Initial elevations in glutamate and dopamine neurotransmission decline with age, as does exploratory behavior, in LRRK2 G2019S knock-in mice.

PubMed

Volta, Mattia; Beccano-Kelly, Dayne A; Paschall, Sarah A; Cataldi, Stefano; MacIsaac, Sarah E; Kuhlmann, Naila; Kadgien, Chelsie A; Tatarnikov, Igor; Fox, Jesse; Khinda, Jaskaran; Mitchell, Emma; Bergeron, Sabrina; Melrose, Heather; Farrer, Matthew J; Milnerwood, Austen J

2017-09-20

LRRK2 mutations produce end-stage Parkinson's disease (PD) with reduced nigrostriatal dopamine, whereas, asymptomatic carriers have increased dopamine turnover and altered brain connectivity. LRRK2 pathophysiology remains unclear, but reduced dopamine and mitochondrial abnormalities occur in aged G2019S mutant knock-in (GKI) mice. Conversely, cultured GKI neurons exhibit increased synaptic transmission. We assessed behavior and synaptic glutamate and dopamine function across a range of ages. Young GKI mice exhibit more vertical exploration, elevated glutamate and dopamine transmission, and aberrant D2-receptor responses. These phenomena decline with age, but are stable in littermates. In young GKI mice, dopamine transients are slower, independent of dopamine transporter (DAT), increasing the lifetime of extracellular dopamine. Slowing of dopamine transients is observed with age in littermates, suggesting premature ageing of dopamine synapses in GKI mice. Thus, GKI mice exhibit early, but declining, synaptic and behavioral phenotypes, making them amenable to investigation of early pathophysiological, and later parkinsonian-like, alterations. This model will prove valuable in efforts to develop neuroprotection for PD.

Impaired intracortical transmission in G2019S leucine rich-repeat kinase Parkinson patients.

PubMed

Ponzo, Viviana; Di Lorenzo, Francesco; Brusa, Livia; Schirinzi, Tommaso; Battistini, Stefania; Ricci, Claudia; Sambucci, Manolo; Caltagirone, Carlo; Koch, Giacomo

2017-05-01

A mutation in leucine-rich repeat kinase 2 is the most common cause of hereditary Parkinson's disease (PD), yet the neural mechanisms and the circuitry potentially involved are poorly understood. We used different transcranial magnetic stimulation protocols to explore in the primary motor cortex the activity of intracortical circuits and cortical plasticity (long-term potentiation) in patients with the G2019S leucine-rich repeat kinase 2 gene mutation when compared with idiopathic PD patients and age-matched healthy subjects. Paired pulse transcranial magnetic stimulation was used to investigate short intracortical inhibition and facilitation and short afferent inhibition. Intermittent theta burst stimulation, a form of repetitive transcranial magnetic stimulation, was used to test long-term potentiation-like cortical plasticity. Leucine-rich repeat kinase 2 and idiopathic PD were tested both in ON and in OFF l-dopa therapy. When compared with idiopathic PD and healthy subjects, leucine-rich repeat kinase 2 PD patients showed a remarkable reduction of short intracortical inhibition in both ON and in OFF l-dopa therapy. This reduction was paralleled by an increase of intracortical facilitation in OFF l-dopa therapy. Leucine-rich repeat kinase 2 PD showed abnormal long-term potentiation-like cortical plasticity in ON l-dopa therapy. The motor cortex in leucine-rich repeat kinase 2 mutated PD patients is strongly disinhibited and hyperexcitable. These abnormalities could be a result of an impairment of inhibitory (gamma-Aminobutyric acid) transmission eventually related to altered neurotransmitter release. © 2017 International Parkinson and Movement Disorder Society. © 2017 International Parkinson and Movement Disorder Society.

The MAPK1/3 pathway is essential for the deregulation of autophagy observed in G2019S LRRK2 mutant fibroblasts

PubMed Central

Bravo-San Pedro, José M.; Gómez-Sánchez, Rubén; Niso-Santano, Mireia; Pizarro-Estrella, Elisa; Aiastui-Pujana, Ana; Gorostidi, Ana; Climent, Vicente; López de Maturana, Rakel; Sanchez-Pernaute, Rosario; López de Munain, Adolfo; Fuentes, José M.; González-Polo, Rosa A.

2012-01-01

The link between the deregulation of autophagy and cell death processes can be essential in the development of several neurodegenerative diseases, such as Parkinson disease (PD). However, the molecular mechanism of deregulation of this degradative process in PD patients is unknown. The leucine-rich repeat kinase 2 (LRRK2) gene is related to PD and its implication in autophagy regulation has been described. Our recent work shows that the presence of the G2019S LRRK2 mutation, one of the most prevalent in LRRK2, is accompanied by a deregulation of autophagy basal levels dependent on the MAPK1/3 (ERK2/1) pathway. PMID:22914360

Functional properties of LRRK2 mutations in Taiwanese Parkinson disease.

PubMed

Chang, Kuo-Hsuan; Chen, Chiung-Mei; Lin, Chih-Hsin; Chang, Wen-Teng; Jiang, Pei-Ru; Hsiao, Ya-Chin; Wu, Yih-Ru; Lee-Chen, Guey-Jen

2017-03-01

Leucine-rich repeat kinase 2 (LRRK2) is a large protein encoding multiple functional domains. Mutations within different LRRK2 domains have been considered to be involved in the development of Parkinson disease by different mechanisms. Our previous study found three LRRK2 mutations-p.R767H, p.S885N, and p.R1441H-in Taiwanese patients with Parkinson disease. We evaluated the functional properties of LRRK2 p.R767H, p.S885N, and p.R1441H mutations by overexpressing them in human embryonic kidney 293 and neuroblastoma SK-N-SH cells. The common p.G2019S mutation in the kinase domain was included for comparison. In 293 cells, overexpressed p.R1441H-but not p.R767H, p.S885N, or p.G2019-increased GTP binding affinity to prolong the active state. Overexpressed p.R1441H and p.G2019S generated inclusions in 293 cells. In SK-N-SH cells, the α-synuclein was coexpressed with wild type as well as mutated p.R767H, p.S885N, p.R1441H, and p.G2019 LRRK2 proteins. Part of the perinuclear inclusions formed by p.R1441H and p.G2019S were colocalized with α-synuclein. Additionally, p.S885N and p.R1441H mutations caused reduced interaction between LRRK2 and ARHGEF7, a putative guanine nucleotide exchange factor for LRRK2, whereas this interaction was well preserved in p.R767H and p.G2019S mutations. Our study suggests that p.R1441H protein facilitates the formation of intracellular inclusions, compromises GTP hydrolysis by increasing its affinity for GTP, and reduces its interaction with ARHGEF7. Copyright © 2016. Published by Elsevier B.V.

CFTR mutation distribution among U.S. Hispanic and African American individuals: evaluation in cystic fibrosis patient and carrier screening populations.

PubMed

Sugarman, Elaine A; Rohlfs, Elizabeth M; Silverman, Lawrence M; Allitto, Bernice A

2004-01-01

We reviewed CFTR mutation distribution among Hispanic and African American individuals referred for CF carrier screening and compared mutation frequencies to those derived from CF patient samples. Results from CFTR mutation analyses received from January 2001 through September 2003, were analyzed for four populations: Hispanic individuals with a CF diagnosis (n = 159) or carrier screening indication (n = 15,333) and African American individuals with a CF diagnosis (n = 108) or carrier screening indication (n = 8,973). All samples were tested for the same 87 mutation panel. In the Hispanic population, 42 mutations were identified: 30 in the patient population (77.5% detection rate) and 33 among carrier screening referrals. Five mutations not included in the ACMG/ACOG carrier screening panel (3876delA, W1089X, R1066C, S549N, 1949del84) accounted for 7.55% detection in patients and 5.58% among carriers. Among African American referrals, 33 different mutations were identified: 21 in the patient population (74.4% detection) and 23 in the carrier screening population. Together, A559T and 711+5G>A were observed at a detection rate of 3.71% in CF patients and 6.38% in carriers. The mutation distribution seen in both the carrier screening populations reflected an increased frequency of mutations with variable expression such as D1152H, R117H, and L206W. A detailed analysis of CFTR mutation distribution in the Hispanic and African American patient and carrier screening populations demonstrates that a diverse group of mutations is most appropriate for diagnostic and carrier screening in these populations. To best serve the increasingly diverse U.S. population, ethnic-specific mutations should be included in mutation panels.

Increased fMRI signal with age in familial Alzheimer’s disease mutation carriers

PubMed Central

Braskie, Meredith N.; Medina, Luis D.; Rodriguez-Agudelo, Yaneth; Geschwind, Daniel H.; Macias-Islas, Miguel Angel; Cummings, Jeffrey L.; Bookheimer, Susan Y.; Ringman, John M.

2010-01-01

Although many Alzheimer’s disease (AD) patients have a family history of the disease, it is rarely inherited in a predictable way. Functional magnetic resonance imaging (fMRI) studies of non-demented adults carrying familial AD mutations provide an opportunity to prospectively identify brain differences associated with early AD-related changes. We compared fMRI activity of 18 non-demented autosomal dominant AD mutation carriers with fMRI activity in 8 of their non-carrier relatives as they performed a novelty encoding task in which they viewed novel and repeated images. Because age of disease onset is relatively consistent within families, we also correlated fMRI activity with subjects’ distance from the median age of diagnosis for their family. Mutation carriers did not show significantly different voxelwise fMRI activity from non-carriers as a group. However, as they approached their family age of disease diagnosis, only mutation carriers showed increased fMRI activity in the fusiform and middle temporal gyri. This suggests that during novelty encoding, increased fMRI activity in the temporal lobe may relate to incipient AD processes. PMID:21129823

Carrier screening of RTEL1 mutations in the Ashkenazi Jewish population.

PubMed

Fedick, A M; Shi, L; Jalas, C; Treff, N R; Ekstein, J; Kornreich, R; Edelmann, L; Mehta, L; Savage, S A

2015-08-01

Hoyeraal-Hreidarsson syndrome (HH) is a clinically severe variant of dyskeratosis congenita (DC), characterized by cerebellar hypoplasia, microcephaly, intrauterine growth retardation, and severe immunodeficiency in addition to features of DC. Germline mutations in the RTEL1 gene have recently been identified as causative of HH. In this study, the carrier frequency for five RTEL1 mutations that occurred in individuals of Ashkenazi Jewish descent was investigated in order to advise on including them in existing clinical mutation panels for this population. Our screening showed that the carrier frequency for c.3791G>A (p.R1264H) was higher than expected, 1% in the Ashkenazi Orthodox and 0.45% in the general Ashkenazi Jewish population. Haplotype analyses suggested the presence of a common founder. We recommend that the c.3791G>A RTEL1 mutation be considered for inclusion in carrier screening panels in the Ashkenazi population. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Arm swing as a potential new prodromal marker of Parkinson's disease.

PubMed

Mirelman, Anat; Bernad-Elazari, Hagar; Thaler, Avner; Giladi-Yacobi, Eytan; Gurevich, Tanya; Gana-Weisz, Mali; Saunders-Pullman, Rachel; Raymond, Deborah; Doan, Nancy; Bressman, Susan B; Marder, Karen S; Alcalay, Roy N; Rao, Ashwini K; Berg, Daniela; Brockmann, Kathrin; Aasly, Jan; Waro, Bjørg Johanne; Tolosa, Eduardo; Vilas, Dolores; Pont-Sunyer, Claustre; Orr-Urtreger, Avi; Hausdorff, Jeffrey M; Giladi, Nir

2016-10-01

Reduced arm swing is a well-known clinical feature of Parkinson's disease (PD), often observed early in the course of the disease. We hypothesized that subtle changes in arm swing and axial rotation may also be detectable in the prodromal phase. The purpose of this study was to evaluate the relationship between the LRRK2-G2019S mutation, arm swing, and axial rotation in healthy nonmanifesting carriers and noncarriers of the G2019S mutation and in patients with PD. A total of 380 participants (186 healthy nonmanifesting controls and 194 PD patients) from 6 clinical sites underwent gait analysis while wearing synchronized 3-axis body-fixed sensors on the lower back and bilateral wrists. Participants walked for 1 minute under the following 2 conditions: (1) usual walking and (2) dual-task walking. Arm swing amplitudes, asymmetry, variability, and smoothness were calculated for both arms along with measures of axial rotation. A total of 122 nonmanifesting participants and 67 PD patients were carriers of the G2019S mutation. Nonmanifesting mutation carriers walked with greater arm swing asymmetry and variability and lower axial rotation smoothness under the dual task condition when compared with noncarriers (P < .04). In the nonmanifesting mutation carriers, arm swing asymmetry was associated with gait variability under dual task (P = .003). PD carriers showed greater asymmetry and variability of movement than PD noncarriers, even after controlling for disease severity (P < .009). The G2019S mutation is associated with increased asymmetry and variability among nonmanifesting participants and patients with PD. Prospective studies should determine if arm swing asymmetry and axial rotation smoothness may be used as motor markers of prodromal PD. © 2016 International Parkinson and Movement Disorder Society. © 2016 International Parkinson and Movement Disorder Society.

Pathogenic LRRK2 mutations, through increased kinase activity, produce enlarged lysosomes with reduced degradative capacity and increase ATP13A2 expression.

PubMed

Henry, Anastasia G; Aghamohammadzadeh, Soheil; Samaroo, Harry; Chen, Yi; Mou, Kewa; Needle, Elie; Hirst, Warren D

2015-11-01

Lysosomal dysfunction plays a central role in the pathogenesis of several neurodegenerative disorders, including Parkinson's disease (PD). Several genes linked to genetic forms of PD, including leucine-rich repeat kinase 2 (LRRK2), functionally converge on the lysosomal system. While mutations in LRRK2 are commonly associated with autosomal-dominant PD, the physiological and pathological functions of this kinase remain poorly understood. Here, we demonstrate that LRRK2 regulates lysosome size, number and function in astrocytes, which endogenously express high levels of LRRK2. Expression of LRRK2 G2019S, the most common pathological mutation, produces enlarged lysosomes and diminishes the lysosomal capacity of these cells. Enlarged lysosomes appears to be a common phenotype associated with pathogenic LRRK2 mutations, as we also observed this effect in cells expressing other LRRK2 mutations; R1441C or Y1699C. The lysosomal defects associated with these mutations are dependent on both the catalytic activity of the kinase and autophosphorylation of LRRK2 at serine 1292. Further, we demonstrate that blocking LRRK2's kinase activity, with the potent and selective inhibitor PF-06447475, rescues the observed defects in lysosomal morphology and function. The present study also establishes that G2019S mutation leads to a reduction in lysosomal pH and increased expression of the lysosomal ATPase ATP13A2, a gene linked to a parkinsonian syndrome (Kufor-Rakeb syndrome), in brain samples from mouse and human LRRK2 G2019S carriers. Together, these results demonstrate that PD-associated LRRK2 mutations perturb lysosome function in a kinase-dependent manner, highlighting the therapeutic promise of LRRK2 kinase inhibitors in the treatment of PD. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

A Comparison between CHEK2*1100delC/I157T Mutation Carrier and Noncarrier Breast Cancer Patients: A Clinicopathological Analysis.

PubMed

Huszno, Joanna; Budryk, Magdalena; Kołosza, Zofia; Tęcza, Karolina; Pamuła Piłat, Jolanta; Nowara, Elżbieta; Grzybowska, Ewa

2016-01-01

The suppressor gene CHEK2 encodes a cell cycle checkpoint kinase, involved in cell cycle regulation, apoptosis and response to DNA damage. The aim of this study was to analyze the differences between CHEK2 mutation carriers (CHEK2*1100delC/I157T) and noncarriers with respect to clinicopathological factors. We reviewed the medical records of 100 early breast cancer patients (46 mutation carriers and 54 noncarriers) who were treated with chemotherapy, hormonotherapy or trastuzumab. CHEK2 mutation carriers were older (>65 years) than noncarriers (17 vs. 7%; p = 0.215). Twenty-five (54%) of them had a history of cancer in the family. Gastric cancer in the family history was detected in 11% of mutation carriers and in 2% of noncarriers (p = 0.092). There was a trend for more frequent lymph node metastases in patients without the mutation in comparison to mutation carriers (46 vs. 28%; p = 0.098). Luminal B type breast cancer was detected more often in carriers (39 vs. 20%; p = 0.048). Breast-conserving treatment was also conducted more often in mutation carriers (57 vs. 31%; p = 0.015). Histologic grades G1/G2 were detected more frequently in mutation carriers (82 vs. 70%; p = 0.212). Mutation carriers were characterized by older age, a history of gastric cancer in the family, locally advanced disease, lower histologic grade and luminal B type breast cancer. © 2016 S. Karger AG, Basel.

Amylin S20G mutation in Mexican population.

PubMed

Garcia-Gonzalez, Claudia Lorena; Montoya-Fuentes, Hector; Padilla-Rosas, Miguel; Sanchez-Corona, Jose

2007-04-01

Diabetes Mellitus type 2 (DM2) is a group of metabolic disorders characterized by defective insulin action or secretion or both with a 10.6% incidence in Mexican Mestizo population, DM2 is also classified within the localized misfolding diseases due to the amyloid pancreatic deposits found in 90% of the DM2 necropsies. The pancreatic amyloid main component is a protein known as human islet amyloid polypeptide (hIAPP) or amylin, the most common mutation is the S20G in Asian population with a polymorphic frequency in DM2 Asian patients. The aim of this study was to search this mutation in Mexican Mestizo general population (104) and DM2 patients (100). This is the first molecular study of hIAPP gene in Mexican population and in which we developed an alternative more effective antisense primer for the analysis of the NFGAILSS region in hIAPP exon 3 critical for the amyloid beta structure formation. We did not find the mutation in any of the 204 analyzed samples, thus the findings show that S20G is not a common mutation in Mexican Mestizo population.

Adherence to Mediterranean Diet and Metabolic Syndrome in BRCA Mutation Carriers

PubMed Central

Bruno, Eleonora; Manoukian, Siranoush; Venturelli, Elisabetta; Oliverio, Andreina; Rovera, Francesca; Iula, Giovanna; Morelli, Daniele; Peissel, Bernard; Azzolini, Jacopo; Roveda, Eliana; Pasanisi, Patrizia

2017-01-01

Background. Insulin resistance is associated with higher breast cancer (BC) penetrance in BRCA mutation carriers. Metabolic syndrome (MetS), an insulin resistance syndrome, can be reversed by adhering to the Mediterranean diet (MedDiet). In a dietary intervention trial on BRCA mutation carriers, we evaluated adherence to the MedDiet, and the association with the MetS, by analyzing data from the Mediterranean Diet Adherence Screener (MEDAS). Methods. BRCA mutation carriers, with or without BC, aged 18 to 70 years, were eligible for the trial. After the baseline examinations, women were randomized to a dietary intervention or to a control group. Both groups completed the MEDAS at baseline and at the end of the dietary intervention. Results. A total of 163 women completed the 6 months of dietary intervention. Compared with controls, the women in the intervention group significantly reduced their consumption of red meat (P < .01) and commercial sweets (P < .01) and their MEDAS score rose significantly (+1.3 vs +0.55, P = .02). The number of MetS parameters decreased with increasing points of adherence to the MEDAS score (P = .01). In the intervention group, there was a significant association with the greater reduction of MetS. Conclusion. BRCA mutation carriers in the intervention group experienced greater improvement in their MedDiet and MetS parameters. PMID:28741383

Lipid Oxidation in Carriers of Lecithin:Cholesterol Acyltransferase Gene Mutations

PubMed Central

Holleboom, Adriaan G.; Daniil, Georgios; Fu, Xiaoming; Zhang, Renliang; Hovingh, G. Kees; Schimmel, Alinda W.; Kastelein, John J.P.; Stroes, Erik S.G.; Witztum, Joseph L.; Hutten, Barbara A.; Tsimikas, Sotirios; Hazen, Stanley L.; Chroni, Angeliki; Kuivenhoven, Jan Albert

2013-01-01

Objective Lecithin:cholesterol acyltransferase (LCAT) has been shown to play a role in the depletion of lipid oxidation products, but this has so far not been studied in humans. In this study, we investigated processes and parameters relevant to lipid oxidation in carriers of functional LCAT mutations. Methods and Results In 4 carriers of 2 mutant LCAT alleles, 63 heterozygotes, and 63 family controls, we measured activities of LCAT, paraoxonase 1, and platelet-activating factor-acetylhydrolase; levels of lysophosphatidylcholine molecular species, arachidonic and linoleic acids, and their oxidized derivatives; immunodetectable oxidized phospholipids on apolipoprotein (apo) B–containing and apo(a)-containing lipoproteins; IgM and IgG autoantibodies to malondialdehyde-low-density lipoprotein and IgG and IgM apoB-immune complexes; and the antioxidant capacity of high-density lipoprotein (HDL). In individuals with LCAT mutations, plasma LCAT activity, HDL cholesterol, apoA-I, arachidonic acid, and its oxidized derivatives, oxidized phospholipids on apo(a)-containing lipoproteins, HDL-associated platelet-activating factor-acetylhydrolase activity, and the antioxidative capacity of HDL were gene-dose–dependently decreased. Oxidized phospholipids on apoB-containing lipoproteins was increased in heterozygotes (17%; P<0.001) but not in carriers of 2 defective LCAT alleles. Conclusion Carriers of LCAT mutations present with significant reductions in LCAT activity, HDL cholesterol, apoA-I, platelet-activating factor-acetylhydrolase activity, and antioxidative potential of HDL, but this is not associated with parameters of increased lipid peroxidation; we did not observe significant changes in the oxidation products of arachidonic acid and linoleic acid, immunoreactive oxidized phospholipids on apo(a)-containing lipoproteins, and IgM and IgG autoantibodies against malondialdehyde-low-density lipoprotein. These data indicate that plasma LCAT activity, HDL

Brief report: Emotional distress and recent stressful life events in long QT syndrome mutation carriers.

PubMed

Määttänen, Ilmari; Jokela, Markus; Pulkki-Råback, Laura; Keltikangas-Järvinen, Liisa; Swan, Heikki; Toivonen, Lauri; Merjonen, Päivi; Hintsa, Taina

2015-11-01

To study emotional distress in symptomatic and asymptomatic long QT syndrome mutation carriers who had experienced a recent stressful life event. The participants were 209 symptomatic and 279 asymptomatic long QT syndrome mutation carriers. Emotional distress was assessed with the Cope questionnaire and stressful life events with the Social Readjustment Rating Scale. Symptomatic long QT syndrome mutation carriers with burdening recent stressful life events reported a higher emotional distress (β = 0.35, p < 0.001), while the asymptomatic did not show such difference (β = 0.13, p = 0.393). Symptomatic long QT syndrome mutation carriers who have experienced stressful life events recently report an increased emotional distress. © The Author(s) 2013.

PMS2 monoallelic mutation carriers: the known unknown

PubMed Central

Goodenberger, McKinsey L.; Thomas, Brittany C.; Riegert-Johnson, Douglas; Boland, C. Richard; Plon, Sharon E.; Clendenning, Mark; Ko Win, Aung; Senter, Leigha; Lipkin, Steven M.; Stadler, Zsofia K.; Macrae, Finlay A.; Lynch, Henry T.; Weitzel, Jeffrey N.; de la Chapelle, Albert; Syngal, Sapna; Lynch, Patrick; Parry, Susan; Jenkins, Mark A.; Gallinger, Steven; Holter, Spring; Aronson, Melyssa; Newcomb, Polly A.; Burnett, Terrilea; Le Marchand, Loïc; Pichurin, Pavel; Hampel, Heather; Terdiman, Jonathan P.; Lu, Karen H.; Thibodeau, Stephen; Lindor, Noralane M.

2016-01-01

Germline mutations in MLH1, MSH2, MSH6 and PMS2 have been shown to cause Lynch syndrome. The penetrance for cancer and tumor spectrum has been repeatedly studied and multiple professional societies have proposed clinical management guidelines for affected individuals. Several studies have demonstrated a reduced penetrance for monoallelic carriers of PMS2 mutations compared to the other mismatch repair (MMR) genes, but clinical management guidelines have largely proposed the same screening recommendations for all MMR gene carriers. The authors considered whether enough evidence existed to propose new screening guidelines specific to PMS2 mutation carriers with regard to age of onset and frequency of colonic screening. Published reports of PMS2 germline mutations were combined with unpublished cases from the authors’ research registries and clinical practices, and a discussion of potential modification of cancer screening guidelines was pursued. A total of 234 monoallelic PMS2 mutation carriers from 170 families were included. Approximately 8% of those with CRC were diagnosed under age 30 and each of these tumors presented on the left-side of the colon. As it is currently unknown what causes the early-onset of CRC in some families with monoallelic PMS2 germline mutations, the authors recommend against reducing cancer surveillance guidelines in families found having monoallelic PMS2 mutations in spite of the documented reduced penetrance. PMID:25856668

Interest in Genetic Testing in Ashkenazi Jewish Parkinson’s Disease Patients and Their Unaffected Relatives

PubMed Central

Gupte, Manisha; Alcalay, Roy N.; Mejia-Santana, Helen; Raymond, Deborah; Saunders-Pullman, Rachel; Roos, Ernest; Orbe-Reily, Martha; Tang, Ming-X; Mirelman, Anat; Ozelius, Laurie; Orr-Urtreger, Avi; Clark, Lorraine; Giladi, Nir; Bressman, Susan

2014-01-01

Our objective was to explore interest in genetic testing among Ashkenazi Jewish (AJ) Parkinson’s Disease (PD) cases and first-degree relatives, as genetic testing for LRRK2 G2019S is widely available. Approximately 18 % of AJ PD cases carry G2019S mutations; penetrance estimations vary between 24 and 100 % by age 80. A Genetic Attitude Questionnaire (GAQ) was administered at two New York sites to PD families unaware of LRRK2 G2019S mutation status. The association of G2019S, age, education, gender and family history of PD with desire for genetic testing (outcome) was modeled using logistic regression. One-hundred eleven PD cases and 77 relatives completed the GAQ. Both PD cases and relatives had excellent PD-specific genetic knowledge. Among PD, 32.6 % “definitely” and 41.1 % “probably” wanted testing, if offered “now.” Among relatives, 23.6 % “definitely” and 36.1 % “probably” wanted testing “now.” Desire for testing in relatives increased incrementally based on hypothetical risk of PD. The most important reasons for testing in probands and relatives were: if it influenced medication response, identifying no mutation, and early prevention and treatment. In logistic regression, older age was associated with less desire for testing in probands OR=0.921 95%CI 0.868–0.977, p=0.009. Both probands and relatives express interest in genetic testing, despite no link to current treatment or prevention. PMID:25127731

PMS2 monoallelic mutation carriers: the known unknown.

PubMed

Goodenberger, McKinsey L; Thomas, Brittany C; Riegert-Johnson, Douglas; Boland, C Richard; Plon, Sharon E; Clendenning, Mark; Win, Aung Ko; Senter, Leigha; Lipkin, Steven M; Stadler, Zsofia K; Macrae, Finlay A; Lynch, Henry T; Weitzel, Jeffrey N; de la Chapelle, Albert; Syngal, Sapna; Lynch, Patrick; Parry, Susan; Jenkins, Mark A; Gallinger, Steven; Holter, Spring; Aronson, Melyssa; Newcomb, Polly A; Burnett, Terrilea; Le Marchand, Loïc; Pichurin, Pavel; Hampel, Heather; Terdiman, Jonathan P; Lu, Karen H; Thibodeau, Stephen; Lindor, Noralane M

2016-01-01

Germ-line mutations in MLH1, MSH2, MSH6, and PMS2 have been shown to cause Lynch syndrome. The penetrance of the cancer and tumor spectrum has been repeatedly studied, and multiple professional societies have proposed clinical management guidelines for affected individuals. Several studies have demonstrated a reduced penetrance for monoallelic carriers of PMS2 mutations compared with the other mismatch repair (MMR) genes, but clinical management guidelines have largely proposed the same screening recommendations for all MMR gene carriers. The authors considered whether enough evidence existed to propose new screening guidelines specific to PMS2 mutation carriers with regard to age at onset and frequency of colonic screening. Published reports of PMS2 germ-line mutations were combined with unpublished cases from the authors' research registries and clinical practices, and a discussion of potential modification of cancer screening guidelines was pursued. A total of 234 monoallelic PMS2 mutation carriers from 170 families were included. Approximately 8% of those with colorectal cancer (CRC) were diagnosed before age 30, and each of these tumors presented on the left side of the colon. As it is currently unknown what causes the early onset of CRC in some families with monoallelic PMS2 germline mutations, the authors recommend against reducing cancer surveillance guidelines in families found having monoallelic PMS2 mutations in spite of the reduced penetrance.Genet Med 18 1, 13-19.

Landscape of Familial Isolated and Young-Onset Pituitary Adenomas: Prospective Diagnosis in AIP Mutation Carriers

PubMed Central

Hernández-Ramírez, Laura C.; Gabrovska, Plamena; Dénes, Judit; Stals, Karen; Trivellin, Giampaolo; Tilley, Daniel; Ferraù, Francesco; Evanson, Jane; Ellard, Sian; Grossman, Ashley B.; Roncaroli, Federico; Gadelha, Mônica R.

2015-01-01

Context: Familial isolated pituitary adenoma (FIPA) due to aryl hydrocarbon receptor interacting protein (AIP) gene mutations is an autosomal dominant disease with incomplete penetrance. Clinical screening of apparently unaffected AIP mutation (AIPmut) carriers could identify previously unrecognized disease. Objective: To determine the AIP mutational status of FIPA and young pituitary adenoma patients, analyzing their clinical characteristics, and to perform clinical screening of apparently unaffected AIPmut carrier family members. Design: This was an observational, longitudinal study conducted over 7 years. Setting: International collaborative study conducted at referral centers for pituitary diseases. Participants: FIPA families (n = 216) and sporadic young-onset (≤30 y) pituitary adenoma patients (n = 404) participated in the study. Interventions: We performed genetic screening of patients for AIPmuts, clinical assessment of their family members, and genetic screening for somatic GNAS1 mutations and the germline FGFR4 p.G388R variant. Main Outcome Measure(s): We assessed clinical disease in mutation carriers, comparison of characteristics of AIPmut positive and negative patients, results of GNAS1, and FGFR4 analysis. Results: Thirty-seven FIPA families and 34 sporadic patients had AIPmuts. Patients with truncating AIPmuts had a younger age at disease onset and diagnosis, compared with patients with nontruncating AIPmuts. Somatic GNAS1 mutations were absent in tumors from AIPmut-positive patients, and the studied FGFR4 variant did not modify the disease behavior or penetrance in AIPmut-positive individuals. A total of 164 AIPmut-positive unaffected family members were identified; pituitary disease was detected in 18 of those who underwent clinical screening. Conclusions: A quarter of the AIPmut carriers screened were diagnosed with pituitary disease, justifying this screening and suggesting a variable clinical course for AIPmut-positive pituitary adenomas. PMID

Reduced BRCA1 transcript levels in freshly isolated blood leukocytes from BRCA1 mutation carriers is mutation specific.

PubMed

Chehade, Rania; Pettapiece-Phillips, Rachael; Salmena, Leonardo; Kotlyar, Max; Jurisica, Igor; Narod, Steven A; Akbari, Mohammad R; Kotsopoulos, Joanne

2016-08-17

BRCA1 mutation carriers face a high lifetime risk of developing both breast and ovarian cancer. Haploinsufficiency is thought to predispose these women to cancer by reducing the pool of available BRCA1 transcript and protein, thereby compromising BRCA1 function. Whether or not cancer-free BRCA1 mutation carriers have lower messenger (m)RNA transcript levels in peripheral blood leukocytes has not been evaluated. The primary aim of this study was to characterize an association between BRCA1 mutation status and BRCA1 mRNA leukocyte expression levels among healthy women with a BRCA1 mutation. RNA was extracted from freshly isolated peripheral blood leukocytes of 58 cancer-free, female participants (22 BRCA1 mutation carriers and 36 non-carriers). The expression levels of 236 cancer-associated genes, including BRCA1, were quantified using the Human Cancer Reference gene panel from the Nanostring Technologies nCounter Analysis System. Multivariate modeling demonstrated that carrying a BRCA1 mutation was the most significant predictor of BRCA1 mRNA levels. BRCA1 mRNA levels were significantly lower in BRCA1 mutation carriers compared to non-carriers (146.7 counts vs. 175.1 counts; P = 0.002). Samples with BRCA1 mutations within exon 11 had lower BRCA1 mRNA levels than samples with mutations within the 5' and 3' regions of the BRCA1 gene (122.1 counts vs. 138.9 and 168.6 counts, respectively; P = 0.003). Unsupervised hierarchical clustering of gene expression profiles from freshly isolated blood leukocytes revealed that BRCA1 mutation carriers cluster more closely with other BRCA1 mutation carriers than with BRCA1 wild-type samples. Moreover, a set of 17 genes (including BRCA1) previously shown to be involved in carcinogenesis, were differentially expressed between BRCA1 mutation carriers and non-carriers. Overall, these findings support the concept of BRCA1 haploinsufficiency wherein a specific mutation results in dosage-dependent alteration of BRCA1 at the

Carriers of filaggrin gene (FLG) mutations avoid professional exposure to irritants in adulthood.

PubMed

Bandier, Josefine; Ross-Hansen, Katrine; Carlsen, Berit C; Menné, Torkil; Linneberg, Allan; Stender, Steen; Szecsi, Pal B; Meldgaard, Michael; Thyssen, Jacob P; Johansen, Jeanne D

2013-12-01

Loss-of-function mutations in the filaggrin gene (FLG) are associated with xerosis, atopic dermatitis, and early onset of hand eczema. Irritant exposure is a risk factor for occupational hand eczema, and FLG mutations increase the risk of occupational irritant contact dermatitis on the hands in hospital cohorts. It is unknown whether FLG mutations affect the level of irritant exposure. To evaluate whether exposure to occupational irritants was dependent on FLG mutations, atopic dermatitis, and age at hand eczema onset. Randomly chosen Danish adults completed a questionnaire on general health and occupational exposures. Genotyping for FLG mutations (R501X, 2282del4, and R2447X) and patch testing were performed. Overall, 38.7% of subjects reported present or previous occupational exposure to irritants. Among individuals who reported hand eczema onset before entering their work life, 50.6% (45/89) of FLG non-mutation carriers became exposed to irritants, as compared with 28.6% (4/14) of heterozygous and 0% (0/6) of homozygous mutation carriers (p = 0.006). Avoidance was conspicuous among mutation carriers reporting childhood hand eczema and atopic dermatitis (odds ratio 0.08, 95% confidence interval 0.01-0.65). Carriers of FLG mutations who have had hand eczema onset in childhood avoid occupational exposure to irritants; the association is most marked with homozygous mutation status combined with atopic dermatitis. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

A rare mutation in AgRP, +79G>A, affects promoter activity.

PubMed

Sözen, M A; de Jonge, L H M; Greenway, F; Ravussin, E; Smith, S R; Argyropoulos, G

2007-06-01

The agouti-related protein is a powerful orexigenic peptide. A rare mutation, +79G>A, was identified in its minimal promoter in two white carriers. Comparison of the 45-year-old male proband, who was also a carrier of the common Ala67Thr polymorphism, with an age- and weight-matching wild-type population showed marginal differences for resting metabolic rate (RMR) and body mass index. The second carrier however was an obese 57-year-old female with reduced RMR. Functional analysis in hypothalamus- and periphery-derived cell lines showed reduced promoter activity for the +79A allele in the adrenocortical cells only, suggesting that it could affect the peripheral expression levels of AgRP. The +79G>A mutation could predispose to body weight gain (as suggested by the phenotype of the second carrier), but it could only affect the proband at an older age as he may be protected by the Ala67Thr polymorphism that is associated with resistance to late-onset fatness.

Breast cancer sensitivity to neoadjuvant therapy in BRCA1 and CHEK2 mutation carriers and non-carriers.

PubMed

Pfeifer, Werner; Sokolenko, Anna P; Potapova, Olga N; Bessonov, Alexandr A; Ivantsov, Alexandr O; Laptiev, Sergey A; Zaitseva, Olga A; Yatsuk, Olga S; Matsko, Dmitry E; Semiglazova, Tatiana Yu; Togo, Alexandr V; Imyanitov, Evgeny N

2014-12-01

Breast carcinomas caused by inheritance of cancer-predisposing germ-line mutations have specific bioclinical features. This study aimed to analyze the efficacy of conventional cytotoxic treatment in BRCA1 and CHEK2 mutation carriers and non-carriers. The study included 415 Russian breast cancer patients aged 50 years or younger, who were subjected to various standard schemes of neoadjuvant therapy. The choice of therapy was done without the knowledge of the mutations status, because DNA testing was performed retrospectively using the archival tissue samples. 19 BRCA1 (4.6%) and 8 CHEK2 (1.9%) heterozygous genotypes were identified. BRCA1 mutation carriers achieved pathological complete response more frequently than non-carriers [6/19 (31.6%) vs. 46/388 (11.9%), p = 0.024]; this effect was limited to women treated by anthracycline-based therapy without taxanes [5/9 (55.6%) vs. 28/247 (11.3%), p = 0.002] and was not observed in any of 7 BRCA1 carriers receiving taxane-containing regimens. CHEK2 heterozygotes did not experience pathological complete response and showed lower frequency of objective clinical responses as compared to mutation non-carriers [4/8 (50%) vs. 333/388 (85.5%), p = 0.020]; the efficacy of neoadjuvant therapy was particularly poor in CHEK2 carriers receiving anthracyclines without taxanes. This study provides evidence for distinct sensitivity of BRCA1 and CHEK2 mutation-driven breast carcinomas to standard chemotherapeutic schemes.

Risks of Lynch Syndrome Cancers for MSH6 Mutation Carriers

PubMed Central

Baglietto, Laura; Dowty, James G.; White, Darren M.; Wagner, Anja; Gomez Garcia, Encarna B.; Vriends, Annette H. J. T.; Cartwright, Nicola R.; Barnetson, Rebecca A.; Farrington, Susan M.; Tenesa, Albert; Hampel, Heather; Buchanan, Daniel; Arnold, Sven; Young, Joanne; Walsh, Michael D.; Jass, Jeremy; Macrae, Finlay; Antill, Yoland; Winship, Ingrid M.; Giles, Graham G.; Goldblatt, Jack; Parry, Susan; Suthers, Graeme; Leggett, Barbara; Butz, Malinda; Aronson, Melyssa; Poynter, Jenny N.; Baron, John A.; Le Marchand, Loic; Haile, Robert; Gallinger, Steve; Hopper, John L.; Potter, John; de la Chapelle, Albert; Vasen, Hans F.; Dunlop, Malcolm G.; Thibodeau, Stephen N.; Jenkins, Mark A.

2010-01-01

Background Germline mutations in MSH6 account for 10%–20% of Lynch syndrome colorectal cancers caused by hereditary DNA mismatch repair gene mutations. Because there have been only a few studies of mutation carriers, their cancer risks are uncertain. Methods We identified 113 families of MSH6 mutation carriers from five countries that we ascertained through family cancer clinics and population-based cancer registries. Mutation status, sex, age, and histories of cancer, polypectomy, and hysterectomy were sought from 3104 of their relatives. Age-specific cumulative risks for carriers and hazard ratios (HRs) for cancer risks of carriers, compared with those of the general population of the same country, were estimated by use of a modified segregation analysis with appropriate conditioning depending on ascertainment. Results For MSH6 mutation carriers, the estimated cumulative risks to ages 70 and 80 years, respectively, were as follows: for colorectal cancer, 22% (95% confidence interval [CI] = 14% to 32%) and 44% (95% CI = 28% to 62%) for men and 10% (95% CI = 5% to 17%) and 20% (95% CI = 11% to 35%) for women; for endometrial cancer, 26% (95% CI = 18% to 36%) and 44% (95% CI = 30% to 58%); and for any cancer associated with Lynch syndrome, 24% (95% CI = 16% to 37%) and 47% (95% CI = 32% to 66%) for men and 40% (95% CI = 32% to 52%) and 65% (95% CI = 53% to 78%) for women. Compared with incidence for the general population, MSH6 mutation carriers had an eightfold increased incidence of colorectal cancer (HR = 7.6, 95% CI = 5.4 to 10.8), which was independent of sex and age. Women who were MSH6 mutation carriers had a 26-fold increased incidence of endometrial cancer (HR = 25.5, 95% CI = 16.8 to 38.7) and a sixfold increased incidence of other cancers associated with Lynch syndrome (HR = 6.0, 95% CI = 3.4 to 10.7). Conclusion We have obtained precise and accurate estimates of both absolute and relative

Dent’s disease: Identification of seven new pathogenic mutations in the CLCN5 gene

PubMed Central

Ramos-Trujillo, Elena; Claverie-Martin, Felix; Garcia-Nieto, Victor; Ariceta, Gema; Vara, Julia; Gonzalez-Acosta, Hilaria; Garcia-Ramirez, Marta; Fons, Jaime; Cordoba-Lanus, Elizabeth; Gonzalez-Paredes, Javier; Valenciano, Blanca; Ramos, Leticia; Muley, Rafael; Caggiani, Marina; Alvarez-Estrada, Pilar; Madrid, Alvaro

2013-01-01

Dent’s disease is an X-linked proximal tubulopathy characterized by low-molecular-weight proteinuria, hypercalciuria, nephrocalcinosis, nephrolithiasis and progressive renal failure. This disorder is frequently caused by mutations in the CLCN5 gene encoding the electrogenic chloride/proton exchanger ClC-5. Occasionally, Dent’s disease has been associated to atypical cases of asymptomatic proteinuria with focal glomerulosclerosis. Twelve unrelated patients with Dent’s disease, including two who presented with asymptomatic proteinuria and developed glomerulosclerosis, were studied. Mutational analysis of the CLCN5 gene was performed by DNA sequencing. We identified thirteen distinct CLCN5 mutations in the twelve patients. Seven of these mutations, p.P416fsX*17, p.[H107P, V108fs*27], p.G466D, p.G65R, p.G462S, p.Y164* and c.723+1G >T, were novel and possibly pathogenic. In one family, the patient’s mother was not a carrier of the respective mutation. Our results increased the spectrum of CLCN5 disease causing defects with seven new pathogenic mutations and established a de novo origin in one of them. Remarkably, three new missense mutations, p.G466D, p.G65R and p.G462S, affect highly conserved glycine residues located in transmembrane α-helix GxxxG packing motifs. The two atypical cases further support that the diagnosis of Dent’s disease should be considered in children with asymptomatic proteinuria and focal glomerulosclerosis and without evidence of primary glomerular disease. PMID:27625851

Disease-Causing Mutations in the G Protein Gαs Subvert the Roles of GDP and GTP.

PubMed

Hu, Qi; Shokat, Kevan M

2018-05-17

The single most frequent cancer-causing mutation across all heterotrimeric G proteins is R201C in Gαs. The current model explaining the gain-of-function activity of the R201 mutations is through the loss of GTPase activity and resulting inability to switch off to the GDP state. Here, we find that the R201C mutation can bypass the need for GTP binding by directly activating GDP-bound Gαs through stabilization of an intramolecular hydrogen bond network. Having found that a gain-of-function mutation can convert GDP into an activator, we postulated that a reciprocal mutation might disrupt the normal role of GTP. Indeed, we found R228C, a loss-of-function mutation in Gαs that causes pseudohypoparathyroidism type 1a (PHP-Ia), compromised the adenylyl cyclase-activating activity of Gαs bound to a non-hydrolyzable GTP analog. These findings show that disease-causing mutations in Gαs can subvert the canonical roles of GDP and GTP, providing new insights into the regulation mechanism of G proteins. Copyright © 2018 Elsevier Inc. All rights reserved.

The novel Tau mutation G335S: clinical, neuropathological and molecular characterization.

PubMed

Spina, Salvatore; Murrell, Jill R; Yoshida, Hirotaka; Ghetti, Bernardino; Bermingham, Niamh; Sweeney, Brian; Dlouhy, Stephen R; Crowther, R Anthony; Goedert, Michel; Keohane, Catherine

2007-04-01

Mutations in Tau cause the inherited neurodegenerative disease, frontotemporal dementia and Parkinsonism linked to chromosome 17 (FTDP-17). Known coding region mutations cluster in the microtubule-binding region, where they alter the ability of tau to promote microtubule assembly. Depending on the tau isoforms, this region consists of three or four imperfect repeats of 31 or 32 amino acids, each of which contains a characteristic and invariant PGGG motif. Here, we report the novel G335S mutation, which changes the PGGG motif of the third tau repeat to PGGS, in an individual who developed social withdrawal, emotional bluntness and stereotypic behavior at age 22, followed by disinhibition, hyperorality and ideomotor apraxia. Abundant tau-positive inclusions were present in neurons and glia in the frontotemporal cortex, hippocampus and brainstem. Sarkosyl-insoluble tau showed paired helical and straight filaments, as well as more irregular rope-like filaments. The pattern of pathological tau bands was like that of Alzheimer disease. Experimentally, the G335S mutation resulted in a greatly reduced ability of tau to promote microtubule assembly, while having no significant effect on heparin-induced assembly of recombinant tau into filaments.

Adiponectin isoform patterns in ethnic-specific ADIPOQ mutation carriers: The IRAS Family Study

PubMed Central

Tabb, Keri L.; Gao, Chuan; Hicks, Pamela J.; Hawkins, Gregory A.; Rotter, Jerome I.; da Chen, Yii-Der I; Guo, Xiuqing; Norris, Jill M.; Lorenzo, Carlos; Freedman, Barry I.; Bowden, Donald W.; Palmer, Nicholette D.

2017-01-01

Objective Adiponectin is found in human serum in three groups of multimers (high, medium, and low molecular weight). Previously, we reported two ethnic-specific variants in ADIPOQ, G45R (Hispanic Americans) and R55C (African Americans). Although carriers of both variants had mean adiponectin levels ≤20% of those of non-carriers, they were not clinically different from non-carriers. To compare carriers of both variants and non-carriers, relative quantification of adiponectin isoforms to total adiponectin was performed on serum samples. Methods The multimeric patterns of serum adiponectin in G45R carriers (n=23), R55C carriers (n=3), and Hispanic and African American non-carriers (n=84 and 44, respectively) from the IRAS Family Study were explored using native western blotting and densitometry. Results Serum samples from carriers showed an absence of the high molecular weight (HMW) isoform and a marked reduction in the medium molecular weight isoform but an approximate two-fold increase in the amount of the low molecular weight isoform (LMW). Thus, individuals making only LMW adiponectin are metabolically normal. Conclusions The results contrast with the proposed biological importance of the HMW multimer. This suggests that the LMW isoform may functionally compensate for some of the loss/reduction of the higher-order multimers in carriers of the G45R and R55C mutations. PMID:28643464

Increased Oxidative Stress Markers in Cerebrospinal Fluid from Healthy Subjects with Parkinson’s Disease-Associated LRRK2 Gene Mutations

PubMed Central

Loeffler, David A.; Klaver, Andrea C.; Coffey, Mary P.; Aasly, Jan O.; LeWitt, Peter A.

2017-01-01

Mutations in the leucine-rich repeat kinase 2 (LRRK2) gene are the most frequent cause of inherited Parkinson’s disease (PD). The most common PD-associated LRRK2 mutation, G2019S, induces increased production of reactive oxygen species in vitro. We therefore hypothesized that individuals with PD-associated LRRK2 mutations might have increased concentrations of oxidative stress markers and/or decreased total antioxidant capacity (TAC) in their cerebrospinal fluid (CSF). We measured two oxidative stress markers, namely 8-hydroxy-2′-deoxyguanosine (8-OHdG) and 8-isoprostane (8-ISO), and TAC in CSF from LRRK2 mutation-bearing PD patients (LRRK2 PD = 19), sporadic PD patients (sPD = 31), and healthy control subjects with or without these mutations (LRRK2 CTL = 30, CTL = 27). 8-OHdG and 8-ISO levels were increased in LRRK2 CTL subjects, while TAC was similar between groups. 8-ISO was negatively correlated, and TAC was positively correlated, with Montreal Cognitive Assessment scores in LRRK2 PD, LRRK2 CTL, and CTL subjects. Correlations in both groups of PD patients between the two oxidative stress markers and Unified Parkinson Disease Rating Scale Total scores were weak, while TAC was negatively correlated with these scores. These findings suggest that oxidative stress may be increased in the CNS in healthy individuals with PD-associated LRRK2 mutations. Further, TAC may decrease in the CNS with the progression of PD, and when cognitive impairment is present regardless of the presence or absence of PD. PMID:28420983

Screening for Pancreatic Adenocarcinoma in BRCA2 Mutation Carriers: Results of a Disease Simulation Model.

PubMed

Pandharipande, Pari V; Jeon, Alvin; Heberle, Curtis R; Dowling, Emily C; Kong, Chung Yin; Chung, Daniel C; Brugge, William R; Hur, Chin

2015-12-01

BRCA2 mutation carriers are at increased risk for multiple cancers including pancreatic adenocarcinoma (PAC). Our goal was to compare the effectiveness of different PAC screening strategies in BRCA2 mutation carriers, from the standpoint of life expectancy. A previously published Markov model of PAC was updated and extended to incorporate key aspects of BRCA2 mutation carrier status, including competing risks of breast- and ovarian-cancer specific mortality. BRCA2 mutation carriers were modeled and analyzed as the primary cohort for the analysis. Additional higher risk BRCA2 cohorts that were stratified according to the number of first-degree relatives (FDRs) with PAC were also analyzed. For each cohort, one-time screening and annual screening were evaluated, with screening starting at age 50 in both strategies. The primary outcome was net gain in life expectancy (LE) compared to no screening. Sensitivity analysis was performed on key model parameters, including surgical mortality and MRI test performance. One-time screening at age 50 resulted in a LE gain of 3.9 days for the primary BRCA2 cohort, and a gain of 5.8 days for those with BRCA2 and one FDR. Annual screening resulted in LE loss of 12.9 days for the primary cohort and 1.3 days for BRCA2 carriers with 1 FDR, but resulted in 20.6 days gained for carriers with 2 FDRs and 260 days gained for those with 3 FDRs. For patients with ≥ 3 FDRs, annual screening starting at an earlier age (i.e. 35-40) was optimal. Among BRCA2 mutation carriers, aggressive screening regimens may be ineffective unless additional indicators of elevated risk (e.g., 2 or more FDRs) are present. More clinical studies are needed to confirm these findings. American Cancer Society - New England Division - Ellison Foundation Research Scholar Grant (RSG-15-129-01-CPHPS).

Is RNASEL:p.Glu265* a modifier of early-onset breast cancer risk for carriers of high-risk mutations?

PubMed

Nguyen-Dumont, Tú; Teo, Zhi L; Hammet, Fleur; Roberge, Alexis; Mahmoodi, Maryam; Tsimiklis, Helen; Park, Daniel J; Pope, Bernard J; Lonie, Andrew; Kapuscinski, Miroslav K; Mahmood, Khalid; Goldgar, David E; Giles, Graham G; Winship, Ingrid; Hopper, John L; Southey, Melissa C

2018-02-08

Breast cancer risk for BRCA1 and BRCA2 pathogenic mutation carriers is modified by risk factors that cluster in families, including genetic modifiers of risk. We considered genetic modifiers of risk for carriers of high-risk mutations in other breast cancer susceptibility genes. In a family known to carry the high-risk mutation PALB2:c.3113G>A (p.Trp1038*), whole-exome sequencing was performed on germline DNA from four affected women, three of whom were mutation carriers. RNASEL:p.Glu265* was identified in one of the PALB2 carriers who had two primary invasive breast cancer diagnoses before 50 years. Gene-panel testing of BRCA1, BRCA2, PALB2 and RNASEL in the Australian Breast Cancer Family Registry identified five carriers of RNASEL:p.Glu265* in 591 early onset breast cancer cases. Three of the five women (60%) carrying RNASEL:p.Glu265* also carried a pathogenic mutation in a breast cancer susceptibility gene compared with 30 carriers of pathogenic mutations in the 586 non-carriers of RNASEL:p.Glu265* (5%) (p < 0.002). Taqman genotyping demonstrated that the allele frequency of RNASEL:p.Glu265* was similar in affected and unaffected Australian women, consistent with other populations. Our study suggests that RNASEL:p.Glu265* may be a genetic modifier of risk for early-onset breast cancer predisposition in carriers of high-risk mutations. Much larger case-case and case-control studies are warranted to test the association observed in this report.

Expression of G(alpha)(s) proteins and TSH receptor signalling in hyperfunctioning thyroid nodules with TSH receptor mutations.

PubMed

Holzapfel, Hans-Peter; Bergner, Beate; Wonerow, Peter; Paschke, Ralf

2002-07-01

Constitutively activating mutations of the thyrotrophin receptor (TSHR) are the main molecular cause of hyperfunctioning thyroid nodules (HTNs). The G protein coupling is an important and critical step in the TSHR signalling which mainly includes G(alpha)(s), G(alpha)(i) and G(alpha)(q)/11 proteins. We investigated the in vitro consequences of overexpressing G(alpha) proteins on signalling of the wild-type (WT) or mutated TSHR. Moreover, we investigated whether changes in G(alpha) protein expression are pathophysiologically relevant in HTNs or cold thyroid nodules (CTNs). Wild-type TSH receptor and mutated TSH receptors were coexpressed with G(alpha)(s), G(alpha)(i) or G(alpha)(q)/11, and cAMP and inositol phosphate (IP) production was measured after stimulation with TSH. The expression of G(alpha)(s), G(alpha)(i) and G(alpha)(q)/11 proteins was examined by Western blotting in 28 HTNs and 14 CTNs. Coexpression of G(alpha)(s) with the WT TSH receptor in COS 7 cells significantly increased the basal and TSH-stimulated cAMP accumulation while coexpression of the G(alpha)(q) or G(alpha)11 protein significantly increased the production of cAMP and inositol triphosphate (IP(3)). The coexpression of the TSH receptor mutants (I486F, DEL613-621), known to couple constitutively to G(alpha)(s) and G(alpha)(q) with G(alpha)(s) and G(alpha)(q)/11, significantly increased the basal and stimulated cAMP and IP(3) accumulation. Coexpression of the TSH receptor mutant V556F with G(alpha)(s) only increased the basal and stimulated cAMP production while its coexpression with G(alpha)(q)/11 increased the basal and stimulated IP(3) signalling. The expression of G(alpha)(s) protein subunits determined by Western blotting was significantly decreased in 14 HTNs with a constitutively activating TSH receptor mutation in comparison with the corresponding surrounding tissue, while in 14 HTNs without TSH receptor or G(alpha)(s) protein mutation and in 14 CTNs the expression of G(alpha)(s

Breast cancer risk is similar for CHEK2 founder and non-founder mutation carriers.

PubMed

Leedom, Tracey P; LaDuca, Holly; McFarland, Rachel; Li, Shuwei; Dolinsky, Jill S; Chao, Elizabeth C

2016-09-01

CHEK2 mutations are associated with increased cancer risks, including breast; however, published risk estimates are limited to those conferred by CHEK2 founder mutations, presenting uncertainty in risk assessment for carriers of other CHEK2 mutations. This study aimed to assess phenotypes and molecular characteristics of CHEK2 mutation carriers (CHEK2 + s) from a multi-gene panel testing (MGPT) cohort, focusing on comparing phenotypes of founder and non-founder CHEK2 + s. Clinical histories and molecular results were reviewed from 45,879 patients who underwent MGPT including CHEK2 at a commercial laboratory. Of individuals tested, 2.4% (n = 1085) were CHEK2 + s. Sixteen individuals harbored biallelic CHEK2 mutations, bringing the total number of CHEK2 mutations detected in this cohort to 1101. Personal/family cancer histories were compared between founder (n = 576; included c.1100delC, p.S428F, c.444 + 1G > A, and EX8_9del) and non-founder (n = 259) CHEK2 + s using Fisher's exact test and multivariate logistic regression analysis. Individuals carrying the p.I157T moderate risk founder mutation (n = 231), additional mutations in non-CHEK2 genes (n = 83), or biallelic mutations (n = 16) were excluded from phenotype analysis, as were cases with no clinical information provided. No significant phenotypic differences were observed between founder and non-founder CHEK2 + s. These data suggest that cancer risks reported for founder mutations may be generalizable to all CHEK2 + s, particularly for breast cancer. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

MutYH mutation carriers have increased breast cancer risk.

PubMed

Rennert, Gad; Lejbkowicz, Flavio; Cohen, Ilana; Pinchev, Mila; Rennert, Hedy S; Barnett-Griness, Ofra

2012-04-15

Variants of the mutY homolog gene MutYH, a DNA repair gene, are associated with increased risk of colorectal cancer; however, it remains unclear whether these variants also are associated with the risk of other cancers. The authors studied the risk of breast cancer associated with MutYH variants in a unique ethnic group of Sephardi Jews in Israel with a high prevalence of MutYH mutations. The study participants were 930 Sephardi Jewish women of North African origin who were recruited into the population-based case-control Breast Cancer in Northern Israel Study (BCINIS) either as breast cancer cases or as healthy controls. All participants contributed a blood sample and completed an interview. Two MutYH variants, a glycine-to-aspartic acid substitution at codon 396 (G396D) and a tyrosine-to-cysteine substitution at codon 179 (Y179C), were studied. In the Sephardi Jews, among the healthy controls, 20 women (3.7%) were homozygote or heterozygote carriers of the G396D variant, and 4 women (0.7%) were heterozygote carriers of the Y179C variant. Breast cancer cases had a 6.7% prevalence of G396D, yielding a significantly elevated risk estimate for breast cancer (odds ratio, 1.86; 95% confidence interval, 1.02-3.39; P = .039). The tumors detected in carriers with MutYH variants were similar in characteristics to those without MutYH variants, as was the age at diagnosis. Carriers of variants in MutYH, although not very common, may have an increased risk of breast cancer in Jews of North African origin. Identification of such carriers and special surveillance protocols may be warranted. Copyright © 2011 American Cancer Society.

Rare mutations in RINT1 predispose carriers to breast and Lynch Syndrome-spectrum cancers

PubMed Central

Park, Daniel J.; Tao, Kayoko; Le Calvez-Kelm, Florence; Nguyen-Dumont, Tu; Robinot, Nivonirina; Hammet, Fleur; Odefrey, Fabrice; Tsimiklis, Helen; Teo, Zhi L.; Thingholm, Louise B.; Young, Erin L.; Voegele, Catherine; Lonie, Andrew; Pope, Bernard J.; Roane, Terrell C.; Bell, Russell; Hu, Hao; Shankaracharya; Huff, Chad D.; Ellis, Jonathan; Li, Jun; Makunin, Igor V.; John, Esther M.; Andrulis, Irene L.; Terry, Mary B.; Daly, Mary; Buys, Saundra S.; Snyder, Carrie; Lynch, Henry T.; Devilee, Peter; Giles, Graham G.; Hopper, John L.; Feng, Bing J.; Lesueur, Fabienne; Tavtigian, Sean V.; Southey, Melissa C.; Goldgar, David E.

2014-01-01

Approximately half of the familial aggregation of breast cancer remains unexplained. A multiple-case breast cancer family exome sequencing study identified three likely pathogenic mutations in RINT1 (NM_021930.4) not present in public sequencing databases: RINT1 c.343C>T (p.Q115X), c.1132_1134del (p.M378del) and c.1207G>T (p.D403Y). Based on this finding, a population-based case-control mutation-screening study was conducted and identified 29 carriers of rare (MAF < 0.5%), likely pathogenic variants: 23 in 1,313 early-onset breast cancer cases and 6 in 1,123 frequency-matched controls (OR=3.24, 95%CI 1.29-8.17; p=0.013). RINT1 mutation screening of probands from 798 multiple-case breast cancer families identified 4additional carriers of rare genetic variants. Analysis of the incidence of first primary cancers in families of women in RINT1-mutation carrying families estimated that carriers were at increased risks of Lynch syndrome-spectrum cancers (SIR 3.35, 95% CI 1.7-6.0; P=0.005), particularly for relatives diagnosed with cancer under age 60 years (SIR 10.9, 95%CI 4.7-21; P=0.0003). PMID:25050558

Survival in Norwegian BRCA1 mutation carriers with breast cancer.

PubMed

Hagen, Anne Irene; Tretli, Steinar; Maehle, Lovise; Apold, Jaran; Vedå, Nina; Møller, Pål

2009-04-14

Several studies of survival in women with BRCA1 mutations have shown either reduced survival or no difference compared to controls. Programmes for early detection and treatment of inherited breast cancer, have failed to demonstrate a significant improvement in survival in BRCA1 mutation carriers.One hundred and sixty-seven women with disease-associated germline BRCA1 mutations and breast cancer from 1980 to 2001 were identified. Tumour characteristics, treatment given and survival were recorded. A control group comprising three hundred and four women matched for age, time of diagnosis and stage were used to compare survival.BRCA1 mutation carriers were found to have a poorer prognosis, which could be explained by neither the mode of surgical treatment nor the use of adjuvant chemotherapy. BRCA1 mutation carriers with node negative breast cancer had worse overall survival than controls.Our findings confirm the serious prognosis of BRCA1-associated breast cancer even when diagnosed at an early stage, and that type of treatment does not influence prognosis.

Survival in Norwegian BRCA1 mutation carriers with breast cancer

PubMed Central

Hagen, Anne Irene; Tretli, Steinar; Mæhle, Lovise; Apold, Jaran; Vedå, Nina; Møller, Pål

2009-01-01

Several studies of survival in women with BRCA1 mutations have shown either reduced survival or no difference compared to controls. Programmes for early detection and treatment of inherited breast cancer, have failed to demonstrate a significant improvement in survival in BRCA1 mutation carriers. One hundred and sixty-seven women with disease-associated germline BRCA1 mutations and breast cancer from 1980 to 2001 were identified. Tumour characteristics, treatment given and survival were recorded. A control group comprising three hundred and four women matched for age, time of diagnosis and stage were used to compare survival. BRCA1 mutation carriers were found to have a poorer prognosis, which could be explained by neither the mode of surgical treatment nor the use of adjuvant chemotherapy. BRCA1 mutation carriers with node negative breast cancer had worse overall survival than controls. Our findings confirm the serious prognosis of BRCA1-associated breast cancer even when diagnosed at an early stage, and that type of treatment does not influence prognosis. PMID:19366445

Rapid detection of common Chinese glucose-6-phosphate dehydrogenase (G6PD) mutations by denaturing gradient gel electrophoresis (DGGE).

PubMed

Lam, V M; Huang, W; Lam, S T; Yeung, C Y; Johnson, P H

1996-03-01

We describe here the use of denaturing gradient gel electrophoresis (DGGE) to detect the most common Chinese glucose-6-phosphate dehydrogenase (G6PD) variants, which are the single point mutations: G-->T at nt 1376, G-->A at 1388 both in exon 12 and A-->G at nt 95 in exon 02. In each case, the mutant allele resolves well from the normal allele(s). The distinct heteroduplex bands are characteristic of a particular genotype suggesting that this feature is very useful for identifying all heterozygous carriers for this and other X-linked diseases. When the analysis is extended to other exons, DGGE scans the gene and coupled with direct sequencing, it leads to the identification of new G6PD variation(s). With this approach, we identified a mutation in exon 9 which had not been reported in Hong Kong. Since DGGE can rapidly screen many unknown samples in one gel, this approach could be used to diagnose these G6PD mutations and to identify the at-risk for counselling.

Furosemide loading test in a case of homozygous solute carrier family 12, member 1 (SLC12A1) mutation (g.62382825G>A, p.Pro372Leu) in Japanese Black cattle.

PubMed

Hasegawa, Kiyotoshi; Sasaki, Shinji; Sakamoto, Yoichi; Takano, Akifumi; Takayama, Megumi; Higashi, Tomoko; Sugimoto, Yoshikazu; Yasuda, Yasuaki

2017-10-01

Hydrallantois is the excessive accumulation of fluid in the allantoic cavity in a pregnant animal and is associated with fetal death. We recently identified a recessive missense mutation in the solute carrier family 12, member 1 (SLC12A1) gene (g.62382825G>A, p.Pro372Leu) that is associated with hydrallantois in Japanese Black cattle. Unexpectedly, we found a case of the homozygous risk-allele for SLC12A1 in a calf, using a PCR-based direct DNA sequencing test. The homozygote was outwardly healthy up to 3 months of age and the mother did not exhibit any clinical symptoms of hydrallantois. In order to validate these observations, we performed confirmation tests for the genotype and a diuretic loading test using furosemide, which inhibits the transporter activity of the SLC12A1 protein. The results showed that the calf was really homozygous for the risk-allele. In the homozygous calf, administration of furosemide did not alter urinary Na + or Cl - levels, in contrast to the heterozygote and wild-type calves in which these were significantly increased. These results demonstrate that the SLC12A1 (g.62382825G>A, p.Pro372Leu) is a hypomorphic or loss-of-function mutation and the hydrallantois with this mutation shows incomplete penetrance in Japanese Black cattle. © 2017 Japanese Society of Animal Science.

T1 Measurements Identify Extracellular Volume Expansion in Hypertrophic Cardiomyopathy Sarcomere Mutation Carriers With and Without Left Ventricular Hypertrophy

PubMed Central

Ho, Carolyn Y.; Abbasi, Siddique A.; Neilan, Tomas G.; Shah, Ravi V.; Chen, Yucheng; Heydari, Bobak; Cirino, Allison L.; Lakdawala, Neal K.; Orav, E. John; González, Arantxa; López, Begoña; Díez, Javier; Jerosch-Herold, Michael; Kwong, Raymond Y.

2013-01-01

Background Myocardial fibrosis is a hallmark of hypertrophic cardiomyopathy (HCM) and a potential substrate for arrhythmias and heart failure. Sarcomere mutations appear to induce profibrotic changes before left ventricular hypertrophy (LVH) develops. To further evaluate these processes, we used cardiac magnetic resonance (CMR) with T1 measurements on a genotyped HCM population to quantify myocardial extracellular volume (ECV). Methods and Results Sarcomere mutation carriers with LVH (G+/LVH+, n = 37) and without LVH (G+/LVH−, n = 29); HCM patients without mutations (sarcomere-negative HCM, n = 11); and healthy controls (n = 11) underwent contrast CMR, measuring T1 times pre- and post-gadolinium infusion. Concurrent echocardiography and serum biomarkers of collagen synthesis, hemodynamic stress, and myocardial injury were also available in a subset. Compared to controls, ECV was increased in patients with overt HCM, as well as G+/LVH− mutation carriers (ECV= 0.36±0.01, 0.33±0.01, 0.27±0.01 in G+/LVH+, G+/LVH−, controls, respectively, P≤0.001 for all comparisons). ECV correlated with NT-proBNP levels (r = 0.58, P<0.001) and global E’ velocity (r = −0.48, P<0.001). Late gadolinium enhancement (LGE) was present in >60% of overt HCM patients but absent from G+/LVH− subjects. Both ECV and LGE were more extensive in sarcomeric HCM than sarcomere-negative HCM. Conclusions Myocardial ECV is increased in HCM sarcomere mutation carriers even in the absence of LVH. These data provide additional support that fibrotic remodeling is triggered early in disease pathogenesis. Quantifying ECV may help characterize the development myocardial fibrosis in HCM and ultimately assist in developing novel disease-modifying therapy, targeting interstitial fibrosis. PMID:23549607

The ABCA4 2588G>C Stargardt mutation: single origin and increasing frequency from South-West to North-East Europe.

PubMed

Maugeri, Alessandra; Flothmann, Kris; Hemmrich, Nadine; Ingvast, Sofie; Jorge, Paula; Paloma, Eva; Patel, Reshma; Rozet, Jean-Michel; Tammur, Jaana; Testa, Francesco; Balcells, Susana; Bird, Alan C; Brunner, Han G; Hoyng, Carel B; Metspalu, Andres; Simonelli, Francesca; Allikmets, Rando; Bhattacharya, Shomi S; D'Urso, Michele; Gonzàlez-Duarte, Roser; Kaplan, Josseline; te Meerman, Gerard J; Santos, Rosário; Schwartz, Marianne; Van Camp, Guy; Wadelius, Claes; Weber, Bernhard H F; Cremers, Frans P M

2002-03-01

Inherited retinal dystrophies represent the most important cause of vision impairment in adolescence, affecting approximately 1 out of 3000 individuals. Mutations of the photoreceptor-specific gene ABCA4 (ABCR) are a common cause of retinal dystrophy. A number of mutations have been repeatedly reported for this gene, notably the 2588G>C mutation which is frequent in both patients and controls. Here we ascertained the frequency of the 2588G>C mutation in a total of 2343 unrelated random control individuals from 11 European countries and 241 control individuals from the US, as well as in 614 patients with STGD both from Europe and the US. We found an overall carrier frequency of 1 out of 54 in Europe, compared with 1 out of 121 in the US, confirming that the 2588G>C ABCA4 mutation is one of the most frequent autosomal recessive mutations in the European population. Carrier frequencies show an increasing gradient in Europe from South-West to North-East. The lowest carrier frequency, 0 out of 199 (0%), was found in Portugal; the highest, 11 out of 197 (5.5%), was found in Sweden. Haplotype analysis in 16 families segregating the 2588G>C mutation showed four intragenic polymorphisms invariably present in all 16 disease chromosomes and sharing of the same allele for several markers flanking the ABCA4 locus in most of the disease chromosomes. These results indicate a single origin of the 2588G>C mutation which, to our best estimate, occurred between 2400 and 3000 years ago.

7 CFR 201.9 - Kind.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 7 Agriculture 3 2012-01-01 2012-01-01 false Kind. 201.9 Section 201.9 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) FEDERAL SEED ACT FEDERAL SEED ACT REGULATIONS Labeling Agricultural Seeds § 201.9 Kind. The...

7 CFR 201.9 - Kind.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 7 Agriculture 3 2011-01-01 2011-01-01 false Kind. 201.9 Section 201.9 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) FEDERAL SEED ACT FEDERAL SEED ACT REGULATIONS Labeling Agricultural Seeds § 201.9 Kind. The...

7 CFR 201.9 - Kind.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 7 Agriculture 3 2014-01-01 2014-01-01 false Kind. 201.9 Section 201.9 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) FEDERAL SEED ACT FEDERAL SEED ACT REGULATIONS Labeling Agricultural Seeds § 201.9 Kind. The...

7 CFR 201.9 - Kind.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 7 Agriculture 3 2010-01-01 2010-01-01 false Kind. 201.9 Section 201.9 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) FEDERAL SEED ACT FEDERAL SEED ACT REGULATIONS Labeling Agricultural Seeds § 201.9 Kind. The...

7 CFR 201.9 - Kind.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 7 Agriculture 3 2013-01-01 2013-01-01 false Kind. 201.9 Section 201.9 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) FEDERAL SEED ACT FEDERAL SEED ACT REGULATIONS Labeling Agricultural Seeds § 201.9 Kind. The...

The Alzheimer’s Prevention Initiative composite cognitive test score: Sample size estimates for the evaluation of preclinical Alzheimer’s disease treatments in presenilin 1 E280A mutation carriers

PubMed Central

Ayutyanont, Napatkamon; Langbaum, Jessica B.; Hendrix, Suzanne B.; Chen, Kewei; Fleisher, Adam S.; Friesenhahn, Michel; Ward, Michael; Aguirre, Camilo; Acosta-Baena, Natalia; Madrigal, Lucìa; Muñoz, Claudia; Tirado, Victoria; Moreno, Sonia; Tariot, Pierre N.; Lopera, Francisco; Reiman, Eric M.

2014-01-01

Objective There is a need to identify a cognitive composite that is sensitive to tracking preclinical AD decline to be used as a primary endpoint in treatment trials. Method We capitalized on longitudinal data, collected from 1995 to 2010, from cognitively unimpaired presenilin 1 (PSEN1) E280A mutation carriers from the world’s largest known early-onset autosomal dominant AD (ADAD) kindred to identify a composite cognitive test with the greatest statistical power to track preclinical AD decline and estimate the number of carriers age 30 and older needed to detect a treatment effect in the Alzheimer’s Prevention Initiative’s (API) preclinical AD treatment trial. The mean-to-standard-deviation ratios (MSDRs) of change over time were calculated in a search for the optimal combination of one to seven cognitive tests/sub-tests drawn from the neuropsychological test battery in cognitively unimpaired mutation carriers during a two and five year follow-up period, using data from non-carriers during the same time period to correct for aging and practice effects. Combinations that performed well were then evaluated for robustness across follow-up years, occurrence of selected items within top performing combinations and representation of relevant cognitive domains. Results This optimal test combination included CERAD Word List Recall, CERAD Boston Naming Test (high frequency items), MMSE Orientation to Time, CERAD Constructional Praxis and Ravens Progressive Matrices (Set A) with an MSDR of 1.62. This composite is more sensitive than using either the CERAD Word List Recall (MSDR=0.38) or the entire CERAD-Col battery (MSDR=0.76). A sample size of 75 cognitively normal PSEN1-E280A mutation carriers age 30 and older per treatment arm allows for a detectable treatment effect of 29% in a 60-month trial (80% power, p=0.05). Conclusions We have identified a composite cognitive test score representing multiple cognitive domains that has improved power compared to the most

Alcohol Consumption and the Risk of Colorectal Cancer for Mismatch Repair Gene Mutation Carriers.

PubMed

Dashti, S Ghazaleh; Buchanan, Daniel D; Jayasekara, Harindra; Ait Ouakrim, Driss; Clendenning, Mark; Rosty, Christophe; Winship, Ingrid M; Macrae, Finlay A; Giles, Graham G; Parry, Susan; Casey, Graham; Haile, Robert W; Gallinger, Steven; Le Marchand, Loïc; Thibodeau, Stephen N; Lindor, Noralane M; Newcomb, Polly A; Potter, John D; Baron, John A; Hopper, John L; Jenkins, Mark A; Win, Aung Ko

2017-03-01

Background: People with germline mutation in one of the DNA mismatch repair (MMR) genes have increased colorectal cancer risk. For these high-risk people, study findings of the relationship between alcohol consumption and colorectal cancer risk have been inconclusive. Methods: 1,925 MMR gene mutations carriers recruited into the Colon Cancer Family Registry who had completed a questionnaire on lifestyle factors were included. Weighted Cox proportional hazard regression models were used to estimate hazard ratios (HR) and 95% confidence intervals (CI) for the association between alcohol consumption and colorectal cancer. Results: Colorectal cancer was diagnosed in 769 carriers (40%) at a mean (SD) age of 42.6 (10.3) years. Compared with abstention, ethanol consumption from any alcoholic beverage up to 14 g/day and >28 g/day was associated with increased colorectal cancer risk (HR, 1.50; 95% CI, 1.09-2.07 and 1.69; 95% CI, 1.07-2.65, respectively; P trend = 0.05), and colon cancer risk (HR, 1.78; 95% CI, 1.27-2.49 and 1.94; 95% CI, 1.19-3.18, respectively; P trend = 0.02). However, there was no clear evidence for an association with rectal cancer risk. Also, there was no evidence for associations between consumption of individual alcoholic beverage types (beer, wine, spirits) and colorectal, colon, or rectal cancer risk. Conclusions: Our data suggest that alcohol consumption, particularly more than 28 g/day of ethanol (∼2 standard drinks of alcohol in the United States), is associated with increased colorectal cancer risk for MMR gene mutation carriers. Impact: Although these data suggested that alcohol consumption in MMR carriers was associated with increased colorectal cancer risk, there was no evidence of a dose-response, and not all types of alcohol consumption were associated with increased risk. Cancer Epidemiol Biomarkers Prev; 26(3); 366-75. ©2016 AACR . ©2016 American Association for Cancer Research.

The risk for developing cancer in Israeli ATM, BLM, and FANCC heterozygous mutation carriers.

PubMed

Laitman, Yael; Boker-Keinan, Lital; Berkenstadt, Michal; Liphsitz, Irena; Weissglas-Volkov, Daphna; Ries-Levavi, Liat; Sarouk, Ifat; Pras, Elon; Friedman, Eitan

2016-03-01

Cancer risks in heterozygous mutation carriers of the ATM, BLM, and FANCC genes are controversial. To shed light on this issue, cancer rates were evaluated by cross referencing asymptomatic Israeli heterozygous mutation carriers in the ATM, BLM, and FANCC genes with cancer diagnoses registered at the Israeli National Cancer Registry (INCR). Comparison of observed to expected Standardized Incidence Rates (SIR) was performed. Overall, 474 individuals participated in the study: 378 females; 25 Arab and 31 Jewish ATM carriers, 152 BLM carriers, and 170 FANCC carriers (all Ashkenazim). Age range at genotyping was 19-53 years (mean + SD 30.6 + 5 years). In addition, 96 males were included; 5, 34, and 57 ATM, BLM, and FANCC mutation carriers, respectively. Over 5-16 years from genotyping (4721 person/years), 15 new cancers were diagnosed in mutation carriers: 5 breast, 4 cervical, 3 melanomas, and one each bone sarcoma, pancreatic, and colorectal cancer. No single cancer diagnosis was more prevalent then expected in all groups combined or per gene analyzed. Specifically breast cancer SIR was 0.02-0.77. We conclude that Israeli ATM, BLM, and FANCC heterozygous mutation carriers are not at an increased risk for developing cancer. Copyright © 2015 Elsevier Inc. All rights reserved.

Risk of uterine cancer for BRCA1 and BRCA2 mutation carriers.

PubMed

Lee, Y C; Milne, R L; Lheureux, S; Friedlander, M; McLachlan, S A; Martin, K L; Bernardini, M Q; Smith, C; Picken, S; Nesci, S; Hopper, J L; Phillips, K A

2017-10-01

Whether BRCA1 and BRCA2 mutation carriers have a clinically relevant elevated risk of uterine cancer has implications for risk-reducing surgery. This multicentre, prospective cohort study assessed uterine cancer risk for mutation carriers compared with the general population. Eligible mutation carriers were enrolled in the Kathleen Cuningham Foundation Consortium for Research into Familial Breast Cancer (kConFab) cohort study, had a uterus present and no history of uterine cancer at cohort entry. Epidemiological, lifestyle and clinical data were collected at cohort entry and updated three-yearly. Cancer events were verified using pathology reports. Follow-up was censored at death or last contact. Relative risk of uterine cancer was estimated using the standardised incidence ratio (SIR), with the expected number of cases determined using population-based data for Australia. Of 1,111 mutation carriers in kConFab, 283 were excluded due to prior hysterectomy (N = 278), prior uterine cancer (N = 2) or being non-residents (N = 3). After a median follow-up of 9.0 years, five incident uterine cancers were reported in the 828 eligible women (419 had prior breast cancer and 160 had prior tamoxifen use), compared to 2.04 expected (SIR = 2.45; 95% confidence interval [CI]: 0.80-5.72; P = 0.11). In 438 BRCA1 mutation carriers and 390 BRCA2 mutation carriers, three and two incident cases of uterine cancer were reported, respectively, compared to 1.04 expected (SIR = 2.87; 95% CI: 0.59-8.43; P = 0.18) and 0.99 expected (SIR = 2.01; 95% CI: 0.24-7.30; P = 0.52), respectively. All cases were endometrioid subtype, International Federation of Gynaecology and Obstetrics stage I-II disease. No serous uterine cancers were reported. Our findings are consistent with those from most other reports and do not support routine risk-reducing hysterectomy for BRCA1 and BRCA2 mutation carriers. Copyright © 2017 Elsevier Ltd. All rights reserved.

Survival analysis of cancer risk reduction strategies for BRCA1/2 mutation carriers.

PubMed

Kurian, Allison W; Sigal, Bronislava M; Plevritis, Sylvia K

2010-01-10

Women with BRCA1/2 mutations inherit high risks of breast and ovarian cancer; options to reduce cancer mortality include prophylactic surgery or breast screening, but their efficacy has never been empirically compared. We used decision analysis to simulate risk-reducing strategies in BRCA1/2 mutation carriers and to compare resulting survival probability and causes of death. We developed a Monte Carlo model of breast screening with annual mammography plus magnetic resonance imaging (MRI) from ages 25 to 69 years, prophylactic mastectomy (PM) at various ages, and/or prophylactic oophorectomy (PO) at ages 40 or 50 years in 25-year-old BRCA1/2 mutation carriers. With no intervention, survival probability by age 70 is 53% for BRCA1 and 71% for BRCA2 mutation carriers. The most effective single intervention for BRCA1 mutation carriers is PO at age 40, yielding a 15% absolute survival gain; for BRCA2 mutation carriers, the most effective single intervention is PM, yielding a 7% survival gain if performed at age 40 years. The combination of PM and PO at age 40 improves survival more than any single intervention, yielding 24% survival gain for BRCA1 and 11% for BRCA2 mutation carriers. PM at age 25 instead of age 40 offers minimal incremental benefit (1% to 2%); substituting screening for PM yields a similarly minimal decrement in survival (2% to 3%). Although PM at age 25 plus PO at age 40 years maximizes survival probability, substituting mammography plus MRI screening for PM seems to offer comparable survival. These results may guide women with BRCA1/2 mutations in their choices between prophylactic surgery and breast screening.

TMEM106B gene polymorphism is associated with age at onset in granulin mutation carriers and plasma granulin protein levels

PubMed Central

Cruchaga, Carlos; Graff, Caroline; Chiang, Huei-Hsin; Wang, Jun; Hinrichs, Anthony L.; Spiegel, Noah; Bertelsen, Sarah; Mayo, Kevin; Norton, Joanne B.; Morris, John C.; Goate, Alison

2011-01-01

Objective A recent genome-wide association study for frontotemporal lobar degeneration with TAR DNA-binding protein inclusions (FTLD-TDP), identified rs1990622 (TMEM106B) as a risk factor for FTLD-TDP. In this study we tested whether rs1990622 is associated with age at onset (AAO) in granulin (GRN) mutation carriers and with plasma GRN levels in mutation carriers and healthy elderly individuals. Design Rs1990622 was genotyped in GRN mutation carriers and tested for association with AAO using the Kaplan-Meier and a Cox proportional hazards model. Subjects We analyzed 50 affected and unaffected GRN mutation carriers from four previously reported FTLD-TDP families (HDDD1, FD1, HDDD2 and the Karolinska family). GRN plasma levels were also measured in 73 healthy, elderly individuals. Results The risk allele of rs1990622 is associated with a mean decrease of the age at onset of thirteen years (p=9.9×10−7), with lower plasma granulin levels in both healthy older adults (p = 4×10−4) and GRN mutation carriers (p=0.0027). Analysis of the HAPMAP database identified a non-synonymous single nucleotide polymorphism, rs3173615 (T185S) in perfect linkage disequilibrium with rs1990622. Conclusions The association of rs1990622 with AAO explains, in part, the wide range in the age at onset of disease among GRN mutation carriers. We hypothesize that rs1990622 or another variant in linkage disequilibrium could act in a manner similar to APOE in Alzheimer’s disease, increasing risk for disease in the general population and modifying AAO in mutation carriers. Our results also suggest that genetic variation in TMEM106B may influence risk for FTLD-TDP by modulating secreted levels of GRN. PMID:21220649

Corin mutations K317E and S472G from preeclamptic patients alter zymogen activation and cell surface targeting. [Corrected].

PubMed

Dong, Ningzheng; Zhou, Tiantian; Zhang, Yue; Liu, Meng; Li, Hui; Huang, Xiaoyi; Liu, Zhenzhen; Wu, Yi; Fukuda, Koichi; Qin, Jun; Wu, Qingyu

2014-06-20

Corin is a membrane-bound serine protease that acts as the atrial natriuretic peptide (ANP) convertase in the heart. Recent studies show that corin also activates ANP in the pregnant uterus to promote spiral artery remodeling and prevent pregnancy-induced hypertension. Two CORIN gene mutations, K317E and S472G, were identified in preeclamptic patients and shown to have reduced activity in vitro. In this study, we carried out molecular modeling and biochemical experiments to understand how these mutations impair corin function. By molecular modeling, the mutation K317E was predicted to alter corin LDL receptor-2 module conformation. Western blot analysis of K317E mutant in HEK293 cells showed that the mutation did not block corin expression on the cell surface but inhibited corin zymogen activation. In contrast, the mutation S472G was predicted to abolish a β-sheet critical for corin frizzled-2 module structure. In Western blot analysis and flow cytometry, S472G mutant was not detected on the cell surface in transfected HEK293 cells. By immunostaining, the S472G mutant was found in the ER, indicating that the mutation S472G disrupted the β-sheet, causing corin misfolding and ER retention. Thus, these results show that mutations in the CORIN gene may impair corin function by entirely different mechanisms. Together, our data provide important insights into the molecular basis underlying corin mutations that may contribute to preeclampsia in patients. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Variation in mutation spectrum partly explains regional differences in the breast cancer risk of female BRCA mutation carriers in the Netherlands.

PubMed

Vos, Janet R; Teixeira, Natalia; van der Kolk, Dorina M; Mourits, Marian J E; Rookus, Matti A; van Leeuwen, Flora E; Collée, Margriet; van Asperen, Christi J; Mensenkamp, Arjen R; Ausems, Margreet G E M; van Os, Theo A M; Meijers-Heijboer, Hanne E J; Gómez-Garcia, Encarna B; Vasen, Hans F; Brohet, Richard M; van der Hout, Annemarie H; Jansen, Liesbeth; Oosterwijk, Jan C; de Bock, Geertruida H

2014-11-01

We aimed to quantify previously observed relatively high cancer risks in BRCA2 mutation carriers (BRCA2 carriers) older than 60 in the Northern Netherlands, and to analyze whether these could be explained by mutation spectrum or population background risk. This consecutive cohort study included all known pathogenic BRCA1/2 carriers in the Northern Netherlands (N = 1,050). Carrier and general reference populations were: BRCA1/2 carriers in the rest of the Netherlands (N = 2,013) and the general population in both regions. Regional differences were assessed with HRs and ORs. HRs were adjusted for birth year and mutation spectrum. All BRCA1 carriers and BRCA2 carriers younger than 60 had a significantly lower breast cancer risk in the Northern Netherlands; HRs were 0.66 and 0.64, respectively. Above age 60, the breast cancer risk in BRCA2 carriers in the Northern Netherlands was higher than in the rest of the Netherlands [HR, 3.99; 95% confidence interval (CI), 1.11-14.35]. Adjustment for mutational spectrum changed the HRs for BRCA1, BRCA2 <60, and BRCA2 ≥60 years by -3%, +32%, and +11% to 0.75, 0.50, and 2.61, respectively. There was no difference in background breast cancer incidence between the two regions (OR, 1.03; 95% CI, 0.97-1.09). Differences in mutation spectrum only partly explain the regional differences in breast cancer risk in BRCA2 carriers, and for an even smaller part in BRCA1 carriers. The increased risk in BRCA2 carriers older than 60 may warrant extension of intensive breast screening beyond age 60. ©2014 American Association for Cancer Research.

E-cadherin germline mutation carriers: clinical management and genetic implications.

PubMed

Corso, Giovanni; Figueiredo, Joana; Biffi, Roberto; Trentin, Chiara; Bonanni, Bernardo; Feroce, Irene; Serrano, Davide; Cassano, Enrico; Annibale, Bruno; Melo, Soraia; Seruca, Raquel; De Lorenzi, Francesca; Ferrara, Francesco; Piagnerelli, Riccardo; Roviello, Franco; Galimberti, Viviana

2014-12-01

Hereditary diffuse gastric cancer is an autosomic dominant syndrome associated with E-cadherin protein (CDH1) gene germline mutations. Clinical criteria for genetic screening were revised in 2010 by the International Gastric Cancer Linkage Consortium at the Cambridge meeting. About 40 % of families fulfilling clinical criteria for this inherited disease present deleterious CDH1 germline mutations. Lobular breast cancer is a neoplastic condition associated with hereditary diffuse gastric cancer syndrome. E-cadherin constitutional mutations have been described in both settings, in gastric and breast cancers. The management of CDH1 asymptomatic mutation carriers requires a multidisciplinary approach; the only life-saving procedure is the prophylactic total gastrectomy after thorough genetic counselling. Several prophylactic gastrectomies have been performed to date; conversely, no prophylactic mastectomies have been described in CDH1 mutant carriers. However, the recent discovery of novel germline alterations in pedigree clustering only for lobular breast cancer opens up a new debate in the management of these individuals. In this critical review, we describe the clinical management of CDH1 germline mutant carriers providing specific recommendations for genetic counselling, clinical criteria, surveillance and/ or prophylactic surgery.

Mitochondrial mutation m.1555A>G as a risk factor for failed newborn hearing screening in a large cohort of preterm infants.

PubMed

Göpel, Wolfgang; Berkowski, Sandra; Preuss, Michael; Ziegler, Andreas; Küster, Helmut; Felderhoff-Müser, Ursula; Gortner, Ludwig; Mögel, Michael; Härtel, Christoph; Herting, Egbert

2014-08-26

The mitochondrial m.1555A>G mutation is associated with a high rate of permanent hearing loss, if aminoglycosides are given. Preterm infants have an increased risk of permanent hearing loss and are frequently treated with aminoglycoside antibiotics. We genotyped preterm infants with a birth weight below 1500 grams who were prospectively enrolled in a large cohort study for the m.1555A>G mutation. Treatment with aminoglycoside antibiotics in combination with mitochondrial m.1555A>G mutation was tested as a predictor for failed hearing screening at discharge in a multivariate logistic regression analysis. 7056 infants were genotyped and analysed. Low birth weight was the most significant predictor of failed hearing screening (p = 7.3 × 10-10). 12 infants (0.2%) had the m.1555A>G-mutation. In a multivariable logistic regression analysis, the combination of aminoglycoside treatment with m.1555A>G-carrier status was associated with failed hearing screening (p = 0.0058). However, only 3 out of 10 preterm m.1555A>G-carriers who were exposed to aminoglycosides failed hearing screening. The m.1555A>G-mutation was detected in all mothers of m.1555A>G-positive children, but in none of 2993 maternal DNA-samples of m.1555A>G-negative infants. Antenatal screening for the m.1555A>G mutation by maternal genotyping of pregnant women with preterm labour might be a reasonable approach to identify infants who are at increased risk for permanent hearing loss. Additional studies are needed to estimate the relevance of cofactors like aminoglycoside plasma levels and birth weight and the amount of preterm m.1555A>G-carriers with permanent hearing loss.

An activating G{sub s}{alpha} mutation is present in fibrous dysplasia of bone in the McCune-Albright syndrome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shenker, A.; Weinstein, L.S.; Spiegel, A.M.

1994-09-01

McCune-Albright syndrome (MAS) is a sporadic disease characterized by polyostotic fibrous dysplasia, cafe-au-lait spots, and multiple endocrinopathies. The etiology of fibrous dysplasia is unknown. Activating mutations of codon 201 in the gene encoding the {alpha}-subunit of G{sub s}, the G-protein that stimulates adenylyl cyclase, have been found in all affected MAS tissues that have been studied. Initial attempts to amplify DNA from decalcified paraffin-embedded bone specimens from frozen surgical bone specimens from five MAS patients using polymerase chain reaction and allele-specific oligonucleotide hybridization. Most of the cells in four specimens of dysplastic bone contained a heterozygous mutation encoding substitution ofmore » Arg{sup 201} of G{sub s}{alpha} with His, but the mutation was barely detectable in peripheral blood specimens from the patients. Only a small amount of mutant allele was detected in a specimen of normal cortical bone from the fifth patient, although this patients had a high proportion of mutation in other, affected tissues. The mosaic distribution of mutant alleles is consistent with an embryological somatic cell mutation of the G{sub s}{alpha} gene in MAS. The presence of an activating mutation of G{sub s}{alpha} in osteoblastic progenitor cells may cause them to exhibit increased proliferation and abnormal differentiation, thereby producing the lesions of fibrous dysplasia. 43 refs., 2 figs.« less

Occurrence of phaeochromocytoma tumours in RET mutation carriers - a single-centre study.

PubMed

Kotecka-Blicharz, Agnieszka; Hasse-Lazar, Kornelia; Jurecka-Lubieniecka, Beata; Pawlaczek, Agnieszka; Oczko-Wojciechowska, Małgorzata; Bugajska, Beata; Ledwon, Aleksandra; Król, Aleksandra; Michalik, Barbara; Jarząb, Barbara

2016-01-01

Multiple endocrine neoplasia type 2 (MEN 2) is an autosomal dominant genetic syndrome caused by germline mutation in RET proto-oncogene. The most common mutations are in a cysteine rich domain. Phaeochromocytoma will develop in approximately 50% of RET proto-oncogene carriers. The studied population consisted of 228 RET proto-oncogene mutation carriers. Monitoring for the diagnosis of phaeochromocytoma was carried out in all patients with established genetic status. Mean time of follow up was 138 months. Surveillance consisted of periodically performed clinical evaluation, 24-hour urinary determinations of total metanephrines complementary with imaging (CT, MR, MIBG scintigraphy). Phaeochromocytoma developed in 41 patients (18% of all RET proto-oncogene mutations carriers). The mean age of diagnosis for the whole cohort was 43 years. In eight cases phaeochromocytoma was the first manifestation of the MEN 2 syndrome. Only eight (20%) patients were symptomatic at diagnosis of phaeochromocytoma. The mean size of the tumour was 4.3 cm. There was no extra-adrenal localisation. We observed one case of malignant phaeochromocytoma. In patients with MEN 2 syndrome phaeochromocytomas are usually benign adrenal tumours with high risk of bilateral development. Taking to account the latter risk and non-specific clinical manifestation of the neoplasm it is mandatory to screen all RET proto-oncogene mutations carriers for phaeochromocytoma.

Do BRCA1/2 mutation carriers have an earlier onset of natural menopause?

PubMed

van Tilborg, Theodora C; Broekmans, Frank J; Pijpe, Anouk; Schrijver, Lieske H; Mooij, Thea M; Oosterwijk, Jan C; Verhoef, Senno; Gómez Garcia, Encarna B; van Zelst-Stams, Wendy A; Adank, Muriel A; van Asperen, Christi J; van Doorn, Helena C; van Os, Theo A; Bos, Anna M; Rookus, Matti A; Ausems, Margreet G

2016-08-01

It has been hypothesized that BRCA1/2 mutation carriers have an earlier age at natural menopause (ANM), although to date findings are inconclusive. This study assessed the influence of BRCA mutation status on ANM, and aimed to explore the reasons of inconsistency in the literature. Cross-sectional assessment from an ongoing nationwide cohort study among members of BRCA1/2 mutated families. Information was obtained by a standardized questionnaire. Kaplan-Meier curves were constructed, and Cox regression was used to assess the association between BRCA1/2 mutation status and ANM. Adjustments were made for birth cohort, family, smoking, use of hormonal contraceptives, and parity. A total of 1,208 BRCA1/2 mutation carriers and 2,211 proven noncarriers were included. Overall, no association was found between BRCA1/2 mutation status and ANM (adjusted hazard ratio [HR] = 1.06 [95% CI, 0.87-1.30]). We examined if the null finding was due to informative censoring by uptake of risk-reducing salpingo-oophorectomy. Indeed, within the oldest birth cohort, in which the percentage of surgical menopause events was lowest and comparable between carriers and noncarriers, the HR for earlier natural menopause in carriers was 1.45 (95% CI, 1.09-1.94). The second oldest birth cohort, however, demonstrated a decreased HR (0.67 [95% CI, 0.46-0.98]), and thus no trend over birth cohorts was found. Various types of selection bias hamper the comparison of ANM between BRCA1/2 mutation carriers and noncarriers, genetically tested in the clinic.

Greater risk of parkinsonism associated with non-N370S GBA1 mutations

PubMed Central

Giraldo, P.; Capablo, J. L.; Alfonso, P.; Irun, P.; Garcia-Rodriguez, B.; Pocovi, M.; Pastores, G. M.

2014-01-01

Mutations in β-glucosidase (GBA1) are the most common genetic risk factor for Parkinson disease (PD). There is evidence to suggest that PD risk is greater (1) in GBA1 heterozygotes with non-N370S GBA1 mutations compared to N370S mutations and (2) in GD type 1 (GD1) patients compared to GBA1 heterozygotes. This study aimed to determine the comparative risk of parkin-sonism in individuals who are affected or carriers of Gaucher disease (GD) and to ascertain the influence of different GBA1 mutations on risk/clinical expression. We conducted a secondary analysis of cross-sectional data assessing the prevalence of parkinsonism in a population of GD1 patients and their heterozygote and non-carrier family members. Two logistic regression models, both employing a family-specific random effect, were used to assess (1) the association between GBA1 mutation (N370S or non-N370S) and parkinsonism among GBA1 heterozygotes and (2) the association between GBA1 genotype and parkinsonism. Parkinsonism was present in 8.6 % of GD1 (7/81), 8.7 % of GBA1 heterozygotes (18/207), and 2.2 % of non-carriers (1/45). For those greater than 60 years old, parkinsonism was present in 38.5 % (5/13) of GD1 (5/13), 15.3 % of GBA1 heterozygotes (13/85), and 7.1 % of non-carriers (1/14). Among GBA1 heterozygotes, non-N370S mutations were associated with a significantly increased risk of parkinsonism compared to N370S (OR=22.5; p=0.035; 95%CI: 1.24, 411). In this population, each additional GBA1 mutation was associated with a non-significant two-fold increased risk of parkinsonism. GBA1 heterozygotes with non-N370S mutations associated with Gaucher disease have an increased risk of parkinsonism compared to those with N370S mutations. PMID:22968580

[Identification of an ideal noninvasive method to detect A3243G gene mutation in MELAS syndrome].

PubMed

Ma, Yi-nan; Fang, Fang; Yang, Yan-ling; Zhang, Ying; Wang, Song-tao; Xu, Yu-feng; Pei, Pei; Yuan, Yun; Bu, Ding-fang; Qi, Yu

2008-12-16

To identify a better non-invasive method to detect the carrier of mitochondrial A3243G mutation, a cause of mitochondrial encephalopathy-lactic acidosis-stroke like episode (MELAS) syndrome. DNA was extracted from the peripheral blood, urine, hair follicle, and saliva of 25 MELAS syndrome patients carrying A3243G mutation and their mothers and other maternal relatives, 33 persons in number, and the muscle tissues from 5 patients obtained by biopsy. A3243G mutation was detected by PCR-RFLP method, and the A3243G mutation ratio was identified by measuring the density of each band and calculation with the software AlphaEase 5.0. A3243G mutations were detected in all tissues of the 25 MELAS patients. The A3243G mutation ratio in urine was 62% +/- 9%, significantly higher than that in the blood [(36% +/- 10%), t = -11.13, P < 0.01]. A3243G mutations were detected in at least one tissue of the 28 maternal relatives. The A3243G mutation rates in their urine samples was 33.0% (5.0% - 70.4%), significantly higher than that in their blood samples [8.0% (0 - 33.3%), z = -4.197, P < 0.01]. There was no significant difference in A3243G mutation ratio among the samples of hair follicle, saliva, and blood. The A3243G mutation ratio in urine is significantly higher than those in blood samples of the patients and their maternal relatives. A noninvasive method, A3243G mutation ratio analysis of urine is superior to that in blood.

Involvement and Influence of Healthcare Providers, Family Members, and Other Mutation Carriers in the Cancer Risk Management Decision-Making Process of BRCA1 and BRCA2 Mutation Carriers.

PubMed

Puski, Athena; Hovick, Shelly; Senter, Leigha; Toland, Amanda Ewart

2018-03-29

Deciding between increased cancer screening or prophylactic surgery and the timing of such procedures can be a difficult and complex process for women with BRCA mutations. There are gaps in our understanding of involvement of others in the decision-making process for women with BRCA mutations. This study evaluated the management decision-making process of women with BRCA mutations, focusing on the involvement of others. Grounded theory was used to analyze and code risk management decision-making information from interviews with 20 BRCA mutation carriers. Unaffected at-risk participants with a BRCA mutation, those under age 40, and those with no children described having a difficult time making risk management decisions. Physicians were an integral part of the decision-making process by providing decisional support and management recommendations. Family members and other mutation carriers filled similar yet distinct roles by providing experiential information as well as decisional and emotional support for carriers. Participants described genetic counselors as short-term providers of risk information and management recommendations. The study findings suggest that unaffected at-risk women, women under 40, and those who do not have children may benefit from additional support and information during the decision-making process. Genetic counselors are well trained to help women through this process and connect them with resources, and may be under-utilized in long-term follow-up for women with a BRCA mutation.

Mitochondrial mutation m.1555A>G as a risk factor for failed newborn hearing screening in a large cohort of preterm infants

PubMed Central

2014-01-01

Background The mitochondrial m.1555A>G mutation is associated with a high rate of permanent hearing loss, if aminoglycosides are given. Preterm infants have an increased risk of permanent hearing loss and are frequently treated with aminoglycoside antibiotics. Methods We genotyped preterm infants with a birth weight below 1500 grams who were prospectively enrolled in a large cohort study for the m.1555A>G mutation. Treatment with aminoglycoside antibiotics in combination with mitochondrial m.1555A>G mutation was tested as a predictor for failed hearing screening at discharge in a multivariate logistic regression analysis. Results 7056 infants were genotyped and analysed. Low birth weight was the most significant predictor of failed hearing screening (p = 7.3 × 10-10). 12 infants (0.2%) had the m.1555A>G-mutation. In a multivariable logistic regression analysis, the combination of aminoglycoside treatment with m.1555A>G-carrier status was associated with failed hearing screening (p = 0.0058). However, only 3 out of 10 preterm m.1555A>G-carriers who were exposed to aminoglycosides failed hearing screening. The m.1555A>G-mutation was detected in all mothers of m.1555A>G-positive children, but in none of 2993 maternal DNA-samples of m.1555A>G-negative infants. Conclusion Antenatal screening for the m.1555A>G mutation by maternal genotyping of pregnant women with preterm labour might be a reasonable approach to identify infants who are at increased risk for permanent hearing loss. Additional studies are needed to estimate the relevance of cofactors like aminoglycoside plasma levels and birth weight and the amount of preterm m.1555A>G-carriers with permanent hearing loss. PMID:25155176

Oestrogen receptor status, treatment and breast cancer prognosis in Icelandic BRCA2 mutation carriers.

PubMed

Jonasson, Jon G; Stefansson, Olafur A; Johannsson, Oskar T; Sigurdsson, Helgi; Agnarsson, Bjarni A; Olafsdottir, Gudridur H; Alexiusdottir, Kristin K; Stefansdottir, Hrefna; Munoz Mitev, Rodrigo; Olafsdottir, Katrin; Olafsdottir, Kristrun; Arason, Adalgeir; Stefansdottir, Vigdis; Olafsdottir, Elinborg J; Barkardottir, Rosa B; Eyfjord, Jorunn E; Narod, Steven A; Tryggvadóttir, Laufey

2016-09-27

The impact of an inherited BRCA2 mutation on the prognosis of women with breast cancer has not been well documented. We studied the effects of oestrogen receptor (ER) status, other prognostic factors and treatments on survival in a large cohort of BRCA2 mutation carriers. We identified 285 breast cancer patients with a 999del5 BRCA2 mutation and matched them with 570 non-carrier patients. Clinical information was abstracted from patient charts and pathology records and supplemented by evaluation of tumour grade and ER status using archived tissue specimens. Univariate and multivariate hazard ratios (HR) were estimated for breast cancer-specific survival using Cox regression. The effects of various therapies were studied in patients treated from 1980 to 2012. Among mutation carriers, positive ER status was associated with higher risk of death than negative ER status (HR=1.94; 95% CI=1.22-3.07, P=0.005). The reverse association was seen for non-carriers (HR=0.71; 95% CI: 0.51-0.97; P=0.03). Among BRCA2 carriers, ER-positive status is an adverse prognostic factor. BRCA2 carrier status should be known at the time when treatment decisions are made.

AWEA WINDPOWER 2019 Conference & Exhibition

Science.gov Websites

than go through menu items. Book a Booth Learn Exhibit Sponsor Register AWEA Wind Power May 20-23 2019 . Book Your Booth Sponsor Sponsoring AWEA WINDPOWER 2019 gives you the opportunity to broadcast your

Swedish CDKN2A mutation carriers do not present the atypical mole syndrome phenotype.

PubMed

Nielsen, Kari; Harbst, Katja; Måsbäck, Anna; Jönsson, Göran; Borg, Ake; Olsson, Håkan; Ingvar, Christian

2010-08-01

Phenotypic characteristics were examined in melanoma-prone southern Swedish CDKN2A (p16-113insArg/p14ARF-128insSer) mutation families, in relation to the CDKN2A genotype, nevi, clinically atypical nevi (CAN) and melanoma. Individuals from eight melanoma-prone families, with index patients carrying the CDKN2A mutation, were offered skin examinations and genotyping (CDKN2A and MC1R). Ninety-three individuals above 18 years of age participated; 29 invasive melanomas in 16 patients were recorded, all in the 38 verified CDKN2A mutation carriers. Median age at diagnosis was 36 years. Several MC1R variants were observed. A significant correlation to CAN (P=0.01) and red hair colour (P=0.02) could be confirmed in melanoma patients. A positive mutation status (CDKN2A) was correlated to one or more CAN (P=0.007) but neither to blue eyes, red hair colour, heavy freckling nor high number of nevi. For mutation carriers, median total naevus count was 24 and interquartile range was 12-47 (mean 31); whereas for the whole cohort, median total naevus count was 12 and interquartile range was 5-25 (mean 22). No participant fulfilled the atypical mole syndrome phenotype criteria. Melanomas were diagnosed only in mutation carriers, and melanoma diagnosis was statistically correlated to the presence of one or more CAN and red hair colour, supporting the possible synergistic effect of a MC1R mutation on increased risk of melanoma in patients with a CDKN2A mutation. Family history, with verified tumour diagnoses, remains an important clinical tool for finding mutation carriers for referral to clinical geneticists and simultaneous presence of CAN in probable mutation carriers might strengthen this indication. The atypical mole syndrome phenotype was, however, not verified in the studied families and total naevus counts were low.

In vivo levels of S-adenosylmethionine modulate C:G to T:A mutations associated with repeat-induced point mutation in Neurospora crassa.

PubMed

Rosa, Alberto Luis; Folco, Hernán Diego; Mautino, Mario Ricardo

2004-04-14

In Neurospora crassa, the mutagenic process termed repeat-induced point mutation (RIP) inactivates duplicated DNA sequences during the sexual cycle by the introduction of C:G to T:A transition mutations. In this work, we have used a collection of N. crassa strains exhibiting a wide range of cellular levels of S-adenosylmethionine (AdoMet), the universal donor of methyl groups, to explore whether frequencies of RIP are dependent on the cellular levels of this metabolite. Mutant strains met-7 and eth-1 carry mutations in genes of the AdoMet pathway and have low levels of AdoMet. Wild type strains with high levels of AdoMet were constructed by introducing a chimeric transgene of the AdoMet synthetase (AdoMet-S) gene fused to the constitutive promoter trpC from Aspergillus nidulans. Crosses of these strains against tester duplications of the pan-2 and am genes showed that frequencies of RIP, as well as the total number of C:G to T:A transition mutations found in randomly selected am(RIP) alleles, are inversely correlated to the cellular level of AdoMet. These results indicate that AdoMet modulates the biochemical pathway leading to RIP.

Effects of α-thalassaemia mutations on the haematological parameters of β-thalassaemia carriers.

PubMed

Saleh-Gohari, Nasrollah; Khademi Bami, Maryam; Nikbakht, Roya; Karimi-Maleh, Hassan

2015-07-01

Thalassaemia is a haemoglobin disorder caused by a reduction in, or a complete absence of, the production of α- or β-globin genes. Detection of β-thalassaemia carriers is the first step in the prenatal diagnosis of the disease and is based primarily on the differences between levels of blood cell indices. Since co-inheritance of β- and α-thalassaemia mutations modulates the haematological parameters of heterozygote β-thalassaemia indices, understanding the influence of this interaction is helpful for identification of disease carriers. To determine the effects of α-thalassaemia mutations on the haematological parameters of β-thalassaemia carriers. We used gap-PCR and amplification refractory mutation system techniques to find any α- and/or β-thalassaemia mutations in 270 subjects who were suspected to be thalassaemia carriers. The mean values of the haematological parameters in α, β-thalassaemia and β-thalassaemia carriers were compared. Significant differences in mean corpuscular volume (MCV), mean corpuscular haemoglobin (MCH) and HbA2 were found between the two groups. Patients who were α, β-thalassaemia carriers had higher mean values of MCV and MCH, whereas HbA2 levels were higher in simple β-thalassaemia. No marked differences were found in mean cell haemoglobin (Hb) concentration and Hb blood cell indices. The value of MCV, MCH and HbA2 were significantly different between α,β-thalassaemia and simple β-thalassaemia in men and women, but the mean values of Hb in the two groups differed markedly only in men. We conclude that co-inheritance of α- and β-thalassaemia mutations may result in misdiagnosis of β-thalassaemia carriers. Therefore, in genetic counselling of patients with a near-normal range of blood cell indices the possibility that they may carry α, β-thalassaemia mutations must be considered. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

Neuropsychological Deficits in Huntington’s Disease Gene Carriers and Correlates of Early “Conversion”

PubMed Central

Brandt, Jason; Inscore, Anjeli B.; Ward, Julianna; Shpritz, Barnett; Rosenblatt, Adam; Margolis, Russell L.; Ross, Christopher A.

2010-01-01

The authors examined whether the baseline cognitive functioning of 21 clinically normal huntingtin mutation carriers who developed manifest Huntington’s disease on follow-up differed from that of 49 mutation carriers who remain asymptomatic over the same period in a longitudinal study. One hundred thirty-four gene-negative offspring of Huntington’s disease patients were studied as well. Overall, there were no differences in cognitive test performance among the three groups. However, “converters” who developed signs of Huntington’s disease within 8.6 years demonstrated poorer performance on the Wisconsin Card Sorting Test at baseline. People with the Huntington’s disease mutation who are carefully examined neurologically and found to be asymptomatic have, at most, very minimal problem-solving impairment, and only if they are within a few years of clinical onset. PMID:19196932

Mechanistic study on the nuclear modifier gene MSS1 mutation suppressing neomycin sensitivity of the mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae.

PubMed

Zhou, Qiyin; Wang, Wei; He, Xiangyu; Zhu, Xiaoyu; Shen, Yaoyao; Yu, Zhe; Wang, Xuexiang; Qi, Xuchen; Zhang, Xuan; Fan, Mingjie; Dai, Yu; Yang, Shuxu; Yan, Qingfeng

2014-01-01

The phenotypic manifestation of mitochondrial DNA (mtDNA) mutations can be modulated by nuclear genes and environmental factors. However, neither the interaction among these factors nor their underlying mechanisms are well understood. The yeast Saccharomyces cerevisiae mtDNA 15S rRNA C1477G mutation (PR) corresponds to the human 12S rRNA A1555G mutation. Here we report that a nuclear modifier gene mss1 mutation suppresses the neomycin-sensitivity phenotype of a yeast C1477G mutant in fermentable YPD medium. Functional assays show that the mitochondrial function of the yeast C1477G mutant was impaired severely in YPD medium with neomycin. Moreover, the mss1 mutation led to a significant increase in the steady-state level of HAP5 (heme activated protein), which greatly up-regulated the expression of glycolytic transcription factors RAP1, GCR1, and GCR2 and thus stimulated glycolysis. Furthermore, the high expression of the key glycolytic enzyme genes HXK2, PFK1 and PYK1 indicated that enhanced glycolysis not only compensated for the ATP reduction from oxidative phosphorylation (OXPHOS) in mitochondria, but also ensured the growth of the mss1(PR) mutant in YPD medium with neomycin. This study advances our understanding of the phenotypic manifestation of mtDNA mutations.

Association of TMEM106B gene polymorphism with age at onset in granulin mutation carriers and plasma granulin protein levels.

PubMed

Cruchaga, Carlos; Graff, Caroline; Chiang, Huei-Hsin; Wang, Jun; Hinrichs, Anthony L; Spiegel, Noah; Bertelsen, Sarah; Mayo, Kevin; Norton, Joanne B; Morris, John C; Goate, Alison

2011-05-01

To test whether rs1990622 (TMEM106B) is associated with age at onset (AAO) in granulin (GRN) mutation carriers and with plasma GRN levels in mutation carriers and healthy, elderly individuals. Rs1990622 (TMEM106B) was identified as a risk factor for frontotemporal lobar degeneration with TAR DNA-binding protein inclusions (FTLD-TDP) in a recent genome-wide association. Rs1990622 was genotyped in GRN mutation carriers and tested for association with AAO using the Kaplan-Meier method and a Cox proportional hazards model. Alzheimer's Disease Research Center. Subjects  We analyzed 50 affected and unaffected GRN mutation carriers from 4 previously reported FTLD-TDP families (HDDD1, FD1, HDDD2, and the Karolinska family). The GRN plasma levels were also measured in 73 healthy, elderly individuals. Age at onset and GRN plasma levels. The risk allele of rs1990622 was associated with a mean decrease of the AAO of 13 years (P = 9.9 × 10(-7)) and with lower plasma GRN levels in both healthy older adults (P = 4 × 10(-4)) and GRN mutation carriers (P = .0027). Analysis of the HapMap database identified a nonsynonymous single-nucleotide polymorphism rs3173615 (T185S) in perfect linkage disequilibrium with rs1990622. The association of rs1990622 with AAO explains, in part, the wide range in the AAO of disease among GRN mutation carriers. We hypothesize that rs1990622 or another variant in linkage disequilibrium could act in a manner similar to APOE in Alzheimer disease, increasing risk for disease in the general population and modifying AAO in mutation carriers. Our results also suggest that genetic variation in TMEM106B may influence risk for FTLD-TDP by modulating secreted levels of GRN.

Evaluation of current prediction models for Lynch syndrome: updating the PREMM5 model to identify PMS2 mutation carriers.

PubMed

Goverde, A; Spaander, M C W; Nieboer, D; van den Ouweland, A M W; Dinjens, W N M; Dubbink, H J; Tops, C J; Ten Broeke, S W; Bruno, M J; Hofstra, R M W; Steyerberg, E W; Wagner, A

2018-07-01

Until recently, no prediction models for Lynch syndrome (LS) had been validated for PMS2 mutation carriers. We aimed to evaluate MMRpredict and PREMM5 in a clinical cohort and for PMS2 mutation carriers specifically. In a retrospective, clinic-based cohort we calculated predictions for LS according to MMRpredict and PREMM5. The area under the operator receiving characteristic curve (AUC) was compared between MMRpredict and PREMM5 for LS patients in general and for different LS genes specifically. Of 734 index patients, 83 (11%) were diagnosed with LS; 23 MLH1, 17 MSH2, 31 MSH6 and 12 PMS2 mutation carriers. Both prediction models performed well for MLH1 and MSH2 (AUC 0.80 and 0.83 for PREMM5 and 0.79 for MMRpredict) and fair for MSH6 mutation carriers (0.69 for PREMM5 and 0.66 for MMRpredict). MMRpredict performed fair for PMS2 mutation carriers (AUC 0.72), while PREMM5 failed to discriminate PMS2 mutation carriers from non-mutation carriers (AUC 0.51). The only statistically significant difference between PMS2 mutation carriers and non-mutation carriers was proximal location of colorectal cancer (77 vs. 28%, p < 0.001). Adding location of colorectal cancer to PREMM5 considerably improved the models performance for PMS2 mutation carriers (AUC 0.77) and overall (AUC 0.81 vs. 0.72). We validated these results in an external cohort of 376 colorectal cancer patients, including 158 LS patients. MMRpredict and PREMM5 cannot adequately identify PMS2 mutation carriers. Adding location of colorectal cancer to PREMM5 may improve the performance of this model, which should be validated in larger cohorts.

40 CFR 52.1992-52.2019 - [Reserved

Code of Federal Regulations, 2014 CFR

2014-07-01

... 40 Protection of Environment 4 2014-07-01 2014-07-01 false [Reserved] 52.1992-52.2019 Section 52.1992-52.2019 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) APPROVAL AND PROMULGATION OF IMPLEMENTATION PLANS (CONTINUED) Oregon §§ 52.1992-52.2019 [Reserved] ...

The Metabolome in Finnish Carriers of the MYBPC3-Q1061X Mutation for Hypertrophic Cardiomyopathy.

PubMed

Jørgenrud, Benedicte; Jalanko, Mikko; Heliö, Tiina; Jääskeläinen, Pertti; Laine, Mika; Hilvo, Mika; Nieminen, Markku S; Laakso, Markku; Hyötyläinen, Tuulia; Orešič, Matej; Kuusisto, Johanna

2015-01-01

Mutations in the cardiac myosin-binding protein C gene (MYBPC3) are the most common genetic cause of hypertrophic cardiomyopathy (HCM) worldwide. The molecular mechanisms leading to HCM are poorly understood. We investigated the metabolic profiles of mutation carriers with the HCM-causing MYBPC3-Q1061X mutation with and without left ventricular hypertrophy (LVH) and non-affected relatives, and the association of the metabolome to the echocardiographic parameters. 34 hypertrophic subjects carrying the MYBPC3-Q1061X mutation, 19 non-hypertrophic mutation carriers and 20 relatives with neither mutation nor hypertrophy were examined using comprehensive echocardiography. Plasma was analyzed for molecular lipids and polar metabolites using two metabolomics platforms. Concentrations of branched chain amino acids, triglycerides and ether phospholipids were increased in mutation carriers with hypertrophy as compared to controls and non-hypertrophic mutation carriers, and correlated with echocardiographic LVH and signs of diastolic and systolic dysfunction in subjects with the MYBPC3-Q1061X mutation. Our study implicates the potential role of branched chain amino acids, triglycerides and ether phospholipids in HCM, as well as suggests an association of these metabolites with remodeling and dysfunction of the left ventricle.

Parkinson’s disease in GTP cyclohydrolase 1 mutation carriers

PubMed Central

Mencacci, Niccolò E.; Isaias, Ioannis U.; Reich, Martin M.; Ganos, Christos; Plagnol, Vincent; Polke, James M.; Bras, Jose; Hersheson, Joshua; Stamelou, Maria; Pittman, Alan M.; Noyce, Alastair J.; Mok, Kin Y.; Opladen, Thomas; Kunstmann, Erdmute; Hodecker, Sybille; Münchau, Alexander; Volkmann, Jens; Samnick, Samuel; Sidle, Katie; Nanji, Tina; Sweeney, Mary G.; Houlden, Henry; Batla, Amit; Zecchinelli, Anna L.; Pezzoli, Gianni; Marotta, Giorgio; Lees, Andrew; Alegria, Paulo; Krack, Paul; Cormier-Dequaire, Florence; Lesage, Suzanne; Brice, Alexis; Heutink, Peter; Gasser, Thomas; Lubbe, Steven J.; Morris, Huw R.; Taba, Pille; Koks, Sulev; Majounie, Elisa; Raphael Gibbs, J.; Singleton, Andrew; Hardy, John; Klebe, Stephan

2014-01-01

GTP cyclohydrolase 1, encoded by the GCH1 gene, is an essential enzyme for dopamine production in nigrostriatal cells. Loss-of-function mutations in GCH1 result in severe reduction of dopamine synthesis in nigrostriatal cells and are the most common cause of DOPA-responsive dystonia, a rare disease that classically presents in childhood with generalized dystonia and a dramatic long-lasting response to levodopa. We describe clinical, genetic and nigrostriatal dopaminergic imaging ([123I]N-ω-fluoropropyl-2β-carbomethoxy-3β-(4-iodophenyl) tropane single photon computed tomography) findings of four unrelated pedigrees with DOPA-responsive dystonia in which pathogenic GCH1 variants were identified in family members with adult-onset parkinsonism. Dopamine transporter imaging was abnormal in all parkinsonian patients, indicating Parkinson’s disease-like nigrostriatal dopaminergic denervation. We subsequently explored the possibility that pathogenic GCH1 variants could contribute to the risk of developing Parkinson’s disease, even in the absence of a family history for DOPA-responsive dystonia. The frequency of GCH1 variants was evaluated in whole-exome sequencing data of 1318 cases with Parkinson’s disease and 5935 control subjects. Combining cases and controls, we identified a total of 11 different heterozygous GCH1 variants, all at low frequency. This list includes four pathogenic variants previously associated with DOPA-responsive dystonia (Q110X, V204I, K224R and M230I) and seven of undetermined clinical relevance (Q110E, T112A, A120S, D134G, I154V, R198Q and G217V). The frequency of GCH1 variants was significantly higher (Fisher’s exact test P-value 0.0001) in cases (10/1318 = 0.75%) than in controls (6/5935 = 0.1%; odds ratio 7.5; 95% confidence interval 2.4–25.3). Our results show that rare GCH1 variants are associated with an increased risk for Parkinson’s disease. These findings expand the clinical and biological relevance of GTP cycloydrolase 1

Acquired resistance to an epidermal growth factor receptor-tyrosine kinase inhibitor (EGFR-TKI) in an uncommon G719S EGFR mutation.

PubMed

Osoegawa, Atsushi; Hashimoto, Takafumi; Takumi, Yohei; Abe, Miyuki; Yamada, Tomonori; Kobayashi, Ryoji; Miyawaki, Michiyo; Takeuchi, Hideya; Okamoto, Tatsuro; Sugio, Kenji

2018-03-28

Background Acquired resistance (AR) to an epidermal growth factor receptor-tyrosine kinase inhibitor (EGFR-TKI) is a common event, and several underlying mechanisms, including T790 M, MET amplification and PTEN downregulation, have been reported for the common EGFR mutations. EGFR G719X is an uncommon mutation that has been reported to show sensitivity to EGFR-TKIs. However, no established cell lines harboring the EGFR G719X have been reported in the literature. Materials and Methods G719S-GR cells were established from malignant pleural effusion of a patient whose tumor developed AR from gefitinib treatment. G719S-GR cells were then genotyped and tested for drug sensitivities. Multiplex ligation-dependent probe amplification (MLPA) was used to compare the clinical tumor samples with G719S-GR. Results G719S-GR cells were resistant to EGFR-TKIs with an LC50 of around 10 μM. A genomic analysis showed that G719S-GR cells harbor the EGFR G719S mutation as well as the amplification of EGFR locus. The homozygous deletion of CDKN2A and the loss of PTEN and TSC1 were also detected. On comparing the copy number of tumor suppressor genes using MLPA, G719S-GR cells were found to lack one copy of PTEN, which was not observed in a tumor obtained before gefitinib treatment. Loss of PTEN may result in AKT activation. The mTORC1/2 inhibitor Torin-1 was able to inhibit the downstream signaling when combined with osimertinib. Discussion The newly established G719S-GR cell line may be useful for investigating the mechanism underlying the development of AR in the G719X mutation; the loss of PTEN may be one such mechanism.

Dysphagia, malnutrition and gastrointestinal problems in patients with mitochondrial disease caused by the m3243A>G mutation.

PubMed

de Laat, P; Zweers, H E E; Knuijt, S; Smeitink, J A M; Wanten, G J A; Janssen, M C H

2015-01-01

Previous research has shown that dysphagia and gastrointestinal problems occur frequently in carriers of the m.3243A>G mutation; however, the exact frequency and severity have not been determined. We hypothesise that adult carriers have an increased risk for malnutrition. In this observational study we evaluated the presence of gastrointestinal problems and dysphagia in 92 carriers of the m.3243A>G mutation. The severity of the general disease involvement was classified using the Newcastle Mitochondrial Disease Adult Scale (NMDAS). Gastrointestinal involvement, dysphagia and the risk for malnutrition were scored using the Gastrointestinal Symptoms Questionnaire and the Malnutrition Universal Screening Tool. Gastrointestinal symptoms and anthropometrics were compared with healthy controls. Our results show that the height, weight and body mass index (BMI) of these carriers were lower than the national average (p < 0.05). Seventy-nine carriers (86%) suffered from at least one gastrointestinal symptom, mainly flatulence or hard stools. Both frequency and severity of symptoms were significantly increased compared with reference data of healthy Dutch adults. Of the carriers, 45% reported (mostly mild) dysphagia. Solid foods cause more problems than liquids. A negative correlation between BMI and heteroplasmy levels in urinary epithelial cells (UEC) was present (Spearman correlation coefficient = - 0.319, p = 0.003). Dysphagia and gastrointestinal problems, especially constipation, are common symptoms in the total m.3243A>G carriers cohort and are not related to heteroplasmy levels in UEC or disease severity. The severity of gastrointestinal problems as well as overall disease severity is associated with an increased risk for malnutrition.

Diagnostic markers for the detection of ovarian cancer in BRCA1 mutation carriers

PubMed Central

Weingartshofer, Sigrid; Rappaport-Fürhauser, Christine; Zeilinger, Robert; Pils, Dietmar; Muhr, Daniela; Braicu, Elena I.; Kastner, Marie-Therese; Tan, Yen Y.; Semmler, Lorenz; Sehouli, Jalid; Singer, Christian F.

2017-01-01

Background Screening for ovarian cancer (OC) in women at high risk consists of a combination of carbohydrate antigen 125 (CA125) and transvaginal ultrasound, despite their low sensitivity and specificity. This could be improved by the combination of several biomarkers, which has been shown in average risk patients but has not been investigated until now in female BRCA mutation carriers. Methods Using a multiplex, bead-based, immunoassay system, we analyzed the concentrations of leptin, prolactin, osteopontin, insulin-like growth factor II, macrophage inhibitory factor, CA125 and human epididymis antigen 4 in 26 healthy wild type women, 26 healthy BRCA1 mutation carriers, 28 wildtype OC patients and 26 OC patients with BRCA1 mutation. Results Using the ROC analysis, we found a high overall sensitivity of 94.3% in differentiating healthy controls from OC patients with comparable results in the wildtype subgroup (sensitivity 92.8%, AUC = 0.988; p = 5.2e-14) as well as in BRCA1 mutation carriers (sensitivity 95.2%, AUC = 0.978; p = 1.7e-15) at an overall specificity of 92.3%. The used algorithm also allowed to identify healthy BRCA1 mutation carriers when compared to healthy wildtype women (sensitivity 88.4%, specificity 80.7%, AUC = 0.895; p = 6e-08), while this was less pronounced in patients with OC (sensitivity 66.7%, specificity 67.8%, AUC = 0.724; p = 0.00065). Conclusion We have developed an algorithm, which can differentiate between healthy women and OC patients and have for the first time shown, that such an algorithm can also be used in BRCA mutation carriers. To clarify a suggested benefit to the existing early detection program, large prospective trials with mainly early stage OC cases are warranted. PMID:29244844

The average cumulative risks of breast and ovarian cancer for carriers of mutations in BRCA1 and BRCA2 attending genetic counseling units in Spain.

PubMed

Milne, Roger L; Osorio, Ana; Cajal, Teresa Ramón Y; Vega, Ana; Llort, Gemma; de la Hoya, Miguel; Díez, Orland; Alonso, M Carmen; Lazaro, Conxi; Blanco, Ignacio; Sánchez-de-Abajo, Ana; Caldés, Trinidad; Blanco, Ana; Graña, Begoña; Durán, Mercedes; Velasco, Eladio; Chirivella, Isabel; Cardeñosa, Eva Esteban; Tejada, María-Isabel; Beristain, Elena; Miramar, María-Dolores; Calvo, María-Teresa; Martínez, Eduardo; Guillén, Carmen; Salazar, Raquel; San Román, Carlos; Antoniou, Antonis C; Urioste, Miguel; Benítez, Javier

2008-05-01

It is not clear that the published estimates of the breast and ovarian cancer penetrances of mutations in BRCA1 and BRCA2 can be used in genetic counseling in countries such as Spain, where the incidence of breast cancer in the general population is considerably lower, the prevalence of BRCA2 mutations seems to be higher, and a distinct spectrum of recurrent mutations exists for both genes. We aimed to estimate these penetrances for women attending genetic counseling units in Spain. We collected phenotype and genotype data on 155 BRCA1 and 164 BRCA2 mutation carrier families from 12 centers across the country. Average age-specific cumulative risks of breast cancer and ovarian cancer were estimated using a modified segregation analysis method. The estimated average cumulative risk of breast cancer to age 70 years was estimated to be 52% [95% confidence interval (95% CI), 26-69%] for BRCA1 mutation carriers and 47% (95% CI, 29-60%) for BRCA2 mutation carriers. The corresponding estimates for ovarian cancer were 22% (95% CI, 0-40%) and 18% (95% CI, 0-35%), respectively. There was some evidence (two-sided P = 0.09) that 330A>G (R71G) in BRCA1 may have lower breast cancer penetrance. These results are consistent with those from a recent meta-analysis of practically all previous penetrance studies, suggesting that women with BRCA1 and BRCA2 mutations attending genetic counseling services in Spain have similar risks of breast and ovarian cancer to those published for other Caucasian populations. Carriers should be fully informed of their mutation- and age-specific risks to make appropriate decisions regarding prophylactic interventions such as oophorectomy.

Nuclear modifier MTO2 modulates the aminoglycoside-sensitivity of mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae.

PubMed

He, Xiangyu; Zhu, Xiaoyu; Wang, Xuexiang; Wang, Wei; Dai, Yu; Yan, Qingfeng

2013-01-01

The phenotypic manifestations of mitochondrial DNA (mtDNA) mutations are modulated by mitochondrial DNA haplotypes, nuclear modifier genes and environmental factors. The yeast mitochondrial 15S rRNA C1477G (P(R) or P(R) 454) mutation corresponds to the human 12S rRNA C1494T and A1555G mutations, which are well known as primary factors for aminoglycoside-induced nonsyndromic deafness. Here we report that the deletion of the nuclear modifier gene MTO2 suppressed the aminoglycoside-sensitivity of mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae. First, the strain with a single mtDNA C1477G mutation exhibited hypersensitivity to neomycin. Functional assays indicated that the steady-state transcription level of mitochondrial DNA, the mitochondrial respiratory rate, and the membrane potential decreased significantly after neomycin treatment. The impaired mitochondria could not produce sufficient energy to maintain cell viability. Second, when the mto2 null and the mitochondrial C1477G mutations co-existed (mto2(P(R))), the oxygen consumption rate in the double mutant decreased markedly compared to that of the control strains (MTO2(P(S)), mto2(P(S)) and MTO2(P(R))). The expression levels of the key glycolytic genes HXK2, PFK1 and PYK1 in the mto2(P(R)) strain were stimulated by neomycin and up-regulated by 89%, 112% and 55%, respectively. The enhanced glycolysis compensated for the respiratory energy deficits, and could be inhibited by the glycolytic enzyme inhibitor. Our findings in yeast will provide a new insight into the pathogenesis of human deafness.

Structural signature of the G719S-T790M double mutation in the EGFR kinase domain and its response to inhibitors

PubMed Central

C., George Priya Doss; B., Rajith; Chakraborty, Chiranjib; N., NagaSundaram; Ali, Shabana Kouser; Zhu, Hailong

2014-01-01

Some individuals with non-small-cell lung cancer (NSCLC) benefit from therapies targeting epidermal growth factor receptor (EGFR), and the characterization of a new mechanism of resistance to the EGFR-specific antibody gefitinib will provide valuable insight into how therapeutic strategies might be designed to overcome this particular resistance mechanism. The G719S and T790M mutations and their combination were involved in causing different conformational redistribution of EGFR. In the present computational study, we analyzed the impact and structural influence of G719S/T790M double mutation (DM) in EGFR with ligand (gefitinib) through molecular dynamic simulation (50 ns) and docking analysis. We observed the escalation in distance between the functional loop and activation loop with respect to T790M mutation compared to the G719S mutation. Furthermore, we confirmed that the G719S mutation causes the ligand to move closer to the hinge region, whereas T790M makes the ligand escape from the binding pocket. Obtained results provide with an explanation for the resistance induced by T790M and a vital clue for the design of drugs to combat gefitinib resistance. PMID:25091415

Bilateral Oophorectomy and Breast Cancer Risk in BRCA1 and BRCA2 Mutation Carriers.

PubMed

Kotsopoulos, Joanne; Huzarski, Tomasz; Gronwald, Jacek; Singer, Christian F; Moller, Pal; Lynch, Henry T; Armel, Susan; Karlan, Beth; Foulkes, William D; Neuhausen, Susan L; Senter, Leigha; Tung, Nadine; Weitzel, Jeffrey N; Eisen, Andrea; Metcalfe, Kelly; Eng, Charis; Pal, Tuya; Evans, Gareth; Sun, Ping; Lubinski, Jan; Narod, Steven A

2017-01-01

Whether oophorectomy reduces breast cancer risk among BRCA mutation carriers is a matter of debate. We undertook a prospective analysis of bilateral oophorectomy and breast cancer risk in BRCA mutation carriers. Subjects had no history of cancer, had both breasts intact, and had information on oophorectomy status (n = 3722). Women were followed until breast cancer diagnosis, prophylactic bilateral mastectomy, or death. A Cox regression model was used to estimate the hazard ratios (HRs) and 95% confidence intervals (CIs) of breast cancer associated with oophorectomy (coded as a time-dependent variable). All statistical tests were two-sided. Over a mean follow-up of 5.6 years, 350 new breast cancers were diagnosed. Among women with a BRCA1 or BRCA2 mutation, oophorectomy was not associated with breast cancer risk compared with women who did not undergo an oophorectomy. The age-adjusted hazard ratio associated with oophorectomy was 0.96 (95% CI = 0.73 to 1.26, P = 76) for BRCA1 and was 0.65 (95% CI = 0.37 to 1.16, P = 14) for BRCA2 mutation carriers. In stratified analyses, the effect of oophorectomy was statistically significant for breast cancer in BRCA2 mutation carriers diagnosed prior to age 50 years (age-adjusted HR = 0.18, 95% CI = 0.05 to 0.63, P = 007). Oophorectomy was not associated with risk of breast cancer prior to age 50 years among BRCA1 mutation carriers (age-adjusted HR = 0.79, 95% CI = 0.55 to 1.13, P = 51). Findings from this large prospective study support a role of oophorectomy for the prevention of premenopausal breast cancer in BRCA2, but not BRCA1 mutation carriers. These findings warrant further evaluation. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

BRCA1 mutation carriers have a lower number of mature oocytes after ovarian stimulation for IVF/PGD.

PubMed

Derks-Smeets, I A P; van Tilborg, T C; van Montfoort, A; Smits, L; Torrance, H L; Meijer-Hoogeveen, M; Broekmans, F; Dreesen, J C F M; Paulussen, A D C; Tjan-Heijnen, V C G; Homminga, I; van den Berg, M M J; Ausems, M G E M; de Rycke, M; de Die-Smulders, C E M; Verpoest, W; van Golde, R

2017-11-01

The aim of this study was to determine whether BRCA1/2 mutation carriers produce fewer mature oocytes after ovarian stimulation for in vitro fertilization (IVF) with preimplantation genetic diagnosis (PGD), in comparison to a PGD control group. A retrospective, international, multicenter cohort study was performed on data of first PGD cycles performed between January 2006 and September 2015. Data were extracted from medical files. The study was performed in one PGD center and three affiliated IVF centers in the Netherlands and one PGD center in Belgium. Exposed couples underwent PGD because of a pathogenic BRCA1/2 mutation, controls for other monogenic conditions. Only couples treated in a long gonadotropin-releasing hormone (GnRH) agonist-suppressive protocol, stimulated with at least 150 IU follicle stimulating hormone (FSH), were included. Women suspected to have a diminished ovarian reserve status due to chemotherapy, auto-immune disorders, or genetic conditions (other than BRCA1/2 mutations) were excluded. A total of 106 BRCA1/2 mutation carriers underwent PGD in this period, of which 43 (20 BRCA1 and 23 BRCA2 mutation carriers) met the inclusion criteria. They were compared to 174 controls selected by frequency matching. Thirty-eight BRCA1/2 mutation carriers (18 BRCA1 and 20 BRCA2 mutation carriers) and 154 controls proceeded to oocyte pickup. The median number of mature oocytes was 7.0 (interquartile range (IQR) 4.0-9.0) in the BRCA group as a whole, 6.5 (IQR 4.0-8.0) in BRCA1 mutation carriers, 7.5 (IQR 5.5-9.0) in BRCA2 mutation carriers, and 8.0 (IQR 6.0-11.0) in controls. Multiple linear regression analysis with the number of mature oocytes as a dependent variable and adjustment for treatment center, female age, female body mass index (BMI), type of gonadotropin used, and the total dose of gonadotropins administered revealed a significantly lower yield of mature oocytes in the BRCA group as compared to controls (p = 0.04). This finding could be fully

USDOT’s Intelligent Transportation Systems (ITS) ITS strategic plan, 2015-2019.

DOT National Transportation Integrated Search

2014-05-01

This document constitutes the Intelligent Transportation Systems Strategic Plan covering the years 2015 to 2019; it builds on the progress of the 2010-2014 plan and presents a wide array of technical, policy, institutional, and organizational concept...

Disease progression in C9orf72 mutation carriers.

PubMed

Floeter, Mary K; Traynor, Bryan J; Farren, Jennifer; Braun, Laura E; Tierney, Michael; Wiggs, Edythe A; Wu, Tianxia

2017-07-18

To assess changes in 3 clinical measures, the Revised ALS Functional Rating Scale (ALSFRS-R), letter fluency, and Frontal Behavioral Inventory (FBI), over time in C9orf72 mutation carriers (C9+) with varied clinical phenotypes. Thirty-four unrelated participants with mutations in C9orf72 were enrolled in a prospective natural history study. Participants were classified as asymptomatic, amyotrophic lateral sclerosis (ALS), ALS-familial frontotemporal dementia (FTD), or behavioral-variant FTD by clinical diagnostic criteria. Diagnostic cognitive and motor tests were repeated at 6 and 18 months. The ALSFRS-R, letter fluency, and FBI were administered at baseline and follow-up visits at 6, 12, and 18 months. The clinical diagnosis of most patients did not change over the follow-up. ALSFRS-R scores correlated with measures of motor function. Letter fluency correlated with FBI and cognitive tests. ALSFRS-R, letter fluency, and FBI differed among the C9+ diagnostic subgroups at enrollment and worsened over follow-up in symptomatic patients, with different slopes among the subgroups. Most patients survived to the 6-month time point after enrollment. Survival of C9+ patients with ALS and C9+ patients with ALS-FTD declined over the 12- and 18-month follow-up. The pattern of scores of the ALSFRS-R, letter fluency, and FBI distinguished between ALS, ALS-FTD, and FTD presentations of C9orf72 mutation carriers and asymptomatic carriers. Longitudinal changes in these measures occurred with disease progression in a manner consistent with presenting phenotype. © 2017 American Academy of Neurology.

Mitochondrial DNA Polymerase W748S Mutation: A Common Cause of Autosomal Recessive Ataxia with Ancient European Origin

PubMed Central

Hakonen, Anna H.; Heiskanen, Silja; Juvonen, Vesa; Lappalainen, Ilse; Luoma, Petri T.; Rantamäki, Maria; Goethem, Gert Van; Löfgren, Ann; Hackman, Peter; Paetau, Anders; Kaakkola, Seppo; Majamaa, Kari; Varilo, Teppo; Udd, Bjarne; Kääriäinen, Helena; Bindoff, Laurence A.; Suomalainen, Anu

2005-01-01

Mutations in the catalytic subunit of the mitochondrial DNA polymerase γ (POLG) have been found to be an important cause of neurological disease. Recently, we and collaborators reported a new neurodegenerative disorder with autosomal recessive ataxia in four patients homozygous for two amino acid changes in POLG: W748S in cis with E1143G. Here, we studied the frequency of this allele and found it to be among the most common genetic causes of inherited ataxia in Finland. We identified 27 patients with mitochondrial recessive ataxia syndrome (MIRAS) from 15 Finnish families, with a carrier frequency in the general population of 1:125. Since the mutation pair W748S+E1143G has also been described in European patients, we examined the haplotypes of 13 non-Finnish, European patients with the W748S mutation. Haplotype analysis revealed that all the chromosomes carrying these two changes, in patients from Finland, Norway, the United Kingdom, and Belgium, originate from a common ancient founder. In Finland and Norway, long, common, northern haplotypes, outside the core haplotype, could be identified. Despite having identical homozygous mutations, the Finnish patients with this adult- or juvenile-onset disease had surprisingly heterogeneous phenotypes, albeit with a characteristic set of features, including ataxia, peripheral neuropathy, dysarthria, mild cognitive impairment, involuntary movements, psychiatric symptoms, and epileptic seizures. The high carrier frequency in Finland, the high number of patients in Norway, and the ancient European founder chromosome indicate that this newly identified ataxia should be considered in the first-line differential diagnosis of progressive ataxia syndromes. PMID:16080118

The HOXB13 G84E Mutation Is Associated with an Increased Risk for Prostate Cancer and Other Malignancies.

PubMed

Beebe-Dimmer, Jennifer L; Hathcock, Matthew; Yee, Cecilia; Okoth, Linda A; Ewing, Charles M; Isaacs, William B; Cooney, Kathleen A; Thibodeau, Stephen N

2015-09-01

A rare nonconservative substitution (G84E) in the HOXB13 gene has been shown to be associated with risk of prostate cancer. DNA samples from male patients included in the Mayo Clinic Biobank (MCB) were genotyped to determine the frequency of the G84E mutation and its association with various cancers. Subjects were genotyped using a custom TaqMan (Applied Biosystems) assay for G84E (rs138213197). In addition to donating a blood specimen, all MCB participants completed a baseline questionnaire to collect information on medical history and family history of cancer. Forty-nine of 9,012 male patients were carriers of G84E (0.5%). Thirty-one percent (n = 2,595) of participants had been diagnosed with cancer, including 51.1% of G84E carriers compared with just 30.6% of noncarriers (P = 0.004). G84E was most frequently observed among men with prostate cancer compared with men without cancer (P < 0.0001). However, the mutation was also more commonly observed in men with bladder cancer (P = 0.06) and leukemia (P = 0.01). G84E carriers were more likely to have a positive family history of prostate cancer in a first-degree relative compared to noncarriers (36.2% vs. 16.0%, P = 0.0003). Our study confirms the association between the HOXB13 G84E variant and prostate cancer and suggests a novel association between G84E and leukemia and a suggestive association with bladder cancer. Future investigation is warranted to confirm these associations in order to improve our understanding of the role of germline HOXB13 mutations in human cancer. The associations between HOXB13 and prostate, leukemia, and bladder suggest that this gene is important in carcinogenesis. ©2015 American Association for Cancer Research.

Psychological Distress, Anxiety, and Depression of Cancer-Affected BRCA1/2 Mutation Carriers: a Systematic Review.

PubMed

Ringwald, Johanna; Wochnowski, Christina; Bosse, Kristin; Giel, Katrin Elisabeth; Schäffeler, Norbert; Zipfel, Stephan; Teufel, Martin

2016-10-01

Understanding the intermediate- and long-term psychological consequences of genetic testing for cancer patients has led to encouraging research, but a clear consensus of the psychosocial impact and clinical routine for cancer-affected BRCA1 and BRCA2 mutation carriers is still missing. We performed a systematic review of intermediate- and long-term studies investigating the psychological impact like psychological distress, anxiety, and depression in cancer-affected BRCA mutation carriers compared to unaffected mutation carriers. This review included the screening of 1243 studies. Eight intermediate- and long-term studies focusing on distress, anxiety, and depression symptoms among cancer-affected mutation carriers at least six months after the disclosure of genetic testing results were included. Studies reported a great variety of designs, methods, and patient outcomes. We found evidence indicating that cancer-affected mutation carriers experienced a negative effect in relation to psychological well-being in terms of an increase in symptoms of distress, anxiety, and depression in the first months after test disclosure. In the intermediate- and long-term, no significant clinical relevant symptoms occurred. However, none of the included studies used specific measurements, which can clearly identify psychological burdens of cancer-affected mutation carriers. We concluded that current well-implemented distress screening instruments are not sufficient for precisely identifying the psychological burden of genetic testing. Therefore, future studies should implement coping strategies, specific personality structures, the impact of genetic testing, supportive care needs and disease management behaviour to clearly screen for the possible intermediate- and long-term psychological impact of a positive test disclosure.

Efficacy of proximal colectomy for surgical management of right-sided first colorectal cancer in Lynch Syndrome mutation carriers.

PubMed

Hiatt, Molly J; Casey, Murray Joseph; Lynch, Henry T; Snyder, Carrie L; Stacey, Mark; Walters, Ryan W

2018-07-01

This study analyzes the occurrence of colorectal cancer (CRC) in Lynch syndrome (LS) mutation carriers, interval until diagnosis of metachronous CRC, and survival after proximal colectomy (PC) compared with total (TC) and subtotal colectomy (STC) for right-sided first CRC in LS mutation carriers. Sixty-four LS mutation carriers with right-sided first CRC treated with PC or TC + STC were confirmed by clinical records. Bivariate analyses were examined for significance and life tables were generated for risk of metachronous CRC and survival estimates following surgery. One of 16 (6.3%) mutation carriers treated with TC + STC developed subsequent CRC compared with 13/48 (27%) treated by PC. There was no significant difference in survival estimates between PC compared with TC + STC through 25 years after surgery. Risk of subsequent CRC and survival estimates following PC and TC + STC should be considered in surgical management of right-sided first CRC in LS mutation carriers. Copyright © 2017 Elsevier Inc. All rights reserved.

4 CFR 201.9 - Restrictions on charging fees.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 4 Accounts 1 2010-01-01 2010-01-01 false Restrictions on charging fees. 201.9 Section 201.9 Accounts RECOVERY ACCOUNTABILITY AND TRANSPARENCY BOARD PUBLIC INFORMATION AND REQUESTS § 201.9 Restrictions on charging fees. (a) When determining search or review fees: (1) No search fee shall be charged...

Emergence of novel and dominant acquired EGFR solvent-front mutations at Gly796 (G796S/R) together with C797S/R and L792F/H mutations in one EGFR (L858R/T790M) NSCLC patient who progressed on osimertinib.

PubMed

Ou, Sai-Hong Ignatius; Cui, Jean; Schrock, Alexa B; Goldberg, Michael E; Zhu, Viola W; Albacker, Lee; Stephens, Philip J; Miller, Vincent A; Ali, Siraj M

2017-06-01

Acquired epidermal growth factor receptor (EGFR) resistance mutations to osimertinib are common, including the EGFR C797S that abolishes the covalent binding of osimertinib to EGFR. Here we report the emergence of novel EGFR solvent front mutations at Gly796 (G796S/R) in addition to a hinge pocket L792F/H mutations, and C797S/G all in cis with T790M in a single patient on progression on osimertinib as detected by plasma circulating tumor DNA (ctDNA) assay in the course of clinical care. A 69-year-old Caucasian female former light-smoker presented with stage IV EGFR L858R positive adenocarcinoma who developed EGFR T790M mutation after 8 month treatment of erlotinib. The patient was initiated on osimertinib with disease shrinkage after 2 months, but tumor regrowth was observed after 5 months of osimertinib treatment. Assay of plasma ctDNA at this time revealed these different secondary resistance mutations all in trans with each other including distinct mutations at the same codon producing different amino acid changes: G796S/R (mutant allele frequency [MAF]; 14.4%), C797S/G (MAF: 2.26%), L792F/H (MAF: 0.36%), and V802F (MAF: 0.40%), in addition to the pre-existing L858R (MAF:17.9%) and T790M (MAF:18.2%) but all in cis with T790M. The G796S/R mutations are homologous with known reported solvent front mutations in ALK G1202R, ROS1 G2032R, TrkA G595R and TrkC G623R, all of which are associated with acquired resistance to type I TKIs. In silico modeling revealed mutation at G796 interferes with osimertinib binding to the EGFR kinase domain at the phenyl aromatic ring position as this residue forms a narrow "hydrophobic sandwich" with L718, while L792F/H mutation interferes with osimertinib binding at the methoxyl group on the phenyl ring. Multiple resistance mutations at differing allele frequencies including novel EGFR solvent front mutations can emerge in a single patient with progression on osimertinib potentially due to tumor hetereogeneity and definitely present a

Tamoxifen and Risk of Contralateral Breast Cancer for BRCA1 and BRCA2 Mutation Carriers

PubMed Central

Phillips, Kelly-Anne; Milne, Roger L.; Rookus, Matti A.; Daly, Mary B.; Antoniou, Antonis C.; Peock, Susan; Frost, Debra; Easton, Douglas F.; Ellis, Steve; Friedlander, Michael L.; Buys, Saundra S.; Andrieu, Nadine; Noguès, Catherine; Stoppa-Lyonnet, Dominique; Bonadona, Valérie; Pujol, Pascal; McLachlan, Sue Anne; John, Esther M.; Hooning, Maartje J.; Seynaeve, Caroline; Tollenaar, Rob A.E.M.; Goldgar, David E.; Beth Terry, Mary; Caldes, Trinidad; Weideman, Prue C.; Andrulis, Irene L.; Singer, Christian F.; Birch, Kate; Simard, Jacques; Southey, Melissa C.; Olsson, Håkan L.; Jakubowska, Anna; Olah, Edith; Gerdes, Anne-Marie; Foretova, Lenka; Hopper, John L.

2013-01-01

Purpose To determine whether adjuvant tamoxifen treatment for breast cancer (BC) is associated with reduced contralateral breast cancer (CBC) risk for BRCA1 and/or BRCA2 mutation carriers. Methods Analysis of pooled observational cohort data, self-reported at enrollment and at follow-up from the International BRCA1, and BRCA2 Carrier Cohort Study, Kathleen Cuningham Foundation Consortium for Research into Familial Breast Cancer, and Breast Cancer Family Registry. Eligible women were BRCA1 and BRCA2 mutation carriers diagnosed with unilateral BC since 1970 and no other invasive cancer or tamoxifen use before first BC. Hazard ratios (HRs) for CBC associated with tamoxifen use were estimated using Cox regression, adjusting for year and age of diagnosis, country, and bilateral oophorectomy and censoring at contralateral mastectomy, death, or loss to follow-up. Results Of 1,583 BRCA1 and 881 BRCA2 mutation carriers, 383 (24%) and 454 (52%), respectively, took tamoxifen after first BC diagnosis. There were 520 CBCs over 20,104 person-years of observation. The adjusted HR estimates were 0.38 (95% CI, 0.27 to 0.55) and 0.33 (95% CI, 0.22 to 0.50) for BRCA1 and BRCA2 mutation carriers, respectively. After left truncating at recruitment to the cohort, adjusted HR estimates were 0.58 (95% CI, 0.29 to 1.13) and 0.48 (95% CI, 0.22 to 1.05) based on 657 BRCA1 and 426 BRCA2 mutation carriers with 100 CBCs over 4,392 person-years of prospective follow-up. HRs did not differ by estrogen receptor status of the first BC (missing for 56% of cases). Conclusion This study provides evidence that tamoxifen use is associated with a reduction in CBC risk for BRCA1 and BRCA2 mutation carriers. Further follow-up of these cohorts will provide increased statistical power for future prospective analyses. PMID:23918944

Genetic Variation at 9p22.2 and Ovarian Cancer Risk for BRCA1 and BRCA2 Mutation Carriers

PubMed Central

Kartsonaki, Christiana; Gayther, Simon A.; Pharoah, Paul D. P.; Sinilnikova, Olga M.; Beesley, Jonathan; Chen, Xiaoqing; McGuffog, Lesley; Healey, Sue; Couch, Fergus J.; Wang, Xianshu; Fredericksen, Zachary; Peterlongo, Paolo; Manoukian, Siranoush; Peissel, Bernard; Zaffaroni, Daniela; Roversi, Gaia; Barile, Monica; Viel, Alessandra; Allavena, Anna; Ottini, Laura; Papi, Laura; Gismondi, Viviana; Capra, Fabio; Radice, Paolo; Greene, Mark H.; Mai, Phuong L.; Andrulis, Irene L.; Glendon, Gord; Ozcelik, Hilmi; Thomassen, Mads; Gerdes, Anne-Marie; Kruse, Torben A.; Cruger, Dorthe; Jensen, Uffe Birk; Caligo, Maria Adelaide; Olsson, Håkan; Kristoffersson, Ulf; Lindblom, Annika; Arver, Brita; Karlsson, Per; Stenmark Askmalm, Marie; Borg, Ake; Neuhausen, Susan L.; Ding, Yuan Chun; Nathanson, Katherine L.; Domchek, Susan M.; Jakubowska, Anna; Lubiński, Jan; Huzarski, Tomasz; Byrski, Tomasz; Gronwald, Jacek; Górski, Bohdan; Cybulski, Cezary; Dębniak, Tadeusz; Osorio, Ana; Durán, Mercedes; Tejada, Maria-Isabel; Benítez, Javier; Hamann, Ute; Rookus, Matti A.; Verhoef, Senno; Tilanus-Linthorst, Madeleine A.; Vreeswijk, Maaike P.; Bodmer, Danielle; Ausems, Margreet G. E. M.; van Os, Theo A.; Asperen, Christi J.; Blok, Marinus J.; Meijers-Heijboer, Hanne E. J.; Peock, Susan; Cook, Margaret; Oliver, Clare; Frost, Debra; Dunning, Alison M.; Evans, D. Gareth; Eeles, Ros; Pichert, Gabriella; Cole, Trevor; Hodgson, Shirley; Brewer, Carole; Morrison, Patrick J.; Porteous, Mary; Kennedy, M. John; Rogers, Mark T.; Side, Lucy E.; Donaldson, Alan; Gregory, Helen; Godwin, Andrew; Stoppa-Lyonnet, Dominique; Moncoutier, Virginie; Castera, Laurent; Mazoyer, Sylvie; Barjhoux, Laure; Bonadona, Valérie; Leroux, Dominique; Faivre, Laurence; Lidereau, Rosette; Nogues, Catherine; Bignon, Yves-Jean; Prieur, Fabienne; Collonge-Rame, Marie-Agnès; Venat-Bouvet, Laurence; Fert-Ferrer, Sandra; Miron, Alex; Buys, Saundra S.; Hopper, John L.; Daly, Mary B.; John, Esther M.; Terry, Mary Beth; Goldgar, David; Hansen, Thomas v. O.; Jønson, Lars; Ejlertsen, Bent; Agnarsson, Bjarni A.; Offit, Kenneth; Kirchhoff, Tomas; Vijai, Joseph; Dutra-Clarke, Ana V. C.; Przybylo, Jennifer A.; Montagna, Marco; Casella, Cinzia; Imyanitov, Evgeny N.; Janavicius, Ramunas; Blanco, Ignacio; Lázaro, Conxi; Moysich, Kirsten B.; Karlan, Beth Y.; Gross, Jenny; Beattie, Mary S.; Schmutzler, Rita; Wappenschmidt, Barbara; Meindl, Alfons; Ruehl, Ina; Fiebig, Britta; Sutter, Christian; Arnold, Norbert; Deissler, Helmut; Varon-Mateeva, Raymonda; Kast, Karin; Niederacher, Dieter; Gadzicki, Dorothea; Caldes, Trinidad; de la Hoya, Miguel; Nevanlinna, Heli; Aittomäki, Kristiina; Simard, Jacques; Soucy, Penny; Spurdle, Amanda B.; Holland, Helene; Chenevix-Trench, Georgia; Easton, Douglas F.; Antoniou, Antonis C.

2011-01-01

Background Germline mutations in the BRCA1 and BRCA2 genes are associated with increased risks of breast and ovarian cancers. Although several common variants have been associated with breast cancer susceptibility in mutation carriers, none have been associated with ovarian cancer susceptibility. A genome-wide association study recently identified an association between the rare allele of the single-nucleotide polymorphism (SNP) rs3814113 (ie, the C allele) at 9p22.2 and decreased risk of ovarian cancer for women in the general population. We evaluated the association of this SNP with ovarian cancer risk among BRCA1 or BRCA2 mutation carriers by use of data from the Consortium of Investigators of Modifiers of BRCA1/2. Methods We genotyped rs3814113 in 10 029 BRCA1 mutation carriers and 5837 BRCA2 mutation carriers. Associations with ovarian and breast cancer were assessed with a retrospective likelihood approach. All statistical tests were two-sided. Results The minor allele of rs3814113 was associated with a reduced risk of ovarian cancer among BRCA1 mutation carriers (per-allele hazard ratio of ovarian cancer = 0.78, 95% confidence interval = 0.72 to 0.85; P = 4.8 × 10-9) and BRCA2 mutation carriers (hazard ratio of ovarian cancer = 0.78, 95% confidence interval = 0.67 to 0.90; P = 5.5 × 10-4). This SNP was not associated with breast cancer risk among either BRCA1 or BRCA2 mutation carriers. BRCA1 mutation carriers with the TT genotype at SNP rs3814113 were predicted to have an ovarian cancer risk to age 80 years of 48%, and those with the CC genotype were predicted to have a risk of 33%. Conclusion Common genetic variation at the 9p22.2 locus was associated with decreased risk of ovarian cancer for carriers of a BRCA1 or BRCA2 mutation. PMID:21169536

An intronic mutation c.6430-3C>G in the F8 gene causes splicing efficiency and premature termination in hemophilia A.

PubMed

Xia, Zunjing; Lin, Jie; Lu, Lingping; Kim, Chol; Yu, Ping; Qi, Ming

2018-06-01

: Hemophilia A is a bleeding disorder caused by coagulation factor VIII protein deficiency or dysfunction, which is classified into severe, moderate, and mild according to factor clotting activity. An overwhelming majority of missense and nonsense mutations occur in exons of F8 gene, whereas mutations in introns can also be pathogenic. This study aimed to investigate the effect of an intronic mutation, c.6430-3C>G (IVS22-3C>G), on pre-mRNA splicing of the F8 gene. We applied DNA and cDNA sequencing in a Chinese boy with hemophilia A to search if any pathogenic mutation in the F8 gene. Functional analysis was performed to investigate the effect of an intronic mutation at the transcriptional level. Human Splicing Finder and PyMol were also used to predict its effect. We found the mutation c.6430-3C>G (IVS22-3C>G) in the F8 gene in the affected boy, with his mother being a carrier. cDNA from the mother and pSPL3 splicing assay showed that the mutation IVS22-3C>G results in a two-nucleotide AG inclusion at the 3' end of intron 22 and leads to a truncated coagulation factor VIII protein, with partial loss of the C1 domain and complete loss of the C2 domain. The in-silico tool predicted that the mutation induces altered pre-mRNA splicing by using a cryptic acceptor site in intron 22. The IVS22-3C>G mutation was confirmed to affect pre-mRNA splicing and produce a truncated protein, which reduces the stability of binding between the F8 protein and von Willebrand factor carrier protein due to the loss of an interaction domain.

Psychiatric symptoms in preclinical behavioural-variant frontotemporal dementia in MAPT mutation carriers.

PubMed

Cheran, Gayathri; Silverman, Hannah; Manoochehri, Masood; Goldman, Jill; Lee, Seonjoo; Wu, Liwen; Cines, Sarah; Fallon, Emer; Kelly, Brendan Desmond; Olszewska, Diana Angelika; Heidebrink, Judith; Shair, Sarah; Campbell, Stephen; Paulson, Henry; Lynch, Timothy; Cosentino, Stephanie; Huey, Edward D

2018-05-01

To characterise psychiatric symptoms in preclinical and early behavioural-variant frontotemporal dementia (bvFTD), a neurodegenerative disorder whose symptoms overlap with and are often mistaken for psychiatric illness. The present study reports findings from a systematic, global, prospective evaluation of psychiatric symptoms in 12 preclinical carriers of pathogenic MAPT mutations, not yet meeting bvFTD diagnostic criteria, and 46 familial non-carrier controls. Current psychiatric symptoms, informant-reported symptoms and lifetime prevalence of psychiatric disorders were assessed with The Structured Clinical Interview for the Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition (DSM-IV) and the Neuropsychiatric Inventory Questionnaire. Fisher exact test was used to compare carriers and non-carriers' lifetime prevalence of six DSM-IV disorders: major depressive disorder, panic attacks, alcohol abuse, generalised anxiety disorder, panic disorder, and depressive disorder not otherwise specified. Other DSM-IV disorders had insufficient prevalence across our sample for between-group comparisons, but are reported. Non-carriers had greater prevalence of mood and anxiety disorders than has been reported for a general reference population. Preclinical carriers had lower lifetime prevalence of mood and anxiety disorders than non-carriers, except for depressive disorder not otherwise specified, an atypical syndrome comprising clinically significant depressive symptoms which fail to meet criteria for major depressive disorder. Findings suggest that early psychiatric symptoms of emergent bvFTD may manifest as emotional blunting or mood changes not cleanly conforming to criteria for a DSM-defined mood disorder. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Risk reducing mastectomy, breast reconstruction and patient satisfaction in Norwegian BRCA1/2 mutation carriers.

PubMed

Hagen, Anne Irene; Mæhle, Lovise; Vedå, Nina; Vetti, Hildegunn Høberg; Stormorken, Astrid; Ludvigsen, Trond; Guntvedt, Bente; Isern, Anne Elisabeth; Schlichting, Ellen; Kleppe, Geir; Bofin, Anna; Gullestad, Hans Petter; Møller, Pål

2014-02-01

The aim of this study was to evaluate the outcome of risk-reducing mastectomy in BRCA1/2 mutation carriers with and without breast cancer. Uptake, methods of operation and reconstruction, complications, patient satisfaction and histopathological findings were registered at all five departments of genetics in Norway. Data from 267 affected and unaffected BRCA1/2 mutation carriers were analyzed, including a study-specific questionnaire returned by 178 mutation carriers. There was a steady increase in the uptake of risk-reducing mastectomies during the study period. Complications were observed in 106/266 (39.7%) women. Patient satisfaction was high. The majority of women expressed great relief after risk-reducing mastectomy and would have chosen the same option again. Copyright © 2013 Elsevier Ltd. All rights reserved.

A family with the Arg103Pro mutation in the NEUROD1 gene detected by next-generation sequencing - Clinical characteristics of mutation carriers.

PubMed

Szopa, Magdalena; Ludwig-Galezowska, Agnieszka H; Radkowski, Piotr; Skupien, Jan; Machlowska, Julita; Klupa, Tomasz; Wolkow, Pawel; Borowiec, Maciej; Mlynarski, Wojciech; Malecki, Maciej T

2016-02-01

Until now only a few families with early onset autosomal diabetes due to the NEUROD1 gene mutations have been identified. Moreover, only some of them meet strict MODY (maturity-onset diabetes of the young) criteria. Next-generation sequencing (NGS) provides an opportunity to detect more pathogenic mutations in this gene. Here, we evaluated the segregation of the Arg103Pro mutation in the NEUROD1 gene in a pedigree in which it was detected, and described the clinical characteristics of the mutation carriers. We included 156 diabetic probands of MODY families, among them 52 patients earlier tested for GCK-MODY and/or HNF1A-MODY by Sanger sequencing with negative results. Genetic testing was performed by targeted NGS sequencing using a panel of 28 monogenic diabetes genes. As detected by NGS, one patient had the missense Arg103Pro (CGC/CCC) mutation in the gene NEUROD1 changing the amino-acid structure of the DNA binding domain of this transcription factor. We confirmed this sequence difference by Sanger sequencing. This family had previously been tested with negative results for HNF1A gene mutations. 17 additional members of this family were invited for further testing. We confirmed the presence of the mutation in 11 subjects. Seven adult mutation carriers (all but one) from three generations had been already diagnosed with diabetes. There were 3 individuals with the Arg103Pro mutation diagnosed before the age of 30 years in the family. The range of age of the four unaffected mutation carriers (3 minors and 1 adult) was 3-48 years. Interestingly, one mutation carrier had a history of transient neonatal hypoglycemia, of which the clinical course resembled episodes typical for HNF4A-MODY. We report a family with autosomal dominant diabetes related to a new NEUROD1 mutation, one of very few meeting MODY criteria. The use of the NGS method will facilitate identification of more families with rare forms of MODY. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

The heterozygous R1441C mutation of leucine-rich repeat kinase 2 gene in a Chinese patient with Parkinson disease: A five-year follow-up and literatures review.

PubMed

Peng, Fang; Sun, Yi-Min; Chen, Chen; Luo, Su-Shan; Li, Da-Ke; Wang, Yi-Xuan; Yang, Ke; Liu, Feng-Tao; Zuo, Chuan-Tao; Ding, Zheng-Tong; An, Yu; Wu, Jian-Jun; Wang, Jian

2017-02-15

Leucine-rich repeat kinase 2 gene (LRRK2) was recognized associated with both familial and sporadic Parkinson Disease (PD). Seven missense mutations (G2019S, R1441C, R1441G, R1441H, Y1699C, I2020T, N1437H) of it have been confirmed disease- causing. They were common among Caucasian PD patients, but rarely reported in Asian, especially in Chinese Han population. We aimed to identify the frequencies of these seven mutations of LRRK2 in Chinese early-onset PD (EOPD) patients and analyze the phenotypes. One hundred and thirty seven EOPD patients were enrolled for genetic testing. The seven disease-causing mutations of LRRK2 were carried out by target sequencing using Illumina HiSeq 2000 Sequencer. The identified variants were further confirmed by Sanger sequence. The clinical materials were investigated retrospectively. Only one patient (0.73%) was found carrying pathogenetic LRRK2 mutation of R1441C. The age at onset of the female patient was 44. She manifested typical motor symptoms of PD and responded well to levodopa therapy. Longitudinal evaluation showed progression of motor symptoms and depression but no cognitive impairment. The dopamine transporter (DAT) imaging via [11C]-2β-carbomethoxy-3β-(4-fluorophenyl) tropan (CFT) and Positron emission computed tomography (PET) revealed typical dopamine transporter uptake reduction. The LRRK2 R1441C mutation was found in a Chinese EOPD patient for the first time. The manifestations of LRRK2-R1441C carriers were indistinguishable from sporadic PD patients. Copyright © 2016 Elsevier B.V. All rights reserved.

Risk of colorectal cancer for carriers of a germline mutation in POLE or POLD1

PubMed Central

Buchanan, Daniel D.; Stewart, Jenna R.; Clendenning, Mark; Rosty, Christophe; Mahmood, Khalid; Pope, Bernard J.; Jenkins, Mark A.; Hopper, John L.; Southey, Melissa C.; Macrae, Finlay A.; Winship, Ingrid M.; Win, Aung Ko

2017-01-01

Background Germline mutations in the exonuclease domains of the POLE and POLD1 genes are associated with an as yet unquantified increased risk of colorectal cancer (CRC). Methods We identified families with POLE or POLD1 variants by searching PubMed for relevant studies prior to October 2016 and by genotyping 669 population-based CRC cases diagnosed <60 years of age from the Australasian Colorectal Cancer Family Registry. We estimated the age-specific cumulative risks (penetrance) using a modified segregation analysis. Results We observed 67 CRCs (mean age at diagnosis=50.2 (standard deviation [SD]=13.8) years) among 364 first- and second- degree relatives from 41 POLE families and 6 CRCs (mean age at diagnosis=39.7 (SD=6.83) years) among 69 relatives from 9 POLD1 families. We estimated risks of CRC to age 70 years (95% confidence interval [CI]) for males and females, respectively, to be: 40%(26%–57%) and 32%(20%–47%) for POLE mutation carriers; and 63%(15%–99%) and 52%(11%–99%) for POLD1 mutation carriers. Conclusion CRC risks for POLE mutation carriers are sufficiently high warranting consideration of annual colonoscopy screening and management guidelines comparable to Lynch syndrome. Refinement of estimates of CRC risk for POLD1 carriers is needed, however, clinical management recommendations could follow those suggested for POLE carriers. PMID:29120461

Glutathione-S-transferase M1, T1 and P1 polymorphisms, and breast cancer risk, in BRCA1/2 mutation carriers

PubMed Central

Kadouri, L; Kote-Jarai, Z; Hubert, A; Baras, M; Abeliovich, D; Hamburger, T; Peretz, T; Eeles, R A

2008-01-01

Variation in penetrance estimates for BRCA1/2 carriers suggests that other environmental and genetic factors may modify cancer risk in carriers. The GSTM1, T1 and P1 isoenzymes are involved in metabolism of environmental carcinogens. The GSTM1 and GSTT1 gene is absent in a substantial proportion of the population. In GSTP1, a single-nucleotide polymorphism that translates to Ile112Val was associated with lower activity. We studied the effect of these polymorphisms on breast cancer (BC) risk in BRCA1/2 carriers. A population of 320 BRCA1/2 carriers were genotyped; of them 262 were carriers of one of the three Ashkenazi founder mutations. Two hundred and eleven were affected with BC (20 also with ovarian cancer (OC)) and 109 were unaffected with BC (39 of them had OC). Risk analyses were conducted using Cox proportional hazard models adjusted for origin (Ashkenazi vs non-Ashkenazi). We found an estimated BC HR of 0.89 (95% CI 0.65–1.12, P=0.25) and 1.11 (95% CI 0.81–1.52, P=0.53) for the null alleles of GSTM1 and GSTT1, respectively. For GSTP1, HR for BC was 1.36 (95% CI 1.02–1.81, P=0.04) for individuals with Ile/Val, and 2.00 (95% CI 1.18–3.38) for carriers of the Val/Val genotype (P=0.01). An HR of 3.20 (95% CI 1.26–8.09, P=0.01), and younger age at BC onset (P=0.2), were found among Val/Val, BRCA2 carriers, but not among BRCA1 carriers. In conclusion, our results indicate significantly elevated risk for BC in carriers of BRCA2 mutations with GSTP1-Val allele with dosage effect, as implicated by higher risk in homozygous Val carriers. The GSTM1- and GSTT1-null allele did not seem to have a major effect. PMID:18542066

RANK ligand as a potential target for breast cancer prevention in BRCA1-mutation carriers.

PubMed

Nolan, Emma; Vaillant, François; Branstetter, Daniel; Pal, Bhupinder; Giner, Göknur; Whitehead, Lachlan; Lok, Sheau W; Mann, Gregory B; Rohrbach, Kathy; Huang, Li-Ya; Soriano, Rosalia; Smyth, Gordon K; Dougall, William C; Visvader, Jane E; Lindeman, Geoffrey J

2016-08-01

Individuals who have mutations in the breast-cancer-susceptibility gene BRCA1 (hereafter referred to as BRCA1-mutation carriers) frequently undergo prophylactic mastectomy to minimize their risk of breast cancer. The identification of an effective prevention therapy therefore remains a 'holy grail' for the field. Precancerous BRCA1(mut/+) tissue harbors an aberrant population of luminal progenitor cells, and deregulated progesterone signaling has been implicated in BRCA1-associated oncogenesis. Coupled with the findings that tumor necrosis factor superfamily member 11 (TNFSF11; also known as RANKL) is a key paracrine effector of progesterone signaling and that RANKL and its receptor TNFRSF11A (also known as RANK) contribute to mammary tumorigenesis, we investigated a role for this pathway in the pre-neoplastic phase of BRCA1-mutation carriers. We identified two subsets of luminal progenitors (RANK(+) and RANK(-)) in histologically normal tissue of BRCA1-mutation carriers and showed that RANK(+) cells are highly proliferative, have grossly aberrant DNA repair and bear a molecular signature similar to that of basal-like breast cancer. These data suggest that RANK(+) and not RANK(-) progenitors are a key target population in these women. Inhibition of RANKL signaling by treatment with denosumab in three-dimensional breast organoids derived from pre-neoplastic BRCA1(mut/+) tissue attenuated progesterone-induced proliferation. Notably, proliferation was markedly reduced in breast biopsies from BRCA1-mutation carriers who were treated with denosumab. Furthermore, inhibition of RANKL in a Brca1-deficient mouse model substantially curtailed mammary tumorigenesis. Taken together, these findings identify a targetable pathway in a putative cell-of-origin population in BRCA1-mutation carriers and implicate RANKL blockade as a promising strategy in the prevention of breast cancer.

Candidate genetic modifiers for breast and ovarian cancer risk in BRCA1 and BRCA2 mutation carriers

PubMed Central

Peterlongo, Paolo; Chang-Claude, Jenny; Moysich, Kirsten B.; Rudolph, Anja; Schmutzler, Rita K.; Simard, Jacques; Soucy, Penny; Eeles, Rosalind A.; Easton, Douglas F.; Hamann, Ute; Wilkening, Stefan; Chen, Bowang; Rookus, Matti A.; Schmidt, Marjanka K; van der Baan, Frederieke H.; Spurdle, Amanda B.; Walker, Logan C.; Lose, Felicity; Maia, Ana-Teresa; Montagna, Marco; Matricardi, Laura; Lubinski, Jan; Jakubowska, Anna; Gómez Garcia, Encarna B.; Olopade, Olufunmilayo I.; Nussbaum, Robert L.; Nathanson, Katherine L.; Domchek, Susan M.; Rebbeck, Timothy R.; Arun, Banu K.; Karlan, Beth Y.; Orsulic, Sandra; Lester, Jenny; Chung, Wendy K.; Miron, Alex; Southey, Melissa C.; Goldgar, David E.; Buys, Saundra S.; Janavicius, Ramunas; Dorfling, Cecilia M.; van Rensburg, Elizabeth J.; Ding, Yuan Chun; Neuhausen, Susan L.; Hansen, Thomas V. O.; Gerdes, Anne-Marie; Ejlertsen, Bent; Jønson, Lars; Osorio, Ana; Martínez-Bouzas, Cristina; Benitez, Javier; Conway, Edye E.; Blazer, Kathleen R.; Weitzel, Jeffrey N.; Manoukian, Siranoush; Peissel, Bernard; Zaffaroni, Daniela; Scuvera, Giulietta; Barile, Monica; Ficarazzi, Filomena; Mariette, Frederique; Fortuzzi, Stefano; Viel, Alessandra; Giannini, Giuseppe; Papi, Laura; Martayan, Aline; Tibiletti, Maria Grazia; Radice, Paolo; Vratimos, Athanassios; Fostira, Florentia; Garber, Judy E.; Donaldson, Alan; Brewer, Carole; Foo, Claire; Evans, D. Gareth R.; Frost, Debra; Eccles, Diana; Brady, Angela; Cook, Jackie; Tischkowitz, Marc; Adlard, Julian; Barwell, Julian; Walker, Lisa; Izatt, Louise; Side, Lucy E.; Kennedy, M. John; Rogers, Mark T.; Porteous, Mary E.; Morrison, Patrick J.; Platte, Radka; Davidson, Rosemarie; Hodgson, Shirley V.; Ellis, Steve; Cole, Trevor; Godwin, Andrew K.; Claes, Kathleen; Van Maerken, Tom; Meindl, Alfons; Gehrig, Andrea; Sutter, Christian; Engel, Christoph; Niederacher, Dieter; Steinemann, Doris; Plendl, Hansjoerg; Kast, Karin; Rhiem, Kerstin; Ditsch, Nina; Arnold, Norbert; Varon-Mateeva, Raymonda; Wappenschmidt, Barbara; Wang-Gohrke, Shan; Bressac-de Paillerets, Brigitte; Buecher, Bruno; Delnatte, Capucine; Houdayer, Claude; Stoppa-Lyonnet, Dominique; Damiola, Francesca; Coupier, Isabelle; Barjhoux, Laure; Venat-Bouvet, Laurence; Golmard, Lisa; Boutry-Kryza, Nadia; Sinilnikova, Olga M.; Caron, Olivier; Pujol, Pascal; Mazoyer, Sylvie; Belotti, Muriel; Piedmonte, Marion; Friedlander, Michael L.; Rodriguez, Gustavo C.; Copeland, Larry J; de la Hoya, Miguel; Segura, Pedro Perez; Nevanlinna, Heli; Aittomäki, Kristiina; van Os, Theo A.M.; Meijers-Heijboer, Hanne E.J.; van der Hout, Annemarie H.; Vreeswijk, Maaike P.G.; Hoogerbrugge, Nicoline; Ausems, Margreet G.E.M.; van Doorn, Helena C.; Collée, J. Margriet; Olah, Edith; Diez, Orland; Blanco, Ignacio; Lazaro, Conxi; Brunet, Joan; Feliubadalo, Lidia; Cybulski, Cezary; Gronwald, Jacek; Durda, Katarzyna; Jaworska-Bieniek, Katarzyna; Sukiennicki, Grzegorz; Arason, Adalgeir; Chiquette, Jocelyne; Teixeira, Manuel R.; Olswold, Curtis; Couch, Fergus J.; Lindor, Noralane M.; Wang, Xianshu; Szabo, Csilla I.; Offit, Kenneth; Corines, Marina; Jacobs, Lauren; Robson, Mark E.; Zhang, Liying; Joseph, Vijai; Berger, Andreas; Singer, Christian F.; Rappaport, Christine; Kaulich, Daphne Geschwantler; Pfeiler, Georg; Tea, Muy-Kheng M.; Phelan, Catherine M.; Greene, Mark H.; Mai, Phuong L.; Rennert, Gad; Mulligan, Anna Marie; Glendon, Gord; Tchatchou, Sandrine; Andrulis, Irene L.; Toland, Amanda Ewart; Bojesen, Anders; Pedersen, Inge Sokilde; Thomassen, Mads; Jensen, Uffe Birk; Laitman, Yael; Rantala, Johanna; von Wachenfeldt, Anna; Ehrencrona, Hans; Askmalm, Marie Stenmark; Borg, Åke; Kuchenbaecker, Karoline B.; McGuffog, Lesley; Barrowdale, Daniel; Healey, Sue; Lee, Andrew; Pharoah, Paul D.P.; Chenevix-Trench, Georgia; Antoniou, Antonis C.; Friedman, Eitan

2014-01-01

Background BRCA1 and BRCA2 mutation carriers are at substantially increased risk for developing breast and ovarian cancer. The incomplete penetrance coupled with the variable age at diagnosis in carriers of the same mutation suggests the existence of genetic and non-genetic modifying factors. In this study we evaluated the putative role of variants in many candidate modifier genes. Methods Genotyping data from 15,252 BRCA1 and 8,211 BRCA2 mutation carriers, for known variants (n=3,248) located within or around 445 candidate genes, were available through the iCOGS custom-designed array. Breast and ovarian cancer association analysis was performed within a retrospective cohort approach. Results The observed p-values of association ranged between 0.005-1.000. None of the variants was significantly associated with breast or ovarian cancer risk in either BRCA1 or BRCA2 mutation carriers, after multiple testing adjustments. Conclusion There is little evidence that any of the evaluated candidate variants act as modifiers of breast and/or ovarian cancer risk in BRCA1 or BRCA2 mutation carriers. Impact Genome-wide association studies have been more successful at identifying genetic modifiers of BRCA1/2 penetrance than candidate gene studies. PMID:25336561

Candidate genetic modifiers for breast and ovarian cancer risk in BRCA1 and BRCA2 mutation carriers.

PubMed

Peterlongo, Paolo; Chang-Claude, Jenny; Moysich, Kirsten B; Rudolph, Anja; Schmutzler, Rita K; Simard, Jacques; Soucy, Penny; Eeles, Rosalind A; Easton, Douglas F; Hamann, Ute; Wilkening, Stefan; Chen, Bowang; Rookus, Matti A; Schmidt, Marjanka K; van der Baan, Frederieke H; Spurdle, Amanda B; Walker, Logan C; Lose, Felicity; Maia, Ana-Teresa; Montagna, Marco; Matricardi, Laura; Lubinski, Jan; Jakubowska, Anna; Gómez Garcia, Encarna B; Olopade, Olufunmilayo I; Nussbaum, Robert L; Nathanson, Katherine L; Domchek, Susan M; Rebbeck, Timothy R; Arun, Banu K; Karlan, Beth Y; Orsulic, Sandra; Lester, Jenny; Chung, Wendy K; Miron, Alex; Southey, Melissa C; Goldgar, David E; Buys, Saundra S; Janavicius, Ramunas; Dorfling, Cecilia M; van Rensburg, Elizabeth J; Ding, Yuan Chun; Neuhausen, Susan L; Hansen, Thomas V O; Gerdes, Anne-Marie; Ejlertsen, Bent; Jønson, Lars; Osorio, Ana; Martínez-Bouzas, Cristina; Benitez, Javier; Conway, Edye E; Blazer, Kathleen R; Weitzel, Jeffrey N; Manoukian, Siranoush; Peissel, Bernard; Zaffaroni, Daniela; Scuvera, Giulietta; Barile, Monica; Ficarazzi, Filomena; Mariette, Frederique; Fortuzzi, Stefano; Viel, Alessandra; Giannini, Giuseppe; Papi, Laura; Martayan, Aline; Tibiletti, Maria Grazia; Radice, Paolo; Vratimos, Athanassios; Fostira, Florentia; Garber, Judy E; Donaldson, Alan; Brewer, Carole; Foo, Claire; Evans, D Gareth R; Frost, Debra; Eccles, Diana; Brady, Angela; Cook, Jackie; Tischkowitz, Marc; Adlard, Julian; Barwell, Julian; Walker, Lisa; Izatt, Louise; Side, Lucy E; Kennedy, M John; Rogers, Mark T; Porteous, Mary E; Morrison, Patrick J; Platte, Radka; Davidson, Rosemarie; Hodgson, Shirley V; Ellis, Steve; Cole, Trevor; Godwin, Andrew K; Claes, Kathleen; Van Maerken, Tom; Meindl, Alfons; Gehrig, Andrea; Sutter, Christian; Engel, Christoph; Niederacher, Dieter; Steinemann, Doris; Plendl, Hansjoerg; Kast, Karin; Rhiem, Kerstin; Ditsch, Nina; Arnold, Norbert; Varon-Mateeva, Raymonda; Wappenschmidt, Barbara; Wang-Gohrke, Shan; Bressac-de Paillerets, Brigitte; Buecher, Bruno; Delnatte, Capucine; Houdayer, Claude; Stoppa-Lyonnet, Dominique; Damiola, Francesca; Coupier, Isabelle; Barjhoux, Laure; Venat-Bouvet, Laurence; Golmard, Lisa; Boutry-Kryza, Nadia; Sinilnikova, Olga M; Caron, Olivier; Pujol, Pascal; Mazoyer, Sylvie; Belotti, Muriel; Piedmonte, Marion; Friedlander, Michael L; Rodriguez, Gustavo C; Copeland, Larry J; de la Hoya, Miguel; Segura, Pedro Perez; Nevanlinna, Heli; Aittomäki, Kristiina; van Os, Theo A M; Meijers-Heijboer, Hanne E J; van der Hout, Annemarie H; Vreeswijk, Maaike P G; Hoogerbrugge, Nicoline; Ausems, Margreet G E M; van Doorn, Helena C; Collée, J Margriet; Olah, Edith; Diez, Orland; Blanco, Ignacio; Lazaro, Conxi; Brunet, Joan; Feliubadalo, Lidia; Cybulski, Cezary; Gronwald, Jacek; Durda, Katarzyna; Jaworska-Bieniek, Katarzyna; Sukiennicki, Grzegorz; Arason, Adalgeir; Chiquette, Jocelyne; Teixeira, Manuel R; Olswold, Curtis; Couch, Fergus J; Lindor, Noralane M; Wang, Xianshu; Szabo, Csilla I; Offit, Kenneth; Corines, Marina; Jacobs, Lauren; Robson, Mark E; Zhang, Liying; Joseph, Vijai; Berger, Andreas; Singer, Christian F; Rappaport, Christine; Kaulich, Daphne Geschwantler; Pfeiler, Georg; Tea, Muy-Kheng M; Phelan, Catherine M; Greene, Mark H; Mai, Phuong L; Rennert, Gad; Mulligan, Anna Marie; Glendon, Gord; Tchatchou, Sandrine; Andrulis, Irene L; Toland, Amanda Ewart; Bojesen, Anders; Pedersen, Inge Sokilde; Thomassen, Mads; Jensen, Uffe Birk; Laitman, Yael; Rantala, Johanna; von Wachenfeldt, Anna; Ehrencrona, Hans; Askmalm, Marie Stenmark; Borg, Åke; Kuchenbaecker, Karoline B; McGuffog, Lesley; Barrowdale, Daniel; Healey, Sue; Lee, Andrew; Pharoah, Paul D P; Chenevix-Trench, Georgia; Antoniou, Antonis C; Friedman, Eitan

2015-01-01

BRCA1 and BRCA2 mutation carriers are at substantially increased risk for developing breast and ovarian cancer. The incomplete penetrance coupled with the variable age at diagnosis in carriers of the same mutation suggests the existence of genetic and nongenetic modifying factors. In this study, we evaluated the putative role of variants in many candidate modifier genes. Genotyping data from 15,252 BRCA1 and 8,211 BRCA2 mutation carriers, for known variants (n = 3,248) located within or around 445 candidate genes, were available through the iCOGS custom-designed array. Breast and ovarian cancer association analysis was performed within a retrospective cohort approach. The observed P values of association ranged between 0.005 and 1.000. None of the variants was significantly associated with breast or ovarian cancer risk in either BRCA1 or BRCA2 mutation carriers, after multiple testing adjustments. There is little evidence that any of the evaluated candidate variants act as modifiers of breast and/or ovarian cancer risk in BRCA1 or BRCA2 mutation carriers. Genome-wide association studies have been more successful at identifying genetic modifiers of BRCA1/2 penetrance than candidate gene studies. ©2014 American Association for Cancer Research.

19 CFR 201.9 - Methods employed in obtaining information.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 19 Customs Duties 3 2014-04-01 2014-04-01 false Methods employed in obtaining information. 201.9 Section 201.9 Customs Duties UNITED STATES INTERNATIONAL TRADE COMMISSION GENERAL RULES OF GENERAL APPLICATION Initiation and Conduct of Investigations § 201.9 Methods employed in obtaining information. In...

19 CFR 201.9 - Methods employed in obtaining information.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 19 Customs Duties 3 2013-04-01 2013-04-01 false Methods employed in obtaining information. 201.9 Section 201.9 Customs Duties UNITED STATES INTERNATIONAL TRADE COMMISSION GENERAL RULES OF GENERAL APPLICATION Initiation and Conduct of Investigations § 201.9 Methods employed in obtaining information. In...

Impairment of memory generalization in preclinical autosomal dominant Alzheimer's disease mutation carriers.

PubMed

Petok, Jessica R; Myers, Catherine E; Pa, Judy; Hobel, Zachary; Wharton, David M; Medina, Luis D; Casado, Maria; Coppola, Giovanni; Gluck, Mark A; Ringman, John M

2018-05-01

Fast, inexpensive, and noninvasive identification of Alzheimer's disease (AD) before clinical symptoms emerge would augment our ability to intervene early in the disease. Individuals with fully penetrant genetic mutations causing autosomal dominant Alzheimer's disease (ADAD) are essentially certain to develop the disease, providing a unique opportunity to examine biomarkers during the preclinical stage. Using a generalization task that has previously shown to be sensitive to medial temporal lobe pathology, we compared preclinical individuals carrying ADAD mutations to noncarrying kin to determine whether generalization (the ability to transfer previous learning to novel but familiar recombinations) is vulnerable early, before overt cognitive decline. As predicted, results revealed that preclinical ADAD mutation carriers made significantly more errors during generalization than noncarrying kin, despite no differences between groups during learning or retention. This impairment correlated with the left hippocampal volume, particularly in mutation carriers. Such identification of generalization deficits in early ADAD may provide an easily implementable and potentially linguistically and culturally neutral way to identify and track cognition in ADAD. Copyright © 2018 Elsevier Inc. All rights reserved.

Double PALB2 and BRCA1/BRCA2 mutation carriers are rare in breast cancer and breast-ovarian cancer syndrome families from the French Canadian founder population.

PubMed

Ancot, Frédéric; Arcand, Suzanna L; Mes-Masson, Anne-Marie; Provencher, Diane M; Tonin, Patricia N

2015-06-01

French Canadian families with breast cancer and breast-ovarian cancer syndrome harbor specific BRCA1, BRCA2 and PALB2 germline mutations, which have been attributed to common founders. Mutations in these genes confer an increased risk to breast and ovarian cancers, and have been identified to play a role in and directly interact with the common homologous recombination DNA repair pathways. Our previous study described the case of a female diagnosed with breast cancer at 45 years old, who harbored the PALB2:c.2323C>T [p.Q775X] and BRCA2:c.9004G>A [p.E3002K] germline mutations, which have been found to recur in the French Canadian cancer families. As the frequency of double heterozygous carriers of breast-ovarian cancer susceptibility alleles is unknown, and due to the possibility that there may be implications for genetic counseling and management for these carriers, the present study investigated the co-occurrence of BRCA1/BRCA2 and PALB2 mutations in the French Canadian cancer families. The PALB2:c.2323C>T [p.Q775X] mutation, which is the only PALB2 mutation to have been identified in French Canadian cancer families, was screened in 214 breast cancer cases and 22 breast-ovarian cancer cases from 114 BRCA1/BRCA2 mutation-positive French Canadian breast cancer (n=61) and breast-ovarian cancer (n=53) families using a tailored polymerase chain reaction-based TaqMan® SNP Genotyping Assay. No additional PALB2:c.2323C>T [p.Q775X] mutation carriers were identified among the BRCA1/BRCA2 mutation carriers. The results suggest that carriers of the PALB2:c.2323C>T [p.Q775X] mutation rarely co-occur in French Canadian breast cancer and breast-ovarian cancer families harboring BRCA1 or BRCA2 mutations.

Contribution of mammography to MRI screening in BRCA mutation carriers by BRCA status and age: individual patient data meta-analysis

PubMed Central

Phi, Xuan-Anh; Saadatmand, Sepideh; De Bock, Geertruida H; Warner, Ellen; Sardanelli, Francesco; Leach, Martin O; Riedl, Christopher C; Trop, Isabelle; Hooning, Maartje J; Mandel, Rodica; Santoro, Filippo; Kwan-Lim, Gek; Helbich, Thomas H; Tilanus-Linthorst, Madeleine MA; van den Heuvel, Edwin R; Houssami, Nehmat

2016-01-01

Background: We investigated the additional contribution of mammography to screening accuracy in BRCA1/2 mutation carriers screened with MRI at different ages using individual patient data from six high-risk screening trials. Methods: Sensitivity and specificity of MRI, mammography and the combination of these tests were compared stratified for BRCA mutation and age using generalised linear mixed models with random effect for studies. Number of screens needed (NSN) for additional mammography-only detected cancer was estimated. Results: In BRCA1/2 mutation carriers of all ages (BRCA1=1219 and BRCA2=732), adding mammography to MRI did not significantly increase screening sensitivity (increased by 3.9% in BRCA1 and 12.6% in BRCA2 mutation carriers, P>0.05). However, in women with BRCA2 mutation younger than 40 years, one-third of breast cancers were detected by mammography only. Number of screens needed for mammography to detect one breast cancer not detected by MRI was much higher for BRCA1 compared with BRCA2 mutation carriers at initial and repeat screening. Conclusions: Additional screening sensitivity from mammography above that from MRI is limited in BRCA1 mutation carriers, whereas mammography contributes to screening sensitivity in BRCA2 mutation carriers, especially those ⩽40 years. The evidence from our work highlights that a differential screening schedule by BRCA status is worth considering. PMID:26908327

Contribution of mammography to MRI screening in BRCA mutation carriers by BRCA status and age: individual patient data meta-analysis.

PubMed

Phi, Xuan-Anh; Saadatmand, Sepideh; De Bock, Geertruida H; Warner, Ellen; Sardanelli, Francesco; Leach, Martin O; Riedl, Christopher C; Trop, Isabelle; Hooning, Maartje J; Mandel, Rodica; Santoro, Filippo; Kwan-Lim, Gek; Helbich, Thomas H; Tilanus-Linthorst, Madeleine M A; van den Heuvel, Edwin R; Houssami, Nehmat

2016-03-15

We investigated the additional contribution of mammography to screening accuracy in BRCA1/2 mutation carriers screened with MRI at different ages using individual patient data from six high-risk screening trials. Sensitivity and specificity of MRI, mammography and the combination of these tests were compared stratified for BRCA mutation and age using generalised linear mixed models with random effect for studies. Number of screens needed (NSN) for additional mammography-only detected cancer was estimated. In BRCA1/2 mutation carriers of all ages (BRCA1 = 1,219 and BRCA2 = 732), adding mammography to MRI did not significantly increase screening sensitivity (increased by 3.9% in BRCA1 and 12.6% in BRCA2 mutation carriers, P > 0.05). However, in women with BRCA2 mutation younger than 40 years, one-third of breast cancers were detected by mammography only. Number of screens needed for mammography to detect one breast cancer not detected by MRI was much higher for BRCA1 compared with BRCA2 mutation carriers at initial and repeat screening. Additional screening sensitivity from mammography above that from MRI is limited in BRCA1 mutation carriers, whereas mammography contributes to screening sensitivity in BRCA2 mutation carriers, especially those ⩽ 40 years. The evidence from our work highlights that a differential screening schedule by BRCA status is worth considering.

Common Breast Cancer-Predisposition Alleles Are Associated with Breast Cancer Risk in BRCA1 and BRCA2 Mutation Carriers

PubMed Central

Antoniou, Antonis C.; Spurdle, Amanda B.; Sinilnikova, Olga M.; Healey, Sue; Pooley, Karen A.; Schmutzler, Rita K.; Versmold, Beatrix; Engel, Christoph; Meindl, Alfons; Arnold, Norbert; Hofmann, Wera; Sutter, Christian; Niederacher, Dieter; Deissler, Helmut; Caldes, Trinidad; Kämpjärvi, Kati; Nevanlinna, Heli; Simard, Jacques; Beesley, Jonathan; Chen, Xiaoqing; Neuhausen, Susan L.; Rebbeck, Timothy R.; Wagner, Theresa; Lynch, Henry T.; Isaacs, Claudine; Weitzel, Jeffrey; Ganz, Patricia A.; Daly, Mary B.; Tomlinson, Gail; Olopade, Olufunmilayo I.; Blum, Joanne L.; Couch, Fergus J.; Peterlongo, Paolo; Manoukian, Siranoush; Barile, Monica; Radice, Paolo; Szabo, Csilla I.; Pereira, Lutecia H. Mateus; Greene, Mark H.; Rennert, Gad; Lejbkowicz, Flavio; Barnett-Griness, Ofra; Andrulis, Irene L.; Ozcelik, Hilmi; Gerdes, Anne-Marie; Caligo, Maria A.; Laitman, Yael; Kaufman, Bella; Milgrom, Roni; Friedman, Eitan; Domchek, Susan M.; Nathanson, Katherine L.; Osorio, Ana; Llort, Gemma; Milne, Roger L.; Benítez, Javier; Hamann, Ute; Hogervorst, Frans B.L.; Manders, Peggy; Ligtenberg, Marjolijn J.L.; van den Ouweland, Ans M.W.; Peock, Susan; Cook, Margaret; Platte, Radka; Evans, D. Gareth; Eeles, Rosalind; Pichert, Gabriella; Chu, Carol; Eccles, Diana; Davidson, Rosemarie; Douglas, Fiona; Godwin, Andrew K.; Barjhoux, Laure; Mazoyer, Sylvie; Sobol, Hagay; Bourdon, Violaine; Eisinger, François; Chompret, Agnès; Capoulade, Corinne; Bressac-de Paillerets, Brigitte; Lenoir, Gilbert M.; Gauthier-Villars, Marion; Houdayer, Claude; Stoppa-Lyonnet, Dominique; Chenevix-Trench, Georgia; Easton, Douglas F.

2008-01-01

Germline mutations in BRCA1 and BRCA2 confer high risks of breast cancer. However, evidence suggests that these risks are modified by other genetic or environmental factors that cluster in families. A recent genome-wide association study has shown that common alleles at single nucleotide polymorphisms (SNPs) in FGFR2 (rs2981582), TNRC9 (rs3803662), and MAP3K1 (rs889312) are associated with increased breast cancer risks in the general population. To investigate whether these loci are also associated with breast cancer risk in BRCA1 and BRCA2 mutation carriers, we genotyped these SNPs in a sample of 10,358 mutation carriers from 23 studies. The minor alleles of SNP rs2981582 and rs889312 were each associated with increased breast cancer risk in BRCA2 mutation carriers (per-allele hazard ratio [HR] = 1.32, 95% CI: 1.20–1.45, ptrend = 1.7 × 10−8 and HR = 1.12, 95% CI: 1.02–1.24, ptrend = 0.02) but not in BRCA1 carriers. rs3803662 was associated with increased breast cancer risk in both BRCA1 and BRCA2 mutation carriers (per-allele HR = 1.13, 95% CI: 1.06–1.20, ptrend = 5 × 10−5 in BRCA1 and BRCA2 combined). These loci appear to interact multiplicatively on breast cancer risk in BRCA2 mutation carriers. The differences in the effects of the FGFR2 and MAP3K1 SNPs between BRCA1 and BRCA2 carriers point to differences in the biology of BRCA1 and BRCA2 breast cancer tumors and confirm the distinct nature of breast cancer in BRCA1 mutation carriers. PMID:18355772

22 CFR 62.12 - Control of Forms DS-2019.

Code of Federal Regulations, 2010 CFR

2010-04-01

... transfer; (4) Replace a lost or stolen Form DS-2019; (5) Facilitate entry of an exchange visitor's alien spouse or minor unmarried children into the United States separately; (6) Facilitate re-entry of an... Form DS-2019. Issue the Form DS-2019 only so as to: (1) Facilitate the entry of a new participant of...

22 CFR 62.12 - Control of Forms DS-2019.

Code of Federal Regulations, 2013 CFR

2013-04-01

... transfer; (4) Replace a lost or stolen Form DS-2019; (5) Facilitate entry of an exchange visitor's alien spouse or minor unmarried children into the United States separately; (6) Facilitate re-entry of an... Form DS-2019. Issue the Form DS-2019 only so as to: (1) Facilitate the entry of a new participant of...

22 CFR 62.12 - Control of Forms DS-2019.

Code of Federal Regulations, 2011 CFR

2011-04-01

... transfer; (4) Replace a lost or stolen Form DS-2019; (5) Facilitate entry of an exchange visitor's alien spouse or minor unmarried children into the United States separately; (6) Facilitate re-entry of an... Form DS-2019. Issue the Form DS-2019 only so as to: (1) Facilitate the entry of a new participant of...

22 CFR 62.12 - Control of Forms DS-2019.

Code of Federal Regulations, 2014 CFR

2014-04-01

... transfer; (4) Replace a lost or stolen Form DS-2019; (5) Facilitate entry of an exchange visitor's alien spouse or minor unmarried children into the United States separately; (6) Facilitate re-entry of an... Form DS-2019. Issue the Form DS-2019 only so as to: (1) Facilitate the entry of a new participant of...

22 CFR 62.12 - Control of Forms DS-2019.

Code of Federal Regulations, 2012 CFR

2012-04-01

... transfer; (4) Replace a lost or stolen Form DS-2019; (5) Facilitate entry of an exchange visitor's alien spouse or minor unmarried children into the United States separately; (6) Facilitate re-entry of an... Form DS-2019. Issue the Form DS-2019 only so as to: (1) Facilitate the entry of a new participant of...

Can selenium be a modifier of cancer risk in CHEK2 mutation carriers?

PubMed

Gupta, Satish; Jaworska-Bieniek, Katarzyna; Lubinski, Jan; Jakubowska, Anna

2013-11-01

Selenium is an essential trace element for humans, playing an important role in various major metabolic pathways. Selenium helps to protect the body from the poisonous effects of heavy metals and other harmful substances. Medical studies have provided evidence of selenium supplementation in preventing certain cancers. Low and too high selenium (Se) status correlates with increased risk of e.g. lung, larynx, colorectal and prostate cancers. A higher level of selenium and supplementation with selenium has been shown to be associated with substantially reduced cancer mortality. Selenium exerts its biological roles through selenoproteins, which are involved in oxidoreductions, redox signalling, antioxidant defence, thyroid hormone metabolism and immune responses. Checkpoint kinase 2 (CHEK2) is an important signal transducer of cellular responses to DNA damage and acts as a tumour suppressor gene. Mutations in the CHEK2 gene have been shown to be associated with increased risks of several cancers. Four common mutations in CHEK2 gene (1100delC, IVS2+1G>A, del5395 and I157T) have been identified in the Polish population. Studies have provided evidence that CHEK2-truncating and/or missense mutations are associated with increased risk of breast, prostate, thyroid, colon and kidney cancers. The variability in penetrance and cancer expression in CHEK2 mutation carriers can probably be explained by the influence of other genetic or environmental factors. One of the possible candidates is Se, which together with genetic variations in selenoprotein genes may influence susceptibility to cancer risk.

The association between smoking and cancer incidence in BRCA1 and BRCA2 mutation carriers.

PubMed

Ko, Kwang-Pil; Kim, Shana J; Huzarski, Tomasz; Gronwald, Jacek; Lubinski, Jan; Lynch, Henry T; Armel, Susan; Park, Sue K; Karlan, Beth; Singer, Christian F; Neuhausen, Susan L; Narod, Steven A; Kotsopoulos, Joanne

2018-06-01

Tobacco smoke is an established carcinogen, but the association between tobacco smoking and cancer risk in BRCA mutation carriers is not clear. The aim of this study was to evaluate prospectively the association between tobacco smoking and cancer incidence in a cohort of BRCA1 and BRCA2 mutation carriers. The study population consisted of unaffected BRCA mutation carriers. Information on lifestyle including smoking histories, reproductive factors, and past medical histories was obtained through questionnaires. Incident cancers were updated biennially via follow-up questionnaires. Hazard ratios (HRs) and 95% confidence intervals (CIs) were estimated using time-dependent Cox regression models. There were 700 incident cancers diagnosed over 26,711 person-years of follow-up. The most frequent cancers seen in BRCA mutation carriers were breast (n = 428; 61%) and ovarian (n = 109; 15%) cancer. Compared to nonsmokers, (ever) smoking was associated with a modest increased risk of all cancers combined (HR = 1.17; 95%CI 1.01-1.37). Women in the highest group of total pack-years (4.3-9.8) had an increased risk of developing any cancer (HR = 1.27; 95%CI 1.04-1.56), breast cancer (HR = 1.33, 95%CI 1.02-1.75), and ovarian cancer (HR = 1.68; 95%CI 1.06-2.67) compared to never smokers. The associations between tobacco smoking and cancer did not differ by BRCA mutation type or by age at diagnosis. This prospective study suggests that tobacco smoking is associated with a modest increase in the risks of breast and ovarian cancer among women with BRCA1 or BRCA2 mutation. © 2018 UICC.

Prediction of Breast and Prostate Cancer Risks in Male BRCA1 and BRCA2 Mutation Carriers Using Polygenic Risk Scores

PubMed Central

Lecarpentier, Julie; Silvestri, Valentina; Kuchenbaecker, Karoline B.; Barrowdale, Daniel; Dennis, Joe; McGuffog, Lesley; Soucy, Penny; Leslie, Goska; Rizzolo, Piera; Navazio, Anna Sara; Valentini, Virginia; Zelli, Veronica; Lee, Andrew; Amin Al Olama, Ali; Tyrer, Jonathan P.; Southey, Melissa; John, Esther M.; Conner, Thomas A.; Goldgar, David E.; Buys, Saundra S.; Janavicius, Ramunas; Steele, Linda; Ding, Yuan Chun; Neuhausen, Susan L.; Hansen, Thomas V.O.; Osorio, Ana; Weitzel, Jeffrey N.; Toss, Angela; Medici, Veronica; Cortesi, Laura; Zanna, Ines; Palli, Domenico; Radice, Paolo; Manoukian, Siranoush; Peissel, Bernard; Azzollini, Jacopo; Viel, Alessandra; Cini, Giulia; Damante, Giuseppe; Tommasi, Stefania; Peterlongo, Paolo; Fostira, Florentia; Hamann, Ute; Evans, D. Gareth; Henderson, Alex; Brewer, Carole; Eccles, Diana; Cook, Jackie; Ong, Kai-ren; Walker, Lisa; Side, Lucy E.; Porteous, Mary E.; Davidson, Rosemarie; Hodgson, Shirley; Frost, Debra; Adlard, Julian; Izatt, Louise; Eeles, Ros; Ellis, Steve; Tischkowitz, Marc; Godwin, Andrew K.; Meindl, Alfons; Gehrig, Andrea; Dworniczak, Bernd; Sutter, Christian; Engel, Christoph; Niederacher, Dieter; Steinemann, Doris; Hahnen, Eric; Hauke, Jan; Rhiem, Kerstin; Kast, Karin; Arnold, Norbert; Ditsch, Nina; Wang-Gohrke, Shan; Wappenschmidt, Barbara; Wand, Dorothea; Lasset, Christine; Stoppa-Lyonnet, Dominique; Belotti, Muriel; Damiola, Francesca; Barjhoux, Laure; Mazoyer, Sylvie; Van Heetvelde, Mattias; Poppe, Bruce; De Leeneer, Kim; Claes, Kathleen B.M.; de la Hoya, Miguel; Garcia-Barberan, Vanesa; Caldes, Trinidad; Perez Segura, Pedro; Kiiski, Johanna I.; Aittomäki, Kristiina; Khan, Sofia; Nevanlinna, Heli; van Asperen, Christi J.; Vaszko, Tibor; Kasler, Miklos; Olah, Edith; Balmaña, Judith; Gutiérrez-Enríquez, Sara; Diez, Orland; Teulé, Alex; Izquierdo, Angel; Darder, Esther; Brunet, Joan; Del Valle, Jesús; Feliubadalo, Lidia; Pujana, Miquel Angel; Lazaro, Conxi; Arason, Adalgeir; Agnarsson, Bjarni A.; Johannsson, Oskar Th.; Barkardottir, Rosa B.; Alducci, Elisa; Tognazzo, Silvia; Montagna, Marco; Teixeira, Manuel R.; Pinto, Pedro; Spurdle, Amanda B.; Holland, Helene; Lee, Jong Won; Lee, Min Hyuk; Lee, Jihyoun; Kim, Sung-Won; Kang, Eunyoung; Kim, Zisun; Sharma, Priyanka; Rebbeck, Timothy R.; Vijai, Joseph; Robson, Mark; Lincoln, Anne; Musinsky, Jacob; Gaddam, Pragna; Tan, Yen Y.; Berger, Andreas; Singer, Christian F.; Loud, Jennifer T.; Greene, Mark H.; Mulligan, Anna Marie; Glendon, Gord; Andrulis, Irene L.; Toland, Amanda Ewart; Senter, Leigha; Bojesen, Anders; Nielsen, Henriette Roed; Skytte, Anne-Bine; Sunde, Lone; Jensen, Uffe Birk; Pedersen, Inge Sokilde; Krogh, Lotte; Kruse, Torben A.; Caligo, Maria A.; Yoon, Sook-Yee; Teo, Soo-Hwang; von Wachenfeldt, Anna; Huo, Dezheng; Nielsen, Sarah M.; Olopade, Olufunmilayo I.; Nathanson, Katherine L.; Domchek, Susan M.; Lorenchick, Christa; Jankowitz, Rachel C.; Campbell, Ian; James, Paul; Mitchell, Gillian; Orr, Nick; Park, Sue Kyung; Thomassen, Mads; Offit, Kenneth; Couch, Fergus J.; Simard, Jacques; Easton, Douglas F.; Chenevix-Trench, Georgia; Schmutzler, Rita K.; Antoniou, Antonis C.; Ottini, Laura

2017-01-01

Purpose BRCA1/2 mutations increase the risk of breast and prostate cancer in men. Common genetic variants modify cancer risks for female carriers of BRCA1/2 mutations. We investigated—for the first time to our knowledge—associations of common genetic variants with breast and prostate cancer risks for male carriers of BRCA1/2 mutations and implications for cancer risk prediction. Materials and Methods We genotyped 1,802 male carriers of BRCA1/2 mutations from the Consortium of Investigators of Modifiers of BRCA1/2 by using the custom Illumina OncoArray. We investigated the combined effects of established breast and prostate cancer susceptibility variants on cancer risks for male carriers of BRCA1/2 mutations by constructing weighted polygenic risk scores (PRSs) using published effect estimates as weights. Results In male carriers of BRCA1/2 mutations, PRS that was based on 88 female breast cancer susceptibility variants was associated with breast cancer risk (odds ratio per standard deviation of PRS, 1.36; 95% CI, 1.19 to 1.56; P = 8.6 × 10−6). Similarly, PRS that was based on 103 prostate cancer susceptibility variants was associated with prostate cancer risk (odds ratio per SD of PRS, 1.56; 95% CI, 1.35 to 1.81; P = 3.2 × 10−9). Large differences in absolute cancer risks were observed at the extremes of the PRS distribution. For example, prostate cancer risk by age 80 years at the 5th and 95th percentiles of the PRS varies from 7% to 26% for carriers of BRCA1 mutations and from 19% to 61% for carriers of BRCA2 mutations, respectively. Conclusion PRSs may provide informative cancer risk stratification for male carriers of BRCA1/2 mutations that might enable these men and their physicians to make informed decisions on the type and timing of breast and prostate cancer risk management. PMID:28448241

Prediction of Breast and Prostate Cancer Risks in Male BRCA1 and BRCA2 Mutation Carriers Using Polygenic Risk Scores.

PubMed

Lecarpentier, Julie; Silvestri, Valentina; Kuchenbaecker, Karoline B; Barrowdale, Daniel; Dennis, Joe; McGuffog, Lesley; Soucy, Penny; Leslie, Goska; Rizzolo, Piera; Navazio, Anna Sara; Valentini, Virginia; Zelli, Veronica; Lee, Andrew; Amin Al Olama, Ali; Tyrer, Jonathan P; Southey, Melissa; John, Esther M; Conner, Thomas A; Goldgar, David E; Buys, Saundra S; Janavicius, Ramunas; Steele, Linda; Ding, Yuan Chun; Neuhausen, Susan L; Hansen, Thomas V O; Osorio, Ana; Weitzel, Jeffrey N; Toss, Angela; Medici, Veronica; Cortesi, Laura; Zanna, Ines; Palli, Domenico; Radice, Paolo; Manoukian, Siranoush; Peissel, Bernard; Azzollini, Jacopo; Viel, Alessandra; Cini, Giulia; Damante, Giuseppe; Tommasi, Stefania; Peterlongo, Paolo; Fostira, Florentia; Hamann, Ute; Evans, D Gareth; Henderson, Alex; Brewer, Carole; Eccles, Diana; Cook, Jackie; Ong, Kai-Ren; Walker, Lisa; Side, Lucy E; Porteous, Mary E; Davidson, Rosemarie; Hodgson, Shirley; Frost, Debra; Adlard, Julian; Izatt, Louise; Eeles, Ros; Ellis, Steve; Tischkowitz, Marc; Godwin, Andrew K; Meindl, Alfons; Gehrig, Andrea; Dworniczak, Bernd; Sutter, Christian; Engel, Christoph; Niederacher, Dieter; Steinemann, Doris; Hahnen, Eric; Hauke, Jan; Rhiem, Kerstin; Kast, Karin; Arnold, Norbert; Ditsch, Nina; Wang-Gohrke, Shan; Wappenschmidt, Barbara; Wand, Dorothea; Lasset, Christine; Stoppa-Lyonnet, Dominique; Belotti, Muriel; Damiola, Francesca; Barjhoux, Laure; Mazoyer, Sylvie; Van Heetvelde, Mattias; Poppe, Bruce; De Leeneer, Kim; Claes, Kathleen B M; de la Hoya, Miguel; Garcia-Barberan, Vanesa; Caldes, Trinidad; Perez Segura, Pedro; Kiiski, Johanna I; Aittomäki, Kristiina; Khan, Sofia; Nevanlinna, Heli; van Asperen, Christi J; Vaszko, Tibor; Kasler, Miklos; Olah, Edith; Balmaña, Judith; Gutiérrez-Enríquez, Sara; Diez, Orland; Teulé, Alex; Izquierdo, Angel; Darder, Esther; Brunet, Joan; Del Valle, Jesús; Feliubadalo, Lidia; Pujana, Miquel Angel; Lazaro, Conxi; Arason, Adalgeir; Agnarsson, Bjarni A; Johannsson, Oskar Th; Barkardottir, Rosa B; Alducci, Elisa; Tognazzo, Silvia; Montagna, Marco; Teixeira, Manuel R; Pinto, Pedro; Spurdle, Amanda B; Holland, Helene; Lee, Jong Won; Lee, Min Hyuk; Lee, Jihyoun; Kim, Sung-Won; Kang, Eunyoung; Kim, Zisun; Sharma, Priyanka; Rebbeck, Timothy R; Vijai, Joseph; Robson, Mark; Lincoln, Anne; Musinsky, Jacob; Gaddam, Pragna; Tan, Yen Y; Berger, Andreas; Singer, Christian F; Loud, Jennifer T; Greene, Mark H; Mulligan, Anna Marie; Glendon, Gord; Andrulis, Irene L; Toland, Amanda Ewart; Senter, Leigha; Bojesen, Anders; Nielsen, Henriette Roed; Skytte, Anne-Bine; Sunde, Lone; Jensen, Uffe Birk; Pedersen, Inge Sokilde; Krogh, Lotte; Kruse, Torben A; Caligo, Maria A; Yoon, Sook-Yee; Teo, Soo-Hwang; von Wachenfeldt, Anna; Huo, Dezheng; Nielsen, Sarah M; Olopade, Olufunmilayo I; Nathanson, Katherine L; Domchek, Susan M; Lorenchick, Christa; Jankowitz, Rachel C; Campbell, Ian; James, Paul; Mitchell, Gillian; Orr, Nick; Park, Sue Kyung; Thomassen, Mads; Offit, Kenneth; Couch, Fergus J; Simard, Jacques; Easton, Douglas F; Chenevix-Trench, Georgia; Schmutzler, Rita K; Antoniou, Antonis C; Ottini, Laura

2017-07-10

Purpose BRCA1/2 mutations increase the risk of breast and prostate cancer in men. Common genetic variants modify cancer risks for female carriers of BRCA1/2 mutations. We investigated-for the first time to our knowledge-associations of common genetic variants with breast and prostate cancer risks for male carriers of BRCA1/ 2 mutations and implications for cancer risk prediction. Materials and Methods We genotyped 1,802 male carriers of BRCA1/2 mutations from the Consortium of Investigators of Modifiers of BRCA1/2 by using the custom Illumina OncoArray. We investigated the combined effects of established breast and prostate cancer susceptibility variants on cancer risks for male carriers of BRCA1/2 mutations by constructing weighted polygenic risk scores (PRSs) using published effect estimates as weights. Results In male carriers of BRCA1/2 mutations, PRS that was based on 88 female breast cancer susceptibility variants was associated with breast cancer risk (odds ratio per standard deviation of PRS, 1.36; 95% CI, 1.19 to 1.56; P = 8.6 × 10 -6 ). Similarly, PRS that was based on 103 prostate cancer susceptibility variants was associated with prostate cancer risk (odds ratio per SD of PRS, 1.56; 95% CI, 1.35 to 1.81; P = 3.2 × 10 -9 ). Large differences in absolute cancer risks were observed at the extremes of the PRS distribution. For example, prostate cancer risk by age 80 years at the 5th and 95th percentiles of the PRS varies from 7% to 26% for carriers of BRCA1 mutations and from 19% to 61% for carriers of BRCA2 mutations, respectively. Conclusion PRSs may provide informative cancer risk stratification for male carriers of BRCA1/2 mutations that might enable these men and their physicians to make informed decisions on the type and timing of breast and prostate cancer risk management.

Manipulating Protein-Protein Interactions in Nonribosomal Peptide Synthetase Type II Peptidyl Carrier Proteins.

PubMed

Jaremko, Matt J; Lee, D John; Patel, Ashay; Winslow, Victoria; Opella, Stanley J; McCammon, J Andrew; Burkart, Michael D

2017-10-10

In an effort to elucidate and engineer interactions in type II nonribosomal peptide synthetases, we analyzed biomolecular recognition between the essential peptidyl carrier proteins and adenylation domains using nuclear magnetic resonance (NMR) spectroscopy, molecular dynamics, and mutational studies. Three peptidyl carrier proteins, PigG, PltL, and RedO, in addition to their cognate adenylation domains, PigI, PltF, and RedM, were investigated for their cross-species activity. Of the three peptidyl carrier proteins, only PigG showed substantial cross-pathway activity. Characterization of the novel NMR solution structure of holo-PigG and molecular dynamics simulations of holo-PltL and holo-PigG revealed differences in structures and dynamics of these carrier proteins. NMR titration experiments revealed perturbations of the chemical shifts of the loop 1 residues of these peptidyl carrier proteins upon their interaction with the adenylation domain. These experiments revealed a key region for the protein-protein interaction. Mutational studies supported the role of loop 1 in molecular recognition, as mutations to this region of the peptidyl carrier proteins significantly modulated their activities.

Prevalence of the HOXB13 G84E mutation in Danish men undergoing radical prostatectomy and its correlations with prostate cancer risk and aggressiveness.

PubMed

Storebjerg, Tine M; Høyer, Søren; Kirkegaard, Pia; Bro, Flemming; Ørntoft, Torben F; Borre, Michael; Sørensen, Karina D

2016-10-01

To determine the prevalence of the HOXB13 G84E mutation (rs138213197) in Danish men with or without prostate cancer (PCa) and to investigate possible correlations between HOXB13 mutation status and clinicopathological characteristics associated with tumour aggressiveness. We conducted a case-control study including 995 men with PCa (cases) who underwent radical prostatectomy (RP) between 1997 and 2011 at the Department of Urology, Aarhus University Hospital, Denmark. As controls, we used 1622 healthy men with a normal prostate specific antigen (PSA) level. The HOXB13 G84E mutation was identified in 0.49% of controls and in 2.51% of PCa cases. The mutation was associated with a 5.12-fold increased relative risk (RR) of PCa (95% confidence interval [CI] 2.26-13.38; P = 13 × 10(-6) ). Furthermore, carriers of the risk allele were significantly more likely to have a higher PSA level at diagnosis (mean PSA 19.9 vs 13.6 ng/mL; P = 0.032), a pathological Gleason score ≥7 (83.3 vs 60.9%; P = 0.032), and positive surgical margins (56.0 vs 28.5%; P = 0.006) than non-carriers. Risk allele carriers were also more likely to have aggressive disease (54.2 vs 28.6%; P = 0.011), as defined by a preoperative PSA ≥20 ng/mL, pathological Gleason score ≥ (4+3) and/or presence of regional/distant disease. At a mean follow-up of 7 months, we found no significant association between HOXB13 mutation status and biochemical recurrence in this cohort of men who underwent RP. This is the first study to investigate the HOXB13 G84E mutation in Danish men. The mutation was detected in 0.49% of controls and in 2.51% of cases, and was associated with 5.12-fold increased RR of being diagnosed with PCa. In our RP cohort, HOXB13 mutation carriers were more likely to develop aggressive PCa. Further studies are needed to assess the potential of HOXB13 for future targeted screening approaches. © 2016 The Authors BJU International © 2016 BJU International Published by John Wiley & Sons Ltd.

Carriers of the Complex Allele HFE c.[187C>G;340+4T>C] Have Increased Risk of Iron Overload in São Miguel Island Population (Azores, Portugal)

PubMed Central

Bulhões, Sara; Brilhante, Maria José; Pereirinha, Tânia; Cabral, Rita; Rego, Ana Catarina; Fraga, Cristina; Miguel, António G.; Brasil, Gracinda; Macedo, Paula; Mota-Vieira, Luisa

2015-01-01

Iron overload is associated with acquired and genetic conditions, the most common being hereditary hemochromatosis (HH) type-I, caused by HFE mutations. Here, we conducted a hospital-based case-control study of 41 patients from the São Miguel Island (Azores, Portugal), six belonging to a family with HH type-I pseudodominant inheritance, and 35 unrelated individuals fulfilling the biochemical criteria of iron overload compatible with HH type-I. For this purpose, we analyzed the most common HFE mutations– c.845G>A [p.Cys282Tyr], c.187C>G [p.His63Asp], and c.193A>T [p.Ser65Cys]. Results revealed that the family’s HH pseudodominant pattern is due to consanguineous marriage of HFE-c.845G>A carriers, and to marriage with a genetically unrelated spouse that is a -c.187G carrier. Regarding unrelated patients, six were homozygous for c.845A, and three were c.845A/c.187G compound heterozygous. We then performed sequencing of HFE exons 2, 4, 5 and their intron-flanking regions. No other mutations were observed, but we identified the -c.340+4C [IVS2+4C] splice variant in 26 (74.3%) patients. Functionally, the c.340+4C may generate alternative splicing by HFE exon 2 skipping and consequently, a protein missing the α1-domain essential for HFE/ transferrin receptor-1 interactions. Finally, we investigated HFE mutations configuration with iron overload by determining haplotypes and genotypic profiles. Results evidenced that carriers of HFE-c.187G allele also carry -c.340+4C, suggesting in-cis configuration. This data is corroborated by the association analysis where carriers of the complex allele HFE-c.[187C>G;340+4T>C] have an increased iron overload risk (RR = 2.08, 95% CI = 1.40−2.94, p<0.001). Therefore, homozygous for this complex allele are at risk of having iron overload because they will produce two altered proteins—the p.63Asp [c.187G], and the protein lacking 88 amino acids encoded by exon 2. In summary, we provide evidence that the complex allele HFE-c.[187C>G

Female Sexual Dysfunction in Presymptomatic Mutation Carriers and Patients with Huntington's Disease.

PubMed

Kolenc, Matej; Kobal, Jan; Podnar, Simon

2017-01-01

Although in Huntington's disease (HD) movement, cognition, and personality are most significantly affected, autonomic dysfunction should not be neglected. In women with HD sexual dysfunction has not been adequately studied yet. To report sexual dysfunction in a systematically studied cohort of female HD patients and compare it with controls of a similar age. In female HD patients and presymptomatic HD mutation carriers, we compared the Female Sexual Function Index (FSFI) questionnaire, neurologic assessment using the Unified Huntington's Disease Rating Scale (UHDRS) and the Total Functional Capacity (TFC). Of 44 female HD patients and 9 presymptomatic HD mutation carriers, 30 HD patients and 8 HD mutation carriers responded our invitation to complete FFSI questionnaire. Finally, 23 HD women with a partner were compared to 47 controls with a partner. HD patients had more problems with sexual arousal, lubrication, orgasm and sexual satisfaction. By contrast, we found no difference in sexual desire and pain. Sexual dysfunction progressed in parallel with the decline in the TFC; severe sexual dysfunction occurred with TFC <7/13. Our study demonstrated a significant impact of HD on female sexual function that progressed with patients' functional decline and impaired patients' quality of life. Sexual dysfunction may be caused by progression of the disease itself, side effects of medication, and comorbidities like depression or dementia.

Clinical and molecular effect on offspring of a marriage of consanguineous spinocerebellar ataxia type 7 mutation carriers: a family case report

PubMed Central

Magaña, Jonathan J; Tapia-Guerrero, Yessica S; Velázquez-Pérez, Luis; Cruz-Mariño, Tania; Cerecedo-Zapata, Cesar M; Gómez, Rocío; Murillo-Melo, Nadia M; González-Piña, Rigoberto; Hernández-Hernández, Oscar; Cisneros, Bulmaro

2014-01-01

Spinocerebellar ataxia type 7 (SCA7) is a genetic disorder characterized by degeneration of the cerebellum, brainstem, and retina that is caused by abnormal expansion of a CAG repeat located in the ATXN7 gene encoding sequence on chromosome 3p21.1. Although SCA7 is an uncommon autosomal dominant ataxia, we previously found increased prevalence of the disease in a Southeastern Mexican population. In this study, we described to our knowledge for the first time a marriage of consanguineous SCA7 mutation carriers and their offspring effect. We characterized a severely affected infantile-onset female patient whose parents and two siblings exhibited no symptoms of the disease at time of diagnosis. A comprehensive clinical analysis of the proband showed a progressive cerebellar syndrome, including gait ataxia, movement disorders, and saccadic movements, as well as hyperreflexia, visual deterioration, urinary and cardiovascular dysfunction, and impaired nerve conduction. The SCA7 mutation was detected in the proband patient. Subsequently, genetic examination using four ATXN7 gene-linked markers (three centromeric microsatellite markers [D3S1228, D3S1287, and D3S3635] and an intragenic Single Nucleotide Polymorphism [SNP-3145G/A]) revealed that the proband descends from a couple of consanguineous SCA7 mutation carriers. Genotyping analysis demonstrated that all offspring inherited only one mutant allele, and that the severe infantile-onset phenotype is caused by germinal expansion (from 37 to 72 CAG repeats) of the paternal mutant allele. Interestingly, the couple also referred a miscarriage. Finally, we found no CAA interruptions in the ATXN7 gene CAG repeats tract in this family, which might explain, at least in part, the triplet instability in the proband. PMID:25664129

AURKA F31I Polymorphism and Breast Cancer Risk in BRCA1 and BRCA2 Mutation Carriers: A CIMBA study

PubMed Central

Couch, Fergus J.; Sinilnikova, Olga; Vierkant, Robert A; Pankratz, V. Shane; Fredericksen, Zachary S.; Stoppa-Lyonnet, Dominique; Coupier, Isabelle; Hughes, David; Hardouin, Agnès; Berthet, Pascaline; Peock, Susan; Cook, Margaret; Baynes, Caroline; Hodgson, Shirley; Morrison, Patrick J.; Porteous, Mary E.; Jakubowska, Anna; Lubinski, Jan; Gronwald, Jacek; Spurdle, Amanda B.; Schmutzler, Rita; Versmold, Beatrix; Engel, Christoph; Meindl, Alfons; Sutter, Christian; Horst, Jurgen; Schaefer, Dieter; Offit, Kenneth; Kirchhoff, Tomas; Andrulis, Irene L.; Ilyushik, Eduard; Glendon, Gordon; Devilee, Peter; Vreeswijk, Maaike P.G.; Vasen, Hans F.A.; Borg, Ake; Backenhorn, Katja; Struewing, Jeffery P.; Greene, Mark H.; Neuhausen, Susan L.; Rebbeck, Timothy R.; Nathanson, Katherine; Domchek, Susan; Wagner, Theresa; Garber, Judy E.; Szabo, Csilla; Zikan, Michal; Foretova, Lenka; Olson, Janet E.; Sellers, Thomas A.; Lindor, Noralane; Nevanlinna, Heli; Tommiska, Johanna; Aittomaki, Kristiina; Hamann, Ute; Rashid, Muhammad U.; Torres, Diana; Simard, Jacques; Durocher, Francine; Guenard, Frederic; Lynch, Henry T.; Isaacs, Claudine; Weitzel, Jeffrey; Olopade, Olufunmilayo I.; Narod, Steven; Daly, Mary B.; Godwin, Andrew K.; Tomlinson, Gail; Easton, Douglas F.; Chenevix-Trench, Georgia; Antoniouon, Antonis C.

2009-01-01

The AURKA oncogene is associated with abnormal chromosome segregation and aneuploidy and predisposition to cancer. Amplification of AURKA has been detected at higher frequency in tumors from BRCA1 and BRCA2 mutation carriers than in sporadic breast tumors, suggesting that overexpression of AURKA and inactivation of BRCA1 and BRCA2 co-operate during tumor development and progression. The F31I polymorphism in AURKA has been associated with breast cancer risk in the homozygous state in prior studies. We evaluated whether the AURKA F31I polymorphism modifies breast cancer risk in BRCA1 and BRCA2 mutation carriers from the Consortium of Investigators of Modifiers of BRCA1/2 (CIMBA). CIMBA was established to provide sufficient statistical power through increased numbers of mutation carriers to identify polymorphisms that act as modifiers of cancer risk and can refine breast cancer risk estimates in BRCA1 and BRCA2 mutation carriers. A total of 4935 BRCA1 and 2241 BRCA2 mutation carriers and 11 individuals carrying both BRCA1 and BRCA2 mutations were genotyped for F31I. Overall, homozygosity for the 31I allele was not significantly associated with breast cancer risk in BRCA1 and BRCA2 carriers combined (HR = 0.91; 95% CI 0.77-1.06). Similarly, no significant association was seen in BRCA1 (HR = 0.90; 95% CI 0.75-1.08) or BRCA2 carriers (HR = 0.93; 95% CI 0.67-1.29) or when assessing the modifying effects of either bilateral prophylactic oophorectomy or menopausal status of BRCA1 and BRCA2 carriers. In summary, the F31I polymorphism in AURKA is not associated with a modified risk of breast cancer in BRCA1 and BRCA2 carriers. PMID:17627006

Baseline results from the UK SIGNIFY study: a whole-body MRI screening study in TP53 mutation carriers and matched controls.

PubMed

Saya, Sibel; Killick, Emma; Thomas, Sarah; Taylor, Natalie; Bancroft, Elizabeth K; Rothwell, Jeanette; Benafif, Sarah; Dias, Alexander; Mikropoulos, Christos; Pope, Jenny; Chamberlain, Anthony; Gunapala, Ranga; Izatt, Louise; Side, Lucy; Walker, Lisa; Tomkins, Susan; Cook, Jackie; Barwell, Julian; Wiles, Vicki; Limb, Lauren; Eccles, Diana; Leach, Martin O; Shanley, Susan; Gilbert, Fiona J; Hanson, Helen; Gallagher, David; Rajashanker, Bala; Whitehouse, Richard W; Koh, Dow-Mu; Sohaib, S Aslam; Evans, D Gareth; Eeles, Rosalind A

2017-07-01

In the United Kingdom, current screening guidelines for TP53 germline mutation carriers solely recommends annual breast MRI, despite the wide spectrum of malignancies typically seen in this group. This study sought to investigate the role of one-off non-contrast whole-body MRI (WB MRI) in the screening of asymptomatic TP53 mutation carriers. 44 TP53 mutation carriers and 44 population controls were recruited. Scans were read by radiologists blinded to participant carrier status. The incidence of malignancies diagnosed in TP53 mutation carriers against general population controls was calculated. The incidences of non-malignant relevant disease and irrelevant disease were measured, as well as the number of investigations required to determine relevance of findings. In TP53 mutation carriers, 6 of 44 (13.6, 95% CI 5.2-27.4%) participants were diagnosed with cancer during the study, all of which would be considered life threatening if untreated. Two were found to have two primary cancers. Two participants with cancer had abnormalities on the MRI which were initially thought to be benign (a pericardial cyst and a uterine fibroid) but transpired to be sarcomas. No controls were diagnosed with cancer. Fifteen carriers (34.1, 95% CI 20.5-49.9%) and seven controls (15.9, 95% CI 6.7-30.1%) underwent further investigations following the WB MRI for abnormalities that transpired to be benign (p = 0.049). The cancer detection rate in this group justifies a minimum baseline non-contrast WB MRI in germline TP53 mutation carriers. This should be adopted into national guidelines for management of adult TP53 mutation carriers in addition to the current practice of contrast enhanced breast MRI imaging.

Smoking and physical inactivity increase cancer prevalence in BRCA-1 and BRCA-2 mutation carriers: results from a retrospective observational analysis.

PubMed

Grill, Sabine; Yahiaoui-Doktor, Maryam; Dukatz, Ricarda; Lammert, Jacqueline; Ullrich, Mirjam; Engel, Christoph; Pfeifer, Katharina; Basrai, Maryam; Siniatchkin, Michael; Schmidt, Thorsten; Weisser, Burkhard; Rhiem, Kerstin; Ditsch, Nina; Schmutzler, Rita; Bischoff, Stephan C; Halle, Martin; Kiechle, Marion

2017-12-01

The aim of this analysis in a pilot study population was to investigate whether we can verify seemingly harmful lifestyle factors such as nicotine and alcohol indulgence, obesity, and physical inactivity, as well as a low socioeconomic status for increased cancer prevalence in a cohort of BRCA 1 and 2 mutation carriers. The analysis data are derived from 68 participants of the lifestyle intervention study LIBRE-1, a randomized, prospective trial that aimed to test the feasibility of a lifestyle modification in BRCA 1 and 2 mutation carriers. At study entry, factors such as medical history, lifestyle behavior, and socioeconomic status were retrospectively documented by interview and the current BMI was determined by clinical examination. The baseline measurements were compared within the cohort, and presented alongside reference values for the German population. Study participants indicating a higher physical activity during their adolescence showed a significantly lower cancer prevalence (p = 0.019). A significant difference in cancer occurrence was observed in those who smoked prior to the disease, and those who did not smoke (p < 0.001). Diseased mutation carriers tended to have a lower BMI compared to non-diseased mutation carriers (p = 0.079), whereas non-diseased revealed a significantly higher physical activity level than diseased mutation carriers (p = 0.046). The present data in this small cohort of 68 mutation carriers suggest that smoking and low physical activity during adolescence are risk factors for developing breast cancer in women with BRCA1 or BRCA2 mutation. Further data of the ongoing LIBRE 2 study are necessary to confirm these findings in a larger cohort of 600 mutation carriers.

G119S ace-1 mutation conferring insecticide resistance detected in the Culex pipiens complex in Morocco.

PubMed

Bkhache, Meriem; Tmimi, Fatim-Zohra; Charafeddine, Omar; Benabdelkrim Filali, Oumama; Lemrani, Meryem; Labbé, Pierrick; Sarih, M'hammed

2018-06-09

Arboviruses are controlled through insecticide control of their mosquito vector. However, inconsiderate use of insecticides often results in the selection of resistance in treated populations, so that monitoring is required to optimize their usage. Here, Culex pipiens (West Nile and Rift Valley Fever virus vector) specimens were collected from four Moroccan cities. Levels of susceptibility to the organophosphate (OP) insecticide malathion were assessed using WHO-recommended bioassays. Individual mosquitoes were tested for the presence of the G119S mutation in the ace-1 gene, the main OP-target resistance mutation. Bioassays showed that mosquitoes from Mohammedia were significantly more resistant to malathion than those from Marrakech. Analyzing the ace-1 genotypes in dead and surviving individuals suggested that other resistance mechanisms may be present in Mohammedia. The ace-1 resistance allele frequencies were relatively moderate (<0.4). Their analyses in three Moroccan cities (Tangier, Casablanca and Marrakech) however showed disparities between two coexisting Cx. pipiens forms and revealed that the G119S mutation tends to be more frequent in urban than in rural collections sites. These findings provide a reference assessment of OP resistance in Morocco and should help the health authorities to develop informed and sustainable vector control programs. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Risks of Breast, Ovarian, and Contralateral Breast Cancer for BRCA1 and BRCA2 Mutation Carriers.

PubMed

Kuchenbaecker, Karoline B; Hopper, John L; Barnes, Daniel R; Phillips, Kelly-Anne; Mooij, Thea M; Roos-Blom, Marie-José; Jervis, Sarah; van Leeuwen, Flora E; Milne, Roger L; Andrieu, Nadine; Goldgar, David E; Terry, Mary Beth; Rookus, Matti A; Easton, Douglas F; Antoniou, Antonis C; McGuffog, Lesley; Evans, D Gareth; Barrowdale, Daniel; Frost, Debra; Adlard, Julian; Ong, Kai-Ren; Izatt, Louise; Tischkowitz, Marc; Eeles, Ros; Davidson, Rosemarie; Hodgson, Shirley; Ellis, Steve; Nogues, Catherine; Lasset, Christine; Stoppa-Lyonnet, Dominique; Fricker, Jean-Pierre; Faivre, Laurence; Berthet, Pascaline; Hooning, Maartje J; van der Kolk, Lizet E; Kets, Carolien M; Adank, Muriel A; John, Esther M; Chung, Wendy K; Andrulis, Irene L; Southey, Melissa; Daly, Mary B; Buys, Saundra S; Osorio, Ana; Engel, Christoph; Kast, Karin; Schmutzler, Rita K; Caldes, Trinidad; Jakubowska, Anna; Simard, Jacques; Friedlander, Michael L; McLachlan, Sue-Anne; Machackova, Eva; Foretova, Lenka; Tan, Yen Y; Singer, Christian F; Olah, Edith; Gerdes, Anne-Marie; Arver, Brita; Olsson, Håkan

2017-06-20

The clinical management of BRCA1 and BRCA2 mutation carriers requires accurate, prospective cancer risk estimates. To estimate age-specific risks of breast, ovarian, and contralateral breast cancer for mutation carriers and to evaluate risk modification by family cancer history and mutation location. Prospective cohort study of 6036 BRCA1 and 3820 BRCA2 female carriers (5046 unaffected and 4810 with breast or ovarian cancer or both at baseline) recruited in 1997-2011 through the International BRCA1/2 Carrier Cohort Study, the Breast Cancer Family Registry and the Kathleen Cuningham Foundation Consortium for Research into Familial Breast Cancer, with ascertainment through family clinics (94%) and population-based studies (6%). The majority were from large national studies in the United Kingdom (EMBRACE), the Netherlands (HEBON), and France (GENEPSO). Follow-up ended December 2013; median follow-up was 5 years. BRCA1/2 mutations, family cancer history, and mutation location. Annual incidences, standardized incidence ratios, and cumulative risks of breast, ovarian, and contralateral breast cancer. Among 3886 women (median age, 38 years; interquartile range [IQR], 30-46 years) eligible for the breast cancer analysis, 5066 women (median age, 38 years; IQR, 31-47 years) eligible for the ovarian cancer analysis, and 2213 women (median age, 47 years; IQR, 40-55 years) eligible for the contralateral breast cancer analysis, 426 were diagnosed with breast cancer, 109 with ovarian cancer, and 245 with contralateral breast cancer during follow-up. The cumulative breast cancer risk to age 80 years was 72% (95% CI, 65%-79%) for BRCA1 and 69% (95% CI, 61%-77%) for BRCA2 carriers. Breast cancer incidences increased rapidly in early adulthood until ages 30 to 40 years for BRCA1 and until ages 40 to 50 years for BRCA2 carriers, then remained at a similar, constant incidence (20-30 per 1000 person-years) until age 80 years. The cumulative ovarian cancer risk to age 80 years was 44

Breast and Ovarian Cancer Risk and Risk Reduction in Jewish BRCA1/2 Mutation Carriers

PubMed Central

Finkelman, Brian S.; Rubinstein, Wendy S.; Friedman, Sue; Friebel, Tara M.; Dubitsky, Shera; Schonberger, Niecee Singer; Shoretz, Rochelle; Singer, Christian F.; Blum, Joanne L.; Tung, Nadine; Olopade, Olufunmilayo I.; Weitzel, Jeffrey N.; Lynch, Henry T.; Snyder, Carrie; Garber, Judy E.; Schildkraut, Joellen; Daly, Mary B.; Isaacs, Claudine; Pichert, Gabrielle; Neuhausen, Susan L.; Couch, Fergus J.; van't Veer, Laura; Eeles, Rosalind; Bancroft, Elizabeth; Evans, D. Gareth; Ganz, Patricia A.; Tomlinson, Gail E.; Narod, Steven A.; Matloff, Ellen; Domchek, Susan; Rebbeck, Timothy R.

2012-01-01

Purpose Mutations in BRCA1/2 dramatically increase the risk of both breast and ovarian cancers. Three mutations in these genes (185delAG, 5382insC, and 6174delT) occur at high frequency in Ashkenazi Jews. We evaluated how these common Jewish mutations (CJMs) affect cancer risks and risk reduction. Methods Our cohort comprised 4,649 women with disease-associated BRCA1/2 mutations from 22 centers in the Prevention and Observation of Surgical End Points Consortium. Of these women, 969 were self-identified Jewish women. Cox proportional hazards models were used to estimate breast and ovarian cancer risks, as well as risk reduction from risk-reducing salpingo-oophorectomy (RRSO), by CJM and self-identified Jewish status. Results Ninety-one percent of Jewish BRCA1/2-positive women carried a CJM. Jewish women were significantly more likely to undergo RRSO than non-Jewish women (54% v 41%, respectively; odds ratio, 1.87; 95% CI, 1.44 to 2.42). Relative risks of cancer varied by CJM, with the relative risk of breast cancer being significantly lower in 6174delT mutation carriers than in non-CJM BRCA2 carriers (hazard ratio, 0.35; 95% CI, 0.18 to 0.69). No significant difference was seen in cancer risk reduction after RRSO among subgroups. Conclusion Consistent with previous results, risks for breast and ovarian cancer varied by CJM in BRCA1/2 carriers. In particular, 6174delT carriers had a lower risk of breast cancer. This finding requires additional confirmation in larger prospective and population-based cohort studies before being integrated into clinical care. PMID:22430266

A Novel Method to Screen for Dominant Negative ATM Mutations in Familial Breast Cancer

DTIC Science & Technology

2005-04-01

carry dominant negative mutation in ATM due to natural variation amongst LCLs. Microarrays have been performed to determine differences in gene expression... genes that are altered in their expression in ATMmutation carriers. The validation of this data in carriers of different ATM mutation indicated that the...heterozygous carriers of T727 1 G mutation display a gene expression phenotype that appears identical to carriers of protein truncating mutations in

Carrier Diagnosis

MedlinePlus

... the potential to provide falsely reassuring or incorrect information to women who may indeed be carriers. Genetic tests such as mutation analysis look directly for the altered gene that’s responsible ...

Evaluation of chromosome 6p22 as a breast cancer risk modifier locus in a follow-up study of BRCA2 mutation carriers

PubMed Central

Stevens, Kristen N.; Wang, Xianshu; Fredericksen, Zachary; Pankratz, Vernon S.; Greene, Mark H.; Andrulis, Irene L.; Thomassen, Mads; Caligo, Maria; Nathanson, Katherine L.; Jakubowska, Anna; Osorio, Ana; Hamann, Ute; Godwin, Andrew K.; Stoppa-Lyonnet, Dominique; Southey, Melissa; Buys, Saundra S.; Singer, Christian F.; Hansen, Thomas V.O.; Arason, Adalgeir; Offit, Kenneth; Piedmonte, Marion; Montagna, Marco; Imyanitov, Evgeny; Tihomirova, Laima; Sucheston, Lara; Beattie, Mary; Neuhausen, Susan L.; Szabo, Csilla I.; Simard, Jacques; Spurdle, Amanda B.; Healey, Sue; Chen, Xiaoqing; Rebbeck, Timothy R.; Easton, Douglas F.; Chenevix-Trench, Georgia; Antoniou, Antonis C; Couch, Fergus J.

2012-01-01

Several common germline variants identified through genome-wide association studies of breast cancer risk in the general population have recently been shown to be associated with breast cancer risk for BRCA1 and/or BRCA2 mutation carriers. When combined, these variants can identify marked differences in the absolute risk of developing breast cancer for mutation carriers, suggesting that additional modifier loci may further enhance individual risk assessment for BRCA1 and BRCA2 mutation carriers. Recently, a common variant on 6p22 (rs9393597) was found to be associated with increased breast cancer risk for BRCA2 mutation carriers [Hazard ratio (HR)=1.55, 95% CI 1.25–1.92, p=6.0×10−5]. This observation was based on data from GWAS studies in which, despite statistical correction for multiple comparisons, the possibility of false discovery remains a concern. Here we report on an analysis of this variant in an additional 6,165 BRCA1 and 3,900 BRCA2 mutation carriers from the Consortium of Investigators of Modifiers of BRCA1/2 (CIMBA). In this replication analysis, rs9393597 was not associated with breast cancer risk for BRCA2 mutation carriers [HR=1.09, 95% CI 0.96–1.24, p=0.18]. No association with ovarian cancer risk for BRCA1 or BRCA2 mutation carriers or with breast cancer risk for BRCA1 mutation carriers was observed. This follow-up study suggests that, contrary to our initial report, this variant is not associated with breast cancer risk among individuals with germline BRCA2 mutations. PMID:23011509

Risk of colorectal cancer for people with a mutation in both a MUTYH and a DNA mismatch repair gene.

PubMed

Win, Aung Ko; Reece, Jeanette C; Buchanan, Daniel D; Clendenning, Mark; Young, Joanne P; Cleary, Sean P; Kim, Hyeja; Cotterchio, Michelle; Dowty, James G; MacInnis, Robert J; Tucker, Katherine M; Winship, Ingrid M; Macrae, Finlay A; Burnett, Terrilea; Le Marchand, Loïc; Casey, Graham; Haile, Robert W; Newcomb, Polly A; Thibodeau, Stephen N; Lindor, Noralane M; Hopper, John L; Gallinger, Steven; Jenkins, Mark A

2015-12-01

The base excision repair protein, MUTYH, functionally interacts with the DNA mismatch repair (MMR) system. As genetic testing moves from testing one gene at a time, to gene panel and whole exome next generation sequencing approaches, understandin g the risk associated with co-existence of germline mutations in these genes will be important for clinical interpretation and management. From the Colon Cancer Family Registry, we identified 10 carriers who had both a MUTYH mutation (6 with c.1187G>A p.(Gly396Asp), 3 with c.821G>A p.(Arg274Gln), and 1 with c.536A>G p.(Tyr179Cys)) and a MMR gene mutation (3 in MLH1, 6 in MSH2, and 1 in PMS2), 375 carriers of a single (monoallelic) MUTYH mutation alone, and 469 carriers of a MMR gene mutation alone. Of the 10 carriers of both gene mutations, 8 were diagnosed with colorectal cancer. Using a weighted cohort analysis, we estimated that risk of colorectal cancer for carriers of both a MUTYH and a MMR gene mutation was substantially higher than that for carriers of a MUTYH mutation alone [hazard ratio (HR) 21.5, 95% confidence interval (CI) 9.19-50.1; p < 0.001], but not different from that for carriers of a MMR gene mutation alone (HR 1.94, 95% CI 0.63-5.99; p = 0.25). Within the limited power of this study, there was no evidence that a monoallelic MUTYH gene mutation confers additional risk of colorectal cancer for carriers of a MMR gene mutation alone. Our finding suggests MUTYH mutation testing in MMR gene mutation carriers is not clinically informative.

First Report of the 23S rRNA Gene A2058G Point Mutation Associated With Macrolide Resistance in Treponema pallidum From Syphilis Patients in Cuba.

PubMed

Noda, Angel A; Matos, Nelvis; Blanco, Orestes; Rodríguez, Islay; Stamm, Lola Virginia

2016-05-01

This study aimed to assess the presence of macrolide-resistant Treponema pallidum subtypes in Havana, Cuba. Samples from 41 syphilis patients were tested for T. pallidum 23S rRNA gene mutations. Twenty-five patients (61%) harbored T. pallidum with the A2058G mutation, which was present in all 8 subtypes that were identified. The A2059G mutation was not detected.

Identification of a founder BRCA1 mutation in the Moroccan population.

PubMed

Quiles, F; Teulé, À; Martinussen Tandstad, N; Feliubadaló, L; Tornero, E; Del Valle, J; Menéndez, M; Salinas, M; Wethe Rognlien, V; Velasco, A; Izquierdo, A; Capellá, G; Brunet, J; Lázaro, C

2016-10-01

Breast cancer (BC) is the most frequent cancer among women in Morocco. However, the role of the most prevalent BC-predisposing genes, BRCA1 and BRCA2, has been largely unexplored. To help define the role of BRCA1 in BC in Morocco, we characterized the first potential BRCA1 founder mutation in this population. Genetic testing of BRCA1 and BRCA2 in BC high-risk families identified mutation BRCA1 c.5309G>T, p.(Gly1770Val) or G1770V in five independent families from Morocco, suggesting a founder effect. To confirm this hypothesis, haplotype construction was performed using seven intragenic and flanking BRCA1 microsatellite markers. Clinical data were also compiled. Clinical data from carriers of mutation G1770V correspond to data from carriers of BRCA1 pathogenic mutations. Microsatellite analysis showed a common haplotype for the five families in a region comprising 1.54 Mb, confirming G1770V as the first specific founder BRCA1 mutation in the Moroccan population. Our findings contribute to a better understanding of BC genetics in the Moroccan population. Nevertheless, comprehensive studies of mutation G1770V in large series of BC patients from Morocco are needed to assess the real prevalence of this mutation and to improve genetic testing and risk assessment in this population. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

High prevalence of exon 8 G533C mutation in apparently sporadic medullary thyroid carcinoma in Greece.

PubMed

Sarika, H L; Papathoma, A; Garofalaki, M; Vasileiou, V; Vlassopoulou, B; Anastasiou, E; Alevizaki, M

2012-12-01

Genetic screening for ret mutation has become routine practice in the evaluation of medullary thyroid carcinoma (MTC). Approximately 25% of these tumours are familial, and they occur as components of the multiple endocrine neoplasia type 2 syndromes (MEN 2A and 2B) or familial MTC. In familial cases, the majority of mutations are found in exons 10, 11, 13, 14 or 15 of the ret gene. A rare mutation involving exon 8 (G533C) has recently been reported in familial cases of MTC in Brazil and Greece; some of these cases were originally thought to be sporadic. The aim of this study was to re-evaluate a series of sporadic cases of MTC, with negative family history, and screen them for germline mutations in exon 8. Genomic DNA was extracted from peripheral lymphocytes in 129 unrelated individuals who had previously been characterized as 'sporadic' based on the negative family history and negative screening for ret gene mutations. Samples were analysed in Applied Biosystems 7500 real-time PCR and confirmed by sequencing. The G533C exon 8 mutation was identified in 10 of 129 patients with sporadic MTC. Asymptomatic gene carriers were subsequently identified in other family members. In our study, we found that 7·75% patients with apparently sporadic MTC do carry G533C mutation involving exon 8 of ret. We feel that there is now a need to include exon 8 mutation screening in all patients diagnosed as sporadic MTC, in Greece. © 2012 Blackwell Publishing Ltd.

Is 2D speckle tracking echocardiography useful for detecting and monitoring myocardial dysfunction in adult m.3243A>G carriers? - a retrospective pilot study.

PubMed

Koene, S; Timmermans, J; Weijers, G; de Laat, P; de Korte, C L; Smeitink, J A M; Janssen, M C H; Kapusta, L

2017-03-01

Cardiomyopathy is a common complication of mitochondrial disorders, associated with increased mortality. Two dimensional speckle tracking echocardiography (2DSTE) can be used to quantify myocardial deformation. Here, we aimed to determine the usefulness of 2DSTE in detecting and monitoring subtle changes in myocardial dysfunction in carriers of the 3243A>G mutation in mitochondrial DNA. In this retrospective pilot study, 30 symptomatic and asymptomatic carriers of the mitochondrial 3243A>G mutation of whom two subsequent echocardiograms were available were included. We measured longitudinal, circumferential and radial strain using 2DSTE. Results were compared to published reference values. Speckle tracking was feasible in 90 % of the patients for longitudinal strain. Circumferential and radial strain showed low face validity (low number of images with sufficient quality; suboptimal tracking) and were therefore rejected for further analysis. Global longitudinal strain showed good face validity, and was abnormal in 56-70 % (depending on reference values used) of the carriers (n = 27). Reproducibility was good (mean difference of 0.83 for inter- and 0.40 for intra-rater reproducibility; ICC 0.78 and 0.89, respectively). The difference between the first and the second measurement exceeded the measurement variance in 39 % of the cases (n = 23; feasibility of follow-up 77 %). Even in data collected as part of clinical care, two-dimensional strain echocardiography seems a feasible method to detect and monitor subtle changes in longitudinal myocardial deformation in adult carriers of the mitochondrial 3243A>G mutation. Based on our data and the reported accuracy of global longitudinal strain in other studies, we suggest the use of global longitudinal strain in a prospective follow-up or intervention study.

LRRK2 modulates vulnerability to mitochondrial dysfunction in C. elegans

PubMed Central

Saha, Shamol; Guillily, Maria; Ferree, Andrew; Lanceta, Joel; Chan, Diane; Ghosh, Joy; Hsu, Cindy H.; Segal, Lilach; Raghavan, Kesav; Matsumoto, Kunihiro; Hisamoto, Naoki; Kuwahara, Tomoki; Iwatsubo, Takeshi; Moore, Landon; Goldstein, Lee; Cookson, Mark; Wolozin, Benjamin

2009-01-01

Summary Mutations in leucine rich repeat kinase 2 (LRRK2) cause autosomal dominant familial Parkinson’s disease. We generated lines of C. elegans expressing neuronally directed human LRRK2. Expressing human LRRK2 expression increased nematode survival in response to rotenone or paraquat, which are agents that cause mitochondrial dysfunction. Protection by G2019S, R1441C or kinase dead LRRK2 was less than protection by wild type LRRK2. Knockdown of lrk-1, the endogenous orthologue of LRRK2 in C. elegans, reduced survival associated with mitochondrial dysfunction. C. elegans expressing LRRK2 showed rapid loss of dopaminergic markers (DAT∷GFP fluorescence and dopamine levels) beginning in early adulthood. Loss of dopaminergic markers was greater for the G2019S LRRK2 line than for the WT line. Rotenone treatment induced a larger loss of dopamine markers in C. elegans expressing G2019S LRRK2 than in C. elegans expressing WT LRRK2; however loss of dopaminergic markers in the G2019S LRRK2 nematode lines was not statistically different than that in the control line. These data suggest that LRRK2 plays an important role in modulating the response to mitochondrial inhibition, and raises the possibility that mutations in LRRK2 selectively enhance the vulnerability of dopaminergic neurons to a stressor associated with Parkinson’s disease. PMID:19625511

Genetic analysis of LRRK2 functional domains in Brazilian patients with Parkinson's disease.

PubMed

Abdalla-Carvalho, C B; Santos-Rebouças, C B; Guimarães, B C; Campos, M; Pereira, J S; de Rosso, A L Zuma; Nicaretta, D H; Marinho e Silva, M; dos Santos, Mendonça J; Pimentel, M M G

2010-12-01

Mutations in the leucine-rich repeat kinase 2 gene (LRRK2) have been associated with Parkinson's disease (PD), and the majority of the pathogenic variants are located in the ROC and MAPKKK domains. Exons 29-31 and 38-44 (ROC and MAPKKK domains) were sequenced in 204 patients with PD, mostly Brazilian. We identified four polymorphisms, a novel silent variant p.R1398R and four substitutions: p.T1410M, p.G2019S, p.Y2189C and the novel variant p.C2139S. The most prevalent mutation was the p.G2019S (2.4%). We consider that the p.T1410M and the p.Y2189C variants are probably polymorphisms and that the p.C2139S mutation is potentially pathogenic. © 2010 The Author(s). European Journal of Neurology © 2010 EFNS.

Dietary intake and breast cancer among carriers and noncarriers of BRCA mutations in the Korean Hereditary Breast Cancer Study.

PubMed

Ko, Kwang-Pil; Kim, Sung-Won; Ma, Sung Hyun; Park, Boyoung; Ahn, Younjhin; Lee, Jong Won; Lee, Min Hyuk; Kang, Eunyoung; Kim, Lee Su; Jung, Yongsik; Cho, Young Up; Lee, ByoungKil; Lin, Jennifer H; Park, Sue K

2013-12-01

Soy intake is associated with a lower risk of breast cancer. However, it is unclear whether the same reduction in risk associated with high soy intake is also applicable to familial or genetic breast cancer. The aim of this study was to assess the dietary factors among carriers and noncarriers of BRCA mutations in the Korean Hereditary Breast Cancer Study (KOHBRA). The KOHBRA Study is an ongoing project composed of affected breast cancer patients and familial members of breast cancer cases with BRCA mutations. To assess the association between dietary diversity and breast cancer risk, an HR was estimated by comparing affected subjects with their familial nonaffected members. To assess the interaction between the combination of BRCA mutation and diet diversity, the case-only OR (COR) was estimated by comparing BRCA mutation carriers and noncarriers only in affected subjects. Soy product intake was associated with a lower risk of breast cancer in carriers (HR: 0.39; 95% CI: 0.19, 0.79 for the highest quartile). The highest quartile of meat intake was associated with a higher risk of breast cancer regardless of BRCA mutation in carriers (HR: 1.97; 95% CI: 1.13, 3.44) and noncarriers (95% CI: 1.41; 1.12, 1.78). The associations of meat intake and soybean intake for breast cancer were more prominent in BRCA2 mutation carriers. In the analysis with only cases, the highest quartile of soy intake, but not meat intake, was associated with BRCA-related breast cancer (COR: 0.57; 95% CI: 0.36, 0.91). Our study suggests that soy product consumption is associated with lower breast cancer risk and it had an interaction with BRCA mutation.

A nonsynonymous polymorphism in IRS1 modifies risk of developing breast and ovarian cancers in BRCA1 and ovarian cancer in BRCA2 mutation carriers.

PubMed

Ding, Yuan C; McGuffog, Lesley; Healey, Sue; Friedman, Eitan; Laitman, Yael; Paluch-Shimon, Shani-; Kaufman, Bella; Liljegren, Annelie; Lindblom, Annika; Olsson, Håkan; Kristoffersson, Ulf; Stenmark-Askmalm, Marie; Melin, Beatrice; Domchek, Susan M; Nathanson, Katherine L; Rebbeck, Timothy R; Jakubowska, Anna; Lubinski, Jan; Jaworska, Katarzyna; Durda, Katarzyna; Gronwald, Jacek; Huzarski, Tomasz; Cybulski, Cezary; Byrski, Tomasz; Osorio, Ana; Cajal, Teresa Ramóny; Stavropoulou, Alexandra V; Benítez, Javier; Hamann, Ute; Rookus, Matti; Aalfs, Cora M; de Lange, Judith L; Meijers-Heijboer, Hanne E J; Oosterwijk, Jan C; van Asperen, Christi J; Gómez García, Encarna B; Hoogerbrugge, Nicoline; Jager, Agnes; van der Luijt, Rob B; Easton, Douglas F; Peock, Susan; Frost, Debra; Ellis, Steve D; Platte, Radka; Fineberg, Elena; Evans, D Gareth; Lalloo, Fiona; Izatt, Louise; Eeles, Ros; Adlard, Julian; Davidson, Rosemarie; Eccles, Diana; Cole, Trevor; Cook, Jackie; Brewer, Carole; Tischkowitz, Marc; Godwin, Andrew K; Pathak, Harsh; Stoppa-Lyonnet, Dominique; Sinilnikova, Olga M; Mazoyer, Sylvie; Barjhoux, Laure; Léoné, Mélanie; Gauthier-Villars, Marion; Caux-Moncoutier, Virginie; de Pauw, Antoine; Hardouin, Agnès; Berthet, Pascaline; Dreyfus, Hélène; Ferrer, Sandra Fert; Collonge-Rame, Marie-Agnès; Sokolowska, Johanna; Buys, Saundra; Daly, Mary; Miron, Alex; Terry, Mary Beth; Chung, Wendy; John, Esther M; Southey, Melissa; Goldgar, David; Singer, Christian F; Tea, Muy-Kheng Maria; Gschwantler-Kaulich, Daphne; Fink-Retter, Anneliese; Hansen, Thomas V O; Ejlertsen, Bent; Johannsson, Oskar T; Offit, Kenneth; Sarrel, Kara; Gaudet, Mia M; Vijai, Joseph; Robson, Mark; Piedmonte, Marion R; Andrews, Lesley; Cohn, David; DeMars, Leslie R; DiSilvestro, Paul; Rodriguez, Gustavo; Toland, Amanda Ewart; Montagna, Marco; Agata, Simona; Imyanitov, Evgeny; Isaacs, Claudine; Janavicius, Ramunas; Lazaro, Conxi; Blanco, Ignacio; Ramus, Susan J; Sucheston, Lara; Karlan, Beth Y; Gross, Jenny; Ganz, Patricia A; Beattie, Mary S; Schmutzler, Rita K; Wappenschmidt, Barbara; Meindl, Alfons; Arnold, Norbert; Niederacher, Dieter; Preisler-Adams, Sabine; Gadzicki, Dorotehea; Varon-Mateeva, Raymonda; Deissler, Helmut; Gehrig, Andrea; Sutter, Christian; Kast, Karin; Nevanlinna, Heli; Aittomäki, Kristiina; Simard, Jacques; Spurdle, Amanda B; Beesley, Jonathan; Chen, Xiaoqing; Tomlinson, Gail E; Weitzel, Jeffrey; Garber, Judy E; Olopade, Olufunmilayo I; Rubinstein, Wendy S; Tung, Nadine; Blum, Joanne L; Narod, Steven A; Brummel, Sean; Gillen, Daniel L; Lindor, Noralane; Fredericksen, Zachary; Pankratz, Vernon S; Couch, Fergus J; Radice, Paolo; Peterlongo, Paolo; Greene, Mark H; Loud, Jennifer T; Mai, Phuong L; Andrulis, Irene L; Glendon, Gord; Ozcelik, Hilmi; Gerdes, Anne-Marie; Thomassen, Mads; Jensen, Uffe Birk; Skytte, Anne-Bine; Caligo, Maria A; Lee, Andrew; Chenevix-Trench, Georgia; Antoniou, Antonis C; Neuhausen, Susan L

2012-08-01

We previously reported significant associations between genetic variants in insulin receptor substrate 1 (IRS1) and breast cancer risk in women carrying BRCA1 mutations. The objectives of this study were to investigate whether the IRS1 variants modified ovarian cancer risk and were associated with breast cancer risk in a larger cohort of BRCA1 and BRCA2 mutation carriers. IRS1 rs1801123, rs1330645, and rs1801278 were genotyped in samples from 36 centers in the Consortium of Investigators of Modifiers of BRCA1/2 (CIMBA). Data were analyzed by a retrospective cohort approach modeling the associations with breast and ovarian cancer risks simultaneously. Analyses were stratified by BRCA1 and BRCA2 status and mutation class in BRCA1 carriers. Rs1801278 (Gly972Arg) was associated with ovarian cancer risk for both BRCA1 (HR, 1.43; 95% confidence interval (CI), 1.06-1.92; P = 0.019) and BRCA2 mutation carriers (HR, 2.21; 95% CI, 1.39-3.52, P = 0.0008). For BRCA1 mutation carriers, the breast cancer risk was higher in carriers with class II mutations than class I mutations (class II HR, 1.86; 95% CI, 1.28-2.70; class I HR, 0.86; 95%CI, 0.69-1.09; P(difference), 0.0006). Rs13306465 was associated with ovarian cancer risk in BRCA1 class II mutation carriers (HR, 2.42; P = 0.03). The IRS1 Gly972Arg single-nucleotide polymorphism, which affects insulin-like growth factor and insulin signaling, modifies ovarian cancer risk in BRCA1 and BRCA2 mutation carriers and breast cancer risk in BRCA1 class II mutation carriers. These findings may prove useful for risk prediction for breast and ovarian cancers in BRCA1 and BRCA2 mutation carriers. ©2012 AACR.

A Novel Founder Mutation in MYBPC3: Phenotypic Comparison With the Most Prevalent MYBPC3 Mutation in Spain.

PubMed

Sabater-Molina, María; Saura, Daniel; García-Molina Sáez, Esperanza; González-Carrillo, Josefa; Polo, Luis; Pérez-Sánchez, Inmaculada; Olmo, María Del Carmen; Oliva-Sandoval, María José; Barriales-Villa, Roberto; Carbonell, Pablo; Pascual-Figal, Domigo; Gimeno, Juan R

2017-02-01

Mutations in MYBPC3 are the cause of hypertrophic cardiomyopathy (HCM). Although most lead to a truncating protein, the severity of the phenotype differs. We describe the clinical phenotype of a novel MYBPC3 mutation, p.Pro108Alafs*9, present in 13 families from southern Spain and compare it with the most prevalent MYBPC3 mutation in this region (c.2308+1 G>A). We studied 107 relatives of 13 index cases diagnosed as HCM carriers of the p.Pro108Alafs*9 mutation. Pedigree analysis, clinical evaluation, and genotyping were performed. A total of 54 carriers of p.Pro108Alafs*9 were identified, of whom 39 had HCM. There were 5 cases of sudden death in the 13 families. Disease penetrance was greater as age increased and HCM patients were more frequently male and developed disease earlier than female patients. The phenotype was similar in p.Pro108Alafs*9 and in c.2308+1 G>A, but differences were found in several risk factors and in survival. There was a trend toward a higher left ventricular mass in p.Pro108Alafs*9 vs c.2308+1G>A. Cardiac magnetic resonance revealed a similar extent and pattern of fibrosis. The p.Pro108Alafs*9 mutation is associated with HCM, high penetrance, and disease onset in middle age. Copyright © 2016 Sociedad Española de Cardiología. Published by Elsevier España, S.L.U. All rights reserved.

Ethnic heterogeneity and cystic fibrosis transmembrane regulator (CFTR) mutation frequencies in Chicago-area CF families

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ober, C.; Lester, L.A.; Mott, C.

1992-12-01

The identification of a common mutation, [Delta]F508, in the CFTR gene allowed, for the first time, the detection of cystic fibrosis (CF) carriers in the general population. Further genetic studies revealed >100 additional disease-causing mutations in this gene, few of which occur on >1% of CF chromosomes in any ethnic group. Prior to establishing counseling guidelines and carrier risk assessments, the authors sought to establish the frequencies of the CFTR mutations that are present in CF families living in the Chicago are, a region notable for its ethnic heterogeneity. Their sample included 283 unrelated CF carriers, with the following ethnicmore » composition: 78% non-Ashkenazi Caucasians, 5% Ashkenazi, 9% African-American, 3% Mexican, 0.3% Native American, and 5% mixed ancestry. When a panel of 10 mutations ([Delta]F508, [Delta]I507, G542X, G551D, R553X, S549N, R1162X, W1282X, N1303K, and 1717-1G[r arrow]A) was used, detection rates ranged from 75% in non-Ashkenazi Caucasians to 40% in African-Americans. These data suggest that the goal of screening for 90%-95% of CF mutations may be unrealistic in this and other, similar US populations. 22 refs., 1 tab.« less

[Clinical-genetic care of BRCA-mutation carrier women: prevention, diagnosis and therapy].

PubMed

Nagy, Zsolt; Csanád, Mónika; Tóth, Katalin; Máté, Szabolcs; Joó, József Gábor

2011-06-05

Predictive genetics opens a considerable perspective in the diagnostics as well as the treatment of breast and ovarian cancer. Current recommendations and guidelines for the management of BRCA 1 and BRCA 2 mutation carriers are not based on controlled randomized trials, but on expert opinions. The existing options of prevention, early diagnosis and treatment must be clearly interpreted to the patient. In the context of a dedicated genetic counseling the participation of all involved professionals (geneticist, oncologist, surgeon, gynecologist) is required. The decision-making process concerning the possibilities of prevention, diagnosis and treatment is always deeply influenced by the patient's own experience with the cancer occurred in the family, as well as by her values and expectations of life. The focused multidisciplinary approach, with the application of results from prospective studies in cohorts of BRCA mutation carriers allow the concerned individuals to benefit from this kind of approach of medical treatment.

Identification of three novel LRRK2 mutations associated with Parkinson's disease in a Calabrian population.

PubMed

Anfossi, Maria; Colao, Rosanna; Gallo, Maura; Bernardi, Livia; Conidi, M Elena; Frangipane, Francesca; Vasso, Franca; Puccio, Gianfranco; Clodomiro, Alessandra; Mirabelli, Maria; Curcio, Sabrina A M; Torchia, Giusi; Smirne, Nicoletta; Di Lorenzo, Raffaele; Maletta, Raffaele; Bruni, Amalia C

2014-01-01

LRRK2 mutations are common in familial and sporadic Parkinson's disease (PD) cases. We present a screening of the most frequently mutated exons of LRRK2 in Calabrian population. Eighty-eight PD patients diagnosed according to standard criteria, underwent screening for LRRK2 mutations in exons 19, 21, 24, 25, 27, 29, 31, 32, 33, 35, 38, 40, 41, and 48. Eight LRRK2 variations were identified in nine patients affected by PD, including three novel missense variations (p.Phe1227Leu, p.Gly1520Ala, p.Ile2020Ser) and five previously identified mutations (p.Ala1151Thr, IVS31+3A>G, p.Arg1514Gln, p.Gly2019Ser, p.Thr2356Ile). LRRK2 frequency mutations were approximately 10.2% in all PD patients, 12% in familial, 8% in sporadic cases. The p.Gly2019Ser mutation was found in 2.3% of the total cohort and in 3.2% of sporadic cases. The clinical features of LRRK2-associated with PD in our patients were similar to those of idiopathic PD although most LRRK2 mutated patients presented with bradykinesia instead of tremor; 33.3% developed dementia. We identified three novel LRRK2 mutations and reported a higher frequency in Calabria compared to previously reported data possibly due to the relative genetic isolation of the Calabrian population. These findings contribute to the understanding of the role of LRKK2 variations in PD and provide additional genetic insight into this disease.

TRPC6 G757D Loss-of-Function Mutation Associates with FSGS

PubMed Central

Riehle, Marc; Büscher, Anja K.; Gohlke, Björn-Oliver; Kaßmann, Mario; Kolatsi-Joannou, Maria; Bräsen, Jan H.; Nagel, Mato; Becker, Jan U.; Winyard, Paul; Hoyer, Peter F.; Preissner, Robert; Krautwurst, Dietmar; Gollasch, Maik

2016-01-01

FSGS is a CKD with heavy proteinuria that eventually progresses to ESRD. Hereditary forms of FSGS have been linked to mutations in the transient receptor potential cation channel, subfamily C, member 6 (TRPC6) gene encoding a nonselective cation channel. Most of these TRPC6 mutations cause a gain-of-function phenotype, leading to calcium–triggered podocyte cell death, but the underlying molecular mechanisms are unclear. We studied the molecular effect of disease-related mutations using tridimensional in silico modeling of tetrameric TRPC6. Our results indicated that G757 is localized in a domain forming a TRPC6-TRPC6 interface and predicted that the amino acid exchange G757D causes local steric hindrance and disruption of the channel complex. Notably, functional characterization of model interface domain mutants suggested a loss-of-function phenotype. We then characterized 19 human FSGS–related TRPC6 mutations, the majority of which caused gain-of-function mutations. However, five mutations (N125S, L395A, G757D, L780P, and R895L) caused a loss-of-function phenotype. Coexpression of wild-type TRPC6 and TRPC6 G757D, mimicking heterozygosity observed in patients, revealed a dominant negative effect of TRPC6 G757D. Our comprehensive analysis of human disease–causing TRPC6 mutations reveals loss of TRPC6 function as an additional concept of hereditary FSGS and provides molecular insights into the mechanism responsible for the loss-of-function phenotype of TRPC6 G757D in humans. PMID:26892346

[Leigh syndrome resulting from a de novo mitochondrial DNA mutation (T8993G)].

PubMed

Playán, A; Solano-Palacios, A; González de la Rosa, J B; Merino-Arribas, J M; Andreu, A L; López-Pérez, M; Montoya, J

Several degenerative neurological diseases are caused by mutations in the mitochondrial gene coding for subunit 6 of the ATPase. Thus, NARP (neurogenic weakness, ataxia, and retinitis pigmentosa) and Leigh syndromes are associated to a T8993G mutation when the percentage of mutant mitochondrial DNA is low (60 90%) or high (>90%), respectively. Leigh syndrome is also caused by a second mutation in the same position T8993C. The patient, a boy that died at 6 months, had generalized hypotonia, psychomotor delay, hepatomegaly, choreic movements and hyporreflexia. MRI showed hypodensities in the basal ganglia and brain stem as well as hyperlactacidemia. Molecular genetic analysis of the mitochondrial DNA showed that the patient had the T8993G mutation in a percentage higher than 95%. No mutated DNA was detected in blood of the proband s mother, maternal aunt and grandmother. The point mutation T8993G may occur de novo, at high levels, causing neurodegenerative diseases.

Co-existence of breast and ovarian cancers in BRCA germ-line mutation carriers

PubMed Central

Dilawari, A; Cangiarella, J; Smith, J; Huang, A; Downey, A; Muggia, F

2008-01-01

The co-existence of breast and ovarian cancers in the same individual should raise suspicion of a hereditary process. Patients with either BRCA1 or BRCA2 germ-line mutations have an average risk of 39% and 11% respectively of developing ovarian cancer by the age of 70; they have a risk of 35–85% of developing breast cancer in their lifetime. We report here unusual pathologic features in a BRCA2 germ-line mutation carrier recently diagnosed with synchronous breast and ovarian cancers, and summarize the findings in six other women who were diagnosed with ovarian cancer either simultaneously with the diagnosis of breast cancer or at varying times after the diagnosis. While in most instances this may be a coincidental occurrence in highly susceptible individuals, the patient we highlight raises the provocative hypothesis that at times breast cancer metastasizes to the ovaries of mutation carriers and stimulates the development of an ovarian cancer as well as other cancers. In addition, these ovarian cancers may have different mechanisms of metastases predisposing them to travel to unusual sites. PMID:22275985

Citrullinemia type I, classical variant. Identification of ASS-p~G390R (c.1168G>A) mutation in families of a limited geographic area of Argentina: a possible population cluster.

PubMed

Laróvere, Laura E; Angaroni, Celia J; Antonozzi, Sandra L; Bezard, Miriam B; Shimohama, Mariko; de Kremer, Raquel Dodelson

2009-07-01

Citrullinemia type I (CTLN1) is an urea cycle defect caused by mutations in the argininosuccinate synthetase gene. We report the first identification in Argentina of patients with CTLN1 in a limited geographic area. Molecular analysis in patient/relatives included PCR, sequencing and restriction enzyme assay. The studied families showed the same mutation: ASS~p.G390R, associated with the early-onset/severe phenotype. We postulate a possible population cluster. A program to know the carrier frequency in that population is in progress.

Emergence of EGFR G724S mutation in EGFR-mutant lung adenocarcinoma post progression on osimertinib.

PubMed

Oztan, A; Fischer, S; Schrock, A B; Erlich, R L; Lovly, C M; Stephens, P J; Ross, J S; Miller, V; Ali, S M; Ou, S-H I; Raez, L E

2017-09-01

Mutations in the epidermal growth factor receptor (EGFR) are drivers for a subset of lung cancers. Osimertinib is a third-generation tyrosine kinase inhibitor (TKI) recently approved for the treatment of T790M-positive non-small cell lung cancer (NSCLC); however, acquired resistance to osimertinib is evident and resistance mechanisms remain incompletely defined. The EGFR G724S mutation was detected using hybrid-capture based comprehensive genomic profiling (CGP) and a hybrid-capture based circulating tumor DNA (ctDNA) assays in two cases of EGFR-driven lung adenocarcinoma in patients who had progressed on osimertinib treatment. This study demonstrates the importance of both tissue and blood based hybrid-capture based genomic profiling at disease progression to identifying novel resistance mechanisms in the clinic. Copyright © 2017 Elsevier B.V. All rights reserved.

The carrier rate and mutation spectrum of genes associated with hearing loss in South China hearing female population of childbearing age

PubMed Central

2013-01-01

Background Given that hearing loss occurs in 1 to 3 of 1,000 live births and approximately 90 to 95 percent of them are born into hearing families, it is of importance and necessity to get better understanding about the carrier rate and mutation spectrum of genes associated with hearing impairment in the general population. Methods 7,263 unrelated women of childbearing age with normal hearing and without family history of hearing loss were tested with allele-specific PCR-based universal array. Further genetic testing were provided to the spouses of the screened carriers. For those couples at risk, multiple choices were provided, including prenatal diagnosis. Results Among the 7,263 normal hearing participants, 303 subjects carried pathogenic mutations included in the screening chip, which made the carrier rate 4.17%. Of the 303 screened carriers, 282 harbored heterozygous mutated genes associated with autosomal recessive hearing loss, and 95 spouses took further genetic tests. 8 out of the 9 couples harbored deafness-causing mutations in the same gene received prenatal diagnosis. Conclusions Given that nearly 90 to 95 percent of deaf and hard-of-hearing babies are born into hearing families, better understanding about the carrier rate and mutation spectrum of genes associated with hearing impairment in the female population of childbearing age may be of importance in carrier screening and genetic counseling. PMID:23718755

The carrier rate and mutation spectrum of genes associated with hearing loss in South China hearing female population of childbearing age.

PubMed

Yin, Aihua; Liu, Chang; Zhang, Yan; Wu, Jing; Mai, Mingqin; Ding, Hongke; Yang, Jiexia; Zhang, Xiaozhuang

2013-05-29

Given that hearing loss occurs in 1 to 3 of 1,000 live births and approximately 90 to 95 percent of them are born into hearing families, it is of importance and necessity to get better understanding about the carrier rate and mutation spectrum of genes associated with hearing impairment in the general population. 7,263 unrelated women of childbearing age with normal hearing and without family history of hearing loss were tested with allele-specific PCR-based universal array. Further genetic testing were provided to the spouses of the screened carriers. For those couples at risk, multiple choices were provided, including prenatal diagnosis. Among the 7,263 normal hearing participants, 303 subjects carried pathogenic mutations included in the screening chip, which made the carrier rate 4.17%. Of the 303 screened carriers, 282 harbored heterozygous mutated genes associated with autosomal recessive hearing loss, and 95 spouses took further genetic tests. 8 out of the 9 couples harbored deafness-causing mutations in the same gene received prenatal diagnosis. Given that nearly 90 to 95 percent of deaf and hard-of-hearing babies are born into hearing families, better understanding about the carrier rate and mutation spectrum of genes associated with hearing impairment in the female population of childbearing age may be of importance in carrier screening and genetic counseling.

A non-synonymous polymorphism in IRS1 modifies risk of developing breast and ovarian cancers in BRCA1 and ovarian cancer in BRCA2 mutation carriers

PubMed Central

Ding, Yuan C.; McGuffog, Lesley; Healey, Sue; Friedman, Eitan; Laitman, Yael; Shani-Shimon–Paluch; Kaufman, Bella; Liljegren, Annelie; Lindblom, Annika; Olsson, Håkan; Kristoffersson, Ulf; Stenmark-Askmalm, Marie; Melin, Beatrice; Domchek, Susan M.; Nathanson, Katherine L.; Rebbeck, Timothy R.; Jakubowska, Anna; Lubinski, Jan; Jaworska, Katarzyna; Durda, Katarzyna; Gronwald, Jacek; Huzarski, Tomasz; Cybulski, Cezary; Byrski, Tomasz; Osorio, Ana; Cajal, Teresa Ramóny; Stavropoulou, Alexandra V; Benítez, Javier; Hamann, Ute; Rookus, Matti; Aalfs, Cora M.; de Lange, Judith L.; Meijers-Heijboer, Hanne E.J.; Oosterwijk, Jan C.; van Asperen, Christi J.; García, Encarna B. Gómez; Hoogerbrugge, Nicoline; Jager, Agnes; van der Luijt, Rob B.; Easton, Douglas F.; Peock, Susan; Frost, Debra; Ellis, Steve D.; Platte, Radka; Fineberg, Elena; Evans, D. Gareth; Lalloo, Fiona; Izatt, Louise; Eeles, Ros; Adlard, Julian; Davidson, Rosemarie; Eccles, Diana; Cole, Trevor; Cook, Jackie; Brewer, Carole; Tischkowitz, Marc; Godwin, Andrew K.; Pathak, Harsh; Stoppa-Lyonnet, Dominique; Sinilnikova, Olga M.; Mazoyer, Sylvie; Barjhoux, Laure; Léoné, Mélanie; Gauthier-Villars, Marion; Caux-Moncoutier, Virginie; de Pauw, Antoine; Hardouin, Agnès; Berthet, Pascaline; Dreyfus, Hélène; Ferrer, Sandra Fert; Collonge-Rame, Marie-Agnès; Sokolowska, Johanna; Buys, Saundra; Daly, Mary; Miron, Alex; Terry, Mary Beth; Chung, Wendy; John, Esther M; Southey, Melissa; Goldgar, David; Singer, Christian F; Maria, Muy-Kheng Tea; Gschwantler-Kaulich, Daphne; Fink-Retter, Anneliese; Hansen, Thomas v. O.; Ejlertsen, Bent; Johannsson, Oskar Th.; Offit, Kenneth; Sarrel, Kara; Gaudet, Mia M.; Vijai, Joseph; Robson, Mark; Piedmonte, Marion R; Andrews, Lesley; Cohn, David; DeMars, Leslie R.; DiSilvestro, Paul; Rodriguez, Gustavo; Toland, Amanda Ewart; Montagna, Marco; Agata, Simona; Imyanitov, Evgeny; Isaacs, Claudine; Janavicius, Ramunas; Lazaro, Conxi; Blanco, Ignacio; Ramus, Susan J; Sucheston, Lara; Karlan, Beth Y.; Gross, Jenny; Ganz, Patricia A.; Beattie, Mary S.; Schmutzler, Rita K.; Wappenschmidt, Barbara; Meindl, Alfons; Arnold, Norbert; Niederacher, Dieter; Preisler-Adams, Sabine; Gadzicki, Dorotehea; Varon-Mateeva, Raymonda; Deissler, Helmut; Gehrig, Andrea; Sutter, Christian; Kast, Karin; Nevanlinna, Heli; Aittomäki, Kristiina; Simard, Jacques; Spurdle, Amanda B.; Beesley, Jonathan; Chen, Xiaoqing; Tomlinson, Gail E.; Weitzel, Jeffrey; Garber, Judy E.; Olopade, Olufunmilayo I.; Rubinstein, Wendy S.; Tung, Nadine; Blum, Joanne L.; Narod, Steven A.; Brummel, Sean; Gillen, Daniel L.; Lindor, Noralane; Fredericksen, Zachary; Pankratz, Vernon S.; Couch, Fergus J.; Radice, Paolo; Peterlongo, Paolo; Greene, Mark H.; Loud, Jennifer T.; Mai, Phuong L.; Andrulis, Irene L.; Glendon, Gord; Ozcelik, Hilmi; Gerdes, Anne-Marie; Thomassen, Mads; Jensen, Uffe Birk; Skytte, Anne-Bine; Caligo, Maria A.; Lee, Andrew; Chenevix-Trench, Georgia; Antoniou, Antonis C; Neuhausen, Susan L.

2012-01-01

Background We previously reported significant associations between genetic variants in insulin receptor substrate 1 (IRS1) and breast cancer risk in women carrying BRCA1 mutations. The objectives of this study were to investigate whether the IRS1 variants modified ovarian cancer risk and were associated with breast cancer risk in a larger cohort of BRCA1 and BRCA2 mutation carriers. Methods IRS1 rs1801123, rs1330645, and rs1801278 were genotyped in samples from 36 centers in the Consortium of Investigators of Modifiers of BRCA1/2 (CIMBA). Data were analyzed by a retrospective cohort approach modeling the associations with breast and ovarian cancer risks simultaneously. Analyses were stratified by BRCA1 and BRCA2 status and mutation class in BRCA1 carriers. Results Rs1801278 (Gly972Arg) was associated with ovarian cancer risk for both BRCA1 [Hazard ratio (HR) = 1.43; 95% CI: 1.06–1.92; p = 0.019] and BRCA2 mutation carriers (HR=2.21; 95% CI: 1.39–3.52, p=0.0008). For BRCA1 mutation carriers, the breast cancer risk was higher in carriers with class 2 mutations than class 1 (mutations (class 2 HR=1.86, 95% CI: 1.28–2.70; class 1 HR=0.86, 95%CI:0.69–1.09; p-for difference=0.0006). Rs13306465 was associated with ovarian cancer risk in BRCA1 class 2 mutation carriers (HR = 2.42; p = 0.03). Conclusion The IRS1 Gly972Arg SNP, which affects insulin-like growth factor and insulin signaling, modifies ovarian cancer risk in BRCA1 and BRCA2 mutation carriers and breast cancer risk in BRCA1 class 2 mutation carriers. Impact These findings may prove useful for risk prediction for breast and ovarian cancers in BRCA1 and BRCA2 mutation carriers. PMID:22729394

49 CFR 193.2019 - Mobile and temporary LNG facilities.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 49 Transportation 3 2011-10-01 2011-10-01 false Mobile and temporary LNG facilities. 193.2019... LIQUEFIED NATURAL GAS FACILITIES: FEDERAL SAFETY STANDARDS General § 193.2019 Mobile and temporary LNG facilities. (a) Mobile and temporary LNG facilities for peakshaving application, for service maintenance...

Risk of breast cancer after a diagnosis of ovarian cancer in BRCA mutation carriers: Is preventive mastectomy warranted?

PubMed

McGee, Jacob; Giannakeas, Vasily; Karlan, Beth; Lubinski, Jan; Gronwald, Jacek; Rosen, Barry; McLaughlin, John; Risch, Harvey; Sun, Ping; Foulkes, William D; Neuhausen, Susan L; Kotsopoulos, Joanne; Narod, Steven A

2017-05-01

Preventive breast surgery and MRI screening are offered to unaffected BRCA mutation carriers. The clinical benefit of these two modalities has not been evaluated among mutation carriers with a history of ovarian cancer. Thus, we sought to determine whether or not BRCA mutation carriers with ovarian cancer would benefit from preventive mastectomy or from MRI screening. First, the annual mortality rate for ovarian cancer patients was estimated for a cohort of 178 BRCA mutation carriers from Ontario, Canada. Next, the actuarial risk of developing breast cancer was estimated using an international registry of 509 BRCA mutation carriers with ovarian cancer. A series of simulations was conducted to evaluate the reduction in the probability of death (from all causes) associated with mastectomy and with MRI-based breast surveillance. Cox proportional hazards models were used to evaluate the impacts of mastectomy and MRI screening on breast cancer incidence as well as on all-cause mortality. Twenty (3.9%) of the 509 patients developed breast cancer within ten years following ovarian cancer diagnosis. The actuarial risk of developing breast cancer at ten years post-diagnosis, conditional on survival from ovarian cancer and other causes of mortality was 7.8%. Based on our simulation results, among all BRCA mutation-carrying patients diagnosed with stage III/IV ovarian cancer at age 50, the chance of dying before age 80 was reduced by less than 1% with MRI and by less than 2% with mastectomy. Greater improvements in survival with MRI or mastectomy were observed for women who had already survived 10years after ovarian cancer, and for women with stage I or II ovarian cancer. Among BRCA mutation-carrying ovarian cancer patients without a personal history of breast cancer, neither preventive mastectomy nor MRI screening is warranted, except for those who have survived ovarian cancer without recurrence for ten years and for those with early stage ovarian cancer. Copyright © 2017

Forest Service Global Change Research Strategy, 2009-2019 Implementation Plan

Treesearch

Allen Solomon; Richard A. Birdsey; Linda A. Joyce

2010-01-01

In keeping with the research goals of the U.S. Global Change Research Program, the climate change strategy of the U.S. Department of Agriculture (USDA), and the climate change framework of the Forest Service, this Forest Service Global Change Research Strategy, 2009-2019 Implementation Plan (hereafter called the Research Plan), was written by Forest Service Research...

14 CFR 380.11 - Payment to direct air carrier(s).

Code of Federal Regulations, 2010 CFR

2010-01-01

... carrier(s). Except for air taxi operators and commuter air carriers (which are governed by 14 CFR 298.38) and Canadian charter air taxi operators (which are governed by 14 CFR 294.32), the direct air carrier...

14 CFR 380.11 - Payment to direct air carrier(s).

Code of Federal Regulations, 2011 CFR

2011-01-01

... carrier(s). Except for air taxi operators and commuter air carriers (which are governed by 14 CFR 298.38) and Canadian charter air taxi operators (which are governed by 14 CFR 294.32), the direct air carrier...

Serum microRNAs in patients with genetic amyotrophic lateral sclerosis and pre-manifest mutation carriers.

PubMed

Freischmidt, Axel; Müller, Kathrin; Zondler, Lisa; Weydt, Patrick; Volk, Alexander E; Božič, Anže Lošdorfer; Walter, Michael; Bonin, Michael; Mayer, Benjamin; von Arnim, Christine A F; Otto, Markus; Dieterich, Christoph; Holzmann, Karlheinz; Andersen, Peter M; Ludolph, Albert C; Danzer, Karin M; Weishaupt, Jochen H

2014-11-01

Knowledge about the nature of pathomolecular alterations preceding onset of symptoms in amyotrophic lateral sclerosis is largely lacking. It could not only pave the way for the discovery of valuable therapeutic targets but might also govern future concepts of pre-manifest disease modifying treatments. MicroRNAs are central regulators of transcriptome plasticity and participate in pathogenic cascades and/or mirror cellular adaptation to insults. We obtained comprehensive expression profiles of microRNAs in the serum of patients with familial amyotrophic lateral sclerosis, asymptomatic mutation carriers and healthy control subjects. We observed a strikingly homogenous microRNA profile in patients with familial amyotrophic lateral sclerosis that was largely independent from the underlying disease gene. Moreover, we identified 24 significantly downregulated microRNAs in pre-manifest amyotrophic lateral sclerosis mutation carriers up to two decades or more before the estimated time window of disease onset; 91.7% of the downregulated microRNAs in mutation carriers overlapped with the patients with familial amyotrophic lateral sclerosis. Bioinformatic analysis revealed a consensus sequence motif present in the vast majority of downregulated microRNAs identified in this study. Our data thus suggest specific common denominators regarding molecular pathogenesis of different amyotrophic lateral sclerosis genes. We describe the earliest pathomolecular alterations in amyotrophic lateral sclerosis mutation carriers known to date, which provide a basis for the discovery of novel therapeutic targets and strongly argue for studies evaluating presymptomatic disease-modifying treatment in amyotrophic lateral sclerosis. © The Author (2014). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Carriers of the Complex Allele HFE c.[187C>G;340+4T>C] Have Increased Risk of Iron Overload in São Miguel Island Population (Azores, Portugal).

PubMed

Branco, Claudia C; Gomes, Cidália T; De Fez, Laura; Bulhões, Sara; Brilhante, Maria José; Pereirinha, Tânia; Cabral, Rita; Rego, Ana Catarina; Fraga, Cristina; Miguel, António G; Brasil, Gracinda; Macedo, Paula; Mota-Vieira, Luisa

2015-01-01

Iron overload is associated with acquired and genetic conditions, the most common being hereditary hemochromatosis (HH) type-I, caused by HFE mutations. Here, we conducted a hospital-based case-control study of 41 patients from the São Miguel Island (Azores, Portugal), six belonging to a family with HH type-I pseudodominant inheritance, and 35 unrelated individuals fulfilling the biochemical criteria of iron overload compatible with HH type-I. For this purpose, we analyzed the most common HFE mutations- c.845G>A [p.Cys282Tyr], c.187C>G [p.His63Asp], and c.193A>T [p.Ser65Cys]. Results revealed that the family's HH pseudodominant pattern is due to consanguineous marriage of HFE-c.845G>A carriers, and to marriage with a genetically unrelated spouse that is a -c.187G carrier. Regarding unrelated patients, six were homozygous for c.845A, and three were c.845A/c.187G compound heterozygous. We then performed sequencing of HFE exons 2, 4, 5 and their intron-flanking regions. No other mutations were observed, but we identified the -c.340+4C [IVS2+4C] splice variant in 26 (74.3%) patients. Functionally, the c.340+4C may generate alternative splicing by HFE exon 2 skipping and consequently, a protein missing the α1-domain essential for HFE/ transferrin receptor-1 interactions. Finally, we investigated HFE mutations configuration with iron overload by determining haplotypes and genotypic profiles. Results evidenced that carriers of HFE-c.187G allele also carry -c.340+4C, suggesting in-cis configuration. This data is corroborated by the association analysis where carriers of the complex allele HFE-c.[187C>G;340+4T>C] have an increased iron overload risk (RR = 2.08, 95% CI = 1.40-2.94, p<0.001). Therefore, homozygous for this complex allele are at risk of having iron overload because they will produce two altered proteins--the p.63Asp [c.187G], and the protein lacking 88 amino acids encoded by exon 2. In summary, we provide evidence that the complex allele HFE-c.[187C>G;340+4T

Correlation of ophthalmic examination with carrier status in females potentially harboring a severe Norrie disease gene mutation.

PubMed

Khan, Arif O; Aldahmesh, Mohammed A; Meyer, Brian

2008-04-01

To correlate ophthalmic findings with carrier status for a severe Norrie disease (ND) gene mutation (C95F). Prospective interventional case series. Six potential carriers and 1 obligate carrier from a family harboring the mutation. An ophthalmologist blind to the pedigree performed a full ophthalmic examination for the 7 asymptomatic family members. A peripheral blood sample was collected from each for ND gene sequencing. Ophthalmic examination findings (with attention to the presence or absence of retinal findings) and results of ND gene sequencing. Three carriers were identified by molecular genetics, and all 3 of them had peripheral retinal abnormality. However, 3 of the 4 genetically identified noncarriers also exhibited peripheral retinal abnormality. Two of these noncarriers with retinal findings were the offspring of a confirmed noncarrier. The genetically identified noncarrier with a normal peripheral retinal examination was the daughter of an obligate carrier. The presence of peripheral retinal changes was not useful for carrier prediction in a family harboring ND. There are likely additional loci responsible for phenotypic expression.

Fine-Scale Mapping at 9p22.2 Identifies Candidate Causal Variants That Modify Ovarian Cancer Risk in BRCA1 and BRCA2 Mutation Carriers

PubMed Central

Vigorito, Elena; Kuchenbaecker, Karoline B.; Beesley, Jonathan; Adlard, Julian; Agnarsson, Bjarni A.; Andrulis, Irene L.; Arun, Banu K.; Barjhoux, Laure; Belotti, Muriel; Benitez, Javier; Berger, Andreas; Bojesen, Anders; Bonanni, Bernardo; Brewer, Carole; Caldes, Trinidad; Caligo, Maria A.; Campbell, Ian; Chan, Salina B.; Claes, Kathleen B. M.; Cohn, David E.; Cook, Jackie; Daly, Mary B.; Damiola, Francesca; Davidson, Rosemarie; de Pauw, Antoine; Delnatte, Capucine; Diez, Orland; Domchek, Susan M.; Dumont, Martine; Durda, Katarzyna; Dworniczak, Bernd; Easton, Douglas F.; Eccles, Diana; Edwinsdotter Ardnor, Christina; Eeles, Ros; Ejlertsen, Bent; Ellis, Steve; Evans, D. Gareth; Feliubadalo, Lidia; Fostira, Florentia; Foulkes, William D.; Friedman, Eitan; Frost, Debra; Gaddam, Pragna; Ganz, Patricia A.; Garber, Judy; Garcia-Barberan, Vanesa; Gauthier-Villars, Marion; Gehrig, Andrea; Gerdes, Anne-Marie; Giraud, Sophie; Godwin, Andrew K.; Goldgar, David E.; Hake, Christopher R.; Hansen, Thomas V. O.; Healey, Sue; Hodgson, Shirley; Hogervorst, Frans B. L.; Houdayer, Claude; Hulick, Peter J.; Imyanitov, Evgeny N.; Isaacs, Claudine; Izatt, Louise; Izquierdo, Angel; Jacobs, Lauren; Jakubowska, Anna; Janavicius, Ramunas; Jaworska-Bieniek, Katarzyna; Jensen, Uffe Birk; John, Esther M.; Vijai, Joseph; Karlan, Beth Y.; Kast, Karin; Investigators, KConFab; Khan, Sofia; Kwong, Ava; Laitman, Yael; Lester, Jenny; Lesueur, Fabienne; Liljegren, Annelie; Lubinski, Jan; Mai, Phuong L.; Manoukian, Siranoush; Mazoyer, Sylvie; Meindl, Alfons; Mensenkamp, Arjen R.; Montagna, Marco; Nathanson, Katherine L.; Neuhausen, Susan L.; Nevanlinna, Heli; Niederacher, Dieter; Olah, Edith; Olopade, Olufunmilayo I.; Ong, Kai-ren; Osorio, Ana; Park, Sue Kyung; Paulsson-Karlsson, Ylva; Pedersen, Inge Sokilde; Peissel, Bernard; Peterlongo, Paolo; Pfeiler, Georg; Phelan, Catherine M.; Piedmonte, Marion; Poppe, Bruce; Pujana, Miquel Angel; Radice, Paolo; Rennert, Gad; Rodriguez, Gustavo C.; Rookus, Matti A.; Ross, Eric A.; Schmutzler, Rita Katharina; Simard, Jacques; Singer, Christian F.; Slavin, Thomas P.; Soucy, Penny; Southey, Melissa; Steinemann, Doris; Stoppa-Lyonnet, Dominique; Sukiennicki, Grzegorz; Sutter, Christian; Szabo, Csilla I.; Tea, Muy-Kheng; Teixeira, Manuel R.; Teo, Soo-Hwang; Terry, Mary Beth; Thomassen, Mads; Tibiletti, Maria Grazia; Tihomirova, Laima; Tognazzo, Silvia; van Rensburg, Elizabeth J.; Varesco, Liliana; Varon-Mateeva, Raymonda; Vratimos, Athanassios; Weitzel, Jeffrey N.; McGuffog, Lesley; Kirk, Judy; Toland, Amanda Ewart; Hamann, Ute; Lindor, Noralane; Ramus, Susan J.; Greene, Mark H.; Couch, Fergus J.; Offit, Kenneth; Pharoah, Paul D. P.; Chenevix-Trench, Georgia; Antoniou, Antonis C.

2016-01-01

Population-based genome wide association studies have identified a locus at 9p22.2 associated with ovarian cancer risk, which also modifies ovarian cancer risk in BRCA1 and BRCA2 mutation carriers. We conducted fine-scale mapping at 9p22.2 to identify potential causal variants in BRCA1 and BRCA2 mutation carriers. Genotype data were available for 15,252 (2,462 ovarian cancer cases) BRCA1 and 8,211 (631 ovarian cancer cases) BRCA2 mutation carriers. Following genotype imputation, ovarian cancer associations were assessed for 4,873 and 5,020 SNPs in BRCA1 and BRCA 2 mutation carriers respectively, within a retrospective cohort analytical framework. In BRCA1 mutation carriers one set of eight correlated candidate causal variants for ovarian cancer risk modification was identified (top SNP rs10124837, HR: 0.73, 95%CI: 0.68 to 0.79, p-value 2× 10−16). These variants were located up to 20 kb upstream of BNC2. In BRCA2 mutation carriers one region, up to 45 kb upstream of BNC2, and containing 100 correlated SNPs was identified as candidate causal (top SNP rs62543585, HR: 0.69, 95%CI: 0.59 to 0.80, p-value 1.0 × 10−6). The candidate causal in BRCA1 mutation carriers did not include the strongest associated variant at this locus in the general population. In sum, we identified a set of candidate causal variants in a region that encompasses the BNC2 transcription start site. The ovarian cancer association at 9p22.2 may be mediated by different variants in BRCA1 mutation carriers and in the general population. Thus, potentially different mechanisms may underlie ovarian cancer risk for mutation carriers and the general population. PMID:27463617

Fine-Scale Mapping at 9p22.2 Identifies Candidate Causal Variants That Modify Ovarian Cancer Risk in BRCA1 and BRCA2 Mutation Carriers.

PubMed

Vigorito, Elena; Kuchenbaecker, Karoline B; Beesley, Jonathan; Adlard, Julian; Agnarsson, Bjarni A; Andrulis, Irene L; Arun, Banu K; Barjhoux, Laure; Belotti, Muriel; Benitez, Javier; Berger, Andreas; Bojesen, Anders; Bonanni, Bernardo; Brewer, Carole; Caldes, Trinidad; Caligo, Maria A; Campbell, Ian; Chan, Salina B; Claes, Kathleen B M; Cohn, David E; Cook, Jackie; Daly, Mary B; Damiola, Francesca; Davidson, Rosemarie; Pauw, Antoine de; Delnatte, Capucine; Diez, Orland; Domchek, Susan M; Dumont, Martine; Durda, Katarzyna; Dworniczak, Bernd; Easton, Douglas F; Eccles, Diana; Edwinsdotter Ardnor, Christina; Eeles, Ros; Ejlertsen, Bent; Ellis, Steve; Evans, D Gareth; Feliubadalo, Lidia; Fostira, Florentia; Foulkes, William D; Friedman, Eitan; Frost, Debra; Gaddam, Pragna; Ganz, Patricia A; Garber, Judy; Garcia-Barberan, Vanesa; Gauthier-Villars, Marion; Gehrig, Andrea; Gerdes, Anne-Marie; Giraud, Sophie; Godwin, Andrew K; Goldgar, David E; Hake, Christopher R; Hansen, Thomas V O; Healey, Sue; Hodgson, Shirley; Hogervorst, Frans B L; Houdayer, Claude; Hulick, Peter J; Imyanitov, Evgeny N; Isaacs, Claudine; Izatt, Louise; Izquierdo, Angel; Jacobs, Lauren; Jakubowska, Anna; Janavicius, Ramunas; Jaworska-Bieniek, Katarzyna; Jensen, Uffe Birk; John, Esther M; Vijai, Joseph; Karlan, Beth Y; Kast, Karin; Investigators, KConFab; Khan, Sofia; Kwong, Ava; Laitman, Yael; Lester, Jenny; Lesueur, Fabienne; Liljegren, Annelie; Lubinski, Jan; Mai, Phuong L; Manoukian, Siranoush; Mazoyer, Sylvie; Meindl, Alfons; Mensenkamp, Arjen R; Montagna, Marco; Nathanson, Katherine L; Neuhausen, Susan L; Nevanlinna, Heli; Niederacher, Dieter; Olah, Edith; Olopade, Olufunmilayo I; Ong, Kai-Ren; Osorio, Ana; Park, Sue Kyung; Paulsson-Karlsson, Ylva; Pedersen, Inge Sokilde; Peissel, Bernard; Peterlongo, Paolo; Pfeiler, Georg; Phelan, Catherine M; Piedmonte, Marion; Poppe, Bruce; Pujana, Miquel Angel; Radice, Paolo; Rennert, Gad; Rodriguez, Gustavo C; Rookus, Matti A; Ross, Eric A; Schmutzler, Rita Katharina; Simard, Jacques; Singer, Christian F; Slavin, Thomas P; Soucy, Penny; Southey, Melissa; Steinemann, Doris; Stoppa-Lyonnet, Dominique; Sukiennicki, Grzegorz; Sutter, Christian; Szabo, Csilla I; Tea, Muy-Kheng; Teixeira, Manuel R; Teo, Soo-Hwang; Terry, Mary Beth; Thomassen, Mads; Tibiletti, Maria Grazia; Tihomirova, Laima; Tognazzo, Silvia; van Rensburg, Elizabeth J; Varesco, Liliana; Varon-Mateeva, Raymonda; Vratimos, Athanassios; Weitzel, Jeffrey N; McGuffog, Lesley; Kirk, Judy; Toland, Amanda Ewart; Hamann, Ute; Lindor, Noralane; Ramus, Susan J; Greene, Mark H; Couch, Fergus J; Offit, Kenneth; Pharoah, Paul D P; Chenevix-Trench, Georgia; Antoniou, Antonis C

2016-01-01

Population-based genome wide association studies have identified a locus at 9p22.2 associated with ovarian cancer risk, which also modifies ovarian cancer risk in BRCA1 and BRCA2 mutation carriers. We conducted fine-scale mapping at 9p22.2 to identify potential causal variants in BRCA1 and BRCA2 mutation carriers. Genotype data were available for 15,252 (2,462 ovarian cancer cases) BRCA1 and 8,211 (631 ovarian cancer cases) BRCA2 mutation carriers. Following genotype imputation, ovarian cancer associations were assessed for 4,873 and 5,020 SNPs in BRCA1 and BRCA 2 mutation carriers respectively, within a retrospective cohort analytical framework. In BRCA1 mutation carriers one set of eight correlated candidate causal variants for ovarian cancer risk modification was identified (top SNP rs10124837, HR: 0.73, 95%CI: 0.68 to 0.79, p-value 2× 10-16). These variants were located up to 20 kb upstream of BNC2. In BRCA2 mutation carriers one region, up to 45 kb upstream of BNC2, and containing 100 correlated SNPs was identified as candidate causal (top SNP rs62543585, HR: 0.69, 95%CI: 0.59 to 0.80, p-value 1.0 × 10-6). The candidate causal in BRCA1 mutation carriers did not include the strongest associated variant at this locus in the general population. In sum, we identified a set of candidate causal variants in a region that encompasses the BNC2 transcription start site. The ovarian cancer association at 9p22.2 may be mediated by different variants in BRCA1 mutation carriers and in the general population. Thus, potentially different mechanisms may underlie ovarian cancer risk for mutation carriers and the general population.

Assessing Associations between the AURKA-HMMR-TPX2-TUBG1 Functional Module and Breast Cancer Risk in BRCA1/2 Mutation Carriers

PubMed Central

Blanco, Ignacio; Kuchenbaecker, Karoline; Cuadras, Daniel; Wang, Xianshu; Barrowdale, Daniel; de Garibay, Gorka Ruiz; Librado, Pablo; Sánchez-Gracia, Alejandro; Rozas, Julio; Bonifaci, Núria; McGuffog, Lesley; Pankratz, Vernon S.; Islam, Abul; Mateo, Francesca; Berenguer, Antoni; Petit, Anna; Català, Isabel; Brunet, Joan; Feliubadaló, Lidia; Tornero, Eva; Benítez, Javier; Osorio, Ana; Cajal, Teresa Ramón y; Nevanlinna, Heli; Aittomäki, Kristiina; Arun, Banu K.; Toland, Amanda E.; Karlan, Beth Y.; Walsh, Christine; Lester, Jenny; Greene, Mark H.; Mai, Phuong L.; Nussbaum, Robert L.; Andrulis, Irene L.; Domchek, Susan M.; Nathanson, Katherine L.; Rebbeck, Timothy R.; Barkardottir, Rosa B.; Jakubowska, Anna; Lubinski, Jan; Durda, Katarzyna; Jaworska-Bieniek, Katarzyna; Claes, Kathleen; Van Maerken, Tom; Díez, Orland; Hansen, Thomas V.; Jønson, Lars; Gerdes, Anne-Marie; Ejlertsen, Bent; de la Hoya, Miguel; Caldés, Trinidad; Dunning, Alison M.; Oliver, Clare; Fineberg, Elena; Cook, Margaret; Peock, Susan; McCann, Emma; Murray, Alex; Jacobs, Chris; Pichert, Gabriella; Lalloo, Fiona; Chu, Carol; Dorkins, Huw; Paterson, Joan; Ong, Kai-Ren; Teixeira, Manuel R.; Hogervorst, Frans B. L.; van der Hout, Annemarie H.; Seynaeve, Caroline; van der Luijt, Rob B.; Ligtenberg, Marjolijn J. L.; Devilee, Peter; Wijnen, Juul T.; Rookus, Matti A.; Meijers-Heijboer, Hanne E. J.; Blok, Marinus J.; van den Ouweland, Ans M. W.; Aalfs, Cora M.; Rodriguez, Gustavo C.; Phillips, Kelly-Anne A.; Piedmonte, Marion; Nerenstone, Stacy R.; Bae-Jump, Victoria L.; O'Malley, David M.; Ratner, Elena S.; Schmutzler, Rita K.; Wappenschmidt, Barbara; Rhiem, Kerstin; Engel, Christoph; Meindl, Alfons; Ditsch, Nina; Arnold, Norbert; Plendl, Hansjoerg J.; Niederacher, Dieter; Sutter, Christian; Wang-Gohrke, Shan; Steinemann, Doris; Preisler-Adams, Sabine; Kast, Karin; Varon-Mateeva, Raymonda; Gehrig, Andrea; Bojesen, Anders; Pedersen, Inge Sokilde; Sunde, Lone; Jensen, Uffe Birk; Thomassen, Mads; Kruse, Torben A.; Foretova, Lenka; Peterlongo, Paolo; Bernard, Loris; Peissel, Bernard; Scuvera, Giulietta; Manoukian, Siranoush; Radice, Paolo; Ottini, Laura; Montagna, Marco; Agata, Simona; Maugard, Christine; Simard, Jacques; Soucy, Penny; Berger, Andreas; Fink-Retter, Anneliese; Singer, Christian F.; Rappaport, Christine; Geschwantler-Kaulich, Daphne; Tea, Muy-Kheng; Pfeiler, Georg; John, Esther M.; Miron, Alex; Neuhausen, Susan L.; Terry, Mary Beth; Chung, Wendy K.; Daly, Mary B.; Goldgar, David E.; Janavicius, Ramunas; Dorfling, Cecilia M.; van Rensburg, Elisabeth J.; Fostira, Florentia; Konstantopoulou, Irene; Garber, Judy; Godwin, Andrew K.; Olah, Edith; Narod, Steven A.; Rennert, Gad; Paluch, Shani Shimon; Laitman, Yael; Friedman, Eitan; Liljegren, Annelie; Rantala, Johanna; Stenmark-Askmalm, Marie; Loman, Niklas; Imyanitov, Evgeny N.; Hamann, Ute; Spurdle, Amanda B.; Healey, Sue; Weitzel, Jeffrey N.; Herzog, Josef; Margileth, David; Gorrini, Chiara; Esteller, Manel; Gómez, Antonio; Sayols, Sergi; Vidal, Enrique; Heyn, Holger; Stoppa-Lyonnet, Dominique; Léoné, Melanie; Barjhoux, Laure; Fassy-Colcombet, Marion; de Pauw, Antoine; Lasset, Christine; Ferrer, Sandra Fert; Castera, Laurent; Berthet, Pascaline; Cornelis, François; Bignon, Yves-Jean; Damiola, Francesca; Mazoyer, Sylvie; Maxwell, Christopher A.; Vijai, Joseph; Robson, Mark; Kauff, Noah; Corines, Marina J.; Villano, Danylko; Cunningham, Julie; Lee, Adam; Lindor, Noralane; Lázaro, Conxi; Easton, Douglas F.; Offit, Kenneth; Chenevix-Trench, Georgia; Couch, Fergus J.; Antoniou, Antonis C.; Pujana, Miguel Angel

2015-01-01

While interplay between BRCA1 and AURKA-RHAMM-TPX2-TUBG1 regulates mammary epithelial polarization, common genetic variation in HMMR (gene product RHAMM) may be associated with risk of breast cancer in BRCA1 mutation carriers. Following on these observations, we further assessed the link between the AURKA-HMMR-TPX2-TUBG1 functional module and risk of breast cancer in BRCA1 or BRCA2 mutation carriers. Forty-one single nucleotide polymorphisms (SNPs) were genotyped in 15,252 BRCA1 and 8,211 BRCA2 mutation carriers and subsequently analyzed using a retrospective likelihood approach. The association of HMMR rs299290 with breast cancer risk in BRCA1 mutation carriers was confirmed: per-allele hazard ratio (HR) = 1.10, 95% confidence interval (CI) 1.04 – 1.15, p = 1.9 x 10−4 (false discovery rate (FDR)-adjusted p = 0.043). Variation in CSTF1, located next to AURKA, was also found to be associated with breast cancer risk in BRCA2 mutation carriers: rs2426618 per-allele HR = 1.10, 95% CI 1.03 – 1.16, p = 0.005 (FDR-adjusted p = 0.045). Assessment of pairwise interactions provided suggestions (FDR-adjusted pinteraction values > 0.05) for deviations from the multiplicative model for rs299290 and CSTF1 rs6064391, and rs299290 and TUBG1 rs11649877 in both BRCA1 and BRCA2 mutation carriers. Following these suggestions, the expression of HMMR and AURKA or TUBG1 in sporadic breast tumors was found to potentially interact, influencing patients’ survival. Together, the results of this study support the hypothesis of a causative link between altered function of AURKA-HMMR-TPX2-TUBG1 and breast carcinogenesis in BRCA1/2 mutation carriers. PMID:25830658

Assessing associations between the AURKA-HMMR-TPX2-TUBG1 functional module and breast cancer risk in BRCA1/2 mutation carriers.

PubMed

Blanco, Ignacio; Kuchenbaecker, Karoline; Cuadras, Daniel; Wang, Xianshu; Barrowdale, Daniel; de Garibay, Gorka Ruiz; Librado, Pablo; Sánchez-Gracia, Alejandro; Rozas, Julio; Bonifaci, Núria; McGuffog, Lesley; Pankratz, Vernon S; Islam, Abul; Mateo, Francesca; Berenguer, Antoni; Petit, Anna; Català, Isabel; Brunet, Joan; Feliubadaló, Lidia; Tornero, Eva; Benítez, Javier; Osorio, Ana; Ramón y Cajal, Teresa; Nevanlinna, Heli; Aittomäki, Kristiina; Arun, Banu K; Toland, Amanda E; Karlan, Beth Y; Walsh, Christine; Lester, Jenny; Greene, Mark H; Mai, Phuong L; Nussbaum, Robert L; Andrulis, Irene L; Domchek, Susan M; Nathanson, Katherine L; Rebbeck, Timothy R; Barkardottir, Rosa B; Jakubowska, Anna; Lubinski, Jan; Durda, Katarzyna; Jaworska-Bieniek, Katarzyna; Claes, Kathleen; Van Maerken, Tom; Díez, Orland; Hansen, Thomas V; Jønson, Lars; Gerdes, Anne-Marie; Ejlertsen, Bent; de la Hoya, Miguel; Caldés, Trinidad; Dunning, Alison M; Oliver, Clare; Fineberg, Elena; Cook, Margaret; Peock, Susan; McCann, Emma; Murray, Alex; Jacobs, Chris; Pichert, Gabriella; Lalloo, Fiona; Chu, Carol; Dorkins, Huw; Paterson, Joan; Ong, Kai-Ren; Teixeira, Manuel R; Hogervorst, Frans B L; van der Hout, Annemarie H; Seynaeve, Caroline; van der Luijt, Rob B; Ligtenberg, Marjolijn J L; Devilee, Peter; Wijnen, Juul T; Rookus, Matti A; Meijers-Heijboer, Hanne E J; Blok, Marinus J; van den Ouweland, Ans M W; Aalfs, Cora M; Rodriguez, Gustavo C; Phillips, Kelly-Anne A; Piedmonte, Marion; Nerenstone, Stacy R; Bae-Jump, Victoria L; O'Malley, David M; Ratner, Elena S; Schmutzler, Rita K; Wappenschmidt, Barbara; Rhiem, Kerstin; Engel, Christoph; Meindl, Alfons; Ditsch, Nina; Arnold, Norbert; Plendl, Hansjoerg J; Niederacher, Dieter; Sutter, Christian; Wang-Gohrke, Shan; Steinemann, Doris; Preisler-Adams, Sabine; Kast, Karin; Varon-Mateeva, Raymonda; Gehrig, Andrea; Bojesen, Anders; Pedersen, Inge Sokilde; Sunde, Lone; Jensen, Uffe Birk; Thomassen, Mads; Kruse, Torben A; Foretova, Lenka; Peterlongo, Paolo; Bernard, Loris; Peissel, Bernard; Scuvera, Giulietta; Manoukian, Siranoush; Radice, Paolo; Ottini, Laura; Montagna, Marco; Agata, Simona; Maugard, Christine; Simard, Jacques; Soucy, Penny; Berger, Andreas; Fink-Retter, Anneliese; Singer, Christian F; Rappaport, Christine; Geschwantler-Kaulich, Daphne; Tea, Muy-Kheng; Pfeiler, Georg; John, Esther M; Miron, Alex; Neuhausen, Susan L; Terry, Mary Beth; Chung, Wendy K; Daly, Mary B; Goldgar, David E; Janavicius, Ramunas; Dorfling, Cecilia M; van Rensburg, Elisabeth J; Fostira, Florentia; Konstantopoulou, Irene; Garber, Judy; Godwin, Andrew K; Olah, Edith; Narod, Steven A; Rennert, Gad; Paluch, Shani Shimon; Laitman, Yael; Friedman, Eitan; Liljegren, Annelie; Rantala, Johanna; Stenmark-Askmalm, Marie; Loman, Niklas; Imyanitov, Evgeny N; Hamann, Ute; Spurdle, Amanda B; Healey, Sue; Weitzel, Jeffrey N; Herzog, Josef; Margileth, David; Gorrini, Chiara; Esteller, Manel; Gómez, Antonio; Sayols, Sergi; Vidal, Enrique; Heyn, Holger; Stoppa-Lyonnet, Dominique; Léoné, Melanie; Barjhoux, Laure; Fassy-Colcombet, Marion; de Pauw, Antoine; Lasset, Christine; Ferrer, Sandra Fert; Castera, Laurent; Berthet, Pascaline; Cornelis, François; Bignon, Yves-Jean; Damiola, Francesca; Mazoyer, Sylvie; Sinilnikova, Olga M; Maxwell, Christopher A; Vijai, Joseph; Robson, Mark; Kauff, Noah; Corines, Marina J; Villano, Danylko; Cunningham, Julie; Lee, Adam; Lindor, Noralane; Lázaro, Conxi; Easton, Douglas F; Offit, Kenneth; Chenevix-Trench, Georgia; Couch, Fergus J; Antoniou, Antonis C; Pujana, Miguel Angel

2015-01-01

While interplay between BRCA1 and AURKA-RHAMM-TPX2-TUBG1 regulates mammary epithelial polarization, common genetic variation in HMMR (gene product RHAMM) may be associated with risk of breast cancer in BRCA1 mutation carriers. Following on these observations, we further assessed the link between the AURKA-HMMR-TPX2-TUBG1 functional module and risk of breast cancer in BRCA1 or BRCA2 mutation carriers. Forty-one single nucleotide polymorphisms (SNPs) were genotyped in 15,252 BRCA1 and 8,211 BRCA2 mutation carriers and subsequently analyzed using a retrospective likelihood approach. The association of HMMR rs299290 with breast cancer risk in BRCA1 mutation carriers was confirmed: per-allele hazard ratio (HR) = 1.10, 95% confidence interval (CI) 1.04-1.15, p = 1.9 x 10(-4) (false discovery rate (FDR)-adjusted p = 0.043). Variation in CSTF1, located next to AURKA, was also found to be associated with breast cancer risk in BRCA2 mutation carriers: rs2426618 per-allele HR = 1.10, 95% CI 1.03-1.16, p = 0.005 (FDR-adjusted p = 0.045). Assessment of pairwise interactions provided suggestions (FDR-adjusted pinteraction values > 0.05) for deviations from the multiplicative model for rs299290 and CSTF1 rs6064391, and rs299290 and TUBG1 rs11649877 in both BRCA1 and BRCA2 mutation carriers. Following these suggestions, the expression of HMMR and AURKA or TUBG1 in sporadic breast tumors was found to potentially interact, influencing patients' survival. Together, the results of this study support the hypothesis of a causative link between altered function of AURKA-HMMR-TPX2-TUBG1 and breast carcinogenesis in BRCA1/2 mutation carriers.

Carbon-11-Pittsburgh compound B positron emission tomography imaging of amyloid deposition in presenilin 1 mutation carriers.

PubMed

Knight, William D; Okello, Aren A; Ryan, Natalie S; Turkheimer, Federico E; Rodríguez Martinez de Llano, Sofia; Edison, Paul; Douglas, Jane; Fox, Nick C; Brooks, David J; Rossor, Martin N

2011-01-01

(11)Carbon-Pittsburgh compound B positron emission tomography studies have suggested early and prominent amyloid deposition in the striatum in presenilin 1 mutation carriers. This cross-sectional study examines the (11)Carbon-Pittsburgh compound B positron emission tomography imaging profiles of presymptomatic and mildly affected (mini-mental state examination ≥ 20) carriers of seven presenilin 1 mutations, comparing them with groups of controls and symptomatic sporadic Alzheimer's disease cases. Parametric ratio images representing (11)Carbon-Pittsburgh compound B retention from 60 to 90 min were created using the pons as a reference region and nine regions of interest were studied. We confirmed that increased amyloid load may be detected in presymptomatic presenilin 1 mutation carriers with (11)Carbon-Pittsburgh compound B positron emission tomography and that the pattern of retention is heterogeneous. Comparison of presenilin 1 and sporadic Alzheimer's disease groups revealed significantly greater thalamic retention in the presenilin 1 group and significantly greater frontotemporal retention in the sporadic Alzheimer's disease group. A few individuals with presenilin 1 mutations showed increased cerebellar (11)Carbon-Pittsburgh compound B retention suggesting that this region may not be as suitable a reference region in familial Alzheimer's disease.

Genetic Diagnosis before Surgery has an Impact on Surgical Decision in BRCA Mutation Carriers with Breast Cancer.

PubMed

Park, Sungmin; Lee, Jeong Eon; Ryu, Jai Min; Kim, Issac; Bae, Soo Youn; Lee, Se Kyung; Yu, Jonghan; Kim, Seok Won; Nam, Seok Jin

2018-05-01

The first aim of our study was to evaluate surgical decision-making by BRCA mutation carriers with breast cancer based on the timing of knowledge of their BRCA mutation status. The second aim was to evaluate breast cancer outcome following surgical treatment. This was a retrospective study of 164 patients diagnosed with invasive breast cancer, tested for BRCA mutation, and treated with primary surgery between 2004 and 2015 at Samsung Medical Center in Seoul, Korea. We reviewed types of surgery and timing of the BRCA test result. We compared surgical decision- making of BRCA carriers with breast cancer based on the timing of knowledge of their BRCA mutation status. Only 15 (9.1%) patients knew their BRCA test results before their surgery, and 149 (90.9%) knew the results after surgery. In patients with unilateral cancer, there was a significant difference between groups whose BRCA mutation status known before surgery and groups whose BRCA status unknown before surgery regarding the choice of surgery (p = 0.017). No significant difference was observed across surgery types of risk of ipsilateral breast tumor recurrence (p = 0.765) and contralateral breast cancer (p = 0.69). Genetic diagnosis before surgery has an impact on surgical decision choosing unilateral mastectomy or bilateral mastectomy in BRCA mutation carriers with breast cancer. Knowledge about BRCA mutation status after initial surgery led to additional surgeries for patients with BCS. Thus, providing genetic counseling and genetic testing before surgical choice and developing treatment strategies for patients with a high risk of breast cancer are important.

Screening for five mutations detects 97% of cystic fibrosis (CF) chromosomes and predicts a carrier frequency of 1:29 in the Jewish Ashkenazi population

DOE Office of Scientific and Technical Information (OSTI.GOV)

Abeliovich, D.; Lavon, I.P.; Lerer, I.

1992-11-01

To determine the distribution and frequency of cystic fibrosis (CF) mutations in the Israeli population, the authors have screened 96 patients for 11 relatively common mutations. Five mutations - [Delta]F508, G542X, W1282X, N1303K, and 3849 + 10kb C[yields]T-were found to account for 97% of the CF alleles in the Ashkenazi Jews. In contrast, of the 11 mutations tested, only [Delta]F508 was detected in Jewish patients of Sephardic or Oriental origin, accounting for 43% of the CF alleles. Four mutations - [Delta]F508, G542X, W1282X, and N1303K- accounted for 55% of the CF alleles in Arab patients. In a pilot screening study,more » a random sample of 424 Ashkenazi individuals was analyzed for three mutations - [Delta]F508, W128X, and G542X. Thirteen individuals were detected as heterozygotes (six for [Delta]F508 and seven for W1282X), predicting a heterozygote frequency of 1:29. This is similar to the frequency of carriers in the Caucasian population of northern European ancestry. On the basis of these data, the Ashkenazi populations is considered to be a candidate for CF heterozygote screening. 32 refs., 2 tabs.« less

Computational Analysis of KRAS Mutations: Implications for Different Effects on the KRAS p.G12D and p.G13D Mutations

PubMed Central

Liu, Yen-Yi; Hwang, Jenn-Kang; Barrio, Maria Jesus; Rodrigo, Maximiliano; Garcia-Toro, Enrique; Herreros-Villanueva, Marta

2013-01-01

Background The issue of whether patients diagnosed with metastatic colorectal cancer who harbor KRAS codon 13 mutations could benefit from the addition of anti-epidermal growth factor receptor therapy remains under debate. The aim of the current study was to perform computational analysis to investigate the structural implications of the underlying mutations caused by c.38G>A (p.G13D) on protein conformation. Methods Molecular dynamics (MD) simulations were performed to understand the plausible structural and dynamical implications caused by c.35G>A (p.G12D) and c.38G>A (p.G13D). The potential of mean force (PMF) simulations were carried out to determine the free energy profiles of the binding processes of GTP interacting with wild-type (WT) KRAS and its mutants (MT). Results Using MD simulations, we observed that the root mean square deviation (RMSD) increased as a function of time for the MT c.35G>A (p.G12D) and MT c.38G>A (p.G13D) when compared with the WT. We also observed that the GTP-binding pocket in the c.35G>A (p.G12D) mutant is more open than that of the WT and the c.38G>A (p.G13D) proteins. Intriguingly, the analysis of atomic fluctuations and free energy profiles revealed that the mutation of c.35G>A (p.G12D) may induce additional fluctuations in the sensitive sites (P-loop, switch I and II regions). Such fluctuations may promote instability in these protein regions and hamper GTP binding. Conclusions Taken together with the results obtained from MD and PMF simulations, the present findings implicate fluctuations at the sensitive sites (P-loop, switch I and II regions). Our findings revealed that KRAS mutations in codon 13 have similar behavior as KRAS WT. To gain a better insight into why patients with metastatic colorectal cancer (mCRC) and the KRAS c.38G>A (p.G13D) mutation appear to benefit from anti-EGFR therapy, the role of the KRAS c.38G>A (p.G13D) mutation in mCRC needs to be further investigated. PMID:23437064

Risk of colorectal cancer for people with a mutation in both a MUTYH and a DNA mismatch repair gene

PubMed Central

Win, Aung Ko; Reece, Jeanette C.; Buchanan, Daniel D.; Clendenning, Mark; Young, Joanne P.; Cleary, Sean P.; Kim, Hyeja; Cotterchio, Michelle; Dowty, James G.; MacInnis, Robert J.; Tucker, Katherine M.; Winship, Ingrid M.; Macrae, Finlay A.; Burnett, Terrilea; Le Marchand, Loïc; Casey, Graham; Haile, Robert W.; Newcomb, Polly A.; Thibodeau, Stephen N.; Lindor, Noralane M.; Hopper, John L.; Gallinger, Steven; Jenkins, Mark A.

2015-01-01

The base excision repair protein, MUTYH, functionally interacts with the DNA mismatch repair (MMR) system. As genetic testing moves from testing one gene at a time, to gene panel and whole exome next generation sequencing approaches, understanding the risk associated with co-existence of germline mutations in these genes will be important for clinical interpretation and management. From the Colon Cancer Family Registry, we identified 10 carriers who had both a MUTYH mutation (6 with c.1187G>A p.(Gly396Asp), 3 with c.821G>A p.(Arg274Gln), and 1 with c.536A>G p.(Tyr179Cys)) and a MMR gene mutation (3 in MLH1, 6 in MSH2, and 1 in PMS2), 375 carriers of a single (monoallelic) MUTYH mutation alone, and 469 carriers of a MMR gene mutation alone. Of the 10 carriers of both gene mutations, 8 were diagnosed with colorectal cancer. Using a weighted cohort analysis, we estimated that risk of colorectal cancer for carriers of both a MUTYH and a MMR gene mutation was substantially higher than that for carriers of a MUTYH mutation alone [hazard ratio (HR) 21.5, 95 % confidence interval (CI) 9.19–50.1; p < 0.001], but not different from that for carriers of a MMR gene mutation alone (HR 1.94, 95 % CI 0.63–5.99; p = 0.25). Within the limited power of this study, there was no evidence that a monoallelic MUTYH gene mutation confers additional risk of colorectal cancer for carriers of a MMR gene mutation alone. Our finding suggests MUTYH mutation testing in MMR gene mutation carriers is not clinically informative. PMID:26202870

Reproductive Decision-Making in MMR Mutation Carriers After Results Disclosure: Impact of Psychological Status in Childbearing Options.

PubMed

Duffour, Jacqueline; Combes, Audrey; Crapez, Evelyne; Boissière-Michot, Florence; Bibeau, Frédéric; Senesse, Pierre; Ychou, Marc; Courraud, Julie; de Forges, Hélène; Roca, Lise

2016-06-01

Reproductive techniques such as prenatal diagnosis (PND) or preimplantation genetic diagnosis (PGD), although debated, are legally forbidden in France in case of Lynch syndrome. The preference of mutation carriers about their reproductive options is not systematically considered in France. We aimed to prospectively assess the reproductive preferences of mismatch repair mutation carriers consulting in our institution (2003-2010, n = 100). We also considered the short- and long-term post-disclosure psychological impact using the Impact of Events Scale-Revised questionnaire to measure the prevalence of posttraumatic stress disorder (PTSD) in those patients. Complete data were obtained for 34 respondents (17 males, 17 females, median age of 33.5 years [22-59]). Seventeen respondents (57 %) preferred spontaneous natural conception versus 28 % and 35 % choosing PND and PGD, respectively. At results disclosure, respondents mainly explained their distress by fear of premature death (43 %) and transmitting mutated genes (42 %). One year later, this last fear remained predominant in 55 % of subjects. None of the main socio-demographical, psychological or medical variables (including fear of transmitting mutations) was significantly associated with the reproductive preferences. Results disclosure had a real and time-decreasing psychological impact on mutation carriers. Reproductive techniques, expected to decrease the hereditary risk, were not significantly preferred to natural conception.

A novel 'splice site' HCN4 Gene mutation, c.1737+1 G>T, causes familial bradycardia, reduced heart rate response, impaired chronotropic competence and increased short-term heart rate variability.

PubMed

Hategan, Lidia; Csányi, Beáta; Ördög, Balázs; Kákonyi, Kornél; Tringer, Annamária; Kiss, Orsolya; Orosz, Andrea; Sághy, László; Nagy, István; Hegedűs, Zoltán; Rudas, László; Széll, Márta; Varró, András; Forster, Tamás; Sepp, Róbert

2017-08-15

The most important molecular determinant of heart rate regulation in sino-atrial pacemaker cells includes hyperpolarization-activated, cyclic nucleotide-gated ion channels, the major isoform of which is encoded by the HCN4 gene. Mutations affecting the HCN4 gene are associated primarily with sick sinus syndrome. A novel c.1737+1 G>T 'splice-site' HCN4 mutation was identified in a large family with familial bradycardia which co-segregated with the disease providing a two-point LOD score of 4.87. Twelve out of the 22 investigated family members [4 males, 8 females average age 36 (SD 6) years] were considered as clinically affected (heart rate<60/min on resting ECG). Minimum [36 (SD 7) vs. 47 (SD 5) bpm, p=0.0087) and average heart rates [62 (SD 8) vs. 73 (SD 8) bpm, p=0.0168) were significantly lower in carriers on 24-hour Holter recordings. Under maximum exercise test carriers achieved significantly lower heart rates than non-carrier family members, and percent heart rate reserve and percent corrected heart rate reserve were significantly lower in carriers. Applying rigorous criteria for chronotropic incompetence a higher number of carriers exhibited chronotropic incompetence. Parameters, characterizing short-term variability of heart rate (i.e. rMSSD and pNN50%) were increased in carrier family members, even after normalization for heart rate, in the 24-hour ECG recordings with the same relative increase in 5-minute recordings. The identified novel 'splice site' HCN4 gene mutation, c.1737+1 G>T, causes familial bradycardia and leads to reduced heart rate response, impaired chronotropic competence and increased short-term heart rate variability in the mutation carriers. Copyright © 2017 Elsevier B.V. All rights reserved.

Increased Oxidative Stress Markers in Cerebrospinal Fluid from Healthy Subjects with Parkinson's Disease-Associated LRRK2 Gene Mutations.

PubMed

Loeffler, David A; Klaver, Andrea C; Coffey, Mary P; Aasly, Jan O; LeWitt, Peter A

2017-01-01

Mutations in the leucine-rich repeat kinase 2 ( LRRK2 ) gene are the most frequent cause of inherited Parkinson's disease (PD). The most common PD-associated LRRK2 mutation, G2019S, induces increased production of reactive oxygen species in vitro . We therefore hypothesized that individuals with PD-associated LRRK2 mutations might have increased concentrations of oxidative stress markers and/or decreased total antioxidant capacity (TAC) in their cerebrospinal fluid (CSF). We measured two oxidative stress markers, namely 8-hydroxy-2'-deoxyguanosine (8-OHdG) and 8-isoprostane (8-ISO), and TAC in CSF from LRRK2 mutation-bearing PD patients ( LRRK2 PD = 19), sporadic PD patients (sPD = 31), and healthy control subjects with or without these mutations ( LRRK2 CTL = 30, CTL = 27). 8-OHdG and 8-ISO levels were increased in LRRK2 CTL subjects, while TAC was similar between groups. 8-ISO was negatively correlated, and TAC was positively correlated, with Montreal Cognitive Assessment scores in LRRK2 PD, LRRK2 CTL, and CTL subjects. Correlations in both groups of PD patients between the two oxidative stress markers and Unified Parkinson Disease Rating Scale Total scores were weak, while TAC was negatively correlated with these scores. These findings suggest that oxidative stress may be increased in the CNS in healthy individuals with PD-associated LRRK2 mutations. Further, TAC may decrease in the CNS with the progression of PD, and when cognitive impairment is present regardless of the presence or absence of PD.

Fabry disease: Evidence for a regional founder effect of the GLA gene mutation 30delG in Brazilian patients.

PubMed

de Alencar, Dayse Oliveira; Netto, Cristina; Ashton-Prolla, Patricia; Giugliani, Roberto; Ribeiro-Dos-Santos, Ândrea; Pereira, Fernanda; Matte, Ursula; Santos, Ney; Santos, Sidney

2014-01-01

The Fabry disease is caused by mutations in the gene ( GLA ) that encodes the enzyme α-galactosidase A (α-Gal A). More than 500 pathologic variants of GLA have already been described, most of them are family-specific. In southern Brazil, a frequent single-base deletion ( GLA 30delG) was identified among four families that do not recognize any common ancestral. In order to investigate the history of this mutation (investigate the founder effect, estimate the mutation age and the most likely source), six gene-flanking microsatellite markers of the X chromosome on the mutation carriers and their parents, 150 individuals from the same population and 300 individuals that compose the Brazilian parental populations (Europeans, Africans and Native Americans) were genotyped. A common haplotype to the four families was identified and characterized as founder. The age was estimated with two statistics software (DMLE 2.2 and ESTIAGE) that agreed with 11 to 12 generations old. This result indicates that the mutation GLA 30delG was originated from a single event on the X chromosome of a European immigrant, during the southern Brazil colonization between 1710 and 1740.

Germline BRCA mutation in male carriers-ripe for precision oncology?

PubMed

Leão, Ricardo Romão Nazário; Price, Aryeh Joshua; James Hamilton, Robert

2018-04-01

Prostate cancer (PC) is one of the known heritable cancers with individual variations attributed to genetic factors. BRCA1 and BRCA2 are tumour suppressor genes with crucial roles in repairing DNA and thereby maintaining genomic integrity. Germline BRCA mutations predispose to multiple familial tumour types including PC. We performed a Pubmed database search along with review of reference lists from prominent articles to capture papers exploring the association between BRCA mtuations and prostate cancer risk and prognosis. Articles were retrieved until May 2017 and filtered for relevance, and publication type. We explored familial PC genetics; discussed the discovery and magnitude of the association between BRCA mutations and PC risk and outcome; examined implications of factoring BRCA mutations into PC screening; and discussed the rationale for chemoprevention in this high-risk population. We confirmed that BRCA1/2 mutations confer an up to 4.5-fold and 8.3-fold increased risk of PC, respectively. BRCA2 mutations are associated with an increased risk of high-grade disease, progression to metastatic castration-resistant disease, and 5-year cancer-specific survival rates of 50 to 60%. Despite the growing body of research on DNA repair genes, deeper analysis is needed to understand the aetiological role of germline BRCA mutations in the natural history of PC. There is a need for awareness to screen for this marker of PC risk. There is similarly an opportunity for structured PC screening programs for BRCA mutation carriers. Finally, further research is required to identify potential chemopreventive strategies for this high-risk subgroup.

RAD51 135G→C Modifies Breast Cancer Risk among BRCA2 Mutation Carriers: Results from a Combined Analysis of 19 Studies

PubMed Central

Antoniou, Antonis C. ; Sinilnikova, Olga M. ; Simard, Jacques ; Léoné, Mélanie ; Dumont, Martine ; Neuhausen, Susan L. ; Struewing, Jeffery P. ; Stoppa-Lyonnet, Dominique ; Barjhoux, Laure ; Hughes, David J. ; Coupier, Isabelle ; Belotti, Muriel ; Lasset, Christine ; Bonadona, Valérie ; Bignon, Yves-Jean ; Rebbeck, Timothy R. ; Wagner, Theresa ; Lynch, Henry T. ; Domchek, Susan M. ; Nathanson, Katherine L. ; Garber, Judy E. ; Weitzel, Jeffrey ; Narod, Steven A. ; Tomlinson, Gail ; Olopade, Olufunmilayo I. ; Godwin, Andrew ; Isaacs, Claudine ; Jakubowska, Anna ; Lubinski, Jan ; Gronwald, Jacek ; Górski, Bohdan ; Byrski, Tomasz ; Huzarski, Tomasz ; Peock, Susan ; Cook, Margaret ; Baynes, Caroline ; Murray, Alexandra ; Rogers, Mark ; Daly, Peter A. ; Dorkins, Huw ; Schmutzler, Rita K. ; Versmold, Beatrix ; Engel, Christoph ; Meindl, Alfons ; Arnold, Norbert ; Niederacher, Dieter ; Deissler, Helmut ; Spurdle, Amanda B. ; Chen, Xiaoqing ; Waddell, Nicola ; Cloonan, Nicole ; Kirchhoff, Tomas ; Offit, Kenneth ; Friedman, Eitan ; Kaufmann, Bella ; Laitman, Yael ; Galore, Gilli ; Rennert, Gad ; Lejbkowicz, Flavio ; Raskin, Leon ; Andrulis, Irene L. ; Ilyushik, Eduard ; Ozcelik, Hilmi ; Devilee, Peter ; Vreeswijk, Maaike P. G. ; Greene, Mark H. ; Prindiville, Sheila A. ; Osorio, Ana ; Benítez, Javier ; Zikan, Michal ; Szabo, Csilla I. ; Kilpivaara, Outi ; Nevanlinna, Heli ; Hamann, Ute ; Durocher, Francine ; Arason, Adalgeir ; Couch, Fergus J. ; Easton, Douglas F. ; Chenevix-Trench, Georgia 

2007-01-01

RAD51 is an important component of double-stranded DNA–repair mechanisms that interacts with both BRCA1 and BRCA2. A single-nucleotide polymorphism (SNP) in the 5′ untranslated region (UTR) of RAD51, 135G→C, has been suggested as a possible modifier of breast cancer risk in BRCA1 and BRCA2 mutation carriers. We pooled genotype data for 8,512 female mutation carriers from 19 studies for the RAD51 135G→C SNP. We found evidence of an increased breast cancer risk in CC homozygotes (hazard ratio [HR] 1.92 [95% confidence interval {CI} 1.25–2.94) but not in heterozygotes (HR 0.95 [95% CI 0.83–1.07]; P=.002, by heterogeneity test with 2 degrees of freedom [df]). When BRCA1 and BRCA2 mutation carriers were analyzed separately, the increased risk was statistically significant only among BRCA2 mutation carriers, in whom we observed HRs of 1.17 (95% CI 0.91–1.51) among heterozygotes and 3.18 (95% CI 1.39–7.27) among rare homozygotes (P=.0007, by heterogeneity test with 2 df). In addition, we determined that the 135G→C variant affects RAD51 splicing within the 5′ UTR. Thus, 135G→C may modify the risk of breast cancer in BRCA2 mutation carriers by altering the expression of RAD51. RAD51 is the first gene to be reliably identified as a modifier of risk among BRCA1/2 mutation carriers. PMID:17999359

Phenotypic characterization of nevus and tumor patterns in MITF E318K mutation carrier melanoma patients.

PubMed

Sturm, Richard A; Fox, Carly; McClenahan, Phil; Jagirdar, Kasturee; Ibarrola-Villava, Maider; Banan, Parastoo; Abbott, Nicola C; Ribas, Gloria; Gabrielli, Brian; Duffy, David L; Peter Soyer, H

2014-01-01

A germline polymorphism of the microphthalmia transcription factor (MITF) gene encoding a SUMOylation-deficient E318K-mutated protein has recently been described as a medium-penetrance melanoma gene. In a clinical assessment of nevi from 301 volunteers taken from Queensland, we identified six individuals as MITF E318K mutation carriers. The phenotype for 5 of these individuals showed a commonality of fair skin, body freckling that varied over a wide range, and total nevus count between 46 and 430; in addition, all were multiple primary melanoma patients. The predominant dermoscopic signature pattern of nevi was reticular, and the frequency of globular nevi in carriers varied, which does not suggest that the MITF E318K mutation acts to force the continuous growth of nevi. Excised melanocytic lesions were available for four MITF E318K carrier patients and were compared with a matched range of wild-type (WT) melanocytic lesions. The MITF staining pattern showed a predominant nuclear signal in all sections, with no significant difference in the nuclear/cytoplasmic ratio between mutation-positive or -negative samples. A high incidence of amelanotic melanomas was found within the group, with three of the five melanomas from one patient suggesting a genetic interaction between the MITF E318K allele and an MC1R homozygous red hair color (RHC) variant genotype.

Voltage-sensitive sodium channel mutations S989P + V1016G in Aedes aegypti confer variable resistance to pyrethroids, DDT and oxadiazines.

PubMed

Smith, Letícia B; Kasai, Shinji; Scott, Jeffrey G

2018-03-01

Aedes aegypti is a vector of several important human pathogens. Control efforts rely primarily on pyrethroid insecticides for adult mosquito control, especially during disease outbreaks. A. aegypti has developed resistance nearly everywhere it occurs and insecticides are used. An important mechanism of resistance is due to mutations in the voltage-sensitive sodium channel (Vssc) gene. Two mutations, in particular, S989P + V1016G, commonly occur together in parts of Asia. We have created a strain (KDR:ROCK) that contains the Vssc mutations S989P + V1016G as the only mechanism of pyrethroid resistance within the genetic background of Rockefeller (ROCK), a susceptible lab strain. We created KDR:ROCK by crossing the pyrethroid-resistant strain Singapore with ROCK followed by four backcrosses with ROCK and Vssc S989P + V1016G genotype selections. We determined the levels of resistance conferred to 17 structurally diverse pyrethroids, the organochloride DDT, and oxadiazines (VSSC blockers) indoxacarb (proinsecticide) and DCJW (the active metabolite of indoxacarb). Levels of resistance to the pyrethroids were variable, ranging from 21- to 107-fold, but no clear pattern between resistance and chemical structure was observed. Resistance is inherited as an incompletely recessive trait. KDR:ROCK had a > 2000-fold resistance to DDT, 37.5-fold cross-resistance to indoxacarb and 13.4-fold cross-resistance to DCJW. Etofenprox (and DDT) should be avoided in areas where Vssc mutations S989P + V1016G exist at high frequencies. We found that pyrethroid structure cannot be used to predict the level of resistance conferred by kdr. These results provide useful information for resistance management and for better understanding pyrethroid interactions with VSSC. © 2017 The Authors. Pest Management Science published by John Wiley & Sons Ltd on behalf of Society of Chemical Industry. © 2017 The Authors. Pest Management Science published by John Wiley & Sons Ltd on behalf of Society of

G1738R is a BRCA1 founder mutation in Greek breast/ovarian cancer patients: evaluation of its pathogenicity and inferences on its genealogical history.

PubMed

Anagnostopoulos, Theodore; Pertesi, Maroulio; Konstantopoulou, Irene; Armaou, Sofia; Kamakari, Smaragda; Nasioulas, George; Athanasiou, Athanassios; Dobrovic, Alex; Young, Mary-Anne; Goldgar, David; Fountzilas, George; Yannoukakos, Drakoulis

2008-07-01

We have performed screening in 287 breast/ovarian cancer families in Greece which has revealed that approximately 12% (8/65) of all index patients-carriers of a deleterious mutation in BRCA1 and BRCA2 genes, contain the base substitution G to A at position 5331 of BRCA1 gene. This generates the amino acid change G1738R for which based on a combination of genetic, in silico and histopathological analysis there are strong suggestions that it is a causative mutation. In this paper, we present further evidence suggesting the pathogenicity of this variant. Forty breast/ovarian cancer patients were reported in 11 Greek families: the above eight living in Greece, two living in Australia and one in USA, all containing G1738R. Twenty of these patients were screened and were all found to be carriers of the same base substitution. In addition, we have detected the same base change in five breast/ovarian cancer patients after screening 475 unselected patient samples with no apparent family history. The mean age of onset for all the above patients was 39.4 and 53.6 years for breast and ovarian cancer cases, respectively. A multi-factorial likelihood model for classification of unclassified variants in BRCA1 and BRCA2 developed previously was applied on G1738R and the odds of it being a deleterious mutation was estimated to be 11470:1. In order to explain the prevalence of this mutation mainly in the Greek population, its genealogical history was examined. DNA samples were collected from 11 carrier families living in Greece, Australia and USA. Screening of eight intragenic SNPs, three intragenic and seven extragenic microsatellite markers and comparison with control individuals, suggested a common origin for the mutation while the time to its most recent common ancestor was estimated to be 11 generations (about 275 years assuming a generational interval of 25 years) with a 1-lod support interval of 4-24 generations (100-600 years). Considering the large degree of genetic

Functional analysis of H. sapiens DNA polymerase γ spacer mutation W748S with and without common variant E1143G

PubMed Central

Palin, Eino JH; Lesonen, Annamari; Farr, Carol L; Euro, Liliya; Suomalainen, Anu; Kaguni, Laurie S

2010-01-01

Mitochondrial DNA polymerase, POLG, is the sole DNA polymerase found in animal mitochondria. In humans, POLGα W748S in cis with an E1143G mutation has been linked to a new type of recessive ataxia, MIRAS, which is the most common inherited ataxia in Finland. We investigated the biochemical phenotypes of the W748S amino acid change, using recombinant human POLG. We measured processive and non-processive DNA polymerase activity, DNA binding affinity, enzyme processivity, and subunit interaction with recombinant POLGβ. In addition, we studied the effects of the W748S and E1143G mutations in primary human cell cultures using retroviral transduction. Here, we examined cell viability, mitochondrial DNA copy number, and products of mitochondrial translation. Our results indicate that the W748S mutant POLGα does not exhibit a clear biochemical phenotype, making it indistinguishable from wild type POLGα and as such, fail to replicate previously published results. Furthermore, results from the cell models were concurrent with the findings from patients, and support our biochemical findings. PMID:20153822

Common genetic variation at BARD1 is not associated with Breast cancer risk in BRCA1 or BRCA2 mutation carriers

PubMed Central

Spurdle, Amanda B.; Marquart, Louise; McGuffog, Lesley; Healey, Sue; Sinilnikova, Olga; Wan, Fei; Chen, Xiaoqing; Beesley, Jonathan; Singer, Christian F; Dressler, Anne-Catharine; Gschwantler-Kaulich, Daphne; Blum, Joanne L.; Tung, Nadine; Weitzel, Jeff; Lynch, Henry; Garber, Judy; Easton, Douglas F.; Peock, Susan; Cook, Margaret; Oliver, Clare T.; Frost, Debra; Conroy, Don; Evans, D. Gareth; Lalloo, Fiona; Eeles, Ros; Izatt, Louise; Davidson, Rosemarie; Chu, Carol; Eccles, Diana; Selkirk, Christina G.; Daly, Mary; Isaacs, Claudine; Stoppa-Lyonnet, Dominique; Sinilnikova, Olga M.; Buecher, Bruno; Belotti, Muriel; Mazoyer, Sylvie; Barjhoux, Laure; Verny-Pierre, Carole; Lasset, Christine; Dreyfus, Hélène; Pujol, Pascal; Collonge-Rame, Marie-Agnès; Rookus, Matti A.; Verhoef, Senno; Kriege, Mieke; Hoogerbrugge, Nicoline; Ausems, Margreet G.E.M.; van Os, Theo A.; Wijnen, Juul; Devilee, Peter; Meijers-Heijboer, Hanne E.J.; Blok, Marinus J.; Heikkinen, Tuomas; Nevanlinna, Heli; Jakubowska, Anna; Lubiński, Jan; Huzarski, Tomasz; Byrski, Tomasz; Durocher, Francine; Couch, Fergus J.; Lindor, Noralane M.; Wang, Xianshu; Thomassen, Mads; Domchek, Susan; Nathanson, Kate; Caligo, MA; Jernström, Helena; Liljegren, Annelie; Ehrencrona, Hans; Karlsson, Per; Ganz, Patricia A.; Olopade, Olufunmilayo I.; Tomlinson, Gail; Neuhausen, Susan; Antoniou, Antonis C.; Chenevix-Trench, Georgia; Rebbeck, Timothy R.

2011-01-01

Background Inherited BRCA1 and BRCA2 (BRCA1/2) mutations confer elevated breast cancer risk. Knowledge of factors that can improve breast cancer risk assessment in BRCA1/2 mutation carriers may improve personalized cancer prevention strategies. Methods A cohort of 5,546 BRCA1 and 2,865 BRCA2 mutation carriers was used to evaluate risk of breast cancer associated with BARD1 Cys557Ser. In a second non-independent cohort of 1,537 of BRCA1 and 839 BRCA2 mutation carriers, BARD1 haplotypes were also evaluated. Results The BARD1 Cys557Ser variant was not significantly associated with risk of breast cancer from single SNP analysis, with a pooled effect estimate of 0.90 (95%CI: 0.71-1.15) in BRCA1 carriers and 0.87 (95%CI: 0.59-1.29) in BRCA2 carriers. Further analysis of haplotypes at BARD1 also revealed no evidence that additional common genetic variation not captured by Cys557Ser was associated with breast cancer risk. Conclusion Evidence to date does not support a role for BARD1 variation, including the Cy557Ser variant, as a modifier of risk in BRCA1/2 mutation carriers. Impact Interactors of BRCA1/2 have been implicated as modifiers of BRCA1/2-associated cancer risk. Our finding that BARD1 does not contribute to this risk modification may focus research on other genes that do modify BRCA1/2-associated cancer risk. PMID:21393566

Effect of the G375C and G346E achondroplasia mutations on FGFR3 activation.

PubMed

He, Lijuan; Serrano, Christopher; Niphadkar, Nitish; Shobnam, Nadia; Hristova, Kalina

2012-01-01

Two mutations in FGFR3, G380R and G375C are known to cause achondroplasia, the most common form of human dwarfism. The G380R mutation accounts for 98% of the achondroplasia cases, and thus has been studied extensively. Here we study the effect of the G375C mutation on the phosphorylation and the cross-linking propensity of full-length FGFR3 in HEK 293 cells, and we compare the results to previously published results for the G380R mutant. We observe identical behavior of the two achondroplasia mutants in these experiments, a finding which supports a direct link between the severity of dwarfism phenotypes and the level and mechanism of FGFR3 over-activation. The mutations do not increase the cross-linking propensity of FGFR3, contrary to previous expectations that the achondroplasia mutations stabilize the FGFR3 dimers. Instead, the phosphorylation efficiency within un-liganded FGFR3 dimers is increased, and this increase is likely the underlying cause for pathogenesis in achondroplasia. We further investigate the G346E mutation, which has been reported to cause achondroplasia in one case. We find that this mutation does not increase FGFR3 phosphorylation and decreases FGFR3 cross-linking propensity, a finding which raises questions whether this mutation is indeed a genetic cause for human dwarfism.

Effect of the G375C and G346E Achondroplasia Mutations on FGFR3 Activation

PubMed Central

He, Lijuan; Serrano, Christopher; Niphadkar, Nitish; Shobnam, Nadia; Hristova, Kalina

2012-01-01

Two mutations in FGFR3, G380R and G375C are known to cause achondroplasia, the most common form of human dwarfism. The G380R mutation accounts for 98% of the achondroplasia cases, and thus has been studied extensively. Here we study the effect of the G375C mutation on the phosphorylation and the cross-linking propensity of full-length FGFR3 in HEK 293 cells, and we compare the results to previously published results for the G380R mutant. We observe identical behavior of the two achondroplasia mutants in these experiments, a finding which supports a direct link between the severity of dwarfism phenotypes and the level and mechanism of FGFR3 over-activation. The mutations do not increase the cross-linking propensity of FGFR3, contrary to previous expectations that the achondroplasia mutations stabilize the FGFR3 dimers. Instead, the phosphorylation efficiency within un-liganded FGFR3 dimers is increased, and this increase is likely the underlying cause for pathogenesis in achondroplasia. We further investigate the G346E mutation, which has been reported to cause achondroplasia in one case. We find that this mutation does not increase FGFR3 phosphorylation and decreases FGFR3 cross-linking propensity, a finding which raises questions whether this mutation is indeed a genetic cause for human dwarfism. PMID:22529939

Mutations in the S gene region of hepatitis B virus genotype D in Turkish patients.

PubMed

Ozaslan, Mehmet; Ozaslan, Ersan; Barsgan, Arzu; Koruk, Mehmet

2007-12-01

The S gene region of the hepatitis B virus (HBV) is responsible for the expression of surface antigens and includes the 'a'-determinant region. Thus, mutation(s) in this region would afford HBV variants a distinct survival advantage, permitting the mutant virus to escape from the immune system. The aim of this study was to search for mutations of the S gene region in different patient groups infected with genotype D variants of HBV, and to analyse the biological significance of these mutations. Moreover, we investigated S gene mutation inductance among family members. Forty HBV-DNA-positive patients were determined among 132 hepatitis B surface antigen (HbsAg) carriers by the first stage of seminested PCR. Genotypes and subtypes were established by sequencing of the amplified S gene regions. Variants were compared with original sequences of these serotypes, and mutations were identified. All variants were designated as genotype D and subtype ayw3. Ten kinds of point mutations were identified within the S region. The highest rates of mutation were found in chronic hepatitis patients and their family members. The amino acid mutations 125 (M -> T) and 127 (T -> P) were found on the first loop of 'a'-determinant. The other consequence was mutation inductance in a family member. We found some mutations in the S gene region known to be stable and observed that some of these mutations affected S gene expression.

Long-Term Clinical Outcome and Carrier Phenotype in Autosomal Recessive Hypophosphatemia Caused by a Novel DMP1 Mutation

PubMed Central

Mäkitie, Outi; Pereira, Renata C; Kaitila, Ilkka; Turan, Serap; Bastepe, Murat; Laine, Tero; Kröger, Heikki; Cole, William G; Jüppner, Harald

2010-01-01

Homozygous inactivating mutations in DMP1 (dentin matrix protein 1), the gene encoding a noncollagenous bone matrix protein expressed in osteoblasts and osteocytes, cause autosomal recessive hypophosphatemia (ARHP). Herein we describe a family with ARHP owing to a novel homozygous DMP1 mutation and provide a detailed description of the associated skeletal dysplasia and carrier phenotype. The two adult patients with ARHP, a 78-year-old man and his 66-year-old sister, have suffered from bone pain and lower extremity varus deformities since early childhood. With increasing age, both patients developed severe joint pain, contractures, and complete immobilization of the spine. Radiographs showed short and deformed long bones, significant cranial hyperostosis, enthesopathies, and calcifications of the paraspinal ligaments. Biochemistries were consistent with hypophosphatemia owing to renal phosphate wasting; markers of bone turnover and serum fibroblast growth factor 23 (FGF-23) levels were increased significantly. Nucleotide sequence analysis of DMP1 revealed a novel homozygous mutation at the splice acceptor junction of exon 6 (IVS5-1G > A). Two heterozygous carriers of the mutation also showed mild hypophosphatemia, and bone biopsy in one of these individuals showed focal areas of osteomalacia. In bone, DMP1 expression was absent in the homozygote but normal in the heterozygote, whereas FGF-23 expression was increased in both subjects but higher in the ARHP patient. The clinical and laboratory observations in this family confirm that DMP1 has an important role in normal skeletal development and mineral homeostasis. The skeletal phenotype in ARHP may be significantly more severe than in other forms of hypophosphatemic rickets. © 2010 American Society for Bone and Mineral Research. PMID:20499351

EGFR G796D mutation mediates resistance to osimertinib.

PubMed

Zheng, Di; Hu, Min; Bai, Yu; Zhu, Xuehua; Lu, Xuesong; Wu, Chunyan; Wang, Jiying; Liu, Li; Wang, Zheng; Ni, Jian; Yang, Zhenfan; Xu, Jianfang

2017-07-25

Osimertinib is an effective third-generation epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor (TKI) approved in multiple countries and regions for patients with EGFR T790M mutation-positive non-small cell lung cancer (NSCLC). Despite impressive initial tumor responses, development of drug resistance ultimately limits the benefit of this compound. Mechanisms of resistance to osimertinib are just beginning to emerge, such as EGFR C797S and L718Q mutations, BRAF V600E and PIK3CA E545K mutations, as well as ERBB2 and MET amplification. However, a comprehensive view is still missing. In this study, we presented the first case of Chinese NSCLC patient who developed resistance to osimertinib, and discovered de novo EGFR G796D mutation as a potential mechanism. Our findings provided insights into mechanisms of resistance to osimertinib and highlighted tumor heterogeneity and clonal evolution during the development of drug resistance.

EGFR G796D mutation mediates resistance to osimertinib

PubMed Central

Bai, Yu; Zhu, Xuehua; Lu, Xuesong; Wu, Chunyan; Wang, Jiying; Liu, Li; Wang, Zheng; Ni, Jian; Yang, Zhenfan; Xu, Jianfang

2017-01-01

Osimertinib is an effective third-generation epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor (TKI) approved in multiple countries and regions for patients with EGFR T790M mutation-positive non-small cell lung cancer (NSCLC). Despite impressive initial tumor responses, development of drug resistance ultimately limits the benefit of this compound. Mechanisms of resistance to osimertinib are just beginning to emerge, such as EGFR C797S and L718Q mutations, BRAF V600E and PIK3CA E545K mutations, as well as ERBB2 and MET amplification. However, a comprehensive view is still missing. In this study, we presented the first case of Chinese NSCLC patient who developed resistance to osimertinib, and discovered de novo EGFR G796D mutation as a potential mechanism. Our findings provided insights into mechanisms of resistance to osimertinib and highlighted tumor heterogeneity and clonal evolution during the development of drug resistance. PMID:28572531

A comparative study of quantitative immunohistochemistry and quantum dot immunohistochemistry for mutation carrier identification in Lynch syndrome.

PubMed

Barrow, Emma; Evans, D Gareth; McMahon, Ray; Hill, James; Byers, Richard

2011-03-01

Lynch Syndrome is caused by mutations in DNA mismatch repair (MMR) genes. Mutation carrier identification is facilitated by immunohistochemical detection of the MMR proteins MHL1 and MSH2 in tumour tissue and is desirable as colonoscopic screening reduces mortality. However, protein detection by conventional immunohistochemistry (IHC) is subjective, and quantitative techniques are required. Quantum dots (QDs) are novel fluorescent labels that enable quantitative multiplex staining. This study compared their use with quantitative 3,3'-diaminobenzidine (DAB) IHC for the diagnosis of Lynch Syndrome. Tumour sections from 36 mutation carriers and six controls were obtained. These were stained with DAB on an automated platform using antibodies against MLH1 and MSH2. Multiplex QD immunofluorescent staining of the sections was performed using antibodies against MLH1, MSH2 and smooth muscle actin (SMA). Multispectral analysis of the slides was performed. The staining intensity of DAB and QDs was measured in multiple colonic crypts, and the mean intensity scores calculated. Receiver operating characteristic (ROC) curves of staining performance for the identification of mutation carriers were evaluated. For quantitative DAB IHC, the area under the MLH1 ROC curve was 0.872 (95% CI 0.763 to 0.981), and the area under the MSH2 ROC curve was 0.832 (95% CI 0.704 to 0.960). For quantitative QD IHC, the area under the MLH1 ROC curve was 0.812 (95% CI 0.681 to 0.943), and the area under the MSH2 ROC curve was 0.598 (95% CI 0.418 to 0.777). Despite the advantage of QD staining to enable several markers to be measured simultaneously, it is of lower utility than DAB IHC for the identification of MMR mutation carriers. Automated DAB IHC staining and quantitative slide analysis may enable high-throughput IHC.

G6PDdb, an integrated database of glucose-6-phosphate dehydrogenase (G6PD) mutations.

PubMed

Kwok, Colin J; Martin, Andrew C R; Au, Shannon W N; Lam, Veronica M S

2002-03-01

G6PDdb (http://www.rubic.rdg.ac.uk/g6pd/ or http://www.bioinf.org.uk/g6pd/) is a newly created web-accessible locus-specific mutation database for the human Glucose-6-phosphate dehydrogenase (G6PD) gene. The relational database integrates up-to-date mutational and structural data from various databanks (GenBank, Protein Data Bank, etc.) with biochemically characterized variants and their associated phenotypes obtained from published literature and the Favism website. An automated analysis of the mutations likely to have a significant impact on the structure of the protein has been performed using a recently developed procedure. The database may be queried online and the full results of the analysis of the structural impact of mutations are available. The web page provides a form for submitting additional mutation data and is linked to resources such as the Favism website, OMIM, HGMD, HGVBASE, and the PDB. This database provides insights into the molecular aspects and clinical significance of G6PD deficiency for researchers and clinicians and the web page functions as a knowledge base relevant to the understanding of G6PD deficiency and its management. Copyright 2002 Wiley-Liss, Inc.

Hereditary Hypophosphatemic Rickets With Hypercalciuria and Nephrolithiasis—Identification of a Novel SLC34A3/NaPi-IIc Mutation

PubMed Central

Phulwani, Priya; Bergwitz, Clemens; Jaureguiberry, Graciana; Rasoulpour, Majjid; Estrada, Elizabeth

2015-01-01

Hereditary hypophosphatemic rickets with hypercalciuria (HHRH) is characterized by rickets, hyperphosphaturia, hypophosphatemia, elevated 1,25-dihydroxyvitamin-D, increased gastrointestinal calcium absorption and hypercalciuria. Serum calcium, 25-hydroxyvitamin-D and PTH levels are normal. Here we describe a boy with HHRH, nephrolithiasis, and compound heterozygosity for one previously described mutation (g.4225_50del) and a novel splice mutation (g.1226G>A) in SLC34A3, the gene encoding the renal sodium-phosphate co-transporter NaPi-IIc. The patient’s mother and grandmother are carriers of g.4225_50del, and both have a history of nephrolithiasis associated with hypercalciuria and elevated 1,25-dihydroxyvitamin-D. His three siblings (2–6 years old), who are also carriers of g.4225_50del, have hypercalciuria but so far their renal ultrasounds are normal. Thus, SLC34A3/NaPi-IIc mutations appear to be associated with variable phenotypic changes at presentation, which can include recurrent nephrolithiasis. PMID:21344632

The UK MRC Mitochondrial Disease Patient Cohort Study: clinical phenotypes associated with the m.3243A>G mutation--implications for diagnosis and management.

PubMed

Nesbitt, Victoria; Pitceathly, Robert D S; Turnbull, Doug M; Taylor, Robert W; Sweeney, Mary G; Mudanohwo, Ese E; Rahman, Shamima; Hanna, Michael G; McFarland, Robert

2013-08-01

Population-based studies suggest the m.3243A>G mutation in MTTL1 is the most common disease-causing mtDNA mutation, with a carrier rate of 1 in 400 people. The m.3243A>G mutation is associated with several clinical syndromes including mitochondrial encephalopathy lactic acidosis and stroke-like episodes (MELAS), maternally inherited deafness and diabetes (MIDD) and progressive external ophthalmoplegia (PEO). Many patients affected by this mutation exhibit a clinical phenotype that does not fall within accepted criteria for the currently recognised classical mitochondrial syndromes. We have defined the phenotypic spectrum associated with the m.3243A>G mtDNA mutation in 129 patients, from 83 unrelated families, recruited to the Mitochondrial Disease Patient Cohort Study UK. 10% of patients exhibited a classical MELAS phenotype, 30% had MIDD, 6% MELAS/MIDD, 2% MELAS/chronic PEO (CPEO) and 5% MIDD/CPEO overlap syndromes. 6% had PEO and other features of mitochondrial disease not consistent with another recognised syndrome. Isolated sensorineural hearing loss occurred in 3%. 28% of patients demonstrated a panoply of clinical features, which were not consistent with any of the classical syndromes associated with the m.3243A>G mutation. 9% of individuals harbouring the mutation were clinically asymptomatic. Following this study we propose guidelines for screening and for the management of confirmed cases.

Carriers of the hypertrophic cardiomyopathy MYBPC3 mutation are characterized by reduced myocardial efficiency in the absence of hypertrophy and microvascular dysfunction.

PubMed

Timmer, Stefan A J; Germans, Tjeerd; Brouwer, Wessel P; Lubberink, Mark; van der Velden, Jolanda; Wilde, Arthur A M; Christiaans, Imke; Lammertsma, Adriaan A; Knaapen, Paul; van Rossum, Albert C

2011-12-01

Next to left ventricular (LV) hypertrophy, hypertrophic cardiomyopathy (HCM) is characterized by microvascular dysfunction and reduced myocardial external efficiency (MEE). Insights into the presence of these abnormalities as early markers of disease are of clinical importance in risk stratification, and development of therapeutic approaches. Therefore, the aim was to investigate myocardial perfusion and energetics in genotype-positive, phenotype-negative HCM subjects (carriers). Fifteen carriers of an MYBPC3 mutation underwent [(15)O]water positron emission tomography (PET) to assess myocardial blood flow (MBF). [(11)C]acetate PET was performed to obtain myocardial oxygen consumption (MVO(2)). By use of cardiovascular magnetic resonance imaging, LV volumes and mass were defined to calculate MEE, i.e. the ratio between external work and MVO(2). Eleven healthy, genotype-negative, family relatives underwent similar scanning protocols to serve as a control group. Left ventricular mass was comparable between carriers and controls (93 ± 25 vs. 99 ± 21 g, P= 0.85), as was MBF at rest (1.19 ± 0.34 vs. 1.18 ± 0.32 mL min(-1) g(-1), P= 0.92), and during hyperaemia (3.87 ± 0.75 vs. 3.96 ± 0.86 mL min(-1) g(-1), P= 0.77). Myocardial oxygen consumption averaged 0.137 ± 0.057 mL min(-1) g(-1) in carriers and was not significantly different from controls (0.125 ± 0.043 mL min(-1) g(-1), P= 0.29). Cardiac work, however, was slightly reduced in carriers (7398 ± 1384 vs. 9139 ± 2484 mmHg mL in controls, P= 0.08). As a consequence, MEE was significantly decreased in carriers (27 ± 10 vs. 36 ± 8% in controls, P= 0.02). Carriers display reduced myocardial work generation in relation to oxygen consumption, in the absence of hypertrophy and flow abnormalities. Hence, impaired myocardial energetics may constitute a primary component of HCM pathogenesis.

Alcohol Consumption and the Risk of Colorectal Cancer for Mismatch Repair Gene Mutation Carriers

PubMed Central

Dashti, S. Ghazaleh; Buchanan, Daniel D.; Jayasekara, Harindra; Ouakrim, Driss Ait; Clendenning, Mark; Rosty, Christophe; Winship, Ingrid M.; Macrae, Finlay A.; Giles, Graham G.; Parry, Susan; Casey, Graham; Haile, Robert W.; Gallinger, Steven; Le Marchand, Loïc; Thibodeau, Stephen N.; Lindor, Noralane M.; Newcomb, Polly A.; Potter, John D.; Baron, John A.; Hopper, John L.; Jenkins, Mark A.; Win, Aung Ko

2016-01-01

Background People with germline mutation in one of the DNA mismatch repair (MMR) genes have increased colorectal cancer risk. For these high-risk people, study findings of the relationship between alcohol consumption and colorectal cancer risk have been inconclusive. Methods 1,925 MMR gene mutations carriers recruited into the Colon Cancer Family Registry who had completed a questionnaire on lifestyle factors were included. Weighted Cox proportional hazard regression models were used to estimate hazard ratios (HRs) and 95% confidence intervals (CIs) for the association between alcohol consumption and colorectal cancer. Results Colorectal cancer was diagnosed in 769 carriers (40%) at a mean (standard deviation) age of 42.6 (10.3) years. Compared with abstention, ethanol consumption from any alcoholic beverage up to 14 grams/day and >28 grams/day were associated with increased colorectal cancer risk (HR, 1.50; 95%CI, 1.09–2.07 and 1.69; 95%CI, 1.07–2.65 respectively; P-trend=0.05), and colon cancer risk (HR, 1.78; 95%CI, 1.27–2.49 and 1.94; 95%CI, 1.19–3.18 respectively; P-trend=0.02). However, there was no clear evidence for an association with rectal cancer risk. Also, there was no evidence for associations between consumption of individual alcoholic beverage types (beer, wine, spirits) and colorectal, colon, or rectal cancer risk. Conclusion Our data suggests that alcohol consumption, particularly more than 28 grams/day of ethanol (~2 standard drinks of alcohol in the US), is associated with increased colorectal cancer risk for MMR gene mutation carriers. Impact Although these data suggested that alcohol consumption in MMR carriers was associated with increased colorectal cancer risk, there was no evidence of a dose-response, and not all types of alcohol consumption were associated with increased risk. PMID:27811119

DNA Glycosylases Involved in Base Excision Repair May Be Associated with Cancer Risk in BRCA1 and BRCA2 Mutation Carriers

PubMed Central

Osorio, Ana; Milne, Roger L.; Kuchenbaecker, Karoline; Vaclová, Tereza; Pita, Guillermo; Alonso, Rosario; Peterlongo, Paolo; Blanco, Ignacio; de la Hoya, Miguel; Duran, Mercedes; Díez, Orland; Ramón y Cajal, Teresa; Konstantopoulou, Irene; Martínez-Bouzas, Cristina; Andrés Conejero, Raquel; Soucy, Penny; McGuffog, Lesley; Barrowdale, Daniel; Lee, Andrew; SWE-BRCA; Arver, Brita; Rantala, Johanna; Loman, Niklas; Ehrencrona, Hans; Olopade, Olufunmilayo I.; Beattie, Mary S.; Domchek, Susan M.; Nathanson, Katherine; Rebbeck, Timothy R.; Arun, Banu K.; Karlan, Beth Y.; Walsh, Christine; Lester, Jenny; John, Esther M.; Whittemore, Alice S.; Daly, Mary B.; Southey, Melissa; Hopper, John; Terry, Mary B.; Buys, Saundra S.; Janavicius, Ramunas; Dorfling, Cecilia M.; van Rensburg, Elizabeth J.; Steele, Linda; Neuhausen, Susan L.; Ding, Yuan Chun; Hansen, Thomas v. O.; Jønson, Lars; Ejlertsen, Bent; Gerdes, Anne-Marie; Infante, Mar; Herráez, Belén; Moreno, Leticia Thais; Weitzel, Jeffrey N.; Herzog, Josef; Weeman, Kisa; Manoukian, Siranoush; Peissel, Bernard; Zaffaroni, Daniela; Scuvera, Giulietta; Bonanni, Bernardo; Mariette, Frederique; Volorio, Sara; Viel, Alessandra; Varesco, Liliana; Papi, Laura; Ottini, Laura; Tibiletti, Maria Grazia; Radice, Paolo; Yannoukakos, Drakoulis; Garber, Judy; Ellis, Steve; Frost, Debra; Platte, Radka; Fineberg, Elena; Evans, Gareth; Lalloo, Fiona; Izatt, Louise; Eeles, Ros; Adlard, Julian; Davidson, Rosemarie; Cole, Trevor; Eccles, Diana; Cook, Jackie; Hodgson, Shirley; Brewer, Carole; Tischkowitz, Marc; Douglas, Fiona; Porteous, Mary; Side, Lucy; Walker, Lisa; Morrison, Patrick; Donaldson, Alan; Kennedy, John; Foo, Claire; Godwin, Andrew K.; Schmutzler, Rita Katharina; Wappenschmidt, Barbara; Rhiem, Kerstin; Engel, Christoph; Meindl, Alfons; Ditsch, Nina; Arnold, Norbert; Plendl, Hans Jörg; Niederacher, Dieter; Sutter, Christian; Wang-Gohrke, Shan; Steinemann, Doris; Preisler-Adams, Sabine; Kast, Karin; Varon-Mateeva, Raymonda; Gehrig, Andrea; Stoppa-Lyonnet, Dominique; Sinilnikova, Olga M.; Mazoyer, Sylvie; Damiola, Francesca; Poppe, Bruce; Claes, Kathleen; Piedmonte, Marion; Tucker, Kathy; Backes, Floor; Rodríguez, Gustavo; Brewster, Wendy; Wakeley, Katie; Rutherford, Thomas; Caldés, Trinidad; Nevanlinna, Heli; Aittomäki, Kristiina; Rookus, Matti A.; van Os, Theo A. M.; van der Kolk, Lizet; de Lange, J. L.; Meijers-Heijboer, Hanne E. J.; van der Hout, A. H.; van Asperen, Christi J.; Gómez Garcia, Encarna B.; Hoogerbrugge, Nicoline; Collée, J. Margriet; van Deurzen, Carolien H. M.; van der Luijt, Rob B.; Devilee, Peter; HEBON; Olah, Edith; Lázaro, Conxi; Teulé, Alex; Menéndez, Mireia; Jakubowska, Anna; Cybulski, Cezary; Gronwald, Jacek; Lubinski, Jan; Durda, Katarzyna; Jaworska-Bieniek, Katarzyna; Johannsson, Oskar Th.; Maugard, Christine; Montagna, Marco; Tognazzo, Silvia; Teixeira, Manuel R.; Healey, Sue; Investigators, kConFab; Olswold, Curtis; Guidugli, Lucia; Lindor, Noralane; Slager, Susan; Szabo, Csilla I.; Vijai, Joseph; Robson, Mark; Kauff, Noah; Zhang, Liying; Rau-Murthy, Rohini; Fink-Retter, Anneliese; Singer, Christian F.; Rappaport, Christine; Geschwantler Kaulich, Daphne; Pfeiler, Georg; Tea, Muy-Kheng; Berger, Andreas; Phelan, Catherine M.; Greene, Mark H.; Mai, Phuong L.; Lejbkowicz, Flavio; Andrulis, Irene; Mulligan, Anna Marie; Glendon, Gord; Toland, Amanda Ewart; Bojesen, Anders; Pedersen, Inge Sokilde; Sunde, Lone; Thomassen, Mads; Kruse, Torben A.; Jensen, Uffe Birk; Friedman, Eitan; Laitman, Yael; Shimon, Shani Paluch; Simard, Jacques; Easton, Douglas F.; Offit, Kenneth; Couch, Fergus J.; Chenevix-Trench, Georgia; Antoniou, Antonis C.; Benitez, Javier

2014-01-01

Single Nucleotide Polymorphisms (SNPs) in genes involved in the DNA Base Excision Repair (BER) pathway could be associated with cancer risk in carriers of mutations in the high-penetrance susceptibility genes BRCA1 and BRCA2, given the relation of synthetic lethality that exists between one of the components of the BER pathway, PARP1 (poly ADP ribose polymerase), and both BRCA1 and BRCA2. In the present study, we have performed a comprehensive analysis of 18 genes involved in BER using a tagging SNP approach in a large series of BRCA1 and BRCA2 mutation carriers. 144 SNPs were analyzed in a two stage study involving 23,463 carriers from the CIMBA consortium (the Consortium of Investigators of Modifiers of BRCA1 and BRCA2). Eleven SNPs showed evidence of association with breast and/or ovarian cancer at p<0.05 in the combined analysis. Four of the five genes for which strongest evidence of association was observed were DNA glycosylases. The strongest evidence was for rs1466785 in the NEIL2 (endonuclease VIII-like 2) gene (HR: 1.09, 95% CI (1.03–1.16), p = 2.7×10−3) for association with breast cancer risk in BRCA2 mutation carriers, and rs2304277 in the OGG1 (8-guanine DNA glycosylase) gene, with ovarian cancer risk in BRCA1 mutation carriers (HR: 1.12 95%CI: 1.03–1.21, p = 4.8×10−3). DNA glycosylases involved in the first steps of the BER pathway may be associated with cancer risk in BRCA1/2 mutation carriers and should be more comprehensively studied. PMID:24698998

S81L and G170R mutations causing Primary Hyperoxaluria type I in homozygosis and heterozygosis: an example of positive interallelic complementation

PubMed Central

Montioli, Riccardo; Roncador, Alessandro; Oppici, Elisa; Mandrile, Giorgia; Giachino, Daniela Francesca; Cellini, Barbara; Borri Voltattorni, Carla

2014-01-01

Primary Hyperoxaluria type I (PH1) is a rare disease due to the deficit of peroxisomal alanine:glyoxylate aminotransferase (AGT), a homodimeric pyridoxal-5′-phosphate (PLP) enzyme present in humans as major (Ma) and minor (Mi) allele. PH1-causing mutations are mostly missense identified in both homozygous and compound heterozygous patients. Until now, the pathogenesis of PH1 has been only studied by approaches mimicking homozygous patients, whereas the molecular aspects of the genotype-enzymatic-clinical phenotype relationship in compound heterozygous patients are completely unknown. Here, for the first time, we elucidate the enzymatic phenotype linked to the S81L mutation on AGT-Ma, relative to a PLP-binding residue, and how it changes when the most common mutation G170R on AGT-Mi, known to cause AGT mistargeting without affecting the enzyme functionality, is present in the second allele. By using a bicistronic eukaryotic expression vector, we demonstrate that (i) S81L-Ma is mainly in its apo-form and has a significant peroxisomal localization and (ii) S81L and G170R monomers interact giving rise to the G170R-Mi/S81L-Ma holo-form, which is imported into peroxisomes and exhibits an enhanced functionality with respect to the parental enzymes. These data, integrated with the biochemical features of the heterodimer and the homodimeric counterparts in their purified recombinant form, (i) highlight the molecular basis of the pathogenicity of S81L-Ma and (ii) provide evidence for a positive interallelic complementation between the S81L and G170R monomers. Our study represents a valid approach to investigate the molecular pathogenesis of PH1 in compound heterozygous patients. PMID:24990153

Cancer Incidence in First- and Second-Degree Relatives of BRCA1 and BRCA2 Mutation Carriers.

PubMed

Streff, Haley; Profato, Jessica; Ye, Yuanqing; Nebgen, Denise; Peterson, Susan K; Singletary, Claire; Arun, Banu K; Litton, Jennifer K

2016-07-01

Mutations in the BRCA1 and BRCA2 genes are associated with increased risk of breast, ovarian, and several other cancers. The purpose of the present study was to evaluate the incidence of cancer in first- and second-degree relatives of BRCA mutation carriers compared with the general population. A total of 1,086 pedigrees of BRCA mutation carriers was obtained from a prospectively maintained, internal review board-approved study of persons referred for clinical genetic counseling at the University of Texas MD Anderson Cancer Center. We identified 9,032 first- and second-degree relatives from 784 pedigrees that had demonstrated a clear indication of parental origin of mutation. Standardized incidence ratios (SIRs) were used to compare the observed incidence of 20 primary cancer sites to the expected incidence of each cancer based on the calculated risk estimates according to each subject's age, sex, and ethnicity. BRCA1 families had increased SIRs for breast and ovarian cancer (p < .001) and decreased SIRs for kidney, lung, prostate, and thyroid cancer and non-Hodgkin's lymphoma (p < .001). BRCA2 families had increased SIRs for breast, ovarian, and pancreatic cancer (p < .001) and decreased SIRs for kidney, lung, thyroid, and uterine cancer and non-Hodgkin's lymphoma (p < .0025). Analysis of only first-degree relatives (n = 4,099) identified no decreased SIRs and agreed with the increased SIRs observed in the overall study population. We have confirmed previous reports of an association between breast, ovarian, and pancreatic cancers with BRCA mutations. Additional research to quantify the relative risks of these cancers for BRCA mutation carriers can help tailor recommendations for risk reduction and enhance genetic counseling. BRCA gene mutations have been well described to carry an increased risk of both breast and ovarian cancer. However, the implications and risks of other cancers continues to be investigated. Evaluating the risks for other cancers further is

Germline BRCA mutations are associated with higher risk of nodal involvement, distant metastasis, and poor survival outcomes in prostate cancer.

PubMed

Castro, Elena; Goh, Chee; Olmos, David; Saunders, Ed; Leongamornlert, Daniel; Tymrakiewicz, Malgorzata; Mahmud, Nadiya; Dadaev, Tokhir; Govindasami, Koveela; Guy, Michelle; Sawyer, Emma; Wilkinson, Rosemary; Ardern-Jones, Audrey; Ellis, Steve; Frost, Debra; Peock, Susan; Evans, D Gareth; Tischkowitz, Marc; Cole, Trevor; Davidson, Rosemarie; Eccles, Diana; Brewer, Carole; Douglas, Fiona; Porteous, Mary E; Donaldson, Alan; Dorkins, Huw; Izatt, Louise; Cook, Jackie; Hodgson, Shirley; Kennedy, M John; Side, Lucy E; Eason, Jacqueline; Murray, Alex; Antoniou, Antonis C; Easton, Douglas F; Kote-Jarai, Zsofia; Eeles, Rosalind

2013-05-10

To analyze the baseline clinicopathologic characteristics of prostate tumors with germline BRCA1 and BRCA2 (BRCA1/2) mutations and the prognostic value of those mutations on prostate cancer (PCa) outcomes. This study analyzed the tumor features and outcomes of 2,019 patients with PCa (18 BRCA1 carriers, 61 BRCA2 carriers, and 1,940 noncarriers). The Kaplan-Meier method and Cox regression analysis were used to evaluate the associations between BRCA1/2 status and other PCa prognostic factors with overall survival (OS), cause-specific OS (CSS), CSS in localized PCa (CSS_M0), metastasis-free survival (MFS), and CSS from metastasis (CSS_M1). PCa with germline BRCA1/2 mutations were more frequently associated with Gleason ≥ 8 (P = .00003), T3/T4 stage (P = .003), nodal involvement (P = .00005), and metastases at diagnosis (P = .005) than PCa in noncarriers. CSS was significantly longer in noncarriers than in carriers (15.7 v 8.6 years, multivariable analyses [MVA] P = .015; hazard ratio [HR] = 1.8). For localized PCa, 5-year CSS and MFS were significantly higher in noncarriers (96% v 82%; MVA P = .01; HR = 2.6%; and 93% v 77%; MVA P = .009; HR = 2.7, respectively). Subgroup analyses confirmed the poor outcomes in BRCA2 patients, whereas the role of BRCA1 was not well defined due to the limited size and follow-up in this subgroup. Our results confirm that BRCA1/2 mutations confer a more aggressive PCa phenotype with a higher probability of nodal involvement and distant metastasis. BRCA mutations are associated with poor survival outcomes and this should be considered for tailoring clinical management of these patients.

Prevalence and Characterization of Somatic Mutations in Chinese Aldosterone-Producing Adenoma Patients

PubMed Central

Wang, Baojun; Li, Xintao; Zhang, Xu; Ma, Xin; Chen, Luyao; Zhang, Yu; Lyu, Xiangjun; Tang, Yuzhe; Huang, Qingbo; Gao, Yu; Fan, Yang; Ouyang, Jinzhi

2015-01-01

Abstract Recently somatic mutations of KCNJ5, ATP1A1, ATP2B3, and CACNA1D have been identified in patients with aldosterone-producing adenoma (APA). The present study sequenced the DNA in the tissues and blood samples from Chinese patients with APA for KCNJ5, ATP1A1, ATP2B3, and CACNA1D gene mutations. Among the 114 patients, 86 (75.4%) were identified with KCNJ5 somatic mutations, including 3 previously reported (G151R, L168R, T158A) and 2 other unreported mutations. One patient presented with both a point mutation (E147) and an insertion mutation, whereas another had a 36-base duplication, G153_G164dup. No mutation of ATP1A1 and ATP2B3 in the known hotspots was identified and only 1 male patient was detected with a novel CACNA1D mutation, V748I. Unlike other studies, male and female patients had similar KCNJ5 mutation rates (76.9% vs 74.2%). Mutation carriers were younger and had lower preoperative potassium level, whereas male (but not female) mutation carriers had higher preoperative plasma aldosterone concentration and preoperative blood pressures. Mutation carriers also had higher LV mass index (LVMI) than nonmutation carriers. After surgery, LVMI improved significantly in the KCNJ5 mutation group but not in the nonmutation group. The mRNA expression of KCNJ5, CYP11B2, and ATP2B3 was higher in the KCNJ5-mutated APA tissues. Functional characterization of the 2 novel KCNJ5 mutations showed that they were associated with decreased proliferation, membrane depolarization, elevated secretion of aldosterone, and increased expression of CYP11B1 and CYP11B2. In conclusion, Chinese APA patients appear to have a high frequency of somatic KCNJ5 mutation. Mutation prevalence rates are similar among men and women and 2 novel mutations are identified. KCNJ5-mutated patients benefit more from surgical resection of APA than nonmutated patients. PMID:25906099

Phenotypic Variability in Autosomal Dominant Familial Alzheimer Disease due to the S170F Mutation of Presenilin-1.

PubMed

Tiedt, Hannes O; Benjamin, Beate; Niedeggen, Michael; Lueschow, Andreas

2018-02-22

In rare cases, patients with Alzheimer disease (AD) present at an early age and with a family history suggestive of an autosomal dominant mode of inheritance. Mutations of the presenilin-1 (PSEN1) gene are the most common causes of dementia in these patients. Early-onset and particularly familial AD patients frequently present with variable non-amnestic cognitive symptoms such as visual, language or behavioural changes as well as non-cognitive, e.g. motor, symptoms. To investigate the phenotypic variability in carriers of the PSEN1 S170F mutation. We report a family with 4 patients carrying the S170F mutation of whom 2 underwent detailed clinical examinations. We discuss our current findings in the context of previously reported S170F cases. The clinical phenotype was consistent regarding initial memory impairment and early onset in the late twenties found in all S170F patients. There were frequent non-amnestic cognitive changes and, at early stages of the disease, indications of a more pronounced disturbance of visuospatial abilities as compared to face and object recognition. Non-cognitive symptoms most often included myoclonus and cerebellar ataxia. A review of the available case reports indicates some phenotypic variability associated with the S170F mutation including different constellations of symptoms such as parkinsonism and delusions. The variable clinical findings associated with the S170F mutation highlight the relevance of atypical phenotypes in the context of research and under a clinical perspective. CSF sampling and detection of Aβ species may be essential to indicate AD pathology in unclear cases presenting with cognitive and motor symptoms at a younger age. © 2018 S. Karger AG, Basel.

G protein-coupled receptor mutations and human genetic disease.

PubMed

Thompson, Miles D; Hendy, Geoffrey N; Percy, Maire E; Bichet, Daniel G; Cole, David E C

2014-01-01

Genetic variations in G protein-coupled receptor genes (GPCRs) disrupt GPCR function in a wide variety of human genetic diseases. In vitro strategies and animal models have been used to identify the molecular pathologies underlying naturally occurring GPCR mutations. Inactive, overactive, or constitutively active receptors have been identified that result in pathology. These receptor variants may alter ligand binding, G protein coupling, receptor desensitization and receptor recycling. Receptor systems discussed include rhodopsin, thyrotropin, parathyroid hormone, melanocortin, follicle-stimulating hormone (FSH), luteinizing hormone, gonadotropin-releasing hormone (GNRHR), adrenocorticotropic hormone, vasopressin, endothelin-β, purinergic, and the G protein associated with asthma (GPRA or neuropeptide S receptor 1 (NPSR1)). The role of activating and inactivating calcium-sensing receptor (CaSR) mutations is discussed in detail with respect to familial hypocalciuric hypercalcemia (FHH) and autosomal dominant hypocalemia (ADH). The CASR mutations have been associated with epilepsy. Diseases caused by the genetic disruption of GPCR functions are discussed in the context of their potential to be selectively targeted by drugs that rescue altered receptors. Examples of drugs developed as a result of targeting GPCRs mutated in disease include: calcimimetics and calcilytics, therapeutics targeting melanocortin receptors in obesity, interventions that alter GNRHR loss from the cell surface in idiopathic hypogonadotropic hypogonadism and novel drugs that might rescue the P2RY12 receptor congenital bleeding phenotype. De-orphanization projects have identified novel disease-associated receptors, such as NPSR1 and GPR35. The identification of variants in these receptors provides genetic reagents useful in drug screens. Discussion of the variety of GPCRs that are disrupted in monogenic Mendelian disorders provides the basis for examining the significance of common

Cancer spectrum in DNA mismatch repair gene mutation carriers: results from a hospital based Lynch syndrome registry

PubMed Central

Pande, Mala; Wei, Chongjuan; Chen, Jinyun; Amos, Christopher I.; Lynch, Patrick M.; Lu, Karen H.; Lucio, Laura A.; Boyd-Rogers, Stephanie G.; Bannon, Sarah A.; Mork, Maureen E.

2012-01-01

The spectrum of cancers seen in a hospital based Lynch syndrome registry of mismatch repair gene mutation carriers was examined to determine the distribution of cancers and examine excess cancer risk. Overall there were 504 cancers recorded in 368 mutation carriers from 176 families. These included 236 (46.8 %) colorectal and 268 (53.2 %) extracolonic cancers. MLH1 mutation carriers had a higher frequency of colorectal cancers whereas MSH2, MSH6 and PMS2 mutation carriers had more extracolonic cancers although these differences were not statistically significant. Men had fewer extracolonic cancers than colorectal (45.3 vs. 54.7 %), whereas women had more extracolonic than colorectal cancers (59.0 vs. 41.0 %). The mean age at diagnosis overall for extracolonic cancers was older than for colorectal, 49.1 versus 44.8 years (P ≤ 0.001). As expected, the index cancer was colorectal in 58.1 % of patients and among the extracolonic index cancers, endometrial was the most common (13.8 %). A significant number of non-Lynch syndrome index cancers were recorded including breast (n = 5) prostate (n = 3), thyroid (n = 3), cervix (n = 3), melanoma (n = 3), and 1 case each of thymoma, sinus cavity, and adenocarcinoma of the lung. However, standardized incidence ratios calculated to assess excess cancer risk showed that only those cancers known to be associated with Lynch syndrome were significant in our sample. We found that Lynch syndrome patients can often present with cancers that are not considered part of Lynch syndrome. This has clinical relevance both for diagnosis of Lynch syndrome and surveillance for cancers of different sites during follow-up of these patients. PMID:22714864

No association of TGFB1 L10P genotypes and breast cancer risk in BRCA1 and BRCA2 mutation carriers: a multi-center cohort study

PubMed Central

Antoniou, Antonis C.; Llopis, Trinidad Caldes; Nevanlinna, Heli; Aittomäki, Kristiina; Simard, Jacques; Spurdle, Amanda B.; Couch, Fergus J.; Pereira, Lutecia H. Mateus; Greene, Mark H.; Andrulis, Irene L.; Pasche, Boris; Kaklamani, Virginia; Hamann, Ute; Szabo, Csilla; Peock, Susan; Cook, Margaret; Harrington, Patricia A.; Donaldson, Alan; Male, Allison M.; Gardiner, Carol Anne; Gregory, Helen; Side, Lucy E.; Robinson, Anne C.; Emmerson, Louise; Ellis, Ian; Peyrat, Jean-Philippe; Fournier, Joëlle; Vennin, Philippe; Adenis, Claude; Muller, Danièle; Fricker, Jean-Pierre; Longy, Michel; Sinilnikova, Olga M.; Stoppa-Lyonnet, Dominique; Schmutzler, Rita K.; Versmold, Beatrix; Engel, Christoph; Meindl, Alfons; Kast, Karin; Schaefer, Dieter; Froster, Ursula G.; Chenevix-Trench, Georgia; Easton, Douglas F.

2008-01-01

Background The transforming growth factor β-1 gene (TGFB1) is a plausible candidate for breast cancer susceptibility. The L10P variant of TGFB1 is associated with higher circulating levels and secretion of TGF-β, and recent large-scale studies suggest strongly that this variant is associated with breast cancer risk in the general population. Methods To evaluate whether TGFB1 L10P also modifies the risk of breast cancer in BRCA1 or BRCA2 mutation carriers, we undertook a multi-center study of 3,442 BRCA1 and 2,095 BRCA2 mutation carriers. Results We found no evidence of association between TGFB1 L10P and breast cancer risk in either BRCA1 or BRCA2 mutation carriers. The per-allele HR for the L10P variant was 1.01 (95%CI: 0.92–1.11) in BRCA1 carriers and 0.92 (95%CI: 0.81–1.04) in BRCA2 mutation carriers. Conclusions These results do not support the hypothesis that TGFB1 L10P genotypes modify the risk of breast cancer in BRCA1 or BRCA2 mutation carriers. PMID:18523885

Structure-based mutational analysis of the 4'-phosphopantetheinyl transferases Sfp from Bacillus subtilis: carrier protein recognition and reaction mechanism.

PubMed

Mofid, Mohammad Reza; Finking, Robert; Essen, Lars Oliver; Marahiel, Mohamed A

2004-04-13

The activation of apo-peptidyl carrier proteins (PCPs) of nonribosomal peptide synthetases (NRPSs), apo-acyl carrier proteins (ACPs) of polyketide synthases (PKSs), and fatty acid synthases (FASs) to their active holo form is accomplished with dedicated 4'-phosphopantetheinyl transferases (PPTases). They catalyze the transfer of the essential prosthetic group 4'-phosphopantetheine (4'-Ppant) from coenzyme A (CoA) to a highly conserved serine residue in all PCPs and ACPs. PPTases, based on sequence and substrate specifity, have been classified into three types: bacterial holo-acyl carrier protein synthase (AcpS), fatty acid synthase of eukaryotes (FAS2) and Sfp, a PPTase of secondary metabolism. The recently solved crystal structures of AcpS and Sfp-type PPTases with CoA revealed a common alpha + beta-fold with a beta(1)alpha(3)beta(2) motif and similarities in CoA binding and polymerization mode. However, it was not possible to discern neither the PCP binding region of Sfp nor the priming reaction mechanism from the Sfp-CoA cocrystal. In this work, we provide a model for the reaction mechanism based on mutational analysis of Sfp that suggests a reaction mechanism in which the highly conserved E151 deprotonates the hydroxyl group of the invariant serine of PCP. That, in turn, acts as a nucleophile to attack the beta-phosphate of CoA. The Sfp mutants K112, E117, and K120 further revealed that the loop region between beta4 and alpha5 (residues T111-S124) in Sfp is the PCP binding region. Also, residues T44, K75, S89, H90, D107, E109, E151, and K155 that have been shown in the Sfp-CoA cocrystal structure to coordinate CoA are now all confirmed by mutational and biochemical analysis.

Common alleles at 6q25.1 and 1p11.2 are associated with breast cancer risk for BRCA1 and BRCA2 mutation carriers

PubMed Central

Antoniou, Antonis C; Kartsonaki, Christiana; Sinilnikova, Olga M.; Soucy, Penny; McGuffog, Lesley; Healey, Sue; Lee, Andrew; Peterlongo, Paolo; Manoukian, Siranoush; Peissel, Bernard; Zaffaroni, Daniela; Cattaneo, Elisa; Barile, Monica; Pensotti, Valeria; Pasini, Barbara; Dolcetti, Riccardo; Giannini, Giuseppe; Laura Putignano, Anna; Varesco, Liliana; Radice, Paolo; Mai, Phuong L.; Greene, Mark H.; Andrulis, Irene L.; Glendon, Gord; Ozcelik, Hilmi; Thomassen, Mads; Gerdes, Anne-Marie; Kruse, Torben A.; Birk Jensen, Uffe; Crüger, Dorthe G.; Caligo, Maria A.; Laitman, Yael; Milgrom, Roni; Kaufman, Bella; Paluch-Shimon, Shani; Friedman, Eitan; Loman, Niklas; Harbst, Katja; Lindblom, Annika; Arver, Brita; Ehrencrona, Hans; Melin, Beatrice; Nathanson, Katherine L.; Domchek, Susan M.; Rebbeck, Timothy; Jakubowska, Ania; Lubinski, Jan; Gronwald, Jacek; Huzarski, Tomasz; Byrski, Tomasz; Cybulski, Cezary; Gorski, Bohdan; Osorio, Ana; Ramón y Cajal, Teresa; Fostira, Florentia; Andrés, Raquel; Benitez, Javier; Hamann, Ute; Hogervorst, Frans B.; Rookus, Matti A.; Hooning, Maartje J.; Nelen, Marcel R.; van der Luijt, Rob B.; van Os, Theo A.M.; van Asperen, Christi J.; Devilee, Peter; Meijers-Heijboer, Hanne E.J.; Gómez Garcia, Encarna B.; Peock, Susan; Cook, Margaret; Frost, Debra; Platte, Radka; Leyland, Jean; Gareth Evans, D.; Lalloo, Fiona; Eeles, Ros; Izatt, Louise; Adlard, Julian; Davidson, Rosemarie; Eccles, Diana; Ong, Kai-ren; Cook, Jackie; Douglas, Fiona; Paterson, Joan; John Kennedy, M.; Miedzybrodzka, Zosia; Godwin, Andrew; Stoppa-Lyonnet, Dominique; Buecher, Bruno; Belotti, Muriel; Tirapo, Carole; Mazoyer, Sylvie; Barjhoux, Laure; Lasset, Christine; Leroux, Dominique; Faivre, Laurence; Bronner, Myriam; Prieur, Fabienne; Nogues, Catherine; Rouleau, Etienne; Pujol, Pascal; Coupier, Isabelle; Frénay, Marc; Hopper, John L.; Daly, Mary B.; Terry, Mary B.; John, Esther M.; Buys, Saundra S.; Yassin, Yosuf; Miron, Alexander; Goldgar, David; Singer, Christian F.; Tea, Muy-Kheng; Pfeiler, Georg; Catharina Dressler, Anne; Hansen, Thomas v.O.; Jønson, Lars; Ejlertsen, Bent; Bjork Barkardottir, Rosa; Kirchhoff, Tomas; Offit, Kenneth; Piedmonte, Marion; Rodriguez, Gustavo; Small, Laurie; Boggess, John; Blank, Stephanie; Basil, Jack; Azodi, Masoud; Ewart Toland, Amanda; Montagna, Marco; Tognazzo, Silvia; Agata, Simona; Imyanitov, Evgeny; Janavicius, Ramunas; Lazaro, Conxi; Blanco, Ignacio; Pharoah, Paul D.P.; Sucheston, Lara; Karlan, Beth Y.; Walsh, Christine S.; Olah, Edith; Bozsik, Aniko; Teo, Soo-Hwang; Seldon, Joyce L.; Beattie, Mary S.; van Rensburg, Elizabeth J.; Sluiter, Michelle D.; Diez, Orland; Schmutzler, Rita K.; Wappenschmidt, Barbara; Engel, Christoph; Meindl, Alfons; Ruehl, Ina; Varon-Mateeva, Raymonda; Kast, Karin; Deissler, Helmut; Niederacher, Dieter; Arnold, Norbert; Gadzicki, Dorothea; Schönbuchner, Ines; Caldes, Trinidad; de la Hoya, Miguel; Nevanlinna, Heli; Aittomäki, Kristiina; Dumont, Martine; Chiquette, Jocelyne; Tischkowitz, Marc; Chen, Xiaoqing; Beesley, Jonathan; Spurdle, Amanda B.; Neuhausen, Susan L.; Chun Ding, Yuan; Fredericksen, Zachary; Wang, Xianshu; Pankratz, Vernon S.; Couch, Fergus; Simard, Jacques; Easton, Douglas F.; Chenevix-Trench, Georgia

2011-01-01

Two single nucleotide polymorphisms (SNPs) at 6q25.1, near the ESR1 gene, have been implicated in the susceptibility to breast cancer for Asian (rs2046210) and European women (rs9397435). A genome-wide association study in Europeans identified two further breast cancer susceptibility variants: rs11249433 at 1p11.2 and rs999737 in RAD51L1 at 14q24.1. Although previously identified breast cancer susceptibility variants have been shown to be associated with breast cancer risk for BRCA1 and BRCA2 mutation carriers, the involvement of these SNPs to breast cancer susceptibility in mutation carriers is currently unknown. To address this, we genotyped these SNPs in BRCA1 and BRCA2 mutation carriers from 42 studies from the Consortium of Investigators of Modifiers of BRCA1/2. In the analysis of 14 123 BRCA1 and 8053 BRCA2 mutation carriers of European ancestry, the 6q25.1 SNPs (r2 = 0.14) were independently associated with the risk of breast cancer for BRCA1 mutation carriers [hazard ratio (HR) = 1.17, 95% confidence interval (CI): 1.11–1.23, P-trend = 4.5 × 10−9 for rs2046210; HR = 1.28, 95% CI: 1.18–1.40, P-trend = 1.3 × 10−8 for rs9397435], but only rs9397435 was associated with the risk for BRCA2 carriers (HR = 1.14, 95% CI: 1.01–1.28, P-trend = 0.031). SNP rs11249433 (1p11.2) was associated with the risk of breast cancer for BRCA2 mutation carriers (HR = 1.09, 95% CI: 1.02–1.17, P-trend = 0.015), but was not associated with breast cancer risk for BRCA1 mutation carriers (HR = 0.97, 95% CI: 0.92–1.02, P-trend = 0.20). SNP rs999737 (RAD51L1) was not associated with breast cancer risk for either BRCA1 or BRCA2 mutation carriers (P-trend = 0.27 and 0.30, respectively). The identification of SNPs at 6q25.1 associated with breast cancer risk for BRCA1 mutation carriers will lead to a better understanding of the biology of tumour development in these women. PMID:21593217

Common breast cancer susceptibility alleles and the risk of breast cancer for BRCA1 and BRCA2 mutation carriers: implications for risk prediction

PubMed Central

Antoniou, Antonis C; Beesley, Jonathan; McGuffog, Lesley; Sinilnikova, Olga M.; Healey, Sue; Neuhausen, Susan L.; Ding, Yuan Chun; Rebbeck, Timothy R.; Weitzel, Jeffrey N.; Lynch, Henry T.; Isaacs, Claudine; Ganz, Patricia A.; Tomlinson, Gail; Olopade, Olufunmilayo I.; Couch, Fergus J.; Wang, Xianshu; Lindor, Noralane M.; Pankratz, Vernon S.; Radice, Paolo; Manoukian, Siranoush; Peissel, Bernard; Zaffaroni, Daniela; Barile, Monica; Viel, Alessandra; Allavena, Anna; Dall’Olio, Valentina; Peterlongo, Paolo; Szabo, Csilla I.; Zikan, Michal; Claes, Kathleen; Poppe, Bruce; Foretova, Lenka; Mai, Phuong L.; Greene, Mark H.; Rennert, Gad; Lejbkowicz, Flavio; Glendon, Gord; Ozcelik, Hilmi; Andrulis, Irene L.; Thomassen, Mads; Gerdes, Anne-Marie; Sunde, Lone; Cruger, Dorthe; Jensen, Uffe Birk; Caligo, Maria; Friedman, Eitan; Kaufman, Bella; Laitman, Yael; Milgrom, Roni; Dubrovsky, Maya; Cohen, Shimrit; Borg, Ake; Jernström, Helena; Lindblom, Annika; Rantala, Johanna; Stenmark-Askmalm, Marie; Melin, Beatrice; Nathanson, Kate; Domchek, Susan; Jakubowska, Ania; Lubinski, Jan; Huzarski, Tomasz; Osorio, Ana; Lasa, Adriana; Durán, Mercedes; Tejada, Maria-Isabel; Godino, Javier; Benitez, Javier; Hamann, Ute; Kriege, Mieke; Hoogerbrugge, Nicoline; van der Luijt, Rob B; van Asperen, Christi J; Devilee, Peter; Meijers-Heijboer, E.J.; Blok, Marinus J; Aalfs, Cora M.; Hogervorst, Frans; Rookus, Matti; Cook, Margaret; Oliver, Clare; Frost, Debra; Conroy, Don; Evans, D. Gareth; Lalloo, Fiona; Pichert, Gabriella; Davidson, Rosemarie; Cole, Trevor; Cook, Jackie; Paterson, Joan; Hodgson, Shirley; Morrison, Patrick J.; Porteous, Mary E.; Walker, Lisa; Kennedy, M. John; Dorkins, Huw; Peock, Susan; Godwin, Andrew K.; Stoppa-Lyonnet, Dominique; de Pauw, Antoine; Mazoyer, Sylvie; Bonadona, Valérie; Lasset, Christine; Dreyfus, Hélène; Leroux, Dominique; Hardouin, Agnès; Berthet, Pascaline; Faivre, Laurence; Loustalot, Catherine; Noguchi, Tetsuro; Sobol, Hagay; Rouleau, Etienne; Nogues, Catherine; Frénay, Marc; Vénat-Bouvet, Laurence; Hopper, John L.; Daly, Mary B.; Terry, Mary B.; John, Esther M.; Buys, Saundra S.; Yassin, Yosuf; Miron, Alex; Goldgar, David; Singer, Christian F.; Dressler, Anne Catharina; Gschwantler-Kaulich, Daphne; Pfeiler, Georg; Hansen, Thomas V. O.; Jønson, Lars; Agnarsson, Bjarni A.; Kirchhoff, Tomas; Offit, Kenneth; Devlin, Vincent; Dutra-Clarke, Ana; Piedmonte, Marion; Rodriguez, Gustavo C.; Wakeley, Katie; Boggess, John F.; Basil, Jack; Schwartz, Peter E.; Blank, Stephanie V.; Toland, Amanda Ewart; Montagna, Marco; Casella, Cinzia; Imyanitov, Evgeny; Tihomirova, Laima; Blanco, Ignacio; Lazaro, Conxi; Ramus, Susan J.; Sucheston, Lara; Karlan, Beth Y.; Gross, Jenny; Schmutzler, Rita; Wappenschmidt, Barbara; Engel, Christoph; Meindl, Alfons; Lochmann, Magdalena; Arnold, Norbert; Heidemann, Simone; Varon-Mateeva, Raymonda; Niederacher, Dieter; Sutter, Christian; Deissler, Helmut; Gadzicki, Dorothea; Preisler-Adams, Sabine; Kast, Karin; Schönbuchner, Ines; Caldes, Trinidad; de la Hoya, Miguel; Aittomäki, Kristiina; Nevanlinna, Heli; Simard, Jacques; Spurdle, Amanda B.; Holland, Helene; Chen, Xiaoqing; Platte, Radka; Chenevix-Trench, Georgia; Easton, Douglas F.

2010-01-01

The known breast cancer (BC) susceptibility polymorphisms in FGFR2, TNRC9/TOX3, MAP3K1,LSP1 and 2q35 confer increased risks of BC for BRCA1 or BRCA2 mutation carriers. We evaluated the associations of three additional SNPs, rs4973768 in SLC4A7/NEK10, rs6504950 in STXBP4/COX11 and rs10941679 at 5p12 and reanalyzed the previous associations using additional carriers in a sample of 12,525 BRCA1 and 7,409 BRCA2 carriers. Additionally, we investigated potential interactions between SNPs and assessed the implications for risk prediction. The minor alleles of rs4973768 and rs10941679 were associated with increased BC risk for BRCA2 carriers (per-allele Hazard Ratio (HR)=1.10, 95%CI:1.03-1.18, p=0.006 and HR=1.09, 95%CI:1.01-1.19, p=0.03, respectively). Neither SNP was associated with BC risk for BRCA1 carriers and rs6504950 was not associated with BC for either BRCA1 or BRCA2 carriers. Of the nine polymorphisms investigated, seven were associated with BC for BRCA2 carriers (FGFR2, TOX3, MAP3K1, LSP1, 2q35, SLC4A7, 5p12, p-values:7×10−11-0.03), but only TOX3 and 2q35 were associated with the risk for BRCA1 carriers (p=0.0049, 0.03 respectively). All risk associated polymorphisms appear to interact multiplicatively on BC risk for mutation carriers. Based on the joint genotype distribution of the seven risk associated SNPs in BRCA2 mutation carriers, the 5% of BRCA2 carriers at highest risk (i.e. between 95th and 100th percentiles) were predicted to have a probability between 80% and 96% of developing BC by age 80, compared with 42-50% for the 5% of carriers at lowest risk. Our findings indicated that these risk differences may be sufficient to influence the clinical management of mutation carriers. PMID:21118973

Mutations Affecting G-Protein Subunit α11 in Hypercalcemia and Hypocalcemia

PubMed Central

Babinsky, Valerie N.; Head, Rosie A.; Cranston, Treena; Rust, Nigel; Hobbs, Maurine R.; Heath, Hunter; Thakker, Rajesh V.

2013-01-01

BACKGROUND Familial hypocalciuric hypercalcemia is a genetically heterogeneous disorder with three variants: types 1, 2, and 3. Type 1 is due to loss-of-function mutations of the calcium-sensing receptor, a guanine nucleotide–binding protein (G-protein)–coupled receptor that signals through the G-protein subunit α11 (Gα11). Type 3 is associated with adaptor-related protein complex 2, sigma 1 subunit (AP2S1) mutations, which result in altered calcium-sensing receptor endocytosis. We hypothesized that type 2 is due to mutations effecting Gα11 loss of function, since Gα11 is involved in calcium-sensing receptor signaling, and its gene (GNA11) and the type 2 locus are colocalized on chromosome 19p13.3. We also postulated that mutations effecting Gα11 gain of function, like the mutations effecting calcium-sensing receptor gain of function that cause autosomal dominant hypocalcemia type 1, may lead to hypocalcemia. METHODS We performed GNA11 mutational analysis in a kindred with familial hypocalciuric hypercalcemia type 2 and in nine unrelated patients with familial hypocalciuric hypercalcemia who did not have mutations in the gene encoding the calcium-sensing receptor (CASR) or AP2S1. We also performed this analysis in eight unrelated patients with hypocalcemia who did not have CASR mutations. In addition, we studied the effects of GNA11 mutations on Gα11 protein structure and calcium-sensing receptor signaling in human embryonic kidney 293 (HEK293) cells. RESULTS The kindred with familial hypocalciuric hypercalcemia type 2 had an in-frame deletion of a conserved Gα11 isoleucine (Ile200del), and one of the nine unrelated patients with familial hypocalciuric hypercalcemia had a missense GNA11 mutation (Leu135Gln). Missense GNA11 mutations (Arg181Gln and Phe341Leu) were detected in two unrelated patients with hypocalcemia; they were therefore identified as having autosomal dominant hypocalcemia type 2. All four GNA11 mutations predicted disrupted protein

Cancer spectrum in DNA mismatch repair gene mutation carriers: results from a hospital based Lynch syndrome registry.

PubMed

Pande, Mala; Wei, Chongjuan; Chen, Jinyun; Amos, Christopher I; Lynch, Patrick M; Lu, Karen H; Lucio, Laura A; Boyd-Rogers, Stephanie G; Bannon, Sarah A; Mork, Maureen E; Frazier, Marsha L

2012-09-01

The spectrum of cancers seen in a hospital based Lynch syndrome registry of mismatch repair gene mutation carriers was examined to determine the distribution of cancers and examine excess cancer risk. Overall there were 504 cancers recorded in 368 mutation carriers from 176 families. These included 236 (46.8 %) colorectal and 268 (53.2 %) extracolonic cancers. MLH1 mutation carriers had a higher frequency of colorectal cancers whereas MSH2, MSH6 and PMS2 mutation carriers had more extracolonic cancers although these differences were not statistically significant. Men had fewer extracolonic cancers than colorectal (45.3 vs. 54.7 %), whereas women had more extracolonic than colorectal cancers (59.0 vs. 41.0 %). The mean age at diagnosis overall for extracolonic cancers was older than for colorectal, 49.1 versus 44.8 years (P ≤ 0.001). As expected, the index cancer was colorectal in 58.1 % of patients and among the extracolonic index cancers, endometrial was the most common (13.8 %). A significant number of non-Lynch syndrome index cancers were recorded including breast (n = 5) prostate (n = 3), thyroid (n = 3), cervix (n = 3), melanoma (n = 3), and 1 case each of thymoma, sinus cavity, and adenocarcinoma of the lung. However, standardized incidence ratios calculated to assess excess cancer risk showed that only those cancers known to be associated with Lynch syndrome were significant in our sample. We found that Lynch syndrome patients can often present with cancers that are not considered part of Lynch syndrome. This has clinical relevance both for diagnosis of Lynch syndrome and surveillance for cancers of different sites during follow-up of these patients.

Development of breast tumors in CHEK2, NBN/NBS1 and BLM mutation carriers does not commonly involve somatic inactivation of the wild-type allele.

PubMed

Suspitsin, Evgeny N; Yanus, Grigory A; Sokolenko, Anna P; Yatsuk, Olga S; Zaitseva, Olga A; Bessonov, Alexandr A; Ivantsov, Alexandr O; Heinstein, Valeria A; Klimashevskiy, Valery F; Togo, Alexandr V; Imyanitov, Evgeny N

2014-02-01

Somatic inactivation of the remaining allele is a characteristic feature of cancers arising in BRCA1 and BRCA2 mutation carriers, which determines their unprecedented sensitivity to some DNA-damaging agents. Data on tumor-specific status of the involved gene in novel varieties of hereditary breast cancer (BC) remain incomplete. We analyzed 32 tumors obtained from 30 patients with non-BRCA1/2 BC-associated germ-line mutations: 25 women were single mutation carriers (7 BLM, 15 CHEK2 and 3 NBN/NBS1) and 5 were double mutation carriers (2 BLM/BRCA1, 1 CHEK2/BLM, 1 CHEK2/BRCA1 and 1 NBN/BLM). Losses of heterozygosity affecting the wild-type allele were detected in none of the tumors from BLM mutation carriers, 3/18 (17 %) CHEK2-associated BC and 1/4 (25 %) NBN/NBS1-driven tumors. The remaining 28 BC were subjected to the sequence analysis of entire coding region of the involved gene; no somatic mutations were identified. We conclude that the tumor-specific loss of the wild-type allele is not characteristic for BC arising in CHEK2, NBN/NBS1 and BLM mutation carriers. Rarity of "second-hit" inactivation of the involved gene in CHEK2-, NBN/NBS1- and BLM-associated BC demonstrates their substantial biological difference from BRCA1/2-driven cancers and makes them poorly suitable for the clinical trials with cisplatin and PARP inhibitors.

The G matrix under fluctuating correlational mutation and selection.

PubMed

Revell, Liam J

2007-08-01

Theoretical quantitative genetics provides a framework for reconstructing past selection and predicting future patterns of phenotypic differentiation. However, the usefulness of the equations of quantitative genetics for evolutionary inference relies on the evolutionary stability of the additive genetic variance-covariance matrix (G matrix). A fruitful new approach for exploring the evolutionary dynamics of G involves the use of individual-based computer simulations. Previous studies have focused on the evolution of the eigenstructure of G. An alternative approach employed in this paper uses the multivariate response-to-selection equation to evaluate the stability of G. In this approach, I measure similarity by the correlation between response-to-selection vectors due to random selection gradients. I analyze the dynamics of G under several conditions of correlational mutation and selection. As found in a previous study, the eigenstructure of G is stabilized by correlational mutation and selection. However, over broad conditions, instability of G did not result in a decreased consistency of the response to selection. I also analyze the stability of G when the correlation coefficients of correlational mutation and selection and the effective population size change through time. To my knowledge, no prior study has used computer simulations to investigate the stability of G when correlational mutation and selection fluctuate. Under these conditions, the eigenstructure of G is unstable under some simulation conditions. Different results are obtained if G matrix stability is assessed by eigenanalysis or by the response to random selection gradients. In this case, the response to selection is most consistent when certain aspects of the eigenstructure of G are least stable and vice versa.

BRCA1 and BRCA2 founder mutations account for 78% of germline carriers among hereditary breast cancer families in Chile

PubMed Central

Alvarez, Carolina; Tapia, Teresa; Perez-Moreno, Elisa; Gajardo-Meneses, Patricia; Ruiz, Catalina; Rios, Mabel; Missarelli, Claudio; Silva, Mariela; Cruz, Adolfo; Matamala, Luis; Carvajal-Carmona, Luis; Camus, Mauricio; Carvallo, Pilar

2017-01-01

Identifying founder mutations in BRCA1 and BRCA2 in specific populations constitute a valuable opportunity for genetic screening. Several studies from different populations have reported recurrent and/or founder mutations representing a relevant proportion of BRCA mutation carriers. In Latin America, only few founder mutations have been described. We screened 453 Chilean patients with hereditary breast cancer for mutations in BRCA1 and BRCA2. For recurrent mutations, we genotyped 11 microsatellite markers in BRCA1 and BRCA2 in order to determine a founder effect through haplotype analysis. We found a total of 25 mutations (6 novel) in 71 index patients among which, nine are present exclusively in Chilean patients. Our analysis revealed the presence of nine founder mutations, 4 in BRCA1 and 5 in BRCA2, shared by 2 to 10 unrelated families and spread in different regions of Chile. Our panel contains the highest amount of founder mutations until today and represents the highest percentage (78%) of BRCA1 and BRCA2 mutation carriers. We suggest that the dramatic reduction of Amerindian population due to smallpox and wars with Spanish conquerors, a scarce population increase during 300 years, and the geographic position of Chile constituted a favorable scenario to establish founder genetic markers in our population. PMID:29088781

Mesocorticolimbic Connectivity and Volumetric Alterations in DCC Mutation Carriers.

PubMed

Vosberg, Daniel E; Zhang, Yu; Menegaux, Aurore; Chalupa, Amanda; Manitt, Colleen; Zehntner, Simone; Eng, Conrad; DeDuck, Kristina; Allard, Dominique; Durand, France; Dagher, Alain; Benkelfat, Chawki; Srour, Myriam; Joober, Ridha; Lepore, Franco; Rouleau, Guy; Théoret, Hugo; Bedell, Barry J; Flores, Cecilia; Leyton, Marco

2018-05-16

The axon guidance cue receptor DCC (deleted in colorectal cancer) plays a critical role in the organization of mesocorticolimbic pathways in rodents. To investigate whether this occurs in humans, we measured (1) anatomical connectivity between the substantia nigra/ventral tegmental area (SN/VTA) and forebrain targets, (2) striatal and cortical volumes, and (3) putatively associated traits and behaviors. To assess translatability, morphometric data were also collected in Dcc -haploinsufficient mice. The human volunteers were 20 DCC +/- mutation carriers, 16 DCC +/+ relatives, and 20 DCC +/+ unrelated healthy volunteers (UHVs; 28 females). The mice were 11 Dcc +/- and 16 wild-type C57BL/6J animals assessed during adolescence and adulthood. Compared with both control groups, the human DCC +/- carriers exhibited the following: (1) reduced anatomical connectivity from the SN/VTA to the ventral striatum [ DCC +/+ : p = 0.0005, r ( effect size ) = 0.60; UHV: p = 0.0029, r = 0.48] and ventral medial prefrontal cortex ( DCC +/+ : p = 0.0031, r = 0.53; UHV: p = 0.034, r = 0.35); (2) lower novelty-seeking scores ( DCC +/+ : p = 0.034, d = 0.82; UHV: p = 0.019, d = 0.84); and (3) reduced striatal volume ( DCC +/+ : p = 0.0009, d = 1.37; UHV: p = 0.0054, d = 0.93). Striatal volumetric reductions were also present in Dcc +/- mice, and these were seen during adolescence ( p = 0.0058, d = 1.09) and adulthood ( p = 0.003, d = 1.26). Together these findings provide the first evidence in humans that an axon guidance gene is involved in the formation of mesocorticolimbic circuitry and related behavioral traits, providing mechanisms through which DCC mutations might affect susceptibility to diverse neuropsychiatric disorders. SIGNIFICANCE STATEMENT Opportunities to study the effects of axon guidance molecules on human brain development have been rare. Here, the identification of a large four-generational family that carries a mutation to the axon guidance molecule receptor gene, DCC

Prevalence of glucocerebrosidase mutations in the Israeli Ashkenazi Jewish population.

PubMed

Horowitz, M; Pasmanik-Chor, M; Borochowitz, Z; Falik-Zaccai, T; Heldmann, K; Carmi, R; Parvari, R; Beit-Or, H; Goldman, B; Peleg, L; Levy-Lahad, E; Renbaum, P; Legum, S; Shomrat, R; Yeger, H; Benbenisti, D; Navon, R; Dror, V; Shohat, M; Magal, N; Navot, N; Eyal, N

1998-01-01

Gaucher disease is the most prevalent inherited disease among Ashkenazi Jews. It is very heterogeneous due to a large number of mutations within the glucocerebrosidase gene, whose impaired activity is the cause for this disease. Aiming at determining Gaucher carrier frequency among the Ashkenazi Jewish population in Israel, 1,208 individuals were molecularly diagnosed for six mutations known to occur among Ashkenazi Jewish Gaucher patients, using the newly developed Pronto Gaucher kit. The following mutations were tested: N370S, 84GG, IVS2+1, D409H, L444P, and V394L. Molecular testing of these mutations also allows identification of the recTL allele. The results indicated that Gaucher carrier frequency is 1:17 within the tested population. The prevalence of N370S carriers is 1:17.5. This implies that approximately 1:1225 Ashkenazi Jews will be homozygous for the N370S mutation. Actually, in our study of 1,208 individuals one was found to be homozygous for the N370S mutation. The actual number of known Ashkenazi Jewish Gaucher patients with this genotype is much lower than that expected according to the frequency of the N370S mutation, suggesting a low penetrance of this mutation. Results of loading experiments in cells homozygous for the N370S mutation, as well as cells homozygous for the L444P and the D409H mutations, exemplified this phenomenon.

Prevalence of Mitochondrial 12S rRNA Mutations Associated with Aminoglycoside Ototoxicity

ERIC Educational Resources Information Center

Guan, Min-Xin

2005-01-01

The mitochondrial DNA (mtDNA) 12S rRNA is a hot spot for mutations associated with both aminoglycoside-induced and nonsyndromic hearing loss. Of those, the homoplasmic A1555G and C1494T mutations at a highly conserved decoding region of the 12S rRNA have been associated with hearing loss. These two mutations account for a significant number of…

The Landscape of Somatic Genetic Alterations in Breast Cancers From ATM Germline Mutation Carriers.

PubMed

Weigelt, Britta; Bi, Rui; Kumar, Rahul; Blecua, Pedro; Mandelker, Diana L; Geyer, Felipe C; Pareja, Fresia; James, Paul A; Couch, Fergus J; Eccles, Diana M; Blows, Fiona; Pharoah, Paul; Li, Anqi; Selenica, Pier; Lim, Raymond S; Jayakumaran, Gowtham; Waddell, Nic; Shen, Ronglai; Norton, Larry; Wen, Hannah Y; Powell, Simon N; Riaz, Nadeem; Robson, Mark E; Reis-Filho, Jorge S; Chenevix-Trench, Georgia

2018-02-28

Pathogenic germline variants in ataxia-telangiectasia mutated (ATM), a gene that plays a role in DNA damage response and cell cycle checkpoints, confer an increased breast cancer (BC) risk. Here, we investigated the phenotypic characteristics and landscape of somatic genetic alterations in 24 BCs from ATM germline mutation carriers by whole-exome and targeted sequencing. ATM-associated BCs were consistently hormone receptor positive and largely displayed minimal immune infiltrate. Although 79.2% of these tumors exhibited loss of heterozygosity of the ATM wild-type allele, none displayed high activity of mutational signature 3 associated with defective homologous recombination DNA (HRD) repair. No TP53 mutations were found in the ATM-associated BCs. Analysis of an independent data set confirmed that germline ATM variants and TP53 somatic mutations are mutually exclusive. Our findings indicate that ATM-associated BCs often harbor bi-allelic inactivation of ATM, are phenotypically distinct from BRCA1/2-associated BCs, lack HRD-related mutational signatures, and that TP53 and ATM genetic alterations are likely epistatic.

An original phylogenetic approach identified mitochondrial haplogroup T1a1 as inversely associated with breast cancer risk in BRCA2 mutation carriers.

PubMed

Blein, Sophie; Bardel, Claire; Danjean, Vincent; McGuffog, Lesley; Healey, Sue; Barrowdale, Daniel; Lee, Andrew; Dennis, Joe; Kuchenbaecker, Karoline B; Soucy, Penny; Terry, Mary Beth; Chung, Wendy K; Goldgar, David E; Buys, Saundra S; Janavicius, Ramunas; Tihomirova, Laima; Tung, Nadine; Dorfling, Cecilia M; van Rensburg, Elizabeth J; Neuhausen, Susan L; Ding, Yuan Chun; Gerdes, Anne-Marie; Ejlertsen, Bent; Nielsen, Finn C; Hansen, Thomas Vo; Osorio, Ana; Benitez, Javier; Conejero, Raquel Andrés; Segota, Ena; Weitzel, Jeffrey N; Thelander, Margo; Peterlongo, Paolo; Radice, Paolo; Pensotti, Valeria; Dolcetti, Riccardo; Bonanni, Bernardo; Peissel, Bernard; Zaffaroni, Daniela; Scuvera, Giulietta; Manoukian, Siranoush; Varesco, Liliana; Capone, Gabriele L; Papi, Laura; Ottini, Laura; Yannoukakos, Drakoulis; Konstantopoulou, Irene; Garber, Judy; Hamann, Ute; Donaldson, Alan; Brady, Angela; Brewer, Carole; Foo, Claire; Evans, D Gareth; Frost, Debra; Eccles, Diana; Douglas, Fiona; Cook, Jackie; Adlard, Julian; Barwell, Julian; Walker, Lisa; Izatt, Louise; Side, Lucy E; Kennedy, M John; Tischkowitz, Marc; Rogers, Mark T; Porteous, Mary E; Morrison, Patrick J; Platte, Radka; Eeles, Ros; Davidson, Rosemarie; Hodgson, Shirley; Cole, Trevor; Godwin, Andrew K; Isaacs, Claudine; Claes, Kathleen; De Leeneer, Kim; Meindl, Alfons; Gehrig, Andrea; Wappenschmidt, Barbara; Sutter, Christian; Engel, Christoph; Niederacher, Dieter; Steinemann, Doris; Plendl, Hansjoerg; Kast, Karin; Rhiem, Kerstin; Ditsch, Nina; Arnold, Norbert; Varon-Mateeva, Raymonda; Schmutzler, Rita K; Preisler-Adams, Sabine; Markov, Nadja Bogdanova; Wang-Gohrke, Shan; de Pauw, Antoine; Lefol, Cédrick; Lasset, Christine; Leroux, Dominique; Rouleau, Etienne; Damiola, Francesca; Dreyfus, Hélène; Barjhoux, Laure; Golmard, Lisa; Uhrhammer, Nancy; Bonadona, Valérie; Sornin, Valérie; Bignon, Yves-Jean; Carter, Jonathan; Van Le, Linda; Piedmonte, Marion; DiSilvestro, Paul A; de la Hoya, Miguel; Caldes, Trinidad; Nevanlinna, Heli; Aittomäki, Kristiina; Jager, Agnes; van den Ouweland, Ans Mw; Kets, Carolien M; Aalfs, Cora M; van Leeuwen, Flora E; Hogervorst, Frans Bl; Meijers-Heijboer, Hanne Ej; Oosterwijk, Jan C; van Roozendaal, Kees Ep; Rookus, Matti A; Devilee, Peter; van der Luijt, Rob B; Olah, Edith; Diez, Orland; Teulé, Alex; Lazaro, Conxi; Blanco, Ignacio; Del Valle, Jesús; Jakubowska, Anna; Sukiennicki, Grzegorz; Gronwald, Jacek; Lubinski, Jan; Durda, Katarzyna; Jaworska-Bieniek, Katarzyna; Agnarsson, Bjarni A; Maugard, Christine; Amadori, Alberto; Montagna, Marco; Teixeira, Manuel R; Spurdle, Amanda B; Foulkes, William; Olswold, Curtis; Lindor, Noralane M; Pankratz, Vernon S; Szabo, Csilla I; Lincoln, Anne; Jacobs, Lauren; Corines, Marina; Robson, Mark; Vijai, Joseph; Berger, Andreas; Fink-Retter, Anneliese; Singer, Christian F; Rappaport, Christine; Kaulich, Daphne Geschwantler; Pfeiler, Georg; Tea, Muy-Kheng; Greene, Mark H; Mai, Phuong L; Rennert, Gad; Imyanitov, Evgeny N; Mulligan, Anna Marie; Glendon, Gord; Andrulis, Irene L; Tchatchou, Sandrine; Toland, Amanda Ewart; Pedersen, Inge Sokilde; Thomassen, Mads; Kruse, Torben A; Jensen, Uffe Birk; Caligo, Maria A; Friedman, Eitan; Zidan, Jamal; Laitman, Yael; Lindblom, Annika; Melin, Beatrice; Arver, Brita; Loman, Niklas; Rosenquist, Richard; Olopade, Olufunmilayo I; Nussbaum, Robert L; Ramus, Susan J; Nathanson, Katherine L; Domchek, Susan M; Rebbeck, Timothy R; Arun, Banu K; Mitchell, Gillian; Karlan, Beth Y; Lester, Jenny; Orsulic, Sandra; Stoppa-Lyonnet, Dominique; Thomas, Gilles; Simard, Jacques; Couch, Fergus J; Offit, Kenneth; Easton, Douglas F; Chenevix-Trench, Georgia; Antoniou, Antonis C; Mazoyer, Sylvie; Phelan, Catherine M; Sinilnikova, Olga M; Cox, David G

2015-04-25

Individuals carrying pathogenic mutations in the BRCA1 and BRCA2 genes have a high lifetime risk of breast cancer. BRCA1 and BRCA2 are involved in DNA double-strand break repair, DNA alterations that can be caused by exposure to reactive oxygen species, a main source of which are mitochondria. Mitochondrial genome variations affect electron transport chain efficiency and reactive oxygen species production. Individuals with different mitochondrial haplogroups differ in their metabolism and sensitivity to oxidative stress. Variability in mitochondrial genetic background can alter reactive oxygen species production, leading to cancer risk. In the present study, we tested the hypothesis that mitochondrial haplogroups modify breast cancer risk in BRCA1/2 mutation carriers. We genotyped 22,214 (11,421 affected, 10,793 unaffected) mutation carriers belonging to the Consortium of Investigators of Modifiers of BRCA1/2 for 129 mitochondrial polymorphisms using the iCOGS array. Haplogroup inference and association detection were performed using a phylogenetic approach. ALTree was applied to explore the reference mitochondrial evolutionary tree and detect subclades enriched in affected or unaffected individuals. We discovered that subclade T1a1 was depleted in affected BRCA2 mutation carriers compared with the rest of clade T (hazard ratio (HR) = 0.55; 95% confidence interval (CI), 0.34 to 0.88; P = 0.01). Compared with the most frequent haplogroup in the general population (that is, H and T clades), the T1a1 haplogroup has a HR of 0.62 (95% CI, 0.40 to 0.95; P = 0.03). We also identified three potential susceptibility loci, including G13708A/rs28359178, which has demonstrated an inverse association with familial breast cancer risk. This study illustrates how original approaches such as the phylogeny-based method we used can empower classical molecular epidemiological studies aimed at identifying association or risk modification effects.

Identification of fragile X pre-mutation carriers in the Chinese obstetric population using a robust FMR1 polymerase chain reaction assay: implications for screening and prenatal diagnosis.

PubMed

Cheng, Y Ky; Lin, C Sw; Kwok, Y Ky; Chan, Y M; Lau, T K; Leung, T Y; Choy, K W

2017-04-01

There is significant morbidity associated with fragile X syndrome. Unfortunately, most maternal carriers are clinically silent during their reproductive years. Because of this, many experts have put forward the notion of preconception or prenatal fragile X carrier screening for females. This study aimed to determine the prevalence of fragile X syndrome pre-mutation and asymptomatic full-mutation carriers in a Chinese pregnant population, and the distribution of cytosine-guanine-guanine (CGG) repeat numbers using a robust fragile X mental retardation 1 (FMR1) polymerase chain reaction assay. This was a cross-sectional survey in prospectively recruited pregnant women from a university hospital in Hong Kong. Chinese pregnant women without a family history of fragile X syndrome were recruited between April 2013 and May 2015. A specific FMR1 polymerase chain reaction assay was performed on peripheral blood to determine the CGG repeat number of the FMR1 gene. Prenatal counselling was offered to full-mutation and pre-mutation carriers. In 2650 Chinese pregnant women, two individuals with pre-mutation alleles (0.08%, one in 1325) and one asymptomatic woman with full-mutation (0.04%, one in 2650) alleles were identified. The overall prevalence of pre-mutation and full-mutation alleles was 0.11% (1 in 883). Furthermore, 30 (1.1%) individuals with intermediate alleles were detected. In the 2617 women with normal CGG repeats, the most common CGG repeat allele was 30. The overall prevalence of pre-mutation and asymptomatic full-mutation carriers in the Chinese pregnant population was one in 883, detected by a new FMR1 polymerase chain reaction assay.

Diltiazem Treatment for Preclinical Hypertrophic Cardiomyopathy Mutation Carriers: A Pilot Randomized Trial to Modify Disease Expression

PubMed Central

Ho, Carolyn Y.; Lakdawala, Neal K.; Cirino, Allison L.; Lipshultz, Steven E.; Sparks, Elizabeth; Abbasi, Siddique A.; Kwong, Raymond Y.; Antman, Elliott M.; Semsarian, Christopher; González, Arantxa; López, Begoña; Diez, Javier; Orav, E. John; Colan, Steven D.; Seidman, Christine E.

2014-01-01

Background Hypertrophic cardiomyopathy (HCM) is caused by sarcomere mutations and characterized by left ventricular hypertrophy (LVH) with increased risk of heart failure and sudden death. HCM typically cannot be diagnosed early in life, although subtle phenotypes are present. Animal studies indicate alterations in intracellular calcium handling before LVH develops. Furthermore, early treatment with diltiazem appeared to attenuate disease emergence. Objectives To assess the safety, feasibility, and effect of diltiazem as disease-modifying therapy for at-risk HCM mutation carriers. Methods In a pilot, double-blind trial, we randomly assigned 38 sarcomere mutation carriers without LVH (mean age 15.8 years) to therapy with diltiazem 360 mg/day (or 5 mg/kg/day) or placebo. Treatment duration ranged from 12 to 42 months (median 25 months). Study procedures included electrocardiography, echocardiography, cardiac magnetic resonance imaging, and serum biomarker measurement. Results Diltiazem was not associated with serious adverse events. Heart rate and blood pressure did not differ significantly between groups. However, mean left ventricular end diastolic diameter improved towards normal in the diltiazem group but decreased further in controls (change in z-scores, +0.6 vs. −0.5; P<0.001). Mean LV thickness-to-dimension ratio was stable in the diltiazem group, but increased in controls (−0.02 vs. +0.15; P=0.04). Among MYBPC3 mutation carriers, LV wall thickness and mass, diastolic filling, and cardiac troponin I levels improved in those taking diltiazem compared with controls. Four participants developed overt HCM, two in each treatment group. Conclusions Preclinical administration of diltiazem is safe and may improve early LV remodeling in HCM. This novel strategy merits further exploration. PMID:25543971

Leber's hereditary optic neuropathy is associated with the mitochondrial ND4 G11696A mutation in five Chinese families

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou Xiangtian; Wei Qiping; Yang Li

2006-02-03

We report here the clinical, genetic, and molecular characterization of five Chinese families with Leber's hereditary optic neuropathy (LHON). Clinical and genetic evaluations revealed the variable severity and age-of-onset in visual impairment in these families. Strikingly, there were extremely low penetrances of visual impairment in these Chinese families. Sequence analysis of the complete mitochondrial genomes in these pedigrees showed the distinct sets of mtDNA polymorphism, in addition to the identical ND4 G11696A mutation associated with LHON. Indeed, this mutation is present in homoplasmy only in the maternal lineage of those pedigrees but not other members of these families. In fact,more » the occurrence of the G11696A mutation in these several genetically unrelated subjects affected by visual impairment strongly indicates that this mutation is involved in the pathogenesis of visual impairment. Furthermore, the N405D in the ND5 and G5820A in the tRNA{sup Cys}, showing high evolutional conservation, may contribute to the phenotypic expression of G11696A mutation in the WZ10 pedigree. However, there was the absence of functionally significant mtDNA mutations in other four Chinese pedigrees carrying the G11696A mutation. Therefore, nuclear modifier gene(s) or environmental factor(s) may play a role in the phenotypic expression of the LHON-associated G11696A mutation in these Chinese pedigrees.« less

Germline BRCA Mutations Are Associated With Higher Risk of Nodal Involvement, Distant Metastasis, and Poor Survival Outcomes in Prostate Cancer

PubMed Central

Castro, Elena; Goh, Chee; Olmos, David; Saunders, Ed; Leongamornlert, Daniel; Tymrakiewicz, Malgorzata; Mahmud, Nadiya; Dadaev, Tokhir; Govindasami, Koveela; Guy, Michelle; Sawyer, Emma; Wilkinson, Rosemary; Ardern-Jones, Audrey; Ellis, Steve; Frost, Debra; Peock, Susan; Evans, D. Gareth; Tischkowitz, Marc; Cole, Trevor; Davidson, Rosemarie; Eccles, Diana; Brewer, Carole; Douglas, Fiona; Porteous, Mary E.; Donaldson, Alan; Dorkins, Huw; Izatt, Louise; Cook, Jackie; Hodgson, Shirley; Kennedy, M. John; Side, Lucy E.; Eason, Jacqueline; Murray, Alex; Antoniou, Antonis C.; Easton, Douglas F.; Kote-Jarai, Zsofia; Eeles, Rosalind

2013-01-01

Purpose To analyze the baseline clinicopathologic characteristics of prostate tumors with germline BRCA1 and BRCA2 (BRCA1/2) mutations and the prognostic value of those mutations on prostate cancer (PCa) outcomes. Patients and Methods This study analyzed the tumor features and outcomes of 2,019 patients with PCa (18 BRCA1 carriers, 61 BRCA2 carriers, and 1,940 noncarriers). The Kaplan-Meier method and Cox regression analysis were used to evaluate the associations between BRCA1/2 status and other PCa prognostic factors with overall survival (OS), cause-specific OS (CSS), CSS in localized PCa (CSS_M0), metastasis-free survival (MFS), and CSS from metastasis (CSS_M1). Results PCa with germline BRCA1/2 mutations were more frequently associated with Gleason ≥ 8 (P = .00003), T3/T4 stage (P = .003), nodal involvement (P = .00005), and metastases at diagnosis (P = .005) than PCa in noncarriers. CSS was significantly longer in noncarriers than in carriers (15.7 v 8.6 years, multivariable analyses [MVA] P = .015; hazard ratio [HR] = 1.8). For localized PCa, 5-year CSS and MFS were significantly higher in noncarriers (96% v 82%; MVA P = .01; HR = 2.6%; and 93% v 77%; MVA P = .009; HR = 2.7, respectively). Subgroup analyses confirmed the poor outcomes in BRCA2 patients, whereas the role of BRCA1 was not well defined due to the limited size and follow-up in this subgroup. Conclusion Our results confirm that BRCA1/2 mutations confer a more aggressive PCa phenotype with a higher probability of nodal involvement and distant metastasis. BRCA mutations are associated with poor survival outcomes and this should be considered for tailoring clinical management of these patients. PMID:23569316

The Structural Basis of Oncogenic Mutations G12, G13 and Q61 in Small GTPase K-Ras4B

NASA Astrophysics Data System (ADS)

Lu, Shaoyong; Jang, Hyunbum; Nussinov, Ruth; Zhang, Jian

2016-02-01

Ras mediates cell proliferation, survival and differentiation. Mutations in K-Ras4B are predominant at residues G12, G13 and Q61. Even though all impair GAP-assisted GTP → GDP hydrolysis, the mutation frequencies of K-Ras4B in human cancers vary. Here we aim to figure out their mechanisms and differential oncogenicity. In total, we performed 6.4 μs molecular dynamics simulations on the wild-type K-Ras4B (K-Ras4BWT-GTP/GDP) catalytic domain, the K-Ras4BWT-GTP-GAP complex, and the mutants (K-Ras4BG12C/G12D/G12V-GTP/GDP, K-Ras4BG13D-GTP/GDP, K-Ras4BQ61H-GTP/GDP) and their complexes with GAP. In addition, we simulated ‘exchanged’ nucleotide states. These comprehensive simulations reveal that in solution K-Ras4BWT-GTP exists in two, active and inactive, conformations. Oncogenic mutations differentially elicit an inactive-to-active conformational transition in K-Ras4B-GTP; in K-Ras4BG12C/G12D-GDP they expose the bound nucleotide which facilitates the GDP-to-GTP exchange. These mechanisms may help elucidate the differential mutational statistics in K-Ras4B-driven cancers. Exchanged nucleotide simulations reveal that the conformational transition is more accessible in the GTP-to-GDP than in the GDP-to-GTP exchange. Importantly, GAP not only donates its R789 arginine finger, but stabilizes the catalytically-competent conformation and pre-organizes catalytic residue Q61; mutations disturb the R789/Q61 organization, impairing GAP-mediated GTP hydrolysis. Together, our simulations help provide a mechanistic explanation of key mutational events in one of the most oncogenic proteins in cancer.

A missense mutation in solute carrier family 12, member 1 (SLC12A1) causes hydrallantois in Japanese Black cattle.

PubMed

Sasaki, Shinji; Hasegawa, Kiyotoshi; Higashi, Tomoko; Suzuki, Yutaka; Sugano, Sumio; Yasuda, Yasuaki; Sugimoto, Yoshikazu

2016-09-09

Hydrallantois is the excessive accumulation of fluid within the allantoic cavity in pregnant animals and is associated with fetal mortality. Although the incidence of hydrallantois is very low in artificial insemination breeding programs in cattle, recently 38 cows with the phenotypic appearance of hydrallantois were reported in a local subpopulation of Japanese Black cattle. Of these, 33 were traced back to the same sire; however, both their parents were reported healthy, suggesting that hydrallantois is a recessive inherited disorder. To identify autozygous chromosome segments shared by individuals with hydrallantois and the causative mutation in Japanese Black cattle, we performed autozygosity mapping using single-nucleotide polymorphism (SNP) array and exome sequencing. Shared haplotypes of the affected fetuses spanned 3.52 Mb on bovine chromosome 10. Exome sequencing identified a SNP (g.62382825G > A, p.Pro372Leu) in exon 10 of solute carrier family 12, member 1 (SLC12A1), the genotype of which was compatible with recessive inheritance. SLC12A1 serves as a reabsorption molecule of Na(+)-K(+)-2Cl(-) in the apical membrane of the thick ascending limb of the loop of Henle in the kidney. We observed that the concentration of Na(+)-Cl(-) increased in allantoic fluid of homozygous SLC12A1 (g.62382825G > A) in a hydrallantois individual. In addition, SLC12A1-positive signals were localized at the apical membrane in the kidneys of unaffected fetuses, whereas they were absent from the apical membrane in the kidneys of affected fetuses. These results suggested that p.Pro372Leu affects the membrane localization of SLC12A1, and in turn, may impair its transporter activity. Surveillance of the risk-allele frequency revealed that the carriers were restricted to the local subpopulation of Japanese Black cattle. Moreover, we identified a founder individual that carried the mutation (g.62382825G > A). In this study, we mapped the shared haplotypes of affected

Carnitine-acylcarnitine translocase deficiency with c.199-10 T>G and novel c.1A>G mutation

PubMed Central

Yan, Hui-ming; Hu, Hao; Ahmed, Aisha; Feng, Bing-bing; Liu, Jing; Jia, Zheng-jun; Wang, Hua

2017-01-01

Abstract Rationale: Carnitine-acylcarnitine translocate deficiency (CACTD) is a rare and life-threatening, autosomal recessive disorder of fatty acid β-oxidation characterized by hypoketotic hypoglycemia, hyperammonemia, cardiomyopathy, liver dysfunction, and muscle weakness; culminating in early death. To date, CACTD cases screened from the Chinese mainland population, especially patient with compound heterozygote with c.199-10T>G and a novel c.1A>G mutation in the SLC25A20 gene has never been described. Patient concerns: Herein, we report 2 neonatal cases of CACTD identified from the mainland China. These 2 patients were presented with severe metabolic crisis and their clinical conditions deteriorate rapidly and both died of cardiorespiratory collapse in the first week of life. We present the clinical and biochemical features of 2 probands and a brief literature review of previously reported CACTD cases with the c.199-10T>G mutation. Diagnoses: The acylcarnitine profiles by tandem-mass-spectrometry and the mutation analysis of SLC25A20 gene confirmed the diagnosis of CACTD in both patients. Mutation analysis demonstrated that patient No. 1 was homozygous for c.199-10T>G mutation, while patient No. 2 was a compound heterozygote for 2 mutations, a maternally-inherited c.199-10T>G and a paternally-inherited, novel c.1A>G mutation. Interventions: Both patients were treated with an aggressive treatment regimen include high glucose and arginine infusion, respiratory, and circulatory support. Outcomes: The first proband died 3 days after delivery due to sudden cardiac arrest. The second patient's clinical condition, at one time, was improved by high glucose infusion, intravenous arginine, and circulatory support. However, the patient failed to wean from mechanical ventilation. Unfortunately, her parents refused further treatment due to fear of financial burdens. The patient died of congestive heart failure in the 6th day of life. Lessons: We report the first 2 cases of

Recurrent mutation testing of BRCA1 and BRCA2 in Asian breast cancer patients identify carriers in those with presumed low risk by family history.

PubMed

Kang, Peter Choon Eng; Phuah, Sze Yee; Sivanandan, Kavitta; Kang, In Nee; Thirthagiri, Eswary; Liu, Jian Jun; Hassan, Norhashimah; Yoon, Sook-Yee; Thong, Meow Keong; Hui, Miao; Hartman, Mikael; Yip, Cheng Har; Mohd Taib, Nur Aishah; Teo, Soo Hwang

2014-04-01

Although the breast cancer predisposition genes BRCA1 and BRCA2 were discovered more than 20 years ago, there remains a gap in the availability of genetic counselling and genetic testing in Asian countries because of cost, access and inaccurate reporting of family history of cancer. In order to improve access to testing, we developed a rapid test for recurrent mutations in our Asian populations. In this study, we designed a genotyping assay with 55 BRCA1 and 44 BRCA2 mutations previously identified in Asian studies, and validated this assay in 267 individuals who had previously been tested by full sequencing. We tested the prevalence of these mutations in additional breast cancer cases. Using this genotyping approach, we analysed recurrent mutations in 533 Malaysian breast cancer cases with <10 % a priori risk, and found 1 BRCA1 (0.2 %) and 5 BRCA2 (0.9 %) carriers. Testing in a hospital-based unselected cohort of 532 Singaporean breast cancer cases revealed 6 BRCA1 (1.1 %) and 3 BRCA2 (0.6 %) carriers. Overall, 2 recurrent BRCA1 and 1 BRCA2 mutations in Malays, 3 BRCA1 and 2 BRCA2 mutations in Chinese and 1 BRCA1 mutation in Indians account for 60, 24 and 20 % of carrier families, respectively. By contrast, haplotype analyses suggest that a recurrent BRCA2 mutation (c.262_263delCT) found in 5 unrelated Malay families has at least 3 distinct haplotypes. Taken together, our data suggests that panel testing may help to identify carriers, particularly Asian BRCA2 carriers, who do not present with a priori strong family history characteristics.

Novel PSEN1 G209A mutation in early-onset Alzheimer dementia supported by structural prediction.

PubMed

An, Seong Soo A; Bagyinszky, Eva; Kim, Hye Ryoun; Seok, Ju-Won; Shin, Hae-Won; Bae, SeunOh; Kim, SangYun; Youn, Young Chul

2016-05-20

Three main genes are described as causative genes for early-onset Alzheimer dementia (EOAD): APP, PSEN1 and PSEN2. We describe a woman with EOAD had a novel PSEN1 mutation. A 54-year-old right-handed woman presented 12-year history of progressive memory decline. She was clinically diagnosed as familial Alzheimer's disease due to a PSEN1 mutation. One of two daughters also has the same mutation, G209A in the TM-IV of PS1 protein. Her mother had unspecified dementia that began at the age of 40s. PolyPhen2 and SIFT prediction suggested that G209A might be a damaging variant with high scores. 3D modeling revealed that G209A exchange could result significant changes in the PS1 protein. We report a case of EOAD having probable novel PSEN1 (G209A) mutation verified with structural prediction.

Metastatic pancreatic adenocarcinoma associated with chronic calcific pancreatitis and a heterozygous SPINK1 N34S mutation.

PubMed

Moran, Robert A; Klapheke, Robert; Jalaly, Niloofar Y; Makary, Martin A; Hirose, Kenzo; Goggins, Michael; Wood, Laura; Laheru, Daniel A; Lennon, Anne Marie; Khashab, Mouen A; Singh, Vikesh K

2016-01-01

Contrary to patients with a cationic trypsinogen gene (PRSS1) mutations, Serine protease inhibitor Kazal-type 1 (SPINK1) heterozygote gene mutation carriers have a very low penetrance for acute, acute recurrent and/or chronic pancreatitis. Despite this, heterozygote SPINK 1 gene mutation patients have a similar age of onset of pancreatitis as PRSS 1 gene mutation patients. While the substantially elevated risk of pancreatic cancer in patients with PRSS1 gene mutations with chronic pancreatitis has been well established, little is known about the risk of pancreatic cancer in SPINK 1 gene mutation carriers with pancreatitis. We describe a case of malignant pancreatic cancer diagnosed in a young patient with chronic pancreatitis who is a SPINK 1 heterozygote gene mutation carrier. The risk of pancreatic cancer in gene mutation patients with chronic pancreatitis, in addition to screening options and management options for these patients is discussed. Copyright © 2016 IAP and EPC. Published by Elsevier B.V. All rights reserved.

12 CFR 7.2019 - Loans secured by a bank's own shares.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 12 Banks and Banking 1 2010-01-01 2010-01-01 false Loans secured by a bank's own shares. 7.2019... AND OPERATIONS Corporate Practices § 7.2019 Loans secured by a bank's own shares. (a) Permitted agreements, relating to bank shares. A national bank may require a borrower holding shares of the bank to...

Common breast cancer susceptibility alleles and the risk of breast cancer for BRCA1 and BRCA2 mutation carriers: implications for risk prediction.

PubMed

Antoniou, Antonis C; Beesley, Jonathan; McGuffog, Lesley; Sinilnikova, Olga M; Healey, Sue; Neuhausen, Susan L; Ding, Yuan Chun; Rebbeck, Timothy R; Weitzel, Jeffrey N; Lynch, Henry T; Isaacs, Claudine; Ganz, Patricia A; Tomlinson, Gail; Olopade, Olufunmilayo I; Couch, Fergus J; Wang, Xianshu; Lindor, Noralane M; Pankratz, Vernon S; Radice, Paolo; Manoukian, Siranoush; Peissel, Bernard; Zaffaroni, Daniela; Barile, Monica; Viel, Alessandra; Allavena, Anna; Dall'Olio, Valentina; Peterlongo, Paolo; Szabo, Csilla I; Zikan, Michal; Claes, Kathleen; Poppe, Bruce; Foretova, Lenka; Mai, Phuong L; Greene, Mark H; Rennert, Gad; Lejbkowicz, Flavio; Glendon, Gord; Ozcelik, Hilmi; Andrulis, Irene L; Thomassen, Mads; Gerdes, Anne-Marie; Sunde, Lone; Cruger, Dorthe; Birk Jensen, Uffe; Caligo, Maria; Friedman, Eitan; Kaufman, Bella; Laitman, Yael; Milgrom, Roni; Dubrovsky, Maya; Cohen, Shimrit; Borg, Ake; Jernström, Helena; Lindblom, Annika; Rantala, Johanna; Stenmark-Askmalm, Marie; Melin, Beatrice; Nathanson, Kate; Domchek, Susan; Jakubowska, Ania; Lubinski, Jan; Huzarski, Tomasz; Osorio, Ana; Lasa, Adriana; Durán, Mercedes; Tejada, Maria-Isabel; Godino, Javier; Benitez, Javier; Hamann, Ute; Kriege, Mieke; Hoogerbrugge, Nicoline; van der Luijt, Rob B; van Asperen, Christi J; Devilee, Peter; Meijers-Heijboer, E J; Blok, Marinus J; Aalfs, Cora M; Hogervorst, Frans; Rookus, Matti; Cook, Margaret; Oliver, Clare; Frost, Debra; Conroy, Don; Evans, D Gareth; Lalloo, Fiona; Pichert, Gabriella; Davidson, Rosemarie; Cole, Trevor; Cook, Jackie; Paterson, Joan; Hodgson, Shirley; Morrison, Patrick J; Porteous, Mary E; Walker, Lisa; Kennedy, M John; Dorkins, Huw; Peock, Susan; Godwin, Andrew K; Stoppa-Lyonnet, Dominique; de Pauw, Antoine; Mazoyer, Sylvie; Bonadona, Valérie; Lasset, Christine; Dreyfus, Hélène; Leroux, Dominique; Hardouin, Agnès; Berthet, Pascaline; Faivre, Laurence; Loustalot, Catherine; Noguchi, Tetsuro; Sobol, Hagay; Rouleau, Etienne; Nogues, Catherine; Frénay, Marc; Vénat-Bouvet, Laurence; Hopper, John L; Daly, Mary B; Terry, Mary B; John, Esther M; Buys, Saundra S; Yassin, Yosuf; Miron, Alexander; Goldgar, David; Singer, Christian F; Dressler, Anne Catharina; Gschwantler-Kaulich, Daphne; Pfeiler, Georg; Hansen, Thomas V O; Jønson, Lars; Agnarsson, Bjarni A; Kirchhoff, Tomas; Offit, Kenneth; Devlin, Vincent; Dutra-Clarke, Ana; Piedmonte, Marion; Rodriguez, Gustavo C; Wakeley, Katie; Boggess, John F; Basil, Jack; Schwartz, Peter E; Blank, Stephanie V; Toland, Amanda Ewart; Montagna, Marco; Casella, Cinzia; Imyanitov, Evgeny; Tihomirova, Laima; Blanco, Ignacio; Lazaro, Conxi; Ramus, Susan J; Sucheston, Lara; Karlan, Beth Y; Gross, Jenny; Schmutzler, Rita; Wappenschmidt, Barbara; Engel, Christoph; Meindl, Alfons; Lochmann, Magdalena; Arnold, Norbert; Heidemann, Simone; Varon-Mateeva, Raymonda; Niederacher, Dieter; Sutter, Christian; Deissler, Helmut; Gadzicki, Dorothea; Preisler-Adams, Sabine; Kast, Karin; Schönbuchner, Ines; Caldes, Trinidad; de la Hoya, Miguel; Aittomäki, Kristiina; Nevanlinna, Heli; Simard, Jacques; Spurdle, Amanda B; Holland, Helene; Chen, Xiaoqing; Platte, Radka; Chenevix-Trench, Georgia; Easton, Douglas F

2010-12-01

The known breast cancer susceptibility polymorphisms in FGFR2, TNRC9/TOX3, MAP3K1, LSP1, and 2q35 confer increased risks of breast cancer for BRCA1 or BRCA2 mutation carriers. We evaluated the associations of 3 additional single nucleotide polymorphisms (SNPs), rs4973768 in SLC4A7/NEK10, rs6504950 in STXBP4/COX11, and rs10941679 at 5p12, and reanalyzed the previous associations using additional carriers in a sample of 12,525 BRCA1 and 7,409 BRCA2 carriers. Additionally, we investigated potential interactions between SNPs and assessed the implications for risk prediction. The minor alleles of rs4973768 and rs10941679 were associated with increased breast cancer risk for BRCA2 carriers (per-allele HR = 1.10, 95% CI: 1.03-1.18, P = 0.006 and HR = 1.09, 95% CI: 1.01-1.19, P = 0.03, respectively). Neither SNP was associated with breast cancer risk for BRCA1 carriers, and rs6504950 was not associated with breast cancer for either BRCA1 or BRCA2 carriers. Of the 9 polymorphisms investigated, 7 were associated with breast cancer for BRCA2 carriers (FGFR2, TOX3, MAP3K1, LSP1, 2q35, SLC4A7, 5p12, P = 7 × 10(-11) - 0.03), but only TOX3 and 2q35 were associated with the risk for BRCA1 carriers (P = 0.0049, 0.03, respectively). All risk-associated polymorphisms appear to interact multiplicatively on breast cancer risk for mutation carriers. Based on the joint genotype distribution of the 7 risk-associated SNPs in BRCA2 mutation carriers, the 5% of BRCA2 carriers at highest risk (i.e., between 95th and 100th percentiles) were predicted to have a probability between 80% and 96% of developing breast cancer by age 80, compared with 42% to 50% for the 5% of carriers at lowest risk. Our findings indicated that these risk differences might be sufficient to influence the clinical management of mutation carriers.

Lynch syndrome: the influence of environmental factors on extracolonic cancer risk in hMLH1 c.C1528T mutation carriers and their mutation-negative sisters.

PubMed

Blokhuis, M M; Pietersen, G E; Goldberg, P A; Algar, U; Van der Merwe, L; Mbatani, N; Vorster, A A; Ramesar, R S

2010-09-01

Lynch Syndrome (LS) is a cancer susceptibility syndrome caused mostly by mutations in the mismatch repair genes, hMLH1, hMSH2 and hMSH6. Mutation carriers are at risk of colorectal and endometrial cancer and, less frequently, cancer of the ovaries, stomach, small bowel, hepatobiliary tract, ureter, renal pelvis and brain. The influence of environmental factors on extracolonic cancer risk in LS patients has not been investigated thus far. The aim of this study was to investigate some of these factors in South African females carrying the hMLH1 c.C1528T mutation and their mutation-negative relatives. Data were collected from 87 mutation-positive females and 121 mutation-negative female relatives regarding age, cancer history, hormonal contraceptive use, parity, duration of breast feeding, height, weight and age at first birth, last birth, menarche and menopause. Influence of these factors on cancer risk was analysed by mixed-effects generalised linear models. Extracolonic cancer occurred in 14% (12/87) of mutation-positive females versus 7% (8/121) of mutation-negative females, (P = 0.0279, adjusted for age and relatedness between women). Breast cancer was the most common extracolonic cancer. An association was found for oral contraceptive use and extracolonic cancer risk in mutation-negative females only. No association was found for any of the other risk factors investigated, when adjusted for age. This might be due to the scarcity of extracolonic cancers in our data. Future knowledge on the influence of additional environmental factors on cancer risk in LS females can lead to evidence-based lifestyle advice for mutation carriers, thereby complementing the prevention strategies available today. In addition, it can contribute to an integrated model of cancer aetiology. Therefore, this study should be taken as a thrust for further research.

The c.1364C>A (p.A455E) Mutation in the CFTR Pseudogene Results in an Incorrectly Assigned Carrier Status by a Commonly Used Screening Platform.

PubMed

Deeb, Kristin K; Metcalf, James D; Sesock, Kaitlin M; Shen, Junqing; Wensel, Christine A; Rippel, Larisa I; Smith, Michelle; Chapman, Mark S; Zhang, Shulin

2015-07-01

Cystic fibrosis (CF) is one of the most common recessive conditions among whites, with an estimated carrier frequency of 1 in 25 in the United States. Population-based CF carrier screening was implemented in the United States in 2001. The number of mutations screened by each laboratory may vary; however, the 23 most common CF mutations recommended for screening by the American College of Medical Genetics and American College of Obstetricians and Gynecologists are included in all platforms. The c.1364C>A (p.A455E) mutation located in exon 10 of the CFTR gene is one of the 23 mutations. Because CFTR exon 10 and its flanking intronic regions are duplicated and transposed onto several other chromosomes of the human genome during evolution and function as unprocessed pseudogenes, variations in the CFTR pseudogenes may confound CF screening results for mutations located in exon 10 of the CFTR gene. We report an incorrectly identified carrier status for the c.1364C>A (p.A455E) mutation in a healthy individual using the Hologic InPlex CF assay. Further analysis revealed that the mutation resides in one of the CFTR pseudogenes. Because most commercial kits and laboratory-developed tests for CF carrier screening involve a short amplicon encompassing this mutation, this finding suggests that individuals with the c.1364C>A (p.A455E) mutation may require further investigation to avoid a false assignment of CF carrier status. Copyright © 2015 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

Hitchhiker-G: A new carrier system for attached shuttle payloads

NASA Technical Reports Server (NTRS)

Goldsmith, T. C.

1987-01-01

A new carrier system has been developed for economical and quick response flight of small attached payloads on the space shuttle. Hitchhiker-G can accommodate up to 750 lb. of customer payloads in canisters or mounted to an exposed plate. The carrier connects to the orbiter's electrical systems and provides up to six customers with standard electrical services including power, real time telemetry, and commands. A transparent data and command system concept is employed to allow the customer to easily use his own ground support equipment and personnel to control his payload during integration and flight operations. The first Hitchhiker-G was successfully flown in January 1986 on STS 61C.

Adult onset Leigh syndrome with mitochondrial DNA 8344 A>G mutation.

PubMed

Han, Jee-Young; Sung, Jung-Joon; Park, Hong-Kyun; Yoon, Byung-Nam; Lee, Kwang-Woo

2014-11-01

We report a pedigree of adult-onset Leigh syndrome (LS) with mitochondrial mutation 8344 A>G. A 38-year-old woman presented with optic neuropathy, weakness and cognitive impairment. Family history of optic neuropathy and systemic involvement was suggestive of mitochondrial encephalopathy. Genetic and radiologic studies showed m.8344 A>G mutation with characteristics of LS. To our knowledge this is the first case of adult-onset LS demonstrating the m.8344 A>G mutation. Copyright © 2014 Elsevier Ltd. All rights reserved.

Brittle cornea syndrome ZNF469 mutation carrier phenotype and segregation analysis of rare ZNF469 variants in familial keratoconus.

PubMed

Davidson, Alice E; Borasio, Edmondo; Liskova, Petra; Khan, Arif O; Hassan, Hala; Cheetham, Michael E; Plagnol, Vincent; Alkuraya, Fowzan S; Tuft, Stephen J; Hardcastle, Alison J

2015-01-06

Brittle cornea syndrome 1 (BCS1) is a rare recessive condition characterized by extreme thinning of the cornea and sclera, caused by mutations in ZNF469. Keratoconus is a relatively common disease characterized by progressive thinning and ectasia of the cornea. The etiology of keratoconus is complex and not yet understood, but rare ZNF469 variants have recently been associated with disease. We investigated the phenotype of BCS1 carriers with known pathogenic ZNF469 mutations, and recruited families in which aggregation of keratoconus was observed to establish if rare variants in ZNF469 segregated with disease. Patients and family members were recruited and underwent comprehensive anterior segment examination, including corneal topography. Blood samples were donated and genomic DNA was extracted. The coding sequence and splice sites of ZNF469 were PCR amplified and Sanger sequenced. Four carriers of three BCS1-associated ZNF469 loss-of-function mutations (p.[Glu1392Ter], p.[Gln1930Argfs*6], p.[Gln1930fs*133]) were examined and none had keratoconus. One carrier had partially penetrant features of BCS1, including joint hypermobility. ZNF469 sequencing in 11 keratoconus families identified 9 rare (minor allele frequency [MAF] ≤ 0.025) variants predicted to be potentially damaging. However, in each instance the rare variant(s) identified, including two previously reported as potentially keratoconus-associated, did not segregate with the disease. The presence of heterozygous loss-of-function alleles in the ZNF469 gene did not cause keratoconus in the individuals examined. None of the rare nonsynonymous ZNF469 variants identified in the familial cohort conferred a high risk of keratoconus; therefore, genetic variants contributing to disease pathogenesis in these 11 families remain to be identified. Copyright 2015 The Association for Research in Vision and Ophthalmology, Inc.

Cancer risks for BRCA1 and BRCA2 mutation carriers: results from prospective analysis of EMBRACE.

PubMed

Mavaddat, Nasim; Peock, Susan; Frost, Debra; Ellis, Steve; Platte, Radka; Fineberg, Elena; Evans, D Gareth; Izatt, Louise; Eeles, Rosalind A; Adlard, Julian; Davidson, Rosemarie; Eccles, Diana; Cole, Trevor; Cook, Jackie; Brewer, Carole; Tischkowitz, Marc; Douglas, Fiona; Hodgson, Shirley; Walker, Lisa; Porteous, Mary E; Morrison, Patrick J; Side, Lucy E; Kennedy, M John; Houghton, Catherine; Donaldson, Alan; Rogers, Mark T; Dorkins, Huw; Miedzybrodzka, Zosia; Gregory, Helen; Eason, Jacqueline; Barwell, Julian; McCann, Emma; Murray, Alex; Antoniou, Antonis C; Easton, Douglas F

2013-06-05

Reliable estimates of cancer risk are critical for guiding management of BRCA1 and BRCA2 mutation carriers. The aims of this study were to derive penetrance estimates for breast cancer, ovarian cancer, and contralateral breast cancer in a prospective series of mutation carriers and to assess how these risks are modified by common breast cancer susceptibility alleles. Prospective cancer risks were estimated using a cohort of 978 BRCA1 and 909 BRCA2 carriers from the United Kingdom. Nine hundred eighty-eight women had no breast or ovarian cancer diagnosis at baseline, 1509 women were unaffected by ovarian cancer, and 651 had been diagnosed with unilateral breast cancer. Cumulative risks were obtained using Kaplan-Meier estimates. Associations between cancer risk and covariables of interest were evaluated using Cox regression. All statistical tests were two-sided. The average cumulative risks by age 70 years for BRCA1 carriers were estimated to be 60% (95% confidence interval [CI] = 44% to 75%) for breast cancer, 59% (95% CI = 43% to 76%) for ovarian cancer, and 83% (95% CI = 69% to 94%) for contralateral breast cancer. For BRCA2 carriers, the corresponding risks were 55% (95% CI = 41% to 70%) for breast cancer, 16.5% (95% CI = 7.5% to 34%) for ovarian cancer, and 62% (95% CI = 44% to 79.5%) for contralateral breast cancer. BRCA2 carriers in the highest tertile of risk, defined by the joint genotype distribution of seven single nucleotide polymorphisms associated with breast cancer risk, were at statistically significantly higher risk of developing breast cancer than those in the lowest tertile (hazard ratio = 4.1, 95% CI = 1.2 to 14.5; P = .02). Prospective risk estimates confirm that BRCA1 and BRCA2 carriers are at high risk of developing breast, ovarian, and contralateral breast cancer. Our results confirm findings from retrospective studies that common breast cancer susceptibility alleles in combination are predictive of breast cancer risk for BRCA2 carriers.

A survey of preventive measures among BRCA1 mutation carriers from Poland.

PubMed

Gronwald, J; Byrski, T; Huzarski, T; Cybulski, C; Stawicka, M; Szwiec, M; Debniak, T; Tulman, A; Sun, P; Oszurek, O; Lubinski, J; Narod, S A

2007-02-01

Among women with a BRCA1 mutation, the lifetime risks of breast and ovarian cancer are elevated. Several measures for reducing cancer risk in carriers of BRCA1 mutations have been proposed, including prophylactic surgery and tamoxifen chemoprevention. It is not yet known to what extent women with mutations have adopted these various preventive measures. We surveyed 414 Polish women with a BRCA1 mutation who had received counseling about various preventive strategies. Each woman completed a survey for a minimum of 18 months after receiving her genetic result. A high proportion of women reported having had an oophorectomy to reduce breast and ovarian cancer risk (49.1%). In contrast, only 11% had taken tamoxifen and only 5% had undergone a preventive mastectomy. Most of the women (81%) had a screening mammogram during the follow-up period. Oral contraceptives and breastfeeding are believed to protect against ovarian cancer, but only 9% of women had taken the birth control pill for 3 years or more and 27% had breastfed for 1 year or more. In summary, approximately one-half of Polish women with a BRCA1 mutation had taken an active step to reduce their risk of breast cancer within 18 months of receiving a positive result. A greater effort should be made to promote breastfeeding and use of oral contraceptive as risk-reducing measures.

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

PubMed

Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

2017-10-01

Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

Combination of N149S and D171G mutations in Aeromonas caviae polyhydroxyalkanoate synthase and impact on polyhydroxyalkanoate biosynthesis.

PubMed

Tsuge, Takeharu; Watanabe, Shinko; Shimada, Daisuke; Abe, Hideki; Doi, Yoshiharu; Taguchi, Seiichi

2007-12-01

Aeromonas caviae polyhydroxyalkanoate synthase (PhaC(Ac)) is an important biocatalyst for the synthesis of practically useful two-component polyhydroxyalkanoate copolymer, poly[(R)-3-hydroxybutyrate-co-(R)-3-hydroxyhexanoate] [P(3HB-co-3HHx)]. In a previous study, two PhaC(Ac) mutants that have a single amino acid substitution of either asparagine 149 by serine (N149S) or aspartate 171 by glycine (D171G) were isolated as higher active enzymes by means of evolutionary engineering. In this study, the synergistic effects of N149S and D171G double mutation (NSDG) in PhaC(Ac) on polyhydroxyalkanoate biosynthesis were investigated in recombinant Ralstonia eutropha. The PhaC(Ac) NSDG mutant showed enhanced incorporation of longer 3-hydroxyalkanoate (3HA) units into the polyhydroxyalkanoate copolymer from octanoate (3HA fraction: 18.5 mol%) and soybean oil (5.4 mol%) as a carbon source. Besides, the NSDG mutant synthesized P(3HB) homopolymer with a very high molecular weight (M(w)=368 x 10(4)) when fructose was used as a carbon source. Thus, a combination of the beneficial mutations synergistically altered enzymatic properties, leading to synthesis of a polyhydroxyalkanoate copolymer with enhanced 3HA fraction and increased molecular weight.

Maple Syrup Urine Disease: Identification and Carrier-Frequency Determination of a Novel Founder Mutation in the Ashkenazi Jewish Population

PubMed Central

Edelmann, Lisa; Wasserstein, Melissa P.; Kornreich, Ruth; Sansaricq, Claude; Snyderman, Selma E.; Diaz, George A.

2001-01-01

Maple syrup urine disease (MSUD) is a rare, autosomal recessive disorder of branched-chain amino acid metabolism. We noted that a large proportion (10 of 34) of families with MSUD that were followed in our clinic were of Ashkenazi Jewish (AJ) descent, leading us to search for a common mutation within this group. On the basis of genotyping data suggestive of a conserved haplotype at tightly linked markers on chromosome 6q14, the BCKDHB gene encoding the E1β subunit was sequenced. Three novel mutations were identified in seven unrelated AJ patients with MSUD. The locations of the affected residues in the crystal structure of the E1β subunit suggested possible mechanisms for the deleterious effects of these mutations. Large-scale population screening of AJ individuals for R183P, the mutation present in six of seven patients, revealed that the carrier frequency of the mutant allele was ∼1/113; the patient not carrying R183P had a previously described homozygous mutation in the gene encoding the E2 subunit. These findings suggested that a limited number of mutations might underlie MSUD in the AJ population, potentially facilitating prenatal diagnosis and carrier detection of MSUD in this group. PMID:11509994

Maple syrup urine disease: identification and carrier-frequency determination of a novel founder mutation in the Ashkenazi Jewish population.

PubMed

Edelmann, L; Wasserstein, M P; Kornreich, R; Sansaricq, C; Snyderman, S E; Diaz, G A

2001-10-01

Maple syrup urine disease (MSUD) is a rare, autosomal recessive disorder of branched-chain amino acid metabolism. We noted that a large proportion (10 of 34) of families with MSUD that were followed in our clinic were of Ashkenazi Jewish (AJ) descent, leading us to search for a common mutation within this group. On the basis of genotyping data suggestive of a conserved haplotype at tightly linked markers on chromosome 6q14, the BCKDHB gene encoding the E1beta subunit was sequenced. Three novel mutations were identified in seven unrelated AJ patients with MSUD. The locations of the affected residues in the crystal structure of the E1beta subunit suggested possible mechanisms for the deleterious effects of these mutations. Large-scale population screening of AJ individuals for R183P, the mutation present in six of seven patients, revealed that the carrier frequency of the mutant allele was approximately 1/113; the patient not carrying R183P had a previously described homozygous mutation in the gene encoding the E2 subunit. These findings suggested that a limited number of mutations might underlie MSUD in the AJ population, potentially facilitating prenatal diagnosis and carrier detection of MSUD in this group.

Glucose-6-phosphate dehydrogenase (G6PD) mutations database: review of the "old" and update of the new mutations.

PubMed

Minucci, Angelo; Moradkhani, Kamran; Hwang, Ming Jing; Zuppi, Cecilia; Giardina, Bruno; Capoluongo, Ettore

2012-03-15

In the present paper we have updated the G6PD mutations database, including all the last discovered G6PD genetic variants. We underline that the last database has been published by Vulliamy et al. [1] who analytically reported 140 G6PD mutations: along with Vulliamy's database, there are two main sites, such as http://202.120.189.88/mutdb/ and www.LOVD.nl/MR, where almost all G6PD mutations can be found. Compared to the previous mutation reports, in our paper we have included for each mutation some additional information, such as: the secondary structure and the enzyme 3D position involving by mutation, the creation or abolition of a restriction site (with the enzyme involved) and the conservation score associated with each amino acid position. The mutations reported in the present tab have been divided according to the gene's region involved (coding and non-coding) and mutations affecting the coding region in: single, multiple (at least with two bases involved) and deletion. We underline that for the listed mutations, reported in italic, literature doesn't provide all the biochemical or bio-molecular information or the research data. Finally, for the "old" mutations, we tried to verify features previously reported and, when subsequently modified, we updated the specific information using the latest literature data. Copyright © 2012 Elsevier Inc. All rights reserved.

Common variants of the BRCA1 wild-type allele modify the risk of breast cancer in BRCA1 mutation carriers

PubMed Central

Cox, David G.; Simard, Jacques; Sinnett, Daniel; Hamdi, Yosr; Soucy, Penny; Ouimet, Manon; Barjhoux, Laure; Verny-Pierre, Carole; McGuffog, Lesley; Healey, Sue; Szabo, Csilla; Greene, Mark H.; Mai, Phuong L.; Andrulis, Irene L.; Thomassen, Mads; Gerdes, Anne-Marie; Caligo, Maria A.; Friedman, Eitan; Laitman, Yael; Kaufman, Bella; Paluch, Shani S.; Borg, Åke; Karlsson, Per; Stenmark Askmalm, Marie; Barbany Bustinza, Gisela; Nathanson, Katherine L.; Domchek, Susan M.; Rebbeck, Timothy R.; Benítez, Javier; Hamann, Ute; Rookus, Matti A.; van den Ouweland, Ans M.W.; Ausems, Margreet G.E.M.; Aalfs, Cora M.; van Asperen, Christi J.; Devilee, Peter; Gille, Hans J.J.P.; Peock, Susan; Frost, Debra; Evans, D. Gareth; Eeles, Ros; Izatt, Louise; Adlard, Julian; Paterson, Joan; Eason, Jacqueline; Godwin, Andrew K.; Remon, Marie-Alice; Moncoutier, Virginie; Gauthier-Villars, Marion; Lasset, Christine; Giraud, Sophie; Hardouin, Agnès; Berthet, Pascaline; Sobol, Hagay; Eisinger, François; Bressac de Paillerets, Brigitte; Caron, Olivier; Delnatte, Capucine; Goldgar, David; Miron, Alex; Ozcelik, Hilmi; Buys, Saundra; Southey, Melissa C.; Terry, Mary Beth; Singer, Christian F.; Dressler, Anne-Catharina; Tea, Muy-Kheng; Hansen, Thomas V.O.; Johannsson, Oskar; Piedmonte, Marion; Rodriguez, Gustavo C.; Basil, Jack B.; Blank, Stephanie; Toland, Amanda E.; Montagna, Marco; Isaacs, Claudine; Blanco, Ignacio; Gayther, Simon A.; Moysich, Kirsten B.; Schmutzler, Rita K.; Wappenschmidt, Barbara; Engel, Christoph; Meindl, Alfons; Ditsch, Nina; Arnold, Norbert; Niederacher, Dieter; Sutter, Christian; Gadzicki, Dorothea; Fiebig, Britta; Caldes, Trinidad; Laframboise, Rachel; Nevanlinna, Heli; Chen, Xiaoqing; Beesley, Jonathan; Spurdle, Amanda B.; Neuhausen, Susan L.; Ding, Yuan C.; Couch, Fergus J.; Wang, Xianshu; Peterlongo, Paolo; Manoukian, Siranoush; Bernard, Loris; Radice, Paolo; Easton, Douglas F.; Chenevix-Trench, Georgia; Antoniou, Antonis C.; Stoppa-Lyonnet, Dominique; Mazoyer, Sylvie; Sinilnikova, Olga M.

2011-01-01

Mutations in the BRCA1 gene substantially increase a woman's lifetime risk of breast cancer. However, there is great variation in this increase in risk with several genetic and non-genetic modifiers identified. The BRCA1 protein plays a central role in DNA repair, a mechanism that is particularly instrumental in safeguarding cells against tumorigenesis. We hypothesized that polymorphisms that alter the expression and/or function of BRCA1 carried on the wild-type (non-mutated) copy of the BRCA1 gene would modify the risk of breast cancer in carriers of BRCA1 mutations. A total of 9874 BRCA1 mutation carriers were available in the Consortium of Investigators of Modifiers of BRCA1/2 (CIMBA) for haplotype analyses of BRCA1. Women carrying the rare allele of single nucleotide polymorphism rs16942 on the wild-type copy of BRCA1 were at decreased risk of breast cancer (hazard ratio 0.86, 95% confidence interval 0.77–0.95, P = 0.003). Promoter in vitro assays of the major BRCA1 haplotypes showed that common polymorphisms in the regulatory region alter its activity and that this effect may be attributed to the differential binding affinity of nuclear proteins. In conclusion, variants on the wild-type copy of BRCA1 modify risk of breast cancer among carriers of BRCA1 mutations, possibly by altering the efficiency of BRCA1 transcription. PMID:21890493

Population-Based Genetic Study of β-Thalassemia Mutations in Mardan Division, Khyber Pakhtunkhwa Province, Pakistan.

PubMed

Muhammad, Raj; Shakeel, Muhammad; Rehman, Shoaib U; Lodhi, Muhammad A

2017-03-01

β-Thalassemia (β-thal) is the most prevalent hereditary blood disorder in Pakistan with a carrier rate of 5.0-8.0%. The homozygous affected children require frequent blood transfusions for their survival. This autosomal recessive disease can only be prevented through awareness programs, carrier screening, mutation detection, genetic counseling and prenatal diagnosis (PND). The present study aimed to determine the prevalence of various mutations causing β-thal and also to detect carriers of these mutations in families living in the Mardan Division, Khyber Pakhtunkhwa (KP) Province, Pakistan. The study was conducted at the Department of Biochemistry, Abdul Wali Khan University Mardan, Pakistan. Blood samples of β-thalassemic families were collected from various transfusion centers in Mardan Division. Using the amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) technique, all samples were analyzed for the six most common mutations causing β-thal in this area. Six different mutant primers for the detection of different mutations were used. The most common mutations detected in thalassemic patients were frameshift codons (FSC) 8/9 (+G) (HBB: c.27_28insG), codons 41/42 (-TTCT) (HBB: c.126_129delCTTT), and IVS-I-5 (G>C) (HBB: c.92+5G>C). The predominant mutation for carrying the mutant genes for β-thal were FSC 8/9, IVS-I-5, codons 41/42, IVS-I-1. It was also found that 66.7% of marriages were consanguineous. The FSC 8/9 mutation was found to be the most common β-thal mutation with a frequency of 44.4%. This research project provides a strong incentive for the establishment of large scale mutation detection and PND services in the Mardan Division.

The effect of genotypes and parent of origin on cancer risk and age of cancer development in PMS2 mutation carriers.

PubMed

Suerink, Manon; van der Klift, Heleen M; Ten Broeke, Sanne W; Dekkers, Olaf M; Bernstein, Inge; Capellá Munar, Gabriel; Gomez Garcia, Encarna; Hoogerbrugge, Nicoline; Letteboer, Tom G W; Menko, Fred H; Lindblom, Annika; Mensenkamp, Arjen; Moller, Pal; van Os, Theo A; Rahner, Nils; Redeker, Bert J W; Olderode-Berends, M J W; Olderode, Maran; Spruijt, Liesbeth; Vos, Yvonne J; Wagner, Anja; Morreau, Hans; Hes, Frederik J; Vasen, Hans F A; Tops, Carli M; Wijnen, Juul T; Nielsen, Maartje

2016-04-01

Lynch syndrome (LS), a heritable disorder with an increased risk of primarily colorectal cancer (CRC) and endometrial cancer (EC), can be caused by mutations in the PMS2 gene. We wished to establish whether genotype and/or parent-of-origin effects (POE) explain (part of) the reported variability in severity of the phenotype. European PMS2 mutation carriers (n = 381) were grouped and compared based on RNA expression and whether the mutation was inherited paternally or maternally. Mutation carriers with loss of RNA expression (group 1) had a significantly lower age at CRC diagnosis (51.1 years vs. 60.0 years, P = 0.035) and a lower age at EC diagnosis (55.8 years vs. 61.0 years, P = 0.2, nonsignificant) compared with group 2 (retention of RNA expression). Furthermore, group 1 showed slightly higher, but nonsignificant, hazard ratios (HRs) for both CRC (HR: 1.31, P = 0.38) and EC (HR: 1.22, P = 0.72). No evidence for a significant parent-of-origin effect was found for either CRC or EC. PMS2 mutation carriers with retention of RNA expression developed CRC 9 years later than those with loss of RNA expression. If confirmed, this finding would justify a delay in surveillance for these cases. Cancer risk was not influenced by a parent-of-origin effect.Genet Med 18 4, 405-409.

Structure and hydrogen bonds of γS-crystallin and γS-G18V studied by molecular dynamics simulation

NASA Astrophysics Data System (ADS)

Ozawa, A.; Yamada, H.; Mori, S.; Noguchi, Y.; Miyakawa, T.; Morikawa, R.; Takasu, M.

2017-11-01

The γS-crystallin protein maintains transparency and increases the reflection index of the eye lens. Here, γS-G18V, a mutant of γS-crystallin, was studied, in which the 18th residue, glycine, is replaced by valine. This mutation is associated with childhood-onset cortical cataract. Mutated γS-crystallin forms cross-links with other proteins in the eye lens and leads to aggregation at a temperature lower than that for γS-crystallin. In this study, structural analysis of γS-crystallin and γS-G18V was performed by molecular dynamics simulation. It was found that cysteine residues around the area where the mutation is introduced are arranged at the solvent side with less hydrogen bonds than in the case of γS-WT.

Cystic fibrosis carrier screening in a North American population.

PubMed

Zvereff, Val V; Faruki, Hawazin; Edwards, Marcia; Friedman, Kenneth J

2014-07-01

The aim of this study was to compare the mutation frequency distribution for a 32-mutation panel and a 69-mutation panel used for cystic fibrosis carrier screening. Further aims of the study were to examine the race-specific detection rates provided by both panels and to assess the performance of extended panels in large-scale, population-based cystic fibrosis carrier screening. Although genetic screening for the most common CFTR mutations allows detection of nearly 90% of cystic fibrosis carriers, the large number of other mutations, and their distribution within different ethnic groups, limits the utility of general population screening. Patients referred for cystic fibrosis screening from January 2005 through December 2010 were tested using either a 32-mutation panel (n = 1,601,308 individuals) or a 69-mutation panel (n = 109,830). The carrier frequencies observed for the 69-mutation panel study population (1/36) and Caucasian (1/27) and African-American individuals (1/79) agree well with published cystic fibrosis carrier frequencies; however, a higher carrier frequency was observed for Hispanic-American individuals (1/48) using the 69-mutation panel as compared with the 32-mutation panel (1/69). The 69-mutation panel detected ~20% more mutations than the 32-mutation panel for both African-American and Hispanic-American individuals. Expanded panels using race-specific variants can improve cystic fibrosis carrier detection rates within specific populations. However, it is important that the pathogenicity and the relative frequency of these variants are confirmed.

Mutations in the G6PC3 gene cause Dursun syndrome.

PubMed

Banka, Siddharth; Newman, William G; Ozgül, R Koksal; Dursun, Ali

2010-10-01

Dursun syndrome is a triad of familial primary pulmonary hypertension, leucopenia, and atrial septal defect. Here we demonstrate that mutations in G6PC3 cause Dursun syndrome. Mutations in G6PC3 are known to also cause severe congenital neutropenia type 4. Identification of the genetic basis of Dursun syndrome expands the pre-existing knowledge about the phenotypic effects of mutations in G6PC3. We propose that Dursun syndrome should now be considered as a subset of severe congenital neutropenia type 4 with pulmonary hypertension as an important clinical feature. Copyright © 2010 Wiley-Liss, Inc.

Novel cases of Tunisian patients with mutations in the gene encoding 17β-hydroxysteroid dehydrogenase type 3 and a founder effect.

PubMed

Ben Rhouma, Bochra; Kallabi, Fakhri; Mahfoudh, Nadia; Ben Mahmoud, Afif; Engeli, Roger T; Kamoun, Hassen; Keskes, Leila; Odermatt, Alex; Belguith, Neila

2017-01-01

17β-Hydroxysteroid dehydrogenase type 3 (17β-HSD3) is expressed almost exclusively in the testis and converts Δ4-androstene-3,17-dione to testosterone. Mutations in the HSD17B3 gene causing 17β-HSD3 deficiency are responsible for a rare recessive form of 46, XY Disorders of Sex Development (46, XY DSD). We report novel cases of Tunisian patients with 17β-HSD3 deficiency due to previously reported mutations, i.e. p.C206X and p.G133R, as well as a case with the novel compound heterozygous mutations p.C206X and p.Q176P. Moreover, the previously reported polymorphism p.G289S was identified in a heterozygous state in combination with a novel non-coding variant c.54G>T, also in a heterozygous state, in a male patient presenting with micropenis and low testosterone levels. The identification of four different mutations in a cohort of eight patients confirms the generally observed genetic heterogeneity of 17β-HSD3 deficiency. Nevertheless, analysis of DNA from 272 randomly selected healthy controls from the same geographic area (region of Sfax) revealed a high carrier frequency for the p.C206X mutation of approximately 1 in 40. Genotype reconstruction of the affected pedigree members revealed that all p.C206X mutation carriers harbored the same haplotype, indicating inheritance of the mutation from a common ancestor. Thus, the identification of a founder effect and the elevated carrier frequency of the p.C206X mutation emphasize the importance to consider this mutation in the diagnosis and genetic counseling of affected 17β-HSD3 deficiency pedigrees in Tunisia. Copyright © 2016 Elsevier Ltd. All rights reserved.

G20210A prothrombin gene mutation identified in patients with venous leg ulcers.

PubMed

Jebeleanu, G; Procopciuc, L

2001-01-01

The G20210A mutation variant of prothrombin gene is the second most frequent mutation identified in patients with deep venous thrombosis, after factor V Leiden. The risk for developing deep venous thrombosis is high in patients identified as heterozygous for G20210A mutation. In order to identify this polymorphism in the gene coding prothrombin, the 345bp fragment in the 3'- untranslated region of the prothrombin gene was amplified using amplification by polymerase chain reaction and enzymatic digestion by HindIII (restriction endonuclease enzyme). The products of amplification and enzymatic's digestion were analized using agarose gel electrophoresis. We investigated 20 patients with venous leg ulcers and we found 2 heterozygous (10%) for G20210A mutation. None of the patients in the control group had G20210A mutation. Our study confirms the presence of G20210A mutation in the Romanian population. Our study also shows the link between venous leg ulcers and this polymorphism in the prothrombin gene.

Association between Three Mutations, F1565C, V1023G and S996P, in the Voltage-Sensitive Sodium Channel Gene and Knockdown Resistance in Aedes aegypti from Yogyakarta, Indonesia

PubMed Central

Rochmijati Wuliandari, Juli; Lee, Siu Fai; White, Vanessa Linley; Tantowijoyo, Warsito; Hoffmann, Ary Anthony; Endersby-Harshman, Nancy Margaret

2015-01-01

Mutations in the voltage-sensitive sodium channel gene (Vssc) have been identified in Aedes aegypti and some have been associated with pyrethroid insecticide resistance. Whether these mutations cause resistance, alone or in combination with other alleles, remains unclear, but must be understood if mutations are to become markers for resistance monitoring. We describe High Resolution Melt (HRM) genotyping assays for assessing mutations found in Ae. aegypti in Indonesia (F1565C, V1023G, S996P) and use them to test for associations with pyrethroid resistance in mosquitoes from Yogyakarta, a city where insecticide use is widespread. Such knowledge is important because Yogyakarta is a target area for releases of Wolbachia-infected mosquitoes with virus-blocking traits for dengue suppression. We identify three alleles across Yogyakarta putatively linked to resistance in previous research. By comparing resistant and susceptible mosquitoes from bioassays, we show that the 1023G allele is associated with resistance to type I and type II pyrethroids. In contrast, F1565C homozygotes were rare and there was only a weak association between individuals heterozygous for the mutation and resistance to a type I pyrethroid. As the heterozygote is expected to be incompletely recessive, it is likely that this association was due to a different resistance mechanism being present. A resistance advantage conferred to V1023G homozygotes through addition of the S996P allele in the homozygous form was suggested for the Type II pyrethroid, deltamethrin. Screening of V1023G and S996P should assist resistance monitoring in Ae. aegypti from Yogyakarta, and these mutations should be maintained in Wolbachia strains destined for release in this city to ensure that these virus-blocking strains of mosquitoes are not disadvantaged, relative to resident populations. PMID:26463408

Association between Three Mutations, F1565C, V1023G and S996P, in the Voltage-Sensitive Sodium Channel Gene and Knockdown Resistance in Aedes aegypti from Yogyakarta, Indonesia.

PubMed

Wuliandari, Juli Rochmijati; Lee, Siu Fai; White, Vanessa Linley; Tantowijoyo, Warsito; Hoffmann, Ary Anthony; Endersby-Harshman, Nancy Margaret

2015-07-23

Mutations in the voltage-sensitive sodium channel gene (Vssc) have been identified in Aedes aegypti and some have been associated with pyrethroid insecticide resistance. Whether these mutations cause resistance, alone or in combination with other alleles, remains unclear, but must be understood if mutations are to become markers for resistance monitoring. We describe High Resolution Melt (HRM) genotyping assays for assessing mutations found in Ae. aegypti in Indonesia (F1565C, V1023G, S996P) and use them to test for associations with pyrethroid resistance in mosquitoes from Yogyakarta, a city where insecticide use is widespread. Such knowledge is important because Yogyakarta is a target area for releases of Wolbachia-infected mosquitoes with virus-blocking traits for dengue suppression. We identify three alleles across Yogyakarta putatively linked to resistance in previous research. By comparing resistant and susceptible mosquitoes from bioassays, we show that the 1023G allele is associated with resistance to type I and type II pyrethroids. In contrast, F1565C homozygotes were rare and there was only a weak association between individuals heterozygous for the mutation and resistance to a type I pyrethroid. As the heterozygote is expected to be incompletely recessive, it is likely that this association was due to a different resistance mechanism being present. A resistance advantage conferred to V1023G homozygotes through addition of the S996P allele in the homozygous form was suggested for the Type II pyrethroid, deltamethrin. Screening of V1023G and S996P should assist resistance monitoring in Ae. aegypti from Yogyakarta, and these mutations should be maintained in Wolbachia strains destined for release in this city to ensure that these virus-blocking strains of mosquitoes are not disadvantaged, relative to resident populations.

RNAi Mediated Silencing of LRRK2G2019S in Parkinson’s Disease

DTIC Science & Technology

2013-08-01

CONTRACTING ORGANIZATION : Georgetown University Medical Center Washington DC 20057-2197 REPORT DATE: August 2013 TYPE OF REPORT: Final Option...georgetown.edu, xs37@georgetown.edu 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) Georgetown University Medical...Center 8. PERFORMING ORGANIZATION REPORT NUMBER Washington DC 20057- 2197 9. SPONSORING / MONITORING AGENCY NAME(S) AND ADDRESS

Ovarian cancer susceptibility alleles and risk of ovarian cancer in BRCA1 and BRCA2 mutation carriers.

PubMed

Ramus, Susan J; Antoniou, Antonis C; Kuchenbaecker, Karoline B; Soucy, Penny; Beesley, Jonathan; Chen, Xiaoqing; McGuffog, Lesley; Sinilnikova, Olga M; Healey, Sue; Barrowdale, Daniel; Lee, Andrew; Thomassen, Mads; Gerdes, Anne-Marie; Kruse, Torben A; Jensen, Uffe Birk; Skytte, Anne-Bine; Caligo, Maria A; Liljegren, Annelie; Lindblom, Annika; Olsson, Håkan; Kristoffersson, Ulf; Stenmark-Askmalm, Marie; Melin, Beatrice; Domchek, Susan M; Nathanson, Katherine L; Rebbeck, Timothy R; Jakubowska, Anna; Lubinski, Jan; Jaworska, Katarzyna; Durda, Katarzyna; Złowocka, Elżbieta; Gronwald, Jacek; Huzarski, Tomasz; Byrski, Tomasz; Cybulski, Cezary; Toloczko-Grabarek, Aleksandra; Osorio, Ana; Benitez, Javier; Duran, Mercedes; Tejada, Maria-Isabel; Hamann, Ute; Rookus, Matti; van Leeuwen, Flora E; Aalfs, Cora M; Meijers-Heijboer, Hanne E J; van Asperen, Christi J; van Roozendaal, K E P; Hoogerbrugge, Nicoline; Collée, J Margriet; Kriege, Mieke; van der Luijt, Rob B; Peock, Susan; Frost, Debra; Ellis, Steve D; Platte, Radka; Fineberg, Elena; Evans, D Gareth; Lalloo, Fiona; Jacobs, Chris; Eeles, Ros; Adlard, Julian; Davidson, Rosemarie; Eccles, Diana; Cole, Trevor; Cook, Jackie; Paterson, Joan; Douglas, Fiona; Brewer, Carole; Hodgson, Shirley; Morrison, Patrick J; Walker, Lisa; Porteous, Mary E; Kennedy, M John; Pathak, Harsh; Godwin, Andrew K; Stoppa-Lyonnet, Dominique; Caux-Moncoutier, Virginie; de Pauw, Antoine; Gauthier-Villars, Marion; Mazoyer, Sylvie; Léoné, Mélanie; Calender, Alain; Lasset, Christine; Bonadona, Valérie; Hardouin, Agnès; Berthet, Pascaline; Bignon, Yves-Jean; Uhrhammer, Nancy; Faivre, Laurence; Loustalot, Catherine; Buys, Saundra; Daly, Mary; Miron, Alex; Terry, Mary Beth; Chung, Wendy K; John, Esther M; Southey, Melissa; Goldgar, David; Singer, Christian F; Tea, Muy-Kheng; Pfeiler, Georg; Fink-Retter, Anneliese; Hansen, Thomas v O; Ejlertsen, Bent; Johannsson, Oskar Th; Offit, Kenneth; Kirchhoff, Tomas; Gaudet, Mia M; Vijai, Joseph; Robson, Mark; Piedmonte, Marion; Phillips, Kelly-Anne; Van Le, Linda; Hoffman, James S; Ewart Toland, Amanda; Montagna, Marco; Tognazzo, Silvia; Imyanitov, Evgeny; Issacs, Claudine; Janavicius, Ramunas; Lazaro, Conxi; Blanco, Iganacio; Tornero, Eva; Navarro, Matilde; Moysich, Kirsten B; Karlan, Beth Y; Gross, Jenny; Olah, Edith; Vaszko, Tibor; Teo, Soo-Hwang; Ganz, Patricia A; Beattie, Mary S; Dorfling, Cecelia M; van Rensburg, Elizabeth J; Diez, Orland; Kwong, Ava; Schmutzler, Rita K; Wappenschmidt, Barbara; Engel, Christoph; Meindl, Alfons; Ditsch, Nina; Arnold, Norbert; Heidemann, Simone; Niederacher, Dieter; Preisler-Adams, Sabine; Gadzicki, Dorotehea; Varon-Mateeva, Raymonda; Deissler, Helmut; Gehrig, Andrea; Sutter, Christian; Kast, Karin; Fiebig, Britta; Schäfer, Dieter; Caldes, Trinidad; de la Hoya, Miguel; Nevanlinna, Heli; Aittomäki, Kristiina; Plante, Marie; Spurdle, Amanda B; Neuhausen, Susan L; Ding, Yuan Chun; Wang, Xianshu; Lindor, Noralane; Fredericksen, Zachary; Pankratz, V Shane; Peterlongo, Paolo; Manoukian, Siranoush; Peissel, Bernard; Zaffaroni, Daniela; Bonanni, Bernardo; Bernard, Loris; Dolcetti, Riccardo; Papi, Laura; Ottini, Laura; Radice, Paolo; Greene, Mark H; Mai, Phuong L; Andrulis, Irene L; Glendon, Gord; Ozcelik, Hilmi; Pharoah, Paul D P; Gayther, Simon A; Simard, Jacques; Easton, Douglas F; Couch, Fergus J; Chenevix-Trench, Georgia

2012-04-01

Germline mutations in BRCA1 and BRCA2 are associated with increased risks of breast and ovarian cancer. A genome-wide association study (GWAS) identified six alleles associated with risk of ovarian cancer for women in the general population. We evaluated four of these loci as potential modifiers of ovarian cancer risk for BRCA1 and BRCA2 mutation carriers. Four single-nucleotide polymorphisms (SNPs), rs10088218 (at 8q24), rs2665390 (at 3q25), rs717852 (at 2q31), and rs9303542 (at 17q21), were genotyped in 12,599 BRCA1 and 7,132 BRCA2 carriers, including 2,678 ovarian cancer cases. Associations were evaluated within a retrospective cohort approach. All four loci were associated with ovarian cancer risk in BRCA2 carriers; rs10088218 per-allele hazard ratio (HR) = 0.81 (95% CI: 0.67-0.98) P-trend = 0.033, rs2665390 HR = 1.48 (95% CI: 1.21-1.83) P-trend = 1.8 × 10(-4), rs717852 HR = 1.25 (95% CI: 1.10-1.42) P-trend = 6.6 × 10(-4), rs9303542 HR = 1.16 (95% CI: 1.02-1.33) P-trend = 0.026. Two loci were associated with ovarian cancer risk in BRCA1 carriers; rs10088218 per-allele HR = 0.89 (95% CI: 0.81-0.99) P-trend = 0.029, rs2665390 HR = 1.25 (95% CI: 1.10-1.42) P-trend = 6.1 × 10(-4). The HR estimates for the remaining loci were consistent with odds ratio estimates for the general population. The identification of multiple loci modifying ovarian cancer risk may be useful for counseling women with BRCA1 and BRCA2 mutations regarding their risk of ovarian cancer. © 2012 Wiley Periodicals, Inc.

Ovarian Cancer Susceptibility Alleles and Risk of Ovarian Cancer in BRCA1 and BRCA2 Mutation Carriers

PubMed Central

Ramus, Susan J.; Antoniou, Antonis C; Kuchenbaecker, Karoline B.; Soucy, Penny; Beesley, Jonathan; Chen, Xiaoqing; McGuffog, Lesley; Sinilnikova, Olga M.; Healey, Sue; Barrowdale, Daniel; Lee, Andrew; Thomassen, Mads; Gerdes, Anne-Marie; Kruse, Torben A.; Jensen, Uffe Birk; Skytte, Anne-Bine; Caligo, Maria A.; Liljegren, Annelie; Lindblom, Annika; Olsson, Håkan; Kristoffersson, Ulf; Stenmark-Askmalm, Marie; Melin, Beatrice; Domchek, Susan M.; Nathanson, Katherine L.; Rebbeck, Timothy R.; Jakubowska, Anna; Lubinski, Jan; Jaworska, Katarzyna; Durda, Katarzyna; Złowocka, Elżbieta; Gronwald, Jacek; Huzarski, Tomasz; Byrski, Tomasz; Cybulski, Cezary; Toloczko-Grabarek, Aleksandra; Osorio, Ana; Benitez, Javier; Duran, Mercedes; Tejada, Maria-Isabel; Hamann, Ute; Rookus, Matti; van Leeuwen, Flora E.; Aalfs, Cora M.; Meijers-Heijboer, Hanne E.J.; van Asperen, Christi J.; van Roozendaal, K.E.P.; Hoogerbrugge, Nicoline; Collée, J. Margriet; Kriege, Mieke; van der Luijt, Rob B.; Peock, Susan; Frost, Debra; Ellis, Steve D.; Platte, Radka; Fineberg, Elena; Evans, D. Gareth; Lalloo, Fiona; Jacobs, Chris; Eeles, Ros; Adlard, Julian; Davidson, Rosemarie; Eccles, Diana; Cole, Trevor; Cook, Jackie; Paterson, Joan; Douglas, Fiona; Brewer, Carole; Hodgson, Shirley; Morrison, Patrick J.; Walker, Lisa; Porteous, Mary E.; Kennedy, M. John; Pathak, Harsh; Godwin, Andrew K.; Stoppa-Lyonnet, Dominique; Caux-Moncoutier, Virginie; de Pauw, Antoine; Gauthier-Villars, Marion; Mazoyer, Sylvie; Léoné, Mélanie; Calender, Alain; Lasset, Christine; Bonadona, Valérie; Hardouin, Agnès; Berthet, Pascaline; Bignon, Yves-Jean; Uhrhammer, Nancy; Faivre, Laurence; Loustalot, Catherine; Buys, Saundra; Daly, Mary; Miron, Alex; Terry, Mary Beth; Chung, Wendy K.; John, Esther M; Southey, Melissa; Goldgar, David; Singer, Christian F; Tea, Muy-Kheng; Pfeiler, Georg; Fink-Retter, Anneliese; Hansen, Thomas v. O.; Ejlertsen, Bent; Johannsson, Oskar Th.; Offit, Kenneth; Kirchhoff, Tomas; Gaudet, Mia M.; Vijai, Joseph; Robson, Mark; Piedmonte, Marion; Phillips, Kelly-Anne; Van Le, Linda; Hoffman, James S; Toland, Amanda Ewart; Montagna, Marco; Tognazzo, Silvia; Imyanitov, Evgeny; Isaacs, Claudine; Janavicius, Ramunas; Lazaro, Conxi; Blanco, Ignacio; Tornero, Eva; Navarro, Matilde; Moysich, Kirsten B.; Karlan, Beth Y.; Gross, Jenny; Olah, Edith; Vaszko, Tibor; Teo, Soo-Hwang; Ganz, Patricia A.; Beattie, Mary S.; Dorfling, Cecelia M; van Rensburg, Elizabeth J; Diez, Orland; Kwong, Ava; Schmutzler, Rita K.; Wappenschmidt, Barbara; Engel, Christoph; Meindl, Alfons; Ditsch, Nina; Arnold, Norbert; Heidemann, Simone; Niederacher, Dieter; Preisler-Adams, Sabine; Gadzicki, Dorotehea; Varon-Mateeva, Raymonda; Deissler, Helmut; Gehrig, Andrea; Sutter, Christian; Kast, Karin; Fiebig, Britta; Schäfer, Dieter; Caldes, Trinidad; de la Hoya, Miguel; Nevanlinna, Heli; Aittomäki, Kristiina; Plante, Marie; Spurdle, Amanda B.; Neuhausen, Susan L.; Ding, Yuan Chun; Wang, Xianshu; Lindor, Noralane; Fredericksen, Zachary; Pankratz, V. Shane; Peterlongo, Paolo; Manoukian, Siranoush; Peissel, Bernard; Zaffaroni, Daniela; Bonanni, Bernardo; Bernard, Loris; Dolcetti, Riccardo; Papi, Laura; Ottini, Laura; Radice, Paolo; Greene, Mark H.; Mai, Phuong L.; Andrulis, Irene L.; Glendon, Gord; Ozcelik, Hilmi; Pharoah, Paul D.P.; Gayther, Simon A.; Simard, Jacques; Easton, Douglas F.; Couch, Fergus J.; Chenevix-Trench, Georgia

2012-01-01

Germline mutations in BRCA1 and BRCA2 are associated with increased risks of breast and ovarian cancer. A genome-wide association study (GWAS) identified six alleles associated with risk of ovarian cancer for women in the general population. We evaluated four of these loci as potential modifiers of ovarian cancer risk for BRCA1 and BRCA2 mutation carriers. Four single-nucleotide polymorphisms (SNPs), rs10088218 (at 8q24), rs2665390 (at 3q25), rs717852 (at 2q31), and rs9303542 (at 17q21), were genotyped in 12,599 BRCA1 and 7,132 BRCA2 carriers, including 2,678 ovarian cancer cases. Associations were evaluated within a retrospective cohort approach. All four loci were associated with ovarian cancer risk in BRCA2 carriers; rs10088218 per-allele hazard ratio (HR) = 0.81 (95% CI: 0.67–0.98) P-trend = 0.033, rs2665390 HR = 1.48 (95% CI: 1.21–1.83) P-trend = 1.8 × 10−4, rs717852 HR = 1.25 (95% CI: 1.10–1.42) P-trend = 6.6 × 10−4, rs9303542 HR = 1.16 (95% CI: 1.02–1.33) P-trend = 0.026. Two loci were associated with ovarian cancer risk in BRCA1 carriers; rs10088218 per-allele HR = 0.89 (95% CI: 0.81–0.99) P-trend = 0.029, rs2665390 HR = 1.25 (95% CI: 1.10–1.42) P-trend = 6.1 × 10−4. The HR estimates for the remaining loci were consistent with odds ratio estimates for the general population. The identification of multiple loci modifying ovarian cancer risk may be useful for counseling women with BRCA1 and BRCA2 mutations regarding their risk of ovarian cancer. PMID:22253144

Common variants at the 19p13.1 and ZNF365 loci are associated with ER subtypes of breast cancer and ovarian cancer risk in BRCA1 and BRCA2 mutation carriers

PubMed Central

Couch, Fergus J.; Gaudet, Mia M.; Antoniou, Antonis C.; Ramus, Susan J.; Kuchenbaecker, Karoline B.; Soucy, Penny; Beesley, Jonathan; Chen, Xiaoqing; Wang, Xianshu; Kirchhoff, Tomas; McGuffog, Lesley; Barrowdale, Daniel; Lee, Andrew; Healey, Sue; Sinilnikova, Olga M.; Andrulis, Irene L.; Ozcelik, Hilmi; Mulligan, Anna Marie; Thomassen, Mads; Gerdes, Anne-Marie; Jensen, Uffe Birk; Skytte, Anne-Bine; Kruse, Torben A.; Caligo, Maria A.; von Wachenfeldt, Anna; Barbany-Bustinza, Gisela; Loman, Niklas; Soller, Maria; Ehrencrona, Hans; Karlsson, Per; Nathanson, Katherine L.; Rebbeck, Timothy R.; Domchek, Susan M.; Jakubowska, Ania; Lubinski, Jan; Jaworska, Katarzyna; Durda, Katarzyna; Złowocka, Elżbieta; Huzarski, Tomasz; Byrski, Tomasz; Gronwald, Jacek; Cybulski, Cezary; Górski, Bohdan; Osorio, Ana; Durán, Mercedes; Tejada, María Isabel; Benitez, Javier; Hamann, Ute; Hogervorst, Frans B.L.; van Os, Theo A.; van Leeuwen, Flora E.; Meijers-Heijboer, Hanne E.J.; Wijnen, Juul; Blok, Marinus J.; Kets, Marleen; Hooning, Maartje J.; Oldenburg, Rogier A.; Ausems, Margreet G.E.M.; Peock, Susan; Frost, Debra; Ellis, Steve D.; Platte, Radka; Fineberg, Elena; Evans, D. Gareth; Jacobs, Chris; Eeles, Rosalind A.; Adlard, Julian; Davidson, Rosemarie; Eccles, Diana M.; Cole, Trevor; Cook, Jackie; Paterson, Joan; Brewer, Carole; Douglas, Fiona; Hodgson, Shirley V.; Morrison, Patrick J.; Walker, Lisa; Porteous, Mary E.; Kennedy, M. John; Side, Lucy E.; Bove, Betsy; Godwin, Andrew K.; Stoppa-Lyonnet, Dominique; Fassy-Colcombet, Marion; Castera, Laurent; Cornelis, François; Mazoyer, Sylvie; Léoné, Mélanie; Boutry-Kryza, Nadia; Bressac-de Paillerets, Brigitte; Caron, Olivier; Pujol, Pascal; Coupier, Isabelle; Delnatte, Capucine; Akloul, Linda; Lynch, Henry T.; Snyder, Carrie L.; Buys, Saundra S.; Daly, Mary B.; Terry, MaryBeth; Chung, Wendy K.; John, Esther M.; Miron, Alexander; Southey, Melissa C.; Hopper, John L.; Goldgar, David E.; Singer, Christian F.; Rappaport, Christine; Tea, Muy-Kheng M.; Fink-Retter, Anneliese; Hansen, Thomas V. O.; Nielsen, Finn C.; Arason, Aðalgeir; Vijai, Joseph; Shah, Sohela; Sarrel, Kara; Robson, Mark E.; Piedmonte, Marion; Phillips, Kelly; Basil, Jack; Rubinstein, Wendy S.; Boggess, John; Wakeley, Katie; Ewart-Toland, Amanda; Montagna, Marco; Agata, Simona; Imyanitov, Evgeny N.; Isaacs, Claudine; Janavicius, Ramunas; Lazaro, Conxi; Blanco, Ignacio; Feliubadalo, Lidia; Brunet, Joan; Gayther, Simon A; Pharoah, Paul PD; Odunsi, Kunle O.; Karlan, Beth Y.; Walsh, Christine S.; Olah, Edith; Teo, Soo Hwang; Ganz, Patricia A.; Beattie, Mary S.; van Rensburg, Elizabeth J.; Dorfling, Cecelia M.; Diez, Orland; Kwong, Ava; Schmutzler, Rita K.; Wappenschmidt, Barbara; Engel, Christoph; Meindl, Alfons; Ditsch, Nina; Arnold, Norbert; Heidemann, Simone; Niederacher, Dieter; Preisler-Adams, Sabine; Gadzicki, Dorothea; Varon-Mateeva, Raymonda; Deissler, Helmut; Gehrig, Andrea; Sutter, Christian; Kast, Karin; Fiebig, Britta; Heinritz, Wolfram; Caldes, Trinidad; de la Hoya, Miguel; Muranen, Taru A.; Nevanlinna, Heli; Tischkowitz, Marc D.; Spurdle, Amanda B.; Neuhausen, Susan L.; Ding, Yuan Chun; Lindor, Noralane M.; Fredericksen, Zachary; Pankratz, V. Shane; Peterlongo, Paolo; Manoukian, Siranoush; Peissel, Bernard; Zaffaroni, Daniela; Barile, Monica; Bernard, Loris; Viel, Alessandra; Giannini, Giuseppe; Varesco, Liliana; Radice, Paolo; Greene, Mark H.; Mai, Phuong L.; Easton, Douglas F.; Chenevix-Trench, Georgia; Offit, Kenneth; Simard, Jacques

2012-01-01

Background Genome-wide association studies (GWAS) identified variants at 19p13.1 and ZNF365 (10q21.2) as risk factors for breast cancer among BRCA1 and BRCA2 mutation carriers, respectively. We explored associations with ovarian cancer and with breast cancer by tumor histopathology for these variants in mutation carriers from the Consortium of Investigators of Modifiers of BRCA1/2 (CIMBA). Methods Genotyping data for 12,599 BRCA1 and 7,132 BRCA2 mutation carriers from 40 studies were combined. Results We confirmed associations between rs8170 at 19p13.1 and breast cancer risk for BRCA1 mutation carriers (hazard ratio (HR)=1.17; 95%CI 1.07–1.27; p=7.42×10−4) and between rs16917302 at ZNF365 (HR=0.84; 95%CI 0.73–0.97; p=0.017) but not rs311499 at 20q13.3 (HR=1.11; 95%CI 0.94–1.31; p=0.22) and breast cancer risk for BRCA2 mutation carriers. Analyses based on tumor histopathology showed that 19p13 variants were predominantly associated with estrogen receptor (ER)-negative breast cancer for both BRCA1 and BRCA2 mutation carriers, whereas rs16917302 at ZNF365 was mainly associated with ER-positive breast cancer for both BRCA1 and BRCA2 mutation carriers. We also found for the first time that rs67397200 at 19p13.1 was associated with an increased risk of ovarian cancer for BRCA1 (HR=1.16; 95%CI 1.05–1.29; p=3.8×10−4) and BRCA2 mutation carriers (HR=1.30; 95%CI 1.10–1.52; p=1.8×10−3). Conclusions 19p13.1 and ZNF365 are susceptibility loci for ovarian cancer and ER subtypes of breast cancer among BRCA1 and BRCA2 mutation carriers. Impact These findings can lead to an improved understanding of tumor development and may prove useful for breast and ovarian cancer risk prediction for BRCA1 and BRCA2 mutation carriers. PMID:22351618

Breast tumors from CHEK2 1100delC-mutation carriers: genomic landscape and clinical implications.

PubMed

Muranen, Taru A; Greco, Dario; Fagerholm, Rainer; Kilpivaara, Outi; Kämpjärvi, Kati; Aittomäki, Kristiina; Blomqvist, Carl; Heikkilä, Päivi; Borg, Ake; Nevanlinna, Heli

2011-09-20

Checkpoint kinase 2 (CHEK2) is a moderate penetrance breast cancer risk gene, whose truncating mutation 1100delC increases the risk about twofold. We investigated gene copy-number aberrations and gene-expression profiles that are typical for breast tumors of CHEK2 1100delC-mutation carriers. In total, 126 breast tumor tissue specimens including 32 samples from patients carrying CHEK2 1100delC were studied in array-comparative genomic hybridization (aCGH) and gene-expression (GEX) experiments. After dimensionality reduction with CGHregions R package, CHEK2 1100delC-associated regions in the aCGH data were detected by the Wilcoxon rank-sum test. The linear model was fitted to GEX data with R package limma. Genes whose expression levels were associated with CHEK2 1100delC mutation were detected by the bayesian method. We discovered four lost and three gained CHEK2 1100delC-related loci. These include losses of 1p13.3-31.3, 8p21.1-2, 8p23.1-2, and 17p12-13.1 as well as gains of 12q13.11-3, 16p13.3, and 19p13.3. Twenty-eight genes located on these regions showed differential expression between CHEK2 1100delC and other tumors, nominating them as candidates for CHEK2 1100delC-associated tumor-progression drivers. These included CLCA1 on 1p22 as well as CALCOCO1, SBEM, and LRP1 on 12q13. Altogether, 188 genes were differentially expressed between CHEK2 1100delC and other tumors. Of these, 144 had elevated and 44, reduced expression levels.Our results suggest the WNT pathway as a driver of tumorigenesis in breast tumors of CHEK2 1100delC-mutation carriers and a role for the olfactory receptor protein family in cancer progression. Differences in the expression of the 188 CHEK2 1100delC-associated genes divided breast tumor samples from three independent datasets into two groups that differed in their relapse-free survival time. We have shown that copy-number aberrations of certain genomic regions are associated with CHEK2 mutation 1100delC. On these regions, we identified

Breast tumors from CHEK2 1100delC-mutation carriers: genomic landscape and clinical implications

PubMed Central

2011-01-01

Introduction Checkpoint kinase 2 (CHEK2) is a moderate penetrance breast cancer risk gene, whose truncating mutation 1100delC increases the risk about twofold. We investigated gene copy-number aberrations and gene-expression profiles that are typical for breast tumors of CHEK2 1100delC-mutation carriers. Methods In total, 126 breast tumor tissue specimens including 32 samples from patients carrying CHEK2 1100delC were studied in array-comparative genomic hybridization (aCGH) and gene-expression (GEX) experiments. After dimensionality reduction with CGHregions R package, CHEK2 1100delC-associated regions in the aCGH data were detected by the Wilcoxon rank-sum test. The linear model was fitted to GEX data with R package limma. Genes whose expression levels were associated with CHEK2 1100delC mutation were detected by the bayesian method. Results We discovered four lost and three gained CHEK2 1100delC-related loci. These include losses of 1p13.3-31.3, 8p21.1-2, 8p23.1-2, and 17p12-13.1 as well as gains of 12q13.11-3, 16p13.3, and 19p13.3. Twenty-eight genes located on these regions showed differential expression between CHEK2 1100delC and other tumors, nominating them as candidates for CHEK2 1100delC-associated tumor-progression drivers. These included CLCA1 on 1p22 as well as CALCOCO1, SBEM, and LRP1 on 12q13. Altogether, 188 genes were differentially expressed between CHEK2 1100delC and other tumors. Of these, 144 had elevated and 44, reduced expression levels. Our results suggest the WNT pathway as a driver of tumorigenesis in breast tumors of CHEK2 1100delC-mutation carriers and a role for the olfactory receptor protein family in cancer progression. Differences in the expression of the 188 CHEK2 1100delC-associated genes divided breast tumor samples from three independent datasets into two groups that differed in their relapse-free survival time. Conclusions We have shown that copy-number aberrations of certain genomic regions are associated with CHEK2 mutation

Targeted prostate cancer screening in BRCA1 and BRCA2 mutation carriers: results from the initial screening round of the IMPACT study.

PubMed

Bancroft, Elizabeth K; Page, Elizabeth C; Castro, Elena; Lilja, Hans; Vickers, Andrew; Sjoberg, Daniel; Assel, Melissa; Foster, Christopher S; Mitchell, Gillian; Drew, Kate; Mæhle, Lovise; Axcrona, Karol; Evans, D Gareth; Bulman, Barbara; Eccles, Diana; McBride, Donna; van Asperen, Christi; Vasen, Hans; Kiemeney, Lambertus A; Ringelberg, Janneke; Cybulski, Cezary; Wokolorczyk, Dominika; Selkirk, Christina; Hulick, Peter J; Bojesen, Anders; Skytte, Anne-Bine; Lam, Jimmy; Taylor, Louise; Oldenburg, Rogier; Cremers, Ruben; Verhaegh, Gerald; van Zelst-Stams, Wendy A; Oosterwijk, Jan C; Blanco, Ignacio; Salinas, Monica; Cook, Jackie; Rosario, Derek J; Buys, Saundra; Conner, Tom; Ausems, Margreet G; Ong, Kai-ren; Hoffman, Jonathan; Domchek, Susan; Powers, Jacquelyn; Teixeira, Manuel R; Maia, Sofia; Foulkes, William D; Taherian, Nassim; Ruijs, Marielle; Helderman-van den Enden, Apollonia T; Izatt, Louise; Davidson, Rosemarie; Adank, Muriel A; Walker, Lisa; Schmutzler, Rita; Tucker, Kathy; Kirk, Judy; Hodgson, Shirley; Harris, Marion; Douglas, Fiona; Lindeman, Geoffrey J; Zgajnar, Janez; Tischkowitz, Marc; Clowes, Virginia E; Susman, Rachel; Ramón y Cajal, Teresa; Patcher, Nicholas; Gadea, Neus; Spigelman, Allan; van Os, Theo; Liljegren, Annelie; Side, Lucy; Brewer, Carole; Brady, Angela F; Donaldson, Alan; Stefansdottir, Vigdis; Friedman, Eitan; Chen-Shtoyerman, Rakefet; Amor, David J; Copakova, Lucia; Barwell, Julian; Giri, Veda N; Murthy, Vedang; Nicolai, Nicola; Teo, Soo-Hwang; Greenhalgh, Lynn; Strom, Sara; Henderson, Alex; McGrath, John; Gallagher, David; Aaronson, Neil; Ardern-Jones, Audrey; Bangma, Chris; Dearnaley, David; Costello, Philandra; Eyfjord, Jorunn; Rothwell, Jeanette; Falconer, Alison; Gronberg, Henrik; Hamdy, Freddie C; Johannsson, Oskar; Khoo, Vincent; Kote-Jarai, Zsofia; Lubinski, Jan; Axcrona, Ulrika; Melia, Jane; McKinley, Joanne; Mitra, Anita V; Moynihan, Clare; Rennert, Gad; Suri, Mohnish; Wilson, Penny; Killick, Emma; Moss, Sue; Eeles, Rosalind A

2014-09-01

Men with germline breast cancer 1, early onset (BRCA1) or breast cancer 2, early onset (BRCA2) gene mutations have a higher risk of developing prostate cancer (PCa) than noncarriers. IMPACT (Identification of Men with a genetic predisposition to ProstAte Cancer: Targeted screening in BRCA1/2 mutation carriers and controls) is an international consortium of 62 centres in 20 countries evaluating the use of targeted PCa screening in men with BRCA1/2 mutations. To report the first year's screening results for all men at enrollment in the study. We recruited men aged 40-69 yr with germline BRCA1/2 mutations and a control group of men who have tested negative for a pathogenic BRCA1 or BRCA2 mutation known to be present in their families. All men underwent prostate-specific antigen (PSA) testing at enrollment, and those men with PSA >3 ng/ml were offered prostate biopsy. PSA levels, PCa incidence, and tumour characteristics were evaluated. The Fisher exact test was used to compare the number of PCa cases among groups and the differences among disease types. We recruited 2481 men (791 BRCA1 carriers, 531 BRCA1 controls; 731 BRCA2 carriers, 428 BRCA2 controls). A total of 199 men (8%) presented with PSA >3.0 ng/ml, 162 biopsies were performed, and 59 PCas were diagnosed (18 BRCA1 carriers, 10 BRCA1 controls; 24 BRCA2 carriers, 7 BRCA2 controls); 66% of the tumours were classified as intermediate- or high-risk disease. The positive predictive value (PPV) for biopsy using a PSA threshold of 3.0 ng/ml in BRCA2 mutation carriers was 48%-double the PPV reported in population screening studies. A significant difference in detecting intermediate- or high-risk disease was observed in BRCA2 carriers. Ninety-five percent of the men were white, thus the results cannot be generalised to all ethnic groups. The IMPACT screening network will be useful for targeted PCa screening studies in men with germline genetic risk variants as they are discovered. These preliminary results support the

Targeted Prostate Cancer Screening in BRCA1 and BRCA2 Mutation Carriers: Results from the Initial Screening Round of the IMPACT Study

PubMed Central

Bancroft, Elizabeth K.; Page, Elizabeth C.; Castro, Elena; Lilja, Hans; Vickers, Andrew; Sjoberg, Daniel; Assel, Melissa; Foster, Christopher S.; Mitchell, Gillian; Drew, Kate; Mæhle, Lovise; Axcrona, Karol; Evans, D. Gareth; Bulman, Barbara; Eccles, Diana; McBride, Donna; van Asperen, Christi; Vasen, Hans; Kiemeney, Lambertus A.; Ringelberg, Janneke; Cybulski, Cezary; Wokolorczyk, Dominika; Selkirk, Christina; Hulick, Peter J.; Bojesen, Anders; Skytte, Anne-Bine; Lam, Jimmy; Taylor, Louise; Oldenburg, Rogier; Cremers, Ruben; Verhaegh, Gerald; van Zelst-Stams, Wendy A.; Oosterwijk, Jan C.; Blanco, Ignacio; Salinas, Monica; Cook, Jackie; Rosario, Derek J.; Buys, Saundra; Conner, Tom; Ausems, Margreet G.; Ong, Kai-ren; Hoffman, Jonathan; Domchek, Susan; Powers, Jacquelyn; Teixeira, Manuel R.; Maia, Sofia; Foulkes, William D.; Taherian, Nassim; Ruijs, Marielle; den Enden, Apollonia T. Helderman-van; Izatt, Louise; Davidson, Rosemarie; Adank, Muriel A.; Walker, Lisa; Schmutzler, Rita; Tucker, Kathy; Kirk, Judy; Hodgson, Shirley; Harris, Marion; Douglas, Fiona; Lindeman, Geoffrey J.; Zgajnar, Janez; Tischkowitz, Marc; Clowes, Virginia E.; Susman, Rachel; Ramón y Cajal, Teresa; Patcher, Nicholas; Gadea, Neus; Spigelman, Allan; van Os, Theo; Liljegren, Annelie; Side, Lucy; Brewer, Carole; Brady, Angela F.; Donaldson, Alan; Stefansdottir, Vigdis; Friedman, Eitan; Chen-Shtoyerman, Rakefet; Amor, David J.; Copakova, Lucia; Barwell, Julian; Giri, Veda N.; Murthy, Vedang; Nicolai, Nicola; Teo, Soo-Hwang; Greenhalgh, Lynn; Strom, Sara; Henderson, Alex; McGrath, John; Gallagher, David; Aaronson, Neil; Ardern-Jones, Audrey; Bangma, Chris; Dearnaley, David; Costello, Philandra; Eyfjord, Jorunn; Rothwell, Jeanette; Falconer, Alison; Gronberg, Henrik; Hamdy, Freddie C.; Johannsson, Oskar; Khoo, Vincent; Kote-Jarai, Zsofia; Lubinski, Jan; Axcrona, Ulrika; Melia, Jane; McKinley, Joanne; Mitra, Anita V.; Moynihan, Clare; Rennert, Gad; Suri, Mohnish; Wilson, Penny; Killick, Emma; Moss, Sue; Eeles, Rosalind A.

2014-01-01

Background Men with germline breast cancer 1, early onset (BRCA1) or breast cancer 2, early onset (BRCA2) gene mutations have a higher risk of developing prostate cancer (PCa) than noncarriers. IMPACT (Identification of Men with a genetic predisposition to ProstAte Cancer: Targeted screening in BRCA1/2 mutation carriers and controls) is an international consortium of 62 centres in 20 countries evaluating the use of targeted PCa screening in men with BRCA1/2 mutations. Objective To report the first year's screening results for all men at enrolment in the study. Design, setting and participants We recruited men aged 40–69 yr with germline BRCA1/2 mutations and a control group of men who have tested negative for a pathogenic BRCA1 or BRCA2 mutation known to be present in their families. All men underwent prostate-specific antigen (PSA) testing at enrolment, and those men with PSA >3 ng/ml were offered prostate biopsy. Outcome measurements and statistical analysis PSA levels, PCa incidence, and tumour characteristics were evaluated. The Fisher exact test was used to compare the number of PCa cases among groups and the differences among disease types. Results and limitations We recruited 2481 men (791 BRCA1 carriers, 531 BRCA1 controls; 731 BRCA2 carriers, 428 BRCA2 controls). A total of 199 men (8%) presented with PSA >3.0 ng/ml, 162 biopsies were performed, and 59 PCas were diagnosed (18 BRCA1 carriers, 10 BRCA1 controls; 24 BRCA2 carriers, 7 BRCA2 controls); 66% of the tumours were classified as intermediate- or high-risk disease. The positive predictive value (PPV) for biopsy using a PSA threshold of 3.0 ng/ml in BRCA2 mutation carriers was 48%—double the PPV reported in population screening studies. A significant difference in detecting intermediate- or high-risk disease was observed in BRCA2 carriers. Ninety-five percent of the men were white, thus the results cannot be generalised to all ethnic groups. Conclusions The IMPACT screening network will be useful

Modifiers of breast and ovarian cancer risks for BRCA1 and BRCA2 mutation carriers.

PubMed

Milne, Roger L; Antoniou, Antonis C

2016-10-01

Pathogenic mutations in BRCA1 and BRCA2 are associated with high risks of breast and ovarian cancer. However, penetrance estimates for mutation carriers have been found to vary substantially between studies, and the observed differences in risk are consistent with the hypothesis that genetic and environmental factors modify cancer risks for women with these mutations. Direct evidence that this is the case has emerged in the past decade, through large-scale international collaborative efforts. Here, we describe the methodological challenges in the identification and characterisation of these risk-modifying factors, review the latest evidence on genetic and lifestyle/hormonal risk factors that modify breast and ovarian cancer risks for women with BRCA1 and BRCA2 mutations and outline the implications of these findings for cancer risk prediction. We also review the unresolved issues in this area of research and identify strategies of clinical implementation so that women with BRCA1 and BRCA2 mutations are no longer counselled on the basis of 'average' risk estimates. © 2016 Society for Endocrinology.

Prophylactic bilateral salpingo-oophorectomy (PBSO) with or without prophylactic bilateral mastectomy (PBM) or no intervention in BRCA1 mutation carriers: a cost-effectiveness analysis.

PubMed

Norum, Jan; Hagen, Anne Irene; Maehle, Lovise; Apold, Jaran; Burn, John; Møller, Pål

2008-05-01

Women with germline BRCA1 mutation have a significant risk of breast and/or ovarian cancer. Prophylactic bilateral mastectomy (PBM) and prophylactic bilateral salpingo-oophorectomy (PBSO) prevent cancer in mutation carriers. The cost-effectiveness of PBSO (age of 35 years) with or without PBM five years earlier was compared to a no intervention setting employing a marginal cost analysis. National data on cancer incidence, mortality rates and costs were implemented together with observed Norwegian BRCA1 data in a Markov model and PBSO was assumed to reduce the risk of ovarian cancer by 90%. A 3% discount rate was used. The additional health care cost per mutation carrier undergoing PBSO and PBM was euro 15,784, and 6.4 discounted life years gained (LYG) was indicated (PBSO alone with 100% acceptance 3.1 LYG). The additional cost per LYG was euro 1973 (PBSO alone euro 1749/LYG). Including all resource use, the figure was a cost of euro 496 and euro 1284 per LYG, respectively. PBSO with or without PBM in BRCA1 mutation carriers is cost-effective. A testing of all incident breast cancers to identify mutation carrying families should be explored.

Mutations in the glucocerebrosidase gene are common in patients with Parkinson's disease from Eastern Canada.

PubMed

Han, Fabin; Grimes, David A; Li, Fang; Wang, Ting; Yu, Zhe; Song, Na; Wu, Shichao; Racacho, Lemuel; Bulman, Dennis E

2016-01-01

Mutations in the β-glucocerebrosidase gene (GBA) have been implicated as a risk factor for Parkinson's disease (PD). However, GBA mutations in PD patients of different ethnic origins were reported to be inconsistent. We sequenced all exons of the GBA gene in 225 PD patients and 110 control individuals from Eastern Canada. Two novel GBA variants of c.-119 A/G and S(-35)N, five known GBA mutations of R120W, N370S, L444P, RecNciI and RecTL mutation (del55/D409H/RecNciI) as well as two non-pathological variants of E326K and T369M were identified from PD patients while only one mutation of S13L and two non-pathological variants of E326K and T369M were found in the control individuals. The frequency of GBA mutations within PD patients (4.4%) is 4.8 times higher than the 0.91% observed in control individuals (X(2) = 2.91, p = 0.088; odds ratio = 4.835; 95% confidence interval = 2.524-9.123). The most common mutations of N370S and L444P accounted for 36.0% (9/25) of all the GBA mutations in this Eastern Canadian PD cohort. The frequency (6.67%) of E326K and T369M in PD patients is comparable to 7.27% in control individuals (X(2) = 0.042, p = 0.8376), further supporting that these two variants have no pathological effects on PD. Phenotype analysis showed that no significant difference in family history, age at onset and cognitive impairment was identified between the GBA mutation carriers and non-GBA mutation carriers. GBA mutations were found to be a common genetic risk factor for PD in Eastern Canadian patients.

Punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori in Colombian populations

PubMed Central

Matta, Andrés Jenuer; Zambrano, Diana Carolina; Pazos, Alvaro Jairo

2018-01-01

AIM To characterize punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori (H. pylori) and determine their association with therapeutic failure. METHODS PCR products of 23S rRNA gene V domain of 74 H. pylori isolates; 34 resistant to clarithromycin (29 from a low-risk gastric cancer (GC) population: Tumaco-Colombia, and 5 from a high-risk population: Tuquerres-Colombia) and 40 from a susceptible population (28 from Tumaco and 12 from Túquerres) were sequenced using capillary electrophoresis. The concordance between mutations of V domain 23S rRNA gene of H. pylori and therapeutic failure was determined using the Kappa coefficient and McNemar’s test was performed to determine the relationship between H. pylori mutations and clarithromycin resistance. RESULTS 23S rRNA gene from H. pylori was amplified in 56/74 isolates, of which 25 were resistant to clarithromycin (20 from Tumaco and 5 from Túquerres, respectively). In 17 resistant isolates (13 from Tumaco and 4 from Túquerres) the following mutations were found: A1593T1, A1653G2, C1770T, C1954T1, and G1827C in isolates from Tumaco, and A2144G from Túquerres. The mutations T2183C, A2144G and C2196T in H. pylori isolates resistant to clarithromycin from Colombia are reported for the first time. No association between the H. pylori mutations and in vitro clarithromycin resistance was found. However, therapeutic failure of eradication treatment was associated with mutations of 23S rRNA gene in clarithromycin-resistant H. pylori (κ = 0.71). CONCLUSION The therapeutic failure of eradication treatment in the two populations from Colombia was associated with mutations of the 23S rRNA gene in clarithromycin-resistant H. pylori. PMID:29662291

LRRK2 G2385R and R1628P Mutations Are Associated with an Increased Risk of Parkinson's Disease in the Malaysian Population

PubMed Central

Chua, Jing Yi; Lim, Thien Thien; Mohamed Ibrahim, Norlinah; Tan, Ai Huey; Eow, Gaik Bee; Abdul Aziz, Zariah; Puvanarajah, Santhi Datuk; Viswanathan, Shanthi; Lim, Soo Kun; Tan, Li Ping; Chong, Yip Boon; Tan, Chong Tin; Zhao, Yi; Tan, E. K.

2014-01-01

The LRRK2 gene has been associated with both familial and sporadic forms of Parkinson's disease (PD). The G2019S variant is commonly found in North African Arab and Caucasian PD patients, but this locus is monomorphic in Asians. The G2385R and R1628P variants are associated with a higher risk of developing PD in certain Asian populations but have not been studied in the Malaysian population. Therefore, we screened the G2385R and R1628P variants in 1,202 Malaysian subjects consisting of 695 cases and 507 controls. The G2385R and R1628P variants were associated with a 2.2-fold (P = 0.019) and 1.2-fold (P = 0.054) increased risk of PD, respectively. Our data concur with other reported findings in Chinese, Taiwanese, Singaporean, and Korean studies. PMID:25243190

Tracking of the origin of recurrent mutations of the BRCA1 and BRCA2 genes in the North-East of Italy and improved mutation analysis strategy.

PubMed

Cini, Giulia; Mezzavilla, Massimo; Della Puppa, Lara; Cupelli, Elisa; Fornasin, Alessio; D'Elia, Angela Valentina; Dolcetti, Riccardo; Damante, Giuseppe; Bertok, Sara; Miolo, Gianmaria; Maestro, Roberta; de Paoli, Paolo; Amoroso, Antonio; Viel, Alessandra

2016-02-06

About 20 % of hereditary breast cancers are caused by mutations in BRCA1 and BRCA2 genes. Since BRCA1 and BRCA2 mutations may be spread throughout the gene, genetic testing is usually performed by direct sequencing of entire coding regions. In some populations, especially if relatively isolated, a few number of recurrent mutations is reported, sometimes caused by founder effect. BRCA1 and BRCA2 screening for mutations was carried out on 1114 breast and/or ovarian cancer patients complying with the eligibility criteria for BRCA testing. Haplotype analysis was performed on the probands carrying recurrent mutations and their relatives, using two sets of microsatellite markers covering the BRCA1 (D17S588, D17S806, D17S902, D17S1325, D17S855, D17S1328, D17S800, and D17S250) and BRCA2 (D13S220, D13S267, D13S171, D13S1701, D13S1698, D13S260, D13S290, D13S1246) loci. The DMLE + 2.2 software was used to estimate the age of BRCA1 c.676delT and BRCA2 c.7806-2A > G. A multiplex PCR and two different primer extension assays were optimized and used for genotyping the recurrent mutations of the two genes. In the time frame of almost 20 years of genetic testing, we have found that five BRCA1 and three BRCA2 mutations are recurrent in a substantial subset of carriers from North-East Italy and neighboring Istria, where they represent more than 50 % of all mutations. Microsatellite analyses identified a common haplotype of different length for each mutation. Age estimation of BRCA1 c.676delT and BRCA2 c.7806-2A > G mutations revealed that they arose in the Friuli Venezia Giulia area about 86 and 94 generations ago, respectively. Suggestion of an association between BRCA2 c.7806-2A > G and risk of breast cancer in males has emerged. Finally, we developed a simple and efficient pre-screening test, performing an in-house primer extension SNaPshot® assay for the rapid identification of the eight recurrent mutations. Proofs of common ancestry has been obtained for the eight recurrent

COMPARISON OF AGE AT NATURAL MENOPAUSE IN BRCA1/2 MUTATION CARRIERS TO A NON-CLINIC-BASED SAMPLE OF WOMEN IN NORTHERN CALIFORNIA

PubMed Central

Lin, Wayne T; Beattie, Mary; Chen, Lee-may; Oktay, Kutluk; Crawford, Sybil L.; Gold, Ellen B.; Cedars, Marcelle; Rosen, Mitchell

2013-01-01

Objective Germline mutations in BRCA1/2 are related to increased lifetime risk of breast and ovarian cancer. While risk-reducing salpingo-oophorectomy reduces the risk for both cancers, loss of fertility is a major concern. A recent study suggested an association of BRCA1 mutation with occult primary ovarian insufficiency. The aim of this study was to determine whether BRCA1/2 mutation carriers have earlier onset of natural menopause than unaffected women. Materials and Methods Caucasian BRCA1/2 carriers (n=382) were identified within the UCSF Breast Cancer Risk Program Registry and compared to non-clinic-based Caucasian women in Northern California (n=765). We compared the two groups regarding median age at natural menopause before and after adjustment for known risk factors, and examined the role of smoking within each group, using the Kaplan-Meier approach for unadjusted analyses and Cox proportional hazards regression analyses for adjusted analyses. Results The median age at natural menopause in BRCA1/2 carriers was significantly earlier than the unaffected sample (50 vs 53years, p-value<0.001). The unadjusted hazard ratio for natural menopause comparing BRCA1/2 carriers to unaffected women was 4.06(95% confidence interval 3.03-5.45), 3.98(2.87-5.53) after adjusting for smoking, parity, and oral contraceptive use. For BRCA1/2 carriers who were current heavy smokers (≥20cigarettes/day), the median age at natural menopause was 46 vs.49years for non-smokers (p-value=0.027). Conclusions BRCA1/2 mutation was associated with significantly earlier age at natural menopause, and heavy smoking compounded this risk. As the relationship between menopause and end of natural fertility is considered fixed, these findings suggest a risk of earlier infertility among BRCA1/2 carriers. PMID:23362014

Association of PHB 1630 C>T and MTHFR 677 C>T polymorphisms with breast and ovarian cancer risk in BRCA1/2 mutation carriers: results from a multicenter study

PubMed Central

Jakubowska, A; Rozkrut, D; Antoniou, A; Hamann, U; Scott, R J; McGuffog, L; Healy, S; Sinilnikova, O M; Rennert, G; Lejbkowicz, F; Flugelman, A; Andrulis, I L; Glendon, G; Ozcelik, H; Thomassen, M; Paligo, M; Aretini, P; Kantala, J; Aroer, B; von Wachenfeldt, A; Liljegren, A; Loman, N; Herbst, K; Kristoffersson, U; Rosenquist, R; Karlsson, P; Stenmark-Askmalm, M; Melin, B; Nathanson, K L; Domchek, S M; Byrski, T; Huzarski, T; Gronwald, J; Menkiszak, J; Cybulski, C; Serrano, P; Osorio, A; Cajal, T R; Tsitlaidou, M; Benítez, J; Gilbert, M; Rookus, M; Aalfs, C M; Kluijt, I; Boessenkool-Pape, J L; Meijers-Heijboer, H E J; Oosterwijk, J C; van Asperen, C J; Blok, M J; Nelen, M R; van den Ouweland, A M W; Seynaeve, C; van der Luijt, R B; Devilee, P; Easton, D F; Peock, S; Frost, D; Platte, R; Ellis, S D; Fineberg, E; Evans, D G; Lalloo, F; Eeles, R; Jacobs, C; Adlard, J; Davidson, R; Eccles, D; Cole, T; Cook, J; Godwin, A; Bove, B; Stoppa-Lyonnet, D; Caux-Moncoutier, V; Belotti, M; Tirapo, C; Mazoyer, S; Barjhoux, L; Boutry-Kryza, N; Pujol, P; Coupier, I; Peyrat, J-P; Vennin, P; Muller, D; Fricker, J-P; Venat-Bouvet, L; Johannsson, O Th; Isaacs, C; Schmutzler, R; Wappenschmidt, B; Meindl, A; Arnold, N; Varon-Mateeva, R; Niederacher, D; Sutter, C; Deissler, H; Preisler-Adams, S; Simard, J; Soucy, P; Durocher, F; Chenevix-Trench, G; Beesley, J; Chen, X; Rebbeck, T; Couch, F; Wang, X; Lindor, N; Fredericksen, Z; Pankratz, V S; Peterlongo, P; Bonanni, B; Fortuzzi, S; Peissel, B; Szabo, C; Mai, P L; Loud, J T; Lubinski, J

2012-01-01

Background: The variable penetrance of breast cancer in BRCA1/2 mutation carriers suggests that other genetic or environmental factors modify breast cancer risk. Two genes of special interest are prohibitin (PHB) and methylene-tetrahydrofolate reductase (MTHFR), both of which are important either directly or indirectly in maintaining genomic integrity. Methods: To evaluate the potential role of genetic variants within PHB and MTHFR in breast and ovarian cancer risk, 4102 BRCA1 and 2093 BRCA2 mutation carriers, and 6211 BRCA1 and 2902 BRCA2 carriers from the Consortium of Investigators of Modifiers of BRCA1 and BRCA2 (CIMBA) were genotyped for the PHB 1630 C>T (rs6917) polymorphism and the MTHFR 677 C>T (rs1801133) polymorphism, respectively. Results: There was no evidence of association between the PHB 1630 C>T and MTHFR 677 C>T polymorphisms with either disease for BRCA1 or BRCA2 mutation carriers when breast and ovarian cancer associations were evaluated separately. Analysis that evaluated associations for breast and ovarian cancer simultaneously showed some evidence that BRCA1 mutation carriers who had the rare homozygote genotype (TT) of the PHB 1630 C>T polymorphism were at increased risk of both breast and ovarian cancer (HR 1.50, 95%CI 1.10–2.04 and HR 2.16, 95%CI 1.24–3.76, respectively). However, there was no evidence of association under a multiplicative model for the effect of each minor allele. Conclusion: The PHB 1630TT genotype may modify breast and ovarian cancer risks in BRCA1 mutation carriers. This association need to be evaluated in larger series of BRCA1 mutation carriers. PMID:22669161

48 CFR 2019.705-4 - Reviewing the subcontracting plan.

Code of Federal Regulations, 2010 CFR

2010-10-01

... COMMISSION SOCIOECONOMIC PROGRAMS SMALL BUSINESS PROGRAMS Subcontracting With Small Business, Small Disadvantaged Business, and Women-Owned Small Business Concerns 2019.705-4 Reviewing the subcontracting plan...

The 95ΔG mutation in the 5'untranslated region of the norA gene increases efflux activity in Staphylococcus epidermidis isolates.

PubMed

García-Gómez, Elizabeth; Jaso-Vera, Marcos E; Juárez-Verdayes, Marco A; Alcántar-Curiel, María D; Zenteno, Juan C; Betanzos-Cabrera, Gabriel; Peralta, Humberto; Rodríguez-Martínez, Sandra; Cancino-Díaz, Mario E; Jan-Roblero, Janet; Cancino-Diaz, Juan C

2017-02-01

In the Staphylococcus aureus ATCC25923 strain, the flqB mutation in the 5'untranslated region (5'UTR) of the norA gene causes increased norA mRNA expression and high efflux activity (HEA). The involvement of the norA gene 5'UTR in HEA has not been explored in S. epidermidis; therefore, we examined the function of this region in S. epidermidis clinical isolates. The selection of isolates with HEA was performed based on ethidium bromide (EtBr) MIC values and efflux efficiency (EF) using the semi-automated fluorometric method. The function of the 5'UTR was studied by quantifying the levels of norA expression (RT-qPCR) and by identifying 5'UTR mutations by sequence analysis. Only 10 isolates from a total of 165 (6.1%) had HEA (EtBr MIC = 300 μg/ml and EF ranged from 48.4 to 97.2%). Eight of 10 isolates with HEA had the 5'UTR 95 Δ G mutation. Isolates carrying the 95 Δ G mutation had higher levels of norA expression compared with those that did not. To corroborate that the 95 Δ G mutation is involved in HEA, a strain adapted to EtBr was obtained in vitro. This strain also presented the 95 Δ G mutation and had a high level of norA expression and EF, indicating that the 95 Δ G mutation is important for the HEA phenotype. The 95 Δ G mutation produces a different structure in the Shine-Dalgarno region, which may promote better translation of norA mRNA. To our knowledge, this is the first report to demonstrate the participation of the 5'UTR 95 Δ G mutation of the norA gene in the HEA phenotype of S. epidermidis isolates. Here, we propose that the efflux of EtBr is caused by an increment in the transcription and/or translation of the norA gene. Copyright © 2016 Elsevier Ltd. All rights reserved.

CHEK2 mutations and the risk of papillary thyroid cancer.

PubMed

Siołek, Monika; Cybulski, Cezary; Gąsior-Perczak, Danuta; Kowalik, Artur; Kozak-Klonowska, Beata; Kowalska, Aldona; Chłopek, Małgorzata; Kluźniak, Wojciech; Wokołorczyk, Dominika; Pałyga, Iwona; Walczyk, Agnieszka; Lizis-Kolus, Katarzyna; Sun, Ping; Lubiński, Jan; Narod, Steven A; Góźdż, Stanisław

2015-08-01

Mutations in the cell cycle checkpoint kinase 2 (CHEK2) tumor suppressor gene are associated with multi-organ cancer susceptibility including cancers of the breast and prostate. A genetic association between thyroid and breast cancer has been suggested, however little is known about the determinants of this association. To characterize the association of CHEK2 mutations with thyroid cancer, we genotyped 468 unselected patients with papillary thyroid cancer and 468 (matched) cancer-free controls for four founder mutations of CHEK2 (1100delC, IVS2 + 1G>A, del5395 and I157T). We compared the family histories reported by patients with a CHEK2 mutation to those of non-carriers. A CHEK2 mutation was seen in 73 of 468 (15.6%) unselected patients with papillary thyroid cancer, compared to 28 of 460 (6.0%) age- and sex-matched controls (OR 3.3; p < 0.0001). A truncating mutation (IVS2 + 1G>A, 1100delC or del5395) was associated with a higher risk of thyroid cancer (OR = 5.7; p = 0.006), than was the missense mutation I157T (OR = 2.8; p = 0.0001). CHEK2 mutation carriers reported a family history of breast cancer 2.2 times more commonly than non-carriers (16.4% vs.8.1%; p = 0.05). A CHEK2 mutation was found in seven of 11 women (63%) with multiple primary cancers of the breast and thyroid (OR = 10; p = 0.0004). These results suggest that CHEK2 mutations predispose to thyroid cancer, familial aggregations of breast and thyroid cancer and to double primary cancers of the breast and thyroid. © 2015 UICC.

Phenotype variability in a large Spanish family with Alport syndrome associated with novel mutations in COL4A3 gene.

PubMed

Cervera-Acedo, C; Coloma, A; Huarte-Loza, E; Sierra-Carpio, M; Domínguez-Garrido, E

2017-10-31

Alport syndrome is an inherited renal disorder characterized by glomerular basement membrane lesions with hematuria, proteinuria and frequent hearing defects and ocular abnormalities. The disease is associated with mutations in genes encoding α3, α4, or α5 chains of type IV collagen, namely COL4A3 and COL4A4 in chromosome 2 and COL4A5 in chromosome X. In contrast to the well-known X-linked and autosomal recessive phenotypes, there is very little information about the autosomal dominant. In view of the wide spectrum of phenotypes, an exact diagnosis is sometimes difficult to achieve. We investigated a Spanish family with variable phenotype of autosomal dominant Alport syndrome using clinical, histological, and genetic analysis. Mutational analysis of COL4A3 and COL4A4 genes showed a novel heterozygous mutation (c. 998G > A; p.G333E) in exon 18 of the COL4A3 gene. Among relatives carrying the novel mutation, the clinical phenotype was variable. Two additional COL4A3 mutations were found, a Pro-Leu substitution in exon 48 (p.P1461L) and a Ser-Cys substitution in exon 49 (p.S1492C), non-pathogenics alone. Carriers of p.G333E and p.P1461L or p.S1492C mutations in COL4A3 gene appear to be more severely affected than carriers of only p.G333E mutation, and the clinical findings has an earlier onset. In this way, we could speculate on a synergistic effect of compound heterozygosity that could explain the different phenotype observed in this family.

Punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori in Colombian populations.

PubMed

Matta, Andrés Jenuer; Zambrano, Diana Carolina; Pazos, Alvaro Jairo

2018-04-14

To characterize punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori ( H. pylori ) and determine their association with therapeutic failure. PCR products of 23S rRNA gene V domain of 74 H. pylori isolates; 34 resistant to clarithromycin (29 from a low-risk gastric cancer (GC) population: Tumaco-Colombia, and 5 from a high-risk population: Tuquerres-Colombia) and 40 from a susceptible population (28 from Tumaco and 12 from Túquerres) were sequenced using capillary electrophoresis. The concordance between mutations of V domain 23S rRNA gene of H. pylori and therapeutic failure was determined using the Kappa coefficient and McNemar's test was performed to determine the relationship between H. pylori mutations and clarithromycin resistance. 23S rRNA gene from H. pylori was amplified in 56/74 isolates, of which 25 were resistant to clarithromycin (20 from Tumaco and 5 from Túquerres, respectively). In 17 resistant isolates (13 from Tumaco and 4 from Túquerres) the following mutations were found: A1593T1, A1653G2, C1770T, C1954T1, and G1827C in isolates from Tumaco, and A2144G from Túquerres. The mutations T2183C, A2144G and C2196T in H. pylori isolates resistant to clarithromycin from Colombia are reported for the first time. No association between the H. pylori mutations and in vitro clarithromycin resistance was found. However, therapeutic failure of eradication treatment was associated with mutations of 23S rRNA gene in clarithromycin-resistant H. pylori ( κ = 0.71). The therapeutic failure of eradication treatment in the two populations from Colombia was associated with mutations of the 23S rRNA gene in clarithromycin-resistant H. pylori .

A Mayan founder mutation is a common cause of deafness in Guatemala.

PubMed

Carranza, C; Menendez, I; Herrera, M; Castellanos, P; Amado, C; Maldonado, F; Rosales, L; Escobar, N; Guerra, M; Alvarez, D; Foster, J; Guo, S; Blanton, S H; Bademci, G; Tekin, M

2015-09-08

Over 5% of the world's population has varying degrees of hearing loss. Mutations in GJB2 are the most common cause of autosomal recessive non-syndromic hearing loss (ARNHL) in many populations. The frequency and type of mutations are influenced by ethnicity. Guatemala is a multi-ethnic country with four major populations: Maya, Ladino, Xinca, and Garifuna. To determine the mutation profile of GJB2 in a ARNHL population from Guatemala, we sequenced both exons of GJB2 in 133 unrelated families. A total of six pathogenic variants were detected. The most frequent pathogenic variant is c.131G>A (p.Trp44*) detected in 21 of 266 alleles. We show that c.131G>A is associated with a conserved haplotype in Guatemala suggesting a single founder. The majority of Mayan population lives in the west region of the country from where all c.131G>A carriers originated. Further analysis of genome-wide variation of individuals carrying the c.131G>A mutation compared with those of Native American, European, and African populations shows a close match with the Mayan population. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

The heterozygous N291S mutation in the lipoprotein lipase gene impairs whole-body insulin sensitivity and affects a distinct set of plasma metabolites in humans.

PubMed

Berg, Sofia Mikkelsen; Havelund, Jesper; Hasler-Sheetal, Harald; Kruse, Vibeke; Pedersen, Andreas James Thestrup; Hansen, Aleksander Bill; Nybo, Mads; Beck-Nielsen, Henning; Højlund, Kurt; Færgeman, Nils Joakim

Mutations in the lipoprotein lipase gene causing decreased lipoprotein lipase activity are associated with surrogate markers of insulin resistance and the metabolic syndrome in humans. We investigated the hypothesis that a heterozygous lipoprotein lipase mutation (N291S) induces whole-body insulin resistance and alterations in the plasma metabolome. In 6 carriers of a heterozygous lipoprotein lipase mutation (N291S) and 11 age-matched and weight-matched healthy controls, we examined insulin sensitivity and substrate metabolism by euglycemic-hyperinsulinemic clamps combined with indirect calorimetry. Plasma samples were taken before and after the clamp (4 hours of physiological hyperinsulinemia), and metabolites were measured enzymatically or by gas chromatography-mass spectrometry. Compared with healthy controls, heterozygous carriers of a defective lipoprotein lipase allele had elevated fasting plasma levels triglycerides (P < .006), and markedly impaired insulin-stimulated glucose disposal rates (P < .024) and nonoxidative glucose metabolism (P < .015). Plasma metabolite profiling demonstrated lower circulating levels of pyruvic acid and α-tocopherol in the N291S carriers than in controls both before and after stimulation with insulin (all >1.5-fold change and P < .05). Heterozygous carriers with a defective lipoprotein lipase allele are less insulin sensitive and have increased plasma levels of nonesterified fatty acids and triglycerides. The heterozygous N291S carriers also have a distinct plasma metabolomic signature, which may serve as a diagnostic tool for deficient lipoprotein lipase activity and as a marker of lipid-induced insulin resistance. Copyright © 2017 National Lipid Association. Published by Elsevier Inc. All rights reserved.

Phosphorylation-Dependent 14-3-3 Binding to LRRK2 Is Impaired by Common Mutations of Familial Parkinson's Disease

PubMed Central

Li, Xianting; Wang, Qing Jun; Pan, Nina; Lee, Sangkyu; Zhao, Yingming; Chait, Brian T.; Yue, Zhenyu

2011-01-01

Background Recent studies show that mutations in Leucine Rich Repeat Kinase 2 (LRRK2) are the cause of the most common inherited and some sporadic forms of Parkinson's disease (PD). The molecular mechanism underlying the pathogenic role of LRRK2 mutations in PD remains unknown. Methodology/Principal Findings Using affinity purification and mass spectrometric analysis, we investigated phosphorylation sites and binding proteins of LRRK2 purified from mouse brain. We identified multiple phosphorylation sites at N-terminus of LRRK2 including S910, S912, S935 and S973. Focusing on the high stoichiometry S935 phosphorylation site, we developed an anti-pS935 specific antibody and showed that LRRK2 is constitutively phosphorylated at S935 in various tissues (including brain) and at different ages in mice. We find that 14-3-3 proteins (especially isoforms γ and η) bind LRRK2 and this binding depends on phosphorylation of S935. The binding of 14-3-3, with little effect on dimer formation of LRRK2, confers protection of the phosphorylation status of S935. Furthermore, we show that protein kinase A (PKA), but not LRRK2 kinase itself, can cause the phosphorylation of LRRK2 at S935 in vitro and in cell culture, suggesting that PKA is a potential upstream kinase that regulates LRRK2 function. Finally, our study indicates that the common PD-related mutations of LRRK2, R1441G, Y1699C and G2019S, decrease homeostatic phosphorylation levels of S935 and impair 14-3-3 binding of LRRK2. Conclusions/Significance LRRK2 is extensively phosphorylated in vivo, and the phosphorylation of specific sites (e.g. S935) determines 14-3-3 binding of LRRK2. We propose that 14-3-3 is an important regulator of LRRK2-mediated cellular functions. Our study suggests that PKA, a cAMP-dependent kinase involved in regulating dopamine physiology, is a potential upstream kinase that phosphorylates LRRK2 at S935. Furthermore, the reduction of phosphorylation/14-3-3 binding of LRRK2 due to the common familial

Molecular Dynamics Simulation of γS-WT and γS-G18V

NASA Astrophysics Data System (ADS)

Ozawa, Ai; Yamada, Hironao; Mori, Sakiko; Noguchi, Yoh; Miyakawa, Takeshi; Morikawa, Ryota; Takasu, Masako

γS-crystallin maintains transparency of the crystalline lens and increases the refraction index of lens. γS-G18V is a mutant γS-crystallin in which 18th glycine is replaced by valine. This protein is related to childhood-onset cortical cataract. In this paper, we study the fluctuation of residues and dihedral angles, and investigate the difference between γS-WT and γS-G18V by using molecular dynamics simulation. In the result of RMSF, we found large difference around the mutation point. In addition, differences of dihedral angles of cysteins were found in this area.

The TMEM43 Newfoundland mutation p.S358L causing ARVC-5 was imported from Europe and increases the stiffness of the cell nucleus.

PubMed

Milting, Hendrik; Klauke, Bärbel; Christensen, Alex Hoerby; Müsebeck, Jörg; Walhorn, Volker; Grannemann, Sören; Münnich, Tamara; Šarić, Tomo; Rasmussen, Torsten Bloch; Jensen, Henrik Kjærulf; Mogensen, Jens; Baecker, Carolin; Romaker, Elena; Laser, Kai Thorsten; zu Knyphausen, Edzard; Kassner, Astrid; Gummert, Jan; Judge, Daniel P; Connors, Sean; Hodgkinson, Kathy; Young, Terry-L; van der Zwaag, Paul A; van Tintelen, J Peter; Anselmetti, Dario

2015-04-07

Arrhythmogenic right ventricular cardiomyopathy (ARVC) is a rare genetic condition caused predominantly by mutations within desmosomal genes. The mutation leading to ARVC-5 was recently identified on the island of Newfoundland and caused by the fully penetrant missense mutation p.S358L in TMEM43. Although TMEM43-p.S358L mutation carriers were also found in the USA, Germany, and Denmark, the genetic relationship between North American and European patients and the disease mechanism of this mutation remained to be clarified. We screened 22 unrelated ARVC patients without mutations in desmosomal genes and identified the TMEM43-p.S358L mutation in a German ARVC family. We excluded TMEM43-p.S358L in 22 unrelated patients with dilated cardiomyopathy. The German family shares a common haplotype with those from Newfoundland, USA, and Denmark, suggesting that the mutation originated from a common founder. Examination of 40 control chromosomes revealed an estimated age of 1300-1500 years for the mutation, which proves the European origin of the Newfoundland mutation. Skin fibroblasts from a female and two male mutation carriers were analysed in cell culture using atomic force microscopy and revealed that the cell nuclei exhibit an increased stiffness compared with TMEM43 wild-type controls. The German family is not affected by a de novo TMEM43 mutation. It is therefore expected that an unknown number of European families may be affected by the TMEM43-p.S358L founder mutation. Due to its deleterious clinical phenotype, this mutation should be checked in any case of ARVC-related genotyping. It appears that the increased stiffness of the cell nucleus might be related to the massive loss of cardiomyocytes, which is typically found in ventricles of ARVC hearts. Published on behalf of the European Society of Cardiology. All rights reserved. © The Author 2014. For permissions please email: journals.permissions@oup.com.

Investigation of C9orf72 in 4 Neurodegenerative Disorders

PubMed Central

Xi, Zhengrui; Zinman, Lorne; Grinberg, Yakov; Moreno, Danielle; Sato, Christine; Bilbao, Juan M.; Ghani, Mahdi; Hernández, Isabel; Ruiz, Agustín; Boada, Mercè; Morón, Francisco J.; Lang, Anthony E.; Marras, Connie; Bruni, Amalia; Colao, Rosanna; Maletta, Raffaele G.; Puccio, Gianfranco; Rainero, Innocenzo; Pinessi, Lorenzo; Galimberti, Daniela; Morrison, Karen E.; Moorby, Catriona; Stockton, Joanne D.; Masellis, Mario; Black, Sandra E.; Hazrati, Lili-Naz; Liang, Yan; van Haersma de With, Jan; Fornazzari, Luis; Villagra, Roque; Rojas-Garcia, Ricardo; Clarimón, Jordi; Mayeux, Richard; Robertson, Janice; St George-Hyslop, Peter; Rogaeva, Ekaterina

2014-01-01

Objective To estimate the allele frequency of C9orf72 (G4C2) repeats in amyotrophic lateral sclerosis (ALS), frontotemporal lobar degeneration (FTLD), Alzheimer disease (AD), and Parkinson disease (PD). Design The number of repeats was estimated by a 2-step genotyping strategy. For expansion carriers, we sequenced the repeat flanking regions and obtained APOE genotypes and MAPT H1/H2 haplotypes. Setting Hospitals specializing in neurodegenerative disorders. Subjects We analyzed 520 patients with FTLD, 389 patients with ALS, 424 patients with AD, 289 patients with PD, 602 controls, 18 families, and 29 patients with PD with the LRRK2 G2019S mutation. Main Outcome Measure The expansion frequency. Results Based on a prior cutoff (>30 repeats), the expansion was detected in 9.3% of patients with ALS, 5.2% of patients with FTLD, and 0.7% of patients with PD but not in controls or patients with AD. It was significantly associated with family history of ALS or FTLD and age at onset of FTLD. Phenotype variation (ALS vs FTLD) was not associated with MAPT, APOE, or variability in the repeat flanking regions. Two patients with PD were carriers of 39 and 32 repeats with questionable pathological significance, since the 39-repeat allele does not segregate with PD. No expansion or intermediate alleles (20–29 repeats) were found among the G2019S carriers and AD cases with TAR DNA-binding protein 43–positive inclusions. Surprisingly, the frequency of the 10-repeat allele was marginally increased in all 4 neurodegenerative diseases compared with controls, indicating the presence of an unknown risk variation in the C9orf72 locus. Conclusions The C9orf72 expansion is a common cause of ALS and FTLD, but not of AD or PD. Our study raises concern about a reliable cutoff for the pathological repeat number, which is important in the utility of genetic screening. PMID:22964832

Peripheral retinopathy in offspring of carriers of Norrie disease gene mutations. Possible transplacental effect of abnormal Norrin.

PubMed

Mintz-Hittner, H A; Ferrell, R E; Sims, K B; Fernandez, K M; Gemmell, B S; Satriano, D R; Caster, J; Kretzer, F L

1996-12-01

The Norrie disease (ND) gene (Xp11.3) (McKusick 310600) consists of one untranslated exon and two exons partially translated as the Norrie disease protein (Norrin). Norrin has sequence homology and computer-predicted tertiary structure of a growth factor containing a cystine knot motif, which affects endothelial cell migration and proliferation. Norrie disease (congenital retinal detachment), X-linked primary retinal dysplasia (congenital retinal fold), and X-linked exudative vitreoretinopathy (congenital macular ectopia) are allelic disorders. Blood was drawn for genetic studies from members of two families to test for ND gene mutations. Sixteen unaffected family members were examined ophthalmologically. If any retinal abnormality were identified, fundus photography and fluorescein angiography was performed. Family A had ND (R109stp), and family B had X-linked exudative vitreoretinopathy (R121L). The retinas of 11 offspring of carrier females were examined: three of seven carrier females, three of three otherwise healthy females, and one of one otherwise healthy male had peripheral inner retinal vascular abnormalities. The retinas of five offspring of affected males were examined: none of three carrier females and none of two otherwise healthy males had this peripheral retinal finding. Peripheral inner retinal vascular abnormalities similar to regressed retinopathy of prematurity were identified in seven offspring of carriers of ND gene mutations in two families. These ophthalmologic findings, especially in four genetically healthy offspring, strongly support the hypothesis that abnormal Norrin may have an adverse transplacental (environmental) effect on normal inner retinal vasculogenesis.

Two Thai families with Norrie disease (ND): association of two novel missense mutations with severe ND phenotype, seizures, and a manifesting carrier.

PubMed

Yamada, K; Limprasert, P; Ratanasukon, M; Tengtrisorn, S; Yingchareonpukdee, J; Vasiknanonte, P; Kitaoka, T; Ghadami, M; Niikawa, N; Kishino, T

2001-04-15

We describe two Thai families with Norrie disease (ND) in three generations, including 10 affected males and one manifesting female. All affected males in each family had severely defective eye development with complete loss of vision. In addition, three male patients (one from family 1 and two from family 2) suffered from epilepsy, and one female carrier from one family manifested blindness with phthisis bulbi in her right eye. Mutation analysis of the ND gene (NDP) revealed two different novel missense mutations (L16P and S75P) that co-segregated with ND in each family, suggesting that the newly appearing proline at codon 16 or codon 75 alters the conformation of the ND protein and contributes to the severe phenotype of ND in each family. Other studies suggest that epileptic seizures or growth retardation that is associated with ND is the consequence of loss of contiguous genes, because most such patients had deletions extending beyond the Norrie locus. Our finding that the three affected males in the two families with the missense mutations had epilepsy does not support a contiguous gene effect, but favors the pleiotropism of NDP, at least as far as the epileptic manifestation is concerned. The unilateral blindness in the female carrier may have been due to non-random X-inactivation. Copyright 2001 Wiley-Liss, Inc.

Short stature in carriers of recessive mutation causing familial isolated growth hormone deficiency.

PubMed

Leiberman, E; Pesler, D; Parvari, R; Elbedour, K; Abdul-Latif, H; Brown, M R; Parks, J S; Carmi, R

2000-01-31

Isolated growth hormone deficiency (IGHD) IB is an autosomal recessive disorder characterized by a good response to exogenous growth hormone (GH) treatment without development of anti-GH antibodies. Patients with IGHD IB were found to be compound heterozygotes for deletion and frameshift mutations as well as homozygotes for splicing mutations in the GH-1 gene. Recently, a novel splicing mutation in the GH-1 gene was identified in an extended, consanguineous Arab-Bedouin family from Israel with IGHD IB. Prior to the identification of this mutation, a considerable number of children with short stature in this family were found normal on pharmacological stimulation for GH release. This observation prompted a genotype/phenotype correlation of potential heterozygotes in the family. Carriers of the mutant GH-1 allele were found as a group to have a significantly shorter stature than normal homozygote (mean standard deviation scores, 1.67 and -0.40, respectively, P<0.05). Moreover, 11 of 33 (33%) heterozygotes, but only 1 of 17 (5.9%) normal homozygotes, had their height at 2 or more SD below the mean. Overall, 48.5% of studied heterozygotes were found to be of appreciably short stature with height at or lower than the 5th centile (> or = -1.7 SD), whereas only 5.9% of the normal homozygotes did (P<0.004). This phenomenon of heterozygotes for a recessive mutation in the GH-1 gene manifesting short stature, might imply that some such mutations may account for non-GH deficiency reduced height in the general population.

Increased Pilus Production Conferred by a Naturally Occurring Mutation Alters Host-Pathogen Interaction in Favor of Carriage in Streptococcus pyogenes

PubMed Central

Olsen, Randall J.; Cantu, Concepcion; Pallister, Kyler B.; Guerra, Fermin E.; Voyich, Jovanka M.; Musser, James M.

2017-01-01

ABSTRACT Studies of the human pathogen group A Streptococcus (GAS) define the carrier phenotype to be an increased ability to adhere to and persist on epithelial surfaces and a decreased ability to cause disease. We tested the hypothesis that a single amino acid change (Arg135Gly) in a highly conserved sensor kinase (LiaS) of a poorly defined GAS regulatory system contributes to a carrier phenotype through increased pilus production. When introduced into an emm serotype-matched invasive strain, the carrier allele (the gene encoding the LiaS protein with an arginine-to-glycine change at position 135 [liaSR135G]) recapitulated a carrier phenotype defined by an increased ability to adhere to mucosal surfaces and a decreased ability to cause disease. Gene transcript analyses revealed that the liaS mutation significantly altered transcription of the genes encoding pilus in the presence of bacitracin. Elimination of pilus production in the isogenic carrier mutant decreased its ability to colonize the mouse nasopharynx and to adhere to and be internalized by cultured human epithelial cells and restored the virulence phenotype in a mouse model of necrotizing fasciitis. We also observed significantly reduced survival of the isogenic carrier mutant compared to that of the parental invasive strain after exposure to human neutrophils. Elimination of pilus in the isogenic carrier mutant increased the level of survival after exposure to human neutrophils to that for the parental invasive strain. Together, our data demonstrate that the carrier mutation (liaSR135G) affects pilus expression. Our data suggest new mechanisms of pilus gene regulation in GAS and that the invasiveness associated with pilus gene regulation in GAS differs from the enhanced invasiveness associated with increased pilus production in other bacterial pathogens. PMID:28264907

The RET p.G533C mutation confers predisposition to multiple endocrine neoplasia type 2A in a Brazilian kindred and is able to induce a malignant phenotype in vitro and in vivo.

PubMed

Oliveira, Mariana N L; Hemerly, Jefferson P; Bastos, André U; Tamanaha, Rosana; Latini, Flavia R M; Camacho, Cléber P; Impellizzeri, Anelise; Maciel, Rui M B; Cerutti, Janete M

2011-09-01

We have previously described a p.G533C substitution in the rearranged during transfection (RET) oncogene in a large family with medullary thyroid carcinoma. Here, we explore the functional transforming potential of RET p.G533C mutation. Plasmids expressing RET mutants (p.G533C and p.C634Y) and RET wild type were stable transfected into a rat thyroid cell line (PCCL3). Biological and biochemical effects of RET p.G533C were investigated both in vitro and in vivo. Moreover, we report the first case of pheochromocytoma among the RET p.G533C-carriers in this Brazilian family and explore the RET mutational status in DNA isolated from pheochromocytoma. Ectopic expression of RET p.G533C and p.C634Y activates RET/MAPK/ERK pathway at similar levels and significantly increased cell proliferation, compared with RET wild type. We additionally show that p.G533C increased cell viability, anchorage-independent growth, and micronuclei formation while reducing apoptosis, hallmarks of the malignant phenotype. RET p.G533C down-regulates the expression of thyroid specific genes in PCCL3. Moreover, RET p.G533C-expressing cells were able to induce liver metastasis in nude mice. Finally, we described two novel RET variants (G548V and S556T) in the DNA isolated from pheochromocytoma while they were absent in the DNA isolated from blood. Our in vitro and in vivo analysis indicates that this mutation confers a malignant phenotype to PCCL3 cells. These findings, in association with the report of first case of pheochromocytoma in the Brazilian kindred, suggest that this noncysteine mutation may be more aggressive than was initially considered.

Endometrial cancers in mutation carriers from hereditary breast ovarian cancer syndrome kindreds: report from the Creighton University Hereditary Cancer Registry with review of the implications.

PubMed

Casey, Murray Joseph; Bewtra, Chhanda; Lynch, Henry T; Snyder, Carrie L; Stacey, Mark

2015-05-01

The aim of this study was to categorize and report endometrial cancers in mutation carriers from hereditary breast ovarian cancer families. Our Hereditary Cancer Registry was searched for gynecologic and peritoneal cancers linked to mutations in BRCA1 or BRCA2. Invasive cancers were registered in 101 mutation carriers with complete pathology reports. Efforts were made to secure diagnostic surgical pathology tissues for review. All records and available diagnostic slides were meticulously studied, and primary cancers were classified. Eight malignancies were classified as primary endometrial cancers. Five of these were low- or intermediate-grade endometrioid carcinomas, and 3 were pure serous carcinomas or contained serous carcinoma elements mixed with high-grade endometrioid carcinoma. Breast cancers were diagnosed in 5 patients before and in 1 patient after endometrial carcinoma. Three endometrioid carcinomas were preceded by estrogen treatment, 2 for many years and the other for only 2 months, and 2 of the patients with serous carcinoma had been treated with tamoxifen. The finding that 8 of gynecologic and peritoneal cancers in 101 mutation carriers were endometrial cancers with a smaller proportion of endometrioid carcinomas than reported in general populations is added to the current controversial literature on endometrial cancer, particularly regarding serous carcinomas, in hereditary breast ovarian cancer syndrome. Well-designed prospective programs for standardized surgical and pathologic handling, processing, and reporting are essential for working out the pathogenesis, true risks, and best management of this disease in carriers of deleterious BRCA1 and BRCA2 germline mutations.

Spectrum of APC and MUTYH germ-line mutations in Russian patients with colorectal malignancies.

PubMed

Yanus, G A; Akhapkina, T A; Ivantsov, A O; Preobrazhenskaya, E V; Aleksakhina, S N; Bizin, I V; Sokolenko, A P; Mitiushkina, N V; Kuligina, E Sh; Suspitsin, E N; Venina, A R; Holmatov, M M; Zaitseva, O A; Yatsuk, O S; Pashkov, D V; Belyaev, A M; Togo, A V; Imyanitov, E N; Iyevleva, A G

2018-05-01

Distribution of cancer-predisposing mutations demonstrates significant interethnic variations. This study aimed to evaluate patterns of APC and MUTYH germ-line mutations in Russian patients with colorectal malignancies. APC gene defects were identified in 26/38 (68%) subjects with colon polyposis; 8/26 (31%) APC mutations were associated with 2 known mutational hotspots (p.E1309Dfs*4 [n = 5] and p.Q1062fs* [n = 3]), while 6/26 (23%) mutations were novel (p.K73Nfs*6, p.S254Hfs*12, p.S1072Kfs*9, p.E1547Kfs*11, p.L1564X and p.C1263Wfs*22). Biallelic mutations in MUTYH gene were detected in 3/12 (25%) remaining subjects with polyposis and in 6/90 (6.7%) patients with colorectal cancer (CRC) carrying KRAS p.G12C substitution, but not in 231 early-onset CRC cases negative for KRAS p.G12C allele. In addition to known European founder alleles p.Y179C and p.G396D, this study revealed a recurrent character of MUTYH p.R245H germ-line mutation. Besides that, 3 novel pathogenic MUTYH alleles (p.L111P, p.R245S and p.Q293X) were found. Targeted next-generation sequencing of 7 APC/MUTYH mutation-negative DNA samples identified novel potentially pathogenic POLD1 variant (p.L460R) in 1 patient and known low-penetrant cancer-associated allele CHEK2 p.I157T in 3 patients. The analysis of 1120 healthy subjects revealed 15 heterozygous carriers of recurrent MUTYH mutations, thus the expected incidence of MUTYH-associated polyposis in Russia is likely to be 1:23 000. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Effect of CHEK2 missense variant I157T on the risk of breast cancer in carriers of other CHEK2 or BRCA1 mutations.

PubMed

Cybulski, C; Górski, B; Huzarski, T; Byrski, T; Gronwald, J; Debniak, T; Wokolorczyk, D; Jakubowska, A; Serrano-Fernández, P; Dork, T; Narod, S A; Lubinski, J

2009-02-01

Carriers of heterozygous mutations in CHEK2 or BRCA1 are at increased risk of breast cancer. These mutations are rare and a very small number of women in a population will carry two mutations. However, it is of interest to estimate the breast cancer risks associated with carrying two mutations because this information may be informative for genetic counsellors and may provide clues to the carcinogenic process. We genotyped 7782 Polish breast cancer patients and 6233 controls for seven founder mutations in BRCA1 and CHEK2. Odds ratios (OR) and 95% confidence intervals (CI) were estimated for the mutations, singly and in combination. Of the 7782 women with breast cancer, 1091 had one mutation (14.0%) and 37 had two mutations (0.5%). Compared to controls, the odds ratio for a BRCA1 mutation in isolation was 13.1 (95% CI 8.2 to 21). The odds ratio was smaller for BRCA1 mutation carriers who also carried a CHEK2 mutation (OR 6.6, 95% CI 1.5 to 29), but the difference was not statistically significant. In contrast, the odds ratio for women who carried two CHEK2 mutations (OR 3.9, 95% CI 1.5 to 10) was greater than that for women who carried one CHEK2 mutation (OR 1.9, 95% CI 1.6 to 2.1). The odds ratio for women who carried both a truncating mutation and the missense mutation in CHEK2 was 7.0 (95% CI 0.9 to 56) and was greater than for women who carried the truncating mutation alone (OR 3.3, 95% CI 2.4 to 4.3) or the missense mutation alone (OR 1.6, 95% CI 1.4 to 1.9), but the difference was not statistically significant. Our study suggests that the risk of breast cancer in carriers of a deleterious CHEK2 mutation is increased if the second allele is the I157T missense variant. However, the presence of a CHEK2 mutation in women with a BRCA1 mutation may not increase their risk beyond that of the BRCA1 mutation alone. These suggestive findings need to be verified in other studies.

Variable haematological and clinical presentation of β-thalassaemia carriers and homozygotes with the Poly A (T→C) mutation in the Indian population.

PubMed

Italia, Khushnooma; Sawant, Pratibha; Surve, Reema; Wadia, Marukh; Nadkarni, Anita; Ghosh, Kanjaksha; Colah, Roshan

2012-08-01

To study the varied clinical and haematological profile of β-thalassaemia homozygotes, compound heterozygotes and heterozygotes with the Poly A (T→C) mutation and its implication in prenatal diagnosis. Forty individuals were included in the study. Peripheral smear examination, complete blood count and haemoglobin analysis were carried out. β-thalassaemia mutation analysis was carried out by reverse-dot-blot hybridization, amplification refractory mutation system and DNA sequencing of the β-globin gene. Five of the six β-thalassaemia homozygotes with the Poly A (T→C) mutation and five individuals who were compound heterozygous for the Poly A (T→C) mutation along with another common Indian β-thalassaemia mutation showed a severe β-thalassaemia major phenotype, while one individual presented as a thalassaemia intermedia. Majority of the 28 heterozygous individuals with this mutation showed borderline HbA₂ (mean HbA₂ = 3.7 ± 0.4%) levels as compared to individuals with common β-thalassaemia mutations (mean HbA₂ = 5.2 ± 1.4%). The Mean Corpuscular Volume (MCV) levels in individuals heterozygous for the Poly A (T→C) mutation (mean MCV 70.0 ± 5.2 fl) were significantly higher than in individuals with other common β-thalassaemia mutations (mean MCV 60.7 ± 7.7 fl) (P < 0.001). It is important to identify these often silent carriers of β-thalassaemia for prenatal diagnosis as homozygotes have a severe disease. © 2012 John Wiley & Sons A/S.

Haplotype structure in Ashkenazi Jewish BRCA1 and BRCA2 mutation carriers

PubMed Central

Im, Kate M.; Kirchhoff, Tomas; Wang, Xianshu; Green, Todd; Chow, Clement Y.; Vijai, Joseph; Korn, Joshua; Gaudet, Mia M.; Fredericksen, Zachary; Pankratz, V. Shane; Guiducci, Candace; Crenshaw, Andrew; McGuffog, Lesley; Kartsonaki, Christiana; Morrison, Jonathan; Healey, Sue; Sinilnikova, Olga M.; Mai, Phuong L.; Greene, Mark H.; Piedmonte, Marion; Rubinstein, Wendy S.; Hogervorst, Frans B.; Rookus, Matti A.; Collée, J. Margriet; Hoogerbrugge, Nicoline; van Asperen, Christi J.; Meijers-Heijboer, Hanne E. J.; Van Roozendaal, Cees E.; Caldes, Trinidad; Perez-Segura, Pedro; Jakubowska, Anna; Lubinski, Jan; Huzarski, Tomasz; Blecharz, Paweł; Nevanlinna, Heli; Aittomäki, Kristiina; Lazaro, Conxi; Blanco, Ignacio; Barkardottir, Rosa B.; Montagna, Marco; D'Andrea, Emma; Devilee, Peter; Olopade, Olufunmilayo I.; Neuhausen, Susan L.; Peissel, Bernard; Bonanni, Bernardo; Peterlongo, Paolo; Singer, Christian F.; Rennert, Gad; Lejbkowicz, Flavio; Andrulis, Irene L.; Glendon, Gord; Ozcelik, Hilmi; Toland, Amanda Ewart; Caligo, Maria Adelaide; Beattie, Mary S.; Chan, Salina; Domchek, Susan M.; Nathanson, Katherine L.; Rebbeck, Timothy R.; Phelan, Catherine; Narod, Steven; John, Esther M.; Hopper, John L.; Buys, Saundra S.; Daly, Mary B.; Southey, Melissa C.; Terry, Mary-Beth; Tung, Nadine; Hansen, Thomas v. O.; Osorio, Ana; Benitez, Javier; Durán, Mercedes; Weitzel, Jeffrey N.; Garber, Judy; Hamann, Ute; Peock, Susan; Cook, Margaret; Oliver, Clare T.; Frost, Debra; Platte, Radka; Evans, D. Gareth; Eeles, Ros; Izatt, Louise; Paterson, Joan; Brewer, Carole; Hodgson, Shirley; Morrison, Patrick J.; Porteous, Mary; Walker, Lisa; Rogers, Mark T.; Side, Lucy E.; Godwin, Andrew K.; Schmutzler, Rita K.; Wappenschmidt, Barbara; Laitman, Yael; Meindl, Alfons; Deissler, Helmut; Varon-Mateeva, Raymonda; Preisler-Adams, Sabine; Kast, Karin; Venat-Bouvet, Laurence; Stoppa-Lyonnet, Dominique; Chenevix-Trench, Georgia; Easton, Douglas F.; Klein, Robert J.; Daly, Mark J.; Friedman, Eitan; Dean, Michael; Clark, Andrew G.; Altshuler, David M.; Antoniou, Antonis C.; Couch, Fergus J.; Offit, Kenneth; Gold, Bert

2011-01-01

Abstract Three founder mutations in BRCA1 and BRCA2 contribute to the risk of hereditary breast and ovarian cancer in Ashkenazi Jews (AJ). They are observed at increased frequency in the AJ compared to other BRCA mutations in Caucasian non-Jews (CNJ). Several authors have proposed that elevated allele frequencies in the surrounding genomic regions reflect adaptive or balancing selection. Such proposals predict long-range linkage dis-equilibrium (LD) resulting from a selective sweep, although genetic drift in a founder population may also act to create long-distance LD. To date, few studies have used the tools of statistical genomics to examine the likelihood of long-range LD at a deleterious locus in a population that faced a genetic bottleneck. We studied the genotypes of hundreds of women from a large international consortium of BRCA1 and BRCA2 mutation carriers and found that AJ women exhibited long-range haplotypes compared to CNJ women. More than 50% of the AJ chromosomes with the BRCA1 185delAG mutation share an identical 2.1 Mb haplotype and nearly 16% of AJ chromosomes carrying the BRCA2 6174delT mutation share a 1.4 Mb haplotype. Simulations based on the best inference of Ashkenazi population demography indicate that long-range haplotypes are expected in the context of a genome-wide survey. Our results are consistent with the hypothesis that a local bottleneck effect from population size constriction events could by chance have resulted in the large haplotype blocks observed at high frequency in the BRCA1 and BRCA2 regions of Ashkenazi Jews. PMID:21597964

Dramatic effect of single-base mutation on the conformational dynamics of human telomeric G-quadruplex

PubMed Central

Lee, Ja Yil; Kim, D. S.

2009-01-01

Guanine-rich DNA sequences can form G-quadruplexes. These four-stranded structures are known to form in several genomic regions and to influence certain biological activities. Sometimes, the instability of G-quadruplexes causes the abnormal biological processes. Mutation is a culprit for the destabilization of G-quadruplexes, but the details of mutated G-quadruplexes are poorly understood. In this article, we investigated the conformational dynamics of single-base mutated human telomeric G-quadruplexes in the presence of K+ with single-molecule FRET spectroscopy. We observed that the replacement of single guanine by thymine in a G-track induces various folded structures, i.e. structural polymorphism. Moreover, direct observation of their dynamics revealed that a single-base mutation causes fast unfolding of folded states under physiological conditions. Furthermore, we found that the degree of destabilization varies according to mutation positions. When the central guanine of a G-track is replaced, the G-quadruplexes unfold quickly at any K+ concentrations and temperature. Meanwhile, outer-quartet mutated G-quadruplexes have heterogeneous dynamics at intermediate K+ concentrations and longstanding folded states at high K+ concentrations. Several factors such as base-stacking interaction and K+ coordination are responsible for the different dynamics according to the mutation position. PMID:19359361

Analysis of fluG mutations that affect light-dependent conidiation in Aspergillus nidulans.

PubMed Central

Yager, L N; Lee, H O; Nagle, D L; Zimmerman, J E

1998-01-01

Conidiation in Aspergillus nidulans is induced by exposure to red light but can also be induced by blue light in certain mutant strains. We have isolated a mutation in the fluG gene that abolishes responsiveness to red light but does not affect the response to blue light. It has been shown that the veA1 (velvet) mutation allows conidiation to occur in the absence of light. We have identified three other fluG mutations that suppress the veA1 phenotype; these double mutants do not conidiate in the dark. The mutations described here define two new phenotypic classes of fluG alleles that display abnormal responses to light. We have characterized these mutations with respect to their molecular identity and to their effect on fluG transcription. Although it has been shown that fluG is required for the synthesis of an extracellular factor that directs conidiation, we do not detect this factor under conditions that promote conidiation in the veA1 suppressors. Furthermore, extracellular rescue is not observed in fluG deletion strains containing the wild-type veA allele. We propose that a genetic interaction between fluG and veA influences the production of the extracellular signal and regulates the initiation of conidiation. PMID:9691036

Glycogen storage disease type 1a in Israel: biochemical, clinical, and mutational studies.

PubMed

Parvari, R; Lei, K J; Bashan, N; Hershkovitz, E; Korman, S H; Barash, V; Lerman-Sagie, T; Mandel, H; Chou, J Y; Moses, S W

1997-10-31

Glycogen storage disease type 1a (von Gierke disease, GSD 1a) is caused by the deficiency of microsomal glucose-6-phosphatase (G6Pase) activity which catalyzes the final common step of glycogenolysis and gluconeogenesis. The recent cloning of the G6Pase cDNA and characterization of the human G6Pase gene enabled the characterization of the mutations causing GSD 1a. This, in turn, allows the introduction of a noninvasive DNA-based diagnosis that provides reliable carrier testing and prenatal diagnosis. In this study, we report the biochemical and clinical characteristics as well as mutational analyses of 12 Israeli GSD 1a patients of different families, who represent most GSD 1a patients in Israel. The mutations, G6Pase activity, and glycogen content of 7 of these patients were reported previously. The biochemical data and clinical findings of all patients were similar and compatible with those described in other reports. All 9 Jewish patients, as well as one Muslim Arab patient, presented the R83C mutation. Two Muslim Arab patients had the V166G mutation which was not found in other patients' populations. The V166G mutation, which was introduced into the G6Pase cDNA by site-directed mutagenesis following transient expression in COS-1 cells, was shown to cause complete inactivation of the G6Pase. The characterization of all GSD 1a mutations in the Israeli population lends itself to carrier testing in these families as well as to prenatal diagnosis, which was carried out in 2 families. Since all Ashkenzai Jewish patients harbor the same mutation, our study suggests that DNA-based diagnosis may be used as an initial diagnostic step in Ashkenazi Jews suspected of having GSD 1a, thereby avoiding liver biopsy.

CHCHD10 mutations p.R15L and p.G66V cause motoneuron disease by haploinsufficiency.

PubMed

Brockmann, Sarah J; Freischmidt, Axel; Oeckl, Patrick; Müller, Kathrin; Ponna, Srinivas K; Helferich, Anika M; Paone, Christoph; Reinders, Jörg; Kojer, Kerstin; Orth, Michael; Jokela, Manu; Auranen, Mari; Udd, Bjarne; Hermann, Andreas; Danzer, Karin M; Lichtner, Peter; Walther, Paul; Ludolph, Albert C; Andersen, Peter M; Otto, Markus; Kursula, Petri; Just, Steffen; Weishaupt, Jochen H

2018-02-15

Mutations in the mitochondrially located protein CHCHD10 cause motoneuron disease by an unknown mechanism. In this study, we investigate the mutations p.R15L and p.G66V in comparison to wild-type CHCHD10 and the non-pathogenic variant p.P34S in vitro, in patient cells as well as in the vertebrate in vivo model zebrafish. We demonstrate a reduction of CHCHD10 protein levels in p.R15L and p.G66V mutant patient cells to approximately 50%. Quantitative real-time PCR revealed that expression of CHCHD10 p.R15L, but not of CHCHD10 p.G66V, is already abrogated at the mRNA level. Altered secondary structure and rapid protein degradation are observed with regard to the CHCHD10 p.G66V mutant. In contrast, no significant differences in expression, degradation rate or secondary structure of non-pathogenic CHCHD10 p.P34S are detected when compared with wild-type protein. Knockdown of CHCHD10 expression in zebrafish to about 50% causes motoneuron pathology, abnormal myofibrillar structure and motility deficits in vivo. Thus, our data show that the CHCHD10 mutations p.R15L and p.G66V cause motoneuron disease primarily based on haploinsufficiency of CHCHD10. © The Author(s) 2018. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

A G542X cystic fibrosis mouse model for examining nonsense mutation directed therapies.

PubMed

McHugh, Daniel R; Steele, Miarasa S; Valerio, Dana M; Miron, Alexander; Mann, Rachel J; LePage, David F; Conlon, Ronald A; Cotton, Calvin U; Drumm, Mitchell L; Hodges, Craig A

2018-01-01

Nonsense mutations are present in 10% of patients with CF, produce a premature termination codon in CFTR mRNA causing early termination of translation, and lead to lack of CFTR function. There are no currently available animal models which contain a nonsense mutation in the endogenous Cftr locus that can be utilized to test nonsense mutation therapies. In this study, we create a CF mouse model carrying the G542X nonsense mutation in Cftr using CRISPR/Cas9 gene editing. The G542X mouse model has reduced Cftr mRNA levels, demonstrates absence of CFTR function, and displays characteristic manifestations of CF mice such as reduced growth and intestinal obstruction. Importantly, CFTR restoration is observed in G542X intestinal organoids treated with G418, an aminoglycoside with translational readthrough capabilities. The G542X mouse model provides an invaluable resource for the identification of potential therapies of CF nonsense mutations as well as the assessment of in vivo effectiveness of these potential therapies targeting nonsense mutations.

Identification of amino acid residues of mammalian mitochondrial phosphate carrier important for its functional expression in yeast cells, as achieved by PCR-mediated random mutation and gap-repair cloning.

PubMed

Yamagoshi, Ryohei; Yamamoto, Takenori; Hashimoto, Mitsuru; Sugahara, Ryohei; Shiotsuki, Takahiro; Miyoshi, Hideto; Terada, Hiroshi; Shinohara, Yasuo

2017-01-01

The mitochondrial phosphate carrier (PiC) of mammals, but not the yeast one, is synthesized with a presequence. The deletion of this presequence of the mammalian PiC was reported to facilitate the import of the carrier into yeast mitochondria, but the question as to whether or not mammalian PiC could be functionally expressed in yeast mitochondria was not addressed. In the present study, we first examined whether the defective growth on a glycerol plate of yeast cells lacking the yeast PiC gene could be reversed by the introduction of expression vectors of rat PiCs. The introduction of expression vectors encoding full-length rat PiC (rPiC) or rPiC lacking the presequence (ΔNrPiC) was ineffective in restoring growth on the glycerol plates. When we examined the expression levels of individual rPiCs in yeast mitochondria, ΔNrPiC was expressed at a level similar to that of yeast PiC, but that of rPiC was very low. These results indicated that ΔNrPiC expressed in yeast mitochondria is inert. Next, we sought to isolate "revertants" viable on the glycerol plate by expressing randomly mutated ΔNrPiC, and obtained two clones. These clones carried either of two mutations, F267S or F282S; and these mutations restored the transport function of ΔNrPiC in yeast mitochondria. These two Phe residues were conserved in human carrier (hPiC), and the transport function of ΔNhPiC expressed in yeast mitochondria was also markedly improved by their substitutions. Thus, substitution of F267S or F282S was concluded to be important for functional expression of mammalian PiCs in yeast mitochondria. Copyright © 2016 Elsevier B.V. and Mitochondria Research Society. All rights reserved.

Comparison of age at natural menopause in BRCA1/2 mutation carriers with a non-clinic-based sample of women in northern California.

PubMed

Lin, Wayne T; Beattie, Mary; Chen, Lee-May; Oktay, Kutluk; Crawford, Sybil L; Gold, Ellen B; Cedars, Marcelle; Rosen, Mitchell

2013-05-01

Germline mutations in BRCA1 and BRCA2 (BRCA1/2) are related to an increased lifetime risk of developing breast and ovarian cancer. Although risk-reducing salpingo-oophorectomy reduces the risk of both cancers, loss of fertility is a major concern. A recent study suggested an association between BRCA1 mutation and occult primary ovarian insufficiency. The objective of the current study was to determine whether BRCA1/2 mutation carriers have an earlier onset of natural menopause compared with unaffected women. White carriers of the BRCA1/2 gene (n = 382) were identified within the Breast Cancer Risk Program Registry at the University of California at San Francisco and compared with non-clinic-based white women in northern California (n = 765). The 2 groups were compared with regard to median age at the time of natural menopause before and after adjustment for known risk factors, and the role of smoking within each group was examined using the Kaplan-Meier approach for unadjusted analyses and Cox proportional hazards regression analyses for adjusted analyses. The median age at the time of natural menopause in the BRCA1/2 carriers was significantly younger than among the unaffected sample (50 years vs 53 years; P < .001). The unadjusted hazard ratio for natural menopause when comparing BRCA1/2 carriers with unaffected women was 4.06 (95% confidence interval, 3.03-5.45) and was 3.98 (95% confidence interval, 2.87-5.53) after adjusting for smoking, parity, and oral contraceptive use. For BRCA1/2 carriers who were current heavy smokers (smoking ≥ 20 cigarettes/day), the median age at natural menopause was 46 years versus 49 years for nonsmokers (P = .027). The BRCA1/2 mutation was associated with a significantly earlier age at natural menopause, and heavy smoking compounded this risk. Because the relationship between menopause and the end of natural fertility is considered to be fixed, these findings suggest the risk of earlier infertility among BRCA1/2 carriers

A multiplex method for detection of glucose-6-phosphate dehydrogenase (G6PD) gene mutations.

PubMed

Zhang, L; Yang, Y; Liu, R; Li, Q; Yang, F; Ma, L; Liu, H; Chen, X; Yang, Z; Cui, L; He, Y

2015-12-01

Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common human enzyme defect caused by G6PD gene mutations. This study aimed to develop a cost-effective, multiplex, genotyping method for detecting common mutations in the G6PD gene. We used a SNaPshot approach to genotype multiple G6PD mutations that are common to human populations in South-East Asia. This assay is based on multiplex PCR coupled with primer extension reactions. Different G6PD gene mutations were determined by peak retention time and colors of the primer extension products. We designed PCR primers for multiplex amplification of the G6PD gene fragments and for primer extension reactions to genotype 11 G6PD mutations. DNA samples from a total of 120 unrelated G6PD-deficient individuals from the China-Myanmar border area were used to establish and validate this method. Direct sequencing of the PCR products demonstrated 100% concordance between the SNaPshot and the sequencing results. The SNaPshot method offers a specific and sensitive alternative for simultaneously interrogating multiple G6PD mutations. © 2015 John Wiley & Sons Ltd.

Mutation detection by mismatch binding protein, MutS, in amplified DNA: Application to the cystic fibrosis gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lishanski, A.; Ostrander, E.A.; Rine, J.

1994-03-29

An experimental strategy for detecting heterozygosity in genomic DNA has been developed based on preferential binding of Escherichia coli MutS protein to DNA molecules containing mismatched bases. The binding was detected by a gel mobility-shift assay. This approach was tested by using as a model the most commonly occurring mutations within the cystic fibrosis (CFTR) gene. Genomic DNA samples were amplified with 5{prime}-end-labeled primers that bracket the site of the {Delta}F508 3-bp deletion in exon 10 of the CFTR gene. The renatured PCR products from homozygotes produced homoduplexes; the PCR products from heterozygotes produced heteroduplexes and homoduplexes (1:1). MutS proteinmore » bound more strongly to heteroduplexes that correspond to heterozygous carriers of {Delta}F508 and contain a CTT or a GAA loop in one of the strands than to homoduplexes corresponding to homozygotes. The ability of MutS protein to detect heteroduplexes in PCR-amplified DNA extended to fragments {approximately} 500 bp long. The method was also able to detect carriers of the point mutations in exon 11 of the CFTR gene by a preferential binding of MutS to single-base mismatches in PCR-amplified DNA.« less

Exposure to diagnostic radiation and risk of breast cancer among carriers of BRCA1/2 mutations: retrospective cohort study (GENE-RAD-RISK).

PubMed

Pijpe, Anouk; Andrieu, Nadine; Easton, Douglas F; Kesminiene, Ausrele; Cardis, Elisabeth; Noguès, Catherine; Gauthier-Villars, Marion; Lasset, Christine; Fricker, Jean-Pierre; Peock, Susan; Frost, Debra; Evans, D Gareth; Eeles, Rosalind A; Paterson, Joan; Manders, Peggy; van Asperen, Christi J; Ausems, Margreet G E M; Meijers-Heijboer, Hanne; Thierry-Chef, Isabelle; Hauptmann, Michael; Goldgar, David; Rookus, Matti A; van Leeuwen, Flora E

2012-09-06

To estimate the risk of breast cancer associated with diagnostic radiation in carriers of BRCA1/2 mutations. Retrospective cohort study (GENE-RAD-RISK). Three nationwide studies (GENEPSO, EMBRACE, HEBON) in France, United Kingdom, and the Netherlands, 1993 female carriers of BRCA1/2 mutations recruited in 2006-09. Risk of breast cancer estimated with a weighted Cox proportional hazards model with a time dependent individually estimated cumulative breast dose, based on nominal estimates of organ dose and frequency of self reported diagnostic procedures. To correct for potential survival bias, the analysis excluded carriers who were diagnosed more than five years before completion of the study questionnaire. In carriers of BRCA1/2 mutations any exposure to diagnostic radiation before the age of 30 was associated with an increased risk of breast cancer (hazard ratio 1.90, 95% confidence interval 1.20 to 3.00), with a dose-response pattern. The risks by quarter of estimated cumulative dose <0.0020 Gy, ≥ 0.0020-0.0065 Gy, ≥ 0.0066-0.0173 Gy, and ≥ 0.0174 Gy were 1.63 (0.96 to 2.77), 1.78 (0.88 to 3.58), 1.75 (0.72 to 4.25), and 3.84 (1.67 to 8.79), respectively. Analyses on the different types of diagnostic procedures showed a pattern of increasing risk with increasing number of radiographs before age 20 and before age 30 compared with no exposure. A history of mammography before age 30 was also associated with an increased risk of breast cancer (hazard ratio 1.43, 0.85 to 2.40). Sensitivity analysis showed that this finding was not caused by confounding by indication of family history. In this large European study among carriers of BRCA1/2 mutations, exposure to diagnostic radiation before age 30 was associated with an increased risk of breast cancer at dose levels considerably lower than those at which increases have been found in other cohorts exposed to radiation. The results of this study support the use of non-ionising radiation imaging techniques (such as

The coexistence of mitochondrial ND6 T14484C and 12S rRNA A1555G mutations in a Chinese family with Leber's hereditary optic neuropathy and hearing loss

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wei Qiping; Zhou Xiangtian; Yang Li

2007-06-15

We report here the clinical, genetic and molecular characterization of one three-generation Han Chinese family with Leber's hereditary optic neuropathy (LHON) and hearing loss. Four of 14 matrilineal relatives exhibited the moderate central vision loss at the average age of 12.5 years. Of these, one subject exhibited both LHON and mild hearing impairment. Sequence analysis of the complete mitochondrial genomes in the pedigree showed the presence of homoplasmic LHON-associated ND6 T14484C mutation, deafness-associated 12S rRNA A1555 mutation and 47 other variants belonging to Eastern Asian haplogroup H2. None of other mitochondrial variants was evolutionarily conserved and functional significance. Therefore, themore » coexistence of the A1555G mutation and T14484C mutations in this Chinese family indicate that the A1555G mutation may play a synergistic role in the phenotypic manifestation of LHON associated ND6 T14484C mutation. However, the incomplete penetrance of vision and hearing loss suggests the involvement of nuclear modifier genes and environmental factors in the phenotypic expression of these mtDNA mutations.« less