Sample records for g2019s lrrk2 mutation

  1. Lower cognitive performance in healthy G2019S LRRK2 mutation carriers

    PubMed Central

    Thaler, Avner; Mirelman, Anat; Gurevich, Tanya; Simon, Ely; Orr-Urtreger, Avi; Marder, Karen; Bressman, Susan

    2012-01-01

    Objective: To assess cognitive abilities of healthy first-degree relatives of Ashkenazi patients with Parkinson disease (PD), carriers of the G2019S mutation in the LRRK2 gene. Methods: In this observational study, 60 consecutive healthy first-degree relatives (aged 50.9 ± 6.2 years; 48% male; 30 G2019S carriers) were assessed using a computerized cognitive program, the Montreal Cognitive Assessment questionnaire, the Unified Parkinson's Disease Rating Scale Part III, and the Geriatric Depression Scale. Results: G2019S carriers scored significantly lower on the computerized executive function index (p = 0.04) and on specific executive function tasks (Stroop test, p = 0.007). Conclusion: Carrying the LRRK2 G2019S mutation was associated with lower executive performance in a population at risk for PD. PMID:22914834

  2. Parkinson Disease Phenotype in Ashkenazi Jews with and without LRRK2 G2019S mutations

    PubMed Central

    Alcalay, Roy N.; Mirelman, Anat; Saunders-Pullman, Rachel; Tang, Ming-X; Santana, Helen Mejia; Raymond, Deborah; Roos, Ernest; Orbe-Reilly, Martha; Gurevich, Tanya; Shira, Anat Bar; Weisz, Mali Gana; Yasinovsky, Kira; Zalis, Maayan; Thaler, Avner; Deik, Andres; Barrett, Matthew James; Cabassa, Jose; Groves, Mark; Hunt, Ann L.; Lubarr, Naomi; Luciano, Marta San; Miravite, Joan; Palmese, Christina; Sachdev, Rivka; Sarva, Harini; Severt, Lawrence; Shanker, Vicki; Swan, Matthew Carrington; Soto-Valencia, Jeannie; Johannes, Brooke; Ortega, Robert; Fahn, Stanley; Cote, Lucien; Waters, Cheryl; Mazzoni, Pietro; Ford, Blair; Louis, Elan; Levy, Oren; Rosado, Llency; Ruiz, Diana; Dorovski, Tsvyatko; Pauciulo, Michael; Nichols, William; Orr-Urtreger, Avi; Ozelius, Laurie; Clark, Lorraine; Giladi, Nir; Bressman, Susan; Marder, Karen S

    2013-01-01

    Background The phenotype of Parkinson disease (PD) patients with and without LRRK2 G2019S mutations is reported to be similar; however large uniformly evaluated series are lacking. Objective To characterize the clinical phenotype of Ashkenazi Jewish (AJ) PD carriers of the LRRK2 G2019S mutation. Methods We studied 553 AJ PD patients, including 65 patients who were previously reported, from three sites (two in New York and one in Tel-Aviv). GBA mutation carriers were excluded. Evaluations included the Montreal Cognitive Assessment (MoCA), the Unified Parkinson's Disease Rating Scale (UPDRS), the geriatric depression scale (GDS) and the non-motor symptoms (NMS) questionnaire. Regression models were constructed to test the association between clinical and demographic features and LRRK2 status (outcome) in 488 newly recruited participants. Results LRRK2 G2019S carriers (n=97) and non-carriers (n=391) were similar in age and age-at-onset of PD. Carriers had longer disease duration (8.6years versus 6.1years, p<0.001), were more likely to be women (51.5% versus 37.9%, p=0.015) and more often reported first symptoms in lower extremities (40.0% versus 19.2%, p<0.001). In logistic models adjusted for age, disease duration, gender, education, and site, carriers were more likely to have lower extremity onset (p<0.001), postural instability gait difficulty (PIGD, p=0.043) and persistent levodopa response for>5 years (p=0.042). Performance on UPDRS, MoCA, GDS and NMS did not differ by mutation status. Conclusion PD in AJ-LRRK2 G2019S mutation carriers is similar to idiopathic PD, but characterized by more frequent lower extremity involvement at onset and PIGD without the associated cognitive impairment. PMID:24243757

  3. Synaptic function is modulated by LRRK2 and glutamate release is increased in cortical neurons of G2019S LRRK2 knock-in mice.

    PubMed

    Beccano-Kelly, Dayne A; Kuhlmann, Naila; Tatarnikov, Igor; Volta, Mattia; Munsie, Lise N; Chou, Patrick; Cao, Li-Ping; Han, Heather; Tapia, Lucia; Farrer, Matthew J; Milnerwood, Austen J

    2014-01-01

    Mutations in Leucine-Rich Repeat Kinase-2 (LRRK2) result in familial Parkinson's disease and the G2019S mutation alone accounts for up to 30% in some ethnicities. Despite this, the function of LRRK2 is largely undetermined although evidence suggests roles in phosphorylation, protein interactions, autophagy and endocytosis. Emerging reports link loss of LRRK2 to altered synaptic transmission, but the effects of the G2019S mutation upon synaptic release in mammalian neurons are unknown. To assess wild type and mutant LRRK2 in established neuronal networks, we conducted immunocytochemical, electrophysiological and biochemical characterization of >3 week old cortical cultures of LRRK2 knock-out, wild-type overexpressing and G2019S knock-in mice. Synaptic release and synapse numbers were grossly normal in LRRK2 knock-out cells, but discretely reduced glutamatergic activity and reduced synaptic protein levels were observed. Conversely, synapse density was modestly but significantly increased in wild-type LRRK2 overexpressing cultures although event frequency was not. In knock-in cultures, glutamate release was markedly elevated, in the absence of any change to synapse density, indicating that physiological levels of G2019S LRRK2 elevate probability of release. Several pre-synaptic regulatory proteins shown by others to interact with LRRK2 were expressed at normal levels in knock-in cultures; however, synapsin 1 phosphorylation was significantly reduced. Thus, perturbations to the pre-synaptic release machinery and elevated synaptic transmission are early neuronal effects of LRRK2 G2019S. Furthermore, the comparison of knock-in and overexpressing cultures suggests that one copy of the G2019S mutation has a more pronounced effect than an ~3-fold increase in LRRK2 protein. Mutant-induced increases in transmission may convey additional stressors to neuronal physiology that may eventually contribute to the pathogenesis of Parkinson's disease.

  4. Enhanced striatal dopamine transmission and motor performance with LRRK2 overexpression in mice is eliminated by familial Parkinson's disease mutation G2019S.

    PubMed

    Li, Xianting; Patel, Jyoti C; Wang, Jing; Avshalumov, Marat V; Nicholson, Charles; Buxbaum, Joseph D; Elder, Gregory A; Rice, Margaret E; Yue, Zhenyu

    2010-02-03

    PARK8/LRRK2 (leucine-rich repeat kinase 2) was recently identified as a causative gene for autosomal dominant Parkinson's disease (PD), with LRRK2 mutation G2019S linked to the most frequent familial form of PD. Emerging in vitro evidence indicates that aberrant enzymatic activity of LRRK2 protein carrying this mutation can cause neurotoxicity. However, the physiological and pathophysiological functions of LRRK2 in vivo remain elusive. Here we characterize two bacterial artificial chromosome (BAC) transgenic mouse strains overexpressing LRRK2 wild-type (Wt) or mutant G2019S. Transgenic LRRK2-Wt mice had elevated striatal dopamine (DA) release with unaltered DA uptake or tissue content. Consistent with this result, LRRK2-Wt mice were hyperactive and showed enhanced performance in motor function tests. These results suggest a role for LRRK2 in striatal DA transmission and the consequent motor function. In contrast, LRRK2-G2019S mice showed an age-dependent decrease in striatal DA content, as well as decreased striatal DA release and uptake. Despite increased brain kinase activity, LRRK2-G2019S overexpression was not associated with loss of DAergic neurons in substantia nigra or degeneration of nigrostriatal terminals at 12 months. Our results thus reveal a pivotal role for LRRK2 in regulating striatal DA transmission and consequent control of motor function. The PD-associated mutation G2019S may exert pathogenic effects by impairing these functions of LRRK2. Our LRRK2 BAC transgenic mice, therefore, could provide a useful model for understanding early PD pathological events.

  5. Parkinson disease-associated LRRK2 G2019S transgene disrupts marrow myelopoiesis and peripheral Th17 response.

    PubMed

    Park, Jeongho; Lee, Jang-Won; Cooper, Scott C; Broxmeyer, Hal E; Cannon, Jason R; Kim, Chang H

    2017-10-01

    Parkinson's disease (PD) is a neurodegenerative disease, whereas Crohn's disease is an inflammatory bowel disease. Interestingly, polymorphisms in the LRRK2 gene have been identified as risk factors for both diseases. LRRK2 G2019S is the most prevalent mutation found in PD. To gain insights into the role of the LRRK2 G2019S gene on the development and activation of the immune system in the brain-gut axis, we investigated the effect of LRRK2 G2019S on bone marrow myeloid progenitors and myeloid cell function in the periphery. We used bacterial artificial chromosome transgenic rats harboring the human LRRK2 G2019S gene. LRRK2 G2019S transgene decreased the numbers of monocytic and granulocytic progenitors in the bone marrow. However, the numbers of peripheral, immature myeloid cells with suppressive activity were increased in the gut and blood circulation of LRRK2 G2019S compared with control rats in various acute and chronic inflammatory responses. In inflammatory conditions, Th17 cell activity was suppressed, but tissue-associated phylum Bacteroidetes was abnormally increased in the intestine of LRRK2 G2019S rats. The abnormally expanded myeloid cells because of the LRRK2 G2019S gene were highly suppressive on Th17 cell differentiation. Moreover, we found that inhibition of LRRK2 kinase affects myeloid progenitors and myeloid cell differentiation. Taken together, the results indicate that abnormal LRRK2 activity can alter bone marrow myelopoiesis, peripheral myeloid cell differentiation, and intestinal immune homeostasis. These findings may have ramifications in immune and inflammatory responses in patients with LRRK2 abnormalities. © Society for Leukocyte Biology.

  6. The LRRK2 G2019S mutation in a series of Argentinean patients with Parkinson's disease: clinical and demographic characteristics.

    PubMed

    Gatto, Emilia Mabel; Parisi, Virginia; Converso, Daniela Paola; Poderoso, Juan José; Carreras, María Cecilia; Martí-Massó, José Felix; Paisán-Ruiz, Coro

    2013-03-14

    To determine clinical characteristics and frequency of leucine-rich repeat kinase 2 gene (LRRK2) mutations in a cohort of patients with Parkinson's disease (PD) from Argentina. Variation in the LRRK2 gene represents the most common genetic determinant of PD, only few data are available from Latin-America. Informed consent was obtained and all studies were approved by the Institutional Review Boards. Fifty five consecutive PD patients were recruited. A structured interview and neurological examination were used to collect demographic and clinical information. Blood samples were obtained and DNA extracted from patient venous blood. All LRRK2 exons from 25 exon to 51 exon were screened in all patients. Clinical and molecular data of 55 patients with PD were analyzed. Mean age was 68.8±10.6 years. Jewish and Basque ancestries were found positive in 9 and 7 patients, respectively; family history of PD was identified in 16 patients. The G2019S mutation was present in 3 Ashkenazi Jewish subjects (5.45%); all of them reported family history of PD in first-degree relatives. Although Argentina possesses one of the most important Basque communities outside Spain, non R1414G mutation was identified in this cohort. Eleven single polymorphisms (SNP) were identified in this cohort. The mean age at onset was higher in G2019S mutation carriers than non-carriers (66.67 vs 58.78 years). Asymmetrical tremor as initial symptom and non-motor symptoms occurred at similar frequencies in both groups. The G2019S mutation carriers showed a non significant increase in dyskinesias, and 2/3 developed Dopamine Dysregulation Syndrome and visual hallucinations. Systemic disorder identified in G2019S mutation carriers included: celiac disease, hypothyroidism, Hashimoto's Thyroiditis and arterial hypertension. The prevalence of LRRK2 G2019S mutation in this Argentinean cohort was similar to other international series, with a higher prevalence in Ashkenazi Jewish. The phenotype was indistinguishable

  7. Genetic and pharmacological evidence that G2019S LRRK2 confers a hyperkinetic phenotype, resistant to motor decline associated with aging

    PubMed Central

    Longo, Francesco; Russo, Isabella; Shimshek, Derya R.; Greggio, Elisa; Morari, Michele

    2014-01-01

    The leucine-rich repeat kinase 2 mutation G2019S in the kinase-domain is the most common genetic cause of Parkinson's disease. To investigate the impact of the G2019S mutation on motor activity in vivo, a longitudinal phenotyping approach was developed in knock-in (KI) mice bearing this kinase-enhancing mutation. Two cohorts of G2019S KI mice and wild-type littermates (WT) were subjected to behavioral tests, specific for akinesia, bradykinesia and overall gait ability, at different ages (3, 6, 10, 15 and 19 months). The motor performance of G2019S KI mice remained stable up to the age of 19 months and did not show the typical age-related decline in immobility time and stepping activity of WT. Several lines of evidence suggest that enhanced LRRK2 kinase activity is the main contributor to the observed hyperkinetic phenotype of G2019S KI mice: i) KI mice carrying a LRRK2 kinase-dead mutation (D1994S KD) showed a similar progressive motor decline as WT; ii) two LRRK2 kinase inhibitors, H-1152 and Nov-LRRK2-11, acutely reversed the hyperkinetic phenotype of G2019S KI mice, while being ineffective in WT or D1994S KD animals. LRRK2 target engagement in vivo was further substantiated by reduction of LRRK2 phosphorylation at Ser935 in the striatum and cortex at efficacious doses of Nov-LRRK2-11, and in the striatum at efficacious doses of H-1152. In summary, expression of the G2019S mutation in the mouse LRRK2 gene confers a hyperkinetic phenotype that is resistant to age-related motor decline, likely via enhancement of LRRK2 kinase activity. This study provides an in vivo model to investigate the effects of LRRK2 inhibitors on motor function. PMID:25107341

  8. Neuropsychological performance in LRRK2 G2019S carriers with Parkinson’s disease

    PubMed Central

    Alcalay, Roy N.; Mejia-Santana, Helen; Mirelman, Anat; Saunders-Pullman, Rachel; Raymond, Deborah; Palmese, Christina; Caccappolo, Elise; Ozelius, Laurie; Orr-Urtreger, Avi; Clark, Lorraine; Giladi, Nir; Bressman, Susan; Marder, Karen

    2014-01-01

    Background Ashkenazi Jewish (AJ) LRRK2 carriers are more likely to manifest the postural instability gait difficulty (PIGD) motor phenotype than non-carriers but perform similarly to non-carriers on cognitive screening tests. Objective To compare the cognitive profiles of AJ with Parkinson’s disease (PD) with and without LRRK2 G2019S mutations using a comprehensive neuropsychological battery. Methods We administered a neuropsychological battery to PD participants in the Michael J. Fox Foundation AJ consortium. Participants (n=236) from Beth Israel Medical Center, NY, Columbia University Medical Center, NY and Tel Aviv Medical Center, Israel included 116 LRRK2 G2019S carriers and 120 non-carriers. Glucocerbrosidase mutation carriers were excluded. We compared performance on each neuropsychological test between carriers and non-carriers. Participants in New York (n=112) were evaluated with the entire battery. Tel Aviv participants (n=124) were evaluated on attention, executive function and psychomotor speed tasks. The association between G2019S mutation status (predictor) and each neuropsychological test (outcome) was assessed using linear regression models adjusted for PIGD motor phenotype, site, sex, age, disease duration, education, Unified Parkinson’s Disease Rating Scale (UPDRS) Part III, levodopa equivalent dose, and Geriatric Depression Score (GDS). Results Carriers had longer disease duration (p<0.001) and were more likely to manifest the PIGD phenotype (p=0.024). In adjusted regression models, carriers performed better than non-carriers in Stroop Word Reading (p<0.001), Stroop Interference (p=0.011) and Category Fluency (p=0.026). Conclusion In AJ-PD, G2019S mutation status is associated with better attention (Stroop Word Reading), executive function (Stroop Interference) and language (Category Fluency) after adjustment for PIGD motor phenotype. PMID:25434972

  9. Type II Kinase Inhibitors Show an Unexpected Inhibition Mode against Parkinson’s Disease-Linked LRRK2 Mutant G2019S

    PubMed Central

    Liu, Min; Bender, Samantha A.; Cuny, Gregory D; Sherman, Woody; Glicksman, Marcie; Ray, Soumya S.

    2014-01-01

    A number of well-known type II inhibitors (ATP non-competitive) that bind kinases in their DFG-out conformation were tested against wild-type LRRK2 and the most common Parkinson’s disease-linked mutation G2019S. We found that traditional type II inhibitors exhibit surprising variability in their inhibition mechanism between wild type (WT) and the G2019S mutant of LRRK2. The type II kinase inhibitors were found to work by an ATP-competitive fashion against the G2019S mutant, whereas they appear to follow the expected non-competitive mechanism against WT. Since the G2019S mutation lies in the DXG-motif (DYG in LRRK2 but DFG in most other kinases) of the activation loop, we explored the structural consequence of the mutation on loop dynamics using an enhanced sampling method called metadynamics. The simulations suggest that the G2019S mutation stabilizes the DYG-in state of LRRK2 through a series of hydrogen bonds, leading to an increase in the conformational barrier between the active and inactive forms of the enzyme and a relative stabilization of the active form. The conformational bias toward the active form of LRRK2 mutants has two primary consequences: 1) the mutant enzyme becomes hyperactive, a known contributor to the Parkinsonian phenotype, as a consequence of being “locked” into the activated state and 2) the mutation creates an unusual allosteric pocket that can bind type II inhibitors but in an ATP competitive fashion. Our results suggest that developing type II inhibitors, which are generally considered superior to type I inhibitors due to desirable selectivity profiles, might be especially challenging for the G2019S LRRK2 mutant. PMID:23379419

  10. Dopamine D2 receptor-mediated neuroprotection in a G2019S Lrrk2 genetic model of Parkinson's disease.

    PubMed

    Tozzi, Alessandro; Tantucci, Michela; Marchi, Saverio; Mazzocchetti, Petra; Morari, Michele; Pinton, Paolo; Mancini, Andrea; Calabresi, Paolo

    2018-02-12

    Parkinson's disease (PD) is a neurodegenerative disorder in which genetic and environmental factors synergistically lead to loss of midbrain dopamine (DA) neurons. Mutation of leucine-rich repeated kinase2 (Lrrk2) genes is responsible for the majority of inherited familial cases of PD and can also be found in sporadic cases. The pathophysiological role of this kinase has to be fully understood yet. Hyperactivation of Lrrk2 kinase domain might represent a predisposing factor for both enhanced striatal glutamatergic release and mitochondrial vulnerability to environmental factors that are observed in PD. To investigate possible alterations of striatal susceptibility to mitochondrial dysfunction, we performed electrophysiological recordings from the nucleus striatum of a G2019S Lrrk2 mouse model of PD, as well as molecular and morphological analyses of G2019S Lrrk2-expressing SH-SY5Y neuroblastoma cells. In G2019S mice, we found reduced striatal DA levels, according to the hypothesis of alteration of dopaminergic transmission, and increased loss of field potential induced by the mitochondrial complex I inhibitor rotenone. This detrimental effect is reversed by the D2 DA receptor agonist quinpirole via the inhibition of the cAMP/PKA intracellular pathway. Analysis of mitochondrial functions in G2019S Lrrk2-expressing SH-SY5Y cells revealed strong rotenone-induced oxidative stress characterized by reduced Ca 2+ buffering capability and ATP synthesis, production of reactive oxygen species, and increased mitochondrial fragmentation. Importantly, quinpirole was able to prevent all these changes. We suggest that the G2019S-Lrrk2 mutation is a predisposing factor for enhanced striatal susceptibility to mitochondrial dysfunction induced by exposure to mitochondrial environmental toxins and that the D2 receptor stimulation is neuroprotective on mitochondrial function, via the inhibition of cAMP/PKA intracellular pathway. We suggest new possible neuroprotective strategies for

  11. G2019S leucine-rich repeat kinase 2 causes uncoupling protein-mediated mitochondrial depolarization

    PubMed Central

    Papkovskaia, Tatiana D.; Chau, Kai-Yin; Inesta-Vaquera, Francisco; Papkovsky, Dmitri B.; Healy, Daniel G.; Nishio, Koji; Staddon, James; Duchen, Michael R.; Hardy, John; Schapira, Anthony H.V.; Cooper, J. Mark

    2012-01-01

    The G2019S leucine rich repeat kinase 2 (LRRK2) mutation is the most common genetic cause of Parkinson's disease (PD), clinically and pathologically indistinguishable from idiopathic PD. Mitochondrial abnormalities are a common feature in PD pathogenesis and we have investigated the impact of G2019S mutant LRRK2 expression on mitochondrial bioenergetics. LRRK2 protein expression was detected in fibroblasts and lymphoblasts at levels higher than those observed in the mouse brain. The presence of G2019S LRRK2 mutation did not influence LRRK2 expression in fibroblasts. However, the expression of the G2019S LRRK2 mutation in both fibroblast and neuroblastoma cells was associated with mitochondrial uncoupling. This was characterized by decreased mitochondrial membrane potential and increased oxygen utilization under basal and oligomycin-inhibited conditions. This resulted in a decrease in cellular ATP levels consistent with compromised cellular function. This uncoupling of mitochondrial oxidative phosphorylation was associated with a cell-specific increase in uncoupling protein (UCP) 2 and 4 expression. Restoration of mitochondrial membrane potential by the UCP inhibitor genipin confirmed the role of UCPs in this mechanism. The G2019S LRRK2-induced mitochondrial uncoupling and UCP4 mRNA up-regulation were LRRK2 kinase-dependent, whereas endogenous LRRK2 levels were required for constitutive UCP expression. We propose that normal mitochondrial function was deregulated by the expression of G2019S LRRK2 in a kinase-dependent mechanism that is a modification of the normal LRRK2 function, and this leads to the vulnerability of selected neuronal populations in PD. PMID:22736029

  12. G2019S LRRK2 mutant fibroblasts from Parkinson's disease patients show increased sensitivity to neurotoxin 1-methyl-4-phenylpyridinium dependent of autophagy.

    PubMed

    Yakhine-Diop, Sokhna M S; Bravo-San Pedro, José M; Gómez-Sánchez, Rubén; Pizarro-Estrella, Elisa; Rodríguez-Arribas, Mario; Climent, Vicente; Aiastui, Ana; López de Munain, Adolfo; Fuentes, José M; González-Polo, Rosa A

    2014-10-03

    Parkinson's disease (PD) is a neurodegenerative disorder of unknown etiology. It is considered as a multifactorial disease dependent on environmental and genetic factors. Deregulation in cell degradation has been related with a significant increase in cell damage, becoming a target for studies on the PD etiology. In the present study, we have characterized the parkinsonian toxin 1-methyl-4-phenylpyridinium ion (MPP(+))-induced damage in fibroblasts from Parkinson's patients with the mutation G2019S in leucine-rich repeat kinase 2 protein (LRRK2) and control individuals without this mutation. The results reveal that MPP(+) induces mTOR-dependent autophagy in fibroblasts. Moreover, the effects of caspase-dependent cell death to MPP(+) were higher in cells with the G2019S LRRK2 mutation, which showed basal levels of autophagy due to the G2019S LRRK2 mutation (mTOR-independent). The inhibition of autophagy by 3-methyladenine (3-MA) treatment reduces these sensitivity differences between both cell types, however, the inhibition of autophagosome-lysosome fusion by bafilomycin A1 (Baf A1) increases these differences. This data confirm the importance of the combination of genetic and environmental factors in the PD etiology. Thereby, the sensitivity to the same damage may be different in function of a genetic predisposition, reason why individuals with certain mutations can develop some early-onset diseases, such as individuals with G2019S LRRK2 mutation and PD. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  13. Functional properties of LRRK2 mutations in Taiwanese Parkinson disease.

    PubMed

    Chang, Kuo-Hsuan; Chen, Chiung-Mei; Lin, Chih-Hsin; Chang, Wen-Teng; Jiang, Pei-Ru; Hsiao, Ya-Chin; Wu, Yih-Ru; Lee-Chen, Guey-Jen

    2017-03-01

    Leucine-rich repeat kinase 2 (LRRK2) is a large protein encoding multiple functional domains. Mutations within different LRRK2 domains have been considered to be involved in the development of Parkinson disease by different mechanisms. Our previous study found three LRRK2 mutations-p.R767H, p.S885N, and p.R1441H-in Taiwanese patients with Parkinson disease. We evaluated the functional properties of LRRK2 p.R767H, p.S885N, and p.R1441H mutations by overexpressing them in human embryonic kidney 293 and neuroblastoma SK-N-SH cells. The common p.G2019S mutation in the kinase domain was included for comparison. In 293 cells, overexpressed p.R1441H-but not p.R767H, p.S885N, or p.G2019-increased GTP binding affinity to prolong the active state. Overexpressed p.R1441H and p.G2019S generated inclusions in 293 cells. In SK-N-SH cells, the α-synuclein was coexpressed with wild type as well as mutated p.R767H, p.S885N, p.R1441H, and p.G2019 LRRK2 proteins. Part of the perinuclear inclusions formed by p.R1441H and p.G2019S were colocalized with α-synuclein. Additionally, p.S885N and p.R1441H mutations caused reduced interaction between LRRK2 and ARHGEF7, a putative guanine nucleotide exchange factor for LRRK2, whereas this interaction was well preserved in p.R767H and p.G2019S mutations. Our study suggests that p.R1441H protein facilitates the formation of intracellular inclusions, compromises GTP hydrolysis by increasing its affinity for GTP, and reduces its interaction with ARHGEF7. Copyright © 2016. Published by Elsevier B.V.

  14. The MAPK1/3 pathway is essential for the deregulation of autophagy observed in G2019S LRRK2 mutant fibroblasts

    PubMed Central

    Bravo-San Pedro, José M.; Gómez-Sánchez, Rubén; Niso-Santano, Mireia; Pizarro-Estrella, Elisa; Aiastui-Pujana, Ana; Gorostidi, Ana; Climent, Vicente; López de Maturana, Rakel; Sanchez-Pernaute, Rosario; López de Munain, Adolfo; Fuentes, José M.; González-Polo, Rosa A.

    2012-01-01

    The link between the deregulation of autophagy and cell death processes can be essential in the development of several neurodegenerative diseases, such as Parkinson disease (PD). However, the molecular mechanism of deregulation of this degradative process in PD patients is unknown. The leucine-rich repeat kinase 2 (LRRK2) gene is related to PD and its implication in autophagy regulation has been described. Our recent work shows that the presence of the G2019S LRRK2 mutation, one of the most prevalent in LRRK2, is accompanied by a deregulation of autophagy basal levels dependent on the MAPK1/3 (ERK2/1) pathway. PMID:22914360

  15. Clustering of motor and nonmotor traits in leucine-rich repeat kinase 2 G2019S Parkinson's disease nonparkinsonian relatives: A multicenter family study.

    PubMed

    Mestre, Tiago A; Pont-Sunyer, Claustre; Kausar, Farah; Visanji, Naomi P; Ghate, Taneera; Connolly, Barbara S; Gasca-Salas, Carmen; Kern, Drew S; Jain, Jennifer; Slow, Elizabeth J; Faust-Socher, Achinoam; Kasten, Meike; Wadia, Pettarusp M; Zadikoff, Cindy; Kumar, Prakash; de Bie, Ronald M; Thomsen, Teri; Lang, Anthony E; Schüle, Birgitt; Klein, Christine; Tolosa, Eduardo; Marras, Connie

    2018-04-17

    The objective of this study was to determine phenotypic features that differentiate nonparkinsonian first-degree relatives of PD leucine-rich repeat kinase 2 (LRRK2) G2019S multiplex families, regardless of carrier status, from healthy controls because nonparkinsonian individuals in multiplex families seem to share a propensity to present neurological features. We included nonparkinsonian first-degree relatives of LRRK2 G2019S familial PD cases and unrelated healthy controls participating in established multiplex family LRRK2 cohorts. Study participants underwent neurologic assessment including cognitive screening, olfaction testing, and questionnaires for daytime sleepiness, depression, and anxiety. We used a multiple logistic regression model with backward variable selection, validated with bootstrap resampling, to establish the best combination of motor and nonmotor features that differentiates nonparkinsonian first-degree relatives of LRRK2 G2019S familial PD cases from unrelated healthy controls. We included 142 nonparkinsonian family members and 172 unrelated healthy controls. The combination of past or current symptoms of anxiety (adjusted odds ratio, 4.16; 95% confidence interval, 2.01-8.63), less daytime sleepiness (adjusted odds ratio [1 unit], 0.90; 95% confidence interval, 0.83-0.97], and worse motor UPDRS score (adjusted odds ratio [1 unit], 1.4; 95% confidence interval, 1.20-1.67) distinguished nonparkinsonian family members, regardless of LRRK2 G2019S mutation status, from unrelated healthy controls. The model accuracy was good (area under the curve = 79.3%). A set of motor and nonmotor features distinguishes first-degree relatives of LRRK2 G2019S probands, regardless of mutation status, from unrelated healthy controls. Environmental or non-LRRK2 genetic factors in LRRK2-associated PD may influence penetrance of the LRRK2 G2019S mutation. The relationship of these features to actual PD risk requires longitudinal observation of LRRK2 familial PD

  16. Evidence for prehistoric origins of the G2019S mutation in the North African Berber population.

    PubMed

    Ben El Haj, Rafiqua; Salmi, Ayyoub; Regragui, Wafa; Moussa, Ahmed; Bouslam, Naima; Tibar, Houyam; Benomar, Ali; Yahyaoui, Mohamed; Bouhouche, Ahmed

    2017-01-01

    The most common cause of the monogenic form of Parkinson's disease known so far is the G2019S mutation of the leucine-rich repeat kinase 2 (LRRK2) gene. Its frequency varies greatly among ethnic groups and geographic regions ranging from less than 0.1% in Asia to 40% in North Africa. This mutation has three distinct haplotypes; haplotype 1 being the oldest and most common. Recent studies have dated haplotype 1 of the G2019S mutation to about 4000 years ago, but it remains controversial whether the mutation has a Near-Eastern or Moroccan-Berber ancestral origin. To decipher this evolutionary history, we genotyped 10 microsatellite markers spanning a region of 11.27 Mb in a total of 57 unrelated Moroccan PD patients carrying the G2019S mutation for which the Berber or Arab origin was established over 3 generations based on spoken language. We estimated the age of the most recent common ancestor for the 36 Arab-speaking and the 15 Berber-speaking G2019S carriers using the likelihood-based method with a mutation rate of 10-4. Data analysis suggests that the shortest haplotype originated in a patient of Berber ethnicity. The common founder was estimated to have lived 159 generations ago (95% CI 116-224) for Arab patients, and 200 generations ago (95% CI 123-348) for Berber patients. Then, 29 native North African males carrying the mutation were assessed for specific uniparental markers by sequencing the Y-chromosome (E-M81, E-M78, and M-267) and mitochondrial DNA (mtDNA) hypervariable regions (HV1 and HV2) to examine paternal and maternal contributions, respectively. Results showed that the autochthonous genetic component reached 76% for mtDNA (Eurasian and north African haplogroups) and 59% for the Y-chromosome (E-M81 and E-M78), suggesting that the G2019S mutation may have arisen in an autochthonous DNA pool. Therefore, we conclude that LRRK2 G2019S mutation most likely originated in a Berber founder who lived at least 5000 years ago (95% CI 3075-8700).

  17. LRRK2 modulates vulnerability to mitochondrial dysfunction in C. elegans

    PubMed Central

    Saha, Shamol; Guillily, Maria; Ferree, Andrew; Lanceta, Joel; Chan, Diane; Ghosh, Joy; Hsu, Cindy H.; Segal, Lilach; Raghavan, Kesav; Matsumoto, Kunihiro; Hisamoto, Naoki; Kuwahara, Tomoki; Iwatsubo, Takeshi; Moore, Landon; Goldstein, Lee; Cookson, Mark; Wolozin, Benjamin

    2009-01-01

    Summary Mutations in leucine rich repeat kinase 2 (LRRK2) cause autosomal dominant familial Parkinson’s disease. We generated lines of C. elegans expressing neuronally directed human LRRK2. Expressing human LRRK2 expression increased nematode survival in response to rotenone or paraquat, which are agents that cause mitochondrial dysfunction. Protection by G2019S, R1441C or kinase dead LRRK2 was less than protection by wild type LRRK2. Knockdown of lrk-1, the endogenous orthologue of LRRK2 in C. elegans, reduced survival associated with mitochondrial dysfunction. C. elegans expressing LRRK2 showed rapid loss of dopaminergic markers (DAT∷GFP fluorescence and dopamine levels) beginning in early adulthood. Loss of dopaminergic markers was greater for the G2019S LRRK2 line than for the WT line. Rotenone treatment induced a larger loss of dopamine markers in C. elegans expressing G2019S LRRK2 than in C. elegans expressing WT LRRK2; however loss of dopaminergic markers in the G2019S LRRK2 nematode lines was not statistically different than that in the control line. These data suggest that LRRK2 plays an important role in modulating the response to mitochondrial inhibition, and raises the possibility that mutations in LRRK2 selectively enhance the vulnerability of dopaminergic neurons to a stressor associated with Parkinson’s disease. PMID:19625511

  18. Pathogenic LRRK2 mutations, through increased kinase activity, produce enlarged lysosomes with reduced degradative capacity and increase ATP13A2 expression.

    PubMed

    Henry, Anastasia G; Aghamohammadzadeh, Soheil; Samaroo, Harry; Chen, Yi; Mou, Kewa; Needle, Elie; Hirst, Warren D

    2015-11-01

    Lysosomal dysfunction plays a central role in the pathogenesis of several neurodegenerative disorders, including Parkinson's disease (PD). Several genes linked to genetic forms of PD, including leucine-rich repeat kinase 2 (LRRK2), functionally converge on the lysosomal system. While mutations in LRRK2 are commonly associated with autosomal-dominant PD, the physiological and pathological functions of this kinase remain poorly understood. Here, we demonstrate that LRRK2 regulates lysosome size, number and function in astrocytes, which endogenously express high levels of LRRK2. Expression of LRRK2 G2019S, the most common pathological mutation, produces enlarged lysosomes and diminishes the lysosomal capacity of these cells. Enlarged lysosomes appears to be a common phenotype associated with pathogenic LRRK2 mutations, as we also observed this effect in cells expressing other LRRK2 mutations; R1441C or Y1699C. The lysosomal defects associated with these mutations are dependent on both the catalytic activity of the kinase and autophosphorylation of LRRK2 at serine 1292. Further, we demonstrate that blocking LRRK2's kinase activity, with the potent and selective inhibitor PF-06447475, rescues the observed defects in lysosomal morphology and function. The present study also establishes that G2019S mutation leads to a reduction in lysosomal pH and increased expression of the lysosomal ATPase ATP13A2, a gene linked to a parkinsonian syndrome (Kufor-Rakeb syndrome), in brain samples from mouse and human LRRK2 G2019S carriers. Together, these results demonstrate that PD-associated LRRK2 mutations perturb lysosome function in a kinase-dependent manner, highlighting the therapeutic promise of LRRK2 kinase inhibitors in the treatment of PD. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  19. Sleep Disorders in Parkinsonian and Nonparkinsonian LRRK2 Mutation Carriers

    PubMed Central

    Pont-Sunyer, Claustre; Iranzo, Alex; Gaig, Carles; Fernández-Arcos, Ana; Vilas, Dolores; Valldeoriola, Francesc; Compta, Yaroslau; Fernández-Santiago, Ruben; Fernández, Manel; Bayés, Angels; Calopa, Matilde; Casquero, Pilar; de Fàbregues, Oriol; Jaumà, Serge; Puente, Victor; Salamero, Manel; José Martí, Maria; Santamaría, Joan; Tolosa, Eduard

    2015-01-01

    Objective In idiopathic Parkinson disease (IPD) sleep disorders are common and may antedate the onset of parkinsonism. Based on the clinical similarities between IPD and Parkinson disease associated with LRRK2 gene mutations (LRRK2-PD), we aimed to characterize sleep in parkinsonian and nonmanifesting LRRK2 mutation carriers (NMC). Methods A comprehensive interview conducted by sleep specialists, validated sleep scales and questionnaires, and video-polysomnography followed by multiple sleep latency test (MSLT) assessed sleep in 18 LRRK2-PD (17 carrying G2019S and one R1441G mutations), 17 NMC (11 G2019S, three R1441G, three R1441C), 14 non-manifesting non-carriers (NMNC) and 19 unrelated IPD. Results Sleep complaints were frequent in LRRK2-PD patients; 78% reported poor sleep quality, 33% sleep onset insomnia, 56% sleep fragmentation and 39% early awakening. Sleep onset insomnia correlated with depressive symptoms and poor sleep quality. In LRRK2-PD, excessive daytime sleepiness (EDS) was a complaint in 33% patients and short sleep latencies on the MSLT, which are indicative of objective EDS, were found in 71%. Sleep attacks occurred in three LRRK2-PD patients and a narcoleptic phenotype was not observed. REM sleep behavior disorder (RBD) was diagnosed in three LRRK2-PD. EDS and RBD were always reported to start after the onset of parkinsonism in LRRK2-PD. In NMC, EDS was rarely reported and RBD was absent. When compared to IPD, sleep onset insomnia was more significantly frequent, EDS was similar, and RBD was less significantly frequent and less severe in LRRK2-PD. In NMC, RBD was not detected and sleep complaints were much less frequent than in LRRK2-PD. No differences were observed in sleep between NMC and NMNC. Conclusions Sleep complaints are frequent in LRRK2-PDand show a pattern that when compared to IPD is characterized by more frequent sleep onset insomnia, similar EDS and less prominent RBD. Unlike in IPD, RBD and EDS seem to be not markers of the

  20. Increased Oxidative Stress Markers in Cerebrospinal Fluid from Healthy Subjects with Parkinson’s Disease-Associated LRRK2 Gene Mutations

    PubMed Central

    Loeffler, David A.; Klaver, Andrea C.; Coffey, Mary P.; Aasly, Jan O.; LeWitt, Peter A.

    2017-01-01

    Mutations in the leucine-rich repeat kinase 2 (LRRK2) gene are the most frequent cause of inherited Parkinson’s disease (PD). The most common PD-associated LRRK2 mutation, G2019S, induces increased production of reactive oxygen species in vitro. We therefore hypothesized that individuals with PD-associated LRRK2 mutations might have increased concentrations of oxidative stress markers and/or decreased total antioxidant capacity (TAC) in their cerebrospinal fluid (CSF). We measured two oxidative stress markers, namely 8-hydroxy-2′-deoxyguanosine (8-OHdG) and 8-isoprostane (8-ISO), and TAC in CSF from LRRK2 mutation-bearing PD patients (LRRK2 PD = 19), sporadic PD patients (sPD = 31), and healthy control subjects with or without these mutations (LRRK2 CTL = 30, CTL = 27). 8-OHdG and 8-ISO levels were increased in LRRK2 CTL subjects, while TAC was similar between groups. 8-ISO was negatively correlated, and TAC was positively correlated, with Montreal Cognitive Assessment scores in LRRK2 PD, LRRK2 CTL, and CTL subjects. Correlations in both groups of PD patients between the two oxidative stress markers and Unified Parkinson Disease Rating Scale Total scores were weak, while TAC was negatively correlated with these scores. These findings suggest that oxidative stress may be increased in the CNS in healthy individuals with PD-associated LRRK2 mutations. Further, TAC may decrease in the CNS with the progression of PD, and when cognitive impairment is present regardless of the presence or absence of PD. PMID:28420983

  1. Initial elevations in glutamate and dopamine neurotransmission decline with age, as does exploratory behavior, in LRRK2 G2019S knock-in mice

    PubMed Central

    Kuhlmann, Naila; Kadgien, Chelsie A; Tatarnikov, Igor; Fox, Jesse; Khinda, Jaskaran; Mitchell, Emma; Bergeron, Sabrina; Melrose, Heather

    2017-01-01

    LRRK2 mutations produce end-stage Parkinson’s disease (PD) with reduced nigrostriatal dopamine, whereas, asymptomatic carriers have increased dopamine turnover and altered brain connectivity. LRRK2 pathophysiology remains unclear, but reduced dopamine and mitochondrial abnormalities occur in aged G2019S mutant knock-in (GKI) mice. Conversely, cultured GKI neurons exhibit increased synaptic transmission. We assessed behavior and synaptic glutamate and dopamine function across a range of ages. Young GKI mice exhibit more vertical exploration, elevated glutamate and dopamine transmission, and aberrant D2-receptor responses. These phenomena decline with age, but are stable in littermates. In young GKI mice, dopamine transients are slower, independent of dopamine transporter (DAT), increasing the lifetime of extracellular dopamine. Slowing of dopamine transients is observed with age in littermates, suggesting premature ageing of dopamine synapses in GKI mice. Thus, GKI mice exhibit early, but declining, synaptic and behavioral phenotypes, making them amenable to investigation of early pathophysiological, and later parkinsonian-like, alterations. This model will prove valuable in efforts to develop neuroprotection for PD. PMID:28930069

  2. Identification of three novel LRRK2 mutations associated with Parkinson's disease in a Calabrian population.

    PubMed

    Anfossi, Maria; Colao, Rosanna; Gallo, Maura; Bernardi, Livia; Conidi, M Elena; Frangipane, Francesca; Vasso, Franca; Puccio, Gianfranco; Clodomiro, Alessandra; Mirabelli, Maria; Curcio, Sabrina A M; Torchia, Giusi; Smirne, Nicoletta; Di Lorenzo, Raffaele; Maletta, Raffaele; Bruni, Amalia C

    2014-01-01

    LRRK2 mutations are common in familial and sporadic Parkinson's disease (PD) cases. We present a screening of the most frequently mutated exons of LRRK2 in Calabrian population. Eighty-eight PD patients diagnosed according to standard criteria, underwent screening for LRRK2 mutations in exons 19, 21, 24, 25, 27, 29, 31, 32, 33, 35, 38, 40, 41, and 48. Eight LRRK2 variations were identified in nine patients affected by PD, including three novel missense variations (p.Phe1227Leu, p.Gly1520Ala, p.Ile2020Ser) and five previously identified mutations (p.Ala1151Thr, IVS31+3A>G, p.Arg1514Gln, p.Gly2019Ser, p.Thr2356Ile). LRRK2 frequency mutations were approximately 10.2% in all PD patients, 12% in familial, 8% in sporadic cases. The p.Gly2019Ser mutation was found in 2.3% of the total cohort and in 3.2% of sporadic cases. The clinical features of LRRK2-associated with PD in our patients were similar to those of idiopathic PD although most LRRK2 mutated patients presented with bradykinesia instead of tremor; 33.3% developed dementia. We identified three novel LRRK2 mutations and reported a higher frequency in Calabria compared to previously reported data possibly due to the relative genetic isolation of the Calabrian population. These findings contribute to the understanding of the role of LRKK2 variations in PD and provide additional genetic insight into this disease.

  3. Initial elevations in glutamate and dopamine neurotransmission decline with age, as does exploratory behavior, in LRRK2 G2019S knock-in mice.

    PubMed

    Volta, Mattia; Beccano-Kelly, Dayne A; Paschall, Sarah A; Cataldi, Stefano; MacIsaac, Sarah E; Kuhlmann, Naila; Kadgien, Chelsie A; Tatarnikov, Igor; Fox, Jesse; Khinda, Jaskaran; Mitchell, Emma; Bergeron, Sabrina; Melrose, Heather; Farrer, Matthew J; Milnerwood, Austen J

    2017-09-20

    LRRK2 mutations produce end-stage Parkinson's disease (PD) with reduced nigrostriatal dopamine, whereas, asymptomatic carriers have increased dopamine turnover and altered brain connectivity. LRRK2 pathophysiology remains unclear, but reduced dopamine and mitochondrial abnormalities occur in aged G2019S mutant knock-in (GKI) mice. Conversely, cultured GKI neurons exhibit increased synaptic transmission. We assessed behavior and synaptic glutamate and dopamine function across a range of ages. Young GKI mice exhibit more vertical exploration, elevated glutamate and dopamine transmission, and aberrant D2-receptor responses. These phenomena decline with age, but are stable in littermates. In young GKI mice, dopamine transients are slower, independent of dopamine transporter (DAT), increasing the lifetime of extracellular dopamine. Slowing of dopamine transients is observed with age in littermates, suggesting premature ageing of dopamine synapses in GKI mice. Thus, GKI mice exhibit early, but declining, synaptic and behavioral phenotypes, making them amenable to investigation of early pathophysiological, and later parkinsonian-like, alterations. This model will prove valuable in efforts to develop neuroprotection for PD.

  4. Increased Oxidative Stress Markers in Cerebrospinal Fluid from Healthy Subjects with Parkinson's Disease-Associated LRRK2 Gene Mutations.

    PubMed

    Loeffler, David A; Klaver, Andrea C; Coffey, Mary P; Aasly, Jan O; LeWitt, Peter A

    2017-01-01

    Mutations in the leucine-rich repeat kinase 2 ( LRRK2 ) gene are the most frequent cause of inherited Parkinson's disease (PD). The most common PD-associated LRRK2 mutation, G2019S, induces increased production of reactive oxygen species in vitro . We therefore hypothesized that individuals with PD-associated LRRK2 mutations might have increased concentrations of oxidative stress markers and/or decreased total antioxidant capacity (TAC) in their cerebrospinal fluid (CSF). We measured two oxidative stress markers, namely 8-hydroxy-2'-deoxyguanosine (8-OHdG) and 8-isoprostane (8-ISO), and TAC in CSF from LRRK2 mutation-bearing PD patients ( LRRK2 PD = 19), sporadic PD patients (sPD = 31), and healthy control subjects with or without these mutations ( LRRK2 CTL = 30, CTL = 27). 8-OHdG and 8-ISO levels were increased in LRRK2 CTL subjects, while TAC was similar between groups. 8-ISO was negatively correlated, and TAC was positively correlated, with Montreal Cognitive Assessment scores in LRRK2 PD, LRRK2 CTL, and CTL subjects. Correlations in both groups of PD patients between the two oxidative stress markers and Unified Parkinson Disease Rating Scale Total scores were weak, while TAC was negatively correlated with these scores. These findings suggest that oxidative stress may be increased in the CNS in healthy individuals with PD-associated LRRK2 mutations. Further, TAC may decrease in the CNS with the progression of PD, and when cognitive impairment is present regardless of the presence or absence of PD.

  5. Short- and long-term effects of LRRK2 on axon and dendrite growth.

    PubMed

    Sepulveda, Bryan; Mesias, Roxana; Li, Xianting; Yue, Zhenyu; Benson, Deanna L

    2013-01-01

    Mutations in leucine-rich repeat kinase 2 (LRRK2) underlie an autosomal-dominant form of Parkinson's disease (PD) that is clinically indistinguishable from idiopathic PD. The function of LRRK2 is not well understood, but it has become widely accepted that LRRK2 levels or its kinase activity, which is increased by the most commonly observed mutation (G2019S), regulate neurite growth. However, growth has not been measured; it is not known whether mean differences in length correspond to altered rates of growth or retraction, whether axons or dendrites are impacted differentially or whether effects observed are transient or sustained. To address these questions, we compared several developmental milestones in neurons cultured from mice expressing bacterial artificial chromosome transgenes encoding mouse wildtype-LRRK2 or mutant LRRK2-G2019S, Lrrk2 knockout mice and non-transgenic mice. Over the course of three weeks of development on laminin, the data show a sustained, negative effect of LRRK2-G2019S on dendritic growth and arborization, but counter to expectation, dendrites from Lrrk2 knockout mice do not elaborate more rapidly. In contrast, young neurons cultured on a slower growth substrate, poly-L-lysine, show significantly reduced axonal and dendritic motility in Lrrk2 transgenic neurons and significantly increased motility in Lrrk2 knockout neurons with no significant changes in length. Our findings support that LRRK2 can regulate patterns of axonal and dendritic growth, but they also show that effects vary depending on growth substrate and stage of development. Such predictable changes in motility can be exploited in LRRK2 bioassays and guide exploration of LRRK2 function in vivo.

  6. Phosphorylation-Dependent 14-3-3 Binding to LRRK2 Is Impaired by Common Mutations of Familial Parkinson's Disease

    PubMed Central

    Li, Xianting; Wang, Qing Jun; Pan, Nina; Lee, Sangkyu; Zhao, Yingming; Chait, Brian T.; Yue, Zhenyu

    2011-01-01

    Background Recent studies show that mutations in Leucine Rich Repeat Kinase 2 (LRRK2) are the cause of the most common inherited and some sporadic forms of Parkinson's disease (PD). The molecular mechanism underlying the pathogenic role of LRRK2 mutations in PD remains unknown. Methodology/Principal Findings Using affinity purification and mass spectrometric analysis, we investigated phosphorylation sites and binding proteins of LRRK2 purified from mouse brain. We identified multiple phosphorylation sites at N-terminus of LRRK2 including S910, S912, S935 and S973. Focusing on the high stoichiometry S935 phosphorylation site, we developed an anti-pS935 specific antibody and showed that LRRK2 is constitutively phosphorylated at S935 in various tissues (including brain) and at different ages in mice. We find that 14-3-3 proteins (especially isoforms γ and η) bind LRRK2 and this binding depends on phosphorylation of S935. The binding of 14-3-3, with little effect on dimer formation of LRRK2, confers protection of the phosphorylation status of S935. Furthermore, we show that protein kinase A (PKA), but not LRRK2 kinase itself, can cause the phosphorylation of LRRK2 at S935 in vitro and in cell culture, suggesting that PKA is a potential upstream kinase that regulates LRRK2 function. Finally, our study indicates that the common PD-related mutations of LRRK2, R1441G, Y1699C and G2019S, decrease homeostatic phosphorylation levels of S935 and impair 14-3-3 binding of LRRK2. Conclusions/Significance LRRK2 is extensively phosphorylated in vivo, and the phosphorylation of specific sites (e.g. S935) determines 14-3-3 binding of LRRK2. We propose that 14-3-3 is an important regulator of LRRK2-mediated cellular functions. Our study suggests that PKA, a cAMP-dependent kinase involved in regulating dopamine physiology, is a potential upstream kinase that phosphorylates LRRK2 at S935. Furthermore, the reduction of phosphorylation/14-3-3 binding of LRRK2 due to the common familial

  7. Indolinone based LRRK2 kinase inhibitors with a key hydrogen bond.

    PubMed

    Göring, Stefan; Taymans, Jean-Marc; Baekelandt, Veerle; Schmidt, Boris

    2014-10-01

    The most prevalent leucine-rich repeat kinase 2 (LRRK2) mutation G2019S is associated with Parkinson's disease (PD). It enhances kinase activity and has been identified in both familial and sporadic cases. Kinase activity was reported to be required for LRRK2 mutants to exert their toxic effects. Hence LRRK2 kinase inhibition may be a promising therapeutic target for PD. Here we report on the discovery and characterization of indolinone based LRRK2 inhibitors. Indolinone 15b, the most potent and selective inhibitor of the present series, is characterized by an IC50 of 15nM against wild-type LRRK2 and 10nM against the LRRK2 G2019S mutant, respectively. Compound 15b was further evaluated in a kinase panel including 46 human protein kinases and in a zebrafish embryo phenotype assay, which enabled toxicity determination in whole organisms. Copyright © 2014 Elsevier Ltd. All rights reserved.

  8. Small molecule kinase inhibitors for LRRK2 and their application to Parkinson's disease models.

    PubMed

    Kramer, Thomas; Lo Monte, Fabio; Göring, Stefan; Okala Amombo, Ghislaine Marlyse; Schmidt, Boris

    2012-03-21

    Parkinson's disease (PD) is the second most common neurodegenerative disorder. Several single gene mutations have been linked to this disease. Mutations in the gene encoding leucine-rich repeat kinase 2 (LRRK2) indicate LRRK2 as promising therapeutic target for the treatment of PD. LRRK2 mutations were observed in sporadic as well as familial PD patients and have been investigated intensively. LRRK2 is a large and complex protein, with multiple enzymatic and protein-interaction domains, each of which is effected by mutations. The most common mutation in PD patients is G2019S. Several LRRK2 inhibitors have been reported already, although the crystal structure of LRRK2 has not yet been determined. This review provides a summary of known LRRK2 inhibitors and will discuss recent in vitro and in vivo results of these inhibitors.

  9. Kinetic, mechanistic, and structural modeling studies of truncated wild-type leucine-rich repeat kinase 2 and the G2019S mutant.

    PubMed

    Liu, Min; Kang, Stephanie; Ray, Soumya; Jackson, Justin; Zaitsev, Alexandra D; Gerber, Scott A; Cuny, Gregory D; Glicksman, Marcie A

    2011-11-01

    Leucine-rich repeat kinase 2 (LRRK2), a large and complex protein that possesses two enzymatic properties, kinase and GTPase, is one of the major genetic factors in Parkinson's disease (PD). Here, we characterize the kinetic and catalytic mechanisms of truncated wild-type (t-wt) LRRK2 and its most common mutant, G2019S (t-G2019S), with a structural interpretation of the kinase domain. First, the substitution of threonine with serine in the LRRKtide peptide results in a much less efficient substrate as demonstrated by a 26-fold decrease in k(cat) and a 6-fold decrease in binding affinity. The significant decrease in k(cat) is attributed to a slow chemical transfer step as evidenced by the inverse solvent kinetic isotope effect in the proton inventory and pL (pH or pD)-dependent studies. The shape of the proton inventory and pL profile clearly signals the involvement of a general base (pK(a) = 7.5) in the catalysis with a low fractionation factor in the ground state. We report for the first time that the increased kinase activity of the G2019S mutant is substrate-dependent. Homology modeling of the kinase domain (open and closed forms) and structural analysis of the docked peptide substrates suggest that electrostatic interactions play an important role in substrate recognition, which is affected by G2019S and may directly influence the kinetic properties of the enzyme. Finally, the GTPase activity of the t-G2019S mutant was characterized, and the mutation modestly decreases GTPase activity without significantly affecting GTP binding affinity.

  10. Roles of the Drosophila LRRK2 homolog in Rab7-dependent lysosomal positioning.

    PubMed

    Dodson, Mark W; Zhang, Ting; Jiang, Changan; Chen, Shengdi; Guo, Ming

    2012-03-15

    LRRK2 (PARK8) is the most common genetic determinant of Parkinson's disease (PD), with dominant mutations in LRRK2 causing inherited PD and sequence variation at the LRRK2 locus associated with increased risk for sporadic PD. Although LRRK2 has been implicated in diverse cellular processes encompassing almost all cellular compartments, the precise functions of LRRK2 remain unclear. Here, we show that the Drosophila homolog of LRRK2 (Lrrk) localizes to the membranes of late endosomes and lysosomes, physically interacts with the crucial mediator of late endosomal transport Rab7 and negatively regulates rab7-dependent perinuclear localization of lysosomes. We also show that a mutant form of lrrk analogous to the pathogenic LRRK2(G2019S) allele behaves oppositely to wild-type lrrk in that it promotes rather than inhibits rab7-dependent perinuclear lysosome clustering, with these effects of mutant lrrk on lysosome position requiring both microtubules and dynein. These data suggest that LRRK2 normally functions in Rab7-dependent lysosomal positioning, and that this function is disrupted by the most common PD-causing LRRK2 mutation, linking endolysosomal dysfunction to the pathogenesis of LRRK2-mediated PD.

  11. Roles of the Drosophila LRRK2 homolog in Rab7-dependent lysosomal positioning

    PubMed Central

    Dodson, Mark W.; Zhang, Ting; Jiang, Changan; Chen, Shengdi; Guo, Ming

    2012-01-01

    LRRK2 (PARK8) is the most common genetic determinant of Parkinson's disease (PD), with dominant mutations in LRRK2 causing inherited PD and sequence variation at the LRRK2 locus associated with increased risk for sporadic PD. Although LRRK2 has been implicated in diverse cellular processes encompassing almost all cellular compartments, the precise functions of LRRK2 remain unclear. Here, we show that the Drosophila homolog of LRRK2 (Lrrk) localizes to the membranes of late endosomes and lysosomes, physically interacts with the crucial mediator of late endosomal transport Rab7 and negatively regulates rab7-dependent perinuclear localization of lysosomes. We also show that a mutant form of lrrk analogous to the pathogenic LRRK2G2019S allele behaves oppositely to wild-type lrrk in that it promotes rather than inhibits rab7-dependent perinuclear lysosome clustering, with these effects of mutant lrrk on lysosome position requiring both microtubules and dynein. These data suggest that LRRK2 normally functions in Rab7-dependent lysosomal positioning, and that this function is disrupted by the most common PD-causing LRRK2 mutation, linking endolysosomal dysfunction to the pathogenesis of LRRK2-mediated PD. PMID:22171073

  12. Clinical Correlations With Lewy Body Pathology in LRRK2-Related Parkinson Disease

    PubMed Central

    Kalia, Lorraine V.; Lang, Anthony E.; Hazrati, Lili-Naz; Fujioka, Shinsuke; Wszolek, Zbigniew K.; Dickson, Dennis W.; Ross, Owen A.; Van Deerlin, Vivianna M.; Trojanowski, John Q.; Hurtig, Howard I.; Alcalay, Roy N.; Marder, Karen S.; Clark, Lorraine N.; Gaig, Carles; Tolosa, Eduardo; Ruiz-Martínez, Javier; Marti-Masso, Jose F.; Ferrer, Isidre; de Munain, Adolfo López; Goldman, Samuel M.; Schüle, Birgitt; Langston, J. William; Aasly, Jan O.; Giordana, Maria T.; Bonifati, Vincenzo; Puschmann, Andreas; Canesi, Margherita; Pezzoli, Gianni; De Paula, Andre Maues; Hasegawa, Kazuko; Duyckaerts, Charles; Brice, Alexis; Stoessl, A. Jon; Marras, Connie

    2015-01-01

    IMPORTANCE Mutations in leucine-rich repeat kinase 2 (LRRK2) are the most common cause of genetic Parkinson disease (PD) known to date. The clinical features of manifesting LRRK2 mutation carriers are generally indistinguishable from those of patients with sporadic PD. However, some PD cases associated with LRRK2 mutations lack Lewy bodies (LBs), a neuropathological hallmark of PD. We investigated whether the presence or absence of LBs correlates with different clinical features in LRRK2-related PD. OBSERVATIONS We describe genetic, clinical, and neuropathological findings of 37 cases of LRRK2-related PD including 33 published and 4 unpublished cases through October 2013. Among the different mutations, the LRRK2 p.G2019S mutation was most frequently associated with LB pathology. Nonmotor features of cognitive impairment/dementia, anxiety, and orthostatic hypotension were correlated with the presence of LBs. In contrast, a primarily motor phenotype was associated with a lack of LBs. CONCLUSIONS AND RELEVANCE To our knowledge, this is the first report of clinicopathological correlations in a series of LRRK2-related PD cases. Findings from this selected group of patients with PD demonstrated that parkinsonian motor features can occur in the absence of LBs. However, LB pathology in LRRK2-related PD may be a marker for a broader parkinsonian symptom complex including cognitive impairment. PMID:25401511

  13. Genetic analysis of LRRK2 functional domains in Brazilian patients with Parkinson's disease.

    PubMed

    Abdalla-Carvalho, C B; Santos-Rebouças, C B; Guimarães, B C; Campos, M; Pereira, J S; de Rosso, A L Zuma; Nicaretta, D H; Marinho e Silva, M; dos Santos, Mendonça J; Pimentel, M M G

    2010-12-01

    Mutations in the leucine-rich repeat kinase 2 gene (LRRK2) have been associated with Parkinson's disease (PD), and the majority of the pathogenic variants are located in the ROC and MAPKKK domains. Exons 29-31 and 38-44 (ROC and MAPKKK domains) were sequenced in 204 patients with PD, mostly Brazilian. We identified four polymorphisms, a novel silent variant p.R1398R and four substitutions: p.T1410M, p.G2019S, p.Y2189C and the novel variant p.C2139S. The most prevalent mutation was the p.G2019S (2.4%). We consider that the p.T1410M and the p.Y2189C variants are probably polymorphisms and that the p.C2139S mutation is potentially pathogenic. © 2010 The Author(s). European Journal of Neurology © 2010 EFNS.

  14. Role of LRRK2 and SNCA in autosomal dominant Parkinson's disease in Turkey.

    PubMed

    Kessler, Christoph; Atasu, Burcu; Hanagasi, Hasmet; Simón-Sánchez, Javier; Hauser, Ann-Kathrin; Pak, Meltem; Bilgic, Basar; Erginel-Unaltuna, Nihan; Gurvit, Hakan; Gasser, Thomas; Lohmann, Ebba

    2018-03-01

    Mutations in the LRRK2 and alpha-synuclein (SNCA) genes are well-established causes of autosomal dominant Parkinson's disease (PD). However, their frequency differs widely between ethnic groups. Only three studies have screened all coding regions of LRRK2 and SNCA in European samples so far. In Turkey, the role of LRRK2 in Parkinson's disease has been studied fragmentarily, and the incidence of SNCA copy number variations is unknown. The purpose of this study is to determine the frequency of LRRK2 and SNCA mutations in autosomal dominant PD in Turkey. We performed Sanger sequencing of all coding LRRK2 and SNCA exons in a sample of 91 patients with Parkinsonism. Copy number variations in SNCA, PRKN, PINK1, DJ1 and ATP13A2 were assessed using the MLPA method. All patients had a positive family history compatible with autosomal dominant inheritance. Known mutations in LRRK2 and SNCA were found in 3.3% of cases: one patient harbored the LRRK2 G2019S mutation, and two patients carried a SNCA gene duplication. Furthermore, we found a heterozygous deletion of PRKN exon 2 in one patient, and four rare coding variants of unknown significance (LRRK2: A211V, R1067Q, T2494I; SNCA: T72T). Genetic testing in one affected family identified the LRRK2 R1067Q variant as a possibly pathogenic substitution. Point mutations in LRRK2 and SNCA are a rare cause of autosomal dominant PD in Turkey. However, copy number variations should be considered. The unclassified variants, especially LRRK2 R1067Q, demand further investigation. Copyright © 2017. Published by Elsevier Ltd.

  15. Role of LRRK2 in the regulation of dopamine receptor trafficking

    PubMed Central

    Sanna, Simona; Taymans, Jean Marc; Morari, Michele; Brugnoli, Alberto; Frassineti, Martina; Masala, Alessandra; Esposito, Sonia; Galioto, Manuela; Valle, Cristiana; Carri, Maria Teresa; Biosa, Alice; Greggio, Elisa; Crosio, Claudia

    2017-01-01

    Mutations in LRRK2 play a critical role in both familial and sporadic Parkinson’s disease (PD). Up to date, the role of LRRK2 in PD onset and progression remains largely unknown. However, experimental evidence highlights a critical role of LRRK2 in the control of vesicle trafficking that in turn may regulate different aspects of neuronal physiology. We have analyzed the role of LRRK2 in regulating dopamine receptor D1 (DRD1) and D2 (DRD2) trafficking. DRD1 and DRD2 are the most abundant dopamine receptors in the brain. They differ in structural, pharmacological and biochemical properties, as well as in localization and internalization mechanisms. Our results indicate that disease-associated mutant G2019S LRRK2 impairs DRD1 internalization, leading to an alteration in signal transduction. Moreover, the mutant forms of LRRK2 affect receptor turnover by decreasing the rate of DRD2 trafficking from the Golgi complex to the cell membrane. Collectively, our findings are consistent with the conclusion that LRRK2 influences the motility of neuronal vesicles and the neuronal receptor trafficking. These findings have important implications for the complex role that LRRK2 plays in neuronal physiology and the possible pathological mechanisms that may lead to neuronal death in PD. PMID:28582422

  16. Phosphorylation of p53 by LRRK2 induces microglial tumor necrosis factor α-mediated neurotoxicity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ho, Dong Hwan, E-mail: ethan2887@gmail.com; Seol, Wongi; Eun, Jin Hwan

    Leucine-rich repeat kinase (LRRK2), a major causal gene of Parkinson's disease (PD), functions as a kinase. The most prevalent mutation of LRRK2 is G2019S. It exhibits increased kinase activity compared to the wildtype LRRK2. Previous studies have shown that LRRK2 can phosphorylate p53 at T304 and T377 of threonine-X-arginine (TXR) motif in neurons. Reduction of LRRK2 expression or inhibition of LRRK2 kinase activity has been shown to be able to alleviate LPS-induced neuroinflammation in microglia cells. In this study, we found that LRRK2 could also phosphorylate p53 in microglia model BV2 cells. Transfection of BV2 with phosphomimetic p53 T304/377D significantlymore » increased the secretion of pro-inflammatory cytokine TNFα compared to BV2 transfected with p53 wild type after LPS treatment. In addition, conditioned media from these transfected cells increased the death of dopaminergic neuronal SN4741 cells. Moreover, such neurotoxic effect was rescued by co-treatment with the conditioned media and etanercept, a TNFα blocking antibody. Furthermore, TNFα secretion was significantly increased in primary microglia derived from G2019S transgenic mice treated with LPS compared to that in cells derived from their littermates. These results suggest that LRRK2 kinase activity in microglia can contribute to neuroinflammation in PD via phosphorylating p53 at T304 and T377 site. - Highlights: • LPS stimulates LRRK2-mediated p53 phosphorylation and its nuclear localization. • Phosphorylation of p53 by LRRK2 in microglia enhances TNFα expression. • Microglial TNFα via LRRK2-induced p53 phosphorylation decreases neuronal survival.« less

  17. Regulation of myeloid cell phagocytosis by LRRK2 via WAVE2 complex stabilization is altered in Parkinson's disease.

    PubMed

    Kim, Kwang Soo; Marcogliese, Paul C; Yang, Jungwoo; Callaghan, Steve M; Resende, Virginia; Abdel-Messih, Elizabeth; Marras, Connie; Visanji, Naomi P; Huang, Jana; Schlossmacher, Michael G; Trinkle-Mulcahy, Laura; Slack, Ruth S; Lang, Anthony E; Park, David S

    2018-05-14

    Leucine-rich repeat kinase 2 ( LRRK2 ) has been implicated in both familial and sporadic Parkinson's disease (PD), yet its pathogenic role remains unclear. A previous screen in Drosophila identified Scar/WAVE (Wiskott-Aldrich syndrome protein-family verproline) proteins as potential genetic interactors of LRRK2 Here, we provide evidence that LRRK2 modulates the phagocytic response of myeloid cells via specific modulation of the actin-cytoskeletal regulator, WAVE2. We demonstrate that macrophages and microglia from LRRK2-G2019S PD patients and mice display a WAVE2-mediated increase in phagocytic response, respectively. Lrrk2 loss results in the opposite effect. LRRK2 binds and phosphorylates Wave2 at Thr470, stabilizing and preventing its proteasomal degradation. Finally, we show that Wave2 also mediates Lrrk2 - G2019S-induced dopaminergic neuronal death in both macrophage-midbrain cocultures and in vivo. Taken together, a LRRK2-WAVE2 pathway, which modulates the phagocytic response in mice and human leukocytes, may define an important role for altered immune function in PD.

  18. Dysregulation of lysosomal morphology by pathogenic LRRK2 is corrected by TPC2 inhibition

    PubMed Central

    Hockey, Leanne N.; Kilpatrick, Bethan S.; Eden, Emily R.; Lin-Moshier, Yaping; Brailoiu, G. Cristina; Brailoiu, Eugen; Futter, Clare E.; Schapira, Anthony H.; Marchant, Jonathan S.; Patel, Sandip

    2015-01-01

    ABSTRACT Two-pore channels (TPCs) are endolysosomal ion channels implicated in Ca2+ signalling from acidic organelles. The relevance of these ubiquitous proteins for human disease, however, is unclear. Here, we report that lysosomes are enlarged and aggregated in fibroblasts from Parkinson disease patients with the common G2019S mutation in LRRK2. Defects were corrected by molecular silencing of TPC2, pharmacological inhibition of TPC regulators [Rab7, NAADP and PtdIns(3,5)P2] and buffering local Ca2+ increases. NAADP-evoked Ca2+ signals were exaggerated in diseased cells. TPC2 is thus a potential drug target within a pathogenic LRRK2 cascade that disrupts Ca2+-dependent trafficking in Parkinson disease. PMID:25416817

  19. Functional variants in the LRRK2 gene confer shared effects on risk for Crohn's disease and Parkinson's disease.

    PubMed

    Hui, Ken Y; Fernandez-Hernandez, Heriberto; Hu, Jianzhong; Schaffner, Adam; Pankratz, Nathan; Hsu, Nai-Yun; Chuang, Ling-Shiang; Carmi, Shai; Villaverde, Nicole; Li, Xianting; Rivas, Manual; Levine, Adam P; Bao, Xiuliang; Labrias, Philippe R; Haritunians, Talin; Ruane, Darren; Gettler, Kyle; Chen, Ernie; Li, Dalin; Schiff, Elena R; Pontikos, Nikolas; Barzilai, Nir; Brant, Steven R; Bressman, Susan; Cheifetz, Adam S; Clark, Lorraine N; Daly, Mark J; Desnick, Robert J; Duerr, Richard H; Katz, Seymour; Lencz, Todd; Myers, Richard H; Ostrer, Harry; Ozelius, Laurie; Payami, Haydeh; Peter, Yakov; Rioux, John D; Segal, Anthony W; Scott, William K; Silverberg, Mark S; Vance, Jeffery M; Ubarretxena-Belandia, Iban; Foroud, Tatiana; Atzmon, Gil; Pe'er, Itsik; Ioannou, Yiannis; McGovern, Dermot P B; Yue, Zhenyu; Schadt, Eric E; Cho, Judy H; Peter, Inga

    2018-01-10

    Crohn's disease (CD), a form of inflammatory bowel disease, has a higher prevalence in Ashkenazi Jewish than in non-Jewish European populations. To define the role of nonsynonymous mutations, we performed exome sequencing of Ashkenazi Jewish patients with CD, followed by array-based genotyping and association analysis in 2066 CD cases and 3633 healthy controls. We detected association signals in the LRRK2 gene that conferred risk for CD (N2081D variant, P = 9.5 × 10 -10 ) or protection from CD (N551K variant, tagging R1398H-associated haplotype, P = 3.3 × 10 -8 ). These variants affected CD age of onset, disease location, LRRK2 activity, and autophagy. Bayesian network analysis of CD patient intestinal tissue further implicated LRRK2 in CD pathogenesis. Analysis of the extended LRRK2 locus in 24,570 CD cases, patients with Parkinson's disease (PD), and healthy controls revealed extensive pleiotropy, with shared genetic effects between CD and PD in both Ashkenazi Jewish and non-Jewish cohorts. The LRRK2 N2081D CD risk allele is located in the same kinase domain as G2019S, a mutation that is the major genetic cause of familial and sporadic PD. Like the G2019S mutation, the N2081D variant was associated with increased kinase activity, whereas neither N551K nor R1398H variants on the protective haplotype altered kinase activity. We also confirmed that R1398H, but not N551K, increased guanosine triphosphate binding and hydrolyzing enzyme (GTPase) activity, thereby deactivating LRRK2. The presence of shared LRRK2 alleles in CD and PD provides refined insight into disease mechanisms and may have major implications for the treatment of these two seemingly unrelated diseases. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  20. CSF lamp2 concentrations are decreased in female Parkinson's disease patients with LRRK2 mutations.

    PubMed

    Klaver, Andrea C; Coffey, Mary P; Aasly, Jan O; Loeffler, David A

    2018-03-15

    Lysosome-associated membrane glycoprotein 2 (lamp2) plays critical roles in chaperone-mediated autophagy (CMA) and macroautophagy. Its isoform lamp2a is decreased in Parkinson's disease (PD) substantia nigra. Mutations in the leucine-rich repeat kinase 2 (LRRK2) gene are the most known common cause of late-onset PD; although LRRK2 is thought to regulate macroautophagy, the influence of LRRK2 mutations on lamp2 concentrations in the CNS is unknown. To examine this issue we compared lamp2 levels in cerebrospinal fluid (CSF) between sporadic PD (sPD) patients (n = 31), LRRK2 PD patients (n = 20), and healthy control subjects with or without LRRK2 mutations (LRRK2 CTL = 30, CTL = 27). We also examined lamp2's correlations with age, oxidative stress, PD progression, and PD duration. Median lamp2 concentrations (pg/mL) were LRRK2 PD = 127, sPD = 333, CTL = 436, and LRRK2 CTL = 412. Log-transformed lamp2 concentrations, adjusting for gender effects (and excluding male LRRK2 PD patients because of low number), were lower in female LRRK2 PD patients than in LRRK2 CTL (p = 0.002) and CTL (p = 0.005) subjects (p = 0.06 for lamp2 comparison between female LRRK2 PD patients and sPD patients). Lamp2 did not appear to be associated with age, PD progression, or PD duration; however, three of four Spearman rho values for correlations between lamp2 and oxidative stress markers in PD subjects were ≥0.30. These findings suggest that CSF lamp2 concentrations may be decreased in female LRRK2 PD patients compared to healthy individuals with or without LRRK2 mutations. Copyright © 2018 Elsevier B.V. All rights reserved.

  1. Dysregulation of lysosomal morphology by pathogenic LRRK2 is corrected by TPC2 inhibition.

    PubMed

    Hockey, Leanne N; Kilpatrick, Bethan S; Eden, Emily R; Lin-Moshier, Yaping; Brailoiu, G Cristina; Brailoiu, Eugen; Futter, Clare E; Schapira, Anthony H; Marchant, Jonathan S; Patel, Sandip

    2015-01-15

    Two-pore channels (TPCs) are endolysosomal ion channels implicated in Ca(2+) signalling from acidic organelles. The relevance of these ubiquitous proteins for human disease, however, is unclear. Here, we report that lysosomes are enlarged and aggregated in fibroblasts from Parkinson disease patients with the common G2019S mutation in LRRK2. Defects were corrected by molecular silencing of TPC2, pharmacological inhibition of TPC regulators [Rab7, NAADP and PtdIns(3,5)P2] and buffering local Ca(2+) increases. NAADP-evoked Ca(2+) signals were exaggerated in diseased cells. TPC2 is thus a potential drug target within a pathogenic LRRK2 cascade that disrupts Ca(2+)-dependent trafficking in Parkinson disease. © 2015. Published by The Company of Biologists Ltd.

  2. Phenotype, genotype, and worldwide genetic penetrance of LRRK2-associated Parkinson's disease: a case-control study

    PubMed Central

    Healy, Daniel G; Falchi, Mario; O'Sullivan, Sean S; Bonifati, Vincenzo; Durr, Alexandra; Bressman, Susan; Brice, Alexis; Aasly, Jan; Zabetian, Cyrus P; Goldwurm, Stefano; Ferreira, Joaquim J; Tolosa, Eduardo; Kay, Denise M; Klein, Christine; Williams, David R; Marras, Connie; Lang, Anthony E; Wszolek, Zbigniew K; Berciano, Jose; Schapira, Anthony HV; Lynch, Timothy; Bhatia, Kailash P; Gasser, Thomas; Lees, Andrew J; Wood, Nicholas W

    2008-01-01

    Summary Background Mutations in LRRK2, the gene that encodes leucine-rich repeat kinase 2, are a cause of Parkinson's disease (PD). The International LRRK2 Consortium was established to answer three key clinical questions: can LRRK2-associated PD be distinguished from idiopathic PD; which mutations in LRRK2 are pathogenic; and what is the age-specific cumulative risk of PD for individuals who inherit or are at risk of inheriting a deleterious mutation in LRRK2? Methods Researchers from 21 centres across the world collaborated on this study. The frequency of the common LRRK2 Gly2019Ser mutation was estimated on the basis of data from 24 populations worldwide, and the penetrance of the mutation was defined in 1045 people with mutations in LRRK2 from 133 families. The LRRK2 phenotype was defined on the basis of 59 motor and non-motor symptoms in 356 patients with LRRK2-associated PD and compared with the symptoms of 543 patients with pathologically proven idiopathic PD. Findings Six mutations met the consortium's criteria for being proven pathogenic. The frequency of the common LRRK2 Gly2019Ser mutation was 1% of patients with sporadic PD and 4% of patients with hereditary PD; the frequency was highest in the middle east and higher in southern Europe than in northern Europe. The risk of PD for a person who inherits the LRRK2 Gly2019Ser mutation was 28% at age 59 years, 51% at 69 years, and 74% at 79 years. The motor symptoms (eg, disease severity, rate of progression, occurrence of falls, and dyskinesia) and non-motor symptoms (eg, cognition and olfaction) of LRRK2-associated PD were more benign than those of idiopathic PD. Interpretation Mutations in LRRK2 are a clinically relevant cause of PD that merit testing in patients with hereditary PD and in subgroups of patients with PD. However, this knowledge should be applied with caution in the diagnosis and counselling of patients. Funding UK Medical Research Council; UK Parkinson's Disease Society; UK Brain Research

  3. Arsenite Stress Down-regulates Phosphorylation and 14-3-3 Binding of Leucine-rich Repeat Kinase 2 (LRRK2), Promoting Self-association and Cellular Redistribution*

    PubMed Central

    Mamais, Adamantios; Chia, Ruth; Beilina, Alexandra; Hauser, David N.; Hall, Christine; Lewis, Patrick A.; Cookson, Mark R.; Bandopadhyay, Rina

    2014-01-01

    Mutations in the gene encoding leucine-rich repeat kinase 2 (LRRK2) are a common genetic cause of Parkinson disease, but the mechanisms whereby LRRK2 is regulated are unknown. Phosphorylation of LRRK2 at Ser910/Ser935 mediates interaction with 14-3-3. Pharmacological inhibition of its kinase activity abolishes Ser910/Ser935 phosphorylation and 14-3-3 binding, and this effect is also mimicked by pathogenic mutations. However, physiological situations where dephosphorylation occurs have not been defined. Here, we show that arsenite or H2O2-induced stresses promote loss of Ser910/Ser935 phosphorylation, which is reversed by phosphatase inhibition. Arsenite-induced dephosphorylation is accompanied by loss of 14-3-3 binding and is observed in wild type, G2019S, and kinase-dead D2017A LRRK2. Arsenite stress stimulates LRRK2 self-association and association with protein phosphatase 1α, decreases kinase activity and GTP binding in vitro, and induces translocation of LRRK2 to centrosomes. Our data indicate that signaling events induced by arsenite and oxidative stress may regulate LRRK2 function. PMID:24942733

  4. The LRRK2 G2385R variant is a partial loss-of-function mutation that affects synaptic vesicle trafficking through altered protein interactions.

    PubMed

    Carrion, Maria Dolores Perez; Marsicano, Silvia; Daniele, Federica; Marte, Antonella; Pischedda, Francesca; Di Cairano, Eliana; Piovesana, Ester; von Zweydorf, Felix; Kremmer, Elisabeth; Gloeckner, Christian Johannes; Onofri, Franco; Perego, Carla; Piccoli, Giovanni

    2017-07-14

    Mutations in the Leucine-rich repeat kinase 2 gene (LRRK2) are associated with familial Parkinson's disease (PD). LRRK2 protein contains several functional domains, including protein-protein interaction domains at its N- and C-termini. In this study, we analyzed the functional features attributed to LRRK2 by its N- and C-terminal domains. We combined TIRF microscopy and synaptopHluorin assay to visualize synaptic vesicle trafficking. We found that N- and C-terminal domains have opposite impact on synaptic vesicle dynamics. Biochemical analysis demonstrated that different proteins are bound at the two extremities, namely β3-Cav2.1 at N-terminus part and β-Actin and Synapsin I at C-terminus domain. A sequence variant (G2385R) harboured within the C-terminal WD40 domain increases the risk for PD. Complementary biochemical and imaging approaches revealed that the G2385R variant alters strength and quality of LRRK2 interactions and increases fusion of synaptic vesicles. Our data suggest that the G2385R variant behaves like a loss-of-function mutation that mimics activity-driven events. Impaired scaffolding capabilities of mutant LRRK2 resulting in perturbed vesicular trafficking may arise as a common pathophysiological denominator through which different LRRK2 pathological mutations cause disease.

  5. LRRK2 phosphorylates pre-synaptic N-ethylmaleimide sensitive fusion (NSF) protein enhancing its ATPase activity and SNARE complex disassembling rate.

    PubMed

    Belluzzi, Elisa; Gonnelli, Adriano; Cirnaru, Maria-Daniela; Marte, Antonella; Plotegher, Nicoletta; Russo, Isabella; Civiero, Laura; Cogo, Susanna; Carrion, Maria Perèz; Franchin, Cinzia; Arrigoni, Giorgio; Beltramini, Mariano; Bubacco, Luigi; Onofri, Franco; Piccoli, Giovanni; Greggio, Elisa

    2016-01-13

    Lrrk2, a gene linked to Parkinson's disease, encodes a large scaffolding protein with kinase and GTPase activities implicated in vesicle and cytoskeletal-related processes. At the presynaptic site, LRRK2 associates with synaptic vesicles through interaction with a panel of presynaptic proteins. Here, we show that LRRK2 kinase activity influences the dynamics of synaptic vesicle fusion. We therefore investigated whether LRRK2 phosphorylates component(s) of the exo/endocytosis machinery. We have previously observed that LRRK2 interacts with NSF, a hexameric AAA+ ATPase that couples ATP hydrolysis to the disassembling of SNARE proteins allowing them to enter another fusion cycle during synaptic exocytosis. Here, we demonstrate that NSF is a substrate of LRRK2 kinase activity. LRRK2 phosphorylates full-length NSF at threonine 645 in the ATP binding pocket of D2 domain. Functionally, NSF phosphorylated by LRRK2 displays enhanced ATPase activity and increased rate of SNARE complex disassembling. Substitution of threonine 645 with alanine abrogates LRRK2-mediated increased ATPase activity. Given that the most common Parkinson's disease LRRK2 G2019S mutation displays increased kinase activity, our results suggest that mutant LRRK2 may impair synaptic vesicle dynamics via aberrant phosphorylation of NSF.

  6. CSF Nrf2 and HSPA8 in Parkinson's disease patients with and without LRRK2 gene mutations.

    PubMed

    Loeffler, David A; Smith, Lynnae M; Coffey, Mary P; Aasly, Jan O; LeWitt, Peter A

    2016-03-01

    Leucine-rich repeat kinase 2 (LRRK2) gene mutations are the most common genetic cause of Parkinson's disease (PD). CSF specimens from LRRK2 + PD patients and healthy LRRK2 mutation carriers are, therefore, useful for biomarker studies. This study examined the hypothesis that differences are present between subjects with sporadic PD (sPD), PD carriers of LRRK2 mutations (LRRK2 + PD), healthy control subjects lacking LRRK2 mutations (CTL), and LRRK2 mutation-carrying healthy controls (LRRK2 + CTL) for CSF concentrations of six potential PD biomarkers. Two of these proteins, nuclear factor (erythroid-derived 2)-like 2 ("Nrf2") and heat shock 70 kDa protein 8 ("HSPA8"), were detected in preliminary ELISAs, then measured in a larger cohort (60 sPD, 10 LRRK2 + PD, 23 CTL, 31 LRRK2 + CTL). No statistically significant differences were found between the groups (Nrf2 p = 0.13, HSPA8 p = 0.21). Nrf2 concentrations in LRRK2 + PD subjects were strongly positively associated with Unified Parkinson's Disease Rating Scale (UPDRS) total and motor scores [Spearman rho = 0.77 (p = 0.012) and 0.83 (p = 0.005)] and negatively associated with Montreal Cognitive Assessment (MoCA) scores (rho = -0.57; p = 0.11). Partial correlation coefficient calculations indicated that disease duration contributed to the associations of Nrf2 levels with UPDRS scores and with MoCA scores in this group. While CSF Nrf2 and HSPA8 do not appear to offer diagnostic biomarkers for PD, the associations between Nrf2 levels and UPDRS scores in LRRK2 + PD patients merit further investigation.

  7. Dysregulated LRRK2 Signaling in Response to Endoplasmic Reticulum Stress Leads to Dopaminergic Neuron Degeneration in C. elegans

    PubMed Central

    Yuan, Yiyuan; Cao, Pengxiu; Smith, Mark A.; Kramp, Kristopher; Huang, Ying; Hisamoto, Naoki; Matsumoto, Kunihiro; Hatzoglou, Maria; Jin, Hui; Feng, Zhaoyang

    2011-01-01

    Mutation of leucine-rich repeat kinase 2 (LRRK2) is the leading genetic cause of Parkinson's Disease (PD), manifested as age-dependent dopaminergic neurodegeneration, but the underlying molecular mechanisms remain unclear. Multiple roles of LRRK2 may contribute to dopaminergic neurodegeneration. Endoplasmic reticulum (ER) stress has also been linked to PD pathogenesis, but its interactive mechanism with PD genetic factors is largely unknown. Here, we used C. elegans, human neuroblastoma cells and murine cortical neurons to determine the role of LRRK2 in maintaining dopaminergic neuron viability. We found that LRRK2 acts to protect neuroblastoma cells and C. elegans dopaminergic neurons from the toxicity of 6-hydroxydopamine and/or human α-synuclein, possibly through the p38 pathway, by supporting upregulation of GRP78, a key cell survival molecule during ER stress. A pathogenic LRRK2 mutant (G2019S), however, caused chronic p38 activation that led to death of murine neurons and age-related dopaminergic-specific neurodegeneration in nematodes. These observations establish a critical functional link between LRRK2 and ER stress. PMID:21857923

  8. Mitochondrial Calcium Dysregulation Contributes to Dendrite Degeneration Mediated by PD/LBD-Associated LRRK2 Mutants.

    PubMed

    Verma, Manish; Callio, Jason; Otero, P Anthony; Sekler, Israel; Wills, Zachary P; Chu, Charleen T

    2017-11-15

    Mutations in leucine-rich repeat kinase 2 (LRRK2) contribute to development of late-onset familial Parkinson's disease (PD), with clinical features of motor and cognitive dysfunction indistinguishable from sporadic PD. Calcium dysregulation plays an important role in PD pathogenesis, but the mechanisms of neurodegeneration remain unclear. Recent reports indicate enhanced excitatory neurotransmission in cortical neurons expressing mutant LRRK2, which occurs before the well-characterized phenotype of dendritic shortening. As mitochondria play a major role in the rapid buffering of cytosolic calcium, we hypothesized that altered mitochondrial calcium handling contributes to dendritic retraction elicited by the LRRK2-G2019S and -R1441C mutations. In primary mouse cortical neurons, we observed increased depolarization-induced mitochondrial calcium uptake. We found that expression of mutant LRRK2 elicited transcriptional upregulation of the mitochondrial calcium uniporter (MCU) and the mitochondrial calcium uptake 1 protein (MICU1) with no change in levels of the mitochondrial calcium antiporter NCLX. Elevated MCU and MICU1 were also observed in LRRK2-mutated patient fibroblasts, along with increased mitochondrial calcium uptake, and in postmortem brains of sporadic PD/PDD patients of both sexes. Transcriptional upregulation of MCU and MICU1 was caused by activation of the ERK1/2 (MAPK3/1) pathway. Inhibiting ERK1/2 conferred protection against mutant LRRK2-induced neurite shortening. Pharmacological inhibitors or RNAi knockdown of MCU attenuated mitochondrial calcium uptake and dendritic/neuritic shortening elicited by mutant LRRK2, whereas expression of a constitutively active mutant of NCLX that enhances calcium export from mitochondria was neuroprotective. These data suggest that an increased susceptibility to mitochondrial calcium dysregulation contributes to dendritic injury in mutant LRRK2 pathogenesis. SIGNIFICANCE STATEMENT Cognitive dysfunction and dementia are

  9. LRRK2 G2385R and R1628P Mutations Are Associated with an Increased Risk of Parkinson's Disease in the Malaysian Population

    PubMed Central

    Chua, Jing Yi; Lim, Thien Thien; Mohamed Ibrahim, Norlinah; Tan, Ai Huey; Eow, Gaik Bee; Abdul Aziz, Zariah; Puvanarajah, Santhi Datuk; Viswanathan, Shanthi; Lim, Soo Kun; Tan, Li Ping; Chong, Yip Boon; Tan, Chong Tin; Zhao, Yi; Tan, E. K.

    2014-01-01

    The LRRK2 gene has been associated with both familial and sporadic forms of Parkinson's disease (PD). The G2019S variant is commonly found in North African Arab and Caucasian PD patients, but this locus is monomorphic in Asians. The G2385R and R1628P variants are associated with a higher risk of developing PD in certain Asian populations but have not been studied in the Malaysian population. Therefore, we screened the G2385R and R1628P variants in 1,202 Malaysian subjects consisting of 695 cases and 507 controls. The G2385R and R1628P variants were associated with a 2.2-fold (P = 0.019) and 1.2-fold (P = 0.054) increased risk of PD, respectively. Our data concur with other reported findings in Chinese, Taiwanese, Singaporean, and Korean studies. PMID:25243190

  10. Mutations in the LRRK2 Roc-COR tandem domain link Parkinson's disease to Wnt signalling pathways.

    PubMed

    Sancho, Rosa M; Law, Bernard M H; Harvey, Kirsten

    2009-10-15

    Mutations in PARK8, encoding LRRK2, are the most common known cause of Parkinson's disease. The LRRK2 Roc-COR tandem domain exhibits GTPase activity controlling LRRK2 kinase activity via an intramolecular process. We report the interaction of LRRK2 with the dishevelled family of phosphoproteins (DVL1-3), key regulators of Wnt (Wingless/Int) signalling pathways important for axon guidance, synapse formation and neuronal maintenance. Interestingly, DVLs can interact with and mediate the activation of small GTPases with structural similarity to the LRRK2 Roc domain. The LRRK2 Roc-COR domain and the DVL1 DEP domain were necessary and sufficient for LRRK2-DVL1 interaction. Co-expression of DVL1 increased LRRK2 steady-state protein levels, an effect that was dependent on the DEP domain. Strikingly, LRRK2-DVL1-3 interactions were disrupted by the familial PARK8 mutation Y1699C, whereas pathogenic mutations at residues R1441 and R1728 strengthened LRRK2-DVL1 interactions. Co-expression of DVL1 with LRRK2 in mammalian cells resulted in the redistribution of LRRK2 to typical cytoplasmic DVL1 aggregates in HEK293 and SH-SY5Y cells and co-localization in neurites and growth cones of differentiated dopaminergic SH-SY5Y cells. This is the first report of the modulation of a key LRRK2-accessory protein interaction by PARK8 Roc-COR domain mutations segregating with Parkinson's disease. Since the DVL1 DEP domain is known to be involved in the regulation of small GTPases, we propose that: (i) DVLs may influence LRRK2 GTPase activity, and (ii) Roc-COR domain mutations modulating LRRK2-DVL interactions indirectly influence kinase activity. Our findings also link LRRK2 to Wnt signalling pathways, suggesting novel pathogenic mechanisms and new targets for genetic analysis in Parkinson's disease.

  11. Mutations in the LRRK2 Roc-COR tandem domain link Parkinson's disease to Wnt signalling pathways

    PubMed Central

    Sancho, Rosa M.; Law, Bernard M.H.; Harvey, Kirsten

    2009-01-01

    Mutations in PARK8, encoding LRRK2, are the most common known cause of Parkinson's disease. The LRRK2 Roc-COR tandem domain exhibits GTPase activity controlling LRRK2 kinase activity via an intramolecular process. We report the interaction of LRRK2 with the dishevelled family of phosphoproteins (DVL1-3), key regulators of Wnt (Wingless/Int) signalling pathways important for axon guidance, synapse formation and neuronal maintenance. Interestingly, DVLs can interact with and mediate the activation of small GTPases with structural similarity to the LRRK2 Roc domain. The LRRK2 Roc-COR domain and the DVL1 DEP domain were necessary and sufficient for LRRK2–DVL1 interaction. Co-expression of DVL1 increased LRRK2 steady-state protein levels, an effect that was dependent on the DEP domain. Strikingly, LRRK2–DVL1-3 interactions were disrupted by the familial PARK8 mutation Y1699C, whereas pathogenic mutations at residues R1441 and R1728 strengthened LRRK2–DVL1 interactions. Co-expression of DVL1 with LRRK2 in mammalian cells resulted in the redistribution of LRRK2 to typical cytoplasmic DVL1 aggregates in HEK293 and SH-SY5Y cells and co-localization in neurites and growth cones of differentiated dopaminergic SH-SY5Y cells. This is the first report of the modulation of a key LRRK2-accessory protein interaction by PARK8 Roc-COR domain mutations segregating with Parkinson's disease. Since the DVL1 DEP domain is known to be involved in the regulation of small GTPases, we propose that: (i) DVLs may influence LRRK2 GTPase activity, and (ii) Roc-COR domain mutations modulating LRRK2–DVL interactions indirectly influence kinase activity. Our findings also link LRRK2 to Wnt signalling pathways, suggesting novel pathogenic mechanisms and new targets for genetic analysis in Parkinson's disease. PMID:19625296

  12. Structural model of the dimeric Parkinson’s protein LRRK2 reveals a compact architecture involving distant interdomain contacts

    PubMed Central

    Guaitoli, Giambattista; Raimondi, Francesco; Gilsbach, Bernd K.; Gómez-Llorente, Yacob; Deyaert, Egon; Renzi, Fabiana; Li, Xianting; Schaffner, Adam; Jagtap, Pravin Kumar Ankush; Boldt, Karsten; von Zweydorf, Felix; Gotthardt, Katja; Lorimer, Donald D.; Yue, Zhenyu; Burgin, Alex; Janjic, Nebojsa; Sattler, Michael; Versées, Wim; Ueffing, Marius; Ubarretxena-Belandia, Iban; Kortholt, Arjan; Gloeckner, Christian Johannes

    2016-01-01

    Leucine-rich repeat kinase 2 (LRRK2) is a large, multidomain protein containing two catalytic domains: a Ras of complex proteins (Roc) G-domain and a kinase domain. Mutations associated with familial and sporadic Parkinson’s disease (PD) have been identified in both catalytic domains, as well as in several of its multiple putative regulatory domains. Several of these mutations have been linked to increased kinase activity. Despite the role of LRRK2 in the pathogenesis of PD, little is known about its overall architecture and how PD-linked mutations alter its function and enzymatic activities. Here, we have modeled the 3D structure of dimeric, full-length LRRK2 by combining domain-based homology models with multiple experimental constraints provided by chemical cross-linking combined with mass spectrometry, negative-stain EM, and small-angle X-ray scattering. Our model reveals dimeric LRRK2 has a compact overall architecture with a tight, multidomain organization. Close contacts between the N-terminal ankyrin and C-terminal WD40 domains, and their proximity—together with the LRR domain—to the kinase domain suggest an intramolecular mechanism for LRRK2 kinase activity regulation. Overall, our studies provide, to our knowledge, the first structural framework for understanding the role of the different domains of full-length LRRK2 in the pathogenesis of PD. PMID:27357661

  13. Familial knockin mutation of LRRK2 causes lysosomal dysfunction and accumulation of endogenous insoluble α-synuclein in neurons.

    PubMed

    Schapansky, Jason; Khasnavis, Saurabh; DeAndrade, Mark P; Nardozzi, Jonathan D; Falkson, Samuel R; Boyd, Justin D; Sanderson, John B; Bartels, Tim; Melrose, Heather L; LaVoie, Matthew J

    2018-03-01

    Missense mutations in the multi-domain kinase LRRK2 cause late onset familial Parkinson's disease. They most commonly with classic proteinopathy in the form of Lewy bodies and Lewy neurites comprised of insoluble α-synuclein, but in rare cases can also manifest tauopathy. The normal function of LRRK2 has remained elusive, as have the cellular consequences of its mutation. Data from LRRK2 null model organisms and LRRK2-inhibitor treated animals support a physiological role for LRRK2 in regulating lysosome function. Since idiopathic and LRRK2-linked PD are associated with the intraneuronal accumulation of protein aggregates, a series of critical questions emerge. First, how do pathogenic mutations that increase LRRK2 kinase activity affect lysosome biology in neurons? Second, are mutation-induced changes in lysosome function sufficient to alter the metabolism of α-synuclein? Lastly, are changes caused by pathogenic mutation sensitive to reversal with LRRK2 kinase inhibitors? Here, we report that mutation of LRRK2 induces modest but significant changes in lysosomal morphology and acidification, and decreased basal autophagic flux when compared to WT neurons. These changes were associated with an accumulation of detergent-insoluble α-synuclein and increased neuronal release of α-synuclein and were reversed by pharmacologic inhibition of LRRK2 kinase activity. These data demonstrate a critical and disease-relevant influence of native neuronal LRRK2 kinase activity on lysosome function and α-synuclein homeostasis. Furthermore, they also suggest that lysosome dysfunction, altered neuronal α-synuclein metabolism, and the insidious accumulation of aggregated protein over decades may contribute to pathogenesis in this late-onset form of familial PD. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. The Parkinson's disease VPS35[D620N] mutation enhances LRRK2-mediated Rab protein phosphorylation in mouse and human

    PubMed Central

    Mir, Rafeeq; Tonelli, Francesca; Lis, Pawel; Macartney, Thomas; Polinski, Nicole K.; Martinez, Terina N.; Chou, Meng-Yun; Howden, Andrew J.M.; König, Theresa; Hotzy, Christoph; Milenkovic, Ivan; Brücke, Thomas; Zimprich, Alexander; Sammler, Esther; Alessi, Dario R.

    2018-01-01

    Missense mutations in the LRRK2 (Leucine-rich repeat protein kinase-2) and VPS35 genes result in autosomal dominant Parkinson's disease. The VPS35 gene encodes for the cargo-binding component of the retromer complex, while LRRK2 modulates vesicular trafficking by phosphorylating a subgroup of Rab proteins. Pathogenic mutations in LRRK2 increase its kinase activity. It is not known how the only thus far described pathogenic VPS35 mutation, [p.D620N] exerts its effects. We reveal that the VPS35[D620N] knock-in mutation strikingly elevates LRRK2-mediated phosphorylation of Rab8A, Rab10, and Rab12 in mouse embryonic fibroblasts. The VPS35[D620N] mutation also increases Rab10 phosphorylation in mouse tissues (the lung, kidney, spleen, and brain). Furthermore, LRRK2-mediated Rab10 phosphorylation is increased in neutrophils as well as monocytes isolated from three Parkinson's patients with a heterozygous VPS35[D620N] mutation compared with healthy donors and idiopathic Parkinson's patients. LRRK2-mediated Rab10 phosphorylation is significantly suppressed by knock-out or knock-down of VPS35 in wild-type, LRRK2[R1441C], or VPS35[D620N] cells. Finally, VPS35[D620N] mutation promotes Rab10 phosphorylation more potently than LRRK2 pathogenic mutations. Available data suggest that Parkinson's patients with VPS35[D620N] develop the disease at a younger age than those with LRRK2 mutations. Our observations indicate that VPS35 controls LRRK2 activity and that the VPS35[D620N] mutation results in a gain of function, potentially causing PD through hyperactivation of the LRRK2 kinase. Our findings suggest that it may be possible to elaborate compounds that target the retromer complex to suppress LRRK2 activity. Moreover, patients with VPS35[D620N] associated Parkinson's might benefit from LRRK2 inhibitor treatment that have entered clinical trials in humans. PMID:29743203

  15. Development of an enzyme-linked immunosorbent assay for detection of cellular and in vivo LRRK2 S935 phosphorylation

    PubMed Central

    Delbroek, Lore; Van Kolen, Kristof; Steegmans, Liesbeth; da Cunha, Raquel; Mandemakers, Wim; Daneels, Guy; De Bock, Pieter-Jan; Zhang, Jinwei; Gevaert, Kris; De Strooper, Bart; Alessi, Dario R.; Verstreken, Patrik; Moechars, Diederik W.

    2014-01-01

    After the discovery of kinase activating mutations in leucine-rich repeat kinase 2 (LRRK2) as associated with autosomal dominant forms of Parkinson’s disease, inhibition of the kinase is being extensively explored as a disease modifying strategy. As signaling properties and substrate(s) of LRRK2 are poorly documented, autophosphorylation has been an important readout for the enzyme’s activity. Western blotting using anti-phospho-S910 or S935 LRRK2 antibodies showed effectiveness in demonstrating inhibitory effects of compounds. In this communication we describe two types of enzyme-linked immunosorbent assays (ELISA) to determine LRRK2 protein levels and kinase activity. Both assays take advantage of the sensitivity of the earlier described total and pS935 antibodies for detection (Nichols et al., Biochem. J. 2010) [10]. The first assay is based on anti-GFP-based capturing of overexpressed LRRK2 and is highly suitable to show cellular effects of kinase inhibitors in a 96-well format. In the other platform anti-LRRK2-based capturing allows detection of endogenously expressed LRRK2 in rat tissue with no significant signal in tissue from LRRK2 knockout rats. Furthermore, both assays showed a significant reduction in pS935 levels on cellular and transgenic R1441C/G LRRK2. With the anti-LRRK2 ELISA we were able to detect LRRK2 phosphorylation in human peripheral blood mononuclear cells (PBMC). To conclude, we report two sensitive assays to monitor LRRK2 expression and kinase activity in samples coming from cellular and in vivo experimental settings. Both can show their value in drug screening and biomarker development but will also be useful in the elucidation of LRRK2-mediated signaling pathways. PMID:23313773

  16. Age-related pathology after adenoviral overexpression of the leucine-rich repeat kinase 2 in the mouse striatum.

    PubMed

    Kritzinger, Astrid; Ferger, Boris; Gillardon, Frank; Stierstorfer, Birgit; Birk, Gerald; Kochanek, Stefan; Ciossek, Thomas

    2018-06-01

    Mutations in leucine-rich repeat kinase 2 (LRRK2) age-dependently cause Parkinson's disease and are associated with several inflammatory diseases. So far, the potential role of LRRK2 expression in glial cells as mediators of neuroinflammation and the influence of aging have not been investigated in viral vector-based LRRK2 animal models. In this study, we compared the effect of striatal injection of high-capacity adenoviral vectors expressing either a kinase-overactive LRRK2 with the familial G2019S mutation or a kinase-inactive LRRK2 variant in young and old C57BL/6J mice. The intrinsic adenovirus tropism guided preferentially glial transduction, and the vector design led to stable expression for at least 6 months. In histopathological analysis, young mice expressing either LRRK2 variant presented with transient vacuolization of striatal white fiber tracts accompanied by accumulation of microglial cells and astrogliosis, but inflammation resolved without permanent damage. Old mice had a stronger and prolonged inflammatory reaction and experienced permanent damage in form of partial neuron loss after 3 months exclusively in case of LRRK2_G2019S expression. The autophagic receptor p62 accumulated in cells with high levels of either LRRK2 variant, even more so in old mice. We conclude that the aging mouse brain is more susceptible to LRRK2-associated pathology, and in this model, glial LRRK2 expression significantly contributed to neuroinflammation, ultimately causing neurodegeneration. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  17. The heterozygous R1441C mutation of leucine-rich repeat kinase 2 gene in a Chinese patient with Parkinson disease: A five-year follow-up and literatures review.

    PubMed

    Peng, Fang; Sun, Yi-Min; Chen, Chen; Luo, Su-Shan; Li, Da-Ke; Wang, Yi-Xuan; Yang, Ke; Liu, Feng-Tao; Zuo, Chuan-Tao; Ding, Zheng-Tong; An, Yu; Wu, Jian-Jun; Wang, Jian

    2017-02-15

    Leucine-rich repeat kinase 2 gene (LRRK2) was recognized associated with both familial and sporadic Parkinson Disease (PD). Seven missense mutations (G2019S, R1441C, R1441G, R1441H, Y1699C, I2020T, N1437H) of it have been confirmed disease- causing. They were common among Caucasian PD patients, but rarely reported in Asian, especially in Chinese Han population. We aimed to identify the frequencies of these seven mutations of LRRK2 in Chinese early-onset PD (EOPD) patients and analyze the phenotypes. One hundred and thirty seven EOPD patients were enrolled for genetic testing. The seven disease-causing mutations of LRRK2 were carried out by target sequencing using Illumina HiSeq 2000 Sequencer. The identified variants were further confirmed by Sanger sequence. The clinical materials were investigated retrospectively. Only one patient (0.73%) was found carrying pathogenetic LRRK2 mutation of R1441C. The age at onset of the female patient was 44. She manifested typical motor symptoms of PD and responded well to levodopa therapy. Longitudinal evaluation showed progression of motor symptoms and depression but no cognitive impairment. The dopamine transporter (DAT) imaging via [11C]-2β-carbomethoxy-3β-(4-fluorophenyl) tropan (CFT) and Positron emission computed tomography (PET) revealed typical dopamine transporter uptake reduction. The LRRK2 R1441C mutation was found in a Chinese EOPD patient for the first time. The manifestations of LRRK2-R1441C carriers were indistinguishable from sporadic PD patients. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Pathogenic Parkinson's disease mutations across the functional domains of LRRK2 alter the autophagic/lysosomal response to starvation.

    PubMed

    Manzoni, Claudia; Mamais, Adamantios; Dihanich, Sybille; McGoldrick, Phillip; Devine, Michael J; Zerle, Julia; Kara, Eleanna; Taanman, Jan-Willem; Healy, Daniel G; Marti-Masso, Jose-Felix; Schapira, Anthony H; Plun-Favreau, Helene; Tooze, Sharon; Hardy, John; Bandopadhyay, Rina; Lewis, Patrick A

    2013-11-29

    LRRK2 is one of the most important genetic contributors to Parkinson's disease (PD). Point mutations in this gene cause an autosomal dominant form of PD, but to date no cellular phenotype has been consistently linked with mutations in each of the functional domains (ROC, COR and Kinase) of the protein product of this gene. In this study, primary fibroblasts from individuals carrying pathogenic mutations in the three central domains of LRRK2 were assessed for alterations in the autophagy/lysosomal pathway using a combination of biochemical and cellular approaches. Mutations in all three domains resulted in alterations in markers for autophagy/lysosomal function compared to wild type cells. These data highlight the autophagy and lysosomal pathways as read outs for pathogenic LRRK2 function and as a marker for disease, and provide insight into the mechanisms linking LRRK2 function and mutations. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  19. Interest in Genetic Testing in Ashkenazi Jewish Parkinson’s Disease Patients and Their Unaffected Relatives

    PubMed Central

    Gupte, Manisha; Alcalay, Roy N.; Mejia-Santana, Helen; Raymond, Deborah; Saunders-Pullman, Rachel; Roos, Ernest; Orbe-Reily, Martha; Tang, Ming-X; Mirelman, Anat; Ozelius, Laurie; Orr-Urtreger, Avi; Clark, Lorraine; Giladi, Nir; Bressman, Susan

    2014-01-01

    Our objective was to explore interest in genetic testing among Ashkenazi Jewish (AJ) Parkinson’s Disease (PD) cases and first-degree relatives, as genetic testing for LRRK2 G2019S is widely available. Approximately 18 % of AJ PD cases carry G2019S mutations; penetrance estimations vary between 24 and 100 % by age 80. A Genetic Attitude Questionnaire (GAQ) was administered at two New York sites to PD families unaware of LRRK2 G2019S mutation status. The association of G2019S, age, education, gender and family history of PD with desire for genetic testing (outcome) was modeled using logistic regression. One-hundred eleven PD cases and 77 relatives completed the GAQ. Both PD cases and relatives had excellent PD-specific genetic knowledge. Among PD, 32.6 % “definitely” and 41.1 % “probably” wanted testing, if offered “now.” Among relatives, 23.6 % “definitely” and 36.1 % “probably” wanted testing “now.” Desire for testing in relatives increased incrementally based on hypothetical risk of PD. The most important reasons for testing in probands and relatives were: if it influenced medication response, identifying no mutation, and early prevention and treatment. In logistic regression, older age was associated with less desire for testing in probands OR=0.921 95%CI 0.868–0.977, p=0.009. Both probands and relatives express interest in genetic testing, despite no link to current treatment or prevention. PMID:25127731

  20. The pathogenic LRRK2 R1441C mutation induces specific deficits modeling the prodromal phase of Parkinson's disease in the mouse.

    PubMed

    Giesert, F; Glasl, L; Zimprich, A; Ernst, L; Piccoli, G; Stautner, C; Zerle, J; Hölter, S M; Vogt Weisenhorn, D M; Wurst, W

    2017-09-01

    The aim of the present study was to further explore the in vivo function of the Leucine-rich repeat kinase 2 (LRRK2)-gene, which is mutated in certain familial forms of Parkinson's disease (PD). We generated a mouse model harboring the disease-associated point mutation R1441C in the GTPase domain of the endogenous murine LRRK2 gene (LRRK2 R1441C line) and performed a comprehensive analysis of these animals throughout lifespan in comparison with an existing knockdown line of LRRK2 (LRRK2 knockdown line). Animals of both lines do not exhibit severe motor dysfunction or pathological signs of neurodegeneration neither at young nor old age. However, at old age the homozygous LRRK2 R1441C animals exhibit clear phenotypes related to the prodromal phase of PD such as impairments in fine motor tasks, gait, and olfaction. These phenotypes are only marginally observable in the LRRK2 knockdown animals, possibly due to activation of compensatory mechanisms as suggested by in vitro studies of synaptic transmission. Thus, at the organismal level the LRRK2 R1441C mutation does not emerge as a loss of function of the protein, but induces mutation specific deficits. Furthermore, judged by the phenotypes presented, the LRRK2-R1441C knock-in line is a valid preclinical model for the prodromal phase of PD. Copyright © 2017. Published by Elsevier Inc.

  1. Parkinson disease-associated mutations in LRRK2 cause centrosomal defects via Rab8a phosphorylation.

    PubMed

    Madero-Pérez, Jesús; Fdez, Elena; Fernández, Belén; Lara Ordóñez, Antonio J; Blanca Ramírez, Marian; Gómez-Suaga, Patricia; Waschbüsch, Dieter; Lobbestael, Evy; Baekelandt, Veerle; Nairn, Angus C; Ruiz-Martínez, Javier; Aiastui, Ana; López de Munain, Adolfo; Lis, Pawel; Comptdaer, Thomas; Taymans, Jean-Marc; Chartier-Harlin, Marie-Christine; Beilina, Alexandria; Gonnelli, Adriano; Cookson, Mark R; Greggio, Elisa; Hilfiker, Sabine

    2018-01-23

    Mutations in LRRK2 are a common genetic cause of Parkinson's disease (PD). LRRK2 interacts with and phosphorylates a subset of Rab proteins including Rab8a, a protein which has been implicated in various centrosome-related events. However, the cellular consequences of such phosphorylation remain elusive. Human neuroblastoma SH-SY5Y cells stably expressing wildtype or pathogenic LRRK2 were used to test for polarity defects in the context of centrosomal positioning. Centrosomal cohesion deficits were analyzed from transiently transfected HEK293T cells, as well as from two distinct peripheral cell types derived from LRRK2-PD patients. Kinase assays, coimmunoprecipitation and GTP binding/retention assays were used to address Rab8a phosphorylation by LRRK2 and its effects in vitro. Transient transfections and siRNA experiments were performed to probe for the implication of Rab8a and its phosphorylated form in the centrosomal deficits caused by pathogenic LRRK2. Here, we show that pathogenic LRRK2 causes deficits in centrosomal positioning with effects on neurite outgrowth, cell polarization and directed migration. Pathogenic LRRK2 also causes deficits in centrosome cohesion which can be detected in peripheral cells derived from LRRK2-PD patients as compared to healthy controls, and which are reversed upon LRRK2 kinase inhibition. The centrosomal cohesion and polarity deficits can be mimicked when co-expressing wildtype LRRK2 with wildtype but not phospho-deficient Rab8a. The centrosomal defects induced by pathogenic LRRK2 are associated with a kinase activity-dependent increase in the centrosomal localization of phosphorylated Rab8a, and are prominently reduced upon RNAi of Rab8a. Our findings reveal a new function of LRRK2 mediated by Rab8a phosphorylation and related to various centrosomal defects.

  2. Deep sequencing of the LRRK2 gene in 14,002 individuals reveals evidence of purifying selection and independent origin of the p.Arg1628Pro mutation in Europe

    PubMed Central

    Rubio, Justin P.; Topp, Simon; Warren, Liling; St Jean, Pamela L.; Wegmann, Daniel; Kessner, Darren; Novembre, John; Shen, Judong; Fraser, Dana; Aponte, Jennifer; Nangle, Keith; Cardon, Lon R.; Ehm, Margaret G.; Chissoe, Stephanie L.; Whittaker, John C.; Nelson, Matthew R.; Mooser, Vincent E.

    2012-01-01

    Genetic variation in LRRK2 predisposes to Parkinson disease (PD), which underpins its development as a therapeutic target. Here, we aimed to identify novel genotype-phenotype associations that might support developing LRRK2 therapies for other conditions. We sequenced the 51 exons of LRRK2 in cases comprising 12 common diseases (n = 9,582), and in 4,420 population controls. We identified 739 single nucleotide variants (SNVs), 62% of which were observed in only one person, including 316 novel exonic variants. We found evidence of purifying selection for the LRRK2 gene and a trend suggesting that this is more pronounced in the central (ROC-COR-kinase) core protein domains of LRRK2 than the flanking domains. Population genetic analyses revealed that LRRK2 is not especially polymorphic or differentiated in comparison to 201 other drug target genes. Amongst Europeans, we identified 17 carriers (0.13%) of pathogenic LRRK2 mutations that were not significantly enriched within any disease or in those reporting a family history of PD. Analysis of pathogenic mutations within Europe reveals that the p.Arg1628Pro (c4883G>C) mutation arose independently in Europe and Asia. Taken together, these findings demonstrate how targeted deep sequencing can help to reveal fundamental characteristics of clinically important loci. PMID:22415848

  3. Deep sequencing of the LRRK2 gene in 14,002 individuals reveals evidence of purifying selection and independent origin of the p.Arg1628Pro mutation in Europe.

    PubMed

    Rubio, Justin P; Topp, Simon; Warren, Liling; St Jean, Pamela L; Wegmann, Daniel; Kessner, Darren; Novembre, John; Shen, Judong; Fraser, Dana; Aponte, Jennifer; Nangle, Keith; Cardon, Lon R; Ehm, Margaret G; Chissoe, Stephanie L; Whittaker, John C; Nelson, Matthew R; Mooser, Vincent E

    2012-07-01

    Genetic variation in LRRK2 predisposes to Parkinson disease (PD), which underpins its development as a therapeutic target. Here, we aimed to identify novel genotype-phenotype associations that might support developing LRRK2 therapies for other conditions. We sequenced the 51 exons of LRRK2 in cases comprising 12 common diseases (n = 9,582), and in 4,420 population controls. We identified 739 single-nucleotide variants, 62% of which were observed in only one person, including 316 novel exonic variants. We found evidence of purifying selection for the LRRK2 gene and a trend suggesting that this is more pronounced in the central (ROC-COR-kinase) core protein domains of LRRK2 than the flanking domains. Population genetic analyses revealed that LRRK2 is not especially polymorphic or differentiated in comparison to 201 other drug target genes. Among Europeans, we identified 17 carriers (0.13%) of pathogenic LRRK2 mutations that were not significantly enriched within any disease or in those reporting a family history of PD. Analysis of pathogenic mutations within Europe reveals that the p.Arg1628Pro (c4883G>C) mutation arose independently in Europe and Asia. Taken together, these findings demonstrate how targeted deep sequencing can help to reveal fundamental characteristics of clinically important loci. © 2012 Wiley Periodicals, Inc.

  4. LRRK2 kinase activity regulates synaptic vesicle trafficking and neurotransmitter release through modulation of LRRK2 macro-molecular complex

    PubMed Central

    Cirnaru, Maria D.; Marte, Antonella; Belluzzi, Elisa; Russo, Isabella; Gabrielli, Martina; Longo, Francesco; Arcuri, Ludovico; Murru, Luca; Bubacco, Luigi; Matteoli, Michela; Fedele, Ernesto; Sala, Carlo; Passafaro, Maria; Morari, Michele; Greggio, Elisa; Onofri, Franco; Piccoli, Giovanni

    2014-01-01

    Mutations in Leucine-rich repeat kinase 2 gene (LRRK2) are associated with familial and sporadic Parkinson's disease (PD). LRRK2 is a complex protein that consists of multiple domains executing several functions, including GTP hydrolysis, kinase activity, and protein binding. Robust evidence suggests that LRRK2 acts at the synaptic site as a molecular hub connecting synaptic vesicles to cytoskeletal elements via a complex panel of protein-protein interactions. Here we investigated the impact of pharmacological inhibition of LRRK2 kinase activity on synaptic function. Acute treatment with LRRK2 inhibitors reduced the frequency of spontaneous currents, the rate of synaptic vesicle trafficking and the release of neurotransmitter from isolated synaptosomes. The investigation of complementary models lacking LRRK2 expression allowed us to exclude potential off-side effects of kinase inhibitors on synaptic functions. Next we studied whether kinase inhibition affects LRRK2 heterologous interactions. We found that the binding among LRRK2, presynaptic proteins and synaptic vesicles is affected by kinase inhibition. Our results suggest that LRRK2 kinase activity influences synaptic vesicle release via modulation of LRRK2 macro-molecular complex. PMID:24904275

  5. The effect of LRRK2 mutations on the cholinergic system in manifest and premanifest stages of Parkinson's disease: a cross-sectional PET study.

    PubMed

    Liu, Shu-Ying; Wile, Daryl J; Fu, Jessie Fanglu; Valerio, Jason; Shahinfard, Elham; McCormick, Siobhan; Mabrouk, Rostom; Vafai, Nasim; McKenzie, Jess; Neilson, Nicole; Perez-Soriano, Alexandra; Arena, Julieta E; Cherkasova, Mariya; Chan, Piu; Zhang, Jing; Zabetian, Cyrus P; Aasly, Jan O; Wszolek, Zbigniew K; McKeown, Martin J; Adam, Michael J; Ruth, Thomas J; Schulzer, Michael; Sossi, Vesna; Stoessl, A Jon

    2018-04-01

    Markers of neuroinflammation are increased in some patients with LRRK2 Parkinson's disease compared with individuals with idiopathic Parkinson's disease, suggesting possible differences in disease pathogenesis. Previous PET studies have suggested amplified dopamine turnover and preserved serotonergic innervation in LRRK2 mutation carriers. We postulated that patients with LRRK2 mutations might show abnormalities of central cholinergic activity, even before the diagnosis of Parkinson's disease. Between June, 2009, and December, 2015, we recruited participants from four movement disorder clinics in Canada, Norway, and the USA. Patients with Parkinson's disease were diagnosed by movement disorder neurologists on the basis of the UK Parkinson's Disease Society Brain Bank criteria. LRRK2 carrier status was confirmed by bidirectional Sanger sequencing. We used the PET tracer N- 11 C-methyl-piperidin-4-yl propionate to scan for acetylcholinesterase activity. The primary outcome measure was rate of acetylcholinesterase hydrolysis, calculated using the striatal input method. We compared acetylcholinesterase hydrolysis rates between groups using ANCOVA, with adjustment for age based on the results of linear regression analysis. We recruited 14 patients with LRRK2 Parkinson's disease, 16 LRRK2 mutation carriers without Parkinson's disease, eight patients with idiopathic Parkinson's disease, and 11 healthy controls. We noted significant between-group differences in rates of acetylcholinesterase hydrolysis in cortical regions (average cortex p=0·009, default mode network-related regions p=0·006, limbic network-related regions p=0·020) and the thalamus (p=0·008). LRRK2 mutation carriers without Parkinson's disease had increased acetylcholinesterase hydrolysis rates compared with healthy controls in the cortex (average cortex, p=0·046). Patients with LRRK2 Parkinson's disease had significantly higher acetylcholinesterase activity in some cortical regions (average cortex p=0

  6. Alterations in late endocytic trafficking related to the pathobiology of LRRK2-linked Parkinson's disease.

    PubMed

    Rivero-Ríos, Pilar; Gómez-Suaga, Patricia; Fernández, Belén; Madero-Pérez, Jesús; Schwab, Andrew J; Ebert, Allison D; Hilfiker, Sabine

    2015-06-01

    Mutations in the leucine-rich repeat kinase 2 (LRRK2) gene comprise the most common cause of familial Parkinson's disease (PD), and variants increase the risk for sporadic PD. LRRK2 displays kinase and GTPase activity, and altered catalytic activity correlates with neurotoxicity, making LRRK2 a promising therapeutic target. Despite the importance of LRRK2 for disease pathogenesis, its normal cellular function, and the mechanism(s) by which pathogenic mutations cause neurodegeneration remain unclear. LRRK2 seems to regulate a variety of intracellular vesicular trafficking events to and from the late endosome in a manner dependent on various Rab proteins. At least some of those events are further regulated by LRRK2 in a manner dependent on two-pore channels (TPCs). TPCs are ionic channels localized to distinct endosomal structures and can cause localized calcium release from those acidic stores, with downstream effects on vesicular trafficking. Here, we review current knowledge about the link between LRRK2, TPC- and Rab-mediated vesicular trafficking to and from the late endosome, highlighting a possible cross-talk between endolysosomal calcium stores and Rab proteins underlying pathomechanism(s) in LRRK2-related PD.

  7. 123I-MIBG cardiac uptake and smell identification in parkinsonian patients with LRRK2 mutations.

    PubMed

    Valldeoriola, Francesc; Gaig, Carles; Muxí, Africa; Navales, Ignacio; Paredes, Pilar; Lomeña, Francisco; De la Cerda, Andres; Buongiorno, Mariateresa; Ezquerra, Mario; Santacruz, Pilar; Martí, Maria Jose; Tolosa, Eduardo

    2011-06-01

    Reduced uptake of (123)I- metaiodobenzylguanidine (MIBG) on cardiac gammagraphy and impaired odor identification are markers of neurodegenerative diseases with Lewy bodies (LB) as a pathological hallmark, such as idiopathic Parkinson's disease (IPD). LRRK2 patients present with a clinical syndrome indistinguishable from IPD, but LB have not been found in some cases. Patients with such mutations could behave differently than patients with IPD with respect to MIBG cardiac uptake and olfaction. We studied 14 LRRK2 patients, 14 IPD patients matched by age, gender, disease duration and severity, and 13 age and gender matched control subjects. Olfaction was analyzed through the University of Pennsylvania Smell Identification Test (UPSIT). MIBG cardiac uptake was evaluated through the H/M ratio. The late H/M was 1.44 ± 0.31 for LRRK2 patients, 1.19 ± 0.15 for PD patients, and 1.67 ± 0.16 for control subjects. LRRK2 patients presented lower but not statistically significant MIBG cardiac uptake than controls (p = 0.08) and significant higher uptake than PD patients (p = 0.04). UPSIT mean scores were 21.5 ± 7.3 for LRRK2 patients, 18.7 ± 6.2 for IPD patients and 29.7 ± 5.7 for control subjects. UPSIT score was lower in both LRRK2 and PD than in controls. In LRRK2 patients a positive correlation was found between myocardial MIBG uptake and UPSIT scores, (R = 0.801, p < 0.001). In LRRK2 patients, MIBG cardiac uptake was less impaired than in PD; a positive correlation between MIBG cardiac uptake and UPSIT scores was observed. As MIBG cardiac reduced uptake and impaired odor identification are markers of LB pathology, this findings may represent neuropathological heterogeneity among LRRK2 patients.

  8. Mutant LRRK2 Toxicity in Neurons Depends on LRRK2 Levels and Synuclein But Not Kinase Activity or Inclusion Bodies

    PubMed Central

    Skibinski, Gaia; Nakamura, Ken; Cookson, Mark R.

    2014-01-01

    By combining experimental neuron models and mathematical tools, we developed a “systems” approach to deconvolve cellular mechanisms of neurodegeneration underlying the most common known cause of Parkinson's disease (PD), mutations in leucine-rich repeat kinase 2 (LRRK2). Neurons ectopically expressing mutant LRRK2 formed inclusion bodies (IBs), retracted neurites, accumulated synuclein, and died prematurely, recapitulating key features of PD. Degeneration was predicted from the levels of diffuse mutant LRRK2 that each neuron contained, but IB formation was neither necessary nor sufficient for death. Genetic or pharmacological blockade of its kinase activity destabilized LRRK2 and lowered its levels enough to account for the moderate reduction in LRRK2 toxicity that ensued. By contrast, targeting synuclein, including neurons made from PD patient-derived induced pluripotent cells, dramatically reduced LRRK2-dependent neurodegeneration and LRRK2 levels. These findings suggest that LRRK2 levels are more important than kinase activity per se in predicting toxicity and implicate synuclein as a major mediator of LRRK2-induced neurodegeneration. PMID:24403142

  9. Leucine-rich repeat kinase 2 inhibitors: a review of recent patents (2011 - 2013).

    PubMed

    Kethiri, Raghava R; Bakthavatchalam, Rajagopal

    2014-07-01

    Leucine-rich repeat kinase 2 (LRRK2) is a large (2527 residues) complex multi-domain protein that has GTPase and kinase domains. Autosomal dominant missense mutations in LRRK2 have been found in individuals with Parkinson's disease (PD) and are considered responsible for 1% of all cases of PD. Among the mutations confirmed to contribute to PD pathogenicity, G2019S is the most common cause of PD and it increases the kinase activity of LRRK2 by around threefold. LRRK2 has received considerable attention as a therapeutic target for PD, and LRRK2 inhibitors may help prevent and/or treat the disease. LRRK2 inhibitors are being investigated by various industrial and academic institutions. The present review covers patents literature on small-molecule LRRK2 inhibitors patented between 2011 and 2013. Currently, wild-type and mutant LRRK2 are being examined as therapeutic targets for PD. In testimony to the significance of these novel targets, over 20 patent applications related to LRRK2 have been filed in the last 3 years. Several distinct chemotypes have been reported to be LRRK2 inhibitors with very good potency. These compounds are being used to elucidate the physiological and pathophysiological functions of LRRK2, and some may even emerge as therapeutics for PD.

  10. The Parkinson’s Disease-Associated Protein Kinase LRRK2 Modulates Notch Signaling through the Endosomal Pathway

    PubMed Central

    Imai, Yuzuru; Kobayashi, Yoshito; Inoshita, Tsuyoshi; Meng, Hongrui; Arano, Taku; Uemura, Kengo; Asano, Takeshi; Yoshimi, Kenji; Zhang, Chang-Liang; Matsumoto, Gen; Ohtsuka, Toshiyuki; Kageyama, Ryoichiro; Kiyonari, Hiroshi; Shioi, Go; Nukina, Nobuyuki; Hattori, Nobutaka; Takahashi, Ryosuke

    2015-01-01

    Leucine-rich repeat kinase 2 (LRRK2) is a key molecule in the pathogenesis of familial and idiopathic Parkinson’s disease (PD). We have identified two novel LRRK2-associated proteins, a HECT-type ubiquitin ligase, HERC2, and an adaptor-like protein with six repeated Neuralized domains, NEURL4. LRRK2 binds to NEURL4 and HERC2 via the LRRK2 Ras of complex proteins (ROC) domain and NEURL4, respectively. HERC2 and NEURL4 link LRRK2 to the cellular vesicle transport pathway and Notch signaling, through which the LRRK2 complex promotes the recycling of the Notch ligand Delta-like 1 (Dll1)/Delta (Dl) through the modulation of endosomal trafficking. This process negatively regulates Notch signaling through cis-inhibition by stabilizing Dll1/Dl, which accelerates neural stem cell differentiation and modulates the function and survival of differentiated dopaminergic neurons. These effects are strengthened by the R1441G ROC domain-mutant of LRRK2. These findings suggest that the alteration of Notch signaling in mature neurons is a component of PD etiology linked to LRRK2. PMID:26355680

  11. LRRK2 interacts with ATM and regulates Mdm2-p53 cell proliferation axis in response to genotoxic stress.

    PubMed

    Chen, Zhongcan; Cao, Zhen; Zhang, Wei; Gu, Minxia; Zhou, Zhi Dong; Li, Baojie; Li, Jing; Tan, Eng King; Zeng, Li

    2017-11-15

    Pathogenic leucine-rich repeat kinase 2 (LRRK2) mutations are recognized as the most common cause of familial Parkinson's disease in certain populations. Recently, LRRK2 mutations were shown to be associated with a higher risk of hormone-related cancers. However, how LRRK2 itself contributes to cancer risk remains unknown. DNA damage causes cancer, and DNA damage responses are among the most important pathways in cancer biology. To understand the role of LRRK2 in DNA damage response pathway, we induced DNA damage by applying genotoxic stress to the cells with Adriamycin. We found that DNA damage enhances LRRK2 phosphorylation at Serine 910, Serine 935 and Serine 1292. We further showed that LRRK2 phosphorylation is abolished in the absence of ATM, suggesting that LRRK2 phosphorylation requires ATM. It should also be noted that LRRK2 interacts with ATM. In contrast, overexpression or knockdown of LRRK2 does not affect ATM phosphorylation, indicating that LRRK2 is the downstream target of ATM in response to DNA damage. Moreover, we demonstrated that LRRK2 increases the expression of p53 and p21 by increasing the Mdm2 phosphorylation in response to DNA damage. Loss-of-function in LRRK2 has the opposite effect to that of LRRK2. In addition, FACS analysis revealed that LRRK2 enhances cell cycle progression into S phase in response to DNA damage, a finding that was confirmed by 5-bromo-2'-deoxyuridine immunostaining. Taken together, our findings demonstrate that LRRK2 plays an important role in the ATM-Mdm2-p53 pathway that regulates cell proliferation in response to DNA damage. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  12. [Advance of the study on LRRK2 gene in Parkinson's disease].

    PubMed

    Zhang, Yu; Chen, Shengdi

    2008-12-01

    The leucine-rich repeat kinase2 (LRRK2) has been identified to be the gene causing autosomal dominant inherited Parkinson's disease(PD)8. The clinical features of this type of PD are similar to those of idiopathic PD, but the pathological changes are diverse. The mutation types and frequencies of the LRRK2 distribute unevenly in different populations. LRRK2 is a large complex protein with multiple functions and expresses widely in human body. Sequence alignment shows that LRRK2 might be a multiple function kinase for substrate phosphorylation and might also act as a scaffolding protein. Further study on the physiological function and pathogenic mechanism of LRRK2 will help to find out the possible pathogenesis and new treatment for PD.

  13. Achieving neuroprotection with LRRK2 kinase inhibitors in Parkinson disease.

    PubMed

    West, Andrew B

    2017-12-01

    In the translation of discoveries from the laboratory to the clinic, the track record in developing disease-modifying therapies in neurodegenerative disease is poor. A carefully designed development pipeline built from discoveries in both pre-clinical models and patient populations is necessary to optimize the chances for success. Genetic variation in the leucine-rich repeat kinase two gene (LRRK2) is linked to Parkinson disease (PD) susceptibility. Pathogenic mutations, particularly those in the LRRK2 GTPase (Roc) and COR domains, increase LRRK2 kinase activities in cells and tissues. In some PD models, small molecule LRRK2 kinase inhibitors that block these activities also provide neuroprotection. Herein, the genetic and biochemical evidence that supports the involvement of LRRK2 kinase activity in PD susceptibility is reviewed. Issues related to the definition of a therapeutic window for LRRK2 inhibition and the safety of chronic dosing are discussed. Finally, recommendations are given for a biomarker-guided initial entry of LRRK2 kinase inhibitors in PD patients. Four key areas must be considered for achieving neuroprotection with LRRK2 kinase inhibitors in PD: 1) identification of patient populations most likely to benefit from LRRK2 kinase inhibitors, 2) prioritization of superior LRRK2 small molecule inhibitors based on open disclosures of drug performance, 3) incorporation of biomarkers and empirical measures of LRRK2 kinase inhibition in clinical trials, and 4) utilization of appropriate efficacy measures guided in part by rigorous pre-clinical modeling. Meticulous and rational development decisions can potentially prevent incredibly costly errors and provide the best chances for LRRK2 inhibitors to slow the progression of PD. Copyright © 2017 The Author. Published by Elsevier Inc. All rights reserved.

  14. LRRK2 knockout mice have an intact dopaminergic system but display alterations in exploratory and motor co-ordination behaviors

    PubMed Central

    2012-01-01

    Mutations in the LRRK2 gene are the most common cause of genetic Parkinson’s disease. Although the mechanisms behind the pathogenic effects of LRRK2 mutations are still not clear, data emerging from in vitro and in vivo models suggests roles in regulating neuronal polarity, neurotransmission, membrane and cytoskeletal dynamics and protein degradation. We created mice lacking exon 41 that encodes the activation hinge of the kinase domain of LRRK2. We have performed a comprehensive analysis of these mice up to 20 months of age, including evaluation of dopamine storage, release, uptake and synthesis, behavioral testing, dendritic spine and proliferation/neurogenesis analysis. Our results show that the dopaminergic system was not functionally comprised in LRRK2 knockout mice. However, LRRK2 knockout mice displayed abnormal exploratory activity in the open-field test. Moreover, LRRK2 knockout mice stayed longer than their wild type littermates on the accelerated rod during rotarod testing. Finally, we confirm that loss of LRRK2 caused degeneration in the kidney, accompanied by a progressive enhancement of autophagic activity and accumulation of autofluorescent material, but without evidence of biphasic changes. PMID:22647713

  15. Serotonin and dopamine transporter PET changes in the premotor phase of LRRK2 parkinsonism: cross-sectional studies.

    PubMed

    Wile, Daryl J; Agarwal, Pankaj A; Schulzer, Michael; Mak, Edwin; Dinelle, Katherine; Shahinfard, Elham; Vafai, Nasim; Hasegawa, Kazuko; Zhang, Jing; McKenzie, Jessamyn; Neilson, Nicole; Strongosky, Audrey; Uitti, Ryan J; Guttman, Mark; Zabetian, Cyrus P; Ding, Yu-Shin; Adam, Mike; Aasly, Jan; Wszolek, Zbigniew K; Farrer, Matthew; Sossi, Vesna; Stoessl, A Jon

    2017-05-01

    People with Parkinson's disease can show premotor neurochemical changes in the dopaminergic and non-dopaminergic systems. Using PET, we assessed whether dopaminergic and serotonin transporter changes are similar in LRRK2 mutation carriers with Parkinson's disease and individuals with sporadic Parkinson's disease, and whether LRRK2 mutation carriers without motor symptoms show PET changes. We did two cross-sectional PET studies at the Pacific Parkinson's Research Centre in Vancouver, BC, Canada. We included LRRK2 mutation carriers with or without manifest Parkinson's disease, people with sporadic Parkinson's disease, and age-matched healthy controls, all aged 18 years or older. People with Parkinson's disease were diagnosed by a neurologist with movement disorder training, in accordance with the UK Parkinson's Disease Society Brain Bank criteria. LRRK2 carrier status was confirmed by bidirectional Sanger sequencing. In the first study, LRRK2 mutation carriers with or without manifest Parkinson's disease who were referred for investigation between July, 1999, and January, 2012, were scanned with PET tracers for the membrane dopamine transporter, and dopamine synthesis and storage ( 18 F-6-fluoro-L-dopa; 18 F-FDOPA). We compared findings with those in people with sporadic Parkinson's disease and age-matched healthy controls. In the second study, distinct groups of LRRK2 mutation carriers, individuals with sporadic Parkinson's disease, and age-matched healthy controls seen from November, 2012, to May, 2016, were studied with tracers for the serotonin transporter and vesicular monoamine transporter 2 (VMAT2). Striatal dopamine transporter binding, VMAT2 binding, 18 F-FDOPA uptake, and serotonin transporter binding in multiple brain regions were compared by ANCOVA, adjusted for age. Between January, 1997, and January, 2012, we obtained data for our first study from 40 LRRK2 mutation carriers, 63 individuals with sporadic Parkinson's disease, and 35 healthy controls. We

  16. Lrrk2 and alpha-synuclein are co-regulated in rodent striatum.

    PubMed

    Westerlund, Marie; Ran, Caroline; Borgkvist, Anders; Sterky, Fredrik H; Lindqvist, Eva; Lundströmer, Karin; Pernold, Karin; Brené, Stefan; Kallunki, Pekka; Fisone, Gilberto; Olson, Lars; Galter, Dagmar

    2008-12-01

    LRRK2, alpha-synuclein, UCH-L1 and DJ-1 are implicated in the etiology of Parkinson's disease. We show for the first time that increase in striatal alpha-synuclein levels induce increased Lrrk2 mRNA levels while Dj-1 and Uch-L1 are unchanged. We also demonstrate that a mouse strain lacking the dopamine signaling molecule DARPP-32 has significantly reduced levels of both Lrrk2 and alpha-synuclein, while mice carrying a disabling mutation of the DARPP-32 phosphorylation site T34A or lack alpha-synuclein do not show any changes. To test if striatal dopamine depletion influences Lrrk2 or alpha-synuclein expression, we used the neurotoxin 6-hydroxydopamine in rats and MitoPark mice in which there is progressive degeneration of dopamine neurons. Because striatal Lrrk2 and alpha-synuclein levels were not changed by dopamine depletion, we conclude that Lrrk2 and alpha-synuclein mRNA levels are possibly co-regulated, but they are not influenced by striatal dopamine levels.

  17. Disclosure of Research Results in Genetic Studies of Parkinson Disease Due to LRRK2 Mutations

    PubMed Central

    Bressman, Susan; Raymond, Deborah; Glickman, Amanda; Tolosa, Eduardo

    2015-01-01

    With the advent of large genetic studies examining both symptomatic and asymptomatic individuals, whether and how to disclose genetic research results have become pressing questions. The need is particularly acute in the case of LRRK2 research: Movement centers worldwide are recruiting cohorts of individuals with PD and their family members, including asymptomatic carriers, clinical features and treatment are complex and evolving, and disclosure policies vary at different sites and have been modified during the course of some studies. Herein, we present the major ethical principles of autonomy, beneficence, non-maleficence, and honesty that should guide disclosure policies in studies of families with LRRK2 mutations. We make recommendations regarding: genetic counseling, policies of either active or passive disclosure, responsibilities of funders to budget for genetic counseling, clinical genetic testing where locally required for disclosure, and aspects of study design to avoid mandatory disclosure whenever feasible. PMID:25952684

  18. A QUICK Screen for Lrrk2 Interaction Partners – Leucine-rich Repeat Kinase 2 is Involved in Actin Cytoskeleton Dynamics*

    PubMed Central

    Meixner, Andrea; Boldt, Karsten; Van Troys, Marleen; Askenazi, Manor; Gloeckner, Christian J.; Bauer, Matthias; Marto, Jarrod A.; Ampe, Christophe; Kinkl, Norbert; Ueffing, Marius

    2011-01-01

    Mutations in human leucine-rich repeat kinase 2 (Lrrk2), a protein of yet unknown function, are linked to Parkinson's disease caused by degeneration of midbrain dopaminergic neurons. The protein comprises several domains including a GTPase and a kinase domain both affected by several pathogenic mutations. To elucidate the molecular interaction network of endogenous Lrrk2 under stoichiometric constraints, we applied QUICK (quantitative immunoprecipitation combined with knockdown) in NIH3T3 cells. The identified interactome reveals actin isoforms as well as actin-associated proteins involved in actin filament assembly, organization, rearrangement, and maintenance, suggesting that the biological function of Lrrk2 is linked to cytoskeletal dynamics. In fact, we demonstrate Lrrk2 de novo binding to F-actin and its ability to modulate its assembly in vitro. When tested in intact cells, knockdown of Lrrk2 causes morphological alterations in NIH3T3 cells. In developing dopaminergic midbrain primary neurons, Lrrk2 knockdown results in shortened neurite processes, indicating a physiological role of Lrrk2 in cytoskeletal organization and dynamics of dopaminergic neurons. Hence, our results demonstrate that molecular interactions as well as the physiological function of Lrrk2 are closely related to the organization of the actin-based cytoskeleton, a crucial feature of neuronal development and neuron function. PMID:20876399

  19. LRRK2 delays degradative receptor trafficking by impeding late endosomal budding through decreasing Rab7 activity.

    PubMed

    Gómez-Suaga, Patricia; Rivero-Ríos, Pilar; Fdez, Elena; Blanca Ramírez, Marian; Ferrer, Isidro; Aiastui, Ana; López De Munain, Adolfo; Hilfiker, Sabine

    2014-12-20

    Mutations in the leucine-rich repeat kinase 2 (LRRK2) gene cause late-onset autosomal dominant Parkinson's disease (PD), and sequence variations at the LRRK2 locus are associated with increased risk for sporadic PD. LRRK2 contains both GTPase and kinase domains flanked by protein interaction motifs, and mutations associated with familial PD have been described for both catalytic domains. LRRK2 has been implicated in diverse cellular processes, and recent evidence pinpoints to an important role for LRRK2 in modulating a variety of intracellular membrane trafficking pathways. However, the underlying mechanisms are poorly understood. Here, by studying the classical, well-understood, degradative trafficking pathway of the epidermal growth factor receptor (EGFR), we show that LRRK2 regulates endocytic membrane trafficking in an Rab7-dependent manner. Mutant LRRK2 expression causes a slight delay in early-to-late endosomal trafficking, and a pronounced delay in trafficking out of late endosomes, which become aberrantly elongated into tubules. This is accompanied by a delay in EGFR degradation. The LRRK2-mediated deficits in EGFR trafficking and degradation can be reverted upon coexpression of active Rab7 and of a series of proteins involved in bridging the EGFR to Rab7 on late endosomes. Effector pulldown assays indicate that pathogenic LRRK2 decreases Rab7 activity both in cells overexpressing LRRK2, as well as in fibroblasts from pathogenic mutant LRRK2 PD patients when compared with healthy controls. Together, these findings provide novel insights into a previously unknown regulation of Rab7 activity by mutant LRRK2 which impairs membrane trafficking at very late stages of the endocytic pathway. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  20. Disclosure of research results in genetic studies of Parkinson's disease caused by LRRK2 mutations.

    PubMed

    Pont-Sunyer, Claustre; Bressman, Susan; Raymond, Deborah; Glickman, Amanda; Tolosa, Eduardo; Saunders-Pullman, Rachel

    2015-06-01

    With the advent of large genetic studies examining both symptomatic and asymptomatic individuals, whether and how to disclose genetic research results have become pressing questions. The need is particularly acute in the case of LRRK2 research: Movement centers worldwide are recruiting cohorts of individuals with Parkinson's disease (PD) and their family members, including asymptomatic carriers. Clinical features and treatment are complex and evolving, and disclosure policies vary at different sites and have been modified during the course of some studies. We present the major ethical principles of autonomy, beneficence, nonmaleficence, and honesty that should guide disclosure policies in studies of families with LRRK2 mutations. We make recommendations regarding genetic counseling, policies of either active or passive disclosure, responsibilities of funders to budget for genetic counseling, clinical genetic testing where locally required for disclosure, and aspects of study design to avoid mandatory disclosure whenever feasible. © 2015 International Parkinson and Movement Disorder Society. © 2015 International Parkinson and Movement Disorder Society.

  1. Impaired intracortical transmission in G2019S leucine rich-repeat kinase Parkinson patients.

    PubMed

    Ponzo, Viviana; Di Lorenzo, Francesco; Brusa, Livia; Schirinzi, Tommaso; Battistini, Stefania; Ricci, Claudia; Sambucci, Manolo; Caltagirone, Carlo; Koch, Giacomo

    2017-05-01

    A mutation in leucine-rich repeat kinase 2 is the most common cause of hereditary Parkinson's disease (PD), yet the neural mechanisms and the circuitry potentially involved are poorly understood. We used different transcranial magnetic stimulation protocols to explore in the primary motor cortex the activity of intracortical circuits and cortical plasticity (long-term potentiation) in patients with the G2019S leucine-rich repeat kinase 2 gene mutation when compared with idiopathic PD patients and age-matched healthy subjects. Paired pulse transcranial magnetic stimulation was used to investigate short intracortical inhibition and facilitation and short afferent inhibition. Intermittent theta burst stimulation, a form of repetitive transcranial magnetic stimulation, was used to test long-term potentiation-like cortical plasticity. Leucine-rich repeat kinase 2 and idiopathic PD were tested both in ON and in OFF l-dopa therapy. When compared with idiopathic PD and healthy subjects, leucine-rich repeat kinase 2 PD patients showed a remarkable reduction of short intracortical inhibition in both ON and in OFF l-dopa therapy. This reduction was paralleled by an increase of intracortical facilitation in OFF l-dopa therapy. Leucine-rich repeat kinase 2 PD showed abnormal long-term potentiation-like cortical plasticity in ON l-dopa therapy. The motor cortex in leucine-rich repeat kinase 2 mutated PD patients is strongly disinhibited and hyperexcitable. These abnormalities could be a result of an impairment of inhibitory (gamma-Aminobutyric acid) transmission eventually related to altered neurotransmitter release. © 2017 International Parkinson and Movement Disorder Society. © 2017 International Parkinson and Movement Disorder Society.

  2. Combined exposure to Maneb and Paraquat alters transcriptional regulation of neurogenesis-related genes in mice models of Parkinson's disease.

    PubMed

    Desplats, Paula; Patel, Pruthul; Kosberg, Kori; Mante, Michael; Patrick, Christina; Rockenstein, Edward; Fujita, Masayo; Hashimoto, Makoto; Masliah, Eliezer

    2012-09-28

    Parkinson's disease (PD) is a multifactorial disease where environmental factors act on genetically predisposed individuals. Although only 5% of PD manifestations are associated with specific mutations, majority of PD cases are of idiopathic origin, where environment plays a prominent role. Concurrent exposure to Paraquat (PQ) and Maneb (MB) in rural workers increases the risk for PD and exposure of adult mice to MB/PQ results in dopamine fiber loss and decreased locomotor activity. While PD is characterized by neuronal loss in the substantia nigra, we previously showed that accumulation of α-synuclein in the limbic system contributes to neurodegeneration by interfering with adult neurogenesis. We investigated the effect of pesticides on adult hippocampal neurogenesis in two transgenic models: Line 61, expressing the human wild type SNCA gene and Line LRRK2(G2019S), expressing the human LRRK2 gene with the mutation G2019S. Combined exposure to MB/PQ resulted in significant reduction of neuronal precursors and proliferating cells in non-transgenic animals, and this effect was increased in transgenic mice, in particular for Line 61, suggesting that α-synuclein accumulation and environmental toxins have a synergistic effect. We further investigated the transcription of 84 genes with direct function on neurogenesis. Overexpresion of α-synuclein resulted in the downregulation of 12% of target genes, most of which were functionally related to cell differentiation, while LRRK2 mutation had a minor impact on gene expression. MB/PQ also affected transcription in non-transgenic backgrounds, but when transgenic mice were exposed to the pesticides, profound alterations in gene expression affecting 27% of the studied targets were observed in both transgenic lines. Gene enrichment analysis showed that 1:3 of those genes were under the regulation of FoxF2 and FoxO3A, suggesting a primary role of these proteins in the response to genetic and environmental cues. We report that

  3. Distinctive genomic signature of neural and intestinal organoids from familial Parkinson's disease patient-derived induced pluripotent stem cells.

    PubMed

    Son, M-Y; Sim, H; Son, Y S; Jung, K B; Lee, M-O; Oh, J-H; Chung, S-K; Jung, C-R; Kim, J

    2017-12-01

    The leucine-rich repeat kinase 2 (LRRK2) G2019S mutation is the most common genetic cause of Parkinson's disease (PD). There is compelling evidence that PD is not only a brain disease but also a gastrointestinal disorder; nonetheless, its pathogenesis remains unclear. We aimed to develop human neural and intestinal tissue models of PD patients harbouring an LRRK2 mutation to understand the link between LRRK2 and PD pathology by investigating the gene expression signature. We generated PD patient-specific induced pluripotent stem cells (iPSCs) carrying an LRRK2 G2019S mutation (LK2GS) and then differentiated into three-dimensional (3D) human neuroectodermal spheres (hNESs) and human intestinal organoids (hIOs). To unravel the gene and signalling networks associated with LK2GS, we analysed differentially expressed genes in the microarray data by functional clustering, gene ontology (GO) and pathway analyses. The expression profiles of LK2GS were distinct from those of wild-type controls in hNESs and hIOs. The most represented GO biological process in hNESs and hIOs was synaptic transmission, specifically synaptic vesicle trafficking, some defects of which are known to be related to PD. The results were further validated in four independent PD-specific hNESs and hIOs by microarray and qRT-PCR analysis. We provide the first evidence that LK2GS also causes significant changes in gene expression in the intestinal cells. These hNES and hIO models from the same genetic background of PD patients could be invaluable resources for understanding PD pathophysiology and for advancing the complexity of in vitro models with 3D expandable organoids. © 2017 British Neuropathological Society.

  4. RNAi Mediated Silencing of LRRK2G2019S in Parkinson’s Disease

    DTIC Science & Technology

    2013-08-01

    CONTRACTING ORGANIZATION : Georgetown University Medical Center Washington DC 20057-2197 REPORT DATE: August 2013 TYPE OF REPORT: Final Option...georgetown.edu, xs37@georgetown.edu 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) Georgetown University Medical...Center 8. PERFORMING ORGANIZATION REPORT NUMBER Washington DC 20057- 2197 9. SPONSORING / MONITORING AGENCY NAME(S) AND ADDRESS

  5. The Parkinson Disease-linked LRRK2 Protein Mutation I2020T Stabilizes an Active State Conformation Leading to Increased Kinase Activity*

    PubMed Central

    Ray, Soumya; Bender, Samantha; Kang, Stephanie; Lin, Regina; Glicksman, Marcie A.; Liu, Min

    2014-01-01

    The effect of leucine-rich repeat kinase 2 (LRRK2) mutation I2020T on its kinase activity has been controversial, with both increased and decreased effects being reported. We conducted steady-state and pre-steady-state kinetic studies on LRRKtide and its analog LRRKtideS. Their phosphorylation differs by the rate-limiting steps: product release is rate-limiting for LRRKtide and phosphoryl transfer is rate-limiting for LRRKtideS. As a result, we observed that the I2020T mutant is more active than wild type (WT) LRRK2 for LRRKtideS phosphorylation, whereas it is less active than WT for LRRKtide phosphorylation. Our pre-steady-state kinetic data suggest that (i) the I2020T mutant accelerates the rates of phosphoryl transfer of both reactions by 3–7-fold; (ii) this increase is masked by a rate-limiting product release step for LRRKtide phosphorylation; and (iii) the observed lower activity of the mutant for LRRKtide phosphorylation is a consequence of its instability: the concentration of the active form of the mutant is 3-fold lower than WT. The I2020T mutant has a dramatically low KATP and therefore leads to resistance to ATP competitive inhibitors. Two well known DFG-out or type II inhibitors are also weaker toward the mutant because they inhibit the mutant in an unexpected ATP competitive mechanism. The I2020 residue lies next to the DYG motif of the activation loop of the LRRK2 kinase domain. Our modeling and metadynamic simulations suggest that the I2020T mutant stabilizes the DYG-in active conformation and creates an unusual allosteric pocket that can bind type II inhibitors but in an ATP competitive fashion. PMID:24695735

  6. Revisiting the Roco G-protein cycle.

    PubMed

    Terheyden, Susanne; Ho, Franz Y; Gilsbach, Bernd K; Wittinghofer, Alfred; Kortholt, Arjan

    2015-01-01

    Mutations in leucine-rich-repeat kinase 2 (LRRK2) are the most frequent cause of late-onset Parkinson's disease (PD). LRRK2 belongs to the Roco family of proteins which share a conserved Ras-like G-domain (Roc) and a C-terminal of Roc (COR) domain tandem. The nucleotide state of small G-proteins is strictly controlled by guanine-nucleotide-exchange factors (GEFs) and GTPase-activating proteins (GAPs). Because of contradictory structural and biochemical data, the regulatory mechanism of the LRRK2 Roc G-domain and the RocCOR tandem is still under debate. In the present study, we solved the first nucleotide-bound Roc structure and used LRRK2 and bacterial Roco proteins to characterize the RocCOR function in more detail. Nucleotide binding induces a drastic structural change in the Roc/COR domain interface, a region strongly implicated in patients with an LRRK2 mutation. Our data confirm previous assumptions that the C-terminal subdomain of COR functions as a dimerization device. We show that the dimer formation is independent of nucleotide. The affinity for GDP/GTP is in the micromolar range, the result of which is high dissociation rates in the s-1 range. Thus Roco proteins are unlikely to need GEFs to achieve activation. Monomeric LRRK2 and Roco G-domains have a similar low GTPase activity to small G-proteins. We show that GTPase activity in bacterial Roco is stimulated by the nucleotide-dependent dimerization of the G-domain within the complex. We thus propose that the Roco proteins do not require GAPs to stimulate GTP hydrolysis but stimulate each other by one monomer completing the catalytic machinery of the other.

  7. Arm swing as a potential new prodromal marker of Parkinson's disease.

    PubMed

    Mirelman, Anat; Bernad-Elazari, Hagar; Thaler, Avner; Giladi-Yacobi, Eytan; Gurevich, Tanya; Gana-Weisz, Mali; Saunders-Pullman, Rachel; Raymond, Deborah; Doan, Nancy; Bressman, Susan B; Marder, Karen S; Alcalay, Roy N; Rao, Ashwini K; Berg, Daniela; Brockmann, Kathrin; Aasly, Jan; Waro, Bjørg Johanne; Tolosa, Eduardo; Vilas, Dolores; Pont-Sunyer, Claustre; Orr-Urtreger, Avi; Hausdorff, Jeffrey M; Giladi, Nir

    2016-10-01

    Reduced arm swing is a well-known clinical feature of Parkinson's disease (PD), often observed early in the course of the disease. We hypothesized that subtle changes in arm swing and axial rotation may also be detectable in the prodromal phase. The purpose of this study was to evaluate the relationship between the LRRK2-G2019S mutation, arm swing, and axial rotation in healthy nonmanifesting carriers and noncarriers of the G2019S mutation and in patients with PD. A total of 380 participants (186 healthy nonmanifesting controls and 194 PD patients) from 6 clinical sites underwent gait analysis while wearing synchronized 3-axis body-fixed sensors on the lower back and bilateral wrists. Participants walked for 1 minute under the following 2 conditions: (1) usual walking and (2) dual-task walking. Arm swing amplitudes, asymmetry, variability, and smoothness were calculated for both arms along with measures of axial rotation. A total of 122 nonmanifesting participants and 67 PD patients were carriers of the G2019S mutation. Nonmanifesting mutation carriers walked with greater arm swing asymmetry and variability and lower axial rotation smoothness under the dual task condition when compared with noncarriers (P < .04). In the nonmanifesting mutation carriers, arm swing asymmetry was associated with gait variability under dual task (P = .003). PD carriers showed greater asymmetry and variability of movement than PD noncarriers, even after controlling for disease severity (P < .009). The G2019S mutation is associated with increased asymmetry and variability among nonmanifesting participants and patients with PD. Prospective studies should determine if arm swing asymmetry and axial rotation smoothness may be used as motor markers of prodromal PD. © 2016 International Parkinson and Movement Disorder Society. © 2016 International Parkinson and Movement Disorder Society.

  8. Analysis of Lrrk2 R1628P as a risk factor for Parkinson's disease.

    PubMed

    Ross, Owen A; Wu, Yih-Ru; Lee, Mei-Ching; Funayama, Manabu; Chen, Meng-Ling; Soto, Alexandra I; Mata, Ignacio F; Lee-Chen, Guey-Jen; Chen, Chiung Mei; Tang, Michelle; Zhao, Yi; Hattori, Nobutaka; Farrer, Matthew J; Tan, Eng-King; Wu, Ruey-Meei

    2008-07-01

    Common genetic variants that increase the risk for Parkinson's disease may differentiate patient subgroups and influence future individualized therapeutic strategies. Herein we show evidence for leucine-rich repeat kinase 2 (LRRK2) c.4883G>C (R1628P) as a risk factor in ethnic Chinese populations. A study of 1,986 individuals from 3 independent centers in Taiwan and Singapore demonstrates that Lrrk2 R1628P increases risk for Parkinson's disease (odds ratio, 1.84; 95% confidence interval, 1.20-2.83; p = 0.006). Haplotype analysis suggests an ancestral founder for carriers approximately 2,500 years ago. These findings support the importance of LRRK2 variants in sporadic Parkinson's disease. Ann Neurol 2008.

  9. A proteomic analysis of LRRK2 binding partners reveals interactions with multiple signaling components of the WNT/PCP pathway.

    PubMed

    Salašová, Alena; Yokota, Chika; Potěšil, David; Zdráhal, Zbyněk; Bryja, Vítězslav; Arenas, Ernest

    2017-07-11

    Autosomal-dominant mutations in the Park8 gene encoding Leucine-rich repeat kinase 2 (LRRK2) have been identified to cause up to 40% of the genetic forms of Parkinson's disease. However, the function and molecular pathways regulated by LRRK2 are largely unknown. It has been shown that LRRK2 serves as a scaffold during activation of WNT/β-catenin signaling via its interaction with the β-catenin destruction complex, DVL1-3 and LRP6. In this study, we examine whether LRRK2 also interacts with signaling components of the WNT/Planar Cell Polarity (WNT/PCP) pathway, which controls the maturation of substantia nigra dopaminergic neurons, the main cell type lost in Parkinson's disease patients. Co-immunoprecipitation and tandem mass spectrometry was performed in a mouse substantia nigra cell line (SN4741) and human HEK293T cell line in order to identify novel LRRK2 binding partners. Inhibition of the WNT/β-catenin reporter, TOPFlash, was used as a read-out of WNT/PCP pathway activation. The capacity of LRRK2 to regulate WNT/PCP signaling in vivo was tested in Xenopus laevis' early development. Our proteomic analysis identified that LRRK2 interacts with proteins involved in WNT/PCP signaling such as the PDZ domain-containing protein GIPC1 and Integrin-linked kinase (ILK) in dopaminergic cells in vitro and in the mouse ventral midbrain in vivo. Moreover, co-immunoprecipitation analysis revealed that LRRK2 binds to two core components of the WNT/PCP signaling pathway, PRICKLE1 and CELSR1, as well as to FLOTILLIN-2 and CULLIN-3, which regulate WNT secretion and inhibit WNT/β-catenin signaling, respectively. We also found that PRICKLE1 and LRRK2 localize in signalosomes and act as dual regulators of WNT/PCP and β-catenin signaling. Accordingly, analysis of the function of LRRK2 in vivo, in X. laevis revelaed that LRKK2 not only inhibits WNT/β-catenin pathway, but induces a classical WNT/PCP phenotype in vivo. Our study shows for the first time that LRRK2 activates the WNT

  10. The protective effect of LRRK2 p.R1398H on risk of Parkinson’s disease is independent of MAPT and SNCA variants

    PubMed Central

    Heckman, Michael G.; Elbaz, Alexis; Soto-Ortolaza, Alexandra I.; Serie, Daniel J.; Aasly, Jan O.; Annesi, Grazia; Auburger, Georg; Bacon, Justin A.; Boczarska-Jedynak, Magdalena; Bozi, Maria; Brighina, Laura; Chartier-Harlin, Marie-Christine; Dardiotis, Efthimios; Destée, Alain; Ferrarese, Carlo; Ferraris, Alessandro; Fiske, Brian; Gispert, Suzana; Hadjigeorgiou, Georgios M.; Hattori, Nobutaka; Ioannidis, John P. A.; Jasinska-Myga, Barbara; Jeon, Beom S.; Kim, Yun Joong; Klein, Christine; Kruger, Rejko; Kyratzi, Elli; Lin, Chin-Hsien; Lohmann, Katja; Loriot, Marie-Anne; Lynch, Timothy; Mellick, George D.; Mutez, Eugénie; Opala, Grzegorz; Park, Sung Sup; Petrucci, Simona; Quattrone, Aldo; Sharma, Manu; Silburn, Peter A.; Sohn, Young Ho; Stefanis, Leonidas; Tadic, Vera; Tomiyama, Hiroyuki; Uitti, Ryan J.; Valente, Enza Maria; Vassilatis, Demetrios K.; Vilariño-Güell, Carles; White, Linda R.; Wirdefeldt, Karin; Wszolek, Zbigniew K.; Wu, Ruey-Meei; Xiromerisiou, Georgia; Maraganore, Demetrius M.; Farrer, Matthew J.; Ross, Owen A.

    2013-01-01

    The best validated susceptibility variants for Parkinson’s disease (PD) are located in the alpha-synuclein (SNCA) and microtubule-associated protein tau (MAPT) genes. Recently, a protective p.N551K-R1398H-K1423K haplotype in the leucine-rich repeat kinase 2 (LRRK2) gene was identified, with p.R1398H appearing to be the most likely functional variant. To date, the consistency of the protective effect of LRRK2 p.R1398H across MAPT and SNCA variant genotypes has not been assessed. To address this, we examined four SNCA variants (rs181489, rs356219, rs11931074, rs2583988), the MAPT H1-haplotype defining variant rs1052553, and LRRK2 p.R1398H (rs7133914) in Caucasian (N=10,322) and Asian (N=2,289) series. There was no evidence of an interaction of LRRK2 p.R1398H with MAPT or SNCA variants (all P≥0.10); the protective effect of p.R1398H was observed at similar magnitude across MAPT and SNCA genotypes, and the risk effects of MAPT and SNCA variants were observed consistently for LRRK2 p.R1398H genotypes. Our results indicate that the association of LRRK2 p.R1398H with PD is independent of SNCA and MAPT variants, and vice versa, in Caucasian and Asian populations. PMID:23962496

  11. Novel ethyl methanesulfonate (EMS)-induced null alleles of the Drosophila homolog of LRRK2 reveal a crucial role in endolysosomal functions and autophagy in vivo.

    PubMed

    Dodson, Mark W; Leung, Lok K; Lone, Mohiddin; Lizzio, Michael A; Guo, Ming

    2014-12-01

    Mutations in LRRK2 cause a dominantly inherited form of Parkinson's disease (PD) and are the most common known genetic determinant of PD. Inhibitor-based therapies targeting LRRK2 have emerged as a key therapeutic strategy in PD; thus, understanding the consequences of inhibiting the normal cellular functions of this protein is vital. Despite much interest, the physiological functions of LRRK2 remain unclear. Several recent studies have linked the toxicity caused by overexpression of pathogenic mutant forms of LRRK2 to defects in the endolysosomal and autophagy pathways, raising the question of whether endogenous LRRK2 might play a role in these processes. Here, we report the characterization of multiple novel ethyl methanesulfonate (EMS)-induced nonsense alleles in the Drosophila LRRK2 homolog, lrrk. Using these alleles, we show that lrrk loss-of-function causes striking defects in the endolysosomal and autophagy pathways, including the accumulation of markedly enlarged lysosomes that are laden with undigested contents, consistent with a defect in lysosomal degradation. lrrk loss-of-function also results in the accumulation of autophagosomes, as well as the presence of enlarged early endosomes laden with mono-ubiquitylated cargo proteins, suggesting an additional defect in lysosomal substrate delivery. Interestingly, the lysosomal abnormalities in these lrrk mutants can be suppressed by a constitutively active form of the small GTPase rab9, which promotes retromer-dependent recycling from late endosomes to the Golgi. Collectively, our data provides compelling evidence of a vital role for lrrk in lysosomal function and endolysosomal membrane transport in vivo, and suggests a link between lrrk and retromer-mediated endosomal recycling. © 2014. Published by The Company of Biologists Ltd.

  12. Interplay between Leucine-Rich Repeat Kinase 2 (LRRK2) and p62/SQSTM-1 in Selective Autophagy.

    PubMed

    Park, Sangwook; Han, Seulki; Choi, Insup; Kim, Beomsue; Park, Seung Pyo; Joe, Eun-Hye; Suh, Young Ho

    2016-01-01

    The deposit of polyubiquitinated aggregates has been implicated in the pathophysiology of Parkinson's disease (PD), and growing evidence indicates that selective autophagy plays a critical role in the clearance of ubiquitin-positive protein aggregates by autophagosomes. The selective autophagic receptor p62/SQSTM-1, which associates directly with both ubiquitin and LC3, transports ubiquitin conjugates to autophagosomes for degradation. Leucine-rich repeat kinase 2 (LRRK2), a PD-associated protein kinase, is tightly controlled by autophagy-lysosome degradation as well as by the ubiquitin-proteasome pathway. However, little is known about the degradation of ubiquitinated LRRK2 via selective autophagy. In the present study, we found that p62/SQSTM-1 physically interacts with LRRK2 as a selective autophagic receptor. The overexpression of p62 leads to the robust degradation of LRRK2 through the autophagy-lysosome pathway. In addition, LRRK2 indirectly regulates Ser351 and Ser403 phosphorylation of p62. Of particular interest, the interaction between phosphorylated p62 and Keap1 is reduced by LRRK2 overexpression. Therefore, we propose that the interplay between LRRK2 and p62 may contribute to the pathophysiological function and homeostasis of LRRK2 protein.

  13. Functional and Morphological Correlates in the Drosophila LRRK2 loss-of-function Model of Parkinson’s Disease: Drug Effects of Withania somnifera (Dunal) Administration

    PubMed Central

    Catelani, Tiziano; Setzu, Maria Dolores; Solla, Paolo; Marrosu, Francesco; Sanna, Enrico; Kasture, Sanjay; Acquas, Elio

    2016-01-01

    The common fruit fly Drosophila melanogaster (Dm) is a simple animal species that contributed significantly to the development of neurobiology whose leucine-rich repeat kinase 2 mutants (LRRK2) loss-of-function in the WD40 domain represent a very interesting tool to look into physiopathology of Parkinson’s disease (PD). Accordingly, LRRK2 Dm have also the potential to contribute to reveal innovative therapeutic approaches to its treatment. Withania somnifera Dunal, a plant that grows spontaneously also in Mediterranean regions, is known in folk medicine for its anti-inflammatory and protective properties against neurodegeneration. The aim of this study was to evaluate the neuroprotective effects of its standardized root methanolic extract (Wse) on the LRRK2 loss-of-function Dm model of PD. To this end mutant and wild type (WT) flies were administered Wse, through diet, at different concentrations as larvae and adults (L+/A+) or as adults (L-/A+) only. LRRK2 mutants have a significantly reduced lifespan and compromised motor function and mitochondrial morphology compared to WT flies 1% Wse-enriched diet, administered to Dm LRRK2 as L-/A+and improved a) locomotor activity b) muscle electrophysiological response to stimuli and also c) protected against mitochondria degeneration. In contrast, the administration of Wse to Dm LRRK2 as L+/A+, no matter at which concentration, worsened lifespan and determined the appearance of increased endosomal activity in the thoracic ganglia. These results, while confirming that the LRRK2 loss-of-function in the WD40 domain represents a valid model of PD, reveal that under appropriate concentrations Wse can be usefully employed to counteract some deficits associated with the disease. However, a careful assessment of the risks, likely related to the impaired endosomal activity, is required. PMID:26727265

  14. Disease-specific phenotypes in dopamine neurons from human iPS-based models of genetic and sporadic Parkinson's disease

    PubMed Central

    Sánchez-Danés, Adriana; Richaud-Patin, Yvonne; Carballo-Carbajal, Iria; Jiménez-Delgado, Senda; Caig, Carles; Mora, Sergio; Di Guglielmo, Claudia; Ezquerra, Mario; Patel, Bindiben; Giralt, Albert; Canals, Josep M; Memo, Maurizio; Alberch, Jordi; López-Barneo, José; Vila, Miquel; Cuervo, Ana Maria; Tolosa, Eduard; Consiglio, Antonella; Raya, Angel

    2012-01-01

    Induced pluripotent stem cells (iPSC) offer an unprecedented opportunity to model human disease in relevant cell types, but it is unclear whether they could successfully model age-related diseases such as Parkinson's disease (PD). Here, we generated iPSC lines from seven patients with idiopathic PD (ID-PD), four patients with familial PD associated to the G2019S mutation in the Leucine-Rich Repeat Kinase 2 (LRRK2) gene (LRRK2-PD) and four age- and sex-matched healthy individuals (Ctrl). Over long-time culture, dopaminergic neurons (DAn) differentiated from either ID-PD- or LRRK2-PD-iPSC showed morphological alterations, including reduced numbers of neurites and neurite arborization, as well as accumulation of autophagic vacuoles, which were not evident in DAn differentiated from Ctrl-iPSC. Further induction of autophagy and/or inhibition of lysosomal proteolysis greatly exacerbated the DAn morphological alterations, indicating autophagic compromise in DAn from ID-PD- and LRRK2-PD-iPSC, which we demonstrate occurs at the level of autophagosome clearance. Our study provides an iPSC-based in vitro model that captures the patients' genetic complexity and allows investigation of the pathogenesis of both sporadic and familial PD cases in a disease-relevant cell type. PMID:22407749

  15. Amylin S20G mutation in Mexican population.

    PubMed

    Garcia-Gonzalez, Claudia Lorena; Montoya-Fuentes, Hector; Padilla-Rosas, Miguel; Sanchez-Corona, Jose

    2007-04-01

    Diabetes Mellitus type 2 (DM2) is a group of metabolic disorders characterized by defective insulin action or secretion or both with a 10.6% incidence in Mexican Mestizo population, DM2 is also classified within the localized misfolding diseases due to the amyloid pancreatic deposits found in 90% of the DM2 necropsies. The pancreatic amyloid main component is a protein known as human islet amyloid polypeptide (hIAPP) or amylin, the most common mutation is the S20G in Asian population with a polymorphic frequency in DM2 Asian patients. The aim of this study was to search this mutation in Mexican Mestizo general population (104) and DM2 patients (100). This is the first molecular study of hIAPP gene in Mexican population and in which we developed an alternative more effective antisense primer for the analysis of the NFGAILSS region in hIAPP exon 3 critical for the amyloid beta structure formation. We did not find the mutation in any of the 204 analyzed samples, thus the findings show that S20G is not a common mutation in Mexican Mestizo population.

  16. Lack of association between the LRRK2 A419V variant and Asian Parkinson's disease.

    PubMed

    Gopalai, Aroma Agape; Lim, Shen Yang; Aziz, Zariah Abdul; Lim, Soo Kun; Tan, Li Ping; Chong, Yip Boon; Tan, Chong Tin; Puvanarajah, Santhi; Viswanathan, Shanti; Kuppusamy, Rishikesan; Tan, Ai Huey; Lim, Thien Thien; Eow, Gaik Bee; Norlinah, Mohamed Ibrahim; Li, Hui Hua; Zhao, Yi; Ahmad-Annuar, Azlina

    2013-05-01

    The G2385R and R1628P LRRK2 gene variants have been associated with an increased risk of Parkinson's disease (PD) in the Asian population. Recently, a new LRRK2 gene variant, A419V, was reported to be a third risk variant for PD in Asian patients. Our objective was to investigate this finding in our cohort of Asian subjects. Eight hundred and twenty-eight subjects (404 PD patients, and 424 age and gender-matched control subjects without neurological disorders) were recruited. Genotyping was done by Taqman® allelic discrimination assay on an Applied Biosystems 7500 Fast Real-Time PCR machine. The heterozygous A419V genotype was found in only 1 patient with PD, compared to 3 in the control group (0.4% vs 1.3%), giving an odds ratio of 0.35 (95% confidence interval (CI), 0.01 to 3.79; P = 0.624). A419V is not an important LRRK2 risk variant in our Asian cohort of patients with PD. Our data are further supported by a literature review which showed that 4 out of 6 published studies reported a negative association of this variant in PD.

  17. A direct interaction between leucine-rich repeat kinase 2 and specific β-tubulin isoforms regulates tubulin acetylation.

    PubMed

    Law, Bernard M H; Spain, Victoria A; Leinster, Veronica H L; Chia, Ruth; Beilina, Alexandra; Cho, Hyun J; Taymans, Jean-Marc; Urban, Mary K; Sancho, Rosa M; Blanca Ramírez, Marian; Biskup, Saskia; Baekelandt, Veerle; Cai, Huaibin; Cookson, Mark R; Berwick, Daniel C; Harvey, Kirsten

    2014-01-10

    Mutations in LRRK2, encoding the multifunctional protein leucine-rich repeat kinase 2 (LRRK2), are a common cause of Parkinson disease. LRRK2 has been suggested to influence the cytoskeleton as LRRK2 mutants reduce neurite outgrowth and cause an accumulation of hyperphosphorylated Tau. This might cause alterations in the dynamic instability of microtubules suggested to contribute to the pathogenesis of Parkinson disease. Here, we describe a direct interaction between LRRK2 and β-tubulin. This interaction is conferred by the LRRK2 Roc domain and is disrupted by the familial R1441G mutation and artificial Roc domain mutations that mimic autophosphorylation. LRRK2 selectively interacts with three β-tubulin isoforms: TUBB, TUBB4, and TUBB6, one of which (TUBB4) is mutated in the movement disorder dystonia type 4 (DYT4). Binding specificity is determined by lysine 362 and alanine 364 of β-tubulin. Molecular modeling was used to map the interaction surface to the luminal face of microtubule protofibrils in close proximity to the lysine 40 acetylation site in α-tubulin. This location is predicted to be poorly accessible within mature stabilized microtubules, but exposed in dynamic microtubule populations. Consistent with this finding, endogenous LRRK2 displays a preferential localization to dynamic microtubules within growth cones, rather than adjacent axonal microtubule bundles. This interaction is functionally relevant to microtubule dynamics, as mouse embryonic fibroblasts derived from LRRK2 knock-out mice display increased microtubule acetylation. Taken together, our data shed light on the nature of the LRRK2-tubulin interaction, and indicate that alterations in microtubule stability caused by changes in LRRK2 might contribute to the pathogenesis of Parkinson disease.

  18. Nuclear modifier MTO2 modulates the aminoglycoside-sensitivity of mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae.

    PubMed

    He, Xiangyu; Zhu, Xiaoyu; Wang, Xuexiang; Wang, Wei; Dai, Yu; Yan, Qingfeng

    2013-01-01

    The phenotypic manifestations of mitochondrial DNA (mtDNA) mutations are modulated by mitochondrial DNA haplotypes, nuclear modifier genes and environmental factors. The yeast mitochondrial 15S rRNA C1477G (P(R) or P(R) 454) mutation corresponds to the human 12S rRNA C1494T and A1555G mutations, which are well known as primary factors for aminoglycoside-induced nonsyndromic deafness. Here we report that the deletion of the nuclear modifier gene MTO2 suppressed the aminoglycoside-sensitivity of mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae. First, the strain with a single mtDNA C1477G mutation exhibited hypersensitivity to neomycin. Functional assays indicated that the steady-state transcription level of mitochondrial DNA, the mitochondrial respiratory rate, and the membrane potential decreased significantly after neomycin treatment. The impaired mitochondria could not produce sufficient energy to maintain cell viability. Second, when the mto2 null and the mitochondrial C1477G mutations co-existed (mto2(P(R))), the oxygen consumption rate in the double mutant decreased markedly compared to that of the control strains (MTO2(P(S)), mto2(P(S)) and MTO2(P(R))). The expression levels of the key glycolytic genes HXK2, PFK1 and PYK1 in the mto2(P(R)) strain were stimulated by neomycin and up-regulated by 89%, 112% and 55%, respectively. The enhanced glycolysis compensated for the respiratory energy deficits, and could be inhibited by the glycolytic enzyme inhibitor. Our findings in yeast will provide a new insight into the pathogenesis of human deafness.

  19. Mutations in the GIGYF2 (TNRC15) Gene at the PARK11 Locus in Familial Parkinson Disease

    PubMed Central

    Lautier, Corinne; Goldwurm, Stefano; Dürr, Alexandra; Giovannone, Barbara; Tsiaras, William G.; Pezzoli, Gianni; Brice, Alexis; Smith, Robert J.

    2008-01-01

    The genetic basis for association of the PARK11 region of chromosome 2 with familial Parkinson disease (PD) is unknown. This study examined the GIGYF2 (Grb10-Interacting GYF Protein-2) (TNRC15) gene, which contains the PARK11 microsatellite marker with the highest linkage score (D2S206, LOD 5.14). The 27 coding exons of the GIGYF2 gene were sequenced in 123 Italian and 126 French patients with familial PD, plus 131 Italian and 96 French controls. A total of seven different GIGYF2 missense mutations resulting in single amino acid substitutions were present in 12 unrelated PD index patients (4.8%) and not in controls. Three amino acid insertions or deletions were found in four other index patients and absent in controls. Specific exon sequencing showed that these ten sequence changes were absent from a further 91 controls. In four families with amino acid substitutions in which at least one other PD case was available, the GIGYF2 mutations (Asn56Ser, Thr112Ala, and Asp606Glu) segregated with PD. There were, however, two unaffected carriers in one family, suggesting age-dependent or incomplete penetrance. One index case (PD onset age 33) inherited a GIGYF2 mutation (Ile278Val) from her affected father (PD onset age 66) and a previously described PD-linked mutation in the LRRK2 gene (Ile1371Val) from her affected mother (PD onset age 61). The earlier onset and severe clinical course in the index patient suggest additive effects of the GIGYF2 and LRRK2 mutations. These data strongly support GIGYF2 as a PARK11 gene with a causal role in familial PD. PMID:18358451

  20. Leucine-Rich Repeat Kinase 2 Binds to Neuronal Vesicles through Protein Interactions Mediated by Its C-Terminal WD40 Domain

    PubMed Central

    Piccoli, Giovanni; Onofri, Franco; Cirnaru, Maria Daniela; Kaiser, Christoph J. O.; Jagtap, Pravinkumar; Kastenmüller, Andreas; Pischedda, Francesca; Marte, Antonella; von Zweydorf, Felix; Vogt, Andreas; Giesert, Florian; Pan, Lifeng; Antonucci, Flavia; Kiel, Christina; Zhang, Mingjie; Weinkauf, Sevil; Sattler, Michael; Sala, Carlo; Matteoli, Michela; Ueffing, Marius

    2014-01-01

    Mutations in the leucine-rich repeat kinase 2 gene (LRRK2) are associated with familial and sporadic Parkinson's disease (PD). LRRK2 is a complex protein that consists of multiple domains, including predicted C-terminal WD40 repeats. In this study, we analyzed functional and molecular features conferred by the WD40 domain. Electron microscopic analysis of the purified LRRK2 C-terminal domain revealed doughnut-shaped particles, providing experimental evidence for its WD40 fold. We demonstrate that LRRK2 WD40 binds and sequesters synaptic vesicles via interaction with vesicle-associated proteins. In fact, a domain-based pulldown approach combined with mass spectrometric analysis identified LRRK2 as being part of a highly specific protein network involved in synaptic vesicle trafficking. In addition, we found that a C-terminal sequence variant associated with an increased risk of developing PD, G2385R, correlates with a reduced binding affinity of LRRK2 WD40 to synaptic vesicles. Our data demonstrate a critical role of the WD40 domain within LRRK2 function. PMID:24687852

  1. LRRK2 Mediated Changes in TAU Phosphorylation

    DTIC Science & Technology

    2012-10-01

    DO NOT RETURN YOUR FORM TO THE ABOVE ADDRESS. 1. REPORT DATE 01 October 2012 2. REPORT TYPE Final 3. DATES COVERED 4 April 2011 – 3 September...2012 4 . TITLE AND SUBTITLE 5a. CONTRACT NUMBER LRRK2 Mediated Changes in TAU Phosphorylation 5b. GRANT NUMBER W81XWH-11-1-0338 5c. PROGRAM...Page Introduction…………………………………………………………….………..….. 4 Body………………………………………………………………………………….. 4 Key Research

  2. Small molecule kinase inhibitor LRRK2-IN-1 demonstrates potent activity against colorectal and pancreatic cancer through inhibition of doublecortin-like kinase 1

    PubMed Central

    2014-01-01

    Background Doublecortin-like kinase 1 (DCLK1) is emerging as a tumor specific stem cell marker in colorectal and pancreatic cancer. Previous in vitro and in vivo studies have demonstrated the therapeutic effects of inhibiting DCLK1 with small interfering RNA (siRNA) as well as genetically targeting the DCLK1+ cell for deletion. However, the effects of inhibiting DCLK1 kinase activity have not been studied directly. Therefore, we assessed the effects of inhibiting DCLK1 kinase activity using the novel small molecule kinase inhibitor, LRRK2-IN-1, which demonstrates significant affinity for DCLK1. Results Here we report that LRRK2-IN-1 demonstrates potent anti-cancer activity including inhibition of cancer cell proliferation, migration, and invasion as well as induction of apoptosis and cell cycle arrest. Additionally we found that it regulates stemness, epithelial-mesenchymal transition, and oncogenic targets on the molecular level. Moreover, we show that LRRK2-IN-1 suppresses DCLK1 kinase activity and downstream DCLK1 effector c-MYC, and demonstrate that DCLK1 kinase activity is a significant factor in resistance to LRRK2-IN-1. Conclusions Given DCLK1’s tumor stem cell marker status, a strong understanding of its biological role and interactions in gastrointestinal tumors may lead to discoveries that improve patient outcomes. The results of this study suggest that small molecule inhibitors of DCLK1 kinase should be further investigated as they may hold promise as anti-tumor stem cell drugs. PMID:24885928

  3. Hypothesis: Do miRNAs Targeting the Leucine-Rich Repeat Kinase 2 Gene (LRRK2) Influence Parkinson's Disease Susceptibility?

    PubMed

    Yılmaz, Şenay Görücü; Geyik, Sırma; Neyal, Ayşe Münife; Soko, Nyarai D; Bozkurt, Hakan; Dandara, Collet

    2016-04-01

    Parkinson's disease (PD) is a frequently occurring neurodegenerative motor disorder adversely impacting global health. There is a paucity of biomarkers and diagnostics that can forecast susceptibility to PD. A new research frontier for PD pathophysiology is the study of variations in microRNA (miRNA) expression whereby miRNAs serve as "upstream regulators" of gene expression in relation to functioning of the dopamine neuronal pathways. Leucine-Rich Repeat Kinase 2 (LRRK2) is a frequently studied gene in PD. Little is known about the ways in which expression of miRNAs targeting LRKK2 impact PD susceptibility. In a sample of 204 unrelated subjects (102 persons with PD and 102 healthy controls), we report here candidate miRNA expression in whole blood samples as measured by real-time PCR (hsa-miR-4671-3p, hsa-miR-335-3p, hsa-miR-561-3p, hsa-miR-579-3p, and hsa-miR-3143) that target LRRK2. Using step-wise logistic regression, and controlling for covariates such as age, gender, PD disease severity, concomitant medications, and co-morbidity, we found that the combination of has-miR-335-3p, has-miR-561-3p, and has-miR-579-3p account for 50% of the variation in regards to PD susceptibility (p<0.0001). Notably, the hsa-miR-561-3p expression was the most robust predictor of PD in both univariate and multivariate analyses (p<0.001). Moreover, the biological direction (polarity) of the association was plausible in that the candidate miRNAs displayed a diminished expression in patients. This is consistent with the hypothesis that decreased levels of miRNAs targeting LRRK2 might result in a gain of function for LRRK2, and by extension, loss of neuronal viability. To the best of our knowledge, this is the first clinical association study of the above candidate miRNAs' expression in PD using peripheral samples. These observations may guide future clinical diagnostics research on PD.

  4. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

    PubMed

    Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

    2017-10-01

    Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

  5. Expression, purification and preliminary biochemical and structural characterization of the leucine rich repeat namesake domain of leucine rich repeat kinase 2.

    PubMed

    Vancraenenbroeck, Renée; Lobbestael, Evy; Weeks, Stephen D; Strelkov, Sergei V; Baekelandt, Veerle; Taymans, Jean-Marc; De Maeyer, Marc

    2012-03-01

    Mutations in leucine-rich repeat kinase 2 (LRRK2) are the most common cause of familial Parkinson's disease. Much research effort has been directed towards the catalytic core region of LRRK2 composed of GTPase (ROC, Ras of complex proteins) and kinase domains and a connecting COR (C-terminus of ROC) domain. In contrast, the precise functions of the protein-protein interaction domains, such as the leucine-rich repeat (LRR) domain, are not known. In the present study, we modeled the LRRK2 LRR domain (LRR(LRRK2)) using a template assembly approach, revealing the presence of 14 LRRs. Next, we focused on the expression and purification of LRR(LRRK2) in Escherichia coli. Buffer optimization revealed that the protein requires the presence of a zwitterionic detergent, namely Empigen BB, during solubilization and the subsequent purification and characterization steps. This indicates that the detergent captures the hydrophobic surface patches of LRR(LRRK2) thereby suppressing its aggregation. Circular dichroism (CD) spectroscopy measured 18% α-helices and 21% β-sheets, consistent with predictions from the homology model. Size exclusion chromatography (SEC) and dynamic light scattering measurements showed the presence of a single species, with a Stokes radius corresponding to the model dimensions of a protein monomer. Furthermore, no obvious LRR(LRRK2) multimerization was detected via cross-linking studies. Finally, the LRR(LRRK2) clinical mutations did not influence LRR(LRRK2) secondary, tertiary or quaternary structure as determined via SEC and CD spectroscopy. We therefore conclude that these mutations are likely to affect putative LRR(LRRK2) inter- and intramolecular interactions. Copyright © 2011 Elsevier B.V. All rights reserved.

  6. Corin mutations K317E and S472G from preeclamptic patients alter zymogen activation and cell surface targeting. [Corrected].

    PubMed

    Dong, Ningzheng; Zhou, Tiantian; Zhang, Yue; Liu, Meng; Li, Hui; Huang, Xiaoyi; Liu, Zhenzhen; Wu, Yi; Fukuda, Koichi; Qin, Jun; Wu, Qingyu

    2014-06-20

    Corin is a membrane-bound serine protease that acts as the atrial natriuretic peptide (ANP) convertase in the heart. Recent studies show that corin also activates ANP in the pregnant uterus to promote spiral artery remodeling and prevent pregnancy-induced hypertension. Two CORIN gene mutations, K317E and S472G, were identified in preeclamptic patients and shown to have reduced activity in vitro. In this study, we carried out molecular modeling and biochemical experiments to understand how these mutations impair corin function. By molecular modeling, the mutation K317E was predicted to alter corin LDL receptor-2 module conformation. Western blot analysis of K317E mutant in HEK293 cells showed that the mutation did not block corin expression on the cell surface but inhibited corin zymogen activation. In contrast, the mutation S472G was predicted to abolish a β-sheet critical for corin frizzled-2 module structure. In Western blot analysis and flow cytometry, S472G mutant was not detected on the cell surface in transfected HEK293 cells. By immunostaining, the S472G mutant was found in the ER, indicating that the mutation S472G disrupted the β-sheet, causing corin misfolding and ER retention. Thus, these results show that mutations in the CORIN gene may impair corin function by entirely different mechanisms. Together, our data provide important insights into the molecular basis underlying corin mutations that may contribute to preeclampsia in patients. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. Inflexible ethanol intake: A putative link with the Lrrk2 pathway.

    PubMed

    da Silva E Silva, Daniel Almeida; Frozino Ribeiro, Andrea; Damasceno, Samara; Rocha, Cristiane S; Berenguer de Matos, Alexandre H; Boerngen-Lacerda, Roseli; Correia, Diego; Brunialti Godard, Ana Lúcia

    2016-10-15

    Alcoholism is a complex multifactorial disorder with a strong genetic influence. Although several studies have shown the impact of high ethanol intake on the striatal gene expression, few have addressed the relationship between the patterns of gene expression underlying the compulsive behaviour associated with the two major concerns in addiction: the excessive drug consumption and relapsing. In this study, we used a chronic three-bottle free-choice murine model to address striatal transcript regulation among animals with different ethanol intakes and preferences: Light Drinkers (preference for water throughout the experiment), Heavy Drinkers (preference for ethanol with a non-compulsive intake) and Inflexible Drinkers (preference for ethanol and simultaneous loss of control over the drug intake). Our aim was to correlate the intake patterns observed in this model with gene expression changes in the striatum, a brain region critical for the development of alcohol addiction. We found that the transcripts of the Lrrk2 gene, which encodes a multifunctional protein with kinase and GTPase activities, is upregulated only in Inflexible Drinkers suggesting, for the first time, that the Lrrk2 pathway plays a major role in the compulsive ethanol intake behaviour of addicted subjects. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Leucine-Rich Repeat Kinase 2 interacts with Parkin, DJ-1 and PINK-1 in a Drosophila melanogaster model of Parkinson's disease.

    PubMed

    Venderova, Katerina; Kabbach, Ghassan; Abdel-Messih, Elizabeth; Zhang, Yi; Parks, Robin J; Imai, Yuzuru; Gehrke, Stephan; Ngsee, Johnny; Lavoie, Matthew J; Slack, Ruth S; Rao, Yong; Zhang, Zhuohua; Lu, Bingwei; Haque, M Emdadul; Park, David S

    2009-11-15

    Mutations in the LRRK2 gene are the most common genetic cause of familial Parkinson's disease (PD). However, its physiological and pathological functions are unknown. Therefore, we generated several independent Drosophila lines carrying WT or mutant human LRRK2 (mutations in kinase, COR or LRR domains, resp.). Ectopic expression of WT or mutant LRRK2 in dopaminergic neurons caused their significant loss accompanied by complex age-dependent changes in locomotor activity. Overall, the ubiquitous expression of LRRK2 increased lifespan and fertility of the flies. However, these flies were more sensitive to rotenone. LRRK2 expression in the eye exacerbated retinal degeneration. Importantly, in double transgenic flies, various indices of the eye and dopaminergic survival were modified in a complex fashion by a concomitant expression of PINK1, DJ-1 or Parkin. This evidence suggests a genetic interaction between these PD-relevant genes.

  9. Disease-Causing Mutations in the G Protein Gαs Subvert the Roles of GDP and GTP.

    PubMed

    Hu, Qi; Shokat, Kevan M

    2018-05-17

    The single most frequent cancer-causing mutation across all heterotrimeric G proteins is R201C in Gαs. The current model explaining the gain-of-function activity of the R201 mutations is through the loss of GTPase activity and resulting inability to switch off to the GDP state. Here, we find that the R201C mutation can bypass the need for GTP binding by directly activating GDP-bound Gαs through stabilization of an intramolecular hydrogen bond network. Having found that a gain-of-function mutation can convert GDP into an activator, we postulated that a reciprocal mutation might disrupt the normal role of GTP. Indeed, we found R228C, a loss-of-function mutation in Gαs that causes pseudohypoparathyroidism type 1a (PHP-Ia), compromised the adenylyl cyclase-activating activity of Gαs bound to a non-hydrolyzable GTP analog. These findings show that disease-causing mutations in Gαs can subvert the canonical roles of GDP and GTP, providing new insights into the regulation mechanism of G proteins. Copyright © 2018 Elsevier Inc. All rights reserved.

  10. The novel Tau mutation G335S: clinical, neuropathological and molecular characterization.

    PubMed

    Spina, Salvatore; Murrell, Jill R; Yoshida, Hirotaka; Ghetti, Bernardino; Bermingham, Niamh; Sweeney, Brian; Dlouhy, Stephen R; Crowther, R Anthony; Goedert, Michel; Keohane, Catherine

    2007-04-01

    Mutations in Tau cause the inherited neurodegenerative disease, frontotemporal dementia and Parkinsonism linked to chromosome 17 (FTDP-17). Known coding region mutations cluster in the microtubule-binding region, where they alter the ability of tau to promote microtubule assembly. Depending on the tau isoforms, this region consists of three or four imperfect repeats of 31 or 32 amino acids, each of which contains a characteristic and invariant PGGG motif. Here, we report the novel G335S mutation, which changes the PGGG motif of the third tau repeat to PGGS, in an individual who developed social withdrawal, emotional bluntness and stereotypic behavior at age 22, followed by disinhibition, hyperorality and ideomotor apraxia. Abundant tau-positive inclusions were present in neurons and glia in the frontotemporal cortex, hippocampus and brainstem. Sarkosyl-insoluble tau showed paired helical and straight filaments, as well as more irregular rope-like filaments. The pattern of pathological tau bands was like that of Alzheimer disease. Experimentally, the G335S mutation resulted in a greatly reduced ability of tau to promote microtubule assembly, while having no significant effect on heparin-induced assembly of recombinant tau into filaments.

  11. Mechanistic study on the nuclear modifier gene MSS1 mutation suppressing neomycin sensitivity of the mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae.

    PubMed

    Zhou, Qiyin; Wang, Wei; He, Xiangyu; Zhu, Xiaoyu; Shen, Yaoyao; Yu, Zhe; Wang, Xuexiang; Qi, Xuchen; Zhang, Xuan; Fan, Mingjie; Dai, Yu; Yang, Shuxu; Yan, Qingfeng

    2014-01-01

    The phenotypic manifestation of mitochondrial DNA (mtDNA) mutations can be modulated by nuclear genes and environmental factors. However, neither the interaction among these factors nor their underlying mechanisms are well understood. The yeast Saccharomyces cerevisiae mtDNA 15S rRNA C1477G mutation (PR) corresponds to the human 12S rRNA A1555G mutation. Here we report that a nuclear modifier gene mss1 mutation suppresses the neomycin-sensitivity phenotype of a yeast C1477G mutant in fermentable YPD medium. Functional assays show that the mitochondrial function of the yeast C1477G mutant was impaired severely in YPD medium with neomycin. Moreover, the mss1 mutation led to a significant increase in the steady-state level of HAP5 (heme activated protein), which greatly up-regulated the expression of glycolytic transcription factors RAP1, GCR1, and GCR2 and thus stimulated glycolysis. Furthermore, the high expression of the key glycolytic enzyme genes HXK2, PFK1 and PYK1 indicated that enhanced glycolysis not only compensated for the ATP reduction from oxidative phosphorylation (OXPHOS) in mitochondria, but also ensured the growth of the mss1(PR) mutant in YPD medium with neomycin. This study advances our understanding of the phenotypic manifestation of mtDNA mutations.

  12. An activating G{sub s}{alpha} mutation is present in fibrous dysplasia of bone in the McCune-Albright syndrome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shenker, A.; Weinstein, L.S.; Spiegel, A.M.

    1994-09-01

    McCune-Albright syndrome (MAS) is a sporadic disease characterized by polyostotic fibrous dysplasia, cafe-au-lait spots, and multiple endocrinopathies. The etiology of fibrous dysplasia is unknown. Activating mutations of codon 201 in the gene encoding the {alpha}-subunit of G{sub s}, the G-protein that stimulates adenylyl cyclase, have been found in all affected MAS tissues that have been studied. Initial attempts to amplify DNA from decalcified paraffin-embedded bone specimens from frozen surgical bone specimens from five MAS patients using polymerase chain reaction and allele-specific oligonucleotide hybridization. Most of the cells in four specimens of dysplastic bone contained a heterozygous mutation encoding substitution ofmore » Arg{sup 201} of G{sub s}{alpha} with His, but the mutation was barely detectable in peripheral blood specimens from the patients. Only a small amount of mutant allele was detected in a specimen of normal cortical bone from the fifth patient, although this patients had a high proportion of mutation in other, affected tissues. The mosaic distribution of mutant alleles is consistent with an embryological somatic cell mutation of the G{sub s}{alpha} gene in MAS. The presence of an activating mutation of G{sub s}{alpha} in osteoblastic progenitor cells may cause them to exhibit increased proliferation and abnormal differentiation, thereby producing the lesions of fibrous dysplasia. 43 refs., 2 figs.« less

  13. Expression of G(alpha)(s) proteins and TSH receptor signalling in hyperfunctioning thyroid nodules with TSH receptor mutations.

    PubMed

    Holzapfel, Hans-Peter; Bergner, Beate; Wonerow, Peter; Paschke, Ralf

    2002-07-01

    Constitutively activating mutations of the thyrotrophin receptor (TSHR) are the main molecular cause of hyperfunctioning thyroid nodules (HTNs). The G protein coupling is an important and critical step in the TSHR signalling which mainly includes G(alpha)(s), G(alpha)(i) and G(alpha)(q)/11 proteins. We investigated the in vitro consequences of overexpressing G(alpha) proteins on signalling of the wild-type (WT) or mutated TSHR. Moreover, we investigated whether changes in G(alpha) protein expression are pathophysiologically relevant in HTNs or cold thyroid nodules (CTNs). Wild-type TSH receptor and mutated TSH receptors were coexpressed with G(alpha)(s), G(alpha)(i) or G(alpha)(q)/11, and cAMP and inositol phosphate (IP) production was measured after stimulation with TSH. The expression of G(alpha)(s), G(alpha)(i) and G(alpha)(q)/11 proteins was examined by Western blotting in 28 HTNs and 14 CTNs. Coexpression of G(alpha)(s) with the WT TSH receptor in COS 7 cells significantly increased the basal and TSH-stimulated cAMP accumulation while coexpression of the G(alpha)(q) or G(alpha)11 protein significantly increased the production of cAMP and inositol triphosphate (IP(3)). The coexpression of the TSH receptor mutants (I486F, DEL613-621), known to couple constitutively to G(alpha)(s) and G(alpha)(q) with G(alpha)(s) and G(alpha)(q)/11, significantly increased the basal and stimulated cAMP and IP(3) accumulation. Coexpression of the TSH receptor mutant V556F with G(alpha)(s) only increased the basal and stimulated cAMP production while its coexpression with G(alpha)(q)/11 increased the basal and stimulated IP(3) signalling. The expression of G(alpha)(s) protein subunits determined by Western blotting was significantly decreased in 14 HTNs with a constitutively activating TSH receptor mutation in comparison with the corresponding surrounding tissue, while in 14 HTNs without TSH receptor or G(alpha)(s) protein mutation and in 14 CTNs the expression of G(alpha)(s

  14. Acquired resistance to an epidermal growth factor receptor-tyrosine kinase inhibitor (EGFR-TKI) in an uncommon G719S EGFR mutation.

    PubMed

    Osoegawa, Atsushi; Hashimoto, Takafumi; Takumi, Yohei; Abe, Miyuki; Yamada, Tomonori; Kobayashi, Ryoji; Miyawaki, Michiyo; Takeuchi, Hideya; Okamoto, Tatsuro; Sugio, Kenji

    2018-03-28

    Background Acquired resistance (AR) to an epidermal growth factor receptor-tyrosine kinase inhibitor (EGFR-TKI) is a common event, and several underlying mechanisms, including T790 M, MET amplification and PTEN downregulation, have been reported for the common EGFR mutations. EGFR G719X is an uncommon mutation that has been reported to show sensitivity to EGFR-TKIs. However, no established cell lines harboring the EGFR G719X have been reported in the literature. Materials and Methods G719S-GR cells were established from malignant pleural effusion of a patient whose tumor developed AR from gefitinib treatment. G719S-GR cells were then genotyped and tested for drug sensitivities. Multiplex ligation-dependent probe amplification (MLPA) was used to compare the clinical tumor samples with G719S-GR. Results G719S-GR cells were resistant to EGFR-TKIs with an LC50 of around 10 μM. A genomic analysis showed that G719S-GR cells harbor the EGFR G719S mutation as well as the amplification of EGFR locus. The homozygous deletion of CDKN2A and the loss of PTEN and TSC1 were also detected. On comparing the copy number of tumor suppressor genes using MLPA, G719S-GR cells were found to lack one copy of PTEN, which was not observed in a tumor obtained before gefitinib treatment. Loss of PTEN may result in AKT activation. The mTORC1/2 inhibitor Torin-1 was able to inhibit the downstream signaling when combined with osimertinib. Discussion The newly established G719S-GR cell line may be useful for investigating the mechanism underlying the development of AR in the G719X mutation; the loss of PTEN may be one such mechanism.

  15. In vivo levels of S-adenosylmethionine modulate C:G to T:A mutations associated with repeat-induced point mutation in Neurospora crassa.

    PubMed

    Rosa, Alberto Luis; Folco, Hernán Diego; Mautino, Mario Ricardo

    2004-04-14

    In Neurospora crassa, the mutagenic process termed repeat-induced point mutation (RIP) inactivates duplicated DNA sequences during the sexual cycle by the introduction of C:G to T:A transition mutations. In this work, we have used a collection of N. crassa strains exhibiting a wide range of cellular levels of S-adenosylmethionine (AdoMet), the universal donor of methyl groups, to explore whether frequencies of RIP are dependent on the cellular levels of this metabolite. Mutant strains met-7 and eth-1 carry mutations in genes of the AdoMet pathway and have low levels of AdoMet. Wild type strains with high levels of AdoMet were constructed by introducing a chimeric transgene of the AdoMet synthetase (AdoMet-S) gene fused to the constitutive promoter trpC from Aspergillus nidulans. Crosses of these strains against tester duplications of the pan-2 and am genes showed that frequencies of RIP, as well as the total number of C:G to T:A transition mutations found in randomly selected am(RIP) alleles, are inversely correlated to the cellular level of AdoMet. These results indicate that AdoMet modulates the biochemical pathway leading to RIP.

  16. Emergence of novel and dominant acquired EGFR solvent-front mutations at Gly796 (G796S/R) together with C797S/R and L792F/H mutations in one EGFR (L858R/T790M) NSCLC patient who progressed on osimertinib.

    PubMed

    Ou, Sai-Hong Ignatius; Cui, Jean; Schrock, Alexa B; Goldberg, Michael E; Zhu, Viola W; Albacker, Lee; Stephens, Philip J; Miller, Vincent A; Ali, Siraj M

    2017-06-01

    Acquired epidermal growth factor receptor (EGFR) resistance mutations to osimertinib are common, including the EGFR C797S that abolishes the covalent binding of osimertinib to EGFR. Here we report the emergence of novel EGFR solvent front mutations at Gly796 (G796S/R) in addition to a hinge pocket L792F/H mutations, and C797S/G all in cis with T790M in a single patient on progression on osimertinib as detected by plasma circulating tumor DNA (ctDNA) assay in the course of clinical care. A 69-year-old Caucasian female former light-smoker presented with stage IV EGFR L858R positive adenocarcinoma who developed EGFR T790M mutation after 8 month treatment of erlotinib. The patient was initiated on osimertinib with disease shrinkage after 2 months, but tumor regrowth was observed after 5 months of osimertinib treatment. Assay of plasma ctDNA at this time revealed these different secondary resistance mutations all in trans with each other including distinct mutations at the same codon producing different amino acid changes: G796S/R (mutant allele frequency [MAF]; 14.4%), C797S/G (MAF: 2.26%), L792F/H (MAF: 0.36%), and V802F (MAF: 0.40%), in addition to the pre-existing L858R (MAF:17.9%) and T790M (MAF:18.2%) but all in cis with T790M. The G796S/R mutations are homologous with known reported solvent front mutations in ALK G1202R, ROS1 G2032R, TrkA G595R and TrkC G623R, all of which are associated with acquired resistance to type I TKIs. In silico modeling revealed mutation at G796 interferes with osimertinib binding to the EGFR kinase domain at the phenyl aromatic ring position as this residue forms a narrow "hydrophobic sandwich" with L718, while L792F/H mutation interferes with osimertinib binding at the methoxyl group on the phenyl ring. Multiple resistance mutations at differing allele frequencies including novel EGFR solvent front mutations can emerge in a single patient with progression on osimertinib potentially due to tumor hetereogeneity and definitely present a

  17. THE GIGAELECTRONVOLT COUNTERPART OF VER J2019+407 IN THE NORTHERN SHELL OF THE SUPERNOVA REMNANT G78.2+2.1 ( γ Cygni)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fraija, N.; Araya, M., E-mail: nifraija@astro.unam.mx, E-mail: miguel.araya@ucr.ac.cr

    2016-07-20

    Analysis of gamma-ray emission from the supernova remnant G78.2+2.1 ( γ Cygni) with 7.2 years of cumulative data from the Fermi Large Area Telescope shows a distinct hard, bright, and extended component to the north of the shell coincident with the known teraelectronvolt source VER J2019+407. In the gigaelectronvolt to teraelectronvolt (GeV–TeV) energy range, its spectrum is best described by a broken power law with indices 1.8 below a break energy of 71 GeV and 2.5 above the break. A broadband spectral energy distribution is assembled, and different scenarios for the origin of the gamma rays are explored. Both hadronicmore » and leptonic mechanisms are able to account for the GeV–TeV observations. In the leptonic framework, a superposition of inverse Compton and nonthermal bremsstrahlung emissions is needed, whereas the hadronic scenario requires a cosmic-ray population described by a broken power-law distribution with a relatively hard spectral index of ∼1.8 below a break particle energy of 0.45 TeV. In addition, the neutrino flux expected from cosmic-ray interactions is calculated.« less

  18. 7 CFR 201.9 - Kind.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 3 2012-01-01 2012-01-01 false Kind. 201.9 Section 201.9 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) FEDERAL SEED ACT FEDERAL SEED ACT REGULATIONS Labeling Agricultural Seeds § 201.9 Kind. The...

  19. 7 CFR 201.9 - Kind.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 3 2011-01-01 2011-01-01 false Kind. 201.9 Section 201.9 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) FEDERAL SEED ACT FEDERAL SEED ACT REGULATIONS Labeling Agricultural Seeds § 201.9 Kind. The...

  20. 7 CFR 201.9 - Kind.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 3 2014-01-01 2014-01-01 false Kind. 201.9 Section 201.9 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) FEDERAL SEED ACT FEDERAL SEED ACT REGULATIONS Labeling Agricultural Seeds § 201.9 Kind. The...

  1. 7 CFR 201.9 - Kind.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Kind. 201.9 Section 201.9 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) FEDERAL SEED ACT FEDERAL SEED ACT REGULATIONS Labeling Agricultural Seeds § 201.9 Kind. The...

  2. 7 CFR 201.9 - Kind.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 3 2013-01-01 2013-01-01 false Kind. 201.9 Section 201.9 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) FEDERAL SEED ACT FEDERAL SEED ACT REGULATIONS Labeling Agricultural Seeds § 201.9 Kind. The...

  3. Language Deficits as a Preclinical Window into Parkinson's Disease: Evidence from Asymptomatic Parkin and Dardarin Mutation Carriers.

    PubMed

    García, Adolfo M; Sedeño, Lucas; Trujillo, Natalia; Bocanegra, Yamile; Gomez, Diana; Pineda, David; Villegas, Andrés; Muñoz, Edinson; Arias, William; Ibáñez, Agustín

    2017-02-01

    The worldwide spread of Parkinson's disease (PD) calls for sensitive and specific measures enabling its early (or, ideally, preclinical) detection. Here, we use language measures revealing deficits in PD to explore whether similar disturbances are present in asymptomatic individuals at risk for the disease. We administered executive, semantic, verb-production, and syntactic tasks to sporadic PD patients, genetic PD patients with PARK2 (parkin) or LRRK2 (dardarin) mutation, asymptomatic first-degree relatives of the latter with similar mutations, and socio-demographically matched controls. Moreover, to detect sui generis language disturbances, we ran analysis of covariance tests using executive functions as covariate. The two clinical groups showed impairments in all measures, most of which survived covariation with executive functions. However, the key finding concerned asymptomatic mutation carriers. While these subjects showed intact executive, semantic, and action-verb production skills, they evinced deficits in a syntactic test with minimal working memory load. We propose that this sui generis disturbance may constitute a prodromal sign anticipating eventual development of PD. Moreover, our results suggest that mutations on specific genes (PARK2 and LRRK2) compromising basal ganglia functioning may be subtly related to language-processing mechanisms. (JINS, 2017, 23, 150-158).

  4. Baseline genetic associations in the Parkinson's Progression Markers Initiative (PPMI).

    PubMed

    Nalls, Mike A; Keller, Margaux F; Hernandez, Dena G; Chen, Lan; Stone, David J; Singleton, Andrew B

    2016-01-01

    The Parkinson's Progression Marker Initiative is an international multicenter study whose main goal is investigating markers for Parkinson's disease (PD) progression as part of a path to a treatment for the disease. This manuscript describes the baseline genetic architecture of this study, providing not only a catalog of disease-linked variants and mutations, but also quantitative measures with which to adjust for population structure. Three hundred eighty-three newly diagnosed typical PD cases, 65 atypical PD and 178 healthy controls, from the Parkinson's Progression Marker Initiative study have been genotyped on the NeuroX or Immunochip arrays. These data are freely available to all researchers interested in pursuing PD research within the Parkinson's Progression Marker Initiative. The Parkinson's Progression Marker Initiative represents a study population with low genetic heterogeneity. We recapitulate known PD associations from large-scale genome-wide association studies and refine genetic risk score models for PD predictability (area under the curve, ∼0.74). We show the presence of six LRRK2 p.G2019S and nine GBA p.N370S mutation carriers. The Parkinson's Progression Marker Initiative study and its genetic data are useful in studies of PD biomarkers. The genetic architecture described here will be useful in the analysis of myriad biological and clinical traits within this study. © 2015 International Parkinson and Movement Disorder Society.

  5. AWEA WINDPOWER 2019 Conference & Exhibition

    Science.gov Websites

    than go through menu items. Book a Booth Learn Exhibit Sponsor Register AWEA Wind Power May 20-23 2019 . Book Your Booth Sponsor Sponsoring AWEA WINDPOWER 2019 gives you the opportunity to broadcast your

  6. 40 CFR 52.1992-52.2019 - [Reserved

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 4 2014-07-01 2014-07-01 false [Reserved] 52.1992-52.2019 Section 52.1992-52.2019 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) APPROVAL AND PROMULGATION OF IMPLEMENTATION PLANS (CONTINUED) Oregon §§ 52.1992-52.2019 [Reserved] ...

  7. Prevalence of 2314delG mutation in Spanish patients with Usher syndrome type II (USH2).

    PubMed

    Beneyto, M M; Cuevas, J M; Millán, J M; Espinós, C; Mateu, E; González-Cabo, P; Baiget, M; Doménech, M; Bernal, S; Ayuso, C; García-Sandoval, B; Trujillo, M J; Borrego, S; Antiñolo, G; Carballo, M; Nájera, C

    2000-06-01

    The Usher syndrome (USH) is a group of autosomal recessive diseases characterized by congenital sensorineural hearing loss and retinitis pigmentosa. Three clinically distinct forms of Usher syndrome have so far been recognized and can be distinguished from one another by assessing auditory and vestibular function. Usher syndrome type II (USH2) patients have congenital moderate-to-severe nonprogressive hearing loss, retinitis pigmentosa, and normal vestibular function. Genetic linkage studies have revealed genetic heterogeneity among the three types of USH, with the majority of USH2 families showing linkage to the USH2A locus in 1q41. The USH2A gene (MIM 276901) has been identified: three mutations, 2314delG, 2913delG, and 4353-54delC, were initially reported in USH2A patients, the most frequent of which is the 2314delG mutation. It has been reported that this mutation can give rise to typical and atypical USH2 phenotypes. USH2 cases represent 62% of all USH cases in the Spanish population, and 95% of these cases have provided evidence of linkage to the USH2A locus. In the present study, the three reported mutations were analyzed in 59 Spanish families with a diagnosis of USH type II. The 2314delG was the only mutation identified in our population: it was detected in 25% of families and 16% of USH2 chromosomes analyzed. This study attempts to estimate the prevalence of this common mutation in a homogeneous Spanish population.

  8. Herpes Simplex Virus Type 2 Glycoprotein G-Negative Clinical Isolates Are Generated by Single Frameshift Mutations

    PubMed Central

    Liljeqvist, Jan-Åke; Svennerholm, Bo; Bergström, Tomas

    1999-01-01

    Herpes simplex virus (HSV) codes for several envelope glycoproteins, including glycoprotein G-2 (gG-2) of HSV type 2 (HSV-2), which are dispensable for replication in cell culture. However, clinical isolates which are deficient in such proteins occur rarely. We describe here five clinical HSV-2 isolates which were found to be unreactive to a panel of anti-gG-2 monoclonal antibodies and therefore considered phenotypically gG-2 negative. These isolates were further examined for expression of the secreted amino-terminal and cell-associated carboxy-terminal portions of gG-2 by immunoblotting and radioimmunoprecipitation. The gG-2 gene was completely inactivated in four isolates, with no expression of the two protein products. For one isolate a normally produced secreted portion and a truncated carboxy-terminal portion of gG-2 were detected in virus-infected cell medium. Sequencing of the complete gG-2 gene identified a single insertion or deletion of guanine or cytosine nucleotides in all five strains, resulting in a premature termination codon. The frameshift mutations were localized within runs of five or more guanine or cytosine nucleotides and were dispersed throughout the gene. For the isolate for which a partially inactivated gG-2 gene was detected, the frameshift mutation was localized upstream of but adjacent to the nucleotides coding for the transmembranous region. Thus, this study demonstrates the existence of clinical HSV-2 isolates which do not express an envelope glycoprotein and identifies the underlying molecular mechanism to be a single frameshift mutation. PMID:10559290

  9. Mutational Analysis of the Adaptor Protein 2 Sigma Subunit (AP2S1) Gene: Search for Autosomal Dominant Hypocalcemia Type 3 (ADH3)

    PubMed Central

    Rogers, Angela; Nesbit, M. Andrew; Hannan, Fadil M.; Howles, Sarah A.; Gorvin, Caroline M.; Cranston, Treena; Allgrove, Jeremy; Bevan, John S.; Bano, Gul; Brain, Caroline; Datta, Vipan; Grossman, Ashley B.; Hodgson, Shirley V.; Izatt, Louise; Millar-Jones, Lynne; Pearce, Simon H.; Robertson, Lisa; Selby, Peter L.; Shine, Brian; Snape, Katie; Warner, Justin

    2014-01-01

    Context: Autosomal dominant hypocalcemia (ADH) types 1 and 2 are due to calcium-sensing receptor (CASR) and G-protein subunit-α11 (GNA11) gain-of-function mutations, respectively, whereas CASR and GNA11 loss-of-function mutations result in familial hypocalciuric hypercalcemia (FHH) types 1 and 2, respectively. Loss-of-function mutations of adaptor protein-2 sigma subunit (AP2σ 2), encoded by AP2S1, cause FHH3, and we therefore sought for gain-of-function AP2S1 mutations that may cause an additional form of ADH, which we designated ADH3. Objective: The objective of the study was to investigate the hypothesis that gain-of-function AP2S1 mutations may cause ADH3. Design: The sample size required for the detection of at least one mutation with a greater than 95% likelihood was determined by binomial probability analysis. Nineteen patients (including six familial cases) with hypocalcemia in association with low or normal serum PTH concentrations, consistent with ADH, but who did not have CASR or GNA11 mutations, were ascertained. Leukocyte DNA was used for sequence and copy number variation analysis of AP2S1. Results: Binomial probability analysis, using the assumption that AP2S1 mutations would occur in hypocalcemic patients at a prevalence of 20%, which is observed in FHH patients without CASR or GNA11 mutations, indicated that the likelihood of detecting at least one AP2S1 mutation was greater than 95% and greater than 98% in sample sizes of 14 and 19 hypocalcemic patients, respectively. AP2S1 mutations and copy number variations were not detected in the 19 hypocalcemic patients. Conclusion: The absence of AP2S1 abnormalities in hypocalcemic patients, suggests that ADH3 may not occur or otherwise represents a rare hypocalcemic disorder. PMID:24708097

  10. Structural signature of the G719S-T790M double mutation in the EGFR kinase domain and its response to inhibitors

    PubMed Central

    C., George Priya Doss; B., Rajith; Chakraborty, Chiranjib; N., NagaSundaram; Ali, Shabana Kouser; Zhu, Hailong

    2014-01-01

    Some individuals with non-small-cell lung cancer (NSCLC) benefit from therapies targeting epidermal growth factor receptor (EGFR), and the characterization of a new mechanism of resistance to the EGFR-specific antibody gefitinib will provide valuable insight into how therapeutic strategies might be designed to overcome this particular resistance mechanism. The G719S and T790M mutations and their combination were involved in causing different conformational redistribution of EGFR. In the present computational study, we analyzed the impact and structural influence of G719S/T790M double mutation (DM) in EGFR with ligand (gefitinib) through molecular dynamic simulation (50 ns) and docking analysis. We observed the escalation in distance between the functional loop and activation loop with respect to T790M mutation compared to the G719S mutation. Furthermore, we confirmed that the G719S mutation causes the ligand to move closer to the hinge region, whereas T790M makes the ligand escape from the binding pocket. Obtained results provide with an explanation for the resistance induced by T790M and a vital clue for the design of drugs to combat gefitinib resistance. PMID:25091415

  11. Proteomics screen to reveal molecular changes mediated by C722G missense mutation in CHRM2 gene.

    PubMed

    Hou, Dongyan; Chen, Ying; Liu, Jiamei; Xu, Lin; Zhang, Zhiyong; Zhang, Juan; Wang, Hua; Wang, Xin; Chen, Jin; Zhao, Rongrui; Hu, Aihua; Hakonarson, Hakon; Zhang, Lin; Shen, Yan

    2013-08-26

    Previously, we reported a missense mutation (C722G) in the M2-muscarinic acetylcholine receptor (CHRM2) gene associated with familial dilated cardiomyopathy. However, the exact molecular mechanisms by the related protein changes of CHRM2-C722G mutation induced are still unclear. CHRM2 and CHRM2-C722G lentiviral vector was infected to CHO cells. Proteomic analysis by label-free shotgun strategy and the STRING 9.0 software were performed. A total of 102 proteins with at least 2-fold change in the CHRM2-C722G group were identified, 42 proteins were up-regulated, whereas 57 were down-regulated. These altered proteins belong to three broad functional categories: (i) metabolic (e.g. Cytosolic acyl coenzyme A thioester hydrolase, Malate dehydrogenase); (ii) cytoskeletal (e.g. Actin-related protein, Myosin light polypeptide 6 and Alpha-actinin-1) and (iii) stress response (e.g. heat shock protein 70, Ras-related protein Rab-10). Interestingly, the marked differences in the expression of selected eight proteins (change >4.0-fold), were connected with many proteins related to apoptosis and immune/inflammatory response such as: FOS, BAX, MYC, TP53 and IL6. This novel study demonstrated for the first time a full-scale screening of the proteomics research by CHRM2-C722G mutation and profiled 102 changed proteins, of which, eight might be critical in cardiac dysfunction for future mapping. It was a full-scale screening of the proteomics research by CHRM2-C722G mutation. These proteins might serve as valuable biomarkers that could predict the presence of a precursor field. These proteins might serve to further explore the pathophysiological mechanisms in familial DCM patients with C176W mutation. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. Investigation of C9orf72 in 4 Neurodegenerative Disorders

    PubMed Central

    Xi, Zhengrui; Zinman, Lorne; Grinberg, Yakov; Moreno, Danielle; Sato, Christine; Bilbao, Juan M.; Ghani, Mahdi; Hernández, Isabel; Ruiz, Agustín; Boada, Mercè; Morón, Francisco J.; Lang, Anthony E.; Marras, Connie; Bruni, Amalia; Colao, Rosanna; Maletta, Raffaele G.; Puccio, Gianfranco; Rainero, Innocenzo; Pinessi, Lorenzo; Galimberti, Daniela; Morrison, Karen E.; Moorby, Catriona; Stockton, Joanne D.; Masellis, Mario; Black, Sandra E.; Hazrati, Lili-Naz; Liang, Yan; van Haersma de With, Jan; Fornazzari, Luis; Villagra, Roque; Rojas-Garcia, Ricardo; Clarimón, Jordi; Mayeux, Richard; Robertson, Janice; St George-Hyslop, Peter; Rogaeva, Ekaterina

    2014-01-01

    Objective To estimate the allele frequency of C9orf72 (G4C2) repeats in amyotrophic lateral sclerosis (ALS), frontotemporal lobar degeneration (FTLD), Alzheimer disease (AD), and Parkinson disease (PD). Design The number of repeats was estimated by a 2-step genotyping strategy. For expansion carriers, we sequenced the repeat flanking regions and obtained APOE genotypes and MAPT H1/H2 haplotypes. Setting Hospitals specializing in neurodegenerative disorders. Subjects We analyzed 520 patients with FTLD, 389 patients with ALS, 424 patients with AD, 289 patients with PD, 602 controls, 18 families, and 29 patients with PD with the LRRK2 G2019S mutation. Main Outcome Measure The expansion frequency. Results Based on a prior cutoff (>30 repeats), the expansion was detected in 9.3% of patients with ALS, 5.2% of patients with FTLD, and 0.7% of patients with PD but not in controls or patients with AD. It was significantly associated with family history of ALS or FTLD and age at onset of FTLD. Phenotype variation (ALS vs FTLD) was not associated with MAPT, APOE, or variability in the repeat flanking regions. Two patients with PD were carriers of 39 and 32 repeats with questionable pathological significance, since the 39-repeat allele does not segregate with PD. No expansion or intermediate alleles (20–29 repeats) were found among the G2019S carriers and AD cases with TAR DNA-binding protein 43–positive inclusions. Surprisingly, the frequency of the 10-repeat allele was marginally increased in all 4 neurodegenerative diseases compared with controls, indicating the presence of an unknown risk variation in the C9orf72 locus. Conclusions The C9orf72 expansion is a common cause of ALS and FTLD, but not of AD or PD. Our study raises concern about a reliable cutoff for the pathological repeat number, which is important in the utility of genetic screening. PMID:22964832

  13. Mutations Affecting G-Protein Subunit α11 in Hypercalcemia and Hypocalcemia

    PubMed Central

    Babinsky, Valerie N.; Head, Rosie A.; Cranston, Treena; Rust, Nigel; Hobbs, Maurine R.; Heath, Hunter; Thakker, Rajesh V.

    2013-01-01

    BACKGROUND Familial hypocalciuric hypercalcemia is a genetically heterogeneous disorder with three variants: types 1, 2, and 3. Type 1 is due to loss-of-function mutations of the calcium-sensing receptor, a guanine nucleotide–binding protein (G-protein)–coupled receptor that signals through the G-protein subunit α11 (Gα11). Type 3 is associated with adaptor-related protein complex 2, sigma 1 subunit (AP2S1) mutations, which result in altered calcium-sensing receptor endocytosis. We hypothesized that type 2 is due to mutations effecting Gα11 loss of function, since Gα11 is involved in calcium-sensing receptor signaling, and its gene (GNA11) and the type 2 locus are colocalized on chromosome 19p13.3. We also postulated that mutations effecting Gα11 gain of function, like the mutations effecting calcium-sensing receptor gain of function that cause autosomal dominant hypocalcemia type 1, may lead to hypocalcemia. METHODS We performed GNA11 mutational analysis in a kindred with familial hypocalciuric hypercalcemia type 2 and in nine unrelated patients with familial hypocalciuric hypercalcemia who did not have mutations in the gene encoding the calcium-sensing receptor (CASR) or AP2S1. We also performed this analysis in eight unrelated patients with hypocalcemia who did not have CASR mutations. In addition, we studied the effects of GNA11 mutations on Gα11 protein structure and calcium-sensing receptor signaling in human embryonic kidney 293 (HEK293) cells. RESULTS The kindred with familial hypocalciuric hypercalcemia type 2 had an in-frame deletion of a conserved Gα11 isoleucine (Ile200del), and one of the nine unrelated patients with familial hypocalciuric hypercalcemia had a missense GNA11 mutation (Leu135Gln). Missense GNA11 mutations (Arg181Gln and Phe341Leu) were detected in two unrelated patients with hypocalcemia; they were therefore identified as having autosomal dominant hypocalcemia type 2. All four GNA11 mutations predicted disrupted protein

  14. PREDICT-PD: An online approach to prospectively identify risk indicators of Parkinson's disease.

    PubMed

    Noyce, Alastair J; R'Bibo, Lea; Peress, Luisa; Bestwick, Jonathan P; Adams-Carr, Kerala L; Mencacci, Niccolo E; Hawkes, Christopher H; Masters, Joseph M; Wood, Nicholas; Hardy, John; Giovannoni, Gavin; Lees, Andrew J; Schrag, Anette

    2017-02-01

    A number of early features can precede the diagnosis of Parkinson's disease (PD). To test an online, evidence-based algorithm to identify risk indicators of PD in the UK population. Participants aged 60 to 80 years without PD completed an online survey and keyboard-tapping task annually over 3 years, and underwent smell tests and genotyping for glucocerebrosidase (GBA) and leucine-rich repeat kinase 2 (LRRK2) mutations. Risk scores were calculated based on the results of a systematic review of risk factors and early features of PD, and individuals were grouped into higher (above 15th centile), medium, and lower risk groups (below 85th centile). Previously defined indicators of increased risk of PD ("intermediate markers"), including smell loss, rapid eye movement-sleep behavior disorder, and finger-tapping speed, and incident PD were used as outcomes. The correlation of risk scores with intermediate markers and movement of individuals between risk groups was assessed each year and prospectively. Exploratory Cox regression analyses with incident PD as the dependent variable were performed. A total of 1323 participants were recruited at baseline and >79% completed assessments each year. Annual risk scores were correlated with intermediate markers of PD each year and baseline scores were correlated with intermediate markers during follow-up (all P values < 0.001). Incident PD diagnoses during follow-up were significantly associated with baseline risk score (hazard ratio = 4.39, P = .045). GBA variants or G2019S LRRK2 mutations were found in 47 participants, and the predictive power for incident PD was improved by the addition of genetic variants to risk scores. The online PREDICT-PD algorithm is a unique and simple method to identify indicators of PD risk. © 2017 The Authors. Movement Disorders published by Wiley Periodicals, Inc. on behalf of International Parkinson and Movement Disorder Society. © 2016 International Parkinson and Movement Disorder

  15. USDOT’s Intelligent Transportation Systems (ITS) ITS strategic plan, 2015-2019.

    DOT National Transportation Integrated Search

    2014-05-01

    This document constitutes the Intelligent Transportation Systems Strategic Plan covering the years 2015 to 2019; it builds on the progress of the 2010-2014 plan and presents a wide array of technical, policy, institutional, and organizational concept...

  16. 4 CFR 201.9 - Restrictions on charging fees.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 4 Accounts 1 2010-01-01 2010-01-01 false Restrictions on charging fees. 201.9 Section 201.9 Accounts RECOVERY ACCOUNTABILITY AND TRANSPARENCY BOARD PUBLIC INFORMATION AND REQUESTS § 201.9 Restrictions on charging fees. (a) When determining search or review fees: (1) No search fee shall be charged...

  17. Carnitine-acylcarnitine translocase deficiency with c.199-10 T>G and novel c.1A>G mutation

    PubMed Central

    Yan, Hui-ming; Hu, Hao; Ahmed, Aisha; Feng, Bing-bing; Liu, Jing; Jia, Zheng-jun; Wang, Hua

    2017-01-01

    Abstract Rationale: Carnitine-acylcarnitine translocate deficiency (CACTD) is a rare and life-threatening, autosomal recessive disorder of fatty acid β-oxidation characterized by hypoketotic hypoglycemia, hyperammonemia, cardiomyopathy, liver dysfunction, and muscle weakness; culminating in early death. To date, CACTD cases screened from the Chinese mainland population, especially patient with compound heterozygote with c.199-10T>G and a novel c.1A>G mutation in the SLC25A20 gene has never been described. Patient concerns: Herein, we report 2 neonatal cases of CACTD identified from the mainland China. These 2 patients were presented with severe metabolic crisis and their clinical conditions deteriorate rapidly and both died of cardiorespiratory collapse in the first week of life. We present the clinical and biochemical features of 2 probands and a brief literature review of previously reported CACTD cases with the c.199-10T>G mutation. Diagnoses: The acylcarnitine profiles by tandem-mass-spectrometry and the mutation analysis of SLC25A20 gene confirmed the diagnosis of CACTD in both patients. Mutation analysis demonstrated that patient No. 1 was homozygous for c.199-10T>G mutation, while patient No. 2 was a compound heterozygote for 2 mutations, a maternally-inherited c.199-10T>G and a paternally-inherited, novel c.1A>G mutation. Interventions: Both patients were treated with an aggressive treatment regimen include high glucose and arginine infusion, respiratory, and circulatory support. Outcomes: The first proband died 3 days after delivery due to sudden cardiac arrest. The second patient's clinical condition, at one time, was improved by high glucose infusion, intravenous arginine, and circulatory support. However, the patient failed to wean from mechanical ventilation. Unfortunately, her parents refused further treatment due to fear of financial burdens. The patient died of congestive heart failure in the 6th day of life. Lessons: We report the first 2 cases of

  18. 19 CFR 201.9 - Methods employed in obtaining information.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 19 Customs Duties 3 2014-04-01 2014-04-01 false Methods employed in obtaining information. 201.9 Section 201.9 Customs Duties UNITED STATES INTERNATIONAL TRADE COMMISSION GENERAL RULES OF GENERAL APPLICATION Initiation and Conduct of Investigations § 201.9 Methods employed in obtaining information. In...

  19. 19 CFR 201.9 - Methods employed in obtaining information.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 19 Customs Duties 3 2013-04-01 2013-04-01 false Methods employed in obtaining information. 201.9 Section 201.9 Customs Duties UNITED STATES INTERNATIONAL TRADE COMMISSION GENERAL RULES OF GENERAL APPLICATION Initiation and Conduct of Investigations § 201.9 Methods employed in obtaining information. In...

  20. Leucine-Rich Repeat Kinase 2 in Parkinson's Disease: Updated from Pathogenesis to Potential Therapeutic Target.

    PubMed

    Chen, Jinhua; Chen, Ying; Pu, Jiali

    2018-04-27

    Parkinson's disease (PD) is characterized by the selective loss of dopaminergic neurons in the midbrain. The pathogenesis of PD is not fully understood but is likely caused by a combination of genetic and environmental factors. Several genes are associated with the onset and progression of familial PD. There is increasing evidence that leucine-rich repeat kinase 2 (LRRK2) plays a significant role in PD pathophysiology. Many studies have been conducted to elucidate the functions of LRRK2 and identify effective LRRK2 inhibitors for PD treatment. In this review, we discuss the role of LRRK2 in PD and recent progress in the use of LRRK2 inhibitors as therapeutic agents. Key Messages: LRRK2 plays a significant role in the pathophysiology of PD, and pharmacological inhibition of LRRK2 has become one of the most promising potential therapies for PD. Further research is warranted to determine the functions of LRRK2 and expand the applications of LRRK2 inhibitors in PD treatment. © 2018 S. Karger AG, Basel.

  1. Recurrent and founder mutations in the PMS2 gene.

    PubMed

    Tomsic, J; Senter, L; Liyanarachchi, S; Clendenning, M; Vaughn, C P; Jenkins, M A; Hopper, J L; Young, J; Samowitz, W; de la Chapelle, A

    2013-03-01

    Germline mutations in PMS2 are associated with Lynch syndrome (LS), the most common known cause of hereditary colorectal cancer. Mutation detection in PMS2 has been difficult due to the presence of several pseudogenes, but a custom-designed long-range PCR strategy now allows adequate mutation detection. Many mutations are unique. However, some mutations are observed repeatedly across individuals not known to be related due to the mutation being either recurrent, arising multiple times de novo at hot spots for mutations, or of founder origin, having occurred once in an ancestor. Previously, we observed 36 distinct mutations in a sample of 61 independently ascertained Caucasian probands of mixed European background with PMS2 mutations. Eleven of these mutations were detected in more than one individual not known to be related and of these, six were detected more than twice. These six mutations accounted for 31 (51%) ostensibly unrelated probands. Here, we performed genotyping and haplotype analysis in four mutations observed in multiple probands and found two (c.137G>T and exon 10 deletion) to be founder mutations and one (c.903G>T) a probable founder. One (c.1A>G) could not be evaluated for founder mutation status. We discuss possible explanations for the frequent occurrence of founder mutations in PMS2. © 2012 John Wiley & Sons A/S.

  2. EGFR G796D mutation mediates resistance to osimertinib.

    PubMed

    Zheng, Di; Hu, Min; Bai, Yu; Zhu, Xuehua; Lu, Xuesong; Wu, Chunyan; Wang, Jiying; Liu, Li; Wang, Zheng; Ni, Jian; Yang, Zhenfan; Xu, Jianfang

    2017-07-25

    Osimertinib is an effective third-generation epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor (TKI) approved in multiple countries and regions for patients with EGFR T790M mutation-positive non-small cell lung cancer (NSCLC). Despite impressive initial tumor responses, development of drug resistance ultimately limits the benefit of this compound. Mechanisms of resistance to osimertinib are just beginning to emerge, such as EGFR C797S and L718Q mutations, BRAF V600E and PIK3CA E545K mutations, as well as ERBB2 and MET amplification. However, a comprehensive view is still missing. In this study, we presented the first case of Chinese NSCLC patient who developed resistance to osimertinib, and discovered de novo EGFR G796D mutation as a potential mechanism. Our findings provided insights into mechanisms of resistance to osimertinib and highlighted tumor heterogeneity and clonal evolution during the development of drug resistance.

  3. EGFR G796D mutation mediates resistance to osimertinib

    PubMed Central

    Bai, Yu; Zhu, Xuehua; Lu, Xuesong; Wu, Chunyan; Wang, Jiying; Liu, Li; Wang, Zheng; Ni, Jian; Yang, Zhenfan; Xu, Jianfang

    2017-01-01

    Osimertinib is an effective third-generation epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor (TKI) approved in multiple countries and regions for patients with EGFR T790M mutation-positive non-small cell lung cancer (NSCLC). Despite impressive initial tumor responses, development of drug resistance ultimately limits the benefit of this compound. Mechanisms of resistance to osimertinib are just beginning to emerge, such as EGFR C797S and L718Q mutations, BRAF V600E and PIK3CA E545K mutations, as well as ERBB2 and MET amplification. However, a comprehensive view is still missing. In this study, we presented the first case of Chinese NSCLC patient who developed resistance to osimertinib, and discovered de novo EGFR G796D mutation as a potential mechanism. Our findings provided insights into mechanisms of resistance to osimertinib and highlighted tumor heterogeneity and clonal evolution during the development of drug resistance. PMID:28572531

  4. 22 CFR 62.12 - Control of Forms DS-2019.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... transfer; (4) Replace a lost or stolen Form DS-2019; (5) Facilitate entry of an exchange visitor's alien spouse or minor unmarried children into the United States separately; (6) Facilitate re-entry of an... Form DS-2019. Issue the Form DS-2019 only so as to: (1) Facilitate the entry of a new participant of...

  5. 22 CFR 62.12 - Control of Forms DS-2019.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... transfer; (4) Replace a lost or stolen Form DS-2019; (5) Facilitate entry of an exchange visitor's alien spouse or minor unmarried children into the United States separately; (6) Facilitate re-entry of an... Form DS-2019. Issue the Form DS-2019 only so as to: (1) Facilitate the entry of a new participant of...

  6. 22 CFR 62.12 - Control of Forms DS-2019.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... transfer; (4) Replace a lost or stolen Form DS-2019; (5) Facilitate entry of an exchange visitor's alien spouse or minor unmarried children into the United States separately; (6) Facilitate re-entry of an... Form DS-2019. Issue the Form DS-2019 only so as to: (1) Facilitate the entry of a new participant of...

  7. 22 CFR 62.12 - Control of Forms DS-2019.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... transfer; (4) Replace a lost or stolen Form DS-2019; (5) Facilitate entry of an exchange visitor's alien spouse or minor unmarried children into the United States separately; (6) Facilitate re-entry of an... Form DS-2019. Issue the Form DS-2019 only so as to: (1) Facilitate the entry of a new participant of...

  8. 22 CFR 62.12 - Control of Forms DS-2019.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... transfer; (4) Replace a lost or stolen Form DS-2019; (5) Facilitate entry of an exchange visitor's alien spouse or minor unmarried children into the United States separately; (6) Facilitate re-entry of an... Form DS-2019. Issue the Form DS-2019 only so as to: (1) Facilitate the entry of a new participant of...

  9. Novel PSEN1 G209A mutation in early-onset Alzheimer dementia supported by structural prediction.

    PubMed

    An, Seong Soo A; Bagyinszky, Eva; Kim, Hye Ryoun; Seok, Ju-Won; Shin, Hae-Won; Bae, SeunOh; Kim, SangYun; Youn, Young Chul

    2016-05-20

    Three main genes are described as causative genes for early-onset Alzheimer dementia (EOAD): APP, PSEN1 and PSEN2. We describe a woman with EOAD had a novel PSEN1 mutation. A 54-year-old right-handed woman presented 12-year history of progressive memory decline. She was clinically diagnosed as familial Alzheimer's disease due to a PSEN1 mutation. One of two daughters also has the same mutation, G209A in the TM-IV of PS1 protein. Her mother had unspecified dementia that began at the age of 40s. PolyPhen2 and SIFT prediction suggested that G209A might be a damaging variant with high scores. 3D modeling revealed that G209A exchange could result significant changes in the PS1 protein. We report a case of EOAD having probable novel PSEN1 (G209A) mutation verified with structural prediction.

  10. Gaucher disease: A G[sup +1][yields]A[sup +1] IVS2 splice donor site mutation causing exon 2 skipping in the acid [beta]-glucosidase mRNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    He, Guo-Shun; Grabowski, G.A.

    1992-10-01

    Gaucher disease is the most frequent lysosomal storage disease and the most prevalent Jewish genetic disease. About 30 identified missense mutations are causal to the defective activity of acid [beta]-glucosidase in this disease. cDNAs were characterized from a moderately affected 9-year-old Ashkenazi Jewish Gaucher disease type 1 patient whose 80-years-old, enzyme-deficient, 1226G (Asn[sup 370][yields]Ser [N370S]) homozygous grandfather was nearly asymptomatic. Sequence analyses revealed four populations of cDNAs with either the 1226G mutation, an exact exon 2 ([Delta] EX2) deletion, a deletion of exon 2 and the first 115 bp of exon 3 ([Delta] EX2-3), or a completely normal sequence. Aboutmore » 50% of the cDNAs were the [Delta] EX2, the [Delta] EX2-3, and the normal cDNAs, in a ratio of 6:3:1. Specific amplification and characterization of exon 2 and 5[prime] and 3[prime] intronic flanking sequences from the structural gene demonstrated clones with either the normal sequence or with a G[sup +1][yields]A[sup +1] transition at the exon 2/intron 2 boundary. This mutation destroyed the splice donor consensus site (U1 binding site) for mRNA processing. This transition also was present at the corresponding exon/intron boundary of the highly homologous pseudogene. This new mutation, termed [open quotes]IVS2 G[sup +1],[close quotes] is the first in the Ashkenazi Jewish population. The occurrence of this [open quotes]pseudogene[close quotes]-type mutation in the structural gene indicates the role of acid [beta]-glucosidase pseudogene and structural gene rearrangements in the pathogenesis of this disease. 33 refs., 8 figs., 1 tab.« less

  11. Unbiased screen for interactors of leucine-rich repeat kinase 2 supports a common pathway for sporadic and familial Parkinson disease

    PubMed Central

    Beilina, Alexandria; Rudenko, Iakov N.; Kaganovich, Alice; Civiero, Laura; Chau, Hien; Kalia, Suneil K.; Kalia, Lorraine V.; Lobbestael, Evy; Chia, Ruth; Ndukwe, Kelechi; Ding, Jinhui; Nalls, Mike A.; Olszewski, Maciej; Hauser, David N.; Kumaran, Ravindran; Lozano, Andres M.; Baekelandt, Veerle; Greene, Lois E.; Taymans, Jean-Marc; Greggio, Elisa; Cookson, Mark R.; Nalls, Mike A.; Plagnol, Vincent; Martinez, Maria; Hernandez, Dena G; Sharma, Manu; Sheerin, Una-Marie; Saad, Mohamad; Simón-Sánchez, Javier; Schulte, Claudia; Lesage, Suzanne; Sveinbjörnsdóttir, Sigurlaug; Arepalli, Sampath; Barker, Roger; Ben-Shlomo, Yoav; Berendse, Henk W; Berg, Daniela; Bhatia, Kailash; de Bie, Rob M A; Biffi, Alessandro; Bloem, Bas; Bochdanovits, Zoltan; Bonin, Michael; Bras, Jose M; Brockmann, Kathrin; Brooks, Janet; Burn, David J; Charlesworth, Gavin; Chen, Honglei; Chong, Sean; Clarke, Carl E; Cookson, Mark R; Cooper, J Mark; Corvol, Jean Christophe; Counsell, Carl; Damier, Philippe; Dartigues, Jean-François; Deloukas, Panos; Deuschl, Günther; Dexter, David T; van Dijk, Karin D; Dillman, Allissa; Durif, Frank; Dürr, Alexandra; Edkins, Sarah; Evans, Jonathan R; Foltynie, Thomas; Gao, Jianjun; Gardner, Michelle; Gibbs, J Raphael; Goate, Alison; Gray, Emma; Guerreiro, Rita; Gústafsson, Ómar; Harris, Clare; van Hilten, Jacobus J; Hofman, Albert; Hollenbeck, Albert; Holton, Janice; Hu, Michele; Huang, Xuemei; Huber, Heiko; Hudson, Gavin; Hunt, Sarah E; Huttenlocher, Johanna; Illig, Thomas; München, Helmholtz Zentrum; Jónsson, Pálmi V; Lambert, Jean-Charles; Langford, Cordelia; Lees, Andrew; Lichtner, Peter; München, Helmholtz Zentrum; Limousin, Patricia; Lopez, Grisel; Lorenz, Delia; McNeill, Alisdair; Moorby, Catriona; Moore, Matthew; Morris, Huw R; Morrison, Karen E; Mudanohwo, Ese; O’Sullivan, Sean S; Pearson, Justin; Perlmutter, Joel S; Pétursson, Hjörvar; Pollak, Pierre; Post, Bart; Potter, Simon; Ravina, Bernard; Revesz, Tamas; Riess, Olaf; Rivadeneira, Fernando; Rizzu, Patrizia; Ryten, Mina; Sawcer, Stephen; Schapira, Anthony; Scheffer, Hans; Shaw, Karen; Shoulson, Ira; Sidransky, Ellen; Smith, Colin; Spencer, Chris C A; Stefánsson, Hreinn; Steinberg, Stacy; Stockton, Joanna D; Strange, Amy; Talbot, Kevin; Tanner, Carlie M; Tashakkori-Ghanbaria, Avazeh; Tison, François; Trabzuni, Daniah; Traynor, Bryan J; Uitterlinden, André G; Velseboer, Daan; Vidailhet, Marie; Walker, Robert; van de Warrenburg, Bart; Wickremaratchi, Mirdhu; Williams, Nigel; Williams-Gray, Caroline H; Winder-Rhodes, Sophie; Stefánsson, Kári; Hardy, John; Heutink, Peter; Brice, Alexis; Gasser, Thomas; Singleton, Andrew B; Wood, Nicholas W; Chinnery, Patrick F; Arepalli, Sampath; Cookson, Mark R; Dillman, Allissa; Ferrucci, Luigi; Gibbs, J Raphael; Hernandez, Dena G; Johnson, Robert; Longo, Dan L; Majounie, Elisa; Nalls, Michael A; O’Brien, Richard; Singleton, Andrew B; Traynor, Bryan J; Troncoso, Juan; van der Brug, Marcel; Zielke, H Ronald; Zonderman, Alan B

    2014-01-01

    Mutations in leucine-rich repeat kinase 2 (LRRK2) cause inherited Parkinson disease (PD), and common variants around LRRK2 are a risk factor for sporadic PD. Using protein–protein interaction arrays, we identified BCL2-associated athanogene 5, Rab7L1 (RAB7, member RAS oncogene family-like 1), and Cyclin-G–associated kinase as binding partners of LRRK2. The latter two genes are candidate genes for risk for sporadic PD identified by genome-wide association studies. These proteins form a complex that promotes clearance of Golgi-derived vesicles through the autophagy–lysosome system both in vitro and in vivo. We propose that three different genes for PD have a common biological function. More generally, data integration from multiple unbiased screens can provide insight into human disease mechanisms. PMID:24510904

  12. A familial case of Keratitis-Ichthyosis-Deafness (KID) syndrome with the GJB2 mutation G45E.

    PubMed

    Jonard, Laurence; Feldmann, Delphine; Parsy, Christophe; Freitag, Sylvie; Sinico, Martine; Koval, Céleste; Grati, Mhamed; Couderc, Remy; Denoyelle, Françoise; Bodemer, Christine; Marlin, Sandrine; Hadj-Rabia, Smail

    2008-01-01

    Keratitis-Ichthyosis-Deafness (KID) syndrome (OMIM 148210) is a congenital ectodermal defect. KID consists of an atypical ichthyosiform erythroderma associated with congenital sensorineural deafness. A rare form of the KID syndrome is a fatal course in the first year of life due to severe skin lesion infections and septicaemia. KID appears to be genetically heterogeneous and may be caused by mutations in connexin 26 or connexin 30 genes. GJB2 mutations in the connexin 26 gene are the main cause of the disease. Most of the cases caused by GJB2 mutations are sporadic, but dominant transmission has also been described. To date, the rare lethal form of the disease has been only observed in two Caucasian sporadic patients with the GJB2 mutation, with the p.Gly45Glu (G45E) arising de novo. We have reported an African family with dizygotic twins suffering from a lethal form of KID. The dizygosity of the twins was confirmed by microsatellite markers. The two patients were heterozygous for the G45E mutation of GJB2, whereas the mutation was not detected in the two parents. The unusual transmission of the disease observed in this family could be explained by the occurrence of a somatic or more probably a germinal mosaic in one of the parents.

  13. CHEK2 1100delC, IVS2+1G>A and I157T mutations are not present in colorectal cancer cases from Turkish population.

    PubMed

    Bayram, Süleyman; Topaktaş, Mehmet; Akkız, Hikmet; Bekar, Aynur; Akgöllü, Ersin

    2012-10-01

    The cell cycle checkpoint kinase 2 (CHEK2) protein participates in the DNA damage response in many cell types. Germline mutations in CHEK2 (1100delC, IVS2+1G>A and I157T) have been impaired serine/threonine kinase activity and associated with a range of cancer types. This hospital-based case-control study aimed to investigate whether CHEK2 1100delC, IVS2+1G>A and I157T mutations play an important role in the development of colorectal cancer (CRC) in Turkish population. A total of 210 CRC cases and 446 cancer-free controls were genotyped for CHEK2 mutations by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and allele specific-polymerase chain reaction (AS-PCR) methods. We did not find the CHEK2 1100delC, IVS2+1G>A and I157T mutations in any of the Turkish subjects. Our result demonstrate for the first time that CHEK2 1100delC, IVS2+1G>A and I157T mutations have not been agenetic susceptibility factor for CRC in the Turkish population. Overall, our data suggest that genotyping of CHEK2 mutations in clinical settings in the Turkish population should not be recommended. However, independent studies are need to validate our findings in a larger series, as well as in patients of different ethnic origins. Copyright © 2012 Elsevier Ltd. All rights reserved.

  14. Novel mutations in PANK2 and PLA2G6 genes in patients with neurodegenerative disorders: two case reports.

    PubMed

    Dastsooz, Hassan; Nemati, Hamid; Fard, Mohammad Ali Farazi; Fardaei, Majid; Faghihi, Mohammad Ali

    2017-08-18

    Neurodegeneration with brain iron accumulation (NBIA) is a genetically heterogeneous group of disorders associated with progressive impairment of movement, vision, and cognition. The disease is initially diagnosed on the basis of changes in brain magnetic resonance imaging which indicate an abnormal brain iron accumulation in the basal ganglia. However, the diagnosis of specific types should be based on both clinical findings and molecular genetic testing for genes associated with different types of NBIA, including PANK2, PLA2G6, C19orf12, FA2H, ATP13A2, WDR45, COASY, FTL, CP, and DCAF17. The purpose of this study was to investigate disease-causing mutations in two patients with distinct NBIA disorders. Whole Exome sequencing using Next Generation Illumina Sequencing was used to enrich all exons of protein-coding genes as well as some other important genomic regions in these two affected patients. A deleterious homozygous four-nucleotide deletion causing frameshift deletion in PANK2 gene (c.1426_1429delATGA, p.M476 fs) was identified in an 8 years old girl with dystonia, bone fracture, muscle rigidity, abnormal movement, lack of coordination and chorea. In addition, our study revealed a novel missense mutation in PLA2G6 gene (c.3G > T:p.M1I) in one and half-year-old boy with muscle weakness and neurodevelopmental regression (speech, motor and cognition). The novel mutations were also confirmed by Sanger sequencing in the proband and their parents. Current study uncovered two rare novel mutations in PANK2 and PLA2G6 genes in patients with NBIA disorder and such studies may help to conduct genetic counseling and prenatal diagnosis more accurately for individuals at the high risk of these types of disorders.

  15. Identification of Novel Compound Mutations in PLA2G6-Associated Neurodegeneration Patient with Characteristic MRI Imaging.

    PubMed

    Guo, Sen; Yang, Liu; Liu, Huijie; Chen, Wei; Li, Jinchen; Yu, Ping; Sun, Zhong Sheng; Chen, Xiang; Du, Jie; Cai, Tao

    2017-08-01

    Neurodegeneration with brain iron accumulation comprises a heterogeneous group of disorders characterized clinically by progressive motor dysfunction. Accurate identification of de novo and rare inherited mutations is important for determining causative genes of undiagnosed neurological diseases. In the present study, we report a unique case with cerebellar ataxia symptoms and social communication difficulties in an intermarriage family. MRI showed a marked cerebellar atrophy and the "eye-of-the-tiger"-like sign in the medial globus pallidus. Potential genetic defects were screened by whole-exome sequencing (WES) for the patient and four additional family members. A previously undescribed de novo missense mutation (c.1634A>G, p.K545R) in the exon 12 of the PLA2G6 gene was identified. A second rare variant c.1077G>A at the end of exon 7 was also identified, which was inherited from the mother, and resulted in a frame-shift mutation (c.1074_1077del.GTCG) due to an alternative splicing. In conclusion, the identification of the "eye-of-the-tiger"-like sign in the globus pallidus of the patient expands the phenotypic spectrum of PLA2G6-associated disorders and reveals its value in differential diagnosis of PLA2G6-associated disorders.

  16. G119S ace-1 mutation conferring insecticide resistance detected in the Culex pipiens complex in Morocco.

    PubMed

    Bkhache, Meriem; Tmimi, Fatim-Zohra; Charafeddine, Omar; Benabdelkrim Filali, Oumama; Lemrani, Meryem; Labbé, Pierrick; Sarih, M'hammed

    2018-06-09

    Arboviruses are controlled through insecticide control of their mosquito vector. However, inconsiderate use of insecticides often results in the selection of resistance in treated populations, so that monitoring is required to optimize their usage. Here, Culex pipiens (West Nile and Rift Valley Fever virus vector) specimens were collected from four Moroccan cities. Levels of susceptibility to the organophosphate (OP) insecticide malathion were assessed using WHO-recommended bioassays. Individual mosquitoes were tested for the presence of the G119S mutation in the ace-1 gene, the main OP-target resistance mutation. Bioassays showed that mosquitoes from Mohammedia were significantly more resistant to malathion than those from Marrakech. Analyzing the ace-1 genotypes in dead and surviving individuals suggested that other resistance mechanisms may be present in Mohammedia. The ace-1 resistance allele frequencies were relatively moderate (<0.4). Their analyses in three Moroccan cities (Tangier, Casablanca and Marrakech) however showed disparities between two coexisting Cx. pipiens forms and revealed that the G119S mutation tends to be more frequent in urban than in rural collections sites. These findings provide a reference assessment of OP resistance in Morocco and should help the health authorities to develop informed and sustainable vector control programs. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  17. Characterization of D150E and G196D aquaporin-2 mutations responsible for nephrogenic diabetes insipidus: importance of a mild phenotype

    PubMed Central

    Guyon, Cécile; Lussier, Yoann; Bissonnette, Pierre; Leduc-Nadeau, Alexandre; Lonergan, Michèle; Arthus, Marie-Françoise; Perez, Rafael Bedoya; Tiulpakov, Anatoly; Lapointe, Jean-Yves; Bichet, Daniel G.

    2009-01-01

    Aquaporin-2 (AQP2) is a water channel responsible for the final water reabsorption in renal collecting ducts. Alterations in AQP2 function induce nephrogenic diabetes insipidus (NDI), a condition characterized by severe polyuria and polydipsia. Three patients affected with severe NDI, who were compound heterozygous for the AQP2 mutations D150E and G196D, are presented here along with a mildly affected D150E homozygous patient from another family. Using Xenopus oocytes as an expression system, these two mutations (G196D and D150E) were compared with the wild-type protein (AQP2-wt) for functional activity (water flux analysis), protein maturation, and plasma membrane targeting. AQP2-wt induces a major increase in water permeability (Pf = 47.4 ± 12.2 × 10−4 cm/s) whereas D150E displays intermediate Pf values (Pf = 12.5 ± 3.0 × 10−4 cm/s) and G196D presents no specific water flux, similar to controls (Pf = 2.1 ± 0.8 × 10−4 cm/s and 2.2 ± 0.7 × 10−4 cm/s, respectively). Western blot and immunocytochemical evaluations show protein targeting that parallels activity levels with AQP2-wt adequately targeted to the plasma membrane, partial targeting for D150E, and complete sequestration of G196D within intracellular compartments. When coinjecting AQP2-wt with mutants, no (AQP2-wt + D150E) or partial (AQP2-wt + G196D) reduction of water flux were observed compared with AQP2-wt alone, whereas complete loss of function was found when both mutants were coinjected. These results essentially recapitulate the clinical profiles of the family members, showing a typical dominant negative effect when G196D is coinjected with either AQP2-wt or D150E but not between AQP2-wt and D150E mutant. PMID:19458121

  18. G protein-coupled receptor mutations and human genetic disease.

    PubMed

    Thompson, Miles D; Hendy, Geoffrey N; Percy, Maire E; Bichet, Daniel G; Cole, David E C

    2014-01-01

    Genetic variations in G protein-coupled receptor genes (GPCRs) disrupt GPCR function in a wide variety of human genetic diseases. In vitro strategies and animal models have been used to identify the molecular pathologies underlying naturally occurring GPCR mutations. Inactive, overactive, or constitutively active receptors have been identified that result in pathology. These receptor variants may alter ligand binding, G protein coupling, receptor desensitization and receptor recycling. Receptor systems discussed include rhodopsin, thyrotropin, parathyroid hormone, melanocortin, follicle-stimulating hormone (FSH), luteinizing hormone, gonadotropin-releasing hormone (GNRHR), adrenocorticotropic hormone, vasopressin, endothelin-β, purinergic, and the G protein associated with asthma (GPRA or neuropeptide S receptor 1 (NPSR1)). The role of activating and inactivating calcium-sensing receptor (CaSR) mutations is discussed in detail with respect to familial hypocalciuric hypercalcemia (FHH) and autosomal dominant hypocalemia (ADH). The CASR mutations have been associated with epilepsy. Diseases caused by the genetic disruption of GPCR functions are discussed in the context of their potential to be selectively targeted by drugs that rescue altered receptors. Examples of drugs developed as a result of targeting GPCRs mutated in disease include: calcimimetics and calcilytics, therapeutics targeting melanocortin receptors in obesity, interventions that alter GNRHR loss from the cell surface in idiopathic hypogonadotropic hypogonadism and novel drugs that might rescue the P2RY12 receptor congenital bleeding phenotype. De-orphanization projects have identified novel disease-associated receptors, such as NPSR1 and GPR35. The identification of variants in these receptors provides genetic reagents useful in drug screens. Discussion of the variety of GPCRs that are disrupted in monogenic Mendelian disorders provides the basis for examining the significance of common

  19. Mutation du gène NOD2 chez les patients marocains atteints de la maladie de Crohn: prévalence, étude génotypique et corrélation au phénotype de la maladie

    PubMed Central

    Tamzaourte, Mouna; Errabih, Ikram; Krami, Hayat; Maha, Fadlouallah; Maria, Lahmiri; Benzzoubeir, Nadia; Ouazzani, Laaziza; Sefiani, Ahmed; Ouazzani, Houria

    2017-01-01

    L'objectif était de déterminer la prévalence des mutations du gène NOD2/CARD15 dans un groupe de patients Marocains atteint de Maladie de Crohn et étudier sa corrélation génotype-expression phénotypique. Etude transversale cas témoin menée sur une durée de 16 mois. Ont été inclus 101 patients atteints de la maladie de Crohn, entre Janvier 2012 et Avril 2013 ainsi qu'un groupe contrôle de 107 patients. L'analyse génétique a consisté à rechercher 3 variants du gène NOD2: p.Arg702Trp, p.Gly908Arg et p.Leu1007fsins. Puis une étude de corrélation génotype-expression phénotypique a été menée. L'analyse génétique des patients atteint de maladie de crohn a mis en évidence la présence de la mutation NOD2 chez 14 patients (13,77%) contre 7 patients (6,53%) du groupe témoin. L'étude de la fréquence des différents allèles a retrouvé la mutation de p.Gly908Arg dans 6,43%, p.Leu1007fsins dans 0,99% et p.Arg702Trp dans 0,49% contre respectivement 2,80%, 0% et 0,46% dans le groupe témoin. L'étude de la corrélation génotype, expression phénotypique a démontré que la mutation CARD15 est corrélée à une localisation iléo-caecale de la maladie, à une présentation fistulisante et sténosante ainsi qu'à une évolution sévère avec recours fréquent à la chirurgie et aux immunosuppresseurs. La prévalence de la mutation NOD2/ CARD15 dans notre série est faible. Cette mutation est corrélée à une forme grave de la maladie. PMID:28819537

  20. Right ventricular outflow tract tachycardia due to a somatic cell mutation in G protein subunitalphai2.

    PubMed Central

    Lerman, B B; Dong, B; Stein, K M; Markowitz, S M; Linden, J; Catanzaro, D F

    1998-01-01

    Idiopathic ventricular tachycardia is a generic term that describes the various forms of ventricular arrhythmias that occur in patients without structural heart disease and in the absence of the long QT syndrome. Many of these tachycardias are focal in origin, localize to the right ventricular outflow tract (RVOT), terminate in response to beta blockers, verapamil, vagal maneuvers, and adenosine, and are thought to result from cAMP-mediated triggered activity. DNA was prepared from biopsy samples obtained from myocardial tissue from a patient with adenosine-insensitive idiopathic ventricular tachycardia arising from the RVOT. Genomic sequences of the inhibitory G protein Galphai2 were determined after amplification by PCR and subcloning. A point mutation (F200L) in the GTP binding domain of the inhibitory G protein Galphai2 was identified in a biopsy sample from the arrhythmogenic focus. This mutation was shown to increase intracellular cAMP concentration and inhibit suppression of cAMP by adenosine. No mutations were detected in Galphai2 sequences from myocardial tissue sampled from regions remote from the origin of tachycardia, or from peripheral lymphocytes. These findings suggest that somatic cell mutations in the cAMP-dependent signal transduction pathway occurring during myocardial development may be responsible for some forms of idiopathic ventricular tachycardia. PMID:9637720

  1. First Report of the 23S rRNA Gene A2058G Point Mutation Associated With Macrolide Resistance in Treponema pallidum From Syphilis Patients in Cuba.

    PubMed

    Noda, Angel A; Matos, Nelvis; Blanco, Orestes; Rodríguez, Islay; Stamm, Lola Virginia

    2016-05-01

    This study aimed to assess the presence of macrolide-resistant Treponema pallidum subtypes in Havana, Cuba. Samples from 41 syphilis patients were tested for T. pallidum 23S rRNA gene mutations. Twenty-five patients (61%) harbored T. pallidum with the A2058G mutation, which was present in all 8 subtypes that were identified. The A2059G mutation was not detected.

  2. Isocitrate dehydrogenase 1 and 2 mutations in cholangiocarcinoma.

    PubMed

    Kipp, Benjamin R; Voss, Jesse S; Kerr, Sarah E; Barr Fritcher, Emily G; Graham, Rondell P; Zhang, Lizhi; Highsmith, W Edward; Zhang, Jun; Roberts, Lewis R; Gores, Gregory J; Halling, Kevin C

    2012-10-01

    Somatic mutations in isocitrate dehydrogenase 1 and 2 genes are common in gliomas and help stratify patients with brain cancer into histologic and molecular subtypes. However, these mutations are considered rare in other solid tumors. The aims of this study were to determine the frequency of isocitrate dehydrogenase 1 and 2 mutations in cholangiocarcinoma and to assess histopathologic differences between specimens with and without an isocitrate dehydrogenase mutation. We sequenced 94 formalin-fixed, paraffin-embedded cholangiocarcinoma (67 intrahepatic and 27 extrahepatic) assessing for isocitrate dehydrogenase 1 (codon 132) and isocitrate dehydrogenase 2 (codons 140 and 172) mutations. Multiple histopathologic characteristics were also evaluated and compared with isocitrate dehydrogenase 1/2 mutation status. Of the 94 evaluated specimens, 21 (22%) had a mutation including 14 isocitrate dehydrogenase 1 and 7 isocitrate dehydrogenase 2 mutations. Isocitrate dehydrogenase mutations were more frequently observed in intrahepatic cholangiocarcinoma than in extrahepatic cholangiocarcinoma (28% versus 7%, respectively; P = .030). The 14 isocitrate dehydrogenase 1 mutations were R132C (n = 9), R132S (n = 2), R132G (n = 2), and R132L (n = 1). The 7 isocitrate dehydrogenase 2 mutations were R172K (n = 5), R172M (n = 1), and R172G (n = 1). Isocitrate dehydrogenase mutations were more frequently observed in tumors with clear cell change (P < .001) and poorly differentiated histology (P = .012). The results of this study show for the first time that isocitrate dehydrogenase 1 and 2 genes are mutated in cholangiocarcinoma. The results of this study are encouraging because it identifies a new potential target for genotype-directed therapeutic trials and may represent a potential biomarker for earlier detection of cholangiocarcinoma in a subset of cases. Copyright © 2012 Elsevier Inc. All rights reserved.

  3. Activating HER2 mutations in HER2 gene amplification negative breast cancer

    PubMed Central

    Bose, Ron; Kavuri, Shyam M.; Searleman, Adam C.; Shen, Wei; Shen, Dong; Koboldt, Daniel C.; Monsey, John; Goel, Nicholas; Aronson, Adam B.; Li, Shunqiang; Ma, Cynthia X.; Ding, Li; Mardis, Elaine R.; Ellis, Matthew J.

    2012-01-01

    Data from eight breast cancer genome sequencing projects identified 25 patients with HER2 somatic mutations in cancers lacking HER2 gene amplification. To determine the phenotype of these mutations, we functionally characterized thirteen HER2 mutations using in vitro kinase assays, protein structure analysis, cell culture and xenograft experiments. Seven of these mutations are activating mutations, including G309A, D769H, D769Y, V777L, P780ins, V842I, and R896C. HER2 in-frame deletion 755-759, which is homologous to EGFR exon 19 in-frame deletions, had a neomorphic phenotype with increased phosphorylation of EGFR or HER3. L755S produced lapatinib resistance, but was not an activating mutation in our experimental systems. All of these mutations were sensitive to the irreversible kinase inhibitor, neratinib. These findings demonstrate that HER2 somatic mutation is an alternative mechanism to activate HER2 in breast cancer and they validate HER2 somatic mutations as drug targets for breast cancer treatment. PMID:23220880

  4. Nature and Recurrence of AVPR2 Mutations in X-linked Nephrogenic Diabetes Insipidus

    PubMed Central

    Bichet, Daniel G.; Birnbaumer, Mariel; Lonergan, Michèle; Arthus, Marie-Françoise; Rosenthal, Walter; Goodyer, Paul; Nivet, Hubert; Benoit, Stéphane; Giampietro, Philip; Simonetti, Simonetta; Fish, Alfred; Whitley, Chester B.; Jaeger, Philippe; Gertner, Joseph; New, Maria; DiBona, Francis J.; Kaplan, Bernard S.; Robertson, Gary L.; Hendy, Geoffrey N.; Fujiwara, T. Mary; Morgan, Kenneth

    1994-01-01

    X-linked nephrogenic diabetes insipidus (NDI) is a rare disease with defective renal and extrarenal arginine-vasopressin V2 receptor responses due to mutations in the AVPR2 gene in Xq28. We analyzed 31 independent NDI families to determine the nature and recurrence of AVPR2 mutations. Twenty-one new putative disease-causing mutations were identified: 113delCT, 253del35, 255del9, 274insG, V88M, R106C, 402delCT, C112R, Y124X, S126F, W164S, S167L, 684delTA, 804insG, W284X, A285P, W293X, R337X, and three large deletions or gene rearrangements. Five other mutations—R113W, Y128S, R137H, R181C, and R202C—that previously had been reported in other families were detected. There was evidence for recurrent mutation for four mutations (R113W, R137H, S167L, and R337X). Eight de novo mutation events were detected (274insG, R106C, Y128S, 167L [twice], R202C, 684delTA, and R337X). The origins were maternal (one), grandmaternal (one), and grandpaternal (six). In the 31 NDI families and 6 families previously reported by us, there is evidence both for mutation hot spots for nucleotide substitutions and for small deletions and insertions. More than half (58%) of the nucleotide substitutions in 26 families could be a consequence of 5-methylcytosine deamination at a CpG dinucleotide. Most of the small deletions and insertions could be attributed to slipped mispairing during DNA replication. PMID:8037205

  5. Exploring the effect of D61G mutation on SHP2 cause gain of function activity by a molecular dynamics study.

    PubMed

    Li, Hong-Lian; Ma, Ying; Zheng, Chang-Jie; Jin, Wen-Yan; Liu, Wen-Shan; Wang, Run-Ling

    2017-11-24

    Noonan syndrome (NS) is a common autosomal dominant congenital disorder which could cause the congenital cardiopathy and cancer predisposition. Previous studies reported that the knock-in mouse models of the mutant D61G of SHP2 exhibited the major features of NS, which demonstrated that the mutation D61G of SHP2 could cause NS. To explore the effect of D61G mutation on SHP2 and explain the high activity of the mutant, molecular dynamic simulations were performed on wild type (WT) of SHP2 and the mutated SHP2-D61G, respectively. The principal component analysis and dynamic cross-correlation mapping, associated with secondary structure, showed that the D61G mutation affected the motions of two regions (residues Asn 58-Thr 59 and Val 460-His 462) in SHP2 from β to turn. Moreover, the residue interaction networks analysis, the hydrogen bond occupancy analysis and the binding free energies were calculated to gain detailed insight into the influence of the mutant D61G on the two regions, revealing that the major differences between SHP2-WT and SHP2-D61G were the different interactions between Gly 61 and Gly 462, Gly 61 and Ala 461, Gln 506 and Ile 463, Gly 61 and Asn 58, Ile 463 and Thr 466, Gly 462 and Cys 459. Consequently, our findings here may provide knowledge to understand the increased activity of SHP2 caused by the mutant D61G.

  6. TRPC6 G757D Loss-of-Function Mutation Associates with FSGS

    PubMed Central

    Riehle, Marc; Büscher, Anja K.; Gohlke, Björn-Oliver; Kaßmann, Mario; Kolatsi-Joannou, Maria; Bräsen, Jan H.; Nagel, Mato; Becker, Jan U.; Winyard, Paul; Hoyer, Peter F.; Preissner, Robert; Krautwurst, Dietmar; Gollasch, Maik

    2016-01-01

    FSGS is a CKD with heavy proteinuria that eventually progresses to ESRD. Hereditary forms of FSGS have been linked to mutations in the transient receptor potential cation channel, subfamily C, member 6 (TRPC6) gene encoding a nonselective cation channel. Most of these TRPC6 mutations cause a gain-of-function phenotype, leading to calcium–triggered podocyte cell death, but the underlying molecular mechanisms are unclear. We studied the molecular effect of disease-related mutations using tridimensional in silico modeling of tetrameric TRPC6. Our results indicated that G757 is localized in a domain forming a TRPC6-TRPC6 interface and predicted that the amino acid exchange G757D causes local steric hindrance and disruption of the channel complex. Notably, functional characterization of model interface domain mutants suggested a loss-of-function phenotype. We then characterized 19 human FSGS–related TRPC6 mutations, the majority of which caused gain-of-function mutations. However, five mutations (N125S, L395A, G757D, L780P, and R895L) caused a loss-of-function phenotype. Coexpression of wild-type TRPC6 and TRPC6 G757D, mimicking heterozygosity observed in patients, revealed a dominant negative effect of TRPC6 G757D. Our comprehensive analysis of human disease–causing TRPC6 mutations reveals loss of TRPC6 function as an additional concept of hereditary FSGS and provides molecular insights into the mechanism responsible for the loss-of-function phenotype of TRPC6 G757D in humans. PMID:26892346

  7. [Leigh syndrome resulting from a de novo mitochondrial DNA mutation (T8993G)].

    PubMed

    Playán, A; Solano-Palacios, A; González de la Rosa, J B; Merino-Arribas, J M; Andreu, A L; López-Pérez, M; Montoya, J

    Several degenerative neurological diseases are caused by mutations in the mitochondrial gene coding for subunit 6 of the ATPase. Thus, NARP (neurogenic weakness, ataxia, and retinitis pigmentosa) and Leigh syndromes are associated to a T8993G mutation when the percentage of mutant mitochondrial DNA is low (60 90%) or high (>90%), respectively. Leigh syndrome is also caused by a second mutation in the same position T8993C. The patient, a boy that died at 6 months, had generalized hypotonia, psychomotor delay, hepatomegaly, choreic movements and hyporreflexia. MRI showed hypodensities in the basal ganglia and brain stem as well as hyperlactacidemia. Molecular genetic analysis of the mitochondrial DNA showed that the patient had the T8993G mutation in a percentage higher than 95%. No mutated DNA was detected in blood of the proband s mother, maternal aunt and grandmother. The point mutation T8993G may occur de novo, at high levels, causing neurodegenerative diseases.

  8. Tracking of the origin of recurrent mutations of the BRCA1 and BRCA2 genes in the North-East of Italy and improved mutation analysis strategy.

    PubMed

    Cini, Giulia; Mezzavilla, Massimo; Della Puppa, Lara; Cupelli, Elisa; Fornasin, Alessio; D'Elia, Angela Valentina; Dolcetti, Riccardo; Damante, Giuseppe; Bertok, Sara; Miolo, Gianmaria; Maestro, Roberta; de Paoli, Paolo; Amoroso, Antonio; Viel, Alessandra

    2016-02-06

    About 20 % of hereditary breast cancers are caused by mutations in BRCA1 and BRCA2 genes. Since BRCA1 and BRCA2 mutations may be spread throughout the gene, genetic testing is usually performed by direct sequencing of entire coding regions. In some populations, especially if relatively isolated, a few number of recurrent mutations is reported, sometimes caused by founder effect. BRCA1 and BRCA2 screening for mutations was carried out on 1114 breast and/or ovarian cancer patients complying with the eligibility criteria for BRCA testing. Haplotype analysis was performed on the probands carrying recurrent mutations and their relatives, using two sets of microsatellite markers covering the BRCA1 (D17S588, D17S806, D17S902, D17S1325, D17S855, D17S1328, D17S800, and D17S250) and BRCA2 (D13S220, D13S267, D13S171, D13S1701, D13S1698, D13S260, D13S290, D13S1246) loci. The DMLE + 2.2 software was used to estimate the age of BRCA1 c.676delT and BRCA2 c.7806-2A > G. A multiplex PCR and two different primer extension assays were optimized and used for genotyping the recurrent mutations of the two genes. In the time frame of almost 20 years of genetic testing, we have found that five BRCA1 and three BRCA2 mutations are recurrent in a substantial subset of carriers from North-East Italy and neighboring Istria, where they represent more than 50 % of all mutations. Microsatellite analyses identified a common haplotype of different length for each mutation. Age estimation of BRCA1 c.676delT and BRCA2 c.7806-2A > G mutations revealed that they arose in the Friuli Venezia Giulia area about 86 and 94 generations ago, respectively. Suggestion of an association between BRCA2 c.7806-2A > G and risk of breast cancer in males has emerged. Finally, we developed a simple and efficient pre-screening test, performing an in-house primer extension SNaPshot® assay for the rapid identification of the eight recurrent mutations. Proofs of common ancestry has been obtained for the eight recurrent

  9. Emergence of EGFR G724S mutation in EGFR-mutant lung adenocarcinoma post progression on osimertinib.

    PubMed

    Oztan, A; Fischer, S; Schrock, A B; Erlich, R L; Lovly, C M; Stephens, P J; Ross, J S; Miller, V; Ali, S M; Ou, S-H I; Raez, L E

    2017-09-01

    Mutations in the epidermal growth factor receptor (EGFR) are drivers for a subset of lung cancers. Osimertinib is a third-generation tyrosine kinase inhibitor (TKI) recently approved for the treatment of T790M-positive non-small cell lung cancer (NSCLC); however, acquired resistance to osimertinib is evident and resistance mechanisms remain incompletely defined. The EGFR G724S mutation was detected using hybrid-capture based comprehensive genomic profiling (CGP) and a hybrid-capture based circulating tumor DNA (ctDNA) assays in two cases of EGFR-driven lung adenocarcinoma in patients who had progressed on osimertinib treatment. This study demonstrates the importance of both tissue and blood based hybrid-capture based genomic profiling at disease progression to identifying novel resistance mechanisms in the clinic. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Plasma fibrin clot properties in the G20210A prothrombin mutation carriers following venous thromboembolism: the effect of rivaroxaban.

    PubMed

    Janion-Sadowska, Agnieszka; Natorska, Joanna; Siudut, Jakub; Ząbczyk, Michal; Stanisz, Andrzej; Undas, Anetta

    2017-08-30

    We sought to investigate whether the G20210A prothrombin mutation modifies plasma fibrin clot properties in patients after venous thromboembolism (VTE) and how rivaroxaban treatment affects these alterations. We studied 34 prothrombin mutation heterozygous carriers and sex- and age-matched 34 non-carriers, all at least three months since the first VTE episode, before and during treatment with rivaroxaban. Clot permeability (K s ) and clot lysis time (CLT) with or without elimination of thrombin activatable fibrinolysis inhibitor (TAFI) were assessed at baseline, 2-6 hours (h) after and 20-25 h after intake of rivaroxaban (20 mg/day). At baseline, the prothrombin mutation group formed denser clots (K s -12 %, p=0.0006) and had impaired fibrinolysis (CLT +14 %, p=0.004, and CLT-TAFI +13 %, p=0.03) compared with the no mutation group and were similar to those observed in 15 healthy unrelated prothrombin mutation carriers. The G20210A prothrombin mutation was the independent predictor for K s and CLT before rivaroxaban intake. At 2-6 h after rivaroxaban intake, clot properties improved in both G20210A carriers and non-carriers (K s +38 %, and +37 %, CLT -25 % and -25 %, CLT-TAFI -20 % and -24 %, respectively, all p<0.001), but those parameters were worse in the prothrombin mutation group (K s -12.8 %, CLT +17 %, CLT-TAFI +13 %, all p<0.001). Rivaroxaban concentration correlated with fibrin clot properties. After 20-25 h since rivaroxaban intake most clot properties returned to baseline. Rivaroxaban-related differences in clot structure were confirmed by scanning electron microscopy images. In conclusion, rivaroxaban treatment, though improves fibrin clot properties, cannot abolish more prothrombotic fibrin clot phenotype observed in prothrombin mutation carriers following VTE.

  11. 49 CFR 193.2019 - Mobile and temporary LNG facilities.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 49 Transportation 3 2011-10-01 2011-10-01 false Mobile and temporary LNG facilities. 193.2019... LIQUEFIED NATURAL GAS FACILITIES: FEDERAL SAFETY STANDARDS General § 193.2019 Mobile and temporary LNG facilities. (a) Mobile and temporary LNG facilities for peakshaving application, for service maintenance...

  12. Analysis of human MutS homolog 2 missense mutations in patients with colorectal cancer.

    PubMed

    Zhang, Xiaomei; Chen, Senqing; Yu, Jun; Zhang, Yuanying; Lv, Min; Zhu, Ming

    2018-05-01

    Germline mutations of DNA mismatch repair gene human MutS homolog 2 ( hMSH2 ) are associated with hereditary nonpolyposis colorectal cancer (HNPCC). A total of one-third of these mutations are missense mutations. Several hMSH2 missense mutations have been identified in patients in East Asia, although their function has not been evaluated. In the present study, the role of ten hMSH2 missense mutations in the pathogenesis of colorectal cancer was examined. The hMSH2/hMSH6 protein interaction system was established using yeast two-hybrid screening. Next, the missense mutations were analyzed for their ability to affect the protein interaction of hMSH2 with its partner hMSH6. Additionally, the Sorting Intolerant from Tolerant tool was applied to predict the effects of different amino acid substitutions. The results demonstrated that certain hMSH2 mutations (L173R and C199R) caused a significant functional change in the human hMutSα complex and were identified to be pathological mutations. The Y408C, D603Y, P696L and S703Y mutations partially affected interaction and partly affected the function of hMSH2. The remaining four variants, T8M, I169V, A370T and Q419K, may be non-functional polymorphisms or could affect protein function through other molecular mechanisms. The present study evaluated the functional consequences of previously unknown missense mutations in hMSH2 , and may contribute to improved clinical diagnosis and mutation screening of HNPCC.

  13. Forest Service Global Change Research Strategy, 2009-2019 Implementation Plan

    Treesearch

    Allen Solomon; Richard A. Birdsey; Linda A. Joyce

    2010-01-01

    In keeping with the research goals of the U.S. Global Change Research Program, the climate change strategy of the U.S. Department of Agriculture (USDA), and the climate change framework of the Forest Service, this Forest Service Global Change Research Strategy, 2009-2019 Implementation Plan (hereafter called the Research Plan), was written by Forest Service Research...

  14. Early-Onset L-dopa-Responsive Parkinsonism with Pyramidal Signs Due to ATP13A2, PLA2G6, FBXO7 and Spatacsin Mutations

    PubMed Central

    Paisán-Ruiz, Coro; Guevara, Rocio; Federoff, Monica; Hanagasi, Hasmet; Sina, Fardaz; Elahi, Elahe; Schneider, Susanne A.; Schwingenschuh, Petra; Bajaj, Nin; Emre, Murat; Singleton, Andrew B.; Hardy, John; Bhatia, Kailash P.; Brandner, Sebastian; Lees, Andrew J.; Houlden, Henry

    2018-01-01

    Seven autosomal recessive genes associated with juvenile and young-onset Levodopa-responsive parkinsonism have been identified. Mutations in PRKN, DJ-1, and PINK1 are associated with a rather pure parkinsonian phenotype, and have a more benign course with sustained treatment response and absence of dementia. On the other hand, Kufor-Rakeb syndrome has additional signs, which distinguish it clearly from Parkinson’s disease including supranu-clear vertical gaze palsy, myoclonic jerks, pyramidal signs, and cognitive impairment. Neurodegeneration with brain iron accumulation type I (Hallervorden-Spatz syndrome) due to mutations in PANK2 gene may share similar features with Kufor-Rakeb syndrome. Mutations in three other genes, PLA2G6 (PARK14), FBXO7 (PARK15), and Spatacsin (SPG11) also produce clinical similar phenotypes in that they presented with rapidly progressive parkinsonism, initially responsive to Levodopa treatment but later, developed additional features including cognitive decline and loss of Levodopa responsiveness. Here, using homozygosity mapping and sequence analysis in families with complex parkinsonisms, we identified genetic defects in the ATP13A2 (1 family), PLA2G6 (1 family) FBXO7 (2 families), and SPG11 (1 family). The genetic heterogeneity was surprising given their initially common clinical features. On careful review, we found the FBXO7 cases to have a phenotype more similar to PRKN gene associated parkinsonism. The ATP13A2 and PLA2G6 cases were more seriously disabled with additional swallowing problems, dystonic features, severe in some, and usually pyramidal involvement including pyramidal weakness. These data suggest that these four genes account for many cases of Levodopa responsive parkinsonism with pyramidal signs cases formerly categorized clinically as pallido-pyramidal syndrome. 3 2010 Movement Disorder Society PMID:20669327

  15. G20210A prothrombin gene mutation identified in patients with venous leg ulcers.

    PubMed

    Jebeleanu, G; Procopciuc, L

    2001-01-01

    The G20210A mutation variant of prothrombin gene is the second most frequent mutation identified in patients with deep venous thrombosis, after factor V Leiden. The risk for developing deep venous thrombosis is high in patients identified as heterozygous for G20210A mutation. In order to identify this polymorphism in the gene coding prothrombin, the 345bp fragment in the 3'- untranslated region of the prothrombin gene was amplified using amplification by polymerase chain reaction and enzymatic digestion by HindIII (restriction endonuclease enzyme). The products of amplification and enzymatic's digestion were analized using agarose gel electrophoresis. We investigated 20 patients with venous leg ulcers and we found 2 heterozygous (10%) for G20210A mutation. None of the patients in the control group had G20210A mutation. Our study confirms the presence of G20210A mutation in the Romanian population. Our study also shows the link between venous leg ulcers and this polymorphism in the prothrombin gene.

  16. BRCA2, EGFR, and NTRK mutations in mismatch repair-deficient colorectal cancers with MSH2 or MLH1 mutations.

    PubMed

    Deihimi, Safoora; Lev, Avital; Slifker, Michael; Shagisultanova, Elena; Xu, Qifang; Jung, Kyungsuk; Vijayvergia, Namrata; Ross, Eric A; Xiu, Joanne; Swensen, Jeffrey; Gatalica, Zoran; Andrake, Mark; Dunbrack, Roland L; El-Deiry, Wafik S

    2017-06-20

    Deficient mismatch repair (MMR) and microsatellite instability (MSI) contribute to ~15% of colorectal cancer (CRCs). We hypothesized MSI leads to mutations in DNA repair proteins including BRCA2 and cancer drivers including EGFR. We analyzed mutations among a discovery cohort of 26 MSI-High (MSI-H) and 558 non-MSI-H CRCs profiled at Caris Life Sciences. Caris-profiled MSI-H CRCs had high mutation rates (50% vs 14% in non-MSI-H, P < 0.0001) in BRCA2. Of 1104 profiled CRCs from a second cohort (COSMIC), MSH2/MLH1-mutant CRCs showed higher mutation rates in BRCA2 compared to non-MSH2/MLH1-mutant tumors (38% vs 6%, P < 0.0000001). BRCA2 mutations in MSH2/MLH1-mutant CRCs included 75 unique mutations not known to occur in breast or pancreatic cancer per COSMIC v73. Only 5 deleterious BRCA2 mutations in CRC were previously reported in the BIC database as germ-line mutations in breast cancer. Some BRCA2 mutations were predicted to disrupt interactions with partner proteins DSS1 and RAD51. Some CRCs harbored multiple BRCA2 mutations. EGFR was mutated in 45.5% of MSH2/MLH1-mutant and 6.5% of non-MSH2/MLH1-mutant tumors (P < 0.0000001). Approximately 15% of EGFR mutations found may be actionable through TKI therapy, including N700D, G719D, T725M, T790M, and E884K. NTRK gene mutations were identified in MSH2/MLH1-mutant CRC including NTRK1 I699V, NTRK2 P716S, and NTRK3 R745L. Our findings have clinical relevance regarding therapeutic targeting of BRCA2 vulnerabilities, EGFR mutations or other identified oncogenic drivers such as NTRK in MSH2/MLH1-mutant CRCs or other tumors with mismatch repair deficiency.

  17. AP1S2 is mutated in X-linked Dandy-Walker malformation with intellectual disability, basal ganglia disease and seizures (Pettigrew syndrome).

    PubMed

    Cacciagli, Pierre; Desvignes, Jean-Pierre; Girard, Nadine; Delepine, Marc; Zelenika, Diana; Lathrop, Mark; Lévy, Nicolas; Ledbetter, David H; Dobyns, William B; Villard, Laurent

    2014-03-01

    MRXS5 or Pettigrew syndrome was described 20 years ago in a four generation family including nine affected individuals presenting with facial dysmorphism, intellectual disability, Dandy-Walker malformation and inconstant choreoathetosis. Four individuals had iron deposition in the basal ganglia seen on MRI or at autopsy. The mutation causing Pettigrew has remained elusive since the initial description of the condition. We report the identification of a mutation in the X-linked AP1S2 gene in the original Pettigrew syndrome family using X-chromosome exome sequencing. We report additional phenotype details for several of the affected individuals, allowing us to further refine the phenotype corresponding to this X-linked intellectual disability syndrome. The AP1S2 c.426+1 G>T mutation segregates with the disease in the Pettigrew syndrome family and results in loss of 46 amino acids in the clathrin adaptor complex small chain domain that spans most of the AP1S2 protein sequence. The mutation reported here in AP1S2 is the first mutation that is not predicted to cause a premature termination of the coding sequence or absence of the AP1S2 protein. Although most of the families affected by a mutation in AP1S2 were initially described as having different disorders assigned to at least three different OMIM numbers (MIM 300629, 300630 and 304340), our analysis of the phenotype shows that they are all the same syndrome with recognition complicated by highly variable expressivity that is seen within as well as between families and is probably not explained by differences in mutation severity.

  18. AP1S2 is mutated in X-linked Dandy–Walker malformation with intellectual disability, basal ganglia disease and seizures (Pettigrew syndrome)

    PubMed Central

    Cacciagli, Pierre; Desvignes, Jean-Pierre; Girard, Nadine; Delepine, Marc; Zelenika, Diana; Lathrop, Mark; Lévy, Nicolas; Ledbetter, David H; Dobyns, William B; Villard, Laurent

    2014-01-01

    MRXS5 or Pettigrew syndrome was described 20 years ago in a four generation family including nine affected individuals presenting with facial dysmorphism, intellectual disability, Dandy–Walker malformation and inconstant choreoathetosis. Four individuals had iron deposition in the basal ganglia seen on MRI or at autopsy. The mutation causing Pettigrew has remained elusive since the initial description of the condition. We report the identification of a mutation in the X-linked AP1S2 gene in the original Pettigrew syndrome family using X-chromosome exome sequencing. We report additional phenotype details for several of the affected individuals, allowing us to further refine the phenotype corresponding to this X-linked intellectual disability syndrome. The AP1S2 c.426+1 G>T mutation segregates with the disease in the Pettigrew syndrome family and results in loss of 46 amino acids in the clathrin adaptor complex small chain domain that spans most of the AP1S2 protein sequence. The mutation reported here in AP1S2 is the first mutation that is not predicted to cause a premature termination of the coding sequence or absence of the AP1S2 protein. Although most of the families affected by a mutation in AP1S2 were initially described as having different disorders assigned to at least three different OMIM numbers (MIM 300629, 300630 and 304340), our analysis of the phenotype shows that they are all the same syndrome with recognition complicated by highly variable expressivity that is seen within as well as between families and is probably not explained by differences in mutation severity. PMID:23756445

  19. Effects of HCM cTnI Mutation R145G on Troponin Structure and Modulation by PKA Phosphorylation Elucidated by Molecular Dynamics Simulations

    PubMed Central

    Lindert, Steffen; Cheng, Yuanhua; Kekenes-Huskey, Peter; Regnier, Michael; McCammon, J. Andrew

    2015-01-01

    Cardiac troponin (cTn) is a key molecule in the regulation of human cardiac muscle contraction. The N-terminal cardiac-specific peptide of the inhibitory subunit of troponin, cTnI (cTnI1-39), is a target for phosphorylation by protein kinase A (PKA) during β-adrenergic stimulation. We recently presented evidence indicating that this peptide interacts with the inhibitory peptide (cTnl137–147) when S23 and S24 are phosphorylated. The inhibitory peptide is also the target of the point mutation cTnI-R145G, which is associated with hypertrophic cardiomyopathy (HCM), a disease associated with sudden death in apparently healthy young adults. It has been shown that both phosphorylation and this mutation alter the cTnC-cTnI (C-I) interaction, which plays a crucial role in modulating contractile activation. However, little is known about the molecular-level events underlying this modulation. Here, we computationally investigated the effects of the cTnI-R145G mutation on the dynamics of cTn, cTnC Ca2+ handling, and the C-I interaction. Comparisons were made with the cTnI-R145G/S23D/S24D phosphomimic mutation, which has been used both experimentally and computationally to study the cTnI N-terminal specific effects of PKA phosphorylation. Additional comparisons between the phosphomimic mutations and the real phosphorylations were made. For this purpose, we ran triplicate 150 ns molecular dynamics simulations of cTnI-R145G Ca2+-bound cTnC1-161-cTnI1-172-cTnT236-285, cTnI-R145G/S23D/S24D Ca2+-bound cTnC1-161-cTnI1-172-cTnT236-285, and cTnI-R145G/PS23/PS24 Ca2+-bound cTnC1-161-cTnI1-172-cTnT236-285, respectively. We found that the cTnI-R145G mutation did not impact the overall dynamics of cTn, but stabilized crucial Ca2+-coordinating interactions. However, the phosphomimic mutations increased overall cTn fluctuations and destabilized Ca2+ coordination. Interestingly, cTnI-R145G blunted the intrasubunit interactions between the cTnI N-terminal extension and the cTnI inhibitory

  20. Effects of HCM cTnI mutation R145G on troponin structure and modulation by PKA phosphorylation elucidated by molecular dynamics simulations.

    PubMed

    Lindert, Steffen; Cheng, Yuanhua; Kekenes-Huskey, Peter; Regnier, Michael; McCammon, J Andrew

    2015-01-20

    Cardiac troponin (cTn) is a key molecule in the regulation of human cardiac muscle contraction. The N-terminal cardiac-specific peptide of the inhibitory subunit of troponin, cTnI (cTnI(1-39)), is a target for phosphorylation by protein kinase A (PKA) during β-adrenergic stimulation. We recently presented evidence indicating that this peptide interacts with the inhibitory peptide (cTnl(137-147)) when S23 and S24 are phosphorylated. The inhibitory peptide is also the target of the point mutation cTnI-R145G, which is associated with hypertrophic cardiomyopathy (HCM), a disease associated with sudden death in apparently healthy young adults. It has been shown that both phosphorylation and this mutation alter the cTnC-cTnI (C-I) interaction, which plays a crucial role in modulating contractile activation. However, little is known about the molecular-level events underlying this modulation. Here, we computationally investigated the effects of the cTnI-R145G mutation on the dynamics of cTn, cTnC Ca(2+) handling, and the C-I interaction. Comparisons were made with the cTnI-R145G/S23D/S24D phosphomimic mutation, which has been used both experimentally and computationally to study the cTnI N-terminal specific effects of PKA phosphorylation. Additional comparisons between the phosphomimic mutations and the real phosphorylations were made. For this purpose, we ran triplicate 150 ns molecular dynamics simulations of cTnI-R145G Ca(2+)-bound cTnC(1-161)-cTnI(1-172)-cTnT(236-285), cTnI-R145G/S23D/S24D Ca(2+)-bound cTnC(1-161)-cTnI(1-172)-cTnT(236-285), and cTnI-R145G/PS23/PS24 Ca(2+)-bound cTnC(1-161)-cTnI(1-172)-cTnT(236-285), respectively. We found that the cTnI-R145G mutation did not impact the overall dynamics of cTn, but stabilized crucial Ca(2+)-coordinating interactions. However, the phosphomimic mutations increased overall cTn fluctuations and destabilized Ca(2+) coordination. Interestingly, cTnI-R145G blunted the intrasubunit interactions between the cTnI N

  1. Computational Analysis of KRAS Mutations: Implications for Different Effects on the KRAS p.G12D and p.G13D Mutations

    PubMed Central

    Liu, Yen-Yi; Hwang, Jenn-Kang; Barrio, Maria Jesus; Rodrigo, Maximiliano; Garcia-Toro, Enrique; Herreros-Villanueva, Marta

    2013-01-01

    Background The issue of whether patients diagnosed with metastatic colorectal cancer who harbor KRAS codon 13 mutations could benefit from the addition of anti-epidermal growth factor receptor therapy remains under debate. The aim of the current study was to perform computational analysis to investigate the structural implications of the underlying mutations caused by c.38G>A (p.G13D) on protein conformation. Methods Molecular dynamics (MD) simulations were performed to understand the plausible structural and dynamical implications caused by c.35G>A (p.G12D) and c.38G>A (p.G13D). The potential of mean force (PMF) simulations were carried out to determine the free energy profiles of the binding processes of GTP interacting with wild-type (WT) KRAS and its mutants (MT). Results Using MD simulations, we observed that the root mean square deviation (RMSD) increased as a function of time for the MT c.35G>A (p.G12D) and MT c.38G>A (p.G13D) when compared with the WT. We also observed that the GTP-binding pocket in the c.35G>A (p.G12D) mutant is more open than that of the WT and the c.38G>A (p.G13D) proteins. Intriguingly, the analysis of atomic fluctuations and free energy profiles revealed that the mutation of c.35G>A (p.G12D) may induce additional fluctuations in the sensitive sites (P-loop, switch I and II regions). Such fluctuations may promote instability in these protein regions and hamper GTP binding. Conclusions Taken together with the results obtained from MD and PMF simulations, the present findings implicate fluctuations at the sensitive sites (P-loop, switch I and II regions). Our findings revealed that KRAS mutations in codon 13 have similar behavior as KRAS WT. To gain a better insight into why patients with metastatic colorectal cancer (mCRC) and the KRAS c.38G>A (p.G13D) mutation appear to benefit from anti-EGFR therapy, the role of the KRAS c.38G>A (p.G13D) mutation in mCRC needs to be further investigated. PMID:23437064

  2. Mutations in SLC2A2 Gene Reveal hGLUT2 Function in Pancreatic β Cell Development*

    PubMed Central

    Michau, Aurélien; Guillemain, Ghislaine; Grosfeld, Alexandra; Vuillaumier-Barrot, Sandrine; Grand, Teddy; Keck, Mathilde; L'Hoste, Sébastien; Chateau, Danielle; Serradas, Patricia; Teulon, Jacques; De Lonlay, Pascale; Scharfmann, Raphaël; Brot-Laroche, Edith; Leturque, Armelle; Le Gall, Maude

    2013-01-01

    The structure-function relationships of sugar transporter-receptor hGLUT2 coded by SLC2A2 and their impact on insulin secretion and β cell differentiation were investigated through the detailed characterization of a panel of mutations along the protein. We studied naturally occurring SLC2A2 variants or mutants: two single-nucleotide polymorphisms and four proposed inactivating mutations associated to Fanconi-Bickel syndrome. We also engineered mutations based on sequence alignment and conserved amino acids in selected domains. The single-nucleotide polymorphisms P68L and T110I did not impact on sugar transport as assayed in Xenopus oocytes. All the Fanconi-Bickel syndrome-associated mutations invalidated glucose transport by hGLUT2 either through absence of protein at the plasma membrane (G20D and S242R) or through loss of transport capacity despite membrane targeting (P417L and W444R), pointing out crucial amino acids for hGLUT2 transport function. In contrast, engineered mutants were located at the plasma membrane and able to transport sugar, albeit with modified kinetic parameters. Notably, these mutations resulted in gain of function. G20S and L368P mutations increased insulin secretion in the absence of glucose. In addition, these mutants increased insulin-positive cell differentiation when expressed in cultured rat embryonic pancreas. F295Y mutation induced β cell differentiation even in the absence of glucose, suggesting that mutated GLUT2, as a sugar receptor, triggers a signaling pathway independently of glucose transport and metabolism. Our results describe the first gain of function mutations for hGLUT2, revealing the importance of its receptor versus transporter function in pancreatic β cell development and insulin secretion. PMID:23986439

  3. Dent’s disease: Identification of seven new pathogenic mutations in the CLCN5 gene

    PubMed Central

    Ramos-Trujillo, Elena; Claverie-Martin, Felix; Garcia-Nieto, Victor; Ariceta, Gema; Vara, Julia; Gonzalez-Acosta, Hilaria; Garcia-Ramirez, Marta; Fons, Jaime; Cordoba-Lanus, Elizabeth; Gonzalez-Paredes, Javier; Valenciano, Blanca; Ramos, Leticia; Muley, Rafael; Caggiani, Marina; Alvarez-Estrada, Pilar; Madrid, Alvaro

    2013-01-01

    Dent’s disease is an X-linked proximal tubulopathy characterized by low-molecular-weight proteinuria, hypercalciuria, nephrocalcinosis, nephrolithiasis and progressive renal failure. This disorder is frequently caused by mutations in the CLCN5 gene encoding the electrogenic chloride/proton exchanger ClC-5. Occasionally, Dent’s disease has been associated to atypical cases of asymptomatic proteinuria with focal glomerulosclerosis. Twelve unrelated patients with Dent’s disease, including two who presented with asymptomatic proteinuria and developed glomerulosclerosis, were studied. Mutational analysis of the CLCN5 gene was performed by DNA sequencing. We identified thirteen distinct CLCN5 mutations in the twelve patients. Seven of these mutations, p.P416fsX*17, p.[H107P, V108fs*27], p.G466D, p.G65R, p.G462S, p.Y164* and c.723+1G >T, were novel and possibly pathogenic. In one family, the patient’s mother was not a carrier of the respective mutation. Our results increased the spectrum of CLCN5 disease causing defects with seven new pathogenic mutations and established a de novo origin in one of them. Remarkably, three new missense mutations, p.G466D, p.G65R and p.G462S, affect highly conserved glycine residues located in transmembrane α-helix GxxxG packing motifs. The two atypical cases further support that the diagnosis of Dent’s disease should be considered in children with asymptomatic proteinuria and focal glomerulosclerosis and without evidence of primary glomerular disease. PMID:27625851

  4. The insulin-like growth factor 2 (IGF2) gene intron3-g.3072G>A polymorphism is not the only Sus scrofa chromosome 2p mutation affecting meat production and carcass traits in pigs: evidence from the effects of a cathepsin D (CTSD) gene polymorphism.

    PubMed

    Fontanesi, L; Speroni, C; Buttazzoni, L; Scotti, E; Dall'Olio, S; Nanni Costa, L; Davoli, R; Russo, V

    2010-07-01

    The objective of this study was to evaluate the effects of mutations in 2 genes [IGF2 and cathepsin D (CTSD)] that map on the telomeric end of the p arm of SSC2. In this region, an imprinted QTL affecting muscle mass and fat deposition was reported, and the IGF2 intron3-g.3072G>A substitution was identified as the causative mutation. In the same chromosome region, we assigned, by linkage mapping, the CTSD gene, a lysosomal proteinase, for which we previously identified an SNP in the 3'-untranslated region (AM933484, g.70G>A). We have already shown strong effects of this CTSD mutation on several production traits in Italian Large White pigs, suggesting a possible independent role of this marker in fatness and meat deposition in pigs. To evaluate this hypothesis, after having refined the map position of the CTSD gene by radiation hybrid mapping, we analyzed the IGF2 and the CTSD polymorphisms in 270 Italian Large White and 311 Italian Duroc pigs, for which EBV and random residuals from fixed models were calculated for several traits. Different association analyses were carried out to distinguish the effects of the 2 close markers. In the Italian Large White pigs, the results for IGF2 were highly significant for all traits when using either EBV or random residuals (e.g., using EBV: lean cuts, P = 2.2 x 10(-18); ADG, P = 2.6 x 10(-16); backfat thickness, P = 2.2 x 10(-9); feed:gain ratio, P = 2.3 x 10(-9); ham weight, P = 1.5 x 10(-6)). No effect was observed for meat quality traits. The IGF2 intron3-g.3072G>A mutation did not show any association in the Italian Duroc pigs, probably because of the small variability at this polymorphic site for this breed. However, a significant association was evident for the CTSD marker (P < 0.001) with EBV of all carcass and production traits in Italian Duroc pigs (lean content, ADG, backfat thickness, feed:gain ratio) after excluding possible confounding effects of the IGF2 mutation. The effects of the CTSD g.70G>A mutation were

  5. Novel USH2A mutations in Japanese Usher syndrome type 2 patients: marked differences in the mutation spectrum between the Japanese and other populations.

    PubMed

    Nakanishi, Hiroshi; Ohtsubo, Masafumi; Iwasaki, Satoshi; Hotta, Yoshihiro; Usami, Shin-Ichi; Mizuta, Kunihiro; Mineta, Hiroyuki; Minoshima, Shinsei

    2011-07-01

    Usher syndrome (USH) is an autosomal recessive disorder characterized by retinitis pigmentosa and hearing loss. USH type 2 (USH2) is the most common type of USH and is frequently caused by mutations in USH2A. In a recent mutation screening of USH2A in Japanese USH2 patients, we identified 11 novel mutations in 10 patients and found the possible frequent mutation c.8559-2A>G in 4 of 10 patients. To obtain a more precise mutation spectrum, we analyzed further nine Japanese patients in this study. We identified nine mutations, of which eight were novel. This result indicates that the mutation spectrum for USH2A among Japanese patients largely differs from Caucasian, Jewish and Palestinian patients. Meanwhile, we did not find the c.8559-2A>G in this study. Haplotype analysis of the c.8559-2G (mutated) alleles using 23 single nucleotide polymorphisms surrounding the mutation revealed an identical haplotype pattern of at least 635 kb in length, strongly suggesting that the mutation originated from a common ancestor. The fact that all patients carrying c.8559-2A>G came from western Japan suggests that the mutation is mainly distributed in that area; indeed, most of the patients involved in this study came from eastern Japan, which contributed to the absence of c.8559-2A>G.

  6. Confirmation of the pathogenicity of a mutation p.G337C in the COL1A2 gene associated with osteogenesis imperfecta

    PubMed Central

    Jia, Mingrui; Shi, Ranran; Zhao, Xuli; Fu, Zhijian; Bai, Zhijing; Sun, Tao; Zhao, Xuejun; Wang, Wenbo; Xu, Chao; Yan, Fang

    2017-01-01

    Abstract Mutation analysis as the gold standard is particularly important in diagnosis of osteogenesis imperfecta (OI) and it may be preventable upon early diagnosis. In this study, we aimed to analyze the clinical and genetic materials of an OI pedigree as well as to confirm the deleterious property of the mutation. A pedigree with OI was identified. All family members received careful clinical examinations and blood was drawn for genetic analyses. Genes implicated in OI were screened for mutation. The function and structure of the mutant protein were predicted using bioinformatics analysis. The proband, a 9-month fetus, showed abnormal sonographic images. Disproportionately short and triangular face with blue sclera was noticed at birth. She can barely walk and suffered multiple fractures till 2-year old. Her mother appeared small stature, frequent fractures, blue sclera, and deformity of extremities. A heterozygous missense mutation c.1009G>T (p.G337C) in the COL1A2 gene was identified in her mother and her. Bioinformatics analysis showed p.G337 was well-conserved among multiple species and the mutation probably changed the structure and damaged the function of collagen. We suggest that the mutation p.G337C in the COL1A2 gene is pathogenic for OI by affecting the protein structure and the function of collagen. PMID:28953610

  7. Activating HER2 mutations in HER2 gene amplification negative breast cancer.

    PubMed

    Bose, Ron; Kavuri, Shyam M; Searleman, Adam C; Shen, Wei; Shen, Dong; Koboldt, Daniel C; Monsey, John; Goel, Nicholas; Aronson, Adam B; Li, Shunqiang; Ma, Cynthia X; Ding, Li; Mardis, Elaine R; Ellis, Matthew J

    2013-02-01

    Data from 8 breast cancer genome-sequencing projects identified 25 patients with HER2 somatic mutations in cancers lacking HER2 gene amplification. To determine the phenotype of these mutations, we functionally characterized 13 HER2 mutations using in vitro kinase assays, protein structure analysis, cell culture, and xenograft experiments. Seven of these mutations are activating mutations, including G309A, D769H, D769Y, V777L, P780ins, V842I, and R896C. HER2 in-frame deletion 755-759, which is homologous to EGF receptor (EGFR) exon 19 in-frame deletions, had a neomorphic phenotype with increased phosphorylation of EGFR or HER3. L755S produced lapatinib resistance, but was not an activating mutation in our experimental systems. All of these mutations were sensitive to the irreversible kinase inhibitor, neratinib. These findings show that HER2 somatic mutation is an alternative mechanism to activate HER2 in breast cancer and they validate HER2 somatic mutations as drug targets for breast cancer treatment. We show that the majority of HER2 somatic mutations in breast cancer patients are activating mutations that likely drive tumorigenesis. Several patients had mutations that are resistant to the reversible HER2 inhibitor lapatinib, but are sensitive to the irreversible HER2 inhibitor, neratinib. Our results suggest that patients with HER2 mutation–positive breast cancers could benefit from existing HER2-targeted drugs.

  8. Voltage-sensitive sodium channel mutations S989P + V1016G in Aedes aegypti confer variable resistance to pyrethroids, DDT and oxadiazines.

    PubMed

    Smith, Letícia B; Kasai, Shinji; Scott, Jeffrey G

    2018-03-01

    Aedes aegypti is a vector of several important human pathogens. Control efforts rely primarily on pyrethroid insecticides for adult mosquito control, especially during disease outbreaks. A. aegypti has developed resistance nearly everywhere it occurs and insecticides are used. An important mechanism of resistance is due to mutations in the voltage-sensitive sodium channel (Vssc) gene. Two mutations, in particular, S989P + V1016G, commonly occur together in parts of Asia. We have created a strain (KDR:ROCK) that contains the Vssc mutations S989P + V1016G as the only mechanism of pyrethroid resistance within the genetic background of Rockefeller (ROCK), a susceptible lab strain. We created KDR:ROCK by crossing the pyrethroid-resistant strain Singapore with ROCK followed by four backcrosses with ROCK and Vssc S989P + V1016G genotype selections. We determined the levels of resistance conferred to 17 structurally diverse pyrethroids, the organochloride DDT, and oxadiazines (VSSC blockers) indoxacarb (proinsecticide) and DCJW (the active metabolite of indoxacarb). Levels of resistance to the pyrethroids were variable, ranging from 21- to 107-fold, but no clear pattern between resistance and chemical structure was observed. Resistance is inherited as an incompletely recessive trait. KDR:ROCK had a > 2000-fold resistance to DDT, 37.5-fold cross-resistance to indoxacarb and 13.4-fold cross-resistance to DCJW. Etofenprox (and DDT) should be avoided in areas where Vssc mutations S989P + V1016G exist at high frequencies. We found that pyrethroid structure cannot be used to predict the level of resistance conferred by kdr. These results provide useful information for resistance management and for better understanding pyrethroid interactions with VSSC. © 2017 The Authors. Pest Management Science published by John Wiley & Sons Ltd on behalf of Society of Chemical Industry. © 2017 The Authors. Pest Management Science published by John Wiley & Sons Ltd on behalf of Society of

  9. Functional analysis of H. sapiens DNA polymerase γ spacer mutation W748S with and without common variant E1143G

    PubMed Central

    Palin, Eino JH; Lesonen, Annamari; Farr, Carol L; Euro, Liliya; Suomalainen, Anu; Kaguni, Laurie S

    2010-01-01

    Mitochondrial DNA polymerase, POLG, is the sole DNA polymerase found in animal mitochondria. In humans, POLGα W748S in cis with an E1143G mutation has been linked to a new type of recessive ataxia, MIRAS, which is the most common inherited ataxia in Finland. We investigated the biochemical phenotypes of the W748S amino acid change, using recombinant human POLG. We measured processive and non-processive DNA polymerase activity, DNA binding affinity, enzyme processivity, and subunit interaction with recombinant POLGβ. In addition, we studied the effects of the W748S and E1143G mutations in primary human cell cultures using retroviral transduction. Here, we examined cell viability, mitochondrial DNA copy number, and products of mitochondrial translation. Our results indicate that the W748S mutant POLGα does not exhibit a clear biochemical phenotype, making it indistinguishable from wild type POLGα and as such, fail to replicate previously published results. Furthermore, results from the cell models were concurrent with the findings from patients, and support our biochemical findings. PMID:20153822

  10. Effect of the G375C and G346E achondroplasia mutations on FGFR3 activation.

    PubMed

    He, Lijuan; Serrano, Christopher; Niphadkar, Nitish; Shobnam, Nadia; Hristova, Kalina

    2012-01-01

    Two mutations in FGFR3, G380R and G375C are known to cause achondroplasia, the most common form of human dwarfism. The G380R mutation accounts for 98% of the achondroplasia cases, and thus has been studied extensively. Here we study the effect of the G375C mutation on the phosphorylation and the cross-linking propensity of full-length FGFR3 in HEK 293 cells, and we compare the results to previously published results for the G380R mutant. We observe identical behavior of the two achondroplasia mutants in these experiments, a finding which supports a direct link between the severity of dwarfism phenotypes and the level and mechanism of FGFR3 over-activation. The mutations do not increase the cross-linking propensity of FGFR3, contrary to previous expectations that the achondroplasia mutations stabilize the FGFR3 dimers. Instead, the phosphorylation efficiency within un-liganded FGFR3 dimers is increased, and this increase is likely the underlying cause for pathogenesis in achondroplasia. We further investigate the G346E mutation, which has been reported to cause achondroplasia in one case. We find that this mutation does not increase FGFR3 phosphorylation and decreases FGFR3 cross-linking propensity, a finding which raises questions whether this mutation is indeed a genetic cause for human dwarfism.

  11. Effect of the G375C and G346E Achondroplasia Mutations on FGFR3 Activation

    PubMed Central

    He, Lijuan; Serrano, Christopher; Niphadkar, Nitish; Shobnam, Nadia; Hristova, Kalina

    2012-01-01

    Two mutations in FGFR3, G380R and G375C are known to cause achondroplasia, the most common form of human dwarfism. The G380R mutation accounts for 98% of the achondroplasia cases, and thus has been studied extensively. Here we study the effect of the G375C mutation on the phosphorylation and the cross-linking propensity of full-length FGFR3 in HEK 293 cells, and we compare the results to previously published results for the G380R mutant. We observe identical behavior of the two achondroplasia mutants in these experiments, a finding which supports a direct link between the severity of dwarfism phenotypes and the level and mechanism of FGFR3 over-activation. The mutations do not increase the cross-linking propensity of FGFR3, contrary to previous expectations that the achondroplasia mutations stabilize the FGFR3 dimers. Instead, the phosphorylation efficiency within un-liganded FGFR3 dimers is increased, and this increase is likely the underlying cause for pathogenesis in achondroplasia. We further investigate the G346E mutation, which has been reported to cause achondroplasia in one case. We find that this mutation does not increase FGFR3 phosphorylation and decreases FGFR3 cross-linking propensity, a finding which raises questions whether this mutation is indeed a genetic cause for human dwarfism. PMID:22529939

  12. Homozygosity Mapping and Whole Exome Sequencing to Detect SLC45A2 and G6PC3 Mutations in a Single Patient with Oculocutaneous Albinism and Neutropenia

    PubMed Central

    Cullinane, Andrew R.; Vilboux, Thierry; O’Brien, Kevin; Curry, James A.; Maynard, Dawn M.; Carlson-Donohoe, Hannah; Ciccone, Carla; Markello, Thomas C.; Gunay-Aygun, Meral; Huizing, Marjan; Gahl, William A.

    2011-01-01

    We evaluated a 32 year-old woman whose oculocutaneous albinism, bleeding diathesis, neutropenia, and history of recurrent infections prompted consideration of the diagnosis of Hermansky-Pudlak syndrome type 2 (HPS-2). This was ruled out due to the presence of platelet delta granules and absence of AP3B1 mutations. Since parental consanguinity suggested an autosomal recessive mode of inheritance, we employed homozygosity mapping, followed by whole exome sequencing, to identify two candidate disease-causing genes, SLC45A2 and G6PC3. Conventional di-deoxy sequencing confirmed pathogenic mutations in SLC45A2, associated with oculocutaneous albinism type 4 (OCA-4), and G6PC3, associated with neutropenia. The substantial reduction of SLC45A2 protein in the patient’s melanocytes caused the mis-localization of tyrosinase from melanosomes to the plasma membrane and also led to the incorporation of tyrosinase into exosomes and secretion into the culture medium, explaining the hypopigmentation in OCA-4. Our patient’s G6PC3 mRNA expression level was also reduced, leading to increased apoptosis of her fibroblasts under ER stress. This report describes the first North American patient with OCA-4, the first culture of human OCA-4 melanocytes, and the use of homozygosity mapping followed by whole exome sequencing to identify disease-causing mutations in multiple genes in a single affected individual. PMID:21677667

  13. Identification of a novel PMS2 alteration c.505C>G (R169G) in trans with a PMS2 pathogenic mutation in a patient with constitutional mismatch repair deficiency.

    PubMed

    Mork, Maureen E; Borras, Ester; Taggart, Melissa W; Cuddy, Amanda; Bannon, Sarah A; You, Y Nancy; Lynch, Patrick M; Ramirez, Pedro T; Rodriguez-Bigas, Miguel A; Vilar, Eduardo

    2016-10-01

    Constitutional mismatch repair deficiency syndrome (CMMRD) is a rare autosomal recessive predisposition to colorectal polyposis and other malignancies, often childhood-onset, that is caused by biallelic inheritance of mutations in the same mismatch repair gene. Here, we describe a patient with a clinical diagnosis of CMMRD based on colorectal polyposis and young-onset endometrial cancer who was identified to have two alterations in trans in PMS2: one known pathogenic mutation (c.1831insA; p.Ile611Asnfs*2) and one novel variant of uncertain significance (c.505C>G; p.Arg169Glu), a missense alteration. We describe the clinical and molecular features in the patient harboring this novel alteration c.505C>G, who meets clinical criteria for CMMRD and exhibits molecular evidence supporting a diagnosis of CMMRD. Although experimental validation is needed to confirm its pathogenicity, PMS2 c.505C>G likely has functional consequences that contributes to our patient's phenotype based on the patient's clinical presentation, tumor studies, and bioinformatics analysis.

  14. G6PDdb, an integrated database of glucose-6-phosphate dehydrogenase (G6PD) mutations.

    PubMed

    Kwok, Colin J; Martin, Andrew C R; Au, Shannon W N; Lam, Veronica M S

    2002-03-01

    G6PDdb (http://www.rubic.rdg.ac.uk/g6pd/ or http://www.bioinf.org.uk/g6pd/) is a newly created web-accessible locus-specific mutation database for the human Glucose-6-phosphate dehydrogenase (G6PD) gene. The relational database integrates up-to-date mutational and structural data from various databanks (GenBank, Protein Data Bank, etc.) with biochemically characterized variants and their associated phenotypes obtained from published literature and the Favism website. An automated analysis of the mutations likely to have a significant impact on the structure of the protein has been performed using a recently developed procedure. The database may be queried online and the full results of the analysis of the structural impact of mutations are available. The web page provides a form for submitting additional mutation data and is linked to resources such as the Favism website, OMIM, HGMD, HGVBASE, and the PDB. This database provides insights into the molecular aspects and clinical significance of G6PD deficiency for researchers and clinicians and the web page functions as a knowledge base relevant to the understanding of G6PD deficiency and its management. Copyright 2002 Wiley-Liss, Inc.

  15. Heterogeneous reactions of HNO3(g) + NaCl(s) yields HCl(g) + NaNO3(s) and N2O5(g) + NaCl(s) yields ClNO2(g) + NaNO3(s)

    NASA Technical Reports Server (NTRS)

    Leu, Ming-Taun; Timonen, Raimo S.; Keyser, Leon F.; Yung, Yuk L.

    1995-01-01

    The heterogeneous reactions of HNO3(g) + NaCl(s) yields HCl(g) + NaNO3(s) (eq 1) and N2O5(g) + NaCl(s) yields ClNO2(g) + NaNO3(S) (eq 2) were investigated over the temperature range 223-296 K in a flow-tube reactor coupled to a quadrupole mass spectrometer. Either a chemical ionization mass spectrometer (CIMS) or an electron-impact ionization mass spectrometer (EIMS) was used to provide suitable detection sensitivity and selectivity. In order to mimic atmospheric conditions, partial pressures of HNO3 and N2O5 in the range 6 x 10(exp -8) - 2 x 10(exp -6) Torr were used. Granule sizes and surface roughness of the solid NaCl substrates were determined by using a scanning electron microscope. For dry NaCl substrates, decay rates of HNO3 were used to obtain gamma(1) = 0.013 +/- 0.004 (1sigma) at 296 K and > 0.008 at 223 K, respectively. The error quoted is the statistical error. After all corrections were made, the overall error, including systematic error, was estimated to be about a factor of 2. HCl was found to be the sole gas-phase product of reaction 1. The mechanism changed from heterogeneous reaction to predominantly physical adsorption when the reactor was cooled from 296 to 223 K. For reaction 2 using dry salts, gamma(2) was found to be less than 1.0 x 10(exp -4) at both 223 and 296 K. The gas-phase reaction product was identified as ClNO2 in previous studies using an infrared spectrometer. An enhancement in reaction probability was observed if water was not completely removed from salt surfaces, probably due to the reaction of N2O5(g) + H2O(s) yields 2HNO3(g). Our results are compared with previous literature values obtained using different experimental techniques and conditions. The implications of the present results for the enhancement of the hydrogen chloride column density in the lower stratosphere after the El Chichon volcanic eruption and for the chemistry of HCl and HNO3 in the marine troposphere are discussed.

  16. Mutation and polymorphism analysis of the human homogentisate 1, 2-dioxygenase gene in alkaptonuria patients.

    PubMed Central

    Beltrán-Valero de Bernabé, D; Granadino, B; Chiarelli, I; Porfirio, B; Mayatepek, E; Aquaron, R; Moore, M M; Festen, J J; Sanmartí, R; Peñalva, M A; de Córdoba, S R

    1998-01-01

    Alkaptonuria (AKU), a rare hereditary disorder of phenylalanine and tyrosine catabolism, was the first disease to be interpreted as an inborn error of metabolism. AKU patients are deficient for homogentisate 1,2 dioxygenase (HGO); this deficiency causes homogentisic aciduria, ochronosis, and arthritis. We cloned the human HGO gene and characterized two loss-of-function mutations, P230S and V300G, in the HGO gene in AKU patients. Here we report haplotype and mutational analysis of the HGO gene in 29 novel AKU chromosomes. We identified 12 novel mutations: 8 (E42A, W97G, D153G, S189I, I216T, R225H, F227S, and M368V) missense mutations that result in amino acid substitutions at positions conserved in HGO in different species, 1 (F10fs) frameshift mutation, 2 intronic mutations (IVS9-56G-->A, IVS9-17G-->A), and 1 splice-site mutation (IVS5+1G-->T). We also report characterization of five polymorphic sites in HGO and describe the haplotypic associations of alleles at these sites in normal and AKU chromosomes. One of these sites, HGO-3, is a variable dinucleotide repeat; IVS2+35T/A, IVS5+25T/C, and IVS6+46C/A are intronic sites at which single nucleotide substitutions (dimorphisms) have been detected; and c407T/A is a relatively frequent nucleotide substitution in the coding sequence, exon 4, resulting in an amino acid change (H80Q). These data provide insight into the origin and evolution of the various AKU alleles. PMID:9529363

  17. S81L and G170R mutations causing Primary Hyperoxaluria type I in homozygosis and heterozygosis: an example of positive interallelic complementation

    PubMed Central

    Montioli, Riccardo; Roncador, Alessandro; Oppici, Elisa; Mandrile, Giorgia; Giachino, Daniela Francesca; Cellini, Barbara; Borri Voltattorni, Carla

    2014-01-01

    Primary Hyperoxaluria type I (PH1) is a rare disease due to the deficit of peroxisomal alanine:glyoxylate aminotransferase (AGT), a homodimeric pyridoxal-5′-phosphate (PLP) enzyme present in humans as major (Ma) and minor (Mi) allele. PH1-causing mutations are mostly missense identified in both homozygous and compound heterozygous patients. Until now, the pathogenesis of PH1 has been only studied by approaches mimicking homozygous patients, whereas the molecular aspects of the genotype-enzymatic-clinical phenotype relationship in compound heterozygous patients are completely unknown. Here, for the first time, we elucidate the enzymatic phenotype linked to the S81L mutation on AGT-Ma, relative to a PLP-binding residue, and how it changes when the most common mutation G170R on AGT-Mi, known to cause AGT mistargeting without affecting the enzyme functionality, is present in the second allele. By using a bicistronic eukaryotic expression vector, we demonstrate that (i) S81L-Ma is mainly in its apo-form and has a significant peroxisomal localization and (ii) S81L and G170R monomers interact giving rise to the G170R-Mi/S81L-Ma holo-form, which is imported into peroxisomes and exhibits an enhanced functionality with respect to the parental enzymes. These data, integrated with the biochemical features of the heterodimer and the homodimeric counterparts in their purified recombinant form, (i) highlight the molecular basis of the pathogenicity of S81L-Ma and (ii) provide evidence for a positive interallelic complementation between the S81L and G170R monomers. Our study represents a valid approach to investigate the molecular pathogenesis of PH1 in compound heterozygous patients. PMID:24990153

  18. Punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori in Colombian populations

    PubMed Central

    Matta, Andrés Jenuer; Zambrano, Diana Carolina; Pazos, Alvaro Jairo

    2018-01-01

    AIM To characterize punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori (H. pylori) and determine their association with therapeutic failure. METHODS PCR products of 23S rRNA gene V domain of 74 H. pylori isolates; 34 resistant to clarithromycin (29 from a low-risk gastric cancer (GC) population: Tumaco-Colombia, and 5 from a high-risk population: Tuquerres-Colombia) and 40 from a susceptible population (28 from Tumaco and 12 from Túquerres) were sequenced using capillary electrophoresis. The concordance between mutations of V domain 23S rRNA gene of H. pylori and therapeutic failure was determined using the Kappa coefficient and McNemar’s test was performed to determine the relationship between H. pylori mutations and clarithromycin resistance. RESULTS 23S rRNA gene from H. pylori was amplified in 56/74 isolates, of which 25 were resistant to clarithromycin (20 from Tumaco and 5 from Túquerres, respectively). In 17 resistant isolates (13 from Tumaco and 4 from Túquerres) the following mutations were found: A1593T1, A1653G2, C1770T, C1954T1, and G1827C in isolates from Tumaco, and A2144G from Túquerres. The mutations T2183C, A2144G and C2196T in H. pylori isolates resistant to clarithromycin from Colombia are reported for the first time. No association between the H. pylori mutations and in vitro clarithromycin resistance was found. However, therapeutic failure of eradication treatment was associated with mutations of 23S rRNA gene in clarithromycin-resistant H. pylori (κ = 0.71). CONCLUSION The therapeutic failure of eradication treatment in the two populations from Colombia was associated with mutations of the 23S rRNA gene in clarithromycin-resistant H. pylori. PMID:29662291

  19. Punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori in Colombian populations.

    PubMed

    Matta, Andrés Jenuer; Zambrano, Diana Carolina; Pazos, Alvaro Jairo

    2018-04-14

    To characterize punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori ( H. pylori ) and determine their association with therapeutic failure. PCR products of 23S rRNA gene V domain of 74 H. pylori isolates; 34 resistant to clarithromycin (29 from a low-risk gastric cancer (GC) population: Tumaco-Colombia, and 5 from a high-risk population: Tuquerres-Colombia) and 40 from a susceptible population (28 from Tumaco and 12 from Túquerres) were sequenced using capillary electrophoresis. The concordance between mutations of V domain 23S rRNA gene of H. pylori and therapeutic failure was determined using the Kappa coefficient and McNemar's test was performed to determine the relationship between H. pylori mutations and clarithromycin resistance. 23S rRNA gene from H. pylori was amplified in 56/74 isolates, of which 25 were resistant to clarithromycin (20 from Tumaco and 5 from Túquerres, respectively). In 17 resistant isolates (13 from Tumaco and 4 from Túquerres) the following mutations were found: A1593T1, A1653G2, C1770T, C1954T1, and G1827C in isolates from Tumaco, and A2144G from Túquerres. The mutations T2183C, A2144G and C2196T in H. pylori isolates resistant to clarithromycin from Colombia are reported for the first time. No association between the H. pylori mutations and in vitro clarithromycin resistance was found. However, therapeutic failure of eradication treatment was associated with mutations of 23S rRNA gene in clarithromycin-resistant H. pylori ( κ = 0.71). The therapeutic failure of eradication treatment in the two populations from Colombia was associated with mutations of the 23S rRNA gene in clarithromycin-resistant H. pylori .

  20. Carnitine-acylcarnitine translocase deficiency with c.199-10 T>G and novel c.1A>G mutation: Two case reports and brief literature review.

    PubMed

    Yan, Hui-Ming; Hu, Hao; Ahmed, Aisha; Feng, Bing-Bing; Liu, Jing; Jia, Zheng-Jun; Wang, Hua

    2017-11-01

    Carnitine-acylcarnitine translocate deficiency (CACTD) is a rare and life-threatening, autosomal recessive disorder of fatty acid β-oxidation characterized by hypoketotic hypoglycemia, hyperammonemia, cardiomyopathy, liver dysfunction, and muscle weakness; culminating in early death. To date, CACTD cases screened from the Chinese mainland population, especially patient with compound heterozygote with c.199-10T>G and a novel c.1A>G mutation in the SLC25A20 gene has never been described. Herein, we report 2 neonatal cases of CACTD identified from the mainland China. These 2 patients were presented with severe metabolic crisis and their clinical conditions deteriorate rapidly and both died of cardiorespiratory collapse in the first week of life. We present the clinical and biochemical features of 2 probands and a brief literature review of previously reported CACTD cases with the c.199-10T>G mutation. The acylcarnitine profiles by tandem-mass-spectrometry and the mutation analysis of SLC25A20 gene confirmed the diagnosis of CACTD in both patients. Mutation analysis demonstrated that patient No. 1 was homozygous for c.199-10T>G mutation, while patient No. 2 was a compound heterozygote for 2 mutations, a maternally-inherited c.199-10T>G and a paternally-inherited, novel c.1A>G mutation. Both patients were treated with an aggressive treatment regimen include high glucose and arginine infusion, respiratory, and circulatory support. The first proband died 3 days after delivery due to sudden cardiac arrest. The second patient's clinical condition, at one time, was improved by high glucose infusion, intravenous arginine, and circulatory support. However, the patient failed to wean from mechanical ventilation. Unfortunately, her parents refused further treatment due to fear of financial burdens. The patient died of congestive heart failure in the 6th day of life. We report the first 2 cases of CACTD identified from the mainland China. Apart from a founder mutation c.199-10T>G

  1. The 95ΔG mutation in the 5'untranslated region of the norA gene increases efflux activity in Staphylococcus epidermidis isolates.

    PubMed

    García-Gómez, Elizabeth; Jaso-Vera, Marcos E; Juárez-Verdayes, Marco A; Alcántar-Curiel, María D; Zenteno, Juan C; Betanzos-Cabrera, Gabriel; Peralta, Humberto; Rodríguez-Martínez, Sandra; Cancino-Díaz, Mario E; Jan-Roblero, Janet; Cancino-Diaz, Juan C

    2017-02-01

    In the Staphylococcus aureus ATCC25923 strain, the flqB mutation in the 5'untranslated region (5'UTR) of the norA gene causes increased norA mRNA expression and high efflux activity (HEA). The involvement of the norA gene 5'UTR in HEA has not been explored in S. epidermidis; therefore, we examined the function of this region in S. epidermidis clinical isolates. The selection of isolates with HEA was performed based on ethidium bromide (EtBr) MIC values and efflux efficiency (EF) using the semi-automated fluorometric method. The function of the 5'UTR was studied by quantifying the levels of norA expression (RT-qPCR) and by identifying 5'UTR mutations by sequence analysis. Only 10 isolates from a total of 165 (6.1%) had HEA (EtBr MIC = 300 μg/ml and EF ranged from 48.4 to 97.2%). Eight of 10 isolates with HEA had the 5'UTR 95 Δ G mutation. Isolates carrying the 95 Δ G mutation had higher levels of norA expression compared with those that did not. To corroborate that the 95 Δ G mutation is involved in HEA, a strain adapted to EtBr was obtained in vitro. This strain also presented the 95 Δ G mutation and had a high level of norA expression and EF, indicating that the 95 Δ G mutation is important for the HEA phenotype. The 95 Δ G mutation produces a different structure in the Shine-Dalgarno region, which may promote better translation of norA mRNA. To our knowledge, this is the first report to demonstrate the participation of the 5'UTR 95 Δ G mutation of the norA gene in the HEA phenotype of S. epidermidis isolates. Here, we propose that the efflux of EtBr is caused by an increment in the transcription and/or translation of the norA gene. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Identification of a Novel PMS2 Alteration c.505C>G (R169G) In Trans with a PMS2 Pathogenic Mutation in a Patient with Constitutional Mismatch Repair Deficiency

    PubMed Central

    Mork, Maureen E.; Borras, Ester; Taggart, Melissa W.; Cuddy, Amanda; Bannon, Sarah A.; You, Y. Nancy; Lynch, Patrick M.; Ramirez, Pedro T.; Rodriguez-Bigas, Miguel A.; Vilar, Eduardo

    2016-01-01

    Constitutional mismatch repair deficiency syndrome (CMMRD) is a rare autosomal recessive predisposition to colorectal polyposis and other malignancies, often childhood-onset, that is caused by biallelic inheritance of mutations in the same mismatch repair gene. Here, we describe a patient with a clinical diagnosis of CMMRD based on colorectal polyposis and young-onset endometrial cancer who was identified to have two alterations in trans in PMS2: one known pathogenic mutation (c.1831insA; p.Ile611Asnfs*2) and one novel variant of uncertain significance (c.505C>G; p.Arg169Glu), a missense alteration. We describe the clinical and molecular features in the patient harboring this novel alteration c.505C>G, who meets clinical criteria for CMMRD and exhibits molecular evidence supporting a diagnosis of CMMRD. Although experimental validation is needed to confirm its pathogenicity, PMS2 c.505C>G likely has functional consequences that contributes to our patient's phenotype based on the patient's clinical presentation, tumor studies, and bioinformatics analysis. PMID:27017610

  3. The USH2A c.2299delG mutation: dating its common origin in a Southern European population

    PubMed Central

    Aller, Elena; Larrieu, Lise; Jaijo, Teresa; Baux, David; Espinós, Carmen; González-Candelas, Fernando; Nájera, Carmen; Palau, Francesc; Claustres, Mireille; Roux, Anne-Françoise; Millán, José M

    2010-01-01

    Usher syndrome type II is the most common form of Usher syndrome. USH2A is the main responsible gene of the three known to be disease causing. It encodes two isoforms of the protein usherin. This protein is part of an interactome that has an essential role in the development and function of inner ear hair cells and photoreceptors. The gene contains 72 exons spanning over a region of 800 kb. Although numerous mutations have been described, the c.2299delG mutation is the most prevalent in several populations. Its ancestral origin was previously suggested after the identification of a common core haplotype restricted to 250 kb in the 5′ region that encodes the short usherin isoform. By extending the haplotype analysis over the 800 kb region of the USH2A gene with a total of 14 intragenic single nucleotide polymorphisms, we have been able to define 10 different c.2299delG haplotypes, showing high variability but preserving the previously described core haplotype. An exhaustive c.2299delG/control haplotype study suggests that the major source of variability in the USH2A gene is recombination. Furthermore, we have evidenced twice the amount of recombination hotspots located in the 500 kb region that covers the 3′ end of the gene, explaining the higher variability observed in this region when compared with the 250 kb of the 5′ region. Our data confirm the common ancestral origin of the c.2299delG mutation. PMID:20145675

  4. Visualizing Mutation-Specific Differences in the Trafficking-Deficient Phenotype of Kv11.1 Proteins Linked to Long QT Syndrome Type 2.

    PubMed

    Hall, Allison R; Anderson, Corey L; Smith, Jennifer L; Mirshahi, Tooraj; Elayi, Claude S; January, Craig T; Delisle, Brian P

    2018-01-01

    KCNH2 encodes the Kv11.1 α-subunit that underlies the rapidly activating delayed-rectifier K + current in the heart. Loss-of-function KCNH2 mutations cause long QT syndrome type 2 (LQT2), and most LQT2-linked missense mutations inhibit the trafficking of Kv11.1 channel protein to the cell surface membrane. Several trafficking-deficient LQT2 mutations (e.g., G601S) generate Kv11.1 proteins that are sequestered in a microtubule-dependent quality control (QC) compartment in the transitional endoplasmic reticulum (ER). We tested the hypothesis that the QC mechanisms that regulate LQT2-linked Kv11.1 protein trafficking are mutation-specific. Confocal imaging analyses of HEK293 cells stably expressing the trafficking-deficient LQT2 mutation F805C showed that, unlike G601S-Kv11.1 protein, F805C-Kv11.1 protein was concentrated in several transitional ER subcompartments. The microtubule depolymerizing drug nocodazole differentially affected G601S- and F805C-Kv11.1 protein immunostaining. Nocodazole caused G601S-Kv11.1 protein to distribute into peripheral reticular structures, and it increased the diffuse immunostaining of F805C-Kv11.1 protein around the transitional ER subcompartments. Proteasome inhibition also affected the immunostaining of G601S- and F805C-Kv11.1 protein differently. Incubating cells in MG132 minimally impacted G601S-Kv11.1 immunostaining, but it dramatically increased the diffuse immunostaining of F805C-Kv11.1 protein in the transitional ER. Similar results were seen after incubating cells in the proteasome inhibitor lactacystin. Differences in the cellular distribution of G601S-Kv11.1 and F805C-Kv11.1 protein persisted in transfected human inducible pluripotent stem cell derived cardiomyocytes. These are the first data to visually demonstrate mutation-specific differences in the trafficking-deficient LQT2 phenotype, and this study has identified a novel way to categorize trafficking-deficient LQT2 mutations based on differences in intracellular

  5. Recurrent and founder mutations in the PMS2 gene

    PubMed Central

    Tomsic, Jerneja; Senter, Leigha; Liyanarachchi, Sandya; Clendenning, Mark; Vaughn, Cecily P.; Jenkins, Mark A.; Hopper, John L.; Young, Joanne; Samowitz, Wade; de la Chapelle, Albert

    2012-01-01

    Germline mutations in PMS2 are associated with Lynch syndrome (LS), the most common known cause of hereditary colorectal cancer. Mutation detection in PMS2 has been difficult due to the presence of several pseudogenes, but a custom-designed long-range PCR strategy now allows adequate mutation detection. Many mutations are unique. However some mutations are observed repeatedly, across individuals not known to be related, due to the mutation being either recurrent, arising multiple times de novo at hot spots for mutations, or of founder origin, having occurred once in an ancestor. Previously, we observed 36 distinct mutations in a sample of 61 independently ascertained Caucasian probands of mixed European background with PMS2 mutations. Eleven of these mutations were detected in more than one individual not known to be related and of these, six were detected more than twice. These six mutations accounted for 31 (51%) ostensibly unrelated probands. Here we performed genotyping and haplotype analysis in four mutations observed in multiple probands and found two (c.137G>T and exon 10 deletion) to be founder mutations, one (c.903G>T) a probable founder, and one (c.1A>G) where founder mutation status could not be evaluated. We discuss possible explanations for the frequent occurrence of founder mutations in PMS2. PMID:22577899

  6. The coexistence of mitochondrial ND6 T14484C and 12S rRNA A1555G mutations in a Chinese family with Leber's hereditary optic neuropathy and hearing loss

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wei Qiping; Zhou Xiangtian; Yang Li

    2007-06-15

    We report here the clinical, genetic and molecular characterization of one three-generation Han Chinese family with Leber's hereditary optic neuropathy (LHON) and hearing loss. Four of 14 matrilineal relatives exhibited the moderate central vision loss at the average age of 12.5 years. Of these, one subject exhibited both LHON and mild hearing impairment. Sequence analysis of the complete mitochondrial genomes in the pedigree showed the presence of homoplasmic LHON-associated ND6 T14484C mutation, deafness-associated 12S rRNA A1555 mutation and 47 other variants belonging to Eastern Asian haplogroup H2. None of other mitochondrial variants was evolutionarily conserved and functional significance. Therefore, themore » coexistence of the A1555G mutation and T14484C mutations in this Chinese family indicate that the A1555G mutation may play a synergistic role in the phenotypic manifestation of LHON associated ND6 T14484C mutation. However, the incomplete penetrance of vision and hearing loss suggests the involvement of nuclear modifier genes and environmental factors in the phenotypic expression of these mtDNA mutations.« less

  7. Inhibition of G0/G1 Switch 2 Ameliorates Renal Inflammation in Chronic Kidney Disease.

    PubMed

    Matsunaga, Naoya; Ikeda, Eriko; Kakimoto, Keisuke; Watanabe, Miyako; Shindo, Naoya; Tsuruta, Akito; Ikeyama, Hisako; Hamamura, Kengo; Higashi, Kazuhiro; Yamashita, Tomohiro; Kondo, Hideaki; Yoshida, Yuya; Matsuda, Masaki; Ogino, Takashi; Tokushige, Kazutaka; Itcho, Kazufumi; Furuichi, Yoko; Nakao, Takaharu; Yasuda, Kaori; Doi, Atsushi; Amamoto, Toshiaki; Aramaki, Hironori; Tsuda, Makoto; Inoue, Kazuhide; Ojida, Akio; Koyanagi, Satoru; Ohdo, Shigehiro

    2016-11-01

    Chronic kidney disease (CKD) is a global health problem, and novel therapies to treat CKD are urgently needed. Here, we show that inhibition of G 0 /G 1 switch 2 (G0s2) ameliorates renal inflammation in a mouse model of CKD. Renal expression of chemokine (C-C motif) ligand 2 (Ccl2) was increased in response to p65 activation in the kidneys of wild-type 5/6 nephrectomy (5/6Nx) mice. Moreover, 5/6Nx Clk/Clk mice, which carry homozygous mutations in the gene encoding circadian locomotor output cycles kaput (CLOCK), did not exhibit aggravation of apoptosis or induction of F4/80-positive cells. The renal expression of G0s2 in wild-type 5/6Nx mice was important for the transactivation of Ccl2 by p65. These pathologies were ameliorated by G0s2 knockdown. Furthermore, a novel small-molecule inhibitor of G0s2 expression was identified by high-throughput chemical screening, and the inhibitor suppressed renal inflammation in 5/6Nx mice. These findings indicated that G0s2 inhibitors may have applications in the treatment of CKD. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  8. Hearing loss caused by a P2RX2 mutation identified in a MELAS family with a coexisting mitochondrial 3243AG mutation

    PubMed Central

    Moteki, Hideaki; Azaiez, Hela; Booth, Kevin T; Hattori, Mitsuru; Sato, Ai; Sato, Yoshihiko; Motobayashi, Mitsuo; Sloan, Christina M; Kolbe, Diana L; Shearer, A Eliot; Smith, Richard J H; Usami, Shin-ichi

    2015-01-01

    Objective We present a family with a mitochondrial DNA 3243A>G mutation resulting in MELAS, of which some members have hearing loss where a novel mutation in the P2RX2 gene was identified. Methods One hundred ninety-four (194) Japanese subjects from unrelated families were enrolled in the study. Targeted genomic enrichment and massively parallel sequencing of all known non-syndromic hearing loss genes were performed to identify the genetic causes of hearing loss. Results A novel mutation in the P2RX2 gene, that corresponded to c.601G>A (p.Asp201Tyr) was identified. Two patients carried the mutation, and had severe SNHL, while other members with MELAS (who did not carry the P2RX2 mutation) had normal hearing. Conclusion This is the first case report of a diagnosis of hearing loss caused by P2RX2 mutation in patients with MELAS. A potential explanation is that decreasing ATP production due to MELAS with mitochondrial 3243A>G mutation might suppress activation of P2X2 receptors. We also suggest that hearing loss caused by the P2RX2 mutation might be influenced by the decrease in ATP production due to MELAS, and that nuclear genetic factors may play a modifying role in mitochondrial dysfunction. PMID:25788561

  9. Novel USH2A compound heterozygous mutations cause RP/USH2 in a Chinese family.

    PubMed

    Liu, Xiaowen; Tang, Zhaohui; Li, Chang; Yang, Kangjuan; Gan, Guanqi; Zhang, Zibo; Liu, Jingyu; Jiang, Fagang; Wang, Qing; Liu, Mugen

    2010-03-17

    To identify the disease-causing gene in a four-generation Chinese family affected with retinitis pigmentosa (RP). Linkage analysis was performed with a panel of microsatellite markers flanking the candidate genetic loci of RP. These loci included 38 known RP genes. The complete coding region and exon-intron boundaries of Usher syndrome 2A (USH2A) were sequenced with the proband DNA to screen the disease-causing gene mutation. Restriction fragment length polymorphism (RFLP) analysis and direct DNA sequence analysis were done to demonstrate co-segregation of the USH2A mutations with the family disease. One hundred normal controls were used without the mutations. The disease-causing gene in this Chinese family was linked to the USH2A locus on chromosome 1q41. Direct DNA sequence analysis of USH2A identified two novel mutations in the patients: one missense mutation p.G1734R in exon 26 and a splice site mutation, IVS32+1G>A, which was found in the donor site of intron 32 of USH2A. Neither the p.G1734R nor the IVS32+1G>A mutation was found in the unaffected family members or the 100 normal controls. One patient with a homozygous mutation displayed only RP symptoms until now, while three patients with compound heterozygous mutations in the family of study showed both RP and hearing impairment. This study identified two novel mutations: p.G1734R and IVS32+1G>A of USH2A in a four-generation Chinese RP family. In this study, the heterozygous mutation and the homozygous mutation in USH2A may cause Usher syndrome Type II or RP, respectively. These two mutations expand the mutant spectrum of USH2A.

  10. Mutation of a single residue in the S2-S3 loop of CNG channels alters the gating properties and sensitivity to inhibitors.

    PubMed

    Crary, J I; Dean, D M; Maroof, F; Zimmerman, A L

    2000-12-01

    We previously found that native cyclic nucleotide-gated (CNG) cation channels from amphibian rod cells are directly and reversibly inhibited by analogues of diacylglycerol (DAG), but little is known about the mechanism of this inhibition. We recently determined that, at saturating cGMP concentrations, DAG completely inhibits cloned bovine rod (Brod) CNG channels while only partially inhibiting cloned rat olfactory (Rolf) channels (Crary, J.I., D.M. Dean, W. Nguitragool, P.T. Kurshan, and A.L. Zimmerman. 2000. J. Gen. Phys. 116:755-768; in this issue). Here, we report that a point mutation at position 204 in the S2-S3 loop of Rolf and a mouse CNG channel (Molf) found in olfactory epithelium and heart, increased DAG sensitivity to that of the Brod channel. Mutation of this residue from the wild-type glycine to a glutamate (Molf G204E) or aspartate (Molf G204D) gave dramatic increases in DAG sensitivity without changing the apparent cGMP or cAMP affinities or efficacies. However, unlike the wild-type olfactory channels, these mutants demonstrated voltage-dependent gating with obvious activation and deactivation kinetics. Interestingly, the mutants were also more sensitive to inhibition by the local anesthetic, tetracaine. Replacement of the position 204 glycine with a tryptophan residue (Rolf G204W) not only gave voltage-dependent gating and an increased sensitivity to DAG and tetracaine, but also showed reduced apparent agonist affinity and cAMP efficacy. Sequence comparisons show that the glycine at position 204 in the S2-S3 loop is highly conserved, and our findings indicate that its alteration can have critical consequences for channel gating and inhibition.

  11. The G matrix under fluctuating correlational mutation and selection.

    PubMed

    Revell, Liam J

    2007-08-01

    Theoretical quantitative genetics provides a framework for reconstructing past selection and predicting future patterns of phenotypic differentiation. However, the usefulness of the equations of quantitative genetics for evolutionary inference relies on the evolutionary stability of the additive genetic variance-covariance matrix (G matrix). A fruitful new approach for exploring the evolutionary dynamics of G involves the use of individual-based computer simulations. Previous studies have focused on the evolution of the eigenstructure of G. An alternative approach employed in this paper uses the multivariate response-to-selection equation to evaluate the stability of G. In this approach, I measure similarity by the correlation between response-to-selection vectors due to random selection gradients. I analyze the dynamics of G under several conditions of correlational mutation and selection. As found in a previous study, the eigenstructure of G is stabilized by correlational mutation and selection. However, over broad conditions, instability of G did not result in a decreased consistency of the response to selection. I also analyze the stability of G when the correlation coefficients of correlational mutation and selection and the effective population size change through time. To my knowledge, no prior study has used computer simulations to investigate the stability of G when correlational mutation and selection fluctuate. Under these conditions, the eigenstructure of G is unstable under some simulation conditions. Different results are obtained if G matrix stability is assessed by eigenanalysis or by the response to random selection gradients. In this case, the response to selection is most consistent when certain aspects of the eigenstructure of G are least stable and vice versa.

  12. Prevalence of Mitochondrial 12S rRNA Mutations Associated with Aminoglycoside Ototoxicity

    ERIC Educational Resources Information Center

    Guan, Min-Xin

    2005-01-01

    The mitochondrial DNA (mtDNA) 12S rRNA is a hot spot for mutations associated with both aminoglycoside-induced and nonsyndromic hearing loss. Of those, the homoplasmic A1555G and C1494T mutations at a highly conserved decoding region of the 12S rRNA have been associated with hearing loss. These two mutations account for a significant number of…

  13. Detection of KatG/inhA Mutation to Guide Isoniazid and Ethionamide Use for Drug-resistant Tuberculosis

    PubMed Central

    Namburete, Evangelina

    2017-01-01

    Abstract Background Both Mozambique and Brazil are countries with a high burden of tuberculosis. Isoniazid (INH) is one of the cornerstones of tuberculosis treatment and, depending on the mutated gene (katG or inhA), the organism may be susceptible to high doses of INH (inhA mutation) or to ethionamide (-Eth-KatG mutation). Methods To analyze isoniazid genotypic resistance profile in Mycobacterium tuberculosis to guide decision making about management of resistant tuberculosis. Descriptive study of 311 M. tuberculosis isolated from Ribeirão Preto, Brazil (2011–2014) and 155 isolates from Beira, Mozambique (2014–2015). Drug resistance patterns and the specific genes mutations were determined using Genotype MTBDRplus (Hain Lifescience GmbH, Germany). Results Mutations in katG gene were detected in 13/22 (59%) of Brazilian and in 32/38 (84.2%) of Mozambican isolates. Unique inhA mutations were observed in 8/22 (36%) isolates in Brazil and 4/38 (10.5%) in Mozambique. Both katG and inhA mutations where detected in 1/22 (5%) and 2/38(5.2%), respectively. katG mutations were more frequent among INH previously treated patients. Conclusion There is a geographical variation of INH mutations and the new molecular tests can be used to guide and accelerate decision making towards the use of ETH or high doses of INH based on detected mutations. Disclosures All authors: No reported disclosures.

  14. The effect of the common c.2299delG mutation in USH2A on RNA splicing.

    PubMed

    Lenassi, Eva; Saihan, Zubin; Bitner-Glindzicz, Maria; Webster, Andrew R

    2014-05-01

    Recessive variants in the USH2A gene are an important cause of both Usher syndrome and nonsyndromic retinitis pigmentosa. A single base-pair deletion in exon 13 (c.2299delG, p.Glu767Serfs*21) is considered the most frequent mutation of USH2A. It is predicted to generate a premature termination codon and is presumed to lead to nonsense mediated decay. However the effect of this variant on RNA has not been formally investigated. It is not uncommon for exonic sequence alterations to cause aberrant splicing and the aim of the present report is to evaluate the effect of c.2299delG on USH2A transcripts. Nasal cells represent the simplest available tissue to study splicing defects in USH2A. Nasal brushing, RNA extraction from nasal epithelial cells and reverse transcription PCR were performed in five Usher syndrome patients who were homozygous for c.2299delG, two unaffected c.2299delG heterozygotes and seven control individuals. Primers to amplify between exons 12 and 15 and exons 10 and 14 were utilised. Significant variability was observed between different RT-PCR experiments. Importantly, in controls, PCR product of the expected size were amplified on all occasions (13/13 experiments); for patients this was true in only 4/14 experiments (Fisher exact test p = 0.0002). Bioinformatics tools predict the c.2299delG change to disrupt an exonic splicing enhancer and to create an exonic splicing silencer within exon 13. Here, we report an effect of the common c.2299delG mutation on splicing of exons 12 and 13 of USH2A. Future studies are expected to provide important insights into the contribution of this effect on the phenotype. Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. VPS53 mutations cause progressive cerebello-cerebral atrophy type 2 (PCCA2).

    PubMed

    Feinstein, Miora; Flusser, Hagit; Lerman-Sagie, Tally; Ben-Zeev, Bruria; Lev, Dorit; Agamy, Orly; Cohen, Idan; Kadir, Rotem; Sivan, Sara; Leshinsky-Silver, Esther; Markus, Barak; Birk, Ohad S

    2014-05-01

    Progressive cerebello-cerebral atrophy (PCCA) leading to profound mental retardation, progressive microcephaly, spasticity and early onset epilepsy, was diagnosed in four non-consanguineous apparently unrelated families of Jewish Moroccan ancestry. Common founder mutation(s) were assumed. Genome-wide linkage analysis and whole exome sequencing were done, followed by realtime PCR and immunofluorescent microscopy. Genome-wide linkage analysis mapped the disease-associated gene to 0.5 Mb on chromosome 17p13.3. Whole exome sequencing identified only two mutations within this locus, which were common to the affected individuals: compound heterozygous mutations in VPS53, segregating as expected for autosomal recessive heredity within all four families, and common in Moroccan Jews (∼1:37 carrier rate). The Golgi-associated retrograde protein (GARP) complex is involved in the retrograde pathway recycling endocytic vesicles to Golgi; c.2084A>G and c.1556+5G>A VPS53 founder mutations are predicted to affect the C-terminal domain of VPS53, known to be critical to its role as part of this complex. Immunofluorescent microscopy demonstrated swollen and abnormally numerous CD63 positive vesicular bodies, likely intermediate recycling/late endosomes, in fibroblasts of affected individuals. Autosomal recessive PCCA type 2 is caused by VPS53 mutations.

  16. Detection of katG and inhA mutations to guide isoniazid and ethionamide use for drug-resistant tuberculosis.

    PubMed

    Bollela, V R; Namburete, E I; Feliciano, C S; Macheque, D; Harrison, L H; Caminero, J A

    2016-08-01

    Depending on the presence of mutations that determine isoniazid (INH) susceptibility (katG and inhA), Mycobacterium tuberculosis may be susceptible to high doses of INH or ethionamide (ETH). To describe the INH resistance profile and association of katG mutation with previous INH treatment and level of drug resistance based on rapid molecular drug susceptibility testing (DST) in southern Brazil and central Mozambique. Descriptive study of 311 isolates from Ribeirão Preto, São Paulo, Brazil (2011-2014) and 155 isolates from Beira, Mozambique (2014-2015). Drug resistance patterns and specific gene mutations were determined using GenoType(®) MTBDRplus. katG gene mutations were detected in 12/22 (54.5%) Brazilian and 32/38 (84.2%) Mozambican isolates. inhA mutations were observed in 9/22 (40.9%) isolates in Brazil and in 4/38 (10.5%) in Mozambique. Both katG and inhA mutations were detected in respectively 1/22 (5%) and 2/38 (5.2%). The difference in the frequency of katG mutations in Brazil and Mozambique was statistically significant (P = 0.04). katG mutations were present in 68.8% (33/48) of patients previously treated with INH and 31.2% (15/48) of patients without previous INH. This difference was not statistically significant (P = 0.223). INH mutations varied geographically; molecular DST can be used to guide and accelerate decision making in the use of ETH or high doses of INH.

  17. Leber's hereditary optic neuropathy is associated with the mitochondrial ND4 G11696A mutation in five Chinese families

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhou Xiangtian; Wei Qiping; Yang Li

    2006-02-03

    We report here the clinical, genetic, and molecular characterization of five Chinese families with Leber's hereditary optic neuropathy (LHON). Clinical and genetic evaluations revealed the variable severity and age-of-onset in visual impairment in these families. Strikingly, there were extremely low penetrances of visual impairment in these Chinese families. Sequence analysis of the complete mitochondrial genomes in these pedigrees showed the distinct sets of mtDNA polymorphism, in addition to the identical ND4 G11696A mutation associated with LHON. Indeed, this mutation is present in homoplasmy only in the maternal lineage of those pedigrees but not other members of these families. In fact,more » the occurrence of the G11696A mutation in these several genetically unrelated subjects affected by visual impairment strongly indicates that this mutation is involved in the pathogenesis of visual impairment. Furthermore, the N405D in the ND5 and G5820A in the tRNA{sup Cys}, showing high evolutional conservation, may contribute to the phenotypic expression of G11696A mutation in the WZ10 pedigree. However, there was the absence of functionally significant mtDNA mutations in other four Chinese pedigrees carrying the G11696A mutation. Therefore, nuclear modifier gene(s) or environmental factor(s) may play a role in the phenotypic expression of the LHON-associated G11696A mutation in these Chinese pedigrees.« less

  18. The Structural Basis of Oncogenic Mutations G12, G13 and Q61 in Small GTPase K-Ras4B

    NASA Astrophysics Data System (ADS)

    Lu, Shaoyong; Jang, Hyunbum; Nussinov, Ruth; Zhang, Jian

    2016-02-01

    Ras mediates cell proliferation, survival and differentiation. Mutations in K-Ras4B are predominant at residues G12, G13 and Q61. Even though all impair GAP-assisted GTP → GDP hydrolysis, the mutation frequencies of K-Ras4B in human cancers vary. Here we aim to figure out their mechanisms and differential oncogenicity. In total, we performed 6.4 μs molecular dynamics simulations on the wild-type K-Ras4B (K-Ras4BWT-GTP/GDP) catalytic domain, the K-Ras4BWT-GTP-GAP complex, and the mutants (K-Ras4BG12C/G12D/G12V-GTP/GDP, K-Ras4BG13D-GTP/GDP, K-Ras4BQ61H-GTP/GDP) and their complexes with GAP. In addition, we simulated ‘exchanged’ nucleotide states. These comprehensive simulations reveal that in solution K-Ras4BWT-GTP exists in two, active and inactive, conformations. Oncogenic mutations differentially elicit an inactive-to-active conformational transition in K-Ras4B-GTP; in K-Ras4BG12C/G12D-GDP they expose the bound nucleotide which facilitates the GDP-to-GTP exchange. These mechanisms may help elucidate the differential mutational statistics in K-Ras4B-driven cancers. Exchanged nucleotide simulations reveal that the conformational transition is more accessible in the GTP-to-GDP than in the GDP-to-GTP exchange. Importantly, GAP not only donates its R789 arginine finger, but stabilizes the catalytically-competent conformation and pre-organizes catalytic residue Q61; mutations disturb the R789/Q61 organization, impairing GAP-mediated GTP hydrolysis. Together, our simulations help provide a mechanistic explanation of key mutational events in one of the most oncogenic proteins in cancer.

  19. Visual dysfunction in Parkinson’s disease

    PubMed Central

    Weil, Rimona S.; Schrag, Anette E.; Warren, Jason D.; Crutch, Sebastian J.; Lees, Andrew J.; Morris, Huw R.

    2016-01-01

    Patients with Parkinson’s disease have a number of specific visual disturbances. These include changes in colour vision and contrast sensitivity and difficulties with complex visual tasks such as mental rotation and emotion recognition. We review changes in visual function at each stage of visual processing from retinal deficits, including contrast sensitivity and colour vision deficits to higher cortical processing impairments such as object and motion processing and neglect. We consider changes in visual function in patients with common Parkinson’s disease-associated genetic mutations including GBA and LRRK2. We discuss the association between visual deficits and clinical features of Parkinson’s disease such as rapid eye movement sleep behavioural disorder and the postural instability and gait disorder phenotype. We review the link between abnormal visual function and visual hallucinations, considering current models for mechanisms of visual hallucinations. Finally, we discuss the role of visuo-perceptual testing as a biomarker of disease and predictor of dementia in Parkinson’s disease. PMID:27412389

  20. 12 CFR 7.2019 - Loans secured by a bank's own shares.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 12 Banks and Banking 1 2010-01-01 2010-01-01 false Loans secured by a bank's own shares. 7.2019... AND OPERATIONS Corporate Practices § 7.2019 Loans secured by a bank's own shares. (a) Permitted agreements, relating to bank shares. A national bank may require a borrower holding shares of the bank to...

  1. The Arrhythmogenic Calmodulin Mutation D129G Dysregulates Cell Growth, Calmodulin-dependent Kinase II Activity, and Cardiac Function in Zebrafish*

    PubMed Central

    Zacharias, Triantafyllos; Kulej, Katarzyna; Wang, Kevin; Torggler, Raffaela; la Cour, Jonas M.

    2016-01-01

    Calmodulin (CaM) is a Ca2+ binding protein modulating multiple targets, several of which are associated with cardiac pathophysiology. Recently, CaM mutations were linked to heart arrhythmia. CaM is crucial for cell growth and viability, yet the effect of the arrhythmogenic CaM mutations on cell viability, as well as heart rhythm, remains unknown, and only a few targets with relevance for heart physiology have been analyzed for their response to mutant CaM. We show that the arrhythmia-associated CaM mutants support growth and viability of DT40 cells in the absence of WT CaM except for the long QT syndrome mutant CaM D129G. Of the six CaM mutants tested (N53I, F89L, D95V, N97S, D129G, and F141L), three showed a decreased activation of Ca2+/CaM-dependent kinase II, most prominently the D129G CaM mutation, which was incapable of stimulating Thr286 autophosphorylation. Furthermore, the CaM D129G mutation led to bradycardia in zebrafish and an arrhythmic phenotype in a subset of the analyzed zebrafish. PMID:27815504

  2. DNA damage bypass operates in the S and G2 phases of the cell cycle and exhibits differential mutagenicity

    PubMed Central

    Diamant, Noam; Hendel, Ayal; Vered, Ilan; Carell, Thomas; Reißner, Thomas; de Wind, Niels; Geacinov, Nicholas; Livneh, Zvi

    2012-01-01

    Translesion DNA synthesis (TLS) employs low-fidelity DNA polymerases to bypass replication-blocking lesions, and being associated with chromosomal replication was presumed to occur in the S phase of the cell cycle. Using immunostaining with anti-replication protein A antibodies, we show that in UV-irradiated mammalian cells, chromosomal single-stranded gaps formed in S phase during replication persist into the G2 phase of the cell cycle, where their repair is completed depending on DNA polymerase ζ and Rev1. Analysis of TLS using a high-resolution gapped-plasmid assay system in cell populations enriched by centrifugal elutriation for specific cell cycle phases showed that TLS operates both in S and G2. Moreover, the mutagenic specificity of TLS in G2 was different from S, and in some cases overall mutation frequency was higher. These results suggest that TLS repair of single-stranded gaps caused by DNA lesions can lag behind chromosomal replication, is separable from it, and occurs both in the S and G2 phases of the cell cycle. Such a mechanism may function to maintain efficient replication, which can progress despite the presence of DNA lesions, with TLS lagging behind and patching regions of discontinuity. PMID:21908406

  3. Detection of katG and inhA mutations to guide isoniazid and ethionamide use for drug-resistant tuberculosis

    PubMed Central

    Bollela, V. R.; Namburete, E. I.; Feliciano, C. S.; Macheque, D.; Harrison, L. H.; Caminero, J. A.

    2017-01-01

    SUMMARY BACKGROUND Depending on the presence of mutations that determine isoniazid (INH) susceptibility (katG and inhA), Mycobacterium tuberculosis may be susceptible to high doses of INH or ethionamide (ETH). OBJECTIVE To describe the INH resistance profile and association of katG mutation with previous INH treatment and level of drug resistance based on rapid molecular drug susceptibility testing (DST) in southern Brazil and central Mozambique. DESIGN Descriptive study of 311 isolates from Ribeirão Preto, São Paulo, Brazil (2011–2014) and 155 isolates from Beira, Mozambique (2014–2015). Drug resistance patterns and specific gene mutations were determined using GenoType® MTBDRplus. RESULTS katG gene mutations were detected in 12/22 (54.5%) Brazilian and 32/38 (84.2%) Mozambican isolates. inhA mutations were observed in 9/22 (40.9%) isolates in Brazil and in 4/38 (10.5%) in Mozambique. Both katG and inhA mutations were detected in respectively 1/22 (5%) and 2/38 (5.2%). The difference in the frequency of katG mutations in Brazil and Mozambique was statistically significant (P = 0.04). katG mutations were present in 68.8% (33/48) of patients previously treated with INH and 31.2% (15/48) of patients without previous INH. This difference was not statistically significant (P = 0.223). CONCLUSION INH mutations varied geographically; molecular DST can be used to guide and accelerate decision making in the use of ETH or high doses of INH. PMID:27393546

  4. Age at cancer onset in germline TP53 mutation carriers: association with polymorphisms in predicted G-quadruplex structures

    PubMed Central

    Hainaut, Pierre

    2014-01-01

    Germline TP53 mutations predispose to multiple cancers defining Li-Fraumeni/Li-Fraumeni-like syndrome (LFS/LFL), a disease with large individual disparities in cancer profiles and age of onset. G-quadruplexes (G4s) are secondary structural motifs occurring in guanine tracks, with regulatory effects on DNA and RNA. We analyzed 85 polymorphisms within or near five predicted G4s in TP53 in search of modifiers of penetrance of LFS/LFL in Brazilian cancer families with (n = 35) or without (n = 110) TP53 mutations. Statistical analyses stratified on family structure showed that cancer tended to occur ~15 years later in mutation carriers who also carried the variant alleles of two polymorphisms within predicted G4-forming regions, rs17878362 (TP53 PIN3, 16 bp duplication in intron 3; P = 0.082) and rs17880560 (6 bp duplication in 3′ flanking region; P = 0.067). Haplotype analysis showed that this inverse association was driven by the polymorphic status of the remaining wild-type (WT) haplotype in mutation carriers: in carriers with a WT haplotype containing at least one variant allele of rs17878362 or rs17880560, cancer occurred ~15 years later than in carriers with other WT haplotypes (P = 0.019). No effect on age of cancer onset was observed in subjects without a TP53 mutation. The G4 in intron 3 has been shown to regulate alternative p53 messenger RNA splicing, whereas the biological roles of predicted G4s in the 3′ flanking region remain to be elucidated. In conclusion, this study demonstrates that G4 polymorphisms in haplotypes of the WT TP53 allele have an impact on LFS/LFL penetrance in germline TP53 mutation carriers. PMID:24336192

  5. Conformational Dynamics Modulate Activation of the Ubiquitin Conjugating Enzyme Ube2g2

    PubMed Central

    2017-01-01

    The ubiquitin conjugating enzyme Ube2g2 together with its cognate E3 ligase gp78 catalyzes the synthesis of lysine-48 polyubiquitin chains constituting signals for the proteasomal degradation of misfolded proteins in the endoplasmic reticulum. Here, we employ NMR spectroscopy in combination with single-turnover diubiquitin formation assays to examine the role of the RING domain from gp78 in the catalytic activation of Ube2g2∼Ub conjugates. We find that approximately 60% of the Ube2g2∼Ub conjugates occupy a closed conformation in the absence of gp78-RING, with the population increasing to 82% upon gp78-RING binding. As expected, strong mutations in the hydrophobic patch residues of the ∼Ub moiety result in Ube2g2∼Ub populating only open states with corresponding loss of the ubiquitin conjugation activity. Less disruptive mutations introduced into the hydrophobic patch of the ∼Ub moiety also destabilize the closed conformational state, yet the corresponding effect on the ubiquitin conjugation activity ranges from complete loss to an enhancement of the catalytic activity. These results present a picture in which Ube2g2s active site is in a state of continual dynamic flux with the organization of the active site into a catalytically viable conformation constituting the rate-limiting step for a single ubiquitin ligation event. Ube2g2s function as a highly specific K48-polyubiquitin chain elongator leads us to speculate that this may be a strategy by which Ube2g2 reduces the probability of nonproductive catalytic outcomes in the absence of available substrate. PMID:28884161

  6. Adult onset Leigh syndrome with mitochondrial DNA 8344 A>G mutation.

    PubMed

    Han, Jee-Young; Sung, Jung-Joon; Park, Hong-Kyun; Yoon, Byung-Nam; Lee, Kwang-Woo

    2014-11-01

    We report a pedigree of adult-onset Leigh syndrome (LS) with mitochondrial mutation 8344 A>G. A 38-year-old woman presented with optic neuropathy, weakness and cognitive impairment. Family history of optic neuropathy and systemic involvement was suggestive of mitochondrial encephalopathy. Genetic and radiologic studies showed m.8344 A>G mutation with characteristics of LS. To our knowledge this is the first case of adult-onset LS demonstrating the m.8344 A>G mutation. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. Comparitive study of fluorescence lifetime quenching of rhodamine 6G by MoS2 and Au-MoS2

    NASA Astrophysics Data System (ADS)

    Shakya, Jyoti; Kasana, Parath; Mohanty, T.

    2018-04-01

    Time resolved fluorescence study of Rhodamine 6G (R6G) in the presence of Molybdenum disulfide (MoS2) nanosheets and gold doped MoS2 (Au-MoS2) have been carried out and discussed. We have analyzed the fluorescence decay curves of R6G and it is observed that Au-MoS2 is a better fluorescence lifetime quencher as compare to MoS2 nanosheets. Also, the energy transfer efficiency and energy transfer rate from R6G to MoS2 and Au-MoS2 has been calculated and found higher for Au-MoS2.

  8. NOD2 mutations and anti-Saccharomyces cerevisiae antibodies are risk factors for Crohn’s disease in African Americans

    PubMed Central

    Dassopoulos, Themistocles; Nguyen, Geoffrey C.; Talor, Monica Vladut; Datta, Lisa Wu; Isaacs, Kim L.; Lewis, James D.; Gold, Michael S.; Valentine, John F.; Smoot, Duane T.; Harris, Mary L.; Oliva-Hemker, Maria; Bayless, Theodore M.; Burek, C. Lynne; Brant, Steven R.

    2012-01-01

    Background NOD2 mutations and anti-Saccharomyces cerevisiae antibodies (ASCA) are associated with Crohn’s disease (CD), ileal involvement and complicated disease behavior in whites. ASCA and the three common NOD2 mutations have not been assessed in African American (AA) adults with CD. Methods AA patients with CD and controls were recruited by the Mid-Atlantic African American IBD Study (Johns Hopkins Hospital and satellite centers at Howard University, University of Florida, University of North Carolina, University of Pennsylvania, and the Washington Hospital Center, Washington, DC) as part of the NIDDK IBD Genetics Consortium. Genotyping for the three common CD associated NOD2 mutations (Leu1007fsinsC, G908R/2722g>c, and R702W/2104c>t) and ASCA ELISA assays were performed in 183 AA CD patients and 143 controls. Positive ASCA was based on either IgA or IgG above threshold. CD phenotyping was performed using the NIDDK IBD Genetics Consortium guidelines. Logistic regression was used to calculate adjusted odds ratios (OR) for the association between ASCA and disease phenotype. Results ASCA sensitivity and specificity in this AA population were 70.5% and 70.4% respectively. On univariate analysis, ASCA was associated with younger mean age at diagnosis (25.0±11.8 vs. 32.1±14.2 yrs, p<0.001), ileal involvement (73.0% vs. 48.0%, p=0.002), and complicated (stricturing/ penetrating) behavior (60.3% vs. 41.7%, p=0.03). On multivariate analysis, ASCA titer (/25U) was associated with ileal involvement (OR 1.18, 95% CI 1.04-1.34), complicated behavior (OR 1.13, 95% CI 1.01-1.28) and surgery (hazard ratio 1.11, 95% CI 1.02-1.21). Risks for surgery also included smoking (hazard ratio 1.50, 95% CI 1.14-1.99) and CD family history (hazard ratio 2.39, 95% CI 1.11-5.14). NOD2 carriers (all heterozygotes) were more common among CD cases than controls (8.2 vs. 2.1%; OR 4.17, 95% CI: 1.18 - 14.69). NOD2 mutation population attributable risk was 6.2%. Conclusions In comparison to

  9. Combination of N149S and D171G mutations in Aeromonas caviae polyhydroxyalkanoate synthase and impact on polyhydroxyalkanoate biosynthesis.

    PubMed

    Tsuge, Takeharu; Watanabe, Shinko; Shimada, Daisuke; Abe, Hideki; Doi, Yoshiharu; Taguchi, Seiichi

    2007-12-01

    Aeromonas caviae polyhydroxyalkanoate synthase (PhaC(Ac)) is an important biocatalyst for the synthesis of practically useful two-component polyhydroxyalkanoate copolymer, poly[(R)-3-hydroxybutyrate-co-(R)-3-hydroxyhexanoate] [P(3HB-co-3HHx)]. In a previous study, two PhaC(Ac) mutants that have a single amino acid substitution of either asparagine 149 by serine (N149S) or aspartate 171 by glycine (D171G) were isolated as higher active enzymes by means of evolutionary engineering. In this study, the synergistic effects of N149S and D171G double mutation (NSDG) in PhaC(Ac) on polyhydroxyalkanoate biosynthesis were investigated in recombinant Ralstonia eutropha. The PhaC(Ac) NSDG mutant showed enhanced incorporation of longer 3-hydroxyalkanoate (3HA) units into the polyhydroxyalkanoate copolymer from octanoate (3HA fraction: 18.5 mol%) and soybean oil (5.4 mol%) as a carbon source. Besides, the NSDG mutant synthesized P(3HB) homopolymer with a very high molecular weight (M(w)=368 x 10(4)) when fructose was used as a carbon source. Thus, a combination of the beneficial mutations synergistically altered enzymatic properties, leading to synthesis of a polyhydroxyalkanoate copolymer with enhanced 3HA fraction and increased molecular weight.

  10. Efficacy Outcome Measures for Clinical Trials of USH2A caused by the Common c.2299delG Mutation.

    PubMed

    Calzetti, Giacomo; Levy, Richard A; Cideciyan, Artur V; Garafalo, Alexandra V; Roman, Alejandro J; Sumaroka, Alexander; Charng, Jason; Heon, Elise; Jacobson, Samuel G

    2018-06-25

    To determine the change in vision and retinal structure in patients with the common c.2299delG mutation in the USH2A gene in anticipation of clinical trials of therapy. Retrospective observational case series. Eighteen patients, homozygotes or compound heterozygotes with the c.2299delG mutation in USH2A, were studied with visual acuity, kinetic perimetry, dark- and light-adapted two-color static perimetry, optical coherence tomography (OCT) and autofluorescence (AF) imaging. Serial data were available for at least half of the patients depending on the parameter analyzed. The kinetics of disease progression in this specific molecular form of USH2A differed between the measured parameters. Visual acuity could remain normal for decades. Kinetic and light-adapted static perimetry across the entire visual field had similar rates of decline that were slower than those of rod-based perimetry. Horizontal OCT scans through the macula showed that IS/OS line width had a similar rate of constriction as co-localized AF imaging and cone-based light-adapted sensitivity extent. The rate of constriction of rod-based sensitivity extent across this same region was twice as rapid as that of cones. In patients with the c.2299delG mutation in USH2A, rod photoreceptors are the cells that express disease early and more aggressively than cones. Rod-based vision measurements in central or extracentral-peripheral retinal regions warrant monitoring in order to complete a clinical trial in a timely manner. Copyright © 2018. Published by Elsevier Inc.

  11. Glucose-6-phosphate dehydrogenase (G6PD) mutations database: review of the "old" and update of the new mutations.

    PubMed

    Minucci, Angelo; Moradkhani, Kamran; Hwang, Ming Jing; Zuppi, Cecilia; Giardina, Bruno; Capoluongo, Ettore

    2012-03-15

    In the present paper we have updated the G6PD mutations database, including all the last discovered G6PD genetic variants. We underline that the last database has been published by Vulliamy et al. [1] who analytically reported 140 G6PD mutations: along with Vulliamy's database, there are two main sites, such as http://202.120.189.88/mutdb/ and www.LOVD.nl/MR, where almost all G6PD mutations can be found. Compared to the previous mutation reports, in our paper we have included for each mutation some additional information, such as: the secondary structure and the enzyme 3D position involving by mutation, the creation or abolition of a restriction site (with the enzyme involved) and the conservation score associated with each amino acid position. The mutations reported in the present tab have been divided according to the gene's region involved (coding and non-coding) and mutations affecting the coding region in: single, multiple (at least with two bases involved) and deletion. We underline that for the listed mutations, reported in italic, literature doesn't provide all the biochemical or bio-molecular information or the research data. Finally, for the "old" mutations, we tried to verify features previously reported and, when subsequently modified, we updated the specific information using the latest literature data. Copyright © 2012 Elsevier Inc. All rights reserved.

  12. Identification of a novel functional JAK1 S646P mutation in acute lymphoblastic leukemia

    PubMed Central

    Hu, Liangding; Ning, Hongmei; Jiang, Min; Wang, Danhong; Liu, Tingting; Zhang, Bin; Chen, Hu

    2017-01-01

    The survival rate of childhood acute lymphoblastic leukemia (ALL) is approaching 90%, while the prognosis of adults remains poor due to the limited therapeutic approaches. In order to identify new targets for ALL, we performed whole-exome sequencing on four adults with B-ALL and discovered a somatic JAK1 S646P mutation. Sanger sequencing of JAK1 was conducted on 53 ALL patients, and two cases exhibited A639G and P960S mutations separately. Functional studies demonstrated that only JAK1 S646P mutation could activate multiple signaling pathways, drive cytokine-independent cell growth, and promote proliferation of malignant cells in nude mice. Moreover, a high sensitivity to the JAK1/2 inhibitor ruxolitinib was observed in S646P mutant model. Exploration in a total of 209 ALL cases showed that JAK1 mutations occur at a frequency of 10.5% in T-ALL (2/19) and 1.6% in B-ALL (3/190). Collectively, our results suggested that JAK1 S646P is an activating mutation in vitro and in vivo. JAK-STAT pathway might represent a promising therapeutic target for ALL. PMID:28410228

  13. Identification of a novel functional JAK1 S646P mutation in acute lymphoblastic leukemia.

    PubMed

    Li, Qian; Li, Botao; Hu, Liangding; Ning, Hongmei; Jiang, Min; Wang, Danhong; Liu, Tingting; Zhang, Bin; Chen, Hu

    2017-05-23

    The survival rate of childhood acute lymphoblastic leukemia (ALL) is approaching 90%, while the prognosis of adults remains poor due to the limited therapeutic approaches. In order to identify new targets for ALL, we performed whole-exome sequencing on four adults with B-ALL and discovered a somatic JAK1 S646P mutation. Sanger sequencing of JAK1 was conducted on 53 ALL patients, and two cases exhibited A639G and P960S mutations separately. Functional studies demonstrated that only JAK1 S646P mutation could activate multiple signaling pathways, drive cytokine-independent cell growth, and promote proliferation of malignant cells in nude mice. Moreover, a high sensitivity to the JAK1/2 inhibitor ruxolitinib was observed in S646P mutant model. Exploration in a total of 209 ALL cases showed that JAK1 mutations occur at a frequency of 10.5% in T-ALL (2/19) and 1.6% in B-ALL (3/190). Collectively, our results suggested that JAK1 S646P is an activating mutation in vitro and in vivo. JAK-STAT pathway might represent a promising therapeutic target for ALL.

  14. Co-occurrence of m.1555A>G and m.11778G>A mitochondrial DNA mutations in two Indian families with strikingly different clinical penetrance of Leber hereditary optic neuropathy

    PubMed Central

    Khan, Nahid Akhtar; Govindaraj, Periyasamy; Jyothi, Vuskamalla; Meena, Angamuthu K

    2013-01-01

    Background Mitochondrial DNA (mtDNA) mutations are known to cause Leber hereditary optic neuropathy (LHON). However, the co-occurrence of double pathogenic mutations with different pathological significance in pedigrees is a rare event. Methods Detailed clinical investigation and complete mtDNA sequencing analysis was performed for two Indian families with LHON. The haplogroup was constructed based on evolutionarily important mtDNA variants. Results We observed the existence of double pathogenic mutations (m.11778G>A and m.1555A>G) in two Indian LHON families, who are from different haplogroup backgrounds (M5a and U2e1), with different clinical penetrance of the disease (visual impairment). The m.11778G>A mutation in the MT-ND4 gene is associated primarily with LHON; whereas, m.1555A>G in the 12S rRNA gene has been reported with aminoglycoside-induced non-syndromic hearing loss. Conclusions The absence of hearing abnormality and widely varying clinical expression of LHON suggest additional nuclear modifier genes, environmental factors, and population heterogeneity might play an important role in the expression of visual impairment in these families. PMID:23805034

  15. Antitumor activity of alectinib, a selective ALK inhibitor, in an ALK-positive NSCLC cell line harboring G1269A mutation: Efficacy of alectinib against ALK G1269A mutated cells.

    PubMed

    Yoshimura, Yasushi; Kurasawa, Mitsue; Yorozu, Keigo; Puig, Oscar; Bordogna, Walter; Harada, Naoki

    2016-03-01

    Alectinib is a highly selective next-generation anaplastic lymphoma kinase (ALK) inhibitor. Although alectinib shows inhibitory activity against various crizotinib-resistant ALK mutations in studies using cell-free kinase assays and Ba/F3 cell-based assays, it has not been tested for efficacy against non-small cell lung cancer (NSCLC) with the ALK mutations. We conducted in vitro and in vivo investigations into the antitumor activity of alectinib against an ALK-positive NSCLC cell line, SNU-2535, which harbors an ALK G1269A mutation. The clinical efficacy of alectinib against a NSCLC patient harboring ALK G1269A mutation was evaluated in the phase I part of the North American study. Alectinib exhibited antiproliferative activity against SNU-2535 cells in vitro with IC50 of 33.1 nM. Alectinib strongly inhibited phosphorylation of ALK and its downstream signaling molecules ERK1/2, AKT, and STAT3. In a mouse xenograft model, once-daily oral administration of alectinib for 21 days resulted in strong tumor regression. In addition, administration of alectinib for 100 days achieved continuous tumor regression without tumor regrowth in all mice. Notably, eradication of tumor cells was observed in half of the mice. In the clinical study, a patient with ALK G1269A mutation showed partial response to alectinib with a duration of response of 84 days. These results indicated that alectinib has potent antitumor activity against NSCLC cells harboring the crizotinib-resistant mutation ALK G1269A. It is expected that alectinib would provide a valuable therapeutic option for patients with NSCLC having not only native ALK but also crizotinib-resistant ALK mutations.

  16. Mutations in the mitochondrial thioredoxin reductase gene TXNRD2 cause dilated cardiomyopathy.

    PubMed

    Sibbing, Dirk; Pfeufer, Arne; Perisic, Tamara; Mannes, Alexander M; Fritz-Wolf, Karin; Unwin, Sarah; Sinner, Moritz F; Gieger, Christian; Gloeckner, Christian Johannes; Wichmann, Heinz-Erich; Kremmer, Elisabeth; Schäfer, Zasie; Walch, Axel; Hinterseer, Martin; Näbauer, Michael; Kääb, Stefan; Kastrati, Adnan; Schömig, Albert; Meitinger, Thomas; Bornkamm, Georg W; Conrad, Marcus; von Beckerath, Nicolas

    2011-05-01

    Cardiac energy requirement is met to a large extent by oxidative phosphorylation in mitochondria that are highly abundant in cardiac myocytes. Human mitochondrial thioredoxin reductase (TXNRD2) is a selenocysteine-containing enzyme essential for mitochondrial oxygen radical scavenging. Cardiac-specific deletion of Txnrd2 in mice results in dilated cardiomyopathy (DCM). The aim of this study was to investigate whether TXNRD2 mutations explain a fraction of monogenic DCM cases. Sequencing and subsequent genotyping of TXNRD2 in patients diagnosed with DCM (n = 227) and in DCM-free (n = 683) individuals from the general population sample KORA S4 was performed. The functional impact of observed mutations on Txnrd2 function was tested in mouse fibroblasts. We identified two novel amino acid residue-altering TXNRD2 mutations [175G > A (Ala59Thr) and 1124G > A (Gly375Arg)] in three heterozygous carriers among 227 patients that were not observed in the 683 DCM-free individuals. Both DCM-associated mutations result in amino acid substitutions of highly conserved residues in helices contributing to the flavin-adenine dinucleotide (FAD)-binding domain of TXNRD2. Functional analysis of both mutations in Txnrd2(-/-) mouse fibroblasts revealed that contrasting to wild-type (wt) Txnrd2, neither mutant did restore Txnrd2 function. Mutants even impaired the survival of Txnrd2 wt cells under oxidative stress by a dominant-negative mechanism. For the first time, we describe mutations in DCM patients in a gene involved in the regulation of cellular redox state. TXNRD2 mutations may explain a fraction of human DCM disease burden.

  17. Identification of the PLA2G6 c.1579G>A Missense Mutation in Papillon Dog Neuroaxonal Dystrophy Using Whole Exome Sequencing Analysis

    PubMed Central

    Tsuboi, Masaya; Watanabe, Manabu; Nibe, Kazumi; Yoshimi, Natsuko; Kato, Akihisa; Sakaguchi, Masahiro; Yamato, Osamu; Tanaka, Miyuu; Kuwamura, Mitsuru; Kushida, Kazuya; Harada, Tomoyuki; Chambers, James Kenn; Sugano, Sumio; Uchida, Kazuyuki; Nakayama, Hiroyuki

    2017-01-01

    Whole exome sequencing (WES) has become a common tool for identifying genetic causes of human inherited disorders, and it has also recently been applied to canine genome research. We conducted WES analysis of neuroaxonal dystrophy (NAD), a neurodegenerative disease that sporadically occurs worldwide in Papillon dogs. The disease is considered an autosomal recessive monogenic disease, which is histopathologically characterized by severe axonal swelling, known as “spheroids,” throughout the nervous system. By sequencing all eleven DNA samples from one NAD-affected Papillon dog and her parents, two unrelated NAD-affected Papillon dogs, and six unaffected control Papillon dogs, we identified 10 candidate mutations. Among them, three candidates were determined to be “deleterious” by in silico pathogenesis evaluation. By subsequent massive screening by TaqMan genotyping analysis, only the PLA2G6 c.1579G>A mutation had an association with the presence or absence of the disease, suggesting that it may be a causal mutation of canine NAD. As a human homologue of this gene is a causative gene for infantile neuroaxonal dystrophy, this canine phenotype may serve as a good animal model for human disease. The results of this study also indicate that WES analysis is a powerful tool for exploring canine hereditary diseases, especially in rare monogenic hereditary diseases. PMID:28107443

  18. Structure and hydrogen bonds of γS-crystallin and γS-G18V studied by molecular dynamics simulation

    NASA Astrophysics Data System (ADS)

    Ozawa, A.; Yamada, H.; Mori, S.; Noguchi, Y.; Miyakawa, T.; Morikawa, R.; Takasu, M.

    2017-11-01

    The γS-crystallin protein maintains transparency and increases the reflection index of the eye lens. Here, γS-G18V, a mutant of γS-crystallin, was studied, in which the 18th residue, glycine, is replaced by valine. This mutation is associated with childhood-onset cortical cataract. Mutated γS-crystallin forms cross-links with other proteins in the eye lens and leads to aggregation at a temperature lower than that for γS-crystallin. In this study, structural analysis of γS-crystallin and γS-G18V was performed by molecular dynamics simulation. It was found that cysteine residues around the area where the mutation is introduced are arranged at the solvent side with less hydrogen bonds than in the case of γS-WT.

  19. Screening for duplications, deletions and a common intronic mutation detects 35% of second mutations in patients with USH2A monoallelic mutations on Sanger sequencing.

    PubMed

    Steele-Stallard, Heather B; Le Quesne Stabej, Polona; Lenassi, Eva; Luxon, Linda M; Claustres, Mireille; Roux, Anne-Francoise; Webster, Andrew R; Bitner-Glindzicz, Maria

    2013-08-08

    Usher Syndrome is the leading cause of inherited deaf-blindness. It is divided into three subtypes, of which the most common is Usher type 2, and the USH2A gene accounts for 75-80% of cases. Despite recent sequencing strategies, in our cohort a significant proportion of individuals with Usher type 2 have just one heterozygous disease-causing mutation in USH2A, or no convincing disease-causing mutations across nine Usher genes. The purpose of this study was to improve the molecular diagnosis in these families by screening USH2A for duplications, heterozygous deletions and a common pathogenic deep intronic variant USH2A: c.7595-2144A>G. Forty-nine Usher type 2 or atypical Usher families who had missing mutations (mono-allelic USH2A or no mutations following Sanger sequencing of nine Usher genes) were screened for duplications/deletions using the USH2A SALSA MLPA reagent kit (MRC-Holland). Identification of USH2A: c.7595-2144A>G was achieved by Sanger sequencing. Mutations were confirmed by a combination of reverse transcription PCR using RNA extracted from nasal epithelial cells or fibroblasts, and by array comparative genomic hybridisation with sequencing across the genomic breakpoints. Eight mutations were identified in 23 Usher type 2 families (35%) with one previously identified heterozygous disease-causing mutation in USH2A. These consisted of five heterozygous deletions, one duplication, and two heterozygous instances of the pathogenic variant USH2A: c.7595-2144A>G. No variants were found in the 15 Usher type 2 families with no previously identified disease-causing mutations. In 11 atypical families, none of whom had any previously identified convincing disease-causing mutations, the mutation USH2A: c.7595-2144A>G was identified in a heterozygous state in one family. All five deletions and the heterozygous duplication we report here are novel. This is the first time that a duplication in USH2A has been reported as a cause of Usher syndrome. We found that 8 of

  20. Characterization of Novel Hepatitis B Virus PreS/S-Gene Mutations in a Patient with Occult Hepatitis B Virus Infection

    PubMed Central

    Xu, Zhihui; Chen, Rongjuan; Si, Lanlan; Lu, Shanshan; Li, Xiaodong; Wang, Shuai; Zhang, Kai; Li, Jin; Han, Juqiang; Xu, Dongping

    2016-01-01

    Objective The impact of hepatitis B virus (HBV) preS/S-gene mutations on occult HBV infection (OBI) is not fully understood. This study characterized multiple novel HBV preS/S-gene mutants obtained from an OBI patient. Methods PreS/S-gene mutants were analyzed by clonal sequencing. Viral replication and expression were analyzed by transfecting HBV genomic recombinants into HepG2 cells. Results Twenty-one preS/S-gene mutants were cloned from four sequential serum samples, including 13 mutants that were not previously documented: (1) sI/T126V+sG145R; (2) preS1 nt 3014−3198 deletion; (3) preS1 nt 3046−3177 deletion; (4) preS1 nt 3046−3177 deletion+s115−116 “INGTST” insertion; (5) preS1 nt 3046−3177 deletion+s115−116 “INGTST” insertion+sG145R; (6) preS1 nt 3115−3123 deletion+sQ129N; (7) preS1 nt 3115−3123 deletion+s126−127 “RPCMNCTI” insertion; (8) s115−116 “INGTST” insertion; (9) s115−116 “INGTST” insertion+sG145R; (10) s126−127 “RPCMNCTI” insertion; (11) preS1 nt 2848−2862 deletion+preS2 initiation codon M→I; (12) s122−123 “KSTGLCK” insertion+sQ129N; and (13) preS2 initiation codon M→I+s131−133TSM→NST. The proportion of preS1 nt 3046−3177 deletion and preS2 initiation codon M→I+s131−133TSM→NST mutants increased in the viral pool with prolonged disease. The 13 novel OBI-related mutants showed a 51.2−99.9% decrease in HBsAg levels compared with that of the wild type. Additional N-glycosylation-associated mutations, sQ129N and s131−133TSM→NST, but not s126−127 “RPCMNCTI,” greatly attenuated anti-HBs binding to HBsAg. Compared with the wild type, replication and surface antigen promoter II activity of the preS1 nt 3046−3177 deletion mutant decreased by 43.3% and 97.0%, respectively. Conclusion PreS/S-gene mutations may play coordinated roles in the presentation of OBI and might be associated with disease progression. This has implications for HBV diagnosis and vaccine improvement. PMID

  1. Cdc6 localizes to S- and G2-phase centrosomes in a cell cycle-dependent manner

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Gwang Su; Kang, Jeeheon; Bang, Sung Woong

    2015-01-16

    Highlights: • Cdc6 protein is a component of the pre-replicative complex required for chromosomal replication initiation. • Cdc6 localized to centrosomes of S and G2 phases in a cell cycle-dependent manner. • The centrosomal localization was governed by centrosomal localization signal sequences of Cdc6. • Deletions or substitution mutations on the centrosomal localization signal interfered with centrosomal localization of the Cdc6 proteins. - Abstract: The Cdc6 protein has been primarily investigated as a component of the pre-replicative complex for the initiation of chromosome replication, which contributes to maintenance of chromosomal integrity. Here, we show that Cdc6 localized to the centrosomesmore » during S and G2 phases of the cell cycle. The centrosomal localization was mediated by Cdc6 amino acid residues 311–366, which are conserved within other Cdc6 homologues and contains a putative nuclear export signal. Deletions or substitutions of the amino acid residues did not allow the proteins to localize to centrosomes. In contrast, DsRed tag fused to the amino acid residues localized to centrosomes. These results indicated that a centrosome localization signal is contained within amino acid residues 311–366. The cell cycle-dependent centrosomal localization of Cdc6 in S and G2 phases suggest a novel function of Cdc6 in centrosomes.« less

  2. CHEK2 mutation and risk of prostate cancer: a systematic review and meta-analysis

    PubMed Central

    Wang, Yue; Dai, Bo; Ye, Dingwei

    2015-01-01

    Background: CHEK2 encodes for a G2 checkpoint kinase which plays a critical role in DNA repair. Its mutation confers an increased risk of breast cancer. It has also been suggested to increase risks of prostate cancer, but its involvement with this type of cancer has not been confirmed. Methods: We performed a systematic review and meta-analysis to clarify the association between CHEK2 1100delC, IVS2+1G>A, I157T mutation and risk of Prostate Cancer. A comprehensive, computerized literature search of PubMed until December 27, 2014 was carried out. Eligible studies were included according to specific inclusion criteria. Pooled hazard ratio was estimated using the fixed effects model or random effects model according to heterogeneity between studies. Results: Eight eligible studies were included in the analysis, all were retrospective studies. The overall meta-analysis demonstrated that the CHEK2 1100delC mutation (OR 3.29; 95% confidence interval: 1.85-5.85; P = 0.00) and I157T missense mutation (OR 1.80; 95% confidence interval: 1.51-2.14; P = 0.00) was associated with higher risk of Prostate Cancer, and CHEK2 1100delC mutation is irrelevant to familial aggregation phenomenon of prostate cancer (OR 1.59; 95% confidence interval: 0.79-3.20; P = 0.20). The IVS2+1G>A mutation is also irrelevant to Prostate Cancer (OR = 1.59, 95% CI = 0.93-2.71, P = 0.09). None of the single studies materially altered the original results and no evidence of publication bias was found. Conclusion: CHEK2 1100delC mutation and I157T missense mutation in males indicates higher risk of Prostate Cancer, but there’s no evidence to prove the CHEK2 1100delC mutation was associated with Familial prostate cancer. PMID:26629066

  3. Effectiveness of ivacaftor in cystic fibrosis patients with non-G551D gating mutations.

    PubMed

    Guimbellot, Jennifer; Solomon, George M; Baines, Arthur; Heltshe, Sonya L; VanDalfsen, Jill; Joseloff, Elizabeth; Sagel, Scott D; Rowe, Steven M

    2018-04-20

    The cystic fibrosis transmembrane conductance regulator (CFTR) potentiator ivacaftor is approved for patients with CF with gating and residual function CFTR mutations. We report the results of an observational study investigating its effects in CF patients with non-G551D gating mutations. Patients with non-G551D gating mutations were recruited to an open-label study evaluating ivacaftor. Primary outcomes included: lung function, sweat chloride, weight gain, and quality of life scores. Twenty-one subjects were enrolled and completed 6 months follow-up on ivacaftor; mean age was 25.6 years with 52% <18. Baseline ppFEV 1 was 68% and mean sweat chloride 89.6 mEq/L. Participants experienced significant improvements in ppFEV 1 (mean absolute increase of 10.9% 95% CI = [2.6,19.3], p = 0.0134), sweat chloride (-48.6 95% CI = [-67.4,-29.9], p < 0.0001), and weight (5.1 kg, 95% CI = [2.8, 7.3], p = 0.0002). Patients with non-G551D gating mutations experienced improved lung function, nutritional status, and quality of life. This study supports ongoing use of ivacaftor for patients with these mutations. Copyright © 2018. Published by Elsevier B.V.

  4. Mutations in the G6PC3 gene cause Dursun syndrome.

    PubMed

    Banka, Siddharth; Newman, William G; Ozgül, R Koksal; Dursun, Ali

    2010-10-01

    Dursun syndrome is a triad of familial primary pulmonary hypertension, leucopenia, and atrial septal defect. Here we demonstrate that mutations in G6PC3 cause Dursun syndrome. Mutations in G6PC3 are known to also cause severe congenital neutropenia type 4. Identification of the genetic basis of Dursun syndrome expands the pre-existing knowledge about the phenotypic effects of mutations in G6PC3. We propose that Dursun syndrome should now be considered as a subset of severe congenital neutropenia type 4 with pulmonary hypertension as an important clinical feature. Copyright © 2010 Wiley-Liss, Inc.

  5. Prolonged Response to Trastuzumab in a Patient With HER2-Nonamplified Breast Cancer With Elevated HER2 Dimerization Harboring an ERBB2 S310F Mutation.

    PubMed

    Chumsri, Saranya; Weidler, Jodi; Ali, Siraj; Balasubramanian, Sohail; Wallweber, Gerald; DeFazio-Eli, Lisa; Chenna, Ahmed; Huang, Weidong; DeRidder, Angela; Goicocheal, Lindsay; Perez, Edith A

    2015-09-01

    In the current genomic era, increasing evidence demonstrates that approximately 2% of HER2-negative breast cancers, by current standard testings, harbor activating mutations of ERBB2. However, whether patients with HER2-negative breast cancer with activating mutations of ERBB2 also experience response to anti-HER2 therapies remains unclear. This case report describes a patient with HER2-nonamplified heavily pretreated breast cancer who experienced prolonged response to trastuzumab in combination with pertuzumab and fulvestrant. Further molecular analysis demonstrated that her tumors had an elevated HER2 dimerization that corresponded to ERBB2 S310F mutation. Located in the extracellular domain of the HER2 protein, this mutation was reported to promote noncovalent dimerization that results in the activation of the downstream signaling pathways. This case highlights the fact that HER2-targeted therapy may be valuable in patients harboring an ERBB2 S310F mutation. Copyright © 2015 by the National Comprehensive Cancer Network.

  6. The structural basis of the dominant negative phenotype of the Gαi1β1γ2 G203A/A326S heterotrimer

    PubMed Central

    Liu, Ping; Jia, Ming-zhu; Zhou, X Edward; De Waal, Parker W; Dickson, Bradley M; Liu, Bo; Hou, Li; Yin, Yan-ting; Kang, Yan-yong; Shi, Yi; Melcher, Karsten; Xu, H Eric; Jiang, Yi

    2016-01-01

    Aim: Dominant negative mutant G proteins have provided critical insight into the mechanisms of G protein-coupled receptor (GPCR) signaling, but the mechanisms underlying the dominant negative characteristics are not completely understood. The aim of this study was to determine the structure of the dominant negative Gαi1β1γ2 G203A/A326S complex (Gi-DN) and to reveal the structural basis of the mutation-induced phenotype of Gαi1β1γ2. Methods: The three subunits of the Gi-DN complex were co-expressed with a baculovirus expression system. The Gi-DN heterotrimer was purified, and the structure of its complex with GDP was determined through X-ray crystallography. Results: The Gi-DN heterotrimer structure revealed a dual mechanism underlying the dominant negative characteristics. The mutations weakened the hydrogen bonding network between GDP/GTP and the binding pocket residues, and increased the interactions in the Gα-Gβγ interface. Concomitantly, the Gi-DN heterotrimer adopted a conformation, in which the C-terminus of Gαi and the N-termini of both the Gβ and Gγ subunits were more similar to the GPCR-bound state compared with the wild type complex. From these structural observations, two additional mutations (T48F and D272F) were designed that completely abolish the GDP binding of the Gi-DN heterotrimer. Conclusion: Overall, the results suggest that the mutations impede guanine nucleotide binding and Gα-Gβγ protein dissociation and favor the formation of the G protein/GPCR complex, thus blocking signal propagation. In addition, the structure provides a rationale for the design of other mutations that cause dominant negative effects in the G protein, as exemplified by the T48F and D272F mutations. PMID:27498775

  7. Association between Three Mutations, F1565C, V1023G and S996P, in the Voltage-Sensitive Sodium Channel Gene and Knockdown Resistance in Aedes aegypti from Yogyakarta, Indonesia

    PubMed Central

    Rochmijati Wuliandari, Juli; Lee, Siu Fai; White, Vanessa Linley; Tantowijoyo, Warsito; Hoffmann, Ary Anthony; Endersby-Harshman, Nancy Margaret

    2015-01-01

    Mutations in the voltage-sensitive sodium channel gene (Vssc) have been identified in Aedes aegypti and some have been associated with pyrethroid insecticide resistance. Whether these mutations cause resistance, alone or in combination with other alleles, remains unclear, but must be understood if mutations are to become markers for resistance monitoring. We describe High Resolution Melt (HRM) genotyping assays for assessing mutations found in Ae. aegypti in Indonesia (F1565C, V1023G, S996P) and use them to test for associations with pyrethroid resistance in mosquitoes from Yogyakarta, a city where insecticide use is widespread. Such knowledge is important because Yogyakarta is a target area for releases of Wolbachia-infected mosquitoes with virus-blocking traits for dengue suppression. We identify three alleles across Yogyakarta putatively linked to resistance in previous research. By comparing resistant and susceptible mosquitoes from bioassays, we show that the 1023G allele is associated with resistance to type I and type II pyrethroids. In contrast, F1565C homozygotes were rare and there was only a weak association between individuals heterozygous for the mutation and resistance to a type I pyrethroid. As the heterozygote is expected to be incompletely recessive, it is likely that this association was due to a different resistance mechanism being present. A resistance advantage conferred to V1023G homozygotes through addition of the S996P allele in the homozygous form was suggested for the Type II pyrethroid, deltamethrin. Screening of V1023G and S996P should assist resistance monitoring in Ae. aegypti from Yogyakarta, and these mutations should be maintained in Wolbachia strains destined for release in this city to ensure that these virus-blocking strains of mosquitoes are not disadvantaged, relative to resident populations. PMID:26463408

  8. Association between Three Mutations, F1565C, V1023G and S996P, in the Voltage-Sensitive Sodium Channel Gene and Knockdown Resistance in Aedes aegypti from Yogyakarta, Indonesia.

    PubMed

    Wuliandari, Juli Rochmijati; Lee, Siu Fai; White, Vanessa Linley; Tantowijoyo, Warsito; Hoffmann, Ary Anthony; Endersby-Harshman, Nancy Margaret

    2015-07-23

    Mutations in the voltage-sensitive sodium channel gene (Vssc) have been identified in Aedes aegypti and some have been associated with pyrethroid insecticide resistance. Whether these mutations cause resistance, alone or in combination with other alleles, remains unclear, but must be understood if mutations are to become markers for resistance monitoring. We describe High Resolution Melt (HRM) genotyping assays for assessing mutations found in Ae. aegypti in Indonesia (F1565C, V1023G, S996P) and use them to test for associations with pyrethroid resistance in mosquitoes from Yogyakarta, a city where insecticide use is widespread. Such knowledge is important because Yogyakarta is a target area for releases of Wolbachia-infected mosquitoes with virus-blocking traits for dengue suppression. We identify three alleles across Yogyakarta putatively linked to resistance in previous research. By comparing resistant and susceptible mosquitoes from bioassays, we show that the 1023G allele is associated with resistance to type I and type II pyrethroids. In contrast, F1565C homozygotes were rare and there was only a weak association between individuals heterozygous for the mutation and resistance to a type I pyrethroid. As the heterozygote is expected to be incompletely recessive, it is likely that this association was due to a different resistance mechanism being present. A resistance advantage conferred to V1023G homozygotes through addition of the S996P allele in the homozygous form was suggested for the Type II pyrethroid, deltamethrin. Screening of V1023G and S996P should assist resistance monitoring in Ae. aegypti from Yogyakarta, and these mutations should be maintained in Wolbachia strains destined for release in this city to ensure that these virus-blocking strains of mosquitoes are not disadvantaged, relative to resident populations.

  9. Mutation in BMPR2 Promoter: A ‘Second Hit’ for Manifestation of Pulmonary Arterial Hypertension?

    PubMed Central

    Ehlken, Nicola; Fischer, Christine; Lichtblau, Mona; Grünig, Ekkehard; Hinderhofer, Katrin

    2015-01-01

    Background Hereditary pulmonary arterial hypertension (HPAH) can be caused by autosomal dominant inherited mutations of TGF-β genes, such as the bone morphogenetic protein receptor 2 (BMPR2) and Endoglin (ENG) gene. Additional modifier genes may play a role in disease manifestation and severity. In this study we prospectively assessed two families with known BMPR2 or ENG mutations clinically and genetically and screened for a second mutation in the BMPR2 promoter region. Methods We investigated the BMPR2 promoter region by direct sequencing in two index-patients with invasively confirmed diagnosis of HPAH, carrying a mutation in the BMPR2 and ENG gene, respectively. Sixteen family members have been assessed clinically by non-invasive methods and genetically by direct sequencing. Results In both index patients with a primary BMPR2 deletion (exon 2 and 3) and Endoglin missense variant (c.1633G>A, p.(G545S)), respectively, we detected a second mutation (c.-669G>A) in the promoter region of the BMPR2 gene. The index patients with 2 mutations/variants were clinically severely affected at early age, whereas further family members with only one mutation had no manifest HPAH. Conclusion The finding of this study supports the hypothesis that additional mutations may lead to an early and severe manifestation of HPAH. This study shows for the first time that in the regulatory region of the BMPR2 gene the promoter may be important for disease penetrance. Further studies are needed to assess the incidence and clinical relevance of mutations of the BMPR2 promoter region in a larger patient cohort. PMID:26167679

  10. Investigating the structural impact of S311C mutation in DRD2 receptor by molecular dynamics & docking studies.

    PubMed

    Podder, Avijit; Pandey, Deeksha; Latha, N

    2016-04-01

    Dopamine receptors (DR) are neuronal cell surface proteins that mediate the action of neurotransmitter dopamine in brain. Dopamine receptor D2 (DRD2) that belongs to G-protein coupled receptors (GPCR) family is a major therapeutic target for of various neurological and psychiatric disorders in human. The third inter cellular loop (ICL3) in DRD2 is essential for coupling G proteins and several signaling scaffold proteins. A mutation in ICL3 can interfere with this binding interface, thereby altering the DRD2 signaling. In this study we have examined the deleterious effect of serine to cysteine mutation at position 311 (S311C) in the ICL3 region that is implicated in diseases like schizophrenia and alcoholism. An in silico structure modeling approach was employed to determine the wild type (WT) and mutant S311C structures of DRD2, scaffold proteins - Gαi/o and NEB2. Protein-ligand docking protocol was exercised to predict the interactions of natural agonist dopamine with both the WT and mutant structures of DRD2. Besides, atomistic molecular dynamics (MD) simulations were performed to provide insights into essential dynamics of the systems-unbound and dopamine bound DRD2 (WT and mutant) and three independent simulations for Gαi, Gαo and NEB2 systems. To provide information on intra-molecular arrangement of the structures, a comprehensive residue interactions network of both dopamine bound WT and mutant DRD2 protein were studied. We also employed a protein-protein docking strategy to find the interactions of scaffold proteins - Gαi/o and NEB2 with both dopamine bound WT and mutant structures of DRD2. We observed a marginal effect of the mutation in dopamine binding mechanism on the trajectories analyzed. However, we noticed a significant structural alteration of the mutant receptor which affects Gαi/o and NEB2 binding that can be causal for malfunctioning in cAMP-dependent signaling and Ca(+) homeostasis in the brain dopaminergic system leading to

  11. A pilot study of mitochondrial DNA point mutation A3243G in a sample of Croatian patients having type 2 diabetes mellitus associated with maternal inheritance.

    PubMed

    Martin-Kleiner, I; Pape-Medvidović, E; Pavlić-Renar, I; Metelko, Z; Kusec, R; Gabrilovac, J; Boranić, M

    2004-12-01

    In this work, patients having type 2 diabetes mellitus and diabetic mothers were tested for the presence of mitochondrial DNA point mutation A3243G. This mutation is associated with the MELAS syndrome (mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes), diabetes and deafness. Twenty-two diabetic persons were screened. DNA was isolated from peripheral blood lymphocytes and from swabs of oral mucosa. The mitochondrial DNA point mutation A3243G was detected using PCR-RFLP test. The mutation was detected in oral mucosal DNA of two patients (but not from lymphocyte DNA). One patient was a man with hearing and visual impairments and proteinuria; the other was a woman having proteinuria but no hearing impairment. The mutation was not detectable in oral mucosal DNA from the control persons: 20 diabetic patients having diabetic fathers and 22 healthy, nondiabetic volunteers. The incidence of mitochondrial DNA point mutation A3243G in this study of Croatian diabetic patients is in line with data in the literature.

  12. Decreased mutation frequencies among immunoglobulin G variable region genes during viremic HIV-1 infection.

    PubMed

    Bowers, Elisabeth; Scamurra, Ronald W; Asrani, Anil; Beniguel, Lydie; MaWhinney, Samantha; Keays, Kathryne M; Thurn, Joseph R; Janoff, Edward N

    2014-01-01

    HIV-1 infection is complicated by high rates of opportunistic infections against which specific antibodies contribute to immune defense. Antibody function depends on somatic hypermutation (SHM) of variable regions of immunoglobulin heavy chain genes (VH-D-J). We characterized the frequency of SHM in expressed IgG mRNA immunoglobulin transcripts from control and HIV-1-infected patients. We compared utilization of genes in the most prominent VH family (VH3) and mutation frequencies and patterns of cDNA from VH3-IgG genes from 10 seronegative control subjects and 21 patients with HIV-1 infection (6 without and 15 patients with detectable plasma viremia). Unique IgG VH3 family cDNA sequences (n = 1,565) were PCR amplified, cloned, and sequenced from blood. Sequences were analyzed using online (Vbase) and in-house immunoglobulin alignment resources. Mutation frequencies in the antigen-binding hypervariable complementarity determining regions (CDR1/2) of IgG class-switched B cells were lower among viremic HIV-1-infected patients vs. controls for nucleotides (CDR1/2: 10±5% vs. 13.5±6%, p = 0.03) and amino acids (CDR: 20%±10 vs. 25%±12, p = 0.02) and in structural framework regions. Mutation patterns were similar among groups. The most common VH3 gene, VH3-23, was utilized less frequently among viremic HIV-1-infected patients (p = 0.03), and overall, mutation frequencies were decreased in nearly all VH3 genes compared with controls. B cells from HIV-1-infected patients show decreased mutation frequencies, especially in antigen-binding VH3 CDR genes, and selective defects in gene utilization. Similar mutation patterns suggest defects in the quantity, but not quality, of mutator activity. Lower levels of SHM in IgG class-switched B cells from HIV-1-infected patients may contribute to the increased risk of opportunistic infections and impaired humoral responses to preventative vaccines.

  13. Whole-exome sequencing identifies novel MPL and JAK2 mutations in triple-negative myeloproliferative neoplasms

    PubMed Central

    Milosevic Feenstra, Jelena D.; Nivarthi, Harini; Gisslinger, Heinz; Leroy, Emilie; Rumi, Elisa; Chachoua, Ilyas; Bagienski, Klaudia; Kubesova, Blanka; Pietra, Daniela; Gisslinger, Bettina; Milanesi, Chiara; Jäger, Roland; Chen, Doris; Berg, Tiina; Schalling, Martin; Schuster, Michael; Bock, Christoph; Constantinescu, Stefan N.; Cazzola, Mario

    2016-01-01

    Essential thrombocythemia (ET) and primary myelofibrosis (PMF) are chronic diseases characterized by clonal hematopoiesis and hyperproliferation of terminally differentiated myeloid cells. The disease is driven by somatic mutations in exon 9 of CALR or exon 10 of MPL or JAK2-V617F in >90% of the cases, whereas the remaining cases are termed “triple negative.” We aimed to identify the disease-causing mutations in the triple-negative cases of ET and PMF by applying whole-exome sequencing (WES) on paired tumor and control samples from 8 patients. We found evidence of clonal hematopoiesis in 5 of 8 studied cases based on clonality analysis and presence of somatic genetic aberrations. WES identified somatic mutations in 3 of 8 cases. We did not detect any novel recurrent somatic mutations. In 3 patients with clonal hematopoiesis analyzed by WES, we identified a somatic MPL-S204P, a germline MPL-V285E mutation, and a germline JAK2-G571S variant. We performed Sanger sequencing of the entire coding region of MPL in 62, and of JAK2 in 49 additional triple-negative cases of ET or PMF. New somatic (T119I, S204F, E230G, Y591D) and 1 germline (R321W) MPL mutation were detected. All of the identified MPL mutations were gain-of-function when analyzed in functional assays. JAK2 variants were identified in 5 of 57 triple-negative cases analyzed by WES and Sanger sequencing combined. We could demonstrate that JAK2-V625F and JAK2-F556V are gain-of-function mutations. Our results suggest that triple-negative cases of ET and PMF do not represent a homogenous disease entity. Cases with polyclonal hematopoiesis might represent hereditary disorders. PMID:26423830

  14. Whole-exome sequencing identifies novel MPL and JAK2 mutations in triple-negative myeloproliferative neoplasms.

    PubMed

    Milosevic Feenstra, Jelena D; Nivarthi, Harini; Gisslinger, Heinz; Leroy, Emilie; Rumi, Elisa; Chachoua, Ilyas; Bagienski, Klaudia; Kubesova, Blanka; Pietra, Daniela; Gisslinger, Bettina; Milanesi, Chiara; Jäger, Roland; Chen, Doris; Berg, Tiina; Schalling, Martin; Schuster, Michael; Bock, Christoph; Constantinescu, Stefan N; Cazzola, Mario; Kralovics, Robert

    2016-01-21

    Essential thrombocythemia (ET) and primary myelofibrosis (PMF) are chronic diseases characterized by clonal hematopoiesis and hyperproliferation of terminally differentiated myeloid cells. The disease is driven by somatic mutations in exon 9 of CALR or exon 10 of MPL or JAK2-V617F in >90% of the cases, whereas the remaining cases are termed "triple negative." We aimed to identify the disease-causing mutations in the triple-negative cases of ET and PMF by applying whole-exome sequencing (WES) on paired tumor and control samples from 8 patients. We found evidence of clonal hematopoiesis in 5 of 8 studied cases based on clonality analysis and presence of somatic genetic aberrations. WES identified somatic mutations in 3 of 8 cases. We did not detect any novel recurrent somatic mutations. In 3 patients with clonal hematopoiesis analyzed by WES, we identified a somatic MPL-S204P, a germline MPL-V285E mutation, and a germline JAK2-G571S variant. We performed Sanger sequencing of the entire coding region of MPL in 62, and of JAK2 in 49 additional triple-negative cases of ET or PMF. New somatic (T119I, S204F, E230G, Y591D) and 1 germline (R321W) MPL mutation were detected. All of the identified MPL mutations were gain-of-function when analyzed in functional assays. JAK2 variants were identified in 5 of 57 triple-negative cases analyzed by WES and Sanger sequencing combined. We could demonstrate that JAK2-V625F and JAK2-F556V are gain-of-function mutations. Our results suggest that triple-negative cases of ET and PMF do not represent a homogenous disease entity. Cases with polyclonal hematopoiesis might represent hereditary disorders. © 2016 by The American Society of Hematology.

  15. Spatially Resolving the Very High Energy Emission from MGRO J2019+37 with VERITAS

    NASA Astrophysics Data System (ADS)

    Aliu, E.; Aune, T.; Behera, B.; Beilicke, M.; Benbow, W.; Berger, K.; Bird, R.; Bouvier, A.; Buckley, J. H.; Bugaev, V.; Cerruti, M.; Chen, X.; Ciupik, L.; Connolly, M. P.; Cui, W.; Dumm, J.; Dwarkadas, V. V.; Errando, M.; Falcone, A.; Federici, S.; Feng, Q.; Finley, J. P.; Fleischhack, H.; Fortin, P.; Fortson, L.; Furniss, A.; Galante, N.; Gillanders, G. H.; Gotthelf, E. V.; Griffin, S.; Griffiths, S. T.; Grube, J.; Gyuk, G.; Hanna, D.; Holder, J.; Hughes, G.; Humensky, T. B.; Johnson, C. A.; Kaaret, P.; Kargaltsev, O.; Kertzman, M.; Khassen, Y.; Kieda, D.; Krennrich, F.; Lang, M. J.; Madhavan, A. S.; Maier, G.; McArthur, S.; McCann, A.; Millis, J.; Moriarty, P.; Mukherjee, R.; Nieto, D.; O'Faoláin de Bhróithe, A.; Ong, R. A.; Otte, A. N.; Pandel, D.; Park, N.; Pohl, M.; Popkow, A.; Prokoph, H.; Quinn, J.; Ragan, K.; Rajotte, J.; Reyes, L. C.; Reynolds, P. T.; Richards, G. T.; Roache, E.; Roberts, M.; Sembroski, G. H.; Shahinyan, K.; Smith, A. W.; Staszak, D.; Telezhinsky, I.; Tucci, J. V.; Tyler, J.; Vincent, S.; Wakely, S. P.; Weinstein, A.; Welsing, R.; Wilhelm, A.; Williams, D. A.; Zitzer, B.

    2014-06-01

    We present very high energy (VHE) imaging of MGRO J2019+37 obtained with the VERITAS observatory. The bright extended (~2°) unidentified Milagro source is located toward the rich star formation region Cygnus-X. MGRO J2019+37 is resolved into two VERITAS sources. The faint, point-like source VER J2016+371 overlaps CTB 87, a filled-center remnant (SNR) with no evidence of a supernova remnant shell at the present time. Its spectrum is well fit in the 0.65-10 TeV energy range by a power-law model with photon index 2.3 ± 0.4. VER J2019+378 is a bright extended (~1°) source that likely accounts for the bulk of the Milagro emission and is notably coincident with PSR J2021+3651 and the star formation region Sh 2-104. Its spectrum in the range 1-30 TeV is well fit with a power-law model of photon index 1.75 ± 0.3, among the hardest values measured in the VHE band, comparable to that observed near Vela-X. We explore the unusual spectrum and morphology in the radio and X-ray bands to constrain possible emission mechanisms for this source.

  16. MPL mutation profile in JAK2 mutation-negative patients with myeloproliferative disorders.

    PubMed

    Ma, Wanlong; Zhang, Xi; Wang, Xiuqiang; Zhang, Zhong; Yeh, Chen-Hsiung; Uyeji, Jennifer; Albitar, Maher

    2011-03-01

    Mutations in the thrombopoietin receptor gene (myeloproliferative leukemia, MPL) have been reported in patients with JAK2 V617F-negative chronic myeloproliferative disorders (MPDs). We evaluated the prevalence of MPL mutations relative to JAK2 mutations in patients with suspected MPDs. A total of 2790 patient samples submitted for JAK2 mutation analysis were tested using real-time polymerase chain reaction and bidirectional sequencing of plasma RNA. JAK2 V617F-negative samples were tested for JAK2 exons 12 to 14 mutations, and those with negative results were then tested for mutations in MPL exons 10 and 11. Of the 2790 patients, 529 (18.96%) had V617F, 12 (0.43%) had small insertions or deletions in exon 12, and 7 (0.25%) had other JAK2 mutations in exons 12 to 14. Of the 2242 JAK2 mutation-negative patients, 68 (3.03%) had MPL mutations. W515L was the predominant MPL mutation (n=46; 68%), and 10 (15%) patients had other W515 variants. The remaining MPL mutations (n=12, 17%) were detected at other locations in exons 10 and 11 and included 3 insertion/deletion mutations. The S505N mutation, associated with familial MPD, was detected in 3 patients. Overall, for every 100 V617F mutations in patients with suspected MPDs, there were 12.9 MPL mutations, 2.3 JAK2 exon 12 mutations, and 1.3 JAK2 exons 13 to 14 mutations. These findings suggest that MPL mutation screening should be performed before JAK2 exons 12 to 14 testing in JAK2 V617F-negative patients with suspected MPDs.

  17. Brief Report:MECP2 Mutations in People without Rett Syndrome

    ERIC Educational Resources Information Center

    Suter, Bernhard; Treadwell-Deering, Diane; Zoghbi, Huda Y.; Glaze, Daniel G.; Neul, Jeffrey L.

    2014-01-01

    Mutations in "Methyl-CpG-Binding protein 2" ("MECP2") are commonly associated with the neurodevelopmental disorder Rett syndrome (RTT). However, some people with RTT do not have mutations in "MECP2," and interestingly there have been people identified with "MECP2" mutations that do not have the clinical…

  18. Cerebral metabolic abnormalities in A3243G mitochondrial DNA mutation carriers

    PubMed Central

    Weiduschat, Nora; Kaufmann, Petra; Mao, Xiangling; Engelstad, Kristin Marie; Hinton, Veronica; DiMauro, Salvatore; De Vivo, Darryl

    2014-01-01

    Objective: To establish cerebral metabolic features associated with the A3243G mitochondrial DNA mutation with proton magnetic resonance spectroscopic imaging (1H MRSI) and to assess their potential as prognostic biomarkers. Methods: In this prospective cohort study, we investigated 135 clinically heterogeneous A3243G mutation carriers and 30 healthy volunteers (HVs) with 1H MRSI. Mutation carriers included 45 patients with mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes (MELAS); 11 participants who would develop the MELAS syndrome during follow-up (converters); and 79 participants who would not develop the MELAS syndrome during follow-up (nonconverters). The groups were compared with respect to MRSI metabolic indices of 1) anaerobic energy metabolism (lactate), 2) neuronal integrity (N-acetyl-l-aspartate [NAA]), 3) mitochondrial function (NAA; lactate), 4) cell energetics (total creatine), and 5) membrane biosynthesis and turnover (total choline [tCho]). Results: Consistent with prior studies, the patients with MELAS had higher lactate (p < 0.001) and lower NAA levels (p = 0.01) than HVs. Unexpectedly, converters showed higher NAA (p = 0.042), tCho (p = 0.004), and total creatine (p = 0.002), in addition to higher lactate levels (p = 0.032), compared with HVs. Compared with nonconverters, converters had higher tCho (p = 0.015). Clinically, converters and nonconverters did not differ at baseline. Lactate and tCho levels were reliable biomarkers for predicting the risk of individual mutation carriers to develop the MELAS phenotype. Conclusions: 1H MRSI assessment of cerebral metabolism in A3243G mutation carriers shows promise in identifying disease biomarkers as well as individuals at risk of developing the MELAS phenotype. PMID:24477106

  19. A disease-associated mutation in the adhesion GPCR BAI2 (ADGRB2) increases receptor signaling activity.

    PubMed

    Purcell, Ryan H; Toro, Camilo; Gahl, William A; Hall, Randy A

    2017-12-01

    Mutations in G protein-coupled receptors (GPCRs) that increase constitutive signaling activity can cause human disease. A de novo C-terminal mutation (R1465W) in the adhesion GPCR BAI2 (also known as ADGRB2) was identified in a patient suffering from progressive spastic paraparesis and other neurological symptoms. In vitro studies revealed that this mutation strongly increases the constitutive signaling activity of an N-terminally cleaved form of BAI2, which represents the activated form of the receptor. Further studies dissecting the mechanism(s) underling this effect revealed that wild-type BAI2 primarily couples to Gα z , with the R1465W mutation conferring increased coupling to Gα i . The R1465W mutation also increases the total and surface expression of BAI2. The mutation has no effect on receptor binding to β-arrestins, but does perturb binding to the endocytic protein endophilin A1, identified here as a novel interacting partner for BAI2. These studies provide new insights into the signaling capabilities of the adhesion GPCR BAI2/ADGRB2 and shed light on how an apparent gain-of-function mutation to the receptor's C-terminus may lead to human disease. © 2017 Wiley Periodicals, Inc.

  20. Early-onset L-dopa-responsive parkinsonism with pyramidal signs due to ATP13A2, PLA2G6, FBXO7 and spatacsin mutations.

    PubMed

    Paisán-Ruiz, Coro; Guevara, Rocio; Federoff, Monica; Hanagasi, Hasmet; Sina, Fardaz; Elahi, Elahe; Schneider, Susanne A; Schwingenschuh, Petra; Bajaj, Nin; Emre, Murat; Singleton, Andrew B; Hardy, John; Bhatia, Kailash P; Brandner, Sebastian; Lees, Andrew J; Houlden, Henry

    2010-09-15

    Seven autosomal recessive genes associated with juvenile and young-onset Levodopa-responsive parkinsonism have been identified. Mutations in PRKN, DJ-1, and PINK1 are associated with a rather pure parkinsonian phenotype, and have a more benign course with sustained treatment response and absence of dementia. On the other hand, Kufor-Rakeb syndrome has additional signs, which distinguish it clearly from Parkinson's disease including supranuclear vertical gaze palsy, myoclonic jerks, pyramidal signs, and cognitive impairment. Neurodegeneration with brain iron accumulation type I (Hallervorden-Spatz syndrome) due to mutations in PANK2 gene may share similar features with Kufor-Rakeb syndrome. Mutations in three other genes, PLA2G6 (PARK14), FBXO7 (PARK15), and Spatacsin (SPG11) also produce clinical similar phenotypes in that they presented with rapidly progressive parkinsonism, initially responsive to Levodopa treatment but later, developed additional features including cognitive decline and loss of Levodopa responsiveness. Here, using homozygosity mapping and sequence analysis in families with complex parkinsonisms, we identified genetic defects in the ATP13A2 (1 family), PLA2G6 (1 family) FBXO7 (2 families), and SPG11 (1 family). The genetic heterogeneity was surprising given their initially common clinical features. On careful review, we found the FBXO7 cases to have a phenotype more similar to PRKN gene associated parkinsonism. The ATP13A2 and PLA2G6 cases were more seriously disabled with additional swallowing problems, dystonic features, severe in some, and usually pyramidal involvement including pyramidal weakness. These data suggest that these four genes account for many cases of Levodopa responsive parkinsonism with pyramidal signs cases formerly categorized clinically as pallido-pyramidal syndrome. © 2010 Movement Disorder Society.

  1. The Cardiomyopathy Mutation, R146G Troponin I, Stabilizes the Intermediate "C" State of Regulated Actin under High- and Low-Free Ca(2+) Conditions.

    PubMed

    Johnson, Dylan; Mathur, Mohit C; Kobayashi, Tomoyoshi; Chalovich, Joseph M

    2016-08-16

    The R146G mutation of troponin I (TnI) is associated with hypertrophic cardiomyopathy in humans. Earlier data pointed to stabilization of the intermediate, C state, of actin-tropomyosin-troponin by this mutant. Because cardiac disorders appear to be linked to changes in regulated actin distributions, we determined the extent to which the R146G TnI mutant alters the distribution of states at low and high Ca(2+) concentrations. We show, from measurements of the kcat for actin-activated ATPase activity at saturating Ca(2+) concentrations, that R146G TnI reduced the population of the active, M, state to 25% of the wild-type level. Together with acrylodan-tropomyosin fluorescence measurements of the B state, it appeared that the C state was populated at ∼91% of the total for the R146G TnI-containing actin filaments. The C state was also more heavily populated at low Ca(2+) concentrations. Acrylodan-tropomyosin fluorescence changes showed a large diminution in the inactive state value relative to the wild-type value without a comparable increase in the active state. Furthermore, the rate of binding of rigor S1 to pyrene-labeled actin filaments containing R146G TnI was faster than the rate of binding to wild-type filaments at low free Ca(2+) concentrations. These results indicate that the inhibitory region of TnI affects the B-C and M-C equilibria of actin-tropomyosin-troponin. The observation that a mutation in the inhibitory region affects the M-C equilibrium may point to a novel regulatory interaction.

  2. Cetuximab treatment for metastatic colorectal cancer with KRAS p.G13D mutations improves progression-free survival

    PubMed Central

    OSUMI, HIROKI; SHINOZAKI, EIJI; OSAKO, MASAHIKO; KAWAZOE, YOSHIMASA; OBA, MASARU; MISAKA, TAKAHARU; GOTO, TAKASHI; KAMO, HITOMI; SUENAGA, MITSUKUNI; KUMEKAWA, YOSUKE; OGURA, MARIKO; OZAKA, MASATO; MATSUSAKA, SATOSHI; CHIN, KEISHO; HATAKE, KIYOHIKO; MIZUNUMA, NOBUYUKI

    2015-01-01

    A number of previous studies have reported that 30–50% of patients with colorectal cancer (CRC) harbor Kirsten rat sarcoma viral oncogene homolog (KRAS) mutations, which is a major predictive biomarker of resistance to epidermal growth factor (EGFR)-targeted therapy. Treatment with an anti-EGFR inhibitor is recommended for patients with KRAS wild-type metastatic colorectal cancer (mCRC). A recent retrospective study of cetuximab reported that patients with KRAS p.G13D mutations had better outcomes compared with those with other mutations. The aim of this retrospective study was to assess the prevalence of KRAS p.G13D mutations and evaluate the effectiveness of cetuximab in mCRC patients with KRAS p.G13D or other KRAS mutations. We reviewed the clinical records of 98 mCRC patients with KRAS mutations who were treated between August, 2004 and January, 2011 in four hospitals located in Tokyo and Kyushu Island. We also investigated KRAS mutation subtypes and patient characteristics. In the patients who received cetuximab, univariate and multivariate analyses were performed to assess the effect of KRAS p.G13D mutations on progression-free survival (PFS) and overall survival (OS). Of the 98 patients, 23 (23.5%) had KRAS p.G13D-mutated tumors, whereas 75 (76.5%) had tumors harboring other mutations. Of the 31 patients who received cetuximab, 9 (29.0%) had KRAS p.G13D mutations and 22 (71.0%) had other mutations. There were no significant differences in age, gender, primary site, pathological type, history of chemotherapy, or the combined use of irinotecan between either of the patient subgroups. The univariate analysis revealed no significant difference in PFS or OS between the patients with KRAS p.G13D mutations and those with other mutations (median PFS, 4.5 vs. 2.8 months, respectively; P=0.65; and median OS, 15.3 vs. 8.9 months, respectively; P=0.51). However, the multivariate analysis revealed a trend toward better PFS among patients harboring p.G13D mutations (PFS

  3. Mutations in the HFE, TFR2, and SLC40A1 genes in patients with hemochromatosis.

    PubMed

    Del-Castillo-Rueda, Alejandro; Moreno-Carralero, María-Isabel; Cuadrado-Grande, Nuria; Alvarez-Sala-Walther, Luis-Antonio; Enríquez-de-Salamanca, Rafael; Méndez, Manuel; Morán-Jiménez, María-Josefa

    2012-10-15

    Hereditary hemochromatosis causes iron overload and is associated with a variety of genetic and phenotypic conditions. Early diagnosis is important so that effective treatment can be administered and the risk of tissue damage avoided. Most patients are homozygous for the c.845G>A (p.C282Y) mutation in the HFE gene; however, rare forms of genetic iron overload must be diagnosed using a specific genetic analysis. We studied the genotype of 5 patients who had hyperferritinemia and an iron overload phenotype, but not classic mutations in the HFE gene. Two patients were undergoing phlebotomy and had no iron overload, 1 with metabolic syndrome and no phlebotomy had mild iron overload, and 2 patients had severe iron overload despite phlebotomy. The patients' first-degree relatives also underwent the analysis. We found 5 not previously published mutations: c.-408_-406delCAA in HFE, c.1118G>A (p.G373D), c.1473G>A (p.E491E) and c.2085G>C (p.S695S) in TFR2; and c.-428_-427GG>TT in SLC40A1. Moreover, we found 3 previously published mutations: c.221C>T (p.R71X) in HFE; c.1127C>A (p.A376D) in TFR2; and c.539T>C (p.I180T) in SLC40A1. Four patients were double heterozygous or compound heterozygous for the mutations mentioned above, and the patient with metabolic syndrome was heterozygous for a mutation in the TFR2 gene. Our findings show that hereditary hemochromatosis is clinically and genetically heterogeneous and that acquired factors may modify or determine the phenotype. Copyright © 2012. Published by Elsevier B.V.

  4. A novel mutation MT-COIII m.9267G>C and MT-COI m.5913G>A mutation in mitochondrial genes in a Tunisian family with maternally inherited diabetes and deafness (MIDD) associated with sever nephropathy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tabebi, Mouna, E-mail: mouna.biologiste@yahoo.com; Mkaouar-Rebai, Emna; Mnif, Mouna

    Mitochondrial diabetes (MD) is a heterogeneous disorder characterized by a chronic hyperglycemia, maternal transmission and its association with a bilateral hearing impairment. Several studies reported mutations in mitochondrial genes as potentially pathogenic for diabetes, since mitochondrial oxidative phosphorylation plays an important role in glucose-stimulated insulin secretion from beta cells. In the present report, we studied a Tunisian family with mitochondrial diabetes (MD) and deafness associated with nephropathy. The mutational analysis screening revealed the presence of a novel heteroplasmic mutation m.9276G>C in the mitochondrial COIII gene, detected in mtDNA extracted from leukocytes of a mother and her two daughters indicating thatmore » this mutation is maternally transmitted and suggest its implication in the observed phenotype. Bioinformatic tools showed that m.9267G>C mutation (p.A21P) is « deleterious » and it can modify the function and the stability of the MT-COIII protein by affecting the assembly of mitochondrial COX subunits and the translocation of protons then reducing the activity of the respective OXPHOS complexes of ATP synthesis. The nonsynonymous mutation (p.A21P) has not been reported before, it is the first mutation described in the COXIII gene which is related to insulin dependent mitochondrial diabetes and deafness and could be specific to the Tunisian population. The m.9267G>C mutation was present with a nonsynonymous inherited mitochondrial homoplasmic variation MT-COI m.5913 G>A (D4N) responsible of high blood pressure, a clinical feature detected in all explored patients. - Highlights: • MT-COX3 m.9267G>C (p.A21P), heteroplasmic substitution, is not reported in any database. • m.9267G>C can be responsible of the MIDD associated with nephropaty. • This substitution can modify the function and the stability of the MT-CO3 protein. • This substitution can modify MT-CO3 structure (2D and 3D). • MT-COX3 m.9267G>C is

  5. Novel MSH2 splice-site mutation in a young patient with Lynch syndrome

    PubMed Central

    Liccardo, Raffaella; De Rosa, Marina; Izzo, Paola; Duraturo, Francesca

    2018-01-01

    Lynch Syndrome (LS) is associated with germline mutations in one of the mismatch repair (MMR) genes, including MutL homolog 1 (MLH1), MutS homolog 2 (MSH2), MSH6, PMS1 homolog 2, mismatch repair system component (PMS2), MLH3 and MSH3. The mutations identified in MMR genes are point mutations or large rearrangements. The point mutations are certainly pathogenetic whether they determine formation of truncated protein. The mutations that arise in splice sites are classified as ‘likely pathogenic’ variants. In the present study, a novel splicing mutation was identified, (named c.212-1g>a), in the MSH2 gene. This novel mutation in the consensus splice site of MSH2 exon 2 leads to the loss of the canonical splice site, without skipping in-frame of exon 2; also with the formation of 2 aberrant transcripts, due to the activation of novel splice sites in exon 2. This mutation was identified in a young patient who developed colon cancer at the age of 26 years and their belongs to family that met the ‘Revised Amsterdam Criteria’. The present study provided insight into the molecular mechanism determining the pathogenicity of this novel MSH2 mutation and it reaffirms the importance of genetic testing in LS. PMID:29568967

  6. 48 CFR 2019.705-4 - Reviewing the subcontracting plan.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... COMMISSION SOCIOECONOMIC PROGRAMS SMALL BUSINESS PROGRAMS Subcontracting With Small Business, Small Disadvantaged Business, and Women-Owned Small Business Concerns 2019.705-4 Reviewing the subcontracting plan...

  7. Novel autosomal recessive gene mutations in aquaporin-2 in two Chinese congenital nephrogenic diabetes insipidus pedigrees

    PubMed Central

    Cen, Jing; Nie, Min; Duan, Lian; Gu, Feng

    2015-01-01

    Recent evidence has linked novel mutations in the arginine vasopressin receptor 2 gene (AVPR2) and aquaporin-2 gene (AQP2) present in Southeast Asian populations to congenital nephrogenic diabetes insipidus (NDI). To investigate mutations in 2 distinct Chinese pedigrees with NDI patients, clinical data, laboratory findings, and genomic DNA sequences from peripheral blood leukocytes were analyzed in two 5.5- and 8-year-old boys (proband 1 and 2, respectively) and their first-degree relatives. Water intake, urinary volume, body weight and medication use were recorded. Mutations in coding regions and intron-exon borders of both AQP2 and AVPR2 gene were sequenced. Three mutations in AQP2 were detected, including previously reported heterozygous frameshift mutation (c.127_128delCA, p.Gln43Aspfs ×63) inherited from the mother, a novel frameshift mutation (c.501_502insC, p.Val168Argfs ×30, inherited from the father) in proband 1 and a novel missense mutation (c. 643G>A, p. G215S), inherited from both parents in proband 2. In family 2 both parents and one sister were heterozygous carriers of the novel missense mutation. Neither pedigree exhibited mutation in the AVPR2 gene. The patient with truncated AQP2 may present with much more severe NDI manifestations. Identification of these novel AQP2 gene mutations expands the AQP2 genotypic spectrum and may contribute to etiological diagnosis and genetic counseling. PMID:26064258

  8. HER2 activating mutations are targets for colorectal cancer treatment

    PubMed Central

    Kavuri, Shyam M.; Jain, Naveen; Galimi, Francesco; Cottino, Francesca; Leto, Simonetta M.; Migliardi, Giorgia; Searleman, Adam C.; Shen, Wei; Monsey, John; Trusolino, Livio; Jacobs, Samuel A.; Bertotti, Andrea; Bose, Ron

    2015-01-01

    The Cancer Genome Atlas project identified HER2 somatic mutations and gene amplification in 7% of colorectal cancer patients. Introduction of the HER2 mutations, S310F, L755S, V777L, V842I, and L866M, into colon epithelial cells increased signaling pathways and anchorage-independent cell growth, indicating that they are activating mutations. Introduction of these HER2 activating mutations into colorectal cancer cell lines produced resistance to cetuximab and panitumumab by sustaining MAPK phosphorylation. HER2 mutations are potently inhibited by low nanomolar doses of the irreversible tyrosine kinase inhibitors, neratinib and afatinib. HER2 gene sequencing of 48 cetuximab resistant, quadruple (KRAS, NRAS, BRAF, and PIK3CA) WT colorectal cancer patient-derived xenografts (PDX’s) identified 4 PDX’s with HER2 mutations. HER2 targeted therapies were tested on two PDX’s. Treatment with a single HER2 targeted drug (trastuzumab, neratinib, or lapatinib) delayed tumor growth, but dual HER2 targeted therapy with trastuzumab plus tyrosine kinase inhibitors produced regression of these HER2 mutated PDX’s. PMID:26243863

  9. Patient derived mutation W257G of PPP2R1A enhances cancer cell migration through SRC-JNK-c-Jun pathway

    PubMed Central

    Jeong, Ae Lee; Han, Sora; Lee, Sunyi; Su Park, Jeong; Lu, Yiling; Yu, Shuangxing; Li, Jane; Chun, Kyung-Hee; Mills, Gordon B.; Yang, Young

    2016-01-01

    Mutation of PPP2R1A has been observed at high frequency in endometrial serous carcinomas but at low frequency in ovarian clear cell carcinoma. However, the biological role of mutation of PPP2R1A in ovarian and endometrial cancer progression remains unclear. In this study, we found that PPP2R1A expression is elevated in high-grade primary tumor patients with papillary serous tumors of the ovary. To determine whether increased levels or mutation of PPP2R1A might contribute to cancer progression, the effects of overexpression or mutation of PPP2R1A on cell proliferation, migration, and PP2A phosphatase activity were investigated using ovarian and endometrial cancer cell lines. Among the mutations, PPP2R1A-W257G enhanced cell migration in vitro through activating SRC-JNK-c-Jun pathway. Overexpression of wild type (WT) PPP2R1A increased its binding ability with B56 regulatory subunits, whereas PPP2R1A-mutations lost the ability to bind to most B56 subunits except B56δ. Total PP2A activity and PPP2R1A-associated PP2Ac activity were significantly increased in cells overexpressing PPP2R1A-WT. In addition, overexpression of PPP2R1A-WT increased cell proliferation in vitro and tumor growth in vivo. PMID:27272709

  10. Molecular Dynamics Simulation of γS-WT and γS-G18V

    NASA Astrophysics Data System (ADS)

    Ozawa, Ai; Yamada, Hironao; Mori, Sakiko; Noguchi, Yoh; Miyakawa, Takeshi; Morikawa, Ryota; Takasu, Masako

    γS-crystallin maintains transparency of the crystalline lens and increases the refraction index of lens. γS-G18V is a mutant γS-crystallin in which 18th glycine is replaced by valine. This protein is related to childhood-onset cortical cataract. In this paper, we study the fluctuation of residues and dihedral angles, and investigate the difference between γS-WT and γS-G18V by using molecular dynamics simulation. In the result of RMSF, we found large difference around the mutation point. In addition, differences of dihedral angles of cysteins were found in this area.

  11. A novel mutation in the MITF may be digenic with GJB2 mutations in a large Chinese family of Waardenburg syndrome type II.

    PubMed

    Yan, Xukun; Zhang, Tianyu; Wang, Zhengmin; Jiang, Yi; Chen, Yan; Wang, Hongyan; Ma, Duan; Wang, Lei; Li, Huawei

    2011-12-20

    Waardenburg syndrome type II (WS2) is associated with syndromic deafness. A subset of WS2, WS2A, accounting for approximately 15% of patients, is attributed to mutations in the microphthalmia-associated transcription factor (MITF) gene. We examined the genetic basis of WS2 in a large Chinese family. All 9 exons of the MITF gene, the single coding exon (exon 2) of the most common hereditary deafness gene GJB2 and the mitochondrial DNA (mtDNA) 12S rRNA were sequenced. A novel heterozygous mutation c.[742_743delAAinsT;746_747delCA] in exon 8 of the MITF gene co-segregates with WS2 in the family. The MITF mutation results in a premature termination codon and a truncated MITF protein with only 247 of the 419 wild type amino acids. The deaf proband had this MITF gene heterozygous mutation as well as a c.[109G>A]+[235delC] compound heterozygous pathogenic mutation in the GJB2 gene. No pathogenic mutation was found in mtDNA 12S rRNA in this family. Thus, a novel compound heterozygous mutation, c.[742_743delAAinsT;746_747delCA] in MITF exon 8 was the key genetic reason for WS2 in this family, and a digenic effect of MITF and GJB2 genes may contribute to deafness of the proband. Copyright © 2011. Published by Elsevier Ltd.

  12. Rapid detection of common Chinese glucose-6-phosphate dehydrogenase (G6PD) mutations by denaturing gradient gel electrophoresis (DGGE).

    PubMed

    Lam, V M; Huang, W; Lam, S T; Yeung, C Y; Johnson, P H

    1996-03-01

    We describe here the use of denaturing gradient gel electrophoresis (DGGE) to detect the most common Chinese glucose-6-phosphate dehydrogenase (G6PD) variants, which are the single point mutations: G-->T at nt 1376, G-->A at 1388 both in exon 12 and A-->G at nt 95 in exon 02. In each case, the mutant allele resolves well from the normal allele(s). The distinct heteroduplex bands are characteristic of a particular genotype suggesting that this feature is very useful for identifying all heterozygous carriers for this and other X-linked diseases. When the analysis is extended to other exons, DGGE scans the gene and coupled with direct sequencing, it leads to the identification of new G6PD variation(s). With this approach, we identified a mutation in exon 9 which had not been reported in Hong Kong. Since DGGE can rapidly screen many unknown samples in one gel, this approach could be used to diagnose these G6PD mutations and to identify the at-risk for counselling.

  13. Association of folate intake, dietary habits, smoking and COX-2 promotor -765G>C polymorphism with K-ras mutation in patients with colorectal cancer.

    PubMed

    Kamal, Manal M; Youssef, Omar Z; Lotfy, Ahmed N; Elsaed, Eman T; Fawzy, May M T

    2012-09-01

    Understanding the role of environmental and molecular influences on the nature and rate of K-ras mutations in colorectal neoplasms is crucial. COX-2 polymorphisms -765G>C may play a role in carcinogenic processes in combination with specific life-style conditions or dependent on the racial composition of a particular population. If mutational events play an important role in colorectal carcinogenesis sequence, one can hypothesize that modification of these events by life-style or other factors would be a useful prevention strategy. To explore the association between K-ras mutation and potential variables known or suspected to be related to the risk of colorectal cancer (CRC) as well as determining the possible modulating effect of the COX-2 polymorphism, -765G>C. The study was conducted on 80 patients with colorectal cancer from Tropical Medicine and Gastrointestinal Tract endoscopy Departments and those attending clinic of the National Cancer Institute, Cairo University during the period extending from April 2009 to March 2010. Full history taking with emphasis on the risk factors of interest, namely age, sex, family history, smoking and dietary history. Serum CEA and CA19-9, RBCs folic acid and occult blood in stool were done to all samples. K-ras protooncogene mutation at codon 12 (exon 1) and cyclooxygenase 2 (COX-2) -765G>C polymorphism were determined by PCR-RFLP. The K-ras mutation was positive in 23 (28.7%) patients. COX-2 polymorphism revealed GG in 62.5%, GC in 26.2 % and CC genotype was found in 11.3 % of cases. The mean red blood cell folic acid level was lower in the K-ras positive group (100.96±51.3 ng/ml) than the negative group (216.6±166.4 ng/ml), (P<0.01). Higher folate levels were found in males than females (median=173 ng/ml and 85 ng/ml; respectively, P=0.002) with adjusted odds ratio (OR) of 0.984. Only, the RBCs folate (P=0.0018) followed by gender (P=0.036) contributed significantly in the discrimination between patients prone to develop K

  14. High prevalence of factor V Leiden and prothrombin G20101A mutations in Kashmiri patients with venous thromboembolism.

    PubMed

    Shafia, Syed; Zargar, Mahrukh H; Khan, Nabeela; Ahmad, Rehana; Shah, Zafar Amin; Asimi, Ravouf

    2018-05-15

    The genetic variants of the factor V (G1691A), prothrombin (G20210A) and MTHFR (C677T) genes have been widely implicated as inherited risk factors for developing venous thrombosis. This study was undertaken to reveal the frequency of these mutations in Kashmiri patients with venous thromboembolism. A case-control study was designed with 250 VTE patients and 250 healthy controls. The mutations were analysed using ARMS-PCR and PCR-RFLP approach. The factor V Leiden G1691A mutation was found in 17/250 (6.8%) VTE patients and prothrombin G20210A mutation was found in 7/250 (2.8%) VTE patients while no mutation was found in any of the healthy controls. Both the mutations were found to be significantly associated with the increased risk of VTE (p = 0.0001 and 0.0150 respectively) while no association of VTE risk with MTHFR C677T polymorphism was found (p = 0.53). The increased frequency of factor V Leiden G1691A and prothrombin G20210A mutation in VTE patients indicates a significant role of these mutations in the development of VTE in our population. We therefore suggest the routine screening of these two mutations as thrombophilic markers in Kashmiri patients with venous thromboembolism. Copyright © 2018 Elsevier B.V. All rights reserved.

  15. C9orf72 hexanucleotide repeat expansion and Guam amyotrophic lateral sclerosis-Parkinsonism-dementia complex.

    PubMed

    Dombroski, Beth A; Galasko, Douglas R; Mata, Ignacio F; Zabetian, Cyrus P; Craig, Ulla-Katrina; Garruto, Ralph M; Oyanagi, Kiyomitsu; Schellenberg, Gerard D

    2013-06-01

    High-prevalence foci of amyotrophic lateral sclerosis (ALS) and parkinsonism-dementia complex (PDC) exist in Japanese on the Kii Peninsula of Japan and in the Chamorros of Guam. Clinical and neuropathologic similarities suggest that the disease in these 2 populations may be related. Recent findings showed that some of the Kii Peninsula ALS cases had pathogenic C9orf72 repeat expansions, a genotype that causes ALS in Western populations. To perform genotyping among Guam residents to determine if the C9orf72 expanded repeat allele contributes to ALS-PDC in this population and to evaluate LRRK2 for mutations in the same population. Case-control series from neurodegenerative disease research programs on Guam that screened residents for ALS, PDC, and dementia. Study participants included 24 with ALS and 22 with PDC and 43 older control subjects with normal cognition ascertained between 1956 and 2006. All but one participant were Chamorro, the indigenous people of Guam. A single individual of white race/ethnicity with ALS was ascertained on Guam during the study. Participants were screened for C9orf72 hexanucleotide repeat length. Participants with repeat numbers in great excess of 30 were considered to have pathogenic repeat expansions. LRRK2 was screened for point mutations by DNA sequencing. We found a single individual with an expanded pathogenic hexanucleotide repeat. This individual of white race/ethnicity with ALS was living on Guam at the time of ascertainment but had been born in the United States. All Chamorro participants with ALS and PDC and control subjects had normal repeats, ranging from 2 to 17 copies. No pathogenic LRRK2 mutations were found. Unlike participants with ALS from the Kii Peninsula, C9orf72 expansions do not cause ALS-PDC in Chamorros. Likewise, LRRK2 mutations do not cause Guam ALS-PDC.

  16. Proximity to AGCT sequences dictates MMR-independent versus MMR-dependent mechanisms for AID-induced mutation via UNG2

    PubMed Central

    Thientosapol, Eddy Sanchai; Sharbeen, George; Lau, K.K. Edwin; Bosnjak, Daniel; Durack, Timothy; Stevanovski, Igor; Weninger, Wolfgang

    2017-01-01

    Abstract AID deaminates C to U in either strand of Ig genes, exclusively producing C:G/G:C to T:A/A:T transition mutations if U is left unrepaired. Error-prone processing by UNG2 or mismatch repair diversifies mutation, predominantly at C:G or A:T base pairs, respectively. Here, we show that transversions at C:G base pairs occur by two distinct processing pathways that are dictated by sequence context. Within and near AGCT mutation hotspots, transversion mutation at C:G was driven by UNG2 without requirement for mismatch repair. Deaminations in AGCT were refractive both to processing by UNG2 and to high-fidelity base excision repair (BER) downstream of UNG2, regardless of mismatch repair activity. We propose that AGCT sequences resist faithful BER because they bind BER-inhibitory protein(s) and/or because hemi-deaminated AGCT motifs innately form a BER-resistant DNA structure. Distal to AGCT sequences, transversions at G were largely co-dependent on UNG2 and mismatch repair. We propose that AGCT-distal transversions are produced when apyrimidinic sites are exposed in mismatch excision patches, because completion of mismatch repair would require bypass of these sites. PMID:28039326

  17. The L‐type Ca2+ channel facilitates abnormal metabolic activity in the cTnI‐G203S mouse model of hypertrophic cardiomyopathy

    PubMed Central

    Viola, Helena; Johnstone, Victoria; Cserne Szappanos, Henrietta; Richman, Tara; Tsoutsman, Tatiana; Filipovska, Aleksandra; Semsarian, Christopher

    2016-01-01

    Key points Genetic mutations in cardiac troponin I (cTnI) are associated with development of hypertrophic cardiomyopathy characterized by myocyte remodelling, disorganization of cytoskeletal proteins and altered energy metabolism.The L‐type Ca2+ channel is the main route for calcium influx and is crucial to cardiac excitation and contraction. The channel also regulates mitochondrial function in the heart by a functional communication between the channel and mitochondria via the cytoskeletal network.We find that L‐type Ca2+ channel kinetics are altered in cTnI‐G203S cardiac myocytes and that activation of the channel causes a significantly greater increase in mitochondrial membrane potential and metabolic activity in cTnI‐G203S cardiac myocytes.These responses occur as a result of impaired communication between the L‐type Ca2+ channel and cytoskeletal protein F‐actin, involving decreased movement of actin–myosin and block of the mitochondrial voltage‐dependent anion channel, resulting in a ‘hypermetabolic’ mitochondrial state.We propose that L‐type Ca2+ channel antagonists, such as diltiazem, might be effective in reducing the cardiomyopathy by normalizing mitochondrial metabolic activity. Abstract Genetic mutations in cardiac troponin I (cTnI) account for 5% of families with hypertrophic cardiomyopathy. Hypertrophic cardiomyopathy is associated with disorganization of cytoskeletal proteins and altered energy metabolism. The L‐type Ca2+ channel (ICa‐L) plays an important role in regulating mitochondrial function. This involves a functional communication between the channel and mitochondria via the cytoskeletal network. We investigate the role of ICa‐L in regulating mitochondrial function in 25‐ to 30‐week‐old cardiomyopathic mice expressing the human disease‐causing mutation Gly203Ser in cTnI (cTnI‐G203S). The inactivation rate of ICa‐L is significantly faster in cTnI‐G203S myocytes [cTnI‐G203S: τ1 = 40.68 ± 3.22, n

  18. TFAP2B mutation and dental anomalies.

    PubMed

    Tanasubsinn, Natchaya; Sittiwangkul, Rekwan; Pongprot, Yupada; Kawasaki, Katsushige; Ohazama, Atsushi; Sastraruji, Thanapat; Kaewgahya, Massupa; Kantaputra, Piranit Nik

    2017-08-01

    Mutations inTFAP2B has been reported in patients with isolated patent ductus arteriosus (PDA) and Char syndrome. We performed mutation analysis of TFAP2B in 43 patients with isolated PDA, 7 patients with PDA with other congenital heart defects and 286 patients with isolated tooth agenesis with or without other dental anomalies. The heterozygous c.1006G>A mutation was identified in 20 individuals. Those mutation carriers consisted of 1 patient with term PDA (1/43), 16 patients with isolated tooth agenesis with or without other dental anomalies (16/286; 5.6%), 1 patient with PDA and severe valvular aortic stenosis and tooth agenesis (1/4) and 2 normal controls (2/100; 1%). The mutation is predicted to cause an amino-acid substitution p.Val336Ile in the TFAP2B protein. Tfap2b expression during early mouse tooth development supports the association of TFAP2B mutation and dental anomalies. It is hypothesized that this incidence might have been the result of founder effect. Here we report for the first time that TFAP2B mutation is associated with tooth agenesis, microdontia, supernumerary tooth and root maldevelopment. In addition, we also found that TFAP2B mutations, the common causes of PDA in Caucasian, are not the common cause of PDA in Thai population.

  19. Leucine-Rich Repeat Kinase 2 Controls the Ca2+/Nuclear Factor of Activated T Cells/IL-2 Pathway during Aspergillus Non-Canonical Autophagy in Dendritic Cells.

    PubMed

    Wong, Alicia Yoke Wei; Oikonomou, Vasilis; Paolicelli, Giuseppe; De Luca, Antonella; Pariano, Marilena; Fric, Jan; Tay, Hock Soon; Ricciardi-Castagnoli, Paola; Zelante, Teresa

    2018-01-01

    The Parkinson's disease-associated protein, Leucine-rich repeat kinase 2 (LRRK2), a known negative regulator of nuclear factor of activated T cells (NFAT), is expressed in myeloid cells such as macrophages and dendritic cells (DCs) and is involved in the host immune response against pathogens. Since, the Ca 2+ /NFAT/IL-2 axis has been previously found to regulate DC response to the fungus Aspergillus , we have investigated the role played by the kinase LRRK2 during fungal infection. Mechanistically, we found that in the early stages of the non-canonical autophagic response of DCs to the germinated spores of Aspergillus , LRRK2 undergoes progressive degradation and regulates NFAT translocation from the cytoplasm to the nucleus. Our results shed new light on the complexity of the Ca 2+ /NFAT/IL-2 pathway, where LRRK2 plays a role in controlling the immune response of DCs to Aspergillus .

  20. [Identification of an ideal noninvasive method to detect A3243G gene mutation in MELAS syndrome].

    PubMed

    Ma, Yi-nan; Fang, Fang; Yang, Yan-ling; Zhang, Ying; Wang, Song-tao; Xu, Yu-feng; Pei, Pei; Yuan, Yun; Bu, Ding-fang; Qi, Yu

    2008-12-16

    To identify a better non-invasive method to detect the carrier of mitochondrial A3243G mutation, a cause of mitochondrial encephalopathy-lactic acidosis-stroke like episode (MELAS) syndrome. DNA was extracted from the peripheral blood, urine, hair follicle, and saliva of 25 MELAS syndrome patients carrying A3243G mutation and their mothers and other maternal relatives, 33 persons in number, and the muscle tissues from 5 patients obtained by biopsy. A3243G mutation was detected by PCR-RFLP method, and the A3243G mutation ratio was identified by measuring the density of each band and calculation with the software AlphaEase 5.0. A3243G mutations were detected in all tissues of the 25 MELAS patients. The A3243G mutation ratio in urine was 62% +/- 9%, significantly higher than that in the blood [(36% +/- 10%), t = -11.13, P < 0.01]. A3243G mutations were detected in at least one tissue of the 28 maternal relatives. The A3243G mutation rates in their urine samples was 33.0% (5.0% - 70.4%), significantly higher than that in their blood samples [8.0% (0 - 33.3%), z = -4.197, P < 0.01]. There was no significant difference in A3243G mutation ratio among the samples of hair follicle, saliva, and blood. The A3243G mutation ratio in urine is significantly higher than those in blood samples of the patients and their maternal relatives. A noninvasive method, A3243G mutation ratio analysis of urine is superior to that in blood.

  1. Leucine-rich repeat kinase 2 inhibitors: a patent review (2014-2016).

    PubMed

    Galatsis, Paul

    2017-06-01

    Leucine-rich repeat kinase 2 (LRRK2) is a member of the Tyrosine Kinase-Like (TKL) branch of the kinome tree and is a multi-domain protein that includes GTPase and kinase activity. While genome-wide association studies (GWAS) has linked LRRK2 with Crohn's disease and leprosy, it has received the greatest attention due to it being implicated as one of the genetic loci associated with autosomal dominant inheritance in Parkinson's disease (PD). Areas covered: In this review, the small molecule patent literature from 2014-2016 with a focus on composition of matter and use patents was surveyed. Scifinder was primarily searched using 'LRRK2' as the query to identify all relevant literature and then triaged for small molecule patents. Expert opinion: The patent landscape around LRRK2 continues to develop. The early patents covered using existing kinase inhibitors for use against LRRK2. This evolved to compounds specifically designed for selectivity against LRRK2, but key exemplified compounds lacked sufficient brain exposure to affect sufficient efficacy. More recent compounds have addressed this deficiency and show greater potential for treating PD. While potency will be necessary to generate medicines with low human daily doses, brain penetration and safety will be the key differentiators for ultimately determining the most effective LRRK2 disease-modifying treatment for PD.

  2. Mutation Analysis of IDH1/2 Genes in Unselected De novo Acute Myeloid Leukaemia Patients in India - Identification of A Novel IDH2 Mutation.

    PubMed

    Raveendran, Sureshkumar; Sarojam, Santhi; Vijay, Sangeetha; Geetha, Aswathy Chandran; Sreedharan, Jayadevan; Narayanan, Geetha; Sreedharan, Hariharan

    2015-01-01

    IDH1/2 mutations which result in alternation in DNA methylation pattern are one of the most common methylation associated mutations in Acute myeloid leukaemia. IDH1/2 mutations frequently associated with higher platelet level, normal cytogentics and NPM1 mutations. Here we analyzed IDH1/2 mutations in 200 newly diagnosed unselected Indian adult AML patients and investigated their correlation with clinical, cytogenetic parameters along with cooperating NPM1 mutation. We detected 5.5% and 4% mutations in IDH1/2 genes, respectively. Except IDH2 c.515_516GG>AA mutation, all the other identified mutations were reported mutations. Similar to reported c.515G>A mutation, the novel c.515_516GG>AA mutation replaces 172nd arginine to lysine in the active site of the enzyme. Even though there was a preponderance of IDH1/2 mutations in NK-AML, cytogenetically abnormal patients also harboured IDH1/2 mutations. IDH1 mutations showed significant higher platelet count and NPM1 mutations. IDH2 mutated patients displayed infrequent NPM1 mutations and lower WBC count. All the NPM1 mutations in the IDH1/2 mutated cases showed type A mutation. The present data suggest that IDH1/2 mutations are associated with normal cytogenetics and type A NPM1 mutations in adult Indian AML patients.

  3. Dramatic effect of single-base mutation on the conformational dynamics of human telomeric G-quadruplex

    PubMed Central

    Lee, Ja Yil; Kim, D. S.

    2009-01-01

    Guanine-rich DNA sequences can form G-quadruplexes. These four-stranded structures are known to form in several genomic regions and to influence certain biological activities. Sometimes, the instability of G-quadruplexes causes the abnormal biological processes. Mutation is a culprit for the destabilization of G-quadruplexes, but the details of mutated G-quadruplexes are poorly understood. In this article, we investigated the conformational dynamics of single-base mutated human telomeric G-quadruplexes in the presence of K+ with single-molecule FRET spectroscopy. We observed that the replacement of single guanine by thymine in a G-track induces various folded structures, i.e. structural polymorphism. Moreover, direct observation of their dynamics revealed that a single-base mutation causes fast unfolding of folded states under physiological conditions. Furthermore, we found that the degree of destabilization varies according to mutation positions. When the central guanine of a G-track is replaced, the G-quadruplexes unfold quickly at any K+ concentrations and temperature. Meanwhile, outer-quartet mutated G-quadruplexes have heterogeneous dynamics at intermediate K+ concentrations and longstanding folded states at high K+ concentrations. Several factors such as base-stacking interaction and K+ coordination are responsible for the different dynamics according to the mutation position. PMID:19359361

  4. Analysis of fluG mutations that affect light-dependent conidiation in Aspergillus nidulans.

    PubMed Central

    Yager, L N; Lee, H O; Nagle, D L; Zimmerman, J E

    1998-01-01

    Conidiation in Aspergillus nidulans is induced by exposure to red light but can also be induced by blue light in certain mutant strains. We have isolated a mutation in the fluG gene that abolishes responsiveness to red light but does not affect the response to blue light. It has been shown that the veA1 (velvet) mutation allows conidiation to occur in the absence of light. We have identified three other fluG mutations that suppress the veA1 phenotype; these double mutants do not conidiate in the dark. The mutations described here define two new phenotypic classes of fluG alleles that display abnormal responses to light. We have characterized these mutations with respect to their molecular identity and to their effect on fluG transcription. Although it has been shown that fluG is required for the synthesis of an extracellular factor that directs conidiation, we do not detect this factor under conditions that promote conidiation in the veA1 suppressors. Furthermore, extracellular rescue is not observed in fluG deletion strains containing the wild-type veA allele. We propose that a genetic interaction between fluG and veA influences the production of the extracellular signal and regulates the initiation of conidiation. PMID:9691036

  5. NR2E3 mutations in enhanced S-cone sensitivity syndrome (ESCS), Goldmann-Favre syndrome (GFS), clumped pigmentary retinal degeneration (CPRD), and retinitis pigmentosa (RP).

    PubMed

    Schorderet, Daniel F; Escher, Pascal

    2009-11-01

    NR2E3, also called photoreceptor-specific nuclear receptor (PNR), is a transcription factor of the nuclear hormone receptor superfamily whose expression is uniquely restricted to photoreceptors. There, its physiological activity is essential for proper rod and cone photoreceptor development and maintenance. Thirty-two different mutations in NR2E3 have been identified in either homozygous or compound heterozygous state in the recessively inherited enhanced S-cone sensitivity syndrome (ESCS), Goldmann-Favre syndrome (GFS), and clumped pigmentary retinal degeneration (CPRD). The clinical phenotype common to all these patients is night blindness, rudimental or absent rod function, and hyperfunction of the "blue" S-cones. A single p.G56R mutation is inherited in a dominant manner and causes retinitis pigmentosa (RP). We have established a new locus-specific database for NR2E3 (www.LOVD.nl/eye), containing all reported mutations, polymorphisms, and unclassified sequence variants, including novel ones. A high proportion of mutations are located in the evolutionarily-conserved DNA-binding domains (DBDs) and ligand-binding domains (LBDs) of NR2E3. Based on homology modeling of these NR2E3 domains, we propose a structural localization of mutated residues. The high variability of clinical phenotypes observed in patients affected by NR2E3-linked retinal degenerations may be caused by different disease mechanisms, including absence of DNA-binding, altered interactions with transcriptional coregulators, and differential activity of modifier genes.

  6. KRAS-G12C mutation is associated with poor outcome in surgically resected lung adenocarcinoma.

    PubMed

    Nadal, Ernest; Chen, Guoan; Prensner, John R; Shiratsuchi, Hiroe; Sam, Christine; Zhao, Lili; Kalemkerian, Gregory P; Brenner, Dean; Lin, Jules; Reddy, Rishindra M; Chang, Andrew C; Capellà, Gabriel; Cardenal, Felipe; Beer, David G; Ramnath, Nithya

    2014-10-01

    The aim of this study was to examine the effects of KRAS mutant subtypes on the outcome of patients with resected lung adenocarcinoma (AC). Using clinical and sequencing data, we identified 179 patients with resected lung AC for whom KRAS mutational status was determined. A multivariate Cox model was used to identify factors associated with disease-free survival (DFS) and overall survival (OS). Publicly available mutation and gene-expression data from lung cancer cell lines and lung AC were used to assess whether distinct KRAS mutant variants have a different profile. Patients with KRAS mutation had a significantly shorter DFS compared with those with KRAS wild-type (p = 0.009). Patients with KRAS-G12C mutant tumors had significantly shorter DFS compared with other KRAS mutants and KRAS wild-type tumors (p < 0.001). In the multivariate Cox model, KRAS-G12C remained as an independent prognostic marker for DFS (Hazard ratio = 2.46, 95% confidence interval 1.51-4.00, p < 0.001) and for OS (Hazard ratio = 2.35, 95% confidence interval 1.35-4.10, p = 0.003). No genes were statistically significant when comparing the mutational or transcriptional profile of lung cancer cell lines and lung AC harboring KRAS-G12C with other KRAS mutant subtypes. Gene set enrichment analysis revealed that KRAS-G12C mutants overexpressed epithelial to mesenchymal transition genes and expressed lower levels of genes predicting KRAS dependency. KRAS-G12C mutation is associated with worse DFS and OS in resected lung AC. Gene-expression profiles in lung cancer cell lines and surgically resected lung AC revealed that KRAS-G12C mutants had an epithelial to mesenchymal transition and a KRAS-independent phenotype.

  7. HBV core promoter mutations promote cellular proliferation through E2F1-mediated upregulation of S-phase kinase-associated protein 2 transcription.

    PubMed

    Huang, Yuehua; Tai, Andrew W; Tong, Shuping; Lok, Anna S F

    2013-06-01

    Hepatitis B virus (HBV) core promoter (CP) mutations have been associated with an increased risk of hepatocellular carcinoma (HCC) in clinical studies. We previously reported that a combination of CP mutations seen in HCC patients, expressed in HBx gene, increased SKP2 (S-phase kinase-associated protein 2) expression, thereby promoting cellular proliferation. Here, we investigate the possible mechanisms by which CP mutations upregulate SKP2. We used immunoblotting and ATPlite assay to validate the effect of CP mutations in full-length HBV genome on cell cycle regulator levels and cell proliferation. Activation of SKP2 mRNA was assessed by quantitative real-time PCR in primary human hepatocytes (PHH) and HCC cell lines. Effect of CP mutations on SKP2 promoter activity was determined by luciferase assay. Target regulation of E2F1 on SKP2 was analyzed by siRNAs. CP mutations in full-length HBV genome upregulated SKP2 expression, thereby downregulating cell cycle inhibitors and accelerating cellular proliferation. CP mutations enhanced SKP2 promoter activity but had no effect on SKP2 protein stability. Mapping of the SKP2 promoter identified a region necessary for activation by CP mutations that contains an E2F1 response element. Knocking down E2F1 reduced the effects of CP mutations on SKP2 and cellular proliferation. The effect of CP mutations on E2F1 might be mediated through hyperphosphorylation of RB. HBV CP mutations enhance SKP2 transcription by activating the E2F1 transcription factor and in turn downregulate cell cycle inhibitors, thus providing a potential mechanism for an association between CP mutations and HCC. Copyright © 2013 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

  8. CHCHD10 mutations p.R15L and p.G66V cause motoneuron disease by haploinsufficiency.

    PubMed

    Brockmann, Sarah J; Freischmidt, Axel; Oeckl, Patrick; Müller, Kathrin; Ponna, Srinivas K; Helferich, Anika M; Paone, Christoph; Reinders, Jörg; Kojer, Kerstin; Orth, Michael; Jokela, Manu; Auranen, Mari; Udd, Bjarne; Hermann, Andreas; Danzer, Karin M; Lichtner, Peter; Walther, Paul; Ludolph, Albert C; Andersen, Peter M; Otto, Markus; Kursula, Petri; Just, Steffen; Weishaupt, Jochen H

    2018-02-15

    Mutations in the mitochondrially located protein CHCHD10 cause motoneuron disease by an unknown mechanism. In this study, we investigate the mutations p.R15L and p.G66V in comparison to wild-type CHCHD10 and the non-pathogenic variant p.P34S in vitro, in patient cells as well as in the vertebrate in vivo model zebrafish. We demonstrate a reduction of CHCHD10 protein levels in p.R15L and p.G66V mutant patient cells to approximately 50%. Quantitative real-time PCR revealed that expression of CHCHD10 p.R15L, but not of CHCHD10 p.G66V, is already abrogated at the mRNA level. Altered secondary structure and rapid protein degradation are observed with regard to the CHCHD10 p.G66V mutant. In contrast, no significant differences in expression, degradation rate or secondary structure of non-pathogenic CHCHD10 p.P34S are detected when compared with wild-type protein. Knockdown of CHCHD10 expression in zebrafish to about 50% causes motoneuron pathology, abnormal myofibrillar structure and motility deficits in vivo. Thus, our data show that the CHCHD10 mutations p.R15L and p.G66V cause motoneuron disease primarily based on haploinsufficiency of CHCHD10. © The Author(s) 2018. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  9. Update of the GJB2/DFNB1 mutation spectrum in Russia: a founder Ingush mutation del(GJB2-D13S175) is the most frequent among other large deletions

    PubMed Central

    Bliznetz, Elena A; Lalayants, Maria R; Markova, Tatiana G; Balanovsky, Oleg P; Balanovska, Elena V; Skhalyakho, Roza A; Pocheshkhova, Elvira A; Nikitina, Natalya V; Voronin, Sergey V; Kudryashova, Elena K; Glotov, Oleg S; Polyakov, Alexander V

    2017-01-01

    Although mutations in the GJB2 gene sequence make up the majority of variants causing autosomal-recessive non-syndromic hearing loss, few large deletions have been shown to contribute to DFNB1 deafness. Currently, genetic testing for DFNB1 hearing loss includes GJB2 sequencing and DFNB1 deletion analysis for two common large deletions, del(GJB6-D13S1830) and del(GJB6-D13S1854). Here, we report frequency in Russia, clinical significance and evolutionary origins of a 101 kb deletion, del(GJB2-D13S175), recently identified by us. In multiethnic cohort of 1104 unrelated hearing loss patients with biallelic mutations at the DFNB1 locus, the del(GJB2-D13S175) allele frequency of up to 0.5% (11/2208) was determined and this allele was shown to be predominantly associated with profound sensorineural hearing loss. Additionally, eight previously unpublished GJB2 mutations were described in this study. All patients carrying del(GJB2-D13S175) were of the Ingush ancestry. Among normal hearing individuals, del(GJB2-D13S175) was observed in Russian Republic of Ingushetia with a carrier rate of ~1% (2/241). Analysis of haplotypes associated with the deletion revealed a common founder in the Ingushes, with age of the deletion being ~3000 years old. Since del(GJB2-D13S175) was missed by standard methods of GJB2 analysis, del(GJB2-D13S175) detection has been added to our routine testing strategy for DFNB1 hearing loss. PMID:28405014

  10. A G542X cystic fibrosis mouse model for examining nonsense mutation directed therapies.

    PubMed

    McHugh, Daniel R; Steele, Miarasa S; Valerio, Dana M; Miron, Alexander; Mann, Rachel J; LePage, David F; Conlon, Ronald A; Cotton, Calvin U; Drumm, Mitchell L; Hodges, Craig A

    2018-01-01

    Nonsense mutations are present in 10% of patients with CF, produce a premature termination codon in CFTR mRNA causing early termination of translation, and lead to lack of CFTR function. There are no currently available animal models which contain a nonsense mutation in the endogenous Cftr locus that can be utilized to test nonsense mutation therapies. In this study, we create a CF mouse model carrying the G542X nonsense mutation in Cftr using CRISPR/Cas9 gene editing. The G542X mouse model has reduced Cftr mRNA levels, demonstrates absence of CFTR function, and displays characteristic manifestations of CF mice such as reduced growth and intestinal obstruction. Importantly, CFTR restoration is observed in G542X intestinal organoids treated with G418, an aminoglycoside with translational readthrough capabilities. The G542X mouse model provides an invaluable resource for the identification of potential therapies of CF nonsense mutations as well as the assessment of in vivo effectiveness of these potential therapies targeting nonsense mutations.

  11. Biallelic Mutations in PLA2G5, Encoding Group V Phospholipase A2, Cause Benign Fleck Retina

    PubMed Central

    Sergouniotis, Panagiotis I.; Davidson, Alice E.; Mackay, Donna S.; Lenassi, Eva; Li, Zheng; Robson, Anthony G.; Yang, Xu; Kam, Jaimie Hoh; Isaacs, Timothy W.; Holder, Graham E.; Jeffery, Glen; Beck, Jonathan A.; Moore, Anthony T.; Plagnol, Vincent; Webster, Andrew R.

    2011-01-01

    Flecked-retina syndromes, including fundus flavimaculatus, fundus albipunctatus, and benign fleck retina, comprise a group of disorders with widespread or limited distribution of yellow-white retinal lesions of various sizes and configurations. Three siblings who have benign fleck retina and were born to consanguineous parents are the basis of this report. A combination of homozygosity mapping and exome sequencing helped to identify a homozygous missense mutation, c.133G>T (p.Gly45Cys), in PLA2G5, a gene encoding a secreted phospholipase (group V phospholipase A2). A screen of a further four unrelated individuals with benign fleck retina detected biallelic variants in the same gene in three patients. In contrast, no loss of function or common (minor-allele frequency>0.05%) nonsynonymous PLA2G5 variants have been previously reported (EVS, dbSNP, 1000 Genomes Project) or were detected in an internal database of 224 exomes (from subjects with adult onset neurodegenerative disease and without a diagnosis of ophthalmic disease). All seven affected individuals had fundoscopic features compatible with those previously described in benign fleck retina and no visual or electrophysiological deficits. No medical history of major illness was reported. Levels of low-density lipoprotein were mildly elevated in two patients. Optical coherence tomography and fundus autofluorescence findings suggest that group V phospholipase A2 plays a role in the phagocytosis of photoreceptor outer-segment discs by the retinal pigment epithelium. Surprisingly, immunohistochemical staining of human retinal tissue revealed localization of the protein predominantly in the inner and outer plexiform layers. PMID:22137173

  12. [Analysis of the parental origin of MECP2 mutations in patients with Rett syndrome].

    PubMed

    Zhang, Jing-jing; Bao, Xin-hua; Cao, Guang-na; Jiang, Sheng-ling; Zhu, Xing-wang; Lu, Hong-mei; Jia, Li-fang; Pan, Hong; Wu, Xi-ru

    2010-04-01

    To identify the parental origin of methyl-CpG-binding protein 2 (MECP2) gene mutations in Chinese patients with Rett syndrome. Single nucleotide polymorphisms (SNPs) in intron 3 of the MECP2 gene were analyzed by PCR and sequencing in 115 patients with Rett syndrome. Then sequencing of the SNP region was performed for the fathers of the patients who had at least one SNP, to determine which allele was from the father. Then allele-specific PCR was performed and the products were sequenced to see whether the allele from father or mother harbored the mutation. Seventy-six of the 115 patients had at least one SNP. Three hot SNPs were found in these patients. They were: IVS3+22C >G, IVS3+266C >T and IVS3+683C>T. Among the 76 cases, 73 had a paternal origin of MECP2 mutations, and the other 3 had a maternal origin. There were multiple types of MECP2 mutation of the paternal origin, including 4 frame shift, 2 deletion and 67 point (56C >T, 6C >G, 2A >G, 2G >T and 1A >T) mutations. The mutation types of the 3 patients with maternal origin included 2 frame shift and 1 point (C >T) mutation. In Chinese RTT patients, the MECP2 mutations are mostly of paternal origin.

  13. High prevalence of exon 8 G533C mutation in apparently sporadic medullary thyroid carcinoma in Greece.

    PubMed

    Sarika, H L; Papathoma, A; Garofalaki, M; Vasileiou, V; Vlassopoulou, B; Anastasiou, E; Alevizaki, M

    2012-12-01

    Genetic screening for ret mutation has become routine practice in the evaluation of medullary thyroid carcinoma (MTC). Approximately 25% of these tumours are familial, and they occur as components of the multiple endocrine neoplasia type 2 syndromes (MEN 2A and 2B) or familial MTC. In familial cases, the majority of mutations are found in exons 10, 11, 13, 14 or 15 of the ret gene. A rare mutation involving exon 8 (G533C) has recently been reported in familial cases of MTC in Brazil and Greece; some of these cases were originally thought to be sporadic. The aim of this study was to re-evaluate a series of sporadic cases of MTC, with negative family history, and screen them for germline mutations in exon 8. Genomic DNA was extracted from peripheral lymphocytes in 129 unrelated individuals who had previously been characterized as 'sporadic' based on the negative family history and negative screening for ret gene mutations. Samples were analysed in Applied Biosystems 7500 real-time PCR and confirmed by sequencing. The G533C exon 8 mutation was identified in 10 of 129 patients with sporadic MTC. Asymptomatic gene carriers were subsequently identified in other family members. In our study, we found that 7·75% patients with apparently sporadic MTC do carry G533C mutation involving exon 8 of ret. We feel that there is now a need to include exon 8 mutation screening in all patients diagnosed as sporadic MTC, in Greece. © 2012 Blackwell Publishing Ltd.

  14. Novel mutations in MYO7A and USH2A in Usher syndrome.

    PubMed

    Maubaret, Cécilia; Griffoin, Jean-Michel; Arnaud, Bernard; Hamel, Christian

    2005-03-01

    Usher syndrome is an autosomal recessive disease associating retinitis pigmentosa and neurosensory deafness. Three clinical types (USH1, USH2, USH3) and 11 mutated genes or loci have been described. Mutations in MYO7A and USH2A are responsible for about 40% and 60% of Usher syndromes type 1 and 2, respectively. These genes were screened in a series of patients suffering from Usher syndrome. We performed SSCP screening of MYO7A in 12 unrelated patients suffering from Usher syndrome type 1 (USH1) and USH2A in 28 unrelated patients affected by Usher syndrome type 2 (USH2). Six mutations in MYO7A were found in five patients, including two novel mutations c.397C > G (His133Asp) and 1244-2A > G (Glu459Stop), accounting for 42% of our USH1 patients. Twelve mutations in USH2A were found in 11 patients, including four new mutations c.850delGA, c.1841-2A > G, c.3129insT, and c.3920C > G (Ser1307Stop), accounting for 39% of our USH2 patients

  15. A multiplex method for detection of glucose-6-phosphate dehydrogenase (G6PD) gene mutations.

    PubMed

    Zhang, L; Yang, Y; Liu, R; Li, Q; Yang, F; Ma, L; Liu, H; Chen, X; Yang, Z; Cui, L; He, Y

    2015-12-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common human enzyme defect caused by G6PD gene mutations. This study aimed to develop a cost-effective, multiplex, genotyping method for detecting common mutations in the G6PD gene. We used a SNaPshot approach to genotype multiple G6PD mutations that are common to human populations in South-East Asia. This assay is based on multiplex PCR coupled with primer extension reactions. Different G6PD gene mutations were determined by peak retention time and colors of the primer extension products. We designed PCR primers for multiplex amplification of the G6PD gene fragments and for primer extension reactions to genotype 11 G6PD mutations. DNA samples from a total of 120 unrelated G6PD-deficient individuals from the China-Myanmar border area were used to establish and validate this method. Direct sequencing of the PCR products demonstrated 100% concordance between the SNaPshot and the sequencing results. The SNaPshot method offers a specific and sensitive alternative for simultaneously interrogating multiple G6PD mutations. © 2015 John Wiley & Sons Ltd.

  16. A new SETX mutation producing AOA2 in two siblings.

    PubMed

    Datta, Neil; Hohler, Anna

    2013-09-01

    In this paper, we document two cases of a new SETX mutation (820:A>G) combined with an established recessive SETX mutation (5927:T>G) causing ataxia with oculomotor apraxia type 2 (AOA2). The patients had a detailed neurological history and examination performed. Radiological imaging was obtained and genetic analysis was obtained. Both siblings demonstrated healthy and normal growth until adolescence. At that time, slowed speech, hypophonia, dysarthria, extraocular muscle dysfunction and some mild choreiform movements began to appear. Family history included some movement disorder difficulties in second degree relatives. The diagnosis of AOA2 was confirmed by genetic testing. We describe a new SETX gene mutation, which when combined with a recognized SETX mutation results in AOA2. The clinical, radiographic and ancillary testing are described.

  17. Expression analysis revealing destabilizing mutations in phosphomannomutase 2 deficiency (PMM2-CDG): expression analysis of PMM2-CDG mutations.

    PubMed

    Vega, Ana Isabel; Pérez-Cerdá, Celia; Abia, David; Gámez, Alejandra; Briones, Paz; Artuch, Rafael; Desviat, Lourdes R; Ugarte, Magdalena; Pérez, Belén

    2011-08-01

    Deficiency of phosphomannomutase (PMM2, MIM#601785) is the most common congenital disorder of glycosylation. Herein we report the genetic analysis of 22 Spanish PMM2 deficient patients and the functional analysis of 14 nucleotide changes in a prokaryotic expression system in order to elucidate their molecular pathogenesis. PMM2 activity assay revealed the presence of six protein changes with no enzymatic activities (p.R123Q, p.R141H, p.F157S, p.P184T, p.F207S and p.D209G) and seven mild protein changes with residual activities ranging from 16 to 54% (p.L32R, p.V44A p.D65Y, p.P113L p.T118S, p.T237M and p.C241S) and also one variant change with normal activity (p.E197A). The results obtained from Western blot analysis, degradation time courses of 11 protein changes and structural analysis of the PMM2 protein, suggest that the loss-of-function of most mutant proteins is based on their increased susceptibility to degradation or aggregation compared to the wild type protein, considering PMM2 deficiency as a conformational disease. We have identified exclusively catalytic protein change (p.D209G), catalytic protein changes affecting protein stability (p.R123Q and p.R141H), two protein changes disrupting the dimer interface (p.P113L and p.T118S) and several misfolding changes (p.L32R, p.V44A, p.D65Y, p.F157S, p.P184T, p.F207S, p.T237M and p.C241S). Our current work opens a promising therapeutic option using pharmacological chaperones to revert the effect of the characterized misfolding mutations identified in a wide range of PMM2 deficient patients.

  18. Case report of a novel homozygous splice site mutation in PLA2G6 gene causing infantile neuroaxonal dystrophy in a Sudanese family.

    PubMed

    Elsayed, Liena E O; Mohammed, Inaam N; Hamed, Ahlam A A; Elseed, Maha A; Salih, Mustafa A M; Yahia, Ashraf; Siddig, Rayan A; Amin, Mutaz; Koko, Mahmoud; Elbashir, Mustafa I; Ibrahim, Muntaser E; Brice, Alexis; Ahmed, Ammar E; Stevanin, Giovanni

    2018-05-08

    Infantile neuroaxonal dystrophy (INAD) is a rare hereditary neurological disorder caused by mutations in PLA2G6. The disease commonly affects children below 3 years of age and presents with delay in motor skills, optic atrophy and progressive spastic tetraparesis. Studies of INAD in Africa are extremely rare, and genetic studies from Sub Saharan Africa are almost non-existent. Two Sudanese siblings presented, at ages 18 and 24 months, with regression in both motor milestones and speech development and hyper-reflexia. Brain MRI showed bilateral and symmetrical T2/FLAIR hyperintense signal changes in periventricular areas and basal ganglia and mild cerebellar atrophy. Whole exome sequencing with confirmatory Sanger sequencing were performed for the two patients and healthy family members. A novel variant (NM_003560.2 c.1427 + 2 T > C) acting on a splice donor site and predicted to lead to skipping of exon 10 was found in PLA2G6. It was found in a homozygous state in the two patients and homozygous reference or heterozygous in five healthy family members. This variant has one very strong (loss of function mutation) and three supporting evidences for its pathogenicity (segregation with the disease, multiple computational evidence and specific patients' phenotype). Therefore this variant can be currently annotated as "pathogenic". This is the first study to report mutations in PLA2G6 gene in patients from Sudan.

  19. Quantification of mutation-derived bias for alternate mating functionalities of the Saccharomyces cerevisiae Ste2p pheromone receptor.

    PubMed

    Choudhary, Pooja; Loewen, Michele C

    2016-01-01

    Although well documented for mammalian G-protein-coupled receptors, alternate functionalities and associated alternate signalling remain to be unequivocally established for the Saccharomyces cerevisiae pheromone Ste2p receptor. Here, evidence supporting alternate functionalities for Ste2p is re-evaluated, extended and quantified. In particular, strong mating and constitutive signalling mutations, focusing on residues S254, P258 and S259 in TM6 of Ste2p, are stacked and investigated in terms of their effects on classical G-protein-mediated signal transduction associated with cell cycle arrest, and alternatively, their impact on downstream mating projection and zygote formation events. In relative dose response experiments, accounting for systemic and observational bias, mutational-derived functional differences were observed, validating the S254L-derived bias for downstream mating responses and highlighting complex relationships between TM6-mutation derived constitutive signalling and ligand-induced functionalities. Mechanistically, localization studies suggest that alterations to receptor trafficking may contribute to mutational bias, in addition to expected receptor conformational stabilization effects. Overall, these results extend previous observations and quantify the contributions of Ste2p variants to mediating cell cycle arrest versus downstream mating functionalities. © Crown copyright 2015.

  20. Prevalence of ESR1 Mutations in Cell-Free DNA and Outcomes in Metastatic Breast Cancer: A Secondary Analysis of the BOLERO-2 Clinical Trial.

    PubMed

    Chandarlapaty, Sarat; Chen, David; He, Wei; Sung, Patricia; Samoila, Aliaksandra; You, Daoqi; Bhatt, Trusha; Patel, Parul; Voi, Maurizio; Gnant, Michael; Hortobagyi, Gabriel; Baselga, José; Moynahan, Mary Ellen

    2016-10-01

    Estrogen receptor α (ESR1) mutations found in metastatic breast cancer (MBC) promote ligand-independent receptor activation and resistance to estrogen-deprivation therapy in laboratory models. The prevalence of these mutations and their potential impact on clinical outcomes has not been established. To determine the prevalence of ESR1 mutations (Y537S and D538G) in estrogen receptor (ER)-positive MBC and determine whether mutation is associated with inferior outcomes. From December 16, 2014, to August 26, 2015, we analyzed cell-free DNA (cfDNA) from baseline plasma samples from participants in the BOLERO-2 double-blind phase 3 study that randomized patients from 189 centers in 24 countries with MBC to exemestane plus placebo or exemestane plus everolimus. The study enrolled postmenopausal women with a diagnosis of MBC and prior exposure to an aromatase inhibitor. Baseline plasma samples were available from 541 of 724 patients (74.7%). We assessed the effect of mutation on overall survival of the population and the effect of mutation on progression-free survival (PFS) by treatment arm. Patients were randomized to treatment with exemestane (25 mg oral daily) together with everolimus (10 mg oral daily) or with placebo. The 2 most frequent mutations in ESR1 (Y537S and D538G) were analyzed from cfDNA using droplet digital polymerase chain reaction and samples scored as wild-type, D538G, Y537S, or double mutant. Cox-proportional hazards model was used to assess PFS in patient subgroups defined by mutations, and the effect of each mutation on overall survival. Of 541 evaluable patients, 156 (28.8%) had ESR1 mutation D538G (21.1%) and/or Y537S (13.3%), and 30 had both. These mutations were associated with shorter overall survival (wild-type, 32.1 months [95% CI, 28.09-36.40 months]; D538G, 25.99 months [95% CI, 19.19-32.36 months]; Y537S, 19.98 months [13.01-29.31 months]; both mutations, 15.15 months [95% CI, 10.87-27.43 months]). The D538G group (hazard ratio, 0.34 [95

  1. Glioma-derived mutations in isocitrate dehydrogenase 2 beneficial to traditional chemotherapy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fu, Yuejun, E-mail: yjfu@sxu.edu.cn; Huang, Rui; Zheng, Yali

    2011-07-01

    Highlights: {yields} IDH1 and IDH2 mutations are not detected in the rat C6 glioma cell line model. {yields} IDH2 mutations are not required for the tumorigenesis of glioma. {yields} IDH2{sup R172G} can sensitize glioma sensitivity to chemotherapy through NADPH levels. {yields} IDH2{sup R172G} can give a benefit to traditional chemotherapy of glioma. {yields} This finding serves as an important complement to existing research on this topic. -- Abstract: Heterozygous mutations in either the R132 residue of isocitrate dehydrogenase I (IDH1) or the R172 residue of IDH2 in human gliomas were recently highlighted. In the present study, we report that mutationsmore » of IDH1 and IDH2 are not detected in the rat C6 glioma cell line model, which suggests that these mutations are not required for the development of glioblastoma induced by N,N'-nitroso-methylurea. The effects of IDH2 and IDH2{sup R172G} on C6 cells proliferation and sensitivity to chemotherapy and the possible mechanism are analyzed at the cellular level. IDH1 and IDH2 mutations lead to simultaneous loss and gain of activities in the production of {alpha}-ketoglutarate ({alpha}-KG) and 2-hydroxyglutarate (2HG), respectively, and result in lowering NADPH levels even further. The low NADPH levels can sensitize tumors to chemotherapy, and account for the prolonged survival of patients harboring the mutations. Our data extrapolate potential importance of the in vitro rat C6 glioma cell model, show that the IDH2{sup R172G} mutation in gliomas may give a benefit to traditional chemotherapy of this cancer and serve as an important complement to existing research on this topic.« less

  2. HPLC-ESI-MS/MS analysis of hemoglobin peptides in tryptic digests of dried-blood spot extracts detects HbS, HbC, HbD, HbE, HbO-Arab, and HbG-Philadelphia mutations.

    PubMed

    Haynes, Christopher A; Guerra, Stephanie L; Fontana, Jessalyn C; DeJesús, Víctor R

    2013-09-23

    Hemoglobinopathies are mutations resulting in abnormal globin chain structure; some have clinically significant outcomes such as anemia or reduced lifespan. Five β-globin mutations are (c.20A>T, p.E6V), (c.19G>A, p. E6K), (c.79G>A, p.E26K), (c.364G>C, p.E121Q), and (c.364G>A, p.E121K), resulting in HbS (sickle-cell hemoglobin), HbC, HbE, HbD-Los Angeles, and HbO-Arab, respectively. One α-globin mutation is (c.[207C>G or 207C>A], p.N68K), resulting in HbG-Philadelphia. HPLC-ESI-MS/MS analysis of dried-blood spot (DBS) punches from newborns extracted with a trypsin-containing solution provides greater than 90% coverage of α-, β-, and γ-globin amino acid sequences. Because the (c.20A>T, p.E6V), (c.19G>A, p. E6K), (c.79G>A, p.E26K), (c.364G>C, p.E121Q), (c.364G>A, p.E121K), and (c.[207C>G or 207C>A], p.N68K) mutations generate globin peptides with novel amino acid sequences, detecting one of these peptides in DBS extracts is indicative of the presence of a hemoglobinopathy in the newborn. The method described here can distinguish normal β-globin peptides from the mutant HbS, HbC, HbE, HbD-Los Angeles and HbO-Arab peptides, as well as normal α-globin peptide from the mutant HbG-Philadelphia peptide, allowing the identification of unaffected heterozygotes such as HbAS, and of compound heterozygotes such as HbASG-Philadelphia. This HPLC-ESI-MS/MS analytical approach provides information that is not available from traditional hemoglobin analyses such as isoelectric focusing and HPLC-UV. It is also capable of determining the amino acid sequence of hemoglobin peptides, potentially allowing the detection of numerous hemoglobinopathies resulting from point mutations. Published by Elsevier B.V.

  3. Insight into a novel p53 single point mutation (G389E) by Molecular Dynamics Simulations.

    PubMed

    Pirolli, Davide; Carelli Alinovi, Cristiana; Capoluongo, Ettore; Satta, Maria Antonia; Concolino, Paola; Giardina, Bruno; De Rosa, Maria Cristina

    2010-12-30

    The majority of inactivating mutations of p53 reside in the central core DNA binding domain of the protein. In this computational study, we investigated the structural effects of a novel p53 mutation (G389E), identified in a patient with congenital adrenal hyperplasia, which is located within the extreme C-terminal domain (CTD) of p53, an unstructured, flexible region (residues 367-393) of major importance for the regulation of the protein. Based on the three-dimensional structure of a carboxyl-terminal peptide of p53 in complex with the S100B protein, which is involved in regulation of the tumor suppressor activity, a model of wild type (WT) and mutant extreme CTD was developed by molecular modeling and molecular dynamics simulation. It was found that the G389E amino acid replacement has negligible effects on free p53 in solution whereas it significantly affects the interactions of p53 with the S100B protein. The results suggest that the observed mutation may interfere with p53 transcription activation and provide useful information for site-directed mutagenesis experiments.

  4. Snyder-Robinson Syndrome: Rescuing the Disease-Causing Effect of G56S mutant by Small Molecule Binding

    NASA Astrophysics Data System (ADS)

    Zhang, Zhe; Martiny, Virginie; Lagorce, David; Alexov, Emil; Miteva, Maria; Clemson University Team; Université Paris Diderot Team

    2013-03-01

    Snyder-Robinson Syndrome (SRS) is an X-linked mental retardation disorder, which is caused by defects in a particular gene coding for the spermine synthase (SMS) protein. Among the missense mutations known to be disease-causing is the G56S, which is positioned at the interface of the SMS homo-dimer. Previous computational and experimental investigations have shown that G56S mutation destabilizes the homo-dimer and thus greatly reduces the SMS enzymatic activity. In this study, we explore the possibility of mitigating the effect of G56S mutation by binding small molecules to suitable pockets around the mutation site. It is done by combined efforts of molecular dynamics simulations and in silico screening. The binding of selected molecules was calculated to fully compensate the effect of the mutation and rescue the wild type dimer affinity. This work was supported by NIH, NLM grant. No. 1R03LM009748

  5. MELAS syndrome, cardiomyopathy, rhabdomyolysis, and autism associated with the A3260G mitochondrial DNA mutation.

    PubMed

    Connolly, Barbara S; Feigenbaum, Annette S J; Robinson, Brian H; Dipchand, Anne I; Simon, David K; Tarnopolsky, Mark A

    2010-11-12

    The A to G transition mutation at position 3260 of the mitochondrial genome is usually associated with cardiomyopathy and myopathy. One Japanese kindred reported the phenotype of mitochondrial encephalomyopathy, lactic acidosis and stroke-like episodes (MELAS syndrome) in association with the A3260G mtDNA mutation. We describe the first Caucasian cases of MELAS syndrome associated with the A3260G mutation. Furthermore, this mutation was associated with exercise-induced rhabdomyolysis, hearing loss, seizures, cardiomyopathy, and autism in the large kindred. We conclude that the A3260G mtDNA mutation is associated with wide phenotypic heterogeneity with MELAS and other "classical" mitochondrial phenotypes being manifestations. Copyright © 2010 Elsevier Inc. All rights reserved.

  6. Rapid screening of rpoB and katG mutations in Mycobacterium tuberculosis isolates by high-resolution melting curve analysis.

    PubMed

    Haeili, M; Fooladi, A I; Bostanabad, S Z; Sarokhalil, D D; Siavoshi, F; Feizabadi, M M

    2014-01-01

    Early detection of multidrug-resistant tuberculosis (MDR-TB) is essential to prevent its transmission in the community and initiate effective anti-TB treatment regimen. High-resolution melting curve (HRM) analysis was evaluated for rapid detection of resistance conferring mutations in rpoB and katG genes. We screened 95 Mycobacterium tuberculosis clinical isolates including 20 rifampin resistant (RIF-R), 21 isoniazid resistant (INH-R) and 54 fully susceptible (S) isolates determined by proportion method of drug susceptibility testing. Nineteen M. tuberculosis isolates with known drug susceptibility genotypes were used as references for the assay validation. The nucleotide sequences of the target regions rpoB and katG genes were determined to investigate the frequency and type of mutations and to confirm HRM results. HRM analysis of a 129-bp fragment of rpoB allowed correct identification of 19 of the 20 phenotypically RIF-R and all RIF-S isolates. All INH-S isolates generated wild-type HRM curves and 18 out of 21 INH-R isolates harboured any mutation in 109-bp fragment of katG exhibited mutant type HRM curves. However, 1 RIF-R and 3 INH-R isolates were falsely identified as susceptible which were confirmed for having no mutation in their target regions by sequencing. The main mutations involved in RIF and INH resistance were found at codons rpoB531 (60% of RIF-R isolates) and katG315 (85.7% of INH-R isolates), respectively. HRM was found to be a reliable, rapid and low cost method to characterise drug susceptibility of clinical TB isolates in resource-limited settings.

  7. CHEK2 mutations and the risk of papillary thyroid cancer.

    PubMed

    Siołek, Monika; Cybulski, Cezary; Gąsior-Perczak, Danuta; Kowalik, Artur; Kozak-Klonowska, Beata; Kowalska, Aldona; Chłopek, Małgorzata; Kluźniak, Wojciech; Wokołorczyk, Dominika; Pałyga, Iwona; Walczyk, Agnieszka; Lizis-Kolus, Katarzyna; Sun, Ping; Lubiński, Jan; Narod, Steven A; Góźdż, Stanisław

    2015-08-01

    Mutations in the cell cycle checkpoint kinase 2 (CHEK2) tumor suppressor gene are associated with multi-organ cancer susceptibility including cancers of the breast and prostate. A genetic association between thyroid and breast cancer has been suggested, however little is known about the determinants of this association. To characterize the association of CHEK2 mutations with thyroid cancer, we genotyped 468 unselected patients with papillary thyroid cancer and 468 (matched) cancer-free controls for four founder mutations of CHEK2 (1100delC, IVS2 + 1G>A, del5395 and I157T). We compared the family histories reported by patients with a CHEK2 mutation to those of non-carriers. A CHEK2 mutation was seen in 73 of 468 (15.6%) unselected patients with papillary thyroid cancer, compared to 28 of 460 (6.0%) age- and sex-matched controls (OR 3.3; p < 0.0001). A truncating mutation (IVS2 + 1G>A, 1100delC or del5395) was associated with a higher risk of thyroid cancer (OR = 5.7; p = 0.006), than was the missense mutation I157T (OR = 2.8; p = 0.0001). CHEK2 mutation carriers reported a family history of breast cancer 2.2 times more commonly than non-carriers (16.4% vs.8.1%; p = 0.05). A CHEK2 mutation was found in seven of 11 women (63%) with multiple primary cancers of the breast and thyroid (OR = 10; p = 0.0004). These results suggest that CHEK2 mutations predispose to thyroid cancer, familial aggregations of breast and thyroid cancer and to double primary cancers of the breast and thyroid. © 2015 UICC.

  8. 49 CFR 193.2019 - Mobile and temporary LNG facilities.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... Section 193.2019 Transportation Other Regulations Relating to Transportation (Continued) PIPELINE AND HAZARDOUS MATERIALS SAFETY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION (CONTINUED) PIPELINE SAFETY... during gas pipeline systems repair/alteration, or for other short term applications need not meet the...

  9. Molecular dynamics simulations and principal component analysis on human laforin mutation W32G and W32G/K87A.

    PubMed

    Srikumar, P S; Rohini, K; Rajesh, Perumbilavil Kaithamanakallam

    2014-06-01

    Mutations in human laforin lead to an autosomal neurodegenerative disorder Lafora disease. In N-terminal carbohydrate binding domain of laforin, two mutations W32G and K87A are reported as highly disease causing laforin mutants. Experimental studies reported that mutations are responsible for the abolishment of glycogen binding which is a critical function of laforin. Our current computational study focused on the role of conformational changes in human laforin structure due to existing single mutation W32G and prepared double mutation W32G/K87A related to loss of glycogen binding. We performed 10 ns molecular dynamics (MD) simulation studies in the Gromacs package for both mutations and analyzed the trajectories. From the results, the global properties like root mean square deviation, root mean square fluctuation, radius of gyration, solvent accessible surface area and hydrogen bonds showed structural changes in atomic level observed in W32G and W32G/K87A laforin mutants. The conformational change induced by mutants influenced the loss of the overall stability of the native laforin. Moreover, the change in overall motion of protein was analyzed by principal component analysis and results showed protein clusters expanded more than native and also change in direction in case of double mutant in conformational space. Overall, our report provides theoretical information on loss of structure-function relationship due to flexible nature of laforin mutants. In conclusion, comparative MD simulation studies support the experimental data on W32G and W32G/K87A related to the lafora disease mechanism on glycogen binding.

  10. Disease-associated extracellular loop mutations in the adhesion G protein-coupled receptor G1 (ADGRG1; GPR56) differentially regulate downstream signaling.

    PubMed

    Kishore, Ayush; Hall, Randy A

    2017-06-09

    Mutations to the adhesion G protein-coupled receptor ADGRG1 (G1; also known as GPR56) underlie the neurological disorder bilateral frontoparietal polymicrogyria. Disease-associated mutations in G1 studied to date are believed to induce complete loss of receptor function through disruption of either receptor trafficking or signaling activity. Given that N-terminal truncation of G1 and other adhesion G protein-coupled receptors has been shown to significantly increase the receptors' constitutive signaling, we examined two different bilateral frontoparietal polymicrogyria-inducing extracellular loop mutations (R565W and L640R) in the context of both full-length and N-terminally truncated (ΔNT) G1. Interestingly, we found that these mutations reduced surface expression of full-length G1 but not G1-ΔNT in HEK-293 cells. Moreover, the mutations ablated receptor-mediated activation of serum response factor luciferase, a classic measure of Gα 12/13 -mediated signaling, but had no effect on G1-mediated signaling to nuclear factor of activated T cells (NFAT) luciferase. Given these differential signaling results, we sought to further elucidate the pathway by which G1 can activate NFAT luciferase. We found no evidence that ΔNT activation of NFAT is dependent on Gα q/11 -mediated or β-arrestin-mediated signaling but rather involves liberation of Gβγ subunits and activation of calcium channels. These findings reveal that disease-associated mutations to the extracellular loops of G1 differentially alter receptor trafficking, depending on the presence of the N terminus, and differentially alter signaling to distinct downstream pathways. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. Clinical, biochemical and morphologic diagnostic markers in an infant male pseudohermaphrodite patient with compound heterozygous mutations (G115D/R246W) in SRD5A2 gene.

    PubMed

    Fernández-Cancio, Mónica; Rodó, Joan; Andaluz, Pilar; Martínez de Osaba, María Jesús; Rodríguez-Hierro, Francisco; Esteban, Cristina; Carrascosa, Antonio; Audí, Laura

    2004-01-01

    A patient with male pseudohermaphroditism and clinical diagnosis of partial androgen insensitivity in the neonatal period was studied at pubertal age for a molecular diagnosis. Hormone studies were conducted at baseline and under hCG stimulation for testosterone and dihydrotestosterone determinations at 2 months of age. Gonadectomy was performed at 4 months. At the age of 13 years genital skin fibroblasts were studied for androgen binding and 5alpha-reductase activity and peripheral blood DNA was available for androgen receptor (AR) and 5alpha-reductase (SRD5A2) gene analysis. Exons 1-8 of AR gene and exons 1-5 of SRD5A2 gene were sequenced. AR gene coding sequences were normal. SRD5A2 gene analysis revealed two heterozygote mutations (G115D and R246W), with the mother carrying the G115D and the father the R246W mutations. The compound heterozygote mutations in SRD5A2 gene explained an extremely low 5alpha-reductase enzyme activity in genital skin fibroblasts. Revision of hormonal data from the neonatal period revealed an increased testosterone-to-dihydrotestosterone ratio at the end of an hCG stimulation test, which concurred with the molecular diagnosis. Testis morphology at 4 months of age was normal. Clinical and biochemical differential diagnosis between partial androgen insensitivity syndrome and 5alpha-reductase enzyme deficiency is difficult in the neonatal period and before puberty. Our results show that in our patient the testosterone-to-dihydrotestosterone ratio would have adequately orientated the diagnosis. The two mutations in SRD5A2 gene have been described in patients of different lineages, though not in combination to date. Testis morphology showed that, during early infancy, the 5alpha-reductase deficiency may not have affected interstitial or tubular development. Copyright (c) 2004 S. Karger AG, Basel.

  12. Misregulation effect of a novel allelic variant in the Z promoter region found in cis with the CYP21A2 p.P482S mutation: implications for 21-hydroxylase deficiency.

    PubMed

    Fernández, Cecilia S; Bruque, Carlos D; Taboas, Melisa; Buzzalino, Noemí D; Espeche, Lucia D; Pasqualini, Titania; Charreau, Eduardo H; Alba, Liliana G; Ghiringhelli, Pablo D; Dain, Liliana

    2015-09-01

    The aim of the current study was to search for the presence of genetic variants in the CYP21A2 Z promoter regulatory region in patients with congenital adrenal hyperplasia due to 21-hydroxylase deficiency. Screening of the 10 most frequent pseudogene-derived mutations was followed by direct sequencing of the entire coding sequence, the proximal promoter, and a distal regulatory region in DNA samples from patients with at least one non-determined allele. We report three non-classical patients that presented a novel genetic variant-g.15626A>G-within the Z promoter regulatory region. In all the patients, the novel variant was found in cis with the mild, less frequent, p.P482S mutation located in the exon 10 of the CYP21A2 gene. The putative pathogenic implication of the novel variant was assessed by in silico analyses and in vitro assays. Topological analyses showed differences in the curvature and bendability of the DNA region bearing the novel variant. By performing functional studies, a significantly decreased activity of a reporter gene placed downstream from the regulatory region was found by the G transition. Our results may suggest that the activity of an allele bearing the p.P482S mutation may be influenced by the misregulated CYP21A2 transcriptional activity exerted by the Z promoter A>G variation.

  13. A novel mutation in the TG gene (G2322S) causing congenital hypothyroidism in a Sudanese family: a case report.

    PubMed

    Watanabe, Y; Sharwood, E; Goodwin, B; Creech, M K; Hassan, H Y; Netea, M G; Jaeger, M; Dumitrescu, A; Refetoff, S; Huynh, T; Weiss, R E

    2018-05-02

    Congenital hypothyroidism (CH) has an incidence of approximately 1:3000, but only 15% have mutations in the thyroid hormone synthesis pathways. Genetic analysis allows for the precise diagnosis. A 3-week old girl presented with a large goiter, serum TSH > 100 mIU/L (reference range: 0.7-5.9 mIU/L); free T 4  < 3.2 pmol/L (reference range: 8.7-16 pmol/L); thyroglobulin (TG) 101 μg/L. Thyroid Tc-99 m scan showed increased radiotracer uptake. One brother had CH and both affected siblings have been clinically and biochemically euthyroid on levothyroxine replacement. Another sibling had normal thyroid function. Both Sudanese parents reported non-consanguinity. Peripheral blood DNA from the proposita was subjected to whole exome sequencing (WES). WES identified a novel homozygous missense mutation of the TG gene: c.7021G > A, p.Gly2322Ser, which was subsequently confirmed by Sanger sequencing and present in one allele of both parents. DNA samples from 354 alleles in four Sudanese ethnic groups (Nilotes, Darfurians, Nuba, and Halfawien) failed to demonstrate the presence of the mutant allele. Haplotyping showed a 1.71 centiMorgans stretch of homozygosity in the TG locus suggesting that this mutation occurred identical by descent and the possibility of common ancestry of the parents. The mutation is located in the cholinesterase-like (ChEL) domain of TG. A novel rare missense mutation in the TG gene was identified. The ChEL domain is critical for protein folding and patients with CH due to misfolded TG may present without low serum TG despite the TG gene mutations.

  14. Linezolid-resistant Staphylococcus haemolyticus and Staphylococcus hominis: single and double mutations at the domain V of 23S rRNA among isolates from a Rio de Janeiro hospital.

    PubMed

    Chamon, Raiane Cardoso; Iorio, Natalia Lopes Pontes; Cavalcante, Fernanda Sampaio; Teodoro, Cristiane R S; de Oliveira, Ana Paula Chaves; Maia, Fernanda; dos Santos, Kátia Regina Netto

    2014-12-01

    In this work, the molecular and phenotypic antimicrobial resistance and clonal diversity of 10 linezolid-resistant Staphylococcus spp. isolates were investigated. The 7 Staphylococcus haemolyticus isolates presented Staphylococcal cassete chromosome mec (SCCmec) V and belonged to the same pulsed-field gel electrophoresis pulsotype. Their MICs for oxacillin, vancomycin, and linezolid were ≥ 256 μg/mL, 1-4 μg/mL, and 8-16 μg/mL, respectively. The 3 S. hominis presented MIC values 32 to >256 μg/mL, 2-4 μg/mL, and 12-24 μg/mL, and all carried the nontypeable SCCmec (ccr1 + mecA class) and belonged to 2 different genotypes. The cfr gene was not found, but the mutation G2603T was detected in S. haemolyticus and C2190T and G2603T in Staphylococcus hominis in 23S rRNA. This study demonstrates the spread of a linezolid-resistant S. haemolyticus genotype and, for the first time, describes the mutation C2190T among S. hominis isolates with a double mutation in Brazil. Copyright © 2014 Elsevier Inc. All rights reserved.

  15. Base substitution mutations in uridinediphosphate-dependent glycosyltransferase 76G1 gene of Stevia rebaudiana causes the low levels of rebaudioside A: mutations in UGT76G1, a key gene of steviol glycosides synthesis.

    PubMed

    Yang, Yong-Heng; Huang, Su-Zhen; Han, Yu-Lin; Yuan, Hai-Yan; Gu, Chun-Sun; Zhao, Yan-Hai

    2014-07-01

    Steviol glycosides, extracted from the leaves of Stevia rebaudiana (Bert) Bertoni, are calorie-free sugar substitute of natural origin with intensely sweet (Boileau et al., 2012). Stevioside and rebaudioside A are the two main kinds of the diterpenic glycosides. We analyzed the concentration of stevioside and rebaudioside A in Stevia leaves of about 500 samples (hybrid progenies) and discovered a mutation plant "Z05" with very low levels of rebaudioside A. Because UGT76G1, a uridinediphosphate-dependent glycosyltransferases, is responsible for the conversion from stevioside to rebaudioside A (Richman et al., 2005), so mutation identification was done by sequencing the candidate gene, UGT76G1. In this study molecular analysis of two strains revealed a heterozygotic nonsense mutation of c.389T > G (p.L121X) in UGT76G1. Meanwhile, we found some amino acid substitutions significant change the protein structure. And the difference of enzyme activity between two strains proved the lack of functionality of UGT76G1 of the mutation "Z05". So the nonsense mutation and amino acid substitution mutation resulted in the low levels of rebaudioside A. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  16. Prevalence of GJB2 (connexin-26) and GJB6 (connexin-30) mutations in a cohort of 300 Brazilian hearing-impaired individuals: implications for diagnosis and genetic counseling.

    PubMed

    Batissoco, Ana Carla; Abreu-Silva, Ronaldo Serafim; Braga, Maria Cristina Célia; Lezirovitz, Karina; Della-Rosa, Valter; Alfredo, Tabith; Otto, Paulo Alberto; Mingroni-Netto, Regina Célia

    2009-02-01

    Hereditary nonsyndromic deafness is an autosomal recessive condition in about 80% of cases, and point mutations in the GJB2 gene (connexin 26) and two deletions in the GJB6 gene (connexin 30), del(GJB6-D13S1830) and del(GJB6-D13S1854), are reported to account for 50% of recessive deafness. Aiming at establishing the frequencies of GJB2 mutations and GJB6 deletions in the Brazilian population, we screened 300 unrelated individuals with hearing impairment, who were not affected by known deafness related syndromes. We firstly screened the most frequently reported mutations, c.35delG and c.167delT in the GJB2 gene, and del(GJB6-D13S1830) and del(GJB6-D13S1854) in the GJB6 gene, through specific techniques. The detected c.35delG and c.167delT mutations were validated by sequencing. Other mutations in the GJB2 gene were screened by single-strand conformation polymorphism and the coding region was sequenced when abnormal patterns were found. Pathogenic mutations in GJB2 and GJB6 genes were detected in 41 individuals (13.7%), and 80.5% (33/41) presented these mutations in homozygosis or compound heterozygosis, thus explaining their hearing defect. The c.35delG in the GJB2 gene was the most frequent mutation (37/300; 12.4%), detected in 23% familial and 6.2% the sporadic cases. The second most frequent mutation (1%; 3/300) was the del(GJB6-D13S1830), always found associated with the c.35delG mutation. Nineteen different sequence variations were found in the GJB2 gene. In addition to the c.35delG mutation, nine known pathogenic alterations were detected c.167delT, p.Trp24X, p.Val37Ile, c.176_191del16, c.235delC, p.Leu90Pro, p.Arg127His, c.509insA, and p.Arg184Pro. Five substitutions had been previously considered benign polymorphisms: c.-15C>T, p.Val27Ile, p.Met34Thr, p.Ala40Ala, and p.Gly160Ser. Two previously reported mutations of unknown pathogenicity were found (p.Lys168Arg, and c.684C>A), and two novel substitutions, p.Leu81Val (c.G241C) and p.Met195Val (c.A583G), both

  17. Contribution of JAK2 mutations to T-cell lymphoblastic lymphoma development.

    PubMed

    Roncero, A M; López-Nieva, P; Cobos-Fernández, M A; Villa-Morales, M; González-Sánchez, L; López-Lorenzo, J L; Llamas, P; Ayuso, C; Rodríguez-Pinilla, S M; Arriba, M C; Piris, M A; Fernández-Navarro, P; Fernández, A F; Fraga, M F; Santos, J; Fernández-Piqueras, J

    2016-01-01

    The JAK-STAT pathway has a substantial role in lymphoid precursor cell proliferation, survival and differentiation. Nonetheless, the contribution of JAK2 to T-cell lymphoblastic lymphoma (T-LBL) development remains poorly understood. We have identified one activating TEL-JAK2 translocation and four missense mutations accumulated in 2 out of 16 T-LBL samples. Two of them are novel JAK2 mutations and the other two are reported for the first time in T-LBL. Notably, R683G and I682T might have arisen owing to RNA editing. Mutated samples showed different mutated transcripts suggesting sub-clonal heterogeneity. Functional approaches revealed that two JAK2 mutations (H574R and R683G) constitutively activate JAK-STAT signaling in γ2A cells and can drive the proliferation of BaF3-EpoR cytokine-dependent cell line. In addition, aberrant hypermethylation of SOCS3 might contribute to enhance the activation of JAK-STAT signaling. Of utmost interest is that primary T-LBL samples harboring JAK2 mutations exhibited increased expression of LMO2, suggesting a mechanistic link between JAK2 mutations and the expression of LMO2, which was confirmed for the four missense mutations in transfected γ2A cells. We therefore propose that active JAK2 contribute to T-LBL development by two different mechanisms, and that the use of pan-JAK inhibitors in combination with epigenetic drugs should be considered in future treatments.

  18. Contribution of JAK2 mutations to T-cell lymphoblastic lymphoma development

    PubMed Central

    Roncero, A M; López-Nieva, P; Cobos-Fernández, M A; Villa-Morales, M; González-Sánchez, L; López-Lorenzo, J L; Llamas, P; Ayuso, C; Rodríguez-Pinilla, S M; Arriba, M C; Piris, M A; Fernández-Navarro, P; Fernández, A F; Fraga, M F; Santos, J; Fernández-Piqueras, J

    2016-01-01

    The JAK-STAT pathway has a substantial role in lymphoid precursor cell proliferation, survival and differentiation. Nonetheless, the contribution of JAK2 to T-cell lymphoblastic lymphoma (T-LBL) development remains poorly understood. We have identified one activating TEL-JAK2 translocation and four missense mutations accumulated in 2 out of 16 T-LBL samples. Two of them are novel JAK2 mutations and the other two are reported for the first time in T-LBL. Notably, R683G and I682T might have arisen owing to RNA editing. Mutated samples showed different mutated transcripts suggesting sub-clonal heterogeneity. Functional approaches revealed that two JAK2 mutations (H574R and R683G) constitutively activate JAK-STAT signaling in γ2A cells and can drive the proliferation of BaF3-EpoR cytokine-dependent cell line. In addition, aberrant hypermethylation of SOCS3 might contribute to enhance the activation of JAK-STAT signaling. Of utmost interest is that primary T-LBL samples harboring JAK2 mutations exhibited increased expression of LMO2, suggesting a mechanistic link between JAK2 mutations and the expression of LMO2, which was confirmed for the four missense mutations in transfected γ2A cells. We therefore propose that active JAK2 contribute to T-LBL development by two different mechanisms, and that the use of pan-JAK inhibitors in combination with epigenetic drugs should be considered in future treatments. PMID:26216197

  19. Newly identified mutations at the CSN1S1 gene in Ethiopian goats affect casein content and coagulation properties of their milk.

    PubMed

    Mestawet, T A; Girma, A; Adnøy, T; Devold, T G; Vegarud, G E

    2013-08-01

    Very high casein content and good coagulation properties previously observed in some Ethiopian goat breeds led to investigating the αs1-casein (CSN1S1) gene in these breeds. Selected regions of the CSN1S1 gene were sequenced in 115 goats from 5 breeds (2 indigenous: Arsi-Bale and Somali, 1 exotic: Boer, and 2 crossbreeds: Boer × Arsi-Bale and Boer × Somali). The DNA analysis resulted in 35 new mutations: 3 in exons, 3 in the 5' untranslated region (UTR), and 29 in the introns. The mutations in exons that resulted in an amino acid shift were then picked to evaluate their influence on individual casein content (αs1-, αs2-, β-, and κ-CN), micellar size, and coagulation properties in the milk from the 5 goat breeds. A mutation at nucleotide 10657 (exon 10) involved a transversion: CAG→CCG, resulting in an amino acid exchange Gln77→Pro77. This mutation was associated with the indigenous breeds only. Two new mutations, at nucleotide 6072 (exon 4) and 12165 (exon 12), revealed synonymous transitions: GTC→GTT in Val15 and AGA→AGG in Arg100 of the mature protein. Transitions G→A and C→T at nucleotides 1374 and 1866, respectively, occurred in the 5' UTR, whereas the third mutation involved a transversion T→G at nucleotide location 1592. The goats were grouped into homozygote new (CC), homozygote reference (AA), and heterozygote (CA) based on the nucleotide that involved the transversion. The content of αs1-CN (15.32g/kg) in milk samples of goats homozygous (CC) for this newly identified mutation, Gln77→Pro77 was significantly higher than in milks of heterozygous (CA; 9.05g/kg) and reference (AA; 7.61g/kg) genotype animals. The αs2-, β-, and κ-CN contents showed a similar pattern. Milk from goats with a homozygous new mutation had significantly lower micellar size. Milk from both homozygote and heterozygote new-mutation goats had significantly shorter coagulation rate and stronger gel than the reference genotype. Except the transversion, the

  20. Alzheimer’s Protective A2T Mutation Changes the Conformational Landscape of the Aβ1–42 Monomer Differently Than Does the A2V Mutation

    PubMed Central

    Das, Payel; Murray, Brian; Belfort, Georges

    2015-01-01

    The aggregation of amyloid-β (Aβ) peptides plays a crucial role in the etiology of Alzheimer’s disease (AD). Recently, it has been reported that an A2T mutation in Aβ can protect against AD. Interestingly, a nonpolar A2V mutation also has been found to offer protection against AD in the heterozygous state, although it causes early-onset AD in homozygous carriers. Since the conformational landscape of the Aβ monomer is known to directly contribute to the early-stage aggregation mechanism, it is important to characterize the effects of the A2T and A2V mutations on Aβ1–42 monomer structure. Here, we have performed extensive atomistic replica-exchange molecular dynamics simulations of the solvated wild-type (WT), A2V, and A2T Aβ1–42 monomers. Our simulations reveal that although all three variants remain as collapsed coils in solution, there exist significant structural differences among them at shorter timescales. A2V exhibits an enhanced double-hairpin population in comparison to the WT, similar to those reported in toxic WT Aβ1–42 oligomers. Such double-hairpin formation is caused by hydrophobic clustering between the N-terminus and the central and C-terminal hydrophobic patches. In contrast, the A2T mutation causes the N-terminus to engage in unusual electrostatic interactions with distant residues, such as K16 and E22, resulting in a unique population comprising only the C-terminal hairpin. These findings imply that a single A2X (where X = V or T) mutation in the primarily disordered N-terminus of the Aβ1–42 monomer can dramatically alter the β-hairpin population and switch the equilibrium toward alternative structures. The atomistically detailed, comparative view of the structural landscapes of A2V and A2T variant monomers obtained in this study can enhance our understanding of the mechanistic differences in their early-stage aggregation. PMID:25650940

  1. Long-range PCR facilitates the identification of PMS2-specific mutations.

    PubMed

    Clendenning, Mark; Hampel, Heather; LaJeunesse, Jennifer; Lindblom, Annika; Lockman, Jan; Nilbert, Mef; Senter, Leigha; Sotamaa, Kaisa; de la Chapelle, Albert

    2006-05-01

    Mutations within the DNA mismatch repair gene, "postmeiotic segregation increased 2" (PMS2), have been associated with a predisposition to hereditary nonpolyposis colorectal cancer (HNPCC; Lynch syndrome). The presence of a large family of highly homologous PMS2 pseudogenes has made previous attempts to sequence PMS2 very difficult. Here, we describe a novel method that utilizes long-range PCR as a way to preferentially amplify PMS2 and not the pseudogenes. A second, exon-specific, amplification from diluted long-range products enables us to obtain a clean sequence that shows no evidence of pseudogene contamination. This method has been used to screen a cohort of patients whose tumors were negative for the PMS2 protein by immunohistochemistry and had not shown any mutations within the MLH1 gene. Sequencing of the PMS2 gene from 30 colorectal and 11 endometrial cancer patients identified 10 novel sequence changes as well as 17 sequence changes that had previously been identified. In total, putative pathologic mutations were detected in 11 of the 41 families. Among these were five novel mutations, c.705+1G>T, c.736_741del6ins11, c.862_863del, c.1688G>T, and c.2007-1G>A. We conclude that PMS2 mutation detection in selected Lynch syndrome and Lynch syndrome-like patients is both feasible and desirable. Published 2006 Wiley-Liss, Inc.

  2. Disease-modifying polymorphisms and C609Y mutation of RET associated with high penetrance of phaeochromocytoma and low rate of MTC in MEN2A.

    PubMed

    Speak, Rowena; Cook, Jackie; Harrison, Barney; Newell-Price, John

    2016-01-01

    Mutations of the rearranged during transfection ( RET ) proto-oncogene, located on chromosome 10q11.2, cause multiple endocrine neoplasia type 2A (MEN2A). Patients with mutations at the codon 609 usually exhibit a high penetrance of medullary thyroid cancer (MTC), but a sufficiently low penetrance of phaeochromocytoma that screening for this latter complication has been called to question. Patients with other RET mutations are at higher risk of younger age onset phaeochromocytoma if they also possess other RET polymorphisms (L769L, S836S, G691S and S904S), but there are no similar data for patients with 609 mutations. We investigated the unusual phenotypic presentation in a family with MEN2A due to a C609Y mutation in RET . Sanger sequencing of the entire RET -coding region and exon-intron boundaries was performed. Five family members were C609Y mutation positive: 3/5 initially presented with phaeochromocytoma, but only 1/5 had MTC. The index case aged 73 years had no evidence of MTC, but presented with phaeochromocytoma. Family members also possessed the G691S and S904S RET polymorphisms. We illustrate a high penetrance of phaeochromocytoma and low penetrance of MTC in patients with a RET C609Y mutation and polymorphisms G691S and S904S. These data highlight the need for life-long screening for the complications of MEN2A in these patients and support the role for the screening of RET polymorphisms for the purposes of risk stratification. C609Y RET mutations may be associated with a life-long risk of phaeochromocytoma indicating the importance of life-long screening for this condition in patients with MEN2A.C609Y RET mutations may be associated with a lower risk of MTC than often quoted, questioning the need for early prophylactic thyroid surgery discussion at the age of 5 years.There may be a role for the routine screening of RET polymorphisms, and this is greatly facilitated by the increasing ease of access to next-generation sequencing.

  3. Calreticulin mutation analysis in non-mutated Janus kinase 2 essential thrombocythemia patients in Chiang Mai University: analysis of three methods and clinical correlations.

    PubMed

    Rattarittamrong, Ekarat; Tantiworawit, Adisak; Kumpunya, Noppamas; Wongtagan, Ornkamon; Tongphung, Ratchanoo; Phusua, Arunee; Chai-Adisaksopha, Chatree; Hantrakool, Sasinee; Rattanathammethee, Thanawat; Norasetthada, Lalita; Charoenkwan, Pimlak; Lekawanvijit, Suree

    2018-03-09

    The primary objective was to determine the prevalence of calreticulin (CALR) mutation in patients with non-JAK2V617F mutated essential thrombocythemia (ET). The secondary objectives were to evaluate the accuracy of CALR mutation analysis by high-resolution melting (HRM) analysis and real-time polymerase chain reaction (PCR) compared with DNA sequencing and to compare clinical characteristics of CALR mutated and JAK2V617F mutated ET. This was a prospective cohort study involving ET patients registered at Chiang Mai University in the period September 2015-September 2017 who were aged more than 2 years, and did not harbor JAK2V617F mutation. The presence of CALR mutation was established by DNA sequencing, HRM, and real-time PCR for type 1 and type 2 mutation. Clinical data were compared with that from ET patients with mutated JAK2V617F. Twenty-eight patients were enrolled onto the study. CALR mutations were found in 10 patients (35.7%). Three patients had type 1 mutation, 5 patients had type 2 mutation, 1 patient had type 18 mutation, and 1 patients had novel mutations (c.1093 C-G, c.1098_1131 del, c.1135 G-A). HRM could differentiate between the types of mutation in complete agreement with DNA sequencing. Patients with a CALR mutation showed a significantly greater male predominance and had a higher platelet count when compared with 42 JAK2V617F patients. The prevalence of CALR mutation in JAK2V617F-negative ET in this study is 35.7%. HRM is an effective method of detecting CALR mutation and is a more advantageous method of screening for CALR mutation.

  4. Mutations of Vasopressin Receptor 2 Including Novel L312S Have Differential Effects on Trafficking.

    PubMed

    Tiulpakov, Anatoly; White, Carl W; Abhayawardana, Rekhati S; See, Heng B; Chan, Audrey S; Seeber, Ruth M; Heng, Julian I; Dedov, Ivan; Pavlos, Nathan J; Pfleger, Kevin D G

    2016-08-01

    Nephrogenic syndrome of inappropriate antidiuresis (NSIAD) is a genetic disease first described in 2 unrelated male infants with severe symptomatic hyponatremia. Despite undetectable arginine vasopressin levels, patients have inappropriately concentrated urine resulting in hyponatremia, hypoosmolality, and natriuresis. Here, we describe and functionally characterize a novel vasopressin type 2 receptor (V2R) gain-of-function mutation. An L312S substitution in the seventh transmembrane domain was identified in a boy presenting with water-induced hyponatremic seizures at the age of 5.8 years. We show that, compared with wild-type V2R, the L312S mutation results in the constitutive production of cAMP, indicative of the gain-of-function NSIAD profile. Interestingly, like the previously described F229V and I130N NSIAD-causing mutants, this appears to both occur in the absence of notable constitutive β-arrestin2 recruitment and can be reduced by the inverse agonist Tolvaptan. In addition, to understand the effect of various V2R substitutions on the full receptor "life-cycle," we have used and further developed a bioluminescence resonance energy transfer intracellular localization assay using multiple localization markers validated with confocal microscopy. This allowed us to characterize differences in the constitutive and ligand-induced localization and trafficking profiles of the novel L312S mutation as well as for previously described V2R gain-of-function mutants (NSIAD; R137C and R137L), loss-of-function mutants (nephrogenic diabetes insipidus; R137H, R181C, and M311V), and a putative silent V266A V2R polymorphism. In doing so, we describe differences in trafficking between unique V2R substitutions, even at the same amino acid position, therefore highlighting the value of full and thorough characterization of receptor function beyond simple signaling pathway analysis.

  5. High MACC1 expression in combination with mutated KRAS G13 indicates poor survival of colorectal cancer patients.

    PubMed

    Ilm, Katharina; Kemmner, Wolfgang; Osterland, Marc; Burock, Susen; Koch, Gudrun; Herrmann, Pia; Schlag, Peter M; Stein, Ulrike

    2015-02-14

    The metastasis-associated in colon cancer 1 (MACC1) gene has been identified as prognostic biomarker for colorectal cancer (CRC). Here, we aimed at the refinement of risk assessment by separate and combined survival analyses of MACC1 expression with any of the markers KRAS mutated in codon 12 (KRAS G12) or codon 13 (KRAS G13), BRAF V600 mutation and MSI status in a retrospective study of 99 CRC patients with tumors UICC staged I, II and III. We showed that only high MACC1 expression (HR: 6.09, 95% CI: 2.50-14.85, P < 0.001) and KRAS G13 mutation (HR: 5.19, 95% CI: 1.06-25.45, P = 0.042) were independent prognostic markers for shorter metastasis-free survival (MFS). Accordingly, Cox regression analysis revealed that patients with high MACC1 expression and KRAS G13 mutation exhibited the worst prognosis (HR: 14.48, 95% CI: 3.37-62.18, P < 0.001). Patients were classified based on their molecular characteristics into four clusters with significant differences in MFS (P = 0.003) by using the SPSS 2-step cluster function and Kaplan-Meier survival analysis. According to our results, patients with high MACC1 expression and mutated KRAS G13 exhibited the highest risk for metachronous metastases formation. Moreover, we demonstrated that the "Traditional pathway" with an intermediate risk for metastasis formation can be further subdivided by assessing MACC1 expression into a low and high risk group with regard to MFS prognosis. This is the first report showing that identification of CRC patients at high risk for metastasis is possible by assessing MACC1 expression in combination with KRAS G13 mutation.

  6. Past and projected trends of body mass index and weight status in South Australia: 2003 to 2019.

    PubMed

    Hendrie, Gilly A; Ullah, Shahid; Scott, Jane A; Gray, John; Berry, Narelle; Booth, Sue; Carter, Patricia; Cobiac, Lynne; Coveney, John

    2015-12-01

    Functional data analysis (FDA) is a forecasting approach that, to date, has not been applied to obesity, and that may provide more accurate forecasting analysis to manage uncertainty in public health. This paper uses FDA to provide projections of Body Mass Index (BMI), overweight and obesity in an Australian population through to 2019. Data from the South Australian Monitoring and Surveillance System (January 2003 to December 2012, n=51,618 adults) were collected via telephone interview survey. FDA was conducted in four steps: 1) age-gender specific BMIs for each year were smoothed using a weighted regression; 2) the functional principal components decomposition was applied to estimate the basis functions; 3) an exponential smoothing state space model was used for forecasting the coefficient series; and 4) forecast coefficients were combined with the basis function. The forecast models suggest that between 2012 and 2019 average BMI will increase from 27.2 kg/m(2) to 28.0 kg/m(2) in males and 26.4 kg/m(2) to 27.6 kg/m(2) in females. The prevalence of obesity is forecast to increase by 6-7 percentage points by 2019 (to 28.7% in males and 29.2% in females). Projections identify age-gender groups at greatest risk of obesity over time. The novel approach will be useful to facilitate more accurate planning and policy development. © 2015 Public Health Association of Australia.

  7. Cardiac abnormalities in patients with mitochondrial DNA mutation 3243A>G.

    PubMed

    Majamaa-Voltti, Kirsi; Peuhkurinen, Keijo; Kortelainen, Marja-Leena; Hassinen, Ilmo E; Majamaa, Kari

    2002-08-01

    Tissues that depend on aerobic energy metabolism suffer most in diseases caused by mutations in mitochondrial DNA (mtDNA). Cardiac abnormalities have been described in many cases, but their frequency and clinical spectrum among patients with mtDNA mutations is unknown. Thirty-nine patients with the 3243A>G mtDNA mutation were examined, methods used included clinical evaluation, electrocardiogram, Holter recording and echocardiography. Autopsy reports on 17 deceased subjects were also reviewed. The degree of 3243A>G mutation heteroplasmy was determined using an Apa I restriction fragment analysis. Better hearing level (BEHL0.5-4 kHz) was used as a measure of the clinical severity of disease. Left ventricular hypertrophy (LVH) was diagnosed in 19 patients (56%) by echocardiography and in six controls (15%) giving an odds ratio of 7.5 (95% confidence interval; 1.74-67). The dimensions of the left ventricle suggested a concentric hypertrophy. Left ventricular systolic or diastolic dysfunction was observed in 11 patients. Holter recording revealed frequent ventricular extrasystoles (>10/h) in five patients. Patients with LVH differed significantly from those without LVH in BEHL0.5-4 kHz, whereas the contribution of age or the degree of the mutant heteroplasmy in skeletal muscle to the risk of LVH was less remarkable. Structural and functional abnormalities of the heart were common in patients with 3243A>G. The risk of LVH was related to the clinical severity of the phenotype, and to a lesser degree to age, suggesting that patients presenting with any symptoms from the mutation should also be evaluated for cardiac abnormalities.

  8. Connecting Ca2+ and lysosomes to Parkinson disease

    PubMed Central

    Kilpatrick, Bethan S.

    2017-01-01

    The neurodegenerative movement disorder Parkinson disease (PD) is prevalent in the aged population. However, the underlying mechanisms that trigger disease are unclear. Increasing work implicates both impaired Ca2+ signalling and lysosomal dysfunction in neuronal demise. Here I aim to connect these distinct processes by exploring the evidence that lysosomal Ca2+ signalling is disrupted in PD. In particular, I highlight defects in lysosomal Ca2+ content and signalling through NAADP-regulated two-pore channels in patient fibroblasts harbouring mutations in the PD-linked genes, GBA1 and LRRK2. As an emerging contributor to PD pathogenesis, the lysosomal Ca2+ signalling apparatus could represent a novel therapeutic target. PMID:28529829

  9. BPS states in N = 2 supersymmetric G2 and F4 models

    NASA Astrophysics Data System (ADS)

    Ahl Laamara, R.; Mellal, O.; Saidi, E. H.

    2017-07-01

    In BPS quiver theory of N = 2 supersymmetric pure gauge models with gauge invariance G, primitive BPS quivers Q0G are of two types: Q0ADE and Q0BCFG. In this study, we first show that Q0ADE have outer-automorphism symmetries inherited from the outer-automorphisms of the Dynkin diagrams of ADE Lie algebras. Then, we extend the usual folding operation of Dynkin diagrams ADE → BCFG to obtain the two following things: (i) relate Q0BCFG quivers and their mutations to the Q0ADE ones and their mutations; and (ii) link the BPS chambers of the N = 2ADE theories with the corresponding BCFG ones. As an illustration of this construction, we derive the BPS and anti-BPS states of the strong chambers QstgG2 and QstgF4 of the 4d N = 2 pure G2 and F4 gauge models.

  10. Glucokinase gene mutations (MODY 2) in Asian Indians.

    PubMed

    Kanthimathi, Sekar; Jahnavi, Suresh; Balamurugan, Kandasamy; Ranjani, Harish; Sonya, Jagadesan; Goswami, Soumik; Chowdhury, Subhankar; Mohan, Viswanathan; Radha, Venkatesan

    2014-03-01

    Heterozygous inactivating mutations in the glucokinase (GCK) gene cause a hyperglycemic condition termed maturity-onset diabetes of the young (MODY) 2 or GCK-MODY. This is characterized by mild, stable, usually asymptomatic, fasting hyperglycemia that rarely requires pharmacological intervention. The aim of the present study was to screen for GCK gene mutations in Asian Indian subjects with mild hyperglycemia. Of the 1,517 children and adolescents of the population-based ORANGE study in Chennai, India, 49 were found to have hyperglycemia. These children along with the six patients referred to our center with mild hyperglycemia were screened for MODY 2 mutations. The GCK gene was bidirectionally sequenced using BigDye(®) Terminator v3.1 (Applied Biosystems, Foster City, CA) chemistry. In silico predictions of the pathogenicity were carried out using the online tools SIFT, Polyphen-2, and I-Mutant 2.0 software programs. Direct sequencing of the GCK gene in the patients referred to our Centre revealed one novel mutation, Thr206Ala (c.616A>G), in exon 6 and one previously described mutation, Met251Thr (c.752T>C), in exon 7. In silico analysis predicted the novel mutation to be pathogenic. The highly conserved nature and critical location of the residue Thr206 along with the clinical course suggests that the Thr206Ala is a MODY 2 mutation. However, we did not find any MODY 2 mutations in the 49 children selected from the population-based study. Hence prevalence of GCK mutations in Chennai is <1:1,517. This is the first study of MODY 2 mutations from India and confirms the importance of considering GCK gene mutation screening in patients with mild early-onset hyperglycemia who are negative for β-cell antibodies.

  11. The mitochondrial calcium uniporter is involved in mitochondrial calcium cycle dysfunction: Underlying mechanism of hypertension associated with mitochondrial tRNA(Ile) A4263G mutation.

    PubMed

    Chen, Xi; Zhang, Yu; Xu, Bin; Cai, Zhongqi; Wang, Lin; Tian, Jinwen; Liu, Yuqi; Li, Yang

    2016-09-01

    Recent studies have shown that the mitochondrial DNA mutations are involved in the pathogenesis of hypertension. Our previous study identified mitochondrial tRNA(Ile) A4263G mutation in a large Chinese Han family with maternally-inherited hypertension. This mutation may contribute to mitochondrial Ca(2+) cycling dysfuntion, but the mechanism is unclear. Lymphoblastoid cell lines were derived from hypertensive and normotensive individuals, either with or without tRNA(Ile) A4263G mutation. The mitochondrial calcium ([Ca(2+)]m) in cells from hypertensive subjects with the tRNA(Ile) A4263G mutation, was lower than in cells from normotension or hypertension without mutation, or normotension with mutation (P<0.05). Meanwhile, cytosolic calcium ([Ca(2+)]c) in hypertensive with mutation cells was higher than another three groups. After exposure to caffeine, which could increase the [Ca(2+)]c by activating ryanodine receptor on endoplasmic reticulum, [Ca(2+)]c/[Ca(2+)]m increased higher than in hypertensive with mutation cells from another three groups. Moreover, MCU expression was decreased in hypertensive with mutation cells compared with in another three groups (P<0.05). [Ca(2+)]c increased and [Ca(2+)]m decreased after treatment with Ru360 (an inhibitor of MCU) or an siRNA against MCU. In this study we found decreased MCU expression in hypertensive with mutation cells contributed to dysregulated Ca(2+) uptake into the mitochondria, and cytoplasmic Ca(2+) overload. This abnormality might be involved in the underlying mechanisms of maternally inherited hypertension in subjects carrying the mitochondrial tRNA(Ile) A4263G mutation. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. A case of a Tunisian Rett patient with a novel double-mutation of the MECP2 gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fendri-Kriaa, Nourhene, E-mail: nourhene.fendri@gmail.com; Hsairi, Ines; Kifagi, Chamseddine

    2011-06-03

    Highlights: {yields} Sequencing of the MECP2 gene, modeling and comparison of the two variants were performed in a Tunisian classical Rett patient. {yields} A double-mutation: a new and de novo mutation c.535C > T and the common one c.763C > T of the MECP2 gene was identified. {yields} The P179S transition may change local electrostatic properties which may affect the function and stability of the protein MeCP2. -- Abstract: Rett syndrome is an X-linked dominant disorder caused frequently by mutations in the methyl-CpG-binding protein 2 gene (MECP2). Rett patients present an apparently normal psychomotor development during the first 6-18 monthsmore » of life. Thereafter, they show a short period of developmental stagnation followed by a rapid regression in language and motor development. The aim of this study was to perform a mutational analysis of the MECP2 gene in a classical Rett patient by sequencing the corresponding gene and modeling the found variants. The results showed the presence of a double-mutation: a new and de novo mutation c.535C > T (p.P179S) and the common c.763C > T (p.R255X) transition of the MECP2 gene. The p.P179S mutation was located in a conserved amino acid in CRIR domain (corepressor interacting region). Modeling results showed that the P179S transition could change local electrostatic properties by adding a negative charge due to serine hydroxyl group of this region of MeCP2 which may affect the function and stability of the protein. The p.R255X mutation is located in TRD-NLS domain (transcription repression domain-nuclear localization signal) of MeCP2 protein.« less

  13. Mutations in the gene encoding the Sigma 2 subunit of the adaptor protein 1 complex, AP1S2, cause X-linked mental retardation.

    PubMed

    Tarpey, Patrick S; Stevens, Claire; Teague, Jon; Edkins, Sarah; O'Meara, Sarah; Avis, Tim; Barthorpe, Syd; Buck, Gemma; Butler, Adam; Cole, Jennifer; Dicks, Ed; Gray, Kristian; Halliday, Kelly; Harrison, Rachel; Hills, Katy; Hinton, Jonathon; Jones, David; Menzies, Andrew; Mironenko, Tatiana; Perry, Janet; Raine, Keiran; Richardson, David; Shepherd, Rebecca; Small, Alexandra; Tofts, Calli; Varian, Jennifer; West, Sofie; Widaa, Sara; Yates, Andy; Catford, Rachael; Butler, Julia; Mallya, Uma; Moon, Jenny; Luo, Ying; Dorkins, Huw; Thompson, Deborah; Easton, Douglas F; Wooster, Richard; Bobrow, Martin; Carpenter, Nancy; Simensen, Richard J; Schwartz, Charles E; Stevenson, Roger E; Turner, Gillian; Partington, Michael; Gecz, Jozef; Stratton, Michael R; Futreal, P Andrew; Raymond, F Lucy

    2006-12-01

    In a systematic sequencing screen of the coding exons of the X chromosome in 250 families with X-linked mental retardation (XLMR), we identified two nonsense mutations and one consensus splice-site mutation in the AP1S2 gene on Xp22 in three families. Affected individuals in these families showed mild-to-profound mental retardation. Other features included hypotonia early in life and delay in walking. AP1S2 encodes an adaptin protein that constitutes part of the adaptor protein complex found at the cytoplasmic face of coated vesicles located at the Golgi complex. The complex mediates the recruitment of clathrin to the vesicle membrane. Aberrant endocytic processing through disruption of adaptor protein complexes is likely to result from the AP1S2 mutations identified in the three XLMR-affected families, and such defects may plausibly cause abnormal synaptic development and function. AP1S2 is the first reported XLMR gene that encodes a protein directly involved in the assembly of endocytic vesicles.

  14. Identification of autism-related MECP2 mutations by whole-exome sequencing and functional validation.

    PubMed

    Wen, Zhu; Cheng, Tian-Lin; Li, Gai-Zhi; Sun, Shi-Bang; Yu, Shun-Ying; Zhang, Yi; Du, Ya-Song; Qiu, Zilong

    2017-01-01

    Methyl-CpG-binding protein-2 (MeCP2) is a critical regulator for neural development. Either loss- or gain-of-function leads to severe neurodevelopmental disorders, such as Rett syndrome (RTT) and autism spectrum disorder (ASD). We set out to screen for MECP2 mutations in patients of ASD and determine whether these autism-related mutations may compromise the proper function of MeCP2. Whole-exome sequencing was performed to screen MECP2 and other ASD candidate genes for 120 patients diagnosed with ASD. The parents of patients who were identified with MECP2 mutation were selected for further Sanger sequencing. Each patient accomplished the case report form including general information and clinical scales applied to assess their clinical features. Mouse cortical neurons and HEK-293 cells were cultured and transfected with MeCP2 wild-type (WT) or mutant to examine the function of autism-associated MeCP2 mutants. HEK-293 cells were used to examine the expression of MeCP2 mutant constructs with Western blot. Mouse cortical neurons were used to analyze neurites and axon outgrowth by immunofluorescence experiments. We identified three missense mutations of MECP2 from three autism patients by whole-exome sequencing: p.P152L (c.455C>T), p.P376S (c.1162C>T), and p.R294X (c.880C>T). Among these mutations, p.P152L and p.R294X were de novo mutations, whereas p.P376S was inherited maternally. The diagnosis of RTT was excluded in all three autism patients. Abnormalities of dendritic and axonal growth were found after autism-related MeCP2 mutants were expressed in mouse cortical neurons; suggesting that autism-related MECP2 mutations impair the proper development of neurons. Our study identified genetic mutations of the MECP2 gene in autism patients, which were previously considered to be associated primarily with RTT. This finding suggests that loss-of-function mutations of MECP2 may also lead to autism spectrum disorders.

  15. Investigation of prolific sheep from UK and Ireland for evidence on origin of the mutations in BMP15 (FecX(G), FecX(B)) and GDF9 (FecG(H)) in Belclare and Cambridge sheep.

    PubMed

    Mullen, Michael P; Hanrahan, James P; Howard, Dawn J; Powell, Richard

    2013-01-01

    This paper concerns the likely origin of three mutations with large effects on ovulation rate identified in the Belclare and Cambridge sheep breeds; two in the BMP15 gene (FecX(G) and FecX(B)) and the third (FecG(H)) in GDF9. All three mutations segregate in Belclare sheep while one, FecX(B), has not been found in the Cambridge. Both Belclare and Cambridge breeds are relatively recently developed composites that have common ancestry through the use of genetic material from the Finnish Landrace and Lleyn breeds. The development of both composites also involved major contributions from exceptionally prolific ewes screened from flocks in Ireland (Belclare) and Britain (Cambridge) during the 1960s. The objective of the current study was to establish the likely origin of the mutations (FecX(G), FecX(B) and FecG(H)) through analysis of DNA from Finnish Landrace and Lleyn sheep, and Galway and Texel breeds which contributed to the development of the Belclare breed. Ewes with exceptionally high prolificacy (hyper-prolific ewes) in current flocks on Irish farms were identified to simulate the screening of ewes from Irish flocks in the 1960s. DNA was obtained from: prolific ewes in extant flocks of Lleyn sheep (n = 44) on the Lleyn peninsula in Wales; hyper-prolific ewes (n = 41); prolific Galway (n = 41) ewes; Finnish Landrace (n = 124) and Texel (n = 19) ewes. The FecX(G) mutation was identified in Lleyn but not in Finnish Landrace, Galway or Texel sheep; FecX(B) was only found among the hyper-prolific ewes. The FecG(H) mutation was identified in the sample of Lleyn sheep. It was concluded from these findings that the Lleyn breed was the most likely source of the FecX(G) and FecG(H) mutations in Belclare and Cambridge sheep and that the FecX(B) mutation came from the High Fertility line that was developed using prolific ewes selected from commercial flocks in Ireland in the 1960's and subsequently used in the genesis of the Belclare.

  16. Functional studies of p.R132C, p.R149C, p.M283V, p.E431K, and a novel c.652-2A>G mutations of the CYP21A2 gene.

    PubMed

    Taboas, Melisa; Gómez Acuña, Luciana; Scaia, María Florencia; Bruque, Carlos D; Buzzalino, Noemí; Stivel, Mirta; Ceballos, Nora R; Dain, Liliana

    2014-01-01

    Congenital adrenal hyperplasia (CAH) due to 21-hydroxylase deficiency is the most frequent inborn error of metabolism and accounts for 90-95% of CAH cases. In the present work, we analyzed the functional consequence of four novel previously reported point CYP21A2 mutations -p.R132C, p.R149C, p.M283V, p.E431K- found in Argentinean 21-hydroxylase deficient patients. In addition, we report an acceptor splice site novel point mutation, c.652-2A>G, found in a classical patient in compound heterozygosity with the rare p.R483Q mutation. We performed bioinformatic and functional assays to evaluate the biological implication of the novel mutation. Our analyses revealed that the residual enzymatic activity of the isolated mutants coding for CYP21A2 aminoacidic substitutions was reduced to a lesser than 50% of the wild type with both progesterone and 17-OH progesterone as substrates. Accordingly, all the variants would predict mild non-classical alleles. In one non-classical patient, the p.E431K mutation was found in cis with the p.D322G one. The highest decrease in enzyme activity was obtained when both mutations were assayed in the same construction, with a residual activity most likely related to the simple virilizing form of the disease. For the c.652-2A>G mutation, bioinformatic tools predicted the putative use of two different cryptic splicing sites. Nevertheless, functional analyses revealed the use of only one cryptic splice acceptor site located within exon 6, leading to the appearance of an mRNA with a 16 nt deletion. A severe allele is strongly suggested due to the presence of a premature stop codon in the protein only 12 nt downstream.

  17. Functional Studies of p.R132C, p.R149C, p.M283V, p.E431K, and a Novel c.652-2A>G Mutations of the CYP21A2 Gene

    PubMed Central

    Taboas, Melisa; Gómez Acuña, Luciana; Scaia, María Florencia; Bruque, Carlos D.; Buzzalino, Noemí; Stivel, Mirta

    2014-01-01

    Congenital adrenal hyperplasia (CAH) due to 21-hydroxylase deficiency is the most frequent inborn error of metabolism and accounts for 90–95% of CAH cases. In the present work, we analyzed the functional consequence of four novel previously reported point CYP21A2 mutations -p.R132C, p.R149C, p.M283V, p.E431K- found in Argentinean 21-hydroxylase deficient patients. In addition, we report an acceptor splice site novel point mutation, c.652-2A>G, found in a classical patient in compound heterozygosity with the rare p.R483Q mutation. We performed bioinformatic and functional assays to evaluate the biological implication of the novel mutation. Our analyses revealed that the residual enzymatic activity of the isolated mutants coding for CYP21A2 aminoacidic substitutions was reduced to a lesser than 50% of the wild type with both progesterone and 17-OH progesterone as substrates. Accordingly, all the variants would predict mild non-classical alleles. In one non-classical patient, the p.E431K mutation was found in cis with the p.D322G one. The highest decrease in enzyme activity was obtained when both mutations were assayed in the same construction, with a residual activity most likely related to the simple virilizing form of the disease. For the c.652-2A>G mutation, bioinformatic tools predicted the putative use of two different cryptic splicing sites. Nevertheless, functional analyses revealed the use of only one cryptic splice acceptor site located within exon 6, leading to the appearance of an mRNA with a 16 nt deletion. A severe allele is strongly suggested due to the presence of a premature stop codon in the protein only 12 nt downstream. PMID:24667412

  18. Mitochondrial tRNA(Thr) A15951G mutation may not be associated with Leber's Hereditary Optic Neuropathy.

    PubMed

    Zhang, Xi; Yu, Shuaishuai; Tu, Yunhai; Huang, Wenjie

    2016-07-01

    Mutation in mitochondrial DNA (mtDNA) has been found to play an important role in the pathogenesis of Leber's Hereditary Optic Neuropathy (LHON). Three primary mutations, the ND4 G11778A, ND6 T14484C, and ND1 G3460A, have been found to account more than 90% of LHON patients in many families worldwide. In addition to the mutations in genes encoding the respiratory chain complex I, reports concerning the mt-tRNA gene mutations associated with LHON have increased, some pathogenic mutations caused the failure in mt-tRNA metabolism, thereby worsened the mitochondrial dysfunction that is responsible for LHON. Recently, the A15951G mutation in mt-tRNA(Thr) gene has been reported to be a "modified" factor in increasing the penetrance and expressivity of LHON-associated ND4 G11778A mutation in three Chinese families. However, evolutionary conservation analysis of this mutation suggested a poor conservation index and the pathogenicity scoring system showed that this mutation was a neutral polymorphism.

  19. Genome-Wide Estimates of Mutation Rates and Spectrum in Schizosaccharomyces pombe Indicate CpG Sites are Highly Mutagenic Despite the Absence of DNA Methylation

    PubMed Central

    Behringer, Megan G.; Hall, David W.

    2015-01-01

    We accumulated mutations for 1952 generations in 79 initially identical, haploid lines of the fission yeast Schizosaccharomyces pombe, and then performed whole-genome sequencing to determine the mutation rates and spectrum. We captured 696 spontaneous mutations across the 79 mutation accumulation (MA) lines. We compared the mutation spectrum and rate to a recently published equivalent experiment on the same species, and to another model ascomycetous yeast, the budding yeast Saccharomyces cerevisiae. While the two species are approximately 600 million years diverged from each other, they share similar life histories, genome size and genomic G/C content. We found that Sc. pombe and S. cerevisiae have similar mutation rates, but Sc. pombe exhibits a stronger insertion bias. Intriguingly, we observed an increased mutation rate at cytosine nucleotides, specifically CpG nucleotides, which is also seen in S. cerevisiae. However, the absence of methylation in Sc. pombe and the pattern of mutation at these sites, primarily C → A as opposed to C → T, strongly suggest that the increased mutation rate is not caused by deamination of methylated cytosines. This result implies that the high mutability of CpG dinucleotides in other species may be caused in part by a methylation-independent mechanism. Many of our findings mirror those seen in the recent study, despite the use of different passaging conditions, indicating that MA is a reliable method for estimating mutation rates and spectra. PMID:26564949

  20. A homozygous PMS2 founder mutation with an attenuated constitutional mismatch repair deficiency phenotype.

    PubMed

    Li, Lili; Hamel, Nancy; Baker, Kristi; McGuffin, Michael J; Couillard, Martin; Gologan, Adrian; Marcus, Victoria A; Chodirker, Bernard; Chudley, Albert; Stefanovici, Camelia; Durandy, Anne; Hegele, Robert A; Feng, Bing-Jian; Goldgar, David E; Zhu, Jun; De Rosa, Marina; Gruber, Stephen B; Wimmer, Katharina; Young, Barbara; Chong, George; Tischkowitz, Marc D; Foulkes, William D

    2015-05-01

    Inherited mutations in DNA mismatch repair genes predispose to different cancer syndromes depending on whether they are mono-allelic or bi-allelic. This supports a causal relationship between expression level in the germline and phenotype variation. As a model to study this relationship, our study aimed to define the pathogenic characteristics of a recurrent homozygous coding variant in PMS2 displaying an attenuated phenotype identified by clinical genetic testing in seven Inuit families from Northern Quebec. Pathogenic characteristics of the PMS2 mutation NM_000535.5:c.2002A>G were studied using genotype-phenotype correlation, single-molecule expression detection and single genome microsatellite instability analysis. This PMS2 mutation generates a de novo splice site that competes with the authentic site. In homozygotes, expression of the full-length protein is reduced to a level barely detectable by conventional diagnostics. Median age at primary cancer diagnosis is 22 years among 13 NM_000535.5:c.2002A>G homozygotes, versus 8 years in individuals carrying bi-allelic truncating mutations. Residual expression of full-length PMS2 transcript was detected in normal tissues from homozygotes with cancers in their 20s. Our genotype-phenotype study of c.2002A>G illustrates that an extremely low level of PMS2 expression likely delays cancer onset, a feature that could be exploited in cancer preventive intervention. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  1. [Leigh syndrome caused by the mitochondrial DNA G14459A mutation in a Mexican family].

    PubMed

    Gutiérrez, A; Saldaña-Martínez, A; García-Ramírez, R; Rayo-Mares, D; Carreras, M; López-Pérez, M J; Ruiz-Pesini, E; Montoya, J; Montiel-Sosa, J F

    Leigh syndrome is a neurodegenerative and progressive disease that appears usually in childhood due to defects in nuclear or mitochondrial genome. The mutation G14459A in mitochondrial DNA has been associated previously to Leber hereditary optic neuropathy and recently to Leigh syndrome. A 10 months-old Mexican girl diagnosed of Leigh syndrome. Molecular-genetic studies detected the mutation G14459A in a percentage close to homoplasmy and in low heteroplasmy in her mother. The rest of the maternally related family members analyzed were negative. The G14459A mutation, although not very frequently associated to Leigh syndrome, should be analyzed in patients that do not present the most common point mutations.

  2. Cardiac abnormalities in patients with mitochondrial DNA mutation 3243A>G

    PubMed Central

    Majamaa-Voltti, Kirsi; Peuhkurinen, Keijo; Kortelainen, Marja-Leena; Hassinen, Ilmo E; Majamaa, Kari

    2002-01-01

    Background Tissues that depend on aerobic energy metabolism suffer most in diseases caused by mutations in mitochondrial DNA (mtDNA). Cardiac abnormalities have been described in many cases, but their frequency and clinical spectrum among patients with mtDNA mutations is unknown. Methods Thirty-nine patients with the 3243A>G mtDNA mutation were examined, methods used included clinical evaluation, electrocardiogram, Holter recording and echocardiography. Autopsy reports on 17 deceased subjects were also reviewed. The degree of 3243A>G mutation heteroplasmy was determined using an Apa I restriction fragment analysis. Better hearing level (BEHL0.5–4 kHz) was used as a measure of the clinical severity of disease. Results Left ventricular hypertrophy (LVH) was diagnosed in 19 patients (56%) by echocardiography and in six controls (15%) giving an odds ratio of 7.5 (95% confidence interval; 1.74–67). The dimensions of the left ventricle suggested a concentric hypertrophy. Left ventricular systolic or diastolic dysfunction was observed in 11 patients. Holter recording revealed frequent ventricular extrasystoles (>10/h) in five patients. Patients with LVH differed significantly from those without LVH in BEHL0.5–4 kHz, whereas the contribution of age or the degree of the mutant heteroplasmy in skeletal muscle to the risk of LVH was less remarkable. Conclusions Structural and functional abnormalities of the heart were common in patients with 3243A>G. The risk of LVH was related to the clinical severity of the phenotype, and to a lesser degree to age, suggesting that patients presenting with any symptoms from the mutation should also be evaluated for cardiac abnormalities. PMID:12150714

  3. New truncation mutation of the NR2E3 gene in a Japanese patient with enhanced S-cone syndrome.

    PubMed

    Kuniyoshi, Kazuki; Hayashi, Takaaki; Sakuramoto, Hiroyuki; Mishima, Hiroshi; Tsuneoka, Hiroshi; Tsunoda, Kazushige; Iwata, Takeshi; Shimomura, Yoshikazu

    2016-11-01

    The enhanced S-cone syndrome (ESCS) is a rare hereditary retinal degeneration that has enhanced short wavelength-sensitive cone (S-cone) functions. The longitudinal clinical course of this disease has been rarely reported, and the genetic aspects of ESCS have not been well investigated in the Japanese population. In this report, we present our clinical and genetic findings for 2 patients with ESCS. The patients were 2 unrelated Japanese men. Standard ophthalmic examinations and mutation screening for the NR2E3 gene were performed. Patient 1 was a 36-year-old man, and his clinical findings were typical of ESCS. His decimal best-corrected visual acuity (BCVA) was 1.0 OD and 0.5 OS after removal of cataracts. Genetic investigations revealed a homozygous truncation frameshift, the p.I307LfsX33 mutation. Patient 2 was an 11-year-old boy when he was first examined by us. His clinical findings were typical of ESCS except for uveitis in the left eye. His decimal BCVA at the age of 39 years was maintained at 1.5 in each eye, although the retinal degeneration and visual field impairments had progressed during the follow-up period. The genetic investigations revealed homozygous mutations of p.R104Q in the NR2E3 gene. The frameshift mutation, p.I307LfsX33, in the NR2E3 gene is a new causative mutation for ESCS. The clinical observations for patient 2 are the longest ever reported. The retinal degeneration caused by this mutation is slowly progressive, and these patients maintained good vision with maintenance of the foveal structure until their late thirties.

  4. JAK and MPL mutations in myeloid malignancies.

    PubMed

    Tefferi, Ayalew

    2008-03-01

    The Janus family of non-receptor tyrosine kinases (JAK1, JAK2, JAK3 and tyrosine kinase 2) transduces signals downstream of type I and II cytokine receptors via signal transducers and activators of transcription (STATs). JAK3 is important in lymphoid and JAK2 in myeloid cell proliferation and differentiation. The thrombopoietin receptor MPL is one of several JAK2 cognate receptors and is essential for myelopoiesis in general and megakaryopoiesis in particular. Germline loss-of-function (LOF) JAK3 and MPL mutations cause severe combined immunodeficiency and congenital amegakaryocytic thrombocytopenia, respectively. Germline gain-of-function (GOF) MPL mutation (MPLS505N) causes familial thrombocytosis. Somatic JAK3 (e.g. JAK3A572V, JAK3V722I, JAK3P132T) and fusion JAK2 (e.g. ETV6-JAK2, PCM1-JAK2, BCR-JAK2) mutations have respectively been described in acute megakaryocytic leukemia and acute leukemia/chronic myeloid malignancies. However, current attention is focused on JAK2 (e.g. JAK2V617F, JAK2 exon 12 mutations) and MPL (e.g. MPLW515L/K/S, MPLS505N) mutations associated with myeloproliferative neoplasms (MPNs). A JAK2 mutation, primarily JAK2V617F, is invariably associated with polycythemia vera (PV). The latter mutation also occurs in the majority of patients with essential thrombocythemia (ET) or primary myelofibrosis (PMF). MPL mutational frequency in MPNs is substantially less (<10%). In general, despite a certain degree of genotype - phenotype correlations, the prognostic relevance of harbouring one of these mutations, or their allele burden when present, remains dubious. Regardless, based on the logical assumption that amplified JAK-STAT signalling is central to the pathogenesis of PV, ET and PMF, several anti-JAK2 tyrosine kinase inhibitors have been developed and are currently being tested in humans with these disorders.

  5. [Genotyping of BRCA1, BRCA2 and CHEK2 germline mutations in Russian breast cancer patients using diagnostic biochips].

    PubMed

    Nasedkina, T V; Gromyko, O E; Emel'ianova, M A; Ignatova, E O; Kazubskaia, T P; Portnoĭ, S M; Zasedatelev, A S; Liubchenko, L N

    2014-01-01

    Germline mutations of BRCA1/2 genes cause the predisposition of their carriers to breast or/and ovary cancers (BC or/and OC) during the lifetime. Identification of these mutations is a basis of molecular diagnosis for BC susceptibility. Rapid genotyping technique using microarrays for identification of BRCA1 185delAG, 300T>G, 4153delA, 5382insC mutations and 4158 A>G sequence variant; BRCA2 695insT and 6174delT mutations; 1100delC mutation in CHEK2 gene was applied for 412 randomly collected breast cancer samples from the central region of European area of Russia. In 25 (6.0%) patients (6.0%) BC was associated with other tumours: OC, cervical cancer, colorectal cancer etc. BRCA1/2 and CHEK2 mutations were found in 33 (8.0%) BC patients. The most frequent mutation was BRCA1 5382insC, occurred in 16 (3.9%) BC patients, and CHEK2 1100delC, revealed in 7 (1.7%) BC patients. An application of diagnostic BC-microarray for genetic testing of BRCA1/2 and CHEK2 founder mutations has been discussed.

  6. SPECTRUM AND MORPHOLOGY OF THE TWO BRIGHTEST MILAGRO SOURCES IN THE CYGNUS REGION: MGRO J2019+37 AND MGRO J2031+41

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Abdo, A. A.; Abeysekara, U.; Linnemann, J. T.

    2012-07-10

    The Cygnus region is a very bright and complex portion of the TeV sky, host to unidentified sources and a diffuse excess with respect to conventional cosmic-ray propagation models. Two of the brightest TeV sources, MGRO J2019+37 and MGRO J2031+41, are analyzed using Milagro data with a new technique, and their emission is tested under two different spectral assumptions: a power law and a power law with an exponential cutoff. The new analysis technique is based on an energy estimator that uses the fraction of photomultiplier tubes in the observatory that detect the extensive air shower. The photon spectrum ismore » measured in the range 1-100 TeV using the last three years of Milagro data (2005-2008), with the detector in its final configuration. An F-test indicates that MGRO J2019+37 is better fit by a power law with an exponential cutoff than by a simple power law. The best-fitting parameters for the power law with exponential cutoff model are a normalization at 10 TeV of 7{sup +5}{sub -2} Multiplication-Sign 10{sup -10} s{sup -1} m{sup -2} TeV{sup -1}, a spectral index of 2.0{sup +0.5}{sub -1.0}, and a cutoff energy of 29{sup +50}{sub -16} TeV. MGRO J2031+41 shows no evidence of a cutoff. The best-fitting parameters for a power law are a normalization of 2.1{sup +0.6}{sub -0.6} Multiplication-Sign 10{sup -10} s{sup -1} m{sup -2} TeV{sup -1} and a spectral index of 3.22{sup +0.23}{sub -0.18}. The overall flux is subject to a {approx}30% systematic uncertainty. The systematic uncertainty on the power-law indices is {approx}0.1. Both uncertainties have been verified with cosmic-ray data. A comparison with previous results from TeV J2032+4130, MGRO J2031+41, and MGRO J2019+37 is also presented.« less

  7. Spectrum and Morphology of the Two Brightest Milagro Sources in the Cygnus Region: MGRO J2019+37 and MGRO J2031+41

    NASA Astrophysics Data System (ADS)

    Abdo, A. A.; Abeysekara, U.; Allen, B. T.; Aune, T.; Berley, D.; Bonamente, E.; Christopher, G. E.; DeYoung, T.; Dingus, B. L.; Ellsworth, R. W.; Galbraith-Frew, J. G.; Gonzalez, M. M.; Goodman, J. A.; Hoffman, C. M.; Hüntemeyer, P. H.; Hui, C. M.; Kolterman, B. E.; Linnemann, J. T.; McEnery, J. E.; Mincer, A. I.; Morgan, T.; Nemethy, P.; Pretz, J.; Ryan, J. M.; Saz Parkinson, P. M.; Shoup, A.; Sinnis, G.; Smith, A. J.; Vasileiou, V.; Walker, G. P.; Williams, D. A.; Yodh, G. B.

    2012-07-01

    The Cygnus region is a very bright and complex portion of the TeV sky, host to unidentified sources and a diffuse excess with respect to conventional cosmic-ray propagation models. Two of the brightest TeV sources, MGRO J2019+37 and MGRO J2031+41, are analyzed using Milagro data with a new technique, and their emission is tested under two different spectral assumptions: a power law and a power law with an exponential cutoff. The new analysis technique is based on an energy estimator that uses the fraction of photomultiplier tubes in the observatory that detect the extensive air shower. The photon spectrum is measured in the range 1-100 TeV using the last three years of Milagro data (2005-2008), with the detector in its final configuration. An F-test indicates that MGRO J2019+37 is better fit by a power law with an exponential cutoff than by a simple power law. The best-fitting parameters for the power law with exponential cutoff model are a normalization at 10 TeV of 7+5 -2 × 10-10 s-1 m-2 TeV-1, a spectral index of 2.0+0.5 -1.0, and a cutoff energy of 29+50 -16 TeV. MGRO J2031+41 shows no evidence of a cutoff. The best-fitting parameters for a power law are a normalization of 2.1+0.6 -0.6 × 10-10 s-1 m-2 TeV-1 and a spectral index of 3.22+0.23 -0.18. The overall flux is subject to a ~30% systematic uncertainty. The systematic uncertainty on the power-law indices is ~0.1. Both uncertainties have been verified with cosmic-ray data. A comparison with previous results from TeV J2032+4130, MGRO J2031+41, and MGRO J2019+37 is also presented.

  8. Identification of ALK germline mutation (3605delG) in pediatric anaplastic medulloblastoma.

    PubMed

    Coco, Simona; De Mariano, Marilena; Valdora, Francesca; Servidei, Tiziana; Ridola, Vita; Andolfo, Immacolata; Oberthuer, André; Tonini, Gian Paolo; Longo, Luca

    2012-10-01

    The anaplastic lymphoma kinase (ALK) gene has been found either rearranged or mutated in several neoplasms such as anaplastic large-cell lymphoma, non-small-cell lung cancer, neuroblastoma and anaplastic thyroid cancer. Medulloblastoma (MB) is an embryonic pediatric cancer arising from nervous system, a tissue in which ALK is expressed during embryonic development. We performed an ALK mutation screening in 52 MBs and we found a novel heterozygous germline deletion of a single base in exon 23 (3605delG) in a case with marked anaplasia. This G deletion results in a frameshift mutation producing a premature stop codon in exon 25 of ALK tyrosine kinase domain. We also screened three human MB cell lines without finding any mutation of ALK gene. Quantitative expression analysis of 16 out of 52 samples showed overexpression of ALK mRNA in three MBs. In the present study, we report the first mutation of ALK found in MB. Moreover, a deletion of ALK gene producing a stop codon has not been detected in human tumors up to now. Further investigations are now required to elucidate whether the truncated form of ALK may have a role in signal transduction.

  9. A Mutation in PGM2 Causing Inefficient Galactose Metabolism in the Probiotic Yeast Saccharomyces boulardii.

    PubMed

    Liu, Jing-Jing; Zhang, Guo-Chang; Kong, In Iok; Yun, Eun Ju; Zheng, Jia-Qi; Kweon, Dae-Hyuk; Jin, Yong-Su

    2018-05-15

    The probiotic yeast Saccharomyces boulardii has been extensively studied for the prevention and treatment of diarrheal diseases, and it is now commercially available in some countries. S. boulardii displays notable phenotypic characteristics, such as a high optimal growth temperature, high tolerance against acidic conditions, and the inability to form ascospores, which differentiate S. boulardii from Saccharomyces cerevisiae The majority of prior studies stated that S. boulardii exhibits sluggish or halted galactose utilization. Nonetheless, the molecular mechanisms underlying inefficient galactose uptake have yet to be elucidated. When the galactose utilization of a widely used S. boulardii strain, ATCC MYA-796, was examined under various culture conditions, the S. boulardii strain could consume galactose, but at a much lower rate than that of S. cerevisiae While all GAL genes were present in the S. boulardii genome, according to analysis of genomic sequencing data in a previous study, a point mutation (G1278A) in PGM2 , which codes for phosphoglucomutase, was identified in the genome of the S. boulardii strain. As the point mutation resulted in the truncation of the Pgm2 protein, which is known to play a pivotal role in galactose utilization, we hypothesized that the truncated Pgm2 might be associated with inefficient galactose metabolism. Indeed, complementation of S. cerevisiae PGM2 in S. boulardii restored galactose utilization. After reverting the point mutation to a full-length PGM2 in S. boulardii by Cas9-based genome editing, the growth rates of wild-type (with a truncated PGM2 gene) and mutant (with a full-length PGM2 ) strains with glucose or galactose as the carbon source were examined. As expected, the mutant (with a full-length PGM2 ) was able to ferment galactose faster than the wild-type strain. Interestingly, the mutant showed a lower growth rate than that of the wild-type strain on glucose at 37°C. Also, the wild-type strain was enriched in the

  10. HER2 activating mutations are targets for colorectal cancer treatment.

    PubMed

    Kavuri, Shyam M; Jain, Naveen; Galimi, Francesco; Cottino, Francesca; Leto, Simonetta M; Migliardi, Giorgia; Searleman, Adam C; Shen, Wei; Monsey, John; Trusolino, Livio; Jacobs, Samuel A; Bertotti, Andrea; Bose, Ron

    2015-08-01

    The Cancer Genome Atlas project identified HER2 somatic mutations and gene amplification in 7% of patients with colorectal cancer. Introduction of the HER2 mutations S310F, L755S, V777L, V842I, and L866M into colon epithelial cells increased signaling pathways and anchorage-independent cell growth, indicating that they are activating mutations. Introduction of these HER2 activating mutations into colorectal cancer cell lines produced resistance to cetuximab and panitumumab by sustaining MAPK phosphorylation. HER2 mutants are potently inhibited by low nanomolar doses of the irreversible tyrosine kinase inhibitors neratinib and afatinib. HER2 gene sequencing of 48 cetuximab-resistant, quadruple (KRAS, NRAS, BRAF, and PIK3CA) wild-type (WT) colorectal cancer patient-derived xenografts (PDX) identified 4 PDXs with HER2 mutations. HER2-targeted therapies were tested on two PDXs. Treatment with a single HER2-targeted drug (trastuzumab, neratinib, or lapatinib) delayed tumor growth, but dual HER2-targeted therapy with trastuzumab plus tyrosine kinase inhibitors produced regression of these HER2-mutated PDXs. HER2 activating mutations cause EGFR antibody resistance in colorectal cell lines, and PDXs with HER2 mutations show durable tumor regression when treated with dual HER2-targeted therapy. These data provide a strong preclinical rationale for clinical trials targeting HER2 activating mutations in metastatic colorectal cancer. ©2015 American Association for Cancer Research.

  11. SALL2 represses cyclins D1 and E1 expression and restrains G1/S cell cycle transition and cancer-related phenotypes.

    PubMed

    E Hermosilla, Viviana; Salgado, Ginessa; Riffo, Elizabeth; Escobar, David; Hepp, Matías I; Farkas, Carlos; Galindo, Mario; Morín, Violeta; García-Robles, María A; Castro, Ariel F; Pincheira, Roxana

    2018-04-24

    SALL2 is a poorly characterized transcription factor that belongs to the Spalt-like family involved in development. Mutations on SALL2 have been associated with ocular coloboma and cancer. In cancers, SALL2 is deregulated and is proposed as a tumor suppressor in ovarian cancer. SALL2 has been implicated in stemness, cell death, proliferation, and quiescence. However, mechanisms underlying roles of SALL2 related to cancer remain largely unknown. Here, we investigated the role of SALL2 in cell proliferation using mouse embryo fibroblasts (MEFs) derived from Sall2 -/- mice. Compared to Sall2 +/+ MEFs, Sall2 -/- MEFs exhibit enhanced cell proliferation and faster postmitotic progression through G1 and S phases. Accordingly, Sall2 -/- MEFs exhibit higher mRNA and protein levels of cyclins D1 and E1. Chromatin immunoprecipitation and promoter reporter assays showed that SALL2 binds and represses CCND1 and CCNE1 promoters, identifying a novel mechanism by which SALL2 may control cell cycle. In addition, the analysis of tissues from Sall2 +/+ and Sall2 -/- mice confirmed the inverse correlation between expression of SALL2 and G1-S cyclins. Consistent with an antiproliferative function of SALL2, immortalized Sall2 -/- MEFs showed enhanced growth rate, foci formation, and anchorage-independent growth, confirming tumor suppressor properties for SALL2. Finally, cancer data analyses show negative correlations between SALL2 and G1-S cyclins' mRNA levels in several cancers. Altogether, our results demonstrated that SALL2 is a negative regulator of cell proliferation, an effect mediated in part by repression of G1-S cyclins' expression. Our results have implications for the understanding and significance of SALL2 role under physiological and pathological conditions. © 2018 The Authors. Published by FEBS Press and John Wiley & Sons Ltd.

  12. An association study between CHEK2 gene mutations and susceptibility to breast cancer.

    PubMed

    Jalilvand, Manizheh; Oloomi, Mana; Najafipour, Reza; Alizadeh, Safar Ali; Saki, Najmaldin; Rad, Fatemeh Samiee; Shekari, Mohammad

    2017-01-01

    CHEK2 gene is known as a tumor suppressor gene in breast cancer (BC), which plays a role in DNA repair. The germ line mutations in CEHK2 have been associated with different types of cancer. The present study was aimed at studying the association between CHEK2 mutations and BC. Peripheral blood was collected from patients into a test tube containing EDTA, and DNA was extracted from blood samples. Then, we analyzed mutations including 1100delc, IVS2+1>A, del5395bp, and I157T within CHEK2 gene in patients with BC and 100 normal healthy controls according to PCR-RFLP, allelic specific PCR, and multiplex-PCR. Although IVS2+1G>A mutation within CHEK2 gene was found in two BC patients, other defined mutants were not detected. For the first time, we identified CHEK2 IVS2+1G>A mutation, one out of four different CHEK2 alterations in two Iranian BC patients (2%). Also, our results showed that CHEK2 1100elC, del5395bp, and I157T mutations are not associated with genetic susceptibility for BC among Iranian population.

  13. ABCG5/G8 gene is associated with hypercholesterolemias without mutation in candidate genes and noncholesterol sterols.

    PubMed

    Lamiquiz-Moneo, Itziar; Baila-Rueda, Lucía; Bea, Ana M; Mateo-Gallego, Rocío; Pérez-Calahorra, Sofía; Marco-Benedí, Victoria; Martín-Navarro, Antonio; Ros, Emilio; Cofán, Montserrat; Rodríguez-Rey, José Carlos; Pocovi, Miguel; Cenarro, Ana; Civeira, Fernando

    Approximately 20% to 40% of clinically defined familial hypercholesterolemia (FH) cases do not show a causative mutation in candidate genes (mutation-negative FH), and some of them may have a polygenic origin. The aim of this work was to study the prevalence of ABCG5/G8 genetic variants in mutation-negative FH, as defects in these genes relate to intestinal hyperabsorption of cholesterol and thus ABCG5/G8 variants could explain in part the mechanism of hypercholesterolemia. We sequenced the ABCG5/G8 genes in 214 mutation-negative FH and 97 controls. Surrogate markers of cholesterol absorption (5α-cholestanol, β-sitosterol, campesterol, stigmasterol, and sitostanol) were quantified by high-performance liquid chromatography-tandem mass spectrometry in both studied groups. We found 8 mutation-negative FH patients (3.73%) with a pathogenic mutation in ABCG5/G8 genes. We observed significantly higher concentration of surrogate markers of cholesterol absorption in mutation-negative FH than in controls. In addition, we found significantly higher concentrations of cholesterol absorption markers in mutation-negative FH with ABCG5/G8 defects than in mutation-negative, ABCG5/G8-negative FH. A gene score reflecting the number of common single nucleotide variants associated with hypercholesterolemia was significantly higher in cases than in controls (P = .032). Subjects with a gene score above the mean had significantly higher 5α-cholestanol and stigmasterol than those with a lower gene score. Mutation-negative FH subjects accumulate an excess of rare and common gene variations in ABCG5/G8 genes. This variation is associated with increased intestinal absorption of cholesterol, as determined by surrogate makers, suggesting that these loci contribute to hypercholesterolemia by enhancing intestinal cholesterol absorption. Copyright © 2017 National Lipid Association. Published by Elsevier Inc. All rights reserved.

  14. Common pathogenic effects of missense mutations in the P-type ATPase ATP13A2 (PARK9) associated with early-onset parkinsonism.

    PubMed

    Podhajska, Agata; Musso, Alessandra; Trancikova, Alzbeta; Stafa, Klodjan; Moser, Roger; Sonnay, Sarah; Glauser, Liliane; Moore, Darren J

    2012-01-01

    Mutations in the ATP13A2 gene (PARK9) cause autosomal recessive, juvenile-onset Kufor-Rakeb syndrome (KRS), a neurodegenerative disease characterized by parkinsonism. KRS mutations produce truncated forms of ATP13A2 with impaired protein stability resulting in a loss-of-function. Recently, homozygous and heterozygous missense mutations in ATP13A2 have been identified in subjects with early-onset parkinsonism. The mechanism(s) by which missense mutations potentially cause parkinsonism are not understood at present. Here, we demonstrate that homozygous F182L, G504R and G877R missense mutations commonly impair the protein stability of ATP13A2 leading to its enhanced degradation by the proteasome. ATP13A2 normally localizes to endosomal and lysosomal membranes in neurons and the F182L and G504R mutations disrupt this vesicular localization and promote the mislocalization of ATP13A2 to the endoplasmic reticulum. Heterozygous T12M, G533R and A746T mutations do not obviously alter protein stability or subcellular localization but instead impair the ATPase activity of microsomal ATP13A2 whereas homozygous missense mutations disrupt the microsomal localization of ATP13A2. The overexpression of ATP13A2 missense mutants in SH-SY5Y neural cells does not compromise cellular viability suggesting that these mutant proteins lack intrinsic toxicity. However, the overexpression of wild-type ATP13A2 may impair neuronal integrity as it causes a trend of reduced neurite outgrowth of primary cortical neurons, whereas the majority of disease-associated missense mutations lack this ability. Finally, ATP13A2 overexpression sensitizes cortical neurons to neurite shortening induced by exposure to cadmium or nickel ions, supporting a functional interaction between ATP13A2 and heavy metals in post-mitotic neurons, whereas missense mutations influence this sensitizing effect. Collectively, our study provides support for common loss-of-function effects of homozygous and heterozygous missense

  15. Common Pathogenic Effects of Missense Mutations in the P-Type ATPase ATP13A2 (PARK9) Associated with Early-Onset Parkinsonism

    PubMed Central

    Podhajska, Agata; Musso, Alessandra; Trancikova, Alzbeta; Stafa, Klodjan; Moser, Roger; Sonnay, Sarah; Glauser, Liliane; Moore, Darren J.

    2012-01-01

    Mutations in the ATP13A2 gene (PARK9) cause autosomal recessive, juvenile-onset Kufor-Rakeb syndrome (KRS), a neurodegenerative disease characterized by parkinsonism. KRS mutations produce truncated forms of ATP13A2 with impaired protein stability resulting in a loss-of-function. Recently, homozygous and heterozygous missense mutations in ATP13A2 have been identified in subjects with early-onset parkinsonism. The mechanism(s) by which missense mutations potentially cause parkinsonism are not understood at present. Here, we demonstrate that homozygous F182L, G504R and G877R missense mutations commonly impair the protein stability of ATP13A2 leading to its enhanced degradation by the proteasome. ATP13A2 normally localizes to endosomal and lysosomal membranes in neurons and the F182L and G504R mutations disrupt this vesicular localization and promote the mislocalization of ATP13A2 to the endoplasmic reticulum. Heterozygous T12M, G533R and A746T mutations do not obviously alter protein stability or subcellular localization but instead impair the ATPase activity of microsomal ATP13A2 whereas homozygous missense mutations disrupt the microsomal localization of ATP13A2. The overexpression of ATP13A2 missense mutants in SH-SY5Y neural cells does not compromise cellular viability suggesting that these mutant proteins lack intrinsic toxicity. However, the overexpression of wild-type ATP13A2 may impair neuronal integrity as it causes a trend of reduced neurite outgrowth of primary cortical neurons, whereas the majority of disease-associated missense mutations lack this ability. Finally, ATP13A2 overexpression sensitizes cortical neurons to neurite shortening induced by exposure to cadmium or nickel ions, supporting a functional interaction between ATP13A2 and heavy metals in post-mitotic neurons, whereas missense mutations influence this sensitizing effect. Collectively, our study provides support for common loss-of-function effects of homozygous and heterozygous missense

  16. Antitumor effects and molecular mechanisms of ponatinib on endometrial cancer cells harboring activating FGFR2 mutations

    PubMed Central

    Kim, Do-Hee; Kwak, Yeonui; Kim, Nam Doo; Sim, Taebo

    2016-01-01

    ABSTRACT Aberrant mutational activation of FGFR2 is associated with endometrial cancers (ECs). AP24534 (ponatinib) currently undergoing clinical trials has been known to be an orally available multi-targeted tyrosine kinase inhibitor. Our biochemical kinase assay showed that AP24534 is potent against wild-type FGFR1-4 and 5 mutant FGFRs (V561M-FGFR1, N549H-FGFR2, K650E-FGFR3, G697C-FGFR3, N535K-FGFR4) and possesses the strongest kinase-inhibitory activity on N549H-FGFR2 (IC50 of 0.5 nM) among all FGFRs tested. We therefore investigated the effects of AP24534 on endometrial cancer cells harboring activating FGFR2 mutations and explored the underlying molecular mechanisms. AP24534 significantly inhibited the proliferation of endometrial cancer cells bearing activating FGFR2 mutations (N549K, K310R/N549K, S252W) and mainly induced G1/S cell cycle arrest leading to apoptosis. AP24534 also diminished the kinase activity of immunoprecipitated FGFR2 derived from MFE-296 and MFE-280 cells and reduced the phosphorylation of FGFR2 and FRS2 on MFE-296 and AN3CA cells. AP24534 caused substantial reductions in ERK phosphorylation, PLCγ signaling and STAT5 signal transduction on ECs bearing FGFR2 activating mutations. Akt signaling pathway was also deactivated by AP24534. AP24534 causes the chemotherapeutic effect through mainly the blockade of ERK, PLCγ and STAT5 signal transduction on ECs. Moreover, AP24534 inhibited migration and invasion of endometrial cancer cells with FGFR2 mutations. In addition, AP24534 significantly blocked anchorage-independent growth of endometrial cancer cells. We, for the first time, report the molecular mechanisms by which AP24534 exerts antitumor effects on ECs with FGFR2 activating mutations, which would provide mechanistic insight into ongoing clinical investigations of AP24534 for ECs. PMID:26574622

  17. Familial hypertrophic cardiomyopathy: functional effects of myosin mutation R723G in cardiomyocytes.

    PubMed

    Kraft, Theresia; Witjas-Paalberends, E Rosalie; Boontje, Nicky M; Tripathi, Snigdha; Brandis, Almuth; Montag, Judith; Hodgkinson, Julie L; Francino, Antonio; Navarro-Lopez, Francisco; Brenner, Bernhard; Stienen, Ger J M; van der Velden, Jolanda

    2013-04-01

    Familial Hypertrophic Cardiomyopathy (FHC) is frequently caused by mutations in the β-cardiac myosin heavy chain (β-MyHC). To identify changes in sarcomeric function triggered by such mutations, distinguishing mutation effects from other functional alterations of the myocardium is essential. We previously identified a direct effect of mutation R723G (MyHC723) on myosin function in slow Musculus soleus fibers. Here we investigate contractile features of left ventricular cardiomyocytes of FHC-patients with the same MyHC723-mutation and compare these to the soleus data. In mechanically isolated, triton-permeabilized MyHC723-cardiomyocytes, maximum force was significantly lower but calcium-sensitivity was unchanged compared to donor. Conversely, MyHC723-soleus fibers showed significantly higher maximum force and reduced calcium-sensitivity compared to controls. Protein phosphorylation, a potential myocardium specific modifying mechanism, might account for differences compared to soleus fibers. Analysis revealed reduced phosphorylation of troponin I and T, myosin-binding-protein C, and myosin-light-chain 2 in MyHC723-myocardium compared to donor. Saturation of protein-kinaseA phospho-sites led to comparable, i.e., reduced MyHC723-calcium-sensitivity in cardiomyocytes as in M. soleus fibers, while maximum force remained reduced. Myofibrillar disarray and lower density of myofibrils, however, largely account for reduced maximum force in MyHC723-cardiomyocytes. The changes seen when phosphorylation of sarcomeric proteins in myocardium of affected patients is matched to control tissue suggest that the R723G mutation causes reduced Ca(++)-sensitivity in both cardiomyocytes and M. soleus fibers. In MyHC723-myocardium, however, hypophosphorylation can compensate for the reduced calcium-sensitivity, while maximum force generation, lowered by myofibrillar deficiency and disarray, remains impaired, and may only be compensated by hypertrophy. Copyright © 2013 Elsevier Ltd. All

  18. Mapping of the human cone transducin {alpha} subunit (GNAT2) gene to 1p13 and mutation analysis in patients with Stargardt`s disease

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Magovcevic, I.; Weremowicz, S.; Morton, C.C.

    Transducin {alpha} subunits are members of a large family of G-proteins and play an important role in phototransduction in rod and cone photoreceptors. We report the localization of the human cone {alpha} transducin (GNAT2) gene using fluorescence in situ hybridization (FISH) on chromosome 1 in band p13. The recent assignment of a gene for Stargardt`s disease to the same chromosomal region by linkage analysis prompted us to investigate the possible role of GNAT2 in the pathogenesis of this disease. Stargardt`s disease is characterized by degeneration in late childhood or early adulthood of the macula of the retina, a region richmore » in cones. We screened patients with Stargardt`s disease, with or without peripheral cone involvement as monitored by the full-field ERG, for mutations in this gene. We investigated 66 unrelated patients including 22 with peripheral cone dysfunction for mutations in the coding region of the GNAT2 gene using polymerase chain reaction-single strand conformation polymorphism analysis (SSCP) and direct sequencing. One patient (034-16) was heterozygous for a silent change in exon VI, Asp238Asp (GAT to GAC). Two patients, one (035-005) with peripheral cone involvement and one (071-001) without peripheral cone involvement, were heterozygous for the missense change Val124Met (GTG to ATG) in exon IV. A subsequent screen of 96 unrelated, unaffected controls revealed one individual (N10) who was also heterozygous for the Val124Met alteration. We concluded that Asp238Asp and Val124Met are rare variants not causing Stargardt`s disease. Hence, no disease-specific mutations were found indicating that GNAT2 is probably not involved in the pathogenesis of most cases of Stargardt`s disease.« less

  19. Coinheritance of a novel mutation on the HBA1 gene: c.187delG (p.W62fsX66) [codon 62 (-G) (α1)] with the α212 patchwork allele and Hb S [β6(A3)Glu→Val, GAG>GTG; HBB: c.20A>T].

    PubMed

    Scheps, Karen G; De Paula, Silvia M; Bitsman, Alicia R; Freigeiro, Daniel H; Basack, F Nora; Pennesi, Sandra P; Varela, Viviana

    2013-01-01

    We describe a novel frameshift mutation on the HBA1 gene (c.187delG), causative of α-thalassemia (α-thal) in a Black Cuban family with multiple sequence variants in the HBA genes and the Hb S [β6(A3)Glu→Val, GAG>GTG; HBB: c.20A>T] mutation. The deletion of the first base of codon 62 resulted in a frameshift at amino acid 62 with a putative premature termination codon (PTC) at amino acid 66 on the same exon (p.W62fsX66), which most likely triggers nonsense mediated decay of the resulting mRNA. This study also presents the first report of the α212 patchwork allele in Latin America and the description of two new sequence variants in the HBA2 region (c.-614G>A in the promoter region and c.95+39 C>T on the first intron).

  20. Mutated form (G52E) of inactive diphtheria toxin CRM197: molecular simulations clearly display effect of the mutation to NAD binding.

    PubMed

    Salmas, Ramin Ekhteiari; Mestanoglu, Mert; Unlu, Ayhan; Yurtsever, Mine; Durdagi, Serdar

    2016-11-01

    Mutated form (G52E) of diphtheria toxin (DT) CRM197 is an inactive and nontoxic enzyme. Here, we provided a molecular insight using comparative molecular dynamics (MD) simulations to clarify the influence of a single point mutation on overall protein and active-site loop. Post-processing MD analysis (i.e. stability, principal component analysis, hydrogen-bond occupancy, etc.) is carried out on both wild and mutated targets to investigate and to better understand the mechanistic differences of structural and dynamical properties on an atomic scale especially at nicotinamide adenine dinucleotide (NAD) binding site when a single mutation (G52E) happens at the DT. In addition, a docking simulation is performed for wild and mutated forms. The docking scoring analysis and docking poses results revealed that mutant form is not able to properly accommodate the NAD molecule.

  1. Distinct clinical and neuropathological features of G51D SNCA mutation cases compared with SNCA duplication and H50Q mutation.

    PubMed

    Kiely, Aoife P; Ling, Helen; Asi, Yasmine T; Kara, Eleanna; Proukakis, Christos; Schapira, Anthony H; Morris, Huw R; Roberts, Helen C; Lubbe, Steven; Limousin, Patricia; Lewis, Patrick A; Lees, Andrew J; Quinn, Niall; Hardy, John; Love, Seth; Revesz, Tamas; Houlden, Henry; Holton, Janice L

    2015-08-27

    We and others have described the neurodegenerative disorder caused by G51D SNCA mutation which shares characteristics of Parkinson's disease (PD) and multiple system atrophy (MSA). The objective of this investigation was to extend the description of the clinical and neuropathological hallmarks of G51D mutant SNCA-associated disease by the study of two additional cases from a further G51D SNCA kindred and to compare the features of this group with a SNCA duplication case and a H50Q SNCA mutation case. All three G51D patients were clinically characterised by parkinsonism, dementia, visual hallucinations, autonomic dysfunction and pyramidal signs with variable age at disease onset and levodopa response. The H50Q SNCA mutation case had a clinical picture that mimicked late-onset idiopathic PD with a good and sustained levodopa response. The SNCA duplication case presented with a clinical phenotype of frontotemporal dementia with marked behavioural changes, pyramidal signs, postural hypotension and transiently levodopa responsive parkinsonism. Detailed post-mortem neuropathological analysis was performed in all cases. All three G51D cases had abundant α-synuclein pathology with characteristics of both PD and MSA. These included widespread cortical and subcortical neuronal α-synuclein inclusions together with small numbers of inclusions resembling glial cytoplasmic inclusions (GCIs) in oligodendrocytes. In contrast the H50Q and SNCA duplication cases, had α-synuclein pathology resembling idiopathic PD without GCIs. Phosphorylated α-synuclein was present in all inclusions types in G51D cases but was more restricted in SNCA duplication and H50Q mutation. Inclusions were also immunoreactive for the 5G4 antibody indicating their highly aggregated and likely fibrillar state. Our characterisation of the clinical and neuropathological features of the present small series of G51D SNCA mutation cases should aid the recognition of this clinico-pathological entity. The

  2. Rapid detection of G6PD mutations by multicolor melting curve analysis.

    PubMed

    Xia, Zhongmin; Chen, Ping; Tang, Ning; Yan, Tizhen; Zhou, Yuqiu; Xiao, Qizhi; Huang, Qiuying; Li, Qingge

    2016-09-01

    The MeltPro G6PD assay is the first commercial genetic test for glucose-6-phosphate dehydrogenase (G6PD) deficiency. This multicolor melting curve analysis-based real-time PCR assay is designed to genotype 16 G6PD mutations prevalent in the Chinese population. We comprehensively evaluated both the analytical and clinical performances of this assay. All 16 mutations were accurately genotyped, and the standard deviation of the measured Tm was <0.3°C. The limit of detection was 1.0ng/μL human genomic DNA. The assay could be run on four mainstream models of real-time PCR machines. The shortest running time (150min) was obtained with LightCycler 480 II. A clinical study using 763 samples collected from three hospitals indicated that, of 433 samples with reduced G6PD activity, the MeltPro assay identified 423 samples as mutant, yielding a clinical sensitivity of 97.7% (423/433). Of the 117 male samples with normal G6PD activity, the MeltPro assay confirmed that 116 samples were wild type, yielding a clinical specificity of 99.1% (116/117). Moreover, the MeltPro assay demonstrated 100% concordance with DNA sequencing for all targeted mutations. We concluded that the MeltPro G6PD assay is useful as a diagnostic or screening tool for G6PD deficiency in clinical settings. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Genetics in Parkinson disease: Mendelian versus non-Mendelian inheritance.

    PubMed

    Hernandez, Dena G; Reed, Xylena; Singleton, Andrew B

    2016-10-01

    Parkinson's disease is a common, progressive neurodegenerative disorder, affecting 3% of those older than 75 years of age. Clinically, Parkinson's disease (PD) is associated with resting tremor, postural instability, rigidity, bradykinesia, and a good response to levodopa therapy. Over the last 15 years, numerous studies have confirmed that genetic factors contribute to the complex pathogenesis of PD. Highly penetrant mutations producing rare, monogenic forms of the disease have been discovered in singular genes such as SNCA, Parkin, DJ-1, PINK 1, LRRK2, and VPS35. Unique variants with incomplete penetrance in LRRK2 and GBA have been shown to be strong risk factors for PD in certain populations. Additionally, over 20 common variants with small effect sizes are now recognized to modulate the risk for PD. Investigating Mendelian forms of PD has provided precious insight into the pathophysiology that underlies the more common idiopathic form of disease; however, no treatment methodologies have developed. Furthermore, for identified common risk alleles, the functional basis underlying risk principally remains unknown. The challenge over the next decade will be to strengthen the findings delivered through genetic discovery by assessing the direct, biological consequences of risk variants in tandem with additional high-content, integrated datasets. This review discusses monogenic risk factors and mechanisms of Mendelian inheritance of Parkinson disease. Highly penetrant mutations in SNCA, Parkin, DJ-1, PINK 1, LRRK2 and VPS35 produce rare, monogenic forms of the disease, while unique variants within LRRK2 and GBA show incomplete penetrance and are strong risk factors for PD. Additionally, over 20 common variants with small effect sizes modulate disease risk. The challenge over the next decade is to strengthen genetic findings by assessing direct, biological consequences of risk variants in tandem with high-content, integrated datasets. This article is part of a special

  4. Novel compound heterozygous Thyroglobulin mutations c.745+1G>A/c.7036+2T>A associated with congenital goiter and hypothyroidism in a Vietnamese family. Identification of a new cryptic 5' splice site in the exon 6.

    PubMed

    Citterio, Cintia E; Morales, Cecilia M; Bouhours-Nouet, Natacha; Machiavelli, Gloria A; Bueno, Elena; Gatelais, Frédérique; Coutant, Regis; González-Sarmiento, Rogelio; Rivolta, Carina M; Targovnik, Héctor M

    2015-03-15

    Several patients were identified with dyshormonogenesis caused by mutations in the thyroglobulin (TG) gene. These defects are inherited in an autosomal recessive manner and affected individuals are either homozygous or compound heterozygous for the mutations. The aim of the present study was to identify new TG mutations in a patient of Vietnamese origin affected by congenital hypothyroidism, goiter and low levels of serum TG. DNA sequencing identified the presence of compound heterozygous mutations in the TG gene: the maternal mutation consists of a novel c.745+1G>A (g.IVS6 + 1G>A), whereas the hypothetical paternal mutation consists of a novel c.7036+2T>A (g.IVS40 + 2T>A). The father was not available for segregation analysis. Ex-vivo splicing assays and subsequent RT-PCR analyses were performed on mRNA isolated from the eukaryotic-cells transfected with normal and mutant expression vectors. Minigene analysis of the c.745+1G>A mutant showed that the exon 6 is skipped during pre-mRNA splicing or partially included by use of a cryptic 5' splice site located to 55 nucleotides upstream of the authentic exon 6/intron 6 junction site. The functional analysis of c.7036+2T>A mutation showed a complete skipping of exon 40. The theoretical consequences of splice site mutations, predicted with the bioinformatics tool NNSplice, Fsplice, SPL, SPLM and MaxEntScan programs were investigated and evaluated in relation with the experimental evidence. These analyses predicted that both mutant alleles would result in the abolition of the authentic splice donor sites. The c.745+1G>A mutation originates two putative truncated proteins of 200 and 1142 amino acids, whereas c.7036+2T>A mutation results in a putative truncated protein of 2277 amino acids. In conclusion, we show that the c.745+1G>A mutation promotes the activation of a new cryptic donor splice site in the exon 6 of the TG gene. The functional consequences of these mutations could be structural changes in the protein

  5. A hemizygous GYG2 mutation and Leigh syndrome: a possible link?

    PubMed

    Imagawa, Eri; Osaka, Hitoshi; Yamashita, Akio; Shiina, Masaaki; Takahashi, Eihiko; Sugie, Hideo; Nakashima, Mitsuko; Tsurusaki, Yoshinori; Saitsu, Hirotomo; Ogata, Kazuhiro; Matsumoto, Naomichi; Miyake, Noriko

    2014-02-01

    Leigh syndrome (LS) is an early-onset progressive neurodegenerative disorder characterized by unique, bilateral neuropathological findings in brainstem, basal ganglia, cerebellum and spinal cord. LS is genetically heterogeneous, with the majority of the causative genes affecting mitochondrial malfunction, and many cases still remain unsolved. Here, we report male sibs affected with LS showing ketonemia, but no marked elevation of lactate and pyruvate. To identify their genetic cause, we performed whole exome sequencing. Candidate variants were narrowed down based on autosomal recessive and X-linked recessive models. Only one hemizygous missense mutation (c.665G>C, p.W222S) in glycogenin-2 (GYG2) (isoform a: NM_001079855) in both affected sibs and a heterozygous change in their mother were identified, being consistent with the X-linked recessive trait. GYG2 encodes glycogenin-2 (GYG2) protein, which plays an important role in the initiation of glycogen synthesis. Based on the structural modeling, the mutation can destabilize the structure and result in protein malfunctioning. Furthermore, in vitro experiments showed mutant GYG2 was unable to undergo the self-glucosylation, which is observed in wild-type GYG2. This is the first report of GYG2 mutation in human, implying a possible link between GYG2 abnormality and LS.

  6. Greater risk of parkinsonism associated with non-N370S GBA1 mutations

    PubMed Central

    Giraldo, P.; Capablo, J. L.; Alfonso, P.; Irun, P.; Garcia-Rodriguez, B.; Pocovi, M.; Pastores, G. M.

    2014-01-01

    Mutations in β-glucosidase (GBA1) are the most common genetic risk factor for Parkinson disease (PD). There is evidence to suggest that PD risk is greater (1) in GBA1 heterozygotes with non-N370S GBA1 mutations compared to N370S mutations and (2) in GD type 1 (GD1) patients compared to GBA1 heterozygotes. This study aimed to determine the comparative risk of parkin-sonism in individuals who are affected or carriers of Gaucher disease (GD) and to ascertain the influence of different GBA1 mutations on risk/clinical expression. We conducted a secondary analysis of cross-sectional data assessing the prevalence of parkinsonism in a population of GD1 patients and their heterozygote and non-carrier family members. Two logistic regression models, both employing a family-specific random effect, were used to assess (1) the association between GBA1 mutation (N370S or non-N370S) and parkinsonism among GBA1 heterozygotes and (2) the association between GBA1 genotype and parkinsonism. Parkinsonism was present in 8.6 % of GD1 (7/81), 8.7 % of GBA1 heterozygotes (18/207), and 2.2 % of non-carriers (1/45). For those greater than 60 years old, parkinsonism was present in 38.5 % (5/13) of GD1 (5/13), 15.3 % of GBA1 heterozygotes (13/85), and 7.1 % of non-carriers (1/14). Among GBA1 heterozygotes, non-N370S mutations were associated with a significantly increased risk of parkinsonism compared to N370S (OR=22.5; p=0.035; 95%CI: 1.24, 411). In this population, each additional GBA1 mutation was associated with a non-significant two-fold increased risk of parkinsonism. GBA1 heterozygotes with non-N370S mutations associated with Gaucher disease have an increased risk of parkinsonism compared to those with N370S mutations. PMID:22968580

  7. A novel mutation MT-COIII m.9267G>C and MT-COI m.5913G>A mutation in mitochondrial genes in a Tunisian family with maternally inherited diabetes and deafness (MIDD) associated with severe nephropathy.

    PubMed

    Tabebi, Mouna; Mkaouar-Rebai, Emna; Mnif, Mouna; Kallabi, Fakhri; Ben Mahmoud, Afif; Ben Saad, Wafa; Charfi, Nadia; Keskes-Ammar, Leila; Kamoun, Hassen; Abid, Mohamed; Fakhfakh, Faiza

    2015-04-10

    Mitochondrial diabetes (MD) is a heterogeneous disorder characterized by a chronic hyperglycemia, maternal transmission and its association with a bilateral hearing impairment. Several studies reported mutations in mitochondrial genes as potentially pathogenic for diabetes, since mitochondrial oxidative phosphorylation plays an important role in glucose-stimulated insulin secretion from beta cells. In the present report, we studied a Tunisian family with mitochondrial diabetes (MD) and deafness associated with nephropathy. The mutational analysis screening revealed the presence of a novel heteroplasmic mutation m.9276G>C in the mitochondrial COIII gene, detected in mtDNA extracted from leukocytes of a mother and her two daughters indicating that this mutation is maternally transmitted and suggest its implication in the observed phenotype. Bioinformatic tools showed that m.9267G>C mutation (p.A21P) is « deleterious » and it can modify the function and the stability of the MT-COIII protein by affecting the assembly of mitochondrial COX subunits and the translocation of protons then reducing the activity of the respective OXPHOS complexes of ATP synthesis. The nonsynonymous mutation (p.A21P) has not been reported before, it is the first mutation described in the COXIII gene which is related to insulin dependent mitochondrial diabetes and deafness and could be specific to the Tunisian population. The m.9267G>C mutation was present with a nonsynonymous inherited mitochondrial homoplasmic variation MT-COI m.5913 G>A (D4N) responsible of high blood pressure, a clinical feature detected in all explored patients. Copyright © 2015. Published by Elsevier Inc.

  8. Skewed segregation of the mtDNA nt 8993 (T-->G) mutation in human oocytes.

    PubMed Central

    Blok, R B; Gook, D A; Thorburn, D R; Dahl, H H

    1997-01-01

    Rapid changes in mtDNA variants between generations have led to the bottleneck theory, which proposes a dramatic reduction in mtDNA numbers during early oogenesis. We studied oocytes from a woman with heteroplasmic expression of the mtDNA nt 8993 (T-->G) mutation. Of seven oocytes analyzed, one showed no evidence of the mutation, and the remaining six had a mutant load > 95%. This skewed expression of the mutation in oocytes is not compatible with the conventional bottleneck theory. A possible explanation is that, during amplification of mtDNA in the developing oocyte, mtDNA from one mitochondrion is preferentially amplified. Thus, subsequent mature oocytes may contain predominantly wild-type or mutant mitochondrial genomes. Images Figure 2 Figure 3 PMID:9199572

  9. Leigh Syndrome and the Mitochondrial m.13513G>A Mutation: Expanding the Clinical Spectrum.

    PubMed

    Monlleo-Neila, Laura; Toro, Mireia Del; Bornstein, Belen; Garcia-Arumi, Elena; Sarrias, Axel; Roig-Quilis, Manuel; Munell, Francina

    2013-11-01

    The mitochondrial DNA m.13513G>A mutation in the ND5 subunit gene is a frequent cause of Leigh syndrome. Patients harboring this mutation typically present with ptosis and cardiac conduction abnormalities, particularly Wolff-Parkinson-White syndrome, and have a late clinical onset, which contrasts with the typical infantile form. The authors describe a patient presenting with intrauterine growth retardation and visual impairment at 3 months of age, followed by infantile spasms, severe gastrointestinal dysmotility, and neurological regression. The patient had hyperlactacidemia and bilateral basal ganglia and brainstem lesions on MRI. Although he did not present cardiac conduction abnormalities, his mother had been diagnosed with Wolff-Parkinson-White syndrome. The m.13513G>A mutation was found in the patient's muscle and in several tissues of his mother. The present results expand the phenotype of Leigh syndrome associated with the m.13513G>A mutation, which should be suspected in patients with early-onset mitochondrial encephalopathy with infantile spasms or prominent gastrointestinal smooth muscle involvement.

  10. Factor V Leiden G1691A and prothrombin G20210A mutations among Palestinian patients with sickle cell disease.

    PubMed

    Samarah, Fekri; Srour, Mahmoud A

    2018-01-01

    Vascular thrombosis is an important pathophysiological aspect of sickle cell disease (SCD). This study aimed to investigate the prevalence and clinical impact of factor V Leiden G1691A (FVL) and prothrombin G20210A mutations among Palestinian sickle cell disease (SCD) patients. A total of 117 SCD patients, including 59 patients with sickle cell anemia (SS), 33 patients with sickle β-thalassemia and 25 individuals with sickle cell trait (AS) were studied. The control group consisted of 118 healthy individuals. FVL and prothrombin G20210A mutations were determined by RFLP PCR. Analysis of the clinical history of SCD patients revealed that seven patients have had vascular complications such as ischemic stroke or deep vein thrombosis. In SCD patients, the inheritance of the FVL mutation showed a significantly higher incidence of pain in joints, chest and abdomen as well as regular dependence on blood transfusion compared to SCD with the wild type. Age- and sex-adjusted logistic regression analysis revealed a significant association between FVL and sickle cell anemia with an odds ratio (OR) of 5.6 (95% confidence intervals [CI] of 1.91-39.4, P  = 0.039) in SS patients. However, increased prevalence of the FVL in AS subjects and sickle β-thalassemia patients was not statistically significant compared to controls (OR 3.97, 95% CI 0.51-28.6, P  = 0.17 and OR 3.59, 95% CI 0.35-41.6, P  = 0.26, respectively). The distribution of prothrombin G20210A mutation among SCD patients compared to controls was not significantly different, thus our findings do not support an association of this mutation with SCD. FVL was more prevalent among SS patients compared to controls and it was associated with higher incidence of disease complications among SCD patients.

  11. [Diabetes mellitus associated with the mitochondrial mutation A3243G: frequency and clinical presentation].

    PubMed

    Salles, João Eduardo N; Kalinin, Larissa Bresgunov; Ferreira, Sandra Roberta G; Kasamatsu, Teresa; Moisés, Regina S

    2007-06-01

    Maternal inherited diabetes and deafness (MIDD) has been related to an A to G transition in the mitochondrial RNA Leu (UUR) at base pair 3243. The prevalence of MIDD in the diabetes population ranges between 0.5-3.0% depending on the ethnic background. To examine the frequency and clinical features of diabetes associated with this mutation in Brazilian patients with glucose intolerance. The study population comprised: 78 type 1 diabetic subjects (group I), 148 patients with type 2 diabetes (group II), 15 patients with either type 1 or type 2 diabetes and hearing loss (group III) and 492 Japanese Brazilians with varying degrees of glucose intolerance. DNA was extracted from peripheral blood leucocytes and the A3243G mutation was determined by PCR amplification and Apa 1 digestion. In some individuals DNA was also extracted from buccal mucosa and hair follicles. The 3243 bp mutation was found in three individuals, all from group III, resulting in a prevalence of 0.4%. These subjects had an early age of diagnosis of diabetes, low or normal body mass index and requirement of insulin therapy. In conclusion MIDD is rare in our population and should be investigate in patients with diabetes and deafness.

  12. DNAJC21 Mutations Link a Cancer-Prone Bone Marrow Failure Syndrome to Corruption in 60S Ribosome Subunit Maturation.

    PubMed

    Tummala, Hemanth; Walne, Amanda J; Williams, Mike; Bockett, Nicholas; Collopy, Laura; Cardoso, Shirleny; Ellison, Alicia; Wynn, Rob; Leblanc, Thierry; Fitzgibbon, Jude; Kelsell, David P; van Heel, David A; Payne, Elspeth; Plagnol, Vincent; Dokal, Inderjeet; Vulliamy, Tom

    2016-07-07

    A substantial number of individuals with bone marrow failure (BMF) present with one or more extra-hematopoietic abnormality. This suggests a constitutional or inherited basis, and yet many of them do not fit the diagnostic criteria of the known BMF syndromes. Through exome sequencing, we have now identified a subgroup of these individuals, defined by germline biallelic mutations in DNAJC21 (DNAJ homolog subfamily C member 21). They present with global BMF, and one individual developed a hematological cancer (acute myeloid leukemia) in childhood. We show that the encoded protein associates with rRNA and plays a highly conserved role in the maturation of the 60S ribosomal subunit. Lymphoblastoid cells obtained from an affected individual exhibit increased sensitivity to the transcriptional inhibitor actinomycin D and reduced amounts of rRNA. Characterization of mutations revealed impairment in interactions with cofactors (PA2G4, HSPA8, and ZNF622) involved in 60S maturation. DNAJC21 deficiency resulted in cytoplasmic accumulation of the 60S nuclear export factor PA2G4, aberrant ribosome profiles, and increased cell death. Collectively, these findings demonstrate that mutations in DNAJC21 cause a cancer-prone BMF syndrome due to corruption of early nuclear rRNA biogenesis and late cytoplasmic maturation of the 60S subunit. Copyright © 2016. Published by Elsevier Inc.

  13. Glucose-6-Phosphate Dehydrogenase (G6PD) deficiency in Greek newborns: the Mediterranean C563T mutation screening.

    PubMed

    Molou, Elina; Schulpis, Kleopatra H; Thodi, Georgia; Georgiou, Vassiliki; Dotsikas, Yannis; Papadopoulos, Konstantinos; Biti, Sofia; Loukas, Yannis L

    2014-04-01

    Glucose-6-Phosphate Dehydrogenase (G6PD) gene is located at the X-chromosome at Xq28 and the disease is recessively inherited predominantly in males. More than 400 variants have been proposed based on clinical and enzymatic studies. The aim of the current study was to identify C563T mutation in G6PD-deficient newborns and to correlate the enzyme residual activity with the presence of the mutation. Some 1189 full-term neonates aged 3-5 days old were tested for G6PD activity in dried blood spots from Guthrie cards using a commercial kit. DNA extraction from Guthrie cards and mutation identification among the deficient samples were performed with current techniques. A total of 92 (7.7%) newborns were G6PD-deficient. In 46 (50%), the mutation C563T was identified. The residual activity in C563T hemizygote males (n = 28) was statistically significantly lower (1.23 ± 0.93 U/g Hb) than that in non-C563T G6PD-deficient males (n = 25) (4.01 ± 1.20 U/g Hb, p < 0.0001) and in controls (13.6 ± 2.9 U/g Hb, p < 0.0001). In C563T heterozygote females, the estimated enzyme activity was lower than that determined in non-C563T females. Male C563T hemizygotes suffer from G6PD deficiency and severe neonatal jaundice. G6PD activity showed statistically significant correlation with total bilirubin blood levels.

  14. DNA polymerase θ contributes to the generation of C/G mutations during somatic hypermutation of Ig genes

    PubMed Central

    Masuda, Keiji; Ouchida, Rika; Takeuchi, Arata; Saito, Takashi; Koseki, Haruhiko; Kawamura, Kiyoko; Tagawa, Masatoshi; Tokuhisa, Takeshi; Azuma, Takachika; O-Wang, Jiyang

    2005-01-01

    Somatic hypermutation of Ig variable region genes is initiated by activation-induced cytidine deaminase; however, the activity of multiple DNA polymerases is required to ultimately introduce mutations. DNA polymerase η (Polη) has been implicated in mutations at A/T, but polymerases involved in C/G mutations have not been identified. We have generated mutant mice expressing DNA polymerase (Polθ) specifically devoid of polymerase activity. Compared with WT mice, Polq-inactive (Polq, the gene encoding Polθ) mice exhibited a reduced level of serum IgM and IgG1. The mutant mice mounted relatively normal primary and secondary immune responses to a T-dependent antigen, but the production of high-affinity specific antibodies was partially impaired. Analysis of the JH4 intronic sequences revealed a slight reduction in the overall mutation frequency in Polq-inactive mice. Remarkably, although mutations at A/T were unaffected, mutations at C/G were significantly decreased, indicating an important, albeit not exclusive, role for Polθ activity. The reduction of C/G mutations was particularly focused on the intrinsic somatic hypermutation hotspots and both transitions and transversions were similarly reduced. These findings, together with the recent observation that Polθ efficiently catalyzes the bypass of abasic sites, lead us to propose that Polθ introduces mutations at C/G by replicating over abasic sites generated via uracil-DNA glycosylase. PMID:16172387

  15. The Presence of Multiple Cellular Defects Associated with a Novel G50E Iron-Sulfur Cluster Scaffold Protein (ISCU) Mutation Leads to Development of Mitochondrial Myopathy*

    PubMed Central

    Saha, Prasenjit Prasad; Kumar, S. K. Praveen; Srivastava, Shubhi; Sinha, Devanjan; Pareek, Gautam; D'Silva, Patrick

    2014-01-01

    Iron-sulfur (Fe-S) clusters are versatile cofactors involved in regulating multiple physiological activities, including energy generation through cellular respiration. Initially, the Fe-S clusters are assembled on a conserved scaffold protein, iron-sulfur cluster scaffold protein (ISCU), in coordination with iron and sulfur donor proteins in human mitochondria. Loss of ISCU function leads to myopathy, characterized by muscle wasting and cardiac hypertrophy. In addition to the homozygous ISCU mutation (g.7044G→C), compound heterozygous patients with severe myopathy have been identified to carry the c.149G→A missense mutation converting the glycine 50 residue to glutamate. However, the physiological defects and molecular mechanism associated with G50E mutation have not been elucidated. In this report, we uncover mechanistic insights concerning how the G50E ISCU mutation in humans leads to the development of severe ISCU myopathy, using a human cell line and yeast as the model systems. The biochemical results highlight that the G50E mutation results in compromised interaction with the sulfur donor NFS1 and the J-protein HSCB, thus impairing the rate of Fe-S cluster synthesis. As a result, electron transport chain complexes show significant reduction in their redox properties, leading to loss of cellular respiration. Furthermore, the G50E mutant mitochondria display enhancement in iron level and reactive oxygen species, thereby causing oxidative stress leading to impairment in the mitochondrial functions. Thus, our findings provide compelling evidence that the respiration defect due to impaired biogenesis of Fe-S clusters in myopathy patients leads to manifestation of complex clinical symptoms. PMID:24573684

  16. Prevalence of GJB2 Mutations in Affected Individuals from United Arab Emirates with Autosomal Recessive Nonsyndromic Hearing Loss.

    PubMed

    Tlili, Abdelaziz; Al Mutery, Abdullah; Kamal Eddine Ahmad Mohamed, Walaa; Mahfood, Mona; Hadj Kacem, Hassen

    2017-11-01

    Mutations in the gap junction protein beta 2 (GJB2) gene are responsible for more cases of nonsyndromic recessive hearing loss than any other gene. The purpose of our study was to evaluate the prevalence of GJB2 mutations among affected individuals from United Arab Emirates (UAE). There were 50 individuals diagnosed with hereditary hearing loss and 120 healthy individuals enrolled in the study. The Sanger sequencing method was used to screen the GJB2 coding region in all affected individuals. The c.-1G>A variant was determined by the polymerase chain reaction-restriction fragment length polymorphism method in normal individuals. Nine cases with bi-allelic mutations and three cases with mono-allelic mutations were detected in 12 out of 50 patients (24%). The homozygous mutation c.35delG was identified as the cause of hearing loss in six participants (12%). The mutation c.506G>A was identified in three affected individuals (6%). The allelic frequency (14%) and low percentage of individuals that were homozygous (2%) for the c.35delG mutation suggest that there are other genes responsible for nonsyndromic deafness in the UAE population. The results reported here are a preliminary step in collecting epidemiological data regarding autosomal recessive nonsyndromic hearing loss related to GJB2 gene mutations among the UAE population. The c.35delG mutation of the GJB2 gene is the most frequently seen causative mutation in the UAE and is followed by the p.Cys169Tyr mutation.

  17. Mutation analysis of the MECP2 gene in patients of Slavic origin with Rett syndrome: novel mutations and polymorphisms.

    PubMed

    Zahorakova, Daniela; Rosipal, Robert; Hadac, Jan; Zumrova, Alena; Bzduch, Vladimir; Misovicova, Nadezda; Baxova, Alice; Zeman, Jiri; Martasek, Pavel

    2007-01-01

    Rett syndrome (RTT), an X-linked dominant neurodevelopmental disorder in females, is caused mainly by de novo mutations in the methyl-CpG-binding protein 2 gene (MECP2). Here we report mutation analysis of the MECP2 gene in 87 patients with RTT from the Czech and Slovak Republics, and Ukraine. The patients, all girls, with classical RTT were investigated for mutations using bi-directional DNA sequencing and conformation sensitive gel electrophoresis analysis of the coding sequence and exon/intron boundaries of the MECP2 gene. Restriction fragment length polymorphism analysis was performed to confirm the mutations that cause the creation or abolition of the restriction site. Mutation-negative cases were subsequently examined by multiple ligation-dependent probe amplification (MLPA) to identify large deletions. Mutation screening revealed 31 different mutations in 68 patients and 12 non-pathogenic polymorphisms. Six mutations have not been previously published: two point mutations (323T>A, 904C>T), three deletions (189_190delGA, 816_832del17, 1069delAGC) and one deletion/inversion (1063_1236del174;1189_1231inv43). MLPA analysis revealed large deletions in two patients. The detection rate was 78.16%. Our results confirm the high frequency of MECP2 mutations in females with RTT and provide data concerning the mutation heterogeneity in the Slavic population.

  18. CHEK2 mutation and risk of prostate cancer: a systematic review and meta-analysis.

    PubMed

    Wang, Yue; Dai, Bo; Ye, Dingwei

    2015-01-01

    CHEK2 encodes for a G2 checkpoint kinase which plays a critical role in DNA repair. Its mutation confers an increased risk of breast cancer. It has also been suggested to increase risks of prostate cancer, but its involvement with this type of cancer has not been confirmed. We performed a systematic review and meta-analysis to clarify the association between CHEK2 1100delC, IVS2+1G>A, I157T mutation and risk of Prostate Cancer. A comprehensive, computerized literature search of PubMed until December 27, 2014 was carried out. Eligible studies were included according to specific inclusion criteria. Pooled hazard ratio was estimated using the fixed effects model or random effects model according to heterogeneity between studies. Eight eligible studies were included in the analysis, all were retrospective studies. The overall meta-analysis demonstrated that the CHEK2 1100delC mutation (OR 3.29; 95% confidence interval: 1.85-5.85; P = 0.00) and I157T missense mutation (OR 1.80; 95% confidence interval: 1.51-2.14; P = 0.00) was associated with higher risk of Prostate Cancer, and CHEK2 1100delC mutation is irrelevant to familial aggregation phenomenon of prostate cancer (OR 1.59; 95% confidence interval: 0.79-3.20; P = 0.20). The IVS2+1G>A mutation is also irrelevant to Prostate Cancer (OR = 1.59, 95% CI = 0.93-2.71, P = 0.09). None of the single studies materially altered the original results and no evidence of publication bias was found. CHEK2 1100delC mutation and I157T missense mutation in males indicates higher risk of Prostate Cancer, but there's no evidence to prove the CHEK2 1100delC mutation was associated with Familial prostate cancer.

  19. Novel GNE mutations in Italian families with autosomal recessive hereditary inclusion-body myopathy.

    PubMed

    Broccolini, Aldobrando; Ricci, Enzo; Cassandrini, Denise; Gliubizzi, Carla; Bruno, Claudio; Tonoli, Emmanuel; Silvestri, Gabriella; Pescatori, Mario; Rodolico, Carmelo; Sinicropi, Stefano; Servidei, Serenella; Zara, Federico; Minetti, Carlo; Tonali, Pietro A; Mirabella, Massimiliano

    2004-06-01

    The most common form of autosomal recessive (AR) hereditary inclusion-body myopathy (HIBM), originally described in Persian-Jewish families, is characterized by onset in early adult life with weakness and atrophy of distal lower limb muscles, which progress proximally and relatively spare the quadriceps. AR HIBM is associated with mutations in the UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase gene (GNE) on chromosome 9p12-13. In the present study we have identified seven novel GNE mutations in patients from five unrelated Italian families with clinical and pathologic features indicative of AR HIBM. Four were missense mutations (c.1556A>G [p.N519S], c.79C>T [p.P27S], c.1798G>A [p.A600T] and c.616G>A [p.G206S]), two consisted in a single-base deletion (c.616delG [p.G206fsX4] and c.1130delT [p.I377fsX16]) and one in an intronic single-base insertion (c.1070+2dupT). These latter findings further extend the type of GNE mutations associated with HIBM. Furthermore, in one patient we also identified the c.737G>A [p.R246Q] missense mutation that corresponds to the one previously reported in a family from the Bahamas. Interestingly, in two of our families distinct mutations affected nucleotide c.616 in exon 3 (c.616delG and c.616G>A). The possibility of specific portions of the gene being more prone to mutations remains to be elucidated. Copyright 2004 Wiley-Liss, Inc.

  20. Spectrum and Morphology of the Two Brightest Milagro Sources in the Cygnus Region: MGRO J2019+37 and MGRO J2031+41

    NASA Technical Reports Server (NTRS)

    Abdo, A. A.; Abeysekara, U.; Allen, B, T.; Aune, T.; Berley, D.; Bonamente, E.; Christopher, G. E.; DeYoung, T.; Dingus, B. L.; Ellsworth, R. W.; hide

    2012-01-01

    The Cygnus region is a very bright and complex portion of the TeV sky, host to unidentified sources and a diffuse excess with respect to conventional cosmic-ray propagation models. Two of the brightest TeV sources, MGRO J2019+37 and MGRO J2031+41, are analyzed using Milagro data with a new technique, and their emission is tested under two different spectral assumptions: a power law and a power law with an exponential cutoff. The new analysis technique is based on an energy estimator that uses the fraction of photomultiplier tubes in the observatory that detect the extensive air shower. The photon spectrum is measured in the range 1-100 TeV using the last three years of Milagro data (2005-2008), with the detector in its final configuration. An F-test indicates that MGRO J2019+37 is better fit by a power law with an exponential cutoff than by a simple power law. The best-fitting parameters for the power law with exponential cutoff model are a normalization at 10 TeV of 7(sup +5 sub -2) × 10(exp -10)/ s /sq m/ TeV, a spectral index of 2.0(sup +0.5 sub -10), and a cutoff energy of 29(sup +50 sub -16) TeV. MGRO J2031+41 shows no evidence of a cutoff. The best-fitting parameters for a power law are a normalization of 2.1(sup +0.6 sub -0.6) × 10(exp -10)/ s/sq m/ TeV and a spectral index of 3.22(sup +0.23 sub -0.18. The overall flux is subject to a approx.. 30% systematic uncertainty. The systematic uncertainty on the power-law indices is approx. 0.1. Both uncertainties have been verified with cosmic-ray data. A comparison with previous results from TeV J2032+4130, MGRO J2031+41, and MGRO J2019+37 is also presented.

  1. Metastatic melanoma cells with BRAF G469A mutation: nab-paclitaxel better than vemurafenib?

    PubMed

    Porcelli, Letizia; Guida, Gabriella; Tommasi, Stefania; Guida, Michele; Azzariti, Amalia

    2015-08-01

    BRAF G469A is a missense mutation within exon 11 of the BRAF gene resulting in a constitutively activated enzyme frequently associated with MAP kinase cascade signaling activation. No evidence currently exists about its role in determining sensitivity/resistance to BRAF inhibitors, utilized in the treatment of patients carrying BRAF V600 mutations, and to chemotherapy. The newly established metastatic melanoma (MM) cell line MO-1 was characterized for its sensitivity to vemurafenib and nab-paclitaxel, both already utilized for the treatment of MM. All analyses were carried out by comparing results with those found in MM cells wild type for BRAF or mutated in V600. In addition, cellular effectors were investigated by ELISA kits, western blotting and flow cytometry. The exposure to vemurafenib inhibited MO-1 cell proliferation at concentrations similar to those obtained in vemurafenib-resistant melanoma models, and an explanation of this sensitivity is the strong activation of Erk1/2 and the low expression of MITF. Nab-paclitaxel strongly reduced proliferation of MO-1 cells perhaps for the very low expression level of PMEL17, transcriptionally regulated by MITF and negatively involved in determining sensitivity to taxanes. Thus, the mutation BRAF G469A in MM might be related to a weak effectiveness of therapy with BRAF inhibitors and a promising therapeutic approach may be with nab-paclitaxel.

  2. PB2 mutations D701N and S714R promote adaptation of an influenza H5N1 virus to a mammalian host.

    PubMed

    Czudai-Matwich, Volker; Otte, Anna; Matrosovich, Mikhail; Gabriel, Gülsah; Klenk, Hans-Dieter

    2014-08-01

    Mutation D701N in the PB2 protein is known to play a prominent role in the adaptation of avian influenza A viruses to mammalian hosts. In contrast, little is known about the nearby mutations S714I and S714R, which have been observed in some avian influenza viruses highly pathogenic for mammals. We have generated recombinant H5N1 viruses with PB2 displaying the avian signature 701D or the mammalian signature 701N and serine, isoleucine, and arginine at position 714 and compared them for polymerase activity and virus growth in avian and mammalian cells, as well as for pathogenicity in mice. Mutation D701N led to an increase in polymerase activity and replication efficiency in mammalian cells and in mouse pathogenicity, and this increase was significantly enhanced when mutation D701N was combined with mutation S714R. Stimulation by mutation S714I was less distinct. These observations indicate that PB2 mutation S714R, in combination with the mammalian signature at position 701, has the potential to promote the adaptation of an H5N1 virus to a mammalian host. Influenza A/H5N1 viruses are avian pathogens that have pandemic potential, since they are spread over large parts of Asia, Africa, and Europe and are occasionally transmitted to humans. It is therefore of high scientific interest to understand the mechanisms that determine the host specificity and pathogenicity of these viruses. It is well known that the PB2 subunit of the viral polymerase is an important host range determinant and that PB2 mutation D701N plays an important role in virus adaptation to mammalian cells. In the present study, we show that mutation S714R is also involved in adaptation and that it cooperates with D701N in exposing a nuclear localization signal that mediates importin-α binding and entry of PB2 into the nucleus, where virus replication and transcription take place. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  3. Cancer-associated IDH1 mutations produce 2-hydroxyglutarate

    PubMed Central

    Dang, Lenny; White, David W.; Gross, Stefan; Bennett, Bryson D.; Bittinger, Mark A.; Driggers, Edward M.; Fantin, Valeria R.; Jang, Hyun Gyung; Jin, Shengfang; Keenan, Marie C.; Marks, Kevin M.; Prins, Robert M.; Ward, Patrick S.; Yen, Katharine E.; Liau, Linda M.; Rabinowitz, Joshua D.; Cantley, Lewis C.; Thompson, Craig B.; Vander Heiden, Matthew G.; Su, Shinsan M.

    2009-01-01

    Summary Mutations in the enzyme cytosolic isocitrate dehydrogenase 1 (IDH1) are a common feature of a major subset of primary human brain cancers. These mutations occur at a single amino acid residue of the IDH1 active site resulting in loss of the enzyme’s ability to catalyze conversion of isocitrate to α-ketoglutarate. However, only a single copy of the gene is mutated in tumors, raising the possibility that the mutations do not result in a simple loss of function. Here we show that cancer-associated IDH1 mutations result in a new ability of the enzyme to catalyze the NADPH-dependent reduction of α-ketoglutarate to R(−)-2-hydroxyglutarate (2HG). Structural studies demonstrate that when R132 is mutated to histidine, residues in the active site are shifted to produce structural changes consistent with reduced oxidative decarboxylation of isocitrate and acquisition of the ability to convert α-ketoglutarate to 2HG. Excess accumulation of 2HG has been shown to lead to an elevated risk of malignant brain tumors in patients with inborn errors of 2HG metabolism. Similarly, in human malignant gliomas harboring IDH1 mutations, we find dramatically elevated levels of 2HG. These data demonstrate that the IDH1 mutations result in production of the onco-metabolite 2HG, and suggest that the excess 2HG which accumulates in vivo contributes to the formation and malignant progression of gliomas. PMID:19935646

  4. Identification of katG Mutations Associated with High-Level Isoniazid Resistance in Mycobacterium tuberculosis▿ †

    PubMed Central

    Ando, Hiroki; Kondo, Yuji; Suetake, Toshinori; Toyota, Emiko; Kato, Seiya; Mori, Toru; Kirikae, Teruo

    2010-01-01

    Isoniazid (INH) is an effective first-line antituberculosis drug. KatG, a catalase-peroxidase, converts INH to an active form in Mycobacterium tuberculosis, and katG mutations are major causes of INH resistance. In the present study, we sequenced katG of 108 INH-resistant M. tuberculosis clinical isolates. Consequently, 9 novel KatG mutants with a single-amino-acid substitution were found. All of these mutants had significantly lower INH oxidase activities than the wild type, and each mutant showed various levels of activity. Isolates having mutations with relatively low activities showed high-level INH resistance. On the basis of our results and known mutations associated with INH resistance, we developed a new hybridization-based line probe assay for rapid detection of INH-resistant M. tuberculosis isolates. PMID:20211896

  5. Breast cancer risk is similar for CHEK2 founder and non-founder mutation carriers.

    PubMed

    Leedom, Tracey P; LaDuca, Holly; McFarland, Rachel; Li, Shuwei; Dolinsky, Jill S; Chao, Elizabeth C

    2016-09-01

    CHEK2 mutations are associated with increased cancer risks, including breast; however, published risk estimates are limited to those conferred by CHEK2 founder mutations, presenting uncertainty in risk assessment for carriers of other CHEK2 mutations. This study aimed to assess phenotypes and molecular characteristics of CHEK2 mutation carriers (CHEK2 + s) from a multi-gene panel testing (MGPT) cohort, focusing on comparing phenotypes of founder and non-founder CHEK2 + s. Clinical histories and molecular results were reviewed from 45,879 patients who underwent MGPT including CHEK2 at a commercial laboratory. Of individuals tested, 2.4% (n = 1085) were CHEK2 + s. Sixteen individuals harbored biallelic CHEK2 mutations, bringing the total number of CHEK2 mutations detected in this cohort to 1101. Personal/family cancer histories were compared between founder (n = 576; included c.1100delC, p.S428F, c.444 + 1G > A, and EX8_9del) and non-founder (n = 259) CHEK2 + s using Fisher's exact test and multivariate logistic regression analysis. Individuals carrying the p.I157T moderate risk founder mutation (n = 231), additional mutations in non-CHEK2 genes (n = 83), or biallelic mutations (n = 16) were excluded from phenotype analysis, as were cases with no clinical information provided. No significant phenotypic differences were observed between founder and non-founder CHEK2 + s. These data suggest that cancer risks reported for founder mutations may be generalizable to all CHEK2 + s, particularly for breast cancer. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  6. EPHA2 MUTATIONS CONTRIBUTE TO CONGENITAL CATARACT THROUGH DIVERSE MECHANISMS.

    PubMed

    Dave, Alpana; Martin, Sarah; Kumar, Raman; Craig, Jamie E; Burdon, Kathryn P; Sharma, Shiwani

    2016-01-01

    Congenital cataract is a leading cause of childhood blindness. Mutations in the EPHA2 gene are one of the causes of inherited congenital cataract. The EPHA2 gene encodes a membrane-bound tyrosine kinase receptor and is highly expressed in epithelial cells, including in the ocular lens. Signaling through the EPHA2 receptor plays a pivotal role in epithelial cell homeostasis. The aim of this study was to determine the effect of congenital cataract causing mutations in the EPHA2 gene on the encoded protein in epithelial cells. The effect of five disease-causing mutations, p.P584L (c.1751C>T), p.T940I (c.2819C>T), p.D942fsXC71 (c.2826-9G>A), p.A959T (c.2875G>A), and p.V972GfsX39 (c.2915_2916delTG), on localization of the protein was examined in two in vitro epithelial cell culture systems: Madin-Darby Canine Kidney (MDCK) and human colorectal adenocarcinoma (Caco-2) epithelial cells. Myc-tagged mutant constructs were generated by polymerase chain reaction (PCR)-based mutagenesis. The Myc-tagged wild-type construct was used as a control. The Myc-tagged wild-type and mutant proteins were ectopically expressed and detected by immunofluorescence labeling. Two of the mutations, p.T940I and p.D942fsXC71, located within the cytoplasmic sterile-α-motif (SAM) domain of EPHA2, led to mis-localization of the protein to the perinuclear space and co-localization with the cis-golgi apparatus, indicating sub-organellar/cellular retention of the mutant proteins. The mutant proteins carrying the remaining three mutations, similar to the wild-type EPHA2, localized to the cell membrane. Mis-localization of two of the mutant proteins in epithelial cells suggests that some disease-causing mutations in EPHA2 likely affect lens epithelial cell homeostasis and contribute to cataract. This study suggests that mutations in EPHA2 contribute to congenital cataract through diverse mechanisms.

  7. Analysis of alkaptonuria (AKU) mutations and polymorphisms reveals that the CCC sequence motif is a mutational hot spot in the homogentisate 1,2 dioxygenase gene (HGO).

    PubMed Central

    Beltrán-Valero de Bernabé, D; Jimenez, F J; Aquaron, R; Rodríguez de Córdoba, S

    1999-01-01

    We recently showed that alkaptonuria (AKU) is caused by loss-of-function mutations in the homogentisate 1,2 dioxygenase gene (HGO). Herein we describe haplotype and mutational analyses of HGO in seven new AKU pedigrees. These analyses identified two novel single-nucleotide polymorphisms (INV4+31A-->G and INV11+18A-->G) and six novel AKU mutations (INV1-1G-->A, W60G, Y62C, A122D, P230T, and D291E), which further illustrates the remarkable allelic heterogeneity found in AKU. Reexamination of all 29 mutations and polymorphisms thus far described in HGO shows that these nucleotide changes are not randomly distributed; the CCC sequence motif and its inverted complement, GGG, are preferentially mutated. These analyses also demonstrated that the nucleotide substitutions in HGO do not involve CpG dinucleotides, which illustrates important differences between HGO and other genes for the occurrence of mutation at specific short-sequence motifs. Because the CCC sequence motifs comprise a significant proportion (34.5%) of all mutated bases that have been observed in HGO, we conclude that the CCC triplet is a mutational hot spot in HGO. PMID:10205262

  8. SLC52A2 [p.P141T] and SLC52A3 [p.N21S] causing Brown-Vialetto-Van Laere Syndrome in an Indian patient: First genetically proven case with mutations in two riboflavin transporters.

    PubMed

    Udhayabanu, Tamilarasan; Subramanian, Veedamali S; Teafatiller, Trevor; Gowda, Vykuntaraju K; Raghavan, Varun S; Varalakshmi, Perumal; Said, Hamid M; Ashokkumar, Balasubramaniem

    2016-11-01

    Brown-Vialetto-Van Laere Syndrome (BVVLS), a rare neurological disorder characterized by bulbar palsies and sensorineural deafness, is mainly associated with defective riboflavin transporters encoded by the SLC52A2 and SLC52A3 genes. Here we present a 16-year-old BVVLS patient belonging to a five generation consanguineous family from Indian ethnicity with two homozygous missense mutations viz., c.421C>A [p.P141T] in SLC52A2 and c.62A>G [p.N21S] in SLC52A3. Functional characterization based on 3 H-riboflavin uptake assay and live-cell confocal imaging revealed that the effect of mutation c.421C>A [p.P141T] identified in SLC52A2 had a slight reduction in riboflavin uptake; on the other hand, the c.62A>G [p.N21S] identified in SLC52A3 showed a drastic reduction in riboflavin uptake, which appeared to be due to impaired trafficking and membrane targeting of the hRFVT-3 protein. This is the first report presenting mutations in both riboflavin transporters hRFVT-2 and hRFVT-3 in the same BVVLS patient. Also, c.62A>G [p.N21S] in SLC52A3 appears to contribute more to the disease phenotype in this patient than c.421C>A [p.P141T] in SLC52A2. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. SLC52A2 [p.P141T] and SLC52A3 [p.N21S] causing Brown-Vialetto-Van Laere Syndrome in an Indian patient: First genetically proven case with mutations in two riboflavin transporters

    PubMed Central

    Udhayabanu, Tamilarasan; Subramanian, Veedamali S; Teafatiller, Trevor; Gowda, Vykuntaraju K; Raghavan, Varun S; Varalakshmi, Perumal; Said, Hamid M; Ashokkumar, Balasubramaniem

    2017-01-01

    Background Brown-Vialetto-Van Laere Syndrome (BVVLS), a rare neurological disorder characterized by bulbar palsies and sensorineural deafness, is mainly associated with defective riboflavin transporters encoded by the SLC52A2 and SLC52A3 genes. Methods Here we present a 16-year-old BVVLS patient belonging to a five generation consanguineous family from Indian ethnicity with two homozygous missense mutations viz., c.421C>A [p.P141T] in SLC52A2 and c.62A>G [p.N21S] in SLC52A3. Results Functional characterization based on 3H-riboflavin uptake assay and live-cell confocal imaging revealed that the effect of mutation c.421C>A [p.P141T] identified in SLC52A2 had a slight reduction in riboflavin uptake; on the other hand, the c.62A>G [p.N21S] identified in SLC52A3 showed a drastic reduction in riboflavin uptake, which appeared to be due to impaired trafficking and membrane targeting of the hRFVT-3 protein. Conclusions This is the first report presenting mutations in both riboflavin transporters hRFVT-2 and hRFVT-3 in the same BVVLS patient. Also, c.62A>G [p.N21S] in SLC52A3 appears to contribute more to the disease phenotype in this patient than c.421C>A [p.P141T] in SLC52A2. PMID:27702554

  10. TeV γ-ray observations of the young synchrotron-dominated SNRs G1.9+0.3 and G330.2+1.0 with H.E.S.S.

    NASA Astrophysics Data System (ADS)

    H.E.S.S. Collaboration; Abramowski, A.; Aharonian, F.; Benkhali, F. Ait; Akhperjanian, A. G.; Angüner, E.; Anton, G.; Balenderan, S.; Balzer, A.; Barnacka, A.; Becherini, Y.; Becker Tjus, J.; Bernlöhr, K.; Birsin, E.; Bissaldi, E.; Biteau, J.; Böttcher, M.; Boisson, C.; Bolmont, J.; Bordas, P.; Brucker, J.; Brun, F.; Brun, P.; Bulik, T.; Carrigan, S.; Casanova, S.; Cerruti, M.; Chadwick, P. M.; Chalme-Calvet, R.; Chaves, R. C. G.; Cheesebrough, A.; Chrétien, M.; Colafrancesco, S.; Cologna, G.; Conrad, J.; Couturier, C.; Cui, Y.; Dalton, M.; Daniel, M. K.; Davids, I. D.; Degrange, B.; Deil, C.; deWilt, P.; Dickinson, H. J.; Djannati-Ataï, A.; Domainko, W.; O'C. Drury, L.; Dubus, G.; Dutson, K.; Dyks, J.; Dyrda, M.; Edwards, T.; Egberts, K.; Eger, P.; Espigat, P.; Farnier, C.; Fegan, S.; Feinstein, F.; Fernandes, M. V.; Fernandez, D.; Fiasson, A.; Fontaine, G.; Förster, A.; Füßling, M.; Gajdus, M.; Gallant, Y. A.; Garrigoux, T.; Giavitto, G.; Giebels, B.; Glicenstein, J. F.; Grondin, M.-H.; Grudzińska, M.; Häffner, S.; Hahn, J.; Harris, J.; Heinzelmann, G.; Henri, G.; Hermann, G.; Hervet, O.; Hillert, A.; Hinton, J. A.; Hofmann, W.; Hofverberg, P.; Holler, M.; Horns, D.; Jacholkowska, A.; Jahn, C.; Jamrozy, M.; Janiak, M.; Jankowsky, F.; Jung, I.; Kastendieck, M. A.; Katarzyński, K.; Katz, U.; Kaufmann, S.; Khélifi, B.; Kieffer, M.; Klepser, S.; Klochkov, D.; Kluźniak, W.; Kneiske, T.; Kolitzus, D.; Komin, Nu.; Kosack, K.; Krakau, S.; Krayzel, F.; Krüger, P. P.; Laffon, H.; Lamanna, G.; Lefaucheur, J.; Lemière, A.; Lemoine-Goumard, M.; Lenain, J.-P.; Lennarz, D.; Lohse, T.; Lopatin, A.; Lu, C.-C.; Marandon, V.; Marcowith, A.; Marx, R.; Maurin, G.; Maxted, N.; Mayer, M.; McComb, T. J. L.; Méhault, J.; Meintjes, P. J.; Menzler, U.; Meyer, M.; Moderski, R.; Mohamed, M.; Moulin, E.; Murach, T.; Naumann, C. L.; de Naurois, M.; Niemiec, J.; Nolan, S. J.; Oakes, L.; Ohm, S.; Wilhelmi, E. de Oña; Opitz, B.; Ostrowski, M.; Oya, I.; Panter, M.; Parsons, R. D.; Arribas, M. Paz; Pekeur, N. W.; Pelletier, G.; Perez, J.; Petrucci, P.-O.; Peyaud, B.; Pita, S.; Poon, H.; Pühlhofer, G.; Punch, M.; Quirrenbach, A.; Raab, S.; Raue, M.; Reimer, A.; Reimer, O.; Renaud, M.; Reyes, R. de los; Rieger, F.; Rob, L.; Romoli, C.; Rosier-Lees, S.; Rowell, G.; Rudak, B.; Rulten, C. B.; Sahakian, V.; Sanchez, D. A.; Santangelo, A.; Schlickeiser, R.; Schüssler, F.; Schulz, A.; Schwanke, U.; Schwarzburg, S.; Schwemmer, S.; Sol, H.; Spengler, G.; Spies, F.; Stawarz, Ł.; Steenkamp, R.; Stegmann, C.; Stinzing, F.; Stycz, K.; Sushch, I.; Szostek, A.; Tavernet, J.-P.; Tavernier, T.; Taylor, A. M.; Terrier, R.; Tluczykont, M.; Trichard, C.; Valerius, K.; van Eldik, C.; van Soelen, B.; Vasileiadis, G.; Venter, C.; Viana, A.; Vincent, P.; Völk, H. J.; Volpe, F.; Vorster, M.; Vuillaume, T.; Wagner, S. J.; Wagner, P.; Ward, M.; Weidinger, M.; Weitzel, Q.; White, R.; Wierzcholska, A.; Willmann, P.; Wörnlein, A.; Wouters, D.; Zabalza, V.; Zacharias, M.; Zajczyk, A.; Zdziarski, A. A.; Zech, A.; Zechlin, H.-S.

    2014-06-01

    The non-thermal nature of the X-ray emission from the shell-type supernova remnants (SNRs) G1.9+0.3 and G330.2+1.0 is an indication of intense particle acceleration in the shock fronts of both objects. This suggests that the SNRs are prime candidates for very-high-energy (VHE; E > 0.1 TeV) γ-ray observations. G1.9+0.3, recently established as the youngest known SNR in the Galaxy, also offers a unique opportunity to study the earliest stages of SNR evolution in the VHE domain. The purpose of this work is to probe the level of VHE γ-ray emission from both SNRs and use this to constrain their physical properties. Observations were conducted with the H.E.S.S. (High Energy Stereoscopic System) Cherenkov Telescope Array over a more than six-year period spanning 2004-2010. The obtained data have effective livetimes of 67 h for G1.9+0.3 and 16 h for G330.2+1.0. The data are analysed in the context of the multiwavelength observations currently available and in the framework of both leptonic and hadronic particle acceleration scenarios. No significant γ-ray signal from G1.9+0.3 or G330.2+1.0 was detected. Upper limits (99 per cent confidence level) to the TeV flux from G1.9+0.3 and G330.2+1.0 for the assumed spectral index Γ = 2.5 were set at 5.6 × 10-13 cm-2 s-1 above 0.26 TeV and 3.2 × 10-12 cm-2 s-1 above 0.38 TeV, respectively. In a one-zone leptonic scenario, these upper limits imply lower limits on the interior magnetic field to BG1.9 ≳ 12 μG for G1.9+0.3 and to BG330 ≳ 8 μG for G330.2+1.0. In a hadronic scenario, the low ambient densities and the large distances to the SNRs result in very low predicted fluxes, for which the H.E.S.S. upper limits are not constraining.

  11. Prevalence of 1691G>A FV mutation in females from Bosnia and Herzegovina - a preliminary report

    PubMed Central

    Yaljevac, Amina; Mehić, Bakir; Kiseljaković, Emina; Ibrulj, Slavka; Garstka, Agnieszka; Adler, Grazyna

    2013-01-01

    Factor V is the liver-synthesized multidomain glycoprotein encoded by a gene localised on chromosome 1q23. The point mutation 1691G>A in this gene results in formation of an altered protein of V Factor resistant to activated protein C (APC) cleavage. This mutation alone is the most frequent cause of inborn thrombophilia and the most widely acknowledged genetic risk factor for venous thrombosis in a Caucasian population. This study was designed to provide the first estimate of the frequency of the allele 1691A FV in the Bosnian female population. The 1691G>A FV mutation was examined by polymerase chain reaction-restriction fragment length polymorphism, in a group of 67 women, mean age of 58.6 years with no history of cardiovascural incident. Our findings revealed an absence of the mutated allele 1691A FV in the studied group. This is the first report on the 1691G>A FV mutation in a population from Bosnia and Herzegovina. Further research is needed to establish prevalence of the mutated allele in the population from Bosnia and Herzegovina. PMID:23448608

  12. SDHAF2 mutations in familial and sporadic paraganglioma and phaeochromocytoma.

    PubMed

    Bayley, Jean-Pierre; Kunst, Henricus P M; Cascon, Alberto; Sampietro, Maria Lourdes; Gaal, José; Korpershoek, Esther; Hinojar-Gutierrez, Adolfo; Timmers, Henri J L M; Hoefsloot, Lies H; Hermsen, Mario A; Suárez, Carlos; Hussain, A Karim; Vriends, Annette H J T; Hes, Frederik J; Jansen, Jeroen C; Tops, Carli M; Corssmit, Eleonora P; de Knijff, Peter; Lenders, Jacques W M; Cremers, Cor W R J; Devilee, Peter; Dinjens, Winand N M; de Krijger, Ronald R; Robledo, Mercedes

    2010-04-01

    Paragangliomas and phaeochromocytomas are neuroendocrine tumours associated frequently with germline mutations of SDHD, SDHC, and SDHB. Previous studies have shown the imprinted SDHAF2 gene to be mutated in a large Dutch kindred with paragangliomas. We aimed to identify SDHAF2 mutation carriers, assess the clinical genetic significance of SDHAF2, and describe the associated clinical phenotype. We undertook a multicentre study in Spain and The Netherlands in 443 apparently sporadic patients with paragangliomas and phaeochromocytomas who did not have mutations in SDHD, SDHC, or SDHB. We analysed DNA of 315 patients for germline mutations of SDHAF2; a subset (n=200) was investigated for gross gene deletions. DNA from a group of 128 tumours was studied for somatic mutations. We also examined a Spanish family with head and neck paragangliomas with a young age of onset for the presence of SDHAF2 mutations, undertook haplotype analysis in this kindred, and assessed their clinical phenotype. We did not identify any germline or somatic mutations of SDHAF2, and no gross gene deletions were noted in the subset of apparently sporadic patients analysed. Investigation of the Spanish family identified a pathogenic germline DNA mutation of SDHAF2, 232G-->A (Gly78Arg), identical to the Dutch kindred. SDHAF2 mutations do not have an important role in phaeochromocytoma and are rare in head and neck paraganglioma. Identification of a second family with the Gly78Arg mutation suggests that this is a crucial residue for the function of SDHAF2. We conclude that SDHAF2 mutation analysis is justified in very young patients with isolated head and neck paraganglioma without mutations in SDHD, SDHC, or SDHB, and in individuals with familial antecedents who are negative for mutations in all other risk genes. Dutch Cancer Society, European Union 6th Framework Program, Fondo Investigaciones Sanitarias, Fundación Mutua Madrileña, and Red Temática de Investigación Cooperativa en Cáncer. 2010

  13. Mutation analysis in the long isoform of USH2A in American patients with Usher Syndrome type II.

    PubMed

    Yan, Denise; Ouyang, Xiaomei; Patterson, D Michael; Du, Li Lin; Jacobson, Samuel G; Liu, Xue-Zhong

    2009-12-01

    Usher syndrome type II (USH2) is an autosomal recessive disorder characterized by moderate to severe hearing impairment and progressive visual loss due to retinitis pigmentosa (RP). To identify novel mutations and determine the frequency of USH2A mutations as a cause of USH2, we have carried out mutation screening of all 72 coding exons and exon-intron splice sites of the USH2A gene. A total of 20 USH2 American probands of European descent were analyzed using single strand conformational polymorphism (SSCP) and direct sequencing methods. Ten different USH2A mutations were identified in 55% of the probands, five of which were novel mutations. The detected mutations include three missense, three frameshifts and four nonsense mutations, with c.2299delG/p.E767fs mutation, accounting for 38.9% of the pathological alleles. Two cases were homozygotes, two cases were compound heterozygotes and one case had complex allele with three variants. In seven probands, only one USH2A mutation was detected and no pathological mutation was found in the remaining eight individuals. Altogether, our data support the fact that c.2299delG/p.E767fs is indeed the most common USH2A mutation found in USH2 patients of European Caucasian background. Thus, if screening for mutations in USH2A is considered, it is reasonable to screen for the c.2299delG mutation first.

  14. A systematic comparison of all mutations in hereditary sensory neuropathy type I (HSAN I) reveals that the G387A mutation is not disease associated.

    PubMed

    Hornemann, Thorsten; Penno, Anke; Richard, Stephane; Nicholson, Garth; van Dijk, Fleur S; Rotthier, Annelies; Timmerman, Vincent; von Eckardstein, Arnold

    2009-04-01

    Hereditary sensory neuropathy type 1 (HSAN I) is an autosomal dominant inherited neurodegenerative disorder of the peripheral nervous system associated with mutations in the SPTLC1 subunit of the serine palmitoyltransferase (SPT). Four missense mutations (C133W, C133Y, V144D and G387A) in SPTLC1 were reported to cause HSAN I. SPT catalyses the condensation of Serine and Palmitoyl-CoA, which is the first and rate-limiting step in the de novo synthesis of ceramides. Earlier studies showed that C133W and C133Y mutants have a reduced activity, whereas the impact of the V144D and G387A mutations on the human enzyme was not tested yet. In this paper, we show that none of the HSAN I mutations interferes with SPT complex formation. We demonstrate that also V144D has a reduced SPT activity, however to a lower extent than C133W and C133Y. In contrast, the G387A mutation showed no influence on SPT activity. Furthermore, the growth phenotype of LY-B cells--a SPTLC1 deficient CHO cell line--could be reversed by expressing either the wild-type SPTLC1 or the G387A mutant, but not the C133W mutant. This indicates that the G387A mutation is most likely not directly associated with HSAN I. These findings were genetically confirmed by the identification of a nuclear HSAN family which showed segregation of the G387A variant as a non-synonymous SNP.

  15. Anatomic & metabolic brain markers of the m.3243A>G mutation: A multi-parametric 7T MRI study.

    PubMed

    Haast, Roy A M; Ivanov, Dimo; IJsselstein, Rutger J T; Sallevelt, Suzanne C E H; Jansen, Jacobus F A; Smeets, Hubert J M; de Coo, Irenaeus F M; Formisano, Elia; Uludağ, Kâmil

    2018-01-01

    One of the most common mitochondrial DNA (mtDNA) mutations, the A to G transition at base pair 3243, has been linked to changes in the brain, in addition to commonly observed hearing problems, diabetes and myopathy. However, a detailed quantitative description of m.3243A>G patients' brains has not been provided so far. In this study, ultra-high field MRI at 7T and volume- and surface-based data analyses approaches were used to highlight morphology (i.e. atrophy)-, microstructure (i.e. myelin and iron concentration)- and metabolism (i.e. cerebral blood flow)-related differences between patients (N = 22) and healthy controls (N = 15). The use of quantitative MRI at 7T allowed us to detect subtle changes of biophysical processes in the brain with high accuracy and sensitivity, in addition to typically assessed lesions and atrophy. Furthermore, the effect of m.3243A>G mutation load in blood and urine epithelial cells on these MRI measures was assessed within the patient population and revealed that blood levels were most indicative of the brain's state and disease severity, based on MRI as well as on neuropsychological data. Morphometry MRI data showed a wide-spread reduction of cortical, subcortical and cerebellar gray matter volume, in addition to significantly enlarged ventricles. Moreover, surface-based analyses revealed brain area-specific changes in cortical thickness (e.g. of the auditory cortex), and in T 1 , T 2 * and cerebral blood flow as a function of mutation load, which can be linked to typically m.3243A>G-related clinical symptoms (e.g. hearing impairment). In addition, several regions linked to attentional control (e.g. middle frontal gyrus), the sensorimotor network (e.g. banks of central sulcus) and the default mode network (e.g. precuneus) were characterized by alterations in cortical thickness, T 1 , T 2 * and/or cerebral blood flow, which has not been described in previous MRI studies. Finally, several hypotheses, based either on vascular

  16. Role of polyamines at the G1/S boundary and G2/M phase of the cell cycle.

    PubMed

    Yamashita, Tomoko; Nishimura, Kazuhiro; Saiki, Ryotaro; Okudaira, Hiroyuki; Tome, Mayuko; Higashi, Kyohei; Nakamura, Mizuho; Terui, Yusuke; Fujiwara, Kunio; Kashiwagi, Keiko; Igarashi, Kazuei

    2013-06-01

    The role of polyamines at the G1/S boundary and in the G2/M phase of the cell cycle was studied using synchronized HeLa cells treated with thymidine or with thymidine and aphidicolin. Synchronized cells were cultured in the absence or presence of α-difluoromethylornithine (DFMO), an inhibitor of ornithine decarboxylase, plus ethylglyoxal bis(guanylhydrazone) (EGBG), an inhibitor of S-adenosylmethionine decarboxylase. When polyamine content was reduced by treatment with DFMO and EGBG, the transition from G1 to S phase was delayed. In parallel, the level of p27(Kip1) was greatly increased, so its mechanism was studied in detail. Synthesis of p27(Kip1) was stimulated at the level of translation by a decrease in polyamine levels, because of the existence of long 5'-untranslated region (5'-UTR) in p27(Kip1) mRNA. Similarly, the transition from the G2/M to the G1 phase was delayed by a reduction in polyamine levels. In parallel, the number of multinucleate cells increased by 3-fold. This was parallel with the inhibition of cytokinesis due to an unusual distribution of actin and α-tubulin at the M phase. Since an association of polyamines with chromosomes was not observed by immunofluorescence microscopy at the M phase, polyamines may have only a minor role in structural changes of chromosomes at the M phase. In general, the involvement of polyamines at the G2/M phase was smaller than that at the G1/S boundary. Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. Genotype-phenotype correlation and identification of two novel SRD5A2 mutations in 33 Chinese patients with hypospadias.

    PubMed

    Yuan, Shimin; Meng, Lanlan; Zhang, Yanan; Tu, Chaofeng; Du, Juan; Li, Wen; Liang, Ping; Lu, Guangxiu; Tan, Yue-Qiu

    2017-09-01

    Hypospadias, a common congenital malformation of male external genitalia, is characterized mainly by an aberrant opening of the urethra on the ventral side of the penis. Depending on the severity of the disease, it can be classified into three types: anterior, middle, and posterior. In our study, 33 patients with hypospadias were recruited, including eight with anterior hypospadias and 25 with posterior hypospadias. We performed mutation analysis of the SRD5A2, AR and HSD17B3 genes in these patients. Eight different SRD5A2 mutations were detected in 15 patients with posterior hypospadias (60%, 15/25), including six previously described mutations (p.Q6X, Q71X, p.L20P, p.G203S, p.R227Q, and p.R246Q) and two novel mutations (p.G196R and p.L73Pfs ∗ 17). One AR gene mutation (p.A597T) was found in a patient and no HSD17B3 mutations were detected. Additionally, we carried out routine semen analyses in all adult patients. Combing mutation analysis with semen examination results, showed that whole five adult patients who carried SRD5A2 mutations had abnormal semen quality. In summary, all the detected mutations were responsible for the clinical features observed in these 16 patients. Our data suggest that mutations of the SRD5A2 gene are the main causes of posterior hypospadias and seem to affect the semen quality of adult patients, whereas mutations in AR and HSD17B3 gene were rare in these hypospadias patients. Our study expanded the SRD5A2 mutation spectrum in the Han Chinese population and provided useful information for genetic and reproductive counselling for patients with hypospadias. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. A Comparison between CHEK2*1100delC/I157T Mutation Carrier and Noncarrier Breast Cancer Patients: A Clinicopathological Analysis.

    PubMed

    Huszno, Joanna; Budryk, Magdalena; Kołosza, Zofia; Tęcza, Karolina; Pamuła Piłat, Jolanta; Nowara, Elżbieta; Grzybowska, Ewa

    2016-01-01

    The suppressor gene CHEK2 encodes a cell cycle checkpoint kinase, involved in cell cycle regulation, apoptosis and response to DNA damage. The aim of this study was to analyze the differences between CHEK2 mutation carriers (CHEK2*1100delC/I157T) and noncarriers with respect to clinicopathological factors. We reviewed the medical records of 100 early breast cancer patients (46 mutation carriers and 54 noncarriers) who were treated with chemotherapy, hormonotherapy or trastuzumab. CHEK2 mutation carriers were older (>65 years) than noncarriers (17 vs. 7%; p = 0.215). Twenty-five (54%) of them had a history of cancer in the family. Gastric cancer in the family history was detected in 11% of mutation carriers and in 2% of noncarriers (p = 0.092). There was a trend for more frequent lymph node metastases in patients without the mutation in comparison to mutation carriers (46 vs. 28%; p = 0.098). Luminal B type breast cancer was detected more often in carriers (39 vs. 20%; p = 0.048). Breast-conserving treatment was also conducted more often in mutation carriers (57 vs. 31%; p = 0.015). Histologic grades G1/G2 were detected more frequently in mutation carriers (82 vs. 70%; p = 0.212). Mutation carriers were characterized by older age, a history of gastric cancer in the family, locally advanced disease, lower histologic grade and luminal B type breast cancer. © 2016 S. Karger AG, Basel.

  19. Mutations in CDK5RAP2 cause Seckel syndrome.

    PubMed

    Yigit, Gökhan; Brown, Karen E; Kayserili, Hülya; Pohl, Esther; Caliebe, Almuth; Zahnleiter, Diana; Rosser, Elisabeth; Bögershausen, Nina; Uyguner, Zehra Oya; Altunoglu, Umut; Nürnberg, Gudrun; Nürnberg, Peter; Rauch, Anita; Li, Yun; Thiel, Christian Thomas; Wollnik, Bernd

    2015-09-01

    Seckel syndrome is a heterogeneous, autosomal recessive disorder marked by prenatal proportionate short stature, severe microcephaly, intellectual disability, and characteristic facial features. Here, we describe the novel homozygous splice-site mutations c.383+1G>C and c.4005-9A>G in CDK5RAP2 in two consanguineous families with Seckel syndrome. CDK5RAP2 (CEP215) encodes a centrosomal protein which is known to be essential for centrosomal cohesion and proper spindle formation and has been shown to be causally involved in autosomal recessive primary microcephaly. We establish CDK5RAP2 as a disease-causing gene for Seckel syndrome and show that loss of functional CDK5RAP2 leads to severe defects in mitosis and spindle organization, resulting in cells with abnormal nuclei and centrosomal pattern, which underlines the important role of centrosomal and mitotic proteins in the pathogenesis of the disease. Additionally, we present an intriguing case of possible digenic inheritance in Seckel syndrome: A severely affected child of nonconsanguineous German parents was found to carry heterozygous mutations in CDK5RAP2 and CEP152. This finding points toward a potential additive genetic effect of mutations in CDK5RAP2 and CEP152.

  20. Mutations in CDK5RAP2 cause Seckel syndrome

    PubMed Central

    Yigit, Gökhan; Brown, Karen E; Kayserili, Hülya; Pohl, Esther; Caliebe, Almuth; Zahnleiter, Diana; Rosser, Elisabeth; Bögershausen, Nina; Uyguner, Zehra Oya; Altunoglu, Umut; Nürnberg, Gudrun; Nürnberg, Peter; Rauch, Anita; Li, Yun; Thiel, Christian Thomas; Wollnik, Bernd

    2015-01-01

    Seckel syndrome is a heterogeneous, autosomal recessive disorder marked by prenatal proportionate short stature, severe microcephaly, intellectual disability, and characteristic facial features. Here, we describe the novel homozygous splice-site mutations c.383+1G>C and c.4005-9A>G in CDK5RAP2 in two consanguineous families with Seckel syndrome. CDK5RAP2 (CEP215) encodes a centrosomal protein which is known to be essential for centrosomal cohesion and proper spindle formation and has been shown to be causally involved in autosomal recessive primary microcephaly. We establish CDK5RAP2 as a disease-causing gene for Seckel syndrome and show that loss of functional CDK5RAP2 leads to severe defects in mitosis and spindle organization, resulting in cells with abnormal nuclei and centrosomal pattern, which underlines the important role of centrosomal and mitotic proteins in the pathogenesis of the disease. Additionally, we present an intriguing case of possible digenic inheritance in Seckel syndrome: A severely affected child of nonconsanguineous German parents was found to carry heterozygous mutations in CDK5RAP2 and CEP152. This finding points toward a potential additive genetic effect of mutations in CDK5RAP2 and CEP152. PMID:26436113

  1. A Novel MAPT Mutation, G55R, in a Frontotemporal Dementia Patient Leads to Altered Tau Function

    PubMed Central

    Guzman, Elmer; Barczak, Anna; Chodakowska-Żebrowska, Małgorzata; Barcikowska, Maria; Feinstein, Stuart

    2013-01-01

    Over two dozen mutations in the gene encoding the microtubule associated protein tau cause a variety of neurodegenerative dementias known as tauopathies, including frontotemporal dementia (FTD), PSP, CBD and Pick's disease. The vast majority of these mutations map to the C-terminal region of tau possessing microtubule assembly and microtubule dynamics regulatory activities as well as the ability to promote pathological tau aggregation. Here, we describe a novel and non-conservative tau mutation (G55R) mapping to an alternatively spliced exon encoding part of the N-terminal region of the protein in a patient with the behavioral variant of FTD. Although less well understood than the C-terminal region of tau, the N-terminal region can influence both MT mediated effects as well as tau aggregation. The mutation changes an uncharged glycine to a basic arginine in the midst of a highly conserved and very acidic region. In vitro, 4-repeat G55R tau nucleates microtubule assembly more effectively than wild-type 4-repeat tau; surprisingly, this effect is tau isoform specific and is not observed in a 3-repeat G55R tau versus 3-repeat wild-type tau comparison. In contrast, the G55R mutation has no effect upon the abilities of tau to regulate MT growing and shortening dynamics or to aggregate. Additionally, the mutation has no effect upon kinesin translocation in a microtubule gliding assay. Together, (i) we have identified a novel tau mutation mapping to a mutation deficient region of the protein in a bvFTD patient, and (ii) the G55R mutation affects the ability of tau to nucleate microtubule assembly in vitro in a 4-repeat tau isoform specific manner. This altered capability could markedly affect in vivo microtubule function and neuronal cell biology. We consider G55R to be a candidate mutation for bvFTD since additional criteria required to establish causality are not yet available for assessment. PMID:24086739

  2. [Frequency of CHEK2 gene mutations in patients with breast cancer from the Republic of Bashkortostan].

    PubMed

    2014-01-01

    Several studies have shown, that mutation in CHEK2 gene can increase the risk of different cancers, including breast cancer (BC). Clearly, that character of mutations distribution in the defined regions is depended on genetic structure of the population. We conducted the screening of mutations c.1100delC, c.444 + 1G>A, de15395, p.I157T andIp.R145Win CHEK2 gene in patients with breast cancer (n = 977) and in control group (n = 1069) originating from the Republic of Bashkortostan. The mutation de15395 in CHEK2 gene was detected with frequency of 1,23% (12/977)in woman with BC and 0.09% (1/1069) in controls (OR:13.28, CI 95%: 1.72-102.33, p = 0.003). Mutations c.1100delC and c.444 + 1G>A were found in BC patients and controls with frequencies of 0.4%, 0.4% (4/977) and 0.09% (1/1069), 0.2% (2/1069), respectively. The missense mutation p.I157T in CHEK2 was found as the most common variant in two studied cohorts (approximately 5%), but differences did not achieved statistical significance. We found the ethnic specificity in distribution of truncating mutations, which occurs mainly among the women of Slavic origin. All three mutations were identified in women of Russian and Ukrainian ethnic origin. Mutations c.1100delC and c.444 + 1G>A in CHEK2 gene were not detected in Bashkirs and Tatars, but CHEK2 de15395 mutation was observed in Tatars.

  3. Fabry disease: Evidence for a regional founder effect of the GLA gene mutation 30delG in Brazilian patients.

    PubMed

    de Alencar, Dayse Oliveira; Netto, Cristina; Ashton-Prolla, Patricia; Giugliani, Roberto; Ribeiro-Dos-Santos, Ândrea; Pereira, Fernanda; Matte, Ursula; Santos, Ney; Santos, Sidney

    2014-01-01

    The Fabry disease is caused by mutations in the gene ( GLA ) that encodes the enzyme α-galactosidase A (α-Gal A). More than 500 pathologic variants of GLA have already been described, most of them are family-specific. In southern Brazil, a frequent single-base deletion ( GLA 30delG) was identified among four families that do not recognize any common ancestral. In order to investigate the history of this mutation (investigate the founder effect, estimate the mutation age and the most likely source), six gene-flanking microsatellite markers of the X chromosome on the mutation carriers and their parents, 150 individuals from the same population and 300 individuals that compose the Brazilian parental populations (Europeans, Africans and Native Americans) were genotyped. A common haplotype to the four families was identified and characterized as founder. The age was estimated with two statistics software (DMLE 2.2 and ESTIAGE) that agreed with 11 to 12 generations old. This result indicates that the mutation GLA 30delG was originated from a single event on the X chromosome of a European immigrant, during the southern Brazil colonization between 1710 and 1740.

  4. A Peruvian family with a novel PARK2 mutation: Clinical and Pathological Characteristics

    PubMed Central

    Cornejo-Olivas, Mario; Torres, Luis; Mata, Ignacio F; Mazzetti, Pilar; Rivas, Diana; Cosentino, Carlos; Inca-Martinez, Miguel; Cuba, Juan M; Zabetian, Cyrus P.; Leverenz, James B.

    2015-01-01

    Background Mutations in PARK2 result in autosomal recessive young onset Parkinson’s disease (YOPD). Although there have been a number of reports on the clinical characteristics of PARK2-related PD, there is limited information available on the associated neuropathologic changes. Design We describe the clinical and pathological characteristics of a Peruvian family with YOPD. The proband and one unaffected sibling were screened for PARK2 dosage and point mutations. One affected sibling had detailed neuropathologic examination. Setting Instituto Nacional de Ciencias Neurologicas (INCN) in Lima, Peru Results The proband and two of her four siblings developed YOPD and both parents were unaffected. The clinical course has been characterized by akinetic-rigid parkinsonism predominantly affecting the lower limbs and dyskinesias. Analysis of PARK2 showed that the proband is compound heterozygous for a novel acceptor splice site mutation in intron 5 (IVS5-1G>A) and an exon 7 deletion. Neuropathologic assessment of an affected sibling revealed severe neuronal loss in the substantia nigra (SN) and loss of tyrosine hydroxylase immunopositive fibers in the striatum. No Lewy body pathology was observed using standard histology or immunohistochemistry for α-synuclein. Conclusions Consistent with most neuropathologic reports of patients with PARK2 mutations, we did not observe Lewy body inclusions, despite marked SN degeneration and severe dopaminergic denervation of the striatum. These data describe a novel splice site mutation and further extend the clinicopathological characterization of PARK2-associated PD. PMID:25817512

  5. Glycogen storage disease type 1a in three siblings with the G270V mutation.

    PubMed

    Parvari, R; Isam, J; Moses, S W

    1999-04-01

    Glycogen storage disease type 1a (von Gierke disease, GSD1a) is caused by the deficiency of microsomal glucose-6-phosphatase (G6Pase) activity. The cloning of G6Pase cDNA and characterization of the human G6Pase gene enabled the identification of the mutations causing GSD1a. Here we report on the clinical and biochemical features of three GSD1a siblings of a Muslin Arab family with a G270V mutation. Two older patients presented with an unusually mild clinical and biochemical course.

  6. KRAS mutation testing in colorectal cancer: comparison of the results obtained using 3 different methods for the analysis of codons G12 and G13.

    PubMed

    Bihl, Michel P; Hoeller, Sylvia; Andreozzi, Maria Carla; Foerster, Anja; Rufle, Alexander; Tornillo, Luigi; Terracciano, Luigi

    2012-03-01

    Targeting the epidermal growth factor receptor (EGFR) is a new therapeutic option for patients with metastatic colorectal or lung carcinoma. However, the therapy efficiency highly depends on the KRAS mutation status in the given tumour. Therefore a reliable and secure KRAS mutation testing is crucial. Here we investigated 100 colorectal carcinoma samples with known KRAS mutation status (62 mutated cases and 38 wild type cases) in a comparative manner with three different KRAS mutation testing techniques (Pyrosequencing, Dideoxysequencing and INFINITI) in order to test their reliability and sensitivity. For the large majority of samples (96/100, 96%), the KRAS mutation status obtained by all three methods was the same. Only two cases with clear discrepancies were observed. One case was reported as wild type by the INFINITI method while the two other methods detected a G13C mutation. In the second case the mutation could be detected by the Pyrosequencing and INFINITI method (15% and 15%), while no signal for mutation could be observed with the Dideoxysequencing method. Additional two unclear results were due to a detection of a G12V with the INFINITI method, which was below cut-off when repeated and which was not detectable by the other two methods and very weak signals in a G12V mutated case with the Dideoxy- and Pyroseqencing method compared to the INFINITI method, respectively. In summary all three methods are reliable and robust methods in detecting KRAS mutations. INFINITI, however seems to be slightly more sensitive compared to Dideoxy- and Pyrosequencing.

  7. Impaired sense of smell and color discrimination in monogenic and idiopathic Parkinson's disease.

    PubMed

    Kertelge, Lena; Brüggemann, Norbert; Schmidt, Alexander; Tadic, Vera; Wisse, Claudia; Dankert, Sylwia; Drude, Laura; van der Vegt, Joyce; Siebner, Hartwig; Pawlack, Heike; Pramstaller, Peter P; Behrens, Maria Isabel; Ramirez, Alfredo; Reichel, Dirk; Buhmann, Carsten; Hagenah, Johann; Klein, Christine; Lohmann, Katja; Kasten, Meike

    2010-11-15

    Olfaction is typically impaired in idiopathic Parkinson's disease (IPD), but its role is uncertain in monogenic PD. Diminished color discrimination has been suggested as another early sign of dopaminergic dysfunction but not been systematically studied. Furthermore, it is unknown whether both deficits are linked. We examined 100 patients with IPD, 27 manifesting mutation carriers (MC), 20 nonmanifesting mutation carriers (NMC), and 110 controls. Participants underwent a standardized neurological examination, the University of Pennsylvania Smell Identification Test (UPSIT), the Farnsworth-Munsell (FM) color discrimination test, and mutation testing in known PD genes. The monogenic group consisted of 15 Parkin (6MC/9NMC), 17 PINK1 (10MC/7NMC), 8 LRRK2 (4MC/4NMC), 3 SNCA (MC), and 4 ATP13A2 (MC) carriers. Olfaction was most impaired in IPD (UPSIT percentiles 10.1 ± 13.5) compared with all other groups (MC 13.8 ± 11.9, NMC 19.6 ± 13.0, controls 33.8 ± 22.4). Within MC, carriers of two mutations in Parkin and PINK1 showed higher UPSIT percentiles than LRRK2 and SNCA carriers. Color discrimination was reduced in IPD (FM total error score 134.8 ± 92.7). In MC (122.4 ± 142.4), the reduction was most pronounced in LRRK2, NMC (80.0 ± 38.8) were comparable with controls (97.2 ± 61.1). UPSIT and FM scores were correlated in the control (r = -0.305; P = 0.002) and the IPD group (r = -0.303; P = 0.006) but not among mutation carriers. First, we confirmed olfaction and color discrimination to be impaired in IPD and suggest olfaction to be a premotor sign. Second, olfaction differed between carriers with one and two mutations in Parkin/PINK1-associated PD. Third, olfaction and color discrimination impairment do not necessarily evolve in parallel. © 2010 Movement Disorder Society.

  8. Methylation of 23S rRNA Nucleotide G748 by RlmAII Methyltransferase Renders Streptococcus pneumoniae Telithromycin Susceptible

    PubMed Central

    Sato, Yoshiharu; Shoji, Tatsuma; Yamamoto, Tomoko

    2013-01-01

    Several posttranscriptional modifications of bacterial rRNAs are important in determining antibiotic resistance or sensitivity. In all Gram-positive bacteria, dimethylation of nucleotide A2058, located in domain V of 23S rRNA, by the dimethyltransferase Erm(B) results in low susceptibility and resistance to telithromycin (TEL). However, this is insufficient to produce high-level resistance to TEL in Streptococcus pneumoniae. Inactivation of the methyltransferase RlmAII, which methylates the N-1 position of nucleotide G748, located in hairpin 35 of domain II of 23S rRNA, results in increased resistance to TEL in erm(B)-carrying S. pneumoniae. Sixteen TEL-resistant mutants (MICs, 16 to 32 μg/ml) were obtained from a clinically isolated S. pneumoniae strain showing low TEL susceptibility (MIC, 2 μg/ml), with mutation resulting in constitutive dimethylation of A2058 because of nucleotide differences in the regulatory region of erm(B) mRNA. Primer extension analysis showed that the degree of methylation at G748 in all TEL-resistant mutants was significantly reduced by a mutation in the gene encoding RlmAII to create a stop codon or change an amino acid residue. Furthermore, RNA footprinting with dimethyl sulfate and a molecular modeling study suggested that methylation of G748 may contribute to the stable interaction of TEL with domain II of 23S rRNA, even after dimethylation of A2058 by Erm(B). This novel finding shows that methylation of G748 by RlmAII renders S. pneumoniae TEL susceptible. PMID:23716046

  9. Methylation of 23S rRNA nucleotide G748 by RlmAII methyltransferase renders Streptococcus pneumoniae telithromycin susceptible.

    PubMed

    Takaya, Akiko; Sato, Yoshiharu; Shoji, Tatsuma; Yamamoto, Tomoko

    2013-08-01

    Several posttranscriptional modifications of bacterial rRNAs are important in determining antibiotic resistance or sensitivity. In all Gram-positive bacteria, dimethylation of nucleotide A2058, located in domain V of 23S rRNA, by the dimethyltransferase Erm(B) results in low susceptibility and resistance to telithromycin (TEL). However, this is insufficient to produce high-level resistance to TEL in Streptococcus pneumoniae. Inactivation of the methyltransferase RlmA(II), which methylates the N-1 position of nucleotide G748, located in hairpin 35 of domain II of 23S rRNA, results in increased resistance to TEL in erm(B)-carrying S. pneumoniae. Sixteen TEL-resistant mutants (MICs, 16 to 32 μg/ml) were obtained from a clinically isolated S. pneumoniae strain showing low TEL susceptibility (MIC, 2 μg/ml), with mutation resulting in constitutive dimethylation of A2058 because of nucleotide differences in the regulatory region of erm(B) mRNA. Primer extension analysis showed that the degree of methylation at G748 in all TEL-resistant mutants was significantly reduced by a mutation in the gene encoding RlmA(II) to create a stop codon or change an amino acid residue. Furthermore, RNA footprinting with dimethyl sulfate and a molecular modeling study suggested that methylation of G748 may contribute to the stable interaction of TEL with domain II of 23S rRNA, even after dimethylation of A2058 by Erm(B). This novel finding shows that methylation of G748 by RlmA(II) renders S. pneumoniae TEL susceptible.

  10. Prevalence of ESR1 E380Q mutation in tumor tissue and plasma from Japanese breast cancer patients.

    PubMed

    Takeshita, Takashi; Yamamoto, Yutaka; Yamamoto-Ibusuki, Mutsuko; Sueta, Aiko; Tomiguchi, Mai; Murakami, Keiichi; Omoto, Yoko; Iwase, Hirotaka

    2017-11-22

    ESR1 mutations have attracted attention as a potentially important marker and treatment target in endocrine therapy-resistant breast cancer patients. The E380Q mutation, which is one of the ESR1 mutations, is associated with estradiol (E2) hypersensitivity, increased DNA binding to the estrogen response element, and E2-independent constitutive trans-activation activity, but its frequency in ESR1 mutations remains unknown. The present study aimed to investigate the E380Q mutation in comparison with the other representative ESR1 mutations. We screened a total of 62 patients (66 tumor tissues and 69 plasma cell-free DNA (cfDNA)) to detect ESR1 mutations (E380Q, Y537S, Y537N, Y537C, and D538G) using droplet-digital polymerase chain reaction. Plasma was collected at more than two points of the clinical course, in whom changes of ESR1 mutations under treatment were investigated. We detected ESR1 mutations in 21% (12/57) of MBCs. The E380Q ESR1 mutation was found in 16% (2/12) and the other ESR1 LBD mutations were five (41.6%) of Y537S, and four each (33.3%) of D538G, Y537N, and Y537C, in 12 ESR1 mutant breast cancer patients. Five tumors had multiple ESR1 mutations: three had double ESR1 mutations; Y537S/E380Q, Y37S/Y537C, and Y537S/D538G, and two had triple ESR1 mutations; Y537S/Y537N/D538G. In plasma cfDNA analysis, the E380Q mutation was not detected, but increases in other ESR1 mutations were detected in 46.2% (6/13) of MBC patients under treatment. We have shown that there are distinct populations of ESR1 mutations in metastatic tissue and plasma. Each ESR1 mutation may have different clinical significance, and it will be necessary to investigate them all.

  11. Mitochondrial mutation m.1555A>G as a risk factor for failed newborn hearing screening in a large cohort of preterm infants.

    PubMed

    Göpel, Wolfgang; Berkowski, Sandra; Preuss, Michael; Ziegler, Andreas; Küster, Helmut; Felderhoff-Müser, Ursula; Gortner, Ludwig; Mögel, Michael; Härtel, Christoph; Herting, Egbert

    2014-08-26

    The mitochondrial m.1555A>G mutation is associated with a high rate of permanent hearing loss, if aminoglycosides are given. Preterm infants have an increased risk of permanent hearing loss and are frequently treated with aminoglycoside antibiotics. We genotyped preterm infants with a birth weight below 1500 grams who were prospectively enrolled in a large cohort study for the m.1555A>G mutation. Treatment with aminoglycoside antibiotics in combination with mitochondrial m.1555A>G mutation was tested as a predictor for failed hearing screening at discharge in a multivariate logistic regression analysis. 7056 infants were genotyped and analysed. Low birth weight was the most significant predictor of failed hearing screening (p = 7.3 × 10-10). 12 infants (0.2%) had the m.1555A>G-mutation. In a multivariable logistic regression analysis, the combination of aminoglycoside treatment with m.1555A>G-carrier status was associated with failed hearing screening (p = 0.0058). However, only 3 out of 10 preterm m.1555A>G-carriers who were exposed to aminoglycosides failed hearing screening. The m.1555A>G-mutation was detected in all mothers of m.1555A>G-positive children, but in none of 2993 maternal DNA-samples of m.1555A>G-negative infants. Antenatal screening for the m.1555A>G mutation by maternal genotyping of pregnant women with preterm labour might be a reasonable approach to identify infants who are at increased risk for permanent hearing loss. Additional studies are needed to estimate the relevance of cofactors like aminoglycoside plasma levels and birth weight and the amount of preterm m.1555A>G-carriers with permanent hearing loss.

  12. Three new mutations account for the prevalence of glucose 6 phosphate deshydrogenase (G6PD) deficiency in Tunisia.

    PubMed

    Bendaoud, B; Hosni, I; Mosbahi, I; Hafsia, R; Prehu, C; Abbes, S

    2013-04-01

    A previous study on G6PD deficiency carried out on Tunisian population, led to the finding of seven different mutations with the prevalence of G6PD A- variant. This present study reports 23 new unrelated deficient subjects studied at the molecular level to determine the mutation that causes G6PD deficiency. Using PCR-SSCP of coding regions followed by direct sequencing of abnormal pattern, three new mutations were detected. Two of them are polymorphic intronic mutations. The first is IVS-V 655C-->C/T, found in four female subjects with mild deficiency of class III variant. The second is IVS-VIII 43 G-->A, found in three male subjects with mild deficiency of class III variant. The third mutation is in the exon region so that it changes the primary structure of the molecule. It is cited for the first time and named G6PD Tunisia. This variant affects the exon 7 of the gene at genomic position 15435 G→T. Its cDNA position is 93 G→G/T, it changes arg 246 to leu. This mutation was found in one heterozygote female with deficiency of class II who have had hemolytic anemia due to ingestion of fava beans. Finally, G6PD Med variant, reported before in three cases, was also found in five other cases (four heterozygote females and one male hemizygote). These findings first enlarge the spectre of mutations to be ten variant mutations, characterizing the Tunisian population and also contribute with hemoglobin gene research in our laboratory to trace the whole genetic map of Tunisian population. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  13. Association of breast-fed neonatal hyperbilirubinemia with UGT1A1 polymorphisms: 211G>A (G71R) mutation becomes a risk factor under inadequate feeding.

    PubMed

    Sato, Hiroko; Uchida, Toshihiko; Toyota, Kentaro; Kanno, Miyako; Hashimoto, Taeko; Watanabe, Masashi; Nakamura, Tomohiro; Tamiya, Gen; Aoki, Kuraaki; Hayasaka, Kiyoshi

    2013-01-01

    Breastfeeding jaundice is a well-known phenomenon, but its pathogenesis is still unclear. Increased production of bilirubin, impaired hepatic uptake and metabolism of bilirubin, and increased enterohepatic circulation of bilirubin account for most cases of pathological neonatal hyperbilirubinemia. We previously reported that 211G>A (G71R) mutation of the UGT1A1 gene is prevalent in East Asians and is associated with the development of neonatal hyperbilirubinemia. Recently, significant association of G71R mutation with hyperbilirubinemia in breast-fed neonates was reported. We enrolled 401 full-term Japanese infants, who were exclusively breast-fed without supplementation of formula before developing hyperbilirubinemia, and classified them into two groups based on the degree of maximal body weight loss during the neonatal period. We analyzed the sex, gestational age, delivery mode, body weight at birth, maximal body weight loss and genotypes of G71R and (TA)(7) polymorphic mutations of UGT1A1. Statistical analysis revealed that maximal body weight loss during the neonatal period is the only independent risk factor for the development of neonatal hyperbilirubinemia. The effect of G71R mutation on neonatal hyperbilirubinemia is significant in neonates with 5% or greater maximal body weight loss and its influence increases in parallel with the degree of maximal body weight loss. Our study indicates that G71R mutation is a risk factor for neonatal hyperbilirubinemia only in infants with inadequate breastfeeding and suggests that adequate breastfeeding may overcome the genetic predisposing factor, G71R mutation, for the development of neonatal hyperbilirubinemia.

  14. Description of a new rare alpha-1 antitrypsin mutation in Naples (Italy): PI*M S-Napoli

    PubMed Central

    Mosella, Marco; Accardo, Mariasofia; Molino, Antonio; Maniscalco, Mauro; Zamparelli, Alessandro Sanduzzi

    2018-01-01

    Alpha-1 antitrypsin deficiency is a rare and often underdiagnosed hereditary disorder, which mainly affects the Caucasian population. We report a case of a noncystic fibrosis bronchiectasis patient in the absence of emphysema associated with low serum alpha-1-antitrypsin (AAT) level, in the absence of the most common defective alleles associated with AAT deficiency (PI*S and PI*Z) but with a new mutation in heterozygosis. This mutation is characterized by the substitution in the coding region of exon 3, of a guanine (G) for a thymine (T), generating the replacement of a glutamine (Gln) by a histidine (His) in codon 212 (cod 212 GlnCAG > HisCAT), corresponds to a new S allelic variant. This mutation, never identified before, is called S-Napoli. PMID:29387258

  15. Restraint of the G2/M Transition by the SR/RRM Family mRNA Shuttling Binding Protein SNXAHRB1 in Aspergillus nidulans

    PubMed Central

    James, Steven W.; Banta, Travis; Barra, James; Ciraku, Lorela; Coile, Clifford; Cuda, Zach; Day, Ryan; Dixit, Cheshil; Eastlack, Steven; Giang, Anh; Goode, James; Guice, Alexis; Huff, Yulon; Humbert, Sara; Kelliher, Christina; Kobie, Julie; Kohlbrenner, Emily; Mwambutsa, Faustin; Orzechowski, Amanda; Shingler, Kristin; Spell, Casey; Anglin, Sarah Lea

    2014-01-01

    Control of the eukaryotic G2/M transition by CDC2/CYCLINB is tightly regulated by protein–protein interactions, protein phosphorylations, and nuclear localization of CDC2/CYCLINB. We previously reported a screen, in Aspergillus nidulans, for extragenic suppressors of nimX2cdc2 that resulted in the identification of the cold-sensitive snxA1 mutation. We demonstrate here that snxA1 suppresses defects in regulators of the CDK1 mitotic induction pathway, including nimX2cdc2, nimE6cyclinB, and nimT23cdc25, but does not suppress G2-arresting nimA1/nimA5 mutations, the S-arresting nimE10cyclinB mutation, or three other G1/S phase mutations. snxA encodes the A. nidulans homolog of Saccharomyces cerevisiae Hrb1/Gbp2; nonessential shuttling messenger RNA (mRNA)-binding proteins belonging to the serine-arginine-rich (SR) and RNA recognition motif (RRM) protein family; and human heterogeneous ribonucleoprotein-M, a spliceosomal component involved in pre-mRNA processing and alternative splicing. snxAHrb1 is nonessential, its deletion phenocopies the snxA1 mutation, and its overexpression rescues snxA1 and ΔsnxA mutant phenotypes. snxA1 and a second allele isolated in this study, snxA2, are hypomorphic mutations that result from decreased transcript and protein levels, suggesting that snxA acts normally to restrain cell cycle progression. SNXAHRB1 is predominantly nuclear, but is not retained in the nucleus during the partially closed mitosis of A. nidulans. We show that the snxA1 mutation does not suppress nimX2 by altering NIMX2CDC2/NIMECYCLINB kinase activity and that snxA1 or ΔsnxA alter localization patterns of NIMECYCLINB at the restrictive temperatures for snxA1 and nimX2. Together, these findings suggest a novel and previously unreported role of an SR/RRM family protein in cell cycle regulation, specifically in control of the CDK1 mitotic induction pathway. PMID:25104516

  16. Clinical relevance of CHEK2 and NBN mutations in the macedonian population.

    PubMed

    Kostovska, I Maleva; Jakimovska, M; Kubelka-Sabit, K; Karadjozov, M; Arsovski, A; Stojanovska, L; Plaseska-Karanfilska, D

    2015-06-01

    Clinical importance of the most common CHEK2 (IVS2+1 G>A, 1100delC, I157T and del5395) and NBN (R215W and 657del5) gene mutations for breast cancer development in Macedonian breast cancer patients is unknown. We performed a case-control study including 300 Macedonian breast cancer patients and 283 Macedonian healthy controls. Genotyping was done using a fast and highly accurate single-nucleotide primer extension method for the detection of five mutations in a single reaction. The detection of the del5395 was performed using an allele-specific duplex polymerase chain reaction (PCR) assay. We have found that mutations were more frequent in breast cancer patients (n = 13, 4.3%) than in controls (n = 5, 1.8%), although without statistical significance. Twelve patients were heterozygous for one of the analyzed mutations, while one patient had two mutations (NBN R215W and CHEK2 I157T). The most frequent variant was I157T, found in 10 patients and four controls (p = 0.176) and was found to be associated with familial breast cancer (p = 0.041). CHEK2 1100delC and NBN 657del5 were each found in one patient and not in the control group. CHEK2 IVS2+1G>A and del5395 were not found in our cohort. Frequencies of the studied mutations are low and they are not likely to represent alleles of clinical importance in the Macedonian population.

  17. An intronic mutation c.6430-3C>G in the F8 gene causes splicing efficiency and premature termination in hemophilia A.

    PubMed

    Xia, Zunjing; Lin, Jie; Lu, Lingping; Kim, Chol; Yu, Ping; Qi, Ming

    2018-06-01

    : Hemophilia A is a bleeding disorder caused by coagulation factor VIII protein deficiency or dysfunction, which is classified into severe, moderate, and mild according to factor clotting activity. An overwhelming majority of missense and nonsense mutations occur in exons of F8 gene, whereas mutations in introns can also be pathogenic. This study aimed to investigate the effect of an intronic mutation, c.6430-3C>G (IVS22-3C>G), on pre-mRNA splicing of the F8 gene. We applied DNA and cDNA sequencing in a Chinese boy with hemophilia A to search if any pathogenic mutation in the F8 gene. Functional analysis was performed to investigate the effect of an intronic mutation at the transcriptional level. Human Splicing Finder and PyMol were also used to predict its effect. We found the mutation c.6430-3C>G (IVS22-3C>G) in the F8 gene in the affected boy, with his mother being a carrier. cDNA from the mother and pSPL3 splicing assay showed that the mutation IVS22-3C>G results in a two-nucleotide AG inclusion at the 3' end of intron 22 and leads to a truncated coagulation factor VIII protein, with partial loss of the C1 domain and complete loss of the C2 domain. The in-silico tool predicted that the mutation induces altered pre-mRNA splicing by using a cryptic acceptor site in intron 22. The IVS22-3C>G mutation was confirmed to affect pre-mRNA splicing and produce a truncated protein, which reduces the stability of binding between the F8 protein and von Willebrand factor carrier protein due to the loss of an interaction domain.

  18. De novo REEP2 missense mutation in pure hereditary spastic paraplegia.

    PubMed

    Roda, Ricardo H; Schindler, Alice B; Blackstone, Craig

    2017-05-01

    Alterations in proteins that regulate endoplasmic reticulum morphology are common causes of hereditary spastic paraplegia (SPG1-78, plus others). Mutations in the REEP1 gene that encodes an endoplasmic reticulum-shaping protein are well-known causes of SPG31, a common autosomal dominant spastic paraplegia. A closely-related gene, REEP2, is mutated in SPG72, with both autosomal and recessive inheritances. Here, we report a patient with a pure hereditary spastic paraplegia due to a de novo missense mutation (c.119T > G, p.Met40Arg) in REEP2 at a highly-conserved residue very close to another known pathogenic missense change. This represents only the second autosomal dominant SPG72 missense mutation reported.

  19. Structural and Dynamic Characterization of Mutated Keap1 for Varied Affinity toward Nrf2: A Molecular Dynamics Simulation Study.

    PubMed

    Cheng, I-Chung; Chen, Ya-Jyun; Ku, Chia-Wei; Huang, Yu-Wen; Yang, Chia-Ning

    2015-10-26

    Keap1 is an adaptor protein that regulates Nrf2 in response to oxidative stress. Under basal conditions, Nrf2 is negatively regulated through ubiquitination by Keap1. However, upon exposure to oxidative stress, the ubiquitination of Nrf2 is inhibited, resulting in an increased steady-state level of Nrf2 in the nucleus and increased transcription of cytoprotective genes. A gene variant G364C and somatic mutation G430C on Keap1 have recently been reported to substantially impair the Keap1-Nrf2 interaction and to be associated with lung cancer. By contrast, alanine scanning experiments have shown that the mutations S363A, S508A, S555A, and S602A do not affect the ability of Keap1 to bind to Nrf2, regardless of the fact that G364 and G430 are not in contact with Nrf2 whereas the four serine residues are involved in the accommodation of Nrf2 with their hydroxy groups. In this study, molecular dynamics simulations were performed to investigate the structural and dynamic variances among wild-type (WT) Keap1 and the six mutants in unbound form. Principal component analysis of the collected MD trajectories was performed to provide dynamic diversity. Our dynamic and structural observations suggest that the G364C and G430C mutants possess a mobile D385 that moves toward R380, an anchor residue to accommodate an acidic residue in Nrf2, thereby hampering the Keap1-Nrf2 recognition of an electrostatic nature. By contrast, none of the four serine-to-alanine mutants alters the H-bond network formed by the serine backbone to its partner; accordingly, these mutants are almost as intact as the WT structurally and dynamically.

  20. PREVALENCE OF MUTATIONS IN ELANE, GFI1, HAX1, SBDS, WAS, AND G6PC3 IN PATIENTS WITH SEVERE CONGENITAL NEUTROPENIA

    PubMed Central

    Xia, Jun; Bolyard, Audrey Anna; Rodger, Elin; Stein, Steve; Aprikyan, Andrew A.; Dale, David C.; Link, Daniel C.

    2009-01-01

    SUMMARY Severe congenital neutropenia (SCN) is a genetically heterogeneous syndrome associated with mutations of ELANE (ELA2), HAX1, GFI1, WAS, CSF3R or G6PC3. We investigated the prevalence of mutations of ELANE in a cohort of 162 SCN patients for whom blood or bone marrow samples were submitted to the North American Severe Chronic Neutropenia Tissue Repository. Mutations of ELANE were found in 90 of 162 patients (55.6%). Subsequently, we conducted an analysis of a subset of 73 of these cases utilizing a high throughput sequencing approach to determine the prevalence of other mutations associated with SCN. Among the 73 patients, mutations of ELANE were detected in 28. In the remaining 45 patients with wild type ELANE alleles, 5 patients had mutations: GFI1 (1), SBDS (1), WAS (1) and G6PC3 (2); no mutations of HAX1 were detected. In approximately 40% of our cases, the genetic basis of SCN remains unknown. These data suggest that for genetic diagnosis of SCN, ELANE genotyping should first be performed. In patients without ELANE mutations, other known SCN-associated gene mutations will be found rarely and genotyping can be guided by the clinical features of each patient. PMID:19775295

  1. G2S: a web-service for annotating genomic variants on 3D protein structures.

    PubMed

    Wang, Juexin; Sheridan, Robert; Sumer, S Onur; Schultz, Nikolaus; Xu, Dong; Gao, Jianjiong

    2018-06-01

    Accurately mapping and annotating genomic locations on 3D protein structures is a key step in structure-based analysis of genomic variants detected by recent large-scale sequencing efforts. There are several mapping resources currently available, but none of them provides a web API (Application Programming Interface) that supports programmatic access. We present G2S, a real-time web API that provides automated mapping of genomic variants on 3D protein structures. G2S can align genomic locations of variants, protein locations, or protein sequences to protein structures and retrieve the mapped residues from structures. G2S API uses REST-inspired design and it can be used by various clients such as web browsers, command terminals, programming languages and other bioinformatics tools for bringing 3D structures into genomic variant analysis. The webserver and source codes are freely available at https://g2s.genomenexus.org. g2s@genomenexus.org. Supplementary data are available at Bioinformatics online.

  2. Meningocerebrovascular amyloidosis associated with a novel transthyretin mis-sense mutation at codon 18 (TTRD 18G)

    PubMed Central

    Vidal, R.; Garzuly, F.; Budka, H.; Lalowski, M.; Linke, R. P.; Brittig, F.; Frangione, B.; Wisniewski, T.

    1996-01-01

    We describe a novel transthyretin mutation at codon 18 where Asp is replaced by Gly (D18G) in a Hungarian kindred. This mutation is associated with meningocerebrovascular amyloidosis, producing dementia, ataxia, and spasticity. Fifty different transthyretin mutations are related to amyloid deposition, typically producing a peripheral neuropathy or cardiac dysfunction. These symptoms are absent in this family. Up to now, amyloid-beta (A beta), cystatin C, and prion proteins have been known to be deposited as amyloid in the brain, leading to stroke or dementia. With this report we establish that transthyretin amyloid deposition can also produce central nervous system dysfunction as the major clinical symptom. Images Figure 2 Figure 4 PMID:8579098

  3. Mutations, associated with early-onset Alzheimer’s disease, discovered in Asian countries

    PubMed Central

    Bagyinszky, Eva; Youn, Young Chul; An, Seong Soo A; Kim, SangYun

    2016-01-01

    Alzheimer’s disease (AD), the most common form of senile dementia, is a genetically complex disorder. In most Asian countries, the population and the number of AD patients are growing rapidly, and the genetics of AD has been extensively studied, except in Japan. However, recent studies have been started to investigate the genes and mutations associated with AD in Korea, the People’s Republic of China, and Malaysia. This review describes all of the known mutations in three early-onset AD (EOAD) causative genes (APP, PSEN1, and PSEN2) that were discovered in Asian countries. Most of the EOAD-associated mutations have been detected in PSEN1, and several novel PSEN1 mutations were recently identified in patients from various parts of the world, including Asia. Until 2014, no PSEN2 mutations were found in Asian patients; however, emerging studies from Korea and the People’s Republic of China discovered probably pathogenic PSEN2 mutations. Since several novel mutations were discovered in these three genes, we also discuss the predictions on their pathogenic nature. This review briefly summarizes genome-wide association studies of late-onset AD and the genes that might be associated with AD in Asian countries. Standard sequencing is a widely used method, but it has limitations in terms of time, cost, and efficacy. Next-generation sequencing strategies could facilitate genetic analysis and association studies. Genetic testing is important for the accurate diagnosis and for understanding disease-associated pathways and might also improve disease therapy and prevention. PMID:27799753

  4. A novel RNase G mutant that is defective in degradation of adhE mRNA but proficient in the processing of 16S rRNA precursor.

    PubMed

    Wachi, M; Kaga, N; Umitsuki, G; Clark, D P; Nagai, K

    2001-12-21

    Escherichia coli RNase G, encoded by the rng gene, is involved in both the processing of 16S rRNA precursor and the degradation of adhE mRNA. Consequently, defects in RNase G result in elevation of AdhE levels. Furthermore, the adhR430 mutant strain, DC430, is reported to overproduce the AdhE protein in a manner dependent on the adhC81 mutation. We found that overproduction of AdhE by DC430 was reversed to wild-type levels by introduction of a plasmid carrying the wild-type allele of rng. Mapping by P1-phage-mediated transduction also indicated that a mutation involved in AdhE overproduction was located around the rng region in DC430. DNA sequencing of the rng region revealed that DC430 indeed had a mutation in the rng gene: a G1022 to A transition that caused substitution of Gly341 with Ser and which was named rng430. This lies in the highly conserved region of the RNase E/RNase G family, called high similarity region 2 (HSR2). However, very interestingly, rng430 mutant strains did not accumulate the 16.3S precursor of 16S rRNA unlike rng::cat mutants. We also found that the Rng1 mutant protein, which is truncated in its C-terminal domain encompassing HSR2, exhibited a residual processing activity against the 16S rRNA precursor, when overproduced. These results indicate that the HSR2 of RNase G plays an important role in substrate recognition and/or ribonucleolytic action.

  5. The mitochondrial 13513G>A mutation is associated with Leigh disease phenotypes independent of complex I deficiency in muscle.

    PubMed

    Brautbar, Ariel; Wang, Jing; Abdenur, Jose E; Chang, Richard C; Thomas, Janet A; Grebe, Theresa A; Lim, Cynthia; Weng, Shao-Wen; Graham, Brett H; Wong, Lee-Jun

    2008-08-01

    The mitochondrial 13513G>A (D393N) mutation in the ND5 subunit of the respiratory chain complex I was initially described in association with MELAS syndrome. Recent observations have linked this mutation to Leigh disease. We screened for the 13513G>A mutation in a cohort of 265 patients with Leigh and Leigh-like disease. The mutation was found in a total of 5 patients. An additional patient who had clinical presentation consistent with a Leigh-like phenotype but with a normal brain MRI was added to the cohort. None of an additional 88 patients meeting MELAS disease criteria, nor 56 patients with respiratory chain deficiency screened for the 13513G>A were found positive for the mutation. The most frequent clinical manifestations in our patients were hypotonia, ocular and cerebellar involvement. Low mutation heteroplasmy in the range of 20-40% was observed in all 6 patients. This observation is consistent with the previously reported low heteroplasmy of this mutation in some patients with the 13513G>A mutation and complex I deficiency. However, normal complex I activity was observed in two patients in our cohort. As most patients with Leigh-like disease and the 13513G>A mutation have been described with complex I deficiency, this report adds to the previously reported subset of patients with normal respiratory complex function. We conclude that in any patient with Leigh or Leigh-like disease, testing for the 13513G>A mutation is clinically relevant and low mutant loads in blood or muscle may be considered pathogenic, in the presence of normal respiratory chain enzyme activities.

  6. Molecular investigation of active binding site of isoniazid (INH) and insight into resistance mechanism of S315T-MtKatG in Mycobacterium tuberculosis.

    PubMed

    Srivastava, Gaurava; Tripathi, Shubhandra; Kumar, Akhil; Sharma, Ashok

    2017-07-01

    Multi drug resistant tuberculosis is a major threat for mankind. Resistance against Isoniazid (INH), targeting MtKatG protein, is one of the most commonly occurring resistances in MDR TB strains. S315T-MtKatG mutation is widely reported for INH resistance. Despite having knowledge about the mechanism of INH, exact binding site of INH to MtKatG is still uncertain and proposed to have three presumable binding sites (site-1, site-2, and site-3). In the current study docking, molecular dynamics simulation, binding free energy estimation, principal component analysis and free energy landscape analysis were performed to get molecular level details of INH binding site on MtKatG, and to probe the effect of S315T mutation on INH binding. Molecular docking and MD analysis suggested site-1 as active binding site of INH, where the effects of S315T mutation were observed on both access tunnel as well as molecular interaction between INH and its neighboring residues. MMPBSA also supported site-1 as potential binding site with lowest binding energy of -44.201 kJ/mol. Moreover, PCA and FEL revealed that S315T mutation not only reduces the dimension of heme access tunnel but also showed that extra methyl group at 315 position altered heme cavity, enforcing heme group distantly from INH, and thus preventing INH activation. The present study not only investigated the active binding site of INH but also provides a new insight about the conformational changes in the binding site of S315T-MtKatG. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Pharmacogenetics and pathophysiology of CACNA1S mutations in malignant hyperthermia.

    PubMed

    Beam, Teresa A; Loudermilk, Emily F; Kisor, David F

    2017-02-01

    A review of the pharmacogenetics (PGt) and pathophysiology of calcium voltage-gated channel subunit alpha1 S (CACNA1S) mutations in malignant hyperthermia susceptibility type 5 (MHS5; MIM #60188) is presented. Malignant hyperthermia (MH) is a life-threatening hypermetabolic state of skeletal muscle usually induced by volatile, halogenated anesthetics and/or the depolarizing neuromuscular blocker succinylcholine. In addition to ryanodine receptor 1 (RYR1) mutations, several CACNA1S mutations are known to be risk factors for increased susceptibility to MH (MHS). However, the presence of these pathogenic CACNA1S gene variations cannot be used to positively predict MH since the condition is genetically heterogeneous with variable expression and incomplete penetrance. At present, one or at most six CACNA1S mutations display significant linkage or association either to clinically diagnosed MH or to MHS as determined by contracture testing. Additional pathogenic variants in CACNA1S, either alone or in combination with genes affecting Ca 2+ homeostasis, are likely to be discovered in association to MH as whole exome sequencing becomes more commonplace. Copyright © 2017 the American Physiological Society.

  8. Mitochondrial mutation m.1555A>G as a risk factor for failed newborn hearing screening in a large cohort of preterm infants

    PubMed Central

    2014-01-01

    Background The mitochondrial m.1555A>G mutation is associated with a high rate of permanent hearing loss, if aminoglycosides are given. Preterm infants have an increased risk of permanent hearing loss and are frequently treated with aminoglycoside antibiotics. Methods We genotyped preterm infants with a birth weight below 1500 grams who were prospectively enrolled in a large cohort study for the m.1555A>G mutation. Treatment with aminoglycoside antibiotics in combination with mitochondrial m.1555A>G mutation was tested as a predictor for failed hearing screening at discharge in a multivariate logistic regression analysis. Results 7056 infants were genotyped and analysed. Low birth weight was the most significant predictor of failed hearing screening (p = 7.3 × 10-10). 12 infants (0.2%) had the m.1555A>G-mutation. In a multivariable logistic regression analysis, the combination of aminoglycoside treatment with m.1555A>G-carrier status was associated with failed hearing screening (p = 0.0058). However, only 3 out of 10 preterm m.1555A>G-carriers who were exposed to aminoglycosides failed hearing screening. The m.1555A>G-mutation was detected in all mothers of m.1555A>G-positive children, but in none of 2993 maternal DNA-samples of m.1555A>G-negative infants. Conclusion Antenatal screening for the m.1555A>G mutation by maternal genotyping of pregnant women with preterm labour might be a reasonable approach to identify infants who are at increased risk for permanent hearing loss. Additional studies are needed to estimate the relevance of cofactors like aminoglycoside plasma levels and birth weight and the amount of preterm m.1555A>G-carriers with permanent hearing loss. PMID:25155176

  9. Cis-oriented solvent-front EGFR G796S mutation in tissue and ctDNA in a patient progressing on osimertinib: a case report and review of the literature.

    PubMed

    Klempner, Samuel J; Mehta, Pareen; Schrock, Alexa B; Ali, Siraj M; Ou, Sai-Hong Ignatius

    2017-01-01

    Acquired resistance to epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKI) is a universal event and limits clinical efficacy. The third-generation EGFR inhibitor osimertinib is active in EGFR-mutant/T790M positive non-small-cell lung cancer. Mechanisms of acquired resistance are emerging, and here we describe a cis -oriented solvent-front EGFR G796S mutation as the resistance mechanism observed in a progression biopsy and circulating tumor DNA (ctDNA) from a patient with initial response followed by progression on osimertinib. This is one of the earliest reports of a sole solvent-front tertiary EGFR mutation as a resistance mechanism to osimertinib. Our case suggests a monoclonal resistance mechanism. We review the importance of the solvent-front residues across TKIs and describe known osimertinib resistance mechanisms. We observe that nearly all clinical osimertinib-resistant tertiary EGFR mutations are oriented in cis with EGFR T790M. This case highlights the importance of mutations affecting EGFR kinase domains and supports the feasibility of broad panel ctDNA assays for detection of novel acquired resistance and tumor heterogeneity in routine clinical care.

  10. Discovery of 2,4-diarylaminopyrimidines bearing a resorcinol motif as novel ALK inhibitors to overcome the G1202R resistant mutation.

    PubMed

    Geng, Kaijun; Xia, Zongjun; Ji, Yinchun; Zhang, Ruisi Ruthy; Sun, Deqiao; Ai, Jing; Song, Zilan; Geng, Meiyu; Zhang, Ao

    2018-01-20

    To address drug resistance caused by ALK kinase mutations, especially the most refractory and predominant mutation G1202R for the second-generation ALK inhibitor, a series of new diarylaminopyrimidine analogues were designed by incorporating a resorcinol moiety (A-ring) to interact the ALK kinase domain where the G1202R is located. Compound 12d turns out as the most potent with IC 50 values of 1.7, 3.5, and 1.8 nM against ALK wild type, gatekeeper mutant L1196M, and the G1202R mutant, respectively. More importantly, compound 12d has excellent inhibitory effects against the proliferation of BaF3 cells specifically expressing ALK wild type, gatekeeper L1196M, and the most challenging mutant G1202R, with IC 50 values all less than 1.5 nM. Collectively, compound 12d is worthy of further investigation as a new more potent third-generation ALK inhibitor to circumvent drug resistance of both the first-generation and the second-generation inhibitors. Copyright © 2017. Published by Elsevier Masson SAS.

  11. 48 CFR 2019.705 - Responsibilities of the contracting officer under the subcontracting assistance program.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... Regulations System NUCLEAR REGULATORY COMMISSION SOCIOECONOMIC PROGRAMS SMALL BUSINESS PROGRAMS Subcontracting With Small Business, Small Disadvantaged Business, and Women-Owned Small Business Concerns 2019.705...

  12. Genetic analysis and literature review of Chinese patients with familial renal glucosuria: Identification of a novel SLC5A2 mutation.

    PubMed

    Wang, Xiaojing; Yu, Miao; Wang, Tong; Zhang, Huabing; Ping, Fan; Zhang, Qian; Xu, Jianping; Feng, Kai; Xiao, Xinhua

    2017-06-01

    Familial renal glucosuria (FRG) is an inherited renal tubular disorder characterized by persistent isolated glucosuria with normal blood glucose. SLC5A2 gene mutation was the causative of FRG. Molecular genetic analysis of SLC5A2 gene by Sanger sequencing was conducted in two unrelated non-consanguineous Chinese families with isolated glucosuria. Extensive laboratory test and physical examination were performed. In silico algorithms were used to explore the potential effect of novel mutation on SGLT2 function. We also summarized the reported SLC5A2 mutations in the Chinese patients with FRG. A novel missense mutation (c.877A>T, p.Ser293Cys) in exon 3 was detected in proband 1 with weight loss accompanying by glucosuria and in her father with normal phenotype. In family 2, a previously reported compound heterozygous mutation (c.229G>C, p.Gly77Arg; c.1540C>T, p.Pro514Ser) was identified, and her healthy parents were heterozygous mutation carriers. The p.S293C mutation was predicted to be pathogenic. No hot spot mutation was found in reported Chinese patients with FRG. The novel pathogenic SLC5A2 mutation p.S293C was responsible for the onset of FRG. Our study further confirmed the co-dominant inheritance trait with variable penetrance and expanded the clinical and genetic spectrum of FRG. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. A novel cell line generated using the CRISPR/Cas9 technology as universal quality control material for KRAS G12V mutation testing.

    PubMed

    Jia, Shiyu; Zhang, Rui; Lin, Guigao; Peng, Rongxue; Gao, Peng; Han, Yanxi; Fu, Yu; Ding, Jiansheng; Wu, Qisheng; Zhang, Kuo; Xie, Jiehong; Li, Jinming

    2018-06-01

    KRAS mutations are the key indicator for EGFR monoclonal antibody-targeted therapy and acquired drug resistance, and their accurate detection is critical to the clinical decision-making of colorectal cancer. However, no proper quality control material is available for the current detection methods, particularly next-generation sequencing (NGS). The ideal quality control material for NGS needs to provide both the tumor mutation gene and the matched background genomic DNA, which is uncataloged in public databases, to accurately distinguish germline polymorphisms and somatic mutations. We developed a novel KRAS G12V mutant cell line using the clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPR-associated protein 9 (Cas9) technique to make up for the deficiencies in existing quality control material and further validated the feasibility of the cell line as quality control material by amplification refractory mutation system (ARMS), Sanger sequencing, digital PCR (dPCR), and NGS. We verified that the edited cell line specifically had the G12V mutation, and the validation results presented a high consistency among the four methods of detection. The three cell lines screened contained the G12V mutation and the mutation allele fractions of G12V-1, G12V-2, and G12V-3 were 52.01%, 82.06%, and 17.29%, respectively. The novel KRAS G12V cell line generated using the CRISPR/Cas9 gene editing system is suitable as a quality control material for all current detection methods and provides a new direction in the development of quality control material. © 2018 Wiley Periodicals, Inc.

  14. Novel mutations in the homogentisate 1,2 dioxygenase gene identified in Jordanian patients with alkaptonuria.

    PubMed

    Al-sbou, Mohammed

    2012-06-01

    This study was conducted to identify mutations in the homogentisate 1,2 dioxygenase gene (HGD) in alkaptonuria patients among Jordanian population. Blood samples were collected from four alkaptonuria patients, four carriers, and two healthy volunteers. DNA was isolated from peripheral blood. All 14 exons of the HGD gene were amplified using the polymerase chain reaction (PCR) technique. The PCR products were then purified and analyzed by sequencing. Five mutations were identified in our samples. Four of them were novel C1273A, T1046G, 551-552insG, T533G and had not been previously reported, and one mutation T847C has been described before. The types of mutations identified were two missense mutations, one splice site mutation, one frameshift mutation, and one polymorphism. We present the first molecular study of the HGD gene in Jordanian alkaptonuria patients. This study provides valuable information about the molecular basis of alkaptonuria in Jordanian population.

  15. A Novel de novo Mutation in the G6PD Gene in a Korean Boy with Glucose-6-phosphate Dehydrogenase Deficiency: Case Report.

    PubMed

    Jang, Mi-Ae; Kim, Ji-Yoon; Lee, Ki-O; Kim, Sun-Hee; Koo, Hong Hoe; Kim, Hee-Jin

    2015-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is an X-linked recessive hemolytic anemia caused by a mutation in the G6PD gene on Xq28. Herein, we describe a Korean boy with G6PD deficiency resulting from a novel mutation in G6PD. A 20-month-old boy with hemolytic anemia was referred for molecular diagnosis. He had no relevant family history. The G6PD activity was severely decreased at 0.2 U/g Hb (severe deficiency). Direct sequencing analyses on the G6PD gene revealed that he was hemizygous for a novel missense variant, c.1187C>G (p.Pro396Arg), in exon 10 of G6PD. Family study involving his parents revealed the de novo occurrence of the mutation. This is the first report of genetically confirmed G6PD deficiency in Korea. © 2015 by the Association of Clinical Scientists, Inc.

  16. Serum lipid alterations in GBA-associated Parkinson's disease.

    PubMed

    Guedes, Leonor Correia; Chan, Robin Barry; Gomes, Marcos António; Conceição, Vasco A; Machado, Raquel Bouça; Soares, Tiago; Xu, Yimeng; Gaspar, Paulo; Carriço, Joao André; Alcalay, Roy N; Ferreira, Joaquim J; Outeiro, Tiago Fleming; Miltenberger-Miltenyi, Gabriel

    2017-11-01

    Mutations in the GBA gene, encoding for the lysosomal enzyme glucocerebrosidase, are associated with Gaucher disease. Alterations in plasma sphingolipids have been reported in Gaucher, and similarly in brain extracts in Lewy body disease. As GBA mutations are prevalent risk factors for Parkinson's disease and overlap of molecular pathways are presumable, here we assessed the lipid profiles in Parkinson's patients with and without GBA mutations. We sequenced all GBA exons in 415 Parkinson's patients, previously genotyped for LRRK2. 64 patients (29 GBA positive vs. 35 non-GBA-carriers including 18 LRRK2 positive and 17 non-mutated) were analyzed for chitotriosidase activity and for the concentration of 40 lipid classes using HPLC-MS. 29/415 patients (6.9%) carried 8 different GBA mutations associated with Gaucher or Parkinson's, including one novel mutation. Chitotriosidase activity was similar across the genetic groups, while the levels of key lipids were altered in GBA mutation carriers: Monohexosylceramide, Ceramide and Sphingomyelin were elevated; while Phosphatidic acid (PA), Phosphatidylethanolamine (PE), Plasmalogen phosphatidylethanolamine (PEp) and Acyl Phosphatidylglycerol (AcylPG) were decreased. The results suggest an important role for these lipids in GBA mediated Parkinson's disease and assist in the identification of common pathways between Gaucher and Parkinson's. Ultimately, our findings may lead to the identification of novel biomarkers for individuals at increased risk of developing Parkinson's disease. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. [A study on the relationship between point mutation in pre-core region G1896A of hepatitis B virus and safety of breast feeding].

    PubMed

    Lu, Yin-ping; Cao, Wei; Hong, Mei; Zhu, Jian-fang; Liu, Zhao; Yang, Dong-liang

    2008-10-01

    To investigate the relationship between pre-core G1896A point mutation of hepatitis B virus (HBV) and safety of breast feeding. Serum and breast milk samples were collected from 62 pregnant women of HBV DNA positive/HBeAg negative. PCR-solid phase hybridization was used to detect the point mutation in pre-core region G1896A of HBV from pregnant women, and HBV DNA loads in sera and breast milk were determined by fluorescence quantitative PCR (FQ-PCR). The prevalence of point mutation was 61.3% (38/62) in 62 pregnant women with HBsAg positive/HBeAg negative. The positive rate of HBV DNA in breast milk of group with point mutation (28.9%) was similar to that of group without mutation (29.2%, chi2=0.0003, P>0.05). However, The positive rate of HBV DNA in breast milk of group with high HBV loads (56.0%) was significantly higher than that of group with low HBV loads (10.8%, chi2=14.79, P<0.01). The point mutation in pre-core region G1896A of HBV dose not affect the positive rate of HBV DNA in breast milk and higher HBV DNA loads in serum of pregnant women might increase the risk of mother-infant transmission.

  18. A deletion mutation in GJB6 cooperating with a GJB2 mutation in trans in non-syndromic deafness: A novel founder mutation in Ashkenazi Jews.

    PubMed

    Lerer, I; Sagi, M; Ben-Neriah, Z; Wang, T; Levi, H; Abeliovich, D

    2001-11-01

    A deletion of at least 140 kb starting approximately 35kb upstream (telomeric) to the GJB2 (CX26) gene was identified in 7 patients from 4 unrelated Jewish Ashkenazi families with non-syndromic hearing loss. These patients were heterozygous for one of the common mutations 167delT or 35delG in the GJB2 gene in trans to the deletion. The deletion started at 5' side of the GJB6 (CX30) gene including the first exon and it did not affect the integrity of the GJB2 gene. The deletion mutation segregated together with the hearing loss, and was not found in a control group of 100 Ashkenazi individuals. We suggest that the deletion is a recessive mutation causing hearing loss in individuals that are double heterozygous for the deletion and for a mutation in the GJB2 gene. The effect of the deletion mutation could be due to a digenic mode of inheritance of GJB2 and GJB6 genes that encode two different connexins; connexin 26 and connexin 30, or it may abolish control elements that are important in the expression of the GJB2 gene in the cochlea. Regardless which of the options is valid, it is apparent that the deletion mutation provides a new insight into connexin function in the auditory system. The deletion mutation was on the same haplotypic background in all the families, and therefore is a founder mutation that increases the impact of GJB2 in the etiology of prelingual recessive non-syndromic hearing loss in the Ashkenazi population. Copyright 2001 Wiley-Liss, Inc.

  19. Proposed Volume Standards for 2018, and the Biomass-Based Diesel Volume for 2019

    EPA Pesticide Factsheets

    EPA proposed volume requirements under the Renewable Fuel Standard (RFS) program for 2018 for cellulosic biofuel, biomass-based diesel, advanced biofuel, and total renewable fuel, and biomass-based diesel for 2019 under the RFS.

  20. The risk of gastric cancer in carriers of CHEK2 mutations.

    PubMed

    Teodorczyk, Urszula; Cybulski, Cezary; Wokołorczyk, Dominika; Jakubowska, Anna; Starzyńska, Teresa; Lawniczak, Małgorzata; Domagała, Paweł; Ferenc, Katarzyna; Marlicz, Krzysztof; Banaszkiewicz, Zbigniew; Wiśniowski, Rafał; Narod, Steven A; Lubiński, Jan

    2013-09-01

    CHEK2 is a tumor suppressor gene whose functions are central to the induction of cell cycle arrest and apoptosis following DNA damage. Mutations in CHEK2 have been associated with cancers at many sites, including breast and prostate cancers, but the relationship between CHEK2 and gastric cancer has not been extensively studied. In Poland, there are four known founder alleles of CHEK2; three alleles are protein truncating (1100delC, IVS2G>A, del5395) and the other is a missense variant (I157T). We examined the frequencies of four Polish founder mutations in the CHEK2 gene in 658 unselected gastric cancer patients, in 154 familial gastric cancer patients and in 8,302 controls. A CHEK2 mutation was seen in 57 of 658 (8.7 %) unselected patients with gastric cancer compared to 480 of 8,302 (5.8 %) controls (OR 1.6, p = 0.004). A CHEK2 mutation was present in 19 of 154 (12.3 %) familial cases (OR = 2.3, p = 0.001). The odds ratio for early onset (<50 years) gastric cancer was higher (2.1, p = 0.01), than for cases diagnosed at age of 50 or above (OR 1.4, p = 0.05). Truncating mutations of CHEK2 were associated with higher risk (OR = 2.1, p = 0.02) than the missense mutation I157T (OR = 1.4, p = 0.04). CHEK2 mutations predispose to gastric cancer, in particular to young-onset cases.

  1. CHEK2 mutations and HNPCC-related colorectal cancer.

    PubMed

    Suchy, Janina; Cybulski, Cezary; Wokołorczyk, Dominika; Oszurek, Oleg; Górski, Bohdan; Debniak, Tadeusz; Jakubowska, Anna; Gronwald, Jacek; Huzarski, Tomasz; Byrski, Tomasz; Dziuba, Ireneusz; Gogacz, Marek; Wiśniowski, Rafał; Wandzel, Piotr; Banaszkiewicz, Zbigniew; Kurzawski, Grzegorz; Kładny, Józef; Narod, Steven A; Lubiński, Jan

    2010-06-15

    Recently, the 1100delC variant of cell cycle checkpoint kinase 2 (CHEK2) has been reported to confer a colorectal cancer risk in hereditary non-polyposis-colorectal cancer (HNPCC) and HNPCC-related families in the Netherlands. To investigate whether CHEK2 mutations confer increased cancer risk in HNPCC and HNPCC-related families in Poland, we genotyped 463 probands from HNPCC and HNPCC-related families, and 5,496 controls for 4 CHEK2 alleles (1100delC, IVS2+1G>A, del5395, I157T). All 463 probands were screened for mutations in the HNPCC-related genes MSH2, MLH1 and MSH6. A positive association was observed for HNPCC-related cancer and the I157T missense CHEK2 mutation (OR = 1.7; p = 0.007), but not for the truncating alleles (OR = 1.0; p = 1.0). The association with the I157T was seen both for the 117 cases who fulfill Amsterdam criteria (OR = 1.9; p = 0.1) and for the 346 cases who do not fulfill the criteria (OR = 1.6; p = 0.03). One hundred forty-five of the 463 families had a mutation in MSH2, MLH1 or MSH6 (MMR-positive families). A positive association between the CHEK2 I157T mutation and HNPCC-related cancer was observed only for MMR-negative cases (OR = 2.1; p = 0.0004), but not for MMR-positive cases (OR = 0.8; p = 0.9). The association with I157T was particularly strong for MMR-negative cases with familial colorectal cancer (2 or more first-degree relatives affected) (OR = 2.5; p < 0.0001). We conclude that the I157T variant of CHEK2 increases the risk of colorectal cancer among MMR-negative, HNPCC/HNPCC-related families in Poland.

  2. A novel AVPR2 gene mutation of X-linked congenital nephrogenic diabetes insipidus in an Asian pedigree

    PubMed Central

    Guo, Wei-Hong; Li, Qiang; Wei, Hong-Yan; Lu, Hong-Yan; Qu, Hui-Qi

    2016-01-01

    Polyuria and polydipsia are the characteristics of congenital nephrogenic diabetes insipidus (CNDI). Approximately 90% of all patients with CNDI have X-linked hereditary disease, which is due to a mutation of the arginine vasopressin receptor 2 (AVPR2) gene. This case report describes a 54-year-old male with polyuria and polydipsia and several male members of his pedigree who had the same symptoms. The proband was diagnosed with diabetes insipidus using a water-deprivation and arginine vasopressin stimulation test. Genomic DNA from the patient and his family members was extracted and the AVPR2 gene was sequenced. A novel missense mutation of a cytosine to guanine transition at position 972 (c.972C > G) was found, which resulted in the substitution of isoleucine for methionine at amino acid position 324 (p.I324M) in the seventh transmembrane domain of the protein. The proband’s mother and daughter were heterozygous for this mutation. The novel mutation of the AVPR2 gene further broadens the phenotypic spectrum of the AVPR2 gene. PMID:27565746

  3. Cantu syndrome-associated SUR2 (ABCC9) mutations in distinct structural domains result in KATP channel gain-of-function by differential mechanisms.

    PubMed

    McClenaghan, Conor; Hanson, Alex; Sala-Rabanal, Monica; Roessler, Helen I; Josifova, Dragana; Grange, Dorothy K; van Haaften, Gijs; Nichols, Colin G

    2018-02-09

    The complex disorder Cantu syndrome (CS) arises from gain-of-function mutations in either KCNJ8 or ABCC9 , the genes encoding the Kir6.1 and SUR2 subunits of ATP-sensitive potassium (K ATP ) channels, respectively. Recent reports indicate that such mutations can increase channel activity by multiple molecular mechanisms. In this study, we determined the mechanism by which K ATP function is altered by several substitutions in distinct structural domains of SUR2: D207E in the intracellular L0-linker and Y985S, G989E, M1060I, and R1154Q/R1154W in TMD2. We engineered substitutions at their equivalent positions in rat SUR2A (D207E, Y981S, G985E, M1056I, and R1150Q/R1150W) and investigated functional consequences using macroscopic rubidium ( 86 Rb + ) efflux assays and patch-clamp electrophysiology. Our results indicate that D207E increases K ATP channel activity by increasing intrinsic stability of the open state, whereas the cluster of Y981S/G985E/M1056I substitutions, as well as R1150Q/R1150W, augmented Mg-nucleotide activation. We also tested the responses of these channel variants to inhibition by the sulfonylurea drug glibenclamide, a potential pharmacotherapy for CS. None of the D207E, Y981S, G985E, or M1056I substitutions had a significant effect on glibenclamide sensitivity. However, Gln and Trp substitution at Arg-1150 significantly decreased glibenclamide potency. In summary, these results provide additional confirmation that mutations in CS-associated SUR2 mutations result in K ATP gain-of-function. They help link CS genotypes to phenotypes and shed light on the underlying molecular mechanisms, including consequences for inhibitory drug sensitivity, insights that may inform the development of therapeutic approaches to manage CS. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. Mutational Signature Mark Cancer’s Smoking Gun

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Alexandrov, Ludmil

    A broad computational study of cancer genome sequences by Los Alamos National Laboratory with the UK’s Wellcome Trust Sanger Institute and other collaborators identifies telltale mutational signatures associated with smoking tobacco. The research demonstrates, for the first time, that smoking increases cancer risk by causing somatic mutations in tissues directly and indirectly exposed to tobacco smoke. The international study was published in the November 4 issue of Science. The analysis shows that tobacco smoking causes mutations leading to cancer by multiple distinct mechanisms, including by damaging DNA in organs and by speeding up a mutational cellular clock.

  5. The effects of a deleterious mutation load on patterns of influenza A/H3N2's antigenic evolution in humans

    PubMed Central

    Koelle, Katia; Rasmussen, David A

    2015-01-01

    Recent phylogenetic analyses indicate that RNA virus populations carry a significant deleterious mutation load. This mutation load has the potential to shape patterns of adaptive evolution via genetic linkage to beneficial mutations. Here, we examine the effect of deleterious mutations on patterns of influenza A subtype H3N2's antigenic evolution in humans. By first analyzing simple models of influenza that incorporate a mutation load, we show that deleterious mutations, as expected, act to slow the virus's rate of antigenic evolution, while making it more punctuated in nature. These models further predict three distinct molecular pathways by which antigenic cluster transitions occur, and we find phylogenetic patterns consistent with each of these pathways in influenza virus sequences. Simulations of a more complex phylodynamic model further indicate that antigenic mutations act in concert with deleterious mutations to reproduce influenza's spindly hemagglutinin phylogeny, co-circulation of antigenic variants, and high annual attack rates. DOI: http://dx.doi.org/10.7554/eLife.07361.001 PMID:26371556

  6. Phenotypic Variability in Autosomal Dominant Familial Alzheimer Disease due to the S170F Mutation of Presenilin-1.

    PubMed

    Tiedt, Hannes O; Benjamin, Beate; Niedeggen, Michael; Lueschow, Andreas

    2018-02-22

    In rare cases, patients with Alzheimer disease (AD) present at an early age and with a family history suggestive of an autosomal dominant mode of inheritance. Mutations of the presenilin-1 (PSEN1) gene are the most common causes of dementia in these patients. Early-onset and particularly familial AD patients frequently present with variable non-amnestic cognitive symptoms such as visual, language or behavioural changes as well as non-cognitive, e.g. motor, symptoms. To investigate the phenotypic variability in carriers of the PSEN1 S170F mutation. We report a family with 4 patients carrying the S170F mutation of whom 2 underwent detailed clinical examinations. We discuss our current findings in the context of previously reported S170F cases. The clinical phenotype was consistent regarding initial memory impairment and early onset in the late twenties found in all S170F patients. There were frequent non-amnestic cognitive changes and, at early stages of the disease, indications of a more pronounced disturbance of visuospatial abilities as compared to face and object recognition. Non-cognitive symptoms most often included myoclonus and cerebellar ataxia. A review of the available case reports indicates some phenotypic variability associated with the S170F mutation including different constellations of symptoms such as parkinsonism and delusions. The variable clinical findings associated with the S170F mutation highlight the relevance of atypical phenotypes in the context of research and under a clinical perspective. CSF sampling and detection of Aβ species may be essential to indicate AD pathology in unclear cases presenting with cognitive and motor symptoms at a younger age. © 2018 S. Karger AG, Basel.

  7. The RET p.G533C mutation confers predisposition to multiple endocrine neoplasia type 2A in a Brazilian kindred and is able to induce a malignant phenotype in vitro and in vivo.

    PubMed

    Oliveira, Mariana N L; Hemerly, Jefferson P; Bastos, André U; Tamanaha, Rosana; Latini, Flavia R M; Camacho, Cléber P; Impellizzeri, Anelise; Maciel, Rui M B; Cerutti, Janete M

    2011-09-01

    We have previously described a p.G533C substitution in the rearranged during transfection (RET) oncogene in a large family with medullary thyroid carcinoma. Here, we explore the functional transforming potential of RET p.G533C mutation. Plasmids expressing RET mutants (p.G533C and p.C634Y) and RET wild type were stable transfected into a rat thyroid cell line (PCCL3). Biological and biochemical effects of RET p.G533C were investigated both in vitro and in vivo. Moreover, we report the first case of pheochromocytoma among the RET p.G533C-carriers in this Brazilian family and explore the RET mutational status in DNA isolated from pheochromocytoma. Ectopic expression of RET p.G533C and p.C634Y activates RET/MAPK/ERK pathway at similar levels and significantly increased cell proliferation, compared with RET wild type. We additionally show that p.G533C increased cell viability, anchorage-independent growth, and micronuclei formation while reducing apoptosis, hallmarks of the malignant phenotype. RET p.G533C down-regulates the expression of thyroid specific genes in PCCL3. Moreover, RET p.G533C-expressing cells were able to induce liver metastasis in nude mice. Finally, we described two novel RET variants (G548V and S556T) in the DNA isolated from pheochromocytoma while they were absent in the DNA isolated from blood. Our in vitro and in vivo analysis indicates that this mutation confers a malignant phenotype to PCCL3 cells. These findings, in association with the report of first case of pheochromocytoma in the Brazilian kindred, suggest that this noncysteine mutation may be more aggressive than was initially considered.

  8. Mutation analysis of GM1 gangliosidosis in a Siamese cat from Japan in the 1960s.

    PubMed

    Uddin, Mohammad M; Tanimoto, Takeshi; Yabuki, Akira; Kotani, Takao; Kuwamura, Mitsuru; Chang, Hye-Sook; Yamato, Osamu

    2012-12-01

    GM1 gangliosidosis is a fatal, progressive neurodegenerative lysosomal storage disease caused by mutations of the β-galactosidase (GLB1) gene. In feline GM1 gangliosidosis, a pathogenic mutation (c.1448G>C) of the feline GLB1 gene was identified in Siamese and Korat cats previously diagnosed with the disease in the USA and Italy, respectively. The present study demonstrated the same mutation in a Siamese cat that had been diagnosed with GM1 gangliosidosis in Japan in the 1960s. The mutation was confirmed using DNA extracted from stored paraffin-embedded brain tissue by a direct sequencing method and a polymerase chain reaction-restriction fragment length polymorphism assay. This pathogenic mutation seems to have been distributed around the world.

  9. Prodromal Parkinsonism and Neurodegenerative Risk Stratification in REM Sleep Behavior Disorder

    PubMed Central

    Lawton, Michael; Rolinski, Michal; Evetts, Samuel; Baig, Fahd; Ruffmann, Claudio; Gornall, Aimie; Klein, Johannes C; Lo, Christine; Dennis, Gary; Bandmann, Oliver; Quinnell, Timothy; Zaiwalla, Zenobia; Ben-Shlomo, Yoav; Hu, Michele TM

    2017-01-01

    Abstract Objectives Rapid eye movement (REM) sleep behavior disorder (RBD) is the most specific marker of prodromal alpha-synucleinopathies. We sought to delineate the baseline clinical characteristics of RBD and evaluate risk stratification models. Methods Clinical assessments were performed in 171 RBD, 296 control, and 119 untreated Parkinson’s (PD) participants. Putative risk measures were assessed as predictors of prodromal neurodegeneration, and Movement Disorders Society (MDS) criteria for prodromal PD were applied. Participants were screened for common leucine-rich repeat kinase 2 (LRRK2)/glucocerebrosidase gene (GBA) gene mutations. Results Compared to controls, participants with RBD had higher rates of solvent exposure, head injury, smoking, obesity, and antidepressant use. GBA mutations were more common in RBD, but no LRRK2 mutations were found. RBD participants performed significantly worse than controls on Unified Parkinson’s Disease Rating Scale (UPDRS)-III, timed “get-up-and-go”, Flamingo test, Sniffin Sticks, and cognitive tests and had worse measures of constipation, quality of life (QOL), and orthostatic hypotension. For all these measures except UPDRS-III, RBD and PD participants were equally impaired. Depression, anxiety, and apathy were worse in RBD compared to PD participants. Stratification of people with RBD according to antidepressant use, obesity, and age altered the odds ratio (OR) of hyposmia compared to controls from 3.4 to 45.5. 74% (95% confidence interval [CI] 66%, 80%) of RBD participants met the MDS criteria for probable prodromal Parkinson’s compared to 0.3% (95% CI 0.009%, 2%) of controls. Conclusions RBD are impaired across a range of clinical measures consistent with prodromal PD and suggestive of a more severe nonmotor subtype. Clinical risk stratification has the potential to select higher risk patients for neuroprotective interventions. PMID:28472425

  10. The common missense mutation D489N in TRIM32 causing limb girdle muscular dystrophy 2H leads to loss of the mutated protein in knock-in mice resulting in a Trim32-null phenotype.

    PubMed

    Kudryashova, Elena; Struyk, Arie; Mokhonova, Ekaterina; Cannon, Stephen C; Spencer, Melissa J

    2011-10-15

    Mutations in tripartite motif protein 32 (TRIM32) are responsible for several hereditary disorders that include limb girdle muscular dystrophy type 2H (LGMD2H), sarcotubular myopathy (STM) and Bardet Biedl syndrome. Most LGMD2H mutations in TRIM32 are clustered in the NHL β-propeller domain at the C-terminus and are predicted to interfere with homodimerization. To get insight into TRIM32's role in the pathogenesis of LGMD2H and to create an accurate model of disease, we have generated a knock-in mouse (T32KI) carrying the c.1465G > A (p.D489N) mutation in murine Trim32 corresponding to the human LGMD2H/STM pathogenic mutation c.1459G > A (p.D487N). Our data indicate that T32KI mice have both a myopathic and a neurogenic phenotype, very similar to the one described in the Trim32-null mice that we created previously. Analysis of Trim32 gene expression in T32KI mice revealed normal mRNA levels, but a severe reduction in mutant TRIM32 (D489N) at the protein level. Our results suggest that the D489N pathogenic mutation destabilizes the protein, leading to its degradation, and results in the same mild myopathic and neurogenic phenotype as that found in Trim32-null mice. Thus, one potential mechanism of LGMD2H might be destabilization of mutated TRIM32 protein leading to a null phenotype.

  11. Identification of a novel COL1A1 frameshift mutation, c.700delG, in a Chinese osteogenesis imperfecta family

    PubMed Central

    Wang, Xiran; Pei, Yu; Dou, Jingtao; Lu, Juming; Li, Jian; Lv, Zhaohui

    2015-01-01

    Osteogenesis imperfecta (OI) is a family of genetic disorders associated with bone loss and fragility. Mutations associated with OI have been found in genes encoding the type I collagen chains. People with OI type I often produce insufficient α1-chain type I collagen because of frameshift, nonsense, or splice site mutations in COL1A1 or COL1A2. This report is of a Chinese daughter and mother who had both experienced two bone fractures. Because skeletal fragility is predominantly inherited, we focused on identifying mutations in COL1A1 and COL1A2 genes. A novel mutation in COL1A1, c.700delG, was detected by genomic DNA sequencing in the mother and daughter, but not in their relatives. The identification of this mutation led to the conclusion that they were affected by mild OI type I. Open reading frame analysis indicated that this frameshift mutation would truncate α1-chain type I collagen at residue p263 (p.E234KfsX264), while the wild-type protein would contain 1,464 residues. The clinical data were consistent with the patients’ diagnosis of mild OI type I caused by haploinsufficiency of α1-chain type I collagen. Combined with previous reports, identification of the novel mutation COL1A1-c.700delG in these patients suggests that additional genetic and environmental factors may influence the severity of OI. PMID:25983617

  12. Endometrial cancer and somatic G>T KRAS transversion in patients with constitutional MUTYH biallelic mutations.

    PubMed

    Tricarico, Rossella; Bet, Paola; Ciambotti, Benedetta; Di Gregorio, Carmela; Gatteschi, Beatrice; Gismondi, Viviana; Toschi, Benedetta; Tonelli, Francesco; Varesco, Liliana; Genuardi, Maurizio

    2009-02-18

    MUTYH-associated polyposis (MAP) is an autosomal recessive condition predisposing to colorectal cancer, caused by constitutional biallelic mutations in the base excision repair (BER) gene MUTYH. Colorectal tumours from MAP patients display an excess of somatic G>T mutations in the APC and KRAS genes due to defective BER function. To date, few extracolonic manifestations have been observed in MAP patients, and the clinical spectrum of this condition is not yet fully established. Recently, one patient with a diagnosis of endometrial cancer and biallelic MUTYH mutations has been described. We here report on two additional unrelated MAP patients with biallelic MUTYH germline mutations who developed endometrioid endometrial carcinoma. The endometrial tumours were evaluated for PTEN, PIK3CA, KRAS, BRAF and CTNNB1 mutations. A G>T transversion at codon 12 of the KRAS gene was observed in one tumour. A single 1bp frameshift deletion of PTEN was observed in the same sample. Overall, these findings suggest that endometrial carcinoma is a phenotypic manifestations of MAP and that inefficient repair of oxidative damage can be involved in its pathogenesis.

  13. DNA hypermethylation and X chromosome inactivation are major determinants of phenotypic variation in women heterozygous for G6PD mutations.

    PubMed

    Wang, Jin; Xiao, Qi-Zhi; Chen, You-Ming; Yi, Sheng; Liu, Dun; Liu, Yan-Hui; Zhang, Cui-Mei; Wei, Xiao-Feng; Zhou, Yu-Qiu; Zhong, Xing-Ming; Zhao, Cun-You; Xiong, Fu; Wei, Xiang-Cai; Xu, Xiang-Min

    2014-12-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is an X-linked incompletely dominant enzyme deficiency that results from G6PD gene mutations. Women heterozygous for G6PD mutations exhibit variation in the loss of enzyme activity but the cause of this phenotypic variation is unclear. We determined DNA methylation and X-inactivation patterns in 71 G6PD-deficient female heterozygotes and 68 G6PD non-deficient controls with the same missense mutations (G6PD Canton c.1376G>T or Kaiping c.1388G>A) to correlate determinants with variable phenotypes. Specific CpG methylations within the G6PD promoter were significantly higher in G6PD-deficient heterozygotes than in controls. Preferential X-inactivation of the G6PD wild-type allele was determined in heterozygotes. The incidence of preferential X-inactivation was 86.2% in the deficient heterozygote group and 31.7% in the non-deficient heterozygote group. A significant negative correlation was observed between X-inactivation ratios of the wild-type allele and G6PD/6-phosphogluconate dehydrogenase (6PGD) ratios in heterozygous G6PD Canton (r=-0.657, p<0.001) or Kaiping (r=-0.668, p<0.001). Multivariate logistic regression indicated that heterozygotes with hypermethylation of specific CpG sites in the G6PD promoter and preferential X-inactivation of the wild-type allele were at risk of enzyme deficiency. Copyright © 2014 Elsevier Inc. All rights reserved.

  14. What affects the predictability of evolutionary constraints using a G-matrix? The relative effects of modular pleiotropy and mutational correlation.

    PubMed

    Chebib, Jobran; Guillaume, Frédéric

    2017-10-01

    Phenotypic traits do not always respond to selection independently from each other and often show correlated responses to selection. The structure of a genotype-phenotype map (GP map) determines trait covariation, which involves variation in the degree and strength of the pleiotropic effects of the underlying genes. It is still unclear, and debated, how much of that structure can be deduced from variational properties of quantitative traits that are inferred from their genetic (co) variance matrix (G-matrix). Here we aim to clarify how the extent of pleiotropy and the correlation among the pleiotropic effects of mutations differentially affect the structure of a G-matrix and our ability to detect genetic constraints from its eigen decomposition. We show that the eigenvectors of a G-matrix can be predictive of evolutionary constraints when they map to underlying pleiotropic modules with correlated mutational effects. Without mutational correlation, evolutionary constraints caused by the fitness costs associated with increased pleiotropy are harder to infer from evolutionary metrics based on a G-matrix's geometric properties because uncorrelated pleiotropic effects do not affect traits' genetic correlations. Correlational selection induces much weaker modular partitioning of traits' genetic correlations in absence then in presence of underlying modular pleiotropy. © 2017 The Author(s). Evolution © 2017 The Society for the Study of Evolution.

  15. Prothrombin polymorphism A19911G, factor V HR2 haplotype A4070G, and plasminogen activator-inhibitor-1 polymorphism 4G/5G and the risk of retinal vein occlusion.

    PubMed

    Kuhli-Hattenbach, Claudia; Hellstern, Peter; Nägler, Dorit Karin; Kohnen, Thomas; Hattenbach, Lars-Olof

    2017-01-01

    Thus far, no data has become available to evaluate systematically the prevalences of prothrombin polymorphism A19911G (PT A19911G), factor V HR2 haplotype A4070G (FV A4070G), or plasminogen activator-inhibitor-1 polymorphism 4G/5G (PAI-1 4G/5G) in patients who develop retinal vein occlusion (RVO) without cardiovascular risk factors. We retrospectively evaluated comprehensive thrombophilia data from 42 preselected RVO patients without cardiovascular risk factors. The prevalences of different gene mutations and polymorphisms including factor V Leiden mutation G1691A (FVL), FV A4070G, prothrombin mutation G20210A, PT A19911G, and PAI-1 4G/5G were compared with 241 healthy controls matched for age and sex. A total of 20 patients (47.7%) were found to carry thrombophilic gene polymorphisms including FVL, FV A4070G, and homozygous PT A19911G compared with 72 of 241 controls (29.9%; p = 0.03). Subgroup analysis of patients with a significant personal or family history of thromboembolism revealed a high prevalence of FVL, FV A4070G, and homozygous PT A19911G (p = 0.005). FV A4070G was found to be significantly associated with at least two other heterozygous or one homozygous gene polymorphisms (p = 0.02). Multivariate analysis revealed the presence of FVL (p = 0.0017) and homozygous PT A19911G (p = 0.03) polymorphism as independent risk factors for the development of RVO. Our results indicate that in selected RVO patients screening for thrombophilic gene polymorphisms including FVL, FV A4070G and homozygous PT G19911A may be helpful in a high percentage of cases. Our findings suggest that hereditary thrombophilia associated with RVO is more likely to be multigenic than caused by any single risk factor.

  16. dNTP pool levels modulate mutator phenotypes of error-prone DNA polymerase ε variants.

    PubMed

    Williams, Lindsey N; Marjavaara, Lisette; Knowels, Gary M; Schultz, Eric M; Fox, Edward J; Chabes, Andrei; Herr, Alan J

    2015-05-12

    Mutator phenotypes create genetic diversity that fuels tumor evolution. DNA polymerase (Pol) ε mediates leading strand DNA replication. Proofreading defects in this enzyme drive a number of human malignancies. Here, using budding yeast, we show that mutator variants of Pol ε depend on damage uninducible (Dun)1, an S-phase checkpoint kinase that maintains dNTP levels during a normal cell cycle and up-regulates dNTP synthesis upon checkpoint activation. Deletion of DUN1 (dun1Δ) suppresses the mutator phenotype of pol2-4 (encoding Pol ε proofreading deficiency) and is synthetically lethal with pol2-M644G (encoding altered Pol ε base selectivity). Although pol2-4 cells cycle normally, pol2-M644G cells progress slowly through S-phase. The pol2-M644G cells tolerate deletions of mediator of the replication checkpoint (MRC) 1 (mrc1Δ) and radiation sensitive (Rad) 9 (rad9Δ), which encode mediators of checkpoint responses to replication stress and DNA damage, respectively. The pol2-M644G mutator phenotype is partially suppressed by mrc1Δ but not rad9Δ; neither deletion suppresses the pol2-4 mutator phenotype. Thus, checkpoint activation augments the Dun1 effect on replication fidelity but is not required for it. Deletions of genes encoding key Dun1 targets that negatively regulate dNTP synthesis, suppress the dun1Δ pol2-M644G synthetic lethality and restore the mutator phenotype of pol2-4 in dun1Δ cells. DUN1 pol2-M644G cells have constitutively high dNTP levels, consistent with checkpoint activation. In contrast, pol2-4 and POL2 cells have similar dNTP levels, which decline in the absence of Dun1 and rise in the absence of the negative regulators of dNTP synthesis. Thus, dNTP pool levels correlate with Pol ε mutator severity, suggesting that treatments targeting dNTP pools could modulate mutator phenotypes for therapy.

  17. Lack of CHEK2 gene mutations in differentiated thyroid carcinoma patients using high resolution melting analysis.

    PubMed

    Fayaz, Shima; Fard-Esfahani, Pezhman; Torbati, Peyman Mohammadi

    2014-01-01

    Recently, mutations in the genes involved in cell cycle control, including CHEK2, are being considered as etiological factors in different kinds of cancers. The CHEK2 protein plays an important role in protecting damaged DNA from entering mitosis. In this study the potential effects of two common mutations IVS2+1G?A and Ile157Thr of CHEK2 gene in differentiated thyroid carcinoma (DTC) were evaluated. A total of 100 patients admitted to the Research Institute for Nuclear Medicine were diagnosed with DTC based on pathology reports of surgery samples. An additional 100 people were selected as a control group with no cancer history. PCR-HRM (high resolution melting) analysis was performed to deal with each of mutations in all case and control samples separately. During the analysis of IVS2+1G?A and Ile157Thr mutations of CHEK2 gene in the case and control groups, all the samples were identified as wild homozygote type. The finding suggests that IVS2+1G?A and Ile157Thr mutations of CHEK2 gene do not constitute a risk factor for DTC in the Iranian population. However, further studies with a larger population are required to confirm the outcome.

  18. GTF2E2 Mutations Destabilize the General Transcription Factor Complex TFIIE in Individuals with DNA Repair-Proficient Trichothiodystrophy

    PubMed Central

    Kuschal, Christiane; Botta, Elena; Orioli, Donata; Digiovanna, John J.; Seneca, Sara; Keymolen, Kathelijn; Tamura, Deborah; Heller, Elizabeth; Khan, Sikandar G.; Caligiuri, Giuseppina; Lanzafame, Manuela; Nardo, Tiziana; Ricotti, Roberta; Peverali, Fiorenzo A.; Stephens, Robert; Zhao, Yongmei; Lehmann, Alan R.; Baranello, Laura; Levens, David; Kraemer, Kenneth H.; Stefanini, Miria

    2016-01-01

    The general transcription factor IIE (TFIIE) is essential for transcription initiation by RNA polymerase II (RNA pol II) via direct interaction with the basal transcription/DNA repair factor IIH (TFIIH). TFIIH harbors mutations in two rare genetic disorders, the cancer-prone xeroderma pigmentosum (XP) and the cancer-free, multisystem developmental disorder trichothiodystrophy (TTD). The phenotypic complexity resulting from mutations affecting TFIIH has been attributed to the nucleotide excision repair (NER) defect as well as to impaired transcription. Here, we report two unrelated children showing clinical features typical of TTD who harbor different homozygous missense mutations in GTF2E2 (c.448G>C [p.Ala150Pro] and c.559G>T [p.Asp187Tyr]) encoding the beta subunit of transcription factor IIE (TFIIEβ). Repair of ultraviolet-induced DNA damage was normal in the GTF2E2 mutated cells, indicating that TFIIE was not involved in NER. We found decreased protein levels of the two TFIIE subunits (TFIIEα and TFIIEβ) as well as decreased phosphorylation of TFIIEα in cells from both children. Interestingly, decreased phosphorylation of TFIIEα was also seen in TTD cells with mutations in ERCC2, which encodes the XPD subunit of TFIIH, but not in XP cells with ERCC2 mutations. Our findings support the theory that TTD is caused by transcriptional impairments that are distinct from the NER disorder XP. PMID:26996949

  19. Prevalence of C282Y, H63D, and S65C mutations in hereditary HFE-hemochromatosis gene in Lithuanian population.

    PubMed

    Kucinskas, Laimutis; Juzenas, Simonas; Sventoraityte, Jurgita; Cedaviciute, Ruta; Vitkauskiene, Astra; Kalibatas, Vytenis; Kondrackiene, Jurate; Kupcinskas, Limas

    2012-04-01

    HFE-hemochromatosis is a common autosomal recessive disease caused by HFE gene mutations and characterized as iron overload and failure of different organs. The aim of this study was to determine the prevalence of C282Y (c.845 G>A), H63D (c.187 C>G), and S65C (c.193A>T) alleles of HFE gene in the Lithuanian population. One thousand and eleven healthy blood donors of Lithuanian nationality were examined in four different ethnic Lithuanian regions to determine HFE gene alleles and genotype frequencies. The samples of DNA were analyzed for the presence of restriction fragment length polymorphism and validated by DNA sequencing. Among 1,011 blood donors tested, the frequency of C282Y, H63D, and S65C alleles were 2.6%, 15.9%, and 1.9%, respectively. One third of the tested subjects (n = 336) had at least one of the C282Y or H63D HFE gene mutations. The screening of Lithuanian blood donors has detected 13 (1.3%) subjects with a genotype C282Y/C282Y or C282Y/H63D responsible for the development of HFE-hemochromatosis. The prevalence of C282Y mutation was significantly higher among the inhabitants of Zemaitija (Somogitia) at the Baltic Sea area (5.9%) in comparison to the regions of continental part of Lithuania (2.4% in Dzukija, 2.3% in Aukstaitija, and 2% in Suvalkija, p < 0.05). These data support the hypothesis that the p.C282Y mutation originated from Scandinavia and spread with the Vikings along the Baltic Sea coast. The first epidemiological investigation of HFE gene mutations in ethnic Lithuanians showed that the frequencies of H63D, C282Y, and S65C of HFE gene alleles are similar to the other North-Eastern Europeans, especially in the Baltic region (Estonia, Latvia), Poland, and part of Russia (Moscow region).

  20. Familial Alzheimer disease-linked mutations specifically disrupt Ca2+ leak function of presenilin 1.

    PubMed

    Nelson, Omar; Tu, Huiping; Lei, Tianhua; Bentahir, Mostafa; de Strooper, Bart; Bezprozvanny, Ilya

    2007-05-01

    Mutations in presenilins are responsible for approximately 40% of all early-onset familial Alzheimer disease (FAD) cases in which a genetic cause has been identified. In addition, a number of mutations in presenilin-1 (PS1) have been suggested to be associated with the occurrence of frontal temporal dementia (FTD). Presenilins are highly conserved transmembrane proteins that support cleavage of the amyloid precursor protein by gamma-secretase. Recently, we discovered that presenilins also function as passive ER Ca(2+) leak channels. Here we used planar lipid bilayer reconstitution assays and Ca(2+) imaging experiments with presenilin-null mouse embryonic fibroblasts to analyze ER Ca(2+) leak function of 6 FAD-linked PS1 mutants and 3 known FTD-associated PS1 mutants. We discovered that L166P, A246E, E273A, G384A, and P436Q FAD mutations in PS1 abolished ER Ca(2+) leak function of PS1. In contrast, A79V FAD mutation or FTD-associated mutations (L113P, G183V, and Rins352) did not appear to affect ER Ca(2+) leak function of PS1 in our experiments. We validated our findings in Ca(2+) imaging experiments with primary fibroblasts obtained from an FAD patient possessing mutant PS1-A246E. Our results indicate that many FAD mutations in presenilins are loss-of-function mutations affecting ER Ca(2+) leak activity. In contrast, none of the FTD-associated mutations affected ER Ca(2+) leak function of PS1, indicating that the observed effects are disease specific. Our observations are consistent with the potential role of disturbed Ca(2+) homeostasis in Alzheimer disease pathogenesis.

  1. Novel Compound Heterozygous CLCNKB Gene Mutations (c.1755A>G/ c.848_850delTCT) Cause Classic Bartter Syndrome.

    PubMed

    Wang, Chunli; Chen, Ying; Zheng, Bixia; Zhu, Mengshu; Fan, Jia; Wang, Juejin; Jia, Zhanjun; Huang, Songming; Zhang, Aihua

    2018-02-14

    Inactivated variants in CLCNKB gene encoding the basolateral chloride channel ClC-Kb cause classic Bartter syndrome characterized by hypokalemic metabolic alkalosis and hyperreninemic hyperaldosteronism. Here we identified two cBS siblings presenting hypokalemia in a Chinese family due to novel compound heterozygous CLCNKB mutations (c.848_850delTCT/c.1755A>G). Compound heterozygosity was confirmed by amplifying and sequencing the patient's genomic DNA. The synonymous mutation c.1755A>G (Thr585Thr) was located at +2bp from the 5' splice donor site in exon 15, further transcript analysis demonstrated that this single nucleotide mutation causes exclusion of exon 15 in the cDNA from the proband and his mother. Furthermore, we investigated the expression and protein trafficking change of c.848_850delTCT (TCT) and exon 15 deletion(E15)mutation in vitro. The E15 mutation markedly decreased the expression of ClC-Kb and resulted in a low-molecular-weight band (~55kD) trapping in the endoplasmic reticulum, while the TCT mutant only decreased the total and plasma membrane ClC-Kb protein expression but did not affect the subcellular localization. Finally, we studied the physiological functions of mutations by using whole-cell patch clamp and found that E15 or TCT mutation decreased the current of ClC-Kb/barttin channel. These results suggested that the compound defective mutations of CLCNKB gene are the molecular mechanism of the two cBS siblings.

  2. The UK MRC Mitochondrial Disease Patient Cohort Study: clinical phenotypes associated with the m.3243A>G mutation--implications for diagnosis and management.

    PubMed

    Nesbitt, Victoria; Pitceathly, Robert D S; Turnbull, Doug M; Taylor, Robert W; Sweeney, Mary G; Mudanohwo, Ese E; Rahman, Shamima; Hanna, Michael G; McFarland, Robert

    2013-08-01

    Population-based studies suggest the m.3243A>G mutation in MTTL1 is the most common disease-causing mtDNA mutation, with a carrier rate of 1 in 400 people. The m.3243A>G mutation is associated with several clinical syndromes including mitochondrial encephalopathy lactic acidosis and stroke-like episodes (MELAS), maternally inherited deafness and diabetes (MIDD) and progressive external ophthalmoplegia (PEO). Many patients affected by this mutation exhibit a clinical phenotype that does not fall within accepted criteria for the currently recognised classical mitochondrial syndromes. We have defined the phenotypic spectrum associated with the m.3243A>G mtDNA mutation in 129 patients, from 83 unrelated families, recruited to the Mitochondrial Disease Patient Cohort Study UK. 10% of patients exhibited a classical MELAS phenotype, 30% had MIDD, 6% MELAS/MIDD, 2% MELAS/chronic PEO (CPEO) and 5% MIDD/CPEO overlap syndromes. 6% had PEO and other features of mitochondrial disease not consistent with another recognised syndrome. Isolated sensorineural hearing loss occurred in 3%. 28% of patients demonstrated a panoply of clinical features, which were not consistent with any of the classical syndromes associated with the m.3243A>G mutation. 9% of individuals harbouring the mutation were clinically asymptomatic. Following this study we propose guidelines for screening and for the management of confirmed cases.

  3. Acute quadriplegia in a young man secondary to prothrombin G20210A mutation.

    PubMed

    Sawaya, R; Diken, Z; Mahfouz, R

    2011-08-01

    We present the case of an 18-year-old man, previously healthy, who presented with acute quadriplegia and respiratory failure. Physical examination was compatible with a high cervical anterior spinal cord lesion. We plan to evaluate the cause of such a neurological presentation in a healthy young man. American University Medical Center, Beirut, Lebanon. The patient underwent routine blood hematological and chemistry work-up, hypercoagulable profile studies, genetic profile for thrombophelias, radiographic studies of the brain and cervical cord, cerebrospinal analysis and extensive electrophyisological studies. Magnetic resonance imaging and magnetic resonance angiogram of the brain, carotid and intracranial vessels were normal. Cerebral angiography was normal. Magnetic resonance imaging of the cervical cord revealed lesion of the anterior segment of the cervical cord between C2 and C5 levels. Hypercoagulable profile studies were normal. Electrophysiological studies confirmed an isolated lesion of the descending cortico-spinal tracts. DNA analysis revealed the presence of a G20210A mutation-causing hyperprothrombinemia. We conclude that a G20210A mutation causing-hyperprothrombinemia can cause anterior spinal artery thrombosis and anterior spinal cord infarction with the resultant neurological deficits in otherwise healthy patients.

  4. Pre-S2 Start Codon Mutation of Hepatitis B Virus Subgenotype B3 Effects on NF-κB Expression and Activation in Huh7 Cell Lines.

    PubMed

    Siburian, Marlinang Diarta; Suriapranata, Ivet Marita; Wanandi, Septelia Inawati

    2018-03-19

    A cross-sectional study on hepatitis B patients in Indonesia showed association of pre-S2 start codon mutation (M120 V) with cirrhosis and hepatocellular carcinoma (HCC), which was dissimilar from studies from other populations where pre-S2 deletion mutation was more prevalent. Different mutation patterns were attributed to different hepatitis B virus (HBV) subgenotypes in each population study. HBV surface proteins are reported to induce the activation of NF-κB, a transcriptional factor known to play an important role in the development of liver disease. This study aimed to see the effects of HBs variants in HBV subgenotype B3 on the expression and activation of NF-κB as one of the mechanisms in inducing advanced liver disease. HBV subgenotypes B3, each carrying wild-type (wt) HBs, M120 V, and pre-S2 deletion mutation were isolated from three HCC patients. HBs genes were amplified and cloned into pcDNA3.1 and were transfected using Lipofectamine into a Huh7 cell line. NF-κB activation was measured through IκB-α expression, which is regulated by NF-κB. RNA expressions for HBs, IκB-α, and NF-κB subunit (p50) were evaluated using real-time PCR. M120 V mutant had a significantly higher mRNA level compared with wt and pre-S2 deletion mutant; however, there were no significant differences in HBs protein expressions. The transcription level of p50 was higher in M120 V mutation compared with HBs wild-type and pre-S2 deletion mutant. NF-κB activation was higher in HBs wild-type compared with the two mutant variants. Pre-S2 mutations had no effect on the increment of NF-κB activation. However, M120 V mutation may utilize a different pathway in liver disease progression that involves high expression of NF-κB subunit, p50.

  5. Targeted next-generation sequencing extends the phenotypic and mutational spectrums for EYS mutations

    PubMed Central

    Gu, Shun; Tian, Yuanyuan; Chen, Xue

    2016-01-01

    Purpose We aim to determine genetic lesions with a phenotypic correlation in four Chinese families with autosomal recessive retinitis pigmentosa (RP). Methods Medical histories were carefully reviewed. All patients received comprehensive ophthalmic evaluations. The next-generation sequencing (NGS) approach targeting a panel of 205 retinal disease–relevant genes and 15 candidate genes was selectively performed on probands from the four recruited families for mutation detection. Online predictive software and crystal structure modeling were also applied to test the potential pathogenic effects of identified mutations. Results Of the four families, two were diagnosed with RP sino pigmento (RPSP). Patients with RPSP claimed to have earlier RP age of onset but slower disease progression. Five mutations in the eyes shut homolog (EYS) gene, involving two novel (c.7228+1G>A and c.9248G>A) and three recurrent mutations (c.4957dupA, c.6416G>A and c.6557G>A), were found as RP causative in the four families. The missense variant c.5093T>C was determined to be a variant of unknown significance (VUS) due to the variant’s colocalization in the same allele with the reported pathogenic mutation c.6416G>A. The two novel variants were further confirmed absent in 100 unrelated healthy controls. Online predictive software indicated potential pathogenicity of the three missense mutations. Further, crystal structural modeling suggested generation of two abnormal hydrogen bonds by the missense mutation p.G2186E (c.6557G>A) and elongation of its neighboring β-sheet induced by p.G3083D (c.9248G>A), which could alter the tertiary structure of the eys protein and thus interrupt its physicochemical properties. Conclusions Taken together, with the targeted NGS approach, we reveal novel EYS mutations and prove the efficiency of targeted NGS in the genetic diagnoses of RP. We also first report the correlation between EYS mutations and RPSP. The genotypic-phenotypic relationship in all

  6. Clarithromycin Resistance Mutations in Helicobacter pylori in Association with Virulence Factors and Antibiotic Susceptibility of the Strains.

    PubMed

    Boyanova, Lyudmila; Markovska, Rumyana; Yordanov, Daniel; Gergova, Galina; Mitov, Ivan

    2016-04-01

    Antibiotic resistance is the major cause for Helicobacter pylori eradication failure. H. pylori clarithromycin resistance mutations were evaluated in 84 (82 phenotypically clarithromycin resistant and 2 intermediately susceptible) strains by allele-specific PCR and 3'-mismatched PCR. Many (57.1%) of these strains were metronidazole resistant. Prevalence of cagA(+), cagE(+), vacA s1a, m1, i1, and i2 strains was 76.2%, 58.0%, 82.1%, 35.7%, 50.0%, and 50.0%, respectively. A2143G, A2142G, A2142C, and A2143G+A2142G mutation rates were 64.3%, 23.8%, 1.2%, and 10.7%, respectively. Strains harboring the A2142G mutation showed 5.3-fold higher clarithromycin MIC50 than those harboring the A2143G mutation. The A2143G mutation alone was 1.7-fold more common in vacA i2 strains compared with vacA i1 strains, while the A2142G mutation alone was 3-fold more frequent in vacA i1 strains than vacA i2 strains and 3.1-fold more common in metronidazole-susceptible compared with metronidazole-resistant strains. Briefly, clarithromycin resistance mutations were significantly linked to vacA i allele and metronidazole susceptibility. This is the first report about associations between the A2143G mutation and less virulent vacA i2 strains, and between the A2142G mutation and more virulent vacA i1 strains. As the 2143G mutation often predicts eradication failure by clarithromycin-based regimens, the results may be linked to the better eradication of more virulent strains compared with the less virulent strains.

  7. Mitochondrial myopathy, lactic acidosis, and sideroblastic anemia (MLASA) plus associated with a novel de novo mutation (m.8969G>A) in the mitochondrial encoded ATP6 gene.

    PubMed

    Burrage, Lindsay C; Tang, Sha; Wang, Jing; Donti, Taraka R; Walkiewicz, Magdalena; Luchak, J Michael; Chen, Li-Chieh; Schmitt, Eric S; Niu, Zhiyv; Erana, Rodrigo; Hunter, Jill V; Graham, Brett H; Wong, Lee-Jun; Scaglia, Fernando

    2014-11-01

    Mitochondrial myopathy, lactic acidosis and sideroblastic anemia (MLASA) is a rare mitochondrial disorder that has previously been associated with mutations in PUS1 and YARS2. In the present report, we describe a 6-year old male with an MLASA plus phenotype. This patient had features of MLASA in the setting of developmental delay, sensorineural hearing loss, epilepsy, agenesis of the corpus callosum, failure to thrive, and stroke-like episodes. Sequencing of the mitochondrial genome identified a novel de novo, heteroplasmic mutation in the mitochondrial DNA (mtDNA) encoded ATP6 gene (m.8969G>A, p.S148N). Whole exome sequencing did not identify mutations or variants in PUS1 or YARS2 or any known nuclear genes that could affect mitochondrial function and explain this phenotype. Studies of fibroblasts derived from the patient revealed a decrease in oligomycin-sensitive respiration, a finding which is consistent with a complex V defect. Thus, this mutation in MT-ATP6 may represent the first mtDNA point mutation associated with the MLASA phenotype. Copyright © 2014 Elsevier Inc. All rights reserved.

  8. Faster Electron Injection and More Active Sites for Efficient Photocatalytic H2 Evolution in g-C3 N4 /MoS2 Hybrid.

    PubMed

    Shi, Xiaowei; Fujitsuka, Mamoru; Kim, Sooyeon; Majima, Tetsuro

    2018-03-01

    Herein, the structural effect of MoS 2 as a cocatalyst of photocatalytic H 2 generation activity of g-C 3 N 4 under visible light irradiation is studied. By using single-particle photoluminescence (PL) and femtosecond time-resolved transient absorption spectroscopies, charge transfer kinetics between g-C 3 N 4 and two kinds of nanostructured MoS 2 (nanodot and monolayer) are systematically investigated. Single-particle PL results show the emission of g-C 3 N 4 is quenched by MoS 2 nanodots more effectively than MoS 2 monolayers. Electron injection rate and efficiency of g-C 3 N 4 /MoS 2 -nanodot hybrid are calculated to be 5.96 × 10 9 s -1 and 73.3%, respectively, from transient absorption spectral measurement, which are 4.8 times faster and 2.0 times higher than those of g-C 3 N 4 /MoS 2 -monolayer hybrid. Stronger intimate junction between MoS 2 nanodots and g-C 3 N 4 is suggested to be responsible for faster and more efficient electron injection. In addition, more unsaturated terminal sulfur atoms can serve as the active site in MoS 2 nanodot compared with MoS 2 monolayer. Therefore, g-C 3 N 4 /MoS 2 nanodot exhibits a 7.9 times higher photocatalytic activity for H 2 evolution (660 µmol g- 1 h -1 ) than g-C 3 N 4 /MoS 2 monolayer (83.8 µmol g -1 h -1 ). This work provides deep insight into charge transfer between g-C 3 N 4 and nanostructured MoS 2 cocatalysts, which can open a new avenue for more rationally designing MoS 2 -based catalysts for H 2 evolution. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Mutating the CX3C Motif in the G Protein Should Make a Live Respiratory Syncytial Virus Vaccine Safer and More Effective.

    PubMed

    Boyoglu-Barnum, S; Todd, S O; Meng, J; Barnum, T R; Chirkova, T; Haynes, L M; Jadhao, S J; Tripp, R A; Oomens, A G; Moore, M L; Anderson, L J

    2017-05-15

    Respiratory syncytial virus (RSV) belongs to the family Paramyxoviridae and is the single most important cause of serious lower respiratory tract infections in young children, yet no highly effective treatment or vaccine is available. Through a CX3C chemokine motif ( 182 CWAIC 186 ) in the G protein, RSV binds to the corresponding chemokine receptor, CX3CR1. Since RSV binding to CX3CR1 contributes to disease pathogenesis, we investigated whether a mutation in the CX3C motif by insertion of an alanine, A 186 , within the CX3C motif, mutating it to CX4C ( 182 CWAIAC 187 ), which is known to block binding to CX3CR1, might decrease disease. We studied the effect of the CX4C mutation in two strains of RSV (A2 and r19F) in a mouse challenge model. We included RSV r19F because it induces mucus production and airway resistance, two manifestations of RSV infection in humans, in mice. Compared to wild-type (wt) virus, mice infected with CX4C had a 0.7 to 1.2 log 10 -fold lower virus titer in the lung at 5 days postinfection (p.i.) and had markedly reduced weight loss, pulmonary inflammatory cell infiltration, mucus production, and airway resistance after challenge. This decrease in disease was not dependent on decrease in virus replication but did correspond to a decrease in pulmonary Th2 and inflammatory cytokines. Mice infected with CX4C viruses also had higher antibody titers and a Th1-biased T cell memory response at 75 days p.i. These results suggest that the CX4C mutation in the G protein could improve the safety and efficacy of a live attenuated RSV vaccine. IMPORTANCE RSV binds to the corresponding chemokine receptor, CX3CR1, through a CX3C chemokine motif ( 182 CWAIC 186 ) in the G protein. RSV binding to CX3CR1 contributes to disease pathogenesis; therefore, we investigated whether a mutation in the CX3C motif by insertion of an alanine, A 186 , within the CX3C motif, mutating it to CX4C ( 182 CWAIAC 187 ), known to block binding to CX3CR1, might decrease disease

  10. A novel homozygous no-stop mutation in G6PC gene from a Chinese patient with glycogen storage disease type Ia.

    PubMed

    Gu, Lei-Lei; Li, Xin-Hua; Han, Yue; Zhang, Dong-Hua; Gong, Qi-Ming; Zhang, Xin-Xin

    2014-02-25

    Glycogen storage disease type Ia (GSD-Ia) is an autosomal recessive genetic disorder resulting in hypoglycemia, hepatomegaly and growth retardation. It is caused by mutations in the G6PC gene encoding Glucose-6-phosphatase. To date, over 80 mutations have been identified in the G6PC gene. Here we reported a novel mutation found in a Chinese patient with abnormal transaminases, hypoglycemia, hepatomegaly and short stature. Direct sequencing of the coding region and splicing-sites in the G6PC gene revealed a novel no-stop mutation, p.*358Yext*43, leading to a 43 amino-acid extension of G6Pase. The expression level of mutant G6Pase transcripts was only 7.8% relative to wild-type transcripts. This mutation was not found in 120 chromosomes from 60 unrelated healthy control subjects using direct sequencing, and was further confirmed by digestion with Rsa I restriction endonuclease. In conclusion, we revealed a novel no-stop mutation in this study which expands the spectrum of mutations in the G6PC gene. The molecular genetic analysis was indispensable to the diagnosis of GSD-Ia for the patient. Copyright © 2013 Elsevier B.V. All rights reserved.

  11. GJB2 and GJB6 mutations are an infrequent cause of autosomal-recessive nonsyndromic hearing loss in residents of Mexico.

    PubMed

    Hernández-Juárez, Aideé Alejandra; Lugo-Trampe, José de Jesús; Campos-Acevedo, Luis Daniel; Lugo-Trampe, Angel; Treviño-González, José Luis; de-la-Cruz-Ávila, Israel; Martínez-de-Villarreal, Laura Elia

    2014-12-01

    Mutations in the DFNB1 locus are the most common cause of autosomal-recessive nonsyndromic hearing loss (ARNSHL) worldwide. The aim of this study was to identify the most frequent mutations in patients with ARNSHL who reside in Northeastern Mexico. We determined the nucleotide sequence the coding region of GJB2 of 78 patients with ARNSHL. Polymerase chain reaction assays were used to detect the GJB2 IVS1+1G>A mutation and deletions within GJB6. GJB2 mutations were detected in 9.6% of the alleles, and c.35delG was the most frequent. Six other less-frequent mutations were detected, including an extremely rare variant (c.645_648delTAGA), a novel mutation (c.35G>A), and one of possible Mexican origin (c.34G>T). GJB6 deletions and GJB2 IVS1+1G>A were not detected. These data suggest that mutations in the DFNB1 locus are a rare cause of ARNSHL among the population of Northeastern Mexico. This confirms the genetic heterogeneity of this condition and indicates that further research is required to determine the other mechanisms of pathogenesis of ARNSHL in Mexicans. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  12. Projections of Education Statistics to 2019. Thirty-Eighth Edition. NCES 2011-017

    ERIC Educational Resources Information Center

    Hussar, William J.; Bailey, Tabitha M.

    2011-01-01

    "Projections of Education Statistics to 2019" is the 38th report in a series begun in 1964. It includes statistics on elementary and secondary schools and degree-granting institutions. This report provides revisions of projections shown in "Projections of Education Statistics to 2018." Included are projections of enrollment,…

  13. A novel mutation of the ACADM gene (c.145C>G) associated with the common c.985A>G mutation on the other ACADM allele causes mild MCAD deficiency: a case report

    PubMed Central

    2010-01-01

    A female patient, with normal familial history, developed at the age of 30 months an episode of diarrhoea, vomiting and lethargy which resolved spontaneously. At the age of 3 years, the patient re-iterated vomiting, was sub-febrile and hypoglycemic, fell into coma, developed seizures and sequels involving right hemi-body. Urinary excretion of hexanoylglycine and suberylglycine was low during this metabolic decompensation. A study of pre- and post-prandial blood glucose and ketones over a period of 24 hours showed a normal glycaemic cycle but a failure to form ketones after 12 hours fasting, suggesting a mitochondrial β-oxidation defect. Total blood carnitine was lowered with unesterified carnitine being half of the lowest control value. A diagnosis of mild MCAD deficiency (MCADD) was based on rates of 1-14C-octanoate and 9, 10-3H-myristate oxidation and of octanoyl-CoA dehydrogenase being reduced to 25% of control values. Other mitochondrial fatty acid oxidation proteins were functionally normal. De novo acylcarnitine synthesis in whole blood samples incubated with deuterated palmitate was also typical of MCADD. Genetic studies showed that the patient was compound heterozygous with a sequence variation in both of the two ACADM alleles; one had the common c.985A>G mutation and the other had a novel c.145C>G mutation. This is the first report for the ACADM gene c.145C>G mutation: it is located in exon 3 and causes a replacement of glutamine to glutamate at position 24 of the mature protein (Q24E). Associated with heterozygosity for c.985A>G mutation, this mutation is responsible for a mild MCADD phenotype along with a clinical story corroborating the emerging literature view that patients with genotypes representing mild MCADD (high residual enzyme activity and low urinary levels of glycine conjugates), similar to some of the mild MCADDs detected by MS/MS newborn screening, may be at risk for disease presentation. PMID:20923556

  14. Forecasting US ivacaftor outcomes and cost in cystic fibrosis patients with the G551D mutation.

    PubMed

    Dilokthornsakul, Piyameth; Hansen, Ryan N; Campbell, Jonathan D

    2016-06-01

    Ivacaftor, a breakthrough treatment for cystic fibrosis (CF) patients with the G551D genetic mutation, lacks long-term clinical and cost projections. This study forecasted outcomes and cost by comparing ivacaftor plus usual care versus usual care alone.A lifetime Markov model was conducted from a US payer perspective. The model consisted of five health states: 1) forced expiratory volume in 1 s (FEV1) % pred ≥70%, 2) 40%≤ FEV1 % pred <70%, 3) FEV1 % pred <40%, 4) lung transplantation and 5) death. All inputs were extracted from published literature. Budget impact was also estimated. We estimated ivacaftor's improvement in outcomes compared with a non-CF referent population.Ivacaftor was associated with 18.25 (95% credible interval (CrI) 13.71-22.20) additional life-years and 15.03 (95% CrI 11.13-18.73) additional quality-adjusted life-years (QALYs). Ivacaftor was associated with improvements in survival and QALYs equivalent to 68% and 56%, respectively, for the survival and QALY gaps between CF usual care and their non-CF peers. The incremental lifetime cost was $3 374 584. The budget impact was $0.087 per member per month.Ivacaftor increased life-years and QALYs in CF patients with the G551D mutation, and moved morbidity and mortality closer to that of their non-CF peers. Ivacaftor costs much more than usual care, but comes at a relatively limited budget impact. Copyright ©ERS 2016.

  15. [(35)S]-GTPgammaS autoradiography reveals alpha(2) adrenoceptor-mediated G-protein activation in amygdala and lateral septum.

    PubMed

    Newman-Tancredi, A; Chaput, C; Touzard, M; Millan, M J

    2000-04-03

    alpha(2)-adrenoceptor-mediated G-protein activation was examined by [(35)S]-GTPgammaS autoradiography. In alpha(2)-adrenoceptor-rich regions (amygdala, lateral septum), noradrenaline stimulated [(35)S]-GTPgammaS binding. These actions were abolished by the selective alpha(2) antagonist, atipamezole. Conversely, in caudate nucleus, which expresses few alpha(2) receptors, noradrenaline-induced stimulation was not inhibited by atipamezole, suggesting that it is not mediated by alpha(2)-adrenoceptors.

  16. The HOXB13 G84E Mutation Is Associated with an Increased Risk for Prostate Cancer and Other Malignancies.

    PubMed

    Beebe-Dimmer, Jennifer L; Hathcock, Matthew; Yee, Cecilia; Okoth, Linda A; Ewing, Charles M; Isaacs, William B; Cooney, Kathleen A; Thibodeau, Stephen N

    2015-09-01

    A rare nonconservative substitution (G84E) in the HOXB13 gene has been shown to be associated with risk of prostate cancer. DNA samples from male patients included in the Mayo Clinic Biobank (MCB) were genotyped to determine the frequency of the G84E mutation and its association with various cancers. Subjects were genotyped using a custom TaqMan (Applied Biosystems) assay for G84E (rs138213197). In addition to donating a blood specimen, all MCB participants completed a baseline questionnaire to collect information on medical history and family history of cancer. Forty-nine of 9,012 male patients were carriers of G84E (0.5%). Thirty-one percent (n = 2,595) of participants had been diagnosed with cancer, including 51.1% of G84E carriers compared with just 30.6% of noncarriers (P = 0.004). G84E was most frequently observed among men with prostate cancer compared with men without cancer (P < 0.0001). However, the mutation was also more commonly observed in men with bladder cancer (P = 0.06) and leukemia (P = 0.01). G84E carriers were more likely to have a positive family history of prostate cancer in a first-degree relative compared to noncarriers (36.2% vs. 16.0%, P = 0.0003). Our study confirms the association between the HOXB13 G84E variant and prostate cancer and suggests a novel association between G84E and leukemia and a suggestive association with bladder cancer. Future investigation is warranted to confirm these associations in order to improve our understanding of the role of germline HOXB13 mutations in human cancer. The associations between HOXB13 and prostate, leukemia, and bladder suggest that this gene is important in carcinogenesis. ©2015 American Association for Cancer Research.

  17. The mutY gene: a mutator locus in Escherichia coli that generates G.C----T.A transversions.

    PubMed Central

    Nghiem, Y; Cabrera, M; Cupples, C G; Miller, J H

    1988-01-01

    We have used a strain with an altered lacZ gene, which reverts to wild type via only certain transversions, to detect transversion-specific mutators in Escherichia coli. Detection relied on a papillation technique that uses a combination of beta-galactosides to reveal blue Lac+ papillae. One class of mutators is specific for the G.C----T.A transversion as determined by the reversion pattern of a set of lacZ mutations and by the distribution of forward nonsense mutations in the lacI gene. The locus responsible for the mutator phenotype is designated mutY and maps near 64 min on the genetic map of E. coli. The mutY locus may act in a similar but reciprocal fashion to the previously characterized mutT locus, which results in A.T----C.G transversions. Images PMID:3128795

  18. CpG island methylator phenotype identifies high risk patients among microsatellite stable BRAF mutated colorectal cancers

    PubMed Central

    Vedeld, Hege Marie; Merok, Marianne; Jeanmougin, Marine; Danielsen, Stine A.; Honne, Hilde; Presthus, Gro Kummeneje; Svindland, Aud; Sjo, Ole H.; Hektoen, Merete; Eknæs, Mette; Nesbakken, Arild; Lothe, Ragnhild A.

    2017-01-01

    The prognostic value of CpG island methylator phenotype (CIMP) in colorectal cancer remains unsettled. We aimed to assess the prognostic value of this phenotype analyzing a total of 1126 tumor samples obtained from two Norwegian consecutive colorectal cancer series. CIMP status was determined by analyzing the 5‐markers CAGNA1G, IGF2, NEUROG1, RUNX3 and SOCS1 by quantitative methylation specific PCR (qMSP). The effect of CIMP on time to recurrence (TTR) and overall survival (OS) were determined by uni‐ and multivariate analyses. Subgroup analyses were conducted according to MSI and BRAF mutation status, disease stage, and also age at time of diagnosis (<60, 60‐74, ≥75 years). Patients with CIMP positive tumors demonstrated significantly shorter TTR and worse OS compared to those with CIMP negative tumors (multivariate hazard ratio [95% CI] 1.86 [1.31‐2.63] and 1.89 [1.34‐2.65], respectively). In stratified analyses, CIMP tumors showed significantly worse outcome among patients with microsatellite stable (MSS, P < 0.001), and MSS BRAF mutated tumors (P < 0.001), a finding that persisted in patients with stage II, III or IV disease, and that remained significant in multivariate analysis (P < 0.01). Consistent results were found for all three age groups. To conclude, CIMP is significantly associated with inferior outcome for colorectal cancer patients, and can stratify the poor prognostic patients with MSS BRAF mutated tumors. PMID:28542846

  19. A cis-Regulatory Mutation of PDSS2 Causes Silky-Feather in Chickens

    PubMed Central

    Feng, Chungang; Gao, Yu; Dorshorst, Ben; Song, Chi; Gu, Xiaorong; Li, Qingyuan; Li, Jinxiu; Liu, Tongxin; Rubin, Carl-Johan; Zhao, Yiqiang; Wang, Yanqiang; Fei, Jing; Li, Huifang; Chen, Kuanwei; Qu, Hao; Shu, Dingming; Ashwell, Chris; Da, Yang; Andersson, Leif; Hu, Xiaoxiang; Li, Ning

    2014-01-01

    Silky-feather has been selected and fixed in some breeds due to its unique appearance. This phenotype is caused by a single recessive gene (hookless, h). Here we map the silky-feather locus to chromosome 3 by linkage analysis and subsequently fine-map it to an 18.9 kb interval using the identical by descent (IBD) method. Further analysis reveals that a C to G transversion located upstream of the prenyl (decaprenyl) diphosphate synthase, subunit 2 (PDSS2) gene is causing silky-feather. All silky-feather birds are homozygous for the G allele. The silky-feather mutation significantly decreases the expression of PDSS2 during feather development in vivo. Consistent with the regulatory effect, the C to G transversion is shown to remarkably reduce PDSS2 promoter activity in vitro. We report a new example of feather structure variation associated with a spontaneous mutation and provide new insight into the PDSS2 function. PMID:25166907

  20. Novel multiplex bead-based assay for detection of IDH1 and IDH2 mutations in myeloid malignancies.

    PubMed

    Shivarov, Velizar; Ivanova, Milena; Hadjiev, Evgueniy; Naumova, Elissaveta

    2013-01-01

    Isocitrate dehydrogenase 1 and 2 (IDH) mutations are frequently found in various cancer types such as gliomas, chondrosarcomas and myeloid malignancies. Their molecular detection has recently gained wide recognition in the diagnosis and prognosis of these neoplasms. For that purpose various molecular approaches have been used but a universally accepted method is still lacking. In this study we aimed to develop a novel bead-based liquid assay using Locked nucleic acids (LNA)-modified oligonucleotide probes for multiplexed detection of the most frequent IDH1 (p.R132C, p.R132G, p.R132H, p.R132L, p.R132S) and IDH2 (p.R140Q, p.R172K) mutations. The method includes four steps: 1) PCR amplification of the targeted fragments with biotinylated primers; 2) Direct hybridization to barcoded microbeads with specific LNA-modified oligonucleotide probes; 3) Incubation with phycoerythrin coupled streptavidin; 4) Acquisition of fluorescent intensities of each set of beads on a flow platform (LuminexCorp., USA). We tested the performance of the assay on both artificial plasmid constructs and on clinical samples from 114 patients with known or suspected myeloid malignancies. The method appeared to be superior to direct sequencing having a much higher sensitivity of 2.5% mutant alleles. Applying this method to patients' samples we identified a total of 9 mutations (one IDH1 p.R132C, seven IDH2 p.R140Q and one IDH2 p.R172K). In conclusion, this method could be successfully implemented in the diagnostic work-up for various tumors known to harbor IDH1/2 mutations (e.g. myeloid malignancies, gliomas, etc.). International initiatives are needed to validate the different existing methods for detection of IDH1/2 mutations in clinical settings.

  1. The novel c.247_249delTTC (p.F83del) GJB2 mutation in a family with prelingual sensorineural deafness.

    PubMed

    Petersen, Michael B; Grigoriadou, Maria; Koutroumpe, Maria; Kokotas, Haris

    2012-07-01

    Non-syndromic hearing loss is one of the most common hereditary determined diseases in human, and the disease is a genetically heterogeneous disorder. Mutations in the GJB2 gene, encoding connexin 26 (Cx26), are a major cause of non-syndromic recessive hearing impairment in many countries and are largely dependent on ethnic groups. Due to the high frequency of the c.35delG GJB2 mutation in the Greek population, we have previously suggested that Greek patients with sensorineural, non-syndromic deafness should be tested for the c.35delG mutation and the coding region of the GJB2 gene should be sequenced in c.35delG heterozygotes. Here we present on the clinical and molecular genetic evaluation of a family suffering from prelingual, sensorineural, non-syndromic deafness. A novel c.247_249delTTC (p.F83del) GJB2 mutation was detected in compound heterozygosity with the c.35delG GJB2 mutation in the proband and was later confirmed in the father, while the mother was homozygous for the c.35delG GJB2 mutation. We conclude that compound heterozygosity of the novel c.247_249delTTC (p.F83del) and the c.35delG mutations in the GJB2 gene was the cause of deafness in the proband and his father. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  2. [Value of pre-gestational deafness-related mutation screening for the prevention and intervention of congenital deafness].

    PubMed

    Sun, Xuejing; Xing, Xinli; He, Qingqing; Zhou, Lin; Zhang, Jing; Zhao, Qing; Hou, Huili; Xi, Zuoming

    2017-10-10

    To assess the value of pre-gestational deafness-related mutation screening for the prevention and intervention of congenital deafness. In this study, 2168 couples with normal hearing were screened for common mutations associated with congenital deafness using real-time fluorescence quantitative PCR. The mutations have included GJB2 c.235delC and c.299_300delAT, SLC26A4 c.2168A>G and c.IVS7-2A>G, and mtDNA 12SrRNA c.1494C>T and c.1555A>G. For couples who have both carried heterozygous mutations of the same gene, genetic counseling and prenatal diagnosis were provided. Among of the 4 336 individuals, 178 (4.06%) were found to carry a mutation. Mutation rate for c.235delC and c.299_300delAT of GJB2 gene, c.IVS7-2 A>G and c.2168 A>G of SLC26A4 gene, c.1555 A>G and c.1494 C>T of DNA 12S rRNA gene were 0.91%, 0.20%, 0.68%, 0.11%, 0.1% and 0.01%, respectively. For six couples who have both carried mutations of the same gene, all fetuses showed a normal karyotype, while DNA sequencing indicated that two fetuses have carried homozygous c.235delC mutation of the GJB2 gene, one carried a heterozygous c.235delC mutation of the GJB2 gene, one carried heterozygous mutation of GJB2 gene (c.299_300delAT), and two have carried a heterozygous mutation of c.IVS7-2A>G of the SLC26A4 gene. Pre-gestational screening for deafness gene mutation can facilitate avoidance the birth of affected children and has a great clinical value for the prevention and intervention of birth defect.

  3. Fabrication of 2D SnS2/g-C3N4 heterojunction with enhanced H2 evolution during photocatalytic water splitting.

    PubMed

    Liu, Enzhou; Chen, Jibing; Ma, Yongning; Feng, Juan; Jia, Jia; Fan, Jun; Hu, Xiaoyun

    2018-08-15

    In this work, the 2D SnS 2 /g-C 3 N 4 heterojunctions were successfully prepared by heating the homogeneous dispersion of SnS 2 nanosheets and g-C 3 N 4 nanosheets using a microwave muffle. SEM, TEM and HRTEM images indicated that the SnS 2 nanosheets were loaded on the surface of the g-C 3 N 4 nanosheets. The UV-vis spectra show that the absorption intensity of the as-prepared samples was increased and the absorption range was also extended from 420 nm to approximately 600 nm. The H 2 production rate over 5 wt% SnS 2 /g-C 3 N 4 can reach 972.6 μmol·h -1 ·g -1 under visible light irradiation (λ > 420 nm) using TEOA as the sacrifice agent and Pt as the electron trap, which is 2.9 and 25.6 times higher than those of the pristine g-C 3 N 4 and SnS 2 , respectively. According to the obtained PL spectra, photocurrent and EIS spectra, the enhanced performance for H 2 generation over the heterojunctions is primarily ascribed to the rapid charge transfer arising from the suitable band gap positions leading to an improved photocatalytic performance. The recycling experiments indicated that the as-prepared composites exhibit good stability in H 2 production. Additionally, a possible enhanced mechanism for H 2 evolution was deduced based on the results obtained by various characterization techniques. Copyright © 2018 Elsevier Inc. All rights reserved.

  4. Krüppel-like factor 1 mutations and expression of hemoglobins F and A2 in homozygous hemoglobin E syndrome.

    PubMed

    Tepakhan, Wanicha; Yamsri, Supawadee; Fucharoen, Goonnapa; Sanchaisuriya, Kanokwan; Fucharoen, Supan

    2015-07-01

    The basis for variability of hemoglobin (Hb) F in homozygous Hb E disease is not well understood. We have examined multiple mutations of the Krüppel-like factor 1 (KLF1) gene; an erythroid specific transcription factor and determined their associations with Hbs F and A2 expression in homozygous Hb E. Four KLF1 mutations including G176AfsX179, T334R, R238H, and -154 (C-T) were screened using specific PCR assays on 461 subjects with homozygous Hb E and 100 normal controls. None of these four mutations were observed in 100 normal controls. Among 461 subjects with homozygous Hb E, 306 had high (≥5 %) and 155 had low (<5 %) Hb F. DNA analysis identified the KLF1 mutations in 35 cases of the former group with high Hb F, including the G176AfsX179 mutation (17/306 = 5.6 %), T334R mutation (9/306 = 2.9 %), -154 (C-T) mutation (7/306 = 2.3 %), and R328H mutation (2/306 = 0.7 %). Only two subjects in the latter group with low Hb F carried the G176AfsX179 and -154 (C-T) mutations. Significant higher Hb A2 level was observed in those of homozygous Hb E with the G176AfsX179 mutation as compared to those without KLF1 mutations. These results indicate that KLF1 is among the genetic factors associated with increased Hbs F and A2, and in combination with other factors could explain the variabilities of these Hb expression in Hb E syndrome.

  5. ASC-ATDM Performance Portability Requirements for 2015-2019

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Edwards, Harold C.; Trott, Christian Robert

    This report outlines the research, development, and support requirements for the Advanced Simulation and Computing (ASC ) Advanced Technology, Development, and Mitigation (ATDM) Performance Portability (a.k.a., Kokkos) project for 2015 - 2019 . The research and development (R&D) goal for Kokkos (v2) has been to create and demonstrate a thread - parallel programming model a nd standard C++ library - based implementation that enables performance portability across diverse manycore architectures such as multicore CPU, Intel Xeon Phi, and NVIDIA Kepler GPU. This R&D goal has been achieved for algorithms that use data parallel pat terns including parallel - for, parallelmore » - reduce, and parallel - scan. Current R&D is focusing on hierarchical parallel patterns such as a directed acyclic graph (DAG) of asynchronous tasks where each task contain s nested data parallel algorithms. This five y ear plan includes R&D required to f ully and performance portably exploit thread parallelism across current and anticipated next generation platforms (NGP). The Kokkos library is being evaluated by many projects exploring algorithm s and code design for NGP. Some production libraries and applications such as Trilinos and LAMMPS have already committed to Kokkos as their foundation for manycore parallelism an d performance portability. These five year requirements includes support required for current and antic ipated ASC projects to be effective and productive in their use of Kokkos on NGP. The greatest risk to the success of Kokkos and ASC projects relying upon Kokkos is a lack of staffing resources to support Kokkos to the degree needed by these ASC projects. This support includes up - to - date tutorials, documentation, multi - platform (hardware and software stack) testing, minor feature enhancements, thread - scalable algorithm consulting, and managing collaborative R&D.« less

  6. Autophosphorylation of CaMKK2 generates autonomous activity that is disrupted by a T85S mutation linked to anxiety and bipolar disorder.

    PubMed

    Scott, John W; Park, Elizabeth; Rodriguiz, Ramona M; Oakhill, Jonathan S; Issa, Samah M A; O'Brien, Matthew T; Dite, Toby A; Langendorf, Christopher G; Wetsel, William C; Means, Anthony R; Kemp, Bruce E

    2015-09-23

    Mutations that reduce expression or give rise to a Thr85Ser (T85S) mutation of Ca(2+)-CaM-dependent protein kinase kinase-2 (CaMKK2) have been implicated in behavioural disorders such as anxiety, bipolar and schizophrenia in humans. Here we report that Thr85 is an autophosphorylation site that endows CaMKK2 with a molecular memory that enables sustained autonomous activation following an initial, transient Ca(2+) signal. Conversely, autophosphorylation of Ser85 in the T85S mutant fails to generate autonomous activity but instead causes a partial loss of CaMKK2 activity. The loss of autonomous activity in the mutant can be rescued by blocking glycogen synthase kinase-3 (GSK3) phosphorylation of CaMKK2 with the anti-mania drug lithium. Furthermore, CaMKK2 null mice representing a loss of function model the human behavioural phenotypes, displaying anxiety and manic-like behavioural disturbances. Our data provide a novel insight into CaMKK2 regulation and its perturbation by a mutation associated with behavioural disorders.

  7. Novel mutation in forkhead box G1 (FOXG1) gene in an Indian patient with Rett syndrome.

    PubMed

    Das, Dhanjit Kumar; Jadhav, Vaishali; Ghattargi, Vikas C; Udani, Vrajesh

    2014-03-15

    Rett syndrome (RTT) is a severe neurodevelopmental disorder characterized by the progressive loss of intellectual functioning, fine and gross motor skills and communicative abilities, deceleration of head growth, and the development of stereotypic hand movements, occurring after a period of normal development. The classic form of RTT involves mutation in MECP2 while the involvement of CDKL5 and FOXG1 genes has been identified in atypical RTT phenotype. FOXG1 gene encodes for a fork-head box protein G1, a transcription factor acting primarily as transcriptional repressor through DNA binding in the embryonic telencephalon as well as a number of other neurodevelopmental processes. In this report we have described the molecular analysis of FOXG1 gene in Indian patients with Rett syndrome. FOXG1 gene mutation analysis was done in a cohort of 34 MECP2/CDKL5 mutation negative RTT patients. We have identified a novel mutation (p. D263VfsX190) in FOXG1 gene in a patient with congenital variant of Rett syndrome. This mutation resulted into a frameshift, thereby causing an alteration in the reading frames of the entire coding sequence downstream of the mutation. The start position of the frameshift (Asp263) and amino acid towards the carboxyl terminal end of the protein was found to be well conserved across species using multiple sequence alignment. Since the mutation is located at forkhead binding domain, the resultant mutation disrupts the secondary structure of the protein making it non-functional. This is the first report from India showing mutation in FOXG1 gene in Rett syndrome. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Enzymic colorimetry-based DNA chip: a rapid and accurate assay for detecting mutations for clarithromycin resistance in the 23S rRNA gene of Helicobacter pylori.

    PubMed

    Xuan, Shi-Hai; Zhou, Yu-Gui; Shao, Bo; Cui, Ya-Lin; Li, Jian; Yin, Hong-Bo; Song, Xiao-Ping; Cong, Hui; Jing, Feng-Xiang; Jin, Qing-Hui; Wang, Hui-Min; Zhou, Jie

    2009-11-01

    Macrolide drugs, such as clarithromycin (CAM), are a key component of many combination therapies used to eradicate Helicobacter pylori. However, resistance to CAM is increasing in H. pylori and is becoming a serious problem in H. pylori eradication therapy. CAM resistance in H. pylori is mostly due to point mutations (A2142G/C, A2143G) in the peptidyltransferase-encoding region of the 23S rRNA gene. In this study an enzymic colorimetry-based DNA chip was developed to analyse single-nucleotide polymorphisms of the 23S rRNA gene to determine the prevalence of mutations in CAM-related resistance in H. pylori-positive patients. The results of the colorimetric DNA chip were confirmed by direct DNA sequencing. In 63 samples, the incidence of the A2143G mutation was 17.46 % (11/63). The results of the colorimetric DNA chip were concordant with DNA sequencing in 96.83 % of results (61/63). The colorimetric DNA chip could detect wild-type and mutant signals at every site, even at a DNA concentration of 1.53 x 10(2) copies microl(-1). Thus, the colorimetric DNA chip is a reliable assay for rapid and accurate detection of mutations in the 23S rRNA gene of H. pylori that lead to CAM-related resistance, directly from gastric tissues.

  9. Mitochondrial tRNALeu(UUR) C3275T, tRNAGln T4363C and tRNALys A8343G mutations may be associated with PCOS and metabolic syndrome.

    PubMed

    Ding, Yu; Xia, Bo-Hou; Zhang, Cai-Juan; Zhuo, Guang-Chao

    2018-02-05

    Polycystic ovary syndrome (PCOS) is a very prevalent endocrine disease affecting reproductive women. Clinically, patients with this disorder are more vulnerable to develop type 2 diabetes mellitus (T2DM), cardiovascular events, as well as metabolic syndrome (MetS). To date, the molecular mechanism underlying PCOS remains largely unknown. Previously, we showed that mitochondrial dysfunction caused by mitochondrial DNA (mtDNA) mutation was an important cause for PCOS. In the current study, we described the clinical and biochemical features of a three-generation pedigree with maternally transmitted MetS, combined with PCOS. A total of three matrilineal relatives exhibited MetS including obesity, high triglyceride (TG) and Hemoglobin A1c (HbA1c) levels, and hypertension. Whereas one patient from the third generation manifestated PCOS. Mutational analysis of the whole mitochondrial genes from the affected individuals identified a set of genetic variations belonging to East Asia haplogroup B4b1c. Among these variants, the homoplasmic C3275T mutation disrupted a highly evolutionary conserved base-pairing (28A-46C) on the variable region of tRNA Leu(UUR) , whereas the T4363C mutation created a new base-pairing (31T-37A) in the anticodon stem of tRNA Gln , furthermore, the A8343G mutation occurred at the very conserved position of tRNA Lys and may result the failure in mitochondrial tRNAs (mt-tRNAs) metabolism. Biochemical analysis revealed the deficiency in mitochondrial functions including lower levels of mitochondrial membrane potential (MMP), ATP production and mtDNA copy number, while a significantly increased reactive oxygen species (ROS) generation was observed in polymononuclear leukocytes (PMNs) from the individuals carrying these mt-tRNA mutations, suggesting that these mutations may cause mitochondrial dysfunction that was responsible for the clinical phenotypes. Taken together, our data indicated that mt-tRNA mutations were associated with MetS and PCOS in this

  10. Mutation spectrum of MSH3-deficient HHUA/chr.2 cells reflects in vivo activity of the MSH3 gene product in mismatch repair.

    PubMed

    Tauchi, H; Komatsu, K; Ishizaki, K; Yatagai, F; Kato, T

    2000-02-14

    The endometrial tumor cell line HHUA carries mutations in two mismatch repair (MMR) genes MSH3 and MSH6. We have established an MSH3-deficient HHUA/chr.2 cell line by introducing human chromosome 2, which carries wild-type MSH6 and MSH2 genes, to HHUA cells. Introduction of chromosome 2 to HHUA cells partially restored G:G MMR activity to the cell extract and reduced the frequency of mutation at the hypoxanthine-guanine phosphoribosyltransferase (hprt*) locus to about 3% that of the parental HHUA cells, which is five-fold the frequency in MMR-proficient cells, indicating that the residual mutator activity in HHUA/chr.2 is due to an MSH3-deficiency in these cells. The spectrum of mutations occurring at the HPRT locus of HHUA/chr.2 was determined with 71 spontaneous 6TG(r) clones. Base substitutions and +/-1 bp frameshifts were the major mutational events constituting, respectively, 54% and 42% of the total mutations, and more than 70% of them occurred at A:T sites. A possible explanation for the apparent bias of mutations to A:T sites in HHUA/chr.2 is haploinsufficiency of the MSH6 gene on the transferred chromosome 2. Comparison of the mutation spectra of HHUA/chr.2 with that of the MSH6-deficient HCT-15 cell line [S. Ohzeki, A. Tachibana, K. Tatsumi, T. Kato, Carcinogenesis 18 (1997) 1127-1133.] suggests that in vivo the MutSalpha (MSH2:MSH6) efficiently repairs both mismatch and unpaired extrahelical bases, whereas MutSbeta (MSH2:MSH3) efficiently repairs extrahelical bases and repairs mismatch bases to a limited extent.

  11. Rare missense mutations in P2RY11 in narcolepsy with cataplexy.

    PubMed

    Degn, Matilda; Dauvilliers, Yves; Dreisig, Karin; Lopez, Régis; Pfister, Corinne; Pradervand, Sylvain; Rahbek Kornum, Birgitte; Tafti, Mehdi

    2017-06-01

    The sleep disorder narcolepsy with cataplexy is characterized by a highly specific loss of hypocretin (orexin) neurons, leading to the hypothesis that the condition is caused by an immune or autoimmune mechanism. All genetic variants associated with narcolepsy are immune-related. Among these are single nucleotide polymorphisms in the P2RY11-EIF3G locus. It is unknown how these genetic variants affect narcolepsy pathogenesis and whether the effect is directly related to P2Y11 signalling or EIF3G function. Exome sequencing in 18 families with at least two affected narcolepsy with cataplexy subjects revealed non-synonymous mutations in the second exon of P2RY11 in two families, and P2RY11 re-sequencing in 250 non-familial cases and 135 healthy control subjects revealed further six different non-synonymous mutations in the second exon of P2RY11 in seven patients. No mutations were found in healthy controls. Six of the eight narcolepsy-associated P2Y11 mutations resulted in significant functional deficits in P2Y11 signalling through both Ca2+ and cAMP signalling pathways. In conclusion, our data show that decreased P2Y11 signalling plays an important role in the development of narcolepsy with cataplexy. © The Author (2017). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  12. Identification of novel ROR2 gene mutations in Indian children with Robinow syndrome.

    PubMed

    Tamhankar, Parag M; Vasudevan, Lakshmi; Kondurkar, Shweta; Yashaswini, K; Agarwalla, Sunil Kumar; Nair, Mohandas; Ramkumar, T V; Chaubal, Nitin; Chennuri, Vasundhara Sridhar

    2014-01-01

    Robinow syndrome (RS) is an extremely rare genetic disorder characterized by short-limbed dwarfism, defects in vertebral segmentation and abnormalities in the head, face and external genitalia. Mutations in the ROR2 gene cause autosomal recessive RS (RRS) whereas mutations in WNT5A are responsible for the autosomal dominant (AD) form of RS. In AD Robinow patients, oral manifestations are more prominent, while hemivertebrae and scoliosis rarely occur and facial abnormalities tend to be milder. Three unrelated patients from different parts of India were studied. These patients were diagnosed as RRS due to presence of characteristic fetal facies, mesomelia, short stature, micropenis, hemivertebrae and rib abnormalities. One of the patients had fetal facies and micropenis but unusually mild skeletal features. This patient's mother had mild affection in the form of short stature and prominent eyes. Testosterone response to human chorionic gonadotropin was investigated in two patients and were normal. The exons and exon-intron boundaries of the ROR2 gene were sequenced for all probands. Bioinformatics analysis was done for putative variants using SIFT, PolyPhen2 and Mutation Taster. Patients 1, 2 and 3 were homozygous for c.G545A or p.C182Y in exon 5, c.227G>A or p.G76D in exon 3 and c.668G>A or p.C223Y in exon 6 respectively. Prenatal diagnosis could be performed in an ongoing pregnancy in one family and the fetus was confirmed to be unaffected. ROR2 mutations were documented for the first time in the Indian population. Knowledge of the molecular basis of the disorder served to provide accurate counseling and prenatal diagnosis to the families.

  13. Ivacaftor treatment of cystic fibrosis patients with the G551D mutation: a review of the evidence.

    PubMed

    Kotha, Kavitha; Clancy, John P

    2013-10-01

    Cystic fibrosis (CF) is a recessive disorder caused by mutations in the gene that encodes the CF transmembrane conductance regulator (CFTR) protein. CFTR protein is a chloride and bicarbonate channel that is critical for normal epithelial ion transport and hydration of epithelial surfaces. Current CF care is supportive, but recent breakthroughs have occurred with the advent of novel therapeutic strategies that assist the function of mutant CFTR proteins. The development and key clinical trial results of ivacaftor, a small molecule that targets gating defects in disease-causing CFTR mutations including G551D CFTR, are summarized in this review. The G551D mutation is reasonably common in the CF patient population and produces a CFTR protein that localizes normally to the plasma membrane, but fails to open in response to cellular cues. Ivacaftor treatment produces dramatic improvements in lung function, weight, lung disease stability, patient-reported outcomes, and CFTR biomarkers in patients with CF harboring the G551D CFTR mutation compared with placebo controls and patients with two copies of the common F508del CFTR mutation. The unprecedented success of ivacaftor treatment for the G551D CF patient population has generated excitement in the CF care community regarding the expansion of its use to other CF patient populations with primary or secondary gating defects.

  14. AVPR2 variants and mutations in nephrogenic diabetes insipidus: review and missense mutation significance.

    PubMed

    Spanakis, Elias; Milord, Edrice; Gragnoli, Claudia

    2008-12-01

    Almost 90% of nephrogenic diabetes insipidus (NDI) is due to mutations in the arginine-vasopressin receptor 2 gene (AVPR2). We retrospectively examined all the published mutations/variants in AVPR2. We planned to perform a comprehensive review of all the AVPR2 mutations/variants and to test whether any amino acid change causing a missense mutation is significantly more or less common than others. We performed a Medline search and collected detailed information regarding all AVPR2 mutations and variants. We performed a frequency comparison between mutated and wild-type amino acids and codons. We predicted the mutation effect or reported it based on published in vitro studies. We also reported the ethnicity of each mutation/variant carrier. In summary, we identified 211 AVPR2 mutations which cause NDI in 326 families and 21 variants which do not cause NDI in 71 NDI families. We described 15 different types of mutations including missense, frameshift, inframe deletion, deletion, insertion, nonsense, duplication, splicing and combined mutations. The missense mutations represent the 55.83% of all the NDI published families. Arginine and tyrosine are significantly (P = 4.07E-08 and P = 3.27E-04, respectively) the AVPR2 most commonly mutated amino acids. Alanine and glutamate are significantly (P = 0.009 and P = 0.019, respectively) the least mutated AVPR2 amino acids. The spectrum of mutations varies from rare gene variants or polymorphisms not causing NDI to rare mutations causing NDI, among which arginine and tyrosine are the most common missense. The AVPR2 mutations are spread world-wide. Our study may serve as an updated review, comprehensive of all AVPR2 variants and specific gene locations. J. Cell. Physiol. 217: 605-617, 2008. (c) 2008 Wiley-Liss, Inc.

  15. Computational design of thermostabilizing point mutations for G protein-coupled receptors

    PubMed Central

    Popov, Petr; Peng, Yao; Shen, Ling; Stevens, Raymond C; Cherezov, Vadim; Liu, Zhi-Jie

    2018-01-01

    Engineering of GPCR constructs with improved thermostability is a key for successful structural and biochemical studies of this transmembrane protein family, targeted by 40% of all therapeutic drugs. Here we introduce a comprehensive computational approach to effective prediction of stabilizing mutations in GPCRs, named CompoMug, which employs sequence-based analysis, structural information, and a derived machine learning predictor. Tested experimentally on the serotonin 5-HT2C receptor target, CompoMug predictions resulted in 10 new stabilizing mutations, with an apparent thermostability gain ~8.8°C for the best single mutation and ~13°C for a triple mutant. Binding of antagonists confers further stabilization for the triple mutant receptor, with total gains of ~21°C as compared to wild type apo 5-HT2C. The predicted mutations enabled crystallization and structure determination for the 5-HT2C receptor complexes in inactive and active-like states. While CompoMug already shows high 25% hit rate and utility in GPCR structural studies, further improvements are expected with accumulation of structural and mutation data. PMID:29927385

  16. Missense mutation T485S alters NBCe1-A electrogenicity causing proximal renal tubular acidosis

    PubMed Central

    Shao, Xuesi M.; Kao, Liyo; Azimov, Rustam; Weinstein, Alan M.; Newman, Debra; Liu, Weixin; Kurtz, Ira

    2013-01-01

    Mutations in SLC4A4, the gene encoding the electrogenic Na+-HCO3− cotransporter NBCe1, cause severe proximal renal tubular acidosis (pRTA), growth retardation, decreased IQ, and eye and teeth abnormalities. Among the known NBCe1 mutations, the disease-causing mechanism of the T485S (NBCe1-A numbering) mutation is intriguing because the substituted amino acid, serine, is structurally and chemically similar to threonine. In this study, we performed intracellular pH and whole cell patch-clamp measurements to investigate the base transport and electrogenic properties of NBCe1-A-T485S in mammalian HEK 293 cells. Our results demonstrated that Ser substitution of Thr485 decreased base transport by ∼50%, and importantly, converted NBCe1-A from an electrogenic to an electroneutral transporter. Aqueous accessibility analysis using sulfhydryl reactive reagents indicated that Thr485 likely resides in an NBCe1-A ion interaction site. This critical location is also supported by the finding that G486R (a pRTA causing mutation) alters the position of Thr485 in NBCe1-A thereby impairing its transport function. By using NO3− as a surrogate ion for CO32−, our result indicated that NBCe1-A mediates electrogenic Na+-CO32− cotransport when functioning with a 1:2 charge transport stoichiometry. In contrast, electroneutral NBCe1-T485S is unable to transport NO3−, compatible with the hypothesis that it mediates Na+-HCO3− cotransport. In patients, NBCe1-A-T485S is predicted to transport Na+-HCO3− in the reverse direction from blood into proximal tubule cells thereby impairing transepithelial HCO3− absorption, possibly representing a new pathogenic mechanism for generating human pRTA. PMID:23636456

  17. Colorectal Carcinomas With CpG Island Methylator Phenotype 1 Frequently Contain Mutations in Chromatin Regulators

    PubMed Central

    Tahara, Tomomitsu; Yamamoto, Eiichiro; Madireddi, Priyanka; Suzuki, Hiromu; Maruyama, Reo; Chung, Woonbok; Garriga, Judith; Jelinek, Jaroslav; Yamano, Hiro-o; Sugai, Tamotsu; Kondo, Yutaka; Toyota, Minoru; Issa, Jean-Pierre J.; Estécio, Marcos R. H.

    2014-01-01

    BACKGROUND & AIMS Subgroups of colorectal carcinomas (CRCs) characterized by DNA methylation anomalies are termed CpG island methylator phenotype (CIMP)1, CIMP2, or CIMP-negative. The pathogenesis of CIMP1 colorectal carcinomas, and their effects on patients’ prognoses and responses to treatment, differ from those of other CRCs. We sought to identify genetic somatic alterations associated with CIMP1 CRCs. METHODS We examined genomic DNA samples from 100 primary CRCs, 10 adenomas, and adjacent normal-appearing mucosae from patients undergoing surgery or colonoscopy at 3 tertiary medical centers. We performed exome sequencing of 16 colorectal tumors and their adjacent normal tissues. Extensive comparison with known somatic alterations in CRCs allowed segregation of CIMP1-exclusive alterations. The prevalence of mutations in selected genes was determined from an independent cohort. RESULTS We found that genes that regulate chromatin were mutated in CIMP1 CRCs; the highest rates of mutation were observed in CHD7 and CHD8, which encode members of the chromodomain helicase/adenosine triphosphate—dependent chromatin remodeling family. Somaticmutations in these 2 genes were detected in 5 of 9 CIMP1 CRCs. A prevalence screen showed that nonsilencing mutations in CHD7 and CHD8 occurred significantly more frequently in CIMP1 tumors (18 of 42 [43%]) than in CIMP2 (3 of 34 [9%]; P < .01) or CIMP-negative tumors (2 of 34 [6%]; P < .001). CIMP1 markers had increased binding by CHD7, compared with all genes. Genes altered in patients with CHARGE syndrome (congenital malformations involving the central nervous system, eye, ear, nose, and mediastinal organs) who had CHD7 mutations were also altered in CRCs with mutations in CHD7. CONCLUSIONS Aberrations in chromatin remodeling could contribute to the development of CIMP1 CRCs. A better understanding of the biological determinants of CRCs can be achieved when these tumors are categorized according to their epigenetic status. PMID

  18. Role of mutations G-480 and C-6203 in the attenuation phenotype of Sabin type 1 poliovirus.

    PubMed

    McGoldrick, A; Macadam, A J; Dunn, G; Rowe, A; Burlison, J; Minor, P D; Meredith, J; Evans, D J; Almond, J W

    1995-12-01

    Of the 55 point mutations which distinguish the type 1 poliovirus vaccine strain (Sabin 1) from its neurovirulent progenitor (P1/Mahoney), two have been strongly implicated by previous studies as determinants of the attenuation phenotype. A change of an A to a G at position 480, located within the 5' noncoding region, has been suggested to be the major attenuating mutation, analogous to the mutations at positions 481 and 472 in poliovirus types 2 and 3, respectively. In addition, the change of a U to a C at position 6203, resulting in an amino acid change in the polymerase protein 3D, has also been implicated as a determinant of attenuation, albeit to a lesser extent. To assess the contributions of these mutations to attenuation and temperature sensitivity, reciprocal changes were generated at these positions in infectious cDNA clones of Sabin 1 and P1/Mahoney. Assays in tissue culture and primates indicated that the two mutations make some contribution to the temperature sensitivity of the Sabin 1 strain but that neither is a strong determinant of attenuation.

  19. Identification of HNF4A Mutation p.T130I and HNF1A Mutations p.I27L and p.S487N in a Han Chinese Family with Early-Onset Maternally Inherited Type 2 Diabetes.

    PubMed

    Yang, Ying; Zhou, Tai-Cheng; Liu, Yong-Ying; Li, Xiao; Wang, Wen-Xue; Irwin, David M; Zhang, Ya-Ping

    2016-01-01

    Maturity-onset diabetes of the young (MODY) is characterized by the onset of diabetes before the age of 25 years, positive family history, high genetic predisposition, monogenic mutations, and an autosomal dominant mode of inheritance. Here, we aimed to investigate the mutations and to characterize the phenotypes of a Han Chinese family with early-onset maternally inherited type 2 diabetes. Detailed clinical assessments and genetic screening for mutations in the HNF4α, GCK, HNF-1α, IPF-1, HNF1β, and NEUROD1 genes were carried out in this family. One HNF4A mutation (p.T130I) and two HNF1A polymorphisms (p.I27L and p.S487N) were identified. Mutation p.T130I was associated with both early-onset and late-onset diabetes and caused downregulated HNF4A expression, whereas HNF1A polymorphisms p.I27L and p.S487N were associated with the age of diagnosis of diabetes. We demonstrated that mutation p.T130I in HNF4A was pathogenic as were the predicted polymorphisms p.I27L and p.S487N in HNF1A by genetic and functional analysis. Our results show that mutations in HNF4A and HNF1A genes might account for this early-onset inherited type 2 diabetes.

  20. Constitutional CHEK2 mutations are infrequent in early-onset and familial breast/ovarian cancer patients from Pakistan.

    PubMed

    Rashid, Muhammad U; Muhammad, Noor; Faisal, Saima; Amin, Asim; Hamann, Ute

    2013-06-27

    Less than 20% of Pakistani women with early-onset or familial breast/ovarian cancer harbor germ line mutations in the high-penetrance genes BRCA1, BRCA2 and TP53. Thus, mutations in other genes confer genetic susceptibility to breast cancer, of which CHEK2 is a plausible candidate. CHEK2 encodes a checkpoint kinase, involved in response to DNA damage. In the present study we assessed the prevalence of CHEK2 germ line mutations in 145 BRCA1/2-negative early-onset and familial breast/ovarian cancer patients from Pakistan (Group 1). Mutation analysis of the complete CHEK2 coding region was performed using denaturing high-performance liquid chromatography analysis, followed by DNA sequencing of variant fragments. Two potentially deleterious missense mutations, c.275C>G (p.P92R) and c.1216C>T, (p.R406C), were identified (1.4%). The c.275C>G mutation is novel and has not been described in other populations. It was detected in a 30-year-old breast cancer patient with a family history of breast and multiple other cancers. The c.1216C>T mutation was found in a 34-year-old ovarian cancer patient from a family with two breast cancer cases. Both mutations were not detected in 229 recently recruited BRCA1/2-negative high risk patients (Group 2). Our findings suggest that CHEK2 mutations may not contribute significantly to breast/ovarian cancer risk in Pakistani women.