Molecular genetic analysis of some mutations in the cystic fibrosis gene in Moldova: Characterization of molecular markers and their linkage to various mutations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gimbovskaya, S.D.; Kalinin, V.N.; Ivashchenko, T.E.

1994-12-01

Sixty-one patients with cystic fibrosis (CF) from Moldova were tested for mutations {Delta}F508, G551D, and R553X. Frequencies of various alleles of the repeated GATT sequence in intron 6B of the GFTR gene, their linkage to other polymorphic markers, and various mutations were determined. The frequency of occurrence of mutation {Delta}F508 was only 25%. An absolute majority of CF patients (80%) had pancreatic insufficiency. Mutations G551D and R553X were not found in our sample. Each of 31 chromosomes with mutation {Delta}F508 carry the 6-GATT allele. Most {open_quotes}non {Delta}F508{close_quotes} (78%) and normal (80%) chromosomes were marked by the 7-GATT allele. Twenty-seven {Delta}F508more » chromosomes (96.4%) belong to haplotype B6, and only one to D6. Most chromosomes with {open_quotes}non {Delta}F508{close_quotes} mutations are associated with haplotypes D7 (26.3%) and C7 (21%). In addition, a significant portion of chromosomes from this subgroup were associated with haplotypes A7 (23.7%), A6 (10.5%), and C6 (2.7%), which are not yet described for mutant chromosomes. The results obtained demonstrate that CF in Moldova is mainly associated with mutations other than {Delta}F508, G551D, and R553X. Severe forms of the disease, with pancreatic insufficiency, are more frequently caused by these mutations; moreover, our data provides strong evidence for the presence of at least seven additional CF mutations in Moldova, apart from {Delta}F508, G551D, and R553X. Some of these are probably not described.« less

A Little CFTR Goes a Long Way: CFTR-Dependent Sweat Secretion from G551D and R117H-5T Cystic Fibrosis Subjects Taking Ivacaftor

PubMed Central

Char, Jessica E.; Wolfe, Marlene H.; Cho, Hyung-ju; Park, Il-Ho; Jeong, Jin Hyeok; Frisbee, Eric; Dunn, Colleen; Davies, Zoe; Milla, Carlos; Moss, Richard B.; Thomas, Ewart A. C.; Wine, Jeffrey J.

2014-01-01

To determine if oral dosing with the CFTR-potentiator ivacaftor (VX-770, Kalydeco) improves CFTR-dependent sweating in CF subjects carrying G551D or R117H-5T mutations, we optically measured sweat secretion from 32–143 individually identified glands in each of 8 CF subjects; 6 F508del/G551D, one G551D/R117H-5T, and one I507del/R117H-5T. Two subjects were tested only (−) ivacaftor, 3 only (+) ivacaftor and 3 (+/−) ivacaftor (1–5 tests per condition). The total number of gland measurements was 852 (−) ivacaftor and 906 (+) ivacaftor. A healthy control was tested 4 times (51 glands). For each gland we measured both CFTR-independent (M-sweat) and CFTR-dependent (C-sweat); C-sweat was stimulated with a β-adrenergic cocktail that elevated [cAMP]i while blocking muscarinic receptors. Absent ivacaftor, almost all CF glands produced M-sweat on all tests, but only 1/593 glands produced C-sweat (10 tests, 5 subjects). By contrast, 6/6 subjects (113/342 glands) produced C-sweat in the (+) ivacaftor condition, but with large inter-subject differences; 3–74% of glands responded with C/M sweat ratios 0.04%–2.57% of the average WT ratio of 0.265. Sweat volume losses cause proportionally larger underestimates of CFTR function at lower sweat rates. The losses were reduced by measuring C/M ratios in 12 glands from each subject that had the highest M-sweat rates. Remaining losses were estimated from single channel data and used to correct the C/M ratios, giving estimates of CFTR function (+) ivacaftor  = 1.6%–7.7% of the WT average. These estimates are in accord with single channel data and transcript analysis, and suggest that significant clinical benefit can be produced by low levels of CFTR function. PMID:24520399

Effect of ivacaftor in patients with advanced cystic fibrosis and a G551D-CFTR mutation: Safety and efficacy in an expanded access program in the United States.

PubMed

Taylor-Cousar, Jennifer; Niknian, Minoo; Gilmartin, Geoffrey; Pilewski, Joseph M

2016-01-01

Ivacaftor is the first therapeutic agent approved for the treatment of cystic fibrosis (CF) that targets the underlying molecular defect. Patients with severe lung disease were excluded from the randomized Phase 3 trials. This open-label study was designed to provide ivacaftor to patients in critical medical need prior to commercial product availability. CF patients aged ≥6 years with a G551D-CFTR mutation and FEV1 ≤ 40% predicted or listed for lung transplant received ivacaftor 150 mg every 12 h. The primary endpoint was safety as determined by adverse events. Secondary endpoints included assessment of lung function and weight. The rate of serious adverse events was consistent with disease severity. At 24 weeks of treatment with ivacaftor, there was a mean absolute increase in percent predicted FEV1 of 5.5 percentage points and a 3.3 kg mean absolute increase in weight from baseline. In patients with severe lung disease, ivacaftor was well tolerated and was associated with improved lung function and weight gain. Copyright © 2015 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.

Optimizing nasal potential difference analysis for CFTR modulator development: assessment of ivacaftor in CF subjects with the G551D-CFTR mutation.

PubMed

Rowe, Steven M; Liu, Bo; Hill, Aubrey; Hathorne, Heather; Cohen, Morty; Beamer, John R; Accurso, Frank J; Dong, Qunming; Ordoñez, Claudia L; Stone, Anne J; Olson, Eric R; Clancy, John P

2013-01-01

Nasal potential difference (NPD) is used as a biomarker of the cystic fibrosis transmembrane conductance regulator (CFTR) and epithelial sodium channel (ENaC) activity. We evaluated methods to detect changes in chloride and sodium transport by NPD based on a secondary analysis of a Phase II CFTR-modulator study. Thirty-nine subjects with CF who also had the G551D-CFTR mutation were randomized to receive ivacaftor (Kalydeco™; also known as VX-770) in four doses or placebo twice daily for at least 14 days. All data were analyzed by a single investigator who was blinded to treatment assignment. We compared three analysis methods to determine the best approach to quantify changes in chloride and sodium transport: (1) the average of both nostrils; (2) the most-polarized nostril at each visit; and (3) the most-polarized nostril at screening carried forward. Parameters of ion transport included the PD change with zero chloride plus isoproterenol (CFTR activity), the basal PD, Ringer's PD, and change in PD with amiloride (measurements of ENaC activity), and the delta NPD (measuring CFTR and ENaC activity). The average and most-polarized nostril at each visit were most sensitive to changes in chloride and sodium transport, whereas the most-polarized nostril at screening carried forward was less discriminatory. Based on our findings, NPD studies should assess both nostrils rather than a single nostril. We also found that changes in CFTR activity were more readily detected than changes in ENaC activity, and that rigorous standardization was associated with relatively good within-subject reproducibility in placebo-treated subjects (± 2.8 mV). Therefore, we have confirmed an assay of reasonable reproducibility for detecting chloride-transport improvements in response to CFTR modulation.

Synergistic Potentiation of Cystic Fibrosis Transmembrane Conductance Regulator Gating by Two Chemically Distinct Potentiators, Ivacaftor (VX-770) and 5-Nitro-2-(3-Phenylpropylamino) Benzoate.

PubMed

Lin, Wen-Ying; Sohma, Yoshiro; Hwang, Tzyh-Chang

2016-09-01

Cystic fibrosis (CF) is caused by loss-of-function mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene encoding a phosphorylation-activated but ATP-gated chloride channel. Previous studies suggested that VX-770 [ivacaftor, N-(2,4-di-tert-butyl-5-hydroxyphenyl)-4-oxo-1,4-dihydroquinoline-3-carboxamide], a CFTR potentiator now used in clinics, increases the open probability of CFTR by shifting the gating conformational changes to favor the open channel configuration. Recently the chloride channel blocker and CFTR potentiator 5-nitro-2-(3-phenylpropylamino) benzoate (NPPB) has been reported to enhance CFTR activity by a mechanism that exploits the ATP hydrolysis-driven, nonequilibrium gating mechanism unique to CFTR. Surprisingly however, NPPB increased the activity of nonhydrolytic G551D-CFTR, the third most common disease-associated mutation. Here, we further investigated the mechanism of NPPB's effects on CFTR gating by assessing its interaction with well-studied VX-770. Interestingly, once G551D-CFTR was maximally potentiated by VX-770, NPPB further increased its activity. However, quantitative analysis of this drug-drug interaction suggests that this pharmacologic synergism is not due to independent actions of NPPB and VX-770 on CFTR gating; instead, our data support a dependent mechanism involving two distinct binding sites. This latter idea is further supported by the observation that the locked-open time of a hydrolysis-deficient mutant K1250A was shortened by NPPB but prolonged by VX-770. In addition, the effectiveness of NPPB, but not of VX-770, was greatly diminished in a mutant whose second nucleotide-binding domain was completely removed. Interpreting these results under the framework of current understanding of CFTR gating not only reveals insights into the mechanism of action for different CFTR potentiators but also brings us one step forward to a more complete schematic for CFTR gating. Copyright © 2016 by The American

TRPC6 G757D Loss-of-Function Mutation Associates with FSGS

PubMed Central

Riehle, Marc; Büscher, Anja K.; Gohlke, Björn-Oliver; Kaßmann, Mario; Kolatsi-Joannou, Maria; Bräsen, Jan H.; Nagel, Mato; Becker, Jan U.; Winyard, Paul; Hoyer, Peter F.; Preissner, Robert; Krautwurst, Dietmar; Gollasch, Maik

2016-01-01

FSGS is a CKD with heavy proteinuria that eventually progresses to ESRD. Hereditary forms of FSGS have been linked to mutations in the transient receptor potential cation channel, subfamily C, member 6 (TRPC6) gene encoding a nonselective cation channel. Most of these TRPC6 mutations cause a gain-of-function phenotype, leading to calcium–triggered podocyte cell death, but the underlying molecular mechanisms are unclear. We studied the molecular effect of disease-related mutations using tridimensional in silico modeling of tetrameric TRPC6. Our results indicated that G757 is localized in a domain forming a TRPC6-TRPC6 interface and predicted that the amino acid exchange G757D causes local steric hindrance and disruption of the channel complex. Notably, functional characterization of model interface domain mutants suggested a loss-of-function phenotype. We then characterized 19 human FSGS–related TRPC6 mutations, the majority of which caused gain-of-function mutations. However, five mutations (N125S, L395A, G757D, L780P, and R895L) caused a loss-of-function phenotype. Coexpression of wild-type TRPC6 and TRPC6 G757D, mimicking heterozygosity observed in patients, revealed a dominant negative effect of TRPC6 G757D. Our comprehensive analysis of human disease–causing TRPC6 mutations reveals loss of TRPC6 function as an additional concept of hereditary FSGS and provides molecular insights into the mechanism responsible for the loss-of-function phenotype of TRPC6 G757D in humans. PMID:26892346

The impact of 12 months treatment with ivacaftor on Scottish paediatric patients with cystic fibrosis with the G551D mutation: a review.

PubMed

Dryden, Carol; Wilkinson, Jane; Young, David; Brooker, Richard John

2018-01-01

We reviewed the impact of ivacaftor on Scottish paediatric patients with cystic fibrosis ≥6 years of age after 12 months of treatment. Statistically significant improvements in FEV 1 and body mass index and a reduction in sweat chloride, all comparable with previously published data were observed. The findings also suggested reduced use of intravenous antibiotics and oral antibiotics. No significant adverse effects were observed but a possible association with cataract formation could not be excluded. This review suggests that, in the short term at least, ivacaftor is effective and safe in paediatric patients ≥6 years of age with G551D. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

Rescue of CF airway epithelial cell function in vitro by a CFTR potentiator, VX-770

PubMed Central

Van Goor, Fredrick; Hadida, Sabine; Grootenhuis, Peter D. J.; Burton, Bill; Cao, Dong; Neuberger, Tim; Turnbull, Amanda; Singh, Ashvani; Joubran, John; Hazlewood, Anna; Zhou, Jinglan; McCartney, Jason; Arumugam, Vijayalaksmi; Decker, Caroline; Yang, Jennifer; Young, Chris; Olson, Eric R.; Wine, Jeffery J.; Frizzell, Raymond A.; Ashlock, Melissa; Negulescu, Paul

2009-01-01

Cystic fibrosis (CF) is a fatal genetic disease caused by mutations in the gene encoding the CF transmembrane conductance regulator (CFTR), a protein kinase A (PKA)-activated epithelial anion channel involved in salt and fluid transport in multiple organs, including the lung. Most CF mutations either reduce the number of CFTR channels at the cell surface (e.g., synthesis or processing mutations) or impair channel function (e.g., gating or conductance mutations) or both. There are currently no approved therapies that target CFTR. Here we describe the in vitro pharmacology of VX-770, an orally bioavailable CFTR potentiator in clinical development for the treatment of CF. In recombinant cells VX-770 increased CFTR channel open probability (Po) in both the F508del processing mutation and the G551D gating mutation. VX-770 also increased Cl− secretion in cultured human CF bronchial epithelia (HBE) carrying the G551D gating mutation on one allele and the F508del processing mutation on the other allele by ≈10-fold, to ≈50% of that observed in HBE isolated from individuals without CF. Furthermore, VX-770 reduced excessive Na+ and fluid absorption to prevent dehydration of the apical surface and increased cilia beating in these epithelial cultures. These results support the hypothesis that pharmacological agents that restore or increase CFTR function can rescue epithelial cell function in human CF airway. PMID:19846789

Potentiators (specific therapies for class III and IV mutations) for cystic fibrosis.

PubMed

Patel, Sanjay; Sinha, Ian P; Dwan, Kerry; Echevarria, Carlos; Schechter, Michael; Southern, Kevin W

2015-03-26

placebo in people with cystic fibrosis. In a post hoc change we excluded trials combining CFTR potentiators with other mutation-specific therapies. These will be considered in a separate review. The authors independently extracted data and assessed the risk of bias in included trials; they contacted trial authors for additional data. Meta-analyses were undertaken on outcomes at a number of time points. We included four randomised controlled trials (n = 378), lasting from 28 days to 48 weeks, comparing the potentiator ivacaftor to placebo. Trials differed in terms of design and participant eligibility criteria, which limited the meta-analyses. The phase 2 trial (n = 19) and two phase 3 trials (adult trial (n = 167), paediatric trial (n = 52)), recruited participants with the G551D mutation (class III). The fourth trial (n = 140) enrolled participants homozygous for the ΔF508 mutation (class II).Risks of bias in the trials were moderate. Random sequence generation, allocation concealment and blinding of trial personnel were well-documented. Participant blinding was less clear throughout all trials; in three trials, some participant data were excluded from the analysis. Selective outcome reporting was apparent in three trials. All trials were sponsored by industry and supported by other non-pharmaceutical funding bodies.No trial reported any deaths. Significantly higher quality of life scores in the respiratory domain were reported by the adult phase 3 G551D trial at 24 weeks, mean difference 8.10 (95% confidence interval (CI) 4.77 to 11.43) and 48 weeks, mean difference 8.60 (95% CI 5.27 to 11.93); but not by the paediatric phase 3 G551D trial. The adult phase 3 G551D trial reported improvements in relative change from baseline in forced expiratory volume at one second at 24 weeks, mean difference 16.90% (95% CI 13.60 to 20.20) and 48 weeks, mean difference 16.80% (95% CI 13.50 to 20.10); as did the paediatric G551D trial at 24 weeks, mean difference 17.4% (P < 0

Effect of VX-770 in Persons with Cystic Fibrosis and the G551D-CFTR Mutation

PubMed Central

Accurso, Frank J.; Rowe, Steven M.; Clancy, J.P.; Boyle, Michael P.; Dunitz, Jordan M.; Durie, Peter R.; Sagel, Scott D.; Hornick, Douglas B.; Konstan, Michael W.; Donaldson, Scott H.; Moss, Richard B.; Pilewski, Joseph M.; Rubenstein, Ronald C.; Uluer, Ahmet Z.; Aitken, Moira L.; Freedman, Steven D.; Rose, Lynn M.; Mayer-Hamblett, Nicole; Dong, Qunming; Zha, Jiuhong; Stone, Anne J.; Olson, Eric R.; Ordoñez, Claudia L.; Campbell, Preston W.; Ashlock, Melissa A.; Ramsey, Bonnie W.

2010-01-01

BACKGROUND A new approach in the treatment of cystic fibrosis involves improving the function of mutant cystic fibrosis transmembrane conductance regulator (CFTR). VX-770, a CFTR potentiator, has been shown to increase the activity of wild-type and defective cell-surface CFTR in vitro. METHODS We randomly assigned 39 adults with cystic fibrosis and at least one G551D-CFTR allele to receive oral VX-770 every 12 hours at a dose of 25, 75, or 150 mg or placebo for 14 days (in part 1 of the study) or VX-770 every 12 hours at a dose of 150 or 250 mg or placebo for 28 days (in part 2 of the study). RESULTS At day 28, in the group of subjects who received 150 mg of VX-770, the median change in the nasal potential difference (in response to the administration of a chloride-free isoproterenol solution) from baseline was −3.5 mV (range, −8.3 to 0.5; P = 0.02 for the within-subject comparison, P = 0.13 vs. placebo), and the median change in the level of sweat chloride was −59.5 mmol per liter (range, −66.0 to −19.0; P = 0.008 within-subject, P = 0.02 vs. placebo). The median change from baseline in the percent of predicted forced expiratory volume in 1 second was 8.7% (range, 2.3 to 31.3; P = 0.008 for the within-subject comparison, P = 0.56 vs. placebo). None of the subjects withdrew from the study. Six severe adverse events occurred in two subjects (diffuse macular rash in one subject and five incidents of elevated blood and urine glucose levels in one subject with diabetes). All severe adverse events resolved without the discontinuation of VX-770. CONCLUSIONS This study to evaluate the safety and adverse-event profile of VX-770 showed that VX-770 was associated with within-subject improvements in CFTR and lung function. These findings provide support for further studies of pharmacologic potentiation of CFTR as a means to treat cystic fibrosis. PMID:21083385

Tezacaftor/Ivacaftor in Subjects with Cystic Fibrosis and F508del/F508del-CFTR or F508del/G551D-CFTR.

PubMed

Donaldson, Scott H; Pilewski, Joseph M; Griese, Matthias; Cooke, Jon; Viswanathan, Lakshmi; Tullis, Elizabeth; Davies, Jane C; Lekstrom-Himes, Julie A; Wang, Linda T

2018-01-15

Tezacaftor (formerly VX-661) is an investigational small molecule that improves processing and trafficking of the cystic fibrosis transmembrane conductance regulator (CFTR) in vitro, and improves CFTR function alone and in combination with ivacaftor. To evaluate the safety and efficacy of tezacaftor monotherapy and of tezacaftor/ivacaftor combination therapy in subjects with cystic fibrosis homozygous for F508del or compound heterozygous for F508del and G551D. This was a randomized, placebo-controlled, double-blind, multicenter, phase 2 study (NCT01531673). Subjects homozygous for F508del received tezacaftor (10 to 150 mg) every day alone or in combination with ivacaftor (150 mg every 12 h) in a dose escalation phase, as well as in a dosage regimen testing phase. Subjects compound heterozygous for F508del and G551D, taking physician-prescribed ivacaftor, received tezacaftor (100 mg every day). Primary endpoints were safety through Day 56 and change in sweat chloride from baseline through Day 28. Secondary endpoints included change in percent predicted FEV 1 (ppFEV 1 ) from baseline through Day 28 and pharmacokinetics. The incidence of adverse events was similar across treatment arms. Tezacaftor (100 mg every day)/ivacaftor (150 mg every 12 h) resulted in a 6.04 mmol/L decrease in sweat chloride and 3.75 percentage point increase in ppFEV 1 in subjects homozygous for F508del, and a 7.02 mmol/L decrease in sweat chloride and 4.60 percentage point increase in ppFEV 1 in subjects compound heterozygous for F508del and G551D from baseline through Day 28 (P < 0.05 for all). These results support continued clinical development of tezacaftor (100 mg every day) in combination with ivacaftor (150 mg every 12 h) in subjects with cystic fibrosis. Clinical trial registered with www.clinicaltrials.gov (NCT01531673).

Cetuximab treatment for metastatic colorectal cancer with KRAS p.G13D mutations improves progression-free survival

PubMed Central

OSUMI, HIROKI; SHINOZAKI, EIJI; OSAKO, MASAHIKO; KAWAZOE, YOSHIMASA; OBA, MASARU; MISAKA, TAKAHARU; GOTO, TAKASHI; KAMO, HITOMI; SUENAGA, MITSUKUNI; KUMEKAWA, YOSUKE; OGURA, MARIKO; OZAKA, MASATO; MATSUSAKA, SATOSHI; CHIN, KEISHO; HATAKE, KIYOHIKO; MIZUNUMA, NOBUYUKI

2015-01-01

A number of previous studies have reported that 30–50% of patients with colorectal cancer (CRC) harbor Kirsten rat sarcoma viral oncogene homolog (KRAS) mutations, which is a major predictive biomarker of resistance to epidermal growth factor (EGFR)-targeted therapy. Treatment with an anti-EGFR inhibitor is recommended for patients with KRAS wild-type metastatic colorectal cancer (mCRC). A recent retrospective study of cetuximab reported that patients with KRAS p.G13D mutations had better outcomes compared with those with other mutations. The aim of this retrospective study was to assess the prevalence of KRAS p.G13D mutations and evaluate the effectiveness of cetuximab in mCRC patients with KRAS p.G13D or other KRAS mutations. We reviewed the clinical records of 98 mCRC patients with KRAS mutations who were treated between August, 2004 and January, 2011 in four hospitals located in Tokyo and Kyushu Island. We also investigated KRAS mutation subtypes and patient characteristics. In the patients who received cetuximab, univariate and multivariate analyses were performed to assess the effect of KRAS p.G13D mutations on progression-free survival (PFS) and overall survival (OS). Of the 98 patients, 23 (23.5%) had KRAS p.G13D-mutated tumors, whereas 75 (76.5%) had tumors harboring other mutations. Of the 31 patients who received cetuximab, 9 (29.0%) had KRAS p.G13D mutations and 22 (71.0%) had other mutations. There were no significant differences in age, gender, primary site, pathological type, history of chemotherapy, or the combined use of irinotecan between either of the patient subgroups. The univariate analysis revealed no significant difference in PFS or OS between the patients with KRAS p.G13D mutations and those with other mutations (median PFS, 4.5 vs. 2.8 months, respectively; P=0.65; and median OS, 15.3 vs. 8.9 months, respectively; P=0.51). However, the multivariate analysis revealed a trend toward better PFS among patients harboring p.G13D mutations (PFS

EGFR G796D mutation mediates resistance to osimertinib.

PubMed

Zheng, Di; Hu, Min; Bai, Yu; Zhu, Xuehua; Lu, Xuesong; Wu, Chunyan; Wang, Jiying; Liu, Li; Wang, Zheng; Ni, Jian; Yang, Zhenfan; Xu, Jianfang

2017-07-25

Osimertinib is an effective third-generation epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor (TKI) approved in multiple countries and regions for patients with EGFR T790M mutation-positive non-small cell lung cancer (NSCLC). Despite impressive initial tumor responses, development of drug resistance ultimately limits the benefit of this compound. Mechanisms of resistance to osimertinib are just beginning to emerge, such as EGFR C797S and L718Q mutations, BRAF V600E and PIK3CA E545K mutations, as well as ERBB2 and MET amplification. However, a comprehensive view is still missing. In this study, we presented the first case of Chinese NSCLC patient who developed resistance to osimertinib, and discovered de novo EGFR G796D mutation as a potential mechanism. Our findings provided insights into mechanisms of resistance to osimertinib and highlighted tumor heterogeneity and clonal evolution during the development of drug resistance.

EGFR G796D mutation mediates resistance to osimertinib

PubMed Central

Bai, Yu; Zhu, Xuehua; Lu, Xuesong; Wu, Chunyan; Wang, Jiying; Liu, Li; Wang, Zheng; Ni, Jian; Yang, Zhenfan; Xu, Jianfang

2017-01-01

Osimertinib is an effective third-generation epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor (TKI) approved in multiple countries and regions for patients with EGFR T790M mutation-positive non-small cell lung cancer (NSCLC). Despite impressive initial tumor responses, development of drug resistance ultimately limits the benefit of this compound. Mechanisms of resistance to osimertinib are just beginning to emerge, such as EGFR C797S and L718Q mutations, BRAF V600E and PIK3CA E545K mutations, as well as ERBB2 and MET amplification. However, a comprehensive view is still missing. In this study, we presented the first case of Chinese NSCLC patient who developed resistance to osimertinib, and discovered de novo EGFR G796D mutation as a potential mechanism. Our findings provided insights into mechanisms of resistance to osimertinib and highlighted tumor heterogeneity and clonal evolution during the development of drug resistance. PMID:28572531

Distinct clinical and neuropathological features of G51D SNCA mutation cases compared with SNCA duplication and H50Q mutation.

PubMed

Kiely, Aoife P; Ling, Helen; Asi, Yasmine T; Kara, Eleanna; Proukakis, Christos; Schapira, Anthony H; Morris, Huw R; Roberts, Helen C; Lubbe, Steven; Limousin, Patricia; Lewis, Patrick A; Lees, Andrew J; Quinn, Niall; Hardy, John; Love, Seth; Revesz, Tamas; Houlden, Henry; Holton, Janice L

2015-08-27

We and others have described the neurodegenerative disorder caused by G51D SNCA mutation which shares characteristics of Parkinson's disease (PD) and multiple system atrophy (MSA). The objective of this investigation was to extend the description of the clinical and neuropathological hallmarks of G51D mutant SNCA-associated disease by the study of two additional cases from a further G51D SNCA kindred and to compare the features of this group with a SNCA duplication case and a H50Q SNCA mutation case. All three G51D patients were clinically characterised by parkinsonism, dementia, visual hallucinations, autonomic dysfunction and pyramidal signs with variable age at disease onset and levodopa response. The H50Q SNCA mutation case had a clinical picture that mimicked late-onset idiopathic PD with a good and sustained levodopa response. The SNCA duplication case presented with a clinical phenotype of frontotemporal dementia with marked behavioural changes, pyramidal signs, postural hypotension and transiently levodopa responsive parkinsonism. Detailed post-mortem neuropathological analysis was performed in all cases. All three G51D cases had abundant α-synuclein pathology with characteristics of both PD and MSA. These included widespread cortical and subcortical neuronal α-synuclein inclusions together with small numbers of inclusions resembling glial cytoplasmic inclusions (GCIs) in oligodendrocytes. In contrast the H50Q and SNCA duplication cases, had α-synuclein pathology resembling idiopathic PD without GCIs. Phosphorylated α-synuclein was present in all inclusions types in G51D cases but was more restricted in SNCA duplication and H50Q mutation. Inclusions were also immunoreactive for the 5G4 antibody indicating their highly aggregated and likely fibrillar state. Our characterisation of the clinical and neuropathological features of the present small series of G51D SNCA mutation cases should aid the recognition of this clinico-pathological entity. The

Improvement in exercise duration, lung function and well-being in G551D-cystic fibrosis patients: a double-blind, placebo-controlled, randomized, cross-over study with ivacaftor treatment.

PubMed

Edgeworth, Deirdre; Keating, Dominic; Ellis, Matthew; Button, Brenda; Williams, Elyssa; Clark, Denise; Tierney, Audrey; Heritier, Stephane; Kotsimbos, Tom; Wilson, John

2017-08-01

G551D, a mutation of the cystic fibrosis transmembrane conductance regulator (CFTR) gene, results in impaired chloride channel function in cystic fibrosis (CF) with multiple end-organ manifestations. The effect of ivacaftor, a CFTR-potentiator, on exercise capacity in CF is unknown. Twenty G551D-CF patients were recruited to a single-centre, double-blind, placebo-controlled, 28-day crossover study of ivacaftor. Variables measured included percentage change from baseline (%Δ) of V O 2 max (maximal oxygen consumption, primary outcome) during cardiopulmonary exercise testing (CPET), relevant other CPET physiological variables, lung function, body mass index (BMI), sweat chloride and disease-specific health related quality of life (QOL) measures (CFQ-R and Alfred Wellness (AWEscore)). %Δ V O 2 max was unchanged compared with placebo as was %Δminute ventilation. However, %Δexercise time (mean 7.3, CI 0.5-14,1, P =0.0222) significantly increased as did %ΔFEV 1 (11.7%, range 5.3-18.1, P <0·005) and %ΔBMI (1.2%, range 0.1-2.3, P =0·0393) whereas sweat chloride decreased (mean -43.4; range -55.5-18.1 mmol·l -1 , P <0·005). Total and activity based domains in both CFQ-R and AWEscore also increased. A positive treatment effect on spirometry, BMI (increased), SCT (decreased) and total and activity based CF-specific QOL measures was expected. However, the lack of discernible improvement in V O 2 max and VE despite other positive changes including spirometric lung function and exercise time with a 28-day ivacaftor intervention suggests that ventilatory parameters are not the sole driver of change in exercise capacity in this study cohort. Investigation over a more prolonged period may delineate the potential interdependencies of the observed discordances over time. ClinicalTrials.gov-NCT01937325. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

Insights into the pathogenesis of dominant retinitis pigmentosa associated with a D477G mutation in RPE65.

PubMed

Choi, Elliot H; Suh, Susie; Sander, Christopher L; Hernandez, Christian J Ortiz; Bulman, Elizabeth R; Khadka, Nimesh; Dong, Zhiqian; Shi, Wuxian; Palczewski, Krzysztof; Kiser, Philip D

2018-04-12

RPE65 is the essential trans-cis isomerase of the classical retinoid (visual) cycle. Mutations in RPE65 give rise to severe retinal dystrophies, most of which are associated with loss of protein function and recessive inheritance. The only known exception is a c.1430G>A (D477G) mutation that gives rise to dominant retinitis pigmentosa with delayed onset and choroidal and macular involvement. Position 477 is distant from functionally critical regions of RPE65. Hence, the mechanism of D477G pathogenicity remains unclear, although protein misfolding and aggregation mechanisms have been suggested. We characterized a D477G knock-in mouse model which exhibited mild age-dependent changes in retinal structure and function. Immunoblot analysis of protein extracts from the eyes of the knock-in mice demonstrated the presence of ubiquitinated RPE65 and reduced RPE65 expression. We observed an accumulation of retinyl esters in the knock-in mice as well as a delay in rhodopsin regeneration kinetics and diminished electroretinography responses, indicative of RPE65 functional impairment induced by the D477G mutation in vivo. However, a cell line expressing D477G RPE65 revealed protein expression levels, cellular localization, and retinoid isomerase activity comparable to cells expressing wild-type protein. Structural analysis of an RPE65 chimera suggested that the D477G mutation does not perturb protein folding or tertiary structure. Instead, the mutation generates an aggregation-prone surface that could induce cellular toxicity through abnormal complex formation as suggested by crystal packing analysis. These results indicate that a toxic gain-of-function induced by the D477G RPE65 substitution may play a role in the pathogenesis of this form of dominant retinitis pigmentosa.

Mutation of a single residue in the S2-S3 loop of CNG channels alters the gating properties and sensitivity to inhibitors.

PubMed

Crary, J I; Dean, D M; Maroof, F; Zimmerman, A L

2000-12-01

We previously found that native cyclic nucleotide-gated (CNG) cation channels from amphibian rod cells are directly and reversibly inhibited by analogues of diacylglycerol (DAG), but little is known about the mechanism of this inhibition. We recently determined that, at saturating cGMP concentrations, DAG completely inhibits cloned bovine rod (Brod) CNG channels while only partially inhibiting cloned rat olfactory (Rolf) channels (Crary, J.I., D.M. Dean, W. Nguitragool, P.T. Kurshan, and A.L. Zimmerman. 2000. J. Gen. Phys. 116:755-768; in this issue). Here, we report that a point mutation at position 204 in the S2-S3 loop of Rolf and a mouse CNG channel (Molf) found in olfactory epithelium and heart, increased DAG sensitivity to that of the Brod channel. Mutation of this residue from the wild-type glycine to a glutamate (Molf G204E) or aspartate (Molf G204D) gave dramatic increases in DAG sensitivity without changing the apparent cGMP or cAMP affinities or efficacies. However, unlike the wild-type olfactory channels, these mutants demonstrated voltage-dependent gating with obvious activation and deactivation kinetics. Interestingly, the mutants were also more sensitive to inhibition by the local anesthetic, tetracaine. Replacement of the position 204 glycine with a tryptophan residue (Rolf G204W) not only gave voltage-dependent gating and an increased sensitivity to DAG and tetracaine, but also showed reduced apparent agonist affinity and cAMP efficacy. Sequence comparisons show that the glycine at position 204 in the S2-S3 loop is highly conserved, and our findings indicate that its alteration can have critical consequences for channel gating and inhibition.

3D modeling of dual-gate FinFET

NASA Astrophysics Data System (ADS)

Mil'shtein, Samson; Devarakonda, Lalitha; Zanchi, Brian; Palma, John

2012-11-01

The tendency to have better control of the flow of electrons in a channel of field-effect transistors (FETs) did lead to the design of two gates in junction field-effect transistors, field plates in a variety of metal semiconductor field-effect transistors and high electron mobility transistors, and finally a gate wrapping around three sides of a narrow fin-shaped channel in a FinFET. With the enhanced control, performance trends of all FETs are still challenged by carrier mobility dependence on the strengths of the electrical field along the channel. However, in cases when the ratio of FinFET volume to its surface dramatically decreases, one should carefully consider the surface boundary conditions of the device. Moreover, the inherent non-planar nature of a FinFET demands 3D modeling for accurate analysis of the device performance. Using the Silvaco modeling tool with quantization effects, we modeled a physical FinFET described in the work of Hisamoto et al. (IEEE Tran. Elec. Devices 47:12, 2000) in 3D. We compared it with a 2D model of the same device. We demonstrated that 3D modeling produces more accurate results. As 3D modeling results came close to experimental measurements, we made the next step of the study by designing a dual-gate FinFET biased at V g1 > V g2. It is shown that the dual-gate FinFET carries higher transconductance than the single-gate device.

Gating currents from Kv7 channels carrying neuronal hyperexcitability mutations in the voltage-sensing domain.

PubMed

Miceli, Francesco; Vargas, Ernesto; Bezanilla, Francisco; Taglialatela, Maurizio

2012-03-21

Changes in voltage-dependent gating represent a common pathogenetic mechanism for genetically inherited channelopathies, such as benign familial neonatal seizures or peripheral nerve hyperexcitability caused by mutations in neuronal K(v)7.2 channels. Mutation-induced changes in channel voltage dependence are most often inferred from macroscopic current measurements, a technique unable to provide a detailed assessment of the structural rearrangements underlying channel gating behavior; by contrast, gating currents directly measure voltage-sensor displacement during voltage-dependent gating. In this work, we describe macroscopic and gating current measurements, together with molecular modeling and molecular-dynamics simulations, from channels carrying mutations responsible for benign familial neonatal seizures and/or peripheral nerve hyperexcitability; K(v)7.4 channels, highly related to K(v)7.2 channels both functionally and structurally, were used for these experiments. The data obtained showed that mutations affecting charged residues located in the more distal portion of S(4) decrease the stability of the open state and the active voltage-sensing domain configuration but do not directly participate in voltage sensing, whereas mutations affecting a residue (R4) located more proximally in S(4) caused activation of gating-pore currents at depolarized potentials. These results reveal that distinct molecular mechanisms underlie the altered gating behavior of channels carrying disease-causing mutations at different voltage-sensing domain locations, thereby expanding our current view of the pathogenesis of neuronal hyperexcitability diseases. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.

The Arrhythmogenic Calmodulin Mutation D129G Dysregulates Cell Growth, Calmodulin-dependent Kinase II Activity, and Cardiac Function in Zebrafish*

PubMed Central

Zacharias, Triantafyllos; Kulej, Katarzyna; Wang, Kevin; Torggler, Raffaela; la Cour, Jonas M.

2016-01-01

Calmodulin (CaM) is a Ca2+ binding protein modulating multiple targets, several of which are associated with cardiac pathophysiology. Recently, CaM mutations were linked to heart arrhythmia. CaM is crucial for cell growth and viability, yet the effect of the arrhythmogenic CaM mutations on cell viability, as well as heart rhythm, remains unknown, and only a few targets with relevance for heart physiology have been analyzed for their response to mutant CaM. We show that the arrhythmia-associated CaM mutants support growth and viability of DT40 cells in the absence of WT CaM except for the long QT syndrome mutant CaM D129G. Of the six CaM mutants tested (N53I, F89L, D95V, N97S, D129G, and F141L), three showed a decreased activation of Ca2+/CaM-dependent kinase II, most prominently the D129G CaM mutation, which was incapable of stimulating Thr286 autophosphorylation. Furthermore, the CaM D129G mutation led to bradycardia in zebrafish and an arrhythmic phenotype in a subset of the analyzed zebrafish. PMID:27815504

A CACNA1D mutation in a patient with persistent hyperinsulinaemic hypoglycaemia, heart defects, and severe hypotonia.

PubMed

Flanagan, S E; Vairo, F; Johnson, M B; Caswell, R; Laver, T W; Lango Allen, H; Hussain, K; Ellard, S

2017-06-01

Congenital hyperinsulinaemic hypoglycaemia (HH) can occur in isolation or it may present as part of a wider syndrome. For approximately 40%-50% of individuals with this condition, sequence analysis of the known HH genes identifies a causative mutation. Identifying the underlying genetic aetiology in the remaining cases is important as a genetic diagnosis will inform on recurrence risk, may guide medical management and will provide valuable insights into β-cell physiology. We sequenced the exome of a child with persistent diazoxide-responsive HH, mild aortic insufficiency, severe hypotonia, and developmental delay as well as the unaffected parents. This analysis identified a de novo mutation, p.G403D, in the proband's CACNA1D gene. CACNA1D encodes the main L-type voltage-gated calcium channel in the pancreatic β-cell, a key component of the insulin secretion pathway. The p.G403D mutation had been reported previously as an activating mutation in an individual with primary hyper-aldosteronism, neuromuscular abnormalities, and transient hypoglycaemia. Sequence analysis of the CACNA1D gene in 60 further cases with HH did not identify a pathogenic mutation. Identification of an activating CACNA1D mutation in a second patient with congenital HH confirms the aetiological role of CACNA1D mutations in this disorder. A genetic diagnosis is important as treatment with a calcium channel blocker may be an option for the medical management of this patient. © 2017 The Authors. Pediatric Diabetes published by John Wiley & Sons Ltd.

Cystic fibrosis transmembrane conductance regulator mutations at a referral center for cystic fibrosis*

PubMed Central

Coutinho, Cyntia Arivabeni de Araújo Correia; Marson, Fernando Augusto de Lima; Ribeiro, Antônio Fernando; Ribeiro, José Dirceu; Bertuzzo, Carmen Silvia

2013-01-01

OBJECTIVE: To determine the frequency of six mutations (F508del, G542X, G551D, R553X, R1162X, and N1303K) in patients with cystic fibrosis (CF) diagnosed, at a referral center, on the basis of abnormal results in two determinations of sweat sodium and chloride concentrations. METHODS: This was a cross-sectional study involving 70 patients with CF. The mean age of the patients was 12.38 ± 9.00 years, 51.43% were female, and 94.29% were White. Mutation screening was performed with polymerase chain reaction (for F508del), followed by enzymatic digestion (for other mutations). Clinical analysis was performed on the basis of gender, age, ethnicity, pulmonary/gastrointestinal symptoms, and Shwachman-Kulczycki (SK) score. RESULTS: All of the patients showed pulmonary symptoms, and 8 had no gastrointestinal symptoms. On the basis of the SK scores, CF was determined to be mild, moderate, and severe in 22 (42.3%), 17 (32.7%), and 13 (25.0%) of the patients, respectively. There was no association between F508del mutation and disease severity by SK score. Of the 140 alleles analyzed, F508del mutation was identified in 70 (50%). Other mutations (G542X, G551D, R553X, R1162X, and N1303K) were identified in 12 (7.93%) of the alleles studied. In F508del homozygous patients with severe disease, the OR was 0.124 (95% CI: 0.005-0.826). CONCLUSIONS: In 50% of the alleles studied, the molecular diagnosis of CF was confirmed by identifying a single mutation (F508del). If we consider the analysis of the six most common mutations in the Brazilian population (including F508del), the molecular diagnosis was confirmed in 58.57% of the alleles studied. PMID:24310628

Cystic fibrosis transmembrane conductance regulator mutations at a referral center for cystic fibrosis.

PubMed

Coutinho, Cyntia Arivabeni de Araújo Correia; Marson, Fernando Augusto de Lima; Ribeiro, Antônio Fernando; Ribeiro, José Dirceu; Bertuzzo, Carmen Silvia

2013-01-01

To determine the frequency of six mutations (F508del, G542X, G551D, R553X, R1162X, and N1303K) in patients with cystic fibrosis (CF) diagnosed, at a referral center, on the basis of abnormal results in two determinations of sweat sodium and chloride concentrations. This was a cross-sectional study involving 70 patients with CF. The mean age of the patients was 12.38 ± 9.00 years, 51.43% were female, and 94.29% were White. Mutation screening was performed with polymerase chain reaction (for F508del), followed by enzymatic digestion (for other mutations). Clinical analysis was performed on the basis of gender, age, ethnicity, pulmonary/gastrointestinal symptoms, and Shwachman-Kulczycki (SK) score. All of the patients showed pulmonary symptoms, and 8 had no gastrointestinal symptoms. On the basis of the SK scores, CF was determined to be mild, moderate, and severe in 22 (42.3%), 17 (32.7%), and 13 (25.0%) of the patients, respectively. There was no association between F508del mutation and disease severity by SK score. Of the 140 alleles analyzed, F508del mutation was identified in 70 (50%). Other mutations (G542X, G551D, R553X, R1162X, and N1303K) were identified in 12 (7.93%) of the alleles studied. In F508del homozygous patients with severe disease, the OR was 0.124 (95% CI: 0.005-0.826). In 50% of the alleles studied, the molecular diagnosis of CF was confirmed by identifying a single mutation (F508del). If we consider the analysis of the six most common mutations in the Brazilian population (including F508del), the molecular diagnosis was confirmed in 58.57% of the alleles studied.

Exploring the effect of D61G mutation on SHP2 cause gain of function activity by a molecular dynamics study.

PubMed

Li, Hong-Lian; Ma, Ying; Zheng, Chang-Jie; Jin, Wen-Yan; Liu, Wen-Shan; Wang, Run-Ling

2017-11-24

Noonan syndrome (NS) is a common autosomal dominant congenital disorder which could cause the congenital cardiopathy and cancer predisposition. Previous studies reported that the knock-in mouse models of the mutant D61G of SHP2 exhibited the major features of NS, which demonstrated that the mutation D61G of SHP2 could cause NS. To explore the effect of D61G mutation on SHP2 and explain the high activity of the mutant, molecular dynamic simulations were performed on wild type (WT) of SHP2 and the mutated SHP2-D61G, respectively. The principal component analysis and dynamic cross-correlation mapping, associated with secondary structure, showed that the D61G mutation affected the motions of two regions (residues Asn 58-Thr 59 and Val 460-His 462) in SHP2 from β to turn. Moreover, the residue interaction networks analysis, the hydrogen bond occupancy analysis and the binding free energies were calculated to gain detailed insight into the influence of the mutant D61G on the two regions, revealing that the major differences between SHP2-WT and SHP2-D61G were the different interactions between Gly 61 and Gly 462, Gly 61 and Ala 461, Gln 506 and Ile 463, Gly 61 and Asn 58, Ile 463 and Thr 466, Gly 462 and Cys 459. Consequently, our findings here may provide knowledge to understand the increased activity of SHP2 caused by the mutant D61G.

Some gating potentiators, including VX-770, diminish ΔF508-CFTR functional expression

PubMed Central

Veit, Guido; Avramescu, Radu G.; Perdomo, Doranda; Phuan, Puay-Wah; Bagdany, Miklos; Apaja, Pirjo M.; Borot, Florence; Szollosi, Daniel; Wu, Yu-Sheng; Finkbeiner, Walter E.; Hegedus, Tamas; Verkman, Alan S.; Lukacs, Gergely L.

2015-01-01

Cystic fibrosis (CF) is caused by mutations in the CF transmembrane regulator (CFTR) that result in reduced anion conductance at the apical membrane of secretory epithelia. Treatment of CF patients carrying the G551D gating mutation with the potentiator VX-770 (ivacaftor) largely restores channel activity and has shown substantial clinical benefit. However, most CF patients carry the ΔF508 mutation, which impairs CFTR folding, processing, function, and stability. Studies in homozygous ΔF508 CF patients indicated little clinical benefit of monotherapy with the investigational corrector VX-809 (lumacaftor) or VX-770, whereas combination clinical trials show limited but significant improvements in lung function. We show that VX-770, as well as most other potentiators, reduces the correction efficacy of VX-809 and another investigational corrector, VX-661. To mimic the administration of VX-770 alone or in combination with VX-809, we examined its long-term effect in immortalized and primary human respiratory epithelia. VX-770 diminished the folding efficiency and the metabolic stability of ΔF508-CFTR at the endoplasmic reticulum (ER) and post-ER compartments, respectively, causing reduced cell surface ΔF508-CFTR density and function. VX-770–induced destabilization of ΔF508-CFTR was influenced by second-site suppressor mutations of the folding defect and was prevented by stabilization of the nucleotide-binding domain 1 (NBD1)–NBD2 interface. The reduced correction efficiency of ΔF508-CFTR, as well as of two other processing mutations in the presence of VX-770, suggests the need for further optimization of potentiators to maximize the clinical benefit of corrector-potentiator combination therapy in CF. PMID:25101887

G4-FETs as Universal and Programmable Logic Gates

NASA Technical Reports Server (NTRS)

Johnson, Travis; Fijany, Amir; Mojarradi, Mohammad; Vatan, Farrokh; Toomarian, Nikzad; Kolawa, Elizabeth; Cristoloveanu, Sorin; Blalock, Benjamin

2007-01-01

An analysis of a patented generic silicon- on-insulator (SOI) electronic device called a G4-FET has revealed that the device could be designed to function as a universal and programmable logic gate. The universality and programmability could be exploited to design logic circuits containing fewer discrete components than are required for conventional transistor-based circuits performing the same logic functions. A G4-FET is a combination of a junction field-effect transistor (JFET) and a metal oxide/semiconductor field-effect transistor (MOSFET) superimposed in a single silicon island and can therefore be regarded as two transistors sharing the same body. A G4-FET can also be regarded as a single transistor having four gates: two side junction-based gates, a top MOS gate, and a back gate activated by biasing of the SOI substrate. Each of these gates can be used to control the conduction characteristics of the transistor; this possibility creates new options for designing analog, radio-frequency, mixed-signal, and digital circuitry. With proper choice of the specific dimensions for the gates, channels, and ancillary features of the generic G4-FET, the device could be made to function as a three-input, one-output logic gate. As illustrated by the truth table in the top part of the figure, the behavior of this logic gate would be the inverse (the NOT) of that of a majority gate. In other words, the device would function as a NOT-majority gate. By simply adding an inverter, one could obtain a majority gate. In contrast, to construct a majority gate in conventional complementary metal oxide/semiconductor (CMOS) circuitry, one would need four three-input AND gates and a four-input OR gate, altogether containing 32 transistors.

31 CFR 551.501-551.502 - [Reserved

Code of Federal Regulations, 2010 CFR

2010-07-01

... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false [Reserved] 551.501-551.502 Section 551.501-551.502 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF FOREIGN ASSETS CONTROL, DEPARTMENT OF THE TREASURY SOMALIA SANCTIONS REGULATIONS Licenses...

31 CFR 551.304 - Interest.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 31 Money and Finance:Treasury 3 2011-07-01 2011-07-01 false Interest. 551.304 Section 551.304... Interest. Except as otherwise provided in this part, the term interest, when used with respect to property (e.g., “an interest in property”), means an interest of any nature whatsoever, direct or indirect. ...

31 CFR 551.304 - Interest.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 31 Money and Finance:Treasury 3 2013-07-01 2013-07-01 false Interest. 551.304 Section 551.304... Interest. Except as otherwise provided in this part, the term interest, when used with respect to property (e.g., “an interest in property”), means an interest of any nature whatsoever, direct or indirect. ...

31 CFR 551.304 - Interest.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 31 Money and Finance:Treasury 3 2012-07-01 2012-07-01 false Interest. 551.304 Section 551.304... Interest. Except as otherwise provided in this part, the term interest, when used with respect to property (e.g., “an interest in property”), means an interest of any nature whatsoever, direct or indirect. ...

31 CFR 551.304 - Interest.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 31 Money and Finance:Treasury 3 2014-07-01 2014-07-01 false Interest. 551.304 Section 551.304... Interest. Except as otherwise provided in this part, the term interest, when used with respect to property (e.g., “an interest in property”), means an interest of any nature whatsoever, direct or indirect. ...

Mutations on M3 helix of Plutella xylostella glutamate-gated chloride channel confer unequal resistance to abamectin by two different mechanisms.

PubMed

Wang, Xingliang; Puinean, Alin M; O Reilly, Andrias O; Williamson, Martin S; Smelt, Charles L C; Millar, Neil S; Wu, Yidong

2017-07-01

Abamectin is one of the most widely used avermectins for agricultural pests control, but the emergence of resistance around the world is proving a major threat to its sustained application. Abamectin acts by directly activating glutamate-gated chloride channels (GluCls) and modulating other Cys-loop ion channels. To date, three mutations occurring in the transmembrane domain of arthropod GluCls are associated with target-site resistance to abamectin: A309V in Plutella xylostella GluCl (PxGluCl), G323D in Tetranychus urticae GluCl1 (TuGluCl1) and G326E in TuGluCl3. To compare the effects of these mutations in a single system, A309V/I/G and G315E (corresponding to G323 in TuGluCl1 and G326 in TuGluCl3) substitutions were introduced individually into the PxGluCl channel. Functional analysis using Xenopus oocytes showed that the A309V and G315E mutations reduced the sensitivity to abamectin by 4.8- and 493-fold, respectively. In contrast, the substitutions A309I/G show no significant effects on the response to abamectin. Interestingly, the A309I substitution increased the channel sensitivity to glutamate by one order of magnitude (∼12-fold). Analysis of PxGluCl homology models indicates that the G315E mutation interferes with abamectin binding through a steric hindrance mechanism. In contrast, the structural consequences of the A309 mutations are not so clear and an allosteric modification of the binding site is the most likely mechanism. Overall the results show that both A309V and G315E mutations may contribute to target-site resistance to abamectin and may be important for the future prediction and monitoring of abamectin resistance in P. xylostella and other arthropod pests. Copyright © 2017 Elsevier Ltd. All rights reserved.

Characterization of D150E and G196D aquaporin-2 mutations responsible for nephrogenic diabetes insipidus: importance of a mild phenotype

PubMed Central

Guyon, Cécile; Lussier, Yoann; Bissonnette, Pierre; Leduc-Nadeau, Alexandre; Lonergan, Michèle; Arthus, Marie-Françoise; Perez, Rafael Bedoya; Tiulpakov, Anatoly; Lapointe, Jean-Yves; Bichet, Daniel G.

2009-01-01

Aquaporin-2 (AQP2) is a water channel responsible for the final water reabsorption in renal collecting ducts. Alterations in AQP2 function induce nephrogenic diabetes insipidus (NDI), a condition characterized by severe polyuria and polydipsia. Three patients affected with severe NDI, who were compound heterozygous for the AQP2 mutations D150E and G196D, are presented here along with a mildly affected D150E homozygous patient from another family. Using Xenopus oocytes as an expression system, these two mutations (G196D and D150E) were compared with the wild-type protein (AQP2-wt) for functional activity (water flux analysis), protein maturation, and plasma membrane targeting. AQP2-wt induces a major increase in water permeability (Pf = 47.4 ± 12.2 × 10−4 cm/s) whereas D150E displays intermediate Pf values (Pf = 12.5 ± 3.0 × 10−4 cm/s) and G196D presents no specific water flux, similar to controls (Pf = 2.1 ± 0.8 × 10−4 cm/s and 2.2 ± 0.7 × 10−4 cm/s, respectively). Western blot and immunocytochemical evaluations show protein targeting that parallels activity levels with AQP2-wt adequately targeted to the plasma membrane, partial targeting for D150E, and complete sequestration of G196D within intracellular compartments. When coinjecting AQP2-wt with mutants, no (AQP2-wt + D150E) or partial (AQP2-wt + G196D) reduction of water flux were observed compared with AQP2-wt alone, whereas complete loss of function was found when both mutants were coinjected. These results essentially recapitulate the clinical profiles of the family members, showing a typical dominant negative effect when G196D is coinjected with either AQP2-wt or D150E but not between AQP2-wt and D150E mutant. PMID:19458121

Some gating potentiators, including VX-770, diminish ΔF508-CFTR functional expression.

PubMed

Veit, Guido; Avramescu, Radu G; Perdomo, Doranda; Phuan, Puay-Wah; Bagdany, Miklos; Apaja, Pirjo M; Borot, Florence; Szollosi, Daniel; Wu, Yu-Sheng; Finkbeiner, Walter E; Hegedus, Tamas; Verkman, Alan S; Lukacs, Gergely L

2014-07-23

Cystic fibrosis (CF) is caused by mutations in the CF transmembrane regulator (CFTR) that result in reduced anion conductance at the apical membrane of secretory epithelia. Treatment of CF patients carrying the G551D gating mutation with the potentiator VX-770 (ivacaftor) largely restores channel activity and has shown substantial clinical benefit. However, most CF patients carry the ΔF508 mutation, which impairs CFTR folding, processing, function, and stability. Studies in homozygous ΔF508 CF patients indicated little clinical benefit of monotherapy with the investigational corrector VX-809 (lumacaftor) or VX-770, whereas combination clinical trials show limited but significant improvements in lung function. We show that VX-770, as well as most other potentiators, reduces the correction efficacy of VX-809 and another investigational corrector, VX-661. To mimic the administration of VX-770 alone or in combination with VX-809, we examined its long-term effect in immortalized and primary human respiratory epithelia. VX-770 diminished the folding efficiency and the metabolic stability of ΔF508-CFTR at the endoplasmic reticulum (ER) and post-ER compartments, respectively, causing reduced cell surface ΔF508-CFTR density and function. VX-770-induced destabilization of ΔF508-CFTR was influenced by second-site suppressor mutations of the folding defect and was prevented by stabilization of the nucleotide-binding domain 1 (NBD1)-NBD2 interface. The reduced correction efficiency of ΔF508-CFTR, as well as of two other processing mutations in the presence of VX-770, suggests the need for further optimization of potentiators to maximize the clinical benefit of corrector-potentiator combination therapy in CF. Copyright © 2014, American Association for the Advancement of Science.

Digital logic circuits in yeast with CRISPR-dCas9 NOR gates

PubMed Central

Gander, Miles W.; Vrana, Justin D.; Voje, William E.; Carothers, James M.; Klavins, Eric

2017-01-01

Natural genetic circuits enable cells to make sophisticated digital decisions. Building equally complex synthetic circuits in eukaryotes remains difficult, however, because commonly used components leak transcriptionally, do not arbitrarily interconnect or do not have digital responses. Here, we designed dCas9-Mxi1-based NOR gates in Saccharomyces cerevisiae that allow arbitrary connectivity and large genetic circuits. Because we used the chromatin remodeller Mxi1, our gates showed minimal leak and digital responses. We built a combinatorial library of NOR gates that directly convert guide RNA (gRNA) inputs into gRNA outputs, enabling the gates to be ‘wired' together. We constructed logic circuits with up to seven gRNAs, including repression cascades with up to seven layers. Modelling predicted the NOR gates have effectively zero transcriptional leak explaining the limited signal degradation in the circuits. Our approach enabled the largest, eukaryotic gene circuits to date and will form the basis for large, synthetic, cellular decision-making systems. PMID:28541304

29 CFR 551.5 - Information to be submitted.

Code of Federal Regulations, 2010 CFR

2010-07-01

... under §§ 551.3 and 551.4 shall contain the following information: (a) A full statement of the facts... during the most recent representative annual period as defined in § 551.8(g)(1), the weekly hours worked and the average workweek of such employees during such period and, if there are any significant...

Cystic fibrosis transmembrane conductance regulator (CFTR) potentiator VX-770 (ivacaftor) opens the defective channel gate of mutant CFTR in a phosphorylation-dependent but ATP-independent manner.

PubMed

Eckford, Paul D W; Li, Canhui; Ramjeesingh, Mohabir; Bear, Christine E

2012-10-26

The cystic fibrosis transmembrane conductance regulator (CFTR) acts as a channel on the apical membrane of epithelia. Disease-causing mutations in the cystic fibrosis gene can lead to CFTR protein misfolding as in the case of the F508del mutation and/or channel dysfunction. Recently, a small molecule, VX-770 (ivacaftor), has shown efficacy in restoring lung function in patients bearing the G551D mutation, and this has been linked to repair of its channel gating defect. However, these studies did not reveal the mechanism of action of VX-770 in detail. Normally, CFTR channel activity is regulated by phosphorylation, ATP binding, and hydrolysis. Hence, it has been hypothesized that VX-770 modifies one or more of these metabolic events. In this study, we examined VX-770 activity using a reconstitution system for purified CFTR protein, a system that enables control of known regulatory factors. We studied the consequences of VX-770 interaction with CFTR incorporated in planar lipid bilayers and in proteoliposomes, using a novel flux-based assay. We found that purified and phosphorylated CFTR was potentiated in the presence of Mg-ATP, suggesting that VX-770 bound directly to the CFTR protein, rather than associated kinases or phosphatases. Interestingly, we also found that VX-770 enhanced the channel activity of purified and mutant CFTR in the nominal absence of Mg-ATP. These findings suggest that VX-770 can cause CFTR channel opening through a nonconventional ATP-independent mechanism. This work sets the stage for future studies of the structural properties that mediate CFTR gating using VX-770 as a probe.

Gain-of-function mutation of a voltage-gated sodium channel NaV1.7 associated with peripheral pain and impaired limb development.

PubMed

Tanaka, Brian S; Nguyen, Phuong T; Zhou, Eray Yihui; Yang, Yong; Yarov-Yarovoy, Vladimir; Dib-Hajj, Sulayman D; Waxman, Stephen G

2017-06-02

Dominant mutations in voltage-gated sodium channel Na V 1.7 cause inherited erythromelalgia, a debilitating pain disorder characterized by severe burning pain and redness of the distal extremities. Na V 1.7 is preferentially expressed within peripheral sensory and sympathetic neurons. Here, we describe a novel Na V 1.7 mutation in an 11-year-old male with underdevelopment of the limbs, recurrent attacks of burning pain with erythema, and swelling in his feet and hands. Frequency and duration of the episodes gradually increased with age, and relief by cooling became less effective. The patient's sister had short stature and reported similar complaints of erythema and burning pain, but with less intensity. Genetic analysis revealed a novel missense mutation in Na V 1.7 (2567G>C; p.Gly856Arg) in both siblings. The G856R mutation, located within the DII/S4-S5 linker of the channel, substitutes a highly conserved non-polar glycine by a positively charged arginine. Voltage-clamp analysis of G856R currents revealed that the mutation hyperpolarized (-11.2 mV) voltage dependence of activation and slowed deactivation but did not affect fast inactivation, compared with wild-type channels. A mutation of Gly-856 to aspartic acid was previously found in a family with limb pain and limb underdevelopment, and its functional assessment showed hyperpolarized activation, depolarized fast inactivation, and increased ramp current. Structural modeling using the Rosetta computational modeling suite provided structural clues to the divergent effects of the substitution of Gly-856 by arginine and aspartic acid. Although the proexcitatory changes in gating properties of G856R contribute to the pathophysiology of inherited erythromelalgia, the link to limb underdevelopment is not well understood. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) Potentiator VX-770 (Ivacaftor) Opens the Defective Channel Gate of Mutant CFTR in a Phosphorylation-dependent but ATP-independent Manner* ♦

PubMed Central

Eckford, Paul D. W.; Li, Canhui; Ramjeesingh, Mohabir; Bear, Christine E.

2012-01-01

The cystic fibrosis transmembrane conductance regulator (CFTR) acts as a channel on the apical membrane of epithelia. Disease-causing mutations in the cystic fibrosis gene can lead to CFTR protein misfolding as in the case of the F508del mutation and/or channel dysfunction. Recently, a small molecule, VX-770 (ivacaftor), has shown efficacy in restoring lung function in patients bearing the G551D mutation, and this has been linked to repair of its channel gating defect. However, these studies did not reveal the mechanism of action of VX-770 in detail. Normally, CFTR channel activity is regulated by phosphorylation, ATP binding, and hydrolysis. Hence, it has been hypothesized that VX-770 modifies one or more of these metabolic events. In this study, we examined VX-770 activity using a reconstitution system for purified CFTR protein, a system that enables control of known regulatory factors. We studied the consequences of VX-770 interaction with CFTR incorporated in planar lipid bilayers and in proteoliposomes, using a novel flux-based assay. We found that purified and phosphorylated CFTR was potentiated in the presence of Mg-ATP, suggesting that VX-770 bound directly to the CFTR protein, rather than associated kinases or phosphatases. Interestingly, we also found that VX-770 enhanced the channel activity of purified and mutant CFTR in the nominal absence of Mg-ATP. These findings suggest that VX-770 can cause CFTR channel opening through a nonconventional ATP-independent mechanism. This work sets the stage for future studies of the structural properties that mediate CFTR gating using VX-770 as a probe. PMID:22942289

Detection of the V1016G mutation in the voltage-gated sodium channel gene of Aedes aegypti (Diptera: Culicidae) by allele-specific PCR assay, and its distribution and effect on deltamethrin resistance in Thailand.

PubMed

Stenhouse, Steven A; Plernsub, Suriya; Yanola, Jintana; Lumjuan, Nongkran; Dantrakool, Anchalee; Choochote, Wej; Somboon, Pradya

2013-08-30

Resistance to pyrethroid insecticides is widespread among populations of Aedes aegypti, the main vector for the dengue virus. Several different point mutations within the voltage-gated sodium channel (VGSC) gene contribute to such resistance. A mutation at position 1016 in domain II, segment 6 of the VGSC gene in Ae. aegypti leads to a valine to glycine substitution (V1016G) that confers resistance to deltamethrin. This study developed and utilized an allele-specific PCR (AS-PCR) assay that could be used to detect the V1016G mutation. The assay was validated against a number of sequenced DNA samples of known genotype and was determined to be in complete agreement. Larvae and pupae were collected from various localities throughout Thailand. Samples were reared to adulthood and their resistance status against deltamethrin was determined by standard WHO susceptibility bioassays. Deltamethrin-resistant and susceptible insects were then genotyped for the V1016G mutation. Additionally, some samples were genotyped for a second mutation at position 1534 in domain III (F1534C) which is also known to confer pyrethroid resistance. The bioassay results revealed an overall mortality of 77.6%. Homozygous 1016G individuals survived at higher rates than either heterozygous or wild-type (1016 V) mosquitoes. The 1016G mutation was significantly and positively associated with deltamethrin resistance and was widely distributed throughout Thailand. Interestingly, wild-type 1016 V mosquitoes tested were homozygous for the 1534C mutation, and all heterozygous mosquitoes were also heterozygous for 1534C. Mutant homozygous (G/G) mosquitoes expressed the wild-type (F/F) at position 1534. However, the presence of the 1534C mutation was not associated with deltamethrin resistance. Our bioassay results indicate that all populations sampled display some degree of resistance to deltamethrin. Homozygous 1016G mosquitoes were far likelier to survive such exposure. However, resistance in some

Co-occurrence of Point Mutations in the Voltage-Gated Sodium Channel of Pyrethroid-Resistant Aedes aegypti Populations in Myanmar

PubMed Central

Kawada, Hitoshi; Oo, Sai Zaw Min; Thaung, Sein; Kawashima, Emiko; Maung, Yan Naung Maung; Thu, Hlaing Myat; Thant, Kyaw Zin; Minakawa, Noboru

2014-01-01

Background Single amino acid substitutions in the voltage-gated sodium channel associated with pyrethroid resistance constitute one of the main causative factors of knockdown resistance in insects. The kdr gene has been observed in several mosquito species; however, point mutations in the para gene of Aedes aegypti populations in Myanmar have not been fully characterized. The aim of the present study was to determine the types and frequencies of mutations in the para gene of Aedes aegypti collected from used tires in Yangon City, Myanmar. Methodology/Principal Findings We determined high pyrethroid resistance in Aedes aegypti larvae at all collection sites in Yangon City, by using a simplified knockdown bioassay. We showed that V1016G and S989P mutations were widely distributed, with high frequencies (84.4% and 78.8%, respectively). By contrast, we were unable to detect I1011M (or I1011V) or L1014F mutations. F1534C mutations were also widely distributed, but with a lower frequency than the V1016G mutation (21.2%). High percentage of co-occurrence of the homozygous V1016G/S989P mutations was detected (65.7%). Additionally, co-occurrence of homozygous V1016G/F1534C mutations (2.9%) and homozygous V1016G/F1534C/S989P mutations (0.98%) were detected in the present study. Conclusions/Significance Pyrethroid insecticides were first used for malaria control in 1992, and have since been constantly used in Myanmar. This intensive use may explain the strong selection pressure toward Aedes aegypti, because this mosquito is generally a domestic and endophagic species with a preference for indoor breeding. Extensive use of DDT for malaria control before the use of this chemical was banned may also explain the development of pyrethroid resistance in Aedes aegypti. PMID:25077956

Co-occurrence of point mutations in the voltage-gated sodium channel of pyrethroid-resistant Aedes aegypti populations in Myanmar.

PubMed

Kawada, Hitoshi; Oo, Sai Zaw Min; Thaung, Sein; Kawashima, Emiko; Maung, Yan Naung Maung; Thu, Hlaing Myat; Thant, Kyaw Zin; Minakawa, Noboru

2014-01-01

Single amino acid substitutions in the voltage-gated sodium channel associated with pyrethroid resistance constitute one of the main causative factors of knockdown resistance in insects. The kdr gene has been observed in several mosquito species; however, point mutations in the para gene of Aedes aegypti populations in Myanmar have not been fully characterized. The aim of the present study was to determine the types and frequencies of mutations in the para gene of Aedes aegypti collected from used tires in Yangon City, Myanmar. We determined high pyrethroid resistance in Aedes aegypti larvae at all collection sites in Yangon City, by using a simplified knockdown bioassay. We showed that V1016G and S989P mutations were widely distributed, with high frequencies (84.4% and 78.8%, respectively). By contrast, we were unable to detect I1011M (or I1011V) or L1014F mutations. F1534C mutations were also widely distributed, but with a lower frequency than the V1016G mutation (21.2%). High percentage of co-occurrence of the homozygous V1016G/S989P mutations was detected (65.7%). Additionally, co-occurrence of homozygous V1016G/F1534C mutations (2.9%) and homozygous V1016G/F1534C/S989P mutations (0.98%) were detected in the present study. Pyrethroid insecticides were first used for malaria control in 1992, and have since been constantly used in Myanmar. This intensive use may explain the strong selection pressure toward Aedes aegypti, because this mosquito is generally a domestic and endophagic species with a preference for indoor breeding. Extensive use of DDT for malaria control before the use of this chemical was banned may also explain the development of pyrethroid resistance in Aedes aegypti.

Structure-based assessment of disease-related mutations in human voltage-gated sodium channels.

PubMed

Huang, Weiyun; Liu, Minhao; Yan, S Frank; Yan, Nieng

2017-06-01

Voltage-gated sodium (Na v ) channels are essential for the rapid upstroke of action potentials and the propagation of electrical signals in nerves and muscles. Defects of Na v channels are associated with a variety of channelopathies. More than 1000 disease-related mutations have been identified in Na v channels, with Na v 1.1 and Na v 1.5 each harboring more than 400 mutations. Na v channels represent major targets for a wide array of neurotoxins and drugs. Atomic structures of Na v channels are required to understand their function and disease mechanisms. The recently determined atomic structure of the rabbit voltage-gated calcium (Ca v ) channel Ca v 1.1 provides a template for homology-based structural modeling of the evolutionarily related Na v channels. In this Resource article, we summarized all the reported disease-related mutations in human Na v channels, generated a homologous model of human Na v 1.7, and structurally mapped disease-associated mutations. Before the determination of structures of human Na v channels, the analysis presented here serves as the base framework for mechanistic investigation of Na v channelopathies and for potential structure-based drug discovery.

30 CFR 551.7 - Test drilling activities under a permit.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 30 Mineral Resources 2 2014-07-01 2014-07-01 false Test drilling activities under a permit. 551.7... GEOLOGICAL AND GEOPHYSICAL (G&G) EXPLORATIONS OF THE OUTER CONTINENTAL SHELF § 551.7 Test drilling activities under a permit. (a) Shallow test drilling. Before you begin shallow test drilling under a permit, the...

30 CFR 551.7 - Test drilling activities under a permit.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 30 Mineral Resources 2 2013-07-01 2013-07-01 false Test drilling activities under a permit. 551.7... GEOLOGICAL AND GEOPHYSICAL (G&G) EXPLORATIONS OF THE OUTER CONTINENTAL SHELF § 551.7 Test drilling activities under a permit. (a) Shallow test drilling. Before you begin shallow test drilling under a permit, the...

30 CFR 551.7 - Test drilling activities under a permit.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 30 Mineral Resources 2 2012-07-01 2012-07-01 false Test drilling activities under a permit. 551.7... GEOLOGICAL AND GEOPHYSCIAL (G&G) EXPLORATIONS OF THE OUTER CONTINENTAL SHELF § 551.7 Test drilling activities under a permit. (a) Shallow test drilling. Before you begin shallow test drilling under a permit, the...

CFTR-dependent chloride efflux in cystic fibrosis mononuclear cells is increased by ivacaftor therapy.

PubMed

Guerra, Lorenzo; D'Oria, Susanna; Favia, Maria; Castellani, Stefano; Santostasi, Teresa; Polizzi, Angela M; Mariggiò, Maria A; Gallo, Crescenzio; Casavola, Valeria; Montemurro, Pasqualina; Leonetti, Giuseppina; Manca, Antonio; Conese, Massimo

2017-07-01

The Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) potentiator ivacaftor (Kalydeco®) improves clinical outcome in G551D cystic fibrosis (CF) patients. Here, we have investigated whether ivacaftor has a clinical impact on non-G551D gating mutations and function of circulating leukocytes as well. Seven patients were treated with ivacaftor and evaluated at baseline, and at 1-3 and 6 months. Besides clinical and systemic inflammatory parameters, circulating mononuclear cells (MNC) were evaluated for CFTR-dependent chloride efflux by spectrofluorimetry, neutrophils for oxidative burst by cytofluorimetry and HVCN1 mRNA expression by real time PCR. Ivacaftor determined a significant decrease in sweat chloride concentrations at all time points during treatment. Body mass index (BMI), FEV 1 , and FVC showed an increasing trend. While C-reactive protein decreased significantly at 2 months, the opposite behavior was noticed for circulating monocytes. CFTR activity in MNC was found to increase significantly at 3 and 6 months. Neutrophil oxidative burst peaked at 2 months and then decreased to baseline. HVCN1 mRNA expression was significantly higher than baseline at 1-3 months and decreased after 6 months of treatment. The chloride efflux in MNC correlated positively with both FEV 1 and FVC. On the other hand, sweat chloride correlated positively with CRP and WBC, and negatively with both respiratory function tests. A cluster analysis confirmed that sweat chloride, FEV 1 , FVC, BMI, and MNC chloride efflux behaved as a single entity over time. In patients with non-G551D mutations, ivacaftor improved both chloride transport in sweat ducts and chloride efflux in MNC, that is, functions directly imputed to CFTR. © 2017 Wiley Periodicals, Inc.

4D micro-CT using fast prospective gating

NASA Astrophysics Data System (ADS)

Guo, Xiaolian; Johnston, Samuel M.; Qi, Yi; Johnson, G. Allan; Badea, Cristian T.

2012-01-01

Micro-CT is currently used in preclinical studies to provide anatomical information. But, there is also significant interest in using this technology to obtain functional information. We report here a new sampling strategy for 4D micro-CT for functional cardiac and pulmonary imaging. Rapid scanning of free-breathing mice is achieved with fast prospective gating (FPG) implemented on a field programmable gate array. The method entails on-the-fly computation of delays from the R peaks of the ECG signals or the peaks of the respiratory signals for the triggering pulses. Projection images are acquired for all cardiac or respiratory phases at each angle before rotating to the next angle. FPG can deliver the faster scan time of retrospective gating (RG) with the regular angular distribution of conventional prospective gating for cardiac or respiratory gating. Simultaneous cardio-respiratory gating is also possible with FPG in a hybrid retrospective/prospective approach. We have performed phantom experiments to validate the new sampling protocol and compared the results from FPG and RG in cardiac imaging of a mouse. Additionally, we have evaluated the utility of incorporating respiratory information in 4D cardiac micro-CT studies with FPG. A dual-source micro-CT system was used for image acquisition with pulsed x-ray exposures (80 kVp, 100 mA, 10 ms). The cardiac micro-CT protocol involves the use of a liposomal blood pool contrast agent containing 123 mg I ml-1 delivered via a tail vein catheter in a dose of 0.01 ml g-1 body weight. The phantom experiment demonstrates that FPG can distinguish the successive phases of phantom motion with minimal motion blur, and the animal study demonstrates that respiratory FPG can distinguish inspiration and expiration. 4D cardiac micro-CT imaging with FPG provides image quality superior to RG at an isotropic voxel size of 88 µm and 10 ms temporal resolution. The acquisition time for either sampling approach is less than 5 min. The

The novel Parkinson's disease linked mutation G51D attenuates in vitro aggregation and membrane binding of α-synuclein, and enhances its secretion and nuclear localization in cells

PubMed Central

Fares, Mohamed-Bilal; Ait-Bouziad, Nadine; Dikiy, Igor; Mbefo, Martial K.; Jovičić, Ana; Kiely, Aoife; Holton, Janice L.; Lee, Seung-Jae; Gitler, Aaron D.; Eliezer, David; Lashuel, Hilal A.

2014-01-01

A novel mutation in the α-Synuclein (α-Syn) gene “G51D” was recently identified in two familial cases exhibiting features of Parkinson's disease (PD) and multiple system atrophy (MSA). In this study, we explored the impact of this novel mutation on the aggregation, cellular and biophysical properties of α-Syn, in an attempt to unravel how this mutant contributes to PD/MSA. Our results show that the G51D mutation significantly attenuates α-Syn aggregation in vitro. Moreover, it disrupts local helix formation in the presence of SDS, decreases binding to lipid vesicles C-terminal to the site of mutation and severely inhibits helical folding in the presence of acidic vesicles. When expressed in yeast, α-SynG51D behaves similarly to α-SynA30P, as both exhibit impaired membrane association, form few inclusions and are non-toxic. In contrast, enhanced secreted and nuclear levels of the G51D mutant were observed in mammalian cells, as well as in primary neurons, where α-SynG51D was enriched in the nuclear compartment, was hyper-phosphorylated at S129 and exacerbated α-Syn-induced mitochondrial fragmentation. Finally, post-mortem human brain tissues of α-SynG51D cases were examined, and revealed only partial colocalization with nuclear membrane markers, probably due to post-mortem tissue delay and fixation. These findings suggest that the PD-linked mutations may cause neurodegeneration via different mechanisms, some of which may be independent of α-Syn aggregation. PMID:24728187

Arrestin-dependent but G-protein coupled receptor kinase-independent uncoupling of D2-dopamine receptors.

PubMed

Celver, Jeremy; Sharma, Meenakshi; Thanawala, Vaidehi; Christopher Octeau, J; Kovoor, Abraham

2013-10-01

We reconstituted D2 like dopamine receptor (D2R) and the delta opioid receptor (DOR) coupling to G-protein gated inwardly rectifying potassium channels (K(ir)3) and directly compared the effects of co-expression of G-protein coupled receptor kinase (GRK) and arrestin on agonist-dependent desensitization of the receptor response. We found, as described previously, that co-expression of a GRK and an arrestin synergistically increased the rate of agonist-dependent desensitization of DOR. In contrast, only arrestin expression was required to produce desensitization of D2R responses. Furthermore, arrestin-dependent GRK-independent desensitization of D2R-K(ir)3 coupling could be transferred to DOR by substituting the third cytoplasmic loop of DOR with that of D2R. The arrestin-dependent GRK-independent desensitization of D2R desensitization was inhibited by staurosporine treatment, and blocked by alanine substitution of putative protein kinase C phosphorylation sites in the third cytoplasmic loop of D2R. Finally, the D2R construct in which putative protein kinase C phosphorylation sites were mutated did not undergo significant agonist-dependent desensitization even after GRK co-expression, suggesting that GRK phosphorylation of D2R does not play an important role in uncoupling of the receptor. © 2013 International Society for Neurochemistry.

Glucose-6-phosphate dehydrogenase (G6PD) mutations database: review of the "old" and update of the new mutations.

PubMed

Minucci, Angelo; Moradkhani, Kamran; Hwang, Ming Jing; Zuppi, Cecilia; Giardina, Bruno; Capoluongo, Ettore

2012-03-15

In the present paper we have updated the G6PD mutations database, including all the last discovered G6PD genetic variants. We underline that the last database has been published by Vulliamy et al. [1] who analytically reported 140 G6PD mutations: along with Vulliamy's database, there are two main sites, such as http://202.120.189.88/mutdb/ and www.LOVD.nl/MR, where almost all G6PD mutations can be found. Compared to the previous mutation reports, in our paper we have included for each mutation some additional information, such as: the secondary structure and the enzyme 3D position involving by mutation, the creation or abolition of a restriction site (with the enzyme involved) and the conservation score associated with each amino acid position. The mutations reported in the present tab have been divided according to the gene's region involved (coding and non-coding) and mutations affecting the coding region in: single, multiple (at least with two bases involved) and deletion. We underline that for the listed mutations, reported in italic, literature doesn't provide all the biochemical or bio-molecular information or the research data. Finally, for the "old" mutations, we tried to verify features previously reported and, when subsequently modified, we updated the specific information using the latest literature data. Copyright © 2012 Elsevier Inc. All rights reserved.

The hepcidin gene promoter nc.-1010C > T; -582A > G haplotype modulates serum ferritin in individuals carrying the common H63D mutation in HFE gene.

PubMed

Silva, Bruno; Pita, Lina; Gomes, Susana; Gonçalves, João; Faustino, Paula

2014-12-01

Hereditary hemochromatosis is an autosomal recessive disorder characterized by severe iron overload. It is usually associated with homozygosity for the HFE gene mutation c.845G > A; p.C282Y. However, in some cases, another HFE mutation (c.187C > G; p.H63D) seems to be associated with the disease. Its penetrance is very low, suggesting the possibility of other iron genetic modulators being involved. In this work, we have screened for HAMP promoter polymorphisms in 409 individuals presenting normal or increased serum ferritin levels together with normal or H63D-mutated HFE genotypes. Our results show that the hepcidin gene promoter TG haplotype, originated by linkage of the nc.-1010C > T and nc.-582A > G polymorphisms, is more frequent in the HFE_H63D individuals presenting serum ferritin levels higher than 300 μg/L than in those presenting the HFE_H63D mutation but with normal serum ferritin levels or in the normal control group.Moreover, it was observed that the TG haplotype was associated to increased serum ferritin levels in the overall pool of HFE_H63D individuals. Thus, our data suggest that screening for these polymorphisms could be of interest in order to explain the phenotype. However, this genetic condition seems to have no clinical significance.

Detection of KRAS G12D in colorectal cancer stool by droplet digital PCR

PubMed Central

Olmedillas-López, Susana; Lévano-Linares, Dennis César; Alexandre, Carmen Laura Aúz; Vega-Clemente, Luz; Sánchez, Edurne León; Villagrasa, Alejandro; Ruíz-Tovar, Jaime; García-Arranz, Mariano; García-Olmo, Damián

2017-01-01

AIM To assess KRAS G12D mutation detection by droplet digital PCR (ddPCR) in stool-derived DNA from colorectal cancer (CRC) patients. METHODS In this study, tumor tissue and stool samples were collected from 70 patients with stage I-IV CRC diagnosed by preoperative biopsy. KRAS mutational status was determined by pyrosequencing analysis of DNA obtained from formalin-fixed paraffin-embedded (FFPE) tumor tissues. The KRAS G12D mutation was then analyzed by ddPCR in FFPE tumors and stool-derived DNA from patients with this point mutation. Wild-type (WT) tumors, as determined by pyrosequencing, were included as controls; analysis of FFPE tissue and stool-derived DNA by ddPCR was performed for these patients as well. RESULTS Among the total 70 patients included, KRAS mutations were detected by pyrosequencing in 32 (45.71%), whereas 38 (54.29%) had WT tumors. The frequency of KRAS mutations was higher in left-sided tumors (11 located in the right colon, 15 in the left, and 6 in the rectum). The predominant point mutation was KRAS G12D (14.29%, n = 10), which was more frequent in early-stage tumors (I-IIA, n = 7). In agreement with pyrosequencing results, the KRAS G12D mutation was detected by ddPCR in FFPE tumor-derived DNA, and only a residual number of mutated copies was found in WT controls. The KRAS G12D mutation was also detected in stool-derived DNA in 80% of all fecal samples from CRC patients with this point mutation. CONCLUSION ddPCR is a reliable and sensitive method to analyze KRAS G12D mutation in stool-derived DNA from CRC patients, especially at early stages. This non-invasive approach is potentially applicable to other relevant biomarkers for CRC management. PMID:29093617

Molecular mechanism of a COOH-terminal gating determinant in the ROMK channel revealed by a Bartter's disease mutation

PubMed Central

Flagg, Thomas P; Yoo, Dana; Sciortino, Christopher M; Tate, Margaret; Romero, Michael F; Welling, Paul A

2002-01-01

The ROMK subtypes of inward-rectifier K+ channels mediate potassium secretion and regulate NaCl reabsorption in the kidney. Loss-of-function mutations in this pH-sensitive K+ channel cause Bartter's disease, a familial salt wasting nephropathy. One disease-causing mutation truncates the extreme COOH-terminus and induces a closed gating conformation. Here we identify a region within the deleted domain that plays an important role in pH-dependent gating. The domain contains a structural element that functionally interacts with the pH sensor in the cytoplasmic NH2-terminus to set a physiological range of pH sensitivity. Removal of the domain shifts the pKa towards alkaline pH values, causing channel inactivation under physiological conditions. Suppressor mutations within the pH sensor rescued channel gating and trans addition of the cognate peptide restored pH sensitivity. A specific interdomain interaction was revealed in an in vitro protein-protein binding assay between the NH2- and COOH-terminal cytoplasmic domains expressed as bacterial fusion proteins. These results provide new insights into the molecular mechanisms underlying Kir channel regulation and channel gating defects that are associated with Bartter's disease. PMID:12381810

The Structural Basis of Oncogenic Mutations G12, G13 and Q61 in Small GTPase K-Ras4B

NASA Astrophysics Data System (ADS)

Lu, Shaoyong; Jang, Hyunbum; Nussinov, Ruth; Zhang, Jian

2016-02-01

Ras mediates cell proliferation, survival and differentiation. Mutations in K-Ras4B are predominant at residues G12, G13 and Q61. Even though all impair GAP-assisted GTP → GDP hydrolysis, the mutation frequencies of K-Ras4B in human cancers vary. Here we aim to figure out their mechanisms and differential oncogenicity. In total, we performed 6.4 μs molecular dynamics simulations on the wild-type K-Ras4B (K-Ras4BWT-GTP/GDP) catalytic domain, the K-Ras4BWT-GTP-GAP complex, and the mutants (K-Ras4BG12C/G12D/G12V-GTP/GDP, K-Ras4BG13D-GTP/GDP, K-Ras4BQ61H-GTP/GDP) and their complexes with GAP. In addition, we simulated ‘exchanged’ nucleotide states. These comprehensive simulations reveal that in solution K-Ras4BWT-GTP exists in two, active and inactive, conformations. Oncogenic mutations differentially elicit an inactive-to-active conformational transition in K-Ras4B-GTP; in K-Ras4BG12C/G12D-GDP they expose the bound nucleotide which facilitates the GDP-to-GTP exchange. These mechanisms may help elucidate the differential mutational statistics in K-Ras4B-driven cancers. Exchanged nucleotide simulations reveal that the conformational transition is more accessible in the GTP-to-GDP than in the GDP-to-GTP exchange. Importantly, GAP not only donates its R789 arginine finger, but stabilizes the catalytically-competent conformation and pre-organizes catalytic residue Q61; mutations disturb the R789/Q61 organization, impairing GAP-mediated GTP hydrolysis. Together, our simulations help provide a mechanistic explanation of key mutational events in one of the most oncogenic proteins in cancer.

Mutation analysis of the cystic fibrosis transmembrane regulator gene in native American populations of the southwest

DOE Office of Scientific and Technical Information (OSTI.GOV)

Grebe, T.A.; Doane, W.W.; Norman, R.A.

1992-10-01

The authors report DNA and clinical analysis of cystic fibrosis (CF) in two previously unstudied, genetically isolated populations: Pueblo and Navajo Native Americans. Direct mutation analysis of six mutations of the CFTR gene - namely, [Delta]F508, G542X, G551D, R553X, N1303K, and W1282X - was performed on PCR-amplified genomic DNA extracted from blood samples. Haplotype analyses with marker/enzyme pairs XV2c/TaqI and KM29/PstI were performed as well. Of the 12 affected individuals studied, no [Delta]F508 mutation was detected; only one G542X mutation was found. None of the other mutations was detected. All affected individuals have either an AA, AC, or CC haplotype,more » except for the one carrying the G542X mutation, who has the haplotye AB. Clinically, six of the affected individuals examined exhibit growth deficiency, and five (all from the Zuni Pueblo) have a severe CF phenotype. Four of the six Zunis with CF are also microcephalic, a finding not previously noted in CF patients. The DNA data have serious implications for risk assessment of CF carrier status for these people. 14 refs., 3 tabs.« less

Mutation in the Auxiliary Calcium-Channel Subunit CACNA2D4 Causes Autosomal Recessive Cone Dystrophy

PubMed Central

Wycisk, Katharina Agnes; Zeitz, Christina; Feil, Silke; Wittmer, Mariana; Forster, Ursula; Neidhardt, John; Wissinger, Bernd; Zrenner, Eberhart; Wilke, Robert; Kohl, Susanne; Berger, Wolfgang

2006-01-01

Retinal signal transmission depends on the activity of high voltage–gated l-type calcium channels in photoreceptor ribbon synapses. We recently identified a truncating frameshift mutation in the Cacna2d4 gene in a spontaneous mouse mutant with profound loss of retinal signaling and an abnormal morphology of ribbon synapses in rods and cones. The Cacna2d4 gene encodes an l-type calcium-channel auxiliary subunit of the α2δ type. Mutations in its human orthologue, CACNA2D4, were not yet known to be associated with a disease. We performed mutation analyses of 34 patients who received an initial diagnosis of night blindness, and, in two affected siblings, we detected a homozygous nucleotide substitution (c.2406C→A) in CACNA2D4. The mutation introduces a premature stop codon that truncates one-third of the corresponding open reading frame. Both patients share symptoms of slowly progressing cone dystrophy. These findings represent the first report of a mutation in the human CACNA2D4 gene and define a novel gene defect that causes autosomal recessive cone dystrophy. PMID:17033974

A novel mutation MT-COIII m.9267G>C and MT-COI m.5913G>A mutation in mitochondrial genes in a Tunisian family with maternally inherited diabetes and deafness (MIDD) associated with sever nephropathy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tabebi, Mouna, E-mail: mouna.biologiste@yahoo.com; Mkaouar-Rebai, Emna; Mnif, Mouna

Mitochondrial diabetes (MD) is a heterogeneous disorder characterized by a chronic hyperglycemia, maternal transmission and its association with a bilateral hearing impairment. Several studies reported mutations in mitochondrial genes as potentially pathogenic for diabetes, since mitochondrial oxidative phosphorylation plays an important role in glucose-stimulated insulin secretion from beta cells. In the present report, we studied a Tunisian family with mitochondrial diabetes (MD) and deafness associated with nephropathy. The mutational analysis screening revealed the presence of a novel heteroplasmic mutation m.9276G>C in the mitochondrial COIII gene, detected in mtDNA extracted from leukocytes of a mother and her two daughters indicating thatmore » this mutation is maternally transmitted and suggest its implication in the observed phenotype. Bioinformatic tools showed that m.9267G>C mutation (p.A21P) is « deleterious » and it can modify the function and the stability of the MT-COIII protein by affecting the assembly of mitochondrial COX subunits and the translocation of protons then reducing the activity of the respective OXPHOS complexes of ATP synthesis. The nonsynonymous mutation (p.A21P) has not been reported before, it is the first mutation described in the COXIII gene which is related to insulin dependent mitochondrial diabetes and deafness and could be specific to the Tunisian population. The m.9267G>C mutation was present with a nonsynonymous inherited mitochondrial homoplasmic variation MT-COI m.5913 G>A (D4N) responsible of high blood pressure, a clinical feature detected in all explored patients. - Highlights: • MT-COX3 m.9267G>C (p.A21P), heteroplasmic substitution, is not reported in any database. • m.9267G>C can be responsible of the MIDD associated with nephropaty. • This substitution can modify the function and the stability of the MT-CO3 protein. • This substitution can modify MT-CO3 structure (2D and 3D). • MT-COX3 m.9267G>C is

dNTP pool levels modulate mutator phenotypes of error-prone DNA polymerase ε variants.

PubMed

Williams, Lindsey N; Marjavaara, Lisette; Knowels, Gary M; Schultz, Eric M; Fox, Edward J; Chabes, Andrei; Herr, Alan J

2015-05-12

Mutator phenotypes create genetic diversity that fuels tumor evolution. DNA polymerase (Pol) ε mediates leading strand DNA replication. Proofreading defects in this enzyme drive a number of human malignancies. Here, using budding yeast, we show that mutator variants of Pol ε depend on damage uninducible (Dun)1, an S-phase checkpoint kinase that maintains dNTP levels during a normal cell cycle and up-regulates dNTP synthesis upon checkpoint activation. Deletion of DUN1 (dun1Δ) suppresses the mutator phenotype of pol2-4 (encoding Pol ε proofreading deficiency) and is synthetically lethal with pol2-M644G (encoding altered Pol ε base selectivity). Although pol2-4 cells cycle normally, pol2-M644G cells progress slowly through S-phase. The pol2-M644G cells tolerate deletions of mediator of the replication checkpoint (MRC) 1 (mrc1Δ) and radiation sensitive (Rad) 9 (rad9Δ), which encode mediators of checkpoint responses to replication stress and DNA damage, respectively. The pol2-M644G mutator phenotype is partially suppressed by mrc1Δ but not rad9Δ; neither deletion suppresses the pol2-4 mutator phenotype. Thus, checkpoint activation augments the Dun1 effect on replication fidelity but is not required for it. Deletions of genes encoding key Dun1 targets that negatively regulate dNTP synthesis, suppress the dun1Δ pol2-M644G synthetic lethality and restore the mutator phenotype of pol2-4 in dun1Δ cells. DUN1 pol2-M644G cells have constitutively high dNTP levels, consistent with checkpoint activation. In contrast, pol2-4 and POL2 cells have similar dNTP levels, which decline in the absence of Dun1 and rise in the absence of the negative regulators of dNTP synthesis. Thus, dNTP pool levels correlate with Pol ε mutator severity, suggesting that treatments targeting dNTP pools could modulate mutator phenotypes for therapy.

3D modeling of dual-gate FinFET.

PubMed

Mil'shtein, Samson; Devarakonda, Lalitha; Zanchi, Brian; Palma, John

2012-11-13

The tendency to have better control of the flow of electrons in a channel of field-effect transistors (FETs) did lead to the design of two gates in junction field-effect transistors, field plates in a variety of metal semiconductor field-effect transistors and high electron mobility transistors, and finally a gate wrapping around three sides of a narrow fin-shaped channel in a FinFET. With the enhanced control, performance trends of all FETs are still challenged by carrier mobility dependence on the strengths of the electrical field along the channel. However, in cases when the ratio of FinFET volume to its surface dramatically decreases, one should carefully consider the surface boundary conditions of the device. Moreover, the inherent non-planar nature of a FinFET demands 3D modeling for accurate analysis of the device performance. Using the Silvaco modeling tool with quantization effects, we modeled a physical FinFET described in the work of Hisamoto et al. (IEEE Tran. Elec. Devices 47:12, 2000) in 3D. We compared it with a 2D model of the same device. We demonstrated that 3D modeling produces more accurate results. As 3D modeling results came close to experimental measurements, we made the next step of the study by designing a dual-gate FinFET biased at Vg1 >Vg2. It is shown that the dual-gate FinFET carries higher transconductance than the single-gate device.

Disease-causing Mutations in the Cystic Fibrosis Transmembrane Conductance Regulator Determine the Functional Responses of Alveolar Macrophages*

PubMed Central

Deriy, Ludmila V.; Gomez, Erwin A.; Zhang, Guangping; Beacham, Daniel W.; Hopson, Jessika A.; Gallan, Alexander J.; Shevchenko, Pavel D.; Bindokas, Vytautas P.; Nelson, Deborah J.

2009-01-01

Alveolar macrophages (AMs) play a major role in host defense against microbial infections in the lung. To perform this function, these cells must ingest and destroy pathogens, generally in phagosomes, as well as secrete a number of products that signal other immune cells to respond. Recently, we demonstrated that murine alveolar macrophages employ the cystic fibrosis transmembrane conductance regulator (CFTR) Cl− channel as a determinant in lysosomal acidification (Di, A., Brown, M. E., Deriy, L. V., Li, C., Szeto, F. L., Chen, Y., Huang, P., Tong, J., Naren, A. P., Bindokas, V., Palfrey, H. C., and Nelson, D. J. (2006) Nat. Cell Biol. 8, 933–944). Lysosomes and phagosomes in murine cftr−/− AMs failed to acidify, and the cells were deficient in bacterial killing compared with wild type controls. Cystic fibrosis is caused by mutations in CFTR and is characterized by chronic lung infections. The information about relationships between the CFTR genotype and the disease phenotype is scarce both on the organismal and cellular level. The most common disease-causing mutation, ΔF508, is found in 70% of patients with cystic fibrosis. The mutant protein fails to fold properly and is targeted for proteosomal degradation. G551D, the second most common mutation, causes loss of function of the protein at the plasma membrane. In this study, we have investigated the impact of CFTR ΔF508 and G551D on a set of core intracellular functions, including organellar acidification, granule secretion, and microbicidal activity in the AM. Utilizing primary AMs from wild type, cftr−/−, as well as mutant mice, we show a tight correlation between CFTR genotype and levels of lysosomal acidification, bacterial killing, and agonist-induced secretory responses, all of which would be expected to contribute to a significant impact on microbial clearance in the lung. PMID:19837664

Determination of prospective displacement-based gate threshold for respiratory-gated radiation delivery from retrospective phase-based gate threshold selected at 4D CT simulation.

PubMed

Vedam, S; Archambault, L; Starkschall, G; Mohan, R; Beddar, S

2007-11-01

Four-dimensional (4D) computed tomography (CT) imaging has found increasing importance in the localization of tumor and surrounding normal structures throughout the respiratory cycle. Based on such tumor motion information, it is possible to identify the appropriate phase interval for respiratory gated treatment planning and delivery. Such a gating phase interval is determined retrospectively based on tumor motion from internal tumor displacement. However, respiratory-gated treatment is delivered prospectively based on motion determined predominantly from an external monitor. Therefore, the simulation gate threshold determined from the retrospective phase interval selected for gating at 4D CT simulation may not correspond to the delivery gate threshold that is determined from the prospective external monitor displacement at treatment delivery. The purpose of the present work is to establish a relationship between the thresholds for respiratory gating determined at CT simulation and treatment delivery, respectively. One hundred fifty external respiratory motion traces, from 90 patients, with and without audio-visual biofeedback, are analyzed. Two respiratory phase intervals, 40%-60% and 30%-70%, are chosen for respiratory gating from the 4D CT-derived tumor motion trajectory. From residual tumor displacements within each such gating phase interval, a simulation gate threshold is defined based on (a) the average and (b) the maximum respiratory displacement within the phase interval. The duty cycle for prospective gated delivery is estimated from the proportion of external monitor displacement data points within both the selected phase interval and the simulation gate threshold. The delivery gate threshold is then determined iteratively to match the above determined duty cycle. The magnitude of the difference between such gate thresholds determined at simulation and treatment delivery is quantified in each case. Phantom motion tests yielded coincidence of simulation

Neutralisation of a single voltage sensor affects gating determinants in all four pore-forming S6 segments of Ca(V)1.2: a cooperative gating model.

PubMed

Beyl, Stanislav; Depil, Katrin; Hohaus, Annette; Stary-Weinzinger, Anna; Linder, Tobias; Timin, Eugen; Hering, Steffen

2012-10-01

Voltage sensors trigger the closed-open transitions in the pore of voltage-gated ion channels. To probe the transmission of voltage sensor signalling to the channel pore of Ca(V)1.2, we investigated how elimination of positive charges in the S4 segments (charged residues were replaced by neutral glutamine) modulates gating perturbations induced by mutations in pore-lining S6 segments. Neutralisation of all positively charged residues in IIS4 produced a functional channel (IIS4(N)), while replacement of the charged residues in IS4, IIIS4 and IVS4 segments resulted in nonfunctional channels. The IIS4(N) channel displayed activation kinetics similar to wild type. Mutations in a highly conserved structure motif on S6 segments ("GAGA ring": G432W in IS6, A780T in IIS6, G1193T in IIIS6 and A1503G in IVS6) induce strong left-shifted activation curves and decelerated channel deactivation kinetics. When IIS4(N) was combined with these mutations, the activation curves were shifted back towards wild type and current kinetics were accelerated. In contrast, 12 other mutations adjacent to the GAGA ring in IS6-IVS6, which also affect activation gating, were not rescued by IIS4(N). Thus, the rescue of gating distortions in segments IS6-IVS6 by IIS4(N) is highly position-specific. Thermodynamic cycle analysis supports the hypothesis that IIS4 is energetically coupled with the distantly located GAGA residues. We speculate that conformational changes caused by neutralisation of IIS4 are not restricted to domain II (IIS6) but are transmitted to gating structures in domains I, III and IV via the GAGA ring.

A systematic comparison of all mutations in hereditary sensory neuropathy type I (HSAN I) reveals that the G387A mutation is not disease associated.

PubMed

Hornemann, Thorsten; Penno, Anke; Richard, Stephane; Nicholson, Garth; van Dijk, Fleur S; Rotthier, Annelies; Timmerman, Vincent; von Eckardstein, Arnold

2009-04-01

Hereditary sensory neuropathy type 1 (HSAN I) is an autosomal dominant inherited neurodegenerative disorder of the peripheral nervous system associated with mutations in the SPTLC1 subunit of the serine palmitoyltransferase (SPT). Four missense mutations (C133W, C133Y, V144D and G387A) in SPTLC1 were reported to cause HSAN I. SPT catalyses the condensation of Serine and Palmitoyl-CoA, which is the first and rate-limiting step in the de novo synthesis of ceramides. Earlier studies showed that C133W and C133Y mutants have a reduced activity, whereas the impact of the V144D and G387A mutations on the human enzyme was not tested yet. In this paper, we show that none of the HSAN I mutations interferes with SPT complex formation. We demonstrate that also V144D has a reduced SPT activity, however to a lower extent than C133W and C133Y. In contrast, the G387A mutation showed no influence on SPT activity. Furthermore, the growth phenotype of LY-B cells--a SPTLC1 deficient CHO cell line--could be reversed by expressing either the wild-type SPTLC1 or the G387A mutant, but not the C133W mutant. This indicates that the G387A mutation is most likely not directly associated with HSAN I. These findings were genetically confirmed by the identification of a nuclear HSAN family which showed segregation of the G387A variant as a non-synonymous SNP.

A novel mouse model of Niemann-Pick type C disease carrying a D1005G-Npc1 mutation comparable to commonly observed human mutations.

PubMed

Maue, Robert A; Burgess, Robert W; Wang, Bing; Wooley, Christine M; Seburn, Kevin L; Vanier, Marie T; Rogers, Maximillian A; Chang, Catherine C; Chang, Ta-Yuan; Harris, Brent T; Graber, David J; Penatti, Carlos A A; Porter, Donna M; Szwergold, Benjamin S; Henderson, Leslie P; Totenhagen, John W; Trouard, Theodore P; Borbon, Ivan A; Erickson, Robert P

2012-02-15

We have identified a point mutation in Npc1 that creates a novel mouse model (Npc1(nmf164)) of Niemann-Pick type C1 (NPC) disease: a single nucleotide change (A to G at cDNA bp 3163) that results in an aspartate to glycine change at position 1005 (D1005G). This change is in the cysteine-rich luminal loop of the NPC1 protein and is highly similar to commonly occurring human mutations. Genetic and molecular biological analyses, including sequencing the Npc1(spm) allele and identifying a truncating mutation, confirm that the mutation in Npc1(nmf164) mice is distinct from those in other existing mouse models of NPC disease (Npc1(nih), Npc1(spm)). Analyses of lifespan, body and spleen weight, gait and other motor activities, as well as acoustic startle responses all reveal a more slowly developing phenotype in Npc1(nmf164) mutant mice than in mice with the null mutations (Npc1(nih), Npc1(spm)). Although Npc1 mRNA levels appear relatively normal, Npc1(nmf164) brain and liver display dramatic reductions in Npc1 protein, as well as abnormal cholesterol metabolism and altered glycolipid expression. Furthermore, histological analyses of liver, spleen, hippocampus, cortex and cerebellum reveal abnormal cholesterol accumulation, glial activation and Purkinje cell loss at a slower rate than in the Npc1(nih) mouse model. Magnetic resonance imaging studies also reveal significantly less demyelination/dysmyelination than in the null alleles. Thus, although prior mouse models may correspond to the severe infantile onset forms of NPC disease, Npc1(nmf164) mice offer many advantages as a model for the late-onset, more slowly progressing forms of NPC disease that comprise the large majority of human cases.

A novel mouse model of Niemann–Pick type C disease carrying a D1005G-Npc1 mutation comparable to commonly observed human mutations

PubMed Central

Maue, Robert A.; Burgess, Robert W.; Wang, Bing; Wooley, Christine M.; Seburn, Kevin L.; Vanier, Marie T.; Rogers, Maximillian A.; Chang, Catherine C.; Chang, Ta-Yuan; Harris, Brent T.; Graber, David J.; Penatti, Carlos A.A.; Porter, Donna M.; Szwergold, Benjamin S.; Henderson, Leslie P.; Totenhagen, John W.; Trouard, Theodore P.; Borbon, Ivan A.; Erickson, Robert P.

2012-01-01

We have identified a point mutation in Npc1 that creates a novel mouse model (Npc1nmf164) of Niemann–Pick type C1 (NPC) disease: a single nucleotide change (A to G at cDNA bp 3163) that results in an aspartate to glycine change at position 1005 (D1005G). This change is in the cysteine-rich luminal loop of the NPC1 protein and is highly similar to commonly occurring human mutations. Genetic and molecular biological analyses, including sequencing the Npc1spm allele and identifying a truncating mutation, confirm that the mutation in Npc1nmf164 mice is distinct from those in other existing mouse models of NPC disease (Npc1nih, Npc1spm). Analyses of lifespan, body and spleen weight, gait and other motor activities, as well as acoustic startle responses all reveal a more slowly developing phenotype in Npc1nmf164 mutant mice than in mice with the null mutations (Npc1nih, Npc1spm). Although Npc1 mRNA levels appear relatively normal, Npc1nmf164 brain and liver display dramatic reductions in Npc1 protein, as well as abnormal cholesterol metabolism and altered glycolipid expression. Furthermore, histological analyses of liver, spleen, hippocampus, cortex and cerebellum reveal abnormal cholesterol accumulation, glial activation and Purkinje cell loss at a slower rate than in the Npc1nih mouse model. Magnetic resonance imaging studies also reveal significantly less demyelination/dysmyelination than in the null alleles. Thus, although prior mouse models may correspond to the severe infantile onset forms of NPC disease, Npc1nmf164 mice offer many advantages as a model for the late-onset, more slowly progressing forms of NPC disease that comprise the large majority of human cases. PMID:22048958

Ethnic heterogeneity and cystic fibrosis transmembrane regulator (CFTR) mutation frequencies in Chicago-area CF families

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ober, C.; Lester, L.A.; Mott, C.

1992-12-01

The identification of a common mutation, [Delta]F508, in the CFTR gene allowed, for the first time, the detection of cystic fibrosis (CF) carriers in the general population. Further genetic studies revealed >100 additional disease-causing mutations in this gene, few of which occur on >1% of CF chromosomes in any ethnic group. Prior to establishing counseling guidelines and carrier risk assessments, the authors sought to establish the frequencies of the CFTR mutations that are present in CF families living in the Chicago are, a region notable for its ethnic heterogeneity. Their sample included 283 unrelated CF carriers, with the following ethnicmore » composition: 78% non-Ashkenazi Caucasians, 5% Ashkenazi, 9% African-American, 3% Mexican, 0.3% Native American, and 5% mixed ancestry. When a panel of 10 mutations ([Delta]F508, [Delta]I507, G542X, G551D, R553X, S549N, R1162X, W1282X, N1303K, and 1717-1G[r arrow]A) was used, detection rates ranged from 75% in non-Ashkenazi Caucasians to 40% in African-Americans. These data suggest that the goal of screening for 90%-95% of CF mutations may be unrealistic in this and other, similar US populations. 22 refs., 1 tab.« less

Widespread Distribution of a Newly Found Point Mutation in Voltage-Gated Sodium Channel in Pyrethroid-Resistant Aedes aegypti Populations in Vietnam

PubMed Central

Kawada, Hitoshi; Higa, Yukiko; Komagata, Osamu; Kasai, Shinji; Tomita, Takashi; Thi Yen, Nguyen; Loan, Luu Lee; Sánchez, Rodrigo A. P.; Takagi, Masahiro

2009-01-01

Background Resistance of Aedes aegypti to photostable pyrethroid insecticides is a major problem for disease-vector control programs. Pyrethroids target the voltage-gated sodium channel on the insects' neurons. Single amino acid substitutions in this channel associated with pyrethroid resistance are one of the main factors that cause knockdown resistance in insects. Although kdr has been observed in several mosquito species, point mutations in the para gene have not been fully characterized in Ae. aegypti populations in Vietnam. The aim of this study was to determine the types and frequencies of mutations in the para gene in Ae. aegypti collected from used tires in Vietnam. Methods and Findings Several point mutations were examined that cause insensitivity of the voltage-gated sodium channel in the insect nervous system due to the replacement of the amino acids L1014F, the most commonly found point mutation in several mosquitoes; I1011M (or V) and V1016G (or I), which have been reported to be associated to knockdown resistance in Ae. aegypti located in segment 6, domain II; and a recently found amino acid replacement in F1269 in Ae. aegypti, located in segment 6, domain III. Among 756 larvae from 70 locations, no I1011M or I1011V nor L1014F mutations were found, and only two heterozygous V1016G mosquitoes were detected. However, F1269C mutations on domain III were distributed widely and with high frequency in 269 individuals among 757 larvae (53 collection sites among 70 locations surveyed). F1269C frequencies were low in the middle to north part of Vietnam but were high in the areas neighboring big cities and in the south of Vietnam, with the exception of the southern mountainous areas located at an elevation of 500–1000 m. Conclusions The overall percentage of homozygous F1269C seems to remain low (7.4%) in the present situation. However, extensive and uncontrolled frequent use of photostable pyrethroids might be a strong selection pressure for this mutation to

Single d(ApG)/cis-diamminedichloroplatinum(II) adduct-induced mutagenesis in Escherichia coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Burnouf, D.; Fuchs, R.P.P.; Gauthier, C.

1990-08-01

The mutation spectrum induced by the widely used antitumor drug cis-diamminedichloroplatinum(II) (cis-DDP) showed that cisDDP(d(ApG)) adducts, although they account for only 25% of the lesions formed are {approx}5 times more mutagenic than the major GG adduct. The authors report the construction of vectors bearing a single cisDDP(d(ApG)) lesion and their use in mutagenesis experiments in Escherichia coli. The mutagenic processing of the lesion is found to depend strictly on induction of the SOS system of the bacterial host cells. In SOS-induced cells, mutation frequencies of 1-2% were detected. All these mutations are targeted to the 5{prime} base of the adduct.more » Single A {yields} T transversions are mainly observed (80%), whereas A {yields} G transitions account for 10% of the total mutations. Tandem base-pair substitutions involving the adenine residue and the thymine residue immediately 5{prime} to the adduct occur at a comparable frequency (10%). No selective loss of the strand bearing the platinum adduct was seen, suggesting that, in vivo, cisDDP(d(ApG)) adducts are not blocking lesions. The high mutation specificity of cisDDP-(d(ApG))-induced mutagenesis is discussed in relation to structural data.« less

Determination of prospective displacement-based gate threshold for respiratory-gated radiation delivery from retrospective phase-based gate threshold selected at 4D CT simulation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vedam, S.; Archambault, L.; Starkschall, G.

2007-11-15

Four-dimensional (4D) computed tomography (CT) imaging has found increasing importance in the localization of tumor and surrounding normal structures throughout the respiratory cycle. Based on such tumor motion information, it is possible to identify the appropriate phase interval for respiratory gated treatment planning and delivery. Such a gating phase interval is determined retrospectively based on tumor motion from internal tumor displacement. However, respiratory-gated treatment is delivered prospectively based on motion determined predominantly from an external monitor. Therefore, the simulation gate threshold determined from the retrospective phase interval selected for gating at 4D CT simulation may not correspond to the deliverymore » gate threshold that is determined from the prospective external monitor displacement at treatment delivery. The purpose of the present work is to establish a relationship between the thresholds for respiratory gating determined at CT simulation and treatment delivery, respectively. One hundred fifty external respiratory motion traces, from 90 patients, with and without audio-visual biofeedback, are analyzed. Two respiratory phase intervals, 40%-60% and 30%-70%, are chosen for respiratory gating from the 4D CT-derived tumor motion trajectory. From residual tumor displacements within each such gating phase interval, a simulation gate threshold is defined based on (a) the average and (b) the maximum respiratory displacement within the phase interval. The duty cycle for prospective gated delivery is estimated from the proportion of external monitor displacement data points within both the selected phase interval and the simulation gate threshold. The delivery gate threshold is then determined iteratively to match the above determined duty cycle. The magnitude of the difference between such gate thresholds determined at simulation and treatment delivery is quantified in each case. Phantom motion tests yielded coincidence of

Transphosphorylation of Bruton's tyrosine kinase on tyrosine 551 is critical for B cell antigen receptor function.

PubMed

Kurosaki, T; Kurosaki, M

1997-06-20

Bruton's tyrosine kinase (Btk) is required for B cell development and B cell antigen receptor (BCR) function. Cross-linking of BCR induces phosphorylation of Btk at Tyr551 and Tyr223. However, the functional requirement of these phosphorylation for BCR signaling remains unclear. We demonstrate here that mutation of Tyr551, not Tyr223, abrogates the BCR-induced calcium mobilization. Not only Lyn, but also Syk was required for tyrosine phosphorylation of Btk in BCR signaling. These results suggest that transphosphorylation of Btk on Tyr551 is essential for BCR function and that this phosphorylation is mediated through the concerted actions of Lyn and Syk.

4D numerical observer for lesion detection in respiratory-gated PET

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lorsakul, Auranuch; Li, Quanzheng; Ouyang, Jinsong

2014-10-15

Purpose: Respiratory-gated positron emission tomography (PET)/computed tomography protocols reduce lesion smearing and improve lesion detection through a synchronized acquisition of emission data. However, an objective assessment of image quality of the improvement gained from respiratory-gated PET is mainly limited to a three-dimensional (3D) approach. This work proposes a 4D numerical observer that incorporates both spatial and temporal informations for detection tasks in pulmonary oncology. Methods: The authors propose a 4D numerical observer constructed with a 3D channelized Hotelling observer for the spatial domain followed by a Hotelling observer for the temporal domain. Realistic {sup 18}F-fluorodeoxyglucose activity distributions were simulated usingmore » a 4D extended cardiac torso anthropomorphic phantom including 12 spherical lesions at different anatomical locations (lower, upper, anterior, and posterior) within the lungs. Simulated data based on Monte Carlo simulation were obtained using GEANT4 application for tomographic emission (GATE). Fifty noise realizations of six respiratory-gated PET frames were simulated by GATE using a model of the Siemens Biograph mMR scanner geometry. PET sinograms of the thorax background and pulmonary lesions that were simulated separately were merged to generate different conditions of the lesions to the background (e.g., lesion contrast and motion). A conventional ordered subset expectation maximization (OSEM) reconstruction (5 iterations and 6 subsets) was used to obtain: (1) gated, (2) nongated, and (3) motion-corrected image volumes (a total of 3200 subimage volumes: 2400 gated, 400 nongated, and 400 motion-corrected). Lesion-detection signal-to-noise ratios (SNRs) were measured in different lesion-to-background contrast levels (3.5, 8.0, 9.0, and 20.0), lesion diameters (10.0, 13.0, and 16.0 mm), and respiratory motion displacements (17.6–31.3 mm). The proposed 4D numerical observer applied on multiple-gated

29 CFR 551.7 - Finding.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 29 Labor 3 2010-07-01 2010-07-01 false Finding. 551.7 Section 551.7 Labor Regulations Relating to... HELPERS; WAGE PAYMENT PLANS § 551.7 Finding. (a) A finding by the Administrator under paragraph (b) of... petitioners as provided in § 551.6(b). The finding shall include such terms and conditions and such...

[Analysis of H63D mutation in hemochromatosis (HFE) gene in populations of central Eurasia].

PubMed

Khusainova, R I; Khusnutdinova, N N; Litvinov, S S; Khusnutdinova, E K

2013-02-01

An analysis of the frequency of H63D (c. 187C>G) mutations in the HFEgene in 19 populations from Central Eurasia demonstrated that the distribution of the mutation in the region of interest was not uniform and that there were the areas of H63D accumulation. The investigation of three polymorphic variants, c.340+4T>C (rs2071303, IVS2(+4)T>C), c.893-44T>C (rs1800708, IVS4(-44)T>C), and c.1007-47G>A (rs1572982, IVS5(-47)A>G), in the HFE gene in individuals homozygous for H63D mutations in the HFE gene revealed the linkage of H63D with three haplotypes, *CTA, *TG, and *TTA. These findings indicated the partial spread of the mutation in Central Eurasia from Western Europe, as well as the possible repeated appearance of the mutation on the territory on interest.

Self-gated golden-angle spiral 4D flow MRI.

PubMed

Bastkowski, Rene; Weiss, Kilian; Maintz, David; Giese, Daniel

2018-01-17

The acquisition of 4D flow magnetic resonance imaging (MRI) in cardiovascular applications has recently made large progress toward clinical feasibility. The need for simultaneous compensation of cardiac and breathing motion still poses a challenge for widespread clinical use. Especially, breathing motion, addressed by gating approaches, can lead to unpredictable and long scan times. The current work proposes a time-efficient self-gated 4D flow sequence that exploits up to 100% of the acquired data and operates at a predictable scan time. A self-gated golden-angle spiral 4D flow sequence was implemented and tested in 10 volunteers. Data were retrospectively binned into respiratory and cardiac states and reconstructed using a conjugate-gradient sensitivity encoding reconstruction. Net flow curves, stroke volumes, and peak flow in the aorta were evaluated and compared to a conventional Cartesian 4D flow sequence. Additionally, flow quantities reconstructed from 50% to 100% of the self-gated 4D flow data were compared. Self-gating signals for respiratory and cardiac motion were extracted for all volunteers. Flow quantities were in agreement with the standard Cartesian scan. Mean differences in stroke volumes and peak flow of 7.6 ± 11.5 and 4.0 ± 79.9 mL/s were obtained, respectively. By retrospectively increasing breathing navigator efficiency while decreasing acquisition times (15:06-07:33 minutes), 50% of the acquired data were sufficient to measure stroke volumes with errors under 9.6 mL. The feasibility to acquire respiratory and cardiac self-gated 4D flow data at a predictable scan time was demonstrated. Magn Reson Med, 2018. © 2018 International Society for Magnetic Resonance in Medicine. © 2018 International Society for Magnetic Resonance in Medicine.

Strength and Fatigue of NT551 Silicon Nitride and NT551 Diesel Exhaust Valves

DOE Office of Scientific and Technical Information (OSTI.GOV)

Andrews, M.J.; Wereszczak, A.A.; Kirkland, T.P.

2000-02-01

The content of this report is excerpted from Mark Andrew's Ph.D. Thesis (Andrews, 1999), which was funded by a DOEYOTT High Temperature Materials Laboratory Graduate Fellowship. It involves the characterization of NT551 and valves fabricated with it. Greater detail of the described issues may be found in that reference or through communications with Andrew Wereszczak.

Is the c.3G>C mutation in the succinate dehydrogenase subunit D (SDHD) gene due to a founder effect in Chinese head and neck paraganglioma patients?

PubMed

Zha, Yang; Chen, Xing-ming; Lam, Ching-wan; Lee, Soo-chin; Tong, Sui-fan; Gao, Zhi-qiang

2011-08-01

Three Chinese patients with head and neck paragangliomas have been reported to carry the c.3G>C mutation in the succinate dehydrogenase subunit D (SDHD) gene. In addition, in our hospital, two further patients were identified who have the same mutation. It is unclear whether the c.3G>C mutation in Chinese patients is a recurrent mutation or if it is due to a founder effect. We conducted haplotype analysis on these patients to answer this question. Individual case-control study. Germ-line mutations were confirmed in the patients and their families examined in this study using direct sequencing. We also constructed and analyzed haplotypes in four Chinese families. Genotype frequencies were compared to the control group. Three of four families shared the same haplotype, which rarely occurred in the control group. The last family shared a very short area on the physical map with the other three families. There is a founder effect in Chinese head and neck paraganglioma patients carrying the SDHD c.3G>C mutation. Copyright © 2011 The American Laryngological, Rhinological, and Otological Society, Inc.

[Pain and analgesia : Mutations of voltage-gated sodium channels].

PubMed

Eberhardt, M J; Leffler, A

2017-02-01

Voltage-gated sodium channels (Navs) are crucial for the generation and propagation of action potentials in all excitable cells, and therefore for the function of sensory neurons as well. Preclinical research over the past 20 years identified three Nav-isoforms in sensory neurons, namely Nav1.7, Nav1.8 and Nav1.9. A specific role for the function of nociceptive neurons was postulated for each. Whereas no selective sodium channel inhibitors have been established in the clinic so far, the relevance of all three isoforms regarding the pain sensitivity in humans is currently undergoing a remarkable verification through the translation of preclinical data into clinically manifest pictures. For the last ten years, Nav1.7 has been the main focus of clinical interest, as a large number of hereditary mutants were identified. The so-called "gain-of-function" mutations of Nav1.7 cause the pain syndromes hereditary erythromelalgia and paroxysmal extreme pain disorder. In addition, several Nav1.7 mutants were shown to be associated with small-fiber neuropathies. On the contrary, "loss-of-function" Nav1.7 mutants lead to a congenital insensitivity to pain. Recently, several gain-of-function mutations in Nav1.8 and Nav1.9 have been identified in patients suffering from painful peripheral neuropathies. However, another gain-of-function Nav1.9 mutation is associated with congenital insensitivity to pain. This review offers an overview of published work on painful Nav mutations with clinical relevance, and proposes possible consequences for the therapy of different pain symptoms resulting from these findings.

Identification of an alternative knockdown resistance (kdr)-like mutation, M918L, and a novel mutation, V1010A, in the Thrips tabaci voltage-gated sodium channel gene.

PubMed

Wu, Meixiang; Gotoh, Hiroki; Waters, Timothy; Walsh, Douglas B; Lavine, Laura Corley

2014-06-01

Knockdown resistance (kdr) has been identified as a main mechanism against pyrethroid insecticides in many arthropod pests including in the onion thrips, Thrips tabaci. To characterize and identify pyrethroid-resistance in onion thrips in Washington state, we conducted insecticide bioassays and sequenced a region of the voltage gated sodium channel gene from several different T. tabaci populations. Field collected Thrips tabaci were found to have large variations in resistance to the pyrethroid insecticide lambda-cyhalothrin. We identified two single nucleotide substitutions in our analysis of a partial sequence of the T. tabaci voltage-gated sodium channel gene. One mutation resulted in the non-synonymous substitution of methionine with leucine (M918L), which is well known to be responsible for super knockdown resistance in some pest species. Another non-synonymous substitution, a valine (GTT) to alanine (GCT) replacement at amino acid 1010 (V1010A) was identified in our study and was associated with lambda-cyhalothrin resistance. We have characterized a known kdr mutation and identified a novel mutation in the voltage-gated sodium channel gene of Thrips tabaci associated with resistance to lambda-cyhalothrin. This gene region and these mutations are expected to be useful in the development of a diagnostic test to detect kdr resistance in many onion thrips populations. © 2013 Society of Chemical Industry.

Inherited macular degeneration-associated mutations in CNGB3 increase the ligand sensitivity and spontaneous open probability of cone cyclic nucleotide-gated channels

PubMed Central

Meighan, Peter C.; Peng, Changhong; Varnum, Michael D.

2015-01-01

Cyclic nucleotide gated (CNG) channels are a critical component of the visual transduction cascade in the vertebrate retina. Mutations in the genes encoding these channels have been associated with a spectrum of inherited retinal disorders. To gain insight into their pathophysiological mechanisms, we have investigated the functional consequences of several CNGB3 mutations, previously associated with macular degeneration (Y469D and L595F) or complete achromatopsia (S156F, P309L, and G558C), by expressing these subunits in combination with wild-type CNGA3 in Xenopus oocytes and characterizing them using patch-clamp recordings in the inside-out configuration. These mutations did not prevent the formation of functional heteromeric channels, as indicated by sensitivity to block by L-cis-diltiazem. With the exception of S156F, each of the mutant channels displayed electrophysiological properties reflecting enhanced channel activity at physiological concentrations of cGMP (i.e., a gain-of-function phenotype). The increased channel activity produced by these mutations resulted from either increased functional expression levels, or increased sensitivity to cyclic nucleotides. Furthermore, L595F increased the spontaneous open probability in the absence of activating ligand, signifying a ligand independent gain-of-function change. In addition to the CNGB3 disease-associate mutations, we characterized the effects of several common CNGB3 and CNGA3 single-nucleotide polymorphisms (SNPs) on heteromeric CNGA3+CNGB3 channel function. Two of the SNPs examined (A3-T153M, and B3-W234C) produced decreased ligand sensitivity for heteromeric CNG channels. These changes may contribute to background disease susceptibility when combined with other genetic or non-genetic factors. Together, these studies help to define the underlying molecular phenotype for mutations relating to CNG channel disease pathogenesis. PMID:26106334

DFG-out Mode of Inhibition by an Irreversible Type-1 Inhibitor Capable of Overcoming Gate-Keeper Mutations in FGF Receptors

PubMed Central

2015-01-01

Drug-resistance acquisition through kinase gate-keeper mutations is a major hurdle in the clinic. Here, we determined the first crystal structures of the human FGFR4 kinase domain (FGFR4K) alone and complexed with ponatinib, a promiscuous type-2 (DFG-out) kinase inhibitor, and an oncogenic FGFR4K harboring the V550L gate-keeper mutation bound to FIIN-2, a new type-1 irreversible inhibitor. Remarkably, like ponatinib, FIIN-2 also binds in the DFG-out mode despite lacking a functional group necessary to occupy the pocket vacated upon the DFG-out flip. Structural analysis reveals that the covalent bond between FIIN-2 and a cysteine, uniquely present in the glycine-rich loop of FGFR kinases, facilitates the DFG-out conformation, which together with the internal flexibility of FIIN-2 enables FIIN-2 to avoid the steric clash with the gate-keeper mutation that causes the ponatinib resistance. The structural data provide a blueprint for the development of next generation anticancer inhibitors through combining the salient inhibitory mechanisms of ponatinib and FIIN-2. PMID:25317566

12 CFR 551.150 - How do my officers and employees file reports of personal securities trading transactions?

Code of Federal Regulations, 2010 CFR

2010-01-01

... of personal securities trading transactions? 551.150 Section 551.150 Banks and Banking OFFICE OF... TRANSACTIONS Securities Trading Policies and Procedures § 551.150 How do my officers and employees file reports of personal securities trading transactions? An officer or employee described in § 551.140(d) must...

28 CFR 551.12 - Eligibility to marry.

Code of Federal Regulations, 2010 CFR

2010-07-01

... MISCELLANEOUS Marriages of Inmates § 551.12 Eligibility to marry. An inmate's request to marry shall be approved... intended spouse has verified, ordinarily in writing, an intention to marry the inmate; and (d) The marriage...

28 CFR 551.112 - Education.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 28 Judicial Administration 2 2011-07-01 2011-07-01 false Education. 551.112 Section 551.112 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Pretrial Inmates § 551.112 Education. (a) A pretrial inmate may participate in correspondence and self...

28 CFR 551.112 - Education.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 28 Judicial Administration 2 2013-07-01 2013-07-01 false Education. 551.112 Section 551.112 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Pretrial Inmates § 551.112 Education. (a) A pretrial inmate may participate in correspondence and self...

28 CFR 551.112 - Education.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 28 Judicial Administration 2 2014-07-01 2014-07-01 false Education. 551.112 Section 551.112 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Pretrial Inmates § 551.112 Education. (a) A pretrial inmate may participate in correspondence and self...

28 CFR 551.112 - Education.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 28 Judicial Administration 2 2012-07-01 2012-07-01 false Education. 551.112 Section 551.112 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Pretrial Inmates § 551.112 Education. (a) A pretrial inmate may participate in correspondence and self...

28 CFR 551.111 - Marriage.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Marriage. 551.111 Section 551.111... Pretrial Inmates § 551.111 Marriage. A pretrial inmate may request permission to marry in accordance with... marriage request of the pretrial inmate and to request their comments. ...

28 CFR 551.161 - Definitions.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 28 Judicial Administration 2 2011-07-01 2011-07-01 false Definitions. 551.161 Section 551.161 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Smoking/No Smoking Areas § 551.161 Definitions. For purpose of this subpart, smoking is defined as...

28 CFR 551.161 - Definitions.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 28 Judicial Administration 2 2014-07-01 2014-07-01 false Definitions. 551.161 Section 551.161 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Smoking/No Smoking Areas § 551.161 Definitions. For purpose of this subpart, smoking is defined as...

28 CFR 551.161 - Definitions.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 28 Judicial Administration 2 2012-07-01 2012-07-01 false Definitions. 551.161 Section 551.161 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Smoking/No Smoking Areas § 551.161 Definitions. For purpose of this subpart, smoking is defined as...

28 CFR 551.161 - Definitions.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Definitions. 551.161 Section 551.161 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Smoking/No Smoking Areas § 551.161 Definitions. For purpose of this subpart, smoking is defined as...

28 CFR 551.161 - Definitions.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 28 Judicial Administration 2 2013-07-01 2013-07-01 false Definitions. 551.161 Section 551.161 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Smoking/No Smoking Areas § 551.161 Definitions. For purpose of this subpart, smoking is defined as...

28 CFR 551.113 - Counseling.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Counseling. 551.113 Section 551.113... Pretrial Inmates § 551.113 Counseling. (a) When consistent with institution security and good order, pretrial inmates may be allowed the opportunity to receive counseling services with convicted inmates. (b...

28 CFR 551.113 - Counseling.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 28 Judicial Administration 2 2014-07-01 2014-07-01 false Counseling. 551.113 Section 551.113... Pretrial Inmates § 551.113 Counseling. (a) When consistent with institution security and good order, pretrial inmates may be allowed the opportunity to receive counseling services with convicted inmates. (b...

28 CFR 551.113 - Counseling.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 28 Judicial Administration 2 2012-07-01 2012-07-01 false Counseling. 551.113 Section 551.113... Pretrial Inmates § 551.113 Counseling. (a) When consistent with institution security and good order, pretrial inmates may be allowed the opportunity to receive counseling services with convicted inmates. (b...

28 CFR 551.113 - Counseling.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 28 Judicial Administration 2 2013-07-01 2013-07-01 false Counseling. 551.113 Section 551.113... Pretrial Inmates § 551.113 Counseling. (a) When consistent with institution security and good order, pretrial inmates may be allowed the opportunity to receive counseling services with convicted inmates. (b...

28 CFR 551.113 - Counseling.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 28 Judicial Administration 2 2011-07-01 2011-07-01 false Counseling. 551.113 Section 551.113... Pretrial Inmates § 551.113 Counseling. (a) When consistent with institution security and good order, pretrial inmates may be allowed the opportunity to receive counseling services with convicted inmates. (b...

28 CFR 551.22 - Pregnancy.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 28 Judicial Administration 2 2013-07-01 2013-07-01 false Pregnancy. 551.22 Section 551.22 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Birth Control, Pregnancy, Child Placement, and Abortion § 551.22 Pregnancy. (a) The Warden shall ensure that each pregnant...

28 CFR 551.22 - Pregnancy.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 28 Judicial Administration 2 2012-07-01 2012-07-01 false Pregnancy. 551.22 Section 551.22 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Birth Control, Pregnancy, Child Placement, and Abortion § 551.22 Pregnancy. (a) The Warden shall ensure that each pregnant...

28 CFR 551.22 - Pregnancy.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 28 Judicial Administration 2 2014-07-01 2014-07-01 false Pregnancy. 551.22 Section 551.22 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Birth Control, Pregnancy, Child Placement, and Abortion § 551.22 Pregnancy. (a) The Warden shall ensure that each pregnant...

28 CFR 551.22 - Pregnancy.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 28 Judicial Administration 2 2011-07-01 2011-07-01 false Pregnancy. 551.22 Section 551.22 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Birth Control, Pregnancy, Child Placement, and Abortion § 551.22 Pregnancy. (a) The Warden shall ensure that each pregnant...

28 CFR 551.22 - Pregnancy.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Pregnancy. 551.22 Section 551.22 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Birth Control, Pregnancy, Child Placement, and Abortion § 551.22 Pregnancy. (a) The Warden shall ensure that each pregnant...

31 CFR 551.303 - Entity.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 31 Money and Finance:Treasury 3 2011-07-01 2011-07-01 false Entity. 551.303 Section 551.303 Money... CONTROL, DEPARTMENT OF THE TREASURY SOMALIA SANCTIONS REGULATIONS General Definitions § 551.303 Entity. The term entity means a partnership, association, trust, joint venture, corporation, group, subgroup...

31 CFR 551.303 - Entity.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Entity. 551.303 Section 551.303 Money... CONTROL, DEPARTMENT OF THE TREASURY SOMALIA SANCTIONS REGULATIONS General Definitions § 551.303 Entity. The term entity means a partnership, association, trust, joint venture, corporation, group, subgroup...

5 CFR 551.103 - Coverage.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Coverage. 551.103 Section 551.103 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS PAY ADMINISTRATION UNDER THE FAIR LABOR STANDARDS ACT General Provisions § 551.103 Coverage. (a) Covered. Any employee of an agency...

5 CFR 551.103 - Coverage.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 5 Administrative Personnel 1 2014-01-01 2014-01-01 false Coverage. 551.103 Section 551.103 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS PAY ADMINISTRATION UNDER THE FAIR LABOR STANDARDS ACT General Provisions § 551.103 Coverage. (a) Covered. Any employee of an agency...

5 CFR 551.103 - Coverage.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 5 Administrative Personnel 1 2011-01-01 2011-01-01 false Coverage. 551.103 Section 551.103 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS PAY ADMINISTRATION UNDER THE FAIR LABOR STANDARDS ACT General Provisions § 551.103 Coverage. (a) Covered. Any employee of an agency...

5 CFR 551.103 - Coverage.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 5 Administrative Personnel 1 2013-01-01 2013-01-01 false Coverage. 551.103 Section 551.103 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS PAY ADMINISTRATION UNDER THE FAIR LABOR STANDARDS ACT General Provisions § 551.103 Coverage. (a) Covered. Any employee of an agency...

5 CFR 551.103 - Coverage.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 5 Administrative Personnel 1 2012-01-01 2012-01-01 false Coverage. 551.103 Section 551.103 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS PAY ADMINISTRATION UNDER THE FAIR LABOR STANDARDS ACT General Provisions § 551.103 Coverage. (a) Covered. Any employee of an agency...

28 CFR 551.36 - Funding.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 28 Judicial Administration 2 2012-07-01 2012-07-01 false Funding. 551.36 Section 551.36 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Inmate Organizations § 551.36 Funding. The Bureau of Prisons may fund approved activities of inmate organizations or...

28 CFR 551.36 - Funding.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 28 Judicial Administration 2 2011-07-01 2011-07-01 false Funding. 551.36 Section 551.36 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Inmate Organizations § 551.36 Funding. The Bureau of Prisons may fund approved activities of inmate organizations or...

28 CFR 551.36 - Funding.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Funding. 551.36 Section 551.36 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Inmate Organizations § 551.36 Funding. The Bureau of Prisons may fund approved activities of inmate organizations or...

28 CFR 551.36 - Funding.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 28 Judicial Administration 2 2013-07-01 2013-07-01 false Funding. 551.36 Section 551.36 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Inmate Organizations § 551.36 Funding. The Bureau of Prisons may fund approved activities of inmate organizations or...

28 CFR 551.36 - Funding.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 28 Judicial Administration 2 2014-07-01 2014-07-01 false Funding. 551.36 Section 551.36 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Inmate Organizations § 551.36 Funding. The Bureau of Prisons may fund approved activities of inmate organizations or...

31 CFR 551.801 - [Reserved

Code of Federal Regulations, 2010 CFR

2010-07-01

... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false [Reserved] 551.801 Section 551.801 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF FOREIGN ASSETS CONTROL, DEPARTMENT OF THE TREASURY SOMALIA SANCTIONS REGULATIONS Procedures § 551.801 [Reserved] ...

31 CFR 551.308 - Transfer.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Transfer. 551.308 Section 551.308 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF FOREIGN ASSETS CONTROL, DEPARTMENT OF THE TREASURY SOMALIA SANCTIONS REGULATIONS General Definitions § 551.308...

31 CFR 551.304 - Interest.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Interest. 551.304 Section 551.304 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF FOREIGN ASSETS CONTROL, DEPARTMENT OF THE TREASURY SOMALIA SANCTIONS REGULATIONS General Definitions § 551.304...

31 CFR 551.401 - [Reserved

Code of Federal Regulations, 2010 CFR

2010-07-01

... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false [Reserved] 551.401 Section 551.401 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF FOREIGN ASSETS CONTROL, DEPARTMENT OF THE TREASURY SOMALIA SANCTIONS REGULATIONS Interpretations § 551.401...

28 CFR 551.3 - Hairpieces.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 28 Judicial Administration 2 2011-07-01 2011-07-01 false Hairpieces. 551.3 Section 551.3 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Grooming § 551.3 Hairpieces. Inmates may not wear wigs or artificial hairpieces, unless medical authorization to do so is...

28 CFR 551.3 - Hairpieces.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Hairpieces. 551.3 Section 551.3 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Grooming § 551.3 Hairpieces. Inmates may not wear wigs or artificial hairpieces, unless medical authorization to do so is...

28 CFR 551.1 - Policy.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 28 Judicial Administration 2 2011-07-01 2011-07-01 false Policy. 551.1 Section 551.1 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Grooming § 551.1... personal cleanliness and dress in keeping with standards of good grooming and the security, good order, and...

28 CFR 551.15 - Furloughs.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Furloughs. 551.15 Section 551.15 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Marriages of Inmates § 551.15 Furloughs. An inmate whose request to marry is approved, and who also meets the Bureau's...

31 CFR 551.306 - Person.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Person. 551.306 Section 551.306 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF FOREIGN ASSETS CONTROL, DEPARTMENT OF THE TREASURY SOMALIA SANCTIONS REGULATIONS General Definitions § 551.306 Person...

Combination of N149S and D171G mutations in Aeromonas caviae polyhydroxyalkanoate synthase and impact on polyhydroxyalkanoate biosynthesis.

PubMed

Tsuge, Takeharu; Watanabe, Shinko; Shimada, Daisuke; Abe, Hideki; Doi, Yoshiharu; Taguchi, Seiichi

2007-12-01

Aeromonas caviae polyhydroxyalkanoate synthase (PhaC(Ac)) is an important biocatalyst for the synthesis of practically useful two-component polyhydroxyalkanoate copolymer, poly[(R)-3-hydroxybutyrate-co-(R)-3-hydroxyhexanoate] [P(3HB-co-3HHx)]. In a previous study, two PhaC(Ac) mutants that have a single amino acid substitution of either asparagine 149 by serine (N149S) or aspartate 171 by glycine (D171G) were isolated as higher active enzymes by means of evolutionary engineering. In this study, the synergistic effects of N149S and D171G double mutation (NSDG) in PhaC(Ac) on polyhydroxyalkanoate biosynthesis were investigated in recombinant Ralstonia eutropha. The PhaC(Ac) NSDG mutant showed enhanced incorporation of longer 3-hydroxyalkanoate (3HA) units into the polyhydroxyalkanoate copolymer from octanoate (3HA fraction: 18.5 mol%) and soybean oil (5.4 mol%) as a carbon source. Besides, the NSDG mutant synthesized P(3HB) homopolymer with a very high molecular weight (M(w)=368 x 10(4)) when fructose was used as a carbon source. Thus, a combination of the beneficial mutations synergistically altered enzymatic properties, leading to synthesis of a polyhydroxyalkanoate copolymer with enhanced 3HA fraction and increased molecular weight.

28 CFR 551.1 - Policy.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 28 Judicial Administration 2 2014-07-01 2014-07-01 false Policy. 551.1 Section 551.1 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Grooming § 551.1 Policy. The Bureau of Prisons permits an inmate to select the hair style of personal choice, and expects...

28 CFR 551.1 - Policy.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 28 Judicial Administration 2 2013-07-01 2013-07-01 false Policy. 551.1 Section 551.1 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Grooming § 551.1 Policy. The Bureau of Prisons permits an inmate to select the hair style of personal choice, and expects...

28 CFR 551.1 - Policy.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 28 Judicial Administration 2 2012-07-01 2012-07-01 false Policy. 551.1 Section 551.1 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Grooming § 551.1 Policy. The Bureau of Prisons permits an inmate to select the hair style of personal choice, and expects...

28 CFR 551.1 - Policy.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Policy. 551.1 Section 551.1 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Grooming § 551.1 Policy. The Bureau of Prisons permits an inmate to select the hair style of personal choice, and expects...

Novel mutations in the homogentisate 1,2 dioxygenase gene identified in Jordanian patients with alkaptonuria.

PubMed

Al-sbou, Mohammed

2012-06-01

This study was conducted to identify mutations in the homogentisate 1,2 dioxygenase gene (HGD) in alkaptonuria patients among Jordanian population. Blood samples were collected from four alkaptonuria patients, four carriers, and two healthy volunteers. DNA was isolated from peripheral blood. All 14 exons of the HGD gene were amplified using the polymerase chain reaction (PCR) technique. The PCR products were then purified and analyzed by sequencing. Five mutations were identified in our samples. Four of them were novel C1273A, T1046G, 551-552insG, T533G and had not been previously reported, and one mutation T847C has been described before. The types of mutations identified were two missense mutations, one splice site mutation, one frameshift mutation, and one polymorphism. We present the first molecular study of the HGD gene in Jordanian alkaptonuria patients. This study provides valuable information about the molecular basis of alkaptonuria in Jordanian population.

The energy and work of a ligand-gated ion channel

PubMed Central

Auerbach, Anthony

2015-01-01

Ligand-gated ion channels are allosteric membrane proteins that isomerize between C(losed) and O(pen) conformations. A difference in affinity for ligands in the two shapes influences the C↔O ‘gating’ equilibrium constant. The energies associated with adult-type mouse neuromuscular nicotinic acetylcholine receptor-channel (AChR) gating have been measured by using single-channel electrophysiology. Without ligands the free energy, enthalpy and entropy of gating are ΔG0=+8.4, ΔH0=+10.9 and ΔS0=+2.4 kcal/mol (−100 mV, 23 °C). Many mutations throughout the protein change ΔG0, including natural ones that cause disease. Agonists and most mutations change approximately independently the ground state energy difference, so it is possible to forecast and engineer AChR responses simply by combining perturbations. The free energy of the low↔high affinity change for the neurotransmitter at each of two functionally-equivalent binding sites is ΔGBACh=−5.1 kcal/mol. ΔGBACh is set mainly by interactions of ACh with just three binding site aromatic groups. For a series of structurally-related agonists there is a correlation between the energies of low- and high-affinity binding, which implies that gating commences with the formation of the low affinity complex. Brief, intermediate states in binding and gating have been detected. Several proposals for the nature of the gating transition state energy landscape and the isomerization mechanism are discussed. PMID:23357172

A novel D458V mutation in the SANS PDZ binding motif causes atypical Usher syndrome.

PubMed

Kalay, E; de Brouwer, A P M; Caylan, R; Nabuurs, S B; Wollnik, B; Karaguzel, A; Heister, J G A M; Erdol, H; Cremers, F P M; Cremers, C W R J; Brunner, H G; Kremer, H

2005-12-01

Homozygosity mapping and linkage analysis in a Turkish family with autosomal recessive prelingual sensorineural hearing loss revealed a 15-cM critical region at 17q25.1-25.3 flanked by the polymorphic markers D17S1807 and D17S1806. The maximum two-point lod score was 4.07 at theta=0.0 for the marker D17S801. The linkage interval contains the Usher syndrome 1G gene (USH1G) that is mutated in patients with Usher syndrome (USH) type 1g and encodes the SANS protein. Mutation analysis of USH1G led to the identification of a homozygous missense mutation D458V at the -3 position of the PDZ binding motif of SANS. This mutation was also present homozygously in one out of 64 additional families from Turkey with autosomal recessive nonsyndromic hearing loss and heterozygously in one out of 498 control chromosomes. By molecular modeling, we provide evidence that this mutation impairs the interaction of SANS with harmonin. Ophthalmologic examination and vestibular evaluation of patients from both families revealed mild retinitis pigmentosa and normal vestibular function. These results suggest that these patients suffer from atypical USH.

39 CFR 551.6 - Pricing.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 39 Postal Service 1 2010-07-01 2010-07-01 false Pricing. 551.6 Section 551.6 Postal Service UNITED STATES POSTAL SERVICE POSTAGE PROGRAMS SEMIPOSTAL STAMP PROGRAM § 551.6 Pricing. (a) The Semipostal Authorization Act, as amended by Public Law 107-67, section 652, 115 Stat. 514 (2001), prescribes that the price...

Disease-causing mutations C277R and C277Y modify gating of human ClC-1 chloride channels in myotonia congenita

PubMed Central

Weinberger, Sebastian; Wojciechowski, Daniel; Sternberg, Damien; Lehmann-Horn, Frank; Jurkat-Rott, Karin; Becher, Toni; Begemann, Birgit; Fahlke, Christoph; Fischer, Martin

2012-01-01

Myotonia congenita is a genetic condition that is caused by mutations in the muscle chloride channel gene CLCN1 and characterized by delayed muscle relaxation and muscle stiffness. We here investigate the functional consequences of two novel disease-causing missense mutations, C277R and C277Y, using heterologous expression in HEK293T cells and patch clamp recording. Both mutations reduce macroscopic anion currents in transfected cells. Since hClC-1 is a double-barrelled anion channel, this reduction in current amplitude might be caused by altered gating of individual protopores or of joint openings and closing of both protopores. We used non-stationary noise analysis and single channel recordings to separate the mutants’ effects on individual and common gating processes. We found that C277Y inverts the voltage dependence and reduces the open probabilities of protopore and common gates resulting in decreases of absolute open probabilities of homodimeric channels to values below 3%. In heterodimeric channels, C277R and C277Y also reduce open probabilities and shift the common gate activation curve towards positive potentials. Moreover, C277Y modifies pore properties of hClC-1. It reduces single protopore current amplitudes to about two-thirds of wild-type values, and inverts the anion permeability sequence to I− = NO3− > Br− > Cl−. Our findings predict a dramatic reduction of the muscle fibre resting chloride conductance and thus fully explain the disease-causing effects of mutations C277R and C277Y. Moreover, they provide additional insights into the function of C277, a residue recently implicated in common gating of ClC channels. PMID:22641783

Majority logic gate for 3D magnetic computing.

PubMed

Eichwald, Irina; Breitkreutz, Stephan; Ziemys, Grazvydas; Csaba, György; Porod, Wolfgang; Becherer, Markus

2014-08-22

For decades now, microelectronic circuits have been exclusively built from transistors. An alternative way is to use nano-scaled magnets for the realization of digital circuits. This technology, known as nanomagnetic logic (NML), may offer significant improvements in terms of power consumption and integration densities. Further advantages of NML are: non-volatility, radiation hardness, and operation at room temperature. Recent research focuses on the three-dimensional (3D) integration of nanomagnets. Here we show, for the first time, a 3D programmable magnetic logic gate. Its computing operation is based on physically field-interacting nanometer-scaled magnets arranged in a 3D manner. The magnets possess a bistable magnetization state representing the Boolean logic states '0' and '1.' Magneto-optical and magnetic force microscopy measurements prove the correct operation of the gate over many computing cycles. Furthermore, micromagnetic simulations confirm the correct functionality of the gate even for a size in the nanometer-domain. The presented device demonstrates the potential of NML for three-dimensional digital computing, enabling the highest integration densities.

Characterization of a mutated Geobacillus stearothermophilus L-arabinose isomerase that increases the production rate of D-tagatose.

PubMed

Kim, H-J; Kim, J-H; Oh, H-J; Oh, D-K

2006-07-01

Characterization of a mutated Geobacillus stearothermophilus L-arabinose isomerase used to increase the production rate of D-tagatose. A mutated gene was obtained by an error-prone polymerase chain reaction using L-arabinose isomerase gene from G. stearothermophilus as a template and the gene was expressed in Escherichia coli. The expressed mutated L-arabinose isomerase exhibited the change of three amino acids (Met322-->Val, Ser393-->Thr, and Val408-->Ala), compared with the wild-type enzyme and was then purified to homogeneity. The mutated enzyme had a maximum galactose isomerization activity at pH 8.0, 65 degrees C, and 1.0 mM Co2+, while the wild-type enzyme had a maximum activity at pH 8.0, 60 degrees C, and 1.0-mM Mn2+. The mutated L-arabinose isomerase exhibited increases in D-galactose isomerization activity, optimum temperature, catalytic efficiency (kcat/Km) for D-galactose, and the production rate of D-tagatose from D-galactose. The mutated L-arabinose isomerase from G. stearothermophilus is valuable for the commercial production of D-tagatose. This work contributes knowledge on the characterization of a mutated L-arabinose isomerase, and allows an increased production rate for D-tagatose from D-galactose using the mutated enzyme.

Multi-country Survey Revealed Prevalent and Novel F1534S Mutation in Voltage-Gated Sodium Channel (VGSC) Gene in Aedes albopictus.

PubMed

Xu, Jiabao; Bonizzoni, Mariangela; Zhong, Daibin; Zhou, Guofa; Cai, Songwu; Li, Yiji; Wang, Xiaoming; Lo, Eugenia; Lee, Rebecca; Sheen, Roger; Duan, Jinhua; Yan, Guiyun; Chen, Xiao-Guang

2016-05-01

Aedes albopictus is an important dengue vector because of its aggressive biting behavior and rapid spread out of its native home range in Southeast Asia. Pyrethroids are widely used for adult mosquito control, and resistance to pyrethroids should be carefully monitored because vector control is the only effective method currently available to prevent dengue transmission. The voltage-gated sodium channel gene is the target site of pyrethroids, and mutations in this gene cause knockdown resistance (kdr). Previous studies reported various mutations in the voltage-gated sodium channel (VGSC) gene, but the spatial distribution of kdr mutations in Ae. albopictus has not been systematically examined, and the association between kdr mutation and phenotypic resistance has not been established. A total of 597 Ae. albopictus individuals from 12 populations across Asia, Africa, America and Europe were examined for mutations in the voltage-gated sodium channel gene. Three domains for a total of 1,107 bp were sequenced for every individual. Two populations from southern China were examined for pyrethroid resistance using the World Health Organization standard tube bioassay, and the association between kdr mutations and phenotypic resistance was tested. A total of 29 synonymous mutations were found across domain II, III and IV of the VGSC gene. Non-synonymous mutations in two codons of the VGSC gene were detected in 5 populations from 4 countries. A novel mutation at 1532 codon (I1532T) was found in Rome, Italy with a frequency of 19.7%. The second novel mutation at codon 1534 (F1534S) was detected in southern China and Florida, USA with a frequency ranging from 9.5-22.6%. The WHO insecticide susceptibility bioassay found 90.1% and 96.1% mortality in the two populations from southern China, suggesting resistance and probable resistance. Positive association between kdr mutations with deltamethrin resistance was established in these two populations. Two novel kdr mutations, I1532T

Syncytial Mutations Do Not Impair the Specificity of Entry and Spread of a Glycoprotein D Receptor-Retargeted Herpes Simplex Virus

PubMed Central

Okubo, Yu; Wakata, Aika; Suzuki, Takuma; Shibata, Tomoko; Ikeda, Hitomi; Yamaguchi, Miki; Cohen, Justus B.; Glorioso, Joseph C.; Tagaya, Mitsuo; Hamada, Hirofumi; Tahara, Hideaki

2016-01-01

ABSTRACT Membrane fusion, which is the key process for both initial cell entry and subsequent lateral spread of herpes simplex virus (HSV), requires the four envelope glycoproteins gB, gD, gH, and gL. Syncytial mutations, predominantly mapped to the gB and gK genes, confer hyperfusogenicity on HSV and cause multinucleated giant cells, termed syncytia. Here we asked whether interaction of gD with a cognate entry receptor remains indispensable for initiating membrane fusion of syncytial strains. To address this question, we took advantage of mutant viruses whose viral entry into cells relies on the uniquely specific interaction of an engineered gD with epidermal growth factor receptor (EGFR). We introduced selected syncytial mutations into gB and/or gK of the EGFR-retargeted HSV and found that these mutations, especially when combined, enabled formation of extensive syncytia by human cancer cell lines that express the target receptor; these syncytia were substantially larger than the plaques formed by the parental retargeted HSV strain. We assessed the EGFR dependence of entry and spread separately by using direct entry and infectious center assays, respectively, and we found that the syncytial mutations did not override the receptor specificity of the retargeted viruses at either stage. We discuss the implications of these results for the development of more effective targeted oncolytic HSV vectors. IMPORTANCE Herpes simplex virus (HSV) is investigated not only as a human pathogen but also as a promising agent for oncolytic virotherapy. We previously showed that both the initial entry and subsequent lateral spread of HSV can be retargeted to cells expressing tumor-associated antigens by single-chain antibodies fused to a receptor-binding-deficient envelope glycoprotein D (gD). Here we introduced syncytial mutations into the gB and/or gK gene of gD-retargeted HSVs to determine whether viral tropism remained dependent on the interaction of gD with the target receptor

Microarray-based mutation detection and phenotypic characterization in Korean patients with retinitis pigmentosa

PubMed Central

Kim, Cinoo; Kim, Kwang Joong; Bok, Jeong; Lee, Eun-Ju; Kim, Dong-Joon; Oh, Ji Hee; Park, Sung Pyo; Shin, Joo Young; Lee, Jong-Young

2012-01-01

Purpose To evaluate microarray-based genotyping technology for the detection of mutations responsible for retinitis pigmentosa (RP) and to perform phenotypic characterization of patients with pathogenic mutations. Methods DNA from 336 patients with RP and 360 controls was analyzed using the GoldenGate assay with microbeads containing 95 previously reported disease-associated mutations from 28 RP genes. Mutations identified by microarray-based genotyping were confirmed by direct sequencing. Segregation analysis and phenotypic characterization were performed in patients with mutations. The disease severity was assessed by visual acuity, electroretinography, optical coherence tomography, and kinetic perimetry. Results Ten RP-related mutations of five RP genes (PRP3 pre-mRNA processing factor 3 homolog [PRPF3], rhodopsin [RHO], phosphodiesterase 6B [PDE6B], peripherin 2 [PRPH2], and retinitis pigmentosa 1 [RP1]) were identified in 26 of the 336 patients (7.7%) and in six of the 360 controls (1.7%). The p.H557Y mutation in PDE6B, which was homozygous in four patients and heterozygous in nine patients, was the most frequent mutation (2.5%). Mutation segregation was assessed in four families. Among the patients with missense mutations, the most severe phenotype occurred in patients with p.D984G in RP1; less severe phenotypes occurred in patients with p.R135W in RHO; a relatively moderate phenotype occurred in patients with p.T494M in PRPF3, p.H557Y in PDE6B, or p.W316G in PRPH2; and a mild phenotype was seen in a patient with p.D190N in RHO. Conclusions The results reveal that the GoldenGate assay may not be an efficient method for molecular diagnosis in RP patients with rare mutations, although it has proven to be reliable and efficient for high-throughput genotyping of single-nucleotide polymorphisms. The clinical features varied according to the mutations. Continuous effort to identify novel RP genes and mutations in a population is needed to improve the efficiency and

Novel PSEN1 G209A mutation in early-onset Alzheimer dementia supported by structural prediction.

PubMed

An, Seong Soo A; Bagyinszky, Eva; Kim, Hye Ryoun; Seok, Ju-Won; Shin, Hae-Won; Bae, SeunOh; Kim, SangYun; Youn, Young Chul

2016-05-20

Three main genes are described as causative genes for early-onset Alzheimer dementia (EOAD): APP, PSEN1 and PSEN2. We describe a woman with EOAD had a novel PSEN1 mutation. A 54-year-old right-handed woman presented 12-year history of progressive memory decline. She was clinically diagnosed as familial Alzheimer's disease due to a PSEN1 mutation. One of two daughters also has the same mutation, G209A in the TM-IV of PS1 protein. Her mother had unspecified dementia that began at the age of 40s. PolyPhen2 and SIFT prediction suggested that G209A might be a damaging variant with high scores. 3D modeling revealed that G209A exchange could result significant changes in the PS1 protein. We report a case of EOAD having probable novel PSEN1 (G209A) mutation verified with structural prediction.

Effect of the G375C and G346E achondroplasia mutations on FGFR3 activation.

PubMed

He, Lijuan; Serrano, Christopher; Niphadkar, Nitish; Shobnam, Nadia; Hristova, Kalina

2012-01-01

Two mutations in FGFR3, G380R and G375C are known to cause achondroplasia, the most common form of human dwarfism. The G380R mutation accounts for 98% of the achondroplasia cases, and thus has been studied extensively. Here we study the effect of the G375C mutation on the phosphorylation and the cross-linking propensity of full-length FGFR3 in HEK 293 cells, and we compare the results to previously published results for the G380R mutant. We observe identical behavior of the two achondroplasia mutants in these experiments, a finding which supports a direct link between the severity of dwarfism phenotypes and the level and mechanism of FGFR3 over-activation. The mutations do not increase the cross-linking propensity of FGFR3, contrary to previous expectations that the achondroplasia mutations stabilize the FGFR3 dimers. Instead, the phosphorylation efficiency within un-liganded FGFR3 dimers is increased, and this increase is likely the underlying cause for pathogenesis in achondroplasia. We further investigate the G346E mutation, which has been reported to cause achondroplasia in one case. We find that this mutation does not increase FGFR3 phosphorylation and decreases FGFR3 cross-linking propensity, a finding which raises questions whether this mutation is indeed a genetic cause for human dwarfism.

Effect of the G375C and G346E Achondroplasia Mutations on FGFR3 Activation

PubMed Central

He, Lijuan; Serrano, Christopher; Niphadkar, Nitish; Shobnam, Nadia; Hristova, Kalina

2012-01-01

Two mutations in FGFR3, G380R and G375C are known to cause achondroplasia, the most common form of human dwarfism. The G380R mutation accounts for 98% of the achondroplasia cases, and thus has been studied extensively. Here we study the effect of the G375C mutation on the phosphorylation and the cross-linking propensity of full-length FGFR3 in HEK 293 cells, and we compare the results to previously published results for the G380R mutant. We observe identical behavior of the two achondroplasia mutants in these experiments, a finding which supports a direct link between the severity of dwarfism phenotypes and the level and mechanism of FGFR3 over-activation. The mutations do not increase the cross-linking propensity of FGFR3, contrary to previous expectations that the achondroplasia mutations stabilize the FGFR3 dimers. Instead, the phosphorylation efficiency within un-liganded FGFR3 dimers is increased, and this increase is likely the underlying cause for pathogenesis in achondroplasia. We further investigate the G346E mutation, which has been reported to cause achondroplasia in one case. We find that this mutation does not increase FGFR3 phosphorylation and decreases FGFR3 cross-linking propensity, a finding which raises questions whether this mutation is indeed a genetic cause for human dwarfism. PMID:22529939

Impact of the F508del mutation on ovine CFTR, a Cl− channel with enhanced conductance and ATP-dependent gating

PubMed Central

Cai, Zhiwei; Palmai-Pallag, Timea; Khuituan, Pissared; Mutolo, Michael J; Boinot, Clément; Liu, Beihui; Scott-Ward, Toby S; Callebaut, Isabelle; Harris, Ann; Sheppard, David N

2015-01-01

Cross-species comparative studies are a powerful approach to understanding the epithelial Cl− channel cystic fibrosis transmembrane conductance regulator (CFTR), which is defective in the genetic disease cystic fibrosis (CF). Here, we investigate the single-channel behaviour of ovine CFTR and the impact of the most common CF mutation, F508del-CFTR, using excised inside-out membrane patches from transiently transfected CHO cells. Like human CFTR, ovine CFTR formed a weakly inwardly rectifying Cl− channel regulated by PKA-dependent phosphorylation, inhibited by the open-channel blocker glibenclamide. However, for three reasons, ovine CFTR was noticeably more active than human CFTR. First, single-channel conductance was increased. Second, open probability was augmented because the frequency and duration of channel openings were increased. Third, with enhanced affinity and efficacy, ATP more strongly stimulated ovine CFTR channel gating. Consistent with these data, the CFTR modulator phloxine B failed to potentiate ovine CFTR Cl− currents. Similar to its impact on human CFTR, the F508del mutation caused a temperature-sensitive folding defect, which disrupted ovine CFTR protein processing and reduced membrane stability. However, the F508del mutation had reduced impact on ovine CFTR channel gating in contrast to its marked effects on human CFTR. We conclude that ovine CFTR forms a regulated Cl− channel with enhanced conductance and ATP-dependent channel gating. This phylogenetic analysis of CFTR structure and function demonstrates that subtle changes in structure have pronounced effects on channel function and the consequences of the CF mutation F508del. Key points Malfunction of the cystic fibrosis transmembrane conductance regulator (CFTR), a gated pathway for chloride movement, causes the common life-shortening genetic disease cystic fibrosis (CF). Towards the development of a sheep model of CF, we have investigated the function of sheep CFTR. We found that

Magnetic gating of a 2D topological insulator

NASA Astrophysics Data System (ADS)

Dang, Xiaoqian; Burton, J. D.; Tsymbal, Evgeny Y.

2016-09-01

Deterministic control of transport properties through manipulation of spin states is one of the paradigms of spintronics. Topological insulators offer a new playground for exploring interesting spin-dependent phenomena. Here, we consider a ferromagnetic ‘gate’ representing a magnetic adatom coupled to the topologically protected edge state of a two-dimensional (2D) topological insulator to modulate the electron transmission of the edge state. Due to the locked spin and wave vector of the transport electrons the transmission across the magnetic gate depends on the mutual orientation of the adatom magnetic moment and the current. If the Fermi energy matches an exchange-split bound state of the adatom, the electron transmission can be blocked due to the full back scattering of the incident wave. This antiresonance behavior is controlled by the adatom magnetic moment orientation so that the transmission of the edge state can be changed from 1 to 0. Expanding this consideration to a ferromagnetic gate representing a 1D chain of atoms shows a possibility to control the spin-dependent current of a strip of a 2D topological insulator by magnetization orientation of the ferromagnetic gate.

G6PDdb, an integrated database of glucose-6-phosphate dehydrogenase (G6PD) mutations.

PubMed

Kwok, Colin J; Martin, Andrew C R; Au, Shannon W N; Lam, Veronica M S

2002-03-01

G6PDdb (http://www.rubic.rdg.ac.uk/g6pd/ or http://www.bioinf.org.uk/g6pd/) is a newly created web-accessible locus-specific mutation database for the human Glucose-6-phosphate dehydrogenase (G6PD) gene. The relational database integrates up-to-date mutational and structural data from various databanks (GenBank, Protein Data Bank, etc.) with biochemically characterized variants and their associated phenotypes obtained from published literature and the Favism website. An automated analysis of the mutations likely to have a significant impact on the structure of the protein has been performed using a recently developed procedure. The database may be queried online and the full results of the analysis of the structural impact of mutations are available. The web page provides a form for submitting additional mutation data and is linked to resources such as the Favism website, OMIM, HGMD, HGVBASE, and the PDB. This database provides insights into the molecular aspects and clinical significance of G6PD deficiency for researchers and clinicians and the web page functions as a knowledge base relevant to the understanding of G6PD deficiency and its management. Copyright 2002 Wiley-Liss, Inc.

28 CFR 551.81 - Manuscript preparation.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 28 Judicial Administration 2 2013-07-01 2013-07-01 false Manuscript preparation. 551.81 Section 551.81 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Inmate Manuscripts § 551.81 Manuscript preparation. An inmate may prepare a manuscript for private...

28 CFR 551.81 - Manuscript preparation.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 28 Judicial Administration 2 2012-07-01 2012-07-01 false Manuscript preparation. 551.81 Section 551.81 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Inmate Manuscripts § 551.81 Manuscript preparation. An inmate may prepare a manuscript for private...

28 CFR 551.81 - Manuscript preparation.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Manuscript preparation. 551.81 Section 551.81 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Inmate Manuscripts § 551.81 Manuscript preparation. An inmate may prepare a manuscript for private...

28 CFR 551.81 - Manuscript preparation.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 28 Judicial Administration 2 2011-07-01 2011-07-01 false Manuscript preparation. 551.81 Section 551.81 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Inmate Manuscripts § 551.81 Manuscript preparation. An inmate may prepare a manuscript for private...

28 CFR 551.81 - Manuscript preparation.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 28 Judicial Administration 2 2014-07-01 2014-07-01 false Manuscript preparation. 551.81 Section 551.81 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Inmate Manuscripts § 551.81 Manuscript preparation. An inmate may prepare a manuscript for private...

A Cyclic Nucleotide-Gated Channel Mutation Associated with Canine Daylight Blindness Provides Insight into a Role for the S2 Segment Tri-Asp motif in Channel Biogenesis

PubMed Central

Tanaka, Naoto; Delemotte, Lucie; Klein, Michael L.; Komáromy, András M.; Tanaka, Jacqueline C.

2014-01-01

Cone cyclic nucleotide-gated channels are tetramers formed by CNGA3 and CNGB3 subunits; CNGA3 subunits function as homotetrameric channels but CNGB3 exhibits channel function only when co-expressed with CNGA3. An aspartatic acid (Asp) to asparagine (Asn) missense mutation at position 262 in the canine CNGB3 (D262N) subunit results in loss of cone function (daylight blindness), suggesting an important role for this aspartic acid residue in channel biogenesis and/or function. Asp 262 is located in a conserved region of the second transmembrane segment containing three Asp residues designated the Tri-Asp motif. This motif is conserved in all CNG channels. Here we examine mutations in canine CNGA3 homomeric channels using a combination of experimental and computational approaches. Mutations of these conserved Asp residues result in the absence of nucleotide-activated currents in heterologous expression. A fluorescent tag on CNGA3 shows mislocalization of mutant channels. Co-expressing CNGB3 Tri-Asp mutants with wild type CNGA3 results in some functional channels, however, their electrophysiological characterization matches the properties of homomeric CNGA3 channels. This failure to record heteromeric currents suggests that Asp/Asn mutations affect heteromeric subunit assembly. A homology model of S1–S6 of the CNGA3 channel was generated and relaxed in a membrane using molecular dynamics simulations. The model predicts that the Tri-Asp motif is involved in non-specific salt bridge pairings with positive residues of S3/S4. We propose that the D262N mutation in dogs with CNGB3-day blindness results in the loss of these inter-helical interactions altering the electrostatic equilibrium within in the S1–S4 bundle. Because residues analogous to Tri-Asp in the voltage-gated Shaker potassium channel family were implicated in monomer folding, we hypothesize that destabilizing these electrostatic interactions impairs the monomer folding state in D262N mutant CNG channels

28 CFR 551.6 - Personal hygiene.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 28 Judicial Administration 2 2011-07-01 2011-07-01 false Personal hygiene. 551.6 Section 551.6 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Grooming § 551.6 Personal hygiene. The Warden shall make available to an inmate those articles necessary...

28 CFR 551.6 - Personal hygiene.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Personal hygiene. 551.6 Section 551.6 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Grooming § 551.6 Personal hygiene. The Warden shall make available to an inmate those articles necessary...

28 CFR 551.108 - Performance pay.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Performance pay. 551.108 Section 551.108 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Pretrial Inmates § 551.108 Performance pay. The Warden may approve a pretrial inmate for performance pay...

28 CFR 551.108 - Performance pay.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 28 Judicial Administration 2 2014-07-01 2014-07-01 false Performance pay. 551.108 Section 551.108 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Pretrial Inmates § 551.108 Performance pay. The Warden may approve a pretrial inmate for performance pay...

28 CFR 551.108 - Performance pay.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 28 Judicial Administration 2 2012-07-01 2012-07-01 false Performance pay. 551.108 Section 551.108 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Pretrial Inmates § 551.108 Performance pay. The Warden may approve a pretrial inmate for performance pay...

31 CFR 551.405 - Setoffs prohibited.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Setoffs prohibited. 551.405 Section 551.405 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF FOREIGN ASSETS CONTROL, DEPARTMENT OF THE TREASURY SOMALIA SANCTIONS REGULATIONS Interpretations § 551.405...

31 CFR 551.302 - Effective date.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Effective date. 551.302 Section 551.302 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF FOREIGN ASSETS CONTROL, DEPARTMENT OF THE TREASURY SOMALIA SANCTIONS REGULATIONS General Definitions § 551...

5 CFR 551.401 - Basic principles.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Basic principles. 551.401 Section 551.401 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS PAY ADMINISTRATION UNDER THE FAIR LABOR STANDARDS ACT Hours of Work General Provisions § 551.401 Basic principles. (a) All time...

28 CFR 551.21 - Birth control.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 28 Judicial Administration 2 2011-07-01 2011-07-01 false Birth control. 551.21 Section 551.21... Birth Control, Pregnancy, Child Placement, and Abortion § 551.21 Birth control. Medical staff shall provide an inmate with advice and consultation about methods for birth control and, where medically...

28 CFR 551.21 - Birth control.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 28 Judicial Administration 2 2014-07-01 2014-07-01 false Birth control. 551.21 Section 551.21... Birth Control, Pregnancy, Child Placement, and Abortion § 551.21 Birth control. Medical staff shall provide an inmate with advice and consultation about methods for birth control and, where medically...

28 CFR 551.21 - Birth control.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 28 Judicial Administration 2 2013-07-01 2013-07-01 false Birth control. 551.21 Section 551.21... Birth Control, Pregnancy, Child Placement, and Abortion § 551.21 Birth control. Medical staff shall provide an inmate with advice and consultation about methods for birth control and, where medically...

28 CFR 551.21 - Birth control.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 28 Judicial Administration 2 2012-07-01 2012-07-01 false Birth control. 551.21 Section 551.21... Birth Control, Pregnancy, Child Placement, and Abortion § 551.21 Birth control. Medical staff shall provide an inmate with advice and consultation about methods for birth control and, where medically...

28 CFR 551.21 - Birth control.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Birth control. 551.21 Section 551.21... Birth Control, Pregnancy, Child Placement, and Abortion § 551.21 Birth control. Medical staff shall provide an inmate with advice and consultation about methods for birth control and, where medically...

A novel autosomal partially dominant mutation designated G476D in the keratin 5 gene causing epidermolysis bullosa simplex Weber-Cockayne type: a family study with a genetic twist.

PubMed

Kowalewski, Cezary; Hamada, Takahiro; Wozniak, Katarzyna; Kawano, Yuko; Szczecinska, Weronika; Yasumoto, Shinichiro; Schwartz, Robert A; Hashimoto, Takashi

2007-07-01

Epidermolysis bullosa simplex Weber-Cockayne type (EBS-WC) is a genetically inherited skin disease characterized by blistering restricted to the palms and soles. Its inheritance in nearly all kindreds is caused by a dominant-negative mutation in either KRT5 or KRT14, the genes encoding keratin 5 and keratin 14 proteins, respectively. Rarely, recessive mutations have also been found. We described a family with EBS-WC caused by a novel autosomal dominant mutation (G476D) in the keratin 5 gene. One family member was first seen with mucosal erosions and generalized blisters localized on the anogenital area, trunk, face and sites of mechanical trauma. Molecular analysis in this patient showed the presence of an additional mutation, an autosomal recessive (G183E) one, in the same gene. This observation suggests an additional effect of a recessively inherited mutation modulating the phenotypic expression of EBS caused by a partially dominant mutation and is important for accurate genetic counseling.

5 CFR 551.311 - Subminimum wage.

Code of Federal Regulations, 2010 CFR

2010-01-01

... FAIR LABOR STANDARDS ACT Minimum Wage Provisions Subminimum Wage § 551.311 Subminimum wage. An agency... minimum wage specified in section 6(a)(1) of the Act. [45 FR 85664, Dec. 30, 1980] ... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Subminimum wage. 551.311 Section 551.311...

28 CFR 551.32 - Staff supervision.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 28 Judicial Administration 2 2014-07-01 2014-07-01 false Staff supervision. 551.32 Section 551.32... Inmate Organizations § 551.32 Staff supervision. (a) The Warden shall appoint a staff member as the... the institution's inmate organizations and staff sponsors. (b) The Warden or designee shall assign to...

28 CFR 551.32 - Staff supervision.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 28 Judicial Administration 2 2013-07-01 2013-07-01 false Staff supervision. 551.32 Section 551.32... Inmate Organizations § 551.32 Staff supervision. (a) The Warden shall appoint a staff member as the... the institution's inmate organizations and staff sponsors. (b) The Warden or designee shall assign to...

28 CFR 551.32 - Staff supervision.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 28 Judicial Administration 2 2012-07-01 2012-07-01 false Staff supervision. 551.32 Section 551.32... Inmate Organizations § 551.32 Staff supervision. (a) The Warden shall appoint a staff member as the... the institution's inmate organizations and staff sponsors. (b) The Warden or designee shall assign to...

28 CFR 551.32 - Staff supervision.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Staff supervision. 551.32 Section 551.32... Inmate Organizations § 551.32 Staff supervision. (a) The Warden shall appoint a staff member as the... the institution's inmate organizations and staff sponsors. (b) The Warden or designee shall assign to...

28 CFR 551.32 - Staff supervision.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 28 Judicial Administration 2 2011-07-01 2011-07-01 false Staff supervision. 551.32 Section 551.32... Inmate Organizations § 551.32 Staff supervision. (a) The Warden shall appoint a staff member as the... the institution's inmate organizations and staff sponsors. (b) The Warden or designee shall assign to...

5 CFR 551.432 - Sleep time.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 5 Administrative Personnel 1 2013-01-01 2013-01-01 false Sleep time. 551.432 Section 551.432... FAIR LABOR STANDARDS ACT Hours of Work Special Situations § 551.432 Sleep time. (a) Except as provided in paragraph (b) of this section, bona fide sleep time that fulfills the following conditions shall...

5 CFR 551.432 - Sleep time.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 5 Administrative Personnel 1 2014-01-01 2014-01-01 false Sleep time. 551.432 Section 551.432... FAIR LABOR STANDARDS ACT Hours of Work Special Situations § 551.432 Sleep time. (a) Except as provided in paragraph (b) of this section, bona fide sleep time that fulfills the following conditions shall...

5 CFR 551.432 - Sleep time.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 5 Administrative Personnel 1 2012-01-01 2012-01-01 false Sleep time. 551.432 Section 551.432... FAIR LABOR STANDARDS ACT Hours of Work Special Situations § 551.432 Sleep time. (a) Except as provided in paragraph (b) of this section, bona fide sleep time that fulfills the following conditions shall...

28 CFR 551.24 - Child placement.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 28 Judicial Administration 2 2013-07-01 2013-07-01 false Child placement. 551.24 Section 551.24... Birth Control, Pregnancy, Child Placement, and Abortion § 551.24 Child placement. (a) The Warden may not permit the inmate's new born child to return to the institution except in accordance with the Bureau of...

28 CFR 551.24 - Child placement.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 28 Judicial Administration 2 2012-07-01 2012-07-01 false Child placement. 551.24 Section 551.24... Birth Control, Pregnancy, Child Placement, and Abortion § 551.24 Child placement. (a) The Warden may not permit the inmate's new born child to return to the institution except in accordance with the Bureau of...

28 CFR 551.24 - Child placement.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 28 Judicial Administration 2 2014-07-01 2014-07-01 false Child placement. 551.24 Section 551.24... Birth Control, Pregnancy, Child Placement, and Abortion § 551.24 Child placement. (a) The Warden may not permit the inmate's new born child to return to the institution except in accordance with the Bureau of...

28 CFR 551.24 - Child placement.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 28 Judicial Administration 2 2011-07-01 2011-07-01 false Child placement. 551.24 Section 551.24... Birth Control, Pregnancy, Child Placement, and Abortion § 551.24 Child placement. (a) The Warden may not permit the inmate's new born child to return to the institution except in accordance with the Bureau of...

28 CFR 551.24 - Child placement.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Child placement. 551.24 Section 551.24... Birth Control, Pregnancy, Child Placement, and Abortion § 551.24 Child placement. (a) The Warden may not permit the inmate's new born child to return to the institution except in accordance with the Bureau of...

28 CFR 551.4 - Hair length.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 28 Judicial Administration 2 2011-07-01 2011-07-01 false Hair length. 551.4 Section 551.4 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Grooming § 551.4 Hair length. (a) The Warden may not restrict hair length if the inmate keeps it neat and clean. (b) The...

47 CFR 74.551 - Equipment changes.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 47 Telecommunication 4 2010-10-01 2010-10-01 false Equipment changes. 74.551 Section 74.551... § 74.551 Equipment changes. (a) Modifications may be made to an existing authorization in accordance with §§ 1.929 and 1.947 of this chapter. (b) Permissible changes in equipment operating in the bands 18...

5 CFR 551.702 - Time limits.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 5 Administrative Personnel 1 2012-01-01 2012-01-01 false Time limits. 551.702 Section 551.702... FAIR LABOR STANDARDS ACT FLSA Claims and Compliance § 551.702 Time limits. (a) Claims. A claimant may at any time file a complaint under the child labor provisions of the Act or an FLSA claim challenging...

5 CFR 551.702 - Time limits.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 5 Administrative Personnel 1 2014-01-01 2014-01-01 false Time limits. 551.702 Section 551.702... FAIR LABOR STANDARDS ACT FLSA Claims and Compliance § 551.702 Time limits. (a) Claims. A claimant may at any time file a complaint under the child labor provisions of the Act or an FLSA claim challenging...

5 CFR 551.702 - Time limits.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 5 Administrative Personnel 1 2013-01-01 2013-01-01 false Time limits. 551.702 Section 551.702... FAIR LABOR STANDARDS ACT FLSA Claims and Compliance § 551.702 Time limits. (a) Claims. A claimant may at any time file a complaint under the child labor provisions of the Act or an FLSA claim challenging...

Characterization of a new disease-causing mutation of SH2D1A in a family with X-linked lymphoproliferative disease.

PubMed

Erdõs, Melinda; Uzvölgyi, Eva; Nemes, Zoltán; Török, Olga; Rákóczi, Eva; Went-Sümegi, Nils; Sümegi, János; Maródi, László

2005-05-01

Males with an expressed mutation in the SH2D1A gene that encodes an SH2 domain protein named SH2D1A or SAP (NP_002342; signaling lymphocyte activating molecule [SLAM]-associated protein), have an X-linked syndrome characterized by an increased vulnerability to infection with Epstein-Barr virus (EBV). We evaluated two related male patients with fatal infectious mononucleosis (FIM) and mutation in the SH2D1A gene. Sequence analysis revealed a hemizygous c.47G>A mutation in one of the patients, and heterozygosity for this mutation in the genomic DNA from his mother and maternal grandmother. This mutation resulted in p.G16D amino acid change in the sequence of the SAP protein. To analyze the effect of this missense mutation on protein function cDNA was generated by site-directed mutagenesis and expressed in COS cells. We found that half-life of the p.G16D protein was comparable to that of wild type SAP. However, the mutant protein was defective in binding to its physiological ligands SLAM and 2B4. These results suggest that a defect in ligand binding contributes to the loss of function of the SAP protein in patients carrying p.G16D mutation.

Long-term vemurafenib treatment drives inhibitor resistance through a spontaneous KRAS G12D mutation in a BRAF V600E papillary thyroid carcinoma model

PubMed Central

Danysh, Brian P.; Rieger, Erin Y.; Sinha, Deepankar K.; Evers, Caitlin V.; Cote, Gilbert J.; Cabanillas, Maria E.; Hofmann, Marie-Claude

2016-01-01

The BRAF V600E mutation is commonly observed in papillary thyroid cancer (PTC) and predominantly activates the MAPK pathway. Presence of BRAF V600E predicts increasing risk of recurrence and higher mortality rate, and treatment options for such patients are limited. Vemurafenib, a BRAF V600E inhibitor, is initially effective, but cells inevitably develop alternative mechanisms of pathway activation. Mechanisms of primary resistance have been described in short-term cultures of PTC cells; however, mechanisms of acquired resistance have not. In the present study, we investigated possible adaptive mechanisms of BRAF V600E inhibitor resistance in KTC1 thyroid cancer cells following long-term vemurafenib exposure. We found that a subpopulation of KTC1 cells acquired resistance to vemurafenib following 5 months of treatment with the inhibitor. Resistance coincided with the spontaneous acquisition of a KRAS G12D activating mutation. Increases in activated AKT, ERK1/2, and EGFR were observed in these cells. In addition, the resistant cells were less sensitive to combinations of vemurafenib and MEK1 inhibitor or AKT inhibitor. These results support the KRAS G12D mutation as a genetic mechanism of spontaneously acquired secondary BRAF inhibitor resistance in BRAF V600E thyroid cancer cells. PMID:27127178

Histidine168 is crucial for ΔpH-dependent gating of the human voltage-gated proton channel, hHV1.

PubMed

Cherny, Vladimir V; Morgan, Deri; Thomas, Sarah; Smith, Susan M E; DeCoursey, Thomas E

2018-05-09

We recently identified a voltage-gated proton channel gene in the snail Helisoma trivolvis , HtH V 1, and determined its electrophysiological properties. Consistent with early studies of proton currents in snail neurons, HtH V 1 opens rapidly, but it unexpectedly exhibits uniquely defective sensitivity to intracellular pH (pH i ). The H + conductance ( g H )- V relationship in the voltage-gated proton channel (H V 1) from other species shifts 40 mV when either pH i or pH o (extracellular pH) is changed by 1 unit. This property, called ΔpH-dependent gating, is crucial to the functions of H V 1 in many species and in numerous human tissues. The HtH V 1 channel exhibits normal pH o dependence but anomalously weak pH i dependence. In this study, we show that a single point mutation in human hH V 1-changing His 168 to Gln 168 , the corresponding residue in HtH V 1-compromises the pH i dependence of gating in the human channel so that it recapitulates the HtH V 1 response. This location was previously identified as a contributor to the rapid gating kinetics of H V 1 in Strongylocentrotus purpuratus His 168 mutation in human H V 1 accelerates activation but accounts for only a fraction of the species difference. H168Q, H168S, or H168T mutants exhibit normal pH o dependence, but changing pH i shifts the g H - V relationship on average by <20 mV/unit. Thus, His 168 is critical to pH i sensing in hH V 1. His 168 , located at the inner end of the pore on the S3 transmembrane helix, is the first residue identified in H V 1 that significantly impairs pH sensing when mutated. Because pH o dependence remains intact, the selective erosion of pH i dependence supports the idea that there are distinct internal and external pH sensors. Although His 168 may itself be a pH i sensor, the converse mutation, Q229H, does not normalize the pH i sensitivity of the HtH V 1 channel. We hypothesize that the imidazole group of His 168 interacts with nearby Phe 165 or other parts of hH V 1 to

28 CFR 551.4 - Hair length.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Hair length. 551.4 Section 551.4 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Grooming § 551.4 Hair length. (a) The Warden may not restrict hair length if the inmate keeps it neat and clean. (b) The Warden shall require an inmate...

5 CFR 551.301 - Minimum wage.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Minimum wage. 551.301 Section 551.301... FAIR LABOR STANDARDS ACT Minimum Wage Provisions Basic Provision § 551.301 Minimum wage. (a)(1) Except... employees wages at rates not less than the minimum wage specified in section 6(a)(1) of the Act for all...

33 CFR 55.1 - Purpose.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Purpose. 55.1 Section 55.1 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY PERSONNEL CHILD DEVELOPMENT... Child Development Services. ...

33 CFR 55.1 - Purpose.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 33 Navigation and Navigable Waters 1 2012-07-01 2012-07-01 false Purpose. 55.1 Section 55.1 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY PERSONNEL CHILD DEVELOPMENT... Child Development Services. ...

33 CFR 55.1 - Purpose.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 33 Navigation and Navigable Waters 1 2011-07-01 2011-07-01 false Purpose. 55.1 Section 55.1 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY PERSONNEL CHILD DEVELOPMENT... Child Development Services. ...

33 CFR 55.1 - Purpose.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 33 Navigation and Navigable Waters 1 2013-07-01 2013-07-01 false Purpose. 55.1 Section 55.1 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY PERSONNEL CHILD DEVELOPMENT... Child Development Services. ...

33 CFR 55.1 - Purpose.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 33 Navigation and Navigable Waters 1 2014-07-01 2014-07-01 false Purpose. 55.1 Section 55.1 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY PERSONNEL CHILD DEVELOPMENT... Child Development Services. ...

5 CFR 551.207 - Professional exemption criteria.

Code of Federal Regulations, 2010 CFR

2010-01-01

... work requiring knowledge of an advanced type in a field of science or learning customarily acquired by... professionals, and computer employees are described in §§ 551.208, 551.209, and 551.210, respectively. ...

5 CFR 551.207 - Professional exemption criteria.

Code of Federal Regulations, 2012 CFR

2012-01-01

... work requiring knowledge of an advanced type in a field of science or learning customarily acquired by... professionals, and computer employees are described in §§ 551.208, 551.209, and 551.210, respectively. ...

5 CFR 551.207 - Professional exemption criteria.

Code of Federal Regulations, 2011 CFR

2011-01-01

... work requiring knowledge of an advanced type in a field of science or learning customarily acquired by... professionals, and computer employees are described in §§ 551.208, 551.209, and 551.210, respectively. ...

5 CFR 551.207 - Professional exemption criteria.

Code of Federal Regulations, 2014 CFR

2014-01-01

... work requiring knowledge of an advanced type in a field of science or learning customarily acquired by... professionals, and computer employees are described in §§ 551.208, 551.209, and 551.210, respectively. ...

5 CFR 551.207 - Professional exemption criteria.

Code of Federal Regulations, 2013 CFR

2013-01-01

... work requiring knowledge of an advanced type in a field of science or learning customarily acquired by... professionals, and computer employees are described in §§ 551.208, 551.209, and 551.210, respectively. ...

3D super resolution range-gated imaging for canopy reconstruction and measurement

NASA Astrophysics Data System (ADS)

Huang, Hantao; Wang, Xinwei; Sun, Liang; Lei, Pingshun; Fan, Songtao; Zhou, Yan

2018-01-01

In this paper, we proposed a method of canopy reconstruction and measurement based on 3D super resolution range-gated imaging. In this method, high resolution 2D intensity images are grasped by active gate imaging, and 3D images of canopy are reconstructed by triangular-range-intensity correlation algorithm at the same time. A range-gated laser imaging system(RGLIS) is established based on 808 nm diode laser and gated intensified charge-coupled device (ICCD) camera with 1392´1040 pixels. The proof experiments have been performed for potted plants located 75m away and trees located 165m away. The experiments show it that can acquire more than 1 million points per frame, and 3D imaging has the spatial resolution about 0.3mm at the distance of 75m and the distance accuracy about 10 cm. This research is beneficial for high speed acquisition of canopy structure and non-destructive canopy measurement.

Nav1.7-A1632G Mutation from a Family with Inherited Erythromelalgia: Enhanced Firing of Dorsal Root Ganglia Neurons Evoked by Thermal Stimuli.

PubMed

Yang, Yang; Huang, Jianying; Mis, Malgorzata A; Estacion, Mark; Macala, Lawrence; Shah, Palak; Schulman, Betsy R; Horton, Daniel B; Dib-Hajj, Sulayman D; Waxman, Stephen G

2016-07-13

Voltage-gated sodium channel Nav1.7 is a central player in human pain. Mutations in Nav1.7 produce several pain syndromes, including inherited erythromelalgia (IEM), a disorder in which gain-of-function mutations render dorsal root ganglia (DRG) neurons hyperexcitable. Although patients with IEM suffer from episodes of intense burning pain triggered by warmth, the effects of increased temperature on DRG neurons expressing mutant Nav1.7 channels have not been well documented. Here, using structural modeling, voltage-clamp, current-clamp, and multielectrode array recordings, we have studied a newly identified Nav1.7 mutation, Ala1632Gly, from a multigeneration family with IEM. Structural modeling suggests that Ala1632 is a molecular hinge and that the Ala1632Gly mutation may affect channel gating. Voltage-clamp recordings revealed that the Nav1.7-A1632G mutation hyperpolarizes activation and depolarizes fast-inactivation, both gain-of-function attributes at the channel level. Whole-cell current-clamp recordings demonstrated increased spontaneous firing, lower current threshold, and enhanced evoked firing in rat DRG neurons expressing Nav1.7-A1632G mutant channels. Multielectrode array recordings further revealed that intact rat DRG neurons expressing Nav1.7-A1632G mutant channels are more active than those expressing Nav1.7 WT channels. We also showed that physiologically relevant thermal stimuli markedly increase the mean firing frequencies and the number of active rat DRG neurons expressing Nav1.7-A1632G mutant channels, whereas the same thermal stimuli only increase these parameters slightly in rat DRG neurons expressing Nav1.7 WT channels. The response of DRG neurons expressing Nav1.7-A1632G mutant channels upon increase in temperature suggests a cellular basis for warmth-triggered pain in IEM. Inherited erythromelalgia (IEM), a severe pain syndrome characterized by episodes of intense burning pain triggered by warmth, is caused by mutations in sodium channel Nav

A novel mutation MT-COIII m.9267G>C and MT-COI m.5913G>A mutation in mitochondrial genes in a Tunisian family with maternally inherited diabetes and deafness (MIDD) associated with severe nephropathy.

PubMed

Tabebi, Mouna; Mkaouar-Rebai, Emna; Mnif, Mouna; Kallabi, Fakhri; Ben Mahmoud, Afif; Ben Saad, Wafa; Charfi, Nadia; Keskes-Ammar, Leila; Kamoun, Hassen; Abid, Mohamed; Fakhfakh, Faiza

2015-04-10

Mitochondrial diabetes (MD) is a heterogeneous disorder characterized by a chronic hyperglycemia, maternal transmission and its association with a bilateral hearing impairment. Several studies reported mutations in mitochondrial genes as potentially pathogenic for diabetes, since mitochondrial oxidative phosphorylation plays an important role in glucose-stimulated insulin secretion from beta cells. In the present report, we studied a Tunisian family with mitochondrial diabetes (MD) and deafness associated with nephropathy. The mutational analysis screening revealed the presence of a novel heteroplasmic mutation m.9276G>C in the mitochondrial COIII gene, detected in mtDNA extracted from leukocytes of a mother and her two daughters indicating that this mutation is maternally transmitted and suggest its implication in the observed phenotype. Bioinformatic tools showed that m.9267G>C mutation (p.A21P) is « deleterious » and it can modify the function and the stability of the MT-COIII protein by affecting the assembly of mitochondrial COX subunits and the translocation of protons then reducing the activity of the respective OXPHOS complexes of ATP synthesis. The nonsynonymous mutation (p.A21P) has not been reported before, it is the first mutation described in the COXIII gene which is related to insulin dependent mitochondrial diabetes and deafness and could be specific to the Tunisian population. The m.9267G>C mutation was present with a nonsynonymous inherited mitochondrial homoplasmic variation MT-COI m.5913 G>A (D4N) responsible of high blood pressure, a clinical feature detected in all explored patients. Copyright © 2015. Published by Elsevier Inc.

Tuning the allosteric regulation of artificial muscarinic and dopaminergic ligand-gated potassium channels by protein engineering of G protein-coupled receptors

PubMed Central

Moreau, Christophe J.; Revilloud, Jean; Caro, Lydia N.; Dupuis, Julien P.; Trouchet, Amandine; Estrada-Mondragón, Argel; Nieścierowicz, Katarzyna; Sapay, Nicolas; Crouzy, Serge; Vivaudou, Michel

2017-01-01

Ligand-gated ion channels enable intercellular transmission of action potential through synapses by transducing biochemical messengers into electrical signal. We designed artificial ligand-gated ion channels by coupling G protein-coupled receptors to the Kir6.2 potassium channel. These artificial channels called ion channel-coupled receptors offer complementary properties to natural channels by extending the repertoire of ligands to those recognized by the fused receptors, by generating more sustained signals and by conferring potassium selectivity. The first artificial channels based on the muscarinic M2 and the dopaminergic D2L receptors were opened and closed by acetylcholine and dopamine, respectively. We find here that this opposite regulation of the gating is linked to the length of the receptor C-termini, and that C-terminus engineering can precisely control the extent and direction of ligand gating. These findings establish the design rules to produce customized ligand-gated channels for synthetic biology applications. PMID:28145461

The episodic ataxia type 1 mutation I262T alters voltage-dependent gating and disrupts protein biosynthesis of human Kv1.1 potassium channels.

PubMed

Chen, Szu-Han; Fu, Ssu-Ju; Huang, Jing-Jia; Tang, Chih-Yung

2016-01-18

Voltage-gated potassium (Kv) channels are essential for setting neuronal membrane excitability. Mutations in human Kv1.1 channels are linked to episodic ataxia type 1 (EA1). The EA1-associated mutation I262T was identified from a patient with atypical phenotypes. Although a previous report has characterized its suppression effect, several key questions regarding the impact of the I262T mutation on Kv1.1 as well as other members of the Kv1 subfamily remain unanswered. Herein we show that the dominant-negative effect of I262T on Kv1.1 current expression is not reversed by co-expression with Kvβ1.1 or Kvβ2 subunits. Biochemical examinations indicate that I262T displays enhanced protein degradation and impedes membrane trafficking of Kv1.1 wild-type subunits. I262T appears to be the first EA1 mutation directly associated with impaired protein stability. Further functional analyses demonstrate that I262T changes the voltage-dependent activation and Kvβ1.1-mediated inactivation, uncouples inactivation from activation gating, and decelerates the kinetics of cumulative inactivation of Kv1.1 channels. I262T also exerts similar dominant effects on the gating of Kv1.2 and Kv1.4 channels. Together our data suggest that I262T confers altered channel gating and reduced functional expression of Kv1 channels, which may account for some of the phenotypes of the EA1 patient.

Comparison of LVEF assessed by 2D echocardiography, gated blood pool SPECT, 99mTc tetrofosmin gated SPECT, and 18F-FDG gated PET with ERNV in patients with CAD and severe LV dysfunction.

PubMed

Raja, Senthil; Mittal, Bhagwant R; Santhosh, Sampath; Bhattacharya, Anish; Rohit, Manoj K

2014-11-01

Left ventricular ejection fraction (LVEF) is the single most important predictor of prognosis in patients with coronary artery disease (CAD) and left ventricular (LV) dysfunction. Equilibrium radionuclide ventriculography (ERNV) is considered the most reliable technique for assessing LVEF. Most of these patients undergo two dimensional (2D) echocardiography and myocardial viability study using gated myocardial perfusion imaging (MPI) or gated F-fluorodeoxyglucose (F-FDG) PET. However, the accuracy of LVEF assessed by these methods is not clear. This study has been designed to assess the correlation and agreement between the LVEF measured by 2D echocardiography, gated blood pool single photon emission computed tomography (SPECT), Tc tetrofosmin gated SPECT, and F-FDG gated PET with ERNV in CAD patients with severe LV dysfunction. Patients with CAD and severe LV dysfunction [ejection fraction (EF) <35 assessed by 2D echocardiography] were prospectively included in the study. These patients underwent ERNV along with gated blood pool SPECT, Tc tetrofosmin gated SPECT, and F-FDG gated PET as per the standard protocol for myocardial viability assessment and LVEF calculation. Spearman's coefficient of correlation (r) was calculated for the different sets of values with significance level kept at a P-value less than 0.05. Bland-Altman plots were inspected to visually assess the between-agreement measurements from different methods. Forty-one patients were prospectively included. LVEF calculated by various radionuclide methods showed good correlation with ERNV as follows: gated blood pool SPECT, r=0.92; MPI gated SPECT, r=0.85; and F-FDG gated PET, r=0.76. However, the correlation between 2D echocardiography and ERNV was poor (r=0.520). The Bland-Altman plot for LVEF measured by all radionuclide methods showed good agreement with ERNV. However, agreement between 2D echocardiography and ERNV is poor, as most of the values in this plot gave a negative difference for low EF

Genotyping of single nucleotide polymorphism by probe-gated silica nanoparticles.

PubMed

Ercan, Meltem; Ozalp, Veli C; Tuna, Bilge G

2017-11-15

The development of simple, reliable, and rapid approaches for molecular detection of common mutations is important for prevention and early diagnosis of genetic diseases, including Thalessemia. Oligonucleotide-gated mesoporous nanoparticles-based analysis is a new platform for mutation detection that has the advantages of sensitivity, rapidity, accuracy, and convenience. A specific mutation in β-thalassemia, one of the most prevalent inherited diseases in several countries, was used as model disease in this study. An assay for detection of IVS110 point mutation (A > G reversion) was developed by designing probe-gated mesoporous silica nanoparticles (MCM-41) loaded with reporter fluorescein molecules. The silica nanoparticles were characterized by AFM, TEM and BET analysis for having 180 nm diameter and 2.83 nm pore size regular hexagonal shape. Amine group functionalized nanoparticles were analysed with FTIR technique. Mutated and normal sequence probe oligonucleotides)about 12.7 nmol per mg nanoparticles) were used to entrap reporter fluorescein molecules inside the pores and hybridization with single stranded DNA targets amplified by PCR gave different fluorescent signals for mutated targets. Samples from IVS110 mutated and normal patients resulted in statistically significant differences when the assay procedure were applied. Copyright © 2017 Elsevier Inc. All rights reserved.

Characterization of Ribozymes Targeting a Congenital Night Blindness Mutation in Rhodopsin Mutation.

PubMed

Conley, Shannon M; Whalen, Patrick; Lewin, Alfred S; Naash, Muna I

2016-01-01

The G90D mutation in the rhodopsin gene leads to autosomal dominant congenital stationary night blindness (CSNB) in patients. This occurs because the G90D mutant protein cannot efficiently bind chromophore and is constitutively active. To combat this mutation, we designed and characterized two different hammerhead ribozymes to cleave G90D transcript. In vitro testing showed that the G90D1 ribozyme efficiently and specifically cleaved the mutant transcript while G90D2 cleaved both WT and mutant transcript. AAV-mediated delivery of G90D1 under the control of the mouse opsin promoter (MOP500) to G90D transgenic eyes showed that the ribozyme partially retarded the functional degeneration (as measured by electroretinography [ERG]) associated with this mutation. These results suggest that with additional optimization, ribozymes may be a useful part of the gene therapy knockdown strategy for dominant retinal disease.

17 CFR 200.551 - Applicability.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Applicability. 200.551 Section 200.551 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION ORGANIZATION; CONDUCT AND ETHICS; AND INFORMATION AND REQUESTS Regulations Pertaining to the Protection of the Environment...

The G matrix under fluctuating correlational mutation and selection.

PubMed

Revell, Liam J

2007-08-01

Theoretical quantitative genetics provides a framework for reconstructing past selection and predicting future patterns of phenotypic differentiation. However, the usefulness of the equations of quantitative genetics for evolutionary inference relies on the evolutionary stability of the additive genetic variance-covariance matrix (G matrix). A fruitful new approach for exploring the evolutionary dynamics of G involves the use of individual-based computer simulations. Previous studies have focused on the evolution of the eigenstructure of G. An alternative approach employed in this paper uses the multivariate response-to-selection equation to evaluate the stability of G. In this approach, I measure similarity by the correlation between response-to-selection vectors due to random selection gradients. I analyze the dynamics of G under several conditions of correlational mutation and selection. As found in a previous study, the eigenstructure of G is stabilized by correlational mutation and selection. However, over broad conditions, instability of G did not result in a decreased consistency of the response to selection. I also analyze the stability of G when the correlation coefficients of correlational mutation and selection and the effective population size change through time. To my knowledge, no prior study has used computer simulations to investigate the stability of G when correlational mutation and selection fluctuate. Under these conditions, the eigenstructure of G is unstable under some simulation conditions. Different results are obtained if G matrix stability is assessed by eigenanalysis or by the response to random selection gradients. In this case, the response to selection is most consistent when certain aspects of the eigenstructure of G are least stable and vice versa.

5 CFR 551.203 - Salary-based nonexemption.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Salary-based nonexemption. 551.203 Section 551.203 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS PAY ADMINISTRATION UNDER THE FAIR LABOR STANDARDS ACT Exemptions and Exclusions § 551.203 Salary-based nonexemption...

5 CFR 551.531 - Compensatory time off.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Compensatory time off. 551.531 Section 551.531 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS PAY ADMINISTRATION UNDER THE FAIR LABOR STANDARDS ACT Overtime Pay Provisions Compensatory Time Off § 551.531...

28 CFR 551.5 - Restrictions and exceptions.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 28 Judicial Administration 2 2011-07-01 2011-07-01 false Restrictions and exceptions. 551.5 Section 551.5 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Grooming § 551.5 Restrictions and exceptions. The Warden may impose restrictions or exceptions for...

28 CFR 551.5 - Restrictions and exceptions.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Restrictions and exceptions. 551.5 Section 551.5 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Grooming § 551.5 Restrictions and exceptions. The Warden may impose restrictions or exceptions for...

Neonatal Diabetes Caused by Mutations in Sulfonylurea Receptor 1: Interplay between Expression and Mg-Nucleotide Gating Defects of ATP-Sensitive Potassium Channels

PubMed Central

Zhou, Qing; Garin, Intza; Castaño, Luis; Argente, Jesús; Muñoz-Calvo, Ma. Teresa; Perez de Nanclares, Guiomar; Shyng, Show-Ling

2010-01-01

Context: ATP-sensitive potassium (KATP) channels regulate insulin secretion by coupling glucose metabolism to β-cell membrane potential. Gain-of-function mutations in the sulfonylurea receptor 1 (SUR1) or Kir6.2 channel subunit underlie neonatal diabetes. Objective: The objective of the study was to determine the mechanisms by which two SUR1 mutations, E208K and V324M, associated with transient neonatal diabetes affect KATP channel function. Design: E208K or V324M mutant SUR1 was coexpressed with Kir6.2 in COS cells, and expression and gating properties of the resulting channels were assessed biochemically and electrophysiologically. Results: Both E208K and V324M augment channel response to MgADP stimulation without altering sensitivity to ATP4− or sulfonylureas. Surprisingly, whereas E208K causes only a small increase in MgADP response consistent with the mild transient diabetes phenotype, V324M causes a severe activating gating defect. Unlike E208K, V324M also impairs channel expression at the cell surface, which is expected to dampen its functional impact on β-cells. When either mutation was combined with a mutation in the second nucleotide binding domain of SUR1 previously shown to abolish Mg-nucleotide response, the activating effect of E208K and V324M was also abolished. Moreover, combination of E208K and V324M results in channels with Mg-nucleotide sensitivity greater than that seen in individual mutations alone. Conclusion: The results demonstrate that E208K and V324M, located in distinct domains of SUR1, enhance transduction of Mg-nucleotide stimulation from the SUR1 nucleotide binding folds to Kir6.2. Furthermore, they suggest that diabetes severity is determined by interplay between effects of a mutation on channel expression and channel gating. PMID:20810569

28 CFR 551.90 - Policy.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 28 Judicial Administration 2 2012-07-01 2012-07-01 false Policy. 551.90 Section 551.90 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Non-Discrimination..., religion, national origin, sex, disability, or political belief. This includes the making of administrative...

28 CFR 551.90 - Policy.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 28 Judicial Administration 2 2011-07-01 2011-07-01 false Policy. 551.90 Section 551.90 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Non-Discrimination..., religion, national origin, sex, disability, or political belief. This includes the making of administrative...

28 CFR 551.90 - Policy.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 28 Judicial Administration 2 2014-07-01 2014-07-01 false Policy. 551.90 Section 551.90 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Non-Discrimination..., religion, national origin, sex, disability, or political belief. This includes the making of administrative...

28 CFR 551.90 - Policy.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 28 Judicial Administration 2 2013-07-01 2013-07-01 false Policy. 551.90 Section 551.90 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Non-Discrimination..., religion, national origin, sex, disability, or political belief. This includes the making of administrative...

28 CFR 551.90 - Policy.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Policy. 551.90 Section 551.90 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Non-Discrimination..., religion, national origin, sex, disability, or political belief. This includes the making of administrative...

16 CFR 5.51 - Scope and applicability.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Scope and applicability. 5.51 Section 5.51 Commercial Practices FEDERAL TRADE COMMISSION ORGANIZATION, PROCEDURES AND RULES OF PRACTICE STANDARDS OF CONDUCT Disciplinary Actions Concerning Postemployment Conflict of Interest § 5.51 Scope and applicability...

28 CFR 551.7 - Bathing and clothing.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Bathing and clothing. 551.7 Section 551.7 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Grooming § 551.7 Bathing and clothing. Each inmate must observe the standards concerning bathing and...

28 CFR 551.7 - Bathing and clothing.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 28 Judicial Administration 2 2011-07-01 2011-07-01 false Bathing and clothing. 551.7 Section 551.7 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Grooming § 551.7 Bathing and clothing. Each inmate must observe the standards concerning bathing and...

28 CFR 551.13 - Application to marry.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Application to marry. 551.13 Section 551.13 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Marriages of Inmates § 551.13 Application to marry. (a) A federal inmate confined in a Bureau...

Prevalence of meconium ileus marks the severity of mutations of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene.

PubMed

Dupuis, Annie; Keenan, Katherine; Ooi, Chee Y; Dorfman, Ruslan; Sontag, Marci K; Naehrlich, Lutz; Castellani, Carlo; Strug, Lisa J; Rommens, Johanna M; Gonska, Tanja

2016-04-01

Meconium ileus (MI) is a perinatal complication in cystic fibrosis (CF), which is only minimally influenced by environmental factors. We derived and examined MI prevalence (MIP) scores to assess CFTR phenotype-phenotype correlation for severe mutations. MIP scores were established using a Canadian CF population (n = 2,492) as estimates of the proportion of patients with MI among all patients carrying the same CFTR mutation, focusing on patients with p.F508del as the second allele. Comparisons were made to the registries from the US CF Foundation (n = 43,432), Italy (Veneto/Trentino/Alto Adige regions) (n = 1,788), and Germany (n = 3,596). The prevalence of MI varied among the different registries (13-21%). MI was predominantly prevalent in patients with pancreatic insufficiency carrying "severe" CFTR mutations. In this severe spectrum MIP scores further distinguished between mutation types, for example, G542X (0.31) with a high, F508del (0.22) with a moderate, and G551D (0.08) with a low MIP score. Higher MIP scores were associated with more severe clinical phenotypes, such as a lower forced expiratory volume in 1 second (P = 0.01) and body mass index z score (P = 0.04). MIP scores can be used to rank CFTR mutations according to their clinical severity and provide a means to expand delineation of CF phenotypes.Genet Med 18 4, 333-340.

28 CFR 551.30 - Purpose and scope.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 28 Judicial Administration 2 2014-07-01 2014-07-01 false Purpose and scope. 551.30 Section 551.30 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Inmate Organizations § 551.30 Purpose and scope. The Bureau of Prisons permits inmates and persons in the...

28 CFR 551.30 - Purpose and scope.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 28 Judicial Administration 2 2013-07-01 2013-07-01 false Purpose and scope. 551.30 Section 551.30 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Inmate Organizations § 551.30 Purpose and scope. The Bureau of Prisons permits inmates and persons in the...

28 CFR 551.30 - Purpose and scope.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Purpose and scope. 551.30 Section 551.30 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Inmate Organizations § 551.30 Purpose and scope. The Bureau of Prisons permits inmates and persons in the...

31 CFR 551.402 - Effect of amendment.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Effect of amendment. 551.402 Section 551.402 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF FOREIGN ASSETS CONTROL, DEPARTMENT OF THE TREASURY SOMALIA SANCTIONS REGULATIONS Interpretations § 551.402...

Antibiotic exposure and interpersonal variance mask the effect of ivacaftor on respiratory microbiota composition.

PubMed

Peleg, Anton Y; Choo, Jocelyn M; Langan, Katherine M; Edgeworth, Deirdre; Keating, Dominic; Wilson, John; Rogers, Geraint B; Kotsimbos, Tom

2018-01-01

G551D is a class III mutation of the cystic fibrosis transmembrane regulator (CFTR) that results in impaired chloride channel function in cystic fibrosis (CF). Ivacaftor, a CFTR-potentiating agent improves sweat chloride, weight, lung function, and pulmonary exacerbation rate in CF patients with G551D mutations, but its effect on the airway microbiome remains poorly characterised. Twenty CF patients with at least one G551D mutation from a single centre were recruited to a 4month double-blind, placebo-controlled, crossover study of ivacaftor with 28days of active treatment. Sputum microbiota composition was assessed by 16S rRNA gene amplicon sequencing and quantitative PCR at five key time points, along with regular clinical review, respiratory function assessment, and peripheral blood testing. No significant difference in microbiota composition was observed in subjects following ivacaftor treatment or placebo (PERMANOVA P=0.95, square root ECV=-4.94, 9479 permutations). Microbiota composition variance was significantly greater between subjects, than within subjects over time (P<0.0001, Mann Whitney U test), and an additional within-patient paired assessment of microbiota similarity was therefore performed. Again, change in microbiota composition was not significantly greater during treatment with ivacaftor compared to placebo (Wilcoxon test, P=0.51). A significant change in microbiota composition was however associated with any change in antibiotic exposure, regardless of whether ivacaftor or placebo was administered (P=0.006). In a small, subgroup analysis of subjects whose antibiotic exposure did not change within the study period, a significant reduction in total bacterial load was observed during treatment with ivacaftor (P=0.004, two-tailed paired Student's t-test). The short-term impact of ivacaftor therapy on sputum microbiota composition in patients with G551D mutations are modest compared to those resulting from antibiotic exposure, and may be masked by

K-Ras(G12D)-selective inhibitory peptides generated by random peptide T7 phage display technology.

PubMed

Sakamoto, Kotaro; Kamada, Yusuke; Sameshima, Tomoya; Yaguchi, Masahiro; Niida, Ayumu; Sasaki, Shigekazu; Miwa, Masanori; Ohkubo, Shoichi; Sakamoto, Jun-Ichi; Kamaura, Masahiro; Cho, Nobuo; Tani, Akiyoshi

2017-03-11

Amino-acid mutations of Gly 12 (e.g. G12D, G12V, G12C) of V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (K-Ras), the most promising drug target in cancer therapy, are major growth drivers in various cancers. Although over 30 years have passed since the discovery of these mutations in most cancer patients, effective mutated K-Ras inhibitors have not been marketed. Here, we report novel and selective inhibitory peptides to K-Ras(G12D). We screened random peptide libraries displayed on T7 phage against purified recombinant K-Ras(G12D), with thorough subtraction of phages bound to wild-type K-Ras, and obtained KRpep-2 (Ac-RRCPLYISYDPVCRR-NH 2 ) as a consensus sequence. KRpep-2 showed more than 10-fold binding- and inhibition-selectivity to K-Ras(G12D), both in SPR analysis and GDP/GTP exchange enzyme assay. K D and IC 50 values were 51 and 8.9 nM, respectively. After subsequent sequence optimization, we successfully generated KRpep-2d (Ac-RRRRCPLYISYDPVCRRRR-NH 2 ) that inhibited enzyme activity of K-Ras(G12D) with IC 50  = 1.6 nM and significantly suppressed ERK-phosphorylation, downstream of K-Ras(G12D), along with A427 cancer cell proliferation at 30 μM peptide concentration. To our knowledge, this is the first report of a K-Ras(G12D)-selective inhibitor, contributing to the development and study of K-Ras(G12D)-targeting drugs. Copyright © 2017 Elsevier Inc. All rights reserved.

39 CFR 551.8 - Cost offset policy.

Code of Federal Regulations, 2010 CFR

2010-07-01

... semipostal stamps; (5) Costs of stamp sales (including employee salaries and benefits); (6) Costs associated... 39 Postal Service 1 2010-07-01 2010-07-01 false Cost offset policy. 551.8 Section 551.8 Postal Service UNITED STATES POSTAL SERVICE POSTAGE PROGRAMS SEMIPOSTAL STAMP PROGRAM § 551.8 Cost offset policy...

47 CFR 5.51 - Eligibility of license.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 47 Telecommunication 1 2011-10-01 2011-10-01 false Eligibility of license. 5.51 Section 5.51...) Applications and Licenses § 5.51 Eligibility of license. (a) Authorizations for stations in the Experimental... for scientific or technical operation data directly related to a use of radio not provided by existing...

28 CFR 551.2 - Mustaches and beards.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 28 Judicial Administration 2 2011-07-01 2011-07-01 false Mustaches and beards. 551.2 Section 551.2 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Grooming § 551.2 Mustaches and beards. An inmate may wear a mustache or beard or both. The Warden shall...

A nicotinic acetylcholine receptor transmembrane point mutation (G275E) associated with resistance to spinosad in Frankliniella occidentalis

PubMed Central

Puinean, Alin M; Lansdell, Stuart J; Collins, Toby; Bielza, Pablo; Millar, Neil S

2013-01-01

High levels of resistance to spinosad, a macrocyclic lactone insecticide, have been reported previously in western flower thrips, Frankliniella occidentalis, an economically important insect pest of vegetables, fruit and ornamental crops. We have cloned the nicotinic acetylcholine receptor (nAChR) α6 subunit from F. occidentalis (Foα6) and compared the nucleotide sequence of Foα6 from susceptible and spinosad-resistant insect populations (MLFOM and R1S respectively). A single nucleotide change has been identified in Foα6, resulting in the replacement of a glycine (G) residue in susceptible insects with a glutamic acid (E) in resistant insects. The resistance-associated mutation (G275E) is predicted to lie at the top of the third α-helical transmembrane domain of Foα6. Although there is no direct evidence identifying the location of the spinosad binding site, the analogous amino acid in the C. elegans glutamate-gated chloride channel lies in close proximity (4.4 Å) to the known binding site of ivermectin, another macrocyclic lactone pesticide. The functional consequences of the resistance-associated mutation have been examined in the human nAChR α7 subunit. Introduction of an analogous (A272E) mutation in α7 abolishes the modulatory effects of spinosad whilst having no significant effect upon activation by acetylcholine, consistent with spinosad having an allosteric mechanism of action. PMID:23016960

Decreased mutation frequencies among immunoglobulin G variable region genes during viremic HIV-1 infection.

PubMed

Bowers, Elisabeth; Scamurra, Ronald W; Asrani, Anil; Beniguel, Lydie; MaWhinney, Samantha; Keays, Kathryne M; Thurn, Joseph R; Janoff, Edward N

2014-01-01

HIV-1 infection is complicated by high rates of opportunistic infections against which specific antibodies contribute to immune defense. Antibody function depends on somatic hypermutation (SHM) of variable regions of immunoglobulin heavy chain genes (VH-D-J). We characterized the frequency of SHM in expressed IgG mRNA immunoglobulin transcripts from control and HIV-1-infected patients. We compared utilization of genes in the most prominent VH family (VH3) and mutation frequencies and patterns of cDNA from VH3-IgG genes from 10 seronegative control subjects and 21 patients with HIV-1 infection (6 without and 15 patients with detectable plasma viremia). Unique IgG VH3 family cDNA sequences (n = 1,565) were PCR amplified, cloned, and sequenced from blood. Sequences were analyzed using online (Vbase) and in-house immunoglobulin alignment resources. Mutation frequencies in the antigen-binding hypervariable complementarity determining regions (CDR1/2) of IgG class-switched B cells were lower among viremic HIV-1-infected patients vs. controls for nucleotides (CDR1/2: 10±5% vs. 13.5±6%, p = 0.03) and amino acids (CDR: 20%±10 vs. 25%±12, p = 0.02) and in structural framework regions. Mutation patterns were similar among groups. The most common VH3 gene, VH3-23, was utilized less frequently among viremic HIV-1-infected patients (p = 0.03), and overall, mutation frequencies were decreased in nearly all VH3 genes compared with controls. B cells from HIV-1-infected patients show decreased mutation frequencies, especially in antigen-binding VH3 CDR genes, and selective defects in gene utilization. Similar mutation patterns suggest defects in the quantity, but not quality, of mutator activity. Lower levels of SHM in IgG class-switched B cells from HIV-1-infected patients may contribute to the increased risk of opportunistic infections and impaired humoral responses to preventative vaccines.

Carnitine-acylcarnitine translocase deficiency with c.199-10 T>G and novel c.1A>G mutation

PubMed Central

Yan, Hui-ming; Hu, Hao; Ahmed, Aisha; Feng, Bing-bing; Liu, Jing; Jia, Zheng-jun; Wang, Hua

2017-01-01

Abstract Rationale: Carnitine-acylcarnitine translocate deficiency (CACTD) is a rare and life-threatening, autosomal recessive disorder of fatty acid β-oxidation characterized by hypoketotic hypoglycemia, hyperammonemia, cardiomyopathy, liver dysfunction, and muscle weakness; culminating in early death. To date, CACTD cases screened from the Chinese mainland population, especially patient with compound heterozygote with c.199-10T>G and a novel c.1A>G mutation in the SLC25A20 gene has never been described. Patient concerns: Herein, we report 2 neonatal cases of CACTD identified from the mainland China. These 2 patients were presented with severe metabolic crisis and their clinical conditions deteriorate rapidly and both died of cardiorespiratory collapse in the first week of life. We present the clinical and biochemical features of 2 probands and a brief literature review of previously reported CACTD cases with the c.199-10T>G mutation. Diagnoses: The acylcarnitine profiles by tandem-mass-spectrometry and the mutation analysis of SLC25A20 gene confirmed the diagnosis of CACTD in both patients. Mutation analysis demonstrated that patient No. 1 was homozygous for c.199-10T>G mutation, while patient No. 2 was a compound heterozygote for 2 mutations, a maternally-inherited c.199-10T>G and a paternally-inherited, novel c.1A>G mutation. Interventions: Both patients were treated with an aggressive treatment regimen include high glucose and arginine infusion, respiratory, and circulatory support. Outcomes: The first proband died 3 days after delivery due to sudden cardiac arrest. The second patient's clinical condition, at one time, was improved by high glucose infusion, intravenous arginine, and circulatory support. However, the patient failed to wean from mechanical ventilation. Unfortunately, her parents refused further treatment due to fear of financial burdens. The patient died of congestive heart failure in the 6th day of life. Lessons: We report the first 2 cases of

Prophage Rs551 and Its Repressor Gene orf14 Reduce Virulence and Increase Competitive Fitness of Its Ralstonia solanacearum Carrier Strain UW551.

PubMed

Ahmad, Abdelmonim Ali; Stulberg, Michael J; Huang, Qi

2017-01-01

We previously characterized a filamentous lysogenic bacteriophage, ϕRs551, isolated directly from the race 3 biovar 2 phylotype IIB sequevar 1 strain UW551 of Ralstonia solanacearum grown under normal culture conditions. The genome of ϕRs551 was identified with 100% identity in the deposited genomes of 11 race 3 biovar 2 phylotype IIB sequevar 1 strains of R. solanacearum , indicating evolutionary and biological importance, and ORF14 of ϕRs551 was annotated as a putative type-2 repressor. In this study, we determined the effect of the prophage and its ORF14 on the virulence and competitive fitness of its carrier strain UW551 by deleting the orf14 gene only (the UW551 orf14 mutant), and nine of the prophage's 14 genes including orf14 and six out of seven structural genes (the UW551 prophage mutant), respectively, from the genome of UW551. The two mutants were increased in extracellular polysaccharide production, twitching motility, expression of targeted virulence and virulence regulatory genes ( pilT, egl, pehC, hrPB, and phcA ), and virulence, suggesting that the virulence of UW551 was negatively regulated by ϕRs551, at least partially through ORF14. Interestingly, we found that the wt ϕRs551-carrying strain UW551 of R. solanacearum significantly outcompeted the wt strain RUN302 which lacks the prophage in tomato plants co-inoculated with the two strains. When each of the two mutant strains was co-inoculated with RUN302, however, the mutants were significantly out-competed by RUN302 for the same colonization site. Our results suggest that ecologically, ϕRs551 may play an important role by regulating the virulence of and offering a competitive fitness advantage to its carrier bacterial strain for persistence of the bacterium in the environment, which in turn prolongs the symbiotic relationship between the phage ϕRs551 and the R. solanacearum strain UW551. Our study is the first toward a better understanding of the co-existence between a lysogenic phage and

5 CFR 551.422 - Time spent traveling.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Time spent traveling. 551.422 Section 551... Activities § 551.422 Time spent traveling. (a) Time spent traveling shall be considered hours of work if: (1... who is permitted to use an alternative mode of transportation, or an employee who travels at a time...

5 CFR 551.422 - Time spent traveling.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 5 Administrative Personnel 1 2013-01-01 2013-01-01 false Time spent traveling. 551.422 Section 551... Activities § 551.422 Time spent traveling. (a) Time spent traveling shall be considered hours of work if: (1... who is permitted to use an alternative mode of transportation, or an employee who travels at a time...

5 CFR 551.422 - Time spent traveling.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 5 Administrative Personnel 1 2011-01-01 2011-01-01 false Time spent traveling. 551.422 Section 551... Activities § 551.422 Time spent traveling. (a) Time spent traveling shall be considered hours of work if: (1... who is permitted to use an alternative mode of transportation, or an employee who travels at a time...

5 CFR 551.422 - Time spent traveling.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 5 Administrative Personnel 1 2012-01-01 2012-01-01 false Time spent traveling. 551.422 Section 551... Activities § 551.422 Time spent traveling. (a) Time spent traveling shall be considered hours of work if: (1... who is permitted to use an alternative mode of transportation, or an employee who travels at a time...

5 CFR 551.422 - Time spent traveling.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 5 Administrative Personnel 1 2014-01-01 2014-01-01 false Time spent traveling. 551.422 Section 551... Activities § 551.422 Time spent traveling. (a) Time spent traveling shall be considered hours of work if: (1... who is permitted to use an alternative mode of transportation, or an employee who travels at a time...

Evaluating the impact of missenses mutations in CYP2D6*7 and CYP2D6*14A: does it compromise tamoxifen metabolism?

PubMed

Borba, Maria Acsm; Melo-Neto, Renato P; Leitão, Glauber M; Castelletti, Carlos Hm; Lima-Filho, José L; Martins, Danyelly Bg

2016-04-01

CYP2D6 is a high polymorphic enzyme from P450, responsible for metabolizing almost 25% of drugs. The distribution of different mutations among CYP2D6 alleles has been associated with poor, intermediate, extensive and ultra-metabolizers. To evaluate how missenses mutations in CYP2D6*7 and CYP2D6*14A poor metabolizer alleles affect CYP2D6 stability and function. CYPalleles database was used to collect polymorphisms data present in 105 alleles. We selected only poor metabolizers alleles that presented exclusively missenses mutations. They were analyzed through seven algorithms to predict the impact on CYP2D6 structure and function. H324P, the unique mutation in CYP2D6*7, has high impact in enzyme function due to its occurrence between two alpha-helixes involved in active site dynamics. G169R, a mutation that occurs only in CYP2D6*14A, leads to the gain of solvent accessibility and severe protein destabilization. Our in silico analysis showed that missenses mutations in CYP2D6*7 and CYP2D6*14A cause CYP2D6 dysfunction.

A common antigenic motif recognized by naturally occurring human VH5-51/VL4-1 anti-tau antibodies with distinct functionalities.

PubMed

Apetri, Adrian; Crespo, Rosa; Juraszek, Jarek; Pascual, Gabriel; Janson, Roosmarijn; Zhu, Xueyong; Zhang, Heng; Keogh, Elissa; Holland, Trevin; Wadia, Jay; Verveen, Hanneke; Siregar, Berdien; Mrosek, Michael; Taggenbrock, Renske; Ameijde, Jeroenvan; Inganäs, Hanna; van Winsen, Margot; Koldijk, Martin H; Zuijdgeest, David; Borgers, Marianne; Dockx, Koen; Stoop, Esther J M; Yu, Wenli; Brinkman-van der Linden, Els C; Ummenthum, Kimberley; van Kolen, Kristof; Mercken, Marc; Steinbacher, Stefan; de Marco, Donata; Hoozemans, Jeroen J; Wilson, Ian A; Koudstaal, Wouter; Goudsmit, Jaap

2018-05-31

Misfolding and aggregation of tau protein are closely associated with the onset and progression of Alzheimer's Disease (AD). By interrogating IgG + memory B cells from asymptomatic donors with tau peptides, we have identified two somatically mutated V H 5-51/V L 4-1 antibodies. One of these, CBTAU-27.1, binds to the aggregation motif in the R3 repeat domain and blocks the aggregation of tau into paired helical filaments (PHFs) by sequestering monomeric tau. The other, CBTAU-28.1, binds to the N-terminal insert region and inhibits the spreading of tau seeds and mediates the uptake of tau aggregates into microglia by binding PHFs. Crystal structures revealed that the combination of V H 5-51 and V L 4-1 recognizes a common Pro-X n -Lys motif driven by germline-encoded hotspot interactions while the specificity and thereby functionality of the antibodies are defined by the CDR3 regions. Affinity improvement led to improvement in functionality, identifying their epitopes as new targets for therapy and prevention of AD.

K-Ras(G12D)-selective inhibitory peptides generated by random peptide T7 phage display technology

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sakamoto, Kotaro; Kamada, Yusuke; Sameshima, Tomoya

Amino-acid mutations of Gly{sup 12} (e.g. G12D, G12V, G12C) of V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (K-Ras), the most promising drug target in cancer therapy, are major growth drivers in various cancers. Although over 30 years have passed since the discovery of these mutations in most cancer patients, effective mutated K-Ras inhibitors have not been marketed. Here, we report novel and selective inhibitory peptides to K-Ras(G12D). We screened random peptide libraries displayed on T7 phage against purified recombinant K-Ras(G12D), with thorough subtraction of phages bound to wild-type K-Ras, and obtained KRpep-2 (Ac-RRCPLYISYDPVCRR-NH{sub 2}) as a consensus sequence. KRpep-2 showedmore » more than 10-fold binding- and inhibition-selectivity to K-Ras(G12D), both in SPR analysis and GDP/GTP exchange enzyme assay. K{sub D} and IC{sub 50} values were 51 and 8.9 nM, respectively. After subsequent sequence optimization, we successfully generated KRpep-2d (Ac-RRRRCPLYISYDPVCRRRR-NH{sub 2}) that inhibited enzyme activity of K-Ras(G12D) with IC{sub 50} = 1.6 nM and significantly suppressed ERK-phosphorylation, downstream of K-Ras(G12D), along with A427 cancer cell proliferation at 30 μM peptide concentration. To our knowledge, this is the first report of a K-Ras(G12D)-selective inhibitor, contributing to the development and study of K-Ras(G12D)-targeting drugs. - Highlights: • The first K-Ras(G12D)-selective inhibitory peptides were generated. • These peptides showed more than 10-fold binding- and inhibition-selectivity to K-Ras(G12D) in compared to wild type K-Ras. • The peptide KRpep-2d suppressed downstream signal of K-Ras(G12D) and cell proliferations of cancer cell line A427.« less

HPLC-ESI-MS/MS analysis of hemoglobin peptides in tryptic digests of dried-blood spot extracts detects HbS, HbC, HbD, HbE, HbO-Arab, and HbG-Philadelphia mutations.

PubMed

Haynes, Christopher A; Guerra, Stephanie L; Fontana, Jessalyn C; DeJesús, Víctor R

2013-09-23

Hemoglobinopathies are mutations resulting in abnormal globin chain structure; some have clinically significant outcomes such as anemia or reduced lifespan. Five β-globin mutations are (c.20A>T, p.E6V), (c.19G>A, p. E6K), (c.79G>A, p.E26K), (c.364G>C, p.E121Q), and (c.364G>A, p.E121K), resulting in HbS (sickle-cell hemoglobin), HbC, HbE, HbD-Los Angeles, and HbO-Arab, respectively. One α-globin mutation is (c.[207C>G or 207C>A], p.N68K), resulting in HbG-Philadelphia. HPLC-ESI-MS/MS analysis of dried-blood spot (DBS) punches from newborns extracted with a trypsin-containing solution provides greater than 90% coverage of α-, β-, and γ-globin amino acid sequences. Because the (c.20A>T, p.E6V), (c.19G>A, p. E6K), (c.79G>A, p.E26K), (c.364G>C, p.E121Q), (c.364G>A, p.E121K), and (c.[207C>G or 207C>A], p.N68K) mutations generate globin peptides with novel amino acid sequences, detecting one of these peptides in DBS extracts is indicative of the presence of a hemoglobinopathy in the newborn. The method described here can distinguish normal β-globin peptides from the mutant HbS, HbC, HbE, HbD-Los Angeles and HbO-Arab peptides, as well as normal α-globin peptide from the mutant HbG-Philadelphia peptide, allowing the identification of unaffected heterozygotes such as HbAS, and of compound heterozygotes such as HbASG-Philadelphia. This HPLC-ESI-MS/MS analytical approach provides information that is not available from traditional hemoglobin analyses such as isoelectric focusing and HPLC-UV. It is also capable of determining the amino acid sequence of hemoglobin peptides, potentially allowing the detection of numerous hemoglobinopathies resulting from point mutations. Published by Elsevier B.V.

Pyrethroid resistance in Sitophilus zeamais is associated with a mutation (T929I) in the voltage-gated sodium channel.

PubMed

Araújo, Rúbia A; Williamson, Martin S; Bass, Christopher; Field, Linda M; Duce, Ian R

2011-08-01

The maize weevil, Sitophilus zeamais, is the most important pest affecting stored grain in Brazil and its control relies heavily on the use of insecticides. The intensive use of compounds such as the pyrethroids has led to the emergence of resistance, and previous studies have suggested that resistance to both pyrethroids and 1,1,1-trichloro-2,2-bis(p-chlorophenyl)ethane (DDT) may result from reduced sensitivity of the insecticide target, the voltage-gated sodium channel. To identify the molecular mechanisms underlying pyrethroid resistance in S. zeamais, the domain II region of the voltage-gated sodium channel (para-orthologue) gene was amplified by PCR and sequenced from susceptible and resistant laboratory S. zeamais strains that were selected with a discriminating dose of DDT. A single point mutation, T929I, was found in the para gene of the resistant S. zeamais populations and its presence in individual weevils was strongly associated with survival after DDT exposure. This is the first identification of a target-site resistance mutation in S. zeamais and unusually it is a super-kdr type mutation occurring in the absence of the more common kdr (L1014F) substitution. A high-throughput assay based on TaqMan single nucleotide polymorphism genotyping was developed for sensitive detection of the mutation and used to screen field-collected strains of S. zeamais. This showed that the mutation is present at low frequency in field populations and is a useful tool for informing control strategies. © 2011 The Authors. Insect Molecular Biology © 2011 The Royal Entomological Society.

Leber's hereditary optic neuropathy is associated with the mitochondrial ND4 G11696A mutation in five Chinese families

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou Xiangtian; Wei Qiping; Yang Li

2006-02-03

We report here the clinical, genetic, and molecular characterization of five Chinese families with Leber's hereditary optic neuropathy (LHON). Clinical and genetic evaluations revealed the variable severity and age-of-onset in visual impairment in these families. Strikingly, there were extremely low penetrances of visual impairment in these Chinese families. Sequence analysis of the complete mitochondrial genomes in these pedigrees showed the distinct sets of mtDNA polymorphism, in addition to the identical ND4 G11696A mutation associated with LHON. Indeed, this mutation is present in homoplasmy only in the maternal lineage of those pedigrees but not other members of these families. In fact,more » the occurrence of the G11696A mutation in these several genetically unrelated subjects affected by visual impairment strongly indicates that this mutation is involved in the pathogenesis of visual impairment. Furthermore, the N405D in the ND5 and G5820A in the tRNA{sup Cys}, showing high evolutional conservation, may contribute to the phenotypic expression of G11696A mutation in the WZ10 pedigree. However, there was the absence of functionally significant mtDNA mutations in other four Chinese pedigrees carrying the G11696A mutation. Therefore, nuclear modifier gene(s) or environmental factor(s) may play a role in the phenotypic expression of the LHON-associated G11696A mutation in these Chinese pedigrees.« less

Adult onset Leigh syndrome with mitochondrial DNA 8344 A>G mutation.

PubMed

Han, Jee-Young; Sung, Jung-Joon; Park, Hong-Kyun; Yoon, Byung-Nam; Lee, Kwang-Woo

2014-11-01

We report a pedigree of adult-onset Leigh syndrome (LS) with mitochondrial mutation 8344 A>G. A 38-year-old woman presented with optic neuropathy, weakness and cognitive impairment. Family history of optic neuropathy and systemic involvement was suggestive of mitochondrial encephalopathy. Genetic and radiologic studies showed m.8344 A>G mutation with characteristics of LS. To our knowledge this is the first case of adult-onset LS demonstrating the m.8344 A>G mutation. Copyright © 2014 Elsevier Ltd. All rights reserved.

10 CFR 55.1 - Purpose.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 10 Energy 2 2014-01-01 2014-01-01 false Purpose. 55.1 Section 55.1 Energy NUCLEAR REGULATORY... of utilization facilities licensed under the Atomic Energy Act of 1954, as amended, or Section 202 of the Energy Reorganization Act of 1974, as amended, and part 50, part 52, or part 54 of this chapter...

10 CFR 55.1 - Purpose.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 10 Energy 2 2010-01-01 2010-01-01 false Purpose. 55.1 Section 55.1 Energy NUCLEAR REGULATORY... of utilization facilities licensed under the Atomic Energy Act of 1954, as amended, or Section 202 of the Energy Reorganization Act of 1974, as amended, and part 50, part 52, or part 54 of this chapter...

Sequence distribution of acetaldehyde-derived N2-ethyl-dG adducts along duplex DNA.

PubMed

Matter, Brock; Guza, Rebecca; Zhao, Jianwei; Li, Zhong-ze; Jones, Roger; Tretyakova, Natalia

2007-10-01

Acetaldehyde (AA) is the major metabolite of ethanol and may be responsible for an increased gastrointestinal cancer risk associated with alcohol beverage consumption. Furthermore, AA is one of the most abundant carcinogens in tobacco smoke and induces tumors of the respiratory tract in laboratory animals. AA binding to DNA induces Schiff base adducts at the exocyclic amino group of dG, N2-ethylidene-dG, which are reversible on the nucleoside level but can be stabilized by reduction to N2-ethyl-dG. Mutagenesis studies in the HPRT reporter gene and in the p53 tumor suppressor gene have revealed the ability of AA to induce G-->A transitions and A-->T transversions, as well as frameshift and splice mutations. AA-induced point mutations are most prominent at 5'-AGG-3' trinucleotides, possibly a result of sequence specific adduct formation, mispairing, and/or repair. However, DNA sequence preferences for the formation of acetaldehyde adducts have not been previously examined. In the present work, we employed a stable isotope labeling-HPLC-ESI+-MS/MS approach developed in our laboratory to analyze the distribution of acetaldehyde-derived N2-ethyl-dG adducts along double-stranded oligodeoxynucleotides representing two prominent lung cancer mutational "hotspots" and their surrounding DNA sequences. 1,7,NH 2-(15)N-2-(13)C-dG was placed at defined positions within DNA duplexes derived from the K-ras protooncogene and the p53 tumor suppressor gene, followed by AA treatment and NaBH 3CN reduction to convert N2-ethylidene-dG to N2-ethyl-dG. Capillary HPLC-ESI+-MS/MS was used to quantify N2-ethyl-dG adducts originating from the isotopically labeled and unlabeled guanine nucleobases and to map adduct formation along DNA duplexes. We found that the formation of N2-ethyl-dG adducts was only weakly affected by the local sequence context and was slightly increased in the presence of 5-methylcytosine within CG dinucleotides. These results are in contrast with sequence

Prophage Rs551 and Its Repressor Gene orf14 Reduce Virulence and Increase Competitive Fitness of Its Ralstonia solanacearum Carrier Strain UW551

PubMed Central

Ahmad, Abdelmonim Ali; Stulberg, Michael J.; Huang, Qi

2017-01-01

We previously characterized a filamentous lysogenic bacteriophage, ϕRs551, isolated directly from the race 3 biovar 2 phylotype IIB sequevar 1 strain UW551 of Ralstonia solanacearum grown under normal culture conditions. The genome of ϕRs551 was identified with 100% identity in the deposited genomes of 11 race 3 biovar 2 phylotype IIB sequevar 1 strains of R. solanacearum, indicating evolutionary and biological importance, and ORF14 of ϕRs551 was annotated as a putative type-2 repressor. In this study, we determined the effect of the prophage and its ORF14 on the virulence and competitive fitness of its carrier strain UW551 by deleting the orf14 gene only (the UW551 orf14 mutant), and nine of the prophage’s 14 genes including orf14 and six out of seven structural genes (the UW551 prophage mutant), respectively, from the genome of UW551. The two mutants were increased in extracellular polysaccharide production, twitching motility, expression of targeted virulence and virulence regulatory genes (pilT, egl, pehC, hrPB, and phcA), and virulence, suggesting that the virulence of UW551 was negatively regulated by ϕRs551, at least partially through ORF14. Interestingly, we found that the wt ϕRs551-carrying strain UW551 of R. solanacearum significantly outcompeted the wt strain RUN302 which lacks the prophage in tomato plants co-inoculated with the two strains. When each of the two mutant strains was co-inoculated with RUN302, however, the mutants were significantly out-competed by RUN302 for the same colonization site. Our results suggest that ecologically, ϕRs551 may play an important role by regulating the virulence of and offering a competitive fitness advantage to its carrier bacterial strain for persistence of the bacterium in the environment, which in turn prolongs the symbiotic relationship between the phage ϕRs551 and the R. solanacearum strain UW551. Our study is the first toward a better understanding of the co-existence between a lysogenic phage and

Targeting a genetic defect: cystic fibrosis transmembrane conductance regulator modulators in cystic fibrosis.

PubMed

Derichs, Nico

2013-03-01

Cystic fibrosis (CF) is caused by genetic mutations that affect the cystic fibrosis transmembrane conductance regulator (CFTR) protein. These mutations can impact the synthesis and transfer of the CFTR protein to the apical membrane of epithelial cells, as well as influencing the gating or conductance of chloride and bicarbonate ions through the channel. CFTR dysfunction results in ionic imbalance of epithelial secretions in several organ systems, such as the pancreas, gastrointestinal tract, liver and the respiratory system. Since discovery of the CFTR gene in 1989, research has focussed on targeting the underlying genetic defect to identify a disease-modifying treatment for CF. Investigated management strategies have included gene therapy and the development of small molecules that target CFTR mutations, known as CFTR modulators. CFTR modulators are typically identified by high-throughput screening assays, followed by preclinical validation using cell culture systems. Recently, one such modulator, the CFTR potentiator ivacaftor, was approved as an oral therapy for CF patients with the G551D-CFTR mutation. The clinical development of ivacaftor not only represents a breakthrough in CF care but also serves as a noteworthy example of personalised medicine.

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

PubMed

Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

2017-10-01

Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

The mitochondrial 13513G>A mutation is associated with Leigh disease phenotypes independent of complex I deficiency in muscle.

PubMed

Brautbar, Ariel; Wang, Jing; Abdenur, Jose E; Chang, Richard C; Thomas, Janet A; Grebe, Theresa A; Lim, Cynthia; Weng, Shao-Wen; Graham, Brett H; Wong, Lee-Jun

2008-08-01

The mitochondrial 13513G>A (D393N) mutation in the ND5 subunit of the respiratory chain complex I was initially described in association with MELAS syndrome. Recent observations have linked this mutation to Leigh disease. We screened for the 13513G>A mutation in a cohort of 265 patients with Leigh and Leigh-like disease. The mutation was found in a total of 5 patients. An additional patient who had clinical presentation consistent with a Leigh-like phenotype but with a normal brain MRI was added to the cohort. None of an additional 88 patients meeting MELAS disease criteria, nor 56 patients with respiratory chain deficiency screened for the 13513G>A were found positive for the mutation. The most frequent clinical manifestations in our patients were hypotonia, ocular and cerebellar involvement. Low mutation heteroplasmy in the range of 20-40% was observed in all 6 patients. This observation is consistent with the previously reported low heteroplasmy of this mutation in some patients with the 13513G>A mutation and complex I deficiency. However, normal complex I activity was observed in two patients in our cohort. As most patients with Leigh-like disease and the 13513G>A mutation have been described with complex I deficiency, this report adds to the previously reported subset of patients with normal respiratory complex function. We conclude that in any patient with Leigh or Leigh-like disease, testing for the 13513G>A mutation is clinically relevant and low mutant loads in blood or muscle may be considered pathogenic, in the presence of normal respiratory chain enzyme activities.

40 CFR 415.551 - Specialized definitions.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 40 Protection of Environment 29 2011-07-01 2009-07-01 true Specialized definitions. 415.551 Section 415.551 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS INORGANIC CHEMICALS MANUFACTURING POINT SOURCE CATEGORY Sodium Fluoride Production...

Sci-Thur PM: YIS - 03: Comparing 4D-VMAT, Gated-VMAT and 3D-VMAT in SBRT treatment of lung cancer.

PubMed

Chin, E; Loewen, S; Nichol, A; Otto, K

2012-07-01

To evaluate the treatment plan qualities of 4D-VMAT, gated-VMAT and 3D-VMAT in the treatment of non-small cell lung cancer (NSCLC) in stereotactic body radiation therapy (SBRT). 4D-VMAT is a motion compensation strategy that aims to exploit relative target and OAR motion to increase OAR sparing over 3D-VMAT without the long treatment times associated with gated-VMAT. The 4D-VMAT algorithm incorporates the entire patient respiratory cycle and 4D-CT in the optimization process. Resulting treatment plans synchronize the delivery of each MLC aperture to a specific phase of the target motion. Using software developed in Matlab™, SBRT treatment plans for 4D-VMAT, gated-VMAT and 3D-VMAT were generated on 3 patients with NSCLC. Tumour motion ranged from 1.4-3.4 cm. The fractionation scheme was 48Gy in 4 fractions with the GTV receiving 100% of the prescribed dose. For gated-VMAT, the treatment window constrained residual tumour motion to 3 mm or less corresponding to duty cycles of 40-60%. In 3D-VMAT, the ITV was generated by merging the GTV from all phases. A b-spline transformation model was used to register the 4D-CT images and DVHs were calculated from total dose accumulated on the max expiration phase. For the majority of OARs, gated-VMAT provided the greatest radiation sparing but significantly extended treatment times (25-35 gantry interruptions/arc). For 3D-VMAT, only 2 patients had clinically acceptable plans that met all the strict dose limits. OAR sparing in 4D-VMAT was comparable to gated-VMAT but with significantly improved delivery efficiency. © 2012 American Association of Physicists in Medicine.

5 CFR 551.210 - Computer employees.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Computer employees. 551.210 Section 551.210 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS PAY... solve complex business, scientific or engineering problems of the organization or the organization's...

5 CFR 551.202 - General principles.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 5 Administrative Personnel 1 2013-01-01 2013-01-01 false General principles. 551.202 Section 551.202 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS PAY... preclude exemption under another category. For example, an engineering technician who fails to meet the...

5 CFR 551.202 - General principles.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 5 Administrative Personnel 1 2011-01-01 2011-01-01 false General principles. 551.202 Section 551.202 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS PAY... preclude exemption under another category. For example, an engineering technician who fails to meet the...

5 CFR 551.202 - General principles.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 5 Administrative Personnel 1 2012-01-01 2012-01-01 false General principles. 551.202 Section 551.202 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS PAY... preclude exemption under another category. For example, an engineering technician who fails to meet the...

5 CFR 551.202 - General principles.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false General principles. 551.202 Section 551.202 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS PAY... preclude exemption under another category. For example, an engineering technician who fails to meet the...

28 CFR 551.34 - Organization activities.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 28 Judicial Administration 2 2011-07-01 2011-07-01 false Organization activities. 551.34 Section 551.34 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT..., but are not limited to, meetings, guest speakers, sports competitions, banquets, or community programs...

28 CFR 551.34 - Organization activities.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 28 Judicial Administration 2 2014-07-01 2014-07-01 false Organization activities. 551.34 Section 551.34 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT..., but are not limited to, meetings, guest speakers, sports competitions, banquets, or community programs...

28 CFR 551.34 - Organization activities.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 28 Judicial Administration 2 2012-07-01 2012-07-01 false Organization activities. 551.34 Section 551.34 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT..., but are not limited to, meetings, guest speakers, sports competitions, banquets, or community programs...

28 CFR 551.34 - Organization activities.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 28 Judicial Administration 2 2013-07-01 2013-07-01 false Organization activities. 551.34 Section 551.34 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT..., but are not limited to, meetings, guest speakers, sports competitions, banquets, or community programs...

Mutational Hotspots in the Mitochondrial D-Loop Region of Cancerous and Precancerous Colorectal Lesions in Egyptian Patients

PubMed Central

El-Guendy, Nadia; Tantawy, Marwa; Abdelhady, Hala; El-Ghor, Akmal; Abdel Wahab, Abdel Hady

2011-01-01

Mutations in the mitochondrial genome (mtDNA) are associated with different types of cancer, specifically colorectal cancer (CRC). However, few studies have been performed on precancerous lesions, such as ulcerative colitis (UC) lesions and adenomatous polyps (AP). The aim of this study was to identify mtDNA mutations in the cancerous and precancerous lesions of Egyptian patients. An analysis of the mutations found in six regions of the mtDNA genome (ND1, ND5, COI, tRNAser, D-loop 1, and 2) in 80 Egyptian patients (40 CRC, 20 UC, and 20 AP) was performed using polymerase chain reaction–single-strand conformational polymorphism techniques and followed up by direct sequencing. The overall incidence of mutations was 25%, 25%, and 35% in CRC, UC, and AP cases, respectively. Although there was no common mutation pattern within each group, a large number of mutations were detected in the D-loop region in all of the groups. Some mutations (e.g., T414G) were detected repeatedly in precancerous (UC and AP) and cancerous lesions. Mutations detected in patients with CRC were predominantly found in the ND1 gene (40%). Our preliminary study suggests that Egyptian patients with CRC have a large number of mtDNA mutations, especially in the D-loop region, which have not been previously reported. Mutations in the mtDNA of precancerous lesions (i.e., AP and UC) may contribute to transformation events that lead to CRC. PMID:21612400

Strength and fatigue of NT551 silicon nitride and NT551 diesel exhaust valves

DOE Office of Scientific and Technical Information (OSTI.GOV)

Andrews, M.J.; Werezczak, A.A.; Kirkland, T.P.

2000-02-01

The content of this report is excerpted from Mark Andrew's Ph.D. Thesis (Andrews, 1999), which was funded by a DOE/OTT High Temperature Materials Laboratory Graduate Fellowship. It involves the characterization of NT551 and valves fabricated with it. The motivations behind using silicon nitride (Si{sub 3}N{sub 4}) as an exhaust valve for a diesel engine are presented in this section. There are several economic factors that have encouraged the design and implementation of ceramic components for internal combustion (IC) engines. The reasons for selecting the diesel engine valve for this are also presented.

A nicotinic acetylcholine receptor transmembrane point mutation (G275E) associated with resistance to spinosad in Frankliniella occidentalis.

PubMed

Puinean, Alin M; Lansdell, Stuart J; Collins, Toby; Bielza, Pablo; Millar, Neil S

2013-03-01

High levels of resistance to spinosad, a macrocyclic lactone insecticide, have been reported previously in western flower thrips, Frankliniella occidentalis, an economically important insect pest of vegetables, fruit and ornamental crops. We have cloned the nicotinic acetylcholine receptor (nAChR) α6 subunit from F. occidentalis (Foα6) and compared the nucleotide sequence of Foα6 from susceptible and spinosad-resistant insect populations (MLFOM and R1S respectively). A single nucleotide change has been identified in Foα6, resulting in the replacement of a glycine (G) residue in susceptible insects with a glutamic acid (E) in resistant insects. The resistance-associated mutation (G275E) is predicted to lie at the top of the third α-helical transmembrane domain of Foα6. Although there is no direct evidence identifying the location of the spinosad binding site, the analogous amino acid in the C. elegans glutamate-gated chloride channel lies in close proximity (4.4 Å) to the known binding site of ivermectin, another macrocyclic lactone pesticide. The functional consequences of the resistance-associated mutation have been examined in the human nAChR α7 subunit. Introduction of an analogous (A272E) mutation in α7 abolishes the modulatory effects of spinosad whilst having no significant effect upon activation by acetylcholine, consistent with spinosad having an allosteric mechanism of action. © 2012 International Society for Neurochemistry.

The 253-kb inversion and deep intronic mutations in UNC13D are present in North American patients with familial hemophagocytic lymphohistiocytosis 3.

PubMed

Qian, Yaping; Johnson, Judith A; Connor, Jessica A; Valencia, C Alexander; Barasa, Nathaniel; Schubert, Jeffery; Husami, Ammar; Kissell, Diane; Zhang, Ge; Weirauch, Matthew T; Filipovich, Alexandra H; Zhang, Kejian

2014-06-01

The mutations in UNC13D are responsible for familial hemophagocytic lymphohistiocytosis (FHL) type 3. A 253-kb inversion and two deep intronic mutations, c.118-308C > T and c.118-307G > A, in UNC13D were recently reported in European and Asian FHL3 patients. We sought to determine the prevalence of these three non-coding mutations in North American FHL patients and evaluate the significance of examining these new mutations in genetic testing. We performed DNA sequencing of UNC13D and targeted analysis of these three mutations in 1,709 North American patients with a suspected clinical diagnosis of hemophagocytic lymphohistiocytosis (HLH). The 253-kb inversion, intronic mutations c.118-308C > T and c.118-307G > A were found in 11, 15, and 4 patients, respectively, in which the genetic basis (bi-allelic mutations) explained 25 additional patients. Taken together with previously diagnosed FHL3 patients in our HLH patient registry, these three non-coding mutations were found in 31.6% (25/79) of the FHL3 patients. The 253-kb inversion, c.118-308C > T and c.118-307G > A accounted for 7.0%, 8.9%, and 1.3% of mutant alleles, respectively. Significantly, eight novel mutations in UNC13D are being reported in this study. To further evaluate the expression level of the newly reported intronic mutation c.118-307G > A, reverse transcription PCR and Western blot analysis revealed a significant reduction of both RNA and protein levels suggesting that the c.118-307G > A mutation affects transcription. These specified non-coding mutations were found in a significant number of North American patients and inclusion of them in mutation analysis will improve the molecular diagnosis of FHL3. © 2014 Wiley Periodicals, Inc.

Amylin S20G mutation in Mexican population.

PubMed

Garcia-Gonzalez, Claudia Lorena; Montoya-Fuentes, Hector; Padilla-Rosas, Miguel; Sanchez-Corona, Jose

2007-04-01

Diabetes Mellitus type 2 (DM2) is a group of metabolic disorders characterized by defective insulin action or secretion or both with a 10.6% incidence in Mexican Mestizo population, DM2 is also classified within the localized misfolding diseases due to the amyloid pancreatic deposits found in 90% of the DM2 necropsies. The pancreatic amyloid main component is a protein known as human islet amyloid polypeptide (hIAPP) or amylin, the most common mutation is the S20G in Asian population with a polymorphic frequency in DM2 Asian patients. The aim of this study was to search this mutation in Mexican Mestizo general population (104) and DM2 patients (100). This is the first molecular study of hIAPP gene in Mexican population and in which we developed an alternative more effective antisense primer for the analysis of the NFGAILSS region in hIAPP exon 3 critical for the amyloid beta structure formation. We did not find the mutation in any of the 204 analyzed samples, thus the findings show that S20G is not a common mutation in Mexican Mestizo population.

Sequence specificity of mutagen-nucleic acid complexes in solution: intercalation and mutagen-base pair overlap geometries for proflavine binding to dC-dC-dG-dG and dG-dG-dC-dC self-complementary duplexes.

PubMed

Patel, D J; Canuel, L L

1977-07-01

The complex formed between the mutagen proflavine and the dC-dC-dG-dG and dG-dG-dC-dC self-complementary tetranucleotide duplexes has been monitored by proton high resolution nuclear magnetic resonance spectroscopy in 0.1 M phosphate solution at high nucleotide/drug ratios. The large upfield shifts (0.5 to 0.85 ppm) observed at all the proflavine ring nonexchangeable protons on complex formation are consistent with intercalation of the mutagen between base pairs of the tetranucleotide duplex. We have proposed an approximate overlap geometry between the proflavine ring and nearest neighbor base pairs at the intercalation site from a comparison between experimental shifts and those calculated for various stacking orientations. We have compared the binding of actinomycin D, propidium diiodide, and proflavine to self-complementary tetranucleotide sequences dC-dC-dG-dG and dG-dG-dC-dC by UV absorbance changes in the drug bands between 400 and 500 nm. Actinomycin D exhibits a pronounced specificity for sequences with dG-dC sites (dG-dG-dC-dC), while propidium diiodide and proflavine exhibit a specificity for sequences with dC-dG sites (dC-dC-dG-dG). Actinomycin D binds more strongly than propidium diiodide and proflavine to dC-dG-dC-dG (contains dC-dG and dG-dC binding sites), indicative of the additional stabilization from hydrogen bonding and hydrophobic interactions between the pentapeptide lactone rings of actinomycin D and the base pair edges and sugar-phosphate backbone of the tetranucleotide duplex.

Sequence specificity of mutagen-nucleic acid complexes in solution: Intercalation and mutagen-base pair overlap geometries for proflavine binding to dC-dC-dG-dG and dG-dG-dC-dC self-complementary duplexes

PubMed Central

Patel, Dinshaw J.; Canuel, Lita L.

1977-01-01

The complex formed between the mutagen proflavine and the dC-dC-dG-dG and dG-dG-dC-dC self-complementary tetranucleotide duplexes has been monitored by proton high resolution nuclear magnetic resonance spectroscopy in 0.1 M phosphate solution at high nucleotide/drug ratios. The large upfield shifts (0.5 to 0.85 ppm) observed at all the proflavine ring nonexchangeable protons on complex formation are consistent with intercalation of the mutagen between base pairs of the tetranucleotide duplex. We have proposed an approximate overlap geometry between the proflavine ring and nearest neighbor base pairs at the intercalation site from a comparison between experimental shifts and those calculated for various stacking orientations. We have compared the binding of actinomycin D, propidium diiodide, and proflavine to self-complementary tetranucleotide sequences dC-dC-dG-dG and dG-dG-dC-dC by UV absorbance changes in the drug bands between 400 and 500 nm. Actinomycin D exhibits a pronounced specificity for sequences with dG-dC sites (dG-dG-dC-dC), while propidium diiodide and proflavine exhibit a specificity for sequences with dC-dG sites (dC-dC-dG-dG). Actinomycin D binds more strongly than propidium diiodide and proflavine to dC-dG-dC-dG (contains dC-dG and dG-dC binding sites), indicative of the additional stabilization from hydrogen bonding and hydrophobic interactions between the pentapeptide lactone rings of actinomycin D and the base pair edges and sugar-phosphate backbone of the tetranucleotide duplex. PMID:268613

Mutations in the G6PC3 gene cause Dursun syndrome.

PubMed

Banka, Siddharth; Newman, William G; Ozgül, R Koksal; Dursun, Ali

2010-10-01

Dursun syndrome is a triad of familial primary pulmonary hypertension, leucopenia, and atrial septal defect. Here we demonstrate that mutations in G6PC3 cause Dursun syndrome. Mutations in G6PC3 are known to also cause severe congenital neutropenia type 4. Identification of the genetic basis of Dursun syndrome expands the pre-existing knowledge about the phenotypic effects of mutations in G6PC3. We propose that Dursun syndrome should now be considered as a subset of severe congenital neutropenia type 4 with pulmonary hypertension as an important clinical feature. Copyright © 2010 Wiley-Liss, Inc.

G20210A prothrombin gene mutation identified in patients with venous leg ulcers.

PubMed

Jebeleanu, G; Procopciuc, L

2001-01-01

The G20210A mutation variant of prothrombin gene is the second most frequent mutation identified in patients with deep venous thrombosis, after factor V Leiden. The risk for developing deep venous thrombosis is high in patients identified as heterozygous for G20210A mutation. In order to identify this polymorphism in the gene coding prothrombin, the 345bp fragment in the 3'- untranslated region of the prothrombin gene was amplified using amplification by polymerase chain reaction and enzymatic digestion by HindIII (restriction endonuclease enzyme). The products of amplification and enzymatic's digestion were analized using agarose gel electrophoresis. We investigated 20 patients with venous leg ulcers and we found 2 heterozygous (10%) for G20210A mutation. None of the patients in the control group had G20210A mutation. Our study confirms the presence of G20210A mutation in the Romanian population. Our study also shows the link between venous leg ulcers and this polymorphism in the prothrombin gene.

45 CFR 5.51 - Records available.

Code of Federal Regulations, 2013 CFR

2013-10-01

... of Finding issued by the Office for Civil Rights in civil rights complaints, and Social Security... 45 Public Welfare 1 2013-10-01 2013-10-01 false Records available. 5.51 Section 5.51 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL ADMINISTRATION FREEDOM OF INFORMATION REGULATIONS...

45 CFR 5.51 - Records available.

Code of Federal Regulations, 2012 CFR

2012-10-01

... of Finding issued by the Office for Civil Rights in civil rights complaints, and Social Security... 45 Public Welfare 1 2012-10-01 2012-10-01 false Records available. 5.51 Section 5.51 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL ADMINISTRATION FREEDOM OF INFORMATION REGULATIONS...

31 CFR 551.309 - United States.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 551.309 Section 551.309 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF....309 United States. The term United States means the United States, its territories and possessions...

The Helicoverpa zea (Boddie) (Lepidoptera: Noctuidae) voltage-gated sodium channel and mutations associated with pyrethroid resistance in field-collected adult males.

PubMed

Hopkins, B W; Pietrantonio, P V

2010-05-01

Helicoverpa zea is one of the most costly insect pests of food and fiber crops throughout the Americas. Pyrethroid insecticides are widely applied for its control as they are effective and relatively inexpensive; however, resistance to pyrethroids threatens agricultural systems sustainability because alternative insecticides are often more expensive or less effective. Although pyrethroid resistance has been identified in this pest since 1990, the mechanisms of resistance have not yet been elucidated at the molecular level. Pyrethroids exert their toxicity by prolonging the open state of the voltage-gated sodium channel. Here we report the cDNA sequence of the H. zea sodium channel alpha-subunit homologous to the para gene from Drosophila melanogaster. In field-collected males which were resistant to cypermethrin as determined by the adult vial test, we identify known resistance-conferring mutations L1029H and V421M, along with two novel mutations at the V421 residue, V421A and V421G. An additional mutation, I951V, may be the first example of a pyrethroid resistance mutation caused by RNA editing. Identification of the sodium channel cDNA sequence will allow for testing hypotheses on target-site resistance for insecticides acting on this channel through modeling and expression studies. Understanding the mechanisms responsible for resistance will greatly improve our ability to identify and predict resistance, as well as preserve susceptibility to pyrethroid insecticides. Copyright 2010 Elsevier Ltd. All rights reserved.

31 CFR 551.309 - United States.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 31 Money and Finance:Treasury 3 2011-07-01 2011-07-01 false United States. 551.309 Section 551.309 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF FOREIGN... United States. The term United States means the United States, its territories and possessions, and all...

31 CFR 551.309 - United States.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 31 Money and Finance:Treasury 3 2014-07-01 2014-07-01 false United States. 551.309 Section 551.309 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF FOREIGN... United States. The term United States means the United States, its territories and possessions, and all...

31 CFR 551.309 - United States.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 31 Money and Finance:Treasury 3 2012-07-01 2012-07-01 false United States. 551.309 Section 551.309 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF FOREIGN... United States. The term United States means the United States, its territories and possessions, and all...

31 CFR 551.309 - United States.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 31 Money and Finance:Treasury 3 2013-07-01 2013-07-01 false United States. 551.309 Section 551.309 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF FOREIGN... United States. The term United States means the United States, its territories and possessions, and all...

31 CFR 551.302 - Effective date.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 31 Money and Finance:Treasury 3 2011-07-01 2011-07-01 false Effective date. 551.302 Section 551....302 Effective date. The term effective date refers to the effective date of the applicable... the date of actual or constructive notice that such person's property and interests in property are...

47 CFR 90.551 - Construction requirements.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 47 Telecommunication 5 2012-10-01 2012-10-01 false Construction requirements. 90.551 Section 90...-775 and 793-805 MHz Bands § 90.551 Construction requirements. Each station authorized under this..., licensees may request a longer construction period, up to but not exceeding 5 years, pursuant to § 90.155(b...

47 CFR 90.551 - Construction requirements.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 47 Telecommunication 5 2014-10-01 2014-10-01 false Construction requirements. 90.551 Section 90...-775 and 793-805 MHz Bands § 90.551 Construction requirements. Each station authorized under this..., licensees may request a longer construction period, up to but not exceeding 5 years, pursuant to § 90.155(b...

A novel CYP27B1 mutation causes a feline vitamin D-dependent rickets type IA.

PubMed

Grahn, Robert A; Ellis, Melanie R; Grahn, Jennifer C; Lyons, Leslie A

2012-08-01

A 12-week-old domestic cat presented at a local veterinary clinic with hypocalcemia and skeletal abnormalities suggestive of rickets. Osteomalacia (rickets) is a disease caused by impaired bone mineralization leading to an increased prevalence of fractures and deformity. Described in a variety of species, rickets is most commonly caused by vitamin D or calcium deficiencies owing to both environmental and or genetic abnormalities. Vitamin D-dependent rickets type 1A (VDDR-1A) is a result of the enzymatic pathway defect caused by mutations in the 25-hydroxyvitamin D(3)-1-alpha-hydroxylase gene [cytochrome P27 B1 (CYP27B1)]. Calcitriol, the active form of vitamin D(3), regulates calcium homeostasis, which requires sufficient dietary calcium availability and correct hormonal function for proper bone growth and maintenance. Patient calcitriol concentrations were low while calcidiol levels were normal suggestive of VDDR-1A. The entire DNA coding sequencing of CYP27B1 was evaluated. The affected cat was wild type for previously identified VDDR-1A causative mutations. However, six novel mutations were identified, one of which was a nonsense mutation at G637T in exon 4. The exon 4 G637T nonsense mutation results in a premature protein truncation, changing a glutamic acid to a stop codon, E213X, likely causing the clinical presentation of rickets. The previously documented genetic mutation resulting in feline VDDR-1A rickets, as well as the case presented in this research, result from novel exon 4 CYP27B1 mutations, thus exon 4 should be the initial focus of future sequencing efforts.

Retrospectively gated intracardiac 4D flow MRI using spiral trajectories.

PubMed

Petersson, Sven; Sigfridsson, Andreas; Dyverfeldt, Petter; Carlhäll, Carl-Johan; Ebbers, Tino

2016-01-01

To develop and evaluate retrospectively gated spiral readout four-dimensional (4D) flow MRI for intracardiac flow analysis. Retrospectively gated spiral 4D flow MRI was implemented on a 1.5-tesla scanner. The spiral sequence was compared against conventional Cartesian 4D flow (SENSE [sensitivity encoding] 2) in seven healthy volunteers and three patients (only spiral). In addition to comparing flow values, linear regression was used to assess internal consistency of aortic versus pulmonary net volume flows and left ventricular inflow versus outflow using quantitative pathlines analysis. Total scan time with spiral 4D flow was 44% ± 6% of the Cartesian counterpart (13 ± 3 vs. 31 ± 7 min). Aortic versus pulmonary flow correlated strongly for the spiral sequence (P < 0.05, slope = 1.03, R(2) = 0.88, N = 10), whereas the linear relationship for the Cartesian sequence was not significant (P = 0.06, N = 7). Pathlines analysis indicated good data quality for the spiral (P < 0.05, slope = 1.02, R(2) = 0.90, N = 10) and Cartesian sequence (P < 0.05, slope = 1.10, R(2) = 0.93, N = 7). Spiral and Cartesian peak flow rate (P < 0.05, slope = 0.96, R(2) = 0.72, N = 14), peak velocity (P < 0.05, slope = 1.00, R(2) = 0.81, N = 14), and pathlines flow components (P < 0.05, slope = 1.04, R(2) = 0.87, N = 28) correlated well. Retrospectively gated spiral 4D flow MRI permits more than two-fold reduction in scan time compared to conventional Cartesian 4D flow MRI, while maintaining similar data quality. © 2015 Wiley Periodicals, Inc.

Novel point mutations and mutational complexes in the enhancer II, core promoter and precore regions of hepatitis B virus genotype D1 associated with hepatocellular carcinoma in Saudi Arabia.

PubMed

Khan, Anis; Al Balwi, Mohammed A; Tanaka, Yasuhito; Hajeer, Ali; Sanai, Faisal M; Al Abdulkarim, Ibrahim; Al Ayyar, Latifah; Badri, Motasim; Saudi, Dib; Tamimi, Waleed; Mizokami, Masashi; Al Knawy, Bandar

2013-12-15

In this study, a cohort of 182 patients [55 hepatocellular carcinoma (HCC) and 127 non-HCC] infected with hepatitis B virus (HBV) in Saudi Arabia was investigated to study the relationship between sequence variation in the enhancer II (EnhII), basal core promoter (BCP) and precore regions of HBV genotype D (HBV/D) and the risk of HCC. HBV genotypes were determined by sequencing analysis and/or enzyme-linked immunosorbent assay. Variations in the EnhII, BCP and precore regions were compared between 107 non-HCC and 45 HCC patients infected with HBV/D, followed by age-matched analysis of 40 cases versus equal number of controls. Age and male gender were significantly associated with HCC (p = 0.0001 and p = 0.03, respectively). Serological markers such as aspartate aminotransferase, albumin and anti-HBe were significantly associated with HCC (p = 0.0001 for all), whereas HBeAg positivity was associated with non-HCC (p = 0.0001). The most prevalent HBV genotype was HBV/D (94%), followed by HBV/E (4%), HBV/A (1.6%) and HBV/C (0.5%). For HBV/D1, genomic mutations associated with HCC were T1673/G1679, G1727, C1741, C1761, A1757/T1764/G1766, T1773, T1773/G1775 and C1909. Age- and gender-adjusted stepwise logistic regression analysis indicated that mutations G1727 [odds ratio (OR) = 18.3; 95% confidence interval (CI) = 2.8-118.4; p = 0.002], A1757/T1764/G1766 (OR = 4.7; 95% CI = 1.3-17.2; p = 0.01) and T1773 (OR = 14.06; 95% CI = 2.3-84.8; p = 0.004) are independent predictors of HCC development. These results implicate novel individual and combination patterns of mutations in the X/precore region of HBV/D1 as predictors of HCC. Risk stratification based on these mutation complexes would be useful in determining high-risk patients and improving diagnostic and treatment strategies for HBV/D1. Copyright © 2013 UICC.

Mutational analysis of the transcriptional activator VirG of Agrobacterium tumefaciens.

PubMed Central

Scheeren-Groot, E P; Rodenburg, K W; den Dulk-Ras, A; Turk, S C; Hooykaas, P J

1994-01-01

To find VirG proteins with altered properties, the virG gene was mutagenized. Random chemical mutagenesis of single-stranded DNA containing the Agrobacterium tumefaciens virG gene led with high frequency to the inactivation of the gene. Sequence analysis showed that 29% of the mutants contained a virG gene with one single-base-pair substitution somewhere in the open reading frame. Thirty-nine different mutations that rendered the VirG protein inactive were mapped. Besides these inactive mutants, two mutants in which the vir genes were active even in the absence of acetosyringone were found on indicator plates. A VirG protein with an N54D substitution turned out to be able to induce a virB-lacZ reporter gene to a high level even in the absence of the inducer acetosyringone. A VirG protein with an I77V substitution exhibited almost no induction in the absence of acetosyringone but showed a maximum induction level already at low concentrations of acetosyringone. Images PMID:7961391

Quantifying the impact of respiratory-gated 4D CT acquisition on thoracic image quality: a digital phantom study.

PubMed

Bernatowicz, K; Keall, P; Mishra, P; Knopf, A; Lomax, A; Kipritidis, J

2015-01-01

Prospective respiratory-gated 4D CT has been shown to reduce tumor image artifacts by up to 50% compared to conventional 4D CT. However, to date no studies have quantified the impact of gated 4D CT on normal lung tissue imaging, which is important in performing dose calculations based on accurate estimates of lung volume and structure. To determine the impact of gated 4D CT on thoracic image quality, the authors developed a novel simulation framework incorporating a realistic deformable digital phantom driven by patient tumor motion patterns. Based on this framework, the authors test the hypothesis that respiratory-gated 4D CT can significantly reduce lung imaging artifacts. Our simulation framework synchronizes the 4D extended cardiac torso (XCAT) phantom with tumor motion data in a quasi real-time fashion, allowing simulation of three 4D CT acquisition modes featuring different levels of respiratory feedback: (i) "conventional" 4D CT that uses a constant imaging and couch-shift frequency, (ii) "beam paused" 4D CT that interrupts imaging to avoid oversampling at a given couch position and respiratory phase, and (iii) "respiratory-gated" 4D CT that triggers acquisition only when the respiratory motion fulfills phase-specific displacement gating windows based on prescan breathing data. Our framework generates a set of ground truth comparators, representing the average XCAT anatomy during beam-on for each of ten respiratory phase bins. Based on this framework, the authors simulated conventional, beam-paused, and respiratory-gated 4D CT images using tumor motion patterns from seven lung cancer patients across 13 treatment fractions, with a simulated 5.5 cm(3) spherical lesion. Normal lung tissue image quality was quantified by comparing simulated and ground truth images in terms of overall mean square error (MSE) intensity difference, threshold-based lung volume error, and fractional false positive/false negative rates. Averaged across all simulations and phase bins

Coexpression of alpha and beta subunits of the rod cyclic GMP-gated channel restores native sensitivity to cyclic AMP: role of D604/N1201.

PubMed Central

Pagès, F; Ildefonse, M; Ragno, M; Crouzy, S; Bennett, N

2000-01-01

Coexpression of the betawt and alphawt subunits of the bovine rod channel restores two characteristics of the native channels: higher sensitivity to cAMP and potentiation of cGMP-induced currents by low cAMP concentrations. To test whether the increased sensitivity to cAMP is due to the uncharged nature of the asparagine residue (N1201) situated in place of aspartate D604 in the beta subunit as previously suggested (, Neuron. 15:619-625), we compared currents from wild-type (alphawt and alphawt/betawt) and from mutated channels (alphaD604N, alphaD604N/betawt, and alphawt/betaN1201D). The results show that the sensitivity to cAMP and cAMP potentiation is partly but not entirely determined by the charge of residue 1201 in the beta subunit. The D604N mutation in the alpha subunit and, to a lesser extent, coexpression of the betawt subunit with the alphawt subunit reduce the open probability for cGMP compared to that of the alphawt channel. Interpretation of the data with the MWC allosteric model (model of Monod, Wyman, Changeux;, J. Mol. Biol. 12:88-118) suggests that the D604N mutation in the alpha subunits and coassembly of alpha and beta subunits alter the free energy of gating by cAMP more than that of cAMP binding. PMID:10692312

31 CFR 551.307 - Property; property interest.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 31 Money and Finance:Treasury 3 2011-07-01 2011-07-01 false Property; property interest. 551.307 Section 551.307 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE... or interests therein, present, future, or contingent. ...

31 CFR 551.307 - Property; property interest.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 31 Money and Finance:Treasury 3 2014-07-01 2014-07-01 false Property; property interest. 551.307 Section 551.307 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE... or interests therein, present, future, or contingent. ...

31 CFR 551.307 - Property; property interest.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 31 Money and Finance:Treasury 3 2013-07-01 2013-07-01 false Property; property interest. 551.307 Section 551.307 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE... or interests therein, present, future, or contingent. ...

31 CFR 551.307 - Property; property interest.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 31 Money and Finance:Treasury 3 2012-07-01 2012-07-01 false Property; property interest. 551.307 Section 551.307 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE... or interests therein, present, future, or contingent. ...

31 CFR 551.307 - Property; property interest.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Property; property interest. 551.307 Section 551.307 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE... or interests therein, present, future, or contingent. ...

Wild-type catalase peroxidase vs G279D mutant type: Molecular basis of Isoniazid drug resistance in Mycobacterium tuberculosis.

PubMed

Singh, Aishwarya; Singh, Aditi; Grover, Sonam; Pandey, Bharati; Kumari, Anchala; Grover, Abhinav

2018-01-30

Mycobacterium tuberculosis katG gene is responsible for production of an enzyme catalase peroxidase that peroxidises and activates the prodrug Isoniazid (INH), a first-line antitubercular agent. INH interacts with catalase peroxidase enzyme within its heme pocket and gets converted to an active form. Mutations occurring in katG gene are often linked to reduced conversion rates for INH. This study is focussed on one such mutation occurring at residue 279, where glycine often mutates to aspartic acid (G279D). In the present study, several structural analyses were performed to study the effect of this mutation on functionality of KatG protein. On comparison, mutant protein exhibited a lower docking score, smaller binding cavity and reduced affinity towards INH. Molecular dynamics analysis revealed the mutant to be more rigid and less compact than the native protein. Essential dynamics analysis determined correlated motions of residues within the protein structure. G279D mutant was found to have many residues that showed related motions and an undesirable effect on the functionality of protein. Copyright © 2017 Elsevier B.V. All rights reserved.

Restoring Cystic Fibrosis Transmembrane Conductance Regulator Function Reduces Airway Bacteria and Inflammation in People with Cystic Fibrosis and Chronic Lung Infections.

PubMed

Hisert, Katherine B; Heltshe, Sonya L; Pope, Christopher; Jorth, Peter; Wu, Xia; Edwards, Rachael M; Radey, Matthew; Accurso, Frank J; Wolter, Daniel J; Cooke, Gordon; Adam, Ryan J; Carter, Suzanne; Grogan, Brenda; Launspach, Janice L; Donnelly, Seamas C; Gallagher, Charles G; Bruce, James E; Stoltz, David A; Welsh, Michael J; Hoffman, Lucas R; McKone, Edward F; Singh, Pradeep K

2017-06-15

Previous work indicates that ivacaftor improves cystic fibrosis transmembrane conductance regulator (CFTR) activity and lung function in people with cystic fibrosis and G551D-CFTR mutations but does not reduce density of bacteria or markers of inflammation in the airway. These findings raise the possibility that infection and inflammation may progress independently of CFTR activity once cystic fibrosis lung disease is established. To better understand the relationship between CFTR activity, airway microbiology and inflammation, and lung function in subjects with cystic fibrosis and chronic airway infections. We studied 12 subjects with G551D-CFTR mutations and chronic airway infections before and after ivacaftor. We measured lung function, sputum bacterial content, and inflammation, and obtained chest computed tomography scans. Ivacaftor produced rapid decreases in sputum Pseudomonas aeruginosa density that began within 48 hours and continued in the first year of treatment. However, no subject eradicated their infecting P. aeruginosa strain, and after the first year P. aeruginosa densities rebounded. Sputum total bacterial concentrations also decreased, but less than P. aeruginosa. Sputum inflammatory measures decreased significantly in the first week of treatment and continued to decline over 2 years. Computed tomography scans obtained before and 1 year after ivacaftor treatment revealed that ivacaftor decreased airway mucous plugging. Ivacaftor caused marked reductions in sputum P. aeruginosa density and airway inflammation and produced modest improvements in radiographic lung disease in subjects with G551D-CFTR mutations. However, P. aeruginosa airway infection persisted. Thus, measures that control infection may be required to realize the full benefits of CFTR-targeting treatments.

A multiplex PCR for detection of knockdown resistance mutations, V1016G and F1534C, in pyrethroid-resistant Aedes aegypti.

PubMed

Saingamsook, Jassada; Saeung, Atiporn; Yanola, Jintana; Lumjuan, Nongkran; Walton, Catherine; Somboon, Pradya

2017-10-10

Mutation of the voltage-gated sodium channel (VGSC) gene, or knockdown resistance (kdr) gene, is an important resistance mechanism of the dengue vector Aedes aegypti mosquitoes against pyrethroids. In many countries in Asia, a valine to glycine substitution (V1016G) and a phenylalanine to cysteine substitution (F1534C) are common in Ae. aegypti populations. The G1016 and C1534 allele frequencies have been increasing in recent years, and hence there is a need to have a simple and inexpensive tool to monitor the alleles in large scale. A multiplex PCR to detect V1016G and F1534C mutations has been developed in the current study. This study utilized primers from previous studies for detecting the mutation at position 1016 and newly designed primers to detect variants at position 1534. The PCR conditions were validated and compared with DNA sequencing using known kdr mutant laboratory strains and field collected mosquitoes. The efficacy of this method was also compared with allele-specific PCR (AS-PCR). The results of our multiplex PCR were in complete agreement with sequencing data and better than the AS-PCR. In addition, the efficiency of two non-toxic DNA staining dyes, Ultrapower™ and RedSafe™, were evaluated by comparing with ethidium bromide (EtBr) and the results were satisfactory. Our multiplex PCR method is highly reliable and useful for implementing vector surveillance in locations where the two alleles co-occur.

Molecular interactions involved in proton-dependent gating in KcsA potassium channels

PubMed Central

Posson, David J.; Thompson, Ameer N.; McCoy, Jason G.

2013-01-01

The bacterial potassium channel KcsA is gated open by the binding of protons to amino acids on the intracellular side of the channel. We have identified, via channel mutagenesis and x-ray crystallography, two pH-sensing amino acids and a set of nearby residues involved in molecular interactions that influence gating. We found that the minimal mutation of one histidine (H25) and one glutamate (E118) near the cytoplasmic gate completely abolished pH-dependent gating. Mutation of nearby residues either alone or in pairs altered the channel’s response to pH. In addition, mutations of certain pairs of residues dramatically increased the energy barriers between the closed and open states. We proposed a Monod–Wyman–Changeux model for proton binding and pH-dependent gating in KcsA, where H25 is a “strong” sensor displaying a large shift in pKa between closed and open states, and E118 is a “weak” pH sensor. Modifying model parameters that are involved in either the intrinsic gating equilibrium or the pKa values of the pH-sensing residues was sufficient to capture the effects of all mutations. PMID:24218397

28 CFR 551.4 - Hair length.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 28 Judicial Administration 2 2013-07-01 2013-07-01 false Hair length. 551.4 Section 551.4 Judicial... Hair length. (a) The Warden may not restrict hair length if the inmate keeps it neat and clean. (b) The Warden shall require an inmate with long hair to wear a cap or hair net when working in food service or...

28 CFR 551.4 - Hair length.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 28 Judicial Administration 2 2014-07-01 2014-07-01 false Hair length. 551.4 Section 551.4 Judicial... Hair length. (a) The Warden may not restrict hair length if the inmate keeps it neat and clean. (b) The Warden shall require an inmate with long hair to wear a cap or hair net when working in food service or...

28 CFR 551.4 - Hair length.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 28 Judicial Administration 2 2012-07-01 2012-07-01 false Hair length. 551.4 Section 551.4 Judicial... Hair length. (a) The Warden may not restrict hair length if the inmate keeps it neat and clean. (b) The Warden shall require an inmate with long hair to wear a cap or hair net when working in food service or...

Prophage Rs551 and its repressor gene orf14 reduce virulence and increase competitive fitness of its Ralstonia solanacearum carrier strain UW551

USDA-ARS?s Scientific Manuscript database

We previously characterized a filamentous lysogenic bacteriophage, 'Rs551, isolated directly from the race 3 biovar 2 phylotype IIB sequevar 1 strain UW551 of R. solanacearum grown under normal culture conditions. The genome of 'Rs551 was identified with 100% identity in the deposited genomes of 11 ...

Meningocerebrovascular amyloidosis associated with a novel transthyretin mis-sense mutation at codon 18 (TTRD 18G)

PubMed Central

Vidal, R.; Garzuly, F.; Budka, H.; Lalowski, M.; Linke, R. P.; Brittig, F.; Frangione, B.; Wisniewski, T.

1996-01-01

We describe a novel transthyretin mutation at codon 18 where Asp is replaced by Gly (D18G) in a Hungarian kindred. This mutation is associated with meningocerebrovascular amyloidosis, producing dementia, ataxia, and spasticity. Fifty different transthyretin mutations are related to amyloid deposition, typically producing a peripheral neuropathy or cardiac dysfunction. These symptoms are absent in this family. Up to now, amyloid-beta (A beta), cystatin C, and prion proteins have been known to be deposited as amyloid in the brain, leading to stroke or dementia. With this report we establish that transthyretin amyloid deposition can also produce central nervous system dysfunction as the major clinical symptom. Images Figure 2 Figure 4 PMID:8579098

31 CFR 551.503 - Exclusion from licenses.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Exclusion from licenses. 551.503 Section 551.503 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF FOREIGN ASSETS CONTROL, DEPARTMENT OF THE TREASURY SOMALIA SANCTIONS REGULATIONS Licenses...

The flexibility of two tropomyosin mutants, D175N and E180G, that cause hypertrophic cardiomyopathy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Xiaochuan; Suphamungmee, Worawit; Janco, Miro

2012-08-03

Highlights: Black-Right-Pointing-Pointer Well-known tropomyosin mutants, D175N and E180G are linked to cardiomyopathies. Black-Right-Pointing-Pointer The structural mechanics of D175N and E180G tropomyosins have been investigated. Black-Right-Pointing-Pointer D175N and E180G mutations increase both local and global tropomyosin flexibility. Black-Right-Pointing-Pointer In muscle, this increased flexibility will enhance myosin interactions on actin. Black-Right-Pointing-Pointer Extra myosin interaction can alter cardiac Ca{sup 2+}-switching, leading to dysfunction. -- Abstract: Point mutations targeting muscle thin filament proteins are the cause of a number of cardiomyopathies. In many cases, biological effects of the mutations are well-documented, whereas their structural and mechanical impact on filament assembly and regulatory function ismore » lacking. In order to elucidate molecular defects leading to cardiac dysfunction, we have examined the structural mechanics of two tropomyosin mutants, E180G and D175N, which are associated with hypertrophic cardiomyopathy (HCM). Tropomyosin is an {alpha}-helical coiled-coil dimer which polymerizes end-to-end to create an elongated superhelix that wraps around F-actin filaments of muscle and non-muscle cells, thus modulating the binding of other actin-binding proteins. Here, we study how flexibility changes in the E180G and D175N mutants might affect tropomyosin binding and regulatory motion on F-actin. Electron microscopy and Molecular Dynamics simulations show that E180G and D175N mutations cause an increase in bending flexibility of tropomyosin both locally and globally. This excess flexibility is likely to increase accessibility of the myosin-binding sites on F-actin, thus destabilizing the low-Ca{sup 2+} relaxed-state of cardiac muscle. The resulting imbalance in the on-off switching mechanism of the mutants will shift the regulatory equilibrium towards Ca{sup 2+}-activation of cardiac muscle, as is observed in

Improved Range Estimation Model for Three-Dimensional (3D) Range Gated Reconstruction

PubMed Central

Chua, Sing Yee; Guo, Ningqun; Tan, Ching Seong; Wang, Xin

2017-01-01

Accuracy is an important measure of system performance and remains a challenge in 3D range gated reconstruction despite the advancement in laser and sensor technology. The weighted average model that is commonly used for range estimation is heavily influenced by the intensity variation due to various factors. Accuracy improvement in term of range estimation is therefore important to fully optimise the system performance. In this paper, a 3D range gated reconstruction model is derived based on the operating principles of range gated imaging and time slicing reconstruction, fundamental of radiant energy, Laser Detection And Ranging (LADAR), and Bidirectional Reflection Distribution Function (BRDF). Accordingly, a new range estimation model is proposed to alleviate the effects induced by distance, target reflection, and range distortion. From the experimental results, the proposed model outperforms the conventional weighted average model to improve the range estimation for better 3D reconstruction. The outcome demonstrated is of interest to various laser ranging applications and can be a reference for future works. PMID:28872589

[Identification of an ideal noninvasive method to detect A3243G gene mutation in MELAS syndrome].

PubMed

Ma, Yi-nan; Fang, Fang; Yang, Yan-ling; Zhang, Ying; Wang, Song-tao; Xu, Yu-feng; Pei, Pei; Yuan, Yun; Bu, Ding-fang; Qi, Yu

2008-12-16

To identify a better non-invasive method to detect the carrier of mitochondrial A3243G mutation, a cause of mitochondrial encephalopathy-lactic acidosis-stroke like episode (MELAS) syndrome. DNA was extracted from the peripheral blood, urine, hair follicle, and saliva of 25 MELAS syndrome patients carrying A3243G mutation and their mothers and other maternal relatives, 33 persons in number, and the muscle tissues from 5 patients obtained by biopsy. A3243G mutation was detected by PCR-RFLP method, and the A3243G mutation ratio was identified by measuring the density of each band and calculation with the software AlphaEase 5.0. A3243G mutations were detected in all tissues of the 25 MELAS patients. The A3243G mutation ratio in urine was 62% +/- 9%, significantly higher than that in the blood [(36% +/- 10%), t = -11.13, P < 0.01]. A3243G mutations were detected in at least one tissue of the 28 maternal relatives. The A3243G mutation rates in their urine samples was 33.0% (5.0% - 70.4%), significantly higher than that in their blood samples [8.0% (0 - 33.3%), z = -4.197, P < 0.01]. There was no significant difference in A3243G mutation ratio among the samples of hair follicle, saliva, and blood. The A3243G mutation ratio in urine is significantly higher than those in blood samples of the patients and their maternal relatives. A noninvasive method, A3243G mutation ratio analysis of urine is superior to that in blood.

Effects of HCM cTnI Mutation R145G on Troponin Structure and Modulation by PKA Phosphorylation Elucidated by Molecular Dynamics Simulations

PubMed Central

Lindert, Steffen; Cheng, Yuanhua; Kekenes-Huskey, Peter; Regnier, Michael; McCammon, J. Andrew

2015-01-01

Cardiac troponin (cTn) is a key molecule in the regulation of human cardiac muscle contraction. The N-terminal cardiac-specific peptide of the inhibitory subunit of troponin, cTnI (cTnI1-39), is a target for phosphorylation by protein kinase A (PKA) during β-adrenergic stimulation. We recently presented evidence indicating that this peptide interacts with the inhibitory peptide (cTnl137–147) when S23 and S24 are phosphorylated. The inhibitory peptide is also the target of the point mutation cTnI-R145G, which is associated with hypertrophic cardiomyopathy (HCM), a disease associated with sudden death in apparently healthy young adults. It has been shown that both phosphorylation and this mutation alter the cTnC-cTnI (C-I) interaction, which plays a crucial role in modulating contractile activation. However, little is known about the molecular-level events underlying this modulation. Here, we computationally investigated the effects of the cTnI-R145G mutation on the dynamics of cTn, cTnC Ca2+ handling, and the C-I interaction. Comparisons were made with the cTnI-R145G/S23D/S24D phosphomimic mutation, which has been used both experimentally and computationally to study the cTnI N-terminal specific effects of PKA phosphorylation. Additional comparisons between the phosphomimic mutations and the real phosphorylations were made. For this purpose, we ran triplicate 150 ns molecular dynamics simulations of cTnI-R145G Ca2+-bound cTnC1-161-cTnI1-172-cTnT236-285, cTnI-R145G/S23D/S24D Ca2+-bound cTnC1-161-cTnI1-172-cTnT236-285, and cTnI-R145G/PS23/PS24 Ca2+-bound cTnC1-161-cTnI1-172-cTnT236-285, respectively. We found that the cTnI-R145G mutation did not impact the overall dynamics of cTn, but stabilized crucial Ca2+-coordinating interactions. However, the phosphomimic mutations increased overall cTn fluctuations and destabilized Ca2+ coordination. Interestingly, cTnI-R145G blunted the intrasubunit interactions between the cTnI N-terminal extension and the cTnI inhibitory

Effects of HCM cTnI mutation R145G on troponin structure and modulation by PKA phosphorylation elucidated by molecular dynamics simulations.

PubMed

Lindert, Steffen; Cheng, Yuanhua; Kekenes-Huskey, Peter; Regnier, Michael; McCammon, J Andrew

2015-01-20

Cardiac troponin (cTn) is a key molecule in the regulation of human cardiac muscle contraction. The N-terminal cardiac-specific peptide of the inhibitory subunit of troponin, cTnI (cTnI(1-39)), is a target for phosphorylation by protein kinase A (PKA) during β-adrenergic stimulation. We recently presented evidence indicating that this peptide interacts with the inhibitory peptide (cTnl(137-147)) when S23 and S24 are phosphorylated. The inhibitory peptide is also the target of the point mutation cTnI-R145G, which is associated with hypertrophic cardiomyopathy (HCM), a disease associated with sudden death in apparently healthy young adults. It has been shown that both phosphorylation and this mutation alter the cTnC-cTnI (C-I) interaction, which plays a crucial role in modulating contractile activation. However, little is known about the molecular-level events underlying this modulation. Here, we computationally investigated the effects of the cTnI-R145G mutation on the dynamics of cTn, cTnC Ca(2+) handling, and the C-I interaction. Comparisons were made with the cTnI-R145G/S23D/S24D phosphomimic mutation, which has been used both experimentally and computationally to study the cTnI N-terminal specific effects of PKA phosphorylation. Additional comparisons between the phosphomimic mutations and the real phosphorylations were made. For this purpose, we ran triplicate 150 ns molecular dynamics simulations of cTnI-R145G Ca(2+)-bound cTnC(1-161)-cTnI(1-172)-cTnT(236-285), cTnI-R145G/S23D/S24D Ca(2+)-bound cTnC(1-161)-cTnI(1-172)-cTnT(236-285), and cTnI-R145G/PS23/PS24 Ca(2+)-bound cTnC(1-161)-cTnI(1-172)-cTnT(236-285), respectively. We found that the cTnI-R145G mutation did not impact the overall dynamics of cTn, but stabilized crucial Ca(2+)-coordinating interactions. However, the phosphomimic mutations increased overall cTn fluctuations and destabilized Ca(2+) coordination. Interestingly, cTnI-R145G blunted the intrasubunit interactions between the cTnI N

5 CFR 551.205 - Executive exemption criteria.

Code of Federal Regulations, 2010 CFR

2010-01-01

... Section 551.205 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS PAY... criteria. (a) An executive employee is an employee whose primary duty is management (as defined in § 551... takes into consideration those organizations that use matrix management, i.e., a system of “shared...

49 CFR 551.37 - Language of communications.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 49 Transportation 6 2013-10-01 2013-10-01 false Language of communications. 551.37 Section 551.37 Transportation Other Regulations Relating to Transportation (Continued) NATIONAL HIGHWAY TRAFFIC SAFETY... knowledge and belief. The translator shall sign the certificate in ink and state his full legal name...

49 CFR 551.37 - Language of communications.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 49 Transportation 6 2011-10-01 2011-10-01 false Language of communications. 551.37 Section 551.37 Transportation Other Regulations Relating to Transportation (Continued) NATIONAL HIGHWAY TRAFFIC SAFETY... knowledge and belief. The translator shall sign the certificate in ink and state his full legal name...

49 CFR 551.37 - Language of communications.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 49 Transportation 6 2012-10-01 2012-10-01 false Language of communications. 551.37 Section 551.37 Transportation Other Regulations Relating to Transportation (Continued) NATIONAL HIGHWAY TRAFFIC SAFETY... knowledge and belief. The translator shall sign the certificate in ink and state his full legal name...

49 CFR 551.37 - Language of communications.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 49 Transportation 6 2010-10-01 2010-10-01 false Language of communications. 551.37 Section 551.37 Transportation Other Regulations Relating to Transportation (Continued) NATIONAL HIGHWAY TRAFFIC SAFETY... knowledge and belief. The translator shall sign the certificate in ink and state his full legal name...

49 CFR 551.37 - Language of communications.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 49 Transportation 6 2014-10-01 2014-10-01 false Language of communications. 551.37 Section 551.37 Transportation Other Regulations Relating to Transportation (Continued) NATIONAL HIGHWAY TRAFFIC SAFETY... knowledge and belief. The translator shall sign the certificate in ink and state his full legal name...

Systolic and diastolic assessment by 3D-ASM segmentation of gated-SPECT Studies: a comparison with MRI

NASA Astrophysics Data System (ADS)

Tobon-Gomez, C.; Bijnens, B. H.; Huguet, M.; Sukno, F.; Moragas, G.; Frangi, A. F.

2009-02-01

Gated single photon emission tomography (gSPECT) is a well-established technique used routinely in clinical practice. It can be employed to evaluate global left ventricular (LV) function of a patient. The purpose of this study is to assess LV systolic and diastolic function from gSPECT datasets in comparison with cardiac magnetic resonance imaging (CMR) measurements. This is achieved by applying our recently implemented 3D active shape model (3D-ASM) segmentation approach for gSPECT studies. This methodology allows for generation of 3D LV meshes for all cardiac phases, providing volume time curves and filling rate curves. Both systolic and diastolic functional parameters can be derived from these curves for an assessment of patient condition even at early stages of LV dysfunction. Agreement of functional parameters, with respect to CMR measurements, were analyzed by means of Bland-Altman plots. The analysis included subjects presenting either LV hypertrophy, dilation or myocardial infarction.

Dramatic effect of single-base mutation on the conformational dynamics of human telomeric G-quadruplex

PubMed Central

Lee, Ja Yil; Kim, D. S.

2009-01-01

Guanine-rich DNA sequences can form G-quadruplexes. These four-stranded structures are known to form in several genomic regions and to influence certain biological activities. Sometimes, the instability of G-quadruplexes causes the abnormal biological processes. Mutation is a culprit for the destabilization of G-quadruplexes, but the details of mutated G-quadruplexes are poorly understood. In this article, we investigated the conformational dynamics of single-base mutated human telomeric G-quadruplexes in the presence of K+ with single-molecule FRET spectroscopy. We observed that the replacement of single guanine by thymine in a G-track induces various folded structures, i.e. structural polymorphism. Moreover, direct observation of their dynamics revealed that a single-base mutation causes fast unfolding of folded states under physiological conditions. Furthermore, we found that the degree of destabilization varies according to mutation positions. When the central guanine of a G-track is replaced, the G-quadruplexes unfold quickly at any K+ concentrations and temperature. Meanwhile, outer-quartet mutated G-quadruplexes have heterogeneous dynamics at intermediate K+ concentrations and longstanding folded states at high K+ concentrations. Several factors such as base-stacking interaction and K+ coordination are responsible for the different dynamics according to the mutation position. PMID:19359361

Analysis of fluG mutations that affect light-dependent conidiation in Aspergillus nidulans.

PubMed Central

Yager, L N; Lee, H O; Nagle, D L; Zimmerman, J E

1998-01-01

Conidiation in Aspergillus nidulans is induced by exposure to red light but can also be induced by blue light in certain mutant strains. We have isolated a mutation in the fluG gene that abolishes responsiveness to red light but does not affect the response to blue light. It has been shown that the veA1 (velvet) mutation allows conidiation to occur in the absence of light. We have identified three other fluG mutations that suppress the veA1 phenotype; these double mutants do not conidiate in the dark. The mutations described here define two new phenotypic classes of fluG alleles that display abnormal responses to light. We have characterized these mutations with respect to their molecular identity and to their effect on fluG transcription. Although it has been shown that fluG is required for the synthesis of an extracellular factor that directs conidiation, we do not detect this factor under conditions that promote conidiation in the veA1 suppressors. Furthermore, extracellular rescue is not observed in fluG deletion strains containing the wild-type veA allele. We propose that a genetic interaction between fluG and veA influences the production of the extracellular signal and regulates the initiation of conidiation. PMID:9691036

49 CFR 551.31 - Form of communications.

Code of Federal Regulations, 2010 CFR

2010-10-01

... communications. Any communication in writing relating to official business (including formal documents) shall be... 49 Transportation 6 2010-10-01 2010-10-01 false Form of communications. 551.31 Section 551.31... other documents that are attached to communications shall be folded to this size, if possible. The left...

Exploring the Structure of the Voltage-gated Na+ Channel by an Engineered Drug Access Pathway to the Receptor Site for Local Anesthetics*

PubMed Central

Lukacs, Peter; Gawali, Vaibhavkumar S.; Cervenka, Rene; Ke, Song; Koenig, Xaver; Rubi, Lena; Zarrabi, Touran; Hilber, Karlheinz; Stary-Weinzinger, Anna; Todt, Hannes

2014-01-01

Despite the availability of several crystal structures of bacterial voltage-gated Na+ channels, the structure of eukaryotic Na+ channels is still undefined. We used predictions from available homology models and crystal structures to modulate an external access pathway for the membrane-impermeant local anesthetic derivative QX-222 into the internal vestibule of the mammalian rNaV1.4 channel. Potassium channel-based homology models predict amino acid Ile-1575 in domain IV segment 6 to be in close proximity to Lys-1237 of the domain III pore-loop selectivity filter. The mutation K1237E has been shown previously to increase the diameter of the selectivity filter. We found that an access pathway for external QX-222 created by mutations of Ile-1575 was abolished by the additional mutation K1237E, supporting the notion of a close spatial relationship between sites 1237 and 1575. Crystal structures of bacterial voltage-gated Na+ channels predict that the side chain of rNaV1.4 Trp-1531 of the domain IV pore-loop projects into the space between domain IV segment 6 and domain III pore-loop and, therefore, should obstruct the putative external access pathway. Indeed, mutations W1531A and W1531G allowed for exceptionally rapid access of QX-222. In addition, W1531G created a second non-selective ion-conducting pore, bypassing the outer vestibule but probably merging into the internal vestibule, allowing for control by the activation gate. These data suggest a strong structural similarity between bacterial and eukaryotic voltage-gated Na+ channels. PMID:24947510

A G542X cystic fibrosis mouse model for examining nonsense mutation directed therapies.

PubMed

McHugh, Daniel R; Steele, Miarasa S; Valerio, Dana M; Miron, Alexander; Mann, Rachel J; LePage, David F; Conlon, Ronald A; Cotton, Calvin U; Drumm, Mitchell L; Hodges, Craig A

2018-01-01

Nonsense mutations are present in 10% of patients with CF, produce a premature termination codon in CFTR mRNA causing early termination of translation, and lead to lack of CFTR function. There are no currently available animal models which contain a nonsense mutation in the endogenous Cftr locus that can be utilized to test nonsense mutation therapies. In this study, we create a CF mouse model carrying the G542X nonsense mutation in Cftr using CRISPR/Cas9 gene editing. The G542X mouse model has reduced Cftr mRNA levels, demonstrates absence of CFTR function, and displays characteristic manifestations of CF mice such as reduced growth and intestinal obstruction. Importantly, CFTR restoration is observed in G542X intestinal organoids treated with G418, an aminoglycoside with translational readthrough capabilities. The G542X mouse model provides an invaluable resource for the identification of potential therapies of CF nonsense mutations as well as the assessment of in vivo effectiveness of these potential therapies targeting nonsense mutations.

[Leigh syndrome resulting from a de novo mitochondrial DNA mutation (T8993G)].

PubMed

Playán, A; Solano-Palacios, A; González de la Rosa, J B; Merino-Arribas, J M; Andreu, A L; López-Pérez, M; Montoya, J

Several degenerative neurological diseases are caused by mutations in the mitochondrial gene coding for subunit 6 of the ATPase. Thus, NARP (neurogenic weakness, ataxia, and retinitis pigmentosa) and Leigh syndromes are associated to a T8993G mutation when the percentage of mutant mitochondrial DNA is low (60 90%) or high (>90%), respectively. Leigh syndrome is also caused by a second mutation in the same position T8993C. The patient, a boy that died at 6 months, had generalized hypotonia, psychomotor delay, hepatomegaly, choreic movements and hyporreflexia. MRI showed hypodensities in the basal ganglia and brain stem as well as hyperlactacidemia. Molecular genetic analysis of the mitochondrial DNA showed that the patient had the T8993G mutation in a percentage higher than 95%. No mutated DNA was detected in blood of the proband s mother, maternal aunt and grandmother. The point mutation T8993G may occur de novo, at high levels, causing neurodegenerative diseases.

Angle-independent measure of motion for image-based gating in 3D coronary angiography

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lehmann, Glen C.; Holdsworth, David W.; Drangova, Maria

2006-05-15

The role of three-dimensional (3D) image guidance for interventional procedures and minimally invasive surgeries is increasing for the treatment of vascular disease. Currently, most interventional procedures are guided by two-dimensional x-ray angiography, but computed rotational angiography has the potential to provide 3D geometric information about the coronary arteries. The creation of 3D angiographic images of the coronary arteries requires synchronization of data acquisition with respect to the cardiac cycle, in order to minimize motion artifacts. This can be achieved by inferring the extent of motion from a patient's electrocardiogram (ECG) signal. However, a direct measurement of motion (from the 2Dmore » angiograms) has the potential to improve the 3D angiographic images by ensuring that only projections acquired during periods of minimal motion are included in the reconstruction. This paper presents an image-based metric for measuring the extent of motion in 2D x-ray angiographic images. Adaptive histogram equalization was applied to projection images to increase the sharpness of coronary arteries and the superior-inferior component of the weighted centroid (SIC) was measured. The SIC constitutes an image-based metric that can be used to track vessel motion, independent of apparent motion induced by the rotational acquisition. To evaluate the technique, six consecutive patients scheduled for routine coronary angiography procedures were studied. We compared the end of the SIC rest period ({rho}) to R-waves (R) detected in the patient's ECG and found a mean difference of 14{+-}80 ms. Two simultaneous angular positions were acquired and {rho} was detected for each position. There was no statistically significant difference (P=0.79) between {rho} in the two simultaneously acquired angular positions. Thus we have shown the SIC to be independent of view angle, which is critical for rotational angiography. A preliminary image-based gating strategy that employed

Altering intracellular pH reveals the kinetic basis of intraburst gating in the CFTR Cl− channel

PubMed Central

Xu, Weiyi; Sheppard, David N.

2017-01-01

that disrupt the interaction of ATP with ATP‐binding site 1, including K464A, D572N and the CF‐associated mutation G1349D all abolished the prolongation of τcf at pHi 6.3. Taken together, our data suggest that the regulation of CFTR intraburst gating is distinct from the ATP‐dependent mechanism that controls channel opening and closing. However, our data also suggest that ATP‐binding site 1 modulates intraburst gating. PMID:27779763

Quantifying the impact of respiratory-gated 4D CT acquisition on thoracic image quality: A digital phantom study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bernatowicz, K., E-mail: kingab@student.ethz.ch; Knopf, A.; Lomax, A.

Purpose: Prospective respiratory-gated 4D CT has been shown to reduce tumor image artifacts by up to 50% compared to conventional 4D CT. However, to date no studies have quantified the impact of gated 4D CT on normal lung tissue imaging, which is important in performing dose calculations based on accurate estimates of lung volume and structure. To determine the impact of gated 4D CT on thoracic image quality, the authors developed a novel simulation framework incorporating a realistic deformable digital phantom driven by patient tumor motion patterns. Based on this framework, the authors test the hypothesis that respiratory-gated 4D CTmore » can significantly reduce lung imaging artifacts. Methods: Our simulation framework synchronizes the 4D extended cardiac torso (XCAT) phantom with tumor motion data in a quasi real-time fashion, allowing simulation of three 4D CT acquisition modes featuring different levels of respiratory feedback: (i) “conventional” 4D CT that uses a constant imaging and couch-shift frequency, (ii) “beam paused” 4D CT that interrupts imaging to avoid oversampling at a given couch position and respiratory phase, and (iii) “respiratory-gated” 4D CT that triggers acquisition only when the respiratory motion fulfills phase-specific displacement gating windows based on prescan breathing data. Our framework generates a set of ground truth comparators, representing the average XCAT anatomy during beam-on for each of ten respiratory phase bins. Based on this framework, the authors simulated conventional, beam-paused, and respiratory-gated 4D CT images using tumor motion patterns from seven lung cancer patients across 13 treatment fractions, with a simulated 5.5 cm{sup 3} spherical lesion. Normal lung tissue image quality was quantified by comparing simulated and ground truth images in terms of overall mean square error (MSE) intensity difference, threshold-based lung volume error, and fractional false positive/false negative rates

A multiplex method for detection of glucose-6-phosphate dehydrogenase (G6PD) gene mutations.

PubMed

Zhang, L; Yang, Y; Liu, R; Li, Q; Yang, F; Ma, L; Liu, H; Chen, X; Yang, Z; Cui, L; He, Y

2015-12-01

Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common human enzyme defect caused by G6PD gene mutations. This study aimed to develop a cost-effective, multiplex, genotyping method for detecting common mutations in the G6PD gene. We used a SNaPshot approach to genotype multiple G6PD mutations that are common to human populations in South-East Asia. This assay is based on multiplex PCR coupled with primer extension reactions. Different G6PD gene mutations were determined by peak retention time and colors of the primer extension products. We designed PCR primers for multiplex amplification of the G6PD gene fragments and for primer extension reactions to genotype 11 G6PD mutations. DNA samples from a total of 120 unrelated G6PD-deficient individuals from the China-Myanmar border area were used to establish and validate this method. Direct sequencing of the PCR products demonstrated 100% concordance between the SNaPshot and the sequencing results. The SNaPshot method offers a specific and sensitive alternative for simultaneously interrogating multiple G6PD mutations. © 2015 John Wiley & Sons Ltd.

28 CFR 551.2 - Mustaches and beards.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Mustaches and beards. 551.2 Section 551.2 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS... require an inmate with a beard to wear a beard covering when working in food service or where a beard...

Molecular mechanism underlying ethanol activation of G-protein–gated inwardly rectifying potassium channels

PubMed Central

Bodhinathan, Karthik; Slesinger, Paul A.

2013-01-01

Alcohol (ethanol) produces a wide range of pharmacological effects on the nervous system through its actions on ion channels. The molecular mechanism underlying ethanol modulation of ion channels is poorly understood. Here we used a unique method of alcohol-tagging to demonstrate that alcohol activation of a G-protein–gated inwardly rectifying potassium (GIRK or Kir3) channel is mediated by a defined alcohol pocket through changes in affinity for the membrane phospholipid signaling molecule phosphatidylinositol 4,5-bisphosphate. Surprisingly, hydrophobicity and size, but not the canonical hydroxyl, were important determinants of alcohol-dependent activation. Altering levels of G protein Gβγ subunits, conversely, did not affect alcohol-dependent activation, suggesting a fundamental distinction between receptor and alcohol gating of GIRK channels. The chemical properties of the alcohol pocket revealed here might extend to other alcohol-sensitive proteins, revealing a unique protein microdomain for targeting alcohol-selective therapeutics in the treatment of alcoholism and addiction. PMID:24145411

5 CFR 551.421 - Regular working hours.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Regular working hours. 551.421 Section... Activities § 551.421 Regular working hours. (a) Under the Act there is no requirement that a Federal employee... distinction based on whether the activity is performed by an employee during regular working hours or outside...

28 CFR 551.162 - Designated smoking areas.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 28 Judicial Administration 2 2012-07-01 2012-07-01 false Designated smoking areas. 551.162 Section... MISCELLANEOUS Smoking/No Smoking Areas § 551.162 Designated smoking areas. (a) The Warden must designate a smoking area for use in instances where smoking is part of an authorized inmate religious activity. (b)(1...

28 CFR 551.162 - Designated smoking areas.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 28 Judicial Administration 2 2014-07-01 2014-07-01 false Designated smoking areas. 551.162 Section... MISCELLANEOUS Smoking/No Smoking Areas § 551.162 Designated smoking areas. (a) The Warden must designate a smoking area for use in instances where smoking is part of an authorized inmate religious activity. (b)(1...

28 CFR 551.162 - Designated smoking areas.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Designated smoking areas. 551.162 Section... MISCELLANEOUS Smoking/No Smoking Areas § 551.162 Designated smoking areas. (a) The Warden must designate a smoking area for use in instances where smoking is part of an authorized inmate religious activity. (b)(1...

28 CFR 551.162 - Designated smoking areas.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 28 Judicial Administration 2 2011-07-01 2011-07-01 false Designated smoking areas. 551.162 Section... MISCELLANEOUS Smoking/No Smoking Areas § 551.162 Designated smoking areas. (a) The Warden must designate a smoking area for use in instances where smoking is part of an authorized inmate religious activity. (b)(1...

28 CFR 551.162 - Designated smoking areas.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 28 Judicial Administration 2 2013-07-01 2013-07-01 false Designated smoking areas. 551.162 Section... MISCELLANEOUS Smoking/No Smoking Areas § 551.162 Designated smoking areas. (a) The Warden must designate a smoking area for use in instances where smoking is part of an authorized inmate religious activity. (b)(1...

Discovery of 2,4-diarylaminopyrimidines bearing a resorcinol motif as novel ALK inhibitors to overcome the G1202R resistant mutation.

PubMed

Geng, Kaijun; Xia, Zongjun; Ji, Yinchun; Zhang, Ruisi Ruthy; Sun, Deqiao; Ai, Jing; Song, Zilan; Geng, Meiyu; Zhang, Ao

2018-01-20

To address drug resistance caused by ALK kinase mutations, especially the most refractory and predominant mutation G1202R for the second-generation ALK inhibitor, a series of new diarylaminopyrimidine analogues were designed by incorporating a resorcinol moiety (A-ring) to interact the ALK kinase domain where the G1202R is located. Compound 12d turns out as the most potent with IC 50 values of 1.7, 3.5, and 1.8 nM against ALK wild type, gatekeeper mutant L1196M, and the G1202R mutant, respectively. More importantly, compound 12d has excellent inhibitory effects against the proliferation of BaF3 cells specifically expressing ALK wild type, gatekeeper L1196M, and the most challenging mutant G1202R, with IC 50 values all less than 1.5 nM. Collectively, compound 12d is worthy of further investigation as a new more potent third-generation ALK inhibitor to circumvent drug resistance of both the first-generation and the second-generation inhibitors. Copyright © 2017. Published by Elsevier Masson SAS.

5 CFR 551.601 - Minimum age standards.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 5 Administrative Personnel 1 2011-01-01 2011-01-01 false Minimum age standards. 551.601 Section... ADMINISTRATION UNDER THE FAIR LABOR STANDARDS ACT Child Labor § 551.601 Minimum age standards. (a) 16-year minimum age. The Act, in section 3(l), sets a general 16-year minimum age, which applies to all employment...

5 CFR 551.601 - Minimum age standards.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 5 Administrative Personnel 1 2014-01-01 2014-01-01 false Minimum age standards. 551.601 Section... ADMINISTRATION UNDER THE FAIR LABOR STANDARDS ACT Child Labor § 551.601 Minimum age standards. (a) 16-year minimum age. The Act, in section 3(l), sets a general 16-year minimum age, which applies to all employment...

5 CFR 551.601 - Minimum age standards.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 5 Administrative Personnel 1 2013-01-01 2013-01-01 false Minimum age standards. 551.601 Section... ADMINISTRATION UNDER THE FAIR LABOR STANDARDS ACT Child Labor § 551.601 Minimum age standards. (a) 16-year minimum age. The Act, in section 3(l), sets a general 16-year minimum age, which applies to all employment...

5 CFR 551.601 - Minimum age standards.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 5 Administrative Personnel 1 2012-01-01 2012-01-01 false Minimum age standards. 551.601 Section... ADMINISTRATION UNDER THE FAIR LABOR STANDARDS ACT Child Labor § 551.601 Minimum age standards. (a) 16-year minimum age. The Act, in section 3(l), sets a general 16-year minimum age, which applies to all employment...

MELAS syndrome, cardiomyopathy, rhabdomyolysis, and autism associated with the A3260G mitochondrial DNA mutation.

PubMed

Connolly, Barbara S; Feigenbaum, Annette S J; Robinson, Brian H; Dipchand, Anne I; Simon, David K; Tarnopolsky, Mark A

2010-11-12

The A to G transition mutation at position 3260 of the mitochondrial genome is usually associated with cardiomyopathy and myopathy. One Japanese kindred reported the phenotype of mitochondrial encephalomyopathy, lactic acidosis and stroke-like episodes (MELAS syndrome) in association with the A3260G mtDNA mutation. We describe the first Caucasian cases of MELAS syndrome associated with the A3260G mutation. Furthermore, this mutation was associated with exercise-induced rhabdomyolysis, hearing loss, seizures, cardiomyopathy, and autism in the large kindred. We conclude that the A3260G mtDNA mutation is associated with wide phenotypic heterogeneity with MELAS and other "classical" mitochondrial phenotypes being manifestations. Copyright © 2010 Elsevier Inc. All rights reserved.

Strain-Gated Field Effect Transistor of a MoS2-ZnO 2D-1D Hybrid Structure.

PubMed

Chen, Libo; Xue, Fei; Li, Xiaohui; Huang, Xin; Wang, Longfei; Kou, Jinzong; Wang, Zhong Lin

2016-01-26

Two-dimensional (2D) molybdenum disulfide (MoS2) is an exciting material due to its unique electrical, optical, and piezoelectric properties. Owing to an intrinsic band gap of 1.2-1.9 eV, monolayer or a-few-layer MoS2 is used for fabricating field effect transistors (FETs) with high electron mobility and on/off ratio. However, the traditional FETs are controlled by an externally supplied gate voltage, which may not be sensitive enough to directly interface with a mechanical stimulus for applications in electronic skin. Here we report a type of top-pressure/force-gated field effect transistors (PGFETs) based on a hybrid structure of a 2D MoS2 flake and 1D ZnO nanowire (NW) array. Once an external pressure is applied, the piezoelectric polarization charges created at the tips of ZnO NWs grown on MoS2 act as a gate voltage to tune/control the source-drain transport property in MoS2. At a 6.25 MPa applied stimulus on a packaged device, the source-drain current can be tuned for ∼25%, equivalent to the results of applying an extra -5 V back gate voltage. Another type of PGFET with a dielectric layer (Al2O3) sandwiched between MoS2 and ZnO also shows consistent results. A theoretical model is proposed to interpret the received data. This study sets the foundation for applying the 2D material-based FETs in the field of artificial intelligence.

Clinical, biochemical and morphologic diagnostic markers in an infant male pseudohermaphrodite patient with compound heterozygous mutations (G115D/R246W) in SRD5A2 gene.

PubMed

Fernández-Cancio, Mónica; Rodó, Joan; Andaluz, Pilar; Martínez de Osaba, María Jesús; Rodríguez-Hierro, Francisco; Esteban, Cristina; Carrascosa, Antonio; Audí, Laura

2004-01-01

A patient with male pseudohermaphroditism and clinical diagnosis of partial androgen insensitivity in the neonatal period was studied at pubertal age for a molecular diagnosis. Hormone studies were conducted at baseline and under hCG stimulation for testosterone and dihydrotestosterone determinations at 2 months of age. Gonadectomy was performed at 4 months. At the age of 13 years genital skin fibroblasts were studied for androgen binding and 5alpha-reductase activity and peripheral blood DNA was available for androgen receptor (AR) and 5alpha-reductase (SRD5A2) gene analysis. Exons 1-8 of AR gene and exons 1-5 of SRD5A2 gene were sequenced. AR gene coding sequences were normal. SRD5A2 gene analysis revealed two heterozygote mutations (G115D and R246W), with the mother carrying the G115D and the father the R246W mutations. The compound heterozygote mutations in SRD5A2 gene explained an extremely low 5alpha-reductase enzyme activity in genital skin fibroblasts. Revision of hormonal data from the neonatal period revealed an increased testosterone-to-dihydrotestosterone ratio at the end of an hCG stimulation test, which concurred with the molecular diagnosis. Testis morphology at 4 months of age was normal. Clinical and biochemical differential diagnosis between partial androgen insensitivity syndrome and 5alpha-reductase enzyme deficiency is difficult in the neonatal period and before puberty. Our results show that in our patient the testosterone-to-dihydrotestosterone ratio would have adequately orientated the diagnosis. The two mutations in SRD5A2 gene have been described in patients of different lineages, though not in combination to date. Testis morphology showed that, during early infancy, the 5alpha-reductase deficiency may not have affected interstitial or tubular development. Copyright (c) 2004 S. Karger AG, Basel.

Germline cytotoxic lymphocytes defective mutations in Chinese patients with lymphoma.

PubMed

Chen, Xue; Zhang, Yang; Wang, Fang; Wang, Mangju; Teng, Wen; Lin, Yuehui; Han, Xiangping; Jin, Fangyuan; Xu, Yuanli; Cao, Panxiang; Fang, Jiancheng; Zhu, Ping; Tong, Chunrong; Liu, Hongxing

2017-11-01

Certain patients with lymphoma may harbor mutations in perforin 1 (PRF1), unc-13 homolog D (UNC13D), syntaxin 11 (STX11), STXBP2 (syntaxin binding protein 2) or SH2 domain containing 1A (SH2D1A), which causes functional defects of cytotoxic lymphocytes. Data regarding the association between genetic defects and the development of lymphoma in Chinese patients are limited to date. In the present study, 90 patients with lymphoma were analyzed for UNC13D, PRF1, STXBP2, STX11, SH2D1A and X-linked inhibitor of apoptosis. Mutations were observed in 24 (26.67%) patients; 16 patients exhibited mutations in UNC13D, 7 exhibited PRF1 mutations, and 1 exhibited monoallelic mutation in STX11. UNC13D c.2588G>A/p.G863D mutation was detected in 9 patients (10.00%) and in 4/210 controls (1.90%). This mutation was predicted to be pathogenic and it predominantly existed in the Chinese population. These findings suggest that impaired cytotoxic machinery may represent a predisposing factor for the development of lymphoma. Furthermore, these data describe a distinct mutation spectrum in Chinese patients with lymphoma, whereby UNC13D is the most frequently mutated gene. In addition, these findings suggest UNC13D c.2588G>A mutation is a founder mutation in Chinese patients.

Germline cytotoxic lymphocytes defective mutations in Chinese patients with lymphoma

PubMed Central

Chen, Xue; Zhang, Yang; Wang, Fang; Wang, Mangju; Teng, Wen; Lin, Yuehui; Han, Xiangping; Jin, Fangyuan; Xu, Yuanli; Cao, Panxiang; Fang, Jiancheng; Zhu, Ping; Tong, Chunrong; Liu, Hongxing

2017-01-01

Certain patients with lymphoma may harbor mutations in perforin 1 (PRF1), unc-13 homolog D (UNC13D), syntaxin 11 (STX11), STXBP2 (syntaxin binding protein 2) or SH2 domain containing 1A (SH2D1A), which causes functional defects of cytotoxic lymphocytes. Data regarding the association between genetic defects and the development of lymphoma in Chinese patients are limited to date. In the present study, 90 patients with lymphoma were analyzed for UNC13D, PRF1, STXBP2, STX11, SH2D1A and X-linked inhibitor of apoptosis. Mutations were observed in 24 (26.67%) patients; 16 patients exhibited mutations in UNC13D, 7 exhibited PRF1 mutations, and 1 exhibited monoallelic mutation in STX11. UNC13D c.2588G>A/p.G863D mutation was detected in 9 patients (10.00%) and in 4/210 controls (1.90%). This mutation was predicted to be pathogenic and it predominantly existed in the Chinese population. These findings suggest that impaired cytotoxic machinery may represent a predisposing factor for the development of lymphoma. Furthermore, these data describe a distinct mutation spectrum in Chinese patients with lymphoma, whereby UNC13D is the most frequently mutated gene. In addition, these findings suggest UNC13D c.2588G>A mutation is a founder mutation in Chinese patients. PMID:29113160

42 CFR 493.551 - General requirements for laboratories.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 42 Public Health 5 2011-10-01 2011-10-01 false General requirements for laboratories. 493.551... SERVICES (CONTINUED) STANDARDS AND CERTIFICATION LABORATORY REQUIREMENTS Accreditation by a Private, Nonprofit Accreditation Organization or Exemption Under an Approved State Laboratory Program § 493.551...

42 CFR 493.551 - General requirements for laboratories.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 42 Public Health 5 2010-10-01 2010-10-01 false General requirements for laboratories. 493.551... SERVICES (CONTINUED) STANDARDS AND CERTIFICATION LABORATORY REQUIREMENTS Accreditation by a Private, Nonprofit Accreditation Organization or Exemption Under an Approved State Laboratory Program § 493.551...

Molecular dynamics simulations and principal component analysis on human laforin mutation W32G and W32G/K87A.

PubMed

Srikumar, P S; Rohini, K; Rajesh, Perumbilavil Kaithamanakallam

2014-06-01

Mutations in human laforin lead to an autosomal neurodegenerative disorder Lafora disease. In N-terminal carbohydrate binding domain of laforin, two mutations W32G and K87A are reported as highly disease causing laforin mutants. Experimental studies reported that mutations are responsible for the abolishment of glycogen binding which is a critical function of laforin. Our current computational study focused on the role of conformational changes in human laforin structure due to existing single mutation W32G and prepared double mutation W32G/K87A related to loss of glycogen binding. We performed 10 ns molecular dynamics (MD) simulation studies in the Gromacs package for both mutations and analyzed the trajectories. From the results, the global properties like root mean square deviation, root mean square fluctuation, radius of gyration, solvent accessible surface area and hydrogen bonds showed structural changes in atomic level observed in W32G and W32G/K87A laforin mutants. The conformational change induced by mutants influenced the loss of the overall stability of the native laforin. Moreover, the change in overall motion of protein was analyzed by principal component analysis and results showed protein clusters expanded more than native and also change in direction in case of double mutant in conformational space. Overall, our report provides theoretical information on loss of structure-function relationship due to flexible nature of laforin mutants. In conclusion, comparative MD simulation studies support the experimental data on W32G and W32G/K87A related to the lafora disease mechanism on glycogen binding.

Disease-associated extracellular loop mutations in the adhesion G protein-coupled receptor G1 (ADGRG1; GPR56) differentially regulate downstream signaling.

PubMed

Kishore, Ayush; Hall, Randy A

2017-06-09

Mutations to the adhesion G protein-coupled receptor ADGRG1 (G1; also known as GPR56) underlie the neurological disorder bilateral frontoparietal polymicrogyria. Disease-associated mutations in G1 studied to date are believed to induce complete loss of receptor function through disruption of either receptor trafficking or signaling activity. Given that N-terminal truncation of G1 and other adhesion G protein-coupled receptors has been shown to significantly increase the receptors' constitutive signaling, we examined two different bilateral frontoparietal polymicrogyria-inducing extracellular loop mutations (R565W and L640R) in the context of both full-length and N-terminally truncated (ΔNT) G1. Interestingly, we found that these mutations reduced surface expression of full-length G1 but not G1-ΔNT in HEK-293 cells. Moreover, the mutations ablated receptor-mediated activation of serum response factor luciferase, a classic measure of Gα 12/13 -mediated signaling, but had no effect on G1-mediated signaling to nuclear factor of activated T cells (NFAT) luciferase. Given these differential signaling results, we sought to further elucidate the pathway by which G1 can activate NFAT luciferase. We found no evidence that ΔNT activation of NFAT is dependent on Gα q/11 -mediated or β-arrestin-mediated signaling but rather involves liberation of Gβγ subunits and activation of calcium channels. These findings reveal that disease-associated mutations to the extracellular loops of G1 differentially alter receptor trafficking, depending on the presence of the N terminus, and differentially alter signaling to distinct downstream pathways. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

G protein-coupled receptor mutations and human genetic disease.

PubMed

Thompson, Miles D; Hendy, Geoffrey N; Percy, Maire E; Bichet, Daniel G; Cole, David E C

2014-01-01

Genetic variations in G protein-coupled receptor genes (GPCRs) disrupt GPCR function in a wide variety of human genetic diseases. In vitro strategies and animal models have been used to identify the molecular pathologies underlying naturally occurring GPCR mutations. Inactive, overactive, or constitutively active receptors have been identified that result in pathology. These receptor variants may alter ligand binding, G protein coupling, receptor desensitization and receptor recycling. Receptor systems discussed include rhodopsin, thyrotropin, parathyroid hormone, melanocortin, follicle-stimulating hormone (FSH), luteinizing hormone, gonadotropin-releasing hormone (GNRHR), adrenocorticotropic hormone, vasopressin, endothelin-β, purinergic, and the G protein associated with asthma (GPRA or neuropeptide S receptor 1 (NPSR1)). The role of activating and inactivating calcium-sensing receptor (CaSR) mutations is discussed in detail with respect to familial hypocalciuric hypercalcemia (FHH) and autosomal dominant hypocalemia (ADH). The CASR mutations have been associated with epilepsy. Diseases caused by the genetic disruption of GPCR functions are discussed in the context of their potential to be selectively targeted by drugs that rescue altered receptors. Examples of drugs developed as a result of targeting GPCRs mutated in disease include: calcimimetics and calcilytics, therapeutics targeting melanocortin receptors in obesity, interventions that alter GNRHR loss from the cell surface in idiopathic hypogonadotropic hypogonadism and novel drugs that might rescue the P2RY12 receptor congenital bleeding phenotype. De-orphanization projects have identified novel disease-associated receptors, such as NPSR1 and GPR35. The identification of variants in these receptors provides genetic reagents useful in drug screens. Discussion of the variety of GPCRs that are disrupted in monogenic Mendelian disorders provides the basis for examining the significance of common

28 CFR 551.60 - Volunteer community service projects.

Code of Federal Regulations, 2010 CFR

2010-07-01

... MANAGEMENT MISCELLANEOUS Volunteer Community Service Projects § 551.60 Volunteer community service projects. (a) A volunteer community service project is a project sponsored and developed by local government or... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Volunteer community service projects. 551...

28 CFR 551.60 - Volunteer community service projects.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 28 Judicial Administration 2 2014-07-01 2014-07-01 false Volunteer community service projects. 551... MANAGEMENT MISCELLANEOUS Volunteer Community Service Projects § 551.60 Volunteer community service projects. (a) A volunteer community service project is a project sponsored and developed by local government or...

28 CFR 551.60 - Volunteer community service projects.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 28 Judicial Administration 2 2012-07-01 2012-07-01 false Volunteer community service projects. 551... MANAGEMENT MISCELLANEOUS Volunteer Community Service Projects § 551.60 Volunteer community service projects. (a) A volunteer community service project is a project sponsored and developed by local government or...

28 CFR 551.60 - Volunteer community service projects.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 28 Judicial Administration 2 2011-07-01 2011-07-01 false Volunteer community service projects. 551... MANAGEMENT MISCELLANEOUS Volunteer Community Service Projects § 551.60 Volunteer community service projects. (a) A volunteer community service project is a project sponsored and developed by local government or...

28 CFR 551.60 - Volunteer community service projects.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 28 Judicial Administration 2 2013-07-01 2013-07-01 false Volunteer community service projects. 551... MANAGEMENT MISCELLANEOUS Volunteer Community Service Projects § 551.60 Volunteer community service projects. (a) A volunteer community service project is a project sponsored and developed by local government or...

28 CFR 551.31 - Approval of an organization.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Approval of an organization. 551.31 Section 551.31 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT... officer(s), and the requirements for activities reporting and operational review; and (2) The organization...

31 CFR 551.301 - Blocked account; blocked property.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Blocked account; blocked property. 551.301 Section 551.301 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF FOREIGN ASSETS CONTROL, DEPARTMENT OF THE TREASURY SOMALIA SANCTIONS REGULATIONS...

Expression patterns, mutation detection and RNA interference of Rhopalosiphum padi voltage-gated sodium channel genes.

PubMed

Zuo, Yayun; Peng, Xiong; Wang, Kang; Lin, Fangfei; Li, Yuting; Chen, Maohua

2016-07-21

The voltage-gated sodium channel (VGSC) is the target of sodium-channel-blocking insecticides. Traditionally, animals were thought to have only one VGSC gene comprising a α-subunit with four homologous domains (DI-DIV). The present study showed that Rhopalosiphum padi, an economically important crop pest, owned a unique heterodimeric VGSC (H1 and H2 subunits) encoded by two genes (Rpvgsc1 and Rpvgsc2), which is unusual in insects and other animals. The open reading frame (ORF) of Rpvgsc1 consisted 1150 amino acids, and the ORF of Rpvgsc2 had 957 amino acids. Rpvgsc1 showed 64.1% amino acid identity to DI-DII of Drosophila melanogaster VGSC and Rpvgsc2 showed 64.0% amino acid identity to DIII-DIV of D. melanogaster VGSC. A M918L mutation previously reported in pyrethroids-resistant strains of other insects was found in the IIS4-S6 region of R. padi field sample. The two R. padi VGSC genes were expressed at all developmental stages and showed similar expression patterns after treatment with beta-cypermethrin. Knockdown of Rpvgsc1 or Rpvgsc2 caused significant reduction in mortality rate of R. padi after exposure to beta-cypermethrin. These findings suggest that the two R. padi VGSC genes are both functional genes.

Expression patterns, mutation detection and RNA interference of Rhopalosiphum padi voltage-gated sodium channel genes

NASA Astrophysics Data System (ADS)

Zuo, Yayun; Peng, Xiong; Wang, Kang; Lin, Fangfei; Li, Yuting; Chen, Maohua

2016-07-01

The voltage-gated sodium channel (VGSC) is the target of sodium-channel-blocking insecticides. Traditionally, animals were thought to have only one VGSC gene comprising a α-subunit with four homologous domains (DI-DIV). The present study showed that Rhopalosiphum padi, an economically important crop pest, owned a unique heterodimeric VGSC (H1 and H2 subunits) encoded by two genes (Rpvgsc1 and Rpvgsc2), which is unusual in insects and other animals. The open reading frame (ORF) of Rpvgsc1 consisted 1150 amino acids, and the ORF of Rpvgsc2 had 957 amino acids. Rpvgsc1 showed 64.1% amino acid identity to DI-DII of Drosophila melanogaster VGSC and Rpvgsc2 showed 64.0% amino acid identity to DIII-DIV of D. melanogaster VGSC. A M918L mutation previously reported in pyrethroids-resistant strains of other insects was found in the IIS4-S6 region of R. padi field sample. The two R. padi VGSC genes were expressed at all developmental stages and showed similar expression patterns after treatment with beta-cypermethrin. Knockdown of Rpvgsc1 or Rpvgsc2 caused significant reduction in mortality rate of R. padi after exposure to beta-cypermethrin. These findings suggest that the two R. padi VGSC genes are both functional genes.

Performance analysis of SiGe double-gate N-MOSFET

NASA Astrophysics Data System (ADS)

Singh, A.; Kapoor, D.; Sharma, R.

2017-04-01

The major purpose of this paper is to find an alternative configuration that not only minimizes the limitations of single-gate (SG) MOSFETs but also provides the better replacement for future technology. In this paper, the electrical characteristics of SiGe double-gate N-MOSFET are demonstrated and compared with electrical characteristics of Si double-gate N-MOSFET. Furthermore, in this paper the electrical characteristics of Si double-gate N-MOSFET are demonstrated and compared with electrical characteristics of Si single-gate N-MOSFET. The simulations are carried out for the device at different operational voltages using Cogenda Visual TCAD tool. Moreover, we have designed its structure and studied both {I}{{d}}{-}{V}{{g}} characteristics for different voltages namely 0.05, 0.1, 0.5, 0.8, 1 and 1.5 V and {I}{{d}}{-}{V}{{d}} characteristics for different voltages namely 0.1, 0.5, 1 and 1.5 V at work functions 4.5, 4.6 and 4.8 eV for this structure. The performance parameters investigated in this paper are threshold voltage, DIBL, subthreshold slope, GIDL, volume inversion and MMCR.

Temporal frequency of knockdown resistance mutations, F1534C and V1016G, in Aedes aegypti in Chiang Mai city, Thailand and the impact of the mutations on the efficiency of thermal fogging spray with pyrethroids.

PubMed

Plernsub, Suriya; Saingamsook, Jassada; Yanola, Jintana; Lumjuan, Nongkran; Tippawangkosol, Pongsri; Walton, Catherine; Somboon, Pradya

2016-10-01

In Thailand, control of dengue outbreaks is currently attained by the use of space sprays, particularly thermal fogging using pyrethroids, with the aim of killing infected Aedes mosquito vectors in epidemic areas. However, the principal dengue vector, Aedes aegypti, is resistant to pyrethroids conferred mainly by mutations in the voltage-gated sodium channel gene, F1534C and V1016G, termed knockdown resistance (kdr). The objectives of this study were to determine the temporal frequencies of F1534C and V1016G in Ae. aegypti populations in relation to pyrethroid resistance in Chiang Mai city, and to evaluate the impact of the mutations on the efficacy of thermal fogging with the pyrethroid deltamethrin. Larvae and pupae were collected from several areas around Chiang Mai city during 2011-2015 and reared to adulthood for bioassays for deltamethrin susceptibility. These revealed no trend of increasing deltamethrin resistance during the study period (mortality 58.0-69.5%, average 62.8%). This corresponded to no overall change in the frequencies of the C1534 allele (0.55-0.66, average 0.62) and G1016 allele (0.34-0.45, average 0.38), determined using allele specific amplification. Only three genotypes of kdr mutations were detected: C1534 homozygous (VV/CC); G1016/C1534 double heterozygous (VG/FC); and G1016 homozygous (GG/FF) indicating that the F1534C and V1016G mutations occurred on separate haplotypic backgrounds and a lack of recombination between them to date. The F1 progeny females were used to evaluate the efficacy of thermal fogging spray with Damthrin-SP(®) (deltamethrin+S-bioallethrin+piperonyl butoxide) using a caged mosquito bioassay. The thermal fogging spray killed 100% and 61.3% of caged mosquito bioassay placed indoors and outdoors, respectively. The outdoor spray had greater killing effect on C1534 homozygous and had partially effect on double heterozygous mosquitoes, but did not kill any G1016 homozygous mutants living outdoors. As this selection

5 CFR 551.204 - Nonexemption of certain employees.

Code of Federal Regulations, 2013 CFR

2013-01-01

... period of time on FLSA exemption status) or § 551.212 (Foreign exemption criteria)) because they do not... as in the Air Traffic Control series, or in the Aircraft Operations series unless such employees are... time on FLSA exemption status) or § 551.212 (Foreign exemption criteria). ...

5 CFR 551.204 - Nonexemption of certain employees.

Code of Federal Regulations, 2010 CFR

2010-01-01

....204 Section 551.204 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS... period of time on FLSA exemption status) or § 551.212 (Foreign exemption criteria)) because they do not..., technical skills and knowledge that can be acquired only through prolonged job training and experience, such...

31 CFR 551.305 - Licenses; general and specific.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Licenses; general and specific. 551.305 Section 551.305 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF FOREIGN ASSETS CONTROL, DEPARTMENT OF THE TREASURY SOMALIA SANCTIONS REGULATIONS General...

31 CFR 551.901 - Paperwork Reduction Act notice.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Paperwork Reduction Act notice. 551.901 Section 551.901 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF FOREIGN ASSETS CONTROL, DEPARTMENT OF THE TREASURY SOMALIA SANCTIONS REGULATIONS Paperwork...

A novel cell line generated using the CRISPR/Cas9 technology as universal quality control material for KRAS G12V mutation testing.

PubMed

Jia, Shiyu; Zhang, Rui; Lin, Guigao; Peng, Rongxue; Gao, Peng; Han, Yanxi; Fu, Yu; Ding, Jiansheng; Wu, Qisheng; Zhang, Kuo; Xie, Jiehong; Li, Jinming

2018-06-01

KRAS mutations are the key indicator for EGFR monoclonal antibody-targeted therapy and acquired drug resistance, and their accurate detection is critical to the clinical decision-making of colorectal cancer. However, no proper quality control material is available for the current detection methods, particularly next-generation sequencing (NGS). The ideal quality control material for NGS needs to provide both the tumor mutation gene and the matched background genomic DNA, which is uncataloged in public databases, to accurately distinguish germline polymorphisms and somatic mutations. We developed a novel KRAS G12V mutant cell line using the clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPR-associated protein 9 (Cas9) technique to make up for the deficiencies in existing quality control material and further validated the feasibility of the cell line as quality control material by amplification refractory mutation system (ARMS), Sanger sequencing, digital PCR (dPCR), and NGS. We verified that the edited cell line specifically had the G12V mutation, and the validation results presented a high consistency among the four methods of detection. The three cell lines screened contained the G12V mutation and the mutation allele fractions of G12V-1, G12V-2, and G12V-3 were 52.01%, 82.06%, and 17.29%, respectively. The novel KRAS G12V cell line generated using the CRISPR/Cas9 gene editing system is suitable as a quality control material for all current detection methods and provides a new direction in the development of quality control material. © 2018 Wiley Periodicals, Inc.

Base substitution mutations in uridinediphosphate-dependent glycosyltransferase 76G1 gene of Stevia rebaudiana causes the low levels of rebaudioside A: mutations in UGT76G1, a key gene of steviol glycosides synthesis.

PubMed

Yang, Yong-Heng; Huang, Su-Zhen; Han, Yu-Lin; Yuan, Hai-Yan; Gu, Chun-Sun; Zhao, Yan-Hai

2014-07-01

Steviol glycosides, extracted from the leaves of Stevia rebaudiana (Bert) Bertoni, are calorie-free sugar substitute of natural origin with intensely sweet (Boileau et al., 2012). Stevioside and rebaudioside A are the two main kinds of the diterpenic glycosides. We analyzed the concentration of stevioside and rebaudioside A in Stevia leaves of about 500 samples (hybrid progenies) and discovered a mutation plant "Z05" with very low levels of rebaudioside A. Because UGT76G1, a uridinediphosphate-dependent glycosyltransferases, is responsible for the conversion from stevioside to rebaudioside A (Richman et al., 2005), so mutation identification was done by sequencing the candidate gene, UGT76G1. In this study molecular analysis of two strains revealed a heterozygotic nonsense mutation of c.389T > G (p.L121X) in UGT76G1. Meanwhile, we found some amino acid substitutions significant change the protein structure. And the difference of enzyme activity between two strains proved the lack of functionality of UGT76G1 of the mutation "Z05". So the nonsense mutation and amino acid substitution mutation resulted in the low levels of rebaudioside A. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

Ca2+ toxicity due to reverse Na+/Ca2+ exchange contributes to degeneration of neurites of DRG neurons induced by a neuropathy-associated Nav1.7 mutation

PubMed Central

Estacion, M.; Vohra, B. P. S; Liu, S.; Hoeijmakers, J.; Faber, C. G.; Merkies, I. S. J.; Lauria, G.; Black, J. A.

2015-01-01

Gain-of-function missense mutations in voltage-gated sodium channel Nav1.7 have been linked to small-fiber neuropathy, which is characterized by burning pain, dysautonomia and a loss of intraepidermal nerve fibers. However, the mechanistic cascades linking Nav1.7 mutations to axonal degeneration are incompletely understood. The G856D mutation in Nav1.7 produces robust changes in channel biophysical properties, including hyperpolarized activation, depolarized inactivation, and enhanced ramp and persistent currents, which contribute to the hyperexcitability exhibited by neurons containing Nav1.8. We report here that cell bodies and neurites of dorsal root ganglion (DRG) neurons transfected with G856D display increased levels of intracellular Na+ concentration ([Na+]) and intracellular [Ca2+] following stimulation with high [K+] compared with wild-type (WT) Nav1.7-expressing neurons. Blockade of reverse mode of the sodium/calcium exchanger (NCX) or of sodium channels attenuates [Ca2+] transients evoked by high [K+] in G856D-expressing DRG cell bodies and neurites. We also show that treatment of WT or G856D-expressing neurites with high [K+] or 2-deoxyglucose (2-DG) does not elicit degeneration of these neurites, but that high [K+] and 2-DG in combination evokes degeneration of G856D neurites but not WT neurites. Our results also demonstrate that 0 Ca2+ or blockade of reverse mode of NCX protects G856D-expressing neurites from degeneration when exposed to high [K+] and 2-DG. These results point to [Na+] overload in DRG neurons expressing mutant G856D Nav1.7, which triggers reverse mode of NCX and contributes to Ca2+ toxicity, and suggest subtype-specific blockade of Nav1.7 or inhibition of reverse NCX as strategies that might slow or prevent axon degeneration in small-fiber neuropathy. PMID:26156380

28 CFR 551.153 - Cancelling the notification request.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Cancelling the notification request. 551... MANAGEMENT MISCELLANEOUS Victim and/or Witness Notification § 551.153 Cancelling the notification request. (a... victim and/or witness that his or her request for notification has been cancelled. (b) Bureau of Prisons...

31 CFR 551.310 - U.S. financial institution.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 31 Money and Finance:Treasury 3 2012-07-01 2012-07-01 false U.S. financial institution. 551.310 Section 551.310 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE..., commodity futures or options, or procuring purchasers and sellers thereof, as principal or agent. It...

31 CFR 551.310 - U.S. financial institution.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 31 Money and Finance:Treasury 3 2011-07-01 2011-07-01 false U.S. financial institution. 551.310 Section 551.310 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE..., commodity futures or options, or procuring purchasers and sellers thereof, as principal or agent. It...

31 CFR 551.310 - U.S. financial institution.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 31 Money and Finance:Treasury 3 2013-07-01 2013-07-01 false U.S. financial institution. 551.310 Section 551.310 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE..., commodity futures or options, or procuring purchasers and sellers thereof, as principal or agent. It...

31 CFR 551.310 - U.S. financial institution.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false U.S. financial institution. 551.310 Section 551.310 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE..., commodity futures or options, or procuring purchasers and sellers thereof, as principal or agent. It...

31 CFR 551.310 - U.S. financial institution.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 31 Money and Finance:Treasury 3 2014-07-01 2014-07-01 false U.S. financial institution. 551.310 Section 551.310 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE..., commodity futures or options, or procuring purchasers and sellers thereof, as principal or agent. It...

49 CFR 236.551 - Power supply voltage; requirement.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 49 Transportation 4 2010-10-01 2010-10-01 false Power supply voltage; requirement. 236.551 Section... Train Stop, Train Control and Cab Signal Systems Rules and Instructions; Locomotives § 236.551 Power supply voltage; requirement. The voltage of power supply shall be maintained within 10 percent of rated...

49 CFR 236.551 - Power supply voltage; requirement.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 49 Transportation 4 2011-10-01 2011-10-01 false Power supply voltage; requirement. 236.551 Section... Train Stop, Train Control and Cab Signal Systems Rules and Instructions; Locomotives § 236.551 Power supply voltage; requirement. The voltage of power supply shall be maintained within 10 percent of rated...

47 CFR 0.551 - Purpose and scope; definitions.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 47 Telecommunication 1 2011-10-01 2011-10-01 false Purpose and scope; definitions. 0.551 Section 0... Regulations § 0.551 Purpose and scope; definitions. (a) The purpose of this subpart is to implement the... maintained by the Commission, including but not limited to, such individual's education, financial...

The insulin-like growth factor 2 (IGF2) gene intron3-g.3072G>A polymorphism is not the only Sus scrofa chromosome 2p mutation affecting meat production and carcass traits in pigs: evidence from the effects of a cathepsin D (CTSD) gene polymorphism.

PubMed

Fontanesi, L; Speroni, C; Buttazzoni, L; Scotti, E; Dall'Olio, S; Nanni Costa, L; Davoli, R; Russo, V

2010-07-01

The objective of this study was to evaluate the effects of mutations in 2 genes [IGF2 and cathepsin D (CTSD)] that map on the telomeric end of the p arm of SSC2. In this region, an imprinted QTL affecting muscle mass and fat deposition was reported, and the IGF2 intron3-g.3072G>A substitution was identified as the causative mutation. In the same chromosome region, we assigned, by linkage mapping, the CTSD gene, a lysosomal proteinase, for which we previously identified an SNP in the 3'-untranslated region (AM933484, g.70G>A). We have already shown strong effects of this CTSD mutation on several production traits in Italian Large White pigs, suggesting a possible independent role of this marker in fatness and meat deposition in pigs. To evaluate this hypothesis, after having refined the map position of the CTSD gene by radiation hybrid mapping, we analyzed the IGF2 and the CTSD polymorphisms in 270 Italian Large White and 311 Italian Duroc pigs, for which EBV and random residuals from fixed models were calculated for several traits. Different association analyses were carried out to distinguish the effects of the 2 close markers. In the Italian Large White pigs, the results for IGF2 were highly significant for all traits when using either EBV or random residuals (e.g., using EBV: lean cuts, P = 2.2 x 10(-18); ADG, P = 2.6 x 10(-16); backfat thickness, P = 2.2 x 10(-9); feed:gain ratio, P = 2.3 x 10(-9); ham weight, P = 1.5 x 10(-6)). No effect was observed for meat quality traits. The IGF2 intron3-g.3072G>A mutation did not show any association in the Italian Duroc pigs, probably because of the small variability at this polymorphic site for this breed. However, a significant association was evident for the CTSD marker (P < 0.001) with EBV of all carcass and production traits in Italian Duroc pigs (lean content, ADG, backfat thickness, feed:gain ratio) after excluding possible confounding effects of the IGF2 mutation. The effects of the CTSD g.70G>A mutation were