Treacher Collins syndrome with craniosynostosis, choanal atresia, and esophageal regurgitation caused by a novel nonsense mutation in TCOF1.

PubMed

Horiuchi, Katsumi; Ariga, Tadashi; Fujioka, Hirotaka; Kawashima, Kunihiro; Yamamoto, Yuhei; Igawa, Hiroharu; Sakiyama, Yukio; Sugihara, Tsuneki

2004-07-15

Treacher Collins syndrome (TCS) is caused by mutations in TCOF1 of the nonsense, small deletion, and small insertion types, which most likely result in haploinsufficiency. We report a novel de novo nonsense mutation 2731C --> T, resulting in Arg911Stop, which truncates the protein. Our patient had the classic findings of TCS, but with documented craniosynostosis, choanal atresia, and esophageal regurgitation. Copyright 2004 Wiley-Liss, Inc.

Novel nonsense mutation in the katA gene of a catalase-negative Staphylococcus aureus strain.

PubMed

Lagos, Jaime; Alarcón, Pedro; Benadof, Dona; Ulloa, Soledad; Fasce, Rodrigo; Tognarelli, Javier; Aguayo, Carolina; Araya, Pamela; Parra, Bárbara; Olivares, Berta; Hormazábal, Juan Carlos; Fernández, Jorge

2016-01-01

We report the first description of a rare catalase-negative strain of Staphylococcus aureus in Chile. This new variant was isolated from blood and synovial tissue samples of a pediatric patient. Sequencing analysis revealed that this catalase-negative strain is related to ST10 strain, which has earlier been described in relation to S. aureus carriers. Interestingly, sequence analysis of the catalase gene katA revealed presence of a novel nonsense mutation that causes premature translational truncation of the C-terminus of the enzyme leading to a loss of 222 amino acids. Our study suggests that loss of catalase activity in this rare catalase-negative Chilean strain is due to this novel nonsense mutation in the katA gene, which truncates the enzyme to just 283 amino acids. Copyright © 2015 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

Readthrough of SCN5A Nonsense Mutations p.R1623X and p.S1812X Questions Gene-therapy in Brugada Syndrome.

PubMed

Teng, Siyong; Huang, Jian; Gao, Zhan; Hao, Jie; Yang, Yuejin; Zhang, Shu; Pu, Jielin; Hui, Rutai; Wu, Yongjian; Fan, Zheng

2017-01-01

Nonsense mutation readthrough is used as a gene-specific treatment in some genetic diseases. The response to readthrough treatment is determined by the readthrough efficiency of various nonsense mutations. In this manuscript, we aimed to explore the harmful effects of nonsense mutation suppression. HEK293 cells were transfected with two SCN5A (encode cardiac Na+ channel) nonsense mutations, p.R1623X and p.S1812X. We applied two readthrough-enhancing methods (either aminoglycosides or a siRNA-targeting eukaryotic release factor eRF3a (a GTPase that binds eRF1)) to suppress these SCN5A nonsense mutations. When either of readthrough methods was used, the sodium channel proteins were examined by western blot and immunoblotting and recorded by whole cell patch-clamp to observe the functional characterization of the restored channels. Upon readthrough treatment, the sodium currents were restored to the mutant cDNAs. These mutations reduced full-length sodium channel protein levels, and the sodium currents were reduced to 3% of wild-type. The mutant cDNA sodium currents were increased to 30% of wild-type, and the fulllength proteins also increased. However, the functional characterization of these channels from cDNAs carrying p.R1623X and p.S1812X exhibited abnormal biophysical properties, including a negative shift in steady-state sodium channel inactivation, a positive shift in sodium channel activation and robust late sodium currents. The ramp test showed prolonged QT intervals. These results demonstrated that readthrough-enhancing methods effectively suppressed nonsense mutations in SCN5A and restored the expression of full-length channels. However, the restored channels may increase the risk of arrhythmia. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Correction of nonsense BMPR2 and SMAD9 mutations by ataluren in pulmonary arterial hypertension.

PubMed

Drake, Kylie M; Dunmore, Benjamin J; McNelly, Lauren N; Morrell, Nicholas W; Aldred, Micheala A

2013-09-01

Heritable pulmonary arterial hypertension (HPAH) is a serious lung vascular disease caused by heterozygous mutations in the bone morphogenetic protein (BMP) pathway genes, BMPR2 and SMAD9. One noncanonical function of BMP signaling regulates biogenesis of a subset of microRNAs. We have previously shown that this function is abrogated in patients with HPAH, making it a highly sensitive readout of BMP pathway integrity. Ataluren (PTC124) is an investigational drug that permits ribosomal readthrough of premature stop codons, resulting in a full-length protein. It exhibits oral bioavailability and limited toxicity in human trials. Here, we tested ataluren in lung- or blood-derived cells from patients with HPAH with nonsense mutations in BMPR2 (n = 6) or SMAD9 (n = 1). Ataluren significantly increased BMP-mediated microRNA processing in six of the seven cases. Moreover, rescue was achieved even for mutations exhibiting significant nonsense-mediated mRNA decay. Response to ataluren was dose dependent, and complete correction was achieved at therapeutic doses currently used in clinical trials for cystic fibrosis. BMP receptor (BMPR)-II protein levels were normalized and ligand-dependent phosphorylation of downstream target Smads was increased. Furthermore, the usually hyperproliferative phenotype of pulmonary artery endothelial and smooth muscle cells was reversed by ataluren. These results indicate that ataluren can effectively suppress a high proportion of BMPR2 and SMAD9 nonsense mutations and correct BMP signaling in vitro. Approximately 29% of all HPAH mutations are nonsense point mutations. In light of this, we propose ataluren as a potential new personalized therapy for this significant subgroup of patients with PAH.

Novel CREB3L3 Nonsense Mutation in a Family With Dominant Hypertriglyceridemia.

PubMed

Cefalù, Angelo B; Spina, Rossella; Noto, Davide; Valenti, Vincenza; Ingrassia, Valeria; Giammanco, Antonina; Panno, Maria D; Ganci, Antonina; Barbagallo, Carlo M; Averna, Maurizio R

2015-12-01

Cyclic AMP responsive element-binding protein 3-like 3 (CREB3L3) is a novel candidate gene for dominant hypertriglyceridemia. To date, only 4 kindred with dominant hypertriglyceridemia have been found to be carriers of 2 nonsense mutations in CREB3L3 gene (245fs and W46X). We investigated a family in which hypertriglyceridemia displayed an autosomal dominant pattern of inheritance. The proband was a 49-year-old woman with high plasma triglycerides (≤1300 mg/dL; 14.68 mmol/L). Her father had a history of moderate hypertriglyceridemia, and her 51-year-old brother had triglycerides levels as high as 1600 mg/dL (18.06 mmol/L). To identify the causal mutation in this family, we analyzed the candidate genes of recessive and dominant forms of primary hypertriglyceridemia by direct sequencing. The sequencing of CREB3L3 gene led to the discovery of a novel minute frame shift mutation in exon 3 of CREB3L3 gene, predicted to result in the formation of a truncated protein devoid of function (c.359delG-p.K120fsX20). Heterozygosity for the c.359delG mutation resulted in a severe phenotype occurring later in life in the proband and her brother and a good response to diet and a hypotriglyceridemic treatment. The same mutation was detected in a 13-year-old daughter who to date is normotriglyceridemic. We have identified a novel pathogenic mutation in CREB3L3 gene in a family with dominant hypertriglyceridemia with a variable pattern of penetrance. © 2015 American Heart Association, Inc.

Identification of a novel nonsense mutation and a missense substitution in the AGPAT2 gene causing congenital generalized lipodystrophy type 1

PubMed Central

Haghighi, Amirreza; Razzaghy-Azar, Maryam; Talea, Ali; Sadeghian, Mahnaz; Ellard, Sian; Haghighi, Alireza

2012-01-01

Congenital generalized lipodystrophy (CGL) is an autosomal recessive disease characterized by the generalized scant of adipose tissue. CGL type 1 is caused by mutations in gene encoding 1-acylglycerol-3-phosphate O-acyltransferase-2 (AGPAT2). A clinical and molecular genetic investigation was performed in affected and unaffected members of two families with CGL type 1. The AGPAT2 coding region was sequenced in index cases of the two families. The presence of the identified mutations in relevant parents was tested. We identified a novel nonsense mutation (c.685G>T, p.Glu229*) and a missense substitution (c.514G>A, p.Glu172Lys). The unaffected parents in both families were heterozygous carrier of the relevant mutation. The results expand genotype–phenotype spectrum in CGL1 and will have applications in prenatal and early diagnosis of the disease. This is the first report of Persian families identified with AGPAT2 mutations. PMID:22902344

Waardenburg syndrome type II in a Chinese patient caused by a novel nonsense mutation in the SOX10 gene.

PubMed

Ma, Jing; Zhang, Tie-Song; Lin, Ken; Sun, Hao; Jiang, Hong-Chao; Yang, Yan-Li; Low, Fan; Gao, Ying-Qin; Ruan, Biao

2016-06-01

Waardenburg syndrome is a congenital genetic disorder. It is the most common type of syndromic hearing impairment with highly genetic heterogeneity and proved to be related by 6 genes as follows: PAX3, MITF, SNAI2, EDN3, EDNRB and SOX10. This article aims to identify the genetic causes of a Chinese WS child patient. A Chinese WS child was collected for clinical data collection by questionnaire survey. DNA samples of proband and his parents were extracted from peripheral blood samples. Six candidate genes were sequenced by the Trusight One sequencing panel on the illumina NextSeq 500 platform. A novel nonsense heterozygous mutation was found in the coding region of exon 2 in the SOX10 gene of proband. The novel nonsense heterozygous mutation could cause the replacement of the 55th lysine codon by stop codon (484T > C, C142R) and further more possibly cause terminating the protein translation in advance. However, both proband's parents had no mutation of genes above mentioned. The gene mutation of SOX10 [NM_006941.3 c.163A > T] is a novel nonsense mutation. No record of this mutation has been found in dbSNP, HGMD, 1000 Genomes Project, ClinVar and ESP6500 databases. It meets the condition of PS2 of strong evidence in 2015 ACMG Standards and Guidelines. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Novel PHEX nonsense mutation in a patient with X-linked hypophosphatemic rickets and review of current therapeutic regimens.

PubMed

Kienitz, T; Ventz, M; Kaminsky, E; Quinkler, M

2011-07-01

The most common form of familial hypophosphatemic rickets is X-linked. PHEX has been identified as the gene defective in this phosphate wasting disorder leading to decreased renal phosphate reabsorption, hypophosphatemia and inappropriate concentrations of 1,25-dihydroxyvitamin D in regard to hypophosphatemia. Clinical manifestation are skeletal deformities, short stature, osteomalacia, dental abscesses, bone pain, and loss of hearing. We report 3 cases of hypophosphatemic rickets with genetic mutational analysis of the PHEX gene. In 1 male patient an unknown nonsense mutation was found in exon 7, codon 245 (c.735T>G, Tyr245Term, Y245X). In both female patients known mutations were found: c.682delTC (exon 6, codon 228) and c.1952G>C (exon 19, codon 651, R651P). Age at diagnosis ranged from early childhood to the age of 35 years. Clinical complications were hip replacement in 1 patient, mild nephrocalcinosis in 2 patients and loss of hearing in 1 patient. All 3 patients have been treated with phosphate supplements and receive 1,25-dihydroxyvitamin D. Under this regimen all patients show stable biochemical markers with slight hyperparathyreoidism. In all patients at least one family member is affected by rickets, as well. We report a novel nonsense mutation of PHEX that has not been identified so far. The recent discovery of FGF23 and MEPE has changed our understanding of the kidney-bone metabolism, but also raises concerns about the efficacy of current therapeutic regimens that are reviewed in this context. © J. A. Barth Verlag in Georg Thieme Verlag KG Stuttgart · New York.

A novel nonsense mutation in CRYBB1 associated with autosomal dominant congenital cataract

PubMed Central

Yang, Juhua; Zhu, Yihua; Gu, Feng; He, Xiang; Cao, Zongfu; Li, Xuexi; Tong, Yi

2008-01-01

Purpose To identify the molecular defect underlying an autosomal dominant congenital nuclear cataract in a Chinese family. Methods Twenty-two members of a three-generation pedigree were recruited, clinical examinations were performed, and genomic DNA was extracted from peripheral blood leukocytes. All members were genotyped with polymorphic microsatellite markers adjacent to each of the known cataract-related genes. Linkage analysis was performed after genotyping. Candidate genes were screened for mutation using direct sequencing. Individuals were screened for presence of a mutation by restriction fragment length polymorphism (RFLP) analysis. Results Linkage analysis identified a maximum LOD score of 3.31 (recombination fraction [θ]=0.0) with marker D22S1167 on chromosome 22, which flanks the β-crystallin gene cluster (CRYBB3, CRYBB2, CRYBB1, and CRYBA4). Sequencing the coding regions and the flanking intronic sequences of these four candidate genes identified a novel, heterozygous C→T transition in exon 6 of CRYBB1 in the affected individuals of the family. This single nucleotide change introduced a novel BfaI site and was predicted to result in a nonsense mutation at codon 223 that changed a phylogenetically conserved amino acid to a stop codon (p.Q223X). RFLP analysis confirmed that this mutation co-segregated with the disease phenotype in all available family members and was not found in 100 normal unrelated individuals from the same ethnic background. Conclusions This study has identified a novel nonsense mutation in CRYBB1 (p.Q223X) associated with autosomal dominant congenital nuclear cataract. PMID:18432316

First de novo ANK3 nonsense mutation in a boy with intellectual disability, speech impairment and autistic features.

PubMed

Kloth, Katja; Denecke, Jonas; Hempel, Maja; Johannsen, Jessika; Strom, Tim M; Kubisch, Christian; Lessel, Davor

2017-09-01

Ankyrin-G, encoded by ANK3, plays an important role in neurodevelopment and neuronal function. There are multiple isoforms of Ankyrin-G resulting in differential tissue expression and function. Heterozygous missense mutations in ANK3 have been associated with autism spectrum disorder. Further, in three siblings a homozygous frameshift mutation affecting only the longest isoform and a patient with a balanced translocation disrupting all isoforms were documented. The latter four patients were affected by a variable degree of intellectual disability, attention deficit hyperactivity disorder and autism. Here, we report on a boy with speech impairment, intellectual disability, autistic features, macrocephaly, macrosomia, chronic hunger and an altered sleeping pattern. By trio-whole-exome sequencing, we identified the first de novo nonsense mutation affecting all ANK3 transcripts. Thus, our data expand the phenotype of ANK3-associated diseases and suggest an isoform-based, phenotypic continuum between dominant and recessive ANK3-associated pathologies. Copyright © 2017. Published by Elsevier Masson SAS.

Suppression of nonsense mutations as a therapeutic approach to treat genetic diseases.

PubMed

Keeling, Kim M; Bedwell, David M

2011-01-01

Suppression therapy is a treatment strategy for genetic diseases caused by nonsense mutations. This therapeutic approach utilizes pharmacological agents that suppress translation termination at in-frame premature termination codons (PTCs) to restore translation of a full-length, functional polypeptide. The efficiency of various classes of compounds to suppress PTCs in mammalian cells is discussed along with the current limitations of this therapy. We also elaborate on approaches to improve the efficiency of suppression that include methods to enhance the effectiveness of current suppression drugs and the design or discovery of new, more effective suppression agents. Finally, we discuss the role of nonsense-mediated mRNA decay (NMD) in limiting the effectiveness of suppression therapy, and describe tactics that may allow the efficiency of NMD to be modulated in order to enhance suppression therapy. Copyright © 2011 John Wiley & Sons, Ltd.

A case report of reversible generalized seizures in a patient with Waardenburg syndrome associated with a novel nonsense mutation in the penultimate exon of SOX10.

PubMed

Suzuki, Noriomi; Mutai, Hideki; Miya, Fuyuki; Tsunoda, Tatsuhiko; Terashima, Hiroshi; Morimoto, Noriko; Matsunaga, Tatsuo

2018-05-23

Waardenburg syndrome type 1 (WS1) can be distinguished from Waardenburg syndrome type 2 (WS2) by the presence of dystopia canthorum. About 96% of WS1 are due to PAX3 mutations, and SOX10 mutations have been reported in 15% of WS2. This report describes a patient with WS1 who harbored a novel SOX10 nonsense mutation (c.652G > T, p.G218*) in exon 3 which is the penultimate exon. The patient had mild prodromal neurological symptoms that were followed by severe attacks of generalized seizures associated with delayed myelination of the brain. The immature myelination recovered later and the neurological symptoms could be improved. This is the first truncating mutation in exon 3 of SOX10 that is associated with neurological symptoms in Waardenburg syndrome. Previous studies reported that the neurological symptoms that associate with WS are congenital and irreversible. These findings suggest that the reversible neurological phenotype may be associated with the nonsense mutation in exon 3 of SOX10. When patients of WS show mild prodromal neurological symptoms, the clinician should be aware of the possibility that severe attacks of generalized seizures may follow, which may be associated with the truncating mutation in exon 3 of SOX10.

Molecular diagnosis of analbuminemia: a new case caused by a nonsense mutation in the albumin gene.

PubMed

Dagnino, Monica; Caridi, Gianluca; Haenni, Ueli; Duss, Adrian; Aregger, Fabienne; Campagnoli, Monica; Galliano, Monica; Minchiotti, Lorenzo

2011-01-01

Analbuminemia is a rare autosomal recessive disorder manifested by the absence, or severe reduction, of circulating serum albumin (ALB). We report here a new case diagnosed in a 45 years old man of Southwestern Asian origin, living in Switzerland, on the basis of his low ALB concentration (0.9 g/L) in the absence of renal or gastrointestinal protein loss, or liver dysfunction. The clinical diagnosis was confirmed by a mutational analysis of the albumin (ALB) gene, carried out by single-strand conformational polymorphism (SSCP), heteroduplex analysis (HA), and DNA sequencing. This screening of the ALB gene revealed that the proband is homozygous for two mutations: the insertion of a T in a stretch of eight Ts spanning positions c.1289 + 23-c.1289 + 30 of intron 10 and a c.802 G > T transversion in exon 7. Whereas the presence of an additional T in the poly-T tract has no direct deleterious effect, the latter nonsense mutation changes the codon GAA for Glu244 to the stop codon TAA, resulting in a premature termination of the polypeptide chain. The putative protein product would have a length of only 243 amino acid residues instead of the normal 585 found in the mature serum albumin, but no evidence for the presence in serum of such a truncated polypeptide chain could be obtained by two dimensional electrophoresis and western blotting analysis.

Association of a homozygous nonsense mutation in the ABCA4 (ABCR) gene with cone-rod dystrophy phenotype in an Italian family.

PubMed

Simonelli, Francesca; Testa, Francesco; Zernant, Jana; Nesti, Anna; Rossi, Settimio; Rinaldi, Ernesto; Allikmets, Rando

2004-01-01

Genetic variation in the ABCA4 (ABCR) gene has been associated with several distinct retinal phenotypes, including Stargardt disease/fundus flavimaculatus (STGD/FFM), cone-rod dystrophy (CRD), retinitis pigmentosa (RP) and age-related macular degeneration. The current model of genotype/phenotype association suggests that patients harboring deleterious mutations in both ABCR alleles would develop RP-like retinal pathology. Here we describe ABCA4-associated phenotypes, including a proband with a homozygous nonsense mutation in a family from Southern Italy. The proband had been originally diagnosed with STGD. Ophthalmologic examination included kinetic perimetry, electrophysiological studies and fluorescein angiography. DNA of the affected individual and family members was analyzed for variants in all 50 exons of the ABCA4 gene by screening on the ABCR400 microarray. A homozygous nonsense mutation 2971G>T (G991X) was detected in a patient initially diagnosed with STGD based on funduscopic evidence, including bull's eye depigmentation of the fovea and flecks at the posterior pole extending to the mid-peripheral retina. Since this novel nucleotide substitution results in a truncated, nonfunctional, ABCA4 protein, the patient was examined in-depth for the severity of the disease phenotype. Indeed, subsequent electrophysiological studies determined severely reduced cone amplitude as compared to the rod amplitude, suggesting the diagnosis of CRD. ABCR400 microarray is an efficient tool for determining causal genetic variation, including new mutations. A homozygous protein-truncating mutation in ABCA4 can cause a phenotype ranging from STGD to CRD as diagnosed at an early stage of the disease. Only a combination of comprehensive genotype/phenotype correlation studies will determine the proper diagnosis and prognosis of ABCA4-associated pathology. Copyright 2004 S. Karger AG, Basel

A novel GATA3 nonsense mutation in a newly diagnosed adult patient of hypoparathyroidism, deafness, and renal dysplasia (HDR) syndrome.

PubMed

Nanba, Kazutaka; Usui, Takeshi; Nakamura, Michikazu; Toyota, Yuko; Hirota, Keisho; Tamanaha, Tamiko; Kawashima, Sachiko-Tsukamoto; Nakao, Kanako; Yuno, Akiko; Tagami, Tetsuya; Naruse, Mitsuhide; Shimatsu, Akira

2013-01-01

Hypoparathyroidism, deafness, and renal dysplasia (HDR) syndrome is an autosomal dominant disorder caused by a GATA3 gene mutation. Here we report a novel mutation of GATA3 in a patient diagnosed with HDR syndrome at the age of 58 with extensive intracranial calcification. A 58-year-old Japanese man showed severe hypocalcemia and marked calcification in the basal ganglia, cerebellum, deep white matter, and gray-white junction on computed tomography (CT). The serum intact parathyroid hormone level was relatively low against low serum calcium concentration. The patient had been diagnosed with bilateral sensorineural deafness in childhood and had a family history of hearing disorders. Imaging studies revealed no renal anomalies. The patient was diagnosed with HDR syndrome, and genetic testing was performed. Genetic analysis of GATA3 showed a novel nonsense mutation at codon 198 (S198X) in exon 3. The S198X mutation leads to a loss of two zinc finger deoxyribonucleic acid (DNA) binding domains and is considered to be responsible for HDR syndrome. We identified a novel nonsense mutation of GATA3 in an adult patient with HDR syndrome who showed extensive intracranial calcification.

Exome Sequencing Identifies a Novel Nonsense Mutation of MYO6 as the Cause of Deafness in a Brazilian Family.

PubMed

Sampaio-Silva, Juliana; Batissoco, Ana Carla; Jesus-Santos, Rafaela; Abath-Neto, Osório; Scarpelli, Luciano Cesar; Nishimura, Patricia Yoshie; Galindo, Layla Testa; Bento, Ricardo Ferreira; Oiticica, Jeanne; Lezirovitz, Karina

2018-01-01

We investigated 313 unrelated subjects who presented with hearing loss to identify the novel genetic causes of this condition in Brazil. Causative GJB2/GJB6 mutations were found in 12.7% of the patients. Among the familial cases (100/313), four were selected for exome sequencing. In one case, two novel heterozygous variants were found and were predicted to be pathogenic based on bioinformatics tools, that is, p.Ser906* (MYO6) and p.Arg42Cys (GJB3). We confirmed that this nonsense MYO6 mutation segregated with deafness in this family. Only the proband and her unaffected mother exhibited the GJB3 mutation, which is in the same amino acid of a known Erythrokeratodermia variabilis mutation. None of the patients exhibited this skin disease, but the proband exhibited a more severe hearing loss. Hence, the GJB3 mutation was considered to be a variant of uncertain significance. In conclusion, we described a novel nonsense MYO6 mutation that was responsible for the hearing loss in a Brazilian family. This mutation resides in the neck domain of myosin-VI after the motor domain. Thus, our data give further support for genotype-phenotype correlations, which state that when the motor domain of the protein is functioning, the hearing loss is milder and has a later onset. The three remaining families without mutations in the known genes suggest that there are still deafness genes to be revealed. © 2017 John Wiley & Sons Ltd/University College London.

A novel nonsense mutation in the DMP1 gene in a Japanese family with autosomal recessive hypophosphatemic rickets.

PubMed

Koshida, Ryusuke; Yamaguchi, Hideki; Yamasaki, Koji; Tsuchimochi, Wakaba; Yonekawa, Tadato; Nakazato, Masamitsu

2010-09-01

Autosomal recessive hypophosphatemic rickets (ARHR) is an extremely rare disorder of autosomal recessive inheritance, characterized by hypophosphatemia resulting from renal phosphate wasting. Dentin matrix protein 1 (DMP1), a noncollagenous extracellular protein, plays critical roles in bone mineralization and phosphate homeostasis. Recently, loss-of-function mutations in DMP1 gene have been identified as the molecular cause of ARHR. Here, we describe a Japanese family that includes two ARHR-affected siblings carrying a novel mutation of the DMP1 gene. The patients were a 53-year-old woman and a 50-year-old man with short stature and skeletal deformities who were the offspring of a first-cousin marriage. Biochemical examination revealed hypophosphatemia with renal phosphate excretion and low levels of 1,25(OH)(2)D. Serum calcium, parathyroid hormone, and urinary calcium excretion were within the normal range, leading to clinical diagnosis of ARHR. Sequence analysis of peripheral leukocytes from the patients revealed that they carried a novel homozygous nonsense mutation in the DMP1 gene (98G>A, W33X), which leads to a truncated DMP protein with no putative biological function. Unaffected family members were heterozygous for the mutation. This is the first report of a Japanese family with ARHR carrying a novel mutation of the DMP1 gene.

Molecular Diagnosis of Analbuminemia: A New Case Caused by a Nonsense Mutation in the Albumin Gene

PubMed Central

Dagnino, Monica; Caridi, Gianluca; Haenni, Ueli; Duss, Adrian; Aregger, Fabienne; Campagnoli, Monica; Galliano, Monica; Minchiotti, Lorenzo

2011-01-01

Analbuminemia is a rare autosomal recessive disorder manifested by the absence, or severe reduction, of circulating serum albumin (ALB). We report here a new case diagnosed in a 45 years old man of Southwestern Asian origin, living in Switzerland, on the basis of his low ALB concentration (0.9 g/L) in the absence of renal or gastrointestinal protein loss, or liver dysfunction. The clinical diagnosis was confirmed by a mutational analysis of the albumin (ALB) gene, carried out by single-strand conformational polymorphism (SSCP), heteroduplex analysis (HA), and DNA sequencing. This screening of the ALB gene revealed that the proband is homozygous for two mutations: the insertion of a T in a stretch of eight Ts spanning positions c.1289 + 23–c.1289 + 30 of intron 10 and a c.802 G > T transversion in exon 7. Whereas the presence of an additional T in the poly-T tract has no direct deleterious effect, the latter nonsense mutation changes the codon GAA for Glu244 to the stop codon TAA, resulting in a premature termination of the polypeptide chain. The putative protein product would have a length of only 243 amino acid residues instead of the normal 585 found in the mature serum albumin, but no evidence for the presence in serum of such a truncated polypeptide chain could be obtained by two dimensional electrophoresis and western blotting analysis. PMID:22174600

Becker muscular dystrophy with widespread muscle hypertrophy and a non-sense mutation of exon 2.

PubMed

Witting, N; Duno, M; Vissing, J

2013-01-01

Becker muscular dystrophy features progressive proximal weakness, wasting and often focal hypertrophy. We present a patient with pain and cramps from adolescence. Widespread muscle hypertrophy, preserved muscle strength and a 10-20-fold raised CPK were noted. Muscle biopsy was dystrophic, and Western blot showed a 95% reduction of dystrophin levels. Genetic analyses revealed a non-sense mutation in exon 2 of the dystrophin gene. This mutation is predicted to result in a Duchenne phenotype, but resulted in a mild Becker muscular dystrophy with widespread muscle hypertrophy. We suggest that this unusual phenotype is caused by translation re-initiation downstream from the mutation site. Copyright © 2012 Elsevier B.V. All rights reserved.

The mutY gene: a mutator locus in Escherichia coli that generates G.C----T.A transversions.

PubMed Central

Nghiem, Y; Cabrera, M; Cupples, C G; Miller, J H

1988-01-01

We have used a strain with an altered lacZ gene, which reverts to wild type via only certain transversions, to detect transversion-specific mutators in Escherichia coli. Detection relied on a papillation technique that uses a combination of beta-galactosides to reveal blue Lac+ papillae. One class of mutators is specific for the G.C----T.A transversion as determined by the reversion pattern of a set of lacZ mutations and by the distribution of forward nonsense mutations in the lacI gene. The locus responsible for the mutator phenotype is designated mutY and maps near 64 min on the genetic map of E. coli. The mutY locus may act in a similar but reciprocal fashion to the previously characterized mutT locus, which results in A.T----C.G transversions. Images PMID:3128795

A nonsense loss-of-function mutation in PCSK1 contributes to dominantly inherited human obesity.

PubMed

Philippe, J; Stijnen, P; Meyre, D; De Graeve, F; Thuillier, D; Delplanque, J; Gyapay, G; Sand, O; Creemers, J W; Froguel, P; Bonnefond, A

2015-02-01

A significant proportion of severe familial forms of obesity remain genetically elusive. Taking advantage of our unique cohort of multigenerational obese families, we aimed to assess the contribution of rare mutations in 29 common obesity-associated genes to familial obesity, and to evaluate in these families the putative presence of nine known monogenic forms of obesity. Through next-generation sequencing, we sequenced the coding regions of 34 genes involved in polygenic and/or monogenic forms of obesity in 201 participants (75 normal weight individuals, 54 overweight individuals and 72 individuals with obesity class I, II or III) from 13 French families. In vitro functional analyses were performed to investigate the mutation PCSK1-p.Arg80* which was identified in a family. A novel heterozygous nonsense variant in PCSK1 (p.Arg80*), encoding a propeptide truncated to less than two exons (out of 14), was found to co-segregate with obesity in a three-generation family. We demonstrated that this mutation inhibits PCSK1 enzyme activity and that this inhibition most likely does not involve a strong physical interaction. Furthermore, both mutations PCSK1-p.Asn180Ser and POMC-p.Phe144Leu, which had previously been reported to be associated with severe obesity, were also identified in this study, but did not co-segregate with obesity. Finally, we did not identify any rare mutations co-segregating with obesity in common obesity susceptibility genes, except for CADM2 and QPCTL, where we found two novel variants (p.Arg81His and p.Leu98Pro, respectively) in three obese individuals. We showed for the first time that a nonsense mutation in PCSK1 was likely to cause dominantly inherited human obesity, due to the inhibiting properties of the propeptide fragment encoded by the null allele. Furthermore, the present family sequencing design challenged the contribution of previously reported mutations to monogenic or at least severe obesity.

Acral peeling skin syndrome resulting from a homozygous nonsense mutation in the CSTA gene encoding cystatin A.

PubMed

Krunic, Aleksandar L; Stone, Kristina L; Simpson, Michael A; McGrath, John A

2013-01-01

Acral peeling skin syndrome (APSS) is a clinically and genetically heterogeneous disorder. We used whole-exome sequencing to identify the molecular basis of APSS in a consanguineous Jordanian-American pedigree. We identified a homozygous nonsense mutation (p.Lys22X) in the CSTA gene, encoding cystatin A, that was confirmed using Sanger sequencing. Cystatin A is a protease inhibitor found in the cornified cell envelope, and loss-of-function mutations have previously been reported in two cases of exfoliative ichthyosis. Our study expands the molecular pathology of APSS and demonstrates the value of next-generation sequencing in the genetic characterization of inherited skin diseases. © 2013 Wiley Periodicals, Inc.

Nonsense mutations in the PAX3 gene cause Waardenburg syndrome type I in two Chinese patients.

PubMed

Yang, Shu-Zhi; Cao, Ju-Yang; Zhang, Rui-Ning; Liu, Li-Xian; Liu, Xin; Zhang, Xin; Kang, Dong-Yang; Li, Mei; Han, Dong-Yi; Yuan, Hui-Jun; Yang, Wei-Yan

2007-01-05

Waardenburg syndrome type I (WS1) is an autosomal dominant disorder characterized by sensorineural hearing loss, pigmental abnormalities of the eye, hair and skin, and dystopia canthorum. The gene mainly responsible for WS1 is PAX3 which is involved in melanocytic development and survival. Mutations of PAX3 have been reported in familiar or sporadic patients with WS1 in several populations of the world except Chinese. In order to explore the genetic background of Chinese WS1 patients, a mutation screening of PAX3 gene was carried out in four WS1 pedigrees. A questionnaire survey and comprehensive clinical examination were conducted in four Chinese pedigrees of WS1. Genomic DNA from each patient and their family members was extracted and exons of PAX3 were amplified by PCR. PCR fragments were ethanol-purified and sequenced in both directions on an ABI_Prism 3100 DNA sequencer with the BigDye Terminator Cycle Sequencing Ready Reaction Kit. The sequences were obtained and aligned to the wild type sequence of PAX3 with the GeneTool program. Two nonsense PAX3 mutations have been found in the study population. One is heterozygous for a novel nonsense mutation S209X. The other is heterozygous for a previously reported mutation in European population R223X. Both mutations create stop codons leading to truncation of the PAX3 protein. This is the first demonstration of PAX3 mutations in Chinese WS1 patients and one of the few examples of an identical mutation of PAX3 occurred in different populations.

Beneficial read-through of a USH1C nonsense mutation by designed aminoglycoside NB30 in the retina.

PubMed

Goldmann, Tobias; Rebibo-Sabbah, Annie; Overlack, Nora; Nudelman, Igor; Belakhov, Valery; Baasov, Timor; Ben-Yosef, Tamar; Wolfrum, Uwe; Nagel-Wolfrum, Kerstin

2010-12-01

The human Usher syndrome (USH) is the most frequent cause of inherited combined deaf-blindness. USH is clinically and genetically heterogeneous, assigned to three clinical types. The most severe type is USH1, characterized by profound inner ear defects and retinitis pigmentosa. Thus far, no effective treatment for the ophthalmic component of USH exists. The p.R31X nonsense mutation in USH1C leads to a disease causing premature termination of gene translation. Here, we investigated the capability of the novel synthetic aminoglycoside NB30 for the translational read-through of the USH1C-p.R31X nonsense mutation as a retinal therapy option. Read-through of p.R31X by three commercial, clinically applied aminoglycosides and the synthetic derivative NB30 was validated in vitro, in cell culture, and in retinal explants. Restoration of harmonin functions was monitored in GST pull-downs (scaffold function) and by F-actin bundling analysis in HEK293T cells. Biocompatibility of aminoglycosides was determined in retinal explants by TUNEL assays. In vitro translation and analyses of transfected HEK293T cells revealed a dose-dependent read-through by all aminoglycosides. In addition, gentamicin, paromomycin, and NB30 induced read-through of p.R31X in mouse retinal explants. The read-through of p.R31X restored harmonin protein function. In contrast to all commercial aminoglycosides NB30 showed good biocompatibility. Commercial aminoglycosides and NB30 induced significant read-through of the USH1C-p.R31X nonsense mutation. However, the observed read-through efficiency, along with its significantly reduced toxicity and good biocompatibility, indicate that the novel derivate NB30 represents a better choice than commercial aminoglycosides in a read-through therapy of USH1C and other ocular diseases.

Association of a Novel Nonsense Mutation in KIAA1279 with Goldberg-Shprintzen Syndrome.

PubMed

Salehpour, Shadab; Hashemi-Gorji, Feyzollah; Soltani, Ziba; Ghafouri-Fard, Soudeh; Miryounesi, Mohammad

2017-01-01

Goldberg-Shprintzen syndrome (OMIM 609460) (GOSHS) is an autosomal recessive multiple congenital anomaly syndrome distinguished by intellectual disability, microcephaly, and dysmorphic facial characteristics. Most affected individuals also have Hirschsprung disease and/or gyral abnormalities of the brain. This syndrome has been associated with KIAA1279 gene mutations at 10q22.1. Here we report a 16 yr old male patient referred to Center for Comprehensive Genetic Services, Tehran, Iran in 2015 with cardinal features of GOSHS in addition to refractory seizures. Whole exome sequencing in the patient revealed a novel nonsense (stop gain) homozygous mutation in KIAA1279 gene (KIAA1279: NM_015634:exon6:c.C976T:p.Q326X). Considering the wide range of phenotypic variations in GOSHS, relying on phenotypic characteristics for discrimination of GOSH from similar syndromes may lead to misdiagnosis. Consequently, molecular diagnostic tools would help in accurate diagnosis of such overlapping phenotypes.

Molecular analysis of congenital goitres with hypothyroidism caused by defective thyroglobulin synthesis. Identification of a novel c.7006C>T [p.R2317X] mutation and expression of minigenes containing nonsense mutations in exon 7.

PubMed

Machiavelli, Gloria A; Caputo, Mariela; Rivolta, Carina M; Olcese, María C; Gruñeiro-Papendieck, Laura; Chiesa, Ana; González-Sarmiento, Rogelio; Targovnik, Héctor M

2010-01-01

Thyroglobulin (TG) deficiency is an autosomal-recessive disorder that results in thyroid dyshormonogenesis. A number of distinct mutations have been identified as causing human hypothyroid goitre. The purpose of this study was to identify and characterize new mutations in the TG gene in an attempt to increase the understanding of the genetic mechanism responsible for this disorder. A total of six patients from four nonconsanguineous families with marked impairment of TG synthesis were studied. Single-strand conformation polymorphism (SSCP) analysis, sequencing of DNA, genotyping, expression of chimeric minigenes and bioinformatic analysis were performed. Four different inactivating TG mutations were identified: one novel mutation (c.7006C>T [p.R2317X]) and three previously reported (c.886C>T [p.R277X], c.6701C>A [p.A2215D] and c.6725G>A [p.R2223H]). Consequently, one patient carried a compound heterozygous for p.R2223H/p.R2317X mutations; two brothers showed a homozygous p.A2215D substitution and the remaining three patients, from two families with typical phenotype, had a single p.R277X mutated allele. We also showed functional evidences that premature stop codons inserted at different positions in exon 7, which disrupt exonic splicing enhancer (ESE) sequences, do not interfere with exon definition and processing. In this study, we have identified a novel nonsense mutation p.R2317X in the acetylcholinesterase homology domain of TG. We have also observed that nonsense mutations do not interfere with the pre-mRNA splicing of exon 7. The results are in accordance with previous observations confirming the genetic heterogeneity of TG defects.

Thomsen or Becker myotonia? A novel autosomal recessive nonsense mutation in the CLCN1 gene associated with a mild phenotype.

PubMed

Gurgel-Giannetti, Juliana; Senkevics, Adriano S; Zilbersztajn-Gotlieb, Dinorah; Yamamoto, Lydia U; Muniz, Viviane P; Pavanello, Rita C M; Oliveira, Acary B; Zatz, Mayana; Vainzof, Mariz

2012-02-01

We describe a large Brazilian consanguineous kindred with 3 clinically affected patients with a Thomsen myotonia phenotype. They carry a novel homozygous nonsense mutation in the CLCN1 gene (K248X). None of the 6 heterozygote carriers show any sign of myotonia on clinical evaluation or electromyography. These findings confirm the autosomal recessive inheritance of the novel mutation in this family, as well as the occurrence of phenotypic variability in the autosomal recessive forms of myotonia. Copyright © 2011 Wiley Periodicals, Inc.

A novel nonsense mutation in the NDP gene in a Chinese family with Norrie disease.

PubMed

Liu, Deyuan; Hu, Zhengmao; Peng, Yu; Yu, Changhong; Liu, Yalan; Mo, Xiaoyun; Li, Xiaoping; Lu, Lina; Xu, Xiaojuan; Su, Wei; Pan, Qian; Xia, Kun

2010-12-08

Norrie disease (ND), a rare X-linked recessive disorder, is characterized by congenital blindness and, occasionally, mental retardation and hearing loss. ND is caused by the Norrie Disease Protein gene (NDP), which codes for norrin, a cysteine-rich protein involved in ocular vascular development. Here, we report a novel mutation of NDP that was identified in a Chinese family in which three members displayed typical ND symptoms and other complex phenotypes, such as cerebellar atrophy, motor disorders, and mental disorders. We conducted an extensive clinical examination of the proband and performed a computed tomography (CT) scan of his brain. Additionally, we performed ophthalmic examinations, haplotype analyses, and NDP DNA sequencing for 26 individuals from the proband's extended family. The proband's computed tomography scan, in which the fifth ventricle could be observed, indicated cerebellar atrophy. Genome scans and haplotype analyses traced the disease to chromosome Xp21.1-p11.22. Mutation screening of the NDP gene identified a novel nonsense mutation, c.343C>T, in this region. Although recent research has shown that multiple different mutations can be responsible for the ND phenotype, additional research is needed to understand the mechanism responsible for the diverse phenotypes caused by mutations in the NDP gene.

A novel nonsense mutation in the NDP gene in a Chinese family with Norrie disease

PubMed Central

Liu, Deyuan; Hu, Zhengmao; Peng, Yu; Yu, Changhong; Liu, Yalan; Mo, Xiaoyun; Li, Xiaoping; Lu, Lina; Xu, Xiaojuan; Su, Wei; Pan, Qian

2010-01-01

Purpose Norrie disease (ND), a rare X-linked recessive disorder, is characterized by congenital blindness and, occasionally, mental retardation and hearing loss. ND is caused by the Norrie Disease Protein gene (NDP), which codes for norrin, a cysteine-rich protein involved in ocular vascular development. Here, we report a novel mutation of NDP that was identified in a Chinese family in which three members displayed typical ND symptoms and other complex phenotypes, such as cerebellar atrophy, motor disorders, and mental disorders. Methods We conducted an extensive clinical examination of the proband and performed a computed tomography (CT) scan of his brain. Additionally, we performed ophthalmic examinations, haplotype analyses, and NDP DNA sequencing for 26 individuals from the proband’s extended family. Results The proband’s computed tomography scan, in which the fifth ventricle could be observed, indicated cerebellar atrophy. Genome scans and haplotype analyses traced the disease to chromosome Xp21.1-p11.22. Mutation screening of the NDP gene identified a novel nonsense mutation, c.343C>T, in this region. Conclusions Although recent research has shown that multiple different mutations can be responsible for the ND phenotype, additional research is needed to understand the mechanism responsible for the diverse phenotypes caused by mutations in the NDP gene. PMID:21179243

Variants of the D{sub 5} dopamine receptor gene found in patients with schizophrenia: Identification of a nonsense mutation and multiple missense changes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sobell, J.L.; Lind, T.J.; Sommer, S.S.

To determine whether mutations in the D{sub 5} dopamine receptor (D{sub 5}DR) gene are associated with schizophrenia, the gene was examined in 78 unrelated schizophrenic individuals. After amplification by the polymerase chain reaction, products were examined by dideoxy fingerprinting (ddF), a highly sensitive screening method related to single strand conformational polymorphism analysis. All samples with unusual ddF patterns were sequenced to precisely identify the sequence change. In the 156 D{sub 5}DR alleles examined, nine sequence changes were identified. Four of the nine did not affect protein structure; of these, three were silent changes and one was a transition in themore » 3{prime} untranslated region. The remaining five sequence changes result in protein alterations: of these, one is a missense change in a non-conserved amino acid, 3 are missense changes in amino acids that are conserved in some dopamine D{sub 5} receptors and the last is a nonsense mutation. To investigate whether the nonsense mutation was associated with schizophrenia, 400 additional schizophrenic cases of western European descent and 1914 ethnically-similar controls were screened for the change. One additional schizophrenic carrier was identified and verified by direct genomic sequencing (allele frequency: .0013), but eight carriers also were found and confirmed among the non-schizophrenics (allele frequency: .0021)(p>.25). The gene was re-examined in all newly identified carriers of the nonsense mutation by direct sequencing and/or ddF in search of additional mutations. None were identified. Family studies also were conducted to investigate possible cosegregation of the mutation with other neuropsychiatric diseases, but this was not demonstrated. Thus, the mutation does not appear to be associated with an increased risk of schizophrenia nor does an initial analysis suggest cosegregation with other neuropsychiatric disorders or symptom complexes.« less

Neonatal-Onset Chronic Diarrhea Caused by Homozygous Nonsense WNT2B Mutations.

PubMed

O'Connell, Amy E; Zhou, Fanny; Shah, Manasvi S; Murphy, Quinn; Rickner, Hannah; Kelsen, Judith; Boyle, John; Doyle, Jefferson J; Gangwani, Bharti; Thiagarajah, Jay R; Kamin, Daniel S; Goldsmith, Jeffrey D; Richmond, Camilla; Breault, David T; Agrawal, Pankaj B

2018-06-04

Homozygous nonsense mutations in WNT2B were identified in three individuals from two unrelated families with severe, neonatal-onset osmotic diarrhea after whole-exome sequencing was performed on trios from the two families. Intestinal biopsy samples from affected individuals were used for histology and immunofluorescence and to generate enteroids ex vivo. Histopathologic evaluation demonstrated chronic inflammatory changes in the stomach, duodenum, and colon. Immunofluorescence demonstrated diminished staining for OLFM4, a marker for intestinal stem cells (ISCs). The enteroids generated from WNT2B-deficient intestinal epithelium could not be expanded and did not survive passage. Addition of CHIR-99021 (a GSK3A and GSK3B inhibitor and activator of canonical WNT/β-CATENIN signaling) could not rescue WNT2B-deficient enteroids. Addition of supplemental recombinant murine WNT2B was able to perpetuate small enteroids for multiple passages but failed to expand their number. Enteroids showed a 10-fold increase in the expression of LEF1 mRNA and a 100-fold reduction in TLR4 expression, compared with controls by quantitative RT-PCR, indicating alterations in canonical WNT and microbial pattern-recognition signaling. In summary, individuals with homozygous nonsense mutations in WNT2B demonstrate severe intestinal dysregulation associated with decreased ISC number and function, likely explaining their diarrheal phenotype. WNT2B deficiency should be considered for individuals with neonatal-onset diarrhea. Copyright © 2018 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Homozygous nonsense mutation in SGCA is a common cause of limb-girdle muscular dystrophy in Assiut, Egypt.

PubMed

Reddy, Hemakumar M; Hamed, Sherifa A; Lek, Monkol; Mitsuhashi, Satomi; Estrella, Elicia; Jones, Michael D; Mahoney, Lane J; Duncan, Anna R; Cho, Kyung-Ah; Macarthur, Daniel G; Kunkel, Louis M; Kang, Peter B

2016-10-01

The genetic causes of limb-girdle muscular dystrophy (LGMD) have been studied in numerous countries, but such investigations have been limited in Egypt. A cohort of 30 families with suspected LGMD from Assiut, Egypt, was studied using immunohistochemistry, homozygosity mapping, Sanger sequencing, and whole exome sequencing. Six families were confirmed to have pathogenic mutations, 4 in SGCA and 2 in DMD. Of these, 3 families harbored a single nonsense mutation in SGCA, suggesting that this may be a common mutation in Assiut, Egypt, originating from a founder effect. The Assiut region in Egypt appears to share at least several of the common LGMD genes found in other parts of the world. It is notable that 4 of the 6 mutations were ascertained by means of whole exome sequencing, even though it was the last approach adopted. This illustrates the power of this technique for identifying causative mutations for muscular dystrophies. Muscle Nerve 54: 690-695, 2016. © 2016 Wiley Periodicals, Inc.

A tailored mouse model of CLN2 disease: A nonsense mutant for testing personalized therapies

PubMed Central

Geraets, Ryan D.; Beraldi, Rosanna; Weimer, Jill M.; Pearce, David A.

2017-01-01

The Neuronal Ceroid Lipofuscinoses (NCLs), also known as Batten disease, result from mutations in over a dozen genes. Although, adults are susceptible, the NCLs are frequently classified as pediatric neurodegenerative diseases due to their greater pediatric prevalence. Initial clinical presentation usually consists of either seizures or retinopathy but develops to encompass both in conjunction with declining motor and cognitive function. The NCLs result in premature death due to the absence of curative therapies. Nevertheless, preclinical and clinical trials exist for various therapies. However, the genotypes of NCL animal models determine which therapeutic approaches can be assessed. Mutations of the CLN2 gene encoding a soluble lysosomal enzyme, tripeptidyl peptidase 1 (TPP1), cause late infantile NCL/CLN2 disease. The genotype of the original mouse model of CLN2 disease, Cln2-/-, excludes mutation guided therapies like antisense oligonucleotides and nonsense suppression. Therefore, the purpose of this study was to develop a model of CLN2 disease that allows for the assessment of all therapeutic approaches. Nonsense mutations in CLN2 disease are frequent, the most common being CLN2R208X. Thus, we created a mouse model that carries a mutation equivalent to the human p.R208X mutation. Molecular assessment of Cln2R207X/R207X tissues determined significant reduction in Cln2 transcript abundance and TPP1 enzyme activity. This reduction leads to the development of neurological impairment (e.g. tremors) and neuropathology (e.g. astrocytosis). Collectively, these assessments indicate that the Cln2R207X/R207X mouse is a valid CLN2 disease model which can be used for the preclinical evaluation of all therapeutic approaches including mutation guided therapies. PMID:28464005

Novel nonsense mutation of the endothelin-B receptor gene in a family with Waardenburg-Hirschsprung disease.

PubMed

Syrris, P; Carter, N D; Patton, M A

1999-11-05

Waardenburg syndrome (WS) comprises sensorineural hearing loss, hypopigmentation of skin and hair, and pigmentary disturbances of the irides. Four types of WS have been classified to date; in WS type IV (WS4), patients additionally have colonic aganglionosis (Hirschsprung disease, HSCR). Mutations in the endothelin-3 (EDN3), endothelin-B receptor (EDNRB), and Sox10 genes have been identified as causative for WS type IV. We screened a family with a combined WS-HSCR phenotype for mutations in the EDNRB locus using standard DNA mutation analysis and sequencing techniques. We have identified a novel nonsense mutation at codon 253 (CGA-->TGA, Arg-->STOP). This mutation leads to a premature end of the translation of EDNRB at exon 3, and it is predicted to produce a truncated and nonfunctional endothelin-B receptor. All affected relatives were heterozygous for the Arg(253)-->STOP mutation, whereas it was not observed in over 50 unrelated individuals used as controls. These data confirm the role of EDNRB in the cause of the Waardenburg-Hirschsprung syndrome and demonstrate that in WS-HSCR there is a lack of correlation between phenotype and genotype and a variable expression of disease even within the same family. Copyright 1999 Wiley-Liss, Inc.

Clinical Variability in a Family with an Ectodermal Dysplasia Syndrome and a Nonsense Mutation in the TP63 Gene.

PubMed

Eisenkraft, Arik; Pode-Shakked, Ben; Goldstein, Nurit; Shpirer, Zvi; van Bokhoven, Hans; Anikster, Yair

2015-01-01

Mutations in the TP63 gene have been associated with a variety of ectodermal dysplasia syndromes, among which the clinically overlapping Ankyloblepharon-Ectodermal defects-Cleft lip/palate (AEC) and the Rapp-Hodgkin syndromes. We report a multiplex nonconsanguineous family of Ashkenazi-Jewish descent, in which the index patient presented with a persistent scalp skin lesion, dystrophic nails and light thin hair. Further evaluation revealed over 10 affected individuals in the kindred, over four generations, exhibiting varying degrees of ectodermal involvement. Analysis of the TP63 gene from four of the patients and from two healthy individuals of the same family was performed. Gene sequencing of the patients revealed a nonsense mutation leading to a premature termination codon (PTC) (p.Gln16X). The same mutation was found in all tested affected individuals in the family, but gave rise to marked phenotypic variability with minor clinical manifestations in some individuals, underscoring the clinical heterogeneity associated with the recently described PTC-causing mutations.

Common pathological mutations in PQBP1 induce nonsense-mediated mRNA decay and enhance exclusion of the mutant exon.

PubMed

Musante, Luciana; Kunde, Stella-Amrei; Sulistio, Tina O; Fischer, Ute; Grimme, Astrid; Frints, Suzanna G M; Schwartz, Charles E; Martínez, Francisco; Romano, Corrado; Ropers, Hans-Hilger; Kalscheuer, Vera M

2010-01-01

The polyglutamine binding protein 1 (PQBP1) gene plays an important role in X-linked mental retardation (XLMR). Nine of the thirteen PQBP1 mutations known to date affect the AG hexamer in exon 4 and cause frameshifts introducing premature termination codons (PTCs). However, the phenotype in this group of patients is variable. To investigate the pathology of these PQBP1 mutations, we evaluated their consequences on mRNA and protein expression. RT-PCRs revealed mutation-specific reduction of PQBP1 mRNAs carrying the PTCs that can be partially restored by blocking translation, thus indicating a role for the nonsense-mediated mRNA decay pathway. In addition, these mutations resulted in altered levels of PQBP1 transcripts that skipped exon 4, probably as a result of altering important splicing motifs via nonsense-associated altered splicing (NAS). This hypothesis is supported by transfection experiments using wild-type and mutant PQBP1 minigenes. Moreover, we show that a truncated PQBP1 protein is indeed present in the patients. Remarkably, patients with insertion/deletion mutations in the AG hexamer express significantly increased levels of a PQBP1 isoform, which is very likely encoded by the transcripts without exon 4, confirming the findings at the mRNA level. Our study provides significant insight into the early events contributing to the pathogenesis of the PQBP1 related XLMR disease.

Normosmic idiopathic hypogonadotropic hypogonadism due to a novel homozygous nonsense c.C969A (p.Y323X) mutation in the KISS1R gene in three unrelated families.

PubMed

Demirbilek, Huseyin; Ozbek, M Nuri; Demir, Korcan; Kotan, L Damla; Cesur, Yasar; Dogan, Murat; Temiz, Fatih; Mengen, Eda; Gurbuz, Fatih; Yuksel, Bilgin; Topaloglu, A Kemal

2015-03-01

The spectrum of genetic alterations in cases of hypogonadotropic hypogonadism continue to expand. However, KISS1R mutations remain rare. The aim of this study was to understand the molecular basis of normosmic idiopathic hypogonadotropic hypogonadism. Clinical characteristics, hormonal studies and genetic analyses of seven cases with idiopathic normosmic hypogonadotropic hypogonadism (nIHH) from three unrelated consanguineous families are presented. One male presented with absence of pubertal onset and required surgery for severe penoscrotal hypospadias and cryptorchidism, while other two males had absence of pubertal onset. Two of four female cases required replacement therapy for pubertal onset and maintenance, whereas the other two had spontaneous pubertal onset but incomplete maturation. In sequence analysis, we identified a novel homozygous nonsense (p.Y323X) mutation (c.C969A) in the last exon of the KISS1R gene in all clinically affected cases. We identified a homozygous nonsense mutation in the KISS1R gene in three unrelated families with nIHH, which enabled us to observe the phenotypic consequences of this rare condition. Escape from nonsense-mediated decay, and thus production of abnormal proteins, may account for the variable severity of the phenotype. Although KISS1R mutations are extremely rare and can cause a heterogeneous phenotype, analysis of the KISS1R gene should be a part of genetic analysis of patients with nIHH, to allow better understanding of phenotype-genotype relationship of KISS1R mutations and the underlying genetic basis of patients with nIHH. © 2014 John Wiley & Sons Ltd.

Identification of a novel mutation in a Chinese family with Nance-Horan syndrome by whole exome sequencing*

PubMed Central

Hong, Nan; Chen, Yan-hua; Xie, Chen; Xu, Bai-sheng; Huang, Hui; Li, Xin; Yang, Yue-qing; Huang, Ying-ping; Deng, Jian-lian; Qi, Ming; Gu, Yang-shun

2014-01-01

Objective: Nance-Horan syndrome (NHS) is a rare X-linked disorder characterized by congenital nuclear cataracts, dental anomalies, and craniofacial dysmorphisms. Mental retardation was present in about 30% of the reported cases. The purpose of this study was to investigate the genetic and clinical features of NHS in a Chinese family. Methods: Whole exome sequencing analysis was performed on DNA from an affected male to scan for candidate mutations on the X-chromosome. Sanger sequencing was used to verify these candidate mutations in the whole family. Clinical and ophthalmological examinations were performed on all members of the family. Results: A combination of exome sequencing and Sanger sequencing revealed a nonsense mutation c.322G>T (E108X) in exon 1 of NHS gene, co-segregating with the disease in the family. The nonsense mutation led to the conversion of glutamic acid to a stop codon (E108X), resulting in truncation of the NHS protein. Multiple sequence alignments showed that codon 108, where the mutation (c.322G>T) occurred, was located within a phylogenetically conserved region. The clinical features in all affected males and female carriers are described in detail. Conclusions: We report a nonsense mutation c.322G>T (E108X) in a Chinese family with NHS. Our findings broaden the spectrum of NHS mutations and provide molecular insight into future NHS clinical genetic diagnosis. PMID:25091991

Identification of a novel mutation in a Chinese family with Nance-Horan syndrome by whole exome sequencing.

PubMed

Hong, Nan; Chen, Yan-hua; Xie, Chen; Xu, Bai-sheng; Huang, Hui; Li, Xin; Yang, Yue-qing; Huang, Ying-ping; Deng, Jian-lian; Qi, Ming; Gu, Yang-shun

2014-08-01

Nance-Horan syndrome (NHS) is a rare X-linked disorder characterized by congenital nuclear cataracts, dental anomalies, and craniofacial dysmorphisms. Mental retardation was present in about 30% of the reported cases. The purpose of this study was to investigate the genetic and clinical features of NHS in a Chinese family. Whole exome sequencing analysis was performed on DNA from an affected male to scan for candidate mutations on the X-chromosome. Sanger sequencing was used to verify these candidate mutations in the whole family. Clinical and ophthalmological examinations were performed on all members of the family. A combination of exome sequencing and Sanger sequencing revealed a nonsense mutation c.322G>T (E108X) in exon 1 of NHS gene, co-segregating with the disease in the family. The nonsense mutation led to the conversion of glutamic acid to a stop codon (E108X), resulting in truncation of the NHS protein. Multiple sequence alignments showed that codon 108, where the mutation (c.322G>T) occurred, was located within a phylogenetically conserved region. The clinical features in all affected males and female carriers are described in detail. We report a nonsense mutation c.322G>T (E108X) in a Chinese family with NHS. Our findings broaden the spectrum of NHS mutations and provide molecular insight into future NHS clinical genetic diagnosis.

A novel silent deletion, an insertion mutation and a nonsense mutation in the TCOF1 gene found in two Chinese cases of Treacher Collins syndrome.

PubMed

Wang, Yan; Yin, Xiao-Juan; Han, Tao; Peng, Wei; Wu, Hong-Lin; Liu, Xin; Feng, Zhi-Chun

2014-12-01

Treacher Collins syndrome (TCS) is the most common and well-known craniofacial disorder caused by mutations in the genes involved in pre-rRNA transcription, which include the TCOF1 gene. This study explored the role of TCOF1 mutations in Chinese patients with TCS. Mutational analysis of the TCOF1 gene was performed in three patients using polymerase chain reaction and direct sequencing. Among these three patients, two additional TCOF1 variations, a novel 18 bp deletion and a novel 1 bp insertion mutation, were found in patient 1, together with a novel nonsense mutation (p.Ser476X) and a previously reported 4 bp deletion (c.1872_1875delTGAG) in other patients. Pedigree analysis allowed for prediction of the character of the mutation, which was either pathological or not. The 18 bp deletion of six amino acids, Ser-Asp-Ser-Glu-Glu-Glu (798*803), which was located in the CKII phosphorylation site of treacle, seemed relatively benign for TCS. By contrast, another novel mutation of c.1072_1073insC (p.Gln358ProfsX23) was a frameshift mutation and expected to result in a premature stop codon. This study provides insights into the functional domain of treacle and illustrates the importance of clinical and family TCS screening for the interpretation of novel sequence alterations.

Limited phenotypic variation of hypocalcified amelogenesis imperfecta in a Danish five-generation family with a novel FAM83H nonsense mutation.

PubMed

Haubek, Dorte; Gjørup, Hans; Jensen, Lillian G; Juncker, Inger; Nyegaard, Mette; Børglum, Anders D; Poulsen, Sven; Hertz, Jens M

2011-11-01

BACKGROUND.  Autosomal dominant hypocalcified amelogenesis imperfecta (ADHCAI) is a disease with severe dental manifestations. OBJECTIVES.  The aims were by means of a genome-wide linkage scan to search for the gene underlying the ADHCAI phenotype in a Danish five-generation family and to study the phenotypic variation of the enamel in affected family members. RESULTS.  Significant linkage was found to a locus at chromosome 8q24.3 comprising the gene FAM83H identified to be responsible for ADHCAI in other families. Subsequent sequencing of FAM83H in affected family members revealed a novel nonsense mutation, p.Y302X. Limited phenotypic variation was found among affected family members with loss of translucency and discoloration of the enamel. Extensive posteruptive loss of enamel was found in all teeth of affected subjects. The tip of the cusps on the premolars and molars and a zone along the gingival margin seemed resistant to posteruptive loss of enamel. We have screened FAM83H in another five unrelated Danish patients with a phenotype of ADHCAI similar to that in the five-generation family, and identified a de novo FAM83H nonsense mutation, p.Q452X in one of these patients. CONCLUSION.  We have identified a FAM83H mutation in two of six unrelated families with ADHCAI and found limited phenotypic variation of the enamel in these patients. © 2011 The Authors. International Journal of Paediatric Dentistry © 2011 BSPD, IAPD and Blackwell Publishing Ltd.

Association of a nonsense mutation (W1282X), the most common mutation in the Ashkenazi Jewish cystic fibrosis patients in Israel, with presentation of severe disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shoshani, T.; Bashan, N.; Seret, H.

1992-01-01

Only about 30% of the cystic fibrosis chromosomes in the Israeli cystic fibrosis patient populations carry the major CF mutation ({Delta}F508). Since different Jewish ethnic groups tended to live as closed isolates until recent times, high frequencies of specific mutations are expected among the remainder cystic fibrosis chromosomes of these ethnic groups. Genetic factors appear to influence the severity of the disease. It is therefore expected that different mutations will be associated with either severe or mild phenotype. Direct genomic sequencing of exons included in the two nucleotide-binding folds of the putative CFTR protein was performed on 119 Israeli cysticmore » fibrosis patients from 97 families. One sequence alteration which is expected to create a termination at residue 1282 (W1282X) was found in 63 chromosomes. Of 95 chromosomes, 57(60%) are of Ashkenazi origin. In conclusion, the W1282X mutation is the most common cystic fibrosis mutation in the Ashkenazi Jewish patient population in Israel. This nonsense mutation is associated with presentation of severe disease.« less

Recurrent nonsense mutations in the growth hormone receptor from patients with Laron dwarfism.

PubMed Central

Amselem, S; Sobrier, M L; Duquesnoy, P; Rappaport, R; Postel-Vinay, M C; Gourmelen, M; Dallapiccola, B; Goossens, M

1991-01-01

In addition to its classical effects on growth, growth hormone (GH) has been shown to have a number of other actions, all of which are initiated by an interaction with specific high affinity receptors present in a variety of tissues. Purification of a rabbit liver protein via its ability to bind GH has allowed the isolation of a cDNA encoding a putative human growth hormone receptor that belongs to a new class of transmembrane receptors. We have previously shown that this putative growth hormone receptor gene is genetically linked to Laron dwarfism, a rare autosomal recessive syndrome caused by target resistance to GH. Nevertheless, the inability to express the corresponding full-length coding sequence and the lack of a test for growth-promoting function have hampered a direct confirmation of its role in growth. We have now identified three nonsense mutations within this growth hormone receptor gene, lying at positions corresponding to the amino terminal extremity and causing a truncation of the molecule, thereby deleting a large portion of both the GH binding domain and the full transmembrane and intracellular domains. Three independent patients with Laron dwarfism born of consanguineous parents were homozygous for these defects. Two defects were identical and consisted of a CG to TG transition. Not only do these results confirm the growth-promoting activity of this receptor but they also suggest that CpG doublets may represent hot spots for mutations in the growth hormone receptor gene that are responsible for hereditary dwarfism. Images PMID:1999489

A novel non-sense mutation in the SLC2A10 gene of an arterial tortuosity syndrome patient of Kurdish origin.

PubMed

Zaidi, Syed H E; Meyer, Sascha; Peltekova, Vanya D; Lindinger, Angelika; Teebi, Ahmad S; Faiyaz-Ul-Haque, Muhammad

2009-07-01

Arterial tortuosity syndrome (ATS) is a rare autosomal recessive disorder in which patients display tortuosity of arteries in addition to hyperextensible skin, joint laxity, and other connective tissue features. This syndrome is caused by mutations in the SLC2A10 gene. In this article we describe an ATS girl of Kurdish origin who, in addition to arterial tortuosity and connective tissue features, displays stomach displacement within the thorax and bilateral hip dislocation. Clinical details of this patient have been reported previously. Sequencing of the SLC2A10 gene identified a novel homozygous non-sense c.756C>A mutation in this patient's DNA. This mutation in the SLC2A10 gene replaces a cysteine encoding codon with a stop signal. This is believed to cause a premature truncation of GLUT10 protein in this patient. We conclude that patients of Kurdish origin who display arterial tortuosity associated with skin hyperextensibility, joint hypermobility, and characteristic facial features may carry mutations in the SLC2A10 gene.

Homozygosity mapping reveals new nonsense mutation in the FAM161A gene causing autosomal recessive retinitis pigmentosa in a Palestinian family.

PubMed

Zobor, Ditta; Balousha, Ghassan; Baumann, Britta; Wissinger, Bernd

2014-01-01

Retinitis pigmentosa (RP) is a heterogenous group of inherited retinal degenerations caused by mutations in at least 45 genes. Recently, the FAM161A gene was identified as the causative gene for RP28, an autosomal recessive form of RP. We performed a clinical and molecular genetic study of a consanguineous Palestinian family with two three siblings affected with retinitis pigmentosa. DNA samples were collected from the index patient, his father, his affected sister, and two non-affected brothers. DNA sample from the index was subjected to high resolution genome-wide SNP array. Assuming identity-by-descent in this consanguineous family we applied homozygosity mapping to identify disease causing genes. The index patient reported night blindness since the age of 20 years, followed by moderate disease progression with decrease of peripheral vision, the development of photophobia and later on reduced central vision. At the age of 40 his visual acuity was counting fingers (CF) for both eyes, color discrimination was not possible and his visual fields were severely constricted. Funduscopic examination revealed a typical appearance of advanced RP with optic disc pallor, narrowed retinal vessels, bone-spicule like pigmentary changes in the mid-periphery and atrophic changes in the macula. His younger affected brother (37 years) was reported with overall milder symptoms, while the youngest sister (21 years) reported problems only with night vision. Applying high-density SNP arrays we identified several homozygous genomic regions one of which included the recently identified FAM161A gene mutated in RP28-linked autosomal recessive RP. Sequencing analysis revealed the presence of a novel homozygous nonsense mutation, c.1003C>T/p.R335X in the index patient and the affected sister. We identified an RP28-linked RP family in the Palestinian population caused by a novel nonsense mutation in FAM161A. RP in this family shows a typical disease onset with moderate to rapid progression

Homozygosity mapping reveals new nonsense mutation in the FAM161A gene causing autosomal recessive retinitis pigmentosa in a Palestinian family

PubMed Central

Zobor, Ditta; Balousha, Ghassan; Baumann, Britta

2014-01-01

Purpose: Retinitis pigmentosa (RP) is a heterogenous group of inherited retinal degenerations caused by mutations in at least 45 genes. Recently, the FAM161A gene was identified as the causative gene for RP28, an autosomal recessive form of RP. Methods: We performed a clinical and molecular genetic study of a consanguineous Palestinian family with two three siblings affected with retinitis pigmentosa. DNA samples were collected from the index patient, his father, his affected sister, and two non-affected brothers. DNA sample from the index was subjected to high resolution genome-wide SNP array. Assuming identity-by-descent in this consanguineous family we applied homozygosity mapping to identify disease causing genes. Results: The index patient reported night blindness since the age of 20 years, followed by moderate disease progression with decrease of peripheral vision, the development of photophobia and later on reduced central vision. At the age of 40 his visual acuity was counting fingers (CF) for both eyes, color discrimination was not possible and his visual fields were severely constricted. Funduscopic examination revealed a typical appearance of advanced RP with optic disc pallor, narrowed retinal vessels, bone-spicule like pigmentary changes in the mid-periphery and atrophic changes in the macula. His younger affected brother (37 years) was reported with overall milder symptoms, while the youngest sister (21 years) reported problems only with night vision. Applying high-density SNP arrays we identified several homozygous genomic regions one of which included the recently identified FAM161A gene mutated in RP28-linked autosomal recessive RP. Sequencing analysis revealed the presence of a novel homozygous nonsense mutation, c.1003C>T/p.R335X in the index patient and the affected sister. Conclusion: We identified an RP28-linked RP family in the Palestinian population caused by a novel nonsense mutation in FAM161A. RP in this family shows a typical disease

Edward Lear, Limericks, and Nonsense: A Little Nonsense. [Lesson Plan].

ERIC Educational Resources Information Center

2002

British poet Edward Lear (1812-1888) is widely recognized as the father of the limerick form of poetry and is well known for his nonsense poems. In the first lesson for grades 3-5, which focuses on Lear's nonsense poem "The Owl and the Pussy Cat," students learn about nonsense poetry as well as the various poetic techniques and devices…

Identification of a novel COL1A1 frameshift mutation, c.700delG, in a Chinese osteogenesis imperfecta family

PubMed Central

Wang, Xiran; Pei, Yu; Dou, Jingtao; Lu, Juming; Li, Jian; Lv, Zhaohui

2015-01-01

Osteogenesis imperfecta (OI) is a family of genetic disorders associated with bone loss and fragility. Mutations associated with OI have been found in genes encoding the type I collagen chains. People with OI type I often produce insufficient α1-chain type I collagen because of frameshift, nonsense, or splice site mutations in COL1A1 or COL1A2. This report is of a Chinese daughter and mother who had both experienced two bone fractures. Because skeletal fragility is predominantly inherited, we focused on identifying mutations in COL1A1 and COL1A2 genes. A novel mutation in COL1A1, c.700delG, was detected by genomic DNA sequencing in the mother and daughter, but not in their relatives. The identification of this mutation led to the conclusion that they were affected by mild OI type I. Open reading frame analysis indicated that this frameshift mutation would truncate α1-chain type I collagen at residue p263 (p.E234KfsX264), while the wild-type protein would contain 1,464 residues. The clinical data were consistent with the patients’ diagnosis of mild OI type I caused by haploinsufficiency of α1-chain type I collagen. Combined with previous reports, identification of the novel mutation COL1A1-c.700delG in these patients suggests that additional genetic and environmental factors may influence the severity of OI. PMID:25983617

A novel nonsense mutation in the EYA1 gene associated with branchio-oto-renal/branchiootic syndrome in an Afrikaner kindred.

PubMed

Clarke, J C; Honey, E M; Bekker, E; Snyman, L C; Raymond, R M; Lord, C; Brophy, P D

2006-07-01

Branchio-oto-renal (BOR) syndrome is an autosomal dominant disorder characterized by the associations of hearing loss, branchial arch defects and renal anomalies. Branchiootic (BO) syndrome is a related disorder that presents without the highly variable characteristic renal anomalies of BOR syndrome. Dominant mutations in the human homologue of the Drosophila eyes absent gene (EYA1) are frequently the cause of both BOR and BO syndromes. We report a South African family of Afrikaner descent with affected individuals presenting with pre-auricular abnormalities and either hearing loss or bilateral absence of the kidneys. Genetic analysis of the pedigree detected a novel EYA1 heterozygous nonsense mutation in affected family members but not in unaffected family members or a random DNA panel. Through mutational analysis, we conclude that this particular mutation is the cause of BOR/BO syndrome in this family as a result of a truncation of the EYA1 protein that ablates the critical EYA homologous region. To the best of our knowledge, this is the first case of BOR/BO syndrome reported in Africa or in those of the Afrikaner descent.

An Indian child with Kindler syndrome resulting from a new homozygous nonsense mutation (C468X) in the KIND1 gene.

PubMed

Sethuraman, G; Fassihi, H; Ashton, G H S; Bansal, A; Kabra, M; Sharma, V K; McGrath, J A

2005-05-01

Kindler syndrome is an inherited skin condition that presents with blistering followed by photosensitivity and a progressive poikiloderma. The disorder results from mutations in the KIND1 gene, encoding the protein kindlin-1, a recently characterized 677-amino acid protein involved in anchorage of the actin cytoskeleton to the extracellular matrix. We report the clinical features of an 11-year-old boy with Kindler syndrome from a consanguineous Indian family and the identification of a homozygous nonsense mutation (C468X) in exon 12 of the KIND1 gene in his genomic DNA. This mutation has not been described previously but is similar to the 17 previously published KIND1 mutations that are all predicted to lead to loss of kindlin-1 protein expression and function. The clinical features in this boy highlight the relevance of kindlin-1 in skin biology, specifically to epidermal adhesion and response to acute and chronic sun exposure. Delineation of this new pathogenic mutation in KIND1 is also useful for genetic counselling in this family and in assessing carrier status in unaffected family members.

Identification of the first nonsense CDSN mutation with expression of a truncated protein causing peeling skin syndrome type B.

PubMed

Mallet, A; Kypriotou, M; George, K; Leclerc, E; Rivero, D; Mazereeuw-Hautier, J; Serre, G; Huber, M; Jonca, N; Hohl, D

2013-12-01

Peeling skin disease (PSD), a generalized inflammatory form of peeling skin syndrome, is caused by autosomal recessive nonsense mutations in the corneodesmosin gene (CDSN). To investigate a novel mutation in CDSN. A 50-year-old white woman showed widespread peeling with erythema and elevated serum IgE. DNA sequencing, immunohistochemistry, Western blot and real-time polymerase chain reaction analyses of skin biopsies were performed in order to study the genetics and to characterize the molecular profile of the disease. Histology showed hyperkeratosis and acanthosis of the epidermis, and inflammatory infiltrates in the dermis. DNA sequencing revealed a homozygous mutation leading to a premature termination codon in CDSN: p.Gly142*. Protein analyses showed reduced expression of a 16-kDa corneodesmosin mutant in the upper epidermal layers, whereas the full-length protein was absent. These results are interesting regarding the genotype-phenotype correlations in diseases caused by CDSN mutations. The PSD-causing CDSN mutations identified heretofore result in total corneodesmosin loss, suggesting that PSD is due to full corneodesmosin deficiency. Here, we show for the first time that a mutant corneodesmosin can be stably expressed in some patients with PSD, and that this truncated protein is very probably nonfunctional. © 2013 British Association of Dermatologists.

Mutations in a Novel Isoform of TRIOBP That Encodes a Filamentous-Actin Binding Protein Are Responsible for DFNB28 Recessive Nonsyndromic Hearing Loss

PubMed Central

Shahin, Hashem; Walsh, Tom; Sobe, Tama; Abu Sa’ed, Judeh; Abu Rayan, Amal; Lynch, Eric D.; Lee, Ming K.; Avraham, Karen B.; King, Mary-Claire; Kanaan, Moein

2006-01-01

In a large consanguineous Palestinian kindred, we previously mapped DFNB28—a locus associated with recessively inherited, prelingual, profound sensorineural hearing impairment—to chromosome 22q13.1. We report here that mutations in a novel 218-kDa isoform of TRIOBP (TRIO and filamentous actin [F-actin] binding protein) are associated with DFNB28 hearing loss in a total of nine Palestinian families. Two nonsense mutations (R347X and Q581X) truncate the protein, and a potentially deleterious missense mutation (G1019R) occurs in a conserved motif in a putative SH3-binding domain. In seven families, 27 deaf individuals are homozygous for one of the nonsense mutations; in two other families, 3 deaf individuals are compound heterozygous for the two nonsense mutations or for Q581X and G1019R. The novel long isoform of TRIOBP has a restricted expression profile, including cochlea, retina, and fetal brain, whereas the original short isoform is widely expressed. Antibodies to TRIOBP reveal expression in sensory cells of the inner ear and colocalization with F-actin along the length of the stereocilia. PMID:16385458

[Novel nonsense mutation (p.Y113X) in the human growth hormone receptor gene in a Brazilian patient with Laron syndrome].

PubMed

Diniz, Erik Trovão; Jorge, Alexander A L; Arnhold, Ivo J P; Rosenbloom, Arlan L; Bandeira, Francisco

2008-11-01

To date, about sixty different mutations within GH receptor (GHR) gene have been described in patients with GH insensitivity syndrome (GHI). In this report, we described a novel nonsense mutation of GHR. The patient was evaluated at the age of 6 yr, for short stature associated to clinical phenotype of GHI. GH, IGF-1, and GHBP levels were determined. The PCR products from exons 2-10 were sequenced. The patient had high GH (26 microg/L), low IGF-1 (22.5 ng/ml) and undetectable GHBP levels. The sequencing of GHR exon 5 disclosed adenine duplication at nucleotide 338 of GHR coding sequence (c.338dupA) in homozygous state. We described a novel mutation that causes a truncated GHR and a loss of receptor function due to the lack of amino acids comprising the transmembrane and intracellular regions of GHR protein, leading to GHI.

Inherited human complement C5 deficiency: Nonsense mutations in exons 1 (Gln{sup 1} to Stop) and 36 (Arg{sup 1458} to Stop) and compound heterozygosity in three African-American families

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, X.; Fleischer, D.T.; Whitehead, W.T.

1995-05-15

Hereditary C5 deficiency has been reported in several families of different ethnic backgrounds and from different geographic regions, but the molecular genetic defect causing C5 deficiency has not been delineated in any of them. To examine the molecular basis of C5 deficiency in the African-American population, the exons and intron/exon boundaries of the C5 structural genes from three C5-deficient (C5D) African-American families were sequenced, revealing two nonsense mutations. The nonsense mutations are located in exon 1 (C{sup 84}AG to TAG) in two of the C5D families (Rhode Island and North Carolina) and in exon 36 (C{sup 4521}GA to TGA) inmore » the third C5D family (New York). The exon 1 and 36 mutations are contained in codons that encode the first amino acid of the C5 {beta}-chain (Gln{sup 1} to Stop) and residue 1458 in the {alpha}-chain (Arg{sup 1458} to Stop), respectively. Allele-specific PCR and sequence analyses demonstrated that the exon 1 mutation is present in only one of the C5 null genes in both the Rhode Island and North Carolina families, and the exon 36 mutation is contained in only one C5 null gene in the New York family. Neither of the nonsense mutations was found in the European or Caucasian-American C5D individuals examined. Collectively, these data indicate that: (1) C5 deficiency is caused by several different molecular genetic defects, (2) C5 deficiency in the African-American population can be explained in part by two distinct nonsense mutations in exons 1 and 36, and (3) compound heterozygosity exists in all of the reported African-American C5D families. 44 refs., 5 figs., 1 tab.« less

Permanent neonatal diabetes caused by a homozygous nonsense mutation in the glucokinase gene.

PubMed

Rubio-Cabezas, O; Díaz González, F; Aragonés, A; Argente, J; Campos-Barros, A

2008-06-01

Glucokinase deficiency is an unfrequent cause of permanent neonatal diabetes (PND), as only seven patients have been reported, either homozygous for a missense or frameshift mutation or compound heterozygous for both of them. We report here the first known case caused by a homozygous nonsense mutation (Y61X) in the glucokinase gene (GCK) that introduces a premature stop codon, generating a truncated protein that is predicted to be completely inactive as it lacks both the glucose- and the adenosine triphosphate-binding sites. The proband, born to consanguineous parents, was a full-term, intra-uterine growth-retarded male newborn who presented with a glycaemia of 129 mg/dL (7.16 mmol/L) on his second day of life, increasing thereafter up to 288 mg/dL (15.98 mmol/L) and 530 mg/dL (29.41 mmol/L) over the next 24 h, in the face of low serum insulin (<3 muIU/mL; <20.83 pmol/L). He was put on insulin on the third day of life. Insulin has never been discontinued since then. The patient was tested negative for anti-insulin and islet cell antibodies at age 5 months. His father had non-progressive, impaired fasting glucose for several years. The mother was found to be mildly hyperglycaemic only when her glucose was checked after the child was diagnosed. In conclusion, biallelic GCK loss should be considered as a potential cause of PND in children born to consanguineous parents, even if they are not known to be diabetic at the time of PND presentation.

[Maple syrup urine disease and gene mutations in twin neonates].

PubMed

Li, Tao; Wang, Yu; Li, Cui; Xu, Wei-Wei; Niu, Feng-Hai; Zhang, Di

2016-12-01

To investigate the clinical features of one pair of twin neonates with maple syrup urine disease (MSUD) in the Chinese Han population and pathogenic mutations in related genes, and to provide guidance for the early diagnosis and treatment of MSUD. The clinical and imaging data of the twin neonates were collected. The peripheral blood samples were collected from the twin neonates and their parents to detect the genes related to MSUD (BCKDHA, BCKDHB, DBT, and DLD). The loci with gene mutations were identified, and a bioinformatic analysis was performed. Two mutations were detected in the BCKDHB gene, missense mutation c.304G>A (p.Gly102Arg) and nonsense mutation c.331C>T (p.Arg111*), and both of them were heterozygotes. The mutation c.304G>A (p.Gly102Arg) had not been reported in the world. Their father carried the missense mutation c.304G>A (p.Gly102Arg), and their mother carried the nonsense mutation c.331C>T (p.Arg111*). The c.331C>T (p.Arg111*) heterozygous mutation in BCKDHB gene is the pathogenic mutation in these twin neonates and provides a genetic and molecular basis for the clinical features of children with MSUD.

Increased Selectivity towards Cytoplasmic versus Mitochondrial Ribosome Confers Improved Efficiency of Synthetic Aminoglycosides in Fixing Damaged Genes: A Strategy for Treatment of Genetic Diseases Caused by Nonsense Mutations

PubMed Central

Kandasamy, Jeyakumar; Atia-Glikin, Dana; Shulman, Eli; Shapira, Katya; Shavit, Michal; Belakhov, Valery; Baasov, Timor

2012-01-01

Compelling evidence is now available that gentamicin and geneticin (G418) can induce mammalian ribosome to suppress disease-causing nonsense mutations and partially restore the expression of functional proteins. However, toxicity and relative lack of efficacy at subtoxic doses limit the use of gentamicin for suppression therapy. Although G418 exhibits strongest activity, it is very cytotoxic even at low doses. We describe here the first systematic development of the novel aminoglycoside (S)-11 exhibiting similar in vitro and ex vivo activity to that of G418, while its cell toxicity is significantly lower than those of gentamicin and G418. Using a series of biochemical assays, we provide proof of principle that antibacterial activity and toxicity of aminoglycosides can be dissected from their suppression activity. The data further indicate that the increased specificity towards cytoplasmic ribosome correlates with the increased activity, and that the decreased specificity towards mitochondrial ribosome confers to the lowered cytotoxicity. PMID:23148581

Differential protein structural disturbances and suppression of assembly partners produced by nonsense GABRG2 epilepsy mutations: implications for disease phenotypic heterogeneity

PubMed Central

Wang, Juexin; Shen, Dingding; Xia, Geqing; Shen, Wangzhen; Macdonald, Robert L.; Xu, Dong; Kang, Jing-Qiong

2016-01-01

Mutations in GABAA receptor subunit genes are frequently associated with epilepsy, and nonsense mutations in GABRG2 are associated with several epilepsy syndromes including childhood absence epilepsy, generalized tonic clonic seizures and the epileptic encephalopathy, Dravet syndrome. The molecular basis for the phenotypic heterogeneity of mutations is unclear. Here we focused on three nonsense mutations in GABRG2 (GABRG2(R136*), GABRG2(Q390*) and GABRG2(W429*)) associated with epilepsies of different severities. Structural modeling and structure-based analysis indicated that the surface of the wild-type γ2 subunit was naturally hydrophobic, which is suitable to be buried in the cell membrane. Different mutant γ2 subunits had different stabilities and different interactions with their wild-type subunit binding partners because they adopted different conformations and had different surface hydrophobicities and different tendency to dimerize. We utilized flow cytometry and biochemical approaches in combination with lifted whole cell patch-clamp recordings. We demonstrated that the truncated subunits had no to minimal surface expression and unchanged or reduced surface expression of wild-type partnering subunits. The amplitudes of GABA-evoked currents from the mutant α1β2γ2(R136*), α1β2γ2(Q390*) and α1β2γ2(W429*) receptors were reduced compared to the currents from α1β2γ2 receptors but with differentially reduced levels. This thus suggests differential protein structure disturbances are correlated with disease severity. PMID:27762395

Characterization of an MPS I-H Knock-In Mouse that Carries a Nonsense Mutation Analogous to the Human IDUA-W402X Mutation

PubMed Central

Wang, Dan; Shukla, Charu; Liu, Xiaoli; Schoeb, Trenton R.; Clarke, Lorne A.; Bedwell, David M.; Keeling, Kim M.

2009-01-01

Here we report the characterization of a knock-in mouse model for the autosomal recessive disorder mucopolysaccharidosis type I-Hurler (MPS I-H), also known as Hurler syndrome. MPS I-H is the most severe form of α-L-iduronidase deficiency. α-L-iduronidase (encoded by the IDUA gene) is a lysosomal enzyme that participates in the degradation of dermatan sulfate and heparan sulfate. Using gene replacement methodology, a nucleotide change was introduced into the mouse Idua locus that resulted in a nonsense mutation at codon W392. The Idua-W392X mutation is analogous to the human IDUA-W402X mutation commonly found in MPS I-H patients. We found that the phenotype in homozygous Idua-W392X mice closely correlated with the human MPS I-H disease. Homozygous W392X mice showed no detectable α-L-iduronidase activity. We observed a defect in GAG degradation as evidenced by an increase in sulfated GAGs excreted in the urine and stored in multiple tissues. Histology and electron microscopy also revealed evidence of GAG storage in all tissues examined. Additional assessment revealed bone abnormalities and altered metabolism within the Idua-W392X mouse. This new mouse will provide an important tool to investigate therapeutic approaches for MPS I-H that cannot be addressed using current MPS I-H animal models. PMID:19751987

An intronic mutation c.6430-3C>G in the F8 gene causes splicing efficiency and premature termination in hemophilia A.

PubMed

Xia, Zunjing; Lin, Jie; Lu, Lingping; Kim, Chol; Yu, Ping; Qi, Ming

2018-06-01

: Hemophilia A is a bleeding disorder caused by coagulation factor VIII protein deficiency or dysfunction, which is classified into severe, moderate, and mild according to factor clotting activity. An overwhelming majority of missense and nonsense mutations occur in exons of F8 gene, whereas mutations in introns can also be pathogenic. This study aimed to investigate the effect of an intronic mutation, c.6430-3C>G (IVS22-3C>G), on pre-mRNA splicing of the F8 gene. We applied DNA and cDNA sequencing in a Chinese boy with hemophilia A to search if any pathogenic mutation in the F8 gene. Functional analysis was performed to investigate the effect of an intronic mutation at the transcriptional level. Human Splicing Finder and PyMol were also used to predict its effect. We found the mutation c.6430-3C>G (IVS22-3C>G) in the F8 gene in the affected boy, with his mother being a carrier. cDNA from the mother and pSPL3 splicing assay showed that the mutation IVS22-3C>G results in a two-nucleotide AG inclusion at the 3' end of intron 22 and leads to a truncated coagulation factor VIII protein, with partial loss of the C1 domain and complete loss of the C2 domain. The in-silico tool predicted that the mutation induces altered pre-mRNA splicing by using a cryptic acceptor site in intron 22. The IVS22-3C>G mutation was confirmed to affect pre-mRNA splicing and produce a truncated protein, which reduces the stability of binding between the F8 protein and von Willebrand factor carrier protein due to the loss of an interaction domain.

Spectrum of MECP2 gene mutations in a cohort of Indian patients with Rett syndrome: report of two novel mutations.

PubMed

Das, Dhanjit Kumar; Raha, Sarbani; Sanghavi, Daksha; Maitra, Anurupa; Udani, Vrajesh

2013-02-15

Rett syndrome (RTT) is an X-linked neurodevelopmental disorder, primarily affecting females and characterized by developmental regression, epilepsy, stereotypical hand movements, and motor abnormalities. Its prevalence is about 1 in 10,000 female births. Rett syndrome is caused by mutations within methyl CpG-binding protein 2 (MECP2) gene. Over 270 individual nucleotide changes which cause pathogenic mutations have been reported. However, eight most commonly occurring missense and nonsense mutations account for almost 70% of all patients. We screened 90 individuals with Rett syndrome phenotype. A total of 19 different MECP2 mutations and polymorphisms were identified in 27 patients. Of the 19 mutations, we identified 7 (37%) frameshift, 6 (31%) nonsense, 14 (74%) missense mutations and one duplication (5%). The most frequent pathogenic changes were: missense p.T158M (11%), p.R133C (7.4%), and p.R306C (7.4%) and nonsense p.R168X (11%), p.R255X (7.4%) mutations. We have identified two novel mutations namely p.385-388delPLPP present in atypical patients and p.Glu290AlafsX38 present in a classical patient of Rett syndrome. Sequence homology for p.385-388delPLPP mutation revealed that these 4 amino acids were conserved across mammalian species. This indicated the importance of these 4 amino acids in structure and function of the protein. A novel variant p.T479T has also been identified in a patient with atypical Rett syndrome. A total of 62 (69%) patients remained without molecular genetics diagnosis that necessitates further search for mutations in other genes like CDKL5 and FOXG1 that are known to cause Rett phenotype. The majority of mutations are detected in exon 4 and only one mutation was present in exon 3. Therefore, our study suggests the need for screening exon 4 of MECP2 as first line of diagnosis in these patients. Copyright © 2012 Elsevier B.V. All rights reserved.

Mechanism and evidence of nonsense suppression therapy for genetic eye disorders.

PubMed

Richardson, Rose; Smart, Matthew; Tracey-White, Dhani; Webster, Andrew R; Moosajee, Mariya

2017-02-01

Between 5 and 70% of genetic disease is caused by in-frame nonsense mutations, which introduce a premature termination codon (PTC) within the disease-causing gene. Consequently, during translation, non-functional or gain-of-function truncated proteins of pathological significance, are formed. Approximately 50% of all inherited retinal disorders have been associated with PTCs, highlighting the importance of novel pharmacological or gene correction therapies in ocular disease. Pharmacological nonsense suppression of PTCs could delineate a therapeutic strategy that treats the mutation in a gene- and disease-independent manner. This approach aims to suppress the fidelity of the ribosome during protein synthesis so that a near-cognate aminoacyl-tRNA, which shares two of the three nucleotides of the PTC, can be inserted into the peptide chain, allowing translation to continue, and a full-length functional protein to be produced. Here we discuss the mechanisms and evidence of nonsense suppression agents, including the small molecule drug ataluren (or PTC124) and next generation 'designer' aminoglycosides, for the treatment of genetic eye disease. Copyright © 2017 Elsevier Ltd. All rights reserved.

A homozygous nonsense mutation in the gene for Tmem79, a component for the lamellar granule secretory system, produces spontaneous eczema in an experimental model of atopic dermatitis.

PubMed

Sasaki, Takashi; Shiohama, Aiko; Kubo, Akiharu; Kawasaki, Hiroshi; Ishida-Yamamoto, Akemi; Yamada, Taketo; Hachiya, Takayuki; Shimizu, Atsushi; Okano, Hideyuki; Kudoh, Jun; Amagai, Masayuki

2013-11-01

Flaky tail (ma/ma Flg(ft/ft)) mice have a frameshift mutation in the filaggrin (Flg(ft)) gene and are widely used as a model of human atopic dermatitis associated with FLG mutations. These mice possess another recessive hair mutation, matted (ma), and develop spontaneous dermatitis under specific pathogen-free conditions, whereas genetically engineered Flg(-/-) mice do not. We identified and characterized the gene responsible for the matted hair and dermatitis phenotype in flaky tail mice. We narrowed down the responsible region by backcrossing ma/ma mice with wild-type mice and identified the mutation using next-generation DNA sequencing. We attempted to rescue the matted phenotype by introducing the wild-type matted transgene. We characterized the responsible gene product by using whole-mount immunostaining of epidermal sheets. We demonstrated that ma, but not Flg(ft), was responsible for the dermatitis phenotype and corresponded to a Tmem79 gene nonsense mutation (c.840C>G, p.Y280*), which encoded a 5-transmembrane protein. Exogenous Tmem79 expression rescued the matted hair and dermatitis phenotype of Tmem79(ma/ma) mice. Tmem79 was mainly expressed in the trans-Golgi network in stratum granulosum cells in the epidermis in both mice and humans. The Tmem79(ma/ma) mutation impaired the lamellar granule secretory system, which resulted in altered stratum corneum formation and a subsequent spontaneous dermatitis phenotype. The Tmem79(ma/ma) mutation is responsible for the spontaneous dermatitis phenotype in matted mice, probably as a result of impaired lamellar granule secretory system and altered stratum corneum barrier function. Copyright © 2013 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights reserved.

A nonsense mutation in cGMP-dependent type II protein kinase (PRKG2) causes dwarfism in American Angus cattle.

PubMed

Koltes, James E; Mishra, Bishnu P; Kumar, Dinesh; Kataria, Ranjit S; Totir, Liviu R; Fernando, Rohan L; Cobbold, Rowland; Steffen, David; Coppieters, Wouter; Georges, Michel; Reecy, James M

2009-11-17

Historically, dwarfism was the major genetic defect in U.S. beef cattle. Aggressive culling and sire testing were used to minimize its prevalence; however, neither of these practices can eliminate a recessive genetic defect. We assembled a 4-generation pedigree to identify the mutation underlying dwarfism in American Angus cattle. An adaptation of the Elston-Steward algorithm was used to overcome small pedigree size and missing genotypes. The dwarfism locus was fine-mapped to BTA6 between markers AFR227 and BM4311. Four candidate genes were sequenced, revealing a nonsense mutation in exon 15 of cGMP-dependant type II protein kinase (PRKG2). This C/T transition introduced a stop codon (R678X) that truncated 85 C-terminal amino acids, including a large portion of the kinase domain. Of the 75 mutations discovered in this region, only this mutation was 100% concordant with the recessive pattern of inheritance in affected and carrier individuals (log of odds score = 6.63). Previous research has shown that PRKG2 regulates SRY (sex-determining region Y) box 9 (SOX9)-mediated transcription of collagen 2 (COL2). We evaluated the ability of wild-type (WT) or R678X PRKG2 to regulate COL2 expression in cell culture. Real-time PCR results confirmed that COL2 is overexpressed in cells that overexpressed R678X PRKG2 as compared with WT PRKG2. Furthermore, COL2 and COL10 mRNA expression was increased in dwarf cattle compared with unaffected cattle. These experiments indicate that the R678X mutation is functional, resulting in a loss of PRKG2 regulation of COL2 and COL10 mRNA expression. Therefore, we present PRKG2 R678X as a causative mutation for dwarfism cattle.

A nonsense mutation in cGMP-dependent type II protein kinase (PRKG2) causes dwarfism in American Angus cattle

PubMed Central

Koltes, James E.; Mishra, Bishnu P.; Kumar, Dinesh; Kataria, Ranjit S.; Totir, Liviu R.; Fernando, Rohan L.; Cobbold, Rowland; Steffen, David; Coppieters, Wouter; Georges, Michel; Reecy, James M.

2009-01-01

Historically, dwarfism was the major genetic defect in U.S. beef cattle. Aggressive culling and sire testing were used to minimize its prevalence; however, neither of these practices can eliminate a recessive genetic defect. We assembled a 4-generation pedigree to identify the mutation underlying dwarfism in American Angus cattle. An adaptation of the Elston-Steward algorithm was used to overcome small pedigree size and missing genotypes. The dwarfism locus was fine-mapped to BTA6 between markers AFR227 and BM4311. Four candidate genes were sequenced, revealing a nonsense mutation in exon 15 of cGMP-dependant type II protein kinase (PRKG2). This C/T transition introduced a stop codon (R678X) that truncated 85 C-terminal amino acids, including a large portion of the kinase domain. Of the 75 mutations discovered in this region, only this mutation was 100% concordant with the recessive pattern of inheritance in affected and carrier individuals (log of odds score = 6.63). Previous research has shown that PRKG2 regulates SRY (sex-determining region Y) box 9 (SOX9)-mediated transcription of collagen 2 (COL2). We evaluated the ability of wild-type (WT) or R678X PRKG2 to regulate COL2 expression in cell culture. Real-time PCR results confirmed that COL2 is overexpressed in cells that overexpressed R678X PRKG2 as compared with WT PRKG2. Furthermore, COL2 and COL10 mRNA expression was increased in dwarf cattle compared with unaffected cattle. These experiments indicate that the R678X mutation is functional, resulting in a loss of PRKG2 regulation of COL2 and COL10 mRNA expression. Therefore, we present PRKG2 R678X as a causative mutation for dwarfism cattle. PMID:19887637

Nonsense mutation p.Q548X in BLM, the gene mutated in Bloom's syndrome, is associated with breast cancer in Slavic populations.

PubMed

Prokofyeva, Darya; Bogdanova, Natalia; Dubrowinskaja, Natalia; Bermisheva, Marina; Takhirova, Zalina; Antonenkova, Natalia; Turmanov, Nurzhan; Datsyuk, Ihor; Gantsev, Shamil; Christiansen, Hans; Park-Simon, Tjoung-Won; Hillemanns, Peter; Khusnutdinova, Elza; Dörk, Thilo

2013-01-01

Bloom's syndrome is a rare autosomal recessive chromosomal instability disorder with a high incidence of various types of neoplasia, including breast cancer. Whether monoallelic BLM mutations predispose to breast cancer has been a long-standing question. A nonsense mutation, p.Q548X, has recently been associated with an increased risk for breast cancer in a Russian case-control study. In the present work, we have investigated the prevalence of this Slavic BLM founder mutation in a total of 3,188 breast cancer cases and 2,458 controls from Bashkortostan, Belarus, Ukraine, and Kazakhstan. The p.Q548X allele was most frequent in Russian patients (0.8 %) but was also prevalent in Byelorussian and Ukrainian patients (0.5 and 0.6 %, respectively), whereas it was absent in Altaic or other non-European subpopulations. In a combined analysis of our four case-control series, the p.Q548X mutation was significantly associated with breast cancer (Mantel-Haenszel OR 5.1, 95 % CI 1.2; 21.9, p = 0.03). A meta-analysis with the previous study from the St. Petersburg area corroborates the association (OR 5.7, 95 % CI 2.0; 15.9, p = 3.7 × 10(-4)). A meta-analysis for all published truncating mutations further supports the association of BLM with breast cancer, with an estimated two- to five-fold increase in risk (OR 3.3, 95 %CI 1.9; 5.6, p = 1.9 × 10(-5)). Altogether, these data indicate that BLM is not only a gene for Bloom's syndrome but also might represent a breast cancer susceptibility gene.

A novel homozygous stop-codon mutation in human HFE responsible for nonsense-mediated mRNA decay.

PubMed

Padula, Maria Carmela; Martelli, Giuseppe; Larocca, Marilena; Rossano, Rocco; Olivieri, Attilio

2014-09-01

HFE-hemochromatosis (HH) is an autosomal disease characterized by excessive iron absorption. Homozygotes for H63D variant, and still less H63D heterozygotes, generally do not express HH phenotype. The data collected in our previous study in the province of Matera (Basilicata, Italy) underlined that some H63D carriers showed altered iron metabolism, without additional factors. In this study, we selected a cohort of 10/22 H63D carriers with severe biochemical iron overload (BIO). Additional analysis was performed for studying HFE exons, exon-intron boundaries, and untranslated regions (UTRs) by performing DNA extraction, PCR amplification and sequencing. The results showed a novel substitution (NM_000410.3:c.847C>T) in a patient exon 4 (GenBankJQ478433); it introduces a premature stop-codon (PTC). RNA extraction and reverse-transcription were also performed. Quantitative real-time PCR was carried out for verifying if our aberrant mRNA is targeted for nonsense-mediated mRNA decay (NMD); we observed that patient HFE mRNA was expressed much less than calibrator, suggesting that the mutated HFE protein cannot play its role in iron metabolism regulation, resulting in proband BIO. Our finding is the first evidence of a variation responsible for a PTC in iron cycle genes. The genotype-phenotype correlation observed in our cases could be related to the additional mutation. Copyright © 2014 Elsevier Inc. All rights reserved.

Two novel cases of cerebral haemorrhages at the neonatal period associated with inherited factor VII deficiency, one of them revealing a new nonsense mutation (Ser52Stop).

PubMed

Giansily-Blaizot, Muriel; Aguilar-Martinez, Patricia; Briquel, Marie-Elisabeth; d'Oiron, Roseline; De Maistre, Emmanuel; Epelbaum, Serge; Schved, Jean-François

2003-02-01

Factor VII (FVII) is a plasma glycoprotein that plays a key role in the initiation of blood coagulation cascade. Inherited FVII deficiency is a rare autosomal recessive disorder with a wide heterogeneous clinical pattern. The severe form may be associated with intracranial haemorrhages occurring closely to birth with a high mortality rate. In the present article, we report two novel cases of neonatal intracerebral bleeding associated with FVII activity levels below 1% of normal. FVII genotyping investigations revealed particular genotypes including the deleterious Cys135Arg mutation and a novel Ser52Stop nonsense mutation at the homozygous state. Both mutations, through different mechanisms, are expected to be inconsistent with the production of functional FVII. These putative mechanisms are discussed through a review of the literature on phenotypic and genotypic characteristics of cerebral haemorrhages in severe inherited FVII deficiency.

Characterization of six mutations in Exon 37 of neurofibromatosis type 1 gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Upadhyaya, M.; Osborn, M.; Maynard, J.

Neurofibromatosis type 1 (NF1) is one of the most common inherited disorders, with an incidence of 1 in 3,000. We screened a total of 320 unrelated NF1 patients for mutations in exon 37 of the NF1 gene. Six independent mutations were identified, of which three are novel, and these include a recurrent nonsense mutation identified in 2 unrelated patients at codon 2281 (G2281X), a 1-bp insertion (6791 ins A) resulting in a change of TAG (tyrosine) to a TAA (stop codon), and a 3-bp deletion (6839 del TAC) which generated a frameshift. Another recurrent nonsense mutation, Y2264X, which was detectedmore » in 2 unrelated patients in this study, was also previously reported in 2 NF1 individuals. All the mutations were identified within a contiguous 49-bp sequence. Further studies are warranted to support the notion that this region of the gene contains highly mutable sequences. 17 refs., 2 figs., 1 tab.« less

Exercise-induced downbeat nystagmus in a Korean family with a nonsense mutation in CACNA1A.

PubMed

Choi, Jae-Hwan; Seo, Jae-Deuk; Choi, Yu Ri; Kim, Min-Ji; Shin, Jin-Hong; Kim, Ji Soo; Choi, Kwang-Dong

2015-08-01

Episodic ataxia type 2 (EA2) is characterized by recurrent attacks of vertigo and ataxia lasting hours triggered by emotional stress or exercise. Although interictal horizontal gaze-evoked nystagmus and rebound nystagmus are commonly observed in patients with EA2, the nystagmus has been rarely reported during the vertigo attack. To better describe exercise-induced nystagmus in EA2, four affected members from three generations of a Korean family with EA2 received full neurological and neuro-otological evaluations. Vertigo was provoked in the proband with running for 10 min to record eye movements during the vertigo attack. We performed a polymerase chain reaction-based direct sequence analysis of all coding regions of CACNA1A in all participants. The four affected members had a history of exertional vertigo, imbalance, childhood epilepsy, headache, and paresthesia. The provocation induced severe vertigo and imbalance lasting several hours, and oculography documented pure downbeat nystagmus during the attack. Genetic analyses identified a nonsense mutation in exon 23 which has been registered in dbSNP as a pathogenic allele (c.3832C>T, p.R1278X) in all the affected members. Ictal downbeat nystagmus in the studied family indicates cerebellar dysfunction during the vertigo attack in EA2. In patients with episodic vertigo and ataxia, the observation of exercise-induced nystagmus would provide a clue for EA2.

Magnetic resonance spectroscopy and molecular studies in ornithine transcarbamylase deficiency novel mutation c.802A>G in exon 8 (p.Met268Val).

PubMed

Jamroz, E; Paprocka, J; Sokół, M; Popowska, E; Ciara, E

2013-01-01

Ornithine transcarbamylase (OTC) deficiency, an X-linked, semidominant disorder, is the most common inherited de-fect in ureagenesis, resulting in hyperammonaemia type II. The OTC gene, localised on chromosome X, has been mapp-ed to band Xp21.1, proximate to the Duchenne muscular dystrophy (DMD) gene. More than 350 different mutations, including missense, nonsense, splice-site changes, small de-letions or insertions and gross deletions, have been describ-ed so far. Almost all mutations in consensus splicing sites confer a neonatal phenotype. Most mutations in the OTC gene are 'private' and are distributed throughout the gene with a paucity of mutation in the sequence encoding the leader peptide (exon 1 and beginning of exon 2) and in exon 7. They have familial origin or occur de novo. Even with sequencing of the entire reading frame and exon/intron boundaries, only about 80% of the mutations are detected in patients with proven OTC deficiency. The remainder probably occur within the introns or in regulatory domains. The authors present a 4-year-old boy with the unreported missense mutation c.802A>G. The nucleotide transition leads to amino acid substitution Met to Val at codon 268 of the OTC protein.

Nonsense-Mediated Decay in Genetic Disease: Friend or Foe?

PubMed Central

Miller, Jake N.; Pearce, David A.

2014-01-01

Eukaryotic cells utilize various RNA quality control mechanisms to ensure high fidelity of gene expression, thus protecting against the accumulation of nonfunctional RNA and the subsequent production of abnormal peptides. Messenger RNAs (mRNAs) are largely responsible for protein production, and mRNA quality control is particularly important for protecting the cell against the downstream effects of genetic mutations. Nonsense-mediated decay (NMD) is an evolutionarily conserved mRNA quality control system in all eukaryotes that degrades transcripts containing premature termination codons (PTCs). By degrading these aberrant transcripts, NMD acts to prevent the production of truncated proteins that could otherwise harm the cell through various insults, such as dominant negative effects or the ER stress response. Although NMD functions to protect the cell against the deleterious effects of aberrant mRNA, there is a growing body of evidence that mutation-, codon-, gene-, cell-, and tissue-specific differences in NMD efficiency can alter the underlying pathology of genetic disease. In addition, the protective role that NMD plays in genetic disease can undermine current therapeutic strategies aimed at increasing the production of full-length functional protein from genes harboring nonsense mutations. Here, we review the normal function of this RNA surveillance pathway and how it is regulated, provide current evidence for the role that it plays in modulating genetic disease phenotypes, and how NMD can be used as a therapeutic target. PMID:25485595

A novel CYP27B1 mutation causes a feline vitamin D-dependent rickets type IA.

PubMed

Grahn, Robert A; Ellis, Melanie R; Grahn, Jennifer C; Lyons, Leslie A

2012-08-01

A 12-week-old domestic cat presented at a local veterinary clinic with hypocalcemia and skeletal abnormalities suggestive of rickets. Osteomalacia (rickets) is a disease caused by impaired bone mineralization leading to an increased prevalence of fractures and deformity. Described in a variety of species, rickets is most commonly caused by vitamin D or calcium deficiencies owing to both environmental and or genetic abnormalities. Vitamin D-dependent rickets type 1A (VDDR-1A) is a result of the enzymatic pathway defect caused by mutations in the 25-hydroxyvitamin D(3)-1-alpha-hydroxylase gene [cytochrome P27 B1 (CYP27B1)]. Calcitriol, the active form of vitamin D(3), regulates calcium homeostasis, which requires sufficient dietary calcium availability and correct hormonal function for proper bone growth and maintenance. Patient calcitriol concentrations were low while calcidiol levels were normal suggestive of VDDR-1A. The entire DNA coding sequencing of CYP27B1 was evaluated. The affected cat was wild type for previously identified VDDR-1A causative mutations. However, six novel mutations were identified, one of which was a nonsense mutation at G637T in exon 4. The exon 4 G637T nonsense mutation results in a premature protein truncation, changing a glutamic acid to a stop codon, E213X, likely causing the clinical presentation of rickets. The previously documented genetic mutation resulting in feline VDDR-1A rickets, as well as the case presented in this research, result from novel exon 4 CYP27B1 mutations, thus exon 4 should be the initial focus of future sequencing efforts.

Identification of a novel homozygous TRAPPC9 gene mutation causing non-syndromic intellectual disability, speech disorder, and secondary microcephaly.

PubMed

Abbasi, Ansar A; Blaesius, Kathrin; Hu, Hao; Latif, Zahid; Picker-Minh, Sylvie; Khan, Muhammad N; Farooq, Sundas; Khan, Muzammil A; Kaindl, Angela M

2017-12-01

TRAPPC9 gene mutations have been linked recently to autosomal recessive mental retardation 13 (MRT13; MIM#613192) with only eight families reported world-wide. We assessed patients from two consanguineous pedigrees of Pakistani descent with non-syndromic intellectual disability and postnatal microcephaly through whole exome sequencing (WES) and cosegregation analysis. Here we report six further patients from two pedigrees with homozygous TRAPPC9 gene mutations, the novel nonsense mutation c.2065G>T (p.E689*) and the previously identified nonsense mutation c.1423C>T (p.R475*). We provide an overview of previously reported clinical features and highlight common symptoms and variability of MRT13. Common findings are intellectual disability and absent speech, and frequently microcephaly, motor delay and pathological findings on MRI including diminished cerebral white matter volume are present. Mutations in TRAPPC9 should be considered in non-syndromic autosomal recessive intellectual disability with severe speech disorder. © 2017 Wiley Periodicals, Inc.

Coinheritance of a novel mutation on the HBA1 gene: c.187delG (p.W62fsX66) [codon 62 (-G) (α1)] with the α212 patchwork allele and Hb S [β6(A3)Glu→Val, GAG>GTG; HBB: c.20A>T].

PubMed

Scheps, Karen G; De Paula, Silvia M; Bitsman, Alicia R; Freigeiro, Daniel H; Basack, F Nora; Pennesi, Sandra P; Varela, Viviana

2013-01-01

We describe a novel frameshift mutation on the HBA1 gene (c.187delG), causative of α-thalassemia (α-thal) in a Black Cuban family with multiple sequence variants in the HBA genes and the Hb S [β6(A3)Glu→Val, GAG>GTG; HBB: c.20A>T] mutation. The deletion of the first base of codon 62 resulted in a frameshift at amino acid 62 with a putative premature termination codon (PTC) at amino acid 66 on the same exon (p.W62fsX66), which most likely triggers nonsense mediated decay of the resulting mRNA. This study also presents the first report of the α212 patchwork allele in Latin America and the description of two new sequence variants in the HBA2 region (c.-614G>A in the promoter region and c.95+39 C>T on the first intron).

The effect of the common c.2299delG mutation in USH2A on RNA splicing.

PubMed

Lenassi, Eva; Saihan, Zubin; Bitner-Glindzicz, Maria; Webster, Andrew R

2014-05-01

Recessive variants in the USH2A gene are an important cause of both Usher syndrome and nonsyndromic retinitis pigmentosa. A single base-pair deletion in exon 13 (c.2299delG, p.Glu767Serfs*21) is considered the most frequent mutation of USH2A. It is predicted to generate a premature termination codon and is presumed to lead to nonsense mediated decay. However the effect of this variant on RNA has not been formally investigated. It is not uncommon for exonic sequence alterations to cause aberrant splicing and the aim of the present report is to evaluate the effect of c.2299delG on USH2A transcripts. Nasal cells represent the simplest available tissue to study splicing defects in USH2A. Nasal brushing, RNA extraction from nasal epithelial cells and reverse transcription PCR were performed in five Usher syndrome patients who were homozygous for c.2299delG, two unaffected c.2299delG heterozygotes and seven control individuals. Primers to amplify between exons 12 and 15 and exons 10 and 14 were utilised. Significant variability was observed between different RT-PCR experiments. Importantly, in controls, PCR product of the expected size were amplified on all occasions (13/13 experiments); for patients this was true in only 4/14 experiments (Fisher exact test p = 0.0002). Bioinformatics tools predict the c.2299delG change to disrupt an exonic splicing enhancer and to create an exonic splicing silencer within exon 13. Here, we report an effect of the common c.2299delG mutation on splicing of exons 12 and 13 of USH2A. Future studies are expected to provide important insights into the contribution of this effect on the phenotype. Copyright © 2014 Elsevier Ltd. All rights reserved.

CXCR4 WHIM-like frameshift and nonsense mutations promote ibrutinib resistance but do not supplant MYD88(L265P) -directed survival signalling in Waldenström macroglobulinaemia cells.

PubMed

Cao, Yang; Hunter, Zachary R; Liu, Xia; Xu, Lian; Yang, Guang; Chen, Jie; Tsakmaklis, Nickolas; Kanan, Sandra; Castillo, Jorge J; Treon, Steven P

2015-03-01

CXCR4(WHIM) frameshift and nonsense mutations follow MYD88(L265P) as the most common somatic variants in Waldenström Macroglobulinaemia (WM), and impact clinical presentation and ibrutinib response. While the nonsense (CXCR4(S338X) ) mutation has been investigated, little is known about CXCR4 frameshift (CXCR4(FS) ) mutations. We engineered WM cells to express CXCR4(FS) mutations present in patients, and compared their CXCL12 (SDF-1a) induced signalling and ibrutinib sensitivity to CXCR4(wild-type (WT)) and CXCR4(S338X) cells. Following CXCL12 stimulation, CXCR4(FS) and CXCR4(S338X) WM cells showed impaired CXCR4 receptor internalization, and enhanced AKT1 (also termed AKT) and MAPK1 (also termed ERK) activation versus CXCR(WT) cells (P < 0·05), though MAPK1 activation was more prolonged in CXCR4(S338X) cells (P < 0·05). CXCR4(FS) and CXCR4(S338X) cells, but not CXCR4(WT) cells, were rescued from ibrutinib-triggered apoptosis by CXCL12 that was reversed by AKT1, MAPK1 or CXCR4 antagonists. Treatment with an inhibitor that blocks MYD88(L265P) signalling triggered similar levels of apoptosis that was not abrogated by CXCL12 treatment in CXCR4(WT) and CXCR4(WHIM) cells. These studies show a functional role for CXCR4(FS) mutations in WM, and provide a framework for the investigation of CXCR4 antagonists with ibrutinib in CXCR4(WHIM) -mutated WM patients. Direct inhibition of MYD88(L265P) signalling overcomes CXCL12 triggered survival effects in CXCR4(WHIM) -mutated cells supporting a primary role for this survival pathway in WM. © 2014 John Wiley & Sons Ltd.

GATA3 mutation in a family with hypoparathyroidism, deafness and renal dysplasia syndrome.

PubMed

Zhu, Zi-Yang; Zhou, Qiao-Li; Ni, Shi-Ning; Gu, Wei

2014-08-01

The hypoparathyroidism, deafness and renal dysplasia (HDR) syndrome is an autosomal dominant disorder primarily caused by GATA3 gene mutation. We report here a case that both of a Chinese boy and his father had HDR syndrome which caused by a novel mutation of GATA3. Polymerase chain reaction and DNA sequencing was performed to detect the exons of the GATA3 gene for mutation analysis. Sequence analysis of GATA3 revealed a heterozygous nonsense mutation in this family: a mutation of GATA3 at exon 2 (c.515C >A) that resulted in a premature stop at codon 172 (p.S172X) with a loss of two zinc finger domains. We identified a novel nonsense mutation which will expand the spectrum of HDR-associated GATA3 mutations.

Somatic mutations in cancer: Stochastic versus predictable.

PubMed

Gold, Barry

2017-02-01

The origins of human cancers remain unclear except for a limited number of potent environmental mutagens, such as tobacco and UV light, and in rare cases, familial germ line mutations that affect tumor suppressor genes or oncogenes. A significant component of cancer etiology has been deemed stochastic and correlated with the number of stem cells in a tissue, the number of times the stem cells divide and a low incidence of random DNA polymerase errors that occur during each cell division. While somatic mutations occur during each round of DNA replication, mutations in cancer driver genes are not stochastic. Out of a total of 2843 codons, 1031 can be changed to stop codons by a single base substitution in the tumor suppressor APC gene, which is mutated in 76% of colorectal cancers (CRC). However, the nonsense mutations, which comprise 65% of all the APC driver mutations in CRC, are not random: 43% occur at Arg CGA codons, although they represent <3% of the codons. In TP53, CGA codons comprise <3% of the total 393 codons but they account for 72% and 39% of the mutations in CRC and ovarian cancer OVC, respectively. This mutation pattern is consistent with the kinetically slow, but not stochastic, hydrolytic deamination of 5-methylcytosine residues at specific methylated CpG sites to afford T·G mismatches that lead to C→T transitions and stop codons at CGA. Analysis of nonsense mutations in CRC, OVC and a number of other cancers indicates the need to expand the predictable risk factors for cancer to include, in addition to random polymerase errors, the methylation status of gene body CGA codons in tumor suppressor genes. Copyright © 2017. Published by Elsevier B.V.

Translational bypass of nonsense mutations in zebrafish rep1, pax2.1 and lamb1 highlights a viable therapeutic option for untreatable genetic eye disease.

PubMed

Moosajee, Mariya; Gregory-Evans, Kevin; Ellis, Charles D; Seabra, Miguel C; Gregory-Evans, Cheryl Y

2008-12-15

The extensive molecular genetic heterogeneity seen with inherited eye disease is a major barrier to the development of gene-based therapeutics. The underlying molecular pathology in a considerable proportion of these diseases however are nonsense mutations leading to premature termination codons. A therapeutic intervention targeted at this abnormality would therefore potentially be relevant to a wide range of inherited eye diseases. We have taken advantage of the ability of aminoglycoside drugs to suppress such nonsense mutations and partially restore full-length, functional protein in a zebrafish model of choroideraemia (chm(ru848); juvenile chorio-retinal degeneration) and in two models of ocular coloboma (noi(tu29a) and gup(m189); congenital optic fissure closure defects). In vitro cell-based assays showed significant readthrough with two drugs, gentamicin and paromomycin, which was confirmed by western blot and in vitro prenylation assays. The presence of either aminoglycoside during zebrafish development in vivo showed remarkable prevention of mutant ocular phenotypes in each model and a reduction in multisystemic defects leading to a 1.5-1.7-fold increase in survival. We also identified a significant reduction in abnormal cell death shown by TUNEL assay. To test the hypothesis that optic fissure closure was apoptosis-dependent, the anti-apoptotic agents, curcumin and zVAD-fmk, were tested in gup(m189) embryos. Both drugs were found to reduce the size of the coloboma, providing molecular evidence that cell death is required for optic fissure remodelling. These findings draw attention to the value of zebrafish models of eye disease as useful preclinical drug screening tools in studies to identify molecular mechanisms amenable to therapeutic intervention.

Murine knockin model for progranulin-deficient frontotemporal dementia with nonsense-mediated mRNA decay

PubMed Central

Nguyen, Thi A.; Zhang, Jiasheng; Devireddy, Swathi; Zhou, Ping; Karydas, Anna M.; Xu, Xialian; Miller, Bruce L.; Rigo, Frank; Ferguson, Shawn M.; Walther, Tobias C.; Farese, Robert V.

2018-01-01

Frontotemporal dementia (FTD) is the most common neurodegenerative disorder in individuals under age 60 and has no treatment or cure. Because many cases of FTD result from GRN nonsense mutations, an animal model for this type of mutation is highly desirable for understanding pathogenesis and testing therapies. Here, we generated and characterized GrnR493X knockin mice, which model the most common human GRN mutation, a premature stop codon at arginine 493 (R493X). Homozygous GrnR493X mice have markedly reduced Grn mRNA levels, lack detectable progranulin protein, and phenocopy Grn knockout mice, with CNS microgliosis, cytoplasmic TDP-43 accumulation, reduced synaptic density, lipofuscinosis, hyperinflammatory macrophages, excessive grooming behavior, and reduced survival. Inhibition of nonsense-mediated mRNA decay (NMD) by genetic, pharmacological, or antisense oligonucleotide-based approaches showed that NMD contributes to the reduced mRNA levels in GrnR493X mice and cell lines and in fibroblasts from patients containing the GRNR493X mutation. Moreover, the expressed truncated R493X mutant protein was functional in several assays in progranulin-deficient cells. Together, these findings establish a murine model for in vivo testing of NMD inhibition or other therapies as potential approaches for treating progranulin deficiency caused by the R493X mutation. PMID:29511098

Positive selection of a CD36 nonsense variant in sub-Saharan Africa, but no association with severe malaria phenotypes

PubMed Central

Fry, Andrew E.; Ghansa, Anita; Small, Kerrin S.; Palma, Alejandro; Auburn, Sarah; Diakite, Mahamadou; Green, Angela; Campino, Susana; Teo, Yik Y.; Clark, Taane G.; Jeffreys, Anna E.; Wilson, Jonathan; Jallow, Muminatou; Sisay-Joof, Fatou; Pinder, Margaret; Griffiths, Michael J.; Peshu, Norbert; Williams, Thomas N.; Newton, Charles R.; Marsh, Kevin; Molyneux, Malcolm E.; Taylor, Terrie E.; Koram, Kwadwo A.; Oduro, Abraham R.; Rogers, William O.; Rockett, Kirk A.; Sabeti, Pardis C.; Kwiatkowski, Dominic P.

2009-01-01

The prevalence of CD36 deficiency in East Asian and African populations suggests that the causal variants are under selection by severe malaria. Previous analysis of data from the International HapMap Project indicated that a CD36 haplotype bearing a nonsense mutation (T1264G; rs3211938) had undergone recent positive selection in the Yoruba of Nigeria. To investigate the global distribution of this putative selection event, we genotyped T1264G in 3420 individuals from 66 populations. We confirmed the high frequency of 1264G in the Yoruba (26%). However, the 1264G allele is less common in other African populations and absent from all non-African populations without recent African admixture. Using long-range linkage disequilibrium, we studied two West African groups in depth. Evidence for recent positive selection at the locus was demonstrable in the Yoruba, although not in Gambians. We screened 70 variants from across CD36 for an association with severe malaria phenotypes, employing a case–control study of 1350 subjects and a family study of 1288 parent–offspring trios. No marker was significantly associated with severe malaria. We focused on T1264G, genotyping 10 922 samples from four African populations. The nonsense allele was not associated with severe malaria (pooled allelic odds ratio 1.0; 95% confidence interval 0.89–1.12; P = 0.98). These results suggest a range of possible explanations including the existence of alternative selection pressures on CD36, co-evolution between host and parasite or confounding caused by allelic heterogeneity of CD36 deficiency. PMID:19403559

Positive selection of a CD36 nonsense variant in sub-Saharan Africa, but no association with severe malaria phenotypes.

PubMed

Fry, Andrew E; Ghansa, Anita; Small, Kerrin S; Palma, Alejandro; Auburn, Sarah; Diakite, Mahamadou; Green, Angela; Campino, Susana; Teo, Yik Y; Clark, Taane G; Jeffreys, Anna E; Wilson, Jonathan; Jallow, Muminatou; Sisay-Joof, Fatou; Pinder, Margaret; Griffiths, Michael J; Peshu, Norbert; Williams, Thomas N; Newton, Charles R; Marsh, Kevin; Molyneux, Malcolm E; Taylor, Terrie E; Koram, Kwadwo A; Oduro, Abraham R; Rogers, William O; Rockett, Kirk A; Sabeti, Pardis C; Kwiatkowski, Dominic P

2009-07-15

The prevalence of CD36 deficiency in East Asian and African populations suggests that the causal variants are under selection by severe malaria. Previous analysis of data from the International HapMap Project indicated that a CD36 haplotype bearing a nonsense mutation (T1264G; rs3211938) had undergone recent positive selection in the Yoruba of Nigeria. To investigate the global distribution of this putative selection event, we genotyped T1264G in 3420 individuals from 66 populations. We confirmed the high frequency of 1264G in the Yoruba (26%). However, the 1264G allele is less common in other African populations and absent from all non-African populations without recent African admixture. Using long-range linkage disequilibrium, we studied two West African groups in depth. Evidence for recent positive selection at the locus was demonstrable in the Yoruba, although not in Gambians. We screened 70 variants from across CD36 for an association with severe malaria phenotypes, employing a case-control study of 1350 subjects and a family study of 1288 parent-offspring trios. No marker was significantly associated with severe malaria. We focused on T1264G, genotyping 10,922 samples from four African populations. The nonsense allele was not associated with severe malaria (pooled allelic odds ratio 1.0; 95% confidence interval 0.89-1.12; P = 0.98). These results suggest a range of possible explanations including the existence of alternative selection pressures on CD36, co-evolution between host and parasite or confounding caused by allelic heterogeneity of CD36 deficiency.

Biallelic Mutations in GNB3 Cause a Unique Form of Autosomal-Recessive Congenital Stationary Night Blindness

PubMed Central

Vincent, Ajoy; Audo, Isabelle; Tavares, Erika; Maynes, Jason T.; Tumber, Anupreet; Wright, Thomas; Li, Shuning; Michiels, Christelle; Banin, Eyal; Bocquet, Beatrice; De Baere, Elfride; Casteels, Ingele; Defoort-Dhellemmes, Sabine; Drumare, Isabelle; Friedburg, Christoph; Gottlob, Irene; Jacobson, Samuel G.; Kellner, Ulrich; Koenekoop, Robert; Kohl, Susanne; Leroy, Bart P.; Lorenz, Birgit; McLean, Rebecca; Meire, Francoise; Meunier, Isabelle; Munier, Francis; de Ravel, Thomy; Reiff, Charlotte M.; Mohand-Saïd, Saddek; Sharon, Dror; Schorderet, Daniel; Schwartz, Sharon; Zanlonghi, Xavier; Condroyer, Christel; MacDonald, Heather; Verdet, Robert; Sahel, José-Alain; Hamel, Christian P.; Zeitz, Christina; Héon, Elise

2016-01-01

Congenital stationary night blindness (CSNB) is a heterogeneous group of non-progressive inherited retinal disorders with characteristic electroretinogram (ERG) abnormalities. Riggs and Schubert-Bornschein are subtypes of CSNB and demonstrate distinct ERG features. Riggs CSNB demonstrates selective rod photoreceptor dysfunction and occurs due to mutations in genes encoding proteins involved in rod phototransduction cascade; night blindness is the only symptom and eye examination is otherwise normal. Schubert-Bornschein CSNB is a consequence of impaired signal transmission between the photoreceptors and bipolar cells. Schubert-Bornschein CSNB is subdivided into complete CSNB with an ON bipolar signaling defect and incomplete CSNB with both ON and OFF pathway involvement. Both subtypes are associated with variable degrees of night blindness or photophobia, reduced visual acuity, high myopia, and nystagmus. Whole-exome sequencing of a family screened negative for mutations in genes associated with CSNB identified biallelic mutations in the guanine nucleotide-binding protein subunit beta-3 gene (GNB3). Two siblings were compound heterozygous for a deletion (c.170_172delAGA [p.Lys57del]) and a nonsense mutation (c.1017G>A [p.Trp339∗]). The maternal aunt was homozygous for the nonsense mutation (c.1017G>A [p.Trp339∗]). Mutational analysis of GNB3 in a cohort of 58 subjects with CSNB identified a sporadic case individual with a homozygous GNB3 mutation (c.200C>T [p.Ser67Phe]). GNB3 encodes the β subunit of G protein heterotrimer (Gαβγ) and is known to modulate ON bipolar cell signaling and cone transducin function in mice. Affected human subjects showed an unusual CSNB phenotype with variable degrees of ON bipolar dysfunction and reduced cone sensitivity. This unique retinal disorder with dual anomaly in visual processing expands our knowledge about retinal signaling. PMID:27063057

Hereditary fructose intolerance: frequency and spectrum mutations of the aldolase B gene in a large patients cohort from France--identification of eight new mutations.

PubMed

Davit-Spraul, Anne; Costa, Catherine; Zater, Mokhtar; Habes, Dalila; Berthelot, Jacques; Broué, Pierre; Feillet, François; Bernard, Olivier; Labrune, Philippe; Baussan, Christiane

2008-08-01

We investigated the molecular basis of hereditary fructose intolerance (HFI) in 160 patients from 92 families by means of a PCR-based mutation screening strategy, consisting of restriction enzyme digestion and direct sequencing. Sixteen different mutations of the aldolase B (ALDOB) gene were identified in HFI patients. As in previous studies, p.A150P (64%), p.A175D (16%) and p.N335K (5%) were the most common mutated alleles, followed by p.R60X, p.A338V, c.360_363delCAAA (p.N120KfsX30), c.324G>A (p.K108K) and c.625-1G>A. Eight novel mutations were also identified in 10 families with HFI: a one-base deletion (c.146delT (p.V49GfsX27)), a small deletion (c.953del42bp), a small insertion (c.689ins TGCTAA (p.K230MfsX136)), one splice site mutation (c.112+1G>A), one nonsense mutation (c.444G>A (p.W148X)), and three missense mutations (c.170G>C (p.R57P), c.839C>A (p.A280P) and c.932T>C (p.L311P)). Our strategy allows to diagnose 75% of HFI patients using restriction enzymatic analysis and to enlarge the diagnosis to 97% of HFI patients when associated with direct sequencing.

Targeted next-generation sequencing identifies a homozygous nonsense mutation in ABHD12, the gene underlying PHARC, in a family clinically diagnosed with Usher syndrome type 3.

PubMed

Eisenberger, Tobias; Slim, Rima; Mansour, Ahmad; Nauck, Markus; Nürnberg, Gudrun; Nürnberg, Peter; Decker, Christian; Dafinger, Claudia; Ebermann, Inga; Bergmann, Carsten; Bolz, Hanno Jörn

2012-09-02

Usher syndrome (USH) is an autosomal recessive genetically heterogeneous disorder with congenital sensorineural hearing impairment and retinitis pigmentosa (RP). We have identified a consanguineous Lebanese family with two affected members displaying progressive hearing loss, RP and cataracts, therefore clinically diagnosed as USH type 3 (USH3). Our study was aimed at the identification of the causative mutation in this USH3-like family. Candidate loci were identified using genomewide SNP-array-based homozygosity mapping followed by targeted enrichment and next-generation sequencing. Using a capture array targeting the three identified homozygosity-by-descent regions on chromosomes 1q43-q44, 20p13-p12.2 and 20p11.23-q12, we identified a homozygous nonsense mutation, p.Arg65X, in ABHD12 segregating with the phenotype. Mutations of ABHD12, an enzyme hydrolyzing an endocannabinoid lipid transmitter, cause PHARC (polyneuropathy, hearing loss, ataxia, retinitis pigmentosa, and early-onset cataract). After the identification of the ABHD12 mutation in this family, one patient underwent neurological examination which revealed ataxia, but no polyneuropathy. ABHD12 is not known to be related to the USH protein interactome. The phenotype of our patient represents a variant of PHARC, an entity that should be taken into account as differential diagnosis for USH3. Our study demonstrates the potential of comprehensive genetic analysis for improving the clinical diagnosis.

Murine knockin model for progranulin-deficient frontotemporal dementia with nonsense-mediated mRNA decay.

PubMed

Nguyen, Andrew D; Nguyen, Thi A; Zhang, Jiasheng; Devireddy, Swathi; Zhou, Ping; Karydas, Anna M; Xu, Xialian; Miller, Bruce L; Rigo, Frank; Ferguson, Shawn M; Huang, Eric J; Walther, Tobias C; Farese, Robert V

2018-03-20

Frontotemporal dementia (FTD) is the most common neurodegenerative disorder in individuals under age 60 and has no treatment or cure. Because many cases of FTD result from GRN nonsense mutations, an animal model for this type of mutation is highly desirable for understanding pathogenesis and testing therapies. Here, we generated and characterized Grn R493X knockin mice, which model the most common human GRN mutation, a premature stop codon at arginine 493 (R493X). Homozygous Grn R493X mice have markedly reduced Grn mRNA levels, lack detectable progranulin protein, and phenocopy Grn knockout mice, with CNS microgliosis, cytoplasmic TDP-43 accumulation, reduced synaptic density, lipofuscinosis, hyperinflammatory macrophages, excessive grooming behavior, and reduced survival. Inhibition of nonsense-mediated mRNA decay (NMD) by genetic, pharmacological, or antisense oligonucleotide-based approaches showed that NMD contributes to the reduced mRNA levels in Grn R493X mice and cell lines and in fibroblasts from patients containing the GRN R493X mutation. Moreover, the expressed truncated R493X mutant protein was functional in several assays in progranulin-deficient cells. Together, these findings establish a murine model for in vivo testing of NMD inhibition or other therapies as potential approaches for treating progranulin deficiency caused by the R493X mutation. Copyright © 2018 the Author(s). Published by PNAS.

Mutation discovery for Mendelian traits in non-laboratory animals: a review of achievements up to 2012

PubMed Central

Nicholas, Frank W; Hobbs, Matthew

2014-01-01

Within two years of the re-discovery of Mendelism, Bateson and Saunders had described six traits in non-laboratory animals (five in chickens and one in cattle) that show single-locus (Mendelian) inheritance. In the ensuing decades, much progress was made in documenting an ever-increasing number of such traits. In 1987 came the first discovery of a causal mutation for a Mendelian trait in non-laboratory animals: a non-sense mutation in the thyroglobulin gene (TG), causing familial goitre in cattle. In the years that followed, the rate of discovery of causal mutations increased, aided mightily by the creation of genome-wide microsatellite maps in the 1990s and even more mightily by genome assemblies and single-nucleotide polymorphism (SNP) chips in the 2000s. With sequencing costs decreasing rapidly, by 2012 causal mutations were being discovered in non-laboratory animals at a rate of more than one per week. By the end of 2012, the total number of Mendelian traits in non-laboratory animals with known causal mutations had reached 499, which was half the number of published single-locus (Mendelian) traits in those species. The distribution of types of mutations documented in non-laboratory animals is fairly similar to that in humans, with almost half being missense or non-sense mutations. The ratio of missense to non-sense mutations in non-laboratory animals to the end of 2012 was 193:78. The fraction of non-sense mutations (78/271 = 0.29) was not very different from the fraction of non-stop codons that are just one base substitution away from a stop codon (21/61 = 0.34). PMID:24372556

A Novel Nonsense Mutation in the DMP1 Gene Identified by a Genome-Wide Association Study Is Responsible for Inherited Rickets in Corriedale Sheep

PubMed Central

Blair, Hugh T.; Thompson, Keith G.; Rothschild, Max F.; Garrick, Dorian J.

2011-01-01

Inherited rickets of Corriedale sheep is characterized by decreased growth rate, thoracic lordosis and angular limb deformities. Previous outcross and backcross studies implicate inheritance as a simple autosomal recessive disorder. A genome wide association study was conducted using the Illumina OvineSNP50 BeadChip on 20 related sheep comprising 17 affected and 3 carriers. A homozygous region of 125 consecutive single-nucleotide polymorphism (SNP) loci was identified in all affected sheep, covering a region of 6 Mb on ovine chromosome 6. Among 35 candidate genes in this region, the dentin matrix protein 1 gene (DMP1) was sequenced to reveal a nonsense mutation 250C/T on exon 6. This mutation introduced a stop codon (R145X) and could truncate C-terminal amino acids. Genotyping by PCR-RFLP for this mutation showed all 17 affected sheep were “T T” genotypes; the 3 carriers were “C T”; 24 phenotypically normal related sheep were either “C T” or “C C”; and 46 unrelated normal control sheep from other breeds were all “C C”. The other SNPs in DMP1 were not concordant with the disease and can all be ruled out as candidates. Previous research has shown that mutations in the DMP1 gene are responsible for autosomal recessive hypophosphatemic rickets in humans. Dmp1_knockout mice exhibit rickets phenotypes. We believe the R145X mutation to be responsible for the inherited rickets found in Corriedale sheep. A simple diagnostic test can be designed to identify carriers with the defective “T” allele. Affected sheep could be used as animal models for this form of human rickets, and for further investigation of the role of DMP1 in phosphate homeostasis. PMID:21747952

Detection of novel NF1 mutations and rapid mutation prescreening with Pyrosequencing.

PubMed

Brinckmann, Anja; Mischung, Claudia; Bässmann, Ingelore; Kühnisch, Jirko; Schuelke, Markus; Tinschert, Sigrid; Nürnberg, Peter

2007-12-01

Neurofibromatosis type 1 (NF1) is caused by mutations in the neurofibromin (NF1) gene. Mutation analysis of NF1 is complicated by its large size, the lack of mutation hotspots, pseudogenes and frequent de novo mutations. Additionally, the search for NF1 mutations on the mRNA level is often hampered by nonsense-mediated mRNA decay (NMD) of the mutant allele. In this study we searched for mutations in a cohort of 38 patients and investigated the relationship between mutation type and allele-specific transcription from the wild-type versus mutant alleles. Quantification of relative mRNA transcript numbers was done by Pyrosequencing, a novel real-time sequencing method whose signals can be quantified very accurately. We identified 21 novel mutations comprising various mutation types. Pyrosequencing detected a definite relationship between allelic NF1 transcript imbalance due to NMD and mutation type in 24 of 29 patients who all carried frame-shift or nonsense mutations. NMD was absent in 5 patients with missense and silent mutations, as well as in 4 patients with splice-site mutations that did not disrupt the reading frame. Pyrosequencing was capable of detecting NMD even when the effects were only moderate. Diagnostic laboratories could thus exploit this effect for rapid prescreening for NF1 mutations as more than 60% of the mutations in this gene disrupt the reading frame and are prone to NMD.

SLC1A4 mutations cause a novel disorder of intellectual disability, progressive microcephaly, spasticity and thin corpus callosum.

PubMed

Heimer, G; Marek-Yagel, D; Eyal, E; Barel, O; Oz Levi, D; Hoffmann, C; Ruzzo, E K; Ganelin-Cohen, E; Lancet, D; Pras, E; Rechavi, G; Nissenkorn, A; Anikster, Y; Goldstein, D B; Ben Zeev, B

2015-10-01

Two unrelated patients, presenting with significant global developmental delay, severe progressive microcephaly, seizures, spasticity and thin corpus callosum (CC) underwent trio whole-exome sequencing. No candidate variant was found in any known genes related to the phenotype. However, crossing the data of the patients illustrated that they both manifested pathogenic variants in the SLC1A4 gene which codes the ASCT1 transporter of serine and other neutral amino acids. The Ashkenazi patient is homozygous for a deleterious missense c.766G>A, p.(E256K) mutation whereas the Ashkenazi-Iraqi patient is compound heterozygous for this mutation and a nonsense c.945delTT, p.(Leu315Hisfs*42) mutation. Structural prediction demonstrates truncation of significant portion of the protein by the nonsense mutation and speculates functional disruption by the missense mutation. Both mutations are extremely rare in general population databases, however, the missense mutation was found in heterozygous mode in 1:100 Jewish Ashkenazi controls suggesting a higher carrier rate among Ashkenazi Jews. We conclude that SLC1A4 is the disease causing gene of a novel neurologic disorder manifesting with significant intellectual disability, severe postnatal microcephaly, spasticity and thin CC. The role of SLC1A4 in the serine transport from astrocytes to neurons suggests a possible pathomechanism for this disease and implies a potential therapeutic approach. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Missense and nonsense mutations in melanocortin 1 receptor (MC1R) gene of different goat breeds: association with red and black coat colour phenotypes but with unexpected evidences

PubMed Central

2009-01-01

Background Agouti and Extension loci control the relative amount of eumelanin and pheomelanin production in melanocytes that, in turn, affects pigmentation of skin and hair. The Extension locus encodes the melanocortin 1 receptor (MC1R) whose permanent activation, caused by functional mutations, results in black coat colour, whereas other inactivating mutations cause red coat colour in different mammals. Results The whole coding region of the MC1R gene was sequenced in goats of six different breeds showing different coat colours (Girgentana, white cream with usually small red spots in the face; Maltese, white with black cheeks and ears; Derivata di Siria, solid red; Murciano-Granadina, solid black or solid brown; Camosciata delle Alpi, brown with black stripes; Saanen, white; F1 goats and the parental animals). Five single nucleotide polymorphisms (SNPs) were identified: one nonsense mutation (p.Q225X), three missense mutations (p.A81V, p.F250V, and p.C267W), and one silent mutation. The stop codon at position 225 should cause the production of a shorter MC1R protein whose functionality may be altered. These SNPs were investigated in a larger sample of animals belonging to the six breeds. The Girgentana breed was almost fixed for the p.225X allele. However, there was not complete association between the presence of red spots in the face and the presence of this allele in homozygous condition. The same allele was identified in the Derivata di Siria breed. However, its frequency was only 33%, despite the fact that these animals are completely red. The p.267W allele was present in all Murciano-Granadina black goats, whereas it was never identified in the brown ones. Moreover, the same substitution was present in almost all Maltese goats providing evidence of association between this mutation and black coat colour. Conclusion According to the results obtained in the investigated goat breeds, MC1R mutations may determine eumelanic and pheomelanic phenotypes. However

Missense and nonsense mutations in melanocortin 1 receptor (MC1R) gene of different goat breeds: association with red and black coat colour phenotypes but with unexpected evidences.

PubMed

Fontanesi, Luca; Beretti, Francesca; Riggio, Valentina; Dall'Olio, Stefania; González, Elena Gómez; Finocchiaro, Raffaella; Davoli, Roberta; Russo, Vincenzo; Portolano, Baldassare

2009-08-25

Agouti and Extension loci control the relative amount of eumelanin and pheomelanin production in melanocytes that, in turn, affects pigmentation of skin and hair. The Extension locus encodes the melanocortin 1 receptor (MC1R) whose permanent activation, caused by functional mutations, results in black coat colour, whereas other inactivating mutations cause red coat colour in different mammals. The whole coding region of the MC1R gene was sequenced in goats of six different breeds showing different coat colours (Girgentana, white cream with usually small red spots in the face; Maltese, white with black cheeks and ears; Derivata di Siria, solid red; Murciano-Granadina, solid black or solid brown; Camosciata delle Alpi, brown with black stripes; Saanen, white; F1 goats and the parental animals). Five single nucleotide polymorphisms (SNPs) were identified: one nonsense mutation (p.Q225X), three missense mutations (p.A81V, p.F250V, and p.C267W), and one silent mutation. The stop codon at position 225 should cause the production of a shorter MC1R protein whose functionality may be altered. These SNPs were investigated in a larger sample of animals belonging to the six breeds. The Girgentana breed was almost fixed for the p.225X allele. However, there was not complete association between the presence of red spots in the face and the presence of this allele in homozygous condition. The same allele was identified in the Derivata di Siria breed. However, its frequency was only 33%, despite the fact that these animals are completely red. The p.267W allele was present in all Murciano-Granadina black goats, whereas it was never identified in the brown ones. Moreover, the same substitution was present in almost all Maltese goats providing evidence of association between this mutation and black coat colour. According to the results obtained in the investigated goat breeds, MC1R mutations may determine eumelanic and pheomelanic phenotypes. However, they are probably not the only

Targeted next-generation sequencing identifies a homozygous nonsense mutation in ABHD12, the gene underlying PHARC, in a family clinically diagnosed with Usher syndrome type 3

PubMed Central

2012-01-01

Background Usher syndrome (USH) is an autosomal recessive genetically heterogeneous disorder with congenital sensorineural hearing impairment and retinitis pigmentosa (RP). We have identified a consanguineous Lebanese family with two affected members displaying progressive hearing loss, RP and cataracts, therefore clinically diagnosed as USH type 3 (USH3). Our study was aimed at the identification of the causative mutation in this USH3-like family. Methods Candidate loci were identified using genomewide SNP-array-based homozygosity mapping followed by targeted enrichment and next-generation sequencing. Results Using a capture array targeting the three identified homozygosity-by-descent regions on chromosomes 1q43-q44, 20p13-p12.2 and 20p11.23-q12, we identified a homozygous nonsense mutation, p.Arg65X, in ABHD12 segregating with the phenotype. Conclusion Mutations of ABHD12, an enzyme hydrolyzing an endocannabinoid lipid transmitter, cause PHARC (polyneuropathy, hearing loss, ataxia, retinitis pigmentosa, and early-onset cataract). After the identification of the ABHD12 mutation in this family, one patient underwent neurological examination which revealed ataxia, but no polyneuropathy. ABHD12 is not known to be related to the USH protein interactome. The phenotype of our patient represents a variant of PHARC, an entity that should be taken into account as differential diagnosis for USH3. Our study demonstrates the potential of comprehensive genetic analysis for improving the clinical diagnosis. PMID:22938382

Characterization of variegate porphyria mutations using a minigene approach.

PubMed

Granata, Barbara Xoana; Baralle, Marco; De Conti, Laura; Parera, Victoria; Rossetti, Maria Victoria

2015-01-01

Porphyrias are a group of metabolic diseases that affect the skin and/or nervous system. In 2008, three unrelated patients were diagnosed with variegate porphyria at the CIPYP (Centro de Investigaciones sobre Porfirinas y Porfirias). Sequencing of the protoporphyrinogen oxidase gene, the gene altered in this type of porphyria, revealed three previously undescribed mutations: c.338+3insT, c.807G>A, and c.808-1G>C. As these mutations do not affect the protein sequence, we hypothesized that they might be splicing mutations. RT-PCRs performed on the patient's mRNAs showed normal mRNA or no amplification at all. This result indicated that the aberrant spliced transcript is possibly being degraded. In order to establish whether they were responsible or not for the patient's disease by causing aberrant splicing, we utilized a minigene approach. We found that the three mutations lead to exon skipping; therefore, the abnormal mRNAs are most likely degraded by a mechanism such as nonsense-mediated decay. In conclusion, these mutations are responsible for the disease because they alter the normal splicing pathway, thus providing a functional explanation for the appearance of disease and highlighting the use of minigene assays to complement transcript analysis.

Late-onset spastic paraplegia: Aberrant SPG11 transcripts generated by a novel splice site donor mutation.

PubMed

Kawarai, Toshitaka; Miyamoto, Ryosuke; Mori, Atsuko; Oki, Ryosuke; Tsukamoto-Miyashiro, Ai; Matsui, Naoko; Miyazaki, Yoshimichi; Orlacchio, Antonio; Izumi, Yuishin; Nishida, Yoshihiko; Kaji, Ryuji

2015-12-15

We identified a novel homozygous mutation in the splice site donor (SSD) of intron 30 (c.5866+1G>A) in consanguineous Japanese SPG11 siblings showing late-onset spastic paraplegia using the whole-exome sequencing. Phenotypic variability was observed, including age-at-onset, dysarthria and pes cavus. Coding DNA sequencing revealed that the mutation affected the recognition of the constitutive SSD of intron 30, splicing upstream onto a nearby cryptic SSD in exon 30. The use of constitutive splice sites of intron 29 was confirmed by sequencing. The mutant transcripts are mostly subject to degradation by the nonsense-mediated mRNA decay system. SPG11 transcripts, escaping from the nonsense-mediated mRNA decay pathway, would generate a truncated protein (p.Tyr1900Phefs5X) containing the first 1899 amino acids and followed by 4 aberrant amino acids. This study showed a successful clinical application of whole-exome sequencing in spastic paraplegia and demonstrated a further evidence of allelic heterogeneity in SPG11. The confirmation of aberrant transcript by splice site mutation is a prerequisite for a more precise molecular diagnosis. Copyright © 2015 Elsevier B.V. All rights reserved.

FANCA Gene Mutations with 8 Novel Molecular Changes in Indian Fanconi Anemia Patients.

PubMed

Solanki, Avani; Mohanty, Purvi; Shukla, Pallavi; Rao, Anita; Ghosh, Kanjaksha; Vundinti, Babu Rao

2016-01-01

Fanconi anemia (FA), a rare heterogeneous genetic disorder, is known to be associated with 19 genes and a spectrum of clinical features. We studied FANCA molecular changes in 34 unrelated and 2 siblings of Indian patients with FA and have identified 26 different molecular changes of FANCA gene, of which 8 were novel mutations (a small deletion c.2500delC, 4 non-sense mutations c.2182C>T, c.2630C>G, c.3677C>G, c.3189G>A; and 3 missense mutations; c.1273G>C, c.3679 G>C, and c.3992 T>C). Among these only 16 patients could be assigned FA-A complementation group, because we could not confirm single exon deletions detected by MLPA or cDNA amplification by secondary confirmation method and due to presence of heterozygous non-pathogenic variations or heterozygous pathogenic mutations. An effective molecular screening strategy should be developed for confirmation of these mutations and determining the breakpoints for single exon deletions.

FANCA Gene Mutations with 8 Novel Molecular Changes in Indian Fanconi Anemia Patients

PubMed Central

Solanki, Avani; Mohanty, Purvi; Shukla, Pallavi; Rao, Anita; Ghosh, Kanjaksha; Vundinti, Babu Rao

2016-01-01

Fanconi anemia (FA), a rare heterogeneous genetic disorder, is known to be associated with 19 genes and a spectrum of clinical features. We studied FANCA molecular changes in 34 unrelated and 2 siblings of Indian patients with FA and have identified 26 different molecular changes of FANCA gene, of which 8 were novel mutations (a small deletion c.2500delC, 4 non-sense mutations c.2182C>T, c.2630C>G, c.3677C>G, c.3189G>A; and 3 missense mutations; c.1273G>C, c.3679 G>C, and c.3992 T>C). Among these only 16 patients could be assigned FA-A complementation group, because we could not confirm single exon deletions detected by MLPA or cDNA amplification by secondary confirmation method and due to presence of heterozygous non-pathogenic variations or heterozygous pathogenic mutations. An effective molecular screening strategy should be developed for confirmation of these mutations and determining the breakpoints for single exon deletions. PMID:26799702

Compound heterozygous HAX1 mutations in a Swedish patient with severe congenital neutropenia and no neurodevelopmental abnormalities.

PubMed

Carlsson, Göran; Elinder, Göran; Malmgren, Helena; Trebinska, Alicja; Grzybowska, Ewa; Dahl, Niklas; Nordenskjöld, Magnus; Fadeel, Bengt

2009-12-01

Kostmann disease or severe congenital neutropenia (SCN) is an autosomal recessive disorder of neutrophil production. Homozygous HAX1 mutations were recently identified in SCN patients belonging to the original family in northern Sweden described by Kostmann. Moreover, recent studies have suggested an association between neurological dysfunction and HAX1 deficiency. Here we describe a patient with a compound heterozygous HAX1 mutation consisting of a nonsense mutation (c.568C > T, p.Glu190X) and a frame-shift mutation (c.91delG, p.Glu31LysfsX54) resulting in a premature stop codon. The patient has a history of neutropenia and a propensity for infections, but has shown no signs of neurodevelopmental abnormalities.

Four novel RS1 gene mutations in Polish patients with X-linked juvenile retinoschisis.

PubMed

Skorczyk, Anna; Krawczyński, Maciej R

2012-01-01

To determine the clinical features and to identify mutations in the retinoschisis gene (RS1) in ten patients with X-linked retinoschisis (XLRS). Ten male patients from nine Polish families were included in this study. Ophthalmologic examinations, including optical coherence tomography (OCT) and full-field electroretinography (ERG), were performed in all affected boys. The entire coding region encompassing six exons of the RS1 gene was amplified with PCR and directly sequenced in all the patients. All affected individuals showed typical retinoschisis signs and symptoms, and all appeared to have a mutation in the RS1 gene. Seven different mutations were identified, including two novel missense substitutions: c.176G>C (p.Cys59Ser), c.451T>A (p.Tyr151Asp); one novel nonsense substitution: c.218C>A (p.Ser73*); and one novel frameshift mutation: c.354_355delCA (p.Asp118Glufs*2). We also found two missense substitutions that had been previously described: c.214G>A (p.Glu72Lys) and c.626G>T (p.Arg209Leu) and one known splice site mutation in intron 5: c.522+1G>T (IVS5+1G>T). This study provides the first molecular genetic characteristics of patients with juvenile retinoschisis from the previously unexplored Polish population. We investigated the molecular background of XLRS in ten boys. The present study reports for the first time four novel mutations, including two missense substitutions, one nonsense substitution, and one frameshift deletion. One of these substitutions and 2-bp deletion created stop codons. Moreover, we described three substitutions that had been previously reported (one is a splicing mutation). Further genetic characterization of Polish patients with XLRS will be helpful in understanding the worldwide spectrum of RS1 mutations. Despite the mutation heterogeneity found in a small group of our patients, they presented a relatively uniform clinical picture. Identifying the causative mutation is helpful in confirming diagnosis and counseling, but cannot

Four novel RS1 gene mutations in Polish patients with X-linked juvenile retinoschisis

PubMed Central

Skorczyk, Anna

2012-01-01

Purpose To determine the clinical features and to identify mutations in the retinoschisis gene (RS1) in ten patients with X-linked retinoschisis (XLRS). Methods Ten male patients from nine Polish families were included in this study. Ophthalmologic examinations, including optical coherence tomography (OCT) and full-field electroretinography (ERG), were performed in all affected boys. The entire coding region encompassing six exons of the RS1 gene was amplified with PCR and directly sequenced in all the patients. Results All affected individuals showed typical retinoschisis signs and symptoms, and all appeared to have a mutation in the RS1 gene. Seven different mutations were identified, including two novel missense substitutions: c.176G>C (p.Cys59Ser), c.451T>A (p.Tyr151Asp); one novel nonsense substitution: c.218C>A (p.Ser73*); and one novel frameshift mutation: c.354_355delCA (p.Asp118Glufs*2). We also found two missense substitutions that had been previously described: c.214G>A (p.Glu72Lys) and c.626G>T (p.Arg209Leu) and one known splice site mutation in intron 5: c.522+1G>T (IVS5+1G>T). Conclusions This study provides the first molecular genetic characteristics of patients with juvenile retinoschisis from the previously unexplored Polish population. We investigated the molecular background of XLRS in ten boys. The present study reports for the first time four novel mutations, including two missense substitutions, one nonsense substitution, and one frameshift deletion. One of these substitutions and 2-bp deletion created stop codons. Moreover, we described three substitutions that had been previously reported (one is a splicing mutation). Further genetic characterization of Polish patients with XLRS will be helpful in understanding the worldwide spectrum of RS1 mutations. Despite the mutation heterogeneity found in a small group of our patients, they presented a relatively uniform clinical picture. Identifying the causative mutation is helpful in confirming

Identification of a nonsense mutation in the granulocyte-colony-stimulating factor receptor in severe congenital neutropenia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dong, F.; Loewenberg, B.; Hoefsloot, L.H.

Severe congenital neutropenia (Kostmann syndrome) is characterized by profound absolute neutropenia and a maturation arrest of marrow progenitor cells at the promyelocyte-myelocyte stage. Marrow cells from such patients frequently display a reduced responsiveness to granulocyte-colony-stimulating factor (G-CSF). G-CSF binds to and activates a specific receptor which transduces signals critical for the proliferation and maturation of granulocytic progenitor cells. Here the authors report the identification of a somatic point mutation in one allele of the G-CSF receptor gene in a patient with severe congenital neutropenia. The mutation results in a cytoplasmic truncation of the receptor. When expressed in murine myeloid cells,more » the mutant receptor transduced a strong growth signal but, in contrast to the wild-type G-CSF receptor, was defective in maturation induction. This mutant receptor chain may act in a dominant negative manner to block granulocytic maturation. 40 refs., figs., 2 tabs.« less

Novel compound heterozygous mutations in MYO7A Associated with Usher syndrome 1 in a Chinese family.

PubMed

Gao, Xue; Wang, Guo-Jian; Yuan, Yong-Yi; Xin, Feng; Han, Ming-Yu; Lu, Jing-Qiao; Zhao, Hui; Yu, Fei; Xu, Jin-Cao; Zhang, Mei-Guang; Dong, Jiang; Lin, Xi; Dai, Pu

2014-01-01

Usher syndrome is an autosomal recessive disease characterized by sensorineural hearing loss, age-dependent retinitis pigmentosa (RP), and occasionally vestibular dysfunction. The most severe form is Usher syndrome type 1 (USH1). Mutations in the MYO7A gene are responsible for USH1 and account for 29-55% of USH1 cases. Here, we characterized a Chinese family (no. 7162) with USH1. Combining the targeted capture of 131 known deafness genes, next-generation sequencing, and bioinformatic analysis, we identified two deleterious compound heterozygous mutations in the MYO7A gene: a reported missense mutation c.73G>A (p.G25R) and a novel nonsense mutation c.462C>A (p.C154X). The two compound variants are absent in 219 ethnicity-matched controls, co-segregates with the USH clinical phenotypes, including hearing loss, vestibular dysfunction, and age-dependent penetrance of progressive RP, in family 7162. Therefore, we concluded that the USH1 in this family was caused by compound heterozygous mutations in MYO7A.

Discovery of a Kiloparsec Extended Hard X-Ray Continuum and Fe-Kα from the Compton Thick AGN ESO 428-G014

NASA Astrophysics Data System (ADS)

Fabbiano, G.; Elvis, M.; Paggi, A.; Karovska, M.; Maksym, W. P.; Raymond, J.; Risaliti, G.; Wang, Junfeng

2017-06-01

We report the discovery of kiloparsec-scale diffuse emission in both the hard continuum (3-6 keV) and in the Fe-Kα line in the Compton thick (CT) Seyfert galaxy ESO 428-G014. This extended hard component contains at least ˜24% of the observed 3-8 keV emission, and follows the direction of the extended optical line emission (ionization cone) and radio jet. The extended hard component has ˜0.5% of the intrinsic 2-10 keV luminosity within the bi-cones. A uniform scattering medium of density 1 {{cm}}-3 would produce this luminosity in a 1 kpc path length in the bi-cones. Alternatively, higher column density molecular clouds in the disk of ESO 428-G014 may be responsible for these components. The continuum may also be enhanced by the acceleration of charged particles in the radio jet. The steeper spectrum (Γ ˜ 1.7 ± 0.4) of the hard continuum outside of the central 1.″5 radius nuclear region suggests a contribution of scattered/fluorescent intrinsic Seyfert emission. Ultrafast nuclear outflows cannot explain the extended Fe-Kα emission. This discovery suggests that we may need to revise the picture at the base of our interpretation of CT AGN spectra.

A non-sense mutation in the putative anti-mutator gene ada/alkA of Mycobacterium tuberculosis and M. bovis isolates suggests convergent evolution

PubMed Central

Nouvel, Laurent X; Vultos, Tiago Dos; Kassa-Kelembho, Eric; Rauzier, Jean; Gicquel, Brigitte

2007-01-01

Background Previous studies have suggested that variations in DNA repair genes of W-Beijing strains may have led to transient mutator phenotypes which in turn may have contributed to host adaptation of this strain family. Single nucleotide polymorphism (SNP) in the DNA repair gene mutT1 was identified in MDR-prone strains from the Central African Republic. A Mycobacteriumtuberculosis H37Rv mutant inactivated in two DNA repair genes, namely ada/alkA and ogt, was shown to display a hypermutator phenotype. We then looked for polymorphisms in these genes in Central African Republic strains (CAR). Results In this study, 55 MDR and 194 non-MDR strains were analyzed. Variations in DNA repair genes ada/alkA and ogt were identified. Among them, by comparison to M. tuberculosis published sequences, we found a non-sense variation in ada/alkA gene which was also observed in M. bovis AF2122 strain. SNPs that are present in the adjacent regions to the amber variation are different in M. bovis and in M. tuberculosis strain. Conclusion An Amber codon was found in the ada/alkA locus of clustered M. tuberculosis isolates and in M. bovis strain AF2122. This is likely due to convergent evolution because SNP differences between strains are incompatible with horizontal transfer of an entire gene. This suggests that such a variation may confer a selective advantage and be implicated in hypermutator phenotype expression, which in turn contributes to adaptation to environmental changes. PMID:17506895

Early Clinical Diagnosis of PC1/3 Deficiency in a Patient With a Novel Homozygous PCSK1 Splice-Site Mutation.

PubMed

Härter, Bettina; Fuchs, Irene; Müller, Thomas; Akbulut, Ulas Emre; Cakir, Murat; Janecke, Andreas R

2016-04-01

Autosomal recessive proprotein convertase 1/3 (PC1/3) deficiency, caused by mutations in the PCSK1 gene, is characterized by severe congenital malabsorptive diarrhea, early-onset obesity, and certain endocrine abnormalities. We suspected PC1/3 deficiency in a 4-month-old girl based on the presence of congenital diarrhea and polyuria. Sequencing the whole coding region and splice sites detected a novel homozygous PCSK1 splice-site mutation, c.544-2A>G, in the patient. The mutation resulted in the skipping of exon 5, the generation of a premature termination codon, and nonsense-mediated PCSK1 messenger ribonucleic acid decay, which was demonstrated in complementary DNA derived from fibroblasts.

Adult onset Leigh syndrome with mitochondrial DNA 8344 A>G mutation.

PubMed

Han, Jee-Young; Sung, Jung-Joon; Park, Hong-Kyun; Yoon, Byung-Nam; Lee, Kwang-Woo

2014-11-01

We report a pedigree of adult-onset Leigh syndrome (LS) with mitochondrial mutation 8344 A>G. A 38-year-old woman presented with optic neuropathy, weakness and cognitive impairment. Family history of optic neuropathy and systemic involvement was suggestive of mitochondrial encephalopathy. Genetic and radiologic studies showed m.8344 A>G mutation with characteristics of LS. To our knowledge this is the first case of adult-onset LS demonstrating the m.8344 A>G mutation. Copyright © 2014 Elsevier Ltd. All rights reserved.

FERMT1 promoter mutations in patients with Kindler syndrome.

PubMed

Has, C; Chmel, N; Levati, L; Neri, I; Sonnenwald, T; Pigors, M; Godbole, K; Dudhbhate, A; Bruckner-Tuderman, L; Zambruno, G; Castiglia, D

2015-09-01

Mutations in the FERMT1 gene, encoding the focal adhesion protein kindlin-1 underlie the Kindler syndrome (KS), an autosomal recessive skin disorder with a phenotype comprising skin blistering, photosensitivity, progressive poikiloderma with extensive skin atrophy, and propensity to skin cancer. The FERMT1 mutational spectrum comprises gross genomic deletions, splice site, nonsense, and frameshift mutations, which are scattered over the coding region spanning exon 2-15. We now report three KS families with mutations affecting the promoter region of FERMT1. Two of these mutations are large deletions (∼38.0 and 1.9 kb in size) and one is a single nucleotide variant (c.-20A>G) within the 5' untranslated region (UTR). Each mutation resulted in loss of gene expression in patient skin or cultured keratinocytes. Reporter assays showed the functional relevance of the genomic regions deleted in our patients for FERMT1 gene transcription and proved the causal role of the c.-20A>G variant in reducing transcriptional activity. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Nonsense-mediated mRNA decay: inter-individual variability and human disease

PubMed Central

Nguyen, Lam Son; Wilkinson, Miles; Gecz, Jozef

2013-01-01

Nonsense-Mediated mRNA Decay (NMD) is a regulatory pathway that functions to degrade transcripts containing premature termination codons (PTCs) and to maintain normal transcriptome homeostasis. Nonsense and frameshift mutations that generate PTCs cause approximately one-third of all known human genetic diseases and thus NMD has a potentially important role in human disease. In genetic disorders in which the affected genes carry PTC-generating mutations, NMD acts as a double-edge sword. While it can benefit the patient by degrading PTC-containing mRNAs that encode detrimental, dominant-negative truncated proteins, it can also make the disease worse when a PTC-containing mRNA is degraded that encodes a mutant but still functional protein. There is evidence that the magnitude of NMD varies between individuals, which, in turn, has been shown to correlate with both clinical presentations and the patients’ responses to drugs that promote read-through of PTCs. In this review, we examine the evidence supporting the existence of inter-individual variability in NMD efficiency and discuss the genetic factors that underlie this variability. We propose that inter-individual variability in NMD efficiency is a common phenomenon in human populations and that an individual’s NMD efficiency should be taken into consideration when testing, developing, and making therapeutic decisions for diseases caused by genes harboring PTCs. PMID:24239855

Carnitine-acylcarnitine translocase deficiency with c.199-10 T>G and novel c.1A>G mutation

PubMed Central

Yan, Hui-ming; Hu, Hao; Ahmed, Aisha; Feng, Bing-bing; Liu, Jing; Jia, Zheng-jun; Wang, Hua

2017-01-01

Abstract Rationale: Carnitine-acylcarnitine translocate deficiency (CACTD) is a rare and life-threatening, autosomal recessive disorder of fatty acid β-oxidation characterized by hypoketotic hypoglycemia, hyperammonemia, cardiomyopathy, liver dysfunction, and muscle weakness; culminating in early death. To date, CACTD cases screened from the Chinese mainland population, especially patient with compound heterozygote with c.199-10T>G and a novel c.1A>G mutation in the SLC25A20 gene has never been described. Patient concerns: Herein, we report 2 neonatal cases of CACTD identified from the mainland China. These 2 patients were presented with severe metabolic crisis and their clinical conditions deteriorate rapidly and both died of cardiorespiratory collapse in the first week of life. We present the clinical and biochemical features of 2 probands and a brief literature review of previously reported CACTD cases with the c.199-10T>G mutation. Diagnoses: The acylcarnitine profiles by tandem-mass-spectrometry and the mutation analysis of SLC25A20 gene confirmed the diagnosis of CACTD in both patients. Mutation analysis demonstrated that patient No. 1 was homozygous for c.199-10T>G mutation, while patient No. 2 was a compound heterozygote for 2 mutations, a maternally-inherited c.199-10T>G and a paternally-inherited, novel c.1A>G mutation. Interventions: Both patients were treated with an aggressive treatment regimen include high glucose and arginine infusion, respiratory, and circulatory support. Outcomes: The first proband died 3 days after delivery due to sudden cardiac arrest. The second patient's clinical condition, at one time, was improved by high glucose infusion, intravenous arginine, and circulatory support. However, the patient failed to wean from mechanical ventilation. Unfortunately, her parents refused further treatment due to fear of financial burdens. The patient died of congestive heart failure in the 6th day of life. Lessons: We report the first 2 cases of

Genome-first approach diagnosed Cabezas syndrome via novel CUL4B mutation detection.

PubMed

Okamoto, Nobuhiko; Watanabe, Miki; Naruto, Takuya; Matsuda, Keiko; Kohmoto, Tomohiro; Saito, Masako; Masuda, Kiyoshi; Imoto, Issei

2017-01-01

Cabezas syndrome is a syndromic form of X-linked intellectual disability primarily characterized by a short stature, hypogonadism and abnormal gait, with other variable features resulting from mutations in the CUL4B gene. Here, we report a clinically undiagnosed 5-year-old male with severe intellectual disability. A genome-first approach using targeted exome sequencing identified a novel nonsense mutation [NM_003588.3:c.2698G>T, p.(Glu900*)] in the last coding exon of CUL4B , thus diagnosing this patient with Cabezas syndrome.

Analysis of Hungarian patients with Rett syndrome phenotype for MECP2, CDKL5 and FOXG1 gene mutations.

PubMed

Hadzsiev, Kinga; Polgar, Noemi; Bene, Judit; Komlosi, Katalin; Karteszi, Judit; Hollody, Katalin; Kosztolanyi, Gyorgy; Renieri, Alessandra; Melegh, Bela

2011-03-01

Rett syndrome (RTT) is characterized by a relatively specific clinical phenotype. We screened 152 individuals with RTT phenotype. A total of 22 different known MECP2 mutations were identified in 42 subjects (27.6%). Of the 22 mutations, we identified 7 (31.8%) frameshift-causing deletions, 4 (18.2%) nonsense, 10 (45.5%) missense mutations and one insertion (4.5%). The most frequent pathologic changes were: p.Thr158Met (14.2%) and p.Arg133Cys (11.9%) missense, and p.Arg255Stop (9.5%) and p.Arg294Stop (9.5%) nonsense mutations. We also detected the c.925C >T (p.Arg309Trp) mutation in an affected patient, whose role in RTT pathogenesis is still unknown. Patients without detectable MECP2 defects were screened for mutations of cyclin-dependent kinase-like 5 (CDKL5) gene, responsible for the early-onset variant of RTT. We discovered two novel mutations: c.607G >T resulting in a termination codon at aa203, disrupting the catalytic domain, and c.1708G >T leading to a stop at aa570 of the C terminus. Both patients with CDKL5 mutation presented therapy-resistant epilepsy and a phenotype fitting with the diagnosis of early-onset variant of RTT. No FOXG1 mutation was detected in any of the remaining patients. A total of 110 (72.5%) patients remained without molecular genetic diagnosis that necessitates further search for novel gene mutations in this phenotype. Our results also suggest the need of screening for CDKL5 mutations in patients with Rett phenotype tested negative for MECP2 mutations.

Whole exome sequencing identifies a homozygous nonsense variation in ALMS1 gene in a patient with syndromic obesity.

PubMed

Das Bhowmik, Aneek; Gupta, Neerja; Dalal, Ashwin; Kabra, Madhulika

In the present study we report on genetic analysis in a patient with developmental delay, truncal obesity and vision problem, to find the causative mutation. Whole exome sequencing was performed on genomic DNA extracted from whole blood of the patient which revealed a homozygous nonsense variant (c.2816T>A) in exon 8 of ALMS1 gene that results in a stop codon and premature truncation at codon 939 (p.L939Ter) of the protein. The mutation was confirmed by Sanger sequencing. Exome sequencing was helpful in establishing diagnosis of Alstrom syndrome in this patient. This case highlights the utility of exome sequencing in clinical practice. Copyright © 2016 Asia Oceania Association for the Study of Obesity. Published by Elsevier Ltd. All rights reserved.

Genetic Mutations in Cancer

Cancer.gov

Many different types of genetic mutations are found in cancer cells. This infographic outlines certain types of alterations that are present in cancer, such as missense, nonsense, frameshift, and chromosome rearrangements.

Genome-first approach diagnosed Cabezas syndrome via novel CUL4B mutation detection

PubMed Central

Okamoto, Nobuhiko; Watanabe, Miki; Naruto, Takuya; Matsuda, Keiko; Kohmoto, Tomohiro; Saito, Masako; Masuda, Kiyoshi; Imoto, Issei

2017-01-01

Cabezas syndrome is a syndromic form of X-linked intellectual disability primarily characterized by a short stature, hypogonadism and abnormal gait, with other variable features resulting from mutations in the CUL4B gene. Here, we report a clinically undiagnosed 5-year-old male with severe intellectual disability. A genome-first approach using targeted exome sequencing identified a novel nonsense mutation [NM_003588.3:c.2698G>T, p.(Glu900*)] in the last coding exon of CUL4B, thus diagnosing this patient with Cabezas syndrome. PMID:28144446

Identification of two novel pathogenic compound heterozygous MYO7A mutations in Usher syndrome by whole exome sequencing.

PubMed

Jia, Ying; Li, Xiaoge; Yang, Dong; Xu, Yi; Guo, Ying; Li, Xin

2018-01-01

The current study aims to identify the pathogenic sites in a core pedigree of Usher syndrome (USH). A core pedigree of USH was analyzed by whole exome sequencing (WES). Mutations were verified by polymerase chain reaction (PCR) amplification and Sanger sequencing. Two pathogenic variations (c.849+2T>C and c.5994G>A) in MYO7A were successfully identified and individually separated from parents. One variant (c.849+2T>C) was nonsense mutation, causing the protein terminated in advance, and the other one (c.5994G>A) located near the boundary of exon could cause aberrant splicing. This study provides a meaningful exploration for identification of clinical core genetic pedigrees. Copyright © 2017 Elsevier B.V. All rights reserved.

Rare Autosomal Recessive Cardiac Valvular Form of Ehlers-Danlos Syndrome Results from Mutations in the COL1A2 Gene That Activate the Nonsense-Mediated RNA Decay Pathway

PubMed Central

Schwarze, Ulrike; Hata, Ryu-Ichiro; McKusick, Victor A.; Shinkai, Hiroshi; Hoyme, H. Eugene; Pyeritz, Reed E.; Byers, Peter H.

2004-01-01

Splice site mutations in the COL1A2 gene of type I collagen can give rise to forms of Ehlers-Danlos syndrome (EDS) because of partial or complete skipping of exon 6, as well as to mild, moderate, or lethal forms of osteogenesis imperfecta as a consequence of skipping of other exons. We identified three unrelated individuals with a rare recessively inherited form of EDS (characterized by joint hypermobility, skin hyperextensibility, and cardiac valvular defects); in two of them, COL1A2 messenger RNA (mRNA) instability results from compound heterozygosity for splice site mutations in the COL1A2 gene, and, in the third, it results from homozygosity for a nonsense codon. The splice site mutations led to use of cryptic splice donor sites, creation of a downstream premature termination codon, and extremely unstable mRNA. In the wild-type allele, the two introns (IVS11 and IVS24) in which these mutations occurred were usually spliced slowly in relation to their respective immediate upstream introns. In the mutant alleles, the upstream intron was removed, so that exon skipping could not occur. In the context of the mutation in IVS24, computer-generated folding of a short stretch of mRNA surrounding the mutation site demonstrated realignment of the relationships between the donor and acceptor sites that could facilitate use of a cryptic donor site. These findings suggest that the order of intron removal is an important variable in prediction of mutation outcome at splice sites and that folding of the nascent mRNA could be one element that contributes to determination of order of splicing. The complete absence of proα2(I) chains has the surprising effect of producing cardiac valvular disease without bone involvement. PMID:15077201

Rare autosomal recessive cardiac valvular form of Ehlers-Danlos syndrome results from mutations in the COL1A2 gene that activate the nonsense-mediated RNA decay pathway.

PubMed

Schwarze, Ulrike; Hata, Ryu-Ichiro; McKusick, Victor A; Shinkai, Hiroshi; Hoyme, H Eugene; Pyeritz, Reed E; Byers, Peter H

2004-05-01

Splice site mutations in the COL1A2 gene of type I collagen can give rise to forms of Ehlers-Danlos syndrome (EDS) because of partial or complete skipping of exon 6, as well as to mild, moderate, or lethal forms of osteogenesis imperfecta as a consequence of skipping of other exons. We identified three unrelated individuals with a rare recessively inherited form of EDS (characterized by joint hypermobility, skin hyperextensibility, and cardiac valvular defects); in two of them, COL1A2 messenger RNA (mRNA) instability results from compound heterozygosity for splice site mutations in the COL1A2 gene, and, in the third, it results from homozygosity for a nonsense codon. The splice site mutations led to use of cryptic splice donor sites, creation of a downstream premature termination codon, and extremely unstable mRNA. In the wild-type allele, the two introns (IVS11 and IVS24) in which these mutations occurred were usually spliced slowly in relation to their respective immediate upstream introns. In the mutant alleles, the upstream intron was removed, so that exon skipping could not occur. In the context of the mutation in IVS24, computer-generated folding of a short stretch of mRNA surrounding the mutation site demonstrated realignment of the relationships between the donor and acceptor sites that could facilitate use of a cryptic donor site. These findings suggest that the order of intron removal is an important variable in prediction of mutation outcome at splice sites and that folding of the nascent mRNA could be one element that contributes to determination of order of splicing. The complete absence of pro alpha 2(I) chains has the surprising effect of producing cardiac valvular disease without bone involvement.

G20210A prothrombin gene mutation identified in patients with venous leg ulcers.

PubMed

Jebeleanu, G; Procopciuc, L

2001-01-01

The G20210A mutation variant of prothrombin gene is the second most frequent mutation identified in patients with deep venous thrombosis, after factor V Leiden. The risk for developing deep venous thrombosis is high in patients identified as heterozygous for G20210A mutation. In order to identify this polymorphism in the gene coding prothrombin, the 345bp fragment in the 3'- untranslated region of the prothrombin gene was amplified using amplification by polymerase chain reaction and enzymatic digestion by HindIII (restriction endonuclease enzyme). The products of amplification and enzymatic's digestion were analized using agarose gel electrophoresis. We investigated 20 patients with venous leg ulcers and we found 2 heterozygous (10%) for G20210A mutation. None of the patients in the control group had G20210A mutation. Our study confirms the presence of G20210A mutation in the Romanian population. Our study also shows the link between venous leg ulcers and this polymorphism in the prothrombin gene.

40 CFR 428.114 - [Reserved

Code of Federal Regulations, 2010 CFR

2010-07-01

... 40 Protection of Environment 29 2010-07-01 2010-07-01 false [Reserved] 428.114 Section 428.114 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS RUBBER MANUFACTURING POINT SOURCE CATEGORY Latex Foam Subcategory § 428.114 [Reserved] ...

40 CFR 428.114 - [Reserved

Code of Federal Regulations, 2011 CFR

2011-07-01

... 40 Protection of Environment 30 2011-07-01 2011-07-01 false [Reserved] 428.114 Section 428.114 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS RUBBER MANUFACTURING POINT SOURCE CATEGORY Latex Foam Subcategory § 428.114 [Reserved] ...

48 CFR 428.106 - Administration.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Administration. 428.106 Section 428.106 Federal Acquisition Regulations System DEPARTMENT OF AGRICULTURE GENERAL CONTRACTING REQUIREMENTS BONDS AND INSURANCE Bonds and Other Financial Protections 428.106 Administration. ...

48 CFR 428.106 - Administration.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 48 Federal Acquisition Regulations System 4 2012-10-01 2012-10-01 false Administration. 428.106 Section 428.106 Federal Acquisition Regulations System DEPARTMENT OF AGRICULTURE GENERAL CONTRACTING REQUIREMENTS BONDS AND INSURANCE Bonds and Other Financial Protections 428.106 Administration. ...

48 CFR 428.106 - Administration.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 48 Federal Acquisition Regulations System 4 2013-10-01 2013-10-01 false Administration. 428.106 Section 428.106 Federal Acquisition Regulations System DEPARTMENT OF AGRICULTURE GENERAL CONTRACTING REQUIREMENTS BONDS AND INSURANCE Bonds and Other Financial Protections 428.106 Administration. ...

48 CFR 428.106 - Administration.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 48 Federal Acquisition Regulations System 4 2014-10-01 2014-10-01 false Administration. 428.106 Section 428.106 Federal Acquisition Regulations System DEPARTMENT OF AGRICULTURE GENERAL CONTRACTING REQUIREMENTS BONDS AND INSURANCE Bonds and Other Financial Protections 428.106 Administration. ...

48 CFR 428.106 - Administration.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 48 Federal Acquisition Regulations System 4 2011-10-01 2011-10-01 false Administration. 428.106 Section 428.106 Federal Acquisition Regulations System DEPARTMENT OF AGRICULTURE GENERAL CONTRACTING REQUIREMENTS BONDS AND INSURANCE Bonds and Other Financial Protections 428.106 Administration. ...

Mutations in POLR3A and POLR3B Encoding RNA Polymerase III Subunits Cause an Autosomal-Recessive Hypomyelinating Leukoencephalopathy

PubMed Central

Saitsu, Hirotomo; Osaka, Hitoshi; Sasaki, Masayuki; Takanashi, Jun-ichi; Hamada, Keisuke; Yamashita, Akio; Shibayama, Hidehiro; Shiina, Masaaki; Kondo, Yukiko; Nishiyama, Kiyomi; Tsurusaki, Yoshinori; Miyake, Noriko; Doi, Hiroshi; Ogata, Kazuhiro; Inoue, Ken; Matsumoto, Naomichi

2011-01-01

Congenital hypomyelinating disorders are a heterogeneous group of inherited leukoencephalopathies characterized by abnormal myelin formation. We have recently reported a hypomyelinating syndrome characterized by diffuse cerebral hypomyelination with cerebellar atrophy and hypoplasia of the corpus callosum (HCAHC). We performed whole-exome sequencing of three unrelated individuals with HCAHC and identified compound heterozygous mutations in POLR3B in two individuals. The mutations include a nonsense mutation, a splice-site mutation, and two missense mutations at evolutionally conserved amino acids. Using reverse transcription-PCR and sequencing, we demonstrated that the splice-site mutation caused deletion of exon 18 from POLR3B mRNA and that the transcript harboring the nonsense mutation underwent nonsense-mediated mRNA decay. We also identified compound heterozygous missense mutations in POLR3A in the remaining individual. POLR3A and POLR3B encode the largest and second largest subunits of RNA Polymerase III (Pol III), RPC1 and RPC2, respectively. RPC1 and RPC2 together form the active center of the polymerase and contribute to the catalytic activity of the polymerase. Pol III is involved in the transcription of small noncoding RNAs, such as 5S ribosomal RNA and all transfer RNAs (tRNA). We hypothesize that perturbation of Pol III target transcription, especially of tRNAs, could be a common pathological mechanism underlying POLR3A and POLR3B mutations. PMID:22036171

XPC gene mutations in families with xeroderma pigmentosum from Pakistan; prevalent founder effect.

PubMed

Ijaz, Ambreen; Basit, Sulman; Gul, Ajab; Batool, Lilas; Hussain, Abrar; Afzal, Sibtain; Ramzan, Khushnooda; Ahmad, Jamil; Wali, Abdul

2018-03-23

Xeroderma pigmentosum (XP) is a rare autosomal recessive skin disorder characterized by hyperpigmentation, premature skin aging, ocular and cutaneous photosensitivity, and increased risk of skin carcinoma. We investigated seven consanguineous XP families with nine patients from Pakistan. All the Patients exhibited typical clinical symptoms of XP since first year of life. Whole genome SNP genotyping identified a 14 Mb autozygous region segregating with the disease phenotype on chromosome 3p25.1. DNA sequencing of XPC gene revealed a founder homozygous splice site mutation (c.2251-1G>C) in patients from six families (A-F) and a homozygous nonsense mutation (c.1399C>T; p.Gln467*) in patients of family G. This is the first report of XPC mutations, underlying XP phenotype, in Pakistani population. © 2018 Japanese Teratology Society.

Genome-wide SNP scan of pooled DNA reveals nonsense mutation in FGF20 in the scaleless line of featherless chickens

PubMed Central

2012-01-01

Background Scaleless (sc/sc) chickens carry a single recessive mutation that causes a lack of almost all body feathers, as well as foot scales and spurs, due to a failure of skin patterning during embryogenesis. This spontaneous mutant line, first described in the 1950s, has been used extensively to explore the tissue interactions involved in ectodermal appendage formation in embryonic skin. Moreover, the trait is potentially useful in tropical agriculture due to the ability of featherless chickens to tolerate heat, which is at present a major constraint to efficient poultry meat production in hot climates. In the interests of enhancing our understanding of feather placode development, and to provide the poultry industry with a strategy to breed heat-tolerant meat-type chickens (broilers), we mapped and identified the sc mutation. Results Through a cost-effective and labour-efficient SNP array mapping approach using DNA from sc/sc and sc/+ blood sample pools, we map the sc trait to chromosome 4 and show that a nonsense mutation in FGF20 is completely associated with the sc/sc phenotype. This mutation, common to all sc/sc individuals and absent from wild type, is predicted to lead to loss of a highly conserved region of the FGF20 protein important for FGF signalling. In situ hybridisation and quantitative RT-PCR studies reveal that FGF20 is epidermally expressed during the early stages of feather placode patterning. In addition, we describe a dCAPS genotyping assay based on the mutation, developed to facilitate discrimination between wild type and sc alleles. Conclusions This work represents the first loss of function genetic evidence supporting a role for FGF ligand signalling in feather development, and suggests FGF20 as a novel central player in the development of vertebrate skin appendages, including hair follicles and exocrine glands. In addition, this is to our knowledge the first report describing the use of the chicken SNP array to map genes based on

40 CFR 428.84 - [Reserved

Code of Federal Regulations, 2013 CFR

2013-07-01

... 40 Protection of Environment 31 2013-07-01 2013-07-01 false [Reserved] 428.84 Section 428.84 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS (CONTINUED) RUBBER MANUFACTURING POINT SOURCE CATEGORY Wet Digestion Reclaimed Rubber Subcategory § 428.84...

40 CFR 428.84 - [Reserved

Code of Federal Regulations, 2010 CFR

2010-07-01

... 40 Protection of Environment 29 2010-07-01 2010-07-01 false [Reserved] 428.84 Section 428.84 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS RUBBER MANUFACTURING POINT SOURCE CATEGORY Wet Digestion Reclaimed Rubber Subcategory § 428.84 [Reserved] ...

40 CFR 428.84 - [Reserved

Code of Federal Regulations, 2014 CFR

2014-07-01

... 40 Protection of Environment 30 2014-07-01 2014-07-01 false [Reserved] 428.84 Section 428.84 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS (CONTINUED) RUBBER MANUFACTURING POINT SOURCE CATEGORY Wet Digestion Reclaimed Rubber Subcategory § 428.84...

40 CFR 428.84 - [Reserved

Code of Federal Regulations, 2011 CFR

2011-07-01

... 40 Protection of Environment 30 2011-07-01 2011-07-01 false [Reserved] 428.84 Section 428.84 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS RUBBER MANUFACTURING POINT SOURCE CATEGORY Wet Digestion Reclaimed Rubber Subcategory § 428.84 [Reserved] ...

40 CFR 428.84 - [Reserved

Code of Federal Regulations, 2012 CFR

2012-07-01

... 40 Protection of Environment 31 2012-07-01 2012-07-01 false [Reserved] 428.84 Section 428.84 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS (CONTINUED) RUBBER MANUFACTURING POINT SOURCE CATEGORY Wet Digestion Reclaimed Rubber Subcategory § 428.84...

40 CFR 428.24 - [Reserved

Code of Federal Regulations, 2014 CFR

2014-07-01

... 40 Protection of Environment 30 2014-07-01 2014-07-01 false [Reserved] 428.24 Section 428.24 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS (CONTINUED) RUBBER MANUFACTURING POINT SOURCE CATEGORY Emulsion Crumb Rubber Subcategory § 428.24 [Reserved] ...

40 CFR 428.24 - [Reserved

Code of Federal Regulations, 2011 CFR

2011-07-01

... 40 Protection of Environment 30 2011-07-01 2011-07-01 false [Reserved] 428.24 Section 428.24 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS RUBBER MANUFACTURING POINT SOURCE CATEGORY Emulsion Crumb Rubber Subcategory § 428.24 [Reserved] ...

40 CFR 428.24 - [Reserved

Code of Federal Regulations, 2012 CFR

2012-07-01

... 40 Protection of Environment 31 2012-07-01 2012-07-01 false [Reserved] 428.24 Section 428.24 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS (CONTINUED) RUBBER MANUFACTURING POINT SOURCE CATEGORY Emulsion Crumb Rubber Subcategory § 428.24 [Reserved] ...

40 CFR 428.24 - [Reserved

Code of Federal Regulations, 2010 CFR

2010-07-01

... 40 Protection of Environment 29 2010-07-01 2010-07-01 false [Reserved] 428.24 Section 428.24 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS RUBBER MANUFACTURING POINT SOURCE CATEGORY Emulsion Crumb Rubber Subcategory § 428.24 [Reserved] ...

40 CFR 428.24 - [Reserved

Code of Federal Regulations, 2013 CFR

2013-07-01

... 40 Protection of Environment 31 2013-07-01 2013-07-01 false [Reserved] 428.24 Section 428.24 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS (CONTINUED) RUBBER MANUFACTURING POINT SOURCE CATEGORY Emulsion Crumb Rubber Subcategory § 428.24 [Reserved] ...

A novel nonsense mutation in the APTX gene associated with delayed DNA single-strand break removal fails to enhance sensitivity to different genotoxic agents.

PubMed

Crimella, Claudia; Cantoni, Orazio; Guidarelli, Andrea; Vantaggiato, Chiara; Martinuzzi, Andrea; Fiorani, Mara; Azzolini, Catia; Orso, Genny; Bresolin, Nereo; Bassi, Maria Teresa

2011-04-01

APTX is the gene involved in ataxia with oculomotor apraxia type 1 (AOA1), a recessive disorder with early-onset cerebellar ataxia, oculomotor apraxia and peripheral neuropathy. The encoded protein, aprataxin, is a DNA repair protein processing the products of abortive ligations, 5'-adenylated DNA. We describe a novel nonsense mutation in APTX, c.892C>T (p.Gln298X), segregating in two AOA1 patients and leading to the loss of aprataxin protein in patient's cells. These cells, while exhibiting reduced catalase activity, are not hypersensitive to toxicity elicited by H(2)O(2) exposure at either physiologic or ice-bath temperature. On the other hand, the rate of repair of DNA single-strand-breaks (SSBs) induced in both conditions is always significantly slower in AOA1 cells. By using the alkylating agent methyl methane sulphonate (MMS) we confirmed the association of the APTX mutation with a DNA repair defect in the absence of detectable changes in susceptibility to toxicity. These results, while consistent with a role of aprataxin in the repair of SSBs induced by H(2)O(2), or MMS, demonstrate that other mechanisms may be recruited in AOA1 cells to complete the repair process, although at a slower rate. Lack of hypersensitivity to the oxidant, or MMS, also implies that delayed repair is not per se a lethal event. © 2011 Wiley-Liss, Inc.

TP53 Mutation Status of Tubo-ovarian and Peritoneal High-grade Serous Carcinoma with a Wild-type p53 Immunostaining Pattern.

PubMed

Na, Kiyong; Sung, Ji-Youn; Kim, Hyun-Soo

2017-12-01

Diffuse and strong nuclear p53 immunoreactivity and a complete lack of p53 expression are regarded as indicative of missense and nonsense mutations, respectively, of the TP53 gene. Tubo-ovarian and peritoneal high-grade serous carcinoma (HGSC) is characterized by aberrant p53 expression induced by a TP53 mutation. However, our experience with some HGSC cases with a wild-type p53 immunostaining pattern led us to comprehensively review previous cases and investigate the TP53 mutational status of the exceptional cases. We analyzed the immunophenotype of 153 cases of HGSC and performed TP53 gene sequencing analysis in those with a wild-type p53 immunostaining pattern. Immunostaining revealed that 109 (71.3%) cases displayed diffuse and strong p53 expression (missense mutation pattern), while 39 (25.5%) had no p53 expression (nonsense mutation pattern). The remaining five cases of HGSC showed a wild-type p53 immunostaining pattern. Direct sequencing analysis revealed that three of these cases harbored nonsense TP53 mutations and two had novel splice site deletions. TP53 mutation is almost invariably present in HGSC, and p53 immunostaining can be used as a surrogate marker of TP53 mutation. In cases with a wild-type p53 immunostaining pattern, direct sequencing for TP53 mutational status can be helpful to confirm the presence of a TP53 mutation. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

A Nonsense Mutation in TMEM95 Encoding a Nondescript Transmembrane Protein Causes Idiopathic Male Subfertility in Cattle

PubMed Central

Pausch, Hubert; Kölle, Sabine; Wurmser, Christine; Schwarzenbacher, Hermann; Emmerling, Reiner; Jansen, Sandra; Trottmann, Matthias; Fuerst, Christian; Götz, Kay-Uwe; Fries, Ruedi

2014-01-01

Genetic variants underlying reduced male reproductive performance have been identified in humans and model organisms, most of them compromising semen quality. Occasionally, male fertility is severely compromised although semen analysis remains without any apparent pathological findings (i.e., idiopathic subfertility). Artificial insemination (AI) in most cattle populations requires close examination of all ejaculates before insemination. Although anomalous ejaculates are rejected, insemination success varies considerably among AI bulls. In an attempt to identify genetic causes of such variation, we undertook a genome-wide association study (GWAS). Imputed genotypes of 652,856 SNPs were available for 7962 AI bulls of the Fleckvieh (FV) population. Male reproductive ability (MRA) was assessed based on 15.3 million artificial inseminations. The GWAS uncovered a strong association signal on bovine chromosome 19 (P = 4.08×10−59). Subsequent autozygosity mapping revealed a common 1386 kb segment of extended homozygosity in 40 bulls with exceptionally poor reproductive performance. Only 1.7% of 35,671 inseminations with semen samples of those bulls were successful. None of the bulls with normal reproductive performance was homozygous, indicating recessive inheritance. Exploiting whole-genome re-sequencing data of 43 animals revealed a candidate causal nonsense mutation (rs378652941, c.483C>A, p.Cys161X) in the transmembrane protein 95 encoding gene TMEM95 which was subsequently validated in 1990 AI bulls. Immunohistochemical investigations evidenced that TMEM95 is located at the surface of spermatozoa of fertile animals whereas it is absent in spermatozoa of subfertile animals. These findings imply that integrity of TMEM95 is required for an undisturbed fertilisation. Our results demonstrate that deficiency of TMEM95 severely compromises male reproductive performance in cattle and reveal for the first time a phenotypic effect associated with genomic variation in

Mutation analysis in the long isoform of USH2A in American patients with Usher Syndrome type II.

PubMed

Yan, Denise; Ouyang, Xiaomei; Patterson, D Michael; Du, Li Lin; Jacobson, Samuel G; Liu, Xue-Zhong

2009-12-01

Usher syndrome type II (USH2) is an autosomal recessive disorder characterized by moderate to severe hearing impairment and progressive visual loss due to retinitis pigmentosa (RP). To identify novel mutations and determine the frequency of USH2A mutations as a cause of USH2, we have carried out mutation screening of all 72 coding exons and exon-intron splice sites of the USH2A gene. A total of 20 USH2 American probands of European descent were analyzed using single strand conformational polymorphism (SSCP) and direct sequencing methods. Ten different USH2A mutations were identified in 55% of the probands, five of which were novel mutations. The detected mutations include three missense, three frameshifts and four nonsense mutations, with c.2299delG/p.E767fs mutation, accounting for 38.9% of the pathological alleles. Two cases were homozygotes, two cases were compound heterozygotes and one case had complex allele with three variants. In seven probands, only one USH2A mutation was detected and no pathological mutation was found in the remaining eight individuals. Altogether, our data support the fact that c.2299delG/p.E767fs is indeed the most common USH2A mutation found in USH2 patients of European Caucasian background. Thus, if screening for mutations in USH2A is considered, it is reasonable to screen for the c.2299delG mutation first.

40 CFR 428.14 - [Reserved

Code of Federal Regulations, 2010 CFR

2010-07-01

... 40 Protection of Environment 29 2010-07-01 2010-07-01 false [Reserved] 428.14 Section 428.14 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS RUBBER MANUFACTURING POINT SOURCE CATEGORY Tire and Inner Tube Plants Subcategory § 428.14 [Reserved] ...

Germ-line mutations in the neurofibromatosis 2 gene: Correlations with disease severity and retinal abnormalities

DOE Office of Scientific and Technical Information (OSTI.GOV)

Parry, D.M.; Kaiser-Kupfer, M.; Eldridge, R.

Neurofibromatosis 2 (NF2) features bilateral vestibular schwannomas, other benign neural tumors, and cataracts. Patients in some families develop many tumors at an early age and have rapid clinical progression, whereas in other families, patients may not have symptoms until much later and vestibular schwannomas may be the only tumors. The NF2 gene has been cloned from chromosome 22q; most identified germ-line mutations result in a truncated protein and severe NF2. To look for additional mutations and clinical correlations, we used SSCP analysis to screen DNA from 32 unrelated patients. We identified 20 different mutations in 21 patients (66%): 10 nonsensemore » mutations, 2 frameshifts, 7 splice-site mutations, and 1 large in-frame deletion. Clinical information on 47 patients from the 21 families included ages at onset and at diagnosis, numbers of meningiomas, spinal and skin tumors, and presence of cataracts and retinal abnormalities. We compared clinical findings in patients with nonsense or frameshift mutations to those with splice-site mutations. When each patient was considered as an independent random event, the two groups differed (P {le} .05) for nearly every variable. Patients with nonsense or frameshift mutations were younger at onset and at diagnosis and had a higher frequency and mean number of tumors, supporting the correlation between nonsense and frameshift mutations and severe NF2. When each family was considered as an independent random event, statistically significant differences between the two groups were observed only for mean ages at onset and at diagnosis. A larger data set is needed to resolve these discrepancies. We observed retinal hamartomas and/or epiretinal membranes in nine patients from five families with four different nonsense mutations. This finding, which may represent a new genotype-phenotype correlation, merits further study. 58 refs., 2 tabs.« less

[Analysis of clinical phenotype and genetic mutations of a pedigree of familial hemophagocytic lymphohistiocytosis].

PubMed

Sun, Shuwen; Guo, Xia; Zhu, Yiping; Yang, Xue; Li, Qiang; Gao, Ju

2014-10-01

To analyze mutations in a pedigree of familial hemophagocytic lymphohistiocytosis (FHLH) from Sichuan and provide genetic counseling for the family. Clinical data of a case with FHLH diagnosed at West China Second Hospital was retrospectively analyzed. Genomic DNA was extracted from peripheral blood samples of the proband and his family members. Eight candidate genes for primary HLH were amplified with PCR and analyzed by direct sequencing. The proband was diagnosed as HLH based on clinical manifestations of recurrent fever for 2 months, hepatosplenomegaly, lymphadenopathy, pancytopenia, hyperferritinemia, and decreased fibrinogen and hemophagocytosis in bone marrow. Genetic testing for primary HLH was carried out considering the relapse of illness after hormone therapy for 8 weeks and the family history. The results of gene sequencing showed that the proband has carried compound heterozygous mutations in PRF1 gene (c.1349C> T in exon 3 and c.445G> A in exon 2). His father has carried a heterozygous mutation (c.445G> A in exon 2) and nonsense mutation (c.900C> T in exon 3), and his mother carried a heterozygous mutation (c.1349C> T in exon 3). Both c.1349C> T and c.445G> A have been previously reported as pathogenic mutations. The family has been diagnosed as familial HLH type 2 based on clinical and laboratory examinations and molecular genetic testing. Gene sequencing has indicated that is was a recessive type familial HLH.

Computational Analysis of KRAS Mutations: Implications for Different Effects on the KRAS p.G12D and p.G13D Mutations

PubMed Central

Liu, Yen-Yi; Hwang, Jenn-Kang; Barrio, Maria Jesus; Rodrigo, Maximiliano; Garcia-Toro, Enrique; Herreros-Villanueva, Marta

2013-01-01

Background The issue of whether patients diagnosed with metastatic colorectal cancer who harbor KRAS codon 13 mutations could benefit from the addition of anti-epidermal growth factor receptor therapy remains under debate. The aim of the current study was to perform computational analysis to investigate the structural implications of the underlying mutations caused by c.38G>A (p.G13D) on protein conformation. Methods Molecular dynamics (MD) simulations were performed to understand the plausible structural and dynamical implications caused by c.35G>A (p.G12D) and c.38G>A (p.G13D). The potential of mean force (PMF) simulations were carried out to determine the free energy profiles of the binding processes of GTP interacting with wild-type (WT) KRAS and its mutants (MT). Results Using MD simulations, we observed that the root mean square deviation (RMSD) increased as a function of time for the MT c.35G>A (p.G12D) and MT c.38G>A (p.G13D) when compared with the WT. We also observed that the GTP-binding pocket in the c.35G>A (p.G12D) mutant is more open than that of the WT and the c.38G>A (p.G13D) proteins. Intriguingly, the analysis of atomic fluctuations and free energy profiles revealed that the mutation of c.35G>A (p.G12D) may induce additional fluctuations in the sensitive sites (P-loop, switch I and II regions). Such fluctuations may promote instability in these protein regions and hamper GTP binding. Conclusions Taken together with the results obtained from MD and PMF simulations, the present findings implicate fluctuations at the sensitive sites (P-loop, switch I and II regions). Our findings revealed that KRAS mutations in codon 13 have similar behavior as KRAS WT. To gain a better insight into why patients with metastatic colorectal cancer (mCRC) and the KRAS c.38G>A (p.G13D) mutation appear to benefit from anti-EGFR therapy, the role of the KRAS c.38G>A (p.G13D) mutation in mCRC needs to be further investigated. PMID:23437064

Truncating mutations in the last exon of NOTCH3 cause lateral meningocele syndrome.

PubMed

Gripp, Karen W; Robbins, Katherine M; Sobreira, Nara L; Witmer, P Dane; Bird, Lynne M; Avela, Kristiina; Makitie, Outi; Alves, Daniela; Hogue, Jacob S; Zackai, Elaine H; Doheny, Kimberly F; Stabley, Deborah L; Sol-Church, Katia

2015-02-01

Lateral meningocele syndrome (LMS, OMIM%130720), also known as Lehman syndrome, is a very rare skeletal disorder with facial anomalies, hypotonia and meningocele-related neurologic dysfunction. The characteristic lateral meningoceles represent the severe end of the dural ectasia spectrum and are typically most severe in the lower spine. Facial features of LMS include hypertelorism and telecanthus, high arched eyebrows, ptosis, midfacial hypoplasia, micrognathia, high and narrow palate, low-set ears and a hypotonic appearance. Hyperextensibility, hernias and scoliosis reflect a connective tissue abnormality, and aortic dilation, a high-pitched nasal voice, wormian bones and osteolysis may be present. Lateral meningocele syndrome has phenotypic overlap with Hajdu-Cheney syndrome. We performed exome resequencing in five unrelated individuals with LMS and identified heterozygous truncating NOTCH3 mutations. In an additional unrelated individual Sanger sequencing revealed a deleterious variant in the same exon 33. In total, five novel de novo NOTCH3 mutations were identified in six unrelated patients. One had a 26 bp deletion (c.6461_6486del, p.G2154fsTer78), two carried the same single base pair insertion (c.6692_93insC, p.P2231fsTer11), and three individuals had a nonsense point mutation at c.6247A > T (pK2083*), c.6663C > G (p.Y2221*) or c.6732C > A, (p.Y2244*). All mutations cluster into the last coding exon, resulting in premature termination of the protein and truncation of the negative regulatory proline-glutamate-serine-threonine rich PEST domain. Our results suggest that mutant mRNA products escape nonsense mediated decay. The truncated NOTCH3 may cause gain-of-function through decreased clearance of the active intracellular product, resembling NOTCH2 mutations in the clinically related Hajdu-Cheney syndrome and contrasting the NOTCH3 missense mutations causing CADASIL. © 2014 Wiley Periodicals, Inc.

Moderation of phenotypic severity in dystrophic and junctional forms of epidermolysis bullosa through in-frame skipping of exons containing non-sense or frameshift mutations.

PubMed

McGrath, J A; Ashton, G H; Mellerio, J E; Salas-Alanis, J C; Swensson, O; McMillan, J R; Eady, R A

1999-09-01

Non-sense mutations on both alleles of either the type VII collagen gene (COL7A1) or the genes encoding laminin 5 (LAMA3, LAMB3, or LAMC2) usually result in clinically severe forms of recessive dystrophic or junctional epidermolysis bullosa, respectively. In this study we assessed two unrelated families whose mutations in genomic DNA predicted severe recessive dystrophic epidermolysis bullosa or junctional epidermolysis bullosa phenotypes but in whom the manifestations were milder than expected. The recessive dystrophic epidermolysis bullosa patients had a homozygous single base-pair frameshift mutation in exon 19 of COL7A1 (2470insG). Clinically, there was generalized blistering but only mild scarring. Skin biopsy revealed positive type VII collagen immunoreactivity and recognizable anchoring fibrils. The junctional epidermolysis bullosa patients were compound heterozygotes for a frameshift/non-sense combination of mutations in exons 3 and 17 of LAMB3 (29insC/Q834X). These patients did not have the lethal form of junctional epidermolysis bullosa but, as adults, displayed the milder generalized atrophic benign epidermolysis bullosa variant. There was undetectable laminin 5 staining at the dermal-epidermal junction using an antibody to the beta3 chain, but faintly positive alpha3 and gamma2 chain labeling, and there was variable hypoplasia of hemidesmosomes. To explain the milder recessive dystrophic epidermolysis bullosa and junctional epidermolysis bullosa phenotypes in these families, reverse transcription-polymerase chain reaction, using RNA extracted from frozen skin, was able to provide evidence for some rescue of mutant mRNA transcripts with restoration of the open- reading frame. In the recessive dystrophic epidermolysis bullosa patients, transcripts containing in-frame skipping of exon 19 of COL7A1 in the cDNA were detected, and in the junctional epidermolysis bullosa patients transcripts with in-frame skipping of exon 17 of LAMB3 were identified. The

Identification of a novel mutation in the PTCH gene in a patient with Gorlin-Goltz syndrome with unusual ocular disorders.

PubMed

Romano, Mary; Iacovello, Daniela; Cascone, Nikhil C; Contestabile, Maria Teresa

2011-01-01

To document the clinical, functional, and in vivo microanatomic characteristics of a patient with Gorlin-Goltz syndrome with a novel nonsense mutation in PTCH (patched). Optical coherence tomography (OCT), fluorescein angiography, electrophysiologic testing, visual field, magnetic resonance imaging, and mutation screening of PTCH gene. Visual acuity was 20/20 in the right eye and 20/25 in the left. Fundus examination revealed myelinated nerve fibers in the left eye and bilateral epiretinal membranes with lamellar macular hole also documented with macular OCT. A reduction of the retinal nerve fiber layers in both eyes was found with fiber nervous OCT. Fluorescein angiography showed bilaterally foveal hyperfluorescence and the visual field revealed inferior hemianopia in the right eye. Pattern visual evoked potentials registered a reduction of amplitude in both eyes and latency was delayed in the left eye. Pattern electroretinogram showed a reduction in P50 and N95 peak time and a delay in P50 peak time in the left eye. Flash electroretinogram was reduced in rod response, maximal response, and oscillatory potentials in both eyes. Cone response was normal and 30-Hz flicker was slightly reduced in both eyes. Mutation screening identified a novel nonsense mutation in PTCH. A novel nonsense mutation in the PTCH gene was found. We report the occurrence of epiretinal membranes and the persistence of myelinated nerve fibers. Electrophysiologic and visual field alterations, supporting a neuroretinal dysfunction, were also documented.

Chronic constipation recognized as a sign of a SOX10 mutation in a patient with Waardenburg syndrome.

PubMed

Arimoto, Yukiko; Namba, Kazunori; Nakano, Atsuko; Matsunaga, Tatsuo

2014-05-01

Waardenburg syndrome is characterized by hearing loss, pigmentation abnormalities, dysmorphologic features, and neurological phenotypes. Waardenburg syndrome consists of four distinct subtypes, and SOX10 mutations have been identified in type II and type IV. Type IV differs from type II owing to the presence of Hirschsprung disease. We identified a de novo nonsense mutation in SOX10 (p.G39X) in a female pediatric patient with Waardenburg syndrome with heterochromia iridis, profound bilateral sensorineural hearing loss, inner ear malformations, and overall hypopigmentation of the hair without dystopia canthorum. This patient has experienced chronic constipation since she was a neonate, but anorectal manometry showed a normal anorectal reflex. Chronic constipation in this patient was likely to be a consequence of a mild intestinal disorder owing to the SOX10 mutation, and this patient was considered to have a clinical phenotype intermediate between type II and type IV of the syndrome. Chronic constipation may be recognized as indicative of a SOX10 mutation in patients with Waardenburg syndrome. Copyright © 2014 Elsevier B.V. All rights reserved.

Mutations at the PAX6 locus are found in heterogeneous anterior segment malformations including Peters' anomaly.

PubMed

Hanson, I M; Fletcher, J M; Jordan, T; Brown, A; Taylor, D; Adams, R J; Punnett, H H; van Heyningen, V

1994-02-01

Mutation or deletion of the PAX6 gene underlies many cases of aniridia. Three lines of evidence now converge to implicate PAX6 more widely in anterior segment malformations including Peters' anomaly. First, a child with Peters' anomaly is deleted for one copy of PAX6. Second, affected members of a family with dominantly inherited anterior segment malformations, including Peters' anomaly are heterozygous for an R26G mutation in the PAX6 paired box. Third, a proportion of Sey/+ Smalleye mice, heterozygous for a nonsense mutation in murine Pax-6, have an ocular phenotype resembling Peters' anomaly. We therefore propose that a variety of anterior segment anomalies may be associated with PAX6 mutations.

Diverse growth hormone receptor gene mutations in Laron syndrome.

PubMed Central

Berg, M A; Argente, J; Chernausek, S; Gracia, R; Guevara-Aguirre, J; Hopp, M; Pérez-Jurado, L; Rosenbloom, A; Toledo, S P; Francke, U

1993-01-01

To better understand the molecular genetic basis and genetic epidemiology of Laron syndrome (growth-hormone insensitivity syndrome), we analyzed the growth-hormone receptor (GHR) genes of seven unrelated affected individuals from the United States, South America, Europe, and Africa. We amplified all nine GHR gene exons and splice junctions from these individuals by PCR and screened the products for mutations by using denaturing gradient gel electrophoresis (DGGE). We identified a single GHR gene fragment with abnormal DGGE results for each affected individual, sequenced this fragment, and, in each case, identified a mutation likely to cause Laron syndrome, including two nonsense mutations (R43X and R217X), two splice-junction mutations, (189-1 G to T and 71 + 1 G to A), and two frameshift mutations (46 del TT and 230 del TA or AT). Only one of these mutations, R43X, has been previously reported. Using haplotype analysis, we determined that this mutation, which involves a CpG dinucleotide hot spot, likely arose as a separate event in this case, relative to the two prior reports of R43X. Aside from R43X, the mutations we identified are unique to patients from particular geographic regions. Ten GHR gene mutations have now been described in this disorder. We conclude that Laron syndrome is caused by diverse GHR gene mutations, including deletions, RNA processing defects, translational stop codons, and missense codons. All the identified mutations involve the extracellular domain of the receptor, and most are unique to particular families or geographic areas. Images Figure 1 Figure 2 PMID:8488849

29 CFR 42.8 - Coordination plan.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 29 Labor 1 2010-07-01 2010-07-01 true Coordination plan. 42.8 Section 42.8 Labor Office of the Secretary of Labor COORDINATED ENFORCEMENT § 42.8 Coordination plan. (a) Based upon, among other things, the... coordination plan concerning farm labor-related responsibilities of the Department, including migrant housing...

A mutation in the neurofibromatosis type 2 tumor-suppressor gene, giving rise to widely different clinical phenotypes in two unrelated individuals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bourn, D.; Carter, S.A.; Goodship, J.

The authors have sought mutations in the recently identified neurofibromatosis type 2 (NF2) tumor-suppressor gene in a large panel of NF2 patients, using PCR-based SSCP and heteroduplex analysis, followed by cloning and sequencing of appropriate PCR products. Two unrelated NF2 patients were found to have identical nonsense mutations caused by a C-to-T transition in a CpG dinucleotide that is a potential mutational hot spot in the NF2 tumor-suppressor gene. Unexpectedly, the two individuals had widely different clinical phenotypes, representing the severe Wishart and mild Gardner clinical subtypes. Analysis of DNA samples from different tissues of the mildly affected patient suggestsmore » that he is a somatic mosaic for the mutation. 26 refs., 3 figs.« less

43 CFR 428.5 - Required information.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 43 Public Lands: Interior 1 2014-10-01 2014-10-01 false Required information. 428.5 Section 428.5... INTERIOR INFORMATION REQUIREMENTS FOR CERTAIN FARM OPERATIONS IN EXCESS OF 960 ACRES AND THE ELIGIBILITY OF CERTAIN FORMERLY EXCESS LAND § 428.5 Required information. (a) We will determine which forms you must use...

Targeted next-generation sequencing reveals that a compound heterozygous mutation in phosphodiesterase 6a gene leads to retinitis pigmentosa in a Chinese family.

PubMed

Zhang, Shanshan; Li, Jie; Li, Shujin; Yang, Yeming; Yang, Mu; Yang, Zhenglin; Zhu, Xianjun; Zhang, Lin

2018-04-25

Retinitis pigmentosa (RP) is a genetically heterogeneous disease with over 70 causative genes identified to date. However, approximately 40% of RP cases remain genetically unsolved, suggesting that many novel disease-causing mutations are yet to be identified. The purpose of this study is to identify the causative mutations of a Chinese RP family. Targeted next-generation sequencing (NGS) for a total of 163 genes which involved in inherited retinal disorders were used to screen the possible causative mutations. Sanger sequencing was used to verify the mutations. As results, we identified two heterozygous mutations: a splicing site mutation c.1407 + 1G>C and a nonsense mutation c. 1957C>T (p.R653X) in phosphodiesterase 6A (PDE6A) gene in the RP patient. These two mutations are inherited from his father and mother, respectively. Furthermore, these mutations are unique in our in-house database and are rare in human genome databases, implicating that these two mutations are pathological. By using targeted NGS method, we identified a compound heterozygous mutation in PDE6A gene that is associated with RP in a Chinese family.

[Identification of an ideal noninvasive method to detect A3243G gene mutation in MELAS syndrome].

PubMed

Ma, Yi-nan; Fang, Fang; Yang, Yan-ling; Zhang, Ying; Wang, Song-tao; Xu, Yu-feng; Pei, Pei; Yuan, Yun; Bu, Ding-fang; Qi, Yu

2008-12-16

To identify a better non-invasive method to detect the carrier of mitochondrial A3243G mutation, a cause of mitochondrial encephalopathy-lactic acidosis-stroke like episode (MELAS) syndrome. DNA was extracted from the peripheral blood, urine, hair follicle, and saliva of 25 MELAS syndrome patients carrying A3243G mutation and their mothers and other maternal relatives, 33 persons in number, and the muscle tissues from 5 patients obtained by biopsy. A3243G mutation was detected by PCR-RFLP method, and the A3243G mutation ratio was identified by measuring the density of each band and calculation with the software AlphaEase 5.0. A3243G mutations were detected in all tissues of the 25 MELAS patients. The A3243G mutation ratio in urine was 62% +/- 9%, significantly higher than that in the blood [(36% +/- 10%), t = -11.13, P < 0.01]. A3243G mutations were detected in at least one tissue of the 28 maternal relatives. The A3243G mutation rates in their urine samples was 33.0% (5.0% - 70.4%), significantly higher than that in their blood samples [8.0% (0 - 33.3%), z = -4.197, P < 0.01]. There was no significant difference in A3243G mutation ratio among the samples of hair follicle, saliva, and blood. The A3243G mutation ratio in urine is significantly higher than those in blood samples of the patients and their maternal relatives. A noninvasive method, A3243G mutation ratio analysis of urine is superior to that in blood.

Congenital myopathy is caused by mutation of HACD1.

PubMed

Muhammad, Emad; Reish, Orit; Ohno, Yusuke; Scheetz, Todd; Deluca, Adam; Searby, Charles; Regev, Miriam; Benyamini, Lilach; Fellig, Yakov; Kihara, Akio; Sheffield, Val C; Parvari, Ruti

2013-12-20

Congenital myopathies are heterogeneous inherited diseases of muscle characterized by a range of distinctive histologic abnormalities. We have studied a consanguineous family with congenital myopathy. Genome-wide linkage analysis and whole-exome sequencing identified a homozygous non-sense mutation in 3-hydroxyacyl-CoA dehydratase 1 (HACD1) in affected individuals. The mutation results in non-sense mediated decay of the HACD1 mRNA to 31% of control levels in patient muscle and completely abrogates the enzymatic activity of dehydration of 3-hydroxyacyl-CoA, the third step in the elongation of very long-chain fatty acids (VLCFAs). We describe clinical findings correlated with a deleterious mutation in a gene not previously known to be associated with congenital myopathy in humans. We suggest that the mutation in the HACD1 gene causes a reduction in the synthesis of VLCFAs, which are components of membrane lipids and participants in physiological processes, leading to congenital myopathy. These data indicate that HACD1 is necessary for muscle function.

Effect of the G375C and G346E achondroplasia mutations on FGFR3 activation.

PubMed

He, Lijuan; Serrano, Christopher; Niphadkar, Nitish; Shobnam, Nadia; Hristova, Kalina

2012-01-01

Two mutations in FGFR3, G380R and G375C are known to cause achondroplasia, the most common form of human dwarfism. The G380R mutation accounts for 98% of the achondroplasia cases, and thus has been studied extensively. Here we study the effect of the G375C mutation on the phosphorylation and the cross-linking propensity of full-length FGFR3 in HEK 293 cells, and we compare the results to previously published results for the G380R mutant. We observe identical behavior of the two achondroplasia mutants in these experiments, a finding which supports a direct link between the severity of dwarfism phenotypes and the level and mechanism of FGFR3 over-activation. The mutations do not increase the cross-linking propensity of FGFR3, contrary to previous expectations that the achondroplasia mutations stabilize the FGFR3 dimers. Instead, the phosphorylation efficiency within un-liganded FGFR3 dimers is increased, and this increase is likely the underlying cause for pathogenesis in achondroplasia. We further investigate the G346E mutation, which has been reported to cause achondroplasia in one case. We find that this mutation does not increase FGFR3 phosphorylation and decreases FGFR3 cross-linking propensity, a finding which raises questions whether this mutation is indeed a genetic cause for human dwarfism.

Effect of the G375C and G346E Achondroplasia Mutations on FGFR3 Activation

PubMed Central

He, Lijuan; Serrano, Christopher; Niphadkar, Nitish; Shobnam, Nadia; Hristova, Kalina

2012-01-01

Two mutations in FGFR3, G380R and G375C are known to cause achondroplasia, the most common form of human dwarfism. The G380R mutation accounts for 98% of the achondroplasia cases, and thus has been studied extensively. Here we study the effect of the G375C mutation on the phosphorylation and the cross-linking propensity of full-length FGFR3 in HEK 293 cells, and we compare the results to previously published results for the G380R mutant. We observe identical behavior of the two achondroplasia mutants in these experiments, a finding which supports a direct link between the severity of dwarfism phenotypes and the level and mechanism of FGFR3 over-activation. The mutations do not increase the cross-linking propensity of FGFR3, contrary to previous expectations that the achondroplasia mutations stabilize the FGFR3 dimers. Instead, the phosphorylation efficiency within un-liganded FGFR3 dimers is increased, and this increase is likely the underlying cause for pathogenesis in achondroplasia. We further investigate the G346E mutation, which has been reported to cause achondroplasia in one case. We find that this mutation does not increase FGFR3 phosphorylation and decreases FGFR3 cross-linking propensity, a finding which raises questions whether this mutation is indeed a genetic cause for human dwarfism. PMID:22529939

Missense mutation (E150K) of rhodopsin in autosomal recessive retinitis pigmentosa

DOE Office of Scientific and Technical Information (OSTI.GOV)

Orth, U.; Oehlmann, R.; Gal, A.

1994-09-01

Missense or nonsense mutations of the rhodopsin gene have been implied in the pathogenesis of at least 3 different traits; autosomal dominant retinitis pigmentosa (adRP), congenital stationary night blindness (CSNB), and autosomal recessive retinitis pigmentosa (arRP). For the latter, a single patient has been reported with a nonsense mutation at codon 249 on both alleles. Heterozygous carriers of missense mutations of rhodopsin develop either adRP or CSNB depending on the particular amino acid substitution. Four of the 9 siblings from a consanguineous marriage in southern India were reported the have arRP. Mutational screening and sequencing of the rhodopsin gene revealedmore » a G-to-A transition of the first nucleotide at codon 150 in exon II, which alters glutamate to lysine. The E150K mutation was present in the 4 patients in homozygous form, whereas the parents and 2 of the siblings were heterozygotes. Two-point analysis produced a Zmax=3.46 at theta=0.00. Two unaffected siblings who are heterozygotes for the E150K mutation underwent a thorough ophthalmological and psychophysical examination. No clinical abnormalities were found although these individuals were over forty, whereas the onset of RP in their affected siblings was in the second decade. Collectively, both the genetic and clinical findings strongly suggest that the E150K mutation of rhodopsin is recessive in this family. Glu150 forms part of the CD cytoplasmic loop of rhodopsin, which has been implicated in the binding and activation of transducin. We speculate that E150K leads to RP because the mutant protein may be incapable of activating transducin. It is tempting to speculate that, in addition to mutations in the genes for rhodopsin and the {beta}-subunit of PDE, mutations in the genes for transducin may also result in arRP.« less

[Leigh syndrome resulting from a de novo mitochondrial DNA mutation (T8993G)].

PubMed

Playán, A; Solano-Palacios, A; González de la Rosa, J B; Merino-Arribas, J M; Andreu, A L; López-Pérez, M; Montoya, J

Several degenerative neurological diseases are caused by mutations in the mitochondrial gene coding for subunit 6 of the ATPase. Thus, NARP (neurogenic weakness, ataxia, and retinitis pigmentosa) and Leigh syndromes are associated to a T8993G mutation when the percentage of mutant mitochondrial DNA is low (60 90%) or high (>90%), respectively. Leigh syndrome is also caused by a second mutation in the same position T8993C. The patient, a boy that died at 6 months, had generalized hypotonia, psychomotor delay, hepatomegaly, choreic movements and hyporreflexia. MRI showed hypodensities in the basal ganglia and brain stem as well as hyperlactacidemia. Molecular genetic analysis of the mitochondrial DNA showed that the patient had the T8993G mutation in a percentage higher than 95%. No mutated DNA was detected in blood of the proband s mother, maternal aunt and grandmother. The point mutation T8993G may occur de novo, at high levels, causing neurodegenerative diseases.

Antitumor activity of alectinib, a selective ALK inhibitor, in an ALK-positive NSCLC cell line harboring G1269A mutation: Efficacy of alectinib against ALK G1269A mutated cells.

PubMed

Yoshimura, Yasushi; Kurasawa, Mitsue; Yorozu, Keigo; Puig, Oscar; Bordogna, Walter; Harada, Naoki

2016-03-01

Alectinib is a highly selective next-generation anaplastic lymphoma kinase (ALK) inhibitor. Although alectinib shows inhibitory activity against various crizotinib-resistant ALK mutations in studies using cell-free kinase assays and Ba/F3 cell-based assays, it has not been tested for efficacy against non-small cell lung cancer (NSCLC) with the ALK mutations. We conducted in vitro and in vivo investigations into the antitumor activity of alectinib against an ALK-positive NSCLC cell line, SNU-2535, which harbors an ALK G1269A mutation. The clinical efficacy of alectinib against a NSCLC patient harboring ALK G1269A mutation was evaluated in the phase I part of the North American study. Alectinib exhibited antiproliferative activity against SNU-2535 cells in vitro with IC50 of 33.1 nM. Alectinib strongly inhibited phosphorylation of ALK and its downstream signaling molecules ERK1/2, AKT, and STAT3. In a mouse xenograft model, once-daily oral administration of alectinib for 21 days resulted in strong tumor regression. In addition, administration of alectinib for 100 days achieved continuous tumor regression without tumor regrowth in all mice. Notably, eradication of tumor cells was observed in half of the mice. In the clinical study, a patient with ALK G1269A mutation showed partial response to alectinib with a duration of response of 84 days. These results indicated that alectinib has potent antitumor activity against NSCLC cells harboring the crizotinib-resistant mutation ALK G1269A. It is expected that alectinib would provide a valuable therapeutic option for patients with NSCLC having not only native ALK but also crizotinib-resistant ALK mutations.

G6PDdb, an integrated database of glucose-6-phosphate dehydrogenase (G6PD) mutations.

PubMed

Kwok, Colin J; Martin, Andrew C R; Au, Shannon W N; Lam, Veronica M S

2002-03-01

G6PDdb (http://www.rubic.rdg.ac.uk/g6pd/ or http://www.bioinf.org.uk/g6pd/) is a newly created web-accessible locus-specific mutation database for the human Glucose-6-phosphate dehydrogenase (G6PD) gene. The relational database integrates up-to-date mutational and structural data from various databanks (GenBank, Protein Data Bank, etc.) with biochemically characterized variants and their associated phenotypes obtained from published literature and the Favism website. An automated analysis of the mutations likely to have a significant impact on the structure of the protein has been performed using a recently developed procedure. The database may be queried online and the full results of the analysis of the structural impact of mutations are available. The web page provides a form for submitting additional mutation data and is linked to resources such as the Favism website, OMIM, HGMD, HGVBASE, and the PDB. This database provides insights into the molecular aspects and clinical significance of G6PD deficiency for researchers and clinicians and the web page functions as a knowledge base relevant to the understanding of G6PD deficiency and its management. Copyright 2002 Wiley-Liss, Inc.

A novel mutation in SCN9A in a child with congenital insensitivity to pain.

PubMed

Shorer, Zamir; Wajsbrot, Einav; Liran, Tamir-Hostovsky; Levy, Jacov; Parvari, Ruti

2014-01-01

[corrected] Congenital insensitivity to pain (CIP) is a rare condition in which patients have no pain perception and anosmia but are otherwise essentially normal (OMIM 243000). The recent discovery of the genetic defects underlying 3 monogenic pain disorders has provided additional and important insights about some components of human pain. Genetic studies in families demonstrating recessively inherited channelopathy-associated insensitivity to pain have identified nonsense mutations that result in truncation of the voltage-gated sodium channel type IX subunit (SCN9A), a 113.5-kb gene comprising coding 26 exons. Here we describe a patient with CIP with a new mutation in SCN9A not described yet. All exons were sequenced. All 26 coding exons were sequenced and two changes were identified in homozygosity in exon 10: c.1126 A > C causing K376Q and c.1124delG causing p.G375Afs* frame shift. We report a novel, loss-of-function mutation in homozygosity that causes congenital insensitivity to pain and provide a comprehensive clinical description of the patient. This contributes to the clinical and neurophysiological characteristic of the sodium channel Nav1.7 channelopathy and expand our genetic knowledge which might provide more accurate and comprehensive clinical electrophysiological and genetic information. Copyright © 2014 Elsevier Inc. All rights reserved.

Basal exon skipping and nonsense-associated altered splicing allows bypassing complete CEP290 loss-of-function in individuals with unusually mild retinal disease.

PubMed

Barny, Iris; Perrault, Isabelle; Michel, Christel; Soussan, Mickael; Goudin, Nicolas; Rio, Marlène; Thomas, Sophie; Attié-Bitach, Tania; Hamel, Christian; Dollfus, Hélène; Kaplan, Josseline; Rozet, Jean-Michel; Gerard, Xavier

2018-05-16

CEP290 mutations cause a spectrum of ciliopathies from Leber congenital amaurosis type 10 (LCA10) to embryo-lethal Meckel syndrome (MKS). Using panel-based molecular diagnosis testing for inherited retinal diseases, we identified two individuals with some preserved vision despite biallelism for presumably truncating CEP290 mutations. The first one carried a homozygous 1 base-pair deletion in exon 17, introducing a premature termination codon (PTC) in exon 18 (c.1666del; p.Ile556Phefs*17). mRNA analysis revealed a basal exon skipping (BES) of exon 18, providing mutant cells with the ability to escape protein truncation, while disrupting the reading frame in controls. The second individual harbored compound heterozygous nonsense mutations in exon 8 (c.508A>T, p.Lys170*) and exon 32 (c.4090G>T, p.Glu1364*), respectively. Some CEP290 lacking exon 8 were detected in mutant fibroblasts but not in controls whereas some skipping of exon 32 occurred in both lines, but with higher amplitude in the mutant. Considering that the deletion of either exon maintains the reading frame in either line, skipping in mutant cells likely involves nonsense-associated altered splicing (NAS) alone (exon 8), or with BES (exon 32). Skipping of PTC-containing exons in mutant cells allowed production of CEP290 isoforms with preserved ability to assemble into a high molecular weight complex and to interact efficiently with proteins important for cilia formation and intraflagellar trafficking. In contrast, studying LCA10 and MKS fibroblasts we show moderate to severe cilia alterations, providing support for a correlation between disease severity and the ability of cells to express shortened, yet functional, CEP290 isoforms.

40 CFR 428.21 - Specialized definitions.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 40 Protection of Environment 30 2011-07-01 2011-07-01 false Specialized definitions. 428.21 Section 428.21 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS RUBBER MANUFACTURING POINT SOURCE CATEGORY Emulsion Crumb Rubber Subcategory § 428.21...

40 CFR 428.21 - Specialized definitions.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 40 Protection of Environment 29 2010-07-01 2010-07-01 false Specialized definitions. 428.21 Section 428.21 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS RUBBER MANUFACTURING POINT SOURCE CATEGORY Emulsion Crumb Rubber Subcategory § 428.21...

Chromosome VIII disomy influences the nonsense suppression efficiency and transition metal tolerance of the yeast Saccharomyces cerevisiae.

PubMed

Zadorsky, S P; Sopova, Y V; Andreichuk, D Y; Startsev, V A; Medvedeva, V P; Inge-Vechtomov, S G

2015-06-01

The SUP35 gene of the yeast Saccharomyces cerevisiae encodes the translation termination factor eRF3. Mutations in this gene lead to the suppression of nonsense mutations and a number of other pleiotropic phenotypes, one of which is impaired chromosome segregation during cell division. Similar effects result from replacing the S. cerevisiae SUP35 gene with its orthologues. A number of genetic and epigenetic changes that occur in the sup35 background result in partial compensation for this suppressor effect. In this study we showed that in S. cerevisiae strains in which the SUP35 orthologue from the yeast Pichia methanolica replaces the S. cerevisiae SUP35 gene, chromosome VIII disomy results in decreased efficiency of nonsense suppression. This antisuppressor effect is not associated with decreased stop codon read-through. We identified SBP1, a gene that localizes to chromosome VIII, as a dosage-dependent antisuppressor that strongly contributes to the overall antisuppressor effect of chromosome VIII disomy. Disomy of chromosome VIII also leads to a change in the yeast strains' tolerance of a number of transition metal salts. Copyright © 2015 John Wiley & Sons, Ltd.

A common variant in combination with a nonsense mutation in a member of the thioredoxin family causes primary ciliary dyskinesia

PubMed Central

Duriez, Bénédicte; Duquesnoy, Philippe; Escudier, Estelle; Bridoux, Anne-Marie; Escalier, Denise; Rayet, Isabelle; Marcos, Elisabeth; Vojtek, Anne-Marie; Bercher, Jean-François; Amselem, Serge

2007-01-01

Thioredoxins belong to a large family of enzymatic proteins that function as general protein disulfide reductases, therefore participating in several cellular processes via redox-mediated reactions. So far, none of the 18 members of this family has been involved in human pathology. Here we identified TXNDC3, which encodes a thioredoxin–nucleoside diphosphate kinase, as a gene implicated in primary ciliary dyskinesia (PCD), a genetic condition characterized by chronic respiratory tract infections, left–right asymmetry randomization, and male infertility. We show that the disease, which segregates as a recessive trait, results from the unusual combination of the following two transallelic defects: a nonsense mutation and a common intronic variant found in 1% of control chromosomes. This variant affects the ratio of two physiological TXNDC3 transcripts: the full-length isoform and a novel isoform, TXNDC3d7, carrying an in-frame deletion of exon 7. In vivo and in vitro expression data unveiled the physiological importance of TXNDC3d7 (whose expression was reduced in the patient) and the corresponding protein that was shown to bind microtubules. PCD is known to result from defects of the axoneme, an organelle common to respiratory cilia, embryonic nodal cilia, and sperm flagella, containing dynein arms, with, to date, the implication of genes encoding dynein proteins. Our findings, which identify a another class of molecules involved in PCD, disclose the key role of TXNDC3 in ciliary function; they also point to an unusual mechanism underlying a Mendelian disorder, which is an SNP-induced modification of the ratio of two physiological isoforms generated by alternative splicing. PMID:17360648

Remarkable difference of somatic mutation patterns between oncogenes and tumor suppressor genes.

PubMed

Liu, Haoxuan; Xing, Yuhang; Yang, Sihai; Tian, Dacheng

2011-12-01

Cancers arise owing to mutations that confer selective growth advantages on the cells in a subset of tumor suppressor and/or oncogenes. To understand oncogenesis and diagnose cancers, it is crucial to discriminate these two groups of genes by using the difference in their mutation patterns. Here, we investigated>120,000 mutation samples in 66 well-known tumor suppressor genes and oncogenes of the COSMIC database, and found a set of significant differences in mutation patterns (e.g., non-3n-indel, non-sense SNP and mutation hotspot) between them. By screening the best measurement, we developed indices to readily distinguish one from another and predict clearly the unknown oncogenesis genes as tumor suppressors (e.g., ASXL1, HNF1A and KDM6A) or oncogenes (e.g., FOXL2, MYD88 and TSHR). Based on our results, a third gene group can be classified, which has a mutational pattern between tumor suppressors and oncogenes. The concept of the third gene group could help to understand gene function in different cancers or individual patients and to know the exact function of genes in oncogenesis. In conclusion, our study provides further insights into cancer-related genes and identifies several potential therapeutic targets.

Mutations of the aminoacyl-tRNA-synthetases SARS and WARS2 are implicated in the etiology of autosomal recessive intellectual disability.

PubMed

Musante, Luciana; Püttmann, Lucia; Kahrizi, Kimia; Garshasbi, Masoud; Hu, Hao; Stehr, Henning; Lipkowitz, Bettina; Otto, Sabine; Jensen, Lars R; Tzschach, Andreas; Jamali, Payman; Wienker, Thomas; Najmabadi, Hossein; Ropers, Hans Hilger; Kuss, Andreas W

2017-06-01

Intellectual disability (ID) is the hallmark of an extremely heterogeneous group of disorders that comprises a wide variety of syndromic and non-syndromic phenotypes. Here, we report on mutations in two aminoacyl-tRNA synthetases that are associated with ID in two unrelated Iranian families. In the first family, we identified a homozygous missense mutation (c.514G>A, p.Asp172Asn) in the cytoplasmic seryl-tRNA synthetase (SARS) gene. The mutation affects the enzymatic core domain of the protein and impairs its enzymatic activity, probably leading to reduced cytoplasmic tRNA Ser concentrations. The mutant protein was predicted to be unstable, which could be substantiated by investigating ectopic mutant SARS in transfected HEK293T cells. In the second family, we found a compound heterozygous genotype of the mitochondrial tryptophanyl-tRNA synthetase (WARS2) gene, comprising a nonsense mutation (c.325delA, p.Ser109Alafs*15), which very likely entails nonsense-mediated mRNA decay and a missense mutation (c.37T>G, p.Trp13Gly). The latter affects the mitochondrial localization signal of WARS2, causing protein mislocalization. Including AIMP1, which we have recently implicated in the etiology of ID, three genes with a role in tRNA-aminoacylation are now associated with this condition. We therefore suggest that the functional integrity of tRNAs in general is an important factor in the development and maintenance of human cognitive functions. © 2017 Wiley Periodicals, Inc.

Mutational spectrum of Xeroderma pigmentosum group A in Egyptian patients.

PubMed

Amr, Khalda; Messaoud, Olfa; El Darouti, Mohamad; Abdelhak, Sonia; El-Kamah, Ghada

2014-01-01

Xeroderma pigmentosum (XP) is a rare autosomal recessive hereditary disease characterized by hyperphotosensitivity, DNA repair defects and a predisposition to skin cancers. The most frequently occurring type worldwide is the XP group A (XPA). There is a close relationship between the clinical features that ranged from severe to mild form and the mutational site in XPA gene. The aim of this study is to carry out the mutational analysis in Egyptian patients with XP-A. This study was carried out on four unrelated Egyptian XP-A families. Clinical features were examined and direct sequencing of the coding region of XPA gene was performed in patients and their parents. Direct sequencing of the whole coding region of the XPA gene revealed the identification of two homozygous nonsense mutations: (c.553C >T; p.(Gln185)) and (c.331G>T; p.(Glu111)), which create premature, stop codon and a homodeletion (c.374delC: p.Thr125Ilefs 15) that leads to frameshift and premature translation termination. We report the identification of one novel XPA gene mutation and two known mutations in four unrelated Egyptian families with Xermoderma pigmentosum. All explored patients presented severe neurological abnormalities and have mutations located in the DNA binding domain. This report gives insight on the mutation spectrum of XP-A in Egypt. This would provide a valuable tool for early diagnosis of this severe disease. © 2013 Elsevier B.V. All rights reserved.

A multiplex method for detection of glucose-6-phosphate dehydrogenase (G6PD) gene mutations.

PubMed

Zhang, L; Yang, Y; Liu, R; Li, Q; Yang, F; Ma, L; Liu, H; Chen, X; Yang, Z; Cui, L; He, Y

2015-12-01

Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common human enzyme defect caused by G6PD gene mutations. This study aimed to develop a cost-effective, multiplex, genotyping method for detecting common mutations in the G6PD gene. We used a SNaPshot approach to genotype multiple G6PD mutations that are common to human populations in South-East Asia. This assay is based on multiplex PCR coupled with primer extension reactions. Different G6PD gene mutations were determined by peak retention time and colors of the primer extension products. We designed PCR primers for multiplex amplification of the G6PD gene fragments and for primer extension reactions to genotype 11 G6PD mutations. DNA samples from a total of 120 unrelated G6PD-deficient individuals from the China-Myanmar border area were used to establish and validate this method. Direct sequencing of the PCR products demonstrated 100% concordance between the SNaPshot and the sequencing results. The SNaPshot method offers a specific and sensitive alternative for simultaneously interrogating multiple G6PD mutations. © 2015 John Wiley & Sons Ltd.

Two novel mutations in the alpha-galactosidase gene in Japanese classical hemizygotes with Fabry disease.

PubMed

Okumiya, T; Takenaka, T; Ishii, S; Kase, R; Kamei, S; Sakuraba, H

1996-09-01

Four alpha-galactosidase gene mutations were identified in Japanese male patients with Fabry disease who had no detectable alpha-galactosidase activity. Two of them were novel mutations, an 11-bp deletion in exon 2 and a g-1 to t substitution at the 3' end of the splice acceptor site in intron 1. The former caused a frameshift and led to the creation of a new stop codon at codon 118. The latter was predicted to provoke aberrant mRNA splicing followed by accelerated degradation of the mRNA. A nonsense mutation, R301X, and a 2-bp deletion starting at nucleotide position 718, which were reported previously, were also identified in unrelated patients.

[Leigh syndrome caused by the mitochondrial DNA G14459A mutation in a Mexican family].

PubMed

Gutiérrez, A; Saldaña-Martínez, A; García-Ramírez, R; Rayo-Mares, D; Carreras, M; López-Pérez, M J; Ruiz-Pesini, E; Montoya, J; Montiel-Sosa, J F

Leigh syndrome is a neurodegenerative and progressive disease that appears usually in childhood due to defects in nuclear or mitochondrial genome. The mutation G14459A in mitochondrial DNA has been associated previously to Leber hereditary optic neuropathy and recently to Leigh syndrome. A 10 months-old Mexican girl diagnosed of Leigh syndrome. Molecular-genetic studies detected the mutation G14459A in a percentage close to homoplasmy and in low heteroplasmy in her mother. The rest of the maternally related family members analyzed were negative. The G14459A mutation, although not very frequently associated to Leigh syndrome, should be analyzed in patients that do not present the most common point mutations.

46 CFR 154.428 - Allowable stress.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 46 Shipping 5 2010-10-01 2010-10-01 false Allowable stress. 154.428 Section 154.428 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS FOR... § 154.428 Allowable stress. The membrane tank and the supporting insulation must have allowable stresses...

49 CFR 238.428 - Overheat sensors.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 49 Transportation 4 2014-10-01 2014-10-01 false Overheat sensors. 238.428 Section 238.428... Equipment § 238.428 Overheat sensors. Overheat sensors for each wheelset journal bearing shall be provided. The sensors may be placed either onboard the equipment or at reasonable intervals along the railroad's...

49 CFR 238.428 - Overheat sensors.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 49 Transportation 4 2013-10-01 2013-10-01 false Overheat sensors. 238.428 Section 238.428... Equipment § 238.428 Overheat sensors. Overheat sensors for each wheelset journal bearing shall be provided. The sensors may be placed either onboard the equipment or at reasonable intervals along the railroad's...

46 CFR 154.428 - Allowable stress.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 46 Shipping 5 2011-10-01 2011-10-01 false Allowable stress. 154.428 Section 154.428 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS FOR... § 154.428 Allowable stress. The membrane tank and the supporting insulation must have allowable stresses...

46 CFR 154.428 - Allowable stress.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 46 Shipping 5 2013-10-01 2013-10-01 false Allowable stress. 154.428 Section 154.428 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS FOR... § 154.428 Allowable stress. The membrane tank and the supporting insulation must have allowable stresses...

46 CFR 154.428 - Allowable stress.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 46 Shipping 5 2014-10-01 2014-10-01 false Allowable stress. 154.428 Section 154.428 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS FOR... § 154.428 Allowable stress. The membrane tank and the supporting insulation must have allowable stresses...

46 CFR 154.428 - Allowable stress.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 46 Shipping 5 2012-10-01 2012-10-01 false Allowable stress. 154.428 Section 154.428 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS FOR... § 154.428 Allowable stress. The membrane tank and the supporting insulation must have allowable stresses...

42 CFR 417.428 - Marketing activities.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 42 Public Health 3 2011-10-01 2011-10-01 false Marketing activities. 417.428 Section 417.428... PREPAYMENT PLANS Enrollment, Entitlement, and Disenrollment under Medicare Contract § 417.428 Marketing... marketing requirements set forth in subpart V of part 422 of this chapter also apply to Medicare contracts...

42 CFR 417.428 - Marketing activities.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 42 Public Health 3 2010-10-01 2010-10-01 false Marketing activities. 417.428 Section 417.428... PREPAYMENT PLANS Enrollment, Entitlement, and Disenrollment under Medicare Contract § 417.428 Marketing... marketing requirements set forth in subpart V of part 422 of this chapter also apply to Medicare contracts...

Molecular and clinical aspects of GHRH receptor mutations.

PubMed

Corazzini, Valentina; Salvatori, Roberto

2013-01-01

The growth hormone (GH)-releasing hormone (GHRH) receptor (GHRHR) belongs to the G protein-coupled receptor family. It binds GHRH resulting in somatotroph cell proliferation and stimulation of GH secretion. Mutations in the gene encoding for GHRHR (GHRHR, OMIM No. 139191) are being reported with increasing frequency in familial isolated GH deficiency. To date, the reported GHRHR mutations include eight missense, seven splice, three microdeletions, and two non-sense mutations. One promoter mutation has also been reported. Most of these mutations show a recessive mode of inheritance. The phenotype includes reduced but not absent serum GH, with abnormal response to a variety of stimuli, and low serum insulin-like growth factor-1 levels, resulting in proportionate growth failure which becomes evident in the first year of life. These patients respond well to GH replacement therapy. Phenotypical observations coming from some unusually large kindreds with untreated GH deficiency due to homozygous GHRHR mutations have allowed the study of the consequences of lifetime lack of GH. This chapter reviews the structure and the role of the GHRHR together with the clinical aspects associated with its mutations. Copyright © 2013 S. Karger AG, Basel.

MELAS syndrome, cardiomyopathy, rhabdomyolysis, and autism associated with the A3260G mitochondrial DNA mutation.

PubMed

Connolly, Barbara S; Feigenbaum, Annette S J; Robinson, Brian H; Dipchand, Anne I; Simon, David K; Tarnopolsky, Mark A

2010-11-12

The A to G transition mutation at position 3260 of the mitochondrial genome is usually associated with cardiomyopathy and myopathy. One Japanese kindred reported the phenotype of mitochondrial encephalomyopathy, lactic acidosis and stroke-like episodes (MELAS syndrome) in association with the A3260G mtDNA mutation. We describe the first Caucasian cases of MELAS syndrome associated with the A3260G mutation. Furthermore, this mutation was associated with exercise-induced rhabdomyolysis, hearing loss, seizures, cardiomyopathy, and autism in the large kindred. We conclude that the A3260G mtDNA mutation is associated with wide phenotypic heterogeneity with MELAS and other "classical" mitochondrial phenotypes being manifestations. Copyright © 2010 Elsevier Inc. All rights reserved.

Whole-exome sequencing revealed two novel mutations in Usher syndrome.

PubMed

Koparir, Asuman; Karatas, Omer Faruk; Atayoglu, Ali Timucin; Yuksel, Bayram; Sagiroglu, Mahmut Samil; Seven, Mehmet; Ulucan, Hakan; Yuksel, Adnan; Ozen, Mustafa

2015-06-01

Usher syndrome is a clinically and genetically heterogeneous autosomal recessive inherited disorder accompanied by hearing loss and retinitis pigmentosa (RP). Since the associated genes are various and quite large, we utilized whole-exome sequencing (WES) as a diagnostic tool to identify the molecular basis of Usher syndrome. DNA from a 12-year-old male diagnosed with Usher syndrome was analyzed by WES. Mutations detected were confirmed by Sanger sequencing. The pathogenicity of these mutations was determined by in silico analysis. A maternally inherited deleterious frameshift mutation, c.14439_14454del in exon 66 and a paternally inherited non-sense c.10830G>A stop-gain SNV in exon 55 of USH2A were found as two novel compound heterozygous mutations. Both of these mutations disrupt the C terminal of USH2A protein. As a result, WES revealed two novel compound heterozygous mutations in a Turkish USH2A patient. This approach gave us an opportunity to have an appropriate diagnosis and provide genetic counseling to the family within a reasonable time. Copyright © 2015 Elsevier B.V. All rights reserved.

De novo SOX10 Nonsense Mutation in a Patient with Kallmann Syndrome, Deafness, Iris Hypopigmentation, and Hyperthyroidism.

PubMed

Wang, Fang; Zhao, Shaoli; Xie, Yanhong; Yang, Wenjun; Mo, Zhaohui

2018-03-01

Kallmann syndrome (KS) is a clinically and genetically heterogeneous disorder characterized by hypogonadotropic hypogonadism and olfactory dysfunction. Recently, mutations in SOX10, a well-known causative gene of Waardenburg syndrome (WS), have been identified in a few KS patients with additional developmental defects including hearing loss. However, the understanding of SOX10 mutation associates with KS and other clinical consequences remains fragmentary. A 30-year-old Chinese male patient presented with no pubertal sex development when he was at the age of twelve years. Additionally, he showed anosmia, sensory deafness, and blue irises. Last year, he developed clinical symptoms of hyperthyroidism with a fast heartbeat, heat intolerance and weight loss. Blood examinations revealed low levels of FSH, LH, and testosterone. Thyroid function showed high levels of FT3, FT4 and extremely low level of TSH. Molecular analysis detected a de novo (c.565G>T/p.E189X) mutation in SOX10, which has previously been reported in a patient with WS4 (WS with Hirschsprung). The mutation was predicted to be probably damaging. These results highlight the significance of SOX10 haploinsufficiency as a genetic cause of KS. Importantly, our result implies that the same SOX10 mutation can underlie both typical KS and WS, while the correlation between SOX10 and hyperthyroidism still needs to be clarified in the future. © 2018 by the Association of Clinical Scientists, Inc.

24 CFR 4.28 - Civil penalties.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Civil penalties. 4.28 Section 4.28... REFORM ACT Prohibition of Advance Disclosure of Funding Decisions § 4.28 Civil penalties. Whenever any... civil money penalty on the employee in accordance with the provisions of 24 CFR part 30. ...

24 CFR 4.28 - Civil penalties.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 24 Housing and Urban Development 1 2013-04-01 2013-04-01 false Civil penalties. 4.28 Section 4.28... REFORM ACT Prohibition of Advance Disclosure of Funding Decisions § 4.28 Civil penalties. Whenever any... civil money penalty on the employee in accordance with the provisions of 24 CFR part 30. ...

24 CFR 4.28 - Civil penalties.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 24 Housing and Urban Development 1 2011-04-01 2011-04-01 false Civil penalties. 4.28 Section 4.28... REFORM ACT Prohibition of Advance Disclosure of Funding Decisions § 4.28 Civil penalties. Whenever any... civil money penalty on the employee in accordance with the provisions of 24 CFR part 30. ...

24 CFR 4.28 - Civil penalties.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 24 Housing and Urban Development 1 2014-04-01 2014-04-01 false Civil penalties. 4.28 Section 4.28... REFORM ACT Prohibition of Advance Disclosure of Funding Decisions § 4.28 Civil penalties. Whenever any... civil money penalty on the employee in accordance with the provisions of 24 CFR part 30. ...

24 CFR 4.28 - Civil penalties.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 24 Housing and Urban Development 1 2012-04-01 2012-04-01 false Civil penalties. 4.28 Section 4.28... REFORM ACT Prohibition of Advance Disclosure of Funding Decisions § 4.28 Civil penalties. Whenever any... civil money penalty on the employee in accordance with the provisions of 24 CFR part 30. ...

DEPDC5 mutations are not a frequent cause of familial temporal lobe epilepsy.

PubMed

Striano, Pasquale; Serioli, Elena; Santulli, Lia; Manna, Ida; Labate, Angelo; Dazzo, Emanuela; Pasini, Elena; Gambardella, Antonio; Michelucci, Roberto; Striano, Salvatore; Nobile, Carlo

2015-10-01

Mutations in the DEPDC5 (DEP domain-containing protein 5) gene are a major cause of familial focal epilepsy with variable foci (FFEVF) and are predicted to account for 12-37% of families with inherited focal epilepsies. To assess the clinical impact of DEPDC5 mutations in familial temporal lobe epilepsy, we screened a collection of Italian families with either autosomal dominant lateral temporal epilepsy (ADLTE) or familial mesial temporal lobe epilepsy (FMTLE). The probands of 28 families classified as ADLTE and 17 families as FMTLE were screened for DEPDC5 mutations by whole exome or targeted massive parallel sequencing. Putative mutations were validated by Sanger sequencing. We identified a DEPDC5 nonsense mutation (c.918C>G; p.Tyr306*) in a family with two affected members, clinically classified as FMTLE. The proband had temporal lobe seizures with prominent psychic symptoms (déjà vu, derealization, and forced thoughts); her mother had temporal lobe seizures, mainly featuring visceral epigastric auras and anxiety. In total, we found a single DEPDC5 mutation in one of (2.2%) 45 families with genetic temporal lobe epilepsy, a proportion much lower than that reported in other inherited focal epilepsies. © 2015 The Authors. Epilepsia published by Wiley Periodicals Inc. on behalf of International League Against Epilepsy.

Whole Exome Sequencing, Familial Genomic Triangulation, and Systems Biology Converge to Identify a Novel Nonsense Mutation in TAB2-encoded TGF-beta Activated Kinase 1 in a Child with Polyvalvular Syndrome.

PubMed

Ackerman, Jaeger P; Smestad, John A; Tester, David J; Qureshi, Muhammad Y; Crabb, Beau A; Mendelsohn, Nancy J; Ackerman, Michael J

2016-09-01

To use whole exome sequencing (WES) of a family trio to identify a genetic cause for polyvalvular syndrome. A male child was born with mild pulmonary valve stenosis and mild aortic root dilatation, and an atrial septal defect, ventricular septal defect, and patent ductus arteriosus that were closed surgically. Subsequently, the phenotype of polyvalvular syndrome with involvement of both semilunar and both atrioventricular valves emerged. His family history was negative for congenital heart disease. Because of hypotonia, myopia, soft pale skin, joint hypermobility, and mild facial dysmorphism, either Noonan syndrome- or William syndrome-spectrum disorders were suspected clinically. However, chromosomal analysis was normal and commercially available Noonan syndrome and William syndrome genetic tests were negative. Whole exome sequencing of the patient and both parents was performed. Variants were analyzed by sporadic and autosomal recessive inheritance models. A sporadic mutation, annotated as c.1491 T > A, in TAB2, resulting in a nonsense mutation, p.Y497X, in the TAB2-encoded TGF-beta activated kinase 1 (TAK1) was identified as the most likely disease-susceptibility gene. This mutation results in elimination of the terminal 197 amino acids, including the C-terminal binding motif critical for interactions with TRAF6 and TAK1. The combination of WES, genomic triangulation, and systems biology has uncovered perturbations in TGF-beta activated kinase 1 signaling as a novel pathogenic substrate for polyvalvular syndrome. © 2016 Wiley Periodicals, Inc.

Mutation screening of SEMA3A and SEMA7A in patients with congenital hypogonadotropic hypogonadism.

PubMed

Känsäkoski, Johanna; Fagerholm, Rainer; Laitinen, Eeva-Maria; Vaaralahti, Kirsi; Hackman, Peter; Pitteloud, Nelly; Raivio, Taneli; Tommiska, Johanna

2014-05-01

Congenital hypogonadotropic hypogonadism (HH), a rare disorder characterized by absent, partial, or delayed puberty, can be caused by the lack or deficient number of hypothalamic gonadotropin-releasing hormone (GnRH) neurons. SEMA3A was recently implicated in the etiology of the disorder, and Sema7A-deficient mice have a reduced number of GnRH neurons in their brains. SEMA3A and SEMA7A were screened by Sanger sequencing in altogether 50 Finnish HH patients (34 with Kallmann syndrome (KS; HH with hyposmia/anosmia) and 16 with normosmic HH (nHH)). In 20 patients, mutation(s) had already been found in genes known to be implicated in congenital HH. Three heterozygous variants (c.458A>G (p.Asn153Ser), c.1253A>G (p.Asn418Ser), and c.1303G>A (p.Val435Ile)) were found in SEMA3A in three KS patients, two of which also had a mutation in FGFR1. Two rare heterozygous variants (c.442C>T (p.Arg148Trp) and c.1421G>A (p.Arg474Gln)) in SEMA7A were found in one male nHH patient with a previously identified KISS1R nonsense variant and one male KS patient with a previously identified mutation in KAL1, respectively. Our results suggest that heterozygous missense variants in SEMA3A and SEMA7A may modify the phenotype of KS but most likely are not alone sufficient to cause the disorder.

A novel alpha-thalassemia nonsense mutation in HBA2: C.382 A > T globin gene.

PubMed

Hamid, Mohammad; Bokharaei Merci, Hanieh; Galehdari, Hamid; Saberi, Ali Hossein; Kaikhaei, Bijan; Mohammadi-Anaei, Marziye; Ahmadzadeh, Ahmad; Shariati, Gholamreza

2014-07-01

In this study, a new alpha globin gene mutation on the α2-globin gene is reported. This mutation resulted in a Lys > stop codon substitution at position 127 which was detected in four individuals (three males and one female). DNA sequencing revealed this mutation in unrelated persons in Khuzestan province, Southwestern Iran of Lor ethnicity. This mutation caused no severe hematological abnormalities in the carriers. From the nature of substituted residues in α2-globin, it is widely expected that this mutation leads to unstable and truncated protein and should be detected in couples at risk for α-thalassemia.

MLL2 mutation detection in 86 patients with Kabuki syndrome: a genotype-phenotype study.

PubMed

Makrythanasis, P; van Bon, B W; Steehouwer, M; Rodríguez-Santiago, B; Simpson, M; Dias, P; Anderlid, B M; Arts, P; Bhat, M; Augello, B; Biamino, E; Bongers, E M H F; Del Campo, M; Cordeiro, I; Cueto-González, A M; Cuscó, I; Deshpande, C; Frysira, E; Izatt, L; Flores, R; Galán, E; Gener, B; Gilissen, C; Granneman, S M; Hoyer, J; Yntema, H G; Kets, C M; Koolen, D A; Marcelis, C l; Medeira, A; Micale, L; Mohammed, S; de Munnik, S A; Nordgren, A; Psoni, S; Reardon, W; Revencu, N; Roscioli, T; Ruiterkamp-Versteeg, M; Santos, H G; Schoumans, J; Schuurs-Hoeijmakers, J H M; Silengo, M C; Toledo, L; Vendrell, T; van der Burgt, I; van Lier, B; Zweier, C; Reymond, A; Trembath, R C; Perez-Jurado, L; Dupont, J; de Vries, B B A; Brunner, H G; Veltman, J A; Merla, G; Antonarakis, S E; Hoischen, A

2013-12-01

Recently, pathogenic variants in the MLL2 gene were identified as the most common cause of Kabuki (Niikawa-Kuroki) syndrome (MIM#147920). To further elucidate the genotype-phenotype correlation, we studied a large cohort of 86 clinically defined patients with Kabuki syndrome (KS) for mutations in MLL2. All patients were assessed using a standardized phenotype list and all were scored using a newly developed clinical score list for KS (MLL2-Kabuki score 0-10). Sequencing of the full coding region and intron-exon boundaries of MLL2 identified a total of 45 likely pathogenic mutations (52%): 31 nonsense, 10 missense and four splice-site mutations, 34 of which were novel. In five additional patients, novel, i.e. non-dbSNP132 variants of clinically unknown relevance, were identified. Patients with likely pathogenic nonsense or missense MLL2 mutations were usually more severely affected (median 'MLL2-Kabuki score' of 6) as compared to the patients without MLL2 mutations (median 'MLL2-Kabuki score' of 5), a significant difference (p < 0.0014). Several typical facial features such as large dysplastic ears, arched eyebrows with sparse lateral third, blue sclerae, a flat nasal tip with a broad nasal root, and a thin upper and a full lower lip were observed more often in mutation positive patients. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Slowly progressive retinitis pigmentosa caused by two novel mutations in the MAK gene.

PubMed

Gray, Joanna Monika; Orlans, Harry Otway; Shanks, Morag; Clouston, Penny; MacLaren, Robert Elvis

2018-05-21

The growing number of clinical trials currently underway for inherited retinal diseases has highlighted the importance of achieving a molecular diagnosis for all new cases presenting to hospital eye services. The male germ cell-associated kinase (MAK) gene encodes a cilium-associated protein selectively expressed in the retina and testis, and has recently been implicated in autosomal recessive retinitis pigmentosa (RP). Whole exome sequencing has previously identified a homozygous Alu insertion in probands with recessive RP and nonsense and missense mutations have also been reported. Here we describe two novel mutations in different alleles of the MAK gene in a 75-year-old British female, who had a clinical diagnosis of RP () with onset in the fourth decade and no relevant family history. The mutations were established through next generation sequencing of a panel of 111 genes associated with RP and RP-like phenotypes. Two novel null mutations were identified within the MAK gene. The first c.1195_1196delAC p.(Thr399fs), was a two base-pair deletion creating a frame-shift in exon 9 predicted to result in nonsense-mediated decay. The second, c.279-2A>G, involved the splice acceptor consensus site upstream of exon 4, predicted to lead to aberrant splicing. The natural history of this individual's RP is consistent with previously described MAK mutations, being significantly milder than that associated with other photoreceptor ciliopathies. We suggest inclusion of MAK as part of wider genetic testing in all individuals presenting with RP.

Identification of a novel LMF1 nonsense mutation responsible for severe hypertriglyceridemia by targeted next-generation sequencing.

PubMed

Cefalù, Angelo B; Spina, Rossella; Noto, Davide; Ingrassia, Valeria; Valenti, Vincenza; Giammanco, Antonina; Fayer, Francesca; Misiano, Gabriella; Cocorullo, Gianfranco; Scrimali, Chiara; Palesano, Ornella; Altieri, Grazia I; Ganci, Antonina; Barbagallo, Carlo M; Averna, Maurizio R

Severe hypertriglyceridemia (HTG) may result from mutations in genes affecting the intravascular lipolysis of triglyceride (TG)-rich lipoproteins. The aim of this study was to develop a targeted next-generation sequencing panel for the molecular diagnosis of disorders characterized by severe HTG. We developed a targeted customized panel for next-generation sequencing Ion Torrent Personal Genome Machine to capture the coding exons and intron/exon boundaries of 18 genes affecting the main pathways of TG synthesis and metabolism. We sequenced 11 samples of patients with severe HTG (TG>885 mg/dL-10 mmol/L): 4 positive controls in whom pathogenic mutations had previously been identified by Sanger sequencing and 7 patients in whom the molecular defect was still unknown. The customized panel was accurate, and it allowed to confirm genetic variants previously identified in all positive controls with primary severe HTG. Only 1 patient of 7 with HTG was found to be carrier of a homozygous pathogenic mutation of the third novel mutation of LMF1 gene (c.1380C>G-p.Y460X). The clinical and molecular familial cascade screening allowed the identification of 2 additional affected siblings and 7 heterozygous carriers of the mutation. We showed that our targeted resequencing approach for genetic diagnosis of severe HTG appears to be accurate, less time consuming, and more economical compared with traditional Sanger resequencing. The identification of pathogenic mutations in candidate genes remains challenging and clinical resequencing should mainly intended for patients with strong clinical criteria for monogenic severe HTG. Copyright © 2017 National Lipid Association. Published by Elsevier Inc. All rights reserved.

Mutations in the human GlyT2 gene define a presynaptic component of human startle disease

PubMed Central

Rees, Mark I.; Harvey, Kirsten; Pearce, Brian R.; Chung, Seo-Kyung; Duguid, Ian C.; Thomas, Philip; Beatty, Sarah; Graham, Gail E.; Armstrong, Linlea; Shiang, Rita; Abbott, Kim J.; Zuberi, Sameer M.; Stephenson, John B.P.; Owen, Michael J.; Tijssen, Marina A.J.; van den Maagdenberg, Arn M.J.M.; Smart, Trevor G.; Supplisson, Stéphane; Harvey, Robert J.

2011-01-01

Hyperekplexia is a human neurological disorder characterized by an excessive startle response and is typically caused by missense and nonsense mutations in the gene encoding the inhibitory glycine receptor (GlyR) α1 subunit (GLRA1)1-3. Genetic heterogeneity has been confirmed in isolated sporadic cases with mutations in other postsynaptic glycinergic proteins including the GlyR β subunit (GLRB)4, gephyrin (GPHN)5 and RhoGEF collybistin (ARHGEF9)6. However, many sporadic patients diagnosed with hyperekplexia do not carry mutations in these genes2-7. Here we reveal that missense, nonsense and frameshift mutations in the presynaptic glycine transporter 2 (GlyT2) gene (SLC6A5)8 also cause hyperekplexia. Patients harbouring mutations in SLC6A5 presented with hypertonia, an exaggerated startle response to tactile or acoustic stimuli, and life-threatening neonatal apnoea episodes. GlyT2 mutations result in defective subcellular localisation and/or decreased glycine uptake, with selected mutations affecting predicted glycine and Na+ binding sites. Our results demonstrate that SLC6A5 is a major gene for hyperekplexia and define the first neurological disorder linked to mutations in a Na+/Cl−-dependent transporter for a classical fast neurotransmitter. By analogy, we suggest that in other human disorders where defects in postsynaptic receptors have been identified, similar symptoms could result from defects in the cognate presynaptic neurotransmitter transporter. PMID:16751771

A novel mutation MT-COIII m.9267G>C and MT-COI m.5913G>A mutation in mitochondrial genes in a Tunisian family with maternally inherited diabetes and deafness (MIDD) associated with sever nephropathy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tabebi, Mouna, E-mail: mouna.biologiste@yahoo.com; Mkaouar-Rebai, Emna; Mnif, Mouna

Mitochondrial diabetes (MD) is a heterogeneous disorder characterized by a chronic hyperglycemia, maternal transmission and its association with a bilateral hearing impairment. Several studies reported mutations in mitochondrial genes as potentially pathogenic for diabetes, since mitochondrial oxidative phosphorylation plays an important role in glucose-stimulated insulin secretion from beta cells. In the present report, we studied a Tunisian family with mitochondrial diabetes (MD) and deafness associated with nephropathy. The mutational analysis screening revealed the presence of a novel heteroplasmic mutation m.9276G>C in the mitochondrial COIII gene, detected in mtDNA extracted from leukocytes of a mother and her two daughters indicating thatmore » this mutation is maternally transmitted and suggest its implication in the observed phenotype. Bioinformatic tools showed that m.9267G>C mutation (p.A21P) is « deleterious » and it can modify the function and the stability of the MT-COIII protein by affecting the assembly of mitochondrial COX subunits and the translocation of protons then reducing the activity of the respective OXPHOS complexes of ATP synthesis. The nonsynonymous mutation (p.A21P) has not been reported before, it is the first mutation described in the COXIII gene which is related to insulin dependent mitochondrial diabetes and deafness and could be specific to the Tunisian population. The m.9267G>C mutation was present with a nonsynonymous inherited mitochondrial homoplasmic variation MT-COI m.5913 G>A (D4N) responsible of high blood pressure, a clinical feature detected in all explored patients. - Highlights: • MT-COX3 m.9267G>C (p.A21P), heteroplasmic substitution, is not reported in any database. • m.9267G>C can be responsible of the MIDD associated with nephropaty. • This substitution can modify the function and the stability of the MT-CO3 protein. • This substitution can modify MT-CO3 structure (2D and 3D). • MT-COX3 m.9267G>C is

Congenital myopathy is caused by mutation of HACD1

PubMed Central

Muhammad, Emad; Reish, Orit; Ohno, Yusuke; Scheetz, Todd; DeLuca, Adam; Searby, Charles; Regev, Miriam; Benyamini, Lilach; Fellig, Yakov; Kihara, Akio; Sheffield, Val C.; Parvari, Ruti

2013-01-01

Congenital myopathies are heterogeneous inherited diseases of muscle characterized by a range of distinctive histologic abnormalities. We have studied a consanguineous family with congenital myopathy. Genome-wide linkage analysis and whole-exome sequencing identified a homozygous non-sense mutation in 3-hydroxyacyl-CoA dehydratase 1 (HACD1) in affected individuals. The mutation results in non-sense mediated decay of the HACD1 mRNA to 31% of control levels in patient muscle and completely abrogates the enzymatic activity of dehydration of 3-hydroxyacyl-CoA, the third step in the elongation of very long-chain fatty acids (VLCFAs). We describe clinical findings correlated with a deleterious mutation in a gene not previously known to be associated with congenital myopathy in humans. We suggest that the mutation in the HACD1 gene causes a reduction in the synthesis of VLCFAs, which are components of membrane lipids and participants in physiological processes, leading to congenital myopathy. These data indicate that HACD1 is necessary for muscle function. PMID:23933735

40 CFR 428.94 - [Reserved

Code of Federal Regulations, 2011 CFR

2011-07-01

... 40 Protection of Environment 30 2011-07-01 2011-07-01 false [Reserved] 428.94 Section 428.94 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS RUBBER MANUFACTURING POINT SOURCE CATEGORY Pan, Dry Digestion, and Mechanical Reclaimed Rubber...

40 CFR 428.94 - [Reserved

Code of Federal Regulations, 2010 CFR

2010-07-01

... 40 Protection of Environment 29 2010-07-01 2010-07-01 false [Reserved] 428.94 Section 428.94 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS RUBBER MANUFACTURING POINT SOURCE CATEGORY Pan, Dry Digestion, and Mechanical Reclaimed Rubber...

Whole exome sequencing identifies mutations in Usher syndrome genes in profoundly deaf Tunisian patients.

PubMed

Riahi, Zied; Bonnet, Crystel; Zainine, Rim; Lahbib, Saida; Bouyacoub, Yosra; Bechraoui, Rym; Marrakchi, Jihène; Hardelin, Jean-Pierre; Louha, Malek; Largueche, Leila; Ben Yahia, Salim; Kheirallah, Moncef; Elmatri, Leila; Besbes, Ghazi; Abdelhak, Sonia; Petit, Christine

2015-01-01

Usher syndrome (USH) is an autosomal recessive disorder characterized by combined deafness-blindness. It accounts for about 50% of all hereditary deafness blindness cases. Three clinical subtypes (USH1, USH2, and USH3) are described, of which USH1 is the most severe form, characterized by congenital profound deafness, constant vestibular dysfunction, and a prepubertal onset of retinitis pigmentosa. We performed whole exome sequencing in four unrelated Tunisian patients affected by apparently isolated, congenital profound deafness, with reportedly normal ocular fundus examination. Four biallelic mutations were identified in two USH1 genes: a splice acceptor site mutation, c.2283-1G>T, and a novel missense mutation, c.5434G>A (p.Glu1812Lys), in MYO7A, and two previously unreported mutations in USH1G, i.e. a frameshift mutation, c.1195_1196delAG (p.Leu399Alafs*24), and a nonsense mutation, c.52A>T (p.Lys18*). Another ophthalmological examination including optical coherence tomography actually showed the presence of retinitis pigmentosa in all the patients. Our findings provide evidence that USH is under-diagnosed in Tunisian deaf patients. Yet, early diagnosis of USH is of utmost importance because these patients should undergo cochlear implant surgery in early childhood, in anticipation of the visual loss.

Cardiac abnormalities in patients with mitochondrial DNA mutation 3243A>G.

PubMed

Majamaa-Voltti, Kirsi; Peuhkurinen, Keijo; Kortelainen, Marja-Leena; Hassinen, Ilmo E; Majamaa, Kari

2002-08-01

Tissues that depend on aerobic energy metabolism suffer most in diseases caused by mutations in mitochondrial DNA (mtDNA). Cardiac abnormalities have been described in many cases, but their frequency and clinical spectrum among patients with mtDNA mutations is unknown. Thirty-nine patients with the 3243A>G mtDNA mutation were examined, methods used included clinical evaluation, electrocardiogram, Holter recording and echocardiography. Autopsy reports on 17 deceased subjects were also reviewed. The degree of 3243A>G mutation heteroplasmy was determined using an Apa I restriction fragment analysis. Better hearing level (BEHL0.5-4 kHz) was used as a measure of the clinical severity of disease. Left ventricular hypertrophy (LVH) was diagnosed in 19 patients (56%) by echocardiography and in six controls (15%) giving an odds ratio of 7.5 (95% confidence interval; 1.74-67). The dimensions of the left ventricle suggested a concentric hypertrophy. Left ventricular systolic or diastolic dysfunction was observed in 11 patients. Holter recording revealed frequent ventricular extrasystoles (>10/h) in five patients. Patients with LVH differed significantly from those without LVH in BEHL0.5-4 kHz, whereas the contribution of age or the degree of the mutant heteroplasmy in skeletal muscle to the risk of LVH was less remarkable. Structural and functional abnormalities of the heart were common in patients with 3243A>G. The risk of LVH was related to the clinical severity of the phenotype, and to a lesser degree to age, suggesting that patients presenting with any symptoms from the mutation should also be evaluated for cardiac abnormalities.

A Novel Missense Mutation of Doublecortin: Mutation Analysis of Korean Patients with Subcortical Band Heterotopia

PubMed Central

Kim, Myeong-Kyu; Park, Man-Seok; Kim, Byeong-Chae; Cho, Ki-Hyun; Kim, Young-Seon; Kim, Jin-Hee; Heo, Tag; Kim, Eun-Young

2005-01-01

The neuronal migration disorders, X-linked lissencephaly syndrome (XLIS) and subcortical band heterotopia (SBH), also called "double cortex", have been linked to missense, nonsense, aberrant splicing, deletion, and insertion mutations in doublecortin (DCX) in families and sporadic cases. Most DCX mutations identified to date are located in two evolutionarily conserved domains. We performed mutation analysis of DCX in two Korean patients with SBH. The SBH patients had mild to moderate developmental delays, drug-resistant generalized seizures, and diffuse thick SBH upon brain MRI. Sequence analysis of the DCX coding region in Patient 1 revealed a c.386 C>T change in exon 3. The sequence variation results in a serine to leucine amino acid change at position 129 (S129L), which has not been found in other family members of Patient 1 or in a large panel of 120 control X-chromosomes. We report here a novel c.386 C>T mutation of DCX that is responsible for SBH. PMID:16100463

Gain-of-Function Mutations in ZIC1 Are Associated with Coronal Craniosynostosis and Learning Disability

PubMed Central

Twigg, Stephen R.F.; Forecki, Jennifer; Goos, Jacqueline A.C.; Richardson, Ivy C.A.; Hoogeboom, A. Jeannette M.; van den Ouweland, Ans M.W.; Swagemakers, Sigrid M.A.; Lequin, Maarten H.; Van Antwerp, Daniel; McGowan, Simon J.; Westbury, Isabelle; Miller, Kerry A.; Wall, Steven A.; van der Spek, Peter J.; Mathijssen, Irene M.J.; Pauws, Erwin; Merzdorf, Christa S.; Wilkie, Andrew O.M.

2015-01-01

Human ZIC1 (zinc finger protein of cerebellum 1), one of five homologs of the Drosophila pair-rule gene odd-paired, encodes a transcription factor previously implicated in vertebrate brain development. Heterozygous deletions of ZIC1 and its nearby paralog ZIC4 on chromosome 3q25.1 are associated with Dandy-Walker malformation of the cerebellum, and loss of the orthologous Zic1 gene in the mouse causes cerebellar hypoplasia and vertebral defects. We describe individuals from five families with heterozygous mutations located in the final (third) exon of ZIC1 (encoding four nonsense and one missense change) who have a distinct phenotype in which severe craniosynostosis, specifically involving the coronal sutures, and variable learning disability are the most characteristic features. The location of the nonsense mutations predicts escape of mutant ZIC1 transcripts from nonsense-mediated decay, which was confirmed in a cell line from an affected individual. Both nonsense and missense mutations are associated with altered and/or enhanced expression of a target gene, engrailed-2, in a Xenopus embryo assay. Analysis of mouse embryos revealed a localized domain of Zic1 expression at embryonic days 11.5–12.5 in a region overlapping the supraorbital regulatory center, which patterns the coronal suture. We conclude that the human mutations uncover a previously unsuspected role for Zic1 in early cranial suture development, potentially by regulating engrailed 1, which was previously shown to be critical for positioning of the murine coronal suture. The diagnosis of a ZIC1 mutation has significant implications for prognosis and we recommend genetic testing when common causes of coronal synostosis have been excluded. PMID:26340333

40 CFR 428.94 - [Reserved

Code of Federal Regulations, 2012 CFR

2012-07-01

... 40 Protection of Environment 31 2012-07-01 2012-07-01 false [Reserved] 428.94 Section 428.94 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS (CONTINUED) RUBBER MANUFACTURING POINT SOURCE CATEGORY Pan, Dry Digestion, and Mechanical Reclaimed Rubber...

40 CFR 428.94 - [Reserved

Code of Federal Regulations, 2014 CFR

2014-07-01

... 40 Protection of Environment 30 2014-07-01 2014-07-01 false [Reserved] 428.94 Section 428.94 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS (CONTINUED) RUBBER MANUFACTURING POINT SOURCE CATEGORY Pan, Dry Digestion, and Mechanical Reclaimed Rubber...

40 CFR 428.94 - [Reserved

Code of Federal Regulations, 2013 CFR

2013-07-01

... 40 Protection of Environment 31 2013-07-01 2013-07-01 false [Reserved] 428.94 Section 428.94 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS (CONTINUED) RUBBER MANUFACTURING POINT SOURCE CATEGORY Pan, Dry Digestion, and Mechanical Reclaimed Rubber...

Clinical and mutational spectra of 23 Chinese patients with glutaric aciduria type 1.

PubMed

Wang, Qiao; Li, Xiyuan; Ding, Yuan; Liu, Yupeng; Song, Jinqing; Yang, Yanling

2014-10-01

Glutaric aciduria type 1 (GA1) is a rare neurometabolic disorder caused by glutaryl-CoA dehydrogenase deficiency due to GCDH gene mutations. In this study, the clinical presentation and molecular aspects of 23 Chinese patients (11 males and 12 females) were investigated. All patients were diagnosed by elevated urinary glutaric acid and GCDH gene analysis. Protein-restricted diet supplemented with special formula, l-carnitine and GABA analog were initialed after diagnosis. The clinical and biochemical features were analyzed. Mutational analysis of GCDH was conducted. Clinical manifestations of 23 patients varied from asymptomatic to severe encephalopathy, with notable phenotypic differences between siblings with the same mutations. One case was detected by newborn screening, while 22 Cases were diagnosed between the ages of 5 months and 51 years. 29 mutations in GCDH were identified. Among them, 11 were novel, including seven missense mutations (c.406G > T, C.416C > G, c.442G > A, c.640A > G, c.901G > A, c.979G > A, and c.1207C > T), three frameshift mutations (c.873delC, c.1172-1173insT and c.1282-1285ins71) and one nonsense mutation (c.411C > G). In exon 5, c.553G > A and c.148T > C were found in four alleles (8.7%) and three alleles (6.5%) of the patients, respectively. In 23 Chinese patients with GA1, 11 novel GCDH mutations were identified. This may indicate that the genetic profiles of Chinese patients are different from those of other populations. 23 Chinese GA1 patients with varied clinical manifestations have been reported. 11 novel mutations in their GCDH gene were identified, indicating that the genetic profiles of Chinese GA1 patients differ from those of other populations. Copyright © 2013 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

A new nonsense mutation in the NF1 gene with neurofibromatosis-Noonan syndrome phenotype.

PubMed

Yimenicioğlu, Sevgi; Yakut, Ayten; Karaer, Kadri; Zenker, Martin; Ekici, Arzu; Carman, Kürşat Bora

2012-12-01

Neurofibromatosis-Noonan syndrome is a rare autosomal dominant disorder which combines neurofibromatosis type 1 (NF1) features with Noonan syndrome. NF1 gene mutations are reported in the majority of these patients. Sequence analysis of the established genes for Noonan syndrome revealed no mutation; a heterozygous NF1 point mutation c.7549C>T in exon 51, creating a premature stop codon (p.R2517X), had been demonstrated. Neurofibromatosis-Noonan syndrome recently has been considered a subtype of NF1 and caused by different NF1 mutations. We report the case of a 14-year-old boy with neurofibromatosis type 1 with Noonan-like features, who complained of headache with triventricular hydrocephaly and a heterozygous NF1 point mutation c.7549C>T in exon 51.

The G matrix under fluctuating correlational mutation and selection.

PubMed

Revell, Liam J

2007-08-01

Theoretical quantitative genetics provides a framework for reconstructing past selection and predicting future patterns of phenotypic differentiation. However, the usefulness of the equations of quantitative genetics for evolutionary inference relies on the evolutionary stability of the additive genetic variance-covariance matrix (G matrix). A fruitful new approach for exploring the evolutionary dynamics of G involves the use of individual-based computer simulations. Previous studies have focused on the evolution of the eigenstructure of G. An alternative approach employed in this paper uses the multivariate response-to-selection equation to evaluate the stability of G. In this approach, I measure similarity by the correlation between response-to-selection vectors due to random selection gradients. I analyze the dynamics of G under several conditions of correlational mutation and selection. As found in a previous study, the eigenstructure of G is stabilized by correlational mutation and selection. However, over broad conditions, instability of G did not result in a decreased consistency of the response to selection. I also analyze the stability of G when the correlation coefficients of correlational mutation and selection and the effective population size change through time. To my knowledge, no prior study has used computer simulations to investigate the stability of G when correlational mutation and selection fluctuate. Under these conditions, the eigenstructure of G is unstable under some simulation conditions. Different results are obtained if G matrix stability is assessed by eigenanalysis or by the response to random selection gradients. In this case, the response to selection is most consistent when certain aspects of the eigenstructure of G are least stable and vice versa.

Novel Nonsense Variants c.58C>T (p.Q20X) and c.256G>T (p.E85X) in the CHEK2 Gene Identified in Breast Cancer Patients from Balochistan.

PubMed

Baloch, Abdul Hameed; Khosa, Ahmad Nawaz; Bangulzai, Nasrullah; Shuja, Jamila; Naseeb, Hafiz Khush; Jan, Mohammad; Marghazani, Illahi Bakhsh; Kakar, MasoodulHaq; Baloch, Dost Mohammad; Cheema, Abdul Majeed; Ahmad, Jamil

2016-01-01

Breast cancer is very common and the leading cause of cancer deaths among women globally. Hereditary cases account for 510% of the total burden and CHEK2, which plays crucial role in response to DNA damage to promote cell cycle arrest and repair or induce apoptosis, is considered as a moderate penetrance breast cancer risk gene. Our objective in the current study was to analyze mutations in related to breast cancer. A total of 271 individuals including breast cancer patients and normal subjects were enrolled and all 14 exons of CHEK2 were amplified and sequenced. The majority of the patients (>95%) were affected with invasive ductal carcinoma (IDC), 52.1% were diagnosed with grade III tumors and 56.2% and 27.5% with advanced stages III and IV. Two novel nonsense variants i.e. c.58C>T (P.Q20X) and c.256G>T (p.E85X) at exon 1 and 2 in two breast cancer patients were identified, both novel and not reported elsewhere.

Molecular dynamics simulations and principal component analysis on human laforin mutation W32G and W32G/K87A.

PubMed

Srikumar, P S; Rohini, K; Rajesh, Perumbilavil Kaithamanakallam

2014-06-01

Mutations in human laforin lead to an autosomal neurodegenerative disorder Lafora disease. In N-terminal carbohydrate binding domain of laforin, two mutations W32G and K87A are reported as highly disease causing laforin mutants. Experimental studies reported that mutations are responsible for the abolishment of glycogen binding which is a critical function of laforin. Our current computational study focused on the role of conformational changes in human laforin structure due to existing single mutation W32G and prepared double mutation W32G/K87A related to loss of glycogen binding. We performed 10 ns molecular dynamics (MD) simulation studies in the Gromacs package for both mutations and analyzed the trajectories. From the results, the global properties like root mean square deviation, root mean square fluctuation, radius of gyration, solvent accessible surface area and hydrogen bonds showed structural changes in atomic level observed in W32G and W32G/K87A laforin mutants. The conformational change induced by mutants influenced the loss of the overall stability of the native laforin. Moreover, the change in overall motion of protein was analyzed by principal component analysis and results showed protein clusters expanded more than native and also change in direction in case of double mutant in conformational space. Overall, our report provides theoretical information on loss of structure-function relationship due to flexible nature of laforin mutants. In conclusion, comparative MD simulation studies support the experimental data on W32G and W32G/K87A related to the lafora disease mechanism on glycogen binding.

Homozygous p.V116* mutation in C12orf65 results in Leigh syndrome.

PubMed

Imagawa, Eri; Fattal-Valevski, Aviva; Eyal, Ori; Miyatake, Satoko; Saada, Ann; Nakashima, Mitsuko; Tsurusaki, Yoshinori; Saitsu, Hirotomo; Miyake, Noriko; Matsumoto, Naomichi

2016-02-01

Leigh syndrome (LS) is an early-onset progressive neurodegenerative disorder associated with mitochondrial dysfunction. LS is characterised by elevated lactate and pyruvate and bilateral symmetric hyperintense lesions in the basal ganglia, thalamus, brainstem, cerebral white matter or spinal cord on T2-weighted MRI. LS is a genetically heterogeneous disease, and to date mutations in approximately 40 genes related to mitochondrial function have been linked to the disorder. We investigated a pair of female monozygotic twins diagnosed with LS from consanguineous healthy parents of Indian origin. Their common clinical features included optic atrophy, ophthalmoplegia, spastic paraparesis and mild intellectual disability. High-blood lactate and high-intensity signal in the brainstem on T2-weighted MRI were consistent with a clinical diagnosis of LS. To identify the genetic cause of their condition, we performed whole exome sequencing. We identified a homozygous nonsense mutation in C12orf65 (NM_001143905; c.346delG, p.V116*) in the affected twins. Interestingly, the identical mutation was previously reported in an Indian family with Charcot-Marie Tooth disease type 6, which displayed some overlapping clinical features with the twins. We demonstrate that the identical nonsense mutation in C12orf65 can result in different clinical features, suggesting the involvement of unknown modifiers. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

Factor V Leiden G1691A and prothrombin G20210A mutations among Palestinian patients with sickle cell disease.

PubMed

Samarah, Fekri; Srour, Mahmoud A

2018-01-01

Vascular thrombosis is an important pathophysiological aspect of sickle cell disease (SCD). This study aimed to investigate the prevalence and clinical impact of factor V Leiden G1691A (FVL) and prothrombin G20210A mutations among Palestinian sickle cell disease (SCD) patients. A total of 117 SCD patients, including 59 patients with sickle cell anemia (SS), 33 patients with sickle β-thalassemia and 25 individuals with sickle cell trait (AS) were studied. The control group consisted of 118 healthy individuals. FVL and prothrombin G20210A mutations were determined by RFLP PCR. Analysis of the clinical history of SCD patients revealed that seven patients have had vascular complications such as ischemic stroke or deep vein thrombosis. In SCD patients, the inheritance of the FVL mutation showed a significantly higher incidence of pain in joints, chest and abdomen as well as regular dependence on blood transfusion compared to SCD with the wild type. Age- and sex-adjusted logistic regression analysis revealed a significant association between FVL and sickle cell anemia with an odds ratio (OR) of 5.6 (95% confidence intervals [CI] of 1.91-39.4, P  = 0.039) in SS patients. However, increased prevalence of the FVL in AS subjects and sickle β-thalassemia patients was not statistically significant compared to controls (OR 3.97, 95% CI 0.51-28.6, P  = 0.17 and OR 3.59, 95% CI 0.35-41.6, P  = 0.26, respectively). The distribution of prothrombin G20210A mutation among SCD patients compared to controls was not significantly different, thus our findings do not support an association of this mutation with SCD. FVL was more prevalent among SS patients compared to controls and it was associated with higher incidence of disease complications among SCD patients.

Cardiac abnormalities in patients with mitochondrial DNA mutation 3243A>G

PubMed Central

Majamaa-Voltti, Kirsi; Peuhkurinen, Keijo; Kortelainen, Marja-Leena; Hassinen, Ilmo E; Majamaa, Kari

2002-01-01

Background Tissues that depend on aerobic energy metabolism suffer most in diseases caused by mutations in mitochondrial DNA (mtDNA). Cardiac abnormalities have been described in many cases, but their frequency and clinical spectrum among patients with mtDNA mutations is unknown. Methods Thirty-nine patients with the 3243A>G mtDNA mutation were examined, methods used included clinical evaluation, electrocardiogram, Holter recording and echocardiography. Autopsy reports on 17 deceased subjects were also reviewed. The degree of 3243A>G mutation heteroplasmy was determined using an Apa I restriction fragment analysis. Better hearing level (BEHL0.5–4 kHz) was used as a measure of the clinical severity of disease. Results Left ventricular hypertrophy (LVH) was diagnosed in 19 patients (56%) by echocardiography and in six controls (15%) giving an odds ratio of 7.5 (95% confidence interval; 1.74–67). The dimensions of the left ventricle suggested a concentric hypertrophy. Left ventricular systolic or diastolic dysfunction was observed in 11 patients. Holter recording revealed frequent ventricular extrasystoles (>10/h) in five patients. Patients with LVH differed significantly from those without LVH in BEHL0.5–4 kHz, whereas the contribution of age or the degree of the mutant heteroplasmy in skeletal muscle to the risk of LVH was less remarkable. Conclusions Structural and functional abnormalities of the heart were common in patients with 3243A>G. The risk of LVH was related to the clinical severity of the phenotype, and to a lesser degree to age, suggesting that patients presenting with any symptoms from the mutation should also be evaluated for cardiac abnormalities. PMID:12150714

Mutations in Elongation Factor Ef-1α Affect the Frequency of Frameshifting and Amino Acid Misincorporation in Saccharomyces Cerevisiae

PubMed Central

Sandbaken, M. G.; Culbertson, M. R.

1988-01-01

A mutational analysis of the eukaryotic elongation factor EF-1α indicates that this protein functions to limit the frequency of errors during genetic code translation. We found that both amino acid misincorporation and reading frame errors are controlled by EF-1α. In order to examine the function of this protein, the TEF2 gene, which encodes EF-1α in Saccharomyces cerevisiae, was mutagenized in vitro with hydroxylamine. Sixteen independent TEF2 alleles were isolated by their ability to suppress frameshift mutations. DNA sequence analysis identified eight different sites in the EF-1α protein that elevate the frequency of mistranslation when mutated. These sites are located in two different regions of the protein. Amino acid substitutions located in or near the GTP-binding and hydrolysis domain of the protein cause suppression of frameshift and nonsense mutations. These mutations may effect mistranslation by altering the binding or hydrolysis of GTP. Amino acid substitutions located adjacent to a putative aminoacyl-tRNA binding region also suppress frameshift and nonsense mutations. These mutations may alter the binding of aminoacyl-tRNA by EF-1α. The identification of frameshift and nonsense suppressor mutations in EF-1α indicates a role for this protein in limiting amino acid misincorporation and reading frame errors. We suggest that these types of errors are controlled by a common mechanism or closely related mechanisms. PMID:3066688

Hypomorphic NOTCH3 mutation in an Italian family with CADASIL features.

PubMed

Moccia, Marcello; Mosca, Lorena; Erro, Roberto; Cervasio, Mariarosaria; Allocca, Roberto; Vitale, Carmine; Leonardi, Antonio; Caranci, Ferdinando; Del Basso-De Caro, Maria Laura; Barone, Paolo; Penco, Silvana

2015-01-01

The cerebral autosomal dominant arteriopathy with subcortical infarcts and leucoencephalopathy (CADASIL) is because of NOTCH3 mutations affecting the number of cysteine residues. In this view, the role of atypical NOTCH3 mutations is still debated. Therefore, we investigated a family carrying a NOTCH3 nonsense mutation, with dominantly inherited recurrent cerebrovascular disorders. Among 7 family members, 4 received a clinical diagnosis of CADASIL. A heterozygous truncating mutation in exon 3 (c.307C>T, p.Arg103X) was found in the 4 clinically affected subjects and in one 27-year old lady, only complaining of migraine with aura. Magnetic resonance imaging scans found typical signs of small-vessel disease in the 4 affected subjects, supporting the clinical diagnosis. Skin biopsies did not show the typical granular osmiophilic material, but only nonspecific signs of vascular damage, resembling those previously described in Notch3 knockout mice. Interestingly, messenger RNA (mRNA) analysis supports the hypothesis of an atypical NOTCH3 mutation, suggesting a nonsense-mediated mRNA decay. In conclusion, the present study broadens the spectrum of CADASIL mutations, and, therefore, opens new insights about Notch3 signaling. Copyright © 2015 Elsevier Inc. All rights reserved.

A novel mutation MT-COIII m.9267G>C and MT-COI m.5913G>A mutation in mitochondrial genes in a Tunisian family with maternally inherited diabetes and deafness (MIDD) associated with severe nephropathy.

PubMed

Tabebi, Mouna; Mkaouar-Rebai, Emna; Mnif, Mouna; Kallabi, Fakhri; Ben Mahmoud, Afif; Ben Saad, Wafa; Charfi, Nadia; Keskes-Ammar, Leila; Kamoun, Hassen; Abid, Mohamed; Fakhfakh, Faiza

2015-04-10

Mitochondrial diabetes (MD) is a heterogeneous disorder characterized by a chronic hyperglycemia, maternal transmission and its association with a bilateral hearing impairment. Several studies reported mutations in mitochondrial genes as potentially pathogenic for diabetes, since mitochondrial oxidative phosphorylation plays an important role in glucose-stimulated insulin secretion from beta cells. In the present report, we studied a Tunisian family with mitochondrial diabetes (MD) and deafness associated with nephropathy. The mutational analysis screening revealed the presence of a novel heteroplasmic mutation m.9276G>C in the mitochondrial COIII gene, detected in mtDNA extracted from leukocytes of a mother and her two daughters indicating that this mutation is maternally transmitted and suggest its implication in the observed phenotype. Bioinformatic tools showed that m.9267G>C mutation (p.A21P) is « deleterious » and it can modify the function and the stability of the MT-COIII protein by affecting the assembly of mitochondrial COX subunits and the translocation of protons then reducing the activity of the respective OXPHOS complexes of ATP synthesis. The nonsynonymous mutation (p.A21P) has not been reported before, it is the first mutation described in the COXIII gene which is related to insulin dependent mitochondrial diabetes and deafness and could be specific to the Tunisian population. The m.9267G>C mutation was present with a nonsynonymous inherited mitochondrial homoplasmic variation MT-COI m.5913 G>A (D4N) responsible of high blood pressure, a clinical feature detected in all explored patients. Copyright © 2015. Published by Elsevier Inc.

34 CFR 428.4 - What regulations apply?

Code of Federal Regulations, 2011 CFR

2011-07-01

... 34 Education 3 2011-07-01 2011-07-01 false What regulations apply? 428.4 Section 428.4 Education Regulations of the Offices of the Department of Education (Continued) OFFICE OF VOCATIONAL AND ADULT EDUCATION, DEPARTMENT OF EDUCATION BILINGUAL VOCATIONAL INSTRUCTOR TRAINING PROGRAM General § 428.4 What regulations...

34 CFR 428.5 - What definitions apply?

Code of Federal Regulations, 2011 CFR

2011-07-01

... 34 Education 3 2011-07-01 2011-07-01 false What definitions apply? 428.5 Section 428.5 Education Regulations of the Offices of the Department of Education (Continued) OFFICE OF VOCATIONAL AND ADULT EDUCATION, DEPARTMENT OF EDUCATION BILINGUAL VOCATIONAL INSTRUCTOR TRAINING PROGRAM General § 428.5 What definitions...

34 CFR 428.5 - What definitions apply?

Code of Federal Regulations, 2012 CFR

2012-07-01

... 34 Education 3 2012-07-01 2012-07-01 false What definitions apply? 428.5 Section 428.5 Education Regulations of the Offices of the Department of Education (Continued) OFFICE OF VOCATIONAL AND ADULT EDUCATION, DEPARTMENT OF EDUCATION BILINGUAL VOCATIONAL INSTRUCTOR TRAINING PROGRAM General § 428.5 What definitions...

34 CFR 428.4 - What regulations apply?

Code of Federal Regulations, 2012 CFR

2012-07-01

... 34 Education 3 2012-07-01 2012-07-01 false What regulations apply? 428.4 Section 428.4 Education Regulations of the Offices of the Department of Education (Continued) OFFICE OF VOCATIONAL AND ADULT EDUCATION, DEPARTMENT OF EDUCATION BILINGUAL VOCATIONAL INSTRUCTOR TRAINING PROGRAM General § 428.4 What regulations...

Mutations in SMG9, Encoding an Essential Component of Nonsense-Mediated Decay Machinery, Cause a Multiple Congenital Anomaly Syndrome in Humans and Mice

PubMed Central

Shaheen, Ranad; Anazi, Shams; Ben-Omran, Tawfeg; Seidahmed, Mohammed Zain; Caddle, L. Brianna; Palmer, Kristina; Ali, Rehab; Alshidi, Tarfa; Hagos, Samya; Goodwin, Leslie; Hashem, Mais; Wakil, Salma M.; Abouelhoda, Mohamed; Colak, Dilek; Murray, Stephen A.; Alkuraya, Fowzan S.

2016-01-01

Nonsense-mediated decay (NMD) is an important process that is best known for degrading transcripts that contain premature stop codons (PTCs) to mitigate their potentially harmful consequences, although its regulatory role encompasses other classes of transcripts as well. Despite the critical role of NMD at the cellular level, our knowledge about the consequences of deficiency of its components at the organismal level is largely limited to model organisms. In this study, we report two consanguineous families in which a similar pattern of congenital anomalies was found to be most likely caused by homozygous loss-of-function mutations in SMG9, encoding an essential component of the SURF complex that generates phospho-UPF1, the single most important step in NMD. By knocking out Smg9 in mice via CRISPR/Cas9, we were able to recapitulate the major features of the SMG9-related multiple congenital anomaly syndrome we observed in humans. Surprisingly, human cells devoid of SMG9 do not appear to have reduction of PTC-containing transcripts but do display global transcriptional dysregulation. We conclude that SMG9 is required for normal human and murine development, most likely through a transcriptional regulatory role, the precise nature of which remains to be determined. PMID:27018474

Prevalence of 1691G>A FV mutation in females from Bosnia and Herzegovina - a preliminary report

PubMed Central

Yaljevac, Amina; Mehić, Bakir; Kiseljaković, Emina; Ibrulj, Slavka; Garstka, Agnieszka; Adler, Grazyna

2013-01-01

Factor V is the liver-synthesized multidomain glycoprotein encoded by a gene localised on chromosome 1q23. The point mutation 1691G>A in this gene results in formation of an altered protein of V Factor resistant to activated protein C (APC) cleavage. This mutation alone is the most frequent cause of inborn thrombophilia and the most widely acknowledged genetic risk factor for venous thrombosis in a Caucasian population. This study was designed to provide the first estimate of the frequency of the allele 1691A FV in the Bosnian female population. The 1691G>A FV mutation was examined by polymerase chain reaction-restriction fragment length polymorphism, in a group of 67 women, mean age of 58.6 years with no history of cardiovascural incident. Our findings revealed an absence of the mutated allele 1691A FV in the studied group. This is the first report on the 1691G>A FV mutation in a population from Bosnia and Herzegovina. Further research is needed to establish prevalence of the mutated allele in the population from Bosnia and Herzegovina. PMID:23448608

Correlation between connexin 32 gene mutations and clinical phenotype in X-linked dominant Charcot-Marie-Tooth neuropathy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ionasescu, V.; Ionasescu, R.; Searby, C.

1996-06-14

We studied the relationship between the genotype and clinical phenotype in 27 families with dominant X-linked Charcot-Marie-Tooth (CMTX1) neuropathy. Twenty-two families showed mutations in the coding region of the connexin32 (cx32) gene. The mutations include four nonsense mutations, eight missense mutations, two medium size deletions, and one insertion. Most missense mutations showed a mild clinical phenotype (five out of eight), whereas all nonsense mutations, the larger of the two deletions, and the insertion that produced frameshifts showed severe phenotypes. Five CMTX1 families with mild clinical phenotype showed no point mutations of the cx32 gene coding region. Three of these familiesmore » showed positive genetic linkage with the markers of the Xq13.1 region. The genetic linkage of the remaining two families could not be evaluated because of their small size. 25 refs., 1 fig., 1 tab.« less

Nonsense mutation in the phosphofructokinase muscle subunit gene associated with retention of intron 10 in one of the isolated transcripts in Ashkenazi Jewish patients with Tarui disease.

PubMed Central

Vasconcelos, O; Sivakumar, K; Dalakas, M C; Quezado, M; Nagle, J; Leon-Monzon, M; Dubnick, M; Gajdusek, D C; Goldfarb, L G

1995-01-01

Mutations in the human phosphofructokinase muscle subunit gene (PFKM) are known to cause myopathy classified as glycogenosis type VII (Tarui disease). Previously described molecular defects include base substitutions altering encoded amino acids or resulting in abnormal splicing. We report a mutation resulting in phosphofructokinase deficiency in three patients from an Ashkenazi Jewish family. Using a reverse transcription PCR assay, PFKM subunit transcripts differing by length were detected in skeletal muscle tissue of all three affected subjects. In the longer transcript, an insertion of 252 nucleotides totally homologous to the structure of the 10th intron of the PFKM gene was found separating exon 10 from exon 11. In addition, two single base transitions were identified by direct sequencing: [exon 6; codon 95; CGA (Arg) to TGA (stop)] and [exon 7; codon 172; ACC (Thr) to ACT (Thr)] in either transcript. Single-stranded conformational polymorphism and restriction enzyme analyses confirmed the presence of these point substitutions in genomic DNA and strongly suggested homozygosity for the pathogenic allele. The nonsense mutation at codon 95 appeared solely responsible for the phenotype in these patients, further expanding genetic heterogeneity of Tarui disease. Transcripts with and without intron 10 arising from identical mutant alleles probably resulted from differential pre-mRNA processing and may represent a novel message from the PFKM gene. Images Fig. 2 Fig. 4 Fig. 5 PMID:7479776

Cerebral metabolic abnormalities in A3243G mitochondrial DNA mutation carriers

PubMed Central

Weiduschat, Nora; Kaufmann, Petra; Mao, Xiangling; Engelstad, Kristin Marie; Hinton, Veronica; DiMauro, Salvatore; De Vivo, Darryl

2014-01-01

Objective: To establish cerebral metabolic features associated with the A3243G mitochondrial DNA mutation with proton magnetic resonance spectroscopic imaging (1H MRSI) and to assess their potential as prognostic biomarkers. Methods: In this prospective cohort study, we investigated 135 clinically heterogeneous A3243G mutation carriers and 30 healthy volunteers (HVs) with 1H MRSI. Mutation carriers included 45 patients with mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes (MELAS); 11 participants who would develop the MELAS syndrome during follow-up (converters); and 79 participants who would not develop the MELAS syndrome during follow-up (nonconverters). The groups were compared with respect to MRSI metabolic indices of 1) anaerobic energy metabolism (lactate), 2) neuronal integrity (N-acetyl-l-aspartate [NAA]), 3) mitochondrial function (NAA; lactate), 4) cell energetics (total creatine), and 5) membrane biosynthesis and turnover (total choline [tCho]). Results: Consistent with prior studies, the patients with MELAS had higher lactate (p < 0.001) and lower NAA levels (p = 0.01) than HVs. Unexpectedly, converters showed higher NAA (p = 0.042), tCho (p = 0.004), and total creatine (p = 0.002), in addition to higher lactate levels (p = 0.032), compared with HVs. Compared with nonconverters, converters had higher tCho (p = 0.015). Clinically, converters and nonconverters did not differ at baseline. Lactate and tCho levels were reliable biomarkers for predicting the risk of individual mutation carriers to develop the MELAS phenotype. Conclusions: 1H MRSI assessment of cerebral metabolism in A3243G mutation carriers shows promise in identifying disease biomarkers as well as individuals at risk of developing the MELAS phenotype. PMID:24477106

21 CFR 556.428 - Narasin.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 21 Food and Drugs 6 2011-04-01 2011-04-01 false Narasin. 556.428 Section 556.428 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS TOLERANCES FOR RESIDUES OF NEW ANIMAL DRUGS IN FOOD Specific Tolerances for...

Diseases associated with growth hormone-releasing hormone receptor (GHRHR) mutations.

PubMed

Martari, Marco; Salvatori, Roberto

2009-01-01

The growth hormone (GH)-releasing hormone (GHRH) receptor (GHRHR) belongs to the G protein-coupled receptors family. It is expressed almost exclusively in the anterior pituitary, where it is necessary for somatotroph cells proliferation and for GH synthesis and secretion. Mutations in the human GHRHR gene (GHRHR) can impair ligand binding and signal transduction, and have been estimated to cause about 10% of autosomal recessive familial isolated growth hormone deficiency (IGHD). Mutations reported to date include five splice donor site mutations, two microdeletions, two nonsense mutations, seven missense mutations, and one mutation in the promoter. These mutations have an autosomal recessive mode of inheritance, and heterozygous individuals do not show signs of IGHD, although the presence of an intermediate phenotype has been hypothesized. Conversely, patients with biallelic mutations have low serum insulin-like growth factor-1 and GH levels (with absent or reduced GH response to exogenous stimuli), resulting--if not treated--in proportionate dwarfism. This chapter reviews the biology of the GHRHR, the mutations that affect its gene and their effects in homozygous and heterozygous individuals. Copyright © 2009 Elsevier Inc. All rights reserved.

MECR Mutations Cause Childhood-Onset Dystonia and Optic Atrophy, a Mitochondrial Fatty Acid Synthesis Disorder.

PubMed

Heimer, Gali; Kerätär, Juha M; Riley, Lisa G; Balasubramaniam, Shanti; Eyal, Eran; Pietikäinen, Laura P; Hiltunen, J Kalervo; Marek-Yagel, Dina; Hamada, Jeffrey; Gregory, Allison; Rogers, Caleb; Hogarth, Penelope; Nance, Martha A; Shalva, Nechama; Veber, Alvit; Tzadok, Michal; Nissenkorn, Andreea; Tonduti, Davide; Renaldo, Florence; Kraoua, Ichraf; Panteghini, Celeste; Valletta, Lorella; Garavaglia, Barbara; Cowley, Mark J; Gayevskiy, Velimir; Roscioli, Tony; Silberstein, Jonathon M; Hoffmann, Chen; Raas-Rothschild, Annick; Tiranti, Valeria; Anikster, Yair; Christodoulou, John; Kastaniotis, Alexander J; Ben-Zeev, Bruria; Hayflick, Susan J

2016-12-01

Mitochondrial fatty acid synthesis (mtFAS) is an evolutionarily conserved pathway essential for the function of the respiratory chain and several mitochondrial enzyme complexes. We report here a unique neurometabolic human disorder caused by defective mtFAS. Seven individuals from five unrelated families presented with childhood-onset dystonia, optic atrophy, and basal ganglia signal abnormalities on MRI. All affected individuals were found to harbor recessive mutations in MECR encoding the mitochondrial trans-2-enoyl-coenzyme A-reductase involved in human mtFAS. All six mutations are extremely rare in the general population, segregate with the disease in the families, and are predicted to be deleterious. The nonsense c.855T>G (p.Tyr285 ∗ ), c.247_250del (p.Asn83Hisfs ∗ 4), and splice site c.830+2_830+3insT mutations lead to C-terminal truncation variants of MECR. The missense c.695G>A (p.Gly232Glu), c.854A>G (p.Tyr285Cys), and c.772C>T (p.Arg258Trp) mutations involve conserved amino acid residues, are located within the cofactor binding domain, and are predicted by structural analysis to have a destabilizing effect. Yeast modeling and complementation studies validated the pathogenicity of the MECR mutations. Fibroblast cell lines from affected individuals displayed reduced levels of both MECR and lipoylated proteins as well as defective respiration. These results suggest that mutations in MECR cause a distinct human disorder of the mtFAS pathway. The observation of decreased lipoylation raises the possibility of a potential therapeutic strategy. Copyright © 2016 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Gain-of-Function Mutations in ZIC1 Are Associated with Coronal Craniosynostosis and Learning Disability.

PubMed

Twigg, Stephen R F; Forecki, Jennifer; Goos, Jacqueline A C; Richardson, Ivy C A; Hoogeboom, A Jeannette M; van den Ouweland, Ans M W; Swagemakers, Sigrid M A; Lequin, Maarten H; Van Antwerp, Daniel; McGowan, Simon J; Westbury, Isabelle; Miller, Kerry A; Wall, Steven A; van der Spek, Peter J; Mathijssen, Irene M J; Pauws, Erwin; Merzdorf, Christa S; Wilkie, Andrew O M

2015-09-03

Human ZIC1 (zinc finger protein of cerebellum 1), one of five homologs of the Drosophila pair-rule gene odd-paired, encodes a transcription factor previously implicated in vertebrate brain development. Heterozygous deletions of ZIC1 and its nearby paralog ZIC4 on chromosome 3q25.1 are associated with Dandy-Walker malformation of the cerebellum, and loss of the orthologous Zic1 gene in the mouse causes cerebellar hypoplasia and vertebral defects. We describe individuals from five families with heterozygous mutations located in the final (third) exon of ZIC1 (encoding four nonsense and one missense change) who have a distinct phenotype in which severe craniosynostosis, specifically involving the coronal sutures, and variable learning disability are the most characteristic features. The location of the nonsense mutations predicts escape of mutant ZIC1 transcripts from nonsense-mediated decay, which was confirmed in a cell line from an affected individual. Both nonsense and missense mutations are associated with altered and/or enhanced expression of a target gene, engrailed-2, in a Xenopus embryo assay. Analysis of mouse embryos revealed a localized domain of Zic1 expression at embryonic days 11.5-12.5 in a region overlapping the supraorbital regulatory center, which patterns the coronal suture. We conclude that the human mutations uncover a previously unsuspected role for Zic1 in early cranial suture development, potentially by regulating engrailed 1, which was previously shown to be critical for positioning of the murine coronal suture. The diagnosis of a ZIC1 mutation has significant implications for prognosis and we recommend genetic testing when common causes of coronal synostosis have been excluded. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

A Novel MAPT Mutation, G55R, in a Frontotemporal Dementia Patient Leads to Altered Tau Function

PubMed Central

Guzman, Elmer; Barczak, Anna; Chodakowska-Żebrowska, Małgorzata; Barcikowska, Maria; Feinstein, Stuart

2013-01-01

Over two dozen mutations in the gene encoding the microtubule associated protein tau cause a variety of neurodegenerative dementias known as tauopathies, including frontotemporal dementia (FTD), PSP, CBD and Pick's disease. The vast majority of these mutations map to the C-terminal region of tau possessing microtubule assembly and microtubule dynamics regulatory activities as well as the ability to promote pathological tau aggregation. Here, we describe a novel and non-conservative tau mutation (G55R) mapping to an alternatively spliced exon encoding part of the N-terminal region of the protein in a patient with the behavioral variant of FTD. Although less well understood than the C-terminal region of tau, the N-terminal region can influence both MT mediated effects as well as tau aggregation. The mutation changes an uncharged glycine to a basic arginine in the midst of a highly conserved and very acidic region. In vitro, 4-repeat G55R tau nucleates microtubule assembly more effectively than wild-type 4-repeat tau; surprisingly, this effect is tau isoform specific and is not observed in a 3-repeat G55R tau versus 3-repeat wild-type tau comparison. In contrast, the G55R mutation has no effect upon the abilities of tau to regulate MT growing and shortening dynamics or to aggregate. Additionally, the mutation has no effect upon kinesin translocation in a microtubule gliding assay. Together, (i) we have identified a novel tau mutation mapping to a mutation deficient region of the protein in a bvFTD patient, and (ii) the G55R mutation affects the ability of tau to nucleate microtubule assembly in vitro in a 4-repeat tau isoform specific manner. This altered capability could markedly affect in vivo microtubule function and neuronal cell biology. We consider G55R to be a candidate mutation for bvFTD since additional criteria required to establish causality are not yet available for assessment. PMID:24086739

Novel folliculin (FLCN) mutation and familial spontaneous pneumothorax.

PubMed

Zhu, J-F; Shen, X-Q; Zhu, F; Tian, L

2017-01-01

Familial spontaneous pneumothorax is one of the characteristics of Birt-Hogg-Dubé syndrome (BHDS), which is an autosomal dominant disease caused by the mutation of folliculin (FLCN). To investigate the mutation of FLCN gene in a familial spontaneous pneumothorax. Prospective case study. Clinical and genetic data of a Chinese family with four patients who presented spontaneous pneumothorax in the absence of skin lesions or renal tumors were collected. CT scan of patient's lung was applied for observation of pneumothorax. DNA sequencing of the coding exons (4-14 exons) of FLCN was performed for all 11 members of the family and 100 unrelated healthy controls. CT scan of patient's lung showed spontaneous pneumothorax. A mutation (c. 510C > G) that leads to a premature stop codon (p. Y170X) was found in the proband using DNA sequencing of coding exons (4-14 exons) of FLCN. This mutation was also observed in the other affected members of the family. A nonsense mutation of FLCN was found in a spontaneous pneumothorax family. Our results expand the mutational spectrum of FLCN in patients with BHDS. © The Author 2016. Published by Oxford University Press on behalf of the Association of Physicians. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Mitochondrial tRNA(Thr) A15951G mutation may not be associated with Leber's Hereditary Optic Neuropathy.

PubMed

Zhang, Xi; Yu, Shuaishuai; Tu, Yunhai; Huang, Wenjie

2016-07-01

Mutation in mitochondrial DNA (mtDNA) has been found to play an important role in the pathogenesis of Leber's Hereditary Optic Neuropathy (LHON). Three primary mutations, the ND4 G11778A, ND6 T14484C, and ND1 G3460A, have been found to account more than 90% of LHON patients in many families worldwide. In addition to the mutations in genes encoding the respiratory chain complex I, reports concerning the mt-tRNA gene mutations associated with LHON have increased, some pathogenic mutations caused the failure in mt-tRNA metabolism, thereby worsened the mitochondrial dysfunction that is responsible for LHON. Recently, the A15951G mutation in mt-tRNA(Thr) gene has been reported to be a "modified" factor in increasing the penetrance and expressivity of LHON-associated ND4 G11778A mutation in three Chinese families. However, evolutionary conservation analysis of this mutation suggested a poor conservation index and the pathogenicity scoring system showed that this mutation was a neutral polymorphism.

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

PubMed

Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

2017-10-01

Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

Characterization of a germline mosaicism in families with Lowe syndrome, and identification of seven novel mutations in the OCRL1 gene.

PubMed Central

Satre, V; Monnier, N; Berthoin, F; Ayuso, C; Joannard, A; Jouk, P S; Lopez-Pajares, I; Megabarne, A; Philippe, H J; Plauchu, H; Torres, M L; Lunardi, J

1999-01-01

The oculocerebrorenal syndrome of Lowe (OCRL) is an X-linked disorder characterized by major abnormalities of eyes, nervous system, and kidneys. Mutations in the OCRL1 gene have been associated with the disease. OCRL1 encodes a phosphatidylinositol 4, 5-biphosphate (PtdIns[4,5]P2) 5-phosphatase. We have examined the OCRL1 gene in eight unrelated patients with OCRL and have found seven new mutations and one recurrent in-frame deletion. Among the new mutations, two nonsense mutations (R317X and E558X) and three other frameshift mutations caused premature termination of the protein. A missense mutation, R483G, was located in the highly conserved PtdIns(4,5)P2 5-phosphatase domain. Finally, one frameshift mutation, 2799delC, modifies the C-terminal part of OCRL1, with an extension of six amino acids. Altogether, 70% of missense mutations are located in exon 15, and 52% of all mutations cluster in exons 11-15. We also identified two new microsatellite markers for the OCRL1 locus, and we detected a germline mosaicism in one family. This observation has direct implications for genetic counseling of Lowe syndrome families. PMID:10364518

Association of breast-fed neonatal hyperbilirubinemia with UGT1A1 polymorphisms: 211G>A (G71R) mutation becomes a risk factor under inadequate feeding.

PubMed

Sato, Hiroko; Uchida, Toshihiko; Toyota, Kentaro; Kanno, Miyako; Hashimoto, Taeko; Watanabe, Masashi; Nakamura, Tomohiro; Tamiya, Gen; Aoki, Kuraaki; Hayasaka, Kiyoshi

2013-01-01

Breastfeeding jaundice is a well-known phenomenon, but its pathogenesis is still unclear. Increased production of bilirubin, impaired hepatic uptake and metabolism of bilirubin, and increased enterohepatic circulation of bilirubin account for most cases of pathological neonatal hyperbilirubinemia. We previously reported that 211G>A (G71R) mutation of the UGT1A1 gene is prevalent in East Asians and is associated with the development of neonatal hyperbilirubinemia. Recently, significant association of G71R mutation with hyperbilirubinemia in breast-fed neonates was reported. We enrolled 401 full-term Japanese infants, who were exclusively breast-fed without supplementation of formula before developing hyperbilirubinemia, and classified them into two groups based on the degree of maximal body weight loss during the neonatal period. We analyzed the sex, gestational age, delivery mode, body weight at birth, maximal body weight loss and genotypes of G71R and (TA)(7) polymorphic mutations of UGT1A1. Statistical analysis revealed that maximal body weight loss during the neonatal period is the only independent risk factor for the development of neonatal hyperbilirubinemia. The effect of G71R mutation on neonatal hyperbilirubinemia is significant in neonates with 5% or greater maximal body weight loss and its influence increases in parallel with the degree of maximal body weight loss. Our study indicates that G71R mutation is a risk factor for neonatal hyperbilirubinemia only in infants with inadequate breastfeeding and suggests that adequate breastfeeding may overcome the genetic predisposing factor, G71R mutation, for the development of neonatal hyperbilirubinemia.

Statistical Analysis of Readthrough Levels for Nonsense Mutations in Mammalian Cells Reveals a Major Determinant of Response to Gentamicin

PubMed Central

Floquet, Célia; Hatin, Isabelle; Rousset, Jean-Pierre; Bidou, Laure

2012-01-01

The efficiency of translation termination depends on the nature of the stop codon and the surrounding nucleotides. Some molecules, such as aminoglycoside antibiotics (gentamicin), decrease termination efficiency and are currently being evaluated for diseases caused by premature termination codons. However, the readthrough response to treatment is highly variable and little is known about the rules governing readthrough level and response to aminoglycosides. In this study, we carried out in-depth statistical analysis on a very large set of nonsense mutations to decipher the elements of nucleotide context responsible for modulating readthrough levels and gentamicin response. We quantified readthrough for 66 sequences containing a stop codon, in the presence and absence of gentamicin, in cultured mammalian cells. We demonstrated that the efficiency of readthrough after treatment is determined by the complex interplay between the stop codon and a larger sequence context. There was a strong positive correlation between basal and induced readthrough levels, and a weak negative correlation between basal readthrough level and gentamicin response (i.e. the factor of increase from basal to induced readthrough levels). The identity of the stop codon did not affect the response to gentamicin treatment. In agreement with a previous report, we confirm that the presence of a cytosine in +4 position promotes higher basal and gentamicin-induced readthrough than other nucleotides. We highlight for the first time that the presence of a uracil residue immediately upstream from the stop codon is a major determinant of the response to gentamicin. Moreover, this effect was mediated by the nucleotide itself, rather than by the amino-acid or tRNA corresponding to the −1 codon. Finally, we point out that a uracil at this position associated with a cytosine at +4 results in an optimal gentamicin-induced readthrough, which is the therapeutically relevant variable. PMID:22479203

42 CFR 417.428 - Marketing activities.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 42 Public Health 3 2014-10-01 2014-10-01 false Marketing activities. 417.428 Section 417.428... Marketing activities. (a) With the exception of § 422.2276 of this chapter, the procedures and requirements relating to marketing requirements set forth in subpart V of part 422 of this chapter also apply to...

42 CFR 417.428 - Marketing activities.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 42 Public Health 3 2012-10-01 2012-10-01 false Marketing activities. 417.428 Section 417.428... Marketing activities. (a) With the exception of § 422.2276 of this chapter, the procedures and requirements relating to marketing requirements set forth in subpart V of part 422 of this chapter also apply to...

42 CFR 417.428 - Marketing activities.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 42 Public Health 3 2013-10-01 2013-10-01 false Marketing activities. 417.428 Section 417.428... Marketing activities. (a) With the exception of § 422.2276 of this chapter, the procedures and requirements relating to marketing requirements set forth in subpart V of part 422 of this chapter also apply to...

40 CFR 428.81 - Specialized definitions.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 40 Protection of Environment 31 2013-07-01 2013-07-01 false Specialized definitions. 428.81 Section 428.81 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS (CONTINUED) RUBBER MANUFACTURING POINT SOURCE CATEGORY Wet Digestion Reclaimed Rubber...

40 CFR 428.81 - Specialized definitions.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 40 Protection of Environment 31 2012-07-01 2012-07-01 false Specialized definitions. 428.81 Section 428.81 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS (CONTINUED) RUBBER MANUFACTURING POINT SOURCE CATEGORY Wet Digestion Reclaimed Rubber...

40 CFR 428.91 - Specialized definitions.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 40 Protection of Environment 30 2014-07-01 2014-07-01 false Specialized definitions. 428.91 Section 428.91 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS (CONTINUED) RUBBER MANUFACTURING POINT SOURCE CATEGORY Pan, Dry Digestion, and...

40 CFR 428.81 - Specialized definitions.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 40 Protection of Environment 30 2014-07-01 2014-07-01 false Specialized definitions. 428.81 Section 428.81 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS (CONTINUED) RUBBER MANUFACTURING POINT SOURCE CATEGORY Wet Digestion Reclaimed Rubber...

40 CFR 428.91 - Specialized definitions.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 40 Protection of Environment 31 2013-07-01 2013-07-01 false Specialized definitions. 428.91 Section 428.91 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS (CONTINUED) RUBBER MANUFACTURING POINT SOURCE CATEGORY Pan, Dry Digestion, and...

40 CFR 428.91 - Specialized definitions.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 40 Protection of Environment 30 2011-07-01 2011-07-01 false Specialized definitions. 428.91 Section 428.91 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS RUBBER MANUFACTURING POINT SOURCE CATEGORY Pan, Dry Digestion, and Mechanical Reclaimed...

40 CFR 428.91 - Specialized definitions.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 40 Protection of Environment 31 2012-07-01 2012-07-01 false Specialized definitions. 428.91 Section 428.91 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS (CONTINUED) RUBBER MANUFACTURING POINT SOURCE CATEGORY Pan, Dry Digestion, and...

40 CFR 428.81 - Specialized definitions.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 40 Protection of Environment 29 2010-07-01 2010-07-01 false Specialized definitions. 428.81 Section 428.81 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS RUBBER MANUFACTURING POINT SOURCE CATEGORY Wet Digestion Reclaimed Rubber Subcategory...

40 CFR 428.81 - Specialized definitions.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 40 Protection of Environment 30 2011-07-01 2011-07-01 false Specialized definitions. 428.81 Section 428.81 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS RUBBER MANUFACTURING POINT SOURCE CATEGORY Wet Digestion Reclaimed Rubber Subcategory...

40 CFR 428.21 - Specialized definitions.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 40 Protection of Environment 31 2012-07-01 2012-07-01 false Specialized definitions. 428.21 Section 428.21 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS (CONTINUED) RUBBER MANUFACTURING POINT SOURCE CATEGORY Emulsion Crumb Rubber Subcategory...

40 CFR 428.21 - Specialized definitions.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 40 Protection of Environment 31 2013-07-01 2013-07-01 false Specialized definitions. 428.21 Section 428.21 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS (CONTINUED) RUBBER MANUFACTURING POINT SOURCE CATEGORY Emulsion Crumb Rubber Subcategory...

40 CFR 428.21 - Specialized definitions.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 40 Protection of Environment 30 2014-07-01 2014-07-01 false Specialized definitions. 428.21 Section 428.21 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS (CONTINUED) RUBBER MANUFACTURING POINT SOURCE CATEGORY Emulsion Crumb Rubber Subcategory...

40 CFR 428.91 - Specialized definitions.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 40 Protection of Environment 29 2010-07-01 2010-07-01 false Specialized definitions. 428.91 Section 428.91 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS RUBBER MANUFACTURING POINT SOURCE CATEGORY Pan, Dry Digestion, and Mechanical Reclaimed...

Leigh Syndrome and the Mitochondrial m.13513G>A Mutation: Expanding the Clinical Spectrum.

PubMed

Monlleo-Neila, Laura; Toro, Mireia Del; Bornstein, Belen; Garcia-Arumi, Elena; Sarrias, Axel; Roig-Quilis, Manuel; Munell, Francina

2013-11-01

The mitochondrial DNA m.13513G>A mutation in the ND5 subunit gene is a frequent cause of Leigh syndrome. Patients harboring this mutation typically present with ptosis and cardiac conduction abnormalities, particularly Wolff-Parkinson-White syndrome, and have a late clinical onset, which contrasts with the typical infantile form. The authors describe a patient presenting with intrauterine growth retardation and visual impairment at 3 months of age, followed by infantile spasms, severe gastrointestinal dysmotility, and neurological regression. The patient had hyperlactacidemia and bilateral basal ganglia and brainstem lesions on MRI. Although he did not present cardiac conduction abnormalities, his mother had been diagnosed with Wolff-Parkinson-White syndrome. The m.13513G>A mutation was found in the patient's muscle and in several tissues of his mother. The present results expand the phenotype of Leigh syndrome associated with the m.13513G>A mutation, which should be suspected in patients with early-onset mitochondrial encephalopathy with infantile spasms or prominent gastrointestinal smooth muscle involvement.

A systematic comparison of all mutations in hereditary sensory neuropathy type I (HSAN I) reveals that the G387A mutation is not disease associated.

PubMed

Hornemann, Thorsten; Penno, Anke; Richard, Stephane; Nicholson, Garth; van Dijk, Fleur S; Rotthier, Annelies; Timmerman, Vincent; von Eckardstein, Arnold

2009-04-01

Hereditary sensory neuropathy type 1 (HSAN I) is an autosomal dominant inherited neurodegenerative disorder of the peripheral nervous system associated with mutations in the SPTLC1 subunit of the serine palmitoyltransferase (SPT). Four missense mutations (C133W, C133Y, V144D and G387A) in SPTLC1 were reported to cause HSAN I. SPT catalyses the condensation of Serine and Palmitoyl-CoA, which is the first and rate-limiting step in the de novo synthesis of ceramides. Earlier studies showed that C133W and C133Y mutants have a reduced activity, whereas the impact of the V144D and G387A mutations on the human enzyme was not tested yet. In this paper, we show that none of the HSAN I mutations interferes with SPT complex formation. We demonstrate that also V144D has a reduced SPT activity, however to a lower extent than C133W and C133Y. In contrast, the G387A mutation showed no influence on SPT activity. Furthermore, the growth phenotype of LY-B cells--a SPTLC1 deficient CHO cell line--could be reversed by expressing either the wild-type SPTLC1 or the G387A mutant, but not the C133W mutant. This indicates that the G387A mutation is most likely not directly associated with HSAN I. These findings were genetically confirmed by the identification of a nuclear HSAN family which showed segregation of the G387A variant as a non-synonymous SNP.

Amylin S20G mutation in Mexican population.

PubMed

Garcia-Gonzalez, Claudia Lorena; Montoya-Fuentes, Hector; Padilla-Rosas, Miguel; Sanchez-Corona, Jose

2007-04-01

Diabetes Mellitus type 2 (DM2) is a group of metabolic disorders characterized by defective insulin action or secretion or both with a 10.6% incidence in Mexican Mestizo population, DM2 is also classified within the localized misfolding diseases due to the amyloid pancreatic deposits found in 90% of the DM2 necropsies. The pancreatic amyloid main component is a protein known as human islet amyloid polypeptide (hIAPP) or amylin, the most common mutation is the S20G in Asian population with a polymorphic frequency in DM2 Asian patients. The aim of this study was to search this mutation in Mexican Mestizo general population (104) and DM2 patients (100). This is the first molecular study of hIAPP gene in Mexican population and in which we developed an alternative more effective antisense primer for the analysis of the NFGAILSS region in hIAPP exon 3 critical for the amyloid beta structure formation. We did not find the mutation in any of the 204 analyzed samples, thus the findings show that S20G is not a common mutation in Mexican Mestizo population.

Detection of KatG/inhA Mutation to Guide Isoniazid and Ethionamide Use for Drug-resistant Tuberculosis

PubMed Central

Namburete, Evangelina

2017-01-01

Abstract Background Both Mozambique and Brazil are countries with a high burden of tuberculosis. Isoniazid (INH) is one of the cornerstones of tuberculosis treatment and, depending on the mutated gene (katG or inhA), the organism may be susceptible to high doses of INH (inhA mutation) or to ethionamide (-Eth-KatG mutation). Methods To analyze isoniazid genotypic resistance profile in Mycobacterium tuberculosis to guide decision making about management of resistant tuberculosis. Descriptive study of 311 M. tuberculosis isolated from Ribeirão Preto, Brazil (2011–2014) and 155 isolates from Beira, Mozambique (2014–2015). Drug resistance patterns and the specific genes mutations were determined using Genotype MTBDRplus (Hain Lifescience GmbH, Germany). Results Mutations in katG gene were detected in 13/22 (59%) of Brazilian and in 32/38 (84.2%) of Mozambican isolates. Unique inhA mutations were observed in 8/22 (36%) isolates in Brazil and 4/38 (10.5%) in Mozambique. Both katG and inhA mutations where detected in 1/22 (5%) and 2/38(5.2%), respectively. katG mutations were more frequent among INH previously treated patients. Conclusion There is a geographical variation of INH mutations and the new molecular tests can be used to guide and accelerate decision making towards the use of ETH or high doses of INH based on detected mutations. Disclosures All authors: No reported disclosures.

An UPF3-based nonsense-mediated decay in Paramecium.

PubMed

Contreras, Julia; Begley, Victoria; Macias, Sandra; Villalobo, Eduardo

2014-12-01

Nonsense-mediated decay recognises mRNAs containing premature termination codons. One of its components, UPF3, is a molecular link bridging through its binding to the exon junction complex nonsense-mediated decay and splicing. In protists UPF3 has not been identified yet. We report that Paramecium tetraurelia bears an UPF3 gene and that it has a role in nonsense-mediated decay. Interestingly, the identified UPF3 has not conserved the essential amino acids required to bind the exon junction complex. Though, our data indicates that this ciliate bears genes coding for core proteins of the exon junction complex. Copyright © 2014 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

A novel recessive mutation in the gene ELOVL4 causes a neuro-ichthyotic disorder with variable expressivity

PubMed Central

2014-01-01

Background A rare neuro-ichthyotic disorder characterized by ichthyosis, spastic quadriplegia and intellectual disability and caused by recessive mutations in ELOVL4, encoding elongase-4 protein has recently been described. The objective of the study was to search for sequence variants in the gene ELOVL4 in three affected individuals of a consanguineous Pakistani family exhibiting features of neuro-ichthyotic disorder. Methods Linkage in the family was searched by genotyping microsatellite markers linked to the gene ELOVL4, mapped at chromosome 6p14.1. Exons and splice junction sites of the gene ELOVL4 were polymerase chain reaction amplified and sequenced in an automated DNA sequencer. Results DNA sequence analysis revealed a novel homozygous nonsense mutation (c.78C > G; p.Tyr26*). Conclusions Our report further confirms the recently described ELOVL4-related neuro-ichthyosis and shows that the neurological phenotype can be absent in some individuals. PMID:24571530

Glucose-6-phosphate dehydrogenase (G6PD) mutations database: review of the "old" and update of the new mutations.

PubMed

Minucci, Angelo; Moradkhani, Kamran; Hwang, Ming Jing; Zuppi, Cecilia; Giardina, Bruno; Capoluongo, Ettore

2012-03-15

In the present paper we have updated the G6PD mutations database, including all the last discovered G6PD genetic variants. We underline that the last database has been published by Vulliamy et al. [1] who analytically reported 140 G6PD mutations: along with Vulliamy's database, there are two main sites, such as http://202.120.189.88/mutdb/ and www.LOVD.nl/MR, where almost all G6PD mutations can be found. Compared to the previous mutation reports, in our paper we have included for each mutation some additional information, such as: the secondary structure and the enzyme 3D position involving by mutation, the creation or abolition of a restriction site (with the enzyme involved) and the conservation score associated with each amino acid position. The mutations reported in the present tab have been divided according to the gene's region involved (coding and non-coding) and mutations affecting the coding region in: single, multiple (at least with two bases involved) and deletion. We underline that for the listed mutations, reported in italic, literature doesn't provide all the biochemical or bio-molecular information or the research data. Finally, for the "old" mutations, we tried to verify features previously reported and, when subsequently modified, we updated the specific information using the latest literature data. Copyright © 2012 Elsevier Inc. All rights reserved.

Novel splice site mutation in the growth hormone receptor gene in Turkish patients with Laron-type dwarfism.

PubMed

Arman, Ahmet; Ozon, Alev; Isguven, Pinar S; Coker, Ajda; Peker, Ismail; Yordam, Nursen

2008-01-01

Growth hormone (GH) is involved in growth, and fat and carbohydrate metabolism. Interaction of GH with the GH receptor (GHR) is necessary for systemic and local production of insulin-like growth factor-I (IGF-I) which mediates GH actions. Mutations in the GHR cause severe postnatal growth failure; the disorder is an autosomal recessive genetic disease resulting in GH insensitivity, called Laron syndrome. It is characterized by dwarfism with elevated serum GH and low levels of IGF-I. We analyzed the GHR gene for mutations and polymorphisms in eight patients with Laron-type dwarfism from six families. We found three missense mutations (S40L, V125A, I526L), one nonsense mutation (W157X), and one splice site mutation in the extracellular domain of GHR. Furthermore, G168G and exon 3 deletion polymorphisms were detected in patients with Laron syndrome. The splice site mutation, which is a novel mutation, was located at the donor splice site of exon 2/ intron 2 within GHR. Although this mutation changed the highly conserved donor splice site consensus sequence GT to GGT by insertion of a G residue, the intron splicing between exon 2 and exon 3 was detected in the patient. These results imply that the splicing occurs arthe GT site in intron 2, leaving the extra inserted G residue at the end of exon 2, thus changing the open reading frame of GHR resulting in a premature termination codon in exon 3.

Mutations in the G6PC3 gene cause Dursun syndrome.

PubMed

Banka, Siddharth; Newman, William G; Ozgül, R Koksal; Dursun, Ali

2010-10-01

Dursun syndrome is a triad of familial primary pulmonary hypertension, leucopenia, and atrial septal defect. Here we demonstrate that mutations in G6PC3 cause Dursun syndrome. Mutations in G6PC3 are known to also cause severe congenital neutropenia type 4. Identification of the genetic basis of Dursun syndrome expands the pre-existing knowledge about the phenotypic effects of mutations in G6PC3. We propose that Dursun syndrome should now be considered as a subset of severe congenital neutropenia type 4 with pulmonary hypertension as an important clinical feature. Copyright © 2010 Wiley-Liss, Inc.

FLG mutation p.Lys4021X in the C-terminal imperfect filaggrin repeat in Japanese patients with atopic eczema.

PubMed

Nemoto-Hasebe, I; Akiyama, M; Nomura, T; Sandilands, A; McLean, W H I; Shimizu, H

2009-12-01

Mutations in the gene encoding filaggrin (FLG) have been shown to predispose to atopic eczema (AE). Further to establish population genetics of FLG mutations in the Japanese population and to elucidate effects of FLG mutations to filaggrin biosynthesis in skin of patients with AE. We searched for FLG mutations in 19 newly recruited Japanese patients with AE. We then screened 137 Japanese patients with AE and 134 Japanese control individuals for a novel mutation identified in the present study. In addition, we evaluated FLG mRNA expression by real-time reverse transcription-polymerase chain reaction and profilaggrin/filaggrin protein expression by immunohistochemical staining in the epidermis of the patients carrying the novel mutation. We identified a novel FLG nonsense mutation c.12069A>T (p.Lys4021X) in one patient with AE. Upon further screening, p.Lys4021X was identified in four patients with AE (2.9% of all the patients with AE). In total, there are at least eight FLG variants in the Japanese population. Here we show that about 27% of patients in our Japanese AE case series carry one or more of these eight FLG mutations and these variants are also carried by 3.7% of Japanese general control individuals. There is a significant statistical association between the eight FLG mutations and AE (chi(2) P = 6.50 x 10(-8)). Interestingly, the present nonsense mutation is in the C-terminal incomplete filaggrin repeat and is the mutation nearest the C-terminal among previously reported FLG mutations. Immunohistochemical staining for filaggrin revealed that this nonsense mutation leads to remarkable reduction of filaggrin protein expression in the patients' epidermis. We clearly demonstrated that FLG mutations are significantly associated with AE in the Japanese population. The present results further support the hypothesis that the C-terminal region is essential for proper processing of profilaggrin to filaggrin.

Three cases with L1 syndrome and two novel mutations in the L1CAM gene.

PubMed

Marín, Rosario; Ley-Martos, Miriam; Gutiérrez, Gema; Rodríguez-Sánchez, Felicidad; Arroyo, Diego; Mora-López, Francisco

2015-11-01

Mutations in the L1CAM gene have been identified in the following various X-linked neurological disorders: congenital hydrocephalus; mental retardation, aphasia, shuffling gait, and adducted thumbs (MASA) syndrome; spastic paraplegia; and agenesis of the corpus callosum. These conditions are currently considered different phenotypes of a single entity known as L1 syndrome. We present three families with L1 syndrome. Sequencing of the L1CAM gene allowed the identification of the following mutations involved: a known splicing mutation (c.3531-12G>A) and two novel ones: a missense mutation (c.1754A>C; p.Asp585Ala) and a nonsense mutation (c.3478C>T; p.Gln1160Stop). The number of affected males and carrier females identified in a relatively small population suggests that L1 syndrome may be under-diagnosed. L1 syndrome should be considered in the differential diagnosis of intellectual disability or mental retardation in children, especially when other signs such as hydrocephalus or adducted thumbs are present.

Novel pathogenic mutations and skin biopsy analysis in Knobloch syndrome.

PubMed

Suzuki, Oscar; Kague, Erika; Bagatini, Kelly; Tu, Hongmin; Heljasvaara, Ritva; Carvalhaes, Lorenza; Gava, Elisandra; de Oliveira, Gisele; Godoi, Paulo; Oliva, Glaucius; Kitten, Gregory; Pihlajaniemi, Taina; Passos-Bueno, Maria-Rita

2009-01-01

To facilitate future diagnosis of Knobloch syndrome (KS) and better understand its etiology, we sought to identify not yet described COL18A1 mutations in KS patients. In addition, we tested whether mutations in this gene lead to absence of the COL18A1 gene product and attempted to better characterize the functional effect of a previously reported missense mutation. Direct sequencing of COL18A1 exons was performed in KS patients from four unrelated pedigrees. We used immunofluorescent histochemistry in skin biopsies to evaluate the presence of type XVIII collagen in four KS patients carrying two already described mutations: c.3277C>T, a nonsense mutation, and c.3601G>A, a missense mutation. Furthermore, we determined the binding properties of the mutated endostatin domain p.A1381T (c.3601G>A) to extracellular matrix proteins using ELISA and surface plasmon resonance assays. We identified four novel mutations in COL18A1, including a large deletion involving exon 41. Skin biopsies from KS patients revealed lack of type XVIII collagen in epithelial basement membranes and blood vessels. We also found a reduced affinity of p.A1381T endostatin to some extracellular matrix components. COL18A1 mutations involved in Knobloch syndrome have a distribution bias toward the coding exons of the C-terminal end. Large deletions must also be considered when point mutations are not identified in patients with characteristic KS phenotype. We report, for the first time, lack of type XVIII collagen in KS patients by immunofluorescent histochemistry in skin biopsy samples. As a final point, we suggest the employment of this technique as a preliminary and complementary test for diagnosis of KS in cases when mutation screening either does not detect mutations or reveals mutations of uncertain effect, such as the p.A1381T change.

Carnitine-acylcarnitine translocase deficiency with c.199-10 T>G and novel c.1A>G mutation: Two case reports and brief literature review.

PubMed

Yan, Hui-Ming; Hu, Hao; Ahmed, Aisha; Feng, Bing-Bing; Liu, Jing; Jia, Zheng-Jun; Wang, Hua

2017-11-01

Carnitine-acylcarnitine translocate deficiency (CACTD) is a rare and life-threatening, autosomal recessive disorder of fatty acid β-oxidation characterized by hypoketotic hypoglycemia, hyperammonemia, cardiomyopathy, liver dysfunction, and muscle weakness; culminating in early death. To date, CACTD cases screened from the Chinese mainland population, especially patient with compound heterozygote with c.199-10T>G and a novel c.1A>G mutation in the SLC25A20 gene has never been described. Herein, we report 2 neonatal cases of CACTD identified from the mainland China. These 2 patients were presented with severe metabolic crisis and their clinical conditions deteriorate rapidly and both died of cardiorespiratory collapse in the first week of life. We present the clinical and biochemical features of 2 probands and a brief literature review of previously reported CACTD cases with the c.199-10T>G mutation. The acylcarnitine profiles by tandem-mass-spectrometry and the mutation analysis of SLC25A20 gene confirmed the diagnosis of CACTD in both patients. Mutation analysis demonstrated that patient No. 1 was homozygous for c.199-10T>G mutation, while patient No. 2 was a compound heterozygote for 2 mutations, a maternally-inherited c.199-10T>G and a paternally-inherited, novel c.1A>G mutation. Both patients were treated with an aggressive treatment regimen include high glucose and arginine infusion, respiratory, and circulatory support. The first proband died 3 days after delivery due to sudden cardiac arrest. The second patient's clinical condition, at one time, was improved by high glucose infusion, intravenous arginine, and circulatory support. However, the patient failed to wean from mechanical ventilation. Unfortunately, her parents refused further treatment due to fear of financial burdens. The patient died of congestive heart failure in the 6th day of life. We report the first 2 cases of CACTD identified from the mainland China. Apart from a founder mutation c.199-10T>G

High prevalence of factor V Leiden and prothrombin G20101A mutations in Kashmiri patients with venous thromboembolism.

PubMed

Shafia, Syed; Zargar, Mahrukh H; Khan, Nabeela; Ahmad, Rehana; Shah, Zafar Amin; Asimi, Ravouf

2018-05-15

The genetic variants of the factor V (G1691A), prothrombin (G20210A) and MTHFR (C677T) genes have been widely implicated as inherited risk factors for developing venous thrombosis. This study was undertaken to reveal the frequency of these mutations in Kashmiri patients with venous thromboembolism. A case-control study was designed with 250 VTE patients and 250 healthy controls. The mutations were analysed using ARMS-PCR and PCR-RFLP approach. The factor V Leiden G1691A mutation was found in 17/250 (6.8%) VTE patients and prothrombin G20210A mutation was found in 7/250 (2.8%) VTE patients while no mutation was found in any of the healthy controls. Both the mutations were found to be significantly associated with the increased risk of VTE (p = 0.0001 and 0.0150 respectively) while no association of VTE risk with MTHFR C677T polymorphism was found (p = 0.53). The increased frequency of factor V Leiden G1691A and prothrombin G20210A mutation in VTE patients indicates a significant role of these mutations in the development of VTE in our population. We therefore suggest the routine screening of these two mutations as thrombophilic markers in Kashmiri patients with venous thromboembolism. Copyright © 2018 Elsevier B.V. All rights reserved.

Neuroligin 2 nonsense variant associated with anxiety, autism, intellectual disability, hyperphagia, and obesity.

PubMed

Parente, Daniel J; Garriga, Caryn; Baskin, Berivan; Douglas, Ganka; Cho, Megan T; Araujo, Gabriel C; Shinawi, Marwan

2017-01-01

Neuroligins are post-synaptic, cellular adhesion molecules implicated in synaptic formation and function. NLGN2 is strongly linked to inhibitory, GABAergic signaling and is crucial for maintaining the excitation-inhibition balance in the brain. Disruption of the excitation-inhibition balance is associated with neuropsychiatric disease. In animal models, altered NLGN2 expression causes anxiety, developmental delay, motor discoordination, social impairment, aggression, and sensory processing defects. In humans, mutations in NLGN3 and NLGN4 are linked to autism and schizophrenia; NLGN2 missense variants are implicated in schizophrenia. Copy number variants encompassing NLGN2 on 17p13.1 are associated with autism, intellectual disability, metabolic syndrome, diabetes, and dysmorphic features, but an isolated NLGN2 nonsense variant has not yet been described in humans. Here, we describe a 15-year-old male with severe anxiety, obsessive-compulsive behaviors, developmental delay, autism, obesity, macrocephaly, and some dysmorphic features. Exome sequencing identified a heterozygous, de novo, c.441C>A p.(Tyr147Ter) variant in NLGN2 that is predicted to cause loss of normal protein function. This is the first report of an NLGN2 nonsense variant in humans, adding to the accumulating evidence that links synaptic proteins with a spectrum of neurodevelopmental phenotypes. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

TRPC6 G757D Loss-of-Function Mutation Associates with FSGS

PubMed Central

Riehle, Marc; Büscher, Anja K.; Gohlke, Björn-Oliver; Kaßmann, Mario; Kolatsi-Joannou, Maria; Bräsen, Jan H.; Nagel, Mato; Becker, Jan U.; Winyard, Paul; Hoyer, Peter F.; Preissner, Robert; Krautwurst, Dietmar; Gollasch, Maik

2016-01-01

FSGS is a CKD with heavy proteinuria that eventually progresses to ESRD. Hereditary forms of FSGS have been linked to mutations in the transient receptor potential cation channel, subfamily C, member 6 (TRPC6) gene encoding a nonselective cation channel. Most of these TRPC6 mutations cause a gain-of-function phenotype, leading to calcium–triggered podocyte cell death, but the underlying molecular mechanisms are unclear. We studied the molecular effect of disease-related mutations using tridimensional in silico modeling of tetrameric TRPC6. Our results indicated that G757 is localized in a domain forming a TRPC6-TRPC6 interface and predicted that the amino acid exchange G757D causes local steric hindrance and disruption of the channel complex. Notably, functional characterization of model interface domain mutants suggested a loss-of-function phenotype. We then characterized 19 human FSGS–related TRPC6 mutations, the majority of which caused gain-of-function mutations. However, five mutations (N125S, L395A, G757D, L780P, and R895L) caused a loss-of-function phenotype. Coexpression of wild-type TRPC6 and TRPC6 G757D, mimicking heterozygosity observed in patients, revealed a dominant negative effect of TRPC6 G757D. Our comprehensive analysis of human disease–causing TRPC6 mutations reveals loss of TRPC6 function as an additional concept of hereditary FSGS and provides molecular insights into the mechanism responsible for the loss-of-function phenotype of TRPC6 G757D in humans. PMID:26892346

Rimas Tontas. (Nonsense Rhymes)

ERIC Educational Resources Information Center

Galarza, Ernesto

Part of the series "Coleccion Mini-Libros" (Mini-Book Collection), the booklet is a compilation of 50 short nonsense verses written in Spanish. The author and The Southwest Council of La Raza offer the collection for the use of parents and teachers dedicated to stimulating interest in Spanish among the youth of our country. (EJ)

Mutations in CTC1, Encoding the CTS Telomere Maintenance Complex Component 1, Cause Cerebroretinal Microangiopathy with Calcifications and Cysts

PubMed Central

Polvi, Anne; Linnankivi, Tarja; Kivelä, Tero; Herva, Riitta; Keating, James P.; Mäkitie, Outi; Pareyson, Davide; Vainionpää, Leena; Lahtinen, Jenni; Hovatta, Iiris; Pihko, Helena; Lehesjoki, Anna-Elina

2012-01-01

Cerebroretinal microangiopathy with calcifications and cysts (CRMCC) is a rare multisystem disorder characterized by extensive intracranial calcifications and cysts, leukoencephalopathy, and retinal vascular abnormalities. Additional features include poor growth, skeletal and hematological abnormalities, and recurrent gastrointestinal bleedings. Autosomal-recessive inheritance has been postulated. The pathogenesis of CRMCC is unknown, but its phenotype has key similarities with Revesz syndrome, which is caused by mutations in TINF2, a gene encoding a member of the telomere protecting shelterin complex. After a whole-exome sequencing approach in four unrelated individuals with CRMCC, we observed four recessively inherited compound heterozygous mutations in CTC1, which encodes the CTS telomere maintenance complex component 1. Sanger sequencing revealed seven more compound heterozygous mutations in eight more unrelated affected individuals. Two individuals who displayed late-onset cerebral findings, a normal fundus appearance, and no systemic findings did not have CTC1 mutations, implying that systemic findings are an important indication for CTC1 sequencing. Of the 11 mutations identified, four were missense, one was nonsense, two resulted in in-frame amino acid deletions, and four were short frameshift-creating deletions. All but two affected individuals were compound heterozygous for a missense mutation and a frameshift or nonsense mutation. No individuals with two frameshift or nonsense mutations were identified, which implies that severe disturbance of CTC1 function from both alleles might not be compatible with survival. Our preliminary functional experiments did not show evidence of severely affected telomere integrity in the affected individuals. Therefore, determining the underlying pathomechanisms associated with deficient CTC1 function will require further studies. PMID:22387016

Nonsense-mediated mRNA degradation of CtFAD2-1 and development of a perfect molecular marker for olol mutation in high oleic safflower (Carthamus tinctorius L.).

PubMed

Liu, Qing; Cao, Shijiang; Zhou, Xue-Rong; Wood, Craig; Green, Allan; Singh, Surinder

2013-09-01

There are two types of safflower oil, high oleic (HO) with 70-75 % oleic acid and high linoleic (HL) with about 70 % linoleic acid. The original HO trait in safflower, found in an introduction from India, is controlled by a partially recessive allele ol at a single locus (Knowles and Bill 1964). In the lipid biosynthesis pathway of developing safflower seeds, microsomal oleoyl phosphatidylcholine desaturase (FAD2) is largely responsible for the conversion of oleic acid to linoleic acid. In vitro microsomal assays indicated drastically reduced FAD2 enzyme activity in the HO genotype compared to conventional HL safflower. A previous study indicated that a single-nucleotide deletion was found in the coding region of CtFAD2-1 that causes premature termination of translation in the HO genotypes, and the expression of the mutant CtFAD2-1Δ was attenuated in the HO genotypes compared to conventional HL safflower (Guan et al. 2012). In this study, we hypothesise that down-regulation of CtFAD2-1 expression in the HO genotype may be explained by nonsense-mediated RNA decay (NMD). NMD phenomenon, indicated by gene-specific RNA degradation of defective CtFAD2-1Δ, was subsequently confirmed in Arabidopsis thaliana seed as well as in the transient expression system in Nicotiana benthamiana leaves. We have developed a perfect molecular marker corresponding to the olol mutation that can facilitate a rapid screening and early detection of genotypes carrying the olol mutation for use in marker-assisted selection for the management of the HO trait in safflower breeding programmes.

Homozygous SALL1 Mutation Causes a Novel Multiple Congenital Anomaly—Mental Retardation Syndrome

PubMed Central

Vodopiutz, Julia; Zoller, Heinz; Fenwick, Aimée L.; Arnhold, Richard; Schmid, Max; Prayer, Daniela; Müller, Thomas; Repa, Andreas; Pollak, Arnold; Aufricht, Christoph; Wilkie, Andrew O.M.; Janecke, Andreas R.

2013-01-01

Objective To delineate a novel autosomal recessive multiple congenital anomaly-mental retardation (MCA-MR) syndrome in 2 female siblings of a consanguineous pedigree and to identify the disease-causing mutation. Study design Both siblings were clinically characterized and homozygosity mapping and sequencing of candidate genes were applied. The contribution of nonsense-mediated messenger RNA (mRNA) decay to the expression of mutant mRNA in fibroblasts of a healthy carrier and a control was studied by pyrosequencing. Results We identified the first homozygous SALL1 mutation, c.3160C > T (p.R1054*), in 2 female siblings presenting with multiple congenital anomalies, central nervous system defects, cortical blindness, and absence of psychomotor development (ie, a novel recognizable, autosomal recessive MCA-MR). The mutant SALL1 transcript partially undergoes nonsense-mediated mRNA decay and is present at 43% of the normal transcript level in the fibroblasts of a healthy carrier. Conclusion Previously heterozygous SALL1 mutations and deletions have been associated with dominantly inherited anal-renal-radial-ear developmental anomalies. We identified an allelic recessive SALL1-related MCA-MR. Our findings imply that quantity and quality of SALL1 transcript are important for SALL1 function and determine phenotype, and mode of inheritance, of allelic SALL1-related disorders. This novel MCA-MR emphasizes SALL1 function as critical for normal central nervous system development and warrants a detailed neurologic investigation in all individuals with SALL1 mutations. PMID:23069192

Novel NTRK1 mutations cause hereditary sensory and autonomic neuropathy type IV: demonstration of a founder mutation in the Turkish population.

PubMed

Tüysüz, Beyhan; Bayrakli, Fatih; DiLuna, Michael L; Bilguvar, Kaya; Bayri, Yasar; Yalcinkaya, Cengiz; Bursali, Aysegul; Ozdamar, Elif; Korkmaz, Baris; Mason, Christopher E; Ozturk, Ali K; Lifton, Richard P; State, Matthew W; Gunel, Murat

2008-05-01

Hereditary sensory and autonomic neuropathy type IV (HSAN IV), or congenital insensitivity to pain with anhidrosis, is an autosomal recessive disorder characterized by insensitivity to noxious stimuli, anhidrosis from deinnervated sweat glands, and delayed mental and motor development. Mutations in the neurotrophic tyrosine kinase receptor type 1 (NTRK1), a receptor in the neurotrophin signaling pathway phosphorylated in response to nerve growth factor, are associated with this disorder. We identified six families from Northern Central Turkey with HSAN IV. We screened the NTRK1 gene for mutations in these families. Microsatellite and single nucleotide polymorphism (SNP) markers on the Affymetrix 250K chip platform were used to determine the haplotypes for three families harboring the same mutation. Screening for mutations in the NTRK1 gene demonstrated one novel frameshift mutation, two novel nonsense mutations, and three unrelated kindreds with the same splice-site mutation. Genotyping of the three families with the identical splice-site mutation revealed that they share the same haplotype. This report broadens the spectrum of mutations in NTRK1 that cause HSAN IV and demonstrates a founder mutation in the Turkish population.

CYP3A5 mRNA degradation by nonsense-mediated mRNA decay.

PubMed

Busi, Florent; Cresteil, Thierry

2005-09-01

The total CYP3A5 mRNA level is significantly greater in carriers of the CYP3A5*1 allele than in CYP3A5*3 homozygotes. Most of the CYP3A5*3 mRNA includes an intronic sequence (exon 3B) containing premature termination codons (PTCs) between exons 3 and 4. Two models were used to investigate the degradation of CYP3A5 mRNA: a CYP3A5 minigene consisting of CYP3A5 exons and introns 3 to 6 transfected into MCF7 cells, and the endogenous CYP3A5 gene expressed in HepG2 cells. The 3'-untranslated region g.31611C>T mutation has no effect on CYP3A5 mRNA decay. Splice variants containing exon 3B were more unstable than wild-type (wt) CYP3A5 mRNA. Cycloheximide prevents the recognition of PTCs by ribosomes: in transfected MCF7 and HepG2 cells, cycloheximide slowed down the degradation of exon 3B-containing splice variants, suggesting the participation of nonsense-mediated decay (NMD). When PTCs were removed from pseudoexon 3B or when UPF1 small interfering RNA was used to impair the NMD mechanism, the decay of the splice variant was reduced, confirming the involvement of NMD in the degradation of CYP3A5 splice variants. Induction could represent a source of variability for CYP3A5 expression and could modify the proportion of splice variants. The extent of CYP3A5 induction was investigated after exposure to barbiturates or steroids: CYP3A4 was markedly induced in a pediatric population compared with untreated neonates. However, no effect could be detected in either the total CYP3A5 RNA, the proportion of splice variant RNA, or the protein level. Therefore, in these carriers, induction is unlikely to switch on the phenotypic CYP3A5 expression in carriers of CYP3A5*3/*3.

Novel PSEN1 G209A mutation in early-onset Alzheimer dementia supported by structural prediction.

PubMed

An, Seong Soo A; Bagyinszky, Eva; Kim, Hye Ryoun; Seok, Ju-Won; Shin, Hae-Won; Bae, SeunOh; Kim, SangYun; Youn, Young Chul

2016-05-20

Three main genes are described as causative genes for early-onset Alzheimer dementia (EOAD): APP, PSEN1 and PSEN2. We describe a woman with EOAD had a novel PSEN1 mutation. A 54-year-old right-handed woman presented 12-year history of progressive memory decline. She was clinically diagnosed as familial Alzheimer's disease due to a PSEN1 mutation. One of two daughters also has the same mutation, G209A in the TM-IV of PS1 protein. Her mother had unspecified dementia that began at the age of 40s. PolyPhen2 and SIFT prediction suggested that G209A might be a damaging variant with high scores. 3D modeling revealed that G209A exchange could result significant changes in the PS1 protein. We report a case of EOAD having probable novel PSEN1 (G209A) mutation verified with structural prediction.

[Mutation analysis of the PAH gene in children with phenylketonuria from the Qinghai area of China].

PubMed

He, Jiang; Wang, Hui-Zhen; Xu, Fa-Liang; Yang, Xi; Wang, Rui; Zou, Hong-Yun; Yu, Wu-Zhong

2015-11-01

To study the mutation characteristics of the phenylalanine hydroxylase (PAH) gene in children with phenylketonuria (PKU) from the Qinghai area of China, in order to provide basic information for genetic counseling and prenatal diagnosis. Mutations of the PAH gene were detected in the promoter and exons 1-13 and their flanking intronic sequences of PAH gene by PCR and DNA sequencing in 49 children with PKU and their parents from the Qinghai area of China. A total of 30 different mutations were detected in 80 out of 98 mutant alleles (82%), including 19 missense (63%), 5 nonsense (17%), 3 splice-site (10%) and 3 deletions (10%). Most mutations were detected in exons 3, 6, 7, 11 and intron 4 of PAH gene. The most frequent mutations were p.R243Q (19%), IVS4-1G>A (9%), p.Y356X (7%) and p.EX6-96A>G(5%). Two novel mutations p.N93fsX5 (c.279-282delCATC) and p.G171E (c.512G>A) were found. p.H64fsX9(c.190delC) was documented for the second time in Chinese PAH gene. The mutation spectrum of the gene PAH in the Qinghai population was similar to that in other populations in North China while significantly different from that in the populations from some provinces in southern China, Japan and Europe. The mutations of PAH gene in the Qinghai area of China demonstrate a unique diversity, complexity and specificity.

Alagille syndrome in a Vietnamese cohort: mutation analysis and assessment of facial features.

PubMed

Lin, Henry C; Le Hoang, Phuc; Hutchinson, Anne; Chao, Grace; Gerfen, Jennifer; Loomes, Kathleen M; Krantz, Ian; Kamath, Binita M; Spinner, Nancy B

2012-05-01

Alagille syndrome (ALGS, OMIM #118450) is an autosomal dominant disorder that affects multiple organ systems including the liver, heart, eyes, vertebrae, and face. ALGS is caused by mutations in one of two genes in the Notch Signaling Pathway, Jagged1 (JAG1) or NOTCH2. In this study, analysis of 21 Vietnamese ALGS individuals led to the identification of 19 different mutations (18 JAG1 and 1 NOTCH2), 17 of which are novel, including the third reported NOTCH2 mutation in Alagille Syndrome. The spectrum of JAG1 mutations in the Vietnamese patients is similar to that previously reported, including nine frameshift, three missense, two splice site, one nonsense, two whole gene, and one partial gene deletion. The missense mutations are all likely to be disease causing, as two are loss of cysteines (C22R and C78G) and the third creates a cryptic splice site in exon 9 (G386R). No correlation between genotype and phenotype was observed. Assessment of clinical phenotype revealed that skeletal manifestations occur with a higher frequency than in previously reported Alagille cohorts. Facial features were difficult to assess and a Vietnamese pediatric gastroenterologist was only able to identify the facial phenotype in 61% of the cohort. To assess the agreement among North American dysmorphologists at detecting the presence of ALGS facial features in the Vietnamese patients, 37 clinical dysmorphologists evaluated a photographic panel of 20 Vietnamese children with and without ALGS. The dysmorphologists were unable to identify the individuals with ALGS in the majority of cases, suggesting that evaluation of facial features should not be used in the diagnosis of ALGS in this population. This is the first report of mutations and phenotypic spectrum of ALGS in a Vietnamese population. Copyright © 2012 Wiley Periodicals, Inc.

Whole Exome Sequencing Identifies de Novo Mutations in GATA6 Associated with Congenital Diaphragmatic Hernia

PubMed Central

Yu, Lan; Bennett, James T.; Wynn, Julia; Carvill, Gemma L.; Cheung, Yee Him; Shen, Yufeng; Mychaliska, George B.; Azarow, Kenneth S.; Crombleholme, Timothy M.; Chung, Dai H.; Potoka, Douglas; Warner, Brad W.; Bucher, Brian; Lim, Foong-Yen; Pietsch, John; Stolar, Charles; Aspelund, Gudrun; Arkovitz, Marc S.; Mefford, Heather; Chung, Wendy K.

2014-01-01

Background Congenital diaphragmatic hernia (CDH) is a common birth defect affecting 1 in 3,000 births. It is characterized by herniation of abdominal viscera through an incompletely formed diaphragm. Although chromosomal anomalies and mutations in several genes have been implicated, the cause for most patients is unknown. Methods We used whole exome sequencing in two families with CDH and congenital heart disease, and identified mutations in GATA6 in both. Results In the first family, we identified a de novo missense mutation (c.1366C>T, p.R456C) in a sporadic CDH patient with tetralogy of Fallot. In the second, a nonsense mutation (c.712G>T, p.G238*) was identified in two siblings with CDH and a large ventricular septal defect. The G238* mutation was inherited from their mother, who was clinically affected with congenital absence of the pericardium, patent ductus arteriosus, and intestinal malrotation. Deep sequencing of blood and saliva derived DNA from the mother suggested somatic mosaicism as an explanation for her milder phenotype, with only approximately 15% mutant alleles. To determine the frequency of GATA6 mutations in CDH, we sequenced the gene in 378 patients with CDH. We identified one additional de novo mutation (c.1071delG, p.V358Cfs34*). Conclusions Mutations in GATA6 have been previously associated with pancreatic agenesis and congenital heart disease. We conclude that, in addition to the heart and the pancreas, GATA6 is involved in development of two additional organs, the diaphragm and the pericardium. In addition we have shown that de novo mutations can contribute to the development of CDH, a common birth defect. PMID:24385578

Novel Nonsense Variants c.58C>T (p.Q20X) and c.256G>T (p.E85X) in the CHEK2 Gene Identified dentified in Breast Cancer Patients from Balochistan.

PubMed

Baloch, Abdul Hameed; Khosa, Ahmad Nawaz; Bangulzai, Nasrullah; Shuja, Jamila; Naseeb, Hafiz Khush; Jan, Mohammad; Marghazani, Illahi Bakhsh; Kakar, Masood-Ul-Haq; Baloch, Dost Mohammad; Cheema, Abdul Majeed; Ahmad, Jamil

2016-01-01

Breast cancer is the most commonly occurring and leading cause of cancer deaths among women globally. Hereditary cases account 5-10% of all the cases and CHEK2 is considered as a moderate penetrance breast cancer risk gene. CHEK2 plays a crucial role in response to DNA damage to promote cell cycle arrest and repair DNA damage or induce apoptosis. Our objective in the current study was to analyze mutations in the CHEK2 gene related to breast cancer in Balochistan. A total of 271 individuals including breast cancer patients and normal subjects were enrolled. All 14 exons of CHEK2 were amplified and sequenced. The majority of the patients (>95%) had invasive ductal carcinomas (IDCs), 52.1% were diagnosed with tumor grade III and 56.1% and 27.5% were diagnosed with advance stages III and IV. Two novel nonsense variants i.e. c.58C>T (P.Q20X) and c.256G>T (p.E85X) at exon 1 and 2 in two breast cancer patients were identified in the current study. Both the variants identified were novel and have not been reported elsewhere.

Mutation analysis of BRCA1/2 mutations with special reference to polymorphic SNPs in Indian breast cancer patients.

PubMed

Shah, Nidhi D; Shah, Parth S; Panchal, Yash Y; Katudia, Kalpesh H; Khatri, Nikunj B; Ray, Hari Shankar P; Bhatiya, Upti R; Shah, Sandip C; Shah, Bhavini S; Rao, Mandava V

2018-01-01

Germline mutations BRCA1 and BRCA2 contribute almost equally in the causation of breast cancer (BC). The type of mutations in the Indian population that cause this condition is largely unknown. In this cohort, 79 randomized BC patients were screened for various types of BRCA1 and BRCA2 mutations including frameshift, nonsense, missense, in-frame and splice site types. The purified extracted DNA of each referral patient was subjected to Sanger gene sequencing using Codon Code Analyzer and Mutation Surveyor and next-generation sequencing (NGS) methods with Ion torrent software, after appropriate care. The data revealed that 35 cases were positive for BRCA1 or BRCA2 (35/79: 44.3%). BRCA2 mutations were higher (52.4%) than BRCA1 mutations (47.6%). Five novel mutations detected in this study were p.pro163 frameshift, p.asn997 frameshift, p.ser148 frameshift and two splice site single-nucleotide polymorphisms (SNPs). Additionally, four nonsense and one in-frame deletion were identified, which all seemed to be pathogenic. Polymorphic SNPs contributed the highest percentage of mutations (72/82: 87.8%) and contributed to pathogenic, likely pathogenic, likely benign, benign and variant of unknown significance (VUS). Young age groups (20-60 years) had a high frequency of germline mutations (62/82;75.6%) in the Indian population. This study suggested that polymorphic SNPs contributed a high percentage of mutations along with five novel types. Younger age groups are prone to having BC with a higher mutational rate. Furthermore, the SNPs detected in exons 10, 11 and 16 of BRCA1 and BRCA2 were higher than those in other exons 2, 3 and 9 polymorphic sites in two germline genes. These may be contributory for BC although missense types are known to be susceptible for cancer depending on the type of amino acid replaced in the protein and associated with pathologic events. Accordingly, appropriate counseling and treatment may be suggested.

Mutations in the HFE, TFR2, and SLC40A1 genes in patients with hemochromatosis.

PubMed

Del-Castillo-Rueda, Alejandro; Moreno-Carralero, María-Isabel; Cuadrado-Grande, Nuria; Alvarez-Sala-Walther, Luis-Antonio; Enríquez-de-Salamanca, Rafael; Méndez, Manuel; Morán-Jiménez, María-Josefa

2012-10-15

Hereditary hemochromatosis causes iron overload and is associated with a variety of genetic and phenotypic conditions. Early diagnosis is important so that effective treatment can be administered and the risk of tissue damage avoided. Most patients are homozygous for the c.845G>A (p.C282Y) mutation in the HFE gene; however, rare forms of genetic iron overload must be diagnosed using a specific genetic analysis. We studied the genotype of 5 patients who had hyperferritinemia and an iron overload phenotype, but not classic mutations in the HFE gene. Two patients were undergoing phlebotomy and had no iron overload, 1 with metabolic syndrome and no phlebotomy had mild iron overload, and 2 patients had severe iron overload despite phlebotomy. The patients' first-degree relatives also underwent the analysis. We found 5 not previously published mutations: c.-408_-406delCAA in HFE, c.1118G>A (p.G373D), c.1473G>A (p.E491E) and c.2085G>C (p.S695S) in TFR2; and c.-428_-427GG>TT in SLC40A1. Moreover, we found 3 previously published mutations: c.221C>T (p.R71X) in HFE; c.1127C>A (p.A376D) in TFR2; and c.539T>C (p.I180T) in SLC40A1. Four patients were double heterozygous or compound heterozygous for the mutations mentioned above, and the patient with metabolic syndrome was heterozygous for a mutation in the TFR2 gene. Our findings show that hereditary hemochromatosis is clinically and genetically heterogeneous and that acquired factors may modify or determine the phenotype. Copyright © 2012. Published by Elsevier B.V.

Glycogen storage disease type 1a in three siblings with the G270V mutation.

PubMed

Parvari, R; Isam, J; Moses, S W

1999-04-01

Glycogen storage disease type 1a (von Gierke disease, GSD1a) is caused by the deficiency of microsomal glucose-6-phosphatase (G6Pase) activity. The cloning of G6Pase cDNA and characterization of the human G6Pase gene enabled the identification of the mutations causing GSD1a. Here we report on the clinical and biochemical features of three GSD1a siblings of a Muslin Arab family with a G270V mutation. Two older patients presented with an unusually mild clinical and biochemical course.

Diagnosis of Xeroderma Pigmentosum Groups A and C by Detection of Two Prevalent Mutations in West Algerian Population: A Rapid Genotyping Tool for the Frequent XPC Mutation c.1643_1644delTG.

PubMed

Bensenouci, Salima; Louhibi, Lotfi; De Verneuil, Hubert; Mahmoudi, Khadidja; Saidi-Mehtar, Nadhira

2016-01-01

Xeroderma pigmentosum (XP) is a rare autosomal recessive disorder. Considering that XP patients have a defect of the nucleotide excision repair (NER) pathway which enables them to repair DNA damage caused by UV light, they have an increased risk of developing skin and eyes cancers. In the present study, we investigated the involvement of the prevalent XPA and XPC genes mutations-nonsense mutation (c.682C>T, p.Arg228X) and a two-base-pair (2 bp) deletion (c.1643_1644delTG or p.Val548Ala fsX25), respectively-in 19 index cases from 19 unrelated families in the West of Algeria. For the genetic diagnosis of XPA gene, we proceeded to PCR-RFLP. For the XPC gene, we validated a routine analysis which includes a specific amplification of a short region surrounding the 2 bp deletion using a fluorescent primer and fragment sizing (GeneScan size) on a sequencing gel. Among the 19 index cases, there were 17 homozygous patients for the 2 bp deletion in the XPC gene and 2 homozygous patients carrying the nonsense XPA mutation. Finally, XPC appears to be the major disease-causing gene concerning xeroderma pigmentosum in North Africa. The use of fragment sizing is the simplest method to analyze this 2 bp deletion for the DNA samples coming from countries where the mutation c.1643_1644delTG of XPC gene is prevalent.

Detection of katG and inhA mutations to guide isoniazid and ethionamide use for drug-resistant tuberculosis.

PubMed

Bollela, V R; Namburete, E I; Feliciano, C S; Macheque, D; Harrison, L H; Caminero, J A

2016-08-01

Depending on the presence of mutations that determine isoniazid (INH) susceptibility (katG and inhA), Mycobacterium tuberculosis may be susceptible to high doses of INH or ethionamide (ETH). To describe the INH resistance profile and association of katG mutation with previous INH treatment and level of drug resistance based on rapid molecular drug susceptibility testing (DST) in southern Brazil and central Mozambique. Descriptive study of 311 isolates from Ribeirão Preto, São Paulo, Brazil (2011-2014) and 155 isolates from Beira, Mozambique (2014-2015). Drug resistance patterns and specific gene mutations were determined using GenoType(®) MTBDRplus. katG gene mutations were detected in 12/22 (54.5%) Brazilian and 32/38 (84.2%) Mozambican isolates. inhA mutations were observed in 9/22 (40.9%) isolates in Brazil and in 4/38 (10.5%) in Mozambique. Both katG and inhA mutations were detected in respectively 1/22 (5%) and 2/38 (5.2%). The difference in the frequency of katG mutations in Brazil and Mozambique was statistically significant (P = 0.04). katG mutations were present in 68.8% (33/48) of patients previously treated with INH and 31.2% (15/48) of patients without previous INH. This difference was not statistically significant (P = 0.223). INH mutations varied geographically; molecular DST can be used to guide and accelerate decision making in the use of ETH or high doses of INH.

CDH23 mutation and phenotype heterogeneity: a profile of 107 diverse families with Usher syndrome and nonsyndromic deafness.

PubMed

Astuto, L M; Bork, J M; Weston, M D; Askew, J W; Fields, R R; Orten, D J; Ohliger, S J; Riazuddin, S; Morell, R J; Khan, S; Riazuddin, S; Kremer, H; van Hauwe, P; Moller, C G; Cremers, C W R J; Ayuso, C; Heckenlively, J R; Rohrschneider, K; Spandau, U; Greenberg, J; Ramesar, R; Reardon, W; Bitoun, P; Millan, J; Legge, R; Friedman, T B; Kimberling, W J

2002-08-01

Usher syndrome type I is characterized by congenital hearing loss, retinitis pigmentosa (RP), and variable vestibular areflexia. Usher syndrome type ID, one of seven Usher syndrome type I genetic localizations, have been mapped to a chromosomal interval that overlaps with a nonsyndromic-deafness localization, DFNB12. Mutations in CDH23, a gene that encodes a putative cell-adhesion protein with multiple cadherin-like domains, are responsible for both Usher syndrome and DFNB12 nonsyndromic deafness. Specific CDH23 mutational defects have been identified that differentiate these two phenotypes. Only missense mutations of CDH23 have been observed in families with nonsyndromic deafness, whereas nonsense, frameshift, splice-site, and missense mutations have been identified in families with Usher syndrome. In the present study, a panel of 69 probands with Usher syndrome and 38 probands with recessive nonsyndromic deafness were screened for the presence of mutations in the entire coding region of CDH23, by heteroduplex, single-strand conformation polymorphism, and direct sequence analyses. A total of 36 different CDH23 mutations were detected in 45 families; 33 of these mutations were novel, including 18 missense, 3 nonsense, 5 splicing defects, 5 microdeletions, and 2 insertions. A total of seven mutations were common to more than one family. Numerous exonic and intronic polymorphisms also were detected. Results of ophthalmologic examinations of the patients with nonsyndromic deafness have found asymptomatic RP-like manifestations, indicating that missense mutations may have a subtle effect in the retina. Furthermore, patients with mutations in CDH23 display a wide range of hearing loss and RP phenotypes, differing in severity, age at onset, type, and the presence or absence of vestibular areflexia.

CDH23 Mutation and Phenotype Heterogeneity: A Profile of 107 Diverse Families with Usher Syndrome and Nonsyndromic Deafness

PubMed Central

Astuto, L. M.; Bork, J. M.; Weston, M. D.; Askew, J. W.; Fields, R. R.; Orten, D. J.; Ohliger, S. J.; Riazuddin, S.; Morell, R. J.; Khan, S.; Riazuddin, S.; Kremer, H.; van Hauwe, P.; Moller, C. G.; Cremers, C. W. R. J.; Ayuso, C.; Heckenlively, J. R.; Rohrschneider, K.; Spandau, U.; Greenberg, J.; Ramesar, R.; Reardon, W.; Bitoun, P.; Millan, J.; Legge, R.; Friedman, T. B.; Kimberling, W. J.

2002-01-01

Usher syndrome type I is characterized by congenital hearing loss, retinitis pigmentosa (RP), and variable vestibular areflexia. Usher syndrome type ID, one of seven Usher syndrome type I genetic localizations, have been mapped to a chromosomal interval that overlaps with a nonsyndromic-deafness localization, DFNB12. Mutations in CDH23, a gene that encodes a putative cell-adhesion protein with multiple cadherin-like domains, are responsible for both Usher syndrome and DFNB12 nonsyndromic deafness. Specific CDH23 mutational defects have been identified that differentiate these two phenotypes. Only missense mutations of CDH23 have been observed in families with nonsyndromic deafness, whereas nonsense, frameshift, splice-site, and missense mutations have been identified in families with Usher syndrome. In the present study, a panel of 69 probands with Usher syndrome and 38 probands with recessive nonsyndromic deafness were screened for the presence of mutations in the entire coding region of CDH23, by heteroduplex, single-strand conformation polymorphism, and direct sequence analyses. A total of 36 different CDH23 mutations were detected in 45 families; 33 of these mutations were novel, including 18 missense, 3 nonsense, 5 splicing defects, 5 microdeletions, and 2 insertions. A total of seven mutations were common to more than one family. Numerous exonic and intronic polymorphisms also were detected. Results of ophthalmologic examinations of the patients with nonsyndromic deafness have found asymptomatic RP–like manifestations, indicating that missense mutations may have a subtle effect in the retina. Furthermore, patients with mutations in CDH23 display a wide range of hearing loss and RP phenotypes, differing in severity, age at onset, type, and the presence or absence of vestibular areflexia. PMID:12075507