Sample records for g1 g2 g4

  1. Overview of Shipyard coast line with Piers G1, G2, G3, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Overview of Shipyard coast line with Piers G-1, G-2, G-3, G-4, and G-5 in view, view facing east-southeast - U.S. Naval Base, Pearl Harbor, Pier & Quay Walls, Entrance to Dry Dock No. 2 & Repair Wharfs, east & west sides of Dry Dock No. 2 & west side of Dry Dock No. 3, Pearl City, Honolulu County, HI

  2. The association between PAI-1 -675 4G/5G polymorphism and type 2 diabetes mellitus.

    PubMed

    Chen, L; Li, S-Y; Liu, M

    2017-08-15

    In this study, we aimed to analyze the association between plasminogen activator inhibitor 1 (PAI-1) -675 4G/5G polymorphism and type 2 diabetes mellitus (T2DM) risk. We included in 187 T2DM patients and 186 heathy controls between 2014 and 2017 from Tianjin Gong An Hospital, China. All patients and controls were ethnically Chinese Han population. The primers and polymerase chain reaction (PCR) conditions were performed. Results from this case-control study suggested that PAI-1 -675 4G/5G polymorphism was not associated with T2DM risk in four genetic models. Additionally, PAI-1 -675 4G/5G polymorphism was not associated with clinical and laboratory characteristics, such as age, gender, body mass index, systolic blood pressure, diastolic blood pressure, total cholesterol, triglycerides, and HbA1c. In conclusion, this case-control study suggested that PAI-1 -675 4G/5G polymorphism was not associated with T2DM risk in this population.

  3. PAI-1 4G/5G polymorphism contributes to cancer susceptibility: evidence from meta-analysis.

    PubMed

    Wang, Shangqian; Cao, Qiang; Wang, Xiaoxiang; Li, Bingjie; Tang, Min; Yuan, Wanqing; Fang, Jianzheng; Qian, Jian; Qin, Chao; Zhang, Wei

    2013-01-01

    The plasminogen activator inhibitor-1 (PAI-1) is expressed in many cancer cell types and allows the modulation of cancer growth, invasion and angiogenesis. To date, studies investigated the association between a functional polymorphism in PAI-1 (4G/5G) and risk of cancer have shown inclusive results. A meta-analysis based on 25 case-control studies was performed to address this issue. Odds ratios (OR) with corresponding 95% confidence intervals (CIs) were used to assess the association. The statistical heterogeneity across studies was examined with I(2) test. Overall, a significant increased risk of cancer was associated with the PAI-1 4G/4G polymorphism for the allele contrast (4G vs. 5G: OR = 1.10, CI = 1.03-1.18, I(2) = 49.5%), the additive genetic model (4G/4G vs. 5G/5G: OR = 1.21, CI = 1.06-1.39, I(2) = 51.9%), the recessive genetic model (4G/4G vs. 4G/5G+5G/5G: OR = 1.11, CI = 1.04-1.18, I(2) = 20.8%). In the subgroup analysis by ethnicity, the results indicated that individuals with 4G/4G genotype had a significantly higher cancer risk among Caucasians (4G/4G vs. 5G/5G: OR = 1.31, 95%CI = 1.09-1.59, I(2) = 59.6%; 4G/4G vs. 4G/5G: OR = 1.12, 95%CI = 1.04-1.21, I(2) = 3.6%; recessive model: OR = 1.12, 95%CI = 1.05-1.21, I(2) = 25.3%). The results of the present meta-analysis support an association between the PAI-1 4G/5G polymorphism and increasing cancer risk, especially among Caucasians, and those with 4G allele have a high risk to develop colorectal cancer and endometrial cancer.

  4. Reduced carriership of 4G allele of plasminogen activator inhibitor-1 4G/5G polymorphism in very young survivors of myocardial infarction.

    PubMed

    Rallidis, Loukianos S; Gialeraki, Argyri; Merkouri, Efrosyni; Liakos, George; Dagres, Nikolaos; Sionis, Dimitrios; Travlou, Anthi; Lekakis, John; Kremastinos, Dimitrios T

    2010-05-01

    There are limited and controversial data regarding the impact of 4G/5G polymorphism of the plasminogen activator inhibitor-1 (PAI-1) gene in the pathogenesis of premature myocardial infarction (MI). We explored whether 4G/5G polymorphism of the PAI-1 gene is associated with the development of MI 2 +/- 3.4 years). The control group consisted of 140 healthy individuals matched with cases for age and sex, without a family history of premature coronary heart disease. 4G/5G polymorphism of PAI-1 was tested with polymerase chain reaction and reverse hybridization. 4G allele carriers (4G/4G and 4G/5G genotypes) of PAI-1 were less frequent in patients than in controls (69.6 vs. 83.6%, P = 0.007). 4G carriership of the polymorphism of PAI-1 was associated with lower risk for acute MI (odds ratio 0.45, 95% confidence interval 0.23-0.88, P = 0.02) after adjusting for major cardiovascular risk factors. Patients possessing the 4G allele had higher PAI-1 plasma levels (32.2 +/- 25 vs. 22.2 +/- 11.3 ng/ml, P = 0.006) but lower lipoprotein(a) levels (10.1 [2.1-29.9] vs. 15.3 [8.2-57.1] mg/dl, P = 0.03) compared to 5G/5G homozygotes. Our data indicate that the 4G allele of the PAI-1 4G/5G polymorphism is less frequent among survivors of MI at very young age compared with matched controls.

  5. Plasminogen activator inhibitor-1 4G/5G polymorphism and retinopathy risk in type 2 diabetes: a meta-analysis.

    PubMed

    Zhang, Tengyue; Pang, Chong; Li, Ningdong; Zhou, Elaine; Zhao, Kanxing

    2013-01-02

    Mounting evidence has suggested that plasminogen activator inhibitor-1 (PAI-1) is a candidate for increased risk of diabetic retinopathy. Studies have reported that insertion/deletion polymorphism in the PAI-1 gene may influence the risk of this disease. To comprehensively address this issue, we performed a meta-analysis to evaluate the association of PAI-1 4G/5G polymorphism with diabetic retinopathy in type 2 diabetes. Data were retrieved in a systematic manner and analyzed using Review Manager and STATA Statistical Software. Crude odds ratios (ORs) with 95% confidence intervals (CIs) were used to assess the strength of associations. Nine studies with 1, 217 cases and 1, 459 controls were included. Allelic and genotypic comparisons between cases and controls were evaluated. Overall analysis suggests a marginal association of the 4G/5G polymorphism with diabetic retinopathy (for 4G versus 5G: OR 1.13, 95%CI 1.01 to 1.26; for 4G/4G versus 5G/5G: OR 1.30, 95%CI 1.04 to 1.64; for 4G/4G versus 5G/5G + 4G/5G: OR 1.26, 95%CI 1.05 to 1.52). In subgroup analysis by ethnicity, we found an association among the Caucasian population (for 4G versus 5G: OR 1.14, 95% CI 1.00 to 1.30; for 4G/4G versus 5G/5G: OR 1.33, 95%CI 1.02 to 1.74; for 4G/4G versus 5G/5G + 4G/5G: OR 1.41, 95%CI 1.13 to 1.77). When stratified by the average duration of diabetes, patients with diabetes histories longer than 10 years have an elevated susceptibility to diabetic retinopathy than those with shorter histories (for 4G/4G versus 5G/5G: OR 1.47, 95%CI 1.08 to 2.00). We also detected a higher risk in hospital-based studies (for 4G/4G versus 5G/5G+4G/5G: OR 1.27, 95%CI 1.02 to 1.57). The present meta-analysis suggested that 4G/5G polymorphism in the PAI-1 gene potentially increased the risk of diabetic retinopathy in type 2 diabetes and showed a discrepancy in different ethnicities. A higher susceptibility in patients with longer duration of diabetes (more than 10 years) indicated a gene

  6. Plasminogen activator inhibitor-1 4G/5G polymorphism and retinopathy risk in type 2 diabetes: a meta-analysis

    PubMed Central

    2013-01-01

    Background Mounting evidence has suggested that plasminogen activator inhibitor-1 (PAI-1) is a candidate for increased risk of diabetic retinopathy. Studies have reported that insertion/deletion polymorphism in the PAI-1 gene may influence the risk of this disease. To comprehensively address this issue, we performed a meta-analysis to evaluate the association of PAI-1 4G/5G polymorphism with diabetic retinopathy in type 2 diabetes. Methods Data were retrieved in a systematic manner and analyzed using Review Manager and STATA Statistical Software. Crude odds ratios (ORs) with 95% confidence intervals (CIs) were used to assess the strength of associations. Results Nine studies with 1, 217 cases and 1, 459 controls were included. Allelic and genotypic comparisons between cases and controls were evaluated. Overall analysis suggests a marginal association of the 4G/5G polymorphism with diabetic retinopathy (for 4G versus 5G: OR 1.13, 95%CI 1.01 to 1.26; for 4G/4G versus 5G/5G: OR 1.30, 95%CI 1.04 to 1.64; for 4G/4G versus 5G/5G + 4G/5G: OR 1.26, 95%CI 1.05 to 1.52). In subgroup analysis by ethnicity, we found an association among the Caucasian population (for 4G versus 5G: OR 1.14, 95% CI 1.00 to 1.30; for 4G/4G versus 5G/5G: OR 1.33, 95%CI 1.02 to 1.74; for 4G/4G versus 5G/5G + 4G/5G: OR 1.41, 95%CI 1.13 to 1.77). When stratified by the average duration of diabetes, patients with diabetes histories longer than 10 years have an elevated susceptibility to diabetic retinopathy than those with shorter histories (for 4G/4G versus 5G/5G: OR 1.47, 95%CI 1.08 to 2.00). We also detected a higher risk in hospital-based studies (for 4G/4G versus 5G/5G+4G/5G: OR 1.27, 95%CI 1.02 to 1.57). Conclusions The present meta-analysis suggested that 4G/5G polymorphism in the PAI-1 gene potentially increased the risk of diabetic retinopathy in type 2 diabetes and showed a discrepancy in different ethnicities. A higher susceptibility in patients with longer duration of diabetes (more than 10

  7. Plasminogen activator inhibitor-1 4G/5G polymorphism is associated with type 2 diabetes risk

    PubMed Central

    Zhao, Luqian; Huang, Ping

    2013-01-01

    A number of studies were performed to assess the association between plasminogen activator inhibitor-1 (PAI-1) 4G/5G polymorphism and susceptibility to type 2 diabetes (T2DM). However, the results were inconsistent and inconclusive. In the present study, the possible association was investigated by a meta-analysis. Eligible articles were identified for the period up to June 2013. Pooled odds ratios (OR) with 95% confidence intervals (CI) were appropriately derived from random-effects models or fixed-effects models. Fourteen case-control studies with a total of 2487 cases and 3538 controls were eligible. In recessive model, PAI-1 4G/5G polymorphism was associated with T2DM risk (OR = 1.23; 95% CI 1.07-1.41; P = 0.004). In the subgroup analysis by ethnicity, a significant association was found among Asians (OR = 1.27; 95% CI 1.08-1.51; P = 0.005). This meta-analysis suggested that PAI-1 4G/5G polymorphism may be associated with T2DM development. PMID:24040470

  8. PAI-1 4G/5G Polymorphism Contributes to Cancer Susceptibility: Evidence from Meta-Analysis

    PubMed Central

    Li, Bingjie; Tang, Min; Yuan, Wanqing; Fang, Jianzheng; Qian, Jian; Qin, Chao; Zhang, Wei

    2013-01-01

    Background The plasminogen activator inhibitor-1 (PAI-1) is expressed in many cancer cell types and allows the modulation of cancer growth, invasion and angiogenesis. To date, studies investigated the association between a functional polymorphism in PAI-1 (4G/5G) and risk of cancer have shown inclusive results. Methods A meta-analysis based on 25 case-control studies was performed to address this issue. Odds ratios (OR) with corresponding 95% confidence intervals (CIs) were used to assess the association. The statistical heterogeneity across studies was examined with I2 test. Results Overall, a significant increased risk of cancer was associated with the PAI-1 4G/4G polymorphism for the allele contrast (4G vs. 5G: OR = 1.10, CI = 1.03–1.18, I2 = 49.5%), the additive genetic model (4G/4G vs. 5G/5G: OR = 1.21, CI = 1.06–1.39, I2 = 51.9%), the recessive genetic model (4G/4G vs. 4G/5G+5G/5G: OR = 1.11, CI = 1.04–1.18, I2 = 20.8%). In the subgroup analysis by ethnicity, the results indicated that individuals with 4G/4G genotype had a significantly higher cancer risk among Caucasians (4G/4G vs. 5G/5G: OR = 1.31, 95%CI = 1.09–1.59, I2 = 59.6%; 4G/4G vs. 4G/5G: OR = 1.12, 95%CI = 1.04–1.21, I2 = 3.6%; recessive model: OR = 1.12, 95%CI = 1.05–1.21, I2 = 25.3%). Conclusions The results of the present meta-analysis support an association between the PAI-1 4G/5G polymorphism and increasing cancer risk, especially among Caucasians, and those with 4G allele have a high risk to develop colorectal cancer and endometrial cancer. PMID:23437240

  9. Plasminogen activator inhibitor 1 4G/5G and -844G/A variants in idiopathic recurrent pregnancy loss.

    PubMed

    Magdoud, Kalthoum; Herbepin, Viviana G; Touraine, Renaud; Almawi, Wassim Y; Mahjoub, Touhami

    2013-09-01

    Plasminogen activator inhibitor type 1 (PAI-1) regulates fibrinolysis, and the common promoter region variants -675G/A (4G/5G) and -844G/A are associated with increased thrombotic risk. Despite evidence linking altered fibrinolysis with adverse pregnancy events, including idiopathic recurrent pregnancy loss (RPL), the contribution of PAI-1 variants to RPL risk remains controversial. We investigated the association between the PAI-1 -844G/A and 4G/5G (-675G/A) variants with altered risk of RPL. This was a case-control study involving 304 women with confirmed RPL and 371 age- and ethnically matched control women. PAI-1 genotyping was performed by PCR single-specific primer -675 (G/A) and real-time PCR (-844G/A) analysis. Minor allele frequency (MAF) of 4G/5G (P < 0.001), but not -844G/A (P = 0.507), was higher in RPL cases. PAI-1 4G/5G single-nucleotide polymorphism (SNP) was significantly associated with RPL under additive, dominant, and recessive genetic models; no association of -844G/A with RPL was seen irrespective of the genetic model tested. Taking common -844G/5G haplotype as reference (OR = 1.00), multivariate analysis confirmed the association of 4G-containing -844A/4G (P < 0.001) and -844G/4G (P = 0.011) haplotypes with increased RPL risk. 4G/5G, but not -844G/A, PAI-1 variant is associated with an increased risk of RPL. © 2013 John Wiley & Sons Ltd.

  10. 4G/5G polymorphism modulates PAI-1 circulating levels in obese women.

    PubMed

    Fernandes, Karla S; Sandrim, Valéria C

    2012-05-01

    The increase in plasminogen activator inhibitor type 1 (PAI-1) has been described as a risk factor to thrombosis-related diseases. In addition, it has been demonstrated that the variant 4G of polymorphism 4G/5G located in promoter region of PAI-1 gene is associated with higher PAI-1 levels. We investigate the role of this polymorphism on circulating PAI-1 concentration in a population of 57 obese women (23%, 4G/4G; 49%, 4G/5G and 28%, 5G/5G genotypes). Our results demonstrate a genotype-specific modulation on PAI-1 levels in obese women, thus 5G/5G genotype presented significantly lower levels of plasma PAI-1 when compared to 4G/4G group (46 ± 19 ng/mL vs. 63 ± 13 ng/mL, respectively). Our findings indicate that obese carriers of 4G/4G genotype may have increased risk to develop thrombotic diseases.

  11. 4G/5G Plasminogen Activator Inhibitor-1 Polymorphisms and Haplotypes Are Associated with Pneumonia

    PubMed Central

    Yende, Sachin; Angus, Derek C.; Ding, Jingzhong; Newman, Anne B.; Kellum, John A.; Li, Rongling; Ferrell, Robert E.; Zmuda, Joseph; Kritchevsky, Stephen B.; Harris, Tamara B.; Garcia, Melissa; Yaffe, Kristine; Wunderink, Richard G.

    2007-01-01

    Rationale: Plasminogen activator inhibitor (PAI)-1 inhibits urokinase and tissue plasminogen activator, required for host response to infection. Whether variation within the PAI-1 gene is associated with increased susceptibility to infection is unknown. Objectives: To ascertain the role of the 4G/5G polymorphism and other genetic variants within the PAI-1 gene. We hypothesized that variants associated with increased PAI-1 expression would be associated with an increased occurrence of community-acquired pneumonia (CAP). Methods: Longitudinal analysis (>12 yr) of the Health, Aging, and Body Composition cohort, aged 65–74 years at start of analysis. Measurements and Main Results: We genotyped the 4G/5G PAI-1 polymorphism and six additional single nucleotide polymorphisms. Of the 3,075 subjects, 272 (8.8%) had at least one hospitalization for CAP. Among whites, variants at the PAI4G,5G, PAI2846, and PAI7343 sites had higher risk of CAP (P = 0.018, 0.021, and 0.021, respectively). At these sites, variants associated with higher PAI-1 expression were associated with increased CAP susceptibility. Compared with the 5G/5G genotypes at PAI4G,5G site, the 4G/4G and 4G/5G genotypes were associated with a 1.98-fold increased risk of CAP (95% confidence interval, 1.2–3.2; P = 0.006). In whole blood stimulation assay, subjects with a 4G allele had 3.3- and 1.9-fold increased PAI-1 expression (P = 0.043 and 0.034, respectively). In haplotype analysis, the 4G/G/C/A haplotype at the PAI4G,5G, PAI2846, PAI4588, and PAI7343 single nucleotide polymorphisms was associated with higher CAP susceptibility, whereas the 5G/G/C/A haplotype was associated with lower CAP susceptibility. No associations were seen among blacks. Conclusions: Genotypes associated with increased expression of PAI-1 were associated with increased susceptibility to CAP in elderly whites. PMID:17761618

  12. [PAL-1 5G/4G polymorphism in patients with systemic lupus erythematosus].

    PubMed

    Savov, A; Andonova, S; Tanev, D; Robeva, R; Marincheva, Ts; Tomova, A; Kumanov, Ph; Rashkov, R; Kolarov, Zl

    2014-01-01

    Systemic lupus erythematosus (SLE) is a connective tissue disease affecting predominantly women that has been widely associated with obstetric complications. Inherited thrombophilias are significant risk factors for pregnancy loss, but their role in patients with SLE, and especially in those without concomitant secondary antiphospholipid syndrome (APS) has not been clarified. The aim of the present study was to study PAI-1 5G/4G polymorphism in women with lupus. A total of 103 SLE patients as well as 69 healthy volunteers were genotyped for PAI-1 5G/4G (rs1799889). No significant differences in the PAI-1 5G/4G genotype prevalence between patients and controls were found. After exclusion of the women with secondary APS, the frequency of pregnancies and spontaneous abortions, as well as the number of live births were similar in the studied patients with different PAI-1 genotype (p> 0.05). PAI-1 5G/4G polymorphism was not significantly related to any of the lupus ACR criteria or disease activity (p > 0.05), but it could influence the platelet number in the studied patients (263.52 ± 91.10 [5G/5G genotype] versus 210.12 ± 71.79 [4G/4G genotype], p = 0.023). In conclusion, our results showed that PAI-1 4G/5G polymorphism did not worsen the reproductive outcome in SLE women without secondary APS.

  13. Prothrombin polymorphism A19911G, factor V HR2 haplotype A4070G, and plasminogen activator-inhibitor-1 polymorphism 4G/5G and the risk of retinal vein occlusion.

    PubMed

    Kuhli-Hattenbach, Claudia; Hellstern, Peter; Nägler, Dorit Karin; Kohnen, Thomas; Hattenbach, Lars-Olof

    2017-01-01

    Thus far, no data has become available to evaluate systematically the prevalences of prothrombin polymorphism A19911G (PT A19911G), factor V HR2 haplotype A4070G (FV A4070G), or plasminogen activator-inhibitor-1 polymorphism 4G/5G (PAI-1 4G/5G) in patients who develop retinal vein occlusion (RVO) without cardiovascular risk factors. We retrospectively evaluated comprehensive thrombophilia data from 42 preselected RVO patients without cardiovascular risk factors. The prevalences of different gene mutations and polymorphisms including factor V Leiden mutation G1691A (FVL), FV A4070G, prothrombin mutation G20210A, PT A19911G, and PAI-1 4G/5G were compared with 241 healthy controls matched for age and sex. A total of 20 patients (47.7%) were found to carry thrombophilic gene polymorphisms including FVL, FV A4070G, and homozygous PT A19911G compared with 72 of 241 controls (29.9%; p = 0.03). Subgroup analysis of patients with a significant personal or family history of thromboembolism revealed a high prevalence of FVL, FV A4070G, and homozygous PT A19911G (p = 0.005). FV A4070G was found to be significantly associated with at least two other heterozygous or one homozygous gene polymorphisms (p = 0.02). Multivariate analysis revealed the presence of FVL (p = 0.0017) and homozygous PT A19911G (p = 0.03) polymorphism as independent risk factors for the development of RVO. Our results indicate that in selected RVO patients screening for thrombophilic gene polymorphisms including FVL, FV A4070G and homozygous PT G19911A may be helpful in a high percentage of cases. Our findings suggest that hereditary thrombophilia associated with RVO is more likely to be multigenic than caused by any single risk factor.

  14. Association between PAI-1 4G/5G polymorphism and diabetic nephropathy: a meta-analysis in the Chinese population.

    PubMed

    Gao, Wen-Feng; Guo, Ying-Bo; Bai, Yu; Ding, Xin-Yu; Yan, Yong-Ji; Wu, Zhen-Qi

    2016-09-01

    Although a number of studies have been conducted on the association between plasminogen activator inhibitor-1 (PAI-1) 4G/5G polymorphism and diabetic nephropathy (DN) in Chinese population, this association remains elusive and controversial. To further assess the effects of PAI-1 4G/5G polymorphism on the risk of DN, a meta-analysis was performed in the Chinese population. Relevant studies were identified using PubMed, Springer Link, Ovid, Chinese Wanfang Data Knowledge Service Platform, Chinese National Knowledge Infrastructure, and Chinese Biology Medicine through November, 2015. Pooled odds ratios (ORs) and 95 % confidence intervals (CIs) were used to assess the strength of the associations. This meta-analysis identified nine studies, including 777 DN cases, 413 healthy controls, and 523 DM controls. In the total analyses, a significantly elevated risk of DN was associated with variants of PAI-1 4G/5G when compared with the healthy group (4G vs. 5G, OR 2.46, 95 % CI 1.45-4.16; 4G/4G vs. 5G/5G, OR 4.32, 95 % CI 1.79-10.39; 4G/4G vs. 4G/5G +5G/5G, OR 2.96, 95 % CI 1.59-5.53; 4G/4G +4G/5G vs. 5G/5G, OR 2.78, 95 % CI 1.34-5.75) and DM group (4G vs. 5G, OR 1.93, 95 % CI 1.28-2.92; 4G/4G vs. 5G/5G, OR 2.99, 95 % CI 1.44-6.21; 4G/4G vs. 4G/5G +5G/5G, OR 2.84, 95 % CI 1.77-4.54). In the subgroup analyses stratified by ethnicity and geographic areas, it revealed the significant results in Chinese Han, in North and South China. This meta-analysis showed that the PAI-1 4G/4G variant, 4G allele might be risk alleles for DN susceptibility in the Chinese population, and further studies in other ethic groups are required for definite conclusions.

  15. The plasminogen activator inhibitor-1 (PAI-1) gene -844 A/G and -675 4G/5G promoter polymorphism significantly influences plasma PAI-1 levels in women with polycystic ovary syndrome.

    PubMed

    Lin, Sun; Huiya, Zhang; Bo, Liu; Wei, Wei; Yongmei, Guan

    2009-12-01

    Mutations in the plasminogen activator inhibitor-1 (PAI-1) gene, along with increased PAI-1 levels, have been implicated in the pathogenesis of polycystic ovarian syndrome (PCOS). We investigated a possible influence of the promoter polymorphism (-844 A/G and -675 4G/5G) in the PAI-1 gene on plasma PAI-1 levels in 126 PCOS patients and 97 healthy controls. Levels of total testosterone, luteinizing hormone (LH), follicle stimulating hormone (FSH), fasting plasma glucose (FPG), fasting insulin, and PAI-1 were measured, and body mass index (BMI), waist-to-hip ratio (WHR), LH/FSH ratio, and homeostasis model assessment for insulin resistance (HOMA-IR) were calculated. PAI-1 -675 4G/5G and -844 A/G gene polymorphisms were also performed. Total testosterone, fasting insulin, and PAI-1 levels; BMI, LH/FSH, and HOMA-IR were significantly higher in PCOS patients than controls (P < 0.05). The odds ratio of 4G/4G genotype, 4G allele, and the combination genotype of 4G/4G and -844 A/A were 2.49 (95% confidence interval (CI), 1.4-4.44), 2.1 (95% CI, 1.43-3.08), and 2.9 (95% CI, 1.41-5.98), respectively, (P < 0.001). In the PCOS group, the PAI-1 level of the A/A was significantly higher than that of the A/G or G/G genotype, similarly was 4G/4G genotype compared with 4G/5G or 5G/5G genotype. The plasma PAI-1 levels of the combination of the PAI-1 -844 A/A and -675 4G/4G or 4G/5G genotypes, or the coadunation of 4G/4G and -844 non-G/G (A/A + A/G) genotypes were significantly high in PCOS women compared with controls. A trend to a positive interaction between PAI-1 -675 4G/5G and -844 A/G gene polymorphism may elevate plasma PAI-1 levels and hypofibrinolysis, which is probably an important hereditary risk factor in PCOS.

  16. Eukaryotic Initiation Factor eIFiso4G1 and eIFiso4G2 Are Isoforms Exhibiting Distinct Functional Differences in Supporting Translation in Arabidopsis*

    PubMed Central

    Gallie, Daniel R.

    2016-01-01

    The eukaryotic translation initiation factor (eIF) 4G is required during protein synthesis to promote the assembly of several factors involved in the recruitment of a 40S ribosomal subunit to an mRNA. Although many eukaryotes express two eIF4G isoforms that are highly similar, the eIF4G isoforms in plants, referred to as eIF4G and eIFiso4G, are highly divergent in size, sequence, and domain organization but both can interact with eIF4A, eIF4B, eIF4E isoforms, and the poly(A)-binding protein. Nevertheless, eIF4G and eIFiso4G from wheat exhibit preferences in the mRNAs they translate optimally. For example, mRNA containing the 5′-leader (called Ω) of tobacco mosaic virus preferentially uses eIF4G in wheat germ lysate. In this study, the eIF4G isoform specificity of Ω was used to examine functional differences of the eIF4G isoforms in Arabidopsis. As in wheat, Ω-mediated translation was reduced in an eif4g null mutant. Loss of the eIFiso4G1 isoform, which is similar in sequence to wheat eIFiso4G, did not substantially affect Ω-mediated translation. However, loss of the eIFiso4G2 isoform substantially reduced Ω-mediated translation. eIFiso4G2 is substantially divergent from eIFiso4G1 and is present only in the Brassicaceae, suggesting a recent evolution. eIFiso4G2 isoforms exhibit sequence-specific differences in regions representing partner protein and RNA binding sites. Loss of any eIF4G isoform also resulted in a substantial reduction in reporter transcript level. These results suggest that eIFiso4G2 appeared late in plant evolution and exhibits more functional similarity with eIF4G than with eIFiso4G1 during Ω-mediated translation. PMID:26578519

  17. Prognostic value of the PAI-1 4G/5G polymorphism in invasive ductal carcinoma of the breast.

    PubMed

    Yagmurdur, M C; Atac, F B; Tutar, N U; Verdi, H; Isiklar, I; Ozdemir, B H; Ozbek, N; Karakayali, H; Haberal, M

    2008-01-01

    The study group was derived from the archive materials of 55 invasive ductal breast cancer (IDC) patients who had undergone breast-preserving surgery (partial mastectomy/ axillary dissection). All patients included in the study had clinically T(1)-2, N0-M0 invasive ductal carcinoma. Genomic DNA species were extracted from paraffin-embedded blocks, and plasminogen activator inhibitor type-1 (PAI-1) gene 4G/5G genotyping was done by polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP). Patient demographics, axillary metastasis status, metastatic lymph nodi/total dissected lymph nodes from axilla, histopathologic characteristics of tumors, local recurrences, and survival ratio were assessed. PAI-1 4G/5G genotype frequencies were 4G/4G (64%), 4G/5G (31%), and 5G/5G (5%) in the patient group. According to the results based on frequencies, the demographics were not different. Five-year local recurrence rate of 4G/5G patients was the lowest (2/17, 12%) (P = 0.02). Also five-year distant metastases ratio of 4G/5G patients was the highest (18%) (P = 0.01). Five- and 10-year disease-free survival rates for the 4G/4G, 4G/5G, and 5G/5G groups were 97% and 94%, 82% and 77%, and 100% and 94%, respectively (P = 0.004). The results of this study indicate that the 4G allele in the PAI 1 gene had a negative impact on local recurrence and disease-free survival of patients with clinical T(1)-2N0M0 IDC.

  18. Association between plasminogen activator inhibitor-1 -675 4G/5G polymorphism and sepsis: a meta-analysis.

    PubMed

    Li, Li; Nie, Wei; Zhou, Hongfeng; Yuan, Weifeng; Li, Weifeng; Huang, Wenjie

    2013-01-01

    Several studies have evaluated the association between plasminogen activator inhibitor-1 (PAI-1) -675 4G/5G polymorphism and sepsis in different populations. However, the available results are conflicting. A search of Pubmed and EMBASE databases was performed to identify relevant studies for inclusion in the meta-analysis. Odds ratios (ORs) and corresponding 95% confidence intervals (CIs) were determined using a random-effects model. Twelve case-control studies and three cohort studies were included. Overall, a significant association between 4G/5G polymorphism and sepsis risk was observed for 4G/4G vs. 4G/5G +5G/5G (OR = 1.30, 95% CI 1.08-1.56, P = 0.006). In addition, there was a significant association between PAI-1 4G/5G polymorphism and sepsis-related mortality (OR = 1.72, 95% CI 1.27-2.33, P = 0.0005). In subgroup analyses, increased sepsis risk and mortality risk were found in Caucasians and in patients with sepsis. This meta-analysis suggested that the PAI-1 -675 4G/5G polymorphism was a risk factor for sepsis and sepsis mortality.

  19. Human rotavirus strains circulating in Venezuela after vaccine introduction: predominance of G2P[4] and reemergence of G1P[8].

    PubMed

    Vizzi, Esmeralda; Piñeros, Oscar A; Oropeza, M Daniela; Naranjo, Laura; Suárez, José A; Fernández, Rixio; Zambrano, José L; Celis, Argelia; Liprandi, Ferdinando

    2017-03-21

    Rotavirus (RV) is the most common cause of severe childhood diarrhea worldwide. Despite Venezuela was among the first developing countries to introduce RV vaccines into their national immunization schedules, RV is still contributing to the burden of diarrhea. Concerns exist about the selective pressure that RV vaccines could exert on the predominant types and/or emergence of new strains. To assess the impact of RV vaccines on the genotype distribution 1 year after the vaccination was implemented, a total of 912 fecal specimens, collected from children with acute gastroenteritis in Caracas from February 2007 to April 2008, were screened, of which 169 (18.5%) were confirmed to be RV positive by PAGE. Rotavirus-associated diarrhea occurred all year-round, although prevailed during the coolest and driest months among unvaccinated children under 24 months old. Of 165 RV strains genotyped for G (VP7) and P (VP4) by seminested multiplex RT-PCR, 77 (46.7%) were G2P[4] and 63 (38.2%) G1P[8]. G9P[8], G3P[8] and G2P[6] were found in a lower proportion (7.3%). Remarkable was also the detection of <5% of uncommon combinations (G8P[14], G8P[4], G1P[4] and G4P[4]) and 3.6% of mixed infections. A changing pattern of G/P-type distribution was observed during the season studied, with complete predominance of G2P[4] from February to June 2007 followed by its gradual decline and the reemergence of G1P[8], predominant since January 2008. Phylogenetic analysis of VP7 and VP4 genes revealed a high similarity among G2P[4] and global strains belonging to G2-II and P[4]-V lineages. The amino acid substitution 96D → N, related with reemergence of the G2 genotype elsewhere, was observed. The G1P[8] strains from Caracas were grouped into the lineages G1-I and P[8]-III, along with geographically remote G1P[8] rotaviruses, but they were rather distant from Rotarix ® vaccine and pre-vaccine strains. Unique amino acid substitutions observed on neutralization domains of the VP7 sequence from

  20. Association between Plasminogen Activator Inhibitor-1 -675 4G/5G Polymorphism and Sepsis: A Meta-Analysis

    PubMed Central

    Yuan, Weifeng; Li, Weifeng; Huang, Wenjie

    2013-01-01

    Background Several studies have evaluated the association between plasminogen activator inhibitor-1 (PAI-1) -675 4G/5G polymorphism and sepsis in different populations. However, the available results are conflicting. Methods A search of Pubmed and EMBASE databases was performed to identify relevant studies for inclusion in the meta-analysis. Odds ratios (ORs) and corresponding 95% confidence intervals (CIs) were determined using a random-effects model. Results Twelve case-control studies and three cohort studies were included. Overall, a significant association between 4G/5G polymorphism and sepsis risk was observed for 4G/4G vs. 4G/5G +5G/5G (OR = 1.30, 95% CI 1.08–1.56, P = 0.006). In addition, there was a significant association between PAI-1 4G/5G polymorphism and sepsis-related mortality (OR = 1.72, 95% CI 1.27–2.33, P = 0.0005). In subgroup analyses, increased sepsis risk and mortality risk were found in Caucasians and in patients with sepsis. Conclusions This meta-analysis suggested that the PAI-1 -675 4G/5G polymorphism was a risk factor for sepsis and sepsis mortality. PMID:23382992

  1. Plasminogen Activator Inhibitor-1 (PAI-1) gene 4G/5G alleles frequency distribution in the Lebanese population.

    PubMed

    Shammaa, Dina M R; Sabbagh, Amira S; Taher, Ali T; Zaatari, Ghazi S; Mahfouz, Rami A R

    2008-09-01

    Plasminogen activator inhibitor-1 (PAI-1) is an inhibitor of fibrinolysis. Increased plasma PAI-1 levels play an essential role in the pathogenesis of cardiovascular risk and other diseases associated with thrombosis. The 4G/5G polymorphism of the PAI-1 promoter region has been extensively studied in different populations. We studied 160 healthy unrelated Lebanese individuals using a reverse hybridization PCR assay to detect the 5G/5G, 4G/5G and, 4G/4G genotypes of the PAI-1 gene and the frequencies of the 4G and 5G alleles. We found that 4G/5G genotype was the most prevalent (45.6%) followed by 5G/5G (36.9%) and 4G/4G (17.5%). The frequencies of the 4G and 5G alleles were calculated to be 0.403 and 0.597, respectively. Compared to other ethnic communities, the Lebanese population was found to harbour a relatively high prevalence of the rare 4G allele. This, in turn, may predispose this population to develop cardiovascular diseases and other thrombotic clinical conditions. This study aids to enhance our understanding of the genetic features of the Lebanese population.

  2. Relationship between post-SARS osteonecrosis and PAI-1 4G/5G gene polymorphisms.

    PubMed

    Sun, Wei; Li, Zirong; Shi, Zhengcai; Wang, Bailiang; Gao, Fuqiang; Yang, Yurun; Guo, Wanshou

    2014-05-01

    To explore the correlation between post-severe acute respiratory symptom (SARS) patients with osteonecrosis, investigate the etiology of post-SARS osteonecrosis and select the sensitive molecular symbols for early diagnosis and distinguish the high-risk population. The studied subjects were divided into two groups. Sixty-two post-SARS patients with osteonecrosis were one group, and 52 age- and sex-matched healthy people were as normal controlled group. Empty stomach blood samples from cubital veins were collected from both groups. Plasminogen activator inhibitor (PAI) by means of enzyme-linked immunosorbent assay and PAI-1 4G/5G polymorphism was detected by polymerase chain reaction and solid phase oligonucleotide assay. The blood agents of post-SARS patients changed obviously with 15.64 ± 13.85 U/ml while the control group 7.96 ± 4.27 U/ml; 4G/4G genotype for the PAI-1 polymorphism detected in post-SARS group was more than that of the control group, but had no statistical significance. The plasma PAI activity was related to homozygote 4G/4G genotype. This reveals that homozygote 4G/4G genotype may be a susceptible gene mark to Chinese osteonecrosis patients. Plasminogen activator inhibitor-1 is sensitive blood symbol for screening high-risk susceptible population; 4G/4G PAI-1 genotype may be an etiological factor in osteonecrosis.

  3. Impacts, Effectiveness and Regional Inequalities of the GeoMIP G1 to G4 Solar Radiation Management Scenarios

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yu, Xiaoyong; Moore, John; Cui, Xuefeng

    We evaluate the regional effectiveness of solar radiation management (SRM) to compensate for simultaneous changes in temperature and precipitation induced by increased greenhouse gas concentrations. We analyze results from multiple earth system models under four Geoengineering Model Intercomparison Project(GeoMIP) experiments with a modified form of the Residual Climate Response approach. Under the solar dimming geoengineering experiments G1(4xCO2) and G2(increasing CO2 by 1% per year), global average temperature is successfully restored to pre-industrial level over 50 years simulations. However, these two SRM experiments also produce a robust global precipitation decrease. The stratospheric aerosol GeoMIP geoengineering experiment, G4 has significantly greater regionalmore » inequality and lower effectiveness for compensating temperature change than G1 and G2. G4 also has significantly larger regional inequality for compensating precipitation change than G1and G2. However, there is no significant difference between precipitation change compensation effectiveness of G4 and G2, though there is much larger across model variability in G4 results. G3 has significant greater regional inequality for compensating temperature change than G1 and G2, and has significant lower effectiveness than G1. The effectiveness of four SRMs to compensate for temperature change is much higher than for precipitation. The large cross-model variation in adjustment percentage of compensated SAT and precipitation change by SRM to achieve optimal compensation effectiveness shed a light on the uncertainty accumulation effect in optimizing compensation effectiveness of SRM.« less

  4. OVA-bound nanoparticles induce OVA-specific IgG1, IgG2a, and IgG2b responses with low IgE synthesis.

    PubMed

    Yanase, Noriko; Toyota, Hiroko; Hata, Kikumi; Yagyu, Seina; Seki, Takahiro; Harada, Mitsunori; Kato, Yasuki; Mizuguchi, Junichiro

    2014-10-14

    There is an urgent requirement for a novel vaccine that can stimulate immune responses without unwanted toxicity, including IgE elevation. We examined whether antigen ovalbumin (OVA) conjugated to the surface of nanoparticles (NPs) (OVA-NPs) with average diameter of 110nm would serve as an immune adjuvant. When BALB/c mice were immunized with OVA-NPs, they developed sufficient levels of OVA-specific IgG1 antibody responses with low levels of IgE synthesis, representing helper T (Th)2-mediated humoral immunity. OVA-specific IgG2a and IgG2b responses (i.e., Th1-mediated immunity) were also induced by secondary immunization with OVA-NPs. As expected, immunization with OVA in alum (OVA-alum) stimulated humoral immune responses, including IgG1 and IgE antibodies, with only low levels of IgG2a/IgG2b antibodies. CD4-positive T cells from mice primed with OVA-NPs produced substantial levels of IL-21 and IL-4, comparable to those from OVA-alum group. The irradiated mice receiving OVA-NPs-primed B cells together with OVA-alum-primed T cells exhibited enhanced anti-OVA IgG2b responses relative to OVA-alum-primed B cells and T cells following stimulation with OVA-NPs. Moreover, when OVA-NPs-primed, but not OVA-alum-primed, B cells were cultured in the presence of anti-CD40 monoclonal antibody, IL-4, and IL-21, or LPS plus TGF-β in vitro, OVA-specific IgG1 or IgG2b antibody responses were elicited, suggesting that immunization with OVA-NPs modulates B cells to generate IgG1 and IgG2b responses. Thus, OVA-NPs might exert their adjuvant action on B cells, and they represent a promising potential vaccine for generating both IgG1 and IgG2a/IgG2b antibody responses with low IgE synthesis. Copyright © 2014 Elsevier Ltd. All rights reserved.

  5. Plasminogen activator inhibitor-1 4G/5G gene polymorphism and primary open-angle glaucoma

    PubMed Central

    Weger, Martin; Faschinger, Christoph; Schmut, Otto; Renner, Wilfried

    2008-01-01

    Purpose Alterations of the plasmin system have been suggested to participate in the multifactorial pathogenesis of primary open-angle glaucoma (POAG). The main physiological inhibitor of the plasmin system is plasminogen activator inhibitor-1 (PAI-1), which leads to decreased degradation of extracellular material. Interestingly, elevated PAI-1 levels in the aqueous humor of patients with POAG have been reported. A common polymorphism within the promoter region (PAI-1 4G/5G) has previously been shown to reduce the gene transcription rate of PAI-1. The purpose of the present study was to investigate a hypothesized association between PAI-1 4G/5G and the presence of POAG in a Caucasian population. Methods The present case-control study comprised 212 unrelated patients with POAG and 212 healthy control subjects, matched for age and sex. Genotyping of PAI-1 4G/5G polymorphisms was done using polymerase chain reaction. Results Allelic frequencies and genotype distributions of PAI-1 4G/5G did not significantly differ between patients with POAG and control subjects (PAI-1 4G/5G: 29.7% versus 29.7%). Presence of the PAI-1 4G-allele was associated with a nonsignificant odds ratio of 0.98 (95% confidence interval: 0.74–1.30) for POAG. Conclusions Our data suggest that PAI-1 4G/5G itself is unlikely to be a major risk factor among Caucasian patients with POAG. PMID:18615155

  6. Association Between Plasminogen Activator Inhibitor-1-675 4G/5G Insertion/Deletion Polymorphism and Chronic Obstructive Pulmonary Disease.

    PubMed

    Essa, Enas S; El Wahsh, Rabab A

    2016-12-01

    Molecular pathology of chronic obstructive pulmonary disease (COPD) is still being investigated to discover relationships with disease pathogenesis. Evidence of plasminogen activator inhibitor-1 (PAI-1) overexpression in the sputum and the blood of COPD patients is growing. We aimed to investigate the potential relation between PAI-1 promoter 4G/5G insertion/deletion polymorphism and COPD development. In a case-control study, we genotyped 117 COPD patients and 160 control subjects for PAI-1 promoter 4G/5G polymorphism by an allele-specific polymerase chain reaction analysis. All subjects were male smokers. In the co-dominant model, there was a significant difference in the distribution of 5G/5G, 4G/5G and 4G/4G genotypes between COPD patients and controls (p = 0.002). In the recessive model, carriers of 4G/4G genotype were significantly higher in COPD patients than controls (p = 0.01). Carriers of 4G/4G genotype were at higher risk to develop COPD than those carrying 5G/5G or 4G/5G genotypes (crude odds ratio (OR) = 2.10, 95% confidence interval (CI) = 1.19-3.73, adjusted OR = 2.5, 95% CI = 1.22-3.99). In conclusion, PAI-1 4G/5G genetic variations are associated with COPD development in males.

  7. Do serum angiopoietin-1, angiopoietin-2, and their receptor Tie-2 and 4G/5G variant of PAI-1 gene have a role in the pathogenesis of preeclampsia?

    PubMed

    Kamal, Manal; El-Khayat, Waleed

    2011-10-01

    To evaluate whether serum angiogenesis markers such as angiopoietins (Ang-1, Ang-2) and their receptor (Tie-2) are altered in women with preeclampsia. We also performed genotyping to determine if the 4G/5G genotypes of -675 PAI-1 gene may play a role in the pathogenesis of preeclampsia. Sixty-eight pregnant women with preeclampsia were compared to 35 normotensive pregnant women and 24 normotensive nonpregnant women in a cross-sectional study. Using enzyme-linked immunosorbent assay, levels of serum Ang-1 and Ang-2, and Tie-2 were measured. A single base pair insertion/deletion 4G/5G polymorphism of the PAI-1 gene was determined by polymerase chain reaction. Serum levels of Ang-1 and Tie-2 were significantly different among the study groups (P = 0.001 and P = 0.025, respectively) being lower in the preeclamptic group. Positive significant correlation was found between Ang-2 and Tie-2, (r = 0.26, P = 0.024). The frequency of the genotypes (4G/5G, 4G/4G, and 5G/5G) differed among the groups (P = 0.001). Also, the mean of systolic and diastolic blood pressures differed significantly according to the PAI-1 genotype being higher in those bearing the 4G allele; P = 0.04 and P = 0.023, respectively. Sera Ang-1 and Ang-2, and Tie-2 as well as variants of 4G/5G of PAI-1 polymorphism have positive implications in the pathogenesis of preeclampsia.

  8. Nuclease digestion and mass spectrometric characterization of oligodeoxyribonucleotides containing 1,2-GpG, 1,2-ApG, and 1,3-GpXpG cisplatin intrastrand cross-links.

    PubMed

    Williams, Renee T; Nalbandian, Jenifer N; Tu, Audrey; Wang, Yinsheng

    2013-05-01

    The primary mode of action for cis-diamminedichloroplatinum (II), referred to as cisplatin, toward the treatment of solid malignancies is through formation of cross-links with DNA at purine sites, especially guanines. We prepared oligodeoxyribonucleotides (ODNs) containing a 1,2-GpG, 1,2-ApG, or 1,3-GpXpG cisplatin intrastrand cross-link and the corresponding ODNs modified with (15)N2-labeled cisplatin, and characterized these ODNs with electrospray ionization mass spectrometry (ESI-MS) and tandem MS (MS/MS). We also employed LC-MS/MS to characterize the digestion products of these ODNs after treatment with a cocktail of 4 enzymes (nuclease P1, phosphodiesterases I and II, and alkaline phosphatase). 1,2-GpG was released from the ODNs as a dinucleoside monophosphate or a dinucleotide. Analyses of the digestion products of ODNs containing a 1,2-GpG cross-link on the 5' or 3' terminus revealed that the dinucleotide carries a terminal 5' phosphate. On the other hand, digestion of the 1,3-GpXpG intrastrand cross-link yielded 3 dinucleoside products with 0, 1, or 2 phosphate groups. The availability of the ODNs carrying the stable isotope-labeled lesions, MS/MS analyses of the cisplatin-modified ODNs, and the characterization of the enzymatic digestion products of these ODNs set the stage for the future LC-MS/MS quantification of the 1,2-GpG, 1,2-ApG, and 1,3-GpXpG lesions in cellular DNA. Copyright © 2012 Elsevier B.V. All rights reserved.

  9. Nuclease Digestion and Mass Spectrometric Characterization of Oligodeoxyribonucleotides Containing 1,2-GpG, 1,2-ApG, and 1,3-GpXpG Cisplatin Intrastrand Cross-links

    PubMed Central

    Williams, Renee T.; Nalbandian, Jenifer; Tu, Audrey; Wang, Yinsheng

    2013-01-01

    Background The primary mode of action for cis-diamminedichloroplatinum (II), referred to as cisplatin, towards the treatment of solid malignancies is through formation of cross-links with DNA at purine sites, especially guanines. Methods We prepared oligodeoxyribonucleotides (ODNs) containing a 1,2-GpG, 1,2-ApG, or 1,3-GpXpG cisplatin intrastrand cross-link and the corresponding ODNs modified with 15N2-labeled cisplatin, and characterized these ODNs with electrospray ionization mass spectrometry (ESI-MS) and tandem MS (MS/MS). We also employed LC-MS/MS to characterize the digestion products of these ODNs after treatment with a cocktail of 4 enzymes (nuclease P1, phosphodiesterases I and II, and alkaline phosphatase). Results 1,2-GpG was released from the ODNs as a dinucleoside monophosphate or a dinucleotide. Analyses of the digestion products of ODNs containing a 1,2-GpG cross-link on the 5′ or 3′ terminus revealed that the dinucleotide carries a terminal 5′ phosphate. On the other hand, digestion of the 1,3-GpXpG intrastrand cross-link yielded 3 dinucleoside products with 0, 1, or 2 phosphate groups. Results The availability of the ODNs carrying the stable isotope-labeled lesions, MS/MS analyses of the cisplatin-modified ODNs, and the characterization of the enzymatic digestion products of these ODNs set the stage for the future LC-MS/MS quantification of the 1,2-GpG, 1,2-ApG, and 1,3-GpXpG lesions in cellular DNA. PMID:23266768

  10. Plasminogen activator inhibitor-1 4G/5G polymorphism in infertile women with and without endometriosis.

    PubMed

    Gonçalves-Filho, Rubens P; Brandes, Ariel; Christofolini, Denise M; Lerner, Tatiana G; Bianco, Bianca; Barbosa, Caio P

    2011-05-01

    To evaluate PAI-1 genotypes in a group of infertile women with or without endometriosis and control subjects. Case-control study. Human Reproduction Center of Medicina do ABC Faculty. One hundred and forty infertile women with endometriosis, 64 women with idiopathic infertility and 148 fertile women as control subjects. The PAI-1 4G/5G polymorphism was identified by restriction fragment length polymorphism-polymerase chain reaction. Genotype distribution and allele frequency of the 4G/5G polymorphism of the PAI-1 gene. The frequencies of genotypes 4G/4G, 4G/5G and 5G/5G of the PAI-1 gene in the infertile women with endometriosis were 38.6, 37.1 and 24.3%, respectively, and in the control group 24.3, 33.8 and 41.9%, respectively (p=0.003). When the infertile women with endometriosis were divided according to their endometriosis stage, genotypes 4G/4G, 4G/5G and 5G/5G were identified, respectively, in 36.7, 32.9 and 30.4% of the patients with minimal/mild endometriosis (p=0.102) and in 41.0, 42.6 and 16.4% of the patients with moderate/severe endometriosis (p=0.001); in the women with idiopathic infertility, these genotypes were found at a frequency of 29.7, 34.3 and 36%, respectively (p=0.637). The data suggest that, in Brazilian women, the PAI-1 4G/5G polymorphism may be associated with a risk of endometriosis-associated infertility. © 2011 The Authors Acta Obstetricia et Gynecologica Scandinavica© 2011 Nordic Federation of Societies of Obstetrics and Gynecology.

  11. Relationship of plasminogen activator inhibitor 1 gene 4G/5G polymorphisms to hypertension in Korean women.

    PubMed

    Kim, Kyu-nam; Kim, Kwang-min; Kim, Bom-taeck; Joo, Nam-seok; Cho, Doo-yeoun; Lee, Duck-joo

    2012-04-01

    Hypertension (HTN) is a major determinant of various cardiovascular events. Plasma levels of plasminogen activator inhibitor 1 (PAI-1) modulate this risk. A deletion/insertion polymorphism within the PAI-1 loci (4G/4G, 4G/5G, 5G/5G) affects the expression of this gene. The present study investigated the association between PAI-1 loci polymorphisms and HTN in Korean women. Korean women (n = 1312) were enrolled in this study to evaluate the association between PAI-1 4G/5G gene polymorphisms and HTN as well as other metabolic risk factors. PAI-1 loci polymorphisms were investigated using polymerase chain reaction amplification and single-strand conformation polymorphism analysis. The three genotype groups differed with respect to systolic blood pressure (P = 0.043), and diastolic blood pressure (P = 0.009) but not with respect to age, body mass index, total cholesterol, low or high density lipoprotein cholesterol, triglycerides, or fasting blood glucose. Carriers of the PAI-1 4G allele had more hypertension significantly (PAI-1 4G/5G vs. PAI-1 5G/5G, P = 0.032; PAI-1 4G/4G vs. PAI-1 5G/5G, P = 0.034). When stratified according to PAI-1 4G/5G polymorphism, there was no significant difference in all metabolic parameters among PAI-1 genotype groups in patients with HTN as well as subjects with normal blood pressure. The estimated odds ratio of the 4G/4G genotype and 4G/5G for HTN was 1.7 (P = 0.005), and 1.6 (P = 0.015), respectively. These findings might indicate that PAI-1 loci polymorphisms independently contribute to HTN and that gene-environmental interaction may be not associated in Korean women.

  12. G4RNA: an RNA G-quadruplex database

    PubMed Central

    Garant, Jean-Michel; Luce, Mikael J.; Scott, Michelle S.

    2015-01-01

    Abstract G-quadruplexes (G4) are tetrahelical structures formed from planar arrangement of guanines in nucleic acids. A simple, regular motif was originally proposed to describe G4-forming sequences. More recently, however, formation of G4 was discovered to depend, at least in part, on the contextual backdrop of neighboring sequences. Prediction of G4 folding is thus becoming more challenging as G4 outlier structures, not described by the originally proposed motif, are increasingly reported. Recent observations thus call for a comprehensive tool, capable of consolidating the expanding information on tested G4s, in order to conduct systematic comparative analyses of G4-promoting sequences. The G4RNA Database we propose was designed to help meet the need for easily-retrievable data on known RNA G4s. A user-friendly, flexible query system allows for data retrieval on experimentally tested sequences, from many separate genes, to assess G4-folding potential. Query output sorts data according to sequence position, G4 likelihood, experimental outcomes and associated bibliographical references. G4RNA also provides an ideal foundation to collect and store additional sequence and experimental data, considering the growing interest G4s currently generate. Database URL: scottgroup.med.usherbrooke.ca/G4RNA PMID:26200754

  13. Plasminogen Activator Inhibitor-1 4G/5G Polymorphism is Associated with Reproductive Failure: Metabolic, Hormonal, and Immune Profiles.

    PubMed

    Salazar Garcia, Maria D; Sung, Nayoung; Mullenix, Thomas M; Dambaeva, Svetlana; Beaman, Kenneth; Gilman-Sachs, Alice; Kwak-Kim, Joanne

    2016-07-01

    Association between PAI-1 4G/5G polymorphism and reproductive failures has been postulated. We aimed to investigate its impact on metabolic, hormonal, and immune profiles of women with reproductive failures. A retrospective study was carried out in 208 women with a history of reproductive failure. Study patients were divided into three groups: women with repeated implantation failure (RIF, n = 40), recurrent pregnancy loss (RPL, n = 113), and both RIF and RPL (n = 55). Fertile controls were 92. PAI-1 4G/4G was prevalent in RPL, RIF, and RIF/RPL groups when compared with controls (P = 0.003) and associated with increased risks of RIF, RPL, and RIF with RPL (OR = 4.5, 2.2 and 2.7). Women with PAI-1 4G/4G have significantly higher BMI, glucose, and PAI-1 levels and lower NK cytotoxicity when compared with women without PAI-1 4G/4G. PAI-1 4G/5G polymorphism plays a major role in the pathogenesis of RPL and RIF by altering metabolic and immunological profiles. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  14. Meta-analysis of the association between plasminogen activator inhibitor-1 4G/5G polymorphism and recurrent pregnancy loss.

    PubMed

    Li, Xuejiao; Liu, Yukun; Zhang, Rui; Tan, Jianping; Chen, Libin; Liu, Yinglin

    2015-04-11

    The association between plasminogen activator inhibitor-1 (PAI-1) 4G/5G polymorphism and recurrent pregnancy loss (RPL) risk is still contradictory. We thus performed a meta-analysis. Relevant studies were searched for in PubMed, Web of Science, Embase, and Cochrane Library. An odds ratio (OR) with a 95% confidence interval (CI) was used to assess the association between PAI-1 4G/5G polymorphism and RPL risk. A total of 22 studies with 4306 cases and 3076 controls were included in this meta-analysis. We found that PAI-1 4G/5G polymorphism was significantly associated with an increased RPL risk (OR=1.89; 95% CI 1.34-2.67; P=0.0003). In the subgroup analysis by race, PAI-1 4G/5G polymorphism was significantly associated with an increased RPL risk in Caucasians (OR=2.23; 95% CI 1.44-3.46; P=0.0003). However, no significant association was observed in Asians (OR=1.47; 95% CI 0.84-2.59; P=0.18). In conclusion, this meta-analysis suggests that PAI-1 4G/5G polymorphism might be associated with RPL development in Caucasians.

  15. IgG4-related prostatitis progressed from localized IgG4-related lymphadenopathy.

    PubMed

    Li, Dujuan; Kan, Yunzhen; Fu, Fangfang; Wang, Shuhuan; Shi, Ligang; Liu, Jie; Kong, Lingfei

    2015-01-01

    Immunoglobulin G4-related disease (IgG4-RD) is a recently described inflammatory disease involving multiple organs. Prostate involvement with IgG4-RD is very rare. In this report, we describe a case of IgG4-related prostatitis progressed from localized IgG4-related lymphadenopathy. This patient was present with urine retention symptoms. MRI and CT examination revealed the prostatic enlargement and the multiple lymphadenopathy. Serum IgG4 levels were elevated. Prostatic tissue samples resected both this time and less than 1 year earlier showed the same histological type of prostatitis with histopathologic and immunohistochemical findings characteristic of IgG4-RD. The right submandibular lymph nodes excised 2 years earlier were eventually proven to be follicular hyperplasia-type IgG4-related lymphadenopathy. This is the first case of IgG4-RD that began as localized IgG4-related lymphadenopathy and progressed into a systemic disease involving prostate and multiple lymph nodes. This patient showed a good response to steroid therapy. This leads us to advocate a novel pathogenesis of prostatitis, and a novel therapeutic approach against prostatitis. Pathologists and urologists should consider this disease entity in the patients with elevated serum IgG4 levels and the symptoms of prostatic hyperplasia to avoid ineffective medical or unnecessary surgical treatment.

  16. Cardiovascular effects of anti-G suit inflation at 1 and 2 G.

    PubMed

    Montmerle, Stéphanie; Linnarsson, Dag

    2005-06-01

    We sought to determine to which pressure a full-coverage anti-G suit needs to be inflated in order to obtain the same stroke volume during a brief exposure to twice the normal gravity (2 G) as that at 1 G without anti-G suit inflation. Nine sitting subjects were studied at normal (1 G) and during 20 s of exposure to 2 G. They wore anti-G suits, which were inflated at both G-levels to the following target pressures: 0, 70, 140 and 210 mmHg. Stroke volume was computed from cardiac output, which was measured by rebreathing. Heart rate and mean arterial pressure at heart level were recorded. Inflation to 70 mmHg compensated for the decrease in stroke volume and cardiac output caused by hypergravity. Mean arterial pressure at heart level was comparable at 1 G and at 2 G and increased gradually and similarly with inflation (P<0.001) at both gravity levels. Thus, anti-G suits act by increasing both preload and afterload but the two effects counteract each other in terms of cardiac output, so that cardiac output at 2 G is maintained at its 1 G level. This effect is reached already at 70 mmHg of inflation. Greater inflation pressure further increases mean arterial pressure at heart level and compensates for the increased difference in hydrostatic pressure between heart and head in moderate hypergravity.

  17. Conformational organizations of G-quadruplexes composed of d(G(4)T(n))(3)G(4).

    PubMed

    Wong, Wan Chi; Zhuang, Jinyi; Ng, Selina Ling Ling; New, Lilian Li Lin; Hiew, Shuhui; Guo, Juanjuan; Yang, Zhaoqi; Li, Tianhu

    2010-08-01

    Structural polymorphism is one of the important issues with regard to G-quadruplexes because the structural diversity may significantly affect their biological functions in vivo and their physical property in nano-material. A series of oligonucleotides with four repeat guanines sequence [d(G(4)T(n))(3)G(4) (n=1-6)] were designed. In this study, the effects of loop length on the formation of structures of G-quadruplex were investigated through the result of CD (circular dichroism) and 20% non-denatured polyacrylamide gel electrophoresis. Our studies demonstrate that the length of loop in 100mM KCl solution could predict the conformation of G-quadruplex. Copyright 2010 Elsevier Ltd. All rights reserved.

  18. The H,G_1,G_2 photometric system with scarce observational data

    NASA Astrophysics Data System (ADS)

    Penttilä, A.; Granvik, M.; Muinonen, K.; Wilkman, O.

    2014-07-01

    The H,G_1,G_2 photometric system was officially adopted at the IAU General Assembly in Beijing, 2012. The system replaced the H,G system from 1985. The 'photometric system' is a parametrized model V(α; params) for the magnitude-phase relation of small Solar System bodies, and the main purpose is to predict the magnitude at backscattering, H := V(0°), i.e., the (absolute) magnitude of the object. The original H,G system was designed using the best available data in 1985, but since then new observations have been made showing certain features, especially near backscattering, to which the H,G function has troubles adjusting to. The H,G_1,G_2 system was developed especially to address these issues [1]. With a sufficient number of high-accuracy observations and with a wide phase-angle coverage, the H,G_1,G_2 system performs well. However, with scarce low-accuracy data the system has troubles producing a reliable fit, as would any other three-parameter nonlinear function. Therefore, simultaneously with the H,G_1,G_2 system, a two-parameter version of the model, the H,G_{12} system, was introduced [1]. The two-parameter version ties the parameters G_1,G_2 into a single parameter G_{12} by a linear relation, and still uses the H,G_1,G_2 system in the background. This version dramatically improves the possibility to receive a reliable phase-curve fit to scarce data. The amount of observed small bodies is increasing all the time, and so is the need to produce estimates for the absolute magnitude/diameter/albedo and other size/composition related parameters. The lack of small-phase-angle observations is especially topical for near-Earth objects (NEOs). With these, even the two- parameter version faces problems. The previous procedure with the H,G system in such circumstances has been that the G-parameter has been fixed to some constant value, thus only fitting a single-parameter function. In conclusion, there is a definitive need for a reliable procedure to produce

  19. Effects of 2.0-g 1.75-g and 1.5-g Hypergravity on Pregnancy Outcome in Rats (Rattus norvegicus)

    NASA Technical Reports Server (NTRS)

    Mills, Nicole A.; Baer, Lisa A.; Ronca, April E.

    2001-01-01

    In 1995, ten pregnant female rats were launched on the Space Shuttle (STS-70) on Gestational day(G) 11 of their 22-day pregnancy as part of the NASA/NIH.Rodent (R)2 Experiment. Following landing on G20, fetuses were harvested from half of the dams, while the remaining five dams underwent birth. Spaceflight did not interrupt pregnancy, alter litter sizes, or affect body weights or gender ratios of the fetuses or neonates. In the present study we used the NASA/NIH.R2 experimental paradigm to analyze the effects of hypergravity on pregnancy outcome. On G10, time-bred Sprague-Dawley rat dams were assigned to either G20 or Birth conditions, then further assigned to Hypergravity (HG) 2.0-g, HG 1.75-g, HG 1.5-g, Rotational Control (RC, 1.03), or Stationary Control (SC, 1.0-g) treatments. Dams were exposed to continuous centrifugation from G11 through G20, with brief daily stops for animal health checks and maintenance. For both the G20 and Birth dams, comparable litter sizes and litter gender ratios were observed across gravity conditions. However, centrifugation-exposed (HG and RC) fetuses and neonates showed significantly lower body masses (p less than 0.05) relative to SC offspring. HG 2.0-g offspring weighed significantly less than those in all other gravity conditions (p less than 0.05). The observed reductions in offspring body mass at 1.5-g and 1.75-g, can be attributed to the rotational component of centrifugation, rather than to increased gravitational load, whereas 2.0-g hypergravity exposure further exacerbated the gravity centrifugation effect on offspring body mass. Pregnant dams exposed to centrifugation weighed significantly less than SC dams (p less than 0.05), suggesting that centrifugation effects on maternal body mass may contribute to reduced size of the developing offspring. These findings are consistent with previous reports of non-pregnant adult animals suggesting that, whereas spaceflight has virtually no effect on body mass, centrifugation is

  20. The Plasminogen Activator Inhibitor 1 4G/5G Polymorphism and the Risk of Alzheimer's Disease.

    PubMed

    Fekih-Mrissa, Najiba; Mansour, Malek; Sayeh, Aicha; Bedoui, Ines; Mrad, Meriem; Riahi, Anis; Mrissa, Ridha; Nsiri, Brahim

    2017-09-01

    The aim of this study was to determine whether plasminogen activator inhibitor 1 (PAI-1) is associated with the risk of Alzheimer's disease (AD) in Tunisian patients. We analyzed the genotype and allele frequency distribution of the PAI-1 polymorphism in 60 Tunisian patients with AD and 120 healthy controls. The results show a significantly increased risk of AD in carriers of the 4G/4G and 4G/5G genotypes versus the wild-type 5G/5G genotype (4G/4G: 28.33% in patients vs 10.0% in controls; P < 10 -3 ; OR = 8.78; 4G/5G: 55.0% in patients vs 38.33% in controls; OR = 4.45; P < 10 -3 ). The 4G allele was also more frequently found in patients compared with controls; P < 10 -3 ; OR = 3.07. For all participants and by gender, homozygotic carriers (4G/4G) were at an increased risk of AD over heterozygotes and women were at an increased risk over their male genotype counterparts. The odds ratio for AD among 4G/4G carriers for any group was approximately twice that of heterozygotes in the same group. Women homozygotes ranked highest for AD risk (OR = 20.8) and, in fact, women heterozygotes (OR = 9.03) ranked higher for risk than male homozygotes (OR = 6.12). These preliminary exploratory results should be confirmed in a larger study.

  1. Association between plasminogen activator inhibitor-1 4G/5G gene polymorphism and immunoglobulin A nephropathy susceptibility.

    PubMed

    Zhou, Tian-Biao; Jiang, Zong-Pei

    2015-02-01

    The association between plasminogen activator inhibitor-1 (PAI-1) 4 G/5 G gene polymorphism and immunoglobulin A nephropathy (IgAN) risk is still controversial. A meta-analysis was performed to evaluate the association between PAI-1 4 G/5 G gene polymorphism and IgAN susceptibility. A predefined literature search and selection of eligible relevant studies were performed to collect data from electronic database. Four articles were identified for the analysis of association between PAI-1 4 G/5 G gene polymorphism and IgAN risk. 4 G allele was not associated with IgAN susceptibility in overall populations and in Asians. Furthermore, 4 G/4 G and 5 G/5 G genotype were not associated with IgAN for overall populations, Asians. In conclusion, PAI-1 4 G/5 G gene polymorphism was not associated with IgAN risk in overall populations and in Asians. However, more studies should be performed in the future.

  2. 4G/5G and A-844G Polymorphisms of Plasminogen Activator Inhibitor-1 Associated with Glioblastoma in Iran--a Case-Control Study.

    PubMed

    Pooyan, Honari; Ahmad, Ebrahimi; Azadeh, Rakhshan

    2015-01-01

    Glioblastoma is a highly aggressive and malignant brain tumor. Risk factors are largely unknown however, although several biomarkers have been identified which may support development, angiogenesis and invasion of tumor cells. One of these biomarkers is PAI-1. 4G/5G and A-844G are two common polymorphisms in the gene promotor of PAI 1 that may be related to high transcription and expression of this gene. Studies have shown that the prevalence of the 4G and 844G allele is significantly higher in patients with some cancers and genetic disorders. We here assessed the association of 4G/5G and A-844G polymorphisms with glioblastoma cancer risk in Iranians in a case-control study. All 71 patients with clinically confirmed and 140 volunteers with no history and symptoms of glioblastoma as control group were screened for 4G/5G and A-844G polymorphisms of PAI-1, using ARMS-PCR. Genotype and allele frequencies of case and control groups were analyzed using the DeFinetti program. Our results showed significant associations between 4G/5G (p=0.01824) and A-844G (p=0.02012) polymorphisms of the PAI-1 gene with glioblastoma cancer risk in our Iranian population. The results of this study supporting an association of the PAI-1 4G/5G (p=0.01824) and A-844G (p=0.02012) polymorphisms with increasing glioblastoma cancer risk in Iranian patients.

  3. Meta-Analysis of the Association between Plasminogen Activator Inhibitor-1 4G/5G Polymorphism and Recurrent Pregnancy Loss

    PubMed Central

    Li, Xuejiao; Liu, Yukun; Zhang, Rui; Tan, Jianping; Chen, Libin; Liu, Yinglin

    2015-01-01

    Background The association between plasminogen activator inhibitor-1 (PAI-1) 4G/5G polymorphism and recurrent pregnancy loss (RPL) risk is still contradictory. We thus performed a meta-analysis. Material/Methods Relevant studies were searched for in PubMed, Web of Science, Embase, and Cochrane Library. An odds ratio (OR) with a 95% confidence interval (CI) was used to assess the association between PAI-1 4G/5G polymorphism and RPL risk. Results A total of 22 studies with 4306 cases and 3076 controls were included in this meta-analysis. We found that PAI-1 4G/5G polymorphism was significantly associated with an increased RPL risk (OR=1.89; 95% CI 1.34–2.67; P=0.0003). In the subgroup analysis by race, PAI-1 4G/5G polymorphism was significantly associated with an increased RPL risk in Caucasians (OR=2.23; 95% CI 1.44–3.46; P=0.0003). However, no significant association was observed in Asians (OR=1.47; 95% CI 0.84–2.59; P=0.18). Conclusions In conclusion, this meta-analysis suggests that PAI-1 4G/5G polymorphism might be associated with RPL development in Caucasians. PMID:25862335

  4. PAI-1 expression and its regulation by promoter 4G/5G polymorphism in clear cell renal cell carcinoma.

    PubMed

    Choi, Jung-Woo; Lee, Ju-Han; Park, Hong Seok; Kim, Young-Sik

    2011-10-01

    To characterise patients with high plasminogen activator inhibitor-1 (PAI-1) expression as oral PAI-1 antagonists are currently in preclinical trials, and to determine whether the PAI-1 promoter 4G/5G polymorphism regulates PAI-1 expression in clear cell renal cell carcinoma (CCRCC). PAI-1 expression was examined by immunohistochemistry in 69 CCRCC specimens. In addition, the promoter 4G/5G polymorphism was investigated by both allele-specific PCR and direct DNA sequencing. PAI-1 was overexpressed in 25/69 (36.2%) patients with CCRCC. PAI-1 staining was intense in tumour cells with a high Fuhrman nuclear grade and in spindle-shaped tumour cells. PAI-1 expression was significantly associated with older age at diagnosis (p=0.027), high nuclear grade (p<0.001), advanced clinical stage (p=0.030) and distant metastasis (p=0.009). In survival analyses, PAI-1 expression was correlated with disease-free survival in Kaplan-Meier curves (p=0.015) but was not significant in the Cox hazards model (p=0.527). The frequencies of the promoter polymorphism were 24.6% (17/69) 4G/4G, 43.5% (30/69) 4G/5G and 31.9% (22/69) 5G/5G. The homozygous 4G/4G or 5G/5G group showed a tendency for a high nuclear grade (p=0.05) but the 4G/5G polymorphism was not related to other prognostic parameters. PAI-1 expression was poorly correlated with its promoter 4G/5G polymorphism (Spearman ρ=0.088). CCRCC with high PAI-1 expression is characterised by older age, high nuclear grade, advanced stage, distant metastasis and/or shortened disease-free survival. PAI-1 expression is not affected by the promoter 4G/5G polymorphism.

  5. The -675 4G/5G polymorphism in the PAI-1 gene may not contribute to the risk of PCOS.

    PubMed

    Zhang, T-T; Yuan, L; Yang, Y-M; Ren, Y

    2014-08-01

    The association between the -675 4G/5G polymorphism in PAI-1 gene and PCOS has been studied with inconclusive results. We sought to investigate this inconsistency by performing a comprehensive meta-analysis on the polymorphism. Searches were performed in the PubMed, Embase, CNKI and Wanfang databases, covering all papers. Statistical analysis was performed using Revman5.2 and STATA11.0 software. A total of 11 case-control studies were extracted on the polymorphism involving 1861 PCOS cases and 1187 controls. The results showed that, no significant increased/decreased risk were found for the polymorphism for PCOS: OR = 1.03, 95% CI = 0.77-1.66, p = 0.52 for 4G4G + 4G5G vs. 5G5G; OR = 0.99, 95% CI = 0.66-1.49, p = 0.96 for 4G4G vs. 5G5G + 4G5G; OR = 1.08, 95% CI = 0.66-1.79, p = 0.76 for 4G4G vs. 5G5G; OR = 1.11, 95% CI = 0.78-1.58, p = 0.56 for 4G5G vs. 5G5G; OR = 1.00, 95% CI = 0.71-1.41, p = 0.99 for 4G vs. 5G. In the further subgroup analysis by ethnicity, we did not find a significant association between the polymorphism for PCOS risk in either Asians or Europeans. Our findings demonstrated that -675 4G/5G polymorphism in the PAI-1 gene might not be a risk factor for the development of PCOS.

  6. PAI-1 promoter 4G/5G polymorphism (rs1799768) contributes to tumor susceptibility: Evidence from meta-analysis.

    PubMed

    Xu, Xin; Xie, Yanqi; Lin, Yiwei; Xu, Xianglai; Zhu, Yi; Mao, Yeqing; Hu, Zhenghui; Wu, Jian; Chen, Hong; Zheng, Xiangyi; Qin, Jie; Xie, Liping

    2012-12-01

    Plasminogen activator inhibitor-1 (PAI-1), belonging to the urokinase plasminogen activation (uPA) system, is involved in cancer development and progression. The PAI-1 promoter 4G/5G polymorphism was shown to contribute to genetic susceptibility to cancer, although the results were inconsistent. To assess this relationship more precisely, a meta-analysis was performed. The electronic databases PubMed, Scopus, Web of Science and Chinese National Knowledge Infrastructure (CNKI) were searched; data were extracted and analyzed independently by two reviewers. Ultimately, 21 eligible case-control studies with a total of 8,415 cancer cases and 9,208 controls were included. The overall odds ratio (OR) with its 95% confidence interval (CI) showed a statistically significant association between the PAI-1 promoter 4G/5G polymorphism and cancer risk (4G/4G vs. 5G/5G: OR=1.25, 95% CI=1.07-1.47, P(heterogeneity)=0.001; 4G/4G vs. 4G/5G+5G/5G: OR=1.10, 95% CI=1.03-1.17, P(heterogeneity)=0.194; 4G/4G+4G/5G vs. 5G/5G: OR=1.17, 95% CI=1.01-1.35, P(heterogeneity)=0.041). In further subgroup analyses, the increased risk of cancer was observed in a subgroup of Caucasians with regards to endometrial cancer. Our meta-analysis suggests that the PAI-1 4G/5G polymorphism most likely contributes to susceptibility to cancer, particularly in Caucasians. Furthermore, the 4G allele may be associated with an increased risk of endometrial cancer.

  7. PAI-1 promoter 4G/5G polymorphism (rs1799768) contributes to tumor susceptibility: Evidence from meta-analysis

    PubMed Central

    XU, XIN; XIE, YANQI; LIN, YIWEI; XU, XIANGLAI; ZHU, YI; MAO, YEQING; HU, ZHENGHUI; WU, JIAN; CHEN, HONG; ZHENG, XIANGYI; QIN, JIE; XIE, LIPING

    2012-01-01

    Plasminogen activator inhibitor-1 (PAI-1), belonging to the urokinase plasminogen activation (uPA) system, is involved in cancer development and progression. The PAI-1 promoter 4G/5G polymorphism was shown to contribute to genetic susceptibility to cancer, although the results were inconsistent. To assess this relationship more precisely, a meta-analysis was performed. The electronic databases PubMed, Scopus, Web of Science and Chinese National Knowledge Infrastructure (CNKI) were searched; data were extracted and analyzed independently by two reviewers. Ultimately, 21 eligible case-control studies with a total of 8,415 cancer cases and 9,208 controls were included. The overall odds ratio (OR) with its 95% confidence interval (CI) showed a statistically significant association between the PAI-1 promoter 4G/5G polymorphism and cancer risk (4G/4G vs. 5G/5G: OR=1.25, 95% CI=1.07–1.47, Pheterogeneity=0.001; 4G/4G vs. 4G/5G+5G/5G: OR=1.10, 95% CI=1.03–1.17, Pheterogeneity=0.194; 4G/4G+4G/5G vs. 5G/5G: OR=1.17, 95% CI=1.01–1.35, Pheterogeneity=0.041). In further subgroup analyses, the increased risk of cancer was observed in a subgroup of Caucasians with regards to endometrial cancer. Our meta-analysis suggests that the PAI-1 4G/5G polymorphism most likely contributes to susceptibility to cancer, particularly in Caucasians. Furthermore, the 4G allele may be associated with an increased risk of endometrial cancer. PMID:23226787

  8. Investigation of Plasminogen Activator Inhibitor-1 (PAI-1) 4G/5G promoter polymorphism in Indian venous thrombosis patients: A case-control study.

    PubMed

    Prabhudesai, Aniket; Shetty, Shrimati; Ghosh, Kanjaksha; Kulkarni, Bipin

    2017-09-01

    The role of PAI-1 4G/5G polymorphism in venous thrombosis has been contradictory. PAI-1 4G/4G genotype is associated with elevated levels of PAI-1 resulting in a hypofibrinolytic state and a higher thrombotic risk. In this study, the distribution of genotypes and frequency of alleles of the 4G/5G polymorphism of PAI-1 gene in Indian patients with different types of venous thrombosis was investigated for its role in development of thrombosis. A total of 87 portal vein thrombosis (PVT), 71 Budd-Chiari syndrome (BCS), 156 cerebral vein thrombosis (CVT), and 163 deep vein thrombosis (DVT) patients were studied alongside 251 healthy controls for the PAI-1 4G/5G polymorphism by allele-specific PCR. Frequency of 4G/4G genotype was higher in all groups in comparison with controls. 4G/4G was associated with PVT risk (OR=2.51, 95% CI=1.29-4.96, P=.0075), BCS risk (OR=5.98, 95% CI=2.68-13.42, P<.0001), and DVT risk (OR=1.75, 95% CI=0.98-3.02, P=.0225). This is the first case-control study from India establishing PAI-1 4G/4G as a strong risk factor for abdominal thrombosis (PVT and BCS). Statistically significant association was not found between 4G/4G genotype and CVT risk. PAI-1 4G/4G is a strong risk factor for venous thrombosis in Indian patients and should be included in laboratory testing panel of thrombophilia. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  9. The Effect of PAI-1 4G/5G Polymorphism and Clinical Factors on Coronary Artery Occlusion in Myocardial Infarction.

    PubMed

    Parpugga, Tajinder Kumar; Tatarunas, Vacis; Skipskis, Vilius; Kupstyte, Nora; Zaliaduonyte-Peksiene, Diana; Lesauskaite, Vaiva

    2015-01-01

    Data on the impact of PAI-1-675 4G/5G genotype for fibrinolysis during myocardial infarction are inconsistent. The aim of our study was to evaluate the association of clinical and genetic (PAI-1-675 4G/5G polymorphism) factors with coronary artery occlusion in patients with myocardial infarction. PAI-1-675 4G/5G detection was achieved by using Sanger sequencing in a sample of patients hospitalized for stent implantation due to myocardial infarction. We categorized the patients into two groups: patients with coronary artery occlusion and patients without coronary artery occlusion according to angiographic evaluation. We identified n = 122 (32.4%) 4G/4G, n = 186 (49.5%) 4G/5G, and n = 68 (18.1%) 5G/5G PAI-1 genotype carriers. Univariate and multivariate analysis showed that only the 4G/5G genotype was associated with coronary artery occlusion (OR: 1.656 and 95% CI: 1.009-2.718, p = 0.046). Our results showed that carriers of PAI-1 4G/5G genotype with myocardial infarction have increased odds of coronary artery occlusion more than 1.6 times in comparison to the carriers of homozygous genotypes.

  10. The Effect of PAI-1 4G/5G Polymorphism and Clinical Factors on Coronary Artery Occlusion in Myocardial Infarction

    PubMed Central

    Parpugga, Tajinder Kumar; Tatarunas, Vacis; Skipskis, Vilius; Kupstyte, Nora; Zaliaduonyte-Peksiene, Diana; Lesauskaite, Vaiva

    2015-01-01

    Objective. Data on the impact of PAI-1-675 4G/5G genotype for fibrinolysis during myocardial infarction are inconsistent. The aim of our study was to evaluate the association of clinical and genetic (PAI-1-675 4G/5G polymorphism) factors with coronary artery occlusion in patients with myocardial infarction. Materials and Methods. PAI-1-675 4G/5G detection was achieved by using Sanger sequencing in a sample of patients hospitalized for stent implantation due to myocardial infarction. We categorized the patients into two groups: patients with coronary artery occlusion and patients without coronary artery occlusion according to angiographic evaluation. Results. We identified n = 122 (32.4%) 4G/4G, n = 186 (49.5%) 4G/5G, and n = 68 (18.1%) 5G/5G PAI-1 genotype carriers. Univariate and multivariate analysis showed that only the 4G/5G genotype was associated with coronary artery occlusion (OR: 1.656 and 95% CI: 1.009–2.718, p = 0.046). Conclusions. Our results showed that carriers of PAI-1 4G/5G genotype with myocardial infarction have increased odds of coronary artery occlusion more than 1.6 times in comparison to the carriers of homozygous genotypes. PMID:26273123

  11. PAI-1 4G/5G polymorphism and plasma levels association in patients with coronary artery disease.

    PubMed

    Lima, Luciana Moreira; Carvalho, Maria das Graças; Fonseca Neto, Cirilo Pereira; Garcia, José Carlos Faria; Sousa, Marinez Oliveira

    2011-12-01

    Type-1 plasminogen activator inhibitor (PAI-1) 4G/5G polymorphism may influence the PAI-1 expression. High plasma levels of PAI-1 are associated with coronary artery disease (CAD). This study investigated the influence of PAI-1 4G/5G polymorphism on plasma PAI-1 levels and its association with CAD assessed by coronary angiography. Blood sample of 35 individuals with angiographically normal coronary arteries, 31 individuals presenting mild/moderate atheromatosis, 57 individuals presenting severe atheromatosis and 38 healthy individuals (controls) were evaluated. In patients and controls, the PAI-1 4G/5G polymorphism was determined by PCR amplification using allele-specific primers. Plasma PAI-1 levels were quantified by ELISA assay (American Diagnostica). No difference was found between groups regarding age, gender and body mass index. Plasma PAI-1 levels and 4G/4G genotype frequency were significantly higher in the severe atheromatosis group compared to the other groups (p<0.001). Furthermore, patients with 4G/4G genotype (r=0.28, p<0.001) had significantly higher plasma PAI-1 levels than those with 5G/5G genotype (r=0.02, p=0.4511). In addition, in a multiple logistic regression model, adjusted for all the other variables, PAI-1 was observed to be independently associated with CAD > 70% (p<0.001). The most important finding of this study was the association between 4G/4G genotype, high plasma PAI-1 levels and coronary stenosis higher than 70% in Brazilian individuals. Whether high plasma PAI-1 levels are a decisive factor for atherosclerosis worsening or it is a consequence remains to be established.

  12. Th1/Th2 cytokine profiles in G+/G- bacteremia in pediatric hematology/oncology patients.

    PubMed

    Tang, Yongmin; Liao, Chan; Xu, Xiaojun; Song, Hua; Shi, Shuwen; Yang, Shilong

    2012-01-01

    Early diagnosis of infection and appropriate choice of antibiotics are essential not only to improve the prognosis of the patients but also to prevent from the abuse of the antibiotics in hematology/oncology children at the time of neutropenia after intensive chemotherapy. We evaluated the quantification of Th1/Th2 cytokines with flow cytometry bead assay (CBA) in 145 hospitalized febrile hematology/oncology children with positive blood culture to seek for a rapid diagnostic method to determine the type of infection. IL-4, IL-6, IL-10, TNF-α, and IFN-γ levels from both G- and G+ bacteremia groups were significantly higher than those of controls (P < 0.001). The median levels of IL-6, IL-10, TNF-α of Group G- were 525.4, 96.0, and 6.9 pg/ml, respectively, significantly higher than those of Group G+ (150.0, 22.6, and 4.5 pg/ml, respectively, P < 0.001). According to the different degrees of increased IL-6 and IL-10 levels, we named the G- bacterial infection related cytokine profile G- BIRCP and the G+ BIRCP. The specificity and sensitivity of BIRCP prediction for G- and G+ bacteria cultures were 60.2% and 75.4%, 66.8% and 70.1%, respectively. Similar therapeutic efficacy was achieved between BIRCP-based and broad-spectrum antibiotics groups (86.1% vs. 89.3%, P > 0.05), which was significantly increased as compared with that (65.5%, P < 0.05) of empirical group. These results showed the promising use of the IL-6/IL-10/TNF-α determination with CBA technology for the early and rapid diagnosis, evaluation of G+/G- bacteremia in pediatric hematology/oncology patients. Copyright © 2011 Wiley Periodicals, Inc.

  13. CYP2E1 immunoglobulin G4 subclass antibodies after desflurane anesthesia

    PubMed Central

    Batistaki, Chrysanthi; Michalopoulos, George; Matsota, Paraskevi; Nomikos, Tzortzis; Kalimeris, Konstantinos; Riga, Maria; Nakou, Maria; Kostopanagiotou, Georgia

    2014-01-01

    AIM: To investigate CYP2E1 IgG4 autoantibody levels and liver biochemical markers in adult patients after anesthesia with desflurane. METHODS: Forty patients who were > 18 years old and undergoing elective surgery under general anesthesia with desflurane were studied. Alpha-glutathione-S-transferase (αGST) and IgG4 antibodies against CYP2E1 were measured preoperatively and 96 h postoperatively, as well as complete blood count, prothrombin time (PT), activated partial thromboplastin time (aPTT), international normalized ratio (INR), aspartate aminotransferase (SGOT), alanine aminotransferase (SGPT), g-glutamyl-transpeptidase (gGT), alkaline phosphatase, total serum proteins, albumin and bilirubin. A separate group of 8 patients who received regional anesthesia was also studied for calibration of the methodology used for CYP2E1 IgG4 and αGST measurements. Student’s t-test and the Mann-Whitney U test were used for comparison of the continuous variables, and Fisher’s exact test was used for the categorical variables. All tests were two-tailed, with statistical significance set as P < 0.05. RESULTS: None of the patients developed postoperative liver dysfunction, and all patients were successfully discharged from the hospital. No statistically significant difference was observed regarding liver function tests (SGOT, SGPT, γGT, bilirubin, INR), αGST and CYP2E1 IgG4, before and after exposure to desflurane. After dividing patients into two subgroups based on whether or not they had received general anesthesia in the past, no significant difference in the levels of CYP2E1 IgG4 was observed at baseline or 96 h after desflurane administration (P = 0.099 and P = 0.051, respectively). Alpha-GST baseline levels and levels after the intervention also did not differ significantly between these two subgroups (P > 0.1). The mean αGST differences were statistically elevated in men by 2.15 ng/mL compared to women when adjusted for BMI, duration of anesthesia, number of times

  14. The -675 4G/5G polymorphism in plasminogen activator inhibitor-1 gene is associated with risk of asthma: a meta-analysis.

    PubMed

    Nie, Wei; Li, Bing; Xiu, Qing-Yu

    2012-01-01

    A number of studies assessed the association of -675 4G/5G polymorphism in the promoter region of plasminogen activator inhibitor (PAI)-1 gene with asthma in different populations. However, most studies reported inconclusive results. A meta-analysis was conducted to investigate the association between polymorphism in the PAI-1 gene and asthma susceptibility. Databases including Pubmed, EMBASE, HuGE Literature Finder, Wanfang Database, China National Knowledge Infrastructure (CNKI) and Weipu Database were searched to find relevant studies. Odds ratios (ORs) with 95% confidence intervals (CIs) were used to assess the strength of association in the dominant model, recessive model, codominant model, and additive model. Eight studies involving 1817 cases and 2327 controls were included. Overall, significant association between 4G/5G polymorphism and asthma susceptibility was observed for 4G4G+4G5G vs. 5G5G (OR = 1.56, 95% CI 1.12-2.18, P = 0.008), 4G/4G vs. 4G/5G+5G/5G (OR = 1.38, 95% CI 1.06-1.80, P = 0.02), 4G/4G vs. 5G/5G (OR = 1.80, 95% CI 1.17-2.76, P = 0.007), 4G/5G vs. 5G/5G (OR = 1.40, 95% CI 1.07-1.84, P = 0.02), and 4G vs. 5G (OR = 1.35, 95% CI 1.08-1.68, P = 0.008). This meta-analysis suggested that the -675 4G/5G polymorphism of PAI-1 gene was a risk factor of asthma.

  15. PAI-1 mRNA expression and plasma level in rheumatoid arthritis: relationship with 4G/5G PAI-1 polymorphism.

    PubMed

    Muñoz-Valle, José Francisco; Ruiz-Quezada, Sandra Luz; Oregón-Romero, Edith; Navarro-Hernández, Rosa Elena; Castañeda-Saucedo, Eduardo; De la Cruz-Mosso, Ulises; Illades-Aguiar, Berenice; Leyva-Vázquez, Marco Antonio; Castro-Alarcón, Natividad; Parra-Rojas, Isela

    2012-12-01

    Rheumatoid arthritis (RA) is a chronic inflammatory disease affecting the synovial membrane, cartilage and bone. PAI-1 is a key regulator of the fibrinolytic system through which plasminogen is converted to plasmin. The plasmin activates the matrix metalloproteinase system, which is closely related with the joint damage and bone destruction in RA. The aim of this study was to investigate the relationship between 4G/5G PAI-1 polymorphism with mRNA expression and PAI-1 plasma protein levels in RA patients. 113 RA patients and 123 healthy subjects (HS) were included in the study. The 4G/5G PAI-1 polymorphism was determined by polymerase chain reaction-restriction fragment length polymorphism method; the PAI-1 mRNA expression was determined by real-time PCR; and the soluble PAI-1 (sPAI-1) levels were quantified using an ELISA kit. No significant differences in the genotype and allele frequencies of 4G/5G PAI-1 polymorphism were found between RA patients and HS. However, the 5G/5G genotype was the most frequent in both studied groups: RA (42%) and HS (44%). PAI-1 mRNA expression was slightly increased (0.67 fold) in RA patients with respect to HS (P = 0.0001). In addition, in RA patients, the 4G/4G genotype carriers showed increased PAI-1 mRNA expression (3.82 fold) versus 4G/5G and 5G/5G genotypes (P = 0.0001), whereas the sPAI-1 plasma levels did not show significant differences. Our results indicate that the 4G/5G PAI-1 polymorphism is not a marker of susceptibility in the Western Mexico. However, the 4G/4G genotype is associated with high PAI-1 mRNA expression but not with the sPAI-1 levels in RA patients.

  16. Comprehensive phenotypic analysis of knockout mice deficient in cyclin G1 and cyclin G2

    PubMed Central

    Ohno, Shouichi; Ikeda, Jun-ichiro; Naito, Yoko; Okuzaki, Daisuke; Sasakura, Towa; Fukushima, Kohshiro; Nishikawa, Yukihiro; Ota, Kaori; Kato, Yorika; Wang, Mian; Torigata, Kosuke; Kasama, Takashi; Uchihashi, Toshihiro; Miura, Daisaku; Yabuta, Norikazu; Morii, Eiichi; Nojima, Hiroshi

    2016-01-01

    Cyclin G1 (CycG1) and Cyclin G2 (CycG2) play similar roles during the DNA damage response (DDR), but their detailed roles remain elusive. To investigate their distinct roles, we generated knockout mice deficient in CycG1 (G1KO) or CycG2 (G2KO), as well as double knockout mice (DKO) deficient in both proteins. All knockouts developed normally and were fertile. Generation of mouse embryonic fibroblasts (MEFs) from these mice revealed that G2KO MEFs, but not G1KO or DKO MEFs, were resistant to DNA damage insults caused by camptothecin and ionizing radiation (IR) and underwent cell cycle arrest. CycG2, but not CycG1, co-localized with γH2AX foci in the nucleus after γ-IR, and γH2AX-mediated DNA repair and dephosphorylation of CHK2 were delayed in G2KO MEFs. H2AX associated with CycG1, CycG2, and protein phosphatase 2A (PP2A), suggesting that γH2AX affects the function of PP2A via direct interaction with its B’γ subunit. Furthermore, expression of CycG2, but not CycG1, was abnormal in various cancer cell lines. Kaplan–Meier curves based on TCGA data disclosed that head and neck cancer patients with reduced CycG2 expression have poorer clinical prognoses. Taken together, our data suggest that reduced CycG2 expression could be useful as a novel prognostic marker of cancer. PMID:27982046

  17. PAI-1 4G-4G and MTHFR 677TT in non-hepatitis C virus/hepatitis B virus-related liver cirrhosis

    PubMed Central

    Pasta, Linda; Pasta, Francesca

    2015-01-01

    AIM: To evaluate the different roles of thrombophilia in patients with and without viral etiology. The thrombophilic genetic factors (THRGFs), PAI-1 4G-4G, MTHFR 677TT, V Leiden 506Q and prothrombin 20210A, were studied as risk factors in 1079 patients with liver cirrhosis (LC), enrolled from January 2000 to January 2014. METHODS: All Caucasian LC patients consecutively observed in a fourteen-year period were included; the presence of portal vein thrombosis (PVT) and Budd Chiari syndrome (BCS) was registered. The differences between the proportions of each THRGF with regard to the presence or absence of viral etiology and the frequencies of the THRGF genotypes with those predicted in a population by the Hardy-Weinberg equilibrium were registered. RESULTS: Four hundred and seventeen/one thousand and seventy-six patients (38.6%) showed thrombophilia: 217 PAI-1 4G-4G, 176 MTHFR C677TT, 71 V Leiden factor and 41 prothrombin G20210 A, 84 with more than 1 THRGF; 350 presented with no viral liver cirrhosis (NVLC) and 729 with, called viral liver cirrhosis (VLC), of whom 56 patients were hepatitis C virus + hepatitis B virus. PAI-1 4G-4G, MTHFR C677TT, the presence of at least one TRHGF and the presence of > 1 THRGF, were statistically more frequent in patients with NVLC vs patients with VLC: All χ2 > 3.85 and P < 0.05. Patients with PVT and/or BCS with at least one TRHGF were 189/352 (53.7%). The Hardy-Weinberg of PAI-1 and MTHFR 677 genotypes deviated from that expected from a population in equilibrium in patients with NVLC (respectively χ2 = 39.3; P < 0.000 and χ2 = 27.94; P < 0.05), whereas the equilibrium was respected in VLC. CONCLUSION: MTHFR 677TT was nearly twofold and PAI-1 4G-4G more than threefold more frequently found in NVLC vs patients with VLC; the Hardy-Weinberg equilibrium of these two polymorphisms confirms this data in NVLC. We suggest that PAI-1 4G-4G and MTHFR 677TT could be considered as factors of fibrosis and thrombosis mechanisms, increasing

  18. PAI-1 4G-4G and MTHFR 677TT in non-hepatitis C virus/hepatitis B virus-related liver cirrhosis.

    PubMed

    Pasta, Linda; Pasta, Francesca

    2015-12-18

    To evaluate the different roles of thrombophilia in patients with and without viral etiology. The thrombophilic genetic factors (THRGFs), PAI-1 4G-4G, MTHFR 677TT, V Leiden 506Q and prothrombin 20210A, were studied as risk factors in 1079 patients with liver cirrhosis (LC), enrolled from January 2000 to January 2014. All Caucasian LC patients consecutively observed in a fourteen-year period were included; the presence of portal vein thrombosis (PVT) and Budd Chiari syndrome (BCS) was registered. The differences between the proportions of each THRGF with regard to the presence or absence of viral etiology and the frequencies of the THRGF genotypes with those predicted in a population by the Hardy-Weinberg equilibrium were registered. Four hundred and seventeen/one thousand and seventy-six patients (38.6%) showed thrombophilia: 217 PAI-1 4G-4G, 176 MTHFR C677TT, 71 V Leiden factor and 41 prothrombin G20210 A, 84 with more than 1 THRGF; 350 presented with no viral liver cirrhosis (NVLC) and 729 with, called viral liver cirrhosis (VLC), of whom 56 patients were hepatitis C virus + hepatitis B virus. PAI-1 4G-4G, MTHFR C677TT, the presence of at least one TRHGF and the presence of > 1 THRGF, were statistically more frequent in patients with NVLC vs patients with VLC: All χ (2) > 3.85 and P < 0.05. Patients with PVT and/or BCS with at least one TRHGF were 189/352 (53.7%). The Hardy-Weinberg of PAI-1 and MTHFR 677 genotypes deviated from that expected from a population in equilibrium in patients with NVLC (respectively χ (2) = 39.3; P < 0.000 and χ (2) = 27.94; P < 0.05), whereas the equilibrium was respected in VLC. MTHFR 677TT was nearly twofold and PAI-1 4G-4G more than threefold more frequently found in NVLC vs patients with VLC; the Hardy-Weinberg equilibrium of these two polymorphisms confirms this data in NVLC. We suggest that PAI-1 4G-4G and MTHFR 677TT could be considered as factors of fibrosis and thrombosis mechanisms, increasing the inflammation response

  19. Experimental and theoretical investigation of homogeneous gaseous reaction of CO2(g) + nH2O(g) + nNH3(g) → products (n = 1, 2).

    PubMed

    Li, Zhuangjie; Zhang, Baoquan

    2012-09-13

    Decreasing CO2 emissions into the atmosphere is key for reducing global warming. To facilitate the CO2 emission reduction efforts, our laboratory conducted experimental and theoretical investigations of the homogeneous gaseous reaction of CO2(g) + nH2O(g) + nNH3(g) → (NH4)HCO3(s)/(NH4)2CO3(s) (n = 1 and 2) using Fourier transform infrared attenuated total reflectance (FTIR-ATR) spectroscopy and ab initio molecular orbital theory. Our FTIR-ATR experimental results indicate that (NH4)2CO3(s) and (NH4)HCO3(s) are formed as aerosol particulate matter when carbon dioxide reacts with ammonia and water in the gaseous phase at room temperature. Ab initio study of this chemical system suggested that the reaction may proceed through formation of NH3·H2O(g), NH3·CO2(g), and CO2·H2O(g) complexes. Subsequent complexes, NH3·H2O·CO2 and (NH3)2·H2O·CO2, can be formed by adding gaseous reactants to the NH3·H2O(g), NH3·CO2(g), and CO2·H2O(g) complexes, respectively. The NH3·H2O·CO2 and (NH3)2·H2O·CO2 complexes can then be rearranged to produce (NH4)HCO3 and (NH4)2CO3 as final products via a transition state, and the NH3 molecule acts as a medium accepting and donating hydrogen atoms in the rearrangement process. Our computational results also reveal that the presence of an additional water molecule can reduce the activation energy of the rearrangement process. The high activation energy predicted in the present work suggests that the reaction is kinetically not favored, and our experimental observation of (NH4)HCO3(s) and (NH4)2CO3(s) may be attributed to the high concentrations of reactants increasing the reaction rate of the title reactions in the reactor.

  20. IgG4 plasma cell myeloma: new insights into the pathogenesis of IgG4-related disease.

    PubMed

    Geyer, Julia T; Niesvizky, Ruben; Jayabalan, David S; Mathew, Susan; Subramaniyam, Shivakumar; Geyer, Alexander I; Orazi, Attilio; Ely, Scott A

    2014-03-01

    IgG4-related disease is a newly described systemic fibroinflammatory process, characterized by increase in IgG4-positive plasma cells. Its pathogenesis, including the role of IgG4, remains poorly understood. Plasma cell myeloma is typically associated with a large monoclonal serum spike, which is frequently of IgG isotype. We sought to identify and characterize a subset of IgG4-secreting myeloma, as it may provide a biological model of disease with high serum levels of IgG4. Six out of 158 bone marrow biopsies (4%) from patients with IgG myeloma expressed IgG4. Four patients were men and two were women, with a mean age of 64 (range 53-87) years. Imaging showed fullness of pancreatic head (1), small non-metabolic lymphadenopathy (1), and bone lytic lesions (6). Two patients developed necrotizing fasciitis. All had elevated serum M-protein (mean 2.4, range 0.5-4.2g/dl), and none had definite signs or symptoms of IgG4-related disease. Four myelomas had plasmablastic morphology. Four had kappa and two had lambda light chain expression. Three cases expressed CD56. Two patients had a complex karyotype. In conclusion, the frequency of IgG4 myeloma correlates with the normal distribution of IgG4 isoform. The patients with IgG4 myeloma appear to have a high rate of plasmablastic morphology and could be predisposed to necrotizing fasciitis. Despite high serum levels of IgG4, none had evidence of IgG4-related disease. These findings suggest that the increased number of IgG4-positive plasma cells is not the primary etiologic agent in IgG4-related disease. Elevated serum levels of IgG4 is not sufficient to produce the typical disease presentation and should not be considered diagnostic of IgG4-related disease.

  1. Plasminogen activator inhibitor-1 4G/5G polymorphism and ischemic stroke risk: a meta-analysis in Chinese population.

    PubMed

    Cao, Yuezhou; Chen, Weixian; Qian, Yun; Zeng, Yanying; Liu, Wenhua

    2014-12-01

    The guanosine insertion/deletion polymorphism (4G/5G) of plasminogen activator inhibitor-1 (PAI-1) gene has been suggested as a risk factor for ischemic stroke (IS), but direct evidence from genetic association studies remains inconclusive even in Chinese population. Therefore, we performed a meta-analysis to evaluate this association. All of the relevant studies were identified from PubMed, Embase, Chinese National Knowledge Infrastructure database and Chinese Wanfang database up to September 2013. Statistical analyses were conducted with Revman 5.2 and STATA 12.0 software. Odds ratio (OR) with 95% confidence interval (CI) values were applied to evaluate the strength of the association. Heterogeneity was evaluated by Q-test and the I² statistic. The Begg's test and Egger's test were used to assess the publication bias. A significant association and a borderline association between the PAI-1 4G/5G polymorphism and IS were found under the recessive model (OR = 1.639, 95% CI = 1.136-2.364) and allelic model (OR = 1.256, 95% CI = 1.000-1.578), respectively. However, no significant association was observed under homogeneous comparison model (OR = 1.428, 95% CI = 0.914-2.233), heterogeneous comparison model (OR = 0.856, 95% CI = 0.689-1.063) and dominant model (OR = 1.036, 95% CI = 0.846-1.270). This meta-analysis suggested that 4G4G genotype of PAI-1 4G/5G polymorphism might be a risk factor for IS in the Chinese population.

  2. Clinicopathological significance of plasminogen activator inhibitor-1 promoter 4G/5G polymorphism in breast cancer: a meta-analysis.

    PubMed

    Lee, Ju-Han; Kim, Younghye; Choi, Jung-Woo; Kim, Young-Sik

    2013-01-01

    Plasminogen activator inhibitor type 1 (PAI-1) is associated with poor prognosis in breast cancer. Transcriptional expression of the PAI-1 can be controlled by PAI-1 promoter 4G/5G polymorphism. However, the significance of PAI-1 promoter 4G/5G polymorphism in breast cancer patients is contentious. To address this controversy, we conducted a meta-analysis for the relationships between PAI-1 promoter polymorphism and clinicopathological characteristics of breast cancer. Relevant published studies were identified using a search of PubMed, Embase, and the ISI Web of Science. The effect sizes of PAI-1 promoter 4G/5G polymorphism on breast cancer risk, lymph node metastasis, histologic grade, and overall survival were calculated by odds ratio (OR) or hazard ratio. The effect sizes were combined using a random-effects model. Individuals with 4G/4G genotype had a higher risk of breast cancer than those with the combined 4G/5G and 5G/5G genotypes (OR = 1.388; p = 0.031). Breast cancer patients with the 5G/5G genotype displayed lymph node metastasis more than patients with either the combined other genotypes (OR = 1.495; p = 0.027) or with the 4G/4G genotype (OR = 1.623; p = 0.018). However, the PAI-1 promoter 4G/5G polymorphism was not associated with histological grade or overall survival. PAI-1 promoter 4G/5G polymorphism is associated with a relatively increased risk of breast cancer development and lymph node metastasis. Copyright © 2013 IMSS. Published by Elsevier Inc. All rights reserved.

  3. The −675 4G/5G Polymorphism in Plasminogen Activator Inhibitor-1 Gene Is Associated with Risk of Asthma: A Meta-Analysis

    PubMed Central

    Xiu, Qing-yu

    2012-01-01

    Background A number of studies assessed the association of −675 4G/5G polymorphism in the promoter region of plasminogen activator inhibitor (PAI)-1 gene with asthma in different populations. However, most studies reported inconclusive results. A meta-analysis was conducted to investigate the association between polymorphism in the PAI-1 gene and asthma susceptibility. Methods Databases including Pubmed, EMBASE, HuGE Literature Finder, Wanfang Database, China National Knowledge Infrastructure (CNKI) and Weipu Database were searched to find relevant studies. Odds ratios (ORs) with 95% confidence intervals (CIs) were used to assess the strength of association in the dominant model, recessive model, codominant model, and additive model. Results Eight studies involving 1817 cases and 2327 controls were included. Overall, significant association between 4G/5G polymorphism and asthma susceptibility was observed for 4G4G+4G5G vs. 5G5G (OR = 1.56, 95% CI 1.12–2.18, P = 0.008), 4G/4G vs. 4G/5G+5G/5G (OR = 1.38, 95% CI 1.06–1.80, P = 0.02), 4G/4G vs. 5G/5G (OR = 1.80, 95% CI 1.17–2.76, P = 0.007), 4G/5G vs. 5G/5G (OR = 1.40, 95% CI 1.07–1.84, P = 0.02), and 4G vs. 5G (OR = 1.35, 95% CI 1.08–1.68, P = 0.008). Conclusions This meta-analysis suggested that the −675 4G/5G polymorphism of PAI-1 gene was a risk factor of asthma. PMID:22479620

  4. Impact of the 4G/5G polymorphism in the plasminogen activator inhibitor-1 gene on primary nephrotic syndrome.

    PubMed

    Luo, Yuezhong; Wang, Chao; Tu, Haitao

    2014-03-01

    The aim of the present study was to investigate whether the four guanosines (4G)/five guanosines (5G) polymorphism in the gene coding for plasminogen activator inhibitor-1 (PAI-1) affects the clinical features of primary nephrotic syndrome (PNS). A cohort of 200 biopsy-diagnosed PNS patients was studied, with 40 healthy subjects as controls. The PAI-1 gene polymorphism was detected by polymerase chain reaction and DNA sequencing. Associations between the PAI-1 4G/5G polymorphism and clinical features and pathological types of PNS were analyzed. The results indicated that the PAI-1 genotype distribution is significantly different between patients with PNS and healthy controls, with significantly higher numbers of the 4G/4G genotype and lower numbers of the 5G5G genotype detected in PNS patients compared to controls (both P<0.05). The frequency of the 4G allele was also significantly higher in PNS patients compared to healthy controls (P<0.01). Among the different pathological types of PNS, IgA nephropathy (IgAN) and membranous nephropathy (MN) were associated with significantly increased frequencies of the 4G/4G and 4G/5G genotypes, as well as of the 4G allele. The increased 4G frequency was also detected in patients with minimal change disease (MCD). Significantly increased international normalized ratio (INR) and prolonged activated partial thromboplastin time (APTT) were observed in 4G/4G compared to 5G/5G PNS subjects. The response to steroids was not significantly different among the three genotypes. In conclusion, the 4G allele of the PAI-1 gene appears to be associated with PNS, especially in MN and IgAN patients. These findings suggest that specific targeting may be required for the treatment of PNS patients with the 4G/4G genotype.

  5. Plasminogen activator inhibitor-1 4G/5G polymorphism is associated with coronary artery disease risk: a meta-analysis.

    PubMed

    Zhang, Huifeng; Dong, Pingshuan; Yang, Xuming; Liu, Zhenghao

    2014-01-01

    The aim of the current study was to evaluate the association of PAI-1 4G/5G polymorphism with coronary artery disease (CAD) risk using a meta-analysis. All eligible studies were identified through a search of PubMed, EMBASE, China National Knowledge Infrastructure (CNKI), Database of Chinese Scientific and Technical Periodicals, and China Biology Medical literature database (CBM) before June 2014. The association between the PAI-1 4G/5G polymorphism and CAD risk was estimated by odds ratio (OR) and 95% confidence interval (CI). A total of 72 studies including 23557 cases and 21526 controls were eventually collected. The PAI-1 4G/5G polymorphism was significant associated with CAD risk in overall population (OR=1.19, 95% CI 1.10-1.28, P < 0.00001). The combination of adjusted ORs for CAD was 1.20 (95% CI 1.03-1.40, P=0.02). This polymorphism was associated with CAD risk in Caucasians (OR=1.10, 95% CI 1.02-1.19, P=0.01) and Asians (OR=1.46, 95% CI 1.21-1.75, P < 0.0001). This polymorphism significantly increased MI risk (OR=1.15, 95% CI 1.06-1.25, P=0.001). In the subgroup analysis by age, this polymorphism was significantly associated with early-onset CAD risk (OR=1.21, 95% CI 1.02-1.43, P=0.03). In the gender subgroup analyses, a statistically significant association was found in male CAD patients (OR=1.10, 95% CI 1.01-1.20, P=0.04). Both T2DM patients and non-T2DM patients carrying 4G allele showed increased CAD risks (OR=2.23, 95% CI 1.27-3.92, P=0.005 and OR=1.64, 95% CI 1.19-2.25, P=0.002, respectively). This meta-analysis suggested that PAI-1 4G/5G polymorphism was a risk factor for CAD.

  6. Plasminogen activator inhibitor-1 4G/5G polymorphism is associated with coronary artery disease risk: a meta-analysis

    PubMed Central

    Zhang, Huifeng; Dong, Pingshuan; Yang, Xuming; Liu, Zhenghao

    2014-01-01

    Background: The aim of the current study was to evaluate the association of PAI-1 4G/5G polymorphism with coronary artery disease (CAD) risk using a meta-analysis. Methods: All eligible studies were identified through a search of PubMed, EMBASE, China National Knowledge Infrastructure (CNKI), Database of Chinese Scientific and Technical Periodicals, and China Biology Medical literature database (CBM) before June 2014. The association between the PAI-1 4G/5G polymorphism and CAD risk was estimated by odds ratio (OR) and 95% confidence interval (CI). Results: A total of 72 studies including 23557 cases and 21526 controls were eventually collected. The PAI-1 4G/5G polymorphism was significant associated with CAD risk in overall population (OR=1.19, 95% CI 1.10-1.28, P < 0.00001). The combination of adjusted ORs for CAD was 1.20 (95% CI 1.03-1.40, P=0.02). This polymorphism was associated with CAD risk in Caucasians (OR=1.10, 95% CI 1.02-1.19, P=0.01) and Asians (OR=1.46, 95% CI 1.21-1.75, P < 0.0001). This polymorphism significantly increased MI risk (OR=1.15, 95% CI 1.06-1.25, P=0.001). In the subgroup analysis by age, this polymorphism was significantly associated with early-onset CAD risk (OR=1.21, 95% CI 1.02-1.43, P=0.03). In the gender subgroup analyses, a statistically significant association was found in male CAD patients (OR=1.10, 95% CI 1.01-1.20, P=0.04). Both T2DM patients and non-T2DM patients carrying 4G allele showed increased CAD risks (OR=2.23, 95% CI 1.27-3.92, P=0.005 and OR=1.64, 95% CI 1.19-2.25, P=0.002, respectively). Conclusions: This meta-analysis suggested that PAI-1 4G/5G polymorphism was a risk factor for CAD. PMID:25419432

  7. Global fibrinolytic activity, PAI-1 level, and 4G/5G polymorphism in Thai children with arterial ischemic stroke.

    PubMed

    Natesirinilkul, Rungrote; Sasanakul, Werasak; Chuansumrit, Ampaiwan; Kadegasem, Praguywan; Visudtibhan, Anannit; Wongwerawattanakoon, Pakawan; Sirachainan, Nongnuch

    2014-01-01

    Prolonged euglobulin clot lysis time (ECLT) and increased level of plasminogen activator inhibitor-1 (PAI-1) were reported to be risk factors of arterial ischemic stroke (AIS) by some studies; however, these findings were not supported by other studies. The objective of this study was to determine the association of ECLT, PAI-1 level, and polymorphisms of 4G and 5G of PAI-1 gene to the development of AIS in Thai children. This study included patients aged 1-18 years old. Diagnosis of AIS was confirmed by imaging study. The control group was age- and sex-matched healthy subjects. Demographic data were recorded, and blood was tested for ECLT, PAI-1 level, lipid profiles, fasting blood sugar (FBS), and 4G and 5G polymorphisms of PAI-1 gene. There were 70 subjects participating in this study, consisting of 30 patients and 40 controls. Demographic data, lipid profiles, and FBS were similar between the 2 groups. Furthermore, ECLT and PAI-1 level did not differ between patient and control groups; however, both showed significant correlation (r = .352, P = .006). The 4G/5G polymorphism was the most common genotype in both patient and control groups (69.0% vs. 80.0%). However, 4G and 5G polymorphisms of PAI-1 gene did not correlate with PAI-1 level in this study (P = .797). The PAI-1 level and 4G/5G polymorphism may not be a risk factor of AIS in this population. It was also found that the 4G/5G polymorphism was the most common PAI-1 genotype in this study. Copyright © 2014 National Stroke Association. Published by Elsevier Inc. All rights reserved.

  8. Plasminogen activator inhibitor I 4G/5G polymorphism in neonatal respiratory distress syndrome.

    PubMed

    Armangil, Didem; Yurdakök, Murat; Okur, Hamza; Gürgey, Aytemiz

    2011-08-01

    Fibrin monomers inhibit surfactant function. 4G/5G insertion/deletion polymorphism plays an important role in the regulation of plasminogen activator inhibitor 1 (PAI-1) gene expression. To examine the genotype distribution of PAI-1 polymorphism in 60 infants with respiratory distress syndrome (RDS) and 53 controls, an allele-specific polymerase chain reaction (PCR) was used. The proportion of 4G/4G, 4G/5G, and 5G/5G genotypes did not differ statistically between the RDS and control groups (P > .05). Having PAI-1 4G/4G genotype polymorphism appears to increase the risk of RDS (odds ratio [OR] =1.5; 95% confidence interval [CI], 0.5-4.3), although it was not statistically significant. No relation was found between the PAI-1 4G/5G polymorphisms and RDS, but there was an increased risk associated with the 4G variant of the PAI-1 gene. We believe that our findings of increased 4G allele of the PAI-1 gene in infants with RDS would also help to clarify the pathogenesis of RDS.

  9. Immunocytochemical localization of the ovine immunoglobulins IgA, IgG1, IgG1A and IgG2: effect of gastro-intestinal parasitism in the sheep

    PubMed Central

    Curtain, C. C.; Anderson, N.

    1971-01-01

    A study has been made of the immunocytochemical localization of IgG1, IgG2, IgG1A and IgA in the alimentary tract and associated lymph nodes of parasitized and parasite-free sheep. No immunoglobulin-containing cells were found in the abomasal mucosa of the parasite-free sheep. On the other hand, large numbers of IgG1 and IgG1A-containing cells were found in the lamina propria and at the base of the villi of the abomasum of the parasitized sheep. IgG1, IgG1A, and IgA-containing cells were found in mucosal sections from the jejunum and ileum of both parasitized and parasite-free sheep, the number of IgG1A-containing cells being sifnificantly greater in the former than in the latter. This increase was considered to be of some importance since the IgG1A subclass appears to be involved in the allergic response of the sheep to intestinal parasites. ImagesFIG. 1FIG. 2FIG. 3FIG. 4FIG. 5FIG. 6FIG. 7 PMID:4924939

  10. Aflatoxin (B1 , B2 , G1 , and G2 ) contamination in rice of Mexico and Spain, from local sources or imported.

    PubMed

    Suárez-Bonnet, Elena; Carvajal, Magda; Méndez-Ramírez, Ignacio; Castillo-Urueta, Pável; Cortés-Eslava, Josefina; Gómez-Arroyo, Sandra; Melero-Vara, José María

    2013-11-01

    Rice is an important cereal but it is often contaminated with aflatoxins (AFs). The purpose of this study was to identify and quantify AF (B1 , B2 , G1 , and G2 ) in 67 rice samples cultivated in Mexico and Spain, and from imported crops collected in 2008 and 2009. The methodology was validated, the rice samples were concentrated and purified with immunoaffinity columns and were quantified by high-pressure liquid chromatography (HPLC). The average total AF (AFt) in the Spanish rice was 37.3 μg/kg, the range was from 1.6 to 1383 μg/kg, the most contaminated samples being from San Juan de Aznalfarache, Sevilla (AFt = 138.6 μg/kg), from Tortosa, Tarragona (AFt = 104.6 μg/kg), and Calasparra, Murcia (AFt = 103.9 μg/kg). The rice imported from France to Spain had AFt of 26.6 μg/kg and from Pakistan AFt of 18.4 μg/kg, showing less AF contamination than the local one. The rice which originated from Mexico contained (AFt = 16.9 μg/kg), and those imported from the United States (AFt = 14.4 μg/kg) and Uruguay (AFt = 15.6 μg/kg). The imported rice had better quality in terms of the presence of AFs. © 2013 Institute of Food Technologists®

  11. Association of the plasminogen activator inhibitor-1 (PAI-1) Gene -675 4G/5G and -844 A/G promoter polymorphism with risk of keloid in a Chinese Han population.

    PubMed

    Wang, Yongjie; Long, Jianhong; Wang, Xiaoyan; Sun, Yang

    2014-10-28

    A keloid is pathological scar caused by aberrant response to skin injuries, characterized by excessive accumulation of histological extracellular matrix, and occurs in genetically susceptible individuals. Plasminogen activator inhibitor-1 (PAI-1) has been implicated in the pathogenesis of keloid. We investigated the association between PAI-1 polymorphisms and plasma PAI-1 level with keloid risk. A total of 242 Chinese keloid patients and 207 controls were enrolled in this study. Polymerase chain reaction-restriction technique was used to determine PAI-1 promoter polymorphism (-675 4G/5G and -844 A/G) distribution. Plasma PAI-1 levels were detected using enzyme-linked immunosorbent assay (ELISA). There was a statistically significant difference in the distribution of PAI-1 -675 4G/5G polymorphism between keloid patients and healthy controls. 4G/4G carriers were more likely to develop keloid. In contrast, the -844 A/G polymorphism distribution did not vary significantly between keloid patients and controls. The keloid patients group had a significantly higher plasma PAI-1 level than the control group. In the -675 4G/4G carrier population, the plasma PAI-1 levels were significant higher in keloid patients compared with controls. Our study provides evidence that PAI-1 promoter polymorphism -675 4G/5G and plasma PAI-1 level are associated with keloid risk. PAI-1 -675 4G/5G polymorphism may be an important hereditary factor responsible for keloid development in the Chinese Han population.

  12. Impact of the -675 4G/5G polymorphism of the plasminogen activator inhibitor-1 gene on childhood IgA nephropathy.

    PubMed

    Han, Su-Ryun; Kim, Cheon-Jong; Lee, Byung-Cheol

    2012-04-01

    Plasminogen activator inhibitor-1 (PAI-1) is an important regulator of the fibrinolytic pathway and extracellular matrix (ECM) turnover. The -675 4G/5G polymorphism in the PAI-1 promoter is associated with altered PAI-1 transcription, suggesting that this polymorphism may be a candidate risk factor for diseases characterized by ECM accumulation, such as immunoglobulin A nephropathy (IgAN) and mesangial proliferative glomerulonephritis (MesPGN). We genotyped childhood patients with biopsy-confirmed IgAN (n=111) and MesPGN (n=47), and healthy control subjects (n=230) for the -675 4G/5G PAI-1 polymorphism by polymerase chain reaction-restriction fragment length polymorphism methods. The distribution of the 4G/4G (27.9%), 4G/5G (45.1%) and 5G/5G (27.0%) genotypes in IgAN patients was significantly different from the healthy controls (32.2, 54.3 and 13.5%, respectively) (p=0.0092). There was no significant difference in the genotype distributions of the 4G/5G polymorphism between MesPGN patients and the healthy controls. Regarding the impact of the polymorphism on IgAN, the 4G/4G genotype was markedly increased in patients with proteinuria (≥1,000 mg/day) and/or hypertension when compared to patients without proteinuria and hypertension (OR=5.23, 95% CI 1.34-20.38, P=0.0183). These findings indicate that the PAI-1 gene polymorphism may affect the susceptibility of childhood IgAN.

  13. Secure Military Communications on 3G, 4G and WiMAX

    DTIC Science & Technology

    2013-09-01

    per bit, low latency, good quality of service, good coverage and support for mobility at high speeds. Thus, 4G wireless technologies are based on 3G ...security for military communications. 87 LIST OF REFERENCES [1] C. Blanchard, “Security for the third generation ( 3G ) mobile system,” Elsevier Science...COMMUNICATIONS ON 3G , 4G AND WIMAX by Panagiotis Schoinas September 2013 Thesis Advisor: Gurminder Singh Co-Advisor: John H. Gibson

  14. Collisional relaxation of O2(X^3Σ _g^ -, υ = 1) and O2(a1Δg, υ = 1) by atmospherically relevant species

    NASA Astrophysics Data System (ADS)

    Pejaković, Dušan A.; Campbell, Zachary; Kalogerakis, Konstantinos S.; Copeland, Richard A.; Slanger, Tom G.

    2011-09-01

    Laboratory measurements are reported of the rate coefficient for collisional removal of O2(X^3Σ _g^ -, υ = 1) by O(3P), and the rate coefficients for removal of O2(a1Δg, υ = 1) by O2, CO2, and O(3P). A two-laser method is employed, in which the pulsed output of the first laser at 285 nm photolyzes ozone to produce oxygen atoms and O2(a1Δg, υ = 1), and the output of the second laser detects O2(a1Δg, υ = 1) via resonance-enhanced multiphoton ionization. The kinetics of O2(X^3Σ _g^ -, υ = 1) + O(3P) relaxation is inferred from the temporal evolution of O2(a1Δg, υ = 1), an approach enabled by the rapid collision-induced equilibration of the O2(X^3Σ _g^ -, υ = 1) and O2(a1Δg, υ = 1) populations in the system. The measured O2(X^3Σ _g^ -, υ = 1) + O(3P) rate coefficient is (2.9 ± 0.6) × 10-12 cm3 s-1 at 295 K and (3.4 ± 0.6) × 10-12 cm3 s-1 at 240 K. These values are consistent with the previously reported result of (3.2 ± 1.0) × 10-12 cm3 s-1, which was obtained at 315 K using a different experimental approach [K. S. Kalogerakis, R. A. Copeland, and T. G. Slanger, J. Chem. Phys. 123, 194303 (2005)]. For removal of O2(a1Δg, υ = 1) by O(3P), the upper limits for the rate coefficient are 4 × 10-13 cm3 s-1 at 295 K and 6 × 10-13 cm3 s-1 at 240 K. The rate coefficient for removal of O2(a1Δg, υ = 1) by O2 is (5.6 ± 0.6) × 10-11 cm3 s-1 at 295 K and (5.9 ± 0.5) × 10-11 cm3 s-1 at 240 K. The O2(a1Δg, υ = 1) + CO2 rate coefficient is (1.5 ± 0.2) × 10-14 cm3 s-1 at 295 K and (1.2 ± 0.1) × 10-14 cm3 s-1 at 240 K. The implications of the measured rate coefficients for modeling of atmospheric emissions are discussed.

  15. Demonstration of IgG Subclass (IgG1 and IgG3) in Immuno-Related Hemocytopenia.

    PubMed

    Shao, Yuanyuan; Qi, Xiao; Fu, Rong; Liu, Hui; Wang, Yihao; Ding, Shaoxue; Wang, Huaquan; Li, Lijuan; Shao, Zonghong

    2018-06-01

    Immuno-related hemocytopenia (IRH) is defined as idiopathic cytopenia of undetermined significance (ICUS) patients with autoantibodies. In our previous studies, we found that IgG1 levels were increased in IRH patients and might cause the destruction of hematopoietic cells. In this study, we analyzed IgG subclasses in 30 IRH patients (male:female = 13:17, median age 32 years, range 18 - 56), 15 IRH remission patients (IRH-R) (male:female = 6:9, median age 34, range 20 - 52) and 20 normal controls (male:female = 8:12, median age 27, range 24 - 36) by Cytometric Bead Array, Flow Cytometry and Immunohistochemical staining. Levels of IgG1/IgG3 in the bone marrow supernatant of IRH patents, as well as the proportion of CD5+ B lymphocytes and Th2 cells (CD3+CD8-IL-4+) were higher than those of IRH-R patients and normal controls, and IgG1 levels had a positive correlation with the proportion of Th2 cells. In IRH patients, IgG1 and IgG3 were positive on nucleated erythrocytes and granulocytes, which were negative in IRH-R patients and healthy controls and had inverse correlations with hematopoietic function. Using immunohistochemical staining, IgG1 were also detected on bone marrow biopsies of IRH patients. The results indicated that IgG1 and IgG3 autoantibodies in IRH patients might play a key role in the IRH pathogenesis and in the abnormal immune function of IRH patients.

  16. Association between the SERPINE1 (PAI-1) 4G/5G insertion/deletion promoter polymorphism (rs1799889) and pre-eclampsia: a systematic review and meta-analysis.

    PubMed

    Zhao, Linlu; Bracken, Michael B; Dewan, Andrew T; Chen, Suzan

    2013-03-01

    The SERPINE1 -675 4G/5G promoter region insertion/deletion polymorphism (rs1799889) has been implicated in the pathogenesis of pre-eclampsia (PE), but the genetic association has been inconsistently replicated. To derive a more precise estimate of the association, a systematic review and meta-analysis was conducted. This study conformed to Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines. PubMed (MEDLINE), Scopus and HuGE Literature Finder literature databases were systematically searched for relevant studies. Summary odds ratios (ORs) and 95% confidence intervals (CIs) were calculated for the allelic comparison (4G versus 5G) and genotypic comparisons following the co-dominant (4G/4G versus 5G/5G and 4G/5G versus 5G/5G), dominant (4G/4G+4G/5G versus 5G/5G) and recessive (4G/4G versus 4G/5G+5G/5G) genetic models. Between-study heterogeneity was quantified by I(2) statistics and publication bias was appraised with funnel plots. Sensitivity analysis was conducted to evaluate the robustness of meta-analysis findings. Meta-analysis of 11 studies involving 1297 PE cases and 1791 controls found a significant association between the SERPINE1 -675 4G/5G polymorphism and PE for the recessive genetic model (OR = 1.36, 95% CI: 1.13-1.64, P = 0.001), a robust finding according to sensitivity analysis. A low level of between-study heterogeneity was detected (I(2) = 20%) in this comparison, which may be explained by ethnic differences. Funnel plot inspection did not reveal evidence of publication bias. In conclusion, this study provides a comprehensive examination of the available literature on the association between SERPINE1 -675 4G/5G and PE. Meta-analysis results support this polymorphism as a likely susceptibility variant for PE.

  17. Association of the Plasminogen Activator Inhibitor-1 (PAI-1) Gene -675 4G/5G and -844 A/G Promoter Polymorphism with Risk of Keloid in a Chinese Han Population

    PubMed Central

    Wang, Yongjie; Long, Jianhong; Wang, Xiaoyan; Sun, Yang

    2014-01-01

    Background A keloid is pathological scar caused by aberrant response to skin injuries, characterized by excessive accumulation of histological extracellular matrix, and occurs in genetically susceptible individuals. Plasminogen activator inhibitor-1 (PAI-1) has been implicated in the pathogenesis of keloid. We investigated the association between PAI-1 polymorphisms and plasma PAI-1 level with keloid risk. Material/Methods A total of 242 Chinese keloid patients and 207 controls were enrolled in this study. Polymerase chain reaction-restriction technique was used to determine PAI-1 promoter polymorphism (-675 4G/5G and -844 A/G) distribution. Plasma PAI-1 levels were detected using enzyme-linked immunosorbent assay (ELISA). Results There was a statistically significant difference in the distribution of PAI-1 -675 4G/5G polymorphism between keloid patients and healthy controls. 4G/4G carriers were more likely to develop keloid. In contrast, the -844 A/G polymorphism distribution did not vary significantly between keloid patients and controls. The keloid patients group had a significantly higher plasma PAI-1 level than the control group. In the -675 4G/4G carrier population, the plasma PAI-1 levels were significant higher in keloid patients compared with controls. Conclusions Our study provides evidence that PAI-1 promoter polymorphism -675 4G/5G and plasma PAI-1 level are associated with keloid risk. PAI-1 -675 4G/5G polymorphism may be an important hereditary factor responsible for keloid development in the Chinese Han population. PMID:25350781

  18. Inhibition of G0/G1 Switch 2 Ameliorates Renal Inflammation in Chronic Kidney Disease.

    PubMed

    Matsunaga, Naoya; Ikeda, Eriko; Kakimoto, Keisuke; Watanabe, Miyako; Shindo, Naoya; Tsuruta, Akito; Ikeyama, Hisako; Hamamura, Kengo; Higashi, Kazuhiro; Yamashita, Tomohiro; Kondo, Hideaki; Yoshida, Yuya; Matsuda, Masaki; Ogino, Takashi; Tokushige, Kazutaka; Itcho, Kazufumi; Furuichi, Yoko; Nakao, Takaharu; Yasuda, Kaori; Doi, Atsushi; Amamoto, Toshiaki; Aramaki, Hironori; Tsuda, Makoto; Inoue, Kazuhide; Ojida, Akio; Koyanagi, Satoru; Ohdo, Shigehiro

    2016-11-01

    Chronic kidney disease (CKD) is a global health problem, and novel therapies to treat CKD are urgently needed. Here, we show that inhibition of G 0 /G 1 switch 2 (G0s2) ameliorates renal inflammation in a mouse model of CKD. Renal expression of chemokine (C-C motif) ligand 2 (Ccl2) was increased in response to p65 activation in the kidneys of wild-type 5/6 nephrectomy (5/6Nx) mice. Moreover, 5/6Nx Clk/Clk mice, which carry homozygous mutations in the gene encoding circadian locomotor output cycles kaput (CLOCK), did not exhibit aggravation of apoptosis or induction of F4/80-positive cells. The renal expression of G0s2 in wild-type 5/6Nx mice was important for the transactivation of Ccl2 by p65. These pathologies were ameliorated by G0s2 knockdown. Furthermore, a novel small-molecule inhibitor of G0s2 expression was identified by high-throughput chemical screening, and the inhibitor suppressed renal inflammation in 5/6Nx mice. These findings indicated that G0s2 inhibitors may have applications in the treatment of CKD. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  19. Impact of the -675 4G/5G polymorphism of the plasminogen activator inhibitor-1 gene on childhood IgA nephropathy

    PubMed Central

    HAN, SU-RYUN; KIM, CHEON-JONG; LEE, BYUNG-CHEOL

    2012-01-01

    Plasminogen activator inhibitor-1 (PAI-1) is an important regulator of the fibrinolytic pathway and extracellular matrix (ECM) turnover. The -675 4G/5G polymorphism in the PAI-1 promoter is associated with altered PAI-1 transcription, suggesting that this polymorphism may be a candidate risk factor for diseases characterized by ECM accumulation, such as immunoglobulin A nephropathy (IgAN) and mesangial proliferative glomerulonephritis (MesPGN). We genotyped childhood patients with biopsy-confirmed IgAN (n=111) and MesPGN (n=47), and healthy control subjects (n=230) for the -675 4G/5G PAI-1 polymorphism by polymerase chain reaction-restriction fragment length polymorphism methods. The distribution of the 4G/4G (27.9%), 4G/5G (45.1%) and 5G/5G (27.0%) genotypes in IgAN patients was significantly different from the healthy controls (32.2, 54.3 and 13.5%, respectively) (p=0.0092). There was no significant difference in the genotype distributions of the 4G/5G polymorphism between MesPGN patients and the healthy controls. Regarding the impact of the polymorphism on IgAN, the 4G/4G genotype was markedly increased in patients with proteinuria (≥1,000 mg/day) and/or hypertension when compared to patients without proteinuria and hypertension (OR=5.23, 95% CI 1.34–20.38, P=0.0183). These findings indicate that the PAI-1 gene polymorphism may affect the susceptibility of childhood IgAN. PMID:22969955

  20. Diagnostic Performance of Serum IgG4 Levels in Patients With IgG4-Related Disease

    PubMed Central

    Yu, Kuang-Hui; Chan, Tien-Ming; Tsai, Ping-Han; Chen, Ching-Hui; Chang, Pi-Yueh

    2015-01-01

    Abstract The aim of this study is to study the clinical features and diagnostic performance of IgG4 in Chinese populations with IgG4-related diseases (IgG4-RDs). The medical records of 2901 adult subjects who underwent serum IgG4 level tests conducted between December 2007 and May 2014 were reviewed. Serum concentrations of IgG4 were measured in 2901 cases, including 161 (5.6%) patients with IgG4-RD and 2740 (94.4%) patients without IgG4-RD (non-IgG4-RD group). The mean age of the IgG4-RD patients was 58.4 ± 16.1 years (range: 21–87), and 48 (29.8%) were women. The mean serum IgG4 level was significantly much higher in IgG4-RD patients than in non-IgG4-RD (1062.6 vs 104.3 mg/dL, P < 0.001) participants. For IgG4 >135 mg/dL, the sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV), likelihood ratio (LR)+, and LR− were 86%, 77%, 18%, 99%, 3.70, and 0.19, respectively. When the upper limit of normal was doubled for an IgG4 >270 mg/dL, the corresponding data were 75%, 94%, 43%, 98%, 12.79, and 0.26, respectively. For IgG4 >405 mg/dL (tripling the upper limit of normal), the corresponding data were 62%, 98%, 68%, 98%, 37.00, and 0.39, respectively. When calculated according to the manufacturer's package insert cutoff (>201 mg/dL) for the diagnosis of IgG4-RD, the corresponding sensitivity, specificity, PPV, NPV, LR+, and LR− were 80%, 89%, 29%, 99%, 7.00, and 0.23, respectively. For IgG4 >402 mg/dL (>2× the upper limit of the normal range), the corresponding data were 62%, 98%, 68%, 98%, 36.21, and 0.39, respectively. For IgG4 >603 mg/dL (>3× the upper limit of the normal range), the corresponding data were 50%, 99%, 84%, 97%, 90.77 and 0.51, respectively. The optimal cutoff value of serum IgG4 (measured by nephelometry using a Siemens BN ProSpec instrument and Siemens reagent) for the diagnosis of IgG4-RD was 248 mg/dL, the sensitivity and specificity were 77.6% and 92.8%, respectively. The present

  1. Optimization of chromatographic conditions for determination of aflatoxin B1, B2, G1 and G2 by using liquid chromatography-mass Spectrometry

    NASA Astrophysics Data System (ADS)

    Ramadhaningtyas, Dillani Putri; Aryana, Nurhani; Aristiawan, Yosi; Styarini, Dyah

    2017-11-01

    The optimization of instrument condition and chromatographic separation for analysis of aflatoxin B1, B2, G1 and G2 using liquid chromatography tandem with mass spectrometer detector was conducted in the aim to provide more accurate and reliable analysis results. The aflatoxin known to be serious threat for human health as it is classified as the carcinogenic compounds. The aflatoxin B1, B2, G1 and G2 were selected due to its extensive contamination in various agricultural commodities. The best chromatographic separation was obtained using C-18 column with gradient elution of solvent 5 mM ammonium acetate and 0.1% formic acid in methanol at 7 minutes runtime analysis. The linearity of the detector showed satisfied results as the coefficient determination found to be 0.9994, 0.9996, 0.9998 and 0.9987 for aflatoxin B1, G1, B2, and G2 respectively in the range concentration from 1 to 20 ng/g. The quantifier ion selected for the aflatoxin B1, B2, G1 and G2 was m/z 285.1, 259, 243 and 313 respectively. The instrument precision at these quantifier ions also showed satisfied result with %RSD was around 3.4 to 6.8%. The optimized method present in this study can be used for further sample analysis.

  2. Influence of decreased fibrinolytic activity and plasminogen activator inhibitor-1 4G/5G polymorphism on the risk of venous thrombosis.

    PubMed

    Vuckovic, Biljana A; Djeric, Mirjana J; Tomic, Branko V; Djordjevic, Valentina J; Bajkin, Branislav V; Mitic, Gorana P

    2018-01-01

    : Objective of our study is to determine whether decreased fibrinolytic activity or plasminogen activator inhibitor (PAI)-1 4G/5G polymorphism influence the risk of venous thrombosis.Our case-control study included 100 patients with venous thrombosis, and 100 random controls. When patients were compared with random controls, unconditional logistic regression was used to calculate odds ratios (ORs) with 95% confidence intervals (CIs).Decreased fibrinolytic activity yielded a 2.7-fold increase in risk for venous thrombosis than physiological fibrinolytic activity (OR 2.70; 95% CI 1.22-5.98), when comparing patients with random controls. Adjustment for several putative confounders did not change the estimate (OR 3.02; 95% CI 1.26-7.22). Analysis of venous thrombotic risk influenced by PAI-1 genotype, showed no influence of PAI-1 4G/5G gene variant in comparison with 5G/5G genotype (OR 0.57 95% CI; 0.27-1.20).Decreased fibrinolytic activity increased, whereas PAI-1 4G/5G polymorphism did not influence venous thrombosis risk in this study.

  3. Degradation of trichloroethylene by Pseudomonas cepacia G4 and the constitutive mutant strain G4 5223 PR1 in aquifer microcosms

    USGS Publications Warehouse

    Krumme, M.L.; Timmis, K.N.; Dwyer, D.F.

    1993-01-01

    Pseudomonas cepacia G4 degrades trichloroethylene (TCE) via a degradation pathway for aromatic compounds which is induced by substrates such as phenol and tryptophan. P. cepacia G4 5223 PR1 (PR1) is a Tn5 insertion mutant which constitutively expresses the toluene ortho-monooxygenase responsible for TCE degradation. In groundwater microcosms, phenol-induced strain G4 and noninduced strain PR1 degraded TCE (20 and 50 microM) to nondetectable levels (< 0.1 microM) within 24 h at densities of 10(8) cells per ml; at lower densities, degradation of TCE was not observed after 48 h. In aquifer sediment microcosms, TCE was reduced from 60 to < 0.1 microM within 24 h at 5 x 10(8) PR1 organisms per g (wet weight) of sediment and from 60 to 26 microM over a period of 10 weeks at 5 x 10(7) PR1 organisms per g. Viable G4 and PR1 cells decreased from approximately 10(7) to 10(4) per g over the 10-week period.

  4. Distances to supernova remnants G20.4 + 0.1, G24.7 - 0.6, and G28.6 - 0.1 and new molecular cloud associations

    NASA Astrophysics Data System (ADS)

    Ranasinghe, S.; Leahy, D. A.

    2018-06-01

    Accurate distances to supernova remnants (SNRs) are crucial in determining their size, age, luminosity, and evolutionary state. To determine distances, we chose three SNRs from the VLA (Very Large Array) Galactic Plane Survey for extraction of H I absorption spectra. Analysing H I absorption spectra, 13CO emission spectra, and H I and 13CO channel maps, kinematic velocities (or their limits) to the three SNRs were calculated. The three SNRs are probably associated with molecular clouds and the new distance to G20.4 + 0.1, G24.7 - 0.6, and G28.6 - 0.1 are 7.8 ± 0.5 kpc, 3.8 ± 0.2 kpc, and 9.6 ± 0.3 kpc, respectively.

  5. Plasminogen activator inhibitor-1 4G/5G gene polymorphism and coronary artery disease in the Chinese Han population: a meta-analysis.

    PubMed

    Li, Yan-yan

    2012-01-01

    The polymorphism of plasminogen activator inhibitor-1 (PAI-1) 4G/5G gene has been indicated to be correlated with coronary artery disease (CAD) susceptibility, but study results are still debatable. The present meta-analysis was performed to investigate the association between PAI-1 4G/5G gene polymorphism and CAD in the Chinese Han population. A total of 879 CAD patients and 628 controls from eight separate studies were involved. The pooled odds ratio (OR) for the distribution of the 4G allele frequency of PAI-1 4G/5G gene and its corresponding 95% confidence interval (CI) was assessed by the random effect model. The distribution of the 4 G allele frequency was 0.61 for the CAD group and 0.51 for the control group. The association between PAI-1 4G/5G gene polymorphism and CAD in the Chinese Han population was significant under an allelic genetic model (OR = 1.70, 95% CI = 1.18 to 2.44, P = 0.004). The heterogeneity test was also significant (P<0.0001). Meta-regression was performed to explore the heterogeneity source. Among the confounding factors, the heterogeneity could be explained by the publication year (P = 0.017), study region (P = 0.014), control group sample size (P = 0.011), total sample size (P = 0.011), and ratio of the case to the control group sample size (RR) (P = 0.019). In a stratified analysis by the total sample size, significantly increased risk was only detected in subgroup 2 under an allelic genetic model (OR = 1.93, 95% CI = 1.09 to 3.35, P = 0.02). In the Chinese Han population, PAI-1 4G/5G gene polymorphism was implied to be associated with increased CAD risk. Carriers of the 4G allele of the PAI-1 4G/5G gene might predispose to CAD.

  6. Plasminogen Activator Inhibitor-1 4G/5G Gene Polymorphism and Coronary Artery Disease in the Chinese Han Population: A Meta-Analysis

    PubMed Central

    Li, Yan-yan

    2012-01-01

    Background The polymorphism of plasminogen activator inhibitor-1 (PAI-1) 4G/5G gene has been indicated to be correlated with coronary artery disease (CAD) susceptibility, but study results are still debatable. Objective and Methods The present meta-analysis was performed to investigate the association between PAI-1 4G/5G gene polymorphism and CAD in the Chinese Han population. A total of 879 CAD patients and 628 controls from eight separate studies were involved. The pooled odds ratio (OR) for the distribution of the 4G allele frequency of PAI-1 4G/5G gene and its corresponding 95% confidence interval (CI) was assessed by the random effect model. Results The distribution of the 4 G allele frequency was 0.61 for the CAD group and 0.51 for the control group. The association between PAI-1 4G/5G gene polymorphism and CAD in the Chinese Han population was significant under an allelic genetic model (OR = 1.70, 95% CI = 1.18 to 2.44, P = 0.004). The heterogeneity test was also significant (P<0.0001). Meta-regression was performed to explore the heterogeneity source. Among the confounding factors, the heterogeneity could be explained by the publication year (P = 0.017), study region (P = 0.014), control group sample size (P = 0.011), total sample size (P = 0.011), and ratio of the case to the control group sample size (RR) (P = 0.019). In a stratified analysis by the total sample size, significantly increased risk was only detected in subgroup 2 under an allelic genetic model (OR = 1.93, 95% CI = 1.09 to 3.35, P = 0.02). Conclusions In the Chinese Han population, PAI-1 4G/5G gene polymorphism was implied to be associated with increased CAD risk. Carriers of the 4G allele of the PAI-1 4G/5G gene might predispose to CAD. PMID:22496752

  7. Application and expression of HSV gG1 protein from a recombinant strain.

    PubMed

    Yan, Hua; Yan, Huishen; Huang, Tao; Li, Guocai; Gong, Weijuan; Jiao, Hongmei; Chen, Hongju; Ji, Mingchun

    2010-11-01

    According to the homologous sequence of glycoprotein G1 (gG1) genes from different strains of herpes simplex virus type 1 (HSV-1), a pair of primers was designed to amplify the gG1 gene fragment by PCR. Both the PCR product and the pGEX-4T-1 vector were digested with EcoR I and Sal I. The gG1 gene fragment was subcloned into the digested pGEX-4T-1 vector to construct a recombinant plasmid (pGEX-4T-1-gG1). The resultant plasmid was identified by dual-enzyme digestion and sequence analysis, and then transformed into Escherichia coli BL21 for expression under the induction of isopropyl β-D-1-thiogalactoside (IPTG). The expressed GST-gG1 fragment was detected by SDS-PAGE and purified by affinity chromatography. The properties of GST-gG1 fragment were evaluated by immunoblot analysis. Enzyme-linked immunosorbent assays (ELISAs) based on the GST-gG1 fragment were used for determining IgG or IgM to HSV-1. The GST-gG1 fragment-specific ELISA was also compared with ELISA with whole-HSV-1 antigen and commercial ELISA kits. The gG1-specific IgG and IFN-γ producing CD8+ T cells were induced in mice immunized with the GST-gG1 fragment. These results indicated that the GST-gG1 fragment could be used for replacing whole-virus antigen to detect IgM and IgG to HSV-1 in human sera, which provided a strategy for developing vaccines to protect HSV-1 infection using gG1 fragment. Copyright © 2010 Elsevier B.V. All rights reserved.

  8. Immunoglobulin class switching to IgG4 in Warthin tumor and analysis of serum IgG4 levels and IgG4-positive plasma cells in the tumor.

    PubMed

    Aga, Mitsuharu; Kondo, Satoru; Yamada, Kazunori; Wakisaka, Naohiro; Yagi-Nakanishi, Sayaka; Tsuji, Akira; Endo, Kazuhira; Murono, Shigeyuki; Ito, Makoto; Muramatsu, Masamichi; Kawano, Mitsuhiro; Yoshizaki, Tomokazu

    2014-04-01

    We previously reported a case of immunoglobulin (Ig)G4-related immune inflammation in Warthin tumor. Increased serum IgG4 levels and tissue infiltration of IgG4-positive plasma cells are characteristics of IgG4-related disease (IgG4-RD), a newly emerging clinicopathological entity. However, the relationship between IgG4-RD and Warthin tumor remains to be elucidated. We aimed to investigate the involvement of systemic and local IgG4 production and class-switch recombination in Warthin tumor. We examined serum IgG4 levels and also analyzed the involvement of IgG4-positive plasma cells in Warthin tumors (18 cases) compared with those of pleomorphic adenomas (19 cases) as controls. Furthermore, in specimens of Warthin tumors (3 cases), pleomorphic adenomas (2 cases), and IgG4-RDs (2 cases), we examined messenger RNA expression of activation-induced cytidine deaminase, IgG4 germline transcripts and productive IgG4 by reverse transcription polymerase chain reaction. Serum IgG4 levels were increased in 5 of 18 Warthin tumors and not in any of the 19 pleomorphic adenomas. Infiltration of IgG4-positive plasma cells was detected in 4 Warthin tumors and none in the pleomorphic adenomas. Moreover, activation-induced cytidine deaminase, IgG4 germline transcripts, and productive IgG4 messenger RNA were found to be expressed in 2 of 3 Warthin tumors as well as IgG4-RDs by reverse transcription polymerase chain reaction, but not in pleomorphic adenomas. In conclusion, immunoglobulin class switching to IgG4 may be involved in the pathogenesis of Warthin tumor, and it is possible that certain inflammatory background with an immune reaction is involved in the pathogenesis of Warthin tumor. © 2013.

  9. Relative stabilities of IgG1 and IgG4 Fab domains: Influence of the light–heavy interchain disulfide bond architecture

    PubMed Central

    Heads, James T; Adams, Ralph; D'Hooghe, Lena E; Page, Matt J T; Humphreys, David P; Popplewell, Andrew G; Lawson, Alastair D; Henry, Alistair J

    2012-01-01

    The stability of therapeutic antibodies is a prime pharmaceutical concern. In this work we examined thermal stability differences between human IgG1 and IgG4 Fab domains containing the same variable regions using the thermofluor assay. It was found that the IgG1 Fab domain is up to 11°C more stable than the IgG4 Fab domain containing the same variable region. We investigated the cause of this difference with the aim of developing a molecule with the enhanced stability of the IgG1 Fab and the biological properties of an IgG4 Fc. We found that replacing the seven residues, which differ between IgG1 CH1 and IgG4 CH1 domains, while retaining the native IgG1 light-heavy interchain disulfide (L–H) bond, did not affect thermal stability. Introducing the IgG1 type L–H interchain disulfide bond (DSB) into the IgG4 Fab resulted in an increase in thermal stability to levels observed in the IgG1 Fab with the same variable region. Conversely, replacement of the IgG1 L–H interchain DSB with the IgG4 type L–H interchain DSB reduced the thermal stability. We utilized the increased stability of the IgG1 Fab and designed a hybrid antibody with an IgG1 CH1 linked to an IgG4 Fc via an IgG1 hinge. This construct has the expected biophysical properties of both the IgG4 Fc and IgG1 Fab domains and may therefore be a pharmaceutically relevant format. PMID:22761163

  10. Determination of aflatoxins B1, B2, G1 and G2 in spices using a multifunctional column clean-up.

    PubMed

    Akiyama, H; Goda, Y; Tanaka, T; Toyoda, M

    2001-10-12

    A rapid and simple method using a multifunctional column, which contains lipophilic and charged active sites, was developed to analyse aflatoxins B1, B2, G1 and G2 in various spices, such as red pepper and nutmeg. After extraction by acetonitrile:water (9:1) and clean-up using MultiSep #228 column, the aflatoxins and aflatoxin-TFA derivatives are determined using LC with fluorescence detection. Recoveries of each aflatoxin B1, B2, G1 and G2 spiked to red pepper, white pepper, black pepper, nutmeg and tear grass at the level of 10 ng/g were over 80-85% in all instances. The minimum detectable concentration for aflatoxins in red pepper was 0.5 ng/g.

  11. Relation between osteonecrosis of the femoral head and PAI-1 4G/5G gene polymorphism: a meta-analysis.

    PubMed

    Zeng, Zheng; Wang, Bing; Pan, Haitao

    2015-01-01

    The aim of this study was to investigate the association of plasminogen activator inhibitor-1 (PAI-1) 4G/5G gene polymorphism and osteonecrosis of the femoral head (ONFH). The pooled relative risk ratio (RR) and 95% confidence intervals (95% CI) were calculated using the the RevMan 5.0 software. The present study included 969 patients with ONFH and 419 healthy controls. The Meta analysis results showed: There is association between PAI-1 gene 4G/5G polymorphism and the increasing risk of ONFH (allele model: RR = 1.24, 95% CI = 1.16 ~ 1.33; dominant genetic model: RR = 1.12, 95% CI = 1.05 ~ 1.18). It was found that the association between PAI-1 gene 4 G/5 G polymorphism and the susceptibility of ONFH (P < 0.05) through the comparison of Caucasian population and Asian people according to the analysis of different races. There is association between PAI-1 gene 4 G/5 G polymorphism and the increasing of the susceptibility of ONFH.

  12. Yeast Sub1 and human PC4 are G-quadruplex binding proteins that suppress genome instability at co-transcriptionally formed G4 DNA.

    PubMed

    Lopez, Christopher R; Singh, Shivani; Hambarde, Shashank; Griffin, Wezley C; Gao, Jun; Chib, Shubeena; Yu, Yang; Ira, Grzegorz; Raney, Kevin D; Kim, Nayun

    2017-06-02

    G-quadruplex or G4 DNA is a non-B secondary DNA structure consisting of a stacked array of guanine-quartets that can disrupt critical cellular functions such as replication and transcription. When sequences that can adopt Non-B structures including G4 DNA are located within actively transcribed genes, the reshaping of DNA topology necessary for transcription process stimulates secondary structure-formation thereby amplifying the potential for genome instability. Using a reporter assay designed to study G4-induced recombination in the context of an actively transcribed locus in Saccharomyces cerevisiae, we tested whether co-transcriptional activator Sub1, recently identified as a G4-binding factor, contributes to genome maintenance at G4-forming sequences. Our data indicate that, upon Sub1-disruption, genome instability linked to co-transcriptionally formed G4 DNA in Top1-deficient cells is significantly augmented and that its highly conserved DNA binding domain or the human homolog PC4 is sufficient to suppress G4-associated genome instability. We also show that Sub1 interacts specifically with co-transcriptionally formed G4 DNA in vivo and that yeast cells become highly sensitivity to G4-stabilizing chemical ligands by the loss of Sub1. Finally, we demonstrate the physical and genetic interaction of Sub1 with the G4-resolving helicase Pif1, suggesting a possible mechanism by which Sub1 suppresses instability at G4 DNA. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Influence of plasminogen activator inhibitor-1 (SERPINE1) 4G/5G polymorphism on circulating SERPINE-1 antigen expression in HCC associated with viral infection.

    PubMed

    Divella, Rosa; Mazzocca, Antonio; Gadaleta, Cosimo; Simone, Giovanni; Paradiso, Angelo; Quaranta, Michele; Daniele, Antonella

    2012-01-01

    Hepatocarcinogenesis is heavily influenced by chronic hepatitis B (HBV) and C (HCV) infection. Elevated levels of plasminogen activator inhibitor-1 (SERPINE1/PAI-1) have been reported in patients with hepatocellular carcinoma (HCC) associated with viral infection. The gene encoding SERPINE1 is highly polymorphic and the frequently associated 4/5 guanosine (4G/5G) polymorphism in the gene promoter may influence its expression. Here, we investigated the distribution of genotypes and the frequency of alleles of the 4G/5G polymorphism in patients with HCC, the influence of the 4G/5G polymorphism on plasma SERPINE1 levels and its association with viral infection. A total of 75 patients with HCC were enrolled: 32 (42.6%) were HBV(+)/HCV(+), 11 (14.6%) were only HCV(+), and 32 (42.6%) were negative for both viruses. A control group of healthy donors was also enrolled (n=50). SERPINE1 plasma concentrations were determined by ELISA and the detection of the promoter 4G/5G polymorphism was performed by an allele-specific PCR analysis. We found that the frequency of both the 4G/4G genotype (p=0.02) and the 4G allele (p=0.006) were significantly higher in patients with HCC compared to the control group, and particularly higher in patients with HCC co-infected with HBV(+)/HCV(+) than in those with no viral infection. We also found that patients with the 4G/4G genotype had significantly higher plasma SERPINE1 protein levels when compared with patients with the 4G/5G or 5G/5G genotype (p<0.001). Differences in frequency of 4G allele and genetic variability of 4G/5G SERPINE1 polymorphism with a higher level of SERPINE1 protein in patients with HCC with HBV(+)/HCV(+) than those without infection, suggest the presence of two distinct pathogenic mechanisms in hepatocarcinogenesis, depending on the etiology.

  14. Expansion of blood IgG4+ B, TH2, and regulatory T cells in patients with IgG4-related disease.

    PubMed

    Heeringa, Jorn J; Karim, A Faiz; van Laar, Jan A M; Verdijk, Robert M; Paridaens, Dion; van Hagen, P Martin; van Zelm, Menno C

    2018-05-01

    IgG 4 -related disease (IgG 4 -RD) is a systemic fibroinflammatory condition affecting various organs and has a diverse clinical presentation. Fibrosis and accumulation of IgG 4 + plasma cells in tissue are hallmarks of the disease, and IgG 4 -RD is associated with increased IgG 4 serum levels. However, disease pathogenesis is still unclear, and these cellular and molecular parameters are neither sensitive nor specific for the diagnosis of IgG 4 -RD. Here we sought to develop a flow cytometric gating strategy to reliably identify blood IgG 4 + B cells to study their cellular and molecular characteristics and investigate their contribution in disease pathogenesis. Sixteen patients with histologically confirmed IgG 4 -RD, 11 patients with sarcoidosis, and 30 healthy subjects were included for 11-color flow cytometric analysis of peripheral blood for IgG 4 -expressing B cells and T H subsets. In addition, detailed analysis of activation markers and chemokine receptors was performed on IgG 4 -expressing B cells, and IgG 4 transcripts were analyzed for somatic hypermutations. Cellular and molecular analyses revealed increased numbers of blood IgG 4 + memory B cells in patients with IgG 4 -RD. These cells showed reduced expression of CD27 and CXCR5 and increased signs of antibody maturation. Furthermore, patients with IgG 4 -RD, but not patients with sarcoidosis, had increased numbers of circulating plasmablasts and CD21 low B cells, as well as T H 2 and regulatory T cells, indicating a common disease pathogenesis in patients with IgG 4 -RD. These results provide new insights into the dysregulated IgG 4 response in patients with IgG 4 -RD. A specific "peripheral lymphocyte signature" observed in patients with IgG 4 -RD, could support diagnosis and treatment monitoring. Copyright © 2017 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  15. The Role of PAI-1 4G/5G Promoter Polymorphism and Its Levels in the Development of Ischemic Stroke in Young Indian Population.

    PubMed

    Akhter, Mohammad Suhail; Biswas, Arijit; Abdullah, Saleh Mohammed; Behari, Madhuri; Saxena, Renu

    2017-11-01

    The plasminogen activator inhibitor-1 (PAI-1) gene has been found to be associated with the pathogenesis and progression of vascular diseases including stroke. A 4G/5G, PAI-1 gene polymorphism has been found to be associated with the plasma PAI-1 levels in different ethnic populations but results are still controversial. The aim of this study was to determine the potential association of 4G/5G polymorphism and plasma PAI-1 levels in the development of ischemic stroke (IS) in young Asian Indians. One hundred patients with IS and an equal number of age- and sex-matched controls were studied. The 4G/5G polymorphism was genotyped in the study population through allele-specific polymerase chain reaction. Plasma PAI-1 levels were evaluated using a commercial kit. The PAI-1 levels were significantly higher in patients when compared to the controls ( P = .03). The variant 4G allele for the PAI-I 4G/5G polymorphism showed both genotypic ( P = .0013, χ 2 = 10.303; odds ratio [OR] = 3.75) as well as allelic association ( P = .0004, χ 2 = 12.273; OR = 1.99) with IS. The homozygous variant 4G/4G also was found to be associated with the higher PAI-1 levels (0.005). The variant allele 4G of PAI-1 4G/5G polymorphism and higher plasma PAI-1 levels were found to be significantly associated with IS in young Asian Indians.

  16. PAI-1 4G/5G gene polymorphism is associated with angiographic patency in ST-elevation myocardial infarction patients treated with thrombolytic therapy.

    PubMed

    Ozkan, Bugra; Cagliyan, Caglar E; Elbasan, Zafer; Uysal, Onur K; Kalkan, Gulhan Y; Bozkurt, Mehmet; Tekin, Kamuran; Bozdogan, Sevcan T; Ozalp, Ozge; Duran, Mustafa; Sahin, Durmus Y; Cayli, Murat

    2012-09-01

    In this study, we examined the relationship between PAI-1 4G/5G polymorphism and patency of the infarct-related artery after thrombolysis in patients with ST-elevation myocardial infarction (STEMI). Acute STEMI patients who received thrombolytic therapy within first 12 h were included in our study. The PAI-1 4G/5G promoter region insertion/deletion polymorphism was studied from venous blood samples. Patients with the PAI-1 4G/5G gene polymorphism were included in group 1 and the others were included in group 2. Coronary angiography was performed in all patients in the first 24 h after receiving thrombolytic therapy. Thrombolysis in myocardial infarction (TIMI) 0-1 flow in the infarct-related artery was considered as 'no flow', TIMI 2 flow as 'slow flow', and TIMI 3 flow as 'normal flow'. A total of 61 patients were included in our study. Thirty patients (49.2%) were positive for the PAI-1 4G/5G gene polymorphism, whereas 31 of them (50.8%) were in the control group. There were significantly more patients with 'no flow' (14 vs. 6; P=0.02) and less patients with 'normal flow' (8 vs. 19; P=0.02) in group 1. In addition, time to thrombolytic therapy (TTT) was maximum in the 'no flow' group and minimum in the 'normal flow' group (P=0.005). In the logistic regression analysis, TTT (odds ratio: 0.9898; 95% confidence interval: 0.982-0.997; P=0.004) and the PAI-1 4G/5G gene polymorphism (odds ratio: 4.621; 95% confidence interval: 1.399-15.268; P<0.01) were found to be independently associated with post-thrombolytic 'no flow'. The PAI-1 4G/5G gene polymorphism and TTT are associated independently with 'no flow' after thrombolysis in patients with STEMI.

  17. Expression of CAR in SW480 and HepG2 cells during G1 is associated with cell proliferation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Osabe, Makoto; Sugatani, Junko; Global COE Program, School of Pharmaceutical Sciences, University of Shizuoka, Shizuoka

    Constitutive androstane receptor (CAR) is a transcription factor to regulate the expression of several genes related to drug-metabolism. Here, we demonstrate that CAR protein accumulates during G1 in human SW480 and HepG2 cells. After the G1/S phase transition, CAR protein levels decreased, and CAR was hardly detected in cells by the late M phase. CAR expression in both cell lines was suppressed by RNA interference-mediated suppression of CDK4. Depletion of CAR by RNA interference in both cells and by hepatocyte growth factor treatment in HepG2 cells resulted in decreased MDM2 expression that led to p21 upregulation and repression of HepG2more » cell growth. Thus, our results demonstrate that CAR expression is an early G1 event regulated by CDK4 that contributes to MDM2 expression; these findings suggest that CAR may influence the expression of genes involved in not only the metabolism of endogenous and exogenous substances but also in the cell proliferation.« less

  18. Hashimoto's thyroiditis with elevated serum IgG4 concentrations is not equivalent to IgG4 Hashimoto's thyroiditis.

    PubMed

    Yu, Yang; Yu, Nan; Lu, Guizhi; Li, Ting; Zhang, Yang; Zhang, Jing; Gao, Ying; Gao, Yanming; Guo, Xiaohui

    2018-06-01

    Hashimoto's thyroiditis (HT) with serum IgG4 concentrations greater than 135 mg/dL can be diagnosed as elevated serum IgG4 HT. HT can also be classified into IgG4 HT and non-IgG4 HT based on an immunohistochemistry analysis of IgG4. The aim of our study was to determine the relationship between elevated serum IgG4 HT and IgG4 HT. Both thyroid tissues and serum samples stored before pathological examination from 93 patients with HT were collected. The serum levels of IgG, IgG4, TgAb IgG, TgAb IgG4, TPOAb IgG and TPOAb IgG4 were measured by ELISAs. The expression levels of IgG4, IgG and TGF-β1 in thyroid tissues were detected by immunohistochemistry. Patients with HT were divided into two groups: elevated serum IgG4 HT (n = 12) and nonelevated serum IgG4 HT (n = 81). Hypothyroidism was found in 5 of 12 cases (41.7%) in the elevated serum IgG4 HT group and 10 of 81 cases (12.3%) in the nonelevated serum IgG4 HT group (P = .023). Serologically, there were no significant differences in the levels of TgAb IgG, TPOAb IgG, TgAb IgG4 and TPOAb IgG4 between the two groups, and the expression of TGF-β1 in thyroid tissues was not significantly different between the groups. Most importantly, the frequency of patients who satisfied the criteria for IgG4 HT diagnosis was comparable (25% vs 20.9%, P = .756). The measurement of serum IgG4 allows the identification of patients with HT closely associated with hypothyroidism. However, our study demonstrated that elevated serum IgG4 HT is not equivalent to IgG4 HT. © 2018 John Wiley & Sons Ltd.

  19. Association between the plasminogen activator inhibitor-1 4G/5G polymorphism and risk of venous thromboembolism: a meta-analysis.

    PubMed

    Wang, Jiarong; Wang, Chengdi; Chen, Nan; Shu, Chi; Guo, Xiaojiang; He, Yazhou; Zhou, Yanhong

    2014-12-01

    The plasminogen activator inhibitor-1 (PAI-1) 4G/5G polymorphism was considered to be associated with risk of venous thromboembolism (VTE), while evidence remains inadequate. To provide a more accurate estimation of this relationship, we performed an updated meta-analysis of all eligible studies. A systematical search was performed in PubMed, EMBASE, Wanfang, China National Knowledge Infrastructure (CNKI) and Cqvip databases to identify relevant studies published before March 6(th) 2014. The odds ratios (ORs) with 95% confidence intervals (CIs) were pooled using the fixed/random-effects model using Review Manager 5.1 and STATA 12.0. A total of 34 studies with 3561 cases and 5693 controls were analyzed. Overall, significant association between the PAI-1 4G/5G variant and VTE risk in total population (dominant model: OR=1.32, 95%CI: 1.13-1.54) was observed. And this variant was also related to the deep vein thrombosis risk (dominant model: OR=1.60, 95%CI: 1.24-2.06, P=0.0003). In the subgroup analyses on ethnicity, significant results were obtained in both Asians (dominant model: OR=2.08, 95%CI: 1.29-3.35, P=0.003) and Caucasians (dominant model: OR=1.31, 95%CI: 1.10-1.56, P=0.003). However, no significant association was found in patients with provoked VTE. In terms of subgroup analyses on co-existence of other thrombotic risk factors, the PAI-1 4G/5G polymorphism was significantly associated with VTE risk in patients with factor V Leiden mutation (dominant model: OR=1.72, 95%CI: 1.17-2.53), but not in patients with cancer or surgery. Our findings demonstrate the role of PAI-1 4G/5G polymorphism being a risk candidate locus for VTE susceptibility, especially in patients with other genetic thrombophilic disorders. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. Increased PAI-1 plasma levels and risk of death from dengue: no association with the 4G/5G promoter polymorphism

    PubMed Central

    Mairuhu, ATA; Setiati, TE; Koraka, P; Hack, CE; Leyte, A; Faradz, SMH; ten Cate, H; Brandjes, DPM; Osterhaus, ADME; Reitsma, PH; van Gorp, ECM

    2005-01-01

    Background Dengue virus infected patients have high plasminogen activator inhibitor type I (PAI-1) plasma concentrations. Whether the insertion/deletion (4G/5G) polymorphism in the promotor region of the PAI-1 gene is associated with increased PAI-1 plasma concentrations and with death from dengue is unknown. We, therefore, investigated the relationship between the 4G/5G polymorphism and PAI-1 plasma concentrations in dengue patients and risk of death from dengue. Methods A total of 194 patients admitted to the Dr. Kariadi Hospital in Semarang, Indonesia, with clinical suspected severe dengue virus infection were enrolled. Blood samples were obtained on day of admission, days 1, 2 and 7 after admission and at a 1-month follow-up visit. Plasma concentrations of PAI-1 were measured using a sandwich ELISA kit. The PAI-1 4G/5G polymorphism was typed by allele-specific PCR analysis. Results Concentrations of PAI-1 on admission and peak values of PAI-1 during admission were higher than the values measured in healthy controls. Survival was significantly worse in patients with PAI-1 concentrations in the highest tertile (at admission: OR 4.7 [95% CI 0.9–23.8], peak value during admission: OR 6.3 [95%CI 1.3–30.8]). No association was found between the PAI-1 4G/5G polymorphism, and PAI-1 plasma concentrations, dengue disease severity and mortality from dengue. Conclusion These data suggest that the 4G/5G polymorphism has no significant influence on PAI-1 concentrations in dengue virus infected patients and is not associated with the risk of death from dengue. Other factors contributing to the variability of PAI-1 plasma concentrations in patients with dengue need to be explored. PMID:16274483

  1. 26 CFR 1.642(g)-2 - Deductions included.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 26 Internal Revenue 8 2014-04-01 2014-04-01 false Deductions included. 1.642(g)-2 Section 1.642(g... (CONTINUED) INCOME TAXES (CONTINUED) Estates, Trusts, and Beneficiaries § 1.642(g)-2 Deductions included. It...(g) is applicable be treated in the same way. One deduction or portion of a deduction may be allowed...

  2. 26 CFR 1.642(g)-2 - Deductions included.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 26 Internal Revenue 8 2013-04-01 2013-04-01 false Deductions included. 1.642(g)-2 Section 1.642(g... (CONTINUED) INCOME TAXES (CONTINUED) Estates, Trusts, and Beneficiaries § 1.642(g)-2 Deductions included. It...(g) is applicable be treated in the same way. One deduction or portion of a deduction may be allowed...

  3. 26 CFR 1.642(g)-2 - Deductions included.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 26 Internal Revenue 8 2011-04-01 2011-04-01 false Deductions included. 1.642(g)-2 Section 1.642(g... (CONTINUED) INCOME TAXES (CONTINUED) Estates, Trusts, and Beneficiaries § 1.642(g)-2 Deductions included. It...(g) is applicable be treated in the same way. One deduction or portion of a deduction may be allowed...

  4. 26 CFR 1.642(g)-2 - Deductions included.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 26 Internal Revenue 8 2012-04-01 2012-04-01 false Deductions included. 1.642(g)-2 Section 1.642(g... (CONTINUED) INCOME TAXES (CONTINUED) Estates, Trusts, and Beneficiaries § 1.642(g)-2 Deductions included. It...(g) is applicable be treated in the same way. One deduction or portion of a deduction may be allowed...

  5. 26 CFR 1.642(g)-2 - Deductions included.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 26 Internal Revenue 8 2010-04-01 2010-04-01 false Deductions included. 1.642(g)-2 Section 1.642(g... (CONTINUED) INCOME TAXES Estates, Trusts, and Beneficiaries § 1.642(g)-2 Deductions included. It is not required that the total deductions, or the total amount of any deduction, to which section 642(g) is...

  6. The presence of PAI-1 4G/5G and ACE DD genotypes increases the risk of early-stage AVF thrombosis in hemodialysis patients.

    PubMed

    Güngör, Yahya; Kayataş, Mansur; Yıldız, Gürsel; Özdemir, Öztürk; Candan, Ferhan

    2011-01-01

    In this study, we investigated the relationship between early arteriovenous fistula (AVF) thrombosis with angiotensin-converting enzyme (ACE) gene and thrombophilic factor gene polymorphisms. Thirty-five patients who suffered from three or more fistula thrombosis episodes in the early period after AVF operation and 33 control patients with no history of thrombosis for at least 3 years were enrolled in this study. Factor V G1691A Leiden, factor V H1299R (R2), prothrombin G20210A, factor XIIIV34L, β-fibrinogen-455 G-A, glycoprotein IIIa L33P human platelet antigens (HPA-1), methylenetetrahydrofolate reductase C677T, and methylenetetrahydrofolate reductase A1298C gene polymorphisms were similar in both groups (p > 0.05). Plasminogen activator inhibitor 1 (PAI-1) 4G/5G genotype in the study group and 4G/4G genotype in the control group were significantly higher (p = 0.014). No significant difference was detected in terms of the 5G/5G genotype. With regard to the ACE gene polymorphism, the control group showed more ID genotype (19/33, 57.6%), whereas the study group showed more DD genotype (17/35, 48.6%). II genotype was similar in both groups (x(2) = 7.40, p = 0.025). The rate of ACE inhibitor-angiotensin II receptor blockers use was 5/35 in the study group (14.3%) and 5/33 in the control group (15.2%). Individuals with PAI-1 4G/5G genotype showed 5.03 times more risk of thrombosis when compared with 4G/4G and 5G/5G genotypes [p = 0.008, OR = 5.03, 95% confidence interval (1.44:17.64)]. Individuals with ACE DD genotype showed 4.25 times more risk of thrombosis when compared with II and ID [p = 0.008, OR = 4.25, 95% confidence interval (1.404:12.83)]. PAI-1 4G/5G and ACE DD genotypes are associated with increased risk for early AVF thrombosis.

  7. Base-Displaced Intercalated Conformation of the 2-Amino-3-methylimidazo[4,5-f]quinoline N2-dG DNA Adduct Positioned at the Nonreiterated G1 in the NarI Restriction Site

    PubMed Central

    2016-01-01

    The conformation of an N2-dG adduct arising from the heterocyclic amine 2-amino-3-methylimidazo[4,5-f]quinoline (IQ), a potent food mutagen, was determined in 5′-d(C1T2C3X4G5C6G7C8C9A10T11C12)-3′:5′-d(G13A14T15G16G17C18G19C20C21G22A23G24)-3′; X = N2-dG-IQ, in which the modified nucleotide X4 corresponds to G1 in the 5′-d(G1G2CG3CC)-3′ NarI restriction endonuclease site. Circular dichroism (CD) revealed blue shifts relative to the unmodified duplex, consistent with adduct-induced twisting, and a hypochromic effect for the IQ absorbance in the near UV region. NMR revealed that the N2-dG-IQ adduct adopted a base-displaced intercalated conformation in which the modified guanine remained in the anti conformation about the glycosidic bond, the IQ moiety intercalated into the duplex, and the complementary base C21 was displaced into the major groove. The processing of the N2-dG-IQ lesion by hpol η is sequence-dependent; when placed at the reiterated G3 position, but not at the G1 position, this lesion exhibits a propensity for frameshift replication [Choi, J. Y., et al. (2006) J. Biol. Chem., 281, 25297–25306]. The structure of the N2-dG-IQ adduct at the nonreiterated G1 position was compared to that of the same adduct placed at the G3 position [Stavros, K. M., et al. (2014) Nucleic Acids Res., 42, 3450–3463]. CD indicted minimal spectral differences between the G1 vs G3N2-dG-IQ adducts. NMR indicated that the N2-dG-IQ adduct exhibited similar base-displaced intercalated conformations at both the G1 and G3 positions. This result differed as compared to the corresponding C8-dG-IQ adducts placed at the same positions. The C8-dG-IQ adduct adopted a minor groove conformation when placed at position G1 but a base-displaced intercalated conformation when placed at position G3 in the NarI sequence. The present studies suggest that differences in lesion bypass by hpol η may be mediated by differences in the 3′-flanking sequences, perhaps modulating the ability

  8. 4G/5G Polymorphism of the plasminogen activator inhibitor-1 gene is associated with multiple organ dysfunction in critically ill patients.

    PubMed

    Huq, Muhammad Aminul; Takeyama, Naoshi; Harada, Makoto; Miki, Yasuo; Takeuchi, Akinori; Inoue, Sousuke; Nakagawa, Takashi; Kanou, Hideki; Hirakawa, Akihiko; Noguchi, Hiroshi

    2012-01-01

    Impaired fibrinolysis is associated with a higher incidence of both multiple organ dysfunction and mortality in the intensive care unit (ICU). Plasminogen activator inhibitor (PAI)-1 is the chief inhibitor of fibrinolysis. We investigated the influence of the 4G/5G polymorphism (rs1799768) of the PAI-1 gene on the plasma PAI-1 level and the outcome of critically ill patients. In 41 consecutive patients admitted to the ICU, PAI-1 gene polymorphism was assessed, plasma PAI-1 and arterial lactate concentrations were measured and clinical severity scores were recorded. Homozygotes for the 4G allele had higher plasma levels of PAI-1 antigen. The mean ± SD PAI-1 antigen level was 193.31 ± 167.93 ng/ml for the 4G/4G genotype, 100.67 ± 114.16 ng/ml for the 4G/5G genotype and 0.43 ± 0.53 ng/ml for the 5G/5G genotype. There was a significant correlation between plasma PAI-1 and arterial lactate concentrations, as well as between PAI-1 and severity scores. The mortality rate was 63, 33 and 0% for patients with the 4G/4G, 4G/5G and 5G/5G genotypes, respectively. These results demonstrate that the 4G/5G polymorphism of the PAI-1 gene affects the plasma PAI-1 concentration, which could impair fibrinolysis and cause organ failure, and thus the presence of the 4G allele increases the risk of death. Copyright © 2011 S. Karger AG, Basel.

  9. Gender-specific association of the plasminogen activator inhibitor-1 4G/5G polymorphism with central arterial blood pressure.

    PubMed

    Björck, Hanna M; Eriksson, Per; Alehagen, Urban; De Basso, Rachel; Ljungberg, Liza U; Persson, Karin; Dahlström, Ulf; Länne, Toste

    2011-07-01

    The functional plasminogen activator inhibitor-1 (PAI-1) 4G/5G polymorphism has previously been associated with hypertension. In recent years, central blood pressure, rather than brachial has been argued a better measure of cardiovascular damage and clinical outcome. The aim of this study was to investigate the possible influence of the 4G/5G polymorphism on central arterial blood pressure in a cohort of elderly individuals. We studied 410 individuals, 216 men and 194 women, aged 70-88. Central pressures and pulse waveforms were calculated from the radial artery pressure waveform by the use of the SphygmoCor system and a generalized transfer function. Brachial pressure was recorded using oscillometric technique (Dinamap, Critikon, Tampa, FL). PAI-1 antigen was determined in plasma. The results showed that central pressures were higher in women carrying the PAI-1 4G/4G genotype compared to female carriers of the 5G/5G genotype, (P = 0.025, P = 0.002, and P = 0.002 for central systolic-, diastolic-, and mean arterial pressure, respectively). The association remained after adjustment for potentially confounding factors related to hypertension. No association of the PAI-1 genotype with blood pressure was found in men. Multiple regression analysis revealed an association between PAI-1 genotype and plasma PAI-1 levels (P = 0.048). Our findings show a gender-specific association of the PAI-1 4G/5G polymorphism with central arterial blood pressure. The genotype effect was independent of other risk factors related to hypertension, suggesting that impaired fibrinolytic potential may play an important role in the development of central hypertension in women.

  10. Influence of PAI-1 gene promoter-675 (4G/5G) polymorphism on fibrinolytic activity after cardiac surgery employing cardiopulmonary bypass.

    PubMed

    Ozolina, Agnese; Strike, Eva; Jaunalksne, Inta; Serova, Jelena; Romanova, Tatjana; Zake, Liene Nikitina; Sabelnikovs, Olegs; Vanags, Indulis

    2012-01-01

    The plasminogen activator inhibitor type-1 (PAI-1) gene promoter contains 675 (4G/5G) polymorphism. The aim of this study was evaluate the effect of the PAI-1 promoter-675 (4G/5G) polymorphism on the concentrations of PAI-1 and tissue plasminogen activator/PAI-1 (t-PA/PAI-1) complex and bleeding volume after on-pump cardiac surgery. A total of 90 patients were included in the study at Pauls Stradins Clinical University Hospital. Seven patients were excluded due to surgical bleeding. Eighty-three patients were classified according to the PAI-1 genotype: 21 patients had the 4G/4G genotype; 42, the 4G/5G genotype; and 20, the 5G/5G genotype. The following fibrinolysis parameters were recorded: the PAI-1 level preoperatively, D-dimer level at 0, 6, and 24 hours after surgery, and t-PA/PAI-1 complex level 24 hours postoperatively. A postoperative bleeding volume was registered in mL 24 hours after surgery. The patients with the 5G/5G genotype had significantly lower preoperative PAI-1 levels (17 [SD, 10.8] vs. 24 ng/mL [SD, 9.6], P=0.04), higher D-dimer levels at 6 hours (371 [SD, 226] vs. 232 ng/mL [SD, 185], P=0.03) and 24 hours (326 [SD, 207] vs. 209 ng/mL [SD, 160], P=0.04), and greater postoperative blood loss (568 [SD, 192] vs. 432 mL [168], P=0.02) compared with the 4G/4G carriers. There were no significant differences in the levels of the t-PA/PAI-1 complex comparing different genotype groups. The carriers of the 5G/5G genotype showed the lower preoperative PAI-1 levels, greater chest tube blood loss, and higher D-dimer levels indicating that the 5G/5G carriers may have enhanced fibrinolysis.

  11. Role of -675 4G/5G in the plasminogen activator inhibitor-1 gene and -308G/A tumor necrosis factor-α gene polymorphisms in obese Argentinean patients.

    PubMed

    Wingeyer, Silvia D Perés; Graffigna, Mabel N; Belli, Susana H; Benetucci, Jorge; de Larrañaga, Gabriela F

    2012-05-01

    Plasminogen activator inhibitor-1 (PAI-1) and tumor necrosis factor-α (TNF-α) are increased in the circulation of obese persons. Because a direct link between PAI-1 and TNF-α in obesity has been observed, they are candidate genes for the development of obesity. We sought to evaluate the relation between the genotypic and allelic frequencies of the -675 4G/5G PAI-1 and -308 G/A TNF-α polymorphisms and their association with the risk for obesity in an Argentinean population. A group of 110 consecutive obese persons and a group of 111 lean controls were recruited. Polymerase chain reaction was used to determine the frequency of PAI-1 and TNF-α polymorphisms; serum fasting glucose, insulin, and lipid levels were measured by standard methods. Insulin sensitivity was evaluated by using homeostasis model assessment. The -308 TNF-α and -675 4G/5G PAI-1 genotype distribution did not significantly differ between the groups (p=0.544 and p=0.327, respectively). Homeostasis model assessment was the only positive independent determinant of body mass index (R(2)=0.493; p<0.001). The -675 4G/5G PAI-1 and the -308 TNF-α polymorphism variants tested in this study, individually or combined, were not associated with obesity in an Argentinean population.

  12. Increase in serum concentrations of IgG2 and IgG4 by selenium supplementation in children with Down's syndrome.

    PubMed Central

    Annerén, G; Magnusson, C G; Nordvall, S L

    1990-01-01

    In a previous study on children with Down's syndrome a reduced rate of infections was reported by their parents after the children had received six months' treatment with selenium supplements. In the present study the concentrations of the four IgG subclasses were measured in 29 of these children in samples of serum obtained before and immediately after the period of supplementation and one year after it had finished. Selenium had a significant augmentative effect on the serum concentrations of IgG2 and IgG4, but not of IgG1 and IgG3. This effect was not related to age, as among children over the age of 6 years the serum concentrations of IgG2 and IgG4 had decreased significantly one year after the treatment had been stopped. This study suggests that selenium has an immunoregulatory effect, which might be of importance in both basic research and clinical practice. PMID:2148668

  13. Geological studies of the COST nos. G-1 and G-2 wells, United States North Atlantic outer continental shelf

    USGS Publications Warehouse

    Scholle, Peter A.; Wenkam, Chiye R.

    1982-01-01

    The COST Nos. G-1 and G-2 wells (fig. 1) are the second and third deep stratigraphic test wells drilled in the North Atlantic Outer Continental Shelf of the United States. COST No. G-1 was drilled in the Georges Bank basin to a total depth of 16,071 ft (4,898 m). G-1 bottomed in phyllite, slate, and metaquartzite overlain by weakly metamorphosed dolomite, all of Cambrian age. From approximately 15,600 to 12,400 ft (4,755 to 3,780 m) the strata are Upper Triassic(?), Lower Jurassic(?), and Middle Jurassic, predominantly red shales, sandstones, and conglomerates. Thin, gray Middle Jurassic beds of shale, sandstone, limestone, and dolomite occur from 12,400 to 9,900 ft (3,780 to 3,018 m). From 9,900 to 1,030 ft (3,018 to 314 m) are coarse-grained unconsolidated sands and loosely cemented sandstones, with beds of gray shale, lignite, and coal. The microfossils indicate the rocks are Upper Jurassic from 10,100 ft (3,078 m) up to 5,400 ft (1,646 m) and Cretaceous from that depth to 1,030 ft (314 m). No younger or shallower rocks were recovered in the drilling at the COST No. G-1 site, but an Eocene limestone is inferred to be disconformable over Santonian strata. The Jurassic strata of the COST No. G-1 well were deposited in shallow marine, marginal marine, and nonmarine environments, which changed to a dominantly shallow marine but still nearshore environment in the Cretaceous. The COST No. G-2 well was drilled 42 statute miles {68 km) east of the G-1 site, still within the Georges Bank basin, to a depth of 21,874 ft (6,667 m). The bottom 40 ft (12 m) of salt and anhydrite is overlain by approximately 7,000 ft {2,134 m) of Upper Triassic{?), Lower Jurassic{?) and Middle Jurassic dolomite, limestone, and interbedded anhydrite from 21,830 to 13,615 ft (6,654 to 4,153 m). From 13,500 to 9,700 ft (4,115 to 2,957 m) are Middle Jurassic limestones with interbedded sandstone. From 9,700 to 4,000 ft (2,957 to 1,219 m) are Upper Jurassic and Cretaceous interbedded sandstones and

  14. Plasminogen activator inhibitor-1 4G/5G and the MTHFR 677C/T polymorphisms and susceptibility to polycystic ovary syndrome: a meta-analysis.

    PubMed

    Lee, Young Ho; Song, Gwan Gyu

    2014-04-01

    The aim of this study was to explore whether the plasminogen activator inhibitor-1 (PAI-1) 4G/5G and the methylenetetrahydrofolate reductase (MTHFR) 677C/T polymorphisms are associated with susceptibility to polycystic ovary syndrome (PCOS). Meta-analyses were conducted to determine the association between the PAI-1 4G/5G and MTHFR 677C/T polymorphisms and PCOS using: (1) allele contrast (2) homozygote contrast, (3) recessive, and (4) dominant models. For meta-analysis, nine studies of the PAI-1 4G/5G polymorphism with 2384 subjects (PCOS, 1615; controls, 769) and eight studies of the MTHFR 677C/T polymorphism with 1270 study subjects were included. Meta-analysis of all study subjects showed no association between PCOS and the PAI-1 4G allele (OR=0.949, 95% CI=0.671-1.343, p=0.767). Stratification by ethnicity, however, indicated a significant association between the PAI-1 4G allele and PCOS in Turkish and Asian populations (OR=0.776, 95% CI=0.602-0.999, p=0.049; OR=1.749, 95% CI=1.297-2.359, p=2.5×10(-5) respectively). In addition, meta-analysis indicated an association between PCOS and the PAI-1 4G4G+4G5G genotype in Europeans (OR=1.406, 95% CI=1.025-1.928, p=0.035). However, meta-analysis of all study subjects showed no association between PCOS and the MTHFR 677T allele (OR=0.998, 95% CI=0.762-1.307, p=0.989), including Europeans (OR=0.806, 95% CI=0.610-1.063, p=0.126). Meta-analysis showed no association between PCOS and the MTHFR 677C/T polymorphism using homozygote contrast, and recessive and dominant models. In conclusion, meta-analysis suggests the PAI-1 4G/5G polymorphism is associated with susceptibility to PCOS in European, Turkish, and Asian populations, but the MTHFR 677C/T polymorphism is not associated with susceptibility to PCOS in Europeans. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  15. Serum levels of IgG and IgG4 in Hashimoto thyroiditis.

    PubMed

    Kawashima, Sachiko-Tsukamoto; Tagami, Tetsuya; Nakao, Kanako; Nanba, Kazutaka; Tamanaha, Tamiko; Usui, Takeshi; Naruse, Mitsuhide; Minamiguchi, Sachiko; Mori, Yusuke; Tsuji, Jun; Tanaka, Issei; Shimatsu, Akira

    2014-03-01

    Although IgG4-related disease is characterized by extensive infiltration of IgG4-positive plasma cells and lymphocytes of various organs, the details of this systemic disease are still unclear. We screened serum total IgG levels in the patients with Hashimoto thyroiditis (HT) to illustrate the prevalence of IgG4-related thyroiditis in HT. Twenty-four of 94 patients with HT (25.5%) had elevated serum IgG levels and their serum IgG4 was measured. Five of the 24 cases had more than 135 mg/dL of IgG4, which is the serum criterion of IgG4-related disease. One was a female patient who was initially treated as Graves' disease and rapidly developed a firm goiter and hypothyroidism. The biopsy of her thyroid gland revealed that follicular cells were atrophic with squamous metaplasia, replaced with fibrosis, which was compatible with the fibrous variant of HT. Immunohistochemical examination revealed diffuse infiltration of IgG4-positive plasma cells, and the serum IgG4 level was 179 mg/dL. The levels of IgG and IgG4 were positively correlated with the titers of anti-thyroglobulin antibody or anti-thyroid peroxidase antibody. In conclusion, at least a small portion of patients with HT with high titers of anti-thyroid antibodies may overlap the IgG4-related thyroiditis.

  16. Cytokinetically quiescent (G0/G1) human multiple myeloma cells are susceptible to simultaneous inhibition of Chk1 and MEK1/2

    PubMed Central

    Pei, Xin-Yan; Dai, Yun; Youssefian, Leena E.; Chen, Shuang; Bodie, Wesley W.; Takabatake, Yukie; Felthousen, Jessica; Almenara, Jorge A.; Kramer, Lora B.; Dent, Paul

    2011-01-01

    Effects of Chk1 and MEK1/2 inhibition were investigated in cytokinetically quiescent multiple myeloma (MM) and primary CD138+ cells. Coexposure to the Chk1 and MEK1/2 inhibitors AZD7762 and selumetinib (AZD6244) robustly induced apoptosis in various MM cells and CD138+ primary samples, but spared normal CD138− and CD34+ cells. Furthermore, Chk1/MEK1/2 inhibitor treatment of asynchronized cells induced G0/G1 arrest and increased apoptosis in all cell-cycle phases, including G0/G1. To determine whether this regimen is active against quiescent G0/G1 MM cells, cells were cultured in low-serum medium to enrich the G0/G1 population. G0/G1–enriched cells exhibited diminished sensitivity to conventional agents (eg, Taxol and VP-16) but significantly increased susceptibility to Chk1 ± MEK1/2 inhibitors or Chk1 shRNA knock-down. These events were associated with increased γH2A.X expression/foci formation and Bim up-regulation, whereas Bim shRNA knock-down markedly attenuated lethality. Immunofluorescent analysis of G0/G1–enriched or primary MM cells demonstrated colocalization of activated caspase-3 and the quiescent (G0) marker statin, a nuclear envelope protein. Finally, Chk1/MEK1/2 inhibition increased cell death in the Hoechst-positive (Hst+), low pyronin Y (PY)–staining (2N Hst+/PY−) G0 population and in sorted small side-population (SSP) MM cells. These findings provide evidence that cytokinetically quiescent MM cells are highly susceptible to simultaneous Chk1 and MEK1/2 inhibition. PMID:21911831

  17. Cytokinetically quiescent (G0/G1) human multiple myeloma cells are susceptible to simultaneous inhibition of Chk1 and MEK1/2.

    PubMed

    Pei, Xin-Yan; Dai, Yun; Youssefian, Leena E; Chen, Shuang; Bodie, Wesley W; Takabatake, Yukie; Felthousen, Jessica; Almenara, Jorge A; Kramer, Lora B; Dent, Paul; Grant, Steven

    2011-11-10

    Effects of Chk1 and MEK1/2 inhibition were investigated in cytokinetically quiescent multiple myeloma (MM) and primary CD138(+) cells. Coexposure to the Chk1 and MEK1/2 inhibitors AZD7762 and selumetinib (AZD6244) robustly induced apoptosis in various MM cells and CD138(+) primary samples, but spared normal CD138(-) and CD34(+) cells. Furthermore, Chk1/MEK1/2 inhibitor treatment of asynchronized cells induced G(0)/G(1) arrest and increased apoptosis in all cell-cycle phases, including G(0)/G(1). To determine whether this regimen is active against quiescent G(0)/G(1) MM cells, cells were cultured in low-serum medium to enrich the G(0)/G(1) population. G(0)/G(1)-enriched cells exhibited diminished sensitivity to conventional agents (eg, Taxol and VP-16) but significantly increased susceptibility to Chk1 ± MEK1/2 inhibitors or Chk1 shRNA knock-down. These events were associated with increased γH2A.X expression/foci formation and Bim up-regulation, whereas Bim shRNA knock-down markedly attenuated lethality. Immunofluorescent analysis of G(0)/G(1)-enriched or primary MM cells demonstrated colocalization of activated caspase-3 and the quiescent (G(0)) marker statin, a nuclear envelope protein. Finally, Chk1/MEK1/2 inhibition increased cell death in the Hoechst-positive (Hst(+)), low pyronin Y (PY)-staining (2N Hst(+)/PY(-)) G(0) population and in sorted small side-population (SSP) MM cells. These findings provide evidence that cytokinetically quiescent MM cells are highly susceptible to simultaneous Chk1 and MEK1/2 inhibition.

  18. Significance of immunoglobulin G4 (IgG4)-positive cells in extrahepatic cholangiocarcinoma: molecular mechanism of IgG4 reaction in cancer tissue.

    PubMed

    Harada, Kenichi; Shimoda, Shinji; Kimura, Yasushi; Sato, Yasunori; Ikeda, Hiroko; Igarashi, Saya; Ren, Xiang-Shan; Sato, Hirohide; Nakanuma, Yasuni

    2012-07-01

    IgG4 reactions consisting of marked infiltration by immunoglobulin G4 (IgG4)-positive plasma cells in affected organs is found in cancer patients as well as patients with IgG4-related diseases. Notably, extrahepatic cholangiocarcinomas accompanying marked IgG4 reactions clinicopathologically mimic IgG4-related sclerosing cholangitis. The regulatory cytokine interleukin (IL)-10 is thought to induce the differentiation of IgG4-positive cells. In this study, to clarify the mechanism of the IgG4 reaction in extrahepatic cholangiocarcinoma, we investigated nonprofessional antigen-presenting cells (APCs) generating IL-10-producing regulatory T cells (anergy T cells) and Foxp3-positive regulatory cells producing IL-10. Immunohistochemistry targeting IgG4, HLA-DR, CD80, CD86, and Foxp3 was performed using 54 cholangiocarcinoma specimens from 24 patients with gallbladder cancer, 22 patients with common bile duct cancer, and eight patients with cancer of the Papilla of Vater. Moreover, a molecular analysis of Foxp3 and IL-10 was performed using a cultured human cholangiocarcinoma cell line. Consequently, 43% of the cholangiocarcinomas were found to be abundant in IgG4. Those expressing HLA-DR but lacking costimulatory molecules (CD80 and CD86) and those expressing Foxp3 detected by an antibody recognizing the N terminus accounted for 54% and 39% of cases, respectively. Moreover, the number of IgG4-positive cells was larger in these cases than in other groups. In cultured cells, the presence of a splicing variant of Foxp3 messenger RNA and the expression of IL-10 were demonstrated. Extrahepatic cholangiocarcinoma is often accompanied by significant infiltration of IgG4-positive cells. Cholangiocarcinoma cells could play the role of nonprofessional APCs and Foxp3-positive regulatory cells, inducing IgG4 reactions via the production of IL-10 indirectly and directly, respectively. Copyright © 2012 American Association for the Study of Liver Diseases.

  19. Reactions of small negative ions with O2(a 1[Delta]g) and O2(X 3[Sigma]g-)

    NASA Astrophysics Data System (ADS)

    Midey, Anthony; Dotan, Itzhak; Seeley, J. V.; Viggiano, A. A.

    2009-02-01

    The rate constants and product ion branching ratios were measured for the reactions of various small negative ions with O2(X 3[Sigma]g-) and O2(a 1[Delta]g) in a selected ion flow tube (SIFT). Only NH2- and CH3O- were found to react with O2(X) and both reactions were slow. CH3O- reacted by hydride transfer, both with and without electron detachment. NH2- formed both OH-, as observed previously, and O2-, the latter via endothermic charge transfer. A temperature study revealed a negative temperature dependence for the former channel and Arrhenius behavior for the endothermic channel, resulting in an overall rate constant with a minimum at 500 K. SF6-, SF4-, SO3- and CO3- were found to react with O2(a 1[Delta]g) with rate constants less than 10-11 cm3 s-1. NH2- reacted rapidly with O2(a 1[Delta]g) by charge transfer. The reactions of HO2- and SO2- proceeded moderately with competition between Penning detachment and charge transfer. SO2- produced a SO4- cluster product in 2% of reactions and HO2- produced O3- in 13% of the reactions. CH3O- proceeded essentially at the collision rate by hydride transfer, again both with and without electron detachment. These results show that charge transfer to O2(a 1[Delta]g) occurs readily if the there are no restrictions on the ion beyond the reaction thermodynamics. The SO2- and HO2- reactions with O2(a) are the only known reactions involving Penning detachment besides the reaction with O2- studied previously [R.S. Berry, Phys. Chem. Chem. Phys., 7 (2005) 289-290].

  20. Association of MMP-1 -1607 1G/2G (rs1799750) polymorphism with primary knee osteoarthritis in the Greek population.

    PubMed

    Lepetsos, Panagiotis; Pampanos, Andreas; Kanavakis, Emmanouil; Tzetis, Maria; Korres, Dimitrios; Papavassiliou, Athanasios G; Efstathopoulos, Nicolaos

    2014-09-01

    Osteoarthritis is the most common form of arthritis with still unknown pathogenic etiology and considerable contribution of genetic factors. One of the mechanisms of cartilage degradation in osteoarthritis is enzymatic proteolysis of the extracellular matrix by metalloproteinases. MMP-1, produced by chondrocytes and synovial cells, is a major proteinase of the MMPs family. The present study aims at evaluating the association of MMP1 gene -1607 1G/2G (rs1799750) polymorphism with primary knee osteoarthritis in the Greek population. One hundred fifty five patients with primary symptomatic knee osteoarthritis participated in the study along with 139 controls. Genotypes were determined using PCR-RLFP technique. Allelic and genotypic frequencies were compared between both study groups. There was no significant association between MMP1 -1607 1G/2G polymorphism and knee osteoarthritis, in crude analysis; however, after multiple logistic regression analysis, 1G/2G was associated with reduced odds of knee osteoarthritis by 75% in males, compared to genotypes 1G/1G + 2G/2G, adjusting for age and BMI (adjusted OR: 0.25, 95% CI: 0.069, 0.910, p = 0.035). The present study shows that MMP1 -1607 1G/2G (rs1799750) polymorphism might be a risk factor for knee osteoarthritis susceptibility in the Greek population. Further investigations are needed to confirm this association in the pathogenesis of osteoarthritis. © 2014 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

  1. G4CEP: A G4 theory modification by including pseudopotential for molecules containing first-, second- and third-row representative elements.

    PubMed

    Silva, Cleuton de Souza; Pereira, Douglas Henrique; Custodio, Rogério

    2016-05-28

    The G4CEP composite method was developed from the respective G4 all-electron version by considering the implementation of compact effective pseudopotential (CEP). The G3/05 test set was used as reference to benchmark the adaptation by treating in this work atoms and compounds from the first and second periods of the periodic table, as well as representative elements of the third period, comprising 440 thermochemical data. G4CEP has not reached a so high level of accuracy as the G4 all-electron theory. G4CEP presented a mean absolute error around 1.09 kcal mol(-1), while the original method presents a deviation corresponding to 0.83 kcal mol(-1). The similarity of the optimized molecular geometries between G4 and G4CEP indicates that the core-electron effects and basis set adjustments may be pointed out as a significant factor responsible for the large discrepancies between the pseudopotential results and the experimental data, or even that the all-electron calculations are more efficient either in its formulation or in the cancellation of errors. When the G4CEP mean absolute error (1.09 kcal mol(-1)) is compared to 1.29 kcal mol(-1) from G3CEP, it does not seem so efficient. However, while the G3CEP uncertainty is ±4.06 kcal mol(-1), the G4CEP deviation is ±2.72 kcal mol(-1). Therefore, the G4CEP theory is considerably more reliable than any previous combination of composite theory and pseudopotential, particularly for enthalpies of formation and electron affinities.

  2. 4G/5G Polymorphism of Plasminogen Activator Inhibitor -1 Gene Is Associated with Mortality in Intensive Care Unit Patients with Severe Pneumonia

    PubMed Central

    Sapru, Anil; Hansen, Helen; Ajayi, Temitayo; Brown, Ron; Garcia, Oscar; Zhuo, HanJing; Wiemels, Joseph; Matthay, Michael A.; Wiener-Kronish, Jeanine

    2011-01-01

    Background Higher plasma and pulmonary edema fluid levels of plasminogen activator inhibitor-1 (PAI-1) are associated with increased mortality in patients with pneumonia and acute lung injury. The 4G allele of the 4G/5G polymorphism of the PAI-1 gene is associated with higher PAI-1 levels and an increased incidence of hospitalizations for pneumonia. The authors hypothesized that the 4G allele would be associated with worse clinical outcomes (mortality and ventilator-free days) in patients with severe pneumonia. Methods The authors enrolled patients admitted with severe pneumonia in a prospective cohort. Patients were followed until hospital discharge. DNA was isolated from blood samples, and genotyping detection for the PAI-1 4G/5G polymorphism was carried out using Taqman-based allelic discrimination. Results A total of 111 patients were available for analysis. Distribution of genotypes was 4G/4G 26 of 111 (23%), 4G/5G 59 of 111 (53%), and 5G/5G 26 of 111 (23%). Of 111 patients, 32 (29%) died before hospital discharge and 105 patients (94%) received mechanical ventilation. Patients with the 4G/4G and the 4G/5G genotypes had higher mortality (35% vs. 8%, P = 0.007) and fewer ventilator-free days (median 4 vs. 13, P = 0.04) compared to patients with the 5G/5G genotype. Conclusions The 4G allele of the 4G/5G polymorphism in the PAI-1 gene is associated with fewer ventilator-free days and increased mortality in hospitalized patients with severe pneumonia. These findings suggest that PAI-1 may have a role in pathogenesis and that the 4G/5G polymorphism may be an important biomarker of risk in patients with severe pneumonia. PMID:19387177

  3. 4G/5G polymorphism of plasminogen activator inhibitor-1 gene is associated with mortality in intensive care unit patients with severe pneumonia.

    PubMed

    Sapru, Anil; Hansen, Helen; Ajayi, Temitayo; Brown, Ron; Garcia, Oscar; Zhuo, HanJing; Wiemels, Joseph; Matthay, Michael A; Wiener-Kronish, Jeanine

    2009-05-01

    Higher plasma and pulmonary edema fluid levels of plasminogen activator inhibitor-1 (PAI-1) are associated with increased mortality in patients with pneumonia and acute lung injury. The 4G allele of the 4G/5G polymorphism of the PAI-1 gene is associated with higher PAI-1 levels and an increased incidence of hospitalizations for pneumonia. The authors hypothesized that the 4G allele would be associated with worse clinical outcomes (mortality and ventilator-free days) in patients with severe pneumonia. The authors enrolled patients admitted with severe pneumonia in a prospective cohort. Patients were followed until hospital discharge. DNA was isolated from blood samples, and genotyping detection for the PAI-1 4G/5G polymorphism was carried out using Taqman-based allelic discrimination. A total of 111 patients were available for analysis. Distribution of genotypes was 4G/4G 26 of 111 (23%), 4G/5G 59 of 111 (53%), and 5G/5G 26 of 111 (23%). Of 111 patients, 32 (29%) died before hospital discharge and 105 patients (94%) received mechanical ventilation. Patients with the 4G/4G and the 4G/5G genotypes had higher mortality (35% vs. 8%, P = 0.007) and fewer ventilator-free days (median 4 vs. 13, P = 0.04) compared to patients with the 5G/5G genotype. The 4G allele of the 4G/5G polymorphism in the PAI-1 gene is associated with fewer ventilator-free days and increased mortality in hospitalized patients with severe pneumonia. These findings suggest that PAI-1 may have a role in pathogenesis and that the 4G/5G polymorphism may be an important biomarker of risk in patients with severe pneumonia.

  4. PAI-1 -675 4G/5G Polymorphism in Association with Diabetes and Diabetic Complications Susceptibility: a Meta-Analysis Study

    PubMed Central

    Yang, Fan; Cui, Dai; Shi, Yun; Shen, Chong; Tang, Wei; Yang, Tao

    2013-01-01

    A meta-analysis was performed to assess the association between the PAI-1 -675 4G/5G polymorphism and susceptibility to diabetes mellitus (DM), diabetic nephropathy (DN), diabetic retinopathy (DR) and diabetic coronary artery disease (CAD). A literature-based search was conducted to identify all relevant studies. The fixed or random effect pooled measure was calculated mainly at the allele level to determine heterogeneity bias among studies. Further stratified analyses and sensitivity analyses were also performed. Publication bias was examined by the modified Begg’s and Egger’s test. Twenty published articles with twenty-seven outcomes were included in the meta-analysis: 6 studies with a total of 1,333 cases and 3,011 controls were analyzed for the PAI-1 -675 4G/5G polymorphism with diabetes risk, 7 studies with 1,060 cases and 1,139 controls for DN risk, 10 studies with 1,327 cases and 1,557 controls for DR and 4 studies with 610 cases and 1,042 controls for diabetic CAD risk respectively. Using allelic comparison (4G vs. 5G), the PAI-1 -675 4G/5G polymorphism was observed to have no significant association with diabetes (REM OR 1.07, 95% CI 0.96, 1.20), DN (REM OR 1.10, 95% CI 0.98, 1.25), DR (REM OR 1.09, 95% CI 0.97, 1.22) or diabetic CAD risk (REM OR 1.07, 95% CI 0.81, 1.42), and similar results were obtained in the dominant, recessive and co-dominant models. Our meta-analyses suggest that the PAI-1 -675 4G/5G polymorphism might not be a risk factor for DM, DN, DR or diabetic CAD risk in the populations investigated. This conclusion warrants confirmation by further studies. PMID:24223897

  5. PAI-1 -675 4G/5G polymorphism in association with diabetes and diabetic complications susceptibility: a meta-analysis study.

    PubMed

    Xu, Kuanfeng; Liu, Xiaoyun; Yang, Fan; Cui, Dai; Shi, Yun; Shen, Chong; Tang, Wei; Yang, Tao

    2013-01-01

    A meta-analysis was performed to assess the association between the PAI-1 -675 4G/5G polymorphism and susceptibility to diabetes mellitus (DM), diabetic nephropathy (DN), diabetic retinopathy (DR) and diabetic coronary artery disease (CAD). A literature-based search was conducted to identify all relevant studies. The fixed or random effect pooled measure was calculated mainly at the allele level to determine heterogeneity bias among studies. Further stratified analyses and sensitivity analyses were also performed. Publication bias was examined by the modified Begg's and Egger's test. Twenty published articles with twenty-seven outcomes were included in the meta-analysis: 6 studies with a total of 1,333 cases and 3,011 controls were analyzed for the PAI-1 -675 4G/5G polymorphism with diabetes risk, 7 studies with 1,060 cases and 1,139 controls for DN risk, 10 studies with 1,327 cases and 1,557 controls for DR and 4 studies with 610 cases and 1,042 controls for diabetic CAD risk respectively. Using allelic comparison (4G vs. 5G), the PAI-1 -675 4G/5G polymorphism was observed to have no significant association with diabetes (REM OR 1.07, 95% CI 0.96, 1.20), DN (REM OR 1.10, 95% CI 0.98, 1.25), DR (REM OR 1.09, 95% CI 0.97, 1.22) or diabetic CAD risk (REM OR 1.07, 95% CI 0.81, 1.42), and similar results were obtained in the dominant, recessive and co-dominant models. Our meta-analyses suggest that the PAI-1 -675 4G/5G polymorphism might not be a risk factor for DM, DN, DR or diabetic CAD risk in the populations investigated. This conclusion warrants confirmation by further studies.

  6. G4CEP: A G4 theory modification by including pseudopotential for molecules containing first-, second- and third-row representative elements

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Silva, Cleuton de Souza; Instituto de Ciências Exatas e Tecnologia, Universidade Federal do Amazonas, Campus de Itacoatiara, 69100-021 Itacoatiara, Amazonas; Pereira, Douglas Henrique

    2016-05-28

    The G4CEP composite method was developed from the respective G4 all-electron version by considering the implementation of compact effective pseudopotential (CEP). The G3/05 test set was used as reference to benchmark the adaptation by treating in this work atoms and compounds from the first and second periods of the periodic table, as well as representative elements of the third period, comprising 440 thermochemical data. G4CEP has not reached a so high level of accuracy as the G4 all-electron theory. G4CEP presented a mean absolute error around 1.09 kcal mol{sup −1}, while the original method presents a deviation corresponding to 0.83more » kcal mol{sup −1}. The similarity of the optimized molecular geometries between G4 and G4CEP indicates that the core-electron effects and basis set adjustments may be pointed out as a significant factor responsible for the large discrepancies between the pseudopotential results and the experimental data, or even that the all-electron calculations are more efficient either in its formulation or in the cancellation of errors. When the G4CEP mean absolute error (1.09 kcal mol{sup −1}) is compared to 1.29 kcal mol{sup −1} from G3CEP, it does not seem so efficient. However, while the G3CEP uncertainty is ±4.06 kcal mol{sup −1}, the G4CEP deviation is ±2.72 kcal mol{sup −1}. Therefore, the G4CEP theory is considerably more reliable than any previous combination of composite theory and pseudopotential, particularly for enthalpies of formation and electron affinities.« less

  7. The association of factor V G1961A (factor V Leiden), prothrombin G20210A, MTHFR C677T and PAI-1 4G/5G polymorphisms with recurrent pregnancy loss in Bosnian women.

    PubMed

    Jusić, Amela; Balić, Devleta; Avdić, Aldijana; Pođanin, Maja; Balić, Adem

    2018-08-01

    Aim To investigate association of factor V Leiden, prothrombin G20210A, MTHFR C677T and PAI-1 4G/5G polymorphisms with recurrent pregnancy loss in Bosnian women. Methods A total of 60 women with two or more consecutive miscarriages before 20 weeks of gestation with the same partners and without history of known causes or recurrent pregnancy loss were included. A control group included 80 healthy women who had one or more successful pregnancies without history of any complication which could be associated with miscarriages. Genotyping of factor V Leiden, prothrombin G20210A, MTHFR C677T and PAI-1 4G/5G polymorphisms were performed by polymerase chain reaction/restriction fragments length polymorphism method (PCR/RFLP). Results Both factor V Leiden and MTHFR C677T polymorphisms were significantly associated with recurrent pregnancy loss (RPL) in Bosnian women while prothrombin G20210A and PAI-1 4G/5G polymorphisms did not show strongly significant association. Conclusion The presence of thrombophilic polymorphisms may predispose women to recurrent pregnancy loss. Future investigation should be addressed in order to find when carriers of those mutations, polymorphisms should be treated with anticoagulant therapy. Copyright© by the Medical Assotiation of Zenica-Doboj Canton.

  8. The role of TPA I/D and PAI-1 4G/5G polymorphisms in multiple sclerosis.

    PubMed

    Zivković, Maja; Starčević Čizmarević, Nada; Lovrečić, Luca; Klupka-Sarić, Inge; Stanković, Aleksandra; Gašparović, Iva; Lavtar, Polona; Dinčić, Evica; Stojković, Ljiljana; Rudolf, Gorazd; Jazbec, Saša Sega; Perković, Olivio; Sinanović, Osman; Sepčić, Juraj; Kapović, Miljenko; Peterlin, Borut; Ristić, Smiljana

    2014-01-01

    Previous studies have shown impaired fibrinolysis in multiple sclerosis (MS) and implicated extracellular proteolytic enzymes as important factors in demyelinating neuroinflammatory disorders. Tissue-type plasminogen activator (t-PA) and its inhibitor (PAI-1) are key molecules in both fibrinolysis and extracellular proteolysis. In the present study, an association of the TPA Alu I/D and PAI-1 4G/5G polymorphisms with MS was analyzed within the Genomic Network for Multiple Sclerosis (GENoMS). The GENoMS includes four populations (Croatian, Slovenian, Serbian, and Bosnian and Herzegovinian) sharing the same geographic location and a similar ethnic background. A total of 885 patients and 656 ethnically matched healthy blood donors with no history of MS in their families were genotyped using PCR-RFLP. TPA DD homozygosity was protective (OR = 0.79, 95% CI 0.63-0.99, P = 0.037) and PAI 5G5G was a risk factor for MS (OR = 1.30, 95% CI 1.01-1.66, P = 0.038). A significant effect of the genotype/carrier combination was detected in 5G5G/I carriers (OR = 1.39 95% CI 1.06-1.82, P = 0.017). We found a significantly harmful effect of the combination of the PAI-1 5G/5G genotype and TPA I allele on MS susceptibility, which indicates the importance of gene-gene interactions in complex diseases such as MS.

  9. The Role of TPA I/D and PAI-1 4G/5G Polymorphisms in Multiple Sclerosis

    PubMed Central

    Živković, Maja; Starčević Čizmarević, Nada; Lovrečić, Luca; Klupka-Sarić, Inge; Stanković, Aleksandra; Gašparović, Iva; Dinčić, Evica; Stojković, Ljiljana; Rudolf, Gorazd; Šega Jazbec, Saša; Perković, Olivio; Sinanović, Osman; Sepčić, Juraj; Kapović, Miljenko; Peterlin, Borut

    2014-01-01

    Background. Previous studies have shown impaired fibrinolysis in multiple sclerosis (MS) and implicated extracellular proteolytic enzymes as important factors in demyelinating neuroinflammatory disorders. Tissue-type plasminogen activator (t-PA) and its inhibitor (PAI-1) are key molecules in both fibrinolysis and extracellular proteolysis. In the present study, an association of the TPA Alu I/D and PAI-1 4G/5G polymorphisms with MS was analyzed within the Genomic Network for Multiple Sclerosis (GENoMS). Methods. The GENoMS includes four populations (Croatian, Slovenian, Serbian, and Bosnian and Herzegovinian) sharing the same geographic location and a similar ethnic background. A total of 885 patients and 656 ethnically matched healthy blood donors with no history of MS in their families were genotyped using PCR-RFLP. Results. TPA DD homozygosity was protective (OR = 0.79, 95% CI 0.63–0.99, P = 0.037) and PAI 5G5G was a risk factor for MS (OR = 1.30, 95% CI 1.01–1.66, P = 0.038). A significant effect of the genotype/carrier combination was detected in 5G5G/I carriers (OR = 1.39 95% CI 1.06–1.82, P = 0.017). Conclusions. We found a significantly harmful effect of the combination of the PAI-1 5G/5G genotype and TPA I allele on MS susceptibility, which indicates the importance of gene-gene interactions in complex diseases such as MS. PMID:24825926

  10. Towards G2G: Systems of Technology Database Systems

    NASA Technical Reports Server (NTRS)

    Maluf, David A.; Bell, David

    2005-01-01

    We present an approach and methodology for developing Government-to-Government (G2G) Systems of Technology Database Systems. G2G will deliver technologies for distributed and remote integration of technology data for internal use in analysis and planning as well as for external communications. G2G enables NASA managers, engineers, operational teams and information systems to "compose" technology roadmaps and plans by selecting, combining, extending, specializing and modifying components of technology database systems. G2G will interoperate information and knowledge that is distributed across organizational entities involved that is ideal for NASA future Exploration Enterprise. Key contributions of the G2G system will include the creation of an integrated approach to sustain effective management of technology investments that supports the ability of various technology database systems to be independently managed. The integration technology will comply with emerging open standards. Applications can thus be customized for local needs while enabling an integrated management of technology approach that serves the global needs of NASA. The G2G capabilities will use NASA s breakthrough in database "composition" and integration technology, will use and advance emerging open standards, and will use commercial information technologies to enable effective System of Technology Database systems.

  11. Plasminogen activator inhibitor-1 4G/5G polymorphism, factor V Leiden, prothrombin mutations and the risk of VTE recurrence.

    PubMed

    Sundquist, Kristina; Wang, Xiao; Svensson, Peter J; Sundquist, Jan; Hedelius, Anna; Larsson Lönn, Sara; Zöller, Bengt; Memon, Ashfaque A

    2015-11-25

    Plasminogen-activator inhibitor (PAI)-1 is an important inhibitor of the plasminogen/plasmin system. PAI-1 levels are influenced by the 4G/5G polymorphism in the PAI-1 promoter. We investigated the relationship between the PAI-1 polymorphism and VTE recurrence, and its possible modification by factor V Leiden (FVL) and prothrombin (PTM) mutations. Patients (n=1,069) from the Malmö Thrombophilia Study were followed from discontinuation of anticoagulant treatment until diagnosis of VTE recurrence or the end of the study (maximum follow-up 9.8 years). One hundred twenty-seven patients (11.9 %) had VTE recurrence. PAI-1 was genotyped by TaqMan PCR. Cox regression analysis adjusted for age, sex and acquired risk factors of VTE showed no evidence of an association between PAI-1 genotype and risk of VTE recurrence in the study population as a whole. However, by including an interaction term in the analysis we showed that FVL but not PTM modified the effect of PAI-1 genotype: patients with the 4G allele plus FVL had a higher risk of VTE recurrence [hazard ratio (HR) =2.3, 95 % confidence interval (CI) =1.5-3.3] compared to patients with the 4G allele but no FVL (reference group) or FVL irrespective of PAI-1 genotype (HR=1.8, 95 % CI=1.3-2.5). Compared to reference group, 5G allele irrespective of FVL was associated with lower risk of VTE recurrence only when compared with 4G allele together with FVL. In conclusion, FVL has a modifying effect on PAI-1 polymorphism in relation to risk of VTE recurrence. The role of PAI-1 polymorphism as a risk factor of recurrent VTE may be FVL dependent.

  12. PAI-1 4G/5G polymorphism and coronary artery disease risk: a meta-analysis.

    PubMed

    Liang, Zhongshu; Jiang, Weihong; Ouyang, Mao; Yang, Kan

    2015-01-01

    Many epidemiologic studies have investigated the plasminogen activator inhibitor-1 (PAI-1) gene 4G/5G polymorphism and this association with coronary artery disease (CAD). But definite conclusions can not be drawn. Related studies were identified from PubMed, Springer Link, Ovid, Chinese Wanfang Data Knowledge Service Platform, Chinese National Knowledge Infrastructure (CNKI), and Chinese Biology Medicine (CBM) till 10 August 2014. Pooled ORs and 95% CIs were used to assess the strength of the associations. A total of 53 studies including 20921 CAD cases and 18434 controls were included. Significantly elevated CAD risk was found in overall analysis (OR = 1.13, 95% CI: 1.05-1.21, P = 0.0009). In the subgroup analysis by races, significantly increased risk was found in Caucasians (OR = 1.11, 95% CI: 1.03-1.20, P = 0.005) and Asians (OR = 1.20, 95% CI: 1.01-1.42, P = 0.04). In the subgroup analysis by gender, significant association was found in males (OR = 1.15, 95% CI: 1.06-1.25, P = 0.0008), but was not found in females (OR = 1.05, 95% CI: 0.92-1.20, P = 0.47). In the subgroup analysis by age, young populations showed increased CAD risk (OR = 1.19, 95% CI: 1.02-1.37, P = 0.02), but old populations did not show this association (OR = 1.01, 95% CI: 0.82-1.24, P = 0.93). This meta-analysis provides the evidence that PAI-1 4G/5G polymorphism may contribute to the CAD development.

  13. PAI-1 4G/5G polymorphism and coronary artery disease risk: a meta-analysis

    PubMed Central

    Liang, Zhongshu; Jiang, Weihong; Ouyang, Mao; Yang, Kan

    2015-01-01

    Many epidemiologic studies have investigated the plasminogen activator inhibitor-1 (PAI-1) gene 4G/5G polymorphism and this association with coronary artery disease (CAD). But definite conclusions can not be drawn. Related studies were identified from PubMed, Springer Link, Ovid, Chinese Wanfang Data Knowledge Service Platform, Chinese National Knowledge Infrastructure (CNKI), and Chinese Biology Medicine (CBM) till 10 August 2014. Pooled ORs and 95% CIs were used to assess the strength of the associations. A total of 53 studies including 20921 CAD cases and 18434 controls were included. Significantly elevated CAD risk was found in overall analysis (OR = 1.13, 95% CI: 1.05-1.21, P = 0.0009). In the subgroup analysis by races, significantly increased risk was found in Caucasians (OR = 1.11, 95% CI: 1.03-1.20, P = 0.005) and Asians (OR = 1.20, 95% CI: 1.01-1.42, P = 0.04). In the subgroup analysis by gender, significant association was found in males (OR = 1.15, 95% CI: 1.06-1.25, P = 0.0008), but was not found in females (OR = 1.05, 95% CI: 0.92-1.20, P = 0.47). In the subgroup analysis by age, young populations showed increased CAD risk (OR = 1.19, 95% CI: 1.02-1.37, P = 0.02), but old populations did not show this association (OR = 1.01, 95% CI: 0.82-1.24, P = 0.93). This meta-analysis provides the evidence that PAI-1 4G/5G polymorphism may contribute to the CAD development. PMID:25932140

  14. IgG4 related sclerosing mastitis: expanding the morphological spectrum of IgG4 related diseases.

    PubMed

    Chougule, Abhijit; Bal, Amanjit; Das, Ashim; Singh, Gurpreet

    2015-01-01

    IgG4 related disease (IgG4RD) is a recently recognised condition characterised by mass forming lesions associated with storiform fibrosis, obliterative phlebitis, lymphoplasmacytic infiltrate rich in IgG4 positive plasma cells and elevated serum IgG4 levels. Although rare, mammary involvement has been reported as IgG4 related sclerosing mastitis, the morphological counterpart of a growing family of IgG4 related diseases. A total of 17 cases belonging to mass forming benign inflammatory breast lesions such as plasma cell mastitis, granulomatous lobular mastitis, non-specific mastitis and inflammatory pseudotumour were investigated as a possible member of IgG4 related sclerosing mastitis. Clinical, radiological, histopathological and immunohistochemistry findings were noted in all cases. Cases diagnosed as inflammatory pseudotumour showed all the histopathological features of IgG4RD along with increased number of IgG4 positive plasma cells and IgG4/IgG ratio >40%. However, only a few IgG4 positive cells were seen in plasma cell mastitis, granulomatous lobular mastitis and non-specific mastitis cases. These cases also did not fulfill the morphological criteria for the diagnosis of IgG4 related diseases. IgG4RD should be excluded in plasma cell rich lesions diagnosed on core biopsies by IgG4 immunostaining. This can avoid unnecessary surgery as IgG4 related diseases respond to simple and effective steroid treatment.

  15. Long-range magnetic order in the Heisenberg pyrochlore antiferromagnets G d2G e2O7 and G d2P t2O7 synthesized under high pressure

    NASA Astrophysics Data System (ADS)

    Li, X.; Cai, Y. Q.; Cui, Q.; Lin, C. J.; Dun, Z. L.; Matsubayashi, K.; Uwatoko, Y.; Sato, Y.; Kawae, T.; Lv, S. J.; Jin, C. Q.; Zhou, J.-S.; Goodenough, J. B.; Zhou, H. D.; Cheng, J.-G.

    2016-12-01

    G d2S n2O7 and G d2T i2O7 have been regarded as good experimental realizations of the classical Heisenberg pyrochlore antiferromagnet with dipolar interaction. The former was found to adopt the Palmer-Chalker state via a single, first-order transition at TN≈1 K , while the latter enters a distinct, partially ordered state through two successive transitions at TN 11 K and TN 2= 0.75 K . To shed more light on their distinct magnetic ground states, we have synthesized two more gadolinium-based pyrochlore oxides, G d2G e2O7 and G d2P t2O7 , under high-pressure conditions and performed detailed characterizations via x-ray powder diffraction, dc and ac magnetic susceptibility, and specific heat measurements down to 100 mK. We found that both compounds enter a long-range antiferromagnetically ordered state through a single, first-order transition at TN= 1.4 K for G d2G e2O7 and TN= 1.56 K for G d2P t2O7 , with the specific heat anomaly similar to that of G d2S n2O7 rather than G d2T i2O7 . Interestingly, the low-temperature magnetic specific heat values of both G d2G e2O7 and G d2P t2O7 were found to follow nicely the T3 dependence as expected for a three-dimensional antiferromagnet with gapless spin-wave excitations. We have rationalized the enhancement of TN in terms of the reduced Gd-Gd distances for the chemically pressurized G d2G e2O7 and the addition of extra superexchange pathways through the empty Pt -eg orbitals for G d2P t2O7 . Our current study has expanded the family of gadolinium-based pyrochlores and permits us to achieve a better understanding of their distinct magnetic properties in a more comprehensive perspective.

  16. Calibration of mass and conventional mass of weights 2 kg, 1 kg, 200 g, 50 g, 1 g and 200 mg

    NASA Astrophysics Data System (ADS)

    Becerra, Luis Omar; Peña, Luis Manuel; Escalante Vargas, Boris; Cori Almonte, Luz; Martín Quiroga Rojas, Aldo; Bermúdez Coronel, Álvaro; Escobar Soto, Jhon J.; Naula, Wilson; Florencio, Arnaldo; Lourdes Valenzuela, María; Ramos Alfaro, Olman; Prenda Peña, Marcela

    2018-01-01

    This report describes the results of a supplementary comparison between SIM NMIs, which was carried out to evaluate the consistency of the measurements of calibration in high accuracy mass standards using the normalized error criteria (2 kg, 1 kg, 200 g, 50 g, 1 g and 200 mg). The supplementary comparison was carried out from April 2012 to July 2013. Main text To reach the main text of this paper, click on Final Report. Note that this text is that which appears in Appendix B of the BIPM key comparison database kcdb.bipm.org/. The final report has been peer-reviewed and approved for publication by the CCM, according to the provisions of the CIPM Mutual Recognition Arrangement (CIPM MRA).

  17. The extraction of the spin structure function, g2 (and g1) at low Bjorken x

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ndukum, Luwani Z.

    2015-08-01

    The Spin Asymmetries of the Nucleon Experiment (SANE) used the Continuous Electron Beam Accelerator Facility at Jefferson Laboratory in Newport News, VA to investigate the spin structure of the proton. The experiment measured inclusive double polarization electron asymmetries using a polarized electron beam, scattered off a solid polarized ammonia target with target polarization aligned longitudinal and near transverse to the electron beam, allowing the extraction of the spin asymmetries A1 and A2, and spin structure functions g1 and g2. Polarized electrons of energies of 4.7 and 5.9 GeV were used. The scattered electrons were detected by a novel, non-magnetic arraymore » of detectors observing a four-momentum transfer range of 2.5 to 6.5 GeV*V. This document addresses the extraction of the spin asymmetries and spin structure functions, with a focus on spin structure function, g2 (and g1) at low Bjorken x. The spin structure functions were measured as a function of x and W in four Q square bins. A full understanding of the low x region is necessary to get clean results for SANE and extend our understanding of the kinematic region at low x.« less

  18. The binding of manganese(II) and zinc(II) to the synthetic oligonucleotide d(C-G-C-G-A-A-T-T-C-G-C-G)2. A 1H NMR study.

    PubMed

    Frøystein, N A; Sletten, E

    1991-03-01

    The interaction of the synthetic oligonucleotide d(C-G-C-G-A-A-T-T-C-G-C-G)2 with two different transition-metal ions has been investigated in aqueous solution by means of 1H NMR spectroscopy. The effects on the DNA due to the presence of manganese(II) or zinc(II) have been monitored by observing the paramagnetic broadening and diamagnetic shifts of the non-exchangeable proton resonance lines, respectively. The 1H NMR spectra acquired during the course of the manganese(II) titration show very distinct broadening effects on certain DNA resonance lines. Primarily, the H8 resonance of G4 is affected, but also the H5 and H6 resonances of C3 are clearly affected by the metal. The results imply that the binding of manganese(II) to DNA is sequence specific. The 1H spectra obtained during the zinc(II) titration reveal diamagnetic shift effects which largely conform with the paramagnetic broadening effects due to the presence of manganese(II), although this picture is somewhat more complex. The H8 resonance of G4 displays a clearly visible high-field shift, while for the other guanosine H8 protons this effect is absent. The H1' and H2' protons of C3 show an effect of similar strength, although in the opposite direction, while H5 and H6 of C3 are only slightly affected. Local differences in the structure of the DNA and the basicities of potential binding sites on different base steps in the sequence might account for the observed sequence selectivity.

  19. APOBEC3G ubiquitination by Nedd4-1 favors its packaging into HIV-1 particles.

    PubMed

    Dussart, Sylvie; Douaisi, Marc; Courcoul, Marianne; Bessou, Gilles; Vigne, Robert; Decroly, Etienne

    2005-01-21

    APOBEC3G is a cytidine deaminase that limits the replication of many retroviruses. This antiviral host factor is packaged into retrovirus particles, where it targets single-stranded DNA generated during reverse transcription and induces up to 2% of G-to-A mutations, which are lethal for the HIV-1 provirus. Vif protein counteracts this antiviral factor by decreasing its packaging into lentivirus particles. Here, we demonstrate that Nedd4-1, an HECT E3 ubiquitin ligase, interacts with APOBEC3G, through its WW2 and WW3 domains. As a result of this interaction, APOBEC3G undergoes post-translational modification by addition of ubiquitin moieties. Accordingly, we demonstrate that the dominant negative Nedd4-1 C/S form prevents APOBEC3G ubiquitination. Moreover, the packaging of APOBEC3G into Pr55 Gag virus-like particles and into HIV-1 virions is reduced when Nedd4-1 C/S is expressed. During HIV-1 viral production in the presence of APOBEC3G, Nedd4-1 C/S restores partially the infectivity of Deltavif HIV-1. We conclude that the ubiquitination of APOBEC3G by Nedd4-1 favors its targeting to the virus assembly site where APOBEC3G interacts with Gag and is packaged into HIV-1 particles in the absence of Vif.

  20. The Association of Plasminogen Activator Inhibitor Type 1 (PAI-1) Level and PAI-1 4G/5G Gene Polymorphism with the Formation and the Grade of Endometrial Cancer.

    PubMed

    Yıldırım, Malik Ejder; Karakuş, Savas; Kurtulgan, Hande Küçük; Kılıçgün, Hasan; Erşan, Serpil; Bakır, Sevtap

    2017-08-01

    Plasminogen activator inhibitor type 1 (PAI-1) is a serine protease inhibitor (Serpine 1), and it inhibits both tissue plasminogen activator and urokinase plasminogen activator which are important in fibrinolysis. We aimed to find whether there is a possible association between PAI-1 level, PAI-1 4G/5G polymorphism, and endometrial cancer. PAI-1 levels in peripheral blood were determined in 82 patients with endometrial carcinoma and 76 female healthy controls using an enzyme-linked immunoassay (ELISA). Then, the genomic DNA was extracted and screened by reverse hybridization procedure (Strip assay) to detect PAI 1 4G/5G polymorphism. The levels of PAI-1 in the patients were higher statistically in comparison to controls (P < 0.001). The distribution of PAI-1 4G/5G polymorphism was quite different between patients and controls (P = 0.008), and 4G allelic frequency was significantly higher in the patients of endometrial cancer than in controls (P = 0.026). We found significant difference between Grade 1 and Grade 2+3 patients in terms of the PAI-1 levels (P = 0.047). There was no association between PAI-1 4G/5G polymorphism and the grades of endometrial cancer (P = 0.993). Our data suggest that the level of PAI-1 and PAI-1 4G/5G gene polymorphism are effective in the formation of endometrial cancer. PAI-1 levels are also associated with the grades of endometrial cancer.

  1. Plasminogen activator inhibitor-1 -675 4G/5G polymorphism and polycystic ovary syndrome risk: a meta analysis.

    PubMed

    Liu, Ying; Sun, Mei-Guo; Jiang, Rong; Ding, Rui; Che, Zhen; Chen, Yan-Yan; Yao, Ci-Jiang; Zhu, Xiao-Xia; Cao, Ji-Yu

    2014-03-01

    Several studies have reported that excessive amounts of plasminogen activator inhibitor-1(PAI-1) might increase the incidence of polycystic ovary syndrome(PCOS), but so far the published results were inconsistent. The aim of this study was to further investigate the association between PAI-1 gene polymorphism and the susceptibility to PCOS by performing a meta-analysis. A comprehensive literature search for relevant studies was conducted on google scholar, PubMed, the Chinese National Knowledge Infrastructure (CNKI) and the Chinese Biomedical Literature Database (CBM). This meta-analysis was performed using the STATA 11.0 software and the pooled odds ratio (OR) with 95% confidence interval (CI) was calculated. Ten case-control studies were included in this meta-analysis with a total of 2,079 cases and 1,556 controls. The results showed that PAI-1 -675 4G/5G polymorphism may increase the risk of PCOS, especially among Asian populations. However, there was no statistically significant association between the polymorphism and PCOS risk in Caucasians. Our meta-analysis suggests that PAI-1 -675 4G/5G polymorphism may contribute to increasing susceptibility to PCOS in Asians. Detection of the PAI-1 gene polymorphism might be a promising biomarker for the susceptibility of PCOS.

  2. Plasminogen activator inhibitor-1 5G/5G genotype is a protecting factor preventing posttransplant diabetes mellitus.

    PubMed

    Chang, Horng-Rong; Yang, Shun-Fa; Tsai, Jen-Pi; Hsieh, Ming-Chia; Wu, Sheng-Wen; Tsai, Hui-Ching; Hung, Tung-Wei; Huang, Jun-Huang; Lian, Jong-Da

    2011-01-30

    Plasminogen activator inhibitor 1 (PAI-1) is thought to play a role in the pathogenesis of obesity and insulin resistance. A connection between gestational diabetes mellitus and the functional -675 PAI-1 genotype has been reported. Therefore, we examined the role of the PAI-1 gene polymorphism in kidney transplant recipients. A total of 376 kidney transplant recipients were prospectively screened for posttransplant diabetes mellitus (PTDM). Eighty-one (21.5%) patients were diagnosed with PTDM and the other 295 patients were non-diabetic following kidney transplantation. DNA samples were isolated from the sera and analyzed for the functional -675 4G/5G promoter polymorphisms of the PAI-1 gene. Kidney transplant recipients with PTDM were significantly associated with tacrolimus use (p=0.03), older age (p=0.036), and higher body mass index (p=0.001). The genotype distribution was significantly different between the patients with PTDM (genotype 4G/4G:4G/5G:5G/5G=33.3%:60.5%:6.2%) and those without PTDM (genotype 4G/4G:4G/5G:5G/5G=36.9%:44.1%:19.0%) (p=0.018). Patients with homozygosity for 5G had a significantly lower rate of PTDM (aOR, 0.286, p=0.022) and higher cumulative event-free probability of time to PTDM (log rank test, p=0.0058). Homozygosity for the 5G allele of the PAI-1 gene constitutes a protecting factor for the development of PTDM. Our findings are similar to a previous study on gestational diabetes mellitus, and strongly support a possible genetic role of PAI-1 in the development of PTDM. Copyright © 2010 Elsevier B.V. All rights reserved.

  3. Excitation of O 2(a 1Δ g, b 1Σ g+) and I( 2P 1/2) by energy transfer from I 2(A, A' 3Π 1,2u) in solid rare gases

    NASA Astrophysics Data System (ADS)

    Böhling, R.; Becker, A. C.; Minaev, B. F.; Seranski, K.; Schurath, U.

    1990-04-01

    O 2a 1Δ g, b 1Σ g+ → X 3Σ g- and I 2P 1/22P 3/4 fluorescence occurs in I 2/O 2-doped rare gas matrices when I 2 is excited with visible laser light. O 2(a 1Δ g) and I( 2P 1/2) are populated independently by near-resonant energy transfer from the metastable triplet states of I 2. The doublet splitting of the O 2a→X band, which peaks at 7879 and 7863 cm -1 in argon, is interpreted as sensitized emission from O 2 trapped in distinct nearest neighbour positions of the donor 3I 2. Annealing reverses the intensity of the doublet, showing that the sites can be interconverted. It is suggested that the a→X emission rate is enhanced by the sensitizer, causing a lifetime reduction of the a 1Δ g state from 79 s in pure argon to 21 and 3±1 s next to I 2. The long-lived O 2(a 1Δ g) state is the precursor of I 2-sensitized emission from O 2(b 1Σ g+). The lifetime of O 2(b 1Σ g+) is reduced from 24.5 ms in pure argon to 17±1 ms in the presence of I 2.

  4. The -675 4G/5G polymorphism at the Plasminogen Activator Inhibitor 1 (PAI-1) gene modulates plasma Plasminogen Activator Inhibitor 1 concentrations in response to dietary fat consumption.

    PubMed

    Pérez-Martínez, P; Adarraga-Cansino, M D; Fernández de la Puebla, R A; Blanco-Molina, A; Delgado-Lista, J; Marín, C; Ordovás, J M; López-Miranda, J; Pérez-Jiménez, F

    2008-04-01

    The objective of the study was to determine whether Plasminogen Activator Inhibitor Type 1 (PAI-1) -675 4G/5G polymorphism is associated with the response of functional plasma PAI-1 concentrations to changes in the amount and quality of dietary fat in healthy subjects. PAI-1 is the major inhibitor of fibrinolysis, and a lower level of fibrinolytic activity could be implicated in an increased risk of IHD. Fifty-nine healthy Spanish volunteers (ten 4G/4G homozygotes, twenty-eight heterozygotes 4G/5G and twenty-one 5G/5G homozygotes) consumed three diets for periods of 4 weeks each: a SFA-rich diet (38 % fat, 20 % SFA), followed by a carbohydrate-rich diet (30 % fat, 55 % carbohydrate) and a MUFA-rich diet (38 % fat, 22 % MUFA) according to a randomized crossover design. At the end of each dietary period plasma lipid and functional plasma PAI-1 concentrations were determined. Subjects carrying the 4G allele (4G/4G and 4G/5G) showed a significant decrease in PAI-1 concentrations after the MUFA diet, compared with the SFA-rich and carbohydrate-rich diets (genotype x diet interaction: P = 0.028). 5G/5G homozygotes had the lowest plasma PAI-1 concentrations compared with 4G/4G and 4G/5G subjects (genotype: P = 0.002), without any changes as a result of the amount and the quality of the dietary fat. In summary, no differences in plasma PAI-1 concentration response were found after changes in dietary fat intake in 5G/5G homozygotes, although these subjects displayed the lowest concentrations of PAI-1. On the other hand, carriers of the 4G allele are more likely to hyper-respond to the presence of MUFA in the diet because of a greater decrease in PAI-1 concentrations.

  5. Plasminogen activator inhibitor type 1 serum levels and 4G/5G gene polymorphism in morbidly obese Hispanic patients with non-alcoholic fatty liver disease.

    PubMed

    Espino, Alberto; Villagrán, Andrea; Vollrath, Valeska; Hanckes, Paulina; Salas, Roberto; Farah, Andrea; Solís, Nancy; Pizarro, Margarita; Escalona, Alex; Boza, Camilo; Pérez, Gustavo; Carrasco, Gonzalo; Padilla, Oslando; Miquel, Juan Francisco; Nervi, Flavio; Chavez-Tapia, Norberto C; Arab, Juan Pablo; Alvarez-Lobos, Manuel; Arrese, Marco; Riquelme, Arnoldo

    2011-01-01

    The plasminogen activator inhibitor type-1 (PAI-1) has been implicated in the regulation of fibrinolysis and extracellular matrix components. The single base pair guanine insertion/deletion polymorphism (4G/5G) within the promoter region of the PAI-1 gene influences PAI-1 synthesis and may modulate hepatic fibrogenesis. To evaluate the influence of PAI-1 serum levels and 4G/5G polymorphism on the risk of liver fibrosis associated to non-alcoholic fatty liver disease (NAFLD) in morbidly obese patients. Case-control study of 50 obese patients undergoing bariatric surgery and 71 non-obese subjects matched by age and sex. Anthropometric and biochemical measurements were performed, including PAI-1 serum levels. Genomic DNA was obtained to assess the presence of 4G/5G polymorphism. BMI, insulinemia, triglycerides, HOMA-IR, hypertension and diabetes were significantly higher in obese patients compared to control subjects. PAI-1 serum levels observed in obese patients were significantly lower (10.63 ± 4.82) compared to controls (14.26 ± 11.4; p < 0.05). No differences were observed in the PAI-1 4G/5G promoter genotypes frequencies (p = 0.12). No differences were observed in PAI-1 plasma levels among obese patients with liver fibrosis (10.64 ± 4.35) compared to patients without liver fibrosis (10.61 ± 5.2; p = 0.985). PAI-1 4G/5G promoter genotypes frequencies were similar in patients with or without liver fibrosis associated to NASH (p = 0.6). Morbidly obese patients had significantly lower PAI-1 serum levels with similar PAI-1 4G/5G genotypes frequencies compared to non-obese subjects. The frequency of 4G/5G genotypes in Chilean Hispanic healthy subjects was similar to that described in other populations. No association was found between PAI-1 serum levels or 4G/5G genotype with liver fibrosis in obese patients.

  6. Coexistence of ACE (I/D) and PAI-1 (4G/5G) gene variants in recurrent miscarriage in Polish population.

    PubMed

    Kurzawińska, Grażyna; Barlik, Magdalena; Drews, Krzysztof; Różycka, Agata; Seremak-Mrozikiewicz, Agnieszka; Ożarowski, Marcin; Klejewski, Andrzej; Czerny, Bogusław; Wolski, Hubert

    2016-01-01

    Recurrent miscarriage (RM) is one of the most common obstetric complications. Numerous studies have suggested that genetic variants leading to an impaired balance between coagulation and fibrinolysis may contribute to elevated risk of pregnancy loss. The aim of the study was to investigate a possible association between angiotensin-converting enzyme (ACE, rs1799752) I/D and plasminogen activator inhibitor type 1 (PAI-1, rs1799768) 4G/5G polymorphisms with RM among Polish women. DNA was extracted from peripheral blood samples of 152 women with a history of ≥ 2 consecutive pregnancy losses before 22 weeks of gestation, and 180 healthy controls with at least 1 live birth at term and no history of pregnancy loss. Polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) were used to identify the polymorphisms. No statistically significant differences were found in genotype and allele frequencies of the studied polymorphisms. The most relevant difference between the study group and controls was found for the ID genotype distribution of the ACE gene (52.6 vs. 46.7%, OR = 1.27, p = 0.28). The analysis of genotype coexistence revealed a higher incidence of the combination of the ACE II and the PAI-1 4G/4G genotypes in the control group (10.0 vs.5.9% in control group; p = 0.17). The obtained results suggest no apparent association between the ACE I/D, PAI-1 4G/5G polymorphisms and increased RM susceptibility in the analyzed Polish population.

  7. Enhanced HIV-1 neutralization by a CD4-VH3-IgG1 fusion protein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Meyuhas, Ronit; Noy, Hava; Fishman, Sigal

    2009-08-21

    HIV-1 gp120 is an alleged B cell superantigen, binding certain VH3+ human antibodies. We reasoned that a CD4-VH3 fusion protein could possess higher affinity for gp120 and improved HIV-1 inhibitory capacity. To test this we produced several human IgG1 immunoligands harboring VH3. Unlike VH3-IgG1 or VH3-CD4-IgG1, CD4-VH3-IgG1 bound gp120 considerably stronger than CD4-IgG1. CD4-VH3-IgG1 exhibited {approx}1.5-2.5-fold increase in neutralization of two T-cell laboratory-adapted strains when compared to CD4-IgG1. CD4-VH3-IgG1 improved neutralization of 7/10 clade B primary isolates or pseudoviruses, exceeding 20-fold for JR-FL and 13-fold for Ba-L. It enhanced neutralization of 4/8 clade C viruses, and had negligible effect onmore » 1/4 clade A pseudoviruses. We attribute this improvement to possible pairing of VH3 with CD4 D1 and stabilization of an Ig Fv-like structure, rather than to superantigen interactions. These novel findings support the current notion that CD4 fusion proteins can act as better HIV-1 entry inhibitors with potential clinical implications.« less

  8. The Vaporization of B2O3(l) to B2O3(g) and B2O2(g)

    NASA Technical Reports Server (NTRS)

    Jacobson, Nathan S.; Myers, Dwight L.

    2011-01-01

    The vaporization of B2O3 in a reducing environment leads to formation of both B2O3(g) and B2O2(g). While formation of B2O3(g) is well understood, many questions about the formation of B2O2(g) remain. Previous studies using B(s) + B2O3(l) have led to inconsistent thermodynamic data. In this study, it was found that after heating, B(s) and B2O3(l) appear to separate and variations in contact area likely led to the inconsistent vapor pressures of B2O2(g). To circumvent this problem, an activity of boron is fixed with a two-phase mixture of FeB and Fe2B. Both second and third law enthalpies of formation were measured for B2O2(g) and B2O3(g). From these the enthalpies of formation at 298.15 K are calculated to be -479.9 +/- 41.5 kJ/mol for B2O2(g) and -833.4 +/- 13.1 kJ/mol for B2O3(g). Ab initio calculations to determine the enthalpies of formation of B2O2(g) and B2O3(g) were conducted using the W1BD composite method and show good agreement with the experimental values.

  9. Whole-genome analyses of DS-1-like human G2P[4] and G8P[4] rotavirus strains from Eastern, Western and Southern Africa

    PubMed Central

    Nyaga, Martin M.; Stucker, Karla M.; Esona, Mathew D.; Jere, Khuzwayo C.; Mwinyi, Bakari; Shonhai, Annie; Tsolenyanu, Enyonam; Mulindwa, Augustine; Chibumbya, Julia N.; Adolfine, Hokororo; Halpin, Rebecca A.; Roy, Sunando; Stockwell, Timothy B.; Berejena, Chipo; Seheri, Mapaseka L.; Mwenda, Jason M.; Steele, A. Duncan; Wentworth, David E.

    2018-01-01

    Group A rotaviruses (RVAs) with distinct G and P genotype combinations have been reported globally. We report the genome composition and possible origin of seven G8P[4] and five G2P[4] human RVA strains based on the genetic evolution of all 11 genome segments at the nucleotide level. Twelve RVA ELISA positive stool samples collected in the representative countries of Eastern, Southern and West Africa during the 2007–2012 surveillance seasons were subjected to sequencing using the Ion Torrent PGM and Illumina MiSeq platforms. A reference-based assembly was performed using CLC Bio’s clc_ref_assemble_long program, and full-genome consensus sequences were obtained. With the exception of the neutralising antigen, VP7, all study strains exhibited the DS-1-like genome constellation (P[4]-I2-R2-C2-M2-A2-N2-T2-E2-H2) and clustered phylogenetically with reference strains having a DS-1-like genetic backbone. Comparison of the nucleotide and amino acid sequences with selected global cognate genome segments revealed nucleotide and amino acid sequence identities of 81.7–100 % and 90.6–100 %, respectively, with NSP4 gene segment showing the most diversity among the strains. Bayesian analyses of all gene sequences to estimate the time of divergence of the lineage indicated that divergence times ranged from 16 to 44 years, except for the NSP4 gene where the lineage seemed to arise in the more distant past at an estimated 203 years ago. However, the long-term effects of changes found within the NSP4 genome segment should be further explored, and thus we recommend continued whole-genome analyses from larger sample sets to determine the evolutionary mechanisms of the DS-1-like strains collected in Africa. PMID:24952422

  10. IgG4 subclass antibodies impair antitumor immunity in melanoma

    PubMed Central

    Karagiannis, Panagiotis; Gilbert, Amy E.; Josephs, Debra H.; Ali, Niwa; Dodev, Tihomir; Saul, Louise; Correa, Isabel; Roberts, Luke; Beddowes, Emma; Koers, Alexander; Hobbs, Carl; Ferreira, Silvia; Geh, Jenny L.C.; Healy, Ciaran; Harries, Mark; Acland, Katharine M.; Blower, Philip J.; Mitchell, Tracey; Fear, David J.; Spicer, James F.; Lacy, Katie E.; Nestle, Frank O.; Karagiannis, Sophia N.

    2013-01-01

    Host-induced antibodies and their contributions to cancer inflammation are largely unexplored. IgG4 subclass antibodies are present in IL-10–driven Th2 immune responses in some inflammatory conditions. Since Th2-biased inflammation is a hallmark of tumor microenvironments, we investigated the presence and functional implications of IgG4 in malignant melanoma. Consistent with Th2 inflammation, CD22+ B cells and IgG4+-infiltrating cells accumulated in tumors, and IL-10, IL-4, and tumor-reactive IgG4 were expressed in situ. When compared with B cells from patient lymph nodes and blood, tumor-associated B cells were polarized to produce IgG4. Secreted B cells increased VEGF and IgG4, and tumor cells enhanced IL-10 secretion in cocultures. Unlike IgG1, an engineered tumor antigen-specific IgG4 was ineffective in triggering effector cell–mediated tumor killing in vitro. Antigen-specific and nonspecific IgG4 inhibited IgG1-mediated tumoricidal functions. IgG4 blockade was mediated through reduction of FcγRI activation. Additionally, IgG4 significantly impaired the potency of tumoricidal IgG1 in a human melanoma xenograft mouse model. Furthermore, serum IgG4 was inversely correlated with patient survival. These findings suggest that IgG4 promoted by tumor-induced Th2-biased inflammation may restrict effector cell functions against tumors, providing a previously unexplored aspect of tumor-induced immune escape and a basis for biomarker development and patient-specific therapeutic approaches. PMID:23454746

  11. Association of G894T eNOS, 4G/5G PAI and T1131C APOA5 polymorphisms with susceptibility to myocardial infarction in Morocco.

    PubMed

    Hassani Idrissi, Hind; Hmimech, Wiam; Diakite, Brehima; Korchi, Farah; Baghdadi, Dalila; Habbal, Rachida; Nadifi, Sellama

    2016-09-01

    Myocardial infarction (MI) is a common multifactorial disease. Numerous studies have found that genetic plays an essential role in MI occurrence. The main objective of our case-control study is to explore the association of G894T eNOS (rs1799983), 4G/5G PAI (rs1799889) and T1131C APOA5 (rs662799) polymorphisms with MI susceptibility in the Moroccan population. 118 MI patients were recruited vs 184 healthy controls. DNA samples were genotyped by PCR-RFLP method using MboI, BslI and MseI restriction enzymes respectively for the G894T eNOS, 4G/5G PAI and T1131C APOA5 polymorphisms. Our results show that the G894T eNOS was significantly associated with increased risk of MI under the three genetic transmission models (dominant: OR = 1.64, 95% CI = 1.05-2.58, P = 0.003; recessive: OR = 2.15, 95% CI = 0.74-6.16, P = 0.03; additive: OR = 1.54, 95% CI = 1.06-2.23, P = 0.001). The T1131C APOA5 polymorphism was associated to MI risk in recessive and additive models (OR = 1.53, 95% CI = 0.72-3.2, P = 0.04 and OR = 1.78, 95% CI = 1.26-2.51, P = 0.03 respectively). For the 4G/5G PAI variant, even the cases and controls groups were not in Hardy-Weinberg Equilibrium (HWE), the dominant and additive models show a statistically significant association with MI risk (OR = 7.96, 95%CI = 3.83-16.36, P = 0.01 and OR = 1.96, 95% CI = 1.4-2.72, P = 0.03 respectively). Our results suggest that G894T eNOS and T1131C APOA5 polymorphisms may be considered as genetic markers of MI among the Moroccan population. Further studies including larger sample sizes and exploring more genetic associations are needed to confirm our results and to better understand the susceptibility to MI.

  12. Seizures and Encephalitis in Myelin Oligodendrocyte Glycoprotein IgG Disease vs Aquaporin 4 IgG Disease.

    PubMed

    Hamid, Shahd H M; Whittam, Dan; Saviour, Mariyam; Alorainy, Amal; Mutch, Kerry; Linaker, Samantha; Solomon, Tom; Bhojak, Maneesh; Woodhall, Mark; Waters, Patrick; Appleton, Richard; Duddy, Martin; Jacob, Anu

    2018-01-01

    Antibodies to myelin oligodendrocyte glycoprotein IgG (MOG-IgG) are increasingly detected in patients with non-multiple sclerosis-related demyelination, some of whom manifest a neuromyelitis optica (NMO) phenotype. Cortical involvement, encephalopathy, and seizures are rare in aquaporin 4 antibody (AQP4-IgG)-related NMO in the white European population. However, the authors encountered several patients with seizures associated with MOG-IgG disease. To compare incidence of seizures and encephalitis-like presentation, or both between AQP4-IgG-positive and MOG-IgG-positive patients. Retrospective case series of all patients who were seropositive for MOG-IgG (n = 34) and the last 100 patients with AQP4-IgG disease (NMO spectrum disorder) seen in the NMO service between January 2013 and December 2016, and analysis was completed January 4, 2017. All patients were seen in a tertiary neurological center, The Walton Centre NHS Foundation Trust in Liverpool, England. The difference in seizure frequency between the AQP4-IgG-positive and MOG-IgG-positive patient groups was determined. Thirty-four patients with MOG-IgG disease (20 female) with a median age at analysis of 30.5 years (interquartile range [IQR], 15-69 years), and 100 AQP4-IgG-positive patients (86 female) with a median age at analysis of 54 years (IQR, 12-91 years) were studied. Most patients were of white race. Five of the 34 patients with MOG-IgG (14.7%) had seizures compared with 1 patient with AQP4-IgG (2-sided P < .008, Fisher test). On magnetic resonance imaging, all 5 MOG-IgG-positive patients had inflammatory cortical brain lesions associated with the seizures. In 3 of the 5 MOG-IgG-positive patients, seizures occurred as part of the index event. Four of the 5 presented with encephalopathy and seizures, and disease relapsed in all 5 patients. Four of these patients were receiving immunosuppressant medication at last follow-up, and 3 continued to take antiepileptic medication. In contrast, the only

  13. Liposomal gD Ectodomain (gD1-306) Vaccine Protects Against HSV2 Genital or Rectal Infection of Female and Male Mice

    PubMed Central

    Olson, K.; Macias, P.; Hutton, S.; Ernst, W. A.; Fujii, G.; Adler-Moore, J. P.

    2009-01-01

    Herpes simplex virus type 2 (HSV2) is the most common causative agent of genital herpes, with infection rates as high as 1 in 6 adults. The present studies were done to evaluate the efficacy of a liposomal HSV2 gD1-306 vaccine (L-gD1-306-HD) in an acute murine HSV2 infection model of intravaginal (female) or intrarectal (male or female) challenge. Two doses of L-gD1-306-HD containing 60μg gD1-306-HD and 15μg monophosphoryl lipid A (MPL) per dose provided protection against HSV2 intravaginal challenge (86-100% survival, P≤0.0003 vs control liposomes; P=0.06 vs L-gD1-306-HD without MPL). Both male and female mice (BALB/c and C57BL/6) immunized with L-gD1-306-HD/MPL were significantly protected against HSV2 intrarectal challenge, with higher survival rates compared to controls (71-100%, P≤0.007). L-gD1-306-HD/MPL also provided increased survival when compared to a liposomal peptide vaccine, L-gD264-285-HD/MPL (male BALB/c, P≤0.001; female BALB/c and male C57BL/6, P=0.06). Mice given L-gD1-306-HD/MPL also had minimal disease signs, reduced viral burden in their spinal cords and elevated neutralizing antibody titers in the females. The vaccine also stimulated gD1-306-HD specific splenocytes of both male and female mice with significantly elevated levels of IFN-γ compared to IL-4 (P≤0.01) indicating that there was an enhanced Th1 response. These results provide the first evidence that the L-gD1-306–HD vaccine can protect both male and female mice against intrarectal HSV2 challenge. PMID:19835825

  14. 4G/5G plasminogen activator inhibitor-1 and -308 A/G tumor necrosis factor-α promoter gene polymorphisms in Argentinean lupus patients: focus on lupus nephritis.

    PubMed

    Muñoz, Sebastián Andrés; Aranda, Federico; Allievi, Alberto; Orden, Alberto Omar; Perés Wingeyer, Silvia; Trobo, Rosana; Alvarez, Analía; Eimon, Alicia; Barreira, Juan Carlos; Schneeberger, Emilce; Dal Pra, Fernando; Sarano, Judith; Hofman, Julio; Chamorro, Julián; de Larrañaga, Gabriela

    2014-02-01

    We investigated the relationship between the 4G/5G plasminogen activator inhibitor (PAI-1) and -308 A/G tumor necrosis factor-α (TNF-α) polymorphisms and the clinical and biochemical features of systemic lupus erythematosus (SLE) in an Argentinean patient cohort. A total of 402 patients were studied, including 179 SLE patients and 223 healthy individuals. PCR-RLFP was used to determine the genotypes of the 4G/5G PAI-1 and -308 A/G TNF-α polymorphisms. SLE patients with lupus nephritis (LN) (n = 86) were compared with patients without LN (n = 93). Additionally, LN patients were divided into proliferative LN and non-proliferative LN groups according to the results of the renal biopsies. No significant differences were noted in the genotype distributions or allele frequencies of these TNF-α and PAI-1 polymorphisms between SLE patients and controls. There were higher numbers of criteria for SLE, more lupus flares and higher damage scores in LN patients, but there were similar frequencies of anti-phospholipid antibody (APA) positivity and anti-phospholipid syndrome. No significant difference was noted for any studied variable between the proliferative LN and non-proliferative LN groups except for the presence of APA. We found no significant differences in the TNF-α and PAI-1 genotype distributions or allele frequencies between groups. We found that the -308 A/G TNF-α and 4G/5G PAI-1 polymorphisms are not associated with susceptibility to SLE in an Argentinean population. We also did not find any association between the presence of any specific allele or genotype and the development of LN in SLE patients. Finally, no association was noted between either of the two polymorphisms and the severity of renal disease.

  15. The binding efficiency of RPA to telomeric G-strands folded into contiguous G-quadruplexes is independent of the number of G4 units.

    PubMed

    Lancrey, Astrid; Safa, Layal; Chatain, Jean; Delagoutte, Emmanuelle; Riou, Jean-François; Alberti, Patrizia; Saintomé, Carole

    2018-03-01

    Replication protein A (RPA) is a single-stranded DNA binding protein involved in replication and in telomere maintenance. During telomere replication, G-quadruplexes (G4) can accumulate on the lagging strand template and need to be resolved. It has been shown that human RPA is able to unfold a single G4. Nevertheless, the G-strand of human telomeres is prone to fold into higher-order structures formed by contiguous G-quadruplexes. To understand how RPA deals with these structures, we studied its interaction with telomeric G-strands folding into an increasing number of contiguous G4s. The aim of this study was to determine whether the efficiency of binding/unfolding of hRPA to telomeric G-strands depends on the number of G4 units. Our data show that the number n of contiguous G4 units (n ≥ 2) does not affect the efficiency of hRPA to coat transiently exposed single-stranded telomeric G-strands. This feature may be essential in preventing instability due to G4 structures during telomere replication. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  16. Determination of O2(a1 delta g) and O2(b1 sigma+ g) yields in the reaction O + ClO --> Cl + O2: implications for photochemistry in the atmosphere of Venus

    NASA Technical Reports Server (NTRS)

    Leu, M. T.; Yung, Y. L.

    1987-01-01

    A discharge flow apparatus with chemiluminescence detector has been used to study the reaction O + ClO --> Cl + O2, where O2 = O2(a1 delta g) or O2(b1 sigma+ g). The measured quantum yields for producing O2(a1 delta g) and O2(b1 sigma+ g) in the above reaction are less than 2.5 x 10(-2) and equal to (4.4 +/- 1.1) x 10(-4), respectively. The observed O2(a1 delta g) airglow of Venus cannot be explained in the context of standard photochemistry using our experimental results and those reported in recent literature. The possibility of an alternative source of O atoms derived from SO2 photolysis in the mesosphere of Venus is suggested.

  17. Four-Quadrant Analog Multipliers Using G4-FETs

    NASA Technical Reports Server (NTRS)

    Mojarradi, Mohammad; Blalock, Benjamin; Christoloveanu, Sorin; Chen, Suheng; Akarvardar, Kerem

    2006-01-01

    Theoretical analysis and some experiments have shown that the silicon-on-insulator (SOI) 4-gate transistors known as G4-FETs can be used as building blocks of four-quadrant analog voltage multiplier circuits. Whereas a typical prior analog voltage multiplier contains between six and 10 transistors, it is possible to construct a superior voltage multiplier using only four G4-FETs. A G4-FET is a combination of a junction field-effect transistor (JFET) and a metal oxide/semiconductor field-effect transistor (MOSFET). It can be regarded as a single transistor having four gates, which are parts of a structure that affords high functionality by enabling the utilization of independently biased multiple inputs. The structure of a G4-FET of the type of interest here (see Figure 1) is that of a partially-depleted SOI MOSFET with two independent body contacts, one on each side of the channel. The drain current comprises of majority charge carriers flowing from one body contact to the other that is, what would otherwise be the side body contacts of the SOI MOSFET are used here as the end contacts [the drain (D) and the source (S)] of the G4-FET. What would otherwise be the source and drain of the SOI MOSFET serve, in the G4-FET, as two junction-based extra gates (JG1 and JG2), which are used to squeeze the channel via reverse-biased junctions as in a JFET. The G4-FET also includes a polysilicon top gate (G1), which plays the same role as does the gate in an accumulation-mode MOSFET. The substrate emulates a fourth MOS gate (G2). By making proper choices of G4-FET device parameters in conjunction with bias voltages and currents, one can design a circuit in which two input gate voltages (Vin1,Vin2) control the conduction characteristics of G4-FETs such that the output voltage (Vout) closely approximates a value proportional to the product of the input voltages. Figure 2 depicts two such analog multiplier circuits. In each circuit, there is the following: The input and output

  18. Possible Role of HLA-G, LILRB1 and KIR2DL4 Gene Polymorphisms in Spontaneous Miscarriage.

    PubMed

    Nowak, Izabela; Malinowski, Andrzej; Barcz, Ewa; Wilczyński, Jacek R; Wagner, Marta; Majorczyk, Edyta; Motak-Pochrzęst, Hanna; Banasik, Małgorzata; Kuśnierczyk, Piotr

    2016-12-01

    The KIR2DL4 receptor and its ligand HLA-G are considered important for fetal-maternal immune tolerance and successful pregnancy. The absence of a particular variant of KIR2DL4 might be a bad prognostic factor for pregnancy outcome. However, it could be compensated by the presence of the respective LILRB1 allele. Therefore, we investigated the KIR2DL4, LILRB1 and HLA-G polymorphisms in 277 couples with spontaneous abortion and 219 control couples by HRM, PCR-SSP and RFLP methods. We found a protective effect of women's heterozygosity in -716 HLA-G (p = 0.0206) and LILRB1 (p = 0.0131) against spontaneous abortion. Surprisingly, we observed more 9A/10A genotypes of KIR2DL4 gene carriers in the group of male partners from the miscarriage group in comparison to the men from the control group (p = 0.0288). Furthermore, there was no association of women's KIR2DL4 polymorphism with susceptibility to spontaneous abortion. Multivariate analysis indicated that women's -716 HLA-G and LILRB1 and men's KIR2DL4 9A/10A are important in terms of the protection or susceptibility to miscarriage, respectively (p = 0.00968). In conclusion, a woman's heterozygosity in HLA-G and LILRB1 might be an advantage for a success of reproduction, but the partner's heterozygosity in 9A/10A KIR2DL4 alleles might not.

  19. The association between plasminogen activator inhibitor type 1 (PAI-1) levels, PAI-1 4G/5G polymorphism, and myocardial infarction: a Mendelian randomization meta-analysis.

    PubMed

    Nikolopoulos, Georgios K; Bagos, Pantelis G; Tsangaris, Iraklis; Tsiara, Chrissa G; Kopterides, Petros; Vaiopoulos, Aristides; Kapsimali, Violetta; Bonovas, Stefanos; Tsantes, Argirios E

    2014-07-01

    The circulating levels of plasminogen activator inhibitor type 1 (PAI-1) are increased in individuals carrying the 4G allele at position -675 of the PAI-1 gene. In turn, overexpression of PAI-1 has been found to affect both atheroma and thrombosis. However, the association between PAI-1 levels and the incidence of myocardial infarction (MI) is complicated by the potentially confounding effects of well-known cardiovascular risk factors. The current study tried to investigate in parallel the association of PAI-1 activity with the PAI-1 4G/5G polymorphism, with MI, and some components of metabolic syndrome (MetS). Using meta-analytical Mendelian randomization approaches, genotype-disease and genotype-phenotype associations were modeled simultaneously. According to an additive model of inheritance and the Mendelian randomization approach, the MI-related odd ratio for individuals carrying the 4G allele was 1.088 with 95% confidence interval (CI) 1.007, 1.175. Moreover, the 4G carriers had, on average, higher PAI-1 activity than 5G carriers by 1.136 units (95% CI 0.738, 1.533). The meta-regression analyses showed that the levels of triglycerides (p=0.005), cholesterol (p=0.037) and PAI-1 (p=0.021) in controls were associated with the MI risk conferred by the 4G carriers. The Mendelian randomization meta-analysis confirmed previous knowledge that the PAI-1 4G allele slightly increases the risk for MI. In addition, it supports the notion that PAI-1 activity and established cardiovascular determinants, such as cholesterol and triglyceride levels, could lie in the etiological pathway from PAI-1 4G allele to the occurrence of MI. Further research is warranted to elucidate these interactions.

  20. Riedel's thyroiditis association with IgG4-related disease.

    PubMed

    Stan, Marius N; Sonawane, Vikram; Sebo, Thomas J; Thapa, Prabin; Bahn, Rebecca S

    2017-03-01

    IgG4-positive (+) plasma cells have been reported in both Riedel's thyroiditis (RT) and Hashimoto's thyroiditis (HT). These cells are the hallmark of IgG4-related disease (IgG4-RD). We sought to determine whether RT is part of IgG4-RD spectrum. This was a case-control study performed at a tertiary medical centre. We included RT cases from the period 1958 to 2008 that had sufficient paraffin-embedded tissue for IgG4 immunostaining. Controls were patients with HT, age and gender matched, with similar pathology criteria. The main outcome measures were the intensity of the IgG4 staining and the clinical and histological correlates with IgG4-RD. Six pairs of RT and HT were analysed. The mean age was 44·7 years. In both groups, 5/6 cases had positive IgG4 staining. The mean number of IgG4 + cells/ HPF, normalized to the degree of inflammation, was 3·2 ± 3·0 SD (RT) vs 0·9 ± 0·7 (HT), P = 0·15, for fibrotic areas and 2·1 ± 2·3 SD vs 1·0 ± 0·8 (P = 0·39) for areas with lymphoid aggregates. We found the number of IgG4 +  cells in RT to be inversely correlated with the duration of disease (P = 0·046). Three RT cases had associated comorbidities from the IgG4-RD spectrum while none of the HT cases had such conditions. Riedel's thyroiditis is a component of IgG4-RD with the density of the IgG4 +  lymphocytic infiltrate being time dependent. In this small study, we did not identify differences in IgG4 infiltration between RT and HT, minimizing the utility of this marker in RT diagnosis. © 2016 John Wiley & Sons Ltd.

  1. Unconventionally prepared TiO2/g-C3N4 photocatalysts for photocatalytic decomposition of nitrous oxide

    NASA Astrophysics Data System (ADS)

    Troppová, Ivana; Šihor, Marcel; Reli, Martin; Ritz, Michal; Praus, Petr; Kočí, Kamila

    2018-02-01

    The TiO2/g-C3N4 nanocomposites with the various TiO2:g-C3N4 weight ratios from 1:1 to 1:3 were prepared unconventionally by pressurized hot water processing in a flow regime. The parent TiO2 and g-C3N4 was prepared by thermal hydrolysis and thermal annealing, respectively. The nanocomposites as well as parent TiO2 and g-C3N4 were characterized using several complementary characterization methods and investigated in the photocatalytic decomposition of N2O under UVA (λ = 365 nm) irradiation. All the prepared TiO2/g-C3N4 nanocomposites showed higher photocatalytic activity in comparison with the pure g-C3N4 and chiefly pure TiO2. The photocatalytic activity of TiO2/g-C3N4 nanocomposites was decreasing in the following sequence: TiO2/g-C3N4 (1:3) > TiO2/g-C3N4 (1:2) > TiO2/g-C3N4 (1:1). In comparison with the parent TiO2 or g-C3N4, the TiO2/g-C3N4 nanocomposites' photocatalytic capability was significantly enhanced by coupling TiO2 with g-C3N4. The generation of TiO2/g-C3N4 Z-scheme photocatalyst mainly benefited from the effective separation of photoinduced electron-hole pairs and the extended optical absorption range. The TiO2/g-C3N4 (1:3) nanocomposite showed the best photocatalytic behavior in a consequence of the optimal weight ratio of TiO2:g-C3N4 and the lowest band gap energy from all nanocomposites. The N2O conversion in its presence was 70.6% after 20 h of UVA irradiation.

  2. Loss of G2 subunit of vacuolar-type proton transporting ATPase leads to G1 subunit upregulation in the brain

    PubMed Central

    Kawamura, Nobuyuki; Sun-Wada, Ge-Hong; Wada, Yoh

    2015-01-01

    Vacuolar-type ATPase (V-ATPase) is a primary proton pump with versatile functions in various tissues. In nerve cells, V-ATPase is required for accumulation of neurotransmitters into secretory vesicles and subsequent release at the synapse. Neurons express a specific isoform (G2) of the G subunit of V-ATPase constituting the catalytic sector of the enzyme complex. Using gene targeting, we generated a mouse lacking functional G2 (G2 null), which showed no apparent disorders in architecture and behavior. In the G2-null mouse brain, a G1 subunit isoform, which is ubiquitously expressed in neuronal and non-neuronal tissues, accumulated more abundantly than in wild-type animals. This G1 upregulation was not accompanied by an increase in mRNA. These results indicate that loss of function of neuron-specific G2 isoform was compensated by an increase in levels of the G1 isoform without apparent upregulation of the G1 mRNA. PMID:26353914

  3. Liposomal gD ectodomain (gD1-306) vaccine protects against HSV2 genital or rectal infection of female and male mice.

    PubMed

    Olson, K; Macias, P; Hutton, S; Ernst, W A; Fujii, G; Adler-Moore, J P

    2009-12-11

    Herpes simplex virus type 2 (HSV2) is the most common causative agent of genital herpes, with infection rates as high as 1 in 6 adults. The present studies were done to evaluate the efficacy of a liposomal HSV2 gD(1-306) vaccine (L-gD(1-306)-HD) in an acute murine HSV2 infection model of intravaginal (female) or intrarectal (male or female) challenge. Two doses of L-gD(1-306)-HD containing 60 microg gD(1-306)-HD and 15 microg monophosphoryl lipid A (MPL) per dose provided protection against HSV2 intravaginal challenge (86-100% survival, P< or =0.0003 vs. control liposomes; P=0.06 vs. L-gD(1-306)-HD without MPL). Both male and female mice (BALB/c and C57BL/6) immunized with L-gD(1-306)-HD/MPL were significantly protected against HSV2 intrarectal challenge, with higher survival rates compared to controls (71-100%, P< or =0.007). L-gD(1-306)-HD/MPL also provided increased survival when compared to a liposomal peptide vaccine, L-gD(264-285)-HD/MPL (male BALB/c, PgD(1-306)-HD/MPL also had minimal disease signs, reduced viral burden in their spinal cords and elevated neutralizing antibody titers in the females. The vaccine also stimulated gD(1-306)-HD specific splenocytes of both male and female mice with significantly elevated levels of IFN-gamma compared to IL-4 (P< or =0.01) indicating that there was an enhanced Th1 response. These results provide the first evidence that the L-gD(1-306)-HD vaccine can protect both male and female mice against intrarectal HSV2 challenge.

  4. On the origin of the system PSR B 1757-24/SNR G 5.4-1.2

    NASA Astrophysics Data System (ADS)

    Gvaramadze, V. V.

    2004-03-01

    A scenario for the origin of the system PSR B 1757-24/supernova remnant (SNR) G 5.4-1.2 is proposed. It is suggested that both objects are the remnants of a supernova (SN) that exploded within a pre-existing bubble blown-up by a runaway massive star (the SN progenitor) during the final (Wolf-Rayet) phase of its evolution. This suggestion implies that (a) the SN blast centre was significantly offset from the geometric centre of the wind-blown bubble (i.e. from the centre of the future SNR), (b) the bubble was surrounded by a massive wind-driven shell, and (c) the SN blast wave was drastically decelerated by the interaction with the shell. Therefore, one can understand how the relatively young and low-velocity pulsar PSR B 1757-24 was able to escape from the associated SNR G 5.4-1.2 and why the inferred vector of pulsar transverse velocity does not point away from the geometric centre of the SNR. A possible origin of the radio source G 5.27-0.9 (located between PSR B 1757-24 and the SNR G 5.4-1.2) is proposed. It is suggested that G 5.27-0.9 is a lobe of a low Mach number (≃1.7) jet of gas outflowing from the interior of G 5.4-1.2 through the hole bored in the SNR's shell by the escaping pulsar. It is also suggested that the non-thermal emission of the comet-shaped pulsar wind nebula originates in the vicinity of the termination shock and in the cylindric region of subsonically moving shocked pulsar wind. The role of magnetized wind-driven shells (swept-up during the Wolf-Rayet phase from the ambient interstellar medium with the regular magnetic field) in formation of elongated axisymmetric SNRs is discussed.

  5. Polymorphism 4G/5G of the plasminogen activator inhibitor 1 gene as a risk factor for the development of allergic rhinitis symptoms in patients with asthma.

    PubMed

    Lampalo, Marina; Jukic, Irena; Bingulac-Popovic, Jasna; Marunica, Ivona; Petlevski, Roberta; Pavlisa, Gordana; Popovic-Grle, Sanja

    2017-06-01

    Plasminogen activator inhibitor-1 (PAI-1) is a glycoprotein which has a role in tissue remodelling after inflammatory processes. The objective is to investigate the frequency of PAI-1 gene polymorphism (4G/5G) in patients with a lung ventilation dysfunction in asthma and allergic rhinitis. Genomic DNA was isolated and genotypes of polymorphism of PAI-1 4G/5G and ABO were determined using the methods of RT-PCR and PCR-SSP. Study group includes 145 adult patients diagnosed with chronic asthma, with all clinically relevant parameters and the laboratory markers of pO 2 , IgE and eosinophils in sputum and nasal swab. In the processing of data, appropriate statistical tests (Kolmogorov-Smirnov test, median, interquartile ranges, χ 2 and Mann-Whitney U tests) were used. Patients with symptoms of allergic rhinitis were significantly younger and had an almost four time higher levels of IgE (P = 0.001), higher pO 2 (P = 0.002) and PEF (P = 0.036), compared to those who do not have these symptoms. Genotype PAI 4G/4G is significantly more common in patients with allergic rhinitis (28.1% vs. 16.1%; P = 0.017) compared to the genotype 5G/5G. Carriers of the genotype 4G/5G also have a borderline statistical significance. There were no statistically significant difference in the incidence of allergic rhinitis in the carriers of any ABO genotypes. The frequency of PAI genotype 4G/4G is significantly more common in patients with allergic rhinitis. The results suggest that the carriers of at least one 4G allele are at a higher risk for developing symptoms of allergic rhinitis in asthma.

  6. Placental Malaria Induces Variant-Specific Antibodies of the Cytophilic Subtypes Immunoglobulin G1 (IgG1) and IgG3 That Correlate with Adhesion Inhibitory Activity

    PubMed Central

    Elliott, Salenna R.; Brennan, Amy K.; Beeson, James G.; Tadesse, Eyob; Molyneux, Malcolm E.; Brown, Graham V.; Rogerson, Stephen J.

    2005-01-01

    Antibodies targeting variant antigens on the surfaces of chondroitin sulfate A (CSA)-binding malaria-infected erythrocytes have been linked to protection against the complications of malaria in pregnancy. We examined the isotype/subtype profiles of antibodies that bound to variant surface antigens expressed by CSA-adherent Plasmodium falciparum in pregnant Malawian women with and without histologically defined placental malaria. Women in their first pregnancy with placental malaria produced significantly greater amounts of immunoglobulin G1 (IgG1) and IgG3 reactive with surface antigens of malaria-infected erythrocytes than uninfected women of the same gravidity. IgG1 and IgG3 levels in infected and control women in later pregnancies were similar to those in infected women in their first pregnancy. Levels of IgG2 and IgG4 were similarly low in infected and uninfected women of all gravidities. IgM that bound to the surface of CSA-adherent P. falciparum occurred in all groups of women and malaria-naïve controls. There was a significant correlation between IgG1 and IgG3 levels, indicating that women usually produced both subtypes. Levels of IgG1 and IgG3 correlated with the ability of serum or plasma to inhibit parasite adhesion to CSA. Taken together, these data suggest that IgG1 and IgG3 dominate the IgG response to placental-type variant surface antigens. They may function by blocking parasite adhesion to placental CSA, but given their cytophilic nature, they might also opsonize malaria-infected erythrocytes for interaction with Fc receptors on phagocytic cells. PMID:16113309

  7. Comparison of efficacy of once daily multimatrix mesalazine 2.4 g/day and 4.8 g/day with other 5-aminosalicylic acid preparation in active ulcerative colitis: a randomized, double-blind study.

    PubMed

    Ogata, Haruhiko; Yokoyama, Tadashi; Mizushima, Seiichi; Hagino, Atsushi; Hibi, Toshifumi

    2018-04-01

    This study compared the efficacy of multimatrix mesalazine 2.4 g/day and 4.8 g/day with controlled-release mesalazine 2.25 g/day. In this multicenter, randomized, double-blind study, 251 patients with mildly to moderately active ulcerative colitis received multimatrix mesalazine 2.4 g/day once daily (Multimatrix-2.4), 4.8 g/day once daily (Multimatrix-4.8), or controlled-release (time-dependent) mesalazine 2.25 g/day 3 times daily (Time-2.25) for 8 weeks. The primary efficacy endpoint was the change in the ulcerative colitis-disease activity index (UC-DAI) score. The mean change in the UC-DAI score and standard deviation in the per protocol set was -1.9±2.5 for Multimatrix-2.4 and -2.4±2.8 for Time-2.25. The difference between Multimatrix-2.4 and Time-2.25 was 0.3 (two-sided 95% confidence interval [CI], -0.5 to 1.1), thus non-inferiority was not demonstrated based on the pre-defined non-inferiority margin (1.0). In the full analysis set, the difference between Multimatrix-4.8 and Time-2.25 was -1.2 (two-sided 95% CI, -2.0 to -0.5), and the mean change in UC-DAI score in the FAS was -3.3 (two-sided 95% CI, -3.9 to -2.8) for Multimatrix-4.8 and -1.9 (two-sided 95% CI, -2.5 to -1.3) for Multimatrix-2.4, indicating that Multimatrix-4.8 was more effective than Time-2.25 and Multimatrix-2.4. There was no difference among the treatment groups in terms of safety. This study showed that the efficacy of multimatrix mesalazine 2.4 g/day was comparable to controlled release mesalazine 2.25 g/day, although non-inferiority was not demonstrated. Importantly, this was the first study to indicate that multimatrix mesalazine 4.8 g/day was more effective than 2.4g/day with no associated safety concerns.

  8. [IgG4 immunohistochemistry in Riedle thyroiditis].

    PubMed

    Wang, S; Luo, Y F; Cao, J L; Zhang, H; Shi, X H; Liang, Z Y; Feng, R E

    2017-03-08

    Objective: To observe the histopathological changes and immunohistochemical expression of IgG4 in Riedle thyroiditis (RT) and to study the relationship between RT and IgG4-related diseases (IgG4-RD). Methods: A total of 5 RT patients were collected from the Department of Pathology, Peking Union Medical College Hospital during April 2012 to August 2014. The clinical and immunohistochemical features were analyzed in the 5 patients. Histopathologic analysis was performed on hematoxylin and eosin-stained sections. Results: There were one male and four female patients, aged 52 to 78 years (median 59 years). Five cases were characterized by multiple nodules of thyroid, which increased year by year. All patients were found to have surrounding tissue compression symptoms and signs. Two female patients were found to have hypothyroidism. The serum concentration of IgG was elevated in 2 cases, and the serum concentration of IgG was not tested before operation in the remaining patients. By ultrasound, all presented as low echo or medium low echo. Strong echo occasionally appeared in hypoechoic nodules. Microscopically, fibrous tissue hyperplasia was infiltrated with varying numbers of lymphocytes and plasma cells. The occlusion of phlebitis was found in 4 cases and eosinophils were found in 3 cases. IgG4 counts and IgG4/IgG ratios in 5 cases were 20/HPF, 16%; 60/HPF, 82%; 22/HPF, 28%; 400/HPF, 266% and 33/HPF, 71%, respectively. Conclusions: With the similar pathological manifestations between RT and IgG4-RD, immunohistochemical staining shows that the number of IgG4 positive plasma cells and IgG4/IgG ratio of RT are increased in varying degrees. Some cases meet the diagnostic criteria of IgG4-RD, and speculate that some cases of RT belong to IgG4-RD.

  9. Serum PAI-1 and PAI-1 4G/5G Polymorphism in Hepatitis C Virus-Induced Cirrhosis and Hepatitis C Virus-Induced Hepatocellular Carcinoma Patients.

    PubMed

    El Edel, Rawhia H; Essa, Enas Said; Essa, Abdallah S; Hegazy, Sara A; El Rowedy, Dalia I

    2016-11-01

    Association between variable agent-induced hepatocellular carcinoma (HCC) and both PAI-1 4G/5G polymorphism and plasminogen activator inhibitor (PAI-1) levels compared to healthy controls have been reported in earlier studies. We aimed to assess serum PAI-1 and PAI-1 4G/5G polymorphism in hepatitis C virus (HCV)-induced HCC, HCV-induced liver cirrhosis, and viral infection-free apparently healthy control subjects. Forty nine HCC, 52 cirrhosis, and 105 controls were genotyped for PAI-1 4G/5G using an allele-specific polymerase chain reaction analysis. In addition, for 31 HCC, 24 cirrhosis, and 28 controls, serum PAI-1 level was measured by enzyme-linked immunosorbent assay (ELISA). There was no significant difference in PAI-1 4G/5G genotype distribution between cirrhosis and controls (p = 0.33, p = 0.15, and p = 0.38 for the codominant, dominant, and recessive models, respectively) or between HCC and cirrhosis (p = 0.5, p = 0.24, and p = 0.69 for the codominant, dominant, and recessive models, respectively). Serum PAI-1 was significantly higher in cirrhosis than controls and significantly lower in HCC than cirrhosis (p < 0.001 for both). Serum PAI-1 did not differ significantly among the three PAI-1 4G/5G genotypes in controls, cirrhosis, and HCC (p = 0.29, p = 0.28, and p = 0.73 respectively). We documented higher serum PAI-1 in HCV-induced HCC than viral infection-free controls, but interestingly, lower than HCV-induced liver cirrhosis patients. This was not genotype related. Further studies will be needed to clearly elucidate the underlying mechanism.

  10. Photocatalytic decomposition of N2O over TiO2/g-C3N4 photocatalysts heterojunction

    NASA Astrophysics Data System (ADS)

    Kočí, K.; Reli, M.; Troppová, I.; Šihor, M.; Kupková, J.; Kustrowski, P.; Praus, P.

    2017-02-01

    TiO2/g-C3N4 photocatalysts with the various TiO2/g-C3N4 weight ratios from 1:2 to 1:6 were fabricated by mechanical mixing in water suspension followed by calcination. Pure TiO2 was prepared by thermal hydrolysis and pure g-C3N4 was prepared from commercial melamine by thermal annealing at 620 °C. All the nanocomposites were characterized by X-ray powder diffraction, UV-vis diffuse reflectance spectroscopy, Raman spectroscopy, infrared spectroscopy, scanning electron microscopy, transmission electron microscopy, photoelectrochemical measurements and nitrogen physisorption. The prepared mixtures along with pure TiO2 and g-C3N4 were tested for the photocatalytic decomposition of nitrous oxide under UVC (λ = 254 nm), UVA (λ = 365 nm) and Vis (λ > 400 nm) irradiation. The TiO2/g-C3N4 nanocomposites showed moderate improvement compared to pure g-C3N4 but pure TiO2 proved to be a better photocatalyst under UVC irradiation. However, under UVA irradiation conditions, the photocatalytic activity of TiO2/g-C3N4 (1:2) nanocomposite exhibited an increase compared to pure TiO2. Nevertheless, further increase of g-C3N4 amount leads/led to a decrease in reactivity. These results are suggesting the nanocomposite with the optimal weight ratio of TiO2 and g-C3N4 have shifted absorption edge energy towards longer wavelengths and decreased the recombination rate of charge carriers compared to pure g-C3N4. This is probably due to the generation of heterojunction on the TiO2/g-C3N4 interface.

  11. 4G/5G polymorphism of PAI-1 gene is associated with multiple organ dysfunction and septic shock in pneumonia induced severe sepsis: prospective, observational, genetic study

    PubMed Central

    2010-01-01

    Introduction Activation of inflammation and coagulation are closely related and mutually interdependent in sepsis. The acute-phase protein, plasminogen activator inhibitor-1 (PAI-1) is a key element in the inhibition of fibrinolysis. Elevated levels of PAI-1 have been related to worse outcome in pneumonia. We aimed to evaluate the effect of functionally relevant 4G/5G polymorphism of PAI-1 gene in pneumonia induced sepsis. Methods We enrolled 208 Caucasian patients with severe sepsis due to pneumonia admitted to an intensive care unit (ICU). Patients were followed up until ICU discharge or death. Clinical data were collected prospectively and the PAI-1 4G/5G polymorphism was genotyped by polymerase chain reaction-restriction fragment length polymorphism technique. Patients were stratified according to the occurrence of multiple organ dysfunction syndrome, septic shock or death. Results We found that carriers of the PAI-1 4G/4G and 4G/5G genotypes have a 2.74-fold higher risk for multiple organ dysfunction syndrome (odds ratio [OR] 95% confidence interval [CI] = 1.335 - 5.604; p = 0.006) and a 2.57-fold higher risk for septic shock (OR 95%CI = 1.180 - 5.615; p = 0.018) than 5G/5G carriers. The multivariate logistic regression analysis adjusted for independent predictors, such as age, nosocomial pneumonia and positive microbiological culture also supported that carriers of the 4G allele have a higher prevalence of multiple organ dysfunction syndrome (adjusted odds ratio [aOR] = 2.957; 95%CI = 1.306 -6.698; p = 0.009) and septic shock (aOR = 2.603; 95%CI = 1.137 - 5.959; p = 0.024). However, genotype and allele analyses have not shown any significant difference regarding mortality in models non-adjusted or adjusted for acute physiology and chronic health evaluation (APACHE) II. Patients bearing the 4G allele had higher disseminated intravascular coagulation (DIC) score at admission (p = 0.007) than 5G/5G carriers. Moreover, in 4G allele carriers the length of ICU stay

  12. 4G/5G polymorphism of PAI-1 gene is associated with multiple organ dysfunction and septic shock in pneumonia induced severe sepsis: prospective, observational, genetic study.

    PubMed

    Madách, Krisztina; Aladzsity, István; Szilágyi, Agnes; Fust, George; Gál, János; Pénzes, István; Prohászka, Zoltán

    2010-01-01

    Activation of inflammation and coagulation are closely related and mutually interdependent in sepsis. The acute-phase protein, plasminogen activator inhibitor-1 (PAI-1) is a key element in the inhibition of fibrinolysis. Elevated levels of PAI-1 have been related to worse outcome in pneumonia. We aimed to evaluate the effect of functionally relevant 4G/5G polymorphism of PAI-1 gene in pneumonia induced sepsis. We enrolled 208 Caucasian patients with severe sepsis due to pneumonia admitted to an intensive care unit (ICU). Patients were followed up until ICU discharge or death. Clinical data were collected prospectively and the PAI-1 4G/5G polymorphism was genotyped by polymerase chain reaction-restriction fragment length polymorphism technique. Patients were stratified according to the occurrence of multiple organ dysfunction syndrome, septic shock or death. We found that carriers of the PAI-1 4G/4G and 4G/5G genotypes have a 2.74-fold higher risk for multiple organ dysfunction syndrome (odds ratio [OR] 95% confidence interval [CI] = 1.335 - 5.604; p = 0.006) and a 2.57-fold higher risk for septic shock (OR 95%CI = 1.180 - 5.615; p = 0.018) than 5G/5G carriers. The multivariate logistic regression analysis adjusted for independent predictors, such as age, nosocomial pneumonia and positive microbiological culture also supported that carriers of the 4G allele have a higher prevalence of multiple organ dysfunction syndrome (adjusted odds ratio [aOR] = 2.957; 95%CI = 1.306 -6.698; p = 0.009) and septic shock (aOR = 2.603; 95%CI = 1.137 - 5.959; p = 0.024). However, genotype and allele analyses have not shown any significant difference regarding mortality in models non-adjusted or adjusted for acute physiology and chronic health evaluation (APACHE) II. Patients bearing the 4G allele had higher disseminated intravascular coagulation (DIC) score at admission (p = 0.007) than 5G/5G carriers. Moreover, in 4G allele carriers the length of ICU stay of non-survivors was longer

  13. Residual vein thrombosis and onset of post-thrombotic syndrome: influence of the 4G/5G polymorphism of plasminogen activator inhibitor-1 gene.

    PubMed

    Incalcaterra, Egle; Meli, Francesco; Muratori, Ida; Corrado, Egle; Amato, Corrado; Canino, Baldassare; Ferrara, Filippo

    2014-03-01

    Plasminogen activator inhibitor-1 (PAI-1) is the most important inhibitor of plasminogen activator. The functional 4G/5G polymorphism of the gene coding for PAI-1 may affect PAI-1 plasmatic activity, influencing the imbalance between coagulation and fibrinolysis cascades. In this prospective cohort analytic study, we investigated the role of this single nucleotide polymorphism in the persistence of thrombotic lesion and the occurrence of post-thrombotic syndrome. In a group of 168 patients with post-surgical deep vein thrombosis of the legs, we analyzed the 4G/5G polymorphism in the promoter of PAI-1 gene and plasmatic PAI-1 activity. Enrolled patients were divided in two groups: patients with 4G/5G polymorphism and increased PAI-1 activity (n=85) and patients without 4G/5G polymorphism and normal PAI-1 activity (n=83). All patients were treated according to current protocols and re-examined after 3, 12 and 36 months in order to evaluate the persistence of thrombotic lesion and the occurrence of post-thrombotic syndrome. We found a significantly increased PAI activity in carrier of the 4G allele, who experienced much more frequently a persistence of thrombosis after 3, 12 and 36 months and/or the development of post-thrombosis syndrome, in spite of the anticoagulant treatment. These data not only confirm the role played by PAI-1 activity and by the 4G/5G SNP of the PAI-1 gene, but also suggest that current therapeutic protocols, recommending the administration of low weight molecular heparin and oral anticoagulant for the treatment of deep vein thrombosis, could be non sufficient for patients genetically predisposed to a less efficient clot lysis. Copyright © 2013. Published by Elsevier Ltd.

  14. 4G/5G polymorphism of plasminogen activator inhibitor-1 gene is associated with polycystic ovary syndrome in Chinese patients: a meta-analysis.

    PubMed

    Wang, Li-Hong; Wang, Li-Mei; Zhou, Na

    2015-09-01

    To date, case-control studies on the association between a single-nucleotide polymorphism (SNP) in the plasminogen activator inhibitor-1 (PAI-1) gene and polycystic ovary syndrome (PCOS) have provided controversial results. The electronic databases PubMed, Embase, Web of Science, and CNKI (China National Knowledge Infrastructure) were searched for studies to include in the present meta-analysis. The fixed effects and random effects models showed that the 4G allele was associated with a risk of PCOS compared with the 5G allele in Chinese patients (OR = 2.05; 95 % CI = 1.56-2.69), but not in Caucasian patients (OR = 1.05; 95 % CI = 0.81-1.37). The contrast of homozygotes and the recessive and dominant models produced the same pattern of results as the allele contrast. Our pooled data suggest evidence for a major role of PAI-1 gene 4G/5G polymorphism in the pathogenesis of PCOS among Chinese patients.

  15. Comparison of efficacy of once daily multimatrix mesalazine 2.4 g/day and 4.8 g/day with other 5-aminosalicylic acid preparation in active ulcerative colitis: a randomized, double-blind study

    PubMed Central

    Yokoyama, Tadashi; Mizushima, Seiichi; Hagino, Atsushi; Hibi, Toshifumi

    2018-01-01

    Background/Aims This study compared the efficacy of multimatrix mesalazine 2.4 g/day and 4.8 g/day with controlled-release mesalazine 2.25 g/day. Methods In this multicenter, randomized, double-blind study, 251 patients with mildly to moderately active ulcerative colitis received multimatrix mesalazine 2.4 g/day once daily (Multimatrix-2.4), 4.8 g/day once daily (Multimatrix-4.8), or controlled-release (time-dependent) mesalazine 2.25 g/day 3 times daily (Time-2.25) for 8 weeks. The primary efficacy endpoint was the change in the ulcerative colitis-disease activity index (UC-DAI) score. Results The mean change in the UC-DAI score and standard deviation in the per protocol set was −1.9±2.5 for Multimatrix-2.4 and −2.4±2.8 for Time-2.25. The difference between Multimatrix-2.4 and Time-2.25 was 0.3 (two-sided 95% confidence interval [CI], −0.5 to 1.1), thus non-inferiority was not demonstrated based on the pre-defined non-inferiority margin (1.0). In the full analysis set, the difference between Multimatrix-4.8 and Time-2.25 was −1.2 (two-sided 95% CI, −2.0 to −0.5), and the mean change in UC-DAI score in the FAS was −3.3 (two-sided 95% CI, −3.9 to −2.8) for Multimatrix-4.8 and −1.9 (two-sided 95% CI, −2.5 to −1.3) for Multimatrix-2.4, indicating that Multimatrix-4.8 was more effective than Time-2.25 and Multimatrix-2.4. There was no difference among the treatment groups in terms of safety. Conclusions This study showed that the efficacy of multimatrix mesalazine 2.4 g/day was comparable to controlled release mesalazine 2.25 g/day, although non-inferiority was not demonstrated. Importantly, this was the first study to indicate that multimatrix mesalazine 4.8 g/day was more effective than 2.4g/day with no associated safety concerns. PMID:29743838

  16. The PAI-1 4G/5G and ACE I/D polymorphisms and risk of recurrent pregnancy loss: a case-control study.

    PubMed

    Kim, Jin Ju; Choi, Young Min; Lee, Sung Ki; Yang, Kwang Moon; Paik, Eun Chan; Jeong, Hyeon Jeong; Jun, Jong Kwan; Han, Ae Ra; Hong, Min A

    2014-12-01

    Thrombophilia has been postulated to be a contributor to the pathophysiology of recurrent pregnancy loss (RPL). We investigated the role of the plasminogen activator inhibitor type 1 (PAI-1) 4G/5G and angiotensin converting enzyme (ACE) I/D polymorphisms in Korean patients with RPL. Genotyping was performed using the TaqMan assay in 227 RPL patients and 304 controls. The genotype distributions of both polymorphisms in the RPL group did not differ from those of controls. Because the frequency of being homozygous for ACE D/D and the PAI-I 4G/4G combination has been reported to be significantly higher in RPL patients, this was also analyzed. However, no significant difference was noted; 3.1% of RPL patients had both ACE D/D and PAI-I 4G/4G, as did 4.9% of controls (P = 0.791). The current study suggests that both polymorphisms, either alone or in combination, are not major determinants of the development of RPL in Korean women. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  17. Oxygen consumption during cold exposure at 2.1 G in rats adapted to hypergravic fields

    NASA Technical Reports Server (NTRS)

    Horowitz, J.; Patterson, S.; Monson, C.

    1985-01-01

    The thermoregulation ability of rats exposed to various gravitational fields is examined. Male Sprague-Dawley rats were exposed to 22 C and 1 G, and 9 C and 2.1 G in experiment one, 1 G, 2.4 G, 5.8 G and 22 + or - 1.5 C in experiment two, and 1 G, 19-22 C, and 5 C in experiment three. It is observed that the core temperature in the control rats was 36.8 + or 0.4 C at 22C and 30.8 + or - 0.6 C at 9 C, and oxygen consumption dropped from 37 + or - 0.3 C core temperature at 22 C, 36.4 + or - 0.3 C at 9 C, 0.4 oxygen consumption was 8.18 + or - 0.9 ml/min at 22 C, and 14.2 + or - 0.4 ml/min at 9 C. The data from experiment two reveal that tail temperature in the control rats peaked at 2.4 G and at 5.8 G for the acclimated rats, and in experiment three a greater decrease in core temperature is detected in the 2.1-G rats. It is noted that prior acclimation to 2.1 G enhances the thermoregulation ability when exposed to the cold.

  18. Thrombophilic genetic factors PAI-1 4G-4G and MTHFR 677TT as risk factors of alcohol, cryptogenic liver cirrhosis and portal vein thrombosis, in a Caucasian population.

    PubMed

    D'Amico, Mario; Pasta, Francesca; Pasta, Linda

    2015-08-15

    The thrombophilic genetic factors (THRGFs), PAI-1 4G-4G, MTHFR 677TT, V Leiden 506Q and Prothrombin 20210A, were studied as risk factors in 865 Caucasian patients with liver cirrhosis, consecutively enrolled from June 2008 to January 2014. A total of 582 HCV, 80 HBV, 94 alcohol, (82 with more than one etiologic factor) and 191 cryptogenic patients with liver cirrhosis had been consecutively enrolled; 243 patients showed portal vein thrombosis (PVT). At least one of the above THRGFs was present in 339/865 patients (39.2%). PAI-1 4G-4G and MTHFR 677TT were the most frequent THRGFs, statistically significant in patients with alcohol, cryptogenic liver cirrhosis, and PVT: respectively 24 and 28, 50 and 73, and 65 and 83 (all chi-square tests>3.84, and p values<0.05). Two logistic regression analysis, using PAI-1 4G-4G and MTHFR 677TT, as dependent variable, confirmed the independent significant relationship of these THRGFs with alcohol, cryptogenic liver cirrhosis and PVT. PAI 1 and MTHFR 677 genotypes, deviated from those expected in populations in Hardy-Weinberg equilibrium (all p values<0.05), in the subgroups of patients with alcohol, cryptogenic liver cirrhosis and presence of PVT. Our study shows the pivotal role of PAI-1 4G-4G and MTHFR 677TT in patients with alcohol, cryptogenic liver cirrhosis, and PVT, in a Caucasian population. In conclusion, thrombo and fibro-genetic mechanisms of PAI-1 4G-4G and MTHFR 677TT, could have a role in the development of liver cirrhosis, mainly in patients without HCV and HBV, and PVT. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Polymorphism of the PAI-1gene (4G/5G) may be linked with Polycystic Ovary Syndrome and associated pregnancy disorders in South Indian Women

    PubMed Central

    Mary, Maniraja Jesintha; Saravanan, Lakshmanan; Deecaraman, Munuswamy; Vijayalakshmi, Melantharu; Umashankar, Vetrivel; Sailaja, Jaigopal

    2017-01-01

    Polycystic Ovary syndrome (PCOS) is the most common endocrine disorder affecting 5 - 10% of all women of reproductive age group. The present research was carried out to study the impact of Plasminogen Activator Inhibitor (PAI-1) 4G/5G polymorphism (rs1799889) in PCOS, and the risk of developing PCOS in South Indian Population. The study was carried out in 60 subjects of South Indian population (30 PCOS and 30 Non PCOS) recruited from ARC Research and Fertility Centre, Chennai, India. Genotype and Allelic frequencies were compared by Fisher exact test, Hardy Weinberg equilibrium. p<0.05 was considered statistically significant. The Genotype frequency difference between PCOS and non-PCOS was observed as statistically non-significant (p=0.4647, OR=1.3077, 95% CI 0.63-2.68). The allelic frequency distribution in Spontaneous Abortion (SAB) cases in total subjects is not found to be statistically significant (p=0. 29), however the PCOS women carrying mutant homozygous and heterozygous genotype are more prone to recurrent pregnancy loss. Out of 17 Implantation failure cases, 23.52% were found to carry mutant homozygous (4G/4G), and 66.66% carried mutant heterozygous (4G/5G), and 5.88% carried wild type homozygous (5G/5G), the allelic difference was highly significant with 4G (62.5%), and 5G (37.5%). P value is highly significant and recorded at p=0.0164. The positive correlation between PAI-1 4G/5G polymorphism and PCOS risk was not observed in this study, however, the correlation between Recurrent Pregnancy Loss (RPL) and Implantation failures were observed in PCOS cases. PMID:28690381

  20. Polymorphism of the PAI-1gene (4G/5G) may be linked with Polycystic Ovary Syndrome and associated pregnancy disorders in South Indian Women.

    PubMed

    Mary, Maniraja Jesintha; Saravanan, Lakshmanan; Deecaraman, Munuswamy; Vijayalakshmi, Melantharu; Umashankar, Vetrivel; Sailaja, Jaigopal

    2017-01-01

    Polycystic Ovary syndrome (PCOS) is the most common endocrine disorder affecting 5 - 10% of all women of reproductive age group. The present research was carried out to study the impact of Plasminogen Activator Inhibitor (PAI-1) 4G/5G polymorphism (rs1799889) in PCOS, and the risk of developing PCOS in South Indian Population. The study was carried out in 60 subjects of South Indian population (30 PCOS and 30 Non PCOS) recruited from ARC Research and Fertility Centre, Chennai, India. Genotype and Allelic frequencies were compared by Fisher exact test, Hardy Weinberg equilibrium. p<0.05 was considered statistically significant. The Genotype frequency difference between PCOS and non-PCOS was observed as statistically non-significant (p=0.4647, OR=1.3077, 95% CI 0.63-2.68). The allelic frequency distribution in Spontaneous Abortion (SAB) cases in total subjects is not found to be statistically significant (p=0. 29), however the PCOS women carrying mutant homozygous and heterozygous genotype are more prone to recurrent pregnancy loss. Out of 17 Implantation failure cases, 23.52% were found to carry mutant homozygous (4G/4G), and 66.66% carried mutant heterozygous (4G/5G), and 5.88% carried wild type homozygous (5G/5G), the allelic difference was highly significant with 4G (62.5%), and 5G (37.5%). P value is highly significant and recorded at p=0.0164. The positive correlation between PAI-1 4G/5G polymorphism and PCOS risk was not observed in this study, however, the correlation between Recurrent Pregnancy Loss (RPL) and Implantation failures were observed in PCOS cases.

  1. 11 CFR 111.4 - Complaints (2 U.S.C. 437g(a)(1)).

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 11 Federal Elections 1 2012-01-01 2012-01-01 false Complaints (2 U.S.C. 437g(a)(1)). 111.4 Section... knowledge and statements based upon information and belief. (d) The complaint should conform to the... accompanied by an identification of the source of information which gives rise to the complainants belief in...

  2. 11 CFR 111.4 - Complaints (2 U.S.C. 437g(a)(1)).

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 11 Federal Elections 1 2010-01-01 2010-01-01 false Complaints (2 U.S.C. 437g(a)(1)). 111.4 Section... knowledge and statements based upon information and belief. (d) The complaint should conform to the... accompanied by an identification of the source of information which gives rise to the complainants belief in...

  3. 11 CFR 111.4 - Complaints (2 U.S.C. 437g(a)(1)).

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 11 Federal Elections 1 2011-01-01 2011-01-01 false Complaints (2 U.S.C. 437g(a)(1)). 111.4 Section... knowledge and statements based upon information and belief. (d) The complaint should conform to the... accompanied by an identification of the source of information which gives rise to the complainants belief in...

  4. 11 CFR 111.4 - Complaints (2 U.S.C. 437g(a)(1)).

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 11 Federal Elections 1 2014-01-01 2014-01-01 false Complaints (2 U.S.C. 437g(a)(1)). 111.4 Section... knowledge and statements based upon information and belief. (d) The complaint should conform to the... accompanied by an identification of the source of information which gives rise to the complainants belief in...

  5. A case of non-lacrimal immunoglobulin G4 (IgG4)-related orbital disease with mastitis.

    PubMed

    Farooq, Tahir Ali; Mudhar, Hardeep; Sandramouli, S

    2016-01-01

    IgG4-related orbital disease is a recognised cause for orbital inflammation. As its awareness increases and diagnostic accuracy improves there will be an increased number of cases being identified. This unique case demonstrates for the first time, with histological evidence, a case of a non-lacrimal IgG4-related orbital disease with concurrent IgG4-related mastitis. We describe a 47 year old who presented with a supraorbital swelling and mass. This was initially successfully treated with oral steroids and was later excised on recurrence. Immunohistochemical and blood serum analysis confirmed IgG4-related orbital disease. On systemic enquiry she was found to have a mass of the breast, which was shown to be IgG4-related mastitis. She is currently asymptomatic with no sign of recurrence and is under long-term surveillance. This case highlights the importance of systemic work up in patients presenting with orbital foci of IgG4 disease.

  6. The association between the 4G/5G polymorphism in the promoter of the plasminogen activator inhibitor-1 gene and extension of postsurgical calf vein thrombosis.

    PubMed

    Ferrara, Filippo; Meli, Francesco; Raimondi, Francesco; Montalto, Salvatore; Cospite, Valentina; Novo, Giuseppina; Novo, Salvatore

    2013-04-01

    The objective of this study was to evaluate whether the presence of a plasminogen activator inhibitor type 1 (PAI-1) promoter polymorphism 4G/5G could significantly influence the proximal extension of vein thrombosis in spite of anticoagulant treatment in patients with calf vein thrombosis (CVT) following orthopaedic, urological and abdominal surgery. We studied 168 patients with CVT, who had undergone orthopaedic, urological and abdominal surgery, subdivided as follows: first, 50 patients with thrombosis progression; second, 118 patients without thrombosis progression. The 4G/5G polymorphism of the plasminogen activator inhibitor 1 was evaluated in all patients and in 70 healthy matched controls. We also studied PAI-1 activity in plasma. The presence of 4G/5G genotype was significantly increased in the group of patients with the extension of thrombotic lesions and was associated with an increase in CVT extension risk (odds ratio adjusted for sex 2.692; 95% confidence interval 1.302-4.702). Moreover, we observed a significant increase of PAI-1 plasma activity in patients with extension of thrombotic lesion vs. patients without extension (P=0.0001). Patients with 4G/5G genotype in the promoter of the plasminogen activator inhibitor - 1 gene present a higher risk of extension of thrombotic lesions.

  7. BPS states in N = 2 supersymmetric G2 and F4 models

    NASA Astrophysics Data System (ADS)

    Ahl Laamara, R.; Mellal, O.; Saidi, E. H.

    2017-07-01

    In BPS quiver theory of N = 2 supersymmetric pure gauge models with gauge invariance G, primitive BPS quivers Q0G are of two types: Q0ADE and Q0BCFG. In this study, we first show that Q0ADE have outer-automorphism symmetries inherited from the outer-automorphisms of the Dynkin diagrams of ADE Lie algebras. Then, we extend the usual folding operation of Dynkin diagrams ADE → BCFG to obtain the two following things: (i) relate Q0BCFG quivers and their mutations to the Q0ADE ones and their mutations; and (ii) link the BPS chambers of the N = 2ADE theories with the corresponding BCFG ones. As an illustration of this construction, we derive the BPS and anti-BPS states of the strong chambers QstgG2 and QstgF4 of the 4d N = 2 pure G2 and F4 gauge models.

  8. Epstein-Barr virus-infected cells in IgG4-related lymphadenopathy with comparison with extranodal IgG4-related disease.

    PubMed

    Takeuchi, Mai; Sato, Yasuharu; Yasui, Hiroshi; Ozawa, Hiroaki; Ohno, Kyotaro; Takata, Katsuyoshi; Gion, Yuka; Orita, Yorihisa; Tachibana, Tomoyasu; Itoh, Tomoo; Asano, Naoko; Nakamura, Shigeo; Swerdlow, Steven H; Yoshino, Tadashi

    2014-07-01

    IgG4-related lymphadenopathy with increased numbers of Epstein-Barr virus (EBV)-infected cells has been reported but not fully described. We analyzed 31 cases of IgG4-related lymphadenopathy and 24 cases of extranodal IgG4-related diseases for their possible relationship with EBV. Other types of reactive lymph nodes (22) and angioimmunoblastic T-cell lymphoma (AITL) (10) were also studied for comparison. EBV-encoded RNA (EBER) in situ hybridization revealed EBER(+) cells in 18 of 31 cases (58%) of IgG4-related lymphadenopathy. Increased EBER(+) cells were found in only 4 of 22 (18.1%) non-IgG4-related reactive lymphoid hyperplasia in patients of a similar age (P=0.002) and in only 5 of 24 (21%) extranodal IgG4-related biopsies (P=0.006). Interestingly, all patients with EBER(+) progressively transformed germinal center-type IgG4-related lymphadenopathy had systemic lymphadenopathy and/or extranodal involvement. AITL also is associated with EBV, and IgG4-related lymphadenopathy sometimes mimics the morphology of AITL; however, the number of IgG4(+) cells in AITL was significantly less than that in IgG4-related lymphadenopathy (P<0.001). Increased numbers of regulatory T cells are seen in IgG4-related disease; however, there was not a significant difference between the EBER(+) and EBER(-) cases. In conclusion, the presence of increased numbers of EBV-infected cells in IgG4-related lymphadenopathy, compared with other reactive lymphadenopathy or extranodal IgG4-related disease, suggests that there may be a relationship at least between nodal IgG4-related disease and EBV. It is important to avoid overdiagnosing these cases as malignant lymphomas or EBV-related lymphoproliferative disorders.

  9. In Black South Africans from Rural and Urban Communities, the 4G/5G PAI-1 Polymorphism Influences PAI-1 Activity, but Not Plasma Clot Lysis Time

    PubMed Central

    de Lange, Zelda; Rijken, Dingeman C.; Hoekstra, Tiny; Conradie, Karin R.; Jerling, Johann C.; Pieters, Marlien

    2013-01-01

    Data on genetic and environmental factors influencing PAI-1 levels and their consequent effect on clot lysis in black African populations are limited. We identified polymorphisms in the promoter area of the PAI-1 gene and determined their influence on PAI-1act levels and plasma clot lysis time (CLT). We also describe gene-environment interactions and the effect of urbanisation. Data from 2010 apparently healthy urban and rural black participants from the South African arm of the PURE study were cross-sectionally analysed. The 5G allele frequency of the 4G/5G polymorphism was 0.85. PAI-1act increased across genotypes in the urban subgroup (p = 0.009) but not significantly in the rural subgroup, while CLT did not differ across genotypes. Significant interaction terms were found between the 4G/5G polymorphism and BMI, waist circumference and triglycerides in determining PAI-1act, and between the 4G/5G polymorphism and fibrinogen and fibrinogen gamma prime in determining CLT. The C428T and G429A polymorphisms did not show direct relationships with PAI-1act or CLT but they did influence the association of other environmental factors with PAI-1act and CLT. Several of these interactions differed significantly between rural and urban subgroups, particularly in individuals harbouring the mutant alleles. In conclusion, although the 4G/5G polymorphism significantly affected PAI-1act, it contributed less than 1% to the PAI-1act variance. (Central) obesity was the biggest contributor to PAI-1act variance (12.5%). Urbanisation significantly influenced the effect of the 4G/5G polymorphism on PAI-1act as well as gene-environment interactions for the C428T and G429A genotypes in determining PAI-1act and CLT. PMID:24386152

  10. In black South Africans from rural and urban communities, the 4G/5G PAI-1 polymorphism influences PAI-1 activity, but not plasma clot lysis time.

    PubMed

    de Lange, Zelda; Rijken, Dingeman C; Hoekstra, Tiny; Conradie, Karin R; Jerling, Johann C; Pieters, Marlien

    2013-01-01

    Data on genetic and environmental factors influencing PAI-1 levels and their consequent effect on clot lysis in black African populations are limited. We identified polymorphisms in the promoter area of the PAI-1 gene and determined their influence on PAI-1act levels and plasma clot lysis time (CLT). We also describe gene-environment interactions and the effect of urbanisation. Data from 2010 apparently healthy urban and rural black participants from the South African arm of the PURE study were cross-sectionally analysed. The 5G allele frequency of the 4G/5G polymorphism was 0.85. PAI-1act increased across genotypes in the urban subgroup (p = 0.009) but not significantly in the rural subgroup, while CLT did not differ across genotypes. Significant interaction terms were found between the 4G/5G polymorphism and BMI, waist circumference and triglycerides in determining PAI-1act, and between the 4G/5G polymorphism and fibrinogen and fibrinogen gamma prime in determining CLT. The C428T and G429A polymorphisms did not show direct relationships with PAI-1act or CLT but they did influence the association of other environmental factors with PAI-1act and CLT. Several of these interactions differed significantly between rural and urban subgroups, particularly in individuals harbouring the mutant alleles. In conclusion, although the 4G/5G polymorphism significantly affected PAI-1act, it contributed less than 1% to the PAI-1act variance. (Central) obesity was the biggest contributor to PAI-1act variance (12.5%). Urbanisation significantly influenced the effect of the 4G/5G polymorphism on PAI-1act as well as gene-environment interactions for the C428T and G429A genotypes in determining PAI-1act and CLT.

  11. 4G/5G Variant of Plasminogen Activator Inhibitor-1 Gene and Severe Pregnancy-Induced Hypertension: Subgroup Analyses of Variants of Angiotensinogen and Endothelial Nitric Oxide Synthase

    PubMed Central

    Kobashi, Gen; Ohta, Kaori; Yamada, Hideto; Hata, Akira; Minakami, Hisanori; Sakuragi, Noriaki; Tamashiro, Hiko; Fujimoto, Seiichiro

    2009-01-01

    Background Pregnancy-induced hypertension (PIH) is a common cause of perinatal mortality. It is believed to result from the interaction of several factors, including those related to the blood coagulation system. We performed genotyping and subgroup analyses to determine if the 4G/5G genotypes of the plasminogen activator inhibitor-1 gene (PAI-1) play a role in the pathogenesis of PIH, and to evaluate possible interactions of the PAI-1 polymorphisms with those of the angiotensinogen gene (AGT) and the endothelial nitric oxide synthase gene (NOS3). Methods An association study of PAI-1 polymorphism, and subgroup analyses of common variants of AGT and NOS3, among 128 patients with PIH and 376 healthy pregnant controls. Results No significant differences were found between the cases and controls in the frequencies of allele 4G or the 4G/4G genotype. In subgroup analyses, after adjustment for multiple comparison, a significant association with the AGT TT genotype was found among women with the PAI-1 4G/4G genotype, and an association with the NOS3 GA+AA genotype was found among women with the 5G/5G or 4G/5G genotypes. Conclusions Our findings suggest that there are at least 2 pathways in the pathogenesis of severe PIH. However, with respect to early prediction and prevention of severe PIH, although the PAI-1 4G/4G genotype alone was not a risk factor for severe PIH, the fact that PAI-1 genotypes are associated with varying risks for severe PIH suggests that PAI-1 genotyping of pregnant women, in combination with other tests, may be useful in the development of individualized measures that may prevent severe PIH. PMID:19838007

  12. Sequencing and phylogenetic analysis of the coding region of six common rotavirus strains: evidence for intragenogroup reassortment among co-circulating G1P[8] and G2P[4] strains from the United States.

    PubMed

    Bányai, K; Mijatovic-Rustempasic, S; Hull, J J; Esona, M D; Freeman, M M; Frace, A M; Bowen, M D; Gentsch, J R

    2011-03-01

    The segmented genome of rotaviruses provides an opportunity for rotavirus strains to generate a large genetic diversity through reassortment; however, this mechanism is considered to play little role in the generation of mosaic gene constellations between Wa-like and DS-1-like strains in genes other than the neutralization antigens. A pilot study was undertaken to analyze these two epidemiologically important strains at the genomic level in order to (i) identify intergenogroup reassortment and (ii) to make available additional reference genome sequences of G1P[8] and G2P[4] for future genomics analyses. The full or nearly complete coding region of all 11 genes for 3 G1P[8] (LB2719, LB2758, and LB2771) and 3 G2P[4] (LB2744, LB2764, and LB2772) strains isolated from children hospitalized with severe diarrhea in Long Beach, California, where these strains were circulating at comparable rates during 2005-2006 are described in this study. Based on the full-genome classification system, all G1P[8] strains had a conserved genomic constellation: G1-P[8]-I1-R1-C1-M1-A1-N1-T1-E1-E1-H1 and were mostly identical to the few Wa-like strains whose genome sequences have already been determined. Similarly, the genome sequences of the 3 G2P[4] strains were highly conserved: G2-P[4]-I2-R2-C2-M2-A2-N2-T2-E2-E2-H2 and displayed an overall lesser genetic divergence with reference DS-1-like strains. While intergenogroup reassortment was not seen between the G1P[8] and G2P[4] strains studied here, evidence for intragenogroup reassortment events was identified. Similar studies in the post-rotavirus genomic era will help uncover whether intergenogroup reassortment affecting the backbone genes could play a significant role in any potential vaccine breakthrough events by evading immunity of vaccinated children. Copyright © 2011 Wiley-Liss, Inc.

  13. 17 CFR 240.12g-1 - Exemption from section 12(g).

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... pursuant to section 12(g)(1) if on the last day of its most recent fiscal year the issuer had total assets...). 240.12g-1 Section 240.12g-1 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION... Securities Exchange Act of 1934 Extensions and Temporary Exemptions; Definitions § 240.12g-1 Exemption from...

  14. 17 CFR 240.12g-1 - Exemption from section 12(g).

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... pursuant to section 12(g)(1) if on the last day of its most recent fiscal year the issuer had total assets...). 240.12g-1 Section 240.12g-1 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION... Securities Exchange Act of 1934 Extensions and Temporary Exemptions; Definitions § 240.12g-1 Exemption from...

  15. 17 CFR 240.12g-1 - Exemption from section 12(g).

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... pursuant to section 12(g)(1) if on the last day of its most recent fiscal year the issuer had total assets...). 240.12g-1 Section 240.12g-1 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION... Securities Exchange Act of 1934 Extensions and Temporary Exemptions; Definitions § 240.12g-1 Exemption from...

  16. 17 CFR 240.12g-1 - Exemption from section 12(g).

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... pursuant to section 12(g)(1) if on the last day of its most recent fiscal year the issuer had total assets...). 240.12g-1 Section 240.12g-1 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION... Securities Exchange Act of 1934 Extensions and Temporary Exemptions; Definitions § 240.12g-1 Exemption from...

  17. 17 CFR 240.12g-1 - Exemption from section 12(g).

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... pursuant to section 12(g)(1) if on the last day of its most recent fiscal year the issuer had total assets...). 240.12g-1 Section 240.12g-1 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION... Securities Exchange Act of 1934 Extensions and Temporary Exemptions; Definitions § 240.12g-1 Exemption from...

  18. PAI-1 4G-4G, MTHFR 677TT, V Leiden 506Q, and Prothrombin 20210A in Splanchnic Vein Thrombosis: Analysis of Individual Patient Data From Three Prospective Studies

    PubMed Central

    Pasta, Linda; Pasta, Francesca; D’Amico, Mario

    2016-01-01

    Background There are no univocal opinions on the role of genetic thrombophilia on splanchnic vein thrombosis (SVT). We defined genetic thrombophilia the presence of one of these thrombophilic genetic factors (THRGFs): PAI-1 4G-4G, MTHFR 677TT, V Leiden 506Q, and prothrombin 20210A. Objectives To evaluate the frequencies of these THRGFs in SVT patients, we analyzed individual data of 482 Caucasian patients, recruited from 2000 to 2014 in three prospective studies. SVT was defined as the presence of thrombosis of portal (PVT), mesenteric (MVT), splenic (SPVT), cava (CT), and hepatic vein (Budd Chiari syndrome, BCS). Pre-hepatic SVT (pre-HSVT) was defined as PVT with or without MVT/SPVT, without BCS. Post-hepatic SVT (post-HSVT) was BCS with or without PVT/MVT/SPVT. Methods We compared 350 patients with liver cirrhosis (LC), 47 hepatocellular carcinoma (HCC), 37 myeloproliferative neoplasm (MPN), 38 associated disease (AD), 10 without any associated disease (WAD), vs 150 healthy controls (HC); 437 patients showed pre-HSVT and 45 post-HSVT. Results Thrombophilia was present in 294/482 (60.9%) patients: 189/350 LC (54.0%), 31/47 (66.0%) HCC, 29/39 (74.4%) MPN, 35/38 AD (92.1%), and 10/10 (100%) WAD, and 54/150 (36.0%) in HC. In the total group, we found 175 PAI-1 4G-4G, 130 MTHFR 677TT, 42V Leiden 506Q, and 27 prothrombin 20210A; 75 patients showed presence of >1 TRHGF; the more frequent association was PAI-1 4G-4G/MTHFR 677TT, in 36 patients. PAI-1 4G-4G and MTHFR 677TT were significantly more frequent in patients with SVT (P values <0.005), whereas V Leiden Q506 and prothrombin G20210A were not. PAI-1 4G-4G and MTHFR 677TT distributions deviated significantly from that expected from a population in Hardy–Weinberg equilibrium. Thrombophilia was significantly less frequent in patients with pre-HSVT (250/437, 57.2%) than in patients with post-HSVT (44/45, 97.8%). Conclusions Our study shows the significant prevalence of PAI-1 4G-4G and MTHFR 677TT in SVT, mainly in

  19. 26 CFR 1.860G-2T - Other rules (temporary).

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 26 Internal Revenue 9 2013-04-01 2013-04-01 false Other rules (temporary). 1.860G-2T Section 1.860G-2T Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Real Estate Investment Trusts § 1.860G-2T Other rules (temporary). (a...

  20. 26 CFR 1.860G-2T - Other rules (temporary).

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 26 Internal Revenue 9 2012-04-01 2012-04-01 false Other rules (temporary). 1.860G-2T Section 1.860G-2T Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Real Estate Investment Trusts § 1.860G-2T Other rules (temporary). (a...

  1. Measuring the performance of G2G services in Iran

    NASA Astrophysics Data System (ADS)

    Zarei, Behrouz; Safdari, Maryam

    To highlight the growth of e-government and the importance of its services it is essential to evaluate the performance of the service delivery to customers. Research indicates that traditional performance indexes are not suitable for this evaluation; moreover, it is noticeable that the e-government services are intangible and invisible. Among different e-government services, measurement of quality government to government (G2G) services has been less attractive for researchers while crucial for government policy-makers. This calls for a better understanding of the specific needs of users of these services in order to provide appropriate type and level of services that meets those needs. In this paper, the performance of the G2G services is measured in the Iranian context. For this purpose, SERVQUAL, which is a well-known method for assessing service quality, is employed. This study proposes and tests a five-factor of SERVQUAL instrument to explain user satisfaction and gap analysis, between expectations and perceptions of its customers, consisting thirty ministries and main governmental organizations. Based on a Chi-square test, factor analysis, gap analysis and correlations, it is concluded the gap between expectations and perceptions of G2G customers is significant and customer satisfaction of G2G services is at low level.

  2. G(sup 4)FET Implementations of Some Logic Circuits

    NASA Technical Reports Server (NTRS)

    Mojarradi, Mohammad; Akarvardar, Kerem; Cristoleveanu, Sorin; Gentil, Paul; Blalock, Benjamin; Chen, Suhan

    2009-01-01

    Some logic circuits have been built and demonstrated to work substantially as intended, all as part of a continuing effort to exploit the high degrees of design flexibility and functionality of the electronic devices known as G(sup 4)FETs and described below. These logic circuits are intended to serve as prototypes of more complex advanced programmable-logicdevice-type integrated circuits, including field-programmable gate arrays (FPGAs). In comparison with prior FPGAs, these advanced FPGAs could be much more efficient because the functionality of G(sup 4)FETs is such that fewer discrete components are needed to perform a given logic function in G(sup 4)FET circuitry than are needed perform the same logic function in conventional transistor-based circuitry. The underlying concept of using G(sup 4)FETs as building blocks of programmable logic circuitry was also described, from a different perspective, in G(sup 4)FETs as Universal and Programmable Logic Gates (NPO-41698), NASA Tech Briefs, Vol. 31, No. 7 (July 2007), page 44. A G(sup 4)FET can be characterized as an accumulation-mode silicon-on-insulator (SOI) metal oxide/semiconductor field-effect transistor (MOSFET) featuring two junction field-effect transistor (JFET) gates. The structure of a G(sup 4)FET (see Figure 1) is the same as that of a p-channel inversion-mode SOI MOSFET with two body contacts on each side of the channel. The top gate (G1), the substrate emulating a back gate (G2), and the junction gates (JG1 and JG2) can be biased independently of each other and, hence, each can be used to independently control some aspects of the conduction characteristics of the transistor. The independence of the actions of the four gates is what affords the enhanced functionality and design flexibility of G(sup 4)FETs. The present G(sup 4)FET logic circuits include an adjustable-threshold inverter, a real-time-reconfigurable logic gate, and a dynamic random-access memory (DRAM) cell (see Figure 2). The configuration

  3. Inactivation of Toluene 2-Monooxygenase in Burkholderia cepacia G4 by Alkynes

    PubMed Central

    Yeager, Chris M.; Bottomley, Peter J.; Arp, Daniel J.; Hyman, Michael R.

    1999-01-01

    High concentrations of acetylene (10 to 50% [vol/vol] gas phase) were required to inhibit the growth of Burkholderia cepacia G4 on toluene, while 1% (vol/vol) (gas phase) propyne or 1-butyne completely inhibited growth. Low concentrations of longer-chain alkynes (C5 to C10) were also effective inhibitors of toluene-dependent growth, and 2- and 3-alkynes were more potent inhibitors than their 1-alkyne counterparts. Exposure of toluene-grown B. cepacia G4 to alkynes resulted in the irreversible loss of toluene- and o-cresol-dependent O2 uptake activities, while acetate- and 3-methylcatechol-dependent O2 uptake activities were unaffected. Toluene-dependent O2 uptake decreased upon the addition of 1-butyne in a concentration- and time-dependent manner. The loss of activity followed first-order kinetics, with apparent rate constants ranging from 0.25 min−1 to 2.45 min−1. Increasing concentrations of toluene afforded protection from the inhibitory effects of 1-butyne. Furthermore, oxygen, supplied as H2O2, was required for inhibition by 1-butyne. These results suggest that alkynes are specific, mechanism-based inactivators of toluene 2-monooxygenase in B. cepacia G4, although the simplest alkyne, acetylene, was relatively ineffective compared to longer alkynes. Alkene analogs of acetylene and propyne—ethylene and propylene—were not inactivators of toluene 2-monooxygenase activity in B. cepacia G4 but were oxidized to their respective epoxides, with apparent Ks and Vmax values of 39.7 μM and 112.3 nmol min−1 mg of protein−1 for ethylene and 32.3 μM and 89.2 nmol min−1 mg of protein−1 for propylene. PMID:9925593

  4. The prevalence of 4G/5G polymorphism of plasminogen activator inhibitor-1 (PAI-1) gene in central serous chorioretinopathy and its association with plasma PAI-1 levels.

    PubMed

    Sogutlu Sari, Esin; Yazici, Alper; Eser, Betül; Erol, Muhammet Kazim; Kilic, Adil; Ermis, Sitki Samet; Koytak, Arif; Akşit, Hasan; Yakut, Tahsin

    2014-12-01

    Central serous chorioretinopathy (CSCR) is a poorly understood disease and the choroidal circulation abnormality induced by the plasminogen activator inhibitor type 1 (PAI-1) seems to be associated with the pathogenesis. There are many reports indicating that 4 G/5 G polymorphism of the PAI-1 gene is a risk factor for several diseases related to the elevated serum levels of PAI-1. To evaluate the 4 G/5 G polymorphism of the PAI-1 gene and its association with serum levels of PAI-1 in acute CSCR patients. Sixty CSCR patients and 50 healthy control patients were included. The PAI-1 4 G/5 G was genotyped using the polymerase chain reaction-restriction technique. Serum PAI-1 level was measured using enzyme-linked immunosorbent assay. Demographic data consisting of age, sex, body mass index (BMI) as well as genotype disturbances and serum PAI-1 levels were compared between the groups. Statistical significance for differences in the serum PAI-1 levels of each group with different genotypes was also analyzed. The CSCR group consisted of 40 male (66.7%) and 20 female (33.3%) patients with a mean age of 46.7 ± 8.39 years. The control group consisted of 32 male (64%) and 18 female (36%) healthy subjects with a mean age of 45.8 ± 8.39 years. There was no statistically significant difference between the groups in terms of age, sex and BMI. In the CSCR group the genotype frequencies were 4 G/4G: 30% (n = 18), 4G/5 G: 50% (n = 30), 5 G/5G: 20% (n = 12) and in the control group genotype frequencies were 34% (n = 17), 42% (n = 21) and 24% (n = 12), respectively. There was no statistically significant difference in the distribution of genotypes among the groups (chi-squared, p = 0.70). The CSCR group had a significantly higher serum PAI-1 concentration than the control group (p = 0.001). In both groups the mean plasma PAI-1 concentration did not vary significantly among the different genotypes (p > 0.05). Although our results demonstrated that the patients with acute CSCR have

  5. 3-(3-Hydroxy-4-methoxyphenyl)-4-(3,4,5-trimethoxyphenyl)-1,2,5-selenadiazole (G-1103), a novel combretastatin A-4 analog, induces G2/M arrest and apoptosis by disrupting tubulin polymerization in human cervical HeLa cells and fibrosarcoma HT-1080 cells.

    PubMed

    Zuo, Daiying; Guo, Dandan; Jiang, Xuewei; Guan, Qi; Qi, Huan; Xu, Jingwen; Li, Zengqiang; Yang, Fushan; Zhang, Weige; Wu, Yingliang

    2015-02-05

    Microtubule is a popular target for anticancer drugs. In this study, we describe the effect 3-(3-hydroxy-4-methoxyphenyl)-4-(3,4,5-trimethoxyphenyl)-1,2,5-selenadiazole (G-1103), a newly synthesized analog of combretastatin A-4 (CA-4), showing a strong time- and dose-dependent anti-proliferative effect on human cervical cancer HeLa cells and human fibrosarcoma HT-1080 cells. We demonstrated that the growth inhibitory effects of G-1103 in HeLa and HT-1080 cells were associated with microtubule depolymerization and proved that G-1103 acted as microtubule destabilizing agent. Furthermore, cell cycle analysis revealed that G-1103 treatment resulted in cell cycle arrest at the G2/M phase in a time-dependent manner with subsequent apoptosis induction. Western blot analysis revealed that down-regulation of cdc25c and up-regulation of cyclin B1 was related with G2/M arrest in HeLa and HT-1080 cells treatment with G-1103. In addition, G-1103 induced HeLa cell apoptosis by up-regulating cleaved caspase-3, Fas, cleaved caspase-8 expression, which indicated that G-1103 induced HeLa cell apoptosis was mainly associated with death receptor pathway. However, G-1103 induced HT-1080 cell apoptosis by up-regulating cleaved caspase-3, Fas, cleaved caspase-8, Bax and cleaved caspase-9 expression and down-regulating anti-apoptotic protein Bcl-2 expression, which indicated that G-1103 induced HT-1080 cell apoptosis was associated with both mitochondrial and death receptor pathway. Taken together, all the data demonstrated that G-1103 exhibited its antitumor activity through disrupting the microtubule assembly, causing cell cycle arrest and consequently inducing apoptosis in HeLa and HT-1080 cells. Therefore, the novel compound G-1103 is a promising microtubule inhibitor that has great potentials for therapeutic treatment of various malignancies. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  6. IgG2 deficiency in sickle cell anaemia.

    PubMed

    Natta, C L; Outschoorn, I M

    1984-08-01

    8 patients with known sickle cell anaemia were studied immunologically. The concentrations of the main immunoglobulin classes, IgG and IgA, were significantly higher than the levels in 11 normal age- and sex-matched black subjects (P less than 0.01). IgM levels were not significantly different in the two groups. There was a heterogeneity in the interaction of the IgG subclasses with Protein A, with low levels of IgG2. The IgG2:IgG1 ratios varied from 1:3.8 to 1:6 (normals 1:3). In 4 patients the absolute levels of IgG2 as measured by radial immunodiffusion were lower than normal, thus confirming the chromatographic ratios. Since specific antibody is often restricted to a single subclass, the levels of IgG subclasses may be related to recurrent bacterial infections in these patients.

  7. Human placenta: relative content of antibodies of different classes and subclasses (IgG1-IgG4) containing lambda- and kappa-light chains and chimeric lambda-kappa-immunoglobulins.

    PubMed

    Lekchnov, Evgenii A; Sedykh, Sergey E; Dmitrenok, Pavel S; Buneva, Valentina N; Nevinsky, Georgy A

    2015-06-01

    The specific organ placenta is much more than a filter: it is an organ that protects, feeds and regulates the growth of the embryo. Affinity chromatography, ELISA, SDS-PAGE and matrix-assisted laser desorption ionization mass spectrometry were used. Using 10 intact human placentas deprived of blood, a quantitative analysis of average relative content [% of total immunoglobulins (Igs)] was carried out for the first time: (92.7), IgA (2.4), IgM (2.5), kappa-antibodies (51.4), lambda-antibodies (48.6), IgG1 (47.0), IgG2 (39.5), IgG3 (8.8) and IgG4 (4.3). It was shown for the first time that placenta contains sIgA (2.5%). In the classic paradigm, Igs represent products of clonal B-cell populations, each producing antibodies recognizing a single antigen. There is a common belief that IgGs in mammalian biological fluids are monovalent molecules having stable structures and two identical antigen-binding sites. However, similarly to human milk Igs, placenta antibodies undergo extensive half-molecule exchange and the IgG pool consists of 43.5 ± 15.0% kappa-kappa-IgGs and 41.6 ± 17.0% lambda-lambda-IgGs, while 15.0 ± 4.0% of the IgGs contained both kappa- and lambda-light chains. Kappa-kappa-IgGs and lambda-lambda-IgGs contained, respectively (%): IgG1 (47.7 and 34.4), IgG2 (36.3 and 44.5), IgG3 (7.4 and 11.8) and IgG4 (7.5 and 9.1), while chimeric kappa-lambda-IgGs consisted of (%): 43.5 IgG1, 41.0 IgG2, 5.6 IgG3 and 7.9 IgG4. Our data are indicative of the possibility of half-molecule exchange between placenta IgGs of various subclasses, raised against different antigens, which explains a very well-known polyspecificity and cross-reactivity of different human IgGs. © The Japanese Society for Immunology. 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  8. G4RNA screener web server: User focused interface for RNA G-quadruplex prediction.

    PubMed

    Garant, Jean-Michel; Perreault, Jean-Pierre; Scott, Michelle S

    2018-06-06

    Though RNA G-quadruplexes became a focus of study over a decade ago, the main challenge associated with the identification of new potential G-quadruplexes remains a bottleneck step. It slows the study of these non-canonical structures in nucleic acids, and thus the understanding of their significance. The G4RNA screener is an accurate tool for the prediction of RNA G-quadruplexes but its deployment has brought to light an issue with its accessibility to G-quadruplex experts and biologists. G4RNA screener web server is a platform that provides a much needed interface to manage the input, parameters and result display of the main command-line ready tool. It is accessible at http://scottgroup.med.usherbrooke.ca/G4RNA_screener/. Copyright © 2018. Published by Elsevier B.V.

  9. Potential energy and dipole moment surfaces of the triplet states of the O2(X3Σg-) - O2(X3Σg-,a1Δg,b1Σg+) complex

    NASA Astrophysics Data System (ADS)

    Karman, Tijs; van der Avoird, Ad; Groenenboom, Gerrit C.

    2017-08-01

    We compute four-dimensional diabatic potential energy surfaces and transition dipole moment surfaces of O2-O2, relevant for the theoretical description of collision-induced absorption in the forbidden X3Σg- → a1Δg and X3Σg- → b1Σg+ bands at 7883 cm-1 and 13 122 cm-1, respectively. We compute potentials at the multi-reference configuration interaction (MRCI) level and dipole surfaces at the MRCI and complete active space self-consistent field (CASSCF) levels of theory. Potentials and dipole surfaces are transformed to a diabatic basis using a recent multiple-property-based diabatization algorithm. We discuss the angular expansion of these surfaces, derive the symmetry constraints on the expansion coefficients, and present working equations for determining the expansion coefficients by numerical integration over the angles. We also present an interpolation scheme with exponential extrapolation to both short and large separations, which is used for representing the O2-O2 distance dependence of the angular expansion coefficients. For the triplet ground state of the complex, the potential energy surface is in reasonable agreement with previous calculations, whereas global excited state potentials are reported here for the first time. The transition dipole moment surfaces are strongly dependent on the level of theory at which they are calculated, as is also shown here by benchmark calculations at high symmetry geometries. Therefore, ab initio calculations of the collision-induced absorption spectra cannot become quantitatively predictive unless more accurate transition dipole surfaces can be computed. This is left as an open question for method development in electronic structure theory. The calculated potential energy and transition dipole moment surfaces are employed in quantum dynamical calculations of collision-induced absorption spectra reported in Paper II [T. Karman et al., J. Chem. Phys. 147, 084307 (2017)].

  10. Potential energy and dipole moment surfaces of the triplet states of the O2(X3Σg-) - O2(X3Σg-,a1Δg,b1Σg+) complex.

    PubMed

    Karman, Tijs; van der Avoird, Ad; Groenenboom, Gerrit C

    2017-08-28

    We compute four-dimensional diabatic potential energy surfaces and transition dipole moment surfaces of O 2 -O 2 , relevant for the theoretical description of collision-induced absorption in the forbidden X 3 Σ g -  → a 1 Δ g and X 3 Σ g -  → b 1 Σ g + bands at 7883 cm -1 and 13 122 cm -1 , respectively. We compute potentials at the multi-reference configuration interaction (MRCI) level and dipole surfaces at the MRCI and complete active space self-consistent field (CASSCF) levels of theory. Potentials and dipole surfaces are transformed to a diabatic basis using a recent multiple-property-based diabatization algorithm. We discuss the angular expansion of these surfaces, derive the symmetry constraints on the expansion coefficients, and present working equations for determining the expansion coefficients by numerical integration over the angles. We also present an interpolation scheme with exponential extrapolation to both short and large separations, which is used for representing the O 2 -O 2 distance dependence of the angular expansion coefficients. For the triplet ground state of the complex, the potential energy surface is in reasonable agreement with previous calculations, whereas global excited state potentials are reported here for the first time. The transition dipole moment surfaces are strongly dependent on the level of theory at which they are calculated, as is also shown here by benchmark calculations at high symmetry geometries. Therefore, ab initio calculations of the collision-induced absorption spectra cannot become quantitatively predictive unless more accurate transition dipole surfaces can be computed. This is left as an open question for method development in electronic structure theory. The calculated potential energy and transition dipole moment surfaces are employed in quantum dynamical calculations of collision-induced absorption spectra reported in Paper II [T. Karman et al., J. Chem. Phys. 147, 084307 (2017)].

  11. Role of polyamines at the G1/S boundary and G2/M phase of the cell cycle.

    PubMed

    Yamashita, Tomoko; Nishimura, Kazuhiro; Saiki, Ryotaro; Okudaira, Hiroyuki; Tome, Mayuko; Higashi, Kyohei; Nakamura, Mizuho; Terui, Yusuke; Fujiwara, Kunio; Kashiwagi, Keiko; Igarashi, Kazuei

    2013-06-01

    The role of polyamines at the G1/S boundary and in the G2/M phase of the cell cycle was studied using synchronized HeLa cells treated with thymidine or with thymidine and aphidicolin. Synchronized cells were cultured in the absence or presence of α-difluoromethylornithine (DFMO), an inhibitor of ornithine decarboxylase, plus ethylglyoxal bis(guanylhydrazone) (EGBG), an inhibitor of S-adenosylmethionine decarboxylase. When polyamine content was reduced by treatment with DFMO and EGBG, the transition from G1 to S phase was delayed. In parallel, the level of p27(Kip1) was greatly increased, so its mechanism was studied in detail. Synthesis of p27(Kip1) was stimulated at the level of translation by a decrease in polyamine levels, because of the existence of long 5'-untranslated region (5'-UTR) in p27(Kip1) mRNA. Similarly, the transition from the G2/M to the G1 phase was delayed by a reduction in polyamine levels. In parallel, the number of multinucleate cells increased by 3-fold. This was parallel with the inhibition of cytokinesis due to an unusual distribution of actin and α-tubulin at the M phase. Since an association of polyamines with chromosomes was not observed by immunofluorescence microscopy at the M phase, polyamines may have only a minor role in structural changes of chromosomes at the M phase. In general, the involvement of polyamines at the G2/M phase was smaller than that at the G1/S boundary. Copyright © 2013 Elsevier Ltd. All rights reserved.

  12. Associations of maternal PLA2G4C and PLA2G4D polymorphisms with the risk of spontaneous preterm birth in a Chinese population

    PubMed Central

    Liu, Guang-Jian; He, Jian-Rong; Kuang, Ya-Shu; Fan, Xue-Jiao; Li, Wei-Dong; Lu, Jin-Hua; Xia, Xiao-Yan; Liu, Xiao-Dan; Chen, Nian-Nian; Mai, Wei-Bi; Xia, Hui-Min; Qiu, Xiu

    2017-01-01

    Preterm birth is the leading cause of mortality and morbidity in infants. Its etiology is multifactorial with genes and immune homeostasis. The authors investigated whether prostaglandin (PG) synthesis related single nucleotide polymorphisms (SNPs) PLA2G4C rs1366442 and PLA2G4D rs4924618 were associated with the risk of spontaneous preterm birth (SPTB) in a Chinese population of 114 cases of SPTB and 250 controls of term delivery. The risk associations were determined by odds ratios (ORs) and their 95% confidence intervals (CIs) calculated using multivariate logistic regression. Homology modeling was performed to elucidate potential mechanism of the SNP function. The maternal AT/TT genotype of PLA2G4D rs4924618 was associated with a reduced risk of SPTB (OR, 0.61; 95% CI, 0.37–0.99), while no significant association between PLA2G4C rs1366442 and SPTB risk was identified. Structure and sequence analysis revealed that the amino acid substitution introduced by this SNP located at the conserved central core of the catalytic domain of cytosolic phospholipase A2 δ and was close to the active site. These findings suggested that the polymorphism of PLA2G4D rs4924618 may have a protective influence on the SPTB susceptibility in a Chinese population, supporting a role for genetics in the association between PG synthesis and preterm birth. PMID:28440406

  13. 26 CFR 1.402(g)-2 - Increased limit for catch-up contributions.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ...(g)-2 Section 1.402(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY.... § 1.402(g)-2 Increased limit for catch-up contributions. (a) General rule. Under section 402(g)(1)(C...(g) for a catch-up eligible participant (within the meaning of § 1.414(v)-1(g)), the otherwise...

  14. Study of Infrared Emission Spectroscopy for the B1Δg-A1Πu and B'1Σg+-A1Πu Systems of C2

    NASA Astrophysics Data System (ADS)

    Tang, Jian; Chen, Wang; Kawaguchi, Kentarou; Bernath, Peter F.

    2016-06-01

    Recently, we carried out the perturbation analysis of C_2 spectra and identified forbidden singlet-triplet intersystem transitions, which aroused further interest in other C_2 spectra for the many low-lying electronic states of this fundamental molecule. In 1988, the B1Δg-A1Πu and B'1Σg+-A1Πu band systems were discovered by Douay et al., who observed eight bands of the B1Δg-A1Πu system with v up to 5 for the B1Δg state and six bands of the B'1Σg+-A1Πu system with v up to 3 for the B'1Σg+ state in the Fourier transform infrared emission spectra of hydrocarbon discharges. In the work presented here, we identified twenty-four bands of the two systems, among which the B'1Σg+ v = 4 and the B1Δg v = 6, 7 and 8 vibrational levels involved in nine bands were studied for the first time. A direct global analysis with Dunham parameters was carried out satisfactorily for the B1Δg-A1Πu system except for a small perturbation in the B1Δg v = 6 level. The calculated rovibrational term energies up to B1Δg v = 12 showed that the level crossing between the B1Δg and d3Πg states is responsible for many of the prominent perturbations in the Swan system observed previously. Nineteen lines of the B1Δg-a3Πu forbidden transitions were identified and the off-diagonal spin-orbit interaction constant AdB between d3Πg and B1Δg was derived as 8.3(1) wn. For the B'1Σg+-A1Πu system, only individual band analyses for each vibrational level in the B'1Σg+ state could be done satisfactorily and Dunham parameters obtained from these effective parameters showed that the anharmonic vibrational constant ω_e x_e is anomalously small (nearly zero). Inspection of the RKR potential curves for the B'1Σg+ and X1Σg+ states revealed that an avoided crossing may occur around 30000 wn, which is responsible for the anomalous molecular constants in these two states. W. Chen, K. Kawaguchi, P. F. Bernath, and J. Tang, J. Chem. Phys., 141, 064317 (2015) M. Douay, R. Nietmann and P. F. Bernath

  15. 26 CFR 1.402(g)-2 - Increased limit for catch-up contributions.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ....402(g)-2 Section 1.402(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY.... § 1.402(g)-2 Increased limit for catch-up contributions. (a) General rule. Under section 402(g)(1)(C...(g) for a catch-up eligible participant (within the meaning of § 1.414(v)-1(g)), the otherwise...

  16. 26 CFR 1.402(g)-2 - Increased limit for catch-up contributions.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ....402(g)-2 Section 1.402(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY.... § 1.402(g)-2 Increased limit for catch-up contributions. (a) General rule. Under section 402(g)(1)(C...(g) for a catch-up eligible participant (within the meaning of § 1.414(v)-1(g)), the otherwise...

  17. 26 CFR 1.402(g)-2 - Increased limit for catch-up contributions.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ....402(g)-2 Section 1.402(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY.... § 1.402(g)-2 Increased limit for catch-up contributions. (a) General rule. Under section 402(g)(1)(C...(g) for a catch-up eligible participant (within the meaning of § 1.414(v)-1(g)), the otherwise...

  18. Interaction of 4.1G and cGMP-gated channels in rod photoreceptor outer segments.

    PubMed

    Cheng, Christiana L; Molday, Robert S

    2013-12-15

    In photoreceptors, the assembly of signaling molecules into macromolecular complexes is important for phototransduction and maintaining the structural integrity of rod outer segments (ROSs). However, the molecular composition and formation of these complexes are poorly understood. Using immunoprecipitation and mass spectrometry, 4.1G was identified as a new interacting partner for the cyclic-nucleotide gated (CNG) channels in ROSs. 4.1G is a widely expressed multifunctional protein that plays a role in the assembly and stability of membrane protein complexes. Multiple splice variants of 4.1G were cloned from bovine retina. A smaller splice variant of 4.1G selectively interacted with CNG channels not associated with peripherin-2-CNG channel complex. A combination of truncation studies and domain-binding assays demonstrated that CNG channels selectively interacted with 4.1G through their FERM and CTD domains. Using immunofluorescence, labeling of 4.1G was seen to be punctate and partially colocalized with CNG channels in the ROS. Our studies indicate that 4.1G interacts with a subset of CNG channels in the ROS and implicate this protein-protein interaction in organizing the spatial arrangement of CNG channels in the plasma membrane of outer segments.

  19. Imaging Potential Evaluation of Fab Derived from the Anti-EGFRvIII Monoclonal Antibody 4G1.

    PubMed

    Jing, Shen; He, Yujia; He, Yanqiong; Wang, Liang; Jia, Jianhua; Shan, Xiaomin; Liu, Shuang; Tang, Min; Peng, Zhiping; Liu, Xujie

    2018-05-31

    As one of the most crucial epidermal growth factor receptor (EGFR) variants, EGFRvIII can be detected in various tumors but rarely in normal tissues, making it an ideal target for prognosis, diagnosis or immune therapy. The recently developed anti-EGFRvIII monoclonal antibody (mAb), 4G1, has been validated as a promising molecular probe to detect EGFRvIII expression in tumors by single-photon emission computed tomography/computed tomography imaging. To overcome shortcomings associated with the whole antibody, including long-term retention, circulation and enhanced permeability and retention effects, the Fab fragment of 4G1 (Fab-4G1) was generated, labeled with 131 I and evaluated in vitro and in vivo to test its potential application in molecular imaging. Whole mAb 4G1 was first digested by immobilized ficin and then purified through a protein A column to generate the Fab fragment, Fab-4G1. Next, SDS-PAGE, Western blot, indirect fluorescence assay, flow cytometry and enzyme-linked immunosorbent assay were performed to verify molecular weight, specificity and affinity of Fab-4G1. Finally, biodistribution planar gamma imaging was performed by injection of 131 I-labeled Fab-4G1 into xenografted EGFRvIII-overexpressed tumors in nude mice. Parallel studies were also performed with intact 4G1. The molecular weight of Fab was determined to be 35-40 kDa by SDS-PAGE. In vitro tests confirmed both intact 4G1 and Fab-4G1 specifically bound EGFRvIII but not wild-type EGFR, and Fab-4G1 showed decreased affinity. Compared to 131 I-4G1, biodistribution studies showed lower tumor uptake of 131 I-Fab-4G1 at all time points, but much faster elimination in all normal organs. As for planar gamma imaging, 131 I-Fab-4G1 and 31 I-4G1 showed similar imaging effect at 2 h after injection of tracer, while 131 I-Fab-4G1 was eliminated more quickly with time, suggesting radiolabeled Fab-4G1 could be potentially used for imaging of EGFRvIII-positive tumors at early time points. Radiolabeled

  20. Plasminogen activator inhibitor-1 4G/5G genotype and residual venous occlusion following acute unprovoked deep vein thrombosis of the lower limb: A prospective cohort study.

    PubMed

    Giurgea, Georgiana-Aura; Brunner-Ziegler, Sophie; Jilma, Bernd; Sunder-Plassmann, Raute; Koppensteiner, Renate; Gremmel, Thomas

    2017-05-01

    A recent study suggested that the plasminogen activator inhibitor (PAI)-1 4G/5G genotype may play a role in the resolution of deep vein thrombosis (DVT) after surgery. In the present study, we investigated the association between PAI-1 4G/5G genotype and the persistence of venous occlusion after acute idiopathic DVT of the lower limb. The PAI-1 4G/5G genotype was determined by real-Time PCR in 43 patients with unprovoked DVT of the lower limb. Residual venous occlusion was assessed by duplex sonography 1, 3, 6, 12 and 24months after the acute event. The PAI-1 Activity was determined by ELISA. Ten patients (23%) were homozygous for 4G (4G/4G), 27 patients (63%) were heterozygous 4G/5G and 6 patients (14%) were homozygous for 5G (5G/5G). Residual venous occlusion (RVO) was found in 77%, 65%, 58%, 56% and 37% of the overall study population, at 1, 3, 6, 12 and 24months after acute DVT, respectively. The presence of residual venous occlusion at 1, 3, 6, 12 and 24months after acute unprovoked DVT did not differ significantly between genotypes, but age was associated with RVO. Plasma levels of PAI-1 activity correlated with body mass index but was not associated with genotypes in our study. The PAI-1 4G/5G genotype was not a relevant predictor of persistent residual venous occlusion after idiopathic DVT, which however was associated with age. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Molecular Characterization of Echinococcus granulosus Cysts in North Indian Patients: Identification of G1, G3, G5 and G6 Genotypes

    PubMed Central

    Sharma, Monika; Sehgal, Rakesh; Fomda, Bashir Ahmad; Malhotra, Anil; Malla, Nancy

    2013-01-01

    Background Cystic echinococcosis (CE) caused by the Echinococcus granulosus, is a major public health problem worldwide, including India. The different genotypes of E. granulosus responsible for human hydatidosis have been reported from endemic areas throughout the world. However, the genetic characterization of E. granulosus infecting the human population in India is lacking. The aim of study was to ascertain the genotype(s) of the parasite responsible for human hydatidosis in North India. Methodology/Principal Findings To study the transmission patterns of E. granulosus, genotypic analysis was performed on hydatid cysts obtained from 32 cystic echinococcosis (CE) patients residing in 7 different states of North India. Mitochondrial cytochrome c oxidase subunit1 (cox1) sequencing was done for molecular identification of the isolates. Most of the CE patients (30/32) were found to be infected with hydatid cyst of either G3 (53.1%) or G1 (40.62%) genotype and one each of G5 (cattle strain) and G6 (camel strain) genotype. Conclusions/Significance These findings demonstrate the zoonotic potential of G1 (sheep strain) and G3 (buffalo strain) genotypes of E. granulosus as these emerged as predominant genotypes infecting the humans in India. In addition to this, the present study reports the first human CE case infected with G5 genotype (cattle strain) in an Asian country and presence of G6 genotype (camel strain) in India. The results may have important implications in the planning of control strategies for human hydatidosis. PMID:23785531

  2. The G protein Gi1 exhibits basal coupling but not preassembly with G protein-coupled receptors.

    PubMed

    Bondar, Alexey; Lazar, Josef

    2017-06-09

    The G i/o protein family transduces signals from a diverse group of G protein-coupled receptors (GPCRs). The observed specificity of G i/o -GPCR coupling and the high rate of G i/o signal transduction have been hypothesized to be enabled by the existence of stable associates between G i/o proteins and their cognate GPCRs in the inactive state (G i/o -GPCR preassembly). To test this hypothesis, we applied the recently developed technique of two-photon polarization microscopy (2PPM) to Gα i1 subunits labeled with fluorescent proteins and four GPCRs: the α 2A -adrenergic receptor, GABA B , cannabinoid receptor type 1 (CB 1 R), and dopamine receptor type 2. Our experiments with non-dissociating mutants of fluorescently labeled Gα i1 subunits (exhibiting impaired dissociation from activated GPCRs) showed that 2PPM is capable of detecting GPCR-G protein interactions. 2PPM experiments with non-mutated fluorescently labeled Gα i1 subunits and α 2A -adrenergic receptor, GABA B , or dopamine receptor type 2 receptors did not reveal any interaction between the G i1 protein and the non-stimulated GPCRs. In contrast, non-stimulated CB 1 R exhibited an interaction with the G i1 protein. Further experiments revealed that this interaction is caused solely by CB 1 R basal activity; no preassembly between CB 1 R and the G i1 protein could be observed. Our results demonstrate that four diverse GPCRs do not preassemble with non-active G i1 However, we also show that basal GPCR activity allows interactions between non-stimulated GPCRs and G i1 (basal coupling). These findings suggest that G i1 interacts only with active GPCRs and that the well known high speed of GPCR signal transduction does not require preassembly between G proteins and GPCRs. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. A study of the possible association of plasminogen activator inhibitor type 1 4G/5G insertion/deletion polymorphism with susceptibility to schizophrenia and in its subtypes.

    PubMed

    Yenilmez, C; Ozdemir Koroglu, Z; Kurt, H; Yanas, M; Colak, E; Degirmenci, I; Gunes, H V

    2017-02-01

    Inhibition of the fibrinolytic system may occur at the level of plasminogen activation, mainly by PAI-1. Mental and physical stress caused to alterations of platelet function, and also decreased to fibrinolytic activity. Furthermore, stress-induced thrombosis regulation was proposed to be by PAI-1 in schizophrenia patients. In this study, the distribution of genotypes and frequency of alleles of the plasminogen activator inhibitor type 1 (PAI-1) gene 4G/5G polymorphism in different Turkish clinical schizophrenia subtypes was investigated for its role in schizophrenia development. The clinical schizophrenia subtypes include paranoid, catatonic, disorganized, undifferentiated and residual, as diagnosed according to the Diagnostic and Statistical Manual of Mental Disorders-Fourth Edition IV (DSM-IV). Samples of genomic DNA (250 total, including 150 schizophrenia patients and 100 healthy subjects) were analysed. PAI-1 4G/5G genotyping was performed by polymerase chain reaction-allele-specific amplification. PCR products were separated by 2% agarose gel electrophoresis and then visualized. The genotype distributions (P = 0·136) and allele frequencies (P = 0·721 for 4G, P = 0. 097 for 5G) were not significantly different between patients with schizophrenia and control subjects for the 4G/5G polymorphism. Similar results were also found for the genotype distributions (P = 0·640) and allele frequencies (P = 0·763 for 4G, P = 0·448 for 5G) in the clinical schizophrenia subtypes compared to the each other. We conclude that PAI-1 4G/5G polymorphism was not significantly associated with schizophrenia or its subtypes in the Turkish population. However, we recognize that with our sample sizes, we cannot exclude weak associations. © 2016 John Wiley & Sons Ltd.

  4. Selective Cytotoxicity of 1,3,4-Thiadiazolium Mesoionic Derivatives on Hepatocarcinoma Cells (HepG2)

    PubMed Central

    Valdameri, Glaucio; Rocha, Maria Eliane Merlin; Martinez, Glaucia Regina; Noleto, Guilhermina Rodrigues; Acco, Alexandra; Alves de Souza, Carlos Eduardo; Echevarria, Aurea; Moretto dos Reis, Camilla; Di Pietro, Attilio; Suter Correia Cadena, Sílvia Maria

    2015-01-01

    In this work, we evaluated the cytotoxicity of mesoionic 4-phenyl-5-(2-Y, 4-X or 4-X-cinnamoyl)-1,3,4-thiadiazolium-2-phenylamine chloride derivatives (MI-J: X=OH, Y=H; MI-D: X=NO2, Y=H; MI-4F: X=F, Y=H; MI-2,4diF: X=Y=F) on human hepatocellular carcinoma (HepG2), and non-tumor cells (rat hepatocytes) for comparison. MI-J, M-4F and MI-2,4diF reduced HepG2 viability by ~ 50% at 25 μM after 24-h treatment, whereas MI-D required a 50 μM concentration, as shown by 3-(4,5-dimethythiazol-2-yl)-2,5-diphenyltetrazolium bromide assays. The cytotoxicity was confirmed with lactate dehydrogenase assay, of which activity was increased by 55, 24 and 16% for MI-J, MI-4F and MI-2,4diF respectively (at 25 μM after 24 h). To identify the death pathway related to cytotoxicity, the HepG2 cells treated by mesoionic compounds were labeled with both annexin V and PI, and analyzed by flow cytometry. All compounds increased the number of doubly-stained cells at 25 μM after 24 h: by 76% for MI-J, 25% for MI-4F and MI-2,4diF, and 11% for MI-D. It was also verified that increased DNA fragmentation occurred upon MI-J, MI-4F and MI-2,4diF treatments (by 12%, 9% and 8%, respectively, at 25 μM after 24 h). These compounds were only weakly, or not at all, transported by the main multidrug transporters, P-glycoprotein, ABCG2 and MRP1, and were able to slightly inhibit their drug-transport activity. It may be concluded that 1,3,4-thiadiazolium compounds, especially the hydroxy derivative MI-J, constitute promising candidates for future investigations on in-vivo treatment of hepatocellular carcinoma. PMID:26083249

  5. The Cak1p Protein Kinase Is Required at G(1)/S and G(2)/M in the Budding Yeast Cell Cycle

    PubMed Central

    Sutton, A.; Freiman, R.

    1997-01-01

    The CAK1 gene encodes the major CDK-activating kinase (CAK) in budding yeast and is required for activation of Cdc28p for cell cycle progression from G(2) to M phase. Here we describe the isolation of a mutant allele of CAK1 in a synthetic lethal screen with the Sit4 protein phosphatase. Analysis of several different cak1 mutants shows that although the G(2) to M transition appears most sensitive to loss of Cak1p function, Cak1p is also required for activation of Cdc28p for progression from G(1) into S phase. Further characterization of these mutants suggests that, unlike the CAK identified from higher eukaryotes, Cak1p of budding yeast may not play a role in general transcription. Finally, although Cak1 protein levels and in vitro protein kinase activity do not fluctuate during the cell cycle, at least a fraction of Cak1p associates with higher molecular weight proteins, which may be important for its in vivo function. PMID:9286668

  6. A double chain reversal loop and two diagonal loops define the architecture of a unimolecular DNA quadruplex containing a pair of stacked G(syn)-G(syn)-G(anti)-G(anti) tetrads flanked by a G-(T-T) Triad and a T-T-T triple.

    PubMed

    Kuryavyi, V; Majumdar, A; Shallop, A; Chernichenko, N; Skripkin, E; Jones, R; Patel, D J

    2001-06-29

    The architecture of G-G-G-G tetrad-aligned DNA quadruplexes in monovalent cation solution is dependent on the directionality of the four strands, which in turn are defined by loop connectivities and the guanine syn/anti distribution along individual strands and within individual G-G-G-G tetrads. The smallest unimolecular G-quadruplex belongs to the d(G2NnG2NnG2NnG2) family, which has the potential to form two stacked G-tetrads linked by Nn loop connectivities. Previous studies have focused on the thrombin-binding DNA aptamer d(G2T2G2TGTG2T2G2), where Nn was T2 for the first and third connecting loops and TGT for the middle connecting loop. This DNA aptamer in K(+) cation solution forms a unimolecular G-quadruplex stabilized by two stacked G(syn)-G(anti)-G(syn)-G(anti) tetrads, adjacent strands which are antiparallel to each other and edge-wise connecting T2, TGT and T2 loops. We now report on the NMR-based solution structure of the d(G2T4G2CAG2GT4G2T) sequence, which differs from the thrombin-binding DNA aptamer sequence in having longer first (T4) and third (GT4) loops and a shorter (CA) middle loop. This d(G2T4G2CAG2GT4G2T) sequence in Na(+) cation solution forms a unimolecular G-quadruplex stabilized by two stacked G(syn)-G(syn)-G(anti)-G(anti) tetrads, adjacent strands which have one parallel and one antiparallel neighbors and distinct non-edge-wise loop connectivities. Specifically, the longer first (T4) and third (GT4) loops are of the diagonal type while the shorter middle loop is of the double chain reversal type. In addition, the pair of stacked G-G-G-G tetrads are flanked on one side by a G-(T-T) triad and on the other side by a T-T-T triple. The distinct differences in strand directionalities, loop connectivities and syn/anti distribution within G-G-G-G tetrads between the thrombin-binding DNA aptamer d(G2T2G2TGTG2T2G2) quadruplex reported previously, and the d(G2T4G2CAG2GT4G2T) quadruplex reported here, reinforces the polymorphic nature of higher

  7. Contribution of cysteine residues to the structure and function of herpes simplex virus gH/gL

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cairns, Tina M.; Landsburg, Daniel J.; Charles Whitbeck, J.

    2005-02-20

    In HSV types 1 and 2, gH forms a noncovalent heterodimer with gL. Previous studies demonstrated that the first 323 amino acids of gH1 and the first 161 amino acids of gL1 are sufficient for gH/gL binding. For gL1, substitution of any of its four cysteine (C) residues (all located within the gH/gL binding region) destroyed gH binding and function. Although gH1 contains 8 cysteines in its ectodomain, gH 2 contains 7 (C3 of gH1 is replaced by arginine in gH2). We found that mutation of any of the four C-terminal cysteines led to a reduction or loss of gH/gLmore » function. Mutation of C5 or C6 in gH1 or gH2 rendered the proteins non-functional. However, substitution of C7 and/or C8 in gH1 has a definite negative impact on cell-cell fusion, although these mutations had less effect on complementation. Remarkably, all four gH1 N-terminal cysteines could be mutated simultaneously with little effect on fusion or complementation. As gH2 already lacks C3, we constructed a triple mutant (gH2-C1/2/4) which exhibited a similar phenotype. Since gH1 is known to bind gL2 and vice versa, we wondered whether binding of gH2 to the heterologous gL1 would enhance the fusion defect seen with the gH2-C2 mutant. The combination of mutant gH2-C2 with wild-type gL1 was nonfunctional in a cell-cell fusion assay. Interestingly, the reciprocal was not true, as gH1-C2 could utilize both gL1 and gL2. These findings suggest that there is a structural difference in the gH2 N-terminus as compared to gH1. We also present genetic evidence for at least one disulfide bond within gH2, between cysteines 2 and 4.« less

  8. Association of Plasminogen Activator Inhibitor-Type 1 (-675 4G/5G) Polymorphism with Pre-Eclampsia: Systematic Review

    PubMed Central

    Morgan, Jessie A.; Bombell, Sarah; McGuire, William

    2013-01-01

    Background and Aims Excessive generation of plasminogen activator inhibitor-type 1 (PAI-1) is implicated in the pathogenesis of pre-eclampsia and related conditions. The PAI-1 (−675 4G/5G) promoter polymorphism (rs1799889) affects transcriptional activity and is a putative genetic risk factor for pre-eclampsia. The aim of this study was identify, appraise and synthesise the available evidence for the association of the PAI-1 (−675 4G/5G) polymorphism with pre-eclampsia. Methods Systematic review and random effects meta-analysis of genetic association studies. Results We found 12 eligible genetic association studies in which a total of 1511 women with pre-eclampsia, eclampsia or HELLP syndrome and 3492 controls participated. The studies were generally small (median number of cases 102, range 24 to 403) and underpowered to detect plausible association sizes. Meta-analysis of all of the studies detected statistically significant gene-disease associations in the recessive [pooled odds ratio 1.28 (95% confidence interval 1.09, 1.50); population attributable risk 7.7%] and dominant [pooled odds ratio 1.21 (95% confidence interval 1.01, 1.44); population attributable risk 13.7%] models. We did not find evidence of statistical heterogeneity, funnel plot asymmetry or small study bias. Conclusions These data suggest that the fibrinolytic pathway regulated by the PAI-1 gene may contribute to the pathogenesis of pre-eclampsia and related conditions. This association, if confirmed in larger genetic association studies, may inform research efforts to develop novel interventions or help to prioritise therapeutic targets that merit evaluation in randomised clinical trials. PMID:23457639

  9. An evaluation of the rate of absorption of solar radiation in the O2(X3Sigma-g - b1Sigma-g) transition

    NASA Technical Reports Server (NTRS)

    Mlynczak, Martin G.

    1993-01-01

    The rate at which molecular oxygen absorbs radiation in the O2(X3Sigma-g - b1Sigma-g) transition is calculated using a line-by-line radiative transfer model. This rate is critical to the determination of the population of the O2(b1Sigma-g) state required for studies of the O2(b1Sigma-g - X3Sigma-g) dayglow, the O2(a1Delta-g - X3Sigma-g) dayglow, and possibly the rates of oxidation of H2 and N2O. Previous evaluations of this rate (which is sometimes called the g-factor) have significantly overestimated its value. The rate is tabulated as a function of altitude, pressure, and solar zenith angle.

  10. 26 CFR 1.149(g)-1 - Hedge bonds.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 26 Internal Revenue 2 2012-04-01 2012-04-01 false Hedge bonds. 1.149(g)-1 Section 1.149(g)-1...) INCOME TAXES (CONTINUED) Tax Exemption Requirements for State and Local Bonds § 1.149(g)-1 Hedge bonds... for purposes of section 149(g) and this section. In addition, the following terms have the following...

  11. 26 CFR 1.149(g)-1 - Hedge bonds.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 26 Internal Revenue 2 2014-04-01 2014-04-01 false Hedge bonds. 1.149(g)-1 Section 1.149(g)-1...) INCOME TAXES (CONTINUED) Tax Exemption Requirements for State and Local Bonds § 1.149(g)-1 Hedge bonds... for purposes of section 149(g) and this section. In addition, the following terms have the following...

  12. 26 CFR 1.149(g)-1 - Hedge bonds.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 26 Internal Revenue 2 2011-04-01 2011-04-01 false Hedge bonds. 1.149(g)-1 Section 1.149(g)-1...) INCOME TAXES (CONTINUED) Tax Exemption Requirements for State and Local Bonds § 1.149(g)-1 Hedge bonds... for purposes of section 149(g) and this section. In addition, the following terms have the following...

  13. 26 CFR 1.149(g)-1 - Hedge bonds.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 26 Internal Revenue 2 2013-04-01 2013-04-01 false Hedge bonds. 1.149(g)-1 Section 1.149(g)-1...) INCOME TAXES (CONTINUED) Tax Exemption Requirements for State and Local Bonds § 1.149(g)-1 Hedge bonds... for purposes of section 149(g) and this section. In addition, the following terms have the following...

  14. 26 CFR 1.149(g)-1 - Hedge bonds.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 26 Internal Revenue 2 2010-04-01 2010-04-01 false Hedge bonds. 1.149(g)-1 Section 1.149(g)-1...) INCOME TAXES (CONTINUED) Tax Exemption Requirements for State and Local Bonds § 1.149(g)-1 Hedge bonds... for purposes of section 149(g) and this section. In addition, the following terms have the following...

  15. An ingenious strategy of preparing TiO2/g-C3N4 heterojunction photocatalyst: In situ growth of TiO2 nanocrystals on g-C3N4 nanosheets via impregnation-calcination method

    NASA Astrophysics Data System (ADS)

    Zhang, Guanghui; Zhang, Tianyong; Li, Bin; Jiang, Shuang; Zhang, Xia; Hai, Li; Chen, Xingwei; Wu, Wubin

    2018-03-01

    An ingenious method was employed to design and fabricate the TiO2/g-C3N4 heterojunction photocatalysts in this study. The thermal oxidation etching of g-C3N4 nanosheets and the in situ growth of TiO2 nanocrystal on the surface of g-C3N4 nanosheets were completed simultaneously by the calcination process. The g-C3N4 nanosheets played a crucial role in regulating and assembling the structures and morphologies of TiO2. Furthermore, the thickness and content of g-C3N4, and the crystallinity of TiO2 in TiO2/g-C3N4 composites could be regulated and controlled by the calcination temperature. Among the resultant TiO2/g-C3N4 samples, the TiO2/g-C3N4 sample with 41.6 wt% g-C3N4 exhibited the highest photocatalytic activity. It could degrade almost all MO molecules under visible light irradiation within 3 h. Moreover, it displayed higher visible light photocatalytic performance for degrading MO solution than pure g-C3N4 and D-TiO2. The synergistic effect between TiO2 and g-C3N4 makes significant contributions to the enhancement of the visible light photocatalytic activity. In addition, the favorable photocatalytic performance of TiO2/g-C3N4 nanocomposites is also attributed to the porous structures and uniform morphologies, and large surface area. Furthermore, the resultant TiO2/g-C3N4 exhibits excellent photocatalytic stability. Radical trapping experiments indicated that rad O2- and h+ were the main reactive species during the photodegradation process under visible light irradiation. Hopefully, the results can offer new design and strategy for preparing other g-C3N4-based nanocomposites for environmental and energy applications.

  16. Polymorphisms of endothelin 1 (G5665T and T-1370G) and endothelin receptor type A (C+70G and G-231A) in Graves' disease.

    PubMed

    Aydın, A Fatih; Develi-İş, Seval; Doğru-Abbasoğlu, Semra; Vural, Pervin; Ozderya, Ayşenur; Karadağ, Berrin; Uysal, Müjdat

    2014-01-01

    Endothelin 1 (EDN1) is a strong angiogenic and mitogenic factor, playing a key role in hypervascularization, thyroid follicle cell hyperplasia, and lymphocyte infiltration in the thyroid gland of patients with Graves' disease (GD). EDN1 induces angiogenesis and mitogenesis via endothelin receptor type A (EDNRA). This study examined the possible association of EDN1 (G5665T and T-1370G) and EDNRA (C+70G and G-231A) single nucleotide polymorphisms (SNPs) with the occurrence of GD, and evaluates the relationship between genotypes and clinical/laboratory manifestations of GD. We analyzed genotype and allele distributions of EDN1 and EDNRA polymorphisms in 165 patients with GD and 181 healthy controls by real-time PCR combined with melting curve analysis. No significant associations between GD and variant alleles of the studied polymorphisms were observed. However, the anti-thyroid peroxidase (anti-TPO) and anti-thyroglobulin (anti-TG) levels in EDN1 G5665T GG genotype were higher than those in T allele carriers (GT+TT) (p=0.001 and p=0.026, respectively). In addition, anti-TPO levels in EDN1 T-1370G wild-type homozygous patients were found to be higher than in mutant gene carrying patients (GT+GG) (p=0.006). The presence of EDNRA+70G allele was associated with 3.37-fold increased risk for development of ophthalmopathy in GD patients (p=0.009). Although there were no associations between EDN1 (G5665T and T-1370G) and EDNRA (C+70G and G-231A) SNPs and susceptibility to GD, EDN1 G5665T and T-1370G polymorphisms were related to alterations of autoantibody production and EDNRA C+70G polymorphism is related with increased risk for ophthalmopathy in GD patients. Copyright © 2013 Elsevier B.V. All rights reserved.

  17. Assembling of G-strands into novel tetra-molecular parallel G4-DNA nanostructures using avidin-biotin recognition.

    PubMed

    Borovok, Natalia; Iram, Natalie; Zikich, Dragoslav; Ghabboun, Jamal; Livshits, Gideon I; Porath, Danny; Kotlyar, Alexander B

    2008-09-01

    We describe a method for the preparation of novel long (hundreds of nanometers), uniform, inter-molecular G4-DNA molecules composed of four parallel G-strands. The only long continuous G4-DNA reported so far are intra-molecular structures made of a single G-strand. To enable a tetra-molecular assembly of the G-strands we developed a novel approach based on avidin-biotin biological recognition. The steps of the G4-DNA production include: (i) Enzymatic synthesis of long poly(dG)-poly(dC) molecules with biotinylated poly(dG)-strand; (ii) Formation of a complex between avidin-tetramer and four biotinylated poly(dG)-poly(dC) molecules; (iii) Separation of the poly(dC) strands from the poly(dG)-strands, which are connected to the avidin; (iv) Assembly of the four G-strands attached to the avidin into tetra-molecular G4-DNA. The average contour length of the formed structures, as measured by AFM, is equal to that of the initial poly(dG)-poly(dC) molecules, suggesting a tetra-molecular mechanism of the G-strands assembly. The height of tetra-molecular G4-nanostructures is larger than that of mono-molecular G4-DNA molecules having similar contour length. The CD spectra of the tetra- and mono-molecular G4-DNA are markedly different, suggesting different structural organization of these two types of molecules. The tetra-molecular G4-DNA nanostructures showed clear electrical polarizability. This suggests that they may be useful for molecular electronics.

  18. 26 CFR 1.904(g)-2 - Recapture of overall domestic losses.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 26 Internal Revenue 9 2010-04-01 2010-04-01 false Recapture of overall domestic losses. 1.904(g)-2 Section 1.904(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES Income from Sources Without the United States § 1.904(g)-2 Recapture...

  19. Body adiposity but not insulin resistance is associated with -675 4G/5G polymorphism in the PAI-1 gene in a sample of Mexican children.

    PubMed

    de la Cruz-Mosso, Ulises; Muñoz-Valle, José Francisco; Salgado-Bernabé, Aralia Berenice; Castro-Alarcón, Natividad; Salgado-Goytia, Lorenzo; Sánchez-Corona, José; Flores-Martínez, Silvia Esperanza; Parra-Rojas, Isela

    2013-01-01

    To assess whether the -675 4G/5G polymorphism in the plasminogen activator inhibitor-1 gene is associated with obesity and insulin resistance in Mexican children. A cross-sectional study was performed in 174 children, 89 with normal-weight and 85 with obesity, aged from 6 to 13 years. All children were from state of Guerrero, and recruited from three primary schools in the city of Chilpancingo, state of Guerrero, Mexico. Insulin levels were determined by immunoenzymatic assay. The homeostasis model assessment was used to determine insulin resistance. The -675 4G/5G polymorphism in PAI-1 gene was analyzed by polymerase chain reaction-restriction fragment length polymorphism. The prevalence of insulin resistance in the obese group was higher (49.41%) than in the normal-weight group (16.85%). The 4G/5G PAI-1 polymorphism was found in Hardy Weinberg equilibrium. The 4G/5G genotype contributed to a significant increase in waist-hip ratio (β=0.02, p=0.006), waist circumference (β=4.42, p=0.009), and subscapular skinfold thickness (β=1.79, p=0.04); however, it was not related with insulin resistance. The -675 4G/5G genotype of PAI-1 gene was associated with increase of body adiposity in Mexican children. Copyright © 2013 Sociedade Brasileira de Pediatria. Published by Elsevier Editora Ltda. All rights reserved.

  20. Dose rate, mitotic cycle duration, and sensitivity of cell transitions from G1 $Yields$ S and G2 $Yields$ M to protracted gamma radiation in root meristems

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Evans, L.S.; Hof, J.V.

    1975-11-01

    Experiments were designed to determine the relative radiosensitivity of the cell transition points of G1 $Yields$ S and G2 $Yields$ M in root meristems of several plant species. Label and mitotic indices and microspectrophotometry were used to measure the proportions of cells in each mitotic cycle stage in root meristems after protracted gamma radiation. The criterion of radiosensitivity was the dose rate needed to produce a tissue with less than 1 percent cells in S and none in M after 3 days of continuous exposure. The results show that DNA is the primary radiation target in proliferative root meristems andmore » that the cycle duration stipulates the time interval of vulnerability. In each species, nonrandom reproducible cell proportions were established with 2C:4C:8C amounts of nuclear DNA after 3 days of exposure. Roots of Helianthus annuus, Crepis capillaris, and Tradescantia clone 02 had 80 percent cells with a 2C amount of DNA and 20 percent had a 4C amount of DNA. In these species the transition point of G1 $Yields$ S was more radiosensitive than G2 $Yields$ M. Roots of Pisum sativum and Triticum aestivum had cell proportions at 2C:4C:8C amounts of DNA in frequencies of 0.10 to 0.20:0.40 to 0.60:0.30 to 0.40. In these two species 0.30 to 0.40 cells underwent radiation-induced endoreduplication that resulted from a rapid inhibition of cell transit from G2 $Yields$ M and a slower impairment of G1 $Yields$ S. Cells increased from 2C to 4C and from 4C to 8C amounts of DNA during irradiation. The proportions of nuclei with 2C:4C:8C amounts of DNA were dependent in part upon the relative radiosensitivity of the G1 $Yields$ S and G2 $Yields$ M control points. The data show the relative radiosensitivity of the transition points from G1 $Yields$ S and from G2 $Yields$ M was species specific and unrelated to the cycle duration and mean nuclear DNA content of the plant species. (auth)« less

  1. A New Synthetic Allotetraploid (A1A1G2G2) between Gossypium herbaceum and G. australe: Bridging for Simultaneously Transferring Favorable Genes from These Two Diploid Species into Upland Cotton

    PubMed Central

    Chen, Yu; Wang, Yingying; Chen, Jinjin; Zhang, Tianzhen; Zhou, Baoliang

    2015-01-01

    Gossypium herbaceum, a cultivated diploid cotton species (2n = 2x = 26, A1A1), has favorable traits such as excellent drought tolerance and resistance to sucking insects and leaf curl virus. G. australe, a wild diploid cotton species (2n = 2x = 26, G2G2), possesses numerous economically valuable characteristics such as delayed pigment gland morphogenesis (which is conducive to the production of seeds with very low levels of gossypol as a potential food source for humans and animals) and resistance to insects, wilt diseases and abiotic stress. Creating synthetic allotetraploid cotton from these two species would lay the foundation for simultaneously transferring favorable genes into cultivated tetraploid cotton. Here, we crossed G. herbaceum (as the maternal parent) with G. australe to produce an F1 interspecific hybrid and doubled its chromosome complement with colchicine, successfully generating a synthetic tetraploid. The obtained tetraploid was confirmed by morphology, cytology and molecular markers and then self-pollinated. The S1 seedlings derived from this tetraploid gradually became flavescent after emergence of the fifth true leaf, but they were rescued by grafting and produced S2 seeds. The rescued S1 plants were partially fertile due to the existence of univalents at Metaphase I of meiosis, leading to the formation of unbalanced, nonviable gametes lacking complete sets of chromosomes. The S2 plants grew well and no flavescence was observed, implying that interspecific incompatibility, to some extent, had been alleviated in the S2 generation. The synthetic allotetraploid will be quite useful for polyploidy evolutionary studies and as a bridge for transferring favorable genes from these two diploid species into Upland cotton through hybridization. PMID:25879660

  2. Enhanced visible light photocatalytic H2-production of g-C3N4/WS2 composite heterostructures

    NASA Astrophysics Data System (ADS)

    Akple, Maxwell Selase; Low, Jingxiang; Wageh, S.; Al-Ghamdi, Ahmed. A.; Yu, Jiaguo; Zhang, Jun

    2015-12-01

    As a clean and renewable solar H2-production system to address the increasing global environmental crisis and energy demand, photocatalytic hydrogen production from water splitting using earth abundant materials has received a lot of attention. In this study, WS2-graphitic carbon nitride (g-C3N4) composites were prepared using WO3 and thiourea as precursors through a gas-solid reaction. Different amount of WS2 were loaded on g-C3N4 to form the heterostructures and the composite samples exhibited enhanced photocatalytic activity for H2 production under visible light. The composite sample with 0.01 wt% WS2 exhibited the highest H2-production rate of 101 μmol g-1 h-1, which was even better than that of the Pt-C3N4 sample with the same loading content. The high photocatalytic activity was attributed to the formation of heterojunction between g-C3N4 and WS2 cocatalyst which allowed for effective separation of photogenerated charge carriers. This work showed the possibility for the utilization of low cost WS2 as an efficient cocatalyst to promote the photocatalytic H2 production of g-C3N4.

  3. 26 CFR 1.904(g)-2 - Recapture of overall domestic losses.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 26 Internal Revenue 9 2012-04-01 2012-04-01 false Recapture of overall domestic losses. 1.904(g)-2 Section 1.904(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Income from Sources Without the United States § 1.904(g...

  4. 26 CFR 1.904(g)-2 - Recapture of overall domestic losses.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 26 Internal Revenue 9 2011-04-01 2011-04-01 false Recapture of overall domestic losses. 1.904(g)-2 Section 1.904(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Income from Sources Without the United States § 1.904(g...

  5. 26 CFR 1.904(g)-2 - Recapture of overall domestic losses.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 26 Internal Revenue 9 2014-04-01 2014-04-01 false Recapture of overall domestic losses. 1.904(g)-2 Section 1.904(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Income from Sources Without the United States § 1.904(g...

  6. 26 CFR 1.904(g)-2 - Recapture of overall domestic losses.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 26 Internal Revenue 9 2013-04-01 2013-04-01 false Recapture of overall domestic losses. 1.904(g)-2 Section 1.904(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Income from Sources Without the United States § 1.904(g...

  7. 26 CFR 1.402(g)-2 - Increased limit for catch-up contributions.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ....402(g)-2 Section 1.402(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES Pension, Profit-Sharing, Stock Bonus Plans, Etc. § 1.402(g)-2 Increased limit for catch-up contributions. (a) General rule. Under section 402(g)(1)(C), in determining the...

  8. Complementary Paired G4FETs as Voltage-Controlled NDR Device

    NASA Technical Reports Server (NTRS)

    Mojarradi, Mohammad; Chen, Suheng; Blalock, Ben; Britton, Chuck; Prothro, Ben; Vandersand, James; Schrimph, Ron; Cristoloveanu, Sorin; Akavardar, Kerem; Gentil, P.

    2009-01-01

    It is possible to synthesize a voltage-controlled negative-differential-resistance (NDR) device or circuit by use of a pair of complementary G4FETs (four-gate field-effect transistors). [For more information about G4FETs, please see the immediately preceding article]. As shown in Figure 1, the present voltage-controlled NDR device or circuit is an updated version of a prior NDR device or circuit, known as a lambda diode, that contains a pair of complementary junction field-effect transistors (JFETs). (The lambda diode is so named because its current-versus- voltage plot bears some resemblance to an upper-case lambda.) The present version can be derived from the prior version by substituting G4FETs for the JFETs and connecting both JFET gates of each G4FET together. The front gate terminals of the G4FETs constitute additional terminals (that is, terminals not available in the older JFET version) to which one can apply control voltages VN and VP. Circuits in which NDR devices have been used include (1) Schmitt triggers and (2) oscillators containing inductance/ capacitance (LC) resonant circuits. Figure 2 depicts such circuits containing G4FET NDR devices like that of Figure 1. In the Schmitt trigger shown here, the G4FET NDR is loaded with an ordinary inversion-mode, p-channel, metal oxide/semiconductor field-effect transistor (inversion-mode PMOSFET), the VN terminal of the G4FET NDR device is used as an input terminal, and the input terminals of the PMOSFET and the G4FET NDR device are connected. VP can be used as an extra control voltage (that is, a control voltage not available in a typical prior Schmitt trigger) for adjusting the pinch-off voltage of the p-channel G4FET and thereby adjusting the trigger-voltage window. In the oscillator, a G4FET NDR device is loaded with a conventional LC tank circuit. As in other LC NDR oscillators, oscillation occurs because the NDR counteracts the resistance in the tank circuit. The advantage of this G4FET-NDR LC oscillator

  9. IgG4-related tubulointerstitial nephritis: A prospective analysis.

    PubMed

    Nada, Ritambhra; Ramachandran, Raja; Kumar, Ashwani; Rathi, Manish; Rawat, Amit; Joshi, Kusum; Kohli, Harbir Singh; Gupta, Krishan Lal

    2016-07-01

    Immunoglobulin-G4 (IgG4)-related tubulo-interstitial nephritis (IgG4TIN) could be the first presentation of IgG4-related systemic disease. Most of the data is from the West or Japan and retrospective, with good patient outcome. This study was carried out from April 2011 to July 2013. We report a prospective follow-up of 11 patients who presented with renal dysfunction and had histological diagnosis of IgG4TIN followed for a minimum period of 1 year or until end-stage renal disease. IgG4TIN constituted 0.28% of total renal biopsies and 6.5% of all tubulointerstitial nephritis. Patient ages ranged between 21 and 71 years with a male predominance. All the patients had renal dysfunction at presentation with a mean serum creatinine of 5.12 mg/dL. Proteinuria was subnephrotic except when there was coexisting membranous glomerulonephritis (36.4%). The mean 24-h urine protien excretion was 1.8 g. Serum IgG4 levels were elevated in 10 (90.9%) patients. Ten (90.9%) patients had renomegaly and one (9.1%) had focal renal mass. Extra-renal manifestations were present in seven (63.6%). Renal histology showed pattern A in five (45.5%), pattern B in four (36.3%) and pattern C in two (18.1%) patients. All but one patient (90.9%) received immunosuppressive therapy. Four (36.3%) achieved complete remission and three (27.2%) progressed to end stage renal disease. Two patients died due to infections while on steroid therapy. One patient with a mass had end stage renal disease for 12 months and did not improve with steroid therapy, and one (pattern C) had progressive chronic kidney disease on follow-up. IgG4TIN in an Indian cohort most often presents with rapidly progressive renal failure and less often has extra-renal organ involvement. On follow-up, patients can experience a more aggressive course with progression to end stage renal disease. © 2015 Asia Pacific League of Associations for Rheumatology and Wiley Publishing Asia Pty Ltd.

  10. Occurrence of IgG4-related hypophysitis lacking IgG4-bearing plasma cell infiltration during steroid therapy.

    PubMed

    Ohkubo, Yohsuke; Sekido, Takashi; Takeshige, Keiko; Ishi, Hiroaki; Takei, Masahiro; Nishio, Shin-ichi; Yamazaki, Masanori; Komatsu, Mitsuhisa; Kawa, Shigeyuki; Suzuki, Satoru

    2014-01-01

    Eight years after an episode of multiple IgG4-related disease, a pituitary mass with panhypopituitarism and a visual disturbance developed in a 70-year-old man under low-dose steroid therapy. A pituitary biopsy revealed findings of lymphocytic hypophysitis with the absence of IgG4-positive plasma cell infiltration. The serum IgG4 level was unremarkable. Although performing a pituitary biopsy and measuring the serum IgG4 level is crucial for making a diagnosis of IgG4-related hypophysitis, it is occasionally difficult to diagnose the disease in patients treated with steroid therapy, as observed in the present case. Based on a review of the diagnosis, conducting a careful assessment is required, especially in men and elderly patients thought to have solitary hypophysitis.

  11. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

    PubMed

    Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

    2017-10-01

    Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

  12. G2 Flywheel Module Design

    NASA Technical Reports Server (NTRS)

    Jensen, Ralph H.; Dever, Timothy P.

    2006-01-01

    Design of a flywheel module, designated the G2 module, is described. The G2 flywheel is a 60,000 RPM, 525 W-hr, 1 kW system designed for a laboratory environment; it will be used for component testing and system demonstrations, with the goal of applying flywheels to aerospace energy storage and integrated power and attitude control (IPACS) applications. G2 has a modular design, which allows for new motors, magnetic bearings, touchdown bearings, and rotors to be installed without a complete redesign of the system. This design process involves several engineering disciplines, and requirements are developed for the speed, energy storage, power level, and operating environment. The G2 rotor system consists of a multilayer carbon fiber rim with a titanium hub on which the other components mount, and rotordynamics analysis is conducted to ensure rigid and flexible rotor modes are controllable or outside of the operating speed range. Magnetic bearings are sized using 1-D magnetic circuit analysis and refined using 3-D finite element analysis. The G2 magnetic bearing system was designed by Texas A&M and has redundancy which allows derated operation after the loss of some components, and an existing liquid cooled two pole permanent magnet motor/generator is used. The touchdown bearing system is designed with a squeeze film damper system allowing spin down from full operating speed in case of a magnetic bearing failure. The G2 flywheel will enable module level demonstrations of component technology, and will be a key building block in system level attitude control and IPACS demonstrations.

  13. A Novel Polysaccharide Conjugate from Bullacta exarata Induces G1-Phase Arrest and Apoptosis in Human Hepatocellular Carcinoma HepG2 Cells.

    PubMed

    Liao, Ningbo; Sun, Liang; Chen, Jiang; Zhong, Jianjun; Zhang, Yanjun; Zhang, Ronghua

    2017-03-01

    Bullacta exarata has been consumed in Asia, not only as a part of the normal diet, but also as a traditional Chinese medicine with liver- and kidney-benefitting functions. Several scientific investigations involving extraction of biomolecules from this mollusk and pharmacological studies on their biological activities have been carried out. However, little is known regarding the antitumor properties of polysaccharides from B. exarata , hence the polysaccharides from B. exarata have been investigated here. One polysaccharide conjugate BEPS-IA was isolated and purified from B. exarata . It mainly consisted of mannose and glucose in a molar ratio of 1:2, with an average molecular weight of 127 kDa. Thirteen general amino acids were identified to be components of the protein-bound polysaccharide. Methylation and NMR studies revealed that BEPS-IA is a heteropolysaccharide consisting of 1,4-linked-α-d-Glc, 1,6-linked-α-d-Man, 1,3,6-linked-α-d-Man, and 1-linked-α-d-Man residue, in a molar ratio of 6:1:1:1. In order to test the antitumor activity of BEPS-IA, we investigated its effect against the growth of human hepatocellular carcinoma cells HepG2 in vitro. The result showed that BEPS-IA dose-dependently exhibited an effective HepG2 cells growth inhibition with an IC 50 of 112.4 μg/mL. Flow cytometry analysis showed that BEPS-IA increased the populations of both apoptotic sub-G1 and G1 phase. The result obtained from TUNEL assay corroborated apoptosis which was shown in flow cytometry. Western blot analysis suggested that BEPS-IA induced apoptosis and growth inhibition were associated with up-regulation of p53, p21 and Bax, down-regulation of Bcl-2. These findings suggest that BEPS-IA may serve as a potential novel dietary agent for hepatocellular carcinoma.

  14. Synthesis and biological activity of novel series of 4-methoxy, and 4,9-dimethoxy-5-substituted furo[2,3-g]-1,2,3-benzoxathiazine-7,7-dioxide derivatives

    PubMed Central

    El-Sawy, Eslam R.; Ebaid, Manal S.; Abo-Salem, Heba M.; El-Hallouty, Salwa; Kassem, Emad M.; Mandour, Adel H.

    2013-01-01

    A novel series of 4-methoxy, and 4,9-dimethoxy-5-substituted furo[2,3-g]-1,2,3-benzoxathiazine-7,7-dioxide derivatives 3a,b, 10a–g and 11a–g were prepared in good yields via the reaction of 4-methoxy (1a) and 4,7-dimethoxy-5-acetyl-6-hydroxybenzofurans (1b) and their α,β-unsaturated keto derivatives 6a–g and 7a–g with chlorosulfonyl isocyanate (CSI). On the other hand, N-chlorosulfonyl carbamate derivatives 4a,b, 12a,b and 13a,b were prepared and allowed to react with piperidine to give the corresponding N-piperidinosulfonyl carbamate derivatives 5a,b, 14a,b and 15a,b, respectively. Sixteen new target compounds 3a,b, 10a–g, and 11a–g were tested for their DPPH radical-scavenging, and in vitro antiproliferative activity against A-549, MCF7 and HCT-116 cancer cell lines. Compounds 10a, 11c, 11e, and 11g showed moderate DPPH radical-scavenging activity compared to ascorbic acid at 100 μg/mL. 4,9-Dimethoxy-5-substituted styrylfuro[3,2-g]-1,2,3-benzoxathiazine-7,7-dioxides 11a, 11b, and 11c were found to be highly active against A-549 and HCT-116 cancer cell lines with IC50 values ranging from 0.02 to 0.08 μmol/mL compared to doxorubicin with IC50 = 0.04 and 0.06 μmol/mL, respectively. PMID:25685501

  15. Synthesis and biological activity of novel series of 4-methoxy, and 4,9-dimethoxy-5-substituted furo[2,3-g]-1,2,3-benzoxathiazine-7,7-dioxide derivatives.

    PubMed

    El-Sawy, Eslam R; Ebaid, Manal S; Abo-Salem, Heba M; El-Hallouty, Salwa; Kassem, Emad M; Mandour, Adel H

    2014-05-01

    A novel series of 4-methoxy, and 4,9-dimethoxy-5-substituted furo[2,3-g]-1,2,3-benzoxathiazine-7,7-dioxide derivatives 3a,b, 10a-g and 11a-g were prepared in good yields via the reaction of 4-methoxy (1a) and 4,7-dimethoxy-5-acetyl-6-hydroxybenzofurans (1b) and their α,β-unsaturated keto derivatives 6a-g and 7a-g with chlorosulfonyl isocyanate (CSI). On the other hand, N-chlorosulfonyl carbamate derivatives 4a,b, 12a,b and 13a,b were prepared and allowed to react with piperidine to give the corresponding N-piperidinosulfonyl carbamate derivatives 5a,b, 14a,b and 15a,b, respectively. Sixteen new target compounds 3a,b, 10a-g, and 11a-g were tested for their DPPH radical-scavenging, and in vitro antiproliferative activity against A-549, MCF7 and HCT-116 cancer cell lines. Compounds 10a, 11c, 11e, and 11g showed moderate DPPH radical-scavenging activity compared to ascorbic acid at 100 μg/mL. 4,9-Dimethoxy-5-substituted styrylfuro[3,2-g]-1,2,3-benzoxathiazine-7,7-dioxides 11a, 11b, and 11c were found to be highly active against A-549 and HCT-116 cancer cell lines with IC50 values ranging from 0.02 to 0.08 μmol/mL compared to doxorubicin with IC50 = 0.04 and 0.06 μmol/mL, respectively.

  16. Heterogeneous reactions of HNO3(g) + NaCl(s) yields HCl(g) + NaNO3(s) and N2O5(g) + NaCl(s) yields ClNO2(g) + NaNO3(s)

    NASA Technical Reports Server (NTRS)

    Leu, Ming-Taun; Timonen, Raimo S.; Keyser, Leon F.; Yung, Yuk L.

    1995-01-01

    The heterogeneous reactions of HNO3(g) + NaCl(s) yields HCl(g) + NaNO3(s) (eq 1) and N2O5(g) + NaCl(s) yields ClNO2(g) + NaNO3(S) (eq 2) were investigated over the temperature range 223-296 K in a flow-tube reactor coupled to a quadrupole mass spectrometer. Either a chemical ionization mass spectrometer (CIMS) or an electron-impact ionization mass spectrometer (EIMS) was used to provide suitable detection sensitivity and selectivity. In order to mimic atmospheric conditions, partial pressures of HNO3 and N2O5 in the range 6 x 10(exp -8) - 2 x 10(exp -6) Torr were used. Granule sizes and surface roughness of the solid NaCl substrates were determined by using a scanning electron microscope. For dry NaCl substrates, decay rates of HNO3 were used to obtain gamma(1) = 0.013 +/- 0.004 (1sigma) at 296 K and > 0.008 at 223 K, respectively. The error quoted is the statistical error. After all corrections were made, the overall error, including systematic error, was estimated to be about a factor of 2. HCl was found to be the sole gas-phase product of reaction 1. The mechanism changed from heterogeneous reaction to predominantly physical adsorption when the reactor was cooled from 296 to 223 K. For reaction 2 using dry salts, gamma(2) was found to be less than 1.0 x 10(exp -4) at both 223 and 296 K. The gas-phase reaction product was identified as ClNO2 in previous studies using an infrared spectrometer. An enhancement in reaction probability was observed if water was not completely removed from salt surfaces, probably due to the reaction of N2O5(g) + H2O(s) yields 2HNO3(g). Our results are compared with previous literature values obtained using different experimental techniques and conditions. The implications of the present results for the enhancement of the hydrogen chloride column density in the lower stratosphere after the El Chichon volcanic eruption and for the chemistry of HCl and HNO3 in the marine troposphere are discussed.

  17. Anti-pituitary antibodies against corticotrophs in IgG4-related hypophysitis.

    PubMed

    Iwata, Naoko; Iwama, Shintaro; Sugimura, Yoshihisa; Yasuda, Yoshinori; Nakashima, Kohtaro; Takeuchi, Seiji; Hagiwara, Daisuke; Ito, Yoshihiro; Suga, Hidetaka; Goto, Motomitsu; Banno, Ryoichi; Caturegli, Patrizio; Koike, Teruhiko; Oshida, Yoshiharu; Arima, Hiroshi

    2017-06-01

    IgG4-related disease is a systemic inflammatory disease characterized by infiltration of IgG4-positive plasma cells into multiple organs, including the pituitary gland. Autoimmunity is thought to be involved in the pathogenesis of IgG4-related disease. The diagnosis of IgG4-related hypophysitis (IgG4-RH) is difficult because its clinical features, such as pituitary swelling and hypopituitarism, are similar to those of other pituitary diseases, including lymphocytic hypophysitis and sellar/suprasellar tumors. The presence and significance of anti-pituitary antibodies (APA) in IgG4-RH is unclear. In this case-control study, we used single indirect immunofluorescence on human pituitary substrates to assess the prevalence of serum APA in 17 patients with IgG4-RH, 8 control patients with other pituitary diseases (lymphocytic infundibulo-neurohypophysitis, 3; craniopharyngioma, 2; germinoma, 3), and 9 healthy subjects. We further analyzed the endocrine cells targeted by the antibodies using double indirect immunofluorescence. APA were found in 5 of 17 patients with IgG4-RH (29%), and in none of the pituitary controls or healthy subjects. The endocrine cells targeted by the antibodies in the 5 IgG4-RH cases were exclusively corticotrophs. Antibodies were of the IgG1 subclass, rather than IgG4, in all 5 cases, suggesting that IgG4 is not directly involved in the pathogenesis. Finally, antibodies recognized pro-opiomelanocortin in 2 of the cases. Our study suggests that autoimmunity is involved in the pathogenesis of IgG4-RH and that corticotrophs are the main antigenic target, highlighting a possible new diagnostic marker for this condition.

  18. Immunoglobulin G (IgG) Subclass Distribution and IgG1 Avidity of Antibodies in Human Immunodeficiency Virus-Infected Individuals after Revaccination with Tetanus Toxoid

    PubMed Central

    Kroon, F. P.; van Tol, M. J. D.; Jol-van der Zijde, C. M.; van Furth, R.; van Dissel, J. T.

    1999-01-01

    In human immunodeficiency virus (HIV)-infected individuals the amount of antibodies formed after vaccination with T-cell-dependent recall antigens such as tetanus toxoid is proportional to the peripheral blood CD4+ T-lymphocyte counts. To investigate whether the immunoglobulin G (IgG) subclass distribution and avidity of the antibodies produced after vaccination are affected as well, we gave 13 HIV-infected adults with low CD4+ T-lymphocyte counts (<200 × 106/liter; group I), 11 HIV-infected adults with intermediate CD4+ T-lymphocyte counts (≥200 × 106/liter; group II), and 5 healthy controls booster immunizations with tetanus toxoid. The prevaccination antibody concentrations against tetanus toxoid were similar in the HIV-infected and healthy adults. After vaccination the total IgG and the IgG1 anti-tetanus toxoid antibody concentrations were significantly lower in group I than in group II and the controls. The avidity of the IgG1 anti-tetanus toxoid antibodies formed by HIV-infected adults was within the range for healthy controls, irrespective of their CD4+ T-lymphocyte counts. PMID:10225835

  19. Role of CYP2E1 immunoglobulin G4 subclass antibodies and complement in pathogenesis of idiosyncratic drug-induced hepatitis.

    PubMed

    Njoku, Dolores B; Mellerson, Jenelle L; Talor, Monica V; Kerr, Douglas R; Faraday, Nauder R; Outschoorn, Ingrid; Rose, Noel R

    2006-02-01

    Idiosyncratic drug-induced hepatitis (IDDIH) is the third most common cause for acute liver failure in the United States. Previous studies have attempted to identify susceptible patients or early stages of disease with various degrees of success. To determine if total serum immunoglobulin subclasses, CYP2E1-specific subclass autoantibodies, complement components, or immune complexes could distinguish persons with IDDIH from others exposed to drugs, we studied persons exposed to halogenated volatile anesthetics, which have been associated with IDDIH and CYP2E1 autoantibodies. We found that patients with anesthetic-induced IDDIH had significantly elevated levels of CYP2E1-specific immunoglobulin G4 (IgG4) autoantibodies, while anesthetic-exposed healthy persons had significantly elevated levels of CYP2E1-specific IgG1 autoantibodies. Anesthetic IDDIH patients had significantly lower levels of C4a, C3a, and C5a compared to anesthetic-exposed healthy persons. C1q- and C3d-containing immune complexes were significantly elevated in anesthetic-exposed persons. In conclusion, our data suggest that anesthetic-exposed persons develop CYP2E1-specific IgG1 autoantibodies which may form detectable circulating immune complexes subsequently cleared by classical pathway activation of the complement system. Persons susceptible to anesthetic-induced IDDIH develop CYP2E1-specific IgG4 autoantibodies which form small, nonprecipitating immune complexes that escape clearance because of their size or by direct inhibition of complement activation.

  20. Role of CYP2E1 Immunoglobulin G4 Subclass Antibodies and Complement in Pathogenesis of Idiosyncratic Drug-Induced Hepatitis

    PubMed Central

    Njoku, Dolores B.; Mellerson, Jenelle L.; Talor, Monica V.; Kerr, Douglas R.; Faraday, Nauder R.; Outschoorn, Ingrid; Rose, Noel R.

    2006-01-01

    Idiosyncratic drug-induced hepatitis (IDDIH) is the third most common cause for acute liver failure in the United States. Previous studies have attempted to identify susceptible patients or early stages of disease with various degrees of success. To determine if total serum immunoglobulin subclasses, CYP2E1-specific subclass autoantibodies, complement components, or immune complexes could distinguish persons with IDDIH from others exposed to drugs, we studied persons exposed to halogenated volatile anesthetics, which have been associated with IDDIH and CYP2E1 autoantibodies. We found that patients with anesthetic-induced IDDIH had significantly elevated levels of CYP2E1-specific immunoglobulin G4 (IgG4) autoantibodies, while anesthetic-exposed healthy persons had significantly elevated levels of CYP2E1-specific IgG1 autoantibodies. Anesthetic IDDIH patients had significantly lower levels of C4a, C3a, and C5a compared to anesthetic-exposed healthy persons. C1q- and C3d-containing immune complexes were significantly elevated in anesthetic-exposed persons. In conclusion, our data suggest that anesthetic-exposed persons develop CYP2E1-specific IgG1 autoantibodies which may form detectable circulating immune complexes subsequently cleared by classical pathway activation of the complement system. Persons susceptible to anesthetic-induced IDDIH develop CYP2E1-specific IgG4 autoantibodies which form small, nonprecipitating immune complexes that escape clearance because of their size or by direct inhibition of complement activation. PMID:16467335

  1. High resolution spectral analysis of oxygen. I. Isotopically invariant Dunham fit for the X(3)Σ(g)(-), a(1)Δ(g), b(1)Σ(g)(+) states.

    PubMed

    Yu, Shanshan; Miller, Charles E; Drouin, Brian J; Müller, Holger S P

    2012-07-14

    We have developed a simultaneous global fit to the MW, THz, infrared, visible, and UV transitions of all six oxygen isotopologues, (16)O(16)O, (16)O(17)O, (16)O(18)O, (17)O(17)O, (17)O(18)O, (18)O(18)O, with the objective of predicting all transitions below the O((3)P) + O((3)P) dissociation threshold as well as the B(3)Σ(u) (-) state from O((3)P)+O((1)D) within state-of-the-art experimental uncertainty. Here, we report an isotopically invariant Dunham fit for the lowest three electronic states, X(3)Σ(g)(-), a(1)Δ(g), and b(1)Σ(g)(+). Experimental transition frequencies involving these three states of all six O(2) isotopologues were critically reviewed and incorporated into the analysis. For the (16)O(16)O isotopologue, experimental data sample vibrational states v = 0-31 for X(3)Σ(g)(-), v = 0-10 for a(1)Δ(g), and v = 0-12 for b(1)Σ(g)(+). To the best of our knowledge, this is the first analysis that simultaneously fits spectra from all six O(2) isotopologues.

  2. Isoguanine quartets formed by d(T4isoG4T4): tetraplex identification and stability.

    PubMed Central

    Seela, F; Wei, C; Melenewski, A

    1996-01-01

    The self-aggregation of the oligonucleotide d(T4isoG4T4) (1) is investigated. Based on ion exchange HPLC experiments and CD spectroscopy, a tetrameric structure is identified. This structure was formed in the presence of sodium ions and shows almost the same chromatographic mobility on ion exchange HPLC as d(T4G4T4) (2). The ratio of aggregate versus monomer is temperature dependent and the tetraplex of [d(T4isoG4T4)]4 is more stable than that of [d(T4G4T4)]4. A mixture of d(T4isoG4T4) and d(T4G4T4) forms mixed tetraplexes containing strands of d(T4isoG4T4) and d(T4G4T4). PMID:9016664

  3. GLU298ASP and 4G/5G Polymorphisms and the Risk of Ischemic Stroke in Young Individuals.

    PubMed

    Esparza-García, Juan Carlos; Santiago-Germán, David; Guadalupe Valades-Mejía, María; Hernández-Juárez, Jesus; Aguilar-Sosa, Eberth; Leaños-Miranda, Alfredo; Alvarado-Moreno, Antonio; Majluf-Cruz, Abraham; Isordia-Salas, Irma

    2015-09-01

    Polymorphisms in the endothelial nitric oxide synthase (eNOS) and in the plasminogen activator inhibitor -1 (PAI-1) genes have been implicated in stroke pathogenesis but results are still controversial. The aim of this study was to examine the possible contribution of Glu298Asp in the eNOS and 4G/5G in the PAI-1polymorphisms with ischemic stroke in a young Mexican population. In a case-control study, conducted between January 2006 and June 2010, 204 patients ≤45 years of age with ischemic stroke and 204 controls matched by age and gender, were recruited. The Glu298Asp and 4G/5G polymorphisms were determined in all participants by polymerase chain reaction-restriction fragment length polymorphism. There was a significant difference in the Glu298Asp genotype distribution (P=0.001) and allele frequency between the two groups (P=0.001). The 4G/5G genotype distribution (P=0.40) and the allele frequency was similar between groups; (P=0.13). There were independent factors for ischemic stroke: Asp carriage (GluAsp+AspAsp) (P=0.02); smoking (P=0.01); hypertension (P=0.03), and familial history of atherothrombotic disease (P=0.04). The Asp allele from the Gu298Asp gene represents an independent risk factor for ischemic stroke in a young Mexican population. In contrast, the 4G/5G was not associated with an increased risk for this disease in the same group of patients, as previously has been demonstrated in other populations.

  4. Supersymmetric M3-branes and G2 manifolds

    NASA Astrophysics Data System (ADS)

    Cvetič, M.; Gibbons, G. W.; Lü, H.; Pope, C. N.

    2002-01-01

    We obtain a generalisation of the original complete Ricci-flat metric of G2 holonomy on R4×S 3 to a family with a nontrivial parameter λ. For generic λ the solution is singular, but it is regular when λ={-1,0,+1}. The case λ=0 corresponds to the original G2 metric, and λ={-1,1} are related to this by an S3 automorphism of the SU(2) 3 isometry group that acts on the S3× S3 principal orbits. We then construct explicit supersymmetric M3-brane solutions in D=11 supergravity, where the transverse space is a deformation of this class of G2 metrics. These are solutions of a system of first-order differential equations coming from a superpotential. We also find M3-branes in the deformed backgrounds of new G2 holonomy metrics that include one found by A. Brandhuber, J. Gomis, S. Gubser and S. Gukov, and show that they also are supersymmetric.

  5. Heteromerization of G2A and OGR1 enhances proton sensitivity and proton-induced calcium signals.

    PubMed

    Huang, Ya-Han; Su, Yeu-Shiuan; Chang, Chung-Jen; Sun, Wei-Hsin

    2016-12-01

    Proton-sensing G-protein-coupled receptors (GPCRs; OGR1, GPR4, G2A, TDAG8), with full activation at pH 6.4 ∼ 6.8, are important to pH homeostasis, immune responses and acid-induced pain. Although G2A mediates the G13-Rho pathway in response to acid, whether G2A activates Gs, Gi or Gq proteins remains debated. In this study, we examined the response of this fluorescence protein-tagged OGR1 family to acid stimulation in HEK293T cells. G2A did not generate detectable intracellular calcium or cAMP signals or show apparent receptor redistribution with moderate acid (pH ≥ 6.0) stimulation but reduced cAMP accumulation under strong acid stimulation (pH ≤ 5.5). Surprisingly, coexpression of OGR1- and G2A-enhanced proton sensitivity and proton-induced calcium signals. This alteration is attributed to oligomerization of OGR1 and G2A. The oligomeric potential locates receptors at a specific site, which leads to enhanced proton-induced calcium signals through channels.

  6. A small subgroup of Hashimoto's thyroiditis is associated with IgG4-related disease.

    PubMed

    Jokisch, Friedrich; Kleinlein, Irene; Haller, Bernhard; Seehaus, Tanja; Fuerst, Heinrich; Kremer, Marcus

    2016-03-01

    IgG4-related disease is a newly identified syndrome characterized by high serum IgG4 levels and increased IgG4-positive plasma cells in involved organs. The incidence of IgG4-related thyroiditis in the Caucasian population of Europe is unknown. We investigated formalin-fixed thyroid gland samples of 216 patients (191 Hashimoto's thyroiditis, 5 Riedel's thyroiditis, and 20 goiters, as controls), morphologically, and immunohistochemically. Cases were divided into two groups: IgG4-related Hashimoto's thyroiditis (24 cases) together with Riedel thyroiditis (1 case) and 171 non-IgG4-related thyroiditis. Compared to the non-IgG4-related cases, IgG4-related thyroiditis showed a higher IgG4/IgG ratio (0.6 vs. 0.1, p < 0.0001), a higher median IgG4 count (45.2 vs. 6.2, p < 0.0001), an association with younger age (42.1 vs. 48.1 years, p = 0.036), and a lower female-to-male ratio (11:1 vs. 17.5:1). Fibrous variant of Hashimoto's thyroiditis was diagnosed in 23 of the 24 IgG4-related cases (96 %) and in 13 of 167 (18 %, p > 0.001) non-IgG4-related cases. The single case of IgG4-related Riedel's thyroiditis also showed a higher median IgG4 plasma cell count (56.3 vs. 14.3) and a higher IgG4/IgG ratio (0.5 vs. 0.2) than the four cases of non-IgG4-related Riedel's thyroiditis. Our data suggests the incidence of IgG4-related disease (IgG4-RD) of the thyroid gland in Europe is considerably lower than that observed in other studies. A significant elevation of IgG4-positive plasma cells was only found in a small group of Hashimoto's thyroiditis and then accompanied by intense fibrosis, indicating an association with IgG4-RD. Morphologically, IgG4-RD of the thyroid gland differs from that in other organ systems, exhibiting a dense fibrosis without intense eosinophilia or obliterative phlebitis.

  7. Adaptive Antenna System for Both 4G LTE and 5G Cellular Systems

    NASA Astrophysics Data System (ADS)

    Henderson, Kendrick Q. T.

    Given the steep increase in the use of mobile communication systems, the current 4G/LTE (Long Term Evolution), cellular system will not be able to handle the increase in data. It is estimated that by 2020 the bandwidth requirements will be 10 times greater than what LTE can sustain. A new 5th generation (5G) communication system has been proposed to meet this demand. The physical layer or the antenna is the most critical part of any wireless communication systems as it is the interface between the free space medium and an electrical circuit. It sets the margin for almost all design parameters in the system such as the system noise and bandwidth. Several interactions of antennas have been proposed over the years for cellular services. These antennas are of various geometries, bandwidths, and radiation patterns with almost all having linear polarization. This thesis attempts to solve the multiple LTE antenna problem by creating a simple antenna that covers most of the LTE bands (850-2700 MHz) as well as introducing an antenna system at the 28 GHz 5G band. This allows for a greater educated hypothesis into what 5G can offer at the physical layer. The proposed concept will provide a solution to the co-existence problem of upcoming 5G wireless systems to be interoperable with existing 4G/LTE system.

  8. Vasoconstriction induced by G1, a G-protein-coupled oestrogen receptor1 (GPER-1) agonist, in the isolated perfused rat kidney.

    PubMed

    Kurt, Akif Hakan; Buyukafsar, Kansu

    2013-02-28

    Vascular effects of the G protein-coupled oestrogen receptor1 (GPER-1) agonist, G1 (10(-7)-5×10(-6) M), the main oestrogenic hormone, 17β-estradiol (10(-9)-10(-4) M), the NR3A1 agonist, PPT (10(-8)-10(-5) M), the NR3A2 agonist DPN (10(-8)-10(-5) M), and the classical oestrogen receptor blocker but also a GPER agonist, ICI-182780 (10(-8)-3×10(-6) M), were investigated on the perfusion pressure in the isolated rat kidney. To seek cellular mechanisms involved in GPER-1-induced signalling we tested several compounds including the inhibitors of Rho-kinase (ROCK) (Y-27632), tyrosine kinase (genistein), p38MAPK (SB203580), p44/42MAPK (PD98059), protein kinase C (PKC) (GF109203X), Jun-kinase (JNK) (SP600125), phosphatidylinositol-3-kinase (PI3K) (LY294002), Ca(2+) channels (nifedipine), GPER-1 (G15) and epidermal growth factor (EGF) receptor kinase (AG-1478). Moreover, the effect of saponin (50mg/ml) that was used for endothelium removal was explored on G1-elicited vascular action. G1, 17β-estradiol and ICI-182780 but not PPT and DPN induced vasoconstrictions in basal renal perfusion pressure. In contrast, G1 promoted vasodilatation when the perfusion pressure was elevated in advance by phenylephrine. G1-elicited vasoconstriction was not modified by endothelial removal; however, it was markedly inhibited by GPER-1 antagonist, G15. The vasoconstrictor response to G1 was also significantly attenuated by Y-27632, PD98059, SB203580, GF109203X, genistein, AG-1478, and nifedipine, but not LY294002 and SP600125. Western blotting indicated the expression of GPER-1 in renal artery, medulla and cortex of rat kidney. In conclusion, GPER-1 could substantially modulate vascular responses through a variety of signalling pathways including ROCK, PKC, p38 MAPK, p42/44 MAPK, tyrosine kinase, EGF receptor kinase and VOCC but not JNK or PI3K in isolated perfused rat kidney. Copyright © 2013 Elsevier B.V. All rights reserved.

  9. Differential Decline in Leishmania Membrane Antigen-Specific Immunoglobulin G (IgG), IgM, IgE, and IgG Subclass Antibodies in Indian Kala-Azar Patients after Chemotherapy

    PubMed Central

    Anam, Khairul; Afrin, Farhat; Banerjee, Dwijadas; Pramanik, Netai; Guha, Subhasis K.; Goswami, Rama P.; Saha, Shiben K.; Ali, Nahid

    1999-01-01

    Pathogenesis in kala-azar is associated with depressed cellular immunity and significant elevation of antileishmanial antibodies. Since these antibodies are present even after cure, analysis of the parasite-specific isotypes and immunoglobulin G (IgG) subclasses in kala-azar patients may shed new light on the immune responses during progression and resolution of infection. Using leishmanial membrane antigenic extracts, we investigated the relative levels of specific IgG, IgM, IgA, IgE, and IgG subclasses in Indian kala-azar patient sera during disease, drug resistance, and cure. Acute-phase sera showed strong stimulation of IgG, followed by IgE and IgM and lastly by IgA antibodies. IgG subclass analysis revealed expression of all of the subclasses, with a predominance of IgG1 during disease. Following sodium stibogluconate (SAG) resistance, the levels of IgG, IgM, IgE, and IgG4 remained constant, while there was a decrease in the titers of IgG2 and IgG3. In contrast, a significant (2.2-fold) increase in IgG1 was observed in these individuals. Cure, in both SAG-responsive and unresponsive patients, correlated with a decline in the levels of IgG, IgM, IgE, and all of the IgG subclasses. The stimulation of IgG1 and the persistence, most importantly, of IgE and IgG4 following drug resistance, along with a decline in IgE, IgG4, and IgG1 with cure, demonstrate the potential of these isotypes as possible markers for monitoring effective treatment in kala-azar. PMID:10569788

  10. 30 CFR 251.4 - Types of G&G activities that require permits or Notices.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... separate permit for each. (b) Scientific research. You may only conduct G&G scientific research related to... proprietary use or sale. (2) Notice. Any other G&G scientific research that you conduct related to oil, gas.... You must obtain a permit if the research activities you propose to conduct involve: (i) Using solid or...

  11. Current Concepts and Diagnosis of IgG4-Related Pancreatitis (Type 1 AIP).

    PubMed

    Kawa, Shigeyuki

    2016-08-01

    Although now considered to be a member of the systemic entity of immunoglobulin G4- (IgG4-) related disease, IgG4-related pancreatitis is generally referred to as type 1 autoimmune pancreatitis (AIP). Type 1 AIP was established based on a pathological background of lymphoplasmacytic sclerosing pancreatitis, high serum IgG4 concentration, and abundant IgG4-bearing plasma cell infiltration. The characteristic clinical features of type 1 AIP, such as elderly male preponderance, obstructive jaundice, and mass-forming lesions in the pancreas, often mimic those of pancreatic cancer. However, because AIP responds favorably to corticosteroid treatment, careful differentiation from pancreatic cancer is required. An AIP diagnosis is currently based on the 2011 International Consensus Diagnostic Criteria for AIP, which are based on high sensitivity, selectivity, and accuracy. Over the long term, AIP can progress to a chronic condition, with pancreatic stone formation and atrophy resembling that of chronic pancreatitis. Although AIP has been linked to the complication of malignancies, it remains controversial whether an association exists between the disease and tumor formation. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.

  12. Half molecular exchange of IgGs in the blood of healthy humans: chimeric lambda-kappa-immunoglobulins containing HL fragments of antibodies of different subclasses (IgG1-IgG4).

    PubMed

    Sedykh, Sergey E; Lekchnov, Evgenii A; Prince, Viktor V; Buneva, Valentina N; Nevinsky, Georgy A

    2016-10-20

    In the classic paradigm, immunoglobulins represent products of clonal B cell populations, each producing antibodies recognizing a single antigen (monospecific). There is a common belief that IgGs in mammalian biological fluids are monospecific molecules having stable structures and two identical antigen-binding sites. But the issue concerning the possibility of exchange by HL-fragments between the antibody molecules in human blood is still unexplored. Different physico-chemical and immunological methods for analysis of half-molecule exchange between human blood IgGs were used. Using eighteen blood samples of healthy humans we have shown unexpected results for the first time: blood antibodies undergo extensive post-transcriptional half-molecule exchange and IgG pools on average consist of 62.4 ± 6.5% IgGs containing kappa light chains (kappa-kappa-IgGs), 29.8.6 ± 5.4% lambda light chains (lambda-lambda-IgGs), and 8.8 ± 2.7% (range 2.6-16.8%) IgGs containing both kappa- and lambda-light chains. Kappa-kappa-IgGs and lambda-lambda-IgGs contained on average (%): IgG1 (36.0 and 32.3), IgG2 (50.9 and 51.4), IgG3 (9.7 and 9.9), and IgG4 (6.5 and 5.7), while chimeric kappa-lambda-IgGs consisted of (%): 25.5 ± 4.2 IgG1, 50.8 ± 3.9 IgG2, 9.1 ± 2.1 IgG3, and 14.5 ± 2.2 IgG4. Our unexpected data are indicative of the possibility of half-molecule exchange between blood IgGs of various subclasses, raised against different antigens. The existence of blood chimeric bifunctional IgGs with different binding sites destroys the classic paradigm. Due to the phenomenon of polyspecificity and cross-reactivity of bifunctional IgGs containing HL-fragments of different types to different antigens, such IgGs may be important in human blood for widening their different biological functions.

  13. Plasminogen activator inhibitor-1 4G/5G promoter polymorphism and coagulation factor VII Arg353-->Gln polymorphism in Korean patients with coronary artery disease.

    PubMed Central

    Song, J.; Yoon, Y. M.; Jung, H. J.; Hong, S. H.; Park, H.; Kim, J. Q.

    2000-01-01

    An increased risk for arterial thrombosis is associated with high plasma levels of coagulation and fibrinolytic factors such as PAI-1 and FVII. In this study, the 4G/5G polymorphism in the promoter of PAI-1 gene and Arg353-->Gln polymorphism in the FVII gene were analysed in 139 normal adults and 158 patients with coronary artery disease (CAD), and their association with plasma lipid traits was investigated. There were no significant differences in the allele frequencies of PAI-1 and FVII polymorphisms between control and patient groups. The allelic distributions of both polymorphisms in Koreans were similar to those in Japanese but significantly different from those in Caucasians. In the CAD group, the 4G homozygotes of PAI-1 polymorphism showed significantly higher levels of total (p=0.0250) and LDL cholesterol (p=0.0335) with individuals having other genotypes. However, FVII polymorphism showed no association with lipid levels. In conclusion, the 4G/5G PAI-1 promoter polymorphism and Arg353-->Gln FVII polymorphism are not major genetic risk factors for CAD in Koreans. However, 4G allele of PAI-1 polymorphism revealed to be associated with the levels of cholesterol, especially LDL cholesterol levels in CAD patients. PMID:10803689

  14. Novel Epstein-Barr virus-like particles incorporating gH/gL-EBNA1 or gB-LMP2 induce high neutralizing antibody titers and EBV-specific T-cell responses in immunized mice.

    PubMed

    Perez, Elizabeth M; Foley, Joslyn; Tison, Timelia; Silva, Rute; Ogembo, Javier Gordon

    2017-03-21

    Previous Epstein-Barr virus (EBV) prophylactic vaccines based on the major surface glycoprotein gp350/220 as an immunogen have failed to block viral infection in humans, suggesting a need to target other viral envelope glycoproteins. In this study, we reasoned that incorporating gH/gL or gB, critical glycoproteins for viral fusion and entry, on the surface of a virus-like particle (VLP) would be more immunogenic than gp350/220 for generating effective neutralizing antibodies to prevent viral infection of both epithelial and B cell lines. To boost the humoral response and trigger cell-mediated immunity, EBV nuclear antigen 1 (EBNA1) and latent membrane protein 2 (LMP2), intracellular latency proteins expressed in all EBV-infected cells, were also included as critical components of the polyvalent EBV VLP. gH/gL-EBNA1 and gB-LMP2 VLPs were efficiently produced in Chinese hamster ovary cells, an FDA-approved vehicle for mass-production of biologics. Immunization with gH/gL-EBNA1 and gB-LMP2 VLPs without adjuvant generated both high neutralizing antibody titers in vitro and EBV-specific T-cell responses in BALB/c mice. These data demonstrate that will be invaluable not only in preventing EBV infection, but importantly, in preventing and treating the 200,000 cases of EBV-associated cancers that occur globally every year.

  15. The Arabidopsis domain of unknown function 1218 (DUF1218) containing proteins, MODIFYING WALL LIGNIN-1 and 2 (At1g31720/MWL-1 and At4g19370/MWL-2) function redundantly to alter secondary cell wall lignin content

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mewalal, Ritesh; Mizrachi, Eshchar; Coetzee, Berdine

    DUF1218 is a land plant-specific innovation and has previously been shown to be associated with cell wall biology, vasculature patterning and abiotic/biotic stress response. The Arabidopsis genome encodes 15 members, two of which (At1g31720 and At4g27435) are preferentially expressed in the secondary cell wall depositing inflorescence stems. To further our understanding of the roles of DUF1218-containing proteins in secondary cell wall biology, we functionally characterized At1g31720 (herein referred to as MODIFYING WALL LIGNIN-1 or MWL-1). Since related gene family members may contribute to functional redundancy, we also characterized At4g19370 ( MWL-2), the most closely related gene to MWL-1 in themore » protein family. Subcellular localization revealed that both Arabidopsis proteins are targeted to the cell periphery. The single T-DNA knockout lines, mwl-1 and mwl-2, and independent overexpression lines showed no significant differences in plant growth or changes in total lignin content relative to wild-type (WT) control plants. However, the double homozygous mutant, mwl-1/ mwl-2, had smaller rosettes with a significant decrease in rosette fresh weight and stem height relative to the WT control at four weeks and six weeks, respectively. Moreover, mwl-1/ mwl-2 showed a significant reduction in total lignin content (by ca. 11% relative to WT) and an increase in syringyl/guaiacyl (S/G) monomer ratio relative to the control plants. Lastly, our study has identified two additional members of the DUF1218 family in Arabidopsis as novel contributors to secondary cell wall biology, specifically lignin biosynthesis, and these proteins appear to function redundantly.« less

  16. The Arabidopsis domain of unknown function 1218 (DUF1218) containing proteins, MODIFYING WALL LIGNIN-1 and 2 (At1g31720/MWL-1 and At4g19370/MWL-2) function redundantly to alter secondary cell wall lignin content

    DOE PAGES

    Mewalal, Ritesh; Mizrachi, Eshchar; Coetzee, Berdine; ...

    2016-03-01

    DUF1218 is a land plant-specific innovation and has previously been shown to be associated with cell wall biology, vasculature patterning and abiotic/biotic stress response. The Arabidopsis genome encodes 15 members, two of which (At1g31720 and At4g27435) are preferentially expressed in the secondary cell wall depositing inflorescence stems. To further our understanding of the roles of DUF1218-containing proteins in secondary cell wall biology, we functionally characterized At1g31720 (herein referred to as MODIFYING WALL LIGNIN-1 or MWL-1). Since related gene family members may contribute to functional redundancy, we also characterized At4g19370 ( MWL-2), the most closely related gene to MWL-1 in themore » protein family. Subcellular localization revealed that both Arabidopsis proteins are targeted to the cell periphery. The single T-DNA knockout lines, mwl-1 and mwl-2, and independent overexpression lines showed no significant differences in plant growth or changes in total lignin content relative to wild-type (WT) control plants. However, the double homozygous mutant, mwl-1/ mwl-2, had smaller rosettes with a significant decrease in rosette fresh weight and stem height relative to the WT control at four weeks and six weeks, respectively. Moreover, mwl-1/ mwl-2 showed a significant reduction in total lignin content (by ca. 11% relative to WT) and an increase in syringyl/guaiacyl (S/G) monomer ratio relative to the control plants. Lastly, our study has identified two additional members of the DUF1218 family in Arabidopsis as novel contributors to secondary cell wall biology, specifically lignin biosynthesis, and these proteins appear to function redundantly.« less

  17. 1 MVA HTS-2G Generator for Wind Turbines

    NASA Astrophysics Data System (ADS)

    Kovalev, K. L.; Poltavets, V. N.; Ilyasov, R. I.; Verzhbitsky, L. G.; Kozub, S. S.

    2017-10-01

    The calculation, design simulations and design performance of 1 MVA HTS-2G (second-generation high-temperature superconductor) Generator for Wind Turbines were done in 2013-2014 [1]. The results of manufacturing and testing of 1 MVA generator are presented in the article. HTS-2G field coils for the rotor were redesigned, fabricated and tested. The tests have shown critical current of the coils, 41-45 A (self field within the ferromagnetic core, T = 77 K), which corresponds to the current of short samples at self field. Application of the copper inner frame on the pole has improved internal cooling conditions of HTS coil windings and reduced the magnetic field in the area, thereby increased the critical current value. The original construction of the rotor with a rotating cryostat was developed, which decreases the thermal in-flow to the rotor. The stator of 1 MW HTS-2G generator has been manufactured. In order to improve the specific weight of the generator, the wave (harmonic drive) multiplier was used, which provides increasing RPM from 15 RPM up to 600 RPM. The total mass of the multiplier and generator is significantly smaller compared to traditional direct-drive wind turbines generators [2-7]. Parameters of the multiplier and generator were chosen based on the actual parameters of wind turbines, namely: 15 RPM, power is 1 MVA. The final test of the assembled synchronous generator with HTS-2G field coils for Wind Turbines with output power 1 MVA was completed during 2015.

  18. 26 CFR 1.904(g)-2T - Recapture of overall domestic losses (temporary).

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ...). 1.904(g)-2T Section 1.904(g)-2T Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE... States § 1.904(g)-2T Recapture of overall domestic losses (temporary). (a) In general. A taxpayer shall... increased. As provided in § 1.904(g)-1T(f)(2), the balance in a taxpayer's overall domestic loss account...

  19. 26 CFR 1.904(g)-2T - Recapture of overall domestic losses (temporary).

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ...). 1.904(g)-2T Section 1.904(g)-2T Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE... States § 1.904(g)-2T Recapture of overall domestic losses (temporary). (a) In general. A taxpayer shall... increased. As provided in § 1.904(g)-1T(f)(2), the balance in a taxpayer's overall domestic loss account...

  20. FoxG1 and TLE2 act cooperatively to regulate ventral telencephalon formation.

    PubMed

    Roth, Martin; Bonev, Boyan; Lindsay, Jennefer; Lea, Robert; Panagiotaki, Niki; Houart, Corinne; Papalopulu, Nancy

    2010-05-01

    FoxG1 is a conserved transcriptional repressor that plays a key role in the specification, proliferation and differentiation of the telencephalon, and is expressed from the earliest stages of telencephalic development through to the adult. How the interaction with co-factors might influence the multiplicity and diversity of FoxG1 function is not known. Here, we show that interaction of FoxG1 with TLE2, a Xenopus tropicalis co-repressor of the Groucho/TLE family, is crucial for regulating the early activity of FoxG1. We show that TLE2 is co-expressed with FoxG1 in the ventral telencephalon from the early neural plate stage and functionally cooperates with FoxG1 in an ectopic neurogenesis assay. FoxG1 has two potential TLE binding sites: an N-terminal eh1 motif and a C-terminal YWPMSPF motif. Although direct binding seems to be mediated by the N-terminal motif, both motifs appear important for functional synergism. In the neurogenesis assay, mutation of either motif abolishes functional cooperation of TLE2 with FoxG1, whereas in the forebrain deletion of both motifs renders FoxG1 unable to induce the ventral telencephalic marker Nkx2.1. Knocking down either FoxG1 or TLE2 disrupts the development of the ventral telencephalon, supporting the idea that endogenous TLE2 and FoxG1 work together to specify the ventral telencephalon.

  1. FoxG1 and TLE2 act cooperatively to regulate ventral telencephalon formation

    PubMed Central

    Roth, Martin; Bonev, Boyan; Lindsay, Jennefer; Lea, Robert; Panagiotaki, Niki; Houart, Corinne; Papalopulu, Nancy

    2010-01-01

    FoxG1 is a conserved transcriptional repressor that plays a key role in the specification, proliferation and differentiation of the telencephalon, and is expressed from the earliest stages of telencephalic development through to the adult. How the interaction with co-factors might influence the multiplicity and diversity of FoxG1 function is not known. Here, we show that interaction of FoxG1 with TLE2, a Xenopus tropicalis co-repressor of the Groucho/TLE family, is crucial for regulating the early activity of FoxG1. We show that TLE2 is co-expressed with FoxG1 in the ventral telencephalon from the early neural plate stage and functionally cooperates with FoxG1 in an ectopic neurogenesis assay. FoxG1 has two potential TLE binding sites: an N-terminal eh1 motif and a C-terminal YWPMSPF motif. Although direct binding seems to be mediated by the N-terminal motif, both motifs appear important for functional synergism. In the neurogenesis assay, mutation of either motif abolishes functional cooperation of TLE2 with FoxG1, whereas in the forebrain deletion of both motifs renders FoxG1 unable to induce the ventral telencephalic marker Nkx2.1. Knocking down either FoxG1 or TLE2 disrupts the development of the ventral telencephalon, supporting the idea that endogenous TLE2 and FoxG1 work together to specify the ventral telencephalon. PMID:20356955

  2. LmaPA2G4, a Homolog of Human Ebp1, Is an Essential Gene and Inhibits Cell Proliferation in L. major

    PubMed Central

    Joyce, Michelle V.; Morales, Miguel A.

    2014-01-01

    We have identified LmaPA2G4, a homolog of the human proliferation-associated 2G4 protein (also termed Ebp1), in a phosphoproteomic screening. Multiple sequence alignment and cluster analysis revealed that LmaPA2G4 is a non-peptidase member of the M24 family of metallopeptidases. This pseudoenzyme is structurally related to methionine aminopeptidases. A null mutant system based on negative selection allowed us to demonstrate that LmaPA2G4 is an essential gene in Leishmania major. Over-expression of LmaPA2G4 did not alter cell morphology or the ability to differentiate into metacyclic and amastigote stages. Interestingly, the over-expression affected cell proliferation and virulence in mouse footpad analysis. LmaPA2G4 binds a synthetic double-stranded RNA polyriboinosinic polyribocytidylic acid [poly(I∶C)] as shown in an electrophoretic mobility shift assay (EMSA). Quantitative proteomics revealed that the over-expression of LmaPA2G4 led to accumulation of factors involved in translation initiation and elongation. Significantly, we found a strong reduction of de novo protein biosynthesis in transgenic parasites using a non-radioactive metabolic labeling assay. In conclusion, LmaPA2G4 is an essential gene and is potentially implicated in fundamental biological mechanisms, such as translation, making it an attractive target for therapeutic intervention. PMID:24421916

  3. 26 CFR 1.665(g)-2A - Application of separate share rule.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 26 Internal Revenue 8 2011-04-01 2011-04-01 false Application of separate share rule. 1.665(g)-2A Section 1.665(g)-2A Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED... Taxable Years Beginning on Or After January 1, 1969 § 1.665(g)-2A Application of separate share rule. (a...

  4. 26 CFR 1.665(g)-2A - Application of separate share rule.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 26 Internal Revenue 8 2013-04-01 2013-04-01 false Application of separate share rule. 1.665(g)-2A Section 1.665(g)-2A Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED... Taxable Years Beginning on Or After January 1, 1969 § 1.665(g)-2A Application of separate share rule. (a...

  5. 26 CFR 1.665(g)-2A - Application of separate share rule.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 26 Internal Revenue 8 2012-04-01 2012-04-01 false Application of separate share rule. 1.665(g)-2A Section 1.665(g)-2A Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED... Taxable Years Beginning on Or After January 1, 1969 § 1.665(g)-2A Application of separate share rule. (a...

  6. 26 CFR 1.665(g)-2A - Application of separate share rule.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 26 Internal Revenue 8 2010-04-01 2010-04-01 false Application of separate share rule. 1.665(g)-2A Section 1.665(g)-2A Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED... Years Beginning on Or After January 1, 1969 § 1.665(g)-2A Application of separate share rule. (a) In...

  7. 26 CFR 1.665(g)-2A - Application of separate share rule.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 26 Internal Revenue 8 2014-04-01 2014-04-01 false Application of separate share rule. 1.665(g)-2A Section 1.665(g)-2A Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED... Taxable Years Beginning on Or After January 1, 1969 § 1.665(g)-2A Application of separate share rule. (a...

  8. 26 CFR 1.904(g)-2T - Recapture of overall domestic losses (temporary).

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ...). 1.904(g)-2T Section 1.904(g)-2T Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE....904(g)-2T Recapture of overall domestic losses (temporary). (a) In general. A taxpayer shall recapture... provided in § 1.904(g)-1T(f)(2), the balance in a taxpayer's overall domestic loss account with respect to...

  9. Relationship of metabolic syndrome and its components with -844 G/A and HindIII C/G PAI-1 gene polymorphisms in Mexican children.

    PubMed

    De la Cruz-Mosso, Ulises; Muñoz-Valle, José F; Salgado-Goytia, Lorenzo; García-Carreón, Adrián; Illades-Aguiar, Berenice; Castañeda-Saucedo, Eduardo; Parra-Rojas, Isela

    2012-03-29

    Several association studies have shown that -844 G/A and HindIII C/G PAI-1 polymorphisms are related with increase of PAI-1 levels, obesity, insulin resistance, glucose intolerance, hypertension and dyslipidemia, which are components of metabolic syndrome. The aim of this study was to analyze the allele and genotype frequencies of these polymorphisms in PAI-1 gene and its association with metabolic syndrome and its components in a sample of Mexican mestizo children. This study included 100 children with an age range between 6-11 years divided in two groups: a) 48 children diagnosed with metabolic syndrome and b) 52 children metabolically healthy without any clinical and biochemical alteration. Metabolic syndrome was defined as the presence of three or more of the following criteria: fasting glucose levels ≥ 100 mg/dL, triglycerides ≥ 150 mg/dL, HDL-cholesterol < 40 mg/dL, obesity BMI ≥ 95th percentile, systolic blood pressure (SBP) and diastolic blood pressure (DBP) ≥ 95th percentile and insulin resistance HOMA-IR ≥ 2.4. The -844 G/A and HindIII C/G PAI-1 polymorphisms were analyzed by PCR-RFLP. For the -844 G/A polymorphism, the G/A genotype (OR = 2.79; 95% CI, 1.11-7.08; p = 0.015) and the A allele (OR = 2.2; 95% CI, 1.10-4.43; p = 0.015) were associated with metabolic syndrome. The -844 G/A and A/A genotypes were associated with increase in plasma triglycerides levels (OR = 2.6; 95% CI, 1.16 to 6.04; p = 0.02), decrease in plasma HDL-cholesterol levels (OR = 2.4; 95% CI, 1.06 to 5.42; p = 0.03) and obesity (OR = 2.6; 95% CI, 1.17-5.92; p = 0.01). The C/G and G/G genotypes of the HindIII C/G polymorphism contributed to a significant increase in plasma total cholesterol levels (179 vs. 165 mg/dL; p = 0.02) in comparison with C/C genotype. The -844 G/A PAI-1 polymorphism is related with the risk of developing metabolic syndrome, obesity and atherogenic dyslipidemia, and the HindIII C/G PAI-1 polymorphism was associated with the increase of total

  10. Association of immunoglobulin G4 and free light chain with idiopathic pleural effusion.

    PubMed

    Murata, Y; Aoe, K; Mimura-Kimura, Y; Murakami, T; Oishi, K; Matsumoto, T; Ueoka, H; Matsunaga, K; Yano, M; Mimura, Y

    2017-10-01

    The cause of pleural effusion remains uncertain in approximately 15% of patients despite exhaustive evaluation. As recently described immunoglobulin (Ig)G4-related disease is a fibroinflammatory disorder that can affect various organs, including the lungs, we investigate whether idiopathic pleural effusion includes IgG4-associated etiology. Between 2000 and 2012, we collected 830 pleural fluid samples and reviewed 35 patients with pleural effusions undiagnosed after pleural biopsy at Yamaguchi-Ube Medical Center. Importantly, IgG4 immunostaining revealed infiltration of IgG4-positive plasma cells in the pleura of 12 patients (34%, IgG4 + group). The median effusion IgG4 level was 41 mg/dl in the IgG4 + group and 27 mg/dl in the IgG4 - group (P < 0·01). The light and heavy chains of effusion IgG4 antibodies of patients in the IgG4 + group were heterogeneous by two-dimensional electrophoresis, indicating the absence of clonality of the IgG4 antibodies. Interestingly, the κ light chains were more heterogeneous than the λ light chains. The measurement of the κ and λ free light chain (FLC) levels in the pleural fluids showed significantly different κ FLC levels (median: 28·0 versus 9·1 mg/dl, P < 0·01) and κ/λ ratios (median: 2·0 versus 1·2, P < 0·001) between the IgG4 + and IgG4 - groups. Furthermore, the κ/λ ratios were correlated with the IgG4 + /IgG + plasma cell ratios in the pleura of the IgG4 + group. Taken together, these results demonstrate the involvement of IgG4 in certain idiopathic pleural effusions and provide insights into the diagnosis, pathogenesis and therapeutic opportunities of IgG4-associated pleural effusion. © 2017 British Society for Immunology.

  11. Soluble Human Cytomegalovirus gH/gL/pUL128-131 Pentameric Complex, but Not gH/gL, Inhibits Viral Entry to Epithelial Cells and Presents Dominant Native Neutralizing Epitopes.

    PubMed

    Loughney, John W; Rustandi, Richard R; Wang, Dai; Troutman, Matthew C; Dick, Lawrence W; Li, Guanghua; Liu, Zhong; Li, Fengsheng; Freed, Daniel C; Price, Colleen E; Hoang, Van M; Culp, Timothy D; DePhillips, Pete A; Fu, Tong-Ming; Ha, Sha

    2015-06-26

    Congenital infection of human cytomegalovirus (HCMV) is one of the leading causes of nongenetic birth defects, and development of a prophylactic vaccine against HCMV is of high priority for public health. The gH/gL/pUL128-131 pentameric complex mediates HCMV entry into endothelial and epithelial cells, and it is a major target for neutralizing antibody responses. To better understand the mechanism by which antibodies interact with the epitopes of the gH/gL/pUL128-131 pentameric complex resulting in viral neutralization, we expressed and purified soluble gH/gL/pUL128-131 pentameric complex and gH/gL from Chinese hamster ovary cells to >95% purity. The soluble gH/gL, which exists predominantly as (gH/gL)2 homodimer with a molecular mass of 220 kDa in solution, has a stoichiometry of 1:1 and a pI of 6.0-6.5. The pentameric complex has a molecular mass of 160 kDa, a stoichiometry of 1:1:1:1:1, and a pI of 7.4-8.1. The soluble pentameric complex, but not gH/gL, adsorbs 76% of neutralizing activities in HCMV human hyperimmune globulin, consistent with earlier reports that the most potent neutralizing epitopes for blocking epithelial infection are unique to the pentameric complex. Functionally, the soluble pentameric complex, but not gH/gL, blocks viral entry to epithelial cells in culture. Our results highlight the importance of the gH/gL/pUL128-131 pentameric complex in HCMV vaccine design and emphasize the necessity to monitor the integrity of the pentameric complex during the vaccine manufacturing process. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. Echinococcus ortleppi (G5) and Echinococcus granulosus sensu stricto (G1) loads in cattle from Southern Brazil.

    PubMed

    Balbinotti, Helier; Santos, Guilherme B; Badaraco, Jeferson; Arend, Ana C; Graichen, Daniel Ângelo S; Haag, Karen L; Zaha, Arnaldo

    2012-09-10

    Echinococcus granulosus sensu stricto (G1) and Echinococcus ortleppi (G5) are haplotypes of the parasite formerly known as Echinococcus granulosus sensu lato, which in its larval stage causes cystic hydatid disease, endemic in Southern Brazil. Epidemiological and molecular knowledge about the haplotypes occurring in a region is essential to control the spread of the disease. The aim of this work was to analyze the haplotype frequency and fertility of hydatid cysts in cattle from the state of Rio Grande do Sul. Cysts were collected and classified according to their fertility status. DNA was extracted from protoscoleces and germinal layers and then used as template for the amplification of the cytochrome c oxidase subunit 1 gene by PCR. Amplicons were purified and sequenced, and the sequences were analyzed for haplotype identification. A total of 638 fertile cysts collected in the last ten years were genotyped. On average, G1 (56.6%) was more frequent than G5 (43.4%). In lungs, the G5 haplotype exhibited a higher parasite load (52.8%), whereas in the liver, G1 was more frequent (90.4%). The analysis revealed an increase in the frequency of G5 haplotype cysts during the period of sampling, and an increase in the abundance of fertile cysts has also been observed in the last several years. Most infertile cysts were genotyped as G1. The possible factors involved in the increase in the proportion of E. ortleppi (G5) and the consequences of this increase are discussed. This study suggests that the proportion of E. ortleppi (G5) loads in cattle may be increasing overtime. Copyright © 2012 Elsevier B.V. All rights reserved.

  13. TeV γ-ray observations of the young synchrotron-dominated SNRs G1.9+0.3 and G330.2+1.0 with H.E.S.S.

    NASA Astrophysics Data System (ADS)

    H.E.S.S. Collaboration; Abramowski, A.; Aharonian, F.; Benkhali, F. Ait; Akhperjanian, A. G.; Angüner, E.; Anton, G.; Balenderan, S.; Balzer, A.; Barnacka, A.; Becherini, Y.; Becker Tjus, J.; Bernlöhr, K.; Birsin, E.; Bissaldi, E.; Biteau, J.; Böttcher, M.; Boisson, C.; Bolmont, J.; Bordas, P.; Brucker, J.; Brun, F.; Brun, P.; Bulik, T.; Carrigan, S.; Casanova, S.; Cerruti, M.; Chadwick, P. M.; Chalme-Calvet, R.; Chaves, R. C. G.; Cheesebrough, A.; Chrétien, M.; Colafrancesco, S.; Cologna, G.; Conrad, J.; Couturier, C.; Cui, Y.; Dalton, M.; Daniel, M. K.; Davids, I. D.; Degrange, B.; Deil, C.; deWilt, P.; Dickinson, H. J.; Djannati-Ataï, A.; Domainko, W.; O'C. Drury, L.; Dubus, G.; Dutson, K.; Dyks, J.; Dyrda, M.; Edwards, T.; Egberts, K.; Eger, P.; Espigat, P.; Farnier, C.; Fegan, S.; Feinstein, F.; Fernandes, M. V.; Fernandez, D.; Fiasson, A.; Fontaine, G.; Förster, A.; Füßling, M.; Gajdus, M.; Gallant, Y. A.; Garrigoux, T.; Giavitto, G.; Giebels, B.; Glicenstein, J. F.; Grondin, M.-H.; Grudzińska, M.; Häffner, S.; Hahn, J.; Harris, J.; Heinzelmann, G.; Henri, G.; Hermann, G.; Hervet, O.; Hillert, A.; Hinton, J. A.; Hofmann, W.; Hofverberg, P.; Holler, M.; Horns, D.; Jacholkowska, A.; Jahn, C.; Jamrozy, M.; Janiak, M.; Jankowsky, F.; Jung, I.; Kastendieck, M. A.; Katarzyński, K.; Katz, U.; Kaufmann, S.; Khélifi, B.; Kieffer, M.; Klepser, S.; Klochkov, D.; Kluźniak, W.; Kneiske, T.; Kolitzus, D.; Komin, Nu.; Kosack, K.; Krakau, S.; Krayzel, F.; Krüger, P. P.; Laffon, H.; Lamanna, G.; Lefaucheur, J.; Lemière, A.; Lemoine-Goumard, M.; Lenain, J.-P.; Lennarz, D.; Lohse, T.; Lopatin, A.; Lu, C.-C.; Marandon, V.; Marcowith, A.; Marx, R.; Maurin, G.; Maxted, N.; Mayer, M.; McComb, T. J. L.; Méhault, J.; Meintjes, P. J.; Menzler, U.; Meyer, M.; Moderski, R.; Mohamed, M.; Moulin, E.; Murach, T.; Naumann, C. L.; de Naurois, M.; Niemiec, J.; Nolan, S. J.; Oakes, L.; Ohm, S.; Wilhelmi, E. de Oña; Opitz, B.; Ostrowski, M.; Oya, I.; Panter, M.; Parsons, R. D.; Arribas, M. Paz; Pekeur, N. W.; Pelletier, G.; Perez, J.; Petrucci, P.-O.; Peyaud, B.; Pita, S.; Poon, H.; Pühlhofer, G.; Punch, M.; Quirrenbach, A.; Raab, S.; Raue, M.; Reimer, A.; Reimer, O.; Renaud, M.; Reyes, R. de los; Rieger, F.; Rob, L.; Romoli, C.; Rosier-Lees, S.; Rowell, G.; Rudak, B.; Rulten, C. B.; Sahakian, V.; Sanchez, D. A.; Santangelo, A.; Schlickeiser, R.; Schüssler, F.; Schulz, A.; Schwanke, U.; Schwarzburg, S.; Schwemmer, S.; Sol, H.; Spengler, G.; Spies, F.; Stawarz, Ł.; Steenkamp, R.; Stegmann, C.; Stinzing, F.; Stycz, K.; Sushch, I.; Szostek, A.; Tavernet, J.-P.; Tavernier, T.; Taylor, A. M.; Terrier, R.; Tluczykont, M.; Trichard, C.; Valerius, K.; van Eldik, C.; van Soelen, B.; Vasileiadis, G.; Venter, C.; Viana, A.; Vincent, P.; Völk, H. J.; Volpe, F.; Vorster, M.; Vuillaume, T.; Wagner, S. J.; Wagner, P.; Ward, M.; Weidinger, M.; Weitzel, Q.; White, R.; Wierzcholska, A.; Willmann, P.; Wörnlein, A.; Wouters, D.; Zabalza, V.; Zacharias, M.; Zajczyk, A.; Zdziarski, A. A.; Zech, A.; Zechlin, H.-S.

    2014-06-01

    The non-thermal nature of the X-ray emission from the shell-type supernova remnants (SNRs) G1.9+0.3 and G330.2+1.0 is an indication of intense particle acceleration in the shock fronts of both objects. This suggests that the SNRs are prime candidates for very-high-energy (VHE; E > 0.1 TeV) γ-ray observations. G1.9+0.3, recently established as the youngest known SNR in the Galaxy, also offers a unique opportunity to study the earliest stages of SNR evolution in the VHE domain. The purpose of this work is to probe the level of VHE γ-ray emission from both SNRs and use this to constrain their physical properties. Observations were conducted with the H.E.S.S. (High Energy Stereoscopic System) Cherenkov Telescope Array over a more than six-year period spanning 2004-2010. The obtained data have effective livetimes of 67 h for G1.9+0.3 and 16 h for G330.2+1.0. The data are analysed in the context of the multiwavelength observations currently available and in the framework of both leptonic and hadronic particle acceleration scenarios. No significant γ-ray signal from G1.9+0.3 or G330.2+1.0 was detected. Upper limits (99 per cent confidence level) to the TeV flux from G1.9+0.3 and G330.2+1.0 for the assumed spectral index Γ = 2.5 were set at 5.6 × 10-13 cm-2 s-1 above 0.26 TeV and 3.2 × 10-12 cm-2 s-1 above 0.38 TeV, respectively. In a one-zone leptonic scenario, these upper limits imply lower limits on the interior magnetic field to BG1.9 ≳ 12 μG for G1.9+0.3 and to BG330 ≳ 8 μG for G330.2+1.0. In a hadronic scenario, the low ambient densities and the large distances to the SNRs result in very low predicted fluxes, for which the H.E.S.S. upper limits are not constraining.

  14. ZERO-G - Crippen, Robert L.

    NASA Image and Video Library

    1979-04-03

    Zero-gravity experiments in KC-135 conducted by John Young, Robert L. Crippen, Joseph Kerwin, and Margaret Seddon. 1. Kerwin, Joseph - Zero-G 2. Seddon, Margaret - Zero-G 3. Young, John - Zero-G 4. Aircraft - KC-135

  15. Chronic cat allergen exposure induces a TH2 cell-dependent IgG4 response related to low sensitization.

    PubMed

    Renand, Amedee; Archila, Luis D; McGinty, John; Wambre, Erik; Robinson, David; Hales, Belinda J; Thomas, Wayne R; Kwok, William W

    2015-12-01

    In human subjects, allergen tolerance has been observed after high-dose allergen exposure or after completed allergen immunotherapy, which is related to the accumulation of anti-inflammatory IgG4. However, the specific T-cell response that leads to IgG4 induction during chronic allergen exposure remains poorly understood. We sought to evaluate the relationship between cat allergen-specific T-cell frequency, cat allergen-specific IgE and IgG4 titers, and clinical status in adults with cat allergy with and without cat ownership and the cellular mechanism by which IgG4 is produced. Fel d 1-, Fel d 4-, Fel d 7-, and Fel d 8-specific T-cell responses were characterized by CD154 expression after antigen stimulation. In allergic subjects without cat ownership, the frequency of cat allergen (Fel d 1 and Fel d 4)-specific TH2 (sTH2) cells correlates with higher IgE levels and is linked to asthma. Paradoxically, we observed that subjects with cat allergy and chronic cat exposure maintain a high frequency of sTH2 cells, which correlates with higher IgG4 levels and low sensitization. B cells from allergic, but not nonallergic subjects, are able to produce IgG4 after cognate interactions with sTH2 clones and Fel d 1 peptide or the Fel d 1 recombinant protein. These experiments suggest that (1) allergen-experienced B cells with the capacity to produce IgG4 are present in allergic subjects and (2) cat allergen exposure induces an IgG4 response in a TH2 cell-dependent manner. Thus IgG4 accumulation could be mediated by chronic activation of the TH2 response, which in turn drives desensitization. Copyright © 2015 American Academy of Allergy, Asthma & Immunology. All rights reserved.

  16. High-throughput screening and stability optimization of anti-streptavidin IgG1 and IgG2 formulations.

    PubMed

    Alekseychyk, Larysa; Su, Cheng; Becker, Gerald W; Treuheit, Michael J; Razinkov, Vladimir I

    2014-10-01

    Selection of a suitable formulation that provides adequate product stability is an important aspect of the development of biopharmaceutical products. Stability of proteins includes not only resistance to chemical modifications but also conformational and colloidal stabilities. While chemical degradation of antibodies is relatively easy to detect and control, propensity for conformational changes and/or aggregation during manufacturing or long-term storage is difficult to predict. In many cases, the formulation factors that increase one type of stability may significantly decrease another type under the same or different conditions. Often compromise is necessary to minimize the adverse effects of an antibody formulation by careful optimization of multiple factors responsible for overall stability. In this study, high-throughput stress and characterization techniques were applied to 96 formulations of anti-streptavidin antibodies (an IgG1 and an IgG2) to choose optimal formulations. Stress and analytical methods applied in this study were 96-well plate based using an automated liquid handling system to prepare the different formulations and sample plates. Aggregation and clipping propensity were evaluated by temperature and mechanical stresses. Multivariate regression analysis of high-throughput data was performed to find statistically significant formulation factors that alter measured parameters such as monomer percentage or unfolding temperature. The results of the regression models were used to maximize the stabilities of antibodies under different formulations and to find the optimal formulation space for each molecule. Comparison of the IgG1 and IgG2 data indicated an overall greater stability of the IgG1 molecule under the conditions studied. The described method can easily be applied to both initial preformulation screening and late-stage formulation development of biopharmaceutical products. © 2014 Society for Laboratory Automation and Screening.

  17. Novel Epstein-Barr virus-like particles incorporating gH/gL-EBNA1 or gB-LMP2 induce high neutralizing antibody titers and EBV-specific T-cell responses in immunized mice

    PubMed Central

    Perez, Elizabeth M.; Foley, Joslyn; Tison, Timelia; Silva, Rute; Ogembo, Javier Gordon

    2017-01-01

    Previous Epstein-Barr virus (EBV) prophylactic vaccines based on the major surface glycoprotein gp350/220 as an immunogen have failed to block viral infection in humans, suggesting a need to target other viral envelope glycoproteins. In this study, we reasoned that incorporating gH/gL or gB, critical glycoproteins for viral fusion and entry, on the surface of a virus-like particle (VLP) would be more immunogenic than gp350/220 for generating effective neutralizing antibodies to prevent viral infection of both epithelial and B cell lines. To boost the humoral response and trigger cell-mediated immunity, EBV nuclear antigen 1 (EBNA1) and latent membrane protein 2 (LMP2), intracellular latency proteins expressed in all EBV-infected cells, were also included as critical components of the polyvalent EBV VLP. gH/gL-EBNA1 and gB-LMP2 VLPs were efficiently produced in Chinese hamster ovary cells, an FDA-approved vehicle for mass-production of biologics. Immunization with gH/gL-EBNA1 and gB-LMP2 VLPs without adjuvant generated both high neutralizing antibody titers in vitro and EBV-specific T-cell responses in BALB/c mice. These data demonstrate that EBV glycoprotein(s)-based VLPs have excellent immunogenicity, and represent a potentially safe vaccine that will be invaluable not only in preventing EBV infection, but importantly, in preventing and treating the 200,000 cases of EBV-associated cancers that occur globally every year. PMID:27926486

  18. Elevated Plasma Moxifloxacin Concentrations and SLCO1B1 g.−11187G>A Polymorphism in Adults with Pulmonary Tuberculosis

    PubMed Central

    Gelfond, Jon; Johnson-Pais, Teresa L.; Engle, Melissa; Peloquin, Charles A.; Johnson, John L.; Sizemore, Erin E.; Mac Kenzie, William R.

    2018-01-01

    ABSTRACT Moxifloxacin exhibits concentration-dependent prolongation of human QTc intervals and bactericidal activity against Mycobacterium tuberculosis. However, moxifloxacin plasma concentrations are variable between patients. We evaluated whether human gene polymorphisms affect moxifloxacin plasma concentrations in tuberculosis patients from two geographic regions. We enrolled a convenience sample of 49 adults with drug-sensitive pulmonary tuberculosis from Africa and the United States enrolled in two treatment trials of moxifloxacin as part of multidrug therapy. Pharmacokinetic parameters were evaluated by noncompartmental techniques. Human single-nucleotide polymorphisms of transporter genes were evaluated by analysis of covariance (ANCOVA) on moxifloxacin exposure and the peak (maximum) concentration (Cmax). The moxifloxacin area under the concentration-time curve from 0 to 24 h (AUC0–24) and Cmax were significantly increased by the drug milligram-per-kilogram dosage and the genotype of variant g.−11187G>A in the SLCO1B1 gene (rs4149015) but not by geographic region. The median moxifloxacin AUC0–24 was 46% higher and the median Cmax was 30% higher in 4 (8%) participants who had the SLCO1B1 g.−11187 AG genotype than in 45 participants who had the wild-type GG genotype (median AUC0–24 from the model, 34.4 versus 23.6 μg · h/ml [P = 0.005, ANCOVA]; median Cmax from the model, 3.5 versus 2.7 μg/ml [P = 0.009, ANCOVA]). Because moxifloxacin exhibits concentration-dependent prolongation of human QTc intervals and prolonged QTc intervals are associated with cardiac arrhythmia, further study is needed to evaluate the risk associated with the SLCO1B1 g.−11187G>A variant. (This study has been registered at ClinicalTrials.gov under identifier NCT00164463.) PMID:29463526

  19. G2 phase-specific proteins of HeLa cells.

    PubMed Central

    Al-Bader, A A; Orengo, A; Rao, P N

    1978-01-01

    The objective of this study was to determine if HeLa cells irreversibly arrested in G2 phase of the cell cycle by a brief exposure to a nitrosourea compound were deficient in certain proteins when compared with G2-synchronized cells. Total cellular proteins of G2-synchronized, G2-arrested, and S phase-synchronized cells were compared by two-dimensional polyacrylamide gel electrophoresis. The S phase cells differed from the G2-synchronized and G2-arrested cells by the absence of about 35 and 25 protein spots, respectively, of a total of nearly 150. At least nine protein spots in the molecular weight range of 4--5 X 10(4) that were present in the G2-synchronized cells were absent in both the G2-arrested and the S phase cells. Thus, these studies suggest that the missing proteins are probably necessary for the transition of cells from G2 phase to mitosis. Supplying the missing proteins to the G2-arrested cells by fusion with G2-synchronized cells facilitated the entry of the former into mitosis. Images PMID:282623

  20. [IgG4-related disease].

    PubMed

    González-Moreno, Juan; Losada López, Inés; Ortego Centeno, Norberto

    2015-12-21

    IgG4-related disease is a recently described clinicopathological entity showing a wide spectrum of clinical manifestations that share a common pathology. Its most characteristic feature is the formation of inflammatory tumors in different organs, which makes differentiation mainly with neoplastic diseases fundamental. The inflammatory process is typically comprised of IgG4 lymphoplasmacytic cells. The pathophysiological role of the immunoglobulin is not clear. The treatment of choice is corticosteroids. This article aims to summarize the main features of the disease. Copyright © 2015 Elsevier España, S.L.U. All rights reserved.

  1. Traffic Dimensioning and Performance Modeling of 4G LTE Networks

    ERIC Educational Resources Information Center

    Ouyang, Ye

    2011-01-01

    Rapid changes in mobile techniques have always been evolutionary, and the deployment of 4G Long Term Evolution (LTE) networks will be the same. It will be another transition from Third Generation (3G) to Fourth Generation (4G) over a period of several years, as is the case still with the transition from Second Generation (2G) to 3G. As a result,…

  2. [Changes of focal and brainstem neurologic signs in patients with traumatic brain injury and their dependence on the -675 4G/5G polymorphism in the PAI-1 gene].

    PubMed

    Potapov, O; Kmyta, O

    2014-09-01

    Regressive course of neurological signs and symptoms is an important factor of evaluating the clinical course and treatment efficacy of traumatic brain injury. This article presents changes evaluation of focal and brainstem symptoms in 200 patients with traumatic brain injury, and determines the association between these changes and the -675 4G/5G polymorphism in the PAI-1 gene. We have found a connection between 4G/4G and 4G/5G genotypes for the studied polymorphism and the changes of focal and brainstem symptoms in patients with traumatic brain injury. Thus, we have demonstrated that the clinical course of traumatic brain injury is influenced by the -675 4G/5G polymorphism in the PAI-1 gene.

  3. [IgG4-related disease: patient group characterization and rituximab therapy].

    PubMed

    Sedyshev, S Kh; Vasil'ev, V I; Kovrigina, A M; Logvinenko, O A; Rodionova, E B; Safonova, T N; Gaĭduk, I V; Silin, A Iu; Komov, D V; Nasonov, E L

    2013-01-01

    To characterize a group of patients with IgG4-related disease (IgG4-RD) in a Russian population and to evaluate the efficiency of rituximab therapy. In 2009 to 2011, at the Research Institute of Rheumatology, Russian Academy of Medical Sciences, 30 patients (16 men and 14 women; mean age 44 years) were diagnosed with IgG4-RD that was confirmed by determination of serum IgG4 levels and immunohistochemical study of biopsy samples stained for IgG4-positive plasma cells. Seven patients received rituximab therapy. It was assumed at baseline that there were different types of neoplasias in 12 (40%), non-Hodgkin's and Hodgkin's lymphomas in 10 (33.3%), Sjögren's syndrome in 5 (16.7%), and Wegener's granulomatosis in 3 (10%). When 2 or more locations were involved, the condition was regarded as multifocal fibrosclerosis (33.3%). Localized forms were revealed in 20 (66.7%) patients. Among them, the largest number of patients was those who had orbital pseudotumor, Mikulicz's disease, or retroperitoneal fibrosclerosis. The most common sites of involvement were orbits (66.7%), salivary glands (70%) and lymph nodes (36.7%). Comparison of serum IgG4 levels in 28 patients with IgG4-RD, 22 patients with Sjögren's disease, salivary and lacrimal gland lymphomas, and 10 healthy controls showed that the concentration of IgG4 was significantly higher in Group 1 (median 2.6 g/I; IQR 1.22-4.65 (p < 0.001). Tissue IgG4/IgG ratio varied from 25 to 50% and averaged 38%. A moiré-like pattern of varying fibrosis was noted in 83% of cases. Analysis of laboratory data revealed elevated C-reactive protein concentrations (46.7% with a mean of 39.5 mg/l; normal values < 5.0 mg/l), increased erythrocyte sedimentation rate (60% with a mean of 37.6 mm/h), hypergammaglobulinemia (30% with a mean of 29.4%; normal range 13-22%), and rheumatoid factor (23.3%). After rituximab therapy, all the patients showed a decrease of IgG4 levels to the normal levels and positive changes evidenced by visualization

  4. Distinguishing Echinococcus granulosus sensu stricto genotypes G1 and G3 with confidence: A practical guide.

    PubMed

    Kinkar, Liina; Laurimäe, Teivi; Acosta-Jamett, Gerardo; Andresiuk, Vanessa; Balkaya, Ibrahim; Casulli, Adriano; Gasser, Robin B; González, Luis Miguel; Haag, Karen L; Zait, Houria; Irshadullah, Malik; Jabbar, Abdul; Jenkins, David J; Manfredi, Maria Teresa; Mirhendi, Hossein; M'rad, Selim; Rostami-Nejad, Mohammad; Oudni-M'rad, Myriam; Pierangeli, Nora Beatriz; Ponce-Gordo, Francisco; Rehbein, Steffen; Sharbatkhori, Mitra; Kia, Eshrat Beigom; Simsek, Sami; Soriano, Silvia Viviana; Sprong, Hein; Šnábel, Viliam; Umhang, Gérald; Varcasia, Antonio; Saarma, Urmas

    2018-06-21

    Cystic echinococcosis (CE), a zoonotic disease caused by tapeworms of the species complex Echinococcus granulosus sensu lato, represents a substantial global health and economic burden. Within this complex, E. granulosus sensu stricto (genotypes G1 and G3) is the most frequent causative agent of human CE. Currently, there is no fully reliable method for assigning samples to genotypes G1 and G3, as the commonly used mitochondrial cox1 and nad1 genes are not sufficiently consistent for the identification and differentiation of these genotypes. Thus, a new genetic assay is required for the accurate assignment of G1 and G3. Here we use a large dataset of near-complete mtDNA sequences (n = 303) to reveal the extent of genetic variation of G1 and G3 on a broad geographical scale and to identify reliable informative positions for G1 and G3. Based on extensive sampling and sequencing data, we developed a new method, that is simple and cost-effective, to designate samples to genotypes G1 and G3. We found that the nad5 is the best gene in mtDNA to differentiate between G1 and G3, and developed new primers for the analysis. Our results also highlight problems related to the commonly used cox1 and nad1. To guarantee consistent identification of G1 and G3, we suggest using the sequencing of the nad5 gene region (680 bp). This region contains six informative positions within a relatively short fragment of the mtDNA, allowing differentiation of G1 and G3 with confidence. Our method offers clear advantages over the previous ones, providing a significantly more consistent means to distinguish G1 and G3 than the commonly used cox1 and nad1. Copyright © 2018. Published by Elsevier B.V.

  5. A New Classification System for IgG4 Autoantibodies

    PubMed Central

    Koneczny, Inga

    2018-01-01

    IgG4 autoimmune diseases are characterized by the presence of antigen-specific autoantibodies of the IgG4 subclass and contain well-characterized diseases such as muscle-specific kinase myasthenia gravis, pemphigus, and thrombotic thrombocytopenic purpura. In recent years, several new diseases were identified, and by now 14 antigens targeted by IgG4 autoantibodies have been described. The IgG4 subclass is considered immunologically inert and functionally monovalent due to structural differences compared to other IgG subclasses. IgG4 usually arises after chronic exposure to antigen and competes with other antibody species, thus “blocking” their pathogenic effector mechanisms. Accordingly, in the context of IgG4 autoimmunity, the pathogenicity of IgG4 is associated with blocking of enzymatic activity or protein–protein interactions of the target antigen. Pathogenicity of IgG4 autoantibodies has not yet been systematically analyzed in IgG4 autoimmune diseases. Here, we establish a modified classification system based on Witebsky’s postulates to determine IgG4 pathogenicity in IgG4 autoimmune diseases, review characteristics and pathogenic mechanisms of IgG4 in these disorders, and also investigate the contribution of other antibody entities to pathophysiology by additional mechanisms. As a result, three classes of IgG4 autoimmune diseases emerge: class I where IgG4 pathogenicity is validated by the use of subclass-specific autoantibodies in animal models and/or in vitro models of pathogenicity; class II where IgG4 pathogenicity is highly suspected but lack validation by the use of subclass specific antibodies in in vitro models of pathogenicity or animal models; and class III with insufficient data or a pathogenic mechanism associated with multivalent antigen binding. Five out of the 14 IgG4 antigens were validated as class I, five as class II, and four as class III. Antibodies of other IgG subclasses or immunoglobulin classes were present in several diseases

  6. Exposure to 2,4-dichlorophenoxyacetic acid induced PPARβ-dependent disruption of glucose metabolism in HepG2 cells.

    PubMed

    Sun, Haidong; Shao, Wentao; Liu, Hui; Jiang, Zhaoyan

    2018-04-09

    2,4-Dichlorophenoxyacetic acid is one of the most widely used herbicides. Its impact on health is increasingly attracting great attentions. This study aimed to investigate the effect of 2,4-dichlorophenoxyacetic acid on glucose metabolism in HepG2 cells and the underlying mechanism. After 24 h exposure to 2,4-dichlorophenoxyacetic acid, glycogen was measured by PAS staining and glucose by ELISA in HepG2 cells. The expression of genes involved in glucose metabolism was measured by real-time PCR, Western blotting, and immunofluorescence. HepG2 cells presented more extracellular glucose consumption and glycogen content after exposed to 2,4-dichlorophenoxyacetic acid. Expression of gluconeogenesis-related genes, FoxO1, and CREB is significantly elevated. Moreover, PPARβ was up-regulated dose-dependently. SiRNA knockdown of PPARβ completely rescued the increase of glycogen accumulation and glucose uptake, and the up-regulation of FOXO1 and CREB expression. Our findings propose novel mechanisms that 2,4-dichlorophenoxyacetic acid causes glucose metabolism dysfunction through PPARβ in HepG2 cells.

  7. Computational repositioning of ethno medicine elucidated gB-gH-gL complex as novel anti herpes drug target

    PubMed Central

    2013-01-01

    Background Herpes viruses are important human pathogens that can cause mild to severe lifelong infections with high morbidity. They remain latent in the host cells and can cause recurrent infections that might prove fatal. These viruses are known to infect the host cells by causing the fusion of viral and host cell membrane proteins. Fusion is achieved with the help of conserved fusion machinery components, glycoproteins gB, heterodimer gH-gL complex along with other non-conserved components. Whereas, another important glycoprotein gD without which viral entry to the cell is not possible, acts as a co-activator for the gB-gH-gL complex formation. Thus, this complex formation interface is the most promising drug target for the development of novel anti-herpes drug candidates. In the present study, we propose a model for binding of gH-gL to gB glycoprotein leading from pre to post conformational changes during gB-gH-gL complex formation and reported the key residues involved in this binding activity along with possible binding site locations. To validate the drug targetability of our proposed binding site, we have repositioned some of the most promising in vitro, in vivo validated anti-herpes molecules onto the proposed binding site of gH-gL complex in a computational approach. Methods Hex 6.3 standalone software was used for protein-protein docking studies. Arguslab 4.0.1 and Accelrys® Discovery Studio 3.1 Visualizer softwares were used for semi-flexible docking studies and visualizing the interactions respectively. Protein receptors and ethno compounds were retrieved from Protein Data Bank (PDB) and Pubchem databases respectively. Lipinski’s Filter, Osiris Property Explorer and Lazar online servers were used to check the pharmaceutical fidelity of the drug candidates. Results Through protein-protein docking studies, it was identified that the amino acid residues VAL342, GLU347, SER349, TYR355, SER388, ASN395, HIS398 and ALA387 of gH-gL complex play an active

  8. [Correlation between IgG subtypes and hematological diseases].

    PubMed

    Shao, Yuan-Yuan; Shao, Zong-Hong

    2015-02-01

    IgG is the main immunoglobulin, brings the immunolgic effects in body. The human IgG can be divided into four kinds; IgG1, IgG2, IgG3, IgG4, respectively. The structures of IgG1, IgG2, IgG3, IgG4 are different, therefore, their functions are also different. The defects, increase or imbalance of the IgG subtypes in autoimmune diseases, infectious diseases, cancer and other diseases are indicators of the immune response. IgG1, IgG2, IgG3 and IgG4 also play a different important roles in the disease progress. The analysis of IgG subtypes is beneficial to study the etiology, pathogenesis and prognosis of above menthioned deseases. This review briefly summarizes the characteristics of IgG subtypes in thrombotic thrombocytopenic purpura, autoimmune hemolytic anemia, hemophilia, lymphoma and leukemia.

  9. Relationship of metabolic syndrome and its components with -844 G/A and HindIII C/G PAI-1 gene polymorphisms in Mexican children

    PubMed Central

    2012-01-01

    Background Several association studies have shown that -844 G/A and HindIII C/G PAI-1 polymorphisms are related with increase of PAI-1 levels, obesity, insulin resistance, glucose intolerance, hypertension and dyslipidemia, which are components of metabolic syndrome. The aim of this study was to analyze the allele and genotype frequencies of these polymorphisms in PAI-1 gene and its association with metabolic syndrome and its components in a sample of Mexican mestizo children. Methods This study included 100 children with an age range between 6-11 years divided in two groups: a) 48 children diagnosed with metabolic syndrome and b) 52 children metabolically healthy without any clinical and biochemical alteration. Metabolic syndrome was defined as the presence of three or more of the following criteria: fasting glucose levels ≥ 100 mg/dL, triglycerides ≥ 150 mg/dL, HDL-cholesterol < 40 mg/dL, obesity BMI ≥ 95th percentile, systolic blood pressure (SBP) and diastolic blood pressure (DBP) ≥ 95th percentile and insulin resistance HOMA-IR ≥ 2.4. The -844 G/A and HindIII C/G PAI-1 polymorphisms were analyzed by PCR-RFLP. Results For the -844 G/A polymorphism, the G/A genotype (OR = 2.79; 95% CI, 1.11-7.08; p = 0.015) and the A allele (OR = 2.2; 95% CI, 1.10-4.43; p = 0.015) were associated with metabolic syndrome. The -844 G/A and A/A genotypes were associated with increase in plasma triglycerides levels (OR = 2.6; 95% CI, 1.16 to 6.04; p = 0.02), decrease in plasma HDL-cholesterol levels (OR = 2.4; 95% CI, 1.06 to 5.42; p = 0.03) and obesity (OR = 2.6; 95% CI, 1.17-5.92; p = 0.01). The C/G and G/G genotypes of the HindIII C/G polymorphism contributed to a significant increase in plasma total cholesterol levels (179 vs. 165 mg/dL; p = 0.02) in comparison with C/C genotype. Conclusions The -844 G/A PAI-1 polymorphism is related with the risk of developing metabolic syndrome, obesity and atherogenic dyslipidemia, and the HindIII C/G PAI-1 polymorphism was

  10. Osthole induces G2/M cell cycle arrest and apoptosis in human hepatocellular carcinoma HepG2 cells.

    PubMed

    Chao, Xu; Zhou, Xiaojun; Zheng, Gang; Dong, Changhu; Zhang, Wei; Song, Xiaomei; Jin, Tianbo

    2014-05-01

    Osthole [7-methoxy-8-(3-methyl-2-butenyl) coumarin] isolated from the fruit of Cnidium monnieri (L.) Cuss, one of the commonly used Chinese medicines listed in the Shennong's Classic of Materia Medica in the Han Dynasty, had remarkable antiproliferative activity against human hepatocellular carcinoma HepG2 cells in culture. This study evaluated the effects of osthole on cell growth, nuclear morphology, cell cycle distribution, and expression of apoptosis-related proteins in HepG2 cells. Cytotoxic activity of osthole was determined by the MTT assay at various concentrations ranging from 0.004 to 1.0 µmol/ml in HepG2 cells. Cell morphology was assessed by Hoechst staining and fluorescence microscopy. Apoptosis and cell-cycle distribution was determined by annexin V staining and flow cytometry. Apoptotic protein levels were assessed by Western blot. Osthole exhibited significant inhibition of the survival of HepG2 cells and the half inhibitory concentration (IC₅₀) values were 0.186, 0.158 and 0.123 µmol/ml at 24, 48 and 72 h, respectively. Cells treated with osthole at concentrations of 0, 0.004, 0.02, 0.1 and 0.5 μmol/ml showed a statistically significant increase in the G2/M fraction accompanied by a decrease in the G0/G1 fraction. The increase of apoptosis induced by osthole was correlated with down-regulation expression of anti-apoptotic Bcl-2 protein and up-regulation expression of pro-apoptotic Bax and p53 proteins. Osthole had significant growth inhibitory activity and the pro-apoptotic effect of osthole is mediated through the activation of caspases and mitochondria in HepG2 cells. Results suggest that osthole has promising therapeutic potential against hepatocellular carcinoma.

  11. 26 CFR 1.167(g)-1 - Basis for depreciation.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 26 Internal Revenue 2 2012-04-01 2012-04-01 false Basis for depreciation. 1.167(g)-1 Section 1.167(g)-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Itemized Deductions for Individuals and Corporations § 1.167(g)-1 Basis...

  12. 26 CFR 1.167(g)-1 - Basis for depreciation.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 26 Internal Revenue 2 2011-04-01 2011-04-01 false Basis for depreciation. 1.167(g)-1 Section 1.167(g)-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Itemized Deductions for Individuals and Corporations § 1.167(g)-1 Basis...

  13. 26 CFR 1.167(g)-1 - Basis for depreciation.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 26 Internal Revenue 2 2014-04-01 2014-04-01 false Basis for depreciation. 1.167(g)-1 Section 1.167(g)-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Itemized Deductions for Individuals and Corporations § 1.167(g)-1 Basis...

  14. 26 CFR 1.167(g)-1 - Basis for depreciation.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 26 Internal Revenue 2 2010-04-01 2010-04-01 false Basis for depreciation. 1.167(g)-1 Section 1.167(g)-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Itemized Deductions for Individuals and Corporations § 1.167(g)-1 Basis...

  15. 26 CFR 1.167(g)-1 - Basis for depreciation.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 26 Internal Revenue 2 2013-04-01 2013-04-01 false Basis for depreciation. 1.167(g)-1 Section 1.167(g)-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Itemized Deductions for Individuals and Corporations § 1.167(g)-1 Basis...

  16. Quark-hadron duality in spin structure functions g1p and g1d

    NASA Astrophysics Data System (ADS)

    Bosted, P. E.; Dharmawardane, K. V.; Dodge, G. E.; Forest, T. A.; Kuhn, S. E.; Prok, Y.; Adams, G.; Amarian, M.; Ambrozewicz, P.; Anghinolfi, M.; Asryan, G.; Avakian, H.; Bagdasaryan, H.; Baillie, N.; Ball, J. P.; Baltzell, N. A.; Barrow, S.; Batourine, V.; Battaglieri, M.; Beard, K.; Bedlinskiy, I.; Bektasoglu, M.; Bellis, M.; Benmouna, N.; Biselli, A. S.; Bonner, B. E.; Bouchigny, S.; Boiarinov, S.; Bradford, R.; Branford, D.; Brooks, W. K.; Bültmann, S.; Burkert, V. D.; Butuceanu, C.; Calarco, J. R.; Careccia, S. L.; Carman, D. S.; Carnahan, B.; Cazes, A.; Chen, S.; Cole, P. L.; Collins, P.; Coltharp, P.; Cords, D.; Corvisiero, P.; Crabb, D.; Crannell, H.; Crede, V.; Cummings, J. P.; Masi, R. De; Devita, R.; Sanctis, E. De; Degtyarenko, P. V.; Denizli, H.; Dennis, L.; Deur, A.; Djalali, C.; Donnelly, J.; Doughty, D.; Dragovitsch, P.; Dugger, M.; Dytman, S.; Dzyubak, O. P.; Egiyan, H.; Egiyan, K. S.; Elouadrhiri, L.; Eugenio, P.; Fatemi, R.; Fedotov, G.; Feuerbach, R. J.; Funsten, H.; Garçon, M.; Gavalian, G.; Gilfoyle, G. P.; Giovanetti, K. L.; Girod, F. X.; Goetz, J. T.; Golovatch, E.; Gonenc, A.; Gothe, R. W.; Griffioen, K. A.; Guidal, M.; Guillo, M.; Guler, N.; Guo, L.; Gyurjyan, V.; Hadjidakis, C.; Hafidi, K.; Hakobyan, R. S.; Hardie, J.; Heddle, D.; Hersman, F. W.; Hicks, K.; Hleiqawi, I.; Holtrop, M.; Huertas, M.; Hyde-Wright, C. E.; Ilieva, Y.; Ireland, D. G.; Ishkhanov, B. S.; Isupov, E. L.; Ito, M. M.; Jenkins, D.; Jo, H. S.; Joo, K.; Juengst, H. G.; Keith, C.; Kellie, J. D.; Khandaker, M.; Kim, K. Y.; Kim, K.; Kim, W.; Klein, A.; Klein, F. J.; Klusman, M.; Kossov, M.; Kramer, L. H.; Kubarovsky, V.; Kuhn, J.; Kuleshov, S. V.; Lachniet, J.; Laget, J. M.; Langheinrich, J.; Lawrence, D.; Li, Ji; Lima, A. C. S.; Livingston, K.; Lu, H.; Lukashin, K.; MacCormick, M.; Manak, J. J.; Markov, N.; McAleer, S.; McKinnon, B.; McNabb, J. W. C.; Mecking, B. A.; Mestayer, M. D.; Meyer, C. A.; Mibe, T.; Mikhailov, K.; Minehart, R.; Mirazita, M.; Miskimen, R.; Mokeev, V.; Morand, L.; Morrow, S. A.; Moteabbed, M.; Mueller, J.; Mutchler, G. S.; Nadel-Turonski, P.; Napolitano, J.; Nasseripour, R.; Niccolai, S.; Niculescu, G.; Niculescu, I.; Niczyporuk, B. B.; Niroula, M. R.; Niyazov, R. A.; Nozar, M.; O'Rielly, G. V.; Osipenko, M.; Ostrovidov, A. I.; Park, K.; Pasyuk, E.; Paterson, C.; Philips, S. A.; Pierce, J.; Pivnyuk, N.; Pocanic, D.; Pogorelko, O.; Polli, E.; Pozdniakov, S.; Preedom, B. M.; Price, J. W.; Protopopescu, D.; Qin, L. M.; Raue, B. A.; Riccardi, G.; Ricco, G.; Ripani, M.; Ronchetti, F.; Rosner, G.; Rossi, P.; Rowntree, D.; Rubin, P. D.; Sabatié, F.; Salgado, C.; Santoro, J. P.; Sapunenko, V.; Schumacher, R. A.; Serov, V. S.; Sharabian, Y. G.; Shaw, J.; Shvedunov, N. V.; Skabelin, A. V.; Smith, E. S.; Smith, L. C.; Sober, D. I.; Stavinsky, A.; Stepanyan, S. S.; Stepanyan, S.; Stokes, B. E.; Stoler, P.; Strauch, S.; Suleiman, R.; Taiuti, M.; Taylor, S.; Tedeschi, D. J.; Thoma, U.; Thompson, R.; Tkabladze, A.; Tkachenko, S.; Todor, L.; Tur, C.; Ungaro, M.; Vineyard, M. F.; Vlassov, A. V.; Weinstein, L. B.; Weygand, D. P.; Williams, M.; Wolin, E.; Wood, M. H.; Yegneswaran, A.; Yun, J.; Zana, L.; Zhang, J.; Zhao, B.; Zhao, Z.

    2007-03-01

    New measurements of the spin structure functions of the proton and deuteron g1p(x,Q2) and g1d(x,Q2) in the nucleon resonance region are compared with extrapolations of target-mass-corrected next-to-leading-order (NLO) QCD fits to higher energy data. Averaged over the entire resonance region (W<2 GeV), the data and QCD fits are in good agreement in both magnitude and Q2 dependence for Q2>1.7 GeV2/c2. This “global” duality appears to result from cancellations among the prominent “local” resonance regions: in particular strong σ3/2 contributions in the Δ(1232) region appear to be compensated by strong σ1/2 contributions in the resonance region centered on 1.5 GeV. These results are encouraging for the extension of NLO QCD fits to lower W and Q2 than have been used previously.

  17. Mesospheric ionization and O2 1Delta(g) depletion

    NASA Technical Reports Server (NTRS)

    Spear, K. A.; Solomon, S.

    1987-01-01

    Observations of O2 1Delta(g) emission during solar proton events reveal large depletions below 80 and near 90 km. The lower-altitude depletions are believed to be due to odd hydrogen production and associated depletion of ozone, but the mechanism producing the depletion near 90 km has not yet been established. In this paper, it is proposed that an exothermic charge exchange reaction between O2(+) and O2 1Delta(g) is likely to be responsible for these high-altitude depletions. In particular, it is shown that the vertical structure of the observed change in airglow emission is consistent with this mechanism.

  18. Comparisons of Serum Total IgE, IgG, and IgG1 Levels in Patients with and without Echinococcosis-Induced Anaphylactic Shock

    PubMed Central

    Li, Yimei; Zheng, Hong; Gu, Meilin; Cao, Xinghua; Wen, Hao; Liu, Zaoling; Liu, Tao

    2012-01-01

    We investigated serum total immunoglobulin E (IgE), IgG, and IgG1 levels in patients with and without echinococcosis-induced anaphylactic shock. This was a case-control study of 11 patients with echinococcosis-induced anaphylactic shock and 22 echinococcosis patients with cyst rupture but without anaphylactic shock. Blood was collected before surgery (T0), at the time of cyst rupture (T1), and shock (Tx), 1 h (T2), 1 day (T3), and 1 week (T4) after cyst rupture. Serum IgE, IgG, and IgG1 were determined by enzyme-linked immunosorbent assay. Serum IgE, IgG, and IgG1 levels were significantly higher in patients who developed anaphylactic shock at all time points. Increased pre-surgical IgG and IgG1 levels were identified to be a significant risk factors for developing anaphylactic shock. The results showed that a serum IgG concentration of 312.25 μg/mL could be used as a cut-off point to predict whether an echinococcosis patient would develop anaphylactic shock. PMID:22764299

  19. IgG4-related disease of the rectum

    PubMed Central

    Choi, Sung-Bong; Lim, Chul-Hyun; Cha, Myung-Guen

    2016-01-01

    IgG4-related disease is a relatively new disease entity characterized by elevated serum IgG4 levels and marked infiltration of IgG4-positive plasma cells in lesions. Organ enlargement or nodular lesions consisting of abundant infiltration of lymphocytes and IgG4-positive plasma cells and fibrosis are seen in various organs throughout. We encountered a patient with an inflammatory pseudotumor of the rectum, which was histopathologically confirmed to be an IgG4-related disease. The patient was a 28-year-old woman who had constipation for 3 months. The endoluminal ultrasonography showed a lesion that was heterogeneous and low echogenic in lower rectum. The result of colonoscopic biopsy findings was of chronic proctitis with lymphoid aggregates. For a confirmative diagnosis, excision was performed. Histopathological examination represented plasma cell infiltration and fibrosis. Immunohistochemistry revealed prominence of IgG4-positive plasma cells and confirmed the diagnosis of IgG4-related disease. The patient is currently under observation on low-dose oral prednisolone without relapse. PMID:27186575

  20. Visualizing Vpr-Induced G2 Arrest and Apoptosis

    PubMed Central

    Murakami, Tomoyuki; Aida, Yoko

    2014-01-01

    Vpr is an accessory protein of human immunodeficiency virus type 1 (HIV-1) with multiple functions. The induction of G2 arrest by Vpr plays a particularly important role in efficient viral replication because the transcriptional activity of the HIV-1 long terminal repeat is most active in G2 phase. The regulation of apoptosis by Vpr is also important for immune suppression and pathogenesis during HIV infection. However, it is not known whether Vpr-induced apoptosis depends on the ability of Vpr to induce G2 arrest, and the dynamics of Vpr-induced G2 arrest and apoptosis have not been visualized. We performed time-lapse imaging to examine the temporal relationship between Vpr-induced G2 arrest and apoptosis using HeLa cells containing the fluorescent ubiquitination-based cell cycle indicator2 (Fucci2). The dynamics of G2 arrest and subsequent long-term mitotic cell rounding in cells transfected with the Vpr-expression vector were visualized. These cells underwent nuclear mis-segregation after prolonged mitotic processes and then entered G1 phase. Some cells subsequently displayed evidence of apoptosis after prolonged mitotic processes and nuclear mis-segregation. Interestingly, Vpr-induced apoptosis was seldom observed in S or G2 phase. Likewise, visualization of synchronized HeLa/Fucci2 cells infected with an adenoviral vector expressing Vpr clearly showed that Vpr arrests the cell cycle at G2 phase, but does not induce apoptosis at S or G2 phase. Furthermore, time-lapse imaging of HeLa/Fucci2 cells expressing SCAT3.1, a caspase-3-sensitive fusion protein, clearly demonstrated that Vpr induces caspase-3-dependent apoptosis. Finally, to examine whether the effects of Vpr on G2 arrest and apoptosis were reversible, we performed live-cell imaging of a destabilizing domain fusion Vpr, which enabled rapid stabilization and destabilization by Shield1. The effects of Vpr on G2 arrest and subsequent apoptosis were reversible. This study is the first to characterize the

  1. Ginsenoside G-Rh2 synergizes with SMI-4a in anti-melanoma activity through autophagic cell death.

    PubMed

    Lv, Da-Lun; Chen, Lei; Ding, Wei; Zhang, Wei; Wang, He-Li; Wang, Shuai; Liu, Wen-Bei

    2018-01-01

    Melanoma is a leading cause of cancer death worldwide, and SMI-4a and G-Rh2 exert anti-tumor activity in multiple cancer. However, SMI-4a as well as a synergistic relationship between SMI-4a and G-Rh2 in anti-melanoma capacity are still unknown. Therefore, we investigated the effects of SMI-4a and combined SMI-4a with G-Rh2 on the viability, apoptosis and autophagy of melanoma, and to preliminarily explore the underlying mechanism of SMI-4a and combined SMI-4a with G-Rh2 in inhibiting tumor growth. Cell viability was examined with cell counting Kit 8 assay and colony formation assay; Apoptosis was evaluated by flow cytometry and Caspase 3/7 activity assay; Western blotting was used to test proteins related to autophagy and the AKT/mammalian target of rapamycin (mTOR) signaling pathway; Tumor xenograft model in BALB/c nude mice was performed to evaluate the effects of SMI-4a and combined SMI-4a with G-Rh2 in anti-melanoma in vivo. SMI-4a, a pharmacological inhibitor of PIM-1, could decrease cell viability, induce apoptosis, and promote Caspase 3/7 activity in both A375 and G361 melanoma cells, and SMI-4a inhibited tumor growth by inducing autophagy via down-regulating AKT/mTOR axis in melanoma cells. Furthermore, G-Rh2 amplified the anti-tumor activity of SMI-4a in melanoma cells via strengthening autophagy. Our results suggested that SMI-4a could enhance autophagy-inducing apoptosis by inhibiting AKT/mTOR signaling pathway in melanoma cells, and G-Rh2 could enhance the effects of SMI-4a against melanoma cancer via amplifying autophagy induction. This study demonstrates that combined SMI-4a and G-Rh2 might be a novel alternative strategy for melanoma treatment.

  2. Neisseria meningitidis Group A IgG1 and IgG2 Subclass Immune Response in African Children Aged 12–23 Months Following Meningococcal Vaccination

    PubMed Central

    Holme, Daniel; Findlow, Helen; Sow, Samba O.; Idoko, Olubukola T.; Preziosi, Marie-Pierre; Carlone, George; Plikaytis, Brian D.; Borrow, Ray

    2015-01-01

    Background. A group A meningococcal conjugate vaccine, PsA-TT, was licensed in 2010 and was previously studied in a phase 2 clinical trial to evaluate its safety and immunogenicity in African children 12–23 months of age. Methods. Subjects received either PsA-TT; meningococcal group A, C, W, Y polysaccharide vaccine (PsACWY); or Haemophilus influenzae type b conjugate vaccine (Hib-TT). Forty weeks following primary vaccination, the 3 groups were further randomized to receive either PsA-TT, one-fifth dose of PsACWY, or Hib-TT. Group A–specific immunoglobulin G (IgG) subclass response was characterized using an enzyme-linked immunosorbent assay. Results. The predominant IgG subclass response, regardless of vaccine, was IgG1. One month following primary vaccination, the geometric mean concentrations (GMCs) of IgG1 and IgG2 in the PsA-TT group were 21.73 µg/mL and 6.27 µg/mL, whereas in the PsACWY group the mean GMCs were 2.01 µg/mL and 0.97 µg/mL, respectively (P < .0001). Group A–specific IgG1 and IgG2 GMCs remained greater in the PsA-TT group than in the PsACWY group 40 weeks following primary vaccination (P < .0001). One week following revaccination, those given 2 doses of PsA-TT had the greatest IgG1 and IgG2 GMCs of 125.23 µg/mL and 36.12 µg/mL, respectively (P = .0008), and demonstrated a significant increase in IgG1:IgG2 mean ratio, indicative of the T-cell–dependent response associated with conjugate vaccines. Conclusions. Vaccination of African children aged 12–24 months with either PsA-TT or PsACWY elicited a predominantly IgG1 response. The IgG1:IgG2 mean ratio decreased following successive vaccination with PsACWY, indicating a shift toward IgG2, suggestive of the T-cell–independent immune response commonly associated with polysaccharide antigens. Clinical Trials Registration. SRCTN78147026. PMID:26553689

  3. G0-G1 Transition and the Restriction Point in Pancreatic β-Cells In Vivo

    PubMed Central

    Hija, Ayat; Salpeter, Seth; Klochendler, Agnes; Grimsby, Joseph; Brandeis, Michael; Glaser, Benjamin; Dor, Yuval

    2014-01-01

    Most of our knowledge on cell kinetics stems from in vitro studies of continuously dividing cells. In this study, we determine in vivo cell-cycle parameters of pancreatic β-cells, a largely quiescent population, using drugs that mimic or prevent glucose-induced replication of β-cells in mice. Quiescent β-cells exposed to a mitogenic glucose stimulation require 8 h to enter the G1 phase of the cell cycle, and this time is prolonged in older age. The duration of G1, S, and G2/M is ∼5, 8, and 6 h, respectively. We further provide the first in vivo demonstration of the restriction point at the G0-G1 transition, discovered by Arthur Pardee 40 years ago. The findings may have pharmacodynamic implications in the design of regenerative therapies aimed at increasing β-cell replication and mass in patients with diabetes. PMID:24130333

  4. A soluble form of IL-13 receptor alpha 1 promotes IgG2a and IgG2b production by murine germinal center B cells.

    PubMed

    Poudrier, J; Graber, P; Herren, S; Gretener, D; Elson, G; Berney, C; Gauchat, J F; Kosco-Vilbois, M H

    1999-08-01

    A functional IL-13R involves at least two cell surface proteins, the IL-13R alpha 1 and IL-4R alpha. Using a soluble form of the murine IL-13R alpha 1 (sIL-13R), we reveal several novel features of this system. The sIL-13R promotes proliferation and augmentation of Ag-specific IgM, IgG2a, and IgG2b production by murine germinal center (GC) B cells in vitro. These effects were enhanced by CD40 signaling and were not inhibited by an anti-IL4R alpha mAb, a result suggesting other ligands. In GC cell cultures, sIL-13R also promoted IL-6 production, and interestingly, sIL-13R-induced IgG2a and IgG2b augmentation was absent in GC cells isolated from IL-6-deficient mice. Furthermore, the effects of the sIL-13R molecule were inhibited in the presence of an anti-IL-13 mAb, and preincubation of GC cells with IL-13 enhanced the sIL-13R-mediated effects. When sIL-13R was injected into mice, it served as an adjuvant-promoting production to varying degrees of IgM and IgG isotypes. We thus propose that IL-13R alpha 1 is a molecule involved in B cell differentiation, using a mechanism that may involve regulation of IL-6-responsive elements. Taken together, our data reveal previously unknown activities as well as suggest that the ligand for the sIL-13R might be a component of the IL-13R complex or a counterstructure yet to be defined.

  5. Differentiating immunoglobulin g4-related sclerosing cholangitis from hilar cholangiocarcinoma.

    PubMed

    Tabata, Taku; Kamisawa, Terumi; Hara, Seiichi; Kuruma, Sawako; Chiba, Kazuro; Kuwata, Go; Fujiwara, Takashi; Egashira, Hideto; Koizumi, Koichi; Fujiwara, Junko; Arakawa, Takeo; Momma, Kumiko; Kurata, Masanao; Honda, Goro; Tsuruta, Koji; Itoi, Takao

    2013-03-01

    Few studies have differentiated immunoglobulin G (IgG) 4-related sclerosing cholangitis (IgG4-SC) from hilar cholangiocarcinoma (CC). Thus, we sought to investigate useful features for differentiating IgG4-SC from hilar CC. We retrospectively compared clinical, serological, imaging, and histological features of six patients with IgG4-SC and 42 patients with hilar CC. In patients with hilar CC, obstructive jaundice was more frequent (p<0.01), serum total bilirubin levels were significantly higher (p<0.05), serum CA19-9 levels were significantly higher (p<0.01), and serum duke pancreatic monoclonal antigen type 2 levels were frequently elevated (p<0.05). However, in patients with IgG4-SC, the serum IgG (p<0.05) and IgG4 (p<0.01) levels were significantly higher and frequently elevated. The pancreas was enlarged in all IgG4-SC patients but only in 17% of hilar CC patients (p<0.01). Salivary and/or lacrimal gland swelling was detected in only 50% of IgG4-SC patients (p<0.01). Endoscopic retrograde cholangiography revealed that the hilar or hepatic duct was completely obstructed in 83% of hilar CC patients (p<0.01). Lower bile duct stenosis, apart from hilar bile duct stenosis, was more frequent in IgG4-SC patients (p<0.01). Bile duct wall thickening in areas without stenosis was more frequent in IgG4-SC patients (p<0.01). An integrated diagnostic approach based on clinical, serological, imaging, and histological findings is necessary to differentiate IgG4-SC from hilar CC.

  6. Differentiating Immunoglobulin G4-Related Sclerosing Cholangitis from Hilar Cholangiocarcinoma

    PubMed Central

    Tabata, Taku; Hara, Seiichi; Kuruma, Sawako; Chiba, Kazuro; Kuwata, Go; Fujiwara, Takashi; Egashira, Hideto; Koizumi, Koichi; Fujiwara, Junko; Arakawa, Takeo; Momma, Kumiko; Kurata, Masanao; Honda, Goro; Tsuruta, Koji; Itoi, Takao

    2013-01-01

    Background/Aims Few studies have differentiated immunoglobulin G (IgG) 4-related sclerosing cholangitis (IgG4-SC) from hilar cholangiocarcinoma (CC). Thus, we sought to investigate useful features for differentiating IgG4-SC from hilar CC. Methods We retrospectively compared clinical, serological, imaging, and histological features of six patients with IgG4-SC and 42 patients with hilar CC. Results In patients with hilar CC, obstructive jaundice was more frequent (p<0.01), serum total bilirubin levels were significantly higher (p<0.05), serum CA19-9 levels were significantly higher (p<0.01), and serum duke pancreatic monoclonal antigen type 2 levels were frequently elevated (p<0.05). However, in patients with IgG4-SC, the serum IgG (p<0.05) and IgG4 (p<0.01) levels were significantly higher and frequently elevated. The pancreas was enlarged in all IgG4-SC patients but only in 17% of hilar CC patients (p<0.01). Salivary and/or lacrimal gland swelling was detected in only 50% of IgG4-SC patients (p<0.01). Endoscopic retrograde cholangiography revealed that the hilar or hepatic duct was completely obstructed in 83% of hilar CC patients (p<0.01). Lower bile duct stenosis, apart from hilar bile duct stenosis, was more frequent in IgG4-SC patients (p<0.01). Bile duct wall thickening in areas without stenosis was more frequent in IgG4-SC patients (p<0.01). Conclusions An integrated diagnostic approach based on clinical, serological, imaging, and histological findings is necessary to differentiate IgG4-SC from hilar CC. PMID:23560161

  7. Efficient water disinfection with Ag2WO4-doped mesoporous g-C3N4 under visible light.

    PubMed

    Li, Yi; Li, Yanan; Ma, Shuanglong; Wang, Pengfei; Hou, Qianlei; Han, Jingjing; Zhan, Sihui

    2017-09-15

    Ag 2 WO 4 /g-C 3 N 4 composite photocatalyst was synthesized by polymerization of thiourea and ammonia chloride combined with the deposition-precipitation method, which was applied as an efficient visible-light driven photocatalyst for inactivating Escherichia coli (E. coli). The physicochemical properties of these photocatalysts were systematically characterized by various techniques such as SEM, TEM, XRD, FT-IR, BET, UV-vis DRS and PL. The synthesized photocatalysts exhibited outstandingly enhanced photocatalytic disinfection efficiency compared with that of pure g-C 3 N 4 and Ag 2 WO 4 under visible light. Furthermore, the optimal mass ratio of the Ag 2 WO 4 to g-C 3 N 4 was 5wt%, and a number of live bacteria could be completely inactivated with Ag 2 WO 4 (5%)/g-C 3 N 4 (100μg/mL) after 90min under visible light irradiation. The high disinfection efficiency is due to the synergetic effect between g-C 3 N 4 and Ag 2 WO 4 , including a good distribution of Ag 2 WO 4 particles on the surface of g-C 3 N 4 and an improved separation rate of photogenerated electron-hole pairs. The enhanced disinfection mechanism was also investigated using photogenerated current densities and electrochemical impedance spectroscopy (EIS). Considering the bulk availability and excellent disinfection activity of Ag 2 WO 4 /g-C 3 N 4 composite, it is a promising solar-driven photocatalyst for cleaning the microbial contaminated water. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Protein phosphatase PPM1G regulates protein translation and cell growth by dephosphorylating 4E binding protein 1 (4E-BP1).

    PubMed

    Liu, Jianyu; Stevens, Payton D; Eshleman, Nichole E; Gao, Tianyan

    2013-08-09

    Protein translation initiation is a tightly controlled process responding to nutrient availability and mitogen stimulation. Serving as one of the most important negative regulators of protein translation, 4E binding protein 1 (4E-BP1) binds to translation initiation factor 4E and inhibits cap-dependent translation in a phosphorylation-dependent manner. Although it has been demonstrated previously that the phosphorylation of 4E-BP1 is controlled by mammalian target of rapamycin in the mammalian target of rapamycin complex 1, the mechanism underlying the dephosphorylation of 4E-BP1 remains elusive. Here, we report the identification of PPM1G as the phosphatase of 4E-BP1. A coimmunoprecipitation experiment reveals that PPM1G binds to 4E-BP1 in cells and that purified PPM1G dephosphorylates 4E-BP1 in vitro. Knockdown of PPM1G in 293E and colon cancer HCT116 cells results in an increase in the phosphorylation of 4E-BP1 at both the Thr-37/46 and Ser-65 sites. Furthermore, the time course of 4E-BP1 dephosphorylation induced by amino acid starvation or mammalian target of rapamycin inhibition is slowed down significantly in PPM1G knockdown cells. Functionally, the amount of 4E-BP1 bound to the cap-dependent translation initiation complex is decreased when the expression of PPM1G is depleted. As a result, the rate of cap-dependent translation, cell size, and protein content are increased in PPM1G knockdown cells. Taken together, our study has identified protein phosphatase PPM1G as a novel regulator of cap-dependent protein translation by negatively controlling the phosphorylation of 4E-BP1.

  9. Comparison of clinical outcome between 23-G and 25-G vitrectomy in diabetic patients

    PubMed Central

    Taleb, Eman Abo; Nagpal, Manish P.; Mehrotra, Navneet S.; Bhatt, Kalyani; Goswami, Sangeeta; Babalola, Yewande O.; Noman, Abdulrahman

    2017-01-01

    PURPOSE: To compare the clinical outcomes and complications between 23-G and 25-G vitrectomy in patients with diabetic vitreous hemorrhage (VH). MATERIALS AND METHODS: A retrospective comparative study comprising 69 eyes (36 eyes in 23-G group and 33 eyes in 25-G group) of 65 patients who underwent vitrectomy with air tamponade for diabetic vitreous hemorrhage (VH) with at least 6 months of follow-up was conducted. RESULTS: There were no significant differences between the two groups in age, gender, bilaterality, type of diabetes, presence of hypertension, lens status, and previous argon laser photocoagulation state (P > 0.05). Best-corrected visual acuity (BCVA) of both groups at postoperative 1 month logarithm of the minimum angle of resolution (logMAR) (1.06 ± 0.99, 0.90 ± 0.96), 3 months logMAR (1.07 ± 0.93, 0.83 ± 0.85), and 6 months logMAR (1.03 ± 0.89, 0.83 ± 0.85) significantly improved from the preoperative BCVA logMAR (2.03 ± 0.83, 2.15 ± 0.99) for 23-G group, 25-G group, respectively (P < 0.0001). There was no significant difference in BCVA between the two groups preoperatively and at 1, 3, and 6 months postoperatively (P = 0.566, 0.506, 0.333, and 0.445, respectively), incidence of intraoperative wound suturing (21.4%, 15.2%), postoperative hypotony (0.0%, 0.0%), early postoperative VH (POVH) (11.1%, 15.2%), late POVH (5.6%, 0.0%), retinal detachment (2.8%, 6.1%), neovascular glaucoma (92.8%, 9.1%), and endophthalmitis (0.0%, 0.0%) for 23-G group, 25-G group, respectively (P > 0.05). CONCLUSION: 25-G vitrectomy is as effective for PDR as 23-G vitrectomy. PMID:29118498

  10. Comparison of clinical outcome between 23-G and 25-G vitrectomy in diabetic patients.

    PubMed

    Taleb, Eman Abo; Nagpal, Manish P; Mehrotra, Navneet S; Bhatt, Kalyani; Goswami, Sangeeta; Babalola, Yewande O; Noman, Abdulrahman

    2017-01-01

    To compare the clinical outcomes and complications between 23-G and 25-G vitrectomy in patients with diabetic vitreous hemorrhage (VH). A retrospective comparative study comprising 69 eyes (36 eyes in 23-G group and 33 eyes in 25-G group) of 65 patients who underwent vitrectomy with air tamponade for diabetic vitreous hemorrhage (VH) with at least 6 months of follow-up was conducted. There were no significant differences between the two groups in age, gender, bilaterality, type of diabetes, presence of hypertension, lens status, and previous argon laser photocoagulation state ( P > 0.05). Best-corrected visual acuity (BCVA) of both groups at postoperative 1 month logarithm of the minimum angle of resolution (logMAR) (1.06 ± 0.99, 0.90 ± 0.96), 3 months logMAR (1.07 ± 0.93, 0.83 ± 0.85), and 6 months logMAR (1.03 ± 0.89, 0.83 ± 0.85) significantly improved from the preoperative BCVA logMAR (2.03 ± 0.83, 2.15 ± 0.99) for 23-G group, 25-G group, respectively ( P < 0.0001). There was no significant difference in BCVA between the two groups preoperatively and at 1, 3, and 6 months postoperatively ( P = 0.566, 0.506, 0.333, and 0.445, respectively), incidence of intraoperative wound suturing (21.4%, 15.2%), postoperative hypotony (0.0%, 0.0%), early postoperative VH (POVH) (11.1%, 15.2%), late POVH (5.6%, 0.0%), retinal detachment (2.8%, 6.1%), neovascular glaucoma (92.8%, 9.1%), and endophthalmitis (0.0%, 0.0%) for 23-G group, 25-G group, respectively ( P > 0.05). 25-G vitrectomy is as effective for PDR as 23-G vitrectomy.

  11. Value of serum IgG4 in the diagnosis of IgG4-related disease and in differentiation from rheumatic diseases and other diseases.

    PubMed

    Yamamoto, Motohisa; Tabeya, Tetsuya; Naishiro, Yasuyoshi; Yajima, Hidetaka; Ishigami, Keisuke; Shimizu, Yui; Obara, Mikiko; Suzuki, Chisako; Yamashita, Kentaro; Yamamoto, Hiroyuki; Hayashi, Toshiaki; Sasaki, Shigeru; Sugaya, Toshiaki; Ishida, Tadao; Takano, Ken-Ichi; Himi, Tetsuo; Suzuki, Yasuo; Nishimoto, Norihiro; Honda, Saho; Takahashi, Hiroki; Imai, Kohzoh; Shinomura, Yasuhisa

    2012-06-01

    IgG4-related disease (IgG4-RD) is a novel disease entity that includes Mikulicz's disease, autoimmune pancreatitis (AIP), and many other conditions. It is characterized by elevated serum IgG4 levels and abundant IgG4-bearing plasmacyte infiltration of involved organs. We postulated that high levels of serum IgG4 would comprise a useful diagnostic tool, but little information is available about IgG4 in conditions other than IgG4-RD, including rheumatic diseases. Several reports have described cutoff values for serum IgG4 when diagnosing IgG4-RD, but these studies mostly used 135 mg/dL in AIP to differentiate from pancreatic cancer instead of rheumatic and other common diseases. There is no evidence for a cutoff serum IgG4 level of 135 mg/dL for rheumatic diseases and common diseases that are often complicated with rheumatic diseases. The aim of this work was to re-evaluate the usual cutoff serum IgG4 value in AIP (135 mg/dL) that is used to diagnose whole IgG4-RD in the setting of a rheumatic clinic by measuring serum IgG4 levels in IgG4-RD and various disorders. We therefore constructed ROC curves of serum IgG4 levels in 418 patients who attended Sapporo Medical University Hospital due to IgG4-RD and various rheumatic and common disorders. The optimal cut-off value of serum IgG4 for a diagnosis of IgG4-RD was 144 mg/dL, and the sensitivity and specificity were 95.10 and 90.76%, respectively. Levels of serum IgG4 were elevated in IgG4-RD, Churg-Strauss syndrome, multicentric Castleman's disease, eosinophilic disorders, and in some patients with rheumatoid arthritis, systemic sclerosis, chronic hepatitis, and liver cirrhosis. The usual cut-off value of 135 mg/dL in AIP is useful for diagnosing whole IgG4-RD, but high levels of serum IgG4 are sometimes observed in not only IgG4-RD but also other rheumatic and common diseases.

  12. Tandem application of ligand-based virtual screening and G4-OAS assay to identify novel G-quadruplex-targeting chemotypes.

    PubMed

    Musumeci, Domenica; Amato, Jussara; Zizza, Pasquale; Platella, Chiara; Cosconati, Sandro; Cingolani, Chiara; Biroccio, Annamaria; Novellino, Ettore; Randazzo, Antonio; Giancola, Concetta; Pagano, Bruno; Montesarchio, Daniela

    2017-05-01

    G-quadruplex (G4) structures are key elements in the regulation of cancer cell proliferation and their targeting is deemed to be a promising strategy in anticancer therapy. A tandem application of ligand-based virtual screening (VS) calculations together with the experimental G-quadruplex on Oligo Affinity Support (G4-OAS) assay was employed to discover novel G4-targeting compounds. The interaction of the selected compounds with the investigated G4 in solution was analysed through a series of biophysical techniques and their biological activity investigated by immunofluorescence and MTT assays. A focused library of 60 small molecules, designed as putative G4 groove binders, was identified through the VS. The G4-OAS experimental screening led to the selection of 7 ligands effectively interacting with the G4-forming human telomeric DNA. Evaluation of the biological activity of the selected compounds showed that 3 ligands of this sub-library induced a marked telomere-localized DNA damage response in human tumour cells. The combined application of virtual and experimental screening tools proved to be a successful strategy to identify new bioactive chemotypes able to target the telomeric G4 DNA. These compounds may represent useful leads for the development of more potent and selective G4 ligands. Expanding the repertoire of the available G4-targeting chemotypes with improved physico-chemical features, in particular aiming at the discovery of novel, selective G4 telomeric ligands, can help in developing effective anti-cancer drugs with fewer side effects. This article is part of a Special Issue entitled "G-quadruplex" Guest Editor: Dr. Concetta Giancola and Dr. Daniela Montesarchio. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Insights into the photocatalytic mechanism of mediator-free direct Z-scheme g-C3N4/Bi2MoO6(010) and g-C3N4/Bi2WO6(010) heterostructures: A hybrid density functional theory study

    NASA Astrophysics Data System (ADS)

    Opoku, Francis; Govender, Krishna Kuben; Sittert, Cornelia Gertina Catharina Elizabeth van; Govender, Penny Poomani

    2018-01-01

    Graphite-like carbon nitride (g-C3N4)-based heterostructures have received much attention due to their prominent photocatalytic activity. The g-C3N4/Bi2WO6 and g-C3N4/Bi2MoO6 heterostructures, which follow a typical hetero-junction charge transfer mechanisms show a weak potential for hydrogen evolution and reactive radical generation under visible light irradiation. A mediator-free Z-scheme g-C3N4/Bi2MoO6(010) and g-C3N4/Bi2WO6(010) heterostructures photocatalyst are designed for the first time using first-principles studies. Moreover, theoretical understanding of the underlying mechanism, the effects of interfacial composition and the role the interface play in the overall photoactivity is still unexplained. The calculated band gap of the heterostructures is reduced compared to the bulk Bi2WO6 and Bi2MoO6. In this study, we systematically calculated energy band structure, optical properties and charge transfer of the g-C3N4/Bi2MoO6(010) and g-C3N4/Bi2WO6(010) heterostructures using the hybrid density functional theory approach. The results show that the charge transfer at the interface of the heterostructures induces a built-in potential, which benefits the separation of photogenerated charge carriers. The g-C3N4/Bi2MoO6(010) heterostructure with more negative adhesion energy (-1.10 eVA-2) is predicted to have a better adsorptive ability and can form more easily compared to the g-C3N4/Bi2WO6(010) interface (-1.16 eVA-2). Therefore, our results show that the g-C3N4 interaction with Bi2MoO6 is stronger than Bi2WO6, which is also verified by the smaller vertical separation (3.25 Å) between Bi2MoO6 and g-C3N4 compared to the g-C3N4/Bi2WO6(010) interface (3.36 Å). The optical absorption verifies that these proposed Z-scheme heterostructures are excellent visible light harvesting semiconductor photocatalyst materials. This enhancement is ascribed to the role of g-C3N4 monolayer as an electron acceptor and the direct Z-scheme charge carrier transfer at the interface of

  14. Sensitivity of solar g-modes to varying G cosmologies

    NASA Technical Reports Server (NTRS)

    Guenther, D. B.; Sills, Ken; Demarque, Pierre; Krauss, Lawrence M.

    1995-01-01

    The sensitivity of the solar g-mode oscillation spectrum to variability in the universal gravitational constant G is described. Solar models in varying G cosmologies were constructed by evolving a zero-age main-sequence stellar model to the Sun's current age, while allowing the value of G to change according to the power law G(t) proportional to t(exp -beta), where Beta approximately equals delta G/GH and H is the Hubble constant. All solar models were constrained to the observed luminosity and radius at the current age of the Sun by adjusting the helium abundance and the mixing-length parameter of the models in the usual way for standard stellar models. Low-l g-mode oscillation periods were calculated for each of the models and compared to the claimed observation of the solar g-mode oscillation spectrum by Hill & Gu (1990). If one accepts Hill & Gu's claims, then within the uncertainties of the physics of the solar model calculation, our models rule out all but (delta G/GH) less than approximately 0.05. In other words, we conclude that G could not have varied by more than 2% over the past 4.5 Gyr, the lifetime of the present-day Sun. This result lends independent support to the validity of the standard solar model.

  15. IgG4-Associated Cholangitis Can Mimic Hilar Cholangiocarcinoma.

    PubMed

    Zaydfudim, Victor M; Wang, Andrew Y; de Lange, Eduard E; Zhao, Zimin; Moskaluk, Christopher A; Bauer, Todd W; Adams, Reid B

    2015-07-01

    IgG4-associated cholangitis can mimic hilar cholangiocarcinoma. Previously reported patients with IgG4-associated cholangitis mimicking cholangiocarcinoma had elevated serum IgG4 levels and long-segment biliary strictures. However, in the absence of other diagnostic criteria for malignancy, IgG4-associated cholangitis should remain a consideration among patients with normal serum IgG4 and a hilar mass suspicious for cholangiocarcinoma. The presence of a hilar mass and a malignant-appearing biliary stricture in two patients with normal serum IgG4 prompted further evaluation and subsequent concomitant liver and bile duct resection and reconstruction. The diagnosis of IgG4-associated cholangitis was established during the pathologic evaluation of the resected specimens. IgG4-associated cholangitis is a known imitator of hilar cholangiocarcinoma and should be considered in the differential diagnosis even among serologically IgG4-negative patients with a hilar mass prior to operative resection.

  16. G protein-coupled estrogen receptor (GPER) mediates NSCLC progression induced by 17β-estradiol (E2) and selective agonist G1.

    PubMed

    Liu, Changyu; Liao, Yongde; Fan, Sheng; Tang, Hexiao; Jiang, Zhixiao; Zhou, Bo; Xiong, Jing; Zhou, Sheng; Zou, Man; Wang, Jianmiao

    2015-04-01

    Estrogen classically drives lung cancer development via estrogen receptor β (ERβ). However, fulvestrant, an anti-estrogen-based endocrine therapeutic treatment, shows limited effects for non-small cell lung cancer (NSCLC) in phase II clinical trials. G protein-coupled estrogen receptor (GPER), a third estrogen receptor that binds to estrogen, has been found to be activated by fulvestrant, stimulating the progression of breast, endometrial, and ovarian cancers. We here demonstrated that cytoplasm-GPER (cGPER) (80.49 %) and nucleus-GPER (53.05 %) were detected by immunohistochemical analysis in NSCLC samples. cGPER expression was related to stages IIIA-IV, lymph node metastasis, and poorly differentiated NSCLC. Selective agonist G1 and 17β-estradiol (E2) promoted the GPER-mediated proliferation, invasion, and migration of NSCLC cells. Additionally, in vitro administration of E2 and G1 increased the number of tumor nodules, tumor grade, and tumor index in a urethane-induced adenocarcinoma model. Importantly, the pro-tumorigenic effects of GPER induced by E2 were significantly reduced by co-administering the GPER inhibitor G15 and the ERβ inhibitor fulvestrant, as compared to administering fulvestrant alone both in vitro and in vivo. Moreover, the phosphorylation of MAPK and Akt was involved in E2/G1-induced GPER activation. In conclusion, our results indicated that a pro-tumor function of GPER exists that mediated E2-/G1-dependent NSCLC progression and showed better efficiency regarding the co-targeting of GPER and ERβ, providing a rationale for further investigation of anti-estrogen clinical therapy.

  17. PcG and trxG in plants - friends or foes.

    PubMed

    Pu, Li; Sung, Zinmay Renee

    2015-05-01

    The highly-conserved Polycomb group (PcG) and trithorax group (trxG) proteins play major roles in regulating gene expression and maintaining developmental states in many organisms. However, neither the recruitment of Polycomb repressive complexes (PRC) nor the mechanisms of PcG and trxG-mediated gene silencing and activation are well understood. Recent progress in Arabidopsis research challenges the dominant model of PRC2-dependent recruitment of PRC1 to target genes. Moreover, evidence indicates that diverse forms of PRC1, with shared components, are a common theme in plants and mammals. Although trxG is known to antagonize PcG, emerging data reveal that trxG can also repress gene expression, acting cooperatively with PcG. We discuss these recent findings and highlight the employment of diverse epigenetic mechanisms during development in plants and animals. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Sugar-modified G-quadruplexes: effects of LNA-, 2′F-RNA– and 2′F-ANA-guanosine chemistries on G-quadruplex structure and stability

    PubMed Central

    Li, Zhe; Lech, Christopher Jacques; Phan, Anh Tuân

    2014-01-01

    G-quadruplex-forming oligonucleotides containing modified nucleotide chemistries have demonstrated promising pharmaceutical potential. In this work, we systematically investigate the effects of sugar-modified guanosines on the structure and stability of a (4+0) parallel and a (3+1) hybrid G-quadruplex using over 60 modified sequences containing a single-position substitution of 2′-O-4′-C-methylene-guanosine (LNAG), 2′-deoxy-2′-fluoro-riboguanosine (FG) or 2′-deoxy-2′-fluoro-arabinoguanosine (FANAG). Our results are summarized in two parts: (I) Generally, LNAG substitutions into ‘anti’ position guanines within a guanine-tetrad lead to a more stable G-quadruplex, while substitutions into ‘syn’ positions disrupt the native G-quadruplex conformation. However, some interesting exceptions to this trend are observed. We discover that a LNAG modification upstream of a short propeller loop hinders G-quadruplex formation. (II) A single substitution of either FG or FANAG into a ‘syn’ position is powerful enough to perturb the (3+1) G-quadruplex. Substitution of either FG or FANAG into any ‘anti’ position is well tolerated in the two G-quadruplex scaffolds. FANAG substitutions to ‘anti’ positions are better tolerated than their FG counterparts. In both scaffolds, FANAG substitutions to the central tetrad layer are observed to be the most stabilizing. The observations reported herein on the effects of LNAG, FG and FANAG modifications on G-quadruplex structure and stability will enable the future design of pharmaceutically relevant oligonucleotides. PMID:24371274

  19. Integration of g4tools in Geant4

    NASA Astrophysics Data System (ADS)

    Hřivnáčová, Ivana

    2014-06-01

    g4tools, that is originally part of the inlib and exlib packages, provides a very light and easy to install set of C++ classes that can be used to perform analysis in a Geant4 batch program. It allows to create and manipulate histograms and ntuples, and write them in supported file formats (ROOT, AIDA XML, CSV and HBOOK). It is integrated in Geant4 through analysis manager classes, thus providing a uniform interface to the g4tools objects and also hiding the differences between the classes for different supported output formats. Moreover, additional features, such as for example histogram activation or support for Geant4 units, are implemented in the analysis classes following users requests. A set of Geant4 user interface commands allows the user to create histograms and set their properties interactively or in Geant4 macros. g4tools was first introduced in the Geant4 9.5 release where its use was demonstrated in one basic example, and it is already used in a majority of the Geant4 examples within the Geant4 9.6 release. In this paper, we will give an overview and the present status of the integration of g4tools in Geant4 and report on upcoming new features.

  20. Intra-genotypic Diversity of Archival G4P[8] Human Rotaviruses from Washington, DC

    PubMed Central

    McDonald, Sarah M.; Davis, Kristin; McAllen, John K.; Spiro, David J.; Patton, John T.

    2011-01-01

    Group A human rotaviruses (RVs) remain the most frequently detected viral agents associated with acute gastroenteritis in infants and young children. Despite their medical importance, relatively few complete genome sequences have been determined for commonly circulating G/P-type strains (i.e., G1P[8], G2P[4], G3P[8], G4P[8], and G9P[8]). In the current study, we sequenced the genomes of 11 G4P[8] isolates from stool specimens that were collected in Washington, DC during the years of 1974-1991. We found that the VP7-VP4-VP6-VP1-VP2-VP3-NSP1-NSP2-NSP3-NSP4-NSP5/6-encoding genes of all 11 G4P[8] RVs have the genotypes of G4-P[8]-I1-R1-C1-M1-A1-N1-T1-E1-H1. By constructing phylogenetic trees for each gene, extensive intra-genotypic diversity was revealed among the G4P[8] RVs, and new sub-genotype gene alleles were identified. Several of these alleles are nearly identical to those of G3P[8] isolates previously sequenced from this same Washington, DC collection, strongly suggesting that the RVs underwent gene reassortment. On the other hand, we observed that some G4P[8] RVs exhibit completely different allele-based genome constellations, despite being collected during the same epidemic season; there was no evidence of gene reassortment between these strains. This observation extends our previous findings and supports the notion that stable, genetically-distinct clades of human RVs with the same G/P-type can co-circulate in a community. Interestingly, the sub-genotype gene alleles found in some of the DC RVs share a close evolutionary relationship with genes of more contemporary human strains. Thus, archival human RVs sequenced in this study might represent evolutionary precursors to modern-day strains. PMID:21712102

  1. Frequency of Aquaporin-4 Immunoglobulin G in Longitudinally Extensive Transverse Myelitis With Antiphospholipid Antibodies.

    PubMed

    Guerra, Hilda; Pittock, Sean J; Moder, Kevin G; Fryer, James P; Gadoth, Avi; Flanagan, Eoin P

    2018-04-11

    Antiphospholipid (aPL) antibodies have historically been postulated to cause a poorly understood inflammatory myelitis. Neuromyelitis optica spectrum disorder (NMOSD) causes an inflammatory longitudinally extensive transverse myelitis (LETM). In 2004, aquaporin-4 immunoglobulin G (AQP4-IgG) was first reported as a highly specific (>99%) serum diagnostic biomarker of NMOSD, distinguishing it from other disorders (eg, multiple sclerosis). We sought to assess the frequency of AQP4-IgG (and thus NMOSD diagnosis) in LETM with aPL antibodies. We searched Mayo Clinic records (from January 1, 1996, through December 31, 2014) for patients with (1) LETM and (2) aPL or β 2 -glycoprotein I antibodies and (3) a serum sample available. AQP4-IgG was evaluated in the 24 included patients and in 20 controls with aPL antibodies but without myelitis. Seropositivity for AQP4-IgG was confirmed in 11 of 24 patients with LETM (46%), confirming an AQP4-IgG-seropositive NMOSD diagnosis rather than aPL-associated LETM. Six of 11 AQP4-IgG-seropositive patients (54%) were initially diagnosed as having aPL/lupus-associated myelitis. Recurrent LETM was exclusive to AQP4-IgG-seropositive patients (P=.003). Alternative diagnoses assigned to the remaining 13 AQP4-IgG-seronegative patients included idiopathic transverse myelitis (n=5), seronegative NMOSD (n=2), spinal cord infarct attributed to aPL antibodies (n=2), spinal cord sarcoidosis (n=1), varicella-zoster virus myelitis (n=1), postinfectious myelitis (n=1), and multiple sclerosis (n=1). All 20 controls were seronegative for AQP4-IgG. Clotting disorders occurred in 36% of patients (4 of 11) with LETM with both aPL antibodies and AQP4-IgG. AQP4-IgG should be tested in all patients with LETM and aPL antibodies because AQP4-IgG-seropositive NMOSD accounts for almost half of all cases. Clotting disorders are common in patients with LETM with dual positivity for AQP4-IgG and aPL antibodies. Copyright © 2018 Mayo Foundation for Medical Education

  2. Action of caffeine on x-irradiated HeLa cells. V. Identity of the sector of cells that expresses potentially lethal damage in G/sub 1/ and G/sub 2/

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Beetham, K.L.; Tolmach, L.J.

    1982-07-01

    When HeLa S3 cells are irradiated in early G/sub 1/ with 4 Gy of 220-kV x rays and are then incubated in growth medium containing up to 5 mM caffeine, survival is reduced (as reported previously), reaching a concentration-dependent plateau. Cell killing presumably occurs as a result of the fixation of a portion of the potentially lethal damage the cells contain. These cells respond to continued treatment with caffeine at concentrations greater than 2 mM during S, but less so than during G/sub 1/. When they reach G/sub 2/ arrest, however, extensive cell killing again occurs (reported previously), presumably alsomore » the result of potentially lethal damage fixation. G/sub 1/-irradiated cultures that are treated with caffeine either continuously at a concentration in the range 1 to 5 mM, or at 10 mM for 8 hr and subsequently with the low concentration, achieve the same survival level in G/sub 2/, provided that the potentially lethal damage is not repaired during G/sub 1/ and S. Repair seems to be completely inhibited in the presence of 3 to 4 mM caffeine. The results indicate that fixation of potentially lethal damage occurs in the same sector of cells in G/sub 1/ and G/sub 2/, suggesting that the same cellular lesion gives rise to cell killing in the two phases.« less

  3. Contactin 1 IgG4 associates to chronic inflammatory demyelinating polyneuropathy with sensory ataxia.

    PubMed

    Miura, Yumako; Devaux, Jérôme J; Fukami, Yuki; Manso, Constance; Belghazi, Maya; Wong, Anna Hiu Yi; Yuki, Nobuhiro

    2015-06-01

    A Spanish group recently reported that four patients with chronic inflammatory demyelinating polyneuropathy carrying IgG4 autoantibodies against contactin 1 showed aggressive symptom onset and poor response to intravenous immunoglobulin. We aimed to describe the clinical and serological features of Japanese chronic inflammatory demyelinating polyneuropathy patients displaying the anti-contactin 1 antibodies. Thirteen of 533 (2.4%) patients with chronic inflammatory demyelinating polyneuropathy had anti-contactin 1 IgG4 whereas neither patients from disease or normal control subjects did (P = 0.02). Three of 13 (23%) patients showed subacute symptom onset, but all of the patients presented with sensory ataxia. Six of 10 (60%) anti-contactin 1 antibody-positive patients had poor response to intravenous immunoglobulin, whereas 8 of 11 (73%) antibody-positive patients had good response to corticosteroids. Anti-contactin 1 IgG4 antibodies are a possible biomarker to guide treatment option. © The Author (2015). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  4. New application of Z-scheme Ag3PO4/g-C3N4 composite in converting CO2 to fuel.

    PubMed

    He, Yiming; Zhang, Lihong; Teng, Botao; Fan, Maohong

    2015-01-06

    This research was designed for the first time to investigate the activities of photocatalytic composite, Ag3PO4/g-C3N4, in converting CO2 to fuels under simulated sunlight irradiation. The composite was synthesized using a simple in situ deposition method and characterized by various techniques including Brunauer-Emmett-Teller method (BET), X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FT-IR), scanning electron microscopy (SEM), transmission electron microscopy (TEM), X-ray photoelectron spectroscopy (XPS), UV-vis diffuse reflectance spectroscopy (DRS), photoluminescence spectroscopy (PL), and an electrochemical method. Thorough investigation indicated that the composite consisted of Ag3PO4, Ag, and g-C3N4. The introduction of Ag3PO4 on g-C3N4 promoted its light absorption performance. However, more significant was the formation of heterojunction structure between Ag3PO4 and g-C3N4, which efficiently promoted the separation of electron-hole pairs by a Z-scheme mechanism and ultimately enhanced the photocatalytic CO2 reduction performance of the Ag3PO4/g-C3N4. The optimal Ag3PO4/g-C3N4 photocatalyst showed a CO2 conversion rate of 57.5 μmol · h(-1) · gcat(-1), which was 6.1 and 10.4 times higher than those of g-C3N4 and P25, respectively, under simulated sunlight irradiation. The work found a new application of the photocatalyst, Ag3PO4/g-C3N4, in simultaneous environmental protection and energy production.

  5. Human IgG2- and IgG4-expressing memory B cells display enhanced molecular and phenotypic signs of maturity and accumulate with age.

    PubMed

    de Jong, Britt G; IJspeert, Hanna; Marques, Lemelinda; van der Burg, Mirjam; van Dongen, Jacques Jm; Loos, Bruno G; van Zelm, Menno C

    2017-10-01

    The mechanisms involved in sequential immunoglobulin G (IgG) class switching are still largely unknown. Sequential IG class switching is linked to higher levels of somatic hypermutation (SHM) in vivo, but it remains unclear if these are generated temporally during an immune response or upon activation in a secondary response. We here aimed to uncouple these processes and to distinguish memory B cells from primary and secondary immune responses. SHM levels and IgG subclasses were studied with 454 pyrosequencing on blood mononuclear cells from young children and adults as models for primary and secondary immunological memory. Additional sequencing and detailed immunophenotyping with IgG subclass-specific antibodies was performed on purified IgG + memory B-cell subsets. In both children and adults, SHM levels were higher in transcripts involving more downstream-located IGHG genes (esp. IGHG2 and IGHG4). In adults, SHM levels were significantly higher than in children, and downstream IGHG genes were more frequently utilized. This was associated with increased frequencies of CD27 + IgG + memory B cells, which contained higher levels of SHM, more IGHG2 usage, and higher expression levels of activation markers than CD27 - IgG + memory B cells. We conclude that secondary immunological memory accumulates with age and these memory B cells express CD27, high levels of activation markers, and carry high SHM levels and frequent usage of IGHG2. These new insights contribute to our understanding of sequential IgG subclass switching and show a potential relevance of using serum IgG2 levels or numbers of IgG2-expressing B cells as markers for efficient generation of memory responses.

  6. Increased lymphangiogenesis in Riedel thyroiditis (Immunoglobulin G4-related thyroid disease).

    PubMed

    Cameselle-Teijeiro, José; Ladra, María Jesús; Abdulkader, Ihab; Eloy, Catarina; Soares, Paula; Barreiro, Francisco; Sobrinho-Simões, Manuel; Beiras-Iglesias, Andrés

    2014-09-01

    The present study describes in depth a case of Riedel thyroiditis (RT) to clarify its pathogenesis and its putative inclusion in the spectrum of IgG4-related disease. We report the clinicopathological, immunohistochemical, and ultrastructural features of a case of RT in a 39-year-old white Spanish woman, admitted with a hard goiter and cold nodule in the left thyroid lobe. This case represents 0.05 % of a series of 1,973 consecutive thyroidectomies performed in our hospital. More than 80 % of the left thyroid lobe was effaced by fibrosis and inflammation (lymphocytes, 57 IgG4+ plasma cells per 1 high-power field, an IgG4/IgG ratio of 0.67, and eosinophils) with extension into the surrounding tissues and occlusive phlebitis. Immunostaining for podoplanin (D2-40) detected signs of increased lymphangiogenesis in the fibroinflammatory areas that were confirmed by electron microscopy. A strong, diffuse stain for podoplanin and transforming growth factor ß1 was also detected in the same areas. The increased number of lymphatic vessels in RT is reported for the first time. Our findings support the inclusion of RT within the spectrum of IgG4-related thyroid disease (IgG4-RTD). Although the etiology and physiopathology of IgG4-RTD still remain elusive, the results obtained in the present case suggest the participation of lymphatic vessels in the pathogenesis of RT.

  7. ABT-263 induces G1/G0-phase arrest, apoptosis and autophagy in human esophageal cancer cells in vitro.

    PubMed

    Lin, Qing-Huan; Que, Fu-Chang; Gu, Chun-Ping; Zhong, De-Sheng; Zhou, Dan; Kong, Yi; Yu, Le; Liu, Shu-Wen

    2017-12-01

    Both the anti- and pro-apoptotic members of the Bcl-2 family are regulated by a conserved Bcl-2 homology (BH3) domain. ABT-263 (Navitoclax), a novel BH3 mimetic and orally bioavailable Bcl-2 family inhibitor with high affinity for Bcl-xL, Bcl-2 and Bcl-w has entered clinical trials for cancer treatment. But the anticancer mechanisms of ABT-263 have not been fully elucidated. In this study we investigated the effects of ABT-263 on human esophageal cancer cells in vitro and to explore its anticancer mechanisms. Treatment with ABT-263 dose-dependently suppressed the viability of 3 human esophageal cancer cells with IC 50 values of 10.7±1.4, 7.1±1.5 and 8.2±1.6 μmol/L, in EC109, HKESC-2 and CaES-17 cells, respectively. ABT-263 (5-20 μmol/L) dose-dependently induced G 1 /G 0 -phase arrest in the 3 cancer cell lines and induced apoptosis evidenced by increased the Annexin V-positive cell population and elevated levels of cleaved caspase 3, cleaved caspase 9 and PARP. We further demonstrated that ABT-263 treatment markedly increased the expression of p21 Waf1/Cip1 and decreased the expression of cyclin D1 and phospho-Rb (retinoblastoma tumor suppressor protein) (Ser780) proteins that contributed to the G 1 /G 0 -phase arrest. Knockdown of p21 Waf1/Cip1 attenuated ABT-263-induced G 1 /G 0 -phase arrest. Moreover, ABT-263 treatment enhanced pro-survival autophagy, shown as the increased LC3-II levels and decreased p62 levels, which counteracted its anticancer activity. Our results suggest that ABT-263 exerts cytostatic and cytotoxic effects on human esophageal cancer cells in vitro and enhances pro-survival autophagy, which counteracts its anticancer activity.

  8. A Benzothiazole Derivative (5g) Induces DNA Damage And Potent G2/M Arrest In Cancer Cells.

    PubMed

    Hegde, Mahesh; Vartak, Supriya V; Kavitha, Chandagirikoppal V; Ananda, Hanumappa; Prasanna, Doddakunche S; Gopalakrishnan, Vidya; Choudhary, Bibha; Rangappa, Kanchugarakoppal S; Raghavan, Sathees C

    2017-05-31

    Chemically synthesized small molecules play important role in anticancer therapy. Several chemical compounds have been reported to damage the DNA, either directly or indirectly slowing down the cancer cell progression by causing a cell cycle arrest. Direct or indirect reactive oxygen species formation causes DNA damage leading to cell cycle arrest and subsequent cell death. Therefore, identification of chemically synthesized compounds with anticancer potential is important. Here we investigate the effect of benzothiazole derivative (5g) for its ability to inhibit cell proliferation in different cancer models. Interestingly, 5g interfered with cell proliferation in both, cell lines and tumor cells leading to significant G2/M arrest. 5g treatment resulted in elevated levels of ROS and subsequently, DNA double-strand breaks (DSBs) explaining observed G2/M arrest. Consistently, we observed deregulation of many cell cycle associated proteins such as CDK1, BCL2 and their phosphorylated form, CyclinB1, CDC25c etc. Besides, 5g treatment led to decreased levels of mitochondrial membrane potential and activation of apoptosis. Interestingly, 5g administration inhibited tumor growth in mice without significant side effects. Thus, our study identifies 5g as a potent biochemical inhibitor to induce G2/M phase arrest of the cell cycle, and demonstrates its anticancer properties both ex vivo and in vivo.

  9. Immunoglobulin G4-related acquired hemophilia: A case report

    PubMed Central

    Li, Xiaoyan; Duan, Wei; Zhu, Xiang; Xu, Jianying

    2016-01-01

    Acquired hemophilia A (AHA) is a relatively rare and life-threatening bleeding disorder whose pathogenesis is not completely understood. The present study reports a rare case of immunogubulin (IgG)4-related AHA with multisystemic involvement. A 55-year old male patient presented with symptoms of bronchial asthma and multiple subdermal hematomas. Chest computed tomography showed multiple diffuse nodular lesions with thickening of bronchovascular bundles, and scattered high-density spots in both lung lobes. Laboratory investigations showed increased activated partial prothrombin time (120.0 sec), a markedly decreased factor VIII (FVIII) activity (0.5%), a high-titer of FVIII inhibitor (27.2 Bethesda units/ml) and a marked increase in serum IgG4 (>4.03 g/l) level. Left inguinal lymph node biopsy revealed capsular thickening with marked lymphoplasmacytic infiltration, occlusive phlebitis and irregular fibrosis. Immunostaining revealed numerous IgG4-positive plasma cells (>100 cells/human plasma fibronectin) in the nodular lesions, with an IgG4/IgG ratio of >40%. The symptoms were markedly alleviated following corticosteroid therapy. The current study presents the first reported case of a rare IgG4-related AHA that presented with unusual clinical features and multisystemic involvement. The patient responded well to corticosteroid therapy. Documentation of such rare cases will help in characterizing the pathogenesis, and prompt recognition and timely treatment of this rare disorder. PMID:28105131

  10. Phaleria macrocarpa (Boerl.) fruit induce G0/G1 and G2/M cell cycle arrest and apoptosis through mitochondria-mediated pathway in MDA-MB-231 human breast cancer cell.

    PubMed

    Kavitha, Nowroji; Ein Oon, Chern; Chen, Yeng; Kanwar, Jagat R; Sasidharan, Sreenivasan

    2017-04-06

    Phaleria macrocarpa (Scheff) Boerl, is a well-known folk medicinal plant in Indonesia. Traditionally, P. macrocarpa has been used to control cancer, impotency, hemorrhoids, diabetes mellitus, allergies, liver and hearth disease, kidney disorders, blood diseases, acne, stroke, migraine, and various skin diseases. The purpose of this study was to determine the in situ cytotoxicity effect P. macrocarpa fruit ethyl acetate fraction (PMEAF) and the underlying molecular mechanism of cell death. MDA-MB-231 cells were incubated with PMEAF for 24h. Cell cycle and viability were examined using flow cytometry analysis. Apoptosis was determined using the Annexin V assay and also by fluorescence microscopy. Apoptosis protein profiling was detected by RayBio® Human Apoptosis Array. The AO/PI staining and flow cytometric analysis of MDA-MB-231 cells treated with PMEAF were showed apoptotic cell death. The cell cycle analysis by flow cytometry analysis revealed that the accumulation of PMEAF treated MDA-MB-231 cells in G 0 /G 1 and G 2 /M-phase of the cell cycle. Moreover, the PMEAF exert cytotoxicity by increased the ROS production in MDA-MB-231 cells consistently stimulated the loss of mitochondrial membrane potential (∆ Ψm ) and induced apoptosis cell death by activation of numerous signalling proteins. The results from apoptosis protein profiling array evidenced that PMEAF stimulated the expression of 9 pro-apoptotic proteins (Bax, Bid, caspase 3, caspase 8, cytochrome c, p21, p27, p53 and SMAC) and suppressed the 4 anti-apoptotic proteins (Bcl-2, Bcl-w, XIAP and survivin) in MDA-MB-231 cells. The results indicated that PMEAF treatment induced apoptosis in MDA-MB-231 cells through intrinsic mitochondrial related pathway with the participation of pro and anti-apoptotic proteins, caspases, G 0 /G 1 and G 2 /M-phases cell cycle arrest by p53-mediated mechanism. Copyright © 2017 Elsevier Ireland Ltd. All rights reserved.

  11. Effects of 2G and 3G mobile phones on performance and electrophysiology in adolescents, young adults and older adults.

    PubMed

    Leung, S; Croft, R J; McKenzie, R J; Iskra, S; Silber, B; Cooper, N R; O'Neill, B; Cropley, V; Diaz-Trujillo, A; Hamblin, D; Simpson, D

    2011-11-01

    This study examined sensory and cognitive processing in adolescents, young adults and older adults, when exposed to 2nd (2G) and 3rd (3G) generation mobile phone signals. Tests employed were the auditory 3-stimulus oddball and the N-back. Forty-one 13-15 year olds, forty-two 19-40 year olds and twenty 55-70 year olds were tested using a double-blind cross-over design, where each participant received Sham, 2G and 3G exposures, separated by at least 4 days. 3-Stimulus oddball task: Behavioural: accuracy and reaction time of responses to targets were not affected by exposure. Electrophysiological: augmented N1 was found in the 2G condition (independent of age group). N-back task: Behavioural: the combined groups performed less accurately during the 3G exposure (compared to Sham), with post hoc tests finding this effect separately in the adolescents only. Electrophysiological: delayed ERD/ERS responses of the alpha power were found in both 3G and 2G conditions (compared to Sham; independent of age group). Employing tasks tailored to each individual's ability level, this study provides support for an effect of acute 2G and 3G exposure on human cognitive function. The subtlety of mobile phone effect on cognition in our study suggests that it is important to account for individual differences in future mobile phone research. Copyright © 2011 International Federation of Clinical Neurophysiology. All rights reserved.

  12. Rotating toroids in G10.62-0.38, G19.61-0.23, and G29.96-0.02

    NASA Astrophysics Data System (ADS)

    Beltrán, M. T.; Cesaroni, R.; Neri, R.; Codella, C.

    2011-01-01

    Context. In recent years, we have detected clear evidence of rotation in more than 5 hot molecular cores (HMCs). Their identification is confirmed by the fact that the rotation axes are parallel to the axes of the associated bipolar outflows. We have now pursued our investigation by extending the sample to 3 known massive cores, G10.62-0.38, G19.61-0.23, and G29.96-0.02. Aims: We wish to make a thorough study of the structure and kinematics of HMCs and corresponding molecular outflows to reveal possible velocity gradients indicative of the rotation of the cores. Methods: We carried out PdBI observations at 2.7 and 1.4 mm of gas and dust with angular resolutions of ~2”-3” and ~1”-2”, respectively. To trace both rotation and expansion, we simultaneously observed CH3CN, a typical HMC tracer, and 13CO, a typical outflow tracer. Results: The CH3CN (12-11) observations reveal clear velocity gradients in the three HMCs oriented perpendicular to the direction of the bipolar outflows. For G19 and G29 the molecular outflows have been mapped in 13CO. The gradients are interpreted as rotating toroids. The rotation temperatures, used to derive the mass of the cores, have been obtained by means of the rotational diagram method, and lie in the range of 87-244 K. The diameters and masses of the toroids lie in the range of 4550-12600 AU and 28-415 M_⊙, respectively. Given that the dynamical masses are 2 to 30 times lower than those of the cores (if the inclination of the toroids with respect to the plane of the sky is not much below 45°), we suggest that the toroids could be accreting onto the embedded cluster. For G19 and G29, the collapse is also suggested by the redshifted absorption seen in the 13CO (2-1) line. We infer that infall onto the embedded (proto)stars must proceed with rates of ~10-2 M_⊙ yr-1 and on timescales of ~4 × 103-104 yr. The infall rates derived for G19 and G29 are two orders of magnitude greater than the accretion rates indirectly estimated

  13. Faster Electron Injection and More Active Sites for Efficient Photocatalytic H2 Evolution in g-C3 N4 /MoS2 Hybrid.

    PubMed

    Shi, Xiaowei; Fujitsuka, Mamoru; Kim, Sooyeon; Majima, Tetsuro

    2018-03-01

    Herein, the structural effect of MoS 2 as a cocatalyst of photocatalytic H 2 generation activity of g-C 3 N 4 under visible light irradiation is studied. By using single-particle photoluminescence (PL) and femtosecond time-resolved transient absorption spectroscopies, charge transfer kinetics between g-C 3 N 4 and two kinds of nanostructured MoS 2 (nanodot and monolayer) are systematically investigated. Single-particle PL results show the emission of g-C 3 N 4 is quenched by MoS 2 nanodots more effectively than MoS 2 monolayers. Electron injection rate and efficiency of g-C 3 N 4 /MoS 2 -nanodot hybrid are calculated to be 5.96 × 10 9 s -1 and 73.3%, respectively, from transient absorption spectral measurement, which are 4.8 times faster and 2.0 times higher than those of g-C 3 N 4 /MoS 2 -monolayer hybrid. Stronger intimate junction between MoS 2 nanodots and g-C 3 N 4 is suggested to be responsible for faster and more efficient electron injection. In addition, more unsaturated terminal sulfur atoms can serve as the active site in MoS 2 nanodot compared with MoS 2 monolayer. Therefore, g-C 3 N 4 /MoS 2 nanodot exhibits a 7.9 times higher photocatalytic activity for H 2 evolution (660 µmol g- 1 h -1 ) than g-C 3 N 4 /MoS 2 monolayer (83.8 µmol g -1 h -1 ). This work provides deep insight into charge transfer between g-C 3 N 4 and nanostructured MoS 2 cocatalysts, which can open a new avenue for more rationally designing MoS 2 -based catalysts for H 2 evolution. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. [Determination of aflatoxin B1, B2, G1, G2 in armeniacae semen amarum by high-performance liquid chromatography-tandem mass spectrometry].

    PubMed

    Zheng, Run-Sheng; Xu, Hui; Wang, Wen-Li; Zhan, Ruo-Ting; Chen, Wei-Wen

    2013-10-01

    A simple, rapid and cost-effective high-performance liquid chromatography-tandem mass spectrometry (LC-MS/ MS) method was established for simultaneous determination of aflatoxins (AFB1, AFB2, AFG1, AFG2) in Armeniacae Semen Amarum and the application was performance in 11 samples collected from different markets, medical stores and hospitals. The sample was extracted with 84% acetonitrile/water and 250 microL extraction was directly injected into a LC-MS/MS system without further purification procedure after being redissolved with methanol. The LC separation was performed on a C18 column with a linear gradient elution program of 4 mmol x L(-1) NH4 Ac-0.1% formic acid solution and menthol as the mobile phase. Selected reaction monitoring (SRM) was used for selective determination of the four aflatoxins on a triple quadruple mass spectrometer, which was operated in positive ionization modes. All the four aflatoxins showed a good linear relationship with r > 0.999 0, the average recoveries were between 87.88% and 102.9% and the matrix effect was ranged from 90.71% to 99.30% in low, intermediate and high levels. Furthermore, the higher recovery was obtained by the method reported in this study, comparing to the cleanup procedure with the Mycosep 226 purification column. Eleven samples collected were detected and the contamination levels of the AFB1 were between 1.590-2.340 microg x kg(-1) and the AF (B1 + B2 + G1 + G2) was ranged from 2.340 to 3.340 microg x kg(-1). In summary, the developed method was suitable to detect and screen AFB1, AFB2, AFG1, AFG2 in Armeniacae Semen Amarum.

  15. In brown adipocytes, adrenergically induced β{sub 1}-/β{sub 3}-(G{sub s})-, α{sub 2}-(G{sub i})- and α{sub 1}-(G{sub q})-signalling to Erk1/2 activation is not mediated via EGF receptor transactivation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Yanling; Fälting, Johanna M.; Mattsson, Charlotte L.

    2013-10-15

    Brown adipose tissue is unusual in that the neurotransmitter norepinephrine influences cell destiny in ways generally associated with effects of classical growth factors: regulation of cell proliferation, of apoptosis, and progression of differentiation. The norepinephrine effects are mediated through G-protein-coupled receptors; further mediation of such stimulation to e.g. Erk1/2 activation is in cell biology in general accepted to occur through transactivation of the EGF receptor (by external or internal pathways). We have examined here the significance of such transactivation in brown adipocytes. Stimulation of mature brown adipocytes with cirazoline (α{sub 1}-adrenoceptor coupled via G{sub q}), clonidine (α{sub 2} via G{submore » i}) or CL316243 (β{sub 3} via G{sub s}) or via β{sub 1}-receptors significantly activated Erk1/2. Pretreatment with the EGF receptor kinase inhibitor AG1478 had, remarkably, no significant effect on Erk1/2 activation induced by any of these adrenergic agonists (although it fully abolished EGF-induced Erk1/2 activation), demonstrating absence of EGF receptor-mediated transactivation. Results with brown preadipocytes (cells in more proliferative states) were not qualitatively different. Joint stimulation of all adrenoceptors with norepinephrine did not result in synergism on Erk1/2 activation. AG1478 action on EGF-stimulated Erk1/2 phosphorylation showed a sharp concentration–response relationship (IC{sub 50} 0.3 µM); a minor apparent effect of AG1478 on norepinephrine-stimulated Erk1/2 phosphorylation showed nonspecific kinetics, implying caution in interpretation of partial effects of AG1478 as reported in other systems. Transactivation of the EGF receptor is clearly not a universal prerequisite for coupling of G-protein coupled receptors to Erk1/2 signalling cascades. - Highlights: • In brown adipocytes, norepinephrine regulates proliferation, apoptosis, differentiation. • EGF receptor transactivation is supposed to

  16. Porcine epidemic diarrhea virus through p53-dependent pathway causes cell cycle arrest in the G0/G1 phase.

    PubMed

    Sun, Pei; Wu, Haoyang; Huang, Jiali; Xu, Ying; Yang, Feng; Zhang, Qi; Xu, Xingang

    2018-05-22

    Porcine epidemic diarrhea virus (PEDV), an enteropathogenic Alphacoronavirus, has caused enormous economic losses in the swine industry. p53 protein exists in a wide variety of animal cells, which is involved in cell cycle regulation, apoptosis, cell differentiation and other biological functions. In this study, we investigated the effects of PEDV infection on the cell cycle of Vero cells and p53 activation. The results demonstrated that PEDV infection induces cell cycle arrest at G0/G1 phase in Vero cells, while UV-inactivated PEDV does not cause cell cycle arrest. PEDV infection up-regulates the levels of p21, cdc2, cdk2, cdk4, Cyclin A protein and down-regulates Cyclin E protein. Further research results showed that inhibition of p53 signaling pathway can reverse the cell cycle arrest in G0/G1 phase induced by PEDV infection and cancel out the up-regulation of p21 and corresponding Cyclin/cdk mentioned above. In addition, PEDV infection of the cells synchronized in various stages of cell cycle showed that viral subgenomic RNA and virus titer were higher in the cells released from G0/G1 phase synchronized cells than that in the cells released from the G1/S phase and G2/M phase synchronized or asynchronous cells after 18 h p.i.. This is the first report to demonstrate that the p53-dependent pathway plays an important role in PEDV induced cell cycle arrest and beneficially contributes to viral infection. Copyright © 2018 Elsevier B.V. All rights reserved.

  17. Mitochondrial-dependent Autoimmunity in Membranous Nephropathy of IgG4-related Disease

    PubMed Central

    Buelli, Simona; Perico, Luca; Galbusera, Miriam; Abbate, Mauro; Morigi, Marina; Novelli, Rubina; Gagliardini, Elena; Tentori, Chiara; Rottoli, Daniela; Sabadini, Ettore; Saito, Takao; Kawano, Mitsuhiro; Saeki, Takako; Zoja, Carlamaria; Remuzzi, Giuseppe; Benigni, Ariela

    2015-01-01

    The pathophysiology of glomerular lesions of membranous nephropathy (MN), including seldom-reported IgG4-related disease, is still elusive. Unlike in idiopathic MN where IgG4 prevails, in this patient IgG3 was predominant in glomerular deposits in the absence of circulating anti-phospholipase A2 receptor antibodies, suggesting a distinct pathologic process. Here we documented that IgG4 retrieved from the serum of our propositus reacted against carbonic anhydrase II (CAII) at the podocyte surface. In patient's biopsy, glomerular CAII staining increased and co-localized with subepithelial IgG4 deposits along the capillary walls. Patient's IgG4 caused a drop in cell pH followed by mitochondrial dysfunction, excessive ROS production and cytoskeletal reorganization in cultured podocytes. These events promoted mitochondrial superoxide-dismutase-2 (SOD2) externalization on the plasma membrane, becoming recognizable by complement-binding IgG3 anti-SOD2. Among patients with IgG4-related disease only sera of those with IgG4 anti-CAII antibodies caused low intracellular pH and mitochondrial alterations underlying SOD2 externalization. Circulating IgG4 anti-CAII can cause podocyte injury through processes of intracellular acidification, mitochondrial oxidative stress and neoantigen induction in patients with IgG4 related disease. The onset of MN in a subset of patients could be due to IgG4 antibodies recognizing CAII with consequent exposure of mitochondrial neoantigen in the context of multifactorial pathogenesis of disease. PMID:26137589

  18. Excited singlet molecular O2 (1Δg) is generated enzymatically from excited carbonyls in the dark

    PubMed Central

    Mano, Camila M.; Prado, Fernanda M.; Massari, Júlio; Ronsein, Graziella E.; Martinez, Glaucia R.; Miyamoto, Sayuri; Cadet, Jean; Sies, Helmut; Medeiros, Marisa H. G.; Bechara, Etelvino J. H.; Di Mascio, Paolo

    2014-01-01

    In mammalian tissues, ultraweak chemiluminescence arising from biomolecule oxidation has been attributed to the radiative deactivation of singlet molecular oxygen [O2 (1Δg)] and electronically excited triplet carbonyl products involving dioxetane intermediates. Herein, we describe evidence of the generation of O2 (1Δg) in aqueous solution via energy transfer from excited triplet acetone. This involves thermolysis of 3,3,4,4-tetramethyl-1,2-dioxetane, a chemical source, and horseradish peroxidase-catalyzed oxidation of 2-methylpropanal, as an enzymatic source. Both sources of excited carbonyls showed characteristic light emission at 1,270 nm, directly indicative of the monomolecular decay of O2 (1Δg). Indirect analysis of O2 (1Δg) by electron paramagnetic resonance using the chemical trap 2,2,6,6-tetramethylpiperidine showed the formation of 2,2,6,6-tetramethylpiperidine-1-oxyl. Using [18O]-labeled triplet, ground state molecular oxygen [18O2 (3Σg-)], chemical trapping of 18O2 (1Δg) with disodium salt of anthracene-9,10-diyldiethane-2,1-diyl disulfate yielding the corresponding double-[18O]-labeled 9,10-endoperoxide, was detected through mass spectrometry. This corroborates formation of O2 (1Δg). Altogether, photoemission and chemical trapping studies clearly demonstrate that chemically and enzymatically nascent excited carbonyl generates 18O2 (1Δg) by triplet-triplet energy transfer to ground state oxygen O2 (3Σg−), and supports the long formulated hypothesis of O2 (1Δg) involvement in physiological and pathophysiological events that might take place in tissues in the absence of light. PMID:25087485

  19. Post dural puncture headache after spinal anaesthesia for caesarean section: a comparison of 25 g Quincke, 27 g Quincke and 27 g Whitacre spinal needles.

    PubMed

    Shaikh, Jan Muhammad; Memon, Amna; Memon, Muhammad Ali; Khan, Majida

    2008-01-01

    To compare the frequency and severity of post dural puncture headache in obstetric patients using 25G Quincke, 27G Quincke and 27G Whitacre spinal needles. Comparative, randomized, double-blind, interventional study. Liaquat University Hospital Hyderabad from October 2005 to December 2006. 480 ASA I-II full term pregnant women, 18 to 45 years of age, scheduled for elective Caesarean section, under spinal anaesthesia, were randomized into three groups: Group I (25G Quincke spinal needle: n=168), Group II (27G Quincke spinal needle: n=160) and Group III (27G Whitacre spinal needle: n=152). Spinal anaesthesia was performed with 1.5-2.0 ml 0.75% hyperbaric bupivacaine using 25G Quincke spinal needle (Group I), 27G Quincke spinal needle (Group II) and 27G Whitacre spinal needle (Group III) at L3-4 inter-vertebral space. Each patient was assessed daily for four consecutive days following Caesarean section. Frequency and severity and of postdural puncture headache (PDPH) were recorded. Data were analyzed using SPSS-11. Frequency of PDPH following the use of 25G Quincke (Group I), 27G Quincke (Group II) and 27G Whitacre (Group III) spinal needles was 8.3% (14/168), 3.8% (6/160) and 2.0% (3/152) respectively. In Group I, PDPH was mild in 5 patients, moderate in 7 patients and severe in 2 patients. In Group II, it was mild in 2, moderate in 3 and severe in 1 patient. In group III, it was mild in 2 and moderate in 1 patient. Severe PDPH did not occur in Group III. Most of the patients with PDPH developed it on 1st and 2nd postoperative day. When using a 27G Whitacre spinal needle, the frequency and severity of PDPH was significantly lower than when a 25G Quincke or 27G Quincke needle was used.

  20. 26 CFR 1.860G-2 - Other rules.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... TAXES (CONTINUED) Real Estate Investment Trusts § 1.860G-2 Other rules. (a) Obligations principally... interests in real property and related assets that would be considered to be permitted investments if the... that are not real estate mortgages; and (D) The release is not within 2 years of the startup day. (9...

  1. Downlink power distributions for 2G and 3G mobile communication networks.

    PubMed

    Colombi, Davide; Thors, Björn; Persson, Tomas; Wirén, Niklas; Larsson, Lars-Eric; Jonsson, Mikael; Törnevik, Christer

    2013-12-01

    Knowledge of realistic power levels is key when conducting accurate EMF exposure assessments. In this study, downlink output power distributions for radio base stations in 2G and 3G mobile communication networks have been assessed. The distributions were obtained from network measurement data collected from the Operations Support System, which normally is used for network monitoring and management. Significant amounts of data were gathered simultaneously for large sets of radio base stations covering wide geographical areas and different environments. The method was validated with in situ measurements. For the 3G network, the 90th percentile of the averaged output power during high traffic hours was found to be 43 % of the maximum available power. The corresponding number for 2G, with two or more transceivers installed, was 65 % or below.

  2. 77 FR 50519 - Agency Information Collection Activities: Forms G-325, G-325A, G-325B, and G-325C; Extension of a...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-08-21

    ... DEPARTMENT OF HOMELAND SECURITY U.S. Citizenship and Immigration Services [OMB Control Number 1615... Department of Homeland Security (DHS), U.S. Citizenship and Immigration Services (USCIS) will be submitting... collection: Forms G-325, G-325A, G-325B, and G-325C; U.S. Citizenship and Immigration Services (USCIS). (4...

  3. Formation of g-C3N4@Ni(OH)2 Honeycomb Nanostructure and Asymmetric Supercapacitor with High Energy and Power Density.

    PubMed

    Dong, Bitao; Li, Mingyan; Chen, Sheng; Ding, Dawei; Wei, Wei; Gao, Guoxin; Ding, Shujiang

    2017-05-31

    Nickel hydroxide (Ni(OH) 2 ) has been regarded as a potential next-generation electrode material for supercapacitor owing to its attractive high theoretical capacitance. However, practical application of Ni(OH) 2 is hindered by its lower cycling life. To overcome the inherent defects, herein we demonstrate a unique interconnected honeycomb structure of g-C 3 N 4 and Ni(OH) 2 synthesized by an environmentally friendly one-step method. In this work, g-C 3 N 4 has excellent chemical stability and supports a perpendicular charge-transporting direction in charge-discharge process, facilitating electron transportation along that direction. The as-prepared composite exhibits higher specific capacities (1768.7 F g -1 at 7 A g -1 and 2667 F g -1 at 3 mV s -1 , respectively) compared to Ni(OH) 2 aggregations (968.9 F g -1 at 7 A g -1 ) and g-C 3 N 4 (416.5 F g -1 at 7 A g -1 ), as well as better cycling performance (∼84% retentions after 4000 cycles). As asymmetric supercapacitor, g-C 3 N 4 @Ni(OH) 2 //graphene exhibits high capacitance (51 F g -1 ) and long cycle life (72% retentions after 8000 cycles). Moreover, high energy density of 43.1 Wh kg -1 and power density of 9126 W kg -1 has been achieved. This attractive performance reveals that g-C 3 N 4 @Ni(OH) 2 with honeycomb architecture could find potential application as an electrode material for high-performance supercapacitors.

  4. Hypermethylation of MST1 in IgG4-related autoimmune pancreatitis and rheumatoid arthritis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fukuhara, Takataro; Tomiyama, Takashi; Yasuda, Kaneki

    The serine/threonine kinase Mst1 plays important roles in the control of immune cell trafficking, proliferation, and differentiation. Previously, we reported that Mst1 was required for thymocyte selection and regulatory T-cell functions, thereby the prevention of autoimmunity in mice. In humans, MST1 null mutations cause T-cell immunodeficiency and hypergammaglobulinemia with autoantibody production. RASSF5C(RAPL) is an activator of MST1 and it is frequently methylated in some tumors. Herein, we investigated methylation of the promoter regions of MST1 and RASSF5C(RAPL) in leukocytes from patients with IgG4-related autoimmune pancreatitis (AIP) and rheumatoid arthritis (RA). Increased number of CpG methylation in the 5′ region ofmore » MST1 was detected in AIP patients with extrapancreatic lesions, whereas AIP patients without extrapancreatic lesions were similar to controls. In RA patients, we detected a slight increased CpG methylation in MST1, although the overall number of methylation sites was lower than that of AIP patients with extrapancreatic lesions. There were no significant changes of the methylation levels of the CpG islands in the 5′ region of RASSF5C(RAPL) in leukocytes from AIP and RA patients. Consistently, we found a significantly down-regulated expression of MST1 in regulatory T cells of AIP patients. Our results suggest that the decreased expression of MST1 in regulatory T cells due to hypermethylation of the promoter contributes to the pathogenesis of IgG4-related AIP. - Highlights: • Mst1 controls immune cells trafficking, cell proliferation and differentiation. • Autoimmune pancreatitis (AIP) is an idiopathic pancreatitis affecting multiple organs. • Decreased MST1 expression and increased CpG methylation of promoter of MST1 in AIP. • Slight increased CpG methylation of MST1 in rheumatoid arthritis patients. • MST1 contributes pathogenesis of IgG4-related AIP.« less

  5. Plasminogen activator inhibitor-1 5G/5G genotype is associated with early spontaneous recanalization of the infarct-related artery in patients presenting with acute ST-elevation myocardial infarction.

    PubMed

    Cagliyan, Caglar E; Yuregir, Ozge O; Balli, Mehmet; Tekin, Kamuran; Akilli, Rabia E; Bozdogan, Sevcan T; Turkmen, Serdar; Deniz, Ali; Baykan, Oytun A; Aslan, Huseyin; Cayli, Murat

    2013-05-01

    We aimed to examine the association between plasminogen activator inhibitor-1 (PAI-1) genetic polymorphism and early spontaneous recanalization in patients presenting with acute ST-elevation myocardial infarction. Patients admitted to our emergency department with ST-elevation myocardial infarction in the first 6 h of symptom onset were included. An immediate primary percutaneous coronary intervention was performed. Patients were grouped according to the initial patency of the infarct-related artery (IRA) as follows: total occlusion (TO) group [Thrombolysis in Myocardial Infarction (TIMI) 0-1 flow in the IRA], partial recanalization group (TIMI 2 flow in the IRA), and complete recanalization (CR) group (TIMI 3 flow in the IRA). PAI-1 4G/5G polymorphism was detected using the real-time PCR method. There were 107 patients in the TO group, 30 patients in the partial recanalization group, and 45 patients in the CR group. When we evaluated degrees of patency according to the PAI-1 genotype, TO of the IRA was the highest in patients with the PAI 4G/4G genotype (PAI-1 4G/4G: 66.7%, PAI-1 4G/5G: 65.9%, PAI-1 5G/5G: 40.4%) and CR of the IRA was the highest in patients with the PAI 5G/5G genotype (PAI-1 5G/5G: 38.5%, PAI-1 4G/5G: 19.8%, PAI-1 4G/4G: 17.9%). The distribution of genotypes in different degrees of patency of IRA was statistically significant (P=0.029). In logistic regression analysis, the PAI-1 5G/5G genotype was associated independently with the spontaneous CR of the IRA (odds ratio: 2.875, 95% confidence interval [1.059-7.086], P=0.038). Patients with the PAI-1 5G/5G genotype seem to be luckier than others in terms of early spontaneous recanalization of the IRA. Further prospective studies with large patient populations are required for more precise results.

  6. Photo-induced CO2 reduction by CH4/H2O to fuels over Cu-modified g-C3N4 nanorods under simulated solar energy

    NASA Astrophysics Data System (ADS)

    Tahir, Beenish; Tahir, Muhammad; Amin, Nor Aishah Saidina

    2017-10-01

    Copper modified polymeric graphitic carbon nitride (Cu/g-C3N4) nanorods for photo-induced CO2 conversion with methane (CH4) and water (H2O) as reducing system under simulated solar energy has been investigated. The nanocatalysts, synthesized by pyrolysis and sonication, were characterized by XRD, FTIR, Raman analysis, XPS, SEM, N2 adsorption-desorption and PL spectroscopy. The presence of Cu2+ ions over the g-C3N4 structure inhibited charge carriers recombination process. The results indicated that photo-activity and selectivity of Cu/g-C3N4 photo-catalyst for CO2 reduction greatly dependent on the type of CO2-reduction system. CO2 was efficiently converted to CH4 and CH3OH with traces of C2H4 and C2H6 hydrocarbons in the CO2-water system. The yield of the main product, CH4 over 3 wt.% Cu/g-C3N4 was 109 μmole g-cata.-1 h-1 under visible light irradiation, significantly higher than the pure g-C3N4 catalyst (60 μmole/g.cat). In photo-induced CO2-CH4 reaction, CO and H2 were detected as the main products with smaller amount of hydrocarbons. The highest efficiency was detected over 3 wt.%Cu-loading of g-C3N4 and at optimal CH4/CO2 feed ratio of 1.0. The maximum yield of CO and H2 detected were 142 and 76 μmole g-catal.-1 h-1, respectively at selectivity 66.6% and 32.5%, respectively. Significantly enhanced CO2/CH4 reduction over Cu/g-C3N4 was attributed to its polymeric structure with efficient charge transfer property and inhibited charges recombination rate. A proposed photo-induced reaction mechanism, corroborated with the experimental data, was also deliberated.

  7. Regeneration of eye tissues is modulated by altered levels of gravity at 1g, 2g, and in microgravity during spaceflight

    NASA Astrophysics Data System (ADS)

    Grigoryan, Eleonora; Almeida, Eduardo; Mitashov, Victor

    The pursuit of human space exploration requires detailed knowledge of microgravity-related changes in fundamental biological processes, and their effects on health. Normal regeneration of organs and tissues is one such fundamental process that allows maintenance of vitality and function of living organisms. Animal models of tissue regeneration include the newt (Pleurodeles waltl, Urodela) eye, which has been extensively used by our team in Russian Bion and Foton microgravity experiments since 1985, and in recent NASA 2.5 meter diameter centrifuge hypergravity experiments. In total, these experiments allow us to draw several broad conclusions: Newt lens regeneration is significantly altered in microgravity and hypergravity relative to 1g controls. Lenses formed in microgravity are larger and more developed than those regenerated in 1g controls; Microgravity alterations of lens regeneration can persist after spaceflight, and continue to affect repeated removal and regeneration of the lens after return to 1g; Microgravity increases the numbers of early stage regenerative proliferating BrdU-labeled cells in dorsal iris progenitors and in the lens regenerate. Regeneration under hypergravity conditions at 2g inhibits lens regeneration, and often causes retinal detachment. Molecular mechanisms regulating lens regeneration rate include FGF2 signaling, (a key pathway for eye tissue development and regeneration), and an expression of stress-related proteins - HSPs. In conclusion, regeneration of lens and other eye tissues in the newt is sensitive to, and regulated by the level of gravity mechanotransduction and developmental signaling pathways, with microgravity favoring stem cell progenitor proliferation, and gravity at 1g promoting terminal differentiation, while hypergravity at 2g often causes damage of delicate regenerating tissues.

  8. Critical Elements of Vehicle-to-Grid (V2G) Economics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Steward, Darlene M.

    This report explores the critical elements of V2G economics. Section 2 summarizes the elements and costs of a V2G system. Section 3 describes V2G revenue-generating services and the business cases for providing these services. Section 4 notes real-world V2G applications. Section 5 lists concerns related to V2G. Section 6 concludes and summarizes V2G cost and revenue elements.

  9. 26 CFR 1.475(g)-1 - Effective dates.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 26 Internal Revenue 6 2012-04-01 2012-04-01 false Effective dates. 1.475(g)-1 Section 1.475(g)-1...) INCOME TAXES (CONTINUED) Inventories § 1.475(g)-1 Effective dates. (a)-(b) [Reserved] (c) Section 1.475(a...) applies on and after August 13, 1996 (the effective date of § 1.1275-6). (g) [Reserved] (h) Section 1.475...

  10. 26 CFR 1.475(g)-1 - Effective dates.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 26 Internal Revenue 6 2014-04-01 2014-04-01 false Effective dates. 1.475(g)-1 Section 1.475(g)-1...) INCOME TAXES (CONTINUED) Inventories § 1.475(g)-1 Effective dates. (a)-(b) [Reserved] (c) Section 1.475(a...) applies on and after August 13, 1996 (the effective date of § 1.1275-6). (g) [Reserved] (h) Section 1.475...

  11. 26 CFR 1.475(g)-1 - Effective dates.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 26 Internal Revenue 6 2013-04-01 2013-04-01 false Effective dates. 1.475(g)-1 Section 1.475(g)-1...) INCOME TAXES (CONTINUED) Inventories § 1.475(g)-1 Effective dates. (a)-(b) [Reserved] (c) Section 1.475(a...) applies on and after August 13, 1996 (the effective date of § 1.1275-6). (g) [Reserved] (h) Section 1.475...

  12. 26 CFR 1.475(g)-1 - Effective dates.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 26 Internal Revenue 6 2011-04-01 2011-04-01 false Effective dates. 1.475(g)-1 Section 1.475(g)-1...) INCOME TAXES (CONTINUED) Inventories § 1.475(g)-1 Effective dates. (a)-(b) [Reserved] (c) Section 1.475(a...) applies on and after August 13, 1996 (the effective date of § 1.1275-6). (g) [Reserved] (h) Section 1.475...

  13. Exogenous FABP4 induces endoplasmic reticulum stress in HepG2 liver cells.

    PubMed

    Bosquet, Alba; Guaita-Esteruelas, Sandra; Saavedra, Paula; Rodríguez-Calvo, Ricardo; Heras, Mercedes; Girona, Josefa; Masana, Lluís

    2016-06-01

    Fatty acid binding protein 4 (FABP4) is an intracellular fatty acid (FA) carrier protein that is, in part, secreted into circulation. Circulating FABP4 levels are increased in obesity, diabetes and other insulin resistance (IR) diseases. FAs contribute to IR by promoting endoplasmic reticulum stress (ER stress) and altering the insulin signaling pathway. The effect of FABP4 on ER stress in the liver is not known. The aim of this study was to investigate whether exogenous FABP4 (eFABP4) is involved in the lipid-induced ER stress in the liver. HepG2 cells were cultured with eFABP4 (40 ng/ml) with or without linoleic acid (LA, 200 μM) for 18 h. The expression of ER stress-related markers was determined by Western blotting (ATF6, EIF2α, IRE1 and ubiquitin) and real-time PCR (ATF6, CHOP, EIF2α and IRE1). Apoptosis was studied by flow cytometry using Annexin V-FITC and propidium iodide staining. eFABP4 increased the ER stress markers ATF6 and IRE1 in HepG2 cells. This effect led to insulin resistance mediated by changes in AKT and JNK phosphorylation. Furthermore, eFABP4 significantly induced both apoptosis, as assessed by flow cytometry, and CHOP expression, without affecting necrosis and ubiquitination. The presence of LA increased the ER stress response induced by eFABP4. eFABP4, per se, induces ER stress and potentiates the effect of LA in HepG2 cells, suggesting that FABP4 could be a link between obesity-associated metabolic abnormalities and hepatic IR mechanisms. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  14. MSH6 G39E Polymorphism and CpG Island Methylator Phenotype in Colon Cancer

    PubMed Central

    Curtin, Karen; Samowitz, Wade S.; Wolff, Roger K.; Caan, Bette J.; Ulrich, Cornelia M.; Potter, John D.; Slattery, Martha L.

    2010-01-01

    The MSH6 G39E germline polymorphism is not associated with an increased risk of either microsatellite stable or unstable sporadic colorectal cancer. Other than microsatellite instability, however, most genetic and epigenetic changes of tumors associated with this common variant have not been studied. The objective of our investigation was to evaluate associations between the MSH6 G39E (116G>A) polymorphism and CpG island methylator phenotype (CIMP) and BRAF V600E mutations in tumors from a sample of 1048 individuals with colon cancer and 1964 controls from Utah, Northern California, and Minnesota. The G39E polymorphism (rs1042821) was determined by the five prime nuclease assay. CIMP was determined by methylation-specific polymerase chain reaction (PCR) of CpG islands in MLH1, methylated in tumors (MINT)1, MINT2, MINT31, and CDKN2A. The BRAF V600E mutation was determined by sequencing exon 15. In microsatellite stable tumors, homozygous carriers of the G39E polymorphism had an increased risk of CIMP+ colon cancer (odds ratio (OR) 2.2, 95% confidence interval (CI) 1.1, 4.2) and BRAF V600E mutation (OR 3.1, 95% CI 1.01, 9.7) in a case–control comparison. This finding was not observed in unstable tumors; however, power may have been low to detect an association. Age at diagnosis, family history, and alcohol use did not interact with MSH6 G39E and CIMP. The MSH6 G39E germline polymorphism may be associated with CIMP+ colon cancer. PMID:19582761

  15. Delayed-release oral mesalamine 4.8 g/day (800 mg tablets) compared with 2.4 g/day (400 mg tablets) for the treatment of mildly to moderately active ulcerative colitis: The ASCEND I trial

    PubMed Central

    Hanauer, Stephen B; Sandborn, William J; Dallaire, Christian; Archambault, André; Yacyshyn, Bruce; Yeh, Chyon; Smith-Hall, Nancy

    2007-01-01

    BACKGROUND: Delayed-release oral mesalamine 2.4 g/day to 4.8 g/day has been shown to be effective in treating mildly to moderately active ulcerative colitis (UC), but it is unknown whether an initial dose of 4.8 g/day is more effective than 2.4 g/day in patients with mildly to moderately active UC and in the subgroup with moderate disease. PATIENTS AND METHODS: A six-week, multicentre, randomized, double-blind, controlled trial assessing the safety and clinical efficacy of a new dose (ASCEND I) of medication randomly assigned 301 adults with mildly to moderately active UC to delayed-release oral mesalamine 2.4 g/day (400 mg tablet [n=154]) or 4.8 g/day (800 mg tablet [n=147]). The primary efficacy end point was overall improvement (ie, treatment success), defined as complete remission or response to therapy from baseline to week 6. Primary safety end points were adverse events and laboratory evaluations. Data were also analyzed separately for the prespecified subgroup of patients with moderate UC at baseline. RESULTS: Treatment success was not statistically different between the treatment groups at week 6; 51% of the group (77 of 150) who received delayed-release oral mesalamine 2.4 g/day and 56% of the group (76 of 136) who received 4.8 g/day reached the efficacy end point (P=0.441). Among the moderate disease subgroup, however, the higher initial dose was more effective; 57% of patients (53 of 93) given delayed-release oral mesalamine 2.4 g/day and 72% of patients (55 of 76) given 4.8 g/day achieved treatment success (P=0.0384). Both regimens were well tolerated. CONCLUSIONS: Delayed-release oral mesalamine is an effective and well-tolerated initial therapy in patients with mildly to moderately active UC, and a 4.8 g/day dose may enhance treatment success rates in patients with moderate disease compared with mesalamine 2.4 g/day. PMID:18080055

  16. Refinement of the crystal structure of the high-temperature phase G0 in (NH4)2WO2F4 (powder, x-ray, and neutron scattering)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Novak, D. M.; Smirnov, Lev S; Kolesnikov, Alexander I

    2013-01-01

    The (NH4)2WO2F4 compound undergoes a series of phase transitions: G0 -> 201 K -> G1 -> 160 K -> G2, with a significant change in entropy ( S1 ~ Rln10 at the G0 -> G1 transition), which indicates significant orientational disordering in the G0 phase and the order disorder type of the phase transition. X-ray diffraction is used to identify the crystal structure of the G0 phase as rhombohedral (sp. gr. Cmcm, Z = 4), determine the lattice parameters and the positions of all atoms (except hydrogen), and show that [WO2F4]2 ions can form a superposition of dynamic and staticmore » orientational disorders in the anionic sublattice. A determination of the orientational position of [NH4]+ ions calls for the combined method of elastic and inelastic neutron scattering. Inelastic neutron scattering is used to determine the state of hindered rotation for ammonium ions in the G0 phase. Powder neutron diffraction shows that the orientational disorder of NH4 ions can adequately be described within the free rotation approximation.« less

  17. 4-Nerolidylcatechol: apoptosis by mitochondrial mechanisms with reduction in cyclin D1 at G0/G1 stage of the chronic myelogenous K562 cell line.

    PubMed

    Benfica, Polyana Lopes; Ávila, Renato Ivan de; Rodrigues, Bruna Dos Santos; Cortez, Alane Pereira; Batista, Aline Carvalho; Gaeti, Marilisa Pedroso Nogueira; Lima, Eliana Martins; Rezende, Kênnia Rocha; Valadares, Marize Campos

    2017-12-01

    4-Nerolidylcatechol (4-NRC) has showed antitumor potential through apoptosis. However, its apoptotic mechanisms are still unclear, especially in leukemic cells. To evaluate the cytotoxic potential of 4-NRC and its cell death pathways in p53-null K562 leukemic cells. Cytotoxicity of 4-NRC (4.17-534.5 μM) over 24 h of exposure was evaluated by MTT assay. 4-NRC-induced apoptosis in K562 cells was investigated by phosphatidylserine (PS) externalization, cell cycle, sub-G1, mitochondrial evaluation, cytochrome c, cyclin D1 and intracellular reactive oxygen species (ROS) levels, and caspase activity analysis. IC 50 values obtained were 11.40, 27.31, 15.93 and 15.70 μM for lymphocytes, K562, HL-60 and Jurkat cells, respectively. In K562 cells, 4-NRC (27 μM) promoted apoptosis as verified by cellular morphological changes, a significant increase in PS externalization and sub-G1 cells. Moreover, it significantly arrested the cells at the G0/G1 phase due to a reduction in cyclin D1 expression. These effects of 4-NRC also significantly promoted a reduction in mitochondrial activity and membrane depolarization, accumulation of cytosolic cytochrome c and ROS overproduction. Additionally, it triggered an increase in caspases -3/7, -8 and -9 activities. When the cells were pretreated with N-acetyl-l-cysteine ROS scavenger, 4-NRC-induced apoptosis was partially blocked, which suggests that it exerts cytotoxicity though not exclusively through ROS-mediated mechanisms. 4-NRC has antileukemic properties, inducing apoptosis mediated by mitochondrial-dependent mechanisms with cyclin D1 inhibition. Given that emerging treatment concepts include novel combinations of well-known agents, 4-NRC could offer a promising alternative for chemotherapeutic combinations to maximize tumour suppression.

  18. Non-Canonical G-quadruplexes cause the hCEB1 minisatellite instability in Saccharomyces cerevisiae

    PubMed Central

    Piazza, Aurèle; Cui, Xiaojie; Adrian, Michael; Samazan, Frédéric; Heddi, Brahim; Phan, Anh-Tuan; Nicolas, Alain G

    2017-01-01

    G-quadruplexes (G4) are polymorphic four-stranded structures formed by certain G-rich nucleic acids in vitro, but the sequence and structural features dictating their formation and function in vivo remains uncertain. Here we report a structure-function analysis of the complex hCEB1 G4-forming sequence. We isolated four G4 conformations in vitro, all of which bear unusual structural features: Form 1 bears a V-shaped loop and a snapback guanine; Form 2 contains a terminal G-triad; Form 3 bears a zero-nucleotide loop; and Form 4 is a zero-nucleotide loop monomer or an interlocked dimer. In vivo, Form 1 and Form 2 differently account for 2/3rd of the genomic instability of hCEB1 in two G4-stabilizing conditions. Form 3 and an unidentified form contribute to the remaining instability, while Form 4 has no detectable effect. This work underscores the structural polymorphisms originated from a single highly G-rich sequence and demonstrates the existence of non-canonical G4s in cells, thus broadening the definition of G4-forming sequences. DOI: http://dx.doi.org/10.7554/eLife.26884.001 PMID:28661396

  19. G2-structures for N  =  1 supersymmetric AdS4 solutions of M-theory

    NASA Astrophysics Data System (ADS)

    Grigorian, Sergey

    2018-04-01

    We study the N  =  1 supersymmetric solutions of D  =  11 supergravity obtained as a warped product of four-dimensional anti-de Sitter space with a seven-dimensional Riemannian manifold M. Using the octonion bundle structure on M we reformulate the Killing spinor equations in terms of sections of the octonion bundle on M. The solutions then define a single complexified G 2-structure on M or equivalently two real G 2-structures. We then study the torsion of these G 2-structures and the relationships between them.

  20. VCC-1 over-expression inhibits cisplatin-induced apoptosis in HepG2 cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhou, Zhitao; Lu, Xiao; Zhu, Ping

    Highlights: Black-Right-Pointing-Pointer VCC-1 is hypothesized to be associated with carcinogenesis. Black-Right-Pointing-Pointer Levels of VCC-1 are increased significantly in HCC. Black-Right-Pointing-Pointer Over-expression of VCC-1 could promotes cellular proliferation rate. Black-Right-Pointing-Pointer Over-expression of VCC-1 inhibit the cisplatin-provoked apoptosis in HepG2 cells. Black-Right-Pointing-Pointer VCC-1 plays an important role in control the tumor growth and apoptosis. -- Abstract: Vascular endothelial growth factor-correlated chemokine 1 (VCC-1), a recently described chemokine, is hypothesized to be associated with carcinogenesis. However, the molecular mechanisms by which aberrant VCC-1 expression determines poor outcomes of cancers are unknown. In this study, we found that VCC-1 was highly expressed in hepatocellularmore » carcinoma (HCC) tissue. It was also associated with proliferation of HepG2 cells, and inhibition of cisplatin-induced apoptosis of HepG2 cells. Conversely, down-regulation of VCC-1 in HepG2 cells increased cisplatin-induced apoptosis of HepG2 cells. In summary, these results suggest that VCC-1 is involved in cisplatin-induced apoptosis of HepG2 cells, and also provides some evidence for VCC-1 as a potential cellular target for chemotherapy.« less

  1. The GIRK1 subunit potentiates G protein activation of cardiac GIRK1/4 hetero-tetramers

    PubMed Central

    Touhara, Kouki K; Wang, Weiwei; MacKinnon, Roderick

    2016-01-01

    G protein gated inward rectifier potassium (GIRK) channels are gated by direct binding of G protein beta-gamma subunits (Gβγ), signaling lipids, and intracellular Na+. In cardiac pacemaker cells, hetero-tetramer GIRK1/4 channels and homo-tetramer GIRK4 channels play a central role in parasympathetic slowing of heart rate. It is known that the Na+ binding site of the GIRK1 subunit is defective, but the functional difference between GIRK1/4 hetero-tetramers and GIRK4 homo-tetramers remains unclear. Here, using purified proteins and the lipid bilayer system, we characterize Gβγ and Na+ regulation of GIRK1/4 hetero-tetramers and GIRK4 homo-tetramers. We find in GIRK4 homo-tetramers that Na+ binding increases Gβγ affinity and thereby increases the GIRK4 responsiveness to G protein stimulation. GIRK1/4 hetero-tetramers are not activated by Na+, but rather are in a permanent state of high responsiveness to Gβγ, suggesting that the GIRK1 subunit functions like a GIRK4 subunit with Na+ permanently bound. DOI: http://dx.doi.org/10.7554/eLife.15750.001 PMID:27074664

  2. Photo reduction of CO2 to CH4 on g-C3N4: The effect of concentrating light and pretreatment

    NASA Astrophysics Data System (ADS)

    Li, Dong; Fang, Xiaoxiang; Liu, Huayan; Lu, Hanfeng; Zhang, Zekai

    2018-06-01

    The behavior of CO2 photoreduction to CH4 on the g-C3N4 catalyst was studied in a concentrating light reactor. The g-C3N4 catalysts before and after pretreatment were characterized by FE-SEM, XRD and photoilluminance. It is found that concentrating light increases the CH4 yield on the g-C3N4 by heightening the incident light intensity, and light pretreatment has an excessive effect on the performance. Pretreated by suitable light intensity, air atmosphere and time, the CH4 yield on the g-C3N4 under concentrating light irradiation reached about 3.39 μmol.g-1.h-1, which is about 16 times of that g-C3N4 reacted at nature incident light without pretreatment. The mechanism of pretreatment is considered to be from the surface oxidation state change of the catalyst either from the oxidation of the catalyst surface or the activation of surface oxygen.

  3. D1((2)B2g) to D0((2)Au) Fluorescence from the Matrix-Isolated Perylene Cation Following Laser Excitation into the D5(2)B3g) and D2 ((2)B3g) Electronic States

    NASA Technical Reports Server (NTRS)

    Chillier, Xavier D. F.; Stone, Bradley M.; Joblin, Christine; Salama, Farid; Allamandola, Louis J.; DeVincenzi, Donald L. (Technical Monitor)

    2001-01-01

    Fluorescence spectra of the perylene cation, pumped by direct laser excitation via the D(sub 2)((2)B(sub 3g)) (left arrow) D(sub 0)((2)A(sub u)) and D(sub 5)(2)B(sub 3g)) (left arrow) D(sub 0)((2)A(sub u)) transitions, are presented. Direct excitation into the D5 or D2 states is followed by rapid non-radiative relaxation to D1 that, in turn,relaxes radiatively. Excitation spectroscopy across the D(sub 2)((2)B(sub 3g)) (left arrow) D(sub 0)((2)A(sub u)) transition near 730 nm shows that site splitting plays little or no role in determining the spectral substructure in the ion spectra. Tentative assignments for ground state vibrational frequencies are made by comparison of spectral intervals with calculated normal mode frequencies.

  4. Clinical features of a new disease concept, IgG4-related thyroiditis.

    PubMed

    Watanabe, T; Maruyama, M; Ito, T; Fujinaga, Y; Ozaki, Y; Maruyama, M; Kodama, R; Muraki, T; Hamano, H; Arakura, N; Kadoya, M; Suzuki, S; Komatsu, M; Shimojo, H; Notohara, K; Uchida, M; Kawa, S

    2013-01-01

    Immunoglobulin (Ig)G4-related disease is a recently proposed systemic disorder that includes autoimmune pancreatitis (AIP), Mikulicz's disease, and various other organ lesions. In the present retrospective study, we examined whether thyroid lesions should also be included in IgG4-related disease (Ig4-RD) under the new term IgG4-related thyroiditis. We enrolled 114 patients with Ig4-RD, including 92 patients with AIP, 15 patients with Mikulicz's disease, and seven patients with IgG4-related cholangitis, and analysed clinical findings, function, serum values of activity markers, computed tomography (CT) images, and histology of the thyroid gland. Among the 22 patients (19%) in our cohort who were found to have hypothyroidism [thyroid stimulating hormone (TSH) > 4 mIU/L], 11 patients had clinical hypothyroidism [free thyroxine (FT4) < 1 ng/dL] and 11 patients had subclinical hypothyroidism (FT41 ng/dL). Serum concentrations of IgG, IgG4, circulating immune complex (CIC), and β2-microglobulin (β2-MG) were significantly higher in the hypothyroidism group compared with the remaining 92 euthyroid patients, and serum C3 concentration was significantly lower. After prednisolone treatment, TSH values had decreased significantly (p = 0.005) in this group and FT4 values had increased significantly (p = 0.047). CT images showed that the thyroid glands of patients with clinical hypothyroidism had a significantly greater volume than those of the euthyroid and other groups. Pathological analysis of one resected thyroid gland disclosed a focused lesion with infiltration of lymphocytes and IgG4-bearing plasma cells and loss of thyroid follicles. Thyroid lesions associated with hypothyroidism can be considered as a new disease termed IgG4-related thyroiditis. Awareness of this condition should lead to appropriate corticosteroid treatment that may prevent progression to a fibrous state.

  5. Arctigenin, a natural lignan compound, induces G0/G1 cell cycle arrest and apoptosis in human glioma cells.

    PubMed

    Maimaitili, Aisha; Shu, Zunhua; Cheng, Xiaojiang; Kaheerman, Kadeer; Sikandeer, Alifu; Li, Weimin

    2017-02-01

    The aim of the current study was to investigate the anticancer potential of arctigenin, a natural lignan compound, in malignant gliomas. The U87MG and T98G human glioma cell lines were treated with various concentrations of arctigenin for 48 h and the effects of arctigenin on the aggressive phenotypes of glioma cells were assessed. The results demonstrated that arctigenin dose-dependently inhibited the growth of U87MG and T98G cells, as determined using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide and bromodeoxyuridine incorporation assays. Arctigenin exposure also induced a 60-75% reduction in colony formation compared with vehicle-treated control cells. However, arctigenin was not observed to affect the invasiveness of glioma cells. Arctigenin significantly increased the proportion of cells in the G 0 /G 1 phase and reduced the number of cells in the S phase, as compared with the control group (P<0.05). Western blot analysis demonstrated that arctigenin increased the expression levels of p21, retinoblastoma and p53 proteins, and significantly decreased the expression levels of cyclin D1 and cyclin-dependent kinase 4 proteins. Additionally, arctigenin was able to induce apoptosis in glioma cells, coupled with increased expression levels of cleaved caspase-3 and the pro-apoptotic BCL2-associated X protein. Furthermore, arctigenin-induced apoptosis was significantly suppressed by the pretreatment of cells with Z-DEVD-FMK, a caspase-3 inhibitor. In conclusion, the results suggest that arctigenin is able to inhibit cell proliferation and may induce apoptosis and cell cycle arrest at the G 0 /G 1 phase in glioma cells. These results warrant further investigation of the anticancer effects of arctigenin in animal models of gliomas.

  6. Arctigenin, a natural lignan compound, induces G0/G1 cell cycle arrest and apoptosis in human glioma cells

    PubMed Central

    Maimaitili, Aisha; Shu, Zunhua; Cheng, Xiaojiang; Kaheerman, Kadeer; Sikandeer, Alifu; Li, Weimin

    2017-01-01

    The aim of the current study was to investigate the anticancer potential of arctigenin, a natural lignan compound, in malignant gliomas. The U87MG and T98G human glioma cell lines were treated with various concentrations of arctigenin for 48 h and the effects of arctigenin on the aggressive phenotypes of glioma cells were assessed. The results demonstrated that arctigenin dose-dependently inhibited the growth of U87MG and T98G cells, as determined using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide and bromodeoxyuridine incorporation assays. Arctigenin exposure also induced a 60–75% reduction in colony formation compared with vehicle-treated control cells. However, arctigenin was not observed to affect the invasiveness of glioma cells. Arctigenin significantly increased the proportion of cells in the G0/G1 phase and reduced the number of cells in the S phase, as compared with the control group (P<0.05). Western blot analysis demonstrated that arctigenin increased the expression levels of p21, retinoblastoma and p53 proteins, and significantly decreased the expression levels of cyclin D1 and cyclin-dependent kinase 4 proteins. Additionally, arctigenin was able to induce apoptosis in glioma cells, coupled with increased expression levels of cleaved caspase-3 and the pro-apoptotic BCL2-associated X protein. Furthermore, arctigenin-induced apoptosis was significantly suppressed by the pretreatment of cells with Z-DEVD-FMK, a caspase-3 inhibitor. In conclusion, the results suggest that arctigenin is able to inhibit cell proliferation and may induce apoptosis and cell cycle arrest at the G0/G1 phase in glioma cells. These results warrant further investigation of the anticancer effects of arctigenin in animal models of gliomas. PMID:28356992

  7. Draft Genome Sequences of Two Kocuria Isolates, K. salsicia G1 and K. rhizophila G2, Isolated from a Slaughterhouse in Denmark

    PubMed Central

    Herschend, Jakob; Raghupathi, Prem K.; Røder, Henriette L.; Sørensen, Søren J.

    2016-01-01

    We report here the draft genome sequences of Kocuria salsicia G1 and Kocuria rhizophila G2, which were isolated from a meat chopper at a small slaughterhouse in Denmark. The two annotated genomes are 2.99 Mb and 2.88 Mb in size, respectively. PMID:27034479

  8. Effects of dietary CLA supplementation, parity and different concentrate levels before calving on immunoglobulin G1, G2 and M concentrations in dairy cows.

    PubMed

    Eger, Melanie; Horn, Jana; Hussen, Jamal; Schuberth, Hans-Joachim; Scharf, Maria; Meyer, Ulrich; Dänicke, Sven; Bostedt, Hartwig; Breves, Gerhard

    2017-10-01

    Peripartal dairy cows exhibit a higher susceptibility for infectious diseases, which might be linked to the negative energy balance occurring at the onset of lactation. A dietary supplementation of conjugated linoleic acids (CLA) may reduce milk fat yield and subsequently lower the energy deficit. The utilization of immunoglobulins (Ig) for colostrogenesis might impair humoral immunity in peripartal dairy cows; therefore this study investigated the effects of a CLA supplement, parity and different dietary energy levels on plasma and colostrum IgG1, IgG2 and IgM levels in dairy cows and their calves. Blood samples were collected from 64 cows from 21days before until 56days after parturition and colostrum samples for the first 3days of lactation. Plasma immunoglobulin concentrations of 19 calves were determined before colostrum uptake. Neither plasma IgG1, nor IgG2 levels were affected by CLA or dietary energy level. However, immunoglobulin levels were affected by parity. Heifers possessed the lowest IgG1 concentrations. IgG2 concentrations were highest in cows with 2 lactations prior to parturition and in heifers after parturition. Plasma IgM levels were characterized by a sharp decrease 3days prior to parturition and were scarcely affected by the feeding regimen or parity. Generally, immunoglobulin levels appear to be mostly independent from the peripartal energy balance of the cows and are not influenced by dietary CLA. However, pronounced differences among parities for IgG1 and IgG2 were revealed which should be further evaluated. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Deficiency of a membrane skeletal protein, 4.1G, results in myelin abnormalities in the peripheral nervous system.

    PubMed

    Saitoh, Yurika; Ohno, Nobuhiko; Yamauchi, Junji; Sakamoto, Takeharu; Terada, Nobuo

    2017-12-01

    We previously demonstrated that a membrane skeletal molecular complex, 4.1G-membrane palmitoylated protein 6 (MPP6)-cell adhesion molecule 4, is incorporated in Schwann cells in the peripheral nervous system (PNS). In this study, we evaluated motor activity and myelin ultrastructures in 4.1G-deficient (-/-) mice. When suspended by the tail, aged 4.1G -/- mice displayed spastic leg extension, especially after overwork. Motor-conduction velocity in 4.1G -/- mice was slower than that in wild-type mice. Using electron microscopy, 4.1G -/- mice exhibited myelin abnormalities: myelin was thicker in internodes, and attachment of myelin tips was distorted in some paranodes. In addition, we found a novel function of 4.1G for sorting a scaffold protein, Lin7, due to disappearance of the immunolocalization and reduction of the production of Lin7c and Lin7a in 4.1G -/- sciatic nerves, as well as the interaction of MPP6 and Lin7 with immunoprecipitation. Thus, we herein propose 4.1G functions as a signal for proper formation of myelin in PNS.

  10. Influence of the Cyclooxygenase-2 Gene -765G/C and -1195G/A Polymorphisms on Development of Ischemic Stroke.

    PubMed

    Wu, Guangliang; Cai, Haiyan; Cai, Haobin; Chen, Zhao; Tan, Lei; Qin, Xiurong; Cai, Yefeng

    2016-09-01

    Many studies have investigated the association between the cyclooxygenase-2 (COX-2) gene polymorphism and ischemic stroke. However, results of these studies still remain controversial. To better explain the association between COX-2 polymorphisms (-765G/C and -1195G/A) and ischemic stroke risk, a meta-analysis was performed. Relevant studies were identified from 4 Chinese databases (Chinese Biological Medical Literature database, Chinese National Knowledge Infrastructure database, Chongqing VIP database, and Chinese WANFANG database), PUBMED and EMBASE prior to December 2015. The strength of association between COX-2 polymorphism and ischemic stroke was evaluated by the odds ratio (OR) with 95% confidence interval (CI). Inconsistency index (I(2)) and the Cochran's Q statistic were used to check heterogeneity. Publication bias was evaluated by funnel plots and Egger's regression test. A total of 4086 ischemic stroke cases and 4747 controls were identified. Significant association between COX-2 -765G/C polymorphism and the risk of ischemic stroke was found in Brazilians and the African-Americans. The OR of (CC+GC versus GG) for the Brazilians and African-Americans were (6.328, 95% CI = 2.295-17.448) and (1.644, 95% CI = 1.060-2.551). In addition, the recessive model of the Brazilians gave an OR of 3.621 (95% CI: 1.519-8.630). Furthermore, the (GC versus GG) and the allele model of the African-Americans were (OR: 1.615, 95% CI = 1.015-2.572) and (OR: 1.422, 95% CI = 1.033-1.957). Significant association was also observed for COX-2 -1195G/A polymorphism in the subtypes of small vessel disease (SVD) of ischemic stroke. Our study suggests that COX-2 -765G/C and -1195G/A polymorphisms may contribute to susceptibility of ischemic stroke, specifically in Brazilians and the African-Americans, and those of SVD. Copyright © 2016 National Stroke Association. Published by Elsevier Inc. All rights reserved.

  11. A case report of immunoglobulin G4-related sclerosing cholangitis with multiple relapse.

    PubMed

    Dong, Xiaoqin; Huo, Na; Wu, Zhao; Wang, Guiqiang; Wang, He; Zhao, Hong

    2018-05-01

    Immunoglobulin G4-related sclerosing cholangitis (IgG4-SC) is classified as a biliary tract manifestation of immunoglobulin G4-related disease (IgG4-RD). Glucocorticoid is the first-line therapy for most patients, but the optimal starting dose, adequate maintaining dose and withdrawal time remain disputable. An elderly male patient presented to our hospital with neoplasms of the bile duct and pancreas at first visit in December 2011. Further examination revealed bile duct stenosis and obstruction, and elevated serum IgG4 level. A diagnosis of IgG4-SC was established by examination results and effectiveness of steroid therapy, although IgG4-positive plasma cells were seldom seen in the liver sample. Prednisolone was started from 40 mg daily, tapered gradually, and totally withdrawn after 22 months of treatment. A new-onset cholangitis was detected 2 months later. Prednisolone 10 mg daily was administered again. Prednisolone was reduced to 5 mg every other day without consultation with his doctor 1 year ago in May 2017, then he presented to our hospital again with recurrent abdominal pain and jaundice. IgG4-SC is a protean condition and can be distinguished from primary sclerosing cholangitis, malignancy, and other inflammatory disorders based on 4 clinical criteria. Serum IgG4/IgG1 ratio is a practicable diagnostic algorithm to distinguish PSC from IgG4-SC. The dose and duration of glucocorticoid for treatment should be adjusted according to clinical situations, and proper maintaining dose is essential for a better prognosis.

  12. G1 arrest induction represents a critical determinant for cisplatin cytotoxicity in G1 checkpoint-retaining human cancers.

    PubMed

    Un, Frank

    2007-04-01

    Cisplatin has been used effectively to treat various human cancer types; yet, the precise mechanism underlying its cytotoxicity remains unknown. In eukaryotes, progression through G1 is monitored by a checkpoint, which executes G1 arrest in the event of DNA damage to allow time for repair before initiating DNA replication. The retinoblastoma tumor suppressor gene is an integral component of the mammalian G1 checkpoint. The utility of the retinoblastoma gene as a therapeutic for human cancers has been investigated. Intriguingly, the cytotoxicity profile of the retinoblastoma gene therapy closely parallels the clinical targets of cisplatin. It prompted an investigation into the potential role of the checkpoint-induced G1 arrest in cisplatin cytotoxicity. Here, the evidence that G1 arrest induction represents a critical step in cisplatin-induced lytic path is presented. First, cisplatin-treated human cancer cells undergo a prolonged G1 arrest before dying. Second, triggering G1 arrest via infection with a recombinant adenovirus expressing the human retinoblastoma gene is sufficient to potentiate lethality in the absence of cisplatin. Third, the extent of the lethality induced correlates with the G1-arresting potential of the ectopically expressed human retinoblastoma polypeptide. Fourth, human cancer cells resistant to cisplatin do not undergo G1 arrest despite cisplatin treatment. The above mechanism may be exploited to develop therapeutics that preserve the efficacy of cisplatin yet bypass its mutagenicity associated with the formation of secondary tumors.

  13. A review on g-C3N4 for photocatalytic water splitting and CO2 reduction

    NASA Astrophysics Data System (ADS)

    Ye, Sheng; Wang, Rong; Wu, Ming-Zai; Yuan, Yu-Peng

    2015-12-01

    Solar fuel generation through water splitting and CO2 photoreduction is an ideal route to provide the renewable energy sources and mitigate global warming. The main challenge in photocatalysis is finding a low-cost photocatalyst that can work efficiently to split water into hydrogen and reduce CO2 to hydrocarbon fuels. Metal-free g-C3N4 photocatalyst shows great potentials for solar fuel production. In this mini review, we summarize the most current advances on novel design idea and new synthesis strategy for g-C3N4 preparation, insightful ideas on extending optical absorption of pristine g-C3N4, overall water splitting and CO2 photoreduction over g-C3N4 based systems. The research challenges and perspectives on g-C3N4 based photocatalysts were also suggested.

  14. Murine J774 Macrophages Recognize LPS/IFN-g, Non-CpG DNA or Two-CpG DNA-containing Sequences as Immunologically Distinct

    PubMed Central

    Crosby, Lynn; Casey, Warren; Morgan, Kevin; Ni, Hong; Yoon, Lawrence; Easton, Marilyn; Misukonis, Mary; Burleson, Gary; Ghosh, Dipak K.

    2010-01-01

    Specific bacterial lipopolysaccharides (LPS), IFN-γ, and unmethylated cytosine or guanosine-phosphorothioate containing DNAs (CpG) activate host immunity, influencing infectious responses. Macrophages detect, inactivate and destroy infectious particles, and synthetic CpG sequences invoke similar responses of the innate immune system. Previously, murine macrophage J774 cells treated with CpG induced the expression of nitric oxide synthase 2 (NOS2) and cyclo-oxygenase 2 (COX2) mRNA and protein. In this study murine J774 macrophages were exposed to vehicle, interferon γ + lipopolysaccharide (IFN-g/LPS), non-CpG (SAK1), or two-CpG sequence-containing DNA (SAK2) for 0–18 hr and gene expression changes measured. A large number of immunostimulatory and inflammatory changes were observed. SAK2 was a stronger activator of TNFα- and chemokine expression-related changes than LPS/IFN-g. Up regulation included tumor necrosis factor receptor superfamily genes (TNFRSF’s), IL-1 receptor signaling via stress-activated protein kinase (SAPK), NF-κB activation, hemopoietic maturation factors and sonic hedgehog/wingless integration site (SHH/Wnt) pathway genes. Genes of the TGF-β pathway were down regulated. In contrast, LPS/IFN-g -treated cells showed increased levels for TGF-β signaling genes, which may be linked to the observed up regulation of numerous collagens and down regulation of Wnt pathway genes. SAK1 produced distinct changes from LPS/IFN-g or SAK2. Therefore, J774 macrophages recognize LPS/IFN-g, non-CpG DNA or two-CpG DNA-containing sequences as immunologically distinct. PMID:20097302

  15. 26 CFR 1.143(g)-1 - Requirements related to arbitrage.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 26 Internal Revenue 2 2010-04-01 2010-04-01 false Requirements related to arbitrage. 1.143(g)-1 Section 1.143(g)-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED....143(g)-1 Requirements related to arbitrage. (a) In general. Under section 143, for an issue to be an...

  16. 26 CFR 1.143(g)-1 - Requirements related to arbitrage.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 26 Internal Revenue 2 2014-04-01 2014-04-01 false Requirements related to arbitrage. 1.143(g)-1 Section 1.143(g)-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED....143(g)-1 Requirements related to arbitrage. (a) In general. Under section 143, for an issue to be an...

  17. 26 CFR 1.143(g)-1 - Requirements related to arbitrage.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 26 Internal Revenue 2 2011-04-01 2011-04-01 false Requirements related to arbitrage. 1.143(g)-1 Section 1.143(g)-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED....143(g)-1 Requirements related to arbitrage. (a) In general. Under section 143, for an issue to be an...

  18. 26 CFR 1.143(g)-1 - Requirements related to arbitrage.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 26 Internal Revenue 2 2012-04-01 2012-04-01 false Requirements related to arbitrage. 1.143(g)-1 Section 1.143(g)-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED....143(g)-1 Requirements related to arbitrage. (a) In general. Under section 143, for an issue to be an...

  19. 26 CFR 1.143(g)-1 - Requirements related to arbitrage.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 26 Internal Revenue 2 2013-04-01 2013-04-01 false Requirements related to arbitrage. 1.143(g)-1 Section 1.143(g)-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED....143(g)-1 Requirements related to arbitrage. (a) In general. Under section 143, for an issue to be an...

  20. G-quadruplexes Significantly Stimulate Pif1 Helicase-catalyzed Duplex DNA Unwinding*

    PubMed Central

    Duan, Xiao-Lei; Liu, Na-Nv; Yang, Yan-Tao; Li, Hai-Hong; Li, Ming; Dou, Shuo-Xing; Xi, Xu-Guang

    2015-01-01

    The evolutionarily conserved G-quadruplexes (G4s) are faithfully inherited and serve a variety of cellular functions such as telomere maintenance, gene regulation, DNA replication initiation, and epigenetic regulation. Different from the Watson-Crick base-pairing found in duplex DNA, G4s are formed via Hoogsteen base pairing and are very stable and compact DNA structures. Failure of untangling them in the cell impedes DNA-based transactions and leads to genome instability. Cells have evolved highly specific helicases to resolve G4 structures. We used a recombinant nuclear form of Saccharomyces cerevisiae Pif1 to characterize Pif1-mediated DNA unwinding with a substrate mimicking an ongoing lagging strand synthesis stalled by G4s, which resembles a replication origin and a G4-structured flap in Okazaki fragment maturation. We find that the presence of G4 may greatly stimulate the Pif1 helicase to unwind duplex DNA. Further studies reveal that this stimulation results from G4-enhanced Pif1 dimerization, which is required for duplex DNA unwinding. This finding provides new insights into the properties and functions of G4s. We discuss the observed activation phenomenon in relation to the possible regulatory role of G4s in the rapid rescue of the stalled lagging strand synthesis by helping the replicator recognize and activate the replication origin as well as by quickly removing the G4-structured flap during Okazaki fragment maturation. PMID:25627683

  1. A diagnostic pitfall in IgG4-related hypophysitis: infiltration of IgG4-positive cells in the pituitary of granulomatosis with polyangiitis.

    PubMed

    Bando, Hironori; Iguchi, Genzo; Fukuoka, Hidenori; Taniguchi, Masaaki; Kawano, Seiji; Saitoh, Miki; Yoshida, Kenichi; Matsumoto, Ryusaku; Suda, Kentaro; Nishizawa, Hitoshi; Takahashi, Michiko; Morinobu, Akio; Kohmura, Eiji; Ogawa, Wataru; Takahashi, Yutaka

    2015-10-01

    Immunoglobulin (Ig) G4-related hypophysitis is an emerging clinical entity, which is characterized by an elevated serum IgG4 concentration and infiltration of IgG4-positive plasma cells in the pituitary. Although some criteria for its diagnosis have been proposed, they have not been fully established. In particular, differential diagnosis from secondary chronic inflammation including granulomatosis with polyangiitis (GPA) is difficult in some cases. We describe central diabetes insipidus with pituitary swelling exhibiting infiltration of IgG4-positive cells. A 43-year-old woman in the remission stage of GPA presented with sudden-onset polyuria and polydipsia. Pituitary magnetic resonance imaging revealed swelling of the anterior and posterior pituitary and stalk, with heterogeneous gadolinium enhancement and disappearance of the high signal intensity of the posterior pituitary. Evaluation of biochemical markers for GPA suggested that the disease activity was well-controlled. Endocrinological examination revealed the presence of central diabetes insipidus and growth hormone deficiency. Pituitary biopsy specimen showed IgG4-positive cells, with a 43% IgG4(+)/IgG(+) ratio, which met the criteria for IgG4-related hypophysitis. However, substantial infiltration of polymorphonuclear neutrophils with giant cells was also noted, resulting in a final diagnosis of pituitary involvement of GPA. These results suggest that pituitary involvement of GPA should be taken into account for the differential diagnosis of IgG4-related hypophysitis.

  2. Low doses of GM-CSF (molgramostim) and G-CSF (filgrastim) after cyclophosphamide (4 g/m2) enhance the peripheral blood progenitor cell harvest: results of two randomized studies including 120 patients

    PubMed Central

    Quittet, Philippe; Ceballos, Patrice; Lopez, Ernesto; Lu, Zhao-Yang; Latry, Pascal; Becht, Catherine; Legouffe, Eric; Fegueux, Nathalie; Exbrayat, Carole; Pouessel, Damien; Rouillé, Valérie; Daures, Jean-Pierre; Klein, Bernard; Rossi, Jean-François

    2006-01-01

    The use of a combination of G-CSF and GM-CSF to G-CSF alone, after cyclophosphamide (4g/m2) was compared in 2 randomized phase III studies, including 120 patients. In study A, 60 patients received 5 × 2 μg/kg/day of G-CSF and GM-CSF compared to 5 μg/kg/day of G-CSF. In study B, 60 patients received 2.5 × 2 μg/kg/day G-CSF and GM-CSF compared to G-CSF alone (5 μg/kg/day). With the aim to collect at least 5 × 106/kg CD34 cells in a maximum of 3 large volume leukapherisis (LK), 123 LK were performed in study A, showing significant higher number of patients reaching 10 × 106/kg CD34 cells (21/29 in G+GM-CSF arm vs 11/27 in G-CSF arm, P= .00006). In study B, 109 LK were performed, with similar results (10/27 vs 15/26, P= .003). In both the study, the total harvest of CD34 cells/kg was 2-fold higher in G-CSF plus GM-CSF group (18.3 × 106 in study A and 15.85 × 106 in study B) than in G-CSF group (9 × 106 in study A and 8.1 × 106 in study B), a difference particularly seen in multiple myeloma, with no significant difference in terms of mobilized myeloma cells between G-CSF and GM-CSF groups. PMID:16883311

  3. [Pseudolaric acid B induces G2/M arrest and inhibits invasion and migration in HepG2 hepatoma cells].

    PubMed

    Li, Shuai; Guo, Lianyi

    2018-01-01

    Objective To investigate the mechanisms of pseudolaric acid B (PAB) blocks cell cycle and inhibits invasion and migration in human hepatoma HepG2 cells. Methods The proliferation effect of PAB on HepG2 cells was evaluated by MTT assay. The effect of PAB on the cell cycle of HepG2 cells was analyzed by flow cytometry. Immunofluorescence cytochemical staining was applied to observe the effect of PAB on the α-tubulin polymerization and expression in HepG2 cells. Transwell TM chamber invasion assay and wound healing assay were performed to detect the influence of PAB on the migration and invasion ability of HepG2 cells. Western blotting was used to determine the expressions of α-tubulin, E-cadherin and MMP-9 in HepG2 cells after treated with PAB. Results PAB inhibited the proliferation of HepG2 cells in a dose-dependent manner and blocked the cell cycle in G2/M phase. PAB significantly changed the polymerization and decreased the expression of α-tubulin. The capacities of invasion and migration of HepG2 cells treated by PAB were significantly depressed. The protein levels of α-tubulin and MMP-9 decreased while the E-cadherin protein level increased. Conclusion PAB can inhibits the proliferation of HepG2 cells by down-regulating the expression of α-tubulin and influencing its polymerization, arresting HepG2 cells in G2/M phase. Meanwhile, PAB also can inhibit the invasion and migration of HepG2 cells by lowering cytoskeleton α-tubulin and MMP-9, and increasing E-cadherin.

  4. 5-brane webs for 5d N = 1 G 2 gauge theories

    NASA Astrophysics Data System (ADS)

    Hayashi, Hirotaka; Kim, Sung-Soo; Lee, Kimyeong; Yagi, Futoshi

    2018-03-01

    We propose 5-brane webs for 5d N = 1 G 2 gauge theories. From a Higgsing of the SO(7) gauge theory with a hypermultiplet in the spinor representation, we construct two types of 5-brane web configurations for the pure G 2 gauge theory using an O5-plane or an \\tilde{O5} -plane. Adding flavors to the 5-brane web for the pure G 2 gauge theory is also discussed. Based on the obtained 5-brane webs, we compute the partition functions for the 5d G 2 gauge theories using the recently suggested topological vertex formulation with an O5-plane, and we find agreement with known results.

  5. HLA-G 3′UTR Polymorphisms Predict Drug-Induced G3-4 Toxicity Related to Folinic Acid/5-Fluorouracil/Oxaliplatin (FOLFOX4) Chemotherapy in Non-Metastatic Colorectal Cancer

    PubMed Central

    Garziera, Marica; Virdone, Saverio; De Mattia, Elena; Scarabel, Lucia; Cecchin, Erika; Polesel, Jerry; D’Andrea, Mario; Pella, Nicoletta; Buonadonna, Angela; Favaretto, Adolfo; Toffoli, Giuseppe

    2017-01-01

    Polymorphisms in drug-metabolizing enzymes might not completely explain inter-individual differences in toxicity profiles of patients with colorectal cancer (CRC) that receive folinic acid/5-fluorouracil/oxaliplatin (FOLFOX4). Recent data indicate that the immune system could contribute to FOLFOX4 outcomes. In light of the immune inhibitory nature of human leukocyte antigen-G (HLA-G), a non-classical major histocompatibility complex (MHC) class I molecule, we aimed to identify novel genomic markers of grades 3 and 4 (G3-4) toxicity related to FOLFOX4 therapy in patients with CRC. We retrospectively analyzed data for 144 patients with stages II-III CRC to identify HLA-G 3′ untranslated region (3′UTR) polymorphisms and related haplotypes and evaluate their impact on the risk of developing G3-4 toxicities (i.e., neutropenia, hematological/non-hematological toxicity, neurotoxicity) with logistic regression. The rs1610696-G/G polymorphism was associated with increased risk of G3-4 neutropenia (OR = 3.76, p = 0.015) and neurotoxicity (OR = 8.78, p = 0.016); rs371194629-Ins/Ins was associated with increased risk of neurotoxicity (OR = 5.49, p = 0.027). HLA-G 3′UTR-2, which contains rs1610696-G/G and rs371194629-Ins/Ins polymorphisms, was associated with increased risk of G3-4 neutropenia (OR = 3.92, p = 0.017) and neurotoxicity (OR = 11.29, p = 0.009). A bootstrap analysis confirmed the predictive value of rs1610696 and rs371194629, but the UTR-2 haplotype was validated only for neurotoxicity. This exploratory study identified new HLA-G 3′UTR polymorphisms/haplotypes as potential predictive markers of G3-4 toxicities in CRC. PMID:28653974

  6. G-quadruplex and G-rich sequence stimulate Pif1p-catalyzed downstream duplex DNA unwinding through reducing waiting time at ss/dsDNA junction

    PubMed Central

    Zhang, Bo; Wu, Wen-Qiang; Liu, Na-Nv; Duan, Xiao-Lei; Li, Ming; Dou, Shuo-Xing; Hou, Xi-Miao; Xi, Xu-Guang

    2016-01-01

    Alternative DNA structures that deviate from B-form double-stranded DNA such as G-quadruplex (G4) DNA can be formed by G-rich sequences that are widely distributed throughout the human genome. We have previously shown that Pif1p not only unfolds G4, but also unwinds the downstream duplex DNA in a G4-stimulated manner. In the present study, we further characterized the G4-stimulated duplex DNA unwinding phenomenon by means of single-molecule fluorescence resonance energy transfer. It was found that Pif1p did not unwind the partial duplex DNA immediately after unfolding the upstream G4 structure, but rather, it would dwell at the ss/dsDNA junction with a ‘waiting time’. Further studies revealed that the waiting time was in fact related to a protein dimerization process that was sensitive to ssDNA sequence and would become rapid if the sequence is G-rich. Furthermore, we identified that the G-rich sequence, as the G4 structure, equally stimulates duplex DNA unwinding. The present work sheds new light on the molecular mechanism by which G4-unwinding helicase Pif1p resolves physiological G4/duplex DNA structures in cells. PMID:27471032

  7. Utility of serum IgG, IgG4 and carbonic anhydrase II antibodies in distinguishing autoimmune pancreatitis from pancreatic cancer and chronic pancreatitis.

    PubMed

    Talar-Wojnarowska, Renata; Gąsiorowska, Anita; Olakowski, Marek; Dranka-Bojarowska, Daria; Lampe, Paweł; Śmigielski, Jacek; Kujawiak, Magdalena; Grzegorczyk, Janina; Małecka-Panas, Ewa

    2014-09-01

    Autoimmune pancreatitis (AIP) can mimic pancreatic cancer in its clinical presentation, imaging features and laboratory parameters. The aim of our study was to compare IgG, IgG4 and anti-CAIIAb serum levels in patients with AIP, pancreatic adenocarcinoma (PA) and chronic pancreatitis (CP) and to assess their clinical significance and utility in differential diagnosis of pancreatic diseases. The study included 124 patients: 45 with PA, 24 with AIP and 55 with CP. Peripheral venous blood samples were obtained from all analyzed patients at the time of hospital admission and total IgG, IgG4 and anti-CAIIAB serum levels were measured using ELISA tests. Serum levels of IgG, IgG4 and anti-CAIIAb were significantly higher in patients with AIP compared to PA and CP patients (p<0.001). In AIP patients the median IgG levels were 19.7 g/l, IgG4 levels - 301.9 mg/dl and anti-CAIIAb - 81.82 ng/ml, compared to 10.61 g/l, 123.2mg/dl and 28.6 ng/ml, respectively, in PA patients. IgG4 for the cut-off 210 mg/dl showed the best sensitivity and specificity (83.8% and 89.5%) in AIP diagnosis compared to IgG (69.3% and 87.3%, respectively) and anti-CAIIAb (45.3% and 74.3%). However, 16 (35.5%) patients with PA and 14 (25.4%) patients with CP had IgG4 levels greater than 140 mg/dl. Moreover, in 3 (6.67%) patients with pancreatic cancer those values were greater than 280 mg/dl. No patients with CP had IgG4 more than 280 mg/dl. IgG4 at cut-off 210 mg/dl showed the best sensitivity and specificity in AIP diagnosis compared to IgG and anti-CAIIAb, however elevations of serum IgG4 may be seen in subjects without AIP, including pancreatic cancer. Copyright © 2014 Medical University of Bialystok. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.

  8. Restraint hypothermia in cold-exposed rats at 3 G and 1 G

    NASA Technical Reports Server (NTRS)

    Monson, C. B.; Horowitz, J. M.; Horwitz, B. A.

    1982-01-01

    The relationship between heat loss, heat production, and hypothermia was investigated in experiments with rats which determined if hypergravity affects heat production by altering oxygen consumption and if restraint modifies the ability of the rats to activate thermogenic mechanisms after cold exposure in a hypergravic field. Restrained and unrestrained rats were exposed for 1 hr periods to 1 G and 3 G at ambient temperatures of 24 C or 10 C, and the rate of oxygen consumption, the core temperatures, and the tail temperatures were measured. Results show that thermoregulatory mechanisms are impaired when rats are exposed to 3 G fields, and at 24 C as well as at 10 C this impairment leads to an inappropriate increase in heat loss.

  9. The Association of PSR B1757-24 and the SNR G5.4-1.2

    NASA Astrophysics Data System (ADS)

    Gvaramadze, V. V.

    The association of PSR B1757-24 and the supernova remnant (SNR) G5.4-1.2 was recently questioned by Thorsett et al. (2002) on the basis of proper motion measurements of the pulsar and the "incorrect" orientation of the vector of pulsar transverse velocity (inferred from the orientation of the cometary-shaped pulsar wind nebula). We show, however, that the association could be real if both objects are the remnants of an off-centered cavity supernova explosion.

  10. Age related IgG subclass concentrations in asthma.

    PubMed

    Hoeger, P H; Niggemann, B; Haeuser, G

    1994-03-01

    The prevalence of IgG subclass deficiency in asthma is still controversial. Earlier studies often included patients receiving treatment with systemic steroids which can induce hypogammaglobulinaemia. Concentrations of IgG subclasses were studies in 200 children (aged 2-17 years) with asthma (mean asthma severity score (ASS) 2, range 1-4) who had not received systemic steroids for at least six weeks before investigation, and in 226 healthy age matched controls. The mean concentrations of IgG subclasses in children with asthma were within the 1SD range of those of the control group. In the group with asthma there was a trend towards higher levels of IgG1 and IgG4, whereas the number of children with low concentrations of IgG2 (< 2 SD of control serum samples; absolute concentrations 0.08-1.25 g/l) was slightly greater than in the group who did not have asthma (4.5 v 2.2%). Patients with subnormal concentrations of IgG2 could not be distinguished clinically or on the basis of case history and additional immunological studies did not show further abnormalities. Patients with severe asthma (ASS 3-4) had significantly higher concentrations of IgG4 (mean (SE) 0.53 (0.09) v 0.26 (0.04) g/l) than patients with mild asthma (ASS 1). No significant difference in subclass concentration was found between patients with atopic and those with non-atopic asthma. It is concluded that in an unselected group of children with asthma the mean IgG subclass concentrations do not differ significantly from a group of healthy age matched controls.

  11. Science Highlights from the Spitzer Survey of Stellar Structure in Galaxies (S4G) & Public Release of S4G Data

    NASA Astrophysics Data System (ADS)

    Sheth, Kartik

    2013-01-01

    The Spitzer Survey of Stellar Structure in Galaxies (S4G) is the largest and the most homogenous survey of the distribution of mass and stellar structure in over 2,300 nearby galaxies. With an integration time of four minutes per pixel at 3.6 and 4.5 microns, the S4G maps are extremely deep, tracing the stellar surface densities of < 1 solar mass per square parsec! S4G is the ultimate survey of the endoskeleton of nearby galaxies from dwarfs to ellipticals and affords an incredible treasury of data which we can address a host of outstanding questions in galaxy evolution. At this special session we will present details on the public release of this survey which will include science ready images, masks for the foreground and background stars, globally integrated properties and radial profiles of all galaxies. In addition we will release the results from a GALFIT decomposition of 200 galaxies which will be supplemented with the remainder of the survey within six months. The data are being released through the NASA/IPAC Infrared Science Archive (IRSA). I will present an overview of the survey, the data we are releasing, introduce the speakers and present science highlights from the team.

  12. 16 CFR Appendix G4 to Part 305 - Mobile Home Furnaces

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 16 Commercial Practices 1 2012-01-01 2012-01-01 false Mobile Home Furnaces G4 Appendix G4 to Part... CONCERNING DISCLOSURES REGARDING ENERGY CONSUMPTION AND WATER USE OF CERTAIN HOME APPLIANCES AND OTHER... Appendix G4 to Part 305—Mobile Home Furnaces Manufacturer's rated heating capacities (Btu's/hr.) Range of...

  13. 16 CFR Appendix G4 to Part 305 - Mobile Home Furnaces

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Mobile Home Furnaces G4 Appendix G4 to Part... CONCERNING DISCLOSURES REGARDING ENERGY CONSUMPTION AND WATER USE OF CERTAIN HOME APPLIANCES AND OTHER... Appendix G4 to Part 305—Mobile Home Furnaces Manufacturer's rated heating capacities (Btu's/hr.) Range of...

  14. 16 CFR Appendix G4 to Part 305 - Mobile Home Furnaces

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 16 Commercial Practices 1 2011-01-01 2011-01-01 false Mobile Home Furnaces G4 Appendix G4 to Part... CONCERNING DISCLOSURES REGARDING ENERGY CONSUMPTION AND WATER USE OF CERTAIN HOME APPLIANCES AND OTHER... Appendix G4 to Part 305—Mobile Home Furnaces Manufacturer's rated heating capacities (Btu's/hr.) Range of...

  15. 16 CFR Appendix G4 to Part 305 - Mobile Home Furnaces

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 16 Commercial Practices 1 2013-01-01 2013-01-01 false Mobile Home Furnaces G4 Appendix G4 to Part... CONCERNING DISCLOSURES REGARDING ENERGY CONSUMPTION AND WATER USE OF CERTAIN HOME APPLIANCES AND OTHER... Appendix G4 to Part 305—Mobile Home Furnaces Manufacturer's rated heating capacities (Btu's/hr.) Range of...

  16. Can the BMS Algorithm Decode Up to \\lfloor \\frac{d_G-g-1}{2}\\rfloor Errors? Yes, but with Some Additional Remarks

    NASA Astrophysics Data System (ADS)

    Sakata, Shojiro; Fujisawa, Masaya

    It is a well-known fact [7], [9] that the BMS algorithm with majority voting can decode up to half the Feng-Rao designed distance dFR. Since dFR is not smaller than the Goppa designed distance dG, that algorithm can correct up to \\lfloor \\frac{d_G-1}{2}\\rfloor errors. On the other hand, it has been considered to be evident that the original BMS algorithm (without voting) [1], [2] can correct up to \\lfloor \\frac{d_G-g-1}{2}\\rfloor errors similarly to the basic algorithm by Skorobogatov-Vladut. But, is it true? In this short paper, we show that it is true, although we need a few remarks and some additional procedures for determining the Groebner basis of the error locator ideal exactly. In fact, as the basic algorithm gives a set of polynomials whose zero set contains the error locators as a subset, it cannot always give the exact error locators, unless the syndrome equation is solved to find the error values in addition.

  17. Sterigmatocystin induces G1 arrest in primary human esophageal epithelial cells but induces G2 arrest in immortalized cells: key mechanistic differences in these two models.

    PubMed

    Wang, Juan; Huang, Shujuan; Xing, Lingxiao; Cui, Jinfeng; Tian, Ziqiang; Shen, Haitao; Jiang, Xiujuan; Yan, Xia; Wang, Junling; Zhang, Xianghong

    2015-11-01

    Sterigmatocystin (ST), a mycotoxin commonly found in food and feed commodities, has been classified as a "possible human carcinogen." Our previous studies suggested that ST exposure might be a risk factor for esophageal cancer and that ST may induce DNA damage and G2 phase arrest in immortalized human esophageal epithelial cells (Het-1A). To further confirm and explore the cellular responses of ST in human esophageal epithelia, we comparatively evaluated DNA damage, cell cycle distribution and the relative mechanisms in primary cultured human esophageal epithelial cells (EPC), which represent a more representative model of the in vivo state, and Het-1A cells. In this study, we found that ST could induce DNA damage in both EPC and Het-1A cells but led to G1 phase arrest in EPC cells and G2 phase arrest in Het-1A cells. Furthermore, our results indicated that the activation of the ATM-Chk2 pathway was involved in ST-induced G1 phase arrest in EPC cells, whereas the p53-p21 pathway activation in ST-induced G2 phase arrest in Het-1A cells. Studies have demonstrated that SV40 large T-antigen (SV40LT) may disturb cell cycle progression by inactivating some of the proteins involved in the G1/S checkpoint. Het-1A is a non-cancerous epithelial cell line immortalized by SV40LT. To evaluate the possible perturbation effect of SV40LT on ST-induced cell cycle disturbance in Het-1A cells, we knocked down SV40LT of Het-1A cells with siRNA and found that under this condition, ST-induced G2 arrest was significantly attenuated, whereas the proportion of cells in the G1 phase was significantly increased. Furthermore, SV40LT-siRNA also inhibited the activation of the p53-p21 signaling pathway induced by ST. In conclusion, our data indicated that ST could induce DNA damage in both primary cultured and immortalized esophageal epithelial cells. In primary human esophageal epithelial cells, ST induced DNA damage and then triggered the ATM-Chk2 pathway, resulting in G1 phase arrest

  18. Two Chimeric Regulators of G-protein Signaling (RGS) Proteins Differentially Modulate Soybean Heterotrimeric G-protein Cycle*

    PubMed Central

    Roy Choudhury, Swarup; Westfall, Corey S.; Laborde, John P.; Bisht, Naveen C.; Jez, Joseph M.; Pandey, Sona

    2012-01-01

    Heterotrimeric G-proteins and the regulator of G-protein signaling (RGS) proteins, which accelerate the inherent GTPase activity of Gα proteins, are common in animals and encoded by large gene families; however, in plants G-protein signaling is thought to be more limited in scope. For example, Arabidopsis thaliana contains one Gα, one Gβ, three Gγ, and one RGS protein. Recent examination of the Glycine max (soybean) genome reveals a larger set of G-protein-related genes and raises the possibility of more intricate G-protein networks than previously observed in plants. Stopped-flow analysis of GTP-binding and GDP/GTP exchange for the four soybean Gα proteins (GmGα14) reveals differences in their kinetic properties. The soybean genome encodes two chimeric RGS proteins with an N-terminal seven transmembrane domain and a C-terminal RGS box. Both GmRGS interact with each of the four GmGα and regulate their GTPase activity. The GTPase-accelerating activities of GmRGS1 and -2 differ for each GmGα, suggesting more than one possible rate of the G-protein cycle initiated by each of the Gα proteins. The differential effects of GmRGS1 and GmRGS2 on GmGα14 result from a single valine versus alanine difference. The emerging picture suggests complex regulation of the G-protein cycle in soybean and in other plants with expanded G-protein networks. PMID:22474294

  19. Importance of Highly Conserved Peptide Sites of Human Cytomegalovirus gO for Formation of the gH/gL/gO Complex

    PubMed Central

    Stegmann, Cora; Abdellatif, Mohamed E. A.; Laib Sampaio, Kerstin; Walther, Paul

    2016-01-01

    ABSTRACT The glycoprotein O (gO) is betaherpesvirus specific. Together with the viral glycoproteins H and L, gO forms a covalent trimeric complex that is part of the viral envelope. This trimer is crucial for cell-free infectivity of human cytomegalovirus (HCMV) but dispensable for cell-associated spread. We hypothesized that the amino acids that are conserved among gOs of different cytomegaloviruses are important for the formation of the trimeric complex and hence for efficient virus spread. In a mutational approach, nine peptide sites, containing all 13 highly conserved amino acids, were analyzed in the context of HCMV strain TB40-BAC4 with regard to infection efficiency and formation of the gH/gL/gO complex. Mutation of amino acids (aa) 181 to 186 or aa 193 to 198 resulted in the loss of the trimer and a complete small-plaque phenotype, whereas mutation of aa 108 or aa 249 to 254 caused an intermediate phenotype. While individual mutations of the five conserved cysteines had little impact, their relevance was revealed in a combined mutation, which abrogated both complex formation and cell-free infectivity. C343 was unique, as it was sufficient and necessary for covalent binding of gO to gH/gL. Remarkably, however, C218 together with C167 rescued infectivity in the absence of detectable covalent complex formation. We conclude that all highly conserved amino acids contribute to the function of gO to some extent but that aa 181 to 198 and cysteines 343, 218, and 167 are particularly relevant. Surprisingly, covalent binding of gO to gH/gL is required neither for its incorporation into virions nor for proper function in cell-free infection. IMPORTANCE Like all herpesviruses, the widespread human pathogen HCMV depends on glycoproteins gB, gH, and gL for entry into target cells. Additionally, gH and gL have to bind gO in a trimeric complex for efficient cell-free infection. Homologs of gO are shared by all cytomegaloviruses, with 13 amino acids being highly conserved

  20. Birth of Archaeal Cells: Molecular Phylogenetic Analyses of G1P Dehydrogenase, G3P Dehydrogenases, and Glycerol Kinase Suggest Derived Features of Archaeal Membranes Having G1P Polar Lipids

    PubMed Central

    2016-01-01

    Bacteria and Eukarya have cell membranes with sn-glycerol-3-phosphate (G3P), whereas archaeal membranes contain sn-glycerol-1-phosphate (G1P). Determining the time at which cells with either G3P-lipid membranes or G1P-lipid membranes appeared is important for understanding the early evolution of terrestrial life. To clarify this issue, we reconstructed molecular phylogenetic trees of G1PDH (G1P dehydrogenase; EgsA/AraM) which is responsible for G1P synthesis and G3PDHs (G3P dehydrogenase; GpsA and GlpA/GlpD) and glycerol kinase (GlpK) which is responsible for G3P synthesis. Together with the distribution of these protein-encoding genes among archaeal and bacterial groups, our phylogenetic analyses suggested that GlpA/GlpD in the Commonote (the last universal common ancestor of all extant life with a cellular form, Commonote commonote) acquired EgsA (G1PDH) from the archaeal common ancestor (Commonote archaea) and acquired GpsA and GlpK from a bacterial common ancestor (Commonote bacteria). In our scenario based on this study, the Commonote probably possessed a G3P-lipid membrane synthesized enzymatically, after which the archaeal lineage acquired G1PDH followed by the replacement of a G3P-lipid membrane with a G1P-lipid membrane. PMID:27774041

  1. Bla g 1 allergen levels in Zagreb area household dust.

    PubMed

    Prester, Ljerka; Macan, Jelena

    2011-03-01

    Cockroach allergy is a health problem in many parts of the world. In urban environments, indoor exposure to cockroach allergens involves a risk of asthma. The aim of this study was to measure the mass fraction of Bla g 1, a major allergen of the German cockroach (Blatella germanica) in 30 house samples, collected at random from Zagreb area households, Croatia. Dust samples were collected on cellulose filters by vacuuming living rooms floors. After extraction, Bla g 1 was detected using the commercial enzyme-linked immunosorbent assay (ELISA). Only four of the thirty households had detectable Bla g 1 levels, and only in one was its concentration higher than 2.0 U g(-1), the threshold associated with sensitisation. The Bla g 1 ELISA proved highly sensitive, with the detection limit of 0.12 U g(-1). The within- and between-assay imprecision was 8.9 % and 14.4 %, respectively, and accuracy 85 % to 120 %. Low Bla g 1 levels in the household dust support previously reported low prevalence of skin sensitisation to B. germanica among Zagreb residents. Further monitoring should reveal if there are differences in cockroach allergen exposure and sensitisation between households from other geographic areas in Croatia.

  2. Mms1 is an assistant for regulating G-quadruplex DNA structures.

    PubMed

    Schwindt, Eike; Paeschke, Katrin

    2018-06-01

    The preservation of genome stability is fundamental for every cell. Genomic integrity is constantly challenged. Among those challenges are also non-canonical nucleic acid structures. In recent years, scientists became aware of the impact of G-quadruplex (G4) structures on genome stability. It has been shown that folded G4-DNA structures cause changes in the cell, such as transcriptional up/down-regulation, replication stalling, or enhanced genome instability. Multiple helicases have been identified to regulate G4 structures and by this preserve genome stability. Interestingly, although these helicases are mostly ubiquitous expressed, they show specificity for G4 regulation in certain cellular processes (e.g., DNA replication). To this date, it is not clear how this process and target specificity of helicases are achieved. Recently, Mms1, an ubiquitin ligase complex protein, was identified as a novel G4-DNA-binding protein that supports genome stability by aiding Pif1 helicase binding to these regions. In this perspective review, we discuss the question if G4-DNA interacting proteins are fundamental for helicase function and specificity at G4-DNA structures.

  3. RTEL1 dismantles T loops and counteracts telomeric G4-DNA to maintain telomere integrity.

    PubMed

    Vannier, Jean-Baptiste; Pavicic-Kaltenbrunner, Visnja; Petalcorin, Mark I R; Ding, Hao; Boulton, Simon J

    2012-05-11

    T loops and telomeric G-quadruplex (G4) DNA structures pose a potential threat to genome stability and must be dismantled to permit efficient telomere replication. Here we implicate the helicase RTEL1 in the removal of telomeric DNA secondary structures, which is essential for preventing telomere fragility and loss. In the absence of RTEL1, T loops are inappropriately resolved by the SLX4 nuclease complex, resulting in loss of the telomere as a circle. Depleting SLX4 or blocking DNA replication abolished telomere circles (TCs) and rescued telomere loss in RTEL1(-/-) cells but failed to suppress telomere fragility. Conversely, stabilization of telomeric G4-DNA or loss of BLM dramatically enhanced telomere fragility in RTEL1-deficient cells but had no impact on TC formation or telomere loss. We propose that RTEL1 performs two distinct functions at telomeres: it disassembles T loops and also counteracts telomeric G4-DNA structures, which together ensure the dynamics and stability of the telomere. Copyright © 2012 Elsevier Inc. All rights reserved.

  4. Distances to Supernova Remnants G31.9+0.0 and G54.4−0.3 Associated with Molecular Clouds

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ranasinghe, S.; Leahy, D. A.

    2017-07-10

    New distances to the supernova remnants (SNRs) G31.9+0.0 and G54.4−0.3 have been found. The analysis method uses H i absorption spectra and CO channel maps. Individual H i channel maps are used to verify absorption features in the H i absorption spectrum or to determine if they have noise. Both of the SNRs are associated with molecular clouds so accurate kinematic velocities are determined. The H iabsorption is used to resolve the kinematic distance ambiguity. The resulting new distance for G31.9+0.0 is 7.1 ± 0.4 kpc and for G54.4−0.3 it is 6.6 ± 0.6 kpc. These are significant revisions tomore » the previous values.« less

  5. IgG abnormality in narcolepsy and idiopathic hypersomnia.

    PubMed

    Tanaka, Susumu; Honda, Makoto

    2010-03-05

    A close association between narcolepsy and the Human Leukocyte Antigen (HLA)-DQB1*0602 allele suggests the involvement of the immune system, or possibly an autoimmune process. We investigated serum IgG levels in narcolepsy. We measured the serum total IgG levels in 159 Japanese narcolepsy-cataplexy patients positive for the HLA-DQB1*0602 allele, 28 idiopathic hypersomnia patients with long sleep time, and 123 healthy controls (the HLA-DQB1*0602 allele present in 45 subjects). The serum levels of each IgG subclass were subsequently measured. The distribution of serum IgG was significantly different among healthy controls negative for the HLA-DQB1*0602 allele (11.66+/-3.55 mg/ml), healthy controls positive for the HLA-DQB1*0602 allele (11.45+/-3.43), narcolepsy patients (9.67+/-3.38), and idiopathic hypersomnia patients (13.81+/-3.80). None of the following clinical variables, age, disease duration, Epworth Sleepiness Scale, smoking habit and BMI at the time of blood sampling, were associated with IgG levels in narcolepsy or idiopathic hypersomnia. Furthermore we found the decrease in IgG1 and IgG2 levels, stable expression of IgG3, and the increase in the proportion of IgG4 in narcolepsy patients with abnormally low IgG levels. The increase in the proportion of IgG4 levels was also found in narcolepsy patients with normal serum total IgG levels. Idiopathic hypersomnia patients showed a different pattern of IgG subclass distribution with high IgG3 and IgG4 level, low IgG2 level, and IgG1/IgG2 imbalance. Our study is the first to determine IgG abnormalities in narcolepsy and idiopathic hypersomnia by measuring the serum IgG levels in a large number of hypersomnia patients. The observed IgG abnormalities indicate humoral immune alterations in narcolepsy and idiopathic hypersomnia. Different IgG profiles suggest immunological differences between narcolepsy and idiopathic hypersomnia.

  6. CO2 conversion in non-thermal plasma and plasma/g-C3N4 catalyst hybrid processes

    NASA Astrophysics Data System (ADS)

    Lu, Na; Sun, Danfeng; Zhang, Chuke; Jiang, Nan; Shang, Kefeng; Bao, Xiaoding; Li, Jie; Wu, Yan

    2018-03-01

    Carbon dioxide conversion at atmosphere pressure and low temperature has been studied in a cylindrical dielectric barrier discharge (DBD) reactor. Pure CO2 feed flows to the discharge zone and typical filamentary discharges were obtained in each half-cycle of the applied voltage. The gas temperature increased with discharge time and discharge power, which was found to affect the CO2 decomposition deeply. As the DBD reactor was cooled to ambient temperature, both the conversion of CO2 and the CO yield were enhanced. Especially the energy efficiencies changed slightly with the increase of discharge power and were much higher in cooling condition comparing to those without cooling. At a discharge power of 40 W, the energy efficiency under cooling condition was approximately six times more than that without cooling. Gas flow rate was observed to affect CO2 conversion and 0.1 L min-1 was obtained as optimum gas flow rate under cooling condition. In addition, the CO2 conversion rate in plasma/g-C3N4 catalyst hybrid system was twice times as that in plasma-alone system. In case of cooling, the existence of g-C3N4 catalyst contributed to a 47% increase of CO2 conversion compared to the sole plasma process. The maximum energy-efficiency with g-C3N4 was 0.26 mmol kJ-1 at 20 W, which increased by 157% compared to that without g-C3N4. The synergistic effect of DBD plasma with g-C3N4 on pure CO2 conversion was verified.

  7. Carnitine-acylcarnitine translocase deficiency with c.199-10 T>G and novel c.1A>G mutation

    PubMed Central

    Yan, Hui-ming; Hu, Hao; Ahmed, Aisha; Feng, Bing-bing; Liu, Jing; Jia, Zheng-jun; Wang, Hua

    2017-01-01

    Abstract Rationale: Carnitine-acylcarnitine translocate deficiency (CACTD) is a rare and life-threatening, autosomal recessive disorder of fatty acid β-oxidation characterized by hypoketotic hypoglycemia, hyperammonemia, cardiomyopathy, liver dysfunction, and muscle weakness; culminating in early death. To date, CACTD cases screened from the Chinese mainland population, especially patient with compound heterozygote with c.199-10T>G and a novel c.1A>G mutation in the SLC25A20 gene has never been described. Patient concerns: Herein, we report 2 neonatal cases of CACTD identified from the mainland China. These 2 patients were presented with severe metabolic crisis and their clinical conditions deteriorate rapidly and both died of cardiorespiratory collapse in the first week of life. We present the clinical and biochemical features of 2 probands and a brief literature review of previously reported CACTD cases with the c.199-10T>G mutation. Diagnoses: The acylcarnitine profiles by tandem-mass-spectrometry and the mutation analysis of SLC25A20 gene confirmed the diagnosis of CACTD in both patients. Mutation analysis demonstrated that patient No. 1 was homozygous for c.199-10T>G mutation, while patient No. 2 was a compound heterozygote for 2 mutations, a maternally-inherited c.199-10T>G and a paternally-inherited, novel c.1A>G mutation. Interventions: Both patients were treated with an aggressive treatment regimen include high glucose and arginine infusion, respiratory, and circulatory support. Outcomes: The first proband died 3 days after delivery due to sudden cardiac arrest. The second patient's clinical condition, at one time, was improved by high glucose infusion, intravenous arginine, and circulatory support. However, the patient failed to wean from mechanical ventilation. Unfortunately, her parents refused further treatment due to fear of financial burdens. The patient died of congestive heart failure in the 6th day of life. Lessons: We report the first 2 cases of

  8. High serum levels of allergen specific IgG-4 (asIgG-4) for common food allergens in healthy blood donors.

    PubMed

    Kruszewski, J; Raczka, A; Kłos, M; Wiktor-Jedrzejczak, W

    1994-01-01

    High serum levels of asIgG-4 against common food allergens are found in many patients with symptoms suggesting food allergy. The same patients are frequently negative for allergen specific IgE (asIgE) against the same allergens. These data were frequently interpreted as suggestive of a role of asIgG-4 in food allergy. In order to evaluate this hypothesis we tested serum levels of asIgG-4 against food allergens in young blood donors without any signs or history of food allergy. Fifty young healthy male donors were evaluated. The serum levels of IgE, and asIgE and IgG-4 against 14 common food allergens were determined. The studies were carried out using commercially available 3M Diagnostics Systems kits. AsIgG-4 against food allergens were found in sera of 92% blood donors, and in 62% of these healthy persons the levels of asIgG-4 were higher than 10.0 micrograms/ml. In a small proportion of patients, high serum levels of IgE and asIgE against the same food and/or inhalant allergens were found. Common occurrence of asIgG-4 against food allergens in healthy persons (without any symptoms which could suggest allergy or food intolerance) argues against the possible participation of these antibodies in the pathogenesis of food allergy. It is possible that their occurrence is the result of immunization against food antigens (allergens). It remains to be resolved whether the presence of these antibodies represents an epiphenomenon or may have some other biological role.

  9. Efficient Multiplexer FPGA Block Structures Based on G4FETs

    NASA Technical Reports Server (NTRS)

    Vatan, Farrokh; Fijany, Amir

    2009-01-01

    Generic structures have been conceived for multiplexer blocks to be implemented in field-programmable gate arrays (FPGAs) based on four-gate field-effect transistors (G(sup 4)FETs). This concept is a contribution to the continuing development of digital logic circuits based on G4FETs and serves as a further demonstration that logic circuits based on G(sup 4)FETs could be more efficient (in the sense that they could contain fewer transistors), relative to functionally equivalent logic circuits based on conventional transistors. Results in this line of development at earlier stages were summarized in two previous NASA Tech Briefs articles: "G(sup 4)FETs as Universal and Programmable Logic Gates" (NPO-41698), Vol. 31, No. 7 (July 2007), page 44, and "Efficient G4FET-Based Logic Circuits" (NPO-44407), Vol. 32, No. 1 ( January 2008), page 38 . As described in the first-mentioned previous article, a G4FET can be made to function as a three-input NOT-majority gate, which has been shown to be a universal and programmable logic gate. The universality and programmability could be exploited to design logic circuits containing fewer components than are required for conventional transistor-based circuits performing the same logic functions. The second-mentioned previous article reported results of a comparative study of NOT-majority-gate (G(sup 4)FET)-based logic-circuit designs and equivalent NOR- and NAND-gate-based designs utilizing conventional transistors. [NOT gates (inverters) were also included, as needed, in both the G(sup 4)FET- and the NOR- and NAND-based designs.] In most of the cases studied, fewer logic gates (and, hence, fewer transistors), were required in the G(sup 4)FET-based designs. There are two popular categories of FPGA block structures or architectures: one based on multiplexers, the other based on lookup tables. In standard multiplexer- based architectures, the basic building block is a tree-like configuration of multiplexers, with possibly a few

  10. Enterocolic lymphocytic phlebitis as a newly recognized manifestation of IgG4-related disease.

    PubMed

    Laco, Jan; Örhalmi, Július; Bártová, Jolana; Zimandlová, Dana

    2015-04-01

    Herein we present a case of a 65-year-old woman with enterocolic lymphocytic phlebitis (ELP) who presented with anemic syndrome and in whom severe stenosis of the right flexure of large bowel was detected. The microscopic examination revealed fibrosis of the submucosa and lymphoplasmacytic phlebitis of small veins and venules, whereas arteries were spared. There were 110 IgG4-positive and 160 IgG-positive plasma cells in 1 high-power field, respectively, with corresponding IgG4/IgG ratio of 0.69. The IgG4 serum level was 2.42 g/L. According to the currently proposed criteria, this ELP case is the first that may be diagnosed as definite IgG4-related disease (IgG4-RD). Although based on the sole case description, taken together with a recent review and a case report, we presume that a subset of ELPs is a manifestation of IgG4-RD. © The Author(s) 2014.

  11. Inhibition of lipolysis in the novel transgenic quail model overexpressing G0/G1 switch gene 2 in the adipose tissue during feed restriction.

    PubMed

    Shin, Sangsu; Choi, Young Min; Han, Jae Yong; Lee, Kichoon

    2014-01-01

    In addition to the issue of obesity in humans, the production of low-fat meat from domestic animals is important in the agricultural industry to satisfy consumer demand. Understanding the regulation of lipolysis in adipose tissue could advance our knowledge to potentially solve both issues. Although the G0/G1 switch gene 2 (G0S2) was recently identified as an inhibitor of adipose triglyceride lipase (ATGL) in vitro, its role in vivo has not been fully clarified. This study was conducted to investigate the role of G0S2 gene in vivo by using two independent transgenic quail lines during different energy conditions. Unexpectedly, G0S2 overexpression had a negligible effect on plasma NEFA concentration, fat cell size and fat pad weight under ad libitum feeding condition when adipose lipolytic activity is minimal. A two-week feed restriction in non-transgenic quail expectedly caused increased plasma NEFA concentration and dramatically reduced fat cell size and fat pad weight. Contrary, G0S2 overexpression under a feed restriction resulted in a significantly less elevation of plasma NEFA concentration and smaller reductions in fat pad weights and fat cell size compared to non-transgenic quail, demonstrating inhibition of lipolysis and resistance to loss of fat by G0S2. Excessive G0S2 inhibits lipolysis in vivo during active lipolytic conditions, such as food restriction and fasting, suggesting G0S2 as a potential target for treatment of obesity. In addition, transgenic quail are novel models for studying lipid metabolism and mechanisms of obesity.

  12. Comparative Analysis of gO Isoforms Reveals that Strains of Human Cytomegalovirus Differ in the Ratio of gH/gL/gO and gH/gL/UL128-131 in the Virion Envelope

    PubMed Central

    Zhou, Momei; Yu, Qin; Wechsler, Anya

    2013-01-01

    Herpesvirus glycoprotein complex gH/gL provides a core entry function through interactions with the fusion protein gB and can also influence tropism through receptor interactions. The Epstein-Barr virus gH/gL and gH/gL/gp42 serve both functions for entry into epithelial and B cells, respectively. Human cytomegalovirus (HCMV) gH/gL can be bound by the UL128-131 proteins or gO. The phenotypes of gO and UL128-131 mutants suggest that gO-gH/gL interactions are necessary for the core entry function on all cell types, whereas the binding of UL128-131 to gH/gL likely relates to a distinct receptor-binding function for entry into some specific cell types (e.g., epithelial) but not others (e.g., fibroblasts and neurons). There are at least eight isoforms of gO that differ by 10 to 30% of amino acids, and previous analysis of two HCMV strains suggested that some isoforms of gO function like chaperones, disassociating during assembly to leave unbound gH/gL in the virion envelope, while others remain bound to gH/gL. For the current report, we analyzed the gH/gL complexes present in the virion envelope of several HCMV strains, each of which encodes a distinct gO isoform. Results indicate that all strains of HCMV contain stable gH/gL/gO trimers and gH/gL/UL128-131 pentamers and little, if any, unbound gH/gL. TR, TB40/e, AD169, and PH virions contained vastly more gH/gL/gO than gH/gL/UL128-131, whereas Merlin virions contained mostly gH/gL/UL128-131, despite abundant unbound gO remaining in the infected cells. Suppression of UL128-131 expression during Merlin replication dramatically shifted the ratio toward gH/gL/gO. These data suggest that Merlin gO is less efficient than other gO isoforms at competing with UL128-131 for binding to gH/gL. Thus, gO diversity may influence the pathogenesis of HCMV through effects on the assembly of the core versus tropism gH/gL complexes. PMID:23804643

  13. Photocatalytic Properties of g-C3N4–TiO2 Heterojunctions under UV and Visible Light Conditions

    PubMed Central

    Fagan, Rachel; McCormack, Declan E.; Hinder, Steven J.; Pillai, Suresh C.

    2016-01-01

    Graphitic carbon nitride (g-C3N4) and titanium dioxide (TiO2) were chosen as a model system to investigate photocatalytic abilities of heterojunction system under UV and visible light conditions. The use of g-C3N4 has been shown to be effective in the reduction in recombination through the interaction between the two interfaces of TiO2 and g-C3N4. A simple method of preparing g-C3N4 through the pyrolysis of melamine was employed, which was then added to undoped TiO2 material to form the g-C3N4–TiO2 system. These materials were then fully characterized by X-ray diffraction (XRD), Brunauer Emmett Teller (BET), and various spectroscopic techniques including Raman, X-ray photoelectron spectroscopy (XPS), Fourier transform infrared spectroscopy (FT-IR), diffuse absorbance, and photoluminescence analysis. Photocatalysis studies were conducted using the model dye, rhodamine 6G utilizing visible and UV light irradiation. Raman spectroscopy confirmed that a composite of the materials was formed as opposed to a mixture of the two. Using XPS analysis, a shift in the nitrogen peak to that indicative of substitutional nitrogen was detected for all doped samples. This is then mirrored in the diffuse absorbance results, which show a clear decrease in band gap values for these samples, showing the effective band gap alteration achieved through this preparation process. When g-C3N4–TiO2 samples were analyzed under visible light irradiation, no significant improvement was observed compared that of pure TiO2. However, under UV light irradiation conditions, the photocatalytic ability of the doped samples exhibited an increased reactivity when compared to the undoped TiO2 (0.130 min−1), with 4% g-C3N4–TiO2 (0.187 min−1), showing a 43.9% increase in reactivity. Further doping to 8% g-C3N4–TiO2 lead to a decrease in reactivity against rhodamine 6G. BET analysis determined that the surface area of the 4% and 8% g-C3N4–TiO2 samples were very similar, with values of 29.4 and

  14. KINETIC ENERGY DISTRIBUTION OF H(1s) FROM H{sub 2} X {sup 1}{Sigma}{sup +} {sub g}-a {sup 3}{Sigma}{sup +} {sub g} EXCITATION AND LIFETIMES AND TRANSITION PROBABILITIES OF a {sup 3}{Sigma}{sup +} {sub g}(v, J)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu Xianming; Johnson, Paul V.; Malone, Charles P.

    Dissociative excitation of molecular hydrogen plays an important role in the heating of outer planet upper thermospheres. This paper addresses the role of one of the triplet states involved in the process. H{sub 2} excited to the a {sup 3}{Sigma}{sup +} {sub g} state, or higher triplet-ungerade states, is dissociated via the a {sup 3}{Sigma}{sup +} {sub g}-b {sup 3}{Sigma}{sup +} {sub u} continuum. The kinetic energy distribution of H(1s) produced from direct X {sup 1}{Sigma}{sup +} {sub g}-a {sup 3}{Sigma}{sup +} {sub g}(v, J) excitation by electrons is investigated by an accurate theoretical evaluation of spontaneous transition probabilities ofmore » the a {sup 3}{Sigma}{sup +} {sub g}(v, J)-b {sup 3}{Sigma}{sup +} {sub u} continuum transition. It is shown that the X {sup 1}{Sigma}{sup +} {sub g}(0)-a {sup 3}{Sigma}{sup +} {sub g}(v, J) excitation primarily produces H(1s) atoms with kinetic energies lower than 2 eV. In addition to the continuum a {sup 3}{Sigma}{sup +} {sub g}(v, J)-b {sup 3}{Sigma}{sup +} {sub u} transition probabilities, spontaneous emission lifetimes of the a {sup 3}{Sigma}{sup +} {sub g}(v, J) (v = 0-20, J {<=} 14) levels have been calculated by considering both the a {sup 3}{Sigma}{sup +} {sub g}-b {sup 3}{Sigma}{sup +} {sub u} and a {sup 3}{Sigma}{sup +} {sub g}-c {sup 3}{Pi} {sub u} transitions. The calculated lifetimes show a moderately strong rotational dependence, and the lifetimes for the J = 0 rotational level of the low v levels agree well with previous calculations and experimental measurements. Calculations of the a {sup 3}{Sigma}{sup +} {sub g}-b {sup 3}{Sigma}{sup +} {sub u} continuum emission spectra from electron impact X {sup 1}{Sigma}{sup +} {sub g}-a {sup 3}{Sigma}{sup +} {sub g} excitation are included.« less

  15. THE GALACTIC CENTER CLOUD G2 AND ITS GAS STREAMER

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pfuhl, Oliver; Gillessen, Stefan; Eisenhauer, Frank

    2015-01-10

    We present new, deep near-infrared SINFONI @ VLT integral field spectroscopy of the gas cloud G2 in the Galactic Center, from late 2013 August, 2014 April, and 2014 July. G2 is visible in recombination line emission. The spatially resolved kinematic data track the ongoing tidal disruption. The cloud reached minimum distance to the MBH of 1950 Schwarzschild radii. As expected for an observation near the pericenter passage, roughly half of the gas in 2014 is found at the redshifted, pre-pericenter side of the orbit, while the other half is at the post-pericenter, blueshifted side. We also present an orbital solutionmore » for the gas cloud G1, which was discovered a decade ago in L'-band images when it was spatially almost coincident with Sgr A*. The orientation of the G1 orbit in the three angles is almost identical to that of G2, but it has a lower eccentricity and smaller semi-major axis. We show that the observed astrometric positions and radial velocities of G1 are compatible with the G2 orbit, assuming that (1) G1 was originally on the G2 orbit preceding G2 by 13 yr, and (2) a simple drag force acted on it during pericenter passage. Taken together with the previously described tail of G2, which we detect in recombination line emission and thermal broadband emission, we propose that G2 may be a bright knot in a much more extensive gas streamer. This matches purely gaseous models for G2, such as a stellar wind clump or the tidal debris from a partial disruption of a star.« less

  16. Anti-cancer Activity of Osmanthus matsumuranus Extract by Inducing G2/M Arrest and Apoptosis in Human Hepatocellular Carcinoma Hep G2 Cells

    PubMed Central

    Jin, Soojung; Park, Hyun-Jin; Oh, You Na; Kwon, Hyun Ju; Kim, Jeong-Hwan; Choi, Yung Hyun; Kim, Byung Woo

    2015-01-01

    Background: Osmanthus matsumuranus, a species of Oleaceae, is found in East Asia and Southeast Asia. The bioactivities of O. matsumuranus have not yet been fully understood. Here, we studied on the molecular mechanisms underlying anti-cancer effect of ethanol extract of O. matsumuranus (EEOM). Methods: Inhibitory effect of EEOM on cell growth and proliferation was determined by WST assay in various cancer cells. To investigate the mechanisms of EEOM-mediated cytotoxicity, HepG2 cells were treated with various concentration of EEOM and analyzed the cell cycle arrest and apoptosis induction by flow cytometry, Western blot analysis, 4,6-diamidino-2-phenylindole (DAPI) staining and DNA fragmentation. Results: EEOM showed the cytotoxic activities in a dose-dependent manner in various cancer cell lines but not in normal cells, and HepG2 cells were most susceptible to EEOM-induced cytotoxicity. EEOM induced G2/M arrest in HepG2 cells associated with decreased expression of cyclin-dependent kinase 1 (CDK1), cyclin A and cylcin B, and increased expression of phospho-checkpoint kinase 2, p53 and CDK inhibitor p21. Immunofluorescence staining showed that EEOM-treated HepG2 increased doublet nuclei and condensed actin, resulting in cell rounding. Furthermore, EEOM-mediated apoptosis was determined by Annexin V staining, chromatin condensation and DNA fragmentation. EEOM caused upregulation of FAS and Bax, activation of caspase-3, -8, -9, and fragmentation of poly ADP ribose polymerase. Conclusions: These results suggest that EEOM efficiently inhibits proliferation of HepG2 cells by inducing both G2/M arrest and apoptosis via intrinsic and extrinsic pathways, and EEOM may be used as a cancer chemopreventive agent in the food or nutraceutical industry. PMID:26734586

  17. Association of CTLA-4 gene 49A/G polymorphism with the incidence of type 1 diabetes mellitus in the Iranian Kurdish population.

    PubMed

    Ahmadi, Slahadin; Rostamzadeh, Jalal; Khosravi, Darya; Shariati, Parvin; Shakiba, Nadia

    2013-12-15

    Cytotoxic T-lymphocyte-associated antigen-4 (CTLA-4) has an inhibitory function on T cells and is critical for the induction of peripheral tolerance. CTLA-4 +49 G allele affects the CTLA-4 function and has been reported to be correlated with a higher risk of various autoimmune diseases including type 1 diabetes (T1D). The present study was conducted to investigate the association between the polymorphism of the CTLA-4 exon 1+49 A/G and susceptibility to TID and type 2 diabetes (T2D) in Kurds living in Iranian Kurdistan. The+49 A/G polymorphism was analyzed in 60 patients with T1D, 56 patients with T2D and 107 control subjects using PCR Single-strand Conformation Polymorphism (SSCP) and restriction fragment length polymorphism methods. All studied populations (T1D, T2D and Controls) were in Hardy-Weinberg equilibrium (p, 0.39, 0.94 and 0.89, respectively). Both+49 G allele (p = 0. 015, OR = 1.86) and +49 A/G genotype frequencies (p = 0. 012, OR = 2.31) were significantly higher in T1D patients than control. There was significant over-representation of the G allele in female T1D patients. No significant differences in +49 G allele and +49 A/G genotype frequencies were found between T2D and control subjects. SSCP analysis did not show new mutation in the amplified segment. The results of this study indicate that CTLA-4+49 A/G gene polymorphism confers genetic susceptibility to T1D but not T2D in the Kurdish population living in Iranian Kurdistan and women carrying the +49 G allele are at greater risk of getting T1D than men having the G allele.

  18. Enzymatic Formation of G-Group Aflatoxins and Biosynthetic Relationship between G- and B-Group Aflatoxins

    PubMed Central

    Yabe, Kimiko; Nakamura, Miki; Hamasaki, Takashi

    1999-01-01

    We detected biosynthetic activity for aflatoxins G1 and G2 in cell extracts of Aspergillus parasiticus NIAH-26. We found that in the presence of NADPH, aflatoxins G1 and G2 were produced from O-methylsterigmatocystin and dihydro-O-methylsterigmatocystin, respectively. No G-group aflatoxins were produced from aflatoxin B1, aflatoxin B2, 5-methoxysterigmatocystin, dimethoxysterigmatocystin, or sterigmatin, confirming that B-group aflatoxins are not the precursors of G-group aflatoxins and that G- and B-group aflatoxins are independently produced from the same substrates (O-methylsterigmatocystin and dihydro-O-methylsterigmatocystin). In competition experiments in which the cell-free system was used, formation of aflatoxin G2 from dihydro-O-methylsterigmatocystin was suppressed when O-methylsterigmatocystin was added to the reaction mixture, whereas aflatoxin G1 was newly formed. This result indicates that the same enzymes can catalyze the formation of aflatoxins G1 and G2. Inhibition of G-group aflatoxin formation by methyrapone, SKF-525A, or imidazole indicated that a cytochrome P-450 monooxygenase may be involved in the formation of G-group aflatoxins. Both the microsome fraction and a cytosol protein with a native mass of 220 kDa were necessary for the formation of G-group aflatoxins. Due to instability of the microsome fraction, G-group aflatoxin formation was less stable than B-group aflatoxin formation. The ordA gene product, which may catalyze the formation of B-group aflatoxins, also may be required for G-group aflatoxin biosynthesis. We concluded that at least three reactions, catalyzed by the ordA gene product, an unstable microsome enzyme, and a 220-kDa cytosol protein, are involved in the enzymatic formation of G-group aflatoxins from either O-methylsterigmatocystin or dihydro-O-methylsterigmatocystin. PMID:10473388

  19. Effectiveness of monovalent rotavirus vaccine (Rotarix) against severe diarrhea caused by serotypically unrelated G2P[4] strains in Brazil.

    PubMed

    Correia, Jailson B; Patel, Manish M; Nakagomi, Osamu; Montenegro, Fernanda M U; Germano, Eliane M; Correia, Nancy B; Cuevas, Luis E; Parashar, Umesh D; Cunliffe, Nigel A; Nakagomi, Toyoko

    2010-02-01

    BACKGROUND. In a Latin American trial, a monovalent G1P[8] rotavirus vaccine showed high efficacy against severe rotavirus diarrhea. Protection was lower against serotypically unrelated G2P[4] strains, which circulated infrequently. This case-control study was undertaken to assess the effectiveness of this monovalent G1P[8] rotavirus vaccine against G2P[4] strains in Brazil. METHODS. Case patients were children with severe G2P[4] rotavirus diarrhea who presented at a hospital in Recife, Brazil, from March 2006 through September 2008. Vaccination rates among case patients were compared with rates among 2 groups of control participants-children with rotavirus-negative diarrhea and children admitted for acute respiratory tract infection (ARI)-to calculate vaccine effectiveness, after controlling for the birth month and year. RESULTS. We enrolled 70 G2P[4] rotavirus-positive case patients with severe diarrhea, 484 rotavirus-negative control participants with diarrhea, and 416 control participants with ARI, aged 6 months. Among children aged 6-11 months, the effectiveness of the vaccine against G2P[4] diarrhea was 77% (95% confidence interval [CI], 42%-91%) and 77% (95% CI, 43%-90%) among the rotavirus-negative control participants with diarrhea and control participants with ARI, respectively. Vaccine effectiveness in children aged 12 months decreased to -24% (95% CI, -190% to 47%) and 15% (95% CI, -101 to 64) among the rotavirus-negative control groups with diarrhea and ARI, respectively. CONCLUSIONS. This monovalent G1P[8] rotavirus vaccine was effective against severe G2P[4] rotavirus diarrhea among children aged 6-11 months. Effectiveness declined among children aged 12 months, which suggests waning immunity.

  20. Joint effect of MCP-1 genotype GG and MMP-1 genotype 2G/2G increases the likelihood of developing pulmonary tuberculosis in BCG-vaccinated individuals.

    PubMed

    Ganachari, Malathesha; Ruiz-Morales, Jorge A; Gomez de la Torre Pretell, Juan C; Dinh, Jeffrey; Granados, Julio; Flores-Villanueva, Pedro O

    2010-01-25

    We previously reported that the -2518 MCP-1 genotype GG increases the likelihood of developing tuberculosis (TB) in non-BCG-vaccinated Mexicans and Koreans. Here, we tested the hypothesis that this genotype, alone or together with the -1607 MMP-1 functional polymorphism, increases the likelihood of developing TB in BCG-vaccinated individuals. We conducted population-based case-control studies of BCG-vaccinated individuals in Mexico and Peru that included 193 TB cases and 243 healthy tuberculin-positive controls from Mexico and 701 TB cases and 796 controls from Peru. We also performed immunohistochemistry (IHC) analysis of lymph nodes from carriers of relevant two-locus genotypes and in vitro studies to determine how these variants may operate to increase the risk of developing active disease. We report that a joint effect between the -2518 MCP-1 genotype GG and the -1607 MMP-1 genotype 2G/2G consistently increases the odds of developing TB 3.59-fold in Mexicans and 3.9-fold in Peruvians. IHC analysis of lymph nodes indicated that carriers of the two-locus genotype MCP-1 GG MMP-1 2G/2G express the highest levels of both MCP-1 and MMP-1. Carriers of these susceptibility genotypes might be at increased risk of developing TB because they produce high levels of MCP-1, which enhances the induction of MMP-1 production by M. tuberculosis-sonicate antigens to higher levels than in carriers of the other two-locus MCP-1 MMP-1 genotypes studied. This notion was supported by in vitro experiments and luciferase based promoter activity assay. MMP-1 may destabilize granuloma formation and promote tissue damage and disease progression early in the infection. Our findings may foster the development of new and personalized therapeutic approaches targeting MCP-1 and/or MMP-1.

  1. Joint Effect of MCP-1 Genotype GG and MMP-1 Genotype 2G/2G Increases the Likelihood of Developing Pulmonary Tuberculosis in BCG-Vaccinated Individuals

    PubMed Central

    Ganachari, Malathesha; Ruiz-Morales, Jorge A.; Gomez de la Torre Pretell, Juan C.; Dinh, Jeffrey; Granados, Julio; Flores-Villanueva, Pedro O.

    2010-01-01

    We previously reported that the – 2518 MCP-1 genotype GG increases the likelihood of developing tuberculosis (TB) in non-BCG-vaccinated Mexicans and Koreans. Here, we tested the hypothesis that this genotype, alone or together with the – 1607 MMP-1 functional polymorphism, increases the likelihood of developing TB in BCG-vaccinated individuals. We conducted population-based case-control studies of BCG-vaccinated individuals in Mexico and Peru that included 193 TB cases and 243 healthy tuberculin-positive controls from Mexico and 701 TB cases and 796 controls from Peru. We also performed immunohistochemistry (IHC) analysis of lymph nodes from carriers of relevant two-locus genotypes and in vitro studies to determine how these variants may operate to increase the risk of developing active disease. We report that a joint effect between the – 2518 MCP-1 genotype GG and the – 1607 MMP-1 genotype 2G/2G consistently increases the odds of developing TB 3.59-fold in Mexicans and 3.9-fold in Peruvians. IHC analysis of lymph nodes indicated that carriers of the two-locus genotype MCP-1 GG MMP-1 2G/2G express the highest levels of both MCP-1 and MMP-1. Carriers of these susceptibility genotypes might be at increased risk of developing TB because they produce high levels of MCP-1, which enhances the induction of MMP-1 production by M. tuberculosis-sonicate antigens to higher levels than in carriers of the other two-locus MCP-1 MMP-1 genotypes studied. This notion was supported by in vitro experiments and luciferase based promoter activity assay. MMP-1 may destabilize granuloma formation and promote tissue damage and disease progression early in the infection. Our findings may foster the development of new and personalized therapeutic approaches targeting MCP-1 and/or MMP-1. PMID:20111728

  2. Serum immunoglobulin G4 levels and Graves' disease phenotype.

    PubMed

    Martin, Carmen Sorina; Sirbu, Anca Elena; Betivoiu, Minodora Andreea; Florea, Suzana; Barbu, Carmen Gabriela; Fica, Simona Vasilica

    2017-02-01

    We investigated, at diagnosis, the relationship between serum immunoglobulin G4 levels and the main characteristics of Graves' disease: hyperthyroidism severity, goiter size, presence of active Graves' ophthalmopathy, antithyroid antibodies status, and titer. This prospective study included 80 newly diagnosed Graves' disease patients. The main parameters measured at diagnosis: thyroid-stimulating hormone, free thyroxine, free triiodothyronine, total triiodothyronine, thyroglobulin, antithyroid peroxidase antibodies, anti-thyroglobulin antibodies, thyroid-stimulating hormone receptor antibodies, immunoglobulin G4. In Graves' disease patients, serum immunoglobulin G4 levels were higher than in general population (p = 0.028) and higher in men compared to women (p = 0.002). Only one female patient with intense hypoechoic goiter, high anti-thyroglobulin antibody, and antithyroid peroxidase antibody titers had an elevated serum immunoglobulin G4 level at diagnosis. Patients with immunoglobulin G4 levels above the 75th percentile (>237.52 mg/dl, N = 20) were younger at Graves' ophthalmopathy onset (p < 0.001), had higher antithyroid peroxidase antibody (p = 0.01), and anti-thyroglobulin antibody levels (p = 0.006) and required shorter duration of the first methimazole treatment cycle (p = 0.041) than patients with immunoglobulin G4 below the 75th percentile. At diagnosis, patients with immunoglobulin G4 levels above the 90th percentile (>286.28 mg/dl, N = 8) had lower total triiodothyronine values (p = 0.001) than patients with IgG below the 90th percentile. No significant correlations were found between smoking status (p = 0.58), goiter size (p = 0.50), the presence of ophthalmopathy (p = 0.42) or thyroid-stimulating hormone receptor antibody titers (p = 0.45) and the mean value of immunoglobulin G4 levels at diagnosis. Our data suggest that Graves' disease patients with elevated immunoglobulin G4 levels at

  3. Black TiO2 nanobelts/g-C3N4 nanosheets Laminated Heterojunctions with Efficient Visible-Light-Driven Photocatalytic Performance

    PubMed Central

    Shen, Liyan; Xing, Zipeng; Zou, Jinlong; Li, Zhenzi; Wu, Xiaoyan; Zhang, Yuchi; Zhu, Qi; Yang, Shilin; Zhou, Wei

    2017-01-01

    Black TiO2 nanobelts/g-C3N4 nanosheets laminated heterojunctions (b-TiO2/g-C3N4) as visible-light-driven photocatalysts are fabricated through a simple hydrothermal-calcination process and an in-situ solid-state chemical reduction approach, followed by the mild thermal treatment (350 °C) in argon atmosphere. The prepared samples are evidently investigated by X-ray diffraction, Fourier transform infrared spectroscopy, scanning electron microscopy, transmission electron microscopy, X-ray photoelectron spectroscopy, N2 adsorption, and UV-visible diffuse reflectance spectroscopy, respectively. The results show that special laminated heterojunctions are formed between black TiO2 nanobelts and g-C3N4 nanosheets, which favor the separation of photogenerated electron-hole pairs. Furthermore, the presence of Ti3+ and g-C3N4 greatly enhance the absorption of visible light. The resultant b-TiO2/g-C3N4 materials exhibit higher photocatalytic activity than that of g-C3N4, TiO2, b-TiO2 and TiO2/g-C3N4 for degradation of methyl orange (95%) and hydrogen evolution (555.8 μmol h−1 g−1) under visible light irradiation. The apparent reaction rate constant (k) of b-TiO2/g-C3N4 is ~9 times higher than that of pristine TiO2. Therefore, the high-efficient laminated heterojunction composites will have potential applications in fields of environment and energy. PMID:28165021

  4. G protein, phosphorylated-GATA4 and VEGF expression in the hearts of transgenic mice overexpressing β1- and β2-adrenergic receptors

    PubMed Central

    Tae, Hyun-Jin; Petrashevskaya, Natalia; Kim, In Hye; Park, Joon Ha; Lee, Jae-Chul; Won, Moo-Ho; Kim, Yang Hee; Ahn, Ji Hyeon; Park, Jinseu; Choi, Soo Young; Jeon, Yong Hwan

    2017-01-01

    β1- and β2-adrenergic receptors (ARs) regulate cardiac contractility, calcium handling and protein phosphorylation. The present study aimed to examine the expression levels of vascular endothelial growth factor A (VEGF-A) and several G proteins, and the phosphorylation of transcription factor GATA binding protein 4 (GATA4), by western blot analysis, using isolated hearts from 6 month-old transgenic (TG) mice that overexpress β1AR or β2AR. Cardiac contractility/relaxation and heart rate was increased in both β1AR TG and β2AR TG mouse hearts compared with wild type; however, no significant differences were observed between the β1- and β2AR TG mouse hearts. Protein expression levels of inhibitory guanine nucleotide-binding protein (Gi) 2, Gi3 and G-protein-coupled receptor kinase 2 were upregulated in both TG mice, although the upregulation of Gi2 was more prominent in the β2AR TG mice. VEGF-A expression levels were also increased in both TG mice, and were highest in the β1AR TG mice. In addition, the levels of phosphorylated-GATA4 expression were increased in β1- and β2AR TG mice. In conclusion, the present study demonstrated that cardiac contractility/relaxation and heart rate is increased in β1AR TG and β2AR TG mice, and indicated that this increase may be related to the overexpression of G proteins and G-protein-associated proteins. PMID:28487987

  5. Estimation of polyclonal IgG4 hybrids in normal human serum.

    PubMed

    Young, Elizabeth; Lock, Emma; Ward, Douglas G; Cook, Alexander; Harding, Stephen; Wallis, Gregg L F

    2014-07-01

    The in vivo or in vitro formation of IgG4 hybrid molecules, wherein the immunoglobulins have exchanged half molecules, has previously been reported under experimental conditions. Here we estimate the incidence of polyclonal IgG4 hybrids in normal human serum and comment on the existence of IgG4 molecules with different immunoglobulin light chains. Polyclonal IgG4 was purified from pooled or individual donor human sera and sequentially fractionated using light-chain affinity and size exclusion chromatography. Fractions were analysed by SDS-PAGE, immunoblotting, ELISA, immunodiffusion and matrix-assisted laser-desorption mass spectrometry. Polyclonal IgG4 purified from normal serum contained IgG4κ, IgG4λ and IgG4κ/λ molecules. Size exclusion chromatography showed that IgG4 was principally present in monomeric form (150 000 MW). SDS-PAGE, immunoblotting and ELISA showed the purity of the three IgG4 samples. Immunodiffusion, light-chain sandwich ELISA and mass spectrometry demonstrated that both κ and λ light chains were present on only the IgG4κ/λ molecules. The amounts of IgG4κ/λ hybrid molecules ranged from 21 to 33% from the five sera analysed. Based on the molecular weight these molecules were formed of two IgG4 heavy chains plus one κ and one λ light chain. Polyclonal IgG (IgG4-depleted) was similarly fractionated according to light-chain specificity. No evidence of hybrid IgG κ/λ antibodies was observed. These results indicate that hybrid IgG4κ/λ antibodies compose a substantial portion of IgG4 from normal human serum. © 2014 John Wiley & Sons Ltd.

  6. 30 CFR 251.4 - Types of G&G activities that require permits or Notices.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ...) Scientific research. You may only conduct G&G scientific research related to oil, gas, and sulphur in the OCS...) Notice. Any other G&G scientific research that you conduct related to oil, gas, and sulphur in the OCS... research activities you propose to conduct involve: (i) Using solid or liquid explosives; (ii) Drilling a...

  7. Preliminary characterisation of new glass reference materials (GSA-1G, GSC-1G, GSD-1G and GSE-1G) by laser ablation-inductively coupled plasma-mass spectrometry using 193 nm, 213 nm and 266 nm wavelengths

    USGS Publications Warehouse

    Guillong, M.; Hametner, K.; Reusser, E.; Wilson, S.A.; Gunther, D.

    2005-01-01

    New glass reference materials GSA-1G, GSC-1G, GSD-1G and GSE-1G have been characterised using a prototype solid state laser ablation system capable of producing wavelengths of 193 nm, 213 nm and 266 nm. This system allowed comparison of the effects of different laser wavelengths under nearly identical ablation and ICP operating conditions. The wavelengths 213 nm and 266 nm were also used at higher energy densities to evaluate the influence of energy density on quantitative analysis. In addition, the glass reference materials were analysed using commercially available 266 nm Nd:YAG and 193 nm ArF excimer lasers. Laser ablation analysis was carried out using both single spot and scanning mode ablation. Using laser ablation ICP-MS, concentrations of fifty-eight elements were determined with external calibration to the NIST SRM 610 glass reference material. Instead of applying the more common internal standardisation procedure, the total concentration of all element oxide concentrations was normalised to 100%. Major element concentrations were compared with those determined by electron microprobe. In addition to NIST SRM 610 for external calibration, USGS BCR-2G was used as a more closely matrix-matched reference material in order to compare the effect of matrix-matched and non matrix-matched calibration on quantitative analysis. The results show that the various laser wavelengths and energy densities applied produced similar results, with the exception of scanning mode ablation at 266 nm without matrix-matched calibration where deviations up to 60% from the average were found. However, results acquired using a scanning mode with a matrix-matched calibration agreed with results obtained by spot analysis. The increased abundance of large particles produced when using a scanning ablation mode with NIST SRM 610, is responsible for elemental fractionation effects caused by incomplete vaporisation of large particles in the ICP.

  8. Selective cytotoxicity of PAMAM G5 core–PAMAM G2.5 shell tecto-dendrimers on melanoma cells

    PubMed Central

    Schilrreff, Priscila; Mundiña-Weilenmann, Cecilia; Romero, Eder Lilia; Morilla, Maria Jose

    2012-01-01

    Background The controlled introduction of covalent linkages between dendrimer building blocks leads to polymers of higher architectural order known as tecto-dendrimers. Because of the few simple steps involved in their synthesis, tecto-dendrimers could expand the portfolio of structures beyond commercial dendrimers, due to the absence of synthetic drawbacks (large number of reaction steps, excessive monomer loading, and lengthy chromatographic separations) and structural constraints of high-generation dendrimers (reduction of good monodispersity and ideal dendritic construction due to de Gennes dense-packing phenomenon). However, the biomedical uses of tecto-dendrimers remain unexplored. In this work, after synthesizing saturated shell core–shell tecto-dendrimers using amine-terminated polyamidoamine (PAMAM) generation 5 (G5) as core and carboxyl-terminated PAMAM G2.5 as shell (G5G2.5 tecto-dendrimers), we surveyed for the first time the main features of their interaction with epithelial cells. Methods Structural characterization of G5G2.5 was performed by polyacrylamide gel electrophoresis, matrix-assisted laser desorption time-of-flight mass spectrometry, and microscopic techniques; their hydrodynamic size and Z-potential was also determined. Cellular uptake by human epidermal keratinocytes, colon adenocarcinoma, and epidermal melanoma (SK-Mel-28) cells was determined by flow cytometry. Cytotoxicity was determined by mitochondrial activity, lactate dehydrogenase release, glutathione depletion, and apoptosis/necrosis measurement. Results The resultant 60%–67% saturated shell, 87,000-dalton G5G2.5 (mean molecular weight) interacted with cells in a significantly different fashion in comparison to their building blocks and to its closest counterpart, PAMAM G6.5. After being actively taken up by epithelial cells, G5G2.5 caused cytotoxicity only on SK-Mel-28 cells, including depletion of intracellular glutathione and fast necrosis that was manifested above 5 μM G5

  9. Whole exome sequencing of rare variants in EIF4G1 and VPS35 in Parkinson disease

    PubMed Central

    Nuytemans, Karen; Bademci, Guney; Inchausti, Vanessa; Dressen, Amy; Kinnamon, Daniel D.; Mehta, Arpit; Wang, Liyong; Züchner, Stephan; Beecham, Gary W.; Martin, Eden R.; Scott, William K.

    2013-01-01

    Objective: Recently, vacuolar protein sorting 35 (VPS35) and eukaryotic translation initiation factor 4 gamma 1 (EIF4G1) have been identified as 2 causal Parkinson disease (PD) genes. We used whole exome sequencing for rapid, parallel analysis of variations in these 2 genes. Methods: We performed whole exome sequencing in 213 patients with PD and 272 control individuals. Those rare variants (RVs) with <5% frequency in the exome variant server database and our own control data were considered for analysis. We performed joint gene-based tests for association using RVASSOC and SKAT (Sequence Kernel Association Test) as well as single-variant test statistics. Results: We identified 3 novel VPS35 variations that changed the coded amino acid (nonsynonymous) in 3 cases. Two variations were in multiplex families and neither segregated with PD. In EIF4G1, we identified 11 (9 nonsynonymous and 2 small indels) RVs including the reported pathogenic mutation p.R1205H, which segregated in all affected members of a large family, but also in 1 unaffected 86-year-old family member. Two additional RVs were found in isolated patients only. Whereas initial association studies suggested an association (p = 0.04) with all RVs in EIF4G1, subsequent testing in a second dataset for the driving variant (p.F1461) suggested no association between RVs in the gene and PD. Conclusions: We confirm that the specific EIF4G1 variation p.R1205H seems to be a strong PD risk factor, but is nonpenetrant in at least one 86-year-old. A few other select RVs in both genes could not be ruled out as causal. However, there was no evidence for an overall contribution of genetic variability in VPS35 or EIF4G1 to PD development in our dataset. PMID:23408866

  10. Hetero-oligomeric Complex between the G Protein-coupled Estrogen Receptor 1 and the Plasma Membrane Ca2+-ATPase 4b*

    PubMed Central

    Tran, Quang-Kim; VerMeer, Mark; Burgard, Michelle A.; Hassan, Ali B.; Giles, Jennifer

    2015-01-01

    The new G protein-coupled estrogen receptor 1 (GPER/GPR30) plays important roles in many organ systems. The plasma membrane Ca2+-ATPase (PMCA) is essential for removal of cytoplasmic Ca2+ and for shaping the time courses of Ca2+-dependent activities. Here, we show that PMCA and GPER/GPR30 physically interact and functionally influence each other. In primary endothelial cells, GPER/GPR30 agonist G-1 decreases PMCA-mediated Ca2+ extrusion by promoting PMCA tyrosine phosphorylation. GPER/GPR30 overexpression decreases PMCA activity, and G-1 further potentiates this effect. GPER/GPR30 knockdown increases PMCA activity, whereas PMCA knockdown substantially reduces GPER/GPR30-mediated phosphorylation of the extracellular signal-related kinase (ERK1/2). GPER/GPR30 co-immunoprecipitates with PMCA with or without treatment with 17β-estradiol, thapsigargin, or G-1. Heterologously expressed GPER/GPR30 in HEK 293 cells co-localizes with PMCA4b, the main endothelial PMCA isoform. Endothelial cells robustly express the PDZ post-synaptic density protein (PSD)-95, whose knockdown reduces the association between GPER/GPR30 and PMCA. Additionally, the association between PMCA4b and GPER/GPR30 is substantially reduced by truncation of either or both of their C-terminal PDZ-binding motifs. Functionally, inhibition of PMCA activity is significantly reduced by truncation of GPER/GPR30's C-terminal PDZ-binding motif. These data strongly indicate that GPER/GPR30 and PMCA4b form a hetero-oligomeric complex in part via the anchoring action of PSD-95, in which they constitutively affect each other's function. Activation of GPER/GPR30 further inhibits PMCA activity through tyrosine phosphorylation of the pump. These interactions represent cross-talk between Ca2+ signaling and GPER/GPR30-mediated activities. PMID:25847233

  11. Hetero-oligomeric Complex between the G Protein-coupled Estrogen Receptor 1 and the Plasma Membrane Ca2+-ATPase 4b.

    PubMed

    Tran, Quang-Kim; VerMeer, Mark; Burgard, Michelle A; Hassan, Ali B; Giles, Jennifer

    2015-05-22

    The new G protein-coupled estrogen receptor 1 (GPER/GPR30) plays important roles in many organ systems. The plasma membrane Ca(2+)-ATPase (PMCA) is essential for removal of cytoplasmic Ca(2+) and for shaping the time courses of Ca(2+)-dependent activities. Here, we show that PMCA and GPER/GPR30 physically interact and functionally influence each other. In primary endothelial cells, GPER/GPR30 agonist G-1 decreases PMCA-mediated Ca(2+) extrusion by promoting PMCA tyrosine phosphorylation. GPER/GPR30 overexpression decreases PMCA activity, and G-1 further potentiates this effect. GPER/GPR30 knockdown increases PMCA activity, whereas PMCA knockdown substantially reduces GPER/GPR30-mediated phosphorylation of the extracellular signal-related kinase (ERK1/2). GPER/GPR30 co-immunoprecipitates with PMCA with or without treatment with 17β-estradiol, thapsigargin, or G-1. Heterologously expressed GPER/GPR30 in HEK 293 cells co-localizes with PMCA4b, the main endothelial PMCA isoform. Endothelial cells robustly express the PDZ post-synaptic density protein (PSD)-95, whose knockdown reduces the association between GPER/GPR30 and PMCA. Additionally, the association between PMCA4b and GPER/GPR30 is substantially reduced by truncation of either or both of their C-terminal PDZ-binding motifs. Functionally, inhibition of PMCA activity is significantly reduced by truncation of GPER/GPR30's C-terminal PDZ-binding motif. These data strongly indicate that GPER/GPR30 and PMCA4b form a hetero-oligomeric complex in part via the anchoring action of PSD-95, in which they constitutively affect each other's function. Activation of GPER/GPR30 further inhibits PMCA activity through tyrosine phosphorylation of the pump. These interactions represent cross-talk between Ca(2+) signaling and GPER/GPR30-mediated activities. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. Exposure of Piglets to Enteroviruses Investigated by an Immunoassay Based on the EV-G1 VP4 Peptide.

    PubMed

    Benkahla, Mehdi A; Sane, Famara; Desailloud, Rachel; Hober, Didier

    2016-01-01

    The aim of this study was to investigate the exposure of piglets to enteroviruses-G (EV-G) through the presence of antibodies in their serum. Serum samples were obtained from the vena cava of 10 piglets at 9 weeks of age and again 39 days later (day 39). They were tested using an immunoassay based on the EV-G1 VP4 peptide, since VP4 is highly conserved among the four Enterovirus capsid proteins, and by using a seroneutralization assay. For each serum collected on day 39 the optical density was high compared to the value obtained in serum collected earlier (p = 0.002). However, the titers of anti-EV-G1 serum neutralizing activity were not different in paired samples (p > 0.999). The sequence alignment of the EV-G1 VP4 peptide, encompassing 50 amino acids, used in the immunoassay showed 88% homology with EV-G, suggesting that antibodies directed toward other EV-G than EV-G1 may be detected. An immunoassay based on EV-G1 VP4 can detect an increased level of EV-G antibodies in piglet serum samples. Further studies are needed to determine whether this immunoassay may be useful for diagnosis and/or epidemiological studies and to monitor EV-G infection in pigs to evaluate strategies aimed to prevent enterovirus infections. © 2016 S. Karger AG, Basel.

  13. G5G2.5 core-shell tecto-dendrimer specifically targets reactive glia in brain ischemia.

    PubMed

    Murta, Veronica; Schilrreff, Priscila; Rosciszewski, Gerardo; Morilla, Maria Jose; Ramos, Alberto Javier

    2018-03-01

    Secondary neuronal death is a serious stroke complication. This process is facilitated by the conversion of glial cells to the reactive pro-inflammatory phenotype that induces neurodegeneration. Therefore, regulation of glial activation is a compelling strategy to reduce brain damage after stroke. However, drugs have difficulties to access the CNS, and to specifically target glial cells. In the present work, we explored the use core-shell polyamidoamine tecto-dendrimer (G5G2.5 PAMAM) and studied its ability to target distinct populations of stroke-activated glial cells. We found that G5G2.5 tecto-dendrimer is actively engulfed by primary glial cells in a time- and dose-dependent manner showing high cellular selectivity and lysosomal localization. In addition, oxygen-glucose deprivation or lipopolysaccharides exposure in vitro and brain ischemia in vivo increase glial G5G2.5 uptake; not being incorporated by neurons or other cell types. We conclude that G5G2.5 tecto-dendrimer is a highly suitable carrier for targeted drug delivery to reactive glial cells in vitro and in vivo after brain ischemia. © 2017 International Society for Neurochemistry.

  14. Ab initio and transition state theory study of the OH + HO2 → H2O + O2(3Σg-)/O2(1Δg) reactions: yield and role of O2(1Δg) in H2O2 decomposition and in combustion of H2.

    PubMed

    Monge-Palacios, M; Sarathy, S Mani

    2018-02-07

    Reactions of hydroxyl (OH) and hydroperoxyl (HO 2 ) are important for governing the reactivity of combustion systems. We performed post-CCSD(T) ab initio calculations at the W3X-L//CCSD = FC/cc-pVTZ level to explore the triplet ground-state and singlet excited-state potential energy surfaces of the OH + HO 2 → H 2 O + O 2 ( 3 Σ g - )/O 2 ( 1 Δ g ) reactions. Using microcanonical and multistructural canonical transition state theories, we calculated the rate constant for the triplet and singlet channels over the temperature range 200-2500 K, represented by k(T) = 3.08 × 10 12 T 0.07  exp(1151/RT) + 8.00 × 10 12 T 0.32  exp(-6896/RT) and k(T) = 2.14 × 10 6 T 1.65  exp(-2180/RT) in cm 3 mol -1 s -1 , respectively. The branching ratios show that the yield of singlet excited oxygen is small (<0.5% below 1000 K). To ascertain the importance of singlet oxygen channel, our new kinetic information was implemented into the kinetic model for hydrogen combustion recently updated by Konnov (Combust. Flame, 2015, 162, 3755-3772). The updated kinetic model was used to perform H 2 O 2 thermal decomposition simulations for comparison against shock tube experiments performed by Hong et al. (Proc. Combust. Inst., 2013, 34, 565-571), and to estimate flame speeds and ignition delay times in H 2 mixtures. The simulation predicted a larger amount of O 2 ( 1 Δ g ) in H 2 O 2 decomposition than that predicted by Konnov's original model. These differences in the O 2 ( 1 Δ g ) yield are due to the use of a higher ab initio level and a more sophisticated methodology to compute the rate constant than those used in previous studies, thereby predicting a significantly larger rate constant. No effect was observed on the rate of the H 2 O 2 decomposition and on the flame speeds and ignition delay times of different H 2 -oxidizer mixtures. However, if the oxidizer is seeded with O 3 , small differences appear in the flame speed. Given that O 2 ( 1 Δ g ) is much more reactive than O

  15. Activation of p21-Dependent G1/G2 Arrest in the Absence of DNA Damage as an Antiapoptotic Response to Metabolic Stress

    PubMed Central

    Hoeferlin, L. Alexis; Oleinik, Natalia V.; Krupenko, Natalia I.

    2011-01-01

    The folate enzyme, FDH (10-formyltetrahydrofolate dehydrogenase, ALDH1L1), a metabolic regulator of proliferation, activates p53-dependent G1 arrest and apoptosis in A549 cells. In the present study, we have demonstrated that FDH-induced apoptosis is abrogated upon siRNA knockdown of the p53 downstream target PUMA. Conversely, siRNA knockdown of p21 eliminated FDH-dependent G1 arrest and resulted in an early apoptosis onset. The acceleration of FDH-dependent apoptosis was even more profound in another cell line, HCT116, in which the p21 gene was silenced through homologous recombination (p21−/− cells). In contrast to A549 cells, FDH caused G2 instead of G1 arrest in HCT116 p21+/+ cells; such an arrest was not seen in p21-deficient (HCT116 p21−/−) cells. In agreement with the cell cycle regulatory function of p21, its strong accumulation in nuclei was seen upon FDH expression. Interestingly, our study did not reveal DNA damage upon FDH elevation in either cell line, as judged by comet assay and the evaluation of histone H2AX phosphorylation. In both A549 and HCT116 cell lines, FDH induced a strong decrease in the intracellular ATP pool (2-fold and 30-fold, respectively), an indication of a decrease in de novo purine biosynthesis as we previously reported. The underlying mechanism for the drop in ATP was the strong decrease in intracellular 10-formyltetrahydrofolate, a substrate in two reactions of the de novo purine pathway. Overall, we have demonstrated that p21 can activate G1 or G2 arrest in the absence of DNA damage as a response to metabolite deprivation. In the case of FDH-related metabolic alterations, this response delays apoptosis but is not sufficient to prevent cell death. PMID:22593801

  16. 78 FR 8191 - Certain Wireless Devices With 3G and/or 4G Capabilities and Components Thereof; Institution of...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-02-05

    ... INTERNATIONAL TRADE COMMISSION [Investigation No. 337-TA-868] Certain Wireless Devices With 3G and... importation, and the sale within the United States after importation of certain wireless devices with 3G and... devices with 3G and/or 4G capabilities and components thereof by reason of infringement of one or more of...

  17. Fibrosing variant of Hashimoto thyroiditis is an IgG4 related disease.

    PubMed

    Deshpande, Vikram; Huck, Amelia; Ooi, Esther; Stone, John H; Faquin, William C; Nielsen, G Petur

    2012-08-01

    Hashimoto thyroiditis (HT) and the fibrosing variant of Hashimoto thyroiditis (FVHT) are immune-mediated tumefactive lesions of the thyroid. Immunoglobulin G4-related disease (IgG4-RD) is now a widely recognised multi-organ system disease characterised by elevated serum and tissue concentrations of IgG4. In this study, the authors address several unresolved questions pertaining to the relationship between HT and FVHT, and the association of each of these diseases with IgG4-RD. The authors evaluated 28 consecutive cases of HT and nine cases of FVHT. The clinical, demographic and serological data were recorded. The slides were stained immunohistochemically using antibodies to IgG4 and IgG and the quantitative analysis was recorded. Data on thyroid function tests were available on seven cases of FVHT and 14 cases of HT. Based on the availability of data, hypothyroidism was noted in 62% (9/14) of HT and 86% of FVHT (6/7). FVHT demonstrated an exaggerated lobular pattern with lobules separated by cellular storiform-type fibrosis, resembling fibrosis seen in other forms of IgG-RD. The median IgG4 counts per high power field (×40) in HT and FVHT were 2.3 and 22, respectively. The median IgG4:IgG ratios in HT and FVHT were 0.11 and 0.58, respectively. The authors propose that FVHT belongs to the spectrum of IgG4-RD. Although a proportion of cases of HT show elevated numbers of IgG4 positive plasma cells, these cases lack the histological features typically associated with IgG4-RD, and thus the relationship between HT and IgG4-RD remains unproven.

  18. Fabrication of 2D SnS2/g-C3N4 heterojunction with enhanced H2 evolution during photocatalytic water splitting.

    PubMed

    Liu, Enzhou; Chen, Jibing; Ma, Yongning; Feng, Juan; Jia, Jia; Fan, Jun; Hu, Xiaoyun

    2018-08-15

    In this work, the 2D SnS 2 /g-C 3 N 4 heterojunctions were successfully prepared by heating the homogeneous dispersion of SnS 2 nanosheets and g-C 3 N 4 nanosheets using a microwave muffle. SEM, TEM and HRTEM images indicated that the SnS 2 nanosheets were loaded on the surface of the g-C 3 N 4 nanosheets. The UV-vis spectra show that the absorption intensity of the as-prepared samples was increased and the absorption range was also extended from 420 nm to approximately 600 nm. The H 2 production rate over 5 wt% SnS 2 /g-C 3 N 4 can reach 972.6 μmol·h -1 ·g -1 under visible light irradiation (λ > 420 nm) using TEOA as the sacrifice agent and Pt as the electron trap, which is 2.9 and 25.6 times higher than those of the pristine g-C 3 N 4 and SnS 2 , respectively. According to the obtained PL spectra, photocurrent and EIS spectra, the enhanced performance for H 2 generation over the heterojunctions is primarily ascribed to the rapid charge transfer arising from the suitable band gap positions leading to an improved photocatalytic performance. The recycling experiments indicated that the as-prepared composites exhibit good stability in H 2 production. Additionally, a possible enhanced mechanism for H 2 evolution was deduced based on the results obtained by various characterization techniques. Copyright © 2018 Elsevier Inc. All rights reserved.

  19. Observation of the spin-orbit components of the 3B 2g( 3A 2g) ground state in the system Ni 2+:MgF 2 by fluorescence line narrowing

    NASA Astrophysics Data System (ADS)

    Tonucci, R. J.; Jacobsen, S. M.; Yen, W. M.

    1990-10-01

    Using a tunable narrow-band infrared laser, we demonstrate for the first time infrared-fluorescnece line narrowing in the system Ni 2+:MgF 2. High-resolution emission spectra were obtained by pumping the lowest spin-orbit component B 3 ( 3T 2g) (orthorhombic notation with octahedral notation in parentheses) of the 3T 2g multiplet and observing the B 3( 3T 2g)→B 1, A, B 2( 3A 2g) luminescent transitions at low temperature. By tuning the narrow-band laser over the B 3( 3T 2g) band, resonant and non-resonant fluorescence were obtained which narrowed with respect to the inhomogeneously broadened profile, and additional lines were observed. The spectra can be understood in terms of a simultaneous excitation of two different subsets of Ni 2+ ions which have their B 2( 3A 2g)→B 3( 3T 2g) and A( 3A 2g)→B 3( 3T 2g) transitions in resonance with the laser. The A( 3A 2g) and B 1( 3A 2g) spin-orbit components of the ground-state multiplet lie 1.9 cm -1 and 6.5 cm -1 above the B 2( 3A 2g) ground state, respectively, at 2 K.

  20. Efficient G(sup 4)FET-Based Logic Circuits

    NASA Technical Reports Server (NTRS)

    Vatan, Farrokh

    2008-01-01

    A total of 81 optimal logic circuits based on four-gate field-effect transistors (G(sup 4)4FETs) have been designed to implement all Boolean functions of up to three variables. The purpose of this development was to lend credence to the expectation that logic circuits based on G(sup 4)FETs could be more efficient (in the sense that they could contain fewer transistors), relative to functionally equivalent logic circuits based on conventional transistors. A G(sup 4)FET a combination of a junction field-effect transistor (JFET) and a metal oxide/semiconductor field-effect transistor (MOSFET) superimposed in a single silicon island and can therefore be regarded as two transistors sharing the same body. A G(sup 4)FET can also be regarded as a single device having four gates: two side junction-based gates, a top MOS gate, and a back gate activated by biasing of a silicon-on-insulator substrate. Each of these gates can be used to control the conduction characteristics of the transistor; this possibility creates new options for designing analog, radio-frequency, mixed-signal, and digital circuitry. One such option is to design a G(sup 4)FET to function as a three-input NOT-majority gate, which has been shown to be a universal and programmable logic gate. Optimal NOT-majority-gate, G(sup 4)FET-based logic-circuit designs were obtained in a comparative study that also included formulation of functionally equivalent logic circuits based on NOR and NAND gates implemented by use of conventional transistors. In the study, the problem of finding the optimal design for each logic function and each transistor type was solved as an integer-programming optimization problem. Considering all 81 non-equivalent Boolean functions included in the study, it was found that in 63% of the cases, fewer logic gates (and, hence, fewer transistors) would be needed in the G(sup 4)FET-based implementations.

  1. miR-139 is up-regulated in osteoarthritis and inhibits chondrocyte proliferation and migration possibly via suppressing EIF4G2 and IGF1R

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hu, Weihua; Zhang, Weikai; Li, Feng

    Osteoarthritis (OA) is one of the most progressive articular cartilage erosions. microRNAs (miRNAs) play pivotal roles in OA modulation, but the role of miR-139 in OA remains elusive. This study aims to reveal the effects and possible mechanism of miR-139 in OA and chondrocytes. The levels of miR-139 and its possible targets eukaryotic translation initiation factor 4 gamma 2 (EIF4G2) and insulin-like growth factor 1 receptor (IGF1R) were detected by qRT-PCR in the articular cartilages of 20 OA patients and 20 non-OA patients. Human chondrocyte CHON-001 cells were transfected with miR-139 mimic or inhibitor, as well as the siRNAs of EIF4G2more » and IGF1R. Cell viability by MTT assay, proliferation by colony formation assay and migration by Transwell assay were performed. Results showed that miR-139 was up-regulated, while EIF4G2 and IGF1R mRNAs down-regulated in OA cartilages (P < 0.001), and negative correlations existed between the level of miR-139 and EIF4G2 or IGF1R. Overexpression of miR-139 in CHON-001 cells suppressed both mRNA and protein levels of EIF4G2 and IGF1R, and inhibited cell viability, colony formation number and cell migration, while miR-139 inhibitor induced the opposite effects. Knockdown of EIF4G2 or IGF1R in CHON-001 cells reversed the effects of miR-139 inhibitor on cell viability, colony formation and cell migration. These results indicate that miR-139 is capable of inhibiting chondrocyte proliferation and migration, thus being a possible therapeutic target for OA. The mechanism of miR-139 in chondrocytes may be related to its regulation on EIF4G2 and IGF1R.« less

  2. Definition of IgG- and albumin-binding regions of streptococcal protein G.

    PubMed

    Akerström, B; Nielsen, E; Björck, L

    1987-10-05

    Protein G, the immunoglobin G-binding surface protein of group C and G streptococci, also binds serum albumin. The albumin-binding site on protein G is distinct from the immunoglobulin G-binding site. By mild acid hydrolysis of the papain-liberated protein G fragment (35 kDa), a 28-kDa fragment was produced which retained full immunoglobulin G-binding activity (determined by Scatchard plotting) but had lost all albumin-binding capacity. A protein G (65 kDa), isolated after cloning and expression of the protein G gene in Escherichia coli, had comparable affinity to immunoglobulin G (5-10 X 10(10)M-1), but much higher affinity to albumin than the 35- and 28-kDa protein G fragments (31, 2.6, and 0 X 10(9)M-1, respectively). The amino-terminal amino acid sequences of the 65-, 35-, and 28-kDa fragments allowed us to exactly locate the three fragments in an overall sequence map of protein G, based on the partial gene sequences published by Guss et al. (Guss, B., Eliasson, M., Olsson, A., Uhlen, M., Frej, A.-K., Jörnvall, H., Flock, J.-I., and Lindberg, M. (1986) EMBO J. 5, 1567-1575) and Fahnestock et al. (Fahnestock, S. R., Alexander, P., Nagle, J., and Filpula, D. (1986) J. Bacteriol. 167, 870-880). In this map could then be deduced the location of three homologous albumin-binding regions and three homologous immunoglobulin G-binding regions.

  3. Enhanced photocatalytic performances of ultrafine g-C3N4 nanosheets obtained by gaseous stripping with wet nitrogen

    NASA Astrophysics Data System (ADS)

    Fan, Chengkong; Feng, Qiang; Xu, Guangqing; Lv, Jun; Zhang, Yong; Liu, Jiaqin; Qin, Yongqiang; Wu, Yucheng

    2018-01-01

    Graphitic carbon nitride (g-C3N4) is a promising heterogeneous photocatalyst for organics pollutants degradation and water splitting. Herein, we highlight an available pathway to prepare the ultrafine g-C3N4 nanosheets by gaseous stripping of bulk g-C3N4 in wet nitrogen. As comparison, g-C3N4 treated in air and nitrogen atmospheres are also prepared. The obtained products are characterized with X-ray diffraction, transmission electron microscopy, X-ray photoelectron spectroscopy and Fourier transform infrared spectra, respectively. Well dispersed g-C3N4 nanosheets can be obtained by this gaseous stripping process in wet nitrogen, which possess much higher specific surface area (211.2 m2 g-1) than that of bulk g-C3N4 (15.3 m2 g-1). Both RhB degradation and water splitting are applied to characterize the photocatalytic performances of the ultrafine g-C3N4 nanosheets. The g-C3N4 (w-N2) nanosheets can degrade 20 mg/L RhB completely within 12 min under visible light illumination, which is 5.32 times faster than that of bulk g-C3N4. Also, the g-C3N4 (w-N2) nanosheets possess the highest photocatalytic hydrogen evolution rate of 1113.48 μmol h-1 g-1 under visible light illumination, which is 6 times that of bulk g-C3N4. The mechanisms of enhancing the photocatalytic performance are discussed to be the higher oxidation ability of VB and higher specific surface area (211.2 m2/g) of the ultrafine g-C3N4 nanosheets.

  4. TopBP1 functions with 53BP1 in the G1 DNA damage checkpoint

    PubMed Central

    Cescutti, Rachele; Negrini, Simona; Kohzaki, Masaoki; Halazonetis, Thanos D

    2010-01-01

    TopBP1 is a checkpoint protein that colocalizes with ATR at sites of DNA replication stress. In this study, we show that TopBP1 also colocalizes with 53BP1 at sites of DNA double-strand breaks (DSBs), but only in the G1-phase of the cell cycle. Recruitment of TopBP1 to sites of DNA replication stress was dependent on BRCT domains 12 and 7–8, whereas recruitment to sites of DNA DSBs was dependent on BRCT domains 12 and 4–5. The BRCT domains 4–5 interacted with 53BP1 and recruitment of TopBP1 to sites of DNA DSBs in G1 was dependent on 53BP1. As TopBP1 contains a domain important for ATR activation, we examined whether it contributes to the G1 cell cycle checkpoint. By monitoring the entry of irradiated G1 cells into S-phase, we observed a checkpoint defect after siRNA-mediated depletion of TopBP1, 53BP1 or ATM. Thus, TopBP1 may mediate the checkpoint function of 53BP1 in G1. PMID:20871591

  5. TopBP1 functions with 53BP1 in the G1 DNA damage checkpoint.

    PubMed

    Cescutti, Rachele; Negrini, Simona; Kohzaki, Masaoki; Halazonetis, Thanos D

    2010-11-03

    TopBP1 is a checkpoint protein that colocalizes with ATR at sites of DNA replication stress. In this study, we show that TopBP1 also colocalizes with 53BP1 at sites of DNA double-strand breaks (DSBs), but only in the G1-phase of the cell cycle. Recruitment of TopBP1 to sites of DNA replication stress was dependent on BRCT domains 1-2 and 7-8, whereas recruitment to sites of DNA DSBs was dependent on BRCT domains 1-2 and 4-5. The BRCT domains 4-5 interacted with 53BP1 and recruitment of TopBP1 to sites of DNA DSBs in G1 was dependent on 53BP1. As TopBP1 contains a domain important for ATR activation, we examined whether it contributes to the G1 cell cycle checkpoint. By monitoring the entry of irradiated G1 cells into S-phase, we observed a checkpoint defect after siRNA-mediated depletion of TopBP1, 53BP1 or ATM. Thus, TopBP1 may mediate the checkpoint function of 53BP1 in G1.

  6. Monoclonal antibody Zt/g4 targeting RON receptor tyrosine kinase enhances chemosensitivity of bladder cancer cells to Epirubicin by promoting G1/S arrest and apoptosis.

    PubMed

    Chen, Jun-Feng; Yu, Bi-Xia; Yu, Rui; Ma, Liang; Lv, Xiu-Yi; Cheng, Yue; Ma, Qi

    2017-02-01

    Epirubicin (EPI) is one of the most used intravesical chemotherapy agents after transurethral resection to non-muscle invasive bladder tumors (NMIBC) to prevent cancer recurrence and progression. However, even after resection of bladder tumors and intravesical chemotherapy, half of them will recur and progress. RON is a membrane tyrosine kinase receptor usually overexpressed in bladder cancer cells and associated with poor pathological features. This study aims to investigate the effects of anti-RON monoclonal antibody Zt/g4 on the chemosensitivity of bladder cells to EPI. After Zt/g4 treatment, cell cytotoxicity was significantly increased and cell invasion was markedly suppressed in EPI-treated bladder cancer cells. Further investigation indicated that combing Zt/g4 with EPI promoted cell G1/S-phase arrest and apoptosis, which are the potential mechanisms that RON signaling inhibition enhances chemosensitivity of EPI. Thus, combing antibody-based RON targeted therapy enhances the therapeutic effects of intravesical chemotherapy, which provides new strategy for further improvement of NMIBC patient outcomes.

  7. O2(b1Σg+, v = 0, 1) Relative Yield in O(1D) + O2 Energy Transfer

    NASA Astrophysics Data System (ADS)

    Kostko, O.; Raj, S.; Campbell, K. M.; Pejakovic, D. A.; Slanger, T. G.; Kalogerakis, K. S.

    2012-04-01

    Energy transfer from excited O(1D) atoms to ground-state O2(X3Σg-) leads to production of O2 in the first two vibrational levels of the O2(b1Σg+) state: O(1D) + O2 → O(3P ) + O2(b1Σg+, v = 0, 1). Subsequent radiative decay of O2(b1Σg+, v = 0, 1) to the ground state results in the Atmospheric Band emission, a prominent feature of the terrestrial airglow. The relative yield for production of O2(b1Σg+, v = 0, 1) in the above process, k1/k0, is an important parameter in modeling of the observed O2 Atmospheric Band emission intensities. In the laboratory experiments, the output of a pulsed fluorine laser at 157 nm is used to photodissociate molecular oxygen in an O2/N2 mixture flowing through a heated gas cell. Photodissociation of O2 produces a ground-state O(3P ) atom and an excited O(1D) atom. O(1D) rapidly transfers energy to the remaining O2 to produce O2(b1Σg+, v = 0, 1). The populations of O2(b1Σg+, v = 0, 1) are monitored by observing emissions in the O2(b-X) 0-0 and 1-0 bands at 762 and 688 nm, respectively. The value of k1/k0 is extracted from the time-dependent O2(b1Σg+, v = 0, 1) fluorescence signals using computer simulations. We find that production of v = 1 is substantially larger than that of v = 0. We will present measurements on k1/k0 and its temperature dependence, and discuss the significance of these and other relevant laboratory measurements on the interpretation of the O2 Atmospheric Band emission. This work was supported by the US National Science Foundation (NSF) Aeronomy Program under grant AGS-0937317. The fluorine laser was purchased under grant ATM-0216583 from the NSF Major Research Instrumentation Program. The participation of Sumana Raj and Kendrick M. Campbell was supported by a Research Experiences for Undergraduates (REU) site, co-funded by the Division of Physics of the NSF and the Department of Defense in partnership with the NSF REU program (PHY-1002892).

  8. Imidazole modified g-C3N4 photocatalyst: Structural characterization and versatile energy applications

    NASA Astrophysics Data System (ADS)

    Zhang, Lu; Liu, Qianqian; Chai, Yuanyuan; Ren, Jia; Dai, Wei-Lin

    2018-02-01

    Novel imidazole modified g-C3N4 were firstly synthesized via a facile one-pot thermo-induced co-condensation method. Characterization results showed that imidazole modification can improve the visible light harvesting, interfacial charge transfer and separation of g-C3N4, without destroying its pristine framework structure. The as-obtained imidazole modified g-C3N4 showed remarkably enhanced and rather stable photocatalytic performance in H2 evolution, photo-degradation of water contaminants and selective photo-oxidation of benzyl alcohol, demonstrating its all-round applications as a versatile photocatalyst. The weight ratio between imidazole and urea was well tuned and the optimal photocatalytic activity was obtained, which shows CNU-I50 sample (50 mg imidazole in 15 g urea) possesses the highest hydrogen evolution rate of 2150 μmol g-1 h-1, superior to most of the previous reported g-C3N4 materials. These results suggest that those imidazole modified g-C3N4 materials are potential photocatalyst when applied to solar energy conversion, water purification and selective photosynthesis reactions.

  9. A clinical trial of the accuracy and treatment experience of the Dexcom G4 sensor (Dexcom G4 system) and Enlite sensor (guardian REAL-time system) tested simultaneously in ambulatory patients with type 1 diabetes.

    PubMed

    Matuleviciene, Viktorija; Joseph, Jeffrey I; Andelin, Mervi; Hirsch, Irl B; Attvall, Stig; Pivodic, Aldina; Dahlqvist, Sofia; Klonoff, David; Haraldsson, Börje; Lind, Marcus

    2014-11-01

    Continuous glucose monitoring (CGM) is a tool widely used in the treatment of patients with type 1 diabetes. The purpose of the current study was to evaluate whether accuracy and patient treatment satisfaction differ between the Enlite™ (Medtronic MiniMed, Inc., Northridge, CA) and Dexcom(®) (San Diego, CA) G4 PLATINUM CGM sensors. Thirty-eight ambulatory patients with type 1 diabetes used the Dexcom G4 and Enlite sensors simultaneously for a minimum of 4 and maximum of 6 days. Patients measured capillary glucose levels with a HemoCue(®) (Ängelholm, Sweden) system six to 10 times a day. In addition, two inpatient studies were performed between Days 1-3 and 4-6. The mean absolute relative difference (MARD) in blood glucose for the Dexcom G4 was significantly lower (13.9%) than for the Enlite sensor (17.8%) (P<0.0001). The corresponding MARDs for Days 1-3 were 15.0% versus 19.4% (P=0.0027) and 13.6% versus 15.9% (P=0.026) for Days 4-6. For glucose levels in the hypoglycemic range (<4.0 mmol/L), the MARD for the Dexcom G4 was 20.0% compared with 34.7% for the Enlite (P=0.0041). On a visual analog scale (VAS) (0-100), patients rated the Dexcom G4 more favorably than the Enlite in 12 out of the 13 user experience questions. For example, more patients rated their experience with the Dexcom G4 as positive (VAS, 79.7 vs. 46.6; P<0.0001) and preferred to use it in their daily lives (VAS, 79.1 vs. 42.1; P<0.0001). The Dexcom G4 sensor was associated with greater overall accuracy than the Enlite sensor during initial (Days 1-3) and later (Days 4-6) use and for glucose levels in the hypoglycemic range. Patients reported a significantly more positive experience using the Dexcom G4 than the Enlite.

  10. Toll-like receptor-4 is a target for suppression of proliferation and chemoresistance in HepG2 hepatoblastoma cells.

    PubMed

    Hsiao, Chih-Cheng; Chen, Po-Han; Cheng, Cheng-I; Tsai, Ming-Shian; Chang, Chih-Yang; Lu, Shang-Chieh; Hsieh, Ming-Chu; Lin, Yu-Chun; Lee, Po-Huang; Kao, Ying-Hsien

    2015-11-01

    Toll-like receptor-4 (TLR4) is known to influence growth and migration of hepatocellular tumors; however, its role in hepatoblastoma remains poorly understood. This study investigated the regulatory role of TLR4 in proliferation and chemoresistance of HepG2 hepatoblastoma cells. Treatment with lipopolysaccharide (LPS), a TLR4 agonist, was found to significantly upregulate TLR4 expression in HepG2 cells, but not in malignant Huh-7 and Sk-Hep1 hepatocellular carcinoma cells. Additionally, IL-6 enhanced LPS-induced TLR4 upregulation. LPS-stimulated TLR4 activation increased proliferation, nitric oxide synthase (NOS) expression, and NO production in HepG2 cells. Chemotherapeutic agents, cisplatin and doxorubicin, effectively inhibited TLR4 expression in HepG2 cells. Characterization of LPS-induced signaling activation and blockade with kinase inhibitors revealed the involvement of Akt and MAPK pathways in LPS-enhanced NO release from, and proliferation of HepG2 cells. Mechanistically, gene modifications as a result of TLR4 transfection and siRNA-mediated knockdown further demonstrated a crucial role for TLR4 in the regulation of NOS expression, cell proliferation, and chemoresistance in HepG2 cells. These findings suggest that targeting TLR4 expression and its cognate signaling may modulate proliferation and chemosensitivity in hepatoblastoma cells and serve as a potential therapeutic target. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  11. UPSS and G2

    NASA Technical Reports Server (NTRS)

    Dito, Scott J.

    2014-01-01

    The Universal Propellant Servicing System (UPSS) is a dedicated mobile launcher propellant delivery method that will minimize danger and complexity in order to allow vehicles to be serviced and ultimately launched from a variety of locations previously not seen fit for space launch. The UPPS/G2 project is the development of a model, simulation, and ultimately a working application that will control and monitor the cryogenic fluid delivery to the rocket for testing purposes. To accomplish this, the project is using the programming language/environment Gensym G2. The environment is an all-inclusive application that allows development, testing, modeling, and finally operation of the unique application through graphical and programmatic methods. We have learned G2 through classes and trial-and-error, and are now in the process of building the application that will soon be able to be tested on apparatuses here at Kennedy Space Center, and eventually on the actual unit. The UPSS will bring near-autonomous control of launches to those that need it, as well it will be a great addition to NASA and KSC's operational viability and the opportunity to bring space launches to parts of the world, and in time constraints, once not thought possible.

  12. 2D-2D stacking of graphene-like g-C3N4/Ultrathin Bi4O5Br2 with matched energy band structure towards antibiotic removal

    NASA Astrophysics Data System (ADS)

    Ji, Mengxia; Di, Jun; Ge, Yuping; Xia, Jiexiang; Li, Huaming

    2017-08-01

    A novel visible-light-driven 2D-2D graphene-like g-C3N4/ultrathin Bi4O5Br2 photocatalyst was prepared via a facile solvothermal method in the presence of reactable ionic liquid 1-hexadecyl-3-methylimidazolium bromide ([C16mim]Br) for the first time. FT-IR, XPS and TEM analysis results demonstrated the successful introduction of the 2D graphene-like g-C3N4 material to the Bi4O5Br2 system. DRS and BET analysis results indicated the existence of the g-C3N4 could lead to the broaden absorption edge and larger surface area of the ultrathin Bi4O5Br2 nanosheets. The electrochemical analysis implied a fast transfer of the interfacial electrons and low recombination rate of photogenerated charge carriers in g-C3N4/Bi4O5Br2, which could be assigned to the sufficient and tight contact between ultrathin Bi4O5Br2 and graphene-like g-C3N4. The quinolone antibiotic ciprofloxacin (CIP) was chosen as the target pollutant to evaluate the photocatalytic performance of the as-prepared samples under visible light irradiation. 1 wt% g-C3N4/Bi4O5Br2 composite exhibited the highest photocatalytic degradation performance among all of the as-prepared photocatalysts. The enhancement of photocatalytic activity was attributed to the maximum contact between graphene-like g-C3N4 and ultrathin Bi4O5Br2 material with matched energy band structure, which enable the efficient charge seperation. A possible photocatalytic mechanism also was proposed.

  13. Plant growth and fertility requires functional interactions between specific PABP and eIF4G gene family members

    PubMed Central

    2018-01-01

    The initiation of protein synthesis requires the involvement of the eukaryotic translation initiation factor (eIF) 4G to promote assembly of the factors needed to recruit a 40S ribosomal subunit to an mRNA. Although many eukaryotes express two eIF4G isoforms that are highly similar, those in plants, referred to as eIF4G and eIFiso4G, are highly divergent in size, sequence, and domain organization. Species of the Brassicaceae and the Cleomaceae also express a divergent eIFiso4G isoform, referred to as eIFiso4G2, not found elsewhere in the plant kingdom. Despite their divergence, eIF4G and eIFiso4G interact with eIF4A, eIF4B, and eIF4E isoforms needed for binding an mRNA. eIF4G and eIFiso4G also interact with the poly(A)-binding protein (PABP) which promotes ribosome recruitment to an mRNA. Increasing the complexity of such an interaction, however, Arabidopsis also expresses three PABP isoforms (PAB2, PAB4, and PAB8) in vegetative and reproductive tissues. In this study, the functional interactions among the eIF4G and the widely-expressed PABP isoforms were examined. Loss of PAB2 or PAB8 in combination with loss of eIF4G or eIFiso4G had little to no effect on growth or fertility whereas pab2 pab8 eif4g or pab2 pab8 eifiso4g1/2 mutants exhibited smaller stature and reduced fertility. Although the pab4 eifiso4g1 mutant grows normally and is fertile, pab4 eif4g or pab4 eifiso4g2 mutants could not be isolated. Even pab4/PAB4 eif4g/eIF4G heterozygous plants exhibited growth defects and low fertility. Mutant co-inheritance analysis in reciprocal crosses with wild-type plants revealed that most ovaries and pollen from pab4/PAB4 eif4g/eIF4G plants were PAB4 eif4g. Similarly, co-inheritance studies with pab4/PAB4 eifiso4g2/eIFiso4G2 plants suggested most ovaries were PAB4 eifiso4g2. These results suggest that a functional interaction between PAB4 and eIF4G and between PAB4 and eIFiso4G2 is required for growth and normal fertility. PMID:29381712

  14. 78 FR 21151 - G4 Products, LLC a Subsidiary of G4 Holdings, Inc. Including Workers Whose Wages are Paid Under...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-04-09

    ... certification for G4 Products. Additional information provided by the company official revealed that the subject... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-81,432] G4 Products, LLC a...-Site Leased Workers from OSW and Maine Staffing Group Lewiston, ME; Amended Certification Regarding...

  15. Phylogenetic analysis of G1P[8] and G12P[8] rotavirus A samples obtained in the pre- and post-vaccine periods, and molecular modeling of VP4 and VP7 proteins.

    PubMed

    Almeida, Tâmera Nunes Vieira; de Sousa, Teresinha Teixeira; da Silva, Roosevelt Alves; Fiaccadori, Fabíola Souza; Souza, Menira; Badr, Kareem Rady; de Paula Cardoso, Divina das Dôres

    2017-09-01

    Reduction in morbimortality rates for acute gastroenteritis (AGE) by Rotavirus A (RVA) has been observed after the introduction of vaccines, however the agent continues to circulate. The present study described the genomic characterization of the 11 dsRNA segments of two RVA samples G1P[8] obtained in the pre- and post-vaccination periods and one of G12P[8] sample (post-vaccine), compared to Rotarix™ vaccine. Analysis by molecular sequencing of the samples showed that the three samples belonged to genogroup I. In addition, the analysis of VP7 gene revealed that the samples G1 (pre-vaccine), G1 (post-vaccine) and G12 were characterized as lineages II, I and III, respectively. Regarding to VP4 and NSP4 gene it was observed that all samples belonged to lineage III, whereas for VP6 gene, the sample of the pre- and post-vaccine belonged to the lineage IV and I, respectively. Considering the VP7 gene, it was observed high nucleotide and amino acid identity for the two G1 samples when compared to Rotarix™ vaccine and lesser identity for the G12 sample. In relation to antigenic epitope of VP7 greater modifications were observed for the G12 sample in the 7-2 epitope that was confirmed by molecular modeling. On the other hand, for VP4, some changes in the 8-1 and 8-3 antigenic epitopes was observed for the three samples. This data could be interpreted as a low selective pressure exerted by vaccination in relation to G1P[8] samples and lesser protection in relation to G12P[8]. Thus, the continuous monitoring of RVA circulating samples remains important. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. 26 CFR 1.402(g)-1 - Limitation on exclusion for elective deferrals.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    .... 1.402(g)-1 Section 1.402(g)-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES Pension, Profit-Sharing, Stock Bonus Plans, Etc. § 1.402(g)-1... section 402(a)(8) (before applying the limits of section 402(g) or this section). (2) Any employer...

  17. 26 CFR 301.6223(g)-1 - Responsibilities of the tax matters partner.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    .... 301.6223(g)-1 Section 301.6223(g)-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE....6223(g)-1 Responsibilities of the tax matters partner. (a) Notices described in section 6223(a)—(1... beginning on or after October 4, 2001. For years beginning prior to October 4, 2001, see § 301.6223(g)-1T...

  18. 26 CFR 301.6223(g)-1 - Responsibilities of the tax matters partner.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    .... 301.6223(g)-1 Section 301.6223(g)-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE....6223(g)-1 Responsibilities of the tax matters partner. (a) Notices described in section 6223(a)—(1... beginning on or after October 4, 2001. For years beginning prior to October 4, 2001, see § 301.6223(g)-1T...

  19. 26 CFR 301.6223(g)-1 - Responsibilities of the tax matters partner.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    .... 301.6223(g)-1 Section 301.6223(g)-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE....6223(g)-1 Responsibilities of the tax matters partner. (a) Notices described in section 6223(a)—(1... beginning on or after October 4, 2001. For years beginning prior to October 4, 2001, see § 301.6223(g)-1T...

  20. 26 CFR 301.6223(g)-1 - Responsibilities of the tax matters partner.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    .... 301.6223(g)-1 Section 301.6223(g)-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE....6223(g)-1 Responsibilities of the tax matters partner. (a) Notices described in section 6223(a)—(1... beginning on or after October 4, 2001. For years beginning prior to October 4, 2001, see § 301.6223(g)-1T...

  1. 26 CFR 301.6223(g)-1 - Responsibilities of the tax matters partner.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    .... 301.6223(g)-1 Section 301.6223(g)-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE....6223(g)-1 Responsibilities of the tax matters partner. (a) Notices described in section 6223(a)—(1... beginning on or after October 4, 2001. For years beginning prior to October 4, 2001, see § 301.6223(g)-1T...

  2. Control of G1 arrest after DNA damage.

    PubMed Central

    Kastan, M B; Kuerbitz, S J

    1993-01-01

    The temporal relationship between DNA damage and DNA replication may be critical in determining whether the genetic changes necessary for cellular transformation occur after DNA damage. Recent characterization of the mechanisms responsible for alterations in cell-cycle progression after DNA damage in our laboratory have implicated the p53 (tumor suppressor) protein in the G1 arrest that occurs after certain types of DNA damage. In particular, we found that levels of p53 protein increased rapidly and transiently after nonlethal doses of gamma irradiation (XRT) in hematopoietic cells with wild-type, but not mutant, p53 genes. These changes in p53 protein levels were temporally linked to a transient G1 arrest in these cells. Hematopoietic cells with mutant or absent p53 genes did not exhibit this G1 arrest, through they continued to demonstrate a G2 arrest. We recently extended these observations of a tight correlation between the status of the endogenous p53 genes and this G1 arrest after XRT and this cell-cycle alteration after XRT was then established by transfecting cells lacking endogenous p53 genes with a wild-type gene and observing acquisition of the G1 arrest and by transfecting cells processing endogenous wild-type p53 genes with a mutant p53 gene and observing loss of the G1 arrest after XRT. These observations and their significance for our understanding of the mechanisms of DNA damage-induced cellular transformation are discussed. PMID:8013425

  3. Azithromycin 1.5g Over 5 Days Compared to 1g Single Dose in Urethral Mycoplasma genitalium: Impact on Treatment Outcome and Resistance.

    PubMed

    Read, Tim R H; Fairley, Christopher K; Tabrizi, Sepehr N; Bissessor, Melanie; Vodstrcil, Lenka; Chow, Eric P F; Grant, Mieken; Danielewski, Jennifer; Garland, Suzanne M; Hocking, Jane S; Chen, Marcus Y; Bradshaw, Catriona S

    2017-02-01

    We evaluated the impact of extended azithromycin (1.5g over 5 days) on selection of macrolide resistance and microbiological cure in men with Mycoplasma genitalium urethritis during 2013-2015 and compared this to cases treated with azithromycin 1g in 2012-2013. Microbiological cure was determined for men with M. genitalium urethritis treated with azithromycin 1.5g using quantitative polymerase chain reaction specific for M. genitalium DNA on samples 14-100 days post-treatment. Pre- and post-treatment macrolide resistance mutations were detected by sequencing the 23 S gene. There was no difference in proportions with microbiological cure between azithromycin 1.5g and 1g: 62/106 (58%; 95% confidence interval [CI], 49%, 68%) and 56/107 (52%; 95%CI 42-62%), P = .34, respectively. Also, there was no difference in the proportion of wild-type 23 S rRNA (presumed macrolide sensitive) infections cured after 1.5g and azithromycin 1g: 28/34 (82%; 95%CI 65-92%) and 49/60 (82%; 95%CI 70-90%), P=1.0, respectively. There was no difference between 1.5g and 1g in the proportions of wild-type infections with post-treatment resistance mutations: 4/34 (12%; 95%CI 3-27%) and 11/60 (18%; 95%CI 10-30%), respectively, P = .40. Pre-treatment resistance was present in 51/98 (52%; 95%CI 42-62%) cases in 2013-2015 compared to 47/107 (44%; 95%CI 34-54%) in 2012-2013, P = .25. Extended azithromycin 1.5g was no more effective than a single 1g dose at achieving cure of M. genitalium urethritis and importantly did not reduce the selection of macrolide resistance. Nonmacrolide and new approaches for the treatment of M. genitalium urethritis are required. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

  4. The putative G-protein coupled estrogen receptor agonist G-1 suppresses proliferation of ovarian and breast cancer cells in a GPER-independent manner

    PubMed Central

    Wang, Cheng; Lv, Xiangmin; Jiang, Chao; Davis, John S

    2012-01-01

    G-protein coupled estrogen receptor 1 (GPER) plays an important role in mediating estrogen action in many different tissues under both physiological and pathological conditions. G-1 (1-[4-(6-bromobenzo[1,3]dioxol-5yl)-3a,4,5,9b-tetrahydro-3H-cyclopenta [c]quinolin-8-yl]-ethanone) has been developed as a selective GPER agonist to distinguish estrogen actions mediated by GPER from those mediated by classic estrogen receptors. In the present study, we surprisingly found that G-1 suppressed proliferation and induced apoptosis of KGN cells (a human ovarian granulosa cell tumor cell line), actions that were not blocked by a selective GPER antagonist G15 or siRNA knockdown of GPER. G-1 also suppressed proliferation and induced cell apoptosis in GPER-negative HEK-293 cells and MDA-MB 231 breast cancer cells. Our results demonstrate that G-1 suppresses proliferation of ovarian and breast cancer cells in a GPER-independent manner. G-1 may be a candidate for the development of drugs against ovarian and breast cancer. PMID:23145207

  5. Determination of O2(a1Delta g) and O2(b1Sigma + g) yields in the reaction O + ClO yields Cl + O2 - Implications for photochemistry in the atmosphere of Venus

    NASA Technical Reports Server (NTRS)

    Leu, Ming-Taun; Yung, Yuk L.

    1987-01-01

    A discharge flow apparatus with a chemiluminescence detector was used to investigate the reaction O + ClO yields Cl + O2(asterisk), where O2(asterisk) = O2(a1Delta g) or O2(b1Sigma + g). It is found that the observed O2(a1Delta g) airglow of Venus cannot be explained in the framework of standard photochemistry using the experimental results obtained here and those reported in the recent literature. The possibility of an alternative source of O atoms derived from SO2 photolysis in the Venus mesosphere is suggested.

  6. Muon g-2

    Science.gov Websites

    Related Links A Key Contribution from Brookhaven Laboratory The Big Move Muon Department Facebook g-2 on is filled with an invisible sea of virtual particles that -in accordance with the laws of quantum presence and nature of these virtual particles with particle beams traveling in a magnetic field. The Muon

  7. Autoimmune thyroiditis in children and adolescents with type 1 diabetes mellitus is associated with elevated IgG4 but not with low vitamin D.

    PubMed

    Demir, Korcan; Keskin, Mehmet; Kör, Yilmaz; Karaoğlan, Murat; Bülbül, Özlem Gümüştekin

    2014-01-01

    To assess levels of vitamin D and of immunoglobulin G subclasses in children and adolescents with type 1 Diabetes Mellitus with or without autoimmune thyroiditis. Among 213 patients with type 1 diabetes, the cases with thyroid-specific autoantibodies formed Group 1 [n=19, M/F: 7/12, median age 13 years (10.1-14.7)]. Nineteen age-, gender-, and diabetes duration-matched cases with type 1 diabetes without any other systemic disease were designated as controls [Group 2, M/F: 7/12, median age 12.9 years (10.5-14.9)]. Levels of thyroid hormones, vitamin D, total IgG and IgG subclasses, as well as IgG subclasses/total IgG ratios were similar between the groups. Five cases (26%) in Group 1 had IgG4 levels > + 2 SDS, whereas there were no such cases in Group 2 (p=0.046). These five patients had similar clinical features but higher median IgG4 levels and IgG4/Total IgG ratios compared to the subjects with IgG4 levels < + 2 SDS in Group 1 and Group 2. There was no difference of vitamin D levels between the groups. Only a small percentage of patients with type 1 diabetes also having autoimmune thyroiditis had elevated serum IgG4 levels, revealing the heterogeneity of autoimmune thyroiditis and existence of IgG4 thyroiditis in the pediatric age group. Total IgG, the other IgG subclasses, and vitamin D levels did not differ in patients with autoimmune thyroiditis and type 1 diabetes compared to those suffering only from type 1 diabetes.

  8. Suppression of STIM1 inhibits human glioblastoma cell proliferation and induces G0/G1 phase arrest

    PubMed Central

    2013-01-01

    Background Depletion of calcium (Ca2+) from the endoplasmic reticulum (ER) activates the ubiquitous store-operated Ca2+ entry (SOCE) pathway which sustains long-term Ca2+ signals and is critical for cellular functions. Stromal interacting molecule 1 (STIM1) serves a dual role as an ER Ca2+ sensor and activator of SOCE. Aberrant expression of STIM1 could be observed in several human cancer cells. However, the role of STIM1 in regulating tumorigenesis of human glioblastoma still remains unclear. Methods Expression of STIM1 protein in a panel of human glioblastoma cell lines (U251, U87 and U373) in different transformation level were evaluated by Western blot method. STIM1 loss of function was performed on U251 cells, derived from grade IV astrocytomas-glioblastoma multiforme with a lentvirus-mediated short harpin RNA (shRNA) method. The biological impacts after knock down of STIM1 on glioblastoma cells were investigated in vitro and in vivo. Results We discovered that STIM1 protein was expressed in U251, U87 and U373 cells, and especially higher in U251 cells. RNA interference efficiently downregulated the expression of STIM1 in U251 cells at both mRNA and protein levels. Specific downregulation of STIM1 inhibited U251 cell proliferation by inducing cell cycle arrest in G0/G1 phase through regulation of cell cycle-related genes, such as p21Waf1/Cip1, cyclin D1 and cyclin-dependent kinase 4 (CDK4), and the antiproliferative effect of STIM1 silencing was also observed in U251 glioma xenograft tumor model. Conclusion Our findings confirm STIM1 as a rational therapeutic target in human glioblastoma, and also indicate that lentivirus-mediated STIM1 silencing is a promising therapeutic strategy for human glioblastoma. PMID:23578185

  9. Suppression of STIM1 inhibits human glioblastoma cell proliferation and induces G0/G1 phase arrest.

    PubMed

    Li, Guilin; Zhang, Zhenxing; Wang, Renzhi; Ma, Wenbin; Yang, Ying; Wei, Junji; Wei, Yanping

    2013-04-11

    Depletion of calcium (Ca2+) from the endoplasmic reticulum (ER) activates the ubiquitous store-operated Ca2+ entry (SOCE) pathway which sustains long-term Ca2+ signals and is critical for cellular functions. Stromal interacting molecule 1 (STIM1) serves a dual role as an ER Ca2+ sensor and activator of SOCE. Aberrant expression of STIM1 could be observed in several human cancer cells. However, the role of STIM1 in regulating tumorigenesis of human glioblastoma still remains unclear. Expression of STIM1 protein in a panel of human glioblastoma cell lines (U251, U87 and U373) in different transformation level were evaluated by Western blot method. STIM1 loss of function was performed on U251 cells, derived from grade IV astrocytomas-glioblastoma multiforme with a lentvirus-mediated short harpin RNA (shRNA) method. The biological impacts after knock down of STIM1 on glioblastoma cells were investigated in vitro and in vivo. We discovered that STIM1 protein was expressed in U251, U87 and U373 cells, and especially higher in U251 cells. RNA interference efficiently downregulated the expression of STIM1 in U251 cells at both mRNA and protein levels. Specific downregulation of STIM1 inhibited U251 cell proliferation by inducing cell cycle arrest in G0/G1 phase through regulation of cell cycle-related genes, such as p21Waf1/Cip1, cyclin D1 and cyclin-dependent kinase 4 (CDK4), and the antiproliferative effect of STIM1 silencing was also observed in U251 glioma xenograft tumor model. Our findings confirm STIM1 as a rational therapeutic target in human glioblastoma, and also indicate that lentivirus-mediated STIM1 silencing is a promising therapeutic strategy for human glioblastoma.

  10. Enhanced visible light activity on direct contact Z-scheme g-C3N4-TiO2 photocatalyst

    NASA Astrophysics Data System (ADS)

    Li, Juan; Zhang, Min; Li, Qiuye; Yang, Jianjun

    2017-01-01

    Direct contact Z-scheme g-C3N4-TiO2 nanocomposites without an electron mediator are prepared via simple annealing the mixture of bulk g-C3N4 and nanotube titanic acid (NTA) in air at 600 °C for 2 h. In the process of annealing, the bulk g-C3N4 transformed to ultra-thin g-C3N4 nanosheets, and NTA converted to a novel anatase TiO2, then the two components formed a close interaction. The XPS result reveals that some amount of nitrogen is doped into this novel-TiO2, and g-C3N4 nanosheets exist in the composites. The results of XRD, TEM and TG indicate that the thickness of g-C3N4 nanosheets is very thin. The ESR spectrum shows the existence of Ti3+ and single-electron-trapped oxygen vacancy in the 30%g-C3N4-TiO2 composites. In photocatalytic activity test, the 30%g-C3N4-TiO2 nanocomposites showed an excellent photo-oxidation activity of propylene under visible light irradiation (λ≥ 420 nm), and the removal efficiency of propylene reached as high as 56.6%, and the activity kept nearly 82% after four consecutive recycles. Photoluminescence (PL) result using terephthalic acid (TA) as a probe molecule indicated that the g-C3N4-TiO2 nanocomposites displayed a Z-sheme photocatalytic reaction system and this should be the main reason for the high photocatalytic activity. A possible photocatalytic mechanism was proposed on the basis of PL result and transient photocurrent-time curves.

  11. Echinococcus canadensis (Cestoda: Taeniidae) is a valid species consisting of the mitochondrial genotypes G6, G7, G8 and G10

    USDA-ARS?s Scientific Manuscript database

    The species status of Echinococcus canadensis has long been controversial, mainly because it consists of the mitochondrial genotypes G6, G7, G8 and G10 with different host affinity: G6 (camel strain) and G7 (pig strain) with domestic cycles and G8 (cervid strain) and G10 (Fennoscandian cervid strain...

  12. IL-27 induces the production of IgG1 by human B cells.

    PubMed

    Boumendjel, Amel; Tawk, Lina; Malefijt, René de Waal; Boulay, Vera; Yssel, Hans; Pène, Jérôme

    2006-12-01

    It has been reported that IL-27 specifically induces the production of IgG2a by mouse B cells and inhibits IL-4-induced IgG1 synthesis. Here, we show that human naïve cord blood expresses a functional IL-27 receptor, consisting of the TCCR and gp130 subunits, although at lower levels as compared to naïve and memory splenic B cells. IL-27 does not induce proliferative responses and does not increase IgG1 production by CD19(+)CD27(+) memory B cells. However, it induces a low, but significant production of IgG1 by naïve CD19(+)CD27(-)IgD(+)IgG(-) spleen and cord blood B cells, activated via CD40, whereas it has no effect on the production of the other IgG subclasses. In addition, IL-27 induces the differentiation of a population of B cells that express high levels of CD38, in association with a down-regulation of surface IgD expression, and that are surface IgG(+/int), CD20(low), CD27(high), indicating that IL-27 promotes isotype switching and plasma cell differentiation of naive B cells. However, as compared to the effects of IL-21 and IL-10, both switch factors for human IgG1 and IgG3, those of IL-27 are modest and regulate exclusively the production of IgG1. Finally, although IL-27 has no effect on IL-4 and anti-CD40-induced Cepsilon germline promoter activity, it up-regulates IL-4-induced IgE production by naive B cells. These results point to a partial redundancy of switch factors regulating the production of IgG1 in humans, and furthermore indicate the existence of a common regulation of the human IgG1and murine IgG2a isotypes by IL-27.

  13. Cycle control and bleeding pattern of a 24/4 regimen of drospirenone 3 mg/ethinylestradiol 20 μg compared with a 21/7 regimen of desogestrel 150 μg/ethinylestradiol 20 μg: a pooled analysis.

    PubMed

    Anttila, Leena; Neunteufel, Walter; Petraglia, Felice; Marr, Joachim; Kunz, Michael

    2011-01-01

    The degree of cycle control achieved with a hormonal contraceptive method is an important determinant of its acceptance and continuation. This study set out to compare the cycle control and bleeding profile of drospirenone (DRSP) 3 mg/ethinylestradiol (EE) 20 μg in a 24-active pill/4-inert pill (24/4) regimen (YAZ®) with those of desogestrel (DSG) 150 μg/EE 20 μg in a 21/7 regimen (Mercilon®), an established European combined oral contraceptive (COC). Bleeding data from women aged 17-36 years who received either DRSP 3 mg/EE 20 μg in a 24/4 regimen (n = 1285) or DSG 150 μg/EE 20 μg in a 21/7 regimen (n = 471) during four clinical studies were pooled and analysed over seven treatment cycles. The maximum intensity of scheduled withdrawal bleeding was 'normal bleeding' for >50% of subjects in cycles 1-6 in both treatment groups. Moreover, the incidence of unscheduled intracyclic bleeding during cycles 2-7 was comparable between treatment types (10.2-14.9% in women treated with DRSP 3 mg/EE 20 μg 24/4 vs 8.6-13.8% in women treated with DSG 150 μg/EE 20 μg 21/7). Overall, similar bleeding patterns were observed with both treatments. DRSP 3 mg/EE 20 μg 24/4 is associated with a bleeding profile and cycle control that is comparable to that of an established, low-dose COC formulation.

  14. Antigenic Determinants of the Bilobal Cockroach Allergen Bla g 2*

    PubMed Central

    Woodfolk, Judith A.; Glesner, Jill; Wright, Paul W.; Kepley, Christopher L.; Li, Mi; Himly, Martin; Muehling, Lyndsey M.; Gustchina, Alla; Wlodawer, Alexander; Chapman, Martin D.; Pomés, Anna

    2016-01-01

    Bla g 2 is a major indoor cockroach allergen associated with the development of asthma. Antigenic determinants on Bla g 2 were analyzed by mutagenesis based on the structure of the allergen alone and in complex with monoclonal antibodies that interfere with IgE antibody binding. The structural analysis revealed mechanisms of allergen-antibody recognition through cation-π interactions. Single and multiple Bla g 2 mutants were expressed in Pichia pastoris and purified. The triple mutant K132A/K251A/F162Y showed an ∼100-fold reduced capacity to bind IgE, while preserving the native molecular fold, as proven by x-ray crystallography. This mutant was still able to induce mast cell release. T-cell responses were assessed by analyzing Th1/Th2 cytokine production and the CD4+ T-cell phenotype in peripheral blood mononuclear cell cultures. Although T-cell activating capacity was similar for the KKF mutant and Bla g 2 based on CD25 expression, the KKF mutant was a weaker inducer of the Th2 cytokine IL-13. Furthermore, this mutant induced IL-10 from a non-T-cell source at higher levels that those induced by Bla g 2. Our findings demonstrate that a rational design of site-directed mutagenesis was effective in producing a mutant with only 3 amino acid substitutions that maintained the same fold as wild type Bla g 2. These residues, which were involved in IgE antibody binding, endowed Bla g 2 with a T-cell modulatory capacity. The antigenic analysis of Bla g 2 will be useful for the subsequent development of recombinant allergen vaccines. PMID:26644466

  15. Body Weight Gain During a Discrete Nursing Episode in Suckling Rats Reared at 1.5-g or 1.5-g Exceeds that of 1.0-g Controls and is Independent of Material Hypergravity Exposure

    NASA Technical Reports Server (NTRS)

    Ronca, April E.; Baer, Lisa A.; Plaut, Karen; Wade, Charles E.; Sun, Sid (Technical Monitor)

    2001-01-01

    We recently reported that body weights of suckling rats reared during 1.5-g centrifugation are approximately 10% lower than those of 1.0-g controls. This finding raises the possibility that hypergravity exposed pups ingest less milk than controls due to either impairments in their ability to acquire milk from the nipple, or to decreased availability or palatability of their mother's milk. In the present study, we analyzed body weight gain in suckling rats reared during a discrete nursing episode following rearing at either 1.75-g, 1.5-g or 1.0-g. On Gestational day (G) 10 of the rats' 22-day pregnancy, time-bred SD rat dams were 1:1 matched based on body weight and assigned to either Hypergravity (HG) or Stationary Yoked Control (SYC) conditions and to either 1.75-g or 1.5-g conditions. Beginning on G11, HG dams and litters were exposed to 26 days of continuous centrifugation with brief daily stops for veterinary inspection and animal maintenance. On the day following birth (Postnatal day), litters were pooled within each condition then randomly re-assigned in equivalent proportions to HG and SYC dams. On P15, HG litters were removed from their mother's and placed in an incubator (33 C). Following a 4hr deprivation period, four neonates were tested from each litter, with two pups placed with either their own dam or the SYC dam; two pups from the yoked mother were paired with the HG pups. Pups were individually weighed, permitted to suckle for 75 min, then re-weighed. At the start of the test, the body weights of HG pups were significantly less than those of SYC pups (p less than 0.05). Relative to SYC pups, BG pups showed significantly greater proportional body weight gain (p less than 0.05), possibly due to augmented post-centrifugation feeding. Pup weight gain was independent of maternal hypergravity exposure. Neither impairments in milk acquisition nor milk availability or palatibility of hypergravity-exposed dams cannot account for reduced body mass of

  16. Complex reassortment events of unusual G9P[4] rotavirus strains in India between 2011 and 2013.

    PubMed

    Doan, Yen Hai; Suzuki, Yoshiyuki; Fujii, Yoshiki; Haga, Kei; Fujimoto, Akira; Takai-Todaka, Reiko; Someya, Yuichi; Nayak, Mukti K; Mukherjee, Anupam; Imamura, Daisuke; Shinoda, Sumio; Chawla-Sarkar, Mamta; Katayama, Kazuhiko

    2017-10-01

    Rotavirus A (RVA) is the predominant etiological agent of acute gastroenteritis in young children worldwide. Recently, unusual G9P[4] rotavirus strains emerged with high prevalence in many countries. Such intergenogroup reassortant strains highlight the ongoing spread of unusual rotavirus strains throughout Asia. This study was undertaken to determine the whole genome of eleven unusual G9P[4] strains detected in India during 2011-2013, and to compare them with other human and animal global RVAs to understand the exact origin of unusual G9P[4] circulating in India and other countries worldwide. Of these 11 RVAs, four G9P[4] strains were double-reassortants with the G9-VP7 and E6-NSP4 genes on a DS-1-like genetic backbone (G9-P[4]-I2-R2-C2-M2-A2-N2-T2-E6-H2). The other strains showed a complex genetic constellation, likely derived from triple reassortment event with the G9-VP7, N1-NSP2 and E6-NSP4 on a DS-1-like genetic backbone (G9-P[4]-I2-R2-C2-M2-A2-N1-T2-E6-H2). Presumably, these unusual G9P[4] strains were generated after several reassortment events between the contemporary co-circulating human rotavirus strains. Moreover, the point mutation S291L at the interaction site between inner and outer capsid proteins of VP6 gene may be important in the rapid spread of this unusual strain. The complex reassortment events within the G9[4] strains may be related to the high prevalence of mixed infections in India as reported in this study and other previous studies. Copyright © 2017. Published by Elsevier B.V.

  17. Enhanced photocatalytic activity of electrospun nanofibrous TiO2/g-C3N4 heterojunction photocatalyst under simulated solar light

    NASA Astrophysics Data System (ADS)

    Wang, Chunlei; Hu, Liming; Chai, Bo; Yan, Juntao; Li, Jianfen

    2018-02-01

    Electrospun nanofibrous TiO2/g-C3N4 heterojunction photocatalysts with different TiO2 content have been synthesized via a facile electrospinning and subsequent in situ evaporation and calcination process for the first time, which are examined in terms of morphology, component content, optical properties, PL spectra, photocurrent response, EIS measurement, photocatalytic activity and mechanism. SEM images exhibit TiO2/g-C3N4-4 heterojunction photocatalyst possesses the excellent 1D structure. HRTEM and element mapping images confirm the formation of heterojunction structure. DRS tests identify that TiO2/g-C3N4-4 heterojunction exhibits the intensitive absorption in both UV and visible light region. The photoelectrochemical tests prove that the recombination between electrons and holes are effectively inhibited. Based on TG analysis and photodegradation experiments, TiO2/g-C3N4-4 heterojunction photocatalyst with TiO2 content of 29.30 wt% possesses the best photocatalytic degradation efficiency for the RhB among the g-C3N4, TiO2 and their mixture under simulated sunlight irradiation. Moreover, 1D morphology of TiO2/g-C3N4-4 heterojunction photocatalyst is in favor of separating from solution for reuse and transferring the electrons, and maintains a very high photocatalytic degradation efficiency of 96% even after four recycles experiments, which is beneficial for practical application.

  18. G-quadruplex induced stabilization by 2′-deoxy-2′-fluoro-d-arabinonucleic acids (2′F-ANA)

    PubMed Central

    Peng, Chang Geng; Damha, Masad J.

    2007-01-01

    The impact of 2′-deoxy-2′-fluoroarabinonucleotide residues (2′F-araN) on different G-quadruplexes derived from a thrombin-binding DNA aptamer d(G2T2G2TGTG2T2G2), an anti-HIV phosphorothioate aptamer PS-d(T2G4T2) and a DNA telomeric sequence d(G4T4G4) via UV thermal melting (Tm) and circular dichroism (CD) experiments has been investigated. Generally, replacement of deoxyguanosines that adopt the anti conformation (anti-guanines) with 2′F-araG can stabilize G-quartets and maintain the quadruplex conformation, while replacement of syn-guanines with 2′F-araG is not favored and results in a dramatic switch to an alternative quadruplex conformation. It was found that incorporation of 2′F-araG or T residues into a thrombin-binding DNA G-quadruplex stabilizes the complex (ΔTm up to ∼+3°C/2′F-araN modification); 2′F-araN units also increased the half-life in 10% fetal bovine serum (FBS) up to 48-fold. Two modified thrombin-binding aptamers (PG13 and PG14) show an approximately 4-fold increase in binding affinity to thrombin, as assessed via a nitrocellulose filter binding assay, both with increased thermal stability (∼1°C/2′F-ANA modification increase in Tm) and nuclease resistance (4–7-fold) as well. Therefore, the 2′-deoxy-2′-fluoro-d-arabinonucleic acid (2′F-ANA) modification is well suited to tune (and improve) the physicochemical and biological properties of naturally occurring DNA G-quartets. PMID:17636049

  19. Coexistence of Acute Crescent Glomerulonephritis and IgG4-Related Kidney Disease.

    PubMed

    Lu, Zeyuan; Yin, Jianyong; Bao, Hongda; Jiao, Qiong; Wu, Huijuan; Wu, Rui; Xue, Qin; Wang, Niansong; Zhang, Zhigang; Wang, Feng

    2016-01-01

    IgG4-related disease (IgG4-RD) is a fibroinflammatory disorder that may involve almost each organ or system. IgG4-related kidney disease (IgG4-RKD) refers to renal lesions associated with IgG4-RD. The most frequent morphological type of renal lesions is IgG4-related tubulointerstitial nephritis (IgG4-TIN) which is associated with increased IgG4-positive plasma cell infiltration and interstitial fibrosis. Herein, we present a rare case with coexisting IgG4-RKD and acute crescent glomerulonephritis with concomitant severe tubulointerstitial lesions instead of classic IgG4-TIN. IgG4-RKD and acute crescent glomerulonephritis can occur in the same patient. This case may give us a clearer viewpoint of the disease.

  20. Experimental and Coupled-channels Investigation of the Radiative Properties of the N2 c4 (sup 1)Sigma+(sub u) - X (sup 1)Sigma+(sub g) Band System

    NASA Technical Reports Server (NTRS)

    Liu, Xianming; Shemansky, Donald E.; Malone, Charles P.; Johnson, Paul V.; Ajello, Joseph M.; Kanik, Isik; Heays, Alan N.; Lewis, Brenton R.; Gibson, Stephen T.; Stark, Glenn

    2008-01-01

    The emission properties of the N2 c(sup prime)(sub 4) (sup 1)Sigma+(sub u) - Chi (sup 1)Sigma+(sub g) band system have been investigated in a joint experimental and coupled-channels theoretical study. Relative intensities of the c(sup prime)(sub 4) (sup 1)Sigma+(sub u)(0) - Chi (sup 1)Sigma+(sub g)(v(sub i)) transitions, measured via electron-impact-induced emission spectroscopy, are combined with a coupled-channel Schroedinger equation (CSE) model of the N2 molecule, enabling determination of the diabatic electronic transition moment for the c(sup prime)(sub 4) (sup 1)Sigma+(sub u) - Chi (sup 1)Sigma+(sub g) system as a function of internuclear distance. The CSE probabilities are further verified by comparison with a high-resolution experimental spectrum. Spontaneous transition probabilities of the c(sup prime)(sub 4) (sup 1)Sigma+(sub u) - Chi (sup 1)Sigma+(sub g) modeling atmospheric emission, can now be calculated reliably.