone abundances in the lower mesosphere, which are separately retrieved with coincident O3 spectral line (249.7886 GHz) observations. The January and November 1993 observations are binned into 20-60 min time intervals to study O2(1-del(sub g)) diurnal behavior. Derived abundances of O2(1-del(sub g)) between 50 and 70 km for the four observation dates are 9%, 31%, 3%, and 26%, respectively, each +/- 10% higher than predicted, based on the simple photochemistry of lower mesospheric O2(1-del(sub g)). Modeled variation of [O2(1-del(sub g))] with time of day agrees with observed variation in that the observed difference between model and data abundances is constant throughout the daylight hours of each observation date. Model underprediction Of [02(lAg)] is consistent with similar model underprediction of mesospheric [O3]. A perturbation to the photochemical model that forces decreased ozone chemical loss brings brings both model [O3] and [O2(1-del(sub g))] into agreement with the observations. O2(1-del(sub g)) abundances derived from these 1.2 mm observations agree with [O2(1-del(sub g))] values derived from comparable SME observations of the 1.27 micrometers emission, with assumption of a 3880 sec O2(1-del(sub g)) radiative lifetime. The 6800 sec O2(1-del(sub g)) radiative lifetime proposed by

26 CFR 1.402(g)-2 - Increased limit for catch-up contributions.

Code of Federal Regulations, 2012 CFR

2012-04-01

...(g)-2 Section 1.402(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY.... § 1.402(g)-2 Increased limit for catch-up contributions. (a) General rule. Under section 402(g)(1)(C...(g) for a catch-up eligible participant (within the meaning of § 1.414(v)-1(g)), the otherwise...

The extraction of the spin structure function, g2 (and g1) at low Bjorken x

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ndukum, Luwani Z.

2015-08-01

The Spin Asymmetries of the Nucleon Experiment (SANE) used the Continuous Electron Beam Accelerator Facility at Jefferson Laboratory in Newport News, VA to investigate the spin structure of the proton. The experiment measured inclusive double polarization electron asymmetries using a polarized electron beam, scattered off a solid polarized ammonia target with target polarization aligned longitudinal and near transverse to the electron beam, allowing the extraction of the spin asymmetries A1 and A2, and spin structure functions g1 and g2. Polarized electrons of energies of 4.7 and 5.9 GeV were used. The scattered electrons were detected by a novel, non-magnetic arraymore » of detectors observing a four-momentum transfer range of 2.5 to 6.5 GeV*V. This document addresses the extraction of the spin asymmetries and spin structure functions, with a focus on spin structure function, g2 (and g1) at low Bjorken x. The spin structure functions were measured as a function of x and W in four Q square bins. A full understanding of the low x region is necessary to get clean results for SANE and extend our understanding of the kinematic region at low x.« less

Conformational distribution of baclofen analogues by 1H and 13C NMR analysis and ab initio HF MO STO-3G or STO-3G* calculations

NASA Astrophysics Data System (ADS)

Vaccher, Claude; Berthelot, Pascal; Debaert, Michel; Vermeersch, Gaston; Guyon, René; Pirard, Bernard; Vercauteren, Daniel P.; Dory, Magdalena; Evrard, Guy; Durant, François

1993-12-01

The conformations of 3-(substituted furan-2-yl) and 3-(substituted thien-2-yl)-γ-aminobutyric acid 1-9 in solution (D 2O) are estimated from high-resolution (300 MHz) 1H NMR coupling data. Conformations and populations of conformers are calculated by means of a modified Karplus-like relationship for the vicinal coupling constants. The results are compared with X-ray crystallographic investigations (torsion angles) and ab initio HF MO ST-3G or STO-3G* calculations. 1H NMR spectral analysis shows how 1-9 in solution retain the preferred g- conformation around the C3C4 bond, as found in the solid state, while a partial rotation is set up around the C2C3 bond: the conformations about C2C3 are all highly populated in solution. The 13C spin-lattice relaxation times are also discussed.

26 CFR 1.402(g)-2 - Increased limit for catch-up contributions.

Code of Federal Regulations, 2013 CFR

2013-04-01

....402(g)-2 Section 1.402(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY.... § 1.402(g)-2 Increased limit for catch-up contributions. (a) General rule. Under section 402(g)(1)(C...(g) for a catch-up eligible participant (within the meaning of § 1.414(v)-1(g)), the otherwise...

26 CFR 1.402(g)-2 - Increased limit for catch-up contributions.

Code of Federal Regulations, 2011 CFR

2011-04-01

....402(g)-2 Section 1.402(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY.... § 1.402(g)-2 Increased limit for catch-up contributions. (a) General rule. Under section 402(g)(1)(C...(g) for a catch-up eligible participant (within the meaning of § 1.414(v)-1(g)), the otherwise...

26 CFR 1.402(g)-2 - Increased limit for catch-up contributions.

Code of Federal Regulations, 2014 CFR

2014-04-01

....402(g)-2 Section 1.402(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY.... § 1.402(g)-2 Increased limit for catch-up contributions. (a) General rule. Under section 402(g)(1)(C...(g) for a catch-up eligible participant (within the meaning of § 1.414(v)-1(g)), the otherwise...

The Plasminogen Activator Inhibitor 1 4G/5G Polymorphism and the Risk of Alzheimer's Disease.

PubMed

Fekih-Mrissa, Najiba; Mansour, Malek; Sayeh, Aicha; Bedoui, Ines; Mrad, Meriem; Riahi, Anis; Mrissa, Ridha; Nsiri, Brahim

2017-09-01

The aim of this study was to determine whether plasminogen activator inhibitor 1 (PAI-1) is associated with the risk of Alzheimer's disease (AD) in Tunisian patients. We analyzed the genotype and allele frequency distribution of the PAI-1 polymorphism in 60 Tunisian patients with AD and 120 healthy controls. The results show a significantly increased risk of AD in carriers of the 4G/4G and 4G/5G genotypes versus the wild-type 5G/5G genotype (4G/4G: 28.33% in patients vs 10.0% in controls; P < 10 -3 ; OR = 8.78; 4G/5G: 55.0% in patients vs 38.33% in controls; OR = 4.45; P < 10 -3 ). The 4G allele was also more frequently found in patients compared with controls; P < 10 -3 ; OR = 3.07. For all participants and by gender, homozygotic carriers (4G/4G) were at an increased risk of AD over heterozygotes and women were at an increased risk over their male genotype counterparts. The odds ratio for AD among 4G/4G carriers for any group was approximately twice that of heterozygotes in the same group. Women homozygotes ranked highest for AD risk (OR = 20.8) and, in fact, women heterozygotes (OR = 9.03) ranked higher for risk than male homozygotes (OR = 6.12). These preliminary exploratory results should be confirmed in a larger study.

[G894T (NOS3) and G1958A (MTHFD1) gene polymorphisms and risk of ischemic heart disease in Yucatan, Mexico].

PubMed

García-González, Igrid; Solís-Cárdenas, Alberto de Jesús; Flores-Ocampo, Jorge A; Alejos-Mex, Ricardo; Herrera-Sánchez, Luis Fernando; González-Herrera, Lizbeth Josefina

2015-01-01

Cardiovascular medicine is focused on the search for genetic risk markers with predictive and/or prognostic value. Among the genetic variants of interest are G894T endothelial nitric oxide synthase and G1958A methylenetetrahydrofolate dehydrogenase1 gene polymorphisms. The aim of this study was to determine the possible association between these polymorphisms and ischemic heart disease in patients from Southern of Mexico (Yucatán). Case-control study matched by age, sex and origin was designed. We studied 98 patients with coronary disease and 101 controls. Participants were evaluated for the usual risk factors. The polymorphisms were identified using the polymerase chain reaction/restriction fragment length polymorphism analysis. Informed consent was obtained from all participants. The G894T and G1958A polymorphisms were not associated with ischemic heart disease, however, the TT genotype (G894T) was associated with the angina (OR=10.2; 95%CI, 1.51-68.8; p=0.025). The genotype GT (G894T) was the most frequent in patients with family history of coronary artery disease. Multiple logistic regression analysis identified smoking (OR=5.21; 95%CI, 2.1-12.9; p=0.000), hypertension (OR=3.54; 95%CI, 1.47-8.56; p=0.005) and obesity (OR=1.16; 95%CI, 1.1-1.27; p=0.001) as risk factors predicting the ischemic heart disease. The G894T and G1958A polymorphisms showed not association with ischemic heart disease. However, homozygosis for the 894T allele (NOS3) confers at risk to develop angina on Yucatán. Copyright © 2014 Sociedad Española de Arteriosclerosis. Published by Elsevier España. All rights reserved.

Vasoconstriction induced by G1, a G-protein-coupled oestrogen receptor1 (GPER-1) agonist, in the isolated perfused rat kidney.

PubMed

Kurt, Akif Hakan; Buyukafsar, Kansu

2013-02-28

Vascular effects of the G protein-coupled oestrogen receptor1 (GPER-1) agonist, G1 (10(-7)-5×10(-6) M), the main oestrogenic hormone, 17β-estradiol (10(-9)-10(-4) M), the NR3A1 agonist, PPT (10(-8)-10(-5) M), the NR3A2 agonist DPN (10(-8)-10(-5) M), and the classical oestrogen receptor blocker but also a GPER agonist, ICI-182780 (10(-8)-3×10(-6) M), were investigated on the perfusion pressure in the isolated rat kidney. To seek cellular mechanisms involved in GPER-1-induced signalling we tested several compounds including the inhibitors of Rho-kinase (ROCK) (Y-27632), tyrosine kinase (genistein), p38MAPK (SB203580), p44/42MAPK (PD98059), protein kinase C (PKC) (GF109203X), Jun-kinase (JNK) (SP600125), phosphatidylinositol-3-kinase (PI3K) (LY294002), Ca(2+) channels (nifedipine), GPER-1 (G15) and epidermal growth factor (EGF) receptor kinase (AG-1478). Moreover, the effect of saponin (50mg/ml) that was used for endothelium removal was explored on G1-elicited vascular action. G1, 17β-estradiol and ICI-182780 but not PPT and DPN induced vasoconstrictions in basal renal perfusion pressure. In contrast, G1 promoted vasodilatation when the perfusion pressure was elevated in advance by phenylephrine. G1-elicited vasoconstriction was not modified by endothelial removal; however, it was markedly inhibited by GPER-1 antagonist, G15. The vasoconstrictor response to G1 was also significantly attenuated by Y-27632, PD98059, SB203580, GF109203X, genistein, AG-1478, and nifedipine, but not LY294002 and SP600125. Western blotting indicated the expression of GPER-1 in renal artery, medulla and cortex of rat kidney. In conclusion, GPER-1 could substantially modulate vascular responses through a variety of signalling pathways including ROCK, PKC, p38 MAPK, p42/44 MAPK, tyrosine kinase, EGF receptor kinase and VOCC but not JNK or PI3K in isolated perfused rat kidney. Copyright © 2013 Elsevier B.V. All rights reserved.

Quark-hadron duality in spin structure functions g1p and g1d

NASA Astrophysics Data System (ADS)

Bosted, P. E.; Dharmawardane, K. V.; Dodge, G. E.; Forest, T. A.; Kuhn, S. E.; Prok, Y.; Adams, G.; Amarian, M.; Ambrozewicz, P.; Anghinolfi, M.; Asryan, G.; Avakian, H.; Bagdasaryan, H.; Baillie, N.; Ball, J. P.; Baltzell, N. A.; Barrow, S.; Batourine, V.; Battaglieri, M.; Beard, K.; Bedlinskiy, I.; Bektasoglu, M.; Bellis, M.; Benmouna, N.; Biselli, A. S.; Bonner, B. E.; Bouchigny, S.; Boiarinov, S.; Bradford, R.; Branford, D.; Brooks, W. K.; Bültmann, S.; Burkert, V. D.; Butuceanu, C.; Calarco, J. R.; Careccia, S. L.; Carman, D. S.; Carnahan, B.; Cazes, A.; Chen, S.; Cole, P. L.; Collins, P.; Coltharp, P.; Cords, D.; Corvisiero, P.; Crabb, D.; Crannell, H.; Crede, V.; Cummings, J. P.; Masi, R. De; Devita, R.; Sanctis, E. De; Degtyarenko, P. V.; Denizli, H.; Dennis, L.; Deur, A.; Djalali, C.; Donnelly, J.; Doughty, D.; Dragovitsch, P.; Dugger, M.; Dytman, S.; Dzyubak, O. P.; Egiyan, H.; Egiyan, K. S.; Elouadrhiri, L.; Eugenio, P.; Fatemi, R.; Fedotov, G.; Feuerbach, R. J.; Funsten, H.; Garçon, M.; Gavalian, G.; Gilfoyle, G. P.; Giovanetti, K. L.; Girod, F. X.; Goetz, J. T.; Golovatch, E.; Gonenc, A.; Gothe, R. W.; Griffioen, K. A.; Guidal, M.; Guillo, M.; Guler, N.; Guo, L.; Gyurjyan, V.; Hadjidakis, C.; Hafidi, K.; Hakobyan, R. S.; Hardie, J.; Heddle, D.; Hersman, F. W.; Hicks, K.; Hleiqawi, I.; Holtrop, M.; Huertas, M.; Hyde-Wright, C. E.; Ilieva, Y.; Ireland, D. G.; Ishkhanov, B. S.; Isupov, E. L.; Ito, M. M.; Jenkins, D.; Jo, H. S.; Joo, K.; Juengst, H. G.; Keith, C.; Kellie, J. D.; Khandaker, M.; Kim, K. Y.; Kim, K.; Kim, W.; Klein, A.; Klein, F. J.; Klusman, M.; Kossov, M.; Kramer, L. H.; Kubarovsky, V.; Kuhn, J.; Kuleshov, S. V.; Lachniet, J.; Laget, J. M.; Langheinrich, J.; Lawrence, D.; Li, Ji; Lima, A. C. S.; Livingston, K.; Lu, H.; Lukashin, K.; MacCormick, M.; Manak, J. J.; Markov, N.; McAleer, S.; McKinnon, B.; McNabb, J. W. C.; Mecking, B. A.; Mestayer, M. D.; Meyer, C. A.; Mibe, T.; Mikhailov, K.; Minehart, R.; Mirazita, M.; Miskimen, R.; Mokeev, V.; Morand, L.; Morrow, S. A.; Moteabbed, M.; Mueller, J.; Mutchler, G. S.; Nadel-Turonski, P.; Napolitano, J.; Nasseripour, R.; Niccolai, S.; Niculescu, G.; Niculescu, I.; Niczyporuk, B. B.; Niroula, M. R.; Niyazov, R. A.; Nozar, M.; O'Rielly, G. V.; Osipenko, M.; Ostrovidov, A. I.; Park, K.; Pasyuk, E.; Paterson, C.; Philips, S. A.; Pierce, J.; Pivnyuk, N.; Pocanic, D.; Pogorelko, O.; Polli, E.; Pozdniakov, S.; Preedom, B. M.; Price, J. W.; Protopopescu, D.; Qin, L. M.; Raue, B. A.; Riccardi, G.; Ricco, G.; Ripani, M.; Ronchetti, F.; Rosner, G.; Rossi, P.; Rowntree, D.; Rubin, P. D.; Sabatié, F.; Salgado, C.; Santoro, J. P.; Sapunenko, V.; Schumacher, R. A.; Serov, V. S.; Sharabian, Y. G.; Shaw, J.; Shvedunov, N. V.; Skabelin, A. V.; Smith, E. S.; Smith, L. C.; Sober, D. I.; Stavinsky, A.; Stepanyan, S. S.; Stepanyan, S.; Stokes, B. E.; Stoler, P.; Strauch, S.; Suleiman, R.; Taiuti, M.; Taylor, S.; Tedeschi, D. J.; Thoma, U.; Thompson, R.; Tkabladze, A.; Tkachenko, S.; Todor, L.; Tur, C.; Ungaro, M.; Vineyard, M. F.; Vlassov, A. V.; Weinstein, L. B.; Weygand, D. P.; Williams, M.; Wolin, E.; Wood, M. H.; Yegneswaran, A.; Yun, J.; Zana, L.; Zhang, J.; Zhao, B.; Zhao, Z.

2007-03-01

New measurements of the spin structure functions of the proton and deuteron g1p(x,Q2) and g1d(x,Q2) in the nucleon resonance region are compared with extrapolations of target-mass-corrected next-to-leading-order (NLO) QCD fits to higher energy data. Averaged over the entire resonance region (W<2 GeV), the data and QCD fits are in good agreement in both magnitude and Q2 dependence for Q2>1.7 GeV2/c2. This “global” duality appears to result from cancellations among the prominent “local” resonance regions: in particular strong σ3/2 contributions in the Δ(1232) region appear to be compensated by strong σ1/2 contributions in the resonance region centered on 1.5 GeV. These results are encouraging for the extension of NLO QCD fits to lower W and Q2 than have been used previously.

Chemical synthesis of 5'-pyrophosphate and triphosphate derivatives of 3'-5' ApA, ApG, GpA and GpG. CD study of the effect of 5'-phosphate groups on the conformation of 3'-5' GpG.

PubMed Central

Tomasz, J; Simoncsits, A; Kajtár, M; Krug, R M; Shatkin, A J

1978-01-01

A simple, two-step method is described for the synthesis of the 5'-pyro- and triphosphate derivatives of 3'-5' ApA, ApG, GpA and GpG. The readily accessible 2'(3')-5' ApA, ApG, GpA and GpG were converted in one step to the corresponding 5'-phosphoramidate derivatives which were then transformed to the 5'-pyro- and triphosphates. CD spectra of 3'-5' pn GpG (n = 0,1,2 or 3) derivatives, measured at pH 1, indicated stabilization of the (syn) G+p (anti)G conformation by the 5'-phosphate groups. PMID:211490

Unconventionally prepared TiO2/g-C3N4 photocatalysts for photocatalytic decomposition of nitrous oxide

NASA Astrophysics Data System (ADS)

Troppová, Ivana; Šihor, Marcel; Reli, Martin; Ritz, Michal; Praus, Petr; Kočí, Kamila

2018-02-01

The TiO2/g-C3N4 nanocomposites with the various TiO2:g-C3N4 weight ratios from 1:1 to 1:3 were prepared unconventionally by pressurized hot water processing in a flow regime. The parent TiO2 and g-C3N4 was prepared by thermal hydrolysis and thermal annealing, respectively. The nanocomposites as well as parent TiO2 and g-C3N4 were characterized using several complementary characterization methods and investigated in the photocatalytic decomposition of N2O under UVA (λ = 365 nm) irradiation. All the prepared TiO2/g-C3N4 nanocomposites showed higher photocatalytic activity in comparison with the pure g-C3N4 and chiefly pure TiO2. The photocatalytic activity of TiO2/g-C3N4 nanocomposites was decreasing in the following sequence: TiO2/g-C3N4 (1:3) > TiO2/g-C3N4 (1:2) > TiO2/g-C3N4 (1:1). In comparison with the parent TiO2 or g-C3N4, the TiO2/g-C3N4 nanocomposites' photocatalytic capability was significantly enhanced by coupling TiO2 with g-C3N4. The generation of TiO2/g-C3N4 Z-scheme photocatalyst mainly benefited from the effective separation of photoinduced electron-hole pairs and the extended optical absorption range. The TiO2/g-C3N4 (1:3) nanocomposite showed the best photocatalytic behavior in a consequence of the optimal weight ratio of TiO2:g-C3N4 and the lowest band gap energy from all nanocomposites. The N2O conversion in its presence was 70.6% after 20 h of UVA irradiation.

Key technologies and concepts for beyond-3G networks

NASA Astrophysics Data System (ADS)

Pehkonen, Kari; Uskela, Sami; Kalliojarvi, Kari; Oksanen, Lauri; Rikkinen, Kari

2001-10-01

Standardization of 3rd Generation (3G) mobile communication systems has produced the first specification releases and the commercial deployment of the 3G systems has started. Whereas 1G and 2G focused on efficiently providing voice services, in 3G a lot of attention has been devoted to solutions that support both Circuit Switched (CS) and Packet Switched (PS) communication. That has called for very flexible air interface and network solutions. 3G will continue to evolve and there are already on-going standardization activities that will, for example, boost the peak data rates up to 5-10 Mbps and improve spectral efficiency by 2-4 times. In the future, 3G evolution will be going towards 10/100 Mbps peak data rates in wide/local are coverage, respectively. This will take place partly because of technical improvements of 3G radio interface solutions, but also due to network evolution which will allow the integration other radio access methods like radio LANs into the 3G system. In longer term the 3G network evolution will be going towards ALL-IP networks. As 3G evolution seems to be going towards 10 Mbps/100 Mbps peak data rates and ALL-IP networks any beyond 3G air interface or network solution should be clearly better in order to justify its technical and commercial feasibility. Given the long evolution time of 3G and integration of other radio access schemes with 3G radio we may not even see a new, complete beyond 3G system being developed. Maybe we will just witness the emergence of a new, more advanced radio access solution which will then be connected to the evolving 3G network. As 3G evolution will continue for several years to come the research targets for any beyond 3G solutions must be set very high. When it comes to air interface, we should aim at 100 Mbps peak data rates for wide area access with high mobility, and at 1 Gbps for local area access with low mobility. Regarding possible commercial launches of any beyond 3G systems or solutions they could then

The G protein Gi1 exhibits basal coupling but not preassembly with G protein-coupled receptors.

PubMed

Bondar, Alexey; Lazar, Josef

2017-06-09

The G i/o protein family transduces signals from a diverse group of G protein-coupled receptors (GPCRs). The observed specificity of G i/o -GPCR coupling and the high rate of G i/o signal transduction have been hypothesized to be enabled by the existence of stable associates between G i/o proteins and their cognate GPCRs in the inactive state (G i/o -GPCR preassembly). To test this hypothesis, we applied the recently developed technique of two-photon polarization microscopy (2PPM) to Gα i1 subunits labeled with fluorescent proteins and four GPCRs: the α 2A -adrenergic receptor, GABA B , cannabinoid receptor type 1 (CB 1 R), and dopamine receptor type 2. Our experiments with non-dissociating mutants of fluorescently labeled Gα i1 subunits (exhibiting impaired dissociation from activated GPCRs) showed that 2PPM is capable of detecting GPCR-G protein interactions. 2PPM experiments with non-mutated fluorescently labeled Gα i1 subunits and α 2A -adrenergic receptor, GABA B , or dopamine receptor type 2 receptors did not reveal any interaction between the G i1 protein and the non-stimulated GPCRs. In contrast, non-stimulated CB 1 R exhibited an interaction with the G i1 protein. Further experiments revealed that this interaction is caused solely by CB 1 R basal activity; no preassembly between CB 1 R and the G i1 protein could be observed. Our results demonstrate that four diverse GPCRs do not preassemble with non-active G i1 However, we also show that basal GPCR activity allows interactions between non-stimulated GPCRs and G i1 (basal coupling). These findings suggest that G i1 interacts only with active GPCRs and that the well known high speed of GPCR signal transduction does not require preassembly between G proteins and GPCRs. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Meta-analysis of the association between plasminogen activator inhibitor-1 4G/5G polymorphism and recurrent pregnancy loss.

PubMed

Li, Xuejiao; Liu, Yukun; Zhang, Rui; Tan, Jianping; Chen, Libin; Liu, Yinglin

2015-04-11

The association between plasminogen activator inhibitor-1 (PAI-1) 4G/5G polymorphism and recurrent pregnancy loss (RPL) risk is still contradictory. We thus performed a meta-analysis. Relevant studies were searched for in PubMed, Web of Science, Embase, and Cochrane Library. An odds ratio (OR) with a 95% confidence interval (CI) was used to assess the association between PAI-1 4G/5G polymorphism and RPL risk. A total of 22 studies with 4306 cases and 3076 controls were included in this meta-analysis. We found that PAI-1 4G/5G polymorphism was significantly associated with an increased RPL risk (OR=1.89; 95% CI 1.34-2.67; P=0.0003). In the subgroup analysis by race, PAI-1 4G/5G polymorphism was significantly associated with an increased RPL risk in Caucasians (OR=2.23; 95% CI 1.44-3.46; P=0.0003). However, no significant association was observed in Asians (OR=1.47; 95% CI 0.84-2.59; P=0.18). In conclusion, this meta-analysis suggests that PAI-1 4G/5G polymorphism might be associated with RPL development in Caucasians.

Liposomal gD Ectodomain (gD1-306) Vaccine Protects Against HSV2 Genital or Rectal Infection of Female and Male Mice

PubMed Central

Olson, K.; Macias, P.; Hutton, S.; Ernst, W. A.; Fujii, G.; Adler-Moore, J. P.

2009-01-01

Herpes simplex virus type 2 (HSV2) is the most common causative agent of genital herpes, with infection rates as high as 1 in 6 adults. The present studies were done to evaluate the efficacy of a liposomal HSV2 gD1-306 vaccine (L-gD1-306-HD) in an acute murine HSV2 infection model of intravaginal (female) or intrarectal (male or female) challenge. Two doses of L-gD1-306-HD containing 60μg gD1-306-HD and 15μg monophosphoryl lipid A (MPL) per dose provided protection against HSV2 intravaginal challenge (86-100% survival, P≤0.0003 vs control liposomes; P=0.06 vs L-gD1-306-HD without MPL). Both male and female mice (BALB/c and C57BL/6) immunized with L-gD1-306-HD/MPL were significantly protected against HSV2 intrarectal challenge, with higher survival rates compared to controls (71-100%, P≤0.007). L-gD1-306-HD/MPL also provided increased survival when compared to a liposomal peptide vaccine, L-gD264-285-HD/MPL (male BALB/c, P≤0.001; female BALB/c and male C57BL/6, P=0.06). Mice given L-gD1-306-HD/MPL also had minimal disease signs, reduced viral burden in their spinal cords and elevated neutralizing antibody titers in the females. The vaccine also stimulated gD1-306-HD specific splenocytes of both male and female mice with significantly elevated levels of IFN-γ compared to IL-4 (P≤0.01) indicating that there was an enhanced Th1 response. These results provide the first evidence that the L-gD1-306–HD vaccine can protect both male and female mice against intrarectal HSV2 challenge. PMID:19835825

ALS mutant SOD1 interacts with G3BP1 and affects stress granule dynamics.

PubMed

Gal, Jozsef; Kuang, Lisha; Barnett, Kelly R; Zhu, Brian Z; Shissler, Susannah C; Korotkov, Konstantin V; Hayward, Lawrence J; Kasarskis, Edward J; Zhu, Haining

2016-10-01

Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disease. Mutations in Cu/Zn superoxide dismutase (SOD1) are responsible for approximately 20 % of the familial ALS cases. ALS-causing SOD1 mutants display a gain-of-toxicity phenotype, but the nature of this toxicity is still not fully understood. The Ras GTPase-activating protein-binding protein G3BP1 plays a critical role in stress granule dynamics. Alterations in the dynamics of stress granules have been reported in several other forms of ALS unrelated to SOD1. To our surprise, the mutant G93A SOD1 transgenic mice exhibited pathological cytoplasmic inclusions that co-localized with G3BP1-positive granules in spinal cord motor neurons. The co-localization was also observed in fibroblast cells derived from familial ALS patient carrying SOD1 mutation L144F. Mutant SOD1, unlike wild-type SOD1, interacted with G3BP1 in an RNA-independent manner. Moreover, the interaction is specific for G3BP1 since mutant SOD1 showed little interaction with four other RNA-binding proteins implicated in ALS. The RNA-binding RRM domain of G3BP1 and two particular phenylalanine residues (F380 and F382) are critical for this interaction. Mutant SOD1 delayed the formation of G3BP1- and TIA1-positive stress granules in response to hyperosmolar shock and arsenite treatment in N2A cells. In summary, the aberrant mutant SOD1-G3BP1 interaction affects stress granule dynamics, suggesting a potential link between pathogenic SOD1 mutations and RNA metabolism alterations in ALS.

Meta-Analysis of the Association between Plasminogen Activator Inhibitor-1 4G/5G Polymorphism and Recurrent Pregnancy Loss

PubMed Central

Li, Xuejiao; Liu, Yukun; Zhang, Rui; Tan, Jianping; Chen, Libin; Liu, Yinglin

2015-01-01

Background The association between plasminogen activator inhibitor-1 (PAI-1) 4G/5G polymorphism and recurrent pregnancy loss (RPL) risk is still contradictory. We thus performed a meta-analysis. Material/Methods Relevant studies were searched for in PubMed, Web of Science, Embase, and Cochrane Library. An odds ratio (OR) with a 95% confidence interval (CI) was used to assess the association between PAI-1 4G/5G polymorphism and RPL risk. Results A total of 22 studies with 4306 cases and 3076 controls were included in this meta-analysis. We found that PAI-1 4G/5G polymorphism was significantly associated with an increased RPL risk (OR=1.89; 95% CI 1.34–2.67; P=0.0003). In the subgroup analysis by race, PAI-1 4G/5G polymorphism was significantly associated with an increased RPL risk in Caucasians (OR=2.23; 95% CI 1.44–3.46; P=0.0003). However, no significant association was observed in Asians (OR=1.47; 95% CI 0.84–2.59; P=0.18). Conclusions In conclusion, this meta-analysis suggests that PAI-1 4G/5G polymorphism might be associated with RPL development in Caucasians. PMID:25862335

Plasminogen activator inhibitor-1 5G/5G genotype is a protecting factor preventing posttransplant diabetes mellitus.

PubMed

Chang, Horng-Rong; Yang, Shun-Fa; Tsai, Jen-Pi; Hsieh, Ming-Chia; Wu, Sheng-Wen; Tsai, Hui-Ching; Hung, Tung-Wei; Huang, Jun-Huang; Lian, Jong-Da

2011-01-30

Plasminogen activator inhibitor 1 (PAI-1) is thought to play a role in the pathogenesis of obesity and insulin resistance. A connection between gestational diabetes mellitus and the functional -675 PAI-1 genotype has been reported. Therefore, we examined the role of the PAI-1 gene polymorphism in kidney transplant recipients. A total of 376 kidney transplant recipients were prospectively screened for posttransplant diabetes mellitus (PTDM). Eighty-one (21.5%) patients were diagnosed with PTDM and the other 295 patients were non-diabetic following kidney transplantation. DNA samples were isolated from the sera and analyzed for the functional -675 4G/5G promoter polymorphisms of the PAI-1 gene. Kidney transplant recipients with PTDM were significantly associated with tacrolimus use (p=0.03), older age (p=0.036), and higher body mass index (p=0.001). The genotype distribution was significantly different between the patients with PTDM (genotype 4G/4G:4G/5G:5G/5G=33.3%:60.5%:6.2%) and those without PTDM (genotype 4G/4G:4G/5G:5G/5G=36.9%:44.1%:19.0%) (p=0.018). Patients with homozygosity for 5G had a significantly lower rate of PTDM (aOR, 0.286, p=0.022) and higher cumulative event-free probability of time to PTDM (log rank test, p=0.0058). Homozygosity for the 5G allele of the PAI-1 gene constitutes a protecting factor for the development of PTDM. Our findings are similar to a previous study on gestational diabetes mellitus, and strongly support a possible genetic role of PAI-1 in the development of PTDM. Copyright © 2010 Elsevier B.V. All rights reserved.

Photocatalytic decomposition of N2O over TiO2/g-C3N4 photocatalysts heterojunction

NASA Astrophysics Data System (ADS)

Kočí, K.; Reli, M.; Troppová, I.; Šihor, M.; Kupková, J.; Kustrowski, P.; Praus, P.

2017-02-01

TiO2/g-C3N4 photocatalysts with the various TiO2/g-C3N4 weight ratios from 1:2 to 1:6 were fabricated by mechanical mixing in water suspension followed by calcination. Pure TiO2 was prepared by thermal hydrolysis and pure g-C3N4 was prepared from commercial melamine by thermal annealing at 620 °C. All the nanocomposites were characterized by X-ray powder diffraction, UV-vis diffuse reflectance spectroscopy, Raman spectroscopy, infrared spectroscopy, scanning electron microscopy, transmission electron microscopy, photoelectrochemical measurements and nitrogen physisorption. The prepared mixtures along with pure TiO2 and g-C3N4 were tested for the photocatalytic decomposition of nitrous oxide under UVC (λ = 254 nm), UVA (λ = 365 nm) and Vis (λ > 400 nm) irradiation. The TiO2/g-C3N4 nanocomposites showed moderate improvement compared to pure g-C3N4 but pure TiO2 proved to be a better photocatalyst under UVC irradiation. However, under UVA irradiation conditions, the photocatalytic activity of TiO2/g-C3N4 (1:2) nanocomposite exhibited an increase compared to pure TiO2. Nevertheless, further increase of g-C3N4 amount leads/led to a decrease in reactivity. These results are suggesting the nanocomposite with the optimal weight ratio of TiO2 and g-C3N4 have shifted absorption edge energy towards longer wavelengths and decreased the recombination rate of charge carriers compared to pure g-C3N4. This is probably due to the generation of heterojunction on the TiO2/g-C3N4 interface.

Effects of 2G and 3G mobile phones on human alpha rhythms: Resting EEG in adolescents, young adults, and the elderly.

PubMed

Croft, R J; Leung, S; McKenzie, R J; Loughran, S P; Iskra, S; Hamblin, D L; Cooper, N R

2010-09-01

The present study was conducted to determine whether adolescents and/or the elderly are more sensitive to mobile phone (MP)-related bioeffects than young adults, and to determine this for both 2nd generation (2G) GSM, and 3rd generation (3G) W-CDMA exposures. To test this, resting alpha activity (8-12 Hz band of the electroencephalogram) was assessed because numerous studies have now reported it to be enhanced by MP exposure. Forty-one 13-15 year olds, forty-two 19-40 year olds, and twenty 55-70 year olds were tested using a double-blind crossover design, where each participant received Sham, 2G and 3G exposures, separated by at least 4 days. Alpha activity, during exposure relative to baseline, was recorded and compared between conditions. Consistent with previous research, the young adults' alpha was greater in the 2G compared to Sham condition, however, no effect was seen in the adolescent or the elderly groups, and no effect of 3G exposures was found in any group. The results provide further support for an effect of 2G exposures on resting alpha activity in young adults, but fail to support a similar enhancement in adolescents or the elderly, or in any age group as a function of 3G exposure. 2010 Wiley-Liss, Inc.

26 CFR 1.149(g)-1 - Hedge bonds.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 26 Internal Revenue 2 2012-04-01 2012-04-01 false Hedge bonds. 1.149(g)-1 Section 1.149(g)-1...) INCOME TAXES (CONTINUED) Tax Exemption Requirements for State and Local Bonds § 1.149(g)-1 Hedge bonds... for purposes of section 149(g) and this section. In addition, the following terms have the following...

26 CFR 1.149(g)-1 - Hedge bonds.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 26 Internal Revenue 2 2014-04-01 2014-04-01 false Hedge bonds. 1.149(g)-1 Section 1.149(g)-1...) INCOME TAXES (CONTINUED) Tax Exemption Requirements for State and Local Bonds § 1.149(g)-1 Hedge bonds... for purposes of section 149(g) and this section. In addition, the following terms have the following...

26 CFR 1.149(g)-1 - Hedge bonds.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 26 Internal Revenue 2 2011-04-01 2011-04-01 false Hedge bonds. 1.149(g)-1 Section 1.149(g)-1...) INCOME TAXES (CONTINUED) Tax Exemption Requirements for State and Local Bonds § 1.149(g)-1 Hedge bonds... for purposes of section 149(g) and this section. In addition, the following terms have the following...

26 CFR 1.149(g)-1 - Hedge bonds.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 26 Internal Revenue 2 2013-04-01 2013-04-01 false Hedge bonds. 1.149(g)-1 Section 1.149(g)-1...) INCOME TAXES (CONTINUED) Tax Exemption Requirements for State and Local Bonds § 1.149(g)-1 Hedge bonds... for purposes of section 149(g) and this section. In addition, the following terms have the following...

26 CFR 1.149(g)-1 - Hedge bonds.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 26 Internal Revenue 2 2010-04-01 2010-04-01 false Hedge bonds. 1.149(g)-1 Section 1.149(g)-1...) INCOME TAXES (CONTINUED) Tax Exemption Requirements for State and Local Bonds § 1.149(g)-1 Hedge bonds... for purposes of section 149(g) and this section. In addition, the following terms have the following...

Semaphorin 3G Provides a Repulsive Guidance Cue to Lymphatic Endothelial Cells via Neuropilin-2/PlexinD1.

PubMed

Liu, Xinyi; Uemura, Akiyoshi; Fukushima, Yoko; Yoshida, Yutaka; Hirashima, Masanori

2016-11-22

The vertebrate circulatory system is composed of closely related blood and lymphatic vessels. It has been shown that lymphatic vascular patterning is regulated by blood vessels during development, but its molecular mechanisms have not been fully elucidated. Here, we show that the artery-derived ligand semaphorin 3G (Sema3G) and the endothelial cell receptor PlexinD1 play a role in lymphatic vascular patterning. In mouse embryonic back skin, genetic inactivation of Sema3G or PlexinD1 results in abnormal artery-lymph alignment and reduced lymphatic vascular branching. Conditional ablation in mice demonstrates that PlexinD1 is primarily required in lymphatic endothelial cells (LECs). In vitro analyses show that Sema3G binds to neuropilin-2 (Nrp2), which forms a receptor complex with PlexinD1. Sema3G induces cell collapse in an Nrp2/PlexinD1-dependent manner. Our findings shed light on a molecular mechanism by which LECs are distributed away from arteries and form a branching network during lymphatic vascular development. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

Osthole induces G2/M cell cycle arrest and apoptosis in human hepatocellular carcinoma HepG2 cells.

PubMed

Chao, Xu; Zhou, Xiaojun; Zheng, Gang; Dong, Changhu; Zhang, Wei; Song, Xiaomei; Jin, Tianbo

2014-05-01

Osthole [7-methoxy-8-(3-methyl-2-butenyl) coumarin] isolated from the fruit of Cnidium monnieri (L.) Cuss, one of the commonly used Chinese medicines listed in the Shennong's Classic of Materia Medica in the Han Dynasty, had remarkable antiproliferative activity against human hepatocellular carcinoma HepG2 cells in culture. This study evaluated the effects of osthole on cell growth, nuclear morphology, cell cycle distribution, and expression of apoptosis-related proteins in HepG2 cells. Cytotoxic activity of osthole was determined by the MTT assay at various concentrations ranging from 0.004 to 1.0 µmol/ml in HepG2 cells. Cell morphology was assessed by Hoechst staining and fluorescence microscopy. Apoptosis and cell-cycle distribution was determined by annexin V staining and flow cytometry. Apoptotic protein levels were assessed by Western blot. Osthole exhibited significant inhibition of the survival of HepG2 cells and the half inhibitory concentration (IC₅₀) values were 0.186, 0.158 and 0.123 µmol/ml at 24, 48 and 72 h, respectively. Cells treated with osthole at concentrations of 0, 0.004, 0.02, 0.1 and 0.5 μmol/ml showed a statistically significant increase in the G2/M fraction accompanied by a decrease in the G0/G1 fraction. The increase of apoptosis induced by osthole was correlated with down-regulation expression of anti-apoptotic Bcl-2 protein and up-regulation expression of pro-apoptotic Bax and p53 proteins. Osthole had significant growth inhibitory activity and the pro-apoptotic effect of osthole is mediated through the activation of caspases and mitochondria in HepG2 cells. Results suggest that osthole has promising therapeutic potential against hepatocellular carcinoma.

[PAL-1 5G/4G polymorphism in patients with systemic lupus erythematosus].

PubMed

Savov, A; Andonova, S; Tanev, D; Robeva, R; Marincheva, Ts; Tomova, A; Kumanov, Ph; Rashkov, R; Kolarov, Zl

2014-01-01

Systemic lupus erythematosus (SLE) is a connective tissue disease affecting predominantly women that has been widely associated with obstetric complications. Inherited thrombophilias are significant risk factors for pregnancy loss, but their role in patients with SLE, and especially in those without concomitant secondary antiphospholipid syndrome (APS) has not been clarified. The aim of the present study was to study PAI-1 5G/4G polymorphism in women with lupus. A total of 103 SLE patients as well as 69 healthy volunteers were genotyped for PAI-1 5G/4G (rs1799889). No significant differences in the PAI-1 5G/4G genotype prevalence between patients and controls were found. After exclusion of the women with secondary APS, the frequency of pregnancies and spontaneous abortions, as well as the number of live births were similar in the studied patients with different PAI-1 genotype (p> 0.05). PAI-1 5G/4G polymorphism was not significantly related to any of the lupus ACR criteria or disease activity (p > 0.05), but it could influence the platelet number in the studied patients (263.52 ± 91.10 [5G/5G genotype] versus 210.12 ± 71.79 [4G/4G genotype], p = 0.023). In conclusion, our results showed that PAI-1 4G/5G polymorphism did not worsen the reproductive outcome in SLE women without secondary APS.

Do serum angiopoietin-1, angiopoietin-2, and their receptor Tie-2 and 4G/5G variant of PAI-1 gene have a role in the pathogenesis of preeclampsia?

PubMed

Kamal, Manal; El-Khayat, Waleed

2011-10-01

To evaluate whether serum angiogenesis markers such as angiopoietins (Ang-1, Ang-2) and their receptor (Tie-2) are altered in women with preeclampsia. We also performed genotyping to determine if the 4G/5G genotypes of -675 PAI-1 gene may play a role in the pathogenesis of preeclampsia. Sixty-eight pregnant women with preeclampsia were compared to 35 normotensive pregnant women and 24 normotensive nonpregnant women in a cross-sectional study. Using enzyme-linked immunosorbent assay, levels of serum Ang-1 and Ang-2, and Tie-2 were measured. A single base pair insertion/deletion 4G/5G polymorphism of the PAI-1 gene was determined by polymerase chain reaction. Serum levels of Ang-1 and Tie-2 were significantly different among the study groups (P = 0.001 and P = 0.025, respectively) being lower in the preeclamptic group. Positive significant correlation was found between Ang-2 and Tie-2, (r = 0.26, P = 0.024). The frequency of the genotypes (4G/5G, 4G/4G, and 5G/5G) differed among the groups (P = 0.001). Also, the mean of systolic and diastolic blood pressures differed significantly according to the PAI-1 genotype being higher in those bearing the 4G allele; P = 0.04 and P = 0.023, respectively. Sera Ang-1 and Ang-2, and Tie-2 as well as variants of 4G/5G of PAI-1 polymorphism have positive implications in the pathogenesis of preeclampsia.

Liposomal gD ectodomain (gD1-306) vaccine protects against HSV2 genital or rectal infection of female and male mice.

PubMed

Olson, K; Macias, P; Hutton, S; Ernst, W A; Fujii, G; Adler-Moore, J P

2009-12-11

Herpes simplex virus type 2 (HSV2) is the most common causative agent of genital herpes, with infection rates as high as 1 in 6 adults. The present studies were done to evaluate the efficacy of a liposomal HSV2 gD(1-306) vaccine (L-gD(1-306)-HD) in an acute murine HSV2 infection model of intravaginal (female) or intrarectal (male or female) challenge. Two doses of L-gD(1-306)-HD containing 60 microg gD(1-306)-HD and 15 microg monophosphoryl lipid A (MPL) per dose provided protection against HSV2 intravaginal challenge (86-100% survival, P< or =0.0003 vs. control liposomes; P=0.06 vs. L-gD(1-306)-HD without MPL). Both male and female mice (BALB/c and C57BL/6) immunized with L-gD(1-306)-HD/MPL were significantly protected against HSV2 intrarectal challenge, with higher survival rates compared to controls (71-100%, P< or =0.007). L-gD(1-306)-HD/MPL also provided increased survival when compared to a liposomal peptide vaccine, L-gD(264-285)-HD/MPL (male BALB/c, PgD(1-306)-HD/MPL also had minimal disease signs, reduced viral burden in their spinal cords and elevated neutralizing antibody titers in the females. The vaccine also stimulated gD(1-306)-HD specific splenocytes of both male and female mice with significantly elevated levels of IFN-gamma compared to IL-4 (P< or =0.01) indicating that there was an enhanced Th1 response. These results provide the first evidence that the L-gD(1-306)-HD vaccine can protect both male and female mice against intrarectal HSV2 challenge.

26 CFR 1.904(g)-2 - Recapture of overall domestic losses.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 26 Internal Revenue 9 2010-04-01 2010-04-01 false Recapture of overall domestic losses. 1.904(g)-2 Section 1.904(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES Income from Sources Without the United States § 1.904(g)-2 Recapture...

Association between PAI-1 4G/5G polymorphism and diabetic nephropathy: a meta-analysis in the Chinese population.

PubMed

Gao, Wen-Feng; Guo, Ying-Bo; Bai, Yu; Ding, Xin-Yu; Yan, Yong-Ji; Wu, Zhen-Qi

2016-09-01

Although a number of studies have been conducted on the association between plasminogen activator inhibitor-1 (PAI-1) 4G/5G polymorphism and diabetic nephropathy (DN) in Chinese population, this association remains elusive and controversial. To further assess the effects of PAI-1 4G/5G polymorphism on the risk of DN, a meta-analysis was performed in the Chinese population. Relevant studies were identified using PubMed, Springer Link, Ovid, Chinese Wanfang Data Knowledge Service Platform, Chinese National Knowledge Infrastructure, and Chinese Biology Medicine through November, 2015. Pooled odds ratios (ORs) and 95 % confidence intervals (CIs) were used to assess the strength of the associations. This meta-analysis identified nine studies, including 777 DN cases, 413 healthy controls, and 523 DM controls. In the total analyses, a significantly elevated risk of DN was associated with variants of PAI-1 4G/5G when compared with the healthy group (4G vs. 5G, OR 2.46, 95 % CI 1.45-4.16; 4G/4G vs. 5G/5G, OR 4.32, 95 % CI 1.79-10.39; 4G/4G vs. 4G/5G +5G/5G, OR 2.96, 95 % CI 1.59-5.53; 4G/4G +4G/5G vs. 5G/5G, OR 2.78, 95 % CI 1.34-5.75) and DM group (4G vs. 5G, OR 1.93, 95 % CI 1.28-2.92; 4G/4G vs. 5G/5G, OR 2.99, 95 % CI 1.44-6.21; 4G/4G vs. 4G/5G +5G/5G, OR 2.84, 95 % CI 1.77-4.54). In the subgroup analyses stratified by ethnicity and geographic areas, it revealed the significant results in Chinese Han, in North and South China. This meta-analysis showed that the PAI-1 4G/4G variant, 4G allele might be risk alleles for DN susceptibility in the Chinese population, and further studies in other ethic groups are required for definite conclusions.

A New Synthetic Allotetraploid (A1A1G2G2) between Gossypium herbaceum and G. australe: Bridging for Simultaneously Transferring Favorable Genes from These Two Diploid Species into Upland Cotton

PubMed Central

Chen, Yu; Wang, Yingying; Chen, Jinjin; Zhang, Tianzhen; Zhou, Baoliang

2015-01-01

Gossypium herbaceum, a cultivated diploid cotton species (2n = 2x = 26, A1A1), has favorable traits such as excellent drought tolerance and resistance to sucking insects and leaf curl virus. G. australe, a wild diploid cotton species (2n = 2x = 26, G2G2), possesses numerous economically valuable characteristics such as delayed pigment gland morphogenesis (which is conducive to the production of seeds with very low levels of gossypol as a potential food source for humans and animals) and resistance to insects, wilt diseases and abiotic stress. Creating synthetic allotetraploid cotton from these two species would lay the foundation for simultaneously transferring favorable genes into cultivated tetraploid cotton. Here, we crossed G. herbaceum (as the maternal parent) with G. australe to produce an F1 interspecific hybrid and doubled its chromosome complement with colchicine, successfully generating a synthetic tetraploid. The obtained tetraploid was confirmed by morphology, cytology and molecular markers and then self-pollinated. The S1 seedlings derived from this tetraploid gradually became flavescent after emergence of the fifth true leaf, but they were rescued by grafting and produced S2 seeds. The rescued S1 plants were partially fertile due to the existence of univalents at Metaphase I of meiosis, leading to the formation of unbalanced, nonviable gametes lacking complete sets of chromosomes. The S2 plants grew well and no flavescence was observed, implying that interspecific incompatibility, to some extent, had been alleviated in the S2 generation. The synthetic allotetraploid will be quite useful for polyploidy evolutionary studies and as a bridge for transferring favorable genes from these two diploid species into Upland cotton through hybridization. PMID:25879660

Effects of dietary CLA supplementation, parity and different concentrate levels before calving on immunoglobulin G1, G2 and M concentrations in dairy cows.

PubMed

Eger, Melanie; Horn, Jana; Hussen, Jamal; Schuberth, Hans-Joachim; Scharf, Maria; Meyer, Ulrich; Dänicke, Sven; Bostedt, Hartwig; Breves, Gerhard

2017-10-01

Peripartal dairy cows exhibit a higher susceptibility for infectious diseases, which might be linked to the negative energy balance occurring at the onset of lactation. A dietary supplementation of conjugated linoleic acids (CLA) may reduce milk fat yield and subsequently lower the energy deficit. The utilization of immunoglobulins (Ig) for colostrogenesis might impair humoral immunity in peripartal dairy cows; therefore this study investigated the effects of a CLA supplement, parity and different dietary energy levels on plasma and colostrum IgG1, IgG2 and IgM levels in dairy cows and their calves. Blood samples were collected from 64 cows from 21days before until 56days after parturition and colostrum samples for the first 3days of lactation. Plasma immunoglobulin concentrations of 19 calves were determined before colostrum uptake. Neither plasma IgG1, nor IgG2 levels were affected by CLA or dietary energy level. However, immunoglobulin levels were affected by parity. Heifers possessed the lowest IgG1 concentrations. IgG2 concentrations were highest in cows with 2 lactations prior to parturition and in heifers after parturition. Plasma IgM levels were characterized by a sharp decrease 3days prior to parturition and were scarcely affected by the feeding regimen or parity. Generally, immunoglobulin levels appear to be mostly independent from the peripartal energy balance of the cows and are not influenced by dietary CLA. However, pronounced differences among parities for IgG1 and IgG2 were revealed which should be further evaluated. Copyright © 2017 Elsevier Ltd. All rights reserved.

Dipole moments and transition probabilities of the i 3Pi sub g-b 3Sigma(+) sub u, c 3Pi sub u-a 3Sigma(+) sub g, and i 3Pi sub g-c 3Pi sub u systems of molecular hydrogen

NASA Technical Reports Server (NTRS)

Guberman, Steven L.; Dalgarno, A.

1992-01-01

Bonn-Oppenheimer-based ab initio calculations of dipole moments from the i 3Pi sub g-b 3Sigma(+) sub u, c 3Pi sub u-a 3Sigma(+) sub g, and i 3Pi sub g-c 3Pi sub u transitions of H2 have been conducted, to yield a tabulation of the dipole transition probabilities and Franck-Condon factors. These factors are given for transitions originating in the lowest vibrational level of the ground X 1Sigma(+) sub g state.

Neisseria meningitidis Group A IgG1 and IgG2 Subclass Immune Response in African Children Aged 12–23 Months Following Meningococcal Vaccination

PubMed Central

Holme, Daniel; Findlow, Helen; Sow, Samba O.; Idoko, Olubukola T.; Preziosi, Marie-Pierre; Carlone, George; Plikaytis, Brian D.; Borrow, Ray

2015-01-01

Background. A group A meningococcal conjugate vaccine, PsA-TT, was licensed in 2010 and was previously studied in a phase 2 clinical trial to evaluate its safety and immunogenicity in African children 12–23 months of age. Methods. Subjects received either PsA-TT; meningococcal group A, C, W, Y polysaccharide vaccine (PsACWY); or Haemophilus influenzae type b conjugate vaccine (Hib-TT). Forty weeks following primary vaccination, the 3 groups were further randomized to receive either PsA-TT, one-fifth dose of PsACWY, or Hib-TT. Group A–specific immunoglobulin G (IgG) subclass response was characterized using an enzyme-linked immunosorbent assay. Results. The predominant IgG subclass response, regardless of vaccine, was IgG1. One month following primary vaccination, the geometric mean concentrations (GMCs) of IgG1 and IgG2 in the PsA-TT group were 21.73 µg/mL and 6.27 µg/mL, whereas in the PsACWY group the mean GMCs were 2.01 µg/mL and 0.97 µg/mL, respectively (P < .0001). Group A–specific IgG1 and IgG2 GMCs remained greater in the PsA-TT group than in the PsACWY group 40 weeks following primary vaccination (P < .0001). One week following revaccination, those given 2 doses of PsA-TT had the greatest IgG1 and IgG2 GMCs of 125.23 µg/mL and 36.12 µg/mL, respectively (P = .0008), and demonstrated a significant increase in IgG1:IgG2 mean ratio, indicative of the T-cell–dependent response associated with conjugate vaccines. Conclusions. Vaccination of African children aged 12–24 months with either PsA-TT or PsACWY elicited a predominantly IgG1 response. The IgG1:IgG2 mean ratio decreased following successive vaccination with PsACWY, indicating a shift toward IgG2, suggestive of the T-cell–independent immune response commonly associated with polysaccharide antigens. Clinical Trials Registration. SRCTN78147026. PMID:26553689

Human apolipoprotein B mRNA-editing enzyme-catalytic polypeptide-like 3G (APOBEC3G) is incorporated into HIV-1 virions through interactions with viral and nonviral RNAs.

PubMed

Svarovskaia, Evguenia S; Xu, Hongzhan; Mbisa, Jean L; Barr, Rebekah; Gorelick, Robert J; Ono, Akira; Freed, Eric O; Hu, Wei-Shau; Pathak, Vinay K

2004-08-20

Apolipoprotein B mRNA-editing enzyme-catalytic polypeptide-like 3G (APOBEC3G) is a host cytidine deaminase that is packaged into virions and confers resistance to retroviral infection. APOBEC3G deaminates deoxycytidines in minus strand DNA to deoxyuridines, resulting in G to A hypermutation and viral inactivation. Human immunodeficiency virus type 1 (HIV-1) virion infectivity factor counteracts the antiviral activity of APOBEC3G by inducing its proteosomal degradation and preventing virion incorporation. To elucidate the mechanism of viral suppression by APOBEC3G, we developed a sensitive cytidine deamination assay and analyzed APOBEC3G virion incorporation in a series of HIV-1 deletion mutants. Virus-like particles derived from constructs in which pol, env, and most of gag were deleted still contained high levels of cytidine deaminase activity; in addition, coimmunoprecipitation of APOBEC3G and HIV-1 Gag in the presence and absence of RNase A indicated that the two proteins do not interact directly but form an RNase-sensitive complex. Viral particles lacking HIV-1 genomic RNA which were generated from the gag-pol expression constructs pC-Help and pSYNGP packaged APOBEC3G at 30-40% of the wild-type level, indicating that interactions with viral RNA are not necessary for incorporation. In addition, viral particles produced from an nucleocapsid zinc finger mutant contained approximately 1% of the viral genomic RNA but approximately 30% of the cytidine deaminase activity. The reduction in APOBEC3G incorporation was equivalent to the reduction in the total RNA present in the nucleocapsid mutant virions. These results indicate that interactions with viral proteins or viral genomic RNA are not essential for APOBEC3G incorporation and suggest that APOBEC3G interactions with viral and nonviral RNAs that are packaged into viral particles are sufficient for APOBEC3G virion incorporation.

Contribution of cysteine residues to the structure and function of herpes simplex virus gH/gL

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cairns, Tina M.; Landsburg, Daniel J.; Charles Whitbeck, J.

2005-02-20

In HSV types 1 and 2, gH forms a noncovalent heterodimer with gL. Previous studies demonstrated that the first 323 amino acids of gH1 and the first 161 amino acids of gL1 are sufficient for gH/gL binding. For gL1, substitution of any of its four cysteine (C) residues (all located within the gH/gL binding region) destroyed gH binding and function. Although gH1 contains 8 cysteines in its ectodomain, gH 2 contains 7 (C3 of gH1 is replaced by arginine in gH2). We found that mutation of any of the four C-terminal cysteines led to a reduction or loss of gH/gLmore » function. Mutation of C5 or C6 in gH1 or gH2 rendered the proteins non-functional. However, substitution of C7 and/or C8 in gH1 has a definite negative impact on cell-cell fusion, although these mutations had less effect on complementation. Remarkably, all four gH1 N-terminal cysteines could be mutated simultaneously with little effect on fusion or complementation. As gH2 already lacks C3, we constructed a triple mutant (gH2-C1/2/4) which exhibited a similar phenotype. Since gH1 is known to bind gL2 and vice versa, we wondered whether binding of gH2 to the heterologous gL1 would enhance the fusion defect seen with the gH2-C2 mutant. The combination of mutant gH2-C2 with wild-type gL1 was nonfunctional in a cell-cell fusion assay. Interestingly, the reciprocal was not true, as gH1-C2 could utilize both gL1 and gL2. These findings suggest that there is a structural difference in the gH2 N-terminus as compared to gH1. We also present genetic evidence for at least one disulfide bond within gH2, between cysteines 2 and 4.« less

26 CFR 1.904(g)-2 - Recapture of overall domestic losses.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 26 Internal Revenue 9 2012-04-01 2012-04-01 false Recapture of overall domestic losses. 1.904(g)-2 Section 1.904(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Income from Sources Without the United States § 1.904(g...

26 CFR 1.904(g)-2 - Recapture of overall domestic losses.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 26 Internal Revenue 9 2011-04-01 2011-04-01 false Recapture of overall domestic losses. 1.904(g)-2 Section 1.904(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Income from Sources Without the United States § 1.904(g...

26 CFR 1.904(g)-2 - Recapture of overall domestic losses.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 26 Internal Revenue 9 2014-04-01 2014-04-01 false Recapture of overall domestic losses. 1.904(g)-2 Section 1.904(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Income from Sources Without the United States § 1.904(g...

26 CFR 1.904(g)-2 - Recapture of overall domestic losses.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 26 Internal Revenue 9 2013-04-01 2013-04-01 false Recapture of overall domestic losses. 1.904(g)-2 Section 1.904(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Income from Sources Without the United States § 1.904(g...

26 CFR 1.402(g)-2 - Increased limit for catch-up contributions.

Code of Federal Regulations, 2010 CFR

2010-04-01

....402(g)-2 Section 1.402(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES Pension, Profit-Sharing, Stock Bonus Plans, Etc. § 1.402(g)-2 Increased limit for catch-up contributions. (a) General rule. Under section 402(g)(1)(C), in determining the...

Oxygen consumption during cold exposure at 2.1 G in rats adapted to hypergravic fields

NASA Technical Reports Server (NTRS)

Horowitz, J.; Patterson, S.; Monson, C.

1985-01-01

The thermoregulation ability of rats exposed to various gravitational fields is examined. Male Sprague-Dawley rats were exposed to 22 C and 1 G, and 9 C and 2.1 G in experiment one, 1 G, 2.4 G, 5.8 G and 22 + or - 1.5 C in experiment two, and 1 G, 19-22 C, and 5 C in experiment three. It is observed that the core temperature in the control rats was 36.8 + or 0.4 C at 22C and 30.8 + or - 0.6 C at 9 C, and oxygen consumption dropped from 37 + or - 0.3 C core temperature at 22 C, 36.4 + or - 0.3 C at 9 C, 0.4 oxygen consumption was 8.18 + or - 0.9 ml/min at 22 C, and 14.2 + or - 0.4 ml/min at 9 C. The data from experiment two reveal that tail temperature in the control rats peaked at 2.4 G and at 5.8 G for the acclimated rats, and in experiment three a greater decrease in core temperature is detected in the 2.1-G rats. It is noted that prior acclimation to 2.1 G enhances the thermoregulation ability when exposed to the cold.

Tumor Necrosis Factor (TNF) –308G>A, Nitric Oxide Synthase 3 (NOS3) +894G>T Polymorphisms and Migraine Risk: A Meta-Analysis

PubMed Central

Chen, Min; Tang, Wenjing; Hou, Lei; Liu, Ruozhuo; Dong, Zhao; Han, Xun; Zhang, Xiaofei; Wan, Dongjun; Yu, Shengyuan

2015-01-01

Background and Objective Conflicting data have been reported on the association between tumor necrosis factor (TNF) –308G>A and nitric oxide synthase 3 (NOS3) +894G>T polymorphisms and migraine. We performed a meta-analysis of case-control studies to evaluate whether the TNF –308G>A and NOS3 +894G>T polymorphisms confer genetic susceptibility to migraine. Method We performed an updated meta-analysis for TNF –308G>A and a meta-analysis for NOS3 +894G>T based on studies published up to July 2014. We calculated study specific odds ratios (OR) and 95% confidence intervals (95% CI) assuming allele contrast, dominant model, recessive model, and co-dominant model as pooled effect estimates. Results Eleven studies in 6682 migraineurs and 22591 controls for TNF –308G>A and six studies in 1055 migraineurs and 877 controls for NOS3 +894G>T were included in the analysis. Neither indicated overall associations between gene polymorphisms and migraine risk. Subgroup analyses suggested that the “A” allele of the TNF –308G>A variant increases the risk of migraine among non-Caucasians (dominant model: pooled OR = 1.82; 95% CI 1.15 – 2.87). The risk of migraine with aura (MA) was increased among both Caucasians and non-Caucasians. Subgroup analyses suggested that the “T” allele of the NOS3 +894G>T variant increases the risk of migraine among non-Caucasians (co-dominant model: pooled OR = 2.10; 95% CI 1.14 – 3.88). Conclusions Our findings appear to support the hypothesis that the TNF –308G>A polymorphism may act as a genetic susceptibility factor for migraine among non-Caucasians and that the NOS3 +894G>T polymorphism may modulate the risk of migraine among non-Caucasians. PMID:26098763

RNA-Dependent Oligomerization of APOBEC3G Is Required for Restriction of HIV-1

PubMed Central

Huthoff, Hendrik; Autore, Flavia; Gallois-Montbrun, Sarah; Fraternali, Franca; Malim, Michael H.

2009-01-01

The human cytidine deaminase APOBEC3G (A3G) is a potent inhibitor of retroviruses and transposable elements and is able to deaminate cytidines to uridines in single-stranded DNA replication intermediates. A3G contains two canonical cytidine deaminase domains (CDAs), of which only the C-terminal one is known to mediate cytidine deamination. By exploiting the crystal structure of the related tetrameric APOBEC2 (A2) protein, we identified residues within A3G that have the potential to mediate oligomerization of the protein. Using yeast two-hybrid assays, co-immunoprecipitation, and chemical crosslinking, we show that tyrosine-124 and tryptophan-127 within the enzymatically inactive N-terminal CDA domain mediate A3G oligomerization, and this coincides with packaging into HIV-1 virions. In addition to the importance of specific residues in A3G, oligomerization is also shown to be RNA-dependent. Homology modelling of A3G onto the A2 template structure indicates an accumulation of positive charge in a pocket formed by a putative dimer interface. Substitution of arginine residues at positions 24, 30, and 136 within this pocket resulted in reduced virus inhibition, virion packaging, and oligomerization. Consistent with RNA serving a central role in all these activities, the oligomerization-deficient A3G proteins associated less efficiently with several cellular RNA molecules. Accordingly, we propose that occupation of the positively charged pocket by RNA promotes A3G oligomerization, packaging into virions and antiviral function. PMID:19266078

Prognostic value of the PAI-1 4G/5G polymorphism in invasive ductal carcinoma of the breast.

PubMed

Yagmurdur, M C; Atac, F B; Tutar, N U; Verdi, H; Isiklar, I; Ozdemir, B H; Ozbek, N; Karakayali, H; Haberal, M

2008-01-01

The study group was derived from the archive materials of 55 invasive ductal breast cancer (IDC) patients who had undergone breast-preserving surgery (partial mastectomy/ axillary dissection). All patients included in the study had clinically T(1)-2, N0-M0 invasive ductal carcinoma. Genomic DNA species were extracted from paraffin-embedded blocks, and plasminogen activator inhibitor type-1 (PAI-1) gene 4G/5G genotyping was done by polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP). Patient demographics, axillary metastasis status, metastatic lymph nodi/total dissected lymph nodes from axilla, histopathologic characteristics of tumors, local recurrences, and survival ratio were assessed. PAI-1 4G/5G genotype frequencies were 4G/4G (64%), 4G/5G (31%), and 5G/5G (5%) in the patient group. According to the results based on frequencies, the demographics were not different. Five-year local recurrence rate of 4G/5G patients was the lowest (2/17, 12%) (P = 0.02). Also five-year distant metastases ratio of 4G/5G patients was the highest (18%) (P = 0.01). Five- and 10-year disease-free survival rates for the 4G/4G, 4G/5G, and 5G/5G groups were 97% and 94%, 82% and 77%, and 100% and 94%, respectively (P = 0.004). The results of this study indicate that the 4G allele in the PAI 1 gene had a negative impact on local recurrence and disease-free survival of patients with clinical T(1)-2N0M0 IDC.

Selective interaction of AGS3 with G-proteins and the influence of AGS3 on the activation state of G-proteins.

PubMed

Bernard, M L; Peterson, Y K; Chung, P; Jourdan, J; Lanier, S M

2001-01-12

AGS3 (activator of G-protein signaling 3) was isolated in a yeast-based functional screen for receptor-independent activators of heterotrimeric G-proteins. As an initial approach to define the role of AGS3 in mammalian signal processing, we defined the AGS3 subdomains involved in G-protein interaction, its selectivity for G-proteins, and its influence on the activation state of G-protein. Immunoblot analysis with AGS3 antisera indicated expression in rat brain, the neuronal-like cell lines PC12 and NG108-15, as well as the smooth muscle cell line DDT(1)-MF2. Immunofluorescence studies and confocal imaging indicated that AGS3 was predominantly cytoplasmic and enriched in microdomains of the cell. AGS3 coimmunoprecipitated with Galpha(i3) from cell and tissue lysates, indicating that a subpopulation of AGS3 and Galpha(i) exist as a complex in the cell. The coimmunoprecipitation of AGS3 and Galpha(i) was dependent upon the conformation of Galpha(i3) (GDP GTPgammaS (guanosine 5'-3-O-(thio)triphosphate)). The regions of AGS3 that bound Galpha(i) were localized to four amino acid repeats (G-protein regulatory motif (GPR)) in the carboxyl terminus (Pro(463)-Ser(650)), each of which were capable of binding Galpha(i). AGS3-GPR domains selectively interacted with Galpha(i) in tissue and cell lysates and with purified Galpha(i)/Galpha(t). Subsequent experiments with purified Galpha(i2) and Galpha(i3) indicated that the carboxyl-terminal region containing the four GPR motifs actually bound more than one Galpha(i) subunit at the same time. The AGS3-GPR domains effectively competed with Gbetagamma for binding to Galpha(t(GDP)) and blocked GTPgammaS binding to Galpha(i1). AGS3 and related proteins provide unexpected mechanisms for coordination of G-protein signaling pathways.

12 CFR 563g.3 - Exemptions.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 12 Banks and Banking 5 2010-01-01 2010-01-01 false Exemptions. 563g.3 Section 563g.3 Banks and Banking OFFICE OF THRIFT SUPERVISION, DEPARTMENT OF THE TREASURY SECURITIES OFFERINGS § 563g.3 Exemptions... non-public offering which satisfies the requirements of § 563g.4 of this part; (e) That are debt...

ABT-263 induces G1/G0-phase arrest, apoptosis and autophagy in human esophageal cancer cells in vitro.

PubMed

Lin, Qing-Huan; Que, Fu-Chang; Gu, Chun-Ping; Zhong, De-Sheng; Zhou, Dan; Kong, Yi; Yu, Le; Liu, Shu-Wen

2017-12-01

Both the anti- and pro-apoptotic members of the Bcl-2 family are regulated by a conserved Bcl-2 homology (BH3) domain. ABT-263 (Navitoclax), a novel BH3 mimetic and orally bioavailable Bcl-2 family inhibitor with high affinity for Bcl-xL, Bcl-2 and Bcl-w has entered clinical trials for cancer treatment. But the anticancer mechanisms of ABT-263 have not been fully elucidated. In this study we investigated the effects of ABT-263 on human esophageal cancer cells in vitro and to explore its anticancer mechanisms. Treatment with ABT-263 dose-dependently suppressed the viability of 3 human esophageal cancer cells with IC 50 values of 10.7±1.4, 7.1±1.5 and 8.2±1.6 μmol/L, in EC109, HKESC-2 and CaES-17 cells, respectively. ABT-263 (5-20 μmol/L) dose-dependently induced G 1 /G 0 -phase arrest in the 3 cancer cell lines and induced apoptosis evidenced by increased the Annexin V-positive cell population and elevated levels of cleaved caspase 3, cleaved caspase 9 and PARP. We further demonstrated that ABT-263 treatment markedly increased the expression of p21 Waf1/Cip1 and decreased the expression of cyclin D1 and phospho-Rb (retinoblastoma tumor suppressor protein) (Ser780) proteins that contributed to the G 1 /G 0 -phase arrest. Knockdown of p21 Waf1/Cip1 attenuated ABT-263-induced G 1 /G 0 -phase arrest. Moreover, ABT-263 treatment enhanced pro-survival autophagy, shown as the increased LC3-II levels and decreased p62 levels, which counteracted its anticancer activity. Our results suggest that ABT-263 exerts cytostatic and cytotoxic effects on human esophageal cancer cells in vitro and enhances pro-survival autophagy, which counteracts its anticancer activity.

Investigation of Plasminogen Activator Inhibitor-1 (PAI-1) 4G/5G promoter polymorphism in Indian venous thrombosis patients: A case-control study.

PubMed

Prabhudesai, Aniket; Shetty, Shrimati; Ghosh, Kanjaksha; Kulkarni, Bipin

2017-09-01

The role of PAI-1 4G/5G polymorphism in venous thrombosis has been contradictory. PAI-1 4G/4G genotype is associated with elevated levels of PAI-1 resulting in a hypofibrinolytic state and a higher thrombotic risk. In this study, the distribution of genotypes and frequency of alleles of the 4G/5G polymorphism of PAI-1 gene in Indian patients with different types of venous thrombosis was investigated for its role in development of thrombosis. A total of 87 portal vein thrombosis (PVT), 71 Budd-Chiari syndrome (BCS), 156 cerebral vein thrombosis (CVT), and 163 deep vein thrombosis (DVT) patients were studied alongside 251 healthy controls for the PAI-1 4G/5G polymorphism by allele-specific PCR. Frequency of 4G/4G genotype was higher in all groups in comparison with controls. 4G/4G was associated with PVT risk (OR=2.51, 95% CI=1.29-4.96, P=.0075), BCS risk (OR=5.98, 95% CI=2.68-13.42, P<.0001), and DVT risk (OR=1.75, 95% CI=0.98-3.02, P=.0225). This is the first case-control study from India establishing PAI-1 4G/4G as a strong risk factor for abdominal thrombosis (PVT and BCS). Statistically significant association was not found between 4G/4G genotype and CVT risk. PAI-1 4G/4G is a strong risk factor for venous thrombosis in Indian patients and should be included in laboratory testing panel of thrombophilia. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Association between plasminogen activator inhibitor-1 -675 4G/5G polymorphism and sepsis: a meta-analysis.

PubMed

Li, Li; Nie, Wei; Zhou, Hongfeng; Yuan, Weifeng; Li, Weifeng; Huang, Wenjie

2013-01-01

Several studies have evaluated the association between plasminogen activator inhibitor-1 (PAI-1) -675 4G/5G polymorphism and sepsis in different populations. However, the available results are conflicting. A search of Pubmed and EMBASE databases was performed to identify relevant studies for inclusion in the meta-analysis. Odds ratios (ORs) and corresponding 95% confidence intervals (CIs) were determined using a random-effects model. Twelve case-control studies and three cohort studies were included. Overall, a significant association between 4G/5G polymorphism and sepsis risk was observed for 4G/4G vs. 4G/5G +5G/5G (OR = 1.30, 95% CI 1.08-1.56, P = 0.006). In addition, there was a significant association between PAI-1 4G/5G polymorphism and sepsis-related mortality (OR = 1.72, 95% CI 1.27-2.33, P = 0.0005). In subgroup analyses, increased sepsis risk and mortality risk were found in Caucasians and in patients with sepsis. This meta-analysis suggested that the PAI-1 -675 4G/5G polymorphism was a risk factor for sepsis and sepsis mortality.

Fish Otolith Growth in 1g and 3g Depends on the Gravity Vector

NASA Astrophysics Data System (ADS)

Anken, R. H.; Werner, K.; Breuer, J.; Rahmann, H.

Size and asymmetry (size difference between the left and the right side) as well as calcium (Ca) content of inner ear otoliths of larval cichlid fish Oreochromis mossambicus were determined after a long-term stay at hypergravity conditions (3g; centrifuge). Both utricular and saccular otoliths (lapilli and sagittae, respectively) were significantly smaller after hyper-g exposure as compared to parallely raised 1g-control specimens and the absolute amount of otolith-Ca was diminished. The asymmetry of sagittae was significantly increased in the experimental animals, whereas the respective asymmetry concerning lapilli was markedly decreased. In the course of another experiment, larvae were raised in aquarium hatch baskets, from which one was placed directly above aeration equipment, which resulted in random water circulation shifting the fish around (``shifted'' specimens). The lapillar asymmetry of the ``stationary'' specimens showed a highly significant increase during early development when larvae were forced to lay on their sides due to their prominent yolk-sacs. In later developmental stages, when they began to swim freely, a dramatic decrease in lapillar asymmetry was apparent. Taken together with own previous findings according to which otolith growth stops after vestibular nerve transection, the results presented here suggest that the growth and the development of bilateral asymmetry of otoliths is guided by the environmental gravity vector, obviously involving a feedback loop between the brain and the inner ear

Post dural puncture headache after spinal anaesthesia for caesarean section: a comparison of 25 g Quincke, 27 g Quincke and 27 g Whitacre spinal needles.

PubMed

Shaikh, Jan Muhammad; Memon, Amna; Memon, Muhammad Ali; Khan, Majida

2008-01-01

To compare the frequency and severity of post dural puncture headache in obstetric patients using 25G Quincke, 27G Quincke and 27G Whitacre spinal needles. Comparative, randomized, double-blind, interventional study. Liaquat University Hospital Hyderabad from October 2005 to December 2006. 480 ASA I-II full term pregnant women, 18 to 45 years of age, scheduled for elective Caesarean section, under spinal anaesthesia, were randomized into three groups: Group I (25G Quincke spinal needle: n=168), Group II (27G Quincke spinal needle: n=160) and Group III (27G Whitacre spinal needle: n=152). Spinal anaesthesia was performed with 1.5-2.0 ml 0.75% hyperbaric bupivacaine using 25G Quincke spinal needle (Group I), 27G Quincke spinal needle (Group II) and 27G Whitacre spinal needle (Group III) at L3-4 inter-vertebral space. Each patient was assessed daily for four consecutive days following Caesarean section. Frequency and severity and of postdural puncture headache (PDPH) were recorded. Data were analyzed using SPSS-11. Frequency of PDPH following the use of 25G Quincke (Group I), 27G Quincke (Group II) and 27G Whitacre (Group III) spinal needles was 8.3% (14/168), 3.8% (6/160) and 2.0% (3/152) respectively. In Group I, PDPH was mild in 5 patients, moderate in 7 patients and severe in 2 patients. In Group II, it was mild in 2, moderate in 3 and severe in 1 patient. In group III, it was mild in 2 and moderate in 1 patient. Severe PDPH did not occur in Group III. Most of the patients with PDPH developed it on 1st and 2nd postoperative day. When using a 27G Whitacre spinal needle, the frequency and severity of PDPH was significantly lower than when a 25G Quincke or 27G Quincke needle was used.

NIa-Pro of Papaya ringspot virus interacts with Carica papaya eukaryotic translation initiation factor 3 subunit G (CpeIF3G).

PubMed

Gao, Le; Tuo, Decai; Shen, Wentao; Yan, Pu; Li, Xiaoying; Zhou, Peng

2015-02-01

The interaction of papaya eukaryotic translation initiation factor 3 subunit G (CpeIF3G) with Papaya ringspot virus (PRSV) NIa-Pro was validated using a bimolecular fluorescence complementation assay in papaya protoplasts based on the previous yeast two-hybrid assay results. The C-terminal (residues 133-239) fragment of PRSV NIa-Pro and the central domain (residues 59-167) of CpeIF3G were required for effective interaction between NIa-Pro and CpeIF3G as shown by a Sos recruitment yeast two-hybrid system with several deletion mutants of NIa-Pro and CpeIF3G. The central domain of CpeIF3G, which contains a C2HC-type zinc finger motif, is required to bind to other eIFs of the translational machinery. In addition, quantitative real-time reverse transcription PCR assay confirmed that PRSV infection leads to a 2- to 4.5-fold up-regulation of CpeIF3G mRNA in papaya. Plant eIF3G is involved in various stress response by enhancing the translation of resistance-related proteins. It is proposed that the NIa-Pro-CpeIF3G interaction may impair translation preinitiation complex assembly of defense proteins and interfere with host defense.

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

PubMed

Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

2017-10-01

Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

Association between Plasminogen Activator Inhibitor-1 -675 4G/5G Polymorphism and Sepsis: A Meta-Analysis

PubMed Central

Yuan, Weifeng; Li, Weifeng; Huang, Wenjie

2013-01-01

Background Several studies have evaluated the association between plasminogen activator inhibitor-1 (PAI-1) -675 4G/5G polymorphism and sepsis in different populations. However, the available results are conflicting. Methods A search of Pubmed and EMBASE databases was performed to identify relevant studies for inclusion in the meta-analysis. Odds ratios (ORs) and corresponding 95% confidence intervals (CIs) were determined using a random-effects model. Results Twelve case-control studies and three cohort studies were included. Overall, a significant association between 4G/5G polymorphism and sepsis risk was observed for 4G/4G vs. 4G/5G +5G/5G (OR = 1.30, 95% CI 1.08–1.56, P = 0.006). In addition, there was a significant association between PAI-1 4G/5G polymorphism and sepsis-related mortality (OR = 1.72, 95% CI 1.27–2.33, P = 0.0005). In subgroup analyses, increased sepsis risk and mortality risk were found in Caucasians and in patients with sepsis. Conclusions This meta-analysis suggested that the PAI-1 -675 4G/5G polymorphism was a risk factor for sepsis and sepsis mortality. PMID:23382992

PAI-1 mRNA expression and plasma level in rheumatoid arthritis: relationship with 4G/5G PAI-1 polymorphism.

PubMed

Muñoz-Valle, José Francisco; Ruiz-Quezada, Sandra Luz; Oregón-Romero, Edith; Navarro-Hernández, Rosa Elena; Castañeda-Saucedo, Eduardo; De la Cruz-Mosso, Ulises; Illades-Aguiar, Berenice; Leyva-Vázquez, Marco Antonio; Castro-Alarcón, Natividad; Parra-Rojas, Isela

2012-12-01

Rheumatoid arthritis (RA) is a chronic inflammatory disease affecting the synovial membrane, cartilage and bone. PAI-1 is a key regulator of the fibrinolytic system through which plasminogen is converted to plasmin. The plasmin activates the matrix metalloproteinase system, which is closely related with the joint damage and bone destruction in RA. The aim of this study was to investigate the relationship between 4G/5G PAI-1 polymorphism with mRNA expression and PAI-1 plasma protein levels in RA patients. 113 RA patients and 123 healthy subjects (HS) were included in the study. The 4G/5G PAI-1 polymorphism was determined by polymerase chain reaction-restriction fragment length polymorphism method; the PAI-1 mRNA expression was determined by real-time PCR; and the soluble PAI-1 (sPAI-1) levels were quantified using an ELISA kit. No significant differences in the genotype and allele frequencies of 4G/5G PAI-1 polymorphism were found between RA patients and HS. However, the 5G/5G genotype was the most frequent in both studied groups: RA (42%) and HS (44%). PAI-1 mRNA expression was slightly increased (0.67 fold) in RA patients with respect to HS (P = 0.0001). In addition, in RA patients, the 4G/4G genotype carriers showed increased PAI-1 mRNA expression (3.82 fold) versus 4G/5G and 5G/5G genotypes (P = 0.0001), whereas the sPAI-1 plasma levels did not show significant differences. Our results indicate that the 4G/5G PAI-1 polymorphism is not a marker of susceptibility in the Western Mexico. However, the 4G/4G genotype is associated with high PAI-1 mRNA expression but not with the sPAI-1 levels in RA patients.

Joint effect of MCP-1 genotype GG and MMP-1 genotype 2G/2G increases the likelihood of developing pulmonary tuberculosis in BCG-vaccinated individuals.

PubMed

Ganachari, Malathesha; Ruiz-Morales, Jorge A; Gomez de la Torre Pretell, Juan C; Dinh, Jeffrey; Granados, Julio; Flores-Villanueva, Pedro O

2010-01-25

We previously reported that the -2518 MCP-1 genotype GG increases the likelihood of developing tuberculosis (TB) in non-BCG-vaccinated Mexicans and Koreans. Here, we tested the hypothesis that this genotype, alone or together with the -1607 MMP-1 functional polymorphism, increases the likelihood of developing TB in BCG-vaccinated individuals. We conducted population-based case-control studies of BCG-vaccinated individuals in Mexico and Peru that included 193 TB cases and 243 healthy tuberculin-positive controls from Mexico and 701 TB cases and 796 controls from Peru. We also performed immunohistochemistry (IHC) analysis of lymph nodes from carriers of relevant two-locus genotypes and in vitro studies to determine how these variants may operate to increase the risk of developing active disease. We report that a joint effect between the -2518 MCP-1 genotype GG and the -1607 MMP-1 genotype 2G/2G consistently increases the odds of developing TB 3.59-fold in Mexicans and 3.9-fold in Peruvians. IHC analysis of lymph nodes indicated that carriers of the two-locus genotype MCP-1 GG MMP-1 2G/2G express the highest levels of both MCP-1 and MMP-1. Carriers of these susceptibility genotypes might be at increased risk of developing TB because they produce high levels of MCP-1, which enhances the induction of MMP-1 production by M. tuberculosis-sonicate antigens to higher levels than in carriers of the other two-locus MCP-1 MMP-1 genotypes studied. This notion was supported by in vitro experiments and luciferase based promoter activity assay. MMP-1 may destabilize granuloma formation and promote tissue damage and disease progression early in the infection. Our findings may foster the development of new and personalized therapeutic approaches targeting MCP-1 and/or MMP-1.

Joint Effect of MCP-1 Genotype GG and MMP-1 Genotype 2G/2G Increases the Likelihood of Developing Pulmonary Tuberculosis in BCG-Vaccinated Individuals

PubMed Central

Ganachari, Malathesha; Ruiz-Morales, Jorge A.; Gomez de la Torre Pretell, Juan C.; Dinh, Jeffrey; Granados, Julio; Flores-Villanueva, Pedro O.

2010-01-01

We previously reported that the – 2518 MCP-1 genotype GG increases the likelihood of developing tuberculosis (TB) in non-BCG-vaccinated Mexicans and Koreans. Here, we tested the hypothesis that this genotype, alone or together with the – 1607 MMP-1 functional polymorphism, increases the likelihood of developing TB in BCG-vaccinated individuals. We conducted population-based case-control studies of BCG-vaccinated individuals in Mexico and Peru that included 193 TB cases and 243 healthy tuberculin-positive controls from Mexico and 701 TB cases and 796 controls from Peru. We also performed immunohistochemistry (IHC) analysis of lymph nodes from carriers of relevant two-locus genotypes and in vitro studies to determine how these variants may operate to increase the risk of developing active disease. We report that a joint effect between the – 2518 MCP-1 genotype GG and the – 1607 MMP-1 genotype 2G/2G consistently increases the odds of developing TB 3.59-fold in Mexicans and 3.9-fold in Peruvians. IHC analysis of lymph nodes indicated that carriers of the two-locus genotype MCP-1 GG MMP-1 2G/2G express the highest levels of both MCP-1 and MMP-1. Carriers of these susceptibility genotypes might be at increased risk of developing TB because they produce high levels of MCP-1, which enhances the induction of MMP-1 production by M. tuberculosis-sonicate antigens to higher levels than in carriers of the other two-locus MCP-1 MMP-1 genotypes studied. This notion was supported by in vitro experiments and luciferase based promoter activity assay. MMP-1 may destabilize granuloma formation and promote tissue damage and disease progression early in the infection. Our findings may foster the development of new and personalized therapeutic approaches targeting MCP-1 and/or MMP-1. PMID:20111728

O2(b1∑+g) relaxation in active medium of oxygen-iodine laser

NASA Astrophysics Data System (ADS)

Tolstov, G. I.; Zagidullin, M. V.; Khvatov, N. A.; Medvedkov, I. A.; Mikheyev, P. A.

2018-04-01

Rate constants for the removal of O2 b1∑+g by collisions with O2, N2, CO2 and H2O have been determined at temperature 297 K. O2(b1 ∑+g) was excited by pulses from a tunable dye laser, and the deactivation kinetics were followed by observing the temporal behavior of the b1∑+g - X3∑-g fluorescence. The removal rate constants for CO2, N2 and H2O were not strongly dependent on temperature, and could be represented by the expressions kCO2=(1.8+/-0.05)×10-16 kN2=(2.2 +/- 0.2)×10-15, and kH2O=(6.12+/-0.67)×10-12 cm3 molecule-1 s-1. Rate constant for O2(b1∑+ ) removal by O2(X), being orders of magnitude lower, represented by the fitted expression kO2=(3.67 +/- 0.06)×10-17 cm3 molecule-1 s-1. All of the rate constants measured at room temperature were found to be in good agreement with previously reported values.

Spreading of HIV-1 subtype G and envB/gagG recombinant strains among injecting drug users in Lisbon, Portugal.

PubMed

Esteves, Aida; Parreira, Ricardo; Piedade, João; Venenno, Teresa; Franco, Margarida; Germano de Sousa, José; Patrício, Luis; Brum, Paula; Costa, António; Canas-Ferreira, Wanda F

2003-06-01

We have evaluated the genetic diversity of HIV-1 strains infecting injecting drug users (IDUs) in Lisbon, Portugal. Heteroduplex mobility assay and/or phylogenetic analysis revealed that env (C2V3C3 or gp41) subtype B is present in 63.7% of the 135 viral samples studied, followed by subtypes G (23.7%), A (6.7%), F (5.2%), and D (0.7%). Similar analysis of gag (p24/p7) performed on 91 of the specimens demonstrated that 49.5% of the infections were caused by subtype G viruses; other gag subtypes identified were B (39.5%), F (3.3%), A and D (1.1.% each), and the recombinant circulating form CRF02_AG (5.5%). Discordant env/gag sub-types were detected in 34.1% of the strains and may reflect the presence of dual infections and/or recombinant viruses. The presumptive B/G recombinant form was highly predominant (21 of 31). The genetic pattern of HIV-1 subtype B and G strains is suggestive of multiple introductions and recombination episodes and of a longstanding presence of both subtypes in the country. C2V3C3 amino acid sequences from IDU-derived subtype G viruses presented highly significant signatures, which distinguish the variants from this transmission group. The unusually high prevalence of subtype G sequences (34.1%), independent of the geographic origin of the infected individuals, makes this IDU HIV-1 epidemic unique.

Plasminogen Activator Inhibitor-1 (PAI-1) gene 4G/5G alleles frequency distribution in the Lebanese population.

PubMed

Shammaa, Dina M R; Sabbagh, Amira S; Taher, Ali T; Zaatari, Ghazi S; Mahfouz, Rami A R

2008-09-01

Plasminogen activator inhibitor-1 (PAI-1) is an inhibitor of fibrinolysis. Increased plasma PAI-1 levels play an essential role in the pathogenesis of cardiovascular risk and other diseases associated with thrombosis. The 4G/5G polymorphism of the PAI-1 promoter region has been extensively studied in different populations. We studied 160 healthy unrelated Lebanese individuals using a reverse hybridization PCR assay to detect the 5G/5G, 4G/5G and, 4G/4G genotypes of the PAI-1 gene and the frequencies of the 4G and 5G alleles. We found that 4G/5G genotype was the most prevalent (45.6%) followed by 5G/5G (36.9%) and 4G/4G (17.5%). The frequencies of the 4G and 5G alleles were calculated to be 0.403 and 0.597, respectively. Compared to other ethnic communities, the Lebanese population was found to harbour a relatively high prevalence of the rare 4G allele. This, in turn, may predispose this population to develop cardiovascular diseases and other thrombotic clinical conditions. This study aids to enhance our understanding of the genetic features of the Lebanese population.

The PDZ and band 4.1 containing protein Frmpd1 regulates the subcellular location of activator of G-protein signaling 3 and its interaction with G-proteins.

PubMed

An, Ningfei; Blumer, Joe B; Bernard, Michael L; Lanier, Stephen M

2008-09-05

Activator of G-protein signaling 3 (AGS3) is one of nine mammalian proteins containing one or more G-protein regulatory (GPR) motifs that stabilize the GDP-bound conformation of Galphai. Such proteins have revealed unexpected functional diversity for the "G-switch" in the control of events within the cell independent of the role of heterotrimeric G-proteins as transducers for G-protein-coupled receptors at the cell surface. A key question regarding this class of proteins is what controls their subcellular positioning and interaction with G-proteins. We conducted a series of yeast two-hybrid screens to identify proteins interacting with the tetratricopeptide repeat (TPR) of AGS3, which plays an important role in subcellular positioning of the protein. We report the identification of Frmpd1 (FERM and PDZ domain containing 1) as a regulatory binding partner of AGS3. Frmpd1 binds to the TPR domain of AGS3 and coimmunoprecipitates with AGS3 from cell lysates. Cell fractionation indicated that Frmpd1 stabilizes AGS3 in a membrane fraction. Upon cotransfection of COS7 cells with Frmpd1-GFP and AGS3-mRFP, AGS3-mRFP is observed in regions of the cell cortex and also in membrane extensions or processes where it appears to be colocalized with Frmpd1-GFP based upon the merged fluorescent signals. Frmpd1 knockdown (siRNA) in Cath.a-differentiated neuronal cells decreased the level of endogenous AGS3 in membrane fractions by approximately 50% and enhanced the alpha2-adrenergic receptor-mediated inhibition of forskolin-induced increases in cAMP. The coimmunoprecipitation of Frmpd1 with AGS3 is lost as the amount of Galphai3 in the cell is increased and AGS3 apparently switches its binding partner from Frmpd1 to Galphai3 indicating that the interaction of AGS3 with Frmpd1 and Galphai3 is mutually exclusive. Mechanistically, Frmpd1 may position AGS3 in a membrane environment where it then interacts with Galphai in a regulated manner.

Novel Epstein-Barr virus-like particles incorporating gH/gL-EBNA1 or gB-LMP2 induce high neutralizing antibody titers and EBV-specific T-cell responses in immunized mice.

PubMed

Perez, Elizabeth M; Foley, Joslyn; Tison, Timelia; Silva, Rute; Ogembo, Javier Gordon

2017-03-21

Previous Epstein-Barr virus (EBV) prophylactic vaccines based on the major surface glycoprotein gp350/220 as an immunogen have failed to block viral infection in humans, suggesting a need to target other viral envelope glycoproteins. In this study, we reasoned that incorporating gH/gL or gB, critical glycoproteins for viral fusion and entry, on the surface of a virus-like particle (VLP) would be more immunogenic than gp350/220 for generating effective neutralizing antibodies to prevent viral infection of both epithelial and B cell lines. To boost the humoral response and trigger cell-mediated immunity, EBV nuclear antigen 1 (EBNA1) and latent membrane protein 2 (LMP2), intracellular latency proteins expressed in all EBV-infected cells, were also included as critical components of the polyvalent EBV VLP. gH/gL-EBNA1 and gB-LMP2 VLPs were efficiently produced in Chinese hamster ovary cells, an FDA-approved vehicle for mass-production of biologics. Immunization with gH/gL-EBNA1 and gB-LMP2 VLPs without adjuvant generated both high neutralizing antibody titers in vitro and EBV-specific T-cell responses in BALB/c mice. These data demonstrate that will be invaluable not only in preventing EBV infection, but importantly, in preventing and treating the 200,000 cases of EBV-associated cancers that occur globally every year.

1 MVA HTS-2G Generator for Wind Turbines

NASA Astrophysics Data System (ADS)

Kovalev, K. L.; Poltavets, V. N.; Ilyasov, R. I.; Verzhbitsky, L. G.; Kozub, S. S.

2017-10-01

The calculation, design simulations and design performance of 1 MVA HTS-2G (second-generation high-temperature superconductor) Generator for Wind Turbines were done in 2013-2014 [1]. The results of manufacturing and testing of 1 MVA generator are presented in the article. HTS-2G field coils for the rotor were redesigned, fabricated and tested. The tests have shown critical current of the coils, 41-45 A (self field within the ferromagnetic core, T = 77 K), which corresponds to the current of short samples at self field. Application of the copper inner frame on the pole has improved internal cooling conditions of HTS coil windings and reduced the magnetic field in the area, thereby increased the critical current value. The original construction of the rotor with a rotating cryostat was developed, which decreases the thermal in-flow to the rotor. The stator of 1 MW HTS-2G generator has been manufactured. In order to improve the specific weight of the generator, the wave (harmonic drive) multiplier was used, which provides increasing RPM from 15 RPM up to 600 RPM. The total mass of the multiplier and generator is significantly smaller compared to traditional direct-drive wind turbines generators [2-7]. Parameters of the multiplier and generator were chosen based on the actual parameters of wind turbines, namely: 15 RPM, power is 1 MVA. The final test of the assembled synchronous generator with HTS-2G field coils for Wind Turbines with output power 1 MVA was completed during 2015.

26 CFR 1.904(g)-2T - Recapture of overall domestic losses (temporary).

Code of Federal Regulations, 2012 CFR

2012-04-01

...). 1.904(g)-2T Section 1.904(g)-2T Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE... States § 1.904(g)-2T Recapture of overall domestic losses (temporary). (a) In general. A taxpayer shall... increased. As provided in § 1.904(g)-1T(f)(2), the balance in a taxpayer's overall domestic loss account...

26 CFR 1.904(g)-2T - Recapture of overall domestic losses (temporary).

Code of Federal Regulations, 2011 CFR

2011-04-01

...). 1.904(g)-2T Section 1.904(g)-2T Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE... States § 1.904(g)-2T Recapture of overall domestic losses (temporary). (a) In general. A taxpayer shall... increased. As provided in § 1.904(g)-1T(f)(2), the balance in a taxpayer's overall domestic loss account...

A first detection of singlet to triplet conversion from the 1 1B u- to the 1 3A g state and triplet internal conversion from the 1 3A g to the 1 3B u state in carotenoids: dependence on the conjugation length

NASA Astrophysics Data System (ADS)

Rondonuwu, Ferdy S.; Watanabe, Yasutaka; Fujii, Ritsuko; Koyama, Yasushi

2003-07-01

Subpicosecond time-resolved absorption spectra were recorded in the visible region for a set of photosynthetic carotenoids having different numbers of conjugated double bonds ( n), which include neurosporene ( n=9), spheroidene ( n=10), lycopene ( n=11), anhydrorhodovibrin ( n=12) and spirilloxanthin ( n=13). Singular-value decomposition and global fitting of the spectral-data matrices lead us to a branched relaxation scheme including both (1) the singlet internal conversion in the sequence of 1 1B u+ → 1 1B u- → 2 1A g- → 1 1A g-(ground), and (2) the singlet-to-triplet conversion of 1 1B u- → 1 3A g followed by triplet internal conversion of 1 3A g → 1 3B u.

Effect of Radiofrequency Radiation Emitted from 2G and 3G Cell Phone on Developing Liver of Chick Embryo - A Comparative Study.

PubMed

D'Silva, Mary Hydrina; Swer, Rijied Thompson; Anbalagan, J; Rajesh, Bhargavan

2017-07-01

The increasing scientific evidence of various health hazards on exposure of Radiofrequency Radiation (RFR) emitted from both the cell phones and base stations have caused significant media attention and public discussion in recent years. The mechanism of interaction of RF fields with developing tissues of children and fetuses may be different from that of adults due to their smaller physical size and variation in tissue electromagnetic properties. The present study may provide an insight into the basic mechanisms by which RF fields interact with developing tissues in an embryo. To evaluate the possible tissue and DNA damage in developing liver of chick embryo following chronic exposure to Ultra-High Frequency/Radiofrequency Radiation (UHF/RFR) emitted from 2G and 3G cell phone. Fertilized chick embryos were incubated in four groups. Group A-experimental group exposed to 2G radiation (60 eggs), Group B- experimental group exposed to 3G radiation (60 eggs), Group C- sham exposed control group (60 eggs) and Group D- control group (48 eggs). On completion of scheduled duration, the embryos were collected and processed for routine histological studies to check structural changes in liver. The nuclear diameter and karyorrhexis changes of hepatocytes were analysed using oculometer and square reticule respectively. The liver procured from one batch of eggs from all the four groups was subjected to alkaline comet assay technique to assess DNA damage. The results were compared using one-way ANOVA test. In our study, the exposure of developing chick embryos to 2G and 3G cell phone radiations caused structural changes in liver in the form of dilated sinusoidal spaces with haemorrhage, increased vacuolations in cytoplasm, increased nuclear diameter and karyorrhexis and significantly increased DNA damage. The chronic exposure of chick embryo liver to RFR emitted from 2G and 3G cell phone resulted in various structural changes and DNA damage. The changes were more pronounced in 3

FoxG1 and TLE2 act cooperatively to regulate ventral telencephalon formation.

PubMed

Roth, Martin; Bonev, Boyan; Lindsay, Jennefer; Lea, Robert; Panagiotaki, Niki; Houart, Corinne; Papalopulu, Nancy

2010-05-01

FoxG1 is a conserved transcriptional repressor that plays a key role in the specification, proliferation and differentiation of the telencephalon, and is expressed from the earliest stages of telencephalic development through to the adult. How the interaction with co-factors might influence the multiplicity and diversity of FoxG1 function is not known. Here, we show that interaction of FoxG1 with TLE2, a Xenopus tropicalis co-repressor of the Groucho/TLE family, is crucial for regulating the early activity of FoxG1. We show that TLE2 is co-expressed with FoxG1 in the ventral telencephalon from the early neural plate stage and functionally cooperates with FoxG1 in an ectopic neurogenesis assay. FoxG1 has two potential TLE binding sites: an N-terminal eh1 motif and a C-terminal YWPMSPF motif. Although direct binding seems to be mediated by the N-terminal motif, both motifs appear important for functional synergism. In the neurogenesis assay, mutation of either motif abolishes functional cooperation of TLE2 with FoxG1, whereas in the forebrain deletion of both motifs renders FoxG1 unable to induce the ventral telencephalic marker Nkx2.1. Knocking down either FoxG1 or TLE2 disrupts the development of the ventral telencephalon, supporting the idea that endogenous TLE2 and FoxG1 work together to specify the ventral telencephalon.

FoxG1 and TLE2 act cooperatively to regulate ventral telencephalon formation

PubMed Central

Roth, Martin; Bonev, Boyan; Lindsay, Jennefer; Lea, Robert; Panagiotaki, Niki; Houart, Corinne; Papalopulu, Nancy

2010-01-01

FoxG1 is a conserved transcriptional repressor that plays a key role in the specification, proliferation and differentiation of the telencephalon, and is expressed from the earliest stages of telencephalic development through to the adult. How the interaction with co-factors might influence the multiplicity and diversity of FoxG1 function is not known. Here, we show that interaction of FoxG1 with TLE2, a Xenopus tropicalis co-repressor of the Groucho/TLE family, is crucial for regulating the early activity of FoxG1. We show that TLE2 is co-expressed with FoxG1 in the ventral telencephalon from the early neural plate stage and functionally cooperates with FoxG1 in an ectopic neurogenesis assay. FoxG1 has two potential TLE binding sites: an N-terminal eh1 motif and a C-terminal YWPMSPF motif. Although direct binding seems to be mediated by the N-terminal motif, both motifs appear important for functional synergism. In the neurogenesis assay, mutation of either motif abolishes functional cooperation of TLE2 with FoxG1, whereas in the forebrain deletion of both motifs renders FoxG1 unable to induce the ventral telencephalic marker Nkx2.1. Knocking down either FoxG1 or TLE2 disrupts the development of the ventral telencephalon, supporting the idea that endogenous TLE2 and FoxG1 work together to specify the ventral telencephalon. PMID:20356955

26 CFR 1.665(g)-2A - Application of separate share rule.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 26 Internal Revenue 8 2011-04-01 2011-04-01 false Application of separate share rule. 1.665(g)-2A Section 1.665(g)-2A Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED... Taxable Years Beginning on Or After January 1, 1969 § 1.665(g)-2A Application of separate share rule. (a...

26 CFR 1.665(g)-2A - Application of separate share rule.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 26 Internal Revenue 8 2013-04-01 2013-04-01 false Application of separate share rule. 1.665(g)-2A Section 1.665(g)-2A Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED... Taxable Years Beginning on Or After January 1, 1969 § 1.665(g)-2A Application of separate share rule. (a...

26 CFR 1.665(g)-2A - Application of separate share rule.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 26 Internal Revenue 8 2012-04-01 2012-04-01 false Application of separate share rule. 1.665(g)-2A Section 1.665(g)-2A Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED... Taxable Years Beginning on Or After January 1, 1969 § 1.665(g)-2A Application of separate share rule. (a...

26 CFR 1.665(g)-2A - Application of separate share rule.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 26 Internal Revenue 8 2010-04-01 2010-04-01 false Application of separate share rule. 1.665(g)-2A Section 1.665(g)-2A Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED... Years Beginning on Or After January 1, 1969 § 1.665(g)-2A Application of separate share rule. (a) In...

26 CFR 1.665(g)-2A - Application of separate share rule.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 26 Internal Revenue 8 2014-04-01 2014-04-01 false Application of separate share rule. 1.665(g)-2A Section 1.665(g)-2A Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED... Taxable Years Beginning on Or After January 1, 1969 § 1.665(g)-2A Application of separate share rule. (a...

O2(b1Σg+, v = 0, 1) Relative Yield in O(1D) + O2 Energy Transfer

NASA Astrophysics Data System (ADS)

Kostko, O.; Raj, S.; Campbell, K. M.; Pejakovic, D. A.; Slanger, T. G.; Kalogerakis, K. S.

2012-04-01

Energy transfer from excited O(1D) atoms to ground-state O2(X3Σg-) leads to production of O2 in the first two vibrational levels of the O2(b1Σg+) state: O(1D) + O2 → O(3P ) + O2(b1Σg+, v = 0, 1). Subsequent radiative decay of O2(b1Σg+, v = 0, 1) to the ground state results in the Atmospheric Band emission, a prominent feature of the terrestrial airglow. The relative yield for production of O2(b1Σg+, v = 0, 1) in the above process, k1/k0, is an important parameter in modeling of the observed O2 Atmospheric Band emission intensities. In the laboratory experiments, the output of a pulsed fluorine laser at 157 nm is used to photodissociate molecular oxygen in an O2/N2 mixture flowing through a heated gas cell. Photodissociation of O2 produces a ground-state O(3P ) atom and an excited O(1D) atom. O(1D) rapidly transfers energy to the remaining O2 to produce O2(b1Σg+, v = 0, 1). The populations of O2(b1Σg+, v = 0, 1) are monitored by observing emissions in the O2(b-X) 0-0 and 1-0 bands at 762 and 688 nm, respectively. The value of k1/k0 is extracted from the time-dependent O2(b1Σg+, v = 0, 1) fluorescence signals using computer simulations. We find that production of v = 1 is substantially larger than that of v = 0. We will present measurements on k1/k0 and its temperature dependence, and discuss the significance of these and other relevant laboratory measurements on the interpretation of the O2 Atmospheric Band emission. This work was supported by the US National Science Foundation (NSF) Aeronomy Program under grant AGS-0937317. The fluorine laser was purchased under grant ATM-0216583 from the NSF Major Research Instrumentation Program. The participation of Sumana Raj and Kendrick M. Campbell was supported by a Research Experiences for Undergraduates (REU) site, co-funded by the Division of Physics of the NSF and the Department of Defense in partnership with the NSF REU program (PHY-1002892).

Expression of progesterone receptor B is associated with G0/G1 arrest of the cell cycle and growth inhibition in NIH3T3 cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Horiuchi, Shinji; Kato, Kiyoko; Suga, Shin

2005-05-01

Previously, we found a significant reduction of progesterone receptor B (PR-B) expression levels in the Ras-mediated NIH3T3 cell transformation, and re-expression of exogenous PR-B eliminated the tumorigenic potential. We hypothesized that this reduction is of biological significance in cell transformation. In the present study, we determined the correlation between PR-B expression and cell cycle progression. In synchronized NIH3T3 cells, we found an increase in PR-B protein and p27 CDK inhibitor levels in the G0/G1 phase and a reduction due to redistribution in the S and G2/M phases. The MEK inhibitor or cAMP stimulation arrested NIH3T3 cells in the G0/G1 phasemore » of the cell cycle. The expression of PR-B and p27 CDK inhibitors was up-regulated by treatment with both the MEK inhibitor and cAMP. Treatment of synchronized cells with a PKA inhibitor in the presence of 1% calf serum resulted in a significant reduction in both PR-B and p27 levels. The decrease in the PR-B levels caused by anti-sense oligomers or siRNA corresponded to the reduction in p27 levels. PR-B overexpression by adenovirus infection induced p27 and suppressed cell growth. Finally, we showed that PR-B modulation involved in the regulation of NIH3T3 cell proliferation was independent of nuclear estrogen receptor (ER) activity but dependent on non-genomic ER activity.« less

26 CFR 1.904(g)-2T - Recapture of overall domestic losses (temporary).

Code of Federal Regulations, 2010 CFR

2010-04-01

...). 1.904(g)-2T Section 1.904(g)-2T Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE....904(g)-2T Recapture of overall domestic losses (temporary). (a) In general. A taxpayer shall recapture... provided in § 1.904(g)-1T(f)(2), the balance in a taxpayer's overall domestic loss account with respect to...

IRE1α links Nck1 deficiency to attenuated PTP1B expression in HepG2 cells.

PubMed

Li, Hui; Li, Bing; Larose, Louise

2017-08-01

PTP1B, a prototype of the non-receptor subfamily of the protein tyrosine phosphatase superfamily, plays a key role in regulating intracellular signaling from various receptor and non-receptor protein tyrosine kinases. Previously, we reported that silencing Nck1 in human hepatocellular carcinoma HepG2 cells enhances basal and growth factor-induced activation of the PI3K-Akt pathway through attenuating PTP1B expression. However, the underlying mechanism by which Nck1 depletion represses PTP1B expression remains unclear. In this study, we found that silencing Nck1 attenuates PTP1B expression in HepG2 cells through down-regulation of IRE1α. Indeed, we show that silencing Nck1 in HepG2 cells leads to decreased IRE1α expression and signaling. Accordingly, IRE1α depletion using siRNA in HepG2 cells enhances PI3K-dependent basal and growth factor-induced Akt activation, reproducing the effects of silencing Nck1 on activation of this pathway. In addition, depletion of IRE1α also leads to reduced PTP1B expression, which was rescued by ectopic expression of IRE1α in Nck1-depleted cells. Mechanistically, we found that silencing either Nck1 or IRE1α in HepG2 cells decreases PTP1B mRNA levels and stability. However, despite miR-122 levels, a miRNA targeting PTP1B 3' UTR and inducing PTP1B mRNA degradation in HepG2 cells, are increased in both Nck1- and IRE1α-depleted HepG2 cells, a miR-122 antagomir did not rescue PTP1B expression in these cells. Overall, this study highlights an important role for Nck1 in fine-tuning IRE1α expression and signaling that regulate PTP1B expression and subsequent activation of the PI3K-Akt pathway in HepG2 cells. Copyright © 2017 Elsevier Inc. All rights reserved.

Tubeimoside-1 induces oxidative stress-mediated apoptosis and G0/G1 phase arrest in human prostate carcinoma cells in vitro

PubMed Central

Yang, Jing-bo; Khan, Muhammad; He, Yang-yang; Yao, Min; Li, Yong-ming; Gao, Hong-wen; Ma, Tong-hui

2016-01-01

Aim: Tubeimoside-1 (TBMS1), a triterpenoid saponin extracted from the Chinese herbal medicine Bolbostemma paniculatum (Maxim) Franquet (Cucurbitaceae), has shown anticancer activities in various cancer cell lines. The aim of this study was to investigate the anticancer activity and molecular targets of TBMS1 in human prostate cancer cells in vitro. Methods: DU145 and P3 human prostate cancer cells were treated with TBMS1. Cell viability and apoptosis were detected. ROS generation, mitochondrial membrane potential and cell cycle profile were examined. Western blotting was used to measure the expression of relevant proteins in the cells. Results: TBMS1 (5–100 μmol/L) significantly suppressed the viability of DU145 and P3 cells with IC50 values of approximately 10 and 20 μmol/L, respectively. Furthermore, TBMS1 dose-dependently induced apoptosis and cell cycle arrest at G0/G1 phase in DU145 and P3 cells. In DU145 cells, TBMS1 induced mitochondrial apoptosis, evidenced by ROS generation, mitochondrial dysfunction, endoplasmic reticulum stress, modulated Bcl-2 family protein and cleaved caspase-3, and activated ASK-1 and its downstream targets p38 and JNK. The G0/G1 phase arrest was linked to increased expression of p53 and p21 and decreased expression of cyclin E and cdk2. Co-treatment with Z-VAD-FMK (pan-caspase inhibitor) could attenuate TBMS1-induced apoptosis but did not prevent G0/G1 arrest. Moreover, co-treatment with NAC (ROS scavenger), SB203580 (p38 inhibitor), SP600125 (JNK inhibitor) or salubrinal (ER stress inhibitor) significantly attenuated TBMS1-induced apoptosis. Conclusion: TBMS1 induces oxidative stress-mediated apoptosis in DU145 human prostate cancer cells in vitro via the mitochondrial pathway. PMID:27292614

Foot-and-Mouth Disease Virus Counteracts on Internal Ribosome Entry Site Suppression by G3BP1 and Inhibits G3BP1-Mediated Stress Granule Assembly via Post-Translational Mechanisms

PubMed Central

Ye, Xu; Pan, Ting; Wang, Dang; Fang, Liurong; Ma, Jun; Zhu, Xinyu; Shi, Yanling; Zhang, Keshan; Zheng, Haixue; Chen, Huanchun; Li, Kui; Xiao, Shaobo

2018-01-01

Foot-and-mouth disease (FMD) is a highly contagious, severe viral illness notifiable to the World Organization for Animal Health. The causative agent, FMD virus (FMDV), replicates rapidly and efficiently inhibits host translation and the innate immune response for it has developed multiple tactics to evade host defenses and takes over gene expression machinery in the host cell. Here, we report a systemic analysis of the proteome and phosphoproteome of FMDV-infected cells. Bioinformatics analysis suggested that FMDV infection shuts off host cap-dependent translation, but leaves intact internal ribosome entry site (IRES)-mediated translation for viral proteins. Interestingly, several FMDV IRES-transacting factors, including G3BP stress granule assembly factor 1 (G3BP1), were dephosphorylated during FMDV infection. Ectopic expression of G3BP1 inhibited FMDV IRES activity, promoted assembly of stress granules, and activated innate immune responses, collectively suppressing FMDV replication. To counteract these host protective responses, FMDV-induced dephosphorylation of G3BP1, compromising its inhibitory effect on viral IRES. In addition, FMDV also proteolytically cleaved G3BP1 by its 3C protease (3Cpro). G3BP1 was cleaved at glutamic acid-284 (E284) by FMDV 3Cpro, and this cleavage completely lost the abilities of G3BP1 to activate innate immunity and to inhibit FMDV replication. Together, these data provide new insights into the post-translational mechanisms by which FMDV limits host stress and antiviral responses and indicate that G3BP1 dephosphorylation and its proteolysis by viral protease are important factors in the failure of host defense against FMDV infection.

High-throughput screening and stability optimization of anti-streptavidin IgG1 and IgG2 formulations.

PubMed

Alekseychyk, Larysa; Su, Cheng; Becker, Gerald W; Treuheit, Michael J; Razinkov, Vladimir I

2014-10-01

Selection of a suitable formulation that provides adequate product stability is an important aspect of the development of biopharmaceutical products. Stability of proteins includes not only resistance to chemical modifications but also conformational and colloidal stabilities. While chemical degradation of antibodies is relatively easy to detect and control, propensity for conformational changes and/or aggregation during manufacturing or long-term storage is difficult to predict. In many cases, the formulation factors that increase one type of stability may significantly decrease another type under the same or different conditions. Often compromise is necessary to minimize the adverse effects of an antibody formulation by careful optimization of multiple factors responsible for overall stability. In this study, high-throughput stress and characterization techniques were applied to 96 formulations of anti-streptavidin antibodies (an IgG1 and an IgG2) to choose optimal formulations. Stress and analytical methods applied in this study were 96-well plate based using an automated liquid handling system to prepare the different formulations and sample plates. Aggregation and clipping propensity were evaluated by temperature and mechanical stresses. Multivariate regression analysis of high-throughput data was performed to find statistically significant formulation factors that alter measured parameters such as monomer percentage or unfolding temperature. The results of the regression models were used to maximize the stabilities of antibodies under different formulations and to find the optimal formulation space for each molecule. Comparison of the IgG1 and IgG2 data indicated an overall greater stability of the IgG1 molecule under the conditions studied. The described method can easily be applied to both initial preformulation screening and late-stage formulation development of biopharmaceutical products. © 2014 Society for Laboratory Automation and Screening.

Novel Epstein-Barr virus-like particles incorporating gH/gL-EBNA1 or gB-LMP2 induce high neutralizing antibody titers and EBV-specific T-cell responses in immunized mice

PubMed Central

Perez, Elizabeth M.; Foley, Joslyn; Tison, Timelia; Silva, Rute; Ogembo, Javier Gordon

2017-01-01

Previous Epstein-Barr virus (EBV) prophylactic vaccines based on the major surface glycoprotein gp350/220 as an immunogen have failed to block viral infection in humans, suggesting a need to target other viral envelope glycoproteins. In this study, we reasoned that incorporating gH/gL or gB, critical glycoproteins for viral fusion and entry, on the surface of a virus-like particle (VLP) would be more immunogenic than gp350/220 for generating effective neutralizing antibodies to prevent viral infection of both epithelial and B cell lines. To boost the humoral response and trigger cell-mediated immunity, EBV nuclear antigen 1 (EBNA1) and latent membrane protein 2 (LMP2), intracellular latency proteins expressed in all EBV-infected cells, were also included as critical components of the polyvalent EBV VLP. gH/gL-EBNA1 and gB-LMP2 VLPs were efficiently produced in Chinese hamster ovary cells, an FDA-approved vehicle for mass-production of biologics. Immunization with gH/gL-EBNA1 and gB-LMP2 VLPs without adjuvant generated both high neutralizing antibody titers in vitro and EBV-specific T-cell responses in BALB/c mice. These data demonstrate that EBV glycoprotein(s)-based VLPs have excellent immunogenicity, and represent a potentially safe vaccine that will be invaluable not only in preventing EBV infection, but importantly, in preventing and treating the 200,000 cases of EBV-associated cancers that occur globally every year. PMID:27926486

Comparison of clinical outcome between 23-G and 25-G vitrectomy in diabetic patients

PubMed Central

Taleb, Eman Abo; Nagpal, Manish P.; Mehrotra, Navneet S.; Bhatt, Kalyani; Goswami, Sangeeta; Babalola, Yewande O.; Noman, Abdulrahman

2017-01-01

PURPOSE: To compare the clinical outcomes and complications between 23-G and 25-G vitrectomy in patients with diabetic vitreous hemorrhage (VH). MATERIALS AND METHODS: A retrospective comparative study comprising 69 eyes (36 eyes in 23-G group and 33 eyes in 25-G group) of 65 patients who underwent vitrectomy with air tamponade for diabetic vitreous hemorrhage (VH) with at least 6 months of follow-up was conducted. RESULTS: There were no significant differences between the two groups in age, gender, bilaterality, type of diabetes, presence of hypertension, lens status, and previous argon laser photocoagulation state (P > 0.05). Best-corrected visual acuity (BCVA) of both groups at postoperative 1 month logarithm of the minimum angle of resolution (logMAR) (1.06 ± 0.99, 0.90 ± 0.96), 3 months logMAR (1.07 ± 0.93, 0.83 ± 0.85), and 6 months logMAR (1.03 ± 0.89, 0.83 ± 0.85) significantly improved from the preoperative BCVA logMAR (2.03 ± 0.83, 2.15 ± 0.99) for 23-G group, 25-G group, respectively (P < 0.0001). There was no significant difference in BCVA between the two groups preoperatively and at 1, 3, and 6 months postoperatively (P = 0.566, 0.506, 0.333, and 0.445, respectively), incidence of intraoperative wound suturing (21.4%, 15.2%), postoperative hypotony (0.0%, 0.0%), early postoperative VH (POVH) (11.1%, 15.2%), late POVH (5.6%, 0.0%), retinal detachment (2.8%, 6.1%), neovascular glaucoma (92.8%, 9.1%), and endophthalmitis (0.0%, 0.0%) for 23-G group, 25-G group, respectively (P > 0.05). CONCLUSION: 25-G vitrectomy is as effective for PDR as 23-G vitrectomy. PMID:29118498

Comparison of clinical outcome between 23-G and 25-G vitrectomy in diabetic patients.

PubMed

Taleb, Eman Abo; Nagpal, Manish P; Mehrotra, Navneet S; Bhatt, Kalyani; Goswami, Sangeeta; Babalola, Yewande O; Noman, Abdulrahman

2017-01-01

To compare the clinical outcomes and complications between 23-G and 25-G vitrectomy in patients with diabetic vitreous hemorrhage (VH). A retrospective comparative study comprising 69 eyes (36 eyes in 23-G group and 33 eyes in 25-G group) of 65 patients who underwent vitrectomy with air tamponade for diabetic vitreous hemorrhage (VH) with at least 6 months of follow-up was conducted. There were no significant differences between the two groups in age, gender, bilaterality, type of diabetes, presence of hypertension, lens status, and previous argon laser photocoagulation state ( P > 0.05). Best-corrected visual acuity (BCVA) of both groups at postoperative 1 month logarithm of the minimum angle of resolution (logMAR) (1.06 ± 0.99, 0.90 ± 0.96), 3 months logMAR (1.07 ± 0.93, 0.83 ± 0.85), and 6 months logMAR (1.03 ± 0.89, 0.83 ± 0.85) significantly improved from the preoperative BCVA logMAR (2.03 ± 0.83, 2.15 ± 0.99) for 23-G group, 25-G group, respectively ( P < 0.0001). There was no significant difference in BCVA between the two groups preoperatively and at 1, 3, and 6 months postoperatively ( P = 0.566, 0.506, 0.333, and 0.445, respectively), incidence of intraoperative wound suturing (21.4%, 15.2%), postoperative hypotony (0.0%, 0.0%), early postoperative VH (POVH) (11.1%, 15.2%), late POVH (5.6%, 0.0%), retinal detachment (2.8%, 6.1%), neovascular glaucoma (92.8%, 9.1%), and endophthalmitis (0.0%, 0.0%) for 23-G group, 25-G group, respectively ( P > 0.05). 25-G vitrectomy is as effective for PDR as 23-G vitrectomy.

4G/5G and A-844G Polymorphisms of Plasminogen Activator Inhibitor-1 Associated with Glioblastoma in Iran--a Case-Control Study.

PubMed

Pooyan, Honari; Ahmad, Ebrahimi; Azadeh, Rakhshan

2015-01-01

Glioblastoma is a highly aggressive and malignant brain tumor. Risk factors are largely unknown however, although several biomarkers have been identified which may support development, angiogenesis and invasion of tumor cells. One of these biomarkers is PAI-1. 4G/5G and A-844G are two common polymorphisms in the gene promotor of PAI 1 that may be related to high transcription and expression of this gene. Studies have shown that the prevalence of the 4G and 844G allele is significantly higher in patients with some cancers and genetic disorders. We here assessed the association of 4G/5G and A-844G polymorphisms with glioblastoma cancer risk in Iranians in a case-control study. All 71 patients with clinically confirmed and 140 volunteers with no history and symptoms of glioblastoma as control group were screened for 4G/5G and A-844G polymorphisms of PAI-1, using ARMS-PCR. Genotype and allele frequencies of case and control groups were analyzed using the DeFinetti program. Our results showed significant associations between 4G/5G (p=0.01824) and A-844G (p=0.02012) polymorphisms of the PAI-1 gene with glioblastoma cancer risk in our Iranian population. The results of this study supporting an association of the PAI-1 4G/5G (p=0.01824) and A-844G (p=0.02012) polymorphisms with increasing glioblastoma cancer risk in Iranian patients.

Plasminogen activator inhibitor-1 4G/5G gene polymorphism and primary open-angle glaucoma

PubMed Central

Weger, Martin; Faschinger, Christoph; Schmut, Otto; Renner, Wilfried

2008-01-01

Purpose Alterations of the plasmin system have been suggested to participate in the multifactorial pathogenesis of primary open-angle glaucoma (POAG). The main physiological inhibitor of the plasmin system is plasminogen activator inhibitor-1 (PAI-1), which leads to decreased degradation of extracellular material. Interestingly, elevated PAI-1 levels in the aqueous humor of patients with POAG have been reported. A common polymorphism within the promoter region (PAI-1 4G/5G) has previously been shown to reduce the gene transcription rate of PAI-1. The purpose of the present study was to investigate a hypothesized association between PAI-1 4G/5G and the presence of POAG in a Caucasian population. Methods The present case-control study comprised 212 unrelated patients with POAG and 212 healthy control subjects, matched for age and sex. Genotyping of PAI-1 4G/5G polymorphisms was done using polymerase chain reaction. Results Allelic frequencies and genotype distributions of PAI-1 4G/5G did not significantly differ between patients with POAG and control subjects (PAI-1 4G/5G: 29.7% versus 29.7%). Presence of the PAI-1 4G-allele was associated with a nonsignificant odds ratio of 0.98 (95% confidence interval: 0.74–1.30) for POAG. Conclusions Our data suggest that PAI-1 4G/5G itself is unlikely to be a major risk factor among Caucasian patients with POAG. PMID:18615155

An ingenious strategy of preparing TiO2/g-C3N4 heterojunction photocatalyst: In situ growth of TiO2 nanocrystals on g-C3N4 nanosheets via impregnation-calcination method

NASA Astrophysics Data System (ADS)

Zhang, Guanghui; Zhang, Tianyong; Li, Bin; Jiang, Shuang; Zhang, Xia; Hai, Li; Chen, Xingwei; Wu, Wubin

2018-03-01

An ingenious method was employed to design and fabricate the TiO2/g-C3N4 heterojunction photocatalysts in this study. The thermal oxidation etching of g-C3N4 nanosheets and the in situ growth of TiO2 nanocrystal on the surface of g-C3N4 nanosheets were completed simultaneously by the calcination process. The g-C3N4 nanosheets played a crucial role in regulating and assembling the structures and morphologies of TiO2. Furthermore, the thickness and content of g-C3N4, and the crystallinity of TiO2 in TiO2/g-C3N4 composites could be regulated and controlled by the calcination temperature. Among the resultant TiO2/g-C3N4 samples, the TiO2/g-C3N4 sample with 41.6 wt% g-C3N4 exhibited the highest photocatalytic activity. It could degrade almost all MO molecules under visible light irradiation within 3 h. Moreover, it displayed higher visible light photocatalytic performance for degrading MO solution than pure g-C3N4 and D-TiO2. The synergistic effect between TiO2 and g-C3N4 makes significant contributions to the enhancement of the visible light photocatalytic activity. In addition, the favorable photocatalytic performance of TiO2/g-C3N4 nanocomposites is also attributed to the porous structures and uniform morphologies, and large surface area. Furthermore, the resultant TiO2/g-C3N4 exhibits excellent photocatalytic stability. Radical trapping experiments indicated that rad O2- and h+ were the main reactive species during the photodegradation process under visible light irradiation. Hopefully, the results can offer new design and strategy for preparing other g-C3N4-based nanocomposites for environmental and energy applications.