Sample records for g6pd gene mutations

  1. A multiplex method for detection of glucose-6-phosphate dehydrogenase (G6PD) gene mutations.

    PubMed

    Zhang, L; Yang, Y; Liu, R; Li, Q; Yang, F; Ma, L; Liu, H; Chen, X; Yang, Z; Cui, L; He, Y

    2015-12-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common human enzyme defect caused by G6PD gene mutations. This study aimed to develop a cost-effective, multiplex, genotyping method for detecting common mutations in the G6PD gene. We used a SNaPshot approach to genotype multiple G6PD mutations that are common to human populations in South-East Asia. This assay is based on multiplex PCR coupled with primer extension reactions. Different G6PD gene mutations were determined by peak retention time and colors of the primer extension products. We designed PCR primers for multiplex amplification of the G6PD gene fragments and for primer extension reactions to genotype 11 G6PD mutations. DNA samples from a total of 120 unrelated G6PD-deficient individuals from the China-Myanmar border area were used to establish and validate this method. Direct sequencing of the PCR products demonstrated 100% concordance between the SNaPshot and the sequencing results. The SNaPshot method offers a specific and sensitive alternative for simultaneously interrogating multiple G6PD mutations. © 2015 John Wiley & Sons Ltd.

  2. G6PDdb, an integrated database of glucose-6-phosphate dehydrogenase (G6PD) mutations.

    PubMed

    Kwok, Colin J; Martin, Andrew C R; Au, Shannon W N; Lam, Veronica M S

    2002-03-01

    G6PDdb (http://www.rubic.rdg.ac.uk/g6pd/ or http://www.bioinf.org.uk/g6pd/) is a newly created web-accessible locus-specific mutation database for the human Glucose-6-phosphate dehydrogenase (G6PD) gene. The relational database integrates up-to-date mutational and structural data from various databanks (GenBank, Protein Data Bank, etc.) with biochemically characterized variants and their associated phenotypes obtained from published literature and the Favism website. An automated analysis of the mutations likely to have a significant impact on the structure of the protein has been performed using a recently developed procedure. The database may be queried online and the full results of the analysis of the structural impact of mutations are available. The web page provides a form for submitting additional mutation data and is linked to resources such as the Favism website, OMIM, HGMD, HGVBASE, and the PDB. This database provides insights into the molecular aspects and clinical significance of G6PD deficiency for researchers and clinicians and the web page functions as a knowledge base relevant to the understanding of G6PD deficiency and its management. Copyright 2002 Wiley-Liss, Inc.

  3. A Novel de novo Mutation in the G6PD Gene in a Korean Boy with Glucose-6-phosphate Dehydrogenase Deficiency: Case Report.

    PubMed

    Jang, Mi-Ae; Kim, Ji-Yoon; Lee, Ki-O; Kim, Sun-Hee; Koo, Hong Hoe; Kim, Hee-Jin

    2015-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is an X-linked recessive hemolytic anemia caused by a mutation in the G6PD gene on Xq28. Herein, we describe a Korean boy with G6PD deficiency resulting from a novel mutation in G6PD. A 20-month-old boy with hemolytic anemia was referred for molecular diagnosis. He had no relevant family history. The G6PD activity was severely decreased at 0.2 U/g Hb (severe deficiency). Direct sequencing analyses on the G6PD gene revealed that he was hemizygous for a novel missense variant, c.1187C>G (p.Pro396Arg), in exon 10 of G6PD. Family study involving his parents revealed the de novo occurrence of the mutation. This is the first report of genetically confirmed G6PD deficiency in Korea. © 2015 by the Association of Clinical Scientists, Inc.

  4. Glucose-6-phosphate dehydrogenase (G6PD) mutations database: review of the "old" and update of the new mutations.

    PubMed

    Minucci, Angelo; Moradkhani, Kamran; Hwang, Ming Jing; Zuppi, Cecilia; Giardina, Bruno; Capoluongo, Ettore

    2012-03-15

    In the present paper we have updated the G6PD mutations database, including all the last discovered G6PD genetic variants. We underline that the last database has been published by Vulliamy et al. [1] who analytically reported 140 G6PD mutations: along with Vulliamy's database, there are two main sites, such as http://202.120.189.88/mutdb/ and www.LOVD.nl/MR, where almost all G6PD mutations can be found. Compared to the previous mutation reports, in our paper we have included for each mutation some additional information, such as: the secondary structure and the enzyme 3D position involving by mutation, the creation or abolition of a restriction site (with the enzyme involved) and the conservation score associated with each amino acid position. The mutations reported in the present tab have been divided according to the gene's region involved (coding and non-coding) and mutations affecting the coding region in: single, multiple (at least with two bases involved) and deletion. We underline that for the listed mutations, reported in italic, literature doesn't provide all the biochemical or bio-molecular information or the research data. Finally, for the "old" mutations, we tried to verify features previously reported and, when subsequently modified, we updated the specific information using the latest literature data. Copyright © 2012 Elsevier Inc. All rights reserved.

  5. Three new mutations account for the prevalence of glucose 6 phosphate deshydrogenase (G6PD) deficiency in Tunisia.

    PubMed

    Bendaoud, B; Hosni, I; Mosbahi, I; Hafsia, R; Prehu, C; Abbes, S

    2013-04-01

    A previous study on G6PD deficiency carried out on Tunisian population, led to the finding of seven different mutations with the prevalence of G6PD A- variant. This present study reports 23 new unrelated deficient subjects studied at the molecular level to determine the mutation that causes G6PD deficiency. Using PCR-SSCP of coding regions followed by direct sequencing of abnormal pattern, three new mutations were detected. Two of them are polymorphic intronic mutations. The first is IVS-V 655C-->C/T, found in four female subjects with mild deficiency of class III variant. The second is IVS-VIII 43 G-->A, found in three male subjects with mild deficiency of class III variant. The third mutation is in the exon region so that it changes the primary structure of the molecule. It is cited for the first time and named G6PD Tunisia. This variant affects the exon 7 of the gene at genomic position 15435 G→T. Its cDNA position is 93 G→G/T, it changes arg 246 to leu. This mutation was found in one heterozygote female with deficiency of class II who have had hemolytic anemia due to ingestion of fava beans. Finally, G6PD Med variant, reported before in three cases, was also found in five other cases (four heterozygote females and one male hemizygote). These findings first enlarge the spectre of mutations to be ten variant mutations, characterizing the Tunisian population and also contribute with hemoglobin gene research in our laboratory to trace the whole genetic map of Tunisian population. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  6. [Molecular characterization of glucose-6-phosphate dehydrogenase deficiency in the Han and Li nationalities in Hainan, China and identification of a new mutation in human G6PD gene].

    PubMed

    Cai, W; Filosa, S; Martini, G; Zhou, Y; Zhou, D; Cai, L; Kuang, Y

    2001-04-01

    To elucidate the molecular basis of G6PD deficiency in the Han and Li nationalities in Hainan, China. Polymerase chain reaction and restriction enzyme digestion were used to screen the mutations 1388G-->A, 1360C-->T, 1024C-->T, 592C-->T, 517T-->C, 493A-->G, 487G-->A, 392G-->T and 95A-->G. Single strand conformation polymorphism analysis was used to screen the other mutations followed by DNA sequencing to characterize the mutations of the samples with abnormal SSCP bands. Of the fifty-nine Han cases with G6PD deficiency, fourteen with 1388G-->A (23.7%), three with 871G-->A(5.1%), one with 835A-->T(1.7%), one with 517T-->C (1.7%), three with 392G-->T(5.1%), and four with 95A-->G(6.8%) were found. Of the thirty-two Li cases with G6PD deficiency, six with 1388G-->A(18.8%), three with 871G-->A(9.4%), and two with 95A-->G(6.3%) were found. A new mutation 835A-->G which causes the substitution of Ala for Thr at 279 in a Han case was identified and named as G6PD Haikou. The enzyme activity of the variant is about 10% of the normal and lower than the activity of the variant 835A-->T with about 40% of the normal. Analysis of the 3D model of human G6PD has revealed that the hydroxyl group of Thr at 279 is a group in maintaining the interaction of the G6PD subunits. The most common mutations of G6PD deficiency in Han and Li nationalities in Hainan are similar. Compared with the mutation spectrum of G6PD gene in the populations in other regions of China, the results indicate that some G6PD gene mutations are widespread in the populations of different regions in the southern part of China. The hydroxyl group of the Thr at 279 of human G6PD may be a necessary group for maintaining the interaction of the G6PD subunits and the enzyme activity.

  7. Glucose-6-Phosphate Dehydrogenase (G6PD) deficiency in Greek newborns: the Mediterranean C563T mutation screening.

    PubMed

    Molou, Elina; Schulpis, Kleopatra H; Thodi, Georgia; Georgiou, Vassiliki; Dotsikas, Yannis; Papadopoulos, Konstantinos; Biti, Sofia; Loukas, Yannis L

    2014-04-01

    Glucose-6-Phosphate Dehydrogenase (G6PD) gene is located at the X-chromosome at Xq28 and the disease is recessively inherited predominantly in males. More than 400 variants have been proposed based on clinical and enzymatic studies. The aim of the current study was to identify C563T mutation in G6PD-deficient newborns and to correlate the enzyme residual activity with the presence of the mutation. Some 1189 full-term neonates aged 3-5 days old were tested for G6PD activity in dried blood spots from Guthrie cards using a commercial kit. DNA extraction from Guthrie cards and mutation identification among the deficient samples were performed with current techniques. A total of 92 (7.7%) newborns were G6PD-deficient. In 46 (50%), the mutation C563T was identified. The residual activity in C563T hemizygote males (n = 28) was statistically significantly lower (1.23 ± 0.93 U/g Hb) than that in non-C563T G6PD-deficient males (n = 25) (4.01 ± 1.20 U/g Hb, p < 0.0001) and in controls (13.6 ± 2.9 U/g Hb, p < 0.0001). In C563T heterozygote females, the estimated enzyme activity was lower than that determined in non-C563T females. Male C563T hemizygotes suffer from G6PD deficiency and severe neonatal jaundice. G6PD activity showed statistically significant correlation with total bilirubin blood levels.

  8. G6PD deficiency assessment in Freetown, Sierra Leone, reveals further insight into the molecular heterogeneity of G6PD A-.

    PubMed

    Jalloh, Amadu; Jalloh, Muctarr; Gamanga, Idrissa; Baion, David; Sahr, Foday; Gbakima, Aiah; Willoughby, Victor R; Matsuoka, Hiroyuki

    2008-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency in Africa is of high prevalence, although precise data are lacking in many individual nations. We investigated 129 unrelated subjects (71 male subjects, 58 female subjects) visiting a teaching hospital in Freetown, Sierra Leone, to collect baseline data on the distribution of G6PD deficiency among respective ethnic groups in the country. We confirmed eight G6PD-deficient male subjects by two formazan-based blood tests (11.3% of the male subjects examined), and also detected the common 376A > G mutation in 11 male subjects and eight female subjects by sequencing exons 3-5 of the G6PD gene. Selected samples were further sequenced for exons 2-13 and introns 5, 7, 8, and 11. Among the deficient male subjects, six were G6PD A- carrying the double mutations (202G > A and 376A > G), all of whom were in the Temne and Mende ethnic groups. Others included A- Betica, and a novel variant having double mutations in exon 5 (311G > A and 376A > G forming 104 Arg > His and 126 Asn > Asp, respectively), which we designate as G6PD Sierra Leone. Subsequent haplotype analysis linked this novel variant to the G6PD A- "family".

  9. Rapid detection of G6PD mutations by multicolor melting curve analysis.

    PubMed

    Xia, Zhongmin; Chen, Ping; Tang, Ning; Yan, Tizhen; Zhou, Yuqiu; Xiao, Qizhi; Huang, Qiuying; Li, Qingge

    2016-09-01

    The MeltPro G6PD assay is the first commercial genetic test for glucose-6-phosphate dehydrogenase (G6PD) deficiency. This multicolor melting curve analysis-based real-time PCR assay is designed to genotype 16 G6PD mutations prevalent in the Chinese population. We comprehensively evaluated both the analytical and clinical performances of this assay. All 16 mutations were accurately genotyped, and the standard deviation of the measured Tm was <0.3°C. The limit of detection was 1.0ng/μL human genomic DNA. The assay could be run on four mainstream models of real-time PCR machines. The shortest running time (150min) was obtained with LightCycler 480 II. A clinical study using 763 samples collected from three hospitals indicated that, of 433 samples with reduced G6PD activity, the MeltPro assay identified 423 samples as mutant, yielding a clinical sensitivity of 97.7% (423/433). Of the 117 male samples with normal G6PD activity, the MeltPro assay confirmed that 116 samples were wild type, yielding a clinical specificity of 99.1% (116/117). Moreover, the MeltPro assay demonstrated 100% concordance with DNA sequencing for all targeted mutations. We concluded that the MeltPro G6PD assay is useful as a diagnostic or screening tool for G6PD deficiency in clinical settings. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Rapid detection of common Chinese glucose-6-phosphate dehydrogenase (G6PD) mutations by denaturing gradient gel electrophoresis (DGGE).

    PubMed

    Lam, V M; Huang, W; Lam, S T; Yeung, C Y; Johnson, P H

    1996-03-01

    We describe here the use of denaturing gradient gel electrophoresis (DGGE) to detect the most common Chinese glucose-6-phosphate dehydrogenase (G6PD) variants, which are the single point mutations: G-->T at nt 1376, G-->A at 1388 both in exon 12 and A-->G at nt 95 in exon 02. In each case, the mutant allele resolves well from the normal allele(s). The distinct heteroduplex bands are characteristic of a particular genotype suggesting that this feature is very useful for identifying all heterozygous carriers for this and other X-linked diseases. When the analysis is extended to other exons, DGGE scans the gene and coupled with direct sequencing, it leads to the identification of new G6PD variation(s). With this approach, we identified a mutation in exon 9 which had not been reported in Hong Kong. Since DGGE can rapidly screen many unknown samples in one gel, this approach could be used to diagnose these G6PD mutations and to identify the at-risk for counselling.

  11. Molecular Analysis of Glucose-6-Phosphate Dehydrogenase Gene Mutations in Bangladeshi Individuals.

    PubMed

    Sarker, Suprovath Kumar; Islam, Md Tarikul; Eckhoff, Grace; Hossain, Mohammad Amir; Qadri, Syeda Kashfi; Muraduzzaman, A K M; Bhuyan, Golam Sarower; Shahidullah, Mohammod; Mannan, Mohammad Abdul; Tahura, Sarabon; Hussain, Manzoor; Akhter, Shahida; Nahar, Nazmun; Shirin, Tahmina; Qadri, Firdausi; Mannoor, Kaiissar

    2016-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a common X-linked human enzyme defect of red blood cells (RBCs). Individuals with this gene defect appear normal until exposed to oxidative stress which induces hemolysis. Consumption of certain foods such as fava beans, legumes; infection with bacteria or virus; and use of certain drugs such as primaquine, sulfa drugs etc. may result in lysis of RBCs in G6PD deficient individuals. The genetic defect that causes G6PD deficiency has been identified mostly as single base missense mutations. One hundred and sixty G6PD gene mutations, which lead to amino acid substitutions, have been described worldwide. The purpose of this study was to detect G6PD gene mutations in hospital-based settings in the local population of Dhaka city, Bangladesh. Qualitative fluorescent spot test and quantitative enzyme activity measurement using RANDOX G6PDH kit were performed for analysis of blood specimens and detection of G6PD-deficient participants. For G6PD-deficient samples, PCR was done with six sets of primers specific for G6PD gene. Automated Sanger sequencing of the PCR products was performed to identify the mutations in the gene. Based on fluorescence spot test and quantitative enzyme assay followed by G6PD gene sequencing, 12 specimens (11 males and one female) among 121 clinically suspected patient-specimens were found to be deficient, suggesting a frequency of 9.9% G6PD deficiency. Sequencing of the G6PD-deficient samples revealed c.C131G substitution (exon-3: Ala44Gly) in six samples, c.G487A substitution (exon-6:Gly163Ser) in five samples and c.G949A substitution (exon-9: Glu317Lys) of coding sequence in one sample. These mutations either affect NADP binding or disrupt protein structure. From the study it appears that Ala44Gly and Gly163Ser are the most common G6PD mutations in Dhaka, Bangladesh. This is the first study of G6PD mutations in Bangladesh.

  12. DNA hypermethylation and X chromosome inactivation are major determinants of phenotypic variation in women heterozygous for G6PD mutations.

    PubMed

    Wang, Jin; Xiao, Qi-Zhi; Chen, You-Ming; Yi, Sheng; Liu, Dun; Liu, Yan-Hui; Zhang, Cui-Mei; Wei, Xiao-Feng; Zhou, Yu-Qiu; Zhong, Xing-Ming; Zhao, Cun-You; Xiong, Fu; Wei, Xiang-Cai; Xu, Xiang-Min

    2014-12-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is an X-linked incompletely dominant enzyme deficiency that results from G6PD gene mutations. Women heterozygous for G6PD mutations exhibit variation in the loss of enzyme activity but the cause of this phenotypic variation is unclear. We determined DNA methylation and X-inactivation patterns in 71 G6PD-deficient female heterozygotes and 68 G6PD non-deficient controls with the same missense mutations (G6PD Canton c.1376G>T or Kaiping c.1388G>A) to correlate determinants with variable phenotypes. Specific CpG methylations within the G6PD promoter were significantly higher in G6PD-deficient heterozygotes than in controls. Preferential X-inactivation of the G6PD wild-type allele was determined in heterozygotes. The incidence of preferential X-inactivation was 86.2% in the deficient heterozygote group and 31.7% in the non-deficient heterozygote group. A significant negative correlation was observed between X-inactivation ratios of the wild-type allele and G6PD/6-phosphogluconate dehydrogenase (6PGD) ratios in heterozygous G6PD Canton (r=-0.657, p<0.001) or Kaiping (r=-0.668, p<0.001). Multivariate logistic regression indicated that heterozygotes with hypermethylation of specific CpG sites in the G6PD promoter and preferential X-inactivation of the wild-type allele were at risk of enzyme deficiency. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. Molecular Analysis of Glucose-6-Phosphate Dehydrogenase Gene Mutations in Bangladeshi Individuals

    PubMed Central

    Sarker, Suprovath Kumar; Hossain, Mohammad Amir; Qadri, Syeda Kashfi; Muraduzzaman, A. K. M.; Bhuyan, Golam Sarower; Shahidullah, Mohammod; Mannan, Mohammad Abdul; Tahura, Sarabon; Hussain, Manzoor; Akhter, Shahida; Nahar, Nazmun; Shirin, Tahmina; Qadri, Firdausi; Mannoor, Kaiissar

    2016-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a common X-linked human enzyme defect of red blood cells (RBCs). Individuals with this gene defect appear normal until exposed to oxidative stress which induces hemolysis. Consumption of certain foods such as fava beans, legumes; infection with bacteria or virus; and use of certain drugs such as primaquine, sulfa drugs etc. may result in lysis of RBCs in G6PD deficient individuals. The genetic defect that causes G6PD deficiency has been identified mostly as single base missense mutations. One hundred and sixty G6PD gene mutations, which lead to amino acid substitutions, have been described worldwide. The purpose of this study was to detect G6PD gene mutations in hospital-based settings in the local population of Dhaka city, Bangladesh. Qualitative fluorescent spot test and quantitative enzyme activity measurement using RANDOX G6PDH kit were performed for analysis of blood specimens and detection of G6PD-deficient participants. For G6PD-deficient samples, PCR was done with six sets of primers specific for G6PD gene. Automated Sanger sequencing of the PCR products was performed to identify the mutations in the gene. Based on fluorescence spot test and quantitative enzyme assay followed by G6PD gene sequencing, 12 specimens (11 males and one female) among 121 clinically suspected patient-specimens were found to be deficient, suggesting a frequency of 9.9% G6PD deficiency. Sequencing of the G6PD-deficient samples revealed c.C131G substitution (exon-3: Ala44Gly) in six samples, c.G487A substitution (exon-6:Gly163Ser) in five samples and c.G949A substitution (exon-9: Glu317Lys) of coding sequence in one sample. These mutations either affect NADP binding or disrupt protein structure. From the study it appears that Ala44Gly and Gly163Ser are the most common G6PD mutations in Dhaka, Bangladesh. This is the first study of G6PD mutations in Bangladesh. PMID:27880809

  14. [Detection of gene mutation in glucose-6-phosphate dehydrogenase deficiency by RT-PCR sequencing].

    PubMed

    Lyu, Rong-Yu; Chen, Xiao-Wen; Zhang, Min; Chen, Yun-Sheng; Yu, Jie; Wen, Fei-Qiu

    2016-07-01

    Since glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common hereditary hemolytic erythrocyte enzyme deficiency, most cases have single nucleotide mutations in the coding region, and current test methods for gene mutation have some missed detections, this study aimed to investigate the feasibility of RT-PCR sequencing in the detection of gene mutation in G6PD deficiency. According to the G6PD/6GPD ratio, 195 children with anemia of unknown cause or who underwent physical examination between August 2013 and July 2014 were classified into G6PD-deficiency group with 130 children (G6PD/6GPD ratio <1.00) and control group with 65 children (G6PD/6GPD ratio≥1.00). The primer design and PCR amplification conditions were optimized, and RT-PCR sequencing was used to analyze the complete coding sequence and verify the genomic DNA sequence in the two groups. In the G6PD-deficiency group, the detection rate of gene mutation was 100% and 13 missense mutations were detected, including one new mutation. In the control group, no missense mutation was detected in 28 boys; 13 heterozygous missense mutations, 1 homozygous same-sense mutation (C1191T) which had not been reported in China and abroad, and 14 single nucleotide polymorphisms of C1311T were detected in 37 girls. The control group showed a high rate of missed detection of G6PD deficiency (carriers) in the specimens from girls (35%, 13/37). RT-PCR sequencing has a high detection rate of G6PD gene mutation and a certain value in clinical diagnosis of G6PD deficiency.

  15. Biochemical Analysis of Two Single Mutants that Give Rise to a Polymorphic G6PD A-Double Mutant

    PubMed Central

    Ramírez-Nava, Edson Jiovany; González-Valdez, Abigail; Vanoye-Carlo, America; Hernández-Ochoa, Beatriz; Sierra-Palacios, Edgar; Hernández-Pineda, Jessica; Rodríguez-Bustamante, Eduardo; Arreguin-Espinosa, Roberto; Oria-Hernández, Jesús; Reyes-Vivas, Horacio; Marcial-Quino, Jaime

    2017-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) is a key regulatory enzyme that plays a crucial role in the regulation of cellular energy and redox balance. Mutations in the gene encoding G6PD cause the most common enzymopathy that drives hereditary nonspherocytic hemolytic anemia. To gain insights into the effects of mutations in G6PD enzyme efficiency, we have investigated the biochemical, kinetic, and structural changes of three clinical G6PD variants, the single mutations G6PD A+ (Asn126AspD) and G6PD Nefza (Leu323Pro), and the double mutant G6PD A− (Asn126Asp + Leu323Pro). The mutants showed lower residual activity (≤50% of WT G6PD) and displayed important kinetic changes. Although all Class III mutants were located in different regions of the three-dimensional structure of the enzyme and were not close to the active site, these mutants had a deleterious effect over catalytic activity and structural stability. The results indicated that the G6PD Nefza mutation was mainly responsible for the functional and structural alterations observed in the double mutant G6PD A−. Moreover, our study suggests that the G6PD Nefza and G6PD A− mutations affect enzyme functions in a similar fashion to those reported for Class I mutations. PMID:29072585

  16. Glucose-6-phosphate dehydrogenase (G6PD)-deficient infants: Enzyme activity and gene variants as risk factors for phototherapy in the first week of life.

    PubMed

    Wong, Fei-Liang; Ithnin, Azlin; Othman, Ainoon; Cheah, Fook-Choe

    2017-07-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a recognised cause of severe neonatal hyperbilirubinaemia, and identifying which infants are at risk could optimise care and resources. In this study, we determined if G6PD enzyme activity (EA) and certain gene variants were associated with neonatal hyperbilirubinaemia requiring phototherapy during the first week after birth. Newborn infants with G6PD deficiency and a group with normal results obtained by the fluorescent spot test were selected for analyses of G6PD EA and the 10 commonly encountered G6PD mutations in this region, relating these with whether the infants required phototherapy before discharge from the hospital in the first week. A total of 222 infants with mean gestation and birth weight of 38.3 ± 1.8 weeks and 3.02 ± 0.48 kg, respectively, were enrolled. Of these, n = 121 were deficient with EA ≤6.76 U/g Hb, and approximately half (43%) received phototherapy in the first week after birth. The mean EA level was 3.7 U/g Hb. The EA had good accuracy in predicting phototherapy use, with area under the receiver-operating-characteristic curve of 0.81 ± 0.05. Infants on phototherapy more commonly displayed World Health Organization Class II mutations (<10% residual EA). Logistic regression analysis showed that deficiency in EA and mutation at c.1388G>A (adjusted odds ratio, 1.5 and 5.7; 95% confidence interval: 1.31-1.76 and 1.30-25.0, respectively) were independent risk factors for phototherapy. Low G6PD EA (<6.76 U/g Hb) and the G6PD gene variant, c.1388G>A, are risk factors for the need of phototherapy in newborn infants during the first week after birth. © 2017 Paediatrics and Child Health Division (The Royal Australasian College of Physicians).

  17. Large cohort screening of G6PD deficiency and the mutational spectrum in the Dongguan District in Southern China.

    PubMed

    Peng, Qi; Li, Siping; Ma, Keze; Li, Wenrui; Ma, Qiang; He, Xiaoguang; He, Yuejing; He, Ting; Lu, Xiaomei

    2015-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a common enzymatic disorder of the erythrocytes that affects 400 million people worldwide. We developed a PCR-reverse dot blot (RDB) assay to screen twenty genotypes of seventeen Chinese G6PD mutations and investigate the spectrum of G6PD deficiency mutations in Dongguan District, Guangdong Province, in southern China. The PCR-RDB assay consists of multiplex PCR amplification of seven fragments in the G6PD target sequence of wild-type and mutant genomic DNA samples followed by hybridization to a test strip containing allele-specific oligonucleotide probes. A total of 16,464 individuals were analyzed by a combination of phenotypic screening and genotypic detection using the PCR-RDB assay and DNA sequence analysis. The PCR-RDB assay had a detection rate of 98.1%, which was validated by direct sequencing in a blind study with 100% concordance. The G6PD deficiency incidence rate in Dongguan District is 4.08%. Thirty-two genotypes from 469 individuals were found. The two most common variants were c.1376G>T and c.1388G>A, followed by c.95A>G, c.871G>A, c.392G>T, and c.1024 C>T. In addition, two rare mutations (c.703C>A and c.406C>T) were detected by DNA sequencing analysis. In our study, 65 cases harbored the C1311T/IVS polymorphism and 67 cases were homozygote. The PCR-RDB assay we established is a reliable and effective method for screening G6PD mutations in the Chinese population. Data on the spectrum of mutations in the Dongguan District is beneficial to the clinical diagnosis and prevention of G6PD deficiency.

  18. Large Cohort Screening of G6PD Deficiency and the Mutational Spectrum in the Dongguan District in Southern China

    PubMed Central

    Ma, Keze; Li, Wenrui; Ma, Qiang; He, Xiaoguang; He, Yuejing; He, Ting; Lu, Xiaomei

    2015-01-01

    Background Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a common enzymatic disorder of the erythrocytes that affects 400 million people worldwide. We developed a PCR-reverse dot blot (RDB) assay to screen twenty genotypes of seventeen Chinese G6PD mutations and investigate the spectrum of G6PD deficiency mutations in Dongguan District, Guangdong Province, in southern China. Method The PCR-RDB assay consists of multiplex PCR amplification of seven fragments in the G6PD target sequence of wild-type and mutant genomic DNA samples followed by hybridization to a test strip containing allele-specific oligonucleotide probes. A total of 16,464 individuals were analyzed by a combination of phenotypic screening and genotypic detection using the PCR-RDB assay and DNA sequence analysis. Results The PCR-RDB assay had a detection rate of 98.1%, which was validated by direct sequencing in a blind study with 100% concordance. The G6PD deficiency incidence rate in Dongguan District is 4.08%. Thirty-two genotypes from 469 individuals were found. The two most common variants were c.1376G>T and c.1388G>A, followed by c.95A>G, c.871G>A, c.392G>T, and c.1024 C>T. In addition, two rare mutations (c.703C>A and c.406C>T) were detected by DNA sequencing analysis. In our study, 65 cases harbored the C1311T/IVS polymorphism and 67 cases were homozygote. Conclusion The PCR-RDB assay we established is a reliable and effective method for screening G6PD mutations in the Chinese population. Data on the spectrum of mutations in the Dongguan District is beneficial to the clinical diagnosis and prevention of G6PD deficiency. PMID:25775246

  19. Molecular characterization of G6PD deficiency in Cyprus.

    PubMed

    Drousiotou, Anthi; Touma, Elias H; Andreou, Nicoletta; Loiselet, Jacques; Angastiniotis, Michalis; Verrelli, Brian C; Tishkoff, Sarah A

    2004-01-01

    In the present study, we determined the frequency of glucose-6-phosphate dehydrogenase (G6PD) deficiency in Cyprus using two different procedures in two separate adult population groups: a semiquantitative fluorescence test on blood spotted on filter paper and a quantitative spectrophotometric test on liquid blood. The frequency of G6PD deficiency among healthy adult males was found to be 5.1% using the semiquantitative procedure and 6.4% using the quantitative procedure. Neither method was able to detect all the expected female heterozygotes (5.3% and 47.1% of the expected number, respectively). A total of 21 male hemizygotes, 1 female homozygote and 9 female heterozygotes that tested positive for G6PD deficiency were studied at the molecular level. All 32 chromosomes were genotyped and five different mutations were identified. The Mediterranean mutation in exon 6 (563C-->T) (Ser188Phe) was found to be the most common variant in the Cypriot population, accounting for 52.6% of the deficient alleles. In the remaining chromosomes, four different mutations were identified: three known mutations, Kaiping 1388G-->A (Arg463His), Chatham 1003G-->A (Ala335Thr) and Acrokorinthos 463C-->G (His155Asp), and one previously undescribed mutation in exon 3, 148C-->T (Pro50Ser), which we called G6PD Kambos. We conclude that the frequency of G6PD deficiency in Cypriot males is 6.4%, and that this deficiency is the result of several different mutations. Although all the individuals carrying the Mediterranean variant can be detected using a semiquantitative screening method, a quantitative enzyme measurement is required to detect the G6PD variants with less severe enzyme deficiencies, while the most appropriate method for heterozygote detection is DNA analysis.

  20. Characterization of G6PD Genotypes and Phenotypes on the Northwestern Thailand-Myanmar Border

    PubMed Central

    Somsakchaicharoen, Raweewan; Chowwiwat, Nongnud; Parker, Daniel M.; Charunwatthana, Prakaykaew; White, Nicholas J.; Nosten, François H.

    2014-01-01

    Mutations in the glucose-6-phosphate dehydrogenase (G6PD) gene result in red blood cells with increased susceptibility to oxidative damage. Significant haemolysis can be caused by primaquine and other 8-aminoquinoline antimalarials used for the radical treatment of Plasmodium vivax malaria. The distribution and phenotypes of mutations causing G6PD deficiency in the male population of migrants and refugees in a malaria endemic region on the Thailand-Myanmar border were characterized. Blood samples for G6PD fluorescent spot test (FST), G6PD genotyping, and malaria testing were taken from 504 unrelated males of Karen and Burman ethnicities presenting to the outpatient clinics. The overall frequency of G6PD deficiency by the FST was 13.7%. Among the deficient subjects, almost 90% had the Mahidol variant (487G>A) genotype. The remaining subjects had Chinese-4 (392G>T), Viangchan (871G>A), Açores (595A>G), Seattle (844G>C) and Mediterranean (563C>T) variants. Quantification of G6PD activity was performed using a modification of the standard spectrophotometric assay on a subset of 24 samples with Mahidol, Viangchan, Seattle and Chinese-4 mutations; all samples showed a residual enzymatic activity below 10% of normal and were diagnosed correctly by the FST. Further studies are needed to characterise the haemolytic risk of using 8-aminoquinolines in patients with these genotypes. PMID:25536053

  1. Hemolysis and Mediterranean G6PD mutation (c.563 C>T) and c.1311 C>T polymorphism among Palestinians at Gaza Strip.

    PubMed

    Sirdah, Mahmoud; Reading, N Scott; Perkins, Sherrie L; Shubair, Mohammad; Aboud, Lina; Prchal, Josef T

    2012-04-15

    The G6PD c.563 C>T deficient mutation is endemic among Mediterranean populations but its clinical significance is not well delineated. We set up to estimate the proportion of G6PD deficient children presenting with hemolytic anemia at Al Nasser Pediatric Hospital at Gaza Strip, Palestine. We then established the prevalence of c.563T Mediterranean mutation and its linkage to c.1311 C>T polymorphism in this population. G6PD deficiency was identified in children presenting with hemolytic anemia at Al Nasser Pediatric Hospital by spectrophotometric measurement of G6PD activity. G6PD exon 6 and exon 11 were amplified from genomic DNA and evaluated for c.563T mutation by sequencing and the c.1311T polymorphism by restriction fragment analysis. Seventy X-chromosomes (60 males and 5 females) from G6PD deficient patients and 40 X-chromosomes from a control group known to be not G6PD deficient were tested. Over 80% of these children presenting with hemolytic anemia were G6PD deficient and 34% of these had the Mediterranean G6PD deficient variant. The allelic frequencies of Mediterranean c.563T and c.1311T polymorphisms among G6PD deficient patients were 0.33 and 0.38 respectively. The c.1311T polymorphism was linked in 95.2% of patients with the Mediterranean mutation, an allele frequency of 0.87, compared to the control non-G6PD deficient group with an allele frequency of 0.18. We conclude that G6PD deficiency accounts for majority of hemolytic anemia encountered in Gaza children treated at Al Nasser Pediatric Hospital Emergency department. The Mediterranean mutation c.563T, while not accounting for a majority of G6PD deficiency, is common among G6PD deficient Gaza Strip Palestinians and is frequently, but not always, linked to the c.1311T polymorphism. This work provides a foundation for the population screening of Palestinians for G6PD deficiency and for investigations of ancestral origin of the Mediterranean variant in world populations. Copyright © 2012 Elsevier Inc

  2. Expanding the clinical and genetic spectrum of G6PD deficiency: The occurrence of BCGitis and novel missense mutation.

    PubMed

    Khan, Taj Ali; Mazhar, Humaira; Nawaz, Mehboob; Kalsoom, Kalsoom; Ishfaq, Muhammad; Asif, Huma; Rahman, Hazir; Qasim, Muhammad; Naz, Farkhanda; Hussain, Mubashir; Khattak, Baharullah; Ullah, Waheed; Cabral-Marques, Otavio; Butt, Jawad; Iqbal, Asif

    2017-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) is a key enzyme in the pentose phosphate pathway that ensures sufficient production of coenzyme nicotinamide adenine dinucleotide phosphate (NADPH) by catalyzing the reduction of NADP+ to NADPH. Noteworthy, the latter mediates the production of reactive oxygen species (ROS) by phagocytic cells such as neutrophils and monocytes. Therefore, patients with severe forms of G6PD deficiency may present impaired NADPH oxidase activity and become susceptible to recurrent infections. This fact, highlights the importance to characterize the immunopathologic mechanisms underlying the susceptibility to infections in patients with G6PD deficiency. Here we report the first two cases of G6PD deficiency with Bacille Calmette-Guérin (BCG) adverse effect, besides jaundice, hemolytic anemia and recurrent infections caused by Staphylococcus aureus. The qualitative G6PD screening was performed and followed by oxidative burst analysis using flow cytometry. Genetic and in silico analyses were carried out by Sanger sequencing and mutation pathogenicity predicted using bioinformatics tools, respectively. Activated neutrophils and monocytes from patients displayed impaired oxidative burst. The genetic analysis revealed the novel missense mutation c.1157T>A/p.L386Q in G6PD. In addition, in silico analysis indicated that this mutation is pathogenic, thereby hampering the oxidative burst of neutrophils and monocytes from patients. Our data expand the clinical and genetic spectrum of G6PD deficiency, and suggest that impaired oxidative burst in this severe primary immune deficiency is an underlying immunopathologic mechanism that predisposes to mycobacterial infections. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. A novel mutation in the glucose-6-phosphate dehydrogenase gene in a subject with chronic nonspherocytic hemolytic anemia--characterization of enzyme using yeast expression system and molecular modeling.

    PubMed

    Grabowska, Dorota; Jablonska-Skwiecinska, Ewa; Plochocka, Danuta; Chelstowska, Anna; Lewandowska, Irmina; Witos, Iwona; Majewska, Zofia; Rokicka-Milewska, Roma; Burzynska, Beata

    2004-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common human enzymopathy. Human G6PD gene is highly polymorphic, with over 130 mutations identified, many of which cause hemolytic anemia. We studied a novel point mutation in the G6PD gene 1226 C-->G, predicting the proline 409 to arginine substitution (G6PD Suwalki). We expressed the human wild-type and mutated G6PD gene in yeast Saccharomyces cerevisiae which allowed the characterization of the Suwalki variant. We showed that human wild-type, as well as the mutated (1226 C-->G) G6PD gene, functionally complemented the phenotype displayed by the yeast strain with disruption of the ZWF1 gene (homologue of the human G6PD gene). Comparison of wild-type (wt) human G6PD purified from yeast and from blood shows no significant differences in the Km values for G6P and in the utilization rate for the substrate analogue, 2-deoxyG6P. The P409R substitution leads to drastic changes in G6PD kinetics. The specific activity as well as stability of mutated G6PD is also significantly reduced. Besides this, the effect of this mutation was analyzed using a model of the tertiary structure of the human enzyme. The localization of the P409R mutation suggests that it may influence the stability of the whole protein by changing tetramer interactions and disturbing the binding of structural NADP+.

  4. Glucose-6-Phosphate Dehydrogenase: Update and Analysis of New Mutations around the World

    PubMed Central

    Gómez-Manzo, Saúl; Marcial-Quino, Jaime; Vanoye-Carlo, America; Serrano-Posada, Hugo; Ortega-Cuellar, Daniel; González-Valdez, Abigail; Castillo-Rodríguez, Rosa Angélica; Hernández-Ochoa, Beatriz; Sierra-Palacios, Edgar; Rodríguez-Bustamante, Eduardo; Arreguin-Espinosa, Roberto

    2016-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) is a key regulatory enzyme in the pentose phosphate pathway which produces nicotinamide adenine dinucleotide phosphate (NADPH) to maintain an adequate reducing environment in the cells and is especially important in red blood cells (RBC). Given its central role in the regulation of redox state, it is understandable that mutations in the gene encoding G6PD can cause deficiency of the protein activity leading to clinical manifestations such as neonatal jaundice and acute hemolytic anemia. Recently, an extensive review has been published about variants in the g6pd gene; recognizing 186 mutations. In this work, we review the state of the art in G6PD deficiency, describing 217 mutations in the g6pd gene; we also compile information about 31 new mutations, 16 that were not recognized and 15 more that have recently been reported. In order to get a better picture of the effects of new described mutations in g6pd gene, we locate the point mutations in the solved three-dimensional structure of the human G6PD protein. We found that class I mutations have the most deleterious effects on the structure and stability of the protein. PMID:27941691

  5. Marked decrease in specific activity contributes to disease phenotype in two human glucose 6-phosphate dehydrogenase mutants, G6PD(Union) and G6PD(Andalus).

    PubMed

    Wang, Xiao-Tao; Lam, Veronica M S; Engel, Paul C

    2005-09-01

    Clones overexpressing clinical glucose 6-phosphate dehydrogenase (G6PD) mutants Union (c.1360C>T/p.Arg454Cys) and Andalus (c.1361G>A/p.Arg454His), have been constructed. These abolish a salt bridge between Arg454 and Asp 286. One mutant is reportedly a Class II clinical variant and the other a Class I. Kinetic studies of the purified proteins reveal that, for both mutants, kcat is about 10-fold decreased, thus giving a 90% decrease in the WHO assay, and also presumably under physiological conditions. In contrast with unfavourable changes in Vmax for both mutants, Km values for both G6P and NADP+ are decreased approximately 5-fold. Measurements with alternative substrates confirm that G6PD Union, like the wild-type enzyme, follows a rapid-equilibrium random-order mechanism, allowing calculation of enzyme-substrate dissociation constants from initial-rate parameters. The mutations result in several-fold tighter binding of glucose 6-phosphate to the free enzyme. Binding, however, is clearly less productive than with normal enzyme. G6PD mutations are thought to cause haemolytic anaemia by compromising enzyme stability. Both these mutants indeed show somewhat decreased thermostability. However, at 37 degrees C and with NADP+, the stability differences are only moderate. Decreased catalytic efficiency clearly contributes to the disease phenotype of these two mutants, entirely accounting for reported decrease in leukocyte G6PD levels, though not for still lower levels in erythrocytes. Neither the kinetic nor the stability effects appear to justify the different clinical classification of these mutations.

  6. Possible association of 3' UTR +357 A>G, IVS11-nt 93 T>C, c.1311 C>T polymorphism with G6PD deficiency.

    PubMed

    Sirdah, Mahmoud M; Shubair, Mohammad E; Al-Kahlout, Mustafa S; Al-Tayeb, Jamal M; Prchal, Josef T; Reading, N Scott

    2017-07-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a common X-linked inherited enzymopathic disorder affecting more than 500 million people worldwide. It has so far been linked to 217 distinct genetic variants in the exons and exon-intron boundaries of the G6PD gene, giving rise to a wide range of biochemical heterogeneity and clinical manifestations. Reports from different settings suggested the association of intronic and other mutations outside the reading frame of the G6PD gene with reduced enzyme activity and presenting clinical symptoms. The present study aimed to investigate any association of other variations apart of the exonic or exonic intronic boundaries in the development of G6PD deficiency. Sixty-seven unrelated Palestinian children admitted to the pediatric hospital with hemolytic crises due to G6PD deficiency were studied. In our Palestinian cohort of 67 [59 males (M) and 8 females (F)] G6PD-deficient children, previously hospitalized for acute hemolytic anemia due to favism, molecular sequencing of the G6PD gene revealed four cases (3M and 1F) that did not have any of the variants known to cause G6PD deficiency, but the 3' UTR c.*+357A>G (rs1050757) polymorphism in association with IVS 11 (c.1365-13T>C; rs2071429), and c.1311C>T (rs2230037). We now provide an additional evidence form Palestinian G6PD-deficient subjects for a possible role of 3' UTR c.*+357 A>G, c.1365-13T>C, and/or c.1311C>T polymorphism for G6PD deficiency, suggesting that not only a single variation in the exonic or exonic intronic boundaries, but also a haplotype of G6PD should considered as a cause for G6PD deficiency.

  7. Purification and detailed study of two clinically different human glucose 6-phosphate dehydrogenase variants, G6PD(Plymouth) and G6PD(Mahidol): Evidence for defective protein folding as the basis of disease.

    PubMed

    Huang, Yuxiang; Choi, Mei Yee; Au, Shannon Wing Ngor; Au, Deborah Man Yee; Lam, Veronica Min Sien; Engel, Paul C

    2008-01-01

    In an attempt to investigate the molecular mechanism underlying human glucose-6-phosphate dehydrogenase (G6PD) deficiency caused by two mutations, G6PD(Plymouth) (G163D) and G6PD(Mahidol) (G163S), the two variants were constructed by site-directed mutagenesis and expressed in G6PD-deficient E. coli DF 213 cells. A first indication of impaired folding came from problems in expressing these clinical mutants, which were only overcome by lowering the growth temperature or co-expressing with molecular chaperones (GroEL and GroES). Both strategies significantly increased soluble expression of recombinant G6PD(Plymouth) and G6PD(Mahidol), judged by both G6PD activity in extracts and the amount of immunoreactive protein. Using a modified 3-step protocol, the two mutant enzymes were successfully purified for the first time. Steady-state kinetic parameters (K(m) for NADP(+), K(m) for G6P and k(cat)) of the two mutants are very similar to the wild-type values, indicating that the catalytic efficiency of the two mutants remains unchanged. The two mutants are, however, markedly less stable than wild-type G6PD in both thermostability and urea-induced inactivation tests. In a typical experiment at 37 degrees C and pH 7.2 after 24h G6PD WT, G6PD(Mahidol) and G6PD(Plymouth) retained 58.3%, 27.0% and 3.9%, respectively, of their corresponding initial activity. The stability of all three enzymes is enhanced by addition of NADP(+). According to unfolding and refolding experiments, the two mutants are impaired in their folding properties. Thus structural instability appears to be the molecular basis of the clinical phenotype in G6PD(Plymouth) and G6PD(Mahidol) and in particular of the differing clinical severity of the two mutations. The 3-D structure solved for G6PD(Canton) allows an interpretation of these effects in terms of steric hindrance.

  8. G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications

    PubMed Central

    Luzzatto, Lucio; Seneca, Elisa

    2014-01-01

    That primaquine and other drugs can trigger acute haemolytic anaemia in subjects who have an inherited mutation of the glucose 6-phosphate dehydrogenase (G6PD) gene has been known for over half a century: however, these events still occur, because when giving the drug either the G6PD status of a person is not known, or the risk of this potentially life-threatening complication is under-estimated. Here we review briefly the genetic basis of G6PD deficiency, and then the pathophysiology and the clinical features of drug-induced haemolysis; we also update the list of potentially haemolytic drugs (which includes rasburicase). It is now clear that it is not good practice to give one of these drugs before testing a person for his/her G6PD status, especially in populations in whom G6PD deficiency is common. We discuss therefore how G6PD testing can be done reconciling safety with cost; this is once again becoming of public health importance, as more countries are moving along the pathway of malaria elimination, that might require mass administration of primaquine. Finally, we sketch the triangular relationship between malaria, antimalarials such as primaquine, and G6PD deficiency: which is to some extent protective against malaria, but also a genetically determined hazard when taking primaquine. PMID:24372186

  9. Molecular identification of Gd A- and Gd B- G6PD deficient variants by ARMS-PCR in a Tunisian population.

    PubMed

    Haloui, Sabrine; Laouini, Naouel; Sahli, Chaima Abdelhafidh; Daboubi, Rim; Becher, Mariem; Jouini, Latifa; Kazdaghli, Kalthoum; Tinsa, Faten; Cherif, Semia; Khemiri, Monia; Fredj, Sondess Hadj; Othmani, Rim; Ouali, Faida; Siala, Hajer; Toumi, Nour El Houda; Barsaoui, Sihem; Bibi, Amina; Messaoud, Taieb

    2016-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common enzymopathy. More than 200 mutations in the G6PD gene have been described. In Tunisia, the A-African and the B-Mediterranean mutations predominate the mutational spectrum. The purpose of this study was to apply the amplification refractory mutation system (ARMS-PCR) to the identification of Gd A+, Gd A- and Gd B- variants in a cohort of deficient individuals and to establish a phenotype/genotype association. 90 subjects were screened for enzymatic deficiency by spectrophotometric assay. The molecular analyses were performed in a group of 50 unrelated patients. Of the 54 altered chromosomes examined, 60% had the Gd A- mutation, 18% showed the Gd B- mutation and in 20% of cases, no mutations have been identified. The ARMS-PCR showed complete concordance with the endonuclease cleavage reference method and agreed perfectly with previous Tunisian studies where Gd A- and Gd B- were the most encountered. Also, similarities in spectrum mutations with North African and Mediterranean countries suggest gene migration from Africa to Europe through Spain. In conclusion, ARMS has been introduced in this study for common G6PD alleles identification in Tunisia. It gives some advantages compared to the traditional endonuclease digestion method since it is more convenient and timesaving and also offers the possibility to be applied in mass screening surveys.

  10. Hemolytic Potential of Tafenoquine in Female Volunteers Heterozygous for Glucose-6-Phosphate Dehydrogenase (G6PD) Deficiency (G6PD Mahidol Variant) versus G6PD-Normal Volunteers.

    PubMed

    Rueangweerayut, Ronnatrai; Bancone, Germana; Harrell, Emma J; Beelen, Andrew P; Kongpatanakul, Supornchai; Möhrle, Jörg J; Rousell, Vicki; Mohamed, Khadeeja; Qureshi, Ammar; Narayan, Sushma; Yubon, Nushara; Miller, Ann; Nosten, François H; Luzzatto, Lucio; Duparc, Stephan; Kleim, Jörg-Peter; Green, Justin A

    2017-09-01

    Tafenoquine is an 8-aminoquinoline under investigation for the prevention of relapse in Plasmodium vivax malaria. This open-label, dose-escalation study assessed quantitatively the hemolytic risk with tafenoquine in female healthy volunteers heterozygous for the Mahidol 487A glucose-6-phosphate dehydrogenase (G6PD)-deficient variant versus G6PD-normal females, and with reference to primaquine. Six G6PD-heterozygous subjects (G6PD enzyme activity 40-60% of normal) and six G6PD-normal subjects per treatment group received single-dose tafenoquine (100, 200, or 300 mg) or primaquine (15 mg × 14 days). All participants had pretreatment hemoglobin levels ≥ 12.0 g/dL. Tafenoquine dose escalation stopped when hemoglobin decreased by ≥ 2.5 g/dL (or hematocrit decline ≥ 7.5%) versus pretreatment values in ≥ 3/6 subjects. A dose-response was evident in G6PD-heterozygous subjects ( N = 15) receiving tafenoquine for the maximum decrease in hemoglobin versus pretreatment values. Hemoglobin declines were similar for tafenoquine 300 mg (-2.65 to -2.95 g/dL [ N = 3]) and primaquine (-1.25 to -3.0 g/dL [ N = 5]). Two further cohorts of G6PD-heterozygous subjects with G6PD enzyme levels 61-80% ( N = 2) and > 80% ( N = 5) of the site median normal received tafenoquine 200 mg; hemolysis was less pronounced at higher G6PD enzyme activities. Tafenoquine hemolytic potential was dose dependent, and hemolysis was greater in G6PD-heterozygous females with lower G6PD enzyme activity levels. Single-dose tafenoquine 300 mg did not appear to increase the severity of hemolysis versus primaquine 15 mg × 14 days.

  11. Hemolytic Potential of Tafenoquine in Female Volunteers Heterozygous for Glucose-6-Phosphate Dehydrogenase (G6PD) Deficiency (G6PD Mahidol Variant) versus G6PD-Normal Volunteers

    PubMed Central

    Rueangweerayut, Ronnatrai; Bancone, Germana; Harrell, Emma J.; Beelen, Andrew P.; Kongpatanakul, Supornchai; Möhrle, Jörg J.; Rousell, Vicki; Mohamed, Khadeeja; Qureshi, Ammar; Narayan, Sushma; Yubon, Nushara; Miller, Ann; Nosten, François H.; Luzzatto, Lucio; Duparc, Stephan; Kleim, Jörg-Peter; Green, Justin A.

    2017-01-01

    Abstract. Tafenoquine is an 8-aminoquinoline under investigation for the prevention of relapse in Plasmodium vivax malaria. This open-label, dose-escalation study assessed quantitatively the hemolytic risk with tafenoquine in female healthy volunteers heterozygous for the Mahidol487A glucose-6-phosphate dehydrogenase (G6PD)-deficient variant versus G6PD-normal females, and with reference to primaquine. Six G6PD-heterozygous subjects (G6PD enzyme activity 40–60% of normal) and six G6PD-normal subjects per treatment group received single-dose tafenoquine (100, 200, or 300 mg) or primaquine (15 mg × 14 days). All participants had pretreatment hemoglobin levels ≥ 12.0 g/dL. Tafenoquine dose escalation stopped when hemoglobin decreased by ≥ 2.5 g/dL (or hematocrit decline ≥ 7.5%) versus pretreatment values in ≥ 3/6 subjects. A dose–response was evident in G6PD-heterozygous subjects (N = 15) receiving tafenoquine for the maximum decrease in hemoglobin versus pretreatment values. Hemoglobin declines were similar for tafenoquine 300 mg (−2.65 to −2.95 g/dL [N = 3]) and primaquine (−1.25 to −3.0 g/dL [N = 5]). Two further cohorts of G6PD-heterozygous subjects with G6PD enzyme levels 61–80% (N = 2) and > 80% (N = 5) of the site median normal received tafenoquine 200 mg; hemolysis was less pronounced at higher G6PD enzyme activities. Tafenoquine hemolytic potential was dose dependent, and hemolysis was greater in G6PD-heterozygous females with lower G6PD enzyme activity levels. Single-dose tafenoquine 300 mg did not appear to increase the severity of hemolysis versus primaquine 15 mg × 14 days. PMID:28749773

  12. Prevalence and distribution of glucose-6-phosphate dehydrogenase (G6PD) variants in Thai and Burmese populations in malaria endemic areas of Thailand.

    PubMed

    Phompradit, Papichaya; Kuesap, Jiraporn; Chaijaroenkul, Wanna; Rueangweerayut, Ronnatrai; Hongkaew, Yaowaluck; Yamnuan, Rujira; Na-Bangchang, Kesara

    2011-12-15

    G6PD deficiency is common in malaria endemic regions and is estimated to affect more than 400 million people worldwide. Treatment of malaria patients with the anti-malarial drug primaquine or other 8-aminoquinolines may be associated with potential haemolytic anaemia. The aim of the present study was to investigate the prevalence of G6PD variants in Thai population who resided in malaria endemic areas (western, northern, north-eastern, southern, eastern and central regions) of Thailand, as well as the Burmese population who resided in areas along the Thai-Myanmar border. The ten common G6PD variants were investigated in dried blood spot samples collected from 317 Thai (84 males, 233 females) and 183 Burmese (11 males, 172 females) populations residing in malaria endemic areas of Thailand using PCR-RFLP method. Four and seven G6PD variants were observed in samples collected from Burmese and Thai population, with prevalence of 6.6% (21/317) and 14.2% (26/183), respectively. Almost all (96.2%) of G6PD mutation samples collected from Burmese population carried G6PD Mahidol variant; only one sample (3.8%) carried G6PD Kaiping variant. For the Thai population, G6PD Mahidol (8/21: 38.1%) was the most common variant detected, followed by G6PD Viangchan (4/21: 19.0%), G6PD Chinese 4 (3/21: 14.3%), G6PD Canton (2/21: 9.5%), G6PD Union (2/21: 9.5%), G6PD Kaiping (1/21: 4.8%), and G6PD Gaohe (1/21: 4.8%). No G6PD Chinese 3, Chinese 5 and Coimbra variants were found. With this limited sample size, there appeared to be variation in G6PD mutation variants in samples obtained from Thai population in different regions particularly in the western region. Results indicate difference in the prevalence and distribution of G6PD gene variants among the Thai and Burmese populations in different malaria endemic areas. Dosage regimen of primaquine for treatment of both Plasmodium falciparum and Plasmodium vivax malaria may need to be optimized, based on endemic areas with supporting data on

  13. Prevalence and distribution of glucose-6-phosphate dehydrogenase (G6PD) variants in Thai and Burmese populations in malaria endemic areas of Thailand

    PubMed Central

    2011-01-01

    Background G6PD deficiency is common in malaria endemic regions and is estimated to affect more than 400 million people worldwide. Treatment of malaria patients with the anti-malarial drug primaquine or other 8-aminoquinolines may be associated with potential haemolytic anaemia. The aim of the present study was to investigate the prevalence of G6PD variants in Thai population who resided in malaria endemic areas (western, northern, north-eastern, southern, eastern and central regions) of Thailand, as well as the Burmese population who resided in areas along the Thai-Myanmar border. Methods The ten common G6PD variants were investigated in dried blood spot samples collected from 317 Thai (84 males, 233 females) and 183 Burmese (11 males, 172 females) populations residing in malaria endemic areas of Thailand using PCR-RFLP method. Results Four and seven G6PD variants were observed in samples collected from Burmese and Thai population, with prevalence of 6.6% (21/317) and 14.2% (26/183), respectively. Almost all (96.2%) of G6PD mutation samples collected from Burmese population carried G6PD Mahidol variant; only one sample (3.8%) carried G6PD Kaiping variant. For the Thai population, G6PD Mahidol (8/21: 38.1%) was the most common variant detected, followed by G6PD Viangchan (4/21: 19.0%), G6PD Chinese 4 (3/21: 14.3%), G6PD Canton (2/21: 9.5%), G6PD Union (2/21: 9.5%), G6PD Kaiping (1/21: 4.8%), and G6PD Gaohe (1/21: 4.8%). No G6PD Chinese 3, Chinese 5 and Coimbra variants were found. With this limited sample size, there appeared to be variation in G6PD mutation variants in samples obtained from Thai population in different regions particularly in the western region. Conclusions Results indicate difference in the prevalence and distribution of G6PD gene variants among the Thai and Burmese populations in different malaria endemic areas. Dosage regimen of primaquine for treatment of both Plasmodium falciparum and Plasmodium vivax malaria may need to be optimized, based

  14. Glucose-6-phosphate dehydrogenase (G6PD) deficiency is associated with asymptomatic malaria in a rural community in Burkina Faso.

    PubMed

    Ouattara, Abdoul Karim; Bisseye, Cyrille; Bazie, Bapio Valery Jean Télesphore Elvira; Diarra, Birama; Compaore, Tegwindé Rebeca; Djigma, Florencia; Pietra, Virginio; Moret, Remy; Simpore, Jacques

    2014-08-01

    To investigate 4 combinations of mutations responsible for glucose-6-phosphate dehydrogenase (G6PD) deficiency in a rural community of Burkina Faso, a malaria endemic country. Two hundred individuals in a rural community were genotyped for the mutations A376G, G202A, A542T, G680T and T968C using TaqMan single nucleotide polymorphism assays and polymerase chain reaction followed by restriction fragment length polymorphism. The prevalence of the G6PD deficiency was 9.5% in the study population. It was significantly higher in men compared to women (14.3% vs 6.0%, P=0.049). The 202A/376G G6PD A- was the only deficient variant detected. Plasmodium falciparum asymptomatic parasitaemia was significantly higher among the G6PD-non-deficient persons compared to the G6PD-deficient (P<0.001). The asymptomatic parasitaemia was also significantly higher among G6PD non-deficient compared to G6PD-heterozygous females (P<0.001). This study showed that the G6PD A- variant associated with protection against asymptomatic malaria in Burkina Faso is probably the most common deficient variant.

  15. Prevalence and genetic variants of G6PD deficiency among two Malagasy populations living in Plasmodium vivax-endemic areas.

    PubMed

    Howes, Rosalind E; Chan, Ernest R; Rakotomanga, Tovonahary Angelo; Schulte, Seth; Gibson, John; Zikursh, Melinda; Franchard, Thierry; Ramiranirina, Brune; Ratsimbasoa, Arsène; Zimmerman, Peter A

    2017-04-04

    The prevalence and variants of G6PD deficiency in the Plasmodium vivax-endemic zones of Madagascar remain unknown. The admixed African-Austronesian origins of the Malagasy population make it probable that a heterogeneous mix of genetic variants with a spectrum of clinical severity will be circulating. This would have implications for the widespread use of P. vivax radical cure therapy. Two study populations in the P. vivax-endemic western foothills region of Madagascar were selected for G6PD screening. Both the qualitative fluorescent spot test and G6PD genotyping were used to screen all participants. A total of 365 unrelated male volunteers from the Tsiroanomandidy, Mandoto, and Miandrivazo districts of Madagascar were screened and 12.9% were found to be phenotypically G6PD deficient. Full gene sequencing of 95 samples identified 16 single nucleotide polymorphisms, which were integrated into a genotyping assay. Genotyping (n = 291) found one individual diagnosed with the severe G6PD Mediterranean C563T mutation, while the remaining G6PD deficient samples had mutations of African origin, G6PD A- and G6PD A. Deployment of P. vivax radical cure in Madagascar must be considerate of the risks presented by the observed prevalence of G6PDd prevalence. The potential morbidity associated with cumulative episodes of P. vivax clinical relapses requires a strategy for increasing access to safe radical cure. The observed dominance of African G6PDd haplotypes is surprising given the known mixed African-Austronesian origins of the Malagasy population; more widespread surveying of G6PDd epidemiology across the island would be required to characterize the distribution of G6PD haplotypes across Madagascar.

  16. Prevalence and molecular characterization of G6PD deficiency in two Plasmodium vivax endemic areas in Venezuela: predominance of the African A-(202A/376G) variant.

    PubMed

    Vizzi, Esmeralda; Bastidas, Gilberto; Hidalgo, Mariana; Colman, Laura; Pérez, Hilda A

    2016-01-11

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency causes acute haemolytic anaemia triggered by oxidative drugs such as primaquine (PQ), used for Plasmodium vivax malaria radical cure. However, in many endemic areas of vivax malaria, patients are treated with PQ without any evaluation of their G6PD status. G6PD deficiency and its genetic heterogeneity were evaluated in northeastern and southeastern areas from Venezuela, Cajigal (Sucre state) and Sifontes (Bolívar state) municipalities, respectively. Blood samples from 664 randomly recruited unrelated individuals were screened for G6PD activity by a quantitative method. Mutation analysis for exons 4-8 of G6PD gen was performed on DNA isolated from G6PD-deficient (G6PDd) subjects through PCR-RFLP and direct DNA sequencing. Quantitative biochemical characterization revealed that overall 24 (3.6%) subjects were G6PDd (average G6PD enzyme activity 4.5 ± 1.2 U/g Hb, moderately deficient, class III), while DNA analysis showed one or two mutated alleles in 19 of them (79.2%). The G6PD A-(202A/376G) variant was the only detected in 17 (70.8%) individuals, 13 of them hemizygous males and four heterozygous females. Two males carried only the 376A → G mutation. No other mutation was found in the analysed exons. The G6PDd prevalence was as low as that one shown by nearby countries. This study contributes to the knowledge of the genetic background of Venezuelan population, especially of those living in malaria-endemic areas. Despite the high degree of genetic mixing described for Venezuelan population, a net predominance of the mild African G6PD A-(202A/376G) variant was observed among G6PDd subjects, suggesting a significant flow of G6PD genes from Africa to Americas, almost certainly introduced through African and/or Spanish immigrants during and after the colonization. The data suggest that 1:27 individuals of the studied population could be G6PDd and therefore at risk of haemolysis under precipitating factors

  17. Two apparent glucose-6-phosphate dehydrogenase variants in normal XY males: G6PD Alabama.

    PubMed

    Prchal, J T; Hall, K; Csepreghy, M; Lilly, M; Berkow, R; Scott, C W

    1988-03-01

    A six-year-old black boy who had transient hemolysis after a viral infection was found to have mildly decreased red cell glucose-6-phosphate dehydrogenase (G6PD) activity (1.25 IU/g hemoglobin). Two G6PD bands, both slightly faster than normal G6PD B, were seen on electrophoresis in both the propositus as well as in his maternal grandfather. This is an unexpected finding, since the G6PD gene is located on the long arm of the X chromosome that is subject to X-chromosome inactivation, and available evidence indicates that it is present as a single functional copy in the human genome. The obvious possibility of duplication of the X chromosome was eliminated by cytogenetic analysis with G-banding. G6PD duplication is unlikely, since peripheral blood granulocytes, platelets, and lymphocytes; cultured skin and bone marrow fibroblasts; and Epstein-Barr virus-stimulated lymphocytes yielded only a single electrophoretic band with mobility identical to the slower band seen in crude red blood cell hemolysate. Study of partially purified red blood cell hemolysate G6PD also yielded a single band with identical mobility. Kinetic studies of the enzyme in the propositus and in three generations of his family identified a unique, previously unpublished G6PD mutant that is herein designated G6PD Alabama. Red blood cells were separated by density gradient into a reticulocyte-enriched, an intermediate, and a dense, older portion. Two distinct enzyme bands were identified on electrophoresis of hemolysate from the reticulocyte-enriched portion, but not from the other two portions. It is postulated that two transcriptional products of the mutant G6PD gene exist; one with a short half-life and detectable only in young red blood cells, and another with a longer half-life present in all cells. The existence of two distinct mutant genes in the genome or a unique post-translational form of the mutant G6PD detected only in reticulocytes cannot be excluded.

  18. A trade off between catalytic activity and protein stability determines the clinical manifestations of glucose-6-phosphate dehydrogenase (G6PD) deficiency.

    PubMed

    Boonyuen, Usa; Chamchoy, Kamonwan; Swangsri, Thitiluck; Junkree, Thanyaphorn; Day, Nicholas P J; White, Nicholas J; Imwong, Mallika

    2017-11-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common polymorphism and enzymopathy in humans, affecting approximately 400 million people worldwide. It is responsible for various clinical manifestations, including favism, hemolytic anemia, chronic non-spherocytic hemolytic anemia, spontaneous abortion, and neonatal hyperbilirubinemia. Understanding the molecular mechanisms underlying the severity of G6PD deficiency is of great importance but that of many G6PD variants are still unknown. In this study, we report the construction, expression, purification, and biochemical characterization in terms of kinetic properties and stability of five clinical G6PD variants-G6PD Bangkok, G6PD Bangkok noi, G6PD Songklanagarind, G6PD Canton+Bangkok noi, and G6PD Union+Viangchan. G6PD Bangkok and G6PD Canton+Bangkok noi showed a complete loss of catalytic activity and moderate reduction in thermal stability when compared with the native G6PD. G6PD Bangkok noi and G6PD Union+Viangchan showed a significant reduction in catalytic efficiency, whereas G6PD Songklanagarind showed a catalytic activity comparable to the wild-type enzyme. The Union+Viangchan mutation showed a remarkable effect on the global stability of the enzyme. In addition, our results indicate that the location of mutations in G6PD variants affects their catalytic activity, stability, and structure. Hence, our results provide a molecular explanation for clinical manifestations observed in individuals with G6PD deficiency. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  19. A population survey of the glucose-6-phosphate dehydrogenase (G6PD) 563C>T (Mediterranean) mutation in Afghanistan.

    PubMed

    Jamornthanyawat, Natsuda; Awab, Ghulam R; Tanomsing, Naowarat; Pukrittayakamee, Sasithon; Yamin, Fazel; Dondorp, Arjen M; Day, Nicholas P J; White, Nicholas J; Woodrow, Charles J; Imwong, Mallika

    2014-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a common inherited enzyme defect and an important problem in areas with Plasmodium vivax infection because of the risk of haemolysis following administration of primaquine to treat the liver forms of the parasite. We undertook a genotypic survey of 713 male individuals across nine provinces of Afghanistan in which malaria is found, four in the north and five in the east. RFLP typing at nucleotide position 563 detected 40 individuals with the Mediterranean mutation 563C>T, an overall prevalence of 5.6%. This varied according to self-reported ethnicity, with prevalence in the Pashtun/Pashai group of 33/369 (8.9%) compared to 7/344 individuals in the rest of the population (2.0%; p<0.001, Chi-squared test). Multivariate analysis of ethnicity and geographical location indicated an adjusted odds ratio of 3.50 (95% CI 1.36-9.02) for the Pashtun/Pashai group, while location showed only a trend towards higher prevalence in eastern provinces (adjusted odds ratio = 1.73, 0.73-4.13). Testing of known polymorphic markers (1311C>T in exon 11, and C93T in intron XI) in a subset of 82 individuals wild-type at C563 revealed a mixture of 3 haplotypes in the background population and was consistent with data from the 1000 Genomes Project and published studies. By comparison individuals with G6PD deficiency showed a highly skewed haplotype distribution, with 95% showing the CT haplotype, a finding consistent with relatively recent appearance and positive selection of the Mediterranean variant in Afghanistan. Overall, the data confirm that the Mediterranean variant of G6PD is common in many ethnic groups in Afghanistan, indicating that screening for G6PD deficiency is required in all individuals before radical treatment of P. vivax with primaquine.

  20. Molecular Characterization of Cosenza Mutation among Patients with Glucose-6-Phosphate Dehydrogenase Deficiency in huzestan Province, Southwest Iran

    PubMed Central

    Kazemi Nezhad, Seyed Reza; Fahmi, Fatemeh; Khatami, Saeid Reza; Musaviun, Mohsen

    2011-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is one of the most common hereditary enzymatic disorders in human, increases the vulnerability of erythrocytes to oxidative stress. It is also characterized by remarkable molecular and biochemical heterogeneity. According to previous investigations, G6PD Cosenza (G1376C) is a common G6PD mutation in some parts of . Therefore in the present study we have characterized mutation among G6PD deficient individuals in Khuzestan province. In order to identify G6PD Cosenza, we analyzed the G6PD gene in 64 samples out of 231 deficient individuals who had not G6PD Mediterranean mutation, using PCR- restriction fragment length polymorphism (RFLP) method. G6PD Cosenza mutation was found in 6 males of 231 samples, resulting in the relative rate of 2.6% and allele frequency of 0.023 among Khuzestanian G6PD deficient subjects. A comparison of these results with previous findings in some parts of suggests that G6PD Cosenza is a common mutation in Khuzestanian G6PD deficient individuals. PMID:23365477

  1. Community expansion and gene geography of sickle cell trait and G6PD deficiency, and natural selection against malaria: experience from tribal land of India.

    PubMed

    Balgir, R S

    2012-03-01

    Malaria is globally endemic in tropical and subtropical regions and so is the hemoglobinopathies, thalassemias and glucose-6-phosphate dehydrogenase (G6PD) deficiency. This biological dogma of hyper-endemic all over the tribal land in India leads to high morbidity and mortality. The directed genetic abnormalities of human erythrocytes have found to decrease the susceptibility towards malaria parasites and the heterozygotes of abnormalities probably confer protection against the Plasmodium falciparum infection. A fascinating trend for an inverse relationship between sickle cell disorders and G6PD deficiency in scheduled caste and tribal communities of Central-Eastern India has been observed. When the frequency of sickle cell allele decreases in malaria endemic cross-section of the tribal population, the frequency of G6PD deficiency allele increases and vice versa. This medical aspect is important from an evolutionary biological background and could be an excellent point for molecular analyses to determine the signature of selection in the genomic regions of β- globin and G6PD genes. Since the selection favors the mutation with least cost to the population [as the clinical manifestations of G6PD deficiency are mild and do not result in a complete loss of enzyme activity against the sickle cell disease with high morbidity and mortality in the region] and the predominant frequency of G6PD deficiency over the sickle cell disorders in some tribal communities, it seems that the replacement of sickle cell allele for G6PD deficiency is occurring in the scheduled castes/tribes of Chhattisgarh, Madhya Pradesh, Maharashtra and Odisha states in Central India. These findings are consistent with our previous studies carried out in Central-Eastern India.

  2. Favism, the commonest form of severe hemolytic anemia in Palestinian children, varies in severity with three different variants of G6PD deficiency within the same community.

    PubMed

    Reading, N Scott; Sirdah, Mahmoud M; Shubair, Mohammad E; Nelson, Benjamin E; Al-Kahlout, Mustafa S; Al-Tayeb, Jamal M; Aboud, Lina N; Shaban, Maysaa Abu; Luzzatto, Lucio; Prchal, Josef T

    2016-09-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a common genetic abnormality known to predispose to acute hemolytic anemia (AHA), which can be triggered by certain drugs or infection. However, the commonest trigger is fava beans (Vicia faba) ingestion, causing AHA (favism), which may be life-threatening especially in children. G6PD deficiency is genetically highly heterogeneous, as nearly 200 different mutations have been observed. We have investigated the hematological features of acute favism in the Palestinian Gaza community that is characterized by the polymorphic coexistence of three different G6PD deficiency genes (G6PD A-, G6PD Cairo, G6PD Med). We have found by comparison to the general population (485 adults and 466 newborns) that children with favism, in terms of relative frequency, G6PD A- was under-represented, whereas G6PD Med was over-represented. We also found that the severity of anemia was significantly greater with G6PD Med and G6PD Cairo than with G6PD A-; and with G6PD Cairo, compared to the other two variants, there was greater hyperbilirubinemia, as well as persistence of mild anemia and reticulocytosis for as long as 4months after recovery from favism. This is the first report determining a differential impact of different G6PD mutations on the clinical features of favism in the same population and the same environment. Copyright © 2016. Published by Elsevier Inc.

  3. Further Molecular Analysis of G6PD Deficiency Variants in Southern Vietnam and a Novel Variant Designated as G6PD Ho Chi Minh (173 A>G; 58 Asp>Gly): Frequency Distributions of Variants Compared with Those in Other Southeast Asian Countries.

    PubMed

    Kawamoto, Fumihiko; Matsuoka, Hiroyuki; Pham, Nghiem Minh; Hayashi, Taeko; Kasahara, Yuichi; Dung, Nguyen The; Kido, Yasutoshi; Kanbe, Toshio; Tantular, Indah S

    2017-08-01

    We conducted a survey of glucose-6-phosphate dehydrogenase (G6PD) deficiency among newborn babies at Tu Du Hospital, Ho Chi Minh, southern Vietnam. A total of 90 deficient babies were detected, including 85 in the Kinh ethnic group, 4 Chinese, and 1 in the K'Ho minority group. In the Kinh ethnic group, G6PD variants such as G6PD Viangchan (n=32), Kaiping (n=11), Canton (n=8), Chinese-5 (n=7), Union (n=5) and Quing Yuan (n=4) were detected. A variant with silent mutations at 1311 C>T and IVS11 nt 93 T>C was also detected in 17 cases. A novel mutation (173 A>G) in exon 4 with a predicted amino acid change of 58 Asp>Gly was also found in a Kinh newborn girl and her father, and it was designated as G6PD Ho Chi Minh. These findings demonstrated that the Kinh ethnic group in southern Vietnam has 8 different G6PD variants, indicating that the members of this group have many ancestors in terms of G6PD variants from Southeast Asia, China, and Oceania. We compared the frequency distribution of G6PD variants in the Kinh population with those of other Southeast Asian populations, and the Kinh population's distribution was quite similar to that in the Thai population, but differed from it by the absence of G6PD Mahidol.

  4. High prevalence of hemoglobin disorders and glucose-6-phosphate dehydrogenase (G6PD) deficiency in the Republic of Guinea (West Africa).

    PubMed

    Millimono, Tamba S; Loua, Kovana M; Rath, Silvia L; Relvas, Luis; Bento, Celeste; Diakite, Mandiou; Jarvis, Martin; Daries, Nathalie; Ribeiro, Leticia M; Manco, Licínio; Kaeda, Jaspal S

    2012-01-01

    Reliable and accurate epidemiological data is a prerequisite for a cost effective screening program for inherited disorders, which however, is lacking in a number of developing countries. Here we report the first detailed population study in the Republic of Guinea, a sub-Saharan West African country, designed to assess the frequency of glucose-6-phosphate dehydrogenase (G6PD) deficiency and hemoglobinopathies, including screening for thalassemia. Peripheral blood samples from 187 Guinean adults were screened for hemoglobin (Hb) variants by standard hematological methods. One hundred and ten samples from males were screened for G6PD deficiency by the fluorescent spot test. Molecular analysis was performed for the most common α-thalassemia (α-thal) deletions, β-globin gene mutations, G6PD variants B (376A), A (376G), A- (376G/202A) and Betica (376G/968C), using polymerase chain reaction (PCR), restriction fragment length polymorphism (RFLP) or sequencing. Of the 187 subjects screened, 36 were heterozygous for Hb S [β6(A3)Glu→Val, GAG>GTG] (allele frequency 9.62%). Sixty-four subjects were heterozygous and seven were homozygous for the -α(3.7) kb deletion (allele frequency 20.85%). β-Thalassemia alleles were detected in five subjects, four with the -29 (A>G) mutation (allele frequency 1.07%) and one with codon 15 (TGG>TAG) (allele frequency 0.96%). The G6PD A- and G6PD Betica deficient variants were highly prevalent with a frequency of 5.7 and 3.3%, respectively. While we did not test for ferritin levels or α(0)-thal, four females (5.2%) had red cell indices strongly suggestive of iron deficient anemia: Hb <9.7 g/dL; MCH <19.3 pg; MCV <68.2; MCHC <31.6 g/dl; RDW >19.8%. Our results are consistent with high frequency of alleles such as Hb S, α-thal and G6PD deficient alleles associated with malaria resistance. Finding a 9.6% Hb S allele frequency supports the notion for a proficient neonatal screening to identify the sickle cell patients, who might benefit

  5. Description of a novel missense mutation of glucose-6-phosphate dehydrogenase gene associated with asymptomatic high enzyme deficiency.

    PubMed

    Minucci, Angelo; Concolino, Paola; Antenucci, Mirca; Santonocito, Concetta; Ameglio, Franco; Zuppi, Cecilia; Giardina, Bruno; Capoluongo, Ettore

    2007-08-01

    We report a case of an asymptomatic young subject affected by severe deficiency of Glucose 6-phosphate dehydrogenase (G6PD) activity. A novel genetic mutation (G130A) in the third exon was found. We named this novel mutation the "G6PD RIGNANO variant". These findings may contribute to a better knowledge of molecular epidemiology of the G6PD mutation and may represent an additional variant to be studied for a deep comprehension of in vivo compensation mechanisms of G6PD deficiency.

  6. Glucose-6-phosphate dehydrogenase Buenos Aires: a novel de novo missense mutation associated with severe enzyme deficiency.

    PubMed

    Minucci, Angelo; Concolino, Paola; Vendittelli, Francesca; Giardina, Bruno; Zuppi, Cecilia; Capoluongo, Ettore

    2008-06-01

    : Glucose 6-phosphate dehydrogenase (G6PD) catalyzes the first committed steps in the pentose phosphate pathway: the generation of NADPH by this enzyme is essential for protection against oxidative stress. The human enzyme is in a dimer<-->tetramer equilibrium and its stability depends on NADP(+) concentration. Herein, we report a case of a symptomatic baby affected by severe deficiency of G6PD activity due to a novel de novo genetic mutation (g1465C>T) in the thirteenth exon of its gene. : Clinical, biochemical and genetic evaluations of the affected baby and his mother were performed. : We found the g1465C>T novel mutation, in the thirteenth exon of G6PD gene (named "G6PD Buenos Aires variant"). This g1465C>T mutation produce a P489S substitution at protein level. The P489S mutation was absent in his mother, suggesting that G6PD Buenos Aires resulted from a de novo mutation. : The absence of mosaicism in the baby's DNA (from saliva and blood samples) suggests that a de novo mutation event may occur in the very early stages in embryogenesis or in the mother's germ cell lines.

  7. Prevalence of G6PD deficiency and Plasmodium falciparum parasites in asymptomatic school children living in southern Ghana.

    PubMed

    Amoah, Linda Eva; Opong, Akua; Ayanful-Torgby, Ruth; Abankwa, Joana; Acquah, Festus K

    2016-07-26

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is an X-linked genetic disorder that results in impaired enzyme activity. Although G6PD deficiency is globally distributed it is more prevalent in malaria-endemic countries. Several mutations have been identified in the G6PD gene, which alter enzyme activity. The G6PD genotype predominantly found in sub-Saharan Africa is the G6PDB (G6PD376A) with (G6PD376G) and G6PDA- (G6PD376G/202A, G6PD376G/542T, G6PD376G/680T and G6PD376G/968C) occurring at lower frequencies. The aim of this study was to identify the prevalence of G6PD deficiency and asymptomatic Plasmodium falciparum carriage in children living in southern Ghana and determine whether G6PD deficiency influences asymptomatic carriage of P. falciparum parasites. Blood samples were obtained once a month from 170 healthy Ghanaian school children aged between 5 and 12 years from Basic schools in two communities Obom and Abura with similar rainfall patterns and malaria peak seasons. G6PD enzyme activity was assessed using the qualitative G6PD RDT kit (AccessBIO). G6PD genotyping and asymptomatic parasite carriage was determined by PCR followed by restriction fragment length polymorphism (RFLP) of DNA extracted from dried blood spots. The only sub-Saharan G6PD A- allele detected was the A376G/G202A found in 12.4 % (21/170), of the children and distributed as 4.1 % (7/170) A-, 1.8 % (3/170) A-/A- homozygous deficient males and females and 6.5 % (11/170) A/A- and B/A- heterozygous deficient females. Phenotypically, 10.6 % (15/142) of the children were G6PD deficient. The asymptomatic carriage of P. falciparum by PCR was 50, 29.4, 38.2 and 38.8 % over the months of February through May 2015, respectively, and 28.8, 22.4, 25.9 and 5.9 % by microscopy during the same periods. G6PD deficiency was significantly associated with a lowered risk of PCR-estimated asymptomatic P. falciparum carriage in children during the off peak malaria season in Southern Ghana.

  8. G6PD as a predictive marker for glioma risk, prognosis and chemosensitivity.

    PubMed

    Yang, Chin-An; Huang, Hsi-Yuan; Lin, Cheng-Li; Chang, Jan-Gowth

    2018-05-29

    Glucose-6-phosphate dehydrogenase (G6PD) is a key enzyme preventing cells from oxidative damage and has been reported to have tumor-promoting roles. This study aims to comprehensively evaluate the predictive values of G6PD on brain tumor risk, prognosis and chemo-resistance. A retrospective 13-year cohort study analyzing cancer risk using the Taiwan National Health Insurance Research Database (4066 G6PD deficiency patients and 16,264 controls) was conducted. Furthermore, RNAseq and clinical data of grade II-III glioma (LGG, n = 515) and glioblastoma (GBM, n = 155) were downloaded from The Cancer Genome Atlas (TCGA) and analyzed. Bioinformatics methods were applied to build a glioma prognostication model and to predict response to chemotherapy based on tumor G6PD-related gene expressions. The predicted results were validated in another glioma cohort GSE 16011 and in KALS1 cell line. G6PD-dificient patients were found to have an increased risk for cancers, especially for brain tumor (adjusted hazard ratio (HR) 10.5, 95% CI 1.03-7.60). Furthermore, higher tumor G6PD expression was associated with poor patient survival in LGG, but not in GBM. A prognostication model using expression levels of G6PD and 9 related genes (PSMA2, PSMB8, SHFM1, GSS, GSTK1, MGST2, POLD3, MSH2, MSH6) could independently predict LGG patient survival. Boosted decision tree analysis on 213 cancer cell line database revealed predictive values of G6PD expression on response to gemcitabine and bortezomib. Knockdown of G6PD in KALS1 cell line enhanced its sensitivity to both chemotherapeutic agents. Our study suggests that G6PD could be a marker predicting glioma risk, prognosis and chemo-sensitivity.

  9. The first evaluation of glucose-6-phosphate dehydrogenase deficiency (G6PD) gene mutation in malaria-endemic region at South Central Timor (SCT) district, Eastern Indonesia 2015-2016

    NASA Astrophysics Data System (ADS)

    Hutagalung, J.; Kusnanto, H.; Supargiyono; Sadewa, A. H.; Satyagraha, A. W.

    2018-03-01

    Primaquine (PQ) is the only licensed drug effective against P. vivax for specific hypnozoites and as a key drug in the malaria elimination stage. However, PQ can cause severe hemolysis in G6PD deficient individuals. Unfortunately, few epidemiological data of these disorders was in Indonesia. This study aimed to assesses the prevalence and genotyping variant of G6PDd among the people on malaria-endemic. Blood samples from 555 unrelated subjects in eastern Indonesia were for G6PDd by quantitative test and PCR-RFLP-DNA sequencing. All protocols followed by Promega, Madison, USA. The prevalence of malaria and anemia was 32.6% (181/555) and 16% (89/555) with P. vivaxdominant species 52.5% (95/181), respectively. Overall, 16.6% (92/555) subjects were G6PD deficient, including 58.7% (54/92) females and 41.3% (38/92). Among the 92 cases G6PD deficient molecularly studied, the genotype variant Vanua Lava (T10883C) were detected dominant and unknown G6PD deficient (T-13.154-C) in 3 cases. It was high G6PD deficient in eastern Indonesia indicate that diagnosis and management of G6PD deficient are necessary. Obligatory anti-malaria doses for G6PD deficient individuals, population screening, are needed on endemic malaria in eastern Indonesia.

  10. Recombinant human G6PD for quality control and quality assurance of novel point-of-care diagnostics for G6PD deficiency.

    PubMed

    Kahn, Maria; LaRue, Nicole; Zhu, Changcheng; Pal, Sampa; Mo, Jack S; Barrett, Lynn K; Hewitt, Steve N; Dumais, Mitchell; Hemmington, Sandra; Walker, Adrian; Joynson, Jeff; Leader, Brandon T; Van Voorhis, Wesley C; Domingo, Gonzalo J

    2017-01-01

    A large gap for the support of point-of-care testing is the availability of reagents to support quality control (QC) of diagnostic assays along the supply chain from the manufacturer to the end user. While reagents and systems exist to support QC of laboratory screening tests for glucose-6-phosphate dehydrogenase (G6PD) deficiency, they are not configured appropriately to support point-of-care testing. The feasibility of using lyophilized recombinant human G6PD as a QC reagent in novel point-of-care tests for G6PD deficiency is demonstrated. Human recombinant G6PD (r-G6PD) was expressed in Escherichia coli and purified. Aliquots were stored at -80°C. Prior to lyophilization, aliquots were thawed, and three concentrations of r-G6PD (representing normal, intermediate, and deficient clinical G6PD levels) were prepared and mixed with a protective formulation, which protects the enzyme activity against degradation from denaturation during the lyophilization process. Following lyophilization, individual single-use tubes of lyophilized r-G6PD were placed in individual packs with desiccants and stored at five temperatures for one year. An enzyme assay for G6PD activity was used to ascertain the stability of r-G6PD activity while stored at different temperatures. Lyophilized r-G6PD is stable and can be used as a control indicator. Results presented here show that G6PD activity is stable for at least 365 days when stored at -80°C, 4°C, 30°C, and 45°C. When stored at 55°C, enzyme activity was found to be stable only through day 28. Lyophilized r-G6PD enzyme is stable and can be used as a control for point-of-care tests for G6PD deficiency.

  11. Validation of the quantitative point-of-care CareStart biosensor for assessment of G6PD activity in venous blood.

    PubMed

    Bancone, Germana; Gornsawun, Gornpan; Chu, Cindy S; Porn, Pen; Pal, Sampa; Bansil, Pooja; Domingo, Gonzalo J; Nosten, Francois

    2018-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common enzymopathy in the human population affecting an estimated 8% of the world population, especially those living in areas of past and present malaria endemicity. Decreased G6PD enzymatic activity is associated with drug-induced hemolysis and increased risk of severe neonatal hyperbilirubinemia leading to brain damage. The G6PD gene is on the X chromosome therefore mutations cause enzymatic deficiency in hemizygote males and homozygote females while the majority of heterozygous females have an intermediate activity (between 30-80% of normal) with a large distribution into the range of deficiency and normality. Current G6PD qualitative tests are unable to diagnose G6PD intermediate activities which could hinder wide use of 8-aminoquinolines for Plasmodium vivax elimination. The aim of the study was to assess the diagnostic performances of the new Carestart G6PD quantitative biosensor. A total of 150 samples of venous blood with G6PD deficient, intermediate and normal phenotypes were collected among healthy volunteers living along the north-western Thailand-Myanmar border. Samples were analyzed by complete blood count, by gold standard spectrophotometric assay using Trinity kits and by the latest model of Carestart G6PD biosensor which analyzes both G6PD and hemoglobin. Bland-Altman comparison of the CareStart normalized G6PD values to that of the gold standard assay showed a strong bias in values resulting in poor area under-the-curve values for both 30% and 80% thresholds. Performing a receiver operator curve identified threshold values for the CareStart product equivalent to the 30% and 80% gold standard values with good sensitivity and specificity values, 100% and 92% (for 30% G6PD activity) and 92% and 94% (for 80% activity) respectively. The Carestart G6PD biosensor represents a significant improvement for quantitative diagnosis of G6PD deficiency over previous versions. Further improvements

  12. G6PD deficiency from lyonization after hematopoietic stem cell transplantation from female heterozygous donors.

    PubMed

    Au, W-Y; Pang, A; Lam, K K Y; Song, Y-Q; Lee, W-M; So, J C C; Kwong, Y-L

    2007-10-01

    To determine whether during hematopoietic stem cell transplantation (HSCT), X-chromosome inactivation (lyonization) of donor HSC might change after engraftment in recipients, the glucose-6-phosphate dehydrogenase (G6PD) gene of 180 female donors was genotyped by PCR/allele-specific primer extension, and MALDI-TOF mass spectrometry/Sequenom MassARRAY analysis. X-inactivation was determined by semiquantitative PCR for the HUMARA gene before/after HpaII digestion. X-inactivation was preserved in most cases post-HSCT, although altered skewing of lyonization might occur to either of the X-chromosomes. Among pre-HSCT clinicopathologic parameters analyzed, only recipient gender significantly affected skewing. Seven donors with normal G6PD biochemically but heterozygous for G6PD mutants were identified. Owing to lyonization changes, some donor-recipient pairs showed significantly different G6PD levels. In one donor-recipient pair, extreme lyonization affecting the wild-type G6PD allele occurred, causing biochemical G6PD deficiency in the recipient. In HSCT from asymptomatic female donors heterozygous for X-linked recessive disorders, altered lyonization might cause clinical diseases in the recipients.

  13. G6PD testing in support of treatment and elimination of malaria: recommendations for evaluation of G6PD tests.

    PubMed

    Domingo, Gonzalo J; Satyagraha, Ari Winasti; Anvikar, Anup; Baird, Kevin; Bancone, Germana; Bansil, Pooja; Carter, Nick; Cheng, Qin; Culpepper, Janice; Eziefula, Chi; Fukuda, Mark; Green, Justin; Hwang, Jimee; Lacerda, Marcus; McGray, Sarah; Menard, Didier; Nosten, Francois; Nuchprayoon, Issarang; Oo, Nwe Nwe; Bualombai, Pongwit; Pumpradit, Wadchara; Qian, Kun; Recht, Judith; Roca, Arantxa; Satimai, Wichai; Sovannaroth, Siv; Vestergaard, Lasse S; Von Seidlein, Lorenz

    2013-11-04

    Malaria elimination will be possible only with serious attempts to address asymptomatic infection and chronic infection by both Plasmodium falciparum and Plasmodium vivax. Currently available drugs that can completely clear a human of P. vivax (known as "radical cure"), and that can reduce transmission of malaria parasites, are those in the 8-aminoquinoline drug family, such as primaquine. Unfortunately, people with glucose-6-phosphate dehydrogenase (G6PD) deficiency risk having severe adverse reactions if exposed to these drugs at certain doses. G6PD deficiency is the most common human enzyme defect, affecting approximately 400 million people worldwide.Scaling up radical cure regimens will require testing for G6PD deficiency, at two levels: 1) the individual level to ensure safe case management, and 2) the population level to understand the risk in the local population to guide Plasmodium vivax treatment policy. Several technical and operational knowledge gaps must be addressed to expand access to G6PD deficiency testing and to ensure that a patient's G6PD status is known before deciding to administer an 8-aminoquinoline-based drug.In this report from a stakeholder meeting held in Thailand on October 4 and 5, 2012, G6PD testing in support of radical cure is discussed in detail. The focus is on challenges to the development and evaluation of G6PD diagnostic tests, and on challenges related to the operational aspects of implementing G6PD testing in support of radical cure. The report also describes recommendations for evaluation of diagnostic tests for G6PD deficiency in support of radical cure.

  14. A novel homozygous no-stop mutation in G6PC gene from a Chinese patient with glycogen storage disease type Ia.

    PubMed

    Gu, Lei-Lei; Li, Xin-Hua; Han, Yue; Zhang, Dong-Hua; Gong, Qi-Ming; Zhang, Xin-Xin

    2014-02-25

    Glycogen storage disease type Ia (GSD-Ia) is an autosomal recessive genetic disorder resulting in hypoglycemia, hepatomegaly and growth retardation. It is caused by mutations in the G6PC gene encoding Glucose-6-phosphatase. To date, over 80 mutations have been identified in the G6PC gene. Here we reported a novel mutation found in a Chinese patient with abnormal transaminases, hypoglycemia, hepatomegaly and short stature. Direct sequencing of the coding region and splicing-sites in the G6PC gene revealed a novel no-stop mutation, p.*358Yext*43, leading to a 43 amino-acid extension of G6Pase. The expression level of mutant G6Pase transcripts was only 7.8% relative to wild-type transcripts. This mutation was not found in 120 chromosomes from 60 unrelated healthy control subjects using direct sequencing, and was further confirmed by digestion with Rsa I restriction endonuclease. In conclusion, we revealed a novel no-stop mutation in this study which expands the spectrum of mutations in the G6PC gene. The molecular genetic analysis was indispensable to the diagnosis of GSD-Ia for the patient. Copyright © 2013 Elsevier B.V. All rights reserved.

  15. Molecular Heterogeneity of Glucose-6-Phosphate Dehydrogenase Deficiency in Burkina Faso: G-6-PD Betica Selma and Santamaria in People with Symptomatic Malaria in Ouagadougou.

    PubMed

    Ouattara, Abdoul Karim; Yameogo, Pouiré; Diarra, Birama; Obiri-Yeboah, Dorcas; Yonli, Albert; Compaore, Tegwindé Rebeca; Soubeiga, Serge Théophile; Djigma, Florencia Wenkuuni; Simpore, Jacques

    2016-01-01

    The G-6-PD deficiency has an important polymorphism with genotypic variants such as 202A/376G, 376G/542T and 376G/968T known in West African populations. It would confer protection against severe forms of malaria although there are differences between the various associations in different studies. In this study we genotyped six (06) variants of the G-6-PD gene in people with symptomatic malaria in urban areas in Burkina Faso. One hundred and eighty-two (182) patients who tested positive using rapid detection test and microscopy were included in this study. A regular PCR with the GENESPARK G6PD African kit was run followed by electrophoresis, allowing initially to genotype six SNPs (G202A, A376G, A542T, G680T, C563T and T968C). Women carrying the mutations 202A and/or 376G were further typed by real-time PCR using TaqMan probes rs1050828 and rs1050829. In the study population the G-6-PD deficiency prevalence was 9.9%. In addition of G-6-PD A- (202A/376G) variant, 376G/542T and 376G/968T variants were also detected. Hemoglobin electrophoresis revealed that 22.5% (41/182) of the individuals had HbAC compared with2.2% with HbAS and one individual had double heterozygous HbSC. There was no correlation between the G-6-PD deficiency or haemoglobinopathies and symptomatic malaria infections in this study. Our study confirms that the G-6-PD deficiency does not confer protection against Plasmodium falciparum infections. As opposed to previous genotyping studies carried out in Burkina Faso, this study shows for the first time the presence of the variant A- (376G/968C) and warrants further investigation at the national level and in specific ethnic groups.

  16. Characterization of glucose-6-phosphate dehydrogenase deficiency and identification of a novel haplotype 487G>A/IVS5-612(G>C) in the Achang population of Southwestern China.

    PubMed

    Yang, YinFeng; Zhu, YueChun; Li, DanYi; Li, ZhiGang; Lü, HuiRu; Wu, Jing; Tang, Jing; Tong, ShuFen

    2007-08-01

    The prevalence of glucose-6-phosphate dehydrogenase (G6PD) deficiency and its gene mutations were studied in the Achang population from Lianghe County in Southwestern China. We found that 7.31% (19 of 260) males and 4.35% (10 of 230) females had G6PD deficiency. The molecular analysis of G6PD gene exons 2-13 was performed by a PCR-DHPLC-Sequencing or PCR-Sequencing. Sixteen independent subjects with G6PD Mahidol (487G>A) and the new polymorphism IVS5-612 (G>C), which combined into a novel haplotype, were identified accounting for 84.2% (16/19). And 100% Achang G6PD Mahidol were linked to the IVS5-612 C. The percentage of G6PD Mahidol in the Achang group is close to that in the Myanmar population (91.3% 73/80), which implies that there are some gene flows between Achang and Myanmar populations. Interestingly, G6PD Canton (1376G>T) and G6PD Kaiping (1388G>A), which were the most common G6PD variants from other ethnic groups in China, were not found in this Achang group, suggesting that there are different G6PD mutation profiles in the Achang group and other ethnic groups in China. Our findings appear to be the first documented report on the G6PD genetics of the AChang people, which will provide important clues to the Achang ethnic group origin and will help prevention and treatment of malaria in this area.

  17. Validation of the quantitative point-of-care CareStart biosensor for assessment of G6PD activity in venous blood

    PubMed Central

    Gornsawun, Gornpan; Chu, Cindy S.; Porn, Pen; Pal, Sampa; Bansil, Pooja

    2018-01-01

    Introduction Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common enzymopathy in the human population affecting an estimated 8% of the world population, especially those living in areas of past and present malaria endemicity. Decreased G6PD enzymatic activity is associated with drug-induced hemolysis and increased risk of severe neonatal hyperbilirubinemia leading to brain damage. The G6PD gene is on the X chromosome therefore mutations cause enzymatic deficiency in hemizygote males and homozygote females while the majority of heterozygous females have an intermediate activity (between 30–80% of normal) with a large distribution into the range of deficiency and normality. Current G6PD qualitative tests are unable to diagnose G6PD intermediate activities which could hinder wide use of 8-aminoquinolines for Plasmodium vivax elimination. The aim of the study was to assess the diagnostic performances of the new Carestart G6PD quantitative biosensor. Methods A total of 150 samples of venous blood with G6PD deficient, intermediate and normal phenotypes were collected among healthy volunteers living along the north-western Thailand-Myanmar border. Samples were analyzed by complete blood count, by gold standard spectrophotometric assay using Trinity kits and by the latest model of Carestart G6PD biosensor which analyzes both G6PD and hemoglobin. Results Bland-Altman comparison of the CareStart normalized G6PD values to that of the gold standard assay showed a strong bias in values resulting in poor area under-the-curve values for both 30% and 80% thresholds. Performing a receiver operator curve identified threshold values for the CareStart product equivalent to the 30% and 80% gold standard values with good sensitivity and specificity values, 100% and 92% (for 30% G6PD activity) and 92% and 94% (for 80% activity) respectively. Conclusion The Carestart G6PD biosensor represents a significant improvement for quantitative diagnosis of G6PD deficiency over

  18. Neonatal Hyperbilirubinemia in infants with G6PD c.563C > TVariant

    PubMed Central

    2012-01-01

    Background There is a strong correlation between glucose-6-phosphate dehydrogenase (G6PD) deficiency and neonatal hyperbilirubinemia with a rare but potential threat of devastating acute bilirubin encephalopathy. G6PD deficiency was observed in 4–14% of hospitalized icteric neonates in Pakistan. G6PD c.563C > T is the most frequently reported variant in this population. The present study was aimed at evaluating the time to onset of hyperbilirubinemia and the postnatal bilirubin trajectory in infants having G6PD c.563C > T. Methods This was a case–control study conducted at The Aga Khan University, Pakistan during the year 2008. We studied 216 icteric male neonates who were re-admitted for phototherapy during the study period. No selection was exercised. Medical records showed that 32 were G6PD deficient while 184 were G6PD normal. Each infant was studied for birth weight, gestational age, age at the time of presentation, presence of cephalhematoma, sepsis and neurological signs, peak bilirubin level, age at peak bilirubin level, days of hospitalization, whether phototherapy or exchange blood transfusion was initiated, and the outcome. During hospital stay, each baby was tested for complete blood count, reticulocyte count, ABO and Rh blood type, direct antiglobulin test and quantitative G6PD estimation [by kinetic determination of G6PDH]. G6PDgenotype was analyzed in 32 deficient infants through PCR-RFLP analysis and gene sequencing. Results G6PD variants c.563C > T and c.131 C > G were observed in 21 (65%) and three (9%) of the 32 G6PD deficient infants, respectively. DNA of eight (25%) newborns remained uncharacterized. In contrast to G6PD normal neonates, infants with c.563C > T variant had significantly lower enzyme activity (mean ± 1SD; 0.3 ± 0.2 U/gHb vs. 14.0 ± 4.5 U/gHb, p < 0.001) experienced higher peak levels of total serum bilirubin (mean ± 1SD; 16.8 ± 5.4 mg/dl vs. 13.8 ± 4.6 mg/dl, p = 0.008) which peaked earlier after

  19. Characterisation of the opposing effects of G6PD deficiency on cerebral malaria and severe malarial anaemia.

    PubMed

    Clarke, Geraldine M; Rockett, Kirk; Kivinen, Katja; Hubbart, Christina; Jeffreys, Anna E; Rowlands, Kate; Jallow, Muminatou; Conway, David J; Bojang, Kalifa A; Pinder, Margaret; Usen, Stanley; Sisay-Joof, Fatoumatta; Sirugo, Giorgio; Toure, Ousmane; Thera, Mahamadou A; Konate, Salimata; Sissoko, Sibiry; Niangaly, Amadou; Poudiougou, Belco; Mangano, Valentina D; Bougouma, Edith C; Sirima, Sodiomon B; Modiano, David; Amenga-Etego, Lucas N; Ghansah, Anita; Koram, Kwadwo A; Wilson, Michael D; Enimil, Anthony; Evans, Jennifer; Amodu, Olukemi K; Olaniyan, Subulade; Apinjoh, Tobias; Mugri, Regina; Ndi, Andre; Ndila, Carolyne M; Uyoga, Sophie; Macharia, Alexander; Peshu, Norbert; Williams, Thomas N; Manjurano, Alphaxard; Sepúlveda, Nuno; Clark, Taane G; Riley, Eleanor; Drakeley, Chris; Reyburn, Hugh; Nyirongo, Vysaul; Kachala, David; Molyneux, Malcolm; Dunstan, Sarah J; Phu, Nguyen Hoan; Quyen, Nguyen Ngoc; Thai, Cao Quang; Hien, Tran Tinh; Manning, Laurens; Laman, Moses; Siba, Peter; Karunajeewa, Harin; Allen, Steve; Allen, Angela; Davis, Timothy Me; Michon, Pascal; Mueller, Ivo; Molloy, Síle F; Campino, Susana; Kerasidou, Angeliki; Cornelius, Victoria J; Hart, Lee; Shah, Shivang S; Band, Gavin; Spencer, Chris Ca; Agbenyega, Tsiri; Achidi, Eric; Doumbo, Ogobara K; Farrar, Jeremy; Marsh, Kevin; Taylor, Terrie; Kwiatkowski, Dominic P

    2017-01-09

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is believed to confer protection against Plasmodium falciparum malaria, but the precise nature of the protective effecthas proved difficult to define as G6PD deficiency has multiple allelic variants with different effects in males and females, and it has heterogeneous effects on the clinical outcome of P. falciparum infection. Here we report an analysis of multiple allelic forms of G6PD deficiency in a large multi-centre case-control study of severe malaria, using the WHO classification of G6PD mutations to estimate each individual's level of enzyme activity from their genotype. Aggregated across all genotypes, we find that increasing levels of G6PD deficiency are associated with decreasing risk of cerebral malaria, but with increased risk of severe malarial anaemia. Models of balancing selection based on these findings indicate that an evolutionary trade-off between different clinical outcomes of P. falciparum infection could have been a major cause of the high levels of G6PD polymorphism seen in human populations.

  20. G6PD A- deficiency and severe malaria in The Gambia: heterozygote advantage and possible homozygote disadvantage.

    PubMed

    Sirugo, Giorgio; Predazzi, Irene M; Bartlett, Jacquelaine; Tacconelli, Alessandra; Walther, Michael; Williams, Scott M

    2014-05-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is frequent in Africa, because it confers resistance to Plasmodium falciparum malaria; however, the nature of the protection and the genotypes associated with it have been controversial. In 1972, Bienzle and others described protection from malaria in West African females heterozygous for G6PD A-. They determined that G6PD A- heterozygotes had lower parasite counts than A- homozygotes, hemizygous males, and normal individuals. However, other studies have reached different conclusions about the protective genotypes. DNA samples from 135 children with severe malaria and 146 children with mild malaria from The Gambia were genotyped for the G6PD A- mutation that is most frequent among Gambians (G6PD 968 T->C); there was a marked deficiency of heterozygotes and an excess of homozygotes with severe malaria, producing a strong deviation from Hardy-Weinberg equilibrium. Our results support the protective effect in G6PD A- heterozygous females and suggest that homozygotes might be more susceptible to severe malaria attacks.

  1. Mutations in the G6PC3 gene cause Dursun syndrome.

    PubMed

    Banka, Siddharth; Newman, William G; Ozgül, R Koksal; Dursun, Ali

    2010-10-01

    Dursun syndrome is a triad of familial primary pulmonary hypertension, leucopenia, and atrial septal defect. Here we demonstrate that mutations in G6PC3 cause Dursun syndrome. Mutations in G6PC3 are known to also cause severe congenital neutropenia type 4. Identification of the genetic basis of Dursun syndrome expands the pre-existing knowledge about the phenotypic effects of mutations in G6PC3. We propose that Dursun syndrome should now be considered as a subset of severe congenital neutropenia type 4 with pulmonary hypertension as an important clinical feature. Copyright © 2010 Wiley-Liss, Inc.

  2. The G6PD flow-cytometric assay is a reliable tool for diagnosis of G6PD deficiency in women and anaemic subjects.

    PubMed

    Bancone, Germana; Kalnoky, Michael; Chu, Cindy S; Chowwiwat, Nongnud; Kahn, Maria; Malleret, Benoit; Wilaisrisak, Pornpimon; Rénia, Laurent; Domingo, Gonzalo J; Nosten, Francois

    2017-08-29

    Glucose-6-phosphate dehydrogenase (G6PD) activity is essential for redox equilibrium of red blood cells (RBCs) and, when compromised, the RBCs are more susceptible to haemolysis. 8-aminoquinolines (primaquine and tafenoquine) are used for the radical curative treatment of Plasmodium vivax malaria and can cause haemolysis in G6PD deficient subjects. Haemolytic risk is dependent on treatment dose and patient G6PD status but ultimately it correlates with the number of G6PD deficient RBCs. The G6PD spectrophotometric assay reliably identifies deficient subjects but is less reliable in heterozygous females, especially when other blood conditions are present. In this work we analysed samples with a range of G6PD phenotypes and haematologic conditions from 243 healthy volunteers of Asian or African-American heritage using both the spectrophotomeric assay and the G6PD flow-cytometric assay. Overall 18.5% of subjects (29.3% of Asian females) presented with anaemia, associated with decreased RBCs volume (MCV) and reticulocytosis; the flow-cytometric assay showed good correlation with the spectrophotometric assay (Pearson's r 0.918-0.957) and was less influenced by haemoglobin concentration, number of RBCs and number of reticulocytes. This resulted in more precise quantification of the number of G6PD deficient RBCs and presumably higher predictive power of drug induced haemolytic risk.

  3. The G209A mutation in the alpha-synuclein gene is not detected in familial cases of Parkinson disease in non-Greek and/or Italian populations.

    PubMed

    Wang, W W; Khajavi, M; Patel, B J; Beach, J; Jankovic, J; Ashizawa, T

    1998-12-01

    To determine whether the G-to-A substitution at nucleotide 209 (G209A) mutation in the alpha-synuclein gene is responsible for familial Parkinson disease (PD) in the US population. Polymerase chain reaction-based DNA analysis of consecutive patients with PD and family history of PD. A university-affiliated movement disorder clinic and a Veterans Affairs clinical research laboratory. Forty-four patients with PD and family history of PD and 29 patients with sporadic PD, all with no known Greek and/or Italian background. None of the DNA samples showed the G209A mutation. The G209A mutation is rare in US patients with familial PD.

  4. Characterisation of the opposing effects of G6PD deficiency on cerebral malaria and severe malarial anaemia

    PubMed Central

    Clarke, Geraldine M; Rockett, Kirk; Kivinen, Katja; Hubbart, Christina; Jeffreys, Anna E; Rowlands, Kate; Jallow, Muminatou; Conway, David J; Bojang, Kalifa A; Pinder, Margaret; Usen, Stanley; Sisay-Joof, Fatoumatta; Sirugo, Giorgio; Toure, Ousmane; Thera, Mahamadou A; Konate, Salimata; Sissoko, Sibiry; Niangaly, Amadou; Poudiougou, Belco; Mangano, Valentina D; Bougouma, Edith C; Sirima, Sodiomon B; Modiano, David; Amenga-Etego, Lucas N; Ghansah, Anita; Koram, Kwadwo A; Wilson, Michael D; Enimil, Anthony; Evans, Jennifer; Amodu, Olukemi K; Olaniyan, Subulade; Apinjoh, Tobias; Mugri, Regina; Ndi, Andre; Ndila, Carolyne M; Uyoga, Sophie; Macharia, Alexander; Peshu, Norbert; Williams, Thomas N; Manjurano, Alphaxard; Sepúlveda, Nuno; Clark, Taane G; Riley, Eleanor; Drakeley, Chris; Reyburn, Hugh; Nyirongo, Vysaul; Kachala, David; Molyneux, Malcolm; Dunstan, Sarah J; Phu, Nguyen Hoan; Quyen, Nguyen Ngoc; Thai, Cao Quang; Hien, Tran Tinh; Manning, Laurens; Laman, Moses; Siba, Peter; Karunajeewa, Harin; Allen, Steve; Allen, Angela; Davis, Timothy ME; Michon, Pascal; Mueller, Ivo; Molloy, Síle F; Campino, Susana; Kerasidou, Angeliki; Cornelius, Victoria J; Hart, Lee; Shah, Shivang S; Band, Gavin; Spencer, Chris CA; Agbenyega, Tsiri; Achidi, Eric; Doumbo, Ogobara K; Farrar, Jeremy; Marsh, Kevin; Taylor, Terrie; Kwiatkowski, Dominic P

    2017-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is believed to confer protection against Plasmodium falciparum malaria, but the precise nature of the protective effect has proved difficult to define as G6PD deficiency has multiple allelic variants with different effects in males and females, and it has heterogeneous effects on the clinical outcome of P. falciparum infection. Here we report an analysis of multiple allelic forms of G6PD deficiency in a large multi-centre case-control study of severe malaria, using the WHO classification of G6PD mutations to estimate each individual’s level of enzyme activity from their genotype. Aggregated across all genotypes, we find that increasing levels of G6PD deficiency are associated with decreasing risk of cerebral malaria, but with increased risk of severe malarial anaemia. Models of balancing selection based on these findings indicate that an evolutionary trade-off between different clinical outcomes of P. falciparum infection could have been a major cause of the high levels of G6PD polymorphism seen in human populations. DOI: http://dx.doi.org/10.7554/eLife.15085.001 PMID:28067620

  5. G6PD Deficiency (Glucose-6-Phosphate Dehydrogenase) (For Parents)

    MedlinePlus

    ... In rare cases, G6PD deficiency leads to chronic anemia . With the right precautions, a child with G6PD deficiency can lead a healthy and ... to rule out other possible causes of the anemia. If you feel that your child may be at risk because of either a ...

  6. Frequency of G6PD Mediterranean in individuals with and without malaria in Southern Pakistan.

    PubMed

    Moiz, Bushra; Arshad, Haroon Muhammad; Raheem, Ahmed; Hayat, Hasan; Karim Ghanchi, Najia; Beg, M Asim

    2017-10-24

    Pakistan has an estimated annual burden of 1.5 million malaria cases. The current situation calls for an effective malaria control and eradication programme in this country. Currently, primaquine is an attractive option for eliminating reservoirs of Plasmodium vivax hypnozoites and killing gametocytes of Plasmodium falciparum. However, this drug causes haemolysis in individuals who are glucose-6-phosphate (G6PD) deficient. It is important to map G6PD deficiency and malaria distribution in Pakistan to design an effective malaria eradication regimen. Frequency of G6PD deficiency (G6PDd) in malaria patients has not been reported from Pakistan in any meaningful way. The purpose of this study was to evaluate the frequency of G6PD c.563C>T (G6PD Mediterranean) in male individuals with and without falciparum malaria. Two hundred and ten archived DNA samples from males (110 from falciparum malaria patients and 100 from healthy individuals) were utilized in this study. Healthy blood donors were selected based on stringent pre-defined criteria. Patients were confirmed for malaria parasites on microscopy and or immune chromatographic assay detecting P. falciparum histidine-rich protein 2. Parasitaemia was also computed. DNA samples were tested for G6PD c.563C>T mutation through PCR-RFLP according to the previously defined protocol and its allelic frequency was computed. G6PD c.563C>T was observed in four of 110 patients with falciparum malaria and in two of 100 healthy donors. Mean (± SD) haemoglobin, median (IQR) platelet and median (IQR) parasite count in G6PD-deficient malaria-patients were 8.9 ± 0.9 g/dL, 124 × 109/L (IQR 32, 171) and 57,920/μL of blood (IQR 12,920, 540,000) respectively. Cumulative allelic frequency for G6PD 563c.C>T was 0.0285 detected in 6 of 210 X-chromosomes in Southern Pakistan. Frequency for this G6PD allele was 0.0364 in malaria-patients and 0.0200 in healthy individuals. Large studies including females are needed to elucidate the true

  7. Prevalence of G6PD deficiency and associated haematological parameters in children from Botswana.

    PubMed

    Motshoge, Thato; Ababio, Grace; Aleksenko, Larysa; Souda, Sajini; Muthoga, Charles Waithaka; Mutukwa, Naledi; Tawe, Leabaneng; Ramatlho, Pleasure; Gabaitiri, Lesego; Chihanga, Simon; Mosweunyane, Tjantilili; Hamda, Shimeles; Moakofhi, Kentse; Ntebela, Davies; Peloewetse, Elias; Mazhani, Loeto; Pernica, Jeffrey M; Read, John; Quaye, Isaac K; Paganotti, Giacomo Maria

    2018-05-17

    Glucose-6-Phosphate Dehydrogenase (G6PD) deficiency is commonly seen in malaria endemic areas as it is known to confer a selective advantage against malaria. Recently, we reported a high proportion of asymptomatic reservoir of Plasmodium vivax in Botswana, that calls for intervention with primaquine to achieve radical cure of vivax malaria. Considering that individuals with this enzyme deficiency are at risk of haemolysis following primaquine treatment, assessment of the population for the relative frequency of G6PD deficiency is imperative. Samples from 3019 children from all the districts of Botswana were successfully genotyped for polymorphisms at positions 202 and 376 of the G6PD gene. Haematological parameters were also measured. The overall population allele frequency (based on the hemizygous male frequency) was 2.30% (95% CI, 1.77-2.83), while the overall frequency of G6PD-deficient genotypes A- (hemizygote and homozygote genotypes only) was 1.26% (95% CI, 0.86-1.66). G6PD deficiency is spread in Botswana according to the historical prevalence of malaria with a North-West to South-East decreasing gradient trend. There was no association between G6PD status and P. vivax positivity. G6PD A- form was found to be associated with decreased RBC count and haemoglobin levels without a known cause or illness. In conclusion, we report for the first time the prevalence of G6PD deficiency in Botswana which is relevant for strategies in the malaria elimination campaign. Further work to examine the activities of the enzyme in the Botswana population at risk for malaria is warranted. Copyright © 2017. Published by Elsevier B.V.

  8. Asian G6PD-Mahidol Reticulocytes Sustain Normal Plasmodium Vivax Development

    PubMed Central

    Bancone, Germana; Malleret, Benoit; Suwanarusk, Rossarin; Chowwiwat, Nongnud; Chu, Cindy S; McGready, Rose; Rénia, Laurent; Nosten, François

    2017-01-01

    Abstract Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common enzymatic disorder in humans and appears to be protective against falciparum severe malaria. Controversially, it is also thought that Plasmodium vivax has driven the recent selection of G6PD alleles. We use an experimental approach to determine whether G6PD-MahidolG487A variant, a widespread cause of severe G6PD deficiency in Southeast Asia, provides a barrier against vivax malaria. Our results show that the immature reticulocytes (CD71+) targeted by P. vivax invasion are enzymatically normal, even in hemizygous G6PD-Mahidol G487A mutants; thus, allowing the normal growth, development, and high parasite density in severely deficient samples. PMID:28591790

  9. Primaquine-induced haemolysis in females heterozygous for G6PD deficiency.

    PubMed

    Chu, Cindy S; Bancone, Germana; Nosten, François; White, Nicholas J; Luzzatto, Lucio

    2018-03-02

    Oxidative agents can cause acute haemolytic anaemia in persons with G6PD deficiency. Understanding the relationship between G6PD genotype and the phenotypic expression of the enzyme deficiency is necessary so that severe haemolysis can be avoided. The patterns of oxidative haemolysis have been well described in G6PD deficient hemizygous males and homozygous females; and haemolysis in the proportionally more numerous heterozygous females has been documented mainly following consumption of fava beans and more recently dapsone. It has long been known that 8-aminoquinolines, notably primaquine and tafenoquine, cause acute haemolysis in G6PD deficiency. To support wider use of primaquine in Plasmodium vivax elimination, more data are needed on the haemolytic consequences of 8-aminoquinolines in G6PD heterozygous females. Two recent studies (in 2017) have provided precisely such data; and the need has emerged for the development of point of care quantitative testing of G6PD activity. Another priority is exploring alternative 8-aminoquinoline dosing regimens that are practical and improve safety in G6PD deficient individuals.

  10. Prevalence, genetic variants and clinical implications of G-6-PD deficiency in Burkina Faso: a systematic review.

    PubMed

    Ouattara, Abdoul Karim; Yameogo, Pouiré; Traore, Lassina; Diarra, Birama; Assih, Maléki; Compaore, Tegwindé Rébéca; Obiri-Yeboah, Dorcas; Soubeiga, Serge Théophile; Djigma, Florencia Wendkuuni; Simpore, Jacques

    2017-11-23

    It is now well-known that some antimalarials such as primaquine may induce severe hemolytic anemia in people with G-6-PD deficiency. Antimalarial drug prescriptions must, therefore take into account the patient's G-6-PD status in malaria endemic areas such as Burkina Faso, where the prevalence of this genetic abnormality is relatively high. Although great clinical heterogeneity is observed depending on the molecular nature of the deficiency and the residual enzyme activity in the red blood cell, there is very poor data on the prevalence of G-6-PD deficiency and the distribution of involved genetic variants in Burkina Faso. In this systematic review, we present a synthesis of the various studies carried out on the G-6-PD deficiency in Burkina Faso in order to determine its prevalence, probable distribution of the genetic variants involved and their clinical implications for a national systematic screening policy among the groups most vulnerable to malaria. A systematic review was carried out to analyze available published data on the prevalence, phenotypes and mutations responsible for G-6-PD deficiency in Burkina Faso. The key words used were "G-6-PD deficiency AND Burkina Faso" or "Déficit en G-6-PD AND Burkina Faso" in French. To identify the relevant articles, two independent reviewers reviewed the titles, abstracts and the full text of the selected papers. An average prevalence of 16.6% (183/1100; CI 95%: 0.145-0.190) and 6.5% (69/1066; CI 95%: 0.051-0.081) of G-6-PD deficiency was found respectively in men and women in this systematic review. Although the predominance (99.8% of G-6-PD deficient cases) of 202A/376G G-6-PD A- variant, the Santamaria and Betica Selma variants were identified in Burkina Faso. Independently of the method used, the enzymatic deficiency was significantly higher in males (2.5-20.5%) compared to females (3.3-12.3%). This systematic review suggests that despite the ubiquity of the 202A/376G G-6-PD A- variant in Burkina Faso, it will be

  11. Asian G6PD-Mahidol Reticulocytes Sustain Normal Plasmodium Vivax Development.

    PubMed

    Bancone, Germana; Malleret, Benoit; Suwanarusk, Rossarin; Chowwiwat, Nongnud; Chu, Cindy S; McGready, Rose; Rénia, Laurent; Nosten, François; Russell, Bruce

    2017-07-15

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common enzymatic disorder in humans and appears to be protective against falciparum severe malaria. Controversially, it is also thought that Plasmodium vivax has driven the recent selection of G6PD alleles. We use an experimental approach to determine whether G6PD-MahidolG487A variant, a widespread cause of severe G6PD deficiency in Southeast Asia, provides a barrier against vivax malaria. Our results show that the immature reticulocytes (CD71+) targeted by P. vivax invasion are enzymatically normal, even in hemizygous G6PD-Mahidol G487A mutants; thus, allowing the normal growth, development, and high parasite density in severely deficient samples. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America.

  12. Glucose-6-phosphate dehydrogenase deficiency in northern Mexico and description of a novel mutation.

    PubMed

    García-Magallanes, N; Luque-Ortega, F; Aguilar-Medina, E M; Ramos-Payán, R; Galaviz-Hernández, C; Romero-Quintana, J G; Del Pozo-Yauner, L; Rangel-Villalobos, H; Arámbula-Meraz, E

    2014-08-01

    Glucose-6-phosphate dehydrogenase deficiency (G6PD) is the most common enzyme pathology in humans; it is X-linked inherited and causes neonatal hyperbilirubinaemia, chronic nonspherocytic haemolytic anaemia and drug-induced acute haemolytic anaemia. G6PD deficiency has scarcely been studied in the northern region of Mexico, which is important because of the genetic heterogeneity described in Mexican population. Therefore, samples from the northern Mexico were biochemically screened for G6PD deficiency, and PCR-RFLPs, and DNA sequencing used to identify mutations in positive samples. The frequency of G6PD deficiency in the population was 0.95% (n = 1993); the mutations in 86% of these samples were G6PD A(-202A/376G), G6PDA(-376G/968C) and G6PD Santamaria(376G/542T). Contrary to previous reports, we demonstrated that G6PD deficiency distribution is relatively homogenous throughout the country (P = 0.48336), and the unique exception with high frequency of G6PD deficiency does not involve a coastal population (Chihuahua: 2.4%). Analysis of eight polymorphic sites showed only 10 haplotypes. In one individual we identified a new G6PD mutation named Mexico DF(193A>G) (rs199474830), which probably results in a damaging functional effect, according to PolyPhen analysis. Proteomic impact of the mutation is also described.

  13. [The genotype analysis of glucose-6-phosphate dehydrogenase deficiency in Yunnan province].

    PubMed

    Yang, Z; Chu, J; Ban, G; Huang, X; Xu, S; Li, M

    2001-08-01

    To identify glucose-6-phosphate dehydrogenase (G6PD) gene mutations in 23 patients with G6PD deficiency and to gain further understanding of the molecular and genetic background of G6PD gene in Yunnan province, China. The mutations located in exons 2-12 and in parts of introns of G6PD gene were analyzed by amplification refractory mutation system(ARMS), natural and mis-match primer PCR/restrict enzyme, polymerase chain reaction-single strand conformation polymorphism(PCR-SSCP ) analysis and automatic DNA sequencing. Among these 23 samples, 5 different point mutations in G6PD gene were identified, and they constituted 5 genotypes. There were 7 Han and 3 Dai patients with G487A mutation, 7 cases with both intron 11 T93C and C1311T mutations, 4 cases with intron 5 636 or 637 T-->del mutation, 1 case with G871A mutation, and 1 case with G487A/T93C/C1311T mutation. Two haplotypes, 93C/1311T and 93C/1311T/487A were identified in Yunnan. A strong association was observed between C1311T and the Nla III restriction site produced by intron 11 T93C. The findings of the investigators on IVS-5 636 or 637T-->del in Chinese, on G871A in mainland of China, and on G487A in the Han people of Yunnan have not been reported previously. G6PD deficiency is very heterogenous in Yunnan; G487A is one of the common mutations in that province and may be of different origins. Possibly IVS-11 T93C mutation is of non-African origin. IVS-11 T93C and C1311T might jointly result in G6PD deficiency. The above data on G6PD gene mutation types could be useful for clinical diagnosis, prevention of G6PD deficiency, and researches in the origin and migration of minorities in Yunnan or other regions.

  14. Lower cognitive performance in healthy G2019S LRRK2 mutation carriers

    PubMed Central

    Thaler, Avner; Mirelman, Anat; Gurevich, Tanya; Simon, Ely; Orr-Urtreger, Avi; Marder, Karen; Bressman, Susan

    2012-01-01

    Objective: To assess cognitive abilities of healthy first-degree relatives of Ashkenazi patients with Parkinson disease (PD), carriers of the G2019S mutation in the LRRK2 gene. Methods: In this observational study, 60 consecutive healthy first-degree relatives (aged 50.9 ± 6.2 years; 48% male; 30 G2019S carriers) were assessed using a computerized cognitive program, the Montreal Cognitive Assessment questionnaire, the Unified Parkinson's Disease Rating Scale Part III, and the Geriatric Depression Scale. Results: G2019S carriers scored significantly lower on the computerized executive function index (p = 0.04) and on specific executive function tasks (Stroop test, p = 0.007). Conclusion: Carrying the LRRK2 G2019S mutation was associated with lower executive performance in a population at risk for PD. PMID:22914834

  15. Does G6PD deficiency protect against cancer? A critical review.

    PubMed Central

    Cocco, P

    1987-01-01

    Previous observations on the lower mortality for cancer experienced in populations with a higher frequency of G6PD deficiency support biochemical studies on the role of G6PD during cell proliferation. The general agreement among experimental studies prevented a deeper analysis of the sources of what has been called "epidemiological evidence of the protective role of G6PD deficiency against cancer". This review analyses the methods and findings in those papers, stressing their limitations and emphasising that no final conclusions can be drawn from them. Preliminary results of ongoing epidemiological studies of G6PD deficiency and cancer are presented, although they do not prove or disprove the hypothesis that G6PD deficiency protects against cancer. PMID:3309118

  16. Single nucleotide primer extension (SNuPE) analysis of the G6PD gene in somatic cells and oocytes of a kangaroo (Macropus robustus).

    PubMed

    Watson, D; Jacombs, A S; Loebel, D A; Robinson, E S; Johnston, P G

    2000-06-01

    cDNA sequence analysis of the X-linked glucose-6-phosphate dehydrogenase (G6PD) gene has shown a base difference between two subspecies of the kangaroo, Macropus robustus robustus (wallaroo) and M. r. erubescens (euro). A thymine residue in the wallaroo at position 358 in exon 5 has been replaced by a cytosine residue in the euro, which accounts for the previously reported electrophoretic difference between the two subspecies. This base difference allowed use of the Single Nucleotide Primer Extension (SNuPE) technique to study allele-specific expression of G6PD at the transcriptional level. We began by examining G6PD expression in somatic cells and observed complete paternal X inactivation in all somatic tissues of adult female heterozygotes, whereas we found partial paternal allele activity in cultured fibroblasts, thus confirming previous allozyme electrophoresis studies. In late dictyate oocytes from an adult heterozygote, the assay also detected expression of both the maternal and paternal alleles at the G6PD locus, with the maternal allele showing preferential expression. Thus reactivation of the inactive paternally derived X chromosome occurs during oogenesis in M. robustus, although the exact timing of reactivation remains to be determined.

  17. Mutations in the XLRS1 gene in Thai families with X-linked juvenile retinoschisis.

    PubMed

    Atchaneeyasakul, La-ongsri; Trinavarat, Adisak; Pituksung, Auengporn; Jinda, Worapoj; Thongnoppakhun, Wanna; Limwongse, Chanin

    2010-01-01

    To identify genetic mutations of the XLRS1 gene and to describe the ocular phenotypes in two unrelated Thai patients with X-linked juvenile retinoschisis. Ophthalmic examination, including best-corrected visual acuity and fundus examination and photography, was performed in all participants. Electroretinography (ERG) and optical coherence tomography were performed when possible. All six exons of the XLRS1 gene were amplified, and mutation screening was determined by denaturing high-performance liquid chromatography and DNA sequencing. Two point mutations were identified, a novel missense mutation c.378A > G (p.D126G) in exon 5 and a reported mutation c.637C > T (p.R213W) in exon 6. The first proband with the p.D126G mutation developed vitreous hemorrhage in both eyes at age 7 months. Foveal and peripheral schisis with several inner layer holes were detected in both eyes. The second proband with the p.R213W mutation developed slightly blurred vision at age 10 years. Fundus examination showed numerous fine white dots at the macula without foveal or peripheral schisis. Electronegative ERG results were documented in both probands. A novel p.D126G mutation appeared to be associated with a severe phenotype with vitreous hemorrhage developing in infancy. Both intra- and interfamilial clinical variabilities were recognized in our patients.

  18. Safety of Single-Dose Primaquine in G6PD-Deficient and G6PD-Normal Males in Mali Without Malaria: An Open-Label, Phase 1, Dose-Adjustment Trial.

    PubMed

    Chen, Ingrid; Diawara, Halimatou; Mahamar, Almahamoudou; Sanogo, Koualy; Keita, Sekouba; Kone, Daouda; Diarra, Kalifa; Djimde, Moussa; Keita, Mohamed; Brown, Joelle; Roh, Michelle E; Hwang, Jimee; Pett, Helmi; Murphy, Maxwell; Niemi, Mikko; Greenhouse, Bryan; Bousema, Teun; Gosling, Roly; Dicko, Alassane

    2018-03-28

    The World Health Organization recommendation on the use of a single low dose of primaquine (SLD-PQ) to reduce Plasmodium falciparum malaria transmission requires more safety data. We conducted an open-label, nonrandomized, dose-adjustment trial of the safety of 3 single doses of primaquine in glucose-6-phosphate dehydrogenase (G6PD)-deficient adult males in Mali, followed by an assessment of safety in G6PD-deficient boys aged 11-17 years and those aged 5-10 years, including G6PD-normal control groups. The primary outcome was the greatest within-person percentage drop in hemoglobin concentration within 10 days after treatment. Fifty-one participants were included in analysis. G6PD-deficient adult males received 0.40, 0.45, or 0.50 mg/kg of SLD-PQ. G6PD-deficient boys received 0.40 mg/kg of SLD-PQ. There was no evidence of symptomatic hemolysis, and adverse events considered related to study drug (n = 4) were mild. The mean largest within-person percentage change in hemoglobin level between days 0 and 10 was -9.7% (95% confidence interval [CI], -13.5% to -5.90%) in G6PD-deficient adults receiving 0.50 mg/kg of SLD-PQ, -11.5% (95% CI, -16.1% to -6.96%) in G6PD-deficient boys aged 11-17 years, and -9.61% (95% CI, -7.59% to -13.9%) in G6PD-deficient boys aged 5-10 years. The lowest hemoglobin concentration at any point during the study was 92 g/L. SLD-PQ doses between 0.40 and 0.50 mg/kg were well tolerated in G6PD-deficient males in Mali. NCT02535767.

  19. X-linked G6PD deficiency protects hemizygous males but not heterozygous females against severe malaria.

    PubMed

    Guindo, Aldiouma; Fairhurst, Rick M; Doumbo, Ogobara K; Wellems, Thomas E; Diallo, Dapa A

    2007-03-01

    Glucose-6-phosphate dehydrogenase (G6PD) is important in the control of oxidant stress in erythrocytes, the host cells for Plasmodium falciparum. Mutations in this enzyme produce X-linked deficiency states associated with protection against malaria, notably in Africa where the A- form of G6PD deficiency is widespread. Some reports have proposed that heterozygous females with mosaic populations of normal and deficient erythrocytes (due to random X chromosome inactivation) have malaria resistance similar to or greater than hemizygous males with populations of uniformly deficient erythrocytes. These proposals are paradoxical, and they are not consistent with currently hypothesized mechanisms of protection. We conducted large case-control studies of the A- form of G6PD deficiency in cases of severe or uncomplicated malaria among two ethnic populations of rural Mali, West Africa, where malaria is hyperendemic. Our results indicate that the uniform state of G6PD deficiency in hemizygous male children conferred significant protection against severe, life-threatening malaria, and that it may have likewise protected homozygous female children. No such protection was evident from the mosaic state of G6PD deficiency in heterozygous females. We also found no significant differences in the parasite densities of males and females with differences in G6PD status. Pooled odds ratios from meta-analysis of our data and data from a previous study confirmed highly significant protection against severe malaria in hemizygous males but not in heterozygous females. Among the different forms of severe malaria, protection was principally evident against cerebral malaria, the most frequent form of life-threatening malaria in these studies. The A- form of G6PD deficiency in Africa is under strong natural selection from the preferential protection it provides to hemizygous males against life-threatening malaria. Little or no such protection is present among heterozygous females. Although these

  20. X-Linked G6PD Deficiency Protects Hemizygous Males but Not Heterozygous Females against Severe Malaria

    PubMed Central

    Doumbo, Ogobara K; Wellems, Thomas E; Diallo, Dapa A

    2007-01-01

    Background Glucose-6-phosphate dehydrogenase (G6PD) is important in the control of oxidant stress in erythrocytes, the host cells for Plasmodium falciparum. Mutations in this enzyme produce X-linked deficiency states associated with protection against malaria, notably in Africa where the A− form of G6PD deficiency is widespread. Some reports have proposed that heterozygous females with mosaic populations of normal and deficient erythrocytes (due to random X chromosome inactivation) have malaria resistance similar to or greater than hemizygous males with populations of uniformly deficient erythrocytes. These proposals are paradoxical, and they are not consistent with currently hypothesized mechanisms of protection. Methods and Findings We conducted large case-control studies of the A− form of G6PD deficiency in cases of severe or uncomplicated malaria among two ethnic populations of rural Mali, West Africa, where malaria is hyperendemic. Our results indicate that the uniform state of G6PD deficiency in hemizygous male children conferred significant protection against severe, life-threatening malaria, and that it may have likewise protected homozygous female children. No such protection was evident from the mosaic state of G6PD deficiency in heterozygous females. We also found no significant differences in the parasite densities of males and females with differences in G6PD status. Pooled odds ratios from meta-analysis of our data and data from a previous study confirmed highly significant protection against severe malaria in hemizygous males but not in heterozygous females. Among the different forms of severe malaria, protection was principally evident against cerebral malaria, the most frequent form of life-threatening malaria in these studies. Conclusions The A− form of G6PD deficiency in Africa is under strong natural selection from the preferential protection it provides to hemizygous males against life-threatening malaria. Little or no such protection is

  1. Neonatal nucleated red blood cells in G6PD deficiency.

    PubMed

    Yeruchimovich, Mark; Shapira, Boris; Mimouni, Francis B; Dollberg, Shaul

    2002-05-01

    The objective of this study is to study the absolute number of nucleated red blood cells (RBC) at birth, an index of active fetal erythropoiesis, in infants with G6PD deficiency and in controls. We tested the hypothesis that hematocrit and hemoglobin would be lower, and absolute nucleated RBC counts higher, in the G6PD deficient and that these changes would be more prominent in infants exposed passively to fava bean through maternal diet. Thirty-two term infants with G6PD deficiency were compared with 30 term controls. Complete blood counts with manual differential counts were obtained within 12 hours of life. Absolute nucleated RBC and corrected leukocyte counts were computed from the Coulter results and the differential count. G6PD deficient patients did not differ from controls in terms of gestational age, birth weight, or Apgar scores or in any of the hematologic parameters studied, whether or not the mother reported fava beans consumption in the days prior to delivery. Although intrauterine hemolysis is possible in G6PD deficient fetuses exposed passively to fava beans, our study supports that such events must be very rare.

  2. Prevalence and hematological indicators of G6PD deficiency in malaria-infected patients.

    PubMed

    Kotepui, Manas; Uthaisar, Kwuntida; PhunPhuech, Bhukdee; Phiwklam, Nuoil

    2016-04-25

    This study aimed to evaluate the prevalence and alteration of hematological parameters in malaria patients with a glucose-6-phosphate dehydrogenase (G6PD) deficiency, in the western region of Thailand, an endemic region for malaria. Data about patients with malaria hospitalized between 2013 and 2015 were collected. Clinical and sociodemographic characteristics such as age and gender, diagnosis on admission, and parasitological results were mined from medical records of the laboratory unit of the Phop Phra Hospital in Tak Province, Thailand. Venous blood samples were collected at the time of admission to hospital to determine G6PD deficiency by fluorescence spot test and detect malaria parasites by thick and thin film examination. Other data such as complete blood count and parasite density were also collected and analyzed. Among the 245 malaria cases, 28 (11.4 %) were diagnosed as Plasmodium falciparum infections and 217 cases (88.6 %) were diagnosed as P. vivax infections. Seventeen (6.9 %) patients had a G6PD deficiency and 228 (93.1 %) patients did not have a G6PD deficiency. Prevalence of male patients with G6PD deficiency was higher than that of female patients (P < 0.05, OR = 5.167). Among the patients with a G6PD deficiency, two (11.8 %) were infected with P. falciparum, while the remaining were infected with P. vivax. Malaria patients with a G6PD deficiency have higher monocyte counts (0.6 × 10(3)/μL) than those without a G6PD deficiency (0.33 × 10(3)/μL) (P < 0.05, OR = 5.167). Univariate and multivariate analyses also confirmed that malaria patients with a G6PD deficiency have high monocyte counts. The association between G6PD status and monocyte counts was independent of age, gender, nationality, Plasmodium species, and parasite density (P < 0.005). This study showed a prevalence of G6PD deficiency in a malaria-endemic area. This study also supported the assertion that patients with G6PD-deficient red blood cells had no

  3. Cell-derived microparticles after exercise in individuals with G6PD Viangchan.

    PubMed

    Chanda, Makamas; Nantakomol, Duangdao; Suksom, Daroonwan; Palasuwan, Attakorn

    2015-07-16

    Glucose-6-phospate dehydrogenase (G6PD) deficient cells are sensitive to oxidative damage leading to the formation of microparticles (MPs). Therefore, we examined the concentration of MPs and changes in the antioxidant balance after an acute strenuous exercise (SEx) and moderate-intensity exercise (MEx). Eighteen healthy females (18-24 years) with G6PD normal and eighteen age-matched females with G6PD Viangchan (871G>A) were tested by running on a treadmill at their maximal oxygen uptake for SEx and at 75% of their maximal heart rate for MEx. It was found that SEx triggered the release of total microparticles (TTMPs) above baseline levels and remained significantly higher 45 minutes after the exercise in G6PD normal individuals. However, SEx-induced increase in TTMPs was significantly higher in G6PD Viangchan as compared to G6PD normal. In contrast, MEx did not to alter the release of TTMPs in both G6PD normal and Viangchan. Moreover, TTMPs concentrations were inversely correlated with G6PD activity (r =-0.82, P <  0.05) but positively correlated with MDA concentrations (r = 0.74, P <  0.05). Using cell specific antibodies, we determined that MPs were mainly derived from platelets and erythrocytes. Altogether, the present study indicates that G6PD Viangchan may participate in MEx without higher MPs concentration and oxidative stress compared with G6PD normal.

  4. Determining mutations in G6PC and SLC37A4 genes in a sample of Brazilian patients with glycogen storage disease types Ia and Ib.

    PubMed

    Carlin, Marcelo Paschoalete; Scherrer, Daniel Zanetti; De Tommaso, Adriana Maria Alves; Bertuzzo, Carmen Silvia; Steiner, Carlos Eduardo

    2013-12-01

    Glycogen storage disease (GSD) comprises a group of autosomal recessive disorders characterized by deficiency of the enzymes that regulate the synthesis or degradation of glycogen. Types Ia and Ib are the most prevalent; while the former is caused by deficiency of glucose-6-phosphatase (G6Pase), the latter is associated with impaired glucose-6-phosphate transporter, where the catalytic unit of G6Pase is located. Over 85 mutations have been reported since the cloning of G6PC and SLC37A4 genes. In this study, twelve unrelated patients with clinical symptoms suggestive of GSDIa and Ib were investigated by using genetic sequencing of G6PC and SLC37A4 genes, being three confirmed as having GSD Ia, and two with GSD Ib. In seven of these patients no mutations were detected in any of the genes. Five changes were detected in G6PC, including three known point mutations (p.G68R, p.R83C and p.Q347X) and two neutral mutations (c.432G > A and c.1176T > C). Four changes were found in SLC37A4: a known point mutation (p.G149E), a novel frameshift insertion (c.1338_1339insT), and two neutral mutations (c.1287G > A and c.1076-28C > T). The frequency of mutations in our population was similar to that observed in the literature, in which the mutation p.R83C is also the most frequent one. Analysis of both genes should be considered in the investigation of this condition. An alternative explanation to the negative results in this molecular study is the possibility of a misdiagnosis. Even with a careful evaluation based on laboratory and clinical findings, overlap with other types of GSD is possible, and further molecular studies should be indicated.

  5. [Molecular analysis of glucose-6-dehydrogenase deficiency in Spain].

    PubMed

    Vives Corrons, J L; Zarza, R; Aymerich, J M; Boixadera, J; Carrera, A; Colomer, D; Corbella, M; Castro, M; Crespo, J M; Del Arco, A; Erkiaga, S; Font, L; González, I; Juncá, J; Lausin, A; Manrubia, E; Martín Núñez, G; Murga, M J; Oliva, E; Pérez de Mendiguren, B; Pujades, M A; Remacha, A; Rovira, A; Villegas, A

    1997-10-01

    G6PD deficiency is the most frequent enzymopathy-producing genetic polymorphism in humans. Up to now, over 400 putative variants of G6PD have been distinguished on the basis of biochemical characterization of the deficient enzyme. Analysis of the G6PD gene has made possible a precise classification of the G6PD molecular variants by identification of about 80 different point mutations causing much of the phenotypic heterogeneity. In the Spanish population, the analysis of G6PD has led to the identification of 15 different point mutations that underlay the phenotypic heterogeneity of G6PD previously reported by biochemical analysis. The purpose of the study has been to identify the genetic mutation responsible of the G6PD deficiency and to improve the knowledge of its genetic homogeneity. From 50 Spanish males with G6PD deficiency 34 came from out consultation and 16 from the Spanish Study Group on Red Cell Pathology (GEHBTA-Eritropatología) The methods employed included screening of prevalent mutations by ER-PCR, SSCP-PCR, genetic segmentation and biochemical characterization of the deficient enzyme. In 31 cases the mutations were characteristic of the four most frequent polymorphic variants found in Spain (G6PD A-376G/202A, G6PD Mediterranean 563T G6PD Union 1360T and G6PD Seattle 344C). Since these mutations either create or abolish a specific site recognized by a restriction endonuclease (RE), they can be rapidly detected by RE digestion of a PCR-amplified product (PCR-RE). In patients where none of these mutations were present (17 cases), the G6PD gene was subjected to PCR single-strand conformation polymorphism (PCR-SSCP) analysis combined with direct PCR-sequencing. By using this procedure, 9 new mutations have been identified, five of them have been also found in other geographical areas and were associated with favism (G6PD A-376G/968C, G6PD Santamaria 376G/542T, G6PD Aures 143C and G6PD Chatham 1003A) or chronic haemolytic anaemia (G6PD Tomah 1153C). The

  6. Novel mutations in PANK2 and PLA2G6 genes in patients with neurodegenerative disorders: two case reports.

    PubMed

    Dastsooz, Hassan; Nemati, Hamid; Fard, Mohammad Ali Farazi; Fardaei, Majid; Faghihi, Mohammad Ali

    2017-08-18

    Neurodegeneration with brain iron accumulation (NBIA) is a genetically heterogeneous group of disorders associated with progressive impairment of movement, vision, and cognition. The disease is initially diagnosed on the basis of changes in brain magnetic resonance imaging which indicate an abnormal brain iron accumulation in the basal ganglia. However, the diagnosis of specific types should be based on both clinical findings and molecular genetic testing for genes associated with different types of NBIA, including PANK2, PLA2G6, C19orf12, FA2H, ATP13A2, WDR45, COASY, FTL, CP, and DCAF17. The purpose of this study was to investigate disease-causing mutations in two patients with distinct NBIA disorders. Whole Exome sequencing using Next Generation Illumina Sequencing was used to enrich all exons of protein-coding genes as well as some other important genomic regions in these two affected patients. A deleterious homozygous four-nucleotide deletion causing frameshift deletion in PANK2 gene (c.1426_1429delATGA, p.M476 fs) was identified in an 8 years old girl with dystonia, bone fracture, muscle rigidity, abnormal movement, lack of coordination and chorea. In addition, our study revealed a novel missense mutation in PLA2G6 gene (c.3G > T:p.M1I) in one and half-year-old boy with muscle weakness and neurodevelopmental regression (speech, motor and cognition). The novel mutations were also confirmed by Sanger sequencing in the proband and their parents. Current study uncovered two rare novel mutations in PANK2 and PLA2G6 genes in patients with NBIA disorder and such studies may help to conduct genetic counseling and prenatal diagnosis more accurately for individuals at the high risk of these types of disorders.

  7. [Gene promoter methylation in glucose-6-phosphate dehydrogenase deficiency].

    PubMed

    Xu, Dan-Dan; Wen, Fei-Qiu; Lv, Rong-Yu; Zhang, Min; Chen, Yun-Sheng; Chen, Xiao-Wen

    2016-05-01

    To investigate the features of methylation in the promoter region of glucose-6-phosphate dehydrogenase (G6PD) gene and the association between gene promoter methylation and G6PD deficiency. Fluorescent quantitative PCR was used to measure the mRNA expression of G6PD in 130 children with G6PD deficiency. Sixty-five children without G6PD deficiency served as the control group. The methylation-sensitive high-resolution melting curve analysis and bisulfite PCR sequencing were used to analyze gene promoter methylation in 22 children with G6PD deficiency and low G6PD mRNA expression. The G6PD gene promoter methylation was analyzed in 44 girls with normal G6PD mRNA expression (7 from G6PD deficiency group and 37 from control group). Twenty-two (16.9%) children with G6PD deficiency had relatively low mRNA expression of G6PD; among whom, 16 boys showed no methylation, and 6 girls showed partial methylation. Among the 44 girls with normal G6PD mRNA expression, 40 showed partial methylation, and 4 showed no methylation (1 case in the G6PD group and 3 cases in the control group). Gene promoter methylation is not associated with G6PD deficiency in boys. Girls have partial methylation or no methylation in the G6PD gene, suggesting that the methylation may be related to G6PD deficiency in girls.

  8. Glucose-6-phosphate dehydrogenase deficiency (G6PD) as a risk factor of male neonatal sepsis.

    PubMed

    Rostami-Far, Z; Ghadiri, K; Rostami-Far, M; Shaveisi-Zadeh, F; Amiri, A; Rahimian Zarif, B

    2016-01-01

    Introduction. Neonatal sepsis is a disease process, which represents the systemic response of bacteria entering the bloodstream during the first 28 days of life. The prevalence of sepsis is higher in male infants than in females, but the exact cause is unknown. Glucose-6-phosphate dehydrogenase (G6PD) is an enzyme in the pentose phosphate pathway, which leads to the production of NADPH. NADPH is required for the respiratory burst reaction in white blood cells (WBCs) to destroy microorganisms. The purpose of this study was to evaluate the prevalence of G6PD deficiency in neonates with sepsis. Materials and methods. This study was performed on 76 neonates with sepsis and 1214 normal neonates from February 2012 to November 2014 in the west of Iran. The G6PD deficiency status was determined by fluorescent spot test. WBCs number and neutrophils percentages were measured and compared in patients with and without G6PD deficiency. Results. The prevalence of the G6PD deficiency in neonates with sepsis was significantly higher compared to the control group (p=0.03). WBCs number and neutrophils percentages in G6PD deficient patients compared with patients without G6PD deficiency were decreased, but were not statistically significant (p=0.77 and p=0.86 respectively). Conclusions. G6PD deficiency is a risk factor of neonatal sepsis and also a justification for more male involvement in this disease. Therefore, newborn screening for this disorder is recommended.

  9. TRPC6 G757D Loss-of-Function Mutation Associates with FSGS

    PubMed Central

    Riehle, Marc; Büscher, Anja K.; Gohlke, Björn-Oliver; Kaßmann, Mario; Kolatsi-Joannou, Maria; Bräsen, Jan H.; Nagel, Mato; Becker, Jan U.; Winyard, Paul; Hoyer, Peter F.; Preissner, Robert; Krautwurst, Dietmar; Gollasch, Maik

    2016-01-01

    FSGS is a CKD with heavy proteinuria that eventually progresses to ESRD. Hereditary forms of FSGS have been linked to mutations in the transient receptor potential cation channel, subfamily C, member 6 (TRPC6) gene encoding a nonselective cation channel. Most of these TRPC6 mutations cause a gain-of-function phenotype, leading to calcium–triggered podocyte cell death, but the underlying molecular mechanisms are unclear. We studied the molecular effect of disease-related mutations using tridimensional in silico modeling of tetrameric TRPC6. Our results indicated that G757 is localized in a domain forming a TRPC6-TRPC6 interface and predicted that the amino acid exchange G757D causes local steric hindrance and disruption of the channel complex. Notably, functional characterization of model interface domain mutants suggested a loss-of-function phenotype. We then characterized 19 human FSGS–related TRPC6 mutations, the majority of which caused gain-of-function mutations. However, five mutations (N125S, L395A, G757D, L780P, and R895L) caused a loss-of-function phenotype. Coexpression of wild-type TRPC6 and TRPC6 G757D, mimicking heterozygosity observed in patients, revealed a dominant negative effect of TRPC6 G757D. Our comprehensive analysis of human disease–causing TRPC6 mutations reveals loss of TRPC6 function as an additional concept of hereditary FSGS and provides molecular insights into the mechanism responsible for the loss-of-function phenotype of TRPC6 G757D in humans. PMID:26892346

  10. Brief report: linkage between G6PD and fragile-X syndrome.

    PubMed

    Filippi, G; Rinaldi, A; Archidiacono, N; Rocchi, M; Balazs, I; Siniscalco, M

    1983-05-01

    Eighteen Sardinian pedigrees segregating for the X-fragile site syndrome were studied with respect to the segregation of the fragile site (FS) at Xq28, mental retardation, and macro-orchidism. No exception was found in the association of this symptomatic triad (MOM-X) in 41 out of 42 patients examined. The exceptional individual had micro- rather than macro-orchidism and was found to have a 47, XXY sex chromosome complement. In six informative sibships, the MOM-X syndrome was found to segregate in close linkage association with G6PD-deficiency or protan colorblindness. The maximum likelihood estimate of recombination if 6% with 90% fiducial limits between 2.5 and 19.5% and an odds ratio in favor of measurable linkage of 428:1. However, no hint of measurable linkage was found in six pedigrees segregating for G6PD and the Renpenning syndrome or other unspecified types of X-linked mental retardation. These data give strong support to the generally held hypothesis that the FS at Zq28, characteristic of the MOM-X syndrome, is a direct expression of a genetic change in the same chromosomal region. They also clearly suggest that X-linked MR without FS may be the result of different allelic mutations at the same locus.

  11. Prevalence of glucose-6-phosphate dehydrogenase (G6PD) deficiency in southeast Iran: implications for malaria elimination.

    PubMed

    Tabatabaei, Seyed Mehdi; Salimi Khorashad, Alireza; Sakeni, Mohammad; Raeisi, Ahmad; Metanat, Zahra

    2015-03-15

    Glucose-6-phosphate dehydrogenase deficiency (G6PD) is an X-linked genetic disorder with a relatively high frequency in malaria-endemic regions. It is an obstacle to malaria elimination, as primaquine administered in the treatment of malaria can cause hemolysis in G6PD-deficient individuals. This study presents information on the prevalence of G6PD deficiency in Sistan and Balouchetsan province, which hosts more than 90% of Plasmodium vivax malaria cases in Iran. This type of information is needed for a successful malaria elimination program. A total of 526 students were randomly recruited through schools located in southeast Iran. Information was collected by interviewing the students using a structured questionnaire. Blood samples taken on filter papers were examined for G6PD deficiency using the fluorescent spot test. Overall, 72.8% (383/526) of the subjects showed normal G6PD enzyme function. Mild and severe G6PD deficiency was observed in 14.8% (78) and 12.2% (64) of subjects, respectively. A total 193/261 males (73.9%) and 190/265 (72%) females had normal enzyme activity. Mild G6PD deficiency was observed in 10.8% (28) and 18.9% (50) of male and female subjects, respectively. However, in comparison with females, a greater proportion of males showed severe enzyme deficiency (15.3% versus 9.1%). All these differences were statistically significant (p < 0.006). G6PD deficiency is highly prevalent in southeast Iran. G6PD-deficient individuals are susceptible to potentially severe and life-threatening hemolytic reactions after primaquine treatment. In order to achieve malaria elimination goals in the province, G6PD testing needs to be made routinely available within the health system.

  12. Prevalence of glucose-6-phosphate dehydrogenase (G6PD) deficiency among malaria patients in Upper Myanmar.

    PubMed

    Lee, Jinyoung; Kim, Tae Im; Kang, Jung-Mi; Jun, Hojong; Lê, Hương Giang; Thái, Thị Lam; Sohn, Woon-Mok; Myint, Moe Kyaw; Lin, Khin; Kim, Tong-Soo; Na, Byoung-Kuk

    2018-03-16

    Glucose-6-phosphate dehydrogenase (G6PD; EC 1.1.1.49) deficiency is one of the most common X-linked recessive hereditary disorders in the world. Primaquine (PQ) has been used for radical cure of P. vivax to prevent relapse. Recently, it is also used to reduce P. falciparum gametocyte carriage to block transmission. However, PQ metabolites oxidize hemoglobin and generate excessive reactive oxygen species which can trigger acute hemolytic anemia in malaria patients with inherited G6PD deficiency. A total of 252 blood samples collected from malaria patients in Myanmar were used in this study. G6PD variant was analysed by a multiplex allele specific PCR kit, DiaPlexC™ G6PD Genotyping Kit [Asian type]. The accuracy of the multiplex allele specific PCR was confirmed by sequencing analysis. Prevalence and distribution of G6PD variants in 252 malaria patients in Myanmar were analysed. Six different types of G6PD allelic variants were identified in 50 (7 females and 43 males) malaria patients. The predominant variant was Mahidol (68%, 34/50), of which 91.2% (31/34) and 8.8% (3/34) were males and females, respectively. Other G6PD variants including Kaiping (18%, 9/50), Viangchan (6%, 3/50), Mediterranean (4%, 2/50), Union (2%, 1/50) and Canton (2%, 1/50) were also observed. Results of this study suggest that more concern for proper and safe use of PQ as a radical cure of malaria in Myanmar is needed by combining G6PD deficiency test before PQ prescription. Establishment of a follow-up system to monitor potential PQ toxicity in malaria patients who are given PQ is also required.

  13. Glucose-6-Phosphate Dehydrogenase Deficiency Genetic Variants in Malaria Patients in Southwestern Ethiopia.

    PubMed

    Carter, Tamar E; Mekonnen, Seleshi Kebede; Lopez, Karen; Bonnell, Victoria; Damodaran, Lambodhar; Aseffa, Abraham; Janies, Daniel A

    2018-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is an X-linked erythrocyte enzyme disorder with relevance to malaria treatment policy. Treatment with the antimalarial primaquine can result in hemolytic anemia in G6PD-deficient patients. With increased interest in primaquine use, it is important to identify G6PD variants in Ethiopia to inform malaria treatment policy. In the present study, mutations in the G6PD gene are identified in a sample of patients with malaria in Jimma town in southwest Ethiopia. Plasmodium species of infection were confirmed using polymerase chain reaction (PCR) and gel electrophoresis. PCR and Sanger sequencing were performed to observe a portion of the G6PD gene where the common G6PD mutations (A376G, G202A, and C563T) are found. Molecular analysis revealed that most of the samples were single Plasmodium vivax infections (83.7%). For G6PD genotyping, A376G was detected in 23.26% of individuals, whereas G202A and C563T were absent. Three other uncommon mutations were identified: rs782669677 (535G→A), rs370658483, (485 + 37 G→T), and a new mutation at chrX:154535443(C→T). Bioinformatic analysis of these mutations' potential functional impact suggests minimal effect on protein function. The discovery of both common and uncommon G6PD mutations contributes to the discussion on G6PD deficiency and appropriate primaquine treatment in Ethiopia.

  14. The role of the G6PD AEth376G/968C allele in glucose-6-phosphate dehydrogenase deficiency in the seerer population of Senegal.

    PubMed

    De Araujo, Carla; Migot-Nabias, Florence; Guitard, Juliette; Pelleau, Stéphane; Vulliamy, Tom; Ducrocq, Rolande

    2006-02-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is common in tropical Sub-Saharan countries. The allele most frequently associated with G6PD deficiency in this a region is G6PD 376G/202A. Here, we show that, the prevalence of G6PD deficiency is 12% in the Sereer ethnic group from Senegal ant that the 376G/968C genotype is predominant; the frequency of the 376G/202A genotype is very low in this ethnic group.

  15. Glucose-6-Phosphate Dehydrogenase (G6PD)-Deficient Epithelial Cells Are Less Tolerant to Infection by Staphylococcus aureus

    PubMed Central

    Ho, Hung-Yao; Chen, Lei-Chin; Chen, Chien-Cheng; Shu, Jwu-Ching

    2013-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) is a key enzyme in the pentose phosphate pathway and provides reducing energy to all cells by maintaining redox balance. The most common clinical manifestations in patients with G6PD deficiency are neonatal jaundice and acute hemolytic anemia. The effects of microbial infection in patients with G6PD deficiency primarily relate to the hemolytic anemia caused by Plasmodium or viral infections and the subsequent medication that is required. We are interested in studying the impact of bacterial infection in G6PD-deficient cells. G6PD knock down A549 lung carcinoma cells, together with the common pathogen Staphylococcus aureus, were employed in our cell infection model. Here, we demonstrate that a lower cell viability was observed among G6PD-deficient cells when compared to scramble controls upon bacterial infection using the MTT assay. A significant increase in the intracellular ROS was detected among S. aureus-infected G6PD-deficient cells by observing dichlorofluorescein (DCF) intensity within cells under a fluorescence microscope and quantifying this signal using flow cytometry. The impairment of ROS removal is predicted to enhance apoptotic activity in G6PD-deficient cells, and this enhanced apoptosis was observed by annexin V/PI staining under a confocal fluorescence microscope and quantified by flow cytometry. A higher expression level of the intrinsic apoptotic initiator caspase-9, as well as the downstream effector caspase-3, was detected by Western blotting analysis of G6PD-deficient cells following bacterial infection. In conclusion, we propose that bacterial infection, perhaps the secreted S. aureus α-hemolysin in this case, promotes the accumulation of intracellular ROS in G6PD-deficient cells. This would trigger a stronger apoptotic activity through the intrinsic pathway thereby reducing cell viability when compared to wild type cells. PMID:24223971

  16. Mutations in the glucocerebrosidase gene are common in patients with Parkinson's disease from Eastern Canada.

    PubMed

    Han, Fabin; Grimes, David A; Li, Fang; Wang, Ting; Yu, Zhe; Song, Na; Wu, Shichao; Racacho, Lemuel; Bulman, Dennis E

    2016-01-01

    Mutations in the β-glucocerebrosidase gene (GBA) have been implicated as a risk factor for Parkinson's disease (PD). However, GBA mutations in PD patients of different ethnic origins were reported to be inconsistent. We sequenced all exons of the GBA gene in 225 PD patients and 110 control individuals from Eastern Canada. Two novel GBA variants of c.-119 A/G and S(-35)N, five known GBA mutations of R120W, N370S, L444P, RecNciI and RecTL mutation (del55/D409H/RecNciI) as well as two non-pathological variants of E326K and T369M were identified from PD patients while only one mutation of S13L and two non-pathological variants of E326K and T369M were found in the control individuals. The frequency of GBA mutations within PD patients (4.4%) is 4.8 times higher than the 0.91% observed in control individuals (X(2) = 2.91, p = 0.088; odds ratio = 4.835; 95% confidence interval = 2.524-9.123). The most common mutations of N370S and L444P accounted for 36.0% (9/25) of all the GBA mutations in this Eastern Canadian PD cohort. The frequency (6.67%) of E326K and T369M in PD patients is comparable to 7.27% in control individuals (X(2) = 0.042, p = 0.8376), further supporting that these two variants have no pathological effects on PD. Phenotype analysis showed that no significant difference in family history, age at onset and cognitive impairment was identified between the GBA mutation carriers and non-GBA mutation carriers. GBA mutations were found to be a common genetic risk factor for PD in Eastern Canadian patients.

  17. G6PD/PK ratio: a reliable parameter to identify glucose-6-phosphate dehydrogenase deficiency associated with microcytic anemia in heterozygous subjects.

    PubMed

    Tagarelli, Antonio; Piro, Anna; Tagarelli, Giuseppe; Bastone, Loredana; Paleari, Renata; Mosca, Andrea

    2004-10-01

    To determine if measuring the ratio of glucose-6-phosphate dehydrogenase (G6PD) to pyruvate kinase (PK) is more reliable than only measuring G6PD activity to identify heterozygous G6PD- individuals with associated microcytic anemia in the Calabrian population, which shows high frequencies of both the thalassaemia (thal) trait and G6PD deficiency. Measurement of G6PD and PK activities was carried out on 205 samples of whole blood from Calabrian subjects of both sexes (age range 10-50 years) using a double starter differential pH-metry technique. The G6PD/PK ratio is able to differentiate G6PD- heterozygous individuals from the normal population. G6PD/PK values also allowed us to easily identify the G6PD- heterozygous subjects with microcytic anaemia. Student's t test shows that G6PD/PK ratio is more reliable in both sample groups, relative to G6PD activity in normal subjects. G6PD/PK ratio is a reliable diagnostic parameter for mass screening for G6PD deficiency.

  18. Characterization of the mutations in the glucose-6-phosphatase gene in Israeli patients with glycogen storage disease type 1a: R83C in six Jews and a novel V166G mutation in a Muslim Arab.

    PubMed

    Parvari, R; Moses, S; Hershkovitz, E; Carmi, R; Bashan, N

    1995-01-01

    Glycogen storage disease type 1a (GSD 1a), an autosomal recessive disease, is caused by the inactivity of glucose-6-phosphatase, the gene of which has been recently cloned. We report on the missense mutation C-->T at nucleotide 326 of the G6Pase gene, causing the change of the Arg codon at position 83 into a Cys codon, as the single mutation detected in six Jewish patients. This finding suggests that this mutation might be prevalent among the Jewish population. A new missense mutation T-->G at nucleotide 576 resulting in V166G was found in an Arab Muslim patient. These families may benefit now from pre- and postnatal diagnosis by analysis of DNA from blood and amniotic fluid or chorionic villus cells rather than liver biopsy. No mutations in the G6Pase gene were detected in two GSD 1b patients.

  19. The LRRK2 G2019S mutation in a series of Argentinean patients with Parkinson's disease: clinical and demographic characteristics.

    PubMed

    Gatto, Emilia Mabel; Parisi, Virginia; Converso, Daniela Paola; Poderoso, Juan José; Carreras, María Cecilia; Martí-Massó, José Felix; Paisán-Ruiz, Coro

    2013-03-14

    To determine clinical characteristics and frequency of leucine-rich repeat kinase 2 gene (LRRK2) mutations in a cohort of patients with Parkinson's disease (PD) from Argentina. Variation in the LRRK2 gene represents the most common genetic determinant of PD, only few data are available from Latin-America. Informed consent was obtained and all studies were approved by the Institutional Review Boards. Fifty five consecutive PD patients were recruited. A structured interview and neurological examination were used to collect demographic and clinical information. Blood samples were obtained and DNA extracted from patient venous blood. All LRRK2 exons from 25 exon to 51 exon were screened in all patients. Clinical and molecular data of 55 patients with PD were analyzed. Mean age was 68.8±10.6 years. Jewish and Basque ancestries were found positive in 9 and 7 patients, respectively; family history of PD was identified in 16 patients. The G2019S mutation was present in 3 Ashkenazi Jewish subjects (5.45%); all of them reported family history of PD in first-degree relatives. Although Argentina possesses one of the most important Basque communities outside Spain, non R1414G mutation was identified in this cohort. Eleven single polymorphisms (SNP) were identified in this cohort. The mean age at onset was higher in G2019S mutation carriers than non-carriers (66.67 vs 58.78 years). Asymmetrical tremor as initial symptom and non-motor symptoms occurred at similar frequencies in both groups. The G2019S mutation carriers showed a non significant increase in dyskinesias, and 2/3 developed Dopamine Dysregulation Syndrome and visual hallucinations. Systemic disorder identified in G2019S mutation carriers included: celiac disease, hypothyroidism, Hashimoto's Thyroiditis and arterial hypertension. The prevalence of LRRK2 G2019S mutation in this Argentinean cohort was similar to other international series, with a higher prevalence in Ashkenazi Jewish. The phenotype was indistinguishable

  20. Ultrasound-Guided Regional Anesthesia in a Glucose-6-Phosphate Dehydrogenase (G6PD)-Deficient Geriatric Trauma Patient

    PubMed Central

    Födinger, Agnes M.; Kammerlander, Christian; Luger, Thomas J.

    2012-01-01

    Objective: Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a genetic enzymatic disorder causing hemolytic anemia. Exposure to drugs is considered to be the most common cause of acute hemolysis in patients with G6PD deficiency. Experience with regional anesthesia, in particular peripheral nerve blocks, is rarely described in patients with G6PD deficiency, but is of great clinical interest. For this reason, we now report on the successful management of ultrasound-guided axillary brachial plexus block in a patient with geriatric G6PD deficiency. Case report: A female, 75-year-old geriatric trauma patient with G6PD deficiency and a fracture of the left forearm, was scheduled for osteosynthesis of the left forearm. For surgery regional anesthesia with ultrasound-guided axillary brachial plexus block with 30 mL bupivacaine 0.5% was established. Surgical operation und postoperative course were uneventful and with no signs of hemolysis. Conclusion: Ultrasound-guided axillary brachial plexus block with bupivacaine was a safe and effective technique in this patient with G6PD deficiency. Peripheral nerve block is a major analgesic approach and of great value for anesthesiologists and surgeons, especially in our aging and multimorbid society. PMID:23569708

  1. Glucose-6-phosphate dehydrogenase deficiency and malaria: cytochemical detection of heterozygous G6PD deficiency in women.

    PubMed

    Peters, Anna L; Van Noorden, Cornelis J F

    2009-11-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a X-chromosomally transmitted disorder of the erythrocyte that affects 400 million people worldwide. Diagnosis of heterozygously-deficient women is complicated: as a result of lyonization, these women have a normal and a G6PD-deficient population of erythrocytes. The cytochemical assay is the only reliable assay to discriminate between heterozygously-deficient women and non-deficient women or homozygously-deficient women. G6PD deficiency is mainly found in areas where malaria is or has been endemic. In these areas, malaria is treated with drugs that can cause (severe) hemolysis in G6PD-deficient individuals. A cheap and reliable test is necessary for diagnosing the deficiency to prevent hemolytic disorders when treating malaria. In this review, it is concluded that the use of two different tests for diagnosing men and women is the ideal approach to detect G6PD deficiency. The fluorescent spot test is inexpensive and easy to perform but only reliable for discriminating hemizygous G6PD-deficient men from non-deficient men. For women, the cytochemical assay is recommended. However, this assay is more expensive and difficult to perform and should be simplified into a kit for use in developing countries.

  2. Decreased mutation frequencies among immunoglobulin G variable region genes during viremic HIV-1 infection.

    PubMed

    Bowers, Elisabeth; Scamurra, Ronald W; Asrani, Anil; Beniguel, Lydie; MaWhinney, Samantha; Keays, Kathryne M; Thurn, Joseph R; Janoff, Edward N

    2014-01-01

    HIV-1 infection is complicated by high rates of opportunistic infections against which specific antibodies contribute to immune defense. Antibody function depends on somatic hypermutation (SHM) of variable regions of immunoglobulin heavy chain genes (VH-D-J). We characterized the frequency of SHM in expressed IgG mRNA immunoglobulin transcripts from control and HIV-1-infected patients. We compared utilization of genes in the most prominent VH family (VH3) and mutation frequencies and patterns of cDNA from VH3-IgG genes from 10 seronegative control subjects and 21 patients with HIV-1 infection (6 without and 15 patients with detectable plasma viremia). Unique IgG VH3 family cDNA sequences (n = 1,565) were PCR amplified, cloned, and sequenced from blood. Sequences were analyzed using online (Vbase) and in-house immunoglobulin alignment resources. Mutation frequencies in the antigen-binding hypervariable complementarity determining regions (CDR1/2) of IgG class-switched B cells were lower among viremic HIV-1-infected patients vs. controls for nucleotides (CDR1/2: 10±5% vs. 13.5±6%, p = 0.03) and amino acids (CDR: 20%±10 vs. 25%±12, p = 0.02) and in structural framework regions. Mutation patterns were similar among groups. The most common VH3 gene, VH3-23, was utilized less frequently among viremic HIV-1-infected patients (p = 0.03), and overall, mutation frequencies were decreased in nearly all VH3 genes compared with controls. B cells from HIV-1-infected patients show decreased mutation frequencies, especially in antigen-binding VH3 CDR genes, and selective defects in gene utilization. Similar mutation patterns suggest defects in the quantity, but not quality, of mutator activity. Lower levels of SHM in IgG class-switched B cells from HIV-1-infected patients may contribute to the increased risk of opportunistic infections and impaired humoral responses to preventative vaccines.

  3. Co-inheritance of glucose-6-phosphate dehydrogenase deficiency mutations and hemoglobin E in a Kachin population in a malaria-endemic region of Southeast Asia

    PubMed Central

    He, Lijun; Li, Qing; Wu, Yanrui; Luo, Lan; Li, Hong; Ma, Limei; Yang, Zhaoqing; He, Yongshu; Cui, Liwang

    2017-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency and hemoglobin E (HbE, β26 Glu-Lys) are two common red cell disorders in Southeast Asia. G6PD deficiency produces hemolytic anemia, which can be triggered by certain drugs or infections. HbE is asymptomatic or is manifested as microcytic, minimally hemolytic anemia. The association between G6PD deficiency and HbE is little understood. This study aimed to investigate G6PD deficiency and HbE in a Kachin ethnic group in the China-Myanmar border area. G6PD enzyme activity was measured using a quantitative G6PD assay, G6PD variants genotyped by the SNaPshot assay, and an HbE gene mutation identified by an amplification refractory mutation system and subsequently confirmed by using a reverse dot blot hybridization assay from 100 unrelated individuals in the study area. G6PD enzyme activity ranged from 0.4 to 24.7 U/g Hb, and six males had severe G6PD deficiency (<0.12–1.2 U/g Hb), while six males and 12 females had mild G6PD deficiency (>1.2–4.5 U/g Hb). Among the 24 G6PD-deficient subjects, 22 (92%) had the Mahidol 487G>A mutation (12 male hemizygotes, one female homozygote, and nine female heterozygotes), while the G6PD genotypes in two female subjects were unknown. HbE was identified in 39 subjects (20 males and 19 females), including 15 HbEE (seven males and eight females) and 24 HbAE (13 males and 11 females). Twenty-three subjects co-inherited both G6PD deficiency and HbE (22 with HbAE and one with HbEE). Whereas mean Hb levels were not significantly different between the HbA and HbE groups, G6PD-deficient males had significantly lower Hb levels than G6PD-normal males (P < 0.05, t-test). However, it is noteworthy that two G6PD-deficient hemizygous males with HbAE were severely anemic with Hb levels below 50 g/L. This study revealed high prevalence of co-inheritance of G6PD deficiency with HbAE in the Kachin ethnicity, and a potential interaction of the G6PD Mahidol 487G>A and HbAE in males leading to severe

  4. Co-inheritance of glucose-6-phosphate dehydrogenase deficiency mutations and hemoglobin E in a Kachin population in a malaria-endemic region of Southeast Asia.

    PubMed

    Deng, Zeshuai; Yang, Fang; Bai, Yao; He, Lijun; Li, Qing; Wu, Yanrui; Luo, Lan; Li, Hong; Ma, Limei; Yang, Zhaoqing; He, Yongshu; Cui, Liwang

    2017-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency and hemoglobin E (HbE, β26 Glu-Lys) are two common red cell disorders in Southeast Asia. G6PD deficiency produces hemolytic anemia, which can be triggered by certain drugs or infections. HbE is asymptomatic or is manifested as microcytic, minimally hemolytic anemia. The association between G6PD deficiency and HbE is little understood. This study aimed to investigate G6PD deficiency and HbE in a Kachin ethnic group in the China-Myanmar border area. G6PD enzyme activity was measured using a quantitative G6PD assay, G6PD variants genotyped by the SNaPshot assay, and an HbE gene mutation identified by an amplification refractory mutation system and subsequently confirmed by using a reverse dot blot hybridization assay from 100 unrelated individuals in the study area. G6PD enzyme activity ranged from 0.4 to 24.7 U/g Hb, and six males had severe G6PD deficiency (<0.12-1.2 U/g Hb), while six males and 12 females had mild G6PD deficiency (>1.2-4.5 U/g Hb). Among the 24 G6PD-deficient subjects, 22 (92%) had the Mahidol 487G>A mutation (12 male hemizygotes, one female homozygote, and nine female heterozygotes), while the G6PD genotypes in two female subjects were unknown. HbE was identified in 39 subjects (20 males and 19 females), including 15 HbEE (seven males and eight females) and 24 HbAE (13 males and 11 females). Twenty-three subjects co-inherited both G6PD deficiency and HbE (22 with HbAE and one with HbEE). Whereas mean Hb levels were not significantly different between the HbA and HbE groups, G6PD-deficient males had significantly lower Hb levels than G6PD-normal males (P < 0.05, t-test). However, it is noteworthy that two G6PD-deficient hemizygous males with HbAE were severely anemic with Hb levels below 50 g/L. This study revealed high prevalence of co-inheritance of G6PD deficiency with HbAE in the Kachin ethnicity, and a potential interaction of the G6PD Mahidol 487G>A and HbAE in males leading to severe

  5. A clinical and molecular review of ubiquitous glucose-6-phosphatase deficiency caused by G6PC3 mutations

    PubMed Central

    2013-01-01

    The G6PC3 gene encodes the ubiquitously expressed glucose-6-phosphatase enzyme (G-6-Pase β or G-6-Pase 3 or G6PC3). Bi-allelic G6PC3 mutations cause a multi-system autosomal recessive disorder of G6PC3 deficiency (also called severe congenital neutropenia type 4, MIM 612541). To date, at least 57 patients with G6PC3 deficiency have been described in the literature. G6PC3 deficiency is characterized by severe congenital neutropenia, recurrent bacterial infections, intermittent thrombocytopenia in many patients, a prominent superficial venous pattern and a high incidence of congenital cardiac defects and uro-genital anomalies. The phenotypic spectrum of the condition is wide and includes rare manifestations such as maturation arrest of the myeloid lineage, a normocellular bone marrow, myelokathexis, lymphopaenia, thymic hypoplasia, inflammatory bowel disease, primary pulmonary hypertension, endocrine abnormalities, growth retardation, minor facial dysmorphism, skeletal and integument anomalies amongst others. Dursun syndrome is part of this extended spectrum. G6PC3 deficiency can also result in isolated non-syndromic severe neutropenia. G6PC3 mutations in result in reduced enzyme activity, endoplasmic reticulum stress response, increased rates of apoptosis of affected cells and dysfunction of neutrophil activity. In this review we demonstrate that loss of function in missense G6PC3 mutations likely results from decreased enzyme stability. The condition can be diagnosed by sequencing the G6PC3 gene. A number of G6PC3 founder mutations are known in various populations and a possible genotype-phenotype relationship also exists. G6PC3 deficiency should be considered as part of the differential diagnoses in any patient with unexplained congenital neutropenia. Treatment with G-CSF leads to improvement in neutrophil numbers, prevents infections and improves quality of life. Mildly affected patients can be managed with prophylactic antibiotics. Untreated G6PC3 deficiency

  6. [Evaluations of newborn screening program performance and enzymatic diagnosis of glucose-6-phosphate dehydrogenase deficiency in Guangzhou].

    PubMed

    Tang, F; Huang, Y L; Jiang, X; Jia, X F; Li, B; Feng, Y; Chen, Q Y; Tang, C F

    2018-05-02

    Objective: To reveal the molecular epidemiologic characteristics of glucose-6-phosphate dehydrogenase (G6PD) gene and to evaluate based on the genetic analysis the newborn screening program performance and enzymatic diagnosis of G6PD deficiency in Guangzhou. Methods: G6PD enzyme activities were measured by quantitative fluorescence assay in dry blood spots of 16 319 newborns(8 725 males, 7 594 females) 3-7 days after birth in Guangzhou Newborn Center. They were born in Guangzhou form Oct. 1 to 20, 2016. The cutoff value of G6PD was less than 2.6 U/g Hb in dry blood spots. G6PD deficiency was diagnosed when G6PD<1 700 U/L or G6PD/6PGD<1 in red blood cells. Genetic analysis of G6PD gene was performed on the dry blood spot samples of 823 newborns (including positive 346, negative 477)with various levels of G6PD enzyme activities through fluorescence PCR melting curve analysis(FMCA) to detect 15 kinds of mutations reported to be common among Chinese.G6PD gene Sanger sequency was performed in seven highly suspicious patients with negative results by FMCA. Results: (1) Using the cutoff value of G6PD< 2.6 U/g Hb , a total of 687(4.2%) newborns showed positive screening results, including 560 (6.4%) males and 127(1.7%) females. (2) Among the newborns with positive screening results, 214 males and 122 females were randomly chosen for G6PD gene analysis. The results showed that 197 (92.1%) males were hemizygote and 108(88.6%) females were mutation carriers with one to four alleles. Among the newborns with negative screening results, 41 males with G6PD 2.6-2.8 U/g Hb and 436 females with G6PD 2.6-4.5 U/g Hb were chosen for genetic analysis.Mutations were detected in 5(12.2%)boys, and 226(51.8%) girls were carriers.G6PD gene Sanger sequency of seven highly suspicious patients showed that c.406C>T, c.551C>T, c.835A>T hemizygote were found in 3 male's samples, respectively. (3) The estimated prevalence of harboring mutation was 6.0% in males and 13.5% in females according to

  7. [Relationship between G6PD deficiency and hand-foot-mouth disease induced by enterovirus 71].

    PubMed

    Ou, Jun-Bin; Zhang, Cui-Mei; Fu, Si-Mao; Huang, Xiang; Huang, Lian-Hong

    2013-09-01

    To study the influence of glucose-6-phosphate dehydrogenase (G6PD) deficiency on hand-foot-mouth disease (HFMD) induced by enterovirus 71 (EV71) , and possible mechanisms. A total of 220 boys with HFMD induced by EV71 were classified into two groups based on disease severity: mild/moderate (n=145) and severe HFMD groups (n=75), and 132 healthy boys were selected as the control group. The activity of G6PD and levels of reduced glutathione (GSH) and malonaldehyde (MDA) in blood were measured using the automatic biochemical analyzer. The percentage of G6PD deficiency cases in the severe HFMD group was significantly higher than in the control group (P<0.0125). In the severe HFMD group, the durations of fever, mental abnormality, limb trembling and hospital stay were significantly longer in children with G6PD deficiency than in those with normal G6PD activity (P<0.05). In the acute and recovery stages, patients in the mild/moderate and severe HFMD groups had significantly lower GSH levels and G6PD activity and significantly higher MDA levels compared with those in the control group (P<0.05). In the acute stage, children in the mild/moderate and severe HFMD groups with G6PD deficiency had significantly lower GSH levels and significantly higher MDA levels compared with those with normal G6PD activity (P<0.01). In the acute and recovery stages, GSH level in children with HFMD was positively correlated with G6PD activity (r=0.61, P<0.01; r=0.58, P<0.01), and in the acute stage, MDA level was negatively correlated with G6PD activity (r=-0.29, P<0.01). G6PD deficiency is probably a predisposing factor for HFMD induced by EV71 and may aggravate the patient's condition. Its mechanism might be related to oxidative stress.

  8. First Evaluation of Glucose-6-Phosphate Dehydrogenase (G6PD) Deficiency in Vivax Malaria Endemic Regions in the Republic of Korea

    PubMed Central

    Goo, Youn-Kyoung; Ji, So-Young; Shin, Hyun-Il; Moon, Jun-Hye; Cho, Shin-Hyung; Lee, Won-Ja; Kim, Jung-Yeon

    2014-01-01

    Background Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common human enzyme defect and affects more than 400 million people worldwide. This deficiency is believed to protect against malaria because its global distribution is similar. However, this genetic disorder may be associated with potential hemolytic anemia after treatment with anti-malarials, primaquine or other 8-aminoquinolines. Although primaquine is used for malaria prevention, no study has previously investigated the prevalence of G6PD variants and G6PD deficiency in the Republic of Korea (ROK). Methods Two commercialized test kits (Trinity G-6-PDH and CareStart G6PD test) were used for G6PD deficiency screening. The seven common G6PD variants were investigated by DiaPlexC kit in blood samples obtained living in vivax malaria endemic regions in the ROK. Results Of 1,044 blood samples tested using the CareStart G6PD test, none were positive for G6PD deficiency. However, a slightly elevated level of G6PD activity was observed in 14 of 1,031 samples tested with the Trinity G-6-PDH test. Forty-nine of the 298 samples with non-specific amplification by DiaPlexC kit were confirmed by sequencing to be negative for the G6PD variants. Conclusions No G6PD deficiency was observed using phenotypic- or genetic-based tests in individuals residing in vivax malaria endemic regions in the ROK. Because massive chemoprophylaxis using primaquine has been performed in the ROK military to kill hypnozoites responsible for relapse and latent stage vivax malaria, further regular monitoring is essential for the safe administration of primaquine. PMID:24853873

  9. First evaluation of glucose-6-phosphate dehydrogenase (G6PD) deficiency in vivax malaria endemic regions in the Republic of Korea.

    PubMed

    Goo, Youn-Kyoung; Ji, So-Young; Shin, Hyun-Il; Moon, Jun-Hye; Cho, Shin-Hyung; Lee, Won-Ja; Kim, Jung-Yeon

    2014-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common human enzyme defect and affects more than 400 million people worldwide. This deficiency is believed to protect against malaria because its global distribution is similar. However, this genetic disorder may be associated with potential hemolytic anemia after treatment with anti-malarials, primaquine or other 8-aminoquinolines. Although primaquine is used for malaria prevention, no study has previously investigated the prevalence of G6PD variants and G6PD deficiency in the Republic of Korea (ROK). Two commercialized test kits (Trinity G-6-PDH and CareStart G6PD test) were used for G6PD deficiency screening. The seven common G6PD variants were investigated by DiaPlexC kit in blood samples obtained living in vivax malaria endemic regions in the ROK. Of 1,044 blood samples tested using the CareStart G6PD test, none were positive for G6PD deficiency. However, a slightly elevated level of G6PD activity was observed in 14 of 1,031 samples tested with the Trinity G-6-PDH test. Forty-nine of the 298 samples with non-specific amplification by DiaPlexC kit were confirmed by sequencing to be negative for the G6PD variants. No G6PD deficiency was observed using phenotypic- or genetic-based tests in individuals residing in vivax malaria endemic regions in the ROK. Because massive chemoprophylaxis using primaquine has been performed in the ROK military to kill hypnozoites responsible for relapse and latent stage vivax malaria, further regular monitoring is essential for the safe administration of primaquine.

  10. Treatment of MRSA infections in an African-American male with G6PD deficiency.

    PubMed

    Paek, David S; Nadkarni, Milan; Singla, Manav

    2009-10-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency affecting erythrocytes is the most common enzymopathy in humans. It requires caution with the intake of oxidizing substances (e.g., medications and foods) because of the threat of hemolysis. Less recognized is the threat of a deficiency in G6PD that alters neutrophil function, which can compromise the killing of microbes by the oxidative burst mechanism. This results from a secondary alteration in the NADPH oxidase pathway. Methicillin-resistant Staphylococcus aureus (MRSA) infection, which is usually observed after exposure in the hospital setting, is becoming increasingly common in a community setting. Here we show the risk of MRSA and G6PD deficiency and discuss the pitfalls of G6PD deficiency.

  11. A novel homozygous mutation IVS6+5G>T in CYP11B1 gene in a Vietnamese patient with 11β-hydroxylase deficiency.

    PubMed

    Nguyen, Thi Phuong Mai; Nguyen, Thu Hien; Ngo, Diem Ngoc; Vu, Chi Dung; Nguyen, Thi Kim Lien; Nong, Van Hai; Nguyen, Huy Hoang

    2015-07-10

    Congenital adrenal hyperplasia (CAH) is an autosomal recessive disease which is characterized by a deficiency of one of the enzymes involved in the synthesis of cortisol from cholesterol by the adrenal cortex. CAH cases arising from impaired 11β-hydroxylase are the second most common form. Mutations in the CYP11B1 gene are the cause of 11β-hydroxylase deficiency. This study was performed on a patient with congenital adrenal hyperplasia and with premature development such as enlarged penis, muscle development, high blood pressure, and bone age equivalent of 5 years old at 2 years of chronological age. Biochemical tests for steroids confirmed the diagnosis of CAH. We used PCR and sequencing to screen for mutations in CYP11B1 gene. Results showed that the patient has a novel homozygous mutation of guanine (G) to thymine (T) in intron 6 (IVS6+5G>T). The analysis of this mutation by MaxEntScan boundary software indicated that this mutant could affect the gene splicing during transcription. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. ABCG5/G8 gene is associated with hypercholesterolemias without mutation in candidate genes and noncholesterol sterols.

    PubMed

    Lamiquiz-Moneo, Itziar; Baila-Rueda, Lucía; Bea, Ana M; Mateo-Gallego, Rocío; Pérez-Calahorra, Sofía; Marco-Benedí, Victoria; Martín-Navarro, Antonio; Ros, Emilio; Cofán, Montserrat; Rodríguez-Rey, José Carlos; Pocovi, Miguel; Cenarro, Ana; Civeira, Fernando

    Approximately 20% to 40% of clinically defined familial hypercholesterolemia (FH) cases do not show a causative mutation in candidate genes (mutation-negative FH), and some of them may have a polygenic origin. The aim of this work was to study the prevalence of ABCG5/G8 genetic variants in mutation-negative FH, as defects in these genes relate to intestinal hyperabsorption of cholesterol and thus ABCG5/G8 variants could explain in part the mechanism of hypercholesterolemia. We sequenced the ABCG5/G8 genes in 214 mutation-negative FH and 97 controls. Surrogate markers of cholesterol absorption (5α-cholestanol, β-sitosterol, campesterol, stigmasterol, and sitostanol) were quantified by high-performance liquid chromatography-tandem mass spectrometry in both studied groups. We found 8 mutation-negative FH patients (3.73%) with a pathogenic mutation in ABCG5/G8 genes. We observed significantly higher concentration of surrogate markers of cholesterol absorption in mutation-negative FH than in controls. In addition, we found significantly higher concentrations of cholesterol absorption markers in mutation-negative FH with ABCG5/G8 defects than in mutation-negative, ABCG5/G8-negative FH. A gene score reflecting the number of common single nucleotide variants associated with hypercholesterolemia was significantly higher in cases than in controls (P = .032). Subjects with a gene score above the mean had significantly higher 5α-cholestanol and stigmasterol than those with a lower gene score. Mutation-negative FH subjects accumulate an excess of rare and common gene variations in ABCG5/G8 genes. This variation is associated with increased intestinal absorption of cholesterol, as determined by surrogate makers, suggesting that these loci contribute to hypercholesterolemia by enhancing intestinal cholesterol absorption. Copyright © 2017 National Lipid Association. Published by Elsevier Inc. All rights reserved.

  13. [Molecular characterization of 71 cases of glucose-6-phosphate dehydrogenase deficiency in Hainan province].

    PubMed

    Huang, Dong-Ai; Wang, Xiao-Ying; Wang, Zheng; Zhou, Dai-Feng; Cai, Wang-Wei

    2007-04-01

    To molecularly analyze in Han and Li individuals of glucose-6-phosphate dehydrogenase deficiency in Hainan, China. The amplification refractory mutation system (ARMS) was employed to detect G1376T, G1388A and A95G mutations. The coding regions and flanking intronic regions from the second to the thirteenth exons of G6PD gene was analyzed by DNA sequencing to characterize the gene mutations in samples without G1376T, G1388A and A95G mutations. Among 29 Han cases of G6PD deficiency, 11 had G1376T (37.9%), 2 G1388A (6.9%), 1 G1376T and G1388A (3.4%) and 1 G1376T and A95G (3.4%) were identified. Mutations of G1376T, G1388A, A95G and their complex accounted for 51.7% of G6PD deficiency in the Han individuals. Among 42 Li cases of G6PD deficiency, 25 had G1376T (59.5%), 6 G1388A (14.3%), 2 A95G (4.8%), 4 G1376T and G1388A (9.5%), 1 G1376T and A95G (2.4% )were identified. These mutations accounted for 90.5% of the Li individuals. Gene mutation of 18 cases (14 Han and 4 Li individuals) remained unknown. Sequencing results of the 18 samples indicated that one case had a single base of T deletion at nucleotide 636 or 637 in the 5th intron (IVS-5 636 or 637 T del) and two cases had C1311T with IVS-11 T93C mutation. G6PD G1376T and G1388A are the most common mutations in the populations of the Han and Li nationalities in Hainan. The IVS-5 636 or 637 T del mutation is first reported in Chinese, and the complex mutation of G1376T/A95G is first found in the Li nationality.

  14. G6PD deficiency in Latin America: systematic review on prevalence and variants

    PubMed Central

    Monteiro, Wuelton M; Val, Fernando FA; Siqueira, André M; Franca, Gabriel P; Sampaio, Vanderson S; Melo, Gisely C; Almeida, Anne CG; Brito, Marcelo AM; Peixoto, Henry M; Fuller, Douglas; Bassat, Quique; Romero, Gustavo AS; Maria Regina F, Oliveira; Marcus Vinícius G, Lacerda

    2014-01-01

    Plasmodium vivax radical cure requires the use of primaquine (PQ), a drug that induces haemolysis in glucose-6-phosphate dehydrogenase deficient (G6PDd) individuals, which further hampers malaria control efforts. The aim of this work was to study the G6PDd prevalence and variants in Latin America (LA) and the Caribbean region. A systematic search of the published literature was undertaken in August 2013. Bibliographies of manuscripts were also searched and additional references were identified. Low prevalence rates of G6PDd were documented in Argentina, Bolivia, Mexico, Peru and Uruguay, but studies from Curaçao, Ecuador, Jamaica, Saint Lucia, Suriname and Trinidad, as well as some surveys carried out in areas of Brazil, Colombia and Cuba, have shown a high prevalence (> 10%) of G6PDd. The G6PD A-202A mutation was the variant most broadly distributed across LA and was identified in 81.1% of the deficient individuals surveyed. G6PDd is a frequent phenomenon in LA, although certain Amerindian populations may not be affected, suggesting that PQ could be safely used in these specific populations. Population-wide use of PQ as part of malaria elimination strategies in LA cannot be supported unless a rapid, accurate and field-deployable G6PDd diagnostic test is made available. PMID:25141282

  15. Dissimilar Deficiency of Glucose-6-Phosphate Dehydrogenase (G-6-PD) among the AFARS and the Somalis of Djibouti

    DTIC Science & Technology

    1991-01-01

    DEFICIENCY OF GLUCOSE - 6 - PHOSPHATE DEHYDROGENASE (G- 6 ...the prevalence of deficient activity of the enzyme glucose - 6 - phosphate dehydrogenase (G- 6 -PD) among - Ces difficiences enzymatiques sant plus particu...Screening for glucose - 6 - 3 - CaosBy W.H. - Hematologic diseases. In : I lunter’s Tropical phosphate dehydrogenase (G- 6 -PD) deficiency by a simple

  16. Acute haemolytic anaemia and myolysis due to G6PD deficiency.

    PubMed

    Mangat, Chetna; Inoue, Susumu; Saah, Elna; Sharman, Mahesh

    2014-09-18

    A 2-year-old African-American male patient with sickle cell trait developed cough, red coloured urine, pallor and fatigue. The patient was hospitalised. Diagnostic workup showed that he was glucose 6 phosphate dehydrogenase (G6PD) deficient in erythrocytes. He also had chest X-ray findings of pneumonia. His urine examination showed the presence of haemoglobin and myoglobin. On repeated questioning it was found that he had a moth ball in his mouth a few days prior to this medical episode. This case illustrates a rarely described complication of myolysis in G6PD deficient persons on exposure to a strong oxidant. A review of the literature showed that most people with G6PD deficiency tolerate exercise well without untoward effect in muscles. However, assay of myoglobin in urine has not been routinely performed in these patients during acute haemolytic episode, and thus it is uncertain how frequent myoglobulinaemia occurs in a similar stress situation. 2014 BMJ Publishing Group Ltd.

  17. Assessment of Point-of-Care Diagnostics for G6PD Deficiency in Malaria Endemic Rural Eastern Indonesia

    PubMed Central

    Satyagraha, Ari W.; Sadhewa, Arkasha; Elvira, Rosalie; Elyazar, Iqbal; Feriandika, Denny; Antonjaya, Ungke; Oyong, Damian; Subekti, Decy; Rozi, Ismail E.; Domingo, Gonzalo J.; Harahap, Alida R.; Baird, J. Kevin

    2016-01-01

    Background Patients infected by Plasmodium vivax or Plasmodium ovale suffer repeated clinical attacks without primaquine therapy against latent stages in liver. Primaquine causes seriously threatening acute hemolytic anemia in patients having inherited glucose-6-phosphate dehydrogenase (G6PD) deficiency. Access to safe primaquine therapy hinges upon the ability to confirm G6PD normal status. CareStart G6PD, a qualitative G6PD rapid diagnostic test (G6PD RDT) intended for use at point-of-care in impoverished rural settings where most malaria patients live, was evaluated. Methodology/Principal Findings This device and the standard qualitative fluorescent spot test (FST) were each compared against the quantitative spectrophotometric assay for G6PD activity as the diagnostic gold standard. The assessment occurred at meso-endemic Panenggo Ede in western Sumba Island in eastern Indonesia, where 610 residents provided venous blood. The G6PD RDT and FST qualitative assessments were performed in the field, whereas the quantitative assay was performed in a research laboratory at Jakarta. The median G6PD activity ≥5 U/gHb was 9.7 U/gHb and was considered 100% of normal activity. The prevalence of G6PD deficiency by quantitative assessment (<5 U/gHb) was 7.2%. Applying 30% of normal G6PD activity as the cut-off for qualitative testing, the sensitivity, specificity, positive predictive value, and negative predictive value for G6PD RDT versus FST among males were as follows: 100%, 98.7%, 89%, and 100% versus 91.7%, 92%, 55%, and 99%; P = 0.49, 0.001, 0.004, and 0.24, respectively. These values among females were: 83%, 92.7%, 17%, and 99.7% versus 100%, 92%, 18%, and 100%; P = 1.0, 0.89, 1.0 and 1.0, respectively. Conclusions/Significance The overall performance of G6PD RDT, especially 100% negative predictive value, demonstrates suitable safety for G6PD screening prior to administering hemolytic drugs like primaquine and many others. Relatively poor diagnostic performance

  18. Assessment of Point-of-Care Diagnostics for G6PD Deficiency in Malaria Endemic Rural Eastern Indonesia.

    PubMed

    Satyagraha, Ari W; Sadhewa, Arkasha; Elvira, Rosalie; Elyazar, Iqbal; Feriandika, Denny; Antonjaya, Ungke; Oyong, Damian; Subekti, Decy; Rozi, Ismail E; Domingo, Gonzalo J; Harahap, Alida R; Baird, J Kevin

    2016-02-01

    Patients infected by Plasmodium vivax or Plasmodium ovale suffer repeated clinical attacks without primaquine therapy against latent stages in liver. Primaquine causes seriously threatening acute hemolytic anemia in patients having inherited glucose-6-phosphate dehydrogenase (G6PD) deficiency. Access to safe primaquine therapy hinges upon the ability to confirm G6PD normal status. CareStart G6PD, a qualitative G6PD rapid diagnostic test (G6PD RDT) intended for use at point-of-care in impoverished rural settings where most malaria patients live, was evaluated. This device and the standard qualitative fluorescent spot test (FST) were each compared against the quantitative spectrophotometric assay for G6PD activity as the diagnostic gold standard. The assessment occurred at meso-endemic Panenggo Ede in western Sumba Island in eastern Indonesia, where 610 residents provided venous blood. The G6PD RDT and FST qualitative assessments were performed in the field, whereas the quantitative assay was performed in a research laboratory at Jakarta. The median G6PD activity ≥ 5 U/gHb was 9.7 U/gHb and was considered 100% of normal activity. The prevalence of G6PD deficiency by quantitative assessment (<5 U/gHb) was 7.2%. Applying 30% of normal G6PD activity as the cut-off for qualitative testing, the sensitivity, specificity, positive predictive value, and negative predictive value for G6PD RDT versus FST among males were as follows: 100%, 98.7%, 89%, and 100% versus 91.7%, 92%, 55%, and 99%; P = 0.49, 0.001, 0.004, and 0.24, respectively. These values among females were: 83%, 92.7%, 17%, and 99.7% versus 100%, 92%, 18%, and 100%; P = 1.0, 0.89, 1.0 and 1.0, respectively. The overall performance of G6PD RDT, especially 100% negative predictive value, demonstrates suitable safety for G6PD screening prior to administering hemolytic drugs like primaquine and many others. Relatively poor diagnostic performance among females due to mosaic G6PD phenotype is an inherent limitation

  19. Identification of Mediterranean mutation in Egyptian favism patients.

    PubMed

    Osman, H G; Zahran, F M; El-Sokkary, A M A; El-Said, A; Sabry, A M

    2014-10-01

    Identify and screen the G6PD Mediterranean mutation in favism patients by applying a Amplification Refractory Mutation System Polymerase Chain Reaction (ARMS-PCR). A total of 114 unrelated Egyptians patients were included in the present study; their ages ranged between (2-9) years with male to female ratio 4.5:1. G6PD activity was determined qualitatively from red cell hemolysate during attack. The G6PD Mediterranean mutation in patients has been identified by ARMS-PCR. G6PD deficiency was detected in 87.7%, (n=100). The frequency of G6PD Mediterranean mutation was (94.7%), (n=108). The association between G6PD deficiency and Mediterranean mutation was a highly significant. Glucose-6-phosphate dehydrogenase Mediterranean mutation is one of the most common mutations causing G6PD deficiency among Egyptian children with favism.

  20. Glucose-6-phosphate dehydrogenase deficiency.

    PubMed

    Cappellini, M D; Fiorelli, G

    2008-01-05

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common human enzyme defect, being present in more than 400 million people worldwide. The global distribution of this disorder is remarkably similar to that of malaria, lending support to the so-called malaria protection hypothesis. G6PD deficiency is an X-linked, hereditary genetic defect due to mutations in the G6PD gene, which cause functional variants with many biochemical and clinical phenotypes. About 140 mutations have been described: most are single base changes, leading to aminoacid substitutions. The most frequent clinical manifestations of G6PD deficiency are neonatal jaundice, and acute haemolytic anaemia, which is usually triggered by an exogenous agent. Some G6PD variants cause chronic haemolysis, leading to congenital non-spherocytic haemolytic anaemia. The most effective management of G6PD deficiency is to prevent haemolysis by avoiding oxidative stress. Screening programmes for the disorder are undertaken, depending on the prevalence of G6PD deficiency in a particular community.

  1. Comparative Study of Antimalarial and Other Drugs on G6PD Deficient Red Cells.

    DTIC Science & Technology

    33063 (1600 mg x day for 6 days) and WR 30090 (690 mg x day for 3- 6 days) demonstrated that these drugs were not hemolytic for G6PD deficient red cells...The studies concerning the effects of DFD on G6PD deficient red cells of the A- and B- variants were completed during the course of this contract...DFD is especially hemolytic even at low single dosages for G6PD deficient red cells of the B- type. The investigations on the new antimalarials WR

  2. Episodic ataxia and SCA6 within the same family due to the D302N CACNA1A gene mutation.

    PubMed

    Pradotto, Luca; Mencarelli, Monica; Bigoni, Matteo; Milesi, Alessandra; Di Blasio, Anna; Mauro, Alessandro

    2016-12-15

    Several dominant mutations of CACNA1A gene were associated with at least three different allelic disorders: spino-cerebellar ataxia type 6 (SCA6), episodic ataxia type 2 (EA2), and familial hemiplegic migraine-1 (FHM1). It is generally thought that loss-of-function mutations are associated with EA2, gain-of-function missense mutations with FHM1, and abnormal CAG expansions with SCA6. But, overlapping features, atypical symptoms and co-occurrence of distinct phenotypes within the same family were reported. We describe a four generation family showing different phenotypes ranging from EA2 to SCA6 and carrying the p.D302N CACNA1A gene mutation. In our family the phenotypes maintained separate and gender differences corresponding to different phenotypes were observed. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Glucose-6-phosphate dehydrogenase (G6PD) deficiency among tribal populations of India - Country scenario.

    PubMed

    Mukherjee, Malay B; Colah, Roshan B; Martin, Snehal; Ghosh, Kanjaksha

    2015-05-01

    It is believed that the tribal people, who constitute 8.6 per cent of the total population (2011 census of India), are the original inhabitants of India. Glucose-6-phosphate-dehydrogenase (G6PD) deficiency is an X-linked genetic defect, affecting around 400 million people worldwide and is characterized by considerable biochemical and molecular heterogeneity. Deficiency of this enzyme is highly polymorphic in those areas where malaria is/has been endemic. G6PD deficiency was reported from India more than 50 years ago. t0 he prevalence varies from 2.3 to 27.0 per cent with an overall prevalence of 7.7 per cent in different tribal groups. Since the tribal populations live in remote areas where malaria is/has been endemic, irrational use of antimalarial drugs could result in an increased number of cases with drug induced haemolysis. Therefore, before giving antimalarial therapy, routine screening for G6PD deficiency should be undertaken in those tribal communities where its prevalence is high.

  4. G20210A prothrombin gene mutation identified in patients with venous leg ulcers.

    PubMed

    Jebeleanu, G; Procopciuc, L

    2001-01-01

    The G20210A mutation variant of prothrombin gene is the second most frequent mutation identified in patients with deep venous thrombosis, after factor V Leiden. The risk for developing deep venous thrombosis is high in patients identified as heterozygous for G20210A mutation. In order to identify this polymorphism in the gene coding prothrombin, the 345bp fragment in the 3'- untranslated region of the prothrombin gene was amplified using amplification by polymerase chain reaction and enzymatic digestion by HindIII (restriction endonuclease enzyme). The products of amplification and enzymatic's digestion were analized using agarose gel electrophoresis. We investigated 20 patients with venous leg ulcers and we found 2 heterozygous (10%) for G20210A mutation. None of the patients in the control group had G20210A mutation. Our study confirms the presence of G20210A mutation in the Romanian population. Our study also shows the link between venous leg ulcers and this polymorphism in the prothrombin gene.

  5. Glucose-6-phosphate dehydrogenase deficiency and the sickle cell gene in Makkah, Saudi Arabia.

    PubMed

    el-Hazmi, M A; Warsy, A S; Bahakim, H H; al-Swailem, A

    1994-02-01

    This study was conducted on 689 Saudi males and females living in the Makkah area in the western province of Saudi Arabia. The frequency of severe glucose-6-phosphate dehydrogenase (G-6-PD) deficiency in the male and female populations was 0.055 and 0.042 respectively. The normal G-6-PD was G-6-PD-B+ and the G-6-PD phenotypes identified included G-6-PD-A+, G-6-PD-A-, G-6-PD-Mediterranean, and G-6-PD-Mediterranean-like at gene frequencies of 0.0288, 0.0026, 0.05497, and 0.1969 in the male population and 0.026, 0.0146, 0.0407, and 0.02606 in the female population. The main variants producing severe and mild G-6-PD deficiency were G-6-PD-Mediterranean and G-6-PD-Mediterranean-like, respectively. The sickle cell gene was identified at a frequency of 0.029 and no interaction between sickle cell and G-6-PD deficiency genes was encountered.

  6. Inactivation of the DNA repair gene O6-methylguanine-DNA methyltransferase by promoter hypermethylation is associated with G to A mutations in K-ras in colorectal tumorigenesis.

    PubMed

    Esteller, M; Toyota, M; Sanchez-Cespedes, M; Capella, G; Peinado, M A; Watkins, D N; Issa, J P; Sidransky, D; Baylin, S B; Herman, J G

    2000-05-01

    O6-methylguanine DNA methyltransferase (MGMT) is a DNA repair protein that removes mutagenic and cytotoxic adducts from the O6 position of guanine. O6-methylguanine mispairs with thymine during replication, and if the adduct is not removed, this results in conversion from a guanine-cytosine pair to an adenine-thymine pair. In vitro assays show that MGMT expression avoids G to A mutations and MGMT transgenic mice are protected against G to A transitions at ras genes. We have recently demonstrated that the MGMT gene is silenced by promoter methylation in many human tumors, including colorectal carcinomas. To study the relevance of defective MGMT function by aberrant methylation in relation to the presence of K-ras mutations, we studied 244 colorectal tumor samples for MGMT promoter hypermethylation and K-ras mutational status. Our results show a clear association between the inactivation of MGMT by promoter hypermethylation and the appearance of G to A mutations at K-ras: 71% (36 of 51) of the tumors displaying this particular type of mutation had abnormal MGMT methylation, whereas only 32% (12 of 37) of those with other K-ras mutations not involving G to A transitions and 35% (55 of 156) of the tumors without K-ras mutations demonstrated MGMT methylation (P = 0.002). In addition, MGMT loss associated with hypermethylation was observed in the small adenomas, including those that do not yet contain K-ras mutations. Hypermethylation of other genes such as p16INK4a and p14ARF was not associated with either MGMT hypermethylation or K-ras mutation. Our data suggest that epigenetic silencing of MGMT by promoter hypermethylation may lead to a particular genetic change in human cancer, specifically G to A transitions in the K-ras oncogene.

  7. [A study of PDE6B gene mutation and phenotype in Chinese cases with retinitis pigmentosa].

    PubMed

    Cui, Yun; Zhao, Kan-xing; Wang, Li; Wang, Qing; Zhang, Wei; Chen, Wei-ying; Wang, Li-ming

    2003-01-01

    To identify the mutation spectrum of phosphodiesterase beta subunit (PDE6B) gene, the incidence in Chinese patients with retinitis pigmentosa (RP) and their clinical phenotypic characteristics. Screening of mutations within PDE6B gene was performed using polymerase chain reaction-heteroduplex-single strand conformation polymorphism (PCR-SSCP) and DNA sequence in 35 autosomal recessive (AR) RP and 55 sporadic RP cases. The phenotypes of the patients with the gene mutation were examined and analyzed. Novel complex heterozygous variants of PDE6B gene in a sporadic case, a T to C transversion in codon 323 resulting in the substitution of Gly by Ser and 2 base pairs (bp: G and T) insert between the 27th-28th bp upstream of the 5'-end of exon 10 were both present in a same isolate RP. But they are not found in 100 unrelated healthy individuals. Ocular findings showed diffuse pigmentary retinal degeneration in the midperipheral and peripheral fundi, optic atrophy and vessel attenuation. Multi-focal ERG indicated that the rod function was more severely deteriorated. A mutation was found in a case with RP in a ARRP family, a G to A transversion at 19th base upstream 5'-end of exon 11 (within intron 10) of PDE6B gene. A sporadic RP carried a sequence variant of PDE6B gene, a G to C transition, at the 15th base adjacent to the 3'-end of exon l8. In another isolate case with RP was found 2 bp (GT) insert between 31st and 32nd base upstream 5'-end of exon 4 (in intron 3) of PDE6B gene. There are novel complex heterozygous mutations of PDE6B gene responsible for a sporadic RP patient in China. This gene mutation associated with rod deterioration and RP. Several DNA variants were found in introns of PDE6B gene in national population.

  8. Parental discussion of G6PD deficiency and child health: implications for clinical practice.

    PubMed

    Guan, Yue; Roter, Debra L; Huang, Aichu; Erby, Lori A H; Chien, Yin-Hsiu; Hwu, Wuh-Liang

    2014-03-01

    Parents are encouraged to discuss self-care with children affected by G6PD deficiency; however, little is known about the extent or impact of these discussions on the physical and psychosocial health of these children. The purpose of this study was to examine the nature of parental-child discussions of G6PD deficiency self-care and their relationship to child health. A quantitative cross-sectional survey of 178 Taiwanese parents of children with G6PD deficiency was conducted. The extent of parental-child self-care discussions was assessed in regards to coverage of nine key topics. Parent's G6PD deficiency status, knowledge of haemolytic anaemia symptoms and reported G6PD deficiency education from providers were examined as correlates of parental discussion. Child health was assessed with the child health questionnaire-parent form (Chinese version) and a 13-item haemolytic anaemia symptom list. Self-care discussions were positively correlated with parental G6PD deficiency status (β=2.08, p=0.03), accurate identification of haemolytic anaemia symptoms (β=0.18, p=0.01), the thoroughness and clarity of patient education (β=0.14, p<0.001) and child age (β=1.04, p<0.001). Among children reported to have experienced significant symptoms of acute haemolytic anaemia (35%), the extent of self-care discussions was positively associated with reported physical and psychosocial child health (β=1.18, p<0.001). Parental-child G6PD deficiency self-care discussions are associated with better child health, and parental involvement in these discussions is facilitated by the thoroughness and clarity of patient education received from providers.

  9. G6pd Deficiency Does Not Affect the Cytosolic Glutathione or Thioredoxin Antioxidant Defense in Mouse Cochlea.

    PubMed

    White, Karessa; Kim, Mi-Jung; Ding, Dalian; Han, Chul; Park, Hyo-Jin; Meneses, Zaimary; Tanokura, Masaru; Linser, Paul; Salvi, Richard; Someya, Shinichi

    2017-06-07

    Glucose-6-phosphate dehydrogenase (G6PD) is the first and rate-limiting enzyme of the pentose phosphate pathway; it catalyzes the conversion of glucose-6-phosphate to 6-phosphogluconate and NADP + to NADPH and is thought to be the principal source of NADPH for the cytosolic glutathione and thioredoxin antioxidant defense systems. We investigated the roles of G6PD in the cytosolic antioxidant defense in the cochlea of G6pd hypomorphic mice that were backcrossed onto normal-hearing CBA/CaJ mice. Young G6pd -deficient mice displayed a significant decrease in cytosolic G6PD protein levels and activities in the inner ears. However, G6pd deficiency did not affect the cytosolic NADPH redox state, or glutathione or thioredoxin antioxidant defense in the inner ears. No histological abnormalities or oxidative damage was observed in the cochlea of G6pd hemizygous males or homozygous females. Furthermore, G6pd deficiency did not affect auditory brainstem response hearing thresholds, wave I amplitudes or wave I latencies in young males or females. In contrast, G6pd deficiency resulted in increased activities and protein levels of cytosolic isocitrate dehydrogenase 1, an enzyme that catalyzes the conversion of isocitrate to α-ketoglutarate and NADP + to NADPH, in the inner ear. In a mouse inner ear cell line, knockdown of Idh1 , but not G6pd , decreased cell growth rates, cytosolic NADPH levels, and thioredoxin reductase activities. Therefore, under normal physiological conditions, G6pd deficiency does not affect the cytosolic glutathione or thioredoxin antioxidant defense in mouse cochlea. Under G6pd deficiency conditions, isocitrate dehydrogenase 1 likely functions as the principal source of NADPH for cytosolic antioxidant defense in the cochlea. SIGNIFICANCE STATEMENT Glucose-6-phosphate dehydrogenase (G6PD) is the first and rate-limiting enzyme of the pentose phosphate pathway; it catalyzes the conversion of glucose-6-phosphate to 6-phosphogluconate and NADP + to NADPH and

  10. Impact of the method of G6PD deficiency assessment on genetic association studies of malaria susceptibility.

    PubMed

    Johnson, Marla K; Clark, Tamara D; Njama-Meya, Denise; Rosenthal, Philip J; Parikh, Sunil

    2009-09-30

    Clinical association studies have yielded varied results regarding the impact of glucose-6-phosphate dehydrogenase (G6PD) deficiency upon susceptibility to malaria. Analyses have been complicated by varied methods used to diagnose G6PD deficiency. We compared the association between uncomplicated malaria incidence and G6PD deficiency in a cohort of 601 Ugandan children using two different diagnostic methods, enzyme activity and G6PD genotype (G202A, the predominant East African allele). Although roughly the same percentage of males were identified as deficient using enzyme activity (12%) and genotype (14%), nearly 30% of males who were enzymatically deficient were wild-type at G202A. The number of deficient females was three-fold higher with assessment by genotype (21%) compared to enzyme activity (7%). Heterozygous females accounted for the majority (46/54) of children with a mutant genotype but normal enzyme activity. G6PD deficiency, as determined by G6PD enzyme activity, conferred a 52% (relative risk [RR] 0.48, 95% CI 0.31-0.75) reduced risk of uncomplicated malaria in females. In contrast, when G6PD deficiency was defined based on genotype, the protective association for females was no longer seen (RR = 0.99, 95% CI 0.70-1.39). Notably, restricting the analysis to those females who were both genotypically and enzymatically deficient, the association of deficiency and protection from uncomplicated malaria was again demonstrated in females, but not in males (RR = 0.57, 95% CI 0.37-0.88 for females). This study underscores the impact that the method of identifying G6PD deficient individuals has upon association studies of G6PD deficiency and uncomplicated malaria. We found that G6PD-deficient females were significantly protected against uncomplicated malaria, but this protection was only seen when G6PD deficiency is described using enzyme activity. These observations may help to explain the discrepancy in some published association studies involving G6PD

  11. Glucose-6-phosphate dehydrogenase deficiency and sickle cell genes in Bisha.

    PubMed

    el-Hazmi, M A; al-Swailem, A; Warsy, A S

    1995-08-01

    This study was conducted on 820 Saudi males and females from Bisha in the western province of Saudi Arabia. Blood samples were analysed to determine the frequency of glucose-6-phosphate dehydrogenase deficiency and haemoglobin S (Hb S) genes, and to investigate interactions between the two genes. Severe G-6-PD deficiency in this population was due to G-6-PD-Mediterranean; the African variant G-6-PD-A- was not detected. The normal and common form of the enzyme was G-6-PD-B+, occurring at a frequency of 0.8444 and 0.8177 in males and females, respectively. Variants included G-6-PD-A+, G-6-PD-Mediterranean, and G-6-PD-Mediterranean-like at frequencies of 0.0043, 0.0767, and 0.0746, respectively, in males and 0.0057, 0.05413, and 0.0855, respectively, in females. Sickle cell haemoglobin (Hb S) was encountered in the homozygous (4 per cent) and heterozygous (10 per cent) states at a gene frequency of 0.0860. No interaction between G-6-PD deficiency and Hb S gene was observed. A severe haematological and clinical presentation of the Hb SS disease was encountered in the children from Bisha.

  12. Prevalence of G6PD deficiency in selected populations from two previously high malaria endemic areas of Sri Lanka

    PubMed Central

    Kapilananda, G. M. G.; Samarakoon, Dilhani; Maddevithana, Sashika; Wijesundera, Sulochana; Goonaratne, Lallindra V.; Karunaweera, Nadira D.

    2017-01-01

    Glucose-6-Phosphate Dehydrogenase (G6PD) enzyme deficiency is known to offer protection against malaria and an increased selection of mutant genes in malaria endemic regions is expected. However, anti-malarial drugs such as primaquine can cause haemolytic anaemia in persons with G6PD deficiency. We studied the extent of G6PD deficiency in selected persons attending Teaching Hospitals of Anuradhapura and Kurunegala, two previously high malaria endemic districts in Sri Lanka. A total of 2059 filter-paper blood spots collected between November 2013 and June 2014 were analysed for phenotypic G6PD deficiency using the modified WST-8/1-methoxy PMS method. Each assay was conducted with a set of controls and the colour development assessed visually as well as with a microplate reader at OD450-630nm. Overall, 142/1018 (13.95%) and 83/1041 (7.97%) were G6PD deficient in Anuradhapura and Kurunegala districts respectively. The G6PD prevalence was significantly greater in Anuradhapura when compared to Kurunegala (P<0.0001). Surprisingly, females were equally affected as males in each district: 35/313 (11.18%) males and 107/705 (15.18%) females were affected in Anuradhapura (P = 0.089); 25/313 (7.99%) males and 58/728 (7.97%) females were affected in Kurunegala (P = 0.991). Prevalence was greater among females in Anuradhapura than in Kurunegala (P<0.05), while no such difference was observed between the males (P>0.05). Severe deficiency (<10% normal) was seen among 28/1018 (2.75%) in Anuradhapura (7 males; 21 females) and 17/1041 (1.63%) in Kurunegala (7 males; 10 females). Enzyme activity between 10–30% was observed among 114/1018 (11.20%; 28 males; 86 females) in Anuradhapura while it was 66/1041 (6.34%; 18 males; 48 females) in Kurunegala. Screening and educational programmes for G6PD deficiency are warranted in these high risk areas irrespective of gender for the prevention of disease states related to this condition. PMID:28152025

  13. Prevalence of G6PD deficiency in selected populations from two previously high malaria endemic areas of Sri Lanka.

    PubMed

    Gunawardena, Sharmini; Kapilananda, G M G; Samarakoon, Dilhani; Maddevithana, Sashika; Wijesundera, Sulochana; Goonaratne, Lallindra V; Karunaweera, Nadira D

    2017-01-01

    Glucose-6-Phosphate Dehydrogenase (G6PD) enzyme deficiency is known to offer protection against malaria and an increased selection of mutant genes in malaria endemic regions is expected. However, anti-malarial drugs such as primaquine can cause haemolytic anaemia in persons with G6PD deficiency. We studied the extent of G6PD deficiency in selected persons attending Teaching Hospitals of Anuradhapura and Kurunegala, two previously high malaria endemic districts in Sri Lanka. A total of 2059 filter-paper blood spots collected between November 2013 and June 2014 were analysed for phenotypic G6PD deficiency using the modified WST-8/1-methoxy PMS method. Each assay was conducted with a set of controls and the colour development assessed visually as well as with a microplate reader at OD450-630nm. Overall, 142/1018 (13.95%) and 83/1041 (7.97%) were G6PD deficient in Anuradhapura and Kurunegala districts respectively. The G6PD prevalence was significantly greater in Anuradhapura when compared to Kurunegala (P<0.0001). Surprisingly, females were equally affected as males in each district: 35/313 (11.18%) males and 107/705 (15.18%) females were affected in Anuradhapura (P = 0.089); 25/313 (7.99%) males and 58/728 (7.97%) females were affected in Kurunegala (P = 0.991). Prevalence was greater among females in Anuradhapura than in Kurunegala (P<0.05), while no such difference was observed between the males (P>0.05). Severe deficiency (<10% normal) was seen among 28/1018 (2.75%) in Anuradhapura (7 males; 21 females) and 17/1041 (1.63%) in Kurunegala (7 males; 10 females). Enzyme activity between 10-30% was observed among 114/1018 (11.20%; 28 males; 86 females) in Anuradhapura while it was 66/1041 (6.34%; 18 males; 48 females) in Kurunegala. Screening and educational programmes for G6PD deficiency are warranted in these high risk areas irrespective of gender for the prevention of disease states related to this condition.

  14. Methods for the field evaluation of quantitative G6PD diagnostics: a review.

    PubMed

    Ley, Benedikt; Bancone, Germana; von Seidlein, Lorenz; Thriemer, Kamala; Richards, Jack S; Domingo, Gonzalo J; Price, Ric N

    2017-09-11

    Individuals with glucose-6-phosphate dehydrogenase (G6PD) deficiency are at risk of severe haemolysis following the administration of 8-aminoquinoline compounds. Primaquine is the only widely available 8-aminoquinoline for the radical cure of Plasmodium vivax. Tafenoquine is under development with the potential to simplify treatment regimens, but point-of-care (PoC) tests will be needed to provide quantitative measurement of G6PD activity prior to its administration. There is currently a lack of appropriate G6PD PoC tests, but a number of new tests are in development and are likely to enter the market in the coming years. As these are implemented, they will need to be validated in field studies. This article outlines the technical details for the field evaluation of novel quantitative G6PD diagnostics such as sample handling, reference testing and statistical analysis. Field evaluation is based on the comparison of paired samples, including one sample tested by the new assay at point of care and one sample tested by the gold-standard reference method, UV spectrophotometry in an established laboratory. Samples can be collected as capillary or venous blood; the existing literature suggests that potential differences in capillary or venous blood are unlikely to affect results substantially. The collection and storage of samples is critical to ensure preservation of enzyme activity, it is recommended that samples are stored at 4 °C and testing occurs within 4 days of collection. Test results can be visually presented as scatter plot, Bland-Altman plot, and a histogram of the G6PD activity distribution of the study population. Calculating the adjusted male median allows categorizing results according to G6PD activity to calculate standard performance indicators and to perform receiver operating characteristic (ROC) analysis.

  15. Nine different glucose-6-phosphate dehydrogenase (G6PD) variants in a Malaysian population with Malay, Chinese, Indian and Orang Asli (aboriginal Malaysian) backgrounds.

    PubMed

    Wang, Jichun; Luo, Enjie; Hirai, Makoto; Arai, Meiji; Abdul-Manan, Eas; Mohamed-Isa, Zaleha; Hidayah, Ni; Matsuoka, Hiroyuki

    2008-10-01

    The Malaysian people consist of several ethnic groups including the Malay, the Chinese, the Indian and the Orang Asli (aboriginal Malaysians). We collected blood samples from outpatients of 2 hospitals in the State of Selangor and identified 27 glucose-6-phosphate dehydrogenase (G6PD)-deficient subjects among these ethnic groups. In the Malay, G6PD Viangchan (871GA, 1311CT, IVS11 nt93TC) and G6PD Mahidol (487GA) types, which are common in Cambodia and Myanmar, respectively, were detected. The Malay also had both subtypes of G6PD Mediterranean:the Mediterranean subtype (563CT, 1311CT, IVS11 nt93TC) and the Indo-Pakistan subtype (563CT, 1311C, IVS11 nt93T). In Malaysians of Chinese background, G6PD Kaiping (1388GA), G6PD Canton (1376GT) and G6PD Gaohe (95AG), which are common in China, were detected. Indian Malaysians possessed G6PD Mediterranean (Indo-Pakistan subtype) and G6PD Namoru (208TC), a few cases of which had been reported in Vanuatu and many in India. Our findings indicate that G6PD Namoru occurs in India and flows to Malaysia up to Vanuatu. We also discovered 5 G6PD-deficient cases with 2 nucleotide substitutions of 1311CT and IVS11 nt93TC, but without amino-acid substitution in the G6PD molecule. These results indicate that the Malaysian people have incorporated many ancestors in terms of G6PD variants.

  16. Dexmedetomidine-based intravenous anesthesia of a pediatric patient with glucose-6-phosphate dehydrogenase (G6PD) deficiency: A case report.

    PubMed

    Takahashi, Nanae; Ogawa, Takashi; Wajima, Zen'ichiro; Omi, Akibumi

    2017-05-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common human enzyme defect, resulting in deficits in nicotinamide adenine dinucleotide phosphate production, an important intracellular antioxidant enzyme. G6PD-deficient subjects present with a susceptibility of erythrocytes to oxidative stress and hemolysis, and should avoid drugs or stressors that have oxidative actions. Dexmedetomidine is an anesthetic agent with antioxidant actions. A 5-year-old boy with G6PD deficiency. The patient was diagnosed with G6PD deficiency at birth. His red blood cell levels were indicating Class II G6PD activity by the World Health Organization (WHO) classification, but had no history of hemolytic anemia. Because of the patient's anxiety and hyperactivity prior to an operation for upper labial frenum resection, we performed perioperative management using intravenous sedation with dexmedetomidine, which provides upper airway patency and has an antioxidant action. There was no abnormal breathing observed during anesthesia, and arousal was smooth with stable hemodynamics. The patient had no symptoms of hemolytic anemia up to 1 week postsurgery. Antioxidant sedatives such as dexmedetomidine may be useful for reducing the risk of hemolysis after surgery in infant G6PD deficiency cases.

  17. Prevalence of glucose-6-phosphate dehydrogenase deficiency and the role of the A- variant in a Saudi population.

    PubMed

    Alharbi, Khalid Khalaf; Khan, Imran Ali

    2014-10-01

    To estimate the prevalence of glucose-6-phosphate dehydrogenase (G6PD) deficiency among Saudi men, and to establish the frequency of the two mutations/polymorphisms associated with the G6PD A- mutation--G to A at nucleotide 202 (G202A) and A to G at nucleotide 376 (A376G)--in those found to have G6PD deficiency. Blood samples were obtained from healthy male Saudi donors and screened for G6PD deficiency using a fluorescent spot test. Samples from subjects shown to be G6PD deficient and controls were then analysed for the presence of the G202A and A376G mutations on exons 4 and 5, respectively, of the G6PD gene using polymerase chain reaction followed by restriction fragment length polymorphism. A total of 2100 male subjects were screened; of these, 100 (4.76%) were shown to be G6PD deficient. The G6PD A- mutation (presence of both G202A and A376G) was observed in two (2%) of the 100 subjects with G6PD deficiency. There was no significant difference in the frequency of this mutation between those with G6PD deficiency and controls. The G6PD A- mutation (G202A and A376G) does not appear to have a role in G6PD deficiency in a Saudi population. © The Author(s) 2014 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

  18. Mutations in the glucose-6-phosphatase gene that cause glycogen storage disease type 1a

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chou, J.Y.; Lei, K.J.; Shelly, L.L.

    1994-09-01

    Glycogen storage disease (GSD) type la (von Gierke disease) is caused by the deficiency of glucose-6-phosphatase (G6Pase), the key enzyme in glucose homeostasis. The disease presents with clinical manifestations of severe hypoglycemia, hepatomegaly, growth retardation, lactic acidemia, hyperlipidemia, and hyperuricemia. We have succeeded in isolating a murine G6Pase cDNA from a normal mouse liver cDNA library by differentially screening method. We then isolated the human G6Pase cDNA and gene. To date, we have characterized the G6Pase genes of twelve GSD type la patients and uncovered a total of six different mutations. The mutations are comprised of R83C (an Arg atmore » codon 83 to a Cys), Q347X (a Gly at codon 347 to a stop codon), 459insTA (a two basepair insertion at nucleotide 459 yielding a truncated G6Pase of 129 residues), R295C (an Arg at codon 295 to a Cys), G222R (a Gly at codon 222 to an Arg) and {delta}F327 (a codon deletion for Phe-327 at nucleotides 1058 to 1060). The relative incidences of these mutations are 37.5% (R83C), 33.3% (Q347X), 16.6% (459insTA), 4.2% (G222R), 4.2% (R295C) and 4.2% ({delta}F327). Site-directed mutagenesis and transient expression assays demonstrated that the R83C, Q347X, R295C, and {delta}F327 mutations abolished whereas the G222R mutation greatly reduced G6Pase activity. We further characterized the structure-function requirements of amino acids 83, 222, and 295 in G6Pase catalysis. The identification of mutations in GSD type la patients has unequivocally established the molecular basis of the type la disorder. Knowledge of the mutations may be applied to prenatal diagnosis and opens the way for developing and evaluating new therapeutic approaches.« less

  19. Diagnostic performances of the fluorescent spot test for G6PD deficiency in newborns along the Thailand-Myanmar border: A cohort study

    PubMed Central

    Thielemans, Laurence; Gornsawun, Gornpan; Hanboonkunupakarn, Borimas; Paw, Moo Kho; Porn, Pen; Moo, Paw Khu; Van Overmeire, Bart; Proux, Stephane; Nosten, François; McGready, Rose; Carrara, Verena I.; Bancone, Germana

    2018-01-01

    Background: Glucose-6-phosphate dehydrogenase (G6PD) deficiency is an inherited enzymatic disorder associated with severe neonatal hyperbilirubinemia and acute haemolysis after exposure to certain drugs or infections. The disorder can be diagnosed phenotypically with a fluorescent spot test (FST), which is a simple test that requires training and basic laboratory equipment. This study aimed to assess the diagnostic performances of the FST used on umbilical cord blood by locally-trained staff and to compare test results of the neonates at birth with the results after one month of age. Methods: We conducted a cohort study on newborns at the Shoklo Malaria Research Unit, along the Thai-Myanmar border between January 2015 and May 2016. The FST was performed at birth on the umbilical cord blood by locally-trained staff and quality controlled by specialised technicians at the central laboratory. The FST was repeated after one month of age. Genotyping for common local G6PD mutations was carried out for all discrepant results. Results: FST was performed on 1521 umbilical cord blood samples. Quality control and genotyping revealed 10 misdiagnoses. After quality control, 10.7% of the males (84/786) and 1.2% of the females (9/735) were phenotypically G6PD deficient at birth. The FST repeated at one month of age or later diagnosed 8 additional G6PD deficient infants who were phenotypically normal at birth. Conclusions: This study shows the short-comings of the G6PD FST in neonatal routine screening and highlights the importance of training and quality control. A more conservative interpretation of the FST in male newborns could increase the diagnostic performances. Quantitative point-of-care tests might show higher sensitivity and specificity for diagnosis of G6PD deficiency on umbilical cord blood and should be investigated. PMID:29552643

  20. Diagnostic performances of the fluorescent spot test for G6PD deficiency in newborns along the Thailand-Myanmar border: A cohort study.

    PubMed

    Thielemans, Laurence; Gornsawun, Gornpan; Hanboonkunupakarn, Borimas; Paw, Moo Kho; Porn, Pen; Moo, Paw Khu; Van Overmeire, Bart; Proux, Stephane; Nosten, François; McGready, Rose; Carrara, Verena I; Bancone, Germana

    2018-01-01

    Background: Glucose-6-phosphate dehydrogenase (G6PD) deficiency is an inherited enzymatic disorder associated with severe neonatal hyperbilirubinemia and acute haemolysis after exposure to certain drugs or infections. The disorder can be diagnosed phenotypically with a fluorescent spot test (FST), which is a simple test that requires training and basic laboratory equipment. This study aimed to assess the diagnostic performances of the FST used on umbilical cord blood by locally-trained staff and to compare test results of the neonates at birth with the results after one month of age. Methods : We conducted a cohort study on newborns at the Shoklo Malaria Research Unit, along the Thai-Myanmar border between January 2015 and May 2016. The FST was performed at birth on the umbilical cord blood by locally-trained staff and quality controlled by specialised technicians at the central laboratory. The FST was repeated after one month of age. Genotyping for common local G6PD mutations was carried out for all discrepant results. Results: FST was performed on 1521 umbilical cord blood samples. Quality control and genotyping revealed 10 misdiagnoses. After quality control, 10.7% of the males (84/786) and 1.2% of the females (9/735) were phenotypically G6PD deficient at birth. The FST repeated at one month of age or later diagnosed 8 additional G6PD deficient infants who were phenotypically normal at birth. Conclusions : This study shows the short-comings of the G6PD FST in neonatal routine screening and highlights the importance of training and quality control. A more conservative interpretation of the FST in male newborns could increase the diagnostic performances. Quantitative point-of-care tests might show higher sensitivity and specificity for diagnosis of G6PD deficiency on umbilical cord blood and should be investigated.

  1. A New Glucose-6-Phosphate Dehydrogenase Variant, G6PD Orissa (44 Ala→Gly), is the Major Polymorphic Variant in Tribal Populations in India

    PubMed Central

    Kaeda, J. S.; Chhotray, G. P.; Ranjit, M. R.; Bautista, J. M.; Reddy, P. H.; Stevens, D.; Naidu, J. M.; Britt, R. P.; Vulliamy, T. J.; Luzzatto, L.; Mason, P. J.

    1995-01-01

    Deficiency of glucose-6-phosphate dehydrogenase (G6PD) is usually found at high frequencies in areas of the world where malaria has been endemic. The frequency and genetic basis of G6PD deficiency have been studied in Africa, around the Mediterranean, and in the Far East, but little such information is available about the situation in India. To determine the extent of heterogeneity of G6PD, we have studied several different Indian populations by screening for G6PD deficiency, followed by molecular analysis of deficient alleles. The frequency of G6PD deficiency varies between 3% and 15% in different tribal and urban groups. Remarkably, a previously unreported deficient variant, G6PD Orissa (44 Ala→Gly), is responsible for most of the G6PD deficiency in tribal Indian populations but is not found in urban populations, where most of the G6PD deficiency is due to the G6PD Mediterranean (188 Ser→Phe) variant. The K of G6PD Orissa is fivefold higher than that of the normal enzyme. This may be due to the fact that the alanine residue that is replaced by glycine is part of a putative coenzyme-binding site. ImagesFigure 2 PMID:8533762

  2. G6PD Deficiency Does Not Enhance Susceptibility for Acquiring Helicobacter pylori Infection in Sardinian Patients

    PubMed Central

    Dore, Maria Pina; Marras, Giuseppina; Rocchi, Chiara; Soro, Sara

    2016-01-01

    Background Subjects with glucose-6-phosphate dehydrogenase (G6PD) deficiency may be more susceptible to infections due to impaired leukocyte bactericidal activity. The disorder is common in the Mediterranean area. The aim of this study was to investigate whether G6PD deficiency may be a risk factor for acquiring H. pylori infection. Methods We performed a retrospective study. Data from clinical records of 6565 patients (2278 men and 4287 women, median age 51, range 7‒94) who underwent upper endoscopy between 2002 and 2014 were collected. H. pylori status, assessed by histology plus rapid urease test or 13C-urea breath test, and G6PD status were also reported. A multiple logistic regression model was used to investigate the association between G6PD deficiency and H. pylori infection. Results Enzyme deficiency was detected in 12% (789/6565) of the entire cohort, and more specifically in 8.3% of men and in 14.0% of women. Overall, the proportion of patients positive for H. pylori was 50.6% and 51.5% among G6PD deficient and non-deficient patients (χ² = 0.271; p = 0.315). Moreover, among G6PD-deficient and normal patients the frequency of previous H. pylori infection was similar. After adjustment for age and gender the risk for acquiring H. pylori infection was similar in G6PD-deficient and normal patients. Only age was a strong statistically significant risk predictor. Conclusions These results demonstrate for the first time that G6PD deficiency does not enhance patients’ susceptibility to acquire H. pylori infection in Sardinia. PMID:27467818

  3. G6PD deficiency alleles in a malaria-endemic region in the Western Brazilian Amazon.

    PubMed

    Dombrowski, Jamille G; Souza, Rodrigo M; Curry, Jonathan; Hinton, Laura; Silva, Natercia R M; Grignard, Lynn; Gonçalves, Ligia A; Gomes, Ana Rita; Epiphanio, Sabrina; Drakeley, Chris; Huggett, Jim; Clark, Taane G; Campino, Susana; Marinho, Claudio R F

    2017-06-15

    Plasmodium vivax parasites are the predominant cause of malaria infections in the Brazilian Amazon. Infected individuals are treated with primaquine, which can induce haemolytic anaemia in glucose-6-phosphate dehydrogenase (G6PD)-deficient individuals and may lead to severe and fatal complications. This X-linked disorder is distributed globally and is caused by allelic variants with a geographical distribution that closely reflects populations exposed historically to endemic malaria. In Brazil, few studies have reported the frequency of G6PD deficiency (G6PDd) present in malaria-endemic areas. This is particularly important, as G6PDd screening is not currently performed before primaquine treatment. The aim of this study was to determine the prevalence of G6PDd in the region of Alto do Juruá, in the Western Brazilian Amazon, an area characterized by a high prevalence of P. vivax infection. Five-hundred and sixteen male volunteers were screened for G6PDd using the fluorescence spot test (Beutler test) and CareStart™ G6PD Biosensor system. Demographic and clinical-epidemiological data were acquired through an individual interview. To assess the genetic basis of G6PDd, 24 SNPs were genotyped using the Kompetitive Allele Specific PCR assay. Twenty-three (4.5%) individuals were G6PDd. No association was found between G6PDd and the number of malaria cases. An increased risk of reported haemolysis symptoms and blood transfusions was evident among the G6PDd individuals. Twenty-two individuals had the G6PDd A(-) variant and one the G6PD A(+) variant. The Mediterranean variant was not present. Apart from one polymorphism, almost all SNPs were monomorphic or with low frequencies (0-0.04%). No differences were detected among ethnic groups. The data indicates that ~1/23 males from the Alto do Juruá could be G6PD deficient and at risk of haemolytic anaemia if treated with primaquine. G6PD A(-) is the most frequent deficiency allele in this population. These results concur

  4. National G6PD neonatal screening program in Gaza Strip of Palestine: rationale, challenges and recommendations.

    PubMed

    Sirdah, M M; Al-Kahlout, M S; Reading, N S

    2016-09-01

    Congenital genetic disorders affecting neonates or young children can have serious clinical consequences if undiagnosed and left untreated. Early detection and an accurate diagnosis are, therefore, of major importance for preventing negative patient outcomes. Even though the occurrence of each specific metabolic disorder may be rare, their collective impact of preventable complications may be of considerable importance to the public health. Our previous studies showed that glucose-6-phosphate dehydrogenase (G6PD) deficiency is a problem of public health importance that has been shown to be a predominant cause of acute hemolytic anemia requiring hospitalization in Palestinian young children in Gaza Strip. Intriguingly, the majority of these children had one of the three variants, Mediterranean(c.) (563T) , African G6PD A-(c.) (202A) (/c.) (376G) and heretofore unrecognized as a common G6PD-deficient variant G6PD Cairo(c.) (404C) . The high prevalence of G6PD deficiency, as well as dietary factors in the region that precipitate anemia, argues for a need to protect the Palestinian children from a treatable and manageable genetic and metabolic disorder. This work reviews and discusses rationales and challenges of G6PD screening program in Gaza Strip. We advocate adopting a national neonatal G6PD screening program in Gaza Strip to identify children at risk and promote wellness and health for Palestine. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  5. Red cell glucose 6-phosphate dehydrogenase deficiency in the northern region of Turkey: is G6PD deficiency exclusively a male disease?

    PubMed

    Albayrak, Canan; Albayrak, Davut

    2015-03-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is an X-linked recessive genetic defect that can cause hemolytic crisis. However, this disease affects both males and females. In Turkey, the frequency of this enzyme deficiency was reported to vary, from 0.25 to 18%, by the geographical area. Its prevalence in the northern Black Sea region of Turkey is unknown. The aims of this study were to assess the prevalence of G6PD deficiency in the northern region Turkey in children and adults with hyperbilirubinemia and hemolytic anemia. This report included a total of 976 G6PD enzyme results that were analyzed between May 2005 and January 2014. G6PD deficiency was detected in 5.0% of all patients. G6PD deficiency was significantly less frequent in females (1.9%, 6/323) than in males (6.6%, 43/653). G6PD deficiency was detected in 3.7% of infants with hyperbilirubinemia, 9.2% of children, and 4.5% of adults with hemolytic anemia. In both the newborn group and the group of children, G6PD deficiency was significantly more frequent in males. In the combined group of children (groups I and II), the proportion of males was 74% and 67% in all groups (P = .0008). In conclusion, in northern region of Turkey, G6PD deficiency is an important cause of neonatal hyperbilirubinemia and hemolytic crisis in children and adults. This study suggests that most pediatricians thought that G6PD deficiency is exclusively a male disease. For this reason, some female patients may have been undiagnosed.

  6. Safety of primaquine given to people with G6PD deficiency: systematic review of prospective studies.

    PubMed

    Uthman, Olalekan A; Graves, Patricia M; Saunders, Rachel; Gelband, Hellen; Richardson, Marty; Garner, Paul

    2017-08-22

    Haemolysis risk with single dose or short course primaquine was evaluated in glucose-6-phosphate dehydrogenase (G6PD) deficient people. Major electronic databases (to August 2016) were searched for single or short course 8-aminoquinolines (8-AQ) in (1) randomized comparisons against placebo in G6PD deficient people; and (2) observational comparisons in G6PD deficient compared to replete people. Two authors independently assessed eligibility, risk-of-bias, and extracted data. Five randomized controlled trials and four controlled observational cohorts were included. In G6PD deficient individuals, high-dose (0.75 mg/kg) PQ resulted in lower average haemoglobin levels at 7 days (mean difference [MD] -1.45 g/dl, 95% CI -2.17 to -0.74, 2 trials) and larger percentage fall from baseline to day 7 (MD -10.31%, 95% CI -17.69 to -2.92, 3 trials) compared to placebo. In G6PD deficient compared to replete people, average haemoglobin was lower at 7 days (MD -1.19 g/dl, 95% CI -1.94 to -0.44, 2 trials) and haemoglobin change from baseline to day 7 was greater (MD -9.10%, 95% CI -12.55 to -5.65, 5 trials). One small trial evaluated mid-range PQ dose (0.4-0.5 mg/kg) in G6PD deficient people, with no difference detected in average haemoglobin at day 7 compared to placebo. In one cohort comparing G6PD deficient and replete people there was a greater fall with G6PD deficiency (MD -4.99%, 95% CI -9.96 to -0.02). For low-dose PQ (0.1-0.25 mg/kg) in G6PD deficient people, haemoglobin change from baseline was similar to the placebo group (MD 1.72%, 95% CI -1.89 to 5.34, 2 trials). Comparing low dose PQ in G6PD deficient with replete people, the average haemoglobin was lower in the G6PD deficient group at 7 days (-0.57 g (95% CI -0.97 to -0.17, 1 trial)); although change from baseline was similar (MD -1.45%, 95% CI -5.69 to 2.78, 3 trials). Falls in average haemoglobin are less marked with the 0.1 to 0.25 mg/kg PQ than with the 0.75 mg/kg dose, and severe haemolytic events are

  7. Parkin dosage mutations have greater pathogenicity in familial PD than simple sequence mutations

    PubMed Central

    Pankratz, N; Kissell, D K.; Pauciulo, M W.; Halter, C A.; Rudolph, A; Pfeiffer, R F.; Marder, K S.; Foroud, T; Nichols, W C.

    2009-01-01

    Objective: Mutations in both alleles of parkin have been shown to result in Parkinson disease (PD). However, it is unclear whether haploinsufficiency (presence of a mutation in only 1 of the 2 parkin alleles) increases the risk for PD. Methods: We performed comprehensive dosage and sequence analysis of all 12 exons of parkin in a sample of 520 independent patients with familial PD and 263 controls. We evaluated whether presence of a single parkin mutation, either a sequence (point mutation or small insertion/deletion) or dosage (whole exon deletion or duplication) mutation, was found at increased frequency in cases as compared with controls. We then compared the clinical characteristics of cases with 0, 1, or 2 parkin mutations. Results: We identified 55 independent patients with PD with at least 1 parkin mutation and 9 controls with a single sequence mutation. Cases and controls had a similar frequency of single sequence mutations (3.1% vs 3.4%, p = 0.83); however, the cases had a significantly higher rate of dosage mutations (2.6% vs 0%, p = 0.009). Cases with a single dosage mutation were more likely to have an earlier age at onset (50% with onset at ≤45 years) compared with those with no parkin mutations (10%, p = 0.00002); this was not true for cases with only a single sequence mutation (25% with onset at ≤45 years, p = 0.06). Conclusions: Parkin haploinsufficiency, specifically for a dosage mutation rather than a point mutation or small insertion/deletion, is a risk factor for familial PD and may be associated with earlier age at onset. GLOSSARY ADL = Activities of Daily Living; GDS = Geriatric Depression Scale; MLPA = multiplex ligation-dependent probe amplification; MMSE = Mini-Mental State Examination; PD = Parkinson disease; UPDRS = Unified Parkinson’s Disease Rating Scale. PMID:19636047

  8. Cellular glucose-6-phosphate dehydrogenase (G6PD) status modulates the effects of nitric oxide (NO) on human foreskin fibroblasts.

    PubMed

    Cheng, M L; Ho, H Y; Liang, C M; Chou, Y H; Stern, A; Lu, F J; Chiu, D T

    2000-06-23

    Glucose-6-phosphate dehydrogenase (G6PD) plays an important role in cellular redox homeostasis, which is crucial for cell survival. In the present study, we found that G6PD status determines the response of cells exposed to nitric oxide (NO) donor. Treatment with NO donor, sodium nitroprusside (SNP), caused apoptosis in G6PD-deficient human foreskin fibroblasts (HFF1), whereas it was growth stimulatory in the normal counterpart (HFF3). Such effects were abolished by NO scavengers like hemoglobin. Ectopic expression of G6PD in HFF1 cells switched the cellular response to NO from apoptosis to growth stimulation. Experiments with 1H-¿1,2,4ŏxadiazolo¿4, 3-aquinoxalin-1-one and 8-bromo-cGMP showed that the effects of NO on HFF1 and HFF3 cells were independent of cGMP signalling pathway. Intriguingly, trolox prevented the SNP-induced apoptosis in HFF1 cells. These data demonstrate that G6PD plays a critical role in regulation of cell growth and survival.

  9. Phenotype in a patient with p.D50N mutation in GJB2 gene resemble both KID and Clouston syndromes.

    PubMed

    Markova, T G; Brazhkina, N B; Bliznech, E A; Bakhshinyan, V V; Polyakov, A V; Tavartkiladze, G A

    2016-02-01

    Keratitis-ichthyosis-deafness (KID) syndrome (OMIM 148210) is a rare ectodermal dysplasia syndrome characterized by vascularizing keratitis, congenital profound sensorineural hearing loss, and progressive erythrokeratoderma. We have found a 148G-A transition in the GJB2 gene, resulting in an asp50-to-asn (D50N) substitution in a girl with congenital deafness. This finding allowed us to diagnose а KID syndrome. But clinical features were uncommon because of a mild skin manifestation, lack of keratitis and unusual appearance resembling Clouston syndrome. Molecular genetic tests showed that it was de novo mutation because parents have normal genotype. Several autosomal dominant mutations in the GJB2 gene (сonnexin 26) now established to underlie many of the affected cases, with the majority of patients harboring the p.D50N mutation. Skin disease-associated mutation of connexin proteins can cause functional disturbances in gap junction intercellular conductance. It is likely that multiple disease mechanisms are involved across the wide spectrum of hereditary diseases relating to connexin proteins. The clinical data may provide additional insights into the dysregulation mechanisms of mutations result in the disease. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  10. Molecular Epidemiological Survey of Glucose-6-Phosphate Dehydrogenase Deficiency and Thalassemia in Uygur and Kazak Ethnic Groups in Xinjiang, Northwest China.

    PubMed

    Han, Luhao; Su, Hai; Wu, Hao; Jiang, Weiying; Chen, Suqin

    2016-06-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency and thalassemia occur frequently in tropical and subtropical regions, while the prevalence of relationship between the two diseases in Xinjiang has not been reported. We aimed to determine the prevalence of these diseases and clarify the relationship between genotypes and phenotypes of the two diseases in the Uygur and Kazak ethnic groups in Xinjiang. We measured G6PD activity by G6PD:6PGD (glucose acid-6-phosphate dehydrogenase) ratio, identified the gene variants of G6PD and α- and β-globin genes by polymerase chain reaction (PCR)-DNA sequencing and gap-PCR and compared these variants in different ethnic groups in Xinjiang with those adjacent to it. Of the 149 subjects with molecular analysis of G6PD deficiency conducted, a higher prevalence of the combined mutations c.1311C > T/IVSXI + 93T > C and IVSXI + 93T > C, both with normal enzymatic activities, were observed in the Uygur and Kazak subjects. A case of rare mutation HBB: c.135delC [codon 44 (-C) in the heterozygous state], a heterozygous case of HBB: c.68A > G [Hb G-Taipei or β22(B4)Glu→Gly] and several common single nucleotide polymorphisms (SNPs) were found on the β-globin gene. In conclusion, G6PD deficiency with pathogenic mutations and three common α-thalassemia (α-thal) [- -(SEA), -α(3.7) (rightward), -α(4.2) (leftward)] deletions and point mutations of the α-globin gene were not detected in the present study. The average incidence of β-thalassemia (β-thal) in Uygurs was 1.45% (2/138) in Xinjiang. The polymorphisms of G6PD and β-globin genes might be useful genetic markers to trace the origin and migration of the Uygur and Kazak in Xinjiang.

  11. Genetic Profiles of Korean Patients With Glucose-6-Phosphate Dehydrogenase Deficiency.

    PubMed

    Lee, Jaewoong; Park, Joonhong; Choi, Hayoung; Kim, Jiyeon; Kwon, Ahlm; Jang, Woori; Chae, Hyojin; Kim, Myungshin; Kim, Yonggoo; Lee, Jae Wook; Chung, Nack Gyun; Cho, Bin

    2017-03-01

    We describe the genetic profiles of Korean patients with glucose-6-phosphate dehydrogenase (G6PD) deficiencies and the effects of G6PD mutations on protein stability and enzyme activity on the basis of in silico analysis. In parallel with a genetic analysis, the pathogenicity of G6PD mutations detected in Korean patients was predicted in silico. The simulated effects of G6PD mutations were compared to the WHO classes based on G6PD enzyme activity. Four previously reported mutations and three newly diagnosed patients with missense mutations were estimated. One novel mutation (p.Cys385Gly, labeled G6PD Kangnam) and two known mutations [p.Ile220Met (G6PD São Paulo) and p.Glu416Lys (G6PD Tokyo)] were identified in this study. G6PD mutations identified in Koreans were also found in Brazil (G6PD São Paulo), Poland (G6PD Seoul), United States of America (G6PD Riley), Mexico (G6PD Guadalajara), and Japan (G6PD Tokyo). Several mutations occurred at the same nucleotide, but resulted in different amino acid residue changes in different ethnic populations (p.Ile380 variant, G6PD Calvo Mackenna; p.Cys385 variants, Tomah, Madrid, Lynwood; p.Arg387 variant, Beverly Hills; p.Pro396 variant, Bari; and p.Pro396Ala in India). On the basis of the in silico analysis, Class I or II mutations were predicted to be highly deleterious, and the effects of one Class IV mutation were equivocal. The genetic profiles of Korean individuals with G6PD mutations indicated that the same mutations may have arisen by independent mutational events, and were not derived from shared ancestral mutations. The in silico analysis provided insight into the role of G6PD mutations in enzyme function and stability.

  12. Comprehensive cancer-gene panels can be used to estimate mutational load and predict clinical benefit to PD-1 blockade in clinical practice.

    PubMed

    Campesato, Luís Felipe; Barroso-Sousa, Romualdo; Jimenez, Leandro; Correa, Bruna R; Sabbaga, Jorge; Hoff, Paulo M; Reis, Luiz F L; Galante, Pedro Alexandre F; Camargo, Anamaria A

    2015-10-27

    Cancer gene panels (CGPs) are already used in clinical practice to match tumor's genetic profile with available targeted therapies. We aimed to determine if CGPs could also be applied to estimate tumor mutational load and predict clinical benefit to PD-1 and CTLA-4 checkpoint blockade therapy. Whole-exome sequencing (WES) mutation data obtained from melanoma and non-small cell lung cancer (NSCLC) patients published by Snyder et al. 2014 and Rizvi et al. 2015, respectively, were used to select nonsynonymous somatic mutations occurring in genes included in the Foundation Medicine Panel (FM-CGP) and in our own Institutional Panel (HSL-CGP). CGP-mutational load was calculated for each patient using both panels and was associated with clinical outcomes as defined and reported in the original articles. Higher CGP-mutational load was observed in NSCLC patients presenting durable clinical benefit (DCB) to PD-1 blockade (FM-CGP P=0.03, HSL-CGP P=0.01). We also observed that 69% of patients with high CGP-mutational load experienced DCB to PD-1 blockade, as compared to 20% of patients with low CGP-mutational load (FM-CGP and HSL-CGP P=0.01). Noteworthy, predictive accuracy of CGP-mutational load for DCB was not statistically different from that estimated by WES sequencing (P=0.73). Moreover, a high CGP-mutational load was significantly associated with progression-free survival (PFS) in patients treated with PD-1 blockade (FM-CGP P=0.005, HR 0.27, 95% IC 0.105 to 0.669; HSL-CGP P=0.008, HR 0.29, 95% IC 0.116 to 0.719). Similar associations between CGP-mutational load and clinical benefit to CTLA-4 blockade were not observed. In summary, our data reveals that CGPs can be used to estimate mutational load and to predict clinical benefit to PD-1 blockade, with similar accuracy to that reported using WES.

  13. Adverse effects of herbal or dietary supplements in G6PD deficiency: a systematic review.

    PubMed

    Lee, Shaun Wen Huey; Lai, Nai Ming; Chaiyakunapruk, Nathorn; Chong, David Weng Kwai

    2017-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a common genetic disorder, affecting nearly 400 million individuals worldwide. Whilst it is known that a number of drugs, foods and chemicals can trigger haemolysis in G6PD deficient individuals, the association between herbal and dietary supplements and haemolysis is less clear. The objective of this study was to evaluate the association between herbal or dietary supplements and adverse events in G6PD deficient individuals. We searched 14 electronic databases from their inception until November 2015 for articles describing the use of herbal or dietary supplements in G6PD deficient individuals. Additional publications were identified from manually searching textbooks, conference abstracts and the grey literature. All study designs were included as long as they contained clinical information. These gathered findings were summarized narratively. Thirty-two publications met inclusion criteria. These reported on 10 herbal and dietary supplements. Overall evidence linking haemolysis to a herbal/dietary supplement was only found for henna. No evidence of harm was observed for vitamin C, vitamin E, vitamin K, Gingko biloba and α-lipoic acid. The review showed that there was insufficient evidence to contravene the use of most herbal or dietary products at therapeutic doses in G6PD deficient subjects. © 2016 The British Pharmacological Society.

  14. Glucose-6-Phosphate Dehydrogenase Deficiency.

    PubMed

    Luzzatto, Lucio; Nannelli, Caterina; Notaro, Rosario

    2016-04-01

    G6PD is a housekeeping gene expressed in all cells. Glucose-6-phosphate dehydrogenase (G6PD) is part of the pentose phosphate pathway, and its main physiologic role is to provide NADPH. G6PD deficiency, one of the commonest inherited enzyme abnormalities in humans, arises through one of many possible mutations, most of which reduce the stability of the enzyme and its level as red cells age. G6PD-deficient persons are mostly asymptomatic, but they can develop severe jaundice during the neonatal period and acute hemolytic anemia when they ingest fava beans or when they are exposed to certain infections or drugs. G6PD deficiency is a global health issue. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. Clinical Pharmacogenetics Implementation Consortium (CPIC) guidelines for rasburicase therapy in the context of G6PD deficiency genotype.

    PubMed

    Relling, M V; McDonagh, E M; Chang, T; Caudle, K E; McLeod, H L; Haidar, C E; Klein, T; Luzzatto, L

    2014-08-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is associated with development of acute hemolytic anemia (AHA) induced by a number of drugs. We provide guidance as to which G6PD genotypes are associated with G6PD deficiency in males and females. Rasburicase is contraindicated in G6PD-deficient patients due to the risk of AHA and possibly methemoglobinemia. Unless preemptive genotyping has established a positive diagnosis of G6PD deficiency, quantitative enzyme assay remains the mainstay of screening prior to rasburicase use. The purpose of this article is to help interpret the results of clinical G6PD genotype tests so that they can guide the use of rasburicase. Detailed guidelines on other aspects of the use of rasburicase, including analyses of cost-effectiveness, are beyond the scope of this document. Clinical Pharmacogenetics Implementation Consortium (CPIC) guidelines are published and updated periodically on https://www.pharmgkb.org/page/cpic to reflect new developments in the field.

  16. Parkinson Disease Phenotype in Ashkenazi Jews with and without LRRK2 G2019S mutations

    PubMed Central

    Alcalay, Roy N.; Mirelman, Anat; Saunders-Pullman, Rachel; Tang, Ming-X; Santana, Helen Mejia; Raymond, Deborah; Roos, Ernest; Orbe-Reilly, Martha; Gurevich, Tanya; Shira, Anat Bar; Weisz, Mali Gana; Yasinovsky, Kira; Zalis, Maayan; Thaler, Avner; Deik, Andres; Barrett, Matthew James; Cabassa, Jose; Groves, Mark; Hunt, Ann L.; Lubarr, Naomi; Luciano, Marta San; Miravite, Joan; Palmese, Christina; Sachdev, Rivka; Sarva, Harini; Severt, Lawrence; Shanker, Vicki; Swan, Matthew Carrington; Soto-Valencia, Jeannie; Johannes, Brooke; Ortega, Robert; Fahn, Stanley; Cote, Lucien; Waters, Cheryl; Mazzoni, Pietro; Ford, Blair; Louis, Elan; Levy, Oren; Rosado, Llency; Ruiz, Diana; Dorovski, Tsvyatko; Pauciulo, Michael; Nichols, William; Orr-Urtreger, Avi; Ozelius, Laurie; Clark, Lorraine; Giladi, Nir; Bressman, Susan; Marder, Karen S

    2013-01-01

    Background The phenotype of Parkinson disease (PD) patients with and without LRRK2 G2019S mutations is reported to be similar; however large uniformly evaluated series are lacking. Objective To characterize the clinical phenotype of Ashkenazi Jewish (AJ) PD carriers of the LRRK2 G2019S mutation. Methods We studied 553 AJ PD patients, including 65 patients who were previously reported, from three sites (two in New York and one in Tel-Aviv). GBA mutation carriers were excluded. Evaluations included the Montreal Cognitive Assessment (MoCA), the Unified Parkinson's Disease Rating Scale (UPDRS), the geriatric depression scale (GDS) and the non-motor symptoms (NMS) questionnaire. Regression models were constructed to test the association between clinical and demographic features and LRRK2 status (outcome) in 488 newly recruited participants. Results LRRK2 G2019S carriers (n=97) and non-carriers (n=391) were similar in age and age-at-onset of PD. Carriers had longer disease duration (8.6years versus 6.1years, p<0.001), were more likely to be women (51.5% versus 37.9%, p=0.015) and more often reported first symptoms in lower extremities (40.0% versus 19.2%, p<0.001). In logistic models adjusted for age, disease duration, gender, education, and site, carriers were more likely to have lower extremity onset (p<0.001), postural instability gait difficulty (PIGD, p=0.043) and persistent levodopa response for>5 years (p=0.042). Performance on UPDRS, MoCA, GDS and NMS did not differ by mutation status. Conclusion PD in AJ-LRRK2 G2019S mutation carriers is similar to idiopathic PD, but characterized by more frequent lower extremity involvement at onset and PIGD without the associated cognitive impairment. PMID:24243757

  17. Genotypic and phenotypic characterization of G6PD deficiency in Bengali adults with severe and uncomplicated malaria.

    PubMed

    Plewes, Katherine; Soontarawirat, Ingfar; Ghose, Aniruddha; Bancone, Germana; Kingston, Hugh W F; Herdman, M Trent; Leopold, Stije J; Ishioka, Haruhiko; Faiz, Md Abul; Anstey, Nicholas M; Day, Nicholas P J; Hossain, Md Amir; Imwong, Mallika; Dondorp, Arjen M; Woodrow, Charles J

    2017-03-29

    Control of malaria increasingly involves administration of 8-aminoquinolines, with accompanying risk of haemolysis in individuals with glucose-6-phosphate dehydrogenase (G6PD) deficiency. Few data on the prevalence and genotypic basis of G6PD deficiency are available from Bangladesh, where malaria remains a major problem in the South (Chittagong Division). The aim of this study was to determine the prevalence of G6PD deficiency, and associated G6PD genotypes, in adults with falciparum malaria in southern Bangladesh. G6PD status was assessed via a combination of fluorescent spot testing (FST) and genotyping in 141 Bengali patients admitted with falciparum malaria to two centres in Chittagong Division from 2012 to 2014. In addition, an analysis of genomic data from 1000 Genomes Project was carried out among five healthy Indian subcontinent populations. One male patient with uncomplicated malaria was found to have G6PD deficiency on FST and a genotype associated with deficiency (hemizygous Orissa variant). In addition, there were two female patients heterozygous for deficiency variants (Orissa and Kerala-Kalyan). These three patients had a relatively long duration of symptoms prior to admission compared to G6PD normal cases, possibly suggesting an interaction with parasite multiplication rate. In addition, one of 27 healthy local controls was deficient on FST and hemizygous for the Mahidol variant of G6PD deficiency. Examination of 1000 Genomes Project sequencing data across the Indian subcontinent showed that 19/723 chromosomes (2.63%) carried a variant associated with deficiency. In the Bengali from Bangladesh 1000 Genomes population, three of 130 chromosomes (2.31%) carried deficient alleles; this included single chromosomes carrying the Kerala-Kalyan and Orissa variants. In line with other recent work, G6PD deficiency is uncommon in Bengalis in Bangladesh. Further studies of particular ethnic groups are needed to evaluate the potential risk of wide deployment of

  18. Comparison of Spectrophotometry, Chromate Inhibition, and Cytofluorometry Versus Gene Sequencing for Detection of Heterozygously Glucose-6-Phosphate Dehydrogenase-Deficient Females.

    PubMed

    Peters, Anna L; Veldthuis, Martijn; van Leeuwen, Karin; Bossuyt, Patrick M M; Vlaar, Alexander P J; van Bruggen, Robin; de Korte, Dirk; Van Noorden, Cornelis J F; van Zwieten, Rob

    2017-11-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common enzyme deficiency worldwide. Detection of heterozygously deficient females can be difficult as residual activity in G6PD-sufficient red blood cells (RBCs) can mask deficiency. In this study, we compared accuracy of 4 methods for detection of G6PD deficiency in females. Blood samples from females more than 3 months of age were used for spectrophotometric measurement of G6PD activity and for determination of the percentage G6PD-negative RBCs by cytofluorometry. An additional sample from females suspected to have G6PD deficiency based on the spectrophotometric G6PD activity was used for measuring chromate inhibition and sequencing of the G6PD gene. Of 165 included females, 114 were suspected to have heterozygous deficiency. From 75 females, an extra sample was obtained. In this group, mutation analysis detected 27 heterozygously deficient females. The sensitivity of spectrophotometry, cytofluorometry, and chromate inhibition was calculated to be 0.52 (confidence interval [CI]: 0.32-0.71), 0.85 (CI: 0.66-0.96), and 0.96 (CI: 0.71-1.00, respectively, and the specificity was 1.00 (CI: 0.93-1.00), 0.88 (CI: 0.75-0.95), and 0.98 (CI: 0.89-1.00), respectively. Heterozygously G6PD-deficient females with a larger percentage of G6PD-sufficient RBCs are missed by routine methods measuring total G6PD activity. However, the majority of these females can be detected with both chromate inhibition and cytofluorometry.

  19. Increased Oxidative Stress Markers in Cerebrospinal Fluid from Healthy Subjects with Parkinson's Disease-Associated LRRK2 Gene Mutations.

    PubMed

    Loeffler, David A; Klaver, Andrea C; Coffey, Mary P; Aasly, Jan O; LeWitt, Peter A

    2017-01-01

    Mutations in the leucine-rich repeat kinase 2 ( LRRK2 ) gene are the most frequent cause of inherited Parkinson's disease (PD). The most common PD-associated LRRK2 mutation, G2019S, induces increased production of reactive oxygen species in vitro . We therefore hypothesized that individuals with PD-associated LRRK2 mutations might have increased concentrations of oxidative stress markers and/or decreased total antioxidant capacity (TAC) in their cerebrospinal fluid (CSF). We measured two oxidative stress markers, namely 8-hydroxy-2'-deoxyguanosine (8-OHdG) and 8-isoprostane (8-ISO), and TAC in CSF from LRRK2 mutation-bearing PD patients ( LRRK2 PD = 19), sporadic PD patients (sPD = 31), and healthy control subjects with or without these mutations ( LRRK2 CTL = 30, CTL = 27). 8-OHdG and 8-ISO levels were increased in LRRK2 CTL subjects, while TAC was similar between groups. 8-ISO was negatively correlated, and TAC was positively correlated, with Montreal Cognitive Assessment scores in LRRK2 PD, LRRK2 CTL, and CTL subjects. Correlations in both groups of PD patients between the two oxidative stress markers and Unified Parkinson Disease Rating Scale Total scores were weak, while TAC was negatively correlated with these scores. These findings suggest that oxidative stress may be increased in the CNS in healthy individuals with PD-associated LRRK2 mutations. Further, TAC may decrease in the CNS with the progression of PD, and when cognitive impairment is present regardless of the presence or absence of PD.

  20. [G6PD deficiency among children under 7 years old from Yunnan with unique ethnic minority origin].

    PubMed

    Yao, Li-qin; Zou, Tuan-biao; Wang, Xing-tian; Quan, Xing; Chen, Qian; Yang, Fa-bin; Hu, Li-sha; Fan, Li-mei; Wang, Min; Feng, Xi-yun; Liu, Jin-tao; Zhao, Zhong-ming

    2013-04-01

    To investigate the epidemiological status of glucose-6-phosphate dehydrogenase (G6PD) deficiency among children from Yunnan with unique ethnic origins. DNA samples from 11759 children were tested with fluorescent spot test, G6PD/6PGD quantitative ratio assay and hemoglobin electrophoresis. The detection rate of G6PD deficiency was 2.5%, for which boys were significantly greater than girls (3.5% vs. 1.4%, P<0.05). Significant differences were also detected among children from different ethnic groups and different regions. For ethnic Han Chinese, the detection rate was 0.7%, which was lower than the majority of ethnic minorities. By regression analysis, altitude of residence and family history both have significant influence on the calculated rate. Occurrence of G6PD deficiency seems to be influenced by gender. It also varies substantially between different ethnic groups as well as regions, e.g., more common in south. It also showed a declining trend after years of diagnosis and intervention. This survey may provide a valuable basis for counseling of G6PD deficiency in Yunnan.

  1. Genetic Profiles of Korean Patients With Glucose-6-Phosphate Dehydrogenase Deficiency

    PubMed Central

    Lee, Jaewoong; Choi, Hayoung; Kim, Jiyeon; Kwon, Ahlm; Jang, Woori; Chae, Hyojin; Kim, Myungshin; Kim, Yonggoo; Lee, Jae Wook; Chung, Nack-Gyun

    2017-01-01

    Background We describe the genetic profiles of Korean patients with glucose-6-phosphate dehydrogenase (G6PD) deficiencies and the effects of G6PD mutations on protein stability and enzyme activity on the basis of in silico analysis. Methods In parallel with a genetic analysis, the pathogenicity of G6PD mutations detected in Korean patients was predicted in silico. The simulated effects of G6PD mutations were compared to the WHO classes based on G6PD enzyme activity. Four previously reported mutations and three newly diagnosed patients with missense mutations were estimated. Results One novel mutation (p.Cys385Gly, labeled G6PD Kangnam) and two known mutations [p.Ile220Met (G6PD São Paulo) and p.Glu416Lys (G6PD Tokyo)] were identified in this study. G6PD mutations identified in Koreans were also found in Brazil (G6PD São Paulo), Poland (G6PD Seoul), United States of America (G6PD Riley), Mexico (G6PD Guadalajara), and Japan (G6PD Tokyo). Several mutations occurred at the same nucleotide, but resulted in different amino acid residue changes in different ethnic populations (p.Ile380 variant, G6PD Calvo Mackenna; p.Cys385 variants, Tomah, Madrid, Lynwood; p.Arg387 variant, Beverly Hills; p.Pro396 variant, Bari; and p.Pro396Ala in India). On the basis of the in silico analysis, Class I or II mutations were predicted to be highly deleterious, and the effects of one Class IV mutation were equivocal. Conclusions The genetic profiles of Korean individuals with G6PD mutations indicated that the same mutations may have arisen by independent mutational events, and were not derived from shared ancestral mutations. The in silico analysis provided insight into the role of G6PD mutations in enzyme function and stability. PMID:28028996

  2. Molecular characterization of glucose-6-phosphate dehydrogenase deficiency among Jordanians.

    PubMed

    Al-Sweedan, Suleimman A; Awwad, Nor

    2012-01-01

    In Jordan, glucose-6-phosphate dehydrogenase (G6PD) deficiency is a significant health problem, and the incidence was reported to be about 3.6%. The aims of this study are to investigate the most common molecular mutations of the G6PD gene among Jordanians in northern Jordan and to examine the correlation between the genotype and phenotype of this enzyme deficiency. Seventy-five blood samples were collected from patients attending King Abdullah University Hospital and Princess Rahma Teaching Hospital. The G6PD gene was scanned for mutations using a DNA sequencing technique. Our results showed 11 variations (7 exonic and 4 intronic) as follows: c.202 G>A (rs1050828), c.376 A>G (rs1050829), c.404 A>C (CM962574 single-nucleotide polymorphism), c.542 A>T (rs5030872), c.563 C>T (rs5030868), c.1003 G>A (rs5030869), c.1311 C>T (rs2230037), c.486-90 C>T, c.486-60 C>G (rs2515904), c.770+175 C>T (rs2515905) and c.1311 C>T (rs2230037). Among these, G6PD Mediterranean (c.563 C>T) was the most common in our patients, with a frequency of 76.2%, followed by G6PD A- (c.202 G>A + c.376 A>G) with 19%, and an equal frequency of 1.6% was found for G6PD Chatham (c.1003 G>A), G6PD Santamaria (c.542 A>T + c.376 A>G) and G6PD Cairo (c.404 A>C). This is the first report of G6PD Santamaria and Cairo among our Jordanian population. Copyright © 2012 S. Karger AG, Basel.

  3. Detailed functional analysis of two clinical glucose-6-phosphate dehydrogenase (G6PD) variants, G6PDViangchan and G6PDViangchan+Mahidol: Decreased stability and catalytic efficiency contribute to the clinical phenotype.

    PubMed

    Boonyuen, Usa; Chamchoy, Kamonwan; Swangsri, Thitiluck; Saralamba, Naowarat; Day, Nicholas P J; Imwong, Mallika

    2016-06-01

    Deficiency of glucose-6-phosphate dehydrogenase (G6PD) is an X-linked hereditary genetic defect that is the most common polymorphism and enzymopathy in humans. To investigate functional properties of two clinical variants, G6PDViangchan and G6PDViangchan+Mahidol, these two mutants were created by overlap-extension PCR, expressed in Escherichia coli and purified to homogeneity. We describe an overexpression and purification method to obtain substantial amounts of functionally active protein. The KM for G6P of the two variants was comparable to the KM of the native enzyme, whereas the KM for NADP(+) was increased 5-fold for G6PDViangchan and 8-fold for G6PDViangchan+Mahidol when compared with the native enzyme. Additionally, kcat of the mutant enzymes was markedly reduced, resulting in a 10- and 18-fold reduction in catalytic efficiency for NADP(+) catalysis for G6PDViangchan and G6PDViangchan+Mahidol, respectively. Furthermore, the two variants demonstrated significant reduction in thermostability, but similar susceptibility to trypsin digestion, when compared with the wild-type enzyme. The presence of NADP(+) is shown to improve the stability of G6PD enzymes. This is the first report indicating that protein instability and reduced catalytic efficiency are responsible for the reduced catalytic activity of G6PDViangchan and G6PDViangchan+Mahidol and, as a consequence, contribute to the clinical phenotypes of these two clinical variants. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  4. A mitochondrial DNA (mtDNA) mutation associated with maternally inherited Parkinson`s disease (PD) and deafness

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shoffner, J.M.; Brown, M.; Huoponen, K.

    1994-09-01

    A pedigree was characterized in which PD and deafness is expressed along the maternal lineage. The proband is 74 years old and has PD. Her mother and 3 of 7 siblings have PD and a maternal lineage cousin may have early signs of PD. The proband`s mother, a sibling, and all four of her daughters have premature deafness. Since manifestations of PD begin after 50 years of age, the 30-40 year old daughters have not reached an age where extrapyramidal symptoms are likely to appear. Although all 4 daughters have premature deafness, one daughter experienced a rapid reduction of hermore » hearing after receiving a short course during childhood of the aminoglycoside streptomycin. Muscle biopsies from the proband who has PD and 3 daughters with deafness revealed normal histology. Oxidative phosphorylation biochemistry showed Complex I and IV defects in the proband and 2 daughters and a Complex I defect in the other daughter. The proband`s mtDNA was sequenced. Of the nucleotide variants observed, the only significant nucleotide change was a homoplasmic A-to-G point mutation in the 12S rRNA gene at position 1555 of the mtDNA. This site is homologous to the E. coli aminoglycoside binding site and has been found in a large Arab-Israeli pedigree with spontaneously occurring deafness and three Chinese pedigrees with aminoglycoside-induced deafness. Hence, this family shows a direct link between PD, deafness, Complex I and IV defects, and a mutation in a gene that functions in mitochondrial protein synthesis. Furthermore, the interaction between aminoglycosides and the mtDNA in a manner that augments the pathogenic effects of this mutation provides an excellent example of how environmental toxins and mtDNA mutations can interact to give a spectrum of clinical presentations.« less

  5. Functional and Biochemical Characterization of Three Recombinant Human Glucose-6-Phosphate Dehydrogenase Mutants: Zacatecas, Vanua-Lava and Viangchan.

    PubMed

    Gómez-Manzo, Saúl; Marcial-Quino, Jaime; Vanoye-Carlo, America; Serrano-Posada, Hugo; González-Valdez, Abigail; Martínez-Rosas, Víctor; Hernández-Ochoa, Beatriz; Sierra-Palacios, Edgar; Castillo-Rodríguez, Rosa Angélica; Cuevas-Cruz, Miguel; Rodríguez-Bustamante, Eduardo; Arreguin-Espinosa, Roberto

    2016-05-21

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency in humans causes severe disease, varying from mostly asymptomatic individuals to patients showing neonatal jaundice, acute hemolysis episodes or chronic nonspherocytic hemolytic anemia. In order to understand the effect of the mutations in G6PD gene function and its relation with G6PD deficiency severity, we report the construction, cloning and expression as well as the detailed kinetic and stability characterization of three purified clinical variants of G6PD that present in the Mexican population: G6PD Zacatecas (Class I), Vanua-Lava (Class II) and Viangchan (Class II). For all the G6PD mutants, we obtained low purification yield and altered kinetic parameters compared with Wild Type (WT). Our results show that the mutations, regardless of the distance from the active site where they are located, affect the catalytic properties and structural parameters and that these changes could be associated with the clinical presentation of the deficiency. Specifically, the structural characterization of the G6PD Zacatecas mutant suggests that the R257L mutation have a strong effect on the global stability of G6PD favoring an unstable active site. Using computational analysis, we offer a molecular explanation of the effects of these mutations on the active site.

  6. Increased Oxidative Stress Markers in Cerebrospinal Fluid from Healthy Subjects with Parkinson’s Disease-Associated LRRK2 Gene Mutations

    PubMed Central

    Loeffler, David A.; Klaver, Andrea C.; Coffey, Mary P.; Aasly, Jan O.; LeWitt, Peter A.

    2017-01-01

    Mutations in the leucine-rich repeat kinase 2 (LRRK2) gene are the most frequent cause of inherited Parkinson’s disease (PD). The most common PD-associated LRRK2 mutation, G2019S, induces increased production of reactive oxygen species in vitro. We therefore hypothesized that individuals with PD-associated LRRK2 mutations might have increased concentrations of oxidative stress markers and/or decreased total antioxidant capacity (TAC) in their cerebrospinal fluid (CSF). We measured two oxidative stress markers, namely 8-hydroxy-2′-deoxyguanosine (8-OHdG) and 8-isoprostane (8-ISO), and TAC in CSF from LRRK2 mutation-bearing PD patients (LRRK2 PD = 19), sporadic PD patients (sPD = 31), and healthy control subjects with or without these mutations (LRRK2 CTL = 30, CTL = 27). 8-OHdG and 8-ISO levels were increased in LRRK2 CTL subjects, while TAC was similar between groups. 8-ISO was negatively correlated, and TAC was positively correlated, with Montreal Cognitive Assessment scores in LRRK2 PD, LRRK2 CTL, and CTL subjects. Correlations in both groups of PD patients between the two oxidative stress markers and Unified Parkinson Disease Rating Scale Total scores were weak, while TAC was negatively correlated with these scores. These findings suggest that oxidative stress may be increased in the CNS in healthy individuals with PD-associated LRRK2 mutations. Further, TAC may decrease in the CNS with the progression of PD, and when cognitive impairment is present regardless of the presence or absence of PD. PMID:28420983

  7. [Glucose-6-phosphate dehydrogenase deficiency in Japan].

    PubMed

    Kanno, Hitoshi; Ogura, Hiromi

    2015-07-01

    In the past 10 years, we have diagnosed congenital hemolytic anemia in 294 patients, approximately 33% of whom were found to have glucose-6-phosphate dehydrogenase (G6PD) deficiency. It is becoming more common for Japanese to marry people of other ethnic origins, such that G6PD deficiency is becoming more prevalent in Japan. Japanese G6PD deficiency tends to be diagnosed in the neonatal period due to severe jaundice, while G6PD-deficient patients with foreign ancestors tend to be diagnosed at the onset of an acute hemolytic crisis before the age of six. It is difficult to predict the clinical course of each patient by G6PD activity, reduced glutathione content, or the presence/absence of severe neonatal jaundice. We propose that both neonatal G6PD screening and systematic analyses of G6PD gene mutations may be useful for personalized management of patients with G6PD-deficient hemolytic anemia.

  8. Identification of Novel Compound Mutations in PLA2G6-Associated Neurodegeneration Patient with Characteristic MRI Imaging.

    PubMed

    Guo, Sen; Yang, Liu; Liu, Huijie; Chen, Wei; Li, Jinchen; Yu, Ping; Sun, Zhong Sheng; Chen, Xiang; Du, Jie; Cai, Tao

    2017-08-01

    Neurodegeneration with brain iron accumulation comprises a heterogeneous group of disorders characterized clinically by progressive motor dysfunction. Accurate identification of de novo and rare inherited mutations is important for determining causative genes of undiagnosed neurological diseases. In the present study, we report a unique case with cerebellar ataxia symptoms and social communication difficulties in an intermarriage family. MRI showed a marked cerebellar atrophy and the "eye-of-the-tiger"-like sign in the medial globus pallidus. Potential genetic defects were screened by whole-exome sequencing (WES) for the patient and four additional family members. A previously undescribed de novo missense mutation (c.1634A>G, p.K545R) in the exon 12 of the PLA2G6 gene was identified. A second rare variant c.1077G>A at the end of exon 7 was also identified, which was inherited from the mother, and resulted in a frame-shift mutation (c.1074_1077del.GTCG) due to an alternative splicing. In conclusion, the identification of the "eye-of-the-tiger"-like sign in the globus pallidus of the patient expands the phenotypic spectrum of PLA2G6-associated disorders and reveals its value in differential diagnosis of PLA2G6-associated disorders.

  9. BAG3 elevation inhibits cell proliferation via direct interaction with G6PD in hepatocellular carcinomas

    PubMed Central

    Kong, De-Hui; Li, Si; Du, Zhen-Xian; Liu, Chuan; Liu, Bao-Qin; Li, Chao; Zong, Zhi-Hong; Wang, Hua-Qin

    2016-01-01

    Bcl-2 associated athanogene 3 (BAG3) contains multiple protein-binding motifs to mediate potential interactions with chaperons and/or other proteins, which is possibly ascribed to the multifaceted functions assigned to BAG3. The current study demonstrated that BAG3 directly interacted with glucose 6 phosphate dehydrogenase (G6PD), the rate-limiting enzyme of the pentose phosphate pathway (PPP). BAG3 suppressed the PPP flux, de novo DNA synthesis and cell growth in hepatocellular carcinomas (HCCs). The growth defect of HCCs with forced BAG3 expression can be rescued by enforced G6PD expression. However, BAG3 elevation did not cause a reduction in cellular NADPH concentrations, another main product of G6PD. In addition, supplement of nucleosides alone was sufficient to recover the growth defect mediated by BAG3 elevation. Collectively, the current study established a tumor suppressor-like function of BAG3 via direct interaction with G6PD in HCCs at the cellular level. PMID:26621836

  10. BAG3 elevation inhibits cell proliferation via direct interaction with G6PD in hepatocellular carcinomas.

    PubMed

    Kong, De-Hui; Li, Si; Du, Zhen-Xian; Liu, Chuan; Liu, Bao-Qin; Li, Chao; Zong, Zhi-Hong; Wang, Hua-Qin

    2016-01-05

    Bcl-2 associated athanogene 3 (BAG3) contains multiple protein-binding motifs to mediate potential interactions with chaperons and/or other proteins, which is possibly ascribed to the multifaceted functions assigned to BAG3. The current study demonstrated that BAG3 directly interacted with glucose 6 phosphate dehydrogenase (G6PD), the rate-limiting enzyme of the pentose phosphate pathway (PPP). BAG3 suppressed the PPP flux, de novo DNA synthesis and cell growth in hepatocellular carcinomas (HCCs). The growth defect of HCCs with forced BAG3 expression can be rescued by enforced G6PD expression. However, BAG3 elevation did not cause a reduction in cellular NADPH concentrations, another main product of G6PD. In addition, supplement of nucleosides alone was sufficient to recover the growth defect mediated by BAG3 elevation. Collectively, the current study established a tumor suppressor-like function of BAG3 via direct interaction with G6PD in HCCs at the cellular level.

  11. Two new mutations in the glucose-6-phosphatase gene cause glycogen storage disease in Hungarian patients.

    PubMed

    Parvari, R; Lei, K J; Szonyi, L; Narkis, G; Moses, S; Chou, J Y

    1997-01-01

    Glycogen storage disease type 1a (von Gierke disease, GSD-1A) is caused by the deficiency of microsomal glucose-6-phosphatase (G6Pase) activity which catalyzes the final common step of glycogenolysis and gluconeogenesis. The cloning of the G6Pase cDNA and characterization of the human G6Pase gene enabled the identification of the mutations causing GSD-1a. This, in turn, allows the development of non-invasive DNA-based diagnosis that provides reliable carrier testing and prenatal diagnosis. Here we report on two new mutations E110Q and D38V causing GSD-1a in two Hungarian patients. The analyses of these mutations by site-directed mutagenesis followed by transient expression assays demonstrated that E110Q retains 17% of G6Pase enzymatic activity while the D38V abolishes the enzymatic activity. The patient with the E110Q has G222R as his other mutation. G222R was also shown to preserve about 4% of the G6Pase enzymatic activity. Nevertheless, the patient presented with the classical severe symptomatology of the GSD-1a.

  12. Steroid Biomarkers and Genetic Studies Reveal Inactivating Mutations in Hexose-6-Phosphate Dehydrogenase in Patients with Cortisone Reductase Deficiency

    PubMed Central

    Lavery, Gareth G.; Walker, Elizabeth A.; Tiganescu, Ana; Ride, Jon P.; Shackleton, Cedric H. L.; Tomlinson, Jeremy W.; Connell, John M. C.; Ray, David W.; Biason-Lauber, Anna; Malunowicz, Ewa M.; Arlt, Wiebke; Stewart, Paul M.

    2008-01-01

    Context: Cortisone reductase deficiency (CRD) is characterized by a failure to regenerate cortisol from cortisone via 11β-hydroxysteroid dehydrogenase type 1 (11β-HSD1), resulting in increased cortisol clearance, activation of the hypothalamic-pituitary-axis (HPA) and ACTH-mediated adrenal androgen excess. 11β-HSD1 oxoreductase activity requires the reduced nicotinamide adenine dinucleotide phosphate-generating enzyme hexose-6-phosphate dehydrogenase (H6PDH) within the endoplasmic reticulum. CRD manifests with hyperandrogenism resulting in hirsutism, oligo-amenorrhea, and infertility in females and premature pseudopuberty in males. Recent association studies have failed to corroborate findings that polymorphisms in the genes encoding H6PDH (R453Q) and 11β-HSD1 (Intron 3 inserted adenine) interact to cause CRD. Objective: Our objective was to reevaluate the genetics and steroid biochemistry of patients with CRD. Design: We analyzed 24-h urine collection for steroid biomarkers by gas chromatography/mass spectrometry and sequenced the HSD11B1 and H6PD genes in our CRD cohort. Patients: Patients included four cases presenting with hyperandrogenism and biochemical features clearly indicative of CRD. Results: Gas chromatography/mass spectrometry identified steroid biomarkers that correlated with CRD in each case. Three cases were identified as homozygous (R109AfsX3, Y316X, and G359D) and one case identified as compound heterozygous (c.960G→A and D620fsX3) for mutations in H6PD. No mutations affecting enzyme activity were identified in the HSD11B1 gene. Expression and activity assays demonstrate loss of function for all reported H6PDH mutations. Conclusions: CRD is caused by inactivating mutations in the H6PD gene, rendering the 11β-HSD1 enzyme unable to operate as an oxoreductase, preventing local glucocorticoid regeneration. These data highlight the importance of the redox control of cortisol metabolism and the 11β-HSD1-H6PDH pathway in regulating hypothalamic

  13. Antiplatelet and invasive treatment in patients with glucose-6-phosphate dehydrogenase (G6PD) deficiency and acute coronary syndrome. The safety of aspirin.

    PubMed

    Kafkas, N V; Liakos, C I; Mouzarou, A G

    2015-06-01

    Aspirin is an important drug in acute coronary syndromes (ACS) and percutaneous coronary interventions (PCI). However, its use is contraindicated in patients with glucose-6-phosphate dehydrogenase (G6PD) deficiency (risk for haemolytic anaemia). We report the management of 2 patients with class II G6PD deficiency and non-ST-segment elevation ACS (NSTE-ACS). The two patients were safely and efficiently treated with dual antiplatelet treatment (DAPT, aspirin plus ticagrelor) and PCI using new-generation drug-eluting stent (DES) despite G6PD deficiency. NSTE-ACS management with DAPT and DES is probably safe and effective in class II G6PD-deficient patients. © 2015 John Wiley & Sons Ltd.

  14. Performance of the CareStart Glucose-6-Phosphate Dehydrogenase (G6PD) Rapid Diagnostic Test in Gressier, Haiti

    PubMed Central

    von Fricken, Michael E.; Weppelmann, Thomas A.; Eaton, Will T.; Masse, Roseline; Beau de Rochars, Madsen V. E.; Okech, Bernard A.

    2014-01-01

    Administering primaquine (PQ) to treat malaria patients with glucose-6-phosphate dehydrogenase (G6PD) deficiency can pose a serious risk of drug-induced hemolysis (DIH). New easy to use point-of-care rapid diagnostic tests are being developed as an alternative to labor-intensive spectrophotometric methods, but they require field testing before they can be used at scale. This study screened 456 participants in Gressier, Haiti using the Access Bio CareStart qualitative G6PD rapid detection test compared with the laboratory-based Trinity Biotech quantitative spectrophotometric assay. Findings suggest that the CareStart test was 90% sensitive for detecting individuals with severe deficiency and 84.8% sensitive for detecting individuals with moderate and severe deficiency compared with the Trinity Biotech assay. A high negative predictive value of 98.2% indicates excellent performance in determining those patients able to take PQ safely. The CareStart G6PD test holds much value for screening malaria patients to determine eligibility for PQ therapy. PMID:24778197

  15. Novel mutations of the carbohydrate sulfotransferase-6 (CHST6) gene causing macular corneal dystrophy in India.

    PubMed

    Sultana, Afia; Sridhar, Mittanamalli S; Jagannathan, Aparna; Balasubramanian, Dorairajan; Kannabiran, Chitra; Klintworth, Gordon K

    2003-12-22

    Macular corneal dystrophy (MCD) is an autosomal recessive disorder characterized by progressive central haze, confluent punctate opacities and abnormal deposits in the cornea. It is caused by mutations in the carbohydrate sulfotransferase-6 (CHST6) gene, encoding corneal N-acetyl glucosamine-6-O-sulfotransferase (C-GlcNAc-6-ST). We screened the CHST6 gene for mutations in Indian families with MCD, in order to determine the range of pathogenic mutations. Genomic DNA was isolated from peripheral blood leukocytes of patients with MCD and normal controls. The coding regions of the CHST6 gene were amplified using three pairs of primers and amplified products were directly sequenced. We identified 22 (5 nonsense, 5 frameshift, 2 insertion, and 10 missense) mutations in 36 patients from 31 families with MCD, supporting the conclusion that loss of function of this gene is responsible for this corneal disease. Seventeen of these mutations are novel. These data highlight the allelic heterogeneity of macular corneal dystrophy in Indian patients.

  16. BRCA1/2 and TP53 mutation status associates with PD-1 and PD-L1 expression in ovarian cancer.

    PubMed

    Wieser, Verena; Gaugg, Inge; Fleischer, Martina; Shivalingaiah, Giridhar; Wenzel, Soeren; Sprung, Susanne; Lax, Sigurd F; Zeimet, Alain G; Fiegl, Heidelinde; Marth, Christian

    2018-04-03

    Checkpoint molecules such as programmed cell death protein-1 (PD-1) and its ligand PD-L1 are critically required for tumor immune escape. The objective of this study was to investigate tumoral PD-1 and PD-L1 mRNA-expression in a cohort of ovarian cancer (OC) patients in relation to tumor mutations. We analyzed mRNA expression of PD-1 , PD-L1 and IFNG by quantitative real-time PCR in tissue of 170 patients with low grade-serous (LGSOC), high-grade serous (HGSOC), endometrioid and clear cell OC compared to 28 non-diseased tissues (ovaries and fallopian tubes) in relation to tumor protein 53 ( TP53 ) and breast cancer gene 1/2 ( BRCA1/2 ) mutation status. TP53 -mutated OC strongly expressed PD-L1 compared to TP53 wild-type OC ( p = 0.028) and BRCA1/2 -mutated OC increasingly expressed PD-1 ( p = 0.024) and PD-L1 ( p = 0.012) compared to BRCA1/2 wild-type OC. For the first time in human, we noted a strong correlation between tumoral IFNG and PD-1 or PD-L1 mRNA-expression, respectively ( p < 0.001). OC tissue increasingly expressed PD-1 compared to healthy controls (vs. ovaries: p < 0.001; vs. tubes: p = 0.018). PD-1 and PD-L1 mRNA-expression increased with higher tumor grade ( p = 0.008 and p = 0.027, respectively) and younger age (< median age, p = 0.001). Finally, in the major subgroup of our cohort, FIGO stage III/IV HGSOC, high PD-1 and PD-L1 mRNA-expression was associated with reduced progression-free ( p = 0.024) and overall survival ( p = 0.049) but only in the univariate analysis. Our study suggests that in OC PD-1 / PD-L1 mRNA-expression is controlled by IFNγ and affected by TP53 and BRCA1/2 mutations. We suggest that these mutations might serve as potential predictive factors that guide anti- PD1 / PD-L1 immunotherapy.

  17. High risk of severe anaemia after chlorproguanil-dapsone+artesunate antimalarial treatment in patients with G6PD (A-) deficiency.

    PubMed

    Fanello, Caterina I; Karema, Corine; Avellino, Pamela; Bancone, Germana; Uwimana, Aline; Lee, Sue J; d'Alessandro, Umberto; Modiano, David

    2008-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common inherited human enzyme defect. This deficiency provides some protection from clinical malaria, but it can also cause haemolysis after administration of drugs with oxidant properties. The safety of chlorproguanil-dapsone+artesunate (CD+A) and amodiaquine+sulphadoxine-pyrimethamine (AQ+SP) for the treatment of uncomplicated P. falciparum malaria was evaluated according to G6PD deficiency in a secondary analysis of an open-label, randomized clinical trial. 702 children, treated with CD+A or AQ+SP and followed for 28 days after treatment were genotyped for G6PD A- deficiency. In the first 4 days following CD+A treatment, mean haematocrit declined on average 1.94% (95% CI 1.54 to 2.33) and 1.05% per day (95% CI 0.95 to 1.15) respectively in patients with G6PD deficiency and normal patients; a mean reduction of 1.3% per day was observed among patients who received AQ+SP regardless of G6PD status (95% CI 1.25 to 1.45). Patients with G6PD deficiency recipients of CD+A had significantly lower haematocrit than the other groups until day 7 (p = 0.04). In total, 10 patients had severe post-treatment haemolysis requiring blood transfusion. Patients with G6PD deficiency showed a higher risk of severe anaemia following treatment with CD+A (RR = 10.2; 95% CI 1.8 to 59.3) or AQ+SP (RR = 5.6; 95% CI 1.0 to 32.7). CD+A showed a poor safety profile in individuals with G6PD deficiency most likely as a result of dapsone induced haemolysis. Screening for G6PD deficiency before drug administration of potentially pro-oxidants drugs, like dapsone-containing combinations, although seldom available, is necessary.

  18. G6PD Deficiency and Hemoglobinopathies: Molecular Epidemiological Characteristics and Healthy Effects on Malaria Endemic Bioko Island, Equatorial Guinea

    PubMed Central

    Lin, Min; Yang, Li Ye; Xie, Dong De; Chen, Jiang Tao; Nguba, Santiago-m Monte; Ehapo, Carlos Sala; Zhan, Xiao Fen; Eyi, Juan Urbano Monsuy; Matesa, Rocio Apicante; Obono, Maximo Miko Ondo; Yang, Hui; Yang, Hui Tian; Cheng, Ji Dong

    2015-01-01

    Background Glucose-6-phosphate dehydrogenase (G6PD) deficiency and hemoglobinopathies were the inherited conditions found mostly in African. However, few epidemiological data of these disorders was reported in Equatorial Guinea (EQG). This study aimed to assess the prevalence and healthy effects of G6PD deficiency and hemoglobinopathies among the people on malaria endemic Bioko Island, EQG. Materials and Methods Blood samples from 4,144 unrelated subjects were analyzed for G6PD deficieny by fluorescence spot test (FST), high-resolution melting assay and PCR-DNA sequencing. In addition, 1,186 samples were randomly selected from the 4,144 subjects for detection of hemoglobin S (HbS), HbC, and α-thalassemia deletion by complete blood count, PCR-DNA sequencing and reverse dot blot (RDB). Results The prevalence of malaria and anemia was 12.6% (522/4,144) and 32.8% (389/1,186), respectively. Overall, 8.7% subjects (359/4,144) were G6PD-deficient by FST, including 9.0% (249/2,758) males and 7.9% (110/1,386) females. Among the 359 G6PD-deficient individuals molecularly studied, the G6PD A- (G202A/A376G) were detected in 356 cases (99.2%), G6PD Betica (T968C/A376G) in 3 cases. Among the 1,186 subjects, 201 cases were HbS heterozygotes, 35 cases were HbC heterozygotes, and 2 cases were HbCS double heterozygotes; 452 cases showed heterozygous α-thalassemia 3.7 kb deletion (-α3.7 kb deletion) and 85 homozygous - α3.7 kb deletion. The overall allele frequencies were HbS 17.1% (203/1186); HbC, 3.1% (37/1186); and –α3.7 kb deletion 52.4% (622/1186), respectively. Conclusions High G6PD deficiency in this population indicate that diagnosis and management of G6PD deficiency is necessary on Bioko Island. Obligatory newborn screening, prenatal screening and counseling for these genetic disorders, especially HbS, are needed on the island. PMID:25915902

  19. G6PD Deficiency and Hemoglobinopathies: Molecular Epidemiological Characteristics and Healthy Effects on Malaria Endemic Bioko Island, Equatorial Guinea.

    PubMed

    Lin, Min; Yang, Li Ye; Xie, Dong De; Chen, Jiang Tao; Nguba, Santiago-m Monte; Ehapo, Carlos Sala; Zhan, Xiao Fen; Eyi, Juan Urbano Monsuy; Matesa, Rocio Apicante; Obono, Maximo Miko Ondo; Yang, Hui; Yang, Hui Tian; Cheng, Ji Dong

    2015-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency and hemoglobinopathies were the inherited conditions found mostly in African. However, few epidemiological data of these disorders was reported in Equatorial Guinea (EQG). This study aimed to assess the prevalence and healthy effects of G6PD deficiency and hemoglobinopathies among the people on malaria endemic Bioko Island, EQG. Blood samples from 4,144 unrelated subjects were analyzed for G6PD deficiency by fluorescence spot test (FST), high-resolution melting assay and PCR-DNA sequencing. In addition, 1,186 samples were randomly selected from the 4,144 subjects for detection of hemoglobin S (HbS), HbC, and α-thalassemia deletion by complete blood count, PCR-DNA sequencing and reverse dot blot (RDB). The prevalence of malaria and anemia was 12.6% (522/4,144) and 32.8% (389/1,186), respectively. Overall, 8.7% subjects (359/4,144) were G6PD-deficient by FST, including 9.0% (249/2,758) males and 7.9% (110/1,386) females. Among the 359 G6PD-deficient individuals molecularly studied, the G6PD A- (G202A/A376G) were detected in 356 cases (99.2%), G6PD Betica (T968C/A376G) in 3 cases. Among the 1,186 subjects, 201 cases were HbS heterozygotes, 35 cases were HbC heterozygotes, and 2 cases were HbCS double heterozygotes; 452 cases showed heterozygous α-thalassemia 3.7 kb deletion (-α3.7 kb deletion) and 85 homozygous - α3.7 kb deletion. The overall allele frequencies were HbS 17.1% (203/1186); HbC, 3.1% (37/1186); and -α3.7 kb deletion 52.4% (622/1186), respectively. High G6PD deficiency in this population indicate that diagnosis and management of G6PD deficiency is necessary on Bioko Island. Obligatory newborn screening, prenatal screening and counseling for these genetic disorders, especially HbS, are needed on the island.

  20. A Comparison of Three Quantitative Methods to Estimate G6PD Activity in the Chittagong Hill Tracts, Bangladesh.

    PubMed

    Ley, Benedikt; Alam, Mohammad Shafiul; O'Donnell, James J; Hossain, Mohammad Sharif; Kibria, Mohammad Golam; Jahan, Nusrat; Khan, Wasif A; Thriemer, Kamala; Chatfield, Mark D; Price, Ric N; Richards, Jack S

    2017-01-01

    Glucose-6-phosphate-dehydrogenase-deficiency (G6PDd) is a major risk factor for primaquine-induced haemolysis. There is a need for improved point-of-care and laboratory-based G6PD diagnostics to unsure safe use of primaquine. G6PD activities of participants in a cross-sectional survey in Bangladesh were assessed using two novel quantitative assays, the modified WST-8 test and the CareStart™ G6PD Biosensor (Access Bio), The results were compared with a gold standard UV spectrophotometry assay (Randox). The handheld CareStart™ Hb instrument (Access Bio) is designed to be a companion instrument to the CareStart™ G6PD biosensor, and its performance was compared to the well-validated HemoCue™ method. All quantitative G6PD results were normalized with the HemoCue™ result. A total of 1002 individuals were enrolled. The adjusted male median (AMM) derived by spectrophotometry was 7.03 U/g Hb (interquartile range (IQR): 5.38-8.69), by WST-8 was 7.03 U/g Hb (IQR: 5.22-8.16) and by Biosensor was 8.61 U/g Hb (IQR: 6.71-10.08). The AMM between spectrophotometry and WST-8 did not differ (p = 1.0) but differed significantly between spectrophotometry and Biosensor (p<0.01). Both, WST-8 and Biosensor were correlated with spectrophotometry (rs = 0.5 and rs = 0.4, both p<0.001). The mean difference in G6PD activity was -0.12 U/g Hb (95% limit of agreement (95% LoA): -5.45 to 5.20) between spectrophotometry and WST-8 and -1.74U/g Hb (95% LoA: -7.63 to 4.23) between spectrophotometry and Biosensor. The WST-8 identified 55.1% (49/89) and the Biosensor 19.1% (17/89) of individuals with G6PD activity <30% by spectrophotometry. Areas under the ROC curve did not differ significantly for the WST-8 and Biosensor irrespective of the cut-off activity applied (all p>0.05). Sensitivity and specificity for detecting G6PD activity <30% was 0.55 (95% confidence interval (95%CI): 0.44-0.66) and 0.98 (95%CI: 0.97-0.99) respectively for the WST-8 and 0.19 (95%CI: 0.12-0.29) and 0.99 (95%CI: 0

  1. Mitochondrial myopathy, lactic acidosis, and sideroblastic anemia (MLASA) plus associated with a novel de novo mutation (m.8969G>A) in the mitochondrial encoded ATP6 gene.

    PubMed

    Burrage, Lindsay C; Tang, Sha; Wang, Jing; Donti, Taraka R; Walkiewicz, Magdalena; Luchak, J Michael; Chen, Li-Chieh; Schmitt, Eric S; Niu, Zhiyv; Erana, Rodrigo; Hunter, Jill V; Graham, Brett H; Wong, Lee-Jun; Scaglia, Fernando

    2014-11-01

    Mitochondrial myopathy, lactic acidosis and sideroblastic anemia (MLASA) is a rare mitochondrial disorder that has previously been associated with mutations in PUS1 and YARS2. In the present report, we describe a 6-year old male with an MLASA plus phenotype. This patient had features of MLASA in the setting of developmental delay, sensorineural hearing loss, epilepsy, agenesis of the corpus callosum, failure to thrive, and stroke-like episodes. Sequencing of the mitochondrial genome identified a novel de novo, heteroplasmic mutation in the mitochondrial DNA (mtDNA) encoded ATP6 gene (m.8969G>A, p.S148N). Whole exome sequencing did not identify mutations or variants in PUS1 or YARS2 or any known nuclear genes that could affect mitochondrial function and explain this phenotype. Studies of fibroblasts derived from the patient revealed a decrease in oligomycin-sensitive respiration, a finding which is consistent with a complex V defect. Thus, this mutation in MT-ATP6 may represent the first mtDNA point mutation associated with the MLASA phenotype. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Three new PAX6 mutations including one causing an unusual ophthalmic phenotype associated with neurodevelopmental abnormalities.

    PubMed

    Dansault, Anouk; David, Gabriel; Schwartz, Claire; Jaliffa, Carolina; Vieira, Véronique; de la Houssaye, Guillaume; Bigot, Karine; Catin, Françise; Tattu, Laurent; Chopin, Catherine; Halimi, Philippe; Roche, Olivier; Van Regemorter, Nicole; Munier, Francis; Schorderet, Daniel; Dufier, Jean-Louis; Marsac, Cécile; Ricquier, Daniel; Menasche, Maurice; Penfornis, Alfred; Abitbol, Marc

    2007-04-02

    . Two previously known heterozygous mutations of the PAX6 gene sequence were also detected in patients affected by aniridia: a de novo previously known nucleotide change, g.972C>T (Q179X), in exon 8, leading to a stop codon and a heterozygous g.555C>A (C40X) recurrent nonsense mutation in exon 5. No mutations were found in patients with Peters' anomaly. We identified three mutations associated with aniridia phenotypes (Q179X, C40X, and V48fsX53). The three other mutations reported here cause non-aniridia ocular phenotypes associated in some cases with neurological anomalies. The IVS2+9G>A nucleotide change was detected in a patient with a microphthalmia phenotype. The L46P mutation was detected in a family with microphthalmia, cataract, and nystagmus. This mutation is located in the DNA-binding paired-domain and the crystallographic representations of this mutation show that this mutation may affect the helix-turn-helix motif, and as a consequence the DNA-binding properties of the resulting mutated protein. Ser74 is located in the PAX6 PD linker region, essential for DNA recognition and DNA binding, and the side chain of the Ser74 contributes to DNA recognition by the linker domain through direct contacts. Crystallographic representations show that the S74G mutation results in no side chain and therefore perturbs the DNA-binding properties of PAX6. This study highlights the severity and diversity of the consequences of PAX6 mutations that appeared to result from the complexity of the PAX6 gene structure, and the numerous possibilities for DNA binding. This study emphasizes the fact that neurodevelopmental abnormalities may be caused by PAX6 mutations. The neuro-developmental abnormalities caused by PAX6 mutations are probably still overlooked in the current clinical examinations performed throughout the world in patients affected by PAX6 mutations.

  3. Three new PAX6 mutations including one causing an unusual ophthalmic phenotype associated with neurodevelopmental abnormalities

    PubMed Central

    Dansault, Anouk; David, Gabriel; Schwartz, Claire; Jaliffa, Carolina; Vieira, Véronique; de la Houssaye, Guillaume; Bigot, Karine; Catin, Françise; Tattu, Laurent; Chopin, Catherine; Halimi, Philippe; Roche, Olivier; Van Regemorter, Nicole; Munier, Francis; Schorderet, Daniel; Dufier, Jean-Louis; Marsac, Cécile; Ricquier, Daniel; Menasche, Maurice; Penfornis, Alfred

    2007-01-01

    remains to be demonstrated. Two previously known heterozygous mutations of the PAX6 gene sequence were also detected in patients affected by aniridia: a de novo previously known nucleotide change, g.972C>T (Q179X), in exon 8, leading to a stop codon and a heterozygous g.555C>A (C40X) recurrent nonsense mutation in exon 5. No mutations were found in patients with Peters' anomaly. Conclusions We identified three mutations associated with aniridia phenotypes (Q179X, C40X, and V48fsX53). The three other mutations reported here cause non-aniridia ocular phenotypes associated in some cases with neurological anomalies. The IVS2+9G>A nucleotide change was detected in a patient with a microphthalmia phenotype. The L46P mutation was detected in a family with microphthalmia, cataract, and nystagmus. This mutation is located in the DNA-binding paired-domain and the crystallographic representations of this mutation show that this mutation may affect the helix-turn-helix motif, and as a consequence the DNA-binding properties of the resulting mutated protein. Ser74 is located in the PAX6 PD linker region, essential for DNA recognition and DNA binding, and the side chain of the Ser74 contributes to DNA recognition by the linker domain through direct contacts. Crystallographic representations show that the S74G mutation results in no side chain and therefore perturbs the DNA-binding properties of PAX6. This study highlights the severity and diversity of the consequences of PAX6 mutations that appeared to result from the complexity of the PAX6 gene structure, and the numerous possibilities for DNA binding. This study emphasizes the fact that neurodevelopmental abnormalities may be caused by PAX6 mutations. The neuro-developmental abnormalities caused by PAX6 mutations are probably still overlooked in the current clinical examinations performed throughout the world in patients affected by PAX6 mutations. PMID:17417613

  4. The impact of phenotypic and genotypic G6PD deficiency on risk of plasmodium vivax infection: a case-control study amongst Afghan refugees in Pakistan.

    PubMed

    Leslie, Toby; Briceño, Marnie; Mayan, Ismail; Mohammed, Nasir; Klinkenberg, Eveline; Sibley, Carol Hopkins; Whitty, Christopher J M; Rowland, Mark

    2010-05-25

    The most common form of malaria outside Africa, Plasmodium vivax, is more difficult to control than P. falciparum because of the latent liver hypnozoite stage, which causes multiple relapses and provides an infectious reservoir. The African (A-) G6PD (glucose-6-phosphate dehydrogenase) deficiency confers partial protection against severe P. falciparum. Recent evidence suggests that the deficiency also confers protection against P. vivax, which could explain its wide geographical distribution in human populations. The deficiency has a potentially serious interaction with antirelapse therapies (8-aminoquinolines such as primaquine). If the level of protection was sufficient, antirelapse therapy could become more widely available. We therefore tested the hypothesis that G6PD deficiency is protective against vivax malaria infection. A case-control study design was used amongst Afghan refugees in Pakistan. The frequency of phenotypic and genotypic G6PD deficiency in individuals with vivax malaria was compared against controls who had not had malaria in the previous two years. Phenotypic G6PD deficiency was less common amongst cases than controls (cases: 4/372 [1.1%] versus controls 42/743 [5.7%]; adjusted odds ratio [AOR] 0.18 [95% confidence interval (CI) 0.06-0.52], p = 0.001). Genetic analysis demonstrated that the G6PD deficiency allele identified (Mediterranean type) was associated with protection in hemizygous deficient males (AOR = 0.12 [95% CI 0.02-0.92], p = 0.041). The deficiency was also protective in females carrying the deficiency gene as heterozygotes or homozygotes (pooled AOR = 0.37 [95% CI 0.15-0.94], p = 0.037). G6PD deficiency (Mediterranean type) conferred significant protection against vivax malaria infection in this population whether measured by phenotype or genotype, indicating a possible evolutionary role for vivax malaria in the selective retention of the G6PD deficiency trait in human populations. Further work is required on the genotypic

  5. Effects of G6PD activity inhibition on the viability, ROS generation and mechanical properties of cervical cancer cells.

    PubMed

    Fang, Zishui; Jiang, Chengrui; Feng, Yi; Chen, Rixin; Lin, Xiaoying; Zhang, Zhiqiang; Han, Luhao; Chen, Xiaodan; Li, Hongyi; Guo, Yibin; Jiang, Weiying

    2016-09-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency has been revealed to be involved in the efficacy to anti-cancer therapy but the mechanism remains unclear. We aimed to investigate the anti-cancer mechanism of G6PD deficiency. In our study, dehydroepiandrosterone (DHEA) and shRNA technology were used for inhibiting the activity of G6PD of cervical cancer cells. Peak Force QNM Atomic Force Microscopy was used to assess the changes of topography and biomechanical properties of cells and detect the effects on living cells in a natural aqueous environment. Flow cytometry was used to detect the apoptosis and reactive oxygen species (ROS) generation. Scanning electron microscopy was used to observe cell morphology. Moreover, a laser scanning confocal microscope was used to observe the alterations in cytoskeleton to explore the involved mechanism. When G6PD was inhibited by DHEA or RNA interference, the abnormal Young's modulus and increased roughness of cell membrane were observed in HeLa cells, as well as the idioblasts. Simultaneously, G6PD deficiency resulted in decreased HeLa cells migration and proliferation ability but increased ROS generation inducing apoptosis. What's more, the inhibition of G6PD activity caused the disorganization of microfilaments and microtubules of cytoskeletons and cell shrinkage. Our results indicated the anti-cervix cancer mechanism of G6PD deficiency may be involved with the decreased cancer cells migration and proliferation ability as a result of abnormal reorganization of cell cytoskeleton and abnormal biomechanical properties caused by the increased ROS. Suppression of G6PD may be a promising strategy in developing novel therapeutic methods for cervical cancer. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. A Comparison of Three Quantitative Methods to Estimate G6PD Activity in the Chittagong Hill Tracts, Bangladesh

    PubMed Central

    Ley, Benedikt; Alam, Mohammad Shafiul; O’Donnell, James J.; Hossain, Mohammad Sharif; Kibria, Mohammad Golam; Jahan, Nusrat; Khan, Wasif A.; Thriemer, Kamala; Chatfield, Mark D.; Price, Ric N.; Richards, Jack S.

    2017-01-01

    Background Glucose-6-phosphate-dehydrogenase-deficiency (G6PDd) is a major risk factor for primaquine-induced haemolysis. There is a need for improved point-of-care and laboratory-based G6PD diagnostics to unsure safe use of primaquine. Methods G6PD activities of participants in a cross-sectional survey in Bangladesh were assessed using two novel quantitative assays, the modified WST-8 test and the CareStart™ G6PD Biosensor (Access Bio), The results were compared with a gold standard UV spectrophotometry assay (Randox). The handheld CareStart™ Hb instrument (Access Bio) is designed to be a companion instrument to the CareStart™ G6PD biosensor, and its performance was compared to the well-validated HemoCue™ method. All quantitative G6PD results were normalized with the HemoCue™ result. Results A total of 1002 individuals were enrolled. The adjusted male median (AMM) derived by spectrophotometry was 7.03 U/g Hb (interquartile range (IQR): 5.38–8.69), by WST-8 was 7.03 U/g Hb (IQR: 5.22–8.16) and by Biosensor was 8.61 U/g Hb (IQR: 6.71–10.08). The AMM between spectrophotometry and WST-8 did not differ (p = 1.0) but differed significantly between spectrophotometry and Biosensor (p<0.01). Both, WST-8 and Biosensor were correlated with spectrophotometry (rs = 0.5 and rs = 0.4, both p<0.001). The mean difference in G6PD activity was -0.12 U/g Hb (95% limit of agreement (95% LoA): -5.45 to 5.20) between spectrophotometry and WST-8 and -1.74U/g Hb (95% LoA: -7.63 to 4.23) between spectrophotometry and Biosensor. The WST-8 identified 55.1% (49/89) and the Biosensor 19.1% (17/89) of individuals with G6PD activity <30% by spectrophotometry. Areas under the ROC curve did not differ significantly for the WST-8 and Biosensor irrespective of the cut-off activity applied (all p>0.05). Sensitivity and specificity for detecting G6PD activity <30% was 0.55 (95% confidence interval (95%CI): 0.44–0.66) and 0.98 (95%CI: 0.97–0.99) respectively for the WST-8 and 0

  7. Performance of the CareStart glucose-6-phosphate dehydrogenase (G6PD) rapid diagnostic test in Gressier, Haiti.

    PubMed

    von Fricken, Michael E; Weppelmann, Thomas A; Eaton, Will T; Masse, Roseline; Beau de Rochars, Madsen V E; Okech, Bernard A

    2014-07-01

    Administering primaquine (PQ) to treat malaria patients with glucose-6-phosphate dehydrogenase (G6PD) deficiency can pose a serious risk of drug-induced hemolysis (DIH). New easy to use point-of-care rapid diagnostic tests are being developed as an alternative to labor-intensive spectrophotometric methods, but they require field testing before they can be used at scale. This study screened 456 participants in Gressier, Haiti using the Access Bio CareStart qualitative G6PD rapid detection test compared with the laboratory-based Trinity Biotech quantitative spectrophotometric assay. Findings suggest that the CareStart test was 90% sensitive for detecting individuals with severe deficiency and 84.8% sensitive for detecting individuals with moderate and severe deficiency compared with the Trinity Biotech assay. A high negative predictive value of 98.2% indicates excellent performance in determining those patients able to take PQ safely. The CareStart G6PD test holds much value for screening malaria patients to determine eligibility for PQ therapy. © The American Society of Tropical Medicine and Hygiene.

  8. Vacuolar Protein Sorting Genes in Parkinson's Disease: A Re-appraisal of Mutations Detection Rate and Neurobiology of Disease.

    PubMed

    Gambardella, Stefano; Biagioni, Francesca; Ferese, Rosangela; Busceti, Carla L; Frati, Alessandro; Novelli, Giuseppe; Ruggieri, Stefano; Fornai, Francesco

    2016-01-01

    Mammalian retromers play a critical role in protein trans-membrane sorting from endosome to the trans-Golgi network (TGN). Recently, retromer alterations have been related to the onset of Parkinson's Disease (PD) since the variant p.Asp620Asn in VPS35 (Vacuolar Protein Sorting 35) was identified as a cause of late onset PD. This variant causes a primary defect in endosomal trafficking and retromers formation. Other mutations in VPS genes have been reported in both sporadic and familial PD. These mutations are less defined. Understanding the specific prevalence of all VPS gene mutations is key to understand the relevance of retromers impairment in the onset of PD. A number of PD-related mutations despite affecting different biochemical systems (autophagy, mitophagy, proteasome, endosomes, protein folding), all converge in producing an impairment in cell clearance. This may explain how genetic predispositions to PD may derive from slightly deleterious VPS mutations when combined with environmental agents overwhelming the clearance of the cell. This manuscript reviews genetic data produced in the last 5 years to re-define the actual prevalence of VPS gene mutations in the onset of PD. The prevalence of p.Asp620Asn mutation in VPS35 is 0.286 of familial PD. This increases up to 0.548 when considering mutations affecting all VPS genes. This configures mutations in VPS genes as the second most frequent autosomal dominant PD genotype. This high prevalence, joined with increased awareness of the role played by retromers in the neurobiology of PD, suggests environmentally-induced VPS alterations as crucial in the genesis of PD.

  9. G6PC3 mutations are associated with a major defect of glycosylation: a novel mechanism for neutrophil dysfunction

    PubMed Central

    Hayee, Bu'Hussain; Antonopoulos, Aristotelis; Murphy, Emma J; Rahman, Farooq Z; Sewell, Gavin; Smith, Bradley N; McCartney, Sara; Furman, Mark; Hall, Georgina; Bloom, Stuart L; Haslam, Stuart M; Morris, Howard R; Boztug, Kaan; Klein, Christoph; Winchester, Bryan; Pick, Edgar; Linch, David C; Gale, Rosemary E; Smith, Andrew M; Dell, Anne; Segal, Anthony W

    2011-01-01

    Glucose-6-phosphatase, an enzyme localized in the endoplasmic reticulum (ER), catalyzes the hydrolysis of glucose-6-phosphate (G6P) to glucose and inorganic phosphate. In humans, there are three differentially expressed glucose-6-phosphatase catabolic genes (G6PC1–3). Recently, it has been shown that mutations in the G6PC3 gene result in a syndrome associating congenital neutropenia and various organ malformations. The enzymatic function of G6PC3 is dependent on G6P transport into the ER, mediated by G6P translocase (G6PT). Mutations in the gene encoding G6PT result in glycogen storage disease type-1b (GSD-1b). Interestingly, GSD-1b patients exhibit a similar neutrophil dysfunction to that observed in G6PC3-deficient patients. To better understand the causes of neutrophil dysfunction in both diseases, we have studied the neutrophil nicotinamide adenine dinucleotide phosphate (NADPH) oxidase of patients with G6PC3 and G6PT syndromes. Unexpectedly, sodium dodecyl sulfate–polyacrylamide gel electrophoresis experiments indicated hypo-glycosylation of gp91phox, the electron-transporting component of the NADPH oxidase, in all of these patients. Rigorous mass spectrometric glycomic profiling showed that most of the complex-type antennae which characterize the neutrophil N-glycome of healthy individuals were severely truncated in the patients' neutrophils. A comparable truncation of the core 2 antenna of the O-glycans was also observed. This aberrant neutrophil glycosylation is predicted to have profound effects on the neutrophil function and merit designation of both syndromes as a new class of congenital disorders of glycosylation. PMID:21385794

  10. Prevalence of glucose-6-phosphate dehydrogenase (G6PD) deficiency in the Ouest and Sud-Est departments of Haiti.

    PubMed

    von Fricken, Michael E; Weppelmann, Thomas A; Eaton, Will T; Alam, Meer T; Carter, Tamar E; Schick, Laura; Masse, Roseline; Romain, Jean R; Okech, Bernard A

    2014-07-01

    Malaria remains a significant public health issue in Haiti, with chloroquine (CQ) used almost exclusively for the treatment of uncomplicated infections. Recently, single dose primaquine (PQ) was added to the Haitian national malaria treatment policy, despite a lack of information on the prevalence of glucose-6-phosphate dehydrogenase (G6PD) deficiency within the population. G6PD deficient individuals who take PQ are at risk of developing drug induced hemolysis (DIH). In this first study to examine G6PD deficiency rates in Haiti, 22.8% (range 14.9%-24.7%) of participants were found to be G6PD deficient (class I, II, or III) with 2.0% (16/800) of participants having severe deficiency (class I and II). Differences in deficiency were observed by gender, with males having a much higher prevalence of severe deficiency (4.3% vs. 0.4%) compared to females. Male participants were 1.6 times more likely to be classified as deficient and 10.6 times more likely to be classified as severely deficient compared to females, as expected. Finally, 10.6% (85/800) of the participants were considered to be at risk for DIH. Males also had much higher rates than females (19.3% vs. 4.6%) with 4.9 times greater likelihood (p value 0.000) of having an activity level that could lead to DIH. These findings provide useful information to policymakers and clinicians who are responsible for the implementation of PQ to control and manage malaria in Haiti. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Haemolytic episode in G6 PD deficient workers exposed to TNT.

    PubMed Central

    Djerassi, L S; Vitany, L

    1975-01-01

    This is a report on three cases of acute haemolytic disease in glucose-6-phosphate dehydrogenase (G6PD) deficient workers exposed to trinitroluene (TNT). The courses of the haemolytic crises have several features in common, the most striking being the onset of the disease within two to four days after the start of exposure, and the fact that this has been the first and so far the only haemolytic episode in their lives in spite of detailed medical records of past diseases, injuries, and medications during 12 to 16 years preceding the haemolytic crisis and five to nine years following the disease. The lowest haemoglobin levels for the three patients were 4-0, 6-8, and 8-2 g/dl respectively; haematocrit values were 17 and 24%; reticulocytes rose in case 1 to 26-2%, in case 2 to 26%, and in case 3 to 10%. Indirect bilirubinaemia was increased in two patients (5-1 and 2-6 mg/100 ml) and stercobilinogen was as high as 2150 mg/24 hr in one patient. The presence of the metabolite monoamino 2-6 dinitrotoluene was proved in the urine of case 3 and reached 21 gamma%. The possibility of a dose-response relationship is briefly discussed and the risk of exposing G6 PD individuals in chemical processes is mentioned. PMID:1125128

  12. Novel mutations of CHST6 in Iranian patients with macular corneal dystrophy

    PubMed Central

    Salehi, Zivar; Houshmand, Masoud; Mohamadi, Mohamad Javad; Promehr, Leila Azizade; Mozafarzadeh, Zahra

    2009-01-01

    Purpose To characterize mutations within the carbohydrate sulfotransferase 6 (CHST6) gene in Iranian subjects from 12 families with macular corneal dystrophy (MCD). Methods Genomic DNA was extracted from peripheral blood of 20 affected patients and 60 healthy volunteers followed by polymerase chain reaction (PCR) and direct sequencing of the CHST6 coding region. The observed nucleotide sequences were then compared with those found by investigators in other populations with MCD and in the controls. Results Analysis of CHST6 revealed 11 different mutations. These mutations were comprised of six novel missense mutations (p.F55L, p.P132L, p.S136G, p.C149Y, p.D203Y, and p.H249R), one novel nonsense mutation (p.S48X), one novel frame shift (after P297), and three previously reported missense mutations (p.P31L, p.C165Y, and p.R127C). The majority of the detected MCD mutations are located in the binding sites or the binding pocket, except the p.P31L and p.H249R mutations. Conclusions Nucleotide changes within the coding region of CHST6 are predicted to significantly alter the encoded sulfotransferase within the evolutionary conserved sequences. Our findings show that CHST6 mutations are responsible for the pathogenesis of MCD in Iranian patients. Moreover, the observation that some cases of MCD cannot be explained by mutations in the coding region of CHST6 suggests that MCD may result from possible upstream rearrangements in the CHST6 genomic region. PMID:19223992

  13. Novel mutations of CHST6 in Iranian patients with macular corneal dystrophy.

    PubMed

    Birgani, Shiva Akbari; Salehi, Zivar; Houshmand, Masoud; Mohamadi, Mohamad Javad; Promehr, Leila Azizade; Mozafarzadeh, Zahra

    2009-01-01

    To characterize mutations within the carbohydrate sulfotransferase 6 (CHST6) gene in Iranian subjects from 12 families with macular corneal dystrophy (MCD). Genomic DNA was extracted from peripheral blood of 20 affected patients and 60 healthy volunteers followed by polymerase chain reaction (PCR) and direct sequencing of the CHST6 coding region. The observed nucleotide sequences were then compared with those found by investigators in other populations with MCD and in the controls. Analysis of CHST6 revealed 11 different mutations. These mutations were comprised of six novel missense mutations (p.F55L, p.P132L, p.S136G, p.C149Y, p.D203Y, and p.H249R), one novel nonsense mutation (p.S48X), one novel frame shift (after P297), and three previously reported missense mutations (p.P31L, p.C165Y, and p.R127C). The majority of the detected MCD mutations are located in the binding sites or the binding pocket, except the p.P31L and p.H249R mutations. Nucleotide changes within the coding region of CHST6 are predicted to significantly alter the encoded sulfotransferase within the evolutionary conserved sequences. Our findings show that CHST6 mutations are responsible for the pathogenesis of MCD in Iranian patients. Moreover, the observation that some cases of MCD cannot be explained by mutations in the coding region of CHST6 suggests that MCD may result from possible upstream rearrangements in the CHST6 genomic region.

  14. Molecular heterogeneity of glucose-6-phosphate dehydrogenase deficiency in Gaza Strip Palestinians.

    PubMed

    Sirdah, Mahmoud; Reading, N Scott; Vankayalapati, Hariprasad; Perkins, Sherrie L; Shubair, Mohammad E; Aboud, Lina; Roper, David; Prchal, Josef T

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency, affecting more than 500 million people worldwide, is one of the most common of inherited disorders. There are 186 G6PD mutations published, with mutational clustering within defined ethnic/racial groups. However comprehensive molecular characterization of ethnically associated G6PD mutants and their clinical implications are lacking. Eighty unrelated Palestinian children hospitalized for hemolysis were studied. G6PD activity was determined by quantitative spectrophotometry and G6PD mutations were analyzed by sequencing of gDNA. 65 of 80 children (81%) had G6PD deficiency, accounting for most of the hemolytic disease in this age group. G6PD Mediterranean(c.563T), African G6PD A-(c.202A/c.376G), and G6PD Cairo(c.404C) were common with relative allele frequencies of 0.33 [1], 0.26, and 0.18 respectively. Two other variants were discovered, G6PD Beverly Hills(c.1160A) mutation, and a novel G6PD missense mutation c.536G>A (Ser179Asn), designated G6PD "Gaza". Three samples exhibited enzyme deficiency without detectable exonic or exon/intron boundary mutations. G6PD deficiency accounts for the majority of diagnoses for hemolysis in Palestinian children (81%), providing support for newborn G6PD deficiency screening programs. We report unanticipated molecular heterogeneity of G6PD variants among Gaza Strip Palestinians greater than reported in neighboring Arab populations. We report a high proportion of affected children with G6PD Cairo, which was observed previously in only a single Egyptian, and a novel mutation G6PD "Gaza". Copyright © 2012 Elsevier Inc. All rights reserved.

  15. Three-dimensional modeling of glucose-6-phosphate dehydrogenase-deficient variants from German ancestry.

    PubMed

    Kiani, Farooq; Schwarzl, Sonja; Fischer, Stefan; Efferth, Thomas

    2007-07-18

    Loss of function of dimeric glucose-6-phosphate dehydrogenase (G6PD) represents the most common inborn error of metabolism throughout the world affecting an estimated 400 million people. In Germany, this enzymopathy is very rare. On the basis of G6PD crystal structures, we have analyzed six G6PD variants of German ancestry by three-dimensional modeling. All mutations present in the German population are either close to one of the three G6P or NADP(+) units or to the interface of the two monomers. Two of the three mutated amino acids of G6PD Vancouver are closer to the binding site of NADP(+). The G6PD Aachen mutation is also closer to the second NADP(+) unit. The G6PD Wayne mutation is closer to the G6P binding region. These mutations may affect the binding of G6P and NADP(+) units. Three mutations, i.e. G6PD Munich, G6PD Riverside and G6PD Gastonia, lie closer to the interface of the two monomers. These may also affect the interface of two monomers. None of these G6PD variants share mutations with the common G6PD variants known from the Mediterranean, Near East, or Africa indicating that they have developed independently. The G6PD variants have been compared with mutants from other populations and the implications for survival of G6PD variants from natural selection have been discussed.

  16. Molecular characterization of glucose-6-phosphate dehydrogenase deficiency in the Eastern Province of Saudi Arabia.

    PubMed

    Al-Ali, Amein K; Al-Mustafa, Zaki H; Al-Madan, Mohammed; Qaw, Foad; Al-Ateeq, Suad

    2002-08-01

    The level of activity of the enzyme glucose-6-phosphate dehydrogenase (G6PD) was determined in 154 unrelated Saudi males and females with G6PD deficiency who were residing in the Eastern Province of Saudi Arabia. DNA was extracted from blood samples and analyzed for known G6PD mutations by polymerase chain reaction (PCR) and restriction fragment length polymorphism techniques. Two different polymorphic mutations were identified which accounted for 90% of the samples analyzed. Of 114 G6PD-deficient males, 96 had G6PD Mediterranean, nine had African deficient variant G6PD A- and in nine the mutation has not been identified. Of the 40 G6PD-deficient females, 34 were homozygous for the G6PD Mediterranean mutation and six were genetic compound, G6PD Mediterranean/G6PD A-. The data indicate that the G6PD Mediterranean mutation is the most common (84%) in the Eastern Province, followed by G6PD A- (5.8%). Seventy one subjects who suffered from favism were found to carry the Mediterranean mutation.

  17. G6PD deficiency at Sumba in Eastern Indonesia is prevalent, diverse and severe: implications for primaquine therapy against relapsing Vivax malaria.

    PubMed

    Satyagraha, Ari Winasti; Sadhewa, Arkasha; Baramuli, Vanessa; Elvira, Rosalie; Ridenour, Chase; Elyazar, Iqbal; Noviyanti, Rintis; Coutrier, Farah Novita; Harahap, Alida Roswita; Baird, J Kevin

    2015-03-01

    Safe treatment of Plasmodium vivax requires diagnosis of both the infection and status of erythrocytic glucose-6-phosphate dehydrogenase (G6PD) activity because hypnozoitocidal therapy against relapse requires primaquine, which causes a mild to severe acute hemolytic anemia in G6PD deficient patients. Many national malaria control programs recommend primaquine therapy without G6PD screening but with monitoring due to a broad lack of G6PD deficiency screening capacity. The degree of risk in doing so hinges upon the level of residual G6PD activity among the variants present in any given area. We conducted studies on Sumba Island in eastern Indonesia in order to assess the potential threat posed by primaquine therapy without G6PD screening. We sampled 2,033 residents of three separate districts in western Sumba for quantitative G6PD activity and 104 (5.1%) were phenotypically deficient (<4.6U/gHb; median normal 10U/gHb). The villages were in two distinct ecosystems, coastal and inland. A positive correlation occurred between the prevalence of malaria and G6PD deficiency: 5.9% coastal versus inland 0.2% for malaria (P<0.001), and 6.7% and 3.1% for G6PD deficiency (P<0.001) at coastal and inland sites, respectively. The dominant genotypes of G6PD deficiency were Vanua Lava, Viangchan, and Chatham, accounting for 98.5% of the 70 samples genotyped. Subjects expressing the dominant genotypes all had less than 10% of normal enzyme activities and were thus considered severe variants. Blind administration of anti-relapse primaquine therapy at Sumba would likely impose risk of serious harm.

  18. G6PD Deficiency at Sumba in Eastern Indonesia Is Prevalent, Diverse and Severe: Implications for Primaquine Therapy against Relapsing Vivax Malaria

    PubMed Central

    Satyagraha, Ari Winasti; Sadhewa, Arkasha; Baramuli, Vanessa; Elvira, Rosalie; Ridenour, Chase; Elyazar, Iqbal; Noviyanti, Rintis; Coutrier, Farah Novita; Harahap, Alida Roswita; Baird, J. Kevin

    2015-01-01

    Safe treatment of Plasmodium vivax requires diagnosis of both the infection and status of erythrocytic glucose-6-phosphate dehydrogenase (G6PD) activity because hypnozoitocidal therapy against relapse requires primaquine, which causes a mild to severe acute hemolytic anemia in G6PD deficient patients. Many national malaria control programs recommend primaquine therapy without G6PD screening but with monitoring due to a broad lack of G6PD deficiency screening capacity. The degree of risk in doing so hinges upon the level of residual G6PD activity among the variants present in any given area. We conducted studies on Sumba Island in eastern Indonesia in order to assess the potential threat posed by primaquine therapy without G6PD screening. We sampled 2,033 residents of three separate districts in western Sumba for quantitative G6PD activity and 104 (5.1%) were phenotypically deficient (<4.6U/gHb; median normal 10U/gHb). The villages were in two distinct ecosystems, coastal and inland. A positive correlation occurred between the prevalence of malaria and G6PD deficiency: 5.9% coastal versus inland 0.2% for malaria (P<0.001), and 6.7% and 3.1% for G6PD deficiency (P<0.001) at coastal and inland sites, respectively. The dominant genotypes of G6PD deficiency were Vanua Lava, Viangchan, and Chatham, accounting for 98.5% of the 70 samples genotyped. Subjects expressing the dominant genotypes all had less than 10% of normal enzyme activities and were thus considered severe variants. Blind administration of anti-relapse primaquine therapy at Sumba would likely impose risk of serious harm. PMID:25746733

  19. Comprehensive Characterization of Cancer Driver Genes and Mutations.

    PubMed

    Bailey, Matthew H; Tokheim, Collin; Porta-Pardo, Eduard; Sengupta, Sohini; Bertrand, Denis; Weerasinghe, Amila; Colaprico, Antonio; Wendl, Michael C; Kim, Jaegil; Reardon, Brendan; Ng, Patrick Kwok-Shing; Jeong, Kang Jin; Cao, Song; Wang, Zixing; Gao, Jianjiong; Gao, Qingsong; Wang, Fang; Liu, Eric Minwei; Mularoni, Loris; Rubio-Perez, Carlota; Nagarajan, Niranjan; Cortés-Ciriano, Isidro; Zhou, Daniel Cui; Liang, Wen-Wei; Hess, Julian M; Yellapantula, Venkata D; Tamborero, David; Gonzalez-Perez, Abel; Suphavilai, Chayaporn; Ko, Jia Yu; Khurana, Ekta; Park, Peter J; Van Allen, Eliezer M; Liang, Han; Lawrence, Michael S; Godzik, Adam; Lopez-Bigas, Nuria; Stuart, Josh; Wheeler, David; Getz, Gad; Chen, Ken; Lazar, Alexander J; Mills, Gordon B; Karchin, Rachel; Ding, Li

    2018-04-05

    Identifying molecular cancer drivers is critical for precision oncology. Multiple advanced algorithms to identify drivers now exist, but systematic attempts to combine and optimize them on large datasets are few. We report a PanCancer and PanSoftware analysis spanning 9,423 tumor exomes (comprising all 33 of The Cancer Genome Atlas projects) and using 26 computational tools to catalog driver genes and mutations. We identify 299 driver genes with implications regarding their anatomical sites and cancer/cell types. Sequence- and structure-based analyses identified >3,400 putative missense driver mutations supported by multiple lines of evidence. Experimental validation confirmed 60%-85% of predicted mutations as likely drivers. We found that >300 MSI tumors are associated with high PD-1/PD-L1, and 57% of tumors analyzed harbor putative clinically actionable events. Our study represents the most comprehensive discovery of cancer genes and mutations to date and will serve as a blueprint for future biological and clinical endeavors. Published by Elsevier Inc.

  20. G6PD Deficiency and Antimalarial Efficacy for Uncomplicated Malaria in Bangladesh: A Prospective Observational Study.

    PubMed

    Ley, Benedikt; Alam, Mohammad Shafiul; Thriemer, Kamala; Hossain, Mohammad Sharif; Kibria, Mohammad Golam; Auburn, Sarah; Poirot, Eugenie; Price, Ric N; Khan, Wasif Ali

    2016-01-01

    The Bangladeshi national treatment guidelines for uncomplicated malaria follow WHO recommendations but without G6PD testing prior to primaquine administration. A prospective observational study was conducted to assess the efficacy of the current antimalarial policy. Patients with uncomplicated malaria, confirmed by microscopy, attending a health care facility in the Chittagong Hill Tracts, Bangladesh, were treated with artemether-lumefantrine (days 0-2) plus single dose primaquine (0.75mg/kg on day2) for P. falciparum infections, or with chloroquine (days 0-2) plus 14 days primaquine (3.5mg/kg total over 14 days) for P. vivax infections. Hb was measured on days 0, 2 and 9 in all patients and also on days 16 and 30 in patients with P. vivax infection. Participants were followed for 30 days. The study was registered with the clinical trials website (NCT02389374). Between September 2014 and February 2015 a total of 181 patients were enrolled (64% P. falciparum, 30% P. vivax and 6% mixed infections). Median parasite clearance times were 22.0 (Interquartile Range, IQR: 15.2-27.3) hours for P. falciparum, 20.0 (IQR: 9.5-22.7) hours for P. vivax and 16.6 (IQR: 10.0-46.0) hours for mixed infections. All participants were afebrile within 48 hours, two patients with P. falciparum infection remained parasitemic at 48 hours. No patient had recurrent parasitaemia within 30 days. Adjusted male median G6PD activity was 7.82U/gHb. One male participant (1/174) had severe G6PD deficiency (<10% activity), five participants (5/174) had mild G6PD deficiency (10-60% activity). The Hb nadir occurred on day 2 prior to primaquine treatment in P. falciparum and P. vivax infected patients; mean fractional fall in Hb was -8.8% (95%CI -6.7% to -11.0%) and -7.4% (95%CI: -4.5 to -10.4%) respectively. The current antimalarial policy remains effective. The prevalence of G6PD deficiency was low. Main contribution to haemolysis in G6PD normal individuals was attributable to acute malaria rather than

  1. Single Low Dose Primaquine (0.25mg/kg) Does Not Cause Clinically Significant Haemolysis in G6PD Deficient Subjects

    PubMed Central

    Bancone, Germana; Chowwiwat, Nongnud; Somsakchaicharoen, Raweewan; Poodpanya, Lalita; Moo, Paw Khu; Gornsawun, Gornpan; Kajeechiwa, Ladda; Thwin, May Myo; Rakthinthong, Santisuk; Nosten, Suphak; Thinraow, Suradet; Nyo, Slight Naw; Ling, Clare L.; Wiladphaingern, Jacher; Kiricharoen, Naw Lily; Moore, Kerryn A.; White, Nicholas J.; Nosten, Francois

    2016-01-01

    Background Primaquine is the only drug consistently effective against mature gametocytes of Plasmodium falciparum. The transmission blocking dose of primaquine previously recommended was 0.75mg/kg (adult dose 45mg) but its deployment was limited because of concerns over haemolytic effects in patients with glucose-6-phosphate dehydrogenase (G6PD) deficiency. G6PD deficiency is an inherited X-linked enzymatic defect that affects an estimated 400 million people around the world with high frequencies (15–20%) in populations living in malarious areas. To reduce transmission in low transmission settings and facilitate elimination of P. falciparum, the World Health Organization now recommends adding a single dose of 0.25mg/kg (adult dose 15mg) to Artemisinin-based Combination Therapies (ACTs) without G6PD testing. Direct evidence of the safety of this low dose is lacking. Adverse events and haemoglobin variations after this treatment were assessed in both G6PD normal and deficient subjects in the context of targeted malaria elimination in a malaria endemic area on the North-Western Myanmar-Thailand border where prevalence of G6PD deficiency (Mahidol variant) approximates 15%. Methods and Findings The tolerability and safety of primaquine (single dose 0.25 mg base/kg) combined with dihydroartemisinin-piperaquine (DHA-PPQ) given three times at monthly intervals was assessed in 819 subjects. Haemoglobin concentrations were estimated over the six months preceding the ACT + primaquine rounds of mass drug administration. G6PD deficiency was assessed with a phenotypic test and genotyping was performed in male subjects with deficient phenotypes and in all females. Fractional haemoglobin changes in relation to G6PD phenotype and genotype and primaquine round were assessed using linear mixed-effects models. No adverse events related to primaquine were reported during the trial. Mean fractional haemoglobin changes after each primaquine treatment in G6PD deficient subjects (-5

  2. Single Low Dose Primaquine (0.25 mg/kg) Does Not Cause Clinically Significant Haemolysis in G6PD Deficient Subjects.

    PubMed

    Bancone, Germana; Chowwiwat, Nongnud; Somsakchaicharoen, Raweewan; Poodpanya, Lalita; Moo, Paw Khu; Gornsawun, Gornpan; Kajeechiwa, Ladda; Thwin, May Myo; Rakthinthong, Santisuk; Nosten, Suphak; Thinraow, Suradet; Nyo, Slight Naw; Ling, Clare L; Wiladphaingern, Jacher; Kiricharoen, Naw Lily; Moore, Kerryn A; White, Nicholas J; Nosten, Francois

    2016-01-01

    Primaquine is the only drug consistently effective against mature gametocytes of Plasmodium falciparum. The transmission blocking dose of primaquine previously recommended was 0.75 mg/kg (adult dose 45 mg) but its deployment was limited because of concerns over haemolytic effects in patients with glucose-6-phosphate dehydrogenase (G6PD) deficiency. G6PD deficiency is an inherited X-linked enzymatic defect that affects an estimated 400 million people around the world with high frequencies (15-20%) in populations living in malarious areas. To reduce transmission in low transmission settings and facilitate elimination of P. falciparum, the World Health Organization now recommends adding a single dose of 0.25 mg/kg (adult dose 15 mg) to Artemisinin-based Combination Therapies (ACTs) without G6PD testing. Direct evidence of the safety of this low dose is lacking. Adverse events and haemoglobin variations after this treatment were assessed in both G6PD normal and deficient subjects in the context of targeted malaria elimination in a malaria endemic area on the North-Western Myanmar-Thailand border where prevalence of G6PD deficiency (Mahidol variant) approximates 15%. The tolerability and safety of primaquine (single dose 0.25 mg base/kg) combined with dihydroartemisinin-piperaquine (DHA-PPQ) given three times at monthly intervals was assessed in 819 subjects. Haemoglobin concentrations were estimated over the six months preceding the ACT + primaquine rounds of mass drug administration. G6PD deficiency was assessed with a phenotypic test and genotyping was performed in male subjects with deficient phenotypes and in all females. Fractional haemoglobin changes in relation to G6PD phenotype and genotype and primaquine round were assessed using linear mixed-effects models. No adverse events related to primaquine were reported during the trial. Mean fractional haemoglobin changes after each primaquine treatment in G6PD deficient subjects (-5.0%, -4.2% and -4.7%) were greater

  3. Promoter hypermethylation of the DNA repair gene O(6)-methylguanine-DNA methyltransferase is associated with the presence of G:C to A:T transition mutations in p53 in human colorectal tumorigenesis.

    PubMed

    Esteller, M; Risques, R A; Toyota, M; Capella, G; Moreno, V; Peinado, M A; Baylin, S B; Herman, J G

    2001-06-15

    Defects in DNA repair may be responsible for the genesis of mutations in key genes in cancer cells. The tumor suppressor gene p53 is commonly mutated in human cancer by missense point mutations, most of them G:C to A:T transitions. A recognized cause for this type of change is spontaneous deamination of the methylcytosine. However, the persistence of a premutagenic O(6)-methylguanine can also be invoked. This last lesion is removed in the normal cell by the DNA repair enzyme O(6)-methylguanine-DNA methyltransferase (MGMT). In many tumor types, epigenetic silencing of MGMT by promoter hypermethylation has been demonstrated and linked to the appearance of G to A mutations in the K-ras oncogene in colorectal tumors. To study the relevance of defective MGMT function by aberrant methylation in relation to the presence of p53 mutations, we studied 314 colorectal tumors for MGMT promoter hypermethylation and p53 mutational spectrum. Inactivation of MGMT by aberrant methylation was associated with the appearance of G:C to A:T transition mutations at p53 (Fischer's exact test, two-tailed; P = 0.01). Overall, MGMT methylated tumors displayed p53 transition mutations in 43 of 126 (34%) cases, whereas MGMT unmethylated tumors only showed G:C to A:T changes in 37 of 188 (19%) tumors. A more striking association was found in G:C to A:T transitions in non-CpG dinucleotides; 71% (12 of 17) of the total non-CpG transition mutations in p53 were observed in MGMT aberrantly methylated tumors (Fischer's exact test, two-tailed; P = 0.008). Our data suggest that epigenetic silencing of MGMT by promoter hypermethylation may lead to G:C to A:T transition mutations in p53.

  4. A novel homozygous mutation in G6PC3 presenting as cyclic neutropenia and severe congenital neutropenia in the same family.

    PubMed

    Alangari, Abdullah A; Alsultan, Abdulrahman; Osman, Mohamed Elfaki; Anazi, Shamsa; Alkuraya, Fowzan S

    2013-11-01

    Patients with autosomal recessive cyclic neutropenia have no known causative genetic defect yet. Autozygosity mapping on two branches of an extended multiplex consanguineous family presenting with cyclic neutropenia or severe congenital neutropenia to look for candidate gene, followed by candidate gene selection and sequencing. A single autozygous interval on Chr17:33,901,938-45,675,414 that is exclusively shared by the affected members was identified. This interval spans 11.8 Mb and contains 30 genes. Review of these genes highlighted G6PC3 as the most likely candidate given its known role in neutrophil biology. Direct sequencing revealed a novel homozygous mutation (NM_138387.3, c.974T > G, p.Leu325Arg). Two of our patients had associated congenital defects that are known to occur in patients with G6PC3 mutations, including congenital heart disease and intermittent thrombocytopenia. Biallelic G6PC3 defects should be considered in patients with autosomal recessive cyclic neutropenia, especially those with typical associated congenital defects.

  5. The Impact of Phenotypic and Genotypic G6PD Deficiency on Risk of Plasmodium vivax Infection: A Case-Control Study amongst Afghan Refugees in Pakistan

    PubMed Central

    Leslie, Toby; Briceño, Marnie; Mayan, Ismail; Mohammed, Nasir; Klinkenberg, Eveline; Sibley, Carol Hopkins; Whitty, Christopher J. M.; Rowland, Mark

    2010-01-01

    Background The most common form of malaria outside Africa, Plasmodium vivax, is more difficult to control than P. falciparum because of the latent liver hypnozoite stage, which causes multiple relapses and provides an infectious reservoir. The African (A−) G6PD (glucose-6-phosphate dehydrogenase) deficiency confers partial protection against severe P. falciparum. Recent evidence suggests that the deficiency also confers protection against P. vivax, which could explain its wide geographical distribution in human populations. The deficiency has a potentially serious interaction with antirelapse therapies (8-aminoquinolines such as primaquine). If the level of protection was sufficient, antirelapse therapy could become more widely available. We therefore tested the hypothesis that G6PD deficiency is protective against vivax malaria infection. Methods and Findings A case-control study design was used amongst Afghan refugees in Pakistan. The frequency of phenotypic and genotypic G6PD deficiency in individuals with vivax malaria was compared against controls who had not had malaria in the previous two years. Phenotypic G6PD deficiency was less common amongst cases than controls (cases: 4/372 [1.1%] versus controls 42/743 [5.7%]; adjusted odds ratio [AOR] 0.18 [95% confidence interval (CI) 0.06–0.52], p = 0.001). Genetic analysis demonstrated that the G6PD deficiency allele identified (Mediterranean type) was associated with protection in hemizygous deficient males (AOR = 0.12 [95% CI 0.02–0.92], p = 0.041). The deficiency was also protective in females carrying the deficiency gene as heterozygotes or homozygotes (pooled AOR = 0.37 [95% CI 0.15–0.94], p = 0.037). Conclusions G6PD deficiency (Mediterranean type) conferred significant protection against vivax malaria infection in this population whether measured by phenotype or genotype, indicating a possible evolutionary role for vivax malaria in the selective retention of the G6PD deficiency

  6. Novel mutations in the USH1C gene in Usher syndrome patients.

    PubMed

    Aparisi, María José; García-García, Gema; Jaijo, Teresa; Rodrigo, Regina; Graziano, Claudio; Seri, Marco; Simsek, Tulay; Simsek, Enver; Bernal, Sara; Baiget, Montserrat; Pérez-Garrigues, Herminio; Aller, Elena; Millán, José María

    2010-12-31

    Usher syndrome type I (USH1) is an autosomal recessive disorder characterized by severe-profound sensorineural hearing loss, retinitis pigmentosa, and vestibular areflexia. To date, five USH1 genes have been identified. One of these genes is Usher syndrome 1C (USH1C), which encodes a protein, harmonin, containing PDZ domains. The aim of the present work was the mutation screening of the USH1C gene in a cohort of 33 Usher syndrome patients, to identify the genetic cause of the disease and to determine the relative involvement of this gene in USH1 pathogenesis in the Spanish population. Thirty-three patients were screened for mutations in the USH1C gene by direct sequencing. Some had already been screened for mutations in the other known USH1 genes (myosin VIIA [MYO7A], cadherin-related 23 [CDH23], protocadherin-related 15 [PCDH15], and Usher syndrome 1G [USH1G]), but no mutation was found. Two novel mutations were found in the USH1C gene: a non-sense mutation (p.C224X) and a frame-shift mutation (p.D124TfsX7). These mutations were found in a homozygous state in two unrelated USH1 patients. In the present study, we detected two novel pathogenic mutations in the USH1C gene. Our results suggest that mutations in USH1C are responsible for 1.5% of USH1 disease in patients of Spanish origin (considering the total cohort of 65 Spanish USH1 patients since 2005), indicating that USH1C is a rare form of USH in this population.

  7. Novel mutations in the USH1C gene in Usher syndrome patients

    PubMed Central

    Aparisi, María José; García-García, Gema; Jaijo, Teresa; Rodrigo, Regina; Graziano, Claudio; Seri, Marco; Simsek, Tulay; Simsek, Enver; Bernal, Sara; Baiget, Montserrat; Pérez-Garrigues, Herminio; Millán, José María

    2010-01-01

    Purpose Usher syndrome type I (USH1) is an autosomal recessive disorder characterized by severe-profound sensorineural hearing loss, retinitis pigmentosa, and vestibular areflexia. To date, five USH1 genes have been identified. One of these genes is Usher syndrome 1C (USH1C), which encodes a protein, harmonin, containing PDZ domains. The aim of the present work was the mutation screening of the USH1C gene in a cohort of 33 Usher syndrome patients, to identify the genetic cause of the disease and to determine the relative involvement of this gene in USH1 pathogenesis in the Spanish population. Methods Thirty-three patients were screened for mutations in the USH1C gene by direct sequencing. Some had already been screened for mutations in the other known USH1 genes (myosin VIIA [MYO7A], cadherin-related 23 [CDH23], protocadherin-related 15 [PCDH15], and Usher syndrome 1G [USH1G]), but no mutation was found. Results Two novel mutations were found in the USH1C gene: a non-sense mutation (p.C224X) and a frame-shift mutation (p.D124TfsX7). These mutations were found in a homozygous state in two unrelated USH1 patients. Conclusions In the present study, we detected two novel pathogenic mutations in the USH1C gene. Our results suggest that mutations in USH1C are responsible for 1.5% of USH1 disease in patients of Spanish origin (considering the total cohort of 65 Spanish USH1 patients since 2005), indicating that USH1C is a rare form of USH in this population. PMID:21203349

  8. Case report of a novel homozygous splice site mutation in PLA2G6 gene causing infantile neuroaxonal dystrophy in a Sudanese family.

    PubMed

    Elsayed, Liena E O; Mohammed, Inaam N; Hamed, Ahlam A A; Elseed, Maha A; Salih, Mustafa A M; Yahia, Ashraf; Siddig, Rayan A; Amin, Mutaz; Koko, Mahmoud; Elbashir, Mustafa I; Ibrahim, Muntaser E; Brice, Alexis; Ahmed, Ammar E; Stevanin, Giovanni

    2018-05-08

    Infantile neuroaxonal dystrophy (INAD) is a rare hereditary neurological disorder caused by mutations in PLA2G6. The disease commonly affects children below 3 years of age and presents with delay in motor skills, optic atrophy and progressive spastic tetraparesis. Studies of INAD in Africa are extremely rare, and genetic studies from Sub Saharan Africa are almost non-existent. Two Sudanese siblings presented, at ages 18 and 24 months, with regression in both motor milestones and speech development and hyper-reflexia. Brain MRI showed bilateral and symmetrical T2/FLAIR hyperintense signal changes in periventricular areas and basal ganglia and mild cerebellar atrophy. Whole exome sequencing with confirmatory Sanger sequencing were performed for the two patients and healthy family members. A novel variant (NM_003560.2 c.1427 + 2 T > C) acting on a splice donor site and predicted to lead to skipping of exon 10 was found in PLA2G6. It was found in a homozygous state in the two patients and homozygous reference or heterozygous in five healthy family members. This variant has one very strong (loss of function mutation) and three supporting evidences for its pathogenicity (segregation with the disease, multiple computational evidence and specific patients' phenotype). Therefore this variant can be currently annotated as "pathogenic". This is the first study to report mutations in PLA2G6 gene in patients from Sudan.

  9. Two new mutations in the MTATP6 gene associated with Leigh syndrome.

    PubMed

    Moslemi, A-R; Darin, N; Tulinius, M; Oldfors, A; Holme, E

    2005-10-01

    In this study we have analyzed the mtDNA encoded ATPase 6 and 8 genes ( MTATP6 and MTATP8) in two children with Leigh syndrome (LS) and reduced Mg (2+) ATPase activity in muscle mitochondria. In patient 1, with a mild and reversible phenotype, mutational analysis revealed a heteroplasmic T --> C mutation at nt position 9185 (T9185C) in the MTATP6. The mutation resulted in substitution of a highly conserved leucine to proline at codon 220. The proportion of the mutation was > 97 % in the patient's blood and muscle and 85 % in blood of his asymptomatic mother. Patient 2, with severe clinical phenotype and death at 2 years of age, exhibited a novel heteroplasmic T9191C missense mutation in the MTATP6, which converted a highly conserved leucine to a proline at position 222 of the polypeptide. The proportion of the mutation was 90 % in fibroblasts and 94 % muscle tissue. This mutation was absent in the patient's parents and sister suggesting that the mutation was de novo. Our findings expand the spectrum of mutations causing LS and emphasize the role of MTATP6 gene mutations in pathogenesis of LS.

  10. Kawasaki disease with G6PD deficiency--report of one case and literature review.

    PubMed

    Chen, Chia-Hao; Lin, Li-Yan; Yang, Kuender D; Hsieh, Kai-Sheng; Kuo, Ho-Chang

    2014-06-01

    Kawasaki disease (KD) is a systemic vasculitis primarily affecting children who are younger than 5 years. The most serious complications are coronary artery aneurysms and sequelae of vasculitis with the subsequent development of coronary artery aneurysm. According to the literature, intravenous immunoglobulin (IVIG) plus high-dose aspirin (acetylsalicylic acid) were standard treatment for KD, whereas low-dose aspirin (3-5 mg/kg/day) was used for thrombocytosis in KD via antiplatelet effect. However, aspirin has been reported to have hemolytic potential in individuals with glucose-6-phosphate dehydrogenase (G6PD) deficiency. We report a child with G6PD-deficiency who has KD, and review the literature. Copyright © 2012. Published by Elsevier B.V.

  11. Life and Death of Glucose-6-Phosphate Dehydrogenase (G6PD) Deficient Erythrocytes - Role of Redox Stress and Band 3 Modifications.

    PubMed

    Arese, Paolo; Gallo, Valentina; Pantaleo, Antonella; Turrini, Franco

    2012-10-01

    G6PD catalyzes the first, pace-making reaction of pentosephosphate cycle (PPC) which produces NADPH. NADPH maintains glutathione and thiol groups of proteins and enzymes in the reduced state which is essential for protection against oxidative stress. Individuals affected by G6PD deficiency are unable to regenerate reduced glutathione (GSH) and are undefended against oxidative stress. G6PD deficiency accelerates normal senescence and enhances the precocious removal of chronologically young, yet biologically old cells. The term hemolytic anemia is misleading because RBCs do not lyse but are removed by phagocytosis. Acute hemolysis by fava bean ingestion in G6PD deficient individuals (favism) is described being the best-studied natural model of oxidant damage. It bears strong analogies to hemolysis by oxidant drugs or chemicals. Membrane alterations observed in vivo during favism are superimposable to changes in senescent RBCs. In summary, RBC membranes isolated from favic patients contained elevated amounts of complexes between IgG and the complement fragment C3b/C3c and were prone to vesiculation. Anti-band 3 IgG reacted to aggregated band 3-complement complexes. In favism extensive clustering of band 3 and membrane deposition of hemichromes were also observed. Severely damaged RBCs isolated from early crises had extensive membrane cross-bonding and very low GSH levels and were phagocytosed 10-fold more intensely compared to normal RBCs.

  12. Glucose-6-phosphate dehydrogenase variants associated with favism in Thai children.

    PubMed

    Laosombat, Vichai; Sattayasevana, Benjamas; Chotsampancharoen, Teerachit; Wongchanchailert, Malai

    2006-02-01

    In a study conducted at Songklanagarind Hospital in the south of Thailand, the subjects were 225 patients (210 boys and 15 girls) with glucose-6-phosphate dehydrogenase (G6PD) deficiency. Favism was found in 3.6% of the G6PD-deficient children. Approximately one half of the G6PD-deficient patients with favism were younger than 2 years. Sudden onset of anemia was found within 1 to 3 days after ingestion of dried fava beans. The classic features of favism, which are pallor, hemoglobinuria, and jaundice, were detected in all cases. To characterize the known G6PD mutations in Thai children, molecular analysis was performed for 8 G6PD-deficient children with favism by a combination of polymerase chain reaction-restriction fragment length polymorphism analysis and amplification refractory mutation system analysis. The G6PD variants in these children were G6PD Kaiping 1388,G-->A; G6PD Mahidol 487,G-->A; G6PD Viangchan 871,G-->A; and uncharacterized mutation with silent mutation 1311,C-->T.

  13. Tools for mass screening of G6PD deficiency: validation of the WST8/1-methoxy-PMS enzymatic assay in Uganda.

    PubMed

    De Niz, Mariana; Eziefula, Alice C; Othieno, Lucas; Mbabazi, Edith; Nabukeera, Damalie; Ssemmondo, Emmanuel; Gonahasa, Samuel; Tumwebaze, Patrick; Diliberto, Deborah; Maiteki-Sebuguzi, Catherine; Staedke, Sarah G; Drakeley, Chris

    2013-06-19

    The distribution of the enzymopathy glucose-6-phosphate dehydrogenase (G6PD) deficiency is linked to areas of high malaria endemicity due to its association with protection from disease. G6PD deficiency is also identified as the cause of severe haemolysis following administration of the anti-malarial drug primaquine and further use of this drug will likely require identification of G6PD deficiency on a population level. Current conventional methods for G6PD screening have various disadvantages for field use. The WST8/1-methoxy PMS method, recently adapted for field use, was validated using a gold standard enzymatic assay (R&D Diagnostics Ltd ®) in a study involving 235 children under five years of age, who were recruited by random selection from a cohort study in Tororo, Uganda. Blood spots were collected by finger-prick onto filter paper at routine visits, and G6PD activity was determined by both tests. Performance of the WST8/1-methoxy PMS test under various temperature, light, and storage conditions was evaluated. The WST8/1-methoxy PMS assay was found to have 72% sensitivity and 98% specificity when compared to the commercial enzymatic assay and the AUC was 0.904, suggesting good agreement. Misclassifications were at borderline values of G6PD activity between mild and normal levels, or related to outlier haemoglobin values (<8.0 gHb/dl or >14 gHb/dl) associated with ongoing anaemia or recent haemolytic crises. Although severe G6PD deficiency was not found in the area, the test enabled identification of low G6PD activity. The assay was found to be highly robust for field use; showing less light sensitivity, good performance over a wide temperature range, and good capacity for medium-to-long term storage. The WST8/1-methoxy PMS assay was comparable to the currently used standard enzymatic test, and offers advantages in terms of cost, storage, portability and use in resource-limited settings. Such features make this test a potential key tool for deployment in the

  14. Effects of cell salvage on erythrocyte 2,3-disphosphoglycerate and G-6-PD levels and phosphatidylserine expression.

    PubMed

    Che, J; Tian, M; Ding, G; Huai, Q; Dong, P; Li, Y; Li, S

    2013-08-01

    The aim of this study was to investigate the contribution of the perioperative cell salvage process to the changes in erythrocyte 2,3-disphosphoglycerate (2,3-DPG) and glucose-6-phosphate dehydrogenase (G-6-PD) levels and phosphatidylserine (PS) expression using a self-control study comparing washed blood with venous blood. Thirty patients undergoing elective heart and blood vessel surgery were enrolled. Blood was collected and processed using a Fresenius continuous autotransfusion system device. 2,3-DPG and G-6-PD activities, as well as PS expression, from both venous and washed red blood cells (RBC) were measured. We also compared these indicators among washed RBC at 6 h, washed RBC at 0 h, and venous RBC. 2,3-DPG and G-6-PD activities in washed blood at 0 h were significantly higher than in venous RBC (2,3-DPG, venous vs. washed blood P < 0.05; G-6-PD, venous vs. washed blood P < 0.05). Flow cytometry results showed no differences between venous blood and washed RBC at 0 h (n = 23, P > 0.05). 2,3-DPG activity in washed RBC that were allowed to stand for 6 h decreased compared with that in venous blood (venous vs. washed blood at 6 h P < 0.01), whereas no significant difference was observed in G-6-PD activity (venous. vs. washed blood at 6 h P > 0.05). Compared with venous RBC, washed RBC from intraoperative cell salvage exhibited good oxygen-carrying and antioxidant capacities. However, the oxygen-carrying capacity of washed RBC that were allowed to stand for 6 h was not as good as that of venous RBC. Thus, we suggest that washed RBC that were left to stand for more than 6 h should not be reinfused. © 2012 John Wiley & Sons Ltd.

  15. Review and drug therapy implications of glucose-6-phosphate dehydrogenase deficiency.

    PubMed

    Belfield, Kristen D; Tichy, Eric M

    2018-02-01

    The pathophysiology, diagnosis, and medication-use implications of glucose-6-phosphate dehydrogenase (G6PD) deficiency, the most common enzyme deficiency in humans, are reviewed. Originally identified as favism in patients who experienced hemolysis after ingestion of fava beans, G6PD deficiency results from an X-linked chromosomal mutation that leads to reduced activity of the enzyme responsible for the final step of the pentose phosphate pathway, through which reduced nicotinamide adenine dinucleotide phosphate required for protection of cells from oxidative stress is produced. G6PD deficiency affects about 400 million people worldwide. Diagnosis of G6PD can be made through detection of enzymatic activity (by spectrophotometric testing, fluorescence testing, or formazan-based spot testing) or molecular analysis to detect known mutations of the gene encoding G6PD. Most individuals with G6PD deficiency are asymptomatic throughout life. Symptoms of acute hemolysis associated with G6PD deficiency include anemia, fatigue, back or abdominal pain, jaundice, and hemoglobinuria. The most common precipitators of oxidative stress and hemolysis in G6PD deficiency include medication use and infection. G6PD deficiency should be considered in patients who experience acute hemolysis after exposure to known oxidative medications, infection, or ingestion of fava beans. A diagnosis of G6PD deficiency is most often made through enzymatic activity detection, but molecular analysis may be required in females heterozygous for the disorder. When clinically feasible, rasburicase, primaquine, dapsone, pegloticase, and methylene blue should not be used until a G6PD diagnostic test has been performed. Copyright © 2018 by the American Society of Health-System Pharmacists, Inc. All rights reserved.

  16. Hyperglycaemia per se does not affect erythrocyte glucose-6-phosphate dehydrogenase activity in ketosis-prone diabetes.

    PubMed

    Choukem, S P; Sobngwi, E; Garnier, J P; Letellier, S; Mauvais-Jarvis, F; Calvo, F; Gautier, J-F

    2015-09-01

    Previously, we described patients with ketosis-prone type 2 diabetes (KPD) and glucose-6-phosphate dehydrogenase (G6PD) deficiency, but no mutation of the G6PD gene. Our present study used two complementary approaches to test whether hyperglycaemia might inhibit G6PD activity: (1) effect of acute hyperglycaemia induced by glucose ramping; and (2) effect of chronic hyperglycaemia using correlation between G6PD activity and HbA1c levels. In the first substudy, 16 KPD patients were compared with 11 healthy, non-diabetic control subjects of the same geographical background. Erythrocyte G6PD activity and plasma glucose were assessed at baseline and every 40 min during intravenous glucose ramping that allowed maintaining hyperglycaemia for more than 3h. In the second substudy, erythrocyte G6PD activity and HbA1c levels were evaluated in 108 consecutive African patients with either type 2 diabetes or KPD, and a potential correlation sought between the two variables. The maximum plasma glucose level after 200 min of glucose perfusion was 20.9±3.7 mmol/L for patients and 10.7±2.3mmol/L for controls. There was no difference between baseline and repeated G6PD activity levels during acute hyperglycaemia in either KPD patients (P=0.94) or controls (P=0.57), nor was there any significant correlation between residual erythrocyte G6PD activity and HbA1c levels (r=-0.085, P=0.38). Neither acute nor chronic hyperglycaemia affects erythrocyte G6PD activity. Thus, hyperglycaemia alone does not explain cases of G6PD deficiency in the absence of gene mutation as described earlier. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  17. Missense mutations (p.H371Y, p.D438Y) in gene CHEK2 are associated with breast cancer risk in women of Balochistan origin.

    PubMed

    Baloch, Abdul Hameed; Daud, Shakeela; Raheem, Nafeesa; Luqman, Muhammad; Ahmad, Adeel; Rehman, Abdul; Shuja, Jameela; Rasheed, Saeeda; Ali, Akhtar; Kakar, Naseebullah; Naseeb, Hafiz Khush; Mengal, Mohammad Alam; Awan, Muhammad Arif; Wasim, Muhammad; Baloch, Dost Mohammad; Ahmad, Jamil

    2014-02-01

    CHEK2 encodes a serine/threonine-protein kinase which plays a critical role in DNA damage signaling pathways. CHEK2 directly phosphorylates and regulates the functions of p53 and BRCA1. Most women with breast and/or ovarian cancer are not carriers of mutant BRCA1 or BRCA2. Multiple studies have shown that a CHEK2*1100delC confers about a two-fold increased risk of breast cancer in unselected females and a tenfold increase in males. Moreover, studies have shown that first-degree relatives of bilateral breast cancer cases who carried the CHEK2*1100delC allele had an eight-fold increased risk of breast cancer. It has been suggested that CHEK2 functions as a low-penetrance susceptibility gene for cancers and multiplies the risks associated with other gene(s) to increase cancer risk. The main goal of this study was to evaluate and to compare the role of truncating mutations, splice junction mutations and rare missense substitutions in breast cancer susceptibility gene CHEK2. Present study was performed on 140 individuals including 70 breast cancer patients both with and without family history and 70 normal individuals. Written consent was obtained and 3 ml intravenous blood was drawn from all the subjects. DNA was extracted from all the samples through inorganic method published already. Primers were synthesized for all the 14 exons of CHEK2 gene. Coding and adjacent intronic sequences of CHEK2 gene were amplified and sequenced. Two genetic variants (p.H371Y, p.D438Y) were found in exon 10 and exon 11 of gene CHEK2 which were not found in any of the 70 control individuals from same geographical area and ethnic group. The genetic variant c.1312G>T (p.D438Y) identified in a patient with a family history of breast cancer. To our knowledge, this is first mutation scanning study of gene CHEK2 from Balochistan population.

  18. Tools for mass screening of G6PD deficiency: validation of the WST8/1-methoxy-PMS enzymatic assay in Uganda

    PubMed Central

    2013-01-01

    Background The distribution of the enzymopathy glucose-6-phosphate dehydrogenase (G6PD) deficiency is linked to areas of high malaria endemicity due to its association with protection from disease. G6PD deficiency is also identified as the cause of severe haemolysis following administration of the anti-malarial drug primaquine and further use of this drug will likely require identification of G6PD deficiency on a population level. Current conventional methods for G6PD screening have various disadvantages for field use. Methods The WST8/1-methoxy PMS method, recently adapted for field use, was validated using a gold standard enzymatic assay (R&D Diagnostics Ltd ®) in a study involving 235 children under five years of age, who were recruited by random selection from a cohort study in Tororo, Uganda. Blood spots were collected by finger-prick onto filter paper at routine visits, and G6PD activity was determined by both tests. Performance of the WST8/1-methoxy PMS test under various temperature, light, and storage conditions was evaluated. Results The WST8/1-methoxy PMS assay was found to have 72% sensitivity and 98% specificity when compared to the commercial enzymatic assay and the AUC was 0.904, suggesting good agreement. Misclassifications were at borderline values of G6PD activity between mild and normal levels, or related to outlier haemoglobin values (<8.0 gHb/dl or >14 gHb/dl) associated with ongoing anaemia or recent haemolytic crises. Although severe G6PD deficiency was not found in the area, the test enabled identification of low G6PD activity. The assay was found to be highly robust for field use; showing less light sensitivity, good performance over a wide temperature range, and good capacity for medium-to-long term storage. Conclusions The WST8/1-methoxy PMS assay was comparable to the currently used standard enzymatic test, and offers advantages in terms of cost, storage, portability and use in resource-limited settings. Such features make this test a

  19. Evaluation of the Diagnostic Accuracy of CareStart G6PD Deficiency Rapid Diagnostic Test (RDT) in a Malaria Endemic Area in Ghana, Africa

    PubMed Central

    Adu-Gyasi, Dennis; Asante, Kwaku Poku; Newton, Sam; Dosoo, David; Amoako, Sabastina; Adjei, George; Amoako, Nicholas; Ankrah, Love; Tchum, Samuel Kofi; Mahama, Emmanuel; Agyemang, Veronica; Kayan, Kingsley; Owusu-Agyei, Seth

    2015-01-01

    Background Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most widespread enzyme defect that can result in red cell breakdown under oxidative stress when exposed to certain medicines including antimalarials. We evaluated the diagnostic accuracy of CareStart G6PD deficiency Rapid Diagnostic Test (RDT) as a point-of-care tool for screening G6PD deficiency. Methods A cross-sectional study was conducted among 206 randomly selected and consented participants from a group with known G6PD deficiency status between February 2013 and June 2013. A maximum of 1.6ml of capillary blood samples were used for G6PD deficiency screening using CareStart G6PD RDT and Trinity qualitative with Trinity quantitative methods as the “gold standard”. Samples were also screened for the presence of malaria parasites. Data entry and analysis were done using Microsoft Access 2010 and Stata Software version 12. Kintampo Health Research Centre Institutional Ethics Committee granted ethical approval. Results The sensitivity (SE) and specificity (SP) of CareStart G6PD deficiency RDT was 100% and 72.1% compared to Trinity quantitative method respectively and was 98.9% and 96.2% compared to Trinity qualitative method. Malaria infection status had no significant (P=0.199) change on the performance of the G6PD RDT test kit compared to the “gold standard”. Conclusions The outcome of this study suggests that the diagnostic performance of the CareStart G6PD deficiency RDT kit was high and it is acceptable at determining the G6PD deficiency status in a high malaria endemic area in Ghana. The RDT kit presents as an attractive tool for point-of-care G6PD deficiency for rapid testing in areas with high temperatures and less expertise. The CareStart G6PD deficiency RDT kit could be used to screen malaria patients before administration of the fixed dose primaquine with artemisinin-based combination therapy. PMID:25885097

  20. Evaluation of the diagnostic accuracy of CareStart G6PD deficiency Rapid Diagnostic Test (RDT) in a malaria endemic area in Ghana, Africa.

    PubMed

    Adu-Gyasi, Dennis; Asante, Kwaku Poku; Newton, Sam; Dosoo, David; Amoako, Sabastina; Adjei, George; Amoako, Nicholas; Ankrah, Love; Tchum, Samuel Kofi; Mahama, Emmanuel; Agyemang, Veronica; Kayan, Kingsley; Owusu-Agyei, Seth

    2015-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most widespread enzyme defect that can result in red cell breakdown under oxidative stress when exposed to certain medicines including antimalarials. We evaluated the diagnostic accuracy of CareStart G6PD deficiency Rapid Diagnostic Test (RDT) as a point-of-care tool for screening G6PD deficiency. A cross-sectional study was conducted among 206 randomly selected and consented participants from a group with known G6PD deficiency status between February 2013 and June 2013. A maximum of 1.6ml of capillary blood samples were used for G6PD deficiency screening using CareStart G6PD RDT and Trinity qualitative with Trinity quantitative methods as the "gold standard". Samples were also screened for the presence of malaria parasites. Data entry and analysis were done using Microsoft Access 2010 and Stata Software version 12. Kintampo Health Research Centre Institutional Ethics Committee granted ethical approval. The sensitivity (SE) and specificity (SP) of CareStart G6PD deficiency RDT was 100% and 72.1% compared to Trinity quantitative method respectively and was 98.9% and 96.2% compared to Trinity qualitative method. Malaria infection status had no significant (P=0.199) change on the performance of the G6PD RDT test kit compared to the "gold standard". The outcome of this study suggests that the diagnostic performance of the CareStart G6PD deficiency RDT kit was high and it is acceptable at determining the G6PD deficiency status in a high malaria endemic area in Ghana. The RDT kit presents as an attractive tool for point-of-care G6PD deficiency for rapid testing in areas with high temperatures and less expertise. The CareStart G6PD deficiency RDT kit could be used to screen malaria patients before administration of the fixed dose primaquine with artemisinin-based combination therapy.

  1. Distinct clinical and neuropathological features of G51D SNCA mutation cases compared with SNCA duplication and H50Q mutation.

    PubMed

    Kiely, Aoife P; Ling, Helen; Asi, Yasmine T; Kara, Eleanna; Proukakis, Christos; Schapira, Anthony H; Morris, Huw R; Roberts, Helen C; Lubbe, Steven; Limousin, Patricia; Lewis, Patrick A; Lees, Andrew J; Quinn, Niall; Hardy, John; Love, Seth; Revesz, Tamas; Houlden, Henry; Holton, Janice L

    2015-08-27

    We and others have described the neurodegenerative disorder caused by G51D SNCA mutation which shares characteristics of Parkinson's disease (PD) and multiple system atrophy (MSA). The objective of this investigation was to extend the description of the clinical and neuropathological hallmarks of G51D mutant SNCA-associated disease by the study of two additional cases from a further G51D SNCA kindred and to compare the features of this group with a SNCA duplication case and a H50Q SNCA mutation case. All three G51D patients were clinically characterised by parkinsonism, dementia, visual hallucinations, autonomic dysfunction and pyramidal signs with variable age at disease onset and levodopa response. The H50Q SNCA mutation case had a clinical picture that mimicked late-onset idiopathic PD with a good and sustained levodopa response. The SNCA duplication case presented with a clinical phenotype of frontotemporal dementia with marked behavioural changes, pyramidal signs, postural hypotension and transiently levodopa responsive parkinsonism. Detailed post-mortem neuropathological analysis was performed in all cases. All three G51D cases had abundant α-synuclein pathology with characteristics of both PD and MSA. These included widespread cortical and subcortical neuronal α-synuclein inclusions together with small numbers of inclusions resembling glial cytoplasmic inclusions (GCIs) in oligodendrocytes. In contrast the H50Q and SNCA duplication cases, had α-synuclein pathology resembling idiopathic PD without GCIs. Phosphorylated α-synuclein was present in all inclusions types in G51D cases but was more restricted in SNCA duplication and H50Q mutation. Inclusions were also immunoreactive for the 5G4 antibody indicating their highly aggregated and likely fibrillar state. Our characterisation of the clinical and neuropathological features of the present small series of G51D SNCA mutation cases should aid the recognition of this clinico-pathological entity. The

  2. Growth-inhibitory and antiangiogenic activity of the MEK inhibitor PD0325901 in malignant melanoma with or without BRAF mutations.

    PubMed

    Ciuffreda, Ludovica; Del Bufalo, Donatella; Desideri, Marianna; Di Sanza, Cristina; Stoppacciaro, Antonella; Ricciardi, Maria Rosaria; Chiaretti, Sabina; Tavolaro, Simona; Benassi, Barbara; Bellacosa, Alfonso; Foà, Robin; Tafuri, Agostino; Cognetti, Francesco; Anichini, Andrea; Zupi, Gabriella; Milella, Michele

    2009-08-01

    The Raf/MEK/ERK pathway is an important mediator of tumor cell proliferation and angiogenesis. Here, we investigated the growth-inhibitory and antiangiogenic properties of PD0325901, a novel MEK inhibitor, in human melanoma cells. PD0325901 effects were determined in a panel of melanoma cell lines with different genetic aberrations. PD0325901 markedly inhibited ERK phosphorylation and growth of both BRAF mutant and wild-type melanoma cell lines, with IC(50) in the nanomolar range even in the least responsive models. Growth inhibition was observed both in vitro and in vivo in xenograft models, regardless of BRAF mutation status, and was due to G(1)-phase cell cycle arrest and subsequent induction of apoptosis. Cell cycle (cyclin D1, c-Myc, and p27(KIP1)) and apoptosis (Bcl-2 and survivin) regulators were modulated by PD0325901 at the protein level. Gene expression profiling revealed profound modulation of several genes involved in the negative control of MAPK signaling and melanoma cell differentiation, suggesting alternative, potentially relevant mechanisms of action. Finally, PD0325901 inhibited the production of the proangiogenic factors vascular endothelial growth factor and interleukin 8 at a transcriptional level. In conclusion, PD0325901 exerts potent growth-inhibitory, proapoptotic, and antiangiogenic activity in melanoma lines, regardless of their BRAF mutation status. Deeper understanding of the molecular mechanisms of action of MEK inhibitors will likely translate into more effective treatment strategies for patients experiencing malignant melanoma.

  3. Origins and implications of neglect of G6PD deficiency and primaquine toxicity in Plasmodium vivax malaria

    PubMed Central

    Baird, Kevin

    2015-01-01

    Most of the tens of millions of clinical attacks caused by Plasmodium vivax each year likely originate from dormant liver forms called hypnozoites. We do not systematically attack that reservoir because the only drug available, primaquine, is poorly suited to doing so. Primaquine was licenced for anti-relapse therapy in 1952 and became available despite threatening patients having an inborn deficiency of glucose-6-phosphate dehydrogenase (G6PD) with acute haemolytic anaemia. The standard method for screening G6PD deficiency, the fluorescent spot test, has proved impractical where most malaria patients live. The blind administration of daily primaquine is dangerous, but so too are the relapses invited by withholding treatment. Absent G6PD screening, providers must choose between risking harm by the parasite or its treatment. How did this dilemma escape redress in science, clinical medicine and public health? This review offers critical historic reflection on the neglect of this serious problem in the chemotherapy of P. vivax. PMID:25943156

  4. Mutation Frequency of the Major Frontotemporal Dementia Genes, MAPT, GRN and C9ORF72 in a Turkish Cohort of Dementia Patients.

    PubMed

    Guven, Gamze; Lohmann, Ebba; Bras, Jose; Gibbs, J Raphael; Gurvit, Hakan; Bilgic, Basar; Hanagasi, Hasmet; Rizzu, Patrizia; Heutink, Peter; Emre, Murat; Erginel-Unaltuna, Nihan; Just, Walter; Hardy, John; Singleton, Andrew; Guerreiro, Rita

    2016-01-01

    'Microtubule-associated protein tau' (MAPT), 'granulin' (GRN) and 'chromosome 9 open reading frame72' (C9ORF72) gene mutations are the major known genetic causes of frontotemporal dementia (FTD). Recent studies suggest that mutations in these genes may also be associated with other forms of dementia. Therefore we investigated whether MAPT, GRN and C9ORF72 gene mutations are major contributors to dementia in a random, unselected Turkish cohort of dementia patients. A combination of whole-exome sequencing, Sanger sequencing and fragment analysis/Southern blot was performed in order to identify pathogenic mutations and novel variants in these genes as well as other FTD-related genes such as the 'charged multivesicular body protein 2B' (CHMP2B), the 'FUS RNA binding protein' (FUS), the 'TAR DNA binding protein' (TARDBP), the 'sequestosome1' (SQSTM1), and the 'valosin containing protein' (VCP). We determined one pathogenic MAPT mutation (c.1906C>T, p.P636L) and one novel missense variant (c.38A>G, p.D13G). In GRN we identified a probably pathogenic TGAG deletion in the splice donor site of exon 6. Three patients were found to carry the GGGGCC expansions in the non-coding region of the C9ORF72 gene. In summary, a complete screening for mutations in MAPT, GRN and C9ORF72 genes revealed a frequency of 5.4% of pathogenic mutations in a random cohort of 93 Turkish index patients with dementia.

  5. The efficacy of a neonatal screening programme in decreasing the hospitalization rate of patients with G6PD deficiency in southern Iran.

    PubMed

    Cohan, Nader; Karimi, Mehran; Khalili, Amir Hossein; Falahzadeh, Mohammad Hossein; Samadi, Behrang; Mahdavi, Mohammad Reza

    2010-01-01

    To investigate whether a neonatal screening programme for G6PD deficiency has decreased hospitalization for acute haemolytic attack in the Fars province of southern Iran. A total of 850 patients registered with G6PD deficiency were included in the study. Variables including age, sex, time and cause of hospitalization, cause of haemolytic crisis, positive history of blood transfusion, G6PD enzyme deficiency, blood urea nitrogen (BUN) and creatinine were recorded based on a standard questionnaire. All patients were analysed for G6PD enzyme level based on a quantitative test. Five hundred and fifty-three patients were hospitalized before the introduction of the neonatal screening programme (2001-2004) and 297 afterwards (2005-2008). Of those patients hospitalized after the introduction of the screening programme, 237 were wrongly classified as normal and 60 were recorded as having G6PD enzyme deficiency by the neonatal screening programme. The main causes of haemolytic crisis in G6PD-deficient patients were fava bean consumption (88.2%), underlying infection (10.9%) and drugs (0.8%). Our study showed the effectiveness of the neonatal screening programme in decreasing the hospitalization rate.

  6. Investigation of the Mitochondrial ATPase 6/8 and tRNALys Genes Mutations in Autism

    PubMed Central

    Piryaei, Fahimeh; Houshmand, Massoud; Aryani, Omid; Dadgar, Sepideh; Soheili, Zahra-Soheila

    2012-01-01

    Objective: Autism results from developmental factors that affect many or all functional brain systems. Brain is one of tissues which are crucially in need of adenosine triphosphate (ATP). Autism is noticeably affected by mitochondrial dysfunction which impairs energy metabolism. Considering mutations within ATPase 6, ATPase 8 and tRNALys genes, associated with different neural diseases, and the main role of ATPase 6/8 in energy generation, we decided to investigate mutations on these mtDNA-encoded genes to reveal their roles in autism pathogenesis. Materials and Methods: In this experimental study, mutation analysis for the mentioned genes were performed in a cohort of 24 unrelated patients with idiopathic autism by employing amplicon sequencing of mtDNA fragments. Results: In this study, 12 patients (50%) showed point mutations that represent a significant correlation between autism and mtDNA variations. Most of the identified substitutions (55.55%) were observed on MT-ATP6, altering some conserved amino acids to other ones which could potentially affect ATPase 6 function. Mutations causing amino acid replacement denote involvement of mtDNA genes, especially ATPase 6 in autism pathogenesis. Conclusion: MtDNA mutations in relation with autism could be remarkable to realize an understandable mechanism of pathogenesis in order to achieve therapeutic solutions. PMID:23508290

  7. Comparative Study of Antimalarial and Other Drugs on G6PD Deficient Red Cells.

    DTIC Science & Technology

    the WR compounds previously studied. The suggested use of xylitol as a protective agent against hemolytic drugs (Wang et al) had raised considerable...expectation. Unfortunately, xylitol at the dosages of 20 and 30 g./day was unable, in our experimental set up (transfusion of 51 Cr tagged G6PD

  8. The 95ΔG mutation in the 5'untranslated region of the norA gene increases efflux activity in Staphylococcus epidermidis isolates.

    PubMed

    García-Gómez, Elizabeth; Jaso-Vera, Marcos E; Juárez-Verdayes, Marco A; Alcántar-Curiel, María D; Zenteno, Juan C; Betanzos-Cabrera, Gabriel; Peralta, Humberto; Rodríguez-Martínez, Sandra; Cancino-Díaz, Mario E; Jan-Roblero, Janet; Cancino-Diaz, Juan C

    2017-02-01

    In the Staphylococcus aureus ATCC25923 strain, the flqB mutation in the 5'untranslated region (5'UTR) of the norA gene causes increased norA mRNA expression and high efflux activity (HEA). The involvement of the norA gene 5'UTR in HEA has not been explored in S. epidermidis; therefore, we examined the function of this region in S. epidermidis clinical isolates. The selection of isolates with HEA was performed based on ethidium bromide (EtBr) MIC values and efflux efficiency (EF) using the semi-automated fluorometric method. The function of the 5'UTR was studied by quantifying the levels of norA expression (RT-qPCR) and by identifying 5'UTR mutations by sequence analysis. Only 10 isolates from a total of 165 (6.1%) had HEA (EtBr MIC = 300 μg/ml and EF ranged from 48.4 to 97.2%). Eight of 10 isolates with HEA had the 5'UTR 95 Δ G mutation. Isolates carrying the 95 Δ G mutation had higher levels of norA expression compared with those that did not. To corroborate that the 95 Δ G mutation is involved in HEA, a strain adapted to EtBr was obtained in vitro. This strain also presented the 95 Δ G mutation and had a high level of norA expression and EF, indicating that the 95 Δ G mutation is important for the HEA phenotype. The 95 Δ G mutation produces a different structure in the Shine-Dalgarno region, which may promote better translation of norA mRNA. To our knowledge, this is the first report to demonstrate the participation of the 5'UTR 95 Δ G mutation of the norA gene in the HEA phenotype of S. epidermidis isolates. Here, we propose that the efflux of EtBr is caused by an increment in the transcription and/or translation of the norA gene. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Heterogeneity of G6PD deficiency prevalence in Mozambique: a school-based cross-sectional survey in three different regions.

    PubMed

    Galatas, Beatriz; Mabote, Lurdes; Simone, Wilson; Matambisso, Gloria; Nhamussua, Lidia; Mañú-Pereira, María Del Mar; Menéndez, Clara; Saute, Francisco; Macete, Eusebio; Bassat, Quique; Alonso, Pedro; Aide, Pedro

    2017-01-19

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is an X-linked hereditary enzymatic abnormality that affects more than 400 million people worldwide. Most deficient individuals do not manifest any symptoms; however, several precipitant agents-such as fava intake, infections, or several drugs-may trigger acute haemolytic anaemia. Countries should be informed of the prevalence of this enzymatic anomaly within their borders, in order to make safe and appropriate national decisions regarding the use of potentially unsafe drugs for G6PD deficient individuals. A school-based cross-sectional survey was conducted in three districts in Mozambique, namely Manhiça, located in the south; Mocuba in the centre; and Pemba in the northern tip of the country. G6PD deficiency was evaluated using the CareStart™ diagnostic test, and enzyme activity levels were measured through fluorescence spectrophotometry in deficient individuals. Chi squared and ANOVA tests were used to assess prevalence and mean enzyme activity differences, and logistic regression was used to identify risk factors associated to the deficiency. G6PD deficiency prevalence estimates were lowest in the northern city of Pemba (8.3%) and among Emakhuwas and Shimakondes, and higher in the centre and southern regions of the country (16.8 and 14.6%, respectively), particularly among Elomwes and Xichanganas. G6PD deficiency was significantly more prevalent among male students than females (OR = 1.4, 95% CI 1.0-1.8, p = 0.02), although enzyme activity levels were not different among deficient individuals from either gender group. Finally, median deficiency levels were found to be more severe among the deficient students from the north (0.7 U/gHg [0.2-0.7] p < 0.001) and south (0.7 U/gHg [0.5-2.5]), compared to those from the centre (1.4 U/gHg [0.6-2.1]). These findings suggest that Mozambique, as a historically high malaria-endemic country has considerable levels of G6PD deficiency, that vary significantly

  10. Targeted next-generation sequencing reveals that a compound heterozygous mutation in phosphodiesterase 6a gene leads to retinitis pigmentosa in a Chinese family.

    PubMed

    Zhang, Shanshan; Li, Jie; Li, Shujin; Yang, Yeming; Yang, Mu; Yang, Zhenglin; Zhu, Xianjun; Zhang, Lin

    2018-04-25

    Retinitis pigmentosa (RP) is a genetically heterogeneous disease with over 70 causative genes identified to date. However, approximately 40% of RP cases remain genetically unsolved, suggesting that many novel disease-causing mutations are yet to be identified. The purpose of this study is to identify the causative mutations of a Chinese RP family. Targeted next-generation sequencing (NGS) for a total of 163 genes which involved in inherited retinal disorders were used to screen the possible causative mutations. Sanger sequencing was used to verify the mutations. As results, we identified two heterozygous mutations: a splicing site mutation c.1407 + 1G>C and a nonsense mutation c. 1957C>T (p.R653X) in phosphodiesterase 6A (PDE6A) gene in the RP patient. These two mutations are inherited from his father and mother, respectively. Furthermore, these mutations are unique in our in-house database and are rare in human genome databases, implicating that these two mutations are pathological. By using targeted NGS method, we identified a compound heterozygous mutation in PDE6A gene that is associated with RP in a Chinese family.

  11. [Phenotypic and genotypic spectra of patients with glucose-6-phosphate dehydrogenase deficiency gene known pathogenic variants: a single-center study].

    PubMed

    Chen, X; Yang, L; Wang, H J; Wu, B B; Lu, Y L; Dong, X R; Zhou, W H

    2018-05-02

    Objective: To analyze the hotspots of known pathogenic disease-causing variants of glucose-6-phosphate dehydrogenase (G6PD) and the phenotype spectrum of neonatal patients with known pathogenic disease-causing variants of G6PD. Methods: The known pathogenic disease-causing variants of G6PD were collected from Human Gene Mutation Database. Screening was performed for these variants among the 7 966 cases (2 357 neonatal, 5 609 non-neonatal) in the database of sequencing at Molecular Diagnosis Center, Children's Hospital of Fudan University. All these samples were from patients suspected with genetic disorder. The database contained Whole Exon Sequencing data and Clinical Exon Sequencing data. We screened out the patients with known pathogenic disease-causing variants of G6PD, analyzed the hotspot of G6PD and the phenotype spectrum of neonatal patients with known pathogenic disease-causing variants of G6PD. Results: (1) Among the next generation sequencing data of the 7 966 samples, 86 samples (1.1%) were detected as positive for the known pathogenic disease-causing variants of G6PD (positive samples set). In the positive sample set, 51 patients (33 males, 18 females) were newborn babies. Forty-three patients (26 males, 17 females) had the enzyme activity data of G6PD. (2) Among the 86 samples, Arg463His, Arg459Leu, Leu342Phe, Val291Met were the leading 4 disease-causing variants found in 72 samples (84%). (3) Male neonatal patients with the same variants had the statistically significant differences in enzyme activity: among 13 patients with Arg463His, enzyme activity of 9 patients was ranked as grade Ⅲ, 1 case ranked as Ⅳ, 3 cases had no activity data;among 10 patients with Arg459Leu, enzyme activity of 4 patients was ranked as Ⅱ, 4 cases ranked as Ⅲ, 2 cases had no activity data;among 2 patients with His32Arg, enzyme activity of one patient was ranked as Ⅱ, another was Ⅲ. Male neonatal patients with the same mutation and enzyme activity also had the

  12. Growth-Inhibitory and Antiangiogenic Activity of the MEK Inhibitor PD0325901 in Malignant Melanoma with or without BRAF Mutations12

    PubMed Central

    Ciuffreda, Ludovica; Del Bufalo, Donatella; Desideri, Marianna; Di Sanza, Cristina; Stoppacciaro, Antonella; Ricciardi, Maria Rosaria; Chiaretti, Sabina; Tavolaro, Simona; Benassi, Barbara; Bellacosa, Alfonso; Foà, Robin; Tafuri, Agostino; Cognetti, Francesco; Anichini, Andrea; Zupi, Gabriella; Milella, Michele

    2009-01-01

    The Raf/MEK/ERK pathway is an important mediator of tumor cell proliferation and angiogenesis. Here, we investigated the growth-inhibitory and antiangiogenic properties of PD0325901, a novel MEK inhibitor, in human melanoma cells. PD0325901 effects were determined in a panel of melanoma cell lines with different genetic aberrations. PD0325901 markedly inhibited ERK phosphorylation and growth of both BRAF mutant and wild-type melanoma cell lines, with IC50 in the nanomolar range even in the least responsive models. Growth inhibition was observed both in vitro and in vivo in xenograft models, regardless of BRAF mutation status, and was due to G1-phase cell cycle arrest and subsequent induction of apoptosis. Cell cycle (cyclin D1, c-Myc, and p27KIP1) and apoptosis (Bcl-2 and survivin) regulators were modulated by PD0325901 at the protein level. Gene expression profiling revealed profound modulation of several genes involved in the negative control of MAPK signaling and melanoma cell differentiation, suggesting alternative, potentially relevant mechanisms of action. Finally, PD0325901 inhibited the production of the proangiogenic factors vascular endothelial growth factor and interleukin 8 at a transcriptional level. In conclusion, PD0325901 exerts potent growth-inhibitory, proapoptotic, and antiangiogenic activity in melanoma lines, regardless of their BRAF mutation status. Deeper understanding of the molecular mechanisms of action of MEK inhibitors will likely translate into more effective treatment strategies for patients experiencing malignant melanoma. PMID:19649202

  13. Screening for G6PD Deficiency Among Neonates with Neonatal Jaundice Admitted to Tertiary Care Center: A Need in Disguise.

    PubMed

    Kumar, Kishwer; Sohaila, Arjumand; Tikmani, Shiyam Sunder; Khan, Iqtidar Ahmed; Zafar, Anila

    2015-08-01

    This study was conducted to determine the association of Glucose-6-Phosphate Dehydrogenase (G-6-PD) deficiency among neonates admitted with jaundice at the neonatal intensive care unit, well baby nursery and neonatal step down nursery of the Aga Khan University Hospital, Karachi, Pakistan, from January to June 2010. A total of 205 neonates following the selection criteria were included. All selected neonates have their venous blood drawn, saved in EDTA bottle and sent to laboratory of The Aga Khan University Hospital (AKUH). The laboratory results of whether G-6-PD deficiency was present or not was recorded in the proforma. G-6-PD was deficient in 19 neonates (9.3%). All neonates were male.

  14. Correlation of MET gene amplification and TP53 mutation with PD-L1 expression in non-small cell lung cancer

    PubMed Central

    Albitar, Maher; Sudarsanam, Sucha; Ma, Wanlong; Jiang, Shiping; Chen, Wayne; Funari, Vincent; Blocker, Forrest; Agersborg, Sally

    2018-01-01

    Background The role of MET amplification in lung cancer, particularly in relation to checkpoint inhibition and EGFR WT, has not been fully explored. In this study, we correlated PD-L1 expression with MET amplification and EGFR, KRAS, or TP53 mutation in primary lung cancer. Methods In this retrospective study, tissue collected from 471 various tumors, including 397 lung cancers, was tested for MET amplification by FISH with a MET/centromere probe. PD-L1 expression was evaluated using clone SP142 and standard immunohistochemistry, and TP53, KRAS, and EGFR mutations were tested using next generation sequencing. Results Our results revealed that PD-L1 expression in non-small cell lung cancer is inversely correlated with EGFR mutation (P=0.0003), and positively correlated with TP53 mutation (P=0.0001) and MET amplification (P=0.004). Patients with TP53 mutations had significantly higher MET amplification (P=0.007), and were more likely (P=0.0002) to be EGFR wild type. There was no correlation between KRAS mutation and overall PD-L1 expression, but significant positive correlation between PD-L1 expression and KRAS with TP53 co-mutation (P=0.0002). A cut-off for the ratio of MET: centromere signal was determined as 1.5%, and 4% of lung cancer patients were identified as MET amplified. Conclusions This data suggests that in lung cancer both MET and TP53 play direct roles in regulating PD-L1 opposing EGFR. Moreover, KRAS and TP53 co-mutation may cooperate to drive PD-L1 expression in lung cancer. Adding MET or TP53 inhibitors to checkpoint inhibitors may be an attractive combination therapy in patients with lung cancer and MET amplification. PMID:29568386

  15. Proteomics screen to reveal molecular changes mediated by C722G missense mutation in CHRM2 gene.

    PubMed

    Hou, Dongyan; Chen, Ying; Liu, Jiamei; Xu, Lin; Zhang, Zhiyong; Zhang, Juan; Wang, Hua; Wang, Xin; Chen, Jin; Zhao, Rongrui; Hu, Aihua; Hakonarson, Hakon; Zhang, Lin; Shen, Yan

    2013-08-26

    Previously, we reported a missense mutation (C722G) in the M2-muscarinic acetylcholine receptor (CHRM2) gene associated with familial dilated cardiomyopathy. However, the exact molecular mechanisms by the related protein changes of CHRM2-C722G mutation induced are still unclear. CHRM2 and CHRM2-C722G lentiviral vector was infected to CHO cells. Proteomic analysis by label-free shotgun strategy and the STRING 9.0 software were performed. A total of 102 proteins with at least 2-fold change in the CHRM2-C722G group were identified, 42 proteins were up-regulated, whereas 57 were down-regulated. These altered proteins belong to three broad functional categories: (i) metabolic (e.g. Cytosolic acyl coenzyme A thioester hydrolase, Malate dehydrogenase); (ii) cytoskeletal (e.g. Actin-related protein, Myosin light polypeptide 6 and Alpha-actinin-1) and (iii) stress response (e.g. heat shock protein 70, Ras-related protein Rab-10). Interestingly, the marked differences in the expression of selected eight proteins (change >4.0-fold), were connected with many proteins related to apoptosis and immune/inflammatory response such as: FOS, BAX, MYC, TP53 and IL6. This novel study demonstrated for the first time a full-scale screening of the proteomics research by CHRM2-C722G mutation and profiled 102 changed proteins, of which, eight might be critical in cardiac dysfunction for future mapping. It was a full-scale screening of the proteomics research by CHRM2-C722G mutation. These proteins might serve as valuable biomarkers that could predict the presence of a precursor field. These proteins might serve to further explore the pathophysiological mechanisms in familial DCM patients with C176W mutation. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. TRAF6-Mediated SM22α K21 Ubiquitination Promotes G6PD Activation and NADPH Production, Contributing to GSH Homeostasis and VSMC Survival In Vitro and In Vivo.

    PubMed

    Dong, Li-Hua; Li, Liang; Song, Yu; Duan, Zhi-Li; Sun, Shao-Guang; Lin, Yan-Ling; Miao, Sui-Bing; Yin, Ya-Juan; Shu, Ya-Nan; Li, Huan; Chen, Peng; Zhao, Li-Li; Han, Mei

    2015-09-25

    Vascular smooth muscle cell (VSMC) survival under stressful conditions is integral to promoting vascular repair, but facilitates plaque stability during the development of atherosclerosis. The cytoskeleton-associated smooth muscle (SM) 22α protein is involved in the regulation of VSMC phenotypes, whereas the pentose phosphate pathway plays an essential role in cell proliferation through the production of dihydronicotinamide adenine dinucleotide phosphate. To identify the relationship between dihydronicotinamide adenine dinucleotide phosphate production and SM22α activity in the development and progression of vascular diseases. We showed that the expression and activity of glucose-6-phosphate dehydrogenase (G6PD) are promoted in platelet-derived growth factor (PDGF)-BB-induced proliferative VSMCs. PDGF-BB induced G6PD membrane translocation and activation in an SM22α K21 ubiquitination-dependent manner. Specifically, the ubiquitinated SM22α interacted with G6PD and mediated G6PD membrane translocation. Furthermore, we found that tumor necrosis factor receptor-associated factor (TRAF) 6 mediated SM22α K21 ubiquitination in a K63-linked manner on PDGF-BB stimulation. Knockdown of TRAF6 decreased the membrane translocation and activity of G6PD, in parallel with reduced SM22α K21 ubiquitination. Elevated levels of activated G6PD consequent to PDGF-BB induction led to increased dihydronicotinamide adenine dinucleotide phosphate generation through stimulation of the pentose phosphate pathway, which enhanced VSMC viability and reduced apoptosis in vivo and in vitro via glutathione homeostasis. We provide evidence that TRAF6-induced SM22α ubiquitination maintains VSMC survival through increased G6PD activity and dihydronicotinamide adenine dinucleotide phosphate production. The TRAF6-SM22α-G6PD pathway is a novel mechanism underlying the association between glucose metabolism and VSMC survival, which is beneficial for vascular repair after injury but facilitates

  17. Dysplastic spondylolysis is caused by mutations in the diastrophic dysplasia sulfate transporter gene

    PubMed Central

    Cai, Tao; Yang, Liu; Cai, Wanshi; Guo, Sen; Yu, Ping; Li, Jinchen; Hu, Xueyu; Yan, Ming; Shao, Qianzhi; Jin, Yan; Sun, Zhong Sheng; Luo, Zhuo-Jing

    2015-01-01

    Spondylolysis is a fracture in part of the vertebra with a reported prevalence of about 3–6% in the general population. Genetic etiology of this disorder remains unknown. The present study was aimed at identifying genomic mutations in patients with dysplastic spondylolysis as well as the potential pathogenesis of the abnormalities. Whole-exome sequencing and functional analysis were performed for patients with spondylolysis. We identified a novel heterozygous mutation (c.2286A > T; p.D673V) in the sulfate transporter gene SLC26A2 in five affected subjects of a Chinese family. Two additional mutations (e.g., c.1922A > G; p.H641R and g.18654T > C in the intron 1) in the gene were identified by screening a cohort of 30 unrelated patients with the disease. In situ hybridization analysis showed that SLC26A2 is abundantly expressed in the lumbosacral spine of the mouse embryo at day 14.5. Sulfate uptake activities in CHO cells transfected with mutant SLC26A2 were dramatically reduced compared with the wild type, confirming the pathogenicity of the two missense mutations. Further analysis of the gene–disease network revealed a convergent pathogenic network for the development of lumbosacral spine. To our knowledge, our findings provide the first identification of autosomal dominant SLC26A2 mutations in patients with dysplastic spondylolysis, suggesting a new clinical entity in the pathogenesis of chondrodysplasia involving lumbosacral spine. The analysis of the gene–disease network may shed new light on the study of patients with dysplastic spondylolysis and spondylolisthesis as well as high-risk individuals who are asymptomatic. PMID:26077908

  18. Mutations in the PDE6B gene in autosomal recessive retinitis pigmentosa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Danciger, M.; Blaney, J.; Gao, Y.Q.

    1995-11-01

    We have studied 24 small families with presumed autosomal recessive inheritance of retinitis pigmentosa by a combination of haplotype analysis and exon screening. Initial analysis of the families was made with a dinucleotide repeat polymorphism adjacent to the gene for rod cGMP-phosphodiesterase (PDE6B). This was followed by denaturing gradient gel electrophoresis (DGGE) and single-strand conformation polymorphism electrophoresis (SSCPE) of the 22 exons and a portion of the 5{prime} untranslated region of the PDE6B gene in the probands of each family in which the PDE6B locus could not be ruled out from segregating with disease. Two probands were found with compoundmore » heterozygous mutations: Gly576Asp and His620(1-bp del) mutations were present in one proband, and a Lys706X null mutation and an AG to AT splice acceptor site mutation in intron 2 were present in the other. Only the affecteds of each of the two families carried both corresponding mutations. 29 refs., 3 figs., 1 tab.« less

  19. Overexpression of G6PD is associated with high risks of recurrent metastasis and poor progression-free survival in primary breast carcinoma.

    PubMed

    Pu, Haihong; Zhang, Qingyuan; Zhao, Chunbo; Shi, Lei; Wang, Yan; Wang, Jingxuan; Zhang, Minghui

    2015-11-25

    The present study aimed to investigate the expression of CYP27A1, CYP7B1, insulin-like growth factor-1 (IGF-1), glucose-6-phosphate-dehydrogenase (G6PD), glutathione S-transferase P1 (GSTP1), and pyruvate kinase isoform M2 (PKM2) in breast carcinoma tissue and evaluate their prognostic value for progression-free survival (PFS) and overall survival (OS). A total of 20 patients treated with surgery for primary breast carcinoma were enrolled: 10 cases diagnosed with recurrent metastasis (A), along with their corresponding metastases specimen (AM) and 10 cases with no evidence of recurrence or metastasis (B). Baseline characteristics of patients including age, lymph node metastasis, molecular subtypes, tumor staging and size, and pathological classification were all collected. Immunohistochemistry was performed to detect the protein expression in tumor specimens. Elevated G6PD protein levels were noted in group A compared with group AM and B (both P < 0.05), and PKM2 expression was also higher in group A when compared to group AM (P = 0.019), but similar with group B (P > 0.05). No association between clinicopathological parameters and the two proteins expression was observed. The G6PD protein expression was strongly associated with PFS of breast carcinoma patients (P = 0.021) but not for OS. According to the Kaplan-Meier analysis, mean PFS time of patients with G6PD-negative and G6PD-positive expression tumor were 71.36 ± 6.53 and 32.25 ± 5.67 months, respectively (P = 0.002). The G6PD protein could be served as a potential prognostic biomarker for primary breast carcinoma, and overexpression of G6PD protein predicted a high risk of recurrent metastasis and poor PFS during follow-up.

  20. Molecular analysis of the PAX6 gene in Mexican patients with congenital aniridia: report of four novel mutations

    PubMed Central

    Villarroel, Camilo E.; Villanueva-Mendoza, Cristina; Orozco, Lorena; Alcántara-Ortigoza, Miguel Angel; Jiménez, Diana F.; Ordaz, Juan C.

    2008-01-01

    Purpose Paired box gene 6 (PAX6) heterozygous mutations are well known to cause congenital non-syndromic aniridia. These mutations produce primarily protein truncations and have been identified in approximately 40%–80% of all aniridia cases worldwide. In Mexico, there is only one previous report describing three intragenic deletions in five cases. In this study, we further analyze PAX6 variants in a group of Mexican aniridia patients and describe associated ocular findings. Methods We evaluated 30 nonrelated probands from two referral hospitals. Mutations were detected by single-strand conformation polymorphism (SSCP) and direct sequencing, and novel missense mutations and intronic changes were analyzed by in silico analysis. One intronic variation (IVS2+9G>A), which in silico analysis suggested had no pathological effects, was searched in 103 unaffected controls. Results Almost all cases exhibited phenotypes that were at the severe end of the aniridia spectrum with associated ocular alterations such as nystagmus, macular hypoplasia, and congenital cataracts. The mutation detection rate was 30%. Eight different mutations were identified: four (c.184_188dupGAGAC, c.361T>C, c.879dupC, and c.277G>A) were novel, and four (c.969C>T, IVS6+1G>C, c.853delC, and IVS7–2A>G) have been previously reported. The substitution at position 969 was observed in two patients. None of the intragenic deletions previously reported in Mexican patients were found. Most of the mutations detected predict either truncation of the PAX6 protein or conservative amino acid changes in the paired domain. We also detected two intronic non-pathogenic variations, IVS9–12C>T and IVS2+9G>A, that had been previously reported. Because the latter variation was considered potentially pathogenic, it was analyzed in 103 healthy Mexican newborns where we found an allelic frequency of 0.1116 for the A allele. Conclusions This study adds four novel mutations to the worldwide PAX6 mutational spectrum, and

  1. Mutations in the GIGYF2 (TNRC15) Gene at the PARK11 Locus in Familial Parkinson Disease

    PubMed Central

    Lautier, Corinne; Goldwurm, Stefano; Dürr, Alexandra; Giovannone, Barbara; Tsiaras, William G.; Pezzoli, Gianni; Brice, Alexis; Smith, Robert J.

    2008-01-01

    The genetic basis for association of the PARK11 region of chromosome 2 with familial Parkinson disease (PD) is unknown. This study examined the GIGYF2 (Grb10-Interacting GYF Protein-2) (TNRC15) gene, which contains the PARK11 microsatellite marker with the highest linkage score (D2S206, LOD 5.14). The 27 coding exons of the GIGYF2 gene were sequenced in 123 Italian and 126 French patients with familial PD, plus 131 Italian and 96 French controls. A total of seven different GIGYF2 missense mutations resulting in single amino acid substitutions were present in 12 unrelated PD index patients (4.8%) and not in controls. Three amino acid insertions or deletions were found in four other index patients and absent in controls. Specific exon sequencing showed that these ten sequence changes were absent from a further 91 controls. In four families with amino acid substitutions in which at least one other PD case was available, the GIGYF2 mutations (Asn56Ser, Thr112Ala, and Asp606Glu) segregated with PD. There were, however, two unaffected carriers in one family, suggesting age-dependent or incomplete penetrance. One index case (PD onset age 33) inherited a GIGYF2 mutation (Ile278Val) from her affected father (PD onset age 66) and a previously described PD-linked mutation in the LRRK2 gene (Ile1371Val) from her affected mother (PD onset age 61). The earlier onset and severe clinical course in the index patient suggest additive effects of the GIGYF2 and LRRK2 mutations. These data strongly support GIGYF2 as a PARK11 gene with a causal role in familial PD. PMID:18358451

  2. Haemolysis in G6PD Heterozygous Females Treated with Primaquine for Plasmodium vivax Malaria: A Nested Cohort in a Trial of Radical Curative Regimens.

    PubMed

    Chu, Cindy S; Bancone, Germana; Moore, Kerryn A; Win, Htun Htun; Thitipanawan, Niramon; Po, Christina; Chowwiwat, Nongnud; Raksapraidee, Rattanaporn; Wilairisak, Pornpimon; Phyo, Aung Pyae; Keereecharoen, Lily; Proux, Stéphane; Charunwatthana, Prakaykaew; Nosten, François; White, Nicholas J

    2017-02-01

    Radical cure of Plasmodium vivax malaria with 8-aminoquinolines (primaquine or tafenoquine) is complicated by haemolysis in individuals with glucose-6-phosphate dehydrogenase (G6PD) deficiency. G6PD heterozygous females, because of individual variation in the pattern of X-chromosome inactivation (Lyonisation) in erythroid cells, may have low G6PD activity in the majority of their erythrocytes, yet are usually reported as G6PD "normal" by current phenotypic screening tests. Their haemolytic risk when treated with 8-aminoquinolines has not been well characterized. In a cohort study nested within a randomised clinical trial that compared different treatment regimens for P. vivax malaria, patients with a normal standard NADPH fluorescent spot test result (≳30%-40% of normal G6PD activity) were randomised to receive 3 d of chloroquine or dihydroartemisinin-piperaquine in combination with primaquine, either the standard high dose of 0.5 mg base/kg/day for 14 d or a higher dose of 1 mg base/kg/d for 7 d. Patterns of haemolysis were compared between G6PD wild-type and G6PD heterozygous female participants. Between 21 February 2012 and 04 July 2014, 241 female participants were enrolled, of whom 34 were heterozygous for the G6PD Mahidol variant. Haemolysis was substantially greater and a larger proportion of participants reached the threshold of clinically significant haemolysis (fractional haematocrit reduction >25%) in G6PD heterozygotes taking the higher (7 d) primaquine dose (9/17 [53%]) compared with G6PD heterozygotes taking the standard high (14 d) dose (2/16 [13%]; p = 0.022). In heterozygotes, the mean fractional haematocrit reductions were correspondingly greater with the higher primaquine dose (7-d regimen): -20.4% (95% CI -26.0% to -14.8%) (nadir on day 5) compared with the standard high (14 d) dose: -13.1% (95% CI -17.6% to -8.6%) (nadir day 6). Two heterozygotes taking the higher (7 d) primaquine dose required blood transfusion. In wild-type participants

  3. Investigation of the Mitochondrial ATPase 6/8 and tRNA(Lys) Genes Mutations in Autism.

    PubMed

    Piryaei, Fahimeh; Houshmand, Massoud; Aryani, Omid; Dadgar, Sepideh; Soheili, Zahra-Soheila

    2012-01-01

    Autism results from developmental factors that affect many or all functional brain systems. Brain is one of tissues which are crucially in need of adenosine triphosphate (ATP). Autism is noticeably affected by mitochondrial dysfunction which impairs energy metabolism. Considering mutations within ATPase 6, ATPase 8 and tRNA(Lys) genes, associated with different neural diseases, and the main role of ATPase 6/8 in energy generation, we decided to investigate mutations on these mtDNA-encoded genes to reveal their roles in autism pathogenesis. In this experimental study, mutation analysis for the mentioned genes were performed in a cohort of 24 unrelated patients with idiopathic autism by employing amplicon sequencing of mtDNA fragments. In this study, 12 patients (50%) showed point mutations that represent a significant correlation between autism and mtDNA variations. Most of the identified substitutions (55.55%) were observed on MT-ATP6, altering some conserved amino acids to other ones which could potentially affect ATPase 6 function. Mutations causing amino acid replacement denote involvement of mtDNA genes, especially ATPase 6 in autism pathogenesis. MtDNA mutations in relation with autism could be remarkable to realize an understandable mechanism of pathogenesis in order to achieve therapeutic solutions.

  4. Mutation analysis of the STRA6 gene in isolated and non-isolated anophthalmia/microphthalmia.

    PubMed

    Chassaing, N; Ragge, N; Kariminejad, A; Buffet, A; Ghaderi-Sohi, S; Martinovic, J; Calvas, P

    2013-03-01

    PDAC syndrome [Pulmonary hypoplasia/agenesis, Diaphragmatic hernia/eventration, Anophthalmia/microphthalmia (A/M) and Cardiac Defect] is a condition associated with recessive mutations in the STRA6 gene in some of these patients. Recently, cases with isolated anophthalmia have been associated with STRA6 mutations. To determine the minimal findings associated with STRA6 mutations, we performed mutation analysis of the STRA6 gene in 28 cases with anophthalmia. In 7 of the cases the anophthalmia was isolated, in 14 cases it was associated with one of the major features included in PDAC and 7 had other abnormalities. Mutations were identified in two individuals: one with bilateral anophthalmia and some features included in PDAC, who was a compound heterozygote for a missense mutation and a large intragenic deletion, and the second case with all the major features of PDAC and who had a homozygous splicing mutation. This study suggests that STRA6 mutations are more likely to be identified in individuals with A/M and other abnormalities included in the PDAC spectrum, rather than in isolated A/M cases. © 2012 John Wiley & Sons A/S.

  5. Excessive fluoride consumption increases haematological alteration in subjects with iron deficiency, thalassaemia, and glucose-6-phosphate dehydrogenase (G-6-PD) deficiency.

    PubMed

    Pornprasert, Sakorn; Wanachantararak, Phenphichar; Kantawong, Fahsai; Chamnanprai, Supoj; Kongpan, Chatpat; Pienthai, Nattasit; Yanola, Jintana; Duangmano, Suwit; Prasannarong, Mujalin

    2017-08-01

    Excessive fluoride consumption leads to accelerated red blood cell death and anaemia. Whether that increases the haematological alteration in subjects with haematological disorders (iron deficiency, thalassaemia, and G-6-PD deficiency) is still unclear. The fluoride in serum and urine and haematological parameters of students at Mae Tuen School (fluoride endemic area) were analysed and compared to those of students at Baan Yang Poa and Baan Mai Schools (control areas). Iron deficiency, thalassaemia, and G-6-PD deficiency were also diagnosed in these students. The students at Mae Tuen School had significantly (P < 0.001) higher levels of mean fluoride in the serum and urine than those in control areas. In both control and fluoride endemic areas, students with haematological disorders had significantly lower levels of Hb, Hct, MCV, MCH, and MCHC than those without haematological disorders. Moreover, the lowest levels of Hb, MCH, and MCHC were observed in the students with haematological disorders who live in the fluoride endemic area. Thus, the excessive fluoride consumption increased haematological alteration in subjects with iron deficiency, thalassaemia, and G-6-PD deficiency and that may increase the risk of anaemia in these subjects.

  6. DNA polymerase θ contributes to the generation of C/G mutations during somatic hypermutation of Ig genes

    PubMed Central

    Masuda, Keiji; Ouchida, Rika; Takeuchi, Arata; Saito, Takashi; Koseki, Haruhiko; Kawamura, Kiyoko; Tagawa, Masatoshi; Tokuhisa, Takeshi; Azuma, Takachika; O-Wang, Jiyang

    2005-01-01

    Somatic hypermutation of Ig variable region genes is initiated by activation-induced cytidine deaminase; however, the activity of multiple DNA polymerases is required to ultimately introduce mutations. DNA polymerase η (Polη) has been implicated in mutations at A/T, but polymerases involved in C/G mutations have not been identified. We have generated mutant mice expressing DNA polymerase (Polθ) specifically devoid of polymerase activity. Compared with WT mice, Polq-inactive (Polq, the gene encoding Polθ) mice exhibited a reduced level of serum IgM and IgG1. The mutant mice mounted relatively normal primary and secondary immune responses to a T-dependent antigen, but the production of high-affinity specific antibodies was partially impaired. Analysis of the JH4 intronic sequences revealed a slight reduction in the overall mutation frequency in Polq-inactive mice. Remarkably, although mutations at A/T were unaffected, mutations at C/G were significantly decreased, indicating an important, albeit not exclusive, role for Polθ activity. The reduction of C/G mutations was particularly focused on the intrinsic somatic hypermutation hotspots and both transitions and transversions were similarly reduced. These findings, together with the recent observation that Polθ efficiently catalyzes the bypass of abasic sites, lead us to propose that Polθ introduces mutations at C/G by replicating over abasic sites generated via uracil-DNA glycosylase. PMID:16172387

  7. Screening mutations in drug-resistant Mycobacterium tuberculosis strains in Yunnan, China.

    PubMed

    Li, Daoqun; Song, Yuzhu; Zhang, Cheng-Lin; Li, Xiaofei; Xia, Xueshan; Zhang, A-Mei

    Drug-resistant tuberculosis (DR-TB), especially multidrug-resistant tuberculosis (MDR-TB), is a serious medical and societal problem in China. The purpose of this study was to evaluate the mutation characteristics of drug-resistant Mycobacterium tuberculosis (M. tuberculosis) isolates in Yunnan, China. Drug susceptibility testing (DST) was performed in 523 clinical M. tuberculosis isolates. Six drug resistance genes (katG, inhA, rpoB, rpsL, embB, and pncA) were selected to screen for mutations. In total, 54 clinical M. tuberculosis strains were identified as drug-resistant by DST, including 18 single drug-resistant (SDR) strains and 36 multidrug-resistant (MDR) strains. Twenty-four types of mutations in five genes (excluding the inhA gene) were screened in forty-one strains. Six novel mutations were identified in this study, including three missense mutations (p.S302R in katG, p.D78G in embB, and p.M1I in pncA), two frameshift mutations (408 ins A and 538-580 del in pncA), and one mutation in a control region (-6 C>T located upstream of rpsL). The mutation frequencies in the hotspot mutation regions in the katG, rpoB, rpsL, embB, and pncA genes were 92.5%, 44.4%, 54.2%, 52.6%, and 37.5%, respectively. The mutation spectra and frequencies seemed somewhat unique in the Yunnan DR-TB strains. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  8. Base substitution mutations in uridinediphosphate-dependent glycosyltransferase 76G1 gene of Stevia rebaudiana causes the low levels of rebaudioside A: mutations in UGT76G1, a key gene of steviol glycosides synthesis.

    PubMed

    Yang, Yong-Heng; Huang, Su-Zhen; Han, Yu-Lin; Yuan, Hai-Yan; Gu, Chun-Sun; Zhao, Yan-Hai

    2014-07-01

    Steviol glycosides, extracted from the leaves of Stevia rebaudiana (Bert) Bertoni, are calorie-free sugar substitute of natural origin with intensely sweet (Boileau et al., 2012). Stevioside and rebaudioside A are the two main kinds of the diterpenic glycosides. We analyzed the concentration of stevioside and rebaudioside A in Stevia leaves of about 500 samples (hybrid progenies) and discovered a mutation plant "Z05" with very low levels of rebaudioside A. Because UGT76G1, a uridinediphosphate-dependent glycosyltransferases, is responsible for the conversion from stevioside to rebaudioside A (Richman et al., 2005), so mutation identification was done by sequencing the candidate gene, UGT76G1. In this study molecular analysis of two strains revealed a heterozygotic nonsense mutation of c.389T > G (p.L121X) in UGT76G1. Meanwhile, we found some amino acid substitutions significant change the protein structure. And the difference of enzyme activity between two strains proved the lack of functionality of UGT76G1 of the mutation "Z05". So the nonsense mutation and amino acid substitution mutation resulted in the low levels of rebaudioside A. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  9. - 174 G>C IL-6 polymorphism and primary iron overload in male patients.

    PubMed

    Tetzlaff, Walter F; Meroño, Tomás; Botta, Eliana E; Martín, Maximiliano E; Sorroche, Patricia B; Boero, Laura E; Castro, Marcelo; Frechtel, Gustavo D; Rey, Jorge; Daruich, Jorge; Cerrone, Gloria E; Brites, Fernando

    2018-04-14

    Primary iron overload (IO) is commonly associated with mutations in the hereditary hemochromatosis gene (HFE). Nonetheless, other genetic variants may influence the development of IO beyond HFE mutations. There is a single nucleotide polymorphism (SNP) at - 174 G>C of the interleukin (IL)-6 gene which might be associated with primary IO. Our aim was to study the association between the SNP - 174 G>C gene promoter of IL-6 and primary IO in middle-aged male patients. We studied 37 men with primary IO diagnosed by liver histology. Controls were age-matched male volunteers (n = 37). HFE mutations and the SNP - 174 G>C gene promoter of IL-6 were evaluated by PCR-RFLP. Logistic regression was used to evaluate the association between primary IO and SNP - 174 G>C gene promoter of IL-6. Patients and control subjects were in Hardy-Weinberg equilibrium for the SNP - 174 G>C gene promoter of IL-6 (p = 0.17). Significantly different genotype frequencies were observed between patients (43% CC, 43% CG, and 14% GG) and control subjects (10% CC, 41% CG, and 49% GG) (OR = 4.09, 95% CI = 2.06-8.13; p < 0.0001). The multiple logistic regression analysis showed that IO was significantly associated with CC homozygosis in the SNP - 174 G>C gene promoter of IL-6 (OR = 6.3, 95% CI = 1.9-21.4; p < 0.005) in a model adjusted by age and body mass index. In conclusion, CC homozygosis in the SNP - 174 G>C gene promoter of IL-6 can be proposed as one of the gene variants influencing iron accumulation in male adults with HFE mutations. Studies in larger cohorts are warranted.

  10. A Clinical and Molecular Genetic Study of 50 Families with Autosomal Recessive Parkinsonism Revealed Known and Novel Gene Mutations.

    PubMed

    Taghavi, Shaghayegh; Chaouni, Rita; Tafakhori, Abbas; Azcona, Luis J; Firouzabadi, Saghar Ghasemi; Omrani, Mir Davood; Jamshidi, Javad; Emamalizadeh, Babak; Shahidi, Gholam Ali; Ahmadi, Mona; Habibi, Seyed Amir Hassan; Ahmadifard, Azadeh; Fazeli, Atena; Motallebi, Marzieh; Petramfar, Peyman; Askarpour, Saeed; Askarpour, Shiva; Shahmohammadibeni, Hossein Ali; Shahmohammadibeni, Neda; Eftekhari, Hajar; Shafiei Zarneh, Amir Ehtesham; Mohammadihosseinabad, Saeed; Khorrami, Mehdi; Najmi, Safa; Chitsaz, Ahmad; Shokraeian, Parasto; Ehsanbakhsh, Hossein; Rezaeidian, Jalal; Ebrahimi Rad, Reza; Madadi, Faranak; Andarva, Monavvar; Alehabib, Elham; Atakhorrami, Minoo; Mortazavi, Seyed Erfan; Azimzadeh, Zahra; Bayat, Mahdis; Besharati, Amir Mohammad; Harati-Ghavi, Mohammad Ali; Omidvari, Samareh; Dehghani-Tafti, Zahra; Mohammadi, Faraz; Mohammad Hossein Pour, Banafsheh; Noorollahi Moghaddam, Hamid; Esmaili Shandiz, Ehsan; Habibi, Arman; Taherian-Esfahani, Zahra; Darvish, Hossein; Paisán-Ruiz, Coro

    2018-04-01

    In this study, the role of known Parkinson's disease (PD) genes was examined in families with autosomal recessive (AR) parkinsonism to assist with the differential diagnosis of PD. Some families without mutations in known genes were also subject to whole genome sequencing with the objective to identify novel parkinsonism-related genes. Families were selected from 4000 clinical files of patients with PD or parkinsonism. AR inheritance pattern, consanguinity, and a minimum of two affected individuals per family were used as inclusion criteria. For disease gene/mutation identification, multiplex ligation-dependent probe amplification, quantitative PCR, linkage, and Sanger and whole genome sequencing assays were carried out. A total of 116 patients (50 families) were examined. Fifty-four patients (46.55%; 22 families) were found to carry pathogenic mutations in known genes while a novel gene, not previously associated with parkinsonism, was found mutated in a single family (2 patients). Pathogenic mutations, including missense, nonsense, frameshift, and exon rearrangements, were found in Parkin, PINK1, DJ-1, SYNJ1, and VAC14 genes. In conclusion, variable phenotypic expressivity was seen across all families.

  11. Mutations of Glucose-6-Phosphate Dehydrogenase Durham, Santa-Maria and A+ Variants Are Associated with Loss Functional and Structural Stability of the Protein

    PubMed Central

    Gómez-Manzo, Saúl; Marcial-Quino, Jaime; Vanoye-Carlo, America; Enríquez-Flores, Sergio; De la Mora-De la Mora, Ignacio; González-Valdez, Abigail; García-Torres, Itzhel; Martínez-Rosas, Víctor; Sierra-Palacios, Edgar; Lazcano-Pérez, Fernando; Rodríguez-Bustamante, Eduardo; Arreguin-Espinosa, Roberto

    2015-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common enzymopathy in the world. More than 160 mutations causing the disease have been identified, but only 10% of these variants have been studied at biochemical and biophysical levels. In this study we report on the functional and structural characterization of three naturally occurring variants corresponding to different classes of disease severity: Class I G6PD Durham, Class II G6PD Santa Maria, and Class III G6PD A+. The results showed that the G6PD Durham (severe deficiency), and the G6PD Santa Maria and A+ (less severe deficiency) (Class I, II and III, respectively) affect the catalytic efficiency of these enzymes, are more sensitive to temperature denaturing, and affect the stability of the overall protein when compared to the wild type WT-G6PD. In the variants, the exposure of more and buried hydrophobic pockets was induced and monitored with 8-Anilinonaphthalene-1-sulfonic acid (ANS) fluorescence, directly affecting the compaction of structure at different levels and probably reducing the stability of the protein. The degree of functional and structural perturbation by each variant correlates with the clinical severity reported in different patients. PMID:26633385

  12. PREVALENCE OF MUTATIONS IN ELANE, GFI1, HAX1, SBDS, WAS, AND G6PC3 IN PATIENTS WITH SEVERE CONGENITAL NEUTROPENIA

    PubMed Central

    Xia, Jun; Bolyard, Audrey Anna; Rodger, Elin; Stein, Steve; Aprikyan, Andrew A.; Dale, David C.; Link, Daniel C.

    2009-01-01

    SUMMARY Severe congenital neutropenia (SCN) is a genetically heterogeneous syndrome associated with mutations of ELANE (ELA2), HAX1, GFI1, WAS, CSF3R or G6PC3. We investigated the prevalence of mutations of ELANE in a cohort of 162 SCN patients for whom blood or bone marrow samples were submitted to the North American Severe Chronic Neutropenia Tissue Repository. Mutations of ELANE were found in 90 of 162 patients (55.6%). Subsequently, we conducted an analysis of a subset of 73 of these cases utilizing a high throughput sequencing approach to determine the prevalence of other mutations associated with SCN. Among the 73 patients, mutations of ELANE were detected in 28. In the remaining 45 patients with wild type ELANE alleles, 5 patients had mutations: GFI1 (1), SBDS (1), WAS (1) and G6PC3 (2); no mutations of HAX1 were detected. In approximately 40% of our cases, the genetic basis of SCN remains unknown. These data suggest that for genetic diagnosis of SCN, ELANE genotyping should first be performed. In patients without ELANE mutations, other known SCN-associated gene mutations will be found rarely and genotyping can be guided by the clinical features of each patient. PMID:19775295

  13. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

    PubMed

    Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

    2017-10-01

    Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

  14. Heterogeneous alleles comprising G6PD deficiency trait in West Africa exert contrasting effects on two major clinical presentations of severe malaria.

    PubMed

    Shah, Shivang S; Rockett, Kirk A; Jallow, Muminatou; Sisay-Joof, Fatou; Bojang, Kalifa A; Pinder, Margaret; Jeffreys, Anna; Craik, Rachel; Hubbart, Christina; Wellems, Thomas E; Kwiatkowski, Dominic P

    2016-01-07

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency exhibits considerable allelic heterogeneity which manifests with variable biochemical and clinical penetrance. It has long been thought that G6PD deficiency confers partial protection against severe malaria, however prior genetic association studies have disagreed with regard to the strength and specificity of a protective effect, which might reflect differences in the host genetic background, environmental influences, or in the specific clinical phenotypes considered. A case-control association study of severe malaria was conducted in The Gambia, a region in West Africa where there is considerable allelic heterogeneity underlying expression of G6PD deficiency trait, evaluating the three major nonsynonymous polymorphisms known to be associated with enzyme deficiency (A968G, T542A, and C202T) in a cohort of 3836 controls and 2379 severe malaria cases. Each deficiency allele exhibited a similar trend toward protection against severe malaria overall (15-26% reduced risk); however, in stratifying severe malaria to two of its constituent clinical subphenotypes, severe malarial anaemia (SMA) and cerebral malaria (CM), the three deficiency alleles exhibited trends of opposing effect, with risk conferred to SMA and protection with respect to CM. To assess the overall effect of G6PD deficiency trait, deficiency alleles found across all three loci were pooled. G6PD deficiency trait was found to be significantly associated with protection from severe malaria overall (OR 0.83 [0.75-0.92], P = 0.0006), but this was limited to CM (OR 0.73 [0.61-0.87], P = 0.0005), with a trend toward increased risk for SMA, especially in fully-deficient individuals (OR 1.43 [0.99-2.08], P = 0.056). Sex-stratified testing largely comported with these results, with evidence suggesting that protection by G6PD deficiency trait is conferred to both males and females, though susceptibility to SMA may be restricted to fully-deficient male hemizygotes

  15. PD-1 (PDCD1) Promoter Methylation Is a Prognostic Factor in Patients With Diffuse Lower-Grade Gliomas Harboring Isocitrate Dehydrogenase (IDH) Mutations.

    PubMed

    Röver, Lea Kristin; Gevensleben, Heidrun; Dietrich, Jörn; Bootz, Friedrich; Landsberg, Jennifer; Goltz, Diane; Dietrich, Dimo

    2018-02-01

    Immune checkpoints are important targets for immunotherapies. However, knowledge on the epigenetic modification of immune checkpoint genes is sparse. In the present study, we investigated promoter methylation of CTLA4, PD-L1, PD-L2, and PD-1 in diffuse lower-grade gliomas (LGG) harboring isocitrate dehydrogenase (IDH) mutations with regard to mRNA expression levels, clinicopathological parameters, previously established methylation subtypes, immune cell infiltrates, and survival in a cohort of 419 patients with IDH-mutated LGG provided by The Cancer Genome Atlas. PD-L1, PD-L2, and CTLA-4 mRNA expression levels showed a significant inverse correlation with promoter methylation (PD-L1: p=0.005; PD-L2: p<0.001; CTLA-4: p<0.001). Furthermore, immune checkpoint methylation was significantly associated with age (PD-L2: p=0.003; PD-1: p=0.015), molecular alterations, i.e. MGMT methylation (PD-L1: p<0.001; PD-L2: p<0.001), ATRX mutations (PD-L2: p<0.001, PD-1: p=0.001), and TERT mutations (PD-L1: p=0.035, PD-L2: p<0.001, PD-1: p<0.001, CTLA4: p<0.001) as well as methylation subgroups and immune cell infiltrates. In multivariate Cox proportional hazard analysis, PD-1 methylation qualified as strong prognostic factor (HR=0.51 [0.34-0.76], p=0.001). Our findings suggest an epigenetic regulation of immune checkpoint genes via DNA methylation in LGG. PD-1 methylation may assist the identification of patients that might benefit from an alternative treatment, particularly in the context of emerging immunotherapies. Copyright © 2018 The Author(s). Published by Elsevier B.V. All rights reserved.

  16. The mutY gene: a mutator locus in Escherichia coli that generates G.C----T.A transversions.

    PubMed Central

    Nghiem, Y; Cabrera, M; Cupples, C G; Miller, J H

    1988-01-01

    We have used a strain with an altered lacZ gene, which reverts to wild type via only certain transversions, to detect transversion-specific mutators in Escherichia coli. Detection relied on a papillation technique that uses a combination of beta-galactosides to reveal blue Lac+ papillae. One class of mutators is specific for the G.C----T.A transversion as determined by the reversion pattern of a set of lacZ mutations and by the distribution of forward nonsense mutations in the lacI gene. The locus responsible for the mutator phenotype is designated mutY and maps near 64 min on the genetic map of E. coli. The mutY locus may act in a similar but reciprocal fashion to the previously characterized mutT locus, which results in A.T----C.G transversions. Images PMID:3128795

  17. Prevalence and Molecular Characterization of Glucose-6-Phosphate Dehydrogenase Deficiency at the China-Myanmar Border.

    PubMed

    Li, Qing; Yang, Fang; Liu, Rong; Luo, Lan; Yang, Yuling; Zhang, Lu; Liu, Huaie; Zhang, Wen; Fan, Zhixiang; Yang, Zhaoqing; Cui, Liwang; He, Yongshu

    2015-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is an X-linked hereditary disease that predisposes red blood cells to oxidative damage. G6PD deficiency is particularly prevalent in historically malaria-endemic areas. Use of primaquine for malaria treatment may result in severe hemolysis in G6PD deficient patients. In this study, we systematically evaluated the prevalence of G6PD deficiency in the Kachin (Jingpo) ethnic group along the China-Myanmar border and determined the underlying G6PD genotypes. We surveyed G6PD deficiency in 1770 adult individuals (671 males and 1099 females) of the Kachin ethnicity using a G6PD fluorescent spot test. The overall prevalence of G6PD deficiency in the study population was 29.6% (523/1770), among which 27.9% and 30.6% were males and females, respectively. From these G6PD deficient samples, 198 unrelated individuals (147 females and 51 males) were selected for genotyping at 11 known G6PD single nucleotide polymorphisms (SNPs) in Southeast Asia (ten in exons and one in intron 11) using a multiplex SNaPshot assay. Mutations with known association to a deficient phenotype were detected in 43.9% (87/198) of cases, intronic and synonymous mutations were detected alone in 34.8% (69/198) cases and no mutation were found in 21.2% (42/198) cases. Five non-synonymous mutations, Mahidol 487G>A, Kaiping 1388G>A, Canton 1376G>T, Chinese 4 392G>T, and Viangchan 871G>A were detected. Of the 87 cases with known deficient mutations, the Mahidol variant was the most common (89.7%; 78/87), followed by the Kaiping (8.0%; 7/87) and the Viangchan (2.2%; 2/87) variants. The Canton and Chinese 4 variants were found in 1.1% of these 87 cases. Among them, two females carried the Mahidol/Viangchan and Mahidol/Kaiping double mutations, respectively. Interestingly, the silent SNPs 1311C>T and IVS11nt93T>C both occurred in the same 95 subjects with frequencies at 56.4% and 23.5% in tested females and males, respectively (P<0.05). It is noteworthy that 24

  18. Rapid diagnostic test for G6PD deficiency in Plasmodium vivax-infected men: a budget impact analysis based in Brazilian Amazon.

    PubMed

    Peixoto, Henry Maia; Brito, Marcelo Augusto Mota; Romero, Gustavo Adolfo Sierra; Monteiro, Wuelton Marcelo; de Lacerda, Marcus Vinícius Guimarães; de Oliveira, Maria Regina Fernandes

    2017-01-01

    The aim of this study was to estimate the incremental budget impact (IBI) of a rapid diagnostic test to detect G6PDd in male patients infected with Plasmodium vivax in the Brazilian Amazon, as compared with the routine protocol recommended in Brazil which does not include G6PDd testing. The budget impact analysis was performed from the perspective of the Brazilian health system, in the Brazilian Amazon for the years 2013, 2014 and 2015. The analysis used a decision model to compare two scenarios: the first consisting of the routine recommended in Brazil which does not include prior diagnosis of dG6PD, and the second based on the use of RDT CareStart™ G6PD (CS-G6PD) in all male subjects diagnosed with vivax malaria. The expected implementation of the diagnostic test was 30% in the first year, 70% the second year and 100% in the third year. The analysis identified negative IBIs which were progressively smaller in the 3 years evaluated. The sensitivity analysis showed that the uncertainties associated with the analytical model did not significantly affect the results. A strategy based on the use of CS-G6PD would result in better use of public resources in the Brazilian Amazon. © 2016 John Wiley & Sons Ltd.

  19. Mutations in PRKN and SNCA Genes Important for the Progress of Parkinson's Disease.

    PubMed

    Oczkowska, Anna; Kozubski, Wojciech; Lianeri, Margarita; Dorszewska, Jolanta

    2013-12-01

    Although Parkinson's disease (PD) was first described almost 200 years ago, it remains an incurable disease with a cause that is not fully understood. Nowadays it is known that disturbances in the structure of pathological proteins in PD can be caused by more than environmental and genetic factors. Despite numerous debates and controversies in the literature about the role of mutations in the SNCA and PRKN genes in the pathogenesis of PD, it is evident that these genes play a key role in maintaining dopamine (DA) neuronal homeostasis and that the dysfunction of this homeostasis is relevant to both familial (FPD) and sporadic (SPD) PD with different onset. In recent years, the importance of alphasynuclein (ASN) in the process of neurodegeneration and neuroprotective function of the Parkin is becoming better understood. Moreover, there have been an increasing number of recent reports indicating the importance of the interaction between these proteins and their encoding genes. Among others interactions, it is suggested that even heterozygous substitution in the PRKN gene in the presence of the variants +2/+2 or +2/+3 of NACP-Rep1 in the SNCA promoter, may increase the risk of PD manifestation, which is probably due to ineffective elimination of over-expressed ASN by the mutated Parkin protein. Finally, it seems that genetic testing may be an important part of diagnostics in patients with PD and may improve the prognostic process in the course of PD. However, only full knowledge of the mechanism of the interaction between the genes associated with the pathogenesis of PD is likely to help explain the currently unknown pathways of selective damage to dopaminergic neurons in the course of PD.

  20. Targeted next generation sequencing identifies novel NOTCH3 gene mutations in CADASIL diagnostics patients.

    PubMed

    Maksemous, Neven; Smith, Robert A; Haupt, Larisa M; Griffiths, Lyn R

    2016-11-24

    Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL) is a monogenic, hereditary, small vessel disease of the brain causing stroke and vascular dementia in adults. CADASIL has previously been shown to be caused by varying mutations in the NOTCH3 gene. The disorder is often misdiagnosed due to its significant clinical heterogeneic manifestation with familial hemiplegic migraine and several ataxia disorders as well as the location of the currently identified causative mutations. The aim of this study was to develop a new, comprehensive and efficient single assay strategy for complete molecular diagnosis of NOTCH3 mutations through the use of a custom next-generation sequencing (NGS) panel for improved routine clinical molecular diagnostic testing. Our custom NGS panel identified nine genetic variants in NOTCH3 (p.D139V, p.C183R, p.R332C, p.Y465C, p.C597W, p.R607H, p.E813E, p.C977G and p.Y1106C). Six mutations were stereotypical CADASIL mutations leading to an odd number of cysteine residues in one of the 34 NOTCH3 gene epidermal growth factor (EGF)-like repeats, including three new typical cysteine mutations identified in exon 11 (p.C597W; c.1791C>G); exon 18 (p.C977G; c.2929T>G) and exon 20 (p.Y1106C; c.3317A>G). Interestingly, a novel missense mutation in the CACNA1A gene was also identified in one CADASIL patient. All variants identified (novel and known) were further investigated using in silico bioinformatic analyses and confirmed through Sanger sequencing. NGS provides an improved and effective methodology for the diagnosis of CADASIL. The NGS approach reduced time and cost for comprehensive genetic diagnosis, placing genetic diagnostic testing within reach of more patients.

  1. Prevalence of Thalassemia and Glucose-6-Phosphate Dehydrogenase Deficiency in Newborns and Adults at the Ramathibodi Hospital, Bangkok, Thailand.

    PubMed

    Banyatsuppasin, Wansa; Jindadamrongwech, Sumalee; Limrungsikul, Anchalee; Butthep, Punnee

    Thalassemias and glucose-6-phosphate dehydrogenase (G6PD) deficiency are the most common inherited blood disorders. They are distributed among populations living in malaria endemic regions resulting in survival advantage from severe malaria disease. The aims of this study were to analyze the prevalence of thalassemias and G6PD deficiency at the Ramathibodi Hospital, Bangkok, Thailand. A total of 616 adult and 174 cord blood samples were collected and analyzed for red blood cell (RBC) parameters, hemoglobin (Hb) typing and DNA analysis for G6PD mutations and α-thalassemia (α-thal). The two most prominent types of thalassemia were heterozygous Hb E (HBB: c.79G>A), (19.5% in newborns and 35.6% in adults) followed by heterozygous α-thal-2 [-α 3.7 (rightward) deletion] at 18.7% in newborns and 19.5% in adults. After performing G6PD genotyping using multiplex amplification refractory mutation system-polymerase chain reaction (multiplex ARMS-PCR) for 10 G6PD mutations, the prevalence of G6PD mutation was found in 12.0% of newborns and 11.7% of adults. The G6PD Viangchan [871 (G>A)] is the most common G6PD mutation in newborns (42.9%) and adults (52.8%). In addition, coinheritance of various types of thalassemia with G6PD deficiency were found. The results indicated that heterozygous Hb E and G6PD Viangchan are predominant both in newborns and adults in this study.

  2. Biological impact of α genes, β haplotypes, and G6PD activity in sickle cell anemia at baseline and with hydroxyurea

    PubMed Central

    Arnaud, Cécile; Kamdem, Annie; Hau, Isabelle; Lelong, Françoise; Epaud, Ralph; Pondarré, Corinne; Pissard, Serge

    2018-01-01

    Sickle cell anemia (SCA), albeit monogenic, has heterogeneous phenotypic expression, mainly related to the level of hemoglobin F (HbF). No large cohort studies have ever compared biological parameters in patients with major β-globin haplotypes; ie, Senegal (SEN), Benin (BEN), and Bantu/Central African Republic (CAR). The aim of this study was to evaluate the biological impact of α genes, β haplotypes, and glucose-6-phosphate dehydrogenase (G6PD) activity at baseline and with hydroxyurea (HU). Homozygous HbS patients from the Créteil pediatric cohort with available α-gene and β-haplotype data were included (n = 580; 301 females and 279 males) in this retrospective study. Homozygous β-haplotype patients represented 74% of cases (37.4% CAR/CAR, 24.3% BEN/BEN, and 12.1% SEN/SEN). HU was given to 168 cohort SCA children. Hematological parameters were recorded when HbF was maximal, and changes (ΔHU-T0) were calculated. At baseline, CAR-haplotype and α-gene numbers were independently and negatively correlated with Hb and positively correlated with lactate dehydrogenase. HbF was negatively correlated with CAR-haplotype numbers and positively with BEN- and SEN-haplotype numbers. The BCL11A/rs1427407 “T” allele, which is favorable for HbF expression, was positively correlated with BEN- and negatively correlated with CAR-haplotype numbers. With HU treatment, Δ and HbF values were positively correlated with the BEN-haplotype number. BEN/BEN patients had higher HbF and Hb levels than CAR/CAR and SEN/SEN patients. In conclusion, we show that BEN/BEN patients have the best response on HU and suggest that this could be related to the higher prevalence of the favorable BCL11A/rs1427407/T/allele for HbF expression in these patients. PMID:29555644

  3. Safety of Live Liver Donation by Individuals With G6PD Deficiency: Initial Results and Comparative Study.

    PubMed

    Reddy, Mettu S; Shrivastav, Manoj; Kaliamoorthy, Ilankumaran; Kota, Venugopal; Dabora, Abderrhaim; Govil, Sanjay; Rela, Mohamed

    2016-04-01

    G6PD deficiency (G6PDd) is the commonest genetic enzyme defect in the world. However, baring a single case report, there is no published literature regarding the safety of donor hepatectomy in G6PDd individuals. Potential donors with World Health Organization class III or class IV G6PDd without evidence of hemolysis were evaluated for donation, if there was no other suitable donor. Postoperatively, donors were closely monitored for hemolysis and medications, which can induce hemolysis, were avoided. Outcomes of our first 14 G6PDd donors are presented. Postoperative course of these donors was also compared with a matched cohort of 30 non-G6PDd donors. There were 9 left lateral segment, 2 left lobe, and 3 right lobe donors. Two G6PDd donors had biochemical evidence of postoperative hemolysis not needing any specific treatment. Postoperative liver function tests, intensive care unit stay, hospital stay, and morbidity (greater than Clavien II) were similar in the G6PDd and non-G6PDd donor cohorts. Donors in the G6PDd group had lower trough hemoglobin in postoperative period (P = 0.006), greater drop in postoperative hemoglobin (P = 0.007), and a higher need for postoperative blood transfusion (4/14 vs 2/30, P = 0.071). This is the first case series reporting the safety of liver resection in G6PDd individuals. Hepatectomy in G6PD-deficient donors is associated with a greater drop in postoperative hemoglobin and a marginally increased need for postoperative transfusion. Use of these donors can be considered with caution, and it should not be an absolute contraindication for live liver donation.

  4. Novel biallelic mutations in MSH6 and PMS2 genes: gene conversion as a likely cause of PMS2 gene inactivation.

    PubMed

    Auclair, Jessie; Leroux, Dominique; Desseigne, Françoise; Lasset, Christine; Saurin, Jean Christophe; Joly, Marie Odile; Pinson, Stéphane; Xu, Xiao Li; Montmain, Gilles; Ruano, Eric; Navarro, Claudine; Puisieux, Alain; Wang, Qing

    2007-11-01

    Since the first report by our group in 1999, more than 20 unrelated biallelic mutations in DNA mismatch repair genes (MMR) have been identified. In the present report, we describe two novel cases: one carrying compound heterozygous mutations in the MSH6 gene; and the other, compound heterozygous mutations in the PMS2 gene. Interestingly, the inactivation of one PMS2 allele was likely caused by gene conversion. Although gene conversion has been suggested to be a mutation mechanism underlying PMS2 inactivation, this is the first report of its involvement in a pathogenic mutation. The clinical features of biallelic mutation carriers were similar to other previously described patients, with the presence of café-au-lait spots (CALS), early onset of brain tumors, and colorectal neoplasia. Our data provide further evidence of the existence, although rare, of a distinct recessively inherited syndrome on the basis of MMR constitutional inactivation. The identification of this syndrome should be useful for genetic counseling, especially in families with atypical hereditary nonpolyposis colon cancer (HNPCC) associated with childhood cancers, and for the clinical surveillance of these mutation carriers. 2007 Wiley-Liss, Inc.

  5. Point-of-care G6PD diagnostics for Plasmodium vivax malaria is a clinical and public health urgency.

    PubMed

    Baird, J Kevin

    2015-12-14

    Malaria caused by Plasmodium vivax threatens over 2 billion people globally and sickens tens of millions annually. Recent clinical evidence discredits the long-held notion of this infection as intrinsically benign revealing an often threatening course associated with mortality. Most acute attacks by this species derive from latent forms in the human liver called hypnozoites. Radical cure for P. vivax malaria includes therapy aimed both at the acute attack (blood schizontocidal) and against future attacks (hypnozoitocidal). The only hypnozoitocide available is primaquine, a drug causing life-threatening acute hemolytic anemia in patients with the inherited blood disorder glucose-6-phosphate dehydrogenase (G6PD) deficiency. This disorder affects 400 million people worldwide, at an average prevalence of 8 % in malaria-endemic nations. In the absence of certain knowledge regarding the G6PD status of patients infected by P. vivax, providers must choose between the risk of harm caused by primaquine and that caused by the parasite by withholding therapy. Resolving this dilemma requires the availability of point-of-care G6PD diagnostics practical for use in the impoverished rural tropics where the vast majority of malaria patients seek care.

  6. Hepatic transcriptional profiling response to fava bean-induced oxidative stress in glucose-6-phosphate dehydrogenase-deficient mice.

    PubMed

    Du, Guankui; Xiao, Man; Wei, Xiuyu; Zhou, Chen; Li, Shuoshuo; Cai, Wangwei

    2018-04-30

    Favism is an acute hemolytic syndrome caused by the ingestion of fava bean (FB) in glucose 6-phosphate dehydrogenase (G6PD) deficient individuals. However, little is known about the global transcripts alteration in liver tissue after FB ingestion in G6PD-normal and -deficient states. In this study, deep sequencing was used to analyze liver genes expression alterations underlying the effects of FB in C3H (Wild Type, WT) and G6PD-deficient (G6PDx) mice and to evaluate and visualize the collective annotation of a list of genes to Gene Ontology (GO) terms associated with favism. Our results showed that FB resulted in a decrease of glutathione (GSH)-to-oxidized glutathione (GSSG) ratio and an increase of malondialdehyde (MDA) both in the G6PDx and WT-control check (CK) mice plasma. Significantly, liver transcript differences were observed between the control and FB-treated groups of both WT and G6PDx mice. A total of 320 differentially expressed transcripts were identified by comparison of G6PDx-CK with WT-CK and were associated with immune response and oxidation-reduction function. A total of 149 differentially expressed genes were identified by comparison of WT-FB with WT-CK. These genes were associated with immune response, steroid metabolic process, creatine kinase activity, and fatty acid metabolic process. A total of 438 differential genes were identified by comparing G6PDx-FB with G6PD-CK, associated with the negative regulation of fatty acid metabolic process, endoplasmic reticulum, iron binding, and glutathione transferase activity. These findings indicate that G6PD mutations may affect the functional categories such as immune response and oxidation-reduction. Copyright © 2018 Elsevier B.V. All rights reserved.

  7. Interaction of polymorphisms in the genes encoding interleukin-6 and estrogen receptor beta on the susceptibility to Parkinson's disease.

    PubMed

    Håkansson, Anna; Westberg, Lars; Nilsson, Staffan; Buervenich, Silvia; Carmine, Andrea; Holmberg, Björn; Sydow, Olof; Olson, Lars; Johnels, Bo; Eriksson, Elias; Nissbrandt, Hans

    2005-02-05

    The multifunctional cytokine interleukin-6 (IL-6) is involved in inflammatory processes in the central nervous system and increased levels of IL-6 have been found in patients with Parkinson's disease (PD). It is known that estrogen inhibits the production of IL-6, via action on estrogen receptors, thereby pointing to an important influence of estrogen on IL-6. In a previous study, we reported an association between a G/A single nucleotide polymorphism (SNP) at position 1730 in the gene coding for estrogen receptor beta (ERbeta) and age of onset of PD. To investigate the influence of a G/C SNP at position 174 in the promoter of the IL-6 gene, and the possible interaction of this SNP and the ERbeta G-1730A SNP on the risk for PD, the G-174C SNP was genotyped, by pyrosequencing, in 258 patients with PD and 308 controls. A significantly elevated frequency of the GG genotype of the IL-6 SNP was found in the patient group and this was most obvious among patients with an early age of onset (PD. When the GG genotypes of the IL-6 and ERbeta SNPs were combined, the combination was much more robustly associated with PD, and especially with PD with an early age of onset, than respective GG genotype when analyzed separately. Our results indicate that the G-174C SNP in the IL-6 promoter may influence the risk for developing PD, particularly regarding early age of onset PD, and that the effect is modified by interaction of the G-1730A SNP in the ERbeta gene. (c) 2004 Wiley-Liss, Inc.

  8. The p.L302P mutation in the lysosomal enzyme gene SMPD1 is a risk factor for Parkinson disease

    PubMed Central

    Gan-Or, Ziv; Ozelius, Laurie J.; Bar-Shira, Anat; Saunders-Pullman, Rachel; Mirelman, Anat; Kornreich, Ruth; Gana-Weisz, Mali; Raymond, Deborah; Rozenkrantz, Liron; Deik, Andres; Gurevich, Tanya; Gross, Susan J.; Schreiber-Agus, Nicole; Giladi, Nir; Bressman, Susan B.

    2013-01-01

    Objective: To study the possible association of founder mutations in the lysosomal storage disorder genes HEXA, SMPD1, and MCOLN1 (causing Tay-Sachs, Niemann-Pick A, and mucolipidosis type IV diseases, respectively) with Parkinson disease (PD). Methods: Two PD patient cohorts of Ashkenazi Jewish (AJ) ancestry, that included a total of 938 patients, were studied: a cohort of 654 patients from Tel Aviv, and a replication cohort of 284 patients from New York. Eight AJ founder mutations in the HEXA, SMPD1, and MCOLN1 genes were analyzed. The frequencies of these mutations were compared to AJ control groups that included large published groups undergoing prenatal screening and 282 individuals matched for age and sex. Results: Mutation frequencies were similar in the 2 groups of patients with PD. The SMPD1 p.L302P was strongly associated with a highly increased risk for PD (odds ratio 9.4, 95% confidence interval 3.9–22.8, p < 0.0001), as 9/938 patients with PD were carriers of this mutation compared to only 11/10,709 controls. Conclusions: The SMPD1 p.L302P mutation is a novel risk factor for PD. Although it is rare on a population level, the identification of this mutation as a strong risk factor for PD may further elucidate PD pathogenesis and the role of lysosomal pathways in disease development. PMID:23535491

  9. Enhanced striatal dopamine transmission and motor performance with LRRK2 overexpression in mice is eliminated by familial Parkinson's disease mutation G2019S.

    PubMed

    Li, Xianting; Patel, Jyoti C; Wang, Jing; Avshalumov, Marat V; Nicholson, Charles; Buxbaum, Joseph D; Elder, Gregory A; Rice, Margaret E; Yue, Zhenyu

    2010-02-03

    PARK8/LRRK2 (leucine-rich repeat kinase 2) was recently identified as a causative gene for autosomal dominant Parkinson's disease (PD), with LRRK2 mutation G2019S linked to the most frequent familial form of PD. Emerging in vitro evidence indicates that aberrant enzymatic activity of LRRK2 protein carrying this mutation can cause neurotoxicity. However, the physiological and pathophysiological functions of LRRK2 in vivo remain elusive. Here we characterize two bacterial artificial chromosome (BAC) transgenic mouse strains overexpressing LRRK2 wild-type (Wt) or mutant G2019S. Transgenic LRRK2-Wt mice had elevated striatal dopamine (DA) release with unaltered DA uptake or tissue content. Consistent with this result, LRRK2-Wt mice were hyperactive and showed enhanced performance in motor function tests. These results suggest a role for LRRK2 in striatal DA transmission and the consequent motor function. In contrast, LRRK2-G2019S mice showed an age-dependent decrease in striatal DA content, as well as decreased striatal DA release and uptake. Despite increased brain kinase activity, LRRK2-G2019S overexpression was not associated with loss of DAergic neurons in substantia nigra or degeneration of nigrostriatal terminals at 12 months. Our results thus reveal a pivotal role for LRRK2 in regulating striatal DA transmission and consequent control of motor function. The PD-associated mutation G2019S may exert pathogenic effects by impairing these functions of LRRK2. Our LRRK2 BAC transgenic mice, therefore, could provide a useful model for understanding early PD pathological events.

  10. Mutations in the vesicular trafficking protein annexin A11 are associated with amyotrophic lateral sclerosis.

    PubMed

    Smith, Bradley N; Topp, Simon D; Fallini, Claudia; Shibata, Hideki; Chen, Han-Jou; Troakes, Claire; King, Andrew; Ticozzi, Nicola; Kenna, Kevin P; Soragia-Gkazi, Athina; Miller, Jack W; Sato, Akane; Dias, Diana Marques; Jeon, Maryangel; Vance, Caroline; Wong, Chun Hao; de Majo, Martina; Kattuah, Wejdan; Mitchell, Jacqueline C; Scotter, Emma L; Parkin, Nicholas W; Sapp, Peter C; Nolan, Matthew; Nestor, Peter J; Simpson, Michael; Weale, Michael; Lek, Monkel; Baas, Frank; Vianney de Jong, J M; Ten Asbroek, Anneloor L M A; Redondo, Alberto Garcia; Esteban-Pérez, Jesús; Tiloca, Cinzia; Verde, Federico; Duga, Stefano; Leigh, Nigel; Pall, Hardev; Morrison, Karen E; Al-Chalabi, Ammar; Shaw, Pamela J; Kirby, Janine; Turner, Martin R; Talbot, Kevin; Hardiman, Orla; Glass, Jonathan D; De Belleroche, Jacqueline; Maki, Masatoshi; Moss, Stephen E; Miller, Christopher; Gellera, Cinzia; Ratti, Antonia; Al-Sarraj, Safa; Brown, Robert H; Silani, Vincenzo; Landers, John E; Shaw, Christopher E

    2017-05-03

    Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disorder. We screened 751 familial ALS patient whole-exome sequences and identified six mutations including p.D40G in the ANXA11 gene in 13 individuals. The p.D40G mutation was absent from 70,000 control whole-exome sequences. This mutation segregated with disease in two kindreds and was present in another two unrelated cases ( P = 0.0102), and all mutation carriers shared a common founder haplotype. Annexin A11-positive protein aggregates were abundant in spinal cord motor neurons and hippocampal neuronal axons in an ALS patient carrying the p.D40G mutation. Transfected human embryonic kidney cells expressing ANXA11 with the p.D40G mutation and other N-terminal mutations showed altered binding to calcyclin, and the p.R235Q mutant protein formed insoluble aggregates. We conclude that mutations in ANXA11 are associated with ALS and implicate defective intracellular protein trafficking in disease pathogenesis. Copyright © 2017, American Association for the Advancement of Science.

  11. Identification of the PLA2G6 c.1579G>A Missense Mutation in Papillon Dog Neuroaxonal Dystrophy Using Whole Exome Sequencing Analysis

    PubMed Central

    Tsuboi, Masaya; Watanabe, Manabu; Nibe, Kazumi; Yoshimi, Natsuko; Kato, Akihisa; Sakaguchi, Masahiro; Yamato, Osamu; Tanaka, Miyuu; Kuwamura, Mitsuru; Kushida, Kazuya; Harada, Tomoyuki; Chambers, James Kenn; Sugano, Sumio; Uchida, Kazuyuki; Nakayama, Hiroyuki

    2017-01-01

    Whole exome sequencing (WES) has become a common tool for identifying genetic causes of human inherited disorders, and it has also recently been applied to canine genome research. We conducted WES analysis of neuroaxonal dystrophy (NAD), a neurodegenerative disease that sporadically occurs worldwide in Papillon dogs. The disease is considered an autosomal recessive monogenic disease, which is histopathologically characterized by severe axonal swelling, known as “spheroids,” throughout the nervous system. By sequencing all eleven DNA samples from one NAD-affected Papillon dog and her parents, two unrelated NAD-affected Papillon dogs, and six unaffected control Papillon dogs, we identified 10 candidate mutations. Among them, three candidates were determined to be “deleterious” by in silico pathogenesis evaluation. By subsequent massive screening by TaqMan genotyping analysis, only the PLA2G6 c.1579G>A mutation had an association with the presence or absence of the disease, suggesting that it may be a causal mutation of canine NAD. As a human homologue of this gene is a causative gene for infantile neuroaxonal dystrophy, this canine phenotype may serve as a good animal model for human disease. The results of this study also indicate that WES analysis is a powerful tool for exploring canine hereditary diseases, especially in rare monogenic hereditary diseases. PMID:28107443

  12. Remarkable difference of somatic mutation patterns between oncogenes and tumor suppressor genes.

    PubMed

    Liu, Haoxuan; Xing, Yuhang; Yang, Sihai; Tian, Dacheng

    2011-12-01

    Cancers arise owing to mutations that confer selective growth advantages on the cells in a subset of tumor suppressor and/or oncogenes. To understand oncogenesis and diagnose cancers, it is crucial to discriminate these two groups of genes by using the difference in their mutation patterns. Here, we investigated>120,000 mutation samples in 66 well-known tumor suppressor genes and oncogenes of the COSMIC database, and found a set of significant differences in mutation patterns (e.g., non-3n-indel, non-sense SNP and mutation hotspot) between them. By screening the best measurement, we developed indices to readily distinguish one from another and predict clearly the unknown oncogenesis genes as tumor suppressors (e.g., ASXL1, HNF1A and KDM6A) or oncogenes (e.g., FOXL2, MYD88 and TSHR). Based on our results, a third gene group can be classified, which has a mutational pattern between tumor suppressors and oncogenes. The concept of the third gene group could help to understand gene function in different cancers or individual patients and to know the exact function of genes in oncogenesis. In conclusion, our study provides further insights into cancer-related genes and identifies several potential therapeutic targets.

  13. Mutations in a gene encoding the. cap alpha. subunit of a Saccharomyces cerevisiae G protein indicate a role in mating pheromone signaling

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jahng, K.Y.; Ferguson, J.; Reed, S.I.

    1988-06-01

    Mutations which allowed conjugation by Saccharomyces cerevisiae cells lacking a mating pheromone receptor gene were selected. One of the genes defined by such mutations was isolated from a yeast genomic library by complementation of a temperature-sensitive mutation and is identically to the gene GPA1 (also known as SCG1), recently shown to be highly homologous to gene encoding the ..cap alpha.. subunits of mammalian G proteins. Physiological analysis of temperature-sensitive gpal mutations suggests that the encoded G protein is involved in signaling in response to mating pheromones. Mutational disruption of G-protein activity causes cell-cycle arrest in G/sub 1/, deposition of mating-specificmore » cell surface aggultinins, and induction of pheromone-specific mRNa, all of which are responses to pheromone in wild-type cells. In addition, mutants can conjugate without the benefit of mating pheromone or pheromone receptor. A model is presented where the activated G protein has a negative impact on a constitutive signal which normally keeps the pheromone response repressed.« less

  14. Programmed cell death-ligand 1 (PD-L1) expression is associated with RAS/TP53 mutations in lung adenocarcinoma.

    PubMed

    Serra, Pierre; Petat, Arthur; Maury, Jean-Michel; Thivolet-Bejui, Françoise; Chalabreysse, Lara; Barritault, Marc; Ebran, Nathalie; Milano, Gérard; Girard, Nicolas; Brevet, Marie

    2018-04-01

    The systematic assessment of anti-programmed cell death ligand 1 (PD-L1) expression by immunohistochemistry (IHC) in lung adenocarcinomas is becoming standard practice. However, the assessment of PD-L1 expression on small tissue specimens needs to be evaluated and the association with other features more thoroughly analyzed. This retrospective single center study evaluated the immunohistochemical expression of the SP263 anti-PD-L1 antibody on tissue microarrays (TMA) of 152 surgically resected lung adenocarcinomas, using a 25% positivity threshold. The positive cases and 50 randomly chosen negative cases in tissue microarray (TMA) were reassessed on whole tissue sections. The results were correlated to clinical, histopathological and to molecular data obtained through the screening of 214 mutations in 26 genes (LungCarta panel, Agena Biosciences). Among 152 primary lung adenocarcinomas, 19 cases (13%) showed PD-L1 expression. The agreement between TMA and whole tissue sections was 89%, specificity was 97%. PD-L1 expression was correlated to RAS mutations (p = .04), RAS/TP53 co-mutations (p = .01) and to the solid or acinar subtype (p = .048). With the SP263 PD-L1 antibody, small samples appear as a reliable means to evaluate the PD-L1 status in lung adenocarcinoma. The association between PD-L1 expression and RAS/TP53 mutations may have clinical relevance to predict the efficacy of PD-1/PD-L1 immune checkpoints inhibitors. Copyright © 2018 Elsevier B.V. All rights reserved.

  15. Favorable outcome of patients with lung adenocarcinoma harboring POLE mutations and expressing high PD-L1.

    PubMed

    Liu, Liang; Ruiz, Jimmy; O'Neill, Stacey S; Grant, Stefan C; Petty, W Jeffrey; Yang, Meng; Chen, Kexin; Topaloglu, Umit; Pasche, Boris; Zhang, Wei

    2018-04-12

    Mutations in polymerase ε (POLE) confer favorable prognosis and outcomes in various cancer types, but their role in non-small cell lung cancer (NSCLC) is unknown. Utilizing the data of 513 patients with adenocarcinoma (LUAD) and 497 patients with squamous cell carcinoma (LUSC) from The Cancer Genome Atlas (TCGA) cohort, we tested the prognostic value of POLE mutations and programmed cell death ligand 1 (PD-L1) expression in the two main subtypes of NSCLC. POLE mutation is a favorable biomarker for the improved overall survival (OS) of the LUSC patients (P = 0.033, 28 mutant vs. 469 wildtype patients), but not that of the LUAD patients (P = 0.12, 31 mutant vs. 482 wildtype patients). POLE-mutant LUAD patients with high expression of PD-L1 (Mut-High, n = 6) exhibited improved OS (P = 0.024) when compared to POLE-mutant patients with low PD-L1 expression (Mut-Low, n = 24) and other patients without POLE mutation (n = 476). This benefit was not due to the high content of the tumor infiltrating lymphocytes. Instead, the antitumor immune response was activated in Mut-High patients so that these patients were likely responding more effectively to immuno-oncology (IO) treatments; whereas genes involved with metabolic pathways were enriched in Mut-Low group, which may cause the decreased OS of these patients. Our study sheds light on the molecular basis of NSCLC and adds to our understanding of responses to chemotherapy and IO therapy.

  16. Molecular characterization of erythrocyte glucose-6-phosphate dehydrogenase deficiency in Al-Ain District, United Arab Emirates.

    PubMed

    Bayoumi, R A; Nur-E-Kamal, M S; Tadayyon, M; Mohamed, K K; Mahboob, B H; Qureshi, M M; Lakhani, M S; Awaad, M O; Kaeda, J; Vulliamy, T J; Luzzatto, L

    1996-01-01

    In a cross-sectional study, the activity, electrophoretic mobility and genotypes of glucose-6-phosphate dehydrogenase (G6PD) were determined among healthy, UAE national school boys from Al-Ain District in the United Arab Emirates, The prevalence of G6PD deficiency in this population sample was 11%. The majority of G6PD-deficient subjects were descendants of Omani, Baluchi or Yemeni migrants. Of 18 deficient subjects, 16 had an enzyme activity of < 10% of normal while 2 had an activity of just above 10%. Electrophoresis was performed on 166 samples and showed that, apart from deficient samples, all had the normal mobility of G6PD type B. Of the 18 deficient subjects, 14 had the B type mobility of G6PD Mediterranean and 4 had the A type mobility of G6PD A-. Genotyping demonstrated that 10 had the Mediterranean mutation while 3 had the A- mutation, consistent with their electrophoretic mobility. Another 3 had the G6PD Aures mutation, recently described as polymorphic in Algeria and Spain. The mutations in the remaining 2 subjects have not yet been identified.

  17. Glycogen storage disease type 1a in three siblings with the G270V mutation.

    PubMed

    Parvari, R; Isam, J; Moses, S W

    1999-04-01

    Glycogen storage disease type 1a (von Gierke disease, GSD1a) is caused by the deficiency of microsomal glucose-6-phosphatase (G6Pase) activity. The cloning of G6Pase cDNA and characterization of the human G6Pase gene enabled the identification of the mutations causing GSD1a. Here we report on the clinical and biochemical features of three GSD1a siblings of a Muslin Arab family with a G270V mutation. Two older patients presented with an unusually mild clinical and biochemical course.

  18. PD-1/PD-L1 pathway inhibitors in advanced prostate cancer.

    PubMed

    Isaacsson Velho, Pedro; Antonarakis, Emmanuel S

    2018-05-01

    Pharmacological inhibition of immune checkpoint receptors or their ligands represents a transformative breakthrough in the management of multiple cancers. However, immune checkpoint inhibitors have yet to be FDA-approved for the management of metastatic prostate cancer (PCa), the commonest non-cutaneous malignancy in men. Areas covered: We review our current understanding of the PD-1/PD-L1 pathway in cancer, the use of anti-PD-1/PD-L1 therapeutics in PCa, and potential subgroups of PCa patients who may derive the greatest benefit from these agents (such as men with tumors that have expression of PD-L1 and/or high mutational load). We also review the prior and current clinical trials evaluating the blockade of PD-1/PD-L1 in PCa, highlighting some of the key ongoing studies of greatest relevance to the field. Expert commentary: Clinical trials investigating PD-1/PD-L1 inhibitors should be encouraged in patients with PCa. While it is unlikely that immune checkpoint monotherapies will produce long-lasting responses in a substantial proportion of patients, there is early evidence of activity in some patient subsets. These subgroups may include those with high PD-L1 expression, those with hypermutated or microsatellite-unstable tumors, and those enriched for germline and/or somatic DNA-repair gene mutations (e.g. intraductal/ductal histology, primary Gleason pattern 5, and perhaps AR-V7-positive tumors).

  19. Prevalence and molecular characterization of glucose-6-phosphate dehydrogenase deficiency in northern Thailand.

    PubMed

    Charoenkwan, Pimlak; Tantiprabha, Watcharee; Sirichotiyakul, Supatra; Phusua, Arunee; Sanguansermsri, Torpong

    2014-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is one of the most common inherited enzymopathies in endemic areas of malaria including Southeast Asia. The molecular features of G6PD deficiency are similar among Southeast Asian population, with differences in the type of the prominent variants in each region. This study determined the prevalence and molecular characteristics of G6PD deficiency in northern Thailand. Quantitative assay of G6PD activity was conducted in 566 neonatal cord blood samples and 6 common G6PD mutations were determined by PCR-restriction fragment length polymorphism method on G6PD complete and intermediate deficiency samples. Ninety newborns had G6PD deficiency, with prevalence in male newborns of 17% and that of female newborns having an intermediate and complete deficiency of 13% and 2%, respectively. From 95 G6PD alleles tested, G6PD Mahidol, G6PD Kaiping, G6PD Canton, G6PD Viangchan, G6PD Union, and G6PD Chinese-5 was detected in 19, 17, 15, 13, 7, and 2 alleles, respectively. Our study shows that the prevalence of G6PD deficiency in northern Thai population is high and combination of the common Chinese mutations is the majority, a distribution different from central and southern Thailand where G6PD Viangchan is the prominent variant. These findings suggest a higher proportion of assimilated Chinese ethnic group in the northern Thai population.

  20. Mechanistic study on the nuclear modifier gene MSS1 mutation suppressing neomycin sensitivity of the mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae.

    PubMed

    Zhou, Qiyin; Wang, Wei; He, Xiangyu; Zhu, Xiaoyu; Shen, Yaoyao; Yu, Zhe; Wang, Xuexiang; Qi, Xuchen; Zhang, Xuan; Fan, Mingjie; Dai, Yu; Yang, Shuxu; Yan, Qingfeng

    2014-01-01

    The phenotypic manifestation of mitochondrial DNA (mtDNA) mutations can be modulated by nuclear genes and environmental factors. However, neither the interaction among these factors nor their underlying mechanisms are well understood. The yeast Saccharomyces cerevisiae mtDNA 15S rRNA C1477G mutation (PR) corresponds to the human 12S rRNA A1555G mutation. Here we report that a nuclear modifier gene mss1 mutation suppresses the neomycin-sensitivity phenotype of a yeast C1477G mutant in fermentable YPD medium. Functional assays show that the mitochondrial function of the yeast C1477G mutant was impaired severely in YPD medium with neomycin. Moreover, the mss1 mutation led to a significant increase in the steady-state level of HAP5 (heme activated protein), which greatly up-regulated the expression of glycolytic transcription factors RAP1, GCR1, and GCR2 and thus stimulated glycolysis. Furthermore, the high expression of the key glycolytic enzyme genes HXK2, PFK1 and PYK1 indicated that enhanced glycolysis not only compensated for the ATP reduction from oxidative phosphorylation (OXPHOS) in mitochondria, but also ensured the growth of the mss1(PR) mutant in YPD medium with neomycin. This study advances our understanding of the phenotypic manifestation of mtDNA mutations.

  1. Novel mutation in ABCC6 gene in a Japanese pedigree with pseudoxanthoma elasticum and retinitis pigmentosa.

    PubMed

    Yoshida, S; Honda, M; Yoshida, A; Nakao, S; Goto, Y; Nakamura, T; Fujisawa, K; Ishibashi, T

    2005-02-01

    To report a novel mutation of the ABCC6 gene in a Japanese family that had a case of pseudoxanthoma elasticum (PXE) another with PXE and retinitis pigmentosa. Ophthalmologic examinations were performed, and the ABCC6 gene was analysed by direct genomic sequencing. Fundus examinations of the 48-year-old proband disclosed angioid streaks and a peud'orange appearance of the retina of the both eyes, whereas both of his 25- and 20-year-old daughters had pigmentary degeneration and angioid streaks. In the sibilings, the mixed cone-rod ERG was almost nondetectable, whereas that of the proband was well-preserved. Molecular genetic analysis revealed that the proband has a homozygous nonsense mutation at the 595 bp in the ABCC6, and the siblings were heterozygous for the same mutation. This mutation was not detected in Japanese subjects in the JSNP database (http://snp.ims.u-tokyo.ac.jp/). Our results demonstrated an association between a novel mutation in the ABCC6 gene and PXE in a Japanese family.

  2. Next-generation sequencing identifies three novel missense variants in ILDR1 and MYO6 genes in an Iranian family with hearing loss with review of the literature.

    PubMed

    Talebi, Farah; Mardasi, Farideh Ghanbari; Asl, Javad Mohammadi; Sayahi, Masoomeh

    2017-12-01

    Hearing impairment is the most common sensorineural disorder and is genetically heterogeneous. Identification of the pathogenic mutations underlying hearing impairment is difficult, since causative mutations in 127 different genes have so far been reported. In this study, we performed Next-generation sequencing (NGS) in 2 individuals from a consanguineous family with hearing loss. Three novel mutations in known deafness genes were identified in the family; MYO6-p.R928C and -p.D1223N in heterozygous state and ILDR1-p.Y143C in homozygous state. Sanger sequencing confirmed co-segregation of the three mutations with deafness in the family. The identified mutation in ILDR1 gene is located in the immunoglobulin-type domain of the ILDR1 protein and the detected mutations in MY06 are located in the tail domain of the MYO6 protein. The mutations are predicted to be pathogenic by SIFT, PolyPhen and Mutation Taster. Our results suggest that either the homozygous ILDR1-p.Y143C mutation might be the pathogenic variant for ARNSHL or heterozygous MYO6- p.R928C, -p.D1223N might be involved in these patient's disorder due to compound heterozygousity. To our knowledge, this is the first ILDR1 and MYO6 mutations recognized in the southwest Iran. Our data expands the spectrum of mutations in ILDR1 and MYO6 genes. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Effect of mutant variants of the KRAS gene on PD-L1 expression and on the immune microenvironment and association with clinical outcome in lung adenocarcinoma patients.

    PubMed

    Falk, Alexander T; Yazbeck, Nathalie; Guibert, Nicolas; Chamorey, Emmanuel; Paquet, Agnès; Ribeyre, Lydia; Bence, Coraline; Zahaf, Katia; Leroy, Sylvie; Marquette, Charles-Hugo; Cohen, Charlotte; Mograbi, Baharia; Mazières, Julien; Hofman, Véronique; Brest, Patrick; Hofman, Paul; Ilié, Marius

    2018-07-01

    The effect of anti-PD-1/PD-L1 inhibitors on lung adenocarcinomas (LADCs) with KRAS mutations is debatable. We examined the association between specific mutant KRAS proteins and the immune infiltrates with the outcome of patients with LADCs. In 219 LADCs harboring either wild-type (WT) or mutated KRAS gene, we quantified the density of several immune markers by immunohistochemistry followed by automated digital image analysis. Data were correlated to clinicopathological parameters and outcome of patients. Tumors harboring mutant KRAS-G12 V had a significantly higher PD-L1 expression compared to other tumors (p = 0.044), while mutant KRAS-G12D tumors showed an increase in the density of CD66b+ cells (p = 0.001). High PD-L1 expression in tumor cells was associated to improved overall survival (OS) in KRAS mutant patients (p = 0.012), but not in the WT population (p = 0.385), whereas increased PD-L1 expression in immune cells correlated to poor OS of KRAS-WT patients (p = 0.025), with no difference in patients with KRAS mutations. KRAS mutational status can affect the immune microenvironment and survival of LADC patients in a heterogeneous way, implying that specific mutant KRAS variants expressed by the tumor should be considered when stratifying patients for immunotherapy. Copyright © 2018 Elsevier B.V. All rights reserved.

  4. Mitochondrial tRNA(Thr) A15951G mutation may not be associated with Leber's Hereditary Optic Neuropathy.

    PubMed

    Zhang, Xi; Yu, Shuaishuai; Tu, Yunhai; Huang, Wenjie

    2016-07-01

    Mutation in mitochondrial DNA (mtDNA) has been found to play an important role in the pathogenesis of Leber's Hereditary Optic Neuropathy (LHON). Three primary mutations, the ND4 G11778A, ND6 T14484C, and ND1 G3460A, have been found to account more than 90% of LHON patients in many families worldwide. In addition to the mutations in genes encoding the respiratory chain complex I, reports concerning the mt-tRNA gene mutations associated with LHON have increased, some pathogenic mutations caused the failure in mt-tRNA metabolism, thereby worsened the mitochondrial dysfunction that is responsible for LHON. Recently, the A15951G mutation in mt-tRNA(Thr) gene has been reported to be a "modified" factor in increasing the penetrance and expressivity of LHON-associated ND4 G11778A mutation in three Chinese families. However, evolutionary conservation analysis of this mutation suggested a poor conservation index and the pathogenicity scoring system showed that this mutation was a neutral polymorphism.

  5. A novel mutation MT-COIII m.9267G>C and MT-COI m.5913G>A mutation in mitochondrial genes in a Tunisian family with maternally inherited diabetes and deafness (MIDD) associated with severe nephropathy.

    PubMed

    Tabebi, Mouna; Mkaouar-Rebai, Emna; Mnif, Mouna; Kallabi, Fakhri; Ben Mahmoud, Afif; Ben Saad, Wafa; Charfi, Nadia; Keskes-Ammar, Leila; Kamoun, Hassen; Abid, Mohamed; Fakhfakh, Faiza

    2015-04-10

    Mitochondrial diabetes (MD) is a heterogeneous disorder characterized by a chronic hyperglycemia, maternal transmission and its association with a bilateral hearing impairment. Several studies reported mutations in mitochondrial genes as potentially pathogenic for diabetes, since mitochondrial oxidative phosphorylation plays an important role in glucose-stimulated insulin secretion from beta cells. In the present report, we studied a Tunisian family with mitochondrial diabetes (MD) and deafness associated with nephropathy. The mutational analysis screening revealed the presence of a novel heteroplasmic mutation m.9276G>C in the mitochondrial COIII gene, detected in mtDNA extracted from leukocytes of a mother and her two daughters indicating that this mutation is maternally transmitted and suggest its implication in the observed phenotype. Bioinformatic tools showed that m.9267G>C mutation (p.A21P) is « deleterious » and it can modify the function and the stability of the MT-COIII protein by affecting the assembly of mitochondrial COX subunits and the translocation of protons then reducing the activity of the respective OXPHOS complexes of ATP synthesis. The nonsynonymous mutation (p.A21P) has not been reported before, it is the first mutation described in the COXIII gene which is related to insulin dependent mitochondrial diabetes and deafness and could be specific to the Tunisian population. The m.9267G>C mutation was present with a nonsynonymous inherited mitochondrial homoplasmic variation MT-COI m.5913 G>A (D4N) responsible of high blood pressure, a clinical feature detected in all explored patients. Copyright © 2015. Published by Elsevier Inc.

  6. The insulin-like growth factor 2 (IGF2) gene intron3-g.3072G>A polymorphism is not the only Sus scrofa chromosome 2p mutation affecting meat production and carcass traits in pigs: evidence from the effects of a cathepsin D (CTSD) gene polymorphism.

    PubMed

    Fontanesi, L; Speroni, C; Buttazzoni, L; Scotti, E; Dall'Olio, S; Nanni Costa, L; Davoli, R; Russo, V

    2010-07-01

    The objective of this study was to evaluate the effects of mutations in 2 genes [IGF2 and cathepsin D (CTSD)] that map on the telomeric end of the p arm of SSC2. In this region, an imprinted QTL affecting muscle mass and fat deposition was reported, and the IGF2 intron3-g.3072G>A substitution was identified as the causative mutation. In the same chromosome region, we assigned, by linkage mapping, the CTSD gene, a lysosomal proteinase, for which we previously identified an SNP in the 3'-untranslated region (AM933484, g.70G>A). We have already shown strong effects of this CTSD mutation on several production traits in Italian Large White pigs, suggesting a possible independent role of this marker in fatness and meat deposition in pigs. To evaluate this hypothesis, after having refined the map position of the CTSD gene by radiation hybrid mapping, we analyzed the IGF2 and the CTSD polymorphisms in 270 Italian Large White and 311 Italian Duroc pigs, for which EBV and random residuals from fixed models were calculated for several traits. Different association analyses were carried out to distinguish the effects of the 2 close markers. In the Italian Large White pigs, the results for IGF2 were highly significant for all traits when using either EBV or random residuals (e.g., using EBV: lean cuts, P = 2.2 x 10(-18); ADG, P = 2.6 x 10(-16); backfat thickness, P = 2.2 x 10(-9); feed:gain ratio, P = 2.3 x 10(-9); ham weight, P = 1.5 x 10(-6)). No effect was observed for meat quality traits. The IGF2 intron3-g.3072G>A mutation did not show any association in the Italian Duroc pigs, probably because of the small variability at this polymorphic site for this breed. However, a significant association was evident for the CTSD marker (P < 0.001) with EBV of all carcass and production traits in Italian Duroc pigs (lean content, ADG, backfat thickness, feed:gain ratio) after excluding possible confounding effects of the IGF2 mutation. The effects of the CTSD g.70G>A mutation were

  7. A novel mutation MT-COIII m.9267G>C and MT-COI m.5913G>A mutation in mitochondrial genes in a Tunisian family with maternally inherited diabetes and deafness (MIDD) associated with sever nephropathy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tabebi, Mouna, E-mail: mouna.biologiste@yahoo.com; Mkaouar-Rebai, Emna; Mnif, Mouna

    Mitochondrial diabetes (MD) is a heterogeneous disorder characterized by a chronic hyperglycemia, maternal transmission and its association with a bilateral hearing impairment. Several studies reported mutations in mitochondrial genes as potentially pathogenic for diabetes, since mitochondrial oxidative phosphorylation plays an important role in glucose-stimulated insulin secretion from beta cells. In the present report, we studied a Tunisian family with mitochondrial diabetes (MD) and deafness associated with nephropathy. The mutational analysis screening revealed the presence of a novel heteroplasmic mutation m.9276G>C in the mitochondrial COIII gene, detected in mtDNA extracted from leukocytes of a mother and her two daughters indicating thatmore » this mutation is maternally transmitted and suggest its implication in the observed phenotype. Bioinformatic tools showed that m.9267G>C mutation (p.A21P) is « deleterious » and it can modify the function and the stability of the MT-COIII protein by affecting the assembly of mitochondrial COX subunits and the translocation of protons then reducing the activity of the respective OXPHOS complexes of ATP synthesis. The nonsynonymous mutation (p.A21P) has not been reported before, it is the first mutation described in the COXIII gene which is related to insulin dependent mitochondrial diabetes and deafness and could be specific to the Tunisian population. The m.9267G>C mutation was present with a nonsynonymous inherited mitochondrial homoplasmic variation MT-COI m.5913 G>A (D4N) responsible of high blood pressure, a clinical feature detected in all explored patients. - Highlights: • MT-COX3 m.9267G>C (p.A21P), heteroplasmic substitution, is not reported in any database. • m.9267G>C can be responsible of the MIDD associated with nephropaty. • This substitution can modify the function and the stability of the MT-CO3 protein. • This substitution can modify MT-CO3 structure (2D and 3D). • MT-COX3 m.9267G>C is

  8. Mutations in PRKN and SNCA Genes Important for the Progress of Parkinson’s Disease

    PubMed Central

    Oczkowska, Anna; Kozubski, Wojciech; Lianeri, Margarita; Dorszewska, Jolanta

    2013-01-01

    Although Parkinson’s disease (PD) was first described almost 200 years ago, it remains an incurable disease with a cause that is not fully understood. Nowadays it is known that disturbances in the structure of pathological proteins in PD can be caused by more than environmental and genetic factors. Despite numerous debates and controversies in the literature about the role of mutations in the SNCA and PRKN genes in the pathogenesis of PD, it is evident that these genes play a key role in maintaining dopamine (DA) neuronal homeostasis and that the dysfunction of this homeostasis is relevant to both familial (FPD) and sporadic (SPD) PD with different onset. In recent years, the importance of alphasynuclein (ASN) in the process of neurodegeneration and neuroprotective function of the Parkin is becoming better understood. Moreover, there have been an increasing number of recent reports indicating the importance of the interaction between these proteins and their encoding genes. Among others interactions, it is suggested that even heterozygous substitution in the PRKN gene in the presence of the variants +2/+2 or +2/+3 of NACP-Rep1 in the SNCA promoter, may increase the risk of PD manifestation, which is probably due to ineffective elimination of over-expressed ASN by the mutated Parkin protein. Finally, it seems that genetic testing may be an important part of diagnostics in patients with PD and may improve the prognostic process in the course of PD. However, only full knowledge of the mechanism of the interaction between the genes associated with the pathogenesis of PD is likely to help explain the currently unknown pathways of selective damage to dopaminergic neurons in the course of PD. PMID:24532983

  9. The heterozygous A53T mutation in the alpha-synuclein gene in a Chinese Han patient with Parkinson disease: case report and literature review.

    PubMed

    Xiong, Wei-Xi; Sun, Yi-Min; Guan, Rong-Yuan; Luo, Su-Shan; Chen, Chen; An, Yu; Wang, Jian; Wu, Jian-Jun

    2016-10-01

    The missense mutation A53T of alpha-synuclein gene (SNCA) was reported to be a rare but definite cause of sporadic and familial Parkinson disease (PD). It seemed to be restricted geographically in Greece and Italy. We aimed to identify the SNCA mutations in a Chinese PD cohort. Ninety-one early onset PD patients or familial PD probands were collected consecutively for the screening of PD-related genes. The genetic analysis was carried out by target sequencing of the exons and the corresponding flanking regions of the PD-related genes using Illumina HiSeq 2000 sequencer and further confirmed by Sanger sequencing or restriction fragment length polymorphism. Dosage mutations of exons in these genes were carried out by multiple ligation-dependent probe amplification. Among the 91 patients, we found only one heterozygous mutation of SNCA A53T, in a 23-year-old male patient with negative family history. The [(11)C]-2β-carbomethoxy-3β-(4-fluorophenyl) tropan (CFT) PET and PD-related spatial covariance pattern (PDRP) via [(18)F]-fluorodeoxyglucos (FDG) PET confirmed a typical pattern of PD. After examining his parents, we found his mother was an asymptomatic carrier, with declined hand dexterity detected by quantitative motor tests. Reduced dopamine transporter uptake of his mother was identified by CFT PET, and abnormal PDRP pattern was found by FDG PET. Our investigation expanded the clinical and genetic spectrum of Chinese PD patients, and we suggested SNCA mutations to be screened in familial and early onset Chinese PD patients.

  10. Factor V Leiden 1691G/A and prothrombin gene 20210G/A polymorphisms as prothrombotic markers in adult Egyptian acute leukemia patients.

    PubMed

    El Sissy, Azza Hamdy; El Sissy, Maha H; Elmoamly, Shereef

    2014-11-01

    Factor V Leiden 1691G/A and prothrombin gene 20210G/A mutations are the most common genetic defects leading to thrombosis. This work aimed to study the FV Leiden and the prothrombin gene polymorphism in adult Egyptian patients with acute leukemia and their importance in thrombophilia screening. The study included 76 patients with acute leukemia and 100 healthy controls. Genotyping was done by real-time polymerase chain reaction technique. For factor V Leiden, the frequency of G/A mutation conferred more than 2.5-fold of increased risk of (OR 2.639 95 % CI 1.045-6.669). The frequency of factor V Leiden combined (G/A + A/A) genotypes conferred 2.83-fold of increased risk (OR 2.828, CI 1.13-7.075), The A allele conferred almost threefold increased risk (OR 2.824, 95 % CI 1.175-6.785). Despite higher frequency in patients compared to controls, there was no risk of association between prothrombin gene mutation and acute leukemia in adult Egyptians nor was there between combined genotypes of prothrombin gene mutation and factor V Leiden.

  11. Photoreceptor dysplasia (pd) in miniature schnauzer dogs: evaluation of candidate genes by molecular genetic analysis.

    PubMed

    Zhang, Q; Baldwin, V J; Acland, G M; Parshall, C J; Haskel, J; Aguirre, G D; Ray, K

    1999-01-01

    Photoreceptor dysplasia (pd) is one of a group of at least six distinct autosomal and one X-linked retinal disorders identified in dogs which are collectively known as progressive retinal atrophy (PRA). It is an early onset retinal disease identified in miniature schnauzer dogs, and pedigree analysis and breeding studies have established autosomal recessive inheritance of the disease. Using a gene-based approach, a number of retina-expressed genes, including some members of the phototransduction pathway, have been causally implicated in retinal diseases of humans and other animals. Here we examined seven such potential candidate genes (opsin, RDS/peripherin, ROM1, rod cGMP-gated cation channel alpha-subunit, and three subunits of transducin) for their causal association with the pd locus by testing segregation of intragenic markers with the disease locus, or, in the absence of informative polymorphisms, sequencing of the coding regions of the genes. Based on these results, we have conclusively excluded four photoreceptor-specific genes as candidates for pd by linkage analysis. For three other photoreceptor-specific genes, we did not find any mutation in the coding sequences of the genes and have excluded them provisionally. Formal exclusion would require investigation of the levels of expression of the candidate genes in pd-affected dogs relative to age-matched controls. At present we are building suitable informative pedigrees for the disease locus with a sufficient number of meiosis to be useful for genomewide screening. This should identify markers linked to the disease locus and eventually permit progress toward the identification of the photoreceptor dysplasia gene and the disease-causing mutation.

  12. [Leigh syndrome resulting from a de novo mitochondrial DNA mutation (T8993G)].

    PubMed

    Playán, A; Solano-Palacios, A; González de la Rosa, J B; Merino-Arribas, J M; Andreu, A L; López-Pérez, M; Montoya, J

    Several degenerative neurological diseases are caused by mutations in the mitochondrial gene coding for subunit 6 of the ATPase. Thus, NARP (neurogenic weakness, ataxia, and retinitis pigmentosa) and Leigh syndromes are associated to a T8993G mutation when the percentage of mutant mitochondrial DNA is low (60 90%) or high (>90%), respectively. Leigh syndrome is also caused by a second mutation in the same position T8993C. The patient, a boy that died at 6 months, had generalized hypotonia, psychomotor delay, hepatomegaly, choreic movements and hyporreflexia. MRI showed hypodensities in the basal ganglia and brain stem as well as hyperlactacidemia. Molecular genetic analysis of the mitochondrial DNA showed that the patient had the T8993G mutation in a percentage higher than 95%. No mutated DNA was detected in blood of the proband s mother, maternal aunt and grandmother. The point mutation T8993G may occur de novo, at high levels, causing neurodegenerative diseases.

  13. The novel Parkinson's disease linked mutation G51D attenuates in vitro aggregation and membrane binding of α-synuclein, and enhances its secretion and nuclear localization in cells

    PubMed Central

    Fares, Mohamed-Bilal; Ait-Bouziad, Nadine; Dikiy, Igor; Mbefo, Martial K.; Jovičić, Ana; Kiely, Aoife; Holton, Janice L.; Lee, Seung-Jae; Gitler, Aaron D.; Eliezer, David; Lashuel, Hilal A.

    2014-01-01

    A novel mutation in the α-Synuclein (α-Syn) geneG51D” was recently identified in two familial cases exhibiting features of Parkinson's disease (PD) and multiple system atrophy (MSA). In this study, we explored the impact of this novel mutation on the aggregation, cellular and biophysical properties of α-Syn, in an attempt to unravel how this mutant contributes to PD/MSA. Our results show that the G51D mutation significantly attenuates α-Syn aggregation in vitro. Moreover, it disrupts local helix formation in the presence of SDS, decreases binding to lipid vesicles C-terminal to the site of mutation and severely inhibits helical folding in the presence of acidic vesicles. When expressed in yeast, α-SynG51D behaves similarly to α-SynA30P, as both exhibit impaired membrane association, form few inclusions and are non-toxic. In contrast, enhanced secreted and nuclear levels of the G51D mutant were observed in mammalian cells, as well as in primary neurons, where α-SynG51D was enriched in the nuclear compartment, was hyper-phosphorylated at S129 and exacerbated α-Syn-induced mitochondrial fragmentation. Finally, post-mortem human brain tissues of α-SynG51D cases were examined, and revealed only partial colocalization with nuclear membrane markers, probably due to post-mortem tissue delay and fixation. These findings suggest that the PD-linked mutations may cause neurodegeneration via different mechanisms, some of which may be independent of α-Syn aggregation. PMID:24728187

  14. Novel mutations in the CHST6 gene associated with macular corneal dystrophy in southern India.

    PubMed

    Warren, John F; Aldave, Anthony J; Srinivasan, M; Thonar, Eugene J; Kumar, Abha B; Cevallos, Vicky; Whitcher, John P; Margolis, Todd P

    2003-11-01

    To further characterize the role of the carbohydrate sulfotransferase (CHST6) gene in macular corneal dystrophy (MCD) through identification of causative mutations in a cohort of affected patients from southern India. Genomic DNA was extracted from buccal epithelium of 75 patients (51 families) with MCD, 33 unaffected relatives, and 48 healthy volunteers. The coding region of the CHST6 gene was evaluated by means of polymerase chain reaction amplification and direct sequencing. Subtyping of MCD into types I and II was performed by measuring serum levels of antigenic keratan sulfate. Seventy patients were classified as having type I MCD, and 5 patients as having type II MCD. Analysis of the CHST6 coding region in patients with type I MCD identified 11 homozygous missense mutations (Leu22Arg, His42Tyr, Arg50Cys, Arg50Leu, Ser53Leu, Arg97Pro, Cys102Tyr, Arg127Cys, Arg205Gln, His249Pro, and Glu274Lys), 2 compound heterozygous missense mutations (Arg93His and Ala206Thr), 5 homozygous deletion mutations (delCG707-708, delC890, delA1237, del1748-1770, and delORF), and 2 homozygous replacement mutations (ACCTAC 1273 GGT, and GCG 1304 AT). One patient with type II MCD was heterozygous for the C890 deletion mutation, whereas 4 possessed no CHST6 coding region mutations. A variety of previously unreported mutations in the coding region of the CHST6 gene are associated with type I MCD in a cohort of patients in southern India. An improved understanding of the genetic basis of MCD allows for earlier, more accurate diagnosis of affected individuals, and may provide the foundation for the development of novel disease treatments.

  15. A novel donor splice site in intron 11 of the CFTR gene, created by mutation 1811 + 1.6kbA {yields} G, produces a new exon: High frequency in spanish cystic fibrosis chromosomes and association with severe phenotype

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chillon, M.; Casals, T.; Gimenez, J.

    1995-03-01

    mRNA analysis of the cystic fibrosis transmembrane regulator (CFTR) gene in tissues of cystic fibrosis (CF) patients has allowed us to detect a cryptic exon. The new exon involves 49 base pairs between exons 11 and 12 and is due to a point mutation (1811+1.6bA{yields}G) that creates a new donor splice site in intron 11. Semiquantitative mRNA analysis showed that 1811+1.6kbA{r_arrow}G-mRNA was 5-10-fold less abundant than {triangle}F508 mRNA. Mutations 1811+1.6kbA{yields}G was found in 21 Spanish and 1 German CF chromosome(s), making it the fourth-most-frequent mutation (2%) in the Spanish population. Individuals with genotype {triangle}F508/1811+1.6kbA{yields}G have only 1%-3% of normal CFTRmore » mRNA. This loss of 97% of normal CFTR mRNA must be responsible for the pancreatic insufficiency and for the severe CF phenotype in these patients. 30 refs., 3 figs., 2 tabs.« less

  16. Novel mutation in forkhead box G1 (FOXG1) gene in an Indian patient with Rett syndrome.

    PubMed

    Das, Dhanjit Kumar; Jadhav, Vaishali; Ghattargi, Vikas C; Udani, Vrajesh

    2014-03-15

    Rett syndrome (RTT) is a severe neurodevelopmental disorder characterized by the progressive loss of intellectual functioning, fine and gross motor skills and communicative abilities, deceleration of head growth, and the development of stereotypic hand movements, occurring after a period of normal development. The classic form of RTT involves mutation in MECP2 while the involvement of CDKL5 and FOXG1 genes has been identified in atypical RTT phenotype. FOXG1 gene encodes for a fork-head box protein G1, a transcription factor acting primarily as transcriptional repressor through DNA binding in the embryonic telencephalon as well as a number of other neurodevelopmental processes. In this report we have described the molecular analysis of FOXG1 gene in Indian patients with Rett syndrome. FOXG1 gene mutation analysis was done in a cohort of 34 MECP2/CDKL5 mutation negative RTT patients. We have identified a novel mutation (p. D263VfsX190) in FOXG1 gene in a patient with congenital variant of Rett syndrome. This mutation resulted into a frameshift, thereby causing an alteration in the reading frames of the entire coding sequence downstream of the mutation. The start position of the frameshift (Asp263) and amino acid towards the carboxyl terminal end of the protein was found to be well conserved across species using multiple sequence alignment. Since the mutation is located at forkhead binding domain, the resultant mutation disrupts the secondary structure of the protein making it non-functional. This is the first report from India showing mutation in FOXG1 gene in Rett syndrome. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Early-onset L-dopa-responsive parkinsonism with pyramidal signs due to ATP13A2, PLA2G6, FBXO7 and spatacsin mutations.

    PubMed

    Paisán-Ruiz, Coro; Guevara, Rocio; Federoff, Monica; Hanagasi, Hasmet; Sina, Fardaz; Elahi, Elahe; Schneider, Susanne A; Schwingenschuh, Petra; Bajaj, Nin; Emre, Murat; Singleton, Andrew B; Hardy, John; Bhatia, Kailash P; Brandner, Sebastian; Lees, Andrew J; Houlden, Henry

    2010-09-15

    Seven autosomal recessive genes associated with juvenile and young-onset Levodopa-responsive parkinsonism have been identified. Mutations in PRKN, DJ-1, and PINK1 are associated with a rather pure parkinsonian phenotype, and have a more benign course with sustained treatment response and absence of dementia. On the other hand, Kufor-Rakeb syndrome has additional signs, which distinguish it clearly from Parkinson's disease including supranuclear vertical gaze palsy, myoclonic jerks, pyramidal signs, and cognitive impairment. Neurodegeneration with brain iron accumulation type I (Hallervorden-Spatz syndrome) due to mutations in PANK2 gene may share similar features with Kufor-Rakeb syndrome. Mutations in three other genes, PLA2G6 (PARK14), FBXO7 (PARK15), and Spatacsin (SPG11) also produce clinical similar phenotypes in that they presented with rapidly progressive parkinsonism, initially responsive to Levodopa treatment but later, developed additional features including cognitive decline and loss of Levodopa responsiveness. Here, using homozygosity mapping and sequence analysis in families with complex parkinsonisms, we identified genetic defects in the ATP13A2 (1 family), PLA2G6 (1 family) FBXO7 (2 families), and SPG11 (1 family). The genetic heterogeneity was surprising given their initially common clinical features. On careful review, we found the FBXO7 cases to have a phenotype more similar to PRKN gene associated parkinsonism. The ATP13A2 and PLA2G6 cases were more seriously disabled with additional swallowing problems, dystonic features, severe in some, and usually pyramidal involvement including pyramidal weakness. These data suggest that these four genes account for many cases of Levodopa responsive parkinsonism with pyramidal signs cases formerly categorized clinically as pallido-pyramidal syndrome. © 2010 Movement Disorder Society.

  18. Early-Onset L-dopa-Responsive Parkinsonism with Pyramidal Signs Due to ATP13A2, PLA2G6, FBXO7 and Spatacsin Mutations

    PubMed Central

    Paisán-Ruiz, Coro; Guevara, Rocio; Federoff, Monica; Hanagasi, Hasmet; Sina, Fardaz; Elahi, Elahe; Schneider, Susanne A.; Schwingenschuh, Petra; Bajaj, Nin; Emre, Murat; Singleton, Andrew B.; Hardy, John; Bhatia, Kailash P.; Brandner, Sebastian; Lees, Andrew J.; Houlden, Henry

    2018-01-01

    Seven autosomal recessive genes associated with juvenile and young-onset Levodopa-responsive parkinsonism have been identified. Mutations in PRKN, DJ-1, and PINK1 are associated with a rather pure parkinsonian phenotype, and have a more benign course with sustained treatment response and absence of dementia. On the other hand, Kufor-Rakeb syndrome has additional signs, which distinguish it clearly from Parkinson’s disease including supranu-clear vertical gaze palsy, myoclonic jerks, pyramidal signs, and cognitive impairment. Neurodegeneration with brain iron accumulation type I (Hallervorden-Spatz syndrome) due to mutations in PANK2 gene may share similar features with Kufor-Rakeb syndrome. Mutations in three other genes, PLA2G6 (PARK14), FBXO7 (PARK15), and Spatacsin (SPG11) also produce clinical similar phenotypes in that they presented with rapidly progressive parkinsonism, initially responsive to Levodopa treatment but later, developed additional features including cognitive decline and loss of Levodopa responsiveness. Here, using homozygosity mapping and sequence analysis in families with complex parkinsonisms, we identified genetic defects in the ATP13A2 (1 family), PLA2G6 (1 family) FBXO7 (2 families), and SPG11 (1 family). The genetic heterogeneity was surprising given their initially common clinical features. On careful review, we found the FBXO7 cases to have a phenotype more similar to PRKN gene associated parkinsonism. The ATP13A2 and PLA2G6 cases were more seriously disabled with additional swallowing problems, dystonic features, severe in some, and usually pyramidal involvement including pyramidal weakness. These data suggest that these four genes account for many cases of Levodopa responsive parkinsonism with pyramidal signs cases formerly categorized clinically as pallido-pyramidal syndrome. 3 2010 Movement Disorder Society PMID:20669327

  19. Language disorder with mild intellectual disability in a child affected by a novel mutation of SLC6A8 gene.

    PubMed

    Battini, R; Chilosi, A M; Casarano, M; Moro, F; Comparini, A; Alessandrì, M G; Leuzzi, V; Tosetti, M; Cioni, G

    2011-02-01

    We describe the clinical and molecular features of a child harboring a novel mutation in SLC6A8 gene in association with a milder phenotype than other creatine transporter (CT1) deficient patients (OMIM 300352) [1-7]. The mutation c.757 G>C p.G253R in exon 4 of SLC6A8 was hemizygous in the child, aged 6 years and 6 months, who showed mild intellectual disability with severe speech and language delay. His carrier mother had borderline intellectual functioning. Although the neurochemical and biochemical parameters were fully consistent with those reported in the literature for subjects with CT1 deficit, in our patient within a general cognitive disability, a discrepancy between nonverbal and verbal skills was observed, confirming the peculiar vulnerability of language development under brain Cr depletion. Copyright © 2010 Elsevier Inc. All rights reserved.

  20. An intronic mutation c.6430-3C>G in the F8 gene causes splicing efficiency and premature termination in hemophilia A.

    PubMed

    Xia, Zunjing; Lin, Jie; Lu, Lingping; Kim, Chol; Yu, Ping; Qi, Ming

    2018-06-01

    : Hemophilia A is a bleeding disorder caused by coagulation factor VIII protein deficiency or dysfunction, which is classified into severe, moderate, and mild according to factor clotting activity. An overwhelming majority of missense and nonsense mutations occur in exons of F8 gene, whereas mutations in introns can also be pathogenic. This study aimed to investigate the effect of an intronic mutation, c.6430-3C>G (IVS22-3C>G), on pre-mRNA splicing of the F8 gene. We applied DNA and cDNA sequencing in a Chinese boy with hemophilia A to search if any pathogenic mutation in the F8 gene. Functional analysis was performed to investigate the effect of an intronic mutation at the transcriptional level. Human Splicing Finder and PyMol were also used to predict its effect. We found the mutation c.6430-3C>G (IVS22-3C>G) in the F8 gene in the affected boy, with his mother being a carrier. cDNA from the mother and pSPL3 splicing assay showed that the mutation IVS22-3C>G results in a two-nucleotide AG inclusion at the 3' end of intron 22 and leads to a truncated coagulation factor VIII protein, with partial loss of the C1 domain and complete loss of the C2 domain. The in-silico tool predicted that the mutation induces altered pre-mRNA splicing by using a cryptic acceptor site in intron 22. The IVS22-3C>G mutation was confirmed to affect pre-mRNA splicing and produce a truncated protein, which reduces the stability of binding between the F8 protein and von Willebrand factor carrier protein due to the loss of an interaction domain.

  1. Two novel de novo mutations of KRT6A and KRT16 genes in two Chinese pachyonychia congenita pedigrees with fissured tongue or diffuse plantar keratoderma.

    PubMed

    Du, Zhen-Fang; Xu, Chen-Ming; Zhao, Yan; Liu, Wen-Ting; Chen, Xiao-Ling; Chen, Chun-Yue; Fang, Hong; Ke, Hai-Ping; Zhang, Xian-Ning

    2012-01-01

    Mutations in the KRT6A or KRT16 gene cause pachyonychia congenita type 1 (PC-1), while mutations in KRT16 or KRT6C underlie focal palmoplantar keratoderma (FPPK). A new classification system of PC has been adopted based on the mutated gene. PC rarely presents the symptoms of diffuse plantar keratoderma. Mutation in the tail domain of keratins is rarely reported. PC combined with fissured tongue has never been described. To investigate the genotype-phenotype correlations between clinical features and gene mutational sites in two unrelated southern Chinese PC pedigrees (one family presented with specific fissured tongue, the other with diffuse plantar keratoderma). The whole coding regions of the KRT6A/KRT16/KRT17/KRT6B genes were amplified and directly sequenced to detect the mutation. To confirm the effect of the IVS8-2A>C mutation in KRT6A at the mRNA level, total RNA from the plantar lesion of a patient was extracted and reverse-transcribed to cDNA for sequence analysis. Two novel de novo mutations, a splice acceptor site variant IVS8-2A>C (p.S487FfsX72) in KRT6A and a heterozygous substitution c.AA373_374GG (p.N125G) within exon 1 of KRT16, were found separately in the two PC families. Genotype-phenotype correlations among PC patients with codon-125 mutation in KRT16 were established, while the phenotypes caused by the IVS8-2A>C mutation in KRT6A need further studies to confirm the rare feature of fissured tongue.

  2. An innovative strategy to clone positive modifier genes of defects caused by mtDNA mutations: MRPS18C as suppressor gene of m.3946G>A mutation in MT-ND1 gene.

    PubMed

    Rodríguez-García, María Elena; Cotrina-Vinagre, Francisco Javier; Carnicero-Rodríguez, Patricia; Martínez-Azorín, Francisco

    2017-07-01

    We have developed a new functional complementation approach to clone modifier genes which overexpression is able to suppress the biochemical defects caused by mtDNA mutations (suppressor genes). This strategy consists in transferring human genes into respiratory chain-deficient fibroblasts, followed by a metabolic selection in a highly selective medium. We used a normalized expression cDNA library in an episomal vector (pREP4) to transfect the fibroblasts, and a medium with glutamine and devoid of any carbohydrate source to select metabolically. Growing the patient's fibroblasts in this selective medium, the deficient cells rapidly disappear unless they are rescued by the cDNA of a suppressor gene. The use of an episomal vector allows us to carry out several rounds of transfection/selection (cyclical phenotypic rescue) to enrich the rescue with true clones of suppressor genes. Using fibroblasts from a patient with epileptic encephalopathy with the m.3946G>A (p.E214K) mutation in the MT-ND1 gene, several candidate genes were identified and one of them was characterized functionally. Thus, overexpression of MRPS18C gene (that encode for bS18m protein) suppressed the molecular defects produced by this mtDNA mutation, recovering the complex I activity and reducing the ROS produced by this complex to normal levels. We suggest that modulation of bS18m expression may be an effective therapeutic strategy for the patients with this mutation.

  3. Parkinsonism Associated with Glucocerebrosidase Mutation

    PubMed Central

    Sunwoo, Mun-Kyung; Kim, Seung-Min; Lee, Sarah

    2011-01-01

    Background Gaucher's disease is an autosomal recessive, lysosomal storage disease caused by mutations of the β-glucocerebrosidase gene (GBA). There is increasing evidence that GBA mutations are a genetic risk factor for the development of Parkinson's disease (PD). We report herein a family of Koreans exhibiting parkinsonism-associated GBA mutations. Case Report A 44-year-old woman suffering from slowness and paresthesia of the left arm for the previous 1.5years, visited our hospital to manage known invasive ductal carcinoma. During a preoperative evaluation, she was diagnosed with Gaucher's disease and double mutations of S271G and R359X in GBA. Parkinsonian features including low amplitude postural tremors, rigidity, bradykinesia and shuffling gait were observed. Genetic analysis also revealed that her older sister, who had also been diagnosed with PD and had been taking dopaminergic drugs for 8-years, also possessed a heterozygote R359X mutation in GBA. 18F-fluoropropylcarbomethoxyiodophenylnortropane positron-emission tomography in these patients revealed decreased uptake of dopamine transporter in the posterior portion of the bilateral putamen. Conclusions This case study demonstrates Korean familial cases of PD with heterozygote mutation of GBA, further supporting the association between PD and GBA mutation. PMID:21779299

  4. Newborn screening of glucose-6-phosphate dehydrogenase deficiency in Guangxi, China: determination of optimal cutoff value to identify heterozygous female neonates.

    PubMed

    Fu, Chunyun; Luo, Shiyu; Li, Qifei; Xie, Bobo; Yang, Qi; Geng, Guoxing; Lin, Caijuan; Su, Jiasun; Zhang, Yue; Wang, Jin; Qin, Zailong; Luo, Jingsi; Chen, Shaoke; Fan, Xin

    2018-01-16

    The aim of this study is to assess the disease incidence and mutation spectrum of glucose-6-phosphate dehydrogenase (G6PD) deficiency in Guangxi, China, and to determine an optimal cutoff value to identify heterozygous female neonates. A total of 130, 635 neonates were screened from the year of 2013 to 2017. Neonates suspected for G6PD deficiency were further analyzed by quantitatively enzymatic assay and G6PD mutation analysis. The overall incidence of G6PD deficiency was 7.28%. A total of 14 G6PD mutations were identified, and different mutations lead to varying levels of G6PD enzymatic activities. The best cut-off value of G6PD activity in male subjects is 2.2 U/g Hb, same as conventional setting. In female population, however, the cut-off value is found to be 2.8 U/g Hb (sensitivity: 97.5%, specificity: 87.7%, AUC: 0.964) to best discriminate between normal and heterozygotes, and 1.6 U/g Hb (sensitivity: 82.2%, specificity: 85.9%, AUC: 0.871) between heterozygotes and deficient subjects. In conclusion, we have conducted a comprehensive newborn screening of G6PD deficiency in a large cohort of population from Guangxi, China, and first established a reliable cut-off value of G6PD activity to distinguish heterozygous females from either normal or deficient subjects.

  5. Relative high frequency of the c.255delA parkin gene mutation in Spanish patients with autosomal recessive parkinsonism

    PubMed Central

    Munoz, E; Tolosa, E; Pastor, P; Marti, M; Valldeoriola, F; Campdelacreu, J; Oliva, R

    2002-01-01

    Objectives: To search for the presence of parkin gene mutations in Spanish patients with Parkinson's disease (PD) and characterise the phenotype associated with these mutations. Methods: Thirty seven PD patients with either early onset or autosomal recessive pattern of inheritance were selected for genetic study. Results: Mutations were identified in seven index patients (19%). Homozygous mutations were detected in six patients and a heterozygous mutation in one. The age at onset was lower in patients with mutations than in patients without mutations. Dystonia at onset was present in two patients with parkin gene mutations. The disease began in two patients with postural tremor in the upper limbs mimicking essential tremor. Four patients exhibited a long term response to dopamine agonists. The c.255delA mutation was identified in four unrelated families. This is a frameshift mutation leading to protein truncation. Conclusions: Parkin gene mutations are present in Spanish patients with early onset and/or an autosomal recessive parkinsonism. The c.255delA is the most frequent mutation found, suggesting a relative high prevalence in the Spanish population. PMID:12397156

  6. Refractory Causes of Kernicterus in Developed Countries: Can We Eradicate G6PD Deficiency Triggered and Low-Bilirubin Kernicterus?

    PubMed

    Watchko, Jon F

    2017-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency triggered and low-bilirubin kernicterus persist despite current prevention strategies. Review efforts to eradicate bilirubin induced brain injury in these two conditions including novel approaches to risk assessment and hyperbilirubinemia evaluation. In the case of G6PD deficiency, a heightened awareness of populations at risk and an expanded kernicterus prevention strategy focused on intensified parental engagement, education and counselling on neonatal jaundice is needed. In the case of low-bilirubin kernicterus, a renewed focus on identifying infants with hypoalbuminemia and implementation of hyperbilirubinemia treatment thresholds based on the bilirubin/albumin ratio is needed. Bilirubin binding panels when commercially available will prove valuable. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  7. [Mutation analysis of the PAH gene in children with phenylketonuria from the Qinghai area of China].

    PubMed

    He, Jiang; Wang, Hui-Zhen; Xu, Fa-Liang; Yang, Xi; Wang, Rui; Zou, Hong-Yun; Yu, Wu-Zhong

    2015-11-01

    To study the mutation characteristics of the phenylalanine hydroxylase (PAH) gene in children with phenylketonuria (PKU) from the Qinghai area of China, in order to provide basic information for genetic counseling and prenatal diagnosis. Mutations of the PAH gene were detected in the promoter and exons 1-13 and their flanking intronic sequences of PAH gene by PCR and DNA sequencing in 49 children with PKU and their parents from the Qinghai area of China. A total of 30 different mutations were detected in 80 out of 98 mutant alleles (82%), including 19 missense (63%), 5 nonsense (17%), 3 splice-site (10%) and 3 deletions (10%). Most mutations were detected in exons 3, 6, 7, 11 and intron 4 of PAH gene. The most frequent mutations were p.R243Q (19%), IVS4-1G>A (9%), p.Y356X (7%) and p.EX6-96A>G(5%). Two novel mutations p.N93fsX5 (c.279-282delCATC) and p.G171E (c.512G>A) were found. p.H64fsX9(c.190delC) was documented for the second time in Chinese PAH gene. The mutation spectrum of the gene PAH in the Qinghai population was similar to that in other populations in North China while significantly different from that in the populations from some provinces in southern China, Japan and Europe. The mutations of PAH gene in the Qinghai area of China demonstrate a unique diversity, complexity and specificity.

  8. Risk of colorectal cancer for people with a mutation in both a MUTYH and a DNA mismatch repair gene.

    PubMed

    Win, Aung Ko; Reece, Jeanette C; Buchanan, Daniel D; Clendenning, Mark; Young, Joanne P; Cleary, Sean P; Kim, Hyeja; Cotterchio, Michelle; Dowty, James G; MacInnis, Robert J; Tucker, Katherine M; Winship, Ingrid M; Macrae, Finlay A; Burnett, Terrilea; Le Marchand, Loïc; Casey, Graham; Haile, Robert W; Newcomb, Polly A; Thibodeau, Stephen N; Lindor, Noralane M; Hopper, John L; Gallinger, Steven; Jenkins, Mark A

    2015-12-01

    The base excision repair protein, MUTYH, functionally interacts with the DNA mismatch repair (MMR) system. As genetic testing moves from testing one gene at a time, to gene panel and whole exome next generation sequencing approaches, understandin g the risk associated with co-existence of germline mutations in these genes will be important for clinical interpretation and management. From the Colon Cancer Family Registry, we identified 10 carriers who had both a MUTYH mutation (6 with c.1187G>A p.(Gly396Asp), 3 with c.821G>A p.(Arg274Gln), and 1 with c.536A>G p.(Tyr179Cys)) and a MMR gene mutation (3 in MLH1, 6 in MSH2, and 1 in PMS2), 375 carriers of a single (monoallelic) MUTYH mutation alone, and 469 carriers of a MMR gene mutation alone. Of the 10 carriers of both gene mutations, 8 were diagnosed with colorectal cancer. Using a weighted cohort analysis, we estimated that risk of colorectal cancer for carriers of both a MUTYH and a MMR gene mutation was substantially higher than that for carriers of a MUTYH mutation alone [hazard ratio (HR) 21.5, 95% confidence interval (CI) 9.19-50.1; p < 0.001], but not different from that for carriers of a MMR gene mutation alone (HR 1.94, 95% CI 0.63-5.99; p = 0.25). Within the limited power of this study, there was no evidence that a monoallelic MUTYH gene mutation confers additional risk of colorectal cancer for carriers of a MMR gene mutation alone. Our finding suggests MUTYH mutation testing in MMR gene mutation carriers is not clinically informative.

  9. Novel XLRS1 gene mutations cause X-linked juvenile retinoschisis in Chinese families.

    PubMed

    Ma, Xiang; Li, Xiaoxin; Wang, Lihua

    2008-01-01

    To investigate various XLRS1 (RS1) gene mutations in Chinese families with X-linked juvenile retinoschisis (XLRS or RS). Genomic DNA was isolated from leukocytes of 29 male patients with X-linked juvenile retinoschisis, 38 female carriers, and 100 normal controls. All 6 exons of the RS1 gene were amplified by polymerase chain reaction, and the RS1 gene mutations were determined by direct sequencing. Eleven different RS1 mutations in 12 families were identified in the 29 male patients. The mutations comprised eight missense, two frameshift, and one splice donor site mutation. Four of these mutations, one frameshift mutation (26 del T) in exon 1, one frameshift mutation (488 del G) in exon 5, Asp145His and Arg156Gly in exon 5, have not been previously described. One novel non-disease-related polymorphism, 576C to T (Pro192Pro) in exon 6, was also found. Six recurrent mutations, Ser73Pro and Arg102Gln mutations in exon 4 and Arg200Cys, Arg209His, Arg213Gln, and Cys223Arg mutations in exon 6, were also identified in this study. RS1 gene mutations caused X-linked juvenile retinoschisis in these Chinese families.

  10. Polymorphism of the cytochrome P450 CYP2D6 gene in a European population: characterization of 48 mutations and 53 alleles, their frequencies and evolution.

    PubMed

    Marez, D; Legrand, M; Sabbagh, N; Lo Guidice, J M; Spire, C; Lafitte, J J; Meyer, U A; Broly, F

    1997-06-01

    The polymorphic cytochrome P450 CYP2D6 is involved in the metabolism of various drugs of wide therapeutic use and is a presumed susceptibility factor for certain environmentally-induced diseases. Our aim was to define the mutations and alleles of the CYP2D6 gene and to evaluate their frequencies in the European population. Using polymerase chain reaction-single strand conformation polymorphism analysis, 672 unrelated subjects were screened for mutations in the 9 exons of the gene and their exon-intron boundaries. A total of 48 point mutations were identified, of which 29 were novel. Mutations 1749 G-->C, 2938 C-->T and 4268 G-->C represented 52.6%, 34.3% and 52.9% of the mutations in the total population, respectively. Of the eight detrimental mutations detected, the 1934 G-->A, the 1795 Tdel and the 2637 Adel accounted for 65.8%, 6.2% and 4.8% respectively, within the poor metabolizer subgroup. Fifty-three different alleles were characterized from the mutation pattern and by allele-specific sequencing. They are derived from three major alleles, namely the wild-type CYP2D6*1A, the functional CYP2D6*2 and the null CYP2D6*4A. Five allelic variants (CYP2D6*1A, *2, *2B, *4A and *5) account for about 87% of all alleles, while the remaining alleles occur with a frequency of 0.1%-2.7%. These data provide a solid basis for future epidemiological, clinical as well as interethnic studies of the CYP2D6 polymorphism and highlight that the described single strand conformation polymorphism method can be successfully used in designing such studies.

  11. G6PD deficiency in Plasmodium falciparum and Plasmodium vivax malaria-infected Cambodian patients.

    PubMed

    Khim, Nimol; Benedet, Christophe; Kim, Saorin; Kheng, Sim; Siv, Sovannaroth; Leang, Rithea; Lek, Soley; Muth, Sinuon; Chea, Nguon; Chuor, Char Meng; Duong, Socheat; Kerleguer, Alexandra; Tor, Pety; Chim, Pheaktra; Canier, Lydie; Witkowski, Benoit; Taylor, Walter R J; Ménard, Didier

    2013-05-28

    Glucose-6-phosphate-dehydrogenase deficiency (G6PDd) rates are unknown in malaria-infected Cambodian patients. These data are key to a rational drug policy for malaria elimination of Plasmodium falciparum and Plasmodium vivax. From September 2010-2012, a two-year survey of G6PDd and haemoglobinopathies assessed by quantitative enzyme activity assay and haemoglobin electrophoresis, respectively, was conducted in malaria-infected patients presenting to 19 health centres throughout Cambodia. A total of 2,408 confirmed malaria patients of mean age 26.7 (range 2-81) years were recruited from mostly western Cambodia (n = 1,732, 71.9%); males outnumbered females by 3.9:1. Plasmodium falciparum was present in 1,443 (59.9%) and P. vivax in 965 (40.1%) patients. Mean G6PD activity was 11.6 (CI 95%: 11.4-11.8) U/g Hb, G6PDd was present in 13.9% of all patients (335/2,408) and severe G6PDd (including WHO Class I and II variants) was more common in western (158/1,732, 9.1%) versus eastern (21/414, 5.1%) Cambodia (P = 0.01). Of 997/2,408 (41.4%) had a haemoglobinopathy. Mean haemoglobin concentrations were inversely related to age: 8.1 g/dL < five years, 8.7 g/dL five to 14 years, and 10.4 g/dL >15 years (P <0.001). G6PDd prevalence, anaemia and haemoglobinopathies were common in malaria-infected patients. The deployment of primaquine in Cambodia should be preceded by primaquine safety studies paralleled with evaluations of easy to use tests to detect G6PDd.

  12. Redox non-innocence of thioether crowns: elucidation of the electronic structure of the mononuclear Pd(III) complexes [Pd([9]aneS3)2]3+ and [Pd([18]aneS6)]3+.

    PubMed

    Stephen, Emma; Blake, Alexander J; Carter, Emma; Collison, David; Davies, E Stephen; Edge, Ruth; Lewis, William; Murphy, Damien M; Wilson, Claire; Gould, Robert O; Holder, Alan J; McMaster, Jonathan; Schröder, Martin

    2012-02-06

    The Pd(II) complexes [Pd([9]aneS(3))(2)](PF(6))(2)·2MeCN (1) ([9]aneS(3) = 1,4,7-trithiacyclononane) and [Pd([18]aneS(6))](PF(6))(2) (2) ([18]aneS(6) = 1,4,7,10,13,16-hexathiacyclooctadecane) can be oxidized electrochemically or chemically oxidized with 70% HClO(4) to [Pd([9]aneS(3))(2)](3+) and [Pd([18]aneS(6))](3+), respectively. These centers have been characterized by single crystal X-ray diffraction, and by UV/vis and multifrequency electron paramagnetic resonance (EPR) spectroscopies. The single crystal X-ray structures of [Pd(III)([9]aneS(3))(2)](ClO(4))(6)·(H(3)O)(3)·(H(2)O)(4) (3) at 150 K and [Pd([18]aneS(6))](ClO(4))(6)·(H(5)O(2))(3) (4) at 90 K reveal distorted octahedral geometries with Pd-S distances of 2.3695(8), 2.3692(8), 2.5356(9) and 2.3490(6), 2.3454(5), 2.5474(6) Å, respectively, consistent with Jahn-Teller distortion at a low-spin d(7) Pd(III) center. The Pd(II) compound [Pd([9]aneS(3))(2)](PF(6))(2) shows a one-electron oxidation process in MeCN (0.2 M NBu(4)PF(6), 293 K) at E(1/2) = +0.57 V vs. Fc(+)/Fc assigned to a formal Pd(III)/Pd(II) couple. Multifrequency (Q-, X-, S-, and L-band) EPR spectroscopic analysis of [Pd([9]aneS(3))(2)](3+) and [Pd([18]aneS(6))](3+) gives g(iso) = 2.024, |A(iso(Pd))| = 18.9 × 10(-4) cm(-1); g(xx) = 2.046, g(yy) = 2.041, g(zz) = 2.004; |A(xx(Pd))| = 24 × 10(-4) cm(-1), |A(yy(Pd))| = 22 × 10(-4) cm(-1), |A(zz(Pd))| = 14 × 10(-4) cm(-1), |a(xx(H))| = 4 × 10(-4) cm(-1), |a(yy(H))| = 5 × 10(-4) cm(-1), |a(zz(H))| = 5.5 × 10(-4) cm(-1) for [Pd([9]aneS(3))(2)](3+), and g(iso) = 2.015, |A(iso(Pd))| = 18.8× 10(-4) cm(-1); g(xx) = 2.048 g(yy) = 2.036, g(zz) = 1.998; |a(xx(H))| = 5, |a(yy(H))| = 5, |a(zz(H))| = 6 × 10(-4) cm(-1); |A(xx(Pd))| = 23× 10(-4) cm(-1), |A(yy(Pd))| = 22 × 10(-4) cm(-1), |A(zz(Pd))| = 4 × 10(-4) cm(-1) for [Pd([18]aneS(6))](3+). Both [Pd([9]aneS(3))(2)](3+) and [Pd([18]aneS(6))](3+) exhibit five-line superhyperfine splitting in the g(zz) region in their frozen solution EPR

  13. Prognostic Significance of NSCLC and Response to EGFR-TKIs of EGFR-Mutated NSCLC Based on PD-L1 Expression.

    PubMed

    Kobayashi, Kenichi; Seike, Masahiro; Zou, Fenfei; Noro, Rintaro; Chiba, Mika; Ishikawa, Arimi; Kunugi, Shinobu; Kubota, Kaoru; Gemma, Akihiko

    2018-02-01

    Recent clinical trials have shown that immune checkpoint blockades that target either PD-1 or PD-L1 yield remarkable responses in a subgroup of patients with non-small cell lung cancer (NSCLC). We retrospectively examined, by immunohistochemical analysis, 211 NSCLC samples. Using 32 independent samples, we also evaluated PD-L1 expression in NSCLC patients with EGFR gene mutations treated by EGFR-TKIs. Overall survival of PD-L1-positive stages I-III NSCLC and stage I NSCLC and stages I-III squamous cell carcinoma (SQ) were significantly shorter than those of PD-L1-negative NSCLC (p<0.01 and p=0.02 and p=0.01, respectively). In stage I NSCLC and stages I-III SQ, PD-L1 expression was found to be independent predictor of death after multivariate analysis. Response to EGFR-TKIs was not significantly different between PD-L1-positive and PD-L1-negative NSCLC patients with EGFR mutations. PD-L1 expression was a significant independent predictor of poor outcome in NSCLC patients. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  14. Microarray-based mutation detection and phenotypic characterization in Korean patients with retinitis pigmentosa

    PubMed Central

    Kim, Cinoo; Kim, Kwang Joong; Bok, Jeong; Lee, Eun-Ju; Kim, Dong-Joon; Oh, Ji Hee; Park, Sung Pyo; Shin, Joo Young; Lee, Jong-Young

    2012-01-01

    Purpose To evaluate microarray-based genotyping technology for the detection of mutations responsible for retinitis pigmentosa (RP) and to perform phenotypic characterization of patients with pathogenic mutations. Methods DNA from 336 patients with RP and 360 controls was analyzed using the GoldenGate assay with microbeads containing 95 previously reported disease-associated mutations from 28 RP genes. Mutations identified by microarray-based genotyping were confirmed by direct sequencing. Segregation analysis and phenotypic characterization were performed in patients with mutations. The disease severity was assessed by visual acuity, electroretinography, optical coherence tomography, and kinetic perimetry. Results Ten RP-related mutations of five RP genes (PRP3 pre-mRNA processing factor 3 homolog [PRPF3], rhodopsin [RHO], phosphodiesterase 6B [PDE6B], peripherin 2 [PRPH2], and retinitis pigmentosa 1 [RP1]) were identified in 26 of the 336 patients (7.7%) and in six of the 360 controls (1.7%). The p.H557Y mutation in PDE6B, which was homozygous in four patients and heterozygous in nine patients, was the most frequent mutation (2.5%). Mutation segregation was assessed in four families. Among the patients with missense mutations, the most severe phenotype occurred in patients with p.D984G in RP1; less severe phenotypes occurred in patients with p.R135W in RHO; a relatively moderate phenotype occurred in patients with p.T494M in PRPF3, p.H557Y in PDE6B, or p.W316G in PRPH2; and a mild phenotype was seen in a patient with p.D190N in RHO. Conclusions The results reveal that the GoldenGate assay may not be an efficient method for molecular diagnosis in RP patients with rare mutations, although it has proven to be reliable and efficient for high-throughput genotyping of single-nucleotide polymorphisms. The clinical features varied according to the mutations. Continuous effort to identify novel RP genes and mutations in a population is needed to improve the efficiency and

  15. [The mutation analysis of PAH gene and prenatal diagnosis in classical phenylketonuria family].

    PubMed

    Yan, Yousheng; Hao, Shengju; Yao, Fengxia; Sun, Qingmei; Zheng, Lei; Zhang, Qinghua; Zhang, Chuan; Yang, Tao; Huang, Shangzhi

    2014-12-01

    To characterize the mutation spectrum of phenylalanine hydroxylase (PAH) gene and perform prenatal diagnosis for families with classical phenylketonuria. By stratified sequencing, mutations were detected in the exons and flaking introns of PAH gene of 44 families with classical phenylketonuria. 47 fetuses were diagnosed by combined sequencing with linkage analysis of three common short tandem repeats (STR) (PAH-STR, PAH-26 and PAH-32) in the PAH gene. Thirty-one types of mutations were identified. A total of 84 mutations were identified in 88 alleles (95.45%), in which the most common mutation have been R243Q (21.59%), EX6-96A>G (6.82%), IVS4-1G>A (5.86%) and IVS7+2T>A (5.86%). Most mutations were found in exons 3, 5, 6, 7, 11 and 12. The polymorphism information content (PIC) of these three STR markers was 0.71 (PAH-STR), 0.48 (PAH-26) and 0.40 (PAH-32), respectively. Prenatal diagnosis was performed successfully with the combined method in 47 fetuses of 44 classical phenylketonuria families. Among them, 11 (23.4%) were diagnosed as affected, 24 (51.1%) as carriers, and 12 (25.5%) as unaffected. Prenatal diagnosis can be achieved efficiently and accurately by stratified sequencing of PAH gene and linkage analysis of STR for classical phenylketonuria families.

  16. Genetic Basis of Glycogen Storage Disease Type 1a: Prevalent Mutations at the Glucose-6-Phosphatase Locus

    PubMed Central

    Lei, Ke-Jian; Chen, Yuan-Tsong; Chen, Hungwen; Wong, Lee-Jun C.; Liu, Ji-Lan; McConkie-Rosell, Allyn; Van Hove, Johan L. K.; Ou, Henry C.-Y.; Yeh, Nan Jung; Pan, Lorraine Y.; Chou, Janice Yang

    1995-01-01

    Diagnosis of glycogen storage disease (GSD) type 1a currently is established by demonstrating the lack of glucose-6-phosphatase (G6Pase) activity in the patient's biopsied liver specimen. Recent cloning of the G6Pase gene and identification of mutations within the gene that causes GSD type 1a allow for the development of a DNA-based diagnostic method. Using SSCP analysis and DNA sequencing, we characterized the G6Pase gene of 70 unrelated patients with enzymatically confirmed diagnosis of GSD type 1a and detected mutations in all except 17 alleles (88%). Sixteen mutations were uncovered that were shown by expression to abolish or greatly reduce G6Pase activity and that therefore are responsible for the GSD type 1a disorder. R83C and Q347X are the most prevalent mutations found in Caucasians, 130X and R83C are most prevalent in Hispanics, and R83H is most prevalent in Chinese. The Q347X mutation has thus far been identified only in Caucasian patients, and the 130X mutation has been identified only in Hispanic patients. Our results demonstrate that the DNA-based analysis can accurately, rapidly, and noninvasively detect the majority of mutations in GSD type 1a. This DNA-based diagnosis now permits prenatal diagnosis among at-risk patients and serves as a database in screening and counseling patients clinically suspected of having this disease. ImagesFigure 1Figure 2 PMID:7573034

  17. Altered Pre-mRNA Splicing Caused by a Novel Intronic Mutation c.1443+5G>A in the Dihydropyrimidinase (DPYS) Gene.

    PubMed

    Nakajima, Yoko; Meijer, Judith; Zhang, Chunhua; Wang, Xu; Kondo, Tomomi; Ito, Tetsuya; Dobritzsch, Doreen; Van Kuilenburg, André B P

    2016-01-12

    Dihydropyrimidinase (DHP) deficiency is an autosomal recessive disease caused by mutations in the DPYS gene. Patients present with highly elevated levels of dihydrouracil and dihydrothymine in their urine, blood and cerebrospinal fluid. The analysis of the effect of mutations in DPYS on pre-mRNA splicing is hampered by the fact that DHP is primarily expressed in liver and kidney cells. The minigene approach can detect mRNA splicing aberrations using cells that do not express the endogenous mRNA. We have used a minigene-based approach to analyze the effects of a presumptive pre-mRNA splicing mutation in two newly identified Chinese pediatric patients with DHP deficiency. Mutation analysis of DPYS showed that both patients were compound heterozygous for a novel intronic mutation c.1443+5G>A in intron 8 and a previously described missense mutation c.1001A>G (p.Q334R) in exon 6. Wild-type and the mutated minigene constructs, containing exons 7, 8 and 9 of DPYS, yielded different splicing products after expression in HEK293 cells. The c.1443+5G>A mutation resulted in altered pre-mRNA splicing of the DPYS minigene construct with full skipping of exon 8. Analysis of the DHP crystal structure showed that the deletion of exon 8 severely affects folding, stability and homooligomerization of the enzyme as well as disruption of the catalytic site. Thus, the analysis suggests that the c.1443+5G>A mutation results in aberrant splicing of the pre-mRNA encoding DHP, underlying the DHP deficiency in two unrelated Chinese patients.

  18. Detection and characterization of interleukin-6 gene variants in Canis familiaris: association studies with periodontal disease.

    PubMed

    Morinha, Francisco; Albuquerque, Carlos; Requicha, João; Dias, Isabel; Leitão, José; Gut, Ivo; Guedes-Pinto, Henrique; Viegas, Carlos; Bastos, Estela

    2011-10-10

    Periodontal disease (PD) is the most common inflammatory disease of the oral cavity of domestic carnivores. In Human Medicine molecular genetics research showed that several genes play a role in the predisposition and progression of this complex disease, primarily through the regulation of inflammatory mediators, but the exactly mechanisms are poorly understood. This study aims to contribute to the characterization of the genetic basis of PD in the dog, a classically accepted model in Periodontology. We searched for genetic variations in the interleukin-6 (IL6) gene, in order to verify its association with PD in a case-control study including 25 dogs in the PD case group and 45 dogs in the control group. We indentified and characterized three new genetic variations in IL6 gene. No statistically significant differences were detected between the control and PD cases groups. Our results do not support an evidence for a major role contribution of these variants in the susceptibility to PD in the analyzed population. Nevertheless, the sequence variant I/5_g.105G>A leads to an amino acid change (arginine to glutamine) and was predicted to be possibly damaging to the IL6 protein. A larger cohort and functional studies would be of extreme importance in a near future to understand the possible role of IL6 variants in this disease. Copyright © 2011 Elsevier B.V. All rights reserved.

  19. Safety of 8-aminoquinolines given to people with G6PD deficiency: protocol for systematic review of prospective studies

    PubMed Central

    Uthman, Olalekan A; Saunders, Rachel; Sinclair, David; Graves, Patricia; Gelband, Hellen; Clarke, Aileen; Garner, Paul

    2014-01-01

    Introduction A single dose or short course of primaquine given to people infected with malaria may reduce transmission of Plasmodium falciparum through its effects on gametocytes. Primaquine is also known to cause haemolysis in people with variants of glucose-6-phosphate dehydrogenase (G6PD) deficiency. The objective of this systematic review was to assess the risk of adverse effects in people with G6PD deficiency given primaquine or other 8-aminoquinoline (8AQ) as a single dose or short course (less than 7 days). Methods and analysis We will search the following databases: Cochrane Infectious Diseases Group Specialized Register, the Cochrane Central Register of Controlled Trials (CENTRAL), MEDLINE, EMBASE and LILACS. Prospective cohort studies, randomised and quasi-randomised trials that evaluated 8AQs for whatever reason in adults or children with a known G6PD deficiency will be included. Two authors will independently assess each study for eligibility, risk of bias and extract data. Ethics and dissemination This systematic review will be published in a peer-reviewed journal. Brief reports of the review findings will be disseminated directly to the appropriate audiences and the WHO Technical Expert Group in Malaria Chemotherapy. As no primary data collection will be undertaken, no additional formal ethical assessment and informed consent are required. Protocol registration in PROSPERO The protocol is registered with PROSPERO, registration number CRD42013006518. PMID:24833685

  20. Glucose 6-phosphate dehydrogenase deficiency enhances germ cell apoptosis and causes defective embryogenesis in Caenorhabditis elegans

    PubMed Central

    Yang, H-C; Chen, T-L; Wu, Y-H; Cheng, K-P; Lin, Y-H; Cheng, M-L; Ho, H-Y; Lo, S J; Chiu, D T-Y

    2013-01-01

    Glucose 6-phosphate dehydrogenase (G6PD) deficiency, known as favism, is classically manifested by hemolytic anemia in human. More recently, it has been shown that mild G6PD deficiency moderately affects cardiac function, whereas severe G6PD deficiency leads to embryonic lethality in mice. How G6PD deficiency affects organisms has not been fully elucidated due to the lack of a suitable animal model. In this study, G6PD-deficient Caenorhabditis elegans was established by RNA interference (RNAi) knockdown to delineate the role of G6PD in animal physiology. Upon G6PD RNAi knockdown, G6PD activity was significantly hampered in C. elegans in parallel with increased oxidative stress and DNA oxidative damage. Phenotypically, G6PD-knockdown enhanced germ cell apoptosis (2-fold increase), reduced egg production (65% of mock), and hatching (10% of mock). To determine whether oxidative stress is associated with G6PD knockdown-induced reproduction defects, C. elegans was challenged with a short-term hydrogen peroxide (H2O2). The early phase egg production of both mock and G6PD-knockdown C. elegans were significantly affected by H2O2. However, H2O2-induced germ cell apoptosis was more dramatic in mock than that in G6PD-deficient C. elegans. To investigate the signaling pathways involved in defective oogenesis and embryogenesis caused by G6PD knockdown, mutants of p53 and mitogen-activated protein kinase (MAPK) pathways were examined. Despite the upregulation of CEP-1 (p53), cep-1 mutation did not affect egg production and hatching in G6PD-deficient C. elegans. Neither pmk-1 nor mek-1 mutation significantly affected egg production, whereas sek-1 mutation further decreased egg production in G6PD-deficient C. elegans. Intriguingly, loss of function of sek-1 or mek-1 dramatically rescued defective hatching (8.3- and 9.6-fold increase, respectively) induced by G6PD knockdown. Taken together, these findings show that G6PD knockdown reduces egg production and hatching in C. elegans

  1. Glucose 6-phosphate dehydrogenase deficiency enhances germ cell apoptosis and causes defective embryogenesis in Caenorhabditis elegans.

    PubMed

    Yang, H-C; Chen, T-L; Wu, Y-H; Cheng, K-P; Lin, Y-H; Cheng, M-L; Ho, H-Y; Lo, S J; Chiu, D T-Y

    2013-05-02

    Glucose 6-phosphate dehydrogenase (G6PD) deficiency, known as favism, is classically manifested by hemolytic anemia in human. More recently, it has been shown that mild G6PD deficiency moderately affects cardiac function, whereas severe G6PD deficiency leads to embryonic lethality in mice. How G6PD deficiency affects organisms has not been fully elucidated due to the lack of a suitable animal model. In this study, G6PD-deficient Caenorhabditis elegans was established by RNA interference (RNAi) knockdown to delineate the role of G6PD in animal physiology. Upon G6PD RNAi knockdown, G6PD activity was significantly hampered in C. elegans in parallel with increased oxidative stress and DNA oxidative damage. Phenotypically, G6PD-knockdown enhanced germ cell apoptosis (2-fold increase), reduced egg production (65% of mock), and hatching (10% of mock). To determine whether oxidative stress is associated with G6PD knockdown-induced reproduction defects, C. elegans was challenged with a short-term hydrogen peroxide (H2O2). The early phase egg production of both mock and G6PD-knockdown C. elegans were significantly affected by H2O2. However, H2O2-induced germ cell apoptosis was more dramatic in mock than that in G6PD-deficient C. elegans. To investigate the signaling pathways involved in defective oogenesis and embryogenesis caused by G6PD knockdown, mutants of p53 and mitogen-activated protein kinase (MAPK) pathways were examined. Despite the upregulation of CEP-1 (p53), cep-1 mutation did not affect egg production and hatching in G6PD-deficient C. elegans. Neither pmk-1 nor mek-1 mutation significantly affected egg production, whereas sek-1 mutation further decreased egg production in G6PD-deficient C. elegans. Intriguingly, loss of function of sek-1 or mek-1 dramatically rescued defective hatching (8.3- and 9.6-fold increase, respectively) induced by G6PD knockdown. Taken together, these findings show that G6PD knockdown reduces egg production and hatching in C. elegans

  2. Evaluation of the phenotypic test and genetic analysis in the detection of glucose-6-phosphate dehydrogenase deficiency.

    PubMed

    Nantakomol, Duangdao; Paul, Rick; Palasuwan, Attakorn; Day, Nicholas P J; White, Nicholas J; Imwong, Mallika

    2013-08-21

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is particularly prevalent in historically malaria-endemic countries. Although most individuals with G6PD deficiency are asymptomatic, deficiency can result in acute haemolytic anaemia after exposure to oxidative agents. A reliable test is necessary for diagnosing the deficiency to prevent an acute haemolytic crisis following, for example, anti-malarial treatment. The aim of this study was to investigate which method was the best predictor of this disorder. The present study investigated four G6PD activity detections (fluorescence spot (FS), methaemoglobin reduction (MR), biochemical and cytochemical test). These methods accompanied with mutation analysis of blood samples were taken from 295 apparently healthy individuals with unknown G6PD deficiency status. Molecular characterization of 295 Thai adults revealed an overall prevalence of 14.2%. The G6PD Viangchan (871 G>A) was the most common (83.3%), followed by G6PD Mahidol (487G>A) (11.9%), and G6PD Union (1360 C>T) (4.8%). There were two cases of G6PD deficiency carrying the double mutations of Viangchan (871G > A)-Mahidol (487G > A) and Viangchan (871G > A)-Union (1360C > T). In comparison, the prevalence of G6PD deficiency was 6.1% by FS test and 7.1% by MR test. G6PD activity was 11 ± 2.5 IU/gHb in non-deficient females (mean ± SD), and 10.9 ± 0.6 IU/gHb in non-deficient males. The upper and lower limit cut-off points for partial and severe deficiency in adults were 5.7 IU/gHb (60% of the normal mean) and 0.95 IU/gHb (10% of the normal mean), respectively. All hemizygote, homozygote and double mutations were associated with severe enzyme deficiency (the residual enzyme activity <10% of the normal mean), whereas only 14.3% of the heterozygote mutations showed severe enzyme deficiency. Based on the cut-off value <5.7 IU/gHb, the quantitative G6PD assay diagnosed 83% of cases as G6PD-deficient. Using a cut-off number of negative cell >20% in

  3. Homozygous G320V mutation in the HJV gene causing juvenile hereditary haemochromatosis type A. A case report.

    PubMed

    Militaru, Mariela S; Popp, Radu A; Trifa, Adrian P

    2010-06-01

    While classical hereditary haemochromatosis, usually associated with mutations in the HFE gene, has an adult age onset and a long, progressive evolution, juvenile haemochromatosis, most often associated with mutations in the HJV gene, is a more severe, rapidly progressive condition and has an onset before the age of 30. We report a 26-year old woman with a severe iron overload, affected by hypogonadotropic hypogonadism and moderate dilative cardiomyopathy, in whom the molecular analysis revealed a homozygous genotype for G320V mutation in the HJV gene. As juvenile haemochromatosis is a severe disease, death usually occurring from cardiac involvement, an efficient iron removal from the body strategy should be started as soon as possible, in order to prevent irreversible damage.

  4. G6PD deficiency in Plasmodium falciparum and Plasmodium vivax malaria-infected Cambodian patients

    PubMed Central

    2013-01-01

    Background Glucose-6-phosphate-dehydrogenase deficiency (G6PDd) rates are unknown in malaria-infected Cambodian patients. These data are key to a rational drug policy for malaria elimination of Plasmodium falciparum and Plasmodium vivax. Methods From September 2010–2012, a two-year survey of G6PDd and haemoglobinopathies assessed by quantitative enzyme activity assay and haemoglobin electrophoresis, respectively, was conducted in malaria-infected patients presenting to 19 health centres throughout Cambodia. Results A total of 2,408 confirmed malaria patients of mean age 26.7 (range 2–81) years were recruited from mostly western Cambodia (n = 1,732, 71.9%); males outnumbered females by 3.9:1. Plasmodium falciparum was present in 1,443 (59.9%) and P. vivax in 965 (40.1%) patients. Mean G6PD activity was 11.6 (CI 95%: 11.4-11.8) U/g Hb, G6PDd was present in 13.9% of all patients (335/2,408) and severe G6PDd (including WHO Class I and II variants) was more common in western (158/1,732, 9.1%) versus eastern (21/414, 5.1%) Cambodia (P = 0.01). Of 997/2,408 (41.4%) had a haemoglobinopathy. Mean haemoglobin concentrations were inversely related to age: 8.1 g/dL < five years, 8.7 g/dL five to 14 years, and 10.4 g/dL >15 years (P <0.001). Conclusions G6PDd prevalence, anaemia and haemoglobinopathies were common in malaria-infected patients. The deployment of primaquine in Cambodia should be preceded by primaquine safety studies paralleled with evaluations of easy to use tests to detect G6PDd. PMID:23714236

  5. Genomic analysis of primordial dwarfism reveals novel disease genes.

    PubMed

    Shaheen, Ranad; Faqeih, Eissa; Ansari, Shinu; Abdel-Salam, Ghada; Al-Hassnan, Zuhair N; Al-Shidi, Tarfa; Alomar, Rana; Sogaty, Sameera; Alkuraya, Fowzan S

    2014-02-01

    Primordial dwarfism (PD) is a disease in which severely impaired fetal growth persists throughout postnatal development and results in stunted adult size. The condition is highly heterogeneous clinically, but the use of certain phenotypic aspects such as head circumference and facial appearance has proven helpful in defining clinical subgroups. In this study, we present the results of clinical and genomic characterization of 16 new patients in whom a broad definition of PD was used (e.g., 3M syndrome was included). We report a novel PD syndrome with distinct facies in two unrelated patients, each with a different homozygous truncating mutation in CRIPT. Our analysis also reveals, in addition to mutations in known PD disease genes, the first instance of biallelic truncating BRCA2 mutation causing PD with normal bone marrow analysis. In addition, we have identified a novel locus for Seckel syndrome based on a consanguineous multiplex family and identified a homozygous truncating mutation in DNA2 as the likely cause. An additional novel PD disease candidate gene XRCC4 was identified by autozygome/exome analysis, and the knockout mouse phenotype is highly compatible with PD. Thus, we add a number of novel genes to the growing list of PD-linked genes, including one which we show to be linked to a novel PD syndrome with a distinct facial appearance. PD is extremely heterogeneous genetically and clinically, and genomic tools are often required to reach a molecular diagnosis.

  6. Genomic analysis of primordial dwarfism reveals novel disease genes

    PubMed Central

    Shaheen, Ranad; Faqeih, Eissa; Ansari, Shinu; Abdel-Salam, Ghada; Al-Hassnan, Zuhair N.; Al-Shidi, Tarfa; Alomar, Rana; Sogaty, Sameera; Alkuraya, Fowzan S.

    2014-01-01

    Primordial dwarfism (PD) is a disease in which severely impaired fetal growth persists throughout postnatal development and results in stunted adult size. The condition is highly heterogeneous clinically, but the use of certain phenotypic aspects such as head circumference and facial appearance has proven helpful in defining clinical subgroups. In this study, we present the results of clinical and genomic characterization of 16 new patients in whom a broad definition of PD was used (e.g., 3M syndrome was included). We report a novel PD syndrome with distinct facies in two unrelated patients, each with a different homozygous truncating mutation in CRIPT. Our analysis also reveals, in addition to mutations in known PD disease genes, the first instance of biallelic truncating BRCA2 mutation causing PD with normal bone marrow analysis. In addition, we have identified a novel locus for Seckel syndrome based on a consanguineous multiplex family and identified a homozygous truncating mutation in DNA2 as the likely cause. An additional novel PD disease candidate gene XRCC4 was identified by autozygome/exome analysis, and the knockout mouse phenotype is highly compatible with PD. Thus, we add a number of novel genes to the growing list of PD-linked genes, including one which we show to be linked to a novel PD syndrome with a distinct facial appearance. PD is extremely heterogeneous genetically and clinically, and genomic tools are often required to reach a molecular diagnosis. PMID:24389050

  7. Role of the mismatch repair gene, Msh6, in suppressing genome instability and radiation-induced mutations

    PubMed Central

    Barrera-Oro, Julio; Liu, Tzu-Yang; Gorden, Erin; Kucherlapati, Raju; Shao, Changshun; Tischfield, Jay A

    2008-01-01

    Mismatch repair (MMR) is critical for preserving genomic integrity. Failure of this system can accelerate somatic mutation and increase the risk of developing cancer. MSH6, in complex with MSH2, is the MMR protein that mediates DNA repair through the recognition of 1- and 2-bp mismatches. To evaluate the effects of MSH6 deficiency on genomic stability we compared the frequency of in vivo loss of heterozygosity (LOH) between MSH6-proficient and deficient, 129S2 x C57BL/6 F1 hybrid mice that were heterozygous for our reporter gene Aprt. We recovered mutant cells that had functionally lost APRT protein activity and categorized the spectrum of mutations responsible for the LOH events. We also measured the mutant frequency at the X-linked gene, Hprt, as a second reporter for point mutation. In Msh6−/−Aprt+/− mice, mutation frequency at Aprt was elevated in both T cells and fibroblasts by 2.5-fold and 5.7-fold, respectively, over Msh6+/+Aprt+/− littermate controls. While a modest increase in mitotic recombination (MR) was observed in MSH6-deficient fibroblasts compared to wild type controls, point mutation was the predominant mechanism leading to APRT deficiency in both cell types. Base substitution, consisting of multiple types of transitions, accounted for all of the point mutations identified within the Aprt coding region. We also assessed the role of MSH6 in preventing mutations caused by a common environmental mutagen, ionizing radiation (IR). In Msh6−/−Aprt+/− mice, 4 Gy of X-irradiation induced a significant increase in point mutations at both Aprt and Hprt in T cells, but not in fibroblasts. These findings indicate that MutSα reduces spontaneous and IR-induced mutation in a cell-type dependant manner. PMID:18538799

  8. Using G6PD tests to enable the safe treatment of Plasmodium vivax infections with primaquine on the Thailand-Myanmar border: A cost-effectiveness analysis

    PubMed Central

    Parmiter, Minnie; Chu, Cindy S.; Bancone, Germana; Nosten, François; Price, Ric N.; Lubell, Yoel; Yeung, Shunmay

    2017-01-01

    Background Primaquine is the only licensed antimalarial for the radical cure of Plasmodium vivax infections. Many countries, however, do not administer primaquine due to fear of hemolysis in those with glucose-6-phosphate dehydrogenase (G6PD) deficiency. In other settings, primaquine is given without G6PD testing, putting patients at risk of hemolysis. New rapid diagnostic tests (RDTs) offer the opportunity to screen for G6PD deficiency prior to treatment with primaquine. Here we assessed the cost-effectiveness of using G6PD RDTs on the Thailand-Myanmar border and provide the model as an online tool for use in other settings. Methods/Principal findings Decision tree models for the management of P. vivax malaria evaluated the costs and disability-adjusted life-years (DALYs) associated with recurrences and primaquine-induced hemolysis from a health care provider perspective. Screening with G6PD RDTs before primaquine use was compared to (1) giving chloroquine alone and (2) giving primaquine without screening. Data were taken from a recent study on the impact of primaquine on P. vivax recurrences and a literature review. Compared to the use of chloroquine alone, the screening strategy had similar costs while averting 0.026 and 0.024 DALYs per primary infection in males and females respectively. Compared to primaquine administered without screening, the screening strategy provided modest cost savings while averting 0.011 and 0.004 DALYs in males and females respectively. The probabilistic sensitivity analyses resulted in a greater than 75% certainty that the screening strategy was cost-effective at a willingness to pay threshold of US$500, which is well below the common benchmark of per capita gross domestic product for Myanmar. Conclusions/Significance In this setting G6PD RDTs could avert DALYs by reducing recurrences and reducing hemolytic risk in G6PD deficient patients at low costs or cost savings. The model results are limited by the paucity of data available in

  9. Mutational screening of CHX10, GDF6, OTX2, RAX and SOX2 genes in 50 unrelated microphthalmia-anophthalmia-coloboma (MAC) spectrum cases.

    PubMed

    Gonzalez-Rodriguez, J; Pelcastre, E L; Tovilla-Canales, J L; Garcia-Ortiz, J E; Amato-Almanza, M; Villanueva-Mendoza, C; Espinosa-Mattar, Z; Zenteno, J C

    2010-08-01

    Microphthalmia-anophthalmia-coloboma (MAC) are congenital eye malformations causing a significant percentage of visually impairments in children. Although these anomalies can arise from prenatal exposure to teratogens, mutations in well-defined genes originate potentially heritable forms of MAC. Mutations in genes such as CHX10, GDF6, RAX, SOX2 and OTX2, among others, have been recognised in dominant or recessive MAC. SOX2 and OTX2 are the two most commonly mutated genes in monogenic MAC. However, as more numerous samples of MAC subjects would be analysed, a better estimation of the actual involvement of specific MAC-genes could be made. Here, a comprehensive mutational analysis of the CHX10, GDF6, RAX, SOX2 and OTX2 genes was performed in 50 MAC subjects. PCR amplification and direct automated DNA sequencing of all five genes in 50 unrelated subjects. Eight mutations (16% prevalence) were recognised, including four GDF6 mutations (one novel), two novel RAX mutations, one novel OTX2 mutation and one SOX2 mutation. Anophthalmia and nanophthalmia, not previously associated with GDF6 mutations, were observed in two subjects carrying defects in this gene, expanding the spectrum of GDF6-linked ocular anomalies. Our study underscores the importance of genotyping large groups of patients from distinct ethnic origins for improving the estimation of the global involvement of particular MAC-causing genes.

  10. MELAS syndrome associated with a new mitochondrial tRNA-Val gene mutation (m.1616A>G).

    PubMed

    Toyoshima, Yuka; Tanaka, Yuji; Satomi, Kazuo

    2017-09-11

    We describe the case of a 40-year-old-man with mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes (MELAS) syndrome, with cardiomyopathy and severe heart failure. He had a mitochondrial transfer RNA (tRNA) mutation (m.1616A>G) of the (tRNA-Val) gene, and it was not found in MELAS syndrome ever before. The presence of this newly observed tRNA-Val mutation (m.1616A>G) may induce multiple respiratory chain enzyme deficiencies and contribute to MELAS syndrome symptoms that are associated with mitochondrial DNA (mtDNA) mutations. We report that the pathognomonic symptom in MELAS syndrome caused by this newly observed mtDNA mutation may be rapid progression of cardiomyopathy and severe heart failure. © BMJ Publishing Group Ltd (unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  11. Data mining and pathway analysis of glucose-6-phosphate dehydrogenase with natural language processing

    PubMed Central

    Chen, Long; Zhang, Chunhua; Wang, Yanling; Li, Yuqian; Han, Qiaoqiao; Yang, Huixin; Zhu, Yuechun

    2017-01-01

    Human glucose-6-phosphate dehydrogenase (G6PD) is a crucial enzyme in the pentose phosphate pathway, and serves an important role in biosynthesis and the redox balance. G6PD deficiency is a major cause of neonatal jaundice and acute hemolyticanemia, and recently, G6PD has been associated with diseases including inflammation and cancer. The aim of the present study was to conduct a search of the National Center for Biotechnology Information PubMed library for articles discussing G6PD. Genes that were identified to be associated with G6PD were recorded, and the frequency at which each gene appeared was calculated. Gene ontology (GO), pathway and network analyses were then performed. A total of 98 G6PD-associated genes and 33 microRNAs (miRNAs) that potentially regulate G6PD were identified. The 98 G6PD-associated genes were then sub-classified into three functional groups by GO analysis, followed by analysis of function, pathway, network, and disease association. Out of the 47 signaling pathways identified, seven were significantly correlated with G6PD-associated genes. At least two out of four independent programs identified the 33 miRNAs that were predicted to target G6PD. miR-1207-5P, miR-1 and miR-125a-5p were predicted by all four software programs to target G6PD. The results of the present study revealed that dysregulation of G6PD was associated with cancer, autoimmune diseases, and oxidative stress-induced disorders. These results revealed the potential roles of G6PD-regulated signaling and metabolic pathways in the etiology of these diseases. PMID:28627690

  12. Pathogenic mutations of TGFBI and CHST6 genes in Chinese patients with Avellino, lattice, and macular corneal dystrophies.

    PubMed

    Huo, Ya-nan; Yao, Yu-feng; Yu, Ping

    2011-09-01

    To investigate gene mutations associated with three different types of corneal dystrophies (CDs), and to establish a phenotype-genotype correlation. Two patients with Avellino corneal dystrophy (ACD), four patients with lattice corneal dystrophy type I (LCD I) from one family, and three patients with macular corneal dystrophy type I (MCD I) were subjected to both clinical and genetic examinations. Slit lamp examination was performed for all the subjects to assess their corneal phenotypes. Genomic DNA was extracted from peripheral blood leukocytes. The coding regions of the human transforming growth factor β-induced (TGFBI) gene and carbohydrate sulfotransferase 6 (CHST6) gene were amplified by polymerase chain reaction (PCR) and subjected to direct sequencing. DNA samples from 50 healthy volunteers were used as controls. Clinical examination showed three different phenotypes of CDs. Genetic examination identified that two ACD subjects were associated with homozygous R124H mutation of TGFBI, and four LCD I subjects were all associated with R124C heterozygous mutation. One MCD I subject was associated with a novel S51X homozygous mutation in CHST6, while the other two MCD I subjects harbored a previously reported W232X homozygous mutation. Our study highlights the prevalence of codon 124 mutations in the TGFBI gene among the Chinese ACD and LCD I patients. Moreover, we found a novel mutation among MCD I patients.

  13. Glucose 6-phosphate dehydrogenase and the kidney.

    PubMed

    Spencer, Netanya Y; Stanton, Robert C

    2017-01-01

    Glucose 6-phosphate dehydrogenase (G6PD) is the rate-limiting enzyme of the pentose phosphate pathway. G6PD is the main source of the essential cellular reductant, NADPH. The purpose of this review is to describe the biochemistry of G6PD and NADPH, cellular factors that regulate G6PD, normal physiologic roles of G6PD, and the pathogenic role altered G6PD/NADPH plays in kidney disease. NADPH is required for many essential cellular processes such as the antioxidant system, nitric oxide synthase, cytochrome p450 enzymes, and NADPH oxidase. Decreased G6PD activity and, as a result, decreased NADPH level have been associated with diabetic kidney disease, altered nitric oxide production, aldosterone-mediated endothelial dysfunction, and dialysis-associated anemia. Increased G6PD activity is associated with all cancers including kidney cancer. Inherited G6PD deficiency is the most common mutation in the world that is thought to be a relatively mild disorder primarily associated with anemia. Yet, intriguing studies have shown an increased prevalence of diabetes mellitus in G6PD-deficient people. It is not known if G6PD-deficient people are at more risk for other diseases. Much more research needs to be done to determine the role of altered G6PD activity (inherited or acquired) in the pathogenesis of kidney disease.

  14. Genetic basis of glycogen storage disease type 1a: Prevalent mutations at the glucose-6-phosphatase locus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ke-Jian Lei; Hungwen Chen; Ji-Lan Liu

    Diagnosis of glycogen storage disease (GSD) type 1a currently is established by demonstrating the lack of glucose-6-phosphatase (G6Pase) activity in the patient`s biopsied liver specimen. Recent cloning of the G6Pase gene and identification of mutations within the gene that causes GSD type 1a allow for the development of a DNA-based diagnostic method. Using SSCP analysis and DNA sequencing, we characterized the G6Pase gene of 70 unrelated patients with enzymatically confirmed diagnosis of GSD type 1a and detected mutations in all except 17 alleles (88%). Sixteen mutations were uncovered that were shown by expression to abolish or greatly reduce G6Pase activitymore » and that therefore are responsible for the GSD type la disorder. R83C and Q347X are the most prevalent mutations found in Caucasians, 130X and R83C are most prevalent in Hispanics, and R83H is most prevalent in Chinese. The Q347X mutation has thus far been identified only in Caucasian patients, and the 130X mutation has been identified only in Hispanic patients. Our results demonstrate that the DNA-based analysis can accurately, rapidly, and noninvasively detect the majority of mutations in GSD type 1a. This DNA-based diagnosis now permits prenatal diagnosis among at-risk patients and serves as a database in screening and counseling patients clinically suspected of having this disease. 22 refs., 2 figs., 4 tabs.« less

  15. Mutational screening in genes related with porto-pulmonary hypertension: An analysis of 6 cases.

    PubMed

    Pousada, Guillermo; Baloira, Adolfo; Valverde, Diana

    2017-04-07

    Portopulmonary hypertension (PPH) is a rare disease with a low incidence and without a clearly-identified genetic component. The aim of this work was to check genes and genetic modifiers related to pulmonary arterial hypertension in patients with PPH in order to clarify the molecular basis of the pathology. We selected a total of 6 patients with PPH and amplified the exonic regions and intronic flanking regions of the relevant genes and regions of interest of the genetic modifiers. Six patients diagnosed with PPH were analyzed and compared to 55 healthy individuals. Potentially-pathogenic mutations were identified in the analyzed genes of 5 patients. None of these mutations, which are highly conserved throughout evolution, were detected in the control patients nor different databases analyzed (1000 Genomes, ExAC and DECIPHER). After analyzing for genetic modifiers, we found different variations that could favor the onset of the disease. The genetic analysis carried out in this small cohort of patients with PPH revealed a large number of mutations, with the ENG gene showing the greatest mutational frequency. Copyright © 2017 Elsevier España, S.L.U. All rights reserved.

  16. Amylin S20G mutation in Mexican population.

    PubMed

    Garcia-Gonzalez, Claudia Lorena; Montoya-Fuentes, Hector; Padilla-Rosas, Miguel; Sanchez-Corona, Jose

    2007-04-01

    Diabetes Mellitus type 2 (DM2) is a group of metabolic disorders characterized by defective insulin action or secretion or both with a 10.6% incidence in Mexican Mestizo population, DM2 is also classified within the localized misfolding diseases due to the amyloid pancreatic deposits found in 90% of the DM2 necropsies. The pancreatic amyloid main component is a protein known as human islet amyloid polypeptide (hIAPP) or amylin, the most common mutation is the S20G in Asian population with a polymorphic frequency in DM2 Asian patients. The aim of this study was to search this mutation in Mexican Mestizo general population (104) and DM2 patients (100). This is the first molecular study of hIAPP gene in Mexican population and in which we developed an alternative more effective antisense primer for the analysis of the NFGAILSS region in hIAPP exon 3 critical for the amyloid beta structure formation. We did not find the mutation in any of the 204 analyzed samples, thus the findings show that S20G is not a common mutation in Mexican Mestizo population.

  17. Altered Pre-mRNA Splicing Caused by a Novel Intronic Mutation c.1443+5G>A in the Dihydropyrimidinase (DPYS) Gene

    PubMed Central

    Nakajima, Yoko; Meijer, Judith; Zhang, Chunhua; Wang, Xu; Kondo, Tomomi; Ito, Tetsuya; Dobritzsch, Doreen; Van Kuilenburg, André B. P.

    2016-01-01

    Dihydropyrimidinase (DHP) deficiency is an autosomal recessive disease caused by mutations in the DPYS gene. Patients present with highly elevated levels of dihydrouracil and dihydrothymine in their urine, blood and cerebrospinal fluid. The analysis of the effect of mutations in DPYS on pre-mRNA splicing is hampered by the fact that DHP is primarily expressed in liver and kidney cells. The minigene approach can detect mRNA splicing aberrations using cells that do not express the endogenous mRNA. We have used a minigene-based approach to analyze the effects of a presumptive pre-mRNA splicing mutation in two newly identified Chinese pediatric patients with DHP deficiency. Mutation analysis of DPYS showed that both patients were compound heterozygous for a novel intronic mutation c.1443+5G>A in intron 8 and a previously described missense mutation c.1001A>G (p.Q334R) in exon 6. Wild-type and the mutated minigene constructs, containing exons 7, 8 and 9 of DPYS, yielded different splicing products after expression in HEK293 cells. The c.1443+5G>A mutation resulted in altered pre-mRNA splicing of the DPYS minigene construct with full skipping of exon 8. Analysis of the DHP crystal structure showed that the deletion of exon 8 severely affects folding, stability and homooligomerization of the enzyme as well as disruption of the catalytic site. Thus, the analysis suggests that the c.1443+5G>A mutation results in aberrant splicing of the pre-mRNA encoding DHP, underlying the DHP deficiency in two unrelated Chinese patients. PMID:26771602

  18. The LRRK2 G2385R variant is a partial loss-of-function mutation that affects synaptic vesicle trafficking through altered protein interactions.

    PubMed

    Carrion, Maria Dolores Perez; Marsicano, Silvia; Daniele, Federica; Marte, Antonella; Pischedda, Francesca; Di Cairano, Eliana; Piovesana, Ester; von Zweydorf, Felix; Kremmer, Elisabeth; Gloeckner, Christian Johannes; Onofri, Franco; Perego, Carla; Piccoli, Giovanni

    2017-07-14

    Mutations in the Leucine-rich repeat kinase 2 gene (LRRK2) are associated with familial Parkinson's disease (PD). LRRK2 protein contains several functional domains, including protein-protein interaction domains at its N- and C-termini. In this study, we analyzed the functional features attributed to LRRK2 by its N- and C-terminal domains. We combined TIRF microscopy and synaptopHluorin assay to visualize synaptic vesicle trafficking. We found that N- and C-terminal domains have opposite impact on synaptic vesicle dynamics. Biochemical analysis demonstrated that different proteins are bound at the two extremities, namely β3-Cav2.1 at N-terminus part and β-Actin and Synapsin I at C-terminus domain. A sequence variant (G2385R) harboured within the C-terminal WD40 domain increases the risk for PD. Complementary biochemical and imaging approaches revealed that the G2385R variant alters strength and quality of LRRK2 interactions and increases fusion of synaptic vesicles. Our data suggest that the G2385R variant behaves like a loss-of-function mutation that mimics activity-driven events. Impaired scaffolding capabilities of mutant LRRK2 resulting in perturbed vesicular trafficking may arise as a common pathophysiological denominator through which different LRRK2 pathological mutations cause disease.

  19. Glucokinase gene mutations (MODY 2) in Asian Indians.

    PubMed

    Kanthimathi, Sekar; Jahnavi, Suresh; Balamurugan, Kandasamy; Ranjani, Harish; Sonya, Jagadesan; Goswami, Soumik; Chowdhury, Subhankar; Mohan, Viswanathan; Radha, Venkatesan

    2014-03-01

    Heterozygous inactivating mutations in the glucokinase (GCK) gene cause a hyperglycemic condition termed maturity-onset diabetes of the young (MODY) 2 or GCK-MODY. This is characterized by mild, stable, usually asymptomatic, fasting hyperglycemia that rarely requires pharmacological intervention. The aim of the present study was to screen for GCK gene mutations in Asian Indian subjects with mild hyperglycemia. Of the 1,517 children and adolescents of the population-based ORANGE study in Chennai, India, 49 were found to have hyperglycemia. These children along with the six patients referred to our center with mild hyperglycemia were screened for MODY 2 mutations. The GCK gene was bidirectionally sequenced using BigDye(®) Terminator v3.1 (Applied Biosystems, Foster City, CA) chemistry. In silico predictions of the pathogenicity were carried out using the online tools SIFT, Polyphen-2, and I-Mutant 2.0 software programs. Direct sequencing of the GCK gene in the patients referred to our Centre revealed one novel mutation, Thr206Ala (c.616A>G), in exon 6 and one previously described mutation, Met251Thr (c.752T>C), in exon 7. In silico analysis predicted the novel mutation to be pathogenic. The highly conserved nature and critical location of the residue Thr206 along with the clinical course suggests that the Thr206Ala is a MODY 2 mutation. However, we did not find any MODY 2 mutations in the 49 children selected from the population-based study. Hence prevalence of GCK mutations in Chennai is <1:1,517. This is the first study of MODY 2 mutations from India and confirms the importance of considering GCK gene mutation screening in patients with mild early-onset hyperglycemia who are negative for β-cell antibodies.

  20. Multiplex primer extension reaction screening and oxidative challenge of glucose-6-phosphate dehydrogenase mutants in hemizygous and heterozygous subjects.

    PubMed

    Ko, Chun Hay; Yung, Edmund; Li, Karen; Li, Chung Leung; Ng, Pak Cheung; Fung, Kwok Pui; Wong, Raymond Pui-On; Chui, Kit Man; Gu, Goldie Jia-Shi; Fok, Tai Fai

    2006-01-01

    The primary objective of our study was to provide a simple and reliable assay for identifying the majority of G6PD genetic variants in the Chinese population. We optimized the multiplex primer extension reaction (MPER) assay for simultaneous screening of 14-point mutations in 98 G6PD-deficient subjects. Our data demonstrated that this method is precise, cost-effective and has successfully identified mutations in 97 out of 98 subjects, including all heterozygous mutants. We also detected a relatively high incidence (12.3%) of c.871G > A, and all of them harbored the silent mutation c.1311C > T. Apart from the screening program, the pharmacogenetic relationship between G6PD level and residual reduced glutathione (GSH) level was studied upon oxidative challenge by alpha-naphthol. The GSH levels were correlated with their status of G6PD deficiency, but no significant difference was observed between individual G6PD-deficient groups. Our data demonstrated the potentials of the MPER assay for characterization of G6PD deficiency and other genetic diseases.

  1. Carnitine-acylcarnitine translocase deficiency with c.199-10 T>G and novel c.1A>G mutation

    PubMed Central

    Yan, Hui-ming; Hu, Hao; Ahmed, Aisha; Feng, Bing-bing; Liu, Jing; Jia, Zheng-jun; Wang, Hua

    2017-01-01

    Abstract Rationale: Carnitine-acylcarnitine translocate deficiency (CACTD) is a rare and life-threatening, autosomal recessive disorder of fatty acid β-oxidation characterized by hypoketotic hypoglycemia, hyperammonemia, cardiomyopathy, liver dysfunction, and muscle weakness; culminating in early death. To date, CACTD cases screened from the Chinese mainland population, especially patient with compound heterozygote with c.199-10T>G and a novel c.1A>G mutation in the SLC25A20 gene has never been described. Patient concerns: Herein, we report 2 neonatal cases of CACTD identified from the mainland China. These 2 patients were presented with severe metabolic crisis and their clinical conditions deteriorate rapidly and both died of cardiorespiratory collapse in the first week of life. We present the clinical and biochemical features of 2 probands and a brief literature review of previously reported CACTD cases with the c.199-10T>G mutation. Diagnoses: The acylcarnitine profiles by tandem-mass-spectrometry and the mutation analysis of SLC25A20 gene confirmed the diagnosis of CACTD in both patients. Mutation analysis demonstrated that patient No. 1 was homozygous for c.199-10T>G mutation, while patient No. 2 was a compound heterozygote for 2 mutations, a maternally-inherited c.199-10T>G and a paternally-inherited, novel c.1A>G mutation. Interventions: Both patients were treated with an aggressive treatment regimen include high glucose and arginine infusion, respiratory, and circulatory support. Outcomes: The first proband died 3 days after delivery due to sudden cardiac arrest. The second patient's clinical condition, at one time, was improved by high glucose infusion, intravenous arginine, and circulatory support. However, the patient failed to wean from mechanical ventilation. Unfortunately, her parents refused further treatment due to fear of financial burdens. The patient died of congestive heart failure in the 6th day of life. Lessons: We report the first 2 cases of

  2. Novel compound heterozygous Thyroglobulin mutations c.745+1G>A/c.7036+2T>A associated with congenital goiter and hypothyroidism in a Vietnamese family. Identification of a new cryptic 5' splice site in the exon 6.

    PubMed

    Citterio, Cintia E; Morales, Cecilia M; Bouhours-Nouet, Natacha; Machiavelli, Gloria A; Bueno, Elena; Gatelais, Frédérique; Coutant, Regis; González-Sarmiento, Rogelio; Rivolta, Carina M; Targovnik, Héctor M

    2015-03-15

    Several patients were identified with dyshormonogenesis caused by mutations in the thyroglobulin (TG) gene. These defects are inherited in an autosomal recessive manner and affected individuals are either homozygous or compound heterozygous for the mutations. The aim of the present study was to identify new TG mutations in a patient of Vietnamese origin affected by congenital hypothyroidism, goiter and low levels of serum TG. DNA sequencing identified the presence of compound heterozygous mutations in the TG gene: the maternal mutation consists of a novel c.745+1G>A (g.IVS6 + 1G>A), whereas the hypothetical paternal mutation consists of a novel c.7036+2T>A (g.IVS40 + 2T>A). The father was not available for segregation analysis. Ex-vivo splicing assays and subsequent RT-PCR analyses were performed on mRNA isolated from the eukaryotic-cells transfected with normal and mutant expression vectors. Minigene analysis of the c.745+1G>A mutant showed that the exon 6 is skipped during pre-mRNA splicing or partially included by use of a cryptic 5' splice site located to 55 nucleotides upstream of the authentic exon 6/intron 6 junction site. The functional analysis of c.7036+2T>A mutation showed a complete skipping of exon 40. The theoretical consequences of splice site mutations, predicted with the bioinformatics tool NNSplice, Fsplice, SPL, SPLM and MaxEntScan programs were investigated and evaluated in relation with the experimental evidence. These analyses predicted that both mutant alleles would result in the abolition of the authentic splice donor sites. The c.745+1G>A mutation originates two putative truncated proteins of 200 and 1142 amino acids, whereas c.7036+2T>A mutation results in a putative truncated protein of 2277 amino acids. In conclusion, we show that the c.745+1G>A mutation promotes the activation of a new cryptic donor splice site in the exon 6 of the TG gene. The functional consequences of these mutations could be structural changes in the protein

  3. Safety of 8-aminoquinolines given to people with G6PD deficiency: protocol for systematic review of prospective studies.

    PubMed

    Uthman, Olalekan A; Saunders, Rachel; Sinclair, David; Graves, Patricia; Gelband, Hellen; Clarke, Aileen; Garner, Paul

    2014-05-14

    A single dose or short course of primaquine given to people infected with malaria may reduce transmission of Plasmodium falciparum through its effects on gametocytes. Primaquine is also known to cause haemolysis in people with variants of glucose-6-phosphate dehydrogenase (G6PD) deficiency. The objective of this systematic review was to assess the risk of adverse effects in people with G6PD deficiency given primaquine or other 8-aminoquinoline (8AQ) as a single dose or short course (less than 7 days). We will search the following databases: Cochrane Infectious Diseases Group Specialized Register, the Cochrane Central Register of Controlled Trials (CENTRAL), MEDLINE, EMBASE and LILACS. Prospective cohort studies, randomised and quasi-randomised trials that evaluated 8AQs for whatever reason in adults or children with a known G6PD deficiency will be included. Two authors will independently assess each study for eligibility, risk of bias and extract data. This systematic review will be published in a peer-reviewed journal. Brief reports of the review findings will be disseminated directly to the appropriate audiences and the WHO Technical Expert Group in Malaria Chemotherapy. As no primary data collection will be undertaken, no additional formal ethical assessment and informed consent are required. The protocol is registered with PROSPERO, registration number CRD42013006518. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  4. Mice over-expressing human O6 alkylguanine-DNA alkyltransferase selectively reduce O6 methylguanine mediated carcinogenic mutations to threshold levels after N-methyl-N-nitrosourea.

    PubMed

    Allay, E; Veigl, M; Gerson, S L

    1999-06-24

    While it is well known that MNU induces thymic lymphomas in the mouse, it remains unclear which pre-mutagenic lesions are responsible for lymphomagenic transformation. One lesion thought to play a critical role is O6methylguanine[O6mG]which initiates G: C to A:T transition mutations in K-ras and other oncogenes. O6alkylguanine-DNA alkyltransferase (AGT), encoded by the methylguanine methyltransferase gene [MGMT], removes the methyl group thereby preventing the mutation from occurring. When overexpressed in the thymus, MGMT protects mice from MNU-induced thymic lymphomas. To determine whether MGMT overexpression reduced G: C to A: T mutation frequency after MNU, Big Blue lacI and MGMT+/Big Blue mice were treated with MNU and analysed for mutations in the lacI and K-ras genes. The incidence of MNU-induced lymphomas was 84% in Big Blue lacI mice compared to 14% in MGMT+Big Blue lacI mice. Sixty-two per cent of the lymphomas had a GGT to GAT activating mutation in codon 12 of K-ras consistent with O6mG adduct-mediated point mutagenesis. LacI mutation frequency in thymus of MNU treated Big Blue mice was 45-fold above background whereas it was 11-fold above background in MNU treated MGMT+/Big Blue mice. Most lacI mutations were G:C to A:T transitions, implicating O6mG even in the MGMT+mice. No mutations were attributable to chromosomal aberrations or rearrangements. Thus, O6mG adducts account for the carcinogenic effect of MNU and MGMT overexpression is selectively able to reduce O6methylguanine adducts below a carcinogenic threshold. Other adducts are mutagenic but appear to contribute much less to malignant transformation or oncogene activation.

  5. A deletion mutation in GJB6 cooperating with a GJB2 mutation in trans in non-syndromic deafness: A novel founder mutation in Ashkenazi Jews.

    PubMed

    Lerer, I; Sagi, M; Ben-Neriah, Z; Wang, T; Levi, H; Abeliovich, D

    2001-11-01

    A deletion of at least 140 kb starting approximately 35kb upstream (telomeric) to the GJB2 (CX26) gene was identified in 7 patients from 4 unrelated Jewish Ashkenazi families with non-syndromic hearing loss. These patients were heterozygous for one of the common mutations 167delT or 35delG in the GJB2 gene in trans to the deletion. The deletion started at 5' side of the GJB6 (CX30) gene including the first exon and it did not affect the integrity of the GJB2 gene. The deletion mutation segregated together with the hearing loss, and was not found in a control group of 100 Ashkenazi individuals. We suggest that the deletion is a recessive mutation causing hearing loss in individuals that are double heterozygous for the deletion and for a mutation in the GJB2 gene. The effect of the deletion mutation could be due to a digenic mode of inheritance of GJB2 and GJB6 genes that encode two different connexins; connexin 26 and connexin 30, or it may abolish control elements that are important in the expression of the GJB2 gene in the cochlea. Regardless which of the options is valid, it is apparent that the deletion mutation provides a new insight into connexin function in the auditory system. The deletion mutation was on the same haplotypic background in all the families, and therefore is a founder mutation that increases the impact of GJB2 in the etiology of prelingual recessive non-syndromic hearing loss in the Ashkenazi population. Copyright 2001 Wiley-Liss, Inc.

  6. PD1 as a common candidate susceptibility gene of subacute sclerosing panencephalitis.

    PubMed

    Ishizaki, Yoshito; Yukaya, Naoko; Kusuhara, Koichi; Kira, Ryutaro; Torisu, Hiroyuki; Ihara, Kenji; Sakai, Yasunari; Sanefuji, Masafumi; Pipo-Deveza, Judy R; Silao, Catherine Lynn T; Sanchez, Benilda C; Lukban, Marissa B; Salonga, Aida M; Hara, Toshiro

    2010-04-01

    Although the exact pathogenesis of subacute sclerosing panencephalitis (SSPE) remains to be determined, our previous data suggested a genetic contribution to the host susceptibility to SSPE. During chronic viral infection, virus-specific cytotoxic T lymphocytes display poor effector functions. Since co-inhibitory molecules are involved in the suppression of T lymphocytes, we investigated whether single nucleotide polymorphisms (SNPs) of genes encoding co-inhibitory molecules contributed to a susceptibility to SSPE. Association studies on a total of 20 SNPs in 8 genes (CTLA4, CD80, CD86, PD1, PDL1, PDL2, BTLA and HVEM) and subsequent haplotype analysis of 4 SNPs in the PD1 genes were performed in Japanese and Filipino SSPE patients and controls. Then, we investigated a functional difference in promoter activity of two haplotypes and compared the expression levels of PD1 between SSPE and controls. The frequency of GCG(C) haplotype of PD1 containing -606G allele was significantly higher in SSPE patients than in controls both in Japanese and in Filipinos. The promoter activity was significantly higher in the construct with -606G allele than in that with -606A allele. The expression levels of PD1 were significantly higher in SSPE patients than in the controls. Our results suggested that the PD1 gene contributed to a genetic susceptibility to SSPE.

  7. Strong association between a splice mutation (IVS12+5G{r_arrow}A) and haplotype 6 in hereditary tyrosinemia type I

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tanguay, R.M.; St-Louis, M.; Gibson, K.

    1994-09-01

    Hereditary tyrosinemia type I (HT I; McKusick 276700) is a severe inborn error of tyrosine catabolism pathway caused by a deficiency of fumarylacetoacetate hydrolase (FAH). The highest frequency reported is the one in Saguenay-Lac St-Jean (Quebec, Canada) where 1:1,846 births are affected. The FAH gene has been cloned and several mutations have been described. Allele specific oligonucleotide (ASO) hybridization was used to examine the frequency of a splice (IVS12-5G{r_arrow}A) mutation recently reported and RFLP analysis was done to identify haplotypes related to HT I. The splice mutation was found on 45/50 alleles (90%) in patients from SLSJ and 12/66 (18%)more » alleles from patients world-wide. All 25 patients from the SLSJ region were positive with 20 being homozygous, indicating that this mutation is the major cause of HT I in French Canada. Of these 25 patients, 96% were positive for one haplotype called no 6 which is these 25 patients, 96% were positive for one haplotype called no 6 which is identified by TaqI, RsaI, BglII, MspI and KpnI digestions. These data show a really strong association between the mutation (IVS12+5G{r_arrow}A) and haplotype 6. Among our patients from around the world, {approximately}52% were positive for haplotype 6 indicating its strong relation with HT I. These results provide the rationale for DNA-based carrier testing for HT I in the F-C population at risk as well as in HT I patients in general.« less

  8. Confirmation of the pathogenicity of a mutation p.G337C in the COL1A2 gene associated with osteogenesis imperfecta

    PubMed Central

    Jia, Mingrui; Shi, Ranran; Zhao, Xuli; Fu, Zhijian; Bai, Zhijing; Sun, Tao; Zhao, Xuejun; Wang, Wenbo; Xu, Chao; Yan, Fang

    2017-01-01

    Abstract Mutation analysis as the gold standard is particularly important in diagnosis of osteogenesis imperfecta (OI) and it may be preventable upon early diagnosis. In this study, we aimed to analyze the clinical and genetic materials of an OI pedigree as well as to confirm the deleterious property of the mutation. A pedigree with OI was identified. All family members received careful clinical examinations and blood was drawn for genetic analyses. Genes implicated in OI were screened for mutation. The function and structure of the mutant protein were predicted using bioinformatics analysis. The proband, a 9-month fetus, showed abnormal sonographic images. Disproportionately short and triangular face with blue sclera was noticed at birth. She can barely walk and suffered multiple fractures till 2-year old. Her mother appeared small stature, frequent fractures, blue sclera, and deformity of extremities. A heterozygous missense mutation c.1009G>T (p.G337C) in the COL1A2 gene was identified in her mother and her. Bioinformatics analysis showed p.G337 was well-conserved among multiple species and the mutation probably changed the structure and damaged the function of collagen. We suggest that the mutation p.G337C in the COL1A2 gene is pathogenic for OI by affecting the protein structure and the function of collagen. PMID:28953610

  9. Mutation and virulence assessment of chromosomal genes of Rhodococcus equi 103

    PubMed Central

    Pei, Yanlong; Parreira, Valeria; Nicholson, Vivian M.; Prescott, John F.

    2007-01-01

    Rhodococcus equi can cause severe or fatal pneumonia in foals as well as in immunocompromised animals and humans. Its ability to persist in macrophages is fundamental to how it causes disease, but the basis of this is poorly understood. To examine further the general application of a recently developed system of targeted gene mutation and to assess the importance of different genes in resistance to innate immune defenses, we disrupted the genes encoding high-temperature requirement A (htrA), nitrate reductase (narG), peptidase D (pepD), phosphoribosylaminoimidazole-succinocarboxamide synthase (purC), and superoxide dismutase (sodC) in strain 103 of R. equi using a double-crossover homologous recombination approach. Virulence testing by clearance after intravenous injection in mice showed that the htrA and narG mutants were fully attenuated, the purC and sodC mutants were unchanged, and the pepD mutant was slightly attenuated. Complementation with the pREM shuttle plasmid restored the virulence of the htrA and pepD mutants but not that of the narG mutant. A single-crossover mutation approach was simpler and faster than the double-crossover homologous recombination technique and was used to obtain mutations in 6 other genes potentially involved in virulence (clpB, fadD8, fbpB, glnA1, regX3, and sigF). These mutants were not attenuated in the mouse clearance assay. We were not able to obtain mutants for genes furA, galE, and sigE using the single-crossover mutation approach. In summary, the targeted-mutation system had general applicability but was not always completely successful, perhaps because some genes are essential under the growth conditions used or because the success of mutation depends on the target genes. PMID:17193875

  10. ANXA11 mutations prevail in Chinese ALS patients with and without cognitive dementia.

    PubMed

    Zhang, Kang; Liu, Qing; Liu, Keqiang; Shen, Dongchao; Tai, Hongfei; Shu, Shi; Ding, Qingyun; Fu, Hanhui; Liu, Shuangwu; Wang, Zhili; Li, Xiaoguang; Liu, Mingsheng; Zhang, Xue; Cui, Liying

    2018-06-01

    To investigate the genetic contribution of ANXA11 , a gene associated with amyotrophic lateral sclerosis (ALS), in Chinese ALS patients with and without cognitive dementia. Sequencing all the coding exons of ANXA11 and intron-exon boundaries in 18 familial amyotrophic lateral sclerosis (FALS), 353 unrelated sporadic amyotrophic lateral sclerosis (SALS), and 12 Chinese patients with ALS-frontotemporal lobar dementia (ALS-FTD). The transcripts in peripheral blood generated from a splicing mutation were examined by reverse transcriptase PCR. We identified 6 nonsynonymous heterozygous mutations (5 novel and 1 recurrent), 1 splice site mutation, and 1 deletion of 10 amino acids (not accounted in the mutant frequency) in 11 unrelated patients, accounting for a mutant frequency of 5.6% (1/18) in FALS, 2.3% (8/353) in SALS, and 8.3% (1/12) in ALS-FTD. The deletion of 10 amino acids was detected in 1 clinically undetermined male with an ALS family history who had atrophy in hand muscles and myotonic discharges revealed by EMG. The novel p. P36R mutation was identified in 1 FALS index, 1 patient with SALS, and 1 ALS-FTD. The splicing mutation (c.174-2A>G) caused in-frame skipping of the entire exon 6. The rest missense mutations including p.D40G, p.V128M, p.S229R, p.R302C and p.G491R were found in 6 unrelated patients with SALS. The ANXA11 gene is one of the most frequently mutated genes in Chinese patients with SALS. A canonical splice site mutation leading to skipping of the entire exon 6 further supports the loss-of-function mechanism. In addition, the study findings further expand the ANXA11 phenotype, first highlighting its pathogenic role in ALS-FTD.

  11. [Maple syrup urine disease and gene mutations in twin neonates].

    PubMed

    Li, Tao; Wang, Yu; Li, Cui; Xu, Wei-Wei; Niu, Feng-Hai; Zhang, Di

    2016-12-01

    To investigate the clinical features of one pair of twin neonates with maple syrup urine disease (MSUD) in the Chinese Han population and pathogenic mutations in related genes, and to provide guidance for the early diagnosis and treatment of MSUD. The clinical and imaging data of the twin neonates were collected. The peripheral blood samples were collected from the twin neonates and their parents to detect the genes related to MSUD (BCKDHA, BCKDHB, DBT, and DLD). The loci with gene mutations were identified, and a bioinformatic analysis was performed. Two mutations were detected in the BCKDHB gene, missense mutation c.304G>A (p.Gly102Arg) and nonsense mutation c.331C>T (p.Arg111*), and both of them were heterozygotes. The mutation c.304G>A (p.Gly102Arg) had not been reported in the world. Their father carried the missense mutation c.304G>A (p.Gly102Arg), and their mother carried the nonsense mutation c.331C>T (p.Arg111*). The c.331C>T (p.Arg111*) heterozygous mutation in BCKDHB gene is the pathogenic mutation in these twin neonates and provides a genetic and molecular basis for the clinical features of children with MSUD.

  12. Mutation of the PAX6 gene in a sporadic patient with atypical aniridia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhu, D.; Li, Y.; Traboulsi, E.I.

    1994-09-01

    A 28 year-old man presented with poor vision since childhood and gradual further decline of several years duration. His visual acuity measures 20/200 OD with -11.50 + 0.50 x 150 and 20/100 OS with -12.25 + 0.25 x 35. He had a fine nystagmus. His visual fields were full. There was a circumferential pannus with areas of corneal stromal opacification. The iris was hypoplastic with atypical colobomatous defects. The lenses had scattered cortical opacities. The intraocular pressures were normal. The optic nerves had cup disk ratios of 0.6 OU. The family history was negative for similar defects. A diagnosis ofmore » aniridia was made and blood was drawn for analysis of the PAX6 gene. PCR amplification of exon 5 showed heterozygous fragments with one allele being larger than normal. Direct DNA sequencing of the individual heterozygous allele showed a 41 base pair insertion at nucleotide 483 in exon 5 of the paired domain. This frameshift mutation changed codon 71 to a stop codon. The diagnosis of aniridia was confirmed in this atypical patient, who will need to be monitored for his high risk of glaucoma. The risk of developing Wilms` tumor in patients with mutations within the aniridia gene is presumably negligible since the neighboring Wilms` tumor gene is unaffected. The identification of intragenic mutations of the PAX6 gene in patients with sporadic aniridia modifies the management of such patients because of recognition of the increased risk of glaucoma and by reducing the necessity for frequent monitoring for the presence of Wilms` tumor.« less

  13. Risk of colorectal cancer for people with a mutation in both a MUTYH and a DNA mismatch repair gene

    PubMed Central

    Win, Aung Ko; Reece, Jeanette C.; Buchanan, Daniel D.; Clendenning, Mark; Young, Joanne P.; Cleary, Sean P.; Kim, Hyeja; Cotterchio, Michelle; Dowty, James G.; MacInnis, Robert J.; Tucker, Katherine M.; Winship, Ingrid M.; Macrae, Finlay A.; Burnett, Terrilea; Le Marchand, Loïc; Casey, Graham; Haile, Robert W.; Newcomb, Polly A.; Thibodeau, Stephen N.; Lindor, Noralane M.; Hopper, John L.; Gallinger, Steven; Jenkins, Mark A.

    2015-01-01

    The base excision repair protein, MUTYH, functionally interacts with the DNA mismatch repair (MMR) system. As genetic testing moves from testing one gene at a time, to gene panel and whole exome next generation sequencing approaches, understanding the risk associated with co-existence of germline mutations in these genes will be important for clinical interpretation and management. From the Colon Cancer Family Registry, we identified 10 carriers who had both a MUTYH mutation (6 with c.1187G>A p.(Gly396Asp), 3 with c.821G>A p.(Arg274Gln), and 1 with c.536A>G p.(Tyr179Cys)) and a MMR gene mutation (3 in MLH1, 6 in MSH2, and 1 in PMS2), 375 carriers of a single (monoallelic) MUTYH mutation alone, and 469 carriers of a MMR gene mutation alone. Of the 10 carriers of both gene mutations, 8 were diagnosed with colorectal cancer. Using a weighted cohort analysis, we estimated that risk of colorectal cancer for carriers of both a MUTYH and a MMR gene mutation was substantially higher than that for carriers of a MUTYH mutation alone [hazard ratio (HR) 21.5, 95 % confidence interval (CI) 9.19–50.1; p < 0.001], but not different from that for carriers of a MMR gene mutation alone (HR 1.94, 95 % CI 0.63–5.99; p = 0.25). Within the limited power of this study, there was no evidence that a monoallelic MUTYH gene mutation confers additional risk of colorectal cancer for carriers of a MMR gene mutation alone. Our finding suggests MUTYH mutation testing in MMR gene mutation carriers is not clinically informative. PMID:26202870

  14. Pathogenic mutations of TGFBI and CHST6 genes in Chinese patients with Avellino, lattice, and macular corneal dystrophies

    PubMed Central

    Huo, Ya-nan; Yao, Yu-feng; Yu, Ping

    2011-01-01

    Objective: To investigate gene mutations associated with three different types of corneal dystrophies (CDs), and to establish a phenotype-genotype correlation. Methods: Two patients with Avellino corneal dystrophy (ACD), four patients with lattice corneal dystrophy type I (LCD I) from one family, and three patients with macular corneal dystrophy type I (MCD I) were subjected to both clinical and genetic examinations. Slit lamp examination was performed for all the subjects to assess their corneal phenotypes. Genomic DNA was extracted from peripheral blood leukocytes. The coding regions of the human transforming growth factor β-induced (TGFBI) gene and carbohydrate sulfotransferase 6 (CHST6) gene were amplified by polymerase chain reaction (PCR) and subjected to direct sequencing. DNA samples from 50 healthy volunteers were used as controls. Results: Clinical examination showed three different phenotypes of CDs. Genetic examination identified that two ACD subjects were associated with homozygous R124H mutation of TGFBI, and four LCD I subjects were all associated with R124C heterozygous mutation. One MCD I subject was associated with a novel S51X homozygous mutation in CHST6, while the other two MCD I subjects harbored a previously reported W232X homozygous mutation. Conclusions: Our study highlights the prevalence of codon 124 mutations in the TGFBI gene among the Chinese ACD and LCD I patients. Moreover, we found a novel mutation among MCD I patients. PMID:21887843

  15. Rationale for recommending a lower dose of primaquine as a Plasmodium falciparum gametocytocide in populations where G6PD deficiency is common.

    PubMed

    White, Nicholas J; Qiao, Li Guo; Qi, Gao; Luzzatto, Lucio

    2012-12-14

    In areas of low malaria transmission, it is currently recommended that a single dose of primaquine (0.75 mg base/kg; 45 mg adult dose) be added to artemisinin combination treatment (ACT) in acute falciparum malaria to block malaria transmission. Review of studies of transmission-blocking activity based on the infectivity of patients or volunteers to anopheline mosquitoes, and of haemolytic toxicity in glucose 6-dehydrogenase (G6PD) deficient subjects, suggests that a lower primaquine dose (0.25 mg base/kg) would be safer and equally effective. This lower dose could be deployed together with ACTs without G6PD testing wherever use of a specific gametocytocide is indicated.

  16. Identification of three subgroups of B cell chronic lymphocytic leukemia based upon mutations of BCL-6 and IgV genes.

    PubMed

    Capello, D; Fais, F; Vivenza, D; Migliaretti, G; Chiorazzi, N; Gaidano, G; Ferrarini, M

    2000-05-01

    Although B cell chronic lymphocytic leukemia (B-CLL) has been traditionally viewed as a tumor of virgin B cells, this notion has been recently questioned by data suggesting that a fraction of B-CLL derives from antigen experienced B cells. In order to further clarify the histogenetic derivation of this lymphoproliferation, we have analyzed the DNA sequences of the 5' non-coding region of BCL-6 proto-oncogene in 28 cases of B-CLL. Mutations of BCL-6 proto-oncogene, a zinc finger transcription factor implicated in lymphoma development, represent a histogenetic marker of B cell transit through the germinal center (GC) and occur frequently in B cell malignancies derived from GC or post-GC B cells. For comparison, the same tumor panel was analyzed for somatic mutations of the rearranged immunoglobulin variable (IgV) genes, which are known to be acquired at the time of B cell transit through the GC. Sequence analyses of BCL-6 and IgV genes allowed the definition of three groups of B-CLL. Group I B-CLL displayed mutations of both BCL-6 and IgV genes (10/28; 36%). Group II B-CLL displayed mutated IgV genes, but a germline BCL-6 gene (5/28; 18%). Finally, group III B-CLL included the remaining cases (13/28; 46%) that were characterized by the absence of somatic mutations of both BCL-6 and IgV genes. Overall, the distribution of BCL-6 and IgV mutations in B-CLL reinforce the notion that this leukemia is histogenetically heterogeneous and that a substantial subgroup of these lymphoproliferations derives from post-germinal center B cells.

  17. Whole Exome Sequencing Identifies de Novo Mutations in GATA6 Associated with Congenital Diaphragmatic Hernia

    PubMed Central

    Yu, Lan; Bennett, James T.; Wynn, Julia; Carvill, Gemma L.; Cheung, Yee Him; Shen, Yufeng; Mychaliska, George B.; Azarow, Kenneth S.; Crombleholme, Timothy M.; Chung, Dai H.; Potoka, Douglas; Warner, Brad W.; Bucher, Brian; Lim, Foong-Yen; Pietsch, John; Stolar, Charles; Aspelund, Gudrun; Arkovitz, Marc S.; Mefford, Heather; Chung, Wendy K.

    2014-01-01

    Background Congenital diaphragmatic hernia (CDH) is a common birth defect affecting 1 in 3,000 births. It is characterized by herniation of abdominal viscera through an incompletely formed diaphragm. Although chromosomal anomalies and mutations in several genes have been implicated, the cause for most patients is unknown. Methods We used whole exome sequencing in two families with CDH and congenital heart disease, and identified mutations in GATA6 in both. Results In the first family, we identified a de novo missense mutation (c.1366C>T, p.R456C) in a sporadic CDH patient with tetralogy of Fallot. In the second, a nonsense mutation (c.712G>T, p.G238*) was identified in two siblings with CDH and a large ventricular septal defect. The G238* mutation was inherited from their mother, who was clinically affected with congenital absence of the pericardium, patent ductus arteriosus, and intestinal malrotation. Deep sequencing of blood and saliva derived DNA from the mother suggested somatic mosaicism as an explanation for her milder phenotype, with only approximately 15% mutant alleles. To determine the frequency of GATA6 mutations in CDH, we sequenced the gene in 378 patients with CDH. We identified one additional de novo mutation (c.1071delG, p.V358Cfs34*). Conclusions Mutations in GATA6 have been previously associated with pancreatic agenesis and congenital heart disease. We conclude that, in addition to the heart and the pancreas, GATA6 is involved in development of two additional organs, the diaphragm and the pericardium. In addition we have shown that de novo mutations can contribute to the development of CDH, a common birth defect. PMID:24385578

  18. Diverse growth hormone receptor gene mutations in Laron syndrome.

    PubMed Central

    Berg, M A; Argente, J; Chernausek, S; Gracia, R; Guevara-Aguirre, J; Hopp, M; Pérez-Jurado, L; Rosenbloom, A; Toledo, S P; Francke, U

    1993-01-01

    To better understand the molecular genetic basis and genetic epidemiology of Laron syndrome (growth-hormone insensitivity syndrome), we analyzed the growth-hormone receptor (GHR) genes of seven unrelated affected individuals from the United States, South America, Europe, and Africa. We amplified all nine GHR gene exons and splice junctions from these individuals by PCR and screened the products for mutations by using denaturing gradient gel electrophoresis (DGGE). We identified a single GHR gene fragment with abnormal DGGE results for each affected individual, sequenced this fragment, and, in each case, identified a mutation likely to cause Laron syndrome, including two nonsense mutations (R43X and R217X), two splice-junction mutations, (189-1 G to T and 71 + 1 G to A), and two frameshift mutations (46 del TT and 230 del TA or AT). Only one of these mutations, R43X, has been previously reported. Using haplotype analysis, we determined that this mutation, which involves a CpG dinucleotide hot spot, likely arose as a separate event in this case, relative to the two prior reports of R43X. Aside from R43X, the mutations we identified are unique to patients from particular geographic regions. Ten GHR gene mutations have now been described in this disorder. We conclude that Laron syndrome is caused by diverse GHR gene mutations, including deletions, RNA processing defects, translational stop codons, and missense codons. All the identified mutations involve the extracellular domain of the receptor, and most are unique to particular families or geographic areas. Images Figure 1 Figure 2 PMID:8488849

  19. The heterozygous R1441C mutation of leucine-rich repeat kinase 2 gene in a Chinese patient with Parkinson disease: A five-year follow-up and literatures review.

    PubMed

    Peng, Fang; Sun, Yi-Min; Chen, Chen; Luo, Su-Shan; Li, Da-Ke; Wang, Yi-Xuan; Yang, Ke; Liu, Feng-Tao; Zuo, Chuan-Tao; Ding, Zheng-Tong; An, Yu; Wu, Jian-Jun; Wang, Jian

    2017-02-15

    Leucine-rich repeat kinase 2 gene (LRRK2) was recognized associated with both familial and sporadic Parkinson Disease (PD). Seven missense mutations (G2019S, R1441C, R1441G, R1441H, Y1699C, I2020T, N1437H) of it have been confirmed disease- causing. They were common among Caucasian PD patients, but rarely reported in Asian, especially in Chinese Han population. We aimed to identify the frequencies of these seven mutations of LRRK2 in Chinese early-onset PD (EOPD) patients and analyze the phenotypes. One hundred and thirty seven EOPD patients were enrolled for genetic testing. The seven disease-causing mutations of LRRK2 were carried out by target sequencing using Illumina HiSeq 2000 Sequencer. The identified variants were further confirmed by Sanger sequence. The clinical materials were investigated retrospectively. Only one patient (0.73%) was found carrying pathogenetic LRRK2 mutation of R1441C. The age at onset of the female patient was 44. She manifested typical motor symptoms of PD and responded well to levodopa therapy. Longitudinal evaluation showed progression of motor symptoms and depression but no cognitive impairment. The dopamine transporter (DAT) imaging via [11C]-2β-carbomethoxy-3β-(4-fluorophenyl) tropan (CFT) and Positron emission computed tomography (PET) revealed typical dopamine transporter uptake reduction. The LRRK2 R1441C mutation was found in a Chinese EOPD patient for the first time. The manifestations of LRRK2-R1441C carriers were indistinguishable from sporadic PD patients. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Mutations in ATP6V1B1 and ATP6V0A4 genes cause recessive distal renal tubular acidosis in Mexican families.

    PubMed

    Escobar, Laura I; Simian, Christopher; Treard, Cyrielle; Hayek, Donia; Salvador, Carolina; Guerra, Norma; Matos, Mario; Medeiros, Mara; Enciso, Sandra; Camargo, María Dolores; Vargas-Poussou, Rosa

    2016-05-01

    Autosomal recessive distal renal tubular acidosis (dRTA) is a rare disease characterized by a hyperchloremic metabolic acidosis with normal anion gap, hypokalemia, hypercalciuria, hypocitraturia, nephrocalcinosis, and conserved glomerular filtration rate. In some cases, neurosensorial deafness is associated. dRTA is developed during the first months of life and the main manifestations are failure to thrive, vomiting, dehydration, and anorexia. Nine unrelated families were studied: seven children, a teenager, and an adult with dRTA. Hearing was preserved in four children. Coding regions of the genes responsible for recessive dRTA were analysed by Sanger sequencing. Molecular defects were found in the genes ATP6V1B1 and ATP6V0A4. We identified three homozygous variants in ATP6V1B: a frameshift mutation (p.Ile386Hisfs*56), a nucleotide substitution in exon 10 (p.Pro346Arg), and a new splicing mutation in intron 5. Three patients were homozygous for one novel (p.Arg743Trp) and one known (p.Asp411Tyr) missense mutations in the ATP6V0A4 gene. Three patients were compound heterozygous: one proband displayed two novel mutations, the frameshift mutation p.Val52Metfs*25, and a large deletion of exons 18-21; two probands showed the missense mutation p.Asp411Tyr and as a second mutation, p.Arg194Ter and c.1691+2dup, respectively. ATP6V0A4 and ATP6V1B1 genes were involved in recessive dRTA of Mexican families. All ATP6V1B1 mutations detected were homozygous and all patients developed sensorineural hearing loss (SNHL) early in infancy. ATP6V0A4 mutations were found in one infant and three children without SNHL, and in one teenager and one adult with SNHL confirming the phenotypic variability in this trait. The mutation p.Asp411Tyr detected in four Mexican families was due to a founder effect. Screening of these mutations could provide a rapid and valuable tool for diagnosis of dRTA in this population.

  1. Novel recurrently mutated genes and a prognostic mutation signature in colorectal cancer.

    PubMed

    Yu, Jun; Wu, William K K; Li, Xiangchun; He, Jun; Li, Xiao-Xing; Ng, Simon S M; Yu, Chang; Gao, Zhibo; Yang, Jie; Li, Miao; Wang, Qiaoxiu; Liang, Qiaoyi; Pan, Yi; Tong, Joanna H; To, Ka F; Wong, Nathalie; Zhang, Ning; Chen, Jie; Lu, Youyong; Lai, Paul B S; Chan, Francis K L; Li, Yingrui; Kung, Hsiang-Fu; Yang, Huanming; Wang, Jun; Sung, Joseph J Y

    2015-04-01

    Characterisation of colorectal cancer (CRC) genomes by next-generation sequencing has led to the discovery of novel recurrently mutated genes. Nevertheless, genomic data has not yet been used for CRC prognostication. To identify recurrent somatic mutations with prognostic significance in patients with CRC. Exome sequencing was performed to identify somatic mutations in tumour tissues of 22 patients with CRC, followed by validation of 187 recurrent and pathway-related genes using targeted capture sequencing in additional 160 cases. Seven significantly mutated genes, including four reported (APC, TP53, KRAS and SMAD4) and three novel recurrently mutated genes (CDH10, FAT4 and DOCK2), exhibited high mutation prevalence (6-14% for novel cancer genes) and higher-than-expected number of non-silent mutations in our CRC cohort. For prognostication, a five-gene-signature (CDH10, COL6A3, SMAD4, TMEM132D, VCAN) was devised, in which mutation(s) in one or more of these genes was significantly associated with better overall survival independent of tumor-node-metastasis (TNM) staging. The median survival time was 80.4 months in the mutant group versus 42.4 months in the wild type group (p=0.0051). The prognostic significance of this signature was successfully verified using the data set from the Cancer Genome Atlas study. The application of next-generation sequencing has led to the identification of three novel significantly mutated genes in CRC and a mutation signature that predicts survival outcomes for stratifying patients with CRC independent of TNM staging. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  2. Human glucose-6-phosphate dehydrogenase: the crystal structure reveals a structural NADP(+) molecule and provides insights into enzyme deficiency.

    PubMed

    Au, S W; Gover, S; Lam, V M; Adams, M J

    2000-03-15

    Glucose-6-phosphate dehydrogenase (G6PD) catalyses the first committed step in the pentose phosphate pathway; the generation of NADPH by this enzyme is essential for protection against oxidative stress. The human enzyme is in a dimer<-->tetramer equilibrium and its stability is dependent on NADP(+) concentration. G6PD deficiency results from many different point mutations in the X-linked gene encoding G6PD and is the most common human enzymopathy. Severe deficiency causes chronic non-spherocytic haemolytic anaemia; the usual symptoms are neonatal jaundice, favism and haemolytic anaemia. We have determined the first crystal structure of a human G6PD (the mutant Canton, Arg459-->Leu) at 3 A resolution. The tetramer is a dimer of dimers. Despite very similar dimer topology, there are two major differences from G6PD of Leuconostoc mesenteroides: a structural NADP(+) molecule, close to the dimer interface but integral to the subunit, is visible in all subunits of the human enzyme; and an intrasubunit disulphide bond tethers the otherwise disordered N-terminal segment. The few dimer-dimer contacts making the tetramer are charge-charge interactions. The importance of NADP(+) for stability is explained by the structural NADP(+) site, which is not conserved in prokaryotes. The structure shows that point mutations causing severe deficiency predominate close to the structural NADP(+) and the dimer interface, primarily affecting the stability of the molecule. They also indicate that a stable dimer is essential to retain activity in vivo. As there is an absolute requirement for some G6PD activity, residues essential for coenzyme or substrate binding are rarely modified.

  3. Primaquine ineligibility in anti-relapse therapy of Plasmodium vivax malaria: the problem of G6PD deficiency and cytochrome P-450 2D6 polymorphisms.

    PubMed

    Baird, J Kevin; Battle, Katherine E; Howes, Rosalind E

    2018-01-22

    The hypnozoite reservoir of Plasmodium vivax represents both the greatest obstacle and opportunity for ultimately eradicating this species. It is silent and cannot be diagnosed until it awakens and provokes a clinical attack with attendant morbidity, risk of mortality, and opportunities for onward transmission. The only licensed drug that kills hypnozoites is primaquine, which attacks the hypnozoite reservoir but imposes serious obstacles in doing so-at hypnozoitocidal doses, it invariably causes a threatening acute haemolytic anaemia in patients having an inborn deficiency in glucose-6-phosphate dehydrogenase (G6PD), affecting about 8% of people living in malaria endemic nations. That problem excludes a large number of people from safe and effective treatment of the latent stage of vivax malaria: the G6PD deficient, pregnant or lactating women, and young infants. These groups were estimated to comprise 14.3% of populations resident in the 95 countries with endemic vivax malaria. Another important obstacle regarding primaquine in the business of killing hypnozoites is its apparent metabolism to an active metabolite exclusively via cytochrome P-450 isozyme 2D6 (CYP2D6). Natural polymorphisms of this allele create genotypes expressing impaired enzymes that occur in over 20% of people living in Southeast Asia, where more than half of P. vivax infections occur globally. Taken together, the estimated frequencies of these primaquine ineligibles due to G6PD toxicity or impaired CYP2D6 activity composed over 35% of the populations at risk of vivax malaria. Much more detailed work is needed to refine these estimates, derive probabilities of error for them, and improve their ethnographic granularity in order to inform control and elimination strategy and tactics.

  4. Long-term response to sulfonylurea in a patient with diabetes due to mutation in the KCNJ11 gene.

    PubMed

    Vendramini, Marcio F; Gurgel, Lucimary C; Moisés, Regina S

    2010-11-01

    To report the long-term (30-month) effect of the switch from insulin to sulfonylurea in a patient carrying the p.G53D (c.158G>A) mutation in KCNJ11 gene. A 29-year-old male patient was diagnosed with diabetes in the third month of life and after identification of a heterozygous p.G53D mutation in the KCNJ11 gene, the therapy was switched from insulin to sulfonylurea. Long-term follow-up (30 months) showed that good metabolic control was maintained (HbA1c: 6.6%) and the glibenclamide dose could be reduced. Long-term therapy with sulfonylureas in patients with neonatal diabetes due to mutation in the KCNJ11 gene is safe and promotes sustained improvement of glycemic control.

  5. Mutation and virulence assessment of chromosomal genes of Rhodococcus equi 103.

    PubMed

    Pei, Yanlong; Parreira, Valeria; Nicholson, Vivian M; Prescott, John F

    2007-01-01

    Rhodococcus equi can cause severe or fatal pneumonia in foals as well as in immunocompromised animals and humans. Its ability to persist in macrophages is fundamental to how it causes disease, but the basis of this is poorly understood. To examine further the general application of a recently developed system of targeted gene mutation and to assess the importance of different genes in resistance to innate immune defenses, we disrupted the genes encoding high-temperature requirement A (htrA), nitrate reductase (narG), peptidase D (pepD), phosphoribosylaminoimidazole-succinocarboxamide synthase (purC), and superoxide dismutase (sodC) in strain 103 of R. equi using a double-crossover homologous recombination approach. Virulence testing by clearance after intravenous injection in mice showed that the htrA and narG mutants were fully attenuated, the purC and sodC mutants were unchanged, and the pepD mutant was slightly attenuated. Complementation with the pREM shuttle plasmid restored the virulence of the htrA and pepD mutants but not that of the narG mutant. A single-crossover mutation approach was simpler and faster than the double-crossover homologous recombination technique and was used to obtain mutations in 6 other genes potentially involved in virulence (clpB, fadD8, fbpB, glnA1, regX3, and sigF). These mutants were not attenuated in the mouse clearance assay. We were not able to obtain mutants for genesfurA, galE, and sigE using the single-crossover mutation approach. In summary, the targeted-mutation system had general applicability but was not always completely successful, perhaps because some genes are essential under the growth conditions used or because the success of mutation depends on the target genes.

  6. Inducing indel mutation in the SOX6 gene by zinc finger nuclease for gamma reactivation: An approach towards gene therapy of beta thalassemia.

    PubMed

    Modares Sadeghi, Mehran; Shariati, Laleh; Hejazi, Zahra; Shahbazi, Mansoureh; Tabatabaiefar, Mohammad Amin; Khanahmad, Hossein

    2018-03-01

    β-thalassemia is a common autosomal recessive disorder characterized by a deficiency in the synthesis of β-chains. Evidences show that increased HbF levels improve the symptoms in patients with β-thalassemia or sickle cell anemia. In this study, ZFN technology was applied to induce a mutation in the binding domain region of SOX6 to reactivate γ-globin expression. The sequences coding for ZFP arrays were designed and sub cloned in TDH plus as a transfer vector. The ZFN expression was confirmed using Western blot analysis. In the next step, using the site-directed mutagenesis strategy through the overlap PCR, a missense mutation (D64V) was induced in the catalytic domain of the integrase gene in the packaging plasmid and verified using DNA sequencing. Then, the integrase minus lentivirus containing ZFN cassette was packaged. Transduction of K562 cells with this virus was performed. Mutation detection assay was performed. The indel percentage of the cells transducted with lenti virus containing ZFN was 31%. After 5 days of erythroid differentiation with 15 μg/mL cisplatin, the levels of γ-globin mRNA were sixfold in the cells treated with ZFN compared to untreated cells. In the meantime, the measurement of HbF expression levels was carried out using hemoglobin electrophoresis and showed the same results. Integrase minus lentivirus can provide a useful tool for efficient transient gene expression and helps avoid disadvantages of gene targeting using the native virus. The ZFN strategy applied here to induce indel on SOX6 gene in adult erythroid progenitors may provide a method to activate fetal hemoglobin expression in individuals with β-thalassemia. © 2017 Wiley Periodicals, Inc.

  7. Prevalence of 1691G>A FV mutation in females from Bosnia and Herzegovina - a preliminary report

    PubMed Central

    Yaljevac, Amina; Mehić, Bakir; Kiseljaković, Emina; Ibrulj, Slavka; Garstka, Agnieszka; Adler, Grazyna

    2013-01-01

    Factor V is the liver-synthesized multidomain glycoprotein encoded by a gene localised on chromosome 1q23. The point mutation 1691G>A in this gene results in formation of an altered protein of V Factor resistant to activated protein C (APC) cleavage. This mutation alone is the most frequent cause of inborn thrombophilia and the most widely acknowledged genetic risk factor for venous thrombosis in a Caucasian population. This study was designed to provide the first estimate of the frequency of the allele 1691A FV in the Bosnian female population. The 1691G>A FV mutation was examined by polymerase chain reaction-restriction fragment length polymorphism, in a group of 67 women, mean age of 58.6 years with no history of cardiovascural incident. Our findings revealed an absence of the mutated allele 1691A FV in the studied group. This is the first report on the 1691G>A FV mutation in a population from Bosnia and Herzegovina. Further research is needed to establish prevalence of the mutated allele in the population from Bosnia and Herzegovina. PMID:23448608

  8. Coinheritance of a novel mutation on the HBA1 gene: c.187delG (p.W62fsX66) [codon 62 (-G) (α1)] with the α212 patchwork allele and Hb S [β6(A3)Glu→Val, GAG>GTG; HBB: c.20A>T].

    PubMed

    Scheps, Karen G; De Paula, Silvia M; Bitsman, Alicia R; Freigeiro, Daniel H; Basack, F Nora; Pennesi, Sandra P; Varela, Viviana

    2013-01-01

    We describe a novel frameshift mutation on the HBA1 gene (c.187delG), causative of α-thalassemia (α-thal) in a Black Cuban family with multiple sequence variants in the HBA genes and the Hb S [β6(A3)Glu→Val, GAG>GTG; HBB: c.20A>T] mutation. The deletion of the first base of codon 62 resulted in a frameshift at amino acid 62 with a putative premature termination codon (PTC) at amino acid 66 on the same exon (p.W62fsX66), which most likely triggers nonsense mediated decay of the resulting mRNA. This study also presents the first report of the α212 patchwork allele in Latin America and the description of two new sequence variants in the HBA2 region (c.-614G>A in the promoter region and c.95+39 C>T on the first intron).

  9. CSF Nrf2 and HSPA8 in Parkinson's disease patients with and without LRRK2 gene mutations.

    PubMed

    Loeffler, David A; Smith, Lynnae M; Coffey, Mary P; Aasly, Jan O; LeWitt, Peter A

    2016-03-01

    Leucine-rich repeat kinase 2 (LRRK2) gene mutations are the most common genetic cause of Parkinson's disease (PD). CSF specimens from LRRK2 + PD patients and healthy LRRK2 mutation carriers are, therefore, useful for biomarker studies. This study examined the hypothesis that differences are present between subjects with sporadic PD (sPD), PD carriers of LRRK2 mutations (LRRK2 + PD), healthy control subjects lacking LRRK2 mutations (CTL), and LRRK2 mutation-carrying healthy controls (LRRK2 + CTL) for CSF concentrations of six potential PD biomarkers. Two of these proteins, nuclear factor (erythroid-derived 2)-like 2 ("Nrf2") and heat shock 70 kDa protein 8 ("HSPA8"), were detected in preliminary ELISAs, then measured in a larger cohort (60 sPD, 10 LRRK2 + PD, 23 CTL, 31 LRRK2 + CTL). No statistically significant differences were found between the groups (Nrf2 p = 0.13, HSPA8 p = 0.21). Nrf2 concentrations in LRRK2 + PD subjects were strongly positively associated with Unified Parkinson's Disease Rating Scale (UPDRS) total and motor scores [Spearman rho = 0.77 (p = 0.012) and 0.83 (p = 0.005)] and negatively associated with Montreal Cognitive Assessment (MoCA) scores (rho = -0.57; p = 0.11). Partial correlation coefficient calculations indicated that disease duration contributed to the associations of Nrf2 levels with UPDRS scores and with MoCA scores in this group. While CSF Nrf2 and HSPA8 do not appear to offer diagnostic biomarkers for PD, the associations between Nrf2 levels and UPDRS scores in LRRK2 + PD patients merit further investigation.

  10. Homozygosity Mapping and Whole Exome Sequencing to Detect SLC45A2 and G6PC3 Mutations in a Single Patient with Oculocutaneous Albinism and Neutropenia

    PubMed Central

    Cullinane, Andrew R.; Vilboux, Thierry; O’Brien, Kevin; Curry, James A.; Maynard, Dawn M.; Carlson-Donohoe, Hannah; Ciccone, Carla; Markello, Thomas C.; Gunay-Aygun, Meral; Huizing, Marjan; Gahl, William A.

    2011-01-01

    We evaluated a 32 year-old woman whose oculocutaneous albinism, bleeding diathesis, neutropenia, and history of recurrent infections prompted consideration of the diagnosis of Hermansky-Pudlak syndrome type 2 (HPS-2). This was ruled out due to the presence of platelet delta granules and absence of AP3B1 mutations. Since parental consanguinity suggested an autosomal recessive mode of inheritance, we employed homozygosity mapping, followed by whole exome sequencing, to identify two candidate disease-causing genes, SLC45A2 and G6PC3. Conventional di-deoxy sequencing confirmed pathogenic mutations in SLC45A2, associated with oculocutaneous albinism type 4 (OCA-4), and G6PC3, associated with neutropenia. The substantial reduction of SLC45A2 protein in the patient’s melanocytes caused the mis-localization of tyrosinase from melanosomes to the plasma membrane and also led to the incorporation of tyrosinase into exosomes and secretion into the culture medium, explaining the hypopigmentation in OCA-4. Our patient’s G6PC3 mRNA expression level was also reduced, leading to increased apoptosis of her fibroblasts under ER stress. This report describes the first North American patient with OCA-4, the first culture of human OCA-4 melanocytes, and the use of homozygosity mapping followed by whole exome sequencing to identify disease-causing mutations in multiple genes in a single affected individual. PMID:21677667

  11. Fabry disease: Evidence for a regional founder effect of the GLA gene mutation 30delG in Brazilian patients.

    PubMed

    de Alencar, Dayse Oliveira; Netto, Cristina; Ashton-Prolla, Patricia; Giugliani, Roberto; Ribeiro-Dos-Santos, Ândrea; Pereira, Fernanda; Matte, Ursula; Santos, Ney; Santos, Sidney

    2014-01-01

    The Fabry disease is caused by mutations in the gene ( GLA ) that encodes the enzyme α-galactosidase A (α-Gal A). More than 500 pathologic variants of GLA have already been described, most of them are family-specific. In southern Brazil, a frequent single-base deletion ( GLA 30delG) was identified among four families that do not recognize any common ancestral. In order to investigate the history of this mutation (investigate the founder effect, estimate the mutation age and the most likely source), six gene-flanking microsatellite markers of the X chromosome on the mutation carriers and their parents, 150 individuals from the same population and 300 individuals that compose the Brazilian parental populations (Europeans, Africans and Native Americans) were genotyped. A common haplotype to the four families was identified and characterized as founder. The age was estimated with two statistics software (DMLE 2.2 and ESTIAGE) that agreed with 11 to 12 generations old. This result indicates that the mutation GLA 30delG was originated from a single event on the X chromosome of a European immigrant, during the southern Brazil colonization between 1710 and 1740.

  12. Transcriptional alterations in skin fibroblasts from Parkinson's disease patients with parkin mutations.

    PubMed

    González-Casacuberta, Ingrid; Morén, Constanza; Juárez-Flores, Diana-Luz; Esteve-Codina, Anna; Sierra, Cristina; Catalán-García, Marc; Guitart-Mampel, Mariona; Tobías, Ester; Milisenda, José César; Pont-Sunyer, Claustre; Martí, María José; Cardellach, Francesc; Tolosa, Eduard; Artuch, Rafael; Ezquerra, Mario; Fernández-Santiago, Rubén; Garrabou, Glòria

    2018-05-01

    Mutations in the parkin gene (PRKN) are the most common cause of autosomal-recessive juvenile Parkinson's disease (PD). PRKN encodes an E3 ubiquitin ligase that is involved in multiple regulatory functions including proteasomal-mediated protein turnover, mitochondrial function, mitophagy, and cell survival. However, the precise molecular events mediated by PRKN mutations in PRKN-associated PD (PRKN-PD) remain unknown. To elucidate the cellular impact of parkin mutations, we performed an RNA sequencing study in skin fibroblasts from PRKN-PD patients carrying different PRKN mutations (n = 4) and genetically unrelated healthy subjects (n = 4). We identified 343 differentially expressed genes in PRKN-PD fibroblasts. Gene ontology and canonical pathway analysis revealed enrichment of differentially expressed genes in processes such as cell adhesion, cell growth, and amino acid and folate metabolism among others. Our findings indicate that PRKN mutations are associated with large global gene expression changes as observed in fibroblasts from PRKN-PD patients and support the view of PD as a systemic disease affecting also non-neural peripheral tissues such as the skin. Copyright © 2018 Elsevier Inc. All rights reserved.

  13. Rationale for recommending a lower dose of primaquine as a Plasmodium falciparum gametocytocide in populations where G6PD deficiency is common

    PubMed Central

    2012-01-01

    In areas of low malaria transmission, it is currently recommended that a single dose of primaquine (0.75 mg base/kg; 45 mg adult dose) be added to artemisinin combination treatment (ACT) in acute falciparum malaria to block malaria transmission. Review of studies of transmission-blocking activity based on the infectivity of patients or volunteers to anopheline mosquitoes, and of haemolytic toxicity in glucose 6-dehydrogenase (G6PD) deficient subjects, suggests that a lower primaquine dose (0.25 mg base/kg) would be safer and equally effective. This lower dose could be deployed together with ACTs without G6PD testing wherever use of a specific gametocytocide is indicated. PMID:23237606

  14. Plasmodium falciparum clearance with artemisinin-based combination therapy (ACT) in patients with glucose-6-phosphate dehydrogenase deficiency in Mali

    PubMed Central

    2010-01-01

    Background Artemisinin-based combination therapy (ACT) is currently the most effective medicine for the treatment of uncomplicated malaria. Artemisinin has previously been shown to increase the clearance of Plasmodium falciparum in malaria patients with haemoglobin E trait, but it did not increase parasite inhibition in an in vitro study using haemoglobin AS erythrocytes. The current study describes the efficacy of artemisinin derivatives on P. falciparum clearance in patients with glucose-6-phosphate dehydrogenase deficiency (G6PD), a haemoglobin enzyme deficiency, not yet studied in the same context, but nonetheless is a common in malaria endemic areas, associated with host protection against uncomplicated and severe malaria. The impact of G6PD deficiency on parasite clearance with ACT treatment was compared between G6PD-deficient patients and G6PD-normal group. Methods Blood samples from children and adults participants (1 to 70 years old) with uncomplicated P. falciparum malaria residing in Kambila, Mali were analysed. Study participants were randomly assigned to receive either artemether-lumefantrine (Coartem®) or artesunate plus mefloquine (Artequin™). A restriction-fragment length polymorphism analysis of PCR-amplified DNA samples was used to identify the (A-) allele of the gene mutation responsible for G6PD deficiency (G6PD*A-). 470 blood samples were thus analysed and of these, DNA was extracted from 315 samples using the QIAamp kit for PCR to identify the G6PD*A- gene. Results The DNA amplified from 315 samples using PCR showed that G6PD*A- deficiency was present in 56 participants (17.8%). The distribution of the specific deficiency was 1%, 7% and, 9.8% respectively for homozygous, hemizygous, and heterozygous genotypes. Before treatment, the median parasitaemia and other baseline characteristics (mean haemoglobin, sex and age groups) between G6PD deficiency (hemizygous, heterozygous, and homozygous) and G6PD-normal participants were comparable (p > 0

  15. Plasmodium falciparum clearance with artemisinin-based combination therapy (ACT) in patients with glucose-6-phosphate dehydrogenase deficiency in Mali.

    PubMed

    Kone, Abdoulaye K; Sagara, Issaka; Thera, Mahamadou A; Dicko, Alassane; Guindo, Aldiouma; Diakite, Seidina; Kurantsin-Mills, Joseph; Djimde, Abdoulaye; Walcourt, Asikiya; Doumbo, Ogabara

    2010-11-21

    Artemisinin-based combination therapy (ACT) is currently the most effective medicine for the treatment of uncomplicated malaria. Artemisinin has previously been shown to increase the clearance of Plasmodium falciparum in malaria patients with haemoglobin E trait, but it did not increase parasite inhibition in an in vitro study using haemoglobin AS erythrocytes. The current study describes the efficacy of artemisinin derivatives on P. falciparum clearance in patients with glucose-6-phosphate dehydrogenase deficiency (G6PD), a haemoglobin enzyme deficiency, not yet studied in the same context, but nonetheless is a common in malaria endemic areas, associated with host protection against uncomplicated and severe malaria. The impact of G6PD deficiency on parasite clearance with ACT treatment was compared between G6PD-deficient patients and G6PD-normal group. Blood samples from children and adults participants (1 to 70 years old) with uncomplicated P. falciparum malaria residing in Kambila, Mali were analysed. Study participants were randomly assigned to receive either artemether-lumefantrine (Coartem®) or artesunate plus mefloquine (Artequin™). A restriction-fragment length polymorphism analysis of PCR-amplified DNA samples was used to identify the (A-) allele of the gene mutation responsible for G6PD deficiency (G6PD*A-). 470 blood samples were thus analysed and of these, DNA was extracted from 315 samples using the QIAamp kit for PCR to identify the G6PD*A- gene. The DNA amplified from 315 samples using PCR showed that G6PD*A- deficiency was present in 56 participants (17.8%). The distribution of the specific deficiency was 1%, 7% and, 9.8% respectively for homozygous, hemizygous, and heterozygous genotypes. Before treatment, the median parasitaemia and other baseline characteristics (mean haemoglobin, sex and age groups) between G6PD deficiency (hemizygous, heterozygous, and homozygous) and G6PD-normal participants were comparable (p > 0.05). After treatment

  16. Mutation update for the CSB/ERCC6 and CSA/ERCC8 genes involved in Cockayne syndrome.

    PubMed

    Laugel, V; Dalloz, C; Durand, M; Sauvanaud, F; Kristensen, U; Vincent, M C; Pasquier, L; Odent, S; Cormier-Daire, V; Gener, B; Tobias, E S; Tolmie, J L; Martin-Coignard, D; Drouin-Garraud, V; Heron, D; Journel, H; Raffo, E; Vigneron, J; Lyonnet, S; Murday, V; Gubser-Mercati, D; Funalot, B; Brueton, L; Sanchez Del Pozo, J; Muñoz, E; Gennery, A R; Salih, M; Noruzinia, M; Prescott, K; Ramos, L; Stark, Z; Fieggen, K; Chabrol, B; Sarda, P; Edery, P; Bloch-Zupan, A; Fawcett, H; Pham, D; Egly, J M; Lehmann, A R; Sarasin, A; Dollfus, H

    2010-02-01

    Cockayne syndrome is an autosomal recessive multisystem disorder characterized principally by neurological and sensory impairment, cachectic dwarfism, and photosensitivity. This rare disease is linked to mutations in the CSB/ERCC6 and CSA/ERCC8 genes encoding proteins involved in the transcription-coupled DNA repair pathway. The clinical spectrum of Cockayne syndrome encompasses a wide range of severity from severe prenatal forms to mild and late-onset presentations. We have reviewed the 45 published mutations in CSA and CSB to date and we report 43 new mutations in these genes together with the corresponding clinical data. Among the 84 reported kindreds, 52 (62%) have mutations in the CSB gene. Many types of mutations are scattered along the whole coding sequence of both genes, but clusters of missense mutations can be recognized and highlight the role of particular motifs in the proteins. Genotype-phenotype correlation hypotheses are considered with regard to these new molecular and clinical data. Additional cases of molecular prenatal diagnosis are reported and the strategy for prenatal testing is discussed. Two web-based locus-specific databases have been created to list all identified variants and to allow the inclusion of future reports (www.umd.be/CSA/ and www.umd.be/CSB/). (c) 2009 Wiley-Liss, Inc.

  17. Data mining and pathway analysis of glucose-6-phosphate dehydrogenase with natural language processing.

    PubMed

    Chen, Long; Zhang, Chunhua; Wang, Yanling; Li, Yuqian; Han, Qiaoqiao; Yang, Huixin; Zhu, Yuechun

    2017-08-01

    Human glucose-6-phosphate dehydrogenase (G6PD) is a crucial enzyme in the pentose phosphate pathway, and serves an important role in biosynthesis and the redox balance. G6PD deficiency is a major cause of neonatal jaundice and acute hemolyticanemia, and recently, G6PD has been associated with diseases including inflammation and cancer. The aim of the present study was to conduct a search of the National Center for Biotechnology Information PubMed library for articles discussing G6PD. Genes that were identified to be associated with G6PD were recorded, and the frequency at which each gene appeared was calculated. Gene ontology (GO), pathway and network analyses were then performed. A total of 98 G6PD‑associated genes and 33 microRNAs (miRNAs) that potentially regulate G6PD were identified. The 98 G6PD‑associated genes were then sub‑classified into three functional groups by GO analysis, followed by analysis of function, pathway, network, and disease association. Out of the 47 signaling pathways identified, seven were significantly correlated with G6PD‑associated genes. At least two out of four independent programs identified the 33 miRNAs that were predicted to target G6PD. miR‑1207‑5P, miR‑1 and miR‑125a‑5p were predicted by all four software programs to target G6PD. The results of the present study revealed that dysregulation of G6PD was associated with cancer, autoimmune diseases, and oxidative stress‑induced disorders. These results revealed the potential roles of G6PD‑regulated signaling and metabolic pathways in the etiology of these diseases.

  18. DHPLC-based mutation analysis of ENG and ALK-1 genes in HHT Italian population.

    PubMed

    Lenato, Gennaro M; Lastella, Patrizia; Di Giacomo, Marilena C; Resta, Nicoletta; Suppressa, Patrizia; Pasculli, Giovanna; Sabbà, Carlo; Guanti, Ginevra

    2006-02-01

    Hereditary haemorrhagic telangiectasia (HHT or Rendu-Osler-Weber syndrome) is an autosomal dominant disorder characterized by localized angiodysplasia due to mutations in endoglin, ALK-1 gene, and a still unidentified locus. The lack of highly recurrent mutations, locus heterogeneity, and the presence of mutations in almost all coding exons of the two genes makes the screening for mutations time-consuming and costly. In the present study, we developed a DHPLC-based protocol for mutation detection in ALK1 and ENG genes through retrospective analysis of known sequence variants, 20 causative mutations and 11 polymorphisms, and a prospective analysis on 47 probands with unknown mutation. Overall DHPLC analysis identified the causative mutation in 61 out 66 DNA samples (92.4%). We found 31 different mutations in the ALK1 gene, of which 15 are novel, and 20, of which 12 are novel, in the ENG gene, thus providing for the first time the mutational spectrum in a cohort of Italian HHT patients. In addition, we characterized the splicing pattern of ALK1 gene in lymphoblastoid cells, both in normal controls and in two individuals carrying a mutation in the non-invariant -3 position of the acceptor splice site upstream exon 6 (c.626-3C>G). Functional essay demonstrated the existence, also in normal individuals, of a small proportion of ALK1 alternative splicing, due to exon 5 skipping, and the presence of further aberrant splicing isoforms in the individuals carrying the c.626-3C>G mutation. 2006 Wiley-Liss, Inc.

  19. [Gene mutation analysis of X-linked hypophosphatemic rickets].

    PubMed

    Song, Ying; Ma, Hong-Wei; Li, Fang; Hu, Man; Ren, Shuang; Yu, Ya-Fen; Zhao, Gui-Jie

    2013-11-01

    To investigate the frequency and type of PHEX gene mutations in children with X-linked hypophosphatemic rickets (XLH), the possible presence of mutational hot spots, and the relationship between genotype and clinical phenotype. Clinical data of 10 children with XLH was retrospectively reviewed. The relationship between gene mutation type and severity of XLH was evaluated. PHEX gene mutations were detected in all 10 children with XLH, including 6 cases of missense mutation, 2 cases of splice site mutation, 1 case of frameshift mutation, and 1 case of nonsense mutation. Two new mutations, c.2048T>C and IVS14+1delAG, were found. The type of PHEX gene mutation was not associated with the degree of short stature and leg deformity (P=0.571 and 0.467), and the mutation site was also not associated with the degree of short stature and leg deformity (P=0.400 and 1.000). Missense mutation is the most common type of PHEX gene mutation in children with XLH, and c.2048T>C and IVS14+1delAG are two new PHEX gene mutations. The type and site of PHEX gene mutation are not associated with the severity of XLH.

  20. Incidence and molecular characterization of Glucose-6-Phosphate Dehydrogenase deficiency among neonates for newborn screening in Chaozhou, China.

    PubMed

    Yang, H; Wang, Q; Zheng, L; Zhan, X-F; Lin, M; Lin, F; Tong, X; Luo, Z-Y; Huang, Y; Yang, L-Y

    2015-06-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is highly prevalent in southern China. The aim of this study is to assess the extent of this disease in Chinese neonates and determine its molecular characteristics using a novel molecular screening method. A total of 2500 neonates were routinely screened for G6PD deficiency using a modified fluorescent spot test (FST). PCR-high-resolution melting (HRM) analysis was then used for the molecular assay. The overall incidence of G6PD deficiency was 2.68% in our study cohort. Frequency in male population was 3.22% (44 neonates of 1365 male neonates), and in female population was 2.03% (23 neonates of 1135 female neonates). Of the 67 newborns suspected to be G6PD deficient based on FST (44 males, 23 females), 58 of 67 (87%) were detected with gene alterations. Seven kinds of mutations [c.95A>G, c.392G>T, c.493A>G, c.871G>A, c.1360C>T, c.1376G>T, and c.1388G>A] were identified by HRM analysis. Routine newborn screening in Chaozhou, China with a relatively high prevalence of G6PD deficiency is justified and meets the World Health Organization recommendation. The usage of molecular diagnosis can favor the detection of heterozygotes which can be a supplement to regular newborn screening and useful for premarital and prenatal diagnosis for G6PD deficiency. © 2014 John Wiley & Sons Ltd.

  1. Locus-Specific Mutation Databases for Neurodegenerative Brain Diseases

    PubMed Central

    Cruts, Marc; Theuns, Jessie; Van Broeckhoven, Christine

    2012-01-01

    The Alzheimer disease and frontotemporal dementia (AD&FTLD) and Parkinson disease (PD) Mutation Databases make available curated information of sequence variations in genes causing Mendelian forms of the most common neurodegenerative brain disease AD, frontotemporal lobar degeneration (FTLD), and PD. They are established resources for clinical geneticists, neurologists, and researchers in need of comprehensive, referenced genetic, epidemiologic, clinical, neuropathological, and/or cell biological information of specific gene mutations in these diseases. In addition, the aggregate analysis of all information available in the databases provides unique opportunities to extract mutation characteristics and genotype–phenotype correlations, which would be otherwise unnoticed and unexplored. Such analyses revealed that 61.4% of mutations are private to one single family, while only 5.7% of mutations occur in 10 or more families. The five mutations with most frequent independent observations occur in 21% of AD, 43% of FTLD, and 48% of PD families recorded in the Mutation Databases, respectively. Although these figures are inevitably biased by a publishing policy favoring novel mutations, they probably also reflect the occurrence of multiple rare and few relatively common mutations in the inherited forms of these diseases. Finally, with the exception of the PD genes PARK2 and PINK1, all other genes are associated with more than one clinical diagnosis or characteristics thereof. Hum Mutat 33:1340–1344, 2012. © 2012 Wiley Periodicals, Inc. PMID:22581678

  2. Novel recurrently mutated genes in African American colon cancers.

    PubMed

    Guda, Kishore; Veigl, Martina L; Varadan, Vinay; Nosrati, Arman; Ravi, Lakshmeswari; Lutterbaugh, James; Beard, Lydia; Willson, James K V; Sedwick, W David; Wang, Zhenghe John; Molyneaux, Neil; Miron, Alexander; Adams, Mark D; Elston, Robert C; Markowitz, Sanford D; Willis, Joseph E

    2015-01-27

    We used whole-exome and targeted sequencing to characterize somatic mutations in 103 colorectal cancers (CRC) from African Americans, identifying 20 new genes as significantly mutated in CRC. Resequencing 129 Caucasian derived CRCs confirmed a 15-gene set as a preferential target for mutations in African American CRCs. Two predominant genes, ephrin type A receptor 6 (EPHA6) and folliculin (FLCN), with mutations exclusive to African American CRCs, are by genetic and biological criteria highly likely African American CRC driver genes. These previously unsuspected differences in the mutational landscapes of CRCs arising among individuals of different ethnicities have potential to impact on broader disparities in cancer behaviors.

  3. [NOTCH3 gene mutations in two Chinese families featuring cerebral autosomal dominant arteriopathy with subcortical infarct and leucoencephalopathy].

    PubMed

    Sun, Qiying; Li, Wenwen; Zhou, Yafang; Yi, Fang; Wang, Jianfeng; Hu, Yacen; Yao, Lingyan; Zhou, Lin; Xu, Hongwei

    2017-12-10

    To analyze potential mutations of the NOTCH3 gene in two Chinese families featuring cerebral autosomal dominant arteriopathy with subcortical infarct and leucoencephalopathy (CADASIL). The two probands and related family members and 100 healthy controls were recruited. Potential mutations of the NOTCH3 gene were screened by PCR and direct sequencing. PolyPhen-2 and SIFT software were used to predict the protein function. The conditions of both probands were adult-onset, with main clinical features including recurrent transient ischemic attacks and/or strokes, cognitive impairment. MRI findings suggested multiple cerebral infarcts and severe leukoencephalopathy. A heterozygous mutation c.328C>T (p.Arg110Cys), which was located in exon 3 of the NOTCH3 gene and known as a causative mutation, was identified in proband 1. A novel heterozygous mutation c.1013 G>C (p.Cys338Ser) located in exon 6 of the NOTCH3 gene was identified in the proband 2, which was not reported previously. The same mutations were not detected among the 100 unrelated healthy controls. Function analysis suggested that heterozygous mutation c.1013G>C can severely affect the functions of NOTCH3 protein. Two heterozygous missense mutations in the NOTCH3 gene have been identified in two families affected with CADASIL. The novel heterozygous Cys338Ser mutation in exon 6 of the NOTCH3 gene probably underlies the CADASIL.

  4. Novel Compound Heterozygous CLCNKB Gene Mutations (c.1755A>G/ c.848_850delTCT) Cause Classic Bartter Syndrome.

    PubMed

    Wang, Chunli; Chen, Ying; Zheng, Bixia; Zhu, Mengshu; Fan, Jia; Wang, Juejin; Jia, Zhanjun; Huang, Songming; Zhang, Aihua

    2018-02-14

    Inactivated variants in CLCNKB gene encoding the basolateral chloride channel ClC-Kb cause classic Bartter syndrome characterized by hypokalemic metabolic alkalosis and hyperreninemic hyperaldosteronism. Here we identified two cBS siblings presenting hypokalemia in a Chinese family due to novel compound heterozygous CLCNKB mutations (c.848_850delTCT/c.1755A>G). Compound heterozygosity was confirmed by amplifying and sequencing the patient's genomic DNA. The synonymous mutation c.1755A>G (Thr585Thr) was located at +2bp from the 5' splice donor site in exon 15, further transcript analysis demonstrated that this single nucleotide mutation causes exclusion of exon 15 in the cDNA from the proband and his mother. Furthermore, we investigated the expression and protein trafficking change of c.848_850delTCT (TCT) and exon 15 deletion(E15)mutation in vitro. The E15 mutation markedly decreased the expression of ClC-Kb and resulted in a low-molecular-weight band (~55kD) trapping in the endoplasmic reticulum, while the TCT mutant only decreased the total and plasma membrane ClC-Kb protein expression but did not affect the subcellular localization. Finally, we studied the physiological functions of mutations by using whole-cell patch clamp and found that E15 or TCT mutation decreased the current of ClC-Kb/barttin channel. These results suggested that the compound defective mutations of CLCNKB gene are the molecular mechanism of the two cBS siblings.

  5. Analysis of mutational characteristics of the drug-resistant gene katG in multi-drug resistant Mycobacterium tuberculosis L-form among patients with pneumoconiosis complicated with tuberculosis.

    PubMed

    Lu, Jun; Jiang, Shan; Liu, Qian-Ying; Ma, Shuai; Li, Ying; Li, Chao-Pin

    2014-05-01

    The aim of the present study was to investigate the mutational characteristics of drug‑resistant genetic mutations in the katG gene to isoniazid (INH) in multi‑drug resistant Mycobacterium tuberculosis (MTB) L‑form among patients with pneumoconiosis complicated with tuberculosis (TB), in order to reduce the occurrence of drug resistance in patients, and gain further insight into the mechanisms underlying drug resistance in MDR‑TB L‑form. A total of 114 clinically isolated strains of MTB L‑forms were collected. The MDR‑TB L‑forms were identified using a conventional antimicrobial susceptibility test (AST). The DNA genomes were extracted, the target genes were amplified by polymerase chain reaction technology and the hotspot mutational regions in the katG gene were analyzed by direct sequencing. The results of AST analysis demonstrated that there were 31 strains of MDR‑TB L‑forms in 114 clinical isolates. The mutation rate of katG was 61.29% (19/31) in INH‑resistant isolates, mainly concentrated in codon 315 (Ser315Thr, 48.39% and Ser315Asn, 9.68%) and 431 (Ala431Val, 3.23%). Base substitutions were identified, however, no multisite mutations were found. No mutations in katG were identified in 10 INH‑sensitive strains that were randomly selected. INH‑resistance was more severe in MDR‑TB L‑form isolates among patients with pneumoconiosis complicated with TB. The substitution of highly conserved amino acids encoded by the katG gene resulted in the molecular mechanisms responsible for INH resistance in MDR‑TB L‑form isolates. It was also verified that the katG gene was in diversiform. The katG Ser315Thr mutation is one of the main causes of resistance to INH in MDR‑TB L-form isolates.

  6. Glucose-6-Phosphate Dehydrogenase Deficiency Mimicking Atypical Hemolytic Uremic Syndrome.

    PubMed

    Walsh, Patrick R; Johnson, Sally; Brocklebank, Vicky; Salvatore, Jacobo; Christian, Martin; Kavanagh, David

    2018-02-01

    A 4-year-old boy presented with nonimmune hemolysis, thrombocytopenia, and acute kidney injury. Investigations for an underlying cause failed to identify a definitive cause and a putative diagnosis of complement-mediated atypical hemolytic uremic syndrome (aHUS) was made. The patient was started initially on plasma exchange and subsequently eculizumab therapy, after which his kidney function rapidly improved. While on eculizumab therapy, despite adequate complement blockade, he presented 2 more times with hemolytic anemia and thrombocytopenia, but without renal involvement. Genetic analysis did not uncover a mutation in any known aHUS gene (CFH, CFI, CFB, C3, CD46, THBD, INF2, and DGKE) and anti-factor H antibodies were undetectable. Whole-exome sequencing was undertaken to identify a cause for the eculizumab resistance. This revealed a pathogenic variant in G6PD (glucose-6-phosphate dehydrogenase), which was confirmed by functional analysis demonstrating decreased erythrocyte G6PD activity. Eculizumab therapy was withdrawn. Complement-mediated aHUS is a diagnosis of exclusion and this case highlights the diagnostic difficulty that remains without an immediately available biomarker for confirmation. This case of G6PD deficiency presented with a phenotype clinically indistinguishable from complement-mediated aHUS. We recommend that G6PD deficiency be included in the differential diagnosis of patients presenting with aHUS and suggest measuring erythrocyte G6PD concentrations in these patients. Copyright © 2017. Published by Elsevier Inc.

  7. Both a frameshift and a missense mutation of the STRA6 gene observed in an infant with the Matthew-Wood syndrome.

    PubMed

    Sadowski, Samantha; Chassaing, Nicolas; Gaj, Zuzanna; Czichos, Ewa; Wilczynski, Jan; Nowakowska, Dorota

    2017-03-01

    The Matthew-Wood syndrome is associated with mutations of the STRA6 gene. It combines a pulmonary agenesis/hypoplasia; microphthalmia/anophthalmia; congenital cardiac, digestive, and urogenital malformations; and diaphragmatic defects. A 23-year-old nulliparous woman was referred to our center after a fetal ultrasound examination at 26 weeks of pregnancy revealed an abnormal head shape, a heart malformation, multiple cysts in both kidneys, and dilated ureters. A male baby (46, XY; 3600g; Apgar score 1) was delivered at 38 weeks of gestation and died 1 hr later due to respiratory failure. The diagnosis of Matthew-Wood syndrome was suspected given the association of bilateral anophthalmia, agenesis of the left lung, and heart and kidney defects. It was confirmed by the identification of two deleterious mutations of the STRA6 gene. The child was a compound heterozygote for two previously reported mutations, a paternally inherited missense mutation (c.878C>T [p.Pro293Leu] and a maternally inherited frameshift mutation (c.50_52delACTinsCC [p. Asp17Alafs*55]), producing a premature stop codon. The diagnosis of Matthew-Wood syndrome should be considered in all fetuses with microphthalmia/anophthalmia. It requires an extensive ultrasound/MRI examination of the lung, heart, and diaphragm. Birth Defects Research 109:251-253, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  8. Vascular smooth muscle cell contractile protein expression is increased through protein kinase G-dependent and -independent pathways by glucose-6-phosphate dehydrogenase inhibition and deficiency.

    PubMed

    Chettimada, Sukrutha; Joshi, Sachindra Raj; Dhagia, Vidhi; Aiezza, Alessandro; Lincoln, Thomas M; Gupte, Rakhee; Miano, Joseph M; Gupte, Sachin A

    2016-10-01

    Homeostatic control of vascular smooth muscle cell (VSMC) differentiation is critical for contractile activity and regulation of blood flow. Recently, we reported that precontracted blood vessels are relaxed and the phenotype of VSMC is regulated from a synthetic to contractile state by glucose-6-phosphate dehydrogenase (G6PD) inhibition. In the current study, we investigated whether the increase in the expression of VSMC contractile proteins by inhibition and knockdown of G6PD is mediated through a protein kinase G (PKG)-dependent pathway and whether it regulates blood pressure. We found that the expression of VSMC-restricted contractile proteins, myocardin (MYOCD), and miR-1 and miR-143 are increased by G6PD inhibition or knockdown. Importantly, RNA-sequence analysis of aortic tissue from G6PD-deficient mice revealed uniform increases in VSMC-restricted genes, particularly those regulated by the MYOCD-serum response factor (SRF) switch. Conversely, expression of Krüppel-like factor 4 (KLF4) is decreased by G6PD inhibition. Interestingly, the G6PD inhibition-induced expression of miR-1 and contractile proteins was blocked by Rp-β-phenyl-1,N 2 -etheno-8-bromo-guanosine-3',5'-cyclic monophosphorothioate, a PKG inhibitor. On the other hand, MYOCD and miR-143 levels are increased by G6PD inhibition through a PKG-independent manner. Furthermore, blood pressure was lower in the G6PD-deficient compared with wild-type mice. Therefore, our results suggest that the expression of VSMC contractile proteins induced by G6PD inhibition occurs via PKG1α-dependent and -independent pathways. Copyright © 2016 the American Physiological Society.

  9. Impact of glucocerebrosidase mutations on motor and nonmotor complications in Parkinson's disease.

    PubMed

    Oeda, Tomoko; Umemura, Atsushi; Mori, Yuko; Tomita, Satoshi; Kohsaka, Masayuki; Park, Kwiyoung; Inoue, Kimiko; Fujimura, Harutoshi; Hasegawa, Hiroshi; Sugiyama, Hiroshi; Sawada, Hideyuki

    2015-12-01

    Homozygous mutations of the glucocerebrosidase gene (GBA) cause Gaucher disease (GD), and heterozygous mutations of GBA are a major risk factor for Parkinson's disease (PD). This study examined the impact of GBA mutations on the longitudinal clinical course of PD patients by retrospective cohort design. GBA-coding regions were fully sequenced in 215 PD patients and GD-associated GBA mutations were identified in 19 (8.8%) PD patients. In a retrospective cohort study, time to develop dementia, psychosis, wearing-off, and dyskinesia were examined. Survival time analysis followed a maximum 12-year observation (median 6.0 years), revealing that PD patients with GD-associated mutations developed dementia and psychosis significantly earlier than those without mutations (p < 0.001 and p = 0.017, respectively). Adjusted hazard ratios of GBA mutations were 8.3 for dementia (p < 0.001) and 3.1 for psychosis (p = 0.002). No statistically significant differences were observed for wearing-off and dyskinesia between the groups. N-isopropyl-p[(123)I] iodoamphetamine single-photon emission tomography pixel-by-pixel analysis revealed that regional cerebral blood flow was reduced in the bilateral parietal cortex, including the precuneus of GD-associated mutant PD patients, compared with matched PD controls without mutations. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  10. [Gene IL6 G(-174)C and gene IL10 G(-1082)A polymorphisms are associated with unfavourable outcomes in patients with acute coronary syndrome].

    PubMed

    Blagodatskikh, K A; Evdokimova, M A; Agapkina, Iu V; Nikitin, A G; Brovkin, A N; Pushkov, A A; Blagodatskikh, E G; Kudriasheva, O Iu; Osmolovskaia, V S; Minushkina, L O; Kochkina, M S; Selezneva, N D; Dankovtseva, E N; Chumakova, O S; Baklanova, T N; Talyzin, P A; Reznichenko, N E; Donetskaia, O P; Tereshchenko, S N; Krasil'nikova, E S; Dzhaiani, N A; Akatova, E V; Glezer, M G; Galiavich, A S; Zakirova, V B; Kaziolova, N A; Timofeeva, I V; Iagoda, A V; Boeva, O I; Katel'nitskaia, L I; Khorolets, E V; Shlyk, S V; Volkova, É G; Margarian, M P; Guz', O I; Konstantinov, V O; Timofeeva, N V; Sidorenko, B A; Zateĭshchikov, D A; Nosikov, V V

    2010-01-01

    We investigated the association of gene IL6 G(-174)C polymorphism and gene IL10 G(-1082)A polymorphism with coronary artery disease (CAD) in the Russian population. A total of 1145 patients with CAD diagnose on the basis of clinical studies in cardiological hospitals of Moscow, St -Petersburg, Kazan, Chelyabinsk, Perm, Stavropol and Rostov-on-Don. Supervision term was 9.10 +/- 5.03 months (the maximum term 18 months). In case of gene IL10 G(-1082)A polymorphism we determined that patients with CAD diagnose and A alleles gene IL10 had unfavorable outcome more often than patients with homozygous G alleles. Survival time from end point from carrier genotype GA and AA is 11.68 +/- 0.67 months against 12.69 +/- 0.65 months from carrier phenotype GG gene IL10 (chi2 = 4.13, p = 0.042). The group studied do not differ significantly with respect to the distributions of gene IL6 G(-174)C alleles and genotypes. However in case combined group studies of gene IL10 G(-1082)A polymorphism and IL6 G(-174)C polymorphism we determined that patients with CAD diagnose and carrier genotype GG gene IL6 and genotype GA and AA gene IL10 had unfavorable outcome more often (survival time 11.01 +/- 1.24 months) than patients with genotype CC and CG gene IL6 and genotype GG gene IL10 (survival time 13.28 +/- 0.83 months) chi2 = 10.23, p = 0.017. The obtained data allows assuming the important role of the IL6 and IL10 genes which are responsible for functioning of inflammation system, in the accelerated formation of failures at the patients who had a coronary syndrome.

  11. New splicing-site mutations in the SURF1 gene in Leigh syndrome patients.

    PubMed

    Pequignot, M O; Desguerre, I; Dey, R; Tartari, M; Zeviani, M; Agostino, A; Benelli, C; Fouque, F; Prip-Buus, C; Marchant, D; Abitbol, M; Marsac, C

    2001-05-04

    The gene SURF1 encodes a factor involved in the biogenesis of cytochrome c oxidase, the last complex in the respiratory chain. Mutations of the SURF1 gene result in Leigh syndrome and severe cytochrome c oxidase deficiency. Analysis of seven unrelated patients with cytochrome c oxidase deficiency and typical Leigh syndrome revealed different SURF1 mutations in four of them. Only these four cases had associated demyelinating neuropathy. Three mutations were novel splicing-site mutations that lead to the excision of exon 6. Two different novel heterozygous mutations were found at the same guanine residue at the donor splice site of intron 6; one was a deletion, whereas the other was a transition [588+1G>A]. The third novel splicing-site mutation was a homozygous [516-2_516-1delAG] in intron 5. One patient only had a homozygous polymorphism in the middle of the intron 8 [835+25C>T]. Western blot analysis showed that Surf1 protein was absent in all four patients harboring mutations. Our studies confirm that the SURF1 gene is an important nuclear gene involved in the cytochrome c oxidase deficiency. We also show that Surf1 protein is not implicated in the assembly of other respiratory chain complexes or the pyruvate dehydrogenase complex.

  12. Prevalence and molecular characterization of Glucose-6-Phosphate dehydrogenase deficient variants among the Kurdish population of Northern Iraq.

    PubMed

    Al-Allawi, Nasir; Eissa, Adil A; Jubrael, Jaladet Ms; Jamal, Shakir Ar; Hamamy, Hanan

    2010-07-05

    Glucose-6-Phosphate dehydrogenase (G6PD) is a key enzyme of the pentose monophosphate pathway, and its deficiency is the most common inherited enzymopathy worldwide. G6PD deficiency is common among Iraqis, including those of the Kurdish ethnic group, however no study of significance has ever addressed the molecular basis of this disorder in this population. The aim of this study is to determine the prevalence of this enzymopathy and its molecular basis among Iraqi Kurds. A total of 580 healthy male Kurdish Iraqis randomly selected from a main regional premarital screening center in Northern Iraq were screened for G6PD deficiency using methemoglobin reduction test. The results were confirmed by quantitative enzyme assay for the cases that showed G6PD deficiency. DNA analysis was performed on 115 G6PD deficient subjects, 50 from the premarital screening group and 65 unrelated Kurdish male patients with documented acute hemolytic episodes due to G6PD deficiency. Analysis was performed using polymerase chain reaction/restriction fragment length polymorphism for five deficient molecular variants, namely G6PD Mediterranean (563 C-->T), G6PD Chatham (1003 G-->A), G6PD A- (202 G-->A), G6PD Aures (143 T-->C) and G6PD Cosenza (1376 G-->C), as well as the silent 1311 (C-->T) mutation. Among 580 random Iraqi male Kurds, 63 (10.9%) had documented G6PD deficiency. Molecular studies performed on a total of 115 G6PD deficient males revealed that 101 (87.8%) had the G6PD Mediterranean variant and 10 (8.7%) had the G6PD Chatham variant. No cases of G6PD A-, G6PD Aures or G6PD Cosenza were identified, leaving 4 cases (3.5%) uncharacterized. Further molecular screening revealed that the silent mutation 1311 was present in 93/95 of the Mediterranean and 1/10 of the Chatham cases. The current study revealed a high prevalence of G6PD deficiency among Iraqi Kurdish population of Northern Iraq with most cases being due to the G6PD Mediterranean and Chatham variants. These results are

  13. Identification of novel mutations in the α-galactosidase A gene in patients with Fabry disease: pitfalls of mutation analyses in patients with low α-galactosidase A activity.

    PubMed

    Yoshimitsu, Makoto; Higuchi, Koji; Miyata, Masaaki; Devine, Sean; Mattman, Andre; Sirrs, Sandra; Medin, Jeffrey A; Tei, Chuwa; Takenaka, Toshihiro

    2011-05-01

    Fabry disease is an X-linked lysosomal storage disorder caused by mutations of the α-galactosidase A (GLA) gene, and the disease is a relatively prevalent cause of left ventricular hypertrophy followed by conduction abnormalities and arrhythmias. Mutation analysis of the GLA gene is a valuable tool for accurate diagnosis of affected families. In this study, we carried out molecular studies of 10 unrelated families diagnosed with Fabry disease. Genetic analysis of the GLA gene using conventional genomic sequencing was performed in 9 hemizygous males and 6 heterozygous females. In patients with no mutations in coding DNA sequence, multiplex ligation-dependent probe amplification (MLPA) and/or cDNA sequencing were performed. We identified a novel exon 2 deletion (IVS1_IVS2) in a heterozygous female by MLPA, which was undetectable by conventional sequencing methods. In addition, the g.9331G>A mutation that has previously been found only in patients with cardiac Fabry disease was found in 3 unrelated, newly-diagnosed, cardiac Fabry patients by sequencing GLA genomic DNA and cDNA. Two other novel mutations, g.8319A>G and 832delA were also found in addition to 4 previously reported mutations (R112C, C142Y, M296I, and G373D) in 6 other families. We could identify GLA gene mutations in all hemizygotes and heterozygotes from 10 families with Fabry disease. Mutations in 4 out of 10 families could not be identified by classical genomic analysis, which focuses on exons and the flanking region. Instead, these data suggest that MLPA analysis and cDNA sequence should be considered in genetic testing surveys of patients with Fabry disease. Copyright © 2011 Japanese College of Cardiology. Published by Elsevier Ltd. All rights reserved.

  14. Extensive Variation in the Mutation Rate Between and Within Human Genes Associated with Mendelian Disease.

    PubMed

    Smith, Thomas; Ho, Gladys; Christodoulou, John; Price, Elizabeth Ann; Onadim, Zerrin; Gauthier-Villars, Marion; Dehainault, Catherine; Houdayer, Claude; Parfait, Beatrice; van Minkelen, Rick; Lohman, Dietmar; Eyre-Walker, Adam

    2016-05-01

    We have investigated whether the mutation rate varies between genes and sites using de novo mutations (DNMs) from three genes associated with Mendelian diseases (RB1, NF1, and MECP2). We show that the relative frequency of mutations at CpG dinucleotides relative to non-CpG sites varies between genes and relative to the genomic average. In particular we show that the rate of transition mutation at CpG sites relative to the rate of non-CpG transversion is substantially higher in our disease genes than amongst DNMs in general; the rate of CpG transition can be several hundred-fold greater than the rate of non-CpG transversion. We also show that the mutation rate varies significantly between sites of a particular mutational type, such as non-CpG transversion, within a gene. We estimate that for all categories of sites, except CpG transitions, there is at least a 30-fold difference in the mutation rate between the 10% of sites with the highest and lowest mutation rates. However, our best estimate is that the mutation rate varies by several hundred-fold variation. We suggest that the presence of hypermutable sites may be one reason certain genes are associated with disease. © 2016 WILEY PERIODICALS, INC.

  15. Inactivating Mutation screening of Exon 6 and Exon 10E of FSHR gene in women with Polycystic Ovarian Syndrome in Vellore population

    NASA Astrophysics Data System (ADS)

    Sekar, Nishu; Sapre, Madhura; Kale, Vaikhari; Prabhu, Yogamaya D.; Renu, Kaviyarasi; Ramgir, Shalaka S.; Abilash, V. G.

    2017-11-01

    Polycystic Ovarian syndrome (PCOS) is a major cause of infertility in females of reproducing age and is typified by oligo-anovulation, hyperandrogenism, hirsutism and polycystic ovaries. FSHR gene located on chromosome 2 p21 is responsible for the normal follicular development and any deletion or mutation in the gene affects the interaction of FSH with its receptor. Thus, it becomes the candidate gene for PCOS study. Inactivating mutation in FSHR gene limits the receptor’s function by creating a complete block, changing the receptor-ligand complex or the basic hormone signal transduction.To screen the inactivating mutations in Exon 6 and Exon 10E of FSHR gene in women diagnosed with PCOS.PCR-RFLP analysis indicated that there were no inactivating mutations found in Exon 6 and Exon 10E. Variations in hormone levels were seen amongst the PCOS patients. There were no inactivating mutations found in FSHR gene of the women diagnosed with PCOS according to the Rotterdam criteria in Vellore population.

  16. Prevalence of glucose-6-phosphate dehydrogenase deficiency and diagnostic challenges in 1500 immigrants in Denmark examined for haemoglobinopathies.

    PubMed

    Warny, Marie; Klausen, Tobias Wirenfeldt; Petersen, Jesper; Birgens, Henrik

    2015-09-01

    Similar to the thalassaemia syndromes, glucose-6-phosphate dehydrogenase (G6PD) deficiency is highly prevalent in areas historically exposed to malaria. In the present study, we used quantitative and molecular methods to determine the prevalence of G6PD deficiency in a population of 1508 immigrants in Denmark. We found the allele frequency to be between 2.4 and 2.9% in the female immigrants. Furthermore, the mutation pattern in the studied population showed a high prevalence of the G6PD A-(202A) variant in African and African-American immigrants, a high prevalence of the G6PD Mediterranean variant in Mediterranean European and Western Asian immigrants, and substantial heterogeneity in the variants found in the Eastern Asian/Pacific immigrants. Inasmuch as many of the patients included in this investigation had various thalassaemic syndromes, we were able to evaluate the effects of the interaction between a low mean corpuscular haemoglobin (MCH) value and G6PD activity, particularly in heterozygous females. The activity level was markedly influenced by the MCH value in females with normal G6PD activity, but not in heterozygous and homozygous females. Comparison of patients with normal G6PD activity and heterozygous females indicated considerable overlap in activity levels. To help separating heterozygous females from females with wild-type genes, a DNA analysis is necessary when the female activity level is between 4.0 and 4.9 U/g hgb corresponding to 50-60% of the median activity of unaffected males.

  17. Evidence for prehistoric origins of the G2019S mutation in the North African Berber population.

    PubMed

    Ben El Haj, Rafiqua; Salmi, Ayyoub; Regragui, Wafa; Moussa, Ahmed; Bouslam, Naima; Tibar, Houyam; Benomar, Ali; Yahyaoui, Mohamed; Bouhouche, Ahmed

    2017-01-01

    The most common cause of the monogenic form of Parkinson's disease known so far is the G2019S mutation of the leucine-rich repeat kinase 2 (LRRK2) gene. Its frequency varies greatly among ethnic groups and geographic regions ranging from less than 0.1% in Asia to 40% in North Africa. This mutation has three distinct haplotypes; haplotype 1 being the oldest and most common. Recent studies have dated haplotype 1 of the G2019S mutation to about 4000 years ago, but it remains controversial whether the mutation has a Near-Eastern or Moroccan-Berber ancestral origin. To decipher this evolutionary history, we genotyped 10 microsatellite markers spanning a region of 11.27 Mb in a total of 57 unrelated Moroccan PD patients carrying the G2019S mutation for which the Berber or Arab origin was established over 3 generations based on spoken language. We estimated the age of the most recent common ancestor for the 36 Arab-speaking and the 15 Berber-speaking G2019S carriers using the likelihood-based method with a mutation rate of 10-4. Data analysis suggests that the shortest haplotype originated in a patient of Berber ethnicity. The common founder was estimated to have lived 159 generations ago (95% CI 116-224) for Arab patients, and 200 generations ago (95% CI 123-348) for Berber patients. Then, 29 native North African males carrying the mutation were assessed for specific uniparental markers by sequencing the Y-chromosome (E-M81, E-M78, and M-267) and mitochondrial DNA (mtDNA) hypervariable regions (HV1 and HV2) to examine paternal and maternal contributions, respectively. Results showed that the autochthonous genetic component reached 76% for mtDNA (Eurasian and north African haplogroups) and 59% for the Y-chromosome (E-M81 and E-M78), suggesting that the G2019S mutation may have arisen in an autochthonous DNA pool. Therefore, we conclude that LRRK2 G2019S mutation most likely originated in a Berber founder who lived at least 5000 years ago (95% CI 3075-8700).

  18. Mutational analysis of FUS gene and its structural and functional role in amyotrophic lateral sclerosis 6.

    PubMed

    Kamaraj, Balu; Rajendran, Vidya; Sethumadhavan, Rao; Kumar, Chundi Vinay; Purohit, Rituraj

    2015-01-01

    Amyotrophic lateral sclerosis 6 (ALS6) is an autosomal recessive disorder caused by heterozygous mutation in the Fused in Sarcoma (FUS) gene. ALS6 is a neurodegenerative disorder, which affects the upper and lower motor neurons in the brain and spinal cord, resulting in fatal paralysis. ALS6 is caused by the genetic mutation in the proline/tyrosine-nuclear localization signals of the Fused in sarcoma Protein (FUS). FUS gene also known as TLS (Translocated in liposarcoma), which encodes a protein called RNA-binding protein-Fus (FUS), has a molecular weight of 75 kDa. In this analysis, we applied computational approach to filter the most deleterious and neurodegenerative disease of ALS6-associated mutation on FUS protein. We found H517Q as most deleterious and disease associated using PolyPhen 2.0, I-Mutant 3.0, SIFT, SNPs&GO, PhD-SNP, Pmut, and Mutpred tools. Molecular dynamics simulation (MDS) approach was conducted to investigate conformational changes in the mutant protein structure with respect to its native conformation. MDS results showed the flexibility loss in mutant (H517Q) FUS protein. Due to mutation, FUS protein became more rigid in nature and might alter the structural and functional behavior of protein and play a major role in inducing ALS6. The results obtained from this investigation would help in the field of pharmacogenomics to develop a potent drug target against FUS-associated neurodegenerative diseases.

  19. Identification and Functional Analysis of a Novel MIP Gene Mutation Associated with Congenital Cataract in a Chinese Family

    PubMed Central

    Shentu, Xingchao; Miao, Qi; Tang, Xiajing; Yin, Houfa; Zhao, Yingying

    2015-01-01

    Congenital cataracts are major cause of visual impairment and blindness in children and previous studies have shown about 1/3 of non-syndromic congenital cataracts are inherited. Major intrinsic protein of the lens (MIP), also known as AQP0, plays a critical role in transparency and development of the lens. To date, more than 10 mutations in MIP have been linked to hereditary cataracts in humans. In this study, we investigated the genetic and functional defects underlying a four-generation Chinese family affected with congenital progressive cortical punctate cataract. Mutation screening of the candidate genes revealed a missense mutation at position 448 (c.448G>C) of MIP, which resulted in the substitution of a conserved aspartic acid with histidine at codon 150 (p.D150H). By linkage and haplotype analysis, we obtained positive multipoint logarithm of odds (LOD) scores at microsatellite markers D12S1632 (Zmax = 1.804 at α = 1.000) and D12S1691 (Zmax = 1.806 at α = 1.000), which flanked the candidate locus. The prediction results of PolyPhen-2 and SIFT indicated that the p.D150H mutation was likely to damage to the structure and function of AQP0. The wild type and p.D150H mutant AQP0 were expressed in HeLa cells separately and the immunofluorescence results showed that the WT-AQP0 distributed at the plasma membrane and in cytoplasm, while AQP0-D150H failed to reach the plasma membrane and was mainly retained in the Golgi apparatus. Moreover, protein levels of AQP0-D150H were significantly lower than those of wide type AQP0 in membrane-enriched lysates when the HEK-293T cells were transfected with the same amount of wild type and mutant plasmids individually. Taken together, our data suggest the p.D150H mutation is a novel disease-causing mutation in MIP, which leads to congenital progressive cortical punctate cataract by impairing the trafficking mechanism of AQP0. PMID:25946197

  20. Prevalence of GJB2 (connexin-26) and GJB6 (connexin-30) mutations in a cohort of 300 Brazilian hearing-impaired individuals: implications for diagnosis and genetic counseling.

    PubMed

    Batissoco, Ana Carla; Abreu-Silva, Ronaldo Serafim; Braga, Maria Cristina Célia; Lezirovitz, Karina; Della-Rosa, Valter; Alfredo, Tabith; Otto, Paulo Alberto; Mingroni-Netto, Regina Célia

    2009-02-01

    Hereditary nonsyndromic deafness is an autosomal recessive condition in about 80% of cases, and point mutations in the GJB2 gene (connexin 26) and two deletions in the GJB6 gene (connexin 30), del(GJB6-D13S1830) and del(GJB6-D13S1854), are reported to account for 50% of recessive deafness. Aiming at establishing the frequencies of GJB2 mutations and GJB6 deletions in the Brazilian population, we screened 300 unrelated individuals with hearing impairment, who were not affected by known deafness related syndromes. We firstly screened the most frequently reported mutations, c.35delG and c.167delT in the GJB2 gene, and del(GJB6-D13S1830) and del(GJB6-D13S1854) in the GJB6 gene, through specific techniques. The detected c.35delG and c.167delT mutations were validated by sequencing. Other mutations in the GJB2 gene were screened by single-strand conformation polymorphism and the coding region was sequenced when abnormal patterns were found. Pathogenic mutations in GJB2 and GJB6 genes were detected in 41 individuals (13.7%), and 80.5% (33/41) presented these mutations in homozygosis or compound heterozygosis, thus explaining their hearing defect. The c.35delG in the GJB2 gene was the most frequent mutation (37/300; 12.4%), detected in 23% familial and 6.2% the sporadic cases. The second most frequent mutation (1%; 3/300) was the del(GJB6-D13S1830), always found associated with the c.35delG mutation. Nineteen different sequence variations were found in the GJB2 gene. In addition to the c.35delG mutation, nine known pathogenic alterations were detected c.167delT, p.Trp24X, p.Val37Ile, c.176_191del16, c.235delC, p.Leu90Pro, p.Arg127His, c.509insA, and p.Arg184Pro. Five substitutions had been previously considered benign polymorphisms: c.-15C>T, p.Val27Ile, p.Met34Thr, p.Ala40Ala, and p.Gly160Ser. Two previously reported mutations of unknown pathogenicity were found (p.Lys168Arg, and c.684C>A), and two novel substitutions, p.Leu81Val (c.G241C) and p.Met195Val (c.A583G), both

  1. Introducing the human Leigh syndrome mutation T9176G into Saccharomyces cerevisiae mitochondrial DNA leads to severe defects in the incorporation of Atp6p into the ATP synthase and in the mitochondrial morphology.

    PubMed

    Kucharczyk, Roza; Salin, Bénédicte; di Rago, J-P

    2009-08-01

    The Leigh syndrome is a severe neurological disorder that has been associated with mutations affecting the mitochondrial energy transducing system. One of these mutations, T9176G, has been localized in the mitochondrial ATP6 gene encoding the Atp6p (or a) subunit of the ATP synthase. This mutation converts a highly conserved leucine residue into arginine within a presumed trans-membrane alpha-helical segment, at position 217 of Atp6p. The T9176G mutation was previously shown to severely reduce the rate of mitochondrial ATP production in cultured human cells containing high loads of this mutation. However, the underlying mechanism responsible for the impaired ATP production is still unknown. To better understand how T9176G affects the ATP synthase, we have created and analyzed the properties of a yeast strain bearing an equivalent of this mutation. We show that incorporation of Atp6p within the ATP synthase was almost completely prevented in the modified yeast. Based on previous partial biochemical characterization of human T9176G cells, it is likely that this mutation similarly affects the human ATP synthase instead of causing a block in the rotary mechanism of this enzyme as it had been suggested. Interestingly, the T9176G yeast exhibits important anomalies in mitochondrial morphology, an observation which indicates that the pathogenicity of T9176G may not be limited to a bioenergetic deficiency.

  2. NIPA1 Gene Mutations Cause Autosomal Dominant Hereditary Spastic Paraplegia (SPG6)

    PubMed Central

    Rainier, Shirley; Chai, Jing-Hua; Tokarz, Debra; Nicholls, Robert D.; Fink, John K.

    2003-01-01

    The hereditary spastic paraplegias (HSPs) are genetically heterogeneous disorders characterized by progressive lower-extremity weakness and spasticity. The molecular pathogenesis is poorly understood. We report discovery of a dominant negative mutation in the NIPA1 gene in a kindred with autosomal dominant HSP (ADHSP), linked to chromosome 15q11-q13 (SPG6 locus); and precisely the same mutation in an unrelated kindred with ADHSP that was too small for meaningful linkage analysis. NIPA1 is highly expressed in neuronal tissues and encodes a putative membrane transporter or receptor. Identification of the NIPA1 function and ligand will aid an understanding of axonal neurodegeneration in HSP and may have important therapeutic implications. PMID:14508710

  3. First implication of STRA6 mutations in isolated anophthalmia, microphthalmia and coloboma: a new dimension to the STRA6 phenotype

    PubMed Central

    Casey, Jillian; Kawaguchi, Riki; Morrissey, Maria; Sun, Hui; McGettigan, Paul; Nielsen, Jens Erik; Conroy, Judith; Regan, Regina; Kenny, Elaine; Cormican, Paul; Morris, Derek W; Tormey, Peter; Chróinín, Muireann Ní; Kennedy, Breandan N; Lynch, SallyAnn; Green, Andrew; Ennis, Sean

    2014-01-01

    Microphthalmia, anophthalmia and coloboma (MAC) are structural congenital eye malformations that cause a significant proportion of childhood visual impairments. Several disease genes have been identified but do not account for all MAC cases, suggesting that additional risk loci exist. We used SNP homozygosity mapping (HM) and targeted next-generation sequencing to identify the causative mutation for autosomal recessive isolated colobomatous micro-anophthalmia (MCOPCB) in a consanguineous Irish Traveller family. We identified a double nucleotide polymorphism (g.1157G>A and g.1156G>A; p.G304K) in STRA6 that was homozygous in all of the MCOPCB patients. The STRA6 p.G304K mutation was subsequently detected in additional MCOPCB patients, including one individual with Matthew-Wood syndrome (MWS; MCOPS9). STRA6 encodes a transmembrane receptor involved in vitamin A uptake, a process essential to eye development and growth. We have shown that the G304K mutant STRA6 protein is mislocalised and has severely reduced vitamin A uptake activity. Furthermore, we reproduced the MCOPCB phenotype in a zebrafish disease model by inhibiting retinoic acid synthesis, suggesting that diminished retinoic acid levels account for the eye malformations in STRA6 p.G304K patients. The current study demonstrates that STRA6 mutations can cause isolated eye malformations in addition to the congenital anomalies observed in MWS. PMID:21901792

  4. First implication of STRA6 mutations in isolated anophthalmia, microphthalmia, and coloboma: a new dimension to the STRA6 phenotype.

    PubMed

    Casey, Jillian; Kawaguchi, Riki; Morrissey, Maria; Sun, Hui; McGettigan, Paul; Nielsen, Jens E; Conroy, Judith; Regan, Regina; Kenny, Elaine; Cormican, Paul; Morris, Derek W; Tormey, Peter; Chróinín, Muireann Ní; Kennedy, Breandan N; Lynch, SallyAnn; Green, Andrew; Ennis, Sean

    2011-12-01

    Microphthalmia, anophthalmia, and coloboma (MAC) are structural congenital eye malformations that cause a significant proportion of childhood visual impairments. Several disease genes have been identified but do not account for all MAC cases, suggesting that additional risk loci exist. We used single nucleotide polymorphism (SNP) homozygosity mapping (HM) and targeted next-generation sequencing to identify the causative mutation for autosomal recessive isolated colobomatous microanophthalmia (MCOPCB) in a consanguineous Irish Traveller family. We identified a double-nucleotide polymorphism (g.1157G>A and g.1156G>A; p.G304K) in STRA6 that was homozygous in all of the MCOPCB patients. The STRA6 p.G304K mutation was subsequently detected in additional MCOPCB patients, including one individual with Matthew-Wood syndrome (MWS; MCOPS9). STRA6 encodes a transmembrane receptor involved in vitamin A uptake, a process essential to eye development and growth. We have shown that the G304K mutant STRA6 protein is mislocalized and has severely reduced vitamin A uptake activity. Furthermore, we reproduced the MCOPCB phenotype in a zebrafish disease model by inhibiting retinoic acid (RA) synthesis, suggesting that diminished RA levels account for the eye malformations in STRA6 p.G304K patients. The current study demonstrates that STRA6 mutations can cause isolated eye malformations in addition to the congenital anomalies observed in MWS. © 2011 Wiley Periodicals, Inc.

  5. The relationship between glucocerebrosidase mutations and Parkinson disease.

    PubMed

    Migdalska-Richards, Anna; Schapira, Anthony H V

    2016-10-01

    Parkinson disease (PD) is the second most common neurodegenerative disorder after Alzheimer disease, whereas Gaucher disease (GD) is the most frequent lysosomal storage disorder caused by homozygous mutations in the glucocerebrosidase (GBA1) gene. Increased risk of developing PD has been observed in both GD patients and carriers. It has been estimated that GBA1 mutations confer a 20- to 30-fold increased risk for the development of PD, and that at least 7-10% of PD patients have a GBA1 mutation. To date, mutations in the GBA1 gene constitute numerically the most important risk factor for PD. The type of PD associated with GBA1 mutations (PD-GBA1) is almost identical to idiopathic PD, except for a slightly younger age of onset and a tendency to more cognitive impairment. Importantly, the pathology of PD-GBA1 is identical to idiopathic PD, with nigral dopamine cell loss, Lewy bodies, and neurites containing alpha-synuclein. The mechanism by which GBA1 mutations increase the risk for PD is still unknown. However, given that clinical manifestation and pathological findings in PD-GBA1 patients are almost identical to those in idiopathic PD individuals, it is likely that, as in idiopathic PD, alpha-synuclein accumulation, mitochondrial dysfunction, autophagic impairment, oxidative and endoplasmic reticulum stress may contribute to the development and progression of PD-GBA1. Here, we review the GBA1 gene, its role in GD, and its link with PD. The impact of glucocerebrosidase 1 (GBA1) mutations on functioning of endoplasmic reticulum (ER), lysosomes, and mitochondria. GBA1 mutations resulting in production of misfolded glucocerebrosidase (GCase) significantly affect the ER functioning. Misfolded GCase trapped in the ER leads to both an increase in the ubiquitin-proteasome system (UPS) and the ER stress. The presence of ER stress triggers the unfolded protein response (UPR) and/or endoplasmic reticulum-associated degradation (ERAD). The prolonged activation of UPR and ERAD

  6. Mitochondrial G8292A and C8794T mutations in patients with Niemann-Pick disease type C.

    PubMed

    Masserrat, Abbas; Sharifpanah, Fatemeh; Akbari, Leila; Tonekaboni, Seyed Hasan; Karimzadeh, Parvaneh; Asharafi, Mahmood Reza; Mazouei, Safoura; Sauer, Heinrich; Houshmand, Massoud

    2018-07-01

    Niemann-Pick disease type C (NP-C) is a neurovisceral lipid storage disorder. At the cellular level, the disorder is characterized by accumulation of unesterified cholesterol and glycolipids in the lysosomal/late endosomal system. NP-C is transmitted in an autosomal recessive manner and is caused by mutations in either the NPC1 (95% of families) or NPC2 gene. The estimated disease incidence is 1 in 120,000 live births, but this likely represents an underestimate, as the disease may be under-diagnosed due to its highly heterogeneous presentation. Variants of adenosine triphosphatase (ATPase) subunit 6 and ATPase subunit 8 ( ATPase6/8 ) in mitochondrial DNA (mtDNA) have been reported in different types of genetic diseases including NP-C. In the present study, the blood samples of 22 Iranian patients with NP-C and 150 healthy subjects as a control group were analyzed. The DNA of the blood samples was extracted by the salting out method and analyzed for ATPase6/8 mutations using polymerase chain reaction sequencing. Sequence variations in mitochondrial genome samples were determined via the Mitomap database. Analysis of sequencing data confirmed the existence of 11 different single nucleotide polymorphisms (SNPs) in patients with NP-C1. One of the most prevalent polymorphisms was the A8860G variant, which was observed in both affected and non-affected groups and determined to have no significant association with NP-C incidence. Amongst the 11 polymorphisms, only one was identified in the ATPase8 gene, while 9 including A8860G were observed in the ATPase6 gene. Furthermore, two SNPs, G8292A and C8792A, located in the non-coding region of mtDNA and the ATPase6 gene, respectively, exhibited significantly higher prevalence rates in NP-C1 patients compared with the control group (P<0.01). The present study suggests that there may be an association between mitochondrial ATPase6/8 mutations and the incidence of NP-C disease. In addition, the mitochondrial SNPs identified

  7. Frequency and origin of G-6-PD deficiency among icteric newborns in the metropolitan area of Monterrey, Nuevo León, Mexico.

    PubMed

    González-Quiroga, G; Ramirez-Del Rio, J L; Cerda-Flores, R M; Garza-Chapa, R

    1994-12-01

    829 icteric newborn males were studied in order to have more information about the frequency of the G-6-PD deficiency and its origin in the population of the Monterrey Metropolitan area (MMA), in northeastern Mexico. For each subject information about the maternal grandparents' birthplace (states of Mexico) was gathered. The newborns were grouped into five geographic areas. It was found that the frequency of G-6-PD deficiency is higher in icterics than in normal newborns. The grandparents of the deficient newborns with variant B belonged to the northeastern states of Mexico where more European genetic contribution was present whereas most of the grandparents of the A- deficient newborns were from the gulf coast states, where the genetic contribution was African.

  8. Mutation Spectrum of Common Deafness-Causing Genes in Patients with Non-Syndromic Deafness in the Xiamen Area, China.

    PubMed

    Jiang, Yi; Huang, Shasha; Deng, Tao; Wu, Lihua; Chen, Juan; Kang, Dongyang; Xu, Xiufeng; Li, Ruiyu; Han, Dongyi; Dai, Pu

    2015-01-01

    In China, approximately 30,000 babies are born with hearing impairment each year. However, the molecular factors causing congenital hearing impairment in the Xiamen area of Fujian province have not been evaluated. To provide accurate genetic testing and counseling in the Xiamen area, we investigated the molecular etiology of non-syndromic deafness in a deaf population from Xiamen. Unrelated students with hearing impairment (n = 155) who attended Xiamen Special Education School in Fujian Province were recruited for this study. Three common deafness-related genes, GJB2, SLC26A4, and mtDNA12SrRNA, were analyzed using all-exon sequencing. GJB2 mutations were detected in 27.1% (42/155) of the entire cohort. The non-syndromic hearing loss (NSHL) hotspot mutations c.109G>A (p.V37I) and c.235delC were found in this population, whereas the Caucasian hotspot mutation c.35delG was not. The allelic frequency of the c.109G>A mutation was 9.03% (28/310), slightly higher than that of c.235delC (8.39%, 26/310), which is the most common GJB2 mutation in most areas of China. The allelic frequency of the c.109G>A mutation was significantly higher in this Xiamen's deaf population than that in previously reported cohorts (P = 0.00). The SLC26A4 mutations were found in 16.77% (26/155) of this cohort. The most common pathogenic allele was c.IVS7-2A>G (6.13%, 19/310), and the second most common was the c.1079C>T (p.A360V) mutation (1.94%, 6/310) which has rarely been reported as a hotspot mutation in other studies. The mutation rate of mtDNA12SrRNA in this group was 3.87% (6/155), all being the m.A1555G mutation. These findings show the specificity of the common deaf gene-mutation spectrum in this area. According to this study, there were specific hotspot mutations in Xiamen deaf patients. Comprehensive sequencing analysis of the three common deaf genes can help portray the mutation spectrum and develop optimal testing strategies for deaf patients in this area.

  9. Prevalence and molecular characterization of Glucose-6-Phosphate dehydrogenase deficient variants among the Kurdish population of Northern Iraq

    PubMed Central

    2010-01-01

    Background Glucose-6-Phosphate dehydrogenase (G6PD) is a key enzyme of the pentose monophosphate pathway, and its deficiency is the most common inherited enzymopathy worldwide. G6PD deficiency is common among Iraqis, including those of the Kurdish ethnic group, however no study of significance has ever addressed the molecular basis of this disorder in this population. The aim of this study is to determine the prevalence of this enzymopathy and its molecular basis among Iraqi Kurds. Methods A total of 580 healthy male Kurdish Iraqis randomly selected from a main regional premarital screening center in Northern Iraq were screened for G6PD deficiency using methemoglobin reduction test. The results were confirmed by quantitative enzyme assay for the cases that showed G6PD deficiency. DNA analysis was performed on 115 G6PD deficient subjects, 50 from the premarital screening group and 65 unrelated Kurdish male patients with documented acute hemolytic episodes due to G6PD deficiency. Analysis was performed using polymerase chain reaction/restriction fragment length polymorphism for five deficient molecular variants, namely G6PD Mediterranean (563 C→T), G6PD Chatham (1003 G→A), G6PD A- (202 G→A), G6PD Aures (143 T→C) and G6PD Cosenza (1376 G→C), as well as the silent 1311 (C→T) mutation. Results Among 580 random Iraqi male Kurds, 63 (10.9%) had documented G6PD deficiency. Molecular studies performed on a total of 115 G6PD deficient males revealed that 101 (87.8%) had the G6PD Mediterranean variant and 10 (8.7%) had the G6PD Chatham variant. No cases of G6PD A-, G6PD Aures or G6PD Cosenza were identified, leaving 4 cases (3.5%) uncharacterized. Further molecular screening revealed that the silent mutation 1311 was present in 93/95 of the Mediterranean and 1/10 of the Chatham cases. Conclusions The current study revealed a high prevalence of G6PD deficiency among Iraqi Kurdish population of Northern Iraq with most cases being due to the G6PD Mediterranean and

  10. DNA mutation motifs in the genes associated with inherited diseases.

    PubMed

    Růžička, Michal; Kulhánek, Petr; Radová, Lenka; Čechová, Andrea; Špačková, Naďa; Fajkusová, Lenka; Réblová, Kamila

    2017-01-01

    Mutations in human genes can be responsible for inherited genetic disorders and cancer. Mutations can arise due to environmental factors or spontaneously. It has been shown that certain DNA sequences are more prone to mutate. These sites are termed hotspots and exhibit a higher mutation frequency than expected by chance. In contrast, DNA sequences with lower mutation frequencies than expected by chance are termed coldspots. Mutation hotspots are usually derived from a mutation spectrum, which reflects particular population where an effect of a common ancestor plays a role. To detect coldspots/hotspots unaffected by population bias, we analysed the presence of germline mutations obtained from HGMD database in the 5-nucleotide segments repeatedly occurring in genes associated with common inherited disorders, in particular, the PAH, LDLR, CFTR, F8, and F9 genes. Statistically significant sequences (mutational motifs) rarely associated with mutations (coldspots) and frequently associated with mutations (hotspots) exhibited characteristic sequence patterns, e.g. coldspots contained purine tract while hotspots showed alternating purine-pyrimidine bases, often with the presence of CpG dinucleotide. Using molecular dynamics simulations and free energy calculations, we analysed the global bending properties of two selected coldspots and two hotspots with a G/T mismatch. We observed that the coldspots were inherently more flexible than the hotspots. We assume that this property might be critical for effective mismatch repair as DNA with a mutation recognized by MutSα protein is noticeably bent.

  11. Analysis of common deafness gene mutations in deaf people from unique ethnic groups in Gansu Province, China.

    PubMed

    Xu, Bai-Cheng; Bian, Pan-Pan; Liu, Xiao-Wen; Zhu, Yi-Ming; Yang, Xiao-Long; Ma, Jian-Li; Chen, Xing-Jian; Wang, Yan-Li; Guo, Yu-Fen

    2014-09-01

    The GJB2 gene mutation characteristic of Dongxiang was the interaction result of ethnic background and geographical environment, and Yugur exhibited the typical founder effect. The SLC26A4 gene mutation characteristic of Dongxiang was related to caucasian backgrounds and selection of purpose exons, i.e. ethnic background and the penetrance of ethnic specificity caused the low mtDNA1555A>G mutation frequency in Dongxiang. To determine the prevalence of GJB2 and SLC26A4 genes and mtDNA1555A>G mutations and analyze the ethnic specificity in the non-syndromic sensorineural hearing loss (NSHL) of unique ethnic groups in Gansu Province. Peripheral blood samples were obtained from Dongxiang, Yugur, Bonan, and ethnic Han groups with moderately severe to profound NSHL in Gansu Province. Bidirectional sequencing (or enzyme digestion) was applied to identify the sequence variations. The pathogenic allele frequency of the three gene mutations was different. The frequency of the GJB2 gene among the Dongxiang, Yugur, Bonan, and ethnic Han groups was 9.03%, 12.5%, 5.88%, and 12.17%, respectively. No difference was found between the ethnic groups. The frequencies of the SLC26A4 genes were 3.23%, 8.33%, 0%, and 9.81%, respectively. The mutation frequency of mtDNA1555A>G was 0%, 0%, 0%, and 6.03%, respectively. No difference was found between the ethnic groups, except for the Dongxiang and ethnic Han groups, both in SLC26A4 gene and mtDNA1555A>G.

  12. The coexistence of mitochondrial ND6 T14484C and 12S rRNA A1555G mutations in a Chinese family with Leber's hereditary optic neuropathy and hearing loss

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wei Qiping; Zhou Xiangtian; Yang Li

    2007-06-15

    We report here the clinical, genetic and molecular characterization of one three-generation Han Chinese family with Leber's hereditary optic neuropathy (LHON) and hearing loss. Four of 14 matrilineal relatives exhibited the moderate central vision loss at the average age of 12.5 years. Of these, one subject exhibited both LHON and mild hearing impairment. Sequence analysis of the complete mitochondrial genomes in the pedigree showed the presence of homoplasmic LHON-associated ND6 T14484C mutation, deafness-associated 12S rRNA A1555 mutation and 47 other variants belonging to Eastern Asian haplogroup H2. None of other mitochondrial variants was evolutionarily conserved and functional significance. Therefore, themore » coexistence of the A1555G mutation and T14484C mutations in this Chinese family indicate that the A1555G mutation may play a synergistic role in the phenotypic manifestation of LHON associated ND6 T14484C mutation. However, the incomplete penetrance of vision and hearing loss suggests the involvement of nuclear modifier genes and environmental factors in the phenotypic expression of these mtDNA mutations.« less

  13. Mutations at the PAX6 locus are found in heterogeneous anterior segment malformations including Peters' anomaly.

    PubMed

    Hanson, I M; Fletcher, J M; Jordan, T; Brown, A; Taylor, D; Adams, R J; Punnett, H H; van Heyningen, V

    1994-02-01

    Mutation or deletion of the PAX6 gene underlies many cases of aniridia. Three lines of evidence now converge to implicate PAX6 more widely in anterior segment malformations including Peters' anomaly. First, a child with Peters' anomaly is deleted for one copy of PAX6. Second, affected members of a family with dominantly inherited anterior segment malformations, including Peters' anomaly are heterozygous for an R26G mutation in the PAX6 paired box. Third, a proportion of Sey/+ Smalleye mice, heterozygous for a nonsense mutation in murine Pax-6, have an ocular phenotype resembling Peters' anomaly. We therefore propose that a variety of anterior segment anomalies may be associated with PAX6 mutations.

  14. CFTR gene mutations in isolated chronic obstructive pulmonary disease

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pignatti, P.F.; Bombien, C.; Marigo, C.

    1994-09-01

    In order to identify a possible hereditary predisposition to the development of chronic obstructive pulmonary disease (COPD), we have looked for the presence of cystic fibrosis transmembrane regulator (CFTR) gene DNA sequence modifications in 28 unrelated patients with no signs of cystic fibrosis. The known mutations in Italian CF patients, as well as the most frequent worldwide CF mutations, were investigated. In addition, a denaturing gradient gel electrophoresis analysis of about half of the coding sequence of the gene in 56 chromosomes from the patients and in 102 chromosomes from control individuals affected by other pulmonary diseases and from normalmore » controls was performed. Nine different CFTR gene mutations and polymorphisms were found in seven patients, a highly significant increase over controls. Two of the patients were compound heterozygotes. Two frequent CF mutations were detected: deletion F508 and R117H; two rare CF mutations: R1066C and 3667ins4; and five CF sequence variants: R75Q (which was also described as a disease-causing mutation in male sterility cases due to the absence of the vasa deferentia), G576A, 2736 A{r_arrow}G, L997F, and 3271+18C{r_arrow}T. Seven (78%) of the mutations are localized in transmembrane domains. Six (86%) of the patients with defined mutations and polymorphisms had bronchiectasis. These results indicate that CFTR gene mutations and sequence alterations may be involved in the etiopathogenesis of some cases of COPD.« less

  15. A Novel Mutation in ERCC8 Gene Causing Cockayne Syndrome

    PubMed Central

    Taghdiri, Maryam; Dastsooz, Hassan; Fardaei, Majid; Mohammadi, Sanaz; Farazi Fard, Mohammad Ali; Faghihi, Mohammad Ali

    2017-01-01

    Cockayne syndrome (CS) is a rare autosomal recessive multisystem disorder characterized by impaired neurological and sensory functions, cachectic dwarfism, microcephaly, and photosensitivity. This syndrome shows a variable age of onset and rate of progression, and its phenotypic spectrum include a wide range of severity. Due to the progressive nature of this disorder, diagnosis can be more important when additional signs and symptoms appear gradually and become steadily worse over time. Therefore, mutation analysis of genes involved in CS pathogenesis can be helpful to confirm the suspected clinical diagnosis. Here, we report a novel mutation in ERCC8 gene in a 16-year-old boy who suffers from poor weight gain, short stature, microcephaly, intellectual disability, and photosensitivity. The patient was born to consanguineous family with no previous documented disease in his parents. To identify disease-causing mutation in the patient, whole exome sequencing utilizing next-generation sequencing on an Illumina HiSeq 2000 platform was performed. Results revealed a novel homozygote mutation in ERCC8 gene (NM_000082: exon 11, c.1122G>C) in our patient. Another gene (ERCC6), which is also involved in CS did not have any disease-causing mutations in the proband. The new identified mutation was then confirmed by Sanger sequencing in the proband, his parents, and extended family members, confirming co-segregation with the disease. In addition, different bioinformatics programs which included MutationTaster, I-Mutant v2.0, NNSplice, Combined Annotation Dependent Depletion, The PhastCons, Genomic Evolutationary Rate Profiling conservation score, and T-Coffee Multiple Sequence Alignment predicted the pathogenicity of the mutation. Our study identified a rare novel mutation in ERCC8 gene and help to provide accurate genetic counseling and prenatal diagnosis to minimize new affected individuals in this family. PMID:28848724

  16. A Novel Mutation in ERCC8 Gene Causing Cockayne Syndrome.

    PubMed

    Taghdiri, Maryam; Dastsooz, Hassan; Fardaei, Majid; Mohammadi, Sanaz; Farazi Fard, Mohammad Ali; Faghihi, Mohammad Ali

    2017-01-01

    Cockayne syndrome (CS) is a rare autosomal recessive multisystem disorder characterized by impaired neurological and sensory functions, cachectic dwarfism, microcephaly, and photosensitivity. This syndrome shows a variable age of onset and rate of progression, and its phenotypic spectrum include a wide range of severity. Due to the progressive nature of this disorder, diagnosis can be more important when additional signs and symptoms appear gradually and become steadily worse over time. Therefore, mutation analysis of genes involved in CS pathogenesis can be helpful to confirm the suspected clinical diagnosis. Here, we report a novel mutation in ERCC8 gene in a 16-year-old boy who suffers from poor weight gain, short stature, microcephaly, intellectual disability, and photosensitivity. The patient was born to consanguineous family with no previous documented disease in his parents. To identify disease-causing mutation in the patient, whole exome sequencing utilizing next-generation sequencing on an Illumina HiSeq 2000 platform was performed. Results revealed a novel homozygote mutation in ERCC8 gene (NM_000082: exon 11, c.1122G>C) in our patient. Another gene ( ERCC6 ), which is also involved in CS did not have any disease-causing mutations in the proband. The new identified mutation was then confirmed by Sanger sequencing in the proband, his parents, and extended family members, confirming co-segregation with the disease. In addition, different bioinformatics programs which included MutationTaster, I-Mutant v2.0, NNSplice, Combined Annotation Dependent Depletion, The PhastCons, Genomic Evolutationary Rate Profiling conservation score, and T-Coffee Multiple Sequence Alignment predicted the pathogenicity of the mutation. Our study identified a rare novel mutation in ERCC8 gene and help to provide accurate genetic counseling and prenatal diagnosis to minimize new affected individuals in this family.

  17. Mutations of the cystic fibrosis gene, but not cationic trypsinogen gene, are associated with recurrent or chronic idiopathic pancreatitis.

    PubMed

    Ockenga, J; Stuhrmann, M; Ballmann, M; Teich, N; Keim, V; Dörk, T; Manns, M P

    2000-08-01

    We investigated whether mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene and cationic trypsinogen gene are associated with recurrent acute, or chronic idiopathic pancreatitis. Twenty patients with idiopathic pancreatitis (11 women, nine men; mean age, 30 yr) were studied for the presence of a CFTR mutation by screening the genomic DNA for more than 30 mutations and variants in the CFTR gene. Selected mutations of the cationic trypsinogen gene were screened by Afl III restriction digestion or by a mutation-specific polymerase chain reaction (PCR). In each patient exons 1, 2, and 3 of the cationic trypsinogen gene were sequenced. Patients with a CFTR mutation underwent evaluation of further functional electrophysiological test (intestinal current measurement). No mutation of the cationic trypsinogen gene was detected. A CFTR mutation was detected in 6/20 (30.0%) patients. Three patients (15.0%) had a cystic fibrosis (CF) mutation on one chromosome (deltaF508, I336K, Y1092X), which is known to cause phenotypical severe cystic fibrosis. One patient was heterozygous for the 5T allele. In addition, two possibly predisposing CFTR variants (R75Q, 1716G-->A) were detected on four patients, one of these being a compound heterozygous for the missense mutation I336K and R75Q. No other family member (maternal I336K; paternal R75Q; sister I1336K) developed pancreatitis. An intestinal current measurement in rectum samples of patients with a CFTR mutation revealed no CF-typical constellations. CFTR mutations are associated with recurrent acute, or chronic idiopathic pancreatitis, whereas mutations of the cationic trypsinogen mutation do not appear to be a frequent pathogenetic factor.

  18. Further insight into the phenotype associated with a mutation in the ORC6 gene, causing Meier-Gorlin syndrome 3.

    PubMed

    Shalev, Stavit Allon; Khayat, Morad; Etty, Daniel-Spiegl; Elpeleg, Orly

    2015-03-01

    Mutations in genes encoding the origin recognition complex subunits cause Meier-Gorlin syndrome. The disease manifests a triad of short stature, small ears, and small and/or absent patellae with variable expressivity. We report on the identification of a homozygous deleterious mutation in the ORC6 gene in previously described fetuses at the severe end of the Meier-Gorlin spectrum. The phenotype included severe intrauterine growth retardation, dislocation of knees, gracile bones, clubfeet, and small mandible and chest. To date, the clinical presentation of ORC6-associated Meier-Gorlin syndrome has been mild compared to other the phenotype associated with other loci. The present report expands the clinical phenotype associated with ORC6 mutations to include severely abnormal embryological development suggesting a possible genotype-phenotype correlation. © 2015 Wiley Periodicals, Inc.

  19. The hepcidin gene promoter nc.-1010C > T; -582A > G haplotype modulates serum ferritin in individuals carrying the common H63D mutation in HFE gene.

    PubMed

    Silva, Bruno; Pita, Lina; Gomes, Susana; Gonçalves, João; Faustino, Paula

    2014-12-01

    Hereditary hemochromatosis is an autosomal recessive disorder characterized by severe iron overload. It is usually associated with homozygosity for the HFE gene mutation c.845G > A; p.C282Y. However, in some cases, another HFE mutation (c.187C > G; p.H63D) seems to be associated with the disease. Its penetrance is very low, suggesting the possibility of other iron genetic modulators being involved. In this work, we have screened for HAMP promoter polymorphisms in 409 individuals presenting normal or increased serum ferritin levels together with normal or H63D-mutated HFE genotypes. Our results show that the hepcidin gene promoter TG haplotype, originated by linkage of the nc.-1010C > T and nc.-582A > G polymorphisms, is more frequent in the HFE_H63D individuals presenting serum ferritin levels higher than 300 μg/L than in those presenting the HFE_H63D mutation but with normal serum ferritin levels or in the normal control group.Moreover, it was observed that the TG haplotype was associated to increased serum ferritin levels in the overall pool of HFE_H63D individuals. Thus, our data suggest that screening for these polymorphisms could be of interest in order to explain the phenotype. However, this genetic condition seems to have no clinical significance.

  20. Association between PD-L1 expression and driven gene status in NSCLC: A meta-analysis.

    PubMed

    Li, D; Zhu, X; Wang, H; Li, N

    2017-07-01

    We explored the potential clinical association between programmed death-ligand 1 (PD-L1) expression and driven gene status in non-small cell lung cancer (NSCLC). We systemically searched through October 2015. Odd ratios (ORs) with 95% CIs were calculated to examine the association of PD-L1 expression with driven gene status. A random- or fixed-effects model was used. Nine studies were identified. KRAS-mutant tumors were more likely to be PD-L1 positive than KRAS-wild type tumors (51% vs 36%; OR 1.69; 95% CI 1.01-2.84; p = 0.045). In contrast, PD-L1 expression did not differ by EGFR (OR 0.86; 95% CI 0.43-1.73; p = 0.675) or ALK (OR 1.02; 95% CI 0.44-2.37; p = 0.954) status. In subgroup analysis, there was also no significant association between PD-L1 expression and EGFR status in term of the cut-offs or ethnicity. In conclusion, NSCLC with KRAS mutations showed a trend for higher frequency of positive PD-L1 expression. Copyright © 2017 Elsevier Ltd, BASO ~ The Association for Cancer Surgery, and the European Society of Surgical Oncology. All rights reserved.

  1. Mutations in HAMP and HJV genes and their impact on expression of clinical hemochromatosis in a cohort of 100 Spanish patients homozygous for the C282Y mutation of HFE gene.

    PubMed

    Altès, Albert; Bach, Vanessa; Ruiz, Angels; Esteve, Anna; Felez, Jordi; Remacha, Angel F; Sardà, M Pilar; Baiget, Montserrat

    2009-10-01

    Most hereditary hemochromatosis (HH) patients are homozygous for the C282Y mutation of the HFE gene. Nevertheless, penetrance of the disease is very variable. In some patients, penetrance can be mediated by concomitant mutations in other iron master genes. We evaluated the clinical impact of hepcidin (HAMP) and hemojuvelin mutations in a cohort of 100 Spanish patients homozygous for the C282Y mutation of the HFE gene. HAMP and hemojuvelin mutations were evaluated in all patients by bidirectional direct cycle sequencing. Phenotype-genotype interactions were evaluated. A heterozygous mutation of the HAMP gene (G71D) was found in only one out of 100 cases. Following, we performed a study of several members of that family, and we observed several members had a digenic inheritance of the C282Y mutation of the HFE gene and the G71D mutation of the HAMP gene. This mutation in the HAMP gene did not modify the phenotype of the individuals who were homozygous for the C282Y mutation. One other patient presented a new polymorphism in the hemojuvelin gene, without consequences in iron load or clinical course of the disease. In conclusion, HAMP and hemojuvelin mutations are rare among Spanish HH patients, and their impact in this population is not significant.

  2. Neurofilament L gene is not a genetic factor of sporadic and familial Parkinson's disease.

    PubMed

    Rahner, Nils; Holzmann, Carsten; Krüger, Rejko; Schöls, Ludger; Berger, Klaus; Riess, Olaf

    2002-09-27

    Mutations in two genes, alpha-synuclein and parkin, have been identified as some rare causes for familial Parkinson's disease (PD). alpha-Synuclein and parkin protein have subsequently been identified in Lewy bodies (LB). To gain further insight into the pathogenesis of PD we investigated the role of neurofilament light (NF-L), another component of LB aggregation. A detailed mutation search of the NF-L gene in 328 sporadic and familial PD patients of German ancestry revealed three silent DNA changes (G163A, C224T, C487T) in three unrelated patients. Analysis of the promoter region of the NF-L gene identified a total of three base pair substitutions defining five haplotypes. Association studies based on these haplotypes revealed no significant differences between PD patients and 344 control individuals. Therefore, NF-L is unlikely to play a major role in the pathogenesis of PD.

  3. Spectrum of CFTR gene mutations in Ecuadorian cystic fibrosis patients: the second report of the p.H609R mutation.

    PubMed

    Ortiz, Sofía C; Aguirre, Santiago J; Flores, Sofía; Maldonado, Claudio; Mejía, Juan; Salinas, Lilian

    2017-11-01

    High heterogeneity in the CFTR gene mutations disturbs the molecular diagnosis of cystic fibrosis (CF). In order to improve the diagnosis of CF in our country, the present study aims to define a panel of common CFTR gene mutations by sequencing 27 exons of the gene in Ecuadorian Cystic Fibrosis patients. Forty-eight Ecuadorian individuals with suspected/confirmed CF diagnosis were included. Twenty-seven exons of CFTR gene were sequenced to find sequence variations. Prevalence of pathogenic variations were determined and compared with other countries' data. We found 70 sequence variations. Eight of these are CF-causing mutations: p.F508del, p.G85E, p.G330E, p.A455E, p.G970S, W1098X, R1162X, and N1303K. Also this study is the second report of p.H609R in Ecuadorian population. Mutation prevalence differences between Ecuadorian population and other Latin America countries were found. The panel of mutations suggested as an initial screening for the Ecuadorian population with cystic fibrosis should contain the mutations: p.F508del, p.G85E, p.G330E, p.A455E, p.G970S, W1098X, R1162X, and N1303K. © 2017 NETLAB Laboratorios Especializados. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

  4. [Application of gene capture technology on mutation screening of RB1 gene in retinoblastoma patients].

    PubMed

    Meng, Q Y; Huang, L Z; Wang, B; Li, X X; Liang, J H

    2017-06-11

    Objectives: To analyze RB1 gene mutation in retinoblastoma (RB) patients using gene capture technology. Methods: Experimental research. The clinical data of 17 RB patients were collected at Department of Ophthalmology, Peking University People's Hospital from June 2010 to Jun 2014. Peripheral blood samples of seventeen RB patients and their parents were collected and genomic DNA were extracted. DNA library from RB patients was mixed with designed gene capture probe of RB1 exons and its flanking sequences. The data were analyzed using bioinformatics software. To avoid the false positive, the abnormal sites were verified using the Sanger sequencing method. Results: Totally, there were 17 RB patients, including 12 males and 5 females, from 0.5 to 23 years old, average ages were (3.2±5.2) years old. Both eyes were involved in 6 patients. The other 11 cases were only one eye was attacked. Four RB patients were found to have germline mutations, among whom 2 had bilateral tumors and 2 had unilateral tumors. 2 novel missense mutations were identified, including 15(th) exon c.1408A>T (p. Ile470Phe) and c.1960G>C (p. Val654Leu) at 19(th) exon. No RB1 mutation was identified in any of their parents. We also identified 2 mutations reported previously. One is c.1030C>T termination mutation at 10(th) exon in a bilateral RB patients and his father, who was diagnosed with unilateral RB. The other is c.371-372delTA frame shift mutation at 3(rd) exon. No mutation was found in their parents. Conclusions: Two novel germline RB1 mutations were found using gene capture technology, which enriched RB1 mutations library. (Chin J Ophthalmol, 2017, 53: 455-459) .

  5. High incidence of 3-thalassemia, hemoglobin E, and glucose-6-phosphate dehydrogenase deficiency in populations of malaria-endemic southern Shan State, Myanmar.

    PubMed

    Than, Aung Myint; Harano, Teruo; Harano, Keiko; Myint, Aye Aye; Ogino, Tetsuya; Okadaa, Shigeru

    2005-08-01

    Samples from 916 members of various ethnic groups from malaria-endemic southern Shan State, Myanmar, were analyzed for 3-thalassemia (3-thal), 3-thalassemia (3-thal), abnormal hemoglobin variants, and glucose-6-phosphate dehydrogenase (G6PD) deficiency. Of these subjects, 530 (57.9%) were found to have at least one of these red cell genetic disorders. The overall frequencies for the various red cell genetic disorders were as follows: 3-thal, 37.5% (343/916); hemoglobin E (Hb-E), 20.3% (186/916); G6PD-Mahidol, 17.5% (160/916); and 3-thal, 0.3% (3/916). The frequencies of combined disorders were 6.9% (63/ 916) for 3-thal/Hb-E, 5.7% (52/916) for 3-thal/G6PD-Mahidol, 2.8% (26/916) for Hb-E/G6PD-Mahidol, 1.1% (10/916) for 3-thal/Hb-E/G6PD-Mahidol, and 0.1% (1/916) for 3-thal/3-thal/G6PD-Mahidol. Of the various ethnic and non-ethnic groups, the Bamar population showed the highest frequencies of 3-thal (56.9%, 177/311), Hb-E (28.3%, 88/311), and G6PD-Mahidol (21.2%, 66/311) (all duplicated and triplicated cases were included). In addition, 2 new mutations, an 3 gene triplication (/333(anti3.7); 0.2%, 2/916) and Hb-Neapolis (0.1%, 1/916), were detected. Our results showed that race was the dominant factor affecting the frequencies of red cell genetic disorders in malaria-endemic areas of Myanmar.

  6. Mutation and polymorphism analysis of the human homogentisate 1, 2-dioxygenase gene in alkaptonuria patients.

    PubMed Central

    Beltrán-Valero de Bernabé, D; Granadino, B; Chiarelli, I; Porfirio, B; Mayatepek, E; Aquaron, R; Moore, M M; Festen, J J; Sanmartí, R; Peñalva, M A; de Córdoba, S R

    1998-01-01

    Alkaptonuria (AKU), a rare hereditary disorder of phenylalanine and tyrosine catabolism, was the first disease to be interpreted as an inborn error of metabolism. AKU patients are deficient for homogentisate 1,2 dioxygenase (HGO); this deficiency causes homogentisic aciduria, ochronosis, and arthritis. We cloned the human HGO gene and characterized two loss-of-function mutations, P230S and V300G, in the HGO gene in AKU patients. Here we report haplotype and mutational analysis of the HGO gene in 29 novel AKU chromosomes. We identified 12 novel mutations: 8 (E42A, W97G, D153G, S189I, I216T, R225H, F227S, and M368V) missense mutations that result in amino acid substitutions at positions conserved in HGO in different species, 1 (F10fs) frameshift mutation, 2 intronic mutations (IVS9-56G-->A, IVS9-17G-->A), and 1 splice-site mutation (IVS5+1G-->T). We also report characterization of five polymorphic sites in HGO and describe the haplotypic associations of alleles at these sites in normal and AKU chromosomes. One of these sites, HGO-3, is a variable dinucleotide repeat; IVS2+35T/A, IVS5+25T/C, and IVS6+46C/A are intronic sites at which single nucleotide substitutions (dimorphisms) have been detected; and c407T/A is a relatively frequent nucleotide substitution in the coding sequence, exon 4, resulting in an amino acid change (H80Q). These data provide insight into the origin and evolution of the various AKU alleles. PMID:9529363

  7. Pathogenic LRRK2 mutations, through increased kinase activity, produce enlarged lysosomes with reduced degradative capacity and increase ATP13A2 expression.

    PubMed

    Henry, Anastasia G; Aghamohammadzadeh, Soheil; Samaroo, Harry; Chen, Yi; Mou, Kewa; Needle, Elie; Hirst, Warren D

    2015-11-01

    Lysosomal dysfunction plays a central role in the pathogenesis of several neurodegenerative disorders, including Parkinson's disease (PD). Several genes linked to genetic forms of PD, including leucine-rich repeat kinase 2 (LRRK2), functionally converge on the lysosomal system. While mutations in LRRK2 are commonly associated with autosomal-dominant PD, the physiological and pathological functions of this kinase remain poorly understood. Here, we demonstrate that LRRK2 regulates lysosome size, number and function in astrocytes, which endogenously express high levels of LRRK2. Expression of LRRK2 G2019S, the most common pathological mutation, produces enlarged lysosomes and diminishes the lysosomal capacity of these cells. Enlarged lysosomes appears to be a common phenotype associated with pathogenic LRRK2 mutations, as we also observed this effect in cells expressing other LRRK2 mutations; R1441C or Y1699C. The lysosomal defects associated with these mutations are dependent on both the catalytic activity of the kinase and autophosphorylation of LRRK2 at serine 1292. Further, we demonstrate that blocking LRRK2's kinase activity, with the potent and selective inhibitor PF-06447475, rescues the observed defects in lysosomal morphology and function. The present study also establishes that G2019S mutation leads to a reduction in lysosomal pH and increased expression of the lysosomal ATPase ATP13A2, a gene linked to a parkinsonian syndrome (Kufor-Rakeb syndrome), in brain samples from mouse and human LRRK2 G2019S carriers. Together, these results demonstrate that PD-associated LRRK2 mutations perturb lysosome function in a kinase-dependent manner, highlighting the therapeutic promise of LRRK2 kinase inhibitors in the treatment of PD. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  8. Molecular genetic analysis of some mutations in the cystic fibrosis gene in Moldova: Characterization of molecular markers and their linkage to various mutations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gimbovskaya, S.D.; Kalinin, V.N.; Ivashchenko, T.E.

    1994-12-01

    Sixty-one patients with cystic fibrosis (CF) from Moldova were tested for mutations {Delta}F508, G551D, and R553X. Frequencies of various alleles of the repeated GATT sequence in intron 6B of the GFTR gene, their linkage to other polymorphic markers, and various mutations were determined. The frequency of occurrence of mutation {Delta}F508 was only 25%. An absolute majority of CF patients (80%) had pancreatic insufficiency. Mutations G551D and R553X were not found in our sample. Each of 31 chromosomes with mutation {Delta}F508 carry the 6-GATT allele. Most {open_quotes}non {Delta}F508{close_quotes} (78%) and normal (80%) chromosomes were marked by the 7-GATT allele. Twenty-seven {Delta}F508more » chromosomes (96.4%) belong to haplotype B6, and only one to D6. Most chromosomes with {open_quotes}non {Delta}F508{close_quotes} mutations are associated with haplotypes D7 (26.3%) and C7 (21%). In addition, a significant portion of chromosomes from this subgroup were associated with haplotypes A7 (23.7%), A6 (10.5%), and C6 (2.7%), which are not yet described for mutant chromosomes. The results obtained demonstrate that CF in Moldova is mainly associated with mutations other than {Delta}F508, G551D, and R553X. Severe forms of the disease, with pancreatic insufficiency, are more frequently caused by these mutations; moreover, our data provides strong evidence for the presence of at least seven additional CF mutations in Moldova, apart from {Delta}F508, G551D, and R553X. Some of these are probably not described.« less

  9. First Report of the 23S rRNA Gene A2058G Point Mutation Associated With Macrolide Resistance in Treponema pallidum From Syphilis Patients in Cuba.

    PubMed

    Noda, Angel A; Matos, Nelvis; Blanco, Orestes; Rodríguez, Islay; Stamm, Lola Virginia

    2016-05-01

    This study aimed to assess the presence of macrolide-resistant Treponema pallidum subtypes in Havana, Cuba. Samples from 41 syphilis patients were tested for T. pallidum 23S rRNA gene mutations. Twenty-five patients (61%) harbored T. pallidum with the A2058G mutation, which was present in all 8 subtypes that were identified. The A2059G mutation was not detected.

  10. An exonic missense mutation c.28G>A is associated with weak B blood group by affecting RNA splicing of the ABO gene.

    PubMed

    Cai, Xiaohong; Qian, Chengrui; Wu, Wenman; Lei, Hang; Ding, Qiulan; Zou, Wei; Xiang, Dong; Wang, Xuefeng

    2017-09-01

    The amino acid substitutions caused by ABO gene mutations are usually predicted to impact glycosyltransferase's function or its biosynthesis. Here we report an ABO exonic missense mutation that affects B-antigen expression by decreasing the mRNA level of the ABO gene rather than the amino acid change. Serologic studies including plasma total GTB transfer capacity were performed. The exon sequences of the ABO gene were analyzed by Sanger sequencing. B 310 cDNA with c.28G>A (p.G10R) mutation was expressed in HeLa cells and total GTB transfer capacity in cell supernatant was measured. Flow cytometry was performed on these HeLa cells after transfection, and agglutination of Hela-B weak cells was also examined. The mRNA of the ABO gene was analyzed by direct sequencing and real-time reverse transcriptase-polymerase chain reaction. A minigene construct was prepared to evaluate the potential of splicing. While plasma total GTB transfer capacity was undetectable in this B 3 -like individual, the relative percentage of antigen-expressing cells and mean fluorescence index of the B weak red blood cells (RBCs) were 19 and 14% of normal B RBCs, respectively. There was no significant difference of total GTB transfer capacity in cell supernatant and B-antigen expression on cell surfaces between HeLa cells transfected with B 310 cDNA and B cDNA. The mRNA expression level of B 310 in peripheral whole blood was significantly reduced. The amount of splicing is significantly lower in c.28G>A construct compared to that in wild-type construct after transfection in K562 cells. ABO c.28G>A mutation may cause B 3 -like subgroup by affecting RNA splicing of the ABO gene. © 2017 AABB.

  11. Distribution of human papilloma virus type 16 E6/E7 gene mutation in cervical precancer or cancer: A case control study in Guizhou Province, China.

    PubMed

    Yang, Yingjie; Ren, Jie; Zhang, Qizhu

    2016-02-01

    HPV-16 varies geographically and is correlated with cervical cancer genesis and progression. This study aimed to determine the distribution of HPV-16 E6/E7 genetic variation in patients with invasive cervical cancer or precancer in Guizhou Province, China. A case-control study was designed, and the distribution of HPV-16 E6/E7 genetic variation was compared among women with cervical cancer, precancer, and sexually active without cervical lesion. HPV infection was detected through flow-through hybridization and gene chip techniques to determine the prevalence of HPV 16 E6/E7 genetic variation. Among 90 specimens (30 cervical cancer, 30 precancer, 30 controls), 81 were subjected to HPV-16 E6/E7 gene sequencing. The rates of DNA sequence mutation and amino acid mutation were 76.5% (62/81) and 66.7% (54/81), respectively. Both E6 and E7 genes showed higher mutation rate than their prototypes. The prevalence of E6/E7 mutation significantly differed between the cervical cancer and the controls (P < 0.05) and between the cervical precancer and the controls (P < 0.05). Mutations were simultaneously detected at the E6-D32E (T96A) and E7-M28V (A82G)/L94P (T281C) sites of the amino acid sequence. The most common genetic variation was D32E/M28V/L94P, which accounted for 35.8% of the cases (29/81). D32E/M28V/L94P mutation was higher in the cervical cancer and precancer compared with the prototype. HPV-16 E6/E7 genetic variations, such as D32E/M28V/L94P, are more prevalent in cervical cancer or precancer than those in the controls. The possible correlation between genetic variation and cancerigenesis may be used to design an HPV vaccine for cervical carcinoma. © 2015 Wiley Periodicals, Inc.

  12. Distinguishing between Selective Sweeps from Standing Variation and from a De Novo Mutation

    PubMed Central

    Peter, Benjamin M.; Huerta-Sanchez, Emilia; Nielsen, Rasmus

    2012-01-01

    An outstanding question in human genetics has been the degree to which adaptation occurs from standing genetic variation or from de novo mutations. Here, we combine several common statistics used to detect selection in an Approximate Bayesian Computation (ABC) framework, with the goal of discriminating between models of selection and providing estimates of the age of selected alleles and the selection coefficients acting on them. We use simulations to assess the power and accuracy of our method and apply it to seven of the strongest sweeps currently known in humans. We identify two genes, ASPM and PSCA, that are most likely affected by selection on standing variation; and we find three genes, ADH1B, LCT, and EDAR, in which the adaptive alleles seem to have swept from a new mutation. We also confirm evidence of selection for one further gene, TRPV6. In one gene, G6PD, neither neutral models nor models of selective sweeps fit the data, presumably because this locus has been subject to balancing selection. PMID:23071458

  13. Mutation detection of E6 and LCR genes from HPV 16 associated with carcinogenesis.

    PubMed

    Mosmann, Jessica P; Monetti, Marina S; Frutos, Maria C; Kiguen, Ana X; Venezuela, Raul F; Cuffini, Cecilia G

    2015-01-01

    Human papillomavirus (HPV) is responsible for one of the most frequent sexually transmitted infections. The first phylogenetic analysis was based on a LCR region fragment. Nowadays, 4 variants are known: African (Af-1, Af-2), Asian-American (AA) and European (E). However the existence of sub-lineages of the European variant havs been proposed, specific mutations in the E6 and LCR sequences being possibly related to persistent viral infections. The aim of this study was a phylogenetic study of HPV16 sequences of endocervical samples from Cordoba, in order to detect the circulating lineages and analyze the presence of mutations that could be correlated with malignant disease. The phylogenetic analysis determined that 86% of the samples belonged to the E variant, 7% to AF-1 and the remaining 7% to AF-2. The most frequent mutation in LCR sequences was G7521A, in 80% of the analyzed samples; it affects the binding site of a transcription factor that could contribute to carcinogenesis. In the E6 sequences, the most common mutation was T350G (L83V), detected in 67% of the samples, associated with increased risk of persistent infection. The high detection rate of the European lineage correlated with patterns of human migration. This study emphasizes the importance of recognizing circulating lineages, as well as the detection of mutations associated with high-grade neoplastic lesions that could be correlated to the development of carcinogenic lesions.

  14. Combined exposure to Maneb and Paraquat alters transcriptional regulation of neurogenesis-related genes in mice models of Parkinson's disease.

    PubMed

    Desplats, Paula; Patel, Pruthul; Kosberg, Kori; Mante, Michael; Patrick, Christina; Rockenstein, Edward; Fujita, Masayo; Hashimoto, Makoto; Masliah, Eliezer

    2012-09-28

    Parkinson's disease (PD) is a multifactorial disease where environmental factors act on genetically predisposed individuals. Although only 5% of PD manifestations are associated with specific mutations, majority of PD cases are of idiopathic origin, where environment plays a prominent role. Concurrent exposure to Paraquat (PQ) and Maneb (MB) in rural workers increases the risk for PD and exposure of adult mice to MB/PQ results in dopamine fiber loss and decreased locomotor activity. While PD is characterized by neuronal loss in the substantia nigra, we previously showed that accumulation of α-synuclein in the limbic system contributes to neurodegeneration by interfering with adult neurogenesis. We investigated the effect of pesticides on adult hippocampal neurogenesis in two transgenic models: Line 61, expressing the human wild type SNCA gene and Line LRRK2(G2019S), expressing the human LRRK2 gene with the mutation G2019S. Combined exposure to MB/PQ resulted in significant reduction of neuronal precursors and proliferating cells in non-transgenic animals, and this effect was increased in transgenic mice, in particular for Line 61, suggesting that α-synuclein accumulation and environmental toxins have a synergistic effect. We further investigated the transcription of 84 genes with direct function on neurogenesis. Overexpresion of α-synuclein resulted in the downregulation of 12% of target genes, most of which were functionally related to cell differentiation, while LRRK2 mutation had a minor impact on gene expression. MB/PQ also affected transcription in non-transgenic backgrounds, but when transgenic mice were exposed to the pesticides, profound alterations in gene expression affecting 27% of the studied targets were observed in both transgenic lines. Gene enrichment analysis showed that 1:3 of those genes were under the regulation of FoxF2 and FoxO3A, suggesting a primary role of these proteins in the response to genetic and environmental cues. We report that

  15. [Identification of an ideal noninvasive method to detect A3243G gene mutation in MELAS syndrome].

    PubMed

    Ma, Yi-nan; Fang, Fang; Yang, Yan-ling; Zhang, Ying; Wang, Song-tao; Xu, Yu-feng; Pei, Pei; Yuan, Yun; Bu, Ding-fang; Qi, Yu

    2008-12-16

    To identify a better non-invasive method to detect the carrier of mitochondrial A3243G mutation, a cause of mitochondrial encephalopathy-lactic acidosis-stroke like episode (MELAS) syndrome. DNA was extracted from the peripheral blood, urine, hair follicle, and saliva of 25 MELAS syndrome patients carrying A3243G mutation and their mothers and other maternal relatives, 33 persons in number, and the muscle tissues from 5 patients obtained by biopsy. A3243G mutation was detected by PCR-RFLP method, and the A3243G mutation ratio was identified by measuring the density of each band and calculation with the software AlphaEase 5.0. A3243G mutations were detected in all tissues of the 25 MELAS patients. The A3243G mutation ratio in urine was 62% +/- 9%, significantly higher than that in the blood [(36% +/- 10%), t = -11.13, P < 0.01]. A3243G mutations were detected in at least one tissue of the 28 maternal relatives. The A3243G mutation rates in their urine samples was 33.0% (5.0% - 70.4%), significantly higher than that in their blood samples [8.0% (0 - 33.3%), z = -4.197, P < 0.01]. There was no significant difference in A3243G mutation ratio among the samples of hair follicle, saliva, and blood. The A3243G mutation ratio in urine is significantly higher than those in blood samples of the patients and their maternal relatives. A noninvasive method, A3243G mutation ratio analysis of urine is superior to that in blood.

  16. Cancer Susceptibility Gene Mutations in Individuals With Colorectal Cancer

    PubMed Central

    Yurgelun, Matthew B.; Kulke, Matthew H.; Fuchs, Charles S.; Allen, Brian A.; Uno, Hajime; Hornick, Jason L.; Ukaegbu, Chinedu I.; Brais, Lauren K.; McNamara, Philip G.; Mayer, Robert J.; Schrag, Deborah; Meyerhardt, Jeffrey A.; Ng, Kimmie; Kidd, John; Singh, Nanda; Hartman, Anne-Renee; Wenstrup, Richard J.

    2017-01-01

    Purpose Hereditary factors play an important role in colorectal cancer (CRC) risk, yet the prevalence of germline cancer susceptibility gene mutations in patients with CRC unselected for high-risk features (eg, early age at diagnosis, personal/family history of cancer or polyps, tumor microsatellite instability [MSI], mismatch repair [MMR] deficiency) is unknown. Patients and Methods We recruited 1,058 participants who received CRC care in a clinic-based setting without preselection for age at diagnosis, personal/family history, or MSI/MMR results. All participants underwent germline testing for mutations in 25 genes associated with inherited cancer risk. Each gene was categorized as high penetrance or moderate penetrance on the basis of published estimates of the lifetime cancer risks conferred by pathogenic germline mutations in that gene. Results One hundred five (9.9%; 95% CI, 8.2% to 11.9%) of 1,058 participants carried one or more pathogenic mutations, including 33 (3.1%) with Lynch syndrome (LS). Twenty-eight (96.6%) of 29 available LS CRCs demonstrated abnormal MSI/MMR results. Seventy-four (7.0%) of 1,058 participants carried non-LS gene mutations, including 23 (2.2%) with mutations in high-penetrance genes (five APC, three biallelic MUTYH, 11 BRCA1/2, two PALB2, one CDKN2A, and one TP53), 15 of whom lacked clinical histories suggestive of their underlying mutation. Thirty-eight (3.6%) participants had moderate-penetrance CRC risk gene mutations (19 monoallelic MUTYH, 17 APC*I1307K, two CHEK2). Neither proband age at CRC diagnosis, family history of CRC, nor personal history of other cancers significantly predicted the presence of pathogenic mutations in non-LS genes. Conclusion Germline cancer susceptibility gene mutations are carried by 9.9% of patients with CRC. MSI/MMR testing reliably identifies LS probands, although 7.0% of patients with CRC carry non-LS mutations, including 1.0% with BRCA1/2 mutations. PMID:28135145

  17. Mutations of the Norrie gene in Korean ROP infants.

    PubMed

    Kim, Jeong Hun; Yu, Young Suk; Kim, Jiyeon; Park, Seong Sup

    2002-12-01

    The present study was conducted to evaluate if there is a Norrie disease gene (ND gene) mutation involved in the retinopathy of prematurity (ROP), and to identify the possibility of a genetic abnormality that may be linked to the presence of ROP. Nineteen premature Korean infants, with a low birth weight (1500 g or less) or low gestational age (32 weeks or less), were included in the study. Eighteen infants had ROP, and the other did not. Genomic DNA was isolated from the peripheral blood leukocytes of these patients, and all three exons and their flanking areas, all known ND gene mutations regions, were evaluated following amplification by a polymerase chain reaction, but no ND gene mutations were detected. Any disagreement between the relationship of ROP to the ND gene mutation will need to be clarified by further investigation.

  18. Identification of a novel homozygous mutation Arg459Pro in SYNJ1 gene of an Indian family with autosomal recessive juvenile Parkinsonism.

    PubMed

    Kirola, Laxmi; Behari, Madhuri; Shishir, Chandan; Thelma, B K

    2016-10-01

    A novel homozygous missense mutation (c.773G > A, p.Arg258Gln) in Synaptojanin 1 (SYNJ1, 21q22.2) has recently been reported in two Italian and one Iranian consanguineous families with autosomal recessive juvenile Parkinsonism (ARJP). Contribution of this synaptic gene related to Parkinsonism phenotypes in other populations still remains unidentified. An ARJP family with two affected siblings characterized by frequent tremor with bradykinesia and rigidity was recruited in this study. Both siblings showed intense dyskinesia and dystonia on administration of Syndopa. The family was analyzed for both mutations and exon dosage variations in PARKIN, PINK1 and DJ1. Further, whole exome sequencing was performed in two affected and one unaffected sibling in the family. We identified a novel homozygous mutation (c.1376C > G, p.Arg459Pro) in SYNJ1 segregating in this family. This p.Arg459Pro mutation was not observed in 285 additional Parkinson disease (PD) samples (32 familial, 81 early onset and 172 late onset) screened by PCR-Sanger-sequencing. It was also absent in dbSNP, 1000 Genomes, ExAC, NHLBI-ESP database and in >250 ethnically matched exomes available in our laboratory. The arginine residue is highly conserved across species and predicted to be damaging by several in silico tools. As with the previous mutation p.Arg258Gln, p.Arg459Pro is also present in Sac 1 domain of SYNJ1 wherein p.Arg258Gln mutation has already been described to impair the phosphatase activity. We report another novel mutation in SYNJ1 of an Indian consanguineous ARJP family. Finding an additional mutation in this gene further supports the involvement of SYNJ1 in PD pathogenesis across different ethnicities. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Glucocerebrosidase Mutations in Parkinson Disease.

    PubMed

    O'Regan, Grace; deSouza, Ruth-Mary; Balestrino, Roberta; Schapira, Anthony H

    2017-01-01

    Following the discovery of a higher than expected incidence of Parkinson Disease (PD) in Gaucher disease, a lysosomal storage disorder, mutations in the glucocerebrocidase (GBA) gene, which encodes a lysosomal enzyme involved in sphingolipid degradation were explored in the context of idiopathic PD. GBA mutations are now known to be the single largest risk factor for development of idiopathic PD. Clinically, on imaging and pharmacologically, GBA PD is almost identical to idiopathic PD, other than certain features that can be identified in the specialist research setting but not in routine clinical practice. In patients with a known GBA mutation, it is possible to monitor for prodromal signs of PD. The clinical similarity with idiopathic PD and the chance to identify PD at a pre-clinical stage provides a unique opportunity to research therapeutic options for early PD, before major irreversible neurodegeneration occurs. However, to date, the molecular mechanisms which lead to this increased PD risk in GBA mutation carriers are not fully elucidated. Experimental models to define the molecular mechanisms and test therapeutic options include cell culture, transgenic mice and other in vivo models amenable to genetic manipulation, such as drosophilia. Some key pathological pathways of interest in the context of GBA mutations include alpha synuclein aggregation, lysosomal-autophagy axis changes and endoplasmic reticulum stress. Therapeutic agents that exploit these pathways are being developed and include the small molecule chaperone Ambroxol. This review aims to summarise the main features of GBA-PD and provide insights into the pathological relevance of GBA mutations on molecular pathways and the therapeutic implications for PD resulting from investigation of the role of GBA in PD.

  20. Identification of Bangladeshi domestic cats with GM1 gangliosidosis caused by the c.1448G>C mutation of the feline GLB1 gene: case study.

    PubMed

    Uddin, Mohammad Mejbah; Hossain, Mohammad Alamgir; Rahman, Mohammad Mahbubur; Chowdhury, Morshedul Alam; Tanimoto, Takeshi; Yabuki, Akira; Mizukami, Keijiro; Chang, Hye-Sook; Yamato, Osamu

    2013-01-01

    GM1 gangliosidosis is a fatal, progressive neurodegenerative lysosomal storage disease caused by mutations in the β-galactosidase (GLB1) gene. In feline GM1 gangliosidosis, a pathogenic mutation (c.1448G>C) in the feline GLB1 gene was identified in Siamese cats in the United States and Japan and in Korat cats in Western countries. The present study found the homozygous c.1448G>C mutation in 2 apparent littermate native kittens in Bangladesh that were exhibiting neurological signs. This is the first identification of GM1 gangliosidosis in native domestic cats in Southeast Asia. This pathogenic mutation seems to have been present in the domestic cat population in the Siamese region and may have been transferred to pure breeds such as Siamese and Korat cats originating in this region.

  1. Implementation of G6PD testing and primaquine for P. vivax radical cure: Operational perspectives from Thailand and Cambodia.

    PubMed

    Kitchakarn, Suravadee; Lek, Dysoley; Thol, Sea; Hok, Chantheasy; Saejeng, Aungkana; Huy, Rekol; Chinanonwait, Nipon; Thimasarn, Krongthong; Wongsrichanalai, Chansuda

    2017-09-01

    Following progressive success in reducing the burden of malaria over the past two decades, countries of the Asia Pacific are now aiming for elimination of malaria by 2030. Plasmodium falciparum and Plasmodium vivax are the two main malaria species that are endemic in the region. P. vivax is generally perceived to be less severe but will be harder to eliminate, owing partly to its dormant liver stage (known as a hypnozoite) that can cause multiple relapses following an initial clinical episode caused by a mosquito-borne infection. Primaquine is the only anti-hypnozoite drug against P. vivax relapse currently available, with tafenoquine in the pipeline. However, both drugs may cause severe haemolysis in individuals with deficiency of the enzyme glucose-6-phosphate dehydrogenase (G6PD), a hereditary defect. The overall incidence of malaria has significantly declined in both Thailand and Cambodia over the last 15 years. However, P. vivax has replaced P. falciparum as the dominant species in large parts of both countries. This paper presents the experience of the national malaria control programmes of the two countries, in their efforts to implement safe primaquine therapy for the radical cure, i.e. relapse prevention, of P. vivax malaria by introducing a rapid, point-of-care test to screen for G6PD deficiency.

  2. A germline missense mutation in COQ6 is associated with susceptibility to familial schwannomatosis

    PubMed Central

    Zhang, Keqiang; Lin, Jia-Wei; Wang, Jinhui; Wu, Xiwei; Gao, Hanlin; Hsieh, Yi-Chen; Hwu, Peter; Liu, Yun-Ru; Su, Leila; Chiou, Hung-Yi; Wang, Daidong; Yuan, Yate-Ching; Whang-Peng, Jacqueline; Chiu, Wen-Ta; Yen, Yun

    2014-01-01

    Purpose: Schwannomatosis, a subtype of neurofibromatosis, is characterized by multiple benign, nonvestibular, nonintradermal schwannomas. Although the tumor suppressor SMARCB1 gene has been frequently identified as the underlying genetic cause of half of familial and ~10% of sporadic schwannomatosis, for most other cases, further causative genes remain to be discovered. Herein, we characterize the genome of a schwannomatosis family without constitutional inactivation of the SMARCB1 gene to explore novel genomic alterations predisposing individuals to the familial disease. Methods: We performed whole-genome/exome sequencing on genomic DNA of both schwannomatosis-affected and normal members of the family. Results: We identified a novel missense mutation (p.Asp208His; c.622G>C) in the coenzyme Q10 (CoQ10) biosynthesis monooxygenase 6 gene (COQ6) in schwannomatosis-affected members. The deleterious effects of the COQ6 mutations were validated by their lack of complementation in a coq6-deficient yeast mutant. Our study further indicated that the resultant haploinsufficiency of COQ6 might lead to CoQ10 deficiency and chronic overproduction of reactive oxygen species in Schwann cells. Conclusion: Although the exact oncogenetic mechanisms in this schwannomatosis family remain to be elucidated, our data strongly indicate a probable role of COQ6 mutation and CoQ10 deficiency in the development of familial schwannomatosis. PMID:24763291

  3. A germline missense mutation in COQ6 is associated with susceptibility to familial schwannomatosis.

    PubMed

    Zhang, Keqiang; Lin, Jia-Wei; Wang, Jinhui; Wu, Xiwei; Gao, Hanlin; Hsieh, Yi-Chen; Hwu, Peter; Liu, Yun-Ru; Su, Leila; Chiou, Hung-Yi; Wang, Daidong; Yuan, Yate-Ching; Whang-Peng, Jacqueline; Chiu, Wen-Ta; Yen, Yun

    2014-10-01

    Schwannomatosis, a subtype of neurofibromatosis, is characterized by multiple benign, nonvestibular, nonintradermal schwannomas. Although the tumor suppressor SMARCB1 gene has been frequently identified as the underlying genetic cause of half of familial and ~10% of sporadic schwannomatosis, for most other cases, further causative genes remain to be discovered. Herein, we characterize the genome of a schwannomatosis family without constitutional inactivation of the SMARCB1 gene to explore novel genomic alterations predisposing individuals to the familial disease. We performed whole-genome/exome sequencing on genomic DNA of both schwannomatosis-affected and normal members of the family. We identified a novel missense mutation (p.Asp208His; c.622G>C) in the coenzyme Q10 (CoQ10) biosynthesis monooxygenase 6 gene (COQ6) in schwannomatosis-affected members. The deleterious effects of the COQ6 mutations were validated by their lack of complementation in a coq6-deficient yeast mutant. Our study further indicated that the resultant haploinsufficiency of COQ6 might lead to CoQ10 deficiency and chronic overproduction of reactive oxygen species in Schwann cells. Although the exact oncogenetic mechanisms in this schwannomatosis family remain to be elucidated, our data strongly indicate a probable role of COQ6 mutation and CoQ10 deficiency in the development of familial schwannomatosis.Genet Med 16 10, 787-792.

  4. Leigh syndrome associated with mitochondrial complex I deficiency due to a novel mutation in the NDUFS1 gene.

    PubMed

    Martín, Miguel A; Blázquez, Alberto; Gutierrez-Solana, Luis G; Fernández-Moreira, Daniel; Briones, Paz; Andreu, Antoni L; Garesse, Rafael; Campos, Yolanda; Arenas, Joaquín

    2005-04-01

    Mutations in the nuclear-encoded subunits of complex I of the mitochondrial respiratory chain are a recognized cause of Leigh syndrome (LS). Recently, 6 mutations in the NDUFS1 gene were identified in 3 families. To describe a Spanish family with LS, complex I deficiency in muscle, and a novel mutation in the NDUFS1 gene. Using molecular genetic approaches, we identified the underlying molecular defect in a patient with LS with a complex I defect. The proband was a child who displayed the clinical features of LS. Muscle biochemistry results showed a complex I defect of the mitochondrial respiratory chain. Sequencing analysis of the mitochondrial DNA-encoded ND genes, the nuclear DNA-encoded NDUFV1, NDUFS1, NDUFS2, NDUFS4, NDUFS6, NDUFS7, NDUFS8, and NDUFAB1 genes, and the complex I assembly factor CIA30 gene revealed a novel homozygous L231V mutation (c.691C-->G) in the NDUFS1 gene. The parents were heterozygous carriers of the L231V mutation. Identifying nuclear mutations as a cause of respiratory chain disorders will enhance the possibility of prenatal diagnosis and help us understand how molecular defects can lead to complex I deficiency.

  5. Clinical features and gene mutational spectrum of CDKL5-related diseases in a cohort of Chinese patients

    PubMed Central

    2014-01-01

    Background Mutations in the cyclin-dependent kinase-like 5 (CDKL5) (NM_003159.2) gene have been associated with early-onset epileptic encephalopathies or Hanefeld variants of RTT(Rett syndrome). In order to clarify the CDKL5 genotype-phenotype correlations in Chinese patients, CDKL5 mutational screening in cases with early-onset epileptic encephalopathies and RTT without MECP2 mutation were performed. Methods The detailed clinical information including clinical manifestation, electroencephalogram (EEG), magnetic resonance imaging (MRI), blood, urine amino acid and organic acid screening of 102 Chinese patients with early-onset epileptic encephalopathies and RTT were collected. CDKL5 gene mutations were analyzed by PCR, direct sequencing and multiplex ligation-dependent probe amplification (MLPA). The patterns of X-chromosome inactivation (XCI) were studied in the female patients with CDKL5 gene mutation. Results De novo CDKL5 gene mutations were found in ten patients including one missense mutation (c.533G > A, p.R178Q) which had been reported, two splicing mutations (ISV6 + 1A > G, ISV13 + 1A > G), three micro-deletions (c.1111delC, c.2360delA, c.234delA), two insertions (c.1791 ins G, c.891_892 ins TT in a pair of twins) and one nonsense mutation (c.1375C > T, p.Q459X). Out of ten patients, 7 of 9 females with Hanefeld variants of RTT and the remaining 2 females with early onset epileptic encephalopathy, were detected while only one male with infantile spasms was detected. The common features of all female patients with CDKL5 gene mutations included refractory seizures starting before 4 months of age, severe psychomotor retardation, Rett-like features such as hand stereotypies, deceleration of head growth after birth and poor prognosis. In contrast, the only one male patient with CDKL5 mutation showed no obvious Rett-like features as females in our cohort. The X-chromosome inactivation patterns of all the female patients were random. Conclusions Mutations in CDKL

  6. Clinical features and gene mutational spectrum of CDKL5-related diseases in a cohort of Chinese patients.

    PubMed

    Zhao, Ying; Zhang, Xiaoying; Bao, Xinhua; Zhang, Qingping; Zhang, Jingjing; Cao, Guangna; Zhang, Jie; Li, Jiarui; Wei, Liping; Pan, Hong; Wu, Xiru

    2014-02-25

    Mutations in the cyclin-dependent kinase-like 5 (CDKL5) (NM_003159.2) gene have been associated with early-onset epileptic encephalopathies or Hanefeld variants of RTT(Rett syndrome). In order to clarify the CDKL5 genotype-phenotype correlations in Chinese patients, CDKL5 mutational screening in cases with early-onset epileptic encephalopathies and RTT without MECP2 mutation were performed. The detailed clinical information including clinical manifestation, electroencephalogram (EEG), magnetic resonance imaging (MRI), blood, urine amino acid and organic acid screening of 102 Chinese patients with early-onset epileptic encephalopathies and RTT were collected. CDKL5 gene mutations were analyzed by PCR, direct sequencing and multiplex ligation-dependent probe amplification (MLPA). The patterns of X-chromosome inactivation (XCI) were studied in the female patients with CDKL5 gene mutation. De novo CDKL5 gene mutations were found in ten patients including one missense mutation (c.533G > A, p.R178Q) which had been reported, two splicing mutations (ISV6 + 1A > G, ISV13 + 1A > G), three micro-deletions (c.1111delC, c.2360delA, c.234delA), two insertions (c.1791 ins G, c.891_892 ins TT in a pair of twins) and one nonsense mutation (c.1375C > T, p.Q459X). Out of ten patients, 7 of 9 females with Hanefeld variants of RTT and the remaining 2 females with early onset epileptic encephalopathy, were detected while only one male with infantile spasms was detected. The common features of all female patients with CDKL5 gene mutations included refractory seizures starting before 4 months of age, severe psychomotor retardation, Rett-like features such as hand stereotypies, deceleration of head growth after birth and poor prognosis. In contrast, the only one male patient with CDKL5 mutation showed no obvious Rett-like features as females in our cohort. The X-chromosome inactivation patterns of all the female patients were random. Mutations in CDKL5 gene are responsible for 7 with

  7. G6PD deficiency and absence of α-thalassemia increase the risk for cerebral vasculopathy in children with sickle cell anemia.

    PubMed

    Joly, Philippe; Garnier, Nathalie; Kebaili, Kamila; Renoux, Céline; Dony, Arthur; Cheikh, Nathalie; Renard, Cécile; Ceraulo, Antony; Cuzzubbo, Daniela; Pondarré, Corinne; Martin, Cyril; Pialoux, Vincent; Francina, Alain; Bertrand, Yves; Connes, Philippe

    2016-04-01

    The aim of this study was to test the association between hematological/genetic factors and cerebral vasculopathy in children with sickle cell anemia (SCA). A group with cerebral vasculopathy (VASC) was composed of children who had stroke (n = 6), silent infarct (n = 11), or an abnormal transcranial Doppler (n = 5). Eighty-four patients had neither positive history of stroke or silent infarct, nor abnormal transcranial Doppler (NORM group). An intermediate group (COND; n = 15) was composed of SCA children with a conditional transcranial Doppler. Biological analyses were performed on samples obtained at steady state and before the beginning of any chronic treatment. The comparisons of the three groups demonstrated a protective effect of α-thalassemia against cerebral vasculopathy through its effects on hemoglobin and reticulocyte levels. Moreover, we observed higher frequency of G6PD deficiency in the VASC group compared with the other groups. Our study confirms the key role of α-thalassemia and G6PD status in the pathophysiology of cerebral vasculopathy in SCA children. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  8. Overexpression of G6PD and HSP90 Beta in Mice with Benzene Exposure Revealed by Serum Peptidome Analysis

    PubMed Central

    Zhang, Juan; Tan, Kehong; Meng, Xing; Yang, Wenwen; Wei, Haiyan; Sun, Rongli; Yin, Lihong; Pu, Yuepu

    2015-01-01

    The small peptides representation of the original proteins are a valuable source of information that can be used as biomarkers involved in toxicity mechanism for chemical exposure. The aim of this study is to investigate serum peptide biomarkers of benzene exposure. C57BL/6 mice were enrolled into control group and benzene groups of 150 and 300 mg/kg/d Serum peptides were identified by mass spectrometry using an assisted laser desorption ionization/time of flight mass spectrometry (MS). Differential peptide spectra were obtained by tandem mass spectrometry and analyzed by searching the International Protein Index using the Sequest program. Forty-one peptide peaks were found in the range of 1000–10,000 Da molecular weight. Among them, seven peaks showed significantly different expression between exposure groups and control group. Two peptide peaks (1231.2 and 1241.8), which showed a two-fold increase in expression, were sequenced and confirmed as glucose 6-phosphate dehydrogenase (G6PD) and heat shock protein 90 Beta (HSP90 Beta), respectively. Furthermore, the expression of the two proteins in liver cells showed the same trend as in serum. In conclusion, G6PD and HSP90 beta might be the candidate serum biomarkers of benzene exposure. It also provided possible clues for the molecular mechanism of benzene-induced oxidative stress. PMID:26378550

  9. Mutation and repair induced by the carcinogen 2-(hydroxyamino)-1-methyl-6-phenylimidazo[4,5-b]pyridine (N-OH-PhIP) in the dihydrofolate reductase gene of Chinese hamster ovary cells and conformational modeling of the dG-C8-PhIP adduct in DNA.

    PubMed

    Carothers, A M; Yuan, W; Hingerty, B E; Broyde, S; Grunberger, D; Snyderwine, E G

    1994-01-01

    Three experiments using 20 microM 2-(hydroxyamino)-1-methyl-6-phenylimidazo[4,5-b]pyridine (N-OH-PhIP) were performed to induce mutations in the dihydrofolate reductase (DHFR) gene of a hemizygous Chinese hamster ovary (CHO) cell line (UA21). Metabolized forms of this chemical primarily bind at the C-8 position of guanine in DNA. In total, 21 independent induced mutants were isolated and 20 were characterized. DNA sequencing showed that the preferred mutation type found in 75% of the induced DHFR- clones was G.C-->T.A single and tandem double transversions. In addition to base substitutions, one mutant carried a-1 frameshift and another one had lost the entire locus by deletion. The induced changes affected purine targets on the nontranscribed strand of the gene in nearly all of the mutants sequenced (18/19). At the time that the first two experiments were performed, the initial adduct levels were quantitated in treated cells at the mutagenic dose by 32P-postlabeling. While the induced frequency of mutation was relatively low (approximately 5 x 10(-6), the adduct levels after a 1-h exposure of UA21 cells to 20 microM N-OH-PhIP were relatively high (13 adducts x 10(-6) nucleotides). This latter method was then employed to learn if the induced mutation frequency correlated with rapid overall genome repair of PhIP-DNA adducts. Total adduct levels, determined using DNA samples from treated cells collected after intervals of time, were reduced by about 50% after 6 h, and about 70% after 24 h. Since overall genome repair in CHO cells is relatively slow compared with preferential gene repair, the removal of dG-C8-PhIP adducts was apparently efficient. In order to better understand the mutational and repair results, we performed computational modeling to determine the lowest energy structure for the major dG-C8-PhIP adduct in a repetitively mutated duplex sequence opposite dA. Results of this analysis indicate that the PhIP-modified base resembles previous structural

  10. Generation of gene-corrected iPSC line from Parkinson's disease patient iPSC line with alpha-SNCA A53T mutation.

    PubMed

    Lee, Seo-Young; Jeong, SangKyun; Kim, Janghwan; Chung, Sun-Ku

    2018-06-09

    Parkinson's disease (PD) is the second most common age-related neurodegenerative disorder. PD can result from a mutation of alpha-synuclein (α-SNCA), such as α-SNCA A53T. Using episomal vectors, induced pluripotent stem cells (iPSCs) were generated from skin fibroblasts with the α-SNCA A53T mutation. A huge bacterial artificial chromosome (BAC) harboring the normal α-SNCA gene successfully corrected the α-SNCA A53T-mutant iPSCs. Melting curve analysis for allelic composition indicated that the BAC DNA was precisely targeted to the α-SNCA A53T mutation allele, without random integration. The corrected PD-iPSCs displayed the normal karyotype and pluripotency, with the capability to differentiate to any cell type. Copyright © 2018 The Author(s). Published by Elsevier B.V. All rights reserved.

  11. Detection of the V1016G mutation in the voltage-gated sodium channel gene of Aedes aegypti (Diptera: Culicidae) by allele-specific PCR assay, and its distribution and effect on deltamethrin resistance in Thailand.

    PubMed

    Stenhouse, Steven A; Plernsub, Suriya; Yanola, Jintana; Lumjuan, Nongkran; Dantrakool, Anchalee; Choochote, Wej; Somboon, Pradya

    2013-08-30

    Resistance to pyrethroid insecticides is widespread among populations of Aedes aegypti, the main vector for the dengue virus. Several different point mutations within the voltage-gated sodium channel (VGSC) gene contribute to such resistance. A mutation at position 1016 in domain II, segment 6 of the VGSC gene in Ae. aegypti leads to a valine to glycine substitution (V1016G) that confers resistance to deltamethrin. This study developed and utilized an allele-specific PCR (AS-PCR) assay that could be used to detect the V1016G mutation. The assay was validated against a number of sequenced DNA samples of known genotype and was determined to be in complete agreement. Larvae and pupae were collected from various localities throughout Thailand. Samples were reared to adulthood and their resistance status against deltamethrin was determined by standard WHO susceptibility bioassays. Deltamethrin-resistant and susceptible insects were then genotyped for the V1016G mutation. Additionally, some samples were genotyped for a second mutation at position 1534 in domain III (F1534C) which is also known to confer pyrethroid resistance. The bioassay results revealed an overall mortality of 77.6%. Homozygous 1016G individuals survived at higher rates than either heterozygous or wild-type (1016 V) mosquitoes. The 1016G mutation was significantly and positively associated with deltamethrin resistance and was widely distributed throughout Thailand. Interestingly, wild-type 1016 V mosquitoes tested were homozygous for the 1534C mutation, and all heterozygous mosquitoes were also heterozygous for 1534C. Mutant homozygous (G/G) mosquitoes expressed the wild-type (F/F) at position 1534. However, the presence of the 1534C mutation was not associated with deltamethrin resistance. Our bioassay results indicate that all populations sampled display some degree of resistance to deltamethrin. Homozygous 1016G mosquitoes were far likelier to survive such exposure. However, resistance in some

  12. Integrated Analysis of Mutation Data from Various Sources Identifies Key Genes and Signaling Pathways in Hepatocellular Carcinoma

    PubMed Central

    Wei, Lin; Tang, Ruqi; Lian, Baofeng; Zhao, Yingjun; He, Xianghuo; Xie, Lu

    2014-01-01

    Background Recently, a number of studies have performed genome or exome sequencing of hepatocellular carcinoma (HCC) and identified hundreds or even thousands of mutations in protein-coding genes. However, these studies have only focused on a limited number of candidate genes, and many important mutation resources remain to be explored. Principal Findings In this study, we integrated mutation data obtained from various sources and performed pathway and network analysis. We identified 113 pathways that were significantly mutated in HCC samples and found that the mutated genes included in these pathways contained high percentages of known cancer genes, and damaging genes and also demonstrated high conservation scores, indicating their important roles in liver tumorigenesis. Five classes of pathways that were mutated most frequently included (a) proliferation and apoptosis related pathways, (b) tumor microenvironment related pathways, (c) neural signaling related pathways, (d) metabolic related pathways, and (e) circadian related pathways. Network analysis further revealed that the mutated genes with the highest betweenness coefficients, such as the well-known cancer genes TP53, CTNNB1 and recently identified novel mutated genes GNAL and the ADCY family, may play key roles in these significantly mutated pathways. Finally, we highlight several key genes (e.g., RPS6KA3 and PCLO) and pathways (e.g., axon guidance) in which the mutations were associated with clinical features. Conclusions Our workflow illustrates the increased statistical power of integrating multiple studies of the same subject, which can provide biological insights that would otherwise be masked under individual sample sets. This type of bioinformatics approach is consistent with the necessity of making the best use of the ever increasing data provided in valuable databases, such as TCGA, to enhance the speed of deciphering human cancers. PMID:24988079

  13. Integrated analysis of mutation data from various sources identifies key genes and signaling pathways in hepatocellular carcinoma.

    PubMed

    Zhang, Yuannv; Qiu, Zhaoping; Wei, Lin; Tang, Ruqi; Lian, Baofeng; Zhao, Yingjun; He, Xianghuo; Xie, Lu

    2014-01-01

    Recently, a number of studies have performed genome or exome sequencing of hepatocellular carcinoma (HCC) and identified hundreds or even thousands of mutations in protein-coding genes. However, these studies have only focused on a limited number of candidate genes, and many important mutation resources remain to be explored. In this study, we integrated mutation data obtained from various sources and performed pathway and network analysis. We identified 113 pathways that were significantly mutated in HCC samples and found that the mutated genes included in these pathways contained high percentages of known cancer genes, and damaging genes and also demonstrated high conservation scores, indicating their important roles in liver tumorigenesis. Five classes of pathways that were mutated most frequently included (a) proliferation and apoptosis related pathways, (b) tumor microenvironment related pathways, (c) neural signaling related pathways, (d) metabolic related pathways, and (e) circadian related pathways. Network analysis further revealed that the mutated genes with the highest betweenness coefficients, such as the well-known cancer genes TP53, CTNNB1 and recently identified novel mutated genes GNAL and the ADCY family, may play key roles in these significantly mutated pathways. Finally, we highlight several key genes (e.g., RPS6KA3 and PCLO) and pathways (e.g., axon guidance) in which the mutations were associated with clinical features. Our workflow illustrates the increased statistical power of integrating multiple studies of the same subject, which can provide biological insights that would otherwise be masked under individual sample sets. This type of bioinformatics approach is consistent with the necessity of making the best use of the ever increasing data provided in valuable databases, such as TCGA, to enhance the speed of deciphering human cancers.

  14. High prevalence of the point mutation in exon 6 of the xeroderma pigmentosum group A-complementing (XPAC) gene in xeroderma pigmentosum group A patients in Tunisia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nishigori, Chikako; Imamura, Sadao; Yagi, Takashi

    1993-11-01

    Xeroderma pigmentosum (XP) patients in Tunisia who belong to the genetic complementation group A (XPA) have milder skin symptoms than do Japanese XPA patients. Such difference in the clinical features might be caused by the difference in the site of mutation in the XP A-complementing (XPAC) gene. The purpose of this study is to identify the genetic alterations in the XPAC gene in the Tunisian XPA patients and to investigate the relationship between the clinical symptoms and the genetic alterations. Three sites of mutation in the XPAC gene have been identified in the Japanese XPA patients, and about 85% ofmore » them have a G [yields] C point mutation at the splicing acceptor site of intron 3. The authors found that six (86%) of seven Tunisian XPA patients had a nonsense mutation in codon 228 in exon 6, because of a CGA [yields] TGA point mutation, which can be detected by the HphI RFLP. This type of mutation is the same as those found in two Japanese XPA patients with mild clinical RFLP. Milder skin symptoms in the XPA patients in Tunisia than in those in Japan, despite mostly sunny weather and the unsatisfactory sun protection in Tunisia, should be due to the difference in the mutation site. 11 refs., 2 figs., 2 tabs.« less

  15. Identification of ALK germline mutation (3605delG) in pediatric anaplastic medulloblastoma.

    PubMed

    Coco, Simona; De Mariano, Marilena; Valdora, Francesca; Servidei, Tiziana; Ridola, Vita; Andolfo, Immacolata; Oberthuer, André; Tonini, Gian Paolo; Longo, Luca

    2012-10-01

    The anaplastic lymphoma kinase (ALK) gene has been found either rearranged or mutated in several neoplasms such as anaplastic large-cell lymphoma, non-small-cell lung cancer, neuroblastoma and anaplastic thyroid cancer. Medulloblastoma (MB) is an embryonic pediatric cancer arising from nervous system, a tissue in which ALK is expressed during embryonic development. We performed an ALK mutation screening in 52 MBs and we found a novel heterozygous germline deletion of a single base in exon 23 (3605delG) in a case with marked anaplasia. This G deletion results in a frameshift mutation producing a premature stop codon in exon 25 of ALK tyrosine kinase domain. We also screened three human MB cell lines without finding any mutation of ALK gene. Quantitative expression analysis of 16 out of 52 samples showed overexpression of ALK mRNA in three MBs. In the present study, we report the first mutation of ALK found in MB. Moreover, a deletion of ALK gene producing a stop codon has not been detected in human tumors up to now. Further investigations are now required to elucidate whether the truncated form of ALK may have a role in signal transduction.

  16. Screening for mutations in two exons of FANCG gene in Pakistani population.

    PubMed

    Aymun, Ujala; Iram, Saima; Aftab, Iram; Khaliq, Saba; Nadir, Ali; Nisar, Ahmed; Mohsin, Shahida

    2017-06-01

    Fanconi anemia is a rare autosomal recessive disorder of genetic instability. It is both molecularly and clinically, a heterogeneous disorder. Its incidence is 1 in 129,000 births and relatively high in some ethnic groups. Sixteen genes have been identified among them mutations in FANCG gene are most common after FANCA and FANCC gene mutations. To study mutations in exon 3 and 4 of FANCG gene in Pakistani population. Thirty five patients with positive Diepoxybutane test were included in the study. DNA was extracted and amplified for exons 3 and 4. Thereafter Sequencing was done and analyzed for the presence of mutations. No mutation was detected in exon 3 whereas a carrier of known mutation c.307+1 G>T was found in exon 4 of the FANCG gene. Absence of any mutation in exon 3 and only one heterozygous mutation in exon 4 of FANCG gene points to a different spectrum of FA gene pool in Pakistan that needs extensive research in this area.

  17. TCOF1 mutation database: novel mutation in the alternatively spliced exon 6A and update in mutation nomenclature.

    PubMed

    Splendore, Alessandra; Fanganiello, Roberto D; Masotti, Cibele; Morganti, Lucas S C; Passos-Bueno, M Rita

    2005-05-01

    Recently, a novel exon was described in TCOF1 that, although alternatively spliced, is included in the major protein isoform. In addition, most published mutations in this gene do not conform to current mutation nomenclature guidelines. Given these observations, we developed an online database of TCOF1 mutations in which all the reported mutations are renamed according to standard recommendations and in reference to the genomic and novel cDNA reference sequences (www.genoma.ib.usp.br/TCOF1_database). We also report in this work: 1) results of the first screening for large deletions in TCOF1 by Southern blot in patients without mutation detected by direct sequencing; 2) the identification of the first pathogenic mutation in the newly described exon 6A; and 3) statistical analysis of pathogenic mutations and polymorphism distribution throughout the gene.

  18. [Analysis of gene mutation of early onset epileptic spasm with unknown reason].

    PubMed

    Yang, X; Pan, G; Li, W H; Zhang, L M; Wu, B B; Wang, H J; Zhang, P; Zhou, S Z

    2017-11-02

    Objective: To summarize the gene mutation of early onset epileptic spasm with unknown reason. Method: In this prospective study, data of patients with early onset epileptic spasm with unknown reason were collected from neurological department of Children's Hospital of Fudan University between March 2016 and December 2016. Patients with known disorders such as infection, metabolic, structural, immunological problems and known genetic mutations were excluded. Patients with genetic disease that can be diagnosed by clinical manifestations and phenotypic characteristics were also excluded. Genetic research methods included nervous system panel containing 1 427 epilepsy genes, whole exome sequencing (WES), analysis of copy number variation (CNV) and karyotype analysis of chromosome. The basic information, phenotypes, genetic results and the antiepileptic treatment of patients were analyzed. Result: Nine of the 17 cases with early onset epileptic spasm were boys and eight were girls. Patients' age at first seizure onset ranged from 1 day after birth to 8 months (median age of 3 months). The first hospital visit age ranged from 1 month to 2 years (median age of 4.5 months). The time of following-up ranged from 8 months to 3 years and 10 months. All the 17 patients had early onset epileptic spasm. Video electroencephalogram was used to monitor the spasm seizure. Five patients had Ohtahara syndrome, 10 had West syndrome, two had unclear classification. In 17 cases, 10 of them had detected pathogenic genes. Nine cases had point mutations, involving SCN2A, ARX, UNC80, KCNQ2, and GABRB3. Except one case of mutations in GABRB3 gene have been reported, all the other cases had new mutations. One patient had deletion mutation in CDKL5 gene. One CNV case had 6q 22.31 5.5MB repeats. Ten cases out of 17 were using 2-3 antiepileptic drugs (AEDs) and the drugs had no effect. Seven cases used adrenocorticotropic hormone (ACTH) and prednisone besides AEDs (a total course for 8 weeks

  19. Detection of EGFR Gene Mutation by Mutation-oriented LAMP Method.

    PubMed

    Matsumoto, Naoyuki; Kumasaka, Akira; Ando, Tomohiro; Komiyama, Kazuo

    2018-04-01

    Epidermal growth factor receptor (EGFR) is a target of molecular therapeutics for non-small cell lung cancer. EGFR gene mutations at codons 746-753 promote constitutive EGFR activation and result in worst prognosis. However, these mutations augment the therapeutic effect of EGFR-tyrosine kinase inhibitor. Therefore, the detection of EGFR gene mutations is important for determining treatment planning. The aim of the study was to establish a method to detect EGFR gene mutations at codons 746-753. EGFR gene mutation at codons 746-753 in six cancer cell lines were investigated. A loop-mediated isothermal amplification (LAMP)-based procedure was developed, that employed peptide nucleic acid to suppress amplification of the wild-type allele. This mutation-oriented LAMP can amplify the DNA fragment of the EGFR gene with codons 746-753 mutations within 30 min. Moreover, boiled cells can work as template resources. Mutation oriented-LAMP assay for EGFR gene mutation is sensitive on extracted DNA. This procedure would be capable of detecting EGFR gene mutation in sputum, pleural effusion, broncho-alveolar lavage fluid or trans-bronchial lung biopsy by chair side. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  20. Novel mutations of endothelin-B receptor gene in Pakistani patients with Waardenburg syndrome.

    PubMed

    Jabeen, Raheela; Babar, Masroor Ellahi; Ahmad, Jamil; Awan, Ali Raza

    2012-01-01

    Mutations in EDNRB gene have been reported to cause Waardenburg-Shah syndrome (WS4) in humans. We investigated 17 patients with WS4 for identification of mutations in EDNRB gene using PCR and direct sequencing technique. Four genomic mutations were detected in four patients; a G to C transversion in codon 335 (S335C) in exon 5 and a transition of T to C in codon (S361L) in exon 5, a transition of A to G in codon 277 (L277L) in exon 4, a non coding transversion of T to A at -30 nucleotide position of exon 5. None of these mutations were found in controls. One of the patients harbored two novel mutations (S335C, S361L) in exon 5 and one in Intronic region (-30exon5 A>G). All of the mutations were homozygous and novel except the mutation observed in exon 4. In this study, we have identified 3 novel mutations in EDNRB gene associated with WS4 in Pakistani patients.

  1. Mutation frequencies of the cytochrome CYP2D6 gene in Parkinson disease patients and in families

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lucotte, G.; Turpin, J.C.; Gerard, N.

    1996-07-26

    The frequencies of five mutations of the debrisoquine 4-hydroxylase (CYP2D6) gene (mutations D6-A, B, C, D, and T), corresponding to poor metabolizer (PM) phenotypes, were determined by restriction fragment length polymorphism (RFLP) and polymerase chain reaction (PCR) in 47 patients with Parkinson disease, and compared with the findings in 47 healthy controls. These mutant alleles were about twice as frequent among patients as in controls, with an approximate relative risk ratio of 2.12 (95% confidence interval, 1.41-2.62). There seem to be no significant differences in frequencies of mutant genotypes in patients among gender and modalities of response with levodopa therapy;more » but frequency of the mutations was slightly enhanced after age-at-onset of 60 years. Mutations D6-B, D, and T were detected in 7 patients belonging to 10 Parkinson pedigrees. 25 refs., 1 fig., 2 tabs.« less

  2. Three major glucose-6-phosphate dehydrogenase-deficient polymorphic variants identified in Mazandaran state of Iran.

    PubMed

    Mesbah-Namin, Seyed A; Sanati, Mohammad H; Mowjoodi, Alireza; Mason, Philip J; Vulliamy, Tom J; Noori-Daloii, Mohammad R

    2002-06-01

    We report the first investigation of glucose- 6-phosphate dehydrogenase (G6PD) deficiency among the Mazandaranians in the north of Iran. We analysed the G6PD gene in 74 unrelated G6PD-deficient men with a history of favism. Molecular analysis revealed three major different polymorphic variants: G6PD Mediterranean 66.2% (49 out of 74), G6PD Chatham 27% (20 out of 74), G6PD Cosenza 6.75% (5 out of 74). These findings indicated a higher prevalence of G6PD Chatham in this Iranian population than anywhere else in the world. In addition, the distribution of these G6PD variants is more similar to that found in an Italian population than in other Middle Eastern countries.

  3. Identification of Deleterious Mutations in Myostatin Gene of Rohu Carp (Labeo rohita) Using Modeling and Molecular Dynamic Simulation Approaches.

    PubMed

    Rasal, Kiran Dashrath; Chakrapani, Vemulawada; Patra, Swagat Kumar; Mohapatra, Shibani D; Nayak, Swapnarani; Jena, Sasmita; Sundaray, Jitendra Kumar; Jayasankar, Pallipuram; Barman, Hirak Kumar

    2016-01-01

    The myostatin (MSTN) is a known negative growth regulator of skeletal muscle. The mutated myostatin showed a double-muscular phenotype having a positive significance for the farmed animals. Consequently, adequate information is not available in the teleosts, including farmed rohu carp, Labeo rohita. In the absence of experimental evidence, computational algorithms were utilized in predicting the impact of point mutation of rohu myostatin, especially its structural and functional relationships. The four mutations were generated at different positions (p.D76A, p.Q204P, p.C312Y, and p.D313A) of MSTN protein of rohu. The impacts of each mutant were analyzed using SIFT, I-Mutant 2.0, PANTHER, and PROVEAN, wherein two substitutions (p.D76A and p.Q204P) were predicted as deleterious. The comparative structural analysis of each mutant protein with the native was explored using 3D modeling as well as molecular-dynamic simulation techniques. The simulation showed altered dynamic behaviors concerning RMSD and RMSF, for either p.D76A or p.Q204P substitution, when compared with the native counterpart. Interestingly, incorporated two mutations imposed a significant negative impact on protein structure and stability. The present study provided the first-hand information in identifying possible amino acids, where mutations could be incorporated into MSTN gene of rohu carp including other carps for undertaking further in vivo studies.

  4. Sleep Disorders in Parkinsonian and Nonparkinsonian LRRK2 Mutation Carriers

    PubMed Central

    Pont-Sunyer, Claustre; Iranzo, Alex; Gaig, Carles; Fernández-Arcos, Ana; Vilas, Dolores; Valldeoriola, Francesc; Compta, Yaroslau; Fernández-Santiago, Ruben; Fernández, Manel; Bayés, Angels; Calopa, Matilde; Casquero, Pilar; de Fàbregues, Oriol; Jaumà, Serge; Puente, Victor; Salamero, Manel; José Martí, Maria; Santamaría, Joan; Tolosa, Eduard

    2015-01-01

    Objective In idiopathic Parkinson disease (IPD) sleep disorders are common and may antedate the onset of parkinsonism. Based on the clinical similarities between IPD and Parkinson disease associated with LRRK2 gene mutations (LRRK2-PD), we aimed to characterize sleep in parkinsonian and nonmanifesting LRRK2 mutation carriers (NMC). Methods A comprehensive interview conducted by sleep specialists, validated sleep scales and questionnaires, and video-polysomnography followed by multiple sleep latency test (MSLT) assessed sleep in 18 LRRK2-PD (17 carrying G2019S and one R1441G mutations), 17 NMC (11 G2019S, three R1441G, three R1441C), 14 non-manifesting non-carriers (NMNC) and 19 unrelated IPD. Results Sleep complaints were frequent in LRRK2-PD patients; 78% reported poor sleep quality, 33% sleep onset insomnia, 56% sleep fragmentation and 39% early awakening. Sleep onset insomnia correlated with depressive symptoms and poor sleep quality. In LRRK2-PD, excessive daytime sleepiness (EDS) was a complaint in 33% patients and short sleep latencies on the MSLT, which are indicative of objective EDS, were found in 71%. Sleep attacks occurred in three LRRK2-PD patients and a narcoleptic phenotype was not observed. REM sleep behavior disorder (RBD) was diagnosed in three LRRK2-PD. EDS and RBD were always reported to start after the onset of parkinsonism in LRRK2-PD. In NMC, EDS was rarely reported and RBD was absent. When compared to IPD, sleep onset insomnia was more significantly frequent, EDS was similar, and RBD was less significantly frequent and less severe in LRRK2-PD. In NMC, RBD was not detected and sleep complaints were much less frequent than in LRRK2-PD. No differences were observed in sleep between NMC and NMNC. Conclusions Sleep complaints are frequent in LRRK2-PDand show a pattern that when compared to IPD is characterized by more frequent sleep onset insomnia, similar EDS and less prominent RBD. Unlike in IPD, RBD and EDS seem to be not markers of the

  5. Efficient gene-driven germ-line point mutagenesis of C57BL/6J mice

    PubMed Central

    Michaud, Edward J; Culiat, Cymbeline T; Klebig, Mitchell L; Barker, Paul E; Cain, KT; Carpenter, Debra J; Easter, Lori L; Foster, Carmen M; Gardner, Alysyn W; Guo, ZY; Houser, Kay J; Hughes, Lori A; Kerley, Marilyn K; Liu, Zhaowei; Olszewski, Robert E; Pinn, Irina; Shaw, Ginger D; Shinpock, Sarah G; Wymore, Ann M; Rinchik, Eugene M; Johnson, Dabney K

    2005-01-01

    Background Analysis of an allelic series of point mutations in a gene, generated by N-ethyl-N-nitrosourea (ENU) mutagenesis, is a valuable method for discovering the full scope of its biological function. Here we present an efficient gene-driven approach for identifying ENU-induced point mutations in any gene in C57BL/6J mice. The advantage of such an approach is that it allows one to select any gene of interest in the mouse genome and to go directly from DNA sequence to mutant mice. Results We produced the Cryopreserved Mutant Mouse Bank (CMMB), which is an archive of DNA, cDNA, tissues, and sperm from 4,000 G1 male offspring of ENU-treated C57BL/6J males mated to untreated C57BL/6J females. Each mouse in the CMMB carries a large number of random heterozygous point mutations throughout the genome. High-throughput Temperature Gradient Capillary Electrophoresis (TGCE) was employed to perform a 32-Mbp sequence-driven screen for mutations in 38 PCR amplicons from 11 genes in DNA and/or cDNA from the CMMB mice. DNA sequence analysis of heteroduplex-forming amplicons identified by TGCE revealed 22 mutations in 10 genes for an overall mutation frequency of 1 in 1.45 Mbp. All 22 mutations are single base pair substitutions, and nine of them (41%) result in nonconservative amino acid substitutions. Intracytoplasmic sperm injection (ICSI) of cryopreserved spermatozoa into B6D2F1 or C57BL/6J ova was used to recover mutant mice for nine of the mutations to date. Conclusions The inbred C57BL/6J CMMB, together with TGCE mutation screening and ICSI for the recovery of mutant mice, represents a valuable gene-driven approach for the functional annotation of the mammalian genome and for the generation of mouse models of human genetic diseases. The ability of ENU to induce mutations that cause various types of changes in proteins will provide additional insights into the functions of mammalian proteins that may not be detectable by knockout mutations. PMID:16300676

  6. Determination of optimal cutoff value to accurately identify glucose-6-phosphate dehydrogenase-deficient heterozygous female neonates.

    PubMed

    Miao, Jing-Kun; Chen, Qi-Xiong; Bao, Li-Ming; Huang, Yi; Zhang, Juan; Wan, Ke-Xing; Yi, Jing; Wang, Shi-Yi; Zou, Lin; Li, Ting-Yu

    2013-09-23

    Conventional screening tests to assess G6PD deficiency use a low cutoff value of 2.10 U/gHb which may not be adequate for detecting females with heterozygous deficiency. The aim of present study was to determine an appropriate cutoff value with increased sensitivity in identifying G6PD-deficient heterozygous females. G6PD activity analysis was performed on 51,747 neonates using semi-quantitative fluorescent spot test. Neonates suspected with G6PD deficiency were further analyzed using quantitatively enzymatic assay and for common G6PD mutations. The cutoff values of G6PD activity were estimated using the receiver operating characteristic curve. Our results demonstrated that using 2.10 U/g Hb as a cutoff, the sensitivity of the assay to detect female neonates with G6PD heterozygous deficiency was 83.3%, as compared with 97.6% using 2.55 U/g Hb as a cutoff. The high cutoff identified 21% (8/38) of the female neonates with partial G6PD deficiency which were not detected with 2.10 U/g Hb. Our study found that high cutoffs, 2.35 and 2.55 U/g Hb, would increase assay's sensitivity to identify male and female G6PD deficiency neonates, respectively. We established a reliable cutoff value of G6PD activity with increased sensitivity in identifying female newborns with partial G6PD deficiency. Copyright © 2013 Elsevier B.V. All rights reserved.

  7. Novel mutations of ABCB6 associated with autosomal dominant dyschromatosis universalis hereditaria.

    PubMed

    Cui, Ying-Xia; Xia, Xin-Yi; Zhou, Yang; Gao, Lin; Shang, Xue-Jun; Ni, Tong; Wang, Wei-Ping; Fan, Xiao-Buo; Yin, Hong-Lin; Jiang, Shao-Jun; Yao, Bing; Hu, Yu-An; Wang, Gang; Li, Xiao-Jun

    2013-01-01

    Dyschromatosis universalis hereditaria (DUH) is a rare heterogeneous pigmentary genodermatosis, which was first described in 1933. The genetic cause has recently been discovered by the discovery of mutations in ABCB6. Here we investigated a Chinese family with typical features of autosomal dominant DUH and 3 unrelated patients with sporadic DUH. Skin tissues were obtained from the proband, of this family and the 3 sporadic patients. Histopathological examination and immunohistochemical analysis of ABCB6 were performed. Peripheral blood DNA samples were obtained from 21 affected, 14 unaffected, 11 spouses in the family and the 3 sporadic patients. A genome-wide linkage scan for the family was carried out to localize the causative gene. Exome sequencing was performed from 3 affected and 1 unaffected in the family. Sanger sequencing of ABCB6 was further used to identify the causative gene for all samples obtained from available family members, the 3 sporadic patients and a panel of 455 ethnically-matched normal Chinese individuals. Histopathological analysis showed melanocytes in normal control's skin tissue and the hyperpigmented area contained more melanized, mature melanosomes than those within the hypopigmented areas. Empty immature melanosomes were found in the hypopigmented melanocytes. Parametric multipoint linkage analysis produced a HLOD score of 4.68, with markers on chromosome 2q35-q37.2. A missense mutation (c.1663 C>A, p.Gln555Lys) in ABCB6 was identified in this family by exome and Sanger sequencing. The mutation perfectly cosegregated with the skin phenotype. An additional mutation (g.776 delC, c.459 delC) in ABCB6 was found in an unrelated sporadic patient. No mutation in ABCB6 was discovered in the other two sporadic patients. Neither of the two mutations was present in the 455 controls. Melanocytes showed positive immunoreactivity to ABCB6. Our data add new variants to the repertoire of ABCB6 mutations with DUH.

  8. A novel autosomal partially dominant mutation designated G476D in the keratin 5 gene causing epidermolysis bullosa simplex Weber-Cockayne type: a family study with a genetic twist.

    PubMed

    Kowalewski, Cezary; Hamada, Takahiro; Wozniak, Katarzyna; Kawano, Yuko; Szczecinska, Weronika; Yasumoto, Shinichiro; Schwartz, Robert A; Hashimoto, Takashi

    2007-07-01

    Epidermolysis bullosa simplex Weber-Cockayne type (EBS-WC) is a genetically inherited skin disease characterized by blistering restricted to the palms and soles. Its inheritance in nearly all kindreds is caused by a dominant-negative mutation in either KRT5 or KRT14, the genes encoding keratin 5 and keratin 14 proteins, respectively. Rarely, recessive mutations have also been found. We described a family with EBS-WC caused by a novel autosomal dominant mutation (G476D) in the keratin 5 gene. One family member was first seen with mucosal erosions and generalized blisters localized on the anogenital area, trunk, face and sites of mechanical trauma. Molecular analysis in this patient showed the presence of an additional mutation, an autosomal recessive (G183E) one, in the same gene. This observation suggests an additional effect of a recessively inherited mutation modulating the phenotypic expression of EBS caused by a partially dominant mutation and is important for accurate genetic counseling.

  9. [Study of gene mutation in 62 hemophilia A children].

    PubMed

    Hu, Q; Liu, A G; Zhang, L Q; Zhang, A; Wang, Y Q; Wang, S M; Lu, Y J; Wang, X

    2017-11-02

    Objective: To analyze the mutation type of FⅧ gene in children with hemophilia A and to explore the relationship among hemophilia gene mutation spectrum, gene mutation and clinical phenotype. Method: Sixty-two children with hemophilia A from Department of Pediatric Hematology, Tongji Hospital of Tongji Medical College, Huazhong University of Science and Technology between January 2015 and March 2017 were enrolled. All patients were male, aged from 4 months to 7 years and F Ⅷ activity ranged 0.2%-11.0%. Fifty cases had severe, 10 cases had moderate and 2 cases had mild hemophilia A. DNA was isolated from peripheral blood in hemophilia A children and the target gene fragment was amplified by PCR, in combination with the second generation sequencing, 22 and 1 introns were detected. Negative cases were detected by the second generation sequencing and results were compared with those of the international FⅧ gene mutation database. Result: There were 20 cases (32%) of intron 22 inversion, 2 cases (3%) of intron 1 inversion, 18 cases (29%) of missense mutation, 5 cases (8%) of nonsense mutation, 7 cases (11%) of deletion mutation, 1 case(2%)of splice site mutation, 2 cases (3%) of large fragment deletion and 1 case of insertion mutation (2%). No mutation was detected in 2 cases (3%), and 4 cases (7%) failed to amplify. The correlation between phenotype and genotype showed that the most common gene mutation in severe hemophilia A was intron 22 inversion (20 cases), accounting for 40% of severe patients, followed by 11 cases of missense mutation (22%). The most common mutation in moderate hemophilia A was missense mutation (6 cases), accounting for 60% of moderate patients. Conclusion: The most frequent mutation type in hemophilia A was intron 22 inversion, followed by missense mutation, again for missing mutation. The relationship between phenotype and genotype: the most frequent gene mutation in severe hemophilia A is intron 22 inversion, followed by missense

  10. Mutation Spectrum and Phenotypic Features in Noonan Syndrome with PTPN11 Mutations: Definition of Two Novel Mutations.

    PubMed

    Atik, Tahir; Aykut, Ayca; Hazan, Filiz; Onay, Huseyin; Goksen, Damla; Darcan, Sukran; Tukun, Ajlan; Ozkinay, Ferda

    2016-06-01

    To evaluate the spectrum of PTPN11 gene mutations in Noonan syndrome patients and to study the genotype-phenotype associations. In this study, twenty Noonan syndrome patients with PTPN11 mutations were included. The patients underwent a detailed clinical and physical evaluation. To identify inherited cases, parents of all mutation positive patients were analyzed. Thirteen different PTPN11 mutations, two of them being novel, were detected in the study group. These mutations included eleven missense mutations: p.G60A, p.D61N, p.Y62D, p.Y63C, p.E69Q, p.Q79R, p.Y279C,p.N308D, p.N308S, p.M504V, p.Q510R and two novel missense mutations: p.I56V and p.I282M. The frequency of cardiac abnormalities and short stature were found to be 80 % and 80 %, respectively. Mental retardation was not observed in patients having exon 8 mutations. No significant correlations were detected between other phenotypic features and genotypes. By identifying genotype-phenotype correlations, this study provides information on phenotypes observed in NS patients with different PTPN11 mutations.

  11. Carnitine-acylcarnitine translocase deficiency with c.199-10 T>G and novel c.1A>G mutation: Two case reports and brief literature review.

    PubMed

    Yan, Hui-Ming; Hu, Hao; Ahmed, Aisha; Feng, Bing-Bing; Liu, Jing; Jia, Zheng-Jun; Wang, Hua

    2017-11-01

    Carnitine-acylcarnitine translocate deficiency (CACTD) is a rare and life-threatening, autosomal recessive disorder of fatty acid β-oxidation characterized by hypoketotic hypoglycemia, hyperammonemia, cardiomyopathy, liver dysfunction, and muscle weakness; culminating in early death. To date, CACTD cases screened from the Chinese mainland population, especially patient with compound heterozygote with c.199-10T>G and a novel c.1A>G mutation in the SLC25A20 gene has never been described. Herein, we report 2 neonatal cases of CACTD identified from the mainland China. These 2 patients were presented with severe metabolic crisis and their clinical conditions deteriorate rapidly and both died of cardiorespiratory collapse in the first week of life. We present the clinical and biochemical features of 2 probands and a brief literature review of previously reported CACTD cases with the c.199-10T>G mutation. The acylcarnitine profiles by tandem-mass-spectrometry and the mutation analysis of SLC25A20 gene confirmed the diagnosis of CACTD in both patients. Mutation analysis demonstrated that patient No. 1 was homozygous for c.199-10T>G mutation, while patient No. 2 was a compound heterozygote for 2 mutations, a maternally-inherited c.199-10T>G and a paternally-inherited, novel c.1A>G mutation. Both patients were treated with an aggressive treatment regimen include high glucose and arginine infusion, respiratory, and circulatory support. The first proband died 3 days after delivery due to sudden cardiac arrest. The second patient's clinical condition, at one time, was improved by high glucose infusion, intravenous arginine, and circulatory support. However, the patient failed to wean from mechanical ventilation. Unfortunately, her parents refused further treatment due to fear of financial burdens. The patient died of congestive heart failure in the 6th day of life. We report the first 2 cases of CACTD identified from the mainland China. Apart from a founder mutation c.199-10T>G

  12. KRAS-G12C mutation is associated with poor outcome in surgically resected lung adenocarcinoma.

    PubMed

    Nadal, Ernest; Chen, Guoan; Prensner, John R; Shiratsuchi, Hiroe; Sam, Christine; Zhao, Lili; Kalemkerian, Gregory P; Brenner, Dean; Lin, Jules; Reddy, Rishindra M; Chang, Andrew C; Capellà, Gabriel; Cardenal, Felipe; Beer, David G; Ramnath, Nithya

    2014-10-01

    The aim of this study was to examine the effects of KRAS mutant subtypes on the outcome of patients with resected lung adenocarcinoma (AC). Using clinical and sequencing data, we identified 179 patients with resected lung AC for whom KRAS mutational status was determined. A multivariate Cox model was used to identify factors associated with disease-free survival (DFS) and overall survival (OS). Publicly available mutation and gene-expression data from lung cancer cell lines and lung AC were used to assess whether distinct KRAS mutant variants have a different profile. Patients with KRAS mutation had a significantly shorter DFS compared with those with KRAS wild-type (p = 0.009). Patients with KRAS-G12C mutant tumors had significantly shorter DFS compared with other KRAS mutants and KRAS wild-type tumors (p < 0.001). In the multivariate Cox model, KRAS-G12C remained as an independent prognostic marker for DFS (Hazard ratio = 2.46, 95% confidence interval 1.51-4.00, p < 0.001) and for OS (Hazard ratio = 2.35, 95% confidence interval 1.35-4.10, p = 0.003). No genes were statistically significant when comparing the mutational or transcriptional profile of lung cancer cell lines and lung AC harboring KRAS-G12C with other KRAS mutant subtypes. Gene set enrichment analysis revealed that KRAS-G12C mutants overexpressed epithelial to mesenchymal transition genes and expressed lower levels of genes predicting KRAS dependency. KRAS-G12C mutation is associated with worse DFS and OS in resected lung AC. Gene-expression profiles in lung cancer cell lines and surgically resected lung AC revealed that KRAS-G12C mutants had an epithelial to mesenchymal transition and a KRAS-independent phenotype.

  13. Is GERD a Factor in Osteonecrosis of the Jaw? Evidence of Pathology Linked to G6PD Deficiency and Sulfomucins

    PubMed Central

    Swanson, Nancy L.; Li, Chen

    2016-01-01

    Osteonecrosis of the jaw (ONJ), a rare side effect of bisphosphonate therapy, is a debilitating disorder with a poorly understood etiology. FDA's Adverse Event Reporting System (FAERS) provides the opportunity to investigate this disease. Our goals were to analyze FAERS data to discover possible relationships between ONJ and specific conditions and drugs and then to consult the scientific literature to deduce biological explanations. Our methodology revealed a very strong association between gastroesophageal reflux and bisphosphonate-induced ONJ, suggesting acidosis as a key factor. Overgrowth of acidophilic species, particularly Streptococcus mutans, in the oral microbiome in the context of insufficient acid buffering due to impaired salivary glands maintains the low pH that sustains damage to the mucosa. Significant associations between ONJ and adrenal insufficiency, vitamin C deficiency, and Sjögren's syndrome were found. Glucose 6 phosphate dehydrogenase (G6PD) deficiency can explain much of the pathology. An inability to maintain vitamin C and other antioxidants in the reduced form leads to vascular oxidative damage and impaired adrenal function. Thus, pathogen-induced acidosis, hypoxia, and insufficient antioxidant defenses together induce ONJ. G6PD deficiency and adrenal insufficiency are underlying factors. Impaired supply of adrenal-derived sulfated sterols such as DHEA sulfate may drive the disease process. PMID:27773962

  14. Isolated case of mental retardation and ataxia due to a de novo mitochondrial T8993G mutation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    De Coo, I.F.M.; Smeets, H.J.M.; Oost, B.A. van

    1996-03-01

    Neurogenic muscle weakness, ataxia, and retinitis pigmentosa (NARP) and subacute necrotizing encephalomyelopathy (Leigh disease) are both associated with an alteration of nt 8993 in the mitochondrial ATPase 6 gene. In NARP, the T-to-G transversion at that position changes leucine into arginine. In Leigh syndrome, the same mutation can be found, as can a T-to-C transition, which changes this leucine into proline. Clinical manifestations occur for NARP when {approximately}60%-90% mutated mtDNA is present. In case of Leigh, these percentages usually exceed 95%. It is known that this mutation can segregate very rapidly within pedigrees. Here we report on a sporadic casemore » with mental retardation and ataxia without retinitis pigmentosa in which the T8993G mutation was found. 13 refs., 1 fig.« less

  15. Mutations in UBQLN2 and SIGMAR1 genes are rare in Korean patients with amyotrophic lateral sclerosis.

    PubMed

    Kim, Hee-Jung; Kwon, Min-Jung; Choi, Won-Jun; Oh, Ki-Wook; Oh, Seong-Il; Ki, Chang-Seok; Kim, Seung Hyun

    2014-08-01

    Mutations in the UBQLN2 and SIGMAR1 genes were recently identified in X-linked dominant amyotrophic lateral sclerosis and/or frontotemporal dementia (ALS and/or FTD) and FTD and/or motor neuron disease, respectively. Subsequent studies, however, found that UBQLN2 mutations were rare, and the pathogenicity of SIGMAR1 mutation in FTD and/or motor neuron disease was controversial. In the present study, we analyzed mutations in the UBQLN2 and SIGMAR1 genes in a Korean cohort of 258 patients with familial ALS (n = 9) or sporadic (sALS; n = 258) ALS. One novel UBQLN2 variant (p.D314E) was observed in 2 patients with sALS and 5 of 727 controls indicating that this variant might be a rare polymorphism rather than a disease-causing mutation. A novel SIGMAR1 gene variant in the 3'-untranslated region (c.*58T>C) was found in 1 sALS and was absent in 727 control samples. Taken together, our data suggest that causative mutations in the UBQLN2 and SIGMAR1 genes are rare in Korean patients with either familial or sporadic ALS. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. Renal Cell Carcinoma Programmed Death-ligand 1, a New Direct Target of Hypoxia-inducible Factor-2 Alpha, is Regulated by von Hippel-Lindau Gene Mutation Status.

    PubMed

    Messai, Yosra; Gad, Sophie; Noman, Muhammad Zaeem; Le Teuff, Gwenael; Couve, Sophie; Janji, Bassam; Kammerer, Solenne Florence; Rioux-Leclerc, Nathalie; Hasmim, Meriem; Ferlicot, Sophie; Baud, Véronique; Mejean, Arnaud; Mole, David Robert; Richard, Stéphane; Eggermont, Alexander M M; Albiges, Laurence; Mami-Chouaib, Fathia; Escudier, Bernard; Chouaib, Salem

    2016-10-01

    Clear cell renal cell carcinomas (ccRCC) frequently display a loss of function of the von Hippel-Lindau (VHL) gene. To elucidate the putative relationship between VHL mutation status and immune checkpoint ligand programmed death-ligand 1 (PD-L1) expression. A series of 32 renal tumors composed of 11 VHL tumor-associated and 21 sporadic RCCs were used to evaluate PD-L1 expression levels after sequencing of the three exons and exon-intron junctions of the VHL gene. The 786-O, A498, and RCC4 cell lines were used to investigate the mechanisms of PD-L1 regulation. Fisher's exact test was used for VHL mutation and Kruskal-Wallis test for PD-L1 expression. If no covariate accounted for the association of VHL and PD-L1, then a Kruskal-Wallis test was used; otherwise Cochran-Mantel-Haenzsel test was used. We also used the Fligner-Policello test to compare two medians when the distributions had different dispersions. We demonstrated that tumors from ccRCC patients with VHL biallelic inactivation (ie, loss of function) display a significant increase in PD-L1 expression compared with ccRCC tumors carrying one VHL wild-type allele. Using the inducible VHL 786-O-derived cell lines with varying hypoxia-inducible factor-2 alpha (HIF-2α) stabilization levels, we showed that PD-L1 expression levels positively correlate with VHL mutation and HIF-2α expression. Targeting HIF-2α decreased PD-L1, while HIF-2α overexpression increased PD-L1 mRNA and protein levels in ccRCC cells. Interestingly, chromatin immunoprecipitation and luciferase assays revealed a direct binding of HIF-2α to a transcriptionally active hypoxia-response element in the human PD-L1 proximal promoter in 786-O cells. Our work provides the first evidence that VHL mutations positively correlate with PD-L1 expression in ccRCC and may influence the response to ccRCC anti-PD-L1/PD-1 immunotherapy. We investigated the relationship between von Hippel-Lindau mutations and programmed death-ligand 1 expression. We

  17. High frequency of a single nucleotide substitution (c.-6-180T>G) of the canine MDR1/ABCB1 gene associated with phenobarbital-resistant idiopathic epilepsy in Border Collie dogs.

    PubMed

    Mizukami, Keijiro; Yabuki, Akira; Chang, Hye-Sook; Uddin, Mohammad Mejbah; Rahman, Mohammad Mahbubur; Kushida, Kazuya; Kohyama, Moeko; Yamato, Osamu

    2013-01-01

    A single nucleotide substitution (c.-6-180T>G) associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type, T/G heterozygote, and G/G mutant homozygote to be 60.0%, 30.3%, and 9.8%, respectively, indicating that the frequency of the mutant G allele is extremely high (24.9%) in Border Collies. The results suggest that this high mutation frequency of the mutation is likely to cause a high prevalence of phenobarbital-resistant epilepsy in Border Collies.

  18. Glucose-6-phosphate dehydrogenase polymorphisms and susceptibility to mild malaria in Dogon and Fulani, Mali.

    PubMed

    Maiga, Bakary; Dolo, Amagana; Campino, Susana; Sepulveda, Nuno; Corran, Patrick; Rockett, Kirk A; Troye-Blomberg, Marita; Doumbo, Ogobara K; Clark, Taane G

    2014-07-11

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is associated with protection from severe malaria, and potentially uncomplicated malaria phenotypes. It has been documented that G6PD deficiency in sub-Saharan Africa is due to the 202A/376G G6PD A-allele, and association studies have used genotyping as a convenient technique for epidemiological studies. However, recent studies have shown discrepancies in G6PD202/376 associations with severe malaria. There is evidence to suggest that other G6PD deficiency alleles may be common in some regions of West Africa, and that allelic heterogeneity could explain these discrepancies. A cross-sectional epidemiological study of malaria susceptibility was conducted during 2006 and 2007 in the Sahel meso-endemic malaria zone of Mali. The study included Dogon (n = 375) and Fulani (n = 337) sympatric ethnic groups, where the latter group is characterized by lower susceptibility to Plasmodium falciparum malaria. Fifty-three G6PD polymorphisms, including 202/376, were genotyped across the 712 samples. Evidence of association of these G6PD polymorphisms and mild malaria was assessed in both ethnic groups using genotypic and haplotypic statistical tests. It was confirmed that the Fulani are less susceptible to malaria, and the 202A mutation is rare in this group (<1% versus Dogon 7.9%). The Betica-Selma 968C/376G (~11% enzymatic activity) was more common in Fulani (6.1% vs Dogon 0.0%). There are differences in haplotype frequencies between Dogon and Fulani, and association analysis did not reveal strong evidence of protective G6PD genetic effects against uncomplicated malaria in both ethnic groups and gender. However, there was some evidence of increased risk of mild malaria in Dogon with the 202A mutation, attaining borderline statistical significance in females. The rs915942 polymorphism was found to be associated with asymptomatic malaria in Dogon females, and the rs61042368 polymorphism was associated with clinical malaria in

  19. High prevalence of factor V Leiden and prothrombin G20101A mutations in Kashmiri patients with venous thromboembolism.

    PubMed

    Shafia, Syed; Zargar, Mahrukh H; Khan, Nabeela; Ahmad, Rehana; Shah, Zafar Amin; Asimi, Ravouf

    2018-05-15

    The genetic variants of the factor V (G1691A), prothrombin (G20210A) and MTHFR (C677T) genes have been widely implicated as inherited risk factors for developing venous thrombosis. This study was undertaken to reveal the frequency of these mutations in Kashmiri patients with venous thromboembolism. A case-control study was designed with 250 VTE patients and 250 healthy controls. The mutations were analysed using ARMS-PCR and PCR-RFLP approach. The factor V Leiden G1691A mutation was found in 17/250 (6.8%) VTE patients and prothrombin G20210A mutation was found in 7/250 (2.8%) VTE patients while no mutation was found in any of the healthy controls. Both the mutations were found to be significantly associated with the increased risk of VTE (p = 0.0001 and 0.0150 respectively) while no association of VTE risk with MTHFR C677T polymorphism was found (p = 0.53). The increased frequency of factor V Leiden G1691A and prothrombin G20210A mutation in VTE patients indicates a significant role of these mutations in the development of VTE in our population. We therefore suggest the routine screening of these two mutations as thrombophilic markers in Kashmiri patients with venous thromboembolism. Copyright © 2018 Elsevier B.V. All rights reserved.

  20. Influence of correlation between HLA-G polymorphism and Interleukin-6 (IL6) gene expression on the risk of schizophrenia.

    PubMed

    Shivakumar, Venkataram; Debnath, Monojit; Venugopal, Deepthi; Rajasekaran, Ashwini; Kalmady, Sunil V; Subbanna, Manjula; Narayanaswamy, Janardhanan C; Amaresha, Anekal C; Venkatasubramanian, Ganesan

    2018-07-01

    Converging evidence suggests important implications of immuno-inflammatory pathway in the risk and progression of schizophrenia. Prenatal infection resulting in maternal immune activation and developmental neuroinflammation reportedly increases the risk of schizophrenia in the offspring by generating pro-inflammatory cytokines including IL-6. However, it is not known how prenatal infection can induce immuno-inflammatory responses despite the presence of immuno-inhibitory Human Leukocyte Antigen-G (HLA-G) molecules. To address this, the present study was aimed at examining the correlation between 14 bp Insertion/Deletion (INDEL) polymorphism of HLA-G and IL-6 gene expression in schizophrenia patients. The 14 bp INDEL polymorphism was studied by PCR amplification/direct sequencing and IL-6 gene expression was quantified by using real-time RT-PCR in 56 schizophrenia patients and 99 healthy controls. We observed significantly low IL6 gene expression in the peripheral mononuclear cells (PBMCs) of schizophrenia patients (t = 3.8, p = .004) compared to the controls. In addition, schizophrenia patients carrying Del/Del genotype of HLA-G 14 bp INDEL exhibited significantly lower IL6 gene expression (t = 3.1; p = .004) than the Del/Ins as well as Ins/Ins carriers. Our findings suggest that presence of "high-expressor" HLA-G 14 bp Del/Del genotype in schizophrenia patients could attenuate IL-6 mediated inflammation in schizophrenia. Based on these findings it can be assumed that HLA-G and cytokine interactions might play an important role in the immunological underpinnings of schizophrenia. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Mutation profile of BBS genes in Iranian patients with Bardet-Biedl syndrome: genetic characterization and report of nine novel mutations in five BBS genes.

    PubMed

    Fattahi, Zohreh; Rostami, Parvin; Najmabadi, Amin; Mohseni, Marzieh; Kahrizi, Kimia; Akbari, Mohammad Reza; Kariminejad, Ariana; Najmabadi, Hossein

    2014-07-01

    Bardet-Biedl syndrome (BBS) is a rare ciliopathy disorder that is clinically and genetically heterogeneous with 18 known genes. This study was performed to characterize responsible genes and mutation spectrum in a cohort of 14 Iranian families with BBS. Sanger sequencing of the most commonly mutated genes (BBS1, BBS2 and BBS10) accounting for ∼50% of BBS patients determined mutations only in BBS2, including three novel mutations. Next, three of the remaining patients were subjected to whole exome sequencing with 96% at 20 × depth of coverage that revealed novel BBS4 mutation. Observation of no mutation in the other patients represents the possible presence of novel genes. Screening of the remaining patients for six other genes (BBS3, BBS4, BBS6, BBS7, BBS9 and BBS12) revealed five novel mutations. This result represents another indication for the genetic heterogeneity of BBS and extends the mutational spectrum of the disease by introducing nine novel mutations in five BBS genes. In conclusion, although BBS1 and BBS10 are among the most commonly mutated genes in other populations like Caucasian, these two seem not to have an important role in Iranian patients. This suggests that a different strategy in molecular genetics diagnostic approaches in Middle Eastern countries such as Iran should be considered.

  2. VPS35 Mutations in Parkinson Disease

    PubMed Central

    Vilariño-Güell, Carles; Wider, Christian; Ross, Owen A.; Dachsel, Justus C.; Kachergus, Jennifer M.; Lincoln, Sarah J.; Soto-Ortolaza, Alexandra I.; Cobb, Stephanie A.; Wilhoite, Greggory J.; Bacon, Justin A.; Behrouz, Bahareh; Melrose, Heather L.; Hentati, Emna; Puschmann, Andreas; Evans, Daniel M.; Conibear, Elizabeth; Wasserman, Wyeth W.; Aasly, Jan O.; Burkhard, Pierre R.; Djaldetti, Ruth; Ghika, Joseph; Hentati, Faycal; Krygowska-Wajs, Anna; Lynch, Tim; Melamed, Eldad; Rajput, Alex; Rajput, Ali H.; Solida, Alessandra; Wu, Ruey-Meei; Uitti, Ryan J.; Wszolek, Zbigniew K.; Vingerhoets, François; Farrer, Matthew J.

    2011-01-01

    The identification of genetic causes for Mendelian disorders has been based on the collection of multi-incident families, linkage analysis, and sequencing of genes in candidate intervals. This study describes the application of next-generation sequencing technologies to a Swiss kindred presenting with autosomal-dominant, late-onset Parkinson disease (PD). The family has tremor-predominant dopa-responsive parkinsonism with a mean onset of 50.6 ± 7.3 years. Exome analysis suggests that an aspartic-acid-to-asparagine mutation within vacuolar protein sorting 35 (VPS35 c.1858G>A; p.Asp620Asn) is the genetic determinant of disease. VPS35 is a central component of the retromer cargo-recognition complex, is critical for endosome-trans-golgi trafficking and membrane-protein recycling, and is evolutionarily highly conserved. VPS35 c.1858G>A was found in all affected members of the Swiss kindred and in three more families and one patient with sporadic PD, but it was not observed in 3,309 controls. Further sequencing of familial affected probands revealed only one other missense variant, VPS35 c.946C>T; (p.Pro316Ser), in a pedigree with one unaffected and two affected carriers, and thus the pathogenicity of this mutation remains uncertain. Retromer-mediated sorting and transport is best characterized for acid hydrolase receptors. However, the complex has many types of cargo and is involved in a diverse array of biologic pathways from developmental Wnt signaling to lysosome biogenesis. Our study implicates disruption of VPS35 and retromer-mediated trans-membrane protein sorting, rescue, and recycling in the neurodegenerative process leading to PD. PMID:21763482

  3. Reduction of Werner Syndrome Protein Enhances G:C → A:T Transition by O6-Methylguanine in Human Cells.

    PubMed

    Suzuki, Tetsuya; Kuramoto, Yoshie; Kamiya, Hiroyuki

    2018-05-21

    O 6 -Methylguanine ( O 6 -MeG) is a damaged base produced by methylating reagents. The Werner syndrome protein (WRN) is a cancer-related human DNA helicase. The effects of WRN reduction on O 6 -MeG-caused mutagenesis were assessed by an siRNA-mediated knockdown in human U2OS cells, using a shuttle plasmid with a single O 6 -MeG base in the supF gene. The plasmid DNA was replicated in the cells, isolated, and electroporated into an Escherichia coli indicator strain. The lowered amount of WRN increased the frequency of mutations induced by O 6 -MeG, mainly G:C → A:T substitution. The increased mutation rate suggested that the cancer-related WRN suppresses the G:C → A:T substitution by O 6 -MeG in human cells.

  4. Detection of KatG/inhA Mutation to Guide Isoniazid and Ethionamide Use for Drug-resistant Tuberculosis

    PubMed Central

    Namburete, Evangelina

    2017-01-01

    Abstract Background Both Mozambique and Brazil are countries with a high burden of tuberculosis. Isoniazid (INH) is one of the cornerstones of tuberculosis treatment and, depending on the mutated gene (katG or inhA), the organism may be susceptible to high doses of INH (inhA mutation) or to ethionamide (-Eth-KatG mutation). Methods To analyze isoniazid genotypic resistance profile in Mycobacterium tuberculosis to guide decision making about management of resistant tuberculosis. Descriptive study of 311 M. tuberculosis isolated from Ribeirão Preto, Brazil (2011–2014) and 155 isolates from Beira, Mozambique (2014–2015). Drug resistance patterns and the specific genes mutations were determined using Genotype MTBDRplus (Hain Lifescience GmbH, Germany). Results Mutations in katG gene were detected in 13/22 (59%) of Brazilian and in 32/38 (84.2%) of Mozambican isolates. Unique inhA mutations were observed in 8/22 (36%) isolates in Brazil and 4/38 (10.5%) in Mozambique. Both katG and inhA mutations where detected in 1/22 (5%) and 2/38(5.2%), respectively. katG mutations were more frequent among INH previously treated patients. Conclusion There is a geographical variation of INH mutations and the new molecular tests can be used to guide and accelerate decision making towards the use of ETH or high doses of INH based on detected mutations. Disclosures All authors: No reported disclosures.

  5. Mutation screening of the HGD gene identifies a novel alkaptonuria mutation with significant founder effect and high prevalence.

    PubMed

    Sakthivel, Srinivasan; Zatkova, Andrea; Nemethova, Martina; Surovy, Milan; Kadasi, Ludevit; Saravanan, Madurai P

    2014-05-01

    Alkaptonuria (AKU) is an autosomal recessive disorder; caused by the mutations in the homogentisate 1, 2-dioxygenase (HGD) gene located on Chromosome 3q13.33. AKU is a rare disorder with an incidence of 1: 250,000 to 1: 1,000,000, but Slovakia and the Dominican Republic have a relatively higher incidence of 1: 19,000. Our study focused on studying the frequency of AKU and identification of HGD gene mutations in nomads. HGD gene sequencing was used to identify the mutations in alkaptonurics. For the past four years, from subjects suspected to be clinically affected, we found 16 positive cases among a randomly selected cohort of 41 Indian nomads (Narikuravar) settled in the specific area of Tamil Nadu, India. HGD gene mutation analysis showed that 11 of these patients carry the same homozygous splicing mutation c.87 + 1G > A; in five cases, this mutation was found to be heterozygous, while the second AKU-causing mutation was not identified in these patients. This result indicates that the founder effect and high degree of consanguineous marriages have contributed to AKU among nomads. Eleven positive samples were homozygous for a novel mutation c.87 + 1G > A, that abolishes an intron 2 donor splice site and most likely causes skipping of exon 2. The prevalence of AKU observed earlier seems to be highly increased in people of nomadic origin. © 2014 John Wiley & Sons Ltd/University College London.

  6. Glucose-6-Phosphate Dehydrogenase Deficiency Improves Insulin Resistance With Reduced Adipose Tissue Inflammation in Obesity.

    PubMed

    Ham, Mira; Choe, Sung Sik; Shin, Kyung Cheul; Choi, Goun; Kim, Ji-Won; Noh, Jung-Ran; Kim, Yong-Hoon; Ryu, Je-Won; Yoon, Kun-Ho; Lee, Chul-Ho; Kim, Jae Bum

    2016-09-01

    Glucose-6-phosphate dehydrogenase (G6PD), a rate-limiting enzyme of the pentose phosphate pathway, plays important roles in redox regulation and de novo lipogenesis. It was recently demonstrated that aberrant upregulation of G6PD in obese adipose tissue mediates insulin resistance as a result of imbalanced energy metabolism and oxidative stress. It remains elusive, however, whether inhibition of G6PD in vivo may relieve obesity-induced insulin resistance. In this study we showed that a hematopoietic G6PD defect alleviates insulin resistance in obesity, accompanied by reduced adipose tissue inflammation. Compared with wild-type littermates, G6PD-deficient mutant (G6PD(mut)) mice were glucose tolerant upon high-fat-diet (HFD) feeding. Intriguingly, the expression of NADPH oxidase genes to produce reactive oxygen species was alleviated, whereas that of antioxidant genes was enhanced in the adipose tissue of HFD-fed G6PD(mut) mice. In diet-induced obesity (DIO), the adipose tissue of G6PD(mut) mice decreased the expression of inflammatory cytokines, accompanied by downregulated proinflammatory macrophages. Accordingly, macrophages from G6PD(mut) mice greatly suppressed lipopolysaccharide-induced proinflammatory signaling cascades, leading to enhanced insulin sensitivity in adipocytes and hepatocytes. Furthermore, adoptive transfer of G6PD(mut) bone marrow to wild-type mice attenuated adipose tissue inflammation and improved glucose tolerance in DIO. Collectively, these data suggest that inhibition of macrophage G6PD would ameliorate insulin resistance in obesity through suppression of proinflammatory responses. © 2016 by the American Diabetes Association.

  7. The androgen receptor gene mutations database.

    PubMed

    Gottlieb, B; Trifiro, M; Lumbroso, R; Pinsky, L

    1997-01-01

    The current version of the androgen receptor (AR) gene mutations database is described. The total number of reported mutations has risen from 212 to 272. We have expanded the database: (i) by adding a large amount of new data on somatic mutations in prostatic cancer tissue; (ii) by defining a new constitutional phenotype, mild androgen insensitivity (MAI); (iii) by placing additional relevant information on an internet site (http://www.mcgill.ca/androgendb/ ). The database has allowed us to examine the contribution of CpG sites to the multiplicity of reports of the same mutation in different families. The database is also available from EMBL (ftp.ebi.ac.uk/pub/databases/androgen) or as a Macintosh Filemaker Pro or Word file (MC33@musica,mcgill.ca)

  8. The androgen receptor gene mutations database.

    PubMed Central

    Gottlieb, B; Trifiro, M; Lumbroso, R; Pinsky, L

    1997-01-01

    The current version of the androgen receptor (AR) gene mutations database is described. The total number of reported mutations has risen from 212 to 272. We have expanded the database: (i) by adding a large amount of new data on somatic mutations in prostatic cancer tissue; (ii) by defining a new constitutional phenotype, mild androgen insensitivity (MAI); (iii) by placing additional relevant information on an internet site (http://www.mcgill.ca/androgendb/ ). The database has allowed us to examine the contribution of CpG sites to the multiplicity of reports of the same mutation in different families. The database is also available from EMBL (ftp.ebi.ac.uk/pub/databases/androgen) or as a Macintosh Filemaker Pro or Word file (MC33@musica,mcgill.ca) PMID:9016528

  9. Associations of ICOS and PD.1 Gene Variants with Colon Cancer Risk in The Iranian Population

    PubMed

    Shamsdin, Seyedeh Azra; Karimi, Mohammad Hossein; Hosseini, Seyed Vahid; Geramizadeh, Bita; Fattahi, Mohamad Reza; Mehrabani, Davood; Moravej, Ali

    2018-03-27

    Background: Positive and negative co-stimulatory molecules are important factors determining the outcome of immune responses to the presence of tumors. Since co-stimulatory molecule expression may be affected by gene polymorphisms, we aimed to investigate associations between variants of PD.1 and ICOS and susceptibility to colon cancer. Material and methods: ICOS (-693A/G), ICOS (+1720C/T) and PD.1 (-538G/A) gene polymorphisms were evaluated by the PCR-RFLP method in 76 colon cancer patients and 73 healthy controls. Results: The frequencies of the GG genotype and the G allele at position -693 of the ICOS gene were significantly higher in the patient group (P=0.014 and p=0.0002), while the AA genotype was significantly more common in controls (P=0.0016). At position -538 of PD.1, GG genotype and G allele frequencies were higher in the patient group (P<0.0001and P<0.0001). Again, AA and also AG genotypes significantly predominated in controls (P<0.0001 and P=0.012). Regarding genotypes and alleles of ICOS at position +1720. Frequencies of GCG and GTG haplotypes were higher in patients compared to those of controls (P=0.016 and P<0.0001), while, frequencies of GTA, ATA and ATG haplotypes were higher in controls (P=0.0017, P<0.0001 and P=0.015). GTG/GTG and GTG/GCG double haplotypes were more frequent in patients compared to controls (P=0.0147 and P=0.0071). Conclusion: Our study clarified that PD.1 (-538G/A) and ICOS (-693A/G) gene polymorphisms can be considered as genetic risk factors for the development of colon cancer among Iranian patients. Creative Commons Attribution License

  10. ITGB6 loss-of-function mutations cause autosomal recessive amelogenesis imperfecta.

    PubMed

    Wang, Shih-Kai; Choi, Murim; Richardson, Amelia S; Reid, Bryan M; Lin, Brent P; Wang, Susan J; Kim, Jung-Wook; Simmer, James P; Hu, Jan C-C

    2014-04-15

    Integrins are cell-surface adhesion receptors that bind to extracellular matrices (ECM) and mediate cell-ECM interactions. Some integrins are known to play critical roles in dental enamel formation. We recruited two Hispanic families with generalized hypoplastic amelogenesis imperfecta (AI). Analysis of whole-exome sequences identified three integrin beta 6 (ITGB6) mutations responsible for their enamel malformations. The female proband of Family 1 was a compound heterozygote with an ITGB6 transition mutation in Exon 4 (g.4545G > A c.427G > A p.Ala143Thr) and an ITGB6 transversion mutation in Exon 6 (g.27415T > A c.825T > A p.His275Gln). The male proband of Family 2 was homozygous for an ITGB6 transition mutation in Exon 11 (g.73664C > T c.1846C > T p.Arg616*) and hemizygous for a transition mutation in Exon 6 of Nance-Horan Syndrome (NHS Xp22.13; g.355444T > C c.1697T > C p.Met566Thr). These are the first disease-causing ITGB6 mutations to be reported. Immunohistochemistry of mouse mandibular incisors localized ITGB6 to the distal membrane of differentiating ameloblasts and pre-ameloblasts, and then ITGB6 appeared to be internalized by secretory stage ameloblasts. ITGB6 expression was strongest in the maturation stage and its localization was associated with ameloblast modulation. Our findings demonstrate that early and late amelogenesis depend upon cell-matrix interactions. Our approach (from knockout mouse phenotype to human disease) demonstrates the power of mouse reverse genetics in mutational analysis of human genetic disorders and attests to the need for a careful dental phenotyping in large-scale knockout mouse projects.

  11. An unusual distribution of glucose-6-phosphate dehydrogenase deficiency of south Indian newborn population.

    PubMed

    Ramadevi, R; Savithri, H S; Devi, A R; Bittles, A H; Rao, N A

    1994-08-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is seen at a higher frequency in many national and ethnic groups in areas of current or former malaria endemicity. A screening programme undertaken to evaluate the gene frequencies for this deficiency in the highly inbred South Indian population of Karnataka revealed that of the 5140 neonates screened, 7.8% were G6PD deficient with no correlation between the reported level of inbreeding and enzyme deficiency. An interesting finding was the equal number of male (198) and female (207) individuals, with G6PD activity of less than 3 IU. The possible implications of this finding with regard to the expression of G6PD gene is discussed.

  12. Glucose-6-phosphate dehydrogenase deficiency and Southeast Asian ovalocytosis in asymptomatic Plasmodium carriers in Sumba island, Indonesia.

    PubMed

    Shimizu, Hana; Tamam, Moedrik; Soemantri, Augustinus; Ishida, Takafumi

    2005-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency and Southeast Asian ovalocytosis (SAO) caused by a 27-bp deletion in the band 3 gene (Band3Delta 27) are well-documented genetic traits resistant to malarial diseases; however, relationships between these traits and asymptomatic malaria infection hitherto had not been investigated. Filter-blotted blood samples were collected from a total of 210 healthy individuals, 100 males and 110 females, aged 6-17 years, in Sumba island, Indonesia, to survey for the presence of Plasmodium parasites, G6PD activity and the Band3Delta 27 mutation. Presence of P. falciparum and/or P. vivax was identified in 25 subjects (11.9%). In all, 24 subjects (11.4%) showed Band3Delta 27 heterozygously. In males and females, eight and nine subjects, respectively, showed G6PD deficiency. There was no significant difference in the prevalence of asymptomatic malaria infection between individuals with or without these traits (P>0.05). No alterations in the prevalence of asymptomatic malaria infection suggest that parasite invasion into erythrocytes is unlikely to be a target phase in which the two polymorphisms demonstrate possible protective effects against malaria.

  13. Mutations in the Norrie disease gene.

    PubMed

    Schuback, D E; Chen, Z Y; Craig, I W; Breakefield, X O; Sims, K B

    1995-01-01

    We report our experience to date in mutation identification in the Norrie disease (ND) gene. We carried out mutational analysis in 26 kindreds in an attempt to identify regions presumed critical to protein function and potentially correlated with generation of the disease phenotype. All coding exons, as well as noncoding regions of exons 1 and 2, 636 nucleotides in the noncoding region of exon 3, and 197 nucleotides of 5' flanking sequence, were analyzed for single-strand conformation polymorphisms (SSCP) by polymerase chain reaction (PCR) amplification of genomic DNA. DNA fragments that showed altered SSCP band mobilities were sequenced to locate the specific mutations. In addition to three previously described submicroscopic deletions encompassing the entire ND gene, we have now identified 6 intragenic deletions, 8 missense (seven point mutations, one 9-bp deletion), 6 nonsense (three point mutations, three single bp deletions/frameshift) and one 10-bp insertion, creating an expanded repeat in the 5' noncoding region of exon 1. Thus, mutations have been identified in a total of 24 of 26 (92%) of the kindreds we have studied to date. With the exception of two different mutations, each found in two apparently unrelated kindreds, these mutations are unique and expand the genotype database. Localization of the majority of point mutations at or near cysteine residues, potentially critical in protein tertiary structure, supports a previous protein model for norrin as member of a cystine knot growth factor family (Meitinger et al., 1993). Genotype-phenotype correlations were not evident with the limited clinical data available, except in the cases of larger submicroscopic deletions associated with a more severe neurologic syndrome.(ABSTRACT TRUNCATED AT 250 WORDS)

  14. Mutations in DDR2 gene cause SMED with short limbs and abnormal calcifications.

    PubMed

    Bargal, Ruth; Cormier-Daire, Valerie; Ben-Neriah, Ziva; Le Merrer, Martine; Sosna, Jacob; Melki, Judith; Zangen, David H; Smithson, Sarah F; Borochowitz, Zvi; Belostotsky, Ruth; Raas-Rothschild, Annick

    2009-01-01

    The spondylo-meta-epiphyseal dysplasia [SMED] short limb-hand type [SMED-SL] is a rare autosomal-recessive disease, first reported by Borochowitz et al. in 1993.(1) Since then, 14 affected patients have been reported.(2-5) We diagnosed 6 patients from 5 different consanguineous Arab Muslim families from the Jerusalem area with SMED-SL. Additionally, we studied two patients from Algerian and Pakistani ancestry and the parents of the first Jewish patients reported.(1) Using a homozygosity mapping strategy, we located a candidate region on chromosome 1q23 spanning 2.4 Mb. The position of the Discoidin Domain Receptor 2 (DDR2) gene within the candidate region and the similarity of the ddr2 knockout mouse to the SMED patients' phenotype prompted us to study this gene(6). We identified three missense mutations c.2254 C > T [R752C], c. 2177 T > G [I726R], c.2138C > T [T713I] and one splice site mutation [IVS17+1g > a] in the conserved sequence encoding the tyrosine kinase domain of the DDR2 gene. The results of this study will permit an accurate early prenatal diagnosis and carrier screening for families at risk.

  15. Mutation analysis of the Fanconi Anemia Gene FACC

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Verlander, P.C.; Lin, J.D.; Udono, M.U.

    1994-04-01

    Fanconi anemia (FA) is a genetically heterogeneous autosomal recessive disorder characterized by a unique hypersensitivity of cells to DNA cross-linking agents; a gene for complementation group C (FACC) has recently been cloned. The authors have amplified FACC exons with their flanking intron sequences from genomic DNA from 174 racially and ethnically diverse families in the International Fanconi Anemia Registry and have screened for mutations by using SSCP analysis. They have identified eight different variants in 32 families; three were detected in exon 1, one in exon 4, one in intron 4, two in exon 6, and one in exon 14.more » Two of the eight variants, in seven families, did not segregate with the disease allele in multiplex families, suggesting that these variants represented benign polymorphisms. Disease-associated mutations in FACC were detected in a total of 25 (14.4%) of 174 families screened. The most frequent mutations were IVS4 + 4 A [yields] T (intron 4; 12 families) and 322delG (exon 1; 9 families). Other, less common mutations include Q13X in exon 1, R185X and D195V in exon 6, and L554P in exon 14. The polymorphisms were S26F in exon 1 and G139E in exon 4. All patients in the study with 322delG, Q13X, R185X, and D195V are of northern or eastern European or southern Italian ancestry, and 18 of 19 have a mild form of the disease, while the 2 patients with L554P, both from the same family, have a severe phenotype. All 19 patients with IVS4 + 4 A [yields] T have Jewish ancestry and have a severe phenotype. 19 refs., 1 fig., 3 tabs.« less

  16. Identification of 5 novel mutations in the AGXT gene.

    PubMed

    Basmaison, O; Rolland, M O; Cochat, P; Bozon, D

    2000-06-01

    In order to identify additional genotypes in primary hyperoxaluria type 1, we sequenced the AGXT genes of 9 patients. We report 5 new mutations. Three are splice-site mutations situated at the end of intron 4 and 8 (647-1G>A, 969-1G>C, 969-3C>G), one is a missense mutation in exon 5 (D183N), and one is a short duplication in exon 2 (349ins7). Their consequence is always a lack of enzymatic activity of the Alanine-Glyoxylate Aminotransferase (AGT); for 4 of them, we were able to deduce that they were associated to the absence of AGT protein. These mutations are rare, as they have been found on one allele in our study (except 969-3C>G present in 2 unrelated families), and have not been previously reported.

  17. Determination of glucose-6-phosphate dehydrogenase cut-off values in a Tunisian population.

    PubMed

    Laouini, Naouel; Sahli, Chaima Abdelhafidh; Jouini, Latifa; Haloui, Sabrine; Fredj, Sondes Hadj; Daboubi, Rym; Siala, Hajer; Ouali, Faida; Becher, Meriam; Toumi, Nourelhouda; Bibi, Amina; Messsaoud, Taieb

    2017-07-26

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the commonest enzymopathy worldwide. The incidence depends essentially on the methods used for the assessment. In this respect, we attempted in this study to set cut-off values of G6PD activity to discriminate among normal, heterozygous, and deficient individuals using the World Health Organization (WHO) classification and the receiver operating characteristics (ROC) curve analysis. Blood samples from 250 female and 302 male subjects were enrolled in this study. The G6PD activity was determined using a quantitative assay. The common G6PD mutations in Tunisia were determined using the amplification refractory mutation system (ARMS-PCR) method. The ROC curve was used to choice the best cut-off. Normal G6PD values were 7.69±2.37, 7.86±2.39, and 7.51±2.35 U/g Hb for the entire, male, and female groups, respectively. Cut-off values for the total, male, and female were determined using the WHO classification and ROC curves analysis. In the male population, both cut-offs established using ROC curve analysis (4.00 U/g Hb) and the 60% level (3.82 U/g Hb), respectively are sensitive and specific resulting in a good efficiency of discrimination between deficient and normal males. For the female group the ROC cut-off (5.84 U/g Hb) seems better than the 60% level cut-off (3.88 U/g Hb) to discriminate between normal and heterozygote or homozygote women with higher Youden Index. The establishment of the normal values for a population is important for a better evaluation of the assay result. The ROC curve analysis is an alternative method to determine the status of patients since it correlates DNA analysis and G6PD activity.

  18. Myocardial 123I-metaiodobenzylguanidine scintigraphy in patients with homozygous and heterozygous parkin mutations.

    PubMed

    De Rosa, Anna; Pellegrino, Teresa; Pappatà, Sabina; Pellecchia, Maria Teresa; Peluso, Silvio; Saccà, Francesco; Barone, Paolo; Cuocolo, Alberto; De Michele, Giuseppe

    2017-02-01

    PARK2 is an autosomal recessive parkinsonism caused by parkin gene mutations. Several Parkinson's Disease (PD) cases harbor single parkin mutations, raising a debate about the pathogenic meaning of heterozygous mutations. Here, we evaluate cardiac autonomic innervation in patients with either two or one parkin mutations compared to patients with idiopathic PD (IPD). Myocardial 123 I-metaiodobenzylguanidine (MIBG) scintigraphy was performed in six PD patients with single parkin mutations (HET), four with two mutations (PARK2), and eight with IPD. In comparison to control group, IPD patients showed lower early and late heart-to-mediastinum (H/M) ratios and higher washout rates, whereas HET patients had only lower early H/M ratio, and PARK2 patients were not different for any parameter. At individual level, MIBG findings were abnormal in 7/8 IPD, in 4/6 HET and in 1/4 PARK2 patients. Preserved cardiac 123 I-MIBG uptake confirms that PARK2 pathogenic mechanism, at least partially, differs from that responsible for IPD. HET subjects show intermediate findings, suggesting possible heterogeneity.

  19. Globo H expression is associated with driver mutations and PD-L1 expressions in stage I non-small cell lung cancer.

    PubMed

    Yang, Ching-Yao; Lin, Mong-Wei; Chang, Yih-Leong; Wu, Chen-Tu

    2017-12-12

    Globo H is a tumor-associated carbohydrate antigen exclusively expressed in cancer cells rather than normal tissue. Globo H has been found on many cancers of epithelial origins, and become an attractive target for cancer vaccine. We aimed to study the expression of Globo H in non-small cell lung cancer (NSCLC) patients, and correlated its expression with common driver mutations, clinical outcomes, and status of immune checkpoint, programmed death-ligand 1 (PD-L1). The study enrolled 228 patients with surgically resected stage I NSCLC, including 139 patients with adenocarcinoma (ADC) and 89 patients with squamous cell carcinoma (SqCC). Using immunohistochemistry, tumors with moderate to strong membranous staining in ⩾ 1% tumor cells per section were scored as positive Globo H expression. Driver mutations including EGFR, KRAS, BRAF were detected by direct sequencing, while ALK, PI3KCA, FGFR1 and PD-L1 expression was detected by immunohistochemical (IHC) staining. Positive Globo H expression was detected in 88 of the 228 (38.6%) patients. These included 51 of 139 (36.7%) patients with ADC and 37 of 89 (41.6%) patients with SqCC. Positive Globo H expression was significantly associated with EGFR mutation and PD-L1 expression in the ADC group, and PI3KCA overexpression in the SqCC group. The survival analysis showed that Globo H expression was not an independent prognostic factor in stage I NSCLC. Globo H expression was correlated with specific driver mutations in ADC and SqCC NSCLC tumors, as well as PD-L1 status. Immunotherapy targeting Globo H may have potential application in lung cancer treatment.

  20. Four novel germline mutations in the MLH1 and PMS2 mismatch repair genes in patients with hereditary nonpolyposis colorectal cancer.

    PubMed

    Montazer Haghighi, Mahdi; Radpour, Ramin; Aghajani, Katayoun; Zali, Narges; Molaei, Mahsa; Zali, Mohammad Reza

    2009-08-01

    Hereditary nonpolyposis colorectal cancer (HNPCC) is the most common cause of early onset hereditary colorectal cancer. In the majority of HNPCC families, microsatellite instability (MSI) and germline mutation in one of the DNA mismatch repair (MMR) genes are found. The entire coding sequence of MMR genes (MLH1, MLH2, MLH6, and PMS2) was analyzed using direct sequencing. Also, tumor tests were done as MSI and immunohistochemistry testing. We were able to find three novel MLH1 and one novel PMS2 germline mutations in three Iranian HNPCC patients. The first was a transversion mutation c.346A>C (T116P) and happened in the highly conserved HATPase-c region of MLH1 protein. The second was a transversion mutation c.736A>T (I246L), which caused an amino acid change of isoleucine to leucine. The third mutation (c.2145,6 delTG) was frameshift and resulted in an immature stop codon in five codons downstream. All of these three mutations were detected in the MLH1 gene. The other mutation was a transition mutation, c.676G>A (G207E), which has been found in exon six of the PMS2 gene and caused an amino acid change of glycine to glutamic acid. MSI assay revealed high instability in microsatellite for two patients and microsatellite stable for one patient. In all patients, an abnormal expression of the MMR proteins in HNPCC was related to the above novel mutations.