Sample records for g2 g3 g4

  1. Overview of Shipyard coast line with Piers G1, G2, G3, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Overview of Shipyard coast line with Piers G-1, G-2, G-3, G-4, and G-5 in view, view facing east-southeast - U.S. Naval Base, Pearl Harbor, Pier & Quay Walls, Entrance to Dry Dock No. 2 & Repair Wharfs, east & west sides of Dry Dock No. 2 & west side of Dry Dock No. 3, Pearl City, Honolulu County, HI

  2. Conformational organizations of G-quadruplexes composed of d(G(4)T(n))(3)G(4).

    PubMed

    Wong, Wan Chi; Zhuang, Jinyi; Ng, Selina Ling Ling; New, Lilian Li Lin; Hiew, Shuhui; Guo, Juanjuan; Yang, Zhaoqi; Li, Tianhu

    2010-08-01

    Structural polymorphism is one of the important issues with regard to G-quadruplexes because the structural diversity may significantly affect their biological functions in vivo and their physical property in nano-material. A series of oligonucleotides with four repeat guanines sequence [d(G(4)T(n))(3)G(4) (n=1-6)] were designed. In this study, the effects of loop length on the formation of structures of G-quadruplex were investigated through the result of CD (circular dichroism) and 20% non-denatured polyacrylamide gel electrophoresis. Our studies demonstrate that the length of loop in 100mM KCl solution could predict the conformation of G-quadruplex. Copyright 2010 Elsevier Ltd. All rights reserved.

  3. Secure Military Communications on 3G, 4G and WiMAX

    DTIC Science & Technology

    2013-09-01

    per bit, low latency, good quality of service, good coverage and support for mobility at high speeds. Thus, 4G wireless technologies are based on 3G ...security for military communications. 87 LIST OF REFERENCES [1] C. Blanchard, “Security for the third generation ( 3G ) mobile system,” Elsevier Science...COMMUNICATIONS ON 3G , 4G AND WIMAX by Panagiotis Schoinas September 2013 Thesis Advisor: Gurminder Singh Co-Advisor: John H. Gibson

  4. The Vaporization of B2O3(l) to B2O3(g) and B2O2(g)

    NASA Technical Reports Server (NTRS)

    Jacobson, Nathan S.; Myers, Dwight L.

    2011-01-01

    The vaporization of B2O3 in a reducing environment leads to formation of both B2O3(g) and B2O2(g). While formation of B2O3(g) is well understood, many questions about the formation of B2O2(g) remain. Previous studies using B(s) + B2O3(l) have led to inconsistent thermodynamic data. In this study, it was found that after heating, B(s) and B2O3(l) appear to separate and variations in contact area likely led to the inconsistent vapor pressures of B2O2(g). To circumvent this problem, an activity of boron is fixed with a two-phase mixture of FeB and Fe2B. Both second and third law enthalpies of formation were measured for B2O2(g) and B2O3(g). From these the enthalpies of formation at 298.15 K are calculated to be -479.9 +/- 41.5 kJ/mol for B2O2(g) and -833.4 +/- 13.1 kJ/mol for B2O3(g). Ab initio calculations to determine the enthalpies of formation of B2O2(g) and B2O3(g) were conducted using the W1BD composite method and show good agreement with the experimental values.

  5. Experimental and theoretical investigation of homogeneous gaseous reaction of CO2(g) + nH2O(g) + nNH3(g) → products (n = 1, 2).

    PubMed

    Li, Zhuangjie; Zhang, Baoquan

    2012-09-13

    Decreasing CO2 emissions into the atmosphere is key for reducing global warming. To facilitate the CO2 emission reduction efforts, our laboratory conducted experimental and theoretical investigations of the homogeneous gaseous reaction of CO2(g) + nH2O(g) + nNH3(g) → (NH4)HCO3(s)/(NH4)2CO3(s) (n = 1 and 2) using Fourier transform infrared attenuated total reflectance (FTIR-ATR) spectroscopy and ab initio molecular orbital theory. Our FTIR-ATR experimental results indicate that (NH4)2CO3(s) and (NH4)HCO3(s) are formed as aerosol particulate matter when carbon dioxide reacts with ammonia and water in the gaseous phase at room temperature. Ab initio study of this chemical system suggested that the reaction may proceed through formation of NH3·H2O(g), NH3·CO2(g), and CO2·H2O(g) complexes. Subsequent complexes, NH3·H2O·CO2 and (NH3)2·H2O·CO2, can be formed by adding gaseous reactants to the NH3·H2O(g), NH3·CO2(g), and CO2·H2O(g) complexes, respectively. The NH3·H2O·CO2 and (NH3)2·H2O·CO2 complexes can then be rearranged to produce (NH4)HCO3 and (NH4)2CO3 as final products via a transition state, and the NH3 molecule acts as a medium accepting and donating hydrogen atoms in the rearrangement process. Our computational results also reveal that the presence of an additional water molecule can reduce the activation energy of the rearrangement process. The high activation energy predicted in the present work suggests that the reaction is kinetically not favored, and our experimental observation of (NH4)HCO3(s) and (NH4)2CO3(s) may be attributed to the high concentrations of reactants increasing the reaction rate of the title reactions in the reactor.

  6. Reduced carriership of 4G allele of plasminogen activator inhibitor-1 4G/5G polymorphism in very young survivors of myocardial infarction.

    PubMed

    Rallidis, Loukianos S; Gialeraki, Argyri; Merkouri, Efrosyni; Liakos, George; Dagres, Nikolaos; Sionis, Dimitrios; Travlou, Anthi; Lekakis, John; Kremastinos, Dimitrios T

    2010-05-01

    There are limited and controversial data regarding the impact of 4G/5G polymorphism of the plasminogen activator inhibitor-1 (PAI-1) gene in the pathogenesis of premature myocardial infarction (MI). We explored whether 4G/5G polymorphism of the PAI-1 gene is associated with the development of MI 2 +/- 3.4 years). The control group consisted of 140 healthy individuals matched with cases for age and sex, without a family history of premature coronary heart disease. 4G/5G polymorphism of PAI-1 was tested with polymerase chain reaction and reverse hybridization. 4G allele carriers (4G/4G and 4G/5G genotypes) of PAI-1 were less frequent in patients than in controls (69.6 vs. 83.6%, P = 0.007). 4G carriership of the polymorphism of PAI-1 was associated with lower risk for acute MI (odds ratio 0.45, 95% confidence interval 0.23-0.88, P = 0.02) after adjusting for major cardiovascular risk factors. Patients possessing the 4G allele had higher PAI-1 plasma levels (32.2 +/- 25 vs. 22.2 +/- 11.3 ng/ml, P = 0.006) but lower lipoprotein(a) levels (10.1 [2.1-29.9] vs. 15.3 [8.2-57.1] mg/dl, P = 0.03) compared to 5G/5G homozygotes. Our data indicate that the 4G allele of the PAI-1 4G/5G polymorphism is less frequent among survivors of MI at very young age compared with matched controls.

  7. An ingenious strategy of preparing TiO2/g-C3N4 heterojunction photocatalyst: In situ growth of TiO2 nanocrystals on g-C3N4 nanosheets via impregnation-calcination method

    NASA Astrophysics Data System (ADS)

    Zhang, Guanghui; Zhang, Tianyong; Li, Bin; Jiang, Shuang; Zhang, Xia; Hai, Li; Chen, Xingwei; Wu, Wubin

    2018-03-01

    An ingenious method was employed to design and fabricate the TiO2/g-C3N4 heterojunction photocatalysts in this study. The thermal oxidation etching of g-C3N4 nanosheets and the in situ growth of TiO2 nanocrystal on the surface of g-C3N4 nanosheets were completed simultaneously by the calcination process. The g-C3N4 nanosheets played a crucial role in regulating and assembling the structures and morphologies of TiO2. Furthermore, the thickness and content of g-C3N4, and the crystallinity of TiO2 in TiO2/g-C3N4 composites could be regulated and controlled by the calcination temperature. Among the resultant TiO2/g-C3N4 samples, the TiO2/g-C3N4 sample with 41.6 wt% g-C3N4 exhibited the highest photocatalytic activity. It could degrade almost all MO molecules under visible light irradiation within 3 h. Moreover, it displayed higher visible light photocatalytic performance for degrading MO solution than pure g-C3N4 and D-TiO2. The synergistic effect between TiO2 and g-C3N4 makes significant contributions to the enhancement of the visible light photocatalytic activity. In addition, the favorable photocatalytic performance of TiO2/g-C3N4 nanocomposites is also attributed to the porous structures and uniform morphologies, and large surface area. Furthermore, the resultant TiO2/g-C3N4 exhibits excellent photocatalytic stability. Radical trapping experiments indicated that rad O2- and h+ were the main reactive species during the photodegradation process under visible light irradiation. Hopefully, the results can offer new design and strategy for preparing other g-C3N4-based nanocomposites for environmental and energy applications.

  8. G4RNA: an RNA G-quadruplex database

    PubMed Central

    Garant, Jean-Michel; Luce, Mikael J.; Scott, Michelle S.

    2015-01-01

    Abstract G-quadruplexes (G4) are tetrahelical structures formed from planar arrangement of guanines in nucleic acids. A simple, regular motif was originally proposed to describe G4-forming sequences. More recently, however, formation of G4 was discovered to depend, at least in part, on the contextual backdrop of neighboring sequences. Prediction of G4 folding is thus becoming more challenging as G4 outlier structures, not described by the originally proposed motif, are increasingly reported. Recent observations thus call for a comprehensive tool, capable of consolidating the expanding information on tested G4s, in order to conduct systematic comparative analyses of G4-promoting sequences. The G4RNA Database we propose was designed to help meet the need for easily-retrievable data on known RNA G4s. A user-friendly, flexible query system allows for data retrieval on experimentally tested sequences, from many separate genes, to assess G4-folding potential. Query output sorts data according to sequence position, G4 likelihood, experimental outcomes and associated bibliographical references. G4RNA also provides an ideal foundation to collect and store additional sequence and experimental data, considering the growing interest G4s currently generate. Database URL: scottgroup.med.usherbrooke.ca/G4RNA PMID:26200754

  9. Photocatalytic decomposition of N2O over TiO2/g-C3N4 photocatalysts heterojunction

    NASA Astrophysics Data System (ADS)

    Kočí, K.; Reli, M.; Troppová, I.; Šihor, M.; Kupková, J.; Kustrowski, P.; Praus, P.

    2017-02-01

    TiO2/g-C3N4 photocatalysts with the various TiO2/g-C3N4 weight ratios from 1:2 to 1:6 were fabricated by mechanical mixing in water suspension followed by calcination. Pure TiO2 was prepared by thermal hydrolysis and pure g-C3N4 was prepared from commercial melamine by thermal annealing at 620 °C. All the nanocomposites were characterized by X-ray powder diffraction, UV-vis diffuse reflectance spectroscopy, Raman spectroscopy, infrared spectroscopy, scanning electron microscopy, transmission electron microscopy, photoelectrochemical measurements and nitrogen physisorption. The prepared mixtures along with pure TiO2 and g-C3N4 were tested for the photocatalytic decomposition of nitrous oxide under UVC (λ = 254 nm), UVA (λ = 365 nm) and Vis (λ > 400 nm) irradiation. The TiO2/g-C3N4 nanocomposites showed moderate improvement compared to pure g-C3N4 but pure TiO2 proved to be a better photocatalyst under UVC irradiation. However, under UVA irradiation conditions, the photocatalytic activity of TiO2/g-C3N4 (1:2) nanocomposite exhibited an increase compared to pure TiO2. Nevertheless, further increase of g-C3N4 amount leads/led to a decrease in reactivity. These results are suggesting the nanocomposite with the optimal weight ratio of TiO2 and g-C3N4 have shifted absorption edge energy towards longer wavelengths and decreased the recombination rate of charge carriers compared to pure g-C3N4. This is probably due to the generation of heterojunction on the TiO2/g-C3N4 interface.

  10. Unconventionally prepared TiO2/g-C3N4 photocatalysts for photocatalytic decomposition of nitrous oxide

    NASA Astrophysics Data System (ADS)

    Troppová, Ivana; Šihor, Marcel; Reli, Martin; Ritz, Michal; Praus, Petr; Kočí, Kamila

    2018-02-01

    The TiO2/g-C3N4 nanocomposites with the various TiO2:g-C3N4 weight ratios from 1:1 to 1:3 were prepared unconventionally by pressurized hot water processing in a flow regime. The parent TiO2 and g-C3N4 was prepared by thermal hydrolysis and thermal annealing, respectively. The nanocomposites as well as parent TiO2 and g-C3N4 were characterized using several complementary characterization methods and investigated in the photocatalytic decomposition of N2O under UVA (λ = 365 nm) irradiation. All the prepared TiO2/g-C3N4 nanocomposites showed higher photocatalytic activity in comparison with the pure g-C3N4 and chiefly pure TiO2. The photocatalytic activity of TiO2/g-C3N4 nanocomposites was decreasing in the following sequence: TiO2/g-C3N4 (1:3) > TiO2/g-C3N4 (1:2) > TiO2/g-C3N4 (1:1). In comparison with the parent TiO2 or g-C3N4, the TiO2/g-C3N4 nanocomposites' photocatalytic capability was significantly enhanced by coupling TiO2 with g-C3N4. The generation of TiO2/g-C3N4 Z-scheme photocatalyst mainly benefited from the effective separation of photoinduced electron-hole pairs and the extended optical absorption range. The TiO2/g-C3N4 (1:3) nanocomposite showed the best photocatalytic behavior in a consequence of the optimal weight ratio of TiO2:g-C3N4 and the lowest band gap energy from all nanocomposites. The N2O conversion in its presence was 70.6% after 20 h of UVA irradiation.

  11. PAI-1 4G/5G polymorphism contributes to cancer susceptibility: evidence from meta-analysis.

    PubMed

    Wang, Shangqian; Cao, Qiang; Wang, Xiaoxiang; Li, Bingjie; Tang, Min; Yuan, Wanqing; Fang, Jianzheng; Qian, Jian; Qin, Chao; Zhang, Wei

    2013-01-01

    The plasminogen activator inhibitor-1 (PAI-1) is expressed in many cancer cell types and allows the modulation of cancer growth, invasion and angiogenesis. To date, studies investigated the association between a functional polymorphism in PAI-1 (4G/5G) and risk of cancer have shown inclusive results. A meta-analysis based on 25 case-control studies was performed to address this issue. Odds ratios (OR) with corresponding 95% confidence intervals (CIs) were used to assess the association. The statistical heterogeneity across studies was examined with I(2) test. Overall, a significant increased risk of cancer was associated with the PAI-1 4G/4G polymorphism for the allele contrast (4G vs. 5G: OR = 1.10, CI = 1.03-1.18, I(2) = 49.5%), the additive genetic model (4G/4G vs. 5G/5G: OR = 1.21, CI = 1.06-1.39, I(2) = 51.9%), the recessive genetic model (4G/4G vs. 4G/5G+5G/5G: OR = 1.11, CI = 1.04-1.18, I(2) = 20.8%). In the subgroup analysis by ethnicity, the results indicated that individuals with 4G/4G genotype had a significantly higher cancer risk among Caucasians (4G/4G vs. 5G/5G: OR = 1.31, 95%CI = 1.09-1.59, I(2) = 59.6%; 4G/4G vs. 4G/5G: OR = 1.12, 95%CI = 1.04-1.21, I(2) = 3.6%; recessive model: OR = 1.12, 95%CI = 1.05-1.21, I(2) = 25.3%). The results of the present meta-analysis support an association between the PAI-1 4G/5G polymorphism and increasing cancer risk, especially among Caucasians, and those with 4G allele have a high risk to develop colorectal cancer and endometrial cancer.

  12. PAI-1 4G/5G Polymorphism Contributes to Cancer Susceptibility: Evidence from Meta-Analysis

    PubMed Central

    Li, Bingjie; Tang, Min; Yuan, Wanqing; Fang, Jianzheng; Qian, Jian; Qin, Chao; Zhang, Wei

    2013-01-01

    Background The plasminogen activator inhibitor-1 (PAI-1) is expressed in many cancer cell types and allows the modulation of cancer growth, invasion and angiogenesis. To date, studies investigated the association between a functional polymorphism in PAI-1 (4G/5G) and risk of cancer have shown inclusive results. Methods A meta-analysis based on 25 case-control studies was performed to address this issue. Odds ratios (OR) with corresponding 95% confidence intervals (CIs) were used to assess the association. The statistical heterogeneity across studies was examined with I2 test. Results Overall, a significant increased risk of cancer was associated with the PAI-1 4G/4G polymorphism for the allele contrast (4G vs. 5G: OR = 1.10, CI = 1.03–1.18, I2 = 49.5%), the additive genetic model (4G/4G vs. 5G/5G: OR = 1.21, CI = 1.06–1.39, I2 = 51.9%), the recessive genetic model (4G/4G vs. 4G/5G+5G/5G: OR = 1.11, CI = 1.04–1.18, I2 = 20.8%). In the subgroup analysis by ethnicity, the results indicated that individuals with 4G/4G genotype had a significantly higher cancer risk among Caucasians (4G/4G vs. 5G/5G: OR = 1.31, 95%CI = 1.09–1.59, I2 = 59.6%; 4G/4G vs. 4G/5G: OR = 1.12, 95%CI = 1.04–1.21, I2 = 3.6%; recessive model: OR = 1.12, 95%CI = 1.05–1.21, I2 = 25.3%). Conclusions The results of the present meta-analysis support an association between the PAI-1 4G/5G polymorphism and increasing cancer risk, especially among Caucasians, and those with 4G allele have a high risk to develop colorectal cancer and endometrial cancer. PMID:23437240

  13. Immunoglobulin class switching to IgG4 in Warthin tumor and analysis of serum IgG4 levels and IgG4-positive plasma cells in the tumor.

    PubMed

    Aga, Mitsuharu; Kondo, Satoru; Yamada, Kazunori; Wakisaka, Naohiro; Yagi-Nakanishi, Sayaka; Tsuji, Akira; Endo, Kazuhira; Murono, Shigeyuki; Ito, Makoto; Muramatsu, Masamichi; Kawano, Mitsuhiro; Yoshizaki, Tomokazu

    2014-04-01

    We previously reported a case of immunoglobulin (Ig)G4-related immune inflammation in Warthin tumor. Increased serum IgG4 levels and tissue infiltration of IgG4-positive plasma cells are characteristics of IgG4-related disease (IgG4-RD), a newly emerging clinicopathological entity. However, the relationship between IgG4-RD and Warthin tumor remains to be elucidated. We aimed to investigate the involvement of systemic and local IgG4 production and class-switch recombination in Warthin tumor. We examined serum IgG4 levels and also analyzed the involvement of IgG4-positive plasma cells in Warthin tumors (18 cases) compared with those of pleomorphic adenomas (19 cases) as controls. Furthermore, in specimens of Warthin tumors (3 cases), pleomorphic adenomas (2 cases), and IgG4-RDs (2 cases), we examined messenger RNA expression of activation-induced cytidine deaminase, IgG4 germline transcripts and productive IgG4 by reverse transcription polymerase chain reaction. Serum IgG4 levels were increased in 5 of 18 Warthin tumors and not in any of the 19 pleomorphic adenomas. Infiltration of IgG4-positive plasma cells was detected in 4 Warthin tumors and none in the pleomorphic adenomas. Moreover, activation-induced cytidine deaminase, IgG4 germline transcripts, and productive IgG4 messenger RNA were found to be expressed in 2 of 3 Warthin tumors as well as IgG4-RDs by reverse transcription polymerase chain reaction, but not in pleomorphic adenomas. In conclusion, immunoglobulin class switching to IgG4 may be involved in the pathogenesis of Warthin tumor, and it is possible that certain inflammatory background with an immune reaction is involved in the pathogenesis of Warthin tumor. © 2013.

  14. Diagnostic Performance of Serum IgG4 Levels in Patients With IgG4-Related Disease

    PubMed Central

    Yu, Kuang-Hui; Chan, Tien-Ming; Tsai, Ping-Han; Chen, Ching-Hui; Chang, Pi-Yueh

    2015-01-01

    Abstract The aim of this study is to study the clinical features and diagnostic performance of IgG4 in Chinese populations with IgG4-related diseases (IgG4-RDs). The medical records of 2901 adult subjects who underwent serum IgG4 level tests conducted between December 2007 and May 2014 were reviewed. Serum concentrations of IgG4 were measured in 2901 cases, including 161 (5.6%) patients with IgG4-RD and 2740 (94.4%) patients without IgG4-RD (non-IgG4-RD group). The mean age of the IgG4-RD patients was 58.4 ± 16.1 years (range: 21–87), and 48 (29.8%) were women. The mean serum IgG4 level was significantly much higher in IgG4-RD patients than in non-IgG4-RD (1062.6 vs 104.3 mg/dL, P < 0.001) participants. For IgG4 >135 mg/dL, the sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV), likelihood ratio (LR)+, and LR− were 86%, 77%, 18%, 99%, 3.70, and 0.19, respectively. When the upper limit of normal was doubled for an IgG4 >270 mg/dL, the corresponding data were 75%, 94%, 43%, 98%, 12.79, and 0.26, respectively. For IgG4 >405 mg/dL (tripling the upper limit of normal), the corresponding data were 62%, 98%, 68%, 98%, 37.00, and 0.39, respectively. When calculated according to the manufacturer's package insert cutoff (>201 mg/dL) for the diagnosis of IgG4-RD, the corresponding sensitivity, specificity, PPV, NPV, LR+, and LR− were 80%, 89%, 29%, 99%, 7.00, and 0.23, respectively. For IgG4 >402 mg/dL (>2× the upper limit of the normal range), the corresponding data were 62%, 98%, 68%, 98%, 36.21, and 0.39, respectively. For IgG4 >603 mg/dL (>3× the upper limit of the normal range), the corresponding data were 50%, 99%, 84%, 97%, 90.77 and 0.51, respectively. The optimal cutoff value of serum IgG4 (measured by nephelometry using a Siemens BN ProSpec instrument and Siemens reagent) for the diagnosis of IgG4-RD was 248 mg/dL, the sensitivity and specificity were 77.6% and 92.8%, respectively. The present

  15. Significance of immunoglobulin G4 (IgG4)-positive cells in extrahepatic cholangiocarcinoma: molecular mechanism of IgG4 reaction in cancer tissue.

    PubMed

    Harada, Kenichi; Shimoda, Shinji; Kimura, Yasushi; Sato, Yasunori; Ikeda, Hiroko; Igarashi, Saya; Ren, Xiang-Shan; Sato, Hirohide; Nakanuma, Yasuni

    2012-07-01

    IgG4 reactions consisting of marked infiltration by immunoglobulin G4 (IgG4)-positive plasma cells in affected organs is found in cancer patients as well as patients with IgG4-related diseases. Notably, extrahepatic cholangiocarcinomas accompanying marked IgG4 reactions clinicopathologically mimic IgG4-related sclerosing cholangitis. The regulatory cytokine interleukin (IL)-10 is thought to induce the differentiation of IgG4-positive cells. In this study, to clarify the mechanism of the IgG4 reaction in extrahepatic cholangiocarcinoma, we investigated nonprofessional antigen-presenting cells (APCs) generating IL-10-producing regulatory T cells (anergy T cells) and Foxp3-positive regulatory cells producing IL-10. Immunohistochemistry targeting IgG4, HLA-DR, CD80, CD86, and Foxp3 was performed using 54 cholangiocarcinoma specimens from 24 patients with gallbladder cancer, 22 patients with common bile duct cancer, and eight patients with cancer of the Papilla of Vater. Moreover, a molecular analysis of Foxp3 and IL-10 was performed using a cultured human cholangiocarcinoma cell line. Consequently, 43% of the cholangiocarcinomas were found to be abundant in IgG4. Those expressing HLA-DR but lacking costimulatory molecules (CD80 and CD86) and those expressing Foxp3 detected by an antibody recognizing the N terminus accounted for 54% and 39% of cases, respectively. Moreover, the number of IgG4-positive cells was larger in these cases than in other groups. In cultured cells, the presence of a splicing variant of Foxp3 messenger RNA and the expression of IL-10 were demonstrated. Extrahepatic cholangiocarcinoma is often accompanied by significant infiltration of IgG4-positive cells. Cholangiocarcinoma cells could play the role of nonprofessional APCs and Foxp3-positive regulatory cells, inducing IgG4 reactions via the production of IL-10 indirectly and directly, respectively. Copyright © 2012 American Association for the Study of Liver Diseases.

  16. The association between PAI-1 -675 4G/5G polymorphism and type 2 diabetes mellitus.

    PubMed

    Chen, L; Li, S-Y; Liu, M

    2017-08-15

    In this study, we aimed to analyze the association between plasminogen activator inhibitor 1 (PAI-1) -675 4G/5G polymorphism and type 2 diabetes mellitus (T2DM) risk. We included in 187 T2DM patients and 186 heathy controls between 2014 and 2017 from Tianjin Gong An Hospital, China. All patients and controls were ethnically Chinese Han population. The primers and polymerase chain reaction (PCR) conditions were performed. Results from this case-control study suggested that PAI-1 -675 4G/5G polymorphism was not associated with T2DM risk in four genetic models. Additionally, PAI-1 -675 4G/5G polymorphism was not associated with clinical and laboratory characteristics, such as age, gender, body mass index, systolic blood pressure, diastolic blood pressure, total cholesterol, triglycerides, and HbA1c. In conclusion, this case-control study suggested that PAI-1 -675 4G/5G polymorphism was not associated with T2DM risk in this population.

  17. HLA-G 3′UTR Polymorphisms Predict Drug-Induced G3-4 Toxicity Related to Folinic Acid/5-Fluorouracil/Oxaliplatin (FOLFOX4) Chemotherapy in Non-Metastatic Colorectal Cancer

    PubMed Central

    Garziera, Marica; Virdone, Saverio; De Mattia, Elena; Scarabel, Lucia; Cecchin, Erika; Polesel, Jerry; D’Andrea, Mario; Pella, Nicoletta; Buonadonna, Angela; Favaretto, Adolfo; Toffoli, Giuseppe

    2017-01-01

    Polymorphisms in drug-metabolizing enzymes might not completely explain inter-individual differences in toxicity profiles of patients with colorectal cancer (CRC) that receive folinic acid/5-fluorouracil/oxaliplatin (FOLFOX4). Recent data indicate that the immune system could contribute to FOLFOX4 outcomes. In light of the immune inhibitory nature of human leukocyte antigen-G (HLA-G), a non-classical major histocompatibility complex (MHC) class I molecule, we aimed to identify novel genomic markers of grades 3 and 4 (G3-4) toxicity related to FOLFOX4 therapy in patients with CRC. We retrospectively analyzed data for 144 patients with stages II-III CRC to identify HLA-G 3′ untranslated region (3′UTR) polymorphisms and related haplotypes and evaluate their impact on the risk of developing G3-4 toxicities (i.e., neutropenia, hematological/non-hematological toxicity, neurotoxicity) with logistic regression. The rs1610696-G/G polymorphism was associated with increased risk of G3-4 neutropenia (OR = 3.76, p = 0.015) and neurotoxicity (OR = 8.78, p = 0.016); rs371194629-Ins/Ins was associated with increased risk of neurotoxicity (OR = 5.49, p = 0.027). HLA-G 3′UTR-2, which contains rs1610696-G/G and rs371194629-Ins/Ins polymorphisms, was associated with increased risk of G3-4 neutropenia (OR = 3.92, p = 0.017) and neurotoxicity (OR = 11.29, p = 0.009). A bootstrap analysis confirmed the predictive value of rs1610696 and rs371194629, but the UTR-2 haplotype was validated only for neurotoxicity. This exploratory study identified new HLA-G 3′UTR polymorphisms/haplotypes as potential predictive markers of G3-4 toxicities in CRC. PMID:28653974

  18. Efficient water disinfection with Ag2WO4-doped mesoporous g-C3N4 under visible light.

    PubMed

    Li, Yi; Li, Yanan; Ma, Shuanglong; Wang, Pengfei; Hou, Qianlei; Han, Jingjing; Zhan, Sihui

    2017-09-15

    Ag 2 WO 4 /g-C 3 N 4 composite photocatalyst was synthesized by polymerization of thiourea and ammonia chloride combined with the deposition-precipitation method, which was applied as an efficient visible-light driven photocatalyst for inactivating Escherichia coli (E. coli). The physicochemical properties of these photocatalysts were systematically characterized by various techniques such as SEM, TEM, XRD, FT-IR, BET, UV-vis DRS and PL. The synthesized photocatalysts exhibited outstandingly enhanced photocatalytic disinfection efficiency compared with that of pure g-C 3 N 4 and Ag 2 WO 4 under visible light. Furthermore, the optimal mass ratio of the Ag 2 WO 4 to g-C 3 N 4 was 5wt%, and a number of live bacteria could be completely inactivated with Ag 2 WO 4 (5%)/g-C 3 N 4 (100μg/mL) after 90min under visible light irradiation. The high disinfection efficiency is due to the synergetic effect between g-C 3 N 4 and Ag 2 WO 4 , including a good distribution of Ag 2 WO 4 particles on the surface of g-C 3 N 4 and an improved separation rate of photogenerated electron-hole pairs. The enhanced disinfection mechanism was also investigated using photogenerated current densities and electrochemical impedance spectroscopy (EIS). Considering the bulk availability and excellent disinfection activity of Ag 2 WO 4 /g-C 3 N 4 composite, it is a promising solar-driven photocatalyst for cleaning the microbial contaminated water. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. 4G/5G Plasminogen Activator Inhibitor-1 Polymorphisms and Haplotypes Are Associated with Pneumonia

    PubMed Central

    Yende, Sachin; Angus, Derek C.; Ding, Jingzhong; Newman, Anne B.; Kellum, John A.; Li, Rongling; Ferrell, Robert E.; Zmuda, Joseph; Kritchevsky, Stephen B.; Harris, Tamara B.; Garcia, Melissa; Yaffe, Kristine; Wunderink, Richard G.

    2007-01-01

    Rationale: Plasminogen activator inhibitor (PAI)-1 inhibits urokinase and tissue plasminogen activator, required for host response to infection. Whether variation within the PAI-1 gene is associated with increased susceptibility to infection is unknown. Objectives: To ascertain the role of the 4G/5G polymorphism and other genetic variants within the PAI-1 gene. We hypothesized that variants associated with increased PAI-1 expression would be associated with an increased occurrence of community-acquired pneumonia (CAP). Methods: Longitudinal analysis (>12 yr) of the Health, Aging, and Body Composition cohort, aged 65–74 years at start of analysis. Measurements and Main Results: We genotyped the 4G/5G PAI-1 polymorphism and six additional single nucleotide polymorphisms. Of the 3,075 subjects, 272 (8.8%) had at least one hospitalization for CAP. Among whites, variants at the PAI4G,5G, PAI2846, and PAI7343 sites had higher risk of CAP (P = 0.018, 0.021, and 0.021, respectively). At these sites, variants associated with higher PAI-1 expression were associated with increased CAP susceptibility. Compared with the 5G/5G genotypes at PAI4G,5G site, the 4G/4G and 4G/5G genotypes were associated with a 1.98-fold increased risk of CAP (95% confidence interval, 1.23.2; P = 0.006). In whole blood stimulation assay, subjects with a 4G allele had 3.3- and 1.9-fold increased PAI-1 expression (P = 0.043 and 0.034, respectively). In haplotype analysis, the 4G/G/C/A haplotype at the PAI4G,5G, PAI2846, PAI4588, and PAI7343 single nucleotide polymorphisms was associated with higher CAP susceptibility, whereas the 5G/G/C/A haplotype was associated with lower CAP susceptibility. No associations were seen among blacks. Conclusions: Genotypes associated with increased expression of PAI-1 were associated with increased susceptibility to CAP in elderly whites. PMID:17761618

  20. Demonstration of IgG Subclass (IgG1 and IgG3) in Immuno-Related Hemocytopenia.

    PubMed

    Shao, Yuanyuan; Qi, Xiao; Fu, Rong; Liu, Hui; Wang, Yihao; Ding, Shaoxue; Wang, Huaquan; Li, Lijuan; Shao, Zonghong

    2018-06-01

    Immuno-related hemocytopenia (IRH) is defined as idiopathic cytopenia of undetermined significance (ICUS) patients with autoantibodies. In our previous studies, we found that IgG1 levels were increased in IRH patients and might cause the destruction of hematopoietic cells. In this study, we analyzed IgG subclasses in 30 IRH patients (male:female = 13:17, median age 32 years, range 18 - 56), 15 IRH remission patients (IRH-R) (male:female = 6:9, median age 34, range 20 - 52) and 20 normal controls (male:female = 8:12, median age 27, range 24 - 36) by Cytometric Bead Array, Flow Cytometry and Immunohistochemical staining. Levels of IgG1/IgG3 in the bone marrow supernatant of IRH patents, as well as the proportion of CD5+ B lymphocytes and Th2 cells (CD3+CD8-IL-4+) were higher than those of IRH-R patients and normal controls, and IgG1 levels had a positive correlation with the proportion of Th2 cells. In IRH patients, IgG1 and IgG3 were positive on nucleated erythrocytes and granulocytes, which were negative in IRH-R patients and healthy controls and had inverse correlations with hematopoietic function. Using immunohistochemical staining, IgG1 were also detected on bone marrow biopsies of IRH patients. The results indicated that IgG1 and IgG3 autoantibodies in IRH patients might play a key role in the IRH pathogenesis and in the abnormal immune function of IRH patients.

  1. Heterogeneous reactions of HNO3(g) + NaCl(s) yields HCl(g) + NaNO3(s) and N2O5(g) + NaCl(s) yields ClNO2(g) + NaNO3(s)

    NASA Technical Reports Server (NTRS)

    Leu, Ming-Taun; Timonen, Raimo S.; Keyser, Leon F.; Yung, Yuk L.

    1995-01-01

    The heterogeneous reactions of HNO3(g) + NaCl(s) yields HCl(g) + NaNO3(s) (eq 1) and N2O5(g) + NaCl(s) yields ClNO2(g) + NaNO3(S) (eq 2) were investigated over the temperature range 223-296 K in a flow-tube reactor coupled to a quadrupole mass spectrometer. Either a chemical ionization mass spectrometer (CIMS) or an electron-impact ionization mass spectrometer (EIMS) was used to provide suitable detection sensitivity and selectivity. In order to mimic atmospheric conditions, partial pressures of HNO3 and N2O5 in the range 6 x 10(exp -8) - 2 x 10(exp -6) Torr were used. Granule sizes and surface roughness of the solid NaCl substrates were determined by using a scanning electron microscope. For dry NaCl substrates, decay rates of HNO3 were used to obtain gamma(1) = 0.013 +/- 0.004 (1sigma) at 296 K and > 0.008 at 223 K, respectively. The error quoted is the statistical error. After all corrections were made, the overall error, including systematic error, was estimated to be about a factor of 2. HCl was found to be the sole gas-phase product of reaction 1. The mechanism changed from heterogeneous reaction to predominantly physical adsorption when the reactor was cooled from 296 to 223 K. For reaction 2 using dry salts, gamma(2) was found to be less than 1.0 x 10(exp -4) at both 223 and 296 K. The gas-phase reaction product was identified as ClNO2 in previous studies using an infrared spectrometer. An enhancement in reaction probability was observed if water was not completely removed from salt surfaces, probably due to the reaction of N2O5(g) + H2O(s) yields 2HNO3(g). Our results are compared with previous literature values obtained using different experimental techniques and conditions. The implications of the present results for the enhancement of the hydrogen chloride column density in the lower stratosphere after the El Chichon volcanic eruption and for the chemistry of HCl and HNO3 in the marine troposphere are discussed.

  2. IgG4-related prostatitis progressed from localized IgG4-related lymphadenopathy.

    PubMed

    Li, Dujuan; Kan, Yunzhen; Fu, Fangfang; Wang, Shuhuan; Shi, Ligang; Liu, Jie; Kong, Lingfei

    2015-01-01

    Immunoglobulin G4-related disease (IgG4-RD) is a recently described inflammatory disease involving multiple organs. Prostate involvement with IgG4-RD is very rare. In this report, we describe a case of IgG4-related prostatitis progressed from localized IgG4-related lymphadenopathy. This patient was present with urine retention symptoms. MRI and CT examination revealed the prostatic enlargement and the multiple lymphadenopathy. Serum IgG4 levels were elevated. Prostatic tissue samples resected both this time and less than 1 year earlier showed the same histological type of prostatitis with histopathologic and immunohistochemical findings characteristic of IgG4-RD. The right submandibular lymph nodes excised 2 years earlier were eventually proven to be follicular hyperplasia-type IgG4-related lymphadenopathy. This is the first case of IgG4-RD that began as localized IgG4-related lymphadenopathy and progressed into a systemic disease involving prostate and multiple lymph nodes. This patient showed a good response to steroid therapy. This leads us to advocate a novel pathogenesis of prostatitis, and a novel therapeutic approach against prostatitis. Pathologists and urologists should consider this disease entity in the patients with elevated serum IgG4 levels and the symptoms of prostatic hyperplasia to avoid ineffective medical or unnecessary surgical treatment.

  3. Downlink power distributions for 2G and 3G mobile communication networks.

    PubMed

    Colombi, Davide; Thors, Björn; Persson, Tomas; Wirén, Niklas; Larsson, Lars-Eric; Jonsson, Mikael; Törnevik, Christer

    2013-12-01

    Knowledge of realistic power levels is key when conducting accurate EMF exposure assessments. In this study, downlink output power distributions for radio base stations in 2G and 3G mobile communication networks have been assessed. The distributions were obtained from network measurement data collected from the Operations Support System, which normally is used for network monitoring and management. Significant amounts of data were gathered simultaneously for large sets of radio base stations covering wide geographical areas and different environments. The method was validated with in situ measurements. For the 3G network, the 90th percentile of the averaged output power during high traffic hours was found to be 43 % of the maximum available power. The corresponding number for 2G, with two or more transceivers installed, was 65 % or below.

  4. Supersymmetric M3-branes and G2 manifolds

    NASA Astrophysics Data System (ADS)

    Cvetič, M.; Gibbons, G. W.; Lü, H.; Pope, C. N.

    2002-01-01

    We obtain a generalisation of the original complete Ricci-flat metric of G2 holonomy on R4×S 3 to a family with a nontrivial parameter λ. For generic λ the solution is singular, but it is regular when λ={-1,0,+1}. The case λ=0 corresponds to the original G2 metric, and λ={-1,1} are related to this by an S3 automorphism of the SU(2) 3 isometry group that acts on the S3× S3 principal orbits. We then construct explicit supersymmetric M3-brane solutions in D=11 supergravity, where the transverse space is a deformation of this class of G2 metrics. These are solutions of a system of first-order differential equations coming from a superpotential. We also find M3-branes in the deformed backgrounds of new G2 holonomy metrics that include one found by A. Brandhuber, J. Gomis, S. Gubser and S. Gukov, and show that they also are supersymmetric.

  5. Nuclease digestion and mass spectrometric characterization of oligodeoxyribonucleotides containing 1,2-GpG, 1,2-ApG, and 1,3-GpXpG cisplatin intrastrand cross-links.

    PubMed

    Williams, Renee T; Nalbandian, Jenifer N; Tu, Audrey; Wang, Yinsheng

    2013-05-01

    The primary mode of action for cis-diamminedichloroplatinum (II), referred to as cisplatin, toward the treatment of solid malignancies is through formation of cross-links with DNA at purine sites, especially guanines. We prepared oligodeoxyribonucleotides (ODNs) containing a 1,2-GpG, 1,2-ApG, or 1,3-GpXpG cisplatin intrastrand cross-link and the corresponding ODNs modified with (15)N2-labeled cisplatin, and characterized these ODNs with electrospray ionization mass spectrometry (ESI-MS) and tandem MS (MS/MS). We also employed LC-MS/MS to characterize the digestion products of these ODNs after treatment with a cocktail of 4 enzymes (nuclease P1, phosphodiesterases I and II, and alkaline phosphatase). 1,2-GpG was released from the ODNs as a dinucleoside monophosphate or a dinucleotide. Analyses of the digestion products of ODNs containing a 1,2-GpG cross-link on the 5' or 3' terminus revealed that the dinucleotide carries a terminal 5' phosphate. On the other hand, digestion of the 1,3-GpXpG intrastrand cross-link yielded 3 dinucleoside products with 0, 1, or 2 phosphate groups. The availability of the ODNs carrying the stable isotope-labeled lesions, MS/MS analyses of the cisplatin-modified ODNs, and the characterization of the enzymatic digestion products of these ODNs set the stage for the future LC-MS/MS quantification of the 1,2-GpG, 1,2-ApG, and 1,3-GpXpG lesions in cellular DNA. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. Nuclease Digestion and Mass Spectrometric Characterization of Oligodeoxyribonucleotides Containing 1,2-GpG, 1,2-ApG, and 1,3-GpXpG Cisplatin Intrastrand Cross-links

    PubMed Central

    Williams, Renee T.; Nalbandian, Jenifer; Tu, Audrey; Wang, Yinsheng

    2013-01-01

    Background The primary mode of action for cis-diamminedichloroplatinum (II), referred to as cisplatin, towards the treatment of solid malignancies is through formation of cross-links with DNA at purine sites, especially guanines. Methods We prepared oligodeoxyribonucleotides (ODNs) containing a 1,2-GpG, 1,2-ApG, or 1,3-GpXpG cisplatin intrastrand cross-link and the corresponding ODNs modified with 15N2-labeled cisplatin, and characterized these ODNs with electrospray ionization mass spectrometry (ESI-MS) and tandem MS (MS/MS). We also employed LC-MS/MS to characterize the digestion products of these ODNs after treatment with a cocktail of 4 enzymes (nuclease P1, phosphodiesterases I and II, and alkaline phosphatase). Results 1,2-GpG was released from the ODNs as a dinucleoside monophosphate or a dinucleotide. Analyses of the digestion products of ODNs containing a 1,2-GpG cross-link on the 5′ or 3′ terminus revealed that the dinucleotide carries a terminal 5′ phosphate. On the other hand, digestion of the 1,3-GpXpG intrastrand cross-link yielded 3 dinucleoside products with 0, 1, or 2 phosphate groups. Results The availability of the ODNs carrying the stable isotope-labeled lesions, MS/MS analyses of the cisplatin-modified ODNs, and the characterization of the enzymatic digestion products of these ODNs set the stage for the future LC-MS/MS quantification of the 1,2-GpG, 1,2-ApG, and 1,3-GpXpG lesions in cellular DNA. PMID:23266768

  7. A review on g-C3N4 for photocatalytic water splitting and CO2 reduction

    NASA Astrophysics Data System (ADS)

    Ye, Sheng; Wang, Rong; Wu, Ming-Zai; Yuan, Yu-Peng

    2015-12-01

    Solar fuel generation through water splitting and CO2 photoreduction is an ideal route to provide the renewable energy sources and mitigate global warming. The main challenge in photocatalysis is finding a low-cost photocatalyst that can work efficiently to split water into hydrogen and reduce CO2 to hydrocarbon fuels. Metal-free g-C3N4 photocatalyst shows great potentials for solar fuel production. In this mini review, we summarize the most current advances on novel design idea and new synthesis strategy for g-C3N4 preparation, insightful ideas on extending optical absorption of pristine g-C3N4, overall water splitting and CO2 photoreduction over g-C3N4 based systems. The research challenges and perspectives on g-C3N4 based photocatalysts were also suggested.

  8. Enhanced visible light photocatalytic H2-production of g-C3N4/WS2 composite heterostructures

    NASA Astrophysics Data System (ADS)

    Akple, Maxwell Selase; Low, Jingxiang; Wageh, S.; Al-Ghamdi, Ahmed. A.; Yu, Jiaguo; Zhang, Jun

    2015-12-01

    As a clean and renewable solar H2-production system to address the increasing global environmental crisis and energy demand, photocatalytic hydrogen production from water splitting using earth abundant materials has received a lot of attention. In this study, WS2-graphitic carbon nitride (g-C3N4) composites were prepared using WO3 and thiourea as precursors through a gas-solid reaction. Different amount of WS2 were loaded on g-C3N4 to form the heterostructures and the composite samples exhibited enhanced photocatalytic activity for H2 production under visible light. The composite sample with 0.01 wt% WS2 exhibited the highest H2-production rate of 101 μmol g-1 h-1, which was even better than that of the Pt-C3N4 sample with the same loading content. The high photocatalytic activity was attributed to the formation of heterojunction between g-C3N4 and WS2 cocatalyst which allowed for effective separation of photogenerated charge carriers. This work showed the possibility for the utilization of low cost WS2 as an efficient cocatalyst to promote the photocatalytic H2 production of g-C3N4.

  9. New application of Z-scheme Ag3PO4/g-C3N4 composite in converting CO2 to fuel.

    PubMed

    He, Yiming; Zhang, Lihong; Teng, Botao; Fan, Maohong

    2015-01-06

    This research was designed for the first time to investigate the activities of photocatalytic composite, Ag3PO4/g-C3N4, in converting CO2 to fuels under simulated sunlight irradiation. The composite was synthesized using a simple in situ deposition method and characterized by various techniques including Brunauer-Emmett-Teller method (BET), X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FT-IR), scanning electron microscopy (SEM), transmission electron microscopy (TEM), X-ray photoelectron spectroscopy (XPS), UV-vis diffuse reflectance spectroscopy (DRS), photoluminescence spectroscopy (PL), and an electrochemical method. Thorough investigation indicated that the composite consisted of Ag3PO4, Ag, and g-C3N4. The introduction of Ag3PO4 on g-C3N4 promoted its light absorption performance. However, more significant was the formation of heterojunction structure between Ag3PO4 and g-C3N4, which efficiently promoted the separation of electron-hole pairs by a Z-scheme mechanism and ultimately enhanced the photocatalytic CO2 reduction performance of the Ag3PO4/g-C3N4. The optimal Ag3PO4/g-C3N4 photocatalyst showed a CO2 conversion rate of 57.5 μmol · h(-1) · gcat(-1), which was 6.1 and 10.4 times higher than those of g-C3N4 and P25, respectively, under simulated sunlight irradiation. The work found a new application of the photocatalyst, Ag3PO4/g-C3N4, in simultaneous environmental protection and energy production.

  10. Plasminogen activator inhibitor-1 4G/5G polymorphism and retinopathy risk in type 2 diabetes: a meta-analysis.

    PubMed

    Zhang, Tengyue; Pang, Chong; Li, Ningdong; Zhou, Elaine; Zhao, Kanxing

    2013-01-02

    Mounting evidence has suggested that plasminogen activator inhibitor-1 (PAI-1) is a candidate for increased risk of diabetic retinopathy. Studies have reported that insertion/deletion polymorphism in the PAI-1 gene may influence the risk of this disease. To comprehensively address this issue, we performed a meta-analysis to evaluate the association of PAI-1 4G/5G polymorphism with diabetic retinopathy in type 2 diabetes. Data were retrieved in a systematic manner and analyzed using Review Manager and STATA Statistical Software. Crude odds ratios (ORs) with 95% confidence intervals (CIs) were used to assess the strength of associations. Nine studies with 1, 217 cases and 1, 459 controls were included. Allelic and genotypic comparisons between cases and controls were evaluated. Overall analysis suggests a marginal association of the 4G/5G polymorphism with diabetic retinopathy (for 4G versus 5G: OR 1.13, 95%CI 1.01 to 1.26; for 4G/4G versus 5G/5G: OR 1.30, 95%CI 1.04 to 1.64; for 4G/4G versus 5G/5G + 4G/5G: OR 1.26, 95%CI 1.05 to 1.52). In subgroup analysis by ethnicity, we found an association among the Caucasian population (for 4G versus 5G: OR 1.14, 95% CI 1.00 to 1.30; for 4G/4G versus 5G/5G: OR 1.33, 95%CI 1.02 to 1.74; for 4G/4G versus 5G/5G + 4G/5G: OR 1.41, 95%CI 1.13 to 1.77). When stratified by the average duration of diabetes, patients with diabetes histories longer than 10 years have an elevated susceptibility to diabetic retinopathy than those with shorter histories (for 4G/4G versus 5G/5G: OR 1.47, 95%CI 1.08 to 2.00). We also detected a higher risk in hospital-based studies (for 4G/4G versus 5G/5G+4G/5G: OR 1.27, 95%CI 1.02 to 1.57). The present meta-analysis suggested that 4G/5G polymorphism in the PAI-1 gene potentially increased the risk of diabetic retinopathy in type 2 diabetes and showed a discrepancy in different ethnicities. A higher susceptibility in patients with longer duration of diabetes (more than 10 years) indicated a gene

  11. Plasminogen activator inhibitor-1 4G/5G polymorphism and retinopathy risk in type 2 diabetes: a meta-analysis

    PubMed Central

    2013-01-01

    Background Mounting evidence has suggested that plasminogen activator inhibitor-1 (PAI-1) is a candidate for increased risk of diabetic retinopathy. Studies have reported that insertion/deletion polymorphism in the PAI-1 gene may influence the risk of this disease. To comprehensively address this issue, we performed a meta-analysis to evaluate the association of PAI-1 4G/5G polymorphism with diabetic retinopathy in type 2 diabetes. Methods Data were retrieved in a systematic manner and analyzed using Review Manager and STATA Statistical Software. Crude odds ratios (ORs) with 95% confidence intervals (CIs) were used to assess the strength of associations. Results Nine studies with 1, 217 cases and 1, 459 controls were included. Allelic and genotypic comparisons between cases and controls were evaluated. Overall analysis suggests a marginal association of the 4G/5G polymorphism with diabetic retinopathy (for 4G versus 5G: OR 1.13, 95%CI 1.01 to 1.26; for 4G/4G versus 5G/5G: OR 1.30, 95%CI 1.04 to 1.64; for 4G/4G versus 5G/5G + 4G/5G: OR 1.26, 95%CI 1.05 to 1.52). In subgroup analysis by ethnicity, we found an association among the Caucasian population (for 4G versus 5G: OR 1.14, 95% CI 1.00 to 1.30; for 4G/4G versus 5G/5G: OR 1.33, 95%CI 1.02 to 1.74; for 4G/4G versus 5G/5G + 4G/5G: OR 1.41, 95%CI 1.13 to 1.77). When stratified by the average duration of diabetes, patients with diabetes histories longer than 10 years have an elevated susceptibility to diabetic retinopathy than those with shorter histories (for 4G/4G versus 5G/5G: OR 1.47, 95%CI 1.08 to 2.00). We also detected a higher risk in hospital-based studies (for 4G/4G versus 5G/5G+4G/5G: OR 1.27, 95%CI 1.02 to 1.57). Conclusions The present meta-analysis suggested that 4G/5G polymorphism in the PAI-1 gene potentially increased the risk of diabetic retinopathy in type 2 diabetes and showed a discrepancy in different ethnicities. A higher susceptibility in patients with longer duration of diabetes (more than 10

  12. Plasminogen activator inhibitor-1 4G/5G polymorphism is associated with type 2 diabetes risk

    PubMed Central

    Zhao, Luqian; Huang, Ping

    2013-01-01

    A number of studies were performed to assess the association between plasminogen activator inhibitor-1 (PAI-1) 4G/5G polymorphism and susceptibility to type 2 diabetes (T2DM). However, the results were inconsistent and inconclusive. In the present study, the possible association was investigated by a meta-analysis. Eligible articles were identified for the period up to June 2013. Pooled odds ratios (OR) with 95% confidence intervals (CI) were appropriately derived from random-effects models or fixed-effects models. Fourteen case-control studies with a total of 2487 cases and 3538 controls were eligible. In recessive model, PAI-1 4G/5G polymorphism was associated with T2DM risk (OR = 1.23; 95% CI 1.07-1.41; P = 0.004). In the subgroup analysis by ethnicity, a significant association was found among Asians (OR = 1.27; 95% CI 1.08-1.51; P = 0.005). This meta-analysis suggested that PAI-1 4G/5G polymorphism may be associated with T2DM development. PMID:24040470

  13. Base-Displaced Intercalated Conformation of the 2-Amino-3-methylimidazo[4,5-f]quinoline N2-dG DNA Adduct Positioned at the Nonreiterated G1 in the NarI Restriction Site

    PubMed Central

    2016-01-01

    The conformation of an N2-dG adduct arising from the heterocyclic amine 2-amino-3-methylimidazo[4,5-f]quinoline (IQ), a potent food mutagen, was determined in 5′-d(C1T2C3X4G5C6G7C8C9A10T11C12)-3′:5′-d(G13A14T15G16G17C18G19C20C21G22A23G24)-3′; X = N2-dG-IQ, in which the modified nucleotide X4 corresponds to G1 in the 5′-d(G1G2CG3CC)-3′ NarI restriction endonuclease site. Circular dichroism (CD) revealed blue shifts relative to the unmodified duplex, consistent with adduct-induced twisting, and a hypochromic effect for the IQ absorbance in the near UV region. NMR revealed that the N2-dG-IQ adduct adopted a base-displaced intercalated conformation in which the modified guanine remained in the anti conformation about the glycosidic bond, the IQ moiety intercalated into the duplex, and the complementary base C21 was displaced into the major groove. The processing of the N2-dG-IQ lesion by hpol η is sequence-dependent; when placed at the reiterated G3 position, but not at the G1 position, this lesion exhibits a propensity for frameshift replication [Choi, J. Y., et al. (2006) J. Biol. Chem., 281, 25297–25306]. The structure of the N2-dG-IQ adduct at the nonreiterated G1 position was compared to that of the same adduct placed at the G3 position [Stavros, K. M., et al. (2014) Nucleic Acids Res., 42, 3450–3463]. CD indicted minimal spectral differences between the G1 vs G3N2-dG-IQ adducts. NMR indicated that the N2-dG-IQ adduct exhibited similar base-displaced intercalated conformations at both the G1 and G3 positions. This result differed as compared to the corresponding C8-dG-IQ adducts placed at the same positions. The C8-dG-IQ adduct adopted a minor groove conformation when placed at position G1 but a base-displaced intercalated conformation when placed at position G3 in the NarI sequence. The present studies suggest that differences in lesion bypass by hpol η may be mediated by differences in the 3′-flanking sequences, perhaps modulating the ability

  14. 3-(3-Hydroxy-4-methoxyphenyl)-4-(3,4,5-trimethoxyphenyl)-1,2,5-selenadiazole (G-1103), a novel combretastatin A-4 analog, induces G2/M arrest and apoptosis by disrupting tubulin polymerization in human cervical HeLa cells and fibrosarcoma HT-1080 cells.

    PubMed

    Zuo, Daiying; Guo, Dandan; Jiang, Xuewei; Guan, Qi; Qi, Huan; Xu, Jingwen; Li, Zengqiang; Yang, Fushan; Zhang, Weige; Wu, Yingliang

    2015-02-05

    Microtubule is a popular target for anticancer drugs. In this study, we describe the effect 3-(3-hydroxy-4-methoxyphenyl)-4-(3,4,5-trimethoxyphenyl)-1,2,5-selenadiazole (G-1103), a newly synthesized analog of combretastatin A-4 (CA-4), showing a strong time- and dose-dependent anti-proliferative effect on human cervical cancer HeLa cells and human fibrosarcoma HT-1080 cells. We demonstrated that the growth inhibitory effects of G-1103 in HeLa and HT-1080 cells were associated with microtubule depolymerization and proved that G-1103 acted as microtubule destabilizing agent. Furthermore, cell cycle analysis revealed that G-1103 treatment resulted in cell cycle arrest at the G2/M phase in a time-dependent manner with subsequent apoptosis induction. Western blot analysis revealed that down-regulation of cdc25c and up-regulation of cyclin B1 was related with G2/M arrest in HeLa and HT-1080 cells treatment with G-1103. In addition, G-1103 induced HeLa cell apoptosis by up-regulating cleaved caspase-3, Fas, cleaved caspase-8 expression, which indicated that G-1103 induced HeLa cell apoptosis was mainly associated with death receptor pathway. However, G-1103 induced HT-1080 cell apoptosis by up-regulating cleaved caspase-3, Fas, cleaved caspase-8, Bax and cleaved caspase-9 expression and down-regulating anti-apoptotic protein Bcl-2 expression, which indicated that G-1103 induced HT-1080 cell apoptosis was associated with both mitochondrial and death receptor pathway. Taken together, all the data demonstrated that G-1103 exhibited its antitumor activity through disrupting the microtubule assembly, causing cell cycle arrest and consequently inducing apoptosis in HeLa and HT-1080 cells. Therefore, the novel compound G-1103 is a promising microtubule inhibitor that has great potentials for therapeutic treatment of various malignancies. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  15. Human rotavirus strains circulating in Venezuela after vaccine introduction: predominance of G2P[4] and reemergence of G1P[8].

    PubMed

    Vizzi, Esmeralda; Piñeros, Oscar A; Oropeza, M Daniela; Naranjo, Laura; Suárez, José A; Fernández, Rixio; Zambrano, José L; Celis, Argelia; Liprandi, Ferdinando

    2017-03-21

    Rotavirus (RV) is the most common cause of severe childhood diarrhea worldwide. Despite Venezuela was among the first developing countries to introduce RV vaccines into their national immunization schedules, RV is still contributing to the burden of diarrhea. Concerns exist about the selective pressure that RV vaccines could exert on the predominant types and/or emergence of new strains. To assess the impact of RV vaccines on the genotype distribution 1 year after the vaccination was implemented, a total of 912 fecal specimens, collected from children with acute gastroenteritis in Caracas from February 2007 to April 2008, were screened, of which 169 (18.5%) were confirmed to be RV positive by PAGE. Rotavirus-associated diarrhea occurred all year-round, although prevailed during the coolest and driest months among unvaccinated children under 24 months old. Of 165 RV strains genotyped for G (VP7) and P (VP4) by seminested multiplex RT-PCR, 77 (46.7%) were G2P[4] and 63 (38.2%) G1P[8]. G9P[8], G3P[8] and G2P[6] were found in a lower proportion (7.3%). Remarkable was also the detection of <5% of uncommon combinations (G8P[14], G8P[4], G1P[4] and G4P[4]) and 3.6% of mixed infections. A changing pattern of G/P-type distribution was observed during the season studied, with complete predominance of G2P[4] from February to June 2007 followed by its gradual decline and the reemergence of G1P[8], predominant since January 2008. Phylogenetic analysis of VP7 and VP4 genes revealed a high similarity among G2P[4] and global strains belonging to G2-II and P[4]-V lineages. The amino acid substitution 96D → N, related with reemergence of the G2 genotype elsewhere, was observed. The G1P[8] strains from Caracas were grouped into the lineages G1-I and P[8]-III, along with geographically remote G1P[8] rotaviruses, but they were rather distant from Rotarix ® vaccine and pre-vaccine strains. Unique amino acid substitutions observed on neutralization domains of the VP7 sequence from

  16. Insights into the photocatalytic mechanism of mediator-free direct Z-scheme g-C3N4/Bi2MoO6(010) and g-C3N4/Bi2WO6(010) heterostructures: A hybrid density functional theory study

    NASA Astrophysics Data System (ADS)

    Opoku, Francis; Govender, Krishna Kuben; Sittert, Cornelia Gertina Catharina Elizabeth van; Govender, Penny Poomani

    2018-01-01

    Graphite-like carbon nitride (g-C3N4)-based heterostructures have received much attention due to their prominent photocatalytic activity. The g-C3N4/Bi2WO6 and g-C3N4/Bi2MoO6 heterostructures, which follow a typical hetero-junction charge transfer mechanisms show a weak potential for hydrogen evolution and reactive radical generation under visible light irradiation. A mediator-free Z-scheme g-C3N4/Bi2MoO6(010) and g-C3N4/Bi2WO6(010) heterostructures photocatalyst are designed for the first time using first-principles studies. Moreover, theoretical understanding of the underlying mechanism, the effects of interfacial composition and the role the interface play in the overall photoactivity is still unexplained. The calculated band gap of the heterostructures is reduced compared to the bulk Bi2WO6 and Bi2MoO6. In this study, we systematically calculated energy band structure, optical properties and charge transfer of the g-C3N4/Bi2MoO6(010) and g-C3N4/Bi2WO6(010) heterostructures using the hybrid density functional theory approach. The results show that the charge transfer at the interface of the heterostructures induces a built-in potential, which benefits the separation of photogenerated charge carriers. The g-C3N4/Bi2MoO6(010) heterostructure with more negative adhesion energy (-1.10 eVA-2) is predicted to have a better adsorptive ability and can form more easily compared to the g-C3N4/Bi2WO6(010) interface (-1.16 eVA-2). Therefore, our results show that the g-C3N4 interaction with Bi2MoO6 is stronger than Bi2WO6, which is also verified by the smaller vertical separation (3.25 Å) between Bi2MoO6 and g-C3N4 compared to the g-C3N4/Bi2WO6(010) interface (3.36 Å). The optical absorption verifies that these proposed Z-scheme heterostructures are excellent visible light harvesting semiconductor photocatalyst materials. This enhancement is ascribed to the role of g-C3N4 monolayer as an electron acceptor and the direct Z-scheme charge carrier transfer at the interface of

  17. Reactions of small negative ions with O2(a 1[Delta]g) and O2(X 3[Sigma]g-)

    NASA Astrophysics Data System (ADS)

    Midey, Anthony; Dotan, Itzhak; Seeley, J. V.; Viggiano, A. A.

    2009-02-01

    The rate constants and product ion branching ratios were measured for the reactions of various small negative ions with O2(X 3[Sigma]g-) and O2(a 1[Delta]g) in a selected ion flow tube (SIFT). Only NH2- and CH3O- were found to react with O2(X) and both reactions were slow. CH3O- reacted by hydride transfer, both with and without electron detachment. NH2- formed both OH-, as observed previously, and O2-, the latter via endothermic charge transfer. A temperature study revealed a negative temperature dependence for the former channel and Arrhenius behavior for the endothermic channel, resulting in an overall rate constant with a minimum at 500 K. SF6-, SF4-, SO3- and CO3- were found to react with O2(a 1[Delta]g) with rate constants less than 10-11 cm3 s-1. NH2- reacted rapidly with O2(a 1[Delta]g) by charge transfer. The reactions of HO2- and SO2- proceeded moderately with competition between Penning detachment and charge transfer. SO2- produced a SO4- cluster product in 2% of reactions and HO2- produced O3- in 13% of the reactions. CH3O- proceeded essentially at the collision rate by hydride transfer, again both with and without electron detachment. These results show that charge transfer to O2(a 1[Delta]g) occurs readily if the there are no restrictions on the ion beyond the reaction thermodynamics. The SO2- and HO2- reactions with O2(a) are the only known reactions involving Penning detachment besides the reaction with O2- studied previously [R.S. Berry, Phys. Chem. Chem. Phys., 7 (2005) 289-290].

  18. Magnetically Separable Fe2O3/g-C3N4 Nanocomposites with Cocoon-Like Shape: Magnetic Properties and Photocatalytic Activities

    NASA Astrophysics Data System (ADS)

    Yu, Xiaojia; Yang, Xiaoyu; Li, Guang

    2018-01-01

    We report magnetically separable Fe2O3/g-C3N4 nanocomposites as a photocatalyst under visible-light irradiation in this study. The Fe2O3/g-C3N4 nanocomposites were synthesized through a two-step hydrothermal method. The Fe2O3 with cocoon-like shape was obviously dispersed on the surface of g-C3N4 with porous and layered nanostructure as seen from micrographs of the particles. Furthermore, the magnetic conversion of the samples was studied via vibrating sample magnetometer technology. It was found that the saturated magnetization Ms of the Fe2O3/g-C3N4 nanoparticles obviously decreased in the presence of g-C3N4, and the photocatalytic activity of the samples investigated by degrading Rhodamine B suggested that the Fe2O3/g-C3N4 photocatalyst was prior to the pure Fe2O3 and g-C3N4 samples. In addition, the magnetically separable ability of Fe2O3/g-C3N4 nanocomposites was efficiently exhibited by an external magnet.

  19. Prothrombin polymorphism A19911G, factor V HR2 haplotype A4070G, and plasminogen activator-inhibitor-1 polymorphism 4G/5G and the risk of retinal vein occlusion.

    PubMed

    Kuhli-Hattenbach, Claudia; Hellstern, Peter; Nägler, Dorit Karin; Kohnen, Thomas; Hattenbach, Lars-Olof

    2017-01-01

    Thus far, no data has become available to evaluate systematically the prevalences of prothrombin polymorphism A19911G (PT A19911G), factor V HR2 haplotype A4070G (FV A4070G), or plasminogen activator-inhibitor-1 polymorphism 4G/5G (PAI-1 4G/5G) in patients who develop retinal vein occlusion (RVO) without cardiovascular risk factors. We retrospectively evaluated comprehensive thrombophilia data from 42 preselected RVO patients without cardiovascular risk factors. The prevalences of different gene mutations and polymorphisms including factor V Leiden mutation G1691A (FVL), FV A4070G, prothrombin mutation G20210A, PT A19911G, and PAI-1 4G/5G were compared with 241 healthy controls matched for age and sex. A total of 20 patients (47.7%) were found to carry thrombophilic gene polymorphisms including FVL, FV A4070G, and homozygous PT A19911G compared with 72 of 241 controls (29.9%; p = 0.03). Subgroup analysis of patients with a significant personal or family history of thromboembolism revealed a high prevalence of FVL, FV A4070G, and homozygous PT A19911G (p = 0.005). FV A4070G was found to be significantly associated with at least two other heterozygous or one homozygous gene polymorphisms (p = 0.02). Multivariate analysis revealed the presence of FVL (p = 0.0017) and homozygous PT A19911G (p = 0.03) polymorphism as independent risk factors for the development of RVO. Our results indicate that in selected RVO patients screening for thrombophilic gene polymorphisms including FVL, FV A4070G and homozygous PT G19911A may be helpful in a high percentage of cases. Our findings suggest that hereditary thrombophilia associated with RVO is more likely to be multigenic than caused by any single risk factor.

  20. Plasminogen activator inhibitor I 4G/5G polymorphism in neonatal respiratory distress syndrome.

    PubMed

    Armangil, Didem; Yurdakök, Murat; Okur, Hamza; Gürgey, Aytemiz

    2011-08-01

    Fibrin monomers inhibit surfactant function. 4G/5G insertion/deletion polymorphism plays an important role in the regulation of plasminogen activator inhibitor 1 (PAI-1) gene expression. To examine the genotype distribution of PAI-1 polymorphism in 60 infants with respiratory distress syndrome (RDS) and 53 controls, an allele-specific polymerase chain reaction (PCR) was used. The proportion of 4G/4G, 4G/5G, and 5G/5G genotypes did not differ statistically between the RDS and control groups (P > .05). Having PAI-1 4G/4G genotype polymorphism appears to increase the risk of RDS (odds ratio [OR] =1.5; 95% confidence interval [CI], 0.5-4.3), although it was not statistically significant. No relation was found between the PAI-1 4G/5G polymorphisms and RDS, but there was an increased risk associated with the 4G variant of the PAI-1 gene. We believe that our findings of increased 4G allele of the PAI-1 gene in infants with RDS would also help to clarify the pathogenesis of RDS.

  1. 78 FR 8191 - Certain Wireless Devices With 3G and/or 4G Capabilities and Components Thereof; Institution of...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-02-05

    ... INTERNATIONAL TRADE COMMISSION [Investigation No. 337-TA-868] Certain Wireless Devices With 3G and... importation, and the sale within the United States after importation of certain wireless devices with 3G and... devices with 3G and/or 4G capabilities and components thereof by reason of infringement of one or more of...

  2. Expansion of blood IgG4+ B, TH2, and regulatory T cells in patients with IgG4-related disease.

    PubMed

    Heeringa, Jorn J; Karim, A Faiz; van Laar, Jan A M; Verdijk, Robert M; Paridaens, Dion; van Hagen, P Martin; van Zelm, Menno C

    2018-05-01

    IgG 4 -related disease (IgG 4 -RD) is a systemic fibroinflammatory condition affecting various organs and has a diverse clinical presentation. Fibrosis and accumulation of IgG 4 + plasma cells in tissue are hallmarks of the disease, and IgG 4 -RD is associated with increased IgG 4 serum levels. However, disease pathogenesis is still unclear, and these cellular and molecular parameters are neither sensitive nor specific for the diagnosis of IgG 4 -RD. Here we sought to develop a flow cytometric gating strategy to reliably identify blood IgG 4 + B cells to study their cellular and molecular characteristics and investigate their contribution in disease pathogenesis. Sixteen patients with histologically confirmed IgG 4 -RD, 11 patients with sarcoidosis, and 30 healthy subjects were included for 11-color flow cytometric analysis of peripheral blood for IgG 4 -expressing B cells and T H subsets. In addition, detailed analysis of activation markers and chemokine receptors was performed on IgG 4 -expressing B cells, and IgG 4 transcripts were analyzed for somatic hypermutations. Cellular and molecular analyses revealed increased numbers of blood IgG 4 + memory B cells in patients with IgG 4 -RD. These cells showed reduced expression of CD27 and CXCR5 and increased signs of antibody maturation. Furthermore, patients with IgG 4 -RD, but not patients with sarcoidosis, had increased numbers of circulating plasmablasts and CD21 low B cells, as well as T H 2 and regulatory T cells, indicating a common disease pathogenesis in patients with IgG 4 -RD. These results provide new insights into the dysregulated IgG 4 response in patients with IgG 4 -RD. A specific "peripheral lymphocyte signature" observed in patients with IgG 4 -RD, could support diagnosis and treatment monitoring. Copyright © 2017 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  3. IgG4 plasma cell myeloma: new insights into the pathogenesis of IgG4-related disease.

    PubMed

    Geyer, Julia T; Niesvizky, Ruben; Jayabalan, David S; Mathew, Susan; Subramaniyam, Shivakumar; Geyer, Alexander I; Orazi, Attilio; Ely, Scott A

    2014-03-01

    IgG4-related disease is a newly described systemic fibroinflammatory process, characterized by increase in IgG4-positive plasma cells. Its pathogenesis, including the role of IgG4, remains poorly understood. Plasma cell myeloma is typically associated with a large monoclonal serum spike, which is frequently of IgG isotype. We sought to identify and characterize a subset of IgG4-secreting myeloma, as it may provide a biological model of disease with high serum levels of IgG4. Six out of 158 bone marrow biopsies (4%) from patients with IgG myeloma expressed IgG4. Four patients were men and two were women, with a mean age of 64 (range 53-87) years. Imaging showed fullness of pancreatic head (1), small non-metabolic lymphadenopathy (1), and bone lytic lesions (6). Two patients developed necrotizing fasciitis. All had elevated serum M-protein (mean 2.4, range 0.5-4.2g/dl), and none had definite signs or symptoms of IgG4-related disease. Four myelomas had plasmablastic morphology. Four had kappa and two had lambda light chain expression. Three cases expressed CD56. Two patients had a complex karyotype. In conclusion, the frequency of IgG4 myeloma correlates with the normal distribution of IgG4 isoform. The patients with IgG4 myeloma appear to have a high rate of plasmablastic morphology and could be predisposed to necrotizing fasciitis. Despite high serum levels of IgG4, none had evidence of IgG4-related disease. These findings suggest that the increased number of IgG4-positive plasma cells is not the primary etiologic agent in IgG4-related disease. Elevated serum levels of IgG4 is not sufficient to produce the typical disease presentation and should not be considered diagnostic of IgG4-related disease.

  4. Plasminogen activator inhibitor 1 4G/5G and -844G/A variants in idiopathic recurrent pregnancy loss.

    PubMed

    Magdoud, Kalthoum; Herbepin, Viviana G; Touraine, Renaud; Almawi, Wassim Y; Mahjoub, Touhami

    2013-09-01

    Plasminogen activator inhibitor type 1 (PAI-1) regulates fibrinolysis, and the common promoter region variants -675G/A (4G/5G) and -844G/A are associated with increased thrombotic risk. Despite evidence linking altered fibrinolysis with adverse pregnancy events, including idiopathic recurrent pregnancy loss (RPL), the contribution of PAI-1 variants to RPL risk remains controversial. We investigated the association between the PAI-1 -844G/A and 4G/5G (-675G/A) variants with altered risk of RPL. This was a case-control study involving 304 women with confirmed RPL and 371 age- and ethnically matched control women. PAI-1 genotyping was performed by PCR single-specific primer -675 (G/A) and real-time PCR (-844G/A) analysis. Minor allele frequency (MAF) of 4G/5G (P < 0.001), but not -844G/A (P = 0.507), was higher in RPL cases. PAI-1 4G/5G single-nucleotide polymorphism (SNP) was significantly associated with RPL under additive, dominant, and recessive genetic models; no association of -844G/A with RPL was seen irrespective of the genetic model tested. Taking common -844G/5G haplotype as reference (OR = 1.00), multivariate analysis confirmed the association of 4G-containing -844A/4G (P < 0.001) and -844G/4G (P = 0.011) haplotypes with increased RPL risk. 4G/5G, but not -844G/A, PAI-1 variant is associated with an increased risk of RPL. © 2013 John Wiley & Sons Ltd.

  5. Effects of 2G and 3G mobile phones on performance and electrophysiology in adolescents, young adults and older adults.

    PubMed

    Leung, S; Croft, R J; McKenzie, R J; Iskra, S; Silber, B; Cooper, N R; O'Neill, B; Cropley, V; Diaz-Trujillo, A; Hamblin, D; Simpson, D

    2011-11-01

    This study examined sensory and cognitive processing in adolescents, young adults and older adults, when exposed to 2nd (2G) and 3rd (3G) generation mobile phone signals. Tests employed were the auditory 3-stimulus oddball and the N-back. Forty-one 13-15 year olds, forty-two 19-40 year olds and twenty 55-70 year olds were tested using a double-blind cross-over design, where each participant received Sham, 2G and 3G exposures, separated by at least 4 days. 3-Stimulus oddball task: Behavioural: accuracy and reaction time of responses to targets were not affected by exposure. Electrophysiological: augmented N1 was found in the 2G condition (independent of age group). N-back task: Behavioural: the combined groups performed less accurately during the 3G exposure (compared to Sham), with post hoc tests finding this effect separately in the adolescents only. Electrophysiological: delayed ERD/ERS responses of the alpha power were found in both 3G and 2G conditions (compared to Sham; independent of age group). Employing tasks tailored to each individual's ability level, this study provides support for an effect of acute 2G and 3G exposure on human cognitive function. The subtlety of mobile phone effect on cognition in our study suggests that it is important to account for individual differences in future mobile phone research. Copyright © 2011 International Federation of Clinical Neurophysiology. All rights reserved.

  6. Enhanced visible light activity on direct contact Z-scheme g-C3N4-TiO2 photocatalyst

    NASA Astrophysics Data System (ADS)

    Li, Juan; Zhang, Min; Li, Qiuye; Yang, Jianjun

    2017-01-01

    Direct contact Z-scheme g-C3N4-TiO2 nanocomposites without an electron mediator are prepared via simple annealing the mixture of bulk g-C3N4 and nanotube titanic acid (NTA) in air at 600 °C for 2 h. In the process of annealing, the bulk g-C3N4 transformed to ultra-thin g-C3N4 nanosheets, and NTA converted to a novel anatase TiO2, then the two components formed a close interaction. The XPS result reveals that some amount of nitrogen is doped into this novel-TiO2, and g-C3N4 nanosheets exist in the composites. The results of XRD, TEM and TG indicate that the thickness of g-C3N4 nanosheets is very thin. The ESR spectrum shows the existence of Ti3+ and single-electron-trapped oxygen vacancy in the 30%g-C3N4-TiO2 composites. In photocatalytic activity test, the 30%g-C3N4-TiO2 nanocomposites showed an excellent photo-oxidation activity of propylene under visible light irradiation (λ≥ 420 nm), and the removal efficiency of propylene reached as high as 56.6%, and the activity kept nearly 82% after four consecutive recycles. Photoluminescence (PL) result using terephthalic acid (TA) as a probe molecule indicated that the g-C3N4-TiO2 nanocomposites displayed a Z-sheme photocatalytic reaction system and this should be the main reason for the high photocatalytic activity. A possible photocatalytic mechanism was proposed on the basis of PL result and transient photocurrent-time curves.

  7. Association Between Plasminogen Activator Inhibitor-1-675 4G/5G Insertion/Deletion Polymorphism and Chronic Obstructive Pulmonary Disease.

    PubMed

    Essa, Enas S; El Wahsh, Rabab A

    2016-12-01

    Molecular pathology of chronic obstructive pulmonary disease (COPD) is still being investigated to discover relationships with disease pathogenesis. Evidence of plasminogen activator inhibitor-1 (PAI-1) overexpression in the sputum and the blood of COPD patients is growing. We aimed to investigate the potential relation between PAI-1 promoter 4G/5G insertion/deletion polymorphism and COPD development. In a case-control study, we genotyped 117 COPD patients and 160 control subjects for PAI-1 promoter 4G/5G polymorphism by an allele-specific polymerase chain reaction analysis. All subjects were male smokers. In the co-dominant model, there was a significant difference in the distribution of 5G/5G, 4G/5G and 4G/4G genotypes between COPD patients and controls (p = 0.002). In the recessive model, carriers of 4G/4G genotype were significantly higher in COPD patients than controls (p = 0.01). Carriers of 4G/4G genotype were at higher risk to develop COPD than those carrying 5G/5G or 4G/5G genotypes (crude odds ratio (OR) = 2.10, 95% confidence interval (CI) = 1.19-3.73, adjusted OR = 2.5, 95% CI = 1.22-3.99). In conclusion, PAI-1 4G/5G genetic variations are associated with COPD development in males.

  8. Increase in serum concentrations of IgG2 and IgG4 by selenium supplementation in children with Down's syndrome.

    PubMed Central

    Annerén, G; Magnusson, C G; Nordvall, S L

    1990-01-01

    In a previous study on children with Down's syndrome a reduced rate of infections was reported by their parents after the children had received six months' treatment with selenium supplements. In the present study the concentrations of the four IgG subclasses were measured in 29 of these children in samples of serum obtained before and immediately after the period of supplementation and one year after it had finished. Selenium had a significant augmentative effect on the serum concentrations of IgG2 and IgG4, but not of IgG1 and IgG3. This effect was not related to age, as among children over the age of 6 years the serum concentrations of IgG2 and IgG4 had decreased significantly one year after the treatment had been stopped. This study suggests that selenium has an immunoregulatory effect, which might be of importance in both basic research and clinical practice. PMID:2148668

  9. Preparation of WO3/g-C3N4 composites and their application in oxidative desulfurization

    NASA Astrophysics Data System (ADS)

    Zhao, Rongxiang; Li, Xiuping; Su, Jianxun; Gao, Xiaohan

    2017-01-01

    WO3/graphitic carbon nitride (g-C3N4) composites were successfully synthesized through direct calcining of a mixture of WO3 and g-C3N4 at 400 °C for 2 h. The WO3 was prepared by calcination of phosphotungstic acid at 550 °C for 4 h, and the g-C3N4 was obtained by calcination of melamine at 520 °C for 4 h. The WO3/g-C3N4 composites were characterized by X-ray diffraction (XRD), Scanning electron microscopy (SEM), Fourier-transform infrared spectroscopy (FT-IR), and Brunner-Emmett-Teller analysis (BET). The WO3/g-C3N4 composites exhibited stronger XRD peaks of WO3 and g-C3N4 than the WO3 and pure g-C3N4. In addition, two WO3 peaks at 25.7° and 26.6° emerged for the 36% -WO3/g-C3N4 composite. This finding indicated that WO3 was highly dispersed on the surface of the g-C3N4 nanosheets and interacted with the nanosheets, which resulted in the appearance of (012) and (022) planes of WO3. The WO3/g-C3N4 composite also exhibited a larger specific surface area and higher degree of crystallization than WO3 or pure g-C3N4, which resulted in high catalytic activity of the catalyst. Desulfurization experiments demonstrated that the desulfurization rate of dibenzothiophene (DBT) in model oil reached 91.2% under optimal conditions. Moreover, the activity of the catalyst was not significantly decreased after five recycles.

  10. The Plasminogen Activator Inhibitor 1 4G/5G Polymorphism and the Risk of Alzheimer's Disease.

    PubMed

    Fekih-Mrissa, Najiba; Mansour, Malek; Sayeh, Aicha; Bedoui, Ines; Mrad, Meriem; Riahi, Anis; Mrissa, Ridha; Nsiri, Brahim

    2017-09-01

    The aim of this study was to determine whether plasminogen activator inhibitor 1 (PAI-1) is associated with the risk of Alzheimer's disease (AD) in Tunisian patients. We analyzed the genotype and allele frequency distribution of the PAI-1 polymorphism in 60 Tunisian patients with AD and 120 healthy controls. The results show a significantly increased risk of AD in carriers of the 4G/4G and 4G/5G genotypes versus the wild-type 5G/5G genotype (4G/4G: 28.33% in patients vs 10.0% in controls; P < 10 -3 ; OR = 8.78; 4G/5G: 55.0% in patients vs 38.33% in controls; OR = 4.45; P < 10 -3 ). The 4G allele was also more frequently found in patients compared with controls; P < 10 -3 ; OR = 3.07. For all participants and by gender, homozygotic carriers (4G/4G) were at an increased risk of AD over heterozygotes and women were at an increased risk over their male genotype counterparts. The odds ratio for AD among 4G/4G carriers for any group was approximately twice that of heterozygotes in the same group. Women homozygotes ranked highest for AD risk (OR = 20.8) and, in fact, women heterozygotes (OR = 9.03) ranked higher for risk than male homozygotes (OR = 6.12). These preliminary exploratory results should be confirmed in a larger study.

  11. A review on g-C3N4-based photocatalysts

    NASA Astrophysics Data System (ADS)

    Wen, Jiuqing; Xie, Jun; Chen, Xiaobo; Li, Xin

    2017-01-01

    As one of the most appealing and attractive technologies, heterogeneous photocatalysis has been utilized to directly harvest, convert and store renewable solar energy for producing sustainable and green solar fuels and a broad range of environmental applications. Due to their unique physicochemical, optical and electrical properties, a wide variety of g-C3N4-based photocatalysts have been designed to drive various reduction and oxidation reactions under light irradiation with suitable wavelengths. In this review, we have systematically summarized the photocatalytic fundamentals of g-C3N4-based photocatalysts, including fundamental mechanism of heterogeneous photocatalysis, advantages, challenges and the design considerations of g-C3N4-based photocatalysts. The versatile properties of g-C3N4-based photocatalysts are highlighted, including their crystal structural, surface phisicochemical, stability, optical, adsorption, electrochemical, photoelectrochemical and electronic properties. Various design strategies are also thoroughly reviewed, including band-gap engineering, defect control, dimensionality tuning, pore texture tailoring, surface sensitization, heterojunction construction, co-catalyst and nanocarbon loading. Many important applications are also addressed, such as photocatalytic water splitting (H2 evolution and overall water splitting), degradation of pollutants, carbon dioxide reduction, selective organic transformations and disinfection. Through reviewing the important state-of-the-art advances on this topic, it may provide new opportunities for designing and constructing highly effective g-C3N4-based photocatalysts for various applications in photocatalysis and other related fields, such as solar cell, photoelectrocatalysis, electrocatalysis, lithium battery, supercapacitor, fuel cell and separation and purification.

  12. Hashimoto's thyroiditis with elevated serum IgG4 concentrations is not equivalent to IgG4 Hashimoto's thyroiditis.

    PubMed

    Yu, Yang; Yu, Nan; Lu, Guizhi; Li, Ting; Zhang, Yang; Zhang, Jing; Gao, Ying; Gao, Yanming; Guo, Xiaohui

    2018-06-01

    Hashimoto's thyroiditis (HT) with serum IgG4 concentrations greater than 135 mg/dL can be diagnosed as elevated serum IgG4 HT. HT can also be classified into IgG4 HT and non-IgG4 HT based on an immunohistochemistry analysis of IgG4. The aim of our study was to determine the relationship between elevated serum IgG4 HT and IgG4 HT. Both thyroid tissues and serum samples stored before pathological examination from 93 patients with HT were collected. The serum levels of IgG, IgG4, TgAb IgG, TgAb IgG4, TPOAb IgG and TPOAb IgG4 were measured by ELISAs. The expression levels of IgG4, IgG and TGF-β1 in thyroid tissues were detected by immunohistochemistry. Patients with HT were divided into two groups: elevated serum IgG4 HT (n = 12) and nonelevated serum IgG4 HT (n = 81). Hypothyroidism was found in 5 of 12 cases (41.7%) in the elevated serum IgG4 HT group and 10 of 81 cases (12.3%) in the nonelevated serum IgG4 HT group (P = .023). Serologically, there were no significant differences in the levels of TgAb IgG, TPOAb IgG, TgAb IgG4 and TPOAb IgG4 between the two groups, and the expression of TGF-β1 in thyroid tissues was not significantly different between the groups. Most importantly, the frequency of patients who satisfied the criteria for IgG4 HT diagnosis was comparable (25% vs 20.9%, P = .756). The measurement of serum IgG4 allows the identification of patients with HT closely associated with hypothyroidism. However, our study demonstrated that elevated serum IgG4 HT is not equivalent to IgG4 HT. © 2018 John Wiley & Sons Ltd.

  13. Collisional relaxation of O2(X^3Σ _g^ -, υ = 1) and O2(a1Δg, υ = 1) by atmospherically relevant species

    NASA Astrophysics Data System (ADS)

    Pejaković, Dušan A.; Campbell, Zachary; Kalogerakis, Konstantinos S.; Copeland, Richard A.; Slanger, Tom G.

    2011-09-01

    Laboratory measurements are reported of the rate coefficient for collisional removal of O2(X^3Σ _g^ -, υ = 1) by O(3P), and the rate coefficients for removal of O2(a1Δg, υ = 1) by O2, CO2, and O(3P). A two-laser method is employed, in which the pulsed output of the first laser at 285 nm photolyzes ozone to produce oxygen atoms and O2(a1Δg, υ = 1), and the output of the second laser detects O2(a1Δg, υ = 1) via resonance-enhanced multiphoton ionization. The kinetics of O2(X^3Σ _g^ -, υ = 1) + O(3P) relaxation is inferred from the temporal evolution of O2(a1Δg, υ = 1), an approach enabled by the rapid collision-induced equilibration of the O2(X^3Σ _g^ -, υ = 1) and O2(a1Δg, υ = 1) populations in the system. The measured O2(X^3Σ _g^ -, υ = 1) + O(3P) rate coefficient is (2.9 ± 0.6) × 10-12 cm3 s-1 at 295 K and (3.4 ± 0.6) × 10-12 cm3 s-1 at 240 K. These values are consistent with the previously reported result of (3.2 ± 1.0) × 10-12 cm3 s-1, which was obtained at 315 K using a different experimental approach [K. S. Kalogerakis, R. A. Copeland, and T. G. Slanger, J. Chem. Phys. 123, 194303 (2005)]. For removal of O2(a1Δg, υ = 1) by O(3P), the upper limits for the rate coefficient are 4 × 10-13 cm3 s-1 at 295 K and 6 × 10-13 cm3 s-1 at 240 K. The rate coefficient for removal of O2(a1Δg, υ = 1) by O2 is (5.6 ± 0.6) × 10-11 cm3 s-1 at 295 K and (5.9 ± 0.5) × 10-11 cm3 s-1 at 240 K. The O2(a1Δg, υ = 1) + CO2 rate coefficient is (1.5 ± 0.2) × 10-14 cm3 s-1 at 295 K and (1.2 ± 0.1) × 10-14 cm3 s-1 at 240 K. The implications of the measured rate coefficients for modeling of atmospheric emissions are discussed.

  14. Synthesis of G-N2-(CH2)3-N2-G Trimethylene DNA interstrand cross-links

    PubMed Central

    Gruppi, Francesca; Salyard, Tracy L. Johnson; Rizzo, Carmelo J.

    2014-01-01

    The synthesis of G-N2-(CH2)3-N2-G trimethylene DNA interstrand cross-links (ICLs) in a 5′-CG-3′ and 5′-GC-3′ sequence from oligodeoxynucleotides containing N2-(3-aminopropyl)-2′-deoxyguanosine and 2-fluoro-O6-(trimethylsilylethyl)inosine is presented. Automated solid-phase DNA synthesis was used for unmodified bases and modified nucleotides were incorporated via their corresponding phosphoramidite reagent by a manual coupling protocol. The preparation of the phosphoramidite reagents for incorporation of N2-(3-aminopropyl)-2′-deoxyguanosine is reported. The high-purity trimethylene DNA interstrand cross-link product is obtained through a nucleophilic aromatic substitution reaction between the N2-(3-aminopropyl)-2′-deoxyguanosine and 2-fluoro-O6-(trimethylsilylethyl)inosine containing oligodeoxynucleotides. PMID:25431636

  15. Plasminogen activator inhibitor-1 4G/5G polymorphism in infertile women with and without endometriosis.

    PubMed

    Gonçalves-Filho, Rubens P; Brandes, Ariel; Christofolini, Denise M; Lerner, Tatiana G; Bianco, Bianca; Barbosa, Caio P

    2011-05-01

    To evaluate PAI-1 genotypes in a group of infertile women with or without endometriosis and control subjects. Case-control study. Human Reproduction Center of Medicina do ABC Faculty. One hundred and forty infertile women with endometriosis, 64 women with idiopathic infertility and 148 fertile women as control subjects. The PAI-1 4G/5G polymorphism was identified by restriction fragment length polymorphism-polymerase chain reaction. Genotype distribution and allele frequency of the 4G/5G polymorphism of the PAI-1 gene. The frequencies of genotypes 4G/4G, 4G/5G and 5G/5G of the PAI-1 gene in the infertile women with endometriosis were 38.6, 37.1 and 24.3%, respectively, and in the control group 24.3, 33.8 and 41.9%, respectively (p=0.003). When the infertile women with endometriosis were divided according to their endometriosis stage, genotypes 4G/4G, 4G/5G and 5G/5G were identified, respectively, in 36.7, 32.9 and 30.4% of the patients with minimal/mild endometriosis (p=0.102) and in 41.0, 42.6 and 16.4% of the patients with moderate/severe endometriosis (p=0.001); in the women with idiopathic infertility, these genotypes were found at a frequency of 29.7, 34.3 and 36%, respectively (p=0.637). The data suggest that, in Brazilian women, the PAI-1 4G/5G polymorphism may be associated with a risk of endometriosis-associated infertility. © 2011 The Authors Acta Obstetricia et Gynecologica Scandinavica© 2011 Nordic Federation of Societies of Obstetrics and Gynecology.

  16. Serum levels of IgG and IgG4 in Hashimoto thyroiditis.

    PubMed

    Kawashima, Sachiko-Tsukamoto; Tagami, Tetsuya; Nakao, Kanako; Nanba, Kazutaka; Tamanaha, Tamiko; Usui, Takeshi; Naruse, Mitsuhide; Minamiguchi, Sachiko; Mori, Yusuke; Tsuji, Jun; Tanaka, Issei; Shimatsu, Akira

    2014-03-01

    Although IgG4-related disease is characterized by extensive infiltration of IgG4-positive plasma cells and lymphocytes of various organs, the details of this systemic disease are still unclear. We screened serum total IgG levels in the patients with Hashimoto thyroiditis (HT) to illustrate the prevalence of IgG4-related thyroiditis in HT. Twenty-four of 94 patients with HT (25.5%) had elevated serum IgG levels and their serum IgG4 was measured. Five of the 24 cases had more than 135 mg/dL of IgG4, which is the serum criterion of IgG4-related disease. One was a female patient who was initially treated as Graves' disease and rapidly developed a firm goiter and hypothyroidism. The biopsy of her thyroid gland revealed that follicular cells were atrophic with squamous metaplasia, replaced with fibrosis, which was compatible with the fibrous variant of HT. Immunohistochemical examination revealed diffuse infiltration of IgG4-positive plasma cells, and the serum IgG4 level was 179 mg/dL. The levels of IgG and IgG4 were positively correlated with the titers of anti-thyroglobulin antibody or anti-thyroid peroxidase antibody. In conclusion, at least a small portion of patients with HT with high titers of anti-thyroid antibodies may overlap the IgG4-related thyroiditis.

  17. 4G/5G polymorphism modulates PAI-1 circulating levels in obese women.

    PubMed

    Fernandes, Karla S; Sandrim, Valéria C

    2012-05-01

    The increase in plasminogen activator inhibitor type 1 (PAI-1) has been described as a risk factor to thrombosis-related diseases. In addition, it has been demonstrated that the variant 4G of polymorphism 4G/5G located in promoter region of PAI-1 gene is associated with higher PAI-1 levels. We investigate the role of this polymorphism on circulating PAI-1 concentration in a population of 57 obese women (23%, 4G/4G; 49%, 4G/5G and 28%, 5G/5G genotypes). Our results demonstrate a genotype-specific modulation on PAI-1 levels in obese women, thus 5G/5G genotype presented significantly lower levels of plasma PAI-1 when compared to 4G/4G group (46 ± 19 ng/mL vs. 63 ± 13 ng/mL, respectively). Our findings indicate that obese carriers of 4G/4G genotype may have increased risk to develop thrombotic diseases.

  18. Eukaryotic Initiation Factor eIFiso4G1 and eIFiso4G2 Are Isoforms Exhibiting Distinct Functional Differences in Supporting Translation in Arabidopsis*

    PubMed Central

    Gallie, Daniel R.

    2016-01-01

    The eukaryotic translation initiation factor (eIF) 4G is required during protein synthesis to promote the assembly of several factors involved in the recruitment of a 40S ribosomal subunit to an mRNA. Although many eukaryotes express two eIF4G isoforms that are highly similar, the eIF4G isoforms in plants, referred to as eIF4G and eIFiso4G, are highly divergent in size, sequence, and domain organization but both can interact with eIF4A, eIF4B, eIF4E isoforms, and the poly(A)-binding protein. Nevertheless, eIF4G and eIFiso4G from wheat exhibit preferences in the mRNAs they translate optimally. For example, mRNA containing the 5′-leader (called Ω) of tobacco mosaic virus preferentially uses eIF4G in wheat germ lysate. In this study, the eIF4G isoform specificity of Ω was used to examine functional differences of the eIF4G isoforms in Arabidopsis. As in wheat, Ω-mediated translation was reduced in an eif4g null mutant. Loss of the eIFiso4G1 isoform, which is similar in sequence to wheat eIFiso4G, did not substantially affect Ω-mediated translation. However, loss of the eIFiso4G2 isoform substantially reduced Ω-mediated translation. eIFiso4G2 is substantially divergent from eIFiso4G1 and is present only in the Brassicaceae, suggesting a recent evolution. eIFiso4G2 isoforms exhibit sequence-specific differences in regions representing partner protein and RNA binding sites. Loss of any eIF4G isoform also resulted in a substantial reduction in reporter transcript level. These results suggest that eIFiso4G2 appeared late in plant evolution and exhibits more functional similarity with eIF4G than with eIFiso4G1 during Ω-mediated translation. PMID:26578519

  19. [IgG4 immunohistochemistry in Riedle thyroiditis].

    PubMed

    Wang, S; Luo, Y F; Cao, J L; Zhang, H; Shi, X H; Liang, Z Y; Feng, R E

    2017-03-08

    Objective: To observe the histopathological changes and immunohistochemical expression of IgG4 in Riedle thyroiditis (RT) and to study the relationship between RT and IgG4-related diseases (IgG4-RD). Methods: A total of 5 RT patients were collected from the Department of Pathology, Peking Union Medical College Hospital during April 2012 to August 2014. The clinical and immunohistochemical features were analyzed in the 5 patients. Histopathologic analysis was performed on hematoxylin and eosin-stained sections. Results: There were one male and four female patients, aged 52 to 78 years (median 59 years). Five cases were characterized by multiple nodules of thyroid, which increased year by year. All patients were found to have surrounding tissue compression symptoms and signs. Two female patients were found to have hypothyroidism. The serum concentration of IgG was elevated in 2 cases, and the serum concentration of IgG was not tested before operation in the remaining patients. By ultrasound, all presented as low echo or medium low echo. Strong echo occasionally appeared in hypoechoic nodules. Microscopically, fibrous tissue hyperplasia was infiltrated with varying numbers of lymphocytes and plasma cells. The occlusion of phlebitis was found in 4 cases and eosinophils were found in 3 cases. IgG4 counts and IgG4/IgG ratios in 5 cases were 20/HPF, 16%; 60/HPF, 82%; 22/HPF, 28%; 400/HPF, 266% and 33/HPF, 71%, respectively. Conclusions: With the similar pathological manifestations between RT and IgG4-RD, immunohistochemical staining shows that the number of IgG4 positive plasma cells and IgG4/IgG ratio of RT are increased in varying degrees. Some cases meet the diagnostic criteria of IgG4-RD, and speculate that some cases of RT belong to IgG4-RD.

  20. Impacts, Effectiveness and Regional Inequalities of the GeoMIP G1 to G4 Solar Radiation Management Scenarios

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yu, Xiaoyong; Moore, John; Cui, Xuefeng

    We evaluate the regional effectiveness of solar radiation management (SRM) to compensate for simultaneous changes in temperature and precipitation induced by increased greenhouse gas concentrations. We analyze results from multiple earth system models under four Geoengineering Model Intercomparison Project(GeoMIP) experiments with a modified form of the Residual Climate Response approach. Under the solar dimming geoengineering experiments G1(4xCO2) and G2(increasing CO2 by 1% per year), global average temperature is successfully restored to pre-industrial level over 50 years simulations. However, these two SRM experiments also produce a robust global precipitation decrease. The stratospheric aerosol GeoMIP geoengineering experiment, G4 has significantly greater regionalmore » inequality and lower effectiveness for compensating temperature change than G1 and G2. G4 also has significantly larger regional inequality for compensating precipitation change than G1and G2. However, there is no significant difference between precipitation change compensation effectiveness of G4 and G2, though there is much larger across model variability in G4 results. G3 has significant greater regional inequality for compensating temperature change than G1 and G2, and has significant lower effectiveness than G1. The effectiveness of four SRMs to compensate for temperature change is much higher than for precipitation. The large cross-model variation in adjustment percentage of compensated SAT and precipitation change by SRM to achieve optimal compensation effectiveness shed a light on the uncertainty accumulation effect in optimizing compensation effectiveness of SRM.« less

  1. One-step electrospinning synthesis of TiO2/g-C3N4 nanofibers with enhanced photocatalytic properties

    NASA Astrophysics Data System (ADS)

    Tang, Qian; Meng, Xianfeng; Wang, Zhiying; Zhou, Jianwei; Tang, Hua

    2018-02-01

    TiO2/g-C3N4 composite nanofibers have been successfully synthesized by one-step electrospinning method, using titanium (IV) n-butoxide (TNBT) and urea as raw materials. The structure and compositions of TiO2/g-C3N4 samples are characterized by X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FT-IR), Diffuse reflectance spectroscopy (DRS), Scanning electron microscopy (SEM), Transmission electron microscope (TEM), X-ray photoelectron spectrometer (XPS) and Brunauer-Emmett-Teller (BET), respectively. The results show that the porous uniform TiO2/g-C3N4 composite nanofibers, with diameter of 100-150 nm, can be successfully prepared through electrospinning method combining 550 °C calcination process. The photocatalytic activity is evaluated by the degradation of rhodamine B (RhB) under simulated solar light. The enhanced catalytic activity is attributed predominantly to the heterojunction between TiO2 and g-C3N4, which promotes the transferring of carriers and prohibits their recombination. With the optimal doping amount of 0.6 g urea (corresponding to 3 g TNBT), the TiO2/g-C3N4 composite nanofibers exhibit the highest rate towards the photocatalytic degradation of RhB. A diagram is presented to explicate the mechanism of the whole catalytic experiment. This study might provide a promising future of applying green catalysts to solving water pollution problems.

  2. Isoelectric point and adsorption activity of porous g-C3N4

    NASA Astrophysics Data System (ADS)

    Zhu, Bicheng; Xia, Pengfei; Ho, Wingkei; Yu, Jiaguo

    2015-07-01

    The isoelectric point (IEP) is an important physicochemical parameter of many compounds, such as oxides, hydroxides, and nitrides, and can contribute to estimation of the surface charges of compound particles at various pH conditions. In this work, three types of graphitic carbon nitrides (g-C3N4) were synthesized by directly heating melamine, thiourea, and urea. The prepared samples showed different microstructures and IEPs that influenced their adsorption activity. Differences in microstructure resulted from the various precursors used during synthesis. The IEPs of the obtained g-C3N4 were measured to be approximately 4-5, which is due to the equilibrium of chemical reactions between hydrogen ions, hydroxyl ions, and amine groups on the g-C3N4 surface. The IEP of g-C3N4 prepared from thiourea was lower than those of the corresponding samples prepared from melamine and urea. The adsorption activity of methylene blue on g-C3N4 prepared from urea and thiourea was excellent, which indicates that g-C3N4 is a promising adsorbent. This work provides a useful reference for choosing precursors with which to prepare g-C3N4 and combining g-C3N4 with other compounds in solution.

  3. Seizures and Encephalitis in Myelin Oligodendrocyte Glycoprotein IgG Disease vs Aquaporin 4 IgG Disease.

    PubMed

    Hamid, Shahd H M; Whittam, Dan; Saviour, Mariyam; Alorainy, Amal; Mutch, Kerry; Linaker, Samantha; Solomon, Tom; Bhojak, Maneesh; Woodhall, Mark; Waters, Patrick; Appleton, Richard; Duddy, Martin; Jacob, Anu

    2018-01-01

    Antibodies to myelin oligodendrocyte glycoprotein IgG (MOG-IgG) are increasingly detected in patients with non-multiple sclerosis-related demyelination, some of whom manifest a neuromyelitis optica (NMO) phenotype. Cortical involvement, encephalopathy, and seizures are rare in aquaporin 4 antibody (AQP4-IgG)-related NMO in the white European population. However, the authors encountered several patients with seizures associated with MOG-IgG disease. To compare incidence of seizures and encephalitis-like presentation, or both between AQP4-IgG-positive and MOG-IgG-positive patients. Retrospective case series of all patients who were seropositive for MOG-IgG (n = 34) and the last 100 patients with AQP4-IgG disease (NMO spectrum disorder) seen in the NMO service between January 2013 and December 2016, and analysis was completed January 4, 2017. All patients were seen in a tertiary neurological center, The Walton Centre NHS Foundation Trust in Liverpool, England. The difference in seizure frequency between the AQP4-IgG-positive and MOG-IgG-positive patient groups was determined. Thirty-four patients with MOG-IgG disease (20 female) with a median age at analysis of 30.5 years (interquartile range [IQR], 15-69 years), and 100 AQP4-IgG-positive patients (86 female) with a median age at analysis of 54 years (IQR, 12-91 years) were studied. Most patients were of white race. Five of the 34 patients with MOG-IgG (14.7%) had seizures compared with 1 patient with AQP4-IgG (2-sided P < .008, Fisher test). On magnetic resonance imaging, all 5 MOG-IgG-positive patients had inflammatory cortical brain lesions associated with the seizures. In 3 of the 5 MOG-IgG-positive patients, seizures occurred as part of the index event. Four of the 5 presented with encephalopathy and seizures, and disease relapsed in all 5 patients. Four of these patients were receiving immunosuppressant medication at last follow-up, and 3 continued to take antiepileptic medication. In contrast, the only

  4. G4CEP: A G4 theory modification by including pseudopotential for molecules containing first-, second- and third-row representative elements.

    PubMed

    Silva, Cleuton de Souza; Pereira, Douglas Henrique; Custodio, Rogério

    2016-05-28

    The G4CEP composite method was developed from the respective G4 all-electron version by considering the implementation of compact effective pseudopotential (CEP). The G3/05 test set was used as reference to benchmark the adaptation by treating in this work atoms and compounds from the first and second periods of the periodic table, as well as representative elements of the third period, comprising 440 thermochemical data. G4CEP has not reached a so high level of accuracy as the G4 all-electron theory. G4CEP presented a mean absolute error around 1.09 kcal mol(-1), while the original method presents a deviation corresponding to 0.83 kcal mol(-1). The similarity of the optimized molecular geometries between G4 and G4CEP indicates that the core-electron effects and basis set adjustments may be pointed out as a significant factor responsible for the large discrepancies between the pseudopotential results and the experimental data, or even that the all-electron calculations are more efficient either in its formulation or in the cancellation of errors. When the G4CEP mean absolute error (1.09 kcal mol(-1)) is compared to 1.29 kcal mol(-1) from G3CEP, it does not seem so efficient. However, while the G3CEP uncertainty is ±4.06 kcal mol(-1), the G4CEP deviation is ±2.72 kcal mol(-1). Therefore, the G4CEP theory is considerably more reliable than any previous combination of composite theory and pseudopotential, particularly for enthalpies of formation and electron affinities.

  5. Towards G2G: Systems of Technology Database Systems

    NASA Technical Reports Server (NTRS)

    Maluf, David A.; Bell, David

    2005-01-01

    We present an approach and methodology for developing Government-to-Government (G2G) Systems of Technology Database Systems. G2G will deliver technologies for distributed and remote integration of technology data for internal use in analysis and planning as well as for external communications. G2G enables NASA managers, engineers, operational teams and information systems to "compose" technology roadmaps and plans by selecting, combining, extending, specializing and modifying components of technology database systems. G2G will interoperate information and knowledge that is distributed across organizational entities involved that is ideal for NASA future Exploration Enterprise. Key contributions of the G2G system will include the creation of an integrated approach to sustain effective management of technology investments that supports the ability of various technology database systems to be independently managed. The integration technology will comply with emerging open standards. Applications can thus be customized for local needs while enabling an integrated management of technology approach that serves the global needs of NASA. The G2G capabilities will use NASA s breakthrough in database "composition" and integration technology, will use and advance emerging open standards, and will use commercial information technologies to enable effective System of Technology Database systems.

  6. IgG4 related sclerosing mastitis: expanding the morphological spectrum of IgG4 related diseases.

    PubMed

    Chougule, Abhijit; Bal, Amanjit; Das, Ashim; Singh, Gurpreet

    2015-01-01

    IgG4 related disease (IgG4RD) is a recently recognised condition characterised by mass forming lesions associated with storiform fibrosis, obliterative phlebitis, lymphoplasmacytic infiltrate rich in IgG4 positive plasma cells and elevated serum IgG4 levels. Although rare, mammary involvement has been reported as IgG4 related sclerosing mastitis, the morphological counterpart of a growing family of IgG4 related diseases. A total of 17 cases belonging to mass forming benign inflammatory breast lesions such as plasma cell mastitis, granulomatous lobular mastitis, non-specific mastitis and inflammatory pseudotumour were investigated as a possible member of IgG4 related sclerosing mastitis. Clinical, radiological, histopathological and immunohistochemistry findings were noted in all cases. Cases diagnosed as inflammatory pseudotumour showed all the histopathological features of IgG4RD along with increased number of IgG4 positive plasma cells and IgG4/IgG ratio >40%. However, only a few IgG4 positive cells were seen in plasma cell mastitis, granulomatous lobular mastitis and non-specific mastitis cases. These cases also did not fulfill the morphological criteria for the diagnosis of IgG4 related diseases. IgG4RD should be excluded in plasma cell rich lesions diagnosed on core biopsies by IgG4 immunostaining. This can avoid unnecessary surgery as IgG4 related diseases respond to simple and effective steroid treatment.

  7. G4CEP: A G4 theory modification by including pseudopotential for molecules containing first-, second- and third-row representative elements

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Silva, Cleuton de Souza; Instituto de Ciências Exatas e Tecnologia, Universidade Federal do Amazonas, Campus de Itacoatiara, 69100-021 Itacoatiara, Amazonas; Pereira, Douglas Henrique

    2016-05-28

    The G4CEP composite method was developed from the respective G4 all-electron version by considering the implementation of compact effective pseudopotential (CEP). The G3/05 test set was used as reference to benchmark the adaptation by treating in this work atoms and compounds from the first and second periods of the periodic table, as well as representative elements of the third period, comprising 440 thermochemical data. G4CEP has not reached a so high level of accuracy as the G4 all-electron theory. G4CEP presented a mean absolute error around 1.09 kcal mol{sup −1}, while the original method presents a deviation corresponding to 0.83more » kcal mol{sup −1}. The similarity of the optimized molecular geometries between G4 and G4CEP indicates that the core-electron effects and basis set adjustments may be pointed out as a significant factor responsible for the large discrepancies between the pseudopotential results and the experimental data, or even that the all-electron calculations are more efficient either in its formulation or in the cancellation of errors. When the G4CEP mean absolute error (1.09 kcal mol{sup −1}) is compared to 1.29 kcal mol{sup −1} from G3CEP, it does not seem so efficient. However, while the G3CEP uncertainty is ±4.06 kcal mol{sup −1}, the G4CEP deviation is ±2.72 kcal mol{sup −1}. Therefore, the G4CEP theory is considerably more reliable than any previous combination of composite theory and pseudopotential, particularly for enthalpies of formation and electron affinities.« less

  8. Photocatalytic Properties of g-C3N4–TiO2 Heterojunctions under UV and Visible Light Conditions

    PubMed Central

    Fagan, Rachel; McCormack, Declan E.; Hinder, Steven J.; Pillai, Suresh C.

    2016-01-01

    Graphitic carbon nitride (g-C3N4) and titanium dioxide (TiO2) were chosen as a model system to investigate photocatalytic abilities of heterojunction system under UV and visible light conditions. The use of g-C3N4 has been shown to be effective in the reduction in recombination through the interaction between the two interfaces of TiO2 and g-C3N4. A simple method of preparing g-C3N4 through the pyrolysis of melamine was employed, which was then added to undoped TiO2 material to form the g-C3N4–TiO2 system. These materials were then fully characterized by X-ray diffraction (XRD), Brunauer Emmett Teller (BET), and various spectroscopic techniques including Raman, X-ray photoelectron spectroscopy (XPS), Fourier transform infrared spectroscopy (FT-IR), diffuse absorbance, and photoluminescence analysis. Photocatalysis studies were conducted using the model dye, rhodamine 6G utilizing visible and UV light irradiation. Raman spectroscopy confirmed that a composite of the materials was formed as opposed to a mixture of the two. Using XPS analysis, a shift in the nitrogen peak to that indicative of substitutional nitrogen was detected for all doped samples. This is then mirrored in the diffuse absorbance results, which show a clear decrease in band gap values for these samples, showing the effective band gap alteration achieved through this preparation process. When g-C3N4–TiO2 samples were analyzed under visible light irradiation, no significant improvement was observed compared that of pure TiO2. However, under UV light irradiation conditions, the photocatalytic ability of the doped samples exhibited an increased reactivity when compared to the undoped TiO2 (0.130 min−1), with 4% g-C3N4–TiO2 (0.187 min−1), showing a 43.9% increase in reactivity. Further doping to 8% g-C3N4–TiO2 lead to a decrease in reactivity against rhodamine 6G. BET analysis determined that the surface area of the 4% and 8% g-C3N4–TiO2 samples were very similar, with values of 29.4 and

  9. Photo reduction of CO2 to CH4 on g-C3N4: The effect of concentrating light and pretreatment

    NASA Astrophysics Data System (ADS)

    Li, Dong; Fang, Xiaoxiang; Liu, Huayan; Lu, Hanfeng; Zhang, Zekai

    2018-06-01

    The behavior of CO2 photoreduction to CH4 on the g-C3N4 catalyst was studied in a concentrating light reactor. The g-C3N4 catalysts before and after pretreatment were characterized by FE-SEM, XRD and photoilluminance. It is found that concentrating light increases the CH4 yield on the g-C3N4 by heightening the incident light intensity, and light pretreatment has an excessive effect on the performance. Pretreated by suitable light intensity, air atmosphere and time, the CH4 yield on the g-C3N4 under concentrating light irradiation reached about 3.39 μmol.g-1.h-1, which is about 16 times of that g-C3N4 reacted at nature incident light without pretreatment. The mechanism of pretreatment is considered to be from the surface oxidation state change of the catalyst either from the oxidation of the catalyst surface or the activation of surface oxygen.

  10. Riedel's thyroiditis association with IgG4-related disease.

    PubMed

    Stan, Marius N; Sonawane, Vikram; Sebo, Thomas J; Thapa, Prabin; Bahn, Rebecca S

    2017-03-01

    IgG4-positive (+) plasma cells have been reported in both Riedel's thyroiditis (RT) and Hashimoto's thyroiditis (HT). These cells are the hallmark of IgG4-related disease (IgG4-RD). We sought to determine whether RT is part of IgG4-RD spectrum. This was a case-control study performed at a tertiary medical centre. We included RT cases from the period 1958 to 2008 that had sufficient paraffin-embedded tissue for IgG4 immunostaining. Controls were patients with HT, age and gender matched, with similar pathology criteria. The main outcome measures were the intensity of the IgG4 staining and the clinical and histological correlates with IgG4-RD. Six pairs of RT and HT were analysed. The mean age was 44·7 years. In both groups, 5/6 cases had positive IgG4 staining. The mean number of IgG4 + cells/ HPF, normalized to the degree of inflammation, was 3·2 ± 3·0 SD (RT) vs 0·9 ± 0·7 (HT), P = 0·15, for fibrotic areas and 2·1 ± 2·3 SD vs 1·0 ± 0·8 (P = 0·39) for areas with lymphoid aggregates. We found the number of IgG4 +  cells in RT to be inversely correlated with the duration of disease (P = 0·046). Three RT cases had associated comorbidities from the IgG4-RD spectrum while none of the HT cases had such conditions. Riedel's thyroiditis is a component of IgG4-RD with the density of the IgG4 +  lymphocytic infiltrate being time dependent. In this small study, we did not identify differences in IgG4 infiltration between RT and HT, minimizing the utility of this marker in RT diagnosis. © 2016 John Wiley & Sons Ltd.

  11. Construction of g-C3N4/CeO2/ZnO ternary photocatalysts with enhanced photocatalytic performance

    NASA Astrophysics Data System (ADS)

    Yuan, Yuan; Huang, Gui-Fang; Hu, Wang-Yu; Xiong, Dan-Ni; Zhou, Bing-Xin; Chang, Shengli; Huang, Wei-Qing

    2017-07-01

    Promoting the spatial separation of photoexcited charge carriers is of paramount significance for photocatalysis. In this work, binary g-C3N4/CeO2 nanosheets are first prepared by pyrolysis and subsequent exfoliation method, then decorated with ZnO nanoparticles to construct g-C3N4/CeO2/ZnO ternary nanocomposites with multi-heterointerfaces. Notably, the type-II staggered band alignments existing between any two of the constituents, as well as the efficient three-level transfer of electron-holes in unique g-C3N4/CeO2/ZnO ternary composites, leads to the robust separation of photoexcited charge carriers, as verified by its photocurrent increased by 8 times under visible light irradiation. The resulting g-C3N4/CeO2/ZnO ternary nanocomposites unveil appreciably increased photocatalytic activity, faster than that of pure g-C3N4, ZnO and g-C3N4/CeO2 by a factor of 11, 4.6 and 3.7, respectively, and good stability toward methylene blue (MB) degradation. The remarkably enhanced photocatalytic activity of g-C3N4/CeO2/ZnO ternary heterostructures can be interpreted in terms of lots of active sites of nanosheet shapes and the efficient charge separation owing to the resulting type-II band alignment with more than one heterointerface and the efficient three-level electron-hole transfer. A plausible mechanism is also elucidated via active species trapping experiments with various scavengers, which indicating that the photogenerated holes and •OH radicals play a crucial role in photodegradation reaction under visible light irradiation. This work suggest that the rational design and construction of type II multi-heterostructures is powerful for developing highly efficient and reusable visible-light photocatalysts for environmental purification and energy conversion.

  12. Faster Electron Injection and More Active Sites for Efficient Photocatalytic H2 Evolution in g-C3 N4 /MoS2 Hybrid.

    PubMed

    Shi, Xiaowei; Fujitsuka, Mamoru; Kim, Sooyeon; Majima, Tetsuro

    2018-03-01

    Herein, the structural effect of MoS 2 as a cocatalyst of photocatalytic H 2 generation activity of g-C 3 N 4 under visible light irradiation is studied. By using single-particle photoluminescence (PL) and femtosecond time-resolved transient absorption spectroscopies, charge transfer kinetics between g-C 3 N 4 and two kinds of nanostructured MoS 2 (nanodot and monolayer) are systematically investigated. Single-particle PL results show the emission of g-C 3 N 4 is quenched by MoS 2 nanodots more effectively than MoS 2 monolayers. Electron injection rate and efficiency of g-C 3 N 4 /MoS 2 -nanodot hybrid are calculated to be 5.96 × 10 9 s -1 and 73.3%, respectively, from transient absorption spectral measurement, which are 4.8 times faster and 2.0 times higher than those of g-C 3 N 4 /MoS 2 -monolayer hybrid. Stronger intimate junction between MoS 2 nanodots and g-C 3 N 4 is suggested to be responsible for faster and more efficient electron injection. In addition, more unsaturated terminal sulfur atoms can serve as the active site in MoS 2 nanodot compared with MoS 2 monolayer. Therefore, g-C 3 N 4 /MoS 2 nanodot exhibits a 7.9 times higher photocatalytic activity for H 2 evolution (660 µmol g- 1 h -1 ) than g-C 3 N 4 /MoS 2 monolayer (83.8 µmol g -1 h -1 ). This work provides deep insight into charge transfer between g-C 3 N 4 and nanostructured MoS 2 cocatalysts, which can open a new avenue for more rationally designing MoS 2 -based catalysts for H 2 evolution. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. 12 CFR 563g.3 - Exemptions.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 12 Banks and Banking 5 2010-01-01 2010-01-01 false Exemptions. 563g.3 Section 563g.3 Banks and Banking OFFICE OF THRIFT SUPERVISION, DEPARTMENT OF THE TREASURY SECURITIES OFFERINGS § 563g.3 Exemptions... non-public offering which satisfies the requirements of § 563g.4 of this part; (e) That are debt...

  14. Observation of the spin-orbit components of the 3B 2g( 3A 2g) ground state in the system Ni 2+:MgF 2 by fluorescence line narrowing

    NASA Astrophysics Data System (ADS)

    Tonucci, R. J.; Jacobsen, S. M.; Yen, W. M.

    1990-10-01

    Using a tunable narrow-band infrared laser, we demonstrate for the first time infrared-fluorescnece line narrowing in the system Ni 2+:MgF 2. High-resolution emission spectra were obtained by pumping the lowest spin-orbit component B 3 ( 3T 2g) (orthorhombic notation with octahedral notation in parentheses) of the 3T 2g multiplet and observing the B 3( 3T 2g)→B 1, A, B 2( 3A 2g) luminescent transitions at low temperature. By tuning the narrow-band laser over the B 3( 3T 2g) band, resonant and non-resonant fluorescence were obtained which narrowed with respect to the inhomogeneously broadened profile, and additional lines were observed. The spectra can be understood in terms of a simultaneous excitation of two different subsets of Ni 2+ ions which have their B 2( 3A 2g)→B 3( 3T 2g) and A( 3A 2g)→B 3( 3T 2g) transitions in resonance with the laser. The A( 3A 2g) and B 1( 3A 2g) spin-orbit components of the ground-state multiplet lie 1.9 cm -1 and 6.5 cm -1 above the B 2( 3A 2g) ground state, respectively, at 2 K.

  15. Enhanced visible light photocatalytic water reduction from a g-C 3N 4/SrTa 2O 6 heterojunction

    DOE PAGES

    Adhikari, Shiba P.; Hood, Zachary D.; Wang, Hui; ...

    2017-06-02

    In this paper, a new g-C 3N 4/SrTa 2O 6 heterojunction photocatalyst was designed and prepared by chimie douce (soft chemistry) method where carbon nitride (g-C 3N 4) was deposited over the metastable perovskite phase of SrTa 2O 6. The morphological study of the heterojunction using SEM and STEM revealed that g-C 3N 4 nanofibers are dispersed uniformly on the surface of SrTa 2O 6 plates leading to the intimate contact between them. The heterojunction could achieve a high and stable visible light photocatalytic H 2 generation of 137 mmol/h/mole of g-C 3N 4, which is much larger than themore » amount of hydrogen generated by one mole of pristine g-C 3N 4. Finally, a plausible mechanism for the observed enhanced photocatalytic activity for the heterojunction is proposed on the basis of effective charge separation of photogenerated electron-hole pairs, supported by band position calculations and photo-physical properties of g-C 3N 4 and SrTa 2O 6.« less

  16. Enhanced visible light photocatalytic water reduction from a g-C 3N 4/SrTa 2O 6 heterojunction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Adhikari, Shiba P.; Hood, Zachary D.; Wang, Hui

    In this paper, a new g-C 3N 4/SrTa 2O 6 heterojunction photocatalyst was designed and prepared by chimie douce (soft chemistry) method where carbon nitride (g-C 3N 4) was deposited over the metastable perovskite phase of SrTa 2O 6. The morphological study of the heterojunction using SEM and STEM revealed that g-C 3N 4 nanofibers are dispersed uniformly on the surface of SrTa 2O 6 plates leading to the intimate contact between them. The heterojunction could achieve a high and stable visible light photocatalytic H 2 generation of 137 mmol/h/mole of g-C 3N 4, which is much larger than themore » amount of hydrogen generated by one mole of pristine g-C 3N 4. Finally, a plausible mechanism for the observed enhanced photocatalytic activity for the heterojunction is proposed on the basis of effective charge separation of photogenerated electron-hole pairs, supported by band position calculations and photo-physical properties of g-C 3N 4 and SrTa 2O 6.« less

  17. Interface engineered construction of porous g-C3N4/TiO2 heterostructure for enhanced photocatalysis of organic pollutants

    NASA Astrophysics Data System (ADS)

    Li, Ya-Nan; Chen, Zhao-Yang; Wang, Min-Qiang; Zhang, Long-zhen; Bao, Shu-Juan

    2018-05-01

    A porous g-C3N4/TiO2 with hierarchical heterostructure has been successfully fabricated through a in situ assembling of small needle-like TiO2 on the surface of ultrathin g-C3N4 sheets. The ultrathin g-C3N4 sheets with carbon vacancies and rich hydroxyl groups were found to facilitate the nucleation and in situ growth of TiO2 and also to modulate the surface chemical activity of the g-C3N4/TiO2 hierarchical heterostructure. The as-designed photocatalytic heterojunction degraded Acid Orange with 82% efficiency after 10 min under simulated solar light, and possessed excellent cycle stability. Relative physical characterizations and photochemical experiments reveal that engineering the interface/surface of g-C3N4 plays a vital role in effectively constructing heterostructures of g-C3N4/TiO2, thus realizing efficient photoinduced electron-hole separation during photocatalytic process.

  18. Adsorption of H2O, H2, O2, CO, NO, and CO2 on graphene/g-C3N4 nanocomposite investigated by density functional theory

    NASA Astrophysics Data System (ADS)

    Wu, Hong-Zhang; Bandaru, Sateesh; Liu, Jin; Li, Li-Li; Wang, Zhenling

    2018-02-01

    Motivated by the photocatalytic reactions of small molecules on g-C3N4 by these insights, we sought to explore the adsorption of H2O and CO2 molecules on the graphene side and H2O, H2, O2, CO, NO, and CO2 molecules on the g-C3N4 side of hybrid g-C3N4/graphene nanocomposite using first-principles calculations. The atomic structure and electronic properties of hybrid g-C3N4/graphene nanocomposite is explored. The adsorption of small molecules on graphene/g-C3N4 nanocomposite is thoroughly investigated. The computational studies revels that all small molecules on graphene/g-C3N4 nanocomposite are the physisorption. The adsorption characteristics of H2O and CO2 molecules on the graphene side are similar to that on graphene. The adsorption of H2O, H2, O2, CO, NO, and CO2 molecules on the g-C3N4 side always leads to a buckle structure of graphene/g-C3N4 nanocomposite. Graphene as a substrate can significantly relax the buckle degree of g-C3N4 in g-C3N4/graphene nanocomposite.

  19. Association between PAI-1 4G/5G polymorphism and diabetic nephropathy: a meta-analysis in the Chinese population.

    PubMed

    Gao, Wen-Feng; Guo, Ying-Bo; Bai, Yu; Ding, Xin-Yu; Yan, Yong-Ji; Wu, Zhen-Qi

    2016-09-01

    Although a number of studies have been conducted on the association between plasminogen activator inhibitor-1 (PAI-1) 4G/5G polymorphism and diabetic nephropathy (DN) in Chinese population, this association remains elusive and controversial. To further assess the effects of PAI-1 4G/5G polymorphism on the risk of DN, a meta-analysis was performed in the Chinese population. Relevant studies were identified using PubMed, Springer Link, Ovid, Chinese Wanfang Data Knowledge Service Platform, Chinese National Knowledge Infrastructure, and Chinese Biology Medicine through November, 2015. Pooled odds ratios (ORs) and 95 % confidence intervals (CIs) were used to assess the strength of the associations. This meta-analysis identified nine studies, including 777 DN cases, 413 healthy controls, and 523 DM controls. In the total analyses, a significantly elevated risk of DN was associated with variants of PAI-1 4G/5G when compared with the healthy group (4G vs. 5G, OR 2.46, 95 % CI 1.45-4.16; 4G/4G vs. 5G/5G, OR 4.32, 95 % CI 1.79-10.39; 4G/4G vs. 4G/5G +5G/5G, OR 2.96, 95 % CI 1.59-5.53; 4G/4G +4G/5G vs. 5G/5G, OR 2.78, 95 % CI 1.34-5.75) and DM group (4G vs. 5G, OR 1.93, 95 % CI 1.28-2.92; 4G/4G vs. 5G/5G, OR 2.99, 95 % CI 1.44-6.21; 4G/4G vs. 4G/5G +5G/5G, OR 2.84, 95 % CI 1.77-4.54). In the subgroup analyses stratified by ethnicity and geographic areas, it revealed the significant results in Chinese Han, in North and South China. This meta-analysis showed that the PAI-1 4G/4G variant, 4G allele might be risk alleles for DN susceptibility in the Chinese population, and further studies in other ethic groups are required for definite conclusions.

  20. [PAL-1 5G/4G polymorphism in patients with systemic lupus erythematosus].

    PubMed

    Savov, A; Andonova, S; Tanev, D; Robeva, R; Marincheva, Ts; Tomova, A; Kumanov, Ph; Rashkov, R; Kolarov, Zl

    2014-01-01

    Systemic lupus erythematosus (SLE) is a connective tissue disease affecting predominantly women that has been widely associated with obstetric complications. Inherited thrombophilias are significant risk factors for pregnancy loss, but their role in patients with SLE, and especially in those without concomitant secondary antiphospholipid syndrome (APS) has not been clarified. The aim of the present study was to study PAI-1 5G/4G polymorphism in women with lupus. A total of 103 SLE patients as well as 69 healthy volunteers were genotyped for PAI-1 5G/4G (rs1799889). No significant differences in the PAI-1 5G/4G genotype prevalence between patients and controls were found. After exclusion of the women with secondary APS, the frequency of pregnancies and spontaneous abortions, as well as the number of live births were similar in the studied patients with different PAI-1 genotype (p> 0.05). PAI-1 5G/4G polymorphism was not significantly related to any of the lupus ACR criteria or disease activity (p > 0.05), but it could influence the platelet number in the studied patients (263.52 ± 91.10 [5G/5G genotype] versus 210.12 ± 71.79 [4G/4G genotype], p = 0.023). In conclusion, our results showed that PAI-1 4G/5G polymorphism did not worsen the reproductive outcome in SLE women without secondary APS.

  1. Black TiO2 nanobelts/g-C3N4 nanosheets Laminated Heterojunctions with Efficient Visible-Light-Driven Photocatalytic Performance

    PubMed Central

    Shen, Liyan; Xing, Zipeng; Zou, Jinlong; Li, Zhenzi; Wu, Xiaoyan; Zhang, Yuchi; Zhu, Qi; Yang, Shilin; Zhou, Wei

    2017-01-01

    Black TiO2 nanobelts/g-C3N4 nanosheets laminated heterojunctions (b-TiO2/g-C3N4) as visible-light-driven photocatalysts are fabricated through a simple hydrothermal-calcination process and an in-situ solid-state chemical reduction approach, followed by the mild thermal treatment (350 °C) in argon atmosphere. The prepared samples are evidently investigated by X-ray diffraction, Fourier transform infrared spectroscopy, scanning electron microscopy, transmission electron microscopy, X-ray photoelectron spectroscopy, N2 adsorption, and UV-visible diffuse reflectance spectroscopy, respectively. The results show that special laminated heterojunctions are formed between black TiO2 nanobelts and g-C3N4 nanosheets, which favor the separation of photogenerated electron-hole pairs. Furthermore, the presence of Ti3+ and g-C3N4 greatly enhance the absorption of visible light. The resultant b-TiO2/g-C3N4 materials exhibit higher photocatalytic activity than that of g-C3N4, TiO2, b-TiO2 and TiO2/g-C3N4 for degradation of methyl orange (95%) and hydrogen evolution (555.8 μmol h−1 g−1) under visible light irradiation. The apparent reaction rate constant (k) of b-TiO2/g-C3N4 is ~9 times higher than that of pristine TiO2. Therefore, the high-efficient laminated heterojunction composites will have potential applications in fields of environment and energy. PMID:28165021

  2. Imidazole modified g-C3N4 photocatalyst: Structural characterization and versatile energy applications

    NASA Astrophysics Data System (ADS)

    Zhang, Lu; Liu, Qianqian; Chai, Yuanyuan; Ren, Jia; Dai, Wei-Lin

    2018-02-01

    Novel imidazole modified g-C3N4 were firstly synthesized via a facile one-pot thermo-induced co-condensation method. Characterization results showed that imidazole modification can improve the visible light harvesting, interfacial charge transfer and separation of g-C3N4, without destroying its pristine framework structure. The as-obtained imidazole modified g-C3N4 showed remarkably enhanced and rather stable photocatalytic performance in H2 evolution, photo-degradation of water contaminants and selective photo-oxidation of benzyl alcohol, demonstrating its all-round applications as a versatile photocatalyst. The weight ratio between imidazole and urea was well tuned and the optimal photocatalytic activity was obtained, which shows CNU-I50 sample (50 mg imidazole in 15 g urea) possesses the highest hydrogen evolution rate of 2150 μmol g-1 h-1, superior to most of the previous reported g-C3N4 materials. These results suggest that those imidazole modified g-C3N4 materials are potential photocatalyst when applied to solar energy conversion, water purification and selective photosynthesis reactions.

  3. Photo-induced CO2 reduction by CH4/H2O to fuels over Cu-modified g-C3N4 nanorods under simulated solar energy

    NASA Astrophysics Data System (ADS)

    Tahir, Beenish; Tahir, Muhammad; Amin, Nor Aishah Saidina

    2017-10-01

    Copper modified polymeric graphitic carbon nitride (Cu/g-C3N4) nanorods for photo-induced CO2 conversion with methane (CH4) and water (H2O) as reducing system under simulated solar energy has been investigated. The nanocatalysts, synthesized by pyrolysis and sonication, were characterized by XRD, FTIR, Raman analysis, XPS, SEM, N2 adsorption-desorption and PL spectroscopy. The presence of Cu2+ ions over the g-C3N4 structure inhibited charge carriers recombination process. The results indicated that photo-activity and selectivity of Cu/g-C3N4 photo-catalyst for CO2 reduction greatly dependent on the type of CO2-reduction system. CO2 was efficiently converted to CH4 and CH3OH with traces of C2H4 and C2H6 hydrocarbons in the CO2-water system. The yield of the main product, CH4 over 3 wt.% Cu/g-C3N4 was 109 μmole g-cata.-1 h-1 under visible light irradiation, significantly higher than the pure g-C3N4 catalyst (60 μmole/g.cat). In photo-induced CO2-CH4 reaction, CO and H2 were detected as the main products with smaller amount of hydrocarbons. The highest efficiency was detected over 3 wt.%Cu-loading of g-C3N4 and at optimal CH4/CO2 feed ratio of 1.0. The maximum yield of CO and H2 detected were 142 and 76 μmole g-catal.-1 h-1, respectively at selectivity 66.6% and 32.5%, respectively. Significantly enhanced CO2/CH4 reduction over Cu/g-C3N4 was attributed to its polymeric structure with efficient charge transfer property and inhibited charges recombination rate. A proposed photo-induced reaction mechanism, corroborated with the experimental data, was also deliberated.

  4. Meta-analysis of the association between plasminogen activator inhibitor-1 4G/5G polymorphism and recurrent pregnancy loss.

    PubMed

    Li, Xuejiao; Liu, Yukun; Zhang, Rui; Tan, Jianping; Chen, Libin; Liu, Yinglin

    2015-04-11

    The association between plasminogen activator inhibitor-1 (PAI-1) 4G/5G polymorphism and recurrent pregnancy loss (RPL) risk is still contradictory. We thus performed a meta-analysis. Relevant studies were searched for in PubMed, Web of Science, Embase, and Cochrane Library. An odds ratio (OR) with a 95% confidence interval (CI) was used to assess the association between PAI-1 4G/5G polymorphism and RPL risk. A total of 22 studies with 4306 cases and 3076 controls were included in this meta-analysis. We found that PAI-1 4G/5G polymorphism was significantly associated with an increased RPL risk (OR=1.89; 95% CI 1.34-2.67; P=0.0003). In the subgroup analysis by race, PAI-1 4G/5G polymorphism was significantly associated with an increased RPL risk in Caucasians (OR=2.23; 95% CI 1.44-3.46; P=0.0003). However, no significant association was observed in Asians (OR=1.47; 95% CI 0.84-2.59; P=0.18). In conclusion, this meta-analysis suggests that PAI-1 4G/5G polymorphism might be associated with RPL development in Caucasians.

  5. Synthesis of g-C{sub 3}N{sub 4}/Ag{sub 3}PO{sub 4} heterojunction with enhanced photocatalytic performance

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    He, Peizhi; Song, Limin; Zhang, Shujuan, E-mail: songlmnk@sohu.com

    2014-03-01

    Graphical abstract: g-C{sub 3}N{sub 4}/Ag{sub 3}PO{sub 4} heterojunction photocatalyst with visible-light response was prepared by a facile coprecipitation method. The results show that g-C{sub 3}N{sub 4}/Ag{sub 3}PO{sub 4} possesses a much higher activity for the decomposition of RhB than that of the pure Ag{sub 3}PO{sub 4} particles. The most mechanism is that g-C{sub 3}N{sub 4}/Ag{sub 3}PO{sub 4} heterojunction photocatalyst can efficiently separate the photogenerated electron–hole pairs, enhancing the photocatalytic activity of g-C{sub 3}N{sub 4}/Ag{sub 3}PO{sub 4} composites. - Highlights: • g-C{sub 3}N{sub 4}/Ag{sub 3}PO{sub 4} heterojunction showed much higher activity than that of Ag{sub 3}PO{sub 4}. • The high activitymore » could be attributed to g-C{sub 3}N{sub 4} for modifying Ag{sub 3}PO{sub 4}. • More ·OH radicals may be significant reason to improve Ag{sub 3}PO{sub 4} activity. - Abstract: g-C{sub 3}N{sub 4}/Ag{sub 3}PO{sub 4} heterojunction photocatalyst with visible-light response was prepared by a facile coprecipitation method. The photocatalysts were characterized by X-ray powder diffraction, transmission electron microscopy, UV–vis absorption spectroscopy and Fourier transform infrared spectroscopy. The photocatalytic activities of the obtained samples were tested by using Rhodamine B (RhB) as the degradation target under visible light irradiation. g-C{sub 3}N{sub 4}/Ag{sub 3}PO{sub 4} decomposed RhB more effectively than the pure Ag{sub 3}PO{sub 4} particles did, and 2 wt.% g-C{sub 3}N{sub 4} had the highest activity. Furthermore, 2 wt.% g-C{sub 3}N{sub 4}/Ag{sub 3}PO{sub 4} degraded high-concentration RhB more potently than unmodified Ag{sub 3}PO{sub 4} did, probably because g-C{sub 3}N{sub 4}/Ag{sub 3}PO{sub 4} heterojunction photocatalyst enhanced the photocatalytic activity by efficiently separating the photogenerated electron–hole pairs.« less

  6. CO2 conversion in non-thermal plasma and plasma/g-C3N4 catalyst hybrid processes

    NASA Astrophysics Data System (ADS)

    Lu, Na; Sun, Danfeng; Zhang, Chuke; Jiang, Nan; Shang, Kefeng; Bao, Xiaoding; Li, Jie; Wu, Yan

    2018-03-01

    Carbon dioxide conversion at atmosphere pressure and low temperature has been studied in a cylindrical dielectric barrier discharge (DBD) reactor. Pure CO2 feed flows to the discharge zone and typical filamentary discharges were obtained in each half-cycle of the applied voltage. The gas temperature increased with discharge time and discharge power, which was found to affect the CO2 decomposition deeply. As the DBD reactor was cooled to ambient temperature, both the conversion of CO2 and the CO yield were enhanced. Especially the energy efficiencies changed slightly with the increase of discharge power and were much higher in cooling condition comparing to those without cooling. At a discharge power of 40 W, the energy efficiency under cooling condition was approximately six times more than that without cooling. Gas flow rate was observed to affect CO2 conversion and 0.1 L min-1 was obtained as optimum gas flow rate under cooling condition. In addition, the CO2 conversion rate in plasma/g-C3N4 catalyst hybrid system was twice times as that in plasma-alone system. In case of cooling, the existence of g-C3N4 catalyst contributed to a 47% increase of CO2 conversion compared to the sole plasma process. The maximum energy-efficiency with g-C3N4 was 0.26 mmol kJ-1 at 20 W, which increased by 157% compared to that without g-C3N4. The synergistic effect of DBD plasma with g-C3N4 on pure CO2 conversion was verified.

  7. Effects of 2G and 3G mobile phones on human alpha rhythms: Resting EEG in adolescents, young adults, and the elderly.

    PubMed

    Croft, R J; Leung, S; McKenzie, R J; Loughran, S P; Iskra, S; Hamblin, D L; Cooper, N R

    2010-09-01

    The present study was conducted to determine whether adolescents and/or the elderly are more sensitive to mobile phone (MP)-related bioeffects than young adults, and to determine this for both 2nd generation (2G) GSM, and 3rd generation (3G) W-CDMA exposures. To test this, resting alpha activity (8-12 Hz band of the electroencephalogram) was assessed because numerous studies have now reported it to be enhanced by MP exposure. Forty-one 13-15 year olds, forty-two 19-40 year olds, and twenty 55-70 year olds were tested using a double-blind crossover design, where each participant received Sham, 2G and 3G exposures, separated by at least 4 days. Alpha activity, during exposure relative to baseline, was recorded and compared between conditions. Consistent with previous research, the young adults' alpha was greater in the 2G compared to Sham condition, however, no effect was seen in the adolescent or the elderly groups, and no effect of 3G exposures was found in any group. The results provide further support for an effect of 2G exposures on resting alpha activity in young adults, but fail to support a similar enhancement in adolescents or the elderly, or in any age group as a function of 3G exposure. 2010 Wiley-Liss, Inc.

  8. Synthesis and biological activity of novel series of 4-methoxy, and 4,9-dimethoxy-5-substituted furo[2,3-g]-1,2,3-benzoxathiazine-7,7-dioxide derivatives

    PubMed Central

    El-Sawy, Eslam R.; Ebaid, Manal S.; Abo-Salem, Heba M.; El-Hallouty, Salwa; Kassem, Emad M.; Mandour, Adel H.

    2013-01-01

    A novel series of 4-methoxy, and 4,9-dimethoxy-5-substituted furo[2,3-g]-1,2,3-benzoxathiazine-7,7-dioxide derivatives 3a,b, 10a–g and 11a–g were prepared in good yields via the reaction of 4-methoxy (1a) and 4,7-dimethoxy-5-acetyl-6-hydroxybenzofurans (1b) and their α,β-unsaturated keto derivatives 6a–g and 7a–g with chlorosulfonyl isocyanate (CSI). On the other hand, N-chlorosulfonyl carbamate derivatives 4a,b, 12a,b and 13a,b were prepared and allowed to react with piperidine to give the corresponding N-piperidinosulfonyl carbamate derivatives 5a,b, 14a,b and 15a,b, respectively. Sixteen new target compounds 3a,b, 10a–g, and 11a–g were tested for their DPPH radical-scavenging, and in vitro antiproliferative activity against A-549, MCF7 and HCT-116 cancer cell lines. Compounds 10a, 11c, 11e, and 11g showed moderate DPPH radical-scavenging activity compared to ascorbic acid at 100 μg/mL. 4,9-Dimethoxy-5-substituted styrylfuro[3,2-g]-1,2,3-benzoxathiazine-7,7-dioxides 11a, 11b, and 11c were found to be highly active against A-549 and HCT-116 cancer cell lines with IC50 values ranging from 0.02 to 0.08 μmol/mL compared to doxorubicin with IC50 = 0.04 and 0.06 μmol/mL, respectively. PMID:25685501

  9. Synthesis and biological activity of novel series of 4-methoxy, and 4,9-dimethoxy-5-substituted furo[2,3-g]-1,2,3-benzoxathiazine-7,7-dioxide derivatives.

    PubMed

    El-Sawy, Eslam R; Ebaid, Manal S; Abo-Salem, Heba M; El-Hallouty, Salwa; Kassem, Emad M; Mandour, Adel H

    2014-05-01

    A novel series of 4-methoxy, and 4,9-dimethoxy-5-substituted furo[2,3-g]-1,2,3-benzoxathiazine-7,7-dioxide derivatives 3a,b, 10a-g and 11a-g were prepared in good yields via the reaction of 4-methoxy (1a) and 4,7-dimethoxy-5-acetyl-6-hydroxybenzofurans (1b) and their α,β-unsaturated keto derivatives 6a-g and 7a-g with chlorosulfonyl isocyanate (CSI). On the other hand, N-chlorosulfonyl carbamate derivatives 4a,b, 12a,b and 13a,b were prepared and allowed to react with piperidine to give the corresponding N-piperidinosulfonyl carbamate derivatives 5a,b, 14a,b and 15a,b, respectively. Sixteen new target compounds 3a,b, 10a-g, and 11a-g were tested for their DPPH radical-scavenging, and in vitro antiproliferative activity against A-549, MCF7 and HCT-116 cancer cell lines. Compounds 10a, 11c, 11e, and 11g showed moderate DPPH radical-scavenging activity compared to ascorbic acid at 100 μg/mL. 4,9-Dimethoxy-5-substituted styrylfuro[3,2-g]-1,2,3-benzoxathiazine-7,7-dioxides 11a, 11b, and 11c were found to be highly active against A-549 and HCT-116 cancer cell lines with IC50 values ranging from 0.02 to 0.08 μmol/mL compared to doxorubicin with IC50 = 0.04 and 0.06 μmol/mL, respectively.

  10. APOBEC3G ubiquitination by Nedd4-1 favors its packaging into HIV-1 particles.

    PubMed

    Dussart, Sylvie; Douaisi, Marc; Courcoul, Marianne; Bessou, Gilles; Vigne, Robert; Decroly, Etienne

    2005-01-21

    APOBEC3G is a cytidine deaminase that limits the replication of many retroviruses. This antiviral host factor is packaged into retrovirus particles, where it targets single-stranded DNA generated during reverse transcription and induces up to 2% of G-to-A mutations, which are lethal for the HIV-1 provirus. Vif protein counteracts this antiviral factor by decreasing its packaging into lentivirus particles. Here, we demonstrate that Nedd4-1, an HECT E3 ubiquitin ligase, interacts with APOBEC3G, through its WW2 and WW3 domains. As a result of this interaction, APOBEC3G undergoes post-translational modification by addition of ubiquitin moieties. Accordingly, we demonstrate that the dominant negative Nedd4-1 C/S form prevents APOBEC3G ubiquitination. Moreover, the packaging of APOBEC3G into Pr55 Gag virus-like particles and into HIV-1 virions is reduced when Nedd4-1 C/S is expressed. During HIV-1 viral production in the presence of APOBEC3G, Nedd4-1 C/S restores partially the infectivity of Deltavif HIV-1. We conclude that the ubiquitination of APOBEC3G by Nedd4-1 favors its targeting to the virus assembly site where APOBEC3G interacts with Gag and is packaged into HIV-1 particles in the absence of Vif.

  11. Comparison of efficacy of once daily multimatrix mesalazine 2.4 g/day and 4.8 g/day with other 5-aminosalicylic acid preparation in active ulcerative colitis: a randomized, double-blind study.

    PubMed

    Ogata, Haruhiko; Yokoyama, Tadashi; Mizushima, Seiichi; Hagino, Atsushi; Hibi, Toshifumi

    2018-04-01

    This study compared the efficacy of multimatrix mesalazine 2.4 g/day and 4.8 g/day with controlled-release mesalazine 2.25 g/day. In this multicenter, randomized, double-blind study, 251 patients with mildly to moderately active ulcerative colitis received multimatrix mesalazine 2.4 g/day once daily (Multimatrix-2.4), 4.8 g/day once daily (Multimatrix-4.8), or controlled-release (time-dependent) mesalazine 2.25 g/day 3 times daily (Time-2.25) for 8 weeks. The primary efficacy endpoint was the change in the ulcerative colitis-disease activity index (UC-DAI) score. The mean change in the UC-DAI score and standard deviation in the per protocol set was -1.9±2.5 for Multimatrix-2.4 and -2.4±2.8 for Time-2.25. The difference between Multimatrix-2.4 and Time-2.25 was 0.3 (two-sided 95% confidence interval [CI], -0.5 to 1.1), thus non-inferiority was not demonstrated based on the pre-defined non-inferiority margin (1.0). In the full analysis set, the difference between Multimatrix-4.8 and Time-2.25 was -1.2 (two-sided 95% CI, -2.0 to -0.5), and the mean change in UC-DAI score in the FAS was -3.3 (two-sided 95% CI, -3.9 to -2.8) for Multimatrix-4.8 and -1.9 (two-sided 95% CI, -2.5 to -1.3) for Multimatrix-2.4, indicating that Multimatrix-4.8 was more effective than Time-2.25 and Multimatrix-2.4. There was no difference among the treatment groups in terms of safety. This study showed that the efficacy of multimatrix mesalazine 2.4 g/day was comparable to controlled release mesalazine 2.25 g/day, although non-inferiority was not demonstrated. Importantly, this was the first study to indicate that multimatrix mesalazine 4.8 g/day was more effective than 2.4g/day with no associated safety concerns.

  12. OVA-bound nanoparticles induce OVA-specific IgG1, IgG2a, and IgG2b responses with low IgE synthesis.

    PubMed

    Yanase, Noriko; Toyota, Hiroko; Hata, Kikumi; Yagyu, Seina; Seki, Takahiro; Harada, Mitsunori; Kato, Yasuki; Mizuguchi, Junichiro

    2014-10-14

    There is an urgent requirement for a novel vaccine that can stimulate immune responses without unwanted toxicity, including IgE elevation. We examined whether antigen ovalbumin (OVA) conjugated to the surface of nanoparticles (NPs) (OVA-NPs) with average diameter of 110nm would serve as an immune adjuvant. When BALB/c mice were immunized with OVA-NPs, they developed sufficient levels of OVA-specific IgG1 antibody responses with low levels of IgE synthesis, representing helper T (Th)2-mediated humoral immunity. OVA-specific IgG2a and IgG2b responses (i.e., Th1-mediated immunity) were also induced by secondary immunization with OVA-NPs. As expected, immunization with OVA in alum (OVA-alum) stimulated humoral immune responses, including IgG1 and IgE antibodies, with only low levels of IgG2a/IgG2b antibodies. CD4-positive T cells from mice primed with OVA-NPs produced substantial levels of IL-21 and IL-4, comparable to those from OVA-alum group. The irradiated mice receiving OVA-NPs-primed B cells together with OVA-alum-primed T cells exhibited enhanced anti-OVA IgG2b responses relative to OVA-alum-primed B cells and T cells following stimulation with OVA-NPs. Moreover, when OVA-NPs-primed, but not OVA-alum-primed, B cells were cultured in the presence of anti-CD40 monoclonal antibody, IL-4, and IL-21, or LPS plus TGF-β in vitro, OVA-specific IgG1 or IgG2b antibody responses were elicited, suggesting that immunization with OVA-NPs modulates B cells to generate IgG1 and IgG2b responses. Thus, OVA-NPs might exert their adjuvant action on B cells, and they represent a promising potential vaccine for generating both IgG1 and IgG2a/IgG2b antibody responses with low IgE synthesis. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. The binding efficiency of RPA to telomeric G-strands folded into contiguous G-quadruplexes is independent of the number of G4 units.

    PubMed

    Lancrey, Astrid; Safa, Layal; Chatain, Jean; Delagoutte, Emmanuelle; Riou, Jean-François; Alberti, Patrizia; Saintomé, Carole

    2018-03-01

    Replication protein A (RPA) is a single-stranded DNA binding protein involved in replication and in telomere maintenance. During telomere replication, G-quadruplexes (G4) can accumulate on the lagging strand template and need to be resolved. It has been shown that human RPA is able to unfold a single G4. Nevertheless, the G-strand of human telomeres is prone to fold into higher-order structures formed by contiguous G-quadruplexes. To understand how RPA deals with these structures, we studied its interaction with telomeric G-strands folding into an increasing number of contiguous G4s. The aim of this study was to determine whether the efficiency of binding/unfolding of hRPA to telomeric G-strands depends on the number of G4 units. Our data show that the number n of contiguous G4 units (n ≥ 2) does not affect the efficiency of hRPA to coat transiently exposed single-stranded telomeric G-strands. This feature may be essential in preventing instability due to G4 structures during telomere replication. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  14. Prognostic value of the PAI-1 4G/5G polymorphism in invasive ductal carcinoma of the breast.

    PubMed

    Yagmurdur, M C; Atac, F B; Tutar, N U; Verdi, H; Isiklar, I; Ozdemir, B H; Ozbek, N; Karakayali, H; Haberal, M

    2008-01-01

    The study group was derived from the archive materials of 55 invasive ductal breast cancer (IDC) patients who had undergone breast-preserving surgery (partial mastectomy/ axillary dissection). All patients included in the study had clinically T(1)-2, N0-M0 invasive ductal carcinoma. Genomic DNA species were extracted from paraffin-embedded blocks, and plasminogen activator inhibitor type-1 (PAI-1) gene 4G/5G genotyping was done by polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP). Patient demographics, axillary metastasis status, metastatic lymph nodi/total dissected lymph nodes from axilla, histopathologic characteristics of tumors, local recurrences, and survival ratio were assessed. PAI-1 4G/5G genotype frequencies were 4G/4G (64%), 4G/5G (31%), and 5G/5G (5%) in the patient group. According to the results based on frequencies, the demographics were not different. Five-year local recurrence rate of 4G/5G patients was the lowest (2/17, 12%) (P = 0.02). Also five-year distant metastases ratio of 4G/5G patients was the highest (18%) (P = 0.01). Five- and 10-year disease-free survival rates for the 4G/4G, 4G/5G, and 5G/5G groups were 97% and 94%, 82% and 77%, and 100% and 94%, respectively (P = 0.004). The results of this study indicate that the 4G allele in the PAI 1 gene had a negative impact on local recurrence and disease-free survival of patients with clinical T(1)-2N0M0 IDC.

  15. Thermodynamics of triple helix formation: spectrophotometric studies on the d(A)10.2d(T)10 and d(C+3T4C+3).d(G3A4G3).d(C3T4C3) triple helices.

    PubMed Central

    Pilch, D S; Brousseau, R; Shafer, R H

    1990-01-01

    We have stabilized the d(A)10.2d(T)10 and d(C+LT4C+3).d(G3A4G3).d(C3T4C3) triple helices with either NaCl or MgCl2 at pH 5.5. UV mixing curves demonstrate a 1:2 stoichiometry of purine to pyrimidine strands under the appropriate conditions of pH and ionic strength. Circular dichroic titrations suggest a possible sequence-independent spectral signature for triplex formation. Thermal denaturation profiles indicate the initial loss of the third strand followed by dissociation of the underlying duplex with increasing temperature. Depending on the base sequence and ionic conditions, the binding affinity of the third strand for the duplex at 25 degrees C is two to five orders of magnitude lower than that of the two strands forming the duplex. Thermodynamic parameters for triplex formation were determined for both sequences in the presence of 50 mM MgCl2 and/or 2.0 M NaCl. Hoogsteen base pairs are 0.22-0.64 kcal/mole less stable than Watson-Crick base pairs, depending on ionic conditions and base composition. C+.G and T.A Hoogsteen base pairs appear to have similar stability in the presence of Mg2+ ions at low pH. PMID:2216768

  16. Distances to Supernova Remnants G31.9+0.0 and G54.4−0.3 Associated with Molecular Clouds

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ranasinghe, S.; Leahy, D. A.

    2017-07-10

    New distances to the supernova remnants (SNRs) G31.9+0.0 and G54.4−0.3 have been found. The analysis method uses H i absorption spectra and CO channel maps. Individual H i channel maps are used to verify absorption features in the H i absorption spectrum or to determine if they have noise. Both of the SNRs are associated with molecular clouds so accurate kinematic velocities are determined. The H iabsorption is used to resolve the kinematic distance ambiguity. The resulting new distance for G31.9+0.0 is 7.1 ± 0.4 kpc and for G54.4−0.3 it is 6.6 ± 0.6 kpc. These are significant revisions tomore » the previous values.« less

  17. g-C3N4 modified TiO2 nanosheets with enhanced photoelectric conversion efficiency in dye-sensitized solar cells

    NASA Astrophysics Data System (ADS)

    Xu, Jian; Wang, Guanxi; Fan, Jiajie; Liu, Baoshun; Cao, Shaowen; Yu, Jiaguo

    2015-01-01

    Dye-sensitized solar cells (DSSCs) were fabricated by using g-C3N4 modified TiO2 nanosheets (CTS) as photoanode materials in this research. A thin layer of g-C3N4 was coated on the surface of TiO2 nanosheets by simply heating the mixture of TiO2 nanosheets and urea, which led to the formation of TiO2@g-C3N4 nanosheet heterostructure. The experimental results showed that the photoelectric conversion efficiency of DSSCs was obviously improved after modified by g-C3N4. The measurements of I-V characteristic indicated that the introduction of g-C3N4 could increase both the open circuit voltage and short-circuit photocurrent density. Along with the analysis of electrochemical impedance spectroscopy, it is considered that the thin layer of g-C3N4 can act as the blocking layer for electron backward recombination with electrolyte, which can be used as the functional material to increase the DSSC performance.

  18. Formation of g-C3N4@Ni(OH)2 Honeycomb Nanostructure and Asymmetric Supercapacitor with High Energy and Power Density.

    PubMed

    Dong, Bitao; Li, Mingyan; Chen, Sheng; Ding, Dawei; Wei, Wei; Gao, Guoxin; Ding, Shujiang

    2017-05-31

    Nickel hydroxide (Ni(OH) 2 ) has been regarded as a potential next-generation electrode material for supercapacitor owing to its attractive high theoretical capacitance. However, practical application of Ni(OH) 2 is hindered by its lower cycling life. To overcome the inherent defects, herein we demonstrate a unique interconnected honeycomb structure of g-C 3 N 4 and Ni(OH) 2 synthesized by an environmentally friendly one-step method. In this work, g-C 3 N 4 has excellent chemical stability and supports a perpendicular charge-transporting direction in charge-discharge process, facilitating electron transportation along that direction. The as-prepared composite exhibits higher specific capacities (1768.7 F g -1 at 7 A g -1 and 2667 F g -1 at 3 mV s -1 , respectively) compared to Ni(OH) 2 aggregations (968.9 F g -1 at 7 A g -1 ) and g-C 3 N 4 (416.5 F g -1 at 7 A g -1 ), as well as better cycling performance (∼84% retentions after 4000 cycles). As asymmetric supercapacitor, g-C 3 N 4 @Ni(OH) 2 //graphene exhibits high capacitance (51 F g -1 ) and long cycle life (72% retentions after 8000 cycles). Moreover, high energy density of 43.1 Wh kg -1 and power density of 9126 W kg -1 has been achieved. This attractive performance reveals that g-C 3 N 4 @Ni(OH) 2 with honeycomb architecture could find potential application as an electrode material for high-performance supercapacitors.

  19. Enhanced visible light photocatalytic activity of g-C3N4 assisted by hydrogen peroxide

    NASA Astrophysics Data System (ADS)

    Chen, Quan-Liang; Liu, Yi-Ling; Tong, Li-Ge

    2018-04-01

    Water pollution has caused much attention nowadays. Photocatalysis as a kind of advanced oxidation technology has been widely studied in the field of environmental pollution control. As a stable non-metal photocatalyst, the photocatalytic activity of g-C3N4 assisted by H2O2 was investigated for the degradation of Rhodamine B (RhB) under visible light irradiation. The combination of g-C3N4 and H2O2 has much higher activity than that of pure g-C3N4 or H2O2. Neutral solution is preferred for the high phtotocatalytic activity of g-C3N4 with H2O2. The effect of the amount of catalyst, H2O2 concentration and RhB concentration was investigated. Photocatalytic mechanism study using radical scavenger showed free radicals {{{{O}}}2}- and · OH are the main active species. g-C3N4 assisted by H2O2 showed good photostability and repeatability after five cycles of degradation experiment.

  20. Enhanced photocatalytic performances of ultrafine g-C3N4 nanosheets obtained by gaseous stripping with wet nitrogen

    NASA Astrophysics Data System (ADS)

    Fan, Chengkong; Feng, Qiang; Xu, Guangqing; Lv, Jun; Zhang, Yong; Liu, Jiaqin; Qin, Yongqiang; Wu, Yucheng

    2018-01-01

    Graphitic carbon nitride (g-C3N4) is a promising heterogeneous photocatalyst for organics pollutants degradation and water splitting. Herein, we highlight an available pathway to prepare the ultrafine g-C3N4 nanosheets by gaseous stripping of bulk g-C3N4 in wet nitrogen. As comparison, g-C3N4 treated in air and nitrogen atmospheres are also prepared. The obtained products are characterized with X-ray diffraction, transmission electron microscopy, X-ray photoelectron spectroscopy and Fourier transform infrared spectra, respectively. Well dispersed g-C3N4 nanosheets can be obtained by this gaseous stripping process in wet nitrogen, which possess much higher specific surface area (211.2 m2 g-1) than that of bulk g-C3N4 (15.3 m2 g-1). Both RhB degradation and water splitting are applied to characterize the photocatalytic performances of the ultrafine g-C3N4 nanosheets. The g-C3N4 (w-N2) nanosheets can degrade 20 mg/L RhB completely within 12 min under visible light illumination, which is 5.32 times faster than that of bulk g-C3N4. Also, the g-C3N4 (w-N2) nanosheets possess the highest photocatalytic hydrogen evolution rate of 1113.48 μmol h-1 g-1 under visible light illumination, which is 6 times that of bulk g-C3N4. The mechanisms of enhancing the photocatalytic performance are discussed to be the higher oxidation ability of VB and higher specific surface area (211.2 m2/g) of the ultrafine g-C3N4 nanosheets.

  1. Meta-Analysis of the Association between Plasminogen Activator Inhibitor-1 4G/5G Polymorphism and Recurrent Pregnancy Loss

    PubMed Central

    Li, Xuejiao; Liu, Yukun; Zhang, Rui; Tan, Jianping; Chen, Libin; Liu, Yinglin

    2015-01-01

    Background The association between plasminogen activator inhibitor-1 (PAI-1) 4G/5G polymorphism and recurrent pregnancy loss (RPL) risk is still contradictory. We thus performed a meta-analysis. Material/Methods Relevant studies were searched for in PubMed, Web of Science, Embase, and Cochrane Library. An odds ratio (OR) with a 95% confidence interval (CI) was used to assess the association between PAI-1 4G/5G polymorphism and RPL risk. Results A total of 22 studies with 4306 cases and 3076 controls were included in this meta-analysis. We found that PAI-1 4G/5G polymorphism was significantly associated with an increased RPL risk (OR=1.89; 95% CI 1.34–2.67; P=0.0003). In the subgroup analysis by race, PAI-1 4G/5G polymorphism was significantly associated with an increased RPL risk in Caucasians (OR=2.23; 95% CI 1.44–3.46; P=0.0003). However, no significant association was observed in Asians (OR=1.47; 95% CI 0.84–2.59; P=0.18). Conclusions In conclusion, this meta-analysis suggests that PAI-1 4G/5G polymorphism might be associated with RPL development in Caucasians. PMID:25862335

  2. Traffic Dimensioning and Performance Modeling of 4G LTE Networks

    ERIC Educational Resources Information Center

    Ouyang, Ye

    2011-01-01

    Rapid changes in mobile techniques have always been evolutionary, and the deployment of 4G Long Term Evolution (LTE) networks will be the same. It will be another transition from Third Generation (3G) to Fourth Generation (4G) over a period of several years, as is the case still with the transition from Second Generation (2G) to 3G. As a result,…

  3. CeVO4 nanofibers hybridized with g-C3N4 nanosheets with enhanced visible-light-driven photocatalytic activity

    NASA Astrophysics Data System (ADS)

    Li, Li; Wang, Haoran; Wang, Xiong

    2018-01-01

    The g-C3N4/CeVO4 composites were successfully synthesized by hybridizing CeVO4 nanofibers with g-C3N4 nanosheets. The photocatalytic activity of g-C3N4/CeVO4 composites was evaluated for the photodegradation of methylene blue under visible light irradiation. Among them, the 50 wt% g-C3N4/CeVO4 composites presented the highest photocatalytic activity, about 2 and 3.2 times higher than those of CeVO4 and g-C3N4, respectively. The improved catalytic activity was owed to the hybridization, which facilitated the rapid separation of photoinduced carriers and enhanced the visible light harvesting. A possible photocatalytic mechanism was proposed.

  4. The plasminogen activator inhibitor-1 (PAI-1) gene -844 A/G and -675 4G/5G promoter polymorphism significantly influences plasma PAI-1 levels in women with polycystic ovary syndrome.

    PubMed

    Lin, Sun; Huiya, Zhang; Bo, Liu; Wei, Wei; Yongmei, Guan

    2009-12-01

    Mutations in the plasminogen activator inhibitor-1 (PAI-1) gene, along with increased PAI-1 levels, have been implicated in the pathogenesis of polycystic ovarian syndrome (PCOS). We investigated a possible influence of the promoter polymorphism (-844 A/G and -675 4G/5G) in the PAI-1 gene on plasma PAI-1 levels in 126 PCOS patients and 97 healthy controls. Levels of total testosterone, luteinizing hormone (LH), follicle stimulating hormone (FSH), fasting plasma glucose (FPG), fasting insulin, and PAI-1 were measured, and body mass index (BMI), waist-to-hip ratio (WHR), LH/FSH ratio, and homeostasis model assessment for insulin resistance (HOMA-IR) were calculated. PAI-1 -675 4G/5G and -844 A/G gene polymorphisms were also performed. Total testosterone, fasting insulin, and PAI-1 levels; BMI, LH/FSH, and HOMA-IR were significantly higher in PCOS patients than controls (P < 0.05). The odds ratio of 4G/4G genotype, 4G allele, and the combination genotype of 4G/4G and -844 A/A were 2.49 (95% confidence interval (CI), 1.4-4.44), 2.1 (95% CI, 1.43-3.08), and 2.9 (95% CI, 1.41-5.98), respectively, (P < 0.001). In the PCOS group, the PAI-1 level of the A/A was significantly higher than that of the A/G or G/G genotype, similarly was 4G/4G genotype compared with 4G/5G or 5G/5G genotype. The plasma PAI-1 levels of the combination of the PAI-1 -844 A/A and -675 4G/4G or 4G/5G genotypes, or the coadunation of 4G/4G and -844 non-G/G (A/A + A/G) genotypes were significantly high in PCOS women compared with controls. A trend to a positive interaction between PAI-1 -675 4G/5G and -844 A/G gene polymorphism may elevate plasma PAI-1 levels and hypofibrinolysis, which is probably an important hereditary risk factor in PCOS.

  5. PAI-1 4G-4G and MTHFR 677TT in non-hepatitis C virus/hepatitis B virus-related liver cirrhosis

    PubMed Central

    Pasta, Linda; Pasta, Francesca

    2015-01-01

    AIM: To evaluate the different roles of thrombophilia in patients with and without viral etiology. The thrombophilic genetic factors (THRGFs), PAI-1 4G-4G, MTHFR 677TT, V Leiden 506Q and prothrombin 20210A, were studied as risk factors in 1079 patients with liver cirrhosis (LC), enrolled from January 2000 to January 2014. METHODS: All Caucasian LC patients consecutively observed in a fourteen-year period were included; the presence of portal vein thrombosis (PVT) and Budd Chiari syndrome (BCS) was registered. The differences between the proportions of each THRGF with regard to the presence or absence of viral etiology and the frequencies of the THRGF genotypes with those predicted in a population by the Hardy-Weinberg equilibrium were registered. RESULTS: Four hundred and seventeen/one thousand and seventy-six patients (38.6%) showed thrombophilia: 217 PAI-1 4G-4G, 176 MTHFR C677TT, 71 V Leiden factor and 41 prothrombin G20210 A, 84 with more than 1 THRGF; 350 presented with no viral liver cirrhosis (NVLC) and 729 with, called viral liver cirrhosis (VLC), of whom 56 patients were hepatitis C virus + hepatitis B virus. PAI-1 4G-4G, MTHFR C677TT, the presence of at least one TRHGF and the presence of > 1 THRGF, were statistically more frequent in patients with NVLC vs patients with VLC: All χ2 > 3.85 and P < 0.05. Patients with PVT and/or BCS with at least one TRHGF were 189/352 (53.7%). The Hardy-Weinberg of PAI-1 and MTHFR 677 genotypes deviated from that expected from a population in equilibrium in patients with NVLC (respectively χ2 = 39.3; P < 0.000 and χ2 = 27.94; P < 0.05), whereas the equilibrium was respected in VLC. CONCLUSION: MTHFR 677TT was nearly twofold and PAI-1 4G-4G more than threefold more frequently found in NVLC vs patients with VLC; the Hardy-Weinberg equilibrium of these two polymorphisms confirms this data in NVLC. We suggest that PAI-1 4G-4G and MTHFR 677TT could be considered as factors of fibrosis and thrombosis mechanisms, increasing

  6. PAI-1 4G-4G and MTHFR 677TT in non-hepatitis C virus/hepatitis B virus-related liver cirrhosis.

    PubMed

    Pasta, Linda; Pasta, Francesca

    2015-12-18

    To evaluate the different roles of thrombophilia in patients with and without viral etiology. The thrombophilic genetic factors (THRGFs), PAI-1 4G-4G, MTHFR 677TT, V Leiden 506Q and prothrombin 20210A, were studied as risk factors in 1079 patients with liver cirrhosis (LC), enrolled from January 2000 to January 2014. All Caucasian LC patients consecutively observed in a fourteen-year period were included; the presence of portal vein thrombosis (PVT) and Budd Chiari syndrome (BCS) was registered. The differences between the proportions of each THRGF with regard to the presence or absence of viral etiology and the frequencies of the THRGF genotypes with those predicted in a population by the Hardy-Weinberg equilibrium were registered. Four hundred and seventeen/one thousand and seventy-six patients (38.6%) showed thrombophilia: 217 PAI-1 4G-4G, 176 MTHFR C677TT, 71 V Leiden factor and 41 prothrombin G20210 A, 84 with more than 1 THRGF; 350 presented with no viral liver cirrhosis (NVLC) and 729 with, called viral liver cirrhosis (VLC), of whom 56 patients were hepatitis C virus + hepatitis B virus. PAI-1 4G-4G, MTHFR C677TT, the presence of at least one TRHGF and the presence of > 1 THRGF, were statistically more frequent in patients with NVLC vs patients with VLC: All χ (2) > 3.85 and P < 0.05. Patients with PVT and/or BCS with at least one TRHGF were 189/352 (53.7%). The Hardy-Weinberg of PAI-1 and MTHFR 677 genotypes deviated from that expected from a population in equilibrium in patients with NVLC (respectively χ (2) = 39.3; P < 0.000 and χ (2) = 27.94; P < 0.05), whereas the equilibrium was respected in VLC. MTHFR 677TT was nearly twofold and PAI-1 4G-4G more than threefold more frequently found in NVLC vs patients with VLC; the Hardy-Weinberg equilibrium of these two polymorphisms confirms this data in NVLC. We suggest that PAI-1 4G-4G and MTHFR 677TT could be considered as factors of fibrosis and thrombosis mechanisms, increasing the inflammation response

  7. Long-range magnetic order in the Heisenberg pyrochlore antiferromagnets G d2G e2O7 and G d2P t2O7 synthesized under high pressure

    NASA Astrophysics Data System (ADS)

    Li, X.; Cai, Y. Q.; Cui, Q.; Lin, C. J.; Dun, Z. L.; Matsubayashi, K.; Uwatoko, Y.; Sato, Y.; Kawae, T.; Lv, S. J.; Jin, C. Q.; Zhou, J.-S.; Goodenough, J. B.; Zhou, H. D.; Cheng, J.-G.

    2016-12-01

    G d2S n2O7 and G d2T i2O7 have been regarded as good experimental realizations of the classical Heisenberg pyrochlore antiferromagnet with dipolar interaction. The former was found to adopt the Palmer-Chalker state via a single, first-order transition at TN≈1 K , while the latter enters a distinct, partially ordered state through two successive transitions at TN 1≈1 K and TN 2= 0.75 K . To shed more light on their distinct magnetic ground states, we have synthesized two more gadolinium-based pyrochlore oxides, G d2G e2O7 and G d2P t2O7 , under high-pressure conditions and performed detailed characterizations via x-ray powder diffraction, dc and ac magnetic susceptibility, and specific heat measurements down to 100 mK. We found that both compounds enter a long-range antiferromagnetically ordered state through a single, first-order transition at TN= 1.4 K for G d2G e2O7 and TN= 1.56 K for G d2P t2O7 , with the specific heat anomaly similar to that of G d2S n2O7 rather than G d2T i2O7 . Interestingly, the low-temperature magnetic specific heat values of both G d2G e2O7 and G d2P t2O7 were found to follow nicely the T3 dependence as expected for a three-dimensional antiferromagnet with gapless spin-wave excitations. We have rationalized the enhancement of TN in terms of the reduced Gd-Gd distances for the chemically pressurized G d2G e2O7 and the addition of extra superexchange pathways through the empty Pt -eg orbitals for G d2P t2O7 . Our current study has expanded the family of gadolinium-based pyrochlores and permits us to achieve a better understanding of their distinct magnetic properties in a more comprehensive perspective.

  8. An oxygen-vacancy-rich Z-scheme g-C3N4/Pd/TiO2 heterostructure for enhanced visible light photocatalytic performance

    NASA Astrophysics Data System (ADS)

    Guo, Yanru; Xiao, Limin; Zhang, Min; Li, Qiuye; Yang, Jianjun

    2018-05-01

    An oxygen-vacancy-rich Z-scheme g-C3N4/Pd/TiO2 ternary nanocomposite was fabricated using nanotubular titanic acid as precursors via a simple photo-deposition of Pd nanoparticles and calcination process. The prepared nanocomposites were investigated by X-ray diffraction, transmission electron microscopy, X-ray photoelectron spectroscopy, and UV-visible diffuse reflectance spectroscopy, respectively. For g-C3N4/TiO2 binary nanocomposites, at the optimal content of g-C3N4 (2%), the apparent photocatalytic activity of 2%g-C3N4/TiO2 was 9 times higher than that of pure TiO2 under visible-light illumination. After deposition of Pd (1 wt%) at the contact interface between g-C3N4 and TiO2, the 2%g-C3N4/Pd/TiO2 ternary nanocomposites demonstrated the highest visible-light-driven photocatalytic activity for the degradation of gaseous propylene, which was 16- and 2-fold higher activities than pure TiO2 and 2%g-C3N4/TiO2, respectively. The mechanism for the enhanced photocatalytic performance of the g-C3N4/Pd/TiO2 photo-catalyst is proposed to be based on the efficient separation of photo-generated electron-hole pairs through Z-scheme system, in which uniform dispersity of Pd nanoparticles at contact interface between g-C3N4 and TiO2 and oxygen vacancies promote charge separation.

  9. Comparison of efficacy of once daily multimatrix mesalazine 2.4 g/day and 4.8 g/day with other 5-aminosalicylic acid preparation in active ulcerative colitis: a randomized, double-blind study

    PubMed Central

    Yokoyama, Tadashi; Mizushima, Seiichi; Hagino, Atsushi; Hibi, Toshifumi

    2018-01-01

    Background/Aims This study compared the efficacy of multimatrix mesalazine 2.4 g/day and 4.8 g/day with controlled-release mesalazine 2.25 g/day. Methods In this multicenter, randomized, double-blind study, 251 patients with mildly to moderately active ulcerative colitis received multimatrix mesalazine 2.4 g/day once daily (Multimatrix-2.4), 4.8 g/day once daily (Multimatrix-4.8), or controlled-release (time-dependent) mesalazine 2.25 g/day 3 times daily (Time-2.25) for 8 weeks. The primary efficacy endpoint was the change in the ulcerative colitis-disease activity index (UC-DAI) score. Results The mean change in the UC-DAI score and standard deviation in the per protocol set was −1.9±2.5 for Multimatrix-2.4 and −2.4±2.8 for Time-2.25. The difference between Multimatrix-2.4 and Time-2.25 was 0.3 (two-sided 95% confidence interval [CI], −0.5 to 1.1), thus non-inferiority was not demonstrated based on the pre-defined non-inferiority margin (1.0). In the full analysis set, the difference between Multimatrix-4.8 and Time-2.25 was −1.2 (two-sided 95% CI, −2.0 to −0.5), and the mean change in UC-DAI score in the FAS was −3.3 (two-sided 95% CI, −3.9 to −2.8) for Multimatrix-4.8 and −1.9 (two-sided 95% CI, −2.5 to −1.3) for Multimatrix-2.4, indicating that Multimatrix-4.8 was more effective than Time-2.25 and Multimatrix-2.4. There was no difference among the treatment groups in terms of safety. Conclusions This study showed that the efficacy of multimatrix mesalazine 2.4 g/day was comparable to controlled release mesalazine 2.25 g/day, although non-inferiority was not demonstrated. Importantly, this was the first study to indicate that multimatrix mesalazine 4.8 g/day was more effective than 2.4g/day with no associated safety concerns. PMID:29743838

  10. Enhanced HIV-1 neutralization by a CD4-VH3-IgG1 fusion protein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Meyuhas, Ronit; Noy, Hava; Fishman, Sigal

    2009-08-21

    HIV-1 gp120 is an alleged B cell superantigen, binding certain VH3+ human antibodies. We reasoned that a CD4-VH3 fusion protein could possess higher affinity for gp120 and improved HIV-1 inhibitory capacity. To test this we produced several human IgG1 immunoligands harboring VH3. Unlike VH3-IgG1 or VH3-CD4-IgG1, CD4-VH3-IgG1 bound gp120 considerably stronger than CD4-IgG1. CD4-VH3-IgG1 exhibited {approx}1.5-2.5-fold increase in neutralization of two T-cell laboratory-adapted strains when compared to CD4-IgG1. CD4-VH3-IgG1 improved neutralization of 7/10 clade B primary isolates or pseudoviruses, exceeding 20-fold for JR-FL and 13-fold for Ba-L. It enhanced neutralization of 4/8 clade C viruses, and had negligible effect onmore » 1/4 clade A pseudoviruses. We attribute this improvement to possible pairing of VH3 with CD4 D1 and stabilization of an Ig Fv-like structure, rather than to superantigen interactions. These novel findings support the current notion that CD4 fusion proteins can act as better HIV-1 entry inhibitors with potential clinical implications.« less

  11. Fabrication of 2D SnS2/g-C3N4 heterojunction with enhanced H2 evolution during photocatalytic water splitting.

    PubMed

    Liu, Enzhou; Chen, Jibing; Ma, Yongning; Feng, Juan; Jia, Jia; Fan, Jun; Hu, Xiaoyun

    2018-08-15

    In this work, the 2D SnS 2 /g-C 3 N 4 heterojunctions were successfully prepared by heating the homogeneous dispersion of SnS 2 nanosheets and g-C 3 N 4 nanosheets using a microwave muffle. SEM, TEM and HRTEM images indicated that the SnS 2 nanosheets were loaded on the surface of the g-C 3 N 4 nanosheets. The UV-vis spectra show that the absorption intensity of the as-prepared samples was increased and the absorption range was also extended from 420 nm to approximately 600 nm. The H 2 production rate over 5 wt% SnS 2 /g-C 3 N 4 can reach 972.6 μmol·h -1 ·g -1 under visible light irradiation (λ > 420 nm) using TEOA as the sacrifice agent and Pt as the electron trap, which is 2.9 and 25.6 times higher than those of the pristine g-C 3 N 4 and SnS 2 , respectively. According to the obtained PL spectra, photocurrent and EIS spectra, the enhanced performance for H 2 generation over the heterojunctions is primarily ascribed to the rapid charge transfer arising from the suitable band gap positions leading to an improved photocatalytic performance. The recycling experiments indicated that the as-prepared composites exhibit good stability in H 2 production. Additionally, a possible enhanced mechanism for H 2 evolution was deduced based on the results obtained by various characterization techniques. Copyright © 2018 Elsevier Inc. All rights reserved.

  12. Th1/Th2 cytokine profiles in G+/G- bacteremia in pediatric hematology/oncology patients.

    PubMed

    Tang, Yongmin; Liao, Chan; Xu, Xiaojun; Song, Hua; Shi, Shuwen; Yang, Shilong

    2012-01-01

    Early diagnosis of infection and appropriate choice of antibiotics are essential not only to improve the prognosis of the patients but also to prevent from the abuse of the antibiotics in hematology/oncology children at the time of neutropenia after intensive chemotherapy. We evaluated the quantification of Th1/Th2 cytokines with flow cytometry bead assay (CBA) in 145 hospitalized febrile hematology/oncology children with positive blood culture to seek for a rapid diagnostic method to determine the type of infection. IL-4, IL-6, IL-10, TNF-α, and IFN-γ levels from both G- and G+ bacteremia groups were significantly higher than those of controls (P < 0.001). The median levels of IL-6, IL-10, TNF-α of Group G- were 525.4, 96.0, and 6.9 pg/ml, respectively, significantly higher than those of Group G+ (150.0, 22.6, and 4.5 pg/ml, respectively, P < 0.001). According to the different degrees of increased IL-6 and IL-10 levels, we named the G- bacterial infection related cytokine profile G- BIRCP and the G+ BIRCP. The specificity and sensitivity of BIRCP prediction for G- and G+ bacteria cultures were 60.2% and 75.4%, 66.8% and 70.1%, respectively. Similar therapeutic efficacy was achieved between BIRCP-based and broad-spectrum antibiotics groups (86.1% vs. 89.3%, P > 0.05), which was significantly increased as compared with that (65.5%, P < 0.05) of empirical group. These results showed the promising use of the IL-6/IL-10/TNF-α determination with CBA technology for the early and rapid diagnosis, evaluation of G+/G- bacteremia in pediatric hematology/oncology patients. Copyright © 2011 Wiley Periodicals, Inc.

  13. Association between plasminogen activator inhibitor-1 -675 4G/5G polymorphism and sepsis: a meta-analysis.

    PubMed

    Li, Li; Nie, Wei; Zhou, Hongfeng; Yuan, Weifeng; Li, Weifeng; Huang, Wenjie

    2013-01-01

    Several studies have evaluated the association between plasminogen activator inhibitor-1 (PAI-1) -675 4G/5G polymorphism and sepsis in different populations. However, the available results are conflicting. A search of Pubmed and EMBASE databases was performed to identify relevant studies for inclusion in the meta-analysis. Odds ratios (ORs) and corresponding 95% confidence intervals (CIs) were determined using a random-effects model. Twelve case-control studies and three cohort studies were included. Overall, a significant association between 4G/5G polymorphism and sepsis risk was observed for 4G/4G vs. 4G/5G +5G/5G (OR = 1.30, 95% CI 1.08-1.56, P = 0.006). In addition, there was a significant association between PAI-1 4G/5G polymorphism and sepsis-related mortality (OR = 1.72, 95% CI 1.27-2.33, P = 0.0005). In subgroup analyses, increased sepsis risk and mortality risk were found in Caucasians and in patients with sepsis. This meta-analysis suggested that the PAI-1 -675 4G/5G polymorphism was a risk factor for sepsis and sepsis mortality.

  14. A weak-light-responsive TiO2/g-C3N4 composite film: photocatalytic activity under low-intensity light irradiation.

    PubMed

    Wang, Peifang; Guo, Xiang; Rao, Lei; Wang, Chao; Guo, Yong; Zhang, Lixin

    2018-05-10

    A TiO 2 /g-C 3 N 4 composite photocatalytic film was prepared by in situ synthesis method and its photocatalytic capability under weak-visible-light condition was studied. The co-precursor with different ratio of melamine and TiO 2 sol-gel precursor were treated using ultrasonic mixing, physical deposition, and co-sintering method to form the smooth, white-yellow, and compact TiO 2 /g-C 3 N 4 composite films. The prepared TiO 2 /g-C 3 N 4 materials were characterized by SEM, TEM, EDS, XRD, BET, VBXPS, and UV-vis diffuse reflectance spectra. The results of composite showed that TiO 2 and g-C 3 N 4 have close interfacial connections which are favorable to charge transfer between these two semiconductors with suitable band structure, g-C 3 N 4 retard the anatase-to-rutile phase transition of TiO 2 significantly, the specific surface area were increased with g-C 3 N 4 ratio raised. Under weak-light irradiation, composite films photocatalytic experiments exhibited RhB removal efficiency approaching 90% after three recycles. Powders suspension degradation experiments revealed the removal efficiency of TiO 2 /g-C 3 N 4 (90.8%) was higher than pure TiO 2 (52.1%) and slightly lower than pure g-C 3 N 4 (96.6%). By control experiment, the enhanced photocatalysis is ascribed to the combination of TiO 2 and g-C 3 N 4 , which not only produced thin films with greater stability but also formed heterojunctions that can be favorable to charge transfer between these two semiconductors with suitable band structure. This study presents the potential application of photocatalytic film in the wastewater treatment under weak-light situation.

  15. Enhanced photocatalytic activity of electrospun nanofibrous TiO2/g-C3N4 heterojunction photocatalyst under simulated solar light

    NASA Astrophysics Data System (ADS)

    Wang, Chunlei; Hu, Liming; Chai, Bo; Yan, Juntao; Li, Jianfen

    2018-02-01

    Electrospun nanofibrous TiO2/g-C3N4 heterojunction photocatalysts with different TiO2 content have been synthesized via a facile electrospinning and subsequent in situ evaporation and calcination process for the first time, which are examined in terms of morphology, component content, optical properties, PL spectra, photocurrent response, EIS measurement, photocatalytic activity and mechanism. SEM images exhibit TiO2/g-C3N4-4 heterojunction photocatalyst possesses the excellent 1D structure. HRTEM and element mapping images confirm the formation of heterojunction structure. DRS tests identify that TiO2/g-C3N4-4 heterojunction exhibits the intensitive absorption in both UV and visible light region. The photoelectrochemical tests prove that the recombination between electrons and holes are effectively inhibited. Based on TG analysis and photodegradation experiments, TiO2/g-C3N4-4 heterojunction photocatalyst with TiO2 content of 29.30 wt% possesses the best photocatalytic degradation efficiency for the RhB among the g-C3N4, TiO2 and their mixture under simulated sunlight irradiation. Moreover, 1D morphology of TiO2/g-C3N4-4 heterojunction photocatalyst is in favor of separating from solution for reuse and transferring the electrons, and maintains a very high photocatalytic degradation efficiency of 96% even after four recycles experiments, which is beneficial for practical application.

  16. Photocatalytic reduction of CO2 into hydrocarbon solar fuels over g-C3N4-Pt nanocomposite photocatalysts.

    PubMed

    Yu, Jiaguo; Wang, Ke; Xiao, Wei; Cheng, Bei

    2014-06-21

    Photocatalytic reduction of CO2 into renewable hydrocarbon fuels is an alternative way to develop reproducible energy, which is also a promising way to solve the problem of the greenhouse effect. In this work, graphitic carbon nitride (g-C3N4) was synthesized by directly heating thiourea at 550 °C and then a certain amount of Pt was deposited on it to form g-C3N4-Pt nanocomposites used as catalysts for photocatalytic reduction of CO2 under simulated solar irradiation. The main products of photocatalysis were CH4, CH3OH and HCHO. The deposited Pt acted as an effective cocatalyst, which not only influenced the selectivity of the product generation, but also affected the activity of the reaction. The yield of CH4 first increased upon increasing the amount of Pt deposited on the g-C3N4 from 0 to 1 wt%, then decreased at 2 wt% Pt loading. The production rates of CH3OH and HCHO also increased with the content of Pt increasing from 0 to 0.75 wt% and the maximum yield was observed at 0.75 wt%. The Pt nanoparticles (NPs) could facilitate the transfer and enrichment of photogenerated electrons from g-C3N4 to its surface for photocatalytic reduction of CO2. At the same time, Pt was also used a catalyst to promote the oxidation of products. The transient photocurrent response further confirmed the proposed photocatalytic reduction mechanism of CO2. This work indicates that the deposition of Pt is a good strategy to improve the photoactivity and selectivity of g-C3N4 for CO2 reduction.

  17. Association of G894T eNOS, 4G/5G PAI and T1131C APOA5 polymorphisms with susceptibility to myocardial infarction in Morocco.

    PubMed

    Hassani Idrissi, Hind; Hmimech, Wiam; Diakite, Brehima; Korchi, Farah; Baghdadi, Dalila; Habbal, Rachida; Nadifi, Sellama

    2016-09-01

    Myocardial infarction (MI) is a common multifactorial disease. Numerous studies have found that genetic plays an essential role in MI occurrence. The main objective of our case-control study is to explore the association of G894T eNOS (rs1799983), 4G/5G PAI (rs1799889) and T1131C APOA5 (rs662799) polymorphisms with MI susceptibility in the Moroccan population. 118 MI patients were recruited vs 184 healthy controls. DNA samples were genotyped by PCR-RFLP method using MboI, BslI and MseI restriction enzymes respectively for the G894T eNOS, 4G/5G PAI and T1131C APOA5 polymorphisms. Our results show that the G894T eNOS was significantly associated with increased risk of MI under the three genetic transmission models (dominant: OR = 1.64, 95% CI = 1.05-2.58, P = 0.003; recessive: OR = 2.15, 95% CI = 0.74-6.16, P = 0.03; additive: OR = 1.54, 95% CI = 1.06-2.23, P = 0.001). The T1131C APOA5 polymorphism was associated to MI risk in recessive and additive models (OR = 1.53, 95% CI = 0.72-3.2, P = 0.04 and OR = 1.78, 95% CI = 1.26-2.51, P = 0.03 respectively). For the 4G/5G PAI variant, even the cases and controls groups were not in Hardy-Weinberg Equilibrium (HWE), the dominant and additive models show a statistically significant association with MI risk (OR = 7.96, 95%CI = 3.83-16.36, P = 0.01 and OR = 1.96, 95% CI = 1.4-2.72, P = 0.03 respectively). Our results suggest that G894T eNOS and T1131C APOA5 polymorphisms may be considered as genetic markers of MI among the Moroccan population. Further studies including larger sample sizes and exploring more genetic associations are needed to confirm our results and to better understand the susceptibility to MI.

  18. Isolation and characterization of rabbit anti-m3 2,2,7G antibodies.

    PubMed Central

    Luhrmann, R; Appel, B; Bringmann, P; Rinke, J; Reuter, R; Rothe, S; Bald, R

    1982-01-01

    Antibodies specific for intact 2,2,7-trimethylguanosine (m3 2,2,7G) were induced by immunization of rabbits with a nucleoside-human serum albumen (HSA) conjugate. Competition radioimmunoassay showed that the antibody distinguishes well between intact m3 2,2,7G and its alkali-hydrolysed form (m3 2,2,7G*). Antibody specificity is largely dependent on the presence of all three methyl groups in m3 2,2,7G: none of the less extensively methylated nucleosides m7G, m2G and m2 2,2G is able to compete efficiently with the homologous hapten. Little or no competition was observed with m1G, m1A, m6A, m5U and each of the four unmodified ribonucleosides. Binding studies with nucleoplasmic RNAs from Ehrlich ascites cells suggest that the antibody reacts specifically with the m3 2,2,7G-containing cap structure of the small nuclear U-RNAs (U-snRNAs). Thus the antibody should be a valuable tool for studying the role of the 5'-terminal regions of the U-snRNAs of eucaryotic cells. Images PMID:7155893

  19. NIa-Pro of Papaya ringspot virus interacts with Carica papaya eukaryotic translation initiation factor 3 subunit G (CpeIF3G).

    PubMed

    Gao, Le; Tuo, Decai; Shen, Wentao; Yan, Pu; Li, Xiaoying; Zhou, Peng

    2015-02-01

    The interaction of papaya eukaryotic translation initiation factor 3 subunit G (CpeIF3G) with Papaya ringspot virus (PRSV) NIa-Pro was validated using a bimolecular fluorescence complementation assay in papaya protoplasts based on the previous yeast two-hybrid assay results. The C-terminal (residues 133-239) fragment of PRSV NIa-Pro and the central domain (residues 59-167) of CpeIF3G were required for effective interaction between NIa-Pro and CpeIF3G as shown by a Sos recruitment yeast two-hybrid system with several deletion mutants of NIa-Pro and CpeIF3G. The central domain of CpeIF3G, which contains a C2HC-type zinc finger motif, is required to bind to other eIFs of the translational machinery. In addition, quantitative real-time reverse transcription PCR assay confirmed that PRSV infection leads to a 2- to 4.5-fold up-regulation of CpeIF3G mRNA in papaya. Plant eIF3G is involved in various stress response by enhancing the translation of resistance-related proteins. It is proposed that the NIa-Pro-CpeIF3G interaction may impair translation preinitiation complex assembly of defense proteins and interfere with host defense.

  20. Association between Plasminogen Activator Inhibitor-1 -675 4G/5G Polymorphism and Sepsis: A Meta-Analysis

    PubMed Central

    Yuan, Weifeng; Li, Weifeng; Huang, Wenjie

    2013-01-01

    Background Several studies have evaluated the association between plasminogen activator inhibitor-1 (PAI-1) -675 4G/5G polymorphism and sepsis in different populations. However, the available results are conflicting. Methods A search of Pubmed and EMBASE databases was performed to identify relevant studies for inclusion in the meta-analysis. Odds ratios (ORs) and corresponding 95% confidence intervals (CIs) were determined using a random-effects model. Results Twelve case-control studies and three cohort studies were included. Overall, a significant association between 4G/5G polymorphism and sepsis risk was observed for 4G/4G vs. 4G/5G +5G/5G (OR = 1.30, 95% CI 1.08–1.56, P = 0.006). In addition, there was a significant association between PAI-1 4G/5G polymorphism and sepsis-related mortality (OR = 1.72, 95% CI 1.27–2.33, P = 0.0005). In subgroup analyses, increased sepsis risk and mortality risk were found in Caucasians and in patients with sepsis. Conclusions This meta-analysis suggested that the PAI-1 -675 4G/5G polymorphism was a risk factor for sepsis and sepsis mortality. PMID:23382992

  1. Cytotoxicity of chloroacetanilide herbicide alachlor in HepG2 cells independent of CYP3A4 and CYP3A7.

    PubMed

    Miranda, Sonia R; Meyer, Sharon A

    2007-05-01

    Alachlor is cytotoxic to human hepatoblastoma HepG2s, a cell line that expresses constitutive CYP3A7 and dexamethasone (DEX)-inducible CYP3A4 and CYP3A7. CYP3A4 catalyzes alachlor N-dealkylation to 2-chloro-N-(2,6-diethylphenyl)acetamide (CDEPA), precursor of 2,6-diethylbenzoquinoneimine, putative reactive metabolite for rat nasal carcinogenicity. We hypothesized that HepG2 alachlor cytotoxicity would be mediated by CYP3A4/7 and increased with DEX. Here, we report time-dependent alachlor cytotoxicity (EC(50) approximately 500 microM and 264+/-17 microM at 6 and 24h, respectively) as assessed by lactate dehydrogenase leakage. DEX pretreatment (25 microM, 48 h) significantly increased CYP3A7-catalyzed luciferin 6' benzylether O-debenzylation, but had no effect on alachlor toxicity. Further, CYP3A4/7 inhibitor triacetyloleandomycin did not prevent, but rather potentiated, alachlor cytotoxicity. In agreement, CDEPA was less toxic than parent alachlor. HepG2 CYP3A4 activity was unaffected by 48 h DEX pretreatment; therefore, studies were done in DPX-2 cells, a HepG2 derivative engineered to overexpress pregnane-X receptor (PXR) that exhibits rifampicin (RIF)-inducible endogenous CYP3A4. Alachlor cytotoxicity in DPX-2 cells occurred over a concentration range equivalent to that in HepG2. CYP3A4 activity of DPX-2 cells treated with RIF (10 microM, 48 h) was twice that of untreated cells, but RIF did not increase alachlor toxicity. These results demonstrate that neither CYP3A4 nor CYP3A7 initiate a pathway leading to a toxic alachlor metabolite.

  2. Enhanced photocatalytic H2-production activity of C-dots modified g-C3N4/TiO2 nanosheets composites.

    PubMed

    Li, Yang; Feng, Xionghan; Lu, Zhexue; Yin, Hui; Liu, Fan; Xiang, Quanjun

    2018-03-01

    As a new carbon-based material, carbon dots (C-dots) have got widely preference because of its excellent electronic transfer capability. In this work, a novel ternary layered C-dots/g-C 3 N 4 /TiO 2 nanosheets (CGT) composite photocatalysts were prepared by impregnation precipitation methods. The optimal ternary CGT composite samples revealed high photocatalytic hydrogen evolution rate in triethanolamine aqueous solutions, which exceeded the rate of the optimal g-C 3 N 4 /TiO 2 composite sample by a factor of 5 times. The improved photocatalytic activity is owed to the positive effects of C-dots and layered heterojunction structure of TiO 2 nanosheets and g-C 3 N 4 sheets. C-dots in the CGT composites can serve as electron reservoirs to capture the photo-induced electrons. The well-defined layered heterojunction structure of CGT provides the intimate contact and the strong interaction of anatase TiO 2 nanosheets and g-C 3 N 4 sheets via face-to-face orientation, which restrains the recombination of photogenerated charge carriers, and thus enhances the photocatalytic H 2 -production activity. Electron paramagnetic resonance and transient photocurrent response proved the strong interaction and improved interfacial charge transfer of TiO 2 nanosheets and g-C 3 N 4 sheets, respectively. The mechanism of improving the photocatalytic H 2 -evolution activity was further confirmed by time-resolved fluorescence, electron paramagnetic resonance, transient photocurrent response and electrochemical impedance spectroscopy. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. 2D-2D stacking of graphene-like g-C3N4/Ultrathin Bi4O5Br2 with matched energy band structure towards antibiotic removal

    NASA Astrophysics Data System (ADS)

    Ji, Mengxia; Di, Jun; Ge, Yuping; Xia, Jiexiang; Li, Huaming

    2017-08-01

    A novel visible-light-driven 2D-2D graphene-like g-C3N4/ultrathin Bi4O5Br2 photocatalyst was prepared via a facile solvothermal method in the presence of reactable ionic liquid 1-hexadecyl-3-methylimidazolium bromide ([C16mim]Br) for the first time. FT-IR, XPS and TEM analysis results demonstrated the successful introduction of the 2D graphene-like g-C3N4 material to the Bi4O5Br2 system. DRS and BET analysis results indicated the existence of the g-C3N4 could lead to the broaden absorption edge and larger surface area of the ultrathin Bi4O5Br2 nanosheets. The electrochemical analysis implied a fast transfer of the interfacial electrons and low recombination rate of photogenerated charge carriers in g-C3N4/Bi4O5Br2, which could be assigned to the sufficient and tight contact between ultrathin Bi4O5Br2 and graphene-like g-C3N4. The quinolone antibiotic ciprofloxacin (CIP) was chosen as the target pollutant to evaluate the photocatalytic performance of the as-prepared samples under visible light irradiation. 1 wt% g-C3N4/Bi4O5Br2 composite exhibited the highest photocatalytic degradation performance among all of the as-prepared photocatalysts. The enhancement of photocatalytic activity was attributed to the maximum contact between graphene-like g-C3N4 and ultrathin Bi4O5Br2 material with matched energy band structure, which enable the efficient charge seperation. A possible photocatalytic mechanism also was proposed.

  4. Relationship between post-SARS osteonecrosis and PAI-1 4G/5G gene polymorphisms.

    PubMed

    Sun, Wei; Li, Zirong; Shi, Zhengcai; Wang, Bailiang; Gao, Fuqiang; Yang, Yurun; Guo, Wanshou

    2014-05-01

    To explore the correlation between post-severe acute respiratory symptom (SARS) patients with osteonecrosis, investigate the etiology of post-SARS osteonecrosis and select the sensitive molecular symbols for early diagnosis and distinguish the high-risk population. The studied subjects were divided into two groups. Sixty-two post-SARS patients with osteonecrosis were one group, and 52 age- and sex-matched healthy people were as normal controlled group. Empty stomach blood samples from cubital veins were collected from both groups. Plasminogen activator inhibitor (PAI) by means of enzyme-linked immunosorbent assay and PAI-1 4G/5G polymorphism was detected by polymerase chain reaction and solid phase oligonucleotide assay. The blood agents of post-SARS patients changed obviously with 15.64 ± 13.85 U/ml while the control group 7.96 ± 4.27 U/ml; 4G/4G genotype for the PAI-1 polymorphism detected in post-SARS group was more than that of the control group, but had no statistical significance. The plasma PAI activity was related to homozygote 4G/4G genotype. This reveals that homozygote 4G/4G genotype may be a susceptible gene mark to Chinese osteonecrosis patients. Plasminogen activator inhibitor-1 is sensitive blood symbol for screening high-risk susceptible population; 4G/4G PAI-1 genotype may be an etiological factor in osteonecrosis.

  5. Advances to G3

    NASA Astrophysics Data System (ADS)

    Salters, Vincent; Tarduno, John; van Keken, Peter

    2008-12-01

    Geochemistry, Geophysics, Geosystems (G3 ), a joint publication of AGU and the Geochemical Society, publishes research papers that speak to a broad community interested in Earth processes that are best studied with interdisciplinary approaches. G3 publishes conventional papers but is especially interested in novel publication forms that take advantage of electronic formats, such as animations and readily reusable digitized data sets. G3 's large number of submissions and subscriptions attests to how an interdisciplinary approach and electronic format benefit authors and readers. In the past few months, G3 has undergone substantial improvements. These include several changes in the timeliness of publication, revised protocols for the publication of data sets, the appointment of new associate editors, an updated Web site, and improved access to articles. As the editors of G3 , we are confident that these improvements will better serve AGU members.

  6. Thermal formation effect of g-C3N4 structure on the visible light driven photocatalysis of g-C3N4/NiTiO3 Z-scheme composite photocatalysts

    NASA Astrophysics Data System (ADS)

    Pham, Thanh-Truc; Shin, Eun Woo

    2018-07-01

    The development of efficient visible-light driven photocatalysts has attracted considerable attention in environmental protection and remediation. In this study, the facile thermal polymerization of dicyandiamide (DCDA) to graphitic carbon nitride (g-C3N4) in the presence of nickel titanium trioxide (NiTiO3) was investigated for fabricating g-C3N4 and NiTiO3 composite (CNT) photocatalysts to understand the influence of the presence of NiTiO3 on the thermal formation of g-C3N4 layers from DCDA and to find an optimal processing temperature for fabricating CNT photocatalysts. To examine the effect of NiTiO3 on the fabrication of CNT photocatalysts, a gas phase environment (flowing air or nitrogen) and different processing temperatures were employed as preparation variables to control the properties of the CNT photocatalysts. In addition, the CNT photocatalysts were applied for the visible light driven photocatalytic degradation of methylene blue to evaluate their photocatalytic performances. The CNT photocatalyst prepared at T = 500 °C showed the highest photocatalytic activity, which was caused by the optimal morphology of g-C3N4 in the composite photocatalysts. The NiTiO3 inorganic phase in the composite photocatalysts acted as a catalyst to accelerate the thermal polymerization to form the g-C3N4 structure and as a promoter to increase the photocatalytic activity during photodegradation.

  7. Double Z-scheme ZnO/ZnS/g-C3N4 ternary structure for efficient photocatalytic H2 production

    NASA Astrophysics Data System (ADS)

    Dong, Zhifang; Wu, Yan; Thirugnanam, Natarajan; Li, Gonglin

    2018-02-01

    In the present work, a novel ZnO/ZnS/g-C3N4 ternary nanocomposite with double Z-scheme heterojunction has been designed via a two-step facile chemical conversion route. The spherical ZnS nanoparticles were uniformly loaded onto ZnO nanoflowers surface. And then the ZnO/ZnS nanocomposite was further hybridized with g-C3N4 nanosheets. Ternary ZnO/ZnS/g-C3N4 nanocomposite displays the largest specific surface area (about 76.2 m2/g), which provides plentiful activated sites for photocatalytic reaction. Furthermore, the ternary material exhibits the highest methylene blue photodegradation rate of about 0.0218 min-1 and the optimum photocatalytic H2 production (1205 μmol/g) over water splitting at 4 h under solar light irradiation. Moreover, it showed the highest photocurrent effect and the minimum charge-transfer resistance. These results implied that the higher photoactivity of ZnO/ZnS/g-C3N4 nanocomposite could be attributed to the multi-steps charge transfer and effective electron-hole separation in the double Z-scheme system.

  8. 78 FR 958 - Certain Wireless Devices With 3G and/or 4G Capabilities and Components Thereof Notice of Receipt...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-01-07

    ... INTERNATIONAL TRADE COMMISSION [DN 2929] Certain Wireless Devices With 3G and/or 4G Capabilities... Interest AGENCY: U.S. International Trade Commission. ACTION: Notice. SUMMARY: Notice is hereby given that the U.S. International Trade Commission has received a complaint entitled Certain Wireless Devices...

  9. A case of non-lacrimal immunoglobulin G4 (IgG4)-related orbital disease with mastitis.

    PubMed

    Farooq, Tahir Ali; Mudhar, Hardeep; Sandramouli, S

    2016-01-01

    IgG4-related orbital disease is a recognised cause for orbital inflammation. As its awareness increases and diagnostic accuracy improves there will be an increased number of cases being identified. This unique case demonstrates for the first time, with histological evidence, a case of a non-lacrimal IgG4-related orbital disease with concurrent IgG4-related mastitis. We describe a 47 year old who presented with a supraorbital swelling and mass. This was initially successfully treated with oral steroids and was later excised on recurrence. Immunohistochemical and blood serum analysis confirmed IgG4-related orbital disease. On systemic enquiry she was found to have a mass of the breast, which was shown to be IgG4-related mastitis. She is currently asymptomatic with no sign of recurrence and is under long-term surveillance. This case highlights the importance of systemic work up in patients presenting with orbital foci of IgG4 disease.

  10. BPS states in N = 2 supersymmetric G2 and F4 models

    NASA Astrophysics Data System (ADS)

    Ahl Laamara, R.; Mellal, O.; Saidi, E. H.

    2017-07-01

    In BPS quiver theory of N = 2 supersymmetric pure gauge models with gauge invariance G, primitive BPS quivers Q0G are of two types: Q0ADE and Q0BCFG. In this study, we first show that Q0ADE have outer-automorphism symmetries inherited from the outer-automorphisms of the Dynkin diagrams of ADE Lie algebras. Then, we extend the usual folding operation of Dynkin diagrams ADE → BCFG to obtain the two following things: (i) relate Q0BCFG quivers and their mutations to the Q0ADE ones and their mutations; and (ii) link the BPS chambers of the N = 2ADE theories with the corresponding BCFG ones. As an illustration of this construction, we derive the BPS and anti-BPS states of the strong chambers QstgG2 and QstgF4 of the 4d N = 2 pure G2 and F4 gauge models.

  11. Selective Cytotoxicity of 1,3,4-Thiadiazolium Mesoionic Derivatives on Hepatocarcinoma Cells (HepG2)

    PubMed Central

    Valdameri, Glaucio; Rocha, Maria Eliane Merlin; Martinez, Glaucia Regina; Noleto, Guilhermina Rodrigues; Acco, Alexandra; Alves de Souza, Carlos Eduardo; Echevarria, Aurea; Moretto dos Reis, Camilla; Di Pietro, Attilio; Suter Correia Cadena, Sílvia Maria

    2015-01-01

    In this work, we evaluated the cytotoxicity of mesoionic 4-phenyl-5-(2-Y, 4-X or 4-X-cinnamoyl)-1,3,4-thiadiazolium-2-phenylamine chloride derivatives (MI-J: X=OH, Y=H; MI-D: X=NO2, Y=H; MI-4F: X=F, Y=H; MI-2,4diF: X=Y=F) on human hepatocellular carcinoma (HepG2), and non-tumor cells (rat hepatocytes) for comparison. MI-J, M-4F and MI-2,4diF reduced HepG2 viability by ~ 50% at 25 μM after 24-h treatment, whereas MI-D required a 50 μM concentration, as shown by 3-(4,5-dimethythiazol-2-yl)-2,5-diphenyltetrazolium bromide assays. The cytotoxicity was confirmed with lactate dehydrogenase assay, of which activity was increased by 55, 24 and 16% for MI-J, MI-4F and MI-2,4diF respectively (at 25 μM after 24 h). To identify the death pathway related to cytotoxicity, the HepG2 cells treated by mesoionic compounds were labeled with both annexin V and PI, and analyzed by flow cytometry. All compounds increased the number of doubly-stained cells at 25 μM after 24 h: by 76% for MI-J, 25% for MI-4F and MI-2,4diF, and 11% for MI-D. It was also verified that increased DNA fragmentation occurred upon MI-J, MI-4F and MI-2,4diF treatments (by 12%, 9% and 8%, respectively, at 25 μM after 24 h). These compounds were only weakly, or not at all, transported by the main multidrug transporters, P-glycoprotein, ABCG2 and MRP1, and were able to slightly inhibit their drug-transport activity. It may be concluded that 1,3,4-thiadiazolium compounds, especially the hydroxy derivative MI-J, constitute promising candidates for future investigations on in-vivo treatment of hepatocellular carcinoma. PMID:26083249

  12. Synergetic effect of Ti 3+ and oxygen doping on enhancing photoelectrochemical and photocatalytic properties of TiO 2/g-C 3N 4 heterojunctions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Kai; Huang, Zhenyu; Zeng, Xiaoqiao

    To improve the utilization of visible light and reduce photogenerated electron/hole recombination, Ti 3+ self-doped TiO 2/oxygen-doped graphitic carbon nitride (Ti 3+-TiO 2/O-g-C 3N 4) heterojunctions were prepared via hydrothermal treatment of a mixture of g-C 3N 4 and titanium oxohydride sol obtained from the reaction of TiH 2 with H 2O 2. In this way, exfoliated O-g-C 3N 4 and Ti 3+-TiO 2 nanoparticles were obtained. Simultaneously, strong bonding was formed between Ti 3+-TiO 2 nanoparticles and exfoliated O-g-C 3N 4 during the hydrothermal process. Charge transfer and recombination processes were characterized by transient photocurrent responses, electrochemical impedance test,more » and photoluminescence spectroscopy. The photocatalytic performances were investigated through rhodamine B degradation test under an irradiation source based on 30 W cold visible-light-emitting diode. The highest visible-light photoelectrochemical and photocatalytic activities were observed from the heterojunction with 1:2 mass ratio of Ti 3+-TiO 2 to O-g-C 3N 4. The photodegradation reaction rate constant based on this heterojuction is 0.0356 min -1, which is 3.87 and 4.56 times higher than those of pristine Ti 3+-TiO 2 and pure g-C 3N 4, respectively. Here, the remarkably high photoelectrochemical and photocatalytic performances of the heterojunctions are mainly attributed to the synergetic effect of efficient photogenerated electron-hole separation, decreased electron transfer resistance from interfacial chemical hydroxy residue bonds, and oxidizing groups originating from Ti 3+-TiO 2 and O-g-C 3N 4.« less

  13. Synergetic Effect of Ti3+ and Oxygen Doping on Enhancing Photoelectrochemical and Photocatalytic Properties of TiO2/g-C3N4 Heterojunctions.

    PubMed

    Li, Kai; Huang, Zhenyu; Zeng, Xiaoqiao; Huang, Baibiao; Gao, Shanmin; Lu, Jun

    2017-04-05

    To improve the utilization of visible light and reduce photogenerated electron/hole recombination, Ti 3+ self-doped TiO 2 /oxygen-doped graphitic carbon nitride (Ti 3+ -TiO 2 /O-g-C 3 N 4 ) heterojunctions were prepared via hydrothermal treatment of a mixture of g-C 3 N 4 and titanium oxohydride sol obtained from the reaction of TiH 2 with H 2 O 2 . In this way, exfoliated O-g-C 3 N 4 and Ti 3+ -TiO 2 nanoparticles were obtained. Simultaneously, strong bonding was formed between Ti 3+ -TiO 2 nanoparticles and exfoliated O-g-C 3 N 4 during the hydrothermal process. Charge transfer and recombination processes were characterized by transient photocurrent responses, electrochemical impedance test, and photoluminescence spectroscopy. The photocatalytic performances were investigated through rhodamine B degradation test under an irradiation source based on 30 W cold visible-light-emitting diode. The highest visible-light photoelectrochemical and photocatalytic activities were observed from the heterojunction with 1:2 mass ratio of Ti 3+ -TiO 2 to O-g-C 3 N 4 . The photodegradation reaction rate constant based on this heterojuction is 0.0356 min -1 , which is 3.87 and 4.56 times higher than those of pristine Ti 3+ -TiO 2 and pure g-C 3 N 4 , respectively. The remarkably high photoelectrochemical and photocatalytic performances of the heterojunctions are mainly attributed to the synergetic effect of efficient photogenerated electron-hole separation, decreased electron transfer resistance from interfacial chemical hydroxy residue bonds, and oxidizing groups originating from Ti 3+ -TiO 2 and O-g-C 3 N 4 .

  14. Synergetic effect of Ti 3+ and oxygen doping on enhancing photoelectrochemical and photocatalytic properties of TiO 2/g-C 3N 4 heterojunctions

    DOE PAGES

    Li, Kai; Huang, Zhenyu; Zeng, Xiaoqiao; ...

    2017-03-07

    To improve the utilization of visible light and reduce photogenerated electron/hole recombination, Ti 3+ self-doped TiO 2/oxygen-doped graphitic carbon nitride (Ti 3+-TiO 2/O-g-C 3N 4) heterojunctions were prepared via hydrothermal treatment of a mixture of g-C 3N 4 and titanium oxohydride sol obtained from the reaction of TiH 2 with H 2O 2. In this way, exfoliated O-g-C 3N 4 and Ti 3+-TiO 2 nanoparticles were obtained. Simultaneously, strong bonding was formed between Ti 3+-TiO 2 nanoparticles and exfoliated O-g-C 3N 4 during the hydrothermal process. Charge transfer and recombination processes were characterized by transient photocurrent responses, electrochemical impedance test,more » and photoluminescence spectroscopy. The photocatalytic performances were investigated through rhodamine B degradation test under an irradiation source based on 30 W cold visible-light-emitting diode. The highest visible-light photoelectrochemical and photocatalytic activities were observed from the heterojunction with 1:2 mass ratio of Ti 3+-TiO 2 to O-g-C 3N 4. The photodegradation reaction rate constant based on this heterojuction is 0.0356 min -1, which is 3.87 and 4.56 times higher than those of pristine Ti 3+-TiO 2 and pure g-C 3N 4, respectively. Here, the remarkably high photoelectrochemical and photocatalytic performances of the heterojunctions are mainly attributed to the synergetic effect of efficient photogenerated electron-hole separation, decreased electron transfer resistance from interfacial chemical hydroxy residue bonds, and oxidizing groups originating from Ti 3+-TiO 2 and O-g-C 3N 4.« less

  15. Hierarchical Cu2O foam/g-C3N4 photocathode for photoelectrochemical hydrogen production

    NASA Astrophysics Data System (ADS)

    Ma, Xinzhou; Zhang, Jingtao; Wang, Biao; Li, Qiuguo; Chu, Sheng

    2018-01-01

    Solar photoelectrochemical (PEC) hydrogen production is a promising way for solving energy and environment problems. Earth-abundant Cu2O is a potential light absorber for PEC hydrogen production. In this article, hierarchical porous Cu2O foams are prepared by thermal oxidation of the electrochemically deposited Cu foams. PEC performances of the Cu2O foams are systematically studied and discussed. Benefiting from their higher light harvesting and more efficient charge separation, the Cu2O foams demonstrate significantly enhanced photocurrents and photostability compared to their film counterparts. Moreover, by integrating g-C3N4, hierarchical Cu2O foam/g-C3N4 composites are prepared with further improved photocurrent and photostability, appearing to be potential photocathodes for solar PEC hydrogen production. This study may provide a new and useful insight for the development of Cu2O-based photocathodes for PEC hydrogen production.

  16. Potential energy and dipole moment surfaces of the triplet states of the O2(X3Σg-) - O2(X3Σg-,a1Δg,b1Σg+) complex

    NASA Astrophysics Data System (ADS)

    Karman, Tijs; van der Avoird, Ad; Groenenboom, Gerrit C.

    2017-08-01

    We compute four-dimensional diabatic potential energy surfaces and transition dipole moment surfaces of O2-O2, relevant for the theoretical description of collision-induced absorption in the forbidden X3Σg- → a1Δg and X3Σg- → b1Σg+ bands at 7883 cm-1 and 13 122 cm-1, respectively. We compute potentials at the multi-reference configuration interaction (MRCI) level and dipole surfaces at the MRCI and complete active space self-consistent field (CASSCF) levels of theory. Potentials and dipole surfaces are transformed to a diabatic basis using a recent multiple-property-based diabatization algorithm. We discuss the angular expansion of these surfaces, derive the symmetry constraints on the expansion coefficients, and present working equations for determining the expansion coefficients by numerical integration over the angles. We also present an interpolation scheme with exponential extrapolation to both short and large separations, which is used for representing the O2-O2 distance dependence of the angular expansion coefficients. For the triplet ground state of the complex, the potential energy surface is in reasonable agreement with previous calculations, whereas global excited state potentials are reported here for the first time. The transition dipole moment surfaces are strongly dependent on the level of theory at which they are calculated, as is also shown here by benchmark calculations at high symmetry geometries. Therefore, ab initio calculations of the collision-induced absorption spectra cannot become quantitatively predictive unless more accurate transition dipole surfaces can be computed. This is left as an open question for method development in electronic structure theory. The calculated potential energy and transition dipole moment surfaces are employed in quantum dynamical calculations of collision-induced absorption spectra reported in Paper II [T. Karman et al., J. Chem. Phys. 147, 084307 (2017)].

  17. Potential energy and dipole moment surfaces of the triplet states of the O2(X3Σg-) - O2(X3Σg-,a1Δg,b1Σg+) complex.

    PubMed

    Karman, Tijs; van der Avoird, Ad; Groenenboom, Gerrit C

    2017-08-28

    We compute four-dimensional diabatic potential energy surfaces and transition dipole moment surfaces of O 2 -O 2 , relevant for the theoretical description of collision-induced absorption in the forbidden X 3 Σ g -  → a 1 Δ g and X 3 Σ g -  → b 1 Σ g + bands at 7883 cm -1 and 13 122 cm -1 , respectively. We compute potentials at the multi-reference configuration interaction (MRCI) level and dipole surfaces at the MRCI and complete active space self-consistent field (CASSCF) levels of theory. Potentials and dipole surfaces are transformed to a diabatic basis using a recent multiple-property-based diabatization algorithm. We discuss the angular expansion of these surfaces, derive the symmetry constraints on the expansion coefficients, and present working equations for determining the expansion coefficients by numerical integration over the angles. We also present an interpolation scheme with exponential extrapolation to both short and large separations, which is used for representing the O 2 -O 2 distance dependence of the angular expansion coefficients. For the triplet ground state of the complex, the potential energy surface is in reasonable agreement with previous calculations, whereas global excited state potentials are reported here for the first time. The transition dipole moment surfaces are strongly dependent on the level of theory at which they are calculated, as is also shown here by benchmark calculations at high symmetry geometries. Therefore, ab initio calculations of the collision-induced absorption spectra cannot become quantitatively predictive unless more accurate transition dipole surfaces can be computed. This is left as an open question for method development in electronic structure theory. The calculated potential energy and transition dipole moment surfaces are employed in quantum dynamical calculations of collision-induced absorption spectra reported in Paper II [T. Karman et al., J. Chem. Phys. 147, 084307 (2017)].

  18. Measuring the performance of G2G services in Iran

    NASA Astrophysics Data System (ADS)

    Zarei, Behrouz; Safdari, Maryam

    To highlight the growth of e-government and the importance of its services it is essential to evaluate the performance of the service delivery to customers. Research indicates that traditional performance indexes are not suitable for this evaluation; moreover, it is noticeable that the e-government services are intangible and invisible. Among different e-government services, measurement of quality government to government (G2G) services has been less attractive for researchers while crucial for government policy-makers. This calls for a better understanding of the specific needs of users of these services in order to provide appropriate type and level of services that meets those needs. In this paper, the performance of the G2G services is measured in the Iranian context. For this purpose, SERVQUAL, which is a well-known method for assessing service quality, is employed. This study proposes and tests a five-factor of SERVQUAL instrument to explain user satisfaction and gap analysis, between expectations and perceptions of its customers, consisting thirty ministries and main governmental organizations. Based on a Chi-square test, factor analysis, gap analysis and correlations, it is concluded the gap between expectations and perceptions of G2G customers is significant and customer satisfaction of G2G services is at low level.

  19. 4G/5G and A-844G Polymorphisms of Plasminogen Activator Inhibitor-1 Associated with Glioblastoma in Iran--a Case-Control Study.

    PubMed

    Pooyan, Honari; Ahmad, Ebrahimi; Azadeh, Rakhshan

    2015-01-01

    Glioblastoma is a highly aggressive and malignant brain tumor. Risk factors are largely unknown however, although several biomarkers have been identified which may support development, angiogenesis and invasion of tumor cells. One of these biomarkers is PAI-1. 4G/5G and A-844G are two common polymorphisms in the gene promotor of PAI 1 that may be related to high transcription and expression of this gene. Studies have shown that the prevalence of the 4G and 844G allele is significantly higher in patients with some cancers and genetic disorders. We here assessed the association of 4G/5G and A-844G polymorphisms with glioblastoma cancer risk in Iranians in a case-control study. All 71 patients with clinically confirmed and 140 volunteers with no history and symptoms of glioblastoma as control group were screened for 4G/5G and A-844G polymorphisms of PAI-1, using ARMS-PCR. Genotype and allele frequencies of case and control groups were analyzed using the DeFinetti program. Our results showed significant associations between 4G/5G (p=0.01824) and A-844G (p=0.02012) polymorphisms of the PAI-1 gene with glioblastoma cancer risk in our Iranian population. The results of this study supporting an association of the PAI-1 4G/5G (p=0.01824) and A-844G (p=0.02012) polymorphisms with increasing glioblastoma cancer risk in Iranian patients.

  20. Calcination Method Synthesis of SnO2/g-C3N4 Composites for a High-Performance Ethanol Gas Sensing Application

    PubMed Central

    Cao, Jianliang; Qin, Cong; Wang, Yan; Zhang, Bo; Gong, Yuxiao; Zhang, Huoli; Sun, Guang; Bala, Hari; Zhang, Zhanying

    2017-01-01

    The SnO2/g-C3N4 composites were synthesized via a facile calcination method by using SnCl4·5H2O and urea as the precursor. The structure and morphology of the as-synthesized composites were characterized by the techniques of X-ray diffraction (XRD), the field-emission scanning electron microscopy and transmission electron microscopy (SEM and TEM), energy dispersive spectrometry (EDS), thermal gravity and differential thermal analysis (TG-DTA), and N2-sorption. The analysis results indicated that the as-synthesized samples possess the two dimensional structure. Additionally, the SnO2 nanoparticles were highly dispersed on the surface of the g-C3N4nanosheets. The gas-sensing performance of the as-synthesized composites for different gases was tested. Moreover, the composite with 7 wt % g-C3N4 content (SnO2/g-C3N4-7) SnO2/g-C3N4-7 exhibits an admirable gas-sensing property to ethanol, which possesses a higher response and better selectivity than that of the pure SnO2-based sensor. The high surface area of the SnO2/g-C3N4 composite and the good electronic characteristics of the two dimensional graphitic carbon nitride are in favor of the elevated gas-sensing property. PMID:28468245

  1. D1((2)B2g) to D0((2)Au) Fluorescence from the Matrix-Isolated Perylene Cation Following Laser Excitation into the D5(2)B3g) and D2 ((2)B3g) Electronic States

    NASA Technical Reports Server (NTRS)

    Chillier, Xavier D. F.; Stone, Bradley M.; Joblin, Christine; Salama, Farid; Allamandola, Louis J.; DeVincenzi, Donald L. (Technical Monitor)

    2001-01-01

    Fluorescence spectra of the perylene cation, pumped by direct laser excitation via the D(sub 2)((2)B(sub 3g)) (left arrow) D(sub 0)((2)A(sub u)) and D(sub 5)(2)B(sub 3g)) (left arrow) D(sub 0)((2)A(sub u)) transitions, are presented. Direct excitation into the D5 or D2 states is followed by rapid non-radiative relaxation to D1 that, in turn,relaxes radiatively. Excitation spectroscopy across the D(sub 2)((2)B(sub 3g)) (left arrow) D(sub 0)((2)A(sub u)) transition near 730 nm shows that site splitting plays little or no role in determining the spectral substructure in the ion spectra. Tentative assignments for ground state vibrational frequencies are made by comparison of spectral intervals with calculated normal mode frequencies.

  2. Placental Malaria Induces Variant-Specific Antibodies of the Cytophilic Subtypes Immunoglobulin G1 (IgG1) and IgG3 That Correlate with Adhesion Inhibitory Activity

    PubMed Central

    Elliott, Salenna R.; Brennan, Amy K.; Beeson, James G.; Tadesse, Eyob; Molyneux, Malcolm E.; Brown, Graham V.; Rogerson, Stephen J.

    2005-01-01

    Antibodies targeting variant antigens on the surfaces of chondroitin sulfate A (CSA)-binding malaria-infected erythrocytes have been linked to protection against the complications of malaria in pregnancy. We examined the isotype/subtype profiles of antibodies that bound to variant surface antigens expressed by CSA-adherent Plasmodium falciparum in pregnant Malawian women with and without histologically defined placental malaria. Women in their first pregnancy with placental malaria produced significantly greater amounts of immunoglobulin G1 (IgG1) and IgG3 reactive with surface antigens of malaria-infected erythrocytes than uninfected women of the same gravidity. IgG1 and IgG3 levels in infected and control women in later pregnancies were similar to those in infected women in their first pregnancy. Levels of IgG2 and IgG4 were similarly low in infected and uninfected women of all gravidities. IgM that bound to the surface of CSA-adherent P. falciparum occurred in all groups of women and malaria-naïve controls. There was a significant correlation between IgG1 and IgG3 levels, indicating that women usually produced both subtypes. Levels of IgG1 and IgG3 correlated with the ability of serum or plasma to inhibit parasite adhesion to CSA. Taken together, these data suggest that IgG1 and IgG3 dominate the IgG response to placental-type variant surface antigens. They may function by blocking parasite adhesion to placental CSA, but given their cytophilic nature, they might also opsonize malaria-infected erythrocytes for interaction with Fc receptors on phagocytic cells. PMID:16113309

  3. Room-temperature in situ fabrication of Bi2O3/g-C3N4 direct Z-scheme photocatalyst with enhanced photocatalytic activity

    NASA Astrophysics Data System (ADS)

    He, Rongan; Zhou, Jiaqian; Fu, Huiqing; Zhang, Shiying; Jiang, Chuanjia

    2018-02-01

    Constructing direct Z-scheme heterojunction is an effective approach to separating photogenerated charge carriers and improving the activity of semiconductor photocatalysts. Herein, a composite of bismuth(III) oxide (Bi2O3) and graphitic carbon nitride (g-C3N4) was in situ fabricated at room temperature by photoreductive deposition of Bi3+ and subsequent air-oxidation of the resultant metallic Bi. Quantum-sized ω-Bi2O3 nanoparticles approximately 6 nm in diameter were uniformly distributed on the surface of mesoporous g-C3N4. The as-prepared Bi2O3/g-C3N4 composite exhibited higher photocatalytic activity than pure Bi2O3 and g-C3N4 for photocatalytic degradation of phenol under visible light. Reactive species trapping experiments revealed that superoxide radicals and photogenerated holes played important roles in the photocatalytic degradation of phenol. The enhanced photocatalytic activity, identification of reactive species and higher rate of charge carrier recombination (as indicated by stronger photoluminescence intensity) collectively suggest that the charge migration within the Bi2O3/g-C3N4 composite followed a Z-scheme mechanism. Photogenerated electrons on the conduction band of Bi2O3 migrate to the valence band of g-C3N4 and combine with photogenerated holes therein. At the cost of these less reactive charge carriers, the Z-scheme heterojunction enables efficient charge separation, while preserving the photogenerated electrons and holes with stronger redox abilities, which is beneficial for enhanced photocatalytic activity.

  4. G4RNA screener web server: User focused interface for RNA G-quadruplex prediction.

    PubMed

    Garant, Jean-Michel; Perreault, Jean-Pierre; Scott, Michelle S

    2018-06-06

    Though RNA G-quadruplexes became a focus of study over a decade ago, the main challenge associated with the identification of new potential G-quadruplexes remains a bottleneck step. It slows the study of these non-canonical structures in nucleic acids, and thus the understanding of their significance. The G4RNA screener is an accurate tool for the prediction of RNA G-quadruplexes but its deployment has brought to light an issue with its accessibility to G-quadruplex experts and biologists. G4RNA screener web server is a platform that provides a much needed interface to manage the input, parameters and result display of the main command-line ready tool. It is accessible at http://scottgroup.med.usherbrooke.ca/G4RNA_screener/. Copyright © 2018. Published by Elsevier B.V.

  5. Plasminogen activator inhibitor-1 4G/5G gene polymorphism and primary open-angle glaucoma

    PubMed Central

    Weger, Martin; Faschinger, Christoph; Schmut, Otto; Renner, Wilfried

    2008-01-01

    Purpose Alterations of the plasmin system have been suggested to participate in the multifactorial pathogenesis of primary open-angle glaucoma (POAG). The main physiological inhibitor of the plasmin system is plasminogen activator inhibitor-1 (PAI-1), which leads to decreased degradation of extracellular material. Interestingly, elevated PAI-1 levels in the aqueous humor of patients with POAG have been reported. A common polymorphism within the promoter region (PAI-1 4G/5G) has previously been shown to reduce the gene transcription rate of PAI-1. The purpose of the present study was to investigate a hypothesized association between PAI-1 4G/5G and the presence of POAG in a Caucasian population. Methods The present case-control study comprised 212 unrelated patients with POAG and 212 healthy control subjects, matched for age and sex. Genotyping of PAI-1 4G/5G polymorphisms was done using polymerase chain reaction. Results Allelic frequencies and genotype distributions of PAI-1 4G/5G did not significantly differ between patients with POAG and control subjects (PAI-1 4G/5G: 29.7% versus 29.7%). Presence of the PAI-1 4G-allele was associated with a nonsignificant odds ratio of 0.98 (95% confidence interval: 0.74–1.30) for POAG. Conclusions Our data suggest that PAI-1 4G/5G itself is unlikely to be a major risk factor among Caucasian patients with POAG. PMID:18615155

  6. Inactivation of Toluene 2-Monooxygenase in Burkholderia cepacia G4 by Alkynes

    PubMed Central

    Yeager, Chris M.; Bottomley, Peter J.; Arp, Daniel J.; Hyman, Michael R.

    1999-01-01

    High concentrations of acetylene (10 to 50% [vol/vol] gas phase) were required to inhibit the growth of Burkholderia cepacia G4 on toluene, while 1% (vol/vol) (gas phase) propyne or 1-butyne completely inhibited growth. Low concentrations of longer-chain alkynes (C5 to C10) were also effective inhibitors of toluene-dependent growth, and 2- and 3-alkynes were more potent inhibitors than their 1-alkyne counterparts. Exposure of toluene-grown B. cepacia G4 to alkynes resulted in the irreversible loss of toluene- and o-cresol-dependent O2 uptake activities, while acetate- and 3-methylcatechol-dependent O2 uptake activities were unaffected. Toluene-dependent O2 uptake decreased upon the addition of 1-butyne in a concentration- and time-dependent manner. The loss of activity followed first-order kinetics, with apparent rate constants ranging from 0.25 min−1 to 2.45 min−1. Increasing concentrations of toluene afforded protection from the inhibitory effects of 1-butyne. Furthermore, oxygen, supplied as H2O2, was required for inhibition by 1-butyne. These results suggest that alkynes are specific, mechanism-based inactivators of toluene 2-monooxygenase in B. cepacia G4, although the simplest alkyne, acetylene, was relatively ineffective compared to longer alkynes. Alkene analogs of acetylene and propyne—ethylene and propylene—were not inactivators of toluene 2-monooxygenase activity in B. cepacia G4 but were oxidized to their respective epoxides, with apparent Ks and Vmax values of 39.7 μM and 112.3 nmol min−1 mg of protein−1 for ethylene and 32.3 μM and 89.2 nmol min−1 mg of protein−1 for propylene. PMID:9925593

  7. IgG2 deficiency in sickle cell anaemia.

    PubMed

    Natta, C L; Outschoorn, I M

    1984-08-01

    8 patients with known sickle cell anaemia were studied immunologically. The concentrations of the main immunoglobulin classes, IgG and IgA, were significantly higher than the levels in 11 normal age- and sex-matched black subjects (P less than 0.01). IgM levels were not significantly different in the two groups. There was a heterogeneity in the interaction of the IgG subclasses with Protein A, with low levels of IgG2. The IgG2:IgG1 ratios varied from 1:3.8 to 1:6 (normals 1:3). In 4 patients the absolute levels of IgG2 as measured by radial immunodiffusion were lower than normal, thus confirming the chromatographic ratios. Since specific antibody is often restricted to a single subclass, the levels of IgG subclasses may be related to recurrent bacterial infections in these patients.

  8. Plasminogen Activator Inhibitor-1 4G/5G Polymorphism is Associated with Reproductive Failure: Metabolic, Hormonal, and Immune Profiles.

    PubMed

    Salazar Garcia, Maria D; Sung, Nayoung; Mullenix, Thomas M; Dambaeva, Svetlana; Beaman, Kenneth; Gilman-Sachs, Alice; Kwak-Kim, Joanne

    2016-07-01

    Association between PAI-1 4G/5G polymorphism and reproductive failures has been postulated. We aimed to investigate its impact on metabolic, hormonal, and immune profiles of women with reproductive failures. A retrospective study was carried out in 208 women with a history of reproductive failure. Study patients were divided into three groups: women with repeated implantation failure (RIF, n = 40), recurrent pregnancy loss (RPL, n = 113), and both RIF and RPL (n = 55). Fertile controls were 92. PAI-1 4G/4G was prevalent in RPL, RIF, and RIF/RPL groups when compared with controls (P = 0.003) and associated with increased risks of RIF, RPL, and RIF with RPL (OR = 4.5, 2.2 and 2.7). Women with PAI-1 4G/4G have significantly higher BMI, glucose, and PAI-1 levels and lower NK cytotoxicity when compared with women without PAI-1 4G/4G. PAI-1 4G/5G polymorphism plays a major role in the pathogenesis of RPL and RIF by altering metabolic and immunological profiles. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  9. An evaluation of the rate of absorption of solar radiation in the O2(X3Sigma-g - b1Sigma-g) transition

    NASA Technical Reports Server (NTRS)

    Mlynczak, Martin G.

    1993-01-01

    The rate at which molecular oxygen absorbs radiation in the O2(X3Sigma-g - b1Sigma-g) transition is calculated using a line-by-line radiative transfer model. This rate is critical to the determination of the population of the O2(b1Sigma-g) state required for studies of the O2(b1Sigma-g - X3Sigma-g) dayglow, the O2(a1Delta-g - X3Sigma-g) dayglow, and possibly the rates of oxidation of H2 and N2O. Previous evaluations of this rate (which is sometimes called the g-factor) have significantly overestimated its value. The rate is tabulated as a function of altitude, pressure, and solar zenith angle.

  10. Associations of maternal PLA2G4C and PLA2G4D polymorphisms with the risk of spontaneous preterm birth in a Chinese population

    PubMed Central

    Liu, Guang-Jian; He, Jian-Rong; Kuang, Ya-Shu; Fan, Xue-Jiao; Li, Wei-Dong; Lu, Jin-Hua; Xia, Xiao-Yan; Liu, Xiao-Dan; Chen, Nian-Nian; Mai, Wei-Bi; Xia, Hui-Min; Qiu, Xiu

    2017-01-01

    Preterm birth is the leading cause of mortality and morbidity in infants. Its etiology is multifactorial with genes and immune homeostasis. The authors investigated whether prostaglandin (PG) synthesis related single nucleotide polymorphisms (SNPs) PLA2G4C rs1366442 and PLA2G4D rs4924618 were associated with the risk of spontaneous preterm birth (SPTB) in a Chinese population of 114 cases of SPTB and 250 controls of term delivery. The risk associations were determined by odds ratios (ORs) and their 95% confidence intervals (CIs) calculated using multivariate logistic regression. Homology modeling was performed to elucidate potential mechanism of the SNP function. The maternal AT/TT genotype of PLA2G4D rs4924618 was associated with a reduced risk of SPTB (OR, 0.61; 95% CI, 0.37–0.99), while no significant association between PLA2G4C rs1366442 and SPTB risk was identified. Structure and sequence analysis revealed that the amino acid substitution introduced by this SNP located at the conserved central core of the catalytic domain of cytosolic phospholipase A2 δ and was close to the active site. These findings suggested that the polymorphism of PLA2G4D rs4924618 may have a protective influence on the SPTB susceptibility in a Chinese population, supporting a role for genetics in the association between PG synthesis and preterm birth. PMID:28440406

  11. Computational study on the half-metallicity in transition metal—oxide-incorporated 2D g-C3N4 nanosheets

    NASA Astrophysics Data System (ADS)

    Gao, Qian; Wang, Hui-Li; Zhang, Li-Fu; Hu, Shuang-Lin; Hu, Zhen-Peng

    2018-06-01

    In this study, based on the first-principles calculations, we systematically investigated the electronic and magnetic properties of the transition metal-oxide-incorporated 2D g-C3N4 nanosheet (labeled C3N4-TM-O, TM = Sc-Mn). The results suggest that the TM-O binds to g-C3N4 nanosheets strongly for all systems. We found that the 2D C3N4-TM-O framework is ferromagnetic for TM = Sc, Ti, V, Cr, while it is antiferromagnetic for TM = Mn. All the ferromagnetic systems exhibit the half-metallic property. Furthermore, Monte Carlo simulations based on the Heisenberg model suggest that the Curie temperatures ( T c ) of the C3N4-TM-O (TM = Sc, Ti, V, Cr) framework are 169 K, 68 K, 203 K, and 190 K, respectively. Based on Bader charge analysis, we found that the origin of the half-metallicity at Fermi energy can be partially attributed to the transfer of electrons from TM atoms to the g-C3N4 nanosheet. In addition, we found that not only electrons but also holes can induce half-metallicity for 2D g-C3N4 nanosheets, which may help to understand the origin of half-metallicity for graphitic carbon nitride.

  12. Fabrication of flower-like direct Z-scheme β-Bi2O3/g-C3N4 photocatalyst with enhanced visible light photoactivity for Rhodamine B degradation

    NASA Astrophysics Data System (ADS)

    Zhang, Liping; Wang, Guohong; Xiong, Zhenzhong; Tang, Hua; Jiang, Chuanjia

    2018-04-01

    A combined hydrothermal-calcination approach is developed to synthesize hierarchical β-Bi2O3/g-C3N4 direct Z-scheme photocatalyst with enhanced visible light photoactivity for Rhodamine B (RhB) degradation. First, Bi2O2CO3 microflowers were hydrothermally prepared using Bi(NO3)3·5H2O as feedstocks, and then a series of β-Bi2O3/g-C3N4 direct Z-scheme photocatalysts were synthesized via a facile calcination method using Bi2O2CO3 and g-C3N4 as precursors. The samples were systematically characterized by various characterization technologies including X-ray diffraction, scanning and transmission electron microscopes, Fourier transform infrared spectroscopy and N2 absorption-desorption equipment. It was found that the g-C3N4 content in the precursors played a key role in affecting the photocatalytic activity of the final products. The β-Bi2O3/g-C3N4 heterojunction exhibited higher photocatalytic activity than single active components (β-Bi2O3 and g-C3N4), indicating the presence of a synergistic effect between two active components in β-Bi2O3/g-C3N4 heterojunction. Among all as-prepared catalysts, the 70 wt.% g-C3N4/Bi2O2CO3 exhibits the highest activity for RhB degradation, and the apparent reaction rate constant k (42.2 × 10-3 min-1) is 3.1 and 1.7 times as high as that of pure β-Bi2O3 (13.5 × 10-3 min-1) and g-C3N4 (25.2 × 10-3 min-1), respectively. The enhanced photocatalytic performance of β-Bi2O3/g-C3N4 heterostructure photocatalysts is mainly due to the high surface area, closely contacted interfaces between the β-Bi2O3 and g-C3N4 component, and the formation of direct Z-scheme structure in the β-Bi2O3/g-C3N4 composites.

  13. Cycle control and bleeding pattern of a 24/4 regimen of drospirenone 3 mg/ethinylestradiol 20 μg compared with a 21/7 regimen of desogestrel 150 μg/ethinylestradiol 20 μg: a pooled analysis.

    PubMed

    Anttila, Leena; Neunteufel, Walter; Petraglia, Felice; Marr, Joachim; Kunz, Michael

    2011-01-01

    The degree of cycle control achieved with a hormonal contraceptive method is an important determinant of its acceptance and continuation. This study set out to compare the cycle control and bleeding profile of drospirenone (DRSP) 3 mg/ethinylestradiol (EE) 20 μg in a 24-active pill/4-inert pill (24/4) regimen (YAZ®) with those of desogestrel (DSG) 150 μg/EE 20 μg in a 21/7 regimen (Mercilon®), an established European combined oral contraceptive (COC). Bleeding data from women aged 17-36 years who received either DRSP 3 mg/EE 20 μg in a 24/4 regimen (n = 1285) or DSG 150 μg/EE 20 μg in a 21/7 regimen (n = 471) during four clinical studies were pooled and analysed over seven treatment cycles. The maximum intensity of scheduled withdrawal bleeding was 'normal bleeding' for >50% of subjects in cycles 1-6 in both treatment groups. Moreover, the incidence of unscheduled intracyclic bleeding during cycles 2-7 was comparable between treatment types (10.2-14.9% in women treated with DRSP 3 mg/EE 20 μg 24/4 vs 8.6-13.8% in women treated with DSG 150 μg/EE 20 μg 21/7). Overall, similar bleeding patterns were observed with both treatments. DRSP 3 mg/EE 20 μg 24/4 is associated with a bleeding profile and cycle control that is comparable to that of an established, low-dose COC formulation.

  14. Molecular Characterization of Echinococcus granulosus Cysts in North Indian Patients: Identification of G1, G3, G5 and G6 Genotypes

    PubMed Central

    Sharma, Monika; Sehgal, Rakesh; Fomda, Bashir Ahmad; Malhotra, Anil; Malla, Nancy

    2013-01-01

    Background Cystic echinococcosis (CE) caused by the Echinococcus granulosus, is a major public health problem worldwide, including India. The different genotypes of E. granulosus responsible for human hydatidosis have been reported from endemic areas throughout the world. However, the genetic characterization of E. granulosus infecting the human population in India is lacking. The aim of study was to ascertain the genotype(s) of the parasite responsible for human hydatidosis in North India. Methodology/Principal Findings To study the transmission patterns of E. granulosus, genotypic analysis was performed on hydatid cysts obtained from 32 cystic echinococcosis (CE) patients residing in 7 different states of North India. Mitochondrial cytochrome c oxidase subunit1 (cox1) sequencing was done for molecular identification of the isolates. Most of the CE patients (30/32) were found to be infected with hydatid cyst of either G3 (53.1%) or G1 (40.62%) genotype and one each of G5 (cattle strain) and G6 (camel strain) genotype. Conclusions/Significance These findings demonstrate the zoonotic potential of G1 (sheep strain) and G3 (buffalo strain) genotypes of E. granulosus as these emerged as predominant genotypes infecting the humans in India. In addition to this, the present study reports the first human CE case infected with G5 genotype (cattle strain) in an Asian country and presence of G6 genotype (camel strain) in India. The results may have important implications in the planning of control strategies for human hydatidosis. PMID:23785531

  15. g-C3N4/NiAl-LDH 2D/2D Hybrid Heterojunction for High-Performance Photocatalytic Reduction of CO2 into Renewable Fuels.

    PubMed

    Tonda, Surendar; Kumar, Santosh; Bhardwaj, Monika; Yadav, Poonam; Ogale, Satishchandra

    2018-01-24

    2D/2D interface heterostructures of g-C 3 N 4 and NiAl-LDH are synthesized utilizing strong electrostatic interactions between positively charged 2D NiAl-LDH sheets and negatively charged 2D g-C 3 N 4 nanosheets. This new 2D/2D interface heterojunction showed remarkable performance for photocatalytic CO 2 reduction to produce renewable fuels such as CO and H 2 under visible-light irradiation, far superior to that of either single phase g-C 3 N 4 or NiAl-LDH nanosheets. The enhancement of photocatalytic activity could be attributed mainly to the excellent interfacial contact at the heterojunction of g-C 3 N 4 /NiAl-LDH, which subsequently results in suppressed recombination, and improved transfer and separation of photogenerated charge carriers. In addition, the optimal g-C 3 N 4 /NiAl-LDH nanocomposite possessed high photostability after successive experimental runs with no obvious change in the production of CO from CO 2 reduction. Our findings regarding the design, fabrication and photophysical properties of 2D/2D heterostructure systems may find use in other photocatalytic applications including H 2 production and water purification.

  16. Carbon/CuO nanosphere-anchored g-C3N4 nanosheets as ternary electrode material for supercapacitors

    NASA Astrophysics Data System (ADS)

    Vattikuti, S. V. Prabhakar; Reddy, B. Purusottam; Byon, Chan; Shim, Jaesool

    2018-06-01

    Novel electrode materials for supercapacitors comprised of carbon and copper oxide (CuO) nanospheres on graphitic carbon nitride (g-C3N4) nanosheets, denoted as C/CuO@g-C3N4 are self-assembled via a one-step co-pyrolysis decomposition method. The pure g-C3N4 and C/CuO@g-C3N4 were confirmed by powder X-ray diffraction (XRD), high-resolution transmission electron microscopy (HRTEM), thermal gravimetric and differential thermal analysis (TG-DTA), X-ray photoelectron spectroscopy (XPS), N2 adsorption/desorption studies and Fourier-transform infrared spectroscopy (FTIR). The specific capacitance was 247.2 F g-1 in 0.5 M NaOH at a current density of 1 A g-1, and more than 92.1% of the capacitance was retained after 6000 cycles. The property enhancement was ascribed to the synergistic effects of the three components in the composite. These results suggest that C/CuO@g-C3N4 possessed an excellent cyclic stability with respect to their capacity performance as electrode materials.

  17. IgG4-related disease of the rectum

    PubMed Central

    Choi, Sung-Bong; Lim, Chul-Hyun; Cha, Myung-Guen

    2016-01-01

    IgG4-related disease is a relatively new disease entity characterized by elevated serum IgG4 levels and marked infiltration of IgG4-positive plasma cells in lesions. Organ enlargement or nodular lesions consisting of abundant infiltration of lymphocytes and IgG4-positive plasma cells and fibrosis are seen in various organs throughout. We encountered a patient with an inflammatory pseudotumor of the rectum, which was histopathologically confirmed to be an IgG4-related disease. The patient was a 28-year-old woman who had constipation for 3 months. The endoluminal ultrasonography showed a lesion that was heterogeneous and low echogenic in lower rectum. The result of colonoscopic biopsy findings was of chronic proctitis with lymphoid aggregates. For a confirmative diagnosis, excision was performed. Histopathological examination represented plasma cell infiltration and fibrosis. Immunohistochemistry revealed prominence of IgG4-positive plasma cells and confirmed the diagnosis of IgG4-related disease. The patient is currently under observation on low-dose oral prednisolone without relapse. PMID:27186575

  18. Critical Elements of Vehicle-to-Grid (V2G) Economics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Steward, Darlene M.

    This report explores the critical elements of V2G economics. Section 2 summarizes the elements and costs of a V2G system. Section 3 describes V2G revenue-generating services and the business cases for providing these services. Section 4 notes real-world V2G applications. Section 5 lists concerns related to V2G. Section 6 concludes and summarizes V2G cost and revenue elements.

  19. The Roles of APOBEC3G Complexes in the Incorporation of APOBEC3G into HIV-1

    PubMed Central

    Zhang, Quan; Liu, Zhenlong; Jia, Pingping; Zhou, Jinming; Guo, Fei; You, Xuefu; Yu, Liyan; Zhao, Lixun; Jiang, Jiandong; Cen, Shan

    2013-01-01

    Background The incorporation of human APOBEC3G (hA3G) into HIV is required for exerting its antiviral activity, therefore the mechanism underlying hA3G virion encapsidation has been investigated extensively. hA3G was shown to form low-molecular-mass (LMM) and high-molecular-mass (HMM) complexes. The function of different forms of hA3G in its viral incorporation remains unclear. Methodology/Principal Findings In this study, we investigated the subcellular distribution and lipid raft association of hA3G using subcellular fractionation, membrane floatation assay and pulse-chase radiolabeling experiments respectively, and studied the correlation between the ability of hA3G to form the different complex and its viral incorporation. Our work herein provides evidence that the majority of newly-synthesized hA3G interacts with membrane lipid raft domains to form Lipid raft-associated hA3G (RA hA3G), which serve as the precursor of mature HMM hA3G complex, while a minority of newly-synthesized hA3G remains in the cytoplasm as a soluble LMM form. The distribution of hA3G among the soluble LMM form, the RA LMM form and the mature forms of HMM is regulated by a mechanism involving the N-terminal part of the linker region and the C-terminus of hA3G. Mutagenesis studies reveal a direct correlation between the ability of hA3G to form the RA LMM complex and its viral incorporation. Conclusions/Significance Together these data suggest that the Lipid raft-associated LMM A3G complex functions as the cellular source of viral hA3G. PMID:24098356

  20. Relationship of plasminogen activator inhibitor 1 gene 4G/5G polymorphisms to hypertension in Korean women.

    PubMed

    Kim, Kyu-nam; Kim, Kwang-min; Kim, Bom-taeck; Joo, Nam-seok; Cho, Doo-yeoun; Lee, Duck-joo

    2012-04-01

    Hypertension (HTN) is a major determinant of various cardiovascular events. Plasma levels of plasminogen activator inhibitor 1 (PAI-1) modulate this risk. A deletion/insertion polymorphism within the PAI-1 loci (4G/4G, 4G/5G, 5G/5G) affects the expression of this gene. The present study investigated the association between PAI-1 loci polymorphisms and HTN in Korean women. Korean women (n = 1312) were enrolled in this study to evaluate the association between PAI-1 4G/5G gene polymorphisms and HTN as well as other metabolic risk factors. PAI-1 loci polymorphisms were investigated using polymerase chain reaction amplification and single-strand conformation polymorphism analysis. The three genotype groups differed with respect to systolic blood pressure (P = 0.043), and diastolic blood pressure (P = 0.009) but not with respect to age, body mass index, total cholesterol, low or high density lipoprotein cholesterol, triglycerides, or fasting blood glucose. Carriers of the PAI-1 4G allele had more hypertension significantly (PAI-1 4G/5G vs. PAI-1 5G/5G, P = 0.032; PAI-1 4G/4G vs. PAI-1 5G/5G, P = 0.034). When stratified according to PAI-1 4G/5G polymorphism, there was no significant difference in all metabolic parameters among PAI-1 genotype groups in patients with HTN as well as subjects with normal blood pressure. The estimated odds ratio of the 4G/4G genotype and 4G/5G for HTN was 1.7 (P = 0.005), and 1.6 (P = 0.015), respectively. These findings might indicate that PAI-1 loci polymorphisms independently contribute to HTN and that gene-environmental interaction may be not associated in Korean women.

  1. Mitochondrial-dependent Autoimmunity in Membranous Nephropathy of IgG4-related Disease

    PubMed Central

    Buelli, Simona; Perico, Luca; Galbusera, Miriam; Abbate, Mauro; Morigi, Marina; Novelli, Rubina; Gagliardini, Elena; Tentori, Chiara; Rottoli, Daniela; Sabadini, Ettore; Saito, Takao; Kawano, Mitsuhiro; Saeki, Takako; Zoja, Carlamaria; Remuzzi, Giuseppe; Benigni, Ariela

    2015-01-01

    The pathophysiology of glomerular lesions of membranous nephropathy (MN), including seldom-reported IgG4-related disease, is still elusive. Unlike in idiopathic MN where IgG4 prevails, in this patient IgG3 was predominant in glomerular deposits in the absence of circulating anti-phospholipase A2 receptor antibodies, suggesting a distinct pathologic process. Here we documented that IgG4 retrieved from the serum of our propositus reacted against carbonic anhydrase II (CAII) at the podocyte surface. In patient's biopsy, glomerular CAII staining increased and co-localized with subepithelial IgG4 deposits along the capillary walls. Patient's IgG4 caused a drop in cell pH followed by mitochondrial dysfunction, excessive ROS production and cytoskeletal reorganization in cultured podocytes. These events promoted mitochondrial superoxide-dismutase-2 (SOD2) externalization on the plasma membrane, becoming recognizable by complement-binding IgG3 anti-SOD2. Among patients with IgG4-related disease only sera of those with IgG4 anti-CAII antibodies caused low intracellular pH and mitochondrial alterations underlying SOD2 externalization. Circulating IgG4 anti-CAII can cause podocyte injury through processes of intracellular acidification, mitochondrial oxidative stress and neoantigen induction in patients with IgG4 related disease. The onset of MN in a subset of patients could be due to IgG4 antibodies recognizing CAII with consequent exposure of mitochondrial neoantigen in the context of multifactorial pathogenesis of disease. PMID:26137589

  2. Anti-pituitary antibodies against corticotrophs in IgG4-related hypophysitis.

    PubMed

    Iwata, Naoko; Iwama, Shintaro; Sugimura, Yoshihisa; Yasuda, Yoshinori; Nakashima, Kohtaro; Takeuchi, Seiji; Hagiwara, Daisuke; Ito, Yoshihiro; Suga, Hidetaka; Goto, Motomitsu; Banno, Ryoichi; Caturegli, Patrizio; Koike, Teruhiko; Oshida, Yoshiharu; Arima, Hiroshi

    2017-06-01

    IgG4-related disease is a systemic inflammatory disease characterized by infiltration of IgG4-positive plasma cells into multiple organs, including the pituitary gland. Autoimmunity is thought to be involved in the pathogenesis of IgG4-related disease. The diagnosis of IgG4-related hypophysitis (IgG4-RH) is difficult because its clinical features, such as pituitary swelling and hypopituitarism, are similar to those of other pituitary diseases, including lymphocytic hypophysitis and sellar/suprasellar tumors. The presence and significance of anti-pituitary antibodies (APA) in IgG4-RH is unclear. In this case-control study, we used single indirect immunofluorescence on human pituitary substrates to assess the prevalence of serum APA in 17 patients with IgG4-RH, 8 control patients with other pituitary diseases (lymphocytic infundibulo-neurohypophysitis, 3; craniopharyngioma, 2; germinoma, 3), and 9 healthy subjects. We further analyzed the endocrine cells targeted by the antibodies using double indirect immunofluorescence. APA were found in 5 of 17 patients with IgG4-RH (29%), and in none of the pituitary controls or healthy subjects. The endocrine cells targeted by the antibodies in the 5 IgG4-RH cases were exclusively corticotrophs. Antibodies were of the IgG1 subclass, rather than IgG4, in all 5 cases, suggesting that IgG4 is not directly involved in the pathogenesis. Finally, antibodies recognized pro-opiomelanocortin in 2 of the cases. Our study suggests that autoimmunity is involved in the pathogenesis of IgG4-RH and that corticotrophs are the main antigenic target, highlighting a possible new diagnostic marker for this condition.

  3. Impact of the -675 4G/5G polymorphism of the plasminogen activator inhibitor-1 gene on childhood IgA nephropathy.

    PubMed

    Han, Su-Ryun; Kim, Cheon-Jong; Lee, Byung-Cheol

    2012-04-01

    Plasminogen activator inhibitor-1 (PAI-1) is an important regulator of the fibrinolytic pathway and extracellular matrix (ECM) turnover. The -675 4G/5G polymorphism in the PAI-1 promoter is associated with altered PAI-1 transcription, suggesting that this polymorphism may be a candidate risk factor for diseases characterized by ECM accumulation, such as immunoglobulin A nephropathy (IgAN) and mesangial proliferative glomerulonephritis (MesPGN). We genotyped childhood patients with biopsy-confirmed IgAN (n=111) and MesPGN (n=47), and healthy control subjects (n=230) for the -675 4G/5G PAI-1 polymorphism by polymerase chain reaction-restriction fragment length polymorphism methods. The distribution of the 4G/4G (27.9%), 4G/5G (45.1%) and 5G/5G (27.0%) genotypes in IgAN patients was significantly different from the healthy controls (32.2, 54.3 and 13.5%, respectively) (p=0.0092). There was no significant difference in the genotype distributions of the 4G/5G polymorphism between MesPGN patients and the healthy controls. Regarding the impact of the polymorphism on IgAN, the 4G/4G genotype was markedly increased in patients with proteinuria (≥1,000 mg/day) and/or hypertension when compared to patients without proteinuria and hypertension (OR=5.23, 95% CI 1.34-20.38, P=0.0183). These findings indicate that the PAI-1 gene polymorphism may affect the susceptibility of childhood IgAN.

  4. Key technologies and concepts for beyond-3G networks

    NASA Astrophysics Data System (ADS)

    Pehkonen, Kari; Uskela, Sami; Kalliojarvi, Kari; Oksanen, Lauri; Rikkinen, Kari

    2001-10-01

    Standardization of 3rd Generation (3G) mobile communication systems has produced the first specification releases and the commercial deployment of the 3G systems has started. Whereas 1G and 2G focused on efficiently providing voice services, in 3G a lot of attention has been devoted to solutions that support both Circuit Switched (CS) and Packet Switched (PS) communication. That has called for very flexible air interface and network solutions. 3G will continue to evolve and there are already on-going standardization activities that will, for example, boost the peak data rates up to 5-10 Mbps and improve spectral efficiency by 2-4 times. In the future, 3G evolution will be going towards 10/100 Mbps peak data rates in wide/local are coverage, respectively. This will take place partly because of technical improvements of 3G radio interface solutions, but also due to network evolution which will allow the integration other radio access methods like radio LANs into the 3G system. In longer term the 3G network evolution will be going towards ALL-IP networks. As 3G evolution seems to be going towards 10 Mbps/100 Mbps peak data rates and ALL-IP networks any beyond 3G air interface or network solution should be clearly better in order to justify its technical and commercial feasibility. Given the long evolution time of 3G and integration of other radio access schemes with 3G radio we may not even see a new, complete beyond 3G system being developed. Maybe we will just witness the emergence of a new, more advanced radio access solution which will then be connected to the evolving 3G network. As 3G evolution will continue for several years to come the research targets for any beyond 3G solutions must be set very high. When it comes to air interface, we should aim at 100 Mbps peak data rates for wide area access with high mobility, and at 1 Gbps for local area access with low mobility. Regarding possible commercial launches of any beyond 3G systems or solutions they could then

  5. Utility of serum IgG, IgG4 and carbonic anhydrase II antibodies in distinguishing autoimmune pancreatitis from pancreatic cancer and chronic pancreatitis.

    PubMed

    Talar-Wojnarowska, Renata; Gąsiorowska, Anita; Olakowski, Marek; Dranka-Bojarowska, Daria; Lampe, Paweł; Śmigielski, Jacek; Kujawiak, Magdalena; Grzegorczyk, Janina; Małecka-Panas, Ewa

    2014-09-01

    Autoimmune pancreatitis (AIP) can mimic pancreatic cancer in its clinical presentation, imaging features and laboratory parameters. The aim of our study was to compare IgG, IgG4 and anti-CAIIAb serum levels in patients with AIP, pancreatic adenocarcinoma (PA) and chronic pancreatitis (CP) and to assess their clinical significance and utility in differential diagnosis of pancreatic diseases. The study included 124 patients: 45 with PA, 24 with AIP and 55 with CP. Peripheral venous blood samples were obtained from all analyzed patients at the time of hospital admission and total IgG, IgG4 and anti-CAIIAB serum levels were measured using ELISA tests. Serum levels of IgG, IgG4 and anti-CAIIAb were significantly higher in patients with AIP compared to PA and CP patients (p<0.001). In AIP patients the median IgG levels were 19.7 g/l, IgG4 levels - 301.9 mg/dl and anti-CAIIAb - 81.82 ng/ml, compared to 10.61 g/l, 123.2mg/dl and 28.6 ng/ml, respectively, in PA patients. IgG4 for the cut-off 210 mg/dl showed the best sensitivity and specificity (83.8% and 89.5%) in AIP diagnosis compared to IgG (69.3% and 87.3%, respectively) and anti-CAIIAb (45.3% and 74.3%). However, 16 (35.5%) patients with PA and 14 (25.4%) patients with CP had IgG4 levels greater than 140 mg/dl. Moreover, in 3 (6.67%) patients with pancreatic cancer those values were greater than 280 mg/dl. No patients with CP had IgG4 more than 280 mg/dl. IgG4 at cut-off 210 mg/dl showed the best sensitivity and specificity in AIP diagnosis compared to IgG and anti-CAIIAb, however elevations of serum IgG4 may be seen in subjects without AIP, including pancreatic cancer. Copyright © 2014 Medical University of Bialystok. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.

  6. Do serum angiopoietin-1, angiopoietin-2, and their receptor Tie-2 and 4G/5G variant of PAI-1 gene have a role in the pathogenesis of preeclampsia?

    PubMed

    Kamal, Manal; El-Khayat, Waleed

    2011-10-01

    To evaluate whether serum angiogenesis markers such as angiopoietins (Ang-1, Ang-2) and their receptor (Tie-2) are altered in women with preeclampsia. We also performed genotyping to determine if the 4G/5G genotypes of -675 PAI-1 gene may play a role in the pathogenesis of preeclampsia. Sixty-eight pregnant women with preeclampsia were compared to 35 normotensive pregnant women and 24 normotensive nonpregnant women in a cross-sectional study. Using enzyme-linked immunosorbent assay, levels of serum Ang-1 and Ang-2, and Tie-2 were measured. A single base pair insertion/deletion 4G/5G polymorphism of the PAI-1 gene was determined by polymerase chain reaction. Serum levels of Ang-1 and Tie-2 were significantly different among the study groups (P = 0.001 and P = 0.025, respectively) being lower in the preeclamptic group. Positive significant correlation was found between Ang-2 and Tie-2, (r = 0.26, P = 0.024). The frequency of the genotypes (4G/5G, 4G/4G, and 5G/5G) differed among the groups (P = 0.001). Also, the mean of systolic and diastolic blood pressures differed significantly according to the PAI-1 genotype being higher in those bearing the 4G allele; P = 0.04 and P = 0.023, respectively. Sera Ang-1 and Ang-2, and Tie-2 as well as variants of 4G/5G of PAI-1 polymorphism have positive implications in the pathogenesis of preeclampsia.

  7. Self-assembled hierarchical carbon/g-C3N4 composite with high photocatalytic activity

    NASA Astrophysics Data System (ADS)

    Huang, Ru-Long; Huang, Wei-Qing; Li, Dong-Feng; Ma, Li-Li; Pan, Anlian; Hu, Wangyu; Fan, Xiaoxing; Huang, Gui-Fang

    2018-04-01

    Hierarchical carbon/g-C3N4 composites consisting of nanosheets are synthesized by a direct thermal diffusion and exfoliation approach with glucose acting as the intercalator and carbon source. This facile protocol not only renders nanosheets with a large surface area, but also carbon intercalation into the interlayer of g-C3N4. Therefore, the synthesized carbon/g-C3N4 composites exhibit superior photocatalytic performance for degrading representative methylene blue (MB) under visible light irradiatuon. Carbon/g-C3N4 composites with an optimal glucose mass ratio of 0.25% show the apparent reaction rate constant of 0.253 h-1, which is 9 times higher than that over bluk g-C3N4. The superior photocatalytic performance of carbon/g-C3N4 hierarchical architectures can be attributed to the synergic effects of large reactive sites, effective visible light adsorption and faster charge transfer owing to the superior electron transfer ability of carbon as verified by the PL and photoelectrochemical measurements. The main reactive species responsible for the photocatalytic degradation are photoinduced holes and ·OH radicals under visible light irradiation. This work provides a facile way to fabricate effecient g-C3N4-based photocatalysts for the potential application in dealing with environmental and energy shortage issues using solar energy.

  8. Investigation of Plasminogen Activator Inhibitor-1 (PAI-1) 4G/5G promoter polymorphism in Indian venous thrombosis patients: A case-control study.

    PubMed

    Prabhudesai, Aniket; Shetty, Shrimati; Ghosh, Kanjaksha; Kulkarni, Bipin

    2017-09-01

    The role of PAI-1 4G/5G polymorphism in venous thrombosis has been contradictory. PAI-1 4G/4G genotype is associated with elevated levels of PAI-1 resulting in a hypofibrinolytic state and a higher thrombotic risk. In this study, the distribution of genotypes and frequency of alleles of the 4G/5G polymorphism of PAI-1 gene in Indian patients with different types of venous thrombosis was investigated for its role in development of thrombosis. A total of 87 portal vein thrombosis (PVT), 71 Budd-Chiari syndrome (BCS), 156 cerebral vein thrombosis (CVT), and 163 deep vein thrombosis (DVT) patients were studied alongside 251 healthy controls for the PAI-1 4G/5G polymorphism by allele-specific PCR. Frequency of 4G/4G genotype was higher in all groups in comparison with controls. 4G/4G was associated with PVT risk (OR=2.51, 95% CI=1.29-4.96, P=.0075), BCS risk (OR=5.98, 95% CI=2.68-13.42, P<.0001), and DVT risk (OR=1.75, 95% CI=0.98-3.02, P=.0225). This is the first case-control study from India establishing PAI-1 4G/4G as a strong risk factor for abdominal thrombosis (PVT and BCS). Statistically significant association was not found between 4G/4G genotype and CVT risk. PAI-1 4G/4G is a strong risk factor for venous thrombosis in Indian patients and should be included in laboratory testing panel of thrombophilia. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  9. A Hierarchical Z-Scheme α-Fe2 O3 /g-C3 N4 Hybrid for Enhanced Photocatalytic CO2 Reduction.

    PubMed

    Jiang, Zhifeng; Wan, Weiming; Li, Huaming; Yuan, Shouqi; Zhao, Huijun; Wong, Po Keung

    2018-03-01

    The challenge in the artificial photosynthesis of fossil resources from CO 2 by utilizing solar energy is to achieve stable photocatalysts with effective CO 2 adsorption capacity and high charge-separation efficiency. A hierarchical direct Z-scheme system consisting of urchin-like hematite and carbon nitride provides an enhanced photocatalytic activity of reduction of CO 2 to CO, yielding a CO evolution rate of 27.2 µmol g -1 h -1 without cocatalyst and sacrifice reagent, which is >2.2 times higher than that produced by g-C 3 N 4 alone (10.3 µmol g -1 h -1 ). The enhanced photocatalytic activity of the Z-scheme hybrid material can be ascribed to its unique characteristics to accelerate the reduction process, including: (i) 3D hierarchical structure of urchin-like hematite and preferable basic sites which promotes the CO 2 adsorption, and (ii) the unique Z-scheme feature efficiently promotes the separation of the electron-hole pairs and enhances the reducibility of electrons in the conduction band of the g-C 3 N 4 . The origin of such an obvious advantage of the hierarchical Z-scheme is not only explained based on the experimental data but also investigated by modeling CO 2 adsorption and CO adsorption on the three different atomic-scale surfaces via density functional theory calculation. The study creates new opportunities for hierarchical hematite and other metal-oxide-based Z-scheme system for solar fuel generation. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. 2D/2D graphitic carbon nitride (g-C3N4) heterojunction nanocomposites for photocatalysis: Why does face-to-face interface matter?

    NASA Astrophysics Data System (ADS)

    Ong, Wee-Jun

    2017-04-01

    In recent years, two-dimensional (2D) graphitic carbon nitride (g-C3N4) has elicited interdisciplinary research fascination among the scientific communities due to its attractive properties such as appropriate band structures, visible-light absorption, and high chemical and thermal stability. At present, research aiming at engineering 2D g-C3N4 photocatalysts at an atomic and molecular level in conquering the global energy demand and environmental pollution has been thriving. In this review, the cutting-edge research progress on the 2D/2D g-C3N4-based hybrid nanoarchitectures will be systematically highlighted with a specific emphasis on a multitude of photocatalytic applications, not only in waste degradation for pollution alleviation, but also in renewable energy production (e.g. water splitting and carbon dioxide (CO2) reduction). By reviewing the substantial developments on this hot research platform, it is envisioned that the review will shed light and pave a new prospect for constructing high photocatalytic performance of 2D/2D g-C3N4-based system, which could also be extended to other related energy fields, namely solar cells, supercapacitors and electrocatalysis.

  11. Distances to supernova remnants G20.4 + 0.1, G24.7 - 0.6, and G28.6 - 0.1 and new molecular cloud associations

    NASA Astrophysics Data System (ADS)

    Ranasinghe, S.; Leahy, D. A.

    2018-06-01

    Accurate distances to supernova remnants (SNRs) are crucial in determining their size, age, luminosity, and evolutionary state. To determine distances, we chose three SNRs from the VLA (Very Large Array) Galactic Plane Survey for extraction of H I absorption spectra. Analysing H I absorption spectra, 13CO emission spectra, and H I and 13CO channel maps, kinematic velocities (or their limits) to the three SNRs were calculated. The three SNRs are probably associated with molecular clouds and the new distance to G20.4 + 0.1, G24.7 - 0.6, and G28.6 - 0.1 are 7.8 ± 0.5 kpc, 3.8 ± 0.2 kpc, and 9.6 ± 0.3 kpc, respectively.

  12. Graphene and g-C3N4 based photocatalysts for NOx removal: A review

    NASA Astrophysics Data System (ADS)

    Nikokavoura, Aspasia; Trapalis, Christos

    2018-02-01

    NOx liberated into atmosphere from automobile exhausts and fossil fuel combustion, comprise the major air pollutants. They are responsible for serious environmental problems such as acid rain, ozone accumulation, haze and photochemical smog. Besides they contribute to the deterioration of human health by causing decrease of the lung function and respiratory problems. The application of photocatalytic methods in order to mitigate the presence of NOx in the atmosphere is preferable as they are environmentally friendly, mild and low cost. Therefore, in this review, the photocatalytic activity of g-C3N4 and graphene based composites towards NOx removal was discussed. NOx oxidation to non volatile nitrates on the surface of graphene and g-C3N4 based photocatalysts has attracted much interest during the last years due to their structures with unique features such as large specific surface area, thermal and chemical stability and enhanced visible light utilization. The formation of 2D-2D intimate heterojunctions between graphene or g-C3N4 and other components ensures the enhanced charge transfer, lifetime of electron/hole pairs and thus photocatalytic activity. The increased visible light harvesting also contributes to their usefulness as effective photocatalytic materials. In the present work, the advantages of these novel photocatalysts and the differences/similarities between them were exhaustively highlighted. The role of graphene as catalyst promoter, electron reservoir, support and photosensitizer in its photocatalytic composites was emphasized. The effect of g-C3N4 doping and copolymerization with metals/semiconductors on its photocatalytic activity towards NOx oxidation was thoroughly discussed. Besides, the preparation methods, photocatalytic efficiencies, type of irradiation, utilization of appropriate cocatalysts, and reaction mechanisms during the photocatalytic NOx removal by graphene and g-C3N4 composies, were summarized. It was demonstrated that in the vast

  13. Association between plasminogen activator inhibitor-1 4G/5G gene polymorphism and immunoglobulin A nephropathy susceptibility.

    PubMed

    Zhou, Tian-Biao; Jiang, Zong-Pei

    2015-02-01

    The association between plasminogen activator inhibitor-1 (PAI-1) 4 G/5 G gene polymorphism and immunoglobulin A nephropathy (IgAN) risk is still controversial. A meta-analysis was performed to evaluate the association between PAI-1 4 G/5 G gene polymorphism and IgAN susceptibility. A predefined literature search and selection of eligible relevant studies were performed to collect data from electronic database. Four articles were identified for the analysis of association between PAI-1 4 G/5 G gene polymorphism and IgAN risk. 4 G allele was not associated with IgAN susceptibility in overall populations and in Asians. Furthermore, 4 G/4 G and 5 G/5 G genotype were not associated with IgAN for overall populations, Asians. In conclusion, PAI-1 4 G/5 G gene polymorphism was not associated with IgAN risk in overall populations and in Asians. However, more studies should be performed in the future.

  14. The binding of manganese(II) and zinc(II) to the synthetic oligonucleotide d(C-G-C-G-A-A-T-T-C-G-C-G)2. A 1H NMR study.

    PubMed

    Frøystein, N A; Sletten, E

    1991-03-01

    The interaction of the synthetic oligonucleotide d(C-G-C-G-A-A-T-T-C-G-C-G)2 with two different transition-metal ions has been investigated in aqueous solution by means of 1H NMR spectroscopy. The effects on the DNA due to the presence of manganese(II) or zinc(II) have been monitored by observing the paramagnetic broadening and diamagnetic shifts of the non-exchangeable proton resonance lines, respectively. The 1H NMR spectra acquired during the course of the manganese(II) titration show very distinct broadening effects on certain DNA resonance lines. Primarily, the H8 resonance of G4 is affected, but also the H5 and H6 resonances of C3 are clearly affected by the metal. The results imply that the binding of manganese(II) to DNA is sequence specific. The 1H spectra obtained during the zinc(II) titration reveal diamagnetic shift effects which largely conform with the paramagnetic broadening effects due to the presence of manganese(II), although this picture is somewhat more complex. The H8 resonance of G4 displays a clearly visible high-field shift, while for the other guanosine H8 protons this effect is absent. The H1' and H2' protons of C3 show an effect of similar strength, although in the opposite direction, while H5 and H6 of C3 are only slightly affected. Local differences in the structure of the DNA and the basicities of potential binding sites on different base steps in the sequence might account for the observed sequence selectivity.

  15. A double chain reversal loop and two diagonal loops define the architecture of a unimolecular DNA quadruplex containing a pair of stacked G(syn)-G(syn)-G(anti)-G(anti) tetrads flanked by a G-(T-T) Triad and a T-T-T triple.

    PubMed

    Kuryavyi, V; Majumdar, A; Shallop, A; Chernichenko, N; Skripkin, E; Jones, R; Patel, D J

    2001-06-29

    The architecture of G-G-G-G tetrad-aligned DNA quadruplexes in monovalent cation solution is dependent on the directionality of the four strands, which in turn are defined by loop connectivities and the guanine syn/anti distribution along individual strands and within individual G-G-G-G tetrads. The smallest unimolecular G-quadruplex belongs to the d(G2NnG2NnG2NnG2) family, which has the potential to form two stacked G-tetrads linked by Nn loop connectivities. Previous studies have focused on the thrombin-binding DNA aptamer d(G2T2G2TGTG2T2G2), where Nn was T2 for the first and third connecting loops and TGT for the middle connecting loop. This DNA aptamer in K(+) cation solution forms a unimolecular G-quadruplex stabilized by two stacked G(syn)-G(anti)-G(syn)-G(anti) tetrads, adjacent strands which are antiparallel to each other and edge-wise connecting T2, TGT and T2 loops. We now report on the NMR-based solution structure of the d(G2T4G2CAG2GT4G2T) sequence, which differs from the thrombin-binding DNA aptamer sequence in having longer first (T4) and third (GT4) loops and a shorter (CA) middle loop. This d(G2T4G2CAG2GT4G2T) sequence in Na(+) cation solution forms a unimolecular G-quadruplex stabilized by two stacked G(syn)-G(syn)-G(anti)-G(anti) tetrads, adjacent strands which have one parallel and one antiparallel neighbors and distinct non-edge-wise loop connectivities. Specifically, the longer first (T4) and third (GT4) loops are of the diagonal type while the shorter middle loop is of the double chain reversal type. In addition, the pair of stacked G-G-G-G tetrads are flanked on one side by a G-(T-T) triad and on the other side by a T-T-T triple. The distinct differences in strand directionalities, loop connectivities and syn/anti distribution within G-G-G-G tetrads between the thrombin-binding DNA aptamer d(G2T2G2TGTG2T2G2) quadruplex reported previously, and the d(G2T4G2CAG2GT4G2T) quadruplex reported here, reinforces the polymorphic nature of higher

  16. Influence of decreased fibrinolytic activity and plasminogen activator inhibitor-1 4G/5G polymorphism on the risk of venous thrombosis.

    PubMed

    Vuckovic, Biljana A; Djeric, Mirjana J; Tomic, Branko V; Djordjevic, Valentina J; Bajkin, Branislav V; Mitic, Gorana P

    2018-01-01

    : Objective of our study is to determine whether decreased fibrinolytic activity or plasminogen activator inhibitor (PAI)-1 4G/5G polymorphism influence the risk of venous thrombosis.Our case-control study included 100 patients with venous thrombosis, and 100 random controls. When patients were compared with random controls, unconditional logistic regression was used to calculate odds ratios (ORs) with 95% confidence intervals (CIs).Decreased fibrinolytic activity yielded a 2.7-fold increase in risk for venous thrombosis than physiological fibrinolytic activity (OR 2.70; 95% CI 1.22-5.98), when comparing patients with random controls. Adjustment for several putative confounders did not change the estimate (OR 3.02; 95% CI 1.26-7.22). Analysis of venous thrombotic risk influenced by PAI-1 genotype, showed no influence of PAI-1 4G/5G gene variant in comparison with 5G/5G genotype (OR 0.57 95% CI; 0.27-1.20).Decreased fibrinolytic activity increased, whereas PAI-1 4G/5G polymorphism did not influence venous thrombosis risk in this study.

  17. Self-assembled hierarchical direct Z-scheme g-C3N4/ZnO microspheres with enhanced photocatalytic CO2 reduction performance

    NASA Astrophysics Data System (ADS)

    Nie, Ning; Zhang, Liuyang; Fu, Junwei; Cheng, Bei; Yu, Jiaguo

    2018-05-01

    Photocatalytic reduction of CO2 into hydrocarbon fuels has been regarded as a promising approach to ease the greenhouse effect and the energy shortage. Herein, an electrostatic self-assembly method was exploited to prepare g-C3N4/ZnO composite microsphere. This method simply utilized the opposite surface charge of each component, achieving a hierarchical structure with intimate contact between them. A much improved photocatalytic CO2 reduction activity was attained. The CH3OH production rate was 1.32 μmol h-1 g-1, which was 2.1 and 4.1 times more than that of the pristine ZnO and g-C3N4, respectively. This facile design bestowed the g-C3N4/ZnO composite an extended light adsorption caused by multi-light scattering effect. It also guaranteed the uniform distribution of g-C3N4 nanosheets on the surface of ZnO microspheres, maximizing their advantage and synergistic effect. Most importantly, the preeminent performance was proposed and validated based on the direct Z-scheme. The recombination rate was considerably suppressed. This work features the meliority of constructing hierarchical direct Z-scheme structures in photocatalytic CO2 reduction reactions.

  18. The -675 4G/5G polymorphism in the PAI-1 gene may not contribute to the risk of PCOS.

    PubMed

    Zhang, T-T; Yuan, L; Yang, Y-M; Ren, Y

    2014-08-01

    The association between the -675 4G/5G polymorphism in PAI-1 gene and PCOS has been studied with inconclusive results. We sought to investigate this inconsistency by performing a comprehensive meta-analysis on the polymorphism. Searches were performed in the PubMed, Embase, CNKI and Wanfang databases, covering all papers. Statistical analysis was performed using Revman5.2 and STATA11.0 software. A total of 11 case-control studies were extracted on the polymorphism involving 1861 PCOS cases and 1187 controls. The results showed that, no significant increased/decreased risk were found for the polymorphism for PCOS: OR = 1.03, 95% CI = 0.77-1.66, p = 0.52 for 4G4G + 4G5G vs. 5G5G; OR = 0.99, 95% CI = 0.66-1.49, p = 0.96 for 4G4G vs. 5G5G + 4G5G; OR = 1.08, 95% CI = 0.66-1.79, p = 0.76 for 4G4G vs. 5G5G; OR = 1.11, 95% CI = 0.78-1.58, p = 0.56 for 4G5G vs. 5G5G; OR = 1.00, 95% CI = 0.71-1.41, p = 0.99 for 4G vs. 5G. In the further subgroup analysis by ethnicity, we did not find a significant association between the polymorphism for PCOS risk in either Asians or Europeans. Our findings demonstrated that -675 4G/5G polymorphism in the PAI-1 gene might not be a risk factor for the development of PCOS.

  19. Impact of the -675 4G/5G polymorphism of the plasminogen activator inhibitor-1 gene on childhood IgA nephropathy

    PubMed Central

    HAN, SU-RYUN; KIM, CHEON-JONG; LEE, BYUNG-CHEOL

    2012-01-01

    Plasminogen activator inhibitor-1 (PAI-1) is an important regulator of the fibrinolytic pathway and extracellular matrix (ECM) turnover. The -675 4G/5G polymorphism in the PAI-1 promoter is associated with altered PAI-1 transcription, suggesting that this polymorphism may be a candidate risk factor for diseases characterized by ECM accumulation, such as immunoglobulin A nephropathy (IgAN) and mesangial proliferative glomerulonephritis (MesPGN). We genotyped childhood patients with biopsy-confirmed IgAN (n=111) and MesPGN (n=47), and healthy control subjects (n=230) for the -675 4G/5G PAI-1 polymorphism by polymerase chain reaction-restriction fragment length polymorphism methods. The distribution of the 4G/4G (27.9%), 4G/5G (45.1%) and 5G/5G (27.0%) genotypes in IgAN patients was significantly different from the healthy controls (32.2, 54.3 and 13.5%, respectively) (p=0.0092). There was no significant difference in the genotype distributions of the 4G/5G polymorphism between MesPGN patients and the healthy controls. Regarding the impact of the polymorphism on IgAN, the 4G/4G genotype was markedly increased in patients with proteinuria (≥1,000 mg/day) and/or hypertension when compared to patients without proteinuria and hypertension (OR=5.23, 95% CI 1.34–20.38, P=0.0183). These findings indicate that the PAI-1 gene polymorphism may affect the susceptibility of childhood IgAN. PMID:22969955

  20. In situ one-step hydrothermal synthesis of oxygen-containing groups-modified g-C3N4 for the improved photocatalytic H2-evolution performance

    NASA Astrophysics Data System (ADS)

    Wu, Xinhe; Chen, Fengyun; Wang, Xuefei; Yu, Huogen

    2018-01-01

    Surface modification of g-C3N4 is one of the most effective strategies to boost its photocatalytic H2-evolution performance via promoting the interfacial catalytic reactions. In this study, an in situ one-step hydrothermal method was developed to prepare the oxygen-containing groups-modified g-C3N4 (OG/g-C3N4) by a facile and green hydrothermal treatment of bulk g-C3N4 in pure water without any additives. It was found that the hydrothermal treatment (180 °C) not only could greatly increase the specific surface area (from 2.3 to 69.8 m2 g-1), but also caused the formation of oxygen-containing groups (sbnd OH and Cdbnd O) on the OG/g-C3N4 surface, via the interlayer delamination and intralayer depolymerization of bulk g-C3N4. Photocatalytic experimental results indicated that after hydrothermal treatment, the resultant OG/g-C3N4 samples showed an obviously improved H2-evolution performance. Especially, when the hydrothermal time was 6 h, the resultant OG/g-C3N4(6 h) exhibited the highest photocatalytic activity, which was clearly higher than that of the bulk g-C3N4 by a factor of ca. 7. In addition to the higher specific surface area, the enhanced H2-evolution rate of OG/g-C3N4 photocatalysts can be mainly attributed to the formation of oxygen-containing groups, which possibly works as the effective H2-evolution active sites. Considering the facie and green synthesis method, the present work may provide a new insight for the development of highly efficient photocatalytic materials.

  1. PAI-1 expression and its regulation by promoter 4G/5G polymorphism in clear cell renal cell carcinoma.

    PubMed

    Choi, Jung-Woo; Lee, Ju-Han; Park, Hong Seok; Kim, Young-Sik

    2011-10-01

    To characterise patients with high plasminogen activator inhibitor-1 (PAI-1) expression as oral PAI-1 antagonists are currently in preclinical trials, and to determine whether the PAI-1 promoter 4G/5G polymorphism regulates PAI-1 expression in clear cell renal cell carcinoma (CCRCC). PAI-1 expression was examined by immunohistochemistry in 69 CCRCC specimens. In addition, the promoter 4G/5G polymorphism was investigated by both allele-specific PCR and direct DNA sequencing. PAI-1 was overexpressed in 25/69 (36.2%) patients with CCRCC. PAI-1 staining was intense in tumour cells with a high Fuhrman nuclear grade and in spindle-shaped tumour cells. PAI-1 expression was significantly associated with older age at diagnosis (p=0.027), high nuclear grade (p<0.001), advanced clinical stage (p=0.030) and distant metastasis (p=0.009). In survival analyses, PAI-1 expression was correlated with disease-free survival in Kaplan-Meier curves (p=0.015) but was not significant in the Cox hazards model (p=0.527). The frequencies of the promoter polymorphism were 24.6% (17/69) 4G/4G, 43.5% (30/69) 4G/5G and 31.9% (22/69) 5G/5G. The homozygous 4G/4G or 5G/5G group showed a tendency for a high nuclear grade (p=0.05) but the 4G/5G polymorphism was not related to other prognostic parameters. PAI-1 expression was poorly correlated with its promoter 4G/5G polymorphism (Spearman ρ=0.088). CCRCC with high PAI-1 expression is characterised by older age, high nuclear grade, advanced stage, distant metastasis and/or shortened disease-free survival. PAI-1 expression is not affected by the promoter 4G/5G polymorphism.

  2. Cardiovascular effects of anti-G suit inflation at 1 and 2 G.

    PubMed

    Montmerle, Stéphanie; Linnarsson, Dag

    2005-06-01

    We sought to determine to which pressure a full-coverage anti-G suit needs to be inflated in order to obtain the same stroke volume during a brief exposure to twice the normal gravity (2 G) as that at 1 G without anti-G suit inflation. Nine sitting subjects were studied at normal (1 G) and during 20 s of exposure to 2 G. They wore anti-G suits, which were inflated at both G-levels to the following target pressures: 0, 70, 140 and 210 mmHg. Stroke volume was computed from cardiac output, which was measured by rebreathing. Heart rate and mean arterial pressure at heart level were recorded. Inflation to 70 mmHg compensated for the decrease in stroke volume and cardiac output caused by hypergravity. Mean arterial pressure at heart level was comparable at 1 G and at 2 G and increased gradually and similarly with inflation (P<0.001) at both gravity levels. Thus, anti-G suits act by increasing both preload and afterload but the two effects counteract each other in terms of cardiac output, so that cardiac output at 2 G is maintained at its 1 G level. This effect is reached already at 70 mmHg of inflation. Greater inflation pressure further increases mean arterial pressure at heart level and compensates for the increased difference in hydrostatic pressure between heart and head in moderate hypergravity.

  3. IgG4 subclass antibodies impair antitumor immunity in melanoma

    PubMed Central

    Karagiannis, Panagiotis; Gilbert, Amy E.; Josephs, Debra H.; Ali, Niwa; Dodev, Tihomir; Saul, Louise; Correa, Isabel; Roberts, Luke; Beddowes, Emma; Koers, Alexander; Hobbs, Carl; Ferreira, Silvia; Geh, Jenny L.C.; Healy, Ciaran; Harries, Mark; Acland, Katharine M.; Blower, Philip J.; Mitchell, Tracey; Fear, David J.; Spicer, James F.; Lacy, Katie E.; Nestle, Frank O.; Karagiannis, Sophia N.

    2013-01-01

    Host-induced antibodies and their contributions to cancer inflammation are largely unexplored. IgG4 subclass antibodies are present in IL-10–driven Th2 immune responses in some inflammatory conditions. Since Th2-biased inflammation is a hallmark of tumor microenvironments, we investigated the presence and functional implications of IgG4 in malignant melanoma. Consistent with Th2 inflammation, CD22+ B cells and IgG4+-infiltrating cells accumulated in tumors, and IL-10, IL-4, and tumor-reactive IgG4 were expressed in situ. When compared with B cells from patient lymph nodes and blood, tumor-associated B cells were polarized to produce IgG4. Secreted B cells increased VEGF and IgG4, and tumor cells enhanced IL-10 secretion in cocultures. Unlike IgG1, an engineered tumor antigen-specific IgG4 was ineffective in triggering effector cell–mediated tumor killing in vitro. Antigen-specific and nonspecific IgG4 inhibited IgG1-mediated tumoricidal functions. IgG4 blockade was mediated through reduction of FcγRI activation. Additionally, IgG4 significantly impaired the potency of tumoricidal IgG1 in a human melanoma xenograft mouse model. Furthermore, serum IgG4 was inversely correlated with patient survival. These findings suggest that IgG4 promoted by tumor-induced Th2-biased inflammation may restrict effector cell functions against tumors, providing a previously unexplored aspect of tumor-induced immune escape and a basis for biomarker development and patient-specific therapeutic approaches. PMID:23454746

  4. In situ construction of g-C3N4/TiO2 heterojunction films with enhanced photocatalytic activity over magnetic-driven rotating frame

    NASA Astrophysics Data System (ADS)

    Pan, Chao; Jia, Jia; Hu, Xiaoyun; Fan, Jun; Liu, Enzhou

    2018-02-01

    Corn-shaped TiO2 nanofilms were fabricated by a glycerol-assisted hydrothermal method, and then g-C3N4 was deposited on the surface of TiO2 films using melamine as precursor under air atmosphere by an in site microwave-heating technique. The investigations indicate that microwave-heating process is a facile strategy to obtain g-C3N4 by thermal polymerization of melamine, which can achieve in situ constructing of g-C3N4/TiO2 heterojunction films with high stability. The as-prepared TiO2 films with crack and holes have visible light scattering capability, and the scattering light overlaps with the intrinsic absorption of g-C3N4, leading to an absorption plateau in the range of 400-550 nm. Besides, a magnetic-driven rotating frame was developed to enhance the mass transfer processes during the photocatalytic water splitting. The result shows that g-C3N4/TiO2 films exhibit excellent activities under simulated-sunlight irradiation, in addition to the enhanced mass transfer, the overlapped visible light absorption, stable contact and effective charge transfer between g-C3N4 and TiO2 can facilitate the hydrogen production and light utilization efficiency as well. The hydrogen production rate can reach 13.8 mmol h-1 m-2 over g-C3N4/TiO2 films prepared using 0.5 g of melamine and 16.0 cm2 of TiO2.

  5. In-Situ-Reduced Synthesis of Ti 3+ Self-Doped TiO 2 /g-C 3 N 4 Heterojunctions with High Photocatalytic Performance under LED Light Irradiation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Kai; Gao, Shanmin; Wang, Qingyao

    2015-04-27

    A simple one-step calcination route was used to prepare Ti3+ self-doped TiO2/g-C3N4 heterojunctions by mixture of H2Ti3O7 and melamine. X-ray diffraction (XRD), transmission electron microscopy (TEM), high-resolution transmission electron microscopy (HRTEM), X-ray photoelectron spectroscopy (XPS), electron spin resonance (ESR) spectroscopy, and UV-Vis diffuse reflectance spectroscopy (UV-vis DRS) technologies were used to characterize the structure, crystallinity, morphology, and chemical state of the as-prepared samples. The absorption of the prepared Ti3+ self-doped TiO2/g-C3N4 heterojunctions shifted to a longer wavelength region in comparison with pristine TiO2 and g-C3N4. The photocatalytic activities of the heterojunctions were studied by degrading methylene blue under a 30more » W visible-light-emitting diode irradiation source. The visible-light photocatalytic activities enhanced by the prepared Ti3+ self-doped TiO2/g-C3N4 heterojunctions were observed and proved to be better than that of pure TiO2 and g-C3N4. The photocatalysis mechanism was investigated and discussed. The intensive separation efficiency of photogenerated electron-hole in the prepared heterojunction was confirmed by photoluminescence (PL) spectra. The removal rate constant reached 0.038 min(-1) for the 22.3 wt % Ti3+ self-doped TiO2/g-C3N4 heterojunction, which was 26.76 and 7.6 times higher than that of pure TiO2 and g-C3N4, respectively. The established heterojunction between the interfaces of TiO2 nanoparticles and g-C3N4 nanosheets as well as introduced Ti3+ led to the rapid electron transfer rate and improved photoinduced electron-hole pair's separation efficiency, resulting in the improved photocatalytic performance of the Ti3+ self-doped TiO2/g-C3N4 heterojunctions.« less

  6. Plasminogen Activator Inhibitor-1 (PAI-1) gene 4G/5G alleles frequency distribution in the Lebanese population.

    PubMed

    Shammaa, Dina M R; Sabbagh, Amira S; Taher, Ali T; Zaatari, Ghazi S; Mahfouz, Rami A R

    2008-09-01

    Plasminogen activator inhibitor-1 (PAI-1) is an inhibitor of fibrinolysis. Increased plasma PAI-1 levels play an essential role in the pathogenesis of cardiovascular risk and other diseases associated with thrombosis. The 4G/5G polymorphism of the PAI-1 promoter region has been extensively studied in different populations. We studied 160 healthy unrelated Lebanese individuals using a reverse hybridization PCR assay to detect the 5G/5G, 4G/5G and, 4G/4G genotypes of the PAI-1 gene and the frequencies of the 4G and 5G alleles. We found that 4G/5G genotype was the most prevalent (45.6%) followed by 5G/5G (36.9%) and 4G/4G (17.5%). The frequencies of the 4G and 5G alleles were calculated to be 0.403 and 0.597, respectively. Compared to other ethnic communities, the Lebanese population was found to harbour a relatively high prevalence of the rare 4G allele. This, in turn, may predispose this population to develop cardiovascular diseases and other thrombotic clinical conditions. This study aids to enhance our understanding of the genetic features of the Lebanese population.

  7. Aqueous poly(amidoamine) dendrimer G3 and G4 generations with several interior cores at pHs 5 and 7: a molecular dynamics simulation study.

    PubMed

    Kavyani, Sajjad; Amjad-Iranagh, Sepideh; Modarress, Hamid

    2014-03-27

    Poly(amidoamine) (PAMAM) dendrimers play an important role in drug delivery systems, because the dendrimers are susceptible to gain unique features with modification of their structure such as changing their terminals or improving their interior core. To investigate the core improvement and the effect of core nature on PAMAM dendrimers, we studied two generations G3 and G4 PAMAM dendrimers with the interior cores of commonly used ethylendiamine (EDA), 1,5-diaminohexane (DAH), and bis(3-aminopropyl) ether (BAPE) solvated in water, as an aqueous dendrimer system, by using molecular dynamics simulation and applying a coarse-grained (CG) dendrimer force field. To consider the electrostatic interactions, the simulations were performed at two protonation states, pHs 5 and 7. The results indicated that the core improvement of PAMAM dendrimers with DAH produces the largest size for G3 and G4 dendrimers at both pHs 5 and 7. The increase in the size was also observed for BAPE core but it was not so significant as that for DAH core. By considering the internal structure of dendrimers, it was found that PAMAM dendrimer shell with DAH core had more cavities than with BAPE core at both pHs 5 and 7. Also the moment of inertia calculations showed that the generation G3 is more open-shaped and has higher structural asymmetry than the generation G4. Possessing these properties by G3, specially due to its structural asymmetry, make penetration of water beads into the dendrimer feasible. But for higher generation G4 with its relatively structural symmetry, the encapsulation efficiency for water molecules can be enhanced by changing its core to DAH or BAPE. It is also observed that for the higher generation G4 the effect of core modification is more profound than G3 because the core modification promotes the structural asymmetry development of G4 more significantly. Comparing the number of water beads that penetrate into the PAMAM dendrimers for EDA, DAH, and BAPE cores indicates a

  8. Assembling of G-strands into novel tetra-molecular parallel G4-DNA nanostructures using avidin-biotin recognition.

    PubMed

    Borovok, Natalia; Iram, Natalie; Zikich, Dragoslav; Ghabboun, Jamal; Livshits, Gideon I; Porath, Danny; Kotlyar, Alexander B

    2008-09-01

    We describe a method for the preparation of novel long (hundreds of nanometers), uniform, inter-molecular G4-DNA molecules composed of four parallel G-strands. The only long continuous G4-DNA reported so far are intra-molecular structures made of a single G-strand. To enable a tetra-molecular assembly of the G-strands we developed a novel approach based on avidin-biotin biological recognition. The steps of the G4-DNA production include: (i) Enzymatic synthesis of long poly(dG)-poly(dC) molecules with biotinylated poly(dG)-strand; (ii) Formation of a complex between avidin-tetramer and four biotinylated poly(dG)-poly(dC) molecules; (iii) Separation of the poly(dC) strands from the poly(dG)-strands, which are connected to the avidin; (iv) Assembly of the four G-strands attached to the avidin into tetra-molecular G4-DNA. The average contour length of the formed structures, as measured by AFM, is equal to that of the initial poly(dG)-poly(dC) molecules, suggesting a tetra-molecular mechanism of the G-strands assembly. The height of tetra-molecular G4-nanostructures is larger than that of mono-molecular G4-DNA molecules having similar contour length. The CD spectra of the tetra- and mono-molecular G4-DNA are markedly different, suggesting different structural organization of these two types of molecules. The tetra-molecular G4-DNA nanostructures showed clear electrical polarizability. This suggests that they may be useful for molecular electronics.

  9. Plasminogen activator inhibitor-1 4G/5G polymorphism is associated with coronary artery disease risk: a meta-analysis.

    PubMed

    Zhang, Huifeng; Dong, Pingshuan; Yang, Xuming; Liu, Zhenghao

    2014-01-01

    The aim of the current study was to evaluate the association of PAI-1 4G/5G polymorphism with coronary artery disease (CAD) risk using a meta-analysis. All eligible studies were identified through a search of PubMed, EMBASE, China National Knowledge Infrastructure (CNKI), Database of Chinese Scientific and Technical Periodicals, and China Biology Medical literature database (CBM) before June 2014. The association between the PAI-1 4G/5G polymorphism and CAD risk was estimated by odds ratio (OR) and 95% confidence interval (CI). A total of 72 studies including 23557 cases and 21526 controls were eventually collected. The PAI-1 4G/5G polymorphism was significant associated with CAD risk in overall population (OR=1.19, 95% CI 1.10-1.28, P < 0.00001). The combination of adjusted ORs for CAD was 1.20 (95% CI 1.03-1.40, P=0.02). This polymorphism was associated with CAD risk in Caucasians (OR=1.10, 95% CI 1.02-1.19, P=0.01) and Asians (OR=1.46, 95% CI 1.21-1.75, P < 0.0001). This polymorphism significantly increased MI risk (OR=1.15, 95% CI 1.06-1.25, P=0.001). In the subgroup analysis by age, this polymorphism was significantly associated with early-onset CAD risk (OR=1.21, 95% CI 1.02-1.43, P=0.03). In the gender subgroup analyses, a statistically significant association was found in male CAD patients (OR=1.10, 95% CI 1.01-1.20, P=0.04). Both T2DM patients and non-T2DM patients carrying 4G allele showed increased CAD risks (OR=2.23, 95% CI 1.27-3.92, P=0.005 and OR=1.64, 95% CI 1.19-2.25, P=0.002, respectively). This meta-analysis suggested that PAI-1 4G/5G polymorphism was a risk factor for CAD.

  10. Plasminogen activator inhibitor-1 4G/5G polymorphism is associated with coronary artery disease risk: a meta-analysis

    PubMed Central

    Zhang, Huifeng; Dong, Pingshuan; Yang, Xuming; Liu, Zhenghao

    2014-01-01

    Background: The aim of the current study was to evaluate the association of PAI-1 4G/5G polymorphism with coronary artery disease (CAD) risk using a meta-analysis. Methods: All eligible studies were identified through a search of PubMed, EMBASE, China National Knowledge Infrastructure (CNKI), Database of Chinese Scientific and Technical Periodicals, and China Biology Medical literature database (CBM) before June 2014. The association between the PAI-1 4G/5G polymorphism and CAD risk was estimated by odds ratio (OR) and 95% confidence interval (CI). Results: A total of 72 studies including 23557 cases and 21526 controls were eventually collected. The PAI-1 4G/5G polymorphism was significant associated with CAD risk in overall population (OR=1.19, 95% CI 1.10-1.28, P < 0.00001). The combination of adjusted ORs for CAD was 1.20 (95% CI 1.03-1.40, P=0.02). This polymorphism was associated with CAD risk in Caucasians (OR=1.10, 95% CI 1.02-1.19, P=0.01) and Asians (OR=1.46, 95% CI 1.21-1.75, P < 0.0001). This polymorphism significantly increased MI risk (OR=1.15, 95% CI 1.06-1.25, P=0.001). In the subgroup analysis by age, this polymorphism was significantly associated with early-onset CAD risk (OR=1.21, 95% CI 1.02-1.43, P=0.03). In the gender subgroup analyses, a statistically significant association was found in male CAD patients (OR=1.10, 95% CI 1.01-1.20, P=0.04). Both T2DM patients and non-T2DM patients carrying 4G allele showed increased CAD risks (OR=2.23, 95% CI 1.27-3.92, P=0.005 and OR=1.64, 95% CI 1.19-2.25, P=0.002, respectively). Conclusions: This meta-analysis suggested that PAI-1 4G/5G polymorphism was a risk factor for CAD. PMID:25419432

  11. The H,G_1,G_2 photometric system with scarce observational data

    NASA Astrophysics Data System (ADS)

    Penttilä, A.; Granvik, M.; Muinonen, K.; Wilkman, O.

    2014-07-01

    The H,G_1,G_2 photometric system was officially adopted at the IAU General Assembly in Beijing, 2012. The system replaced the H,G system from 1985. The 'photometric system' is a parametrized model V(α; params) for the magnitude-phase relation of small Solar System bodies, and the main purpose is to predict the magnitude at backscattering, H := V(0°), i.e., the (absolute) magnitude of the object. The original H,G system was designed using the best available data in 1985, but since then new observations have been made showing certain features, especially near backscattering, to which the H,G function has troubles adjusting to. The H,G_1,G_2 system was developed especially to address these issues [1]. With a sufficient number of high-accuracy observations and with a wide phase-angle coverage, the H,G_1,G_2 system performs well. However, with scarce low-accuracy data the system has troubles producing a reliable fit, as would any other three-parameter nonlinear function. Therefore, simultaneously with the H,G_1,G_2 system, a two-parameter version of the model, the H,G_{12} system, was introduced [1]. The two-parameter version ties the parameters G_1,G_2 into a single parameter G_{12} by a linear relation, and still uses the H,G_1,G_2 system in the background. This version dramatically improves the possibility to receive a reliable phase-curve fit to scarce data. The amount of observed small bodies is increasing all the time, and so is the need to produce estimates for the absolute magnitude/diameter/albedo and other size/composition related parameters. The lack of small-phase-angle observations is especially topical for near-Earth objects (NEOs). With these, even the two- parameter version faces problems. The previous procedure with the H,G system in such circumstances has been that the G-parameter has been fixed to some constant value, thus only fitting a single-parameter function. In conclusion, there is a definitive need for a reliable procedure to produce

  12. Tandem application of ligand-based virtual screening and G4-OAS assay to identify novel G-quadruplex-targeting chemotypes.

    PubMed

    Musumeci, Domenica; Amato, Jussara; Zizza, Pasquale; Platella, Chiara; Cosconati, Sandro; Cingolani, Chiara; Biroccio, Annamaria; Novellino, Ettore; Randazzo, Antonio; Giancola, Concetta; Pagano, Bruno; Montesarchio, Daniela

    2017-05-01

    G-quadruplex (G4) structures are key elements in the regulation of cancer cell proliferation and their targeting is deemed to be a promising strategy in anticancer therapy. A tandem application of ligand-based virtual screening (VS) calculations together with the experimental G-quadruplex on Oligo Affinity Support (G4-OAS) assay was employed to discover novel G4-targeting compounds. The interaction of the selected compounds with the investigated G4 in solution was analysed through a series of biophysical techniques and their biological activity investigated by immunofluorescence and MTT assays. A focused library of 60 small molecules, designed as putative G4 groove binders, was identified through the VS. The G4-OAS experimental screening led to the selection of 7 ligands effectively interacting with the G4-forming human telomeric DNA. Evaluation of the biological activity of the selected compounds showed that 3 ligands of this sub-library induced a marked telomere-localized DNA damage response in human tumour cells. The combined application of virtual and experimental screening tools proved to be a successful strategy to identify new bioactive chemotypes able to target the telomeric G4 DNA. These compounds may represent useful leads for the development of more potent and selective G4 ligands. Expanding the repertoire of the available G4-targeting chemotypes with improved physico-chemical features, in particular aiming at the discovery of novel, selective G4 telomeric ligands, can help in developing effective anti-cancer drugs with fewer side effects. This article is part of a Special Issue entitled "G-quadruplex" Guest Editor: Dr. Concetta Giancola and Dr. Daniela Montesarchio. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. The Effect of PAI-1 4G/5G Polymorphism and Clinical Factors on Coronary Artery Occlusion in Myocardial Infarction.

    PubMed

    Parpugga, Tajinder Kumar; Tatarunas, Vacis; Skipskis, Vilius; Kupstyte, Nora; Zaliaduonyte-Peksiene, Diana; Lesauskaite, Vaiva

    2015-01-01

    Data on the impact of PAI-1-675 4G/5G genotype for fibrinolysis during myocardial infarction are inconsistent. The aim of our study was to evaluate the association of clinical and genetic (PAI-1-675 4G/5G polymorphism) factors with coronary artery occlusion in patients with myocardial infarction. PAI-1-675 4G/5G detection was achieved by using Sanger sequencing in a sample of patients hospitalized for stent implantation due to myocardial infarction. We categorized the patients into two groups: patients with coronary artery occlusion and patients without coronary artery occlusion according to angiographic evaluation. We identified n = 122 (32.4%) 4G/4G, n = 186 (49.5%) 4G/5G, and n = 68 (18.1%) 5G/5G PAI-1 genotype carriers. Univariate and multivariate analysis showed that only the 4G/5G genotype was associated with coronary artery occlusion (OR: 1.656 and 95% CI: 1.009-2.718, p = 0.046). Our results showed that carriers of PAI-1 4G/5G genotype with myocardial infarction have increased odds of coronary artery occlusion more than 1.6 times in comparison to the carriers of homozygous genotypes.

  14. The Effect of PAI-1 4G/5G Polymorphism and Clinical Factors on Coronary Artery Occlusion in Myocardial Infarction

    PubMed Central

    Parpugga, Tajinder Kumar; Tatarunas, Vacis; Skipskis, Vilius; Kupstyte, Nora; Zaliaduonyte-Peksiene, Diana; Lesauskaite, Vaiva

    2015-01-01

    Objective. Data on the impact of PAI-1-675 4G/5G genotype for fibrinolysis during myocardial infarction are inconsistent. The aim of our study was to evaluate the association of clinical and genetic (PAI-1-675 4G/5G polymorphism) factors with coronary artery occlusion in patients with myocardial infarction. Materials and Methods. PAI-1-675 4G/5G detection was achieved by using Sanger sequencing in a sample of patients hospitalized for stent implantation due to myocardial infarction. We categorized the patients into two groups: patients with coronary artery occlusion and patients without coronary artery occlusion according to angiographic evaluation. Results. We identified n = 122 (32.4%) 4G/4G, n = 186 (49.5%) 4G/5G, and n = 68 (18.1%) 5G/5G PAI-1 genotype carriers. Univariate and multivariate analysis showed that only the 4G/5G genotype was associated with coronary artery occlusion (OR: 1.656 and 95% CI: 1.009–2.718, p = 0.046). Conclusions. Our results showed that carriers of PAI-1 4G/5G genotype with myocardial infarction have increased odds of coronary artery occlusion more than 1.6 times in comparison to the carriers of homozygous genotypes. PMID:26273123

  15. PAI-1 promoter 4G/5G polymorphism (rs1799768) contributes to tumor susceptibility: Evidence from meta-analysis.

    PubMed

    Xu, Xin; Xie, Yanqi; Lin, Yiwei; Xu, Xianglai; Zhu, Yi; Mao, Yeqing; Hu, Zhenghui; Wu, Jian; Chen, Hong; Zheng, Xiangyi; Qin, Jie; Xie, Liping

    2012-12-01

    Plasminogen activator inhibitor-1 (PAI-1), belonging to the urokinase plasminogen activation (uPA) system, is involved in cancer development and progression. The PAI-1 promoter 4G/5G polymorphism was shown to contribute to genetic susceptibility to cancer, although the results were inconsistent. To assess this relationship more precisely, a meta-analysis was performed. The electronic databases PubMed, Scopus, Web of Science and Chinese National Knowledge Infrastructure (CNKI) were searched; data were extracted and analyzed independently by two reviewers. Ultimately, 21 eligible case-control studies with a total of 8,415 cancer cases and 9,208 controls were included. The overall odds ratio (OR) with its 95% confidence interval (CI) showed a statistically significant association between the PAI-1 promoter 4G/5G polymorphism and cancer risk (4G/4G vs. 5G/5G: OR=1.25, 95% CI=1.07-1.47, P(heterogeneity)=0.001; 4G/4G vs. 4G/5G+5G/5G: OR=1.10, 95% CI=1.03-1.17, P(heterogeneity)=0.194; 4G/4G+4G/5G vs. 5G/5G: OR=1.17, 95% CI=1.01-1.35, P(heterogeneity)=0.041). In further subgroup analyses, the increased risk of cancer was observed in a subgroup of Caucasians with regards to endometrial cancer. Our meta-analysis suggests that the PAI-1 4G/5G polymorphism most likely contributes to susceptibility to cancer, particularly in Caucasians. Furthermore, the 4G allele may be associated with an increased risk of endometrial cancer.

  16. PAI-1 promoter 4G/5G polymorphism (rs1799768) contributes to tumor susceptibility: Evidence from meta-analysis

    PubMed Central

    XU, XIN; XIE, YANQI; LIN, YIWEI; XU, XIANGLAI; ZHU, YI; MAO, YEQING; HU, ZHENGHUI; WU, JIAN; CHEN, HONG; ZHENG, XIANGYI; QIN, JIE; XIE, LIPING

    2012-01-01

    Plasminogen activator inhibitor-1 (PAI-1), belonging to the urokinase plasminogen activation (uPA) system, is involved in cancer development and progression. The PAI-1 promoter 4G/5G polymorphism was shown to contribute to genetic susceptibility to cancer, although the results were inconsistent. To assess this relationship more precisely, a meta-analysis was performed. The electronic databases PubMed, Scopus, Web of Science and Chinese National Knowledge Infrastructure (CNKI) were searched; data were extracted and analyzed independently by two reviewers. Ultimately, 21 eligible case-control studies with a total of 8,415 cancer cases and 9,208 controls were included. The overall odds ratio (OR) with its 95% confidence interval (CI) showed a statistically significant association between the PAI-1 promoter 4G/5G polymorphism and cancer risk (4G/4G vs. 5G/5G: OR=1.25, 95% CI=1.07–1.47, Pheterogeneity=0.001; 4G/4G vs. 4G/5G+5G/5G: OR=1.10, 95% CI=1.03–1.17, Pheterogeneity=0.194; 4G/4G+4G/5G vs. 5G/5G: OR=1.17, 95% CI=1.01–1.35, Pheterogeneity=0.041). In further subgroup analyses, the increased risk of cancer was observed in a subgroup of Caucasians with regards to endometrial cancer. Our meta-analysis suggests that the PAI-1 4G/5G polymorphism most likely contributes to susceptibility to cancer, particularly in Caucasians. Furthermore, the 4G allele may be associated with an increased risk of endometrial cancer. PMID:23226787

  17. The presence of PAI-1 4G/5G and ACE DD genotypes increases the risk of early-stage AVF thrombosis in hemodialysis patients.

    PubMed

    Güngör, Yahya; Kayataş, Mansur; Yıldız, Gürsel; Özdemir, Öztürk; Candan, Ferhan

    2011-01-01

    In this study, we investigated the relationship between early arteriovenous fistula (AVF) thrombosis with angiotensin-converting enzyme (ACE) gene and thrombophilic factor gene polymorphisms. Thirty-five patients who suffered from three or more fistula thrombosis episodes in the early period after AVF operation and 33 control patients with no history of thrombosis for at least 3 years were enrolled in this study. Factor V G1691A Leiden, factor V H1299R (R2), prothrombin G20210A, factor XIIIV34L, β-fibrinogen-455 G-A, glycoprotein IIIa L33P human platelet antigens (HPA-1), methylenetetrahydrofolate reductase C677T, and methylenetetrahydrofolate reductase A1298C gene polymorphisms were similar in both groups (p > 0.05). Plasminogen activator inhibitor 1 (PAI-1) 4G/5G genotype in the study group and 4G/4G genotype in the control group were significantly higher (p = 0.014). No significant difference was detected in terms of the 5G/5G genotype. With regard to the ACE gene polymorphism, the control group showed more ID genotype (19/33, 57.6%), whereas the study group showed more DD genotype (17/35, 48.6%). II genotype was similar in both groups (x(2) = 7.40, p = 0.025). The rate of ACE inhibitor-angiotensin II receptor blockers use was 5/35 in the study group (14.3%) and 5/33 in the control group (15.2%). Individuals with PAI-1 4G/5G genotype showed 5.03 times more risk of thrombosis when compared with 4G/4G and 5G/5G genotypes [p = 0.008, OR = 5.03, 95% confidence interval (1.44:17.64)]. Individuals with ACE DD genotype showed 4.25 times more risk of thrombosis when compared with II and ID [p = 0.008, OR = 4.25, 95% confidence interval (1.404:12.83)]. PAI-1 4G/5G and ACE DD genotypes are associated with increased risk for early AVF thrombosis.

  18. MoS2 quantum dots decorated g-C3N4/Ag heterostructures for enhanced visible light photocatalytic activity

    NASA Astrophysics Data System (ADS)

    Fu, Yanhui; Liang, Wei; Guo, Jinqiu; Tang, Hua; Liu, Shuaishuai

    2018-02-01

    A novel MoS2 quantum dots (QDs) decorated g-C3N4/Ag heterostructured photocatalyst has been synthesized via a two-step method including in situ microemulsion-assisted reduction and wetness impregnation method. The obtained heterostructure photocatalyst was characterized by X-ray diffraction (XRD), transmission electron microscopy (TEM), X-ray photoelectron spectroscopy (XPS), UV-vis diffuse reflectance spectroscopy (DRS) and photoluminescence spectrosxopy (PL). The photocatalytic activity was evaluated by the degradation of methyl orange (MO) under visible-light irradiation. The MoS2 QDs decorated hybrid photocatalysts exhibited significantly enhanced photocatalytic performance. The concentration of Ag and MoS2 QDs showing the optimal photocatalytic performance was determined to be 10% and 0.3% respectively, which exceeded the photocatalytic performance of pure g-C3N4 by more than 4.7 times. Recycling experiments confirmed that the hybrid catalysts had superior cycle performance and stability. The enhanced photocatalytic activity of MoS2 QDs decorated g-C3N4/Ag hybrid photocatalysts can be mainly ascribed to enhanced visible-light absorption, the efficient separation of photogenerated charge carriers and the stronger oxidation and reduction ability through a Z-scheme system composed of g-C3N4, Ag and MoS2 QDs, in which Ag nanoparticles act as the charge separation center. The evidence of the Z-scheme photocatalytic mechanism of the composite photocatalysts was obtained from the active species trapping experiments.

  19. Epstein-Barr virus-infected cells in IgG4-related lymphadenopathy with comparison with extranodal IgG4-related disease.

    PubMed

    Takeuchi, Mai; Sato, Yasuharu; Yasui, Hiroshi; Ozawa, Hiroaki; Ohno, Kyotaro; Takata, Katsuyoshi; Gion, Yuka; Orita, Yorihisa; Tachibana, Tomoyasu; Itoh, Tomoo; Asano, Naoko; Nakamura, Shigeo; Swerdlow, Steven H; Yoshino, Tadashi

    2014-07-01

    IgG4-related lymphadenopathy with increased numbers of Epstein-Barr virus (EBV)-infected cells has been reported but not fully described. We analyzed 31 cases of IgG4-related lymphadenopathy and 24 cases of extranodal IgG4-related diseases for their possible relationship with EBV. Other types of reactive lymph nodes (22) and angioimmunoblastic T-cell lymphoma (AITL) (10) were also studied for comparison. EBV-encoded RNA (EBER) in situ hybridization revealed EBER(+) cells in 18 of 31 cases (58%) of IgG4-related lymphadenopathy. Increased EBER(+) cells were found in only 4 of 22 (18.1%) non-IgG4-related reactive lymphoid hyperplasia in patients of a similar age (P=0.002) and in only 5 of 24 (21%) extranodal IgG4-related biopsies (P=0.006). Interestingly, all patients with EBER(+) progressively transformed germinal center-type IgG4-related lymphadenopathy had systemic lymphadenopathy and/or extranodal involvement. AITL also is associated with EBV, and IgG4-related lymphadenopathy sometimes mimics the morphology of AITL; however, the number of IgG4(+) cells in AITL was significantly less than that in IgG4-related lymphadenopathy (P<0.001). Increased numbers of regulatory T cells are seen in IgG4-related disease; however, there was not a significant difference between the EBER(+) and EBER(-) cases. In conclusion, the presence of increased numbers of EBV-infected cells in IgG4-related lymphadenopathy, compared with other reactive lymphadenopathy or extranodal IgG4-related disease, suggests that there may be a relationship at least between nodal IgG4-related disease and EBV. It is important to avoid overdiagnosing these cases as malignant lymphomas or EBV-related lymphoproliferative disorders.

  20. UV-light-assisted ethanol sensing characteristics of g-C3N4/ZnO composites at room temperature

    NASA Astrophysics Data System (ADS)

    Zhai, Jiali; Wang, Tao; Wang, Chuang; Liu, Dechen

    2018-05-01

    A highly efficient UV-light-assisted room temperature sensor based on g-C3N4/ZnO composites were prepared by an in situ precipitation method. The thermostability, composition, structure, and morphology properties of the as-prepared g-C3N4/ZnO composites were characterized by TGA, XRD, FT-IR, TEM, and XPS, respectively. And then, we studied the ethanol (C2H5OH) sensing performance of the g-C3N4/ZnO composites at the room temperature. Compared with pure ZnO and g-C3N4, the gas sensing activity of g-C3N4/ZnO composites was greatly improved at room temperature, for example, the g-C3N4/ZnO-8% composites showed an obvious response of 121-40 ppm C2H5OH at room temperature, which was 60 times higher than the pure ZnO based on the sensors under the same condition. The great enhancement of the C2H5OH sensing properties of composites can be understood by the efficient separation of photogenerated charge carriers of g-C3N4/ZnO heterogeneous and the UV-light catalytic effect. Finally, a possible mechanism for the gas sensing activity was proposed.

  1. One step synthesis of P-doped g-C3N4 with the enhanced visible light photocatalytic activity

    NASA Astrophysics Data System (ADS)

    Liu, Sen; Zhu, Honglei; Yao, Wenqing; Chen, Kai; Chen, Daimei

    2018-02-01

    In our work, P doped Graphitic nitride (g-C3N4) was prepared by the simple copolymerization of melamine and melamine phosphate. The melamine phosphate ester polymer is a complex of an s-triazine and phosphoric acid polymer, thus it will be favourable for P atom to incorporate into the Csbnd N network of g-C3N4. The doped P atoms may produce the delocalized lone electron and form the Lewis acid sites. The obtained P-doped g-C3N4 showed the higher photocatalytic activity in photodegradation of MB and 2,4-Dichlorophenol than g-C3N4. The optimum photocatatlytic activity of P-C3N4 with the weight ration of melamine phosphate and melamine at 0.06 is 2 times as higher as the pure g-C3N4 in MB photodegradation, and 1.5 times higher in 2,4-Dichlorophenol photodegradation. The enhancement of photodegradation efficiency is due to the delocalization effect of lone electron, promoting the separation of photogenerated charges, and the larger band gap of P doped g-C3N4.

  2. Selective Oxidation of Alcohols Using Photoactive VO@g??C3N4

    EPA Pesticide Factsheets

    A photoactive VO@g-C3N4 catalyst has been developed for the selective oxidation of alcohols to the corresponding aldehydes and ketones. The visible light mediated activity of the catalyst could be attributed to photoactive graphitic carbon nitrides surface.This dataset is associated with the following publication:Verma, S., R.B. Nasir Baig, M. Nadagouda , and R. Varma. Selective oxidation of alcohols using photoactive VO@g-C3N4.. ACS Sustainable Chemistry & Engineering. American Chemical Society, Washington, DC, USA, 4(3): 1094-1098, (2015).

  3. The -675 4G/5G polymorphism in plasminogen activator inhibitor-1 gene is associated with risk of asthma: a meta-analysis.

    PubMed

    Nie, Wei; Li, Bing; Xiu, Qing-Yu

    2012-01-01

    A number of studies assessed the association of -675 4G/5G polymorphism in the promoter region of plasminogen activator inhibitor (PAI)-1 gene with asthma in different populations. However, most studies reported inconclusive results. A meta-analysis was conducted to investigate the association between polymorphism in the PAI-1 gene and asthma susceptibility. Databases including Pubmed, EMBASE, HuGE Literature Finder, Wanfang Database, China National Knowledge Infrastructure (CNKI) and Weipu Database were searched to find relevant studies. Odds ratios (ORs) with 95% confidence intervals (CIs) were used to assess the strength of association in the dominant model, recessive model, codominant model, and additive model. Eight studies involving 1817 cases and 2327 controls were included. Overall, significant association between 4G/5G polymorphism and asthma susceptibility was observed for 4G4G+4G5G vs. 5G5G (OR = 1.56, 95% CI 1.12-2.18, P = 0.008), 4G/4G vs. 4G/5G+5G/5G (OR = 1.38, 95% CI 1.06-1.80, P = 0.02), 4G/4G vs. 5G/5G (OR = 1.80, 95% CI 1.17-2.76, P = 0.007), 4G/5G vs. 5G/5G (OR = 1.40, 95% CI 1.07-1.84, P = 0.02), and 4G vs. 5G (OR = 1.35, 95% CI 1.08-1.68, P = 0.008). This meta-analysis suggested that the -675 4G/5G polymorphism of PAI-1 gene was a risk factor of asthma.

  4. Molten salt-mediated formation of g-C3N4-MoS2 for visible-light-driven photocatalytic hydrogen evolution

    NASA Astrophysics Data System (ADS)

    Li, Ni; Zhou, Jing; Sheng, Ziqiong; Xiao, Wei

    2018-02-01

    Construction of two-dimensional/two-dimensional (2D/2D) hybrid with well-defined composition and microstructure is a general protocol to achieve high-performance catalysts. We herein report preparation of g-C3N4-MoS2 hybrid by pyrolysis of affordable melamine and (NH4)2MoS4 in molten LiCl-NaCl-KCl at 550 °C. Molten salts are confirmed as ideal reaction media for formation of homogeneous hybrid. Characterizations suggest a strong interaction between g-C3N4 and MoS2 in the hybrid, which results in an enhanced visible-light-driven photocatalytic hydrogen generation of the hybrid with an optimal g-C3N4/MoS2 ratio. The present study highlights the merits of molten salt methods on preparation of 2D photocatalysts and provides a rational design of 2D/2D hybrid catalysts for advanced environmental and energy applications.

  5. A highly efficient g-C3N4/SiO2 heterojunction: the role of SiO2 in the enhancement of visible light photocatalytic activity.

    PubMed

    Hao, Qiang; Niu, Xiuxiu; Nie, Changshun; Hao, Simeng; Zou, Wei; Ge, Jiangman; Chen, Daimei; Yao, Wenqing

    2016-11-23

    SiO 2 , an insulator, hardly has any photocatalytic acitivity due to its intrinsic property, and it is generally used as a hard template to increase the surface area of catalysts. However, in this work, we found that the surface state of the insulator SiO 2 can promote the migration of photogenerated charge carriers, leading to the enhancement of the photooxidation ability of graphitic carbon nitride (g-C 3 N 4 ). A one-pot calcination method was employed to prepare g-C 3 N 4 /SiO 2 composites using melamine and SiO 2 as precursors. The composites present considerably high photocatalytic degradation activities for 2,4-dichlorophenol (2,4-DCP) and rhodamine B (RhB) under visible light (λ > 420 nm) irradiation, which are about 1.53 and 4.18 times as high as those of bulk g-C 3 N 4 , respectively. The enhancement of the photocatalytic activity is due to the fact that the introduction of the insulator SiO 2 in g-C 3 N 4 /SiO 2 composites can greatly improve the specific surface area of the composites; more importantly, the impurity energy level of SiO 2 can help accelerate the separation and transfer of electron-hole pairs of g-C 3 N 4 . Electron paramagnetic resonance (EPR) spectroscopy and trapping experiments with different radical scavengers show that the main active species of g-C 3 N 4 are superoxide radicals, while holes also play a role in photodegradation. For g-C 3 N 4 /SiO 2 -5, besides superoxide radicals and holes, the effect of hydroxyl radicals was greatly improved. Finally, a possible mechanism for the photogenerated charge carrier migration of the g-C 3 N 4 /SiO 2 photocatalyst was proposed.

  6. Geological studies of the COST nos. G-1 and G-2 wells, United States North Atlantic outer continental shelf

    USGS Publications Warehouse

    Scholle, Peter A.; Wenkam, Chiye R.

    1982-01-01

    The COST Nos. G-1 and G-2 wells (fig. 1) are the second and third deep stratigraphic test wells drilled in the North Atlantic Outer Continental Shelf of the United States. COST No. G-1 was drilled in the Georges Bank basin to a total depth of 16,071 ft (4,898 m). G-1 bottomed in phyllite, slate, and metaquartzite overlain by weakly metamorphosed dolomite, all of Cambrian age. From approximately 15,600 to 12,400 ft (4,755 to 3,780 m) the strata are Upper Triassic(?), Lower Jurassic(?), and Middle Jurassic, predominantly red shales, sandstones, and conglomerates. Thin, gray Middle Jurassic beds of shale, sandstone, limestone, and dolomite occur from 12,400 to 9,900 ft (3,780 to 3,018 m). From 9,900 to 1,030 ft (3,018 to 314 m) are coarse-grained unconsolidated sands and loosely cemented sandstones, with beds of gray shale, lignite, and coal. The microfossils indicate the rocks are Upper Jurassic from 10,100 ft (3,078 m) up to 5,400 ft (1,646 m) and Cretaceous from that depth to 1,030 ft (314 m). No younger or shallower rocks were recovered in the drilling at the COST No. G-1 site, but an Eocene limestone is inferred to be disconformable over Santonian strata. The Jurassic strata of the COST No. G-1 well were deposited in shallow marine, marginal marine, and nonmarine environments, which changed to a dominantly shallow marine but still nearshore environment in the Cretaceous. The COST No. G-2 well was drilled 42 statute miles {68 km) east of the G-1 site, still within the Georges Bank basin, to a depth of 21,874 ft (6,667 m). The bottom 40 ft (12 m) of salt and anhydrite is overlain by approximately 7,000 ft {2,134 m) of Upper Triassic{?), Lower Jurassic{?) and Middle Jurassic dolomite, limestone, and interbedded anhydrite from 21,830 to 13,615 ft (6,654 to 4,153 m). From 13,500 to 9,700 ft (4,115 to 2,957 m) are Middle Jurassic limestones with interbedded sandstone. From 9,700 to 4,000 ft (2,957 to 1,219 m) are Upper Jurassic and Cretaceous interbedded sandstones and

  7. Excitation of O 2(a 1Δ g, b 1Σ g+) and I( 2P 1/2) by energy transfer from I 2(A, A' 3Π 1,2u) in solid rare gases

    NASA Astrophysics Data System (ADS)

    Böhling, R.; Becker, A. C.; Minaev, B. F.; Seranski, K.; Schurath, U.

    1990-04-01

    O 2a 1Δ g, b 1Σ g+ → X 3Σ g- and I 2P 1/22P 3/4 fluorescence occurs in I 2/O 2-doped rare gas matrices when I 2 is excited with visible laser light. O 2(a 1Δ g) and I( 2P 1/2) are populated independently by near-resonant energy transfer from the metastable triplet states of I 2. The doublet splitting of the O 2a→X band, which peaks at 7879 and 7863 cm -1 in argon, is interpreted as sensitized emission from O 2 trapped in distinct nearest neighbour positions of the donor 3I 2. Annealing reverses the intensity of the doublet, showing that the sites can be interconverted. It is suggested that the a→X emission rate is enhanced by the sensitizer, causing a lifetime reduction of the a 1Δ g state from 79 s in pure argon to 21 and 3±1 s next to I 2. The long-lived O 2(a 1Δ g) state is the precursor of I 2-sensitized emission from O 2(b 1Σ g+). The lifetime of O 2(b 1Σ g+) is reduced from 24.5 ms in pure argon to 17±1 ms in the presence of I 2.

  8. Four-Quadrant Analog Multipliers Using G4-FETs

    NASA Technical Reports Server (NTRS)

    Mojarradi, Mohammad; Blalock, Benjamin; Christoloveanu, Sorin; Chen, Suheng; Akarvardar, Kerem

    2006-01-01

    Theoretical analysis and some experiments have shown that the silicon-on-insulator (SOI) 4-gate transistors known as G4-FETs can be used as building blocks of four-quadrant analog voltage multiplier circuits. Whereas a typical prior analog voltage multiplier contains between six and 10 transistors, it is possible to construct a superior voltage multiplier using only four G4-FETs. A G4-FET is a combination of a junction field-effect transistor (JFET) and a metal oxide/semiconductor field-effect transistor (MOSFET). It can be regarded as a single transistor having four gates, which are parts of a structure that affords high functionality by enabling the utilization of independently biased multiple inputs. The structure of a G4-FET of the type of interest here (see Figure 1) is that of a partially-depleted SOI MOSFET with two independent body contacts, one on each side of the channel. The drain current comprises of majority charge carriers flowing from one body contact to the other that is, what would otherwise be the side body contacts of the SOI MOSFET are used here as the end contacts [the drain (D) and the source (S)] of the G4-FET. What would otherwise be the source and drain of the SOI MOSFET serve, in the G4-FET, as two junction-based extra gates (JG1 and JG2), which are used to squeeze the channel via reverse-biased junctions as in a JFET. The G4-FET also includes a polysilicon top gate (G1), which plays the same role as does the gate in an accumulation-mode MOSFET. The substrate emulates a fourth MOS gate (G2). By making proper choices of G4-FET device parameters in conjunction with bias voltages and currents, one can design a circuit in which two input gate voltages (Vin1,Vin2) control the conduction characteristics of G4-FETs such that the output voltage (Vout) closely approximates a value proportional to the product of the input voltages. Figure 2 depicts two such analog multiplier circuits. In each circuit, there is the following: The input and output

  9. [IgG4-related disease: patient group characterization and rituximab therapy].

    PubMed

    Sedyshev, S Kh; Vasil'ev, V I; Kovrigina, A M; Logvinenko, O A; Rodionova, E B; Safonova, T N; Gaĭduk, I V; Silin, A Iu; Komov, D V; Nasonov, E L

    2013-01-01

    To characterize a group of patients with IgG4-related disease (IgG4-RD) in a Russian population and to evaluate the efficiency of rituximab therapy. In 2009 to 2011, at the Research Institute of Rheumatology, Russian Academy of Medical Sciences, 30 patients (16 men and 14 women; mean age 44 years) were diagnosed with IgG4-RD that was confirmed by determination of serum IgG4 levels and immunohistochemical study of biopsy samples stained for IgG4-positive plasma cells. Seven patients received rituximab therapy. It was assumed at baseline that there were different types of neoplasias in 12 (40%), non-Hodgkin's and Hodgkin's lymphomas in 10 (33.3%), Sjögren's syndrome in 5 (16.7%), and Wegener's granulomatosis in 3 (10%). When 2 or more locations were involved, the condition was regarded as multifocal fibrosclerosis (33.3%). Localized forms were revealed in 20 (66.7%) patients. Among them, the largest number of patients was those who had orbital pseudotumor, Mikulicz's disease, or retroperitoneal fibrosclerosis. The most common sites of involvement were orbits (66.7%), salivary glands (70%) and lymph nodes (36.7%). Comparison of serum IgG4 levels in 28 patients with IgG4-RD, 22 patients with Sjögren's disease, salivary and lacrimal gland lymphomas, and 10 healthy controls showed that the concentration of IgG4 was significantly higher in Group 1 (median 2.6 g/I; IQR 1.22-4.65 (p < 0.001). Tissue IgG4/IgG ratio varied from 25 to 50% and averaged 38%. A moiré-like pattern of varying fibrosis was noted in 83% of cases. Analysis of laboratory data revealed elevated C-reactive protein concentrations (46.7% with a mean of 39.5 mg/l; normal values < 5.0 mg/l), increased erythrocyte sedimentation rate (60% with a mean of 37.6 mm/h), hypergammaglobulinemia (30% with a mean of 29.4%; normal range 13-22%), and rheumatoid factor (23.3%). After rituximab therapy, all the patients showed a decrease of IgG4 levels to the normal levels and positive changes evidenced by visualization

  10. Occurrence of IgG4-related hypophysitis lacking IgG4-bearing plasma cell infiltration during steroid therapy.

    PubMed

    Ohkubo, Yohsuke; Sekido, Takashi; Takeshige, Keiko; Ishi, Hiroaki; Takei, Masahiro; Nishio, Shin-ichi; Yamazaki, Masanori; Komatsu, Mitsuhisa; Kawa, Shigeyuki; Suzuki, Satoru

    2014-01-01

    Eight years after an episode of multiple IgG4-related disease, a pituitary mass with panhypopituitarism and a visual disturbance developed in a 70-year-old man under low-dose steroid therapy. A pituitary biopsy revealed findings of lymphocytic hypophysitis with the absence of IgG4-positive plasma cell infiltration. The serum IgG4 level was unremarkable. Although performing a pituitary biopsy and measuring the serum IgG4 level is crucial for making a diagnosis of IgG4-related hypophysitis, it is occasionally difficult to diagnose the disease in patients treated with steroid therapy, as observed in the present case. Based on a review of the diagnosis, conducting a careful assessment is required, especially in men and elderly patients thought to have solitary hypophysitis.

  11. Enhanced photo-Fenton-like process over Z-scheme CoFe2O4/g-C3N4 Heterostructures under natural indoor light.

    PubMed

    Yao, Yunjin; Wu, Guodong; Lu, Fang; Wang, Shaobin; Hu, Yi; Zhang, Jie; Huang, Wanzheng; Wei, Fengyu

    2016-11-01

    Low-cost catalysts with high activity and stability toward producing strongly oxidative species are extremely desirable, but their development still remains a big challenge. Here, we report a novel strategy for the synthesis of a magnetic CoFe 2 O 4 /C 3 N 4 hybrid via a simple self-assembly method. The CoFe 2 O 4 /C 3 N 4 was utilized as a photo-Fenton-like catalyst for degradation of organic dyes in the presence of H 2 O 2 under natural indoor light irradiation, a green and energy-saving approach for environmental cleaning. It was found the CoFe 2 O 4 /C 3 N 4 hybrid with a CoFe 2 O 4 : g-C 3 N 4 mass ratio of 2:1 can completely degrade Rhodamine B nearly 100 % within 210 min under room-light irradiation. The effects of the amount of H 2 O 2 (0.01-0.5 M), initial dye concentration (5-20 mg/L), solution pH (3.08-10.09), fulvic acid concentration (5-50 mg/L), different dyes and catalyst stability on the organic dye degradation were investigated. The introduction of CoFe 2 O 4 on g-C 3 N 4 produced an enhanced separation efficiency of photogenerated electron - hole pairs by a Z-scheme mechanism between the interfaces of g-C 3 N 4 and CoFe 2 O 4 , leading to an excellent activity as compared with either g-C 3 N 4 or CoFe 2 O 4 and their mixture. This study demonstrates an efficient way to construct the low-cost magnetic CoFe 2 O 4 /C 3 N 4 heterojunction as a typical Z-scheme system in environmental remediation.

  12. An in situ mediator-free route to fabricate Cu2O/g-C3N4 type-II heterojunctions for enhanced visible-light photocatalytic H2 generation

    NASA Astrophysics Data System (ADS)

    Ji, Cong; Yin, Su-Na; Sun, Shasha; Yang, Shengyang

    2018-03-01

    Cu2O nanoparticles doped g-C3N4 are synthesized via an in situ method and investigated in detail by IR techniques, X-ray diffraction, X-ray photoelectron spectroscopy, transmission electron microscopy, ultraviolet visible diffuse reflection spectroscopy, and photoluminescence spectroscopy. The as-prepared Cu2O/g-C3N4 hybrids demonstrate enhanced photocatalytic activity toward hydrogen generation compared to pure bulk g-C3N4, the effect of Cu2O content on the rate of visible light photocatalytic hydrogen evolution reveals the optimal hydrogen evolution rate can reach 33.2 μmol h-1 g-1, which is about 4 times higher that of pure g-C3N4. The enhanced photocatalytic activity can be attributed to the improved separation and transfer of photogenerated electron-hole pairs at the intimate interface between g-C3N4 and Cu2O. A possible photocatalytic mechanism of the Cu2O/g-C3N4 composite is also discussed. This mediator-free in situ chemical doping strategy developed in this work will contribute to the achievement of other multicomponent photocatalysts.

  13. Water-assisted production of honeycomb-like g-C3N4 with ultralong carrier lifetime and outstanding photocatalytic activity

    NASA Astrophysics Data System (ADS)

    Wang, Zhenyu; Guan, Wei; Sun, Yanjuan; Dong, Fan; Zhou, Ying; Ho, Wing-Kei

    2015-01-01

    Graphitic carbon nitride (g-C3N4) is a visible light photocatalyst, limited by low activity mainly caused by rapid recombination of charge carriers. In the present work, honeycomb-like g-C3N4 was synthesized via thermal condensation of urea with addition of water at 450 °C for 1 h. Prolonging the condensation time caused the morphology of g-C3N4 to change from a porous honeycomb structure to a velvet-like nanoarchitecture. Unlike in previous studies, the photocatalytic activity of g-C3N4 decreased with increasing surface area. The honeycomb-like g-C3N4 with a relatively low surface area showed highly enhanced photocatalytic activity with an NO removal ratio of 48%. The evolution of NO2 intermediate was dramatically inhibited over the honeycomb-like g-C3N4. The short and long lifetimes of the charge carriers for honeycomb-like g-C3N4 were unprecedentedly prolonged to 22.3 and 165.4 ns, respectively. As a result, the honeycomb-like g-C3N4 was highly efficient and stable in activity and could be used repeatedly. Addition of water had the following multiple positive effects on g-C3N4: (1) formation of the honeycomb structure, (2) promotion of charge separation and migration, (3) enlargement of the band gap, (4) increase in production yield, and (5) decrease in energy cost. These advantages make the present preparation method for highly efficient g-C3N4 extremely appealing for large-scale applications. The active species produced from g-C3N4 under illumination were confirmed using DMPO-ESR spin-trapping, the reaction intermediate was monitored, and the reaction mechanism of photocatalytic NO oxidation by g-C3N4 was revealed. This work could provide an attractive alternative method for mass-production of highly active g-C3N4-based photocatalysts for environmental and energetic applications.Graphitic carbon nitride (g-C3N4) is a visible light photocatalyst, limited by low activity mainly caused by rapid recombination of charge carriers. In the present work, honeycomb

  14. Aflatoxin (B1 , B2 , G1 , and G2 ) contamination in rice of Mexico and Spain, from local sources or imported.

    PubMed

    Suárez-Bonnet, Elena; Carvajal, Magda; Méndez-Ramírez, Ignacio; Castillo-Urueta, Pável; Cortés-Eslava, Josefina; Gómez-Arroyo, Sandra; Melero-Vara, José María

    2013-11-01

    Rice is an important cereal but it is often contaminated with aflatoxins (AFs). The purpose of this study was to identify and quantify AF (B1 , B2 , G1 , and G2 ) in 67 rice samples cultivated in Mexico and Spain, and from imported crops collected in 2008 and 2009. The methodology was validated, the rice samples were concentrated and purified with immunoaffinity columns and were quantified by high-pressure liquid chromatography (HPLC). The average total AF (AFt) in the Spanish rice was 37.3 μg/kg, the range was from 1.6 to 1383 μg/kg, the most contaminated samples being from San Juan de Aznalfarache, Sevilla (AFt = 138.6 μg/kg), from Tortosa, Tarragona (AFt = 104.6 μg/kg), and Calasparra, Murcia (AFt = 103.9 μg/kg). The rice imported from France to Spain had AFt of 26.6 μg/kg and from Pakistan AFt of 18.4 μg/kg, showing less AF contamination than the local one. The rice which originated from Mexico contained (AFt = 16.9 μg/kg), and those imported from the United States (AFt = 14.4 μg/kg) and Uruguay (AFt = 15.6 μg/kg). The imported rice had better quality in terms of the presence of AFs. © 2013 Institute of Food Technologists®

  15. Computational repositioning of ethno medicine elucidated gB-gH-gL complex as novel anti herpes drug target

    PubMed Central

    2013-01-01

    Background Herpes viruses are important human pathogens that can cause mild to severe lifelong infections with high morbidity. They remain latent in the host cells and can cause recurrent infections that might prove fatal. These viruses are known to infect the host cells by causing the fusion of viral and host cell membrane proteins. Fusion is achieved with the help of conserved fusion machinery components, glycoproteins gB, heterodimer gH-gL complex along with other non-conserved components. Whereas, another important glycoprotein gD without which viral entry to the cell is not possible, acts as a co-activator for the gB-gH-gL complex formation. Thus, this complex formation interface is the most promising drug target for the development of novel anti-herpes drug candidates. In the present study, we propose a model for binding of gH-gL to gB glycoprotein leading from pre to post conformational changes during gB-gH-gL complex formation and reported the key residues involved in this binding activity along with possible binding site locations. To validate the drug targetability of our proposed binding site, we have repositioned some of the most promising in vitro, in vivo validated anti-herpes molecules onto the proposed binding site of gH-gL complex in a computational approach. Methods Hex 6.3 standalone software was used for protein-protein docking studies. Arguslab 4.0.1 and Accelrys® Discovery Studio 3.1 Visualizer softwares were used for semi-flexible docking studies and visualizing the interactions respectively. Protein receptors and ethno compounds were retrieved from Protein Data Bank (PDB) and Pubchem databases respectively. Lipinski’s Filter, Osiris Property Explorer and Lazar online servers were used to check the pharmaceutical fidelity of the drug candidates. Results Through protein-protein docking studies, it was identified that the amino acid residues VAL342, GLU347, SER349, TYR355, SER388, ASN395, HIS398 and ALA387 of gH-gL complex play an active

  16. Plasminogen activator inhibitor-1 4G/5G gene polymorphism and coronary artery disease in the Chinese Han population: a meta-analysis.

    PubMed

    Li, Yan-yan

    2012-01-01

    The polymorphism of plasminogen activator inhibitor-1 (PAI-1) 4G/5G gene has been indicated to be correlated with coronary artery disease (CAD) susceptibility, but study results are still debatable. The present meta-analysis was performed to investigate the association between PAI-1 4G/5G gene polymorphism and CAD in the Chinese Han population. A total of 879 CAD patients and 628 controls from eight separate studies were involved. The pooled odds ratio (OR) for the distribution of the 4G allele frequency of PAI-1 4G/5G gene and its corresponding 95% confidence interval (CI) was assessed by the random effect model. The distribution of the 4 G allele frequency was 0.61 for the CAD group and 0.51 for the control group. The association between PAI-1 4G/5G gene polymorphism and CAD in the Chinese Han population was significant under an allelic genetic model (OR = 1.70, 95% CI = 1.18 to 2.44, P = 0.004). The heterogeneity test was also significant (P<0.0001). Meta-regression was performed to explore the heterogeneity source. Among the confounding factors, the heterogeneity could be explained by the publication year (P = 0.017), study region (P = 0.014), control group sample size (P = 0.011), total sample size (P = 0.011), and ratio of the case to the control group sample size (RR) (P = 0.019). In a stratified analysis by the total sample size, significantly increased risk was only detected in subgroup 2 under an allelic genetic model (OR = 1.93, 95% CI = 1.09 to 3.35, P = 0.02). In the Chinese Han population, PAI-1 4G/5G gene polymorphism was implied to be associated with increased CAD risk. Carriers of the 4G allele of the PAI-1 4G/5G gene might predispose to CAD.

  17. Plasminogen Activator Inhibitor-1 4G/5G Gene Polymorphism and Coronary Artery Disease in the Chinese Han Population: A Meta-Analysis

    PubMed Central

    Li, Yan-yan

    2012-01-01

    Background The polymorphism of plasminogen activator inhibitor-1 (PAI-1) 4G/5G gene has been indicated to be correlated with coronary artery disease (CAD) susceptibility, but study results are still debatable. Objective and Methods The present meta-analysis was performed to investigate the association between PAI-1 4G/5G gene polymorphism and CAD in the Chinese Han population. A total of 879 CAD patients and 628 controls from eight separate studies were involved. The pooled odds ratio (OR) for the distribution of the 4G allele frequency of PAI-1 4G/5G gene and its corresponding 95% confidence interval (CI) was assessed by the random effect model. Results The distribution of the 4 G allele frequency was 0.61 for the CAD group and 0.51 for the control group. The association between PAI-1 4G/5G gene polymorphism and CAD in the Chinese Han population was significant under an allelic genetic model (OR = 1.70, 95% CI = 1.18 to 2.44, P = 0.004). The heterogeneity test was also significant (P<0.0001). Meta-regression was performed to explore the heterogeneity source. Among the confounding factors, the heterogeneity could be explained by the publication year (P = 0.017), study region (P = 0.014), control group sample size (P = 0.011), total sample size (P = 0.011), and ratio of the case to the control group sample size (RR) (P = 0.019). In a stratified analysis by the total sample size, significantly increased risk was only detected in subgroup 2 under an allelic genetic model (OR = 1.93, 95% CI = 1.09 to 3.35, P = 0.02). Conclusions In the Chinese Han population, PAI-1 4G/5G gene polymorphism was implied to be associated with increased CAD risk. Carriers of the 4G allele of the PAI-1 4G/5G gene might predispose to CAD. PMID:22496752

  18. PAI-1 mRNA expression and plasma level in rheumatoid arthritis: relationship with 4G/5G PAI-1 polymorphism.

    PubMed

    Muñoz-Valle, José Francisco; Ruiz-Quezada, Sandra Luz; Oregón-Romero, Edith; Navarro-Hernández, Rosa Elena; Castañeda-Saucedo, Eduardo; De la Cruz-Mosso, Ulises; Illades-Aguiar, Berenice; Leyva-Vázquez, Marco Antonio; Castro-Alarcón, Natividad; Parra-Rojas, Isela

    2012-12-01

    Rheumatoid arthritis (RA) is a chronic inflammatory disease affecting the synovial membrane, cartilage and bone. PAI-1 is a key regulator of the fibrinolytic system through which plasminogen is converted to plasmin. The plasmin activates the matrix metalloproteinase system, which is closely related with the joint damage and bone destruction in RA. The aim of this study was to investigate the relationship between 4G/5G PAI-1 polymorphism with mRNA expression and PAI-1 plasma protein levels in RA patients. 113 RA patients and 123 healthy subjects (HS) were included in the study. The 4G/5G PAI-1 polymorphism was determined by polymerase chain reaction-restriction fragment length polymorphism method; the PAI-1 mRNA expression was determined by real-time PCR; and the soluble PAI-1 (sPAI-1) levels were quantified using an ELISA kit. No significant differences in the genotype and allele frequencies of 4G/5G PAI-1 polymorphism were found between RA patients and HS. However, the 5G/5G genotype was the most frequent in both studied groups: RA (42%) and HS (44%). PAI-1 mRNA expression was slightly increased (0.67 fold) in RA patients with respect to HS (P = 0.0001). In addition, in RA patients, the 4G/4G genotype carriers showed increased PAI-1 mRNA expression (3.82 fold) versus 4G/5G and 5G/5G genotypes (P = 0.0001), whereas the sPAI-1 plasma levels did not show significant differences. Our results indicate that the 4G/5G PAI-1 polymorphism is not a marker of susceptibility in the Western Mexico. However, the 4G/4G genotype is associated with high PAI-1 mRNA expression but not with the sPAI-1 levels in RA patients.

  19. Immunocytochemical localization of the ovine immunoglobulins IgA, IgG1, IgG1A and IgG2: effect of gastro-intestinal parasitism in the sheep

    PubMed Central

    Curtain, C. C.; Anderson, N.

    1971-01-01

    A study has been made of the immunocytochemical localization of IgG1, IgG2, IgG1A and IgA in the alimentary tract and associated lymph nodes of parasitized and parasite-free sheep. No immunoglobulin-containing cells were found in the abomasal mucosa of the parasite-free sheep. On the other hand, large numbers of IgG1 and IgG1A-containing cells were found in the lamina propria and at the base of the villi of the abomasum of the parasitized sheep. IgG1, IgG1A, and IgA-containing cells were found in mucosal sections from the jejunum and ileum of both parasitized and parasite-free sheep, the number of IgG1A-containing cells being sifnificantly greater in the former than in the latter. This increase was considered to be of some importance since the IgG1A subclass appears to be involved in the allergic response of the sheep to intestinal parasites. ImagesFIG. 1FIG. 2FIG. 3FIG. 4FIG. 5FIG. 6FIG. 7 PMID:4924939

  20. The Role of PAI-1 4G/5G Promoter Polymorphism and Its Levels in the Development of Ischemic Stroke in Young Indian Population.

    PubMed

    Akhter, Mohammad Suhail; Biswas, Arijit; Abdullah, Saleh Mohammed; Behari, Madhuri; Saxena, Renu

    2017-11-01

    The plasminogen activator inhibitor-1 (PAI-1) gene has been found to be associated with the pathogenesis and progression of vascular diseases including stroke. A 4G/5G, PAI-1 gene polymorphism has been found to be associated with the plasma PAI-1 levels in different ethnic populations but results are still controversial. The aim of this study was to determine the potential association of 4G/5G polymorphism and plasma PAI-1 levels in the development of ischemic stroke (IS) in young Asian Indians. One hundred patients with IS and an equal number of age- and sex-matched controls were studied. The 4G/5G polymorphism was genotyped in the study population through allele-specific polymerase chain reaction. Plasma PAI-1 levels were evaluated using a commercial kit. The PAI-1 levels were significantly higher in patients when compared to the controls ( P = .03). The variant 4G allele for the PAI-I 4G/5G polymorphism showed both genotypic ( P = .0013, χ 2 = 10.303; odds ratio [OR] = 3.75) as well as allelic association ( P = .0004, χ 2 = 12.273; OR = 1.99) with IS. The homozygous variant 4G/4G also was found to be associated with the higher PAI-1 levels (0.005). The variant allele 4G of PAI-1 4G/5G polymorphism and higher plasma PAI-1 levels were found to be significantly associated with IS in young Asian Indians.

  1. PAI-1 4G/5G polymorphism and plasma levels association in patients with coronary artery disease.

    PubMed

    Lima, Luciana Moreira; Carvalho, Maria das Graças; Fonseca Neto, Cirilo Pereira; Garcia, José Carlos Faria; Sousa, Marinez Oliveira

    2011-12-01

    Type-1 plasminogen activator inhibitor (PAI-1) 4G/5G polymorphism may influence the PAI-1 expression. High plasma levels of PAI-1 are associated with coronary artery disease (CAD). This study investigated the influence of PAI-1 4G/5G polymorphism on plasma PAI-1 levels and its association with CAD assessed by coronary angiography. Blood sample of 35 individuals with angiographically normal coronary arteries, 31 individuals presenting mild/moderate atheromatosis, 57 individuals presenting severe atheromatosis and 38 healthy individuals (controls) were evaluated. In patients and controls, the PAI-1 4G/5G polymorphism was determined by PCR amplification using allele-specific primers. Plasma PAI-1 levels were quantified by ELISA assay (American Diagnostica). No difference was found between groups regarding age, gender and body mass index. Plasma PAI-1 levels and 4G/4G genotype frequency were significantly higher in the severe atheromatosis group compared to the other groups (p<0.001). Furthermore, patients with 4G/4G genotype (r=0.28, p<0.001) had significantly higher plasma PAI-1 levels than those with 5G/5G genotype (r=0.02, p=0.4511). In addition, in a multiple logistic regression model, adjusted for all the other variables, PAI-1 was observed to be independently associated with CAD > 70% (p<0.001). The most important finding of this study was the association between 4G/4G genotype, high plasma PAI-1 levels and coronary stenosis higher than 70% in Brazilian individuals. Whether high plasma PAI-1 levels are a decisive factor for atherosclerosis worsening or it is a consequence remains to be established.

  2. High Expression of Galectin-3 in Patients with IgG4-Related Disease: A Proteomic Approach.

    PubMed

    Salah, Adeeb; Yoshifuji, Hajime; Ito, Shinji; Kitagori, Koji; Kiso, Kaori; Yamada, Norishige; Nakajima, Toshiki; Haga, Hironori; Tsuruyama, Tatsuaki; Miyagawa-Hayashino, Aya

    2017-01-01

    Immunoglobulin G4-related disease (IgG4-RD) is a multiorgan condition manifesting itself in different forms. This study aimed to investigate protein expression profiles and to find the possible biomarker for IgG4-RD by liquid chromatography mass spectrometry (LC-MS) using tissue sections in IgG4-RD patients. Protein expression profiles in five IgG4-related pancreatitis and three normal pancreatic samples were compared using LC-MS and were validated by quantitative real-time PCR (qRT-PCR), immunoblotting, and immunohistochemistry. ELISA was employed in the serum of 20 patients with systemic IgG4-RD before and during steroid treatment. LC-MS indicated that the levels of 17 proteins were significantly higher and 12 others were significantly lower in IgG4-related pancreatitis patients compared to controls. Among these proteins, galectin-3 levels were 13-fold higher in IgG4-related pancreatitis ( P < 0.01). These results were confirmed by immunoblotting and qRT-PCR. The average number of galectin-3 + cells in various organs of IgG4-RD patients, including salivary glands, lungs, and lymph nodes, was higher than in controls. Galectin-3 was detectable in macrophages, dendritic cells, and stromal myofibroblast-like cells, but not in lymphocytes by immunofluorescence staining. Serum galectin-3 levels were higher in patients with IgG4-RD compared with healthy donors and remained high during steroid therapy. Galectin-3 was overexpressed in IgG4-RD and the levels were indirectly related to clinical activity.

  3. High Expression of Galectin-3 in Patients with IgG4-Related Disease: A Proteomic Approach

    PubMed Central

    Salah, Adeeb; Yoshifuji, Hajime; Ito, Shinji; Kitagori, Koji; Kiso, Kaori; Yamada, Norishige; Nakajima, Toshiki; Haga, Hironori; Tsuruyama, Tatsuaki

    2017-01-01

    Objectives Immunoglobulin G4-related disease (IgG4-RD) is a multiorgan condition manifesting itself in different forms. This study aimed to investigate protein expression profiles and to find the possible biomarker for IgG4-RD by liquid chromatography mass spectrometry (LC-MS) using tissue sections in IgG4-RD patients. Methods Protein expression profiles in five IgG4-related pancreatitis and three normal pancreatic samples were compared using LC-MS and were validated by quantitative real-time PCR (qRT-PCR), immunoblotting, and immunohistochemistry. ELISA was employed in the serum of 20 patients with systemic IgG4-RD before and during steroid treatment. Results LC-MS indicated that the levels of 17 proteins were significantly higher and 12 others were significantly lower in IgG4-related pancreatitis patients compared to controls. Among these proteins, galectin-3 levels were 13-fold higher in IgG4-related pancreatitis (P < 0.01). These results were confirmed by immunoblotting and qRT-PCR. The average number of galectin-3 + cells in various organs of IgG4-RD patients, including salivary glands, lungs, and lymph nodes, was higher than in controls. Galectin-3 was detectable in macrophages, dendritic cells, and stromal myofibroblast-like cells, but not in lymphocytes by immunofluorescence staining. Serum galectin-3 levels were higher in patients with IgG4-RD compared with healthy donors and remained high during steroid therapy. Conclusion Galectin-3 was overexpressed in IgG4-RD and the levels were indirectly related to clinical activity. PMID:28593065

  4. IgG4-related tubulointerstitial nephritis: A prospective analysis.

    PubMed

    Nada, Ritambhra; Ramachandran, Raja; Kumar, Ashwani; Rathi, Manish; Rawat, Amit; Joshi, Kusum; Kohli, Harbir Singh; Gupta, Krishan Lal

    2016-07-01

    Immunoglobulin-G4 (IgG4)-related tubulo-interstitial nephritis (IgG4TIN) could be the first presentation of IgG4-related systemic disease. Most of the data is from the West or Japan and retrospective, with good patient outcome. This study was carried out from April 2011 to July 2013. We report a prospective follow-up of 11 patients who presented with renal dysfunction and had histological diagnosis of IgG4TIN followed for a minimum period of 1 year or until end-stage renal disease. IgG4TIN constituted 0.28% of total renal biopsies and 6.5% of all tubulointerstitial nephritis. Patient ages ranged between 21 and 71 years with a male predominance. All the patients had renal dysfunction at presentation with a mean serum creatinine of 5.12 mg/dL. Proteinuria was subnephrotic except when there was coexisting membranous glomerulonephritis (36.4%). The mean 24-h urine protien excretion was 1.8 g. Serum IgG4 levels were elevated in 10 (90.9%) patients. Ten (90.9%) patients had renomegaly and one (9.1%) had focal renal mass. Extra-renal manifestations were present in seven (63.6%). Renal histology showed pattern A in five (45.5%), pattern B in four (36.3%) and pattern C in two (18.1%) patients. All but one patient (90.9%) received immunosuppressive therapy. Four (36.3%) achieved complete remission and three (27.2%) progressed to end stage renal disease. Two patients died due to infections while on steroid therapy. One patient with a mass had end stage renal disease for 12 months and did not improve with steroid therapy, and one (pattern C) had progressive chronic kidney disease on follow-up. IgG4TIN in an Indian cohort most often presents with rapidly progressive renal failure and less often has extra-renal organ involvement. On follow-up, patients can experience a more aggressive course with progression to end stage renal disease. © 2015 Asia Pacific League of Associations for Rheumatology and Wiley Publishing Asia Pty Ltd.

  5. Ginsenoside G-Rh2 synergizes with SMI-4a in anti-melanoma activity through autophagic cell death.

    PubMed

    Lv, Da-Lun; Chen, Lei; Ding, Wei; Zhang, Wei; Wang, He-Li; Wang, Shuai; Liu, Wen-Bei

    2018-01-01

    Melanoma is a leading cause of cancer death worldwide, and SMI-4a and G-Rh2 exert anti-tumor activity in multiple cancer. However, SMI-4a as well as a synergistic relationship between SMI-4a and G-Rh2 in anti-melanoma capacity are still unknown. Therefore, we investigated the effects of SMI-4a and combined SMI-4a with G-Rh2 on the viability, apoptosis and autophagy of melanoma, and to preliminarily explore the underlying mechanism of SMI-4a and combined SMI-4a with G-Rh2 in inhibiting tumor growth. Cell viability was examined with cell counting Kit 8 assay and colony formation assay; Apoptosis was evaluated by flow cytometry and Caspase 3/7 activity assay; Western blotting was used to test proteins related to autophagy and the AKT/mammalian target of rapamycin (mTOR) signaling pathway; Tumor xenograft model in BALB/c nude mice was performed to evaluate the effects of SMI-4a and combined SMI-4a with G-Rh2 in anti-melanoma in vivo. SMI-4a, a pharmacological inhibitor of PIM-1, could decrease cell viability, induce apoptosis, and promote Caspase 3/7 activity in both A375 and G361 melanoma cells, and SMI-4a inhibited tumor growth by inducing autophagy via down-regulating AKT/mTOR axis in melanoma cells. Furthermore, G-Rh2 amplified the anti-tumor activity of SMI-4a in melanoma cells via strengthening autophagy. Our results suggested that SMI-4a could enhance autophagy-inducing apoptosis by inhibiting AKT/mTOR signaling pathway in melanoma cells, and G-Rh2 could enhance the effects of SMI-4a against melanoma cancer via amplifying autophagy induction. This study demonstrates that combined SMI-4a and G-Rh2 might be a novel alternative strategy for melanoma treatment.

  6. Visible Light-Driven Photocatalytic Performance of N-Doped ZnO/g-C3N4 Nanocomposites.

    PubMed

    Kong, Ji-Zhou; Zhai, Hai-Fa; Zhang, Wei; Wang, Shan-Shan; Zhao, Xi-Rui; Li, Min; Li, Hui; Li, Ai-Dong; Wu, Di

    2017-09-06

    N-doped ZnO/g-C 3 N 4 composites have been successfully prepared via a facile and cost-effective sol-gel method. The nanocomposites were systematically characterized by XRD, FE-SEM, HRTEM, FT-IR, XPS, and UV-vis DRS. The results indicated that compared with the pure N-doped ZnO, the absorption edge of binary N-doped ZnO/g-C 3 N 4 shifted to a lower energy with increasing the visible-light absorption and improving the charge separation efficiency, which would enhance its photocatalytic activity. Compared with the pure g-C 3 N 4 , ZnO, N-doped ZnO and the composite ZnO/g-C 3 N 4 , the as-prepared N-doped ZnO/g-C 3 N 4 exhibits a greatly enhanced photocatalytic degradation of methylene blue and phenol under visible-light irradiation. Meanwhile, N-doped ZnO/g-C 3 N 4 possesses a high stability. Finally, a proposed mechanism for N-doped ZnO/g-C 3 N 4 is also discussed. The improved photocatalysis can be attributed to the synergistic effect between N-doped ZnO and g-C 3 N 4 , including the energy band structure and enhanced charge separation efficiency.

  7. Inhibition of G0/G1 Switch 2 Ameliorates Renal Inflammation in Chronic Kidney Disease.

    PubMed

    Matsunaga, Naoya; Ikeda, Eriko; Kakimoto, Keisuke; Watanabe, Miyako; Shindo, Naoya; Tsuruta, Akito; Ikeyama, Hisako; Hamamura, Kengo; Higashi, Kazuhiro; Yamashita, Tomohiro; Kondo, Hideaki; Yoshida, Yuya; Matsuda, Masaki; Ogino, Takashi; Tokushige, Kazutaka; Itcho, Kazufumi; Furuichi, Yoko; Nakao, Takaharu; Yasuda, Kaori; Doi, Atsushi; Amamoto, Toshiaki; Aramaki, Hironori; Tsuda, Makoto; Inoue, Kazuhide; Ojida, Akio; Koyanagi, Satoru; Ohdo, Shigehiro

    2016-11-01

    Chronic kidney disease (CKD) is a global health problem, and novel therapies to treat CKD are urgently needed. Here, we show that inhibition of G 0 /G 1 switch 2 (G0s2) ameliorates renal inflammation in a mouse model of CKD. Renal expression of chemokine (C-C motif) ligand 2 (Ccl2) was increased in response to p65 activation in the kidneys of wild-type 5/6 nephrectomy (5/6Nx) mice. Moreover, 5/6Nx Clk/Clk mice, which carry homozygous mutations in the gene encoding circadian locomotor output cycles kaput (CLOCK), did not exhibit aggravation of apoptosis or induction of F4/80-positive cells. The renal expression of G0s2 in wild-type 5/6Nx mice was important for the transactivation of Ccl2 by p65. These pathologies were ameliorated by G0s2 knockdown. Furthermore, a novel small-molecule inhibitor of G0s2 expression was identified by high-throughput chemical screening, and the inhibitor suppressed renal inflammation in 5/6Nx mice. These findings indicated that G0s2 inhibitors may have applications in the treatment of CKD. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  8. Ultrathin g-C3N4 films supported on Attapulgite nanofibers with enhanced photocatalytic performance

    NASA Astrophysics Data System (ADS)

    Xu, Yongshuai; Zhang, Lili; Yin, Minghui; Xie, Dengyu; Chen, Jiaqi; Yin, Jingzhou; Fu, Yongsheng; Zhao, Pusu; Zhong, Hui; Zhao, Yijiang; Wang, Xin

    2018-05-01

    A novel visible-light-responsive photocatalyst is fabricated by introducing g-C3N4 ultrathin films onto the surface of attapulgite (ATP) via a simple in-situ depositing technique, in which ATP was pre-grafted using (3-Glycidyloxypropyl) trimethoxysilane (KH560) as the surfactant. A combination of XRD, FT-IR, BET, XPS, UV-vis, TEM and SEM techniques are utilized to characterize the composition, morphology and optical properties of the products. The results show that with the help of KH560, g-C3N4 presented as ultrathin layer is uniformly loaded onto the surface of ATP by forming a new chemical bond (Sisbnd Osbnd C). Comparing with g-C3N4 and ATP, ATP/g-C3N4 exhibits remarkably enhanced visible-light photocatalytic activity in degradation of methyl orange (MO) because of its high surface area, appropriate band gap and the synergistic effect between g-C3N4 and ATP. To achieve the best photocatalyst, the ratio of g-C3N4 was adjusted by controlling the mass portion between ATP-KH560 and melamine (r = m (ATP-KH560)/m (melamine)). The highest decomposition rate of methyl orange (MO) was 96.06% when r = 0.5 and this degradation efficiency remained unchanged after 4 cycles, which is 10 times as that of pure g-C3N4 particles. Possible photocatalytic mechanism is presented.

  9. Synergetic effect of MoS{sub 2} and g-C{sub 3}N{sub 4} as cocatalysts for enhanced photocatalytic H{sub 2} production activity of TiO{sub 2}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yang, Xixian; Huang, Hongyu, E-mail: huanghy@ms.giec.ac.cn; Kubota, Mitsuhiro

    Highlights: • A hydrogen evolution reaction of g-C{sub 3}N{sub 4}/MoS{sub 2}/TiO{sub 2} photocatalyst was synthesized. • g-C{sub 3}N{sub 4}/MoS{sub 2}/TiO{sub 2} presents highly efficient H{sub 2} evolution without noble metals. • The effect of g-C{sub 3}N{sub 4} and MoS{sub 2} co-catalyst content in the composites was studied. • The mechanism of g-C{sub 3}N{sub 4}/MoS{sub 2}/TiO{sub 2} photocatalyst under UV–vis light was discussed. - Abstract: In this paper, we report a new g-C{sub 3}N{sub 4}/MoS{sub 2}/TiO{sub 2} composite material as a high-performance photocatalyst for H{sub 2} evolution. Without a noble-metal cocatalyst, the g-C{sub 3}N{sub 4}/MoS{sub 2}/TiO{sub 2} composite reaches a highmore » H{sub 2} production rate of 125 μmol h{sup −1} when the content of the g-C{sub 3}N{sub 4}/MoS{sub 2} cocatalyst is 1.0 wt.% and the content of g-C{sub 3}N{sub 4} in this cocatalyst is 10 wt.%. This unusual photocatalytic activity is attributed to the positive synergetic effect between the MoS{sub 2} and g-C{sub 3}N{sub 4} components in this cocatalyst, which serve as an electron collector and a source of active adsorption sites, respectively.« less

  10. Distinguishing Echinococcus granulosus sensu stricto genotypes G1 and G3 with confidence: A practical guide.

    PubMed

    Kinkar, Liina; Laurimäe, Teivi; Acosta-Jamett, Gerardo; Andresiuk, Vanessa; Balkaya, Ibrahim; Casulli, Adriano; Gasser, Robin B; González, Luis Miguel; Haag, Karen L; Zait, Houria; Irshadullah, Malik; Jabbar, Abdul; Jenkins, David J; Manfredi, Maria Teresa; Mirhendi, Hossein; M'rad, Selim; Rostami-Nejad, Mohammad; Oudni-M'rad, Myriam; Pierangeli, Nora Beatriz; Ponce-Gordo, Francisco; Rehbein, Steffen; Sharbatkhori, Mitra; Kia, Eshrat Beigom; Simsek, Sami; Soriano, Silvia Viviana; Sprong, Hein; Šnábel, Viliam; Umhang, Gérald; Varcasia, Antonio; Saarma, Urmas

    2018-06-21

    Cystic echinococcosis (CE), a zoonotic disease caused by tapeworms of the species complex Echinococcus granulosus sensu lato, represents a substantial global health and economic burden. Within this complex, E. granulosus sensu stricto (genotypes G1 and G3) is the most frequent causative agent of human CE. Currently, there is no fully reliable method for assigning samples to genotypes G1 and G3, as the commonly used mitochondrial cox1 and nad1 genes are not sufficiently consistent for the identification and differentiation of these genotypes. Thus, a new genetic assay is required for the accurate assignment of G1 and G3. Here we use a large dataset of near-complete mtDNA sequences (n = 303) to reveal the extent of genetic variation of G1 and G3 on a broad geographical scale and to identify reliable informative positions for G1 and G3. Based on extensive sampling and sequencing data, we developed a new method, that is simple and cost-effective, to designate samples to genotypes G1 and G3. We found that the nad5 is the best gene in mtDNA to differentiate between G1 and G3, and developed new primers for the analysis. Our results also highlight problems related to the commonly used cox1 and nad1. To guarantee consistent identification of G1 and G3, we suggest using the sequencing of the nad5 gene region (680 bp). This region contains six informative positions within a relatively short fragment of the mtDNA, allowing differentiation of G1 and G3 with confidence. Our method offers clear advantages over the previous ones, providing a significantly more consistent means to distinguish G1 and G3 than the commonly used cox1 and nad1. Copyright © 2018. Published by Elsevier B.V.

  11. Increased PAI-1 plasma levels and risk of death from dengue: no association with the 4G/5G promoter polymorphism

    PubMed Central

    Mairuhu, ATA; Setiati, TE; Koraka, P; Hack, CE; Leyte, A; Faradz, SMH; ten Cate, H; Brandjes, DPM; Osterhaus, ADME; Reitsma, PH; van Gorp, ECM

    2005-01-01

    Background Dengue virus infected patients have high plasminogen activator inhibitor type I (PAI-1) plasma concentrations. Whether the insertion/deletion (4G/5G) polymorphism in the promotor region of the PAI-1 gene is associated with increased PAI-1 plasma concentrations and with death from dengue is unknown. We, therefore, investigated the relationship between the 4G/5G polymorphism and PAI-1 plasma concentrations in dengue patients and risk of death from dengue. Methods A total of 194 patients admitted to the Dr. Kariadi Hospital in Semarang, Indonesia, with clinical suspected severe dengue virus infection were enrolled. Blood samples were obtained on day of admission, days 1, 2 and 7 after admission and at a 1-month follow-up visit. Plasma concentrations of PAI-1 were measured using a sandwich ELISA kit. The PAI-1 4G/5G polymorphism was typed by allele-specific PCR analysis. Results Concentrations of PAI-1 on admission and peak values of PAI-1 during admission were higher than the values measured in healthy controls. Survival was significantly worse in patients with PAI-1 concentrations in the highest tertile (at admission: OR 4.7 [95% CI 0.9–23.8], peak value during admission: OR 6.3 [95%CI 1.3–30.8]). No association was found between the PAI-1 4G/5G polymorphism, and PAI-1 plasma concentrations, dengue disease severity and mortality from dengue. Conclusion These data suggest that the 4G/5G polymorphism has no significant influence on PAI-1 concentrations in dengue virus infected patients and is not associated with the risk of death from dengue. Other factors contributing to the variability of PAI-1 plasma concentrations in patients with dengue need to be explored. PMID:16274483

  12. ZERO-G - Crippen, Robert L.

    NASA Image and Video Library

    1979-04-03

    Zero-gravity experiments in KC-135 conducted by John Young, Robert L. Crippen, Joseph Kerwin, and Margaret Seddon. 1. Kerwin, Joseph - Zero-G 2. Seddon, Margaret - Zero-G 3. Young, John - Zero-G 4. Aircraft - KC-135

  13. Efficient enhancement of ozonation performance via ZVZ immobilized g-C3N4 towards superior oxidation of micropollutants.

    PubMed

    Yuan, Xiangjuan; Qin, Wenlei; Lei, Xiaoman; Sun, Lei; Li, Qiang; Li, Dongya; Xu, Haiming; Xia, Dongsheng

    2018-08-01

    A functional organic-metal composite material zero-valent zinc immobilized graphitic carbon nitride (ZVZ-g-C 3 N 4 ) was prepared by a fast and facile two-step synthetic approach with an optimal ZVZ content of 5.4 wt%. The structure, surface morphology and chemical composition of the as-synthesized ZVZ-g-C 3 N 4 were characterized by BET surface area, XRD, FT-IR, SEM, TEM, and XPS, respectively. ZVZ-g-C 3 N 4 composite exhibited superior catalytic ozonation activity with an improvement of 61.2% on atrazine (ATZ) degradation efficiency in 1.5 min reaction, more than 12 times of the pseudo-first-order rate constant, and almost 16-fold of the R ct value obtained in O 3 /ZVZ-g-C 3 N 4 process compared to O 3 alone. Meanwhile, the ATZ degradation efficiency was gradually enhanced with increasing ZVZ-g-C 3 N 4 dosage and initial solution pH in the range from 3.0 to 9.0, and a higher amount of ATZ was degraded when the initial concentration of ATZ rose from 1 to 10 mg L -1 . The enhanced catalytic ozonation activity of ZVZ-g-C 3 N 4 is attributed to the synergistic effects among ZVZ, ZnO and g-C 3 N 4 , as well as the improved dispersibility, increased surface area, and intensive electron-transfer ascribed to the electronic and surface properties modification. The radical scavengers experiments demonstrated that O 2 - , OH, and 1 O 2 were the dominant reactive radical species in the multifunctional processes. Moreover, an empirical kinetic model was proposed to predict ATZ degradation. The results indicated that the ZVZ-g-C 3 N 4 composite was a highly efficient, recoverable, and durable catalyst, which would provide a promising alternative in catalytic ozonation. Copyright © 2018 Elsevier Ltd. All rights reserved.

  14. Comprehensive phenotypic analysis of knockout mice deficient in cyclin G1 and cyclin G2

    PubMed Central

    Ohno, Shouichi; Ikeda, Jun-ichiro; Naito, Yoko; Okuzaki, Daisuke; Sasakura, Towa; Fukushima, Kohshiro; Nishikawa, Yukihiro; Ota, Kaori; Kato, Yorika; Wang, Mian; Torigata, Kosuke; Kasama, Takashi; Uchihashi, Toshihiro; Miura, Daisaku; Yabuta, Norikazu; Morii, Eiichi; Nojima, Hiroshi

    2016-01-01

    Cyclin G1 (CycG1) and Cyclin G2 (CycG2) play similar roles during the DNA damage response (DDR), but their detailed roles remain elusive. To investigate their distinct roles, we generated knockout mice deficient in CycG1 (G1KO) or CycG2 (G2KO), as well as double knockout mice (DKO) deficient in both proteins. All knockouts developed normally and were fertile. Generation of mouse embryonic fibroblasts (MEFs) from these mice revealed that G2KO MEFs, but not G1KO or DKO MEFs, were resistant to DNA damage insults caused by camptothecin and ionizing radiation (IR) and underwent cell cycle arrest. CycG2, but not CycG1, co-localized with γH2AX foci in the nucleus after γ-IR, and γH2AX-mediated DNA repair and dephosphorylation of CHK2 were delayed in G2KO MEFs. H2AX associated with CycG1, CycG2, and protein phosphatase 2A (PP2A), suggesting that γH2AX affects the function of PP2A via direct interaction with its B’γ subunit. Furthermore, expression of CycG2, but not CycG1, was abnormal in various cancer cell lines. Kaplan–Meier curves based on TCGA data disclosed that head and neck cancer patients with reduced CycG2 expression have poorer clinical prognoses. Taken together, our data suggest that reduced CycG2 expression could be useful as a novel prognostic marker of cancer. PMID:27982046

  15. G2 Flywheel Module Design

    NASA Technical Reports Server (NTRS)

    Jensen, Ralph H.; Dever, Timothy P.

    2006-01-01

    Design of a flywheel module, designated the G2 module, is described. The G2 flywheel is a 60,000 RPM, 525 W-hr, 1 kW system designed for a laboratory environment; it will be used for component testing and system demonstrations, with the goal of applying flywheels to aerospace energy storage and integrated power and attitude control (IPACS) applications. G2 has a modular design, which allows for new motors, magnetic bearings, touchdown bearings, and rotors to be installed without a complete redesign of the system. This design process involves several engineering disciplines, and requirements are developed for the speed, energy storage, power level, and operating environment. The G2 rotor system consists of a multilayer carbon fiber rim with a titanium hub on which the other components mount, and rotordynamics analysis is conducted to ensure rigid and flexible rotor modes are controllable or outside of the operating speed range. Magnetic bearings are sized using 1-D magnetic circuit analysis and refined using 3-D finite element analysis. The G2 magnetic bearing system was designed by Texas A&M and has redundancy which allows derated operation after the loss of some components, and an existing liquid cooled two pole permanent magnet motor/generator is used. The touchdown bearing system is designed with a squeeze film damper system allowing spin down from full operating speed in case of a magnetic bearing failure. The G2 flywheel will enable module level demonstrations of component technology, and will be a key building block in system level attitude control and IPACS demonstrations.

  16. CYP2E1 immunoglobulin G4 subclass antibodies after desflurane anesthesia

    PubMed Central

    Batistaki, Chrysanthi; Michalopoulos, George; Matsota, Paraskevi; Nomikos, Tzortzis; Kalimeris, Konstantinos; Riga, Maria; Nakou, Maria; Kostopanagiotou, Georgia

    2014-01-01

    AIM: To investigate CYP2E1 IgG4 autoantibody levels and liver biochemical markers in adult patients after anesthesia with desflurane. METHODS: Forty patients who were > 18 years old and undergoing elective surgery under general anesthesia with desflurane were studied. Alpha-glutathione-S-transferase (αGST) and IgG4 antibodies against CYP2E1 were measured preoperatively and 96 h postoperatively, as well as complete blood count, prothrombin time (PT), activated partial thromboplastin time (aPTT), international normalized ratio (INR), aspartate aminotransferase (SGOT), alanine aminotransferase (SGPT), g-glutamyl-transpeptidase (gGT), alkaline phosphatase, total serum proteins, albumin and bilirubin. A separate group of 8 patients who received regional anesthesia was also studied for calibration of the methodology used for CYP2E1 IgG4 and αGST measurements. Student’s t-test and the Mann-Whitney U test were used for comparison of the continuous variables, and Fisher’s exact test was used for the categorical variables. All tests were two-tailed, with statistical significance set as P < 0.05. RESULTS: None of the patients developed postoperative liver dysfunction, and all patients were successfully discharged from the hospital. No statistically significant difference was observed regarding liver function tests (SGOT, SGPT, γGT, bilirubin, INR), αGST and CYP2E1 IgG4, before and after exposure to desflurane. After dividing patients into two subgroups based on whether or not they had received general anesthesia in the past, no significant difference in the levels of CYP2E1 IgG4 was observed at baseline or 96 h after desflurane administration (P = 0.099 and P = 0.051, respectively). Alpha-GST baseline levels and levels after the intervention also did not differ significantly between these two subgroups (P > 0.1). The mean αGST differences were statistically elevated in men by 2.15 ng/mL compared to women when adjusted for BMI, duration of anesthesia, number of times

  17. Impact of the 4G/5G polymorphism in the plasminogen activator inhibitor-1 gene on primary nephrotic syndrome.

    PubMed

    Luo, Yuezhong; Wang, Chao; Tu, Haitao

    2014-03-01

    The aim of the present study was to investigate whether the four guanosines (4G)/five guanosines (5G) polymorphism in the gene coding for plasminogen activator inhibitor-1 (PAI-1) affects the clinical features of primary nephrotic syndrome (PNS). A cohort of 200 biopsy-diagnosed PNS patients was studied, with 40 healthy subjects as controls. The PAI-1 gene polymorphism was detected by polymerase chain reaction and DNA sequencing. Associations between the PAI-1 4G/5G polymorphism and clinical features and pathological types of PNS were analyzed. The results indicated that the PAI-1 genotype distribution is significantly different between patients with PNS and healthy controls, with significantly higher numbers of the 4G/4G genotype and lower numbers of the 5G5G genotype detected in PNS patients compared to controls (both P<0.05). The frequency of the 4G allele was also significantly higher in PNS patients compared to healthy controls (P<0.01). Among the different pathological types of PNS, IgA nephropathy (IgAN) and membranous nephropathy (MN) were associated with significantly increased frequencies of the 4G/4G and 4G/5G genotypes, as well as of the 4G allele. The increased 4G frequency was also detected in patients with minimal change disease (MCD). Significantly increased international normalized ratio (INR) and prolonged activated partial thromboplastin time (APTT) were observed in 4G/4G compared to 5G/5G PNS subjects. The response to steroids was not significantly different among the three genotypes. In conclusion, the 4G allele of the PAI-1 gene appears to be associated with PNS, especially in MN and IgAN patients. These findings suggest that specific targeting may be required for the treatment of PNS patients with the 4G/4G genotype.

  18. Effects of 2.0-g 1.75-g and 1.5-g Hypergravity on Pregnancy Outcome in Rats (Rattus norvegicus)

    NASA Technical Reports Server (NTRS)

    Mills, Nicole A.; Baer, Lisa A.; Ronca, April E.

    2001-01-01

    In 1995, ten pregnant female rats were launched on the Space Shuttle (STS-70) on Gestational day(G) 11 of their 22-day pregnancy as part of the NASA/NIH.Rodent (R)2 Experiment. Following landing on G20, fetuses were harvested from half of the dams, while the remaining five dams underwent birth. Spaceflight did not interrupt pregnancy, alter litter sizes, or affect body weights or gender ratios of the fetuses or neonates. In the present study we used the NASA/NIH.R2 experimental paradigm to analyze the effects of hypergravity on pregnancy outcome. On G10, time-bred Sprague-Dawley rat dams were assigned to either G20 or Birth conditions, then further assigned to Hypergravity (HG) 2.0-g, HG 1.75-g, HG 1.5-g, Rotational Control (RC, 1.03), or Stationary Control (SC, 1.0-g) treatments. Dams were exposed to continuous centrifugation from G11 through G20, with brief daily stops for animal health checks and maintenance. For both the G20 and Birth dams, comparable litter sizes and litter gender ratios were observed across gravity conditions. However, centrifugation-exposed (HG and RC) fetuses and neonates showed significantly lower body masses (p less than 0.05) relative to SC offspring. HG 2.0-g offspring weighed significantly less than those in all other gravity conditions (p less than 0.05). The observed reductions in offspring body mass at 1.5-g and 1.75-g, can be attributed to the rotational component of centrifugation, rather than to increased gravitational load, whereas 2.0-g hypergravity exposure further exacerbated the gravity centrifugation effect on offspring body mass. Pregnant dams exposed to centrifugation weighed significantly less than SC dams (p less than 0.05), suggesting that centrifugation effects on maternal body mass may contribute to reduced size of the developing offspring. These findings are consistent with previous reports of non-pregnant adult animals suggesting that, whereas spaceflight has virtually no effect on body mass, centrifugation is

  19. Enhanced electrochemical performance from 3DG/LiFePO4/G sandwich cathode material

    NASA Astrophysics Data System (ADS)

    Du, Yahui; Tang, Yufeng; Chang, Chengkang

    2017-08-01

    In this paper, we have successfully synthesized a three dimensional graphene/LiFePO4/graphene (3DG/LFP/G) sandwich composite by an in-situ hydrothermal method, in which chemical vapor deposited 3D graphene acts as the high conductivity supporting framework, while the LiFePO4 nanoparticles are anchored onto the 3D graphene framework covered by graphene sheets. XRD and SEM results confirmed the formation of the 3DG/LFP/G sandwich composite. Cyclic Voltammetry curve of the sandwich composite shows sharper redox peaks and reduced voltage separation when compared to the reference electrodes, suggesting high specific capacity and good rate performance. Further charge/discharge measurements presented high capacity of 164 mAh g-1 at 0.2 C and 124 mAh g-1 at 10 C (75.7% of its initial capacity) for the sandwich composite, with capacity retention of 95.7% after 100 cycles, implying potential application in lithium ion battery at high rates. The EIS investigation suggests that both the electronic conductivity and the Li ion diffusion are promoted by the underlined 3D graphene framework, which is regarded as the reason for the enhanced electrochemical performance.

  20. Adaptive Antenna System for Both 4G LTE and 5G Cellular Systems

    NASA Astrophysics Data System (ADS)

    Henderson, Kendrick Q. T.

    Given the steep increase in the use of mobile communication systems, the current 4G/LTE (Long Term Evolution), cellular system will not be able to handle the increase in data. It is estimated that by 2020 the bandwidth requirements will be 10 times greater than what LTE can sustain. A new 5th generation (5G) communication system has been proposed to meet this demand. The physical layer or the antenna is the most critical part of any wireless communication systems as it is the interface between the free space medium and an electrical circuit. It sets the margin for almost all design parameters in the system such as the system noise and bandwidth. Several interactions of antennas have been proposed over the years for cellular services. These antennas are of various geometries, bandwidths, and radiation patterns with almost all having linear polarization. This thesis attempts to solve the multiple LTE antenna problem by creating a simple antenna that covers most of the LTE bands (850-2700 MHz) as well as introducing an antenna system at the 28 GHz 5G band. This allows for a greater educated hypothesis into what 5G can offer at the physical layer. The proposed concept will provide a solution to the co-existence problem of upcoming 5G wireless systems to be interoperable with existing 4G/LTE system.

  1. The −675 4G/5G Polymorphism in Plasminogen Activator Inhibitor-1 Gene Is Associated with Risk of Asthma: A Meta-Analysis

    PubMed Central

    Xiu, Qing-yu

    2012-01-01

    Background A number of studies assessed the association of −675 4G/5G polymorphism in the promoter region of plasminogen activator inhibitor (PAI)-1 gene with asthma in different populations. However, most studies reported inconclusive results. A meta-analysis was conducted to investigate the association between polymorphism in the PAI-1 gene and asthma susceptibility. Methods Databases including Pubmed, EMBASE, HuGE Literature Finder, Wanfang Database, China National Knowledge Infrastructure (CNKI) and Weipu Database were searched to find relevant studies. Odds ratios (ORs) with 95% confidence intervals (CIs) were used to assess the strength of association in the dominant model, recessive model, codominant model, and additive model. Results Eight studies involving 1817 cases and 2327 controls were included. Overall, significant association between 4G/5G polymorphism and asthma susceptibility was observed for 4G4G+4G5G vs. 5G5G (OR = 1.56, 95% CI 1.12–2.18, P = 0.008), 4G/4G vs. 4G/5G+5G/5G (OR = 1.38, 95% CI 1.06–1.80, P = 0.02), 4G/4G vs. 5G/5G (OR = 1.80, 95% CI 1.17–2.76, P = 0.007), 4G/5G vs. 5G/5G (OR = 1.40, 95% CI 1.07–1.84, P = 0.02), and 4G vs. 5G (OR = 1.35, 95% CI 1.08–1.68, P = 0.008). Conclusions This meta-analysis suggested that the −675 4G/5G polymorphism of PAI-1 gene was a risk factor of asthma. PMID:22479620

  2. Plasminogen activator inhibitor-1 4G/5G polymorphism, factor V Leiden, prothrombin mutations and the risk of VTE recurrence.

    PubMed

    Sundquist, Kristina; Wang, Xiao; Svensson, Peter J; Sundquist, Jan; Hedelius, Anna; Larsson Lönn, Sara; Zöller, Bengt; Memon, Ashfaque A

    2015-11-25

    Plasminogen-activator inhibitor (PAI)-1 is an important inhibitor of the plasminogen/plasmin system. PAI-1 levels are influenced by the 4G/5G polymorphism in the PAI-1 promoter. We investigated the relationship between the PAI-1 polymorphism and VTE recurrence, and its possible modification by factor V Leiden (FVL) and prothrombin (PTM) mutations. Patients (n=1,069) from the Malmö Thrombophilia Study were followed from discontinuation of anticoagulant treatment until diagnosis of VTE recurrence or the end of the study (maximum follow-up 9.8 years). One hundred twenty-seven patients (11.9 %) had VTE recurrence. PAI-1 was genotyped by TaqMan PCR. Cox regression analysis adjusted for age, sex and acquired risk factors of VTE showed no evidence of an association between PAI-1 genotype and risk of VTE recurrence in the study population as a whole. However, by including an interaction term in the analysis we showed that FVL but not PTM modified the effect of PAI-1 genotype: patients with the 4G allele plus FVL had a higher risk of VTE recurrence [hazard ratio (HR) =2.3, 95 % confidence interval (CI) =1.5-3.3] compared to patients with the 4G allele but no FVL (reference group) or FVL irrespective of PAI-1 genotype (HR=1.8, 95 % CI=1.3-2.5). Compared to reference group, 5G allele irrespective of FVL was associated with lower risk of VTE recurrence only when compared with 4G allele together with FVL. In conclusion, FVL has a modifying effect on PAI-1 polymorphism in relation to risk of VTE recurrence. The role of PAI-1 polymorphism as a risk factor of recurrent VTE may be FVL dependent.

  3. Contribution of cysteine residues to the structure and function of herpes simplex virus gH/gL

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cairns, Tina M.; Landsburg, Daniel J.; Charles Whitbeck, J.

    2005-02-20

    In HSV types 1 and 2, gH forms a noncovalent heterodimer with gL. Previous studies demonstrated that the first 323 amino acids of gH1 and the first 161 amino acids of gL1 are sufficient for gH/gL binding. For gL1, substitution of any of its four cysteine (C) residues (all located within the gH/gL binding region) destroyed gH binding and function. Although gH1 contains 8 cysteines in its ectodomain, gH 2 contains 7 (C3 of gH1 is replaced by arginine in gH2). We found that mutation of any of the four C-terminal cysteines led to a reduction or loss of gH/gLmore » function. Mutation of C5 or C6 in gH1 or gH2 rendered the proteins non-functional. However, substitution of C7 and/or C8 in gH1 has a definite negative impact on cell-cell fusion, although these mutations had less effect on complementation. Remarkably, all four gH1 N-terminal cysteines could be mutated simultaneously with little effect on fusion or complementation. As gH2 already lacks C3, we constructed a triple mutant (gH2-C1/2/4) which exhibited a similar phenotype. Since gH1 is known to bind gL2 and vice versa, we wondered whether binding of gH2 to the heterologous gL1 would enhance the fusion defect seen with the gH2-C2 mutant. The combination of mutant gH2-C2 with wild-type gL1 was nonfunctional in a cell-cell fusion assay. Interestingly, the reciprocal was not true, as gH1-C2 could utilize both gL1 and gL2. These findings suggest that there is a structural difference in the gH2 N-terminus as compared to gH1. We also present genetic evidence for at least one disulfide bond within gH2, between cysteines 2 and 4.« less

  4. PAI-1 4G/5G gene polymorphism is associated with angiographic patency in ST-elevation myocardial infarction patients treated with thrombolytic therapy.

    PubMed

    Ozkan, Bugra; Cagliyan, Caglar E; Elbasan, Zafer; Uysal, Onur K; Kalkan, Gulhan Y; Bozkurt, Mehmet; Tekin, Kamuran; Bozdogan, Sevcan T; Ozalp, Ozge; Duran, Mustafa; Sahin, Durmus Y; Cayli, Murat

    2012-09-01

    In this study, we examined the relationship between PAI-1 4G/5G polymorphism and patency of the infarct-related artery after thrombolysis in patients with ST-elevation myocardial infarction (STEMI). Acute STEMI patients who received thrombolytic therapy within first 12 h were included in our study. The PAI-1 4G/5G promoter region insertion/deletion polymorphism was studied from venous blood samples. Patients with the PAI-1 4G/5G gene polymorphism were included in group 1 and the others were included in group 2. Coronary angiography was performed in all patients in the first 24 h after receiving thrombolytic therapy. Thrombolysis in myocardial infarction (TIMI) 0-1 flow in the infarct-related artery was considered as 'no flow', TIMI 2 flow as 'slow flow', and TIMI 3 flow as 'normal flow'. A total of 61 patients were included in our study. Thirty patients (49.2%) were positive for the PAI-1 4G/5G gene polymorphism, whereas 31 of them (50.8%) were in the control group. There were significantly more patients with 'no flow' (14 vs. 6; P=0.02) and less patients with 'normal flow' (8 vs. 19; P=0.02) in group 1. In addition, time to thrombolytic therapy (TTT) was maximum in the 'no flow' group and minimum in the 'normal flow' group (P=0.005). In the logistic regression analysis, TTT (odds ratio: 0.9898; 95% confidence interval: 0.982-0.997; P=0.004) and the PAI-1 4G/5G gene polymorphism (odds ratio: 4.621; 95% confidence interval: 1.399-15.268; P<0.01) were found to be independently associated with post-thrombolytic 'no flow'. The PAI-1 4G/5G gene polymorphism and TTT are associated independently with 'no flow' after thrombolysis in patients with STEMI.

  5. Enhancement of acid treated g-C3N4sbnd Cu2O photocatalytic activity by PEG under visible light irradiation

    NASA Astrophysics Data System (ADS)

    Zuo, Shiyu; Xu, Haiming; Liao, Wei; Sun, Lei; Li, Qiang; Zan, Jie; Zhang, Binyang; Li, Dongya; Xia, Dongsheng

    2018-05-01

    In this study, g-C3N4sbnd Cu2O was successfully synthesized in the presence of PEG-400 surfactant via an acid treatment hydrothermal method and a high-temperature calcination method. The structures and properties of as-synthesized samples were characterized using a range of techniques, such as XPS, TEM, PL and BET. The g-C3N4sbnd Cu2O heterojunction exhibits the enhanced photocatalytic performance and high stability. It is revealed that the addition of PEG can promote the heterojunction effect of g-C3N4sbnd Cu2O, effectively improving the crystallinity and specific surface area of the photocatalyst, separation efficiency of photocarriers, and light absorption, thus enhancing the photocatalytic performance.

  6. Plasminogen activator inhibitor-1 4G/5G polymorphism and ischemic stroke risk: a meta-analysis in Chinese population.

    PubMed

    Cao, Yuezhou; Chen, Weixian; Qian, Yun; Zeng, Yanying; Liu, Wenhua

    2014-12-01

    The guanosine insertion/deletion polymorphism (4G/5G) of plasminogen activator inhibitor-1 (PAI-1) gene has been suggested as a risk factor for ischemic stroke (IS), but direct evidence from genetic association studies remains inconclusive even in Chinese population. Therefore, we performed a meta-analysis to evaluate this association. All of the relevant studies were identified from PubMed, Embase, Chinese National Knowledge Infrastructure database and Chinese Wanfang database up to September 2013. Statistical analyses were conducted with Revman 5.2 and STATA 12.0 software. Odds ratio (OR) with 95% confidence interval (CI) values were applied to evaluate the strength of the association. Heterogeneity was evaluated by Q-test and the I² statistic. The Begg's test and Egger's test were used to assess the publication bias. A significant association and a borderline association between the PAI-1 4G/5G polymorphism and IS were found under the recessive model (OR = 1.639, 95% CI = 1.136-2.364) and allelic model (OR = 1.256, 95% CI = 1.000-1.578), respectively. However, no significant association was observed under homogeneous comparison model (OR = 1.428, 95% CI = 0.914-2.233), heterogeneous comparison model (OR = 0.856, 95% CI = 0.689-1.063) and dominant model (OR = 1.036, 95% CI = 0.846-1.270). This meta-analysis suggested that 4G4G genotype of PAI-1 4G/5G polymorphism might be a risk factor for IS in the Chinese population.

  7. Facile synthesis of Fe3O4/g-C3N4/HKUST-1 composites as a novel biosensor platform for ochratoxin A.

    PubMed

    Hu, Shuisheng; Ouyang, Wenjun; Guo, Longhua; Lin, Zhenyu; Jiang, Xiaohua; Qiu, Bin; Chen, Guonan

    2017-06-15

    A fluorescent biosensor for ochratoxin A was fabricated on the basis of a new nanocomposite (Fe 3 O 4 /g-C 3 N 4 /HKUST-1 composites). Fe 3 O 4 /g-C 3 N 4 /HKUST-1 was synthesized in this work for the first time, which combined HKUST-1 with g-C 3 N 4 to improve its chemical stability. Fe 3 O 4 /g-C 3 N 4 /HKUST-1 composites have strong adsorption capacity for dye-labeled aptamer and are able to completely quench the fluorescence of the dye through the photoinduced electron transfer (PET) mechanism. In the presence of ochratoxin A (OTA), it can bind with the aptamer with high affinity, causing the releasing of the dye-labeled aptamer from the Fe 3 O 4 /g-C 3 N 4 /HKUST-1 and therefore results in the recovery of fluorescence. The fluorescence intensity of the biosensor has a linear relationship with the OTA concentration in the range of 5.0-160.0ng/mL. The LOD of sensor is 2.57ng/mL (S/N=3). This fluorescence sensor based on the Fe 3 O 4 /g-C 3 N 4 /HKUST-1 composites has been applied to detect OTA in corn with satisfying results. Copyright © 2016. Published by Elsevier B.V.

  8. Novel microwave-assisted synthesis of porous g-C3N4/SnO2 nanocomposite for solar water-splitting

    NASA Astrophysics Data System (ADS)

    Seza, A.; Soleimani, F.; Naseri, N.; Soltaninejad, M.; Montazeri, S. M.; Sadrnezhaad, S. K.; Mohammadi, M. R.; Moghadam, H. Asgari; Forouzandeh, M.; Amin, M. H.

    2018-05-01

    Highly porous nanocomposites of graphitic-carbon nitride and tin oxide (g-C3N4/SnO2) were prepared through simple pyrolysis of urea molecules under microwave irradiation. The initial amount of tin was varied in order to investigate the effect of SnO2 content on preparation and properties of the composites. The synthesized nanocomposites were well-characterized by XRD, FE-SEM, HR-TEM, BET, FTIR, XPS, DRS, and PL. A homogeneous distribution of SnO2 nanoparticles with the size of less than 10 nm on the porous C3N4 sheets could be obtained, suggesting that in-situ synthesis of SnO2 nanoparticles was responsible for the formation of g-C3N4. The process likely occurred by the aid of the large amounts of OH groups formed on the surfaces of SnO2 nanoparticles during the polycondensation reactions of tin derivatives which could facilitate the pyrolysis of urea to carbon nitride. The porous nanocomposite prepared with initial tin amount of 0.175 g had high specific surface area of 195 m2 g-1 which showed high efficiency photoelectrochemical water-splitting ability. A maximum photocurrent density of 33 μA cm-2 was achieved at an applied potential of 0.5 V when testing this nanocomposite as photo-anode in water-splitting reactions under simulated visible light irradiation, introducing it as a promising visible light photoactive material.

  9. 30 CFR 251.4 - Types of G&G activities that require permits or Notices.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... separate permit for each. (b) Scientific research. You may only conduct G&G scientific research related to... proprietary use or sale. (2) Notice. Any other G&G scientific research that you conduct related to oil, gas.... You must obtain a permit if the research activities you propose to conduct involve: (i) Using solid or...

  10. [Correlation between IgG subtypes and hematological diseases].

    PubMed

    Shao, Yuan-Yuan; Shao, Zong-Hong

    2015-02-01

    IgG is the main immunoglobulin, brings the immunolgic effects in body. The human IgG can be divided into four kinds; IgG1, IgG2, IgG3, IgG4, respectively. The structures of IgG1, IgG2, IgG3, IgG4 are different, therefore, their functions are also different. The defects, increase or imbalance of the IgG subtypes in autoimmune diseases, infectious diseases, cancer and other diseases are indicators of the immune response. IgG1, IgG2, IgG3 and IgG4 also play a different important roles in the disease progress. The analysis of IgG subtypes is beneficial to study the etiology, pathogenesis and prognosis of above menthioned deseases. This review briefly summarizes the characteristics of IgG subtypes in thrombotic thrombocytopenic purpura, autoimmune hemolytic anemia, hemophilia, lymphoma and leukemia.

  11. Effect of Radiofrequency Radiation Emitted from 2G and 3G Cell Phone on Developing Liver of Chick Embryo - A Comparative Study.

    PubMed

    D'Silva, Mary Hydrina; Swer, Rijied Thompson; Anbalagan, J; Rajesh, Bhargavan

    2017-07-01

    The increasing scientific evidence of various health hazards on exposure of Radiofrequency Radiation (RFR) emitted from both the cell phones and base stations have caused significant media attention and public discussion in recent years. The mechanism of interaction of RF fields with developing tissues of children and fetuses may be different from that of adults due to their smaller physical size and variation in tissue electromagnetic properties. The present study may provide an insight into the basic mechanisms by which RF fields interact with developing tissues in an embryo. To evaluate the possible tissue and DNA damage in developing liver of chick embryo following chronic exposure to Ultra-High Frequency/Radiofrequency Radiation (UHF/RFR) emitted from 2G and 3G cell phone. Fertilized chick embryos were incubated in four groups. Group A-experimental group exposed to 2G radiation (60 eggs), Group B- experimental group exposed to 3G radiation (60 eggs), Group C- sham exposed control group (60 eggs) and Group D- control group (48 eggs). On completion of scheduled duration, the embryos were collected and processed for routine histological studies to check structural changes in liver. The nuclear diameter and karyorrhexis changes of hepatocytes were analysed using oculometer and square reticule respectively. The liver procured from one batch of eggs from all the four groups was subjected to alkaline comet assay technique to assess DNA damage. The results were compared using one-way ANOVA test. In our study, the exposure of developing chick embryos to 2G and 3G cell phone radiations caused structural changes in liver in the form of dilated sinusoidal spaces with haemorrhage, increased vacuolations in cytoplasm, increased nuclear diameter and karyorrhexis and significantly increased DNA damage. The chronic exposure of chick embryo liver to RFR emitted from 2G and 3G cell phone resulted in various structural changes and DNA damage. The changes were more pronounced in 3

  12. Clinicopathological significance of plasminogen activator inhibitor-1 promoter 4G/5G polymorphism in breast cancer: a meta-analysis.

    PubMed

    Lee, Ju-Han; Kim, Younghye; Choi, Jung-Woo; Kim, Young-Sik

    2013-01-01

    Plasminogen activator inhibitor type 1 (PAI-1) is associated with poor prognosis in breast cancer. Transcriptional expression of the PAI-1 can be controlled by PAI-1 promoter 4G/5G polymorphism. However, the significance of PAI-1 promoter 4G/5G polymorphism in breast cancer patients is contentious. To address this controversy, we conducted a meta-analysis for the relationships between PAI-1 promoter polymorphism and clinicopathological characteristics of breast cancer. Relevant published studies were identified using a search of PubMed, Embase, and the ISI Web of Science. The effect sizes of PAI-1 promoter 4G/5G polymorphism on breast cancer risk, lymph node metastasis, histologic grade, and overall survival were calculated by odds ratio (OR) or hazard ratio. The effect sizes were combined using a random-effects model. Individuals with 4G/4G genotype had a higher risk of breast cancer than those with the combined 4G/5G and 5G/5G genotypes (OR = 1.388; p = 0.031). Breast cancer patients with the 5G/5G genotype displayed lymph node metastasis more than patients with either the combined other genotypes (OR = 1.495; p = 0.027) or with the 4G/4G genotype (OR = 1.623; p = 0.018). However, the PAI-1 promoter 4G/5G polymorphism was not associated with histological grade or overall survival. PAI-1 promoter 4G/5G polymorphism is associated with a relatively increased risk of breast cancer development and lymph node metastasis. Copyright © 2013 IMSS. Published by Elsevier Inc. All rights reserved.

  13. Rationally designed MoS2/protonated g-C3N4 nanosheet composites as photocatalysts with an excellent synergistic effect toward photocatalytic degradation of organic pollutants.

    PubMed

    Shi, Lang; Ding, Wang; Yang, Shuping; He, Zhen; Liu, Suqin

    2018-04-05

    The positively charged ultrathin g-C 3 N 4 nanosheets are prepared by ultrasonic-assisted exfoliation of the protonated g-C 3 N 4 . Compared with the protonated g-C 3 N 4 and exfoliated g-C 3 N 4 , the positively charged ultrathin g-C 3 N 4 has abundant functional groups as well as desired dispersibility in deionized water, thus it could serve as a basic building block for designing related heterojunction composites. To take a full advantage of these features, the positively charged ultrathin g-C 3 N 4 /MoS 2 composites are fabricated through a simple electrostatic adsorption and self-assembly process followed by a hydrothermal method. By loading an appropriate amount of MoS 2 on the ultrathin g-C 3 N 4 nanosheets, the as-fabricated composites exhibit considerable improvement on the photocatalytic activities toward the degradation of typical organic pollutants (i.e., methyl orange and phenol) under visible light irradiation. The composite containing 2 wt% MoS 2 shows the highest efficiency of about 96.5% for the methyl orange degradation, which is about 3.5 times and 8 times compared to those of the positively charged ultrathin g-C 3 N 4 and bulk g-C 3 N 4 , respectively. The superb photocatalytic performance benefits from the unique advantages, including richly available reaction sites, aligned energy levels between g-C 3 N 4 and the MoS 2 , and efficient electron transfer. This work opens new possibilities for the rational design and construction of the g-C 3 N 4 based composites as highly efficient and stable visible-light driven photocatalysts for the degradation of organic pollutants. Copyright © 2018 Elsevier B.V. All rights reserved.

  14. Synthesis and characterization of g-C{sub 3}N{sub 4}/Cu{sub 2}O composite catalyst with enhanced photocatalytic activity under visible light irradiation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Peng, Biyu; Zhang, Shengsen; Yang, Siyuan

    2014-08-15

    The prepared g-C{sub 3}N{sub 4}/Cu{sub 2}O composite exhibited the enhanced photocatalytic activity under visible-light irradiation due to the stronger ability in separation of electron–hole pairs, which was proven by the transient photocurrent measurement. - Highlights: • The coupled Cu{sub 2}O with g-C{sub 3}N{sub 4} of narrow-band-gap semiconductor has been designed. • g-C{sub 3}N{sub 4}/Cu{sub 2}O is prepared via an alcohol-aqueous based on chemical precipitation method. • g-C{sub 3}N{sub 4}/Cu{sub 2}O exhibits the enhanced photocatalytic activity under visible-light. • The enhanced photocatalytic activity is proven by the transient photocurrent test. • A mechanism for the visible-light-driven photocatalysis of g-C{sub 3}N{sub 4}/Cu{submore » 2}O is revealed. - Abstract: To overcome the drawback of low photocatalytic efficiency brought by electron–hole pairs recombination and narrow photo-response range, a novel g-C{sub 3}N{sub 4}/Cu{sub 2}O composite photocatalyst was designed and prepared successfully. Compared with bare Cu{sub 2}O and g-C{sub 3}N{sub 4}, the g-C{sub 3}N{sub 4}/Cu{sub 2}O composite exhibited significantly enhanced photocatalytic activity for acid orange-II (AO-II) degradation under visible light irradiation. Based on energy band positions, the mechanism of enhanced visible-light photocatalytic activity was proposed.« less

  15. Fabrication of novel ternary Au/CeO2@g-C3N4 nanocomposite: kinetics and mechanism investigation of 4-nitrophenol reduction, and benzyl alcohol oxidation

    NASA Astrophysics Data System (ADS)

    Kohantorabi, Mona; Gholami, Mohammad Reza

    2018-06-01

    Au nanoparticles supported on cerium oxide/graphitic carbon nitride (CeO2@g-C3N4) was synthesized and used as heterogeneous catalyst in redox reaction. The catalyst was characterized by different techniques such as FT-IR, XRD, FE-SEM, EDS, TEM, BET, TGA, and ICP. The as-prepared ternary nanocomposite was used as an effective catalyst for the reduction of toxic 4-nitrophenol to useful 4-aminophenol by NaBH4. The rate constant value of reduction reaction reached up to 0.106 s-1 by Au/CeO2@g-C3N4, which was 3.8, and 8.8 times higher than that of Au@CeO2 (0.028 s-1), and Au@g-C3N4 (0.012 s-1) nanocomposites, respectively. The superior catalytic performance of as-prepared catalyst in 4-NP reduction can be attributed to synergistic effect between Au nanoparticles and CeO2@g-C3N4 support, and efficient electron transfer. The reduction reaction was carried out at different temperatures, and the energy of activation ({Ea}), and thermodynamic parameters including, activation of entropy (Δ S^ ≠), enthalpy (Δ H^ ≠), and Gibbs free energy (Δ G^ ≠) were determined. Additionally, the mechanism of reaction was studied in details, and equilibrium constants of 4-NP ( K 4-NP), and {BH}4^{ - } ({K_{{BH}4^{{ - }} }}) were calculated using Langmuir-Hinshelwood model. Furthermore, this nanocomposite exhibited excellent catalytic activity in oxidation of benzyl alcohol by molecular oxygen as a green oxidant. This study revealed that the ternary Au/CeO2@g-C3N4 nanocomposite is an attractive candidate for catalytic applications.

  16. G(sup 4)FET Implementations of Some Logic Circuits

    NASA Technical Reports Server (NTRS)

    Mojarradi, Mohammad; Akarvardar, Kerem; Cristoleveanu, Sorin; Gentil, Paul; Blalock, Benjamin; Chen, Suhan

    2009-01-01

    Some logic circuits have been built and demonstrated to work substantially as intended, all as part of a continuing effort to exploit the high degrees of design flexibility and functionality of the electronic devices known as G(sup 4)FETs and described below. These logic circuits are intended to serve as prototypes of more complex advanced programmable-logicdevice-type integrated circuits, including field-programmable gate arrays (FPGAs). In comparison with prior FPGAs, these advanced FPGAs could be much more efficient because the functionality of G(sup 4)FETs is such that fewer discrete components are needed to perform a given logic function in G(sup 4)FET circuitry than are needed perform the same logic function in conventional transistor-based circuitry. The underlying concept of using G(sup 4)FETs as building blocks of programmable logic circuitry was also described, from a different perspective, in G(sup 4)FETs as Universal and Programmable Logic Gates (NPO-41698), NASA Tech Briefs, Vol. 31, No. 7 (July 2007), page 44. A G(sup 4)FET can be characterized as an accumulation-mode silicon-on-insulator (SOI) metal oxide/semiconductor field-effect transistor (MOSFET) featuring two junction field-effect transistor (JFET) gates. The structure of a G(sup 4)FET (see Figure 1) is the same as that of a p-channel inversion-mode SOI MOSFET with two body contacts on each side of the channel. The top gate (G1), the substrate emulating a back gate (G2), and the junction gates (JG1 and JG2) can be biased independently of each other and, hence, each can be used to independently control some aspects of the conduction characteristics of the transistor. The independence of the actions of the four gates is what affords the enhanced functionality and design flexibility of G(sup 4)FETs. The present G(sup 4)FET logic circuits include an adjustable-threshold inverter, a real-time-reconfigurable logic gate, and a dynamic random-access memory (DRAM) cell (see Figure 2). The configuration

  17. A porcine G9 rotavirus strain shares neutralization and VP7 phylogenetic sequence lineage 3 characteristics with contemporary human G9 rotavirus strains.

    PubMed

    Hoshino, Yasutaka; Honma, Shinjiro; Jones, Ronald W; Ross, Jerri; Santos, Norma; Gentsch, Jon R; Kapikian, Albert Z; Hesse, Richard A

    2005-02-05

    Of five globally important VP7 (G) serotypes (G1-4 and 9) of group A rotaviruses (the single most important etiologic agents of infantile diarrhea worldwide), G9 continues to attract considerable attention because of its unique natural history. Serotype G9 rotavirus was isolated from a child with diarrhea first in the United States in 1983 and subsequently in Japan in 1985. Curiously, soon after their detection, G9 rotaviruses were not detected for about a decade in both countries and then reemerged in both countries in the mid-1990s. Unexpectedly, however, such reemerged G9 strains were distinct genetically and molecularly from those isolated in the 1980s. Thus, the origin of the reemerged G9 viruses remains an enigma. Sequence analysis has demonstrated that the G9 rotavirus VP7 gene belongs to one of at least three phylogenetic lineages: lineage 1 (strains isolated in the 1980s in the United States and Japan), lineage 2 (strains first isolated in 1986 and exclusively in India thus far), and lineage 3 (strains that emerged/reemerged in the mid-1990s). Currently, lineage 3 G9 viruses are the most frequently detected G9 strains globally. We characterized a porcine rotavirus (A2 strain) isolated in the United States that was known to belong to the P[7] genotype but had not been serotyped by neutralization. The A2 strain was found to bear serotype G9 and P9 specificities as well as NSP4 [B] and subgroup I characteristics. By VP7-specific neutralization, the porcine G9 strain was more closely related to lineage 3 viruses than to lineage 1 or 2 viruses. Furthermore, by sequence analysis, the A2 VP7 was shown to belong to lineage 3 G9. These findings raise intriguing questions regarding possible explanations for the emergence of variations among the G9 strains.

  18. Synthesis, Anti-inflammatory and Antibacterial Activities of Novel Pyrazolo[4,3-g]pteridines.

    PubMed

    Abdel-Mohsen, Shawkat Ahmed; El-Emary, Talaat Ibrahim; El-Kashef, Hussein Salama

    2016-01-01

    A novel series of 6-substituted pyrazolo[3,4-g]pteridines 2-9 and pyrazolo[4,3-e][1,2,4]triazolo[1,5-c]pteridin-2(3H)-one (thione) 10 and 11 was synthesized using the starting compound 3,7-dimethyl-1-phenylpyrazolo[4',3':5,6]pyrazino[2,3-d][1,3]oxazin-5(1H)-one 2. The structure of the newly synthesized compounds was elucidated by IR, (1)H-NMR, (13)C-NMR, mass spectroscopy and elemental analyses. The anti-inflammatory activity of all the newly synthesized compounds was evaluated using the carrageenan-induced paw oedema test in rats using indomethacin as the reference drug. Compound 11 and the two derivatives 7f and 8b were the most active compounds, showing an activity comparable to indomethacin. Also, the synthesized compounds were evaluated for their antibacterial activity against Gram-positive bacteria (Staphylococcus aureus and Bacillus cereus) and Gram-negative bacteria (Escherichia coli and Pseudomonas aeruginosa) using chloramphenicol as control. The pyrazolotriazolopteridin-2-thione 11, 6-hydroxyethyl- 6a, 6-(4-nitrophenyl)-7g, and 6-(phenylamino) 8b derivatives were found to be the most active compounds against the Gram-positive species. None of them showed any activity against Gram-negative species.

  19. Synthesis and photocatalytic performance of g-C{sub 3}N{sub 4} nanosheets via liquid phase stripping

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Miao, Jilin; Xu, Guangqing; Key Laboratory of Advanced Functional Materials and Devices of Anhui Province, Hefei University of Technology, Hefei 230009

    Well dispersed g-C{sub 3}N{sub 4} nanosheets were prepared by exfoliating the bulk g-C{sub 3}N{sub 4} in concentrated sulfuric acid. Phase structures, morphologies and elemental compositions were characterized by X-ray diffractometer, scanning electron microscope, transmission electron microscope and X-ray photoelectron spectrometer, respectively. Optical absorption and photoluminescence were also used to explain the optical performances of samples. NaI, BQ and IPA were used as the sacrificial agents for studying the surface reactions in the photocatalytic process. By the precipitation of g-C{sub 3}N{sub 4} nanosheets in ethanol with different ratios between concentrated sulfuric acid and ethyl alcohol, well dispersed g-C{sub 3}N{sub 4} nanosheetsmore » with high specific surface area can be obtained. The optimized g-C{sub 3}N{sub 4} (1:10) nanosheets achieve the highest photocatalytic activities under UV light illumination, which can degrade 10 mg/L RhB about 98% in 60 min, which is 6 times that of bulk g-C{sub 3}N{sub 4} under UV light. - Graphical Abstract: The schematic diagram of photocatalysis and excellent photocatalytic performance of g-C{sub 3}N{sub 4} nanosheets. - Highlights: • Well dispersed g-C{sub 3}N{sub 4} were prepared via Liquid Phase Stripping. • The g-C{sub 3}N{sub 4} is in a sheet like structure after being exfoliated. • The g-C{sub 3}N{sub 4} nanosheets possess high photocatalytic performances.« less

  20. G2 phase-specific proteins of HeLa cells.

    PubMed Central

    Al-Bader, A A; Orengo, A; Rao, P N

    1978-01-01

    The objective of this study was to determine if HeLa cells irreversibly arrested in G2 phase of the cell cycle by a brief exposure to a nitrosourea compound were deficient in certain proteins when compared with G2-synchronized cells. Total cellular proteins of G2-synchronized, G2-arrested, and S phase-synchronized cells were compared by two-dimensional polyacrylamide gel electrophoresis. The S phase cells differed from the G2-synchronized and G2-arrested cells by the absence of about 35 and 25 protein spots, respectively, of a total of nearly 150. At least nine protein spots in the molecular weight range of 4--5 X 10(4) that were present in the G2-synchronized cells were absent in both the G2-arrested and the S phase cells. Thus, these studies suggest that the missing proteins are probably necessary for the transition of cells from G2 phase to mitosis. Supplying the missing proteins to the G2-arrested cells by fusion with G2-synchronized cells facilitated the entry of the former into mitosis. Images PMID:282623

  1. Facile synthesis of novel CaFe2O4/g-C3N4 nanocomposites for degradation of methylene blue under visible-light irradiation.

    PubMed

    Vadivel, S; Maruthamani, D; Habibi-Yangjeh, A; Paul, Bappi; Dhar, Siddhartha Sankar; Selvam, Kaliyamoorthy

    2016-10-15

    Hybrid organic/inorganic nanocomposites comprised of calcium ferrite (CaFe2O4) and graphitic carbon nitride (g-C3N4) were prepared via a simple two-step process. The hybridized CaFe2O4/g-C3N4 heterostructure was characterized by a variety of techniques, including X-ray diffraction (XRD), Fourier transform-infrared spectroscopy (FT-IR), UV-vis diffuse reflectance spectroscopy (UV-vis DRS), scanning electron microscopy (SEM), transmission electron microscopy (TEM), energy dispersive analysis of X-rays (EDS), X-ray photoelectron spectroscopy (XPS), photoluminescence spectroscopy, electrochemical impedance spectroscopy (EIS), and photoelectrochemical studies. Photocatalytic activity of the prepared samples was evaluated against degradation of methylene blue (MB) under visible-light irradiation. The photocatalytic activity of CaFe2O4 30%/g-C3N4 nanocomposite, as optimum photocatalyst, for degradation of MB was superior to the pure CaFe2O4 and g-C3N4 samples. It was demonstrated that the photogenerated holes and superoxide ion radicals were the two main reactive species towards the photocatalytic degradation of MB over the nanocomposite. Based on the experimental results, a possible photocatalytic mechanism for the MB degradation over the nanocomposite was proposed. This work may provide some inspiration for the fabrication of spinel ferrites with efficient photocatalytic performance. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Global fibrinolytic activity, PAI-1 level, and 4G/5G polymorphism in Thai children with arterial ischemic stroke.

    PubMed

    Natesirinilkul, Rungrote; Sasanakul, Werasak; Chuansumrit, Ampaiwan; Kadegasem, Praguywan; Visudtibhan, Anannit; Wongwerawattanakoon, Pakawan; Sirachainan, Nongnuch

    2014-01-01

    Prolonged euglobulin clot lysis time (ECLT) and increased level of plasminogen activator inhibitor-1 (PAI-1) were reported to be risk factors of arterial ischemic stroke (AIS) by some studies; however, these findings were not supported by other studies. The objective of this study was to determine the association of ECLT, PAI-1 level, and polymorphisms of 4G and 5G of PAI-1 gene to the development of AIS in Thai children. This study included patients aged 1-18 years old. Diagnosis of AIS was confirmed by imaging study. The control group was age- and sex-matched healthy subjects. Demographic data were recorded, and blood was tested for ECLT, PAI-1 level, lipid profiles, fasting blood sugar (FBS), and 4G and 5G polymorphisms of PAI-1 gene. There were 70 subjects participating in this study, consisting of 30 patients and 40 controls. Demographic data, lipid profiles, and FBS were similar between the 2 groups. Furthermore, ECLT and PAI-1 level did not differ between patient and control groups; however, both showed significant correlation (r = .352, P = .006). The 4G/5G polymorphism was the most common genotype in both patient and control groups (69.0% vs. 80.0%). However, 4G and 5G polymorphisms of PAI-1 gene did not correlate with PAI-1 level in this study (P = .797). The PAI-1 level and 4G/5G polymorphism may not be a risk factor of AIS in this population. It was also found that the 4G/5G polymorphism was the most common PAI-1 genotype in this study. Copyright © 2014 National Stroke Association. Published by Elsevier Inc. All rights reserved.

  3. [IgG4-related disease].

    PubMed

    González-Moreno, Juan; Losada López, Inés; Ortego Centeno, Norberto

    2015-12-21

    IgG4-related disease is a recently described clinicopathological entity showing a wide spectrum of clinical manifestations that share a common pathology. Its most characteristic feature is the formation of inflammatory tumors in different organs, which makes differentiation mainly with neoplastic diseases fundamental. The inflammatory process is typically comprised of IgG4 lymphoplasmacytic cells. The pathophysiological role of the immunoglobulin is not clear. The treatment of choice is corticosteroids. This article aims to summarize the main features of the disease. Copyright © 2015 Elsevier España, S.L.U. All rights reserved.

  4. Base-displaced intercalation of the 2-amino-3-methylimidazo[4,5-f]quinolone N2-dG adduct in the NarI DNA recognition sequence

    PubMed Central

    Stavros, Kallie M.; Hawkins, Edward K.; Rizzo, Carmelo J.; Stone, Michael P.

    2014-01-01

    2-Amino-3-methylimidazo[4,5-f]quinolone (IQ), a heterocyclic amine found in cooked meats, undergoes bioactivation to a nitrenium ion, which alkylates guanines at both the C8-dG and N2-dG positions. The conformation of a site-specific N2-dG-IQ adduct in an oligodeoxynucleotide duplex containing the iterated CG repeat restriction site of the NarI endonuclease has been determined. The IQ moiety intercalates, with the IQ H4a and CH3 protons facing the minor groove, and the IQ H7a, H8a and H9a protons facing the major groove. The adducted dG maintains the anti-conformation about the glycosyl bond. The complementary dC is extruded into the major groove. The duplex maintains its thermal stability, which is attributed to stacking between the IQ moiety and the 5′- and 3′-neighboring base pairs. This conformation is compared to that of the C8-dG-IQ adduct in the same sequence, which also formed a ‘base-displaced intercalated’ conformation. However, the C8-dG-IQ adopted the syn conformation placing the Watson−Crick edge of the modified dG into the major groove. In addition, the C8-dG-IQ adduct was oriented with the IQ CH3 group and H4a and H5a facing the major groove. These differences may lead to differential processing during DNA repair and replication. PMID:24366876

  5. Sugar-modified G-quadruplexes: effects of LNA-, 2′F-RNA– and 2′F-ANA-guanosine chemistries on G-quadruplex structure and stability

    PubMed Central

    Li, Zhe; Lech, Christopher Jacques; Phan, Anh Tuân

    2014-01-01

    G-quadruplex-forming oligonucleotides containing modified nucleotide chemistries have demonstrated promising pharmaceutical potential. In this work, we systematically investigate the effects of sugar-modified guanosines on the structure and stability of a (4+0) parallel and a (3+1) hybrid G-quadruplex using over 60 modified sequences containing a single-position substitution of 2′-O-4′-C-methylene-guanosine (LNAG), 2′-deoxy-2′-fluoro-riboguanosine (FG) or 2′-deoxy-2′-fluoro-arabinoguanosine (FANAG). Our results are summarized in two parts: (I) Generally, LNAG substitutions into ‘anti’ position guanines within a guanine-tetrad lead to a more stable G-quadruplex, while substitutions into ‘syn’ positions disrupt the native G-quadruplex conformation. However, some interesting exceptions to this trend are observed. We discover that a LNAG modification upstream of a short propeller loop hinders G-quadruplex formation. (II) A single substitution of either FG or FANAG into a ‘syn’ position is powerful enough to perturb the (3+1) G-quadruplex. Substitution of either FG or FANAG into any ‘anti’ position is well tolerated in the two G-quadruplex scaffolds. FANAG substitutions to ‘anti’ positions are better tolerated than their FG counterparts. In both scaffolds, FANAG substitutions to the central tetrad layer are observed to be the most stabilizing. The observations reported herein on the effects of LNAG, FG and FANAG modifications on G-quadruplex structure and stability will enable the future design of pharmaceutically relevant oligonucleotides. PMID:24371274

  6. Gunner's Mate G 3 and 2; Rate Training Manual. Revised.

    ERIC Educational Resources Information Center

    Naval Education and Training Command, Pensacola, FL.

    The rate training manual has been prepared for men of the regular Navy and of the Naval Reserve for the purpose of advancement to increase knowledge in the various aspects of the Gunner's Mate rating (G 3 and 2). Chapters 1 through 14 deal with the following topics: the requirements of the Gunner's Mate G Rating, explosives and pyrotechnics,…

  7. Post dural puncture headache after spinal anaesthesia for caesarean section: a comparison of 25 g Quincke, 27 g Quincke and 27 g Whitacre spinal needles.

    PubMed

    Shaikh, Jan Muhammad; Memon, Amna; Memon, Muhammad Ali; Khan, Majida

    2008-01-01

    To compare the frequency and severity of post dural puncture headache in obstetric patients using 25G Quincke, 27G Quincke and 27G Whitacre spinal needles. Comparative, randomized, double-blind, interventional study. Liaquat University Hospital Hyderabad from October 2005 to December 2006. 480 ASA I-II full term pregnant women, 18 to 45 years of age, scheduled for elective Caesarean section, under spinal anaesthesia, were randomized into three groups: Group I (25G Quincke spinal needle: n=168), Group II (27G Quincke spinal needle: n=160) and Group III (27G Whitacre spinal needle: n=152). Spinal anaesthesia was performed with 1.5-2.0 ml 0.75% hyperbaric bupivacaine using 25G Quincke spinal needle (Group I), 27G Quincke spinal needle (Group II) and 27G Whitacre spinal needle (Group III) at L3-4 inter-vertebral space. Each patient was assessed daily for four consecutive days following Caesarean section. Frequency and severity and of postdural puncture headache (PDPH) were recorded. Data were analyzed using SPSS-11. Frequency of PDPH following the use of 25G Quincke (Group I), 27G Quincke (Group II) and 27G Whitacre (Group III) spinal needles was 8.3% (14/168), 3.8% (6/160) and 2.0% (3/152) respectively. In Group I, PDPH was mild in 5 patients, moderate in 7 patients and severe in 2 patients. In Group II, it was mild in 2, moderate in 3 and severe in 1 patient. In group III, it was mild in 2 and moderate in 1 patient. Severe PDPH did not occur in Group III. Most of the patients with PDPH developed it on 1st and 2nd postoperative day. When using a 27G Whitacre spinal needle, the frequency and severity of PDPH was significantly lower than when a 25G Quincke or 27G Quincke needle was used.

  8. A historical cycle control comparison of two drospirenone-containing combined oral contraceptives: ethinylestradiol 30 μg/drospirenone 3 mg administered in a 21/7 regimen versus ethinylestradiol 20 μg/drospirenone 3 mg administered in a 24/4 regimen.

    PubMed

    Marr, Joachim; Gerlinger, Christoph; Kunz, Michael

    2012-05-01

    To compare the bleeding patterns and cycle control of an oral contraceptive (OC) containing ethinylestradiol (EE) 30 μg/drospirenone (drsp) 3mg administered in a 21/7 regimen versus a lower-dose OC containing EE 20 μg/drsp 3mg administered in a 24/4 regimen, using data from two identically designed studies. In the first study, 326 healthy women (18-35 years) received EE 30 μg/drsp 3mg in a 21/7 regimen. In the second study, 1027 healthy women (17-36 years) received EE 20 μg/drsp 3mg in a 24/4 regimen. Participants recorded bleeding using daily completed diaries over 13 treatment cycles. During cycles 1-12, the prevalence of scheduled withdrawal bleeding was lower with EE 20 μg/drsp 3mg 24/4 than with EE 30 μg/drsp 3mg 21/7 (82.0-91.7% versus 94.8-100.0% of women, respectively); moreover, a higher proportion of women reported a maximum intensity of light scheduled withdrawal bleeding with EE 20 μg/drsp 3mg 24/4 than with EE 30 μg/drsp 3mg 21/7 (30.9-39.0% versus 13.8-20.5% of women, respectively). In cycles 2-13, unscheduled intracyclic bleeding was reported by 7.7-13.8% of EE 20 μg/drsp 3mg 24/4 recipients and 3.8-7.9% of EE 30 μg/drsp 3mg 21/7 recipients; these were mainly single bleeding days. During reference periods 1-4, the mean number of bleeding episodes was similar between groups (3.1-3.3 episodes with EE 20 μg/drsp 3mg 24/4 versus 3.2 episodes with EE 30 μg/drsp 3mg 21/7). A low-dose 24/4 regimen OC containing EE 20 μg/drsp 3mg is generally comparable in terms of bleeding to a higher-dose 21/7 regimen OC containing EE30 μg/drsp 3mg. Between-treatment differences in bleeding intensity and unscheduled intracyclic bleeding rates were observed. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  9. A small subgroup of Hashimoto's thyroiditis is associated with IgG4-related disease.

    PubMed

    Jokisch, Friedrich; Kleinlein, Irene; Haller, Bernhard; Seehaus, Tanja; Fuerst, Heinrich; Kremer, Marcus

    2016-03-01

    IgG4-related disease is a newly identified syndrome characterized by high serum IgG4 levels and increased IgG4-positive plasma cells in involved organs. The incidence of IgG4-related thyroiditis in the Caucasian population of Europe is unknown. We investigated formalin-fixed thyroid gland samples of 216 patients (191 Hashimoto's thyroiditis, 5 Riedel's thyroiditis, and 20 goiters, as controls), morphologically, and immunohistochemically. Cases were divided into two groups: IgG4-related Hashimoto's thyroiditis (24 cases) together with Riedel thyroiditis (1 case) and 171 non-IgG4-related thyroiditis. Compared to the non-IgG4-related cases, IgG4-related thyroiditis showed a higher IgG4/IgG ratio (0.6 vs. 0.1, p < 0.0001), a higher median IgG4 count (45.2 vs. 6.2, p < 0.0001), an association with younger age (42.1 vs. 48.1 years, p = 0.036), and a lower female-to-male ratio (11:1 vs. 17.5:1). Fibrous variant of Hashimoto's thyroiditis was diagnosed in 23 of the 24 IgG4-related cases (96 %) and in 13 of 167 (18 %, p > 0.001) non-IgG4-related cases. The single case of IgG4-related Riedel's thyroiditis also showed a higher median IgG4 plasma cell count (56.3 vs. 14.3) and a higher IgG4/IgG ratio (0.5 vs. 0.2) than the four cases of non-IgG4-related Riedel's thyroiditis. Our data suggests the incidence of IgG4-related disease (IgG4-RD) of the thyroid gland in Europe is considerably lower than that observed in other studies. A significant elevation of IgG4-positive plasma cells was only found in a small group of Hashimoto's thyroiditis and then accompanied by intense fibrosis, indicating an association with IgG4-RD. Morphologically, IgG4-RD of the thyroid gland differs from that in other organ systems, exhibiting a dense fibrosis without intense eosinophilia or obliterative phlebitis.

  10. Ti4O7/g-C3N4 visible light photocatalytic performance on hypophosphite oxidation: Effect of annealing temperature

    NASA Astrophysics Data System (ADS)

    Guan, Wei; Sun, Gaoge; Yin, Lei; Zhang, Zhenghua; Tian, Shichao

    2018-03-01

    The oxidation of hypophosphite to phosphate is the key to recover the phosphorus resource from the hypophosphite wastewater. In the present work, Ti4O7/g-C3N4 composites were synthesized at two different temperatures (100 and 160 °C) and their performance on photocatalytic oxidation of hypophosphite under visible light irradiation and the corresponding mechanism were evaluated. A hydrolysis method using g-C3N4 and Ti4O7 was applied to synthesize the Ti4O7/g-C3N4 composites with their hybrid structure and morphology confirmed by XRD, SEM and XPS. The annealing temperature significantly affected the photocatalytic performance of Ti4O7/g-C3N4 that the 160-Ti4O7/g-C3N4 composite (fabricated at 160 °C) showed the highest oxidation efficiency of hypophosphite of 81% and the highest photocatalytic oxidation rate of 0.467 h-1 comparing with the 100-Ti4O7/g-C3N4 composite (fabricated at 100 °C) and pure g-C3N4. The enhanced photocatalytic performance of 160-Ti4O7/g-C3N4 could be ascribed to the effective charge separation and enhanced photoabsorption efficiency. Additionally, electron spin resonance (ESR) results showed that hydroxyl radicals and superoxide anion radicals were mainly responsible to the oxidation of hypophosphite with superoxide anion radicals accounting for a more significant contribution. Moreover, Ti4O7/g-C3N4 photocatalysts showed the remarkable stability in the repetitive experiments.

  11. High serum levels of allergen specific IgG-4 (asIgG-4) for common food allergens in healthy blood donors.

    PubMed

    Kruszewski, J; Raczka, A; Kłos, M; Wiktor-Jedrzejczak, W

    1994-01-01

    High serum levels of asIgG-4 against common food allergens are found in many patients with symptoms suggesting food allergy. The same patients are frequently negative for allergen specific IgE (asIgE) against the same allergens. These data were frequently interpreted as suggestive of a role of asIgG-4 in food allergy. In order to evaluate this hypothesis we tested serum levels of asIgG-4 against food allergens in young blood donors without any signs or history of food allergy. Fifty young healthy male donors were evaluated. The serum levels of IgE, and asIgE and IgG-4 against 14 common food allergens were determined. The studies were carried out using commercially available 3M Diagnostics Systems kits. AsIgG-4 against food allergens were found in sera of 92% blood donors, and in 62% of these healthy persons the levels of asIgG-4 were higher than 10.0 micrograms/ml. In a small proportion of patients, high serum levels of IgE and asIgE against the same food and/or inhalant allergens were found. Common occurrence of asIgG-4 against food allergens in healthy persons (without any symptoms which could suggest allergy or food intolerance) argues against the possible participation of these antibodies in the pathogenesis of food allergy. It is possible that their occurrence is the result of immunization against food antigens (allergens). It remains to be resolved whether the presence of these antibodies represents an epiphenomenon or may have some other biological role.

  12. High resolution spectral analysis of oxygen. I. Isotopically invariant Dunham fit for the X(3)Σ(g)(-), a(1)Δ(g), b(1)Σ(g)(+) states.

    PubMed

    Yu, Shanshan; Miller, Charles E; Drouin, Brian J; Müller, Holger S P

    2012-07-14

    We have developed a simultaneous global fit to the MW, THz, infrared, visible, and UV transitions of all six oxygen isotopologues, (16)O(16)O, (16)O(17)O, (16)O(18)O, (17)O(17)O, (17)O(18)O, (18)O(18)O, with the objective of predicting all transitions below the O((3)P) + O((3)P) dissociation threshold as well as the B(3)Σ(u) (-) state from O((3)P)+O((1)D) within state-of-the-art experimental uncertainty. Here, we report an isotopically invariant Dunham fit for the lowest three electronic states, X(3)Σ(g)(-), a(1)Δ(g), and b(1)Σ(g)(+). Experimental transition frequencies involving these three states of all six O(2) isotopologues were critically reviewed and incorporated into the analysis. For the (16)O(16)O isotopologue, experimental data sample vibrational states v = 0-31 for X(3)Σ(g)(-), v = 0-10 for a(1)Δ(g), and v = 0-12 for b(1)Σ(g)(+). To the best of our knowledge, this is the first analysis that simultaneously fits spectra from all six O(2) isotopologues.

  13. A New Classification System for IgG4 Autoantibodies

    PubMed Central

    Koneczny, Inga

    2018-01-01

    IgG4 autoimmune diseases are characterized by the presence of antigen-specific autoantibodies of the IgG4 subclass and contain well-characterized diseases such as muscle-specific kinase myasthenia gravis, pemphigus, and thrombotic thrombocytopenic purpura. In recent years, several new diseases were identified, and by now 14 antigens targeted by IgG4 autoantibodies have been described. The IgG4 subclass is considered immunologically inert and functionally monovalent due to structural differences compared to other IgG subclasses. IgG4 usually arises after chronic exposure to antigen and competes with other antibody species, thus “blocking” their pathogenic effector mechanisms. Accordingly, in the context of IgG4 autoimmunity, the pathogenicity of IgG4 is associated with blocking of enzymatic activity or protein–protein interactions of the target antigen. Pathogenicity of IgG4 autoantibodies has not yet been systematically analyzed in IgG4 autoimmune diseases. Here, we establish a modified classification system based on Witebsky’s postulates to determine IgG4 pathogenicity in IgG4 autoimmune diseases, review characteristics and pathogenic mechanisms of IgG4 in these disorders, and also investigate the contribution of other antibody entities to pathophysiology by additional mechanisms. As a result, three classes of IgG4 autoimmune diseases emerge: class I where IgG4 pathogenicity is validated by the use of subclass-specific autoantibodies in animal models and/or in vitro models of pathogenicity; class II where IgG4 pathogenicity is highly suspected but lack validation by the use of subclass specific antibodies in in vitro models of pathogenicity or animal models; and class III with insufficient data or a pathogenic mechanism associated with multivalent antigen binding. Five out of the 14 IgG4 antigens were validated as class I, five as class II, and four as class III. Antibodies of other IgG subclasses or immunoglobulin classes were present in several diseases

  14. G3 Program

    EPA Pesticide Factsheets

    The G3 initiative was designed to build a collaborative network for small to mid-sized towns and communities that are interested in adopting Green Streets to address urban stormwater, improve community health and livability, and encourage economic growth.

  15. Association between the plasminogen activator inhibitor-1 4G/5G polymorphism and risk of venous thromboembolism: a meta-analysis.

    PubMed

    Wang, Jiarong; Wang, Chengdi; Chen, Nan; Shu, Chi; Guo, Xiaojiang; He, Yazhou; Zhou, Yanhong

    2014-12-01

    The plasminogen activator inhibitor-1 (PAI-1) 4G/5G polymorphism was considered to be associated with risk of venous thromboembolism (VTE), while evidence remains inadequate. To provide a more accurate estimation of this relationship, we performed an updated meta-analysis of all eligible studies. A systematical search was performed in PubMed, EMBASE, Wanfang, China National Knowledge Infrastructure (CNKI) and Cqvip databases to identify relevant studies published before March 6(th) 2014. The odds ratios (ORs) with 95% confidence intervals (CIs) were pooled using the fixed/random-effects model using Review Manager 5.1 and STATA 12.0. A total of 34 studies with 3561 cases and 5693 controls were analyzed. Overall, significant association between the PAI-1 4G/5G variant and VTE risk in total population (dominant model: OR=1.32, 95%CI: 1.13-1.54) was observed. And this variant was also related to the deep vein thrombosis risk (dominant model: OR=1.60, 95%CI: 1.24-2.06, P=0.0003). In the subgroup analyses on ethnicity, significant results were obtained in both Asians (dominant model: OR=2.08, 95%CI: 1.29-3.35, P=0.003) and Caucasians (dominant model: OR=1.31, 95%CI: 1.10-1.56, P=0.003). However, no significant association was found in patients with provoked VTE. In terms of subgroup analyses on co-existence of other thrombotic risk factors, the PAI-1 4G/5G polymorphism was significantly associated with VTE risk in patients with factor V Leiden mutation (dominant model: OR=1.72, 95%CI: 1.17-2.53), but not in patients with cancer or surgery. Our findings demonstrate the role of PAI-1 4G/5G polymorphism being a risk candidate locus for VTE susceptibility, especially in patients with other genetic thrombophilic disorders. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. Severe congenital neutropenia resulting from G6PC3 deficiency with increased neutrophil CXCR4 expression and myelokathexis.

    PubMed

    McDermott, David H; De Ravin, Suk See; Jun, Hyun Sik; Liu, Qian; Priel, Debra A Long; Noel, Pierre; Takemoto, Clifford M; Ojode, Teresa; Paul, Scott M; Dunsmore, Kimberly P; Hilligoss, Dianne; Marquesen, Martha; Ulrick, Jean; Kuhns, Douglas B; Chou, Janice Y; Malech, Harry L; Murphy, Philip M

    2010-10-14

    Mutations in more than 15 genes are now known to cause severe congenital neutropenia (SCN); however, the pathologic mechanisms of most genetic defects are not fully defined. Deficiency of G6PC3, a glucose-6-phosphatase, causes a rare multisystem syndrome with SCN first described in 2009. We identified a family with 2 children with homozygous G6PC3 G260R mutations, a loss of enzymatic function, and typical syndrome features with the exception that their bone marrow biopsy pathology revealed abundant neutrophils consistent with myelokathexis. This pathologic finding is a hallmark of another type of SCN, WHIM syndrome, which is caused by gain-of-function mutations in CXCR4, a chemokine receptor and known neutrophil bone marrow retention factor. We found markedly increased CXCR4 expression on neutrophils from both our G6PC3-deficient patients and G6pc3(-/-) mice. In both patients, granulocyte colony-stimulating factor treatment normalized CXCR4 expression and neutrophil counts. In G6pc3(-/-) mice, the specific CXCR4 antagonist AMD3100 rapidly reversed neutropenia. Thus, myelokathexis associated with abnormally high neutrophil CXCR4 expression may contribute to neutropenia in G6PC3 deficiency and responds well to granulocyte colony-stimulating factor.

  17. Microwave modification of surface hydroxyl density for g-C3N4 with enhanced photocatalytic activity

    NASA Astrophysics Data System (ADS)

    An, Na; Zhao, Yang; Mao, Zhiyong; Agrawal, Dinesh Kumar; Wang, Dajian

    2018-03-01

    Microwave modification was performed on graphitic carbon nitride (g-C3N4) photocatalysts to tail the surface hydroxyl content for enhanced photocatalytic activity in this work. The influence of microwave heating on the surface hydroxyl density was investigated by a suite of characterization methods. The microwave treated g-C3N4 (MT-g-C3N4) delivered a higher photocatalytic activity in degradation of Rhodamine B (RhB) under visible light irradiation than pristine g-C3N4 due to its improved separation efficiency of photogenerated charge carries and promoted absorption capacity of RhB reactants on surface, which resulted from the increased surface hydroxyl density induced by microwave treatment. This study provides a simple and convenient method to modify g-C3N4 materials with enhanced photocatalytic activity for the potential application in photocatalytic elimination of environmental pollutants.

  18. KINETIC ENERGY DISTRIBUTION OF H(1s) FROM H{sub 2} X {sup 1}{Sigma}{sup +} {sub g}-a {sup 3}{Sigma}{sup +} {sub g} EXCITATION AND LIFETIMES AND TRANSITION PROBABILITIES OF a {sup 3}{Sigma}{sup +} {sub g}(v, J)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu Xianming; Johnson, Paul V.; Malone, Charles P.

    Dissociative excitation of molecular hydrogen plays an important role in the heating of outer planet upper thermospheres. This paper addresses the role of one of the triplet states involved in the process. H{sub 2} excited to the a {sup 3}{Sigma}{sup +} {sub g} state, or higher triplet-ungerade states, is dissociated via the a {sup 3}{Sigma}{sup +} {sub g}-b {sup 3}{Sigma}{sup +} {sub u} continuum. The kinetic energy distribution of H(1s) produced from direct X {sup 1}{Sigma}{sup +} {sub g}-a {sup 3}{Sigma}{sup +} {sub g}(v, J) excitation by electrons is investigated by an accurate theoretical evaluation of spontaneous transition probabilities ofmore » the a {sup 3}{Sigma}{sup +} {sub g}(v, J)-b {sup 3}{Sigma}{sup +} {sub u} continuum transition. It is shown that the X {sup 1}{Sigma}{sup +} {sub g}(0)-a {sup 3}{Sigma}{sup +} {sub g}(v, J) excitation primarily produces H(1s) atoms with kinetic energies lower than 2 eV. In addition to the continuum a {sup 3}{Sigma}{sup +} {sub g}(v, J)-b {sup 3}{Sigma}{sup +} {sub u} transition probabilities, spontaneous emission lifetimes of the a {sup 3}{Sigma}{sup +} {sub g}(v, J) (v = 0-20, J {<=} 14) levels have been calculated by considering both the a {sup 3}{Sigma}{sup +} {sub g}-b {sup 3}{Sigma}{sup +} {sub u} and a {sup 3}{Sigma}{sup +} {sub g}-c {sup 3}{Pi} {sub u} transitions. The calculated lifetimes show a moderately strong rotational dependence, and the lifetimes for the J = 0 rotational level of the low v levels agree well with previous calculations and experimental measurements. Calculations of the a {sup 3}{Sigma}{sup +} {sub g}-b {sup 3}{Sigma}{sup +} {sub u} continuum emission spectra from electron impact X {sup 1}{Sigma}{sup +} {sub g}-a {sup 3}{Sigma}{sup +} {sub g} excitation are included.« less

  19. Rotating toroids in G10.62-0.38, G19.61-0.23, and G29.96-0.02

    NASA Astrophysics Data System (ADS)

    Beltrán, M. T.; Cesaroni, R.; Neri, R.; Codella, C.

    2011-01-01

    Context. In recent years, we have detected clear evidence of rotation in more than 5 hot molecular cores (HMCs). Their identification is confirmed by the fact that the rotation axes are parallel to the axes of the associated bipolar outflows. We have now pursued our investigation by extending the sample to 3 known massive cores, G10.62-0.38, G19.61-0.23, and G29.96-0.02. Aims: We wish to make a thorough study of the structure and kinematics of HMCs and corresponding molecular outflows to reveal possible velocity gradients indicative of the rotation of the cores. Methods: We carried out PdBI observations at 2.7 and 1.4 mm of gas and dust with angular resolutions of ~2”-3” and ~1”-2”, respectively. To trace both rotation and expansion, we simultaneously observed CH3CN, a typical HMC tracer, and 13CO, a typical outflow tracer. Results: The CH3CN (12-11) observations reveal clear velocity gradients in the three HMCs oriented perpendicular to the direction of the bipolar outflows. For G19 and G29 the molecular outflows have been mapped in 13CO. The gradients are interpreted as rotating toroids. The rotation temperatures, used to derive the mass of the cores, have been obtained by means of the rotational diagram method, and lie in the range of 87-244 K. The diameters and masses of the toroids lie in the range of 4550-12600 AU and 28-415 M_⊙, respectively. Given that the dynamical masses are 2 to 30 times lower than those of the cores (if the inclination of the toroids with respect to the plane of the sky is not much below 45°), we suggest that the toroids could be accreting onto the embedded cluster. For G19 and G29, the collapse is also suggested by the redshifted absorption seen in the 13CO (2-1) line. We infer that infall onto the embedded (proto)stars must proceed with rates of ~10-2 M_⊙ yr-1 and on timescales of ~4 × 103-104 yr. The infall rates derived for G19 and G29 are two orders of magnitude greater than the accretion rates indirectly estimated

  20. Optimization of chromatographic conditions for determination of aflatoxin B1, B2, G1 and G2 by using liquid chromatography-mass Spectrometry

    NASA Astrophysics Data System (ADS)

    Ramadhaningtyas, Dillani Putri; Aryana, Nurhani; Aristiawan, Yosi; Styarini, Dyah

    2017-11-01

    The optimization of instrument condition and chromatographic separation for analysis of aflatoxin B1, B2, G1 and G2 using liquid chromatography tandem with mass spectrometer detector was conducted in the aim to provide more accurate and reliable analysis results. The aflatoxin known to be serious threat for human health as it is classified as the carcinogenic compounds. The aflatoxin B1, B2, G1 and G2 were selected due to its extensive contamination in various agricultural commodities. The best chromatographic separation was obtained using C-18 column with gradient elution of solvent 5 mM ammonium acetate and 0.1% formic acid in methanol at 7 minutes runtime analysis. The linearity of the detector showed satisfied results as the coefficient determination found to be 0.9994, 0.9996, 0.9998 and 0.9987 for aflatoxin B1, G1, B2, and G2 respectively in the range concentration from 1 to 20 ng/g. The quantifier ion selected for the aflatoxin B1, B2, G1 and G2 was m/z 285.1, 259, 243 and 313 respectively. The instrument precision at these quantifier ions also showed satisfied result with %RSD was around 3.4 to 6.8%. The optimized method present in this study can be used for further sample analysis.

  1. Ti4O7/g-C3N4 Visible Light Photocatalytic Performance on Hypophosphite Oxidation: Effect of Annealing Temperature

    PubMed Central

    Guan, Wei; Sun, Gaoge; Yin, Lei; Zhang, Zhenghua; Tian, Shichao

    2018-01-01

    The oxidation of hypophosphite to phosphate is the key to recover the phosphorus resource from the hypophosphite wastewater. In the present work, Ti4O7/g-C3N4 composites were synthesized at two different temperatures (100 and 160°C) and their performance on photocatalytic oxidation of hypophosphite under visible light irradiation and the corresponding mechanism were evaluated. A hydrolysis method using g-C3N4 and Ti4O7 was applied to synthesize the Ti4O7/g-C3N4 composites with their hybrid structure and morphology confirmed by X-ray diffraction (XRD), scanning electron microscopy (SEM), and X-ray photoelectron spectra (XPS). The annealing temperature significantly affected the photocatalytic performance of Ti4O7/g-C3N4 that the 160-Ti4O7/g-C3N4 composite (fabricated at 160°C) showed the highest oxidation efficiency of hypophosphite of 81% and the highest photocatalytic oxidation rate of 0.467 h−1 comparing with the 100-Ti4O7/g-C3N4 composite (fabricated at 100°C) and pure g-C3N4. The enhanced photocatalytic performance of 160-Ti4O7/g-C3N4 could be ascribed to the effective charge separation and enhanced photoabsorption efficiency. Additionally, electron spin resonance (ESR) results showed that hydroxyl radicals and superoxide anion radicals were mainly responsible to the oxidation of hypophosphite with superoxide anion radicals accounting for a more significant contribution. Moreover, Ti4O7/g-C3N4 photocatalysts showed the remarkable stability in the repetitive experiments. PMID:29546041

  2. Ti4O7/g-C3N4 Visible Light Photocatalytic Performance on Hypophosphite Oxidation: Effect of Annealing Temperature.

    PubMed

    Guan, Wei; Sun, Gaoge; Yin, Lei; Zhang, Zhenghua; Tian, Shichao

    2018-01-01

    The oxidation of hypophosphite to phosphate is the key to recover the phosphorus resource from the hypophosphite wastewater. In the present work, Ti 4 O 7 /g-C 3 N 4 composites were synthesized at two different temperatures (100 and 160°C) and their performance on photocatalytic oxidation of hypophosphite under visible light irradiation and the corresponding mechanism were evaluated. A hydrolysis method using g-C 3 N 4 and Ti 4 O 7 was applied to synthesize the Ti 4 O 7 /g-C 3 N 4 composites with their hybrid structure and morphology confirmed by X-ray diffraction (XRD), scanning electron microscopy (SEM), and X-ray photoelectron spectra (XPS). The annealing temperature significantly affected the photocatalytic performance of Ti 4 O 7 /g-C 3 N 4 that the 160-Ti 4 O 7 /g-C 3 N 4 composite (fabricated at 160°C) showed the highest oxidation efficiency of hypophosphite of 81% and the highest photocatalytic oxidation rate of 0.467 h -1 comparing with the 100-Ti 4 O 7 /g-C 3 N 4 composite (fabricated at 100°C) and pure g-C 3 N 4 . The enhanced photocatalytic performance of 160-Ti 4 O 7 /g-C 3 N 4 could be ascribed to the effective charge separation and enhanced photoabsorption efficiency. Additionally, electron spin resonance (ESR) results showed that hydroxyl radicals and superoxide anion radicals were mainly responsible to the oxidation of hypophosphite with superoxide anion radicals accounting for a more significant contribution. Moreover, Ti 4 O 7 /g-C 3 N 4 photocatalysts showed the remarkable stability in the repetitive experiments.

  3. Differentiating immunoglobulin g4-related sclerosing cholangitis from hilar cholangiocarcinoma.

    PubMed

    Tabata, Taku; Kamisawa, Terumi; Hara, Seiichi; Kuruma, Sawako; Chiba, Kazuro; Kuwata, Go; Fujiwara, Takashi; Egashira, Hideto; Koizumi, Koichi; Fujiwara, Junko; Arakawa, Takeo; Momma, Kumiko; Kurata, Masanao; Honda, Goro; Tsuruta, Koji; Itoi, Takao

    2013-03-01

    Few studies have differentiated immunoglobulin G (IgG) 4-related sclerosing cholangitis (IgG4-SC) from hilar cholangiocarcinoma (CC). Thus, we sought to investigate useful features for differentiating IgG4-SC from hilar CC. We retrospectively compared clinical, serological, imaging, and histological features of six patients with IgG4-SC and 42 patients with hilar CC. In patients with hilar CC, obstructive jaundice was more frequent (p<0.01), serum total bilirubin levels were significantly higher (p<0.05), serum CA19-9 levels were significantly higher (p<0.01), and serum duke pancreatic monoclonal antigen type 2 levels were frequently elevated (p<0.05). However, in patients with IgG4-SC, the serum IgG (p<0.05) and IgG4 (p<0.01) levels were significantly higher and frequently elevated. The pancreas was enlarged in all IgG4-SC patients but only in 17% of hilar CC patients (p<0.01). Salivary and/or lacrimal gland swelling was detected in only 50% of IgG4-SC patients (p<0.01). Endoscopic retrograde cholangiography revealed that the hilar or hepatic duct was completely obstructed in 83% of hilar CC patients (p<0.01). Lower bile duct stenosis, apart from hilar bile duct stenosis, was more frequent in IgG4-SC patients (p<0.01). Bile duct wall thickening in areas without stenosis was more frequent in IgG4-SC patients (p<0.01). An integrated diagnostic approach based on clinical, serological, imaging, and histological findings is necessary to differentiate IgG4-SC from hilar CC.

  4. Differentiating Immunoglobulin G4-Related Sclerosing Cholangitis from Hilar Cholangiocarcinoma

    PubMed Central

    Tabata, Taku; Hara, Seiichi; Kuruma, Sawako; Chiba, Kazuro; Kuwata, Go; Fujiwara, Takashi; Egashira, Hideto; Koizumi, Koichi; Fujiwara, Junko; Arakawa, Takeo; Momma, Kumiko; Kurata, Masanao; Honda, Goro; Tsuruta, Koji; Itoi, Takao

    2013-01-01

    Background/Aims Few studies have differentiated immunoglobulin G (IgG) 4-related sclerosing cholangitis (IgG4-SC) from hilar cholangiocarcinoma (CC). Thus, we sought to investigate useful features for differentiating IgG4-SC from hilar CC. Methods We retrospectively compared clinical, serological, imaging, and histological features of six patients with IgG4-SC and 42 patients with hilar CC. Results In patients with hilar CC, obstructive jaundice was more frequent (p<0.01), serum total bilirubin levels were significantly higher (p<0.05), serum CA19-9 levels were significantly higher (p<0.01), and serum duke pancreatic monoclonal antigen type 2 levels were frequently elevated (p<0.05). However, in patients with IgG4-SC, the serum IgG (p<0.05) and IgG4 (p<0.01) levels were significantly higher and frequently elevated. The pancreas was enlarged in all IgG4-SC patients but only in 17% of hilar CC patients (p<0.01). Salivary and/or lacrimal gland swelling was detected in only 50% of IgG4-SC patients (p<0.01). Endoscopic retrograde cholangiography revealed that the hilar or hepatic duct was completely obstructed in 83% of hilar CC patients (p<0.01). Lower bile duct stenosis, apart from hilar bile duct stenosis, was more frequent in IgG4-SC patients (p<0.01). Bile duct wall thickening in areas without stenosis was more frequent in IgG4-SC patients (p<0.01). Conclusions An integrated diagnostic approach based on clinical, serological, imaging, and histological findings is necessary to differentiate IgG4-SC from hilar CC. PMID:23560161

  5. Human placenta: relative content of antibodies of different classes and subclasses (IgG1-IgG4) containing lambda- and kappa-light chains and chimeric lambda-kappa-immunoglobulins.

    PubMed

    Lekchnov, Evgenii A; Sedykh, Sergey E; Dmitrenok, Pavel S; Buneva, Valentina N; Nevinsky, Georgy A

    2015-06-01

    The specific organ placenta is much more than a filter: it is an organ that protects, feeds and regulates the growth of the embryo. Affinity chromatography, ELISA, SDS-PAGE and matrix-assisted laser desorption ionization mass spectrometry were used. Using 10 intact human placentas deprived of blood, a quantitative analysis of average relative content [% of total immunoglobulins (Igs)] was carried out for the first time: (92.7), IgA (2.4), IgM (2.5), kappa-antibodies (51.4), lambda-antibodies (48.6), IgG1 (47.0), IgG2 (39.5), IgG3 (8.8) and IgG4 (4.3). It was shown for the first time that placenta contains sIgA (2.5%). In the classic paradigm, Igs represent products of clonal B-cell populations, each producing antibodies recognizing a single antigen. There is a common belief that IgGs in mammalian biological fluids are monovalent molecules having stable structures and two identical antigen-binding sites. However, similarly to human milk Igs, placenta antibodies undergo extensive half-molecule exchange and the IgG pool consists of 43.5 ± 15.0% kappa-kappa-IgGs and 41.6 ± 17.0% lambda-lambda-IgGs, while 15.0 ± 4.0% of the IgGs contained both kappa- and lambda-light chains. Kappa-kappa-IgGs and lambda-lambda-IgGs contained, respectively (%): IgG1 (47.7 and 34.4), IgG2 (36.3 and 44.5), IgG3 (7.4 and 11.8) and IgG4 (7.5 and 9.1), while chimeric kappa-lambda-IgGs consisted of (%): 43.5 IgG1, 41.0 IgG2, 5.6 IgG3 and 7.9 IgG4. Our data are indicative of the possibility of half-molecule exchange between placenta IgGs of various subclasses, raised against different antigens, which explains a very well-known polyspecificity and cross-reactivity of different human IgGs. © The Japanese Society for Immunology. 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  6. Plasminogen activator inhibitor-1 4G/5G and the MTHFR 677C/T polymorphisms and susceptibility to polycystic ovary syndrome: a meta-analysis.

    PubMed

    Lee, Young Ho; Song, Gwan Gyu

    2014-04-01

    The aim of this study was to explore whether the plasminogen activator inhibitor-1 (PAI-1) 4G/5G and the methylenetetrahydrofolate reductase (MTHFR) 677C/T polymorphisms are associated with susceptibility to polycystic ovary syndrome (PCOS). Meta-analyses were conducted to determine the association between the PAI-1 4G/5G and MTHFR 677C/T polymorphisms and PCOS using: (1) allele contrast (2) homozygote contrast, (3) recessive, and (4) dominant models. For meta-analysis, nine studies of the PAI-1 4G/5G polymorphism with 2384 subjects (PCOS, 1615; controls, 769) and eight studies of the MTHFR 677C/T polymorphism with 1270 study subjects were included. Meta-analysis of all study subjects showed no association between PCOS and the PAI-1 4G allele (OR=0.949, 95% CI=0.671-1.343, p=0.767). Stratification by ethnicity, however, indicated a significant association between the PAI-1 4G allele and PCOS in Turkish and Asian populations (OR=0.776, 95% CI=0.602-0.999, p=0.049; OR=1.749, 95% CI=1.297-2.359, p=2.5×10(-5) respectively). In addition, meta-analysis indicated an association between PCOS and the PAI-1 4G4G+4G5G genotype in Europeans (OR=1.406, 95% CI=1.025-1.928, p=0.035). However, meta-analysis of all study subjects showed no association between PCOS and the MTHFR 677T allele (OR=0.998, 95% CI=0.762-1.307, p=0.989), including Europeans (OR=0.806, 95% CI=0.610-1.063, p=0.126). Meta-analysis showed no association between PCOS and the MTHFR 677C/T polymorphism using homozygote contrast, and recessive and dominant models. In conclusion, meta-analysis suggests the PAI-1 4G/5G polymorphism is associated with susceptibility to PCOS in European, Turkish, and Asian populations, but the MTHFR 677C/T polymorphism is not associated with susceptibility to PCOS in Europeans. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  7. Fabrication of modified g-C3N4 nanorod/Ag3PO4 nanocomposites for solar-driven photocatalytic oxygen evolution from water splitting

    NASA Astrophysics Data System (ADS)

    Tian, Lin; Xian, Xiaozhai; Cui, Xingkai; Tang, Hua; Yang, Xiaofei

    2018-02-01

    Semiconductor-based photocatalysis has been considered as one of the most effective techniques to achieve the conversion of clean and sustainable sunlight to solar fuel, in which the construction of novel solar-driven photocatalytic systems is the key point. Here, we report initially the synthesis of modified graphitic carbon nitride (g-C3N4) nanorods via the calcination of intermediates obtained from the co-polymerization of precursors, and the in-situ hybridization of Ag3PO4 with as-prepared modified g-C3N4 to produce g-C3N4 nanorod/Ag3PO4 composite materials. The diameter of modified rod-like g-C3N4 materials is determined to be around 1 μm. Subsequently the morphological features, crystal and chemical structures of the assembled g-C3N4 nanorod/Ag3PO4 composites were systematically investigated by SEM, XRD, XPS, UV-vis diffuse reflectance spectra (DRS). Furthermore, the use of as-prepared composite materials as the catalyst for photocatalytic oxygen evolution from water splitting was studied. The oxygen-generating results showed that the composite photocatalyst modified with 600 mg rod-like g-C3N4 demonstrates 2.5 times higher efficiency than that of bulk Ag3PO4. The mechanism behind the enhancement in the oxygen-evolving activity is proposed on the basis of in-situ electron spin resonance (ESR) measurement as well as theoretical analysis. The study provides new insights into the design and development of new photocatalytic composite materials for energy and environmental applications.

  8. Value of serum IgG4 in the diagnosis of IgG4-related disease and in differentiation from rheumatic diseases and other diseases.

    PubMed

    Yamamoto, Motohisa; Tabeya, Tetsuya; Naishiro, Yasuyoshi; Yajima, Hidetaka; Ishigami, Keisuke; Shimizu, Yui; Obara, Mikiko; Suzuki, Chisako; Yamashita, Kentaro; Yamamoto, Hiroyuki; Hayashi, Toshiaki; Sasaki, Shigeru; Sugaya, Toshiaki; Ishida, Tadao; Takano, Ken-Ichi; Himi, Tetsuo; Suzuki, Yasuo; Nishimoto, Norihiro; Honda, Saho; Takahashi, Hiroki; Imai, Kohzoh; Shinomura, Yasuhisa

    2012-06-01

    IgG4-related disease (IgG4-RD) is a novel disease entity that includes Mikulicz's disease, autoimmune pancreatitis (AIP), and many other conditions. It is characterized by elevated serum IgG4 levels and abundant IgG4-bearing plasmacyte infiltration of involved organs. We postulated that high levels of serum IgG4 would comprise a useful diagnostic tool, but little information is available about IgG4 in conditions other than IgG4-RD, including rheumatic diseases. Several reports have described cutoff values for serum IgG4 when diagnosing IgG4-RD, but these studies mostly used 135 mg/dL in AIP to differentiate from pancreatic cancer instead of rheumatic and other common diseases. There is no evidence for a cutoff serum IgG4 level of 135 mg/dL for rheumatic diseases and common diseases that are often complicated with rheumatic diseases. The aim of this work was to re-evaluate the usual cutoff serum IgG4 value in AIP (135 mg/dL) that is used to diagnose whole IgG4-RD in the setting of a rheumatic clinic by measuring serum IgG4 levels in IgG4-RD and various disorders. We therefore constructed ROC curves of serum IgG4 levels in 418 patients who attended Sapporo Medical University Hospital due to IgG4-RD and various rheumatic and common disorders. The optimal cut-off value of serum IgG4 for a diagnosis of IgG4-RD was 144 mg/dL, and the sensitivity and specificity were 95.10 and 90.76%, respectively. Levels of serum IgG4 were elevated in IgG4-RD, Churg-Strauss syndrome, multicentric Castleman's disease, eosinophilic disorders, and in some patients with rheumatoid arthritis, systemic sclerosis, chronic hepatitis, and liver cirrhosis. The usual cut-off value of 135 mg/dL in AIP is useful for diagnosing whole IgG4-RD, but high levels of serum IgG4 are sometimes observed in not only IgG4-RD but also other rheumatic and common diseases.

  9. Visualizing Vpr-Induced G2 Arrest and Apoptosis

    PubMed Central

    Murakami, Tomoyuki; Aida, Yoko

    2014-01-01

    Vpr is an accessory protein of human immunodeficiency virus type 1 (HIV-1) with multiple functions. The induction of G2 arrest by Vpr plays a particularly important role in efficient viral replication because the transcriptional activity of the HIV-1 long terminal repeat is most active in G2 phase. The regulation of apoptosis by Vpr is also important for immune suppression and pathogenesis during HIV infection. However, it is not known whether Vpr-induced apoptosis depends on the ability of Vpr to induce G2 arrest, and the dynamics of Vpr-induced G2 arrest and apoptosis have not been visualized. We performed time-lapse imaging to examine the temporal relationship between Vpr-induced G2 arrest and apoptosis using HeLa cells containing the fluorescent ubiquitination-based cell cycle indicator2 (Fucci2). The dynamics of G2 arrest and subsequent long-term mitotic cell rounding in cells transfected with the Vpr-expression vector were visualized. These cells underwent nuclear mis-segregation after prolonged mitotic processes and then entered G1 phase. Some cells subsequently displayed evidence of apoptosis after prolonged mitotic processes and nuclear mis-segregation. Interestingly, Vpr-induced apoptosis was seldom observed in S or G2 phase. Likewise, visualization of synchronized HeLa/Fucci2 cells infected with an adenoviral vector expressing Vpr clearly showed that Vpr arrests the cell cycle at G2 phase, but does not induce apoptosis at S or G2 phase. Furthermore, time-lapse imaging of HeLa/Fucci2 cells expressing SCAT3.1, a caspase-3-sensitive fusion protein, clearly demonstrated that Vpr induces caspase-3-dependent apoptosis. Finally, to examine whether the effects of Vpr on G2 arrest and apoptosis were reversible, we performed live-cell imaging of a destabilizing domain fusion Vpr, which enabled rapid stabilization and destabilization by Shield1. The effects of Vpr on G2 arrest and subsequent apoptosis were reversible. This study is the first to characterize the

  10. Low doses of GM-CSF (molgramostim) and G-CSF (filgrastim) after cyclophosphamide (4 g/m2) enhance the peripheral blood progenitor cell harvest: results of two randomized studies including 120 patients

    PubMed Central

    Quittet, Philippe; Ceballos, Patrice; Lopez, Ernesto; Lu, Zhao-Yang; Latry, Pascal; Becht, Catherine; Legouffe, Eric; Fegueux, Nathalie; Exbrayat, Carole; Pouessel, Damien; Rouillé, Valérie; Daures, Jean-Pierre; Klein, Bernard; Rossi, Jean-François

    2006-01-01

    The use of a combination of G-CSF and GM-CSF to G-CSF alone, after cyclophosphamide (4g/m2) was compared in 2 randomized phase III studies, including 120 patients. In study A, 60 patients received 5 × 2 μg/kg/day of G-CSF and GM-CSF compared to 5 μg/kg/day of G-CSF. In study B, 60 patients received 2.5 × 2 μg/kg/day G-CSF and GM-CSF compared to G-CSF alone (5 μg/kg/day). With the aim to collect at least 5 × 106/kg CD34 cells in a maximum of 3 large volume leukapherisis (LK), 123 LK were performed in study A, showing significant higher number of patients reaching 10 × 106/kg CD34 cells (21/29 in G+GM-CSF arm vs 11/27 in G-CSF arm, P= .00006). In study B, 109 LK were performed, with similar results (10/27 vs 15/26, P= .003). In both the study, the total harvest of CD34 cells/kg was 2-fold higher in G-CSF plus GM-CSF group (18.3 × 106 in study A and 15.85 × 106 in study B) than in G-CSF group (9 × 106 in study A and 8.1 × 106 in study B), a difference particularly seen in multiple myeloma, with no significant difference in terms of mobilized myeloma cells between G-CSF and GM-CSF groups. PMID:16883311

  11. Noble-metal-free g-C3N4/Ni(dmgH)2 composite for efficient photocatalytic hydrogen evolution under visible light irradiation

    NASA Astrophysics Data System (ADS)

    Cao, Shao-Wen; Yuan, Yu-Peng; Barber, James; Loo, Say Chye Joachim; Xue, Can

    2014-11-01

    We report an economic photocatalytic H2 generation system consisting of earth-abundant elements only by coupling graphitic carbon nitride (g-C3N4) with Ni(dmgH)2 sub-microwires that serve as effective co-catalysts for H2 evolution. This composite photocatalyst exhibits efficient hydrogen evolution under visible-light irradiation in the presence of triethanolamine as electron donor. The optimal coupling of 3.5 wt% Ni(dmgH)2 to g-C3N4 (5 mg composite) allows for a steady H2 generation rate of 1.18 μmol/h with excellent stability. This study demonstrates that the combination of polymeric g-C3N4 semiconductor and small proportion of transition-metal-based co-catalyst could serve as a stable, earth-abundant and low-cost system for solar-to-hydrogen conversion.

  12. Sensitivity of solar g-modes to varying G cosmologies

    NASA Technical Reports Server (NTRS)

    Guenther, D. B.; Sills, Ken; Demarque, Pierre; Krauss, Lawrence M.

    1995-01-01

    The sensitivity of the solar g-mode oscillation spectrum to variability in the universal gravitational constant G is described. Solar models in varying G cosmologies were constructed by evolving a zero-age main-sequence stellar model to the Sun's current age, while allowing the value of G to change according to the power law G(t) proportional to t(exp -beta), where Beta approximately equals delta G/GH and H is the Hubble constant. All solar models were constrained to the observed luminosity and radius at the current age of the Sun by adjusting the helium abundance and the mixing-length parameter of the models in the usual way for standard stellar models. Low-l g-mode oscillation periods were calculated for each of the models and compared to the claimed observation of the solar g-mode oscillation spectrum by Hill & Gu (1990). If one accepts Hill & Gu's claims, then within the uncertainties of the physics of the solar model calculation, our models rule out all but (delta G/GH) less than approximately 0.05. In other words, we conclude that G could not have varied by more than 2% over the past 4.5 Gyr, the lifetime of the present-day Sun. This result lends independent support to the validity of the standard solar model.

  13. IgG4-Associated Cholangitis Can Mimic Hilar Cholangiocarcinoma.

    PubMed

    Zaydfudim, Victor M; Wang, Andrew Y; de Lange, Eduard E; Zhao, Zimin; Moskaluk, Christopher A; Bauer, Todd W; Adams, Reid B

    2015-07-01

    IgG4-associated cholangitis can mimic hilar cholangiocarcinoma. Previously reported patients with IgG4-associated cholangitis mimicking cholangiocarcinoma had elevated serum IgG4 levels and long-segment biliary strictures. However, in the absence of other diagnostic criteria for malignancy, IgG4-associated cholangitis should remain a consideration among patients with normal serum IgG4 and a hilar mass suspicious for cholangiocarcinoma. The presence of a hilar mass and a malignant-appearing biliary stricture in two patients with normal serum IgG4 prompted further evaluation and subsequent concomitant liver and bile duct resection and reconstruction. The diagnosis of IgG4-associated cholangitis was established during the pathologic evaluation of the resected specimens. IgG4-associated cholangitis is a known imitator of hilar cholangiocarcinoma and should be considered in the differential diagnosis even among serologically IgG4-negative patients with a hilar mass prior to operative resection.

  14. Nanocomposite of exfoliated bentonite/g-C3N4/Ag3PO4 for enhanced visible-light photocatalytic decomposition of Rhodamine B.

    PubMed

    Ma, Jianfeng; Huang, Daiqin; Zhang, Wenyi; Zou, Jing; Kong, Yong; Zhu, Jianxi; Komarneni, Sridhar

    2016-11-01

    Novel visible-light-driven heterojunction photocatalyst comprising exfoliated bentonite, g-C3N4 and Ag3PO4 (EB/g-C3N4/Ag3PO4) was synthesized by a facile and green method. The composites EB/g-C3N4/Ag3PO4 were characterized by X-ray diffraction, Transmission electron microscopy, Fourier transform infrared spectroscopy, UV-Vis diffuse reflectance spectroscopy and the Brunauer, Emmett, and Teller (BET) surface area method. Under visible light irradiation, EB/g-C3N4/Ag3PO4 composites displayed much higher photocatalytic activity than that of either pure g-C3N4 or pure Ag3PO4 in the degradation of Rhodamine B (RhB). Among the hybrid photocatalysts, EB/g-C3N4/Ag3PO4 composite containing 20 wt% Ag3PO4 exhibited the highest photocatalytic activity for the decolorization of RhB. Under the visible-light irradiation, the RhB dye was completely decolorized in less than 60 min. The enhanced photocatalytic performance is attributed to the stable structure, enlarged surface area, strong adsorbability, strong light absorption ability, and high-efficiency separation rate of photoinduced electron-hole pairs. Our finding paves a way to design highly efficient and stable visible-light-induced photocatalysts for practical applications in wastewater treatment. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Use of Single-Layer g-C3N4/Ag Hybrids for Surface-Enhanced Raman Scattering (SERS)

    PubMed Central

    Jiang, Jizhou; Zou, Jing; Wee, Andrew Thye Shen; Zhang, Wenjing

    2016-01-01

    Surface-enhanced Raman scattering (SERS) substrates with high activity and stability are desirable for SERS sensing. Here, we report a new single atomic layer graphitic-C3N4 (S-g-C3N4) and Ag nanoparticles (NPs) hybrid as high-performance SERS substrates. The SERS mechanism of the highly stable S-g-C3N4/Ag substrates was systematically investigated by a combination of experiments and theoretical calculations. From the results of XPS and Raman spectroscopies, it was found that there was a strong interaction between S-g-C3N4 and Ag NPs, which facilitates the uniform distribution of Ag NPs over the edges and surfaces of S-g-C3N4 nanosheets, and induces a charge transfer from S-g-C3N4 to the oxidizing agent through the silver surface, ultimately protecting Ag NPs from oxidation. Based on the theoretical calculations, we found that the net surface charge of the Ag atoms on the S-g-C3N4/Ag substrates was positive and the Ag NPs presented high dispersibility, suggesting that the Ag atoms on the S-g-C3N4/Ag substrates were not likely to be oxidized, thereby ensuring the high stability of the S-g-C3N4/Ag substrate. An understanding of the stability mechanism in this system can be helpful for developing other effective SERS substrates with long-term stability. PMID:27687573

  16. Serum immunoglobulin G4 levels and Graves' disease phenotype.

    PubMed

    Martin, Carmen Sorina; Sirbu, Anca Elena; Betivoiu, Minodora Andreea; Florea, Suzana; Barbu, Carmen Gabriela; Fica, Simona Vasilica

    2017-02-01

    We investigated, at diagnosis, the relationship between serum immunoglobulin G4 levels and the main characteristics of Graves' disease: hyperthyroidism severity, goiter size, presence of active Graves' ophthalmopathy, antithyroid antibodies status, and titer. This prospective study included 80 newly diagnosed Graves' disease patients. The main parameters measured at diagnosis: thyroid-stimulating hormone, free thyroxine, free triiodothyronine, total triiodothyronine, thyroglobulin, antithyroid peroxidase antibodies, anti-thyroglobulin antibodies, thyroid-stimulating hormone receptor antibodies, immunoglobulin G4. In Graves' disease patients, serum immunoglobulin G4 levels were higher than in general population (p = 0.028) and higher in men compared to women (p = 0.002). Only one female patient with intense hypoechoic goiter, high anti-thyroglobulin antibody, and antithyroid peroxidase antibody titers had an elevated serum immunoglobulin G4 level at diagnosis. Patients with immunoglobulin G4 levels above the 75th percentile (>237.52 mg/dl, N = 20) were younger at Graves' ophthalmopathy onset (p < 0.001), had higher antithyroid peroxidase antibody (p = 0.01), and anti-thyroglobulin antibody levels (p = 0.006) and required shorter duration of the first methimazole treatment cycle (p = 0.041) than patients with immunoglobulin G4 below the 75th percentile. At diagnosis, patients with immunoglobulin G4 levels above the 90th percentile (>286.28 mg/dl, N = 8) had lower total triiodothyronine values (p = 0.001) than patients with IgG below the 90th percentile. No significant correlations were found between smoking status (p = 0.58), goiter size (p = 0.50), the presence of ophthalmopathy (p = 0.42) or thyroid-stimulating hormone receptor antibody titers (p = 0.45) and the mean value of immunoglobulin G4 levels at diagnosis. Our data suggest that Graves' disease patients with elevated immunoglobulin G4 levels at

  17. 48 CFR Appendix G to Chapter 2 - [Reserved

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 48 Federal Acquisition Regulations System 3 2013-10-01 2013-10-01 false [Reserved] G Appendix G to Chapter 2 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE Appendix G to Chapter 2 [Reserved] ...

  18. 48 CFR Appendix G to Chapter 2 - [Reserved

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 48 Federal Acquisition Regulations System 3 2011-10-01 2011-10-01 false [Reserved] G Appendix G to Chapter 2 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE Appendix G to Chapter 2 [Reserved] ...

  19. 48 CFR Appendix G to Chapter 2 - [Reserved

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false [Reserved] G Appendix G to Chapter 2 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE Appendix G to Chapter 2 [Reserved] ...

  20. 48 CFR Appendix G to Chapter 2 - [Reserved

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 48 Federal Acquisition Regulations System 3 2012-10-01 2012-10-01 false [Reserved] G Appendix G to Chapter 2 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE Appendix G to Chapter 2 [Reserved] ...

  1. 48 CFR Appendix G to Chapter 2 - [Reserved

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 48 Federal Acquisition Regulations System 3 2014-10-01 2014-10-01 false [Reserved] G Appendix G to Chapter 2 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE Appendix G to Chapter 2 [Reserved] ...

  2. Fibrosing variant of Hashimoto thyroiditis is an IgG4 related disease.

    PubMed

    Deshpande, Vikram; Huck, Amelia; Ooi, Esther; Stone, John H; Faquin, William C; Nielsen, G Petur

    2012-08-01

    Hashimoto thyroiditis (HT) and the fibrosing variant of Hashimoto thyroiditis (FVHT) are immune-mediated tumefactive lesions of the thyroid. Immunoglobulin G4-related disease (IgG4-RD) is now a widely recognised multi-organ system disease characterised by elevated serum and tissue concentrations of IgG4. In this study, the authors address several unresolved questions pertaining to the relationship between HT and FVHT, and the association of each of these diseases with IgG4-RD. The authors evaluated 28 consecutive cases of HT and nine cases of FVHT. The clinical, demographic and serological data were recorded. The slides were stained immunohistochemically using antibodies to IgG4 and IgG and the quantitative analysis was recorded. Data on thyroid function tests were available on seven cases of FVHT and 14 cases of HT. Based on the availability of data, hypothyroidism was noted in 62% (9/14) of HT and 86% of FVHT (6/7). FVHT demonstrated an exaggerated lobular pattern with lobules separated by cellular storiform-type fibrosis, resembling fibrosis seen in other forms of IgG-RD. The median IgG4 counts per high power field (×40) in HT and FVHT were 2.3 and 22, respectively. The median IgG4:IgG ratios in HT and FVHT were 0.11 and 0.58, respectively. The authors propose that FVHT belongs to the spectrum of IgG4-RD. Although a proportion of cases of HT show elevated numbers of IgG4 positive plasma cells, these cases lack the histological features typically associated with IgG4-RD, and thus the relationship between HT and IgG4-RD remains unproven.

  3. Integration of g4tools in Geant4

    NASA Astrophysics Data System (ADS)

    Hřivnáčová, Ivana

    2014-06-01

    g4tools, that is originally part of the inlib and exlib packages, provides a very light and easy to install set of C++ classes that can be used to perform analysis in a Geant4 batch program. It allows to create and manipulate histograms and ntuples, and write them in supported file formats (ROOT, AIDA XML, CSV and HBOOK). It is integrated in Geant4 through analysis manager classes, thus providing a uniform interface to the g4tools objects and also hiding the differences between the classes for different supported output formats. Moreover, additional features, such as for example histogram activation or support for Geant4 units, are implemented in the analysis classes following users requests. A set of Geant4 user interface commands allows the user to create histograms and set their properties interactively or in Geant4 macros. g4tools was first introduced in the Geant4 9.5 release where its use was demonstrated in one basic example, and it is already used in a majority of the Geant4 examples within the Geant4 9.6 release. In this paper, we will give an overview and the present status of the integration of g4tools in Geant4 and report on upcoming new features.

  4. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

    PubMed

    Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

    2017-10-01

    Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

  5. Enhanced visible-light-driven photocatalytic bacteria disinfection by g-C3N4-AgBr.

    PubMed

    Deng, Jun; Liang, Jialiang; Li, Mian; Tong, Meiping

    2017-04-01

    g-C 3 N 4 -AgBr was synthesized by depositing AgBr nanoparticles onto g-C 3 N 4 . Scanning electron microscopy (SEM), Transmission electron microscope (TEM), X-ray diffraction (XRD), X-ray photoelectron spectroscopy (XPS), UV-vis diffuse reflectance spectra (DRS) and Photoluminescence (PL) spectra were employed to characterize the as-synthesized photocatalysts. The disinfection activities towards representative Gram-negative strain E. coli and Gram-positive strain S. aureus were examined under visible light irradiation. Complete inactivation of 3×10 6 CFU/mL viable cell density was reached in 60min for E. coli and 150min for S. aureus, respectively. Ag + released from the photocatalysts did not contribute to the photocatalytic disinfection process. Direct contact of g-C 3 N 4 -AgBr composites and bacterial cells, as well as the presence of O 2 was indispensable for the cell inactivation. Photo-generated holes, surface bounded OH, and indirect generation of intracellular active species played important roles in disinfection process of g-C 3 N 4 -AgBr under visible light irradiation. The disruption of outside structure of cells as well as inner cell injury led to the inactivation. High pH condition led to increasing the cell disinfection due to the generation of surface bounded OH. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Differential Decline in Leishmania Membrane Antigen-Specific Immunoglobulin G (IgG), IgM, IgE, and IgG Subclass Antibodies in Indian Kala-Azar Patients after Chemotherapy

    PubMed Central

    Anam, Khairul; Afrin, Farhat; Banerjee, Dwijadas; Pramanik, Netai; Guha, Subhasis K.; Goswami, Rama P.; Saha, Shiben K.; Ali, Nahid

    1999-01-01

    Pathogenesis in kala-azar is associated with depressed cellular immunity and significant elevation of antileishmanial antibodies. Since these antibodies are present even after cure, analysis of the parasite-specific isotypes and immunoglobulin G (IgG) subclasses in kala-azar patients may shed new light on the immune responses during progression and resolution of infection. Using leishmanial membrane antigenic extracts, we investigated the relative levels of specific IgG, IgM, IgA, IgE, and IgG subclasses in Indian kala-azar patient sera during disease, drug resistance, and cure. Acute-phase sera showed strong stimulation of IgG, followed by IgE and IgM and lastly by IgA antibodies. IgG subclass analysis revealed expression of all of the subclasses, with a predominance of IgG1 during disease. Following sodium stibogluconate (SAG) resistance, the levels of IgG, IgM, IgE, and IgG4 remained constant, while there was a decrease in the titers of IgG2 and IgG3. In contrast, a significant (2.2-fold) increase in IgG1 was observed in these individuals. Cure, in both SAG-responsive and unresponsive patients, correlated with a decline in the levels of IgG, IgM, IgE, and all of the IgG subclasses. The stimulation of IgG1 and the persistence, most importantly, of IgE and IgG4 following drug resistance, along with a decline in IgE, IgG4, and IgG1 with cure, demonstrate the potential of these isotypes as possible markers for monitoring effective treatment in kala-azar. PMID:10569788

  7. Human IgG2- and IgG4-expressing memory B cells display enhanced molecular and phenotypic signs of maturity and accumulate with age.

    PubMed

    de Jong, Britt G; IJspeert, Hanna; Marques, Lemelinda; van der Burg, Mirjam; van Dongen, Jacques Jm; Loos, Bruno G; van Zelm, Menno C

    2017-10-01

    The mechanisms involved in sequential immunoglobulin G (IgG) class switching are still largely unknown. Sequential IG class switching is linked to higher levels of somatic hypermutation (SHM) in vivo, but it remains unclear if these are generated temporally during an immune response or upon activation in a secondary response. We here aimed to uncouple these processes and to distinguish memory B cells from primary and secondary immune responses. SHM levels and IgG subclasses were studied with 454 pyrosequencing on blood mononuclear cells from young children and adults as models for primary and secondary immunological memory. Additional sequencing and detailed immunophenotyping with IgG subclass-specific antibodies was performed on purified IgG + memory B-cell subsets. In both children and adults, SHM levels were higher in transcripts involving more downstream-located IGHG genes (esp. IGHG2 and IGHG4). In adults, SHM levels were significantly higher than in children, and downstream IGHG genes were more frequently utilized. This was associated with increased frequencies of CD27 + IgG + memory B cells, which contained higher levels of SHM, more IGHG2 usage, and higher expression levels of activation markers than CD27 - IgG + memory B cells. We conclude that secondary immunological memory accumulates with age and these memory B cells express CD27, high levels of activation markers, and carry high SHM levels and frequent usage of IGHG2. These new insights contribute to our understanding of sequential IgG subclass switching and show a potential relevance of using serum IgG2 levels or numbers of IgG2-expressing B cells as markers for efficient generation of memory responses.

  8. Restraint hypothermia in cold-exposed rats at 3 G and 1 G

    NASA Technical Reports Server (NTRS)

    Monson, C. B.; Horowitz, J. M.; Horwitz, B. A.

    1982-01-01

    The relationship between heat loss, heat production, and hypothermia was investigated in experiments with rats which determined if hypergravity affects heat production by altering oxygen consumption and if restraint modifies the ability of the rats to activate thermogenic mechanisms after cold exposure in a hypergravic field. Restrained and unrestrained rats were exposed for 1 hr periods to 1 G and 3 G at ambient temperatures of 24 C or 10 C, and the rate of oxygen consumption, the core temperatures, and the tail temperatures were measured. Results show that thermoregulatory mechanisms are impaired when rats are exposed to 3 G fields, and at 24 C as well as at 10 C this impairment leads to an inappropriate increase in heat loss.

  9. Graphitic carbon nitride (g-C3N4) coated titanium oxide nanotube arrays with enhanced photo-electrochemical performance.

    PubMed

    Sun, Mingxuan; Fang, Yalin; Kong, Yuanyuan; Sun, Shanfu; Yu, Zhishui; Umar, Ahmad

    2016-08-09

    Herein, we report the successful formation of graphitic carbon nitride coated titanium oxide nanotube array thin films (g-C3N4/TiO2) via the facile thermal treatment of anodized Ti sheets over melamine. The proportion of C3N4 and TiO2 in the composite can be adjusted by changing the initial addition mass of melamine. The as-prepared samples are characterized by several techniques in order to understand the morphological, structural, compositional and optical properties. UV-vis absorption studies exhibit a remarkable red shift for the g-C3N4/TiO2 thin films as compared to the pristine TiO2 nanotubes. Importantly, the prepared composites exhibit an enhanced photocurrent and photo-potential under both UV-vis and visible light irradiation. Moreover, the observed maximum photo-conversion efficiency of the prepared composites is 1.59 times higher than that of the pristine TiO2 nanotubes. The optical and electrochemical impedance spectra analysis reveals that the better photo-electrochemical performance of the g-C3N4/TiO2 nanotubes is mainly due to the wider light absorption and reduced impedance compared to the bare TiO2 nanotube electrode. The presented work demonstrates a facile and simple method to fabricate g-C3N4/TiO2 nanotubes and clearly revealed that the introduction of g-C3N4 is a new and innovative approach to improve the photocurrent and photo-potential efficiencies of TiO2.

  10. TiO{sub 2} nanobelts with a uniform coating of g-C{sub 3}N{sub 4} as a highly effective heterostructure for enhanced photocatalytic activities

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhong, Xing; Jin, Meimei; Dong, Huaqing

    2014-12-15

    A novel g-C{sub 3}N{sub 4}/TiO{sub 2} nanobelt (NB) heterostructure was successfully designed and prepared. The as-prepared g-C{sub 3}N{sub 4}/TiO{sub 2} NB heterostructure exhibited high photocatalytic activity not only in the photodegradation of Rhodamine B (RhB) but also in photocatalytic H{sub 2} production. The g-C{sub 3}N{sub 4}/TiO{sub 2} NB heterostructure with a mass ratio of 1:1 demonstrated the best performance in the photodegradation of RhB, whereas a mass ratio of 3:1 demonstrated the highest H{sub 2} production rate of 46.6 μmol h{sup −1} in photocatalytic H{sub 2} production. We conclude that the synergistic effect between g-C{sub 3}N{sub 4} and TiO{sub 2}more » NBs promotes the photogenerated carrier separation in space. This valuable insight into the rational architectural design of nanostructure-based photocatalysts is expected to shed light on other photocatalytic reaction systems in the future. - Graphical abstract: A novel strategy to fabricate the g-C{sub 3}N{sub 4}/TiO{sub 2} nanobelt (NB) heterostructures was reported. The g-C{sub 3}N{sub 4}/TiO{sub 2} NB heterostructures exhibited highly effective photocatalytic activities for photodegradation of Rhodamine B and H{sub 2} production. - Highlights: • A novel strategy to fabricate the g-C{sub 3}N{sub 4}/TiO{sub 2} NB heterostructures was reported. • The heterostructure exhibited high catalytic activity in photodegradation of RhB. • The heterostructure showed good H{sub 2} productivity in photocatalytic water splitting. • The synergistic effect between g-C{sub 3}N{sub 4} and TiO{sub 2} NBs are important. • This study shows that the heterostructure can be an effective photocatalyst.« less

  11. Facile approach to synthesis the curly leaf-like Nano-sheets of g-C3N4 with enhanced photocatalytic ability

    NASA Astrophysics Data System (ADS)

    Zhao, Zhiren; Li, Kebin; Muhmood, Tahir; Xia, Mingzhu; Wang, Fengyun

    2018-03-01

    Exfoliation of porous g-C3N4 has been proved a very effective way to prepare g-C3N4 nanosheets (2D layered materials). Here, we present an environment-friendly, high-efficiency and easy scale-up preparation method of curly leaf-like g-C3N4 nanosheets (CL-CN) by liquid-phase exfoliation of honeycomb-like porous g-C3N4 (HP-CN). Two-dimensional curly nanosheets have induced excellent physicochemical properties, i.e. large surface area, high fluorescence quantum efficiency, wide band gap and good water-dispersibility. The photocatalytic performance of CL-CN in degradation of RhB under visible light is much better than that of honeycomb-like porous g-C3N4 and bulk g-C3N4. The improved photocatalytic performance of CL-CN is well explained by the improved physicochemical properties and photocatalytic mechanism. In addition, CL-CN being a 2D layered material with excellent photoluminescence characteristic and non-toxic behavior can be widely applied in bio-medicine, bio-imaging and biosensors field.

  12. Degradation of trichloroethylene by Pseudomonas cepacia G4 and the constitutive mutant strain G4 5223 PR1 in aquifer microcosms

    USGS Publications Warehouse

    Krumme, M.L.; Timmis, K.N.; Dwyer, D.F.

    1993-01-01

    Pseudomonas cepacia G4 degrades trichloroethylene (TCE) via a degradation pathway for aromatic compounds which is induced by substrates such as phenol and tryptophan. P. cepacia G4 5223 PR1 (PR1) is a Tn5 insertion mutant which constitutively expresses the toluene ortho-monooxygenase responsible for TCE degradation. In groundwater microcosms, phenol-induced strain G4 and noninduced strain PR1 degraded TCE (20 and 50 microM) to nondetectable levels (< 0.1 microM) within 24 h at densities of 10(8) cells per ml; at lower densities, degradation of TCE was not observed after 48 h. In aquifer sediment microcosms, TCE was reduced from 60 to < 0.1 microM within 24 h at 5 x 10(8) PR1 organisms per g (wet weight) of sediment and from 60 to 26 microM over a period of 10 weeks at 5 x 10(7) PR1 organisms per g. Viable G4 and PR1 cells decreased from approximately 10(7) to 10(4) per g over the 10-week period.

  13. VizieR Online Data Catalog: ISOCAM survey of Serpens/G3-G6 (Djupvik+, 2006)

    NASA Astrophysics Data System (ADS)

    Djupvik, A. A.; Andre, P.; Bontemps, S.; Motte, F.; Olofsson, G.; Gaalfalk, M.; Floren, H.-G.

    2006-08-01

    We present results from an ISOCAM survey in the two broadband filters LW2 (5-8.5um) and LW3 (12-18um) of a 19'x16' field called Serp_NH3 centred on the optical group Serpens/G3-G6. A total of 186 sources were detected in the 6.7um band and/or the 14.3um band to a limiting sensitivity of ~2mJy. These have been cross-correlated with the 2MASS catalogue and are all listed in table1. Deep follow-up photometry in the Ks band obtained with Arnica at the Nordic Optical Telescope (NOT) is listed in table2. Deep L' band photometry of selected sources using SIRCA at the NOT is listed in table3. Continuum emission at 1.3mm and 3.6cm was observed with IRAM and VLA, respectively, and deep imaging in the 2.12um S(1) line of H2 was obtained with NOTCam at the NOT. We find strong evidence for a stellar population of 31 Class II sources (listed in table5), 5 flat-spectrum sources, 5 Class I sources (listed in table4), and two Class 0 sources. Our method does not sample the Class III sources. (3 data files).

  14. APOBEC3G levels predict rates of progression to AIDS.

    PubMed

    Jin, Xia; Wu, Hulin; Smith, Harold

    2007-03-20

    APOBEC3G (hA3G) is a newly discovered cellular factor of innate immunity that inhibits HIV replication in vitro. Whether hA3G confers protection against HIV in vivo is not known. To investigate the possible anti-HIV activity of hA3G in vivo, we examined hA3G mRNA abundance in primary human cells isolated from either HIV-infected or HIV-uninfected individuals, and found that hA3G mRNA levels follow a hierarchical order of long-term nonprogressors>HIV-uninfected>Progressors; and, hA3G mRNA abundance is correlated with surrogates of HIV disease progression: viral load and CD4 count. Another group later confirmed that HIV-infected subjects have lower hA3G mRNA levels than HIV-uninfected controls, but did not find correlations between hA3G mRNA levels and viral load or CD4 count. These conflicting results indicate that a more comprehensive, conclusive investigation of hA3G expression levels in various patient cohorts is urgently needed. For exploring whether hA3G abundance might influence HIV disease progression, we have formulated a hypothesis that includes two parts: a) in vivo, the basal hA3G mRNA expression level per PBMC is a constant--with minor physiologic fluctuations--determined by host genetic and epigenetic elements in a healthy individual; and that the basal hA3G mRNA expression levels in a population follow a Normal (or Gaussian) distribution; b) that although HIV infects randomly, it results in more rapid disease progression in those with lower hA3G mRNA levels, and slower disease progression in those with higher hA3G mRNA levels. This hypothesis could be tested by a straight forward set of experiments to compare the distribution of hA3G mRNA levels in HIV-uninfected healthy individuals and that in HIV-infected, antiretroviral therapy-naïve subjects who are at early and late stages of infection. Testing this hypothesis will have significant implications for biomedical research. a) It will link hA3G to the mechanisms underlying slower disease progression

  15. Preparation of MoO2/g-C3N4 composites with a high surface area and its application in deep desulfurization from model oil

    NASA Astrophysics Data System (ADS)

    Hou, Liang-pei; Zhao, Rong-xiang; Li, Xiu-ping; Gao, Xiao-han

    2018-03-01

    A series of catalysts of composition X-MoO2/g-C3N4 (X = 0, 0.5, 1, 3, 5 wt.%) were successfully synthesized by calcination of a mixture of (NH4)6Mo7O24·4H2O and g-C3N4. Oxidative desulfurization experiments were conducted using X-MoO2/g-C3N4 as a catalyst, H2O2 as an oxidant, and ionic liquids (ILs) as extraction agents. Catalysts were characterized by X-ray diffraction (XRD), X-ray photoelectron spectroscopy (XPS), Fourier-transform infrared (FT-IR), scanning electron microscopy-energy dispersive X-ray spectroscopy (SEM-EDS), and Brunauer-Emmett-Teller analysis (BET). Characterization results suggested that MoO2 was present in the catalyst and its crystallinity improved with increased Mo-loading. The catalysts had a larger specific surface area due to the presence of MoO2 dispersed on g-C3N4. Experimental results showed that 3%-MoO2/g-C3N4 had the highest catalytic activity among all the catalysts tested. A desulfurization rate of 96.0% was achieved under optimal conditions. Through gas chromatography-mass spectrometry (GC-MS) analysis, it was shown that dibenzothoiphene sulfone was the sole product of the oxidation desulfurization reaction. An apparent activation energy of 61.1 kJ/mol was estimated based on Arrhenius equation. The activity of 3%-MoO2/g-C3N4 slightly decreased after six runs. A possible mechanism for the reaction has been proposed.

  16. Synthesis of novel and stable g-C3N4-Bi2WO6 hybrid nanocomposites and their enhanced photocatalytic activity under visible light irradiation.

    PubMed

    Li, Haitao; Li, Na; Wang, Ming; Zhao, Beiping; Long, Fei

    2018-03-01

    Graphitic carbon nitride (g-C 3 N 4 ) nanosheets with a thickness of only a few nanometres were obtained by a facile deammoniation treatment of bulk g-C 3 N 4 and were further hybridized with Bi 2 WO 6 nanoparticles on the surface via a solvothermal method. The composite photocatalysts were characterized by powder X-ray diffraction, scanning electron microscopy, transmission electron microscopy, UV-vis diffuse reflection spectroscopy and X-ray photoelectron spectroscopy (XPS). The HR-TEM results show that the nano-sized Bi 2 WO 6 particles were finely distributed on g-C 3 N 4 sheet surface, which forms heterojunction structure. The UV-vis diffuse reflectance spectra (DRS) show that the absorption edge of composite photocatalysts shifts towards lower energy region in comparison with those of pure g-C 3 N 4 and Bi 2 WO 6 . The degradation of methyl orange (MO) tests reveals that the optimum activity of 8 : 2g-C 3 N 4 -Bi 2 WO 6 photocatalyst is almost 2.7 and 8.5 times higher than those of individual g-C 3 N 4 and Bi 2 WO 6 . Moreover, the recycle experiments depict high stability of the composite photocatalysts. Through the study of the influencing factors, a possible photocatalytic mechanism is proposed. The enhancement in both photocatalytic performance and stability was caused by the synergistic effect, including the effective separation of the photogenerated electron-hole pairs at the interface of g-C 3 N 4 and Bi 2 WO 6 , the smaller the particle size and the relatively larger specific surface area of the composite photocatalyst.

  17. Immunoglobulin G4-related acquired hemophilia: A case report

    PubMed Central

    Li, Xiaoyan; Duan, Wei; Zhu, Xiang; Xu, Jianying

    2016-01-01

    Acquired hemophilia A (AHA) is a relatively rare and life-threatening bleeding disorder whose pathogenesis is not completely understood. The present study reports a rare case of immunogubulin (IgG)4-related AHA with multisystemic involvement. A 55-year old male patient presented with symptoms of bronchial asthma and multiple subdermal hematomas. Chest computed tomography showed multiple diffuse nodular lesions with thickening of bronchovascular bundles, and scattered high-density spots in both lung lobes. Laboratory investigations showed increased activated partial prothrombin time (120.0 sec), a markedly decreased factor VIII (FVIII) activity (0.5%), a high-titer of FVIII inhibitor (27.2 Bethesda units/ml) and a marked increase in serum IgG4 (>4.03 g/l) level. Left inguinal lymph node biopsy revealed capsular thickening with marked lymphoplasmacytic infiltration, occlusive phlebitis and irregular fibrosis. Immunostaining revealed numerous IgG4-positive plasma cells (>100 cells/human plasma fibronectin) in the nodular lesions, with an IgG4/IgG ratio of >40%. The symptoms were markedly alleviated following corticosteroid therapy. The current study presents the first reported case of a rare IgG4-related AHA that presented with unusual clinical features and multisystemic involvement. The patient responded well to corticosteroid therapy. Documentation of such rare cases will help in characterizing the pathogenesis, and prompt recognition and timely treatment of this rare disorder. PMID:28105131

  18. Intra-genotypic Diversity of Archival G4P[8] Human Rotaviruses from Washington, DC

    PubMed Central

    McDonald, Sarah M.; Davis, Kristin; McAllen, John K.; Spiro, David J.; Patton, John T.

    2011-01-01

    Group A human rotaviruses (RVs) remain the most frequently detected viral agents associated with acute gastroenteritis in infants and young children. Despite their medical importance, relatively few complete genome sequences have been determined for commonly circulating G/P-type strains (i.e., G1P[8], G2P[4], G3P[8], G4P[8], and G9P[8]). In the current study, we sequenced the genomes of 11 G4P[8] isolates from stool specimens that were collected in Washington, DC during the years of 1974-1991. We found that the VP7-VP4-VP6-VP1-VP2-VP3-NSP1-NSP2-NSP3-NSP4-NSP5/6-encoding genes of all 11 G4P[8] RVs have the genotypes of G4-P[8]-I1-R1-C1-M1-A1-N1-T1-E1-H1. By constructing phylogenetic trees for each gene, extensive intra-genotypic diversity was revealed among the G4P[8] RVs, and new sub-genotype gene alleles were identified. Several of these alleles are nearly identical to those of G3P[8] isolates previously sequenced from this same Washington, DC collection, strongly suggesting that the RVs underwent gene reassortment. On the other hand, we observed that some G4P[8] RVs exhibit completely different allele-based genome constellations, despite being collected during the same epidemic season; there was no evidence of gene reassortment between these strains. This observation extends our previous findings and supports the notion that stable, genetically-distinct clades of human RVs with the same G/P-type can co-circulate in a community. Interestingly, the sub-genotype gene alleles found in some of the DC RVs share a close evolutionary relationship with genes of more contemporary human strains. Thus, archival human RVs sequenced in this study might represent evolutionary precursors to modern-day strains. PMID:21712102

  19. Studies of the g factors of the ground 4A2 and the first excited 2E state of Cr 3+ ions in emerald

    NASA Astrophysics Data System (ADS)

    Wei, Qun; Guo, Li-Xin; Yang, Zi-Yuan; Wei, Bing

    2011-09-01

    By using complete diagonalization method, the zero-field splitting and g factors of the ground 4A2 and the first excited 2E states of Cr 3+ ions in emerald are calculated. The theoretical results are in good agreement with the experimental data. The dependencies of the g factors on the crystal field parameters, including Dq, v, and v', have been studied. It is shown that, the g factors of the ground state varied with the crystal field parameters approximately in a linear way, but the g factors of the first excited state varied nonlinearly with these parameters.

  20. High-resolution spectrum of the second member in the ( πu3 p) 4 ( πg3 p) ( πunp) Rydberg series of 32S 2

    NASA Astrophysics Data System (ADS)

    Ramanamma Chaudhri, Y. V.; Mahajan, C. G.

    1991-02-01

    High-resolution spectra of S 2 in the region of the E and F- X progressions have been used to carry out the rotational analyses of the bands at 65 869, 66 666, 65 978, 66 380, and 67 094 cm -1. The first two bands form a single progression and have been attributed to the transition E1 u( {1}/{2}, {1}/{2}) ← X0 g+. The bands at 65 978 and 66 380 cm -1 are shown to belong to the electronic transitions E'0 u+( {1}/{2}, {1}/{2}) ← X0 g+ and F1 u( {3}/{2}, {1}/{2}) ← X0 g+, respectively. The group of states E, E', and F constitutes the second member ( n = 5) of the Rydberg series ( πu3 p) 4 ( πu3 p) ( πunp) whose first member ( n = 4) is the state 3Σ u-. The band at 67 094 cm -1 has been assigned to the transition D'1 u ← X0 g+ which, when considered in the light of the state D3Π u, seems to form a second member of the Rydberg series ( πu3 p) 4 ( πg3 p) ( σunp). The vibrational and rotational constants of these electronic states have also been derived.

  1. 17 CFR 240.12g3-2 - Exemptions for American depositary receipts and certain foreign securities.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 17 Commodity and Securities Exchanges 4 2014-04-01 2014-04-01 false Exemptions for American depositary receipts and certain foreign securities. 240.12g3-2 Section 240.12g3-2 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION (CONTINUED) GENERAL RULES AND REGULATIONS, SECURITIES EXCHANGE...

  2. EIF3G is associated with narcolepsy across ethnicities.

    PubMed

    Holm, Anja; Lin, Ling; Faraco, Juliette; Mostafavi, Sara; Battle, Alexis; Zhu, Xiaowei; Levinson, Douglas F; Han, Fang; Gammeltoft, Steen; Jennum, Poul; Mignot, Emmanuel; Kornum, Birgitte R

    2015-11-01

    Type 1 narcolepsy, an autoimmune disease affecting hypocretin (orexin) neurons, is strongly associated with HLA-DQB1*06:02. Among polymorphisms associated with the disease is single-nucleotide polymorphism rs2305795 (c.*638G>A) located within the P2RY11 gene. P2RY11 is in a region of synteny conserved in mammals and zebrafish containing PPAN, EIF3G and DNMT1 (DNA methyltransferase 1). As mutations in DNMT1 cause a rare dominant form of narcolepsy in association with deafness, cerebellar ataxia and dementia, we questioned whether the association with P2RY11 in sporadic narcolepsy could be secondary to linkage disequilibrium with DNMT1. Based on genome-wide association data from two cohorts of European and Chinese ancestry, we found that the narcolepsy association signal drops sharply between P2RY11/EIF3G and DNMT1, suggesting that the association with narcolepsy does not extend into the DNMT1 gene region. Interestingly, using transethnic mapping, we identified a novel single-nucleotide polymorphism rs3826784 (c.596-260A>G) in the EIF3G gene also associated with narcolepsy. The disease-associated allele increases EIF3G mRNA expression. EIF3G is located in the narcolepsy risk locus and EIF3G expression correlates with PPAN and P2RY11 expression. This suggests shared regulatory mechanisms that might be affected by the polymorphism and are of relevance to narcolepsy.

  3. The association of factor V G1961A (factor V Leiden), prothrombin G20210A, MTHFR C677T and PAI-1 4G/5G polymorphisms with recurrent pregnancy loss in Bosnian women.

    PubMed

    Jusić, Amela; Balić, Devleta; Avdić, Aldijana; Pođanin, Maja; Balić, Adem

    2018-08-01

    Aim To investigate association of factor V Leiden, prothrombin G20210A, MTHFR C677T and PAI-1 4G/5G polymorphisms with recurrent pregnancy loss in Bosnian women. Methods A total of 60 women with two or more consecutive miscarriages before 20 weeks of gestation with the same partners and without history of known causes or recurrent pregnancy loss were included. A control group included 80 healthy women who had one or more successful pregnancies without history of any complication which could be associated with miscarriages. Genotyping of factor V Leiden, prothrombin G20210A, MTHFR C677T and PAI-1 4G/5G polymorphisms were performed by polymerase chain reaction/restriction fragments length polymorphism method (PCR/RFLP). Results Both factor V Leiden and MTHFR C677T polymorphisms were significantly associated with recurrent pregnancy loss (RPL) in Bosnian women while prothrombin G20210A and PAI-1 4G/5G polymorphisms did not show strongly significant association. Conclusion The presence of thrombophilic polymorphisms may predispose women to recurrent pregnancy loss. Future investigation should be addressed in order to find when carriers of those mutations, polymorphisms should be treated with anticoagulant therapy. Copyright© by the Medical Assotiation of Zenica-Doboj Canton.

  4. Yeast Sub1 and human PC4 are G-quadruplex binding proteins that suppress genome instability at co-transcriptionally formed G4 DNA.

    PubMed

    Lopez, Christopher R; Singh, Shivani; Hambarde, Shashank; Griffin, Wezley C; Gao, Jun; Chib, Shubeena; Yu, Yang; Ira, Grzegorz; Raney, Kevin D; Kim, Nayun

    2017-06-02

    G-quadruplex or G4 DNA is a non-B secondary DNA structure consisting of a stacked array of guanine-quartets that can disrupt critical cellular functions such as replication and transcription. When sequences that can adopt Non-B structures including G4 DNA are located within actively transcribed genes, the reshaping of DNA topology necessary for transcription process stimulates secondary structure-formation thereby amplifying the potential for genome instability. Using a reporter assay designed to study G4-induced recombination in the context of an actively transcribed locus in Saccharomyces cerevisiae, we tested whether co-transcriptional activator Sub1, recently identified as a G4-binding factor, contributes to genome maintenance at G4-forming sequences. Our data indicate that, upon Sub1-disruption, genome instability linked to co-transcriptionally formed G4 DNA in Top1-deficient cells is significantly augmented and that its highly conserved DNA binding domain or the human homolog PC4 is sufficient to suppress G4-associated genome instability. We also show that Sub1 interacts specifically with co-transcriptionally formed G4 DNA in vivo and that yeast cells become highly sensitivity to G4-stabilizing chemical ligands by the loss of Sub1. Finally, we demonstrate the physical and genetic interaction of Sub1 with the G4-resolving helicase Pif1, suggesting a possible mechanism by which Sub1 suppresses instability at G4 DNA. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Effect of Radiofrequency Radiation Emitted from 2G and 3G Cell Phone on Developing Liver of Chick Embryo – A Comparative Study

    PubMed Central

    Swer, Rijied Thompson; Anbalagan, J.; Rajesh, Bhargavan

    2017-01-01

    Introduction The increasing scientific evidence of various health hazards on exposure of Radiofrequency Radiation (RFR) emitted from both the cell phones and base stations have caused significant media attention and public discussion in recent years. The mechanism of interaction of RF fields with developing tissues of children and fetuses may be different from that of adults due to their smaller physical size and variation in tissue electromagnetic properties. The present study may provide an insight into the basic mechanisms by which RF fields interact with developing tissues in an embryo. Aim To evaluate the possible tissue and DNA damage in developing liver of chick embryo following chronic exposure to Ultra-High Frequency/Radiofrequency Radiation (UHF/RFR) emitted from 2G and 3G cell phone. Materials and Methods Fertilized chick embryos were incubated in four groups. Group A-experimental group exposed to 2G radiation (60 eggs), Group B- experimental group exposed to 3G radiation (60 eggs), Group C- sham exposed control group (60 eggs) and Group D– control group (48 eggs). On completion of scheduled duration, the embryos were collected and processed for routine histological studies to check structural changes in liver. The nuclear diameter and karyorrhexis changes of hepatocytes were analysed using oculometer and square reticule respectively. The liver procured from one batch of eggs from all the four groups was subjected to alkaline comet assay technique to assess DNA damage. The results were compared using one-way ANOVA test. Results In our study, the exposure of developing chick embryos to 2G and 3G cell phone radiations caused structural changes in liver in the form of dilated sinusoidal spaces with haemorrhage, increased vacuolations in cytoplasm, increased nuclear diameter and karyorrhexis and significantly increased DNA damage. Conclusion The chronic exposure of chick embryo liver to RFR emitted from 2G and 3G cell phone resulted in various structural

  6. Chemical synthesis of 5'-pyrophosphate and triphosphate derivatives of 3'-5' ApA, ApG, GpA and GpG. CD study of the effect of 5'-phosphate groups on the conformation of 3'-5' GpG.

    PubMed Central

    Tomasz, J; Simoncsits, A; Kajtár, M; Krug, R M; Shatkin, A J

    1978-01-01

    A simple, two-step method is described for the synthesis of the 5'-pyro- and triphosphate derivatives of 3'-5' ApA, ApG, GpA and GpG. The readily accessible 2'(3')-5' ApA, ApG, GpA and GpG were converted in one step to the corresponding 5'-phosphoramidate derivatives which were then transformed to the 5'-pyro- and triphosphates. CD spectra of 3'-5' pn GpG (n = 0,1,2 or 3) derivatives, measured at pH 1, indicated stabilization of the (syn) G+p (anti)G conformation by the 5'-phosphate groups. PMID:211490

  7. Induction of G1 and G2/M cell cycle arrests by the dietary compound 3,3'-diindolylmethane in HT-29 human colon cancer cells.

    PubMed

    Choi, Hyun Ju; Lim, Do Young; Park, Jung Han Yoon

    2009-05-29

    3,3'-Diindolylmethane (DIM), an indole derivative produced in the stomach after the consumption of broccoli and other cruciferous vegetables, has been demonstrated to exert anti-cancer effects in both in vivo and in vitro models. We have previously determined that DIM (0 - 30 micromol/L) inhibited the growth of HT-29 human colon cancer cells in a concentration-dependent fashion. In this study, we evaluated the effects of DIM on cell cycle progression in HT-29 cells. HT-29 cells were cultured with various concentrations of DIM (0 - 30 micromol/L) and the DNA was stained with propidium iodide, followed by flow cytometric analysis. [3H]Thymidine incorporation assays, Western blot analyses, immunoprecipitation and in vitro kinase assays for cyclin-dependent kinase (CDK) and cell division cycle (CDC)2 were conducted. The percentages of cells in the G1 and G2/M phases were dose-dependently increased and the percentages of cells in S phase were reduced within 12 h in DIM-treated cells. DIM also reduced DNA synthesis in a dose-dependent fashion. DIM markedly reduced CDK2 activity and the levels of phosphorylated retinoblastoma proteins (Rb) and E2F-1, and also increased the levels of hypophosphorylated Rb. DIM reduced the protein levels of cyclin A, D1, and CDK4. DIM also increased the protein levels of CDK inhibitors, p21CIP1/WAF1 and p27KIPI. In addition, DIM reduced the activity of CDC2 and the levels of CDC25C phosphatase and cyclin B1. Here, we have demonstrated that DIM induces G1 and G2/M phase cell cycle arrest in HT-29 cells, and this effect may be mediated by reduced CDK activity.

  8. 77 FR 50519 - Agency Information Collection Activities: Forms G-325, G-325A, G-325B, and G-325C; Extension of a...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-08-21

    ... DEPARTMENT OF HOMELAND SECURITY U.S. Citizenship and Immigration Services [OMB Control Number 1615... Department of Homeland Security (DHS), U.S. Citizenship and Immigration Services (USCIS) will be submitting... collection: Forms G-325, G-325A, G-325B, and G-325C; U.S. Citizenship and Immigration Services (USCIS). (4...

  9. Arsenic silences hepatic PDK4 expression through activation of histone H3K9 methylatransferase G9a

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Xi; Wu, Jianguo; Choiniere, Jonathan

    It is well established that increased liver cancer incidence is strongly associated with epigenetic silencing of tumor suppressor genes; the latter is contributed by the environmental exposure to arsenic. Pyruvate dehydrogenase kinase 4 (PDK4) is a mitochondrial protein that regulates the TCA cycle. However, the epigenetic mechanisms mediated by arsenic to control PDK4 expression remain elusive. In the present study, we showed that histone methyltransferase G9a- and Suv39H-mediated histone H3 lysine 9 (H3K9) methylations contributed to PDK4 silencing in hepatic cells. The PDK4 expression was induced by G9a inhibitor BRD4770 (BRD) and Suv39H inhibitor Chaetocin (CHA). In contrast, arsenic exposuremore » decreased PDK4 expression by inducing G9a and increasing H3K9 di- and tri-methylations levels (H3K9me2/3). In addition, arsenic exposure antagonizes the effect of BRD by enhancing the enrichment of H3K9me2/3 in the PKD4 promoter. Moreover, knockdown of G9a using siRNA induced PDK4 expression in HCC cells. Furthermore, arsenic decreased hepatic PDK4 expression as well as diminished the induction of PDK4 by BRD in mouse liver and hepatocytes. Overall, the results suggest that arsenic causes aberrant repressive histone modification to silence PDK4 in both HCC cells and in mouse liver. - Graphical abstract: Schematic showing arsenic-mediated epigenetic pathway that inhibits PDK4 expression. (A) BRD induces PDK4 expression by decreasing G9a protein and histone H3K9me2 and H3K9me3 levels as well as diminishing their recruitment to the PDK4 promoter. (B) Arsenic counteracts the effect of BRD by increasing histone H3K9me2 and H3K9me3 levels as well as enhancing their enrichment to the PDK4 promoter. Display Omitted - Highlights: • Histone methyltrasferase G9a inhibitor BRD induces PDK4 expression. • Arsenic decreases PDK4 expression and increases H3K9me2 and me3 levels. • Arsenic enhances H3K9me2/me3 enrichment in the PDK4 promoter. • Arsenic antagonizes the

  10. PAI-1 -675 4G/5G Polymorphism in Association with Diabetes and Diabetic Complications Susceptibility: a Meta-Analysis Study

    PubMed Central

    Yang, Fan; Cui, Dai; Shi, Yun; Shen, Chong; Tang, Wei; Yang, Tao

    2013-01-01

    A meta-analysis was performed to assess the association between the PAI-1 -675 4G/5G polymorphism and susceptibility to diabetes mellitus (DM), diabetic nephropathy (DN), diabetic retinopathy (DR) and diabetic coronary artery disease (CAD). A literature-based search was conducted to identify all relevant studies. The fixed or random effect pooled measure was calculated mainly at the allele level to determine heterogeneity bias among studies. Further stratified analyses and sensitivity analyses were also performed. Publication bias was examined by the modified Begg’s and Egger’s test. Twenty published articles with twenty-seven outcomes were included in the meta-analysis: 6 studies with a total of 1,333 cases and 3,011 controls were analyzed for the PAI-1 -675 4G/5G polymorphism with diabetes risk, 7 studies with 1,060 cases and 1,139 controls for DN risk, 10 studies with 1,327 cases and 1,557 controls for DR and 4 studies with 610 cases and 1,042 controls for diabetic CAD risk respectively. Using allelic comparison (4G vs. 5G), the PAI-1 -675 4G/5G polymorphism was observed to have no significant association with diabetes (REM OR 1.07, 95% CI 0.96, 1.20), DN (REM OR 1.10, 95% CI 0.98, 1.25), DR (REM OR 1.09, 95% CI 0.97, 1.22) or diabetic CAD risk (REM OR 1.07, 95% CI 0.81, 1.42), and similar results were obtained in the dominant, recessive and co-dominant models. Our meta-analyses suggest that the PAI-1 -675 4G/5G polymorphism might not be a risk factor for DM, DN, DR or diabetic CAD risk in the populations investigated. This conclusion warrants confirmation by further studies. PMID:24223897

  11. PAI-1 -675 4G/5G polymorphism in association with diabetes and diabetic complications susceptibility: a meta-analysis study.

    PubMed

    Xu, Kuanfeng; Liu, Xiaoyun; Yang, Fan; Cui, Dai; Shi, Yun; Shen, Chong; Tang, Wei; Yang, Tao

    2013-01-01

    A meta-analysis was performed to assess the association between the PAI-1 -675 4G/5G polymorphism and susceptibility to diabetes mellitus (DM), diabetic nephropathy (DN), diabetic retinopathy (DR) and diabetic coronary artery disease (CAD). A literature-based search was conducted to identify all relevant studies. The fixed or random effect pooled measure was calculated mainly at the allele level to determine heterogeneity bias among studies. Further stratified analyses and sensitivity analyses were also performed. Publication bias was examined by the modified Begg's and Egger's test. Twenty published articles with twenty-seven outcomes were included in the meta-analysis: 6 studies with a total of 1,333 cases and 3,011 controls were analyzed for the PAI-1 -675 4G/5G polymorphism with diabetes risk, 7 studies with 1,060 cases and 1,139 controls for DN risk, 10 studies with 1,327 cases and 1,557 controls for DR and 4 studies with 610 cases and 1,042 controls for diabetic CAD risk respectively. Using allelic comparison (4G vs. 5G), the PAI-1 -675 4G/5G polymorphism was observed to have no significant association with diabetes (REM OR 1.07, 95% CI 0.96, 1.20), DN (REM OR 1.10, 95% CI 0.98, 1.25), DR (REM OR 1.09, 95% CI 0.97, 1.22) or diabetic CAD risk (REM OR 1.07, 95% CI 0.81, 1.42), and similar results were obtained in the dominant, recessive and co-dominant models. Our meta-analyses suggest that the PAI-1 -675 4G/5G polymorphism might not be a risk factor for DM, DN, DR or diabetic CAD risk in the populations investigated. This conclusion warrants confirmation by further studies.

  12. An efficient top-down approach for the fabrication of large-aspect-ratio g-C3N4 nanosheets with enhanced photocatalytic activities.

    PubMed

    Tong, Jincheng; Zhang, Li; Li, Fei; Li, Mingming; Cao, Shaokui

    2015-09-28

    Graphitic carbon nitride (g-C3N4) nanosheets with large aspect ratios were fabricated from bulk g-C3N4 through an efficient top-down approach of moderate disintegration-exfoliation using diluted H2SO4 as an "efficient knife". By prior disintegration in a diluted H2SO4 solution, the exfoliation of bulk g-C3N4 was effectively accelerated. The as-prepared g-C3N4 nanosheets possess a two-dimensional (2D) thin-layer structure with seven-atom thickness, a large lateral size of about 1 μm, and a high specific surface area of 80 m(2) g(-1). Compared with the bulk precursor, the g-C3N4 nanosheets showed much higher efficiency of photogenerated charge transfer and separation, and consequently exhibited enhanced photocatalytic activity toward hydrogen evolution and pollutant decomposition under both full-sunlight and visible-light irradiation.

  13. Osthole induces G2/M cell cycle arrest and apoptosis in human hepatocellular carcinoma HepG2 cells.

    PubMed

    Chao, Xu; Zhou, Xiaojun; Zheng, Gang; Dong, Changhu; Zhang, Wei; Song, Xiaomei; Jin, Tianbo

    2014-05-01

    Osthole [7-methoxy-8-(3-methyl-2-butenyl) coumarin] isolated from the fruit of Cnidium monnieri (L.) Cuss, one of the commonly used Chinese medicines listed in the Shennong's Classic of Materia Medica in the Han Dynasty, had remarkable antiproliferative activity against human hepatocellular carcinoma HepG2 cells in culture. This study evaluated the effects of osthole on cell growth, nuclear morphology, cell cycle distribution, and expression of apoptosis-related proteins in HepG2 cells. Cytotoxic activity of osthole was determined by the MTT assay at various concentrations ranging from 0.004 to 1.0 µmol/ml in HepG2 cells. Cell morphology was assessed by Hoechst staining and fluorescence microscopy. Apoptosis and cell-cycle distribution was determined by annexin V staining and flow cytometry. Apoptotic protein levels were assessed by Western blot. Osthole exhibited significant inhibition of the survival of HepG2 cells and the half inhibitory concentration (IC₅₀) values were 0.186, 0.158 and 0.123 µmol/ml at 24, 48 and 72 h, respectively. Cells treated with osthole at concentrations of 0, 0.004, 0.02, 0.1 and 0.5 μmol/ml showed a statistically significant increase in the G2/M fraction accompanied by a decrease in the G0/G1 fraction. The increase of apoptosis induced by osthole was correlated with down-regulation expression of anti-apoptotic Bcl-2 protein and up-regulation expression of pro-apoptotic Bax and p53 proteins. Osthole had significant growth inhibitory activity and the pro-apoptotic effect of osthole is mediated through the activation of caspases and mitochondria in HepG2 cells. Results suggest that osthole has promising therapeutic potential against hepatocellular carcinoma.

  14. Delayed-release oral mesalamine 4.8 g/day (800 mg tablets) compared with 2.4 g/day (400 mg tablets) for the treatment of mildly to moderately active ulcerative colitis: The ASCEND I trial

    PubMed Central

    Hanauer, Stephen B; Sandborn, William J; Dallaire, Christian; Archambault, André; Yacyshyn, Bruce; Yeh, Chyon; Smith-Hall, Nancy

    2007-01-01

    BACKGROUND: Delayed-release oral mesalamine 2.4 g/day to 4.8 g/day has been shown to be effective in treating mildly to moderately active ulcerative colitis (UC), but it is unknown whether an initial dose of 4.8 g/day is more effective than 2.4 g/day in patients with mildly to moderately active UC and in the subgroup with moderate disease. PATIENTS AND METHODS: A six-week, multicentre, randomized, double-blind, controlled trial assessing the safety and clinical efficacy of a new dose (ASCEND I) of medication randomly assigned 301 adults with mildly to moderately active UC to delayed-release oral mesalamine 2.4 g/day (400 mg tablet [n=154]) or 4.8 g/day (800 mg tablet [n=147]). The primary efficacy end point was overall improvement (ie, treatment success), defined as complete remission or response to therapy from baseline to week 6. Primary safety end points were adverse events and laboratory evaluations. Data were also analyzed separately for the prespecified subgroup of patients with moderate UC at baseline. RESULTS: Treatment success was not statistically different between the treatment groups at week 6; 51% of the group (77 of 150) who received delayed-release oral mesalamine 2.4 g/day and 56% of the group (76 of 136) who received 4.8 g/day reached the efficacy end point (P=0.441). Among the moderate disease subgroup, however, the higher initial dose was more effective; 57% of patients (53 of 93) given delayed-release oral mesalamine 2.4 g/day and 72% of patients (55 of 76) given 4.8 g/day achieved treatment success (P=0.0384). Both regimens were well tolerated. CONCLUSIONS: Delayed-release oral mesalamine is an effective and well-tolerated initial therapy in patients with mildly to moderately active UC, and a 4.8 g/day dose may enhance treatment success rates in patients with moderate disease compared with mesalamine 2.4 g/day. PMID:18080055

  15. Antibacterial properties of (2,3)-alpha- and (2,3)-beta-methylene analogs of penicillin G.

    PubMed Central

    Christenson, J G; Pruess, D L; Talbot, M K; Keith, D D

    1988-01-01

    The penam nucleus can assume two conformations; these are designated open and closed. The synthetic (2,3)-alpha- and (2,3)-beta-methylenepenams can be regarded as analogs of the open and closed conformations, respectively. It has been shown that the beta-methylenepenams are essentially inactive, suggesting that the closed conformation of penams is also inactive. In this study, we investigated a series of beta-lactams, all of which contained phenylacetamido side chains: penicillin G, the (2,3)-alpha- and (2,3)-beta-methylenepenams, and the 3-acetoxymethyl- and 3-methylcephalosporins. The alpha-methylenepenam and penicillin G were the most active compounds, while the beta-methylene isomer was only poorly active. Results with permeability mutants suggested that the alpha-methylene compound penetrated the outer membrane somewhat more readily than penicillin G did. The intrinsic potency of the alpha-methylenepenam appeared to be similar to that of penicillin G, on the basis of their affinities for penicillin-binding proteins and their abilities to inhibit peptidoglycan synthesis in ether-permeabilized Escherichia coli, while the beta-methylene analog had very poor intrinsic potency. The alpha-methylene analog was about 10-fold more efficient (Vmax/Km) than penicillin G as a substrate for the cephalosporinases from Enterobacter cloacae and Proteus vulgaris, but it was about 40-fold less efficient with penicillinase from Staphylococcus aureus. These results strongly support the hypothesis that the active conformation of penams is the open conformation and suggest that the position in space of the carboxyl group relative to the beta-lactam carbonyl is an important determinant of cephalosporinlike character, as distinct from penicillinlike character. Images PMID:3190190

  16. Sequencing and phylogenetic analysis of the coding region of six common rotavirus strains: evidence for intragenogroup reassortment among co-circulating G1P[8] and G2P[4] strains from the United States.

    PubMed

    Bányai, K; Mijatovic-Rustempasic, S; Hull, J J; Esona, M D; Freeman, M M; Frace, A M; Bowen, M D; Gentsch, J R

    2011-03-01

    The segmented genome of rotaviruses provides an opportunity for rotavirus strains to generate a large genetic diversity through reassortment; however, this mechanism is considered to play little role in the generation of mosaic gene constellations between Wa-like and DS-1-like strains in genes other than the neutralization antigens. A pilot study was undertaken to analyze these two epidemiologically important strains at the genomic level in order to (i) identify intergenogroup reassortment and (ii) to make available additional reference genome sequences of G1P[8] and G2P[4] for future genomics analyses. The full or nearly complete coding region of all 11 genes for 3 G1P[8] (LB2719, LB2758, and LB2771) and 3 G2P[4] (LB2744, LB2764, and LB2772) strains isolated from children hospitalized with severe diarrhea in Long Beach, California, where these strains were circulating at comparable rates during 2005-2006 are described in this study. Based on the full-genome classification system, all G1P[8] strains had a conserved genomic constellation: G1-P[8]-I1-R1-C1-M1-A1-N1-T1-E1-E1-H1 and were mostly identical to the few Wa-like strains whose genome sequences have already been determined. Similarly, the genome sequences of the 3 G2P[4] strains were highly conserved: G2-P[4]-I2-R2-C2-M2-A2-N2-T2-E2-E2-H2 and displayed an overall lesser genetic divergence with reference DS-1-like strains. While intergenogroup reassortment was not seen between the G1P[8] and G2P[4] strains studied here, evidence for intragenogroup reassortment events was identified. Similar studies in the post-rotavirus genomic era will help uncover whether intergenogroup reassortment affecting the backbone genes could play a significant role in any potential vaccine breakthrough events by evading immunity of vaccinated children. Copyright © 2011 Wiley-Liss, Inc.

  17. Dipole moments and transition probabilities of the i 3Pi sub g-b 3Sigma(+) sub u, c 3Pi sub u-a 3Sigma(+) sub g, and i 3Pi sub g-c 3Pi sub u systems of molecular hydrogen

    NASA Technical Reports Server (NTRS)

    Guberman, Steven L.; Dalgarno, A.

    1992-01-01

    Bonn-Oppenheimer-based ab initio calculations of dipole moments from the i 3Pi sub g-b 3Sigma(+) sub u, c 3Pi sub u-a 3Sigma(+) sub g, and i 3Pi sub g-c 3Pi sub u transitions of H2 have been conducted, to yield a tabulation of the dipole transition probabilities and Franck-Condon factors. These factors are given for transitions originating in the lowest vibrational level of the ground X 1Sigma(+) sub g state.

  18. UreE-UreG Complex Facilitates Nickel Transfer and Preactivates GTPase of UreG in Helicobacter pylori*♦

    PubMed Central

    Yang, Xinming; Li, Hongyan; Lai, Tsz-Pui; Sun, Hongzhe

    2015-01-01

    The pathogenicity of Helicobacter pylori relies heavily on urease, which converts urea to ammonia to neutralize the stomach acid. Incorporation of Ni2+ into the active site of urease requires a battery of chaperones. Both metallochaperones UreE and UreG play important roles in the urease activation. In this study, we demonstrate that, in the presence of GTP and Mg2+, UreG binds Ni2+ with an affinity (Kd) of ∼0.36 μm. The GTPase activity of Ni2+-UreG is stimulated by both K+ (or NH4+) and HCO3− to a biologically relevant level, suggesting that K+/NH4+ and HCO3− might serve as GTPase elements of UreG. We show that complexation of UreE and UreG results in two protein complexes, i.e. 2E-2G and 2E-G, with the former being formed only in the presence of both GTP and Mg2+. Mutagenesis studies reveal that Arg-101 on UreE and Cys-66 on UreG are critical for stabilization of 2E-2G complex. Combined biophysical and bioassay studies show that the formation of 2E-2G complex not only facilitates nickel transfer from UreE to UreG, but also enhances the binding of GTP. This suggests that UreE might also serve as a structural scaffold for recruitment of GTP to UreG. Importantly, we demonstrate for the first time that UreE serves as a bridge to grasp Ni2+ from HypA, subsequently donating it to UreG. The study expands our horizons on the molecular details of nickel translocation among metallochaperones UreE, UreG, and HypA, which further extends our knowledge on the urease maturation process. PMID:25752610

  19. 4G/5G Variant of Plasminogen Activator Inhibitor-1 Gene and Severe Pregnancy-Induced Hypertension: Subgroup Analyses of Variants of Angiotensinogen and Endothelial Nitric Oxide Synthase

    PubMed Central

    Kobashi, Gen; Ohta, Kaori; Yamada, Hideto; Hata, Akira; Minakami, Hisanori; Sakuragi, Noriaki; Tamashiro, Hiko; Fujimoto, Seiichiro

    2009-01-01

    Background Pregnancy-induced hypertension (PIH) is a common cause of perinatal mortality. It is believed to result from the interaction of several factors, including those related to the blood coagulation system. We performed genotyping and subgroup analyses to determine if the 4G/5G genotypes of the plasminogen activator inhibitor-1 gene (PAI-1) play a role in the pathogenesis of PIH, and to evaluate possible interactions of the PAI-1 polymorphisms with those of the angiotensinogen gene (AGT) and the endothelial nitric oxide synthase gene (NOS3). Methods An association study of PAI-1 polymorphism, and subgroup analyses of common variants of AGT and NOS3, among 128 patients with PIH and 376 healthy pregnant controls. Results No significant differences were found between the cases and controls in the frequencies of allele 4G or the 4G/4G genotype. In subgroup analyses, after adjustment for multiple comparison, a significant association with the AGT TT genotype was found among women with the PAI-1 4G/4G genotype, and an association with the NOS3 GA+AA genotype was found among women with the 5G/5G or 4G/5G genotypes. Conclusions Our findings suggest that there are at least 2 pathways in the pathogenesis of severe PIH. However, with respect to early prediction and prevention of severe PIH, although the PAI-1 4G/4G genotype alone was not a risk factor for severe PIH, the fact that PAI-1 genotypes are associated with varying risks for severe PIH suggests that PAI-1 genotyping of pregnant women, in combination with other tests, may be useful in the development of individualized measures that may prevent severe PIH. PMID:19838007

  20. Sites of instability in the human TCF3 (E2A) gene adopt G-quadruplex DNA structures in vitro

    PubMed Central

    Williams, Jonathan D.; Fleetwood, Sara; Berroyer, Alexandra; Kim, Nayun; Larson, Erik D.

    2015-01-01

    The formation of highly stable four-stranded DNA, called G-quadruplex (G4), promotes site-specific genome instability. G4 DNA structures fold from repetitive guanine sequences, and increasing experimental evidence connects G4 sequence motifs with specific gene rearrangements. The human transcription factor 3 (TCF3) gene (also termed E2A) is subject to genetic instability associated with severe disease, most notably a common translocation event t(1;19) associated with acute lymphoblastic leukemia. The sites of instability in TCF3 are not randomly distributed, but focused to certain sequences. We asked if G4 DNA formation could explain why TCF3 is prone to recombination and mutagenesis. Here we demonstrate that sequences surrounding the major t(1;19) break site and a region associated with copy number variations both contain G4 sequence motifs. The motifs identified readily adopt G4 DNA structures that are stable enough to interfere with DNA synthesis in physiological salt conditions in vitro. When introduced into the yeast genome, TCF3 G4 motifs promoted gross chromosomal rearrangements in a transcription-dependent manner. Our results provide a molecular rationale for the site-specific instability of human TCF3, suggesting that G4 DNA structures contribute to oncogenic DNA breaks and recombination. PMID:26029241

  1. Comparison of clinical outcome between 23-G and 25-G vitrectomy in diabetic patients

    PubMed Central

    Taleb, Eman Abo; Nagpal, Manish P.; Mehrotra, Navneet S.; Bhatt, Kalyani; Goswami, Sangeeta; Babalola, Yewande O.; Noman, Abdulrahman

    2017-01-01

    PURPOSE: To compare the clinical outcomes and complications between 23-G and 25-G vitrectomy in patients with diabetic vitreous hemorrhage (VH). MATERIALS AND METHODS: A retrospective comparative study comprising 69 eyes (36 eyes in 23-G group and 33 eyes in 25-G group) of 65 patients who underwent vitrectomy with air tamponade for diabetic vitreous hemorrhage (VH) with at least 6 months of follow-up was conducted. RESULTS: There were no significant differences between the two groups in age, gender, bilaterality, type of diabetes, presence of hypertension, lens status, and previous argon laser photocoagulation state (P > 0.05). Best-corrected visual acuity (BCVA) of both groups at postoperative 1 month logarithm of the minimum angle of resolution (logMAR) (1.06 ± 0.99, 0.90 ± 0.96), 3 months logMAR (1.07 ± 0.93, 0.83 ± 0.85), and 6 months logMAR (1.03 ± 0.89, 0.83 ± 0.85) significantly improved from the preoperative BCVA logMAR (2.03 ± 0.83, 2.15 ± 0.99) for 23-G group, 25-G group, respectively (P < 0.0001). There was no significant difference in BCVA between the two groups preoperatively and at 1, 3, and 6 months postoperatively (P = 0.566, 0.506, 0.333, and 0.445, respectively), incidence of intraoperative wound suturing (21.4%, 15.2%), postoperative hypotony (0.0%, 0.0%), early postoperative VH (POVH) (11.1%, 15.2%), late POVH (5.6%, 0.0%), retinal detachment (2.8%, 6.1%), neovascular glaucoma (92.8%, 9.1%), and endophthalmitis (0.0%, 0.0%) for 23-G group, 25-G group, respectively (P > 0.05). CONCLUSION: 25-G vitrectomy is as effective for PDR as 23-G vitrectomy. PMID:29118498

  2. Comparison of clinical outcome between 23-G and 25-G vitrectomy in diabetic patients.

    PubMed

    Taleb, Eman Abo; Nagpal, Manish P; Mehrotra, Navneet S; Bhatt, Kalyani; Goswami, Sangeeta; Babalola, Yewande O; Noman, Abdulrahman

    2017-01-01

    To compare the clinical outcomes and complications between 23-G and 25-G vitrectomy in patients with diabetic vitreous hemorrhage (VH). A retrospective comparative study comprising 69 eyes (36 eyes in 23-G group and 33 eyes in 25-G group) of 65 patients who underwent vitrectomy with air tamponade for diabetic vitreous hemorrhage (VH) with at least 6 months of follow-up was conducted. There were no significant differences between the two groups in age, gender, bilaterality, type of diabetes, presence of hypertension, lens status, and previous argon laser photocoagulation state ( P > 0.05). Best-corrected visual acuity (BCVA) of both groups at postoperative 1 month logarithm of the minimum angle of resolution (logMAR) (1.06 ± 0.99, 0.90 ± 0.96), 3 months logMAR (1.07 ± 0.93, 0.83 ± 0.85), and 6 months logMAR (1.03 ± 0.89, 0.83 ± 0.85) significantly improved from the preoperative BCVA logMAR (2.03 ± 0.83, 2.15 ± 0.99) for 23-G group, 25-G group, respectively ( P < 0.0001). There was no significant difference in BCVA between the two groups preoperatively and at 1, 3, and 6 months postoperatively ( P = 0.566, 0.506, 0.333, and 0.445, respectively), incidence of intraoperative wound suturing (21.4%, 15.2%), postoperative hypotony (0.0%, 0.0%), early postoperative VH (POVH) (11.1%, 15.2%), late POVH (5.6%, 0.0%), retinal detachment (2.8%, 6.1%), neovascular glaucoma (92.8%, 9.1%), and endophthalmitis (0.0%, 0.0%) for 23-G group, 25-G group, respectively ( P > 0.05). 25-G vitrectomy is as effective for PDR as 23-G vitrectomy.

  3. TeV γ-ray observations of the young synchrotron-dominated SNRs G1.9+0.3 and G330.2+1.0 with H.E.S.S.

    NASA Astrophysics Data System (ADS)

    H.E.S.S. Collaboration; Abramowski, A.; Aharonian, F.; Benkhali, F. Ait; Akhperjanian, A. G.; Angüner, E.; Anton, G.; Balenderan, S.; Balzer, A.; Barnacka, A.; Becherini, Y.; Becker Tjus, J.; Bernlöhr, K.; Birsin, E.; Bissaldi, E.; Biteau, J.; Böttcher, M.; Boisson, C.; Bolmont, J.; Bordas, P.; Brucker, J.; Brun, F.; Brun, P.; Bulik, T.; Carrigan, S.; Casanova, S.; Cerruti, M.; Chadwick, P. M.; Chalme-Calvet, R.; Chaves, R. C. G.; Cheesebrough, A.; Chrétien, M.; Colafrancesco, S.; Cologna, G.; Conrad, J.; Couturier, C.; Cui, Y.; Dalton, M.; Daniel, M. K.; Davids, I. D.; Degrange, B.; Deil, C.; deWilt, P.; Dickinson, H. J.; Djannati-Ataï, A.; Domainko, W.; O'C. Drury, L.; Dubus, G.; Dutson, K.; Dyks, J.; Dyrda, M.; Edwards, T.; Egberts, K.; Eger, P.; Espigat, P.; Farnier, C.; Fegan, S.; Feinstein, F.; Fernandes, M. V.; Fernandez, D.; Fiasson, A.; Fontaine, G.; Förster, A.; Füßling, M.; Gajdus, M.; Gallant, Y. A.; Garrigoux, T.; Giavitto, G.; Giebels, B.; Glicenstein, J. F.; Grondin, M.-H.; Grudzińska, M.; Häffner, S.; Hahn, J.; Harris, J.; Heinzelmann, G.; Henri, G.; Hermann, G.; Hervet, O.; Hillert, A.; Hinton, J. A.; Hofmann, W.; Hofverberg, P.; Holler, M.; Horns, D.; Jacholkowska, A.; Jahn, C.; Jamrozy, M.; Janiak, M.; Jankowsky, F.; Jung, I.; Kastendieck, M. A.; Katarzyński, K.; Katz, U.; Kaufmann, S.; Khélifi, B.; Kieffer, M.; Klepser, S.; Klochkov, D.; Kluźniak, W.; Kneiske, T.; Kolitzus, D.; Komin, Nu.; Kosack, K.; Krakau, S.; Krayzel, F.; Krüger, P. P.; Laffon, H.; Lamanna, G.; Lefaucheur, J.; Lemière, A.; Lemoine-Goumard, M.; Lenain, J.-P.; Lennarz, D.; Lohse, T.; Lopatin, A.; Lu, C.-C.; Marandon, V.; Marcowith, A.; Marx, R.; Maurin, G.; Maxted, N.; Mayer, M.; McComb, T. J. L.; Méhault, J.; Meintjes, P. J.; Menzler, U.; Meyer, M.; Moderski, R.; Mohamed, M.; Moulin, E.; Murach, T.; Naumann, C. L.; de Naurois, M.; Niemiec, J.; Nolan, S. J.; Oakes, L.; Ohm, S.; Wilhelmi, E. de Oña; Opitz, B.; Ostrowski, M.; Oya, I.; Panter, M.; Parsons, R. D.; Arribas, M. Paz; Pekeur, N. W.; Pelletier, G.; Perez, J.; Petrucci, P.-O.; Peyaud, B.; Pita, S.; Poon, H.; Pühlhofer, G.; Punch, M.; Quirrenbach, A.; Raab, S.; Raue, M.; Reimer, A.; Reimer, O.; Renaud, M.; Reyes, R. de los; Rieger, F.; Rob, L.; Romoli, C.; Rosier-Lees, S.; Rowell, G.; Rudak, B.; Rulten, C. B.; Sahakian, V.; Sanchez, D. A.; Santangelo, A.; Schlickeiser, R.; Schüssler, F.; Schulz, A.; Schwanke, U.; Schwarzburg, S.; Schwemmer, S.; Sol, H.; Spengler, G.; Spies, F.; Stawarz, Ł.; Steenkamp, R.; Stegmann, C.; Stinzing, F.; Stycz, K.; Sushch, I.; Szostek, A.; Tavernet, J.-P.; Tavernier, T.; Taylor, A. M.; Terrier, R.; Tluczykont, M.; Trichard, C.; Valerius, K.; van Eldik, C.; van Soelen, B.; Vasileiadis, G.; Venter, C.; Viana, A.; Vincent, P.; Völk, H. J.; Volpe, F.; Vorster, M.; Vuillaume, T.; Wagner, S. J.; Wagner, P.; Ward, M.; Weidinger, M.; Weitzel, Q.; White, R.; Wierzcholska, A.; Willmann, P.; Wörnlein, A.; Wouters, D.; Zabalza, V.; Zacharias, M.; Zajczyk, A.; Zdziarski, A. A.; Zech, A.; Zechlin, H.-S.

    2014-06-01

    The non-thermal nature of the X-ray emission from the shell-type supernova remnants (SNRs) G1.9+0.3 and G330.2+1.0 is an indication of intense particle acceleration in the shock fronts of both objects. This suggests that the SNRs are prime candidates for very-high-energy (VHE; E > 0.1 TeV) γ-ray observations. G1.9+0.3, recently established as the youngest known SNR in the Galaxy, also offers a unique opportunity to study the earliest stages of SNR evolution in the VHE domain. The purpose of this work is to probe the level of VHE γ-ray emission from both SNRs and use this to constrain their physical properties. Observations were conducted with the H.E.S.S. (High Energy Stereoscopic System) Cherenkov Telescope Array over a more than six-year period spanning 2004-2010. The obtained data have effective livetimes of 67 h for G1.9+0.3 and 16 h for G330.2+1.0. The data are analysed in the context of the multiwavelength observations currently available and in the framework of both leptonic and hadronic particle acceleration scenarios. No significant γ-ray signal from G1.9+0.3 or G330.2+1.0 was detected. Upper limits (99 per cent confidence level) to the TeV flux from G1.9+0.3 and G330.2+1.0 for the assumed spectral index Γ = 2.5 were set at 5.6 × 10-13 cm-2 s-1 above 0.26 TeV and 3.2 × 10-12 cm-2 s-1 above 0.38 TeV, respectively. In a one-zone leptonic scenario, these upper limits imply lower limits on the interior magnetic field to BG1.9 ≳ 12 μG for G1.9+0.3 and to BG330 ≳ 8 μG for G330.2+1.0. In a hadronic scenario, the low ambient densities and the large distances to the SNRs result in very low predicted fluxes, for which the H.E.S.S. upper limits are not constraining.

  4. Improving the photocatalytic hydrogen production of Ag/g-C3N4 nanocomposites by dye-sensitization under visible light irradiation

    NASA Astrophysics Data System (ADS)

    Qin, Jiayi; Huo, Jingpei; Zhang, Piyong; Zeng, Jian; Wang, Tingting; Zeng, Heping

    2016-01-01

    Ag nanoparticles were deposited on the surface of g-C3N4 by a chemical reduction method to increase visible-light absorption via the localized surface plasmon resonance effect, resulting in the reduced recombination of photo-generated electron-holes and enhanced photocatalytic activity. The Ag/g-C3N4 composite with a Ag loading of 3 wt% has the optimum photoactivity that is almost 3.6 and 3.4 times higher than pure g-C3N4 and the same photocatalysis system which has been reported, respectively. Fluorescein was introduced as a photosensitizer and H2 evolution soared to 2014.20 μmol g-1 h-1 and the rate is even about 4.8 times higher than that of the 3 wt% Ag/g-C3N4 composite. The chemical structure, composites, morphologies and optical properties of the obtained products are well-characterized by XRD, FTIR, TEM, EDS, XPS and UV-Vis DRS. Meanwhile, the photocatalyst exhibits high stability and reusability.Ag nanoparticles were deposited on the surface of g-C3N4 by a chemical reduction method to increase visible-light absorption via the localized surface plasmon resonance effect, resulting in the reduced recombination of photo-generated electron-holes and enhanced photocatalytic activity. The Ag/g-C3N4 composite with a Ag loading of 3 wt% has the optimum photoactivity that is almost 3.6 and 3.4 times higher than pure g-C3N4 and the same photocatalysis system which has been reported, respectively. Fluorescein was introduced as a photosensitizer and H2 evolution soared to 2014.20 μmol g-1 h-1 and the rate is even about 4.8 times higher than that of the 3 wt% Ag/g-C3N4 composite. The chemical structure, composites, morphologies and optical properties of the obtained products are well-characterized by XRD, FTIR, TEM, EDS, XPS and UV-Vis DRS. Meanwhile, the photocatalyst exhibits high stability and reusability. Electronic supplementary information (ESI) available: TEM images, TGA curves, PXRD and FTIR spectra, the recycling experiment of 3% Ag/g-C3N4, the specific

  5. An AgI@g-C3N4 hybrid core@shell structure: Stable and enhanced photocatalytic degradation

    NASA Astrophysics Data System (ADS)

    Liu, Li; Qi, Yuehong; Yang, Jinyi; Cui, Wenquan; Li, Xingang; Zhang, Zisheng

    2015-12-01

    A novel visible-light-active material AgI@g-C3N4 was prepared by ultrasonication/chemisorption method. The core@shell structure AgI@g-C3N4 catalyst showed high efficiency for the degradation of MB under visible light irradiation (λ > 420 nm). Nearly 96.5% of MB was degraded after 120 min of irradiation in the presence of the AgI@g-C3N4 photocatalyst. Superior stability was also observed in the cyclic runs indicating that the as prepared hybrid composite is highly desirable for the remediation of organic contaminated wastewaters. The improved photocatalytic performance is due to synergistic effects at the interface of AgI and g-C3N4 which can effectively accelerate the charge separation and reinforce the photostability of hybrid composite. The possible mechanism for the photocatalytic activity of AgI@g-C3N4 was tentatively proposed.

  6. Association of the plasminogen activator inhibitor-1 (PAI-1) Gene -675 4G/5G and -844 A/G promoter polymorphism with risk of keloid in a Chinese Han population.

    PubMed

    Wang, Yongjie; Long, Jianhong; Wang, Xiaoyan; Sun, Yang

    2014-10-28

    A keloid is pathological scar caused by aberrant response to skin injuries, characterized by excessive accumulation of histological extracellular matrix, and occurs in genetically susceptible individuals. Plasminogen activator inhibitor-1 (PAI-1) has been implicated in the pathogenesis of keloid. We investigated the association between PAI-1 polymorphisms and plasma PAI-1 level with keloid risk. A total of 242 Chinese keloid patients and 207 controls were enrolled in this study. Polymerase chain reaction-restriction technique was used to determine PAI-1 promoter polymorphism (-675 4G/5G and -844 A/G) distribution. Plasma PAI-1 levels were detected using enzyme-linked immunosorbent assay (ELISA). There was a statistically significant difference in the distribution of PAI-1 -675 4G/5G polymorphism between keloid patients and healthy controls. 4G/4G carriers were more likely to develop keloid. In contrast, the -844 A/G polymorphism distribution did not vary significantly between keloid patients and controls. The keloid patients group had a significantly higher plasma PAI-1 level than the control group. In the -675 4G/4G carrier population, the plasma PAI-1 levels were significant higher in keloid patients compared with controls. Our study provides evidence that PAI-1 promoter polymorphism -675 4G/5G and plasma PAI-1 level are associated with keloid risk. PAI-1 -675 4G/5G polymorphism may be an important hereditary factor responsible for keloid development in the Chinese Han population.

  7. Expression of CAR in SW480 and HepG2 cells during G1 is associated with cell proliferation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Osabe, Makoto; Sugatani, Junko; Global COE Program, School of Pharmaceutical Sciences, University of Shizuoka, Shizuoka

    Constitutive androstane receptor (CAR) is a transcription factor to regulate the expression of several genes related to drug-metabolism. Here, we demonstrate that CAR protein accumulates during G1 in human SW480 and HepG2 cells. After the G1/S phase transition, CAR protein levels decreased, and CAR was hardly detected in cells by the late M phase. CAR expression in both cell lines was suppressed by RNA interference-mediated suppression of CDK4. Depletion of CAR by RNA interference in both cells and by hepatocyte growth factor treatment in HepG2 cells resulted in decreased MDM2 expression that led to p21 upregulation and repression of HepG2more » cell growth. Thus, our results demonstrate that CAR expression is an early G1 event regulated by CDK4 that contributes to MDM2 expression; these findings suggest that CAR may influence the expression of genes involved in not only the metabolism of endogenous and exogenous substances but also in the cell proliferation.« less

  8. Association between the SERPINE1 (PAI-1) 4G/5G insertion/deletion promoter polymorphism (rs1799889) and pre-eclampsia: a systematic review and meta-analysis.

    PubMed

    Zhao, Linlu; Bracken, Michael B; Dewan, Andrew T; Chen, Suzan

    2013-03-01

    The SERPINE1 -675 4G/5G promoter region insertion/deletion polymorphism (rs1799889) has been implicated in the pathogenesis of pre-eclampsia (PE), but the genetic association has been inconsistently replicated. To derive a more precise estimate of the association, a systematic review and meta-analysis was conducted. This study conformed to Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines. PubMed (MEDLINE), Scopus and HuGE Literature Finder literature databases were systematically searched for relevant studies. Summary odds ratios (ORs) and 95% confidence intervals (CIs) were calculated for the allelic comparison (4G versus 5G) and genotypic comparisons following the co-dominant (4G/4G versus 5G/5G and 4G/5G versus 5G/5G), dominant (4G/4G+4G/5G versus 5G/5G) and recessive (4G/4G versus 4G/5G+5G/5G) genetic models. Between-study heterogeneity was quantified by I(2) statistics and publication bias was appraised with funnel plots. Sensitivity analysis was conducted to evaluate the robustness of meta-analysis findings. Meta-analysis of 11 studies involving 1297 PE cases and 1791 controls found a significant association between the SERPINE1 -675 4G/5G polymorphism and PE for the recessive genetic model (OR = 1.36, 95% CI: 1.13-1.64, P = 0.001), a robust finding according to sensitivity analysis. A low level of between-study heterogeneity was detected (I(2) = 20%) in this comparison, which may be explained by ethnic differences. Funnel plot inspection did not reveal evidence of publication bias. In conclusion, this study provides a comprehensive examination of the available literature on the association between SERPINE1 -675 4G/5G and PE. Meta-analysis results support this polymorphism as a likely susceptibility variant for PE.

  9. Complementary Paired G4FETs as Voltage-Controlled NDR Device

    NASA Technical Reports Server (NTRS)

    Mojarradi, Mohammad; Chen, Suheng; Blalock, Ben; Britton, Chuck; Prothro, Ben; Vandersand, James; Schrimph, Ron; Cristoloveanu, Sorin; Akavardar, Kerem; Gentil, P.

    2009-01-01

    It is possible to synthesize a voltage-controlled negative-differential-resistance (NDR) device or circuit by use of a pair of complementary G4FETs (four-gate field-effect transistors). [For more information about G4FETs, please see the immediately preceding article]. As shown in Figure 1, the present voltage-controlled NDR device or circuit is an updated version of a prior NDR device or circuit, known as a lambda diode, that contains a pair of complementary junction field-effect transistors (JFETs). (The lambda diode is so named because its current-versus- voltage plot bears some resemblance to an upper-case lambda.) The present version can be derived from the prior version by substituting G4FETs for the JFETs and connecting both JFET gates of each G4FET together. The front gate terminals of the G4FETs constitute additional terminals (that is, terminals not available in the older JFET version) to which one can apply control voltages VN and VP. Circuits in which NDR devices have been used include (1) Schmitt triggers and (2) oscillators containing inductance/ capacitance (LC) resonant circuits. Figure 2 depicts such circuits containing G4FET NDR devices like that of Figure 1. In the Schmitt trigger shown here, the G4FET NDR is loaded with an ordinary inversion-mode, p-channel, metal oxide/semiconductor field-effect transistor (inversion-mode PMOSFET), the VN terminal of the G4FET NDR device is used as an input terminal, and the input terminals of the PMOSFET and the G4FET NDR device are connected. VP can be used as an extra control voltage (that is, a control voltage not available in a typical prior Schmitt trigger) for adjusting the pinch-off voltage of the p-channel G4FET and thereby adjusting the trigger-voltage window. In the oscillator, a G4FET NDR device is loaded with a conventional LC tank circuit. As in other LC NDR oscillators, oscillation occurs because the NDR counteracts the resistance in the tank circuit. The advantage of this G4FET-NDR LC oscillator

  10. Assessment of G3(MP2)//B3 theory including a pseudopotential for molecules containing first-, second-, and third-row representative elements

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rocha, Carlos Murilo Romero; Morgon, Nelson Henrique; Custodio, Rogério, E-mail: roger@iqm.unicamp.br

    2013-11-14

    G3(MP2)//B3 theory was modified to incorporate compact effective potential (CEP) pseudopotentials, providing a theoretical alternative referred to as G3(MP2)//B3-CEP for calculations involving first-, second-, and third-row representative elements. The G3/05 test set was used as a standard to evaluate the accuracy of the calculated properties. G3(MP2)//B3-CEP theory was applied to the study of 247 standard enthalpies of formation, 104 ionization energies, 63 electron affinities, 10 proton affinities, and 22 atomization energies, comprising 446 experimental energies. The mean absolute deviations compared with the experimental data for all thermochemical results presented an accuracy of 1.4 kcal mol{sup −1} for G3(MP2)//B3 and 1.6more » kcal mol{sup −1} for G3(MP2)//B3-CEP. Approximately 75% and 70% of the calculated properties are found with accuracy between ±2 kcal mol{sup −1} for G3(MP2)//B3 and G3(MP2)//B3-CEP, respectively. Considering a confidence interval of 95%, the results may oscillate between ±4.2 kcal mol{sup −1} and ±4.6 kcal mol{sup −1}, respectively. The overall statistical behavior indicates that the calculations using pseudopotential present similar behavior with the all-electron theory. Of equal importance to the accuracy is the CPU time, which was reduced by between 10% and 40%.« less

  11. Relative stabilities of IgG1 and IgG4 Fab domains: Influence of the light–heavy interchain disulfide bond architecture

    PubMed Central

    Heads, James T; Adams, Ralph; D'Hooghe, Lena E; Page, Matt J T; Humphreys, David P; Popplewell, Andrew G; Lawson, Alastair D; Henry, Alistair J

    2012-01-01

    The stability of therapeutic antibodies is a prime pharmaceutical concern. In this work we examined thermal stability differences between human IgG1 and IgG4 Fab domains containing the same variable regions using the thermofluor assay. It was found that the IgG1 Fab domain is up to 11°C more stable than the IgG4 Fab domain containing the same variable region. We investigated the cause of this difference with the aim of developing a molecule with the enhanced stability of the IgG1 Fab and the biological properties of an IgG4 Fc. We found that replacing the seven residues, which differ between IgG1 CH1 and IgG4 CH1 domains, while retaining the native IgG1 light-heavy interchain disulfide (L–H) bond, did not affect thermal stability. Introducing the IgG1 type L–H interchain disulfide bond (DSB) into the IgG4 Fab resulted in an increase in thermal stability to levels observed in the IgG1 Fab with the same variable region. Conversely, replacement of the IgG1 L–H interchain DSB with the IgG4 type L–H interchain DSB reduced the thermal stability. We utilized the increased stability of the IgG1 Fab and designed a hybrid antibody with an IgG1 CH1 linked to an IgG4 Fc via an IgG1 hinge. This construct has the expected biophysical properties of both the IgG4 Fc and IgG1 Fab domains and may therefore be a pharmaceutically relevant format. PMID:22761163

  12. Selective interaction of AGS3 with G-proteins and the influence of AGS3 on the activation state of G-proteins.

    PubMed

    Bernard, M L; Peterson, Y K; Chung, P; Jourdan, J; Lanier, S M

    2001-01-12

    AGS3 (activator of G-protein signaling 3) was isolated in a yeast-based functional screen for receptor-independent activators of heterotrimeric G-proteins. As an initial approach to define the role of AGS3 in mammalian signal processing, we defined the AGS3 subdomains involved in G-protein interaction, its selectivity for G-proteins, and its influence on the activation state of G-protein. Immunoblot analysis with AGS3 antisera indicated expression in rat brain, the neuronal-like cell lines PC12 and NG108-15, as well as the smooth muscle cell line DDT(1)-MF2. Immunofluorescence studies and confocal imaging indicated that AGS3 was predominantly cytoplasmic and enriched in microdomains of the cell. AGS3 coimmunoprecipitated with Galpha(i3) from cell and tissue lysates, indicating that a subpopulation of AGS3 and Galpha(i) exist as a complex in the cell. The coimmunoprecipitation of AGS3 and Galpha(i) was dependent upon the conformation of Galpha(i3) (GDP GTPgammaS (guanosine 5'-3-O-(thio)triphosphate)). The regions of AGS3 that bound Galpha(i) were localized to four amino acid repeats (G-protein regulatory motif (GPR)) in the carboxyl terminus (Pro(463)-Ser(650)), each of which were capable of binding Galpha(i). AGS3-GPR domains selectively interacted with Galpha(i) in tissue and cell lysates and with purified Galpha(i)/Galpha(t). Subsequent experiments with purified Galpha(i2) and Galpha(i3) indicated that the carboxyl-terminal region containing the four GPR motifs actually bound more than one Galpha(i) subunit at the same time. The AGS3-GPR domains effectively competed with Gbetagamma for binding to Galpha(t(GDP)) and blocked GTPgammaS binding to Galpha(i1). AGS3 and related proteins provide unexpected mechanisms for coordination of G-protein signaling pathways.

  13. Role of -675 4G/5G in the plasminogen activator inhibitor-1 gene and -308G/A tumor necrosis factor-α gene polymorphisms in obese Argentinean patients.

    PubMed

    Wingeyer, Silvia D Perés; Graffigna, Mabel N; Belli, Susana H; Benetucci, Jorge; de Larrañaga, Gabriela F

    2012-05-01

    Plasminogen activator inhibitor-1 (PAI-1) and tumor necrosis factor-α (TNF-α) are increased in the circulation of obese persons. Because a direct link between PAI-1 and TNF-α in obesity has been observed, they are candidate genes for the development of obesity. We sought to evaluate the relation between the genotypic and allelic frequencies of the -675 4G/5G PAI-1 and -308 G/A TNF-α polymorphisms and their association with the risk for obesity in an Argentinean population. A group of 110 consecutive obese persons and a group of 111 lean controls were recruited. Polymerase chain reaction was used to determine the frequency of PAI-1 and TNF-α polymorphisms; serum fasting glucose, insulin, and lipid levels were measured by standard methods. Insulin sensitivity was evaluated by using homeostasis model assessment. The -308 TNF-α and -675 4G/5G PAI-1 genotype distribution did not significantly differ between the groups (p=0.544 and p=0.327, respectively). Homeostasis model assessment was the only positive independent determinant of body mass index (R(2)=0.493; p<0.001). The -675 4G/5G PAI-1 and the -308 TNF-α polymorphism variants tested in this study, individually or combined, were not associated with obesity in an Argentinean population.

  14. The mCpG-binding domain of human MBD3 does not bind to mCpG but interacts with NuRD/Mi2 components HDAC1 and MTA2.

    PubMed

    Saito, Motoki; Ishikawa, Fuyuki

    2002-09-20

    Although mammalian MBD3 contains the mCpG-binding domain (MBD) and is highly homologous with the authentic mCpG-binding protein MBD2, it was reported that the protein does not bind to mCpG specifically. Using recombinant human wild type and mutant MBD3 proteins, we demonstrated that atypical amino acids found in MBD3 MBD, namely, His-30 and Phe-34, are responsible for the inability of MBD3 to bind to mCpG. Interestingly, although H30K/F34Y MBD3 mutant protein binds to mCpG efficiently in vitro, it was not localized at the mCpG-rich pericentromeric regions in mouse cells. We also showed that Y34F MBD2b MBD, which possesses not the mCpG-specific DNA-binding activity but the nonspecific DNA-binding activity, was localized at the pericentromeric regions. These results suggested that the mCpG-specific DNA-binding activity is largely dispensable, and another factor(s) is required for the localization of MBD proteins in vivo. MBD3 was identified as a component of the NuRD/Mi2 complex that shows chromatin remodeling and histone deacetylase activities. We demonstrated that MBD3 MBD is necessary and sufficient for binding to HDAC1 and MTA2, two components of the NuRD/Mi2 complex. It was therefore suggested that mCpG-binding-defective MBD3 has evolutionarily conserved its MBD because of the secondary role played by the MBD in protein-protein interactions.

  15. Association of the Plasminogen Activator Inhibitor-1 (PAI-1) Gene -675 4G/5G and -844 A/G Promoter Polymorphism with Risk of Keloid in a Chinese Han Population

    PubMed Central

    Wang, Yongjie; Long, Jianhong; Wang, Xiaoyan; Sun, Yang

    2014-01-01

    Background A keloid is pathological scar caused by aberrant response to skin injuries, characterized by excessive accumulation of histological extracellular matrix, and occurs in genetically susceptible individuals. Plasminogen activator inhibitor-1 (PAI-1) has been implicated in the pathogenesis of keloid. We investigated the association between PAI-1 polymorphisms and plasma PAI-1 level with keloid risk. Material/Methods A total of 242 Chinese keloid patients and 207 controls were enrolled in this study. Polymerase chain reaction-restriction technique was used to determine PAI-1 promoter polymorphism (-675 4G/5G and -844 A/G) distribution. Plasma PAI-1 levels were detected using enzyme-linked immunosorbent assay (ELISA). Results There was a statistically significant difference in the distribution of PAI-1 -675 4G/5G polymorphism between keloid patients and healthy controls. 4G/4G carriers were more likely to develop keloid. In contrast, the -844 A/G polymorphism distribution did not vary significantly between keloid patients and controls. The keloid patients group had a significantly higher plasma PAI-1 level than the control group. In the -675 4G/4G carrier population, the plasma PAI-1 levels were significant higher in keloid patients compared with controls. Conclusions Our study provides evidence that PAI-1 promoter polymorphism -675 4G/5G and plasma PAI-1 level are associated with keloid risk. PAI-1 -675 4G/5G polymorphism may be an important hereditary factor responsible for keloid development in the Chinese Han population. PMID:25350781

  16. Science Highlights from the Spitzer Survey of Stellar Structure in Galaxies (S4G) & Public Release of S4G Data

    NASA Astrophysics Data System (ADS)

    Sheth, Kartik

    2013-01-01

    The Spitzer Survey of Stellar Structure in Galaxies (S4G) is the largest and the most homogenous survey of the distribution of mass and stellar structure in over 2,300 nearby galaxies. With an integration time of four minutes per pixel at 3.6 and 4.5 microns, the S4G maps are extremely deep, tracing the stellar surface densities of < 1 solar mass per square parsec! S4G is the ultimate survey of the endoskeleton of nearby galaxies from dwarfs to ellipticals and affords an incredible treasury of data which we can address a host of outstanding questions in galaxy evolution. At this special session we will present details on the public release of this survey which will include science ready images, masks for the foreground and background stars, globally integrated properties and radial profiles of all galaxies. In addition we will release the results from a GALFIT decomposition of 200 galaxies which will be supplemented with the remainder of the survey within six months. The data are being released through the NASA/IPAC Infrared Science Archive (IRSA). I will present an overview of the survey, the data we are releasing, introduce the speakers and present science highlights from the team.

  17. IgG abnormality in narcolepsy and idiopathic hypersomnia.

    PubMed

    Tanaka, Susumu; Honda, Makoto

    2010-03-05

    A close association between narcolepsy and the Human Leukocyte Antigen (HLA)-DQB1*0602 allele suggests the involvement of the immune system, or possibly an autoimmune process. We investigated serum IgG levels in narcolepsy. We measured the serum total IgG levels in 159 Japanese narcolepsy-cataplexy patients positive for the HLA-DQB1*0602 allele, 28 idiopathic hypersomnia patients with long sleep time, and 123 healthy controls (the HLA-DQB1*0602 allele present in 45 subjects). The serum levels of each IgG subclass were subsequently measured. The distribution of serum IgG was significantly different among healthy controls negative for the HLA-DQB1*0602 allele (11.66+/-3.55 mg/ml), healthy controls positive for the HLA-DQB1*0602 allele (11.45+/-3.43), narcolepsy patients (9.67+/-3.38), and idiopathic hypersomnia patients (13.81+/-3.80). None of the following clinical variables, age, disease duration, Epworth Sleepiness Scale, smoking habit and BMI at the time of blood sampling, were associated with IgG levels in narcolepsy or idiopathic hypersomnia. Furthermore we found the decrease in IgG1 and IgG2 levels, stable expression of IgG3, and the increase in the proportion of IgG4 in narcolepsy patients with abnormally low IgG levels. The increase in the proportion of IgG4 levels was also found in narcolepsy patients with normal serum total IgG levels. Idiopathic hypersomnia patients showed a different pattern of IgG subclass distribution with high IgG3 and IgG4 level, low IgG2 level, and IgG1/IgG2 imbalance. Our study is the first to determine IgG abnormalities in narcolepsy and idiopathic hypersomnia by measuring the serum IgG levels in a large number of hypersomnia patients. The observed IgG abnormalities indicate humoral immune alterations in narcolepsy and idiopathic hypersomnia. Different IgG profiles suggest immunological differences between narcolepsy and idiopathic hypersomnia.

  18. Enantioselective light switch effect of Δ- and Λ-[Ru(phenanthroline)2 dipyrido[3,2-a:2', 3'-c]phenazine]2+ bound to G-quadruplex DNA.

    PubMed

    Park, Jin Ha; Lee, Hyun Suk; Jang, Myung Duk; Han, Sung Wook; Kim, Seog K; Lee, Young-Ae

    2018-06-01

    The interaction of Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ (DPPZ = dipyrido[3,2-a:2', 3'-c]phenazine, phen = phenanthroline) with a G-quadruplex formed from 5'-G 2 T 2 G 2 TGTG 2 T 2 G 2-3 '(15-mer) was investigated. The well-known enhancement of luminescence intensity (the 'light-switch' effect) was observed for the [Ru(phen) 2 DPPZ] 2+ complexes upon formation of an adduct with the G-quadruplex. The emission intensity of the G-quadruplex-bound Λ-isomer was 3-fold larger than that of the Δ-isomer when bound to the G-quadruplex, which is opposite of the result observed in the case of double stranded DNA (dsDNA); the light switch effect is larger for the dsDNA-bound Δ-isomer. In the job plot of the G-quadruplex with Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ , a major inflection point for the two isomers was observed at x ≈ .65, which suggests a binding stoichiometry of 2:1 for both enantiomers. When the G base at the 8th position was replaced with 6-methyl isoxanthopterin (6MI), a fluorescent guanine analog, the excited energy of 6-MI transferred to bound Δ- or Λ-[Ru(phen) 2 DPPZ] 2+ , which suggests that at least a part of both Ru(II) enantiomers is close to or in contact with the diagonal loop of the G-quadruplex. A luminescence quenching experiment using [Fe(CN) 6 ] 4- for the G-quadruplex-bound Ru(II) complex revealed downward bending curves for both enantiomers in the Stern-Volmer plot, which suggests the presence of Ru(II) complexes that are both accessible and inaccessible to the quencher and may be related to the 2:1 binding stoichiometry.

  19. Isoguanine quartets formed by d(T4isoG4T4): tetraplex identification and stability.

    PubMed Central

    Seela, F; Wei, C; Melenewski, A

    1996-01-01

    The self-aggregation of the oligonucleotide d(T4isoG4T4) (1) is investigated. Based on ion exchange HPLC experiments and CD spectroscopy, a tetrameric structure is identified. This structure was formed in the presence of sodium ions and shows almost the same chromatographic mobility on ion exchange HPLC as d(T4G4T4) (2). The ratio of aggregate versus monomer is temperature dependent and the tetraplex of [d(T4isoG4T4)]4 is more stable than that of [d(T4G4T4)]4. A mixture of d(T4isoG4T4) and d(T4G4T4) forms mixed tetraplexes containing strands of d(T4isoG4T4) and d(T4G4T4). PMID:9016664

  20. Plasmonic resonance enhanced photoelectrochemical aptasensors based on g-C3N4/Bi2MoO6.

    PubMed

    Qiu, Zhenli; Shu, Jian; Tang, Dianping

    2018-06-13

    An in-depth exploration associated with the localized surface plasmon resonance (LSPR) effect for plasmonic photoelectrochemistry (PEC) is beneficial for the development of high-efficiency biosensors. A novel phenomenon on the LSPR between g-C3N4/Bi2MoO6 and gold nanoparticles is investigated in a PEC aptasensing system under ultraviolet and visible light irradiation.

  1. Structural characterization of the Man5 glycoform of human IgG3 Fc

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shah, Ishan S.; Lovell, Scott; Mehzabeen, Nurjahan

    Immunoglobulin G (IgG) consists of four subclasses in humans: IgG1, IgG2, IgG3 and IgG4, which are highly conserved but have unique differences that result in subclass-specific effector functions. Though IgG1 is the most extensively studied IgG subclass, study of other subclasses is important to understand overall immune function and for development of new therapeutics. When compared to IgG1, IgG3 exhibits a similar binding profile to Fcγ receptors and stronger activation of complement. All IgG subclasses are glycosylated at N297, which is required for Fcγ receptor and C1q complement binding as well as maintaining optimal Fc conformation. We have determined themore » crystal structure of homogenously glycosylated human IgG3 Fc with a GlcNAc2Man5 (Man5) high mannose glycoform at 1.8 Å resolution and compared its structural features with published structures from the other IgG subclasses. Although the overall structure of IgG3 Fc is similar to that of other subclasses, some structural perturbations based on sequence differences were revealed. For instance, the presence of R435 in IgG3 (and H435 in the other IgG subclasses) has been implicated to result in IgG3-specific properties related to binding to protein A, protein G and the neonatal Fc receptor (FcRn). The IgG3 Fc structure helps to explain some of these differences. Additionally, protein-glycan contacts observed in the crystal structure appear to correlate with IgG3 affinity for Fcγ receptors as shown by binding studies with IgG3 Fc glycoforms. Finally, this IgG3 Fc structure provides a template for further studies aimed at engineering the Fc for specific gain of function.« less

  2. Photocatalytic reductive dechlorination of 2-chlorodibenzo-p-dioxin by Pd modified g-C3N4 photocatalysts under UV-vis irradiation: Efficacy, kinetics and mechanism.

    PubMed

    Ding, Jiafeng; Long, Gaoyuan; Luo, Yang; Sun, Runze; Chen, Mengxia; Li, Yajun; Zhou, Yanfang; Xu, Xinhua; Zhao, Weirong

    2018-05-09

    Polychlorinated dibenzo-p-dioxins (PCDDs), as a group of notorious anthropogenic environmental toxicants, are arguably ubiquitous in nature. In this study, we investigated the photocatalytic reductive dechlorination of 2-chlorodibenzo-p-dioxin (2-CDD) over Pd/g-C 3 N 4 catalysts under UV-vis irradiation. The g-C 3 N 4 and a series of Pd/g-C 3 N 4 catalysts were prepared by thermal polymerization and mechanical mixing-illumination method and characterized by XRD, TEM, BET, SEM and UV-vis DRS analyses. Among all the samples, the Pd/g-C 3 N 4 (5 wt%) yielded the optimal dechlorination activity with a total 2-CDD conversion of 54% within 4 h, and 76% of those converted 2-CDD were evolved to dibenzo-p-dioxin (DD). The kinetics of dechlorination could be described as pseudo-first-order decay model (R 2  > 0.84). Corresponding rate constants (k) increased from 0.052 to 0.17 h -1 with Pd contents up to 5 wt% and decreased to 0.13 h -1 with a 10 wt% of Pd. The enhanced activities originated from the surface plasmonic resonance (SPR) effect of Pd nanoparticles and the formation of Schottky barrier between Pd and g-C 3 N 4 , which extend the spectrum responsive range and suppress the charge recombination of g-C 3 N 4 . This is the first report on the photocatalytic reductive removal of PCDDs and may provide a new approach for PCDDs pollution control. Copyright © 2018 Elsevier B.V. All rights reserved.

  3. Broadband sensitized white light emission of g-C{sub 3}N{sub 4}/Y{sub 2}MoO{sub 6}:Eu{sup 3+} composite phosphor under near ultraviolet excitation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Han, Bing, E-mail: hanbing@zzuli.edu.cn; Xue, Yongfei; Li, Pengju

    2015-12-15

    The g-C{sub 3}N{sub 4}/Y{sub 2}MoO{sub 6}:Eu{sup 3+} composite phosphors were synthesized and characterized by X-ray diffraction, Fourier transform-infrared spectroscopy, ultraviolet visible diffuse reflection spectra, photoluminescence spectra and luminescence decay curves. Under the excitation of 360 nm near ultraviolet light, these composite phosphors show tunable emission from blue to red region, in which white light emission can be obtained in term of appropriate quality proportion of Y{sub 2}MoO{sub 6}:Eu{sup 3+} relative to g-C{sub 3}N{sub 4}/Y{sub 2}MoO{sub 6}:Eu{sup 3+}. In addition, the emission color can be also dependent on the excitation wavelength in g-C{sub 3}N{sub 4}/Y{sub 2}MoO{sub 6}:Eu{sup 3+} composite phosphor. -more » Graphical abstract: Under the excitation of 360 nm near ultraviolet light, the g-C{sub 3}N{sub 4}/Y{sub 2}MoO{sub 6}:Eu{sup 3+} composite phosphors show tunable emission from blue to red region, in which white light emission can be obtained. - Highlights: • The g-C3N4/Y2MoO6:Eu{sup 3+} composite phosphors were synthesized and characterized. • White light emission was realized in the g-C3N4/Y2MoO6:Eu{sup 3+} composites under UV excitation. • A novel idea to realize the broadband sensitized white light emission in phosphors was provided.« less

  4. Comparative analysis of 3D culture methods on human HepG2 cells.

    PubMed

    Luckert, Claudia; Schulz, Christina; Lehmann, Nadja; Thomas, Maria; Hofmann, Ute; Hammad, Seddik; Hengstler, Jan G; Braeuning, Albert; Lampen, Alfonso; Hessel, Stefanie

    2017-01-01

    Human primary hepatocytes represent a gold standard in in vitro liver research. Due to their low availability and high costs alternative liver cell models with comparable morphological and biochemical characteristics have come into focus. The human hepatocarcinoma cell line HepG2 is often used as a liver model for toxicity studies. However, under two-dimensional (2D) cultivation conditions the expression of xenobiotic-metabolizing enzymes and typical liver markers such as albumin is very low. Cultivation for 21 days in a three-dimensional (3D) Matrigel culture system has been reported to strongly increase the metabolic competence of HepG2 cells. In our present study we further compared HepG2 cell cultivation in three different 3D systems: collagen, Matrigel and Alvetex culture. Cell morphology, albumin secretion, cytochrome P450 monooxygenase enzyme activities, as well as gene expression of xenobiotic-metabolizing and liver-specific enzymes were analyzed after 3, 7, 14, and 21 days of cultivation. Our results show that the previously reported increase of metabolic competence of HepG2 cells is not primarily the result of 3D culture but a consequence of the duration of cultivation. HepG2 cells grown for 21 days in 2D monolayer exhibit comparable biochemical characteristics, CYP activities and gene expression patterns as all 3D culture systems used in our study. However, CYP activities did not reach the level of HepaRG cells. In conclusion, the increase of metabolic competence of the hepatocarcinoma cell line HepG2 is not due to 3D cultivation but rather a result of prolonged cultivation time.

  5. Relation between osteonecrosis of the femoral head and PAI-1 4G/5G gene polymorphism: a meta-analysis.

    PubMed

    Zeng, Zheng; Wang, Bing; Pan, Haitao

    2015-01-01

    The aim of this study was to investigate the association of plasminogen activator inhibitor-1 (PAI-1) 4G/5G gene polymorphism and osteonecrosis of the femoral head (ONFH). The pooled relative risk ratio (RR) and 95% confidence intervals (95% CI) were calculated using the the RevMan 5.0 software. The present study included 969 patients with ONFH and 419 healthy controls. The Meta analysis results showed: There is association between PAI-1 gene 4G/5G polymorphism and the increasing risk of ONFH (allele model: RR = 1.24, 95% CI = 1.16 ~ 1.33; dominant genetic model: RR = 1.12, 95% CI = 1.05 ~ 1.18). It was found that the association between PAI-1 gene 4 G/5 G polymorphism and the susceptibility of ONFH (P < 0.05) through the comparison of Caucasian population and Asian people according to the analysis of different races. There is association between PAI-1 gene 4 G/5 G polymorphism and the increasing of the susceptibility of ONFH.

  6. Effects of calcining temperature on photocatalysis of g-C{sub 3}N{sub 4}/TiO{sub 2} composites for hydrogen evolution from water

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Qu, Ailan, E-mail: elainqal@163.com; Xu, Xinmei; Xie, Haolong

    Highlights: • TiO{sub 2} promotes melon to form at 400 °C, whereas it forms at 500 °C for only melamine. • The highest photocatalytic activity was achieved when calcination was performed at 400 °C. • Coordinated N−Ti−N bonds were formed in MA/TiO{sub 2} (400) and disappeared at high temperature. • The surface area decreased and the pore size increased with increasing of temperature. • Only MA/TiO{sub 2} (400) has a narrower band gap than pure g-C{sub 3}N{sub 4}. - Abstract: A composite of graphitic carbon nitride and TiO{sub 2} (g-C{sub 3}N{sub 4}/TiO{sub 2}) with enhanced photocatalytic hydrogen evolution capacity wasmore » achieved by calcining melamine and TiO{sub 2} sol-gel precursor. Characterization results reveal that heating temperature had a great influence on the structure, surface area and properties of the composites. Compared with the polycondensation of pure melamine, the presence of TiO{sub 2} precursor can promote the formation of melon at a low temperature. The highest photocatalytic activity of g-C{sub 3}N{sub 4}/TiO{sub 2}(400) was achieved when the calcination was performed at 400 °C, exhibiting H{sub 2} production rate of 76.25 μmol/h under UV–vis light irradiation (λ > 320 nm) and 35.44 μmol/h under visible light irradiation (λ > 420 nm). The highest photocatalytic performance of g-C{sub 3}N{sub 4}/TiO{sub 2}(400) can be attributed to: (1) the strong UV–vis light absorption due to the narrow bandgap caused by synergic effect of TiO{sub 2} and g-C{sub 3}N{sub 4}, (2) high surface area and porosity, (3) the effective separation of photo-generated electron-holes owing to the favorable heterojunction between TiO{sub 2} and g-C{sub 3}N{sub 4}.« less

  7. Exploring the formation and electronic structure properties of the g-C3N4 nanoribbon with density functional theory

    NASA Astrophysics Data System (ADS)

    Wu, Hong-Zhang; Zhong, Qing-Hua; Bandaru, Sateesh; Liu, Jin; Lau, Woon Ming; Li, Li-Li; Wang, Zhenling

    2018-04-01

    The optical properties and condensation degree (structure) of polymeric g-C3N4 depend strongly on the process temperature. For polymeric g-C3N4, its structure and condensation degree depend on the structure of molecular strand(s). Here, the formation and electronic structure properties of the g-C3N4 nanoribbon are investigated by studying the polymerization and crystallinity of molecular strand(s) employing first-principle density functional theory. The calculations show that the width of the molecular strand has a significant effect on the electronic structure of polymerized and crystallized g-C3N4 nanoribbons, a conclusion which would be indirect evidence that the electronic structure depends on the structure of g-C3N4. The edge shape also has a distinct effect on the electronic structure of the crystallized g-C3N4 nanoribbon. Furthermore, the conductive band minimum and valence band maximum of the polymeric g-C3N4 nanoribbon show a strong localization, which is in good agreement with the quasi-monomer characters. In addition, molecular strands prefer to grow along the planar direction on graphene. These results provide new insight on the properties of the g-C3N4 nanoribbon and the relationship between the structure and properties of g-C3N4.

  8. Exploring the formation and electronic structure properties of the g-C3N4 nanoribbon with density functional theory.

    PubMed

    Wu, Hong-Zhang; Zhong, Qing-Hua; Bandaru, Sateesh; Liu, Jin; Lau, Woon Ming; Li, Li-Li; Wang, Zhenling

    2018-04-18

    The optical properties and condensation degree (structure) of polymeric g-C 3 N 4 depend strongly on the process temperature. For polymeric g-C 3 N 4 , its structure and condensation degree depend on the structure of molecular strand(s). Here, the formation and electronic structure properties of the g-C 3 N 4 nanoribbon are investigated by studying the polymerization and crystallinity of molecular strand(s) employing first-principle density functional theory. The calculations show that the width of the molecular strand has a significant effect on the electronic structure of polymerized and crystallized g-C 3 N 4 nanoribbons, a conclusion which would be indirect evidence that the electronic structure depends on the structure of g-C 3 N 4 . The edge shape also has a distinct effect on the electronic structure of the crystallized g-C 3 N 4 nanoribbon. Furthermore, the conductive band minimum and valence band maximum of the polymeric g-C 3 N 4 nanoribbon show a strong localization, which is in good agreement with the quasi-monomer characters. In addition, molecular strands prefer to grow along the planar direction on graphene. These results provide new insight on the properties of the g-C 3 N 4 nanoribbon and the relationship between the structure and properties of g-C 3 N 4 .

  9. Immunization with a Vaccine Combining Herpes Simplex Virus 2 (HSV-2) Glycoprotein C (gC) and gD Subunits Improves the Protection of Dorsal Root Ganglia in Mice and Reduces the Frequency of Recurrent Vaginal Shedding of HSV-2 DNA in Guinea Pigs Compared to Immunization with gD Alone ▿

    PubMed Central

    Awasthi, Sita; Lubinski, John M.; Shaw, Carolyn E.; Barrett, Shana M.; Cai, Michael; Wang, Fushan; Betts, Michael; Kingsley, Susan; DiStefano, Daniel J.; Balliet, John W.; Flynn, Jessica A.; Casimiro, Danilo R.; Bryan, Janine T.; Friedman, Harvey M.

    2011-01-01

    Attempts to develop a vaccine to prevent genital herpes simplex virus 2 (HSV-2) disease have been only marginally successful, suggesting that novel strategies are needed. Immunization with HSV-2 glycoprotein C (gC-2) and gD-2 was evaluated in mice and guinea pigs to determine whether adding gC-2 to a gD-2 subunit vaccine would improve protection by producing antibodies that block gC-2 immune evasion from complement. Antibodies produced by gC-2 immunization blocked the interaction between gC-2 and complement C3b, and passive transfer of gC-2 antibody protected complement-intact mice but not C3 knockout mice against HSV-2 challenge, indicating that gC-2 antibody is effective, at least in part, because it prevents HSV-2 evasion from complement. Immunization with gC-2 also produced neutralizing antibodies that were active in the absence of complement; however, the neutralizing titers were higher when complement was present, with the highest titers in animals immunized with both antigens. Animals immunized with the gC-2-plus-gD-2 combination had robust CD4+ T-cell responses to each immunogen. Multiple disease parameters were evaluated in mice and guinea pigs immunized with gC-2 alone, gD-2 alone, or both antigens. In general, gD-2 outperformed gC-2; however, the gC-2-plus-gD-2 combination outperformed gD-2 alone, particularly in protecting dorsal root ganglia in mice and reducing recurrent vaginal shedding of HSV-2 DNA in guinea pigs. Therefore, the gC-2 subunit antigen enhances a gD-2 subunit vaccine by stimulating a CD4+ T-cell response, by producing neutralizing antibodies that are effective in the absence and presence of complement, and by blocking immune evasion domains that inhibit complement activation. PMID:21813597

  10. A diagnostic pitfall in IgG4-related hypophysitis: infiltration of IgG4-positive cells in the pituitary of granulomatosis with polyangiitis.

    PubMed

    Bando, Hironori; Iguchi, Genzo; Fukuoka, Hidenori; Taniguchi, Masaaki; Kawano, Seiji; Saitoh, Miki; Yoshida, Kenichi; Matsumoto, Ryusaku; Suda, Kentaro; Nishizawa, Hitoshi; Takahashi, Michiko; Morinobu, Akio; Kohmura, Eiji; Ogawa, Wataru; Takahashi, Yutaka

    2015-10-01

    Immunoglobulin (Ig) G4-related hypophysitis is an emerging clinical entity, which is characterized by an elevated serum IgG4 concentration and infiltration of IgG4-positive plasma cells in the pituitary. Although some criteria for its diagnosis have been proposed, they have not been fully established. In particular, differential diagnosis from secondary chronic inflammation including granulomatosis with polyangiitis (GPA) is difficult in some cases. We describe central diabetes insipidus with pituitary swelling exhibiting infiltration of IgG4-positive cells. A 43-year-old woman in the remission stage of GPA presented with sudden-onset polyuria and polydipsia. Pituitary magnetic resonance imaging revealed swelling of the anterior and posterior pituitary and stalk, with heterogeneous gadolinium enhancement and disappearance of the high signal intensity of the posterior pituitary. Evaluation of biochemical markers for GPA suggested that the disease activity was well-controlled. Endocrinological examination revealed the presence of central diabetes insipidus and growth hormone deficiency. Pituitary biopsy specimen showed IgG4-positive cells, with a 43% IgG4(+)/IgG(+) ratio, which met the criteria for IgG4-related hypophysitis. However, substantial infiltration of polymorphonuclear neutrophils with giant cells was also noted, resulting in a final diagnosis of pituitary involvement of GPA. These results suggest that pituitary involvement of GPA should be taken into account for the differential diagnosis of IgG4-related hypophysitis.

  11. APOBEC3G: a Double Agent in Defense

    PubMed Central

    Smith, Harold C.

    2011-01-01

    APOBEC3G (A3G) is an effective cellular host defense factor under experimental conditions in which a functional form of the HIV-encoded protein Vif cannot be expressed. Wild type Vif targets A3G for proteasomal degradation and along with it, any host defense advantage A3G might provide is severely diminished or lost. Recent evidence cast doubt on the potency of A3G in host defense and suggested that it could, under some circumstances, promote the emergence of more virulent HIV strains. In this article, I argue that it is time to recognize that A3G has the potential to act as a double agent. The path forward relies on understanding how cellular and viral regulatory mechanisms enable A3G antiviral function and on developing novel research reagents to explore these pathways. PMID:21239176

  12. QED contributions to electron g-2

    NASA Astrophysics Data System (ADS)

    Laporta, Stefano

    2018-05-01

    In this paper I briefly describe the results of the numerical evaluation of the mass-independent 4-loop contribution to the electron g-2 in QED with 1100 digits of precision. In particular I also show the semi-analytical fit to the numerical value, which contains harmonic polylogarithms of eiπ/3, e2iπ/3 and eiπ/2 one-dimensional integrals of products of complete elliptic integrals and six finite parts of master integrals, evaluated up to 4800 digits. I give also some information about the methods and the program used.

  13. [Pseudolaric acid B induces G2/M arrest and inhibits invasion and migration in HepG2 hepatoma cells].

    PubMed

    Li, Shuai; Guo, Lianyi

    2018-01-01

    Objective To investigate the mechanisms of pseudolaric acid B (PAB) blocks cell cycle and inhibits invasion and migration in human hepatoma HepG2 cells. Methods The proliferation effect of PAB on HepG2 cells was evaluated by MTT assay. The effect of PAB on the cell cycle of HepG2 cells was analyzed by flow cytometry. Immunofluorescence cytochemical staining was applied to observe the effect of PAB on the α-tubulin polymerization and expression in HepG2 cells. Transwell TM chamber invasion assay and wound healing assay were performed to detect the influence of PAB on the migration and invasion ability of HepG2 cells. Western blotting was used to determine the expressions of α-tubulin, E-cadherin and MMP-9 in HepG2 cells after treated with PAB. Results PAB inhibited the proliferation of HepG2 cells in a dose-dependent manner and blocked the cell cycle in G2/M phase. PAB significantly changed the polymerization and decreased the expression of α-tubulin. The capacities of invasion and migration of HepG2 cells treated by PAB were significantly depressed. The protein levels of α-tubulin and MMP-9 decreased while the E-cadherin protein level increased. Conclusion PAB can inhibits the proliferation of HepG2 cells by down-regulating the expression of α-tubulin and influencing its polymerization, arresting HepG2 cells in G2/M phase. Meanwhile, PAB also can inhibit the invasion and migration of HepG2 cells by lowering cytoskeleton α-tubulin and MMP-9, and increasing E-cadherin.

  14. Plasminogen activator inhibitor-1 5G/5G genotype is a protecting factor preventing posttransplant diabetes mellitus.

    PubMed

    Chang, Horng-Rong; Yang, Shun-Fa; Tsai, Jen-Pi; Hsieh, Ming-Chia; Wu, Sheng-Wen; Tsai, Hui-Ching; Hung, Tung-Wei; Huang, Jun-Huang; Lian, Jong-Da

    2011-01-30

    Plasminogen activator inhibitor 1 (PAI-1) is thought to play a role in the pathogenesis of obesity and insulin resistance. A connection between gestational diabetes mellitus and the functional -675 PAI-1 genotype has been reported. Therefore, we examined the role of the PAI-1 gene polymorphism in kidney transplant recipients. A total of 376 kidney transplant recipients were prospectively screened for posttransplant diabetes mellitus (PTDM). Eighty-one (21.5%) patients were diagnosed with PTDM and the other 295 patients were non-diabetic following kidney transplantation. DNA samples were isolated from the sera and analyzed for the functional -675 4G/5G promoter polymorphisms of the PAI-1 gene. Kidney transplant recipients with PTDM were significantly associated with tacrolimus use (p=0.03), older age (p=0.036), and higher body mass index (p=0.001). The genotype distribution was significantly different between the patients with PTDM (genotype 4G/4G:4G/5G:5G/5G=33.3%:60.5%:6.2%) and those without PTDM (genotype 4G/4G:4G/5G:5G/5G=36.9%:44.1%:19.0%) (p=0.018). Patients with homozygosity for 5G had a significantly lower rate of PTDM (aOR, 0.286, p=0.022) and higher cumulative event-free probability of time to PTDM (log rank test, p=0.0058). Homozygosity for the 5G allele of the PAI-1 gene constitutes a protecting factor for the development of PTDM. Our findings are similar to a previous study on gestational diabetes mellitus, and strongly support a possible genetic role of PAI-1 in the development of PTDM. Copyright © 2010 Elsevier B.V. All rights reserved.

  15. 40 CFR Appendix G to Subpart G of... - Substitutes Subject to Use Restrictions and Unacceptable Substitutes Listed in the March 3, 1999...

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... Restrictions and Unacceptable Substitutes Listed in the March 3, 1999, Final rule, Effective April 2, 1999. G Appendix G to Subpart G of Part 82 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... Pt. 82, Subpt. G, App. G Appendix G to Subpart G of Part 82—Substitutes Subject to Use Restrictions...

  16. 40 CFR Appendix G to Subpart G of... - Substitutes Subject to Use Restrictions and Unacceptable Substitutes Listed in the March 3, 1999...

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... Restrictions and Unacceptable Substitutes Listed in the March 3, 1999, Final rule, Effective April 2, 1999. G Appendix G to Subpart G of Part 82 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... Pt. 82, Subpt. G, App. G Appendix G to Subpart G of Part 82—Substitutes Subject to Use Restrictions...

  17. 40 CFR Appendix G to Subpart G of... - Substitutes Subject to Use Restrictions and Unacceptable Substitutes Listed in the March 3, 1999...

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... Restrictions and Unacceptable Substitutes Listed in the March 3, 1999, Final rule, Effective April 2, 1999. G Appendix G to Subpart G of Part 82 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... Pt. 82, Subpt. G, App. G Appendix G to Subpart G of Part 82—Substitutes Subject to Use Restrictions...

  18. Tumor Necrosis Factor (TNF) –308G>A, Nitric Oxide Synthase 3 (NOS3) +894G>T Polymorphisms and Migraine Risk: A Meta-Analysis

    PubMed Central

    Chen, Min; Tang, Wenjing; Hou, Lei; Liu, Ruozhuo; Dong, Zhao; Han, Xun; Zhang, Xiaofei; Wan, Dongjun; Yu, Shengyuan

    2015-01-01

    Background and Objective Conflicting data have been reported on the association between tumor necrosis factor (TNF) –308G>A and nitric oxide synthase 3 (NOS3) +894G>T polymorphisms and migraine. We performed a meta-analysis of case-control studies to evaluate whether the TNF –308G>A and NOS3 +894G>T polymorphisms confer genetic susceptibility to migraine. Method We performed an updated meta-analysis for TNF –308G>A and a meta-analysis for NOS3 +894G>T based on studies published up to July 2014. We calculated study specific odds ratios (OR) and 95% confidence intervals (95% CI) assuming allele contrast, dominant model, recessive model, and co-dominant model as pooled effect estimates. Results Eleven studies in 6682 migraineurs and 22591 controls for TNF –308G>A and six studies in 1055 migraineurs and 877 controls for NOS3 +894G>T were included in the analysis. Neither indicated overall associations between gene polymorphisms and migraine risk. Subgroup analyses suggested that the “A” allele of the TNF –308G>A variant increases the risk of migraine among non-Caucasians (dominant model: pooled OR = 1.82; 95% CI 1.15 – 2.87). The risk of migraine with aura (MA) was increased among both Caucasians and non-Caucasians. Subgroup analyses suggested that the “T” allele of the NOS3 +894G>T variant increases the risk of migraine among non-Caucasians (co-dominant model: pooled OR = 2.10; 95% CI 1.14 – 3.88). Conclusions Our findings appear to support the hypothesis that the TNF –308G>A polymorphism may act as a genetic susceptibility factor for migraine among non-Caucasians and that the NOS3 +894G>T polymorphism may modulate the risk of migraine among non-Caucasians. PMID:26098763

  19. High-performance for hydrogen evolution and pollutant degradation of reduced graphene oxide/two-phase g-C3N4 heterojunction photocatalysts.

    PubMed

    Song, Chengjie; Fan, Mingshan; Shi, Weidong; Wang, Wei

    2018-05-01

    We have successfully synthesized the composites of two-phase g-C 3 N 4 heterojunction photocatalysts by one-step method. And the reduced graphene oxide/two-phase g-C 3 N 4 heterojunction photocatalyst was fabricated via a facile hydrothermal reduction method. The characterization results indicated that the two-phase g-C 3 N 4 was integrated closely, and the common phenomenon of agglomeration for g-C 3 N 4 was significantly reduced. Moreover, the oxidized graphene was reduced successfully in the composites and the graphene was overlaid on the surface or the interlayers of g-C 3 N 4 heterojunction composite uniformly. In addition, we have carried out the photocatalytic activity experiments by H 2 evolution and rhodamine B removal, tetracycline removal under the visible light irradiation. The results revealed that the composite has improved the separation efficiency a lot than the pure photocatalyst. The photocurrent test demonstrated that the recombination of electrons and holes were efficiently inhibited as well as enhanced the photocatalytic activity. The 0.4% rGO loaded samples, 0.4% rGOCN2, own the best performance. Its rate of H 2 evolution was 15 times as high as that of the pure g-C 3 N 4 .

  20. Clinical features of a new disease concept, IgG4-related thyroiditis.

    PubMed

    Watanabe, T; Maruyama, M; Ito, T; Fujinaga, Y; Ozaki, Y; Maruyama, M; Kodama, R; Muraki, T; Hamano, H; Arakura, N; Kadoya, M; Suzuki, S; Komatsu, M; Shimojo, H; Notohara, K; Uchida, M; Kawa, S

    2013-01-01

    Immunoglobulin (Ig)G4-related disease is a recently proposed systemic disorder that includes autoimmune pancreatitis (AIP), Mikulicz's disease, and various other organ lesions. In the present retrospective study, we examined whether thyroid lesions should also be included in IgG4-related disease (Ig4-RD) under the new term IgG4-related thyroiditis. We enrolled 114 patients with Ig4-RD, including 92 patients with AIP, 15 patients with Mikulicz's disease, and seven patients with IgG4-related cholangitis, and analysed clinical findings, function, serum values of activity markers, computed tomography (CT) images, and histology of the thyroid gland. Among the 22 patients (19%) in our cohort who were found to have hypothyroidism [thyroid stimulating hormone (TSH) > 4 mIU/L], 11 patients had clinical hypothyroidism [free thyroxine (FT4) < 1 ng/dL] and 11 patients had subclinical hypothyroidism (FT4 ≥ 1 ng/dL). Serum concentrations of IgG, IgG4, circulating immune complex (CIC), and β2-microglobulin (β2-MG) were significantly higher in the hypothyroidism group compared with the remaining 92 euthyroid patients, and serum C3 concentration was significantly lower. After prednisolone treatment, TSH values had decreased significantly (p = 0.005) in this group and FT4 values had increased significantly (p = 0.047). CT images showed that the thyroid glands of patients with clinical hypothyroidism had a significantly greater volume than those of the euthyroid and other groups. Pathological analysis of one resected thyroid gland disclosed a focused lesion with infiltration of lymphocytes and IgG4-bearing plasma cells and loss of thyroid follicles. Thyroid lesions associated with hypothyroidism can be considered as a new disease termed IgG4-related thyroiditis. Awareness of this condition should lead to appropriate corticosteroid treatment that may prevent progression to a fibrous state.

  1. Residual vein thrombosis and onset of post-thrombotic syndrome: influence of the 4G/5G polymorphism of plasminogen activator inhibitor-1 gene.

    PubMed

    Incalcaterra, Egle; Meli, Francesco; Muratori, Ida; Corrado, Egle; Amato, Corrado; Canino, Baldassare; Ferrara, Filippo

    2014-03-01

    Plasminogen activator inhibitor-1 (PAI-1) is the most important inhibitor of plasminogen activator. The functional 4G/5G polymorphism of the gene coding for PAI-1 may affect PAI-1 plasmatic activity, influencing the imbalance between coagulation and fibrinolysis cascades. In this prospective cohort analytic study, we investigated the role of this single nucleotide polymorphism in the persistence of thrombotic lesion and the occurrence of post-thrombotic syndrome. In a group of 168 patients with post-surgical deep vein thrombosis of the legs, we analyzed the 4G/5G polymorphism in the promoter of PAI-1 gene and plasmatic PAI-1 activity. Enrolled patients were divided in two groups: patients with 4G/5G polymorphism and increased PAI-1 activity (n=85) and patients without 4G/5G polymorphism and normal PAI-1 activity (n=83). All patients were treated according to current protocols and re-examined after 3, 12 and 36 months in order to evaluate the persistence of thrombotic lesion and the occurrence of post-thrombotic syndrome. We found a significantly increased PAI activity in carrier of the 4G allele, who experienced much more frequently a persistence of thrombosis after 3, 12 and 36 months and/or the development of post-thrombosis syndrome, in spite of the anticoagulant treatment. These data not only confirm the role played by PAI-1 activity and by the 4G/5G SNP of the PAI-1 gene, but also suggest that current therapeutic protocols, recommending the administration of low weight molecular heparin and oral anticoagulant for the treatment of deep vein thrombosis, could be non sufficient for patients genetically predisposed to a less efficient clot lysis. Copyright © 2013. Published by Elsevier Ltd.

  2. Highly Efficient Performance and Conversion Pathway of Photocatalytic CH3SH Oxidation on Self-Stabilized Indirect Z-Scheme g-C3N4/I3--BiOI.

    PubMed

    Hu, Lingling; He, Huanjunwa; Xia, Dehua; Huang, Yajing; Xu, Jiarong; Li, Haoyue; He, Chun; Yang, Wenjing; Shu, Dong; Wong, Po Keung

    2018-06-06

    A self-stabilized Z-scheme porous g-C 3 N 4 /I 3- -containing BiOI ultrathin nanosheets (g-C 3 N 4 /I 3- -BiOI) heterojunction photocatalyst with I 3 - /I - redox mediator was successfully synthesized by a facile solvothermal method coupling with light illumination. The structure and optical properties of g-C 3 N 4 /I 3- -BiOI composites were systematically characterized by means of X-ray diffraction, scanning electron microscopy, transmission electron microscopy, Fourier transform infrared, X-ray photoelectron spectroscopy, N 2 adsorption/desorption, UV-vis diffuse reflectance spectrum, and photoluminescence. The g-C 3 N 4 /I 3- -BiOI composites, with a heterojunction between porous g-C 3 N 4 and BiOI ultrathin nanosheets, were first applied for the photocatalytic elimination of ppm-leveled CH 3 SH under light-emitting diode visible light illumination. The g-C 3 N 4 /I 3- -BiOI heterojunction with 10% g-C 3 N 4 showed a dramatically enhanced photocatalytic activity in the removal of CH 3 SH compared with pure BiOI and g-C 3 N 4 due to its effective interfacial charge transfer and separation. The adsorption and photocatalytic oxidation of CH 3 SH over g-C 3 N 4 /I 3- -BiOI were deeply explored by in situ diffuse reflectance infrared Fourier transform spectroscopy, and the intermediates and conversion pathways were elucidated and compared. Furthermore, on the basis of reactive species trapping, electron spin resonance and Mott-Schottky experiments, it was revealed that the responsible reactive species for catalytic CH 3 SH composition were h + , • O 2 - , and 1 O 2 ; thus, the g-C 3 N 4 /I 3- -BiOI heterojunction followed an indirect all-solid state Z-scheme charge-transfer mode with self-stabilized I 3 - /I - pairs as redox mediator, which could accelerate the separation of photogenerated charge and enhance the redox reaction power of charged carriers simultaneously.

  3. P dopants induced ferromagnetism in g-C3N4 nanosheets: Experiments and calculations

    NASA Astrophysics Data System (ADS)

    Liu, Yonggang; Liu, Peitao; Sun, Changqi; Wang, Tongtong; Tao, Kun; Gao, Daqiang

    2017-05-01

    Outstanding magnetic properties are highly desired for two-dimensional (2D) semiconductor nanosheets due to their potential applications in spintronics. Metal-free ferromagnetic 2D materials whose magnetism originated from the pure s/p electron configuration could give a long spin relaxation time, which plays the vital role in spin information transfer. Here, we synthesize 2D g-C3N4 nanosheets with room temperature ferromagnetism induced by P doping. In our case, the Curie temperature of P doped g-C3N4 nanosheets reaches as high as 911 K and the precise control of the P concentration can further adjust the saturation magnetization of the samples. First principles calculation results indicate that the magnetic moment is primarily due to strong hybridization between p bonds of P, N, and C atoms, giving the theoretical evidence of the ferromagnetism. This work opens another door to engineer a future generation of spintronic devices.

  4. Moderate Bacterial Etching Allows Scalable and Clean Delamination of g-C3N4 with Enriched Unpaired Electrons for Highly Improved Photocatalytic Water Disinfection.

    PubMed

    Kang, Shifei; Huang, Wei; Zhang, Lu; He, Maofen; Xu, Suyun; Sun, Di; Jiang, Xia

    2018-04-25

    Delamination treatment is crucial in promoting the activity of bulk graphitic carbon nitride (g-C 3 N 4 ). However, most of the currently used methods of exfoliating bulk g-C 3 N 4 to achieve g-C 3 N 4 thin layers suffer from low yield and environmental pollution. Herein, we developed a facile bacterial etching approach for the preparation of high-quality g-C 3 N 4 nanosheets by exfoliating bulk g-C 3 N 4 under room temperature. Morphology and physicochemical characterizations show that the bacteria-treated g-C 3 N 4 (BT-CN) samples, especially BT-CN-2d, have a lamina-like two-dimensional (2D) in-plane porous structure, a significantly enlarged specific surface area (82.61 m 2 g -1 ), and a remarkable narrow band gap (2.11 eV). X-ray photoelectron spectroscopy and electron paramagnetic resonance spectra confirm the dramatic enrichment of unpaired electron in the BT-CN-2d g-C 3 N 4 nanosheets. EIS spectra and photocurrent tests indicate the fast electron transportation. As a result, the representative BT-CN-2d g-C 3 N 4 photocatalyst shows an optimal visible light-driven photocatalytic performance in water disinfection (fourfold higher than bulk g-C 3 N 4 ), as well as good cycle stability. This moderate and clean bacterial etching process can be realized in tens of gram scale in the laboratory and should be readily extended to kilogram scale. The present work provides fundamental knowledge about the scalable production of high-quality g-C 3 N 4 by bioengineering method, offering extendable availability for designing and fabricating other functional 2D materials.

  5. The PAI-1 4G/5G and ACE I/D polymorphisms and risk of recurrent pregnancy loss: a case-control study.

    PubMed

    Kim, Jin Ju; Choi, Young Min; Lee, Sung Ki; Yang, Kwang Moon; Paik, Eun Chan; Jeong, Hyeon Jeong; Jun, Jong Kwan; Han, Ae Ra; Hong, Min A

    2014-12-01

    Thrombophilia has been postulated to be a contributor to the pathophysiology of recurrent pregnancy loss (RPL). We investigated the role of the plasminogen activator inhibitor type 1 (PAI-1) 4G/5G and angiotensin converting enzyme (ACE) I/D polymorphisms in Korean patients with RPL. Genotyping was performed using the TaqMan assay in 227 RPL patients and 304 controls. The genotype distributions of both polymorphisms in the RPL group did not differ from those of controls. Because the frequency of being homozygous for ACE D/D and the PAI-I 4G/4G combination has been reported to be significantly higher in RPL patients, this was also analyzed. However, no significant difference was noted; 3.1% of RPL patients had both ACE D/D and PAI-I 4G/4G, as did 4.9% of controls (P = 0.791). The current study suggests that both polymorphisms, either alone or in combination, are not major determinants of the development of RPL in Korean women. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  6. 4G/5G Polymorphism of the plasminogen activator inhibitor-1 gene is associated with multiple organ dysfunction in critically ill patients.

    PubMed

    Huq, Muhammad Aminul; Takeyama, Naoshi; Harada, Makoto; Miki, Yasuo; Takeuchi, Akinori; Inoue, Sousuke; Nakagawa, Takashi; Kanou, Hideki; Hirakawa, Akihiko; Noguchi, Hiroshi

    2012-01-01

    Impaired fibrinolysis is associated with a higher incidence of both multiple organ dysfunction and mortality in the intensive care unit (ICU). Plasminogen activator inhibitor (PAI)-1 is the chief inhibitor of fibrinolysis. We investigated the influence of the 4G/5G polymorphism (rs1799768) of the PAI-1 gene on the plasma PAI-1 level and the outcome of critically ill patients. In 41 consecutive patients admitted to the ICU, PAI-1 gene polymorphism was assessed, plasma PAI-1 and arterial lactate concentrations were measured and clinical severity scores were recorded. Homozygotes for the 4G allele had higher plasma levels of PAI-1 antigen. The mean ± SD PAI-1 antigen level was 193.31 ± 167.93 ng/ml for the 4G/4G genotype, 100.67 ± 114.16 ng/ml for the 4G/5G genotype and 0.43 ± 0.53 ng/ml for the 5G/5G genotype. There was a significant correlation between plasma PAI-1 and arterial lactate concentrations, as well as between PAI-1 and severity scores. The mortality rate was 63, 33 and 0% for patients with the 4G/4G, 4G/5G and 5G/5G genotypes, respectively. These results demonstrate that the 4G/5G polymorphism of the PAI-1 gene affects the plasma PAI-1 concentration, which could impair fibrinolysis and cause organ failure, and thus the presence of the 4G allele increases the risk of death. Copyright © 2011 S. Karger AG, Basel.

  7. Highly Efficient visible-light-induced photoactivity of magnetically retrievable Fe3O4@SiO2@Bi2WO6@g-C3N4 hierarchical microspheres for the degradation of organic pollutant and production of hydrogen

    NASA Astrophysics Data System (ADS)

    Lu, Dingze; Wang, Hongmei; Shen, Qingqing; Kondamareddy, Kiran Kumar; Neena D

    2017-07-01

    The new multifunctional composite Fe3O4@SiO2@Bi2WO6@g-C3N4 (FSBG) hierarchical microspheres with Bi2WO6/g-C3N4 heterostructure as an outer shell and Fe3O4@SiO2 as a magnetic core have been synthesized and characterized for photocatalytic applications. An efficient and adoptable approach of synthesizing magnetic Bi2WO6/g-C3N4 hierarchical microspheres of grape-like morphology is realized. The as-synthesized structures exhibit highly efficient visible-light absorption and separation efficiency of photo-induced charge. The visible-light-induced photocatalytic activity of g-C3N4, Fe3O4@SiO2@Bi2WO6, and FSBG is evaluated by investigating the photodegradation of Rhodamine B (RhB) and hydrogen (H2) out of water. The comparative study reveals that the FSBG microspheres exhibit an optimum visible-light-induced photocatalytic activity in degrading Rhodamin B (RhB), which is 3.06 and 1.92 times to that of g-C3N4 and Fe3O4@SiO2@Bi2WO6 systems respectively and 3.89 and 2.31 times in the production of hydrogen (H2) out of water, respectively. The FSBG composite microspheres also exhibit good magnetic recoverability. An alternate mechanism for the enhanced visible-light photocatalytic activity is given in the present manuscript.

  8. Conjugation of TbPO4·H2O-Based Nanowires with Immunoglobulin G for Bioimaging

    NASA Astrophysics Data System (ADS)

    Huong, Nguyen Thanh; Lien, Pham Thi; Hung, Nguyen Manh; Van, Nguyen Duc; Thuy, Tran Thi; Binh, Nguyen Thanh; Minh, Le Quoc

    2016-05-01

    The surface modification, functionalization, and conjugation of undoped and 11 at.% Eu3+-doped TbPO4 ·H2O nanowires by using silica, a thyocyanate functional group, and immunoglobulin G, respectively, are described in this paper. For the core layer of obtained conjugated nanowires, the undoped TbPO4 ·H2O exhibited characteristic photoluminescent green emission corresponding to 5 D 4 → 7 F J transitions ( J = 6, 5, 4, 3) while the incorporation of Eu3+ into TbPO4 ·H2O lattice was evidenced by Starks splitting transitions at 590, 615, 693 nm of Eu3+ ions for the case of 11 at.% Eu3+-doped TbPO4 ·H2O. The results also indicated that both immunoglobulin G-conjugated undoped and Eu3+-doped TbPO4 ·H2O nanowires can be used in the fluorescent immune analysis as a biomedical label maker to identify measles viruses in vaccine testing.

  9. Conformational distribution of baclofen analogues by 1H and 13C NMR analysis and ab initio HF MO STO-3G or STO-3G* calculations

    NASA Astrophysics Data System (ADS)

    Vaccher, Claude; Berthelot, Pascal; Debaert, Michel; Vermeersch, Gaston; Guyon, René; Pirard, Bernard; Vercauteren, Daniel P.; Dory, Magdalena; Evrard, Guy; Durant, François

    1993-12-01

    The conformations of 3-(substituted furan-2-yl) and 3-(substituted thien-2-yl)-γ-aminobutyric acid 1-9 in solution (D 2O) are estimated from high-resolution (300 MHz) 1H NMR coupling data. Conformations and populations of conformers are calculated by means of a modified Karplus-like relationship for the vicinal coupling constants. The results are compared with X-ray crystallographic investigations (torsion angles) and ab initio HF MO ST-3G or STO-3G* calculations. 1H NMR spectral analysis shows how 1-9 in solution retain the preferred g- conformation around the C3C4 bond, as found in the solid state, while a partial rotation is set up around the C2C3 bond: the conformations about C2C3 are all highly populated in solution. The 13C spin-lattice relaxation times are also discussed.

  10. Neurofascin-155 IgG4 in chronic inflammatory demyelinating polyneuropathy

    PubMed Central

    Devaux, Jérôme J.; Miura, Yumako; Fukami, Yuki; Inoue, Takayuki; Manso, Constance; Belghazi, Maya; Sekiguchi, Kenji; Kokubun, Norito; Ichikawa, Hiroo; Wong, Anna Hiu Yi

    2016-01-01

    Objective: We report the clinical and serologic features of Japanese patients with chronic inflammatory demyelinating polyneuropathy (CIDP) displaying anti-neurofascin-155 (NF155) immunoglobulin G4 (IgG4) antibodies. Methods: In sera from 533 patients with CIDP, anti-NF155 IgG4 antibodies were detected by ELISA. Binding of IgG antibodies to central and peripheral nerves was tested. Results: Anti-NF155 IgG4 antibodies were identified in 38 patients (7%) with CIDP, but not in disease controls or normal participants. These patients were younger at onset as compared to 100 anti-NF155–negative patients with CIDP. Twenty-eight patients (74%) presented with sensory ataxia, 16 (42%) showed tremor, 5 (13%) presented with cerebellar ataxia associated with nystagmus, 3 (8%) had demyelinating lesions in the CNS, and 20 of 25 (80%) had poor response to IV immunoglobulin. The clinical features of the antibody-positive patients were statistically more frequent as compared to negative patients with CIDP (n = 100). Anti-NF155 IgG antibodies targeted similarly central and peripheral paranodes. Conclusion: Anti-NF155 IgG4 antibodies were associated with a subgroup of patients with CIDP showing a younger age at onset, ataxia, tremor, CNS demyelination, and a poor response to IV immunoglobulin. The autoantibodies may serve as a biomarker to improve patients' diagnosis and guide treatments. PMID:26843559

  11. Neurofascin-155 IgG4 in chronic inflammatory demyelinating polyneuropathy.

    PubMed

    Devaux, Jérôme J; Miura, Yumako; Fukami, Yuki; Inoue, Takayuki; Manso, Constance; Belghazi, Maya; Sekiguchi, Kenji; Kokubun, Norito; Ichikawa, Hiroo; Wong, Anna Hiu Yi; Yuki, Nobuhiro

    2016-03-01

    We report the clinical and serologic features of Japanese patients with chronic inflammatory demyelinating polyneuropathy (CIDP) displaying anti-neurofascin-155 (NF155) immunoglobulin G4 (IgG4) antibodies. In sera from 533 patients with CIDP, anti-NF155 IgG4 antibodies were detected by ELISA. Binding of IgG antibodies to central and peripheral nerves was tested. Anti-NF155 IgG4 antibodies were identified in 38 patients (7%) with CIDP, but not in disease controls or normal participants. These patients were younger at onset as compared to 100 anti-NF155-negative patients with CIDP. Twenty-eight patients (74%) presented with sensory ataxia, 16 (42%) showed tremor, 5 (13%) presented with cerebellar ataxia associated with nystagmus, 3 (8%) had demyelinating lesions in the CNS, and 20 of 25 (80%) had poor response to IV immunoglobulin. The clinical features of the antibody-positive patients were statistically more frequent as compared to negative patients with CIDP (n = 100). Anti-NF155 IgG antibodies targeted similarly central and peripheral paranodes. Anti-NF155 IgG4 antibodies were associated with a subgroup of patients with CIDP showing a younger age at onset, ataxia, tremor, CNS demyelination, and a poor response to IV immunoglobulin. The autoantibodies may serve as a biomarker to improve patients' diagnosis and guide treatments. © 2016 American Academy of Neurology.

  12. IgG4 Expression in Primary Cutaneous Marginal Zone Lymphoma: A Multicenter Study.

    PubMed

    De Souza, Aieska; Ferry, Judith A; Burghart, Daniel R; Tinguely, Marianne; Goyal, Amrita; Duncan, Lyn M; Kutzner, Heinz; Kempf, Werner

    2017-02-01

    Primary cutaneous marginal zone lymphoma (PCMZL) is the second most common B-cell lymphoma of the skin. A recent study has demonstrated a strikingly high prevalence of immunoglobulin (Ig)G4 expression in PCMZL with plasmacytic differentiation. The objective was to investigate the incidence of IgG4 expression in PCMZL, and its correlation with clinical and immunophenotypic features. Multicenter study that utilized immunohistochemistry and in-situ hybridization to evaluate the expression of IgG4, Ig light (κ and λ), and heavy chains (IgM, IgG), and the ratio of T (CD3+) and B (CD20+) cells in biopsy specimens from 30 patients with PCMZL and to correlate these findings with the clinical features. IgG4 expression was observed in 4 out of 30 patients (13%) with PCMZL. Patients with IgG4-positive lymphomas were 57 to 77 years of age (mean, 69) at biopsy. The lesions were solitary in 2 patients with IgG4-positive lymphomas, and were most commonly located on the trunk. Patients with IgG4-negative lymphomas experienced earlier disease onset at an average age of 53 years. The majority of the IgG4-negative cases presented with localized disease, on the trunk and upper extremities. There was no significant difference in the IgG4-positive versus negative cases for the following parameters: Ig κ or λ restriction, B-cell or T-cell predominance, and site of the lesions. IgG4 expression was observed in a minority of PCMZL patients. We did not identify significant clinical or immunophenotypic differences between IgG4 positive and negative cases.

  13. Cytotoxic potential of few Indian fruit peels through 3-(4,5-dimethylthiazol-yl)-2,5-diphenyltetrazolium bromide assay on HepG2 cells.

    PubMed

    Garg, Munish; Lata, Kusum; Satija, Saurabh

    2016-01-01

    To investigate in vitro anticancer activity of a few Indian fruit peels through 3-(4,5-dimethylthiazol-yl)-2,5-diphenyltetrazolium bromide (MTT) assay against HepG2 cells. Hydroalcoholic extracts were prepared of five fruit peels, i.e., banana, lemon, guava, orange, and papaya by maceration and thereafter subjected for MTT assay to evaluate anticancer potential on HepG2 cells. Plant extract showed best activity was further fractionated with petroleum ether, chloroform, and ethyl acetate successively and screened again. Phytochemical analysis was then carried out to find out responsible components for the observed activity. Out of the 40 samples from five fruit peel extracts with rich folklore usage, papaya extract showed maximum activity with least inhibitory concentration50 (IC50) value of 18.5 μg/ml. Further analysis after fractionation of the papaya peel extract, aqueous fraction showed the maximum inhibitory activity with least IC50 value of 17.3 μg/ml. Phytochemical analysis of the aqueous fraction of papaya peel extract revealed the presence of flavonoids and glycosides. Total flavonoid content found to be 72.25 mg/g. Papaya fruit extract demonstrated the best activity against MTT assay which may be due to the presence of flavonoids.

  14. Cytotoxic potential of few Indian fruit peels through 3-(4,5-dimethylthiazol-yl)-2,5-diphenyltetrazolium bromide assay on HepG2 cells

    PubMed Central

    Garg, Munish; Lata, Kusum; Satija, Saurabh

    2016-01-01

    Objective: To investigate in vitro anticancer activity of a few Indian fruit peels through 3-(4,5-dimethylthiazol-yl)-2,5-diphenyltetrazolium bromide (MTT) assay against HepG2 cells. Materials and Methods: Hydroalcoholic extracts were prepared of five fruit peels, i.e., banana, lemon, guava, orange, and papaya by maceration and thereafter subjected for MTT assay to evaluate anticancer potential on HepG2 cells. Plant extract showed best activity was further fractionated with petroleum ether, chloroform, and ethyl acetate successively and screened again. Phytochemical analysis was then carried out to find out responsible components for the observed activity. Results: Out of the 40 samples from five fruit peel extracts with rich folklore usage, papaya extract showed maximum activity with least inhibitory concentration50 (IC50) value of 18.5 μg/ml. Further analysis after fractionation of the papaya peel extract, aqueous fraction showed the maximum inhibitory activity with least IC50 value of 17.3 μg/ml. Phytochemical analysis of the aqueous fraction of papaya peel extract revealed the presence of flavonoids and glycosides. Total flavonoid content found to be 72.25 mg/g. Conclusion: Papaya fruit extract demonstrated the best activity against MTT assay which may be due to the presence of flavonoids. PMID:26997725

  15. Plasminogen activator inhibitor-1 4G/5G genotype and residual venous occlusion following acute unprovoked deep vein thrombosis of the lower limb: A prospective cohort study.

    PubMed

    Giurgea, Georgiana-Aura; Brunner-Ziegler, Sophie; Jilma, Bernd; Sunder-Plassmann, Raute; Koppensteiner, Renate; Gremmel, Thomas

    2017-05-01

    A recent study suggested that the plasminogen activator inhibitor (PAI)-1 4G/5G genotype may play a role in the resolution of deep vein thrombosis (DVT) after surgery. In the present study, we investigated the association between PAI-1 4G/5G genotype and the persistence of venous occlusion after acute idiopathic DVT of the lower limb. The PAI-1 4G/5G genotype was determined by real-Time PCR in 43 patients with unprovoked DVT of the lower limb. Residual venous occlusion was assessed by duplex sonography 1, 3, 6, 12 and 24months after the acute event. The PAI-1 Activity was determined by ELISA. Ten patients (23%) were homozygous for 4G (4G/4G), 27 patients (63%) were heterozygous 4G/5G and 6 patients (14%) were homozygous for 5G (5G/5G). Residual venous occlusion (RVO) was found in 77%, 65%, 58%, 56% and 37% of the overall study population, at 1, 3, 6, 12 and 24months after acute DVT, respectively. The presence of residual venous occlusion at 1, 3, 6, 12 and 24months after acute unprovoked DVT did not differ significantly between genotypes, but age was associated with RVO. Plasma levels of PAI-1 activity correlated with body mass index but was not associated with genotypes in our study. The PAI-1 4G/5G genotype was not a relevant predictor of persistent residual venous occlusion after idiopathic DVT, which however was associated with age. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Synthesis and Enhanced Ethanol Gas Sensing Properties of the g-C3N4 Nanosheets-Decorated Tin Oxide Flower-Like Nanorods Composite

    PubMed Central

    Qin, Cong; Zhang, Bo; Sun, Guang; Zhang, Zhanying

    2017-01-01

    Flower-like SnO2/g-C3N4 nanocomposites were synthesized via a facile hydrothermal method by using SnCl4·5H2O and urea as the precursor. The structure and morphology of the as-synthesized samples were characterized by using the X-ray powder diffraction (XRD), electron microscopy (FESEM and TEM), and Fourier transform infrared spectrometer (FT-IR) techniques. SnO2 displays the unique 3D flower-like microstructure assembled with many uniform nanorods with the lengths and diameters of about 400–600 nm and 50–100 nm, respectively. For the SnO2/g-C3N4 composites, SnO2 flower-like nanorods were coupled by a lamellar structure 2D g-C3N4. Gas sensing performance test results indicated that the response of the sensor based on 7 wt. % 2D g-C3N4-decorated SnO2 composite to 500 ppm ethanol vapor was 150 at 340 °C, which was 3.5 times higher than that of the pure flower-like SnO2 nanorods-based sensor. The gas sensing mechanism of the g-C3N4nanosheets-decorated SnO2 flower-like nanorods was discussed in relation to the heterojunction structure between g-C3N4 and SnO2. PMID:28937649

  17. Enhanced photocatalytic H{sub 2} evolution over CdS/Au/g-C{sub 3}N{sub 4} composite photocatalyst under visible-light irradiation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ding, Xiaoling; University of Chinese Academy of Sciences, Beijing 100049; Li, Yingxuan, E-mail: yxli@ms.xjb.ac.cn, E-mail: cywang@ms.xjb.ac.cn

    2015-10-01

    A novel heterojunction structured composite photocatalyst CdS/Au/g-C{sub 3}N{sub 4} has been developed by depositing CdS/Au with a core (Au)-shell (CdS) structure on the surface of g-C{sub 3}N{sub 4}. The photocatalytic hydrogen production activity of the developed photocatalyst was evaluated under visible-light irradiation (λ > 420 nm) using methanol as a sacrificial reagent. As a result, its activity is about 125.8 times higher than that of g-C{sub 3}N{sub 4} and is even much higher than that of Pt/g-C{sub 3}N{sub 4}. The enhancement in photocatalytic activity is attributed to efficient separation of the photoexcited charges due to the anisotropic junction in themore » CdS/Au/g-C{sub 3}N{sub 4} system.« less

  18. Ultra-thin g-C{sub 3}N{sub 4} nanosheets wrapped silicon nanowire array for improved chemical stability and enhanced photoresponse

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Beibei; Yu, Hongtao; Quan, Xie, E-mail: quanxie@dlut.edu.cn

    2014-11-15

    Highlights: • g-C{sub 3}N{sub 4}, as an oxygen free and metal free protective material for Si, was proposed. • g-C{sub 3}N{sub 4} nanosheets wrapped Si nanowire array was synthesized. • SiNW/g-C{sub 3}N{sub 4} exhibited enhancement of photoelectrochemical stability and photocurrent. - Abstract: In order to inhibit the oxidation of Si materials in aqueous solution, Si nanowire array was wrapped by ultra-thin g-C{sub 3}N{sub 4} nanosheets via an electrophoresis process. Scanning electron microscopy and transmission electron microscopy images showed that g-C{sub 3}N{sub 4} nanosheets were evenly distributed on the surface of Si nanowire array. X-ray diffraction patterns indicated that Si nanowiremore » array/g-C{sub 3}N{sub 4} nanosheets were composed of Si (4 0 0 crystal plane) and g-C{sub 3}N{sub 4} (0 0 2 and 1 0 0 crystal planes). The cyclic voltammetry curves revealed that the corrosion of Si nanowire array was restrained under the protection of g-C{sub 3}N{sub 4} nanosheets. Furthermore, the photocurrent density of Si nanowire array/g-C{sub 3}N{sub 4} nanosheets increased by nearly 3 times compared to that of bare Si nanowire array due to the effective charge separation caused by the built-in electric field at the interface. This work will facilitate the applications of Si materials in aqueous solution, such as solar energy harvest and photocatalytic pollution control.« less

  19. Electrocatalytic performances of g-C3N4-LaNiO3 composite as bi-functional catalysts for lithium-oxygen batteries

    PubMed Central

    Wu, Yixin; Wang, Taohuan; Zhang, Yidie; Xin, Sen; He, Xiaojun; Zhang, Dawei; Shui, Jianglan

    2016-01-01

    A low cost and non-precious metal composite material g-C3N4-LaNiO3 (CNL) was synthesized as a bifunctional electrocatalyst for the air electrode of lithium-oxygen (Li-O2) batteries. The composition strategy changed the electron structure of LaNiO3 and g-C3N4, ensures high Ni3+/Ni2+ ratio and more absorbed hydroxyl on the surface of CNL that can promote the oxygen reduction reaction (ORR) and oxygen evolution reaction (OER). The composite catalyst presents higher activities than the individual components g-C3N4 and LaNiO3 for both ORR and OER. In non-aqueous Li-O2 batteries, CNL shows higher capacity, lower overpotentials and better cycling stability than XC-72 carbon and LaNiO3 catalysts. Our results suggest that CNL composite is a promising cathode catalyst for Li-O2 batteries. PMID:27074882

  20. Importance of Highly Conserved Peptide Sites of Human Cytomegalovirus gO for Formation of the gH/gL/gO Complex

    PubMed Central

    Stegmann, Cora; Abdellatif, Mohamed E. A.; Laib Sampaio, Kerstin; Walther, Paul

    2016-01-01

    ABSTRACT The glycoprotein O (gO) is betaherpesvirus specific. Together with the viral glycoproteins H and L, gO forms a covalent trimeric complex that is part of the viral envelope. This trimer is crucial for cell-free infectivity of human cytomegalovirus (HCMV) but dispensable for cell-associated spread. We hypothesized that the amino acids that are conserved among gOs of different cytomegaloviruses are important for the formation of the trimeric complex and hence for efficient virus spread. In a mutational approach, nine peptide sites, containing all 13 highly conserved amino acids, were analyzed in the context of HCMV strain TB40-BAC4 with regard to infection efficiency and formation of the gH/gL/gO complex. Mutation of amino acids (aa) 181 to 186 or aa 193 to 198 resulted in the loss of the trimer and a complete small-plaque phenotype, whereas mutation of aa 108 or aa 249 to 254 caused an intermediate phenotype. While individual mutations of the five conserved cysteines had little impact, their relevance was revealed in a combined mutation, which abrogated both complex formation and cell-free infectivity. C343 was unique, as it was sufficient and necessary for covalent binding of gO to gH/gL. Remarkably, however, C218 together with C167 rescued infectivity in the absence of detectable covalent complex formation. We conclude that all highly conserved amino acids contribute to the function of gO to some extent but that aa 181 to 198 and cysteines 343, 218, and 167 are particularly relevant. Surprisingly, covalent binding of gO to gH/gL is required neither for its incorporation into virions nor for proper function in cell-free infection. IMPORTANCE Like all herpesviruses, the widespread human pathogen HCMV depends on glycoproteins gB, gH, and gL for entry into target cells. Additionally, gH and gL have to bind gO in a trimeric complex for efficient cell-free infection. Homologs of gO are shared by all cytomegaloviruses, with 13 amino acids being highly conserved

  1. Thrombophilic genetic factors PAI-1 4G-4G and MTHFR 677TT as risk factors of alcohol, cryptogenic liver cirrhosis and portal vein thrombosis, in a Caucasian population.

    PubMed

    D'Amico, Mario; Pasta, Francesca; Pasta, Linda

    2015-08-15

    The thrombophilic genetic factors (THRGFs), PAI-1 4G-4G, MTHFR 677TT, V Leiden 506Q and Prothrombin 20210A, were studied as risk factors in 865 Caucasian patients with liver cirrhosis, consecutively enrolled from June 2008 to January 2014. A total of 582 HCV, 80 HBV, 94 alcohol, (82 with more than one etiologic factor) and 191 cryptogenic patients with liver cirrhosis had been consecutively enrolled; 243 patients showed portal vein thrombosis (PVT). At least one of the above THRGFs was present in 339/865 patients (39.2%). PAI-1 4G-4G and MTHFR 677TT were the most frequent THRGFs, statistically significant in patients with alcohol, cryptogenic liver cirrhosis, and PVT: respectively 24 and 28, 50 and 73, and 65 and 83 (all chi-square tests>3.84, and p values<0.05). Two logistic regression analysis, using PAI-1 4G-4G and MTHFR 677TT, as dependent variable, confirmed the independent significant relationship of these THRGFs with alcohol, cryptogenic liver cirrhosis and PVT. PAI 1 and MTHFR 677 genotypes, deviated from those expected in populations in Hardy-Weinberg equilibrium (all p values<0.05), in the subgroups of patients with alcohol, cryptogenic liver cirrhosis and presence of PVT. Our study shows the pivotal role of PAI-1 4G-4G and MTHFR 677TT in patients with alcohol, cryptogenic liver cirrhosis, and PVT, in a Caucasian population. In conclusion, thrombo and fibro-genetic mechanisms of PAI-1 4G-4G and MTHFR 677TT, could have a role in the development of liver cirrhosis, mainly in patients without HCV and HBV, and PVT. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Mechanistic insight into the enhanced photocatalytic activity of single-atom Pt, Pd or Au-embedded g-C3N4

    NASA Astrophysics Data System (ADS)

    Tong, Tong; Zhu, Bicheng; Jiang, Chuanjia; Cheng, Bei; Yu, Jiaguo

    2018-03-01

    Single atoms of platinum (Pt), palladium (Pd) or gold (Au) trapped by two-dimensional graphitic carbon nitride (g-C3N4) exhibit superior photocatalytic performance. However, the underlying mechanism of single-atom noble metal/g-C3N4 photocatalytic system is still unclear. Herein, the structural, electronic and optical properties of single-atom Pt, Pd and Au loaded on bilayer g-C3N4 (BL-g-C3N4) substrate were investigated by density functional theory (DFT) simulations. The results indicate that single-atom Pt/Pd/Au loading can significantly narrow the band gap of g-C3N4 and thus increase its light absorption in the visible-light region. Rather than being adsorbed on the surface, Pt and Pd atoms tend to be embedded into g-C3N4 interlayer and act as bridges to facilitate the interlayer charge carrier transfer due to the effects of conduction band offset. In particular, an internal electric field is generated in Pt/BL-g-C3N4, which is further beneficial for separating charge carrier of photoexcited g-C3N4. By contrast, Au can only be adsorbed on the g-C3N4 surface (in the six-fold cavity) and deliver a limited amount of charge carrier excited in the N-conjugated aromatic pore of g-C3N4 surface. Our finding is conducive to understanding the interactive relationship between single-atom noble metal co-catalysts and g-C3N4 and to the design of high-efficiency photocatalyst.

  3. Fabrication of Bi modified Bi2S3 pillared g-C3N4 photocatalyst and its efficient photocatalytic reduction and oxidation performances

    NASA Astrophysics Data System (ADS)

    Chen, Dongdong; Fang, Jianzhang; Lu, Shaoyou; Zhou, GuangYing; Feng, Weihua; Yang, Fan; Chen, Yi; Fang, ZhanQiang

    2017-12-01

    A novel efficient Bi modified Bi2S3 pillared g-C3N4 (BBC) plasmonic semiconductor photocatalyst has been successfully developed in a mixed solvothermal environment. The photocatalytic abilities of the as-prepared samples are examined by the photocatalytic reduction of Cr(VI) and oxidation of tetracycline (TC). And the chemical composition, structure, morphology and photo-absorption properties of the photocatalysts have been investigated by XRD, FT-IR, XPS, TEM, HRTEM and DRS methods, respectively. It is found that the addition of triethanolamine (TEA) results in the formation of the pillared-g-C3N4 (PG) nanostructure. The agglomeration of g-C3N4 nanosheets moiety and Bi2S3 nanorods moiety can be both hindered effectively by the special PG structure. And the photocatalytic results indicate that BBC exhibits the best photoreduction and photooxidation performances among all the samples, and meanwhile possesses superior photo-stability during the recycling runs. The enhanced photocatalytic activity of BBC could be ascribed to the furtherance of charge separation, localized surface plasma resonance (SPR) effect of metallic Bi and the excellent reaction interface. Finally, a tentative mechanism of BBC for photocatalytic reduction of Cr(VI) and oxidation of TC is discussed in detail.

  4. 4G/5G Polymorphism of Plasminogen Activator Inhibitor -1 Gene Is Associated with Mortality in Intensive Care Unit Patients with Severe Pneumonia

    PubMed Central

    Sapru, Anil; Hansen, Helen; Ajayi, Temitayo; Brown, Ron; Garcia, Oscar; Zhuo, HanJing; Wiemels, Joseph; Matthay, Michael A.; Wiener-Kronish, Jeanine

    2011-01-01

    Background Higher plasma and pulmonary edema fluid levels of plasminogen activator inhibitor-1 (PAI-1) are associated with increased mortality in patients with pneumonia and acute lung injury. The 4G allele of the 4G/5G polymorphism of the PAI-1 gene is associated with higher PAI-1 levels and an increased incidence of hospitalizations for pneumonia. The authors hypothesized that the 4G allele would be associated with worse clinical outcomes (mortality and ventilator-free days) in patients with severe pneumonia. Methods The authors enrolled patients admitted with severe pneumonia in a prospective cohort. Patients were followed until hospital discharge. DNA was isolated from blood samples, and genotyping detection for the PAI-1 4G/5G polymorphism was carried out using Taqman-based allelic discrimination. Results A total of 111 patients were available for analysis. Distribution of genotypes was 4G/4G 26 of 111 (23%), 4G/5G 59 of 111 (53%), and 5G/5G 26 of 111 (23%). Of 111 patients, 32 (29%) died before hospital discharge and 105 patients (94%) received mechanical ventilation. Patients with the 4G/4G and the 4G/5G genotypes had higher mortality (35% vs. 8%, P = 0.007) and fewer ventilator-free days (median 4 vs. 13, P = 0.04) compared to patients with the 5G/5G genotype. Conclusions The 4G allele of the 4G/5G polymorphism in the PAI-1 gene is associated with fewer ventilator-free days and increased mortality in hospitalized patients with severe pneumonia. These findings suggest that PAI-1 may have a role in pathogenesis and that the 4G/5G polymorphism may be an important biomarker of risk in patients with severe pneumonia. PMID:19387177

  5. 4G/5G polymorphism of plasminogen activator inhibitor-1 gene is associated with mortality in intensive care unit patients with severe pneumonia.

    PubMed

    Sapru, Anil; Hansen, Helen; Ajayi, Temitayo; Brown, Ron; Garcia, Oscar; Zhuo, HanJing; Wiemels, Joseph; Matthay, Michael A; Wiener-Kronish, Jeanine

    2009-05-01

    Higher plasma and pulmonary edema fluid levels of plasminogen activator inhibitor-1 (PAI-1) are associated with increased mortality in patients with pneumonia and acute lung injury. The 4G allele of the 4G/5G polymorphism of the PAI-1 gene is associated with higher PAI-1 levels and an increased incidence of hospitalizations for pneumonia. The authors hypothesized that the 4G allele would be associated with worse clinical outcomes (mortality and ventilator-free days) in patients with severe pneumonia. The authors enrolled patients admitted with severe pneumonia in a prospective cohort. Patients were followed until hospital discharge. DNA was isolated from blood samples, and genotyping detection for the PAI-1 4G/5G polymorphism was carried out using Taqman-based allelic discrimination. A total of 111 patients were available for analysis. Distribution of genotypes was 4G/4G 26 of 111 (23%), 4G/5G 59 of 111 (53%), and 5G/5G 26 of 111 (23%). Of 111 patients, 32 (29%) died before hospital discharge and 105 patients (94%) received mechanical ventilation. Patients with the 4G/4G and the 4G/5G genotypes had higher mortality (35% vs. 8%, P = 0.007) and fewer ventilator-free days (median 4 vs. 13, P = 0.04) compared to patients with the 5G/5G genotype. The 4G allele of the 4G/5G polymorphism in the PAI-1 gene is associated with fewer ventilator-free days and increased mortality in hospitalized patients with severe pneumonia. These findings suggest that PAI-1 may have a role in pathogenesis and that the 4G/5G polymorphism may be an important biomarker of risk in patients with severe pneumonia.

  6. Influence of PAI-1 gene promoter-675 (4G/5G) polymorphism on fibrinolytic activity after cardiac surgery employing cardiopulmonary bypass.

    PubMed

    Ozolina, Agnese; Strike, Eva; Jaunalksne, Inta; Serova, Jelena; Romanova, Tatjana; Zake, Liene Nikitina; Sabelnikovs, Olegs; Vanags, Indulis

    2012-01-01

    The plasminogen activator inhibitor type-1 (PAI-1) gene promoter contains 675 (4G/5G) polymorphism. The aim of this study was evaluate the effect of the PAI-1 promoter-675 (4G/5G) polymorphism on the concentrations of PAI-1 and tissue plasminogen activator/PAI-1 (t-PA/PAI-1) complex and bleeding volume after on-pump cardiac surgery. A total of 90 patients were included in the study at Pauls Stradins Clinical University Hospital. Seven patients were excluded due to surgical bleeding. Eighty-three patients were classified according to the PAI-1 genotype: 21 patients had the 4G/4G genotype; 42, the 4G/5G genotype; and 20, the 5G/5G genotype. The following fibrinolysis parameters were recorded: the PAI-1 level preoperatively, D-dimer level at 0, 6, and 24 hours after surgery, and t-PA/PAI-1 complex level 24 hours postoperatively. A postoperative bleeding volume was registered in mL 24 hours after surgery. The patients with the 5G/5G genotype had significantly lower preoperative PAI-1 levels (17 [SD, 10.8] vs. 24 ng/mL [SD, 9.6], P=0.04), higher D-dimer levels at 6 hours (371 [SD, 226] vs. 232 ng/mL [SD, 185], P=0.03) and 24 hours (326 [SD, 207] vs. 209 ng/mL [SD, 160], P=0.04), and greater postoperative blood loss (568 [SD, 192] vs. 432 mL [168], P=0.02) compared with the 4G/4G carriers. There were no significant differences in the levels of the t-PA/PAI-1 complex comparing different genotype groups. The carriers of the 5G/5G genotype showed the lower preoperative PAI-1 levels, greater chest tube blood loss, and higher D-dimer levels indicating that the 5G/5G carriers may have enhanced fibrinolysis.

  7. Ultrasonic-assisted pyrolyzation fabrication of reduced SnO2–x /g-C3N4 heterojunctions: Enhance photoelectrochemical and photocatalytic activity under visible LED light irradiation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Kai; Zeng, Xiaoqiao; Gao, Shanmin

    Novel SnO 2–x/g-C 3N 4 heterojunction nanocomposites composed of reduced SnO 2–x nanoparticles and exfoliated g-C 3N 4 nanosheets were prepared by a convenient one-step pyrolysis method. The structural, morphological, and optical properties of the as-prepared nanocomposites were characterized in detail, indicating that the aggregation of g-C 3N 4 nanosheets was prevented by small, well-dispersed SnO 2–x nanoparticles. The ultraviolet–visible spectroscopy absorption bands of the nanocomposites were shifted to a longer wavelength region than those exhibited by pure SnO 2 or g-C 3N 4. The charge transfer and recombination processes occurring in the nanocomposites were investigated using linear scan voltammetrymore » and electrochemical impedance spectroscopy. Under 30-W visible-light-emitting diode irradiation, the heterojunction containing 27.4 wt.% SnO 2–x exhibited the highest photocurrent density of 0.0468 mA·cm–2, which is 33.43 and 5.64 times larger than that of pure SnO 2 and g-C 3N 4, respectively. The photocatalytic activity of the heterojunction material was investigated by degrading rhodamine B under irradiation from the same light source. Kinetic study revealed a promising degradation rate constant of 0.0226 min-1 for the heterojunction containing 27.4 wt.% SnO 2–x, which is 32.28 and 5.79 times higher than that of pure SnO 2 and g-C 3N 4, respectively. The enhanced photoelectrochemical and photocatalytic performances of the nanocomposite may be due to its appropriate SnO 2–x content and the compact structure of the junction between the SnO 2–x nanoparticles and the g-C 3N 4 nanosheets, which inhibits the recombination of photogenerated electrons and holes.« less

  8. Association of immunoglobulin G4 and free light chain with idiopathic pleural effusion.

    PubMed

    Murata, Y; Aoe, K; Mimura-Kimura, Y; Murakami, T; Oishi, K; Matsumoto, T; Ueoka, H; Matsunaga, K; Yano, M; Mimura, Y

    2017-10-01

    The cause of pleural effusion remains uncertain in approximately 15% of patients despite exhaustive evaluation. As recently described immunoglobulin (Ig)G4-related disease is a fibroinflammatory disorder that can affect various organs, including the lungs, we investigate whether idiopathic pleural effusion includes IgG4-associated etiology. Between 2000 and 2012, we collected 830 pleural fluid samples and reviewed 35 patients with pleural effusions undiagnosed after pleural biopsy at Yamaguchi-Ube Medical Center. Importantly, IgG4 immunostaining revealed infiltration of IgG4-positive plasma cells in the pleura of 12 patients (34%, IgG4 + group). The median effusion IgG4 level was 41 mg/dl in the IgG4 + group and 27 mg/dl in the IgG4 - group (P < 0·01). The light and heavy chains of effusion IgG4 antibodies of patients in the IgG4 + group were heterogeneous by two-dimensional electrophoresis, indicating the absence of clonality of the IgG4 antibodies. Interestingly, the κ light chains were more heterogeneous than the λ light chains. The measurement of the κ and λ free light chain (FLC) levels in the pleural fluids showed significantly different κ FLC levels (median: 28·0 versus 9·1 mg/dl, P < 0·01) and κ/λ ratios (median: 2·0 versus 1·2, P < 0·001) between the IgG4 + and IgG4 - groups. Furthermore, the κ/λ ratios were correlated with the IgG4 + /IgG + plasma cell ratios in the pleura of the IgG4 + group. Taken together, these results demonstrate the involvement of IgG4 in certain idiopathic pleural effusions and provide insights into the diagnosis, pathogenesis and therapeutic opportunities of IgG4-associated pleural effusion. © 2017 British Society for Immunology.

  9. Frequency of Aquaporin-4 Immunoglobulin G in Longitudinally Extensive Transverse Myelitis With Antiphospholipid Antibodies.

    PubMed

    Guerra, Hilda; Pittock, Sean J; Moder, Kevin G; Fryer, James P; Gadoth, Avi; Flanagan, Eoin P

    2018-04-11

    Antiphospholipid (aPL) antibodies have historically been postulated to cause a poorly understood inflammatory myelitis. Neuromyelitis optica spectrum disorder (NMOSD) causes an inflammatory longitudinally extensive transverse myelitis (LETM). In 2004, aquaporin-4 immunoglobulin G (AQP4-IgG) was first reported as a highly specific (>99%) serum diagnostic biomarker of NMOSD, distinguishing it from other disorders (eg, multiple sclerosis). We sought to assess the frequency of AQP4-IgG (and thus NMOSD diagnosis) in LETM with aPL antibodies. We searched Mayo Clinic records (from January 1, 1996, through December 31, 2014) for patients with (1) LETM and (2) aPL or β 2 -glycoprotein I antibodies and (3) a serum sample available. AQP4-IgG was evaluated in the 24 included patients and in 20 controls with aPL antibodies but without myelitis. Seropositivity for AQP4-IgG was confirmed in 11 of 24 patients with LETM (46%), confirming an AQP4-IgG-seropositive NMOSD diagnosis rather than aPL-associated LETM. Six of 11 AQP4-IgG-seropositive patients (54%) were initially diagnosed as having aPL/lupus-associated myelitis. Recurrent LETM was exclusive to AQP4-IgG-seropositive patients (P=.003). Alternative diagnoses assigned to the remaining 13 AQP4-IgG-seronegative patients included idiopathic transverse myelitis (n=5), seronegative NMOSD (n=2), spinal cord infarct attributed to aPL antibodies (n=2), spinal cord sarcoidosis (n=1), varicella-zoster virus myelitis (n=1), postinfectious myelitis (n=1), and multiple sclerosis (n=1). All 20 controls were seronegative for AQP4-IgG. Clotting disorders occurred in 36% of patients (4 of 11) with LETM with both aPL antibodies and AQP4-IgG. AQP4-IgG should be tested in all patients with LETM and aPL antibodies because AQP4-IgG-seropositive NMOSD accounts for almost half of all cases. Clotting disorders are common in patients with LETM with dual positivity for AQP4-IgG and aPL antibodies. Copyright © 2018 Mayo Foundation for Medical Education

  10. Whole-genome analyses of DS-1-like human G2P[4] and G8P[4] rotavirus strains from Eastern, Western and Southern Africa

    PubMed Central

    Nyaga, Martin M.; Stucker, Karla M.; Esona, Mathew D.; Jere, Khuzwayo C.; Mwinyi, Bakari; Shonhai, Annie; Tsolenyanu, Enyonam; Mulindwa, Augustine; Chibumbya, Julia N.; Adolfine, Hokororo; Halpin, Rebecca A.; Roy, Sunando; Stockwell, Timothy B.; Berejena, Chipo; Seheri, Mapaseka L.; Mwenda, Jason M.; Steele, A. Duncan; Wentworth, David E.

    2018-01-01

    Group A rotaviruses (RVAs) with distinct G and P genotype combinations have been reported globally. We report the genome composition and possible origin of seven G8P[4] and five G2P[4] human RVA strains based on the genetic evolution of all 11 genome segments at the nucleotide level. Twelve RVA ELISA positive stool samples collected in the representative countries of Eastern, Southern and West Africa during the 2007–2012 surveillance seasons were subjected to sequencing using the Ion Torrent PGM and Illumina MiSeq platforms. A reference-based assembly was performed using CLC Bio’s clc_ref_assemble_long program, and full-genome consensus sequences were obtained. With the exception of the neutralising antigen, VP7, all study strains exhibited the DS-1-like genome constellation (P[4]-I2-R2-C2-M2-A2-N2-T2-E2-H2) and clustered phylogenetically with reference strains having a DS-1-like genetic backbone. Comparison of the nucleotide and amino acid sequences with selected global cognate genome segments revealed nucleotide and amino acid sequence identities of 81.7–100 % and 90.6–100 %, respectively, with NSP4 gene segment showing the most diversity among the strains. Bayesian analyses of all gene sequences to estimate the time of divergence of the lineage indicated that divergence times ranged from 16 to 44 years, except for the NSP4 gene where the lineage seemed to arise in the more distant past at an estimated 203 years ago. However, the long-term effects of changes found within the NSP4 genome segment should be further explored, and thus we recommend continued whole-genome analyses from larger sample sets to determine the evolutionary mechanisms of the DS-1-like strains collected in Africa. PMID:24952422

  11. Selective oxidation of alcohols using photoactive VO@g-C3N4.

    EPA Science Inventory

    A photoactive VO@g-C3N4 catalyst has been developed for the selective oxidation of alcohols to the corresponding aldehydes and ketones. The visible light mediated activity of the catalyst could be attributed to photoactive graphitic carbon nitrides surface.

  12. Nickel sulfide/graphitic carbon nitride/strontium titanate (NiS/g-C3N4/SrTiO3) composites with significantly enhanced photocatalytic hydrogen production activity.

    PubMed

    Luo, Xiu-Li; He, Gang-Ling; Fang, Yue-Ping; Xu, Yue-Hua

    2018-05-15

    NiS/g-C 3 N 4 /SrTiO 3 (NS/CN/STO) composites were prepared using a facile hydrothermal method. The synergistic effect of g-C 3 N 4 /SrTiO 3 (CN/STO) heterojunction and NiS cocatalyst enhanced the photocatalytic hydrogen evolution activity of NS/CN/STO. A hydrogen production rate of 1722.7 μmol h -1  g -1 was obtained when the 2%NiS/20%g-C 3 N 4 /SrTiO 3 (2NS/20CN/STO) was used for the photocatalytic hydrogen evolution in the presence of methanol used as a sacrificial agent under UV-vis light irradiation; the photocatalytic hydrogen production rate of 2NS/20CN/STO is 32.8, 8.9 and 4.2 times the value of that obtained with pure g-C 3 N 4 , SrTiO 3 and 20%g-C 3 N 4 /SrTiO 3 (20CN/STO), respectively. Moreover, in photoelectrochemical investigations when compared with 20CN/STO, SrTiO 3 and g-C 3 N 4 , 2NS/20CN/STO exhibited significant photocurrent enhancement. The heterojunction and cocatalyst in NS/CN/STO improved the charge separation efficiency and the lifetime of the charge carriers, leading to the enhanced generation of electrons for photocatalytic hydrogen production. Copyright © 2018 Elsevier Inc. All rights reserved.

  13. Glycoengineered Monoclonal Antibodies with Homogeneous Glycan (M3, G0, G2, and A2) Using a Chemoenzymatic Approach Have Different Affinities for FcγRIIIa and Variable Antibody-Dependent Cellular Cytotoxicity Activities.

    PubMed

    Kurogochi, Masaki; Mori, Masako; Osumi, Kenji; Tojino, Mami; Sugawara, Shu-Ichi; Takashima, Shou; Hirose, Yuriko; Tsukimura, Wataru; Mizuno, Mamoru; Amano, Junko; Matsuda, Akio; Tomita, Masahiro; Takayanagi, Atsushi; Shoda, Shin-Ichiro; Shirai, Takashi

    2015-01-01

    Many therapeutic antibodies have been developed, and IgG antibodies have been extensively generated in various cell expression systems. IgG antibodies contain N-glycans at the constant region of the heavy chain (Fc domain), and their N-glycosylation patterns differ during various processes or among cell expression systems. The Fc N-glycan can modulate the effector functions of IgG antibodies, such as antibody-dependent cellular cytotoxicity (ADCC) and complement dependent cytotoxicity (CDC). To control Fc N-glycans, we performed a rearrangement of Fc N-glycans from a heterogeneous N-glycosylation pattern to homogeneous N-glycans using chemoenzymatic approaches with two types of endo-β-N-acetyl glucosaminidases (ENG'ases), one that works as a hydrolase to cleave all heterogeneous N-glycans, another that is used as a glycosynthase to generate homogeneous N-glycans. As starting materials, we used an anti-Her2 antibody produced in transgenic silkworm cocoon, which consists of non-fucosylated pauci-mannose type (Man2-3GlcNAc2), high-mannose type (Man4-9GlcNAc2), and complex type (Man3GlcNAc3-4) N-glycans. As a result of the cleavage of several ENG'ases (endoS, endoM, endoD, endoH, and endoLL), the heterogeneous glycans on antibodies were fully transformed into homogeneous-GlcNAc by a combination of endoS, endoD, and endoLL. Next, the desired N-glycans (M3; Man3GlcNAc1, G0; GlcNAc2Man3GlcNAc1, G2; Gal2GlcNAc2Man3GlcNAc1, A2; NeuAc2Gal2GlcNAc2Man3GlcNAc1) were transferred from the corresponding oxazolines to the GlcNAc residue on the intact anti-Her2 antibody with an ENG'ase mutant (endoS-D233Q), and the glycoengineered anti-Her2 antibody was obtained. The binding assay of anti-Her2 antibody with homogenous N-glycans with FcγRIIIa-V158 showed that the glycoform influenced the affinity for FcγRIIIa-V158. In addition, the ADCC assay for the glycoengineered anti-Her2 antibody (mAb-M3, mAb-G0, mAb-G2, and mAb-A2) was performed using SKBR-3 and BT-474 as target cells, and

  14. Gender-specific association of the plasminogen activator inhibitor-1 4G/5G polymorphism with central arterial blood pressure.

    PubMed

    Björck, Hanna M; Eriksson, Per; Alehagen, Urban; De Basso, Rachel; Ljungberg, Liza U; Persson, Karin; Dahlström, Ulf; Länne, Toste

    2011-07-01

    The functional plasminogen activator inhibitor-1 (PAI-1) 4G/5G polymorphism has previously been associated with hypertension. In recent years, central blood pressure, rather than brachial has been argued a better measure of cardiovascular damage and clinical outcome. The aim of this study was to investigate the possible influence of the 4G/5G polymorphism on central arterial blood pressure in a cohort of elderly individuals. We studied 410 individuals, 216 men and 194 women, aged 70-88. Central pressures and pulse waveforms were calculated from the radial artery pressure waveform by the use of the SphygmoCor system and a generalized transfer function. Brachial pressure was recorded using oscillometric technique (Dinamap, Critikon, Tampa, FL). PAI-1 antigen was determined in plasma. The results showed that central pressures were higher in women carrying the PAI-1 4G/4G genotype compared to female carriers of the 5G/5G genotype, (P = 0.025, P = 0.002, and P = 0.002 for central systolic-, diastolic-, and mean arterial pressure, respectively). The association remained after adjustment for potentially confounding factors related to hypertension. No association of the PAI-1 genotype with blood pressure was found in men. Multiple regression analysis revealed an association between PAI-1 genotype and plasma PAI-1 levels (P = 0.048). Our findings show a gender-specific association of the PAI-1 4G/5G polymorphism with central arterial blood pressure. The genotype effect was independent of other risk factors related to hypertension, suggesting that impaired fibrinolytic potential may play an important role in the development of central hypertension in women.

  15. Comparative Analysis of gO Isoforms Reveals that Strains of Human Cytomegalovirus Differ in the Ratio of gH/gL/gO and gH/gL/UL128-131 in the Virion Envelope

    PubMed Central

    Zhou, Momei; Yu, Qin; Wechsler, Anya

    2013-01-01

    Herpesvirus glycoprotein complex gH/gL provides a core entry function through interactions with the fusion protein gB and can also influence tropism through receptor interactions. The Epstein-Barr virus gH/gL and gH/gL/gp42 serve both functions for entry into epithelial and B cells, respectively. Human cytomegalovirus (HCMV) gH/gL can be bound by the UL128-131 proteins or gO. The phenotypes of gO and UL128-131 mutants suggest that gO-gH/gL interactions are necessary for the core entry function on all cell types, whereas the binding of UL128-131 to gH/gL likely relates to a distinct receptor-binding function for entry into some specific cell types (e.g., epithelial) but not others (e.g., fibroblasts and neurons). There are at least eight isoforms of gO that differ by 10 to 30% of amino acids, and previous analysis of two HCMV strains suggested that some isoforms of gO function like chaperones, disassociating during assembly to leave unbound gH/gL in the virion envelope, while others remain bound to gH/gL. For the current report, we analyzed the gH/gL complexes present in the virion envelope of several HCMV strains, each of which encodes a distinct gO isoform. Results indicate that all strains of HCMV contain stable gH/gL/gO trimers and gH/gL/UL128-131 pentamers and little, if any, unbound gH/gL. TR, TB40/e, AD169, and PH virions contained vastly more gH/gL/gO than gH/gL/UL128-131, whereas Merlin virions contained mostly gH/gL/UL128-131, despite abundant unbound gO remaining in the infected cells. Suppression of UL128-131 expression during Merlin replication dramatically shifted the ratio toward gH/gL/gO. These data suggest that Merlin gO is less efficient than other gO isoforms at competing with UL128-131 for binding to gH/gL. Thus, gO diversity may influence the pathogenesis of HCMV through effects on the assembly of the core versus tropism gH/gL complexes. PMID:23804643

  16. Effect of the G375C and G346E achondroplasia mutations on FGFR3 activation.

    PubMed

    He, Lijuan; Serrano, Christopher; Niphadkar, Nitish; Shobnam, Nadia; Hristova, Kalina

    2012-01-01

    Two mutations in FGFR3, G380R and G375C are known to cause achondroplasia, the most common form of human dwarfism. The G380R mutation accounts for 98% of the achondroplasia cases, and thus has been studied extensively. Here we study the effect of the G375C mutation on the phosphorylation and the cross-linking propensity of full-length FGFR3 in HEK 293 cells, and we compare the results to previously published results for the G380R mutant. We observe identical behavior of the two achondroplasia mutants in these experiments, a finding which supports a direct link between the severity of dwarfism phenotypes and the level and mechanism of FGFR3 over-activation. The mutations do not increase the cross-linking propensity of FGFR3, contrary to previous expectations that the achondroplasia mutations stabilize the FGFR3 dimers. Instead, the phosphorylation efficiency within un-liganded FGFR3 dimers is increased, and this increase is likely the underlying cause for pathogenesis in achondroplasia. We further investigate the G346E mutation, which has been reported to cause achondroplasia in one case. We find that this mutation does not increase FGFR3 phosphorylation and decreases FGFR3 cross-linking propensity, a finding which raises questions whether this mutation is indeed a genetic cause for human dwarfism.

  17. Effect of the G375C and G346E Achondroplasia Mutations on FGFR3 Activation

    PubMed Central

    He, Lijuan; Serrano, Christopher; Niphadkar, Nitish; Shobnam, Nadia; Hristova, Kalina

    2012-01-01

    Two mutations in FGFR3, G380R and G375C are known to cause achondroplasia, the most common form of human dwarfism. The G380R mutation accounts for 98% of the achondroplasia cases, and thus has been studied extensively. Here we study the effect of the G375C mutation on the phosphorylation and the cross-linking propensity of full-length FGFR3 in HEK 293 cells, and we compare the results to previously published results for the G380R mutant. We observe identical behavior of the two achondroplasia mutants in these experiments, a finding which supports a direct link between the severity of dwarfism phenotypes and the level and mechanism of FGFR3 over-activation. The mutations do not increase the cross-linking propensity of FGFR3, contrary to previous expectations that the achondroplasia mutations stabilize the FGFR3 dimers. Instead, the phosphorylation efficiency within un-liganded FGFR3 dimers is increased, and this increase is likely the underlying cause for pathogenesis in achondroplasia. We further investigate the G346E mutation, which has been reported to cause achondroplasia in one case. We find that this mutation does not increase FGFR3 phosphorylation and decreases FGFR3 cross-linking propensity, a finding which raises questions whether this mutation is indeed a genetic cause for human dwarfism. PMID:22529939

  18. GLU298ASP and 4G/5G Polymorphisms and the Risk of Ischemic Stroke in Young Individuals.

    PubMed

    Esparza-García, Juan Carlos; Santiago-Germán, David; Guadalupe Valades-Mejía, María; Hernández-Juárez, Jesus; Aguilar-Sosa, Eberth; Leaños-Miranda, Alfredo; Alvarado-Moreno, Antonio; Majluf-Cruz, Abraham; Isordia-Salas, Irma

    2015-09-01

    Polymorphisms in the endothelial nitric oxide synthase (eNOS) and in the plasminogen activator inhibitor -1 (PAI-1) genes have been implicated in stroke pathogenesis but results are still controversial. The aim of this study was to examine the possible contribution of Glu298Asp in the eNOS and 4G/5G in the PAI-1polymorphisms with ischemic stroke in a young Mexican population. In a case-control study, conducted between January 2006 and June 2010, 204 patients ≤45 years of age with ischemic stroke and 204 controls matched by age and gender, were recruited. The Glu298Asp and 4G/5G polymorphisms were determined in all participants by polymerase chain reaction-restriction fragment length polymorphism. There was a significant difference in the Glu298Asp genotype distribution (P=0.001) and allele frequency between the two groups (P=0.001). The 4G/5G genotype distribution (P=0.40) and the allele frequency was similar between groups; (P=0.13). There were independent factors for ischemic stroke: Asp carriage (GluAsp+AspAsp) (P=0.02); smoking (P=0.01); hypertension (P=0.03), and familial history of atherothrombotic disease (P=0.04). The Asp allele from the Gu298Asp gene represents an independent risk factor for ischemic stroke in a young Mexican population. In contrast, the 4G/5G was not associated with an increased risk for this disease in the same group of patients, as previously has been demonstrated in other populations.

  19. The role of electric field in enhancing separation of gas molecules (H2S, CO2, H2O) on VIB modified g-C3N4 (0 0 1)

    NASA Astrophysics Data System (ADS)

    Wang, Fang; Li, Penghui; Wei, Shiqian; Guo, Jiaxing; Dan, Meng; Zhou, Ying

    2018-07-01

    In this study, the first-principles calculations were performed to investigate the adsorption behaviors of gas molecules H2S, CO2 and H2O on Cr, Mo and W modified g-C3N4 (0 0 1) surface. The results show that H2S, CO2 and H2O are physically adsorbed on the pristine g-C3N4, while the adsorption becomes chemisorbed due to the introduction of transition metals which significantly improve the interfacial electron transfer and narrow the band gap of g-C3N4 (0 0 1). Furthermore, it is found that the adsorption behaviors can be greatly influenced by the applied electric field. The adsorption energy is generally arranged in the order of Eads(H2S) > Eads(H2O) > Eads(CO2), and W/g-C3N4 (0 0 1) exhibits the best separation capability. The study could provide a versatile approach to selectively capture and separate the mixed gases in the catalytic reactions by controlling the applied intensity of electric field.

  20. Ternary composite of TiO2 nanotubes/Ti plates modified by g-C3N4 and SnO2 with enhanced photocatalytic activity for enhancing antibacterial and photocatalytic activity.

    PubMed

    Faraji, Masoud; Mohaghegh, Neda; Abedini, Amir

    2018-01-01

    A series of g-C 3 N 4 -SnO 2 /TiO 2 nanotubes/Ti plates were fabricated via simple dipping of TiO 2 nanotubes/Ti in a solution containing SnCl 2 and g-C 3 N 4 nanosheets and finally annealing of the plates. Synthesized plates were characterized by various techniques. The SEM analysis revealed that the g-C 3 N 4 -SnO 2 nanosheets with high physical stability have been successfully deposited onto the surface of TiO 2 nanotubes/Ti plate. Photocatalytic activity was investigated using two probe chemical reactions: oxidative decomposition of acetic acid and oxidation of 2-propanol under irradiation. Antibacterial activities for Escherichia coli (E. coli) bacteria were also investigated in dark and under UV/Vis illuminations. Detailed characterization and results of photocatalytic and antibacterial activity tests revealed that semiconductor coupling significantly affected the photocatalyst properties synthesized and hence their photocatalytic and antibacterial activities. Modification of TiO 2 nanotubes/Ti plates with g-C 3 N 4 -SnO 2 deposits resulted in enhanced photocatalytic activities in both chemical and microbial systems. The g-C 3 N 4 -SnO 2 /TiO 2 nanotubes/Ti plate exhibited the highest photocatalytic and antibacterial activity, probably due to the heterojunction between g-C 3 N 4 -SnO 2 and TiO 2 nanotubes/Ti in the ternary composite plate and thus lower electron/hole recombination rate. Based on the obtained results, a photocatalytic and an antibacterial mechanism for the degradation of E. coli bacteria and chemical pollutants over g-C 3 N 4 -SnO 2 /TiO 2 nanotubes/Ti plate were proposed and discussed. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Origin of photoluminescence in β -G a2O3

    NASA Astrophysics Data System (ADS)

    Ho, Quoc Duy; Frauenheim, Thomas; Deák, Peter

    2018-03-01

    β -G a2O3 , a candidate material for power electronics and UV optoelectronics, shows strong room-temperature photoluminescence (PL). In addition to the three well-known bands of as-grown samples in the UV, blue, and green, also red PL was observed upon nitrogen doping. This raises the possibility of applying β -G a2O3 nanostructures as white phosphors. Using an optimized, Koopmans-compliant hybrid functional, we show that most intrinsic point defects, as well as substitutional nitrogen, act as deep acceptors, and each of the observed PL bands can be explained by electron recombination with a hole trapped in one of them. We suggest this mechanism to be general in wide-band-gap semiconductors which can only be doped n -type. Calculations on the nitrogen acceptor reproduce the observed red luminescence accurately. Earlier we have shown that not only the energy, but the polarization properties of the UV band can be explained by self-trapped hole states. Here we find that the blue band has its origin mainly in singly negative Ga-O divacancies, and the green band is caused dominantly by interstitial O atoms (with minor contribution of Ga vacancies to both). These assignments can explain the experimentally observed dependence of the PL bands on free-electron concentration and stoichiometry. The information provided here paves the way for the conscious tuning of light emission from β -G a2O3 .

  2. Role of immunoglobulin G subclasses in Q fever.

    PubMed

    Camacho, M T; Outschoorn, I; Tellez, A

    1995-12-01

    The progression of Q fever to either acute or chronic disease has been attributed both to biological characteristics of the bacteria and to the host immune response. In order to determine whether a specific immunoglobulin G (IgG) subclass distribution could play a diagnostic or prognostic role in Q fever, IgG subclass levels were measured in patients with acute or chronic disease. It was observed that (i) IgG1 and IgG3 levels were elevated in patients with chronic Q fever compared to patients with acute disease or normal controls; (ii) variations over time reflected inverse complementary relationships of subclass levels, such as between IgG1 and IgG3 compared with IgG2 and IgG4, or an inverse relationship between IgG1 and IgG2; (iii) variations in IgG2 and IgG3 total subclass levels during follow-up of patients with chronic Q fever showed a decrease in IgG2 with a concomitant increase in IgG3 two years from disease onset. These findings indicate that measurements of IgG subclasses may be a simple, additional tool useful in the diagnosis of Q fever. This data raises the question of an unusual immunoregulatory mechanism in Q fever that is implicated in the presentation of the clinical disease.

  3. Estimation of polyclonal IgG4 hybrids in normal human serum.

    PubMed

    Young, Elizabeth; Lock, Emma; Ward, Douglas G; Cook, Alexander; Harding, Stephen; Wallis, Gregg L F

    2014-07-01

    The in vivo or in vitro formation of IgG4 hybrid molecules, wherein the immunoglobulins have exchanged half molecules, has previously been reported under experimental conditions. Here we estimate the incidence of polyclonal IgG4 hybrids in normal human serum and comment on the existence of IgG4 molecules with different immunoglobulin light chains. Polyclonal IgG4 was purified from pooled or individual donor human sera and sequentially fractionated using light-chain affinity and size exclusion chromatography. Fractions were analysed by SDS-PAGE, immunoblotting, ELISA, immunodiffusion and matrix-assisted laser-desorption mass spectrometry. Polyclonal IgG4 purified from normal serum contained IgG4κ, IgG4λ and IgG4κ/λ molecules. Size exclusion chromatography showed that IgG4 was principally present in monomeric form (150 000 MW). SDS-PAGE, immunoblotting and ELISA showed the purity of the three IgG4 samples. Immunodiffusion, light-chain sandwich ELISA and mass spectrometry demonstrated that both κ and λ light chains were present on only the IgG4κ/λ molecules. The amounts of IgG4κ/λ hybrid molecules ranged from 21 to 33% from the five sera analysed. Based on the molecular weight these molecules were formed of two IgG4 heavy chains plus one κ and one λ light chain. Polyclonal IgG (IgG4-depleted) was similarly fractionated according to light-chain specificity. No evidence of hybrid IgG κ/λ antibodies was observed. These results indicate that hybrid IgG4κ/λ antibodies compose a substantial portion of IgG4 from normal human serum. © 2014 John Wiley & Sons Ltd.

  4. 30 CFR 251.4 - Types of G&G activities that require permits or Notices.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ...) Scientific research. You may only conduct G&G scientific research related to oil, gas, and sulphur in the OCS...) Notice. Any other G&G scientific research that you conduct related to oil, gas, and sulphur in the OCS... research activities you propose to conduct involve: (i) Using solid or liquid explosives; (ii) Drilling a...

  5. Differential endothelial transcriptomics identifies semaphorin 3G as a vascular class 3 semaphorin.

    PubMed

    Kutschera, Simone; Weber, Holger; Weick, Anja; De Smet, Frederik; Genove, Guillem; Takemoto, Minoru; Prahst, Claudia; Riedel, Maria; Mikelis, Constantinos; Baulande, Sylvain; Champseix, Catherine; Kummerer, Petra; Conseiller, Emmanuel; Multon, Marie-Christine; Heroult, Melanie; Bicknell, Roy; Carmeliet, Peter; Betsholtz, Christer; Augustin, Hellmut G

    2011-01-01

    To characterize the role of a vascular-expressed class 3 semaphorin (semaphorin 3G [Sema3G]). Semaphorins have been identified as axon guidance molecules. Yet, they have more recently also been characterized as attractive and repulsive regulators of angiogenesis. Through a transcriptomic screen, we identified Sema3G as a molecule of angiogenic endothelial cells. Sema3G-deficient mice are viable and exhibit no overt vascular phenotype. Yet, LacZ expression in the Sema3G locus revealed intense arterial vascular staining in the angiogenic vasculature, starting at E9.5, which was detectable throughout adolescence and downregulated in adult vasculature. Sema3G is expressed as a full-length 100-kDa secreted molecule that is processed by furin proteases to yield 95- and a 65-kDa Sema domain-containing subunits. Full-length Sema3G binds to NP2, whereas processed Sema3G binds to NP1 and NP2. Expression profiling and cellular experiments identified autocrine effects of Sema3G on endothelial cells and paracrine effects on smooth muscle cells. Although the mouse knockout phenotype suggests compensatory mechanisms, the experiments identify Sema3G as a primarily endothelial cell-expressed class 3 semaphorin that controls endothelial and smooth muscle cell functions in autocrine and paracrine manners, respectively.

  6. Selective cytotoxicity of PAMAM G5 core–PAMAM G2.5 shell tecto-dendrimers on melanoma cells

    PubMed Central

    Schilrreff, Priscila; Mundiña-Weilenmann, Cecilia; Romero, Eder Lilia; Morilla, Maria Jose

    2012-01-01

    Background The controlled introduction of covalent linkages between dendrimer building blocks leads to polymers of higher architectural order known as tecto-dendrimers. Because of the few simple steps involved in their synthesis, tecto-dendrimers could expand the portfolio of structures beyond commercial dendrimers, due to the absence of synthetic drawbacks (large number of reaction steps, excessive monomer loading, and lengthy chromatographic separations) and structural constraints of high-generation dendrimers (reduction of good monodispersity and ideal dendritic construction due to de Gennes dense-packing phenomenon). However, the biomedical uses of tecto-dendrimers remain unexplored. In this work, after synthesizing saturated shell core–shell tecto-dendrimers using amine-terminated polyamidoamine (PAMAM) generation 5 (G5) as core and carboxyl-terminated PAMAM G2.5 as shell (G5G2.5 tecto-dendrimers), we surveyed for the first time the main features of their interaction with epithelial cells. Methods Structural characterization of G5G2.5 was performed by polyacrylamide gel electrophoresis, matrix-assisted laser desorption time-of-flight mass spectrometry, and microscopic techniques; their hydrodynamic size and Z-potential was also determined. Cellular uptake by human epidermal keratinocytes, colon adenocarcinoma, and epidermal melanoma (SK-Mel-28) cells was determined by flow cytometry. Cytotoxicity was determined by mitochondrial activity, lactate dehydrogenase release, glutathione depletion, and apoptosis/necrosis measurement. Results The resultant 60%–67% saturated shell, 87,000-dalton G5G2.5 (mean molecular weight) interacted with cells in a significantly different fashion in comparison to their building blocks and to its closest counterpart, PAMAM G6.5. After being actively taken up by epithelial cells, G5G2.5 caused cytotoxicity only on SK-Mel-28 cells, including depletion of intracellular glutathione and fast necrosis that was manifested above 5 μM G5

  7. Application and expression of HSV gG1 protein from a recombinant strain.

    PubMed

    Yan, Hua; Yan, Huishen; Huang, Tao; Li, Guocai; Gong, Weijuan; Jiao, Hongmei; Chen, Hongju; Ji, Mingchun

    2010-11-01

    According to the homologous sequence of glycoprotein G1 (gG1) genes from different strains of herpes simplex virus type 1 (HSV-1), a pair of primers was designed to amplify the gG1 gene fragment by PCR. Both the PCR product and the pGEX-4T-1 vector were digested with EcoR I and Sal I. The gG1 gene fragment was subcloned into the digested pGEX-4T-1 vector to construct a recombinant plasmid (pGEX-4T-1-gG1). The resultant plasmid was identified by dual-enzyme digestion and sequence analysis, and then transformed into Escherichia coli BL21 for expression under the induction of isopropyl β-D-1-thiogalactoside (IPTG). The expressed GST-gG1 fragment was detected by SDS-PAGE and purified by affinity chromatography. The properties of GST-gG1 fragment were evaluated by immunoblot analysis. Enzyme-linked immunosorbent assays (ELISAs) based on the GST-gG1 fragment were used for determining IgG or IgM to HSV-1. The GST-gG1 fragment-specific ELISA was also compared with ELISA with whole-HSV-1 antigen and commercial ELISA kits. The gG1-specific IgG and IFN-γ producing CD8+ T cells were induced in mice immunized with the GST-gG1 fragment. These results indicated that the GST-gG1 fragment could be used for replacing whole-virus antigen to detect IgM and IgG to HSV-1 in human sera, which provided a strategy for developing vaccines to protect HSV-1 infection using gG1 fragment. Copyright © 2010 Elsevier B.V. All rights reserved.

  8. G5G2.5 core-shell tecto-dendrimer specifically targets reactive glia in brain ischemia.

    PubMed

    Murta, Veronica; Schilrreff, Priscila; Rosciszewski, Gerardo; Morilla, Maria Jose; Ramos, Alberto Javier

    2018-03-01

    Secondary neuronal death is a serious stroke complication. This process is facilitated by the conversion of glial cells to the reactive pro-inflammatory phenotype that induces neurodegeneration. Therefore, regulation of glial activation is a compelling strategy to reduce brain damage after stroke. However, drugs have difficulties to access the CNS, and to specifically target glial cells. In the present work, we explored the use core-shell polyamidoamine tecto-dendrimer (G5G2.5 PAMAM) and studied its ability to target distinct populations of stroke-activated glial cells. We found that G5G2.5 tecto-dendrimer is actively engulfed by primary glial cells in a time- and dose-dependent manner showing high cellular selectivity and lysosomal localization. In addition, oxygen-glucose deprivation or lipopolysaccharides exposure in vitro and brain ischemia in vivo increase glial G5G2.5 uptake; not being incorporated by neurons or other cell types. We conclude that G5G2.5 tecto-dendrimer is a highly suitable carrier for targeted drug delivery to reactive glial cells in vitro and in vivo after brain ischemia. © 2017 International Society for Neurochemistry.

  9. Facile Photochemical Synthesis of Au/Pt/g-C3N4 with Plasmon-Enhanced Photocatalytic Activity for Antibiotic Degradation.

    PubMed

    Xue, Jinjuan; Ma, Shuaishuai; Zhou, Yuming; Zhang, Zewu; He, Man

    2015-05-13

    A novel plasmonic photocatalyst, Au/Pt/g-C3N4, was prepared by a facile calcination-photodeposition technique. The samples were characterized by X-ray diffraction, energy-dispersive spectroscopy, transmission electron microscopy, and UV-vis diffuse reflectance spectroscopy, and the results demonstrated that the Au and Pt nanoparticles (7-15 nm) were well-dispersed on the surfaces of g-C3N4. The Au/Pt codecorated g-C3N4 heterostructure displayed enhanced photocatalytic activity for antibiotic tetracycline hydrochloride (TC-HCl) degradation, and the degradation rate was 3.4 times higher than that of pure g-C3N4 under visible light irradiation. The enhancement of photocatalytic activity could be attributed to the surface plasmon resonance effect of Au and electron-sink function of Pt nanoparticles, which improve the optical absorption property and photogenerated charge carriers separation of g-C3N4, synergistically facilitating the photocatalysis process. Finally, a possible photocatalytic mechanism for degrading TC-HCl by Au/Pt/g-C3N4 heterostructure was tentatively proposed.

  10. One-pot synthesis of K-doped g-C3N4 nanosheets with enhanced photocatalytic hydrogen production under visible-light irradiation

    NASA Astrophysics Data System (ADS)

    Wang, Yanyun; Zhao, Shuo; Zhang, Yiwei; Fang, Jiasheng; Zhou, Yuming; Yuan, Shenhao; Zhang, Chao; Chen, Wenxia

    2018-05-01

    Graphite carbon nitride (g-C3N4), as a promising low cost, visible light driven conjugated polymer semiconductor photocatalyst, has attracted wide attentions from researchers. However, low light absorption efficiency and inadequate charge separation limit the potential applications of g-C3N4. This paper exhibits K-doped g-C3N4 prepared by a facile thermal polymerization with KBr as the K source. The experiments of photocatalytic hydrogen evolution demonstrate that KBr content strongly affects the activity of the catalyst. XRD, FT-IR, XPS, SEM, TEM, UV-vis diffuse reflectance spectra, photoluminescence (PL) characterization methods are used to study the effects of potassium on the catalyst performance. The results find that K-modified g-C3N4 has a narrower band gap and enhanced light harvesting properties. Moreover, the photocatalytic hydrogen evolution rate (HER) of the optimized K-doped g-C3N4 nanosheets (10 wt % KBr) reaches 1337.2 μmol g-1h-1, which is about 5.6 times in comparison with that of pure g-C3N4 (239.8 μmol g-1h-1). The doping of the potassium may increase the π-conjugated systems and accelerate the electron transport rate, then improve the photocatalytic properties. Based on the results of the analysis, a possible mechanism is proposed.

  11. MSH6 G39E Polymorphism and CpG Island Methylator Phenotype in Colon Cancer

    PubMed Central

    Curtin, Karen; Samowitz, Wade S.; Wolff, Roger K.; Caan, Bette J.; Ulrich, Cornelia M.; Potter, John D.; Slattery, Martha L.

    2010-01-01

    The MSH6 G39E germline polymorphism is not associated with an increased risk of either microsatellite stable or unstable sporadic colorectal cancer. Other than microsatellite instability, however, most genetic and epigenetic changes of tumors associated with this common variant have not been studied. The objective of our investigation was to evaluate associations between the MSH6 G39E (116G>A) polymorphism and CpG island methylator phenotype (CIMP) and BRAF V600E mutations in tumors from a sample of 1048 individuals with colon cancer and 1964 controls from Utah, Northern California, and Minnesota. The G39E polymorphism (rs1042821) was determined by the five prime nuclease assay. CIMP was determined by methylation-specific polymerase chain reaction (PCR) of CpG islands in MLH1, methylated in tumors (MINT)1, MINT2, MINT31, and CDKN2A. The BRAF V600E mutation was determined by sequencing exon 15. In microsatellite stable tumors, homozygous carriers of the G39E polymorphism had an increased risk of CIMP+ colon cancer (odds ratio (OR) 2.2, 95% confidence interval (CI) 1.1, 4.2) and BRAF V600E mutation (OR 3.1, 95% CI 1.01, 9.7) in a case–control comparison. This finding was not observed in unstable tumors; however, power may have been low to detect an association. Age at diagnosis, family history, and alcohol use did not interact with MSH6 G39E and CIMP. The MSH6 G39E germline polymorphism may be associated with CIMP+ colon cancer. PMID:19582761

  12. Constructing effective photocatalytic purification system with P-introduced g-C3N4 for elimination of UO22+

    NASA Astrophysics Data System (ADS)

    Wu, Xi; Jiang, Shujuan; Song, Shaoqing; Sun, Chuanzhi

    2018-02-01

    Due to the inherent defects of precursor molecular structure, the limited effect of structure in the formed g-C3N4 will weaken the extension of delocalization of π electrons between the adjacent tri-s-triazine or heptazine units of g-C3N4, which thus leads to poor visible-light absorption, low utilization efficiency of charge carrier. Herein, P-introduced g-C3N4 (PC3N4) photocatalysts were constructed by partially replacing C with tributyl phosphate as precursor, and the as-designed PC3N4 photocatalysts were used to eliminate aqueous uranyl ion by photocatalytic reduction technology under visible-light irradiation. Experimental and DFT revealed that introduction of P into g-C3N4 significantly modified its electronic structure, as reflected by the narrowed band gap, enhanced visible-light absorption as well as improved transfer capability of photogenerated charge. Therefore, photocatalytic activity of PC3N4 was much better than that of pristine g-C3N4 and conventional reducing-type photocatalysts. This study suggests an efficient strategy for construct effective visible-light-responsive photocatalysts for radioactive environmental remediation.

  13. Magnetic Fe@g??C3N4: A Photoactive Catalyst for the Hydrogenation of Alkenes and Alkynes

    EPA Pesticide Factsheets

    A photoactive catalyst, Fe@g-C3N4, has been developed for the hydrogenation of alkenes and alkynes using hydrazine hydrate as a source of hydrogen. The magnetically separable Fe@g-C3N4 eliminates the use of high pressure hydrogenation, and the reaction can be accomplished using visible light without the need for external sources of energy.This dataset is associated with the following publication:Baig, N., S. Verma, R. Varma , and M. Nadagouda. Magnetic Fe@g-C3N4: A Photoactive Catalyst for the Hydrogenation of Alkenes and Alkynes. ACS Sustainable Chemistry & Engineering. American Chemical Society, Washington, DC, USA, 4(3): 1661-1664, (2016).

  14. Oxygen consumption during cold exposure at 2.1 G in rats adapted to hypergravic fields

    NASA Technical Reports Server (NTRS)

    Horowitz, J.; Patterson, S.; Monson, C.

    1985-01-01

    The thermoregulation ability of rats exposed to various gravitational fields is examined. Male Sprague-Dawley rats were exposed to 22 C and 1 G, and 9 C and 2.1 G in experiment one, 1 G, 2.4 G, 5.8 G and 22 + or - 1.5 C in experiment two, and 1 G, 19-22 C, and 5 C in experiment three. It is observed that the core temperature in the control rats was 36.8 + or 0.4 C at 22C and 30.8 + or - 0.6 C at 9 C, and oxygen consumption dropped from 37 + or - 0.3 C core temperature at 22 C, 36.4 + or - 0.3 C at 9 C, 0.4 oxygen consumption was 8.18 + or - 0.9 ml/min at 22 C, and 14.2 + or - 0.4 ml/min at 9 C. The data from experiment two reveal that tail temperature in the control rats peaked at 2.4 G and at 5.8 G for the acclimated rats, and in experiment three a greater decrease in core temperature is detected in the 2.1-G rats. It is noted that prior acclimation to 2.1 G enhances the thermoregulation ability when exposed to the cold.

  15. Efficient G(sup 4)FET-Based Logic Circuits

    NASA Technical Reports Server (NTRS)

    Vatan, Farrokh

    2008-01-01

    A total of 81 optimal logic circuits based on four-gate field-effect transistors (G(sup 4)4FETs) have been designed to implement all Boolean functions of up to three variables. The purpose of this development was to lend credence to the expectation that logic circuits based on G(sup 4)FETs could be more efficient (in the sense that they could contain fewer transistors), relative to functionally equivalent logic circuits based on conventional transistors. A G(sup 4)FET a combination of a junction field-effect transistor (JFET) and a metal oxide/semiconductor field-effect transistor (MOSFET) superimposed in a single silicon island and can therefore be regarded as two transistors sharing the same body. A G(sup 4)FET can also be regarded as a single device having four gates: two side junction-based gates, a top MOS gate, and a back gate activated by biasing of a silicon-on-insulator substrate. Each of these gates can be used to control the conduction characteristics of the transistor; this possibility creates new options for designing analog, radio-frequency, mixed-signal, and digital circuitry. One such option is to design a G(sup 4)FET to function as a three-input NOT-majority gate, which has been shown to be a universal and programmable logic gate. Optimal NOT-majority-gate, G(sup 4)FET-based logic-circuit designs were obtained in a comparative study that also included formulation of functionally equivalent logic circuits based on NOR and NAND gates implemented by use of conventional transistors. In the study, the problem of finding the optimal design for each logic function and each transistor type was solved as an integer-programming optimization problem. Considering all 81 non-equivalent Boolean functions included in the study, it was found that in 63% of the cases, fewer logic gates (and, hence, fewer transistors) would be needed in the G(sup 4)FET-based implementations.

  16. Synthesis and properties of Ag/ZnO/g-C3N4 ternary micro/nano composites by microwave-assisted method

    NASA Astrophysics Data System (ADS)

    Zhang, Zijie; Li, Xuexue; Chen, Haitao; Shao, Gang; Zhang, Rui; Lu, Hongxia

    2018-01-01

    Ag/ZnO/g-C3N4 ternary micro/nanocomposites, as novel visible-light-driven photocatalysts, were prepared by a simple and convenient microwave-assisted method. The resulting ternary structure micro/nano composites were characterized by x-ray diffraction, x-ray photoelectron spectroscopy, scanning electron microscopy, ultraviolet-visible diffuse reflectance spectroscopy and infrared radiation techniques to examine its phase structure, valence state, morphological, thermal and optical properties. Well crystallized Ag/ZnO/g-C3N4 ternary micro/nano composites were synthesized under microwave-radiation for 15 min with the output of 240 W. Further experiments indicated Ag(5.0mol%)/ZnO/g-C3N4 photocatalyst in degradation of methylene blue exhibited an outstanding photocatalytic activity and its reaction rate constant (k, 0.0084 min-1) is 7.5, 2.4 2.9 and 3.5 times higher than that of monolithic ZnO (k, 0.0011 min-1), ZnO/g-C3N4(k, 0.0035 min-1), Ag(5 mol%)/ZnO(k, 0.0029 min-1) and Ag(5mol%)/g-C3N4 (k, 0.0024 min-1) respectively. Finally, a possible photocatalytic mechanism of Ag/ZnO/g-C3N4 photocatalyst in degradation process was proposed. This work provides a feasible strategy to synthesize an efficient ZnO-based photocatalyst which combines structure and properties of different dimensional components and made this ternary system an exciting candidate for sunlight-driven photocatalytic water treatment.

  17. Interfacial coupling induced direct Z scheme water splitting in metal-free photocatalyst: C3N/g-C3N4 heterojunctions.

    PubMed

    Wang, Jiajun; Li, Xiaoting; You, Ya; Xintong, Yang; Wang, Ying; Li, Qunxiang

    2018-06-21

    Mimicking the natural photosynthesis in green plants, artificial Z-scheme photocatalysis enables more efficient utilization of solar energy for photocatalytic water splitting. Most currently designed g-C3N4-based Z-scheme heterojunctions are usually based on metal-containing semiconductor photocatalysts, thus exploiting metal-free photocatalysts for Z-scheme water splitting is of huge interest. Herein, we propose two metal-free C3N/g-C3N4 heterojunctions with the C3N monolayer covering g-C3N4 sheet (monolayer or bilayer) and systematically explore their electronic structures, charge distributions and photocatalytic properties by performing extensive hybrid density functional calculations. We clearly reveal that the relative strong built-in electric fields around their respective interface regions, caused by the charge transfer from C3N monolayer to g-C3N4 monolayer or bilayer, result in the bands bending, renders the transfer of photogenerated carriers in these two heterojunctions following the Z-scheme instead of the type-II pathway. Moreover, the photogenerated electrons and holes in these two C3N/g-C3N4 heterojunctions not only can be efficiently separated, but also have strong redox abilities for water oxidation and reduction. Compared with the isolated g-C3N4 sheets, the light absorption in visible to near-infrared region are significantly enhanced in these proposed heterojunctions. These theoretical findings suggest that these proposed metal-free C3N/g-C3N4 heterojunctions are promising direct Z-scheme photocatalysts for solar water splitting. © 2018 IOP Publishing Ltd.

  18. N -jettiness subtractions for g g →H at subleading power

    NASA Astrophysics Data System (ADS)

    Moult, Ian; Rothen, Lorena; Stewart, Iain W.; Tackmann, Frank J.; Zhu, Hua Xing

    2018-01-01

    N -jettiness subtractions provide a general approach for performing fully-differential next-to-next-to-leading order (NNLO) calculations. Since they are based on the physical resolution variable N -jettiness, TN , subleading power corrections in τ =TN/Q , with Q a hard interaction scale, can also be systematically computed. We study the structure of power corrections for 0-jettiness, T0, for the g g →H process. Using the soft-collinear effective theory we analytically compute the leading power corrections αsτ ln τ and αs2τ ln3τ (finding partial agreement with a previous result in the literature), and perform a detailed numerical study of the power corrections in the g g , g q , and q q ¯ channels. This includes a numerical extraction of the αsτ and αs2τ ln2τ corrections, and a study of the dependence on the T0 definition. Including such power suppressed logarithms significantly reduces the size of missing power corrections, and hence improves the numerical efficiency of the subtraction method. Having a more detailed understanding of the power corrections for both q q ¯ and g g initiated processes also provides insight into their universality, and hence their behavior in more complicated processes where they have not yet been analytically calculated.

  19. Enhanced NO2 abatement by alkaline-earth modified g-C3N4 nanocomposites for efficient air purification

    NASA Astrophysics Data System (ADS)

    Papailias, Ilias; Todorova, Nadia; Giannakopoulou, Tatiana; Karapati, Sofia; Boukos, Nikos; Dimotikali, Dimitra; Trapalis, Christos

    2018-02-01

    The emission of nitrogen dioxide (NO2) is a major problem encountered in photocatalytic NOx removal for air purification. Although the oxidation of nitric oxide (NO) has been extensively studied, the elimination of NO2 byproduct is still in preliminary stage. In this work, alkaline-earth modified graphitic carbon nitride (g-C3N4) is proposed for efficient NOx removal by minimizing the emission of NO2 during the NO oxidation process. The novel photocatalysts were synthesized by annealing mixtures of melamine and various alkaline-earth acetates (magnesium, calcium and barium acetate) at 550 °C for 3 h. The specific surface area of the photocatalysts varied between 4.65 and 11.81 m2/g. The formation of MgO, CaCO3 and BaCO3 was demonstrated by XPS and FT-IR analyses. The initial concentration of each alkaline-earth precursor was 5 and 10 wt%, while the final metal concentration in the nanocomposites was in the range of 7.19-22.39 wt%. The modified photocatalysts showed slightly reduced NO oxidation ability. However, the overall air quality was significantly improved by restraining the NO2 emission. The results were related to the basic character of the nanocomposites due to the presence of alkaline-earths and their enhanced NO2 adsorption capability.

  20. Half molecular exchange of IgGs in the blood of healthy humans: chimeric lambda-kappa-immunoglobulins containing HL fragments of antibodies of different subclasses (IgG1-IgG4).

    PubMed

    Sedykh, Sergey E; Lekchnov, Evgenii A; Prince, Viktor V; Buneva, Valentina N; Nevinsky, Georgy A

    2016-10-20

    In the classic paradigm, immunoglobulins represent products of clonal B cell populations, each producing antibodies recognizing a single antigen (monospecific). There is a common belief that IgGs in mammalian biological fluids are monospecific molecules having stable structures and two identical antigen-binding sites. But the issue concerning the possibility of exchange by HL-fragments between the antibody molecules in human blood is still unexplored. Different physico-chemical and immunological methods for analysis of half-molecule exchange between human blood IgGs were used. Using eighteen blood samples of healthy humans we have shown unexpected results for the first time: blood antibodies undergo extensive post-transcriptional half-molecule exchange and IgG pools on average consist of 62.4 ± 6.5% IgGs containing kappa light chains (kappa-kappa-IgGs), 29.8.6 ± 5.4% lambda light chains (lambda-lambda-IgGs), and 8.8 ± 2.7% (range 2.6-16.8%) IgGs containing both kappa- and lambda-light chains. Kappa-kappa-IgGs and lambda-lambda-IgGs contained on average (%): IgG1 (36.0 and 32.3), IgG2 (50.9 and 51.4), IgG3 (9.7 and 9.9), and IgG4 (6.5 and 5.7), while chimeric kappa-lambda-IgGs consisted of (%): 25.5 ± 4.2 IgG1, 50.8 ± 3.9 IgG2, 9.1 ± 2.1 IgG3, and 14.5 ± 2.2 IgG4. Our unexpected data are indicative of the possibility of half-molecule exchange between blood IgGs of various subclasses, raised against different antigens. The existence of blood chimeric bifunctional IgGs with different binding sites destroys the classic paradigm. Due to the phenomenon of polyspecificity and cross-reactivity of bifunctional IgGs containing HL-fragments of different types to different antigens, such IgGs may be important in human blood for widening their different biological functions.

  1. Anti-cancer Activity of Osmanthus matsumuranus Extract by Inducing G2/M Arrest and Apoptosis in Human Hepatocellular Carcinoma Hep G2 Cells

    PubMed Central

    Jin, Soojung; Park, Hyun-Jin; Oh, You Na; Kwon, Hyun Ju; Kim, Jeong-Hwan; Choi, Yung Hyun; Kim, Byung Woo

    2015-01-01

    Background: Osmanthus matsumuranus, a species of Oleaceae, is found in East Asia and Southeast Asia. The bioactivities of O. matsumuranus have not yet been fully understood. Here, we studied on the molecular mechanisms underlying anti-cancer effect of ethanol extract of O. matsumuranus (EEOM). Methods: Inhibitory effect of EEOM on cell growth and proliferation was determined by WST assay in various cancer cells. To investigate the mechanisms of EEOM-mediated cytotoxicity, HepG2 cells were treated with various concentration of EEOM and analyzed the cell cycle arrest and apoptosis induction by flow cytometry, Western blot analysis, 4,6-diamidino-2-phenylindole (DAPI) staining and DNA fragmentation. Results: EEOM showed the cytotoxic activities in a dose-dependent manner in various cancer cell lines but not in normal cells, and HepG2 cells were most susceptible to EEOM-induced cytotoxicity. EEOM induced G2/M arrest in HepG2 cells associated with decreased expression of cyclin-dependent kinase 1 (CDK1), cyclin A and cylcin B, and increased expression of phospho-checkpoint kinase 2, p53 and CDK inhibitor p21. Immunofluorescence staining showed that EEOM-treated HepG2 increased doublet nuclei and condensed actin, resulting in cell rounding. Furthermore, EEOM-mediated apoptosis was determined by Annexin V staining, chromatin condensation and DNA fragmentation. EEOM caused upregulation of FAS and Bax, activation of caspase-3, -8, -9, and fragmentation of poly ADP ribose polymerase. Conclusions: These results suggest that EEOM efficiently inhibits proliferation of HepG2 cells by inducing both G2/M arrest and apoptosis via intrinsic and extrinsic pathways, and EEOM may be used as a cancer chemopreventive agent in the food or nutraceutical industry. PMID:26734586

  2. Monovalent IgG4 molecules

    PubMed Central

    Wilkinson, Ian C.; Fowler, Susan B.; Machiesky, LeeAnn; Miller, Kenneth; Hayes, David B.; Adib, Morshed; Her, Cheng; Borrok, M. Jack; Tsui, Ping; Burrell, Matthew; Corkill, Dominic J.; Witt, Susanne; Lowe, David C.; Webster, Carl I.

    2013-01-01

    Antibodies have become the fastest growing class of biological therapeutics, in part due to their exquisite specificity and ability to modulate protein-protein interactions with a high biological potency. The relatively large size and bivalency of antibodies, however, limits their use as therapeutics in certain circumstances. Antibody fragments, such as single-chain variable fragments and antigen binding-fragments, have emerged as viable alternatives, but without further modifications these monovalent formats have reduced terminal serum half-lives because of their small size and lack of an Fc domain, which is required for FcRn-mediated recycling. Using rational engineering of the IgG4 Fc domain to disrupt key interactions at the CH3-CH3 interface, we identified a number of point mutations that abolish Fc dimerization and created half-antibodies, a novel monovalent antibody format that retains a monomeric Fc domain. Introduction of these mutations into an IgG1 framework also led to the creation of half-antibodies. These half-antibodies were shown to be soluble, thermodynamically stable and monomeric, characteristics that are favorable for use as therapeutic proteins. Despite significantly reduced FcRn binding in vitro, which suggests that avidity gains in a dimeric Fc are critical to optimal FcRn binding, this format demonstrated an increased terminal serum half-life compared with that expected for most alternative antibody fragments. PMID:23567207

  3. Graphitic Carbon Nitride (g-C3N4)-Based Photocatalysts for Artificial Photosynthesis and Environmental Remediation: Are We a Step Closer To Achieving Sustainability?

    PubMed

    Ong, Wee-Jun; Tan, Lling-Lling; Ng, Yun Hau; Yong, Siek-Ting; Chai, Siang-Piao

    2016-06-22

    As a fascinating conjugated polymer, graphitic carbon nitride (g-C3N4) has become a new research hotspot and drawn broad interdisciplinary attention as a metal-free and visible-light-responsive photocatalyst in the arena of solar energy conversion and environmental remediation. This is due to its appealing electronic band structure, high physicochemical stability, and "earth-abundant" nature. This critical review summarizes a panorama of the latest progress related to the design and construction of pristine g-C3N4 and g-C3N4-based nanocomposites, including (1) nanoarchitecture design of bare g-C3N4, such as hard and soft templating approaches, supramolecular preorganization assembly, exfoliation, and template-free synthesis routes, (2) functionalization of g-C3N4 at an atomic level (elemental doping) and molecular level (copolymerization), and (3) modification of g-C3N4 with well-matched energy levels of another semiconductor or a metal as a cocatalyst to form heterojunction nanostructures. The construction and characteristics of each classification of the heterojunction system will be critically reviewed, namely metal-g-C3N4, semiconductor-g-C3N4, isotype g-C3N4/g-C3N4, graphitic carbon-g-C3N4, conducting polymer-g-C3N4, sensitizer-g-C3N4, and multicomponent heterojunctions. The band structures, electronic properties, optical absorption, and interfacial charge transfer of g-C3N4-based heterostructured nanohybrids will also be theoretically discussed based on the first-principles density functional theory (DFT) calculations to provide insightful outlooks on the charge carrier dynamics. Apart from that, the advancement of the versatile photoredox applications toward artificial photosynthesis (water splitting and photofixation of CO2), environmental decontamination, and bacteria disinfection will be presented in detail. Last but not least, this comprehensive review will conclude with a summary and some invigorating perspectives on the challenges and future directions

  4. The physical properties of Li-doped g-C{sub 3}N{sub 4} monolayer sheet investigated by the first-principles

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ruan, Linwei; Xu, Gengsheng; Gu, Lina

    2015-06-15

    Highlights: • Systematically research on Li-doped g-C{sub 3}N{sub 4} monolayer sheets by first-principles calculation. • Optimal dopant concentration for optical absorption is 7.12%. • Thermodynamics stability of the doped substrate g-C{sub 3}N{sub 4} decreased with Li dopant concentration increasing. • The values of work function Φ decreased monotonously with the increasing of Li dopant concentration. - Abstract: The geometric, electronic, optical properties, thermodynamic stability, and work function of Li-doped g-C{sub 3}N{sub 4} monolayer were investigated by the first-principles calculation. It was found that the Li atoms were preferentially substituted the open-hollow sites of g-C{sub 3}N{sub 4}. Interestingly, the “odd” numbermore » of Li doped g-C{sub 3}N{sub 4} showed metallic properties, while the “even” number of Li atoms widened the band gap of g-C{sub 3}N{sub 4}. The HOMO and LUMO distributions reveal that the active sites located at edge N and C atoms for both pristine and the Li-doped g-C{sub 3}N{sub 4}. In addition, thermodynamic analysis showed that the doped Li atoms reduced the thermodynamic stability of g-C{sub 3}N{sub 4} monolayer sheets.« less

  5. Antigenic Determinants of the Bilobal Cockroach Allergen Bla g 2*

    PubMed Central

    Woodfolk, Judith A.; Glesner, Jill; Wright, Paul W.; Kepley, Christopher L.; Li, Mi; Himly, Martin; Muehling, Lyndsey M.; Gustchina, Alla; Wlodawer, Alexander; Chapman, Martin D.; Pomés, Anna

    2016-01-01

    Bla g 2 is a major indoor cockroach allergen associated with the development of asthma. Antigenic determinants on Bla g 2 were analyzed by mutagenesis based on the structure of the allergen alone and in complex with monoclonal antibodies that interfere with IgE antibody binding. The structural analysis revealed mechanisms of allergen-antibody recognition through cation-π interactions. Single and multiple Bla g 2 mutants were expressed in Pichia pastoris and purified. The triple mutant K132A/K251A/F162Y showed an ∼100-fold reduced capacity to bind IgE, while preserving the native molecular fold, as proven by x-ray crystallography. This mutant was still able to induce mast cell release. T-cell responses were assessed by analyzing Th1/Th2 cytokine production and the CD4+ T-cell phenotype in peripheral blood mononuclear cell cultures. Although T-cell activating capacity was similar for the KKF mutant and Bla g 2 based on CD25 expression, the KKF mutant was a weaker inducer of the Th2 cytokine IL-13. Furthermore, this mutant induced IL-10 from a non-T-cell source at higher levels that those induced by Bla g 2. Our findings demonstrate that a rational design of site-directed mutagenesis was effective in producing a mutant with only 3 amino acid substitutions that maintained the same fold as wild type Bla g 2. These residues, which were involved in IgE antibody binding, endowed Bla g 2 with a T-cell modulatory capacity. The antigenic analysis of Bla g 2 will be useful for the subsequent development of recombinant allergen vaccines. PMID:26644466

  6. [Knockdown of STAT3 inhibits proliferation and migration of HepG2 hepatoma cells induced by IFN1].

    PubMed

    Li, Xiaofang; Wang, Yuqi; Yan, Ben; Fang, Peipei; Ma, Chao; Xu, Ning; Fu, Xiaoyan; Liang, Shujuan

    2018-02-01

    Objective To prepare lentiviruses expressing shRNA sequences targeting human signal transducer and activator of transcription 3 (STAT3) and detect the effect of STAT3 knockdown on type I interferon (IFN1)-induced proliferation and migration in HepG2 cells. Methods Four STAT3-targeting shRNA sequences (shRNA1-shRNA4) and one control sequence (Ctrl shRNA) were selected and cloned respectively into pLKO.1-sp6-pgk-GFP to construct shRNA-expressing vectors. Along with backbone psPAX2 and pMD2.G vectors, they were separately transfected into HEK293T cells to prepare lentiviruses. HepG2 cells were infected with the lentiviruses. Cytoplastic STAT3 level was detected by Western blotting to screen effective shRNA sequence(s) targeting STAT3. Proliferation and migration of HepG2 cells were analyzed by CCK-8 assay and Transwell TM migration and scratching assay, respectively. To detect the effect of IFN1 on cell proliferation and migration of HepG2 cells, the cells were treated with 2000 U/mL IFNα2b for indicated time and the activation of IFN-triggered STAT1 signal transduction was assayed by Western blotting. Results Two most effective STAT3-targeting shRNA sequences shRNA1 and shRNA2 were selected, and the expression of both STAT3 shRNA significantly decreased proliferation and migration of HepG2 cells. When treated with IFNα2b, 2000 U/mL of IFN1 showed more competent in attenuating growth and migration of HepG2 cells. Our data further proved that knockdown of STAT3 increased the phosphorylation of STAT1, and IFNα2b further enhanced the activation of STAT1 signaling in HepG2 cells. Conclusion Knockdown of STAT3 inhibits cell migration and growth, and rescues IFN response through up-regulating STAT1 signal transduction in HepG2 hepatoma cells.

  7. G-quadruplex induced stabilization by 2′-deoxy-2′-fluoro-d-arabinonucleic acids (2′F-ANA)

    PubMed Central

    Peng, Chang Geng; Damha, Masad J.

    2007-01-01

    The impact of 2′-deoxy-2′-fluoroarabinonucleotide residues (2′F-araN) on different G-quadruplexes derived from a thrombin-binding DNA aptamer d(G2T2G2TGTG2T2G2), an anti-HIV phosphorothioate aptamer PS-d(T2G4T2) and a DNA telomeric sequence d(G4T4G4) via UV thermal melting (Tm) and circular dichroism (CD) experiments has been investigated. Generally, replacement of deoxyguanosines that adopt the anti conformation (anti-guanines) with 2′F-araG can stabilize G-quartets and maintain the quadruplex conformation, while replacement of syn-guanines with 2′F-araG is not favored and results in a dramatic switch to an alternative quadruplex conformation. It was found that incorporation of 2′F-araG or T residues into a thrombin-binding DNA G-quadruplex stabilizes the complex (ΔTm up to ∼+3°C/2′F-araN modification); 2′F-araN units also increased the half-life in 10% fetal bovine serum (FBS) up to 48-fold. Two modified thrombin-binding aptamers (PG13 and PG14) show an approximately 4-fold increase in binding affinity to thrombin, as assessed via a nitrocellulose filter binding assay, both with increased thermal stability (∼1°C/2′F-ANA modification increase in Tm) and nuclease resistance (4–7-fold) as well. Therefore, the 2′-deoxy-2′-fluoro-d-arabinonucleic acid (2′F-ANA) modification is well suited to tune (and improve) the physicochemical and biological properties of naturally occurring DNA G-quartets. PMID:17636049

  8. UPSS and G2

    NASA Technical Reports Server (NTRS)

    Dito, Scott J.

    2014-01-01

    The Universal Propellant Servicing System (UPSS) is a dedicated mobile launcher propellant delivery method that will minimize danger and complexity in order to allow vehicles to be serviced and ultimately launched from a variety of locations previously not seen fit for space launch. The UPPS/G2 project is the development of a model, simulation, and ultimately a working application that will control and monitor the cryogenic fluid delivery to the rocket for testing purposes. To accomplish this, the project is using the programming language/environment Gensym G2. The environment is an all-inclusive application that allows development, testing, modeling, and finally operation of the unique application through graphical and programmatic methods. We have learned G2 through classes and trial-and-error, and are now in the process of building the application that will soon be able to be tested on apparatuses here at Kennedy Space Center, and eventually on the actual unit. The UPSS will bring near-autonomous control of launches to those that need it, as well it will be a great addition to NASA and KSC's operational viability and the opportunity to bring space launches to parts of the world, and in time constraints, once not thought possible.

  9. 4G/5G plasminogen activator inhibitor-1 and -308 A/G tumor necrosis factor-α promoter gene polymorphisms in Argentinean lupus patients: focus on lupus nephritis.

    PubMed

    Muñoz, Sebastián Andrés; Aranda, Federico; Allievi, Alberto; Orden, Alberto Omar; Perés Wingeyer, Silvia; Trobo, Rosana; Alvarez, Analía; Eimon, Alicia; Barreira, Juan Carlos; Schneeberger, Emilce; Dal Pra, Fernando; Sarano, Judith; Hofman, Julio; Chamorro, Julián; de Larrañaga, Gabriela

    2014-02-01

    We investigated the relationship between the 4G/5G plasminogen activator inhibitor (PAI-1) and -308 A/G tumor necrosis factor-α (TNF-α) polymorphisms and the clinical and biochemical features of systemic lupus erythematosus (SLE) in an Argentinean patient cohort. A total of 402 patients were studied, including 179 SLE patients and 223 healthy individuals. PCR-RLFP was used to determine the genotypes of the 4G/5G PAI-1 and -308 A/G TNF-α polymorphisms. SLE patients with lupus nephritis (LN) (n = 86) were compared with patients without LN (n = 93). Additionally, LN patients were divided into proliferative LN and non-proliferative LN groups according to the results of the renal biopsies. No significant differences were noted in the genotype distributions or allele frequencies of these TNF-α and PAI-1 polymorphisms between SLE patients and controls. There were higher numbers of criteria for SLE, more lupus flares and higher damage scores in LN patients, but there were similar frequencies of anti-phospholipid antibody (APA) positivity and anti-phospholipid syndrome. No significant difference was noted for any studied variable between the proliferative LN and non-proliferative LN groups except for the presence of APA. We found no significant differences in the TNF-α and PAI-1 genotype distributions or allele frequencies between groups. We found that the -308 A/G TNF-α and 4G/5G PAI-1 polymorphisms are not associated with susceptibility to SLE in an Argentinean population. We also did not find any association between the presence of any specific allele or genotype and the development of LN in SLE patients. Finally, no association was noted between either of the two polymorphisms and the severity of renal disease.

  10. The 26gAl(p,g)27Si reaction in Novae

    NASA Astrophysics Data System (ADS)

    Ruiz, Chris; Parikh, A.; José, J.; Buchmann, L.; Caggiano, J. A.; Chen, A. A.; Clark, J. A.; Crawford, H.; Davids, B.; D'Auria, J. M.; Davis, C.; Deibel, C.; Erikson, L.; Fogarty, L.; Frekers, D.; Greife, U.; Hussein, A.; Hutcheon, D. A.; Huyse, M.; Jewett, C.; Laird, A. M.; Lewis, R.; Mumby-Croft, P.; Olin, A.; Ottewell, D. F.; Ouellet, C. V.; Parker, P.; Pearson, J.; Ruprecht, G.; Trinczek, M.; Vockenhuber, C.; Wrede, C.

    The 26gAl(p,γ)27Si Reaction in Novae PoS(NIC-IX)004 1 TRIUMF, 4004 Wesbrook Mall, Vancouver, BC V6T 2A3, Canada 2 Wright Nuclear Structure Laboratory, Yale University, New Haven, Conneticut 06520-8124, USA 3 Dept. de Física í Enginyeria Nuclear, Universitat Politécnica de Catalunya, Barcelona, Spain 4 Institut d'Estudis Espacials de Catalunya (IEEC), Barcelona, Spain 5 McMaster University, Hamilton, ON L8S 481, Canada 6 Simon Fraser University, Burnaby, BC V5A 1S6, Canada 7 Department of Physics, Colorado School of Mines, Golden, Colorado 80401, USA 8 National University of Ireland, Maynooth, Co. Kildare, Ireland 9 Institut für Kernphysik, Westfälische Willhelms-Universität Münster, 48149 Münster, Germany 10 University of Northern British Columbia, Prince George, BC V2N 4Z9, Canada 11 Katholieke Universiteit Leuven, 3000 Leuven, Belgium 12 Department of Physics, University of York, York YO10 5DD, United Kingdom The 184 keV resonance strength in the 26gAl(p,γ)27Si reaction was measured in inverse kinematics using the DRAGON facility at TRIUMF-ISAC. We obtain a value of ωγ=35±7 μeV for the strength and ER=184±1 keV for the resonance energy. These values are consistent with p-wave capture into the 7652(3) keV state in 27Si. We discuss the implications of these results for 26gAl nucleosynthesis in a typical O-Ne white dwarf nova.

  11. 78 FR 21151 - G4 Products, LLC a Subsidiary of G4 Holdings, Inc. Including Workers Whose Wages are Paid Under...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-04-09

    ... certification for G4 Products. Additional information provided by the company official revealed that the subject... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-81,432] G4 Products, LLC a...-Site Leased Workers from OSW and Maine Staffing Group Lewiston, ME; Amended Certification Regarding...

  12. Incomplete APOBEC3G/F Neutralization by HIV-1 Vif Mutants Facilitates the Genetic Evolution from CCR5 to CXCR4 Usage.

    PubMed

    Alteri, Claudia; Surdo, Matteo; Bellocchi, Maria Concetta; Saccomandi, Patrizia; Continenza, Fabio; Armenia, Daniele; Parrotta, Lucia; Carioti, Luca; Costa, Giosuè; Fourati, Slim; Di Santo, Fabiola; Scutari, Rossana; Barbaliscia, Silvia; Fedele, Valentina; Carta, Stefania; Balestra, Emanuela; Alcaro, Stefano; Marcelin, Anne Genevieve; Calvez, Vincent; Ceccherini-Silberstein, Francesca; Artese, Anna; Perno, Carlo Federico; Svicher, Valentina

    2015-08-01

    Incomplete APOBEC3G/F neutralization by a defective HIV-1Vif protein can promote genetic diversification by inducing G-to-A mutations in the HIV-1 genome. The HIV-1 Env V3 loop, critical for coreceptor usage, contains several putative APOBEC3G/F target sites. Here, we determined if APOBEC3G/F, in the presence of Vif-defective HIV-1 virus, can induce G-to-A mutations at V3 positions critical to modulation of CXCR4 usage. Peripheral blood mononuclear cells (PBMC) and monocyte-derived macrophages (MDM) from 2 HIV-1-negative donors were infected with CCR5-using 81.A-VifWT virus (i.e., with wild-type [WT] Vif protein), 81.A-VifE45G, or 81.A-VifK22E (known to incompletely/partially neutralize APOBEC3G/F). The rate of G-toA mutations was zero or extremely low in 81.A-VifWT- and 81.A-VifE45G-infected PBMC from both donors. Conversely, G-to-A enrichment was detected in 81.A-VifK22E-infected PBMC (prevalence ranging from 2.18% at 7 days postinfection [dpi] to 3.07% at 21 dpi in donor 1 and from 10.49% at 7 dpi to 8.69% at 21 dpi in donor 2). A similar scenario was found in MDM. G-to-A mutations occurred at 8 V3 positions, resulting in nonsynonymous amino acid substitutions. Of them, G24E and E25K strongly correlated with phenotypically/genotypically defined CXCR4-using viruses (P = 0.04 and 5.5e-7, respectively) and increased the CXCR4 N-terminal binding affinity for V3 (WT, -40.1 kcal/mol; G24E, -510 kcal/mol; E25K, -522 kcal/mol). The analysis of paired V3 and Vif DNA sequences from 84 HIV-1-infected patients showed that the presence of a Vif-defective virus correlated with CXCR4 usage in proviral DNA (P = 0.04). In conclusion, incomplete APOBEC3G/F neutralization by a single Vif amino acid substitution seeds a CXCR4-using proviral reservoir. This can have implications for the success of CCR5 antagonist-based therapy, as well as for the risk of disease progression. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  13. Incomplete APOBEC3G/F Neutralization by HIV-1 Vif Mutants Facilitates the Genetic Evolution from CCR5 to CXCR4 Usage

    PubMed Central

    Alteri, Claudia; Surdo, Matteo; Bellocchi, Maria Concetta; Saccomandi, Patrizia; Continenza, Fabio; Armenia, Daniele; Parrotta, Lucia; Carioti, Luca; Costa, Giosuè; Fourati, Slim; Di Santo, Fabiola; Scutari, Rossana; Barbaliscia, Silvia; Fedele, Valentina; Carta, Stefania; Balestra, Emanuela; Alcaro, Stefano; Marcelin, Anne Genevieve; Calvez, Vincent; Ceccherini-Silberstein, Francesca; Artese, Anna

    2015-01-01

    Incomplete APOBEC3G/F neutralization by a defective HIV-1Vif protein can promote genetic diversification by inducing G-to-A mutations in the HIV-1 genome. The HIV-1 Env V3 loop, critical for coreceptor usage, contains several putative APOBEC3G/F target sites. Here, we determined if APOBEC3G/F, in the presence of Vif-defective HIV-1 virus, can induce G-to-A mutations at V3 positions critical to modulation of CXCR4 usage. Peripheral blood mononuclear cells (PBMC) and monocyte-derived macrophages (MDM) from 2 HIV-1-negative donors were infected with CCR5-using 81.A-VifWT virus (i.e., with wild-type [WT] Vif protein), 81.A-VifE45G, or 81.A-VifK22E (known to incompletely/partially neutralize APOBEC3G/F). The rate of G-toA mutations was zero or extremely low in 81.A-VifWT- and 81.A-VifE45G-infected PBMC from both donors. Conversely, G-to-A enrichment was detected in 81.A-VifK22E-infected PBMC (prevalence ranging from 2.18% at 7 days postinfection [dpi] to 3.07% at 21 dpi in donor 1 and from 10.49% at 7 dpi to 8.69% at 21 dpi in donor 2). A similar scenario was found in MDM. G-to-A mutations occurred at 8 V3 positions, resulting in nonsynonymous amino acid substitutions. Of them, G24E and E25K strongly correlated with phenotypically/genotypically defined CXCR4-using viruses (P = 0.04 and 5.5e−7, respectively) and increased the CXCR4 N-terminal binding affinity for V3 (WT, −40.1 kcal/mol; G24E, −510 kcal/mol; E25K, −522 kcal/mol). The analysis of paired V3 and Vif DNA sequences from 84 HIV-1-infected patients showed that the presence of a Vif-defective virus correlated with CXCR4 usage in proviral DNA (P = 0.04). In conclusion, incomplete APOBEC3G/F neutralization by a single Vif amino acid substitution seeds a CXCR4-using proviral reservoir. This can have implications for the success of CCR5 antagonist-based therapy, as well as for the risk of disease progression. PMID:26055363

  14. Birth of Archaeal Cells: Molecular Phylogenetic Analyses of G1P Dehydrogenase, G3P Dehydrogenases, and Glycerol Kinase Suggest Derived Features of Archaeal Membranes Having G1P Polar Lipids

    PubMed Central

    2016-01-01

    Bacteria and Eukarya have cell membranes with sn-glycerol-3-phosphate (G3P), whereas archaeal membranes contain sn-glycerol-1-phosphate (G1P). Determining the time at which cells with either G3P-lipid membranes or G1P-lipid membranes appeared is important for understanding the early evolution of terrestrial life. To clarify this issue, we reconstructed molecular phylogenetic trees of G1PDH (G1P dehydrogenase; EgsA/AraM) which is responsible for G1P synthesis and G3PDHs (G3P dehydrogenase; GpsA and GlpA/GlpD) and glycerol kinase (GlpK) which is responsible for G3P synthesis. Together with the distribution of these protein-encoding genes among archaeal and bacterial groups, our phylogenetic analyses suggested that GlpA/GlpD in the Commonote (the last universal common ancestor of all extant life with a cellular form, Commonote commonote) acquired EgsA (G1PDH) from the archaeal common ancestor (Commonote archaea) and acquired GpsA and GlpK from a bacterial common ancestor (Commonote bacteria). In our scenario based on this study, the Commonote probably possessed a G3P-lipid membrane synthesized enzymatically, after which the archaeal lineage acquired G1PDH followed by the replacement of a G3P-lipid membrane with a G1P-lipid membrane. PMID:27774041

  15. The Failure Models of Lead Free Sn-3.0Ag-0.5Cu Solder Joint Reliability Under Low-G and High-G Drop Impact

    NASA Astrophysics Data System (ADS)

    Gu, Jian; Lei, YongPing; Lin, Jian; Fu, HanGuang; Wu, Zhongwei

    2017-02-01

    The reliability of Sn-3.0Ag-0.5Cu (SAC 305) solder joint under a broad level of drop impacts was studied. The failure performance of solder joint, failure probability and failure position were analyzed under two shock test conditions, i.e., 1000 g for 1 ms and 300 g for 2 ms. The stress distribution on the solder joint was calculated by ABAQUS. The results revealed that the dominant reason was the tension due to the difference in stiffness between the print circuit board and ball grid array, and the maximum tension of 121.1 MPa and 31.1 MPa, respectively, under both 1000 g or 300 g drop impact, was focused on the corner of the solder joint which was located in the outmost corner of the solder ball row. The failure modes were summarized into the following four modes: initiation and propagation through the (1) intermetallic compound layer, (2) Ni layer, (3) Cu pad, or (4) Sn-matrix. The outmost corner of the solder ball row had a high failure probability under both 1000 g and 300 g drop impact. The number of failures of solder ball under the 300 g drop impact was higher than that under the 1000 g drop impact. The characteristic drop values for failure were 41 and 15,199, respectively, following the statistics.

  16. Differential in vitro inhibition of M3G and M6G formation from morphine by (R)- and (S)-methadone and structurally related opioids

    PubMed Central

    Morrish, Glynn A; Foster, David J R; Somogyi, Andrew A

    2006-01-01

    Aims To determine the in vitro kinetics of morphine-3-glucuronide (M3G) and morphine-6-glucuronide (M6G) formation and the inhibition potential by methadone enantiomers and structurally related opioids. Methods M3G and M6G formation kinetics from morphine were determined using microsomes from five human livers. Inhibition of glucuronide formation was investigated with eight inhibitors (100 µm) and the mechanism of inhibition determined for (R)- and (S)-methadone (70–500 µm) using three microsomal samples. Results Glucuronide formation displayed single enzyme kinetics. The M3G Vmax (mean ± SD) was 4.8-fold greater than M6G Vmax (555 ± 110 vs. 115 ± 19 nmol mg−1 protein h−1; P = 0.006, mean of difference 439; 95% confidence interval 313, 565 nmol mg−1 protein h−1). Km values for M3G and M6G formation were not significantly different (1.12 ± 0.37 vs. 1.11 ± 0.31 mm; P = 0.89, 0.02; −0.29, 0.32 mm). M3G and M6G formation was inhibited (P < 0.01) with a significant increase in the M3G/M6G ratio (P < 0.01) for all compounds tested. Detailed analysis with (R)- and (S)-methadone revealed noncompetitive inhibition with (R)-methadone Ki of 320 ± 42 µm and 192 ± 12 µm for M3G and M6G, respectively, and (S)-methadone Ki of 226 ± 30 µm and 152 ± 20 µm for M3G and M6G, respectively. Ki values for M3G inhibition were significantly greater than for M6G for (R)-methadone (P = 0.017, 128; 55, 202 µm) and (S)-methadone (P = 0.026, 75; 22, 128 µm). Conclusions Both methadone enantiomers noncompetitively inhibited the formation of morphine's primary metabolites, with greater inhibition of M6G formation compared with M3G. These findings indicate a mechanism for reduced morphine clearance in methadone-maintained patients and reduced relative formation of the opioid active M6G compared with M3G. PMID:16487227

  17. Exposure to 2,4-dichlorophenoxyacetic acid induced PPARβ-dependent disruption of glucose metabolism in HepG2 cells.

    PubMed

    Sun, Haidong; Shao, Wentao; Liu, Hui; Jiang, Zhaoyan

    2018-04-09

    2,4-Dichlorophenoxyacetic acid is one of the most widely used herbicides. Its impact on health is increasingly attracting great attentions. This study aimed to investigate the effect of 2,4-dichlorophenoxyacetic acid on glucose metabolism in HepG2 cells and the underlying mechanism. After 24 h exposure to 2,4-dichlorophenoxyacetic acid, glycogen was measured by PAS staining and glucose by ELISA in HepG2 cells. The expression of genes involved in glucose metabolism was measured by real-time PCR, Western blotting, and immunofluorescence. HepG2 cells presented more extracellular glucose consumption and glycogen content after exposed to 2,4-dichlorophenoxyacetic acid. Expression of gluconeogenesis-related genes, FoxO1, and CREB is significantly elevated. Moreover, PPARβ was up-regulated dose-dependently. SiRNA knockdown of PPARβ completely rescued the increase of glycogen accumulation and glucose uptake, and the up-regulation of FOXO1 and CREB expression. Our findings propose novel mechanisms that 2,4-dichlorophenoxyacetic acid causes glucose metabolism dysfunction through PPARβ in HepG2 cells.

  18. The extraction of the spin structure function, g2 (and g1) at low Bjorken x

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ndukum, Luwani Z.

    2015-08-01

    The Spin Asymmetries of the Nucleon Experiment (SANE) used the Continuous Electron Beam Accelerator Facility at Jefferson Laboratory in Newport News, VA to investigate the spin structure of the proton. The experiment measured inclusive double polarization electron asymmetries using a polarized electron beam, scattered off a solid polarized ammonia target with target polarization aligned longitudinal and near transverse to the electron beam, allowing the extraction of the spin asymmetries A1 and A2, and spin structure functions g1 and g2. Polarized electrons of energies of 4.7 and 5.9 GeV were used. The scattered electrons were detected by a novel, non-magnetic arraymore » of detectors observing a four-momentum transfer range of 2.5 to 6.5 GeV*V. This document addresses the extraction of the spin asymmetries and spin structure functions, with a focus on spin structure function, g2 (and g1) at low Bjorken x. The spin structure functions were measured as a function of x and W in four Q square bins. A full understanding of the low x region is necessary to get clean results for SANE and extend our understanding of the kinematic region at low x.« less

  19. Photocatalytic CH activation and oxidative esterification using Pd@g-C3N4

    EPA Science Inventory

    Graphitic carbon nitride supported palladium nanoparticles, Pd@g-C3N4, have been synthesized and utilized for the direct oxidative esterification of alcohols using atmospheric oxygen as a co-oxidant via photocatalytic CH activation.

  20. Muon g-2

    Science.gov Websites

    Related Links A Key Contribution from Brookhaven Laboratory The Big Move Muon Department Facebook g-2 on is filled with an invisible sea of virtual particles that -in accordance with the laws of quantum presence and nature of these virtual particles with particle beams traveling in a magnetic field. The Muon

  1. Preparation of new nano magnetic material Fe3O4@g-C3N4 and good adsorption performance on uranium ion

    NASA Astrophysics Data System (ADS)

    Long, Wei; Liu, Huijun; Yan, Xueming; Fu, Li

    2018-03-01

    A new nano magnetic material Fe3O4@g-C3N4 was prepared by deposition reduction method, which performed good adsorption performance to uranium ion. Characterization results showed that the g-C3N4 particles were wrapped around the nano magnetic Fe3O4 particles, and the textural properties of this material was improved, so the adsorption performance to uranium ion was good. Adsorption experiments of this material demonstrated that the optimum pH value was 10, the optimum mass of adsorbent was 6.5 mg and the optimum adsorption time was 150 min in the initial concentration of 140 mg/L uranium ion solution system, and the maximum adsorption capacity was up to 352.1 mg/g and the maximum adsorption rate was more than 90%.

  2. G2S: a web-service for annotating genomic variants on 3D protein structures.

    PubMed

    Wang, Juexin; Sheridan, Robert; Sumer, S Onur; Schultz, Nikolaus; Xu, Dong; Gao, Jianjiong

    2018-06-01

    Accurately mapping and annotating genomic locations on 3D protein structures is a key step in structure-based analysis of genomic variants detected by recent large-scale sequencing efforts. There are several mapping resources currently available, but none of them provides a web API (Application Programming Interface) that supports programmatic access. We present G2S, a real-time web API that provides automated mapping of genomic variants on 3D protein structures. G2S can align genomic locations of variants, protein locations, or protein sequences to protein structures and retrieve the mapped residues from structures. G2S API uses REST-inspired design and it can be used by various clients such as web browsers, command terminals, programming languages and other bioinformatics tools for bringing 3D structures into genomic variant analysis. The webserver and source codes are freely available at https://g2s.genomenexus.org. g2s@genomenexus.org. Supplementary data are available at Bioinformatics online.

  3. 5-Aminouracil treatment. A method for estimating G2.

    PubMed

    Socher, S H; Davidson, D

    1971-02-01

    Treatment of Vicia faba lateral roots with a range of concentrations of 5-aminouracil (5-AU) indicate that cells are stopped at a particular point in interphase. The timing of the fall in mitotic index suggests that cells are held at the S - G(2) transition. When cells are held at this point, treatments with 5-AU can be used to estimate the duration of G(2) + mitosis/2 of proliferating cells. Treatment with 5-AU can also be used to demonstrate the presence of subpopulations of dividing cells that differ in their G(2) duration. Using this method, 5-AU-induced inhibition, we have confirmed that in V. faba lateral roots there are two populations of dividing cells: (a) a fast-dividing population, which makes up approximately 85% of the proliferating cell population and has a G(2) + mitosis/2 duration of 3.3 hr, and (b) a slow-dividing population, which makes up approximately 15% of dividing cells and has a G(2) duration in excess of 12 hr. These estimates are similar to those obtained from percentage labeled mitosis (PLM) curves after incorporation of thymidine-(3)H.

  4. Compressible and Recyclable Monolithic g-C3N4/Melamine Sponge: A Facile Ultrasonic-coating Approach and Enhanced Visible-light Photocatalytic Activity

    NASA Astrophysics Data System (ADS)

    Yang, Ye; Zhang, Qian; Zhang, Ruiyang; Ran, Tao; Wan, Wenchao; Zhou, Ying

    2018-05-01

    Powdery photocatalysts seriously restrict their practical application due to the difficult recycle and low photocatalytic activity. In this work, a monolithic g-C3N4/melamine sponge (g-C3N4/MS) was successfully fabricated by a cost-effective ultrasonic-coating route, which is easy to achieve the uniform dispersion and firm loading of g-C3N4 on MS skeleton. The monolithic g-C3N4/MS entirely inherits the porous structure of MS and results in a larger specific surface area (SSA) than its powdery counterpart. Benefit from this monolithic structure, g-C3N4/MS gains more exposed active sites, enhanced visible-light absorption and separation of photogenerated carriers, thus achieving noticeable photocatalytic activity on nitric oxide (NO) removal, rhodamine B (RhB) degradation and CO2 reduction. Specifically, NO removal ratio is as high as 78.6% which is 4.5 times higher than that of the powdery g-C3N4, while RhB degradation rate reaches 97.88%, and yield rate of CO and CH4 attains 7.48 and 3.93 μmol g-1 h-1. Importantly, the features of low-density, high porosity, good elasticity and firmness, not only endow g-C3N4/MS with flexibility in various environmental applications, but also make it easy to recycle and stable for long-time application. Our work provides a feasible approach to fabricate novel monolithic photocatalysts with large-scale production and application.

  5. Compressible and Recyclable Monolithic g-C3N4/Melamine Sponge: A Facile Ultrasonic-Coating Approach and Enhanced Visible-Light Photocatalytic Activity.

    PubMed

    Yang, Ye; Zhang, Qian; Zhang, Ruiyang; Ran, Tao; Wan, Wenchao; Zhou, Ying

    2018-01-01

    Powdery photocatalysts seriously restrict their practical application due to the difficult recycle and low photocatalytic activity. In this work, a monolithic g-C 3 N 4 /melamine sponge (g-C 3 N 4 /MS) was successfully fabricated by a cost-effective ultrasonic-coating route, which is easy to achieve the uniform dispersion and firm loading of g-C 3 N 4 on MS skeleton. The monolithic g-C 3 N 4 /MS entirely inherits the porous structure of MS and results in a larger specific surface area (SSA) than its powdery counterpart. Benefit from this monolithic structure, g-C 3 N 4 /MS gains more exposed active sites, enhanced visible-light absorption and separation of photogenerated carriers, thus achieving noticeable photocatalytic activity on nitric oxide (NO) removal and CO 2 reduction. Specifically, NO removal ratio is as high as 78.6% which is 4.5 times higher than that of the powdery g-C 3 N 4 , and yield rate of CO and CH 4 attains 7.48 and 3.93 μmol g -1 h -1 . Importantly, the features of low-density, high porosity, good elasticity, and firmness, not only endow g-C 3 N 4 /MS with flexibility in various environmental applications, but also make it easy to recycle and stable for long-time application. Our work provides a feasible approach to fabricate novel monolithic photocatalysts with large-scale production and application.

  6. Echinococcus canadensis (Cestoda: Taeniidae) is a valid species consisting of the mitochondrial genotypes G6, G7, G8 and G10

    USDA-ARS?s Scientific Manuscript database

    The species status of Echinococcus canadensis has long been controversial, mainly because it consists of the mitochondrial genotypes G6, G7, G8 and G10 with different host affinity: G6 (camel strain) and G7 (pig strain) with domestic cycles and G8 (cervid strain) and G10 (Fennoscandian cervid strain...

  7. Plasminogen activator inhibitor type 1 serum levels and 4G/5G gene polymorphism in morbidly obese Hispanic patients with non-alcoholic fatty liver disease.

    PubMed

    Espino, Alberto; Villagrán, Andrea; Vollrath, Valeska; Hanckes, Paulina; Salas, Roberto; Farah, Andrea; Solís, Nancy; Pizarro, Margarita; Escalona, Alex; Boza, Camilo; Pérez, Gustavo; Carrasco, Gonzalo; Padilla, Oslando; Miquel, Juan Francisco; Nervi, Flavio; Chavez-Tapia, Norberto C; Arab, Juan Pablo; Alvarez-Lobos, Manuel; Arrese, Marco; Riquelme, Arnoldo

    2011-01-01

    The plasminogen activator inhibitor type-1 (PAI-1) has been implicated in the regulation of fibrinolysis and extracellular matrix components. The single base pair guanine insertion/deletion polymorphism (4G/5G) within the promoter region of the PAI-1 gene influences PAI-1 synthesis and may modulate hepatic fibrogenesis. To evaluate the influence of PAI-1 serum levels and 4G/5G polymorphism on the risk of liver fibrosis associated to non-alcoholic fatty liver disease (NAFLD) in morbidly obese patients. Case-control study of 50 obese patients undergoing bariatric surgery and 71 non-obese subjects matched by age and sex. Anthropometric and biochemical measurements were performed, including PAI-1 serum levels. Genomic DNA was obtained to assess the presence of 4G/5G polymorphism. BMI, insulinemia, triglycerides, HOMA-IR, hypertension and diabetes were significantly higher in obese patients compared to control subjects. PAI-1 serum levels observed in obese patients were significantly lower (10.63 ± 4.82) compared to controls (14.26 ± 11.4; p < 0.05). No differences were observed in the PAI-1 4G/5G promoter genotypes frequencies (p = 0.12). No differences were observed in PAI-1 plasma levels among obese patients with liver fibrosis (10.64 ± 4.35) compared to patients without liver fibrosis (10.61 ± 5.2; p = 0.985). PAI-1 4G/5G promoter genotypes frequencies were similar in patients with or without liver fibrosis associated to NASH (p = 0.6). Morbidly obese patients had significantly lower PAI-1 serum levels with similar PAI-1 4G/5G genotypes frequencies compared to non-obese subjects. The frequency of 4G/5G genotypes in Chilean Hispanic healthy subjects was similar to that described in other populations. No association was found between PAI-1 serum levels or 4G/5G genotype with liver fibrosis in obese patients.

  8. Solar photocatalytic water oxidation over Ag3PO4/g-C3N4 composite materials mediated by metallic Ag and graphene

    NASA Astrophysics Data System (ADS)

    Cui, Xingkai; Tian, Lin; Xian, Xiaozhai; Tang, Hua; Yang, Xiaofei

    2018-02-01

    Solar-driven water splitting over semiconductor-based photocatalysts provides direct conversion of solar energy to chemical energy, in which electron-hole separation and charge transport are critical for enhancing the photocatalytic activity of semiconducting materials. Moreover, the search for active photocatalysts that efficiently oxidize water remains a challenging task. Here, we demonstrate that a series of Ag3PO4/Ag/graphene/graphitic carbon nitride (g-C3N4) heterostructured materials can drive photocatalytic water oxidation efficiently under LED illumination. The water oxidation behavior of as-prepared composite photocatalysts in relation to the added amount of g-C3N4 and the roles of electron mediators was investigated in detail. Based on the illuminated Z-scheme photocatalytic mechanism, the photogenerated electrons and holes can be separated effectively and the electron-hole recombination of bulk material is suppressed. The reduced metallic Ag nanoparticles were found to function as the center for the accumulation of electrons from Ag3PO4 and holes from g-C3N4. By exploiting the proper addition of g-C3N4 into the composite, photocatalytic oxygen evolution performance over the heterostructured materials could be suitably tuned, which resulted in highly efficient water oxidation.

  9. Fabrication of conductive and high-dispersed Ppy@Ag/g-C3N4 composite photocatalysts for removing various pollutants in water

    NASA Astrophysics Data System (ADS)

    Zhu, Zhi; Tang, Xu; Ma, Changchang; Song, Minshan; Gao, Nailing; Wang, Youshan; Huo, Pengwei; Lu, Ziyang; Yan, Yongsheng

    2016-11-01

    The ternary conductive Ppy@Ag/g-C3N4 composite photocatalysts was successfully synthesized by polymerization process and surface polymerization technique. And the as-prepared Ppy@Ag/g-C3N4 sample exhibited the higher photocatalytic activity for various pollutant (MO, DM, TC, CIP, GFLX and EH) remove than that of pure g-C3N4 and Ag/g-C3N4 under visible light irradiation. It mainly originated from the Ag nanoparticles anchored between g-C3N4 and Ppy acted as electron transfer mediator that facilitated the charge carrier separation and then expending the lifetime of the carriers. Meanwhile, the obtained Ppy@Ag/g-C3N4 sample also showed a relatively good recycling stability which was the crucial factor for photocatalyst practical application. This work provided a new facile strategy for improving photo-degradation activity of g-C3N4 photocatalyst.

  10. Two related trypanosomatid eIF4G homologues have functional differences compatible with distinct roles during translation initiation

    PubMed Central

    Moura, Danielle MN; Reis, Christian RS; Xavier, Camila C; da Costa Lima, Tamara D; Lima, Rodrigo P; Carrington, Mark; de Melo Neto, Osvaldo P

    2015-01-01

    In higher eukaryotes, eIF4A, eIF4E and eIF4G homologues interact to enable mRNA recruitment to the ribosome. eIF4G acts as a scaffold for these interactions and also interacts with other proteins of the translational machinery. Trypanosomatid protozoa have multiple homologues of eIF4E and eIF4G and the precise function of each remains unclear. Here, 2 previously described eIF4G homologues, EIF4G3 and EIF4G4, were further investigated. In vitro, both homologues bound EIF4AI, but with different interaction properties. Binding to distinct eIF4Es was also confirmed; EIF4G3 bound EIF4E4 while EIF4G4 bound EIF4E3, both these interactions required similar binding motifs. EIF4G3, but not EIF4G4, interacted with PABP1, a poly-A binding protein homolog. Work in vivo with Trypanosoma brucei showed that both EIF4G3 and EIF4G4 are cytoplasmic and essential for viability. Depletion of EIF4G3 caused a rapid reduction in total translation while EIF4G4 depletion led to changes in morphology but no substantial inhibition of translation. Site-directed mutagenesis was used to disrupt interactions of the eIF4Gs with either eIF4E or eIF4A, causing different levels of growth inhibition. Overall the results show that only EIF4G3, with its cap binding partner EIF4E4, plays a major role in translational initiation. PMID:25826663

  11. Magnetic Fe@g-C3N4: A Photoactive Catalyst for the Hydrogenation of Alkenes and Alkynes

    EPA Science Inventory

    A photoactive catalyst, Fe@g-C3N4, has been developed for the hydrogenation of alkenes and alkynes using hydrazine hydrate as a source of hydrogen. The magnetically separable Fe@g-C3N4 eliminates the use of high pressure hydrogenation and the reaction can be accomplished using vi...

  12. Roles of Stat3 and ERK in G-CSF signaling.

    PubMed

    Kamezaki, Kenjirou; Shimoda, Kazuya; Numata, Akihiko; Haro, Takashi; Kakumitsu, Haruko; Yoshie, Masumi; Yamamoto, Masahiro; Takeda, Kiyoshi; Matsuda, Tadashi; Akira, Shizuo; Ogawa, Katsuhiro; Harada, Mine

    2005-02-01

    G-CSF specifically stimulates the proliferation and differentiation of cells that are committed to the neutrophil-granulocyte lineage. Although Stat3 was thought to be essential for the transduction of G-CSF-induced cell proliferation and differentiation signals, mice deficient for Stat3 in hematopoietic cells show neutrocytosis and infiltration of cells into the digestive tract. The number of progenitor cells in the neutrophil lineage is not changed, and G-CSF-induced proliferation of progenitor cells and prolonged neutrophil survival were observed in Stat3-deficient mice. In hematopoietic cells from Stat3-deficient mice, trace levels of SOCS3, a negative regulator of granulopoiesis, were observed, and SOCS3 expression was not induced by G-CSF stimulation. Stat3-null bone marrow cells displayed a significant activation of extra-cellular regulated kinase 1 (ERK1)/ERK2 under basal conditions, and the activation of ERK was enhanced and sustained by G-CSF stimulation. Furthermore, the augmented proliferation of Stat3-deficient bone marrow cells in response to G-CSF was dramatically decreased by addition of a MEK1 inhibitor. These results indicate that Stat3 functions as a negative regulator of G-CSF signaling by inducing SOCS3 expression and that ERK activation is the major factor responsible for inducing the proliferation of hematopoietic cells in response to G-CSF.

  13. Dose rate, mitotic cycle duration, and sensitivity of cell transitions from G1 $Yields$ S and G2 $Yields$ M to protracted gamma radiation in root meristems

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Evans, L.S.; Hof, J.V.

    1975-11-01

    Experiments were designed to determine the relative radiosensitivity of the cell transition points of G1 $Yields$ S and G2 $Yields$ M in root meristems of several plant species. Label and mitotic indices and microspectrophotometry were used to measure the proportions of cells in each mitotic cycle stage in root meristems after protracted gamma radiation. The criterion of radiosensitivity was the dose rate needed to produce a tissue with less than 1 percent cells in S and none in M after 3 days of continuous exposure. The results show that DNA is the primary radiation target in proliferative root meristems andmore » that the cycle duration stipulates the time interval of vulnerability. In each species, nonrandom reproducible cell proportions were established with 2C:4C:8C amounts of nuclear DNA after 3 days of exposure. Roots of Helianthus annuus, Crepis capillaris, and Tradescantia clone 02 had 80 percent cells with a 2C amount of DNA and 20 percent had a 4C amount of DNA. In these species the transition point of G1 $Yields$ S was more radiosensitive than G2 $Yields$ M. Roots of Pisum sativum and Triticum aestivum had cell proportions at 2C:4C:8C amounts of DNA in frequencies of 0.10 to 0.20:0.40 to 0.60:0.30 to 0.40. In these two species 0.30 to 0.40 cells underwent radiation-induced endoreduplication that resulted from a rapid inhibition of cell transit from G2 $Yields$ M and a slower impairment of G1 $Yields$ S. Cells increased from 2C to 4C and from 4C to 8C amounts of DNA during irradiation. The proportions of nuclei with 2C:4C:8C amounts of DNA were dependent in part upon the relative radiosensitivity of the G1 $Yields$ S and G2 $Yields$ M control points. The data show the relative radiosensitivity of the transition points from G1 $Yields$ S and from G2 $Yields$ M was species specific and unrelated to the cycle duration and mean nuclear DNA content of the plant species. (auth)« less

  14. Antigenic Determinants of the Bilobal Cockroach Allergen Bla g 2.

    PubMed

    Woodfolk, Judith A; Glesner, Jill; Wright, Paul W; Kepley, Christopher L; Li, Mi; Himly, Martin; Muehling, Lyndsey M; Gustchina, Alla; Wlodawer, Alexander; Chapman, Martin D; Pomés, Anna

    2016-01-29

    Bla g 2 is a major indoor cockroach allergen associated with the development of asthma. Antigenic determinants on Bla g 2 were analyzed by mutagenesis based on the structure of the allergen alone and in complex with monoclonal antibodies that interfere with IgE antibody binding. The structural analysis revealed mechanisms of allergen-antibody recognition through cation-π interactions. Single and multiple Bla g 2 mutants were expressed in Pichia pastoris and purified. The triple mutant K132A/K251A/F162Y showed an ∼100-fold reduced capacity to bind IgE, while preserving the native molecular fold, as proven by x-ray crystallography. This mutant was still able to induce mast cell release. T-cell responses were assessed by analyzing Th1/Th2 cytokine production and the CD4(+) T-cell phenotype in peripheral blood mononuclear cell cultures. Although T-cell activating capacity was similar for the KKF mutant and Bla g 2 based on CD25 expression, the KKF mutant was a weaker inducer of the Th2 cytokine IL-13. Furthermore, this mutant induced IL-10 from a non-T-cell source at higher levels that those induced by Bla g 2. Our findings demonstrate that a rational design of site-directed mutagenesis was effective in producing a mutant with only 3 amino acid substitutions that maintained the same fold as wild type Bla g 2. These residues, which were involved in IgE antibody binding, endowed Bla g 2 with a T-cell modulatory capacity. The antigenic analysis of Bla g 2 will be useful for the subsequent development of recombinant allergen vaccines. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. The Muon $g$-$2$ Experiment at Fermilab

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gohn, Wesley

    A new measurement of the anomalous magnetic moment of the muon,more » $$a_{\\mu} \\equiv (g-2)/2$$, will be performed at the Fermi National Accelerator Laboratory with data taking beginning in 2017. The most recent measurement, performed at Brookhaven National Laboratory (BNL) and completed in 2001, shows a 3.5 standard deviation discrepancy with the standard model value of $$a_\\mu$$. The new measurement will accumulate 21 times the BNL statistics using upgraded magnet, detector, and storage ring systems, enabling a measurement of $$a_\\mu$$ to 140 ppb, a factor of 4 improvement in the uncertainty the previous measurement. This improvement in precision, combined with recent improvements in our understanding of the QCD contributions to the muon $g$-$2$, could provide a discrepancy from the standard model greater than 7$$\\sigma$$ if the central value is the same as that measured by the BNL experiment, which would be a clear indication of new physics.« less

  16. Riedel's thyroiditis and multifocal fibrosclerosis are part of the IgG4-related systemic disease spectrum.

    PubMed

    Dahlgren, Mollie; Khosroshahi, Arezou; Nielsen, G Petur; Deshpande, Vikram; Stone, John H

    2010-09-01

    Riedel's thyroiditis is a chronic fibrosing disorder of unknown etiology often associated with "multifocal fibrosclerosis." IgG4-related systemic disease is characterized by IgG4+ plasma cell infiltration and fibrosis throughout many organs. We hypothesized that Riedel's thyroiditis is part of the IgG4-related systemic disease spectrum. We searched our institution's pathology database using the terms "Riedel's," "struma," "thyroid," and "fibrosis," and identified 3 cases of Riedel's thyroiditis. Riedel's thyroiditis was diagnosed if there was a fibroinflammatory process involving all or a portion of the thyroid gland, with evidence of extension of the process into surrounding tissues. Immunohistochemical stains for IgG4 and IgG were performed. The histopathologic and immunohistochemical features of each involved organ were evaluated. The clinical features of one patient with multiple organ system disease were described. All 3 thyroidectomy samples stained positively for IgG4-bearing plasma cells. One patient had extensive extrathyroidal involvement diagnostic of IgG4-related systemic disease, including cholangitis, pseudotumors of both the lung and lacrimal gland, and a lymph node contiguous to the thyroid that stained intensely for IgG4+ plasma cells. The histologic features of all organs involved were consistent with IgG4-related systemic disease. Patient 3 had 10 IgG4+ plasma cells per high-power field initially, but rebiopsy 2 years later demonstrated no IgG4+ plasma cells. That patient's second biopsy, characterized by fibrosis and minimal residual inflammation, further solidifies the link between IgG4-bearing plasma cells in tissue and the histologic evolution to Riedel's thyroiditis. Riedel's thyroiditis is part of the IgG4-related systemic disease spectrum. In many cases, multifocal fibrosclerosis and IgG4-related systemic disease are probably the same entity.

  17. Chronic cat allergen exposure induces a TH2 cell-dependent IgG4 response related to low sensitization.

    PubMed

    Renand, Amedee; Archila, Luis D; McGinty, John; Wambre, Erik; Robinson, David; Hales, Belinda J; Thomas, Wayne R; Kwok, William W

    2015-12-01

    In human subjects, allergen tolerance has been observed after high-dose allergen exposure or after completed allergen immunotherapy, which is related to the accumulation of anti-inflammatory IgG4. However, the specific T-cell response that leads to IgG4 induction during chronic allergen exposure remains poorly understood. We sought to evaluate the relationship between cat allergen-specific T-cell frequency, cat allergen-specific IgE and IgG4 titers, and clinical status in adults with cat allergy with and without cat ownership and the cellular mechanism by which IgG4 is produced. Fel d 1-, Fel d 4-, Fel d 7-, and Fel d 8-specific T-cell responses were characterized by CD154 expression after antigen stimulation. In allergic subjects without cat ownership, the frequency of cat allergen (Fel d 1 and Fel d 4)-specific TH2 (sTH2) cells correlates with higher IgE levels and is linked to asthma. Paradoxically, we observed that subjects with cat allergy and chronic cat exposure maintain a high frequency of sTH2 cells, which correlates with higher IgG4 levels and low sensitization. B cells from allergic, but not nonallergic subjects, are able to produce IgG4 after cognate interactions with sTH2 clones and Fel d 1 peptide or the Fel d 1 recombinant protein. These experiments suggest that (1) allergen-experienced B cells with the capacity to produce IgG4 are present in allergic subjects and (2) cat allergen exposure induces an IgG4 response in a TH2 cell-dependent manner. Thus IgG4 accumulation could be mediated by chronic activation of the TH2 response, which in turn drives desensitization. Copyright © 2015 American Academy of Allergy, Asthma & Immunology. All rights reserved.

  18. Decoration of mesoporous Co3O4 nanospheres assembled by monocrystal nanodots on g-C3N4 to construct Z-scheme system for improving photocatalytic performance

    NASA Astrophysics Data System (ADS)

    Wu, Haijun; Li, Chunmei; Che, Huinan; Hu, Hao; Hu, Wei; Liu, Chunbo; Ai, Junzhe; Dong, Hongjun

    2018-05-01

    The Co3O4/g-C3N4 Z-scheme system is constructed by decoration of mesoporous Co3O4 nanospheres assembled by monocrystal nanodots on the surface of g-C3N4, which dramatically improves the photocatalytic activity for degrading tetracycline hydrochloride (TC) compared with single g-C3N4. The microstructure investigations evidence the mesoporous structure and enlarged specific surface area of Co3O4/g-C3N4 Z-scheme system, which implies the increase of surface active sites and adsorption ability for reactant molecules. Moreover, by virtue of analyzing physical and photoelectrochemical properties, it evidences that the decoration effect of mesoporous Co3O4 nanospheres on the surface of g-C3N4 obviously improves the transfer and separation efficiency of charge carriers between two phase interfaces and broadens light harvest range. These important factors are beneficial to enhancing photocatalytic activity of Co3O4/g-C3N4 Z-scheme system. In addition, the photocatalityc reaction mechanism is also revealed in depth.

  19. A facile one-pot preparation of Co3O4/g-C3N4 heterojunctions with excellent electrocatalytic activity for the detection of environmental phenolic hormones

    NASA Astrophysics Data System (ADS)

    Sun, Yanjuan; Jiang, Jizhou; Liu, Yi; Wu, Shengli; Zou, Jing

    2018-02-01

    The Co3O4/g-C3N4 heterojunctions were prepared by a facile one-pot thermal decomposition technique. Compared with g-C3N4, it was found that Co3O4/g-C3N4 heterojunctions possessed a higher Brunner-Emmet-Teller (BET) surface area, which was beneficial to the diffusion of aim molecules on the electrode surfaces. And the optimal Co3O4/g-C3N4 heterojunctions exhibited a narrower band gap and a higher donor density, resulting in an excellent electrocatalytic activity for environmental phenolic hormones. Moreover, the Co3O4/g-C3N4 heterojunctions were used for the electrochemical sensing of environmental phenolic hormones such as bisphenol A, pentachlorophenol, p-nitrophenol and octylphenol. All detection ranges reached three orders of magnitude, showing a lower limit of detection of 10-9 mol L-1. So, sensitivity and accurate determination of environmental phenolic hormones in real water samples may use this Co3O4/g-C3N4 heterojunctions modified electrode.

  20. Coexistence of Acute Crescent Glomerulonephritis and IgG4-Related Kidney Disease.

    PubMed

    Lu, Zeyuan; Yin, Jianyong; Bao, Hongda; Jiao, Qiong; Wu, Huijuan; Wu, Rui; Xue, Qin; Wang, Niansong; Zhang, Zhigang; Wang, Feng

    2016-01-01

    IgG4-related disease (IgG4-RD) is a fibroinflammatory disorder that may involve almost each organ or system. IgG4-related kidney disease (IgG4-RKD) refers to renal lesions associated with IgG4-RD. The most frequent morphological type of renal lesions is IgG4-related tubulointerstitial nephritis (IgG4-TIN) which is associated with increased IgG4-positive plasma cell infiltration and interstitial fibrosis. Herein, we present a rare case with coexisting IgG4-RKD and acute crescent glomerulonephritis with concomitant severe tubulointerstitial lesions instead of classic IgG4-TIN. IgG4-RKD and acute crescent glomerulonephritis can occur in the same patient. This case may give us a clearer viewpoint of the disease.

  1. Age related IgG subclass concentrations in asthma.

    PubMed

    Hoeger, P H; Niggemann, B; Haeuser, G

    1994-03-01

    The prevalence of IgG subclass deficiency in asthma is still controversial. Earlier studies often included patients receiving treatment with systemic steroids which can induce hypogammaglobulinaemia. Concentrations of IgG subclasses were studies in 200 children (aged 2-17 years) with asthma (mean asthma severity score (ASS) 2, range 1-4) who had not received systemic steroids for at least six weeks before investigation, and in 226 healthy age matched controls. The mean concentrations of IgG subclasses in children with asthma were within the 1SD range of those of the control group. In the group with asthma there was a trend towards higher levels of IgG1 and IgG4, whereas the number of children with low concentrations of IgG2 (< 2 SD of control serum samples; absolute concentrations 0.08-1.25 g/l) was slightly greater than in the group who did not have asthma (4.5 v 2.2%). Patients with subnormal concentrations of IgG2 could not be distinguished clinically or on the basis of case history and additional immunological studies did not show further abnormalities. Patients with severe asthma (ASS 3-4) had significantly higher concentrations of IgG4 (mean (SE) 0.53 (0.09) v 0.26 (0.04) g/l) than patients with mild asthma (ASS 1). No significant difference in subclass concentration was found between patients with atopic and those with non-atopic asthma. It is concluded that in an unselected group of children with asthma the mean IgG subclass concentrations do not differ significantly from a group of healthy age matched controls.

  2. Coexistence of ACE (I/D) and PAI-1 (4G/5G) gene variants in recurrent miscarriage in Polish population.

    PubMed

    Kurzawińska, Grażyna; Barlik, Magdalena; Drews, Krzysztof; Różycka, Agata; Seremak-Mrozikiewicz, Agnieszka; Ożarowski, Marcin; Klejewski, Andrzej; Czerny, Bogusław; Wolski, Hubert

    2016-01-01

    Recurrent miscarriage (RM) is one of the most common obstetric complications. Numerous studies have suggested that genetic variants leading to an impaired balance between coagulation and fibrinolysis may contribute to elevated risk of pregnancy loss. The aim of the study was to investigate a possible association between angiotensin-converting enzyme (ACE, rs1799752) I/D and plasminogen activator inhibitor type 1 (PAI-1, rs1799768) 4G/5G polymorphisms with RM among Polish women. DNA was extracted from peripheral blood samples of 152 women with a history of ≥ 2 consecutive pregnancy losses before 22 weeks of gestation, and 180 healthy controls with at least 1 live birth at term and no history of pregnancy loss. Polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) were used to identify the polymorphisms. No statistically significant differences were found in genotype and allele frequencies of the studied polymorphisms. The most relevant difference between the study group and controls was found for the ID genotype distribution of the ACE gene (52.6 vs. 46.7%, OR = 1.27, p = 0.28). The analysis of genotype coexistence revealed a higher incidence of the combination of the ACE II and the PAI-1 4G/4G genotypes in the control group (10.0 vs.5.9% in control group; p = 0.17). The obtained results suggest no apparent association between the ACE I/D, PAI-1 4G/5G polymorphisms and increased RM susceptibility in the analyzed Polish population.

  3. Compact, singular G 2-holonomy manifolds and M/heterotic/F-theory duality

    NASA Astrophysics Data System (ADS)

    Braun, Andreas P.; Schäfer-Nameki, Sakura

    2018-04-01

    We study the duality between M-theory on compact holonomy G 2-manifolds and the heterotic string on Calabi-Yau three-folds. The duality is studied for K3-fibered G 2-manifolds, called twisted connected sums, which lend themselves to an application of fiber-wise M-theory/Heterotic Duality. For a large class of such G 2-manifolds we are able to identify the dual heterotic as well as F-theory realizations. First we establish this chain of dualities for smooth G 2-manifolds. This has a natural generalization to situations with non-abelian gauge groups, which correspond to singular G 2-manifolds, where each of the K3-fibers degenerates. We argue for their existence through the chain of dualities, supported by non-trivial checks of the spectra. The corresponding 4d gauge groups can be both Higgsable and non-Higgsable, and we provide several explicit examples of the general construction.

  4. The role of TPA I/D and PAI-1 4G/5G polymorphisms in multiple sclerosis.

    PubMed

    Zivković, Maja; Starčević Čizmarević, Nada; Lovrečić, Luca; Klupka-Sarić, Inge; Stanković, Aleksandra; Gašparović, Iva; Lavtar, Polona; Dinčić, Evica; Stojković, Ljiljana; Rudolf, Gorazd; Jazbec, Saša Sega; Perković, Olivio; Sinanović, Osman; Sepčić, Juraj; Kapović, Miljenko; Peterlin, Borut; Ristić, Smiljana

    2014-01-01

    Previous studies have shown impaired fibrinolysis in multiple sclerosis (MS) and implicated extracellular proteolytic enzymes as important factors in demyelinating neuroinflammatory disorders. Tissue-type plasminogen activator (t-PA) and its inhibitor (PAI-1) are key molecules in both fibrinolysis and extracellular proteolysis. In the present study, an association of the TPA Alu I/D and PAI-1 4G/5G polymorphisms with MS was analyzed within the Genomic Network for Multiple Sclerosis (GENoMS). The GENoMS includes four populations (Croatian, Slovenian, Serbian, and Bosnian and Herzegovinian) sharing the same geographic location and a similar ethnic background. A total of 885 patients and 656 ethnically matched healthy blood donors with no history of MS in their families were genotyped using PCR-RFLP. TPA DD homozygosity was protective (OR = 0.79, 95% CI 0.63-0.99, P = 0.037) and PAI 5G5G was a risk factor for MS (OR = 1.30, 95% CI 1.01-1.66, P = 0.038). A significant effect of the genotype/carrier combination was detected in 5G5G/I carriers (OR = 1.39 95% CI 1.06-1.82, P = 0.017). We found a significantly harmful effect of the combination of the PAI-1 5G/5G genotype and TPA I allele on MS susceptibility, which indicates the importance of gene-gene interactions in complex diseases such as MS.

  5. The Role of TPA I/D and PAI-1 4G/5G Polymorphisms in Multiple Sclerosis

    PubMed Central

    Živković, Maja; Starčević Čizmarević, Nada; Lovrečić, Luca; Klupka-Sarić, Inge; Stanković, Aleksandra; Gašparović, Iva; Dinčić, Evica; Stojković, Ljiljana; Rudolf, Gorazd; Šega Jazbec, Saša; Perković, Olivio; Sinanović, Osman; Sepčić, Juraj; Kapović, Miljenko; Peterlin, Borut

    2014-01-01

    Background. Previous studies have shown impaired fibrinolysis in multiple sclerosis (MS) and implicated extracellular proteolytic enzymes as important factors in demyelinating neuroinflammatory disorders. Tissue-type plasminogen activator (t-PA) and its inhibitor (PAI-1) are key molecules in both fibrinolysis and extracellular proteolysis. In the present study, an association of the TPA Alu I/D and PAI-1 4G/5G polymorphisms with MS was analyzed within the Genomic Network for Multiple Sclerosis (GENoMS). Methods. The GENoMS includes four populations (Croatian, Slovenian, Serbian, and Bosnian and Herzegovinian) sharing the same geographic location and a similar ethnic background. A total of 885 patients and 656 ethnically matched healthy blood donors with no history of MS in their families were genotyped using PCR-RFLP. Results. TPA DD homozygosity was protective (OR = 0.79, 95% CI 0.63–0.99, P = 0.037) and PAI 5G5G was a risk factor for MS (OR = 1.30, 95% CI 1.01–1.66, P = 0.038). A significant effect of the genotype/carrier combination was detected in 5G5G/I carriers (OR = 1.39 95% CI 1.06–1.82, P = 0.017). Conclusions. We found a significantly harmful effect of the combination of the PAI-1 5G/5G genotype and TPA I allele on MS susceptibility, which indicates the importance of gene-gene interactions in complex diseases such as MS. PMID:24825926

  6. Determination of aflatoxins B1, B2, G1 and G2 in spices using a multifunctional column clean-up.

    PubMed

    Akiyama, H; Goda, Y; Tanaka, T; Toyoda, M

    2001-10-12

    A rapid and simple method using a multifunctional column, which contains lipophilic and charged active sites, was developed to analyse aflatoxins B1, B2, G1 and G2 in various spices, such as red pepper and nutmeg. After extraction by acetonitrile:water (9:1) and clean-up using MultiSep #228 column, the aflatoxins and aflatoxin-TFA derivatives are determined using LC with fluorescence detection. Recoveries of each aflatoxin B1, B2, G1 and G2 spiked to red pepper, white pepper, black pepper, nutmeg and tear grass at the level of 10 ng/g were over 80-85% in all instances. The minimum detectable concentration for aflatoxins in red pepper was 0.5 ng/g.

  7. Influence of the Cyclooxygenase-2 Gene -765G/C and -1195G/A Polymorphisms on Development of Ischemic Stroke.

    PubMed

    Wu, Guangliang; Cai, Haiyan; Cai, Haobin; Chen, Zhao; Tan, Lei; Qin, Xiurong; Cai, Yefeng

    2016-09-01

    Many studies have investigated the association between the cyclooxygenase-2 (COX-2) gene polymorphism and ischemic stroke. However, results of these studies still remain controversial. To better explain the association between COX-2 polymorphisms (-765G/C and -1195G/A) and ischemic stroke risk, a meta-analysis was performed. Relevant studies were identified from 4 Chinese databases (Chinese Biological Medical Literature database, Chinese National Knowledge Infrastructure database, Chongqing VIP database, and Chinese WANFANG database), PUBMED and EMBASE prior to December 2015. The strength of association between COX-2 polymorphism and ischemic stroke was evaluated by the odds ratio (OR) with 95% confidence interval (CI). Inconsistency index (I(2)) and the Cochran's Q statistic were used to check heterogeneity. Publication bias was evaluated by funnel plots and Egger's regression test. A total of 4086 ischemic stroke cases and 4747 controls were identified. Significant association between COX-2 -765G/C polymorphism and the risk of ischemic stroke was found in Brazilians and the African-Americans. The OR of (CC+GC versus GG) for the Brazilians and African-Americans were (6.328, 95% CI = 2.295-17.448) and (1.644, 95% CI = 1.060-2.551). In addition, the recessive model of the Brazilians gave an OR of 3.621 (95% CI: 1.519-8.630). Furthermore, the (GC versus GG) and the allele model of the African-Americans were (OR: 1.615, 95% CI = 1.015-2.572) and (OR: 1.422, 95% CI = 1.033-1.957). Significant association was also observed for COX-2 -1195G/A polymorphism in the subtypes of small vessel disease (SVD) of ischemic stroke. Our study suggests that COX-2 -765G/C and -1195G/A polymorphisms may contribute to susceptibility of ischemic stroke, specifically in Brazilians and the African-Americans, and those of SVD. Copyright © 2016 National Stroke Association. Published by Elsevier Inc. All rights reserved.

  8. G-warm inflation

    NASA Astrophysics Data System (ADS)

    Herrera, Ramón

    2017-05-01

    A warm inflationary universe in the context of Galileon model or G-model is studied. Under a general formalism we study the inflationary dynamics and the cosmological perturbations considering a coupling of the form G(phi,X)=g(phi) X. As a concrete example, we consider an exponential potential together with the cases in which the dissipation and Galilean coefficients are constants. Also, we study the weak regime given by the condition R<1+3gHdot phi, and the strong regime in which 13gHdot phi. Additionally, we obtain constraints on the parameters during the evolution of G-warm inflation, assuming the condition for warm inflation in which the temperature T>H, the conditions or the weak and strong regimes, together with the consistency relation r=r(ns) from Planck data.

  9. In vitro synthesis and processing of herpes simplex virus type 2 gG-2, using cell-free transcription and translation systems.

    PubMed Central

    Weldon, S K; Su, H K; Fetherston, J D; Courtney, R J

    1990-01-01

    Translation of in vitro-synthesized herpes simplex virus type 2 (HSV-2) gG-2 mRNA in a reticulocyte lysate system was used to study the processing of HSV-2 gG-2. In the presence of canine pancreatic microsomal membranes, a single species that is protected from trypsin digestion was detected. This product comigrates with the 104,000-Mr (104K) high mannose intermediate seen in HSV-2-infected-cell lysates. Endo-beta-N-acetylglucosaminidase H treatment of the in vitro-synthesized 104K protein yielded a single product migrating at 100 K. The 72K and 31K cleavage products of gG-2 were not observed in the in vitro system. These data show that the molecular weight of the nonglycosylated form of the gG-2 protein is 100,000 and that the cotranslational processing of this protein in the endoplasmic reticulum yields the 104K high-mannose intermediate. Images PMID:2154614

  10. Novel ternary g-C3N4/Ag3VO4/AgBr nanocomposites with excellent visible-light-driven photocatalytic performance for environmental applications

    NASA Astrophysics Data System (ADS)

    Barzegar, Javid; Habibi-Yangjeh, Aziz; Akhundi, Anise; Vadivel, S.

    2018-04-01

    Novel visible-light-induced photocatalysts were fabricated by integration of Ag3VO4 and AgBr semiconductors with graphitic carbon nitride (g-C3N4) through a facile refluxing method. The fabricated photocatalysts were extensively characterized by XRD, EDX, SEM, TEM, FT-IR, UV-vis DRS, BET, TGA, and PL instruments. The photocatalytic performance of these samples was studied by degradations of three dye contaminants under visible-light exposure. Among the ternary photocatalysts, the g-C3N4/Ag3VO4/AgBr (10%) nanocomposite displayed the maximum activity for RhB degradation with rate constant of 1366.6 × 10-4 min-1, which is 116, 7.23, and 38.5 times as high as those of the g-C3N4, g-C3N4/AgBr (10%), and g-C3N4/Ag3VO4 (30%) photocatalysts, respectively. The effects of synthesis time and calcination temperature were also investigated and discussed. Furthermore, according to the trapping experiments, it was found that superoxide anion radicals were the predominant reactive species in this system. Finally, the ternary photocatalyst displayed superlative activity in removal of the contaminants under visible-light exposure, displaying great potential of this ternary photocatalyst for environmental remediation, because of a facile synthesis route and outstanding photocatalytic performance.

  11. Potential of transition metal atoms embedded in buckled monolayer g-C3N4 as single-atom catalysts.

    PubMed

    Li, Shu-Long; Yin, Hui; Kan, Xiang; Gan, Li-Yong; Schwingenschlögl, Udo; Zhao, Yong

    2017-11-15

    We use first-principles calculations to systematically explore the potential of transition metal atoms (Sc, Ti, V, Cr, Mn, Fe, Co, Ni, Cu, Ru, Rh, Pd, Ag, Ir, Pt, and Au) embedded in buckled monolayer g-C 3 N 4 as single-atom catalysts. We show that clustering of Sc and Ti on g-C 3 N 4 is thermodynamically impeded and that V, Cr, Mn, and Cu are much less susceptible to clustering than the other TM atoms under investigation. Strong bonding of the transition metal atoms in the cavities of g-C 3 N 4 and high diffusion barriers together are responsible for single-atom fixation. Analysis of the CO oxidation process indicates that embedding of Cr and Mn in g-C 3 N 4 gives rise to promising single-atom catalysts at low temperature.

  12. 76 FR 6629 - Agency Information Collection Activities: Forms G-325, G-325A, G-325B, and G-325C; Extension of...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-02-07

    ... Collection Activities: Forms G-325, G-325A, G- 325B, and G-325C; Extension of an Existing Information Collection; Comment Request ACTION: 60-Day Notice of Information Collection Under Review; Forms 325, G-325A, G-325B, and G-325C, Biographic Information; OMB Control No. 1615-0008. The Department of Homeland...

  13. In situ synthesis of g-C3N4/TiO2 heterojunction nanocomposites as a highly active photocatalyst for the degradation of Orange II under visible light irradiation.

    PubMed

    Ren, Bin; Wang, Tiecheng; Qu, Guangzhou; Deng, Fang; Liang, Dongli; Yang, Wenli; Liu, Meishan

    2018-05-04

    As a highly active photocatalyst, g-C 3 N 4 /TiO 2 heterojunction nanocomposites were in situ synthesized by simple ultrasonic mixing and calcination by using TiO 2 and melamine as precursors. The morphology and structure of the prepared photocatalysts were characterized by field emission scanning electron microscopy, transmission electron microscopy, X-ray diffraction, Fourier-transform infrared spectroscopy, UV-Vis diffuse reflectance spectroscopy, and X-ray photoelectron spectroscopy. The photocatalytic activities of g-C 3 N 4 /TiO 2 nanocomposites to degrade Orange II (AO7) under visible light irradiation were evaluated. Results showed that the photocatalytic rate of the prepared g-C 3 N 4 /TiO 2 photocatalyst to degrade AO7 was about three times than that of pristine TiO 2 and g-C 3 N 4 . The g-C 3 N 4 /TiO 2 composite with a ratio of 1:4 had the highest degradation efficiency for AO7 solution. Its degradation efficiency under acidic conditions was significantly higher than that under alkaline conditions. The enhancement of photocatalytic activity can be attributed to the formation of heterojunctions between g-C 3 N 4 and TiO 2 , which leads to rapid charge transfer and the efficient separation of photogenerated electron-hole pairs. The recycling experiment indicated that the photocatalyst of g-C 3 N 4 /TiO 2 nanocomposites still maintained good photochemical stability and recyclability after five cycles; this finding was important for its practical applications. A series of free radical trapping experiments showed that •O 2 - played a crucial role in the degradation of AO7. Graphical Abstract ᅟ.

  14. [Postspinal headache. A comparison of the 24G Sprotte syringe and a 29G Quincke needle].

    PubMed

    Lim, M; Cross, G D; Sold, M

    1992-09-01

    A randomised study was performed to compare the frequency of postdural puncture headache in 56 patients who underwent spinal anaesthesia for extra-corporeal shockwave lithotripsy using either a Sprotte 24 G (n = 28) or Vygon 29 G or Quincke type needle (n = 28). Frequency of headache was recorded in a similar group of 28 patients who received general anaesthesia. Dural puncture was easier with the Sprotte 24 G cannula than with the less stable Quincke needle, as documented by a significantly shortened time for insertion of the cannula (4.6 +/- 2.6 vs 8.6 +/- 6.3 min, P less than 0.005). The total frequency of post-operative headache was 57% in the Vygon 29 G group and 25% in the Sprotte 24 G group; 21% of patients in the general anaesthesia group complained of headache. Frequency of postdural puncture headache, classified as being posture-related, was 25% in the 29 G Vygon group, compared with 11% in the 24 G Sprotte group (P = 0.148). When only moderate and severe postdural puncture headache was considered, there was a significant difference (25% vs. 4%; P = 0.026) in favour of the Sprotte cannula. Thus, the 24 G Sprotte needle was at least as effective as the 29 G Vygon needle, and there is a suggestion that the former is more effective in minimising the incidence of moderate or severe postdural puncture headache.

  15. A Benzothiazole Derivative (5g) Induces DNA Damage And Potent G2/M Arrest In Cancer Cells.

    PubMed

    Hegde, Mahesh; Vartak, Supriya V; Kavitha, Chandagirikoppal V; Ananda, Hanumappa; Prasanna, Doddakunche S; Gopalakrishnan, Vidya; Choudhary, Bibha; Rangappa, Kanchugarakoppal S; Raghavan, Sathees C

    2017-05-31

    Chemically synthesized small molecules play important role in anticancer therapy. Several chemical compounds have been reported to damage the DNA, either directly or indirectly slowing down the cancer cell progression by causing a cell cycle arrest. Direct or indirect reactive oxygen species formation causes DNA damage leading to cell cycle arrest and subsequent cell death. Therefore, identification of chemically synthesized compounds with anticancer potential is important. Here we investigate the effect of benzothiazole derivative (5g) for its ability to inhibit cell proliferation in different cancer models. Interestingly, 5g interfered with cell proliferation in both, cell lines and tumor cells leading to significant G2/M arrest. 5g treatment resulted in elevated levels of ROS and subsequently, DNA double-strand breaks (DSBs) explaining observed G2/M arrest. Consistently, we observed deregulation of many cell cycle associated proteins such as CDK1, BCL2 and their phosphorylated form, CyclinB1, CDC25c etc. Besides, 5g treatment led to decreased levels of mitochondrial membrane potential and activation of apoptosis. Interestingly, 5g administration inhibited tumor growth in mice without significant side effects. Thus, our study identifies 5g as a potent biochemical inhibitor to induce G2/M phase arrest of the cell cycle, and demonstrates its anticancer properties both ex vivo and in vivo.

  16. Soluble Human Cytomegalovirus gH/gL/pUL128-131 Pentameric Complex, but Not gH/gL, Inhibits Viral Entry to Epithelial Cells and Presents Dominant Native Neutralizing Epitopes.

    PubMed

    Loughney, John W; Rustandi, Richard R; Wang, Dai; Troutman, Matthew C; Dick, Lawrence W; Li, Guanghua; Liu, Zhong; Li, Fengsheng; Freed, Daniel C; Price, Colleen E; Hoang, Van M; Culp, Timothy D; DePhillips, Pete A; Fu, Tong-Ming; Ha, Sha

    2015-06-26

    Congenital infection of human cytomegalovirus (HCMV) is one of the leading causes of nongenetic birth defects, and development of a prophylactic vaccine against HCMV is of high priority for public health. The gH/gL/pUL128-131 pentameric complex mediates HCMV entry into endothelial and epithelial cells, and it is a major target for neutralizing antibody responses. To better understand the mechanism by which antibodies interact with the epitopes of the gH/gL/pUL128-131 pentameric complex resulting in viral neutralization, we expressed and purified soluble gH/gL/pUL128-131 pentameric complex and gH/gL from Chinese hamster ovary cells to >95% purity. The soluble gH/gL, which exists predominantly as (gH/gL)2 homodimer with a molecular mass of 220 kDa in solution, has a stoichiometry of 1:1 and a pI of 6.0-6.5. The pentameric complex has a molecular mass of 160 kDa, a stoichiometry of 1:1:1:1:1, and a pI of 7.4-8.1. The soluble pentameric complex, but not gH/gL, adsorbs 76% of neutralizing activities in HCMV human hyperimmune globulin, consistent with earlier reports that the most potent neutralizing epitopes for blocking epithelial infection are unique to the pentameric complex. Functionally, the soluble pentameric complex, but not gH/gL, blocks viral entry to epithelial cells in culture. Our results highlight the importance of the gH/gL/pUL128-131 pentameric complex in HCMV vaccine design and emphasize the necessity to monitor the integrity of the pentameric complex during the vaccine manufacturing process. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. PcG and trxG in plants - friends or foes.

    PubMed

    Pu, Li; Sung, Zinmay Renee

    2015-05-01

    The highly-conserved Polycomb group (PcG) and trithorax group (trxG) proteins play major roles in regulating gene expression and maintaining developmental states in many organisms. However, neither the recruitment of Polycomb repressive complexes (PRC) nor the mechanisms of PcG and trxG-mediated gene silencing and activation are well understood. Recent progress in Arabidopsis research challenges the dominant model of PRC2-dependent recruitment of PRC1 to target genes. Moreover, evidence indicates that diverse forms of PRC1, with shared components, are a common theme in plants and mammals. Although trxG is known to antagonize PcG, emerging data reveal that trxG can also repress gene expression, acting cooperatively with PcG. We discuss these recent findings and highlight the employment of diverse epigenetic mechanisms during development in plants and animals. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Photocatalytic reduction of CO2 to CO over copper decorated g-C3N4 nanosheets with enhanced yield and selectivity

    NASA Astrophysics Data System (ADS)

    Shi, Guodong; Yang, Lin; Liu, Zhuowen; Chen, Xiao; Zhou, Jianqing; Yu, Ying

    2018-01-01

    Photocatalytic reduction of CO2 to fuel has attracted considerable attention due to the consumption of fossil fuels and serious environmental problems. Although there are many photocatalysts reported for CO2 reduction, the improvement of activity and selectivity is still in great need of. In this work, a series of Cu nanoparticle decorated g-C3N4 nanosheets with different Cu loadings were fabricated by a facile secondary calcination and subsequent microwave hydrothermal method. The designed catalysts shown good photocatalytic activity and selectivity for CO2 reduction to CO. The optimal sample exhibited a 3-fold augmentation of the CO yield in comparison with pristine g-C3N4 under visible light. It is revealed that with the loading of Cu nanoparticles, the resulting photocatalyst possessed an improved charge carrier transfer and separation efficiency as well as increased surface reactive sites, resulting in a significant enhancement of CO yield. It is anticipated that the designed Cu/C3N4 photocatalyst may provide new insights for two dimensional layer materials and non-noble particles applied to CO2 reduction.

  19. Plasminogen activator inhibitor-1 -675 4G/5G polymorphism and polycystic ovary syndrome risk: a meta analysis.

    PubMed

    Liu, Ying; Sun, Mei-Guo; Jiang, Rong; Ding, Rui; Che, Zhen; Chen, Yan-Yan; Yao, Ci-Jiang; Zhu, Xiao-Xia; Cao, Ji-Yu

    2014-03-01

    Several studies have reported that excessive amounts of plasminogen activator inhibitor-1(PAI-1) might increase the incidence of polycystic ovary syndrome(PCOS), but so far the published results were inconsistent. The aim of this study was to further investigate the association between PAI-1 gene polymorphism and the susceptibility to PCOS by performing a meta-analysis. A comprehensive literature search for relevant studies was conducted on google scholar, PubMed, the Chinese National Knowledge Infrastructure (CNKI) and the Chinese Biomedical Literature Database (CBM). This meta-analysis was performed using the STATA 11.0 software and the pooled odds ratio (OR) with 95% confidence interval (CI) was calculated. Ten case-control studies were included in this meta-analysis with a total of 2,079 cases and 1,556 controls. The results showed that PAI-1 -675 4G/5G polymorphism may increase the risk of PCOS, especially among Asian populations. However, there was no statistically significant association between the polymorphism and PCOS risk in Caucasians. Our meta-analysis suggests that PAI-1 -675 4G/5G polymorphism may contribute to increasing susceptibility to PCOS in Asians. Detection of the PAI-1 gene polymorphism might be a promising biomarker for the susceptibility of PCOS.

  20. One pot synthesis of new heterocyclic systems: Polysubstituted pyrano[3,2-c]chromene and benzo[g]chromene derivatives

    NASA Astrophysics Data System (ADS)

    Nasri, Shima; Bayat, Mohammad

    2018-07-01

    A novel library of pyrano[3,2-c]chromene-3-carbonitrile and benzo[g]chromene-3-carbonitrile containing an aroyl or acetyl group moiety at 4-position has been extended by successive three-component reaction of 4-hydroxycoumarin or 2-hydroxy-1,4-naphthoquinone with phenylglyoxal monohydrate and a CH-acid like malononitrile/ethyl cyanoacetate/methyl cyanoacetate/cyanoacetamide under mild condition in ethanol. This approach for the preparation of novel polysubstituted pyrano[3,2-c]chromene and benzo[g]chromene is distinguished with high atom-economy, good to high efficiencies, mild and metal-free conditions, simple workup and easy purification.